Patent application title:

Novel VEGF-like factor

Publication number:

US20050112665A1

Publication date:
Application number:

10/978,107

Filed date:

2004-10-29

Abstract:

A novel human gene having a significant homology with a VEGF-C gene, a member of the VEGF family, has been isolated by the PCR method using primers designed based on the sequence of EST that is assumed to be homologous with the C-terminal region of the VEGF-C gene. Mouse and rat genes have been isolated based on the human gene isolated as above. A protein encoded by the above human gene has been isolated by introducing the gene into Escherichia coli and expressing it. The isolated protein and genes can be applied to, for example, gene therapy for the VEGF-D deficiency, wound healing, and promotion of collateral vessel formation. Furthermore, VEGF-D protein inhibitors can be used as a novel anticancer drug, etc.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C07K14/52 »  CPC main

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans Cytokines; Lymphokines; Interferons

A61P7/00 »  CPC further

Drugs for disorders of the blood or the extracellular fluid

A61K38/00 »  CPC further

Medicinal preparations containing peptides

A61K48/00 »  CPC further

Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Description

TECHNICAL FIELD

The present invention relates to a protein factor involved in angiogenesis in humans and falls in the field of genetic engineering.

BACKGROUND ART

The process of angiogenesis, in which endothelial cells existing in the inner wall of blood vessels of animals generate new blood vessels, is triggered by transduction of a specific signal. A variety of substances are reportedly involved in this signal transduction. The most notable substance among them is the vascular endothelial growth factor (VEGF). VEGF is a protein factor which was isolated and purified, and can increase the proliferation of endothelial cells and the permeability of blood vessels (Senger, D. R. et al., Science 219: 983-985 (1983); Ferrara, N. and Henzel, W. J., Biochem. Biophys. Res. Commun. 161: 851-858 (1989)). It has been reported that the human VEGF gene contains eight exons and produces four subtypes consisting of 121, 165, 189, or 206 amino acid residues, depending on the difference in splicing, which causes different secretion patterns (Houck, K. A. et al., Mol. Endocrinol. 5:1806-1814 (1991)). It has also been reported that there is a VEGF-specific receptor, flt-1, and that the binding of VEGF to flt-1 is important for the signal transduction (Vries, C. D. et al., Science 255: 989-991 (1992)).

Placental growth factor (PlGF) and platelet-derived growth factor (PDGF) have thus far been isolated and are factors related to VEGF. These factors are found to promote proliferation activities of vascular endothelial cells (Maglione, D. et al., Proc. Natl. Acad. Sci. USA 88: 9267-9271 (1991); Betsholtz, C. et al., Nature 320: 695-699(1986)). In addition, VEGF-B (Olofsson, B. et al., Proc. Natl. Acad. Sci. USA 93: 2576-2581 (1996)) and VEGF-C (Lee, J. et al., Proc. Natl. Acad. Sci. USA 93: 1988-1992 (1996); Joukov, V. et al., EMBO J. 15, 290-299 (1996)) have recently been isolated.

These factors appear to constitute a family, and this may contain additional unknown factors.

It has been suggested that VEGF is involved in not only vascular formation at the developmental stage but also in the pathological neovascularization associated with diabetes, rheumatoid arthritis, retinopathy, and the growth of solid tumors. Furthermore, in addition to its vascular endothelial cell growth-promoting effects listed above, VEGF's ability to increase vascular permeability was suggested to be involved in the edema formation resulting from various causes. Also, these VEGF family factors may act on not only the blood vessels but also the blood cells and the lymphatic vessels. They may thus play a role in the differentiation and proliferation of blood cells and the formation of lymphatic vessels. Consequently, the VEGF family factors are presently drawing extraordinary attention for developing useful, novel drugs.

DISCLOSURE OF THE INVENTION

An objective of the present invention is to isolate a novel protein belonging to the VEGF family and a gene encoding the protein. We searched for genes having homology to VEGF-C, which is a recently cloned VEGF family gene, against Expressed Sequence Tags (EST) and Sequence Tagged Sites (STS) in the GenBank database. As a result, we found an EST that was assumed to have homology to the C-terminal portion of VEGF-C. We then designed primers based on the sequence, and amplified and isolated the corresponding cDNA using the 5′ RACE method and the 3′ RACE method. The nucleotide sequence of the isolated cDNA was determined, and the deduced amino acid sequence therefrom revealed that the amino acid sequence had significant homology to that of VEGF-C. Based on the homology, we have assumed that the isolated human clone is a fourth member of the VEGF family (hereinafter designated as VEGF-D). We have also succeeded in expressing the protein encoded by the isolated human VEGF-D gene in E. coli cells, and have also purified and isolated it. Furthermore, we have succeeded in isolating the mouse and rat VEGF-D genes using the isolated human VEGF-D gene.

In particular, the present invention relates to a novel protein belonging to the VEGF family and a gene encoding the protein. More specifically it relates to

    • (1) A protein shown by SEQ ID NO. 1 or having the amino acid sequence derived therefrom in which one or more amino acids are substituted, deleted, or added;
    • (2) A protein encoded by a DNA that hybridizes with the DNA shown by SEQ ID NO. 2;
    • (3) A DNA encoding the protein of (1);
    • (4) A DNA hybridizing with the DNA shown by SEQ ID NO. 2;
    • (5) A vector containing the DNA of (3) or (4);
    • (6) A transformant carrying the vector of (5);
    • (7) A method of producing the protein of (1) or (2), which comprises culturing the transformant of (6);
    • (8) An antibody binding to the protein of (1) or (2);
    • (9) A method of screening a compound binding to the protein of (1) or (2), which comprises a step of detecting the activity of the protein of (1) or (2) to bind to a test sample; and
    • (10) A compound binding to the protein of (1) or (2), wherein said compound has been isolated by the method of (9).

The protein of the present invention (VEGF-D) has significant homology to VEGF-C and can be considered to be a fourth factor of the VEGF family. Since the major function of VEGF is vascular formation at the developmental stage and VEGF is considered to be involved in the pathological neovascularization associated with diabetes, rheumatoid arthritis, retinopathy, and the growth of solid tumors, the protein of the present invention is thought to have similar functions.

A person skilled in the art could prepare functionally equivalent proteins through modifying VEGF-D of the present invention by adding, deleting, or substituting one or more of the amino acids of VEGF-D shown by SEQ ID NO. 1 using known methods. Modifications of the protein can also occur naturally in addition to the artificial modifications described above. These modified proteins are also included in the present invention. Known methods for adding, deleting, or substituting amino acids include the overlap extension polymerase chain reaction (OE-PCR) method (Gene, 1989, 77 (1): 51).

The DNA encoding VEGF-D of the present invention, shown by SEQ ID NO. 2, is useful for isolating DNAs encoding the proteins having similar functions to VEGF-D in other organisms. For example, a person skilled in the. art could routinely isolate homologs of human VEGF-D of the present invention from other organisms by allowing the DNA shown by SEQ ID NO. 2, or part thereof, as a probe, to hybridize with the DNA derived from other organisms. The DNA that hybridizes with the DNA shown by SEQ ID NO. 2 is also included in the present invention. The other organisms include mice, rats, and rabbits.

The DNA encoding a protein that is functionally equivalent to VEGF-D usually has high homology to the DNA shown by SEQ ID NO. 2. The high homology used herein means at least 70% or higher, more preferably 80% or higher, and still more preferably 90% or higher of sequence homology.

An example of the hybridization conditions for isolating the DNA having high homology will be given below. Prehybridization is performed in ExpressHyb Solution at 68° C. for 30 minutes. The probe labeled with a radioisotope is denatured at 95° C. to 100° C. for 2 to 5 minutes and rapidly chilled on ice. The probe is added to a new ExpressHyb Solution. The blot is transferred to the solution containing the probe and allowed to hybridize under a temperature gradient of 68° C. to 55° C. for 2 hours. The blot is washed four times, for 10 minute each, with a 2×SSC solution containing 0.05% SDS at room temperature. The blot is then washed with. a 0.1×SSC solution containing 0.1% SDS at 45° C. for 3 minutes. The blot is subjected to autoradioqraphy.

An example of the hybridization conditions for isolating the DNA having very high homology will be given below. Prehybridization is performed in ExpressHyb Solution at 68° C. for 30 minutes. The probe labeled with a radioisotope is denatured at 95° C. to 100° C. for 2 to 5 minutes and rapidly chilled on ice. The probe is added into a new ExpressHyb Solution. The blot is transferred into the solution containing the probe, and allowed to hybridize at 68° C. for 1 hour. The blot was washed four times, for 10 minute each, with a 2×SSC solution containing 0.05% SDS at room temperature. The blot was then washed with a 0.1×SSC solution containing 0.1% SDS at 50° C. for 40 minutes, during which the solution was replaced once. The blot was then subjected to autoradiography.

Note that the hybridization condition can vary depending on the length of the probe (whether it is an oligomer or a probe with more than several hundred bases), the labeling method (whether the probe is radioisotopically labeled or non-radioisotopically-labeled), and the type of the target gene to be cloned. A person skilled in the art would properly select the suitable hybridization conditions. In the present invention, it is especially desirable that the condition does not allow the probe to hybridize with the DNA encoding VEGF-C.

The DNA of the present invention is also used to produce VEGF-D of the present invention as a recombinant protein. Specifically, the recombinant protein can be produced in large quantity by incorporating the DNA encoding VEGF-D (for example, the DNA shown by SEQ ID NO. 2) into a suitable expression vector, introducing the resulting vector into a host, and culturing the transformant to allow the recombinant protein to be expressed.

The vector to be used for producing the recombinant protein is not particularly restricted. However, vectors such as pGEMEX-1 (Promega) or pEF-BOS (Nucleic Acids Res. 1990, 18(17): p.5322) are preferable. Suitable examples of the host into which the vector is introduced include E. coli cells, CHO cells, and COS cells.

The VEGF-D protein expressed by the transformant can be purified by suitably combining purification treatments such as solubilization with a homogenizer or a sonicator, extraction by various buffers, solubilization or precipitation by acid or alkali, extraction or precipitation with organic solvents, salting out by ammonium sulfate and other agents, dialysis, ultrafiltration using membrane filters, gel filtration, ion exchange chromatography, reversed-phase chromatography, counter-current distribution chromatography, high-performance liquid chromatography, isoelectric focusing, gel electrophoresis, or affinity chromatography in which antibodies or receptors are immobilized.

Once the recombinant protein is obtained, antibodies against it can be prepared using known methods. The known methods include preparing polyclonal antibodies by immunizing rabbits, sheep, or other animals with the purified protein, and preparing monoclonal antibodies from the antibody-producing cells of immunized mice or rats. These antibodies will make it possible to quantify VEGF. Although the antibodies thus obtained can be used as they are, it will be more effective to use the humanized antibodies to reduce the immunogenicity. The methods of humanizing the antibodies include the CDR graft method and the method of directly producing a human antibody. In the CDR Graft method, the antibody gene is cloned from the monoclonal antibody-producing cells and its antigenic determinant portion is transplanted into an existing human antibody. In the method of directly producing a human antibody, a mouse whose immune system has been replaced by the human immune system is immunized, similar to ordinary monoclonal antibodies. The VEGF-D protein or its antibody thus obtained can be administered into the body by subcutaneous injection or a similar method.

A person skilled in the art could screen compounds that bind to the protein of the present invention by known methods.

For example, such compounds can be obtained by making a cDNA library on a phage vector (such as λgtll and ZAP) from the cells expected to express the protein that binds to the protein of the present invention (such as lung, small intestine, and heart cells of mammals), expressing the cDNAs on LB-agarose, fixing the expressed proteins onto a filter, preparing the purified protein of the present invention as a biotin-labeled or a fusion protein with the GST protein, and reacting this protein with the above filter. The desired compounds could then be detected by west western blotting using streptavidin or an anti-GST antibody (Skolnik, E. Y., Margolis, B., Mohammadi, M., Lowenstein, E., Fischer, R., Drepps, A., Ullrich, A., and. Schlessinger, J. (1991) Cloning of P13 kinase-associated p85 utilizing a novel method for expression/cloning of target proteins for receptor tyrosine kinases, Cell 65: 83-90). Another method comprises the following steps. First, express the protein of the present invention fused with the SRF binding domain or the GAL4 binding domain in yeast cells. Second, prepare a cDNA library which expresses cDNAs fused with the transcription activation domain of VP16 or GAL4 from the cells expected to express a protein that binds to the protein of the present invention. Third, introduce the cDNA into the above yeast cells. Fourth, isolate the library-derived cDNA from the positive clones. Finally, introduce the isolated cDNA into E. coli to allow it: to be expressed. (When a protein that binds to the protein of the present invention is expressed in yeast cells, the reporter gene is activated and the positive clone can be detected.) This method can be performed using the two-hybrid system (MATCHMAKER Two-Hybrid System, Mammalian MATCHMAKER Two-Hybrid Assay Kit, or MATCHMAKER One-Hybrid System (all by Clontech) orthe HybriZAP Two-Hybrid Vector System (Stratagene) (Dalton, S. and Treisman, R. (1992) Characterization of SAP-1, a protein recruited by serum response factor to the c-fos serum response element, Cell 68: 597-612). Alternatively, the binding proteins can be screened by preparing a cDNA library from the cells expected to express a substance, such as a receptor, which binds to the protein of the present invention (for example, vascular endothelial cells, bone marrow cells, or lymph duct cells), introducing it into such cells as COS, detecting the binding of the protein of the present invention by itself or labeled with a radioisotope or a fluorescence, and cloning proteins that bind to the protein of the present invention (Yamasaki, K., Taga, T., Hirata, Y., Yawata, H., Kawanishi, Y., Seed, B., Taniguchi, T., Hirano, T., and Kishimoto, T. (1988) Cloning and expression of human interleukin-6 (BSF-2/IFN beta2) receptor, Science 241: 825-828, Fukunaga, R., Ishizaka-Ikeda, E., Seto, Y., and Nagata, S. (1990) Expression cloning of a receptor for murine granulocyte colony-stimulating factor, Cell 61: 341-350). Still another method comprises applying the culture supernatant or the cellular extract of the cells expected to express a protein that binds to the protein of the present invention onto an affinity column to which the protein of the present invention has been immobilized, and purifying the proteins specifically bound to the column. In addition, a DNA encoding the protein that binds to the protein of the present invention can be obtained by determining the amino acid sequence of the binding protein, synthesizing oligonucleotides based on the sequence, and screening a cDNA library with the oligonucleotides as probes.

Furthermore, compounds that bind to the protein of the present invention can be screened by contacting compounds, a natural substance bank, or a random phage peptide display library with the immobilized protein of the present invention and detecting the molecules bound to the protein. These compounds can also be screened by high throughput screening utilizing combinatorial chemistry technology (Wrighton, N. C., Farrell, F. X., Chang, R., Kashyap, A. K., Barbone, F. P., Mulcahy, L. S., Johnson, D. L., Barrett, R. W., Jolliffe, L. K., and Dower, W. J., Small peptides as potent mimetics of the protein hormone erythropoietin, Science (United States) Jul. 26 1996, 273: 458-464,Verdine, G. L., The combinatorial chemistry of nature, Nature (England) Nov. 7 1996, 384: 11-13, Hogan, J. C. Jr. Directed combinatorial chemistry, Nature (England) Nov. 7 1996, 384: 17-19).

VEGF-D of the present invention may be used for gene therapy by introducing the VEGF-D gene into the body of the patient with the VEGF-D deficiency, or expressing the gene in the body. An anti-sense DNA of the VEGF-D gene may also be used to inhibit the expression of the gene itself, thereby suppressing the pathological neovascularization.

Among the many available methods to introduce the VEGF-D gene or its antisense DNA into the body, the retrovirus method, the liposome method, the cationic liposome method, and the adenovirus method are preferable.

In order to express these genes in the body, the genes can be incorporated into a suitable vector and introduced into the body by the retrovirus method, the liposome method, the cationic liposome method, or the adenovirus method. Although the vectors to be used are not particularly limited, such vectors as pAdexlcw and pZIPneo are preferable.

The present invention may also be applied for diagnosing disorders caused by abnormalities of the VEGF-D gene, for example, by PCR to detect an abnormality of the nucleotide sequence of the VEGF-D gene.

Furthermore, according to the present invention, the VEGF-D protein or its agonists can be used to heal wounds, promote collateral vessel formation, and aid hematopoiesis by the hematopoietic stem cells, by taking advantage of the angiogenic effect of the VEGF-D protein. The antibodies against the VEGF-D protein or its antagonists can be used as the therapeutic agents for pathological neovascularization, lymphatic dysplasia, dyshematopoiesis, or edemas arising from various causes. The anti-VEGF-D antibodies can be used for diagnosing diseases resulting from abnormal production of VEGF-D by quantifying VEGF-D.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows the relationship among the VEGF-D gene, the EST sequences, and the primers used for cloning.

FIG. 2 compares the amino acid sequences of EST (H24828) and VEGF-C.

FIG. 3 compares the amino acid sequences deduced from the VEGF-D gene and from the known genes of the VEGF family proteins.

FIG. 4a shows the hydrophobicity plot of VEGF-D. FIG. 4b shows the prediction of the cleavage site of the VEGF-D signal peptide.

BEST MODE FOR IMPLEMENTING THE INVENTION

The following examples illustrate the present invention in detail, but are not to be construed to limit the scope of the invention.

EXAMPLE 1 Homology Search by TFASTA Method

The sequence CGPNKELDENTCQCVC (SEQ ID NO. 3) was designed based on the consensus sequence found in the BR3P (Balbiani ring 3 protein) repeat at the C-terminus of VEGF-C. The entire ESTs and STS sequences in the Genbank database (as of 29 Feb. 1996) were then searched by the TFASTA method (Person and Lipman, Proc. Natl. Acad. Sci. USA 85:2444-2448(1988)). The searching conditions used are shown below (Table 1).

TABLE 1
Sequences 392,210
Symbols 135,585,305
Word Size 2
Gap creation penalty 12.0
Gap extension penalty 4.0

As a result, an EST (Accession No. H24828) that is considered to code the consensus sequence was found. The sequence is one of the ESTs registered by The WashU-Merck EST Project, and nine out of 16 amino acid residues were identical. Further searching for UniGene by NCBI based on this sequence revealed that five registered sequences (T64149, H24780, H24633, H24828, and T64277 (as of 1 Mar. 1996)), including the above EST, were considered to be derived from the same gene. T64277 and T64149, as well as H24828 and H24780, are the combination of the 5′ sequence and the 3′ sequence of the same clones, and the length of the insert in both of these clones was 0.9 kb (FIG. 1).

Translating the H24828 sequence into a protein sequence in a frame where homology is found suggested that this sequence codes 104 C-terminal amino acid residues. Comparing this amino acid sequence with the C-terminus of VEGF-C, 28 out of 104 amino acids (27%) were identical. Moreover, the amino acids that are important for maintaining the protein structure, such as cysteine and proline, were well conserved (FIG. 2). Conserved sequences are shown in a black box.

EXAMPLE 2 cDNA Cloning from a Library

Primers for 5′ RACE and 3′ RACE (5′ RACE primer: 5′-AGGGATGGGGAACTTGGAACGCTGAAT-3′ (SEQ ID NO. 4), 3′ RACE primer: 5′ -GATCTAATCCAGCACCCCAAAAACTGC-3′ (SEQ ID NO.5)) were designed (FIG. 1). A double-stranded cDNA was synthesized from human lung-derived polyA+ RNA using reverse transcriptase. PCR was then performed using Marathon-Ready cDNA, Lung (Chlontech), having an adapter cDNA ligated to both ends as a template cDNA, and using the above primer and adapter primer (AP-1 primer) as primers. The above adapter cDNA contains the regions to which the adapter primers AP-1 and AP-2 hybridize. The PCR was performed in a manner such that the system was exposed to treatment at 94° C. for 1 min; five cycles of treatment at 94° C. for 30 sec and at 72° C. for 4 min; five cycles of treatment at 94° C. for 30 sec and at 70° C. for 4 min; then 25 cycles of treatment at 94° C. for 20 sec and at 68° C. for 4 min. (TaKaRa Ex Taq (Takara Shuzo) and the attached buffer were used as Taq polymerase instead of Advantage KlenTaq Polymerase Mix.) As a result, 1.5 kb fragments were amplified at the 5′ region and 0.9 kb fragments at the 3′ region. These fragments were cloned with the pCR-Direct Cloning System (Clontech), CR-TRAP Cloning System (GenHunter), and PT7Blue-T vector (Novagen). When the 5′-RACE fragment was cloned into the pCR-Direct vector, the fragment was amplified again using 5′-CTGGTTCGGCCCAGAACTTGGAACGCTGAATCA-3′ (SEQ No. 7) and 5′-CTCGCTCGCCCACTAATACGACTCACTATAGG-3′ (SEQ ID NO. 8) as primers.

EXAMPLE 3 Nucleotide Sequence Analysis

ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit with Amplitaq DNA Polymerase FS and 377 A DNA Sequencer (ABI) were used for DNA sequencing. The primers used are the primers in the vectors (5′-AATTAACCCTCACTAAAGGG-3′ (SEQ ID NO. 9), 5′-CCAGGGTTTTCCCAGTCACGAC-3′ (SEQ ID NO. 10)), AP-2 primer (5′-ACTCACTATAGGGCTCGAGCGGC-3′ (SEQ ID NO. 11)), and 10 primers in the sequence shown below (Table 2).

TABLE 2
SQ1 5′-AAGTCTGGAGACCTGCT-3 (SEQ ID NO. 12)
SQ2 5′-CAGCAGGTCTCCAGACT-3′ (SEQ ID NO. 13)
SQ3 5′-CGCACCCAAGGAATGGA-3′ (SEQ ID NO. 14)
SQ4 5′-TGACACCTGGCCATTCCA-3′ (SEQ ID NO. 15)
SQ5 5′-CATCAGATGGTAGTTCAT-3′ (SEQ ID NO. 16)
SQ6 5′-ATGCTGAGCGAGAGTCCATA-3′ (SEQ ID NO. 17)
SQ7 5′-CACTAGGTTTGCGGCAACTT-3′ (SEQ ID NO. 18)
SQ8 5′-GCTGTTGGCAAGCACTTACA-3′ (SEQ ID NO. 19)
SQ9 5′-GATCCATCCAGATCCCTGAA-3′ (SEQ ID NO. 20)
SQ10 5′-CAGATCAGGGCTGCTTCTA-3′ (SEQ ID NO. 21)

Determining the nucleotide sequence of the 1.5 kb fragment at the 5′-side and the 0.9 kb fragment at the 3′-side revealed that the sequence of the overlapping region was identical, confirming that 5′- and 3′-side cDNAs of the desired gene were obtained. Determining the entire nucleotide sequence of the cDNA revealed that this novel gene has the full length of 2 kb and can code a protein consisting of 354 amino acid residues (SEQ ID NO. 1 and SEQ ID NO. 2). FIG. 1 shows the relation between this gene and the EST sequences registered in the Genbank database. Comparing the amino acid sequence with other VEGF family proteins revealed that the amino acids that are well conserved between family proteins are also conserved in this novel gene, and therefore this gene is obviously a new member of the VEGF family (FIG. 3). In FIG. 3, HSVEGF indicates human VEGF; HSVEGF-D, HSVEGF-C, and HSVEGF-B indicate human VEGF homologues (human VEGF-D, human VEGF-C, and human VEGF-B, respectively); HSPDGF-A indicates human PDGF-A; HSPDGF-B indicates human PDGF-B; and HSP1GF2 indicates human PlGF2. The conserved sequences are shown in a black box. Since VEGF-D is highly homologous to VEGF-C that was cloned as the Flt4 ligand, it was presumed to be a ligand to a Flt-4-like receptor.

Deducing the signal peptide cleavage site (FIG. 4b) by hydrophobicity plot (FIG. 4a) and the method of von Heijne (von Heijne, G, Nucleic Acids Res. 14, 4683-4690(1986)), N-terminal 21 amino acid residues may be cleaved as signal peptides, and they may also undergo additional processing like VEGF-C.

EXAMPLE 4 Northern Blot Analysis

A 1 kb fragment, which had been cut out by digestion with EcoRI from the 5′-fragment subcloned into pCR-Direct vector, was labeled with [α-32P]dCTP and used as a probe. Labeling was performed by random priming using Ready-to Go DNA labeling beads (Pharmacia). Hybridization was performed in ExpressHyb Hybridization Solution (Clontech) by the usual method using Multiple Tissue Northern (MTN) Blot-Human, Human II, Human Fetal, and Human Cell lines (Clontech). Significant expression was observed in lung, heart, and intestine. Weak expression was observed in skeletal muscle, ovary, colon, and pancreas. The apparent molecular weight of the mRNA was 2.2 kb, and the cloned fragment seemed to be almost the full length of the gene.

EXAMPLE 5 VEGF-D Protein Expression in E. coli

Two primers, 5′-TCCAGATCTTTTGCGGCAACTTTCTATGACAT-3′ (SEQ ID NO. 22) and 5 ′-CAGGTCGACTCAAACAGGCACTAATTCAGGTAC-3′ (SEQ ID NO. 23), were synthesized to amplify the region corresponding to the 89th to 181st amino acid residues of human VEGF cDNA. The thus-obtained DNA fragment was digested with restriction enzymes BglII and SalI, and ligated using ligation kit II (Takara Shuzo Co., Ltd) to plasmid pQE42 (QIAGEN), which had been digested with restriction enzymes BamHI and SalI. The resulting plasmid was introduced into E. coli SG19003[pREP4] (QIAGEN), and a plasmid, which was obtained as designed without any mutation, was selected (pQE42-BS3). Plasmid pQE42-BS3 was introduced into E. coli BL21 (Invitorogen) and cultured in 10 ml of L Broth containing 100 mg/l bicucilline (ampicillin sodium for injection, Meiji Seika Kaisha, Ltd.). 200 ml of fresh L Broth was then inoculated with the culture. After incubation at 37° C. for 1.5 hours, IPTG was added to 3 mM, and the culture was further incubated at 37° C. for 5 hours. After cells were harvested, a protein was purified with a Ni-NTA column following the protocol of QIAexpress TypeII kit.

EXAMPLE 6 Expression of DHFR-VEGF-D Fusion Protein in E. coli

The region corresponding to the 89th to 181st amino acid residues of human VEGF cDNA was amplified with the same primers used in Example 5. The thus-obtained DNA fragment was digested with restriction enzymes BglI and SalI. The fragment was then ligated using ligation kit II (Takara Shuzo Co., Ltd.) to the plasmid pQE40 (QIAGEN), which had been digested with restriction enzymes BamHI and SalI. The resulting plasmid was introduced into E. coli SG19003[pREP4] (QIAGEN), and a plasmid, which was obtained as designed without any mutation, was selected (pQE40-BS3). Plasmid pQE40-BS3 was introduced into E. coli BL21 (Invitrogen) and cultured in 10 ml of L Broth containing 100 mg/l bicucilline (ampicillin sodium for injection, Meiji Seika Kaisha, Ltd.). 200 ml of fresh L Broth was then inoculated with the culture. After incubation at 37° C. for 1.5 hours, IPTG was added to 3mM, and the culture was further incubated at 37° C. for 5 hours. After cells were harvested, a DHFR-VEGF-D fusion protein was purified with a Ni-NTA column following the protocol of a QIAexpress TypeII kit.

EXAMPLE 7 Cloning Mouse VEGF-D cDNA

Two Hybond-N+ (Amersham) filters (20 cm×22 cm) on which 1.5×105 pfu of Mouse lung 5′-stretch cDNA library was transferred were prepared. Gradient hybridization from 68° C. to 55° C. was performed for 2 hours in ExpressHyb Hybridization Solution (Clontech) using as a probe an approximately 50 ng Pvu II fragment of human VEGF-D, which had been labeled with α32P-dCTP (Amersham) using Ready-To-Go DNA Labeling Beads(-dCTP) (Pharmacia). The filters were washed four times in 2×SSC, 0.05% SDS at room temperature for 10 min, then washed in 0.1×SSC, 0.1% SDS at 45° C. for 3 min. The washed filters were exposed overnight at −80° C. using HyperFilm MP (Amersham) and intensifying paper. Positive clones were subjected to the second screening in the same manner as above to isolate a single clone. Isolated lambda DNAs were purified from the plate lysate using a QIAGEN Lambda MAX I Kit (Qiagen). Insert DNAs were cut out with EcoRI and subcloned into pUC118 EcoRI/BAP (Takara Shuzo Co., Ltd.). Its nucleotide sequence was then determined with ABI377 sequencer (Perkin Elmer). The cDNA coding the full length of mouse VRGF-D was reconstructed with two of the obtained clones that overlapped each other. SEQ ID NO. 24 shows the nucleotide sequence of mouse VEGF-D cDNA and the deduced amino acid sequence therefrom.

EXAMPLE 8 Cloning Rat VEGF-D cDNA

Two Hybond-N+ (Amersham) filters (20 cm×22 cm), on which 1.5×105 pfu of Rat lung 5′-stretch cDNA library had been transferred, were prepared. Gradient hybridization from 68° C. to 55° C. was performed for 2 hours in ExpressH.Fyb Hybridization Solution (Clontech) using as a probe an approximately 1 μg fragment containing 1-782 bp of the mouse VEGF-D cDNA which had been labeled with α32P-dCTP (Amersham) using Ready-To-Go DNA Labeling Beads(-dCTP) (Pharmacia). The filters were washed four times in 2×SSC, 0.05% SDS at room temperature for 10 min, then washed in 0.1×SSC, 0.1% SDS at 45° C. for 3 min. The washed filters were exposed overnight at −80° C. using HyperFilm MP (Amersham) and intensifying paper. Positive clones were subjected to the second screening in the same manner as above to isolate a single clone. The isolated positive clone was excised into pBluescript using E. coli SOLAR (Stratagene) and helper phage ExAssist (Stratagene.), then the sequence was determined with. ABI377 sequencer (Perkin Elmer). The sequence seemed to be the rat VEGF-D cDNA but did not contain the termination codon.

To obtain the C-terminal cDNA which had not been obtained, PCR was performed using Marathon-Ready rat kidney cDNA (Clontech) as a template and 5′ primerGCTGCGAGTGTGTCTGTAAA (SEQ ID NO. 26) and 3′ primer GGGTAGTGGGCAACAGTGACAGCAA (SEQ ID NO. 27) with 40 cycles of 94° C. for 15 sec, 55° C. for 30 sec, and 72 ° C. for 2 min. After the thus-obtained fragment was subcloned into pGEM-T vector (promega), the nucleotide sequence was determined with ABI377 sequencer (Perkin Elmer). The resulting clone contained the C-terminus of rat VEGF-D. Based on the results of sequencing the clone obtained by plaque hybridization and the clone obtained by PCR, the full length of the rat VEGF-D sequence was determined. SEQ ID NO. 25 . shows the determined nucleotide sequence and the deduced amino acid sequence therefrom.

Industrial Applicability

In the present invention, a novel protein (VEGF-D) having significant homology to VEGF-C and its gene have been isolated. VEGF-D appears to be involved in the pathological neovascularization associated with diabetes, rheumatoid arthritis, the growth of solid tumors, differentiation and proliferation of blood cells, formation of lymphatic vessels, and formation of edema resulting from various causes as well as the normal neovascularization at the developmental stage. The gene of the present invention can be used to diagnos disorders caused by abnormalities of the VEGF-D gene and gene therapy for the VEGF-D deficiency. The VEGF-D protein, which is obtained by expressing the gene of the present invention, can be used for healing wounds, promoting collateral vessel formation, and aiding hematopoietic stem cell proliferation. The antibodies or inhibitors against the VEGF-D protein can be used for treating angiodysplasia and lymphangiodysplasia associated with inflammation, edemas arising from various causes, dyshematopoiesis, and, as a novel anticancer agent, for treating pathological neovascularization. The VEGF-D protein and its antibodies can be useful for diagnosing diseases resulting from abnormal production of VEGF-D.

Claims

1. canceled.

2. canceled.

3. A DNA encoding a protein shown by SEQ ID NO: 1 or having the amino acid sequence derived therefrom in which one or more amino acids are substituted, deleted, or added.

4. A DNA hybridizing with the DNA shown by SEQ ID NO: 2.

5. A vector containing the DNA of claim 3 or 4.

6. A transformant carrying the vector of claim 5.

7. A method of producing a protein shown by SEQ ID NO: 1 or having the amino acid sequence derived therefrom in which one or more amino acids are substituted, deleted, or added or a protein encoded by a DNA hybridizing with the DNA shown by SEQ ID NO:2, wherein said method comprises culturing the transformant of claim 6.

8. canceled.

9. canceled.

10. canceled.

Resources

Images & Drawings included:

Sources:

Recent applications in this class:

Recent applications for this Assignee: