US20050186624A1
2005-08-25
11/100,436
2005-04-07
The present invention relates to a method of detection in vitro of a target substance in a sample. The sample can comprise, among other things, a nucleic sequence or more generally any type of substance. In particular, the present invention provides a method of detection comprising (i) specifically labeling a substance with a reporter gene and any sequences necessary for the in vitro expression of the reporter gene; (ii) in vitro transcription and translation of the reporter gene; and (iii) in vitro detection of a reporter protein coded by the reporter gene.
Get notified when new applications in this technology area are published.
C12Q2531/113 » CPC further
Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid PCR
C12Q1/6897 » CPC main
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
C12Q2531/125 » CPC further
Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid Rolling circle
C12Q2525/301 » CPC further
Reactions involving modified oligonucleotides, nucleic acids, or nucleotides; Oligonucleotides characterised by their secondary structure Hairpin oligonucleotides
The present invention relates to a method of detection in vitro of a target substance, notably a nucleic sequence but more generally any type of substance, in a sample. The search for target substances, notably for nucleic acid sequences, represents a primary goal in numerous research laboratories implicated in numerous fields of activity, and principally in the medical or agribusiness fields. In these fields, the search for target sequences is directed for example to:
The major difficulty of the diagnosis methods used in the prior art resides in the specificity, the sensitivity, the speed and the reproducibility of the detection test used. These difficulties generally come from the nature of the labeling used. In effect, the nature of the labeling of a substance is the decisive factor in any subsequent detection permitting the following or the quantifying of said substance. Regardless of whether it concerns a human, animal diagnosis, or a vegetable, in agribusiness, therapy, pharmacology, research, in varied industrial processes etc., it is necessary to detect, follow and specifically qualify one or several target substances. In order for this detection to be optimal, it is necessary to set up high performance and sensitive labeling techniques.
One of the specific techniques for labeling nucleic acids uses PCR amplification. The labeling of primers which can be used in PCR can be carried out in two ways, either by labeling of the primers, preferably at their 5′ ends or by internal marking of the amplified fragment.
The first type of labeling has the disadvantage of having a low specific activity and consequently, limits the sensitivity of the later revelation. It is possible to fix a radioactive phosphate (32P) at the 5′end of the primers. There will be one (32P) per primer. If biotin or a fluorochrome is fixed, it is possible to have at the most 3 to 4 labels per primer molecule.
If the radioactive nucleotides are incorporated in the amplicon, the specific activity is certainly more important, but it is necessary to manipulate more radioactivity. The current tendency is to replace the isotopic labeling methods with cold labeling (fluorophore, digoxigenine, biotin).
The fluorophores are sensitive to environmental changes: variations in the experimental conditions (pH, presence of oxidizing elements, etc. . . .) can displace the emission wavelength. In addition, the phenomena of fluorescence extinction (or quenching) have largely been described. The incorporation of nucleotides labeled with a fluorophore or with digoxigenine or with biotin by polymerases is of low effectiveness because these nucleotides have a strong steric hindrance that disturbs the PCR polymerization reaction.
The radioactive labeling of proteins can be carried out by using amino acids labeled with an isotope, which implicates the manipulation of radioactivity. The labeling of proteins by an antigen/antibody reaction may for its part not be sensitive enough.
The object of the present invention is precisely to offer a sensitive method of detection of target substances not giving rise to the disadvantages hereinabove.
This goal is achieved thanks to a method of detection of a target substance in a sample, characterized in that it comprises the following steps:
The method of the invention is therefore based on a labeling consisting of combining with the target substance a DNA molecule constituting a reporter gene that can be expressed in vitro. The labeling therefore consists of combining with the target substance, a reporter gene placed under the control of sequences necessary for its expression.
The in vitro transcription promoters which can be used within the scope of the invention can notably correspond to the promoters of the phages T7, SP6, Qβ or λ.
At step (b), the protein encoded by the reporter gene is obtained in a way so as to specifically reveal the target substance.
The revelation of the labeling which is the object of the process of the invention is sensitive because it makes use of amplification steps during steps of transcription (step b), of translation (step b) and of detection (step c). This amplification can correspond for example to a factor of 500 for the transcription (Pokrovkaya and Gurevich, Analytical Biochemistry 220, 420-423 (1994).
The method of the invention is also specific in the test of detection of the protein at step (c).
Moreover the method of the invention can go through, after the transcription step, a step of amplification of the transcripts by all techniques known to a person skilled in the art such as 3 SR, NASBA (nucleic Acid Sequence-based amplification), TMA (Transcription Mediated Amplification).
In the case where the target substance corresponds to a nucleic acid molecule, the amplification of the signal of revelation can begin during step (a) of the method of the invention. A set of primers or of particular probes is used so as to specifically amplify a sequence and to combine in the presence of a specific oligonucleotide sequence a reporter gene that can be expressed in vitro. The reporter gene is expressed only if the target gene is present and amplified. As indicated above, amplification of the reporter gene or of the target gene is understood as PCR type reactions (polymerase chain reaction), NASBA (nucleic acid sequence-based amplification), SDA (strand displacement amplification), bDNA (branched DNA signal amplification), rolling circle, techniques derived from PCR (nested PCR, multiplex PCR).
The method of the invention moreover is fast and reproducible, because all of the reactions are carried out in vitro, which permits standardization of the detection. The method of the invention permits carrying out qualitative and quantitative detections.
The method of the invention is notable in that it can be applied to any type of substance. However, the invention is more particularly applied to chemical or biological substances, such as antibodies, fragments of antibodies, nucleotide fragments, genes, cellular receptors, peptides, proteins, amino acids, glycopeptides, lipids, glycolipids, sugars, polysaccharides, etc. In a particular application, the target substance can be the reporter gene itself.
Labeled target substance is understood as any substance directly or indirectly associated with a reporter gene that can be expressed in vitro.
The reporter gene is a gene that can be transcribed and translated in vitro in the presence of sequences that regulate its expression. The protein that the reporter gene codes for can be detected at step (c) by any technique known to a person skilled in the art. By way of example, the reporter gene can be the gene of the GFP (Green Fluorescent Protein) or that of the beta-lactamase (TEM-1). In the case of the GFP, it is the fluorescent emission that is measured. In the case of the beta-lactamase, it is the activity of this enzyme that is measured by incubating a fraction of the translation reaction in a buffer containing nitrocephine. Nitrocephine is a chromogenic beta-lactamine that has the property of changing color from yellow to red when it is hydrolyzed by a beta-lactamase. Any other reporter gene can be contemplated in the process of the invention, such as beta-galactosidase, beta-glucuronidase, luciferase, peroxidase or a microperoxidase, etc.
The reporter gene advantageously encodes for an enzyme. The specificity of the labeling of the target substance at step (a) of the method of the invention can be carried out by any direct or indirect method known to a person skilled in the art.
For the direct method, it is understood that the target substance is directly combined with the gene and with the elements necessary for the expression of said reporter gene in vitro. It relates for example to the case described hereinafter of a recombinant nucleic acid molecule where the target substance is a nucleic sequence included in said recombinant nucleic acid molecule equally including the reporter gene and the sequences necessary for its in vitro expression.
For the indirect method, it is understood that the target substance is combined with a reporter gene and with the sequences necessary for its expression in vitro, by the intermediary of a specific ligand of the target substance. This ligand is combined with the reporter gene and with the elements necessary for its expression in vitro. It is therefore the contacting of this ligand with the target substance which permits the carrying out of the specific labeling of the target substance. It relates for example to an antibody labeled by the reporter gene and the sequences necessary for its expression in vitro, which is capable of specifically recognizing a target substance composed of an antigen. A target/ligand couple substance is understood as for example: an antigen/antibody, a nucleic sequence/a nucleic sequence, a probe, a receptor/a receptor ligand, etc.
In the indirect embodiment, the method of the invention consists at step (a) of contacting the sample liable to contain the target substance with a ligand specific for this target substance, said ligand being labeled by a reporter gene and by the sequences necessary for the expression of said reporter gene in vitro. The remainder of the method includes as previously the steps (b) and (c).
The labeling of the specific ligand of the target substance can be as previously a direct or indirect labeling.
According to the indirect method of the invention, the combination of the reporter gene and a target sequence corresponding to a protein allows several embodiments. In effect, the bonding of a nucleic acid molecule composed of a reporter gene and of the sequences necessary for its expression in vitro, on a protein can be carried out by techniques known to a person skilled in the art making use of bonding compounds such as:
The method of the invention per direct marking finds several shapes of implementation which will be presented hereafter.
The sample on which is carried out the method of the invention perhaps any taking away human, animal, vegetable, environmental, or any likely matter to be marked by a gene reporter having any information for his in vitro expression.
A preferred form of implementation of the process of the invention relates to nucleic detection of a sequence targets, advantageously by the direct method.
Description hereafter thus relates to a method of in vitro detection of a nucleic sequence in a sample. This method includes/understands the following stages:
Various particular forms of setting in work of specific detection of a substance targets correspondent with a nucleic sequence of acid by direct marking are quoted hereafter.
The method of the invention is adapted to detection of target sequences being able to correspond to a gene, a fraction of gene or with all other nucleic acid fragment.
The method of the invention offers the advantage of being able to specifically detect a target sequence in a sample to be analyzed and to later work directly on this target sequence.
The method of the invention is also notable in that it is quite particularly adapted to the detection of target nucleic acid sequences coding for a peptide or a protein not having identifiable activity in vitro.
According to a first preferred aspect of carrying out the method of the invention the preparation of the nucleic acid molecule of step (a) is carried out by in vitro amplification of the target nucleic acid sequence.
It relates to an amplification by PCR or by techniques derived from PCR of the RT-PCR, nested PCR, multiplex PCR type or techniques different from PCR: NASBA (nucleic acid sequence-based amplification) or rolling circle or others.
In an aspect of carrying out the method of the invention, hereinafter designated “universal,” the first step (a) of the method is based on the carrying out of an amplification reaction of the target sequence, if it is understood that it is present in the analyzed sample, with the aid of two primers designated sense and anti-sense as defined below:
The invention therefore also relates to a set of primers capable of being used at step (a) of a method according to the invention characterized in that it comprises:
In a first specific embodiment of the universal method of the invention, step (a) includes the three following reactions (FIG. 1a):
In this embodiment, the PCR reaction mixture contains the sample DNA, two sense and anti-sense primers, the reporter sequence, and a third primer homologous to a region downstream of the reporter gene. The first amplification of step (a′) and the second amplification of step (a′″) can be carried out simultaneously or not.
As shown in FIG. 1a attached, the first cycles of the PCR1 reaction permit the amplification of the target sequence. Once this sequence is present in a sufficient quantity in the reaction medium, it serves as a mega-primer and comes to be hybridized to the reporter sequence, which is thus amplified thanks to the third primer.
In a second embodiment of the universal method of the invention, step (a) includes the two following reactions (FIG. 1b):
In this embodiment, the anti-sense primer possess a 5′ region homologous to the beginning of the reporter sequence, which possess, as previously, all the information for its own translation. As indicated at FIG. 1b attached, the PCR reaction mixture contains the sample DNA, two sense and anti-sense primers and a mega-primer corresponding to the reporter sequence. The anti-sense primer is present in a less amount than the sense primer. The first cycles of the PCR1 reaction permit the amplification of the target sequence. Once this sequence is present in sufficient quantity in the reaction mixture, it is amplified (PCR2) with the aid of the PCR1 sense primer and the mega-primer.
In a third embodiment of the universal method of the invention (FIG. 1c), step (a) includes the amplification reaction of the target sequence with a pair of primers wherein the sense primer possesses an RNA polymerase promoter and the anti-sense primer possesses a 5′ region including a sequence coding for a ribosome binding site, a reporter gene and optionally a transcription terminator.
In this embodiment represented in FIG. 1c attached, the anti-sense primer possesses a 3′ region specific to the target sequence and a 5′ region corresponding to a sequence coding for a ribosome binding site, a reporter gene and optionally a transcription terminator. The PCR reaction mixture contains the sample DNA, two sense and anti-sense primers.
The invention equally relates to a labeling mixture for amplification for the carrying out of the embodiments described above. Such a mixture includes, the reactants necessary for carrying out the amplification cycles, and therefore more particularly, the four deoxynucleotide triphosphates, the salts and the reactants that assure the optimal DNA polymerase activity, as well as the different types of primers described above.
A labeling mixture for amplification more particularly adapted for the carrying out of step (a) of the first embodiment of the universal method according to the invention includes:
A labeling mixture for amplification more particularly adapted to the carrying out of step (a) of the third embodiment of the universal method according to the invention comprises a pair of primers wherein the sense primer possesses an RNA polymerase promoter and the anti-sense primer possesses a 5′ region comprising a sequence coding for a ribosome binding site, a reporter gene and optionally a transcription terminator.
The invention therefore equally has for an object a kit for the detection of a nucleic acid target sequence in a sample in accordance with the universal method previously described.
A kit for the detection of a nucleic acid target sequence in a sample according to the invention includes a set of primers defined above, a mixture necessary for the amplification, the triphosphate nucleotides, a DNA dependent RNA polymerase, a DNA dependent DNA polymerase, a cellular translation extract, the mixtures necessary for transcription, translation and optionally revelation of the reporter molecule, and optionally one or several substances permitting revelation of the activity of the reporter molecule.
A particular example of a kit according to the invention further comprises, one of the amplification mixtures above, a DNA dependent DNA polymerase, the triphosphate nucleotides and the triphosphate deoxynucleotides, a DNA dependent RNA polymerase, a cellular translation extract, the mixtures necessary for amplification, transcription and translation and optionally one or several substances permitting revelation of the activity of the reporter molecule.
The method of the invention, at the level of step (a), can equally be used based on the properties of the probes called “Padlock (1, 2, 3, 4, WO 97/19193). This embodiment is more particularly adapted to the detection of target sequences possessing a point mutation.
The detection of target sequences using the “Padlock” probes therefore constitutes an alternative to the previously described embodiments of the so-called universal method of the invention.
The invention therefore equally relates to a method for in vitro detection of a target nucleic acid sequence in a sample characterized in that the preparation of the nucleic acid molecule of step (a) is carried out by hybridization and ligation of a Padlock probe with the target sequence if it is present in the sample.
Said probe is composed at its 3′ and 5′ ends of segments separated by the complementary sequence of a reporter gene which possesses the complementary sequences of a promoter and possibly of an RNA polymerase terminator for its transcription, and the complementary sequence of a ribosome binding site for its in vitro translation, the sequences of said 3′ and 5′ segments of the Padlock probe being complementary of the sought-after target sequence in a manner so as to form with it a joined hybrid, and the 5′ end of the probe possessing a phosphate group so as to permit the circularization of the probe under the action of a ligase. There will preferably be used a nick-sealing ligase. In this way, in the absence of target sequence, the probe cannot be circularized.
Said probe can likewise be composed at its 5′ and 3′ ends of segments separated from 5′ to 3′ by the sequence of an RNA polymerase promoter, a ribosome binding site and the sequence of a reporter gene optionally with an RNA polymerase terminator.
The segments 3′ and 5′ of the Padlock probe are therefore defined by their being hybridized in a complementary and joined manner to a target sequence.
The invention thus relates to also a likely Padlock probe to be used in a method characterized above in that segments 3′ and 5′ of the aforementioned Padlock probe are defined for hybridization in a complementary and jointed way on a target sequence.
As previously indicated, the method of the invention based on the use of a padlock probe can advantageously be used for the in vitro detection of a target nucleic acid sequence, having a mutation. In this case, the preparation of the nucleic acid molecule of step (a) is carried out by hybridization of a Padlock type probe with the target sequence if it is present, said probe corresponding to one of the two probes previously described with the following in particular: the sequences of said segments 3′ and 5′ of the Padlock probe are complementary to the sought-after target sequence in a matter so as to form with it a hybrid where the critical nucleotide liable to be mutated, is found at their junction when they are hybridized to the target sequence.
Thus, when the method of the invention is applied to the demonstration of the presence of a mutation at the level of a target sequence, as shown in FIG. 2b, the segments 3′ and 5′ of the “Padlock” probe are defined in such a manner that the critical nucleotide, liable to be mutated, is found at their junction when they are hybridized to the target sequence. In case of mispairing, the ligase will not be able to bond the two ends and the circularization of the probe will not be able to occur.
The invention therefore also relates to a Padlock probe capable of being used in the above method, characterized in that the sequences of said segments 3′ and 5′ of the Padlock probe are complementary to a target sequence having a nucleotide capable of being mutated in a manner so as to form with it a hybrid where said nucleotide is found at their junction when they are hybridized to the target sequence.
Advantageously, in the method of the invention based on the use of a padlock probe, after circularization, the probe is used as a matrix for its replication by a rolling circle. The replication by a rolling circle is carried out with the aid of a primer complementary to the padlock probe in order to initiate the replication by DNA polymerase, in such a way as to produce a DNA matrix possessing a linking of reporter genes with all the signals necessary for its in vitro expression (that is from 5′ to 3′, a repetition of the following element RNA polymerase promoter, ribosome binding site, reporter gene and optionally RNA polymerase terminator), or the complement of that sequence according to the probe chosen then the complementary strand of that DNA matrix is synthesized starting from a second oligonucleotide primer in such a way to make this matrix double stranded.
This preparation step increases the sensitivity of the detection thanks to numerous copies of the reporter gene produced starting from a single target molecule
A particularly preferred embodiment of the method of the invention based on the padlock probes consists of carrying out directly at step (b) the transcription of the reporter gene on the Padlock probe after its circularization and the synthesis of the complementary strand with the aid of a primer complementary to the padlock probe complementary to the target.
This embodiment includes the preparation at step (a) of a padlock probe corresponding to those previously described permitting either the detection of a nucleic acid sequence or the detection of a mutation on a nucleic acid sequence. This padlock probe is created in such a fashion that the direct transcription of the reporter gene by RNA polymerase can only take place if the padlock probe was previously circularized following its hybridization on the target nucleotide sequence. In this case, there is not any rolling circle amplification, but only the synthesis of the complementary strand of the padlock probe with the aid of a primer complementary to the padlock probe complementary to the target, and optionally ligation then direct transcription of the reporter gene of the padlock probe by RNA polymerase.
The invention relates as well to kits for the implementation of the method of the invention using a padlock probe.
Such a kit is characterized in that it includes a probe as described previously, a DNA dependent DNA polymerase, a nick-sealing ligase, the triphosphate nucleotides and the triphosphate deoxynucleotides, a primer for initiating the replication, a primer permitting the synthesis of the second strand of DNA, a DNA dependent RNA polymerase, the mixtures necessary for the ligation, replication, transcription, translation and the revelation of the reporter molecule.
A first example of a kit according to the invention more particularly includes:
A second example of a kit according to the invention more particularly comprises:
A third type of kit for the particularly preferred embodiment of the above method of the invention using a padlock probe comprises:
The method of the invention can equally be implemented in the scope of an isothermic amplification also designated CIA for “Continuous Isothermic Amplification” of the type described in international patent application PCT No. WO96/01327.
In this method of carrying out the method of the invention, the sought-after target nucleic acid sequence is isolated from a nucleic acid sample at step (a) by specific isothermic amplification with the aid of a DNA dependent DNA polymerase and of two specific primers of the target sequence, wherein at least one is composed of a 3′ part which can be specifically hybridized to the target sequence and of a 5′ part composed of at least one inverted repeated sequence in order to form at a suitable temperature a structure called a “hairpin.” The fusion temperature of the double-stranded hairpin structure is preferably less than or equal to the fusion temperature of the part of the primer specifically hybridizing with the target sequence. The difference between the two fusion temperatures is for example about 10° C. Moreover, one of the primers carries the sequence of a DNA dependent RNA polymerase transcription promoter, such as the RNA polymerase promoter of the phage T7 and the other primer carries a reporter gene possessing at its 5′ end a ribosome-binding site.
In this embodiment of the invention, a gene coding for a microperoxidase can be cited more particularly as a reporter gene.
According to an advantageous embodiment, the two primers possess an inverted repeated sequence in order to form at a suitable temperature a hairpin structure. The inverted repeated sequences of the two primers can be identical or different. It is preferred that they be different to avoid hybridization between them.
A schematic representation of the method of the invention based on an isothermic amplification is presented in FIG. 3 attached. Among the different pairs of primers which can be used in this embodiment of the method of the invention, the pair of preferred primers, designated A, can be more particularly cited as follows:
The invention also relates to a set of primers that can be used in the above method, characterized in that it comprises:
The isothermic amplification is carried out with the following reaction medium:
The DNA dependent DNA polymerase can be thermostable or mesophilic. Advantageously, a mesophilic DNA polymerase with a strand displacing activity is used, such as for example the Klenow fragment of the DNA polymerase I of E. coli. The adding of this DNA dependent DNA polymerase is carried out at the beginning of the reaction and after the two first steps of heating necessary for the denaturation of the DNA before of the implementation of the isothermic amplification.
Step (a) of the method of the invention consists: of heating the reaction mixture above in a manner to separate the DNA strands, then of cooling in order to permit the hybridization of the primers, and of using the temperature suitable for elongation by DNA polymerase. These steps of heating, of hybridization and of elongation are repeated a second time before obtaining a single-stranded target sequence whose ends are composed of inverted repeated sequences. This recombinant nucleic acid molecule has, at the same time, a role as a matrix and as a primer thanks to the hairpin structure at each one of its ends. Contrary to what is known with PCR, the amplification takes place here in a spontaneous fashion and at a constant temperature. The temperature is chosen in a manner permitting:
As shown in FIG. 3 attached, the amplification products rapidly attain a significant size, which can limit the elongation. The primers defining the size of the amplified fragment are chosen to optimize the amplification of the target sequence associated with a reporter gene.
A preferred operation of step (a) of isothermic amplification according to the invention is as follows:
Moreover, the amplification products can be specifically cut by a restriction enzyme, during or after the amplification reaction of the target sequence combined with the reporter gene of step (a). The restriction site is preferably situated at the level of one of the primers and more preferably in a loop of a hairpin, more precisely in two inverted repeated sequences of one of the primers.
The choice of the primers and of the cutting site of the enzyme will be defined for an effective transcription of the reporter gene, in such a way that this cutting does not alter the later transcription of the reporter gene.
In the case of the pair of preferred primers A described previously, the cutting site can be situated on the two primers and thus be identical or different on each of the primers.
The invention therefore equally has for an object a set of primers as defined above capable of being used in the previous method characterized in that at least one of the two primers comprises a restriction site. If the two possess a restriction site, they can be identical or different.
Preferably, the restriction site present on at least one of the primers is situated in a loop of a hairpin, more precisely between two repeated inverted sequences of one of the primers.
The invention also relates to the reaction mixture for the carrying out of the isothermic amplification method of the invention above comprising the four triphosphate deoxynucleotides, salts and reactants assuring an optimal activity of the DNA polymerase, a DNA dependent DNA polymerase, a pair of primers specific for the target sequence to amplify and comprising at 5′ the inverted repeated sequences containing the reporter sequences.
The invention also relates to a kit for the implementation of the method of detection of a target sequence in a DNA sample comprising a set of primers as defined above, an amplification reaction mixture, optionally one or several restriction enzymes, a DNA dependent RNA polymerase, a DNA dependent DNA polymerase, the mixtures necessary for the transcription, for the translation and for the revelation of the reporter molecule.
Outside of the specific examples of the kit previously described where the target substance is a target nucleic acid sequence, the invention relates to kits for the implementation of the method of the invention, regardless of the target substance, such a kit is characterized in that it comprises at least a reporter gene, the mixtures necessary for transcription, for translation and for the revelation of the protein encoded by the reporter gene.
It is also possible to combine in a single tube several detections according to the method of the invention. In this case, different reporters are used to detect each of the target substances.
It is also possible to use the same reporter for several target substances. A positive result thus uniquely indicates the presence of one or the other of the target substances.
The transcription and translation reaction (step b) can be broken down into two distinct steps or simultaneous. In the latter case, the transcription and translation reactions are carried out simultaneously. On the other hand, the breaking down of the steps permits an easier optimization of the yields of each step, and thus produces more significant quantities of the reporter protein, which is especially useful in the case of enzymes of low specific activity.
The separation between the transcription and translation also permits avoiding the problems of degradation of the DNA matrix by the nucleases if they were prepared by PCR. In effect, the constituents of the transcription reaction are slightly contaminated by nucleases, contrary to the translation extracts.
Moreover, the use of different cellular translation extracts according to the origin of the reporter gene permits optimization of the translation. In effect, the phase of translation of the transcript of step (b) is advantageously carried out with a cellular extract of the same origin or of an origin close to that of the reporter gene. There can be cited by way of example the use of a translation extract prepared starting from eukaryotic cells for the translation of a eukaryotic reporter gene. In another illustrative case, the translation extract is prepared starting from extremophilic organisms for the translation of a reporter gene from the same organism or from another extremophilic organism of the same type (thermophiles, halophiles, acidophiles, etc. . . ).
These specific extracts permit an increase in the effectiveness of the translation. But they can also be carried out with a standard extract such as for example an E. coli extract.
The process of the invention is thus notable in that it makes use of an adequacy between the expression punctuation of the transcripts and the translation extracts used. These extracts are also characterized in that either they do not contain the sought-after property, or they contain it but it is not detectable in the conditions of the test carried out for detecting the sought-after function. It relates for example to the use of a translation extract containing a mesophilic beta-galactosidase activity permitting translation of an mRNA of a thermophilic beta-galactosidase and the detection of the activity of this latter at high temperature, which eliminates the mesophilic beta-galactosidase activity.
A particular embodiment of the process of the invention consists of using at step (b) a translation extract that is in fact a mixture of several translation extracts. It can also relate for example to a translation extract of E coli overexpressing a chaperon protein A mixed with a translation extract of E. coli overexpressing a chaperon protein B. Any type of mixture is contemplated so long as it corresponds to the characteristics described above. In the same manner, it is possible to use a translation extract in which are added one or several tRNAs specific of one or several codons. The translation extracts thus obtained thereby permit translation of the mRNA comprising these specific codons, such as for example the translation of an mRNA containing an amber codon by adding in the translation extract a suppressor tRNA.
The treatment of step (b) with a translation extract can also be carried out with a standard translation extract what ever the origin of the sample as for example an extract of E coli and/or any other cellular extract(s) supplemented or not by molecules of interest such as those, for example, indicated previously (tRNA, chaperon . . . ).
It is equally possible to add to the translation extract of step (b) one or several substances favoring a refolding or a more effective maturation of the expressed proteins, such as for example chaperons, detergents, sulfobetaines, membrane extracts, etc. . . .
According to a particular embodiment of step (c), the revelation of the activity of the protein encoded by the reporter gene, also designated “reporter molecule” is carried out by contacting the reporter molecule with one or several substrates capable of revealing its activity.
Any type of specific substrate can be contemplated by a person skilled in the art in order to highlight the presence of the activity of the protein encoded by the reporter gene. A person skilled in the art will be able for example to refer to works such as Methods In Enzymology or Annual Review of Biochemistry, in which a large number of methods to study enzyme activity and of preparation of substrate have been described.
The measurement of the activity of the protein of step (c) can be read directly in a fluorimeter if the reporter is for example GFP or by a colorimeter if the reporter is for example beta-lactamase. The readers are adapted for the revelation of the reporter. One can equally contemplate measurements by absorbance, viscosity, mass spectrometry etc. . . . It can also be contemplated to carry out a reading continuously of the reporter activity, if the latter lends itself to it.
A particular application of the process of the invention consists of administrating the target substance labeled by the reporter gene and the sequences necessary for its expression, for example to an organisms or in a process, then searching for, by the pursuit of the steps of the invention up to step (c) of the method of the invention, in a sample withdrawn from said organism or from said process, the protein encoded by said reporter gene.
The method of the invention can also advantageously be automated, notably if the number of samples to analyze is high. The samples containing the target substances are thus placed on a support that can correspond to biochips or microtitration plates that can contain several dozens to several thousands of sites. These supports are placed on an automatic machine for:
Consequently, the invention relates to a device comprising an arrangement of one or several supports, of robots and of a reader of said supports for the carrying out of the steps of the method described previously.
The invention equally concerns a process of labeling a substance corresponding to step (a) of the method of the invention described above. The invention therefore also concerns a substance labeled by a reporter gene and the elements necessary for the in vitro expression of said reporter gene capable of being obtained by this labeling process.
The invention finally concerns the use of a reporter gene and the elements necessary for the in vitro expression of said reporter gene as a label of a target substance.
Other advantages and features of the invention will appear form the examples of carrying out the invention that follow.
EXAMPLE I Labeling by PCR and Detection1) The gene coding for microperoxidase 8 (MP8) was cloned in the expression vector pET26b+.
For this, two partially complementary oligonucleotides MICRO1 and MICRO2 were hybridized thus producing a double-stranded DNA fragment with compatible protruding ends respectively with a restriction Ndel site at the ATG side of the gene and with a Xhol site at the other end. This DNA fragment was inserted in the vector pET26b+ digested by Ndel and Xhol. In this way, the obtained plasmid contains the gene coding for the MP8 under the control of the promoter of the T7 RNA polymerase and its terminator situated on both sides.
| Sequence MICRO1: | ||
| 5′ TATGTGCGCACAATGTCATACAGTAGAATAATAAC | ||
| Sequence MICRO2: | ||
| 5′ TCGAGTTATTATTCTACTGTATGACATTGTGCGCACA |
Double-stranded DNA fragment:
| Compatible | Compatible | |
| Ndel | Xhol | |
| -------- | --------- | |
| 5′ TATG TGC GCA CAA TGT CAT ACA GTA GAA TAA TAA C | ||
| 3′ AC ACG CGT GTT ACA GTA TGT CAT CTT ATT ATT | ||
| GAGCT | ||
| Met Cys Ala Gln Cys His Thr Val Glu Stop Stop |
2) This plasmid then served as matrix during the following PCR:
Mix Taqpol Appligene: 1X
| pET5′ AGATCTCGATCCCGCGAAATTAATACG | ||
| pET3′ CAAAAAACCCCTCAAGACCCGTTTAG |
The amplification cycles carried out are the following: 3 mn at 94°, (30 s at 94°, 30 s at 60°, 1 mn at 72°) 30 times, 3 mn at 72°
This PCR permits amplification of a fragment containing, from 5′ to 3′, the promoter of the T7,RNA polymerase, the ribosome-binding site, the MP8 gene and the transcription terminator of the T7 RNA polymerase. The PCR product was purified by phenol chloroform extraction and precipitated with ethanol.
3) The product of the PCR reaction was transcribed under the following conditions:
4) Some translations were carried out starting from 0, 2.75 and 11 μg of RNA under the following conditions:
5) The measuring of the microenzyme activity was carried out according to the following protocol described by Hirayama et al. Two standard ranges were carried out: one in the presence of 10 μl of translation control (without RNA) for the points where 10 μl of translation are measured. The results obtained are reported in the table 1 below, expressed in units of luminescence.
| TABLE 1 | ||
| Sample | 10 μl of translation | |
| 0 control | 1760 | |
| 0.1 ng purified MP8 | 2368 | |
| 1 ng purified MP8 | 5248 | |
| 10 ng purified MP8 | 49088 | |
| 100 ng purified MP8 | 1530144 | |
| Translation with 2.75 μg of RNA | 2784 | |
| Translation with 11 μg of RNA | 6752 | |
The standard range obtained permits estimation of the quantity of MP8 produced at 0.14 ng with a translation of 2.75 μg showing that the PCR product can be demonstrated by the method which is the object of the invention.
EXAMPLE II Detection of a Target DNA by Padlock, and Rolling Circle1) The following oligonucleotide was prepared:
2) The plasmid used as target contains the following sequence:
| CTGTGGGGAATCCTGCTGAACCAAGCCTTATGATCGACGG |
This sequence is recognized by the padlock probe above.
3) The ligation reaction is carried out as follows:
The following temperature cycles are then carried out: 3 mn at 94°, (10 s at 94°, 10 s at 55°, 1 mn 30 at 65°) 30 times.
4) The rolling circle amplification was done according to the following protocol:
The PADRCMP8 oligonucleotide has the following sequence: TTTAACTTTAAGAAGGAGATATAC. It is complementary to a part of the padlock probe and therefore serves as a primer to the rolling circle.
5) Synthesis of the complementary strand 50 pmol of PADPCR5′ oligonucleotide was added as well as 5 nmol of dNTP.
This oligonucleotide is complementary to the strand amplified by rolling circle. The reaction mixture was heated 5 mn at 100° C. then allowed to cool in order to permit the hybridization of the oligonucleotide to the rolling circle.
5U of Klenow DNA polymerase and 5U of restriction enzyme Asel were then added. After incubation 2h at 37°, double-stranded DNA molecules were obtained. An Asel site being present just upstream of the promoter sequence, the cutting by Asel permits shortening the multimers and thus will favor transcription.
The oligonucleotide PADPCR5′ has the following sequence:
| 5′ TTCAGCAGGATTCCCCACAG |
6) Transcription
The transcription of the amplification product was carried out under the following conditions:
7) Translation: The translation was carried out as described in the previous example.
8) Measuring: The measuring of the activity of the microenzyme was carried out with 10 μl of translation according to the following protocol described by Hirayama et al. (Hirayama O et al., 1997, Analytical Biochem., 247, p237-241): The negative control is a complete experiment where the target plasmid was replaced by water at step 3. The translation and the measuring were done twice with different reaction mixes.
The results obtained are reported in Table 2 below and are expressed in units of luminescence.
| TABLE 2 | |||
| Sample | Experiment 1 | Experiment 2 | |
| Negative Control | 280213 | 179333 | |
| Positive Control | 396000 | 268207 | |
1) Landegren, U., Samiotaki, M., Nilsson, M., Malmgren, H. and Kwiatkowski, M. (1996). Detecting genes with ligases. METHODS: A Companion to Methods in Enzymology 9, 84-90.
2) Landegren, U. and Nilsson M. (1997). Locked on target: strategies for future gene diagnostics. Ann. Med. 29, 585-590.
3) Nilsson M., Malmgren, H., Samiotaki, Kwiatkowski, M. Chowdhary, B. P. and Landegren, U (1994). Padlock Probes: Circularizing oligonucleotides for localized DNA detection. Science 265, 2085-2088.
4) Nilsson M., Krejc, K., Koch, J., Kwiatkowski, M I, Gustavsson, P. and Landegren, U. (1997). Padlock probes reveal single-nucleotide differences, parent of origin and in situ distribution of centromeric sequences in human chromosomes 13 and 21. Nature Genetics 16, 252-255.
1) Method of detection of a target substance in a sample, comprising:
a) specific labeling of said substance by a reporter gene and by sequences necessary for expression of said reporter gene in vitro;
b) transcription and translation in vitro of said reporter gene; and
c) The detection in vitro of the a reporter protein encoded by said reporter gene.
2-4. (canceled)
5) Method of detection of a target nucleic acid sequence in a sample according to claim 1, comprising
a) The preparation, starting from the sample of a recombinant nucleic acid molecule comprising, in the 5′ to 3′ sense, an RNA polymerase promoter, a reporter gene possessing the sequences necessary for its expression and possibly an RNA polymerase terminator, the target nucleic acid sequence being localized between any two of these elements,
b) The transcription and the translation of the amplification products obtained at step (a),
c) The revelation of the activity of the protein encoded by the reporter gene, designated the reporter molecule, obtained in step (b) by any appropriate means.
6) Method of detection of a target nucleic acid sequence in a sample according to claim 5, characterized in that the preparation of the nucleic acid molecule of step (a) is carried out by amplification in vitro of the target nucleic acid sequence.
7-10. (canceled)
11) A set of primers capable of being used at step (a) of the method according to claim 6, comprising:
A sense primer comprising at least one part homologous to the 5′ region of the target sequence,
An anti-sense primer, comprising at least one part homologous to the region 3′ of the target sequence,
said primers permitting after amplification of the target nucleic acid sequence, and after the step (b) the expression of a reporter gene.
12) A kit for the detection of a target nucleic acid sequence in a sample, characterized in that it comprises a set of primers according to claim 11, a mixture necessary for amplification, the triphosphate nucleotides, a DNA dependent RNA polymerase, a cellular translation extract, the mixtures necessary for transcription, for translation, and optionally for the revelation of the reporter molecule, and optionally one or several substances permitting revelation of the activity of a reporter molecule.
13) Method of detection in vitro of a target nucleic acid sequence in a sample according to claim 6, characterized in that the preparation of the nucleic acid molecule of step (a) is carried out by hybridization and ligation of a Padlock-type probe with the target sequence.
14-15. (canceled)
16) A Padlock probe capable of being used in a method according to claim 13, characterized in that the sequences of said segments 3′ and 5′ of the Padlock probe are defined such as being able to hybridize in a complementary and joined manner to a target sequence.
17) A Padlock probe capable of being used in a method according to claim 13, characterized in that the sequences of said segments 3′ and 5′ of the Padlock probe are complementary to a target sequence having a nucleotide capable of being mutated so as to form with it a hybrid where said nucleotide is found at their junction when they are hybridized to the target sequence.
18) Method of detection in vitro of a target nucleic acid sequence in a sample according to claim 13, characterized in that after circularization, the probe is used as a matrix for its replication by rolling circle.
19-20. (canceled)
21) A kit comprising:
a probe according to claim 16, a DNA dependent DNA polymerase, a nick-sealing ligase, the triphosphate nucleotides and the triphosphate deoxynucleotides, a primer for initiating replication, a primer permitting the synthesis of the second DNA strand, a DNA dependent RNA polymerase, the mixtures necessary for ligation, for replication, for transcription, for translation and for the revelation of the reporter molecule.
22) Method of detection in vitro of a target nucleic acid sequence in a sample according to claim 6, characterized in that the target nucleic acid sequence is isolated from a nucleic acid sample at step (a) by specific isothermic amplification, with the aid of a DNA dependent DNA polymerase and of two specific primers of the target sequence, wherein at least one is composed of a 3′ part which can be specifically hybridized to the target sequence and of a 5′ part comprising at least one inverted repeat sequence for forming at a suitable temperature a so called “hairpin” structure.
23-24. (canceled)
25) A set of primers capable of being used in the method according to claim 22, characterized in that it comprises:
A sense primer comprising at least a part homologous to the 5′ region of the target sequence,
An anti-sense primer, comprising at least a part homologous to the 3′ region of the target sequence
said primers permitting after amplification of the target nucleic acid sequence, and after the step (b) the expression of a reporter gene, and at least one of said primers comprising a 5′ inverted repeat sequence.
26. (canceled)
27) A set of primers according to claim 25, characterized in that at least one of the two primers contains a restriction site, wherein if the two possess a restriction site, the latter is identical or different.
28) A set of primers according to claim 27, characterized in that the restriction site present on at least one of the primers is situated in a loop of a hairpin, more precisely between two inverted repeat sequences of one of the primers.
29) A kit comprising: a set of primers according to claim 25, a amplification reaction mixture, optionally one or several restriction enzymes, a DNA dependent RNA polymerase, a DNA dependent DNA polymerase, the mixtures necessary for transcription, for translation, and for the revelation of the reporter molecule.
30. (canceled)
31) A kit for the implementation of the method of detection of a target substance according to claim 1, comprising at least a reporter gene, the mixtures necessary for the transcription, for the translation and for the revelation of the reporter protein encoded by the reporter gene.
32) A substance labeled by a reporter gene and the elements necessary for the expression in vitro of said reporter gene capable of being obtained by the process for labeling a substance by step (a) according to claim 1.
33) A kit comprising:
a probe according to claim 17, a DNA dependent DNA polymerase, a nick-sealing ligase, the triphosphate nucleotides and the triphosphate deoxynucleotides, a primer for initiating replication, a primer permitting the synthesis of the second DNA strand, a DNA dependent RNA polymerase, the mixtures necessary for ligation, for replication, for transcription, for translation and for the revelation of the reporter molecule.
34) A kit comprising:
a set of primers according to claim 27, a amplification reaction mixture, optionally one or several restriction enzymes, a DNA dependent RNA polymerase, a DNA dependent DNA polymerase, the mixtures necessary for transcription, for translation, and for the revelation of the reporter molecule.
35) A kit comprising:
a set of primers according to claim 28, a amplification reaction mixture, optionally one or several restriction enzymes, a DNA dependent RNA polymerase, a DNA dependent DNA polymerase, the mixtures necessary for transcription, for translation, and for the revelation of the reporter molecule.