US20050208549A1
2005-09-22
11/058,105
2005-02-15
The invention relates to the diagnosis of disease or the determination of functioning of cellular organisms, being of multi-cellular or unicellular nature, being visible by the naked eye or being a microorganism. The invention provides a method for determining functioning of a cellular organism comprising determining the relative ratio of a first endosymbiont cellular organelle nucleic acid and/or gene product thereof in a sample obtained from the organism in relation to the amount of a second nucleic acid and/or gene product thereof.
Get notified when new applications in this technology area are published.
C12Q1/6888 » CPC main
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
C12Q2600/136 » CPC further
Oligonucleotides characterized by their use Screening for pharmacological compounds
C12Q2600/158 » CPC further
Oligonucleotides characterized by their use Expression markers
C12Q2600/16 » CPC further
Oligonucleotides characterized by their use Primer sets for multiplex assays
C12Q1/6809 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids Methods for determination or identification of nucleic acids involving differential detection
C12Q2545/101 » CPC further
Reactions characterised by their quantitative nature the purpose being quantitative analysis with an internal standard/control
This application is a continuation of U.S. patent application Ser. No. 10/006,009, filed Dec. 4, 2001, pending, which application claims priority under 35 U.S.C. 119(a)-(d) to European Patent Application 00204322.2, filed Dec. 4, 2000 and European Patent Application 01202168.9 filed Jun. 6, 2001, the contents of all of which are incorporated herein by this reference.
TECHNICAL FIELDThe invention relates to diagnosis of disease and/or determination of functioning of cellular organisms, of multicellular or unicellular nature, including organisms visible to the naked eye and microorganisms.
BACKGROUNDA diagnostician of disease studying (mal)functioning of cellular organisms can employ a broad range of inroads into the organism to obtain relevant information as to the various aspects of the malfunctioning. These inroads vary widely, examples of which include detecting relative ratios of kidney stones by studying urinary samples obtained from various patients, probing for the presence or absence of intestinal ulcers via endoscopy, scanning for detectable tumors by nuclear magnetic resonance (“NMR”), detecting diabetes by testing for insulin levels and/or glucose concentration in blood plasma, determining cancer proneness by determining transcriptional levels of oncogenes, and so on.
Currently, the detection of disease or malfunctioning (or vice versa, of health and proper functioning) of higher organisms, such as animals and plants, relies on testing samples obtained from these organisms and studying these samples in a laboratory. Often, when a fruitful method capable of determining, identifying or detecting (aspects of) a disease or malfunctioning of an organism has been found, it is also generally useful in testing or screening of compounds or methods for treatment of (aspects of) the disease or malfunctioning or useful in testing or screening for compounds or methods involved in causing (aspects of) the disease or malfunctioning. By using the same or similar methods used in diagnosis, it is generally possible to assess the usefulness of such candidate compounds or methods in treating and/or causing the disease or malfunctioning in question. Clearly, life science laboratories are always in the need of other inroads into organisms to obtain yet more information relating to disease or malfunctioning and to compounds and methods related to causing and/or treating the disease or malfunctioning.
DISCLOSURE OF THE INVENTIONThe invention provides a method for determining (mal)functioning of a cellular organism comprising determining the relative ratio of an endosymbiont cellular organelle nucleic acid and/or gene product thereof in relation to another nucleic acid or gene product present in a sample obtained from the organism. In terms of the invention, “relative ratio” includes the amount of the first endosymbiont cellular organelle nucleic acid and/or gene product thereof in relation to the amount of the second nucleic acid and/or gene product thereof. The relative ratio may, for instance, be determined by (among other things) dividing the amount of the first nucleic acid or gene product thereof by the amount of the second nucleic acid or gene product thereof, or vice versa. The amount of one or both compounds may also be divided by, or subtracted from, a reference value. By determining functioning of a cellular organism is meant herein determining whether the cellular organism is in its natural healthy state, or whether the organism is somehow affected, for instance, by a disease and/or a (toxic) compound. The disease and/or (toxic) compound may affect the organism to such extent that clinical symptoms are present. Alternatively, the disease or (toxic) compound may have an influence upon the organism while clinical symptoms are not (yet) manifested.
Endosymbiont cellular organelles include those organelles of a eukaryotic cell that are thought to have been derived of prokaryotic bacteria very early on in the evolution of eukaryotic cells. These bacteria (as it is thought) have engaged in a symbiosis with early eukaryotic cells, and, at present, eukaryotic cells comprising these endosymbiont organelles in general cannot live without them. None of the present eukaryotic cells would function properly without mitochondria, and most plant cells would at least be considered to be malfunctioning when no proplastids, or organelles derived thereof, such as chloroplasts, etioplasts, amyloplasts, elaioplasts or chromoplasts were present. These organelles in general appear to be at least partially self-replicating bodies which, although under some nuclear controls, still possess considerable autonomy.
In particular, the invention provides a method whereby the relative ratio of an endosymbiont cellular organelle nucleic acid and/or gene product thereof is determined in relation to the amount of essentially nuclear nucleic acid detectable in the sample (be it DNA or RNA), or in relation to gene products (derivable by transcription and/or translation, such as mRNA or (poly)peptides) of the nuclear nucleic acid, (nuclear nucleic acid herein comprises chromosomal DNA and the RNA transcribed therefrom) for example, present in nuclear or cytoplasmatic fractions or parts of the sample. DNA or corresponding mRNA encoding components of small nuclear ribonucleoprotein (SNRNP), or other essentially common nucleic acid derived from chromosomal DNA, is particularly useful to test, because of its ubiquitous presence. In this way, the invention provides a method for studying, for example, endosymbiont cellular organelle-related disease, like mitochondrial and/or proplastid-related disease. By endosymbiont cellular organelle-related disease is meant herein a condition wherein the amount and/or at least one property of nucleic acid of the endosymbiont cellular organelle, and/or gene product thereof, is altered as compared to the natural situation. For instance, expression of the nucleic acid may be reduced. Endosymbiont cellular organelle-related disease, e.g., encoded by defects in the organelle's DNA, manifests in many different syndromes and is often variable in its expression (and thus in general hard to detect by testing for clinical parameters alone) due to heteroplasmy, whereby mutant and wild-type nucleic acid can be found in one cell, whereby its distribution can vary. Endosymbiont cellular organelle-related disease is often aggravated with increasing age of the affected individual. Endosymbiont cellular organelle-related disease can also often be observed after treatment against other disease with various drugs, and then contributes to various side-effects of those drugs that one would like to avoid during treatment. Those side-effects can now be better studied by using a method as provided herein.
Furthermore, the invention provides a method whereby the relative ratio of a first endosymbiont cellular organelle nucleic acid and/or gene product thereof is determined in relation to the amount of a second (distinct) endosymbiont cellular organelle nucleic acid detectable in the sample (be it DNA or RNA), or in relation to gene products (derivable by transcription and/or translation, such as mRNA or (poly)peptides)) of the endosymbiont cellular organelle nucleic acid. In one aspect of the invention, the method involves determining a ratio between organelle DNA, such as mtDNA, and the corresponding transcriptionally derivable organelle RNA, in the example the related mtRNA, or translated gene product. This way, the level of transcription and/or translation can be determined. An alteration of the level of transcription and/or translation, as compared to the natural level of transcription and/or translation, is indicative for an altered functioning of the organelle. The altered functioning may be malfunctioning of the organelle, because of a disease and/or because of side-effects of a certain treatment. The malfunctioning may, for instance, comprise a decreased level of transcription. Alternatively, the altered functioning may be an improved functioning of the organelle, for instance, during treatment and/or curing of an endosymbiont cellular organelle-related disease.
The malfunctioning may also comprise an increased level of transcription. A disease, or a treatment of a disease, may involve decrement of the amount of endosymbiont organelle DNA. However, the decrement can at least in part be compensated by an increase in transcription of the DNA, at least in the first stage of the disease. This way, the amount of RNA derived from the endosymbiont organelle DNA may not be decreased at all, or relatively less decreased as compared to the amount of the endosymbiont organelle DNA. Symptomatic side-effects of the disease or treatment may then not be (fully) sensed yet. However, upon further decrement of the amount of the endosymbiont organelle DNA, the amount of RNA derived from the DNA will eventually also drop significantly. Side-effects can then occur. Conventionally, upon manifestation of side-effects, a disease is treated or a treatment is reduced or stopped. However, in this conventional way, a patient already suffers from the side-effect(s). With a method of the invention, however, side-effect(s) involving clinical symptoms can be predicted. For instance, an altered level of transcription and/or translation of an endosymbiont cellular organelle nucleic acid is indicative for altered functioning of a cellular organism, for instance, malfunctioning of the organism involving (future) side-effects. An alteration of the relative ratio of endosymbiont cellular organelle DNA and/or gene product thereof in relation to the amount of nuclear nucleic acid or gene product thereof is also indicative of altered functioning of a cellular organism.
In yet another aspect of the invention, the ratio between two distinct organelle DNAs or related gene products is determined. In one aspect, a method of the invention is provided wherein the first endosymbiont cellular organelle nucleic acid and the second endosymbiont cellular organelle nucleic acid are obtained from the same kind of organelle. The organelle, for instance, comprises a mitochondrion.
A method of the invention is particularly suitable for staging of a disease. An organism can already be affected by a disease, while no or little clinical symptoms are essentially present yet. However, although no clinical symptoms are essentially present, the relative ratio of a first endosymbiont cellular organelle nucleic acid and/or gene product thereof in relation to the amount of a second nucleic acid and/or gene product thereof can already be altered. As shown in the examples, the alteration of the relative ratio can be determined before clinical symptoms and/or conventional tests, like determination of the lactate pyruvate ratio, to indicate an altered functioning of an organism. Thus, the relative ratio is very suitable for determining the stage of a certain disease. The invention therefore provides in one aspect a method for determining the staging of a disease, comprising determining the relative ratio of an endosymbiont cellular organelle nucleic acid and/or gene product thereof in a sample obtained from an organism suffering from or at risk of suffering from the disease.
A method of the invention for staging of a disease can be used for diagnosis. For instance, people can be routinely tested by a method of the invention with certain time intervals. Alternatively, people can be tested at the moment that they have some clinical symptoms. An alteration in the relative ratio is indicative of a certain degree of disease. The kind of the disease need not be diagnosed by a method of the invention.
Other possible uses of the invention lay in candidate drug testing for beneficial activity and/or side-effects of possible medicaments or pharmaceutical compositions such as candidate anti-parasitic compounds, antibiotic compounds, cytostatic compounds, and so on. For example, the invention provides a method for determining therapeutic activity and/or possible side-effects of a candidate compound, for example, in determining its usefulness for treatment of malfunctioning of a cellular organism, comprising determining the relative ratio of an endosymbiont cellular organelle nucleic acid and/or gene product thereof in a sample obtained from the organism, preferably the organism or an essentially related organism, such as belonging to the same species or genus, having been provided with the compound. If the relative ratio of an endosymbiont cellular organelle nucleic acid, and/or gene product thereof, of a certain organism is altered after the candidate compound is administered to the organism, this indicates therapeutic activity and/or side-effects involved with the compound when administered to the organism. Additionally, this also indicates therapeutic activity and/or side-effects involved with the compound in an essentially related organism. Therefore, for determining therapeutic activity and/or side-effects of a candidate compound for treatment of malfunctioning of a cellular organism, it is not necessary to use exactly the same organism in a method of the invention. An essentially related organism can also be used.
In another aspect, the invention provides a method for determining therapeutic activity and/or possible side-effects of a medicament comprising determining the relative ratio of an endosymbiont cellular organelle nucleic acid and/or gene product thereof in a sample obtained from an organism, preferably the organism having been provided with the medicament. In terms of the invention, therapeutic activity means the capability of at least in part treating a disease. In one embodiment of the invention, the therapeutic activity comprises a therapeutic activity against an HIV-related disease and/or a tumor-related disease. The medicament may, for instance, comprise a cytostaticum, optionally combined with other antiretroviral therapy. According to the ATHENA-study in the Netherlands, forty percent of the patients undergoing an antiretroviral therapy need to change antiretroviral therapy because of adverse side-effects. Therefore, a method of the invention is very much desired during such therapies, because the method can detect side-effects before (severe) clinical symptoms are essentially present. The therapy can then already be stopped and/or changed before the clinical effects are essentially present. In that case, the clinical symptoms may not, or to a lesser extent, become present. This will prevent a lot of suffering. Thus, in a preferred aspect, a method of the invention is provided wherein the side-effects are not essentially manifested at the moment that the method is performed. In terms of the invention, by “not essentially manifested” is meant that the side-effect is not (yet), or only partly, manifested by clinical symptoms.
In one aspect, a method of the invention is provided wherein the compound or medicament comprises a cytostaticum. Commonly used cytostatica, for instance, comprise alkylating compounds, antimitotoxic cytostatica, antitumor antibiotica, and topo-isomerase inhibitors. Nonlimiting examples thereof comprise chloorambucil, cyclofosfamide, estramustine, ifosamide, melfalanthiotepabusulfan, treosulfancarmustne, lomustinecisplatine, carboplatine, oxaliplatinedacarbazine, procarbazine, temozolomide vinblastine, vincristine, vindesinedocetaxel, paclitaxeldaunorubicine, doxorubicine, epirubicine, idarubicine, mitoxanthronbleomycine, dactinomycine, mitomycineirinotecan, topotecanetoposide, teniposide amsacrine, asparaginase, cladribine, hydroxycarbamide, pentostatine methotrexate and/or raltitrexed. During antiretroviral treatment, and/or treatment of tumor-related disease, a nucleoside and/or nucleotide analogue is often used. These analogues involve a high risk of side-effects, because they interfere with replication and/or transcription processes in an organism. The amount of endosymbiont cellular organelle nucleic acid is then often altered as well. Therefore, a method of the invention is very suitable when an organism is treated with a medicament involving nucleoside and/or nucleotide analogues.
In one aspect, the invention provides a method of the invention wherein the compound or medicament comprises a nucleoside and/or nucleotide analogue. Nonlimiting examples of such analogues are fludarabine, mercaptopurine, thioguanine, cytarabine, fluorouracil, and/or gemcytabine. In yet another aspect, a method of the invention is provided wherein the compound or medicament comprises AZT, ddI, ddC, d4T, 3TC and/or tenofofir. In a method of the invention, the organism or an essentially related organism has preferably been provided with the compound or organism.
Treatment of certain diseases, like, for instance, an HIV-related disease, has to be performed during a long period of time. A method of the invention is particularly suitable during treatment of a disease during a long period of time. During the long period, many side-effects can evolve, and a patient can now be monitored regularly even though no clinical symptoms are present (yet). Therefore, in one aspect, a method of the invention is provided wherein the medicament is used during at least three months, preferably during at least six months, and more preferably during at least twelve months. In one aspect, the medicament is used for treatment of a chronic disease. By a chronic disease is meant herein a disease which cannot be completely cured. Once an individual has acquired the disease, the disease is always present in the individual, albeit the clinical symptoms may vary widely. The symptoms may sometimes even be unnoticed by the individual. A chronic disease, for instance, comprises an HIV-related disease.
By a side-effect of a compound is meant herein another effect than the purpose of the compound. The side-effect may be an unwanted effect. For instance, a therapeutic compound may counteract a disease and simultaneously reduce the metabolism of an organism. The reduction of the metabolism is then referred to as a (negative) side-effect. Alternatively, a side-effect of a compound may be a beneficial effect, like, for instance, immunity against yet another disease.
Also, use for (selective) toxin testing of, e.g., herbicides, insecticides, anti-parasitic compounds, and antibiotic compounds is provided herein. The invention provides a method for determining toxic activity of a candidate compound, for example, in determining its usefulness for causing malfunctioning of a cellular organism, e.g., by having a cytostatic or even cytotoxic effect, comprising determining the relative ratio of an endosymbiont cellular organelle nucleic acid and/or gene product thereof in a sample obtained from an organism, preferably the organism or related organism having been provided with the compound.
In a preferred embodiment, selectivity is also tested, using or applying the method as provided herein (preferably in parallel experiments) on or to a first organism and on or to an essentially unrelated second organism, if desired, belonging to a different family or order, but preferably belonging to at least a different class or phylum, most preferably belonging to a different kingdom of organisms. Selectivity aspects are, for example, tested by testing the compounds in (if desired only in cells of) a first target organism (such as a bacterium or parasite) as well as testing the host or cells thereof, being an essentially unrelated second organism, for example, a mammal or plant, or by testing of a crop plant or cells thereof as well as testing an essentially unrelated weed plant or cells thereof with the compound to determine, for example, selective toxic or selective therapeutic effects. It is also provided to test normal cells derived from an individual in parallel or comparison with aberrant cells, such as tumor cells derived from the same individual, to detect or screen for a tumor-specific or at least selective cytostatic or cytotoxic compound for use in therapy of the individual or others with similar or related disease.
With a method of the invention, a relative ratio is, for instance, determined by measuring the amount of the nucleic acid(s) and/or gene product(s) present in the sample, usually after at least one processing step, like, for instance, amplification of target nucleic acid. After the amounts have been measured, the relative ratio can be determined by dividing one amount by another.
Minute amounts of target nucleic acid can be detected and quantified by using enzymatic amplification. Examples of enzymatic amplification techniques are a polymerase chain reaction (PCR),1 nucleic acid sequence-based amplification (NASBA),2 SDA, TMA, and others. Specific amplification of a target nucleic acid sequence can be achieved by adding two primer sequences to a reaction. An amplified region can be detected at the end of an amplification reaction by probes that are specific for the amplified region. Alternatively, an amplified region can be detected during generation of the amplified nucleic acid in the amplification reaction.3 In the latter protocol, a signal of a label attached to a probe can become detectable after the probe has hybridized to a complementary nucleic acid. Examples of such probes that enable real-time homogeneous detection in amplification reactions are TaqMan3 and Molecular Beacon probes.4,5
Quantification of a target nucleic acid sequence is commonly accomplished by adding a competitor molecule, which is amplified using the same primers and which contains sequences that allow discrimination between the competitor and target nucleic acid sequence.2,6 The ratio between the amplified competitor and target nucleic acid sequence can be used to quantify the target nucleic acid sequence. Detection of the competitor or target nucleic acid sequence can, for instance, be achieved at the end of the amplification reaction by probes that are specific for the amplified region of competitor or target nucleic acid sequence or during generation of the amplified nucleic acid in the amplification reaction. In the latter protocol, a signal of a label attached to a probe can become detectable after the probe has hybridized to a complementary target nucleic acid and when the target has exceeded a threshold level, the time or cycle number to positivity. In other methods for quantification, the time to positivity can be used for quantification without addition of a competitor.7
A method of the invention is very suitable for, among others, determining (mal)functioning of a cellular organism, candidate drug testing and selective toxin testing. Many reactions have been carried out using a method of the invention, which has proven to be a useful tool (see Examples). An even more precise result can be obtained using a method of the invention when double spreading in the result is avoided. Generally, double spreading in the result of a method of the invention is obtained due to varieties in conditions in different reaction mixtures. For instance, to be able to detect and quantify specific nucleic acids present in a sample, an amplification step is often necessary. However, the temperature of the reaction mixture of nucleic acid 1 may be slightly higher than the temperature of the reaction mixture of nucleic acid 2. This may result in a higher yield of nucleic acid 1 and, hence, in a higher ratio of the amount of nucleic acid 1 versus nucleic acid 2 than would have been obtained if the temperature of reaction mixture 1 had been exactly the same as the temperature of reaction mixture 2. Because of the temperature difference in the reaction mixtures, the determined ratio is not exactly the same as the real ratio of the two nucleic acids present in the initial sample. Likewise, minute variations in other conditions like, for instance, the amount of enzyme added can lead to variations in the determined amounts of nucleic acids 1 and 2. Thus, the measured amounts of nucleic acids 1 and 2 may vary independently from each other. Independent variations in the determined amounts may result in an even larger variation in the calculated ratio of the measured amounts. This is called double spreading in the result. Thus, by double spreading is meant herein at least one variation in an obtained result, due to a variety of at least one reaction condition in at least two reaction mixtures. For instance, also the total amount of volume may differ slightly between two reaction mixtures.
In some particular cases, double spreading in a result may exceed the variations of the relative ratio of an endosymbiont cellular organelle nucleic acid and/or gene product thereof in an organism which is due to a certain disease or treatment. For instance, inhibitors of viral polymerase are often used for treatment of HIV. Inhibitors of viral polymerase may also affect mitochondrial polymerase gamma. Thus, the amount of mitochondrial polymerase gamma may be reduced during the treatment of HIV, which may result in a decreased amount of mitochondria per cell. A decrement of, for instance, 50% of the mitochondria may result in side-effects. The ratio of mitochondrial DNA versus nuclear DNA may be diminished by a factor of two. However, a decrement of mitochondrial DNA by a factor of two can, in some cases, lie within the double spreading of the measurement of the ratio because of the mentioned variations in conditions. Therefore, this biologically important difference in the amount of mitochondria may not reliably be detected because of double spreading in the result. Thus, double spreading can, in some cases, reduce the reliability of detection of biologically important differences in a ratio of nucleic acids and/or their gene products. Therefore, one embodiment of the present invention provides a method for determining functioning of a cellular organism, without double spreading in the result, comprising determining the relative ratio of a first endosymbiont cellular organelle nucleic acid and/or gene product thereof in a sample obtained from the organism in relation to the amount of a second nucleic acid and/or gene product thereof. The double spreading can, in a preferred embodiment of the present invention, be prevented by determination of the ratio in the same assay. This means that a processing step and/or a measurement of the amounts of at least two nucleic acids and/or gene products thereof is performed in the same assay. In terms of the invention, an assay typically utilizes one reaction mixture. Preferably, all components of an assay of the invention are mixed randomly in the assay. The reaction mixture may be present in one reaction tube.
However, a person skilled in the art can think of more methods to prevent double spreading in the result. He/she can, for instance, use a reaction vessel which is divided into different parts by a (semi)permeable membrane. As long as at least one reaction condition varies dependently in the different parts, double spreading is avoided and the obtained result will be more accurate.
In one embodiment of the current invention, at least two target sequences are amplified in one assay. The two target sequences may be the endosymbiont cellular organelle nucleic acid and the second nucleic acid. Thus, in one embodiment of the current invention, a method of the invention is provided, comprising amplification of the endosymbiont cellular organelle nucleic acid and the second nucleic acid in the same assay. When at least two target sequences are amplified in one assay, varieties in reaction conditions in the assay can influence the obtained amount of each sequence present in the assay dependently. For instance, the obtained amount of each sequence present in the assay will be influenced by the same temperature, the same overall volume, and so on. Detection of the two target sequences can be achieved by using two specific probes during the generation of amplified nucleic acids during an amplification reaction. The two probes may each have a different label allowing discrimination between the two probes and thereby between the two different target sequences. Quantification can be achieved by relating the time to positivity as well as the slope of the relative fluorescence increase of both real time amplification reactions. Preferably, a reference curve is created before. The quantification of the nucleic acid can then be performed by comparing the obtained value(s) with the reference curve. Thus, there is no need for an internal standard like, for instance, a competitor molecule. A method of relative quantification of two targets in one assay has an improved accuracy compared to quantification in two separate assays and requires less handling time and reagents. We found that duplexing of two amplification reactions in the same tube gives an immediate indication of the ratio of the two targets. The conditions of both amplification reactions are the same, ruling out variations of those conditions without the necessity for internal or external calibrators. Hence, double spreading in the result is now avoided. Thus, in one aspect, the invention provides a method, wherein a relative ratio is determined directly by dividing one amount of nucleic acid by another. Preferably, the relative ratio is performed by comparison with a reference curve. In terms of the invention, “determined directly” means that an immediate indication of the ratio of the two targets is possible, for instance, by comparing the intensity of the two different fluorescent labels of the two specific probes. In this embodiment, dividing one amount of nucleic acid by another is performed by dividing the intensity of the corresponding fluorescent label by another. No internal standards are used in a method of the invention wherein the relative ratio is determined directly.
In one aspect, a method of the invention is provided wherein the cellular organelle nucleic acid, the gene product thereof, the second nucleic acid and/or the gene product thereof is obtained from a peripheral blood mononuclear cell (PBMC) and/or a fibroblast. Especially the use of PBMCs is preferred because then a blood sample from the organism can be used. A blood sample is easy to obtain and relatively large amounts are often available. Therefore, in a preferred embodiment, a method of the invention is provided wherein the sample comprises a blood sample.
A method of the invention is especially useful to quantify a target nucleic acid and/or gene product thereof with a variable content in relation to a target nucleic acid and/or gene product thereof with a constant content. An example is the quantification of the variable cellular content of mitochondrial DNA to the constant cellular content of the DNA of a nuclear gene (two per diploid cell). Another example comprises the quantification of variably expressed RNA like mitochondrial RNA to constitutively expressed RNA that is essential for cell survival like the SNRP U1A encoding RNA involved in splicing or other essentially common nucleic acids derived from nuclear DNA with a ubiquitous presence. We found that it is possible to determine a relative ratio of a factor 2:3.
In one aspect, the invention provides a method of the invention wherein the first nucleic acid comprises RNA and the second nucleic acid comprises DNA. A method of the invention is, for instance, particularly suitable for the quantification of the cellular content of mitochondrial RNA to the cellular content of the DNA of a nuclear gene like U1A. This is shown in Example 22.
Furthermore, the invention provides a diagnostic kit comprising at least one means for performing a method according to the invention the kit of comprising at least one primer or probe set selective for the amplification and detection of a nucleic acid related to or derived from endosymbiont cellular organelles and, when so desired, necessary amplification reagents, such as can be found exemplified in the detailed description herein or which are otherwise known in the art. In particular, the invention provides a diagnostic kit wherein the kit comprises more than one primer or probe set for the amplification of nucleic acid sequences related to cellular organelles, preferably supplemented with a primer or probe set for the amplification of nucleic acid related to the chromosomes, such as an SNRP specific primer or probe. In particular, the invention provides a kit comprising at least one primer or probe from Table 1 for the amplification of nucleic acid sequences related to cellular organelles. It is, of course, preferred that the amplification reagents, when provided with the kit, comprise an enzyme with reverse transcriptase activity, such as required for PCR or NASBA amplification. Of course, a kit comprising a means for the detection of a gene product other than nucleic acid for use in a method according to the invention is herewith also provided.
The invention furthermore provides the use of a compound obtainable or detectable by a method according to the invention in the preparation of a medicament, a herbicide, insecticide, anti-parasiticum, cytostatic, etc., and a medicament, herbicide, insecticide, anti-parasiticum, etc., obtainable or derivable or identifiable by a method according to the invention.
The invention is further explained in the detailed description herein, wherein most examples are directed by way of example at testing of mitochondria, being central to the provision and use of energy in a cell; however, it will easily be understood that the same principles apply to tests using other endosymbiont organelles, such as chloroplasts, being central to the provision of carbohydrates to a plant cell.
BRIEF DESCRIPTION OF THE DRAWINGSFIG. 1. Examples of standard curves for DNA and RNA target sequences.
FIG. 2. Ratio of mitochondrial DNA and chromosomal DNA in fibroblast cells cultured in the presence of ddC.
FIG. 3. Ratio of mitochondrial RNA and chromosome-encoded RNA in fibroblast cells cultured in the presence of ddC.
FIG. 4. Ratio of mitochondrial RNA and chromosomal DNA in fibroblast cells cultured in the presence of ddC.
FIG. 5. Ratio of mitochondrial RNA and mitochondrial DNA in fibroblast cells cultured in the presence of ddC.
FIG. 6. Ratio of chromosome encoded RNA and chromosomal DNA in fibroblast cells cultured in the presence of ddC.
FIG. 7. Ratio of mitochondrial DNA and chromosomal DNA in fibroblast cells cultured in the absence of ddC after being cultured with ddC for four weeks.
FIG. 8. Ratio of mitochondrial RNA and chromosome-encoded RNA in fibroblast cells cultured in the absence of ddC after being cultured with ddC for four weeks.
FIG. 9. Ratio of mitochondrial DNA and chromosomal DNA in PBMCs cultured in the presence of ddC for five days.
FIG. 10. Ratio of mitochondrial RNA and chromosome-encoded RNA in PBMCs cultured in the presence of ddC for five days.
FIG. 11. Comparison of SNRNP DNA NASBA reactions with and without pretreatment with restriction enzyme Msp I.
FIG. 12. Fluorescence in time of the reactions of 1,000 molecules plasmid containing Snrp DNA mixed with 4×105 (A), 2×105 (B), 105 (C), 5×104 (D), 2.5×104 (E) or 104 (F) molecules of plasmid containing mitochondrial DNA. The curve (G) of the ratio of the amount of molecules of amplified mitochondrial DNA to Snrp nuclear DNA plotted against the ratio of the slope of the corresponding fluorescence in time.
FIG. 13. Fluorescence in time of the reactions of 1,000 molecules plasmid containing Snrp DNA mixed with 4×105 (A), 2×105 (B), 105 (C), or 5×104 (D) molecules of plasmid containing mitochondrial DNA. The standard curve (E) of the ratio of the amount of molecules of amplified plasmid mitochondrial DNA to plasmid Snrp nuclear DNA plotted against ratio of the slope of the corresponding fluorescence in time as derived from the Panels A-D; closed circles indicate data points. The 1:10 (F, H) and 1:100 (G, I) dilutions of PBMC in the absence (F, G) and the presence of 5 μM ddC (H, I). In Panel E, the squares represent the PBMC samples cultured in the absence of ddC and the diamonds represent PBMC samples cultured in the presence of 5 μM ddC.
FIG. 14. Mitochondrial DNA copies per chromosomal DNA copy in four blood PBMC samples of an HIV-1 infected patient that died of lactic acidosis. For further explanation of time points see text.
FIG. 15A. CD4 positive cell numbers and HIV-1 RNA load of an HIV-1 infected individual. Bars labeled with ddC and AZT below the X-axis indicate the time period of treatment with these drugs. The four arrows below the X-axis indicate the time points at which samples of PBMC were analyzed for mitochondrial DNA content and lactate-pyruvate ratio. Approximately one month after time point four, the patient died of lactate acidosis.
FIG. 15B. The left panel shows the lactate-pyruvate ratios of the PBMC samples numbered 1 to 4. No increase in lactate-pyruvate ratio can be measured in these PBMC. The right panel shows the mitochondrial DNA content of PBMC in samples 1 to 4. In this experiment a clear decrease in mitochondrial DNA content can be observed.
FIG. 16. Fluorescence in time of ROX (chromosomal DNA, grey lines) and FAM (mitochondrial DNA, black lines) fluorescent signal using different ratios of mitochondrial DNA to chromosomal DNA as input. In the lower panel the linear relation between the ratio of signal and the ratio of DNAs is shown.
FIG. 17. Lactate-pyruvate ratio as measured in fibroblasts cultured in the presence of ddC for the first four weeks, after which the culture was continued both in the presence and absence of ddC.
FIG. 18. Fluorescence in time of ROX (chromosomal DNA, grey lines) and FAM (mitochondrial DNA, black lines) fluorescent signal of fibroblasts cultured in the presence of ddC. Panels from top left to top right: culture in the presence of ddC for respectively one, two, three and four weeks. Bottom left two panels: culture continued in the presence of ddC to respectively week seven and week ten. Bottom right two panels: culture continued in the absence of ddC to respectively week seven and week ten.
FIG. 19. The bars represent the percent of mitochondria in PBMC during culture in the absence (dotted bars) and presence (striped bars) of ddC. The amount of mitochondrial DNA in the controls (DMSO) is set at 100% at each given time point.
FIG. 20. Decrease of mitochondrial DNA content in three patient groups treated with AZT, AZT+ddI and AZT+ddC, respectively. P-values above the bars indicate significant changes in mitochondrial DNA content compared to time point zero, the start of therapy.
FIG. 21. The mitochondrial DNA content of three individual patients during treatment with AZT, AZT+ddI and AZT+ddC, respectively.
FIG. 22. Fluorescence in time of ROX (chromosomal DNA, grey lines) and FAM (mitochondrial RNA, black lines) fluorescent signal using different ratios of mitochondrial RNA to chromosomal DNA as input. In the lower panel, the linear relation between the ratio of signal and the ratio of RNA and DNAs is shown.
FIG. 23. Bars represent the amount of mitochondrial RNA in fibroblasts cultured in the presence of ddC for the first eight weeks, after which the culture was continued both with and without ddC until week 16.
FIG. 24. ATHENA-study of patients changing anti-retroviral treatment because of adverse side-effects.
FIG. 25. Schematic representation of DNA-NASBA amplification.
FIG. 26. Genetic map of the mitochondrial DNA with two regions indicated where part of the amplification primers as shown in Table 1 are located. Other amplification primers shown in Table 1 are located in other regions of the mitochondrial genome and are not indicated in this figure.
DETAILED DESCRIPTION OF THE INVENTION EXAMPLESUsed Ingredients and General Methodology
In Table 1, the primers and probes used in the examples are summarized. Standard NASBA nucleic acid amplification reactions were performed in a 20 μl reaction volume and contained: 40 mM Tris-pH 8.5, 70 mM KCl, 12 mM MgCl2, 5 mM dithiothreitol, 1 mM dNTPs (each), 2 mM rNTPs (each), 0.2 μM primer (each), 0.05 μM molecular beacon, 375 mM sorbitol, 0.105 μg/μl bovine serum albumin, 6.4 units AMV RT, 32 units T7 RNA polymerase, 0.08 units RNAse H and input nucleic acid. The complete mixture, except the enzymes, sorbitol and/or bovine serum albumin was, prior to adding the enzyme mixture, heated to 65° C. for two minutes in order to denature any secondary structure in the RNA and to allow the primers to anneal. After cooling the mixture to 41° C., the enzymes were added. The amplification took place at 41° C. for 90 minutes in a fluorimeter (CytoFluor 2000) and the fluorescent signal was measured every minute (using the filter set 530/25 nm and 485/30 nm). For amplification of DNA target sequences, the 65° C. denaturation step was replaced with a 95° C. denaturation step for two to five minutes.
To achieve quantification, a dilution series of target sequences for a particular primer set was amplified and the time points at which the reactions became positive (the time to positivity, TTP) were plotted against the input amounts of nucleic acid. This way a calibration curve was created that could be used to read TTP values of reactions with unknown amounts of input and deduce the input amount. Examples of typical standard curves for quantification of RNA and DNA are shown in FIG. 1.
For some of the target sequences, no dilution series were available with reliable absolute amount of copies determined. Those series were given an arbitrary unit as measurement instead of DNA or RNA copies, e.g., cell-equivalent or ET-unit. As a result, it sometimes seems that there is less RNA than DNA, which is quite the opposite of what is expected.
Cells (fibroblasts and PBMCs) were cultured under standard conditions in standard media known to persons skilled in the art with the addition of drugs or putative toxic or stimulating compounds as defined in the examples. Nucleic acids were isolated from the cells with the method described by Boom et al. (Boom, R.; Sol, C. J.; Salimans, M. M.; Jansen, C. L.; Wertheim-van Dillen, P. M.; van der Noordaa, J.; 1990, Rapid and simple method for purification of nucleic acids, J. Clin. Microbiol., 28(3):495-503) or with dedicated isolation kits purchased from Qiagen (Qiagen GmbH, Max Volmer Strasse 4, 40724 Hilden, Germany) and used according to the manufacturer's protocols. A small aliquot of the isolated nucleic acid was analyzed on an agarose gel and the remainder stored at −80° C. until further analysis. Usually the nucleic acid was diluted ten times with water, and of the diluted nucleic acid, usually 5 μl was used as input in the NASBA amplification reactions.
Example 1In this example it is explained what kind of ratios can be measured with a method according to the invention and the meaning they can have in a diagnostic sense:
The invention, for example, provides determining the relative ratio of organelle DNA to chromosomal DNA. This ratio, when compared with normal values or determined at at least two points in time, shows the decline or increase of organelles per cell. Also is provided determining the ratio of organelle RNA to chromosome-encoded RNA. This ratio, when compared with normal values or determined at at least two points in time, shows the organelle transcription activity decline or increase per cell, normalized for the active state (i.e., transcription state) of the cell.
Determining the ratio of organelle RNA to chromosomal DNA is also provided. This ratio, when compared with normal values or determined at at least two points in time, shows the organelle transcription activity decline or increase per cell.
Determining the ratio of organelle DNA to organelle RNA is also provided. This ratio, when compared with normal values or determined at at least two points in time, shows the decline or increase of transcription in the organelle, indicating regulation at the transcriptional level to achieve a certain mRNA (and therefore protein) level.
Determining the ratio of organelle DNA to chromosome encoded RNA is also provided. This ratio, when compared with normal values or determined at at least two points in time, shows the decline or increase of transcription in the cell, in relation to chromosomal RNA transcription levels, indicating the activity state of the organelle, which is especially useful when chromosomal RNA is determined that encodes an organelle protein or other component thereof
Example 2Fibroblast cells were cultured in vitro in the presence of the antiviral drugs ddC, AZT and D4T at two concentrations each, 3 μM and 30 μM, respectively, for four weeks. As controls, cell cultures with ethidium bromide and without drugs were also performed. Ethidium bromide is known to deplete mitochondrial DNA completely from cells and is a positive control in terms of achieving an effect on the mitochondria content of cells. At one week intervals, part of the cells was harvested and analyzed for an amount of mitochondrial DNA (primers MtD p1 and MtD p2 and probe MtD mb) and chromosomal DNA (primers SnrpD p1 and SnrpD p2 and probe SnrpD mb) in the described NASBA protocol. The cultures with AZT, D4T and without additive showed no measurable change in mitochondrial DNA to chromosomal DNA ratio in the culture period of four weeks. The culture with ethidium bromide showed a decline in mitochondrial DNA content as expected. The results for ddC are shown in FIG. 2.
The data in FIG. 2 clearly show a decline in the amount of mitochondrial DNA per cell with more than two logs and therewith the mitochondrial toxicity of the antiviral drug ddC.
Example 3Fibroblast cells were cultured in vitro in the presence of the antiviral drugs ddC, AZT and D4T at two concentrations each, 3 μM and 30 μM, respectively, for four weeks. As controls, cell cultures with ethidium bromide and without drugs were also performed. Ethidium bromide is known to deplete mitochondrial DNA completely from cells and is a positive control in terms of achieving an effect on the mitochondria content of cells. At one week intervals, part of the cells was harvested and analyzed for an amount of mitochondrial RNA (primers MtR p1 and MtR p2 and probe MtR mb) and chromosome-encoded RNA (primers SnrpR p1 and SnrpR p2 and probe SnrpR mb) in the described NASBA protocol. The cultures with AZT, D4T and without additive showed no measurable change in mitochondrial RNA to chromosome-encoded RNA ratio in the culture period of four weeks. The culture with ethidium bromide showed a decline in mitochondrial RNA content as expected. The results for ddC are shown in FIG. 3. The data in FIG. 3 clearly show a decline in the amount of mitochondrial RNA per cell with at least two logs and therewith the mitochondrial toxicity of the antiviral drug ddC. The time point at three weeks has a very low value and presumably this is somewhat of an outlier measurement.
Example 4Fibroblast cells were cultured in vitro in the presence of the antiviral drugs ddc, AZT and D4T at two concentrations each, 3 μM and 30 μM, respectively, for four weeks. As controls, cell cultures with ethidium bromide and without drugs were also performed. Ethidium bromide is known to deplete mitochondrial DNA completely from cells and is a positive control in terms of achieving an effect on the mitochondria content of cells. At one week intervals, part of the cells was harvested and analyzed for an amount of mitochondrial RNA (primers MtR p1 and MtR p2 and probe MtR mb) and chromosomal DNA (primers SnrpD p1 and SnrpD p2 and probe SnrpD mb) in the described NASBA protocol.
The cultures with AZT, D4T and without additive showed no measurable change in mitochondrial RNA to chromosomal DNA ratio in the culture period of four weeks. The culture with ethidium bromide showed a decline in mitochondrial RNA content as expected. The results for ddC are shown in FIG. 4.
The data in FIG. 4 clearly show a decline in the amount of mitochondrial RNA per cell with almost three logs and therewith the mitochondrial toxicity of the antiviral drug ddC. The time point at three weeks has a very low value and presumably this is somewhat of an outlier measurement.
Example 5Fibroblast cells were cultured in vitro in the presence of the antiviral drugs ddC, AZT and D4T at two concentrations each, 3 μM and 30 μM, respectively, for four weeks. As controls, cell cultures with ethidium bromide and without drugs were also performed. Ethidium bromide is known to deplete mitochondrial DNA completely from cells and is a positive control in terms of achieving an effect on the mitochondria content of cells. At one week intervals, part of the cells was harvested and analyzed for an amount of mitochondrial RNA (primers MtR p1 and MtR p2 and probe MtR mb) and mitochondrial DNA (primers MtD p1 and MtD p2 and probe MtD mb) in the described NASBA protocol.
The cultures with AZT, D4T and without additive showed no measurable change in mitochondrial RNA to mitochondrial DNA ratio in the culture period of four weeks. The culture with ethidium bromide showed a decline in mitochondrial RNA and DNA content as expected. The results for ddC are shown in FIG. 5.
The data in FIG. 5 clearly show that the ratio of mitochondrial DNA to RNA is not significantly changing over the period of four weeks. The time point at three weeks in FIG. 5 has a low value for mitochondrial RNA that shows up; this measurement is presumably somewhat of an outlier measurement.
Example 6Fibroblast cells were cultured in vitro in the presence of the antiviral drugs ddC, AZT and D4T at two concentrations each, 3 μM and 30 μM, respectively, for four weeks. As controls, cell cultures with ethidium bromide and without drugs were also performed. Ethidium bromide is known to deplete mitochondrial DNA completely from cells and is a positive control in terms of achieving an effect on the mitochondria content of cells. At one-week intervals, part of the cells was harvested and analyzed for an amount of chromosome-encoded RNA primers SnrpR p1 and SnrpR p2 and probe SnrpR mb) and chromosomal DNA (primers SnrpD p1 and SnrpD p2 and probe SnrpD mb) in the described NASBA protocol.
The cultures with AZT, D4T, ethidium bromide and without additive showed no measurable change in ratio in the culture period of four weeks. The results for ddC are shown in FIG. 6.
The data in FIG. 6 clearly show that the ratio of chromosomal DNA to RNA is not significantly changing over the period of four weeks.
Example 7Fibroblast cells were cultured in vitro in the presence of the antiviral drug ddC at a concentration of 30 μM for four weeks. After that period, the cell culture continued but now in the absence of ddC. During this period of culture without ddC, part of the cells was harvested and analyzed for an amount of mitochondrial DNA (primers MtD p1 and MtD p2 and probe MtD mb) and chromosomal DNA (primers SnrpD p1 and SnrpD p2 and probe SnrpD mb) in the described NASBA protocol at two-week intervals for a period of twelve weeks. The results of the analysis are shown in FIG. 7.
The results in FIG. 7 clearly show that the amount of mitochondria per cell increases with more than two logs after ddC is removed from the culture. This result shows that the toxic effect of ddC can be reversed if there are still some mitochondria left in the cells to repopulate the new growing cells.
Example 8Fibroblast cells were cultured in vitro in the presence of the antiviral drug ddC at a concentration of 30 μM for four weeks. After that period, the cell culture continued but now in the absence of ddC. During this period of culture without ddC, part of the cells was harvested and analyzed for an amount of mitochondrial RNA (primers MtR p1 and MtR p2 and probe MtR mb) and chromosome-encoded RNA (primers SnrpR p1 and SnrpR p2 and probe SnrpR mb) in the described NASBA protocol at two-week intervals for a period of twelve weeks. The results of the analysis are shown in FIG. 8.
The results in FIG. 8 clearly show that the amount of mitochondrial RNA per cell increases with more than two logs after ddC is removed from the culture. This results shows that the toxic effect of ddC can be reversed and that the function of the mitochondria comes back as shown by synthesis of RNA and, subsequently, proteins.
Example 9Fresh peripheral blood mononuclear cells (PBMCs) from a healthy blood donor were cultured in vitro in the presence of the antiviral drugs ddC, AZT and D4T at two concentrations each, 6 μM and 60 μM, respectively, for five days. As controls, cell cultures with DMSO and without drugs were also performed. DMSO is part of the solvent in which the drugs are solubilized. After five days, the cells were harvested and analyzed for an amount of mitochondrial DNA (primers MtD p1 and MtD p2 and probe MtD mb) and chromosomal DNA (primers SnrpD p1 and SnrpD p2 and probe SnrpD mb) in the described NASBA protocol.
The cultures with AZT,. D4T, DMSO and without additive showed no measurable change in ratio in the culture period of five days. The results for ddC are shown in FIG. 9.
The results in FIG. 9 clearly show the decline in PBMCs of mitochondrial DNA per cell of more than one log during the five-day culture period.
Example 10Fresh peripheral blood mononuclear cells (PBMCs) from a healthy blood donor were cultured in vitro in the presence of the antiviral drugs ddC, AZT and D4T at two concentrations each, 6 μM and 60 μM, respectively, for five days. As controls, cell cultures with DMSO and without drugs were also performed. DMSO is part of the solvent in which the drugs are solubilized. After five days, the cells were harvested and analyzed for an amount of mitochondrial RNA (primers MtR p1 and MtR p2 and probe MtR mb) and chromosome-encoded RNA (primers SnrpR p1 and SnrpR p2 and probe SnrpR mb) in the described NASBA protocol.
The cultures with AZT, D4T, DMSO and without additive showed no measurable change in ratio in the culture period of five days. The results for ddC are shown in FIG. 10. Interestingly, the results in FIG. 10 do not clearly show a decline in PBMCs of mitochondrial RNA per cell during the five-day culture period at the highest concentration of ddC used. This is in contrast to the mitochondrial DNA as shown in Example 9. Probably the decline in mitochondrial DNA is compensated by an increase in transcription, maintaining the level of mitochondrial RNA. This mechanism delays the decline of mitochondrial RNA.
Consequently, one can say that the mitochondrial RNA is a reflection of the current status of the functionality of the mitochondria and that mitochondrial DNA is predictive of what will happen in the (near) future with the mitochondrial function and therefore has a more prognostic character.
Example 11Using the primers and probes Rubisco-DNA p1, Rubisco-DNA p2, Rubisco-DNA MB, Rubisco-RNA p1, Rubisco-RNA p2 and Rubisco-RNA-MB (Table 1), the chloroplast DNA and RNA of Oryza sativum (rice) can be quantified and the ratio to the chromosomal DNA and RNA can be determined by using primers and probes OryzaDNA p1, OryzaDNA p2, OryzaDNA mb, OryzaRNA p1, OryzaRNA p2, OryzaRNA mb (Table 1). During the application of herbicide (or other) compounds, the conditions of the plants can be assessed by measurement of the chloroplast nucleic acid content of the cells using amplification methods like PCR and NASBA that are known to persons skilled in the art. At the same time, using primer sets suitable for weeds, the deterioration of the unwanted plants can be monitored. It is clear that these molecular tools are very suited in the research for new herbicides that specifically attack one group of plants and not others.
Example 12In this example, the NASBA nucleic acid amplification reactions for DNA target sequences were performed in a 20 μl reaction volume and contained: 40 mM Tris-pH 8.5, 70 mM KCl, 12 mM MgCl2, 5 mM dithiotreitol, 1 mM dNTPs (each), 2 mM rNTPs (each), 0.2 μM primer (each), 0.05 μM molecular beacon, 1.5 units restriction enzyme Msp I, 375 mM sorbitol, 0.105 μg/μl bovine serum albumin, 6.4 units AMV RT, 32 units T7 RNA polymerase, 0.08 units RNAse H and input nucleic acid. The complete mixture, except the enzymes sorbitol and bovine serum albumin, was, prior to adding the enzyme mixture, incubated at 37° C. for 25 minutes and subsequently heated to 95° C. for two minutes in order to denature the DNA and to allow the primers to anneal. After cooling the mixture to 41° C., the enzyme mixture was added. The amplification took place at 41° C. for 90 minutes in a fluorimeter (CytoFluor 2000) and the fluorescent signal was measured every minute (using the filter set 530/25 nm and 485/30 nm). To achieve quantification, a dilution series of target sequence for a particular primer set was amplified and the time points at which the reactions became positive (the time to positivity, TTP) were plotted against the input amounts of nucleic acid. This way a calibration curve was created that could be used to read TTP values of reactions with unknown amounts of input and deduce the input amount. Fresh peripheral blood mononuclear cells (PBMCs) from a healthy blood donor were cultured in vitro for five days. After five days, the cells were harvested and analyzed for an amount of chromosomal DNA (primers SnrpD p1 and SnrpD2 p2 and probe SnrpD mb) with the described NASBA protocol in the chapter “Used ingredients and general methodology” and compared with the NASBA protocol as described in this example. As can be clearly seen in FIG. 11, the DNA NASBA reactions with pretreatment of restriction enzyme perform much better than without. The rationale for this observation is the direct extension from the Msp I created 3′ over the T7 promoter part of the p1 primer.
Example 13Using the primers and probes tRNA-L-D p1, tRNA-L-D p2, tRNA-L-D MB, petB RNA p1, petB RNA p2 and petB RNA MB (Table 1), the chloroplast DNA and RNA of Oryza Sativum (rice) can be quantified and the ratio to the chromosomal DNA and RNA can be determined by using primers and probes OryzaDNA p1, OryzaDNA p2, OryzaDNA mb, OryzaRNA p1, OryzaRNA p2, OryzaRNA mb (Table 1). During the application of herbicide (or other) compounds, the conditions of the plants can be assessed by measurement of the chloroplast nucleic acid content of the cells using amplification methods like PCR and NASBA that are known to persons skilled in the art. At the same time, using primer sets suitable for weeds, the deterioration of the unwanted plants can be monitored. It is clear that these molecular tools are very suited in the research for new herbicides that specifically attack one group of plants and not others.
Example 14A thousand molecules of plasmid containing Snrp DNA were mixed with 4×105, 2×105, 105, 5×104, 2.5×104, or 104 molecules of plasmid containing mitochondrial DNA, and the mixture was used as input for the reactions. A reaction mix was prepared similar to that of Example 12, except that primers and beacons differed in order to amplify Snrp-nuclear and mitochondrial DNA in one tube. The reaction mix (duplex-mix) contained two sets of primers and beacon: SnrpD p1 and SnrpD p2, and MtD p1—2 and MtD p2—2 (each 0.2 μM) with beacons SnrpD mb (ROX-labeled) and MtD mb—2 (FAM-labeled) (each 0.05 μM). Restriction enzyme digestion, amplification, and detection were performed as in Example 12. Filter sets of the fluorimeter (CytoFluor 2000) were adapted to simultaneously measure the FAM and the ROX-label (485/20 and 530/25 for FAM; 590/20 and 645/40 for ROX). In a duplex reaction with two competing amplifications, the ratio of the slope of the curves of fluorescence in time is proportional to the ratio of the amount of molecules of each amplified species (see FIG. 12).
Example 15PBMC were cultured in the absence and presence of 5 μM ddC. After five days, PBMC samples were drawn. Nucleic acids were isolated from 105 PBMC according to the method described by Boom et al. and dissolved in 50 μl DNAse-free and RNAse-free water. 1:10 and 1:100 dilutions were made, and 5 μl of the dilutions (equivalent to 1,000 or 100 PBMC, respectively) were put in the reaction mix to amplify the specific targets. In parallel, 103 molecules of plasmid containing Snrp DNA was mixed with 4×105, 2×105, 105, or 5×104 molecules of plasmid containing mitochondrial DNA, and the mixture was used as input for the reactions. A reaction mix was prepared similar to that of Example 12, except that primers and beacons differed in order to amplify Snrp-nuclear and mitochondrial DNA in one tube. The reaction mix (duplex-mix) contained two sets of primers and beacons: SnrpD p1 and SnrpD p2, and MtD p1—2 and MtD p2—2 (each 0.2 μM) with beacons SnrpD mb (ROX-labeled) and MtD mb—2 (FAM-labeled) (each 0.05 μM). Restriction enzyme digestion, amplification, and detection were performed as in Example 12. Filter sets of the fluorimeter (CytoFluor 2000) were adapted to simultaneously measure the FAM and the ROX-label (485/20 and 530/25 for FAM; 590/20 and 645/40 for ROX). In a duplex reaction with two competing amplifications, the ratio of the slope of the curves of fluorescence in time is proportional to the ratio of the amount of molecules of each amplified species. The data of the plasmid Snrp/mitochondrial DNA mixtures were used to create a standard curve on which the unknown ratio of mitochondrial to Snrp nuclear DNA of the PBMC samples in the dilutions 1:10 and 1:100 in the absence and presence of 5 μM ddC could be assessed (see FIG. 13).
Example 16From an HIV-1 infected patient that died as a result of severe lactic acidosis, four blood samples were analyzed for the mitochondrial content of the peripheral blood mononuclear cells (PBMC). Sample 1 was taken one year prior to the moment of death, sample 2 was taken three months before the moment of death, sample 3 was taken 1.5 months before the moment of death and sample 4 was taken just before death. The blood was used to prepare peripheral blood mononuclear cells (PBMC) by Ficoll-Isopaque purification. PBMC were viably frozen in medium plus 5% DMSO and stored in liquid nitrogen until use. Nucleic acids were extracted from 105 PBMC using the Boom method. Nucleic acids equivalent of 1,000 PBMC were used as input for the NASBA that measures mitochondrial DNA (primers MtD p1 and MtD p2 and probe MtD mb) and the NASBA that measures chromosomal DNA (primers SnrpD p1 and SnrpD p2 and probe SnrpD mb). See Table 1 for primer and probe sequences. The result of this assay is expressed as the mitochondrial DNA copies per chromosomal DNA copy (see FIG. 14).
Example 17Different ratios of mitochondrial and chromosomal DNA targets in plasmids were analyzed in this example: 2×103 U1a DNA/8×103 Mt DNA, 2×103 U1a DNA/2×104 MtDNA, 2×103 U1a DNA/4×104 Mt DNA, 2×103 U1a DNA/105 Mt DNA, 2×103 U1a DNA/2×105 Mt DNA, 2×103 U1a DNA/4×105 Mt DNA, and 2×103 U1a DNA/8×105 Mt DNA molecules were included. A reaction mix was prepared similar to that of Example 12, except that primers and beacons differed in order to amplify chromosomal and mitochondrial DNA in one tube. The reaction mix (duplex-mix) contained two sets of primers and beacons: SnrpD P1 and SnrpD2 P2 (first primer set, each 0.2 μM), and MtD P1—2 and MtD P2—2 (second primer set, each 0.3 μM) with beacons SnrpD mb—2 (FAM-labeled) and MtD mb—3 (ROX-labeled) (each 0.04 μM). See Table 1 for primer and, probe sequences. Restriction enzyme digestion, amplification, and detection were performed as in Example 12. Filter sets of the fluorimeter (CytoFluor 2000 or EasyQ analyzer) were adapted to simultaneously measure the FAM and the ROX-label (485/20 and 530/25 for FAM; 590/20 and 645/40 for ROX). In a duplex reaction with two competing amplifications, the ratio of the slope of the curves of fluorescence in time is proportional to the ratio of the amount of molecules of each amplified species. The results are shown in FIG. 16. The relation between the ratio of the slopes of FAM and ROX signal is linear to the ratio of mitochondrial DNA and chromosomal DNA in the input. This result can be used to generate a calibration curve and the number of mitochondrial DNA copies per cell can be calculated from this standard calibration curve.
Example 18Fibroblasts were cultured in the presence of the anti-retroviral drug ddC. (30 μM) for four weeks. After that period, the cell culture continued in the presence, but also in the absence, of ddC for another six weeks. During this period of culture, part of the cells were harvested and analyzed for the ratio of lactate-pyruvate using standard methods known by persons skilled in the art. The results of the lactate-pyruvate ratio measurements are shown in FIG. 17.
The data in FIG. 17 clearly show that in the presence of ddC, the lactate pyruvate ratio increases, but significant increase can only be observed after four weeks of culture. During continued culture in the presence of ddC, the lactate-pyruvate ratio remains high; however, in continued culture after week four in the absence of ddC, the lactate-pyruvate ratio drops to normal levels.
Furthermore, the same samples were used to determine the ratio of mitochondrial DNA and chromosomal DNA as described in Example 17. The results are shown in FIG. 18.
The data in FIG. 18 clearly show that in the presence of ddC, the fibroblasts lose their mitochondrial DNA (decline of the black line in top panels). A significant decrease in the mitochondrial DNA content can already be observed after two weeks and hardly any mitochondrial DNA can be observed after three weeks of culture in the presence of ddC. These data are in contrast to the traditional lactate-pyruvate measurements where a significant change could only be observed after four weeks. These results clearly show the predictive value of measurement of mitochondrial DNA content for effects on functionality in time.
In the continued culture in the presence of ddC, the amount of mitochondrial DNA remains very low (bottom left two panels). Continued culture in the absence of ddC shows a clear rebound in the amount of mitochondrial DNA in the fibroblasts (bottom right two panels).
Example 19PBMCs were cultured in the presence of the anti-retroviral drug ddC (5 μM) and with a corresponding concentration of the solvent (DMSO) of the drug as a control for eleven days. During this period of culture, every two days, part of the cells were harvested and analyzed for the ratio of mitochondrial DNA and U1a DNA as described in Example 17. The results are shown in FIG. 19.
The data of this experiment clearly show that the mitochondrial DNA content of PBMC in culture in the presence of ddC rapidly declines. At day two, the mitochondrial DNA content of PBMC cultured in the presence of ddC has decreased to 20%, compared to control cultures. The number or mitochondrial DNA copies in PBMC further declines to undetectable levels at day eleven of the culture in the presence of ddC.
Example 20Forty-eight HIV-1 infected patients were randomized for antiviral therapy with either AZT, AZT+ddI, or AZT+ddC. Blood was drawn at week 0, 4, 24, and 48 after the start of therapy. The blood was used to prepare peripheral blood mononuclear cells (PBMC) by Ficoll-Isopaque purification. PBMC were viably frozen in medium plus 5% DMSO and stored in liquid nitrogen until use.
Nucleic acids were extracted from 105 PBMC using the Boom method. Nucleic acids equivalent of 1,000 PBMC were used as input for the one-tube real-time duplex-NASBA that measures both mitochondrial and chromosomal DNA as described in Example 17. The result of this assay is expressed as the mitochondrial DNA content per cell (i.e., PBMC) of the patient sample. The results are summarized in Table 2.
The mtDNA content of the PBMC of the patients at start of therapy was compared to the mtDNA content at week 4, 24, and 48 and analyzed for statistically significant changes (see Table 3 and FIGS. 20 and 21). The data clearly show that patients undergoing therapy containing AZT+ddI or ddC experience a significant decline in the mitochondrial DNA content of their PBMC.
Example 21Different ratios of mitochondrial RNA target and chromosomal DNA target in a plasmid were analyzed in this example: 2×103 U1a DNA/5×104 Mt RNA, 2×103 U1a DNA/2.5×105 Mt RNA, 2×103 U1a DNA/5×105 Mt RNA, 2×103 U1a DNA/2.5×106 Mt RNA, 2×103 U1a DNA/5×106 Mt RNA, 2×103 U1a DNA/107 Mt RNA, 2×103 U1a DNA/2.5×107 Mt RNA molecules were included. A reaction mix was prepared similar to that of Example 12, except that primers and beacons differed in order to amplify chromosomal DNA and mitochondrial RNA in one tube. The reaction mix (duplex-mix) contained two sets of primers and beacons: SnrpD P1 and SnrpD2 P2 (first primer set, each 0.1 μM) and MtR P1—2 and MtR P2—2 (first primer set, each 0.4 μM) with beacons SnrpD mb (ROX-labeled) and MtR mb (FAM-labeled) (each 0.04 μM). See Table 1 for primer and probe sequences. Restriction enzyme digestion, amplification, and detection were performed as in Example 12. Filter sets of the fluorimeter (CytoFluor 2000 or EasyQ) were adapted to simultaneously measure the FAM and the ROX-label (485/20 and 530/25 for FAM; 590/20 and 645/40 for ROX). In a duplex reaction with two competing amplifications, the ratio of the slope of the curves of fluorescence in time is proportional to the ratio of the amount of molecules of each amplified species. The results are shown in FIG. 22. The relation between the ratio of the slopes of FAM and ROX signal is linear to the ratio of mitochondrial RNA and chromosomal DNA in the input. This result can be used to generate a calibration curve and the number of mitochondrial RNA copies per cell can be calculated from this standard calibration curve.
Example 22Fibroblasts were cultured in the presence of the anti-retroviral drug ddC (30 μM) for eight weeks. After that period, the cell culture continued in the presence, but also in the absence, of ddC for another eight weeks. During this period of culture, part of the cells were harvested at different time points and analyzed for the ratio of mitochondrial RNA and chromosomal DNA as described in Example 21. The results are shown in FIG. 23.
The data in FIG. 23 clearly show that in the presence of ddC, the fibroblasts lose their mitochondrial RNA. In the continued culture in the presence of ddC, the amount of mitochondrial RNA remains very low. Continued culture in the absence of ddC shows a clear rebound in the amount of mitochondrial RNA in the fibroblasts (week 10, 12, 14 and 16 time points).
Example 23Two HIV-1 infected patients (patients 1 and 2) treated with antiviral therapy (AZT+ddI) were analyzed for the mitochondrial RNA content in their PBMC. Blood was drawn at week 0, 4, 24, and 48 after the start of therapy. The blood was used to prepare peripheral blood mononuclear cells (PBMC) by Ficoll-Isopaque purification. PBMC were viably frozen in medium plus 5% DMSO and stored in liquid nitrogen until use.
Nucleic acids were extracted from 105 PBMC using the Boom method. Nucleic acids equivalent of 1,000 PBMC were used as input for the one-tube real-time duplex-NASBA that measures both mitochondrial RNA and chromosomal DNA as described in Example 21. The result of this assay is expressed as the mitochondrial RNA content per cell (i.e., PBMC) of the patient sample. The results are summarized in Table 4.
The mitochondrial RNA content of the PBMC of the patients 1 and 2 does not seem to vary significantly in the time of this study and with the therapies (drugs and doses) applied. The current study will be expanded to encompass more individuals and different therapies to get an even better assessment of the changes in mitochondrial RNA caused by therapies encompassing nucleoside analogues.
| Table 1 |
| Sequences of primers and probes used in the examples. |
| Name | Sequence1 | Sequence ID No. |
| MtD p1 | 5′AATTCTAATACGACTCACTATAGGGAGAAGAGCCGT | (SEQ ID NO:1) | |
| TGAGTTGTGGTA 3′ | |||
| MtD p2 | 5′TCTCCATCTATTGATGAGGGTCTTA 3′ | (SEQ ID NO:2) | |
| MtD mb | 5′GCATGCCCCTCCTAGCCTTACTACTAATGCATGC | (SEQ ID NO:3) | |
| MtD p1_2 | AAT TCT AAT ACG ACT CAC TAT AGG GAA GAA CCG | (SEQ ID NO:4) | |
| GGC TCT GCC ATC TTA A | |||
| MtD p2_2 | GTA ATC CAG GTC GGT TTC TA | (SEQ ID NO:5) | |
| MtD mb_2 | GGA CCC CCC ACA CCC ACC CAA GAA GAG GGT CC | (SEQ ID NO:6) | |
| SnrpD p1 | 5′AATTCTAATACGACTCACTATAGGGAGAGGCCCGGC | (SEQ ID NO:7) | |
| ATGTGGTGCATAA 3′ | |||
| SnrpD p2 | 5′TTCCTTACATCTCTCACCCGCTA 3′ | (SEQ ID NO:8) | |
| SnrpD mb | 5′GCATGCTGTAACCACGCACTCTCCTCGCATGC 3′ | (SEQ ID NO:9) | |
| SnrpD2 p2 | 5′TGCGCCTCTTTCTGGGTGTT 3′ | (SEQ ID NO:10) | |
| MtR p1 | 5′AATTCTAATACGACTCACTATAGGGAGGAGAAGATG | (SEQ ID NO:11) | |
| GTTAGCTCTAC 3′ | |||
| MtR p2 | 5′CGATATGGCGTTCCCCCGCATAAA 3′ | (SEQ ID NO:12) | |
| MtR mb | 5′GCTCCG AAGCTTCTGACTCTTACCTCCC CGGAGC 3′ | (SEQ ID NO:13) | |
| MtR p1_2 | AAT TCT AAT ACG ACT CAC TAT AGG GAG AGG AGA | (SEQ ID NO:14) | |
| CAC CTG CTA GGT GT | |||
| MtR pl_3 | AAT TCT AAT ACG ACT CAC TAT AGG GAG AAG GGT | (SEQ ID NO:15) | |
| AGA CTG TTC AAC CTG TT | |||
| MtR p2_2 | GGT GCC CCC GAT ATG GCG TTC C | (SEQ ID NO:16) | |
| MtR p2_3 | GTA ATA ATC TTC TTC ATA GTA A | (SEQ ID NO:17) | |
| SnrpR p1 | 5′AATTCTAATACGACTCACTATAGGGAGAGGCCCG | (SEQ ID NO:18) | |
| GCATGTGGTGCATAA 3′ | |||
| SnrpR p2 | 5′CAGTATGCCAAGACCGACTCAGA 3′ | (SEQ ID NO:19) | |
| SnrpR mb | 5′CGTACGAGAAGAGGAAGCCCAAGAGCCACGTACG3′ | (SEQ ID NO:20) | |
| SnrpR p1_2 | AAT TCT AAT ACG ACT CAC TAT AGG GA GAA GAA | (SEQ ID NO:21) | |
| GAT GAC AAA GGC CTG GCC | |||
| SnrnpR p1_3 | AAT TCT AAT ACG ACT CAC TAT AGG GA GAA AAA | (SEQ ID NO:22) | |
| GGC CTG GCC CCT CAT CTT | |||
| SnrnpR p2_2 | TCC ATG GCA GTT CCC GAG A | (SEQ ID NO:23) | |
| SnrnpR p2_3 | CAC TAT TTA TAT CAA CAA CC | (SEQ ID NO:24) | |
| SnrnpR p2_4 | TCA ATG AGA AGA TCA AGA A | (SEQ ID NO:25) | |
| SnrnpR mb_2 | CGA TCG AGT CCC TGT ACG CCA TCT TC CGA TCG | (SEQ ID NO:26) | |
| Rubisco-DNA p1 | 5′AATTCTAATACGACTCACTATAGGGGGATAATTTCAT | (SEQ ID NO:27) | |
| TACCTTCACGAG 3′ | |||
| Rubisco-DNA p2 | 5′GGAGTCCTGAACTAGCCGCAG 3′ | (SEQ ID NO:28) | |
| Rubisco-DNA MB | 5′GCATGCGGTAGATAAACTAGATAGCTAGGCATGC3′ | (SEQ ID NO:29) | |
| Rubisco-RNA p1 | 5′AATTCTAATACGACTCACTATAGGGGAGTTGTTGTTA | (SEQ ID NO:30) | |
| TTGTAAGTC 3′ | |||
| Rubisco-RNA p2 | 5′CAAGTCTTATGAATTCCTATAG 3′ | (SEQ ID NO:31) | |
| Rubisco-RNA-MB | 5′GCTAGCACACAGGGTGTACCCATTATGCTAGC 3′ | (SEQ ID NO:32) | |
| OryzaDNA p1 | 5′AATTCTAATACGACTCACTATAGGGGGATCTTAATTA | (SEQ ID NO:33) | |
| CATGCCGTTCA 3′ | |||
| OryzaDNA p2 | 5′AAAGGTGCCGGTTCTCACTA 3′ | (SEQ ID NO:34) | |
| OryzaDNA mb | 5′GCTAGCCTCTGCAAGCTTCATCAGTAATAGGCTA | (SEQ ID NO:35) | |
| GC 3′ | |||
| OryzaRNA p1 | 5′AATTCTAATACGACTCACTATAGGGGCTAATGCCCTT | (SEQ ID NO:36) | |
| TTCTTTTCTTCCTC 3′ | |||
| OryzaRNA p2 | 5′CATATTGGCT TTCGAAGATT 3′ | (SEQ ID NO:37) | |
| OryzaRNA mb | 5′GCTAGCCTTCAGCCATTATTCAAGAT | (SEQ ID NO:38) | |
| GGTGGCTAGC 3′ | |||
| tRNA-L-D p1 | 5′AATTCTAATACGACTCACTATAGGGGGGTTCTAGTTC | (SEQ ID NO:39) | |
| GAGAACCGCTTG 3′ | |||
| tRNA-L-D p2 | 5′GCGAAATCGGTAGACGCTACG 3′ | (SEQ ID NO:40) | |
| tRNA-L-D MB | 5′GCTAGCCAACTTCCAAATTCAGAGAAGCTAGC 3′ | (SEQ ID NO:41) | |
| petB RNA p1 | 5′AATTCTAATACGACTCACTATAGGGAAACCGGTA | (SEQ ID NO:42) | |
| GCAACTTGTACTAG 3′ | |||
| petB RNA p2 | 5′GGTTTCGGTATCTCTGGAATATGAG 3′ | (SEQ ID NO:43) | |
| petB RNA MB | 5′GCTAGCGAGGAACGTCTTGAGATTCAGCTAGC 3′ | (SEQ ID NO:44) | |
| SnrnpD mb_2 | CGCATGC TGTAACCACGCACTCTCCTC GCATGCG | (SEQ ID NO:45) | |
| MtD mb_3 | CGTACG TGATATCATCTCAACTTAGTAT CGTACG | (SEQ ID NO:46) | |
1 The T7 promoter part of primer p1 sequences is shown in italics, the stem sequences of the molecular beacon probes are shown in bold. The molecular beacon sequences were labeled at the 3′end with DABCYL (the quencher) and at the 5′end with 6-FAM (the fluorescent label). |
| TABLE 2 |
| Mitochondrial DNA content in PBMC of patients undergoing |
| different therapy regimens during 48 week follow up. |
| Week | Median | Interquartiles range; | |
| AZT | 0 | 196 | 111-252 | |
| 4 | 157 | 103-191 | ||
| 24 | 182 | 123-224 | ||
| 48 | 155 | 110-224 | ||
| AZT/ddI | 0 | 174 | 150-243 | |
| 4 | 126 | 89-235 | ||
| 24 | 93 | 42-200 | ||
| 48 | 112 | 66-170 | ||
| AZT/ddC | 0 | 132 | 83-200 | |
| 4 | 48 | 36-76 | ||
| 24 | 68 | 29-107 | ||
| 48 | 74 | 51-83 | ||
| TABLE 3 |
| Analysis of significant changes in mitochondrial DNA content |
| of PBMC of patients undergoing different regimens of therapy |
| Antiviral drugs | Week | % decrease | p-value | |
| AZT | 4 | 11% | 0.22 | |
| 24 | 1% | 0.80 | ||
| 48 | 5% | 0.55 | ||
| AZT + ddI | 4 | 13% | 0.04 | |
| 24 | 24% | 0.09 | ||
| 48 | 16% | 0.02 | ||
| AZT + ddC | 4 | 22% | 0.002 | |
| 24 | 22% | 0.06 | ||
| 48 | 25% | 0.04 | ||
| TABLE 4 |
| Mitochondrial RNA content in PBMC of patients undergoing |
| different therapy regimens during 48 week follow up. |
| Week | Patient 1 | Patient 2 |
| 0 | 632 | 680 |
| 4 | 1482 | 605 |
| 24 | 516 | 1106 |
| 48 | 448 | not valid |
| TABLE 5 |
| Mitochondrial toxicities of nucleoside and nucleotide analogue HIV-1 RT-inhibitors. |
| From: A. Carr, DA Cooper, Lancet 2000; 356: 1423-1430. |
| Affected | Laboratory | |||
| organ | Clinical features | features | Rate (%) | Drug(s) |
| Muscle | Fatigue, myalgia, | Creatine | 17 | AZT |
| proximal weakness, | kinase ↑ | |||
| wasting | ||||
| Heart | Dilated cardio-myopathy | Rare | AZT | |
| Nerve | Distal pain, numbness, | 10-30 | ddC = d4T > | |
| paraesthesia, reduced, | ddI > 3TC | |||
| reflexes/power | ||||
| Liver | Hepatomegaly, nausea, | Lactic acidosis | <1 | All except, |
| ascites, oedema, dyspnea, | Serum lactate ↑ | 3TC, ABC | ||
| encephalopathy | Liver enzymes ↑ | |||
| Anion gap ↓ | ||||
| Bicarbonate ↑ | ||||
| Pancreas | Abdominal pain | Amylase | <1-6 | ddI > 3TC/ddC |
| Fat | Peripheral atrophy | 50 | d4T > others | |
| Lipodystrophy | ||||
1. Saiki, R. K.; Gelfand, D. H.; Stoffel, S.; Scharf, S. J.; Higuchi, R.; Horn, G. T.; Mullis, K. B.; Erlich, H. A.: Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487-491, 1988.
2. Van Gemen, B.; van Beuningen, R.; Nabbe, A.; Van Strijp, D.; Jurriaans, S.; Lens, P.; Kievits, T.: A one-tube quantitative HIV-1 RNA NASBA nucleic acid amplification assay using electrochemiluminescent (ECL) labeled probes. J. Virol. Methods 49:157-167, 1994.
3. Heid, C. A.; Stevens, J.; Livak, K. J.; Williams, P. M.: Real time quantitative PCR. Genome Res. 6:986-994, 1996.
4. Tyagi, S.; Kramer, F. R.: Molecular beacons: probes that fluoresce upon hybridization. Nat. Biotechnol. 14:303-308, 1996.
5. Leone, G.; van Schijndel, H.; Van Gemen, B.; Kramer, F. R.; Schoen, C. D.: Molecular beacon probes combined with amplification by NASBA enable homogeneous, real-time detection of RNA. Nucleic Acids Res. 26:2150-2155, 1998.
6. Piatak, M.; Luk, K. C.; Williams, B.; Lifson, J. D.: Quantitative competitive polymerase chain reaction for accurate quantitation of HIV DNA and RNA species. Biotechniques 14:70-81, 1993.
7. De Baar, M. P.; van Dooren, M. W.; de Rooij, E.; Bakker, M.; Van Gemen, B.; Goudsmit, J.; and de Ronde, A.: Single rapid real-time monitored isothermal RNA amplification assay for quantification of HIV-1 isolates from group M, N, and O. J. Clin. Microbiol. 39(4):1378-1384, 2001.
8. Boom, R.; Sol, C. J.; Salimans, M. M.; Jansen, C. L.; Wertheim-van Dillen, P. M.; van der, N. J.: Rapid and simple method for purification of nucleic acids. J. Clin. Microbiol. 28:495-503, 1990.
1. A method for determining whether an organism has a disease, comprising:
obtaining a sample from the organism; and
determining a relative ratio of a first indicator to a second indicator, wherein the first indicator and second indicator are derived from said sample and comprise endosymbiont cellular organelle molecules selected from the group consisting of DNA, RNA, and protein, and wherein said relative ratio is indicative of the presence or absence of a disease.
2. The method according to claim 1, wherein said first indicator comprises DNA and said second indicator comprises a transcription product of said first indicator.
3. The method according to claim 1, wherein said relative ratio is compared to a reference curve, said comparison being indicative of the presence or absence of a disease.
4. The method according to claim 1, further comprising:
amplifying an endosymbiont cellular organelle nucleic acid.
5. The method according to claim 1, wherein said first sample comprises peripheral blood mononuclear cells, fibroblasts, or combinations thereof.
6. The method according to claim 1, wherein said first indicator and said second indicator are comprised of mitochondrial molecules selected from the group consisting of DNA, RNA, and protein.
7. The method according to claim 1, wherein said relative ratio is indicative of exposure of said organism to a chemical compound.
8. The method according to claim 1, wherein said first indicator and said second indicator comprise nuclear endosymbiont cellular organelle molecules selected from the group consisting of DNA, RNA, and protein.
9. The method according to claim 1, wherein said first indicator and said second indicator comprise endosymbiont cellular organelle molecules selected from the group consisting of DNA, RNA, protein, and small nuclear ribonucleoprotein RNA or DNA sequences or fragments thereof.
10. The method according to claim 1, wherein said relative ratio is determined in a single assay.
11. The method according to claim 1, further comprising:
obtaining a second sample from said organism, wherein said second sample is taken after said first sample;
determining a second relative ratio of said first indicator to said second indicator; and
comparing said first relative ratio to said second relative ratio, wherein said comparison is indicative of progression of a disease.
12. A diagnostic kit for performing the method of claim 1, comprising:
a means for detecting said first indicator and said second indicator, said means comprising at least one primer or probe.
13. The kit of claim 12, wherein said at least one primer or probe is listed in Table 1.
14. The kit according to claim 12, further comprising:
at least one primer or probe capable of specifically amplifying a second nucleic acid.
15. A method of determining whether a medicament has therapeutic activity and/or possible side-effects, said method comprising:
obtaining a sample from an organism;
determining a first relative ratio of a first DNA molecule, RNA molecule or gene product thereof of an endosymbiont cellular organelle derived from said sample to any second DNA molecule, RNA molecule or gene product thereof derived from said sample;
introducing a medicament to said organism;
determining a second relative ratio of said first DNA molecule, RNA molecule or gene product thereof to said second DNA molecule, RNA molecule or gene product thereof; and
determining whether there is a difference between said first relative ratio and said second relative ratio, wherein said difference is indicative of a therapeutic activity and/or a side-effect of the medicament.
16. The method according to claim 15, wherein said medicament is administered for about three months.
17. The method according to claim 15, wherein said medicament is useful for treatment of a chronic disease, an HIV-related disease, a tumor-related disease, or any combination thereof.
18. The method according to claim 15, wherein said medicament is selected from the group consisting of: a nucleoside analogue, a nucleotide analogue, fludarabine, mercaptopurine, tioguanine, cytarabine, flurouracil, gemcyatbine, AZT, ddI, ddC, d4T, 3TC, tenofofir, a cytostaticum, an alkylating compound, an antimitotoxic an antitumor antibioticum, a topoisomerase inhibitor, chlorambucil, cyclofosfamide, estramustine, ifosamide, melfalanthiotepabusulfan, treosulfancarmustne, lomustinecisplatine, carboplatine, oxaliplatinedacarbazine, procarbazine, temozolomide vinblastine, vincristine, vindesinedocetaxel, paclitaxel, daunorubicine, doxorubicine, epirubicine, idarubicine, mitoxanthrobleomycine, dactinomycine, mitomycineirinotecan, topotecanetoposide, teniposide amsacrine, asparaginase, cladribine, hydroxycarbamide, pentostatine methotrexate, and raltitrexed.
19. A method for measuring the selectivity of a chemical compound for one or more organisms, said method comprising:
obtaining a first sample from a first organism;
determining a first relative ratio of a first indicator to a second indicator, wherein the first indicator and the second indicator are derived from said first sample and comprise endosymbiont cellular organelle molecules selected from the group consisting of: DNA, RNA and protein;
exposing said first organism to a chemical compound;
determining whether there is a change in the relative ratio before, during and/or after exposure of said first organism to said chemical compound;
obtaining a second sample from a second organism;
determining a second relative ratio of a third indicator to a fourth indicator, wherein the third indicator and the fourth indicator are derived from said second sample and comprise endosymbiont cellular organelle molecules selected from the group consisting of: DNA, RNA and protein;
exposing said second organism to said chemical compound;
determining whether there is a change in the relative ratio before, during and/or after exposure of said second organism to said chemical compound;
determining whether there is a difference between said first and said second organisms' relative ratios during and/or after exposure to said chemical compound, wherein the difference is indicative of selectivity of said chemical compound for one or more organisms.
20. The method according to claim 19, wherein the first organism comprises a host and the second organism comprises a pathogen.
21. The method according to claim 19, wherein the first organism comprises a plant and the second organism comprises a weed.
22. The method according to clam 19, wherein the first organism comprises a non-cancerous cell and the second organism comprises a cancer cell.
23. A selective chemical compound identified by the method according to claim 19.