Novel gene and protein encoded by the gene
US20060063152A1
2006-03-23
10/204,639
2001-12-20
Abstract:
Novel DNAs containing the regions which encode proteins have been directly cloned from cDNA libraries derived from the human adult whole brain, the human adult hippocampus and the human embryonic whole brain, the nucleotide sequences thereof have been determined, and their functions have been identified. The present invention provides DNA which comprises the nucleotide sequence encoding the following polypeptide (a) or (b): (a) a polypeptide comprising an amino acid sequence which is identical or substantially identical to an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70; (b) a polypeptide comprising an amino acid sequence derived from the amino acid sequence represented by any one of SEQ ID NOS: 1 to 70 by deletion, substitution or addition of a section of amino acids, and having biological activity which is substantially the same characteristic with the function of the polypeptide of (a); a recombinant polypeptide, which is encoded by the above DNA; and a protein containing the polypeptide.
Inventors:
- Osamu OHARA 19 🇯🇵 Chiba, Japan
- Takahiro Nagase 17 🇯🇵 Chiba, Japan
- Daisuke Nakajima 4 🇯🇵 Chiba, Japan
Interested in similar patents?
Get notified when new applications in this technology area are published.
Classification:
A61P13/08 » CPC further
Drugs for disorders of the urinary system of the prostate
A61P15/00 » CPC further
Drugs for genital or sexual disorders ; Contraceptives
A61P35/00 » CPC further
Antineoplastic agents
A61K2039/505 » CPC further
Medicinal preparations containing antigens or antibodies comprising antibodies
C12Q1/68 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids
C07H21/02 IPC
Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical
C12P21/06 IPC
Preparation of peptides or proteins produced by the hydrolysis of a peptide bond, e.g. hydrolysate products
C12M1/34 IPC
Apparatus for enzymology or microbiology Measuring or testing with condition measuring or sensing means, e.g. colony counters
C07K14/47 » CPC main
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
C07K16/18 IPC
Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
Description
TECHNICAL FIELDThe present invention relates to DNA and a gene containing the DNA, and a recombinant polypeptide encoded by the DNA and a novel recombinant protein containing the polypeptide.
BACKGROUND ARTAn enormous amount of information on the nucleotide sequence of the human genome has been obtained by large-scale sequencing in the Human Genome Project and analysis of the information is continuing on a daily basis.
The ultimate goal of the Human Genome Project is not just simple determination of the entire nucleotide sequence of the genome, but also the elucidation of various human life phenomena based on the structural information, that is the nucleotide sequence information of DNA.
Only limited regions of the human genome sequence encode proteins. Currently, the coding regions are predicted by the neural network or an information science technique, called the Hidden Markov Model. However, these models' predictive abilities are not yet sufficiently reliable.
DISCLOSURE OF THE INVENTIONFor the purpose of finding novel genes, we have completed the present invention by succeeding in directly cloning novel DNAs comprising regions that encode proteins from cDNA libraries derived from the human adult whole brain, the human adult hippocampus and the human embryonic whole brain, and determining the nucleotide sequences thereof.
In a first embodiment, the present invention relates to DNA comprising a nucleotide sequence encoding the following (a) or (b):
- (a) a polypeptide consisting of an amino acid sequence which is identical or substantially identical to an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70;
- (b) a polypeptide consisting of an amino acid sequence derived from an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70 by deletion, substitution or addition of a section of amino acid(s), and having biological activity which is substantially the same characteristic with the function of the polypeptide of (a). Examples of such DNA include, but are not limited to, DNAs comprising the nucleotide sequences of SEQ ID NOS: 71 to 140.
In a second embodiment, the present invention further relates to a DNA hybridizing to the DNA of the first embodiment of the present invention under stringent conditions, and encoding a polypeptide having biological activity which is substantially the same characteristic with the function of the polypeptide of (a) above.
Hereinafter, the DNAs of the first and the second embodiments of the present invention are together referred to as “the DNA of the present invention.” Further, the present invention also relates to antisense DNA comprising a nucleotide sequence which is substantially complementary to the DNA of the present invention.
In a third embodiment, the present invention relates to a gene construct containing the DNA of the present invention. The term “gene construct” in the present specification refers to every artificially-engineered gene. Examples of the gene construct include, but are not limited to, a vector containing the DNA of the present invention or the antisense DNA of the DNA of the present invention, and an expression vector of the DNA of the present invention.
In a fourth embodiment, the present invention relates to the following (a) or (b):
- (a) a polypeptide, consisting of an amino acid sequence which is identical or substantially identical to an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70;
- (b) a polypeptide, consisting of an amino acid sequence derived from the amino acid sequence represented by any one of SEQ ID NOS: 1 to 70 by deletion, substitution or addition of a section of amino acids, and having biological activity which is substantially the same characteristic with the function of the polypeptide of (a).
In a fifth embodiment, the present invention relates to a recombinant polypeptide encoded by the gene construct of the third embodiment of the present invention.
Hereinafter, the above polypeptides are together also referred to as “the polypeptide of the present invention.” The term “polypeptide” in the present specification refers to “polymers of amino acids having every molecular weight.” The present invention also relates to a recombinant protein containing the polypeptide of the present invention. As defined above, in the present specification the term “polypeptide” is not to be limited by molecular weight, and therefore the term “the polypeptide of the present invention” also includes a recombinant protein containing the polypeptide of the present invention.
In a sixth embodiment, the present invention relates to an antibody against the polypeptide of the present invention.
In a seventh embodiment, the present invention relates to a DNA chip on which the DNAs of the present invention are arrayed.
In an eighth embodiment, the present invention relates to a polypeptide chip on which the polypeptides of the present invention are arrayed.
In a ninth embodiment, the present invention relates to an antibody chip on which the antibodies of the sixth embodiment of the present invention are arrayed.
Table 1 shows the names of clones having the DNA of the present invention, lengths of the polypeptide of the present invention, their putative functions and grounds for prediction.
The DNAs of the present invention are identified by determining the nucleotide sequences after isolating them as cDNA fragments from cDNA libraries that we have prepared using as a starter material the commercially available (Clontech) mRNA of human adult whole brain, the human adult hippocampus and the human embryonic whole brain.
Specifically, clones are randomly isolated from cDNA libraries derived from the human adult whole brain, the human adult hippocampus and the human embryonic whole brain prepared according to the method of Ohara et al. (DNA Research 4:53-59 (1997)).
Next, redundant clones (clones containing the same sequences) are removed by hybridization, followed by in vitro transcription and translation. Both termini of its nucleotide sequence are determined for a clone that has been confirmed to have products of 50 kDa or more.
Homology searches are performed with databases of known genes using the thus obtained terminal nucleotide sequences as queries. As a result, the full-length nucleotide sequence of a clone that is shown to be new is determined.
As described above, unknown genes that cannot be obtained by standard cloning techniques, which rely on known genes, can now be cloned systematically.
Further, the entire region of a human-derived gene containing the DNA of the present invention can also be prepared by a PCR method, such as RACE, while exercising proper care so as not to cause short fragments or any artificial mistakes in obtained sequences.
Furthermore, the present invention provides a recombinant vector which comprises the DNA of the present invention or a gene construct containing the DNA of the present invention; a transformant retaining the recombinant vector; a method for producing the polypeptide of the present invention or a recombinant protein containing the polypeptide, or salts thereof, which comprises the steps of culturing the transformant, producing and accumulating the polypeptide of the present invention or the recombinant protein containing the polypeptide, and collecting these products; and the thus produced polypeptide of the present invention or the recombinant protein containing the polypeptide, or salts thereof.
The present invention also relates to a pharmaceutical preparation comprising the DNA of the present invention or the gene construct; a pharmaceutical preparation comprising a polynucleotide (DNA) comprising a nucleotide sequence which encodes the polypeptide of the present invention or a partial polypeptide thereof, or a recombinant protein containing the polypeptides, an antisense nucleotide comprising a nucleotide sequence substantially complementary to the nucleotide sequence which encodes the polypeptide of the present invention or a partial polypeptide thereof, or a recombinant protein containing the polypeptides; a pharmaceutical preparation comprising the polynucleotide of the present invention and the antisense nucleotide , and a pharmaceutical preparation comprising the polypeptide of the present invention or a partial polypeptide thereof, and a recombinant protein containing the polypeptides.
The present invention further relates to a DNA chip, a peptide chip and an antibody chip that are prepared by arraying the DNAs of the present invention, the polypeptides of the present invention and the antibodies against the polypeptide of the present invention, respectively.
The present invention further relates to an antibody against the polypeptide of the present invention or a partial polypeptide thereof or a recombinant protein containing the polypeptides, or against salts thereof, and a method for screening a substance which specifically interacts with the polypeptide of the present invention by using the polypeptide of the present invention, a partial polypeptide thereof or a recombinant protein containing the polypeptides, or salts thereof, or antibodies against these substances; a kit for screening; and the substance (compound) itself which is identified by the screening method.
Any DNA can be used as the DNA of the present invention, so far as it comprises a nucleotide sequence encoding the above-mentioned polypeptide of the present invention. Further, the DNA of the present invention may be cDNA identified and isolated from cDNA libraries or the like derived from the human brain, from cells or tissues other than the brain, such as the heart, lung, liver, spleen, kidney, and testicle, or synthetic DNA.
A vector used for constructing libraries may be a bacteriophage, a plasmid, a cosmid, or a phagemid. In addition, using total RNA fractions or mRNA fractions prepared from the above cells or tissues, amplification can be performed directly by a reverse transcriptase-polymerase chain reaction (hereinafter, abbreviated as “RT-PCR method.”).
Any antisense DNA may be used as an antisense oligonucleotide (DNA) having a nucleotide sequence substantially complementary to the DNA that encodes the polypeptide of the present invention or a partial polypeptide thereof, so far as it comprises a nucleotide sequence substantially complementary to the nucleotide sequence of the DNA, and is capable of inhibiting the expression of the DNA. A substantially complementary sequence is, for example, a nucleotide sequence having preferably about 90% or more, more preferably about 95% or more, and most preferably 100% homology with the full-length or partial nucleotide sequence of the nucleotide sequence complementary to the DNA of the present invention. The antisense DNA of the present invention includes a nucleic acid sequence (RNA or DNA modified) having a similar function to that of the antisense DNA. These antisense DNAs can be produced using a known DNA synthesizer or the like.
The term “an amino acid sequence substantially identical to an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70” refers to an amino acid sequence having on the overall average about 70% or more, preferably about 80% or more, further preferably about 90% or more, and particularly preferably about 95% or more homology with each of all the amino acid sequences represented by any one of SEQ ID NOS: 1 to 70.
An example of a polypeptide consisting of an amino acid sequence substantially identical to an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70 of the present invention is a polypeptide having the above homology with the amino acid sequence represented by each of the above SEQ ID NOS, and having biological activity (function) which is substantially the same characteristic with the function of the polypeptide comprising the amino acid sequence represented by each SEQ ID NO. The term “substantially the same characteristic” refers to the activity (function) having the same characteristics.
Further, the polypeptide of the present invention also includes, for example, a polypeptide consisting of an amino acid sequence derived from an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70 by deletion, substitution or addition of a section of amino acids (preferably about 1 to 20, more preferably about 1 to 10, and further preferably several amino acids) or by a combination of these, and having biological activity (function) which is substantially the same characteristic with the function of a polypeptide comprising an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70.
The polypeptide consisting of an amino acid sequence which is substantially identical to the above amino acid sequence represented by any one of SEQ ID NOS: 1 to 70, or the polypeptide comprising an amino acid sequence derived from the above amino acid sequence by deletion, substitution or addition of a section of the amino acids can be easily produced by, for example, an appropriate combination of methods known by a person skilled in the art, such as site-directed mutagenesis, homologous recombination of genes, primer elongation and PCR.
For the polypeptide to have biological activity which is substantially the same characteristics, a possible method is substitution between homologous amino acids (polar or nonpolar amino acids, hydrophobic or hydrophilic amino acids, positively or negatively charged amino acids, aromatic amino acids and the like) among amino acids composing the polypeptide. To maintain biological activity that is substantially the same characteristics, it is preferred to retain amino acids within functional domains contained in each polypeptide of the present invention.
Further, the DNA of the present invention includes DNA comprising a nucleotide sequence encoding an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70, and a DNA hybridizing to the DNA under stringent conditions, and encoding a polypeptide having biological activity (function) which is the same characteristic with the function of a polypeptide consisting of an amino acid sequence represented by each of the sequences.
Under such conditions, examples of DNA capable of hybridizing to DNA comprising a nucleotide sequence encoding an amino acid sequence represented by each of the nucleotide sequences of SEQ ID NOS: 1 to 70 include DNA comprising a nucleotide sequence having on the overall average about 80% or more, preferably about 90% or more, more preferably about 95% or more homology with each of all the nucleotide sequences of the DNAs.
Hybridization can be performed by a method known in the art or a method according to any known methods, such as a method described in Current Protocols in Molecular Biology (edited by Frederick M. Ausubel et al., 1987). When a commercially available library is used, hybridization can also be performed by the method described in the attached instructions.
The term “stringent conditions” means, for example, conditions that allow hybridizing to the DNA probe of the present invention by southern blot hybridization under conditions that involve hybridization in an 7% SDS solution containing 1 mM sodium EDTA and 0.5 M dibasic sodium phosphate (pH 7.2) at 65° C., and washing membranes in a 1% SDS solution containing 1 mM sodium EDTA and 40 mM dibasic sodium phosphate (pH 7.2) at 65° C. The same stringency can also be achieved by conditions other than the above conditions.
To clone the DNA of the present invention, amplification is performed by a PCR method using a synthetic DNA primer having an appropriate nucleotide sequence of a part of the polypeptide of the present invention or the like, or the DNA can be selected by hybridization of DNA incorporated in an appropriate vector with DNA labeled using a DNA fragment or synthetic DNA which encodes a section or the full-length region of the polypeptide of the present invention.
Hybridization can be performed according to, for example, the above-described method in “Current Protocols in Molecular Biology” (edited by Frederick M. Ausubel et al., 1987). In addition, when commercially available libraries are used, hybridization can be performed according to the method described in the attached instructions.
Cloned DNA encoding a polypeptide can be used intact, or can be used after digestion with restriction enzymes if necessary, or after addition of linkers thereto, depending on the purposes. The DNA may contain ATG as a translation initiating codon at the 5′ terminal side, or TAA, TGA or TAG as a translation termination codon at the 3′ terminal side. These translation initiating and termination codons may be added using an appropriate synthetic DNA adaptor.
An expression vector for the polypeptide of the present invention can be produced according to any method known in the technical field. For example, the vector can be produced by (1) cleaving a DNA fragment containing the DNA of the present invention or a gene having the DNA of the present invention, and (2) ligating the DNA fragment downstream of a promoter in an appropriate expression vector.
Examples of vectors that can be used herein include plasmids derived from Escherichia coli, (for example, pBR322, pBR325, pUC18 and pUC118), plasmids derived from Bacillus subtilis (for example, pUB110, pTP5 and pC194), plasmids derived from yeast (for example, pSH19 and pSH15), bacteriophages, such as λ phages, and animal viruses, such as retrovirus, vaccinia virus, baculovirus and the like.
Any promoter can be used in the present invention, so far as it is appropriate for a host to be used for gene expression. Preferred examples of promoters include, when the host is Escherichia coli, trp promoters, lac promoters, recA promoters, λPL promoters and lpp promoters; when the host is Bacillus subtilis, SPO1 promoters, SPO2 promoters and penP promoters; and when the host is yeast, PHO5 promoters, PGK promoters, GAP promoters and ADH promoters. When animal cells are used as hosts, examples of promoters include SRα promoters, SV40 promoters, LTR promoters, CMV promoters and HSV-TK promoters.
In addition to the above substances, an enhancer, splicing signal, polyA addition signal, a selection marker, SV40 replication origin and the like that are known in the technical field can be added to the expression vector, if desired. Further, if necessary, a protein encoded by the DNA of the present invention can be expressed as a fusion protein with another protein (for example, glutathione S transferase and protein A). Such a fusion protein can be cleaved with appropriate protease and then separated into each protein.
Examples of host cells that are used herein include bacteria of the genus Escherichia or the genus Bacillus, yeast, insect cells, insects, and animal cells.
Specific examples of bacteria of the genus Escherichia that are used herein include Escherichia coli K12/DH1 (Proc. Natl. Acad. Sci. USA, 60:160 (1968)), JM103 (Nucleic Acids Research, 9:309 (1981)), JA221 (Journal of Molecular Biology, 120:517 (1978)), and HB 101 (Journal of Molecular Biology, 41:459 (1969)).
Examples of bacteria of the genus Bacillus that are used herein include Bacillus subtilis MI114 (Gene, 24:255(1983)) and 207-21 [Journal of Biochemistry, 95:87 (1984)].
Examples of yeast that are used herein include Saccaromyces, such as Saccaromyces cerevisiae AH22, AH22R-, NA87-11A, DKD-5D and 20B-12; Schizosaccaromyces pombe NCYC1913 and NCYC2036; and Pichia pastoris.
Examples of animal cells that are used herein include monkey cells, such as COS-7 and Vero, Chinese hamster ovary cells, such as CHO (hereinafter, abbreviated as CHO cells), dhfr gene-deficient CHO cells; mouse L cells, mouse AtT-20, mouse myeloma cells, rat GH3, and human FL cells.
These host cells can be transformed according to a method known in the technical field. For example, transformation can be performed by referring to Proc. Natl. Acad. Sci. USA, 69:2110 (1972); Gene, 17:107 (1982); Molecular & General Genetics, 168:111 (1979); “Methods in Enzymology,” vol. 194, p 182-187 (1991); Proc. Natl. Acad. Sci. USA, 75:1929 (1978); A Separate Volume 8 of Cell Technology, New Experimental Protocols in Cell Technology, p 263-267 (1995) (issued by Shujunsha); and Virology, 52:456 (1973).
The thus obtained transformant, which has been transformed with an expression vector containing the DNA of the present invention or a gene containing the DNA of the present invention, can be cultured according to a method known in the technical field.
For example, when hosts are bacteria of the genus Escherichia, culturing is performed normally at about 15° C. to 43° C. for about 3 to 24 hours, and if necessary, aeration and agitation may be performed. When hosts are bacteria of the genus Bacillus, culturing is performed normally at about 30° C. to 40° C. for about 6 to 24 hours, and if necessary, aeration and agitation may be performed.
A transformant whose host is yeast is normally cultured using media adjusted to have pH of approximately 5 to 8, at about 20° C. to 35° C. for about 24 to 72 hours, and if necessary, aeration and agitation may be performed.
A transformant whose host is an animal cell is normally cultured using media adjusted to have pH of about 6 to 8, at about 30° C. to 40° C. for about 15 to 60 hours, and if necessary, aeration and agitation may be performed.
To isolate and purify the polypeptide or the protein of the present invention from the above culture product, for example, bacteria or cells are collected by a known method after culturing, suspended in an appropriate buffer, disrupted by ultrasonication, lysozyme and/or freezing and thawing, and then centrifuged or filtered, thereby obtaining a crude protein extract. The buffer may contain a protein denaturing agent, such as urea or guanidine hydrochloride, or a surfactant, such as Triton X-100 (trade-mark). When the protein is secreted in a culture solution, bacteria or cells are separated after culturing from the supernatant by a known method, thereby collecting the supernatant. The thus obtained culture supernatant or the protein contained in an extract can be purified by an appropriate combination of known isolation and purification methods.
The thus obtained polypeptide of the present invention can be converted to a salt by a known method or a method according to the known method. Conversely, when the polypeptide is obtained as a salt, it can be converted to an educt or another salt by a known method or a method according to the known method. Further before or after purification, the protein produced by a recombinant can be freely modified by allowing an appropriate protein modification enzyme, such as trypsin and chymotrypsin, to act on the protein, or polypeptides can be partially removed.
The presence of the polypeptide of the present invention or its salt can be measured by various binding assays and enzyme immunoassay using a specific antibody.
The C terminus of the polypeptide of the present invention is normally a carboxyl group (—COOH) or a carboxylate (—COO—), and the C terminus may be an amide (—CONH2) or ester (—COOR). Here, examples of R in ester that are used herein include a C1-6 alkyl group, such as methyl, ethyl, n-propyl, isopropyl or n-butyl; a C3-8 cycloalkyl group, such as cyclopentyl or cyclohexyl; a C6-12 aryl group, such as phenyl or α-naphthyl; a phenyl-C1-2 alkyl group, such as benzyl or phenethyl; and a C7-14 aralkyl group, such as an α-naphthyl-C1-2 alkyl group, e.g., α-naphthyl methyl. Further, pivaloyl-oxymethylester which is generally used as oral administration may also be used.
When the polypeptide of the present invention has a carboxyl group (or carboxylate) at the terminus other than the C terminus, the carboxyl group is amidated or esterified. The polypeptide of the present invention encompasses such a polypeptide. An example of ester that is used in this case is the above-mentioned ester at the C-terminus. Moreover, the polypeptide of the present invention also encompasses a polypeptide wherein an amino group of a methionine residue at the N-terminus is protected with a protecting group (for example, a C1-6 acyl group, such as a formyl group or an acetyl group); a polypeptide wherein a glutamic acid residue at the N-terminus which is generated by in vivo cleavage is pyroglutamated; a polypeptide wherein OH, COOH, NH2, SH and the like on the side chain of intramolecular amino acids are protected with appropriate protecting groups (for example, a C1-6 acyl group, such as a formyl group and an acetyl group); or a complex protein, such as a so-called glycoprotein formed by the binding of sugar chains.
A partial polypeptide of the polypeptide of the present invention may be any polypeptide which is a partial peptide of the above-mentioned polypeptide of the present invention and has activity which has substantially the same characteristics. For example, a peptide that is used herein comprises a sequence of at least 10 or more, preferably 50 or more, further preferably 70 or more, further more preferably 100 or more, and most preferably 200 or more amino acids of the amino acid sequence composing the polypeptide of the present invention, and, for example, has biological activity substantially the same characteristic with the function of the polypeptide of the present invention. An example of a preferable partial polypeptide of the present invention contains each functional domain. Further, the partial peptide of the present invention normally has a carboxyl group (—COOH) or a carboxylate (—COO—) at the C terminus, and it may also have an amide (—CONH2) or an ester (—COOR) at the C terminus like the above polypeptide of the present invention may have. Further, examples of the partial peptide of the present invention, similar to the polypeptide of the present invention described above, include a peptide wherein an amino group of a methionine residue at the N terminus is protected with a protecting group; a peptide wherein a glutamyl residue at the N-terminus which is generated by in vivo cleavage is pyroglutamated; a peptide wherein a substituent on the side chain of intramolecular amino acids is protected with an appropriate protecting group; a complex peptide, such as a so-called glycopeptide formed by the binding of sugar chains, or the like. The partial peptide of the present invention can be used as, for example, a reagent, reference materials for experiments, or an immunogen or a portion thereof.
Particularly preferred salts of the polypeptide of the present invention or the partial peptide are physiologically acceptable acid-added salts. Examples of such salts that are used herein include a salt formed with inorganic acid (for example, hydrochloric acid, phosphoric acid, hydrobromic acid and sulfuric acid), and a salt formed with organic acid (for example, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methane sulfonic acid and benzenesulfonic acid).
The polypeptide of the present invention, the partial peptide thereof or salts thereof, or amides thereof can be prepared by a chemical synthesis method known in the technical field.
For example, amino acids whose α-amino groups and side chain functional groups are appropriately protected are condensed on resin (which is commercially available resin for protein synthesis) in accordance with the sequence of a target polypeptide, according to various condensation methods known in the art. Various protecting groups are then removed simultaneously with cleavage of the polypeptide from the resin at the end of reaction. Further, reaction for forming an intramolecular disulfide linkage is conducted in a highly diluted solution, thereby obtaining a target polypeptide, the partial peptide thereof or amides thereof. Examples of activation reagents that can be used to condense the above protected amino acids include those that can be used for polypeptide synthesis and are represented by carbodiimides, such as DCC, N,N′-diisopropylcarbodiimide and N-ethyl-N′-(3-dimethylaminopropyl) carbodiimide. For activation by such reagents, both protected amino acids and a racemization-suppressing additive (for example, HOBt or HOOBt) are directly added to the resin; or protected amino acids can be previously activated with acid anhydride as a control, or HOBt ester or HOOBt ester, and then added to the resin.
Solvents used for activation of protected amino acids and condensation with resin can be appropriately selected from solvents known in the art as applicable to polypeptide condensation reaction, such as acid amides, halogenated hydrocarbons, alcohols, sulfoxides and ethers. A reaction temperature is appropriately selected from a known range that can be used for reaction of polypeptide linkage formation. Activated amino acid derivatives are normally used in 1.5 to 4-fold excess. When condensation is insufficient as a result of a test using ninhydrin reaction, sufficient condensation can be performed by repeating condensation reaction without eliminating protecting groups. When condensation is still insufficient even when reaction is repeated, unreacted amino acids are acetylated using acetic anhydride or acetylimidazole so as not to affect the subsequent reaction.
Protecting groups which are normally employed in the technical field can be used for raw materials, such as those for each of amino groups, carboxyl groups and serine hydroxyl groups.
The protection of functional groups that should not involve the reaction of raw materials, protecting groups, and the elimination of the protecting groups, and the activation of functional groups that involve reaction and the like can be appropriately selected from known groups or performed by known measures.
The partial peptide of the present invention or a salt thereof can be produced according to a peptide synthesis method known in the technical field, or by cleaving the polypeptide of the present invention with appropriate peptidase. For example, the peptide synthesis method may be either a solid-phase synthesis method or a liquid phase synthesis method. Examples of a known condensation method and a method of elimination of protecting groups are described in Nobuo IZUMIYA et al., Basics and Experiment for Peptide Synthesis, Maruzen (1975); Haruaki YAJIMA and Shunpei SAKAKIBARA, Experiment Course for Biochemistry 1, Protein Chemistry IV, 205 (1977); and Development of Pharmaceutical Preparation 2, vol. 14, Peptide Synthesis, under the editorship of Haruaki YAJIMA, Hirokawa Publishing Co.
After reaction, the partial peptide of the present invention can be purified and isolated using known methods, such as solvent extraction, distillation, column chromatography, liquid chromatography, recrystallization and the like in combination. When the partial peptide obtained by the above methods is an educt, it can be converted to an appropriate salt by a known method. Conversely, when the peptide is obtained as a salt, it can be converted to an educt by a known method.
The antibody for the polypeptide of the present invention, the partial peptide thereof or salts thereof may be either a polyclonal or a monoclonal antibody, so far as it can recognize these substances. The antibody for the polypeptide of the present invention, the partial peptide thereof or salts thereof can be produced using as an antigen the polypeptide of the present invention or the partial peptide thereof according to a known method for producing antibodies or anti-serum.
The antibody of the present invention can be used to detect the polypeptide of the present invention and the like which are present in a specimen, such as body fluid, tissues or the like. In addition, the antibody can be used for preparing an antibody column to be used for purifying these substances; detecting the polypeptide of the present invention in each fraction upon purification; analyzing the behavior of the polypeptide of the present invention within the cells of a specimen; and the like.
The use of the DNA, the polypeptide and the antibody of the present invention will be further described below.
Using as a probe the DNA of the present invention, the antisense DNA of the DNA of the present invention, or a gene construct containing these DNAs, abnormalities (of the gene) in DNA or mRNA encoding the polypeptide of the present invention or the partial peptide thereof can be detected.
The DNA, the antisense DNA or the gene construct of the present invention are useful as a genetic diagnostic agent for, for example, damages, mutation or hypoexpression in the DNA or mRNA, and an increase or hyperexpression of the DNA or mRNA. The above gene diagnosis using the DNA of the present invention can be performed by, for example, a known northern hybridization or a PCR-SSCP method (Genomics, 5:874-879(1989), Proc. Natl. Acad. Sci. USA, 86:2766-2770 (1989)).
Moreover, for patients who cannot exert normal in vivo functions because of abnormalities or deletions in the DNA or the gene of the present invention, or because the expression amount of the DNA or the gene of the present invention is reduced, it is effective that the DNA or the gene construct of the present invention is introduced for expression into the bodies of the patients by gene therapy using as vehicles appropriate vectors, such as retrovirus vectors, adenovirus vectors and adenovirus-associated virus vectors according to known techniques. Further, when patients cannot exert normal functions because of an increased expression amount, introduction of antisense can be effective.
The DNA, the antisense DNA of the present invention, or the gene construct thereof can be administered alone, or in combination with an adjuvant to promote uptake using a gene gun or a catheter, such as a hydrogel catheter.
In another example, injection of the polypeptide of the present invention or the like into patients with the above diseases also enables the polypeptide of the present invention or the like to exert its function in the patients.
Furthermore, the antibody of the present invention can be used for quantitatively determining the polypeptide of the present invention in a test liquid by a known method. Specifically, the antibody of the present invention can be used for quantitative determination by a sandwich immuno-assay using monoclonal antibodies, detection by tissue staining, and the like, by which, for example, diseases that involve the polypeptide of the present invention or the like can be diagnosed.
For these purposes, an antibody molecule itself can be used, or the antibody molecules F(ab′)2, Fab′ or Fab fractions can be used. Quantitative determination methods for the polypeptide of the present invention using the antibody of the present invention are not specifically limited. Any measurement method can be used, so far as it involves detecting the amount of antibodies, antigens or antibody-antigen complexes corresponding to the amount of antigens (for example, protein amount) in a test liquid by chemical or physical means, and calculating with a calibration curve which has been prepared using a standardized solution containing a known amount of antigens. For example, nephrometry, competitive assay, immunometric assay and sandwich assay are preferably used, and a later described sandwich assay is preferred in terms of sensitivity and specificity. Examples of a labeling agent that can be used in a measurement method using a labeling substance include a substance known in the technical field, such as radioisotopes, enzymes, fluorescent materials and light-emitting materials.
Details about the general technical procedures concerning these measurement and detection methods can be referred to in a review, reference book or the like, such as Radioimmunoassay 2 edited by Hiroshi IRIE, (Kodansha, issued in 1979); Enzyme Immunoassay edited by Eiji ISHIKAWA et al., (3rd edition; Igaku-Shoin, issued in 1987); and Methods in Enzymology (issued by Academic Press), vol. 70, “Immunochemical Techniques (Part A),” vol. 73, “Immunochemical Techniques (Part B),” vol. 74, “Immunochemical Techniques (Part C),” vol. 84, “Immunochemical Techniques (Part D: Selected Immunoassays),” vol. 92, “Immunochemical Techniques (Part E: Monoclonal Antibodies and General Immunoassay Methods),” and vol. 121, “Immunochemical Techniques (Part I: Hybridoma Technology and Monoclonal Antibodies).”
Moreover, DNA chips prepared by arraying the DNA of the present invention are useful in detecting mutations and polymorphism of the DNA of the present invention, and monitoring the DNA dynamics. Regarding DNA array, which is a type of DNA chip, see “DNA Microarray and Current PCR method” (a separate volume of Cell Technology, Genome Science Series 1, under the editorship of Masaaki MURAMATSU and Hiroyuki NABA, 1st impression of the first edition, issued on Mar. 16, 2000) and the like.
Further, polypeptide chip prepared by arraying the polypeptides of the present invention can be a strong tool for functional analysis on the expression, interaction and posttranslational modification of the polypeptides of the present invention, and for identification and purification of proteins.
Antibody chip prepared by arraying antibodies against the polypeptides of the present invention are very useful in analyzing the correlation between the polypeptides of the present invention and diseases, disorders, or other physiological phenomena.
Methods and materials for preparing the chip are known by persons skilled in the art.
Furthermore, the polypeptides of the present invention or the like are useful as reagents for screening compounds which interact specifically with these substances. Specifically, the present invention provides a method for screening compounds which specifically interact with the polypeptide of the present invention, a partial peptide thereof or salts thereof, or antibodies against them by using these substances; and provides the screening kit therefor.
Compounds or salts thereof that are identified using the screening method or the screening kit of the present invention are selected from the above test compounds. The compounds interact with the polypeptide of the present invention or the like. For example, the compounds regulate, inhibit, promote or antagonize the biological activity of the polypeptide of the present invention or the like. The compound or a salt thereof may directly act on the activity of the polypeptide of the present invention or the like, or indirectly act on the activity of the polypeptide of the present invention or the like by acting on the expression of the polypeptide of the present invention or the like. An example of the salt of the compound that is used herein is a pharmaceutically acceptable salt. Specific examples of such salts include a salt formed with inorganic base, a salt formed with organic base, a salt formed with inorganic acid, a salt formed with organic acid, and a salt formed with basic or acidic amino acid. Compounds which inhibit the biological activity of the polypeptide of the present invention or the like can also be used as pharmaceutical preparations, such as therapeutic agents and preventive agents for each of the above-mentioned diseases.
When nucleotides (bases) and amino acids are indicated with abbreviations in the present specification, the abbreviations follow the IUPAC-IUB Joint Commission on Biochemical Nomenclature, or those commonly used in the art. Amino acids for which optical isomerism is possible are, unless otherwise specified, in the L form.
BEST MODE FOR CARRYING OUT THE INVENTIONThe present invention will now be further described by means of examples that are not intended to limit the present invention. The various gene manipulations employed in the examples are according to the methods described in the above Current Protocols in Molecular Biology (edited by Frederick M. Ausubel et al., 1987).
(1) Construction of cDNA Library Derived from Human Adult Whole Brain, Human Adult Hippocampus and Human Embryonic Whole Brain
Double-stranded cDNA was synthesized using an oligonucleotide having Not-I site (GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15) (Invitrogen) as a primer, mRNAs (Clontech) derived from the human adult whole brain, the human adult hippocampus and the human embryonic whole brain as templates, and a SuperScriptII reverse transcriptase kit (Invitrogen). Next, an adaptor (Invitrogen) having SalI site was ligated to the cDNA, followed by digestion with NotI and 1% low-melt agarose electrophoresis. Thus, DNA fragments of 3 kb or more were purified.
The purified cDNA fragment was ligated to pBluescript IISK+ plasmid pre-treated with SalI-NotI restriction enzymes. The recombinant plasmid was introduced into Escherichia coli strain ElectroMax DH10B (Invitrogen) by electroporation.
(2) Screening
Subsequently, clones were randomly picked up from the constructed cDNA library, and then spotted onto membranes. The mixture of oligo DNAs (each comprising 21 nucleotides) was prepared based on each of the full-length nucleotide sequences of approximately 1300 clones that we had previously analyzed. Each 3′ terminus of the oligo DNAs was labeled with DIG using terminal transferase. Using the DIG-labeled DNAs as probes, dot hybridization (Current Protocols in Molecular Biology, edited by Frederick M. Ausubel et al, 1987) was performed so as to remove redundant clones (clones containing the same sequences).
Next, in vitro transcription and translation (Promega, TNT T7 Quick Coupled Transcription/Translation System cat. No. L1107) were performed, thereby selecting clones for which products of 50 kDa or more had been confirmed.
The terminal nucleotide sequences of the selected clones were then determined. Using the obtained sequences as queries, a homology search program BLASTN 2.0.14 (Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs,” Nucleic Acids Res. 25:3389-3402) was run on nr database (GenBank+EMBL+DDBJ+PDB sequences which do not contain EST, STS, GSS or HTGS (phase 0, 1 or 2) sequences). As a result, the full-length nucleotide sequences of novel genes, for which no homologous gene was present, were determined.
For sequencing, a DNA sequencer (ABI PRISM377) and a reaction kit which are manufactured by PE Applied Biosystems were used. Most sequences were determined by a dye terminator method using shotgun clones. Part of the nucleotide sequences was determined by synthesizing oligonucleotides based on the determined nucleotide sequences, and then performing a primer walking method.
As described above, screening for novel DNAs or genes was performed. As a result, a novel DNA or a gene represented by any one of SEQ ID NOS: 71 to 140 in the sequence listing was detected.
The nucleotide sequences of these novel DNAs or genes were determined by the above sequencing method. Table 1 shows the names of clones having the DNA or the gene of the present invention, the length of a polypeptide encoded by the gene in the clone, its putative function and the grounds for prediction.
| TABLE 1 |
| Clone Name and Putative Function |
| Clone |
| SEQ | Name/Protein length/ | ||
| ID | Full length or partial | Grounds for | |
| NO: | sequence | Putative function | prediction |
| 1 | fg01864 | 323 | Partial | Involved in mitoses, cell motility | Partially has a region |
| sequence | and phagocytosis through the | having 50% homology to | |||
| regulation of the cytoskeleton. | coronin-, actin-binding | ||||
| Useful in therapy and diagnosis in | protein 1C. | ||||
| the field of regulating the dynamic | |||||
| states of cells, such as suppression | |||||
| of cancer metastasis and the action | |||||
| of immunocytes. | |||||
| 2 | fg02011 | 314 | Partial | Regulates gene expression by binding | Partially has a region |
| sequence | of C2H2 type zinc finger motif to | having 42% homology to | |||
| DNA, and interaction between | zinc finger protein 91 | ||||
| Kruppel-associated box (KRAB) | and has zf-C2H2 motifs. | ||||
| domain and the other transcriptional | |||||
| apparatus. The deletion or the | |||||
| mutation of the protein may cause | |||||
| abnormalities in morphogenesis or | |||||
| cell proliferation. The detection | |||||
| of the mutation is useful in | |||||
| diagnosing cancer and the | |||||
| introduction of the normal gene is | |||||
| useful in treating cancer. | |||||
| 3 | fg02301 | 187 | Partial | A molecule inferred to be involved in | Partially has a region |
| sequence | cell adhesion because it has a | having 39% homology to | |||
| transmembrane domain and three | the immunoglobulin | ||||
| Ig-like C2-type domains, and shares | superfamily, and has ig | ||||
| high homology with NCAM1 and NCAM2. | motifs and a sosui | ||||
| Since the molecule regulates | transmembrane domain. | ||||
| intercellular adhesion, it is useful | |||||
| in diagnosing and treating | |||||
| canceration of cells and cancer | |||||
| metastasis, and screening for the | |||||
| therapeutic agent. | |||||
| 4 | fg02936 | 1479 | Partial | A membrane protein expressed in the | Partially has a region |
| sequence | nerve system. Inferred to function | having 99% homology to | |||
| as receptors for semaphorins, the | NOV/plexin-A1 protein | ||||
| guidance factor to elongate neural | and has the function | ||||
| axial filaments, thus regulating | motifs of each of Sema, | ||||
| neuron formation. With its | Plexin_repeat, integrin— | ||||
| function to regulate the growth of | B, and TIG. | ||||
| neural axial filaments, it is useful | |||||
| in diagnosing and treating a variety | |||||
| of neuropsychiatric diseases, or | |||||
| screening for the therapeutic agent. | |||||
| 5 | fg04068 | 258 | Partial | Encodes a guanine nucleotide | Partially has a region |
| sequence | exchange factor (GEF) whose target | having 91% homology to a | |||
| is Rho-type GTPase. Activates Rho | neuronal guanine | ||||
| signal by converting Rho to GTP type. | nucleotide exchange | ||||
| The expression of the protein is high | factor, and has a PH | ||||
| in the brain, suggesting that it is | domain motif. | ||||
| involved in brain functions. | |||||
| Useful in diagnosing and treating | |||||
| cancer, and screening for the | |||||
| therapeutic agent. Also inferred | |||||
| to be useful in improving brain | |||||
| functions, since it is strongly | |||||
| expressed in the brain and is thought | |||||
| to be involved in recognition | |||||
| functions. | |||||
| 6 | fg05423 | 675 | Partial | A DNA-binding protein having a zinc | Partially has a region |
| sequence | finger motif, and is a | having 51% homology to | |||
| transcriptional regulatory factor. | EVI1 protein, and has | ||||
| Inferred to be a protooncogene, | zf-C2H2 motifs and a | ||||
| similar to EVI-1, or a causative | zf-BED motif. | ||||
| protein of osteomyelodysplasia | |||||
| syndrome. Thus, it is thought to be | |||||
| useful in diagnosing and treating | |||||
| cancer or osteomyelodysplasia, and | |||||
| in screening for the therapeutic | |||||
| agent. | |||||
| 7 | fg06344 | 248 | Partial | Inferred to synthesize acetyl | Partially has a region |
| sequence | coenzyme A. The protein may be | having 60% homology to | |||
| useful in screening for anticancer | acetyl CoA synthetase. | ||||
| agents and immunosuppressant | |||||
| agents. | |||||
| 8 | fg06691 | 193 | Partial | Inferred to have high homology with | Partially has a region |
| sequence | an enzyme, proline dehydrogenase, | having 93% homology to | |||
| and has functions similar to proline | proline dehydrogenase. | ||||
| dehydrogenase. Oxidizes proline to | |||||
| 1-proline-5-carboxilic acid. The | |||||
| deletion of the enzyme causes | |||||
| hyperprolinemia. Proline | |||||
| regulates transmission by | |||||
| glutamate-operated synapses, and | |||||
| controls neurotransmission in the | |||||
| brain. Elevated blood proline | |||||
| levels lead to abnormal sensory | |||||
| motor. Thus, it is useful in | |||||
| diagnosing and treating mental | |||||
| disorders due to hyperprolinemia and | |||||
| proline metabolic disorders. | |||||
| 9 | fh02216 | 373 | Partial | Has α1,2-mannosidase activity to | Partially has a region |
| sequence | remove the terminal mannose of | having 100% homology to | |||
| Man9GlcNac2-, the precursor, formed | α1,2-mannosidase, and | ||||
| in ER during the biosynthetic | has a Glyco_hydro_47 | ||||
| pathways of N-glycoside-binding | motif and a sosui | ||||
| sugar chain; and plays an important | transmembrane domain. | ||||
| role in sugar chain synthesis of | |||||
| N-glycoside-binding glycoprotein. | |||||
| The N-glycoside-binding sugar chain | |||||
| functions everywhere in vivo. The | |||||
| deletion of the protein may cause | |||||
| diseases induced by deficient | |||||
| N-glycoside binding sugar chain. | |||||
| The protein is useful in treating and | |||||
| diagnosing these diseases. | |||||
| 10 | fh02982 | 215 | Partial | Regulates exocytosis, triggered by | Partially has a region |
| sequence | Ca2+, of neurotransmitters in | having 68% homology to | |||
| synapse. Inferred to be useful in | NIM3, and has a C2 domain | ||||
| diagnosing and treating nervous | motif. | ||||
| diseases. | |||||
| 11 | fh03203 | 1134 | Partial | An extracellular matrix | Partially has a region |
| sequence | glycoprotein which responds to | having 37% homology to | |||
| pheromone and is transcribed. | hydroxyproline-rich | ||||
| Involved in biophylaxis. | glycoprotein DZ-HRGP. | ||||
| 12 | fh05673 | 438 | Partial | Expressed upon cephalization to be a | Partially has a region |
| sequence | guidance for the growth of neural | having 57% homology to | |||
| axial filaments. Not a type which | netrin-G1c and has a | ||||
| acts by diffusion, but acts locally | laminin_Nterm motif and a | ||||
| on the surface of a cell membrane. | laminin_EGF motif. | ||||
| Useful in diagnosing and treating | |||||
| various neuropsychiatric diseases, | |||||
| or screening for the therapeutic | |||||
| agents for these diseases, since the | |||||
| protein regulates the growth of | |||||
| neural axial filaments. | |||||
| 13 | fh06634 | 505 | Partial | One of the proteins forming an | Partially has a region |
| sequence | adaptor molecule complex which | having 100% homology to | |||
| transduces a signal from tyrosine | guanine | ||||
| kinase to Ras. Functions as guanine | nucleotide-releasing | ||||
| nucleotide-releasing factor 2 for | factor 2, and has a | ||||
| Ras. Since the protein is involved | RasGEFN motif and a | ||||
| in signal transduction from a | RasGEF motif. | ||||
| receptor to Ras, it is useful in | |||||
| diagnosing and treating cancer | |||||
| through the regulation of cell | |||||
| proliferation, and screening for the | |||||
| therapeutic agent. | |||||
| 14 | fh08795 | 572 | Partial | Promotes GTPase activity of | Partially has a region |
| sequence | Ras-related nuclear protein Ran, | having 100% homology to | |||
| which is involved in cell cycle; thus | Ran GTPase activating | ||||
| promotes conversion of active | protein 1. | ||||
| GTP-Ran to inactive GDP-Ran, thereby | |||||
| regulating initiation of cell | |||||
| mitosis. Useful in diagnosing and | |||||
| treating cancer, and screening for | |||||
| the therapeutic agent, since | |||||
| abnormalities in the protein can | |||||
| cause canceration. | |||||
| 15 | fh13310 | 1051 | Partial | Inferred to help the migration of | Partially has a region |
| sequence | hnRNPA1 from cytoplasms to nuclei by | having 98% homology to | |||
| binding to hnRNPA1, which is a | karyopherinβ2b, | ||||
| protein controlling mRNA processing | transportin, and has | ||||
| and the transport of mRNA from nuclei | Armadillo_seg motifs and | ||||
| to cytoplasms. Useful in | HEAT motifs. | ||||
| diagnosing and treating cancer by | |||||
| regulating the gene. | |||||
| 16 | fh18356 | 887 | Partial | Inferred to be a factor which is | Partially has a region |
| sequence | induced in blastocysts by | having 94% homology to | |||
| parathyroid hormone, and involved in | PTH-responsive | ||||
| the activation of blastocysts by | osteosarcome B1 protein. | ||||
| parathyroid hormone and | |||||
| osteogenesis. Useful in diagnosing | |||||
| and treating bone diseases, such as | |||||
| osteoporosis and a variety of | |||||
| cancers, and screening for the | |||||
| therapeutic agent for these | |||||
| diseases. | |||||
| 17 | fh18358 | 689 | Partial | Promotes the formation of | Partially has a region |
| sequence | CDC25c/14-3-3 protein complex by | having 64% homology to | |||
| phosphorylating Ser216 of | Cdc25C associated | ||||
| CDC25c; and regulates the initiation | protein kinase C-TAK1, | ||||
| of cell mitosis through the complex. | and has a pkinase motif | ||||
| Useful in diagnosing and treating | and a UBA motif. | ||||
| cancer and screening for the | |||||
| therapeutic agent, since it is | |||||
| involved in the regulation of cell | |||||
| division. | |||||
| 18 | fh20539 | 1004 | Partial | Has the ankyrin repeat and is | Partially has a region |
| sequence | involved in protein interaction. | having 35% homology to | |||
| Useful in treating cystic fibrosis, | FRANK2 protein, and has | ||||
| since it is involved in regulating | ank repeat motifs. | ||||
| CFTR expression. | |||||
| 19 | fh22167 | 761 | Partial | Serine/threonine kinase in the | Partially has a region |
| sequence | intracellular signal transduction | having 30% homology to | |||
| system. Useful in screening a drug | protein kinase WNK1. | ||||
| for diseases which involve the | |||||
| signal transduction system. | |||||
| 20 | fh23421 | 480 | Partial | A nuclear protein involved in mRNA | Has 97% homology to a |
| sequence | splicing. Concentrated in portions | putative splicing | |||
| referred to as nuclear TY body, and | factor, YT521-B. | ||||
| inferred to provide a site for mRNA | |||||
| splicing. Useful in diagnosing and | |||||
| treating cancer, and screening for | |||||
| the therapeutic agent, since it is | |||||
| involved in regulating expression | |||||
| and cell proliferation. Also | |||||
| useful in the field of regeneration | |||||
| medicine. | |||||
| 21 | fh24594 | 762 | Partial | Involved in binding synaptosome | Partially has a region |
| sequence | binding protein (SNAP-25) to the | having 94% homology to | |||
| cytoskeleton, and regulating | SNAP-25-interacting | ||||
| exocytosis. Useful in diagnosing, | protein, and has a | ||||
| preventing and treating nervous | Troponin motif. | ||||
| diseases, since it is involved in | |||||
| regulating the release of | |||||
| neurotransmitters. | |||||
| 22 | fh26207 | 1094 | Partial | A GnRH-like decapeptide precursor | Partially has a region |
| sequence | acting as gonadotropin releasing | having 98% homology to | |||
| hormone. Useful in diagnosing, | putative preoptic | ||||
| preventing and treating | regulatory factor-2 | ||||
| abnormalities in sex hormones, such | precursor. | ||||
| as infertility and cancer. | |||||
| 23 | fj00154 | 388 | Partial | An enzyme which substitutes | Partially has a region |
| sequence | adenosine residue 37 of alanine tRNA | having 99% homology to | |||
| with an inosine residue. Useful in | adenosine deaminase | ||||
| preventing, treating and diagnosing | acting on tRNA 1, and has | ||||
| diseases involved in modifying, such | A_deamin motifs. | ||||
| as tRNA. | |||||
| 24 | fj00597s1 | 523 | Full | Inferred to transport iron or other | Partially has a region |
| length | divalent cations or to function as a | having 39% homology to | |||
| membrane-binding receptor. For | TTYH1, and has sosui | ||||
| example, iron metabolic disorders | transmembrane motifs. | ||||
| cause blood diseases, such as | |||||
| anemia, the disease of nervous | |||||
| degeneration and the like. Thus it | |||||
| is useful in diagnosing and treating | |||||
| such diseases by detecting and | |||||
| regulating the expression and the | |||||
| function of the protein. | |||||
| 25 | fj03879s1 | 1653 | Partial | Acts on protein interaction since it | Partially has a region |
| sequence | has a PH domain. Inferred to act on | having 44% homology to | |||
| the morphological changes in | P116 RHO-interacting | ||||
| neurons. Also inferred to inhibit | protein (P116RIP) | ||||
| cell expansion and the elongation of | (RIP3), and has a PH | ||||
| neurons by acting on Rho. Useful in | domain motif. | ||||
| diagnosing and treating nervous | |||||
| diseases and cancer, and screening | |||||
| for the therapeutic agents for these | |||||
| diseases by regulating the gene. | |||||
| 26 | fj04226 | 959 | Partial | A microtubule-associated protein | Partially has a region |
| sequence | which regulates microtubule | having 61% homology to | |||
| kinetics and interaction between | microtubule-associated | ||||
| microtubules and other | protein 4, and has | ||||
| intracellular molecules. With the | tubulin-binding motifs. | ||||
| strong involvement of a | |||||
| microtubule-associated protein in | |||||
| cancer and Alzheimer's disease, the | |||||
| protein, a putative member of the | |||||
| protein family, is useful in | |||||
| diagnosing and treating these | |||||
| diseases. | |||||
| 27 | fj04751 | 878 | Full | A protein which binds to oxysterol, | Partially has a region |
| length | and plays an important role in | having 60% homology to | |||
| regulating cholesterol metabolism. | oxysterol-binding | ||||
| Useful in diagnosing and treating | protein, and has a PH | ||||
| cardiovascular diseases caused by | domain and an | ||||
| abnormalities in cholesterol | Oxysterol_Bp motif. | ||||
| metabolism, and screening for the | |||||
| drug. | |||||
| 28 | fj05456 | 281 | Partial | Inferred to act as a cytoskeleton | Partially has a region |
| sequence | factor in neurons of the brain. | having 32% homology to a | |||
| This protein has 5 kelch motifs, | ring canal protein, and | ||||
| while Gigaxonin (mutated Gigaxonin | has Kelch motifs. | ||||
| is found in giant axonal neuropathy) | |||||
| has the BTB domain and 6 Kelch | |||||
| motifs. The protein is useful in | |||||
| diagnosing and treating giant axonal | |||||
| neuropathy and degenerative | |||||
| disorders in the nervous system | |||||
| (e.g., amyotrophic lateral | |||||
| sclerosis, amyotrophy, | |||||
| charcot-Marie-tooth disease). | |||||
| 29 | fj06918 | 707 | Partial | Present in neurons, and co-exists | Partially has a region |
| sequence | with ion channels. Involved in | having 46% homology to a | |||
| differentiation of the functional | cell recognition | ||||
| domain of axial filaments. Useful | molecule, Caspr2, and has | ||||
| in treating, preventing, and | laminin_G motifs and an | ||||
| diagnosing nervous diseases, and | EGF motif. | ||||
| screening for the therapeutic agent. | |||||
| 30 | fj08985 | 341 | Partial | A protein having a motif which binds | Partially has a region |
| sequence | to GTP-Rho, and which plays a role in | having 80% homology to | |||
| transducing Rho signal to other | GTP-rho binding protein | ||||
| proteins. Involved in the regulation | 1, and has a BRO1 motif. | ||||
| of the cytoskeleton which is based on | |||||
| actin, the contraction of the smooth | |||||
| muscle, transcription, cell | |||||
| proliferation, and the regulation of | |||||
| cell cycle. Useful in diagnosing | |||||
| and treating diseases caused by | |||||
| abnormalities in the cytoskeleton | |||||
| and morphogenesis, and cancer, and | |||||
| screening for the therapeutic agent. | |||||
| 31 | fj10564 | 531 | Partial | An isozyme of phosphoenzyme which | Partially has a region |
| sequence | converts inositol triphosphate to | having 100% homology to | |||
| inositol tetraphosphate. | inositol1, 4,5- | ||||
| Regulates intracellular calcium | triphosphate3-kinase | ||||
| levels and is involved in signal | (IP3K). | ||||
| transduction. Expressed in the | |||||
| hippocampus. Useful in screening | |||||
| for an agent selectively acting on | |||||
| the inositol phosphate pathway. | |||||
| 32 | fj11471 | 1199 | Partial | Has domains involved inhistogenesis | Partially has a region |
| sequence | and development of extremities. | having 37% homology to | |||
| Possible involvement in cell | FH1/FH2 | ||||
| localization, cell division and the | domain-containing | ||||
| regulation of the cytoskeleton. | protein FHOS, and has a | ||||
| High expression of this protein in | FH2 motif. | ||||
| the spleen suggests its involvement | |||||
| in maturation and development of B | |||||
| cells and erythrocytes. Useful in | |||||
| diagnosing and treating diseases | |||||
| caused by cell or tissue | |||||
| development, morphogenesis and | |||||
| maturation, and in regeneration | |||||
| medicine. | |||||
| 33 | fj12188 | 449 | Partial | Regulates the binding and fusion of | Partially has a region |
| sequence | synaptic vesicles at the synaptic | having 51% homology to | |||
| termini in the brain. Useful in | serine/threonine- | ||||
| treating and diagnosing diseases | protein kinase DCAMKL1, | ||||
| with abnormalities in neural | and has a pkinase motif. | ||||
| transmission. | |||||
| 34 | fj14406 | 1354 | Partial | A motor molecule which converts ATP | Partially has a region |
| sequence | (chemical energy) into physical | having 37% homology to 1 | |||
| force so as to move along | β dynein heavy chain, | ||||
| microtubules. While dyneins | and has a Dynein_heavy | ||||
| involved in mitosis, vesicle | motif. | ||||
| transport, and the movement of cilia | |||||
| and fragella exist as multisubunit | |||||
| complexes, the protein functions as | |||||
| 1β dynein heavy chain which is a | |||||
| component of the complex. Useful in | |||||
| diagnosing and treating cancer, and | |||||
| screening for the therapeutic agent. | |||||
| Also useful in diagnosing cranial | |||||
| nerve diseases, such as | |||||
| hydrencephaly, infertility and | |||||
| respiratory apparatus-related | |||||
| diseases. | |||||
| 35 | fj15278 | 966 | Partial | Involved in regulation of binding | Has 95% homology to |
| Sequence | and fusion of synaptic vesicles to | rsec8. | |||
| pre-synaptic membranes. A | |||||
| component of a complex involved in | |||||
| neural transmission. Useful in | |||||
| treating and diagnosing diseases | |||||
| with abnormalities in neural | |||||
| transmission. | |||||
| 36 | fj16085s1 | 1766 | Partial | Regulates cell differentiation and | Partially has a region |
| sequence | cell proliferation by interacting | having 57% homology to | |||
| with proteins having the SET domain. | nuclear dual-specificity | ||||
| Useful in diagnosing and treating | phosphatase, and has a | ||||
| cancer, and screening for the | DENN, a GRAM and a PH | ||||
| therapeutic agent. | domain motif. | ||||
| 37 | fj17028 | 498 | Partial | Produces phospholipids, the second | Partially has a region |
| sequence | messenger, and involved in | having 95% homology to | |||
| intracellular reactions including | phosphatidic | ||||
| production of hyperoxides in | acid-preferring | ||||
| neutrophils, actin polymerization | phospholipase A1, and has | ||||
| and the like. Useful in diagnosing | a DDHD motif. | ||||
| and treating infectious diseases, | |||||
| inflammation and immune diseases, | |||||
| and screening for the drug. | |||||
| 38 | fj17066 | 389 | Full | Regulates the expression of homeotic | Partially has a region |
| length | genes by modifying the structure of | having 87% homology to | |||
| chromosomes, and inhibits | chromobox homolog 8, and | ||||
| (functions to perform silencing) | has a chromo motif. | ||||
| gene expression. Useful in | |||||
| diagnosing and treating cancer, and | |||||
| screening for the therapeutic agent. | |||||
| Also useful in gene diagnosis of | |||||
| malformation, teratogeny and the | |||||
| like, and in the field of | |||||
| regeneration medicine. | |||||
| 39 | gh01817b | 380 | Partial | Dissociates a transcribed complex | Partially has a region |
| sequence | from a template. Can be used for | having 92% homology to | |||
| analyzing the transcriptional | polymerase I and a | ||||
| mechanism. | transcript release | ||||
| factor. | |||||
| 40 | gh13812 | 360 | Partial | A regulatory subunit of phosphatase | Partially has a region |
| sequence | which regulates the activity of a | having 93% homology to | |||
| pyruvate dehydrogenase complex. | pyruvate dehydrogenase | ||||
| Useful in diagnosing and treating | phosphatase regulatory | ||||
| cancer, and screening for the | subunit precursor, and | ||||
| therapeutic agent. Also useful in | has a GCV_T motif. | ||||
| screening for an antiobestic drug. | |||||
| 41 | hh05136b | 832 | Partial | A homologue of collagen V precursor. | Partially has a region |
| sequence | Collagen V plays an important role in | having 46% homology to | |||
| forming extracellular matrix. | collagen α1 (V) chain | ||||
| Useful in diagnosing cirrhosis, and | precursor, and has | ||||
| as biological base materials in | Collagen motifs and COLFI | ||||
| regeneration medicine. | motifs. | ||||
| 42 | hh05356 | 370 | Partial | Forms a spindle during cell | Partially has a region |
| sequence | division, and delivers chromosomes | having 97% homology to | |||
| to daughter cells. Involved in | tubulin β-5 chain (β- | ||||
| constructing and maintaining the | tubulin class-V). | ||||
| three-dimensional structure of a | |||||
| cytoplasm together with actin fibers | |||||
| and intermediate filaments. Useful | |||||
| in diagnosing and treating cancer, | |||||
| and screening for the therapeutic | |||||
| agent. | |||||
| 43 | hh10052 | 412 | Partial | Inferred to be the gene product of a | Partially has a region |
| sequence | novel human cartilage link protein | having 49% homology to | |||
| family, which is important in | proteoglycan link | ||||
| differentiation and proliferation | protein precursor | ||||
| of cartilage cells. Useful in | (cartilage link | ||||
| regeneration of the cartilage. | protein), and has an ig | ||||
| motif and Xlink motifs. | |||||
| 44 | hh13045 | 803 | Partial | Inferred to be novel cadherin | Partially has a region |
| sequence | molecules, since they have cadherin | having 30% homology to | |||
| repeats. Involved in cell | FAT tumor suppressor, and | ||||
| adhesion. Possible involvement in | has cadherin motifs. | ||||
| segregation of cancer cells from | |||||
| primary layers and infiltrationwith | |||||
| cancer cells. Useful in diagnosing | |||||
| and treating cancer, and screening | |||||
| for the therapeutic agent. Also | |||||
| useful as a marker for renal | |||||
| diseases, because of its high | |||||
| expression in kidney. | |||||
| 45 | hh14180 | 1036 | Full | (Threonin)-0-binding | Has a region having 99% |
| length | N-acetylglucosamine transferase, | homology to | |||
| which controls activities of various | N-acetylglucosaminyl | ||||
| proteins including a transcription | transferase 110 KDA | ||||
| factor, a nuclear membrane protein, | subunit, and has TPR | ||||
| a cytoskeletal protein and a | motifs. | ||||
| cancer-related protein within the | |||||
| nucleus and cytoplasm. Useful in | |||||
| diagnosing and treating various | |||||
| diseases, such as cancer, and | |||||
| screening for the therapeutic agent. | |||||
| 46 | hj02562 | 277 | Partial | A protein which may function as a | Has a region having 88% |
| sequence | co-activator in RNA polymerase II | homology to PC2 glutamine | |||
| complexes. Possible involvement in | rich binding protein. | ||||
| cranial nerve diseases, such as | |||||
| Alzheimer's disease and | |||||
| Parkinson's disease, because they | |||||
| have glutamate repeats. Useful in | |||||
| diagnosing cranial nerve diseases, | |||||
| such as Alzheimer's disease and | |||||
| Parkinson's disease, and as a | |||||
| target therapeutic agent to be | |||||
| developed. | |||||
| 47 | hj03865 | 1115 | Partial | Has 98% homology to a | Partially has a region |
| sequence | huntingtin-associated protein | having 98% homology to | |||
| interacting protein (HAPIP) which | huntingtin-associated | ||||
| binds to a protein (Duo) binding to | protein interacting | ||||
| huntingtin, the cause of | protein, and has a RhoGEF | ||||
| Huntington's chorea. High | and a PH domain motif. | ||||
| expression in the brain. UNC-73, | |||||
| the C. elegans homologue of HAPIP, | |||||
| has been shown to involve axonal | |||||
| guidance. Suggested to be involved | |||||
| in signal transduction, because it | |||||
| has the RhoGEF motif. Inferred to | |||||
| be useful in diagnosing and treating | |||||
| Huntington's chorea. Useful as a | |||||
| target gene for developing an agent | |||||
| for nerve regeneration because of | |||||
| the involvement in axonal guidance. | |||||
| 48 | hj05256 | 783 | Partial | Inferred to be a transcription | Partially has a region |
| sequence | factor, since the protein has the | having 48% homology to | |||
| zinc finger motif. A deletion or a | zinc finger protein 91, | ||||
| mutation in the protein may cause | and has zf-C2H2 motifs. | ||||
| abnormalities in morphogenesis and | |||||
| cell proliferation. Detection of a | |||||
| mutation in the gene is useful in | |||||
| diagnosing cancer, and introduction | |||||
| of the normal gene is useful in | |||||
| treating cancer. | |||||
| 49 | hk02174 | 797 | Partial | A protein, which is accumulated in | Partially has a region |
| sequence | significant amount in the | having 94% homology to | |||
| post-synaptic density of excitable | proline rich synapse | ||||
| synapses. Inferred to be a gene | associated protein 2, and | ||||
| encoding a protein which anchors | has a SAM motif. | ||||
| SAP90/PSD-95, the scaffold for a | |||||
| membrane receptor, to the | |||||
| cytoskeleton in synapses using | |||||
| glutamate in the central nerve | |||||
| system. | |||||
| The protein may have influence on the | |||||
| generation of the neural network, | |||||
| and establishment of memory and | |||||
| learning. Useful in diagnosing | |||||
| various neuropsychiatric disorders, | |||||
| and screening for the therapeutic | |||||
| agent. | |||||
| 50 | pf00330s1 | 1043 | Full | A protein, the scaffold for ephr in B, | Partially has a region |
| length | which plays an important role by | having 87% homology to | |||
| guiding axial filaments in the | glutamate receptor | ||||
| embryogenesis, to form a complex | interacting protein 2, | ||||
| that transduces signal. Inferred | and has PDZ motifs. | ||||
| to involve neural circuit formation. | |||||
| Useful in gene diagnosis and the | |||||
| field of regeneration medicine. | |||||
| 51 | pf00447 | 421 | Partial | It may bind to a protein having the | Partially has a region |
| sequence | SH3 domain, because the protein is | having 41% homology to | |||
| homologous to SH3-domain binding | SH3-domain binding | ||||
| protein. Since the protein having | protein 5 | ||||
| the SH3-domain is often involved in | (BTK-associated). | ||||
| intracellular signal transduction, | |||||
| it can be inferred that the protein | |||||
| has similar functions. Useful in | |||||
| diagnosing and treating cancer, and | |||||
| screening for the therapeutic agent. | |||||
| 52 | pg00239 | 1644 | Partial | Inferred to perform protein | Partially has a region |
| sequence | interaction, since the protein has | having 30% homology to | |||
| the ankyrin repeat. Possible | ankyrin 3, and has ank | ||||
| involvement in signal transduction | repeat motifs. | ||||
| and transcriptional control. | |||||
| Useful in diagnosing and treating | |||||
| cancer, and screening for the | |||||
| therapeutic agent. | |||||
| 53 | pg00264 | 534 | Partial | Inferred to be sialyltransferase, | Partially has a region |
| sequence | and involve post-translational | having 54% homology to | |||
| modification of protein. Useful in | CMP-N-acetylneuraminate- | ||||
| treating, preventing and diagnosing | β-galactosamide-α-2, | ||||
| cancer, and screening for the drug. | 6-siaryltransferase, and | ||||
| Also useful in modifying the sugar | has a sosui transmembrane | ||||
| chain of a recombinant protein, | motif and a | ||||
| similar to a human type. | Glyco_transf_29 motif. | ||||
| 54 | pg00933 | 1768 | Partial | A motor molecule which converts ATP | Partially has a region |
| sequence | (chemical energy) into physical | having 98% homology to | |||
| force so as to move along | ubiqutinating enzyme | ||||
| microtubules. While dyneins | E2-230 kDa. | ||||
| involved in mitosis, vesicle | |||||
| transport, and the movement of cilia | |||||
| and fragella exist as multisubunit | |||||
| complexes, the protein functions as | |||||
| 1β dynein heavy chain which is a | |||||
| component of the complex. Useful in | |||||
| diagnosing and treating cancer, and | |||||
| screening for the therapeutic agent. | |||||
| Also useful in diagnosing cranial | |||||
| nerve diseases, such as | |||||
| hydrencephaly, infertility and | |||||
| respiratory apparatus-related | |||||
| diseases. | |||||
| 55 | ph00331 | 1313 | Partial | Inferred to be ubiquitin-binding | Partially has a region |
| sequence | enzyme. It is known that with an | having 73% homology to | |||
| abnormal ubiquitinating process, | dynein heavy chain | ||||
| cells are unable to differentiate | isotype 6. | ||||
| and proliferate, inducing various | |||||
| diseases including cancer and | |||||
| Parkinson's disease. Useful in | |||||
| screening for the therapeutic agent | |||||
| of these diseases. | |||||
| 56 | pj01645 | 765 | Partial | Inferred to be a gene involved in | Partially has a region |
| sequence | cilia formation. Useful in | having 76% homology to | |||
| diagnosing and treating respiratory | KPL2. | ||||
| diseases and cilia dysfunction. | |||||
| 57 | pj01649 | 439 | Full | Many microtubule-binding proteins | Partially has a region |
| length | are present in neurons, and involve | having 58% homology to | |||
| neural axial filament formation. | putative | ||||
| Therefore abnormal | microtubule-associated | ||||
| microtubule-binding proteins affect | protein. | ||||
| neurogenesis and cause malformation | |||||
| and teratogeny. Useful in | |||||
| diagnosing and treating cancer, and | |||||
| screening for the therapeutic agent. | |||||
| Also useful in gene diagnosis of | |||||
| congenital diseases and the field of | |||||
| nerve regeneration medicine. | |||||
| 58 | bf00083 | 879 | Full | A pyruvate dehydrogenase | Has a region having 91% |
| length | phosphatase activity regulatory | homology to pyruvate | |||
| subunit. Inferred to involve | dehydrogenase | ||||
| regulating sugar metabolism. | phosphatase regulatory | ||||
| Useful in diagnosing and treating | subunit precursor, and | ||||
| cancer, and screening for the | has a DAO, a Phytoene_dh | ||||
| therapeutic agent. Also useful in | and a GCV_T motifs. | ||||
| screening for an antiobestic agent. | |||||
| 59 | bf00135 | 699 | Partial | Kinesin light chain, the motor | Partially has a region |
| sequence | protein which moves along | having 36% homology to | |||
| microtubules. Inferred to involve | kinesin light chain, and | ||||
| the intracellular transport of | has TPR motifs. | ||||
| substances. Directly binds amyloid | |||||
| protein precursor (APP), the | |||||
| causative agent of Alzheimer with | |||||
| substances, so as to transport the | |||||
| substances along neural axial | |||||
| filaments in neurons. Useful in | |||||
| preventing diseases involved in the | |||||
| intracellular transport of | |||||
| substances; and diagnosing and | |||||
| treating Alzheimer, and screening | |||||
| for the therapeutic agent. | |||||
| 60 | bg00184 | 1179 | Partial | A novel transcription factor. Many | Partially has a region |
| sequence | of them are present as a nuclear | having 99% homology to | |||
| protein in the cerebellum. Useful | TFNR. | ||||
| in diagnosing and treating cancer, | |||||
| and screening for the therapeutic | |||||
| agent. | |||||
| 61 | bj00061 | 802 | — | A protein analogous to endozepine, | Partially has a region |
| the ligand of the receptor of | having 80% homology to | ||||
| benzodiazepine which is classified | endodiazepine-related | ||||
| as an antianxiety agent or sedative | protein precursor, and | ||||
| drug/hypnotics. Useful as an | has an ACBP motif and a | ||||
| analgesic agent, antianxiety agent | sosui transmembrane | ||||
| and anticonvulsant in diagnosing, | motif. | ||||
| preventing and treating nervous | |||||
| diseases. | |||||
| 62 | bj00195 | 1194 | Partial | Type 1 hexokinase, which is | Partially has a region |
| sequence | transcribed upon spermatogenesis. | having 94% homology to | |||
| The protein is present in the | cytoplasmic dynein heavy | ||||
| acrosome of a sperm, and functions as | chain 2. | ||||
| a receptor for ZP3 protein, the | |||||
| pellucid zone of an egg, upon | |||||
| fertilization. Useful in | |||||
| discriminating the maturity of | |||||
| sperms and suppressing the function | |||||
| of sperm. Also useful in diagnosing | |||||
| and treating infertility, and | |||||
| contraception. | |||||
| 63 | fg01285 | 1560 | Partial | A protein analogous to myosin, which | Partially has a region |
| sequence | is involved in intracellular | having 35% homology to | |||
| transport and induces dysgenic | myosin XV, and has a | ||||
| congenital asymptomatic auditory | myosin_head motif and a | ||||
| disorder DFNB3. Useful in | MyTH4 motif. | ||||
| preventing, diagnosing and treating | |||||
| nervous diseases involving | |||||
| intracellular transport. Also | |||||
| useful in the filed of medicine of | |||||
| nerve regeneration. | |||||
| 64 | fh17057 | 958 | Partial | Inferred to be breakpoint cluster | Present on chromosome 14, |
| sequence | region protein 2, the product of a | partially has a region | |||
| house keeping gene which encodes a | having 99% homology to | ||||
| protein necessary for cell | breakpoint cluster | ||||
| survival. Useful in diagnosing | region protein 2, and has | ||||
| and treating cancer, and screening | WD40 motifs. | ||||
| for the therapeutic agent. | |||||
| 65 | ha06731 | 715 | Partial | An analogous protein of HrPOPK-1, | Partially has a region |
| sequence | which is inferred to have | having 51% homology to | |||
| serine/threonine kinase activity, | HrPOPK-1, and has a sosui | ||||
| and have regulatory functions in | transmembrane motif. | ||||
| generation/differentiation, such as | |||||
| determination of the embryonic axis. | |||||
| Useful in gene diagnosis of | |||||
| congenital abnormalities and | |||||
| teratogeny, and in the field of | |||||
| regeneration medicine. Further, | |||||
| useful in diagnosing and treating | |||||
| cancer, and screening for the | |||||
| therapeutic agent. | |||||
| 66 | hj05226 | 105 | — | Homologous to a part of EGF-like | Partially has a region |
| domains in a protein (MEGF) having | having 52% homology to | ||||
| many EGF-like domains. It is known | MEGF6, and has EGF | ||||
| that mutations in the domains affect | motifs. | ||||
| cell-to-cell interaction in the | |||||
| brain and ligand-receptor | |||||
| interaction, so as to cause auxesis | |||||
| of the nerve system or | |||||
| disorganization of the brain cortex, | |||||
| thus induces dementia or the like. | |||||
| Useful in diagnosing and treating | |||||
| diseases of the brain and the nervous | |||||
| system. | |||||
| 67 | pf01012 | 1192 | — | Homologous to a part of EGF-like | Partially has a region |
| domains in a protein (MEGF) having | having 32% homology to | ||||
| many EGF-like domains. It is known | MEGF6, and has EGF | ||||
| that mutations in the domains affect | motifs. | ||||
| cell-to-cell interaction in the | |||||
| brain and ligand-receptor | |||||
| interaction, so as to cause auxesis | |||||
| of the nerve system or | |||||
| disorganization of the brain cortex, | |||||
| thus induces dementia or the like. | |||||
| Useful in diagnosing and treating | |||||
| diseases of the brain and the nervous | |||||
| system. | |||||
| 68 | fg02852 | 350 | Partial | An analogous protein of p150-Spir | Partially has a region |
| sequence | protein which regulates | having 42% homology to | |||
| reconstruction of actin by being | p150-Spir protein. | ||||
| phosphorylated with | |||||
| stress-responsive phosphoenzyme | |||||
| JNK. Useful in diagnosing and | |||||
| treating cancer, and screening for | |||||
| the therapeutic agent. | |||||
| 69 | fh21913a | 244 | Partial | A protein analogous to fibrillin | Partially has a region |
| sequence | which is a major component of a thin | having 74% homology to | |||
| fiber network formed by assembly of | fibrillin 5, and has EGF | ||||
| elastin proteins and is present | motifs and a TB motif. | ||||
| extensively over the connective | |||||
| tissue. With its possible | |||||
| involvement in a hereditary disease, | |||||
| Marfans syndrome, associated with | |||||
| cardiovascular and visual | |||||
| disorders, it is useful in the | |||||
| diagnosis and the treatment. | |||||
| 70 | fj22564 | 1299 | — | A protein having C2H2 type zinc | Partially has a region |
| finger motifs. One of intranuclear | having 96% homology to | ||||
| proteins expressed in embryonic stem | zinc finger protein and | ||||
| cells. Inferred to involve | has zf-C2H2 motifs. | ||||
| development, differentiation and | |||||
| proliferation. With possible | |||||
| involvement in development of early | |||||
| embryos, it is inferred to involve | |||||
| cell proliferation or | |||||
| differentiation. Thus it is useful | |||||
| in diagnosing and treating cancer, | |||||
| and screening for the therapeutic | |||||
| agent. Also it is useful in | |||||
| regeneration medicine or gene | |||||
| diagnosis of congenital | |||||
| abnormalities and teratogeny. | |||||
(3) Homology Search for the DNA of the Present Invention
Next, based on the thus obtained full-length nucleotide sequences, the amino acid sequences of the clones were searched on the library of known sequences, nr release 122, using an analysis program BLASTP 2.0.14 (the above-mentioned “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs”). Thus, it was shown that the clones were homologous to each homologous genes listed in Table 2. Table 2 shows the information on these homologous genes, specifically, the name, database ID, biological species, nomenclature, protein length and the literature containing the information.
| TABLE 2 |
| Homologous Gene of Each Gene and Biological Species |
| SEQ | Homologous gene |
| ID | Database | Biological | Protein | ||
| NO: | Name | ID | species※ | length | Literature |
| 1 | coronin, actin binding protein | gi|6753496 | Mouse | 474 | DNA Cell Biol. 17 (9), |
| 1C | 779-787 (1998) | ||||
| 2 | zinc finger protein 91 | gi|4508041 | Human | 1191 | Proc. Natl. Acad. Sci. |
| U.S.A. 88 (9), | |||||
| 3608-3612 (1991) | |||||
| 3 | immunoglobulin superfamily | gi|7657226 | Human | 442 | Genomics 62 (2), |
| 139-146 (1999) | |||||
| 4 | NOV/plexin-A1 protein | emb|CAB57274.1| | Human | 1754 | Proc. Natl. Acad. Sci. |
| U.S.A. 93 (2), 674-678 | |||||
| (1996) | |||||
| 5 | neuronal guanine nucleotide | gi|9845277 | Mouse | 554 | Genomics 65 (1), 53-61 |
| exchange factor | (2000) | ||||
| 6 | EVI1 protein | pir||S41705 | Human | 1042 | EMBO J. 13 (3), |
| 504-510 (1994) | |||||
| 7 | acetyl-coenzyme A synthetase | gb|AAG08119.1|AE004887_3 | Bacillus of green pus | 645 | Nature 406 (6799), |
| 959-964 (2000) | |||||
| 8 | proline dehydrogenase | gb|AAD24775.1|AF120278_1 | Human | 516 | Nat. Genet. 21 (4), |
| 434-439 (1999) | |||||
| 9 | alpha 1,2-mannosidase | gi|7706437 | Human | 699 | Glycobiology 9 (10), |
| 1073-1078 (1999) | |||||
| 10 | NIM3 | gb|AAF81657.1|AF199335_1 | Rat | 285 | J. Biol. Chem. 275 |
| (26), 20033-20044 | |||||
| (2000) | |||||
| 11 | hydroxyproline-rich | emb|CAB62280.1| | Volvox | 409 | J. Biol. Chem. 274 |
| glycoprotein DZ-HRGP | (49), 35023-35028 | ||||
| (1999) | |||||
| 12 | Netrin-G1c | dbj|BAB12008.1| | Mouse | 438 | J. Neurosci. 20 (17), |
| 6540-6550 (2000) | |||||
| 13 | guanine nucleotide-releasing | gi|4885357 | Human | 1077 | Proc. Natl. Acad. Sci. |
| factor 2 | U.S.A. 91 (8), | ||||
| 3443-3447 (1994) | |||||
| 14 | Ran GTPase activating protein 1 | gi|4506411 | Human | 587 | Proc. Natl. Acad. Sci. |
| U.S.A. 91 (7), | |||||
| 2587-2591 (1994) | |||||
| 15 | karyopherin beta 2b, | gi|7305595 | Human | 887 | J. Cell Biol. 138 |
| transportin | (6), 1181-1192 (1997) | ||||
| 16 | PTH-responsive osteosarcoma | gb|AAD25981.1|AF095771_1 | Human | 802 | Bone 24 (4), 305-313 |
| B1 protein | (1999) | ||||
| 17 | Cdc25C associated protein | gb|AAC15093.1| | Human | 729 | Cell Growth Differ. 9 |
| kinase C-TAK1 | (3), 197-208 (1998) | ||||
| 18 | FRANK2 protein | emb|CAB96906.1| | Hawaii's | 1596 | Genome Res. 10 (8), |
| sea urchin | 1194-1203 (2000) | ||||
| 19 | protein kinase WNK1 | gb|AAF74258.1|AF227741_1 | Rat | 2126 | J. Biol. Chem. 275 |
| (22), 16795-16801 | |||||
| (2000) | |||||
| 20 | putative splicing factor | gb|AAD55973.1|AF144731_1 | Rat | 738 | Mol. Biol. Cell 10 |
| YT521-B | (11), 3909-3926 | ||||
| (1999) | |||||
| 21 | SNAP-25-interacting protein | gi|9507127 | Rat | 1197 | J. Biol. Chem. 275 |
| (2), 1191-1200 (2000) | |||||
| 22 | PUTATIVE PREOPTIC REGULATORY | sp|P18890|PRF2— | Rat | 75 | Mol. Endocrinol. 4 |
| FACTOR-2 PRECURSOR | (8), 1205-1210 (1990) | ||||
| 23 | adenosine deaminase acting on | gi|6912230 | Human | 502 | Proc. Natl. Acad. Sci. |
| tRNA 1 | U.S.A. 96 (16), | ||||
| 8895-8900 (1999) | |||||
| 24 | TTYH1 | gb|AAG02580.1|AF177909_1 | Human | 450 | Genomics 68 (1), |
| 89-92 (2000) | |||||
| 25 | P116 RHO-INTERACTING PROTEIN | sp|P97434|RIP3 | Mouse | 1024 | J. Cell Biol. 137 (7), |
| (P116RIP) (RIP3) | 1603-1613 (1997) | ||||
| 26 | microtubule-associated | gi|4505099 | Human | 1152 | Cell Motil. |
| protein 4 | Cytoskeleton 23 (4), | ||||
| 236-243 (1992) | |||||
| 27 | OXYSTEROL-BINDING PROTEIN | sp|P16258|OXYB | Rabbit | 809 | J. Biol. Chem. 264 |
| (28), 16798-16803 | |||||
| (1989) | |||||
| 28 | ring canal protein | gb|AAA53472.2| | Fruit fly | 1477 | Cell 72 (5), 681-693 |
| (1993) | |||||
| 29 | cell recognition molecule | gi|7662350 | Human | 1331 | Neuron 24 (4), |
| Caspr2 | 1037-1047 (1999) | ||||
| 30 | GTP-rho binding protein 1 | gi|6680085 | Mouse | 643 | Science 271 (5249), |
| 645-648 (1996) | |||||
| 31 | INOSITOL 1,4,5-TRISPHOSPHATE | sp|P27987|IP3L | Human | 505 | Biochem. J. 278 (Pt |
| 3-KINASE (IP3K) | 3), 883-886 (1991) | ||||
| 32 | FH1/FH2 domain-containing | gi|7019375 | Human | 1164 | Gene 232 (2), 173-182 |
| protein FHOS | (1999) | ||||
| 33 | SERINE/THREONINE-PROTEIN | sp|008875|DCK1 | Rat | 433 | J. Mol. Neurosci. 10 |
| KINASE DCAMKL1 | (2), 75-98 (1998) | ||||
| 34 | 1 beta dynein heavy chain | emb|CAB99316.1| | Chlamydomonas | 4513 | Mol. Biol. Cell 11 |
| (7), 2297-2313 (2000) | |||||
| 35 | rsec8 | pir||I59422 | Rat | 975 | Proc. Natl. Acad. Sci. |
| U.S.A. 92 (21), | |||||
| 9613-9617 (1995) | |||||
| 36 | nuclear dual-specificity | gb|AAC39675.1| | Human | 1697 | Nature Genet. 18 (4), |
| phosphatase | 331-337 (1998) | ||||
| 37 | phosphatidic acid-preferring | gb|AAC03019.1| | Bovine | 875 | J. Biol. Chem. 273 |
| phospholipase A1 | (1998) 5468-5477 | ||||
| 38 | chromobox homolog 8 | gi|7304947 | Mouse | 362 | Gene 242 (1-2), 31-40 |
| (2000) | |||||
| 39 | polymerase I and transcript | gi|6679567 | Mouse | 392 | EMBO J. 17 (10), |
| release factor | 2855-2864 (1998) | ||||
| 40 | pyruvate dehydrogenase | gb|AAC48785.1| | Bovine | 878 | J. Biol. Chem. 272 |
| phosphatase regulatory | (50), 31625-31629 | ||||
| subunit precursor | (1997) | ||||
| 41 | collagen alpha 1(V) chain | pir||CGHU1V | Human | 1838 | J. Biol. Chem. 261 |
| precursor | (11), 5034-5040 | ||||
| (1986) | |||||
| 42 | TUBULIN BETA-5 CHAIN | sp|P09653|TBB5— | Gallus | 446 | Mol. Cell. Biol. 6 |
| (BETA-TUBULIN CLASS-V) | CHICK | (12), 4409-4418 | |||
| (1986) | |||||
| 43 | PROTEOGLYCAN LINK PROTEIN | sp|P07354|PLK_CHICK | Gallus | 355 | Proc. Natl. Acad. Sci. |
| PRECURSOR (CARTILAGE LINK | U.S.A. 83 (11), | ||||
| PROTEIN) | 3766-3770 (1986) | ||||
| 44 | FAT tumor suppressor | gi|4885229 | Human | 4590 | Genomics 30 (2), |
| 207-223 (1995) | |||||
| 45 | N-ACETYLGLUCOSAMINYLTRANSFERASE | sp|P56558|OGT1 | Rat | 1036 | J. Biol. Chem. 272 |
| 110 KDA SUBUNIT | (14), 9308-9315 | ||||
| (1997) | |||||
| 46 | OPA-containing protein 1 | gb|AAC83164.1| | Mouse | 2074 | Mol. Psych. 3 (4), |
| 303-309 (1998) | |||||
| 47 | huntingtin-associated protein | gi|4504335 | Human | 1663 | Hum. Mol. Genet. 6 |
| interacting protein | (9), 1519-1525 (1997) | ||||
| 48 | zinc finger protein 91 | gi|4508041 | Human | 1191 | Proc. Natl. Acad. Sci. |
| U.S.A. 88 (9), | |||||
| 3608-3612 (1991) | |||||
| 49 | Proline rich synapse | emb|CAB45688.1| | Rat | 1806 | Biochem. Biophys. |
| associated protein 2 | Res. Commun. 264, | ||||
| 2476-2528 (1999) | |||||
| 50 | glutamate receptor | gb|AAD25916.1|AF072509_1 | Rat | 1043 | Neuron 22, 511-524 |
| interacting protein 2 | (1999) | ||||
| 51 | SH3-domain binding protein 5 | gi|4759058 | Human | 425 | Biochem. Biophys. |
| (BTK-associated) | Res. Commun. 245 (2), | ||||
| 337-343 (1998) | |||||
| 52 | ankyrin 3 | gb|AAB01607.1| | Mouse | 1961 | J. Cell Biol. 130 |
| (2), 313-330 (1995) | |||||
| 53 | CMP-N-ACETYLNEURAMINATE-BETA- | sp|Q92182|CAG1— | Gallus | 413 | Eur. J. Biochem. 219 |
| GALACTOSAMIDE-ALPHA-2, | CHICK | (1-2), 375-381 (1994) | |||
| 6-SIALYLTRANSFERASE | |||||
| 54 | dynein heavy chain isotype 6 | pir||T30298 | Globe fish | 1125 | Mol. Biol. Cell 5 (1), |
| 57-70 (1994) | |||||
| 55 | ubiquitinating enzyme E2-230 kDa | pir||I49264 | Mouse | 299 | Proc. Natl. Acad. |
| Sci. U.S.A. 92 (11), | |||||
| 4982-4986 (1995) | |||||
| 56 | KPL2 | gb|AAD56310.1|AF102129_1 | Rat | 1744 | Am. J. Respir. Cell |
| Mol. Biol. 20 (4), | |||||
| 675-683 (1999) | |||||
| 57 | putative microtubule | gb|AAC79958.1| | Gallus | 369 | J. Med. Dent. Sci. 45, |
| associated protein | 123-133 (1998) | ||||
| 58 | pyruvate dehydrogenase | gb|AAC48785.1| | Bovine | 878 | J. Biol. Chem. 272 |
| phosphatase regulatory | (50), 31625-31629 | ||||
| subunit precursor | (1997) | ||||
| 59 | kinesin light chain | gb|AAB87735.1| | Plectonema | 490 | DNA Cell Biol. 16 (6), |
| 787-795 (1997) | |||||
| 60 | TFNR | emb|CAC21448.1| | Human | 2187 | Genomics 70, 315-326 |
| (2000) | |||||
| 61 | ENDOZEPINE-RELATED PROTEIN | sp|P07106|ENDR | Bovine | 533 | DNA 6 (1), 71-79 |
| PRECURSOR | (1987) | ||||
| 62 | cytoplasmic dynein heavy chain 2 | gi|12711694 | Rat | 4306 | Mol. Biol. Cell 9, 276 |
| (1998) | |||||
| 63 | Myosin XV | gi|6754780 | Mouse | 3511 | Genomics 61 (3), |
| 243-258 (1999) | |||||
| 64 | breakpoint cluster region | gb|AAC08965.1| | Human | 510 | Genomics 52 (1), 17-26 |
| protein 2 | (1998) | ||||
| 65 | HrPOPK-1 | dbj|BAA28663.1| | Ascidian | 698 | Mech. Dev. 76 (1-2), |
| 161-163 (1998) | |||||
| 66 | MEGF6 | gi|12621134 | Rat | 1574 | Genomics 51 (1), 27-34 |
| (1998) | |||||
| 67 | MEGF6 | gi|12621134 | Rat | 1574 | Genomics 51 (1), 27-34 |
| (1998) | |||||
| 68 | p150-Spir protein | emb|CAB62901.1| | Fruit fly | 1020 | Curr. Biol. 10 (6), |
| 345-348 (2000) | |||||
| 69 | fibrillin 5 | emb|CAB56757.1| | Human | 754 | Nature 352 (6333), |
| 330-334 (1991) | |||||
| 70 | zinc finger protein | pir||B38203 | Mouse | 191 | Genes Dev. 6 (6), |
| 903-918 (1992) | |||||
※Nomenclature of each biological species is as follows: mouse = Mus musculus; human = Homo sapiens; bacillus of green pus = Pseudomonas aeruginosa; rat = Rattus norvegicus; volvox = Volvox carteri f. nagariensis; Hawaii's sea urchin = Tripneustes gratilla; rabbit = Oryctolagus cuniculus; fruit fly = Drosophila melanogaster; chlamydomonas = Chlamydomonas reinhardtii; |
|||||
| # bovine = Bos taurus; gallus = Gallus gallus; globe fish = Takifugu rubripes; plectonema = Plectonema boryanum; ascidian = Halocynthia roretzi. |
Table 3 summarizes a variety of data concerning homology between the DNA or the gene of the present invention contained in each clone and each homologous gene listed in Table 2. The meaning of each item in Table 3 is as follows:
- Score: the higher the value, the higher the reliability
- E-value: the closer this value to 0, the higher the reliability
- Starting point: an amino acid position as a starting point of the homologous region
- End point: an amino acid position as an end point of the homologous region
- Homology: the proportion (degree) of amino acid residues that are identical in a homologous region.
Homologous region %: the proportion (%) of a homologous region in a homologous gene.
| TABLE 3 |
| Homology between each gene and homologous gene |
| Homologous region |
| Homologous | |||
| SEQ | clone | gene | Homology value |
| ID | Starting | End | Starting | End | Homologous | |||
| NO: | point | point | point | point | Score | E-value | Homology | region % |
| 1 | 20 | 318 | 211 | 472 | 295 | 4e−79 | 50% | (155/310) | 55% |
| 2 | 1 | 183 | 975 | 1166 | 156 | 3e−37 | 42% | (81/192) | 16% |
| 3 | 20 | 187 | 259 | 442 | 122 | 3e−27 | 39% | (74/187) | 42% |
| 4 | 1 | 1324 | 278 | 1601 | 2708 | 0 | 99% | (1321/1324) | 75% |
| 5 | 71 | 217 | 322 | 468 | 266 | 2e−70 | 91% | (135/147) | 27% |
| 6 | 4 | 653 | 294 | 923 | 599 | e−170 | 51% | (343/661) | 60% |
| 7 | 1 | 235 | 303 | 534 | 325 | 3e−88 | 60% | (142/235) | 36% |
| 8 | 51 | 193 | 283 | 425 | 275 | 3e−73 | 93% | (134/143) | 28% |
| 9 | 92 | 373 | 418 | 699 | 591 | e−168 | 100% | (282/282) | 40% |
| 10 | 6 | 215 | 76 | 285 | 303 | 9e−82 | 68% | (143/210) | 74% |
| 11 | 875 | 1130 | 27 | 277 | 144 | 6e−33 | 37% | (96/256) | 61% |
| 12 | 36 | 380 | 28 | 372 | 444 | e−124 | 57% | (199/346) | 79% |
| 13 | 47 | 505 | 619 | 1077 | 928 | 0 | 100% | (459/459) | 43% |
| 14 | 37 | 530 | 1 | 494 | 963 | 0 | 100% | (494/494) | 84% |
| 15 | 165 | 1051 | 1 | 887 | 1794 | 0 | 98% | (874/887) | 100% |
| 16 | 62 | 856 | 1 | 755 | 1499 | 0 | 94% | (753/795) | 94% |
| 17 | 2 | 669 | 1 | 655 | 816 | 0 | 64% | (435/674) | 90% |
| 18 | 2 | 998 | 515 | 1592 | 593 | e−168 | 35% | (398/1127) | 68% |
| 19 | 187 | 748 | 739 | 1328 | 189 | 9e−47 | 30% | (188/625) | 28% |
| 20 | 1 | 480 | 251 | 738 | 1001 | 0 | 97% | (476/488) | 66% |
| 21 | 1 | 718 | 457 | 1173 | 1364 | 0 | 94% | (683/719) | 60% |
| 22 | 1020 | 1094 | 1 | 75 | 152 | 1e−35 | 98% | (74/75) | 100% |
| 23 | 26 | 388 | 97 | 459 | 738 | 0 | 99% | (360/363) | 72% |
| 24 | 6 | 413 | 7 | 417 | 306 | 3e−82 | 39% | (163/411) | 91% |
| 25 | 1063 | 1644 | 383 | 975 | 452 | e−125 | 44% | (273/611) | 58% |
| 26 | 140 | 913 | 332 | 1089 | 835 | 0 | 61% | (491/793) | 66% |
| 27 | 54 | 878 | 20 | 809 | 965 | 0 | 60% | (498/830) | 98% |
| 28 | 1 | 278 | 408 | 684 | 136 | 3e−31 | 32% | (91/284) | 19% |
| 29 | 1 | 705 | 597 | 1329 | 663 | 0 | 46% | (343/736) | 55% |
| 30 | 94 | 259 | 160 | 325 | 267 | 1e−70 | 80% | (133/166) | 26% |
| 31 | 319 | 519 | 3 | 203 | 419 | e−116 | 100% | (201/201) | 40% |
| 32 | 2 | 361 | 216 | 569 | 182 | 2e−44 | 37% | (142/379) | 30% |
| 33 | 308 | 445 | 75 | 212 | 152 | 7e−36 | 51% | (71/138) | 32% |
| 34 | 1 | 1353 | 3205 | 4512 | 966 | 0 | 37% | (515/1363) | 29% |
| 35 | 1 | 966 | 9 | 975 | 1816 | 0 | 95% | (921/967) | 99% |
| 36 | 110 | 1762 | 5 | 1630 | 1828 | 0 | 57% | (957/1674) | 96% |
| 37 | 4 | 498 | 381 | 875 | 979 | 0 | 95% | (475/495) | 57% |
| 38 | 1 | 389 | 1 | 362 | 667 | 0 | 87% | (341/389) | 100% |
| 39 | 1 | 380 | 11 | 392 | 682 | 0 | 92% | (355/382) | 97% |
| 40 | 1 | 360 | 519 | 878 | 715 | 0 | 93% | (336/360) | 41% |
| 41 | 2 | 592 | 634 | 1274 | 545 | e−154 | 46% | (304/647) | 35% |
| 42 | 14 | 369 | 90 | 445 | 720 | 0 | 97% | (346/356) | 80% |
| 43 | 36 | 376 | 19 | 353 | 361 | 7e−99 | 49% | (171/345) | 94% |
| 44 | 3 | 615 | 2979 | 3576 | 255 | 1e−66 | 30% | (189/618) | 13% |
| 45 | 1 | 1036 | 1 | 1036 | 2117 | 0 | 99% | (1030/1036) | 100% |
| 46 | 129 | 263 | 1911 | 2052 | 101 | 7e−21 | 50% | (72/144) | 7% |
| 47 | 53 | 1115 | 588 | 1663 | 2132 | 0 | 98% | (1063/1076) | 65% |
| 48 | 66 | 760 | 425 | 1157 | 744 | 0 | 48% | (365/758) | 62% |
| 49 | 1 | 797 | 1010 | 1806 | 1504 | 0 | 94% | (754/799) | 44% |
| 50 | 4 | 1043 | 11 | 1043 | 1814 | 0 | 87% | (912/1040) | 99% |
| 51 | 80 | 365 | 7 | 269 | 213 | 2e−54 | 41% | (120/287) | 62% |
| 52 | 658 | 1057 | 213 | 611 | 149 | 2e−34 | 30% | (126/413) | 20% |
| 53 | 211 | 524 | 100 | 413 | 371 | e−102 | 54% | (172/315) | 76% |
| 54 | 717 | 1768 | 1 | 1047 | 1570 | 0 | 73% | (774/1060) | 93% |
| 55 | 129 | 368 | 1 | 240 | 497 | e−139 | 98% | (236/240) | 80% |
| 56 | 6 | 735 | 965 | 1715 | 1195 | 0 | 76% | (579/753) | 43% |
| 57 | 1 | 439 | 1 | 369 | 472 | e−132 | 58% | (258/440) | 100% |
| 58 | 1 | 879 | 1 | 878 | 1680 | 0 | 91% | (804/878) | 100% |
| 59 | 264 | 557 | 179 | 446 | 153 | 5e−36 | 36% | (108/294) | 55% |
| 60 | 1 | 742 | 1446 | 2187 | 1463 | 0 | 99% | (741/742) | 34% |
| 61 | 6 | 437 | 93 | 533 | 722 | 0 | 80% | (357/443) | 83% |
| 62 | 1 | 1194 | 3113 | 4306 | 2274 | 0 | 94% | (1126/1194) | 28% |
| 63 | 146 | 965 | 1653 | 2499 | 494 | e−138 | 35% | (319/888) | 24% |
| 64 | 278 | 787 | 1 | 510 | 1048 | 0 | 99% | (508/510) | 100% |
| 65 | 1 | 650 | 44 | 647 | 611 | e−174 | 51% | (346/678) | 87% |
| 66 | 4 | 94 | 330 | 419 | 117 | 5e−26 | 52% | (48/91) | 6% |
| 67 | 74 | 892 | 32 | 1002 | 499 | e−139 | 32% | (315/982) | 62% |
| 68 | 62 | 318 | 213 | 456 | 189 | 6e−47 | 42% | (109/259) | 24% |
| 69 | 1 | 242 | 163 | 405 | 435 | e−121 | 74% | (181/243) | 32% |
| 70 | 798 | 988 | 1 | 191 | 389 | e−106 | 96% | (185/191) | 100% |
(4) Search for Each Domain
Using as queries the amino acid sequence encoded by DNAs contained in the clones, functional domains were searched with a search tool contained in Pfam 6.0 (Pfam HMM ver. 2.1 Search (HMMPFAM), Sonnhammer, E. L. L., Eddy, S. R., Birney, E., Bateman, A., and Durbin, R. (1998) “Pfam: multiple sequence alignments and HMM-profiles of protein domains” Nucleic Acids Res. 26:320-322).
Further, transmembrane domains were searched with a prediction program for membrane proteins, the SOSUI system (ver. 1.0/10, March, 1996) (Takatsugu Hirokawa, Seah Chieng and Shigeki Mitaku, SOSUI: Classification and Secondary Structure Prediction System for Membrane Proteins), Bioinformatics (formerly CABIOS) 1998 May; 14(4):378-379).
Table 4 shows the detected functional domains and transmembrane domains for each clone.
The meaning of each item in Table 4 is as follows:
- Functional domain: a domain detected by Pfam or SOSUI
- Starting point: an amino acid position as a starting point of a functional domain
- End point: an amino acid position as an end point of a functional domain.
- Score (Pfam only): the higher the value, the higher the reliability
- Exp (Pfam only): the closer the value to 0, the higher the reliability
Table 5 shows the complete notation of each functional domain.
| TABLE 4 |
| Functional domain |
| SEQ | Clone | Homologous gene |
| ID | Functional | Starting | End | Functional | Starting | End | ||||
| NO: | domain | point | point | Score | Exp | domain | point | point | Score | Exp |
| 1 | WD40 | 72 | 109 | 33.1 | 6.2e−06 | |||||
| WD40 | 122 | 159 | 28.6 | 0.00015 | ||||||
| WD40 | 166 | 202 | 21.4 | 0.022 | ||||||
| 2 | zf-C2H2 | 45 | 67 | 31.2 | 2.4e−05 | KRAB | 13 | 75 | 159.5 | 5.6e−44 |
| zf-C2H2 | 73 | 95 | 37.1 | 3.9e−07 | zf-C2H2 | 182 | 200 | −1.9 | 1.3e+02 | |
| zf-C2H2 | 123 | 145 | 23.2 | 0.0063 | zf-C2H2 | 210 | 232 | 21.8 | 0.017 | |
| zf-C2H2 | 151 | 173 | 31.3 | 2.2e−05 | zf-C2H2 | 238 | 260 | 33.1 | 6.3e−06 | |
| zf-C2H2 | 179 | 201 | 27.7 | 0.00026 | zf-C2H2 | 266 | 288 | 34 | 3.4e−06 | |
| zf-C2H2 | 261 | 283 | 31.3 | 2.3e−05 | zf-C2H2 | 294 | 316 | 37.9 | 2.3e−07 | |
| zf-C2H2 | 289 | 311 | 38.4 | 1.6e−07 | zf-C2H2 | 322 | 344 | 37.9 | 2.2e−07 | |
| zf-C2H2 | 350 | 372 | 36.1 | 7.8e−07 | ||||||
| zf-C2H2 | 378 | 400 | 34.9 | 1.8e−06 | ||||||
| zf-C2H2 | 406 | 428 | 35.3 | 1.4e−06 | ||||||
| zf-C2H2 | 434 | 456 | 35.3 | 1.4e−06 | ||||||
| zf-C2H2 | 462 | 484 | 33.8 | 3.9e−06 | ||||||
| zf-C2H2 | 490 | 512 | 37.1 | 4e−07 | ||||||
| zf-C2H2 | 518 | 540 | 15.7 | 1.1 | ||||||
| zf-C2H2 | 546 | 568 | 32.4 | 1.1e−05 | ||||||
| zf-C2H2 | 574 | 596 | 34 | 3.4e−06 | ||||||
| zf-C2H2 | 602 | 624 | 34.2 | 3.1e−06 | ||||||
| zf-C2H2 | 630 | 652 | 37.9 | 2.2e−07 | ||||||
| zf-C2H2 | 658 | 680 | 36.1 | 7.8e−07 | ||||||
| zf-C2H2 | 686 | 708 | 34.9 | 1.8e−06 | ||||||
| zf-C2H2 | 714 | 736 | 35.3 | 1.4e−06 | ||||||
| zf-C2H2 | 742 | 764 | 36.8 | 5e−07 | ||||||
| zf-C2H2 | 770 | 792 | 35 | 1.7e−06 | ||||||
| zf-C2H2 | 798 | 820 | 37.3 | 3.4e−07 | ||||||
| zf-C2H2 | 826 | 848 | 34.8 | 2e−06 | ||||||
| zf-C2H2 | 854 | 876 | 37 | 4.2e−07 | ||||||
| zf-C2H2 | 885 | 904 | 11.3 | 6.3 | ||||||
| zf-C2H2 | 910 | 932 | 38.2 | 1.9e−07 | ||||||
| zf-C2H2 | 938 | 960 | 36.5 | 5.9e−07 | ||||||
| zf-C2H2 | 966 | 988 | 34.3 | 2.8e−06 | ||||||
| zf-C2H2 | 994 | 1016 | 39 | 1.1e−07 | ||||||
| zf-C2H2 | 1022 | 1044 | 35.1 | 1.6e−06 | ||||||
| zf-C2H2 | 1050 | 1072 | 33.8 | 3.8e−06 | ||||||
| zf-C2H2 | 1078 | 1100 | 39 | 1.1e−07 | ||||||
| zf-C2H2 | 1106 | 1128 | 32.9 | 7.5e−06 | ||||||
| zf-C2H2 | 1134 | 1156 | 19.5 | 0.081 | ||||||
| 3 | ig | 21 | 87 | 16.9 | 0.0012 | sosui | 16 | 38 | — | — |
| sosui | 120 | 142 | — | — | ig | 57 | 126 | 23.3 | 1.1e−05 | |
| ig | 159 | 222 | 9.6 | 0.21 | ||||||
| ig | 260 | 315 | 36.6 | 8.6e−10 | ||||||
| sosui | 374 | 396 | — | — | ||||||
| 4 | Sema | 14 | 196 | 78.3 | 2.9e−20 | Sema | 29 | 473 | 198.8 | 8.3e−56 |
| Plexin_repeat | 215 | 265 | 58.1 | 1.9e−13 | Plexin_repeat | 492 | 542 | 58.1 | 1.9e−13 | |
| integrin_B | 221 | 237 | 5.1 | 0.18 | integrin_B | 498 | 514 | 5.1 | 0.18 | |
| Plexin_repeat | 361 | 408 | 59.8 | 5.7e−14 | Plexin_repeat | 638 | 685 | 59.8 | 5.7e−14 | |
| Plexin_repeat | 509 | 563 | 50.7 | 3.3e−11 | Plexin_repeat | 786 | 840 | 50.7 | 3.3e−11 | |
| integrin_B | 516 | 535 | 9.4 | 0.006 | integrin_B | 793 | 812 | 9.4 | 0.006 | |
| TIG | 565 | 660 | 75.5 | 1.1e−18 | TIG | 842 | 937 | 75.5 | 1.1e−18 | |
| TIG | 662 | 746 | 86.3 | 6.3e−22 | TIG | 939 | 1023 | 86.3 | 6.3e−22 | |
| TIG | 749 | 848 | 71.3 | 2e−17 | TIG | 1026 | 1125 | 71.3 | 2e−17 | |
| TIG | 851 | 937 | 42.9 | 7.2e−09 | TIG | 1128 | 1214 | 42.9 | 7.2e−09 | |
| sosui | 943 | 965 | — | — | ||||||
| 5 | PH | 83 | 194 | 43.6 | 7.7e−11 | RhoGEF | 121 | 297 | 71.2 | 2.2e−17 |
| PH | 334 | 445 | 42.8 | 1.3e−10 | ||||||
| SH3 | 459 | 515 | 47.3 | 3.3e−10 | ||||||
| 6 | zf-C2H2 | 449 | 471 | 37.3 | 3.4e−07 | zf-C2H2 | 21 | 44 | 26.3 | 0.00074 |
| zf-BED | 462 | 501 | 11.3 | 0.073 | zf-C2H2 | 75 | 97 | 26.5 | 0.00061 | |
| zf-C2H2 | 477 | 500 | 33.5 | 4.8e−06 | zf-C2H2 | 103 | 125 | 35.1 | 1.6e−06 | |
| zf-C2H2 | 506 | 528 | 26.5 | 0.00061 | zf-BED | 116 | 155 | −0.3 | 1.5 | |
| zf-C2H2 | 131 | 154 | 37.2 | 3.8e−07 | ||||||
| zf-C2H2 | 160 | 182 | 32 | 1.4e−05 | ||||||
| zf-C2H2 | 188 | 210 | 26.5 | 0.00064 | ||||||
| zf-C2H2 | 217 | 239 | 29.5 | 7.8e−05 | ||||||
| zf-C2H2 | 724 | 746 | 37.3 | 3.4e−07 | ||||||
| zf-BED | 737 | 776 | 11.3 | 0.073 | ||||||
| zf-C2H2 | 752 | 775 | 33.5 | 4.8e−06 | ||||||
| zf-C2H2 | 781 | 803 | 27.5 | 0.0003 | ||||||
| 7 | AMP-binding | 108 | 544 | 446.8 | 1.8e−130 | |||||
| 8 | Pro_dh | 143 | 498 | 582.7 | 2.4e−171 | |||||
| 9 | Glyco_hydro_47 | 2 | 369 | 205 | 1.2e−57 | sosui | 83 | 105 | — | — |
| sosui | 17 | 39 | — | — | Glyco_hydro_47 | 256 | 695 | 696 | 1.9e−205 | |
| 10 | C2 | 76 | 163 | 45.6 | 1.1e−09 | C2 | 146 | 233 | 61.9 | 1.4e−14 |
| 12 | BNR | 44 | 55 | 9.4 | 34 | sosui | 1 | 23 | — | — |
| laminin_Nterm | 58 | 304 | 30 | 5.4e−12 | laminin_Nterm | 50 | 295 | 37.3 | 1.6e−12 | |
| BNR | 171 | 182 | 11.7 | 16 | laminin_EGF | 297 | 341 | 33.3 | 5.4e−06 | |
| laminin_EGF | 306 | 363 | 35.2 | 1.5e−06 | sosui | 419 | 438 | — | — | |
| 13 | RasGEFN | 114 | 170 | 36.7 | 5.3e−07 | RasGEFN | 686 | 742 | 36.7 | 5.3e−07 |
| RasGEF | 265 | 442 | 206.6 | 3.8e−58 | RasGEF | 837 | 1014 | 206.6 | 3.8e−58 | |
| 15 | Armadillo_seg | 281 | 319 | 13.4 | 2.6 | Armadillo_seg | 117 | 155 | 13.4 | 2.6 |
| Armadillo_seg | 364 | 406 | 0.4 | 84 | Armadillo_seg | 200 | 242 | 0.4 | 84 | |
| HEAT | 373 | 408 | 10.9 | 9 | HEAT | 209 | 244 | 10.9 | 9 | |
| HEAT | 551 | 589 | 10.3 | 11 | HEAT | 387 | 425 | 10.3 | 11 | |
| Armadillo_seg | 590 | 628 | 19.8 | 0.064 | Armadillo_seg | 426 | 464 | 19.8 | 0.064 | |
| HEAT | 592 | 630 | 1.4 | 1.1e+02 | HEAT | 428 | 466 | 1.4 | 1.1e+02 | |
| HEAT | 718 | 758 | 1.7 | 1e+02 | HEAT | 554 | 594 | 1.7 | 1e+02 | |
| Armadillo_seg | 819 | 857 | 1.2 | 68 | HEAT | 657 | 695 | 11.7 | 7.3 | |
| HEAT | 821 | 859 | 11.6 | 7.6 | Armadillo_seg | 695 | 734 | 17.3 | 0.37 | |
| Armadillo_seg | 859 | 898 | 11.4 | 4.5 | ||||||
| 17 | pkinase | 60 | 311 | 351.3 | 1.1e−101 | pkinase | 56 | 307 | 345.6 | 5.3e−100 |
| UBA | 331 | 370 | 30.8 | 3.1e−05 | UBA | 327 | 366 | 31.1 | 2.6e−05 | |
| 18 | ank | 50 | 83 | 6.3 | 36 | ank | 563 | 594 | 4.6 | 58 |
| ank | 84 | 116 | 42.3 | 1.1e−08 | ank | 627 | 659 | 18.1 | 0.2 | |
| ank | 117 | 149 | 39.4 | 8.3e−08 | ank | 660 | 692 | 42.8 | 7.6e−09 | |
| ank | 150 | 182 | 40.1 | 5e−08 | ank | 693 | 725 | 39.8 | 6e−08 | |
| ank | 183 | 217 | 18.5 | 0.16 | ank | 726 | 760 | 25.9 | 0.00094 | |
| ank | 253 | 286 | 23.4 | 0.0053 | ||||||
| 19 | Pkinase | 221 | 479 | 215.7 | 7e−61 | |||||
| 21 | Troponin | 230 | 378 | −18.4 | 0.97 | Troponin | 685 | 833 | −17.8 | 0.87 |
| 22 | WW | 37 | 67 | 4.5 | 2.3 | Sosui | 1 | 23 | — | — |
| WW | 76 | 106 | 23.4 | 0.0054 | ||||||
| MyTH4 | 772 | 890 | 78.5 | 1.4e−19 | ||||||
| RhoGAP | 920 | 1067 | 76.1 | 7.3e−19 | ||||||
| 23 | A_deamin | 27 | 76 | 17.7 | 0.0003 | A_deamin | 63 | 147 | 86.3 | 3.9e−24 |
| A_deamin | 220 | 295 | 76.3 | 3.2e−21 | A_deamin | 431 | 497 | 16.1 | 0.00084 | |
| 24 | sosui | 1 | 19 | — | — | sosui | 46 | 68 | — | — |
| sosui | 43 | 65 | — | — | sosui | 87 | 108 | — | — | |
| sosui | 83 | 104 | — | — | sosui | 214 | 236 | — | — | |
| sosui | 175 | 197 | — | — | sosui | 247 | 269 | — | — | |
| sosui | 209 | 231 | — | — | sosui | 390 | 412 | — | — | |
| sosui | 240 | 262 | — | — | ||||||
| sosui | 388 | 410 | — | — | ||||||
| 25 | PH | 1067 | 1175 | 77.3 | 2.6e−20 | PH | 44 | 145 | 49.8 | 1.4e−12 |
| PH | 387 | 482 | 75.2 | 9.6e−20 | ||||||
| 26 | tubulin-binding | 747 | 777 | 54.8 | 1.1e−14 | tubulin-binding | 923 | 953 | 54.8 | 1.1e−14 |
| tubulin-binding | 816 | 846 | 61.8 | 9.4e−17 | tubulin-binding | 992 | 1022 | 61.8 | 9.4e−17 | |
| tubulin-binding | 847 | 877 | 61 | 1.6e−16 | tubulin-binding | 1023 | 1053 | 61 | 1.6e−16 | |
| tubulin-binding | 878 | 909 | 36.5 | 3.2e−09 | tubulin-binding | 1054 | 1085 | 36.5 | 3.2e−09 | |
| 27 | PH | 145 | 236 | 78.7 | 1e−20 | PH | 91 | 183 | 87.8 | 2.8e−23 |
| Oxysterol_BP | 446 | 868 | 506.2 | 2.4e−148 | Oxysterol_BP | 383 | 799 | 770.3 | 7.5e−228 | |
| 28 | Kelch | 32 | 79 | 30 | 5.5e−05 | BTB | 141 | 253 | 127.6 | 2.3e−34 |
| Kelch | 81 | 126 | 43.2 | 6e−09 | Kelch | 392 | 436 | 20.4 | 0.042 | |
| Kelch | 128 | 176 | 30.1 | 5.1e−05 | Kelch | 438 | 483 | 44.6 | 2.3e−09 | |
| Kelch | 178 | 218 | 42.8 | 7.5e−09 | Kelch | 485 | 530 | 52.7 | 8.3e−12 | |
| Kelch | 220 | 267 | 48.3 | 1.7e−10 | Kelch | 532 | 579 | 49.9 | 5.5e−11 | |
| Kelch | 581 | 626 | 49 | 1.1e−10 | ||||||
| Kelch | 628 | 673 | 48.9 | 1.1e−10 | ||||||
| 29 | laminin_G | 220 | 342 | 76.1 | 1.6e−20 | sosui | 7 | 29 | — | — |
| EGF | 361 | 395 | 19.3 | 0.089 | F5_F8_type_C | 38 | 178 | 216.5 | 4e−61 | |
| TSPN | 380 | 577 | −42.4 | 0.71 | laminin_G | 216 | 348 | 62.2 | 1.5e−16 | |
| laminin_G | 472 | 530 | 8.4 | 0.37 | laminin_G | 401 | 532 | 48.5 | 1.3e−12 | |
| sosui | 639 | 661 | — | — | EGF | 558 | 590 | 30.3 | 4.4e−05 | |
| laminin_G | 827 | 948 | 53.8 | 3.8e−14 | ||||||
| EGF | 967 | 1001 | 18.2 | 0.19 | ||||||
| Laminin_G | 1055 | 1185 | 15.6 | 0.0032 | ||||||
| 30 | BR01 | 66 | 201 | 123.2 | 4.7e−33 | HR1 | 42 | 114 | 89.2 | 8.4e−23 |
| BR01 | 115 | 267 | 276.1 | 4.6e−79 | ||||||
| PDZ | 500 | 577 | 45 | 1.6e−09 | ||||||
| 32 | FH2 | 661 | 1157 | 178.1 | 1.5e−49 | FH2 | 594 | 1069 | 187.1 | 2.7e−52 |
| 33 | pkinase | 316 | 445 | 170.2 | 3.4e−47 | pkinase | 83 | 340 | 326.3 | 3.5e−94 |
| 34 | Dynein_heavy | 597 | 1351 | 920 | 6.8e−273 | Dynein_heavy | 3804 | 4510 | 910.4 | 5.1e−270 |
| 36 | DENN | 44 | 183 | 111.1 | 7e−30 | DENN | 5 | 78 | 70 | 2.2e−18 |
| GRAM | 756 | 842 | 46.6 | 3.8e−12 | GRAM | 650 | 736 | 62.4 | 9.1e−17 | |
| PH | 1661 | 1764 | 68 | 1e−17 | PH | 1529 | 1632 | 63.6 | 1.8e−16 | |
| 37 | DDHD | 237 | 484 | 401.4 | 8.6e−117 | DDHD | 614 | 861 | 431.3 | 8.9e−126 |
| 38 | chromo | 8 | 48 | 67.7 | 2.1e−18 | chromo | 8 | 48 | 67.7 | 2.1e−18 |
| 40 | GCV_T | 4 | 344 | 556.6 | 1.6e−163 | DAO | 42 | 403 | −70.5 | 0.0014 |
| Phytoene_dh | 44 | 405 | −327.7 | 0.14 | ||||||
| UPF0079 | 52 | 149 | −47.5 | 0.26 | ||||||
| GCV_T | 522 | 862 | 593.6 | 1.2e−174 | ||||||
| 41 | Collagen | 5 | 64 | 46.8 | 4.9e−10 | TSPN | 39 | 230 | 289.8 | 3.3e−83 |
| Collagen | 65 | 124 | 50.1 | 5.1e−11 | Collagen | 469 | 528 | 23.8 | 0.00018 | |
| Collagen | 125 | 184 | 52.1 | 1.2e−11 | Collagen | 554 | 612 | 27.7 | 0.00011 | |
| Collagen | 188 | 247 | 48.8 | 1.2e−10 | Collagen | 613 | 672 | 61.8 | 1.5e−14 | |
| Collagen | 251 | 310 | 53.8 | 3.7e−12 | Collagen | 673 | 732 | 60.8 | 3e−14 | |
| Collagen | 312 | 371 | 58.4 | 1.5e−13 | Collagen | 733 | 792 | 42.8 | 7.5e−09 | |
| Collagen | 384 | 443 | 48.5 | 1.5e−10 | Collagen | 793 | 852 | 37.7 | 2.7e−07 | |
| Collagen | 450 | 509 | 50.8 | 3e−11 | Collagen | 853 | 912 | 43.9 | 3.6e−09 | |
| Collagen | 534 | 593 | 44.8 | 1.9e−09 | Collagen | 913 | 972 | 59.9 | 5.4e−14 | |
| COLFI | 648 | 706 | 92.7 | 1e−35 | Collagen | 985 | 1044 | 54.4 | 2.5e−12 | |
| COLFI | 715 | 831 | 56.7 | 1.1e−21 | Collagen | 1045 | 1104 | 55.2 | 1.5e−12 | |
| Collagen | 1105 | 1164 | 55.7 | 9.9e−13 | ||||||
| Collagen | 1165 | 1224 | 49.5 | 7.2e−11 | ||||||
| Collagen | 1225 | 1284 | 46.7 | 5.3e−10 | ||||||
| Collagen | 1285 | 1344 | 48.9 | 1.1e−10 | ||||||
| Collagen | 1345 | 1404 | 43.5 | 4.7e−09 | ||||||
| Collagen | 1405 | 1464 | 46.4 | 6.3e−10 | ||||||
| Collagen | 1465 | 1524 | 55.9 | 9.1e−13 | ||||||
| Collagen | 1525 | 1584 | 18.9 | 0.00032 | ||||||
| COLFI | 1625 | 1836 | 484.1 | 1.1e−188 | ||||||
| 42 | tubulin | 14 | 347 | 737 | 8e−218 | |||||
| 43 | sosui | 16 | 36 | — | — | ig | 54 | 142 | 25.8 | 2e−06 |
| ig | 71 | 155 | 23.8 | 8e−06 | Xlink | 159 | 254 | 220.3 | 7.1e−95 | |
| Xlink | 172 | 277 | 162 | 1.2e−69 | Xlink | 260 | 351 | 196 | 2.3e−84 | |
| Xlink | 283 | 374 | 132 | 1.3e−56 | ||||||
| 44 | cadherin | 56 | 143 | 86.5 | 5.3e−22 | sosui | 4 | 26 | — | — |
| cadherin | 157 | 253 | 81.7 | 1.5e−20 | cadherin | 39 | 140 | 14.8 | 0.04 | |
| cadherin | 267 | 360 | 69.7 | 6.2e−17 | cadherin | 154 | 248 | 70.4 | 3.8e−17 | |
| cadherin | 374 | 470 | 50.8 | 3.1e−11 | cadherin | 372 | 454 | 20.6 | 0.013 | |
| cadherin | 486 | 577 | 94.6 | 1.9e−24 | cadherin | 468 | 560 | 69.2 | 8.8e−17 | |
| cadherin | 591 | 682 | 72.4 | 9.5e−18 | cadherin | 574 | 664 | 24.7 | 0.0022 | |
| cadherin | 722 | 813 | 68.8 | 1.1e−16 | ||||||
| cadherin | 827 | 918 | 98.3 | 1.5e−25 | ||||||
| cadherin | 932 | 1023 | 96.9 | 3.9e−25 | ||||||
| cadherin | 1039 | 1130 | 83.9 | 3.3e−21 | ||||||
| cadherin | 1144 | 1236 | 105.7 | 8.8e−28 | ||||||
| cadherin | 1250 | 1346 | 41 | 2.7e−08 | ||||||
| cadherin | 1363 | 1447 | 46.3 | 6.6e−10 | ||||||
| cadherin | 1461 | 1553 | 53.5 | 4.7e−12 | ||||||
| cadherin | 1567 | 1661 | 89.5 | 6.6e−23 | ||||||
| cadherin | 1675 | 1759 | 69.7 | 6e−17 | ||||||
| cadherin | 1773 | 1871 | 47.7 | 2.7e−10 | ||||||
| cadherin | 1887 | 1973 | 36.7 | 5.4e−07 | ||||||
| cadherin | 1987 | 2073 | 29.5 | 7.9e−05 | ||||||
| cadherin | 2089 | 2178 | 43.9 | 3.6e−09 | ||||||
| cadherin | 2190 | 2277 | 53.8 | 3.9e−12 | ||||||
| cadherin | 2291 | 2384 | 96.1 | 7e−25 | ||||||
| cadherin | 2398 | 2486 | 44.1 | 3.1e−09 | ||||||
| cadherin | 2500 | 2590 | 48.6 | 1.4e−10 | ||||||
| cadherin | 2604 | 2696 | 47.1 | 3.9e−10 | ||||||
| cadherin | 2710 | 2802 | 35.4 | 1.3e−06 | ||||||
| cadherin | 2816 | 2911 | 81.5 | 1.8e−20 | ||||||
| cadherin | 2925 | 3016 | 68.3 | 1.7e−16 | ||||||
| cadherin | 3030 | 3118 | 94.1 | 2.8e−24 | ||||||
| cadherin | 3132 | 3223 | 99.9 | 5e−26 | ||||||
| cadherin | 3237 | 3328 | 104.8 | 1.7e−27 | ||||||
| cadherin | 3342 | 3433 | 106.6 | 4.8e−28 | ||||||
| cadherin | 3447 | 3538 | 47.2 | 3.7e−10 | ||||||
| cadherin | 3553 | 3634 | 11.5 | 0.077 | ||||||
| EGF | 3796 | 3828 | 19.5 | 0.077 | ||||||
| laminin_G | 3861 | 3990 | 75.5 | 2.3e−20 | ||||||
| EGF | 4019 | 4051 | 36.8 | 4.9e−07 | ||||||
| EGF | 4058 | 4089 | 31.7 | 1.7e−05 | ||||||
| EGF | 4095 | 4126 | 35.6 | 1.1e−06 | ||||||
| EGF | 4133 | 4164 | 32.9 | 7.2e−06 | ||||||
| 45 | TPR | 11 | 44 | 1.6 | 31 | TPR | 11 | 44 | 1.6 | 31 |
| TPR | 79 | 112 | 50.7 | 3.3e−11 | TPR | 79 | 112 | 50.7 | 3.3e−11 | |
| TPR | 113 | 146 | 26.3 | 0.00073 | TPR | 113 | 146 | 26.3 | 0.00073 | |
| TPR | 147 | 180 | 31 | 2.8e−05 | TPR | 147 | 180 | 31 | 2.8e−05 | |
| TPR | 181 | 214 | 39.8 | 6.1e−08 | TPR | 181 | 214 | 39.8 | 6.1e−08 | |
| TPR | 215 | 248 | 31.9 | 1.5e−05 | TPR | 215 | 248 | 31.9 | 1.5e−05 | |
| TPR | 249 | 282 | 38.8 | 1.3e−07 | TPR | 249 | 282 | 38.8 | 1.3e−07 | |
| TPR | 283 | 316 | 39.5 | 7.4e−08 | TPR | 283 | 316 | 39.5 | 7.4e−08 | |
| TPR | 317 | 350 | 40.1 | 5e−08 | TPR | 317 | 350 | 40.1 | 5e−08 | |
| TPR | 351 | 384 | 39.7 | 6.4e−08 | TPR | 351 | 384 | 39.7 | 6.4e−08 | |
| TPR | 385 | 418 | 41.4 | 2e−08 | TPR | 385 | 418 | 41.4 | 2e−08 | |
| TPR | 419 | 452 | 38.2 | 1.9e−07 | TPR | 419 | 452 | 38.2 | 1.9e−07 | |
| 46 | sosui | 179 | 200 | — | — | |||||
| sosui | 266 | 288 | — | — | ||||||
| 47 | RhoGEF | 737 | 907 | 120.3 | 3.6e−32 | spectrin | 188 | 235 | 12 | 0.074 |
| PH | 921 | 1032 | 45.6 | 2.1e−11 | spectrin | 279 | 308 | 9.6 | 0.34 | |
| spectrin | 310 | 416 | 23.7 | 4.2e−05 | ||||||
| spectrin | 536 | 642 | 20.1 | 0.00043 | ||||||
| spectrin | 803 | 877 | −9.2 | 3.5e+04 | ||||||
| spectrin | 890 | 937 | 7 | 1.8 | ||||||
| spectrin | 958 | 1004 | 7.8 | 1.1 | ||||||
| spectrin | 1130 | 1222 | 17.6 | 0.0021 | ||||||
| RhoGEF | 1285 | 1455 | 120.3 | 3.6e−32 | ||||||
| PH | 1469 | 1580 | 45.6 | 2.1e−11 | ||||||
| 48 | zf-C2H2 | 103 | 125 | 38.1 | 1.9e−07 | KRAB | 13 | 75 | 159.5 | 5.6e−44 |
| zf-C2H2 | 131 | 153 | 31.8 | 1.6e−05 | zf-C2H2 | 182 | 200 | −1.9 | 1.3e+02 | |
| zf-C2H2 | 159 | 181 | 34.5 | 2.4e−06 | zf-C2H2 | 210 | 232 | 21.8 | 0.017 | |
| zf-C2H2 | 187 | 209 | 35.5 | 1.2e−06 | zf-C2H2 | 238 | 260 | 33.1 | 6.3e−06 | |
| zf-C2H2 | 215 | 237 | 30.8 | 3.2e−05 | zf-C2H2 | 266 | 288 | 34 | 3.4e−06 | |
| zf-C2H2 | 243 | 265 | 30.1 | 5.2e−05 | zf-C2H2 | 294 | 316 | 37.9 | 2.3e−07 | |
| zf-C2H2 | 271 | 293 | 28.6 | 0.00015 | zf-C2H2 | 322 | 344 | 37.9 | 2.2e−07 | |
| zf-C2H2 | 299 | 321 | 29.6 | 7.4e−05 | zf-C2H2 | 350 | 372 | 36.1 | 7.8e−07 | |
| zf-C2H2 | 352 | 374 | 20.2 | 0.051 | zf-C2H2 | 378 | 400 | 34.9 | 1.8e−06 | |
| zf-C2H2 | 380 | 402 | 37.2 | 3.7e−07 | zf-C2H2 | 406 | 428 | 35.3 | 1.4e−06 | |
| zf-BED | 393 | 431 | 5.6 | 0.32 | zf-C2H2 | 434 | 456 | 35.3 | 1.4e−06 | |
| zf-C2H2 | 408 | 430 | 30.2 | 4.7e−05 | zf-C2H2 | 462 | 484 | 33.8 | 3.9e−06 | |
| zf-C2H2 | 436 | 458 | 38.1 | 2e−07 | zf-C2H2 | 490 | 512 | 37.1 | 4e−07 | |
| zf-C2H2 | 464 | 486 | 37.6 | 2.9e−07 | zf-C2H2 | 518 | 540 | 15.7 | 1.1 | |
| zf-C2H2 | 492 | 514 | 25.4 | 0.0013 | zf-C2H2 | 546 | 568 | 32.4 | 1.1e−05 | |
| zf-C2H2 | 544 | 566 | 22.8 | 0.0079 | zf-C2H2 | 574 | 596 | 34 | 3.4e−06 | |
| zf-C2H2 | 572 | 594 | 37.2 | 3.7e−07 | zf-C2H2 | 602 | 624 | 34.2 | 3.1e−06 | |
| zf-BED | 585 | 623 | 3.9 | 0.5 | zf-C2H2 | 630 | 652 | 37.9 | 2.2e−07 | |
| zf-C2H2 | 600 | 622 | 34.9 | 1.9e−06 | zf-C2H2 | 658 | 680 | 36.1 | 7.8e−07 | |
| zf-C2H2 | 628 | 650 | 38.2 | 1.9e−07 | zf-C2H2 | 686 | 708 | 34.9 | 1.8e−06 | |
| zf-C2H2 | 656 | 678 | 32.6 | 9.3e−06 | zf-C2H2 | 714 | 736 | 35.3 | 1.4e−06 | |
| zf-C2H2 | 684 | 706 | 24.4 | 0.0026 | zf-C2H2 | 742 | 764 | 36.8 | 5e−07 | |
| zf-C2H2 | 737 | 759 | 20.9 | 0.03 | zf-C2H2 | 770 | 792 | 35 | 1.7e−06 | |
| zf-C2H2 | 798 | 820 | 37.3 | 3.4e−07 | ||||||
| zf-C2H2 | 826 | 848 | 34.8 | 2e−06 | ||||||
| zf-C2H2 | 854 | 876 | 37 | 4.2e−07 | ||||||
| zf-C2H2 | 885 | 904 | 11.3 | 6.3 | ||||||
| zf-C2H2 | 910 | 932 | 38.2 | 1.9e−07 | ||||||
| zf-C2H2 | 938 | 960 | 36.5 | 5.9e−07 | ||||||
| zf-C2H2 | 966 | 988 | 34.3 | 2.8e−06 | ||||||
| zf-C2H2 | 994 | 1016 | 39 | 1.1e−07 | ||||||
| zf-C2H2 | 1022 | 1044 | 35.1 | 1.6e−06 | ||||||
| zf-C2H2 | 1050 | 1072 | 33.8 | 3.8e−06 | ||||||
| zf-C2H2 | 1078 | 1100 | 39 | 1.1e−07 | ||||||
| zf-C2H2 | 1106 | 1128 | 32.9 | 7.5e−06 | ||||||
| zf-C2H2 | 1134 | 1156 | 19.5 | 0.081 | ||||||
| 49 | SAM | 732 | 795 | 79.8 | 5.7e−20 | ank | 223 | 256 | 12.3 | 6.6 |
| ank | 257 | 289 | 28 | 0.00022 | ||||||
| ank | 290 | 323 | 12.6 | 6 | ||||||
| ank | 324 | 356 | 21.5 | 0.021 | ||||||
| ank | 357 | 389 | 37.1 | 4.1e−07 | ||||||
| SH3 | 548 | 602 | 36.5 | 6.2e−07 | ||||||
| PDZ | 645 | 738 | 22.2 | 0.007 | ||||||
| SAM | 1741 | 1804 | 80.5 | 3.5e−20 | ||||||
| 50 | PDZ | 48 | 130 | 51.2 | 2.3e−11 | PDZ | 53 | 135 | 48.8 | 1.2e−10 |
| PDZ | 148 | 233 | 54.1 | 3e−12 | PDZ | 153 | 238 | 53.5 | 4.7e−12 | |
| PDZ | 248 | 331 | 42.3 | 1.1e−08 | PDZ | 253 | 336 | 46.7 | 5.3e−10 | |
| PDZ | 456 | 544 | 42.5 | 9.2e−09 | PDZ | 458 | 546 | 39 | 1.1e−07 | |
| PDZ | 557 | 640 | 62 | 1.3e−14 | PDZ | 559 | 642 | 55.7 | 1e−12 | |
| PDZ | 656 | 737 | 69.4 | 7.5e−17 | PDZ | 658 | 739 | 65.6 | 1e−15 | |
| PDZ | 941 | 1022 | 36.4 | 6.5e−07 | PDZ | 942 | 1023 | 26.6 | 0.0006 | |
| 52 | ank | 679 | 714 | 6.6 | 33 | ank | 23 | 55 | 3.5 | 80 |
| ank | 717 | 749 | 6.1 | 38 | ank | 56 | 88 | 43.2 | 5.7e−09 | |
| ank | 750 | 782 | 33.2 | 6.2e−06 | ank | 89 | 121 | 45.3 | 1.4e−09 | |
| ank | 783 | 815 | 4.8 | 55 | ank | 122 | 154 | 42.7 | 8.4e−09 | |
| ank | 823 | 859 | 4.1 | 67 | ank | 155 | 183 | 14.3 | 2.9 | |
| ank | 861 | 893 | 31.5 | 1.9e−05 | ank | 184 | 216 | 18.6 | 0.15 | |
| ank | 894 | 926 | 40 | 5.4e−08 | ank | 217 | 249 | 36.1 | 8e−07 | |
| ank | 927 | 959 | 42.3 | 1.1e−08 | ank | 250 | 282 | 45.6 | 1.1e−09 | |
| ank | 960 | 992 | 35.7 | 1.1e−06 | ank | 283 | 315 | 39.3 | 8.4e−08 | |
| ank | 993 | 1025 | 38.1 | 2e−07 | ank | 316 | 348 | 39.3 | 8.8e−08 | |
| ank | 1026 | 1058 | 12.9 | 5.5 | ank | 349 | 381 | 39.1 | 9.7e−08 | |
| TPR | 1072 | 1105 | 0.2 | 43 | ank | 382 | 414 | 46.6 | 5.5e−10 | |
| TPR | 1119 | 1152 | 16.4 | 0.7 | ank | 415 | 447 | 39.7 | 6.7e−08 | |
| TPR | 1153 | 1186 | 25.6 | 0.0012 | ank | 448 | 480 | 42.6 | 9.1e−09 | |
| ank | 481 | 513 | 40.2 | 4.7e−08 | ||||||
| ank | 514 | 546 | 49.7 | 6.5e−11 | ||||||
| ank | 547 | 579 | 43.6 | 4.5e−09 | ||||||
| ank | 580 | 612 | 38.3 | 1.7e−07 | ||||||
| ank | 613 | 645 | 47.2 | 3.6e−10 | ||||||
| ank | 646 | 678 | 36.3 | 7e−07 | ||||||
| ank | 679 | 711 | 42.7 | 8e−09 | ||||||
| ank | 712 | 744 | 43.8 | 3.9e−09 | ||||||
| ank | 745 | 777 | 41 | 2.8e−08 | ||||||
| ank | 778 | 810 | 2.2 | 1.1e+02 | ||||||
| ZU5 | 983 | 1087 | 229.6 | 4.4e−65 | ||||||
| death | 1479 | 1562 | 111.4 | 1.8e−29 | ||||||
| 53 | sosui | 16 | 38 | — | — | sosui | 9 | 30 | — | — |
| Glyco_transf_29 | 218 | 512 | 243.2 | 3.6e−69 | Glyco_transf_29 | 107 | 401 | 448 | 8.2e−131 | |
| 54 | GSPII_E | 1032 | 1046 | 8.6 | 0.092 | |||||
| 55 | UQ_con | 971 | 1136 | 0.9 | 2.6e−06 | |||||
| 57 | Ca_channel_B | 17 | 75 | 6.5 | 0.07 | |||||
| 58 | DAO | 43 | 404 | −61.8 | 0.00044 | DAO | 42 | 403 | −70.5 | 0.0014 |
| Phytoene_dh | 45 | 406 | −331.1 | 0.19 | Phytoene_dh | 44 | 405 | −327.7 | 0.14 | |
| GCV_T | 523 | 863 | 556.6 | 1.6e−163 | UPF0079 | 52 | 149 | −47.5 | 0.26 | |
| GCV_T | 522 | 862 | 593.6 | 1.2e−174 | ||||||
| 59 | TPR | 285 | 318 | 9.6 | 4.2 | TPR | 155 | 189 | 10.7 | 3.2 |
| TPR | 327 | 360 | 21.6 | 0.018 | TPR | 198 | 231 | 30.9 | 3e−05 | |
| TPR | 369 | 402 | 8.6 | 5.4 | TPR | 240 | 273 | 31.3 | 2.2e−05 | |
| TPR | 435 | 468 | 19.9 | 0.06 | TPR | 282 | 315 | 15.1 | 1.1 | |
| TPR | 477 | 510 | 28.8 | 0.00013 | TPR | 324 | 357 | 30.1 | 5.3e−05 | |
| TPR | 519 | 552 | 23.6 | 0.0046 | TPR | 366 | 399 | 18.5 | 0.16 | |
| TPR | 561 | 594 | 36.5 | 6.1e−07 | TPR | 408 | 441 | 10.6 | 3.3 | |
| TPR | 603 | 636 | 19.7 | 0.071 | ||||||
| 60 | Myb_DNA-binding | 300 | 345 | 18.8 | 0.0011 | |||||
| 61 | ACBP | 5 | 43 | −18.1 | 0.014 | ACBP | 42 | 130 | 199.3 | 5.9e−56 |
| sosui | 405 | 427 | — | — | sosui | 503 | 524 | — | — | |
| 62 | Dynein_heavy | 494 | 1192 | 444.2 | 1.1e−129 | |||||
| 63 | myosin_head | 147 | 282 | 81.9 | 3.4e−23 | myosin_head | 1208 | 1871 | 946.2 | 8.7e−281 |
| MyTH4 | 561 | 673 | 33.9 | 2.1e−06 | IQ | 1887 | 1907 | 22.5 | 0.0097 | |
| SH3 | 1455 | 1511 | 8 | 0.013 | IQ | 1910 | 1930 | 26.1 | 0.00081 | |
| MyTH4 | 2088 | 2195 | 71.8 | 1.4e−17 | ||||||
| MyTH4 | 3071 | 3185 | 108.4 | 1.4e−28 | ||||||
| 64 | WD40 | 61 | 98 | 22.4 | 0.011 | WD40 | 12 | 47 | 13.6 | 3.4 |
| WD40 | 110 | 145 | 12.9 | 4.7 | WD40 | 64 | 100 | 19.9 | 0.059 | |
| WD40 | 150 | 187 | 25.3 | 0.0014 | ||||||
| WD40 | 289 | 324 | 13.6 | 3.4 | ||||||
| WD40 | 341 | 377 | 19.9 | 0.059 | ||||||
| 65 | sosui | 152 | 174 | — | — | pkinase | 14 | 265 | 330.4 | 2e−95 |
| sosui | 193 | 215 | — | — | ||||||
| 66 | EGF | 12 | 47 | 20.7 | 0.035 | EGF | 127 | 162 | 25.5 | 0.0013 |
| EGF | 53 | 86 | 10.6 | 2.5 | EGF | 168 | 203 | 43.5 | 4.6e−09 | |
| EGF | 209 | 245 | 27.2 | 0.00038 | ||||||
| EGF | 251 | 286 | 29.2 | 9.5e−05 | ||||||
| EGF | 292 | 327 | 30.5 | 4e−05 | ||||||
| EGF | 338 | 373 | 27.2 | 0.0004 | ||||||
| EGF | 379 | 413 | 8.6 | 3.8 | ||||||
| EGF | 419 | 454 | 29.3 | 9e−05 | ||||||
| EGF | 524 | 555 | 21.3 | 0.022 | ||||||
| EGF | 568 | 598 | 23.2 | 0.0061 | ||||||
| EGF | 611 | 641 | 12.3 | 1.7 | ||||||
| EGF | 645 | 686 | 8.2 | 4.1 | ||||||
| EGF | 699 | 731 | 2.2 | 14 | ||||||
| EGF | 735 | 773 | 4.3 | 9.2 | ||||||
| EGF | 786 | 817 | 21.5 | 0.02 | ||||||
| EGF | 830 | 860 | 21.4 | 0.022 | ||||||
| EGF | 873 | 904 | 7.1 | 5.1 | ||||||
| EGF | 917 | 947 | 17.7 | 0.27 | ||||||
| EGF | 960 | 990 | 11.4 | 2.1 | ||||||
| EGF | 1003 | 1033 | 22.8 | 0.0079 | ||||||
| EGF | 1046 | 1076 | 21.6 | 0.018 | ||||||
| EGF | 1089 | 1119 | 28.6 | 0.00015 | ||||||
| EGF | 1132 | 1162 | 18.1 | 0.21 | ||||||
| EGF | 1175 | 1205 | 21.8 | 0.017 | ||||||
| EGF | 1209 | 1249 | 0.6 | 20 | ||||||
| EGF | 1262 | 1292 | 14.5 | 1.1 | ||||||
| EGF | 1305 | 1335 | 15 | 1 | ||||||
| EGF | 1348 | 1378 | 22.5 | 0.0099 | ||||||
| EGF | 1391 | 1421 | 19 | 0.12 | ||||||
| EGF | 1434 | 1464 | 16.5 | 0.62 | ||||||
| EGF | 1477 | 1507 | 9.2 | 3.3 | ||||||
| EGF | 1520 | 1550 | 14.2 | 1.2 | ||||||
| 67 | EGF | 157 | 187 | 10.9 | 2.3 | EGF | 127 | 162 | 25.5 | 0.0013 |
| EGF | 200 | 230 | 15.6 | 0.88 | EGF | 168 | 203 | 43.5 | 4.6e−09 | |
| EGF | 243 | 273 | 27 | 0.00045 | EGF | 209 | 245 | 27.2 | 0.00038 | |
| EGF | 286 | 316 | 25.5 | 0.0012 | EGF | 251 | 286 | 29.2 | 9.5e−05 | |
| EGF | 329 | 359 | 26.1 | 0.0008 | EGF | 292 | 327 | 30.5 | 4e−05 | |
| EGF | 372 | 402 | 20 | 0.056 | EGF | 338 | 373 | 27.2 | 0.0004 | |
| EGF | 416 | 448 | 11.8 | 1.9 | EGF | 379 | 413 | 8.6 | 3.8 | |
| EGF | 461 | 491 | 23.2 | 0.006 | EGF | 419 | 454 | 29.3 | 9e−05 | |
| EGF | 504 | 534 | 24.9 | 0.0019 | EGF | 524 | 555 | 21.3 | 0.022 | |
| EGF | 547 | 577 | 23.9 | 0.0038 | EGF | 568 | 598 | 23.2 | 0.0061 | |
| EGF | 590 | 620 | 12.6 | 1.6 | EGF | 611 | 641 | 12.3 | 1.7 | |
| EGF | 633 | 663 | 21.6 | 0.019 | EGF | 645 | 686 | 8.2 | 4.1 | |
| EGF | 676 | 708 | 9.9 | 2.9 | EGF | 699 | 731 | 2.2 | 14 | |
| EGF | 721 | 751 | 15.8 | 0.84 | EGF | 735 | 773 | 4.3 | 9.2 | |
| EGF | 764 | 794 | 22 | 0.014 | EGF | 786 | 817 | 21.5 | 0.02 | |
| EGF | 807 | 837 | 18.6 | 0.15 | EGF | 830 | 860 | 21.4 | 0.022 | |
| EGF | 850 | 880 | 18.2 | 0.19 | EGF | 873 | 904 | 7.1 | 5.1 | |
| sosui | 909 | 930 | — | — | EGF | 917 | 947 | 17.7 | 0.27 | |
| EGF | 960 | 990 | 11.4 | 2.1 | ||||||
| EGF | 1003 | 1033 | 22.8 | 0.0079 | ||||||
| EGF | 1046 | 1076 | 21.6 | 0.018 | ||||||
| EGF | 1089 | 1119 | 28.6 | 0.00015 | ||||||
| EGF | 1132 | 1162 | 18.1 | 0.21 | ||||||
| EGF | 1175 | 1205 | 21.8 | 0.017 | ||||||
| EGF | 1209 | 1249 | 0.6 | 20 | ||||||
| EGF | 1262 | 1292 | 14.5 | 1.1 | ||||||
| EGF | 1305 | 1335 | 15 | 1 | ||||||
| EGF | 1348 | 1378 | 22.5 | 0.0099 | ||||||
| EGF | 1391 | 1421 | 19 | 0.12 | ||||||
| EGF | 1434 | 1464 | 16.5 | 0.62 | ||||||
| EGF | 1477 | 1507 | 9.2 | 3.3 | ||||||
| EGF | 1520 | 1550 | 14.2 | 1.2 | ||||||
| 68 | WH2 | 399 | 417 | 8.5 | 22 | |||||
| WH2 | 463 | 480 | 17.2 | 0.38 | ||||||
| 69 | EGF | 45 | 81 | 43.6 | 4.4e−09 | EGF | 20 | 56 | 36.8 | 4.9e−07 |
| TB | 96 | 137 | 42.8 | 7.5e−09 | EGF | 62 | 98 | 37.7 | 2.6e−07 | |
| EGF | 162 | 198 | 26.5 | 0.00063 | EGF | 104 | 138 | 31.9 | 1.5e−05 | |
| EGF | 204 | 241 | 19.5 | 0.078 | TB | 153 | 194 | 56.9 | 4.5e−13 | |
| EGF | 207 | 243 | 39.4 | 8e−08 | ||||||
| TB | 258 | 299 | 74.2 | 2.8e−18 | ||||||
| EGF | 325 | 361 | 23.4 | 0.0055 | ||||||
| EGF | 367 | 404 | 18.3 | 0.18 | ||||||
| EGF | 410 | 446 | 35.7 | 1e−06 | ||||||
| EGF | 452 | 488 | 24.6 | 0.0024 | ||||||
| EGF | 494 | 529 | 27.7 | 0.00027 | ||||||
| EGF | 535 | 571 | 28.8 | 0.00013 | ||||||
| EGF | 577 | 613 | 17.4 | 0.33 | ||||||
| EGF | 619 | 654 | 26.5 | 0.00061 | ||||||
| Plexin_repeat | 625 | 674 | 4.9 | 0.73 | ||||||
| EGF | 660 | 695 | 31.8 | 1.5e−05 | ||||||
| EGF | 701 | 737 | 34.8 | 2e−06 | ||||||
| 70 | zf-C2H2 | 44 | 67 | 6.3 | 19 | zf-C2H2 | 21 | 43 | 20.9 | 0.031 |
| zf-C2H2 | 101 | 124 | 4.3 | 31 | zf-C2H2 | 50 | 73 | 17.6 | 0.3 | |
| zf-C2H2 | 202 | 225 | 16.1 | 0.87 | zf-C2H2 | 79 | 102 | 15 | 1.8 | |
| zf-C2H2 | 247 | 270 | 5.6 | 23 | ||||||
| zf-C2H2 | 309 | 332 | 15.5 | 1.3 | ||||||
| zf-C2H2 | 392 | 415 | 16.1 | 0.84 | ||||||
| zf-C2H2 | 429 | 452 | 6.3 | 20 | ||||||
| zf-C2H2 | 499 | 522 | 1.8 | 55 | ||||||
| zf-C2H2 | 578 | 601 | 4.5 | 29 | ||||||
| zf-C2H2 | 624 | 646 | 18.9 | 0.12 | ||||||
| zf-C2H2 | 700 | 722 | 11 | 6.7 | ||||||
| zf-C2H2 | 784 | 806 | 19.1 | 0.1 | ||||||
| zf-C2H2 | 818 | 840 | 20.9 | 0.031 | ||||||
| zf-C2H2 | 847 | 870 | 17.6 | 0.3 | ||||||
| zf-C2H2 | 876 | 899 | 15 | 1.8 | ||||||
| zf-C2H2 | 984 | 1007 | 3.8 | 35 | ||||||
| zf-C2H2 | 1013 | 1036 | 15.4 | 1.4 | ||||||
| zf-C2H2 | 1047 | 1069 | 12.8 | 4.4 | ||||||
| zf-C2H2 | 1093 | 1115 | 20.5 | 0.039 | ||||||
| zf-C2H2 | 1121 | 1144 | 16.6 | 0.58 | ||||||
| zf-C2H2 | 1207 | 1229 | 27.4 | 0.00034 | ||||||
| TABLE 5 |
| Complete notation of each functional domain |
| Abbreviated notation | Complete notation |
| A_deamin | Adenosine-deaminase (editase) domain |
| ACBP | Acetyl CoA binding protein |
| AMP-binding | AMP-binding enzyme |
| ank | Ank repeat |
| Armadillo— | Armadillo/beta-catenin-like repeat |
| seg | |
| BNR | BNR repeat |
| BR01 | BR01-like domain |
| BTB | BTB/POZ domain |
| C2 | C2 domain |
| Ca_channel_B | Dihydropyridine sensitive L-type calcium |
| channel (Beta subunit) | |
| cadherin | Cadherin domain |
| chromo | ‘chromo’ (CHRomatin Organization MOdifier) |
| domain | |
| COLFI | Fibrillar collagen C-terminal domain |
| Collagen | Collagen triple helix repeat (20 copies) |
| DAO | FAD dependent oxidoreductase |
| DDHD | DDHD domain |
| death | Death domain |
| DENN | DENN (AEX-3) domain |
| Dynein_heavy | Dynein heavy chain |
| EGF | EGF-like domain |
| F5_F8_type_C | F5/8 type C domain |
| FH2 | Formin Homology 2 Domain |
| GCV_T | Glycine cleavage T-protein (aminomethyl |
| transferase) | |
| Glyco_hydro_47 | Glycosyl hydrolase family 47 |
| Glyco_transf_29 | Glycosyltransferase family 29 |
| (sialyltransferase) | |
| GRAM | GRAM domain |
| GSPII_E | Bacterial type II secretion system protein |
| HEAT | HEAT repeat |
| HR1 | Hr1 repeat motif |
| integrin_B | Integrins, beta chain |
| IQ | IQ calmodulin-binding motif |
| Kelch | Kelch motif |
| KRAB | KRAB box |
| Laminin_EGF | Laminin EGF-like |
| (Domains III and V) | |
| laminin_G | Laminin G domain |
| Laminin_Nterm | Laminin N-terminal |
| (Domain VI) | |
| myb_DNA-binding | Myb-like DNA-binding domain |
| myosin_head | Myosin head (motor domain) |
| MyTH4 | MyTH4 domain |
| Oxysterol_BP | Oxysterol-binding protein |
| PDZ | PDZ domain |
| (Also known as DHR or GLGF). | |
| PH | PH domain |
| Phytoene_dh | Phytoene dehydrogenase related enzyme |
| pkinase | Protein kinase domain |
| Plexin_repeat | Plexin repeat |
| Pro_dh | Proline dehydrogenase |
| RasGEF | RasGEF domain |
| RasGEFN | Guanine nucleotide exchange factor |
| for Ras-like GTPases; | |
| N-terminal motif | |
| RhoGAP | RhoGAP domain |
| RhoGEF | RhoGEF domain |
| SAM | SAM domain |
| (Sterile alpha motif) | |
| Sema | Sema domain |
| SH3 | SH3 domain |
| spectrin | Spectrin repeat |
| TB | TB domain |
| TIG | IPT/TIG domain |
| TPR | TPR Domain |
| Troponin | Troponin |
| TSPN | Thrombospondin |
| N-terminal-like domain | |
| tubulin | Tubulin/FtsZ family |
| tubulin-binding | Tau and MAP protein, |
| Tubulin-binding repeat | |
| UBA | UBA/TS-N domain |
| UPF0079 | Uncharacterised P-loop |
| hydrolase UPF0079 | |
| UQ_con | Ubiquitin-conjugating enzyme |
| WD40 | WD domain, G-beta repeat |
| WH2 | WH2 motif |
| WW | WW domain |
| Xlink | Extracellular link domain |
| zf-BED | BED zinc finger |
| zf-C2H2 | Zinc finger, C2H2 type |
| ZU5 | ZU5 domain |
(5) Expression Site
Expressions in the tissue and the sites of the brain were examined by RT-PCR ELISA. Table 6 lists the sites showing the strongest expression.
(6) Chromosome Position
Using the DNA nucleotide sequences of the clones as queries, an analysis program BLASTN 2.0.14 (the above-mentioned “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs”) was run on human genome sequences corresponding to the library of known sequences, Genbank release 119. The description of the chromosome number from which the clone had been derived was extracted from the definitions for the matched clones as listed in Table 6.
| TABLE 6 |
| Expression site of each gene and chromosome |
| position of homologous gene |
| Chromosome | ||
| Expression site | position |
| SEQ ID NO: | Tissue | Brain | Position |
| 1 | Brain | Caudate nucleus | — |
| 2 | Ovary | Cerebellum | — |
| 3 | Brain | — | — |
| 4 | Brain | Nucleus of hypothalamus | — |
| 5 | Brain | Caudate nucleus | 2 |
| 6 | Kidney | Caudate nucleus | — |
| 7 | Ovary | Spinal cord | 20 |
| 8 | Brain | Substantia nigra | 7 |
| 9 | Ovary | Amygdaloid body | — |
| 10 | Brain | Caudate nucleus | 20 |
| 11 | Ovary | Thalamus | 7 |
| 12 | Brain | Amygdaloid body | — |
| 13 | Ovary | Substantia nigra | 9 |
| 14 | Brain | Caudate nucleus | 22 |
| 15 | Brain | Thalamus | 19 |
| 16 | Kidney | Spinal cord | 7 |
| 17 | Skeletal muscle | Caudate nucleus | 19 |
| 18 | Brain | Spinal cord | 7 |
| 19 | Heart | Amygdaloid body | 9 |
| 20 | — | — | — |
| 21 | Brain | Hippocampus | 17 |
| 22 | Brain | Spinal cord | — |
| 23 | Orchis | Corpus callosum | — |
| 24 | Kidney | Thalamus | 7 |
| 25 | — | Nucleus of hypothalamus | 22 |
| 26 | — | — | 3 |
| 27 | Brain | Thalamus | 22 |
| 28 | Brain | Cerebellum | 2 |
| 29 | Brain | Spinal cord | 16 |
| 30 | Brain | Caudate nucleus | 8 |
| 31 | Ovary | Nucleus of hypothalamus | 1 |
| 32 | Heart | Amygdaloid body | 18 |
| 33 | Brain | Caudate nucleus | 3 |
| 34 | Ovary | Caudate nucleus | 2 |
| 35 | Ovary | Thalamus | 7 |
| 36 | Ovary | Spinal cord | 11 |
| 37 | Brain | Cerebellum | 14 |
| 38 | Brain | Cerebellum | — |
| 39 | Ovary | Spinal cord | 17 |
| 40 | Ovary | Corpus callosum | 16 |
| 41 | Ovary | Cerebellum | — |
| 42 | Kidney | Spinal cord | — |
| 43 | Brain | Thalamus | 19 |
| 44 | Brain | Corpus callosum | — |
| 45 | Kidney | Cerebellum | X |
| 46 | Brain | Spinal cord | 22 |
| 47 | Brain | Amygdaloid body | 3 |
| 48 | Ovary | Spinal cord | 17 |
| 49 | Skeletal muscle | Amygdaloid body | 22 |
| 50 | Skeletal muscle | Thalamus | 3 |
| 51 | Skeletal muscle | Spinal cord | — |
| 52 | Ovary | Hippocampus | — |
| 53 | Brain | Cerebellum | 2 |
| 54 | — | — | 3 |
| 55 | Brain | Thalamus | — |
| 56 | Kidney | Spinal cord | 5 |
| 57 | Brain | Caudate nucleus | 11 |
| 58 | — | — | 16 |
| 59 | Kidney | Spinal cord | 3 |
| 60 | — | — | 5 |
| 61 | Brain | Substantia nigra | 10 |
| 62 | Ovary | Caudate nucleus | 11 |
| 63 | — | — | 17 |
| 64 | Skeletal muscle | Spinal cord | 14 |
| 65 | Brain | Substantia nigra | 19 |
| 66 | Brain | Caudate nucleus | 3 |
| 67 | Brain | Hippocampus | 5 |
| 68 | — | — | 16 |
| 69 | — | — | 19 |
| 70 | Brain | Caudate nucleus | 19 |
According to the above information on homology, homologous genes, each domain, expression sites, chromosome positions and the like, a person skilled in the art can predict based on the grounds shown in Table 1 that the DNAs or the genes of the present invention respectively have each function described in Table 1.
INDUSTRIAL APPLICABILITYA single nucleotide polymorphism, SNP, which is a change in one base (nucleotide) among individuals in the DNA or the gene of the present invention, can be found by performing PCR using synthetic DNA primers prepared based on the nucleotide sequence of the DNA or the gene of the present invention or a part thereof, and using chromosome DNA extracted from human blood or tissue so as to determine the nucleotide sequence of the product. Therefore, individual constitution or the like can be predicted, which enables the development of a pharmaceutical preparation suitable for each individual.
Further, when ortholog (homolog, counterpart) genes for the DNA or the gene of the present invention in model organisms, such as mice, are isolated with cross hybridization, for example, these genes are knocked out to produce human disease model animals, so that the causative genes which cause human diseases can be searched and identified.
DNA chip, polypeptide chip and antibody chip can be respectively prepared by arraying the DNAs and the polypeptides of the present invention, and antibodies for the polypeptides of the present invention. Specifically, novel DNAs or genes obtained by the present invention are assembled on a so-called DNA chip, and then probes prepared using blood or tissue derived from patients with diseases that relate to the brain, such as mental disease, or as a control using blood or tissue from healthy individuals are hybridized to the chip, so that the chip can be applied to diagnosis and treatment for the diseases. Moreover, antibody chip, on which the antibodies against the polypeptides of the present invention are thoroughly prepared and arrayed, can be applied to diagnosis, treatment of diseases and the like through proteome analysis, such as detection of a difference in expression amount of a protein between a patient and a healthy individual.
The present application asserts priority based on the three specifications of Japanese Patent Application Nos. 2000-389742, 2001-95524 and 2001-127066, and includes by reference all of the contents as disclosed in these specifications.
Claims
1. DNA comprising a nucleotide sequence encoding a polypeptide (a) or (b) as follows:
(a) a polypeptide comprising an amino acid sequence which is identical or substantially identical to an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70;
(b) a polypeptide which comprises an amino acid sequence derived from an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70 by deletion, substitution or addition of a section of amino acid(s), and has biological activity which is substantially the same characteristic with the function of the polypeptide of (a).
2. DNA hybridizing to the DNA of claim 1 under stringent conditions, and encoding a polypeptide having biological activity which is substantially the same characteristic with the function of the polypeptide of (a) of claim 1.
3. A gene construct containing the DNA of claim 1 or 2.
4. A polypeptide (a) or (b) as follows:
(a) a polypeptide comprising an amino acid sequence which is identical or substantially identical to an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70;
(b) a polypeptide comprising an amino acid sequence derived from an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70 by deletion, substitution or addition of a section of amino acids, and having biological activity which is substantially the same characteristic with the function of the polypeptide of (a).
5. A recombinant polypeptide, which is encoded by the gene construct of claim 3.
6. An antibody against the polypeptide of claim 4 or 5.
7. A DNA chip, on which the DNAs of claim 1 or 2 are arrayed.
8. A polypeptide chip, on which the polypeptides of claim 4 or 5 are arrayed.
9. An antibody chip, on which the antibodies of claim 6 are arrayed.