US20070037764A1
2007-02-15
11/433,257
2006-05-11
The invention provides antisense antiviral compounds and methods of their use in inhibition of growth of human immunodeficiency virus-1 (HOV-1), as in treatment of a viral infection. The antisense antiviral compounds have morpholino subunits linked by uncharged phosphorodiamidate linkages interspersed with cationic phosphorodiamidate linkages. An exemplary embodiment of the invention provides an antisense compound directed to the HIV Vif gene, causing the production of defective HIV- 1 virions in an infected individual.
Get notified when new applications in this technology area are published.
A61K31/675 » CPC main
Medicinal preparations containing organic active ingredients; Phosphorus compounds having nitrogen as a ring hetero atom, e.g. pyridoxal phosphate
A61P31/18 » CPC further
Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics; Antivirals for RNA viruses for HIV
A61P37/06 » CPC further
Drugs for immunological or allergic disorders; Immunomodulators Immunosuppressants, e.g. drugs for graft rejection
C12N15/1132 » CPC further
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides against viruses against retroviridae, e.g. HIV
C07K2319/10 » CPC further
Fusion polypeptide containing a localisation/targetting motif containing a tag for extracellular membrane crossing, e.g. TAT or VP22
C12N2310/11 » CPC further
Structure or type of the nucleic acid; Type of nucleic acid Antisense
C12N2810/6054 » CPC further
Vectors comprising a targeting moiety; Vectors comprising as targeting moiety peptide derived from defined protein from viruses; RNA rev transcr viruses Retroviridae
A61K48/00 IPC
Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
C07F9/6533 IPC
Compounds containing elements of Groups 5 or 15 of the Periodic System; Phosphorus compounds; Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having nitrogen and oxygen atoms as the only ring hetero atoms Six-membered rings
This is a continuation-in-part of U.S. patent application Ser. No. 10/971,959, filed Oct. 21, 2004, now pending, which claims the benefit of priority to U.S. Provisional Application No. 60/514,064, filed Oct. 23, 2003. Both applications are incorporated herein by reference.
FIELD OF THE INVENTIONThe present invention is drawn to novel antiviral antisense oligomers and their use in inhibiting HIV- 1 infection and replication in hematopoietic cells, in particular, macrophage and T lymphocyte cells.
REFERENCESAgrawal, S., S. H. Mayrand, et al. (1990). “Site-specific excision from RNA by RNase H and mixed-phosphate-backbone oligodeoxynucleotides.” Proc Natl Acad Sci USA 87(4): 1401-5.
Akhtar, S., S. Basu, et al. (1991). “Interactions of antisense DNA oligonucleotide analogs with phospholipid membranes (liposomes).” Nucleic Acids Res 19(20): 5551-9.
Aldrovandi, G. M. and J. A. Zack (1996). “Replication and pathogenicity of human immunodeficiency virus type 1 accessory gene mutants in SCID-hu mice.” J Virol 70(3): 1505-11.
Anderson, C. M., W. Xiong, et al. (1999). “Distribution of equilibrative, nitrobenzylthioinosine-sensitive nucleoside transporters (ENT1) in brain.” J Neurochem 73(2): 867-73.
Anderson, K. P., M. C. Fox, et al. (1996). “Inhibition of human cytomegalovirus immediate-early gene expression by an antisense oligonucleotide complementary to immediate-early RNA.” Antimicrob Agents Chemother 40(9): 2004-11.
Berrey, M. M., T. Schacker, et al. (2001). “Treatment of primary human immunodeficiency virus type 1 infection with potent antiretroviral therapy reduces frequency of rapid progression to AIDS.” J Infect Dis 183(10): 1466-75.
Bonham, M. A., S. Brown, et al. (1995). “An assessment of the antisense properties of RNase H-competent and steric-blocking oligomers.” Nucleic Acids Res 23(7): 1197-203.
Boudvillain, M., M. Guerin, et al. (1997). “Transplatin-modified oligo(2′-O-methyl ribonucleotide)s: a new tool for selective modulation of gene expression.” Biochemistry 36(10): 2925-31.
Courcoul, M., C. Patience, et al. (1995). “Peripheral blood mononuclear cells produce normal amounts of defective Vif- human immunodeficiency virus type 1 particles which are restricted for the preretrotranscription steps.” J Virol 69(4): 2068-74.
Desrosiers, R. C., J. D. Lifson, et al. (1998). “Identification of highly attenuated mutants of simian immunodeficiency virus.” J Virol 72(2): 1431-7.
Dettenhofer, M., S. Cen, et al. (2000). “Association of human immunodeficiency virus type 1 Vif with RNA and its role in reverse transcription.” J Virol 74(19): 8938-45.
Ding, D., S. M. Grayaznov, et al. (1996). “An oligodeoxyribonucleotide N3′->P5′ phosphoramidate duplex forms an A-type helix in solution.” Nucleic Acids Res 24(2): 354-60.
Gee, J. E., I. Robbins, et al. (1998). “Assessment of high-affinity hybridization, RNase H cleavage, and covalent linkage in translation arrest by antisense oligonucleotides.” Antisense Nucleic Acid Drug Dev 8(2): 103-11.
Goncalves, J., Y. Korin, et al. (1996). “Role of Vif in human immunodeficiency virus type 1 reverse transcription.” J Virol 70(12): 8701-9.
Harris, R. S., K. N. Bishop, et al. (2003). “DNA deamination mediates innate immunity to retroviral infection.” Cell 113(6): 803-9.
Hudziak, R. M., E. Barofsky, et al. (1996). “Resistance of morpholino phosphorodiamidate oligomers to enzymatic degradation.” Antisense Nucleic Acid Drug Dev 6(4): 267-72.
Kinter, A. L., C. A. Umscheid, et al. (2003). “HIV envelope induces virus expression from resting CD4+T cells isolated from HIV-infected individuals in the absence of markers of cellular activation or apoptosis.” J Immunol 170(5): 2449-55.
Loke, S. L., C. A. Stein, et al. (1989). “Characterization of oligonucleotide transport into living cells.” Proc Natl Acad Sci USA 86(10): 3474-8.
Mariani, R., D. Chen, et al. (2003). “Species-specific exclusion of APOBEC3G from HIV-1 virions by Vif.” Cell 114(1): 21-31.
Marin, M., K. M. Rose, et al. (2003). “HIV-1 Vif protein binds the editing enzyme APOBEC3G and induces its degradation.” Nat Med.
Moulton, H. M., M. C. Hase, et al. (2003). “HIV Tat peptide enhances cellular delivery of antisense morpholino oligomers.” Antisense Nucleic Acid Drug Dev 13(1): 31-43.
Moulton, H. M. and J. D. Moulton (2003). “Peptide-assisted delivery of steric-blocking antisense oligomers.” Curr Opin Mol Ther 5(2): 123-32.
Moulton, H. M., M. H. Nelson, et al. (2004). “Cellular uptake of antisense morpholino oligomers conjugated to arginine-rich peptides.” Bioconjug Chem 15(2): 290-9.
Murphy, K. M., A. B. Heimberger, et al. (1990). “Induction by antigen of intrathymic apoptosis of CD4+CD8+TCR1o thymocytes in vivo.” Science 250(4988): 1720-3.
Pari, G. S., A. K. Field, et aL (1995). “Potent antiviral activity of an antisense oligonucleotide complementary to the intron-exon boundary of human cytomegalovirus genes UL36 and UL37.” Antimicrob Agents Chemother 39(5): 1157-61.
Sheehy, A. M., N. C. Gaddis, et al. (2002). “Isolation of a human gene that inhibits HIV-1 infection and is suppressed by the viral Vif protein.” Nature 418(6898): 646-50.
Simon, J. H. and M. H. Malim (1996). “The human immunodeficiency virus type 1 Vif protein modulates the postpenetration stability of viral nucleoprotein complexes.” J Virol 70(8): 5297-305.
Stein, D., E. Foster, et al. (1997). “A specificity comparison of four antisense types: morpholino, 2′-O-methyl RNA, DNA, and phosphorothioate DNA.” Antisense Nucleic Acid Drug Dev 7(3): 151-7.
Summerton, J. and D. Weller (1997). “Morpholino antisense oligomers: design, preparation, and properties.” Antisense Nucleic Acid Drug Dev 7(3): 187-95.
Toulme, J. J., R. L. Tinevez, et al. (1996). “Targeting RNA structures by antisense oligonucleotides.” Biochimie 78(7): 663-73.
Wender, P. A., D. J. Mitchell, et al. (2000). “The design, synthesis, and evaluation of molecules that enable or enhance cellular uptake: peptoid molecular transporters.” Proc Natl Acad Sci USA 97(24): 13003-8.
Yakubov, L. A., E. A. Deeva, et al. (1989). “Mechanism of oligonucleotide uptake by cells: involvement of specific receptors?” Proc Natl Acad Sci USA 86(17): 6454-8.
Zhu, T., D. Muthui, et al. (2002). “Evidence for human immunodeficiency virus type 1 replication in vivo in CD 14(+) monocytes and its potential role as a source of virus in patients on highly active antiretroviral therapy.” J Virol 76(2): 707-16
BACKGROUND OF THE INVENTIONHuman immunodeficiency virus (HIV) has been identified as the etiological agent responsible for acquired immune deficiency syndrome (AIDS), a fatal disease characterized by destruction of the immune system and the inability to fight off life threatening opportunistic infections. Recent statistics (UNAIDS: AIDS Epidemic Update, December 2002), indicate that as many as 42 million people worldwide are infected with the virus. In addition to the large number of individuals already infected, the virus continues to spread. Estimates from 2002 indicate 5 million new infections in that year alone. In the same year there were approximately 3.1 million deaths associated with HIV and AIDS.
The global health crisis caused by the human immunodeficiency virus (HIV) is unquestioned, and while recent advances in drug therapies have been successful in slowing the progression of AIDS, there is still a need to find a safer, more efficient way to control the virus. Although considerable effort is being put into the successful design of effective therapeutics, currently no curative anti-retroviral drugs against AIDS exist.
Presently available antiviral drugs to combat HIV infection can be divided into three classes based on the viral protein they target and their mode of action. Saquinavir, indinavir, ritonavir, nelfinavir and amprenavir are competitive inhibitors of the aspartyl protease expressed by HIV. Zidovudine, didanosine, stavudine, lamivudine, zalcitabine and abacavir are nucleoside reverse transcriptase inhibitors that block viral cDNA synthesis. The non-nucleoside reverse transcriptase inhibitors, nevaripine, delavamidine and efavirenz inhibit the synthesis of viral cDNA via a non-competitive mechanism. Used alone these drugs are effective in reducing viral replication. The antiviral effect is only temporary as HIV rapidly develops resistance to all known agents. To circumvent this problem, combination therapy (also called highly active antiretroviral therapy, or HAART) has proven very effective at both reducing virus load and suppressing the emergence of resistance in a number of patients. In the US, where HAART is widely available, the number of HIV-related deaths has declined (Berrey, Schacker et al. 2001).
Despite the success obtained with HAART, approximately 30-50% of patients ultimately fail resulting in the emergence of viral resistance. Viral resistance in turn is caused by the rapid turnover of HIV- 1 during the course of infection combined with a high viral mutation rate. Incomplete viral suppression is thought to provide an environment for drug resistant variants to emerge. Even when viral plasma levels have dropped below detectable levels (<50 copies/ml) as a consequence of HAART, low-level HIV replication continues (Zhu, Muthui et al. 2002; Kinter, Umscheid et al. 2003). Clearly there is a need for new antiviral agents, preferably targeting other viral enzymes to reduce the rate of resistance and suppress viral replication even further.
SUMMARY OF THE INVENTIONIn one aspect, the invention provides an antiviral compound directed against a human immunodeficiency virus (HIV-1). The antiviral compound comprises an oligomer or oligonucleotide compound having a sequence of 12 to 40 morpholino subunits (a) with a targeting base sequence that is substantially complementary to a viral target sequence composed of at least 12 contiguous bases in a region of HIV-1 positive strand RNA identified by one of the sequences selected from the group consisting of SEQ ID NOS:17-19 of and (b) that are linked by uncharged phosphorodiamidate linkages interspersed with at least two and up to half positively charged phosphorodiamidate linkages. In a preferred embodiment, the uncharged, phosphorus-containing intersubunit linkages are represented by the structure:
where Y1═O, Z=O, Pj is a purine or pyrimidine base-pairing moiety effective to bind, by base-specific hydrogen bonding , to a base in a polynucleotide (where base-pairing moieties on different subunits may be the same or different), X is alkyl, alkoxy, thioalkoxy, or alkyl amino of the form NR2, where each R is independently hydrogen or methyl, and the positively charged linkages are represented by the same structure, but where X is 1-piperazino.
In one embodiment, the antisense compound is capable of hybridizing with a sequence selected from the group consisting of SEQ ID NO:17 (i) to form a heteroduplex structure having a Tm of dissociation of at least 45° C., and (ii) to inhibit the synthesis of the HIV Vif protein in the infected cells. The compound in this embodiment may have at least 12 contiguous bases from one of the sequences selected from the group consisting of SEQ ID NOS:5-13.
In another embodiment, the antisense compound is capable of hybridizing with SEQ ID NO:18 (i) to form a heteroduplex structure having a Tm of dissociation of at least 45° C., and (ii) to inhibit the transcription of HIV mRNA transcripts. The compound in this embodiment may have at least 12 contiguous bases from the sequences identified as SEQ ID NOS:14 and 15.
In another embodiment, the antisense compound is capable of hybridizing with SEQ ID NOS: 19, (i) to form a heteroduplex structure having a Tm of dissociation of at least 45° C., and (ii) to inhibit reverse transcription of viral RNA by blocking the minus-strand transfer step. The compound in this embodiment may have at least 12 contiguous bases from the sequence identified as SEQ ID NO:16.
In a related aspect, the invention includes a method of selectively inhibiting HIV-1 replication in HIV-1-infected human hematopoietic cells, e.g., macrophage or T lymphocyte cells. In practicing the method, HIV-infected cells are exposed to an antisense oligomer of the type described above, including exemplary embodiments noted above.
These and other objects and features of the invention will become more fully apparent when the following detailed description of the invention is read in conjunction with the accompanying drawings.
BRIEF DESCRIPTION OF THE FIGURESFIGS. 1A-1D show several preferred morpholino-type subunits having 5-atom (A), six-atom (B) and seven-atom (C-D) linking groups suitable for forming polymers.
FIGS. 2A-2D show the repeating subunit segment of exemplary morpholino oligonucleotides, designated A through D, constructed using subunits A-D, respectively, of FIG. 1.
FIGS. 3A-3G show examples of uncharged linkage types in oligonucleotide analogs. FIG. 3H shows a preferred positively charged linkage.
FIGS. 4A-4C show fluorescence activated cell sorting (FACS) analysis of uptake of rTAT-PMO conjugates into cultured splenocytes incubated with fluorescent conjugates and subjected to various lymphocyte activating substance in culture, as indicated. Separate lymphocytes populations were stained with antibodies to determine the extent of uptake by FACS analysis in CD8 positive T cells (FIG. 4A), CD4 positive T cells (FIG. 4B), and B cells (B220 positive cells) (FIG. 4C).
FIGS. 5A-5B shows FACS analysis of conjugated PMO uptake into naive and activated CD8 (FIG. 5A), and CD4 T-cells (FIG. 5B) using PMO-0003 (arginine-rich peptide-PMO) and PMO-0002 (rTAT-PMO).
FIG. 6 shows the synthetic steps to produce subunits used to produce +PMO containing the (1-piperazino) phosphinylideneoxy cationic linkage as shown in FIG. 3H.
FIG. 7 shows the inhibition of HIV-1 replication in human H9 cells in the presence of a peptide-conjugated PMO that targets the Vif AUG start codon (SEQ ID NO:
DETAILED DESCRIPTION OF THE INVENTIONI. Definitions
The terms below, as used herein, have the following meanings, unless indicated otherwise.
The term “hematopoietic cells ” refers specifically to T cells (T lymphocyte cells), B cells (B lymphocyte cells), monocytes, macrophages, dendritic cells and microglial cells among the other cell lineages derived from these hematopoietic precursors. All of these cells support HIV infection.
The term “activated, HIV-infected T-lymphocyte cells” refers to T cells that become activated, either as a result of HIV infection of the cells and/or after the T cell receptor (TCR) complex and a co-stimulatory receptor (e.g. CD28 on naive CD4 and CD8 T cells) are engaged to the extent that a signal transduction cascade is initiated, following HIV infection. Upon activation, T cells will proliferate and then secrete cytokines or carry out cytolysis on cells expressing a specific foreign peptide with self MHC. Cytokines are growth factors for other T cells, signals for B cells to produce antibody and signals for the transcriptional activation of HIV. The majority of HIV production in T cells is linked to T cell activation as determined by classical activation markers.
The term “macrophages” refer to mononuclear phagocytes which are key components of innate immunity because they recognize, ingest, and destroy many pathogens without the aid of an adaptive immune response. They are also an important reservoir of HIV infection and are able to harbor replicating virus without being killed by it.
“Activated, HIV-infected macrophage cells” refers to HIV-infected macrophage cells that have become activated either as a result of HIV infection of the cells and/or effector T cells activate macrophages by direct interaction (e.g. CD40 ligand on T cells binds to CD40 on macrophages) and by secretion of gamma-interferon, a potent macrophage activating cytokine. Macrophage activation results in increased HIV replication as is the case with T cells.
The term “antigen-activated B cells” refer to either of two different types of B cell activation, T cell dependent and T cell independent. T cell independent antigens contain repetitive identical epitopes and are capable of clustering membrane bound antibody on the surface of the B cell which can result in delivering activation signals. T cell dependent activation is in response to protein antigens where the B cell acts as a professional antigen presenting cell. In either case of B cell activation the cell will proliferate and differentiate into plasma B cells capable of secreting antibodies against the antigen.
The term “mature dendritic cells” (DCs) refer to professional antigen-presenting cells (APCs) that express both MHC class I and II and co-stimulatory molecules and are capable of initiating activation of naive T cells. Two different DC phenotypes are exhibited depending on maturation state and location in the body. Immature DCs reside in all tissues and organs as active phagocytic cells. Mature DCs traffic to secondary lymphoid organs (e.g. lymph node and spleen) and present peptides derived from processed protein antigens to T cells in the context of MHC molecules. Mature DCs also provide the necessary co-stimulatory signals to T cells by expressing the appropriate surface ligand (e.g. CD80 and CD86 on DCs bind to CD28 on T cells).
The terms “antisense oligonucleotides,” “antisense oligomer,” “antisense compound” and “targeting antisense oligomer” are used interchangeably and refer to a compound having sequence of nucleotide bases and a subunit-to-subunit backbone that allows the antisense oligomer to hybridize to a target sequence in an RNA by Watson-Crick base pairing, to form an RNA:oligomer heterduplex within the target sequence. The antisense oligonucleotide includes a sequence of purine and pyrimidine heterocyclic bases, supported by a backbone, which are effective to hydrogen-bond to corresponding, contiguous bases in a target nucleic acid sequence. The backbone is composed of subunit backbone moieties supporting the purine and pyrimidine heterocyclic bases at positions that allow such hydrogen bonding. These backbone moieties may be cyclic moieties of 5 to 7 atoms in length, linked together by, for example, phosphorous-containing linkages one to three atoms long. Alternatively, the backbone may comprise a peptide structure, such as the backbone of a peptide nucleic acid (PNA)
A “morpholino” oligonucleotide refers to a polymeric molecule having a backbone which supports bases capable of hydrogen bonding to typical polynucleotides, wherein the polymer lacks a pentose sugar backbone moiety, and more specifically a ribose backbone linked by phosphodiester bonds which is typical of nucleotides and nucleosides, but instead contains a ring nitrogen with coupling through the ring nitrogen.
A substantially uncharged, phosphorus containing backbone in an oligonucleotide analog is one in which a majority of the subunit linkages, e.g., between 50-100%, are uncharged at physiological pH, and contain a single phosphorous atom. The analog contains between 12 and 40 subunits, typically about 15-25 subunits, and preferably about 18 to 25 subunits. The analog may have exact sequence complementarity to the target sequence or near complementarity, as defined below. The morpholino subunits in the oliogmer compound of the present invention that are linked by uncharged phosphorodiamidate linkages interspersed with at least two and up to half positively charged phosphorodiamidate linkages. Such oligomers are composed of morpholino subunit structures such as shown in FIG. 2B, where X═NH2, NHR, or NR2 (where R is lower alkyl, preferably methyl), Y═O, and Z=O, and Pi and Pj are purine or pyrimidine base-pairing moieties effective to bind, by base-specific hydrogen bonding, to a base in a polynucleotide, where the phosphordiamidate linkages may be a mixture of uncharged linkages as shown in FIG. 3G and cationic linkages as shown in FIG. 3H where, in FIG. 2B, X=1-piperazino. Also preferred are structures having an alternate uncharged phosphorodiamidate linkage, where, in FIG. 1B, X=lower alkoxy, such as methoxy or ethoxy, Y═NH or NR, where R is lower alkyl, and Z=O.
A preferred “morpholino” oligonucleotide is composed of morpholino subunit structures of the form shown in FIGS. 1A-1D, where (i) the structures are linked together by phosphorous-containing linkages, one to three atoms long, joining the morpholino nitrogen of one subunit to the 5′ exocyclic carbon of an adjacent subunit, and (ii) Pi and Pj are purine or pyrimidine base-pairing moieties effective to bind, by base-specific hydrogen bonding, to a base in a polynucleotide. Exemplary structures for antisense oligonucleotides for use in the invention include the morpholino subunit types shown in FIGS. 1A-1D, with the uncharged, phosphorous-containing linkages shown in FIGS. 2A-2D, and more generally, the uncharged linkages 3A-3G, and the charged,cationic linkage is shown in FIG. 3H.
As used herein, an oligonucleotide or antisense oligomer “specifically hybridizes” to a target polynucleotide if the oligomer hybridizes to the target under physiological conditions, with a thermal melting point (Tm) substantially greater than 37° C., preferably at least 45° C., and typically 50° C.-80° C. or higher. Such hybridization preferably corresponds to stringent hybridization conditions, selected to be about 10° C., and preferably about 50° C. lower than the Tm for the specific sequence at a defined ionic strength and pH. At a given ionic strength and pH, the Tm is the temperature at which 50% of a target sequence hybridizes to a complementary polynucleotide.
Polynucleotides are described as “complementary” to one another when hybridization occurs in an antiparallel configuration between two single-stranded polynucleotides. A double-stranded polynucleotide can be “complementary” to another polynucleotide, if hybridization can occur between one of the strands of the first polynucleotide and the second. Complementarity (the degree that one polynucleotide is complementary with another) is quantifiable in terms of the proportion of bases in opposing strands that are expected to form hydrogen bonds with each other, according to generally accepted base-pairing rules.
As used herein the term “analog” with reference to an oligomer means a substance possessing both structural and chemical properties similar to those of the reference oligomer.
As used herein, a first sequence is an “antisense sequence” with respect to a second sequence if a polynucleotide whose sequence is the first sequence specifically binds to, or specifically hybridizes with, the second polynucleotide sequence under physiological conditions.
As used herein, “effective amount” relative to an antisense oligomer refers to the amount of antisense oligomer administered to a subject, either as a single dose or as part of a series of doses, that is effective to inhibit expression of a selected target nucleic acid sequence.
Unless otherwise indicated, “HIV” is intended to include Human Immunodeficiency Virus-1 (HIV-1).
“Inhibition HIV-1 replication in HIV-1-infected cells” means inhibiting viral replication within the cell, either by inhibiting or blocking the synthesis of a critical structural protein, inhibiting or blocking the synthesis of a viral protein necessary for viral-protein synthesis, replication, or assembly, or blocking a cis-acting element on the HIV genome or portion thereof.
“Selectively inhibiting HIV-1 in activated, HIV-1-infected hematopoietic cells, e.g., macrophage or T-lymphocyte cells, cells” means inhibiting HIV infection selectively with respect to the extent of viral inhibition that would be observed in non-activated or non-HIV infected hematopoietic cells under the same inhibition conditions.
The terms “percent identity” and “% identity,” as applied to polynucleotide sequences, refer to the percentage of residue matches between at least two polynucleotide sequences aligned using a standardized algorithm.
The term “similarity” refers to a degree of complementarity. There may be partial similarity or complete similarity. The word “identity” may substitute for the word “similarity.”
Percent identity can be determined electronically, e.g., by using the MEGALIGN program (DNASTAR, Madison Wis.) and protocols well known in the art.
Abbreviations:
PMO=morpholino oligomer
PMO+=morpholino oligomer with interspersed cationic linkages
ARP=arginine-rich polypeptide
ARP-PMO=arginine-rich polypeptide conjugated to a PMO
HIV=HIV-1=human immunodeficiency virus-1
Vif=viral infectivity factor
HAART=highly active antiretroviral therapy
II. HIV Replication in Hematopoietic Cells
HIV infection of a cell is initiated by the interaction of viral envelope glycoproteins with specific cellular receptors. Following adsorption and uncoating, the viral RNA enters the target cell and is converted into cDNA by the action of reverse transcriptase (RT), an enzyme brought within the virion. The cDNA adopts a circular form, is converted to double-stranded cDNA and then becomes integrated into the host cell's genomic DNA by the action of integrase, a component of RT. Once integrated, HIV proviral cDNA is transcribed from the promoter within the 5′ LTR. The transcribed RNA is spliced into one of several subgenomic mRNAs which act as mRNA and are translated to produce the viral proteins or is left as nascent, full-length viral RNA which is also translated or targeted for packaging into budding virions. Full length genomic viral RNA contains a psi packaging sequence and a dimerization sequence near its 5′ end which are essential for packaging of two dimerized, full-length viral RNA molecules into virions. Once the virion is produced, it is released from the cell by budding from the plasma membrane. The proviral cDNA remains stably integrated in the host genome and is replicated with the host DNA so that progeny cells also inherit the provirus.
The entry of HIV into cells, including T lymphocytes, monocytes and macrophages, is, in general, effected by the interaction of the gp120 envelope protein of HIV with a CD4 receptor on the target cell surface. The amino acid sequence of gp120 can be highly variable in different patients (or even the same patient). This variability plays an important role in disease progression. The major peculiarities for HIV are that it has a latent phase in which the provirus may lie dormant following integration into the host cell's genome and it is cytopathic for T lymphocyte target cells. HIV commences the bulk of viral replication in activated and proliferating cells due to the binding of nuclear transcription and cellular enhancer factors to the HIV LTR which results in increased levels of viral transcription. As for all retroviruses, gag, pol and env gene products are translated into structural and enzymatic proteins. In addition, HIV encodes several additional regulatory genes. Specifically, Tat and Rev are regulatory proteins and act to modulate transcriptional and posttranscriptional steps, respectively, and are essential for virus propagation. Nef is another regulatory gene which increases viral infectivity and is essential for efficient viral spread and disease progression in vivo.
Another important regulatory protein is Vif or the viral infectivity factor (see below). Vif promotes the infectivity but not the production of viral particles. Viral particles produced in the absence of Vif (e.g. Vif deletion mutants) are defective while the cell to cell transmission of virus is not altered.
HIV infects primarily T cells and macrophages and HIV isolates that preferentially infect these cells are called T-tropic and M-tropic, respectively. Virus isolates from early stages of an infection are consistently M-tropic while over the course of disease progression T-tropic viruses emerge and are associated with advanced disease stages. HIV replication in both T cells and macrophages is highest in activated and proliferating cells due to the binding of nuclear transcription and cellular enhancer factors to the HIV long terminal repeat (LTR) resulting in increased transcription of HIV genes. This narrow tissue tropism provides an opportunity to deliver antiviral drugs to a discrete population of hematopoietic cells provided an appropriate delivery mechanism is available.
As described above, anti-HIV drugs currently in use directly interfere with the machinery by which HIV-1 replicates itself within human cells. Lentiviruses such as HIV-1 encode a number of accessory genes in addition to the structural gag, pol, and env genes common to all retroviruses. One of these accessory genes, Vif (viral infectivity factor), is expressed by many lentiviruses. The HIV-1 Vif protein is a 23-kDa protein composed of 192 highly basic amino acids. Deletion of the Vif gene dramatically decreases the replication of simian immunodeficiency virus (SIV) in macaques and HIV-1 replication in SCID-hu mice (Aldrovandi and Zack 1996; Desrosiers, Lifson et al. 1998), supporting an essential role for Vif in the pathogenic replication of lentiviruses in vivo.
A. Targeting Vif mRNA
Recently, a mechanism for Vif function has been proposed (Sheehy, Gaddis et al. 2002; Mariani, Chen et al. 2003; Marin, Rose et al. 2003). In this model Vif acts to neutralize a cellular protein, APOBEC3G, that is part of a conserved antiretroviral pathway in mammalian cells. In the absence of Vif, APOBEC3G is incorporated into virions and in newly infected cells disables reverse transcription. Vif specifically inactivates APOBEC3G and prevents its incorporation into progeny virions allowing productive infection of newly infected cells.
HIV-1 mutants with defective Vif genes have normal viral transcription, translation and virion production. These HIV-1 variants are able to bind and penetrate target cells but are not able to complete reverse transcription during the subsequent cycle of infection (Courcoul, Patience et al. 1995; Goncalves, Korin et al. 1996; Simon and Malim 1996; Dettenhofer, Cen et al. 2000). Vif is incorporated into HIV-1 virions and binds to RNA.
Vif functions to inactivate a newly discovered innate antiretroviral pathway in human T lymphocytes. The APOBEC3G protein is a member of the cytidine deaminase family of nucleic acid editing enzymes and provides innate immunity to retroviral infection by effecting massive deamination of cytidine residues in nascent, first strand cDNA produced by reverse transcriptase (Harris, Bishop et al. 2003). HIV-1 utilizes the Vif protein to defeat the antiretroviral activity of APOBEC3G by Vif binding to APOBEC3G and targeting it for degradation by cellular proteasome-dependent pathways (Marin, Rose et al. 2003). APOBEC3G is absent from HIV-1 virions produced in the presence of Vif and present in virions produced in the absence of Vif. Current models suggest that virion incorporated APOBEC3G is responsible for the cytidine deamination of nascent cDNA in cells infected by virions containing APOBEC3G (Marin, Rose et al. 2003). Therefore, Vif acts to eliminate APOBEC3G from progeny virions and allows infection of otherwise nonpermisive cells.
Antisense oligomers directed to Vif MRNA reduce Vif protein levels and allow incorporation of APOBEC3G into nascent virions. This substantially reduces or eliminates the replicative potential of these virions and cause infected cells to produce a virus population with an increased defective to non-defective virion ratio. The overall effect on an in vivo infection is to block the productive infection of lymphoid and myeloid cells and reduce the viral load in the individual. A preferred target sequence is the region adjacent or including the AUG start site of the Vif gene, including the sequence identified by SEQ ID NO: 17 in Table 2 below. Exemplary targeting sequences for the Vif start codon include SEQ ID NOS:5-16 given below.
B. Other HIV Targets
Other HIV target sites include the translational start sites of essential HIV structural and accessory genes, the tRNA primer binding site (PBS) and primer activation sequences (PAS), the Tat-Rev subgenomic mRNA splice donor and splice acceptor sites, the major 5′ splice donor (SD) site, the psi viral RNA packaging site, sequences required for dimerization of viral RNA prior to packaging, the TAR stemloop and the boundary between the U3 and R region of the viral long terminal repeat (LTR) which serves as the point of minus strand transfer during reverse transcription. In these general embodiments designed to target translational start sites, RNA splice sites or cis-acting elements, the antisense compound has a base sequence that is complementary to a target region containing at least 12 contiguous bases in a HIV RNA transcript, and which includes at least 6 contiguous bases of one of the sequences identified by SEQ ID NOS:18 and 19 in Table 2 below. Exemplary antisense oligomer sequences include those identified as SEQ ID NOS:14-16 in Table 1 below. The target nucleotide sequence regions in Table 2 are referenced to NCBI GenBank Accession Number AF324493.
Inhibition of viral replication or infectivity may also be inhibited by blocking cis-acting elements of HIV RNA transcripts. Among the preferred target sequences for this approach are the tRNA-PBS (primer binding site), the TAR stemloop, primer activation sequences (PAS) and the Psi-packaging site and dimerization sequences (DIS) in full length HIV RNA transcripts. Exemplary target sequences for the TAR stemloop include SEQ ID NO:18 given below.
Viral replication can also be inhibitied by interfering with the minus-strand transfer step during reverse transcription. The preferred target region for this approach is found at the junction of the U3 and R regions of the viral long terminal repeat (LTR). An exemplary target sequence is SEQ ID NO:19 given below.
III. ARP-Antisense Conjugate For Targeting Activated HIV-Infected Hematopoietic Cells
The present invention is based, in part, on the discovery that the uptake of uncharged of substantially uncharged antisense compounds into activated human hematopoietic cells, such as activated, HIV-infected macrophages and T-lymphocyte cells, can be selectively enhanced, with respect to non-infected and/or non-activated cells, by conjugating the antisense compound with an rTAT polypeptide. This section describes various exemplary antisense compounds, the rTAT polypeptide, alternative ARPs and methods of producing the ARP-antisense conjugate.
A. Antisense Compound
Antisense oligomers for use in practicing the invention, preferably have the properties: (1) a backbone that is substantially uncharged, (2) the ability to hybridize with the complementary sequence of a target RNA with high affinity, that is a Tm substantially greater than 37° C., preferably at least 45° C., and typically greater than 50° C., e.g., 60° C.-80° C. or higher, (3) a subunit length of at least 8 bases, generally about 8-40 bases, preferably 12-25 bases, and (4) nuclease resistance (Hudziak, Barofsky et al. 1996).
In addition, the antisense compound may have the capability for active or facilitated transport as evidenced by (i) competitive binding with a phosphorothioate antisense oligomer, and/or (ii) the ability to transport a detectable reporter into target cells. In particular, for purposes of transport, the antisense compound displays selective uptake into activated immune cells when conjugated with rTAT polypeptide, according to cell-uptake criteria set out below.
Candidate antisense oligomers may be evaluated, according to well known methods, for acute and chronic cellular toxicity, such as the effect on protein and DNA synthesis as measured via incorporation of 3H-leucine and 3H-thymidine, respectively. In addition, various control oligonucleotides, e.g., control oligonucleotides such as sense, nonsense or scrambled antisense sequences, or sequences containing mismatched bases, in order to confirm the specificity of binding of candidate antisense oligomers. The outcome of such tests is important in discerning specific effects of antisense inhibition of gene expression from indiscriminate suppression. Accordingly, sequences may be modified as needed to limit non-specific binding of antisense oligomers to non-target nucleic acid sequences.
Heteroduplex formation. The effectiveness of a given antisense oligomer molecule in forming a heteroduplex with the target mRNA may be determined by screening methods known in the art. For example, the oligomer is incubated in a cell culture containing an MRNA preferentially expressed in activated lymphocytes, and the effect on the target mRNA is evaluated by monitoring the presence or absence of (1) heteroduplex formation with the target sequence and non-target sequences using procedures known to those of skill in the art, (2) the amount of the target MRNA expressed by activated lymphocytes, as determined by standard techniques such as RT-PCR or Northern blot, (3) the amount of protein transcribed from the target MRNA, as determined by standard techniques such as ELISA or Western blotting. (See, for example,(Pari, Field et al. 1995; Anderson, Fox et al. 1996).
Uptake into cells. A second test measures cell transport, by examining the ability of the test compound to transport a labeled reporter, e.g., a fluorescence reporter, into cells. The cells are incubated in the presence of labeled test compound, added at a final concentration between about 10-300 nM. After incubation for 30-120 minutes, the cells are examined, e.g., by microscopy or FACS analysis, for intracellular label. The presence of significant intracellular label is evidence that the test compound is transported by facilitated or active transport. It will be recognized that conjugation of the oligomer with the rTAT peptide selectively enhances uptake into activated immune cells, including activated, HIV-infected hematopoietic cells, in particular, activated, HIV-infected macrophage and T-lymphocyte cells.
RNAse resistance. Two general mechanisms have been proposed to account for inhibition of expression by antisense oligonucleotides (Agrawal, Mayrand et al. 1990; Bonham, Brown et al. 1995; Boudvillain, Guerin et al. 1997). In the first, a heteroduplex formed between the oligonucleotide and the viral RNA acts as a substrate for RNaseH, leading to cleavage of the viral RNA. Oligonucleotides belonging, or proposed to belong, to this class include phosphorothioates, phosphotriesters, and phosphodiesters (unmodified “natural” oligonucleotides). Such compounds expose the viral RNA in an oligomer:RNA duplex structure to hydrolysis by RNaseH, and therefore loss of function.
A second class of oligonucleotide analogs, termed “steric blockers” or, alternatively, “RNaseH inactive” or “RNaseH resistant” , have not been observed to act as a substrate for RNaseH, and are believed to act by sterically blocking target RNA nucleocytoplasmic transport, splicing, translation, or replication. This class includes methylphosphonates (Toulme, Tinevez et al. 1996), morpholino oligonucleotides, peptide nucleic acids (PNA's), certain 2′-O-allyl or 2′-O-alkyl modified oligonucleotides (Bonham, Brown et al. 1995), and N3′→P5′ phosphoramidates (Ding, Grayaznov et al. 1996; Gee, Robbins et al. 1998).
A test oligomer can be assayed for its RNaseH resistance by forming an RNA:oligomer duplex with the test compound, then incubating the duplex with RNaseH under a standard assay conditions, as described (Stein, Foster et al. 1997). After exposure to RNaseH, the presence or absence of intact duplex can be monitored by gel electrophoresis or mass spectrometry.
In vivo uptake. In accordance with another aspect of the invention, there is provided a simple, rapid test for confirming that a given antisense oligomer type provides the required characteristics noted above, namely, high Tm, ability to be actively taken up by the host cells, and substantial resistance to RNaseH. This method is based on the discovery that a properly designed antisense compound will form a stable heteroduplex with the complementary portion of the viral RNA target when administered to a mammalian subject, and the heteroduplex subsequently appears in the urine (or other body fluid). Details of this method are also given in co-owned U.S. Pat. No. 6,365,351 for “Non-Invasive Method for Detecting Target RNA,” the disclosure of which is incorporated herein by reference.
Briefly, a test oligomer containing a backbone to be evaluated, having a base sequence targeted against a known RNA, is administered to a mammalian subject. The antisense oligomer may be directed against any intracellular RNA, including RNA encoded by a host gene. Several hours (typically 8-72) after administration, the urine is assayed for the presence of the antisense-RNA heteroduplex. If heteroduplex is detected, the backbone is suitable for use in the antisense oligomers of the present invention.
The test oligomer may be labeled, e.g. by a fluorescent or a radioactive tag, to facilitate subsequent analyses, if it is appropriate for the mammalian subject. The assay can be in any suitable solid-phase or fluid format. Generally, a solid-phase assay involves first binding the heteroduplex analyte to a solid-phase support, e.g., particles or a polymer or test-strip substrate, and detecting the presence/amount of heteroduplex bound. In a fluid-phase assay, the analyte sample is typically pretreated to remove interfering sample components. If the oligomer is labeled, the presence of the heteroduplex is confirmed by detecting the label tags. For non-labeled compounds, the heteroduplex may be detected by immunoassay if in solid phase format or by mass spectroscopy or other known methods if in solution or suspension format.
Structural features. As detailed above, the antisense oligomer has a base sequence directed to a targeted portion of the HIV genome, as discussed in Section II above. In addition, the oligomer is able to effectively inhibit expression or action of the targeted genome region when administered to a host cell, e.g. in a mammalian subject. This requirement is met when the oligomer compound (a) has the ability to be selectively taken up by activated, HIV-infected macrophage or T lymphocyte cells, (or other activated immune cells) and (b) once taken up, form a duplex with the target RNA with a Tm greater than about 45° C.
The ability to be taken up selectively by activated immune cells requires, in part, that the oligomer backbone be substantially uncharged. The ability of the oligomer to form a stable duplex with the target RNA will depend on the oligomer backbone, the length and degree of complementarity of the antisense oligomer with respect to the target, the ratio of G:C to A:T base matches, and the positions of any mismatched bases. The ability of the antisense oligomer to resist cellular nucleases promotes survival and ultimate delivery of the agent to the cell cytoplasm.
Antisense oligonucleotides of 15-20 bases are generally long enough to have one complementary sequence in the mammalian genome. In addition, antisense compounds having a length of at least 17 nucleotides in length hybridize well with their target mRNA(Akhtar, Basu et al. 1991). Due to their hydrophobicity, antisense oligonucleotides interact well with phospholipid membranes (Akhtar, Basu et al. 1991), and it has been suggested that following the interaction with the cellular plasma membrane, oligonucleotides are actively transported into living cells (Loke, Stein et al. 1989; Yakubov, Deeva et al. 1989; Anderson, Xiong et al. 1999).
Morpholino oligonucleotides, particularly phosphoramidate- or phosphorodiamidate-linked morpholino oligonucleotides have been shown to have high binding affinities for complementary or near-complementary nucleic acids. Morpholino oligomers also exhibit little or no non-specific antisense activity, afford good water solubility, are immune to nucleases, and are designed to have low production costs (Summerton and Weller 1997).
Morpholino oligonucleotides (including antisense oligomers) are detailed, for example, in co-owned U.S. Patent Nos. 5,698,685, 5,217,866, 5,142,047, 5,034,506, 5,166,315, 5,185, 444, 5,521,063, and 5,506,337, all of which are expressly incorporated by reference herein
In one preferred approach, antisense oligomers for use in practicing the invention are composed of morpholino subunits of the form shown in the above cited patents, where (i) the morpholino groups are linked together by phosphorodiamidate linkages, one to three atoms long, joining the morpholino nitrogen of one subunit to the 5′ exocyclic carbon of an adjacent subunit, and (ii) the base attached to the morpholino group is a purine or pyrimidine base-pairing moiety effective to bind, by base-specific hydrogen bonding, to a base in a polynucleotide. The purine or pyrimidine base-pairing moiety is typically adenine, cytosine, guanine, uracil, inosine or thymine. Preparation of such oligomers is described in detail in U.S. Pat. No. 5,185,444 (Summerton et al., 1993), which is hereby incorporated by reference in its entirety. As shown in this reference, several types of nonionic linkages may be used to construct a morpholino backbone.
Exemplary subunit structures for antisense oligonucleotides of the invention include the morpholino subunit types shown in FIGS. 1A-D, each linked by an uncharged, phosphorous-containing subunit linkage, as shown in FIGS. 2A-2D, respectively. In these figures, the X moiety pendant from the phosphorous may be any of the following: fluorine; an alkyl or substituted alkyl; an alkoxy or substituted alkoxy; a thioalkoxy or substituted thioalkoxy; or, an unsubstituted, monosubstituted, or disubstituted nitrogen, including cyclic structures. Alkyl, alkoxy and thioalkoxy preferably include 1-6 carbon atoms, and more preferably 1-4 carbon atoms. Monosubstituted or disubstituted nitrogen preferably refers to lower alkyl substitution, and the cyclic structures are preferably 5- to 7-membered nitrogen heterocycles optionally containing 1-2 additional heteroatoms selected from oxygen, nitrogen, and sulfur. Z is sulfur or oxygen, and is preferably oxygen.
FIG. 1A shows a phosphorous-containing linkage which forms the five atom repeating-unit backbone shown in FIG. 2A, where the morpholino rings are linked by a 1-atom phosphoamide linkage. Subunit B in FIG. 1B is designed for 6-atom repeating-unit backbones, as shown in FIG. 2B. In FIG. 1B, the atom Y linking the 5′ morpholino carbon to the phosphorous group may be sulfur, nitrogen, carbon or, preferably, oxygen. The X moiety pendant from the phosphorous may be any of the following: fluorine; an alkyl or substituted alkyl; an alkoxy or substituted alkoxy; a thioalkoxy or substituted thioalkoxy; or, an unsubstituted, monosubstituted, or disubstituted nitrogen, including cyclic structures. Z is sulfur or oxygen, and is preferably oxygen. Particularly preferred morpholino oligonucleotides include those composed of morpholino subunit structures of the form shown in FIG. 2B, where X is an amine or alkyl amine of the form X═NR2, where R is independently H or CH3, that is where X═NH2, X═NHCH3 or X═N(CH3)2, Y═O, and Z=O.
Subunits C-D in FIGS. 1C-D are designed for 7-atom unit-length backbones as shown for structures in FIGS. 2C and D. In Structure C, the X moiety is as in Structure B, and the moiety Y may be methylene, sulfur, or preferably oxygen. In Structure D, the X and Y moieties are as in Structure B. In all subunits depicted in FIGS. 1 and 2, each Pi and Pj is a purine or pyrimidine base-pairing moiety effective to bind, by base-specific hydrogen bonding, to a base in a polynucleotide, and is preferably selected from adenine, cytosine, guanine and uracil.
As noted above, the morpholino oligomer backbone of the present invention includes substantially phosphordiamidate linkages interspersed with a limited number of charged linkages, e.g. up to about one for every one uncharged linkages. In the case of the morpholino oligomers, such a charged linkage may be a linkage as represented by FIG. 3H where, in FIG. 2B, X=1-piperazino
More generally, the morpholino oligomers with substantially uncharged backbones are shown in FIGS. 3A-3G, with interspersed cationic linkages such as shown in FIG. 3H. By including between two to eight such cationic linkages, and more generally, at least two and no more than about half the total number of linkages, interspersed along the backbone of the otherwise uncharged oligomer, antisense activity can be enhanced without a significant loss of specificity. The charged linkages are preferably separated in the backbone by at least 1 and preferably 2 or more uncharged linkages.
B. Antisense Sequences
In the methods of the invention, the antisense oligomer is designed to hybridize to a region of the target nucleic acid sequence, under physiological conditions with a Tm substantially greater than 37° C., e.g., at least 45° C. and preferably 60° C.-80° C., wherein the target nucleic acid sequence is preferentially expressed in activated lymphocytes. The oligomer is designed to have high-binding affinity to the target nucleic acid sequence and may be 100% complementary thereto, or may include mismatches, e.g., to accommodate allelic variants, as long as the heteroduplex formed between the oligomer and the target nucleic acid sequence is sufficiently stable to withstand the action of cellular nucleases and other modes of degradation during its transit from cell to body fluid. Mismatches, if present, are less destabilizing toward the end regions of the hybrid duplex than in the middle. The number of mismatches allowed will depend on the length of the oligomer, the percentage of G:C base pair in the duplex and the position of the mismatch(es) in the duplex, according to well understood principles of duplex stability. In this sense, the invention also encompasses PMO alternatives or variants. A preferred PMO alternative or variant is one having at least about 90% nucleic acid sequence identity to the target nucleic acid sequence.
Although such an antisense oligomer is not necessarily 100% complementary to a nucleic acid sequence that is preferentially expressed in activated lymphocytes, it is effective to stably and specifically bind to the target sequence such that expression of the target sequence is modulated. The appropriate length of the oligomer to allow stable, effective binding combined with good specificity is about 8-40 nucleotide base units, and preferably about 12-25 nucleotides. Oligomer bases that allow degenerate base pairing with target bases are also contemplated, assuming base-pair specificity with the target is maintained.
mRNA transcribed from the relevant region of HIV is generally targeted by the antisense oligonucleotides for use in practicing the invention, however, in some cases double-stranded DNA may be targeted using a non-ionic probe designed for sequence-specific binding to major-groove sites in duplex DNA. Such probe types are described in U.S. Pat. No. 5,166,315 (Summerton et al., 1992), which is hereby incorporated by reference, and are generally referred to herein as antisense oligomers, referring to their ability to block expression of target genes.
When the antisense compound is complementary to a specific region of a target gene (such as the region surrounding the AUG start codon of the Vif gene) the method can be used to monitor the binding of the oligomer to the Vif RNA.
The antisense activity of the oligomer may be enhanced by using a mixture of uncharged and cationic phosphorodiamidate linkages as shown in FIGS. 3G and 3H. The total number of cationic linkages in the oligomer can vary from 1 to 10, and be interspersed throughout the oligomer. Preferably the number of charged linkages is at least 2 and no more than half the total backbone linkages, e.g., between 2-8 positively charged linkages, and preferably each charged linkages is separated along the backbone by at least one, preferably at least two uncharged linkages. The antisense activity of various oligomers can be measured in vitro by fusing the oligomer target region to the 5′ end a reporter gene (e.g. firefly luciferase) and then measuring the inhibition of translation of the fusion gene mRNA transcripts in cell free translation assays. The inhibitory properties of oligomers containing a mixture of uncharged and cationic linkages can be enhanced between, approximately, five to 100 fold in cell free translation assays. Examples of oligomers that target the Vif AUG start codon and that contain cationic linkages of the type shown in FIG. 3H are listed below as SEQ ID NOS:11-13. In these examples four positive charges are introduced per oligomer.
The antisense compounds for use in practicing the invention can be synthesized by stepwise solid-phase synthesis, employing methods detailed in the references cited above. The sequence of subunit additions will be determined by the selected base sequence. In some cases, it may be desirable to add additional chemical moieties to the oligomer compounds, e.g. to enhance the pharmacokinetics of the compound or to facilitate capture or detection of the compound. Such a moiety may be covalently attached, typically to the 5′- or 3′-end of the oligomer, according to standard synthesis methods. For example, addition of a polyethyleneglycol moiety or other hydrophilic polymer, e.g., one having 10-100 polymer subunits, may be useful in enhancing solubility. One or more charged groups, e.g., anionic charged groups such as an organic acid, may enhance cell uptake. A reporter moiety, such as fluorescein or a radiolabeled group, may be attached for purposes of detection. Alternatively, the reporter label attached to the oligomer may be a ligand, such as an antigen or biotin, capable of binding a labeled antibody or streptavidin. In selecting a moiety for attachment or modification of an oligomer antisense, it is generally of course desirable to select chemical compounds of groups that are biocompatible and likely to be tolerated by cells in vitro or in vivo without undesirable side effects.
| TABLE 1 | |
| Exemplary Antisense Oligomer Sequences | |
| (Based on GenBank Acc. No. AF324493) |
| Target | Targeting Antisense Oligo- | SE | ||
| PMO | Nucleo | mer (5′ to 3′) | NO. | |
| Vif-AUG4 | CCTGCCATCTGTTTTCCATAATC | 5 | ||
| Vif-AUG5 | CTGCCATCTGTTTTCCATA | 6 | ||
| Vif-AUG6 | CACCTGCCATCTGTTTTCC | 7 | ||
| Vif-AUG4 | CTGCCATCTGTTTTCCATAGTC | 8 | ||
| Vif-AUG4 | CTGCCATCTGTTTTCCATAITC | 9 | ||
| Vif-AUG5 | CACCTGCCATCTGTTTTCCATA | 10 | ||
| Vif-AUG4 | CTGCCATCTGT+T+TTCCAT+AG+TC | 11 | ||
| Vif-AUG4 | CTGCCATCTGT+T+TTCCAT+A+ | 12 | ||
| I | ||||
| Vif-AUG5 | CACCTGCCATCTGT+T+TTCC+ | 13 | ||
| A+ | ||||
| Tar1 | GCTCCCAGGCTCAGATCTGGTC | 14 | ||
| Tar2 | GTTAGCCAGAGAGCTCCCAGGC | 15 | ||
| U3R | CCAGAGAGACCCAGTACAGG | 16 | ||
| TABLE 2 | |
| Exemplary Target Sequences | |
| (Based on GenBank Acc. No. AF324493) |
| SE | ||||
| Name | Target | Target Sequence (5′ to 3′) | NO. | |
| Vif-A | 5037-50 | GACTATGGAAAACAGATGGCAGGT | ||
| GATTGT | ||||
| TARc | 469-502 | GACCAGATCTGAGCCTGGGAGCTCT | ||
| GGCTAAC | ||||
| U3Rc | 446-465 | CCTGTACTGGGTCTCTCTGG | ||
C. rTAT Peptide
The use of arginine-rich peptide sequences conjugated to PMO has been shown to enhance cellular uptake in a variety of cells (Wender, Mitchell et al. 2000; Moulton, Hase et al. 2003; Moulton and Moulton 2003; Moulton, Nelson et al. 2004; and U.S. patent application Ser. No. 10/836,804).
In studies conducted in support of the present invention, several different “arginine-rich” peptide sequences were conjugated to fluorescent tagged PMO (PMO-fl) and examined to determine the effect of peptide sequence on uptake into lymphocytes. Enhanced uptake was observed for all arginine-rich peptide-PMO conjugates tested compared to unconjugated PMO. The P003 arginine-rich peptide [NH2-RRRRRRRRFFC—COOH] (SEQ ID NO:2) provides enhanced uptake into lymphocytes regardless of the cell activation state as does the ARP listed as SEQ ID NOS: 3 and 4. However, among the arginine-rich peptides examined, only the rTAT (P002) peptide [NH2—RRRQRRKKRC—COOH] (SEQ ID NO:1) PMO conjugates exhibited differential uptake into lymphocytes dependent on cell activation status. PMO uptake was greatly increased in mature dendritic cells as well as activated B cells and CD4 and CD8 T cells when compared to immature or naive lymphocytes, as discussed below.
The rTAT peptide can be synthesized by a variety of known methods, including solid-phase synthesis. The amino acid subunits used in construction of the polypeptide may be either l- or d-amino acids, preferably all l-amino acids or all d-amino acids. Minor (or neutral) amino acid substitutions are allowed, as long as these do not substantially degrade the ability of the polypeptide to enhance uptake of antisense compounds selectively into activated T cells. One skilled in the art can readily determine the effect of amino acid substitutions by construction a series of substituted rTAT polypeptides, e.g., with a given amino acid substitution separately at each of the positions along the rTAT chain (see Example 1). Using the above test for uptake of fluoresceinated PMO-polypeptide conjugate, (see Example 2) one can then determine which substitutions are neutral and which significantly degrade the transporter activity of the peptide. Rules for neutral amino acid substitutions, based on common charge and hydrophobicity similarities among distinct classes of amino acids are well known and applicable here. In addition, it will be recognized that the N-terminal cysteine of SEQ ID NO: 1 is added for purposes of coupling to the antisense compound, and may be replaced/deleted when another terminal amino acid or linker is used for coupling.
The rTAT polypeptide can be linked to the antisense to be delivered by a variety of methods available to one of skill in the art. The linkage point can be at various locations along the transporter. In selected embodiments, it is at a terminus of the transporter, e.g., the C-terminal or N-terminal amino acid. In one exemplary approach, the polypeptide has, as its N terminal residue, a single cysteine residue whose side chain thiol is used for linking. Multiple transporters can be attached to a single compound if desired.
When the compound is a PMO, the transporter can be attached at the 5′ end of the PMO, e.g. via the 5′-hydroxyl group, or via an amine capping moiety, as described in Example 1C. Alternatively, the transporter may be attached at the 3′ end, e.g. via a morpholino ring nitrogen, as described in Example ID, either at a terminus or an internal linkage. The linker may also comprise a direct bond between the carboxy terminus of a transporter peptide and an amine or hydroxy group of the PMO, formed by condensation promoted by e.g. carbodiimide.
Linkers can be selected from those which are non-cleavable under normal conditions of use, e.g., containing a thioether or carbamate bond. In some embodiments, it may be desirable to include a linkage between the transporter moiety and compound which is cleavable in vivo. Bonds which are cleavable in vivo are known in the art and include, for example, carboxylic acid esters, which are hydrolyzed enzymatically, and disulfides, which are cleaved in the presence of glutathione. It may also be feasible to cleave a photolytically cleavable linkage, such as an ortho-nitrophenyl ether, in vivo by application of radiation of the appropriate wavelength.
For example, the preparation of a conjugate having a disulfide linker, using the reagent N-succinimidyl 3-(2-pyridyldithio) propionate (SPDP) or succinimidyloxycarbonyl α-methyl-α-(2-pyridyldithio) toluene (SMPT), is described in Example 1E. Exemplary heterobifunctional linking agents which further contain a cleavable disulfide group include N-hydroxysuccinimidyl 3-[(4-azidophenyl)dithio]propionate and others described in (Vanin).
IV. Targeted Delivery of rTat-Conjugated Anti-HIV Antisense Oligomers
The present invention provides a method and composition for delivering therapeutic compounds, e.g., uncharged antisense compounds to hematopoietic cells, and, specifically, to activated T cells, macrophages, monocytes, and mature dendritic cells. The primary cellular reservoir for HIV production is from activated T cells, macrophages and dendritic cells. The antiviral therapeutic effect of HIV antisense oligomers is augmented by precisely targeting the cells producing the majority of infectious virions. This is especially powerful when coupled to an antisense oligomer (e.g. antisense Vif oligomers) designed to create defective virions as the mechanism of its therapeutic effect, in part, because the crippled virus can serve as a vaccine in the infected host.
The ability of the rTAT peptide to enhance uptake of a fluoresceinated PMO antisense compound selectively into activated mouse lymphocytes is demonstrated in the study described in Example 1, and with the results shown in FIGS. 4A-4C. In this study, cultured mouse splenocytes were incubated with fluorescent rTAT-PMO conjugate and subjected to various lymphocyte activating substances, as indicated in the drawings. Separate lymphocyte populations (CD8 positive T cells, CD4 positive T cells, and B cells (B220 positive cells) were stained with antibody to determine the extent of uptake by FACS analysis of the cells. The results show relatively low uptake of the antisense PMO into non-activated cells (dark heavy line) in all three cell types. Activation by gamma-interferon (gamma-IFN), phytohemaglutinin (PHA) or phorbol myristic acid+calcium ionophore (PMA+ION) caused significantly increased uptake of the antisense into CD8 and CD 4 T cells. Likewise, activation of B cells with lipopolysaccharide (LPS) or gamma-IFN resulted in a significant enhancement of the rTAT-PMO into B cells.
The property of activation-dependent uptake of peptide-antisense conjugate is not observed with other arginine-rich peptides, which are known to enhance drug transport into cells. This is demonstrated by a second study described in Example 2, and with the results shown in FIGS. 5A and 5B. As seen in these figures, P003-PMO conjugate (corresponding to the arginine-rich peptide of SEQ ID NO:2) is readily taken up by naive CD4 and naive CD8 T cells, PMO alone (e.g. no peptide conjugate) is relatively poorly taken up naïve cells, and rTAT-PMO shows enhanced uptake into PHA treated cells.
In one aspect of the invention, therefore, the rTAT peptide may be conjugated to a substantially uncharged antisense compound, to enhance its selective uptake into activated T cells, B cells, macrophages, monocytes or dendritic cells, including HIV-infected cells of these lineages.
Where the method is used for treating an HIV infection in a human subject, the exposing step involves administering the antisense conjugate to the subject, in an amount effective to reduce the severity of the HIV infection.
In one exemplary embodiment, the rTAT polypeptide is covalently coupled at its N-terminal cysteine residue to the 3′ or 5′ end of the antisense compound. Also in an exemplary embodiment, the antisense compound is composed of morpholino subunits and phosphorus-containing intersubunit linkages joining a morpholino nitrogen of one subunit to a 5′ exocyclic carbon of an adjacent subunit.
The invention further includes an antisense conjugate for use in selectively targeting activated, HIV-activated myeloid- or lymphoid-derived human cells, e.g., macrophage or T-lymphocyte cells, with an antisense conjugate. The conjugate is composed of (i) a substantially uncharged antisense compound containing 12-40 subunits and a base sequence effective to hybridize to a region of HIV positive-strand RNA, e.g., the HIV Vif transcript identified by SEQ ID NOS:26-31, thereby to block expression or otherwise inhibit replication of the virus in the infected cells, and (ii) a reverse TAT (rTAT) polypeptide having the sequence identified as SEQ ID NO: 1 and covalently coupled to the antisense compound. The compound may have various exemplary structural features, as described above.
Also disclosed is a method for treating a HIV infection in a subject. The method includes administering to the subject, a substantially uncharged antisense conjugate of the type just described, thereby to block expression of an HIV protein or proteins or block a cis-acting genomic elements that plays a role in viral replication.
All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety.
The following examples illustrate but are not intended in any way to limit the invention.
EXAMPLE 1 Preparation Antisense PMO And Peptide ConjugatesA. Production of PMO and Peptide Conjugated PMOs.
The PMOs were synthesized at AVI BioPharma (Corvallis, OR) as previously described (Summerton and Weller, 1997). Purity of full length oligomers was >95% as determined by reverse-phase high-pressure liquid chromatography (HPLC) and MALDI TOF mass spectroscopy. Peptide conjugated forms of the PMO where produced by attaching the carboxy terminal cysteine of the peptide to the 5′ end of the PMO through a cross-linker N-[□-maleimidobutyryloxy] succinimide ester (GMBS) (Moulton and Moulton, 2003), as detailed below in section C. The peptides used in this study designated as P002 (RRRQRRKKRC, SEQ ID NO:1) (Moulton and Moulton, 2003) and P003 (RRRRRRRRRFFC, SEQ ID NO:2). The lyophilized PMO or peptide-conjugated PMO were dissolved in sterile H2O prior to use in cell cultures or dilution in PBS prior to injection in to mice.
A schematic of a synthetic pathway that can be used to make morpholino subunits containing a (1-piperazino) phosphinylideneoxy linkage is shown in FIG. 6; further experimental detail for a representative synthesis is provided in Materials and Methods, below. As shown in the Figure, reaction of piperazine and trityl chloride gave trityl piperazine (1a), which was isolated as the succinate salt. Reaction with ethyl trifluoroacetate (1b) in the presence of a weak base (such as diisopropylethylamine or DIEA) provided 1-trifluoroacetyl-4-trityl piperazine (2), which was immediately reacted with HCI to provide the salt (3) in good yield. Introduction of the dichlorophosphoryl moiety was performed with phosphorus oxychloride in toluene.
The acid chloride (4) is reacted with morpholino subunits (moN), which may be prepared as described in U.S. Pat. No. 5,185,444 or in Summerton and Weller, 1997 (cited above), to provide the activated subunits (5,6,7). Suitable protecting groups are used for the nucleoside bases, where necessary; for example, benzoyl for adenine and cytosine, isobutyryl for guanine, and pivaloylmethyl for inosine. The subunits containing the (1-piperazino) phosphinylideneoxy linkage can be incorporated into the existing PMO synthesis protocol, as described, for example in Summerton and Weller (1997), without modification.
B. 3′- Fluoresceination of a PMO (Phosphorodiamidate-Linked Morpholino Oligomer).
A protected and activated carboxyfluorescein, e.g. 6-carboxyfluorescein dipivalate N-hydroxysuccinimide ester, commercially available from Berry & Associates, Inc. (Dexter, Mich.), was dissolved in NMP (0.05M), and the solution was added to a PMO synthesis column in sufficient volume to cover the resin. The mixture was incubated at 45° C. for 20 minutes, then the column was drained and a second similar portion of protected and activated carboxyfluorescein was added to the column and incubated at 45° C. for 60 minutes. The column was drained and washed with NMP, and the oligomer was cleaved from the resin using 1 ml of cleavage solution (0.1M dithiothreitol in NMP containing 10% triethylamine). The resin was washed with 300 μl of cleavage solution three times, immediately followed by addition of 4 ml of concentrated ammonia hydroxide and 16 hours incubation at 45° C. to remove base protecting groups. The morpholino oligomer was precipitated by adding 8 volumes of acetone, the mixture was centrifuged, and the pellet was washed with 15 ml of CH3CN. The washed pellet was re-dissolved in 4 ml of H2O and lyophilized. The product was analyzed by time-of-flight MALDI mass spectrometry (MALDI-TOF) and high pressure liquid chromatography (HPLC).
C. 2. 3′-Acetylation of PMO and 5′ Attachment of Transport Peptide.
Acetic anhydride (0.1 M), dissolved in N-methyl-2-pyrrolidinone (NMP) containing 1% N-ethyl morpholine (v/v) was added while the oligomer was still attached to the synthesis resin. After 90 minutes at room temperature, the oligomer was washed with NMP, cleaved from the synthesis resin and worked up as described above. The product was analyzed by time-of-flight MALDI mass spectrometry (MALDI-TOF) and high pressure liquid chromatography (HPLC). The desired product included a 3′-acetyl group and was capped at the 5′-end with piperazine, which was used for conjugation, as described below.
The cross linker, N-(γ-maleimidobutyryloxy)succinimide ester (GMBS), was dissolved in 50 μl of DMSO, and the solution was added to the oligomer (2-5 mM) in sodium phosphate buffer (50 mM, pH 7.2) at a 1:2 PMO/GMBS molar ratio. The mixture was stirred at room temperature in the dark for 30 minutes, and the product was precipitated using a 30-fold excess of acetone, then redissolved in water. The PMO-GMBS adduct was lyophilized and analyzed by MALDI-TOF and HPLC. The adduct was then dissolved in phosphate buffer (5OmM, pH 6.5, 5 mM EDTA) containing 20% CH3CN, and the transport peptide was added, at a 2:1 peptide to PMO molar ratio (based on a PMO concentration as determined by its absorbance at 260 nm). The reaction was stirred at room temperature in the dark for 2 hours. The conjugate was purified first through a CM-Sepharose (Sigma, St. Louis, Mo.) cationic exchange column, to remove unconjugated PMO, then through a reverse phase column (HLB column, Waters, Milford, Mass.). The conjugate was lyophilized and analyzed by MALDI-TOF and capillary electrophoresis (CE). The final product contained about 70% material corresponding to the full length PMO conjugated to the transport peptide, with the balance composed of shorter sequence conjugates, a small amount of unconjugated PMO, both full length and fragments, and a very small amount (about 2%) of unconjugated peptide. The concentration determination used for all experiments was based on the total absorbance at 260 nm, including all shorter PMO sequences in the sample.
D. 3′-Attachment of Transport Peptide.
A PMO having a free secondary amine (ring nitrogen of morpholine) at the 5′-end was dissolved in 100 MM sodium phosphate buffer, pH 7.2, to make a 2-5 mM solution. The linking reagent, GMBS, was dissolved in 100 μl of DMSO and added to the PMO solution at a PMO/GMBS ratio of 1:2. The mixture was stirred at room temperature in the dark for 30 min, then passed through a P2 (Biorad) gel filtration column to remove the excess GMBS and reaction by-products.
The GMBS-PMO adduct was lyophilized and re-dissolved in 50mM phosphate buffer, pH 6.5, to make a 2-5 mM solution. A transport peptide having a terminal cysteine was added to the GMBS-PMO solution at a molar ratio of 2:1 peptide to PMO. The reaction mixture was stirred at room temperature for 2 hours or at 4° C. overnight. The conjugate was purified by passing through Excellulose gel filtration column (Pierce Chemical) to remove excess peptide, then through a cation exchange CM-Sepharose column (Sigma) to remove unconjugated PMO, and finally through an Amberchrom reverse phase column (Rohm and Haas) to remove salt. The conjugate was lyophilized and characterized by MS and HPLC.
E. Preparation of a PMO-Peptide Conjugate Having a Cleavable Linker
The procedure of sections C or D is repeated, employing N-succinimidyl 3-(2-pyridyldithio) propionate (SPDP) or succinimidyloxycarbonyl α-methyl-α-(2-pyridyldithio) toluene (SMPT) as linking reagent place of GMBS.
EXAMPLE 2 Uptake of rTAT-Antisense Conjugates Selectively into Activated T CellsThe DO11.10 transgenic mouse system (Murphy, Heimberger et al. 1990) was used as a source of splenocytes and T cells. This transgenic mouse contains the gene for the T cell receptor (TCR) from the T cell hybridoma, DO11. 10, that recognizes chicken ovalbumin (OVA). Virtually all thymocytes and peripheral T cells in these mice express the OVA-TCR which is detected by the KJ26 monoclonal antibody.
A. Uptake in Naïve and Activated Murine Lymphocytes
Freshly isolated splenocytes from B6 mice were plated (1.5 million/well) into 96 well V-bottom plates and incubated with PMO-fl, P002-PMO-fl or P003-PMO-fl [10 μM, 10 μM and 5 μM in culture media, respectively]. Lymphocyte activating substances derived from bacterial (LPS), murine cytokine (Gamma IFN), mitogenic plant lectin (PHA), chemical activator (PMA+ION) or culture media control (naive cell treatment) were added to individual cultures as follows; LPS [1μg/ml] (lipopolysaccharide), murine gamma interferon [10 ng/ml], PHA (phytohemaglutanin) [2.5 μg/ml], PMA (phorbol myristic acid)+calcium ionophore [10 ng/ml+5 ng/ml] or RPMI+10% fetal calf serum. All activating substances were added to cells with the PMO treatment overnight save the PMA+calcium ionophore which was added 4 hours prior to staining the cells for flow cytometric analysis. Immediately following treatment the cultures were washed twice with cold FACS buffer (phosphate buffered saline+1% fetal calf serum+0.02% w/v sodium azide). All cultures were suspended in 100 μls of Fc blocking antibody (eBioscience) [0.5 μg/well] for 15 min on ice. Staining of lymphocyte populations was performed using anti-CD4 or anti CD8 PE-Texas Red [0.3 μg/million cells] (CalTag) or anti-CD45R (clone B220) APC (eBioscience) [0.4 mg/million cells] for 30 min on ice. The cells were washed twice with cold FACS buffer and suspended in 50 μl of cold cyofix/cytoperm reagent (Pharmingen) for 30 min to lyse remaining red blood cells. The cells were washed once with FACS buffer and suspended in 200 μl FACS buffer prior to analysis. Cell staining and PMO-fl uptake was measured using a FACSCalibur flow cytometer (Becton Dickinson). Flow data was analyzed using FCS Express 2 Pro software (Denovo software).
FIG. 4 demonstrates that separate lymphocytes populations all have enhanced uptake of P002-PMO conjugate when activated by a variety of lymphocyte activators. Different lymphocyte populations were stained with antibodies to determine the extent of uptake by FACS analysis in T cells A) CD8 positive T cells, B) CD4 positive T cells and C) B cells (B220 positive cells).
FIG. 5 is similar to FIG. 4 except that P003-PMO-fl was compared to P002-PMO-fl and unconjugated PMO-fl in A) CD8 positive T cells and B) CD4 positive T cells. The P002-PMO-fl treated cells were activated with PHA as described above. The figure indicates that the P003 peptide greatly enhances uptake in naive T-cells of both CD4 and CD8 lineages compared to PHA-activated T-cells treated with P002-PMO-fl. Uptake of the PMO-fl without a peptide conjugate is undetectable.
EXAMPLE 3 Inhibition of HIV-1 Replication in Human H9 Cells by a Peptide-Conjugated Antisense PMO Targeted to the HIV-1 Vif AUG Start CodonThe human T-cell line H9 was grown and harvested using standard protocols. Cells were pelleted and resuspended in RPMI-1640 supplemented with 0.1% fetal bovine serum (FBS). From this cell suspension, 5×10ˆ6 cells were infected in bulk with HIV-1 (strain NL4-3) at a multiplicity of infection (MOI) equal to 0.001 in a T25 flask The cells were incubated in the presence of HIV-1 for 2 hours at 37 degrees C. The cells were pelleted by centrifugation and resuspended in 20 ml of RPMI-1640+10% FBS. The infected cell suspension was used to seed a 24 well plate at 1×10ˆ5 cells per well. The final volume per well was adjusted to one ml. Peptide conjugated Vif-AUG4 PMO (Vif4-P007; SEQ ID NO:5 conjugated to SEQ ID NO:3) was added to each well at concentrations ranging from 10 to 5000 nanomolar and incubated for 5-7 days at 37 degrees C. A P007 conjugated scrambled control PMO was used as a negative control with a concentration range from 500 to 10000 nanomolar. On day five, 200 microliters was removed from each well and used in a HIV-1 P24 antigen capture ELISA. The results are shown in FIG. 7 as a plot of the P24 ELISA readout (Absorbance at 450 nM) versus the PMO concentration. The Vif4-P007 PMO reduced the replication of HIV-1 significantly compared to the scramble control (Scr-P007). The Scr-P007 compound does inhibit HIV-1 replication due to a known ability of arginine-rich polypeptides to block HIV-1 cell entry. The specific inhibition of the Vif4-P007 compound is reflected in the greater than 20-fold lower EC50 as shown in FIG. 7 (approx. 100 nanomolar for Vif4-P007 vs. approx. 2 micromolar for the Scr-P007 compound).
| Sequence ID Listing |
| SEQ | |||
| ID | |||
| Peptide Sequences (NH2 to COOH)* | NO. | Name | |
| RRRQRRKKRC | 1 | P002, rTat | |
| RRRRRRRRRFFC | 2 | P003, | |
| R9F2 | |||
| RAhxRRAhxRRAhxRRAhxRAhxB | 3 | P007, | |
| (RXR)4XB | |||
| RBRBRBRBRBRBRBRAhxB | 4 | (RB)7RXB | |
| Oligomer Targeting Sequences (5′-3′) |
| CCTGCCATCTGTTTTCCATAATC | 5 | Vif-AUG4 | |
| CTGCCATCTGTTTTCCATA | 6 | Vif-AUG5 | |
| CACCTGCCATCTGTTTTCC | 7 | Vif-AUG6 | |
| CTGCCATCTGTTTTCCATAGTC | 8 | Vif-AUG4 | |
| CTGCCATCTGTTTTCCATAITC | 9 | Vif-AUG4I | |
| CACCTGCCATCTGTTTTCCATA | 10 | Vif-AUG5 | |
| CTGCCATCTGT+T+TTCCAT+AG+TC | 11 | Vif-AUG4 | |
| CTGCCATCTGT+T+TTCCAT+A+ITC | 12 | Vif-AUG4I | |
| RRRQRRKKRC | 1 | P002, rTat | |
| RRRRRRRRRFFC | 2 | P003, | |
| R9F2 | |||
| RAhxRRAhxRRAhxRRAhxRAhxB | 3 | P007, | |
| (RXR)4XB | |||
| RBRBRBRBRBRBRBRAhxB | 4 | (RB)7RXB | |
| Oligomer Targeting Sequences (5′-3′) |
| CCTGCCATCTGTTTTCCATAATC | 5 | Vif-AUG4 | |
| CTGCCATCTGTTTTCCATA | 6 | Vif-AUG5 | |
| CACCTGCCATCTGTTTTCC | 7 | Vif-AUG6 | |
| CTGCCATCTGTTTTCCATAGTC | 8 | Vif-AUG4 | |
| CTGCCATCTGTTTTCCATAITC | 9 | Vif-AUG4I | |
| CACCTGCCATCTGTTTTCCATA | 10 | Vif-AUG56 | |
| CTGCCATCTGT+T+TTCCAT+AG+TC | 11 | Vif-AUG4 | |
| CTGCCATCTGT+T+TTCCAT+A+ITC | 12 | Vif-AUG4I | |
| CACCTGCCATCTGT+T+TTCC+A+TA | 13 | Vif-AUG56 | |
| RRRQRRKKRC | 1 | P002, rTat | |
| RRRRRRRRRFFC | 2 | P003, | |
| R9F2 | |||
| RAhxRRAhxRRAhxRRAhxRAhxB | 3 | P007, | |
| (RXR)4XB | |||
| RBRBRBRBRBRBRBRAhxB | 4 | (RB)7RXB | |
| Oligomer Targeting Sequences (5′-3′) |
| CCTGCCATCTGTTTTCCATAATC | 5 | Vif-AUG4 | |
| CTGCCATCTGTTTTCCATA | 6 | Vif-AUG5 | |
| CACCTGCCATCTGTTTTCC | 7 | Vif-AUG6 | |
| CTGCCATCTGTTTTCCATAGTC | 8 | Vif-AUG4 | |
| CTGCCATCTGTTTTCCATAITC | 9 | Vif-AUG4I | |
| CACCTGCCATCTGTTTTCCATA | 10 | Vif-AUG56 | |
| CTGCCATCTGT+T+TTCCAT+AG+TC | 11 | Vif-AUG4 | |
| CTGCCATCTGT+T+TTCCAT+A+ITC | 12 | Vif-AUG4I | |
| GCTCCCAGGCTCAGATCTGGTC | 14 | Tar1 | |
| RRRQRRKKRC | 1 | P002, rTat | |
| RRRRRRRRRFFC | 2 | P003, | |
| R9F2 | |||
| RAhxRRAhxRRAhxRRAhxRAhxB | 3 | P007, | |
| (RXR)4XB | |||
| RBRBRBRBRBRBRBRAhxB | 4 | (RB)7RXB | |
| Oligomer Targeting Sequences (5′-3′) |
| CCTGCCATCTGTTTTCCATAATC | 5 | Vif-AUG4 | |
| CTGCCATCTGTTTTCCATA | 6 | Vif-AUG5 | |
| CACCTGCCATCTGTTTTCC | 7 | Vif-AUG6 | |
| CTGCCATCTGTTTTCCATAGTC | 8 | Vif-AUG4 | |
| CTGCCATCTGTTTTCCATAITC | 9 | Vif-AUG4I | |
| CACCTGCCATCTGTTTTCCATA | 10 | Vif-AUG56 | |
| CTGCCATCTGT+T+TTCCAT+AG+TC | 11 | Vif-AUG4 | |
| CTGCCATCTGT+T+TTCCAT+A+ITC | 12 | Vif-AUG4I | |
| GTTAGCCAGAGAGCTCCCAGGC | 15 | Tar2 | |
| RRRQRRKKRC | 1 | P002, rTat | |
| RRRRRRRRRFFC | 2 | P003, | |
| R9F2 | |||
| RAhxRRAhxRRAhxRRAhxRAhxB | 3 | P007, | |
| (RXR)4XB | |||
| RBRBRBRBRBRBRBRAhxB | 4 | (RB)7RXB | |
| Oligomer Targeting Sequences (5′-3′) |
| CCTGCCATCTGTTTTCCATAATC | 5 | Vif-AUG4 | |
| CTGCCATCTGTTTTCCATA | 6 | Vif-AUG5 | |
| CACCTGCCATCTGTTTTCC | 7 | Vif-AUG6 | |
| CTGCCATCTGTTTTCCATAGTC | 8 | Vif-AUG4 | |
| CTGCCATCTGTTTTCCATAITC | 9 | Vif-AUG4I | |
| CACCTGCCATCTGTTTTCCATA | 10 | Vif-AUG56 | |
| CTGCCATCTGT+T+TTCCAT+AG+TC | 11 | Vif-AUG4 | |
| CTGCCATCTGT+T+TTCCAT+A+ITC | 12 | Vif-AUG4I | |
| CCAGAGAGACCCAGTACAGG | 16 | U3R | |
| RRRQRRKKRC | 1 | P002, rTat | |
| RRRRRRRRRFFC | 2 | P003, | |
| R9F2 | |||
| RAhxRRAhxRRAhxRRAhxRAhxB | 3 | P007, | |
| (RXR)4XB | |||
| RBRBRBRBRBRBRBRAhxB | 4 | (RB)7RXB | |
| Oligomer Targeting Sequences (5′-3′) |
| CCTGCCATCTGTTTTCCATAATC | 5 | Vif-AUG4 | |
| CTGCCATCTGTTTTCCATA | 6 | Vif-AUG5 | |
| CACCTGCCATCTGTTTTCC | 7 | Vif-AUG6 | |
| CTGCCATCTGTTTTCCATAGTC | 8 | Vif-AUG4 | |
| CTGCCATCTGTTTTCCATAITC | 9 | Vif-AUG4I | |
| CACCTGCCATCTGTTTTCCATA | 10 | Vif-AUG56 | |
| CTGCCATCTGT+T+TTCCAT+AG+TC | 11 | Vif-AUG4 | |
| CTGCCATCTGT+T+TTCCAT+A+ITC | 12 | Vif-AUG4I | |
| Target Sequences (5′-3′) |
| RRRQRRKKRC | 1 | P002, rTat | |
| RRRRRRRRRFFC | 2 | P003, | |
| R9F2 | |||
| RAhxRRAhxRRAhxRRAhxRAhxB | 3 | P007, | |
| (RXR)4XB | |||
| RBRBRBRBRBRBRBRAhxB | 4 | (RB)7RXB | |
| Oligomer Targeting Sequences (5′-3′) |
| CCTGCCATCTGTTTTCCATAATC | 5 | Vif-AUG4 | |
| CTGCCATCTGTTTTCCATA | 6 | Vif-AUG5 | |
| CACCTGCCATCTGTTTTCC | 7 | Vif-AUG6 | |
| CTGCCATCTGTTTTCCATAGTC | 8 | Vif-AUG4 | |
| CTGCCATCTGTTTTCCATAITC | 9 | Vif-AUG4I | |
| CACCTGCCATCTGTTTTCCATA | 10 | Vif-AUG56 | |
| CTGCCATCTGT+T+TTCCAT+AG+TC | 11 | Vif-AUG4 | |
| CTGCCATCTGT+T+TTCCAT+A+ITC | 12 | Vif-AUG4I | |
| GACTATGGAAAACAGATGGCAGGTGATGAT | 17 | Vif-AUGc | |
| GACCAGATCTGAGCCTGGGAGCTCTCTGGC | 18 | TARc | |
| RRRQRRKKRC | 1 | P002, rTat | |
| RRRRRRRRRFFC | 2 | P003, | |
| R9F2 | |||
| RAhxRRAhxRRAhxRRAhxRAhxB | 3 | P007, | |
| (RXR)4XB | |||
| RBRBRBRBRBRBRBRAhxB | 4 | (RB)7RXB | |
| Oligomer Targeting Sequences (5′-3′) |
| CCTGCCATCTGTTTTCCATAATC | 5 | Vif-AUG4 | |
| CTGCCATCTGTTTTCCATA | 6 | Vif-AUG5 | |
| CACCTGCCATCTGTTTTCC | 7 | Vif-AUG6 | |
| CTGCCATCTGTTTTCCATAGTC | 8 | Vif-AUG4 | |
| CTGCCATCTGTTTTCCATAITC | 9 | Vif-AUG4I | |
| CACCTGCCATCTGTTTTCCATA | 10 | Vif-AUG56 | |
| CTGCCATCTGT+T+TTCCAT+AG+TC | 11 | Vif-AUG4 | |
| CTGCCATCTGT+T+TTCCAT+A+ITC | 12 | Vif-AUG4I | |
| CCTGTACTGGGTCTCTCTGG | 19 | U3Rc | |
*R = Arginine, F = phenylalanine, B = beta-alanine, Ahx = 6-aminohexanoic acid |
1. An antiviral compound directed against an human immunodeficiency virus (HIV-1), comprising
a morpholino oligonucleotide compound composed of 12 to 40 morpholino subunits (a) with a targeting base sequence that is substantially complementary to a viral target sequence composed of at least 12 contiguous bases in a region of HIV-1 positive strand RNA identified by one of the sequences selected from the group consisting of SEQ ID NOS:17-19, and (b) that are linked by uncharged phosphorodiamidate linkages interspersed with at least two and up to half positively charged phosphorodiamidate linkages.
2. The compound of claim 1, wherein said morpholino subunits are joined by phosphorodiamidate linkages, in accordance with the structure:
where Y1═O, Z=O, Pj is a purine or pyrimidine base-pairing moiety effective to bind, by base-specific hydrogen bonding, to a base in a polynucleotide (where base-pairing moieties on different subunits may be the same or different), and X is alkyl, alkoxy, thioalkoxy, or alkyl amino of the form NR2, where each R is independently hydrogen or methyl, for the uncharged linkages, and the positively charged linkages are represented by the same structure, but where X is 1-piperazino.
3. The compound of claim 1, which has a Tm, with respect to binding to said viral target sequence, of greater than about 45° C., and said compound is actively taken up by mammalian cells.
4. The compound of claim 1, wherein the antisense compound is capable of hybridizing with a sequence consisting of SEQ ID NO:17 (i) to form a heteroduplex structure having a Tm of dissociation of at least 45 degrees C., and (ii) to inhibit the synthesis of the HIV Vif protein in the infected cells.
5. The compound of claim 4, having a targeting sequence with at least 90% homology to a sequence selected from SEQ ID NOS.5-13
6. The compound of claim 1, wherein said compound is a covalent conjugate of the oligonucloeotide and an arginine-rich polypeptide effective to enhance the uptake of the compound into host cells.
7. The compound of claim 1, wherein the arginine-rich polypeptide has a sequence selected from the group consisting of SEQ ID NOS: 1-4.
8. The compound of claim 1, wherein the antisense compound is capable of hybridizing with a sequence selected from the group consisting of SEQ ID NOS: 18 and 19 to form a heteroduplex structure having a Tm of dissociation of at least 45 degrees C.
9. The compound of claim 1, wherein the antisense compound has at least 12 contiguous bases from one of the sequences selected from the group consisting of SEQ ID NOS: 14-16.
10. A method of inhibiting infection by an HIV-1 virus in a subject, comprising:
administering to the subject, a therapeutically effective amount of a morpholino oligonucleotide compound composed of 12 to 40 morpholino subunits (a) with a targeting base sequence that is substantially complementary to a viral target sequence composed of at least 12 contiguous bases in in a region of HIV-1 positive strand RNA identified by one of the sequences selected from the group consisting of SEQ ID NOS:17-19, and (b) that are linked by uncharged phosphorodiamidate linkages interspersed with at least two and up to half positively charged phosphorodiamidate linkages.
11. The method of claim 10, wherein said morpholino subunits are joined by phosphorodiamidate linkages, in accordance with the structure:
where Y1═O, Z=O, Pj is a purine or pyrimidine base-pairing moiety effective to bind, by base-specific hydrogen bonding , to a base in a polynucleotide (where base-pairing moieties on different subunits may be the same or different), and X is alkyl, alkoxy, thioalkoxy, or alkyl amino of the form NR2, where each R is independently hydrogen or methyl, for the uncharged linkages, and the positively charged linkages are represented by the same structure, but where X is 1-piperazino.
12. The method of claim 10, wherein the compound has a Tm, with respect to binding to said viral target sequence, of greater than about 50° C., and said compound is actively taken up by mammalian cells.
13. The method of claim 10, wherein the antisense compound is capable of hybridizing with a sequence consisting of SEQ ID NO:17 (i) to form a heteroduplex structure having a Tm of dissociation of at least 45 degrees C., and (ii) to inhibit the synthesis of the HIV Vif protein in the infected cells.
14. The method of claim 10, wherein the compound has a targeting sequence having at least 90% homology to a sequence selected from the group consisting of SEQ ID NOS.5-13.
15. The method of claim 10, wherein said compound is a covalent conjugate of the oligonucloeotide and an arginine-rich polypeptide effective to enhance the uptake of the compound into host cells.
16. The method of claim 10, wherein the arginine-rich polypeptide has a sequence selected from the group consisting of SEQ ID NOS: 1-4.
17. The method of claim 10, wherein the antisense compound is capable of hybridizing with a sequence selected from the group consisting of SEQ ID NOS:18 and 19 to form a heteroduplex structure having a Tm of dissociation of at least 45 degrees C.
18. The method of claim 10, wherein the antisense compound has at least 12 contiguous bases from one of the sequences selected from the group consisting of SEQ ID NOS:14-16.