US20070081979A1
2007-04-12
11/099,263
2005-04-05
Disclosed are novel multi-functional chimeric hematopoietic receptor agonist proteins, DNAs which encode the multi-functional chimeric hematopoietic receptor agonist proteins, methods of making the multi-functional chimeric hematopoietic receptor agonist proteins and methods of using the multi-functional chimeric hematopoietic receptor agonist proteins.
Get notified when new applications in this technology area are published.
C07K14/524 » CPC main
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans; Cytokines; Lymphokines; Interferons Thrombopoietin, i.e. C-MPL ligand
C07K14/475 » CPC further
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans Growth factors; Growth regulators
C07K14/505 » CPC further
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans; Growth factors; Growth regulators Erythropoietin [EPO]
C07K14/535 » CPC further
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans; Cytokines; Lymphokines; Interferons; Colony-stimulating factor [CSF] Granulocyte CSF; Granulocyte-macrophage CSF
C07K14/5403 » CPC further
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans; Cytokines; Lymphokines; Interferons; Interleukins [IL] IL-3
C07K2319/00 » CPC further
Fusion polypeptide
A61K45/00 IPC
Medicinal preparations containing active ingredients not provided for in groups Β -Β
C07H21/04 IPC
Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
C07K14/71 IPC
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans; Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
The present application is a continuation of U.S. patent application Ser. No. 08/957,610, filed Oct. 24, 1997, which claims priority under Title 35, United States Code, Β§119 to U.S. Provisional application Ser. No. 60/029,629, filed Oct. 25, 1996.
FIELD OF THE INVENTIONThe present invention relates to multi-functional chimeric hematopoietic receptor agonists. These multi-functional chimeric hematopoietic receptor agonists retain one or more activities of individual components of the chimera molecule and may also show improved hematopoietic cell-stimulating activity and/or an improved activity profile which may include reduction of undesirable biological activities associated with individual hematopoietic growth factors and/or have improved physical properties which may include increased solubility, stability and refold efficiency.
BACKGROUND OF THE INVENTIONColony stimulating factors (CSFs) which stimulate the differentiation and/or proliferation of bone marrow cells have generated much interest because of their therapeutic potential for restoring depressed levels of hematopoietic stem cell-derived cells. CSFs in both human and murine systems have been identified and distinguished according to their activities. For example, granulocyte-CSF (G-CSF) and macrophage-CSF (M-CSF) stimulate the in vitro formation of neutrophilic granulocyte and macrophage colonies, respectively, while GM-CSF and interleukin-3 (IL-3) have broader activities and stimulate the formation of both macrophage, neutrophilic and eosinophilic granulocyte colonies. IL-3 also stimulates the formation of mast, megakaryocyte and pure and mixed erythroid colonies.
U.S. Pat. No. 4,877,729 and U.S. Pat. No. 4,959,455 disclose a gibbon IL-3 cDNA and a deduced human IL-3 DNA sequence and the protein sequences for which they code. The hIL-3 disclosed has serine rather than proline at position 8 in the protein sequence.
International Patent Application (PCT) WO 88/00598 discloses gibbon- and human-like IL-3. The hIL-3 contains a Ser8βPro8 replacement. Suggestions are made to replace Cys by Ser, thereby breaking the disulfide bridge, and to replace one or more amino acids at the glycosylation sites.
U.S. Pat. No. 4,810,643 discloses a DNA sequence encoding human G-CSF.
WO 91/02754 discloses a fusion protein comprised of GM-CSF and IL-3 which has increased biological activity compared to GM-CSF or IL-3 alone. Also disclosed are nonglycosylated IL-3 and GM-CSF analog proteins as components of the multi-functional chimeric hematopoietic receptor agonist.
WO 92/04455 discloses fusion proteins composed of IL-3 fused to a lymphokine selected from the group consisting of IL-3, IL-6, IL-7, IL-9, IL-11, EPO and G-CSF.
WO 95/21197 and WO 95/21254 disclose fusion proteins capable of broad multi-functional hematopoietic properties.
GB 2,285,446 relates to the c-mpl ligand (thrombopoietin) and various forms of thrombopoietin which are shown to influence the replication, differentiation and maturation of megakaryocytes and megakaryocytes progenitors which may be used for the treatment of thrombocytopenia.
EP 675,201 A1 relates to the c-mpl ligand (Megakaryocyte growth and development factor (MGDF), allelic variations of c-mpl ligand and c-mpl ligand attached to water soluble polymers such as polyethylene glycol.
WO 95/21920 provides the murine and human c-mpl ligand and polypeptide fragments thereof. The proteins are useful for in vivo and ex vivo therapy for stimulating platelet production.
U.S. Pat. No. 4,703,008 by Lin, F-K. discloses the a cDNA sequence encoding erythropoietin, methods of production and uses for erythropoietin.
WO 91/05867 discloses analogs of human erythropoietin having a greater number of sites for carbohydrate attachment than human erythropoietin, such as EPO (Asn69), EPO (Asn125 Ser127), EPO (Thr125) and EPO (Pro124 Thr125).
WO 94/24160 discloses erythropoietin muteins which have enhanced activity, specifically amino acid substitutions at positions 20, 49, 73, 140, 143, 146, 147 and 154.
WO 94/28391 discloses the native flt3 ligand protein sequence and a cDNA sequence encoding the flt3 ligand, methods of expressing flt3 ligand in a host cell transfected with the cDNA and methods of treating patients with a hematopoietic disorder using flt3 ligand.
U.S. Pat. No. 5,554,512 is directed to human flt3 ligand as an isolated protein, DNA encoding the flt3 ligand, host cells transfected with cDNAs encoding flt3 ligand and methods for treating patients with flt3 ligand.
WO 94/26891 provides mammalianflt3 ligands, including an isolate that has an insertion of 29 amino acids, and fragments there of.
Rearrangement of Protein SequencesIn evolution, rearrangements of DNA sequences serve an important role in generating a diversity of protein structure and function. Gene duplication and exon shuffling provide an important mechanism to rapidly generate diversity and thereby provide organisms with a competitive advantage, especially since the basal mutation rate is low (Doolittle, Protein Science 1:191-200, 1992).
The development of recombinant DNA methods has made it possible to study the effects of sequence transposition on protein folding, structure and function. The approach used in creating new sequences resembles that of naturally occurring pairs of proteins that are related by linear reorganization of their amino acid sequences (Cunningham, et al., Proc. Natl. Acad. Sci. U.S.A. 76:3218-3222, 1979; Teather & Erfle, J. Bacterial. 172: 3837-3841, 1990; Schimming et al., Eur. J. Biochem. 204: 13-19, 1992; Yamiuchi and Minamikawa, FEBS Lett. 260:127-130, 1991; MacGregor et al., FEBS Lett. 378:263-266). The first in vitro application of this type of rearrangement to proteins was described by Goldenberg and Creighton (J. Mol. Biol. 165:407-413, 1983). A new N-terminus is selected at an internal site (breakpoint) of the original sequence, the new sequence having the same order of amino acids as the original from the breakpoint until it reaches an amino acid that is at or near the original C-terminus. At this point the new sequence is joined, either directly or through an additional portion of sequence (linker), to an amino acid that is at or near the original N-terminus, and the new sequence continues with the same sequence as the original until it reaches a point that is at or near the amino acid that was N-terminal to the breakpoint site of the original sequence, this residue forming the new C-terminus of the chain.
This approach has been applied to proteins which range in size from 58 to 462 amino acids (Goldenberg & Creighton, J. Mol. Biol. 165:407-413, 1983; Li & Coffino, Mol. Cell. Biol. 13:2377-2383, 1993). The proteins examined have represented a broad range of structural classes, including proteins that contain predominantly a-helix (interleukin-4; Kreitman et al., Cytokine 7:311-318, 1995), b-sheet (interleukin-1; Horlick et al., Protein Eng. 5:427-431, 1992), or mixtures of the two (yeast phosphoribosyl anthranilate isomerase; Luger et al., Science 243:206-210, 1989). Broad categories of protein function are represented in these sequence reorganization studies:
Enzymes
The results of these studies have been highly variable. In many cases substantially lower activity, solubility or thermodynamic stability were observed (E. coli dihydrofolate reductase, aspartate transcarbamoylase, phosphoribosyl anthranilate isomerase, glyceraldehyde-3-phosphate dehydrogenase, ornithine decarboxylase, omp A, yeast phosphoglycerate dehydrogenase). In other cases, the sequence rearranged protein appeared to have many nearly identical properties as its natural counterpart (basic pancreatic trypsin inhibitor, T4 lysozyme, ribonuclease T1, Bacillus b-glucanase, interleukin-1b, a-spectrin SH3 domain, pepsinogen, interleukin-4). In exceptional cases, an unexpected improvement over some properties of the natural sequence was observed, e.g., the solubility and refolding rate for rearranged a-spectrin SH3 domain sequences, and the receptor affinity and anti-tumor activity of transposed interleukin-4-Pseudomonas exotoxin fusion molecule (Kreitman et al., Proc. Natl. Acad. Sci. U.S.A. 91:6889-6893, 1994; Kreitman et al., Cancer Res. 55:3357-3363, 1995).
The primary motivation for these types of studies has been to study the role of short-range and long-range interactions in protein folding and stability. Sequence rearrangements of this type convert a subset of interactions that are long-range in the original sequence into short-range interactions in the new sequence, and vice versa. The fact that many of these sequence rearrangements are able to attain a conformation with at least some activity is persuasive evidence that protein folding occurs by multiple folding pathways (Viguera, et al., J. Mol. Biol. 247:670-681, 1995). In the case of the SH3 domain of a-spectrin, choosing new termini at locations that corresponded to b-hairpin turns resulted in proteins with slightly less stability, but which were nevertheless able to fold.
The positions of the internal breakpoints used in the studies cited here are found exclusively on the surface of proteins, and are distributed throughout the linear sequence without any obvious bias towards the ends or the middle (the variation in the relative distance from the original N-terminus to the breakpoint is ca. 10 to 80% of the total sequence length). The linkers connecting the original N- and C-termini in these studies have ranged from 0 to 9 residues. In one case (Yang & Schachman, Proc. Natl. Acad. Sci. U.S.A. 90:11980-11984, 1993), a portion of sequence has been deleted from the original C-terminal segment, and the connection made from the truncated C-terminus to the original N-terminus. Flexible hydrophilic residues such as Gly and Ser are frequently used in the linkers. Viguera, et al. (J. Mol. Biol. 247:670-681, 1995) compared joining the original N- and C-termini with 3- or 4-residue linkers; the 3-residue linker was less thermodynamically stable. Protasova et al. (Protein Eng. 7:1373-1377, 1994) used 3- or 5-residue linkers in connecting the original N-termini of E. coli dihydrofolate reductase; only the 3-residue linker produced protein in good yield.
SUMMARY OF THE INVENTION A hematopoietic protein comprising; an amino acid sequence of the formula:
R1-L1-R2, R2-L1-R1, R1-R2, or R2-R1
wherein R1, and R2 are independently selected from the group consisting of:
(I) A human EPO receptor agonist polypeptide, comprising a modified EPO amino acid sequence of the Formula:
| SEQ ID NO:464 |
| Ala Pro Pro Arg Leu Ile Cys Asp Ser Arg Val Leu | |
| ββββββββββββββββββββββββββββββββββββ10 | |
| Glu Arg Tyr Leu Leu Glu Ala Lys Glu Ala Glu Asn | |
| ββββββββββββββββββββββββββββ20 | |
| Ile Thr Thr Gly Cys Ala Glu His Cys Ser Leu Asn | |
| ββββββββββββββββββββ30 | |
| Glu Asn Ile Thr Val Pro Asp Thr Lys Val Asn Phe | |
| ββββββββββββ40 | |
| Tyr Ala Trp Lys Arg Met Glu Val Gly Gln Gln Ala | |
| ββββ50ββββββββββββββββββββββββββββββββββββββ60 | |
| Val Glu Val Trp Gln Gly Leu Ala Leu Leu Ser Glu | |
| ββββββββββββββββββββββββββββββββββββ70 | |
| Ala Val Leu Arg Gly Gln Ala Leu Leu Val Asn Ser | |
| ββββββββββββββββββββββββββββ80 | |
| Ser Gln Pro Trp Glu Pro Leu Gln Leu His Val Asp | |
| ββββββββββββββββββββ90 | |
| Lys Ala Val Ser Gly Leu Arg Ser Leu Thr Thr Leu | |
| ββββββββββββ100 | |
| Leu Arg Ala Leu Gly Ala Gln Lys Glu Ala Ile Ser | |
| ββββ110βββββββββββββββββββββββββββββββββββββ120 | |
| Pro Pro Asp Ala Ala Ser Ala Ala Pro Leu Arg Thr | |
| ββββββββββββββββββββββββββββββββββββ130 | |
| Ile Thr Ala Asp Thr Phe Arg Lys Leu Phe Arg Val | |
| ββββββββββββββββββββββββββββ140 | |
| Tyr Ser Asn Phe Leu Arg Gly Lys Leu Lys Leu Tyr | |
| ββββββββββββββββββββ150 | |
| Thr Gly Glu Ala Cys Arg Thr Gly Asp Arg | |
| ββββββββββββ160βββββββββββββββββββββ166 |
wherein the N-terminus is joined to the C-terminus directly or through a linker (L2) capable of joining the N-terminus to the C-terminus and having new C- and N-termini at amino acids;
| 23-24 |
| 24-25 |
| 25-26 |
| 26-27 |
| 27-28 |
| 28-29 |
| 29-30 |
| 30-31 |
| 31-32 |
| 32-33 |
| 33-34 |
| 34-35 |
| 35-36 |
| 36-37 |
| 37-38 |
| 38-39 |
| 39-40 |
| 40-41 |
| 41-42 |
| 42-43 |
| 43-44 |
| 44-45 |
| 45-46 |
| 46-47 |
| 47-48 |
| 48-49 |
| 49-50 |
| 50-51 |
| 51-52 |
| 52-53 |
| 53-54 |
| 54-55 |
| 55-56 |
| 56-57 |
| 57-58 |
| 77-78 |
| 78-79 |
| 79-80 |
| 80-81 |
| 81-82 |
| 82-83 |
| 84-85 |
| 85-86 |
| 86-87 |
| 87-88 |
| 88-89 |
| 108-109 |
| 109-110 |
| 110-111 |
| 111-112 |
| 112-113 |
| 113-114 |
| 114-115 |
| 115-116 |
| 116-117 |
| 117-118 |
| 118-119 |
| 119-120 |
| 120-121 |
| 121-122 |
| 122-123 |
| 123-124 |
| 124-125 |
| 125-126 |
| 126-127 |
| 127-128 |
| 128-129 |
| 129-130 |
| 130-131 |
| 131-132 |
| respectively; |
| and |
(II) A human stem cell factor receptor agonist polypeptide, comprising a modified stem cell factor amino acid sequence of the Formula:
| SEQ ID NO:465 |
| Glu Gly Ile Cys Arg Asn Arg Val Thr Asn Asn Val | |
| ββββββββββββββββββββββββββββββββββββ10 | |
| Lys Asp Val Thr Lys Leu Val Ala Asn Leu Pro Lys | |
| ββββββββββββββββββββββββββββ20 | |
| Asp Tyr Met Ile Thr Leu Lys Tyr Val Pro Gly Met | |
| ββββββββββββββββββββ30 | |
| Asp Val Leu Pro Ser His Cys Trp Ile Ser Glu Met | |
| ββββββββββββ40 | |
| Val Val Gln Leu Ser Asp Ser Leu Thr Asp Leu Leu | |
| ββββ50βββββββββββββββββββββββββββββββββββββ60 | |
| Asp Lys Phe Ser Asn Ile Ser Glu Gly Leu Ser Asn | |
| ββββββββββββββββββββββββββββββββββββ70 | |
| Tyr Ser Ile Ile Asp Lys Leu Val Asn Ile Val Asp | |
| ββββββββββββββββββββββββββββ80 | |
| Asp Leu Val Glu Cys Val Lys Glu Asn Ser Ser Lys | |
| ββββββββββββββββββββ90 | |
| Asp Leu Lys Lys Ser Phe Lys Ser Pro Glu Pro Arg | |
| ββββββββββββ100 | |
| Leu Phe Thr Pro Glu Glu Phe Phe Arg Ile Phe Asn | |
| ββββ110βββββββββββββββββββββββββββββββββββββ120 | |
| Arg Ser Ile Asp Ala Phe Lys Asp Phe Val Val Ala | |
| ββββββββββββββββββββββββββββββββββββ130 | |
| Ser Glu Thr Ser Asp Cys Val Val Ser Ser Thr Leu | |
| ββββββββββββββββββββββββββββββββ140 | |
| Ser Pro Glu Lys Asp Ser Arg Val Ser Val Thr Lys | |
| ββββββββββββββββββββ150 | |
| Pro Phe Met Leu Pro Pro Val Ala Ala | |
| ββββββββββββ160βββββββββββββββββ165 |
wherein the N-terminus is joined to the C-terminus directly or through a linker (L2) capable of joining the N-terminus to the C-terminus and having new C- and N-termini at amino acids;
| 23-24 |
| 24-25 |
| 25-26 |
| 26-27 |
| 27-28 |
| 28-29 |
| 29-30 |
| 30-31 |
| 31-32 |
| 32-33 |
| 33-34 |
| 34-35 |
| 35-36 |
| 36-37 |
| 37-38 |
| 38-39 |
| 39-40 |
| 40-41 |
| 64-65 |
| 65-66 |
| 66-67 |
| 67-68 |
| 68-69 |
| 69-70 |
| 70-71 |
| 89-90 |
| 90-91 |
| 91-92 |
| 92-93 |
| 93-94 |
| 94-95 |
| 95-96 |
| 96-97 |
| 97-98 |
| 98-99 |
| β99-100 |
| 100-101 |
| 101-102 |
| 102-103 |
| 103-104 |
| 104-105 |
| 105-106 |
| 106-107 |
| 107-108 |
| 108-109 |
| 109-110 |
| 110-111 |
| respectively; and |
(III) A human flt-3 receptor agonist polypeptide, comprising a modified flt-3 ligand amino acid sequence of the Formula:
| SEQ ID NO:466 |
| Thr Gln Aep Cys Ser Phe Gln His Ser Pro Ile Ser | |
| ββββββββββββββββββββββββββββββββββββ10 | |
| Ser Asp Phe Ala Val Lys Ile Arg Glu Leu Ser Asp | |
| ββββββββββββββββββββββββββββ20 | |
| Tyr Leu Leu Gln Asp Tyr Pro Val Thr Val Ala Ser | |
| ββββββββββββββββββββ30 | |
| Asn Leu Gln Asp Glu Glu Leu Cys Gly Gly Leu Trp | |
| ββββββββββββ40 | |
| Arg Leu Val Leu Ala Gln Arg Trp Met Glu Arg Leu | |
| ββββ50βββββββββββββββββββββββββββββββββββββ60 | |
| Lys Thr Val Ala Gly Ser Lys Met Gln Gly Leu Leu | |
| ββββββββββββββββββββββββββββββββββββ70 | |
| Glu Arg Val Asn Thr Glu Ile His Phe Val Thr Lys | |
| ββββββββββββββββββββββββββββ80 | |
| Cys Ala Phe Gln Pro Pro Pro Ser Cys Leu Arg Phe | |
| ββββββββββββββββββββ90 | |
| Val Gln Thr Asn Ile Ser Arg Leu Leu Gln Glu Thr | |
| ββββββββββββ100 | |
| Ser Glu Gln Leu Val Ala Leu Lys Pro Trp Ile Thr | |
| ββββ110βββββββββββββββββββββββββββββββββββββ120 | |
| Arg Gln Asn Phe Ser Arg Cys Leu Glu Leu Gln Cys | |
| ββββββββββββββββββββββββββββββββββββ130 | |
| Gln Pro Asp Ser Ser Thr Leu |
wherein the N-terminus is joined to the C-terminus directly or through a linker (L2) capable of joining the N-terminus to the C-terminus and having new C- and N-termini at amino acids;
| 28-29 |
| 29-30 |
| 30-31 |
| 31-32 |
| 32-33 |
| 34-35 |
| 36-37 |
| 37-38 |
| 38-39 |
| 39-40 |
| 40-41 |
| 41-42 |
| 42-43 |
| 64-65 |
| 65-66 |
| 66-67 |
| 86-87 |
| 87-88 |
| 88-89 |
| 89-90 |
| 90-91 |
| 91-92 |
| 92-93 |
| 93-94 |
| 94-95 |
| 95-96 |
| 96-97 |
| 97-98 |
| 98-99 |
| β99-100 |
| 100-101 |
| 101-102 |
| 102-103 |
| respectively; and |
(IV) A polypeptide comprising; a modified human G-CSF amino acid sequence of the formula:
| SEQ ID NO:858 |
| 1βββββββββββββββββββββββββββββββββββ10 | |
| Xaa Xaa Xaa Gly Pro Ala Ser Ser Leu Pro Gln Ser | |
| ββββββββββββββββββββββββββββ20 | |
| Xaa Leu Leu Xaa Xaa Xaa Glu Gln Val Xaa Lys Xaa | |
| ββββββββββββββββββββ30 | |
| Gln Gly Xaa Gly Ala Xaa Leu Gln Glu Xaa Leu Xaa | |
| ββββββββββββ40 | |
| Ala Thr Tyr Lys Leu Xaa Xaa Xaa Glu Xaa Xaa Val | |
| ββββ50βββββββββββββββββββββββββββββββββββββ60 | |
| Xaa Xaa Gly His Ser Xaa Gly Ile Pro Trp Ala Pro | |
| ββββββββββββββββββββββββββββββββββββ70 | |
| Leu Ser Ser Xaa Pro Ser Xaa Ala Leu Xaa Leu Ala | |
| ββββββββββββββββββββββββ80 | |
| Gly Xaa Leu Ser Gln Leu His Ser Gly Leu Phe Leu | |
| ββββββββββββββββββββ90 | |
| Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser | |
| ββββββββββββ100 | |
| Pro Glu Leu Gly Pro Thr Leu Xaa Thr Leu Gln Xaa | |
| ββββββββββββββββββββββββββββββββββββββββββββ120 | |
| Asp Val Ala Asp Phe Ala Xaa Thr Ile Trp Gln Gln | |
| ββββββββββββββββββββββββββββββββββββ130 | |
| Met Glu Xaa Xaa Gly Met Ala Pro Ala Leu Gln Pro | |
| ββββββββββββββββββββββββββββ140 | |
| Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Xaa | |
| ββββββββββββββββββββ150 | |
| Gln Xaa Xaa Ala Gly Gly Val Leu Val Ala Ser Xaa | |
| ββββββββββββ160 | |
| Leu Gln Xaa Phe Leu Xaa Xaa Ser Tyr Arg Val Leu | |
| ββββ170 | |
| Xaa Xaa Leu Ala Gln Pro |
wherein the N-terminus is joined to the C-terminus directly or through a linker (L2) capable of joining the N-terminus to the C-terminus and having new C- and N-termini at amino acids;
| 38-39 |
| 39-40 |
| 40-41 |
| 41-42 |
| 42-43 |
| 43-44 |
| 45-46 |
| 48-49 |
| 49-50 |
| 52-53 |
| 53-54 |
| 54-55 |
| 55-56 |
| 56-57 |
| 57-58 |
| 58-59 |
| 59-60 |
| 60-61 |
| 61-62 |
| 62-63 |
| 63-64 |
| 64-65 |
| 65-66 |
| 66-67 |
| 67-68 |
| 68-69 |
| 69-70 |
| 70-71 |
| 71-72 |
| 91-92 |
| 92-93 |
| 93-94 |
| 94-95 |
| 95-96 |
| 96-97 |
| 97-98 |
| 98-99 |
| β99-100 |
| 123-124 |
| 124-125 |
| 125-126 |
| 126-127 |
| 128-129 |
| 128-129 |
| 129-130 |
| 130-131 |
| 131-132 |
| 132-133 |
| 133-134 |
| 134-135 |
| 135-136 |
| 136-137 |
| 137-138 |
| 138-139 |
| 139-140 |
| 140-141 |
| 141-142 |
| or 142-143 |
| respectively; |
(V) A polypeptide comprising; a modified human IL-3 amino acid sequence of the formula:
| SEQ ID NO:859 |
| Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser | |
| 1βββββββββββββββ5βββββββββββββββββββ10 | |
| Trp Val Asn Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββββββ15βββββββββββββββββ20 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| 25ββββββββββββββββββ30ββββββββββββββββββ35 | |
| Xaa Xaa Asn Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββββββββββ40ββββββββββββββββββ45 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββ50ββββββββββββββββββ55ββββββββββββββββββ60 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββββββββββββββ65ββββββββββββββββββ70 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββββββ75ββββββββββββββββββ80 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| 85ββββββββββββββββββ90ββββββββββββββββββ95 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Phe Xaa | |
| ββββββββββββ100βββββββββββββββββ105 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββ110βββββββββββββββββ115βββββββββββββββββ120 | |
| Xaa Xaa Xaa Gln Gln Thr Thr Leu Ser Leu Ala Ile | |
| ββββββββββββββββ125βββββββββββββββββ130 | |
| Phe |
wherein the N-terminus is joined to the C-terminus directly or through a linker (L2), capable of joining the N-terminus to the C-terminus and having new C- and N-termini at amino acids;
| 26-27 |
| 27-28 |
| 28-29 |
| 29-30 |
| 30-31 |
| 31-32 |
| 32-33 |
| 33-34 |
| 34-35 |
| 35-36 |
| 36-37 |
| 37-38 |
| 38-39 |
| 39-40 |
| 40-41 |
| 41-42 |
| 49-50 |
| 50-51 |
| 51-52 |
| 52-53 |
| 53-54 |
| 54-55 |
| 64-65 |
| 65-66 |
| 66-67 |
| 67-68 |
| 68-69 |
| 69-70 |
| 70-71 |
| 71-72 |
| 72-73 |
| 82-83 |
| 83-84 |
| 84-85 |
| 85-86 |
| 86-87 |
| 87-88 |
| 88-89 |
| 89-90 |
| 90-91 |
| 91-92 |
| 92-93 |
| 97-98 |
| 98-99 |
| β99-100 |
| 100-101 |
| 101-102 |
| 102-103 |
| or 103-104 |
| respectively; |
(VI) A polypeptide comprising a modified human c-mpl ligand amino acid sequence of the formula:
| SEQ ID NO:860 |
| Ser Pro Ala Pro Pro Ala Cys Asp Leu Arg Val Leu | |
| 1βββββββββββββββββββ5βββββββββββββββββββ10 | |
| Ser Lys Leu Leu Arg Asp Ser His Val Leu His Ser | |
| ββββββββ15ββββββββββββββββββ20 | |
| Arg Leu Ser Gln Cys Pro Glu Val His Pro Leu Pro | |
| 25ββββββββββββββββββ30ββββββββββββββββββ35 | |
| Thr Pro Val Leu Leu Pro Ala Val Asp Phe Ser Leu | |
| ββββββββββββ40ββββββββββββββββββ45 | |
| Gly Glu Trp Lys Thr Gln Met Glu Glu Thr Lys Ala | |
| ββββ50ββββββββββββββββββ55ββββββββββββββββββ60 | |
| Gln Asp Ile Leu Gly Ala Val Thr Leu Leu Leu Glu | |
| ββββββββββββββββ65ββββββββββββββββββ70 | |
| Gly Val Met Ala Ala Arg Gly Gln Leu Gly Pro Thr | |
| ββββββββ75ββββββββββββββββββ80 | |
| Cys Leu Ser Ser Leu Leu Gly Gln Leu Ser Gly Gln | |
| 85ββββββββββββββββββ90ββββββββββββββββββ95 | |
| Val Arg Leu Leu Leu Gly Ala Leu Gln Ser Leu Leu | |
| ββββββββββββ100βββββββββββββββββ105 | |
| Gly Thr Gln Xaa Xaa Xaa Xaa Gly Arg Thr Thr Ala | |
| ββββ110βββββββββββββββββ115βββββββββββββββββ120 | |
| His Lys Asp Pro Asn Ala Ile Phe Leu Ser Phe Gln | |
| ββββββββββββββββ125βββββββββββββββββ130 | |
| His Leu Leu Arg Gly Lys Val Arg Phe Leu Met Leu | |
| ββββββββ135βββββββββββββββββ140 | |
| Val Gly Gly Ser Thr Leu Cys Val Arg | |
| 145βββββββββββββββββ150 |
wherein the N-terminus is joined to the C-terminus directly or through a linker (L2) capable of joining the N-terminus to the C-terminus and having new C- and N-termini at amino acids;
| 26-27 |
| 27-28 |
| 28-29 |
| 29-30 |
| 30-31 |
| 32-33 |
| 33-34 |
| 34-35 |
| 36-37 |
| 37-38 |
| 38-39 |
| 40-41 |
| 41-42 |
| 42-43 |
| 43-44 |
| 44-45 |
| 46-47 |
| 47-48 |
| 48-49 |
| 50-51 |
| 51-52 |
| 52-53 |
| 53-54 |
| 54-55 |
| 55-56 |
| 56-57 |
| 57-58 |
| 58-59 |
| 59-60 |
| 78-79 |
| 79-80 |
| 80-81 |
| 81-82 |
| 82-83 |
| 83-84 |
| 84-85 |
| 85-86 |
| 86-87 |
| 87-88 |
| 88-89 |
| 108-109 |
| 109-110 |
| 110-111 |
| 111-112 |
| 112-113 |
| 113-114 |
| 114-115 |
| 115-116 |
| 116-117 |
| 117-118 |
| 118-119 |
| 119-120 |
| 120-121 |
| 121-122 |
| 122-123 |
| 123-124 |
| 124-125 |
| 125-126 |
| 126-127 |
| or 127-128 |
| respectively; |
(VII) A polypeptide comprising; a modified human IL-3 amino acid sequence of the formula:
| SEQ ID NO:859 |
| Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser | |
| 1βββββββββββββββββββ5βββββββββββββββββββ10 | |
| Trp Val Asn Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββββββ15ββββββββββββββββββ20 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| 25ββββββββββββββββββββββ30ββββββββββββββββββ35 | |
| Xaa Xaa Asn Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββββββββββ40ββββββββββββββββββ45 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββ50ββββββββββββββββββ55ββββββββββββββββββ60 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββββββββββββββ65ββββββββββββββββββ70 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββββββ75ββββββββββββββββββ80 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| 85ββββββββββββββββββ90ββββββββββββββββββ95 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Phe Xaa | |
| ββββββββββββ100βββββββββββββββββ105 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββ110βββββββββββββββββ115βββββββββββββββββ120 | |
| Xaa Xaa Xaa Gln Gln Thr Thr Leu Ser Leu Ala Ile | |
| ββββββββββββββββ125βββββββββββββββββ130 | |
| Phe |
(VIII) a factor selected from the group consisting of: a colony stimulating factor, a cytokine, a lymphokine, an interleukin;
and wherein L1 is a linker capable of linking R1 to R2;
with the proviso that at least R1 or R2 is selected from the polypeptide of formula (I), (II), or (III); and
said hematopoietic protein can optionally be immediately preceded by (methionineβ1), (alanineβ1) or (methionine2, alanineβ1).
The more preferred breakpoints at which new C-terminus and N-terminus can be made in the polypeptide (I) above are; 23-24, 24-25, 25-26, 27-28, 28-29, 29-30, 30-31, 31-32, 32-33, 33-34, 34-35, 35-36, 36-37, 37-38, 38-39, 40-41, 41-42, 42-43, 52-53, 53-54, 54-55, 55-56, 77-78, 78-79, 79-80, 80-81, 81-82, 82-83, 83-84, 84-85, 85-86, 86-87, 109-110, 110-111, 110-111, 111-112, 112-113, 113-114, 114-115, 115-116, 116-117, 117-118, 118-119, 119-120, 120-121, 121-122, 122-123, 123-124, 124-125, 125-126, 126-127, 127-128, 128-129, 129-130, 130-131, and 131-132.
The most preferred breakpoints at which new C-terminus and N-terminus can be made in the polypeptide (I) above are; 23-24, 24-25, 31-32, 32-33, 37-38, 38-39, 82-83, 83-84, 85-86, 86-87, 87-88, 125-126, 126-127 and 131-132.
The EPO receptor agonists of the present invention may contain amino acid substitutions, such as those disclosed in WO 94/24160 or one or more of the glycosylation sites at Asn24, Asn83, and Asn126 are changed to other amino acids such as but not limited to Asp or Glu, deletions and/or insertions. It is also intended that the EPO receptor agonists of the present invention may also have amino acid deletions at either/or both the N- and C-termini of the original protein and or deletions from the new N- and/or C-termini of the sequence rearranged proteins in the formulas shown above.
The more preferred breakpoints at which new C-terminus and N-terminus can be made in the polypeptide (II) above are; 23-24, 24-25, 25-26, 33-34, 34-35, 35-36, 36-37, 38-39, 39-40, 40-41, 64-65, 65-66, 66-67, 67-68, 68-69, 69-70, 70-71, 89-90, 90-91, 91-92, 9-93, 93-94, 94-95, 95-96, 96-97, 97-98, 98-99, 99-100, 100-101, 101-102, 102-103, 103-104, 104-105 and 105-106 respectively.
The most preferred breakpoints at which new C-terminus and N-terminus can be made in the polypeptide (II) above are; 64-65, 65-66, 92-93 and 93-94 respectively.
The more preferred breakpoints at which new C-terminus and N-terminus can be made in the polypeptide (III) above are; 36-37, 37-38, 39-40, 41-42, 42-43, 64-65, 65-66, 66-67, 86-87, 87-88, 88-89, 89-90, 90-91, 91-92, 92-93, 93-94, 94-95, 95,-96, 96-97, 97-98, 98-99, 99-100 and 100-101
The most preferred breakpoints at which new C-terminus and N-terminus can be made in the polypeptide (III) above are; 39-40, 65-66, 89-90, 99-100 and 100-101.
The more preferred breakpoints at which new C-terminus and N-terminus can be made in the polypeptide (IV) above are; 38-39, 39-40, 40-41, 41-42, 48-49, 53-54, 54-55, 55-56, 56-57, 57-58, 58-59, 59-60, 60-61, 61-62, 62-63, 64-65, 65-66, 66-67, 67-68, 68-69, 69-70, 96-97, 125-126, 126-127, 127-128, 128-129, 129-130, 130-131, 131-132, 132-133, 133-134, 134-135, 135-136, 136-137, 137-138, 138-139, 139-140, 140-141 and 141-142.
The most preferred breakpoints at which new C-terminus and N-terminus can be made in the polypeptide (IV) above are; 38-39, 48-49, 96-97, 125-126, 132-133 and 141-142.
The more preferred breakpoints at which new C-terminus and N-terminus can be made in the polypeptide (V) above are; 28-29, 29-30, 30-31, 31-32, 32-33, 33-34, 34-35, 35-36, 36-37, 37-38, 38-39, 39-40, 66-67, 67-68, 68-69, 69-70, 70-71, 84-85, 85-86, 86-87, 87-88, 88-89, 89-90, 90-91, 98-99, 99-100, 100-101 and 101-102.
The most preferred breakpoints at which new C-terminus and N-terminus can be made in the polypeptide (V) above are; 34-35, 69-70 and 90-91.
The more preferred breakpoints at which new C-terminus and N-terminus can be made in the polypeptide (VI) above are; 80-81, 81-82, 82-83, 83-84, 84-85, 85-86, 86-87, 108-109, 109-110, 110-111, 111-112, 112-113, 113-114, 114-115, 115-116, 116-117, 117-118, 118-119, 119-120, 120-121, 121-122, 122-123, 123-124, 124-125, 125-126 and 126-127.
The most preferred breakpoints at which new C-terminus and N-terminus can be made in the polypeptide (VI) above are; 81-82, 108-109, 115-116, 119-120, 122-123 and 125-126.
The multi-functional receptor agonist of the present invention can also be represented by the following formulas:
(T1)a(L1)b-X1-(L)c-X2-(L2)d-(T2)e
or
X1-(L)c-X2 (L)-Y1-(L)c-Y2
in which:
X1 is a peptide comprising an amino acid sequence corresponding to the sequence of residues n+1 through J of the original protein having amino acids residues numbered sequentially 1 through J with an amino terminus at residue 1;
L is an optional linker;
X2 is a peptide comprising an amino acid sequence of residues 1 through n of the original protein;
Y1 is a peptide comprising an amino acid sequence corresponding to the sequence of residues n=1 through K of the original protein having amino acids residues numbered sequentially 1 through K with an amino terminus at residue 1;
Y2 is a peptide comprising an amino acid sequence of residues 1 through n of the original protein;
L1 and L2 are optional peptide spacers:
n is an integer ranging from 1 to Jβ1;
b, c, and d are each independently 0 or 1;
a and e are either 0 or 1, provided that both a and e cannot both be 0; and
T1 and T2 are proteins.
The multi-functional chimeric hematopoietic receptor agonists of the present invention may contain amino acid substitutions, deletions and/or insertions in the individual protein components of the chimera molecule. It is also intended that the multi-functional chimeric hematopoietic receptor agonists of the present invention may also have amino acid deletions at either/or both the N- and C-termini of the original protein and or deletions from the new N- and/or C-termini of the sequence rearranged proteins in the formulas shown above.
A preferred embodiment of the present invention the linker (L), (L1) or (L2), of the above formulas, joining the N-terminus to the C-terminus is a polypeptide selected from the group consisting of:
| Ser; | ||
| Asn; | ||
| Gly; | ||
| Thr; | ||
| Gly Ser; | ||
| Ala Ala; | ||
| Gly Ser Gly; | ||
| Gly Gly Gly; | ||
| Gly Asn Gly; | ||
| Gly Ala Gly; | ||
| Gly Thr Gly; | ||
| Ala Ser Ala; | ||
| Ala Ala Ala; | ||
| Gly Gly Gly Ser SEQ ID NO:778; | ||
| Gly Gly Gly Ser Gly Gly Gly Ser SEQ ID NO:779; | ||
| Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser | ||
| SEQ ID NO: 780; | ||
| Ser Gly Gly Ser Gly Gly Ser SEQ ID NO:781; | ||
| Glu Phe Gly Asn Met SEQ ID NO:782; | ||
| Glu Phe Gly Gly Asn Met SEQ ID NO:783; | ||
| Glu Phe Gly Gly Asn Gly Gly Asn Met SEQ ID NO:784; | ||
| Gly Gly Ser Asp Met Ala Gly SEQ ID NO:785; | ||
| Ser Gly Gly Asn Gly SEQ ID NO:786; | ||
| Ser Gly Gly Asn Gly Ser Gly Gly Asn Gly | ||
| SEQ ID NO:787; | ||
| Ser Gly Gly Asn Gly Ser Gly Gly Asn Gly Ser Gly | ||
| Gly Asn Gly SEQ ID NO:788; | ||
| Ser Gly Gly Ser Gly Ser Gly Gly Ser Gly | ||
| SEQ ID NO:789; | ||
| Ser Gly Gly Ser Gly Ser Gly Gly Ser Gly Ser Gly | ||
| Gly Ser Gly SEQ ID NO:790; | ||
| Gly Gly Gly Ser Gly Gly SEQ ID NO:791; | ||
| Gly Gly Gly Ser Gly Gly Gly SEQ ID NO:792; | ||
| Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly | ||
| SEQ ID NO:793; | ||
| Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser | ||
| Gly SEQ ID NO:794; | ||
| Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser | ||
| Gly Gly Gly SEQ ID NO:795; | ||
| Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser | ||
| Gly Gly Gly Ser Gly Gly Gly Ser Gly SEQ ID NO:796; | ||
| Pro Pro Pro Trp Ser Pro Arg Pro Leu Gly Ala Thr | ||
| Ala Pro Thr Ala Gly Gln Pro Pro Leu SEQ ID NO:797; | ||
| Pro Pro Pro Trp Ser Pro Arg Pro Leu Gly Ala Thr | ||
| Ala Pro Thr SEQ ID NO:798; | ||
| and | ||
| Val Glu Thr Val Phe His Arg Val Ser Gln Asp Gly | ||
| Leu Leu Thr Ser SEQ ID NO: 799. |
Additionally, the present invention relates to recombinant expression vectors comprising nucleotide sequences encoding the multi-functional chimeric hematopoietic receptor agonists, related microbial expression systems, and processes for making the multi-functional chimeric hematopoietic receptor agonists. The invention also relates to pharmaceutical compositions containing the multi-functional chimeric hematopoietic receptor agonists, and methods for using the multi-functional chimeric hematopoietic receptor agonists.
In addition to the use of the multi-functional chimeric hematopoietic receptor agonists of the present invention in vivo, it is envisioned that in vitro uses would include the ability to stimulate bone marrow and blood cell activation and growth before infusion into patients. Another intended use is for the production of dendritic cells both in vivo and ex vivo.
It is believed that the reduced affinity of fusion proteins is due, at least in part, to the inability of the individual moieties to achieve their native conformation when incorporated into a chimeric molecule or to steric hindrance between the active site of the individual moieties of the fusion protein. This invention overcomes these limitations providing novel multi-functional chimeric hematopoietic receptor agonists that have a binding affinity comparable to or greater than the individual components of the chimeric molecule.
BRIEF DESCRIPTION OF THE FIGURESFIG. 1 schematically illustrates the sequence rearrangement of a protein. The N-terminus (N) and the C-terminus (C) of the native protein are joined through a linker, or joined directly. The protein is opened at a breakpoint creating a new N-terminus (new N) and a new C-terminus (new-C) resulting in a protein with a new linear amino acid sequence. A rearranged molecule may be synthesized de novo as linear molecule and not go through the steps of joining the original N-terminus and the C-terminus and opening of the protein at the breakpoint.
FIG. 2 shows a schematic of Method I, for creating new proteins in which the original N-terminus and C-terminus of the native protein are joined with a linker and different N-terminus and C-terminus of the protein are created. In the example shown the sequence rearrangement results in a new gene encoding a protein with a new N-terminus created at amino acid 97 of the original protein, the original C-terminus (a.a. 174) joined to the amino acid 11 (a.a. 1-10 are deleted) through a linker region and a new C-terminus created at amino acid 96 of the original sequence.
FIG. 3 shows a schematic of Method II, for creating new proteins in which the original N-terminus and C-terminus of the native protein are joined without a linker and different N-terminus and C-terminus of the protein are created. In the example shown the sequence rearrangement results in a new gene encoding a protein with a new N-terminus created at amino acid 97 of the original protein, the original C-terminus (a.a. 174) joined to the original N-terminus and a new C-terminus created at amino acid 96 of the original sequence.
FIG. 4 shows a schematic of Method III, for creating new proteins in which the original N-terminus and C-terminus of the native protein are joined with a linker and different N-terminus and C-terminus of the protein are created. In the example shown the sequence rearrangement results in a new gene encoding a protein with a new N-terminus created at amino acid 97 of the original protein, the original C-terminus (a.a. 174) joined to amino acid 1 through a linker region and a new C-terminus created at amino acid 96 of the original sequence.
FIG. 5 shows the bioactivity of the multi-functional receptor agonists comprising flt3 receptor agonists pMON32332, pMON32333, pMON32334 and pMON32335 compared to recombinant native flt3 (Genzyme) in the MUTZ-2 cell proliferation assay. MT=mock transfection
FIG. 6 shows a DNA sequence encoding human mature EPO based on the sequence of Lin et al. (PNAS 82:7580-7584, 1985).
FIGS. 7a and 7b shows a DNA sequence encoding native stem cell factor based on the sequence of Martin et al. (Cell 63:203-211, 1990).
FIG. 8 shows a DNA sequence encoding soluble stem cell factor based on the sequence of Langley et al. (Archives of Bichemistry and Biophysica 311:55-61, 1994).
FIGS. 9a and 9b shows the DNA sequence encoding the 209 amino acid mature form of flt3 ligand from Lyman et al. (Oncogene 11:1165-1172, 1995).
FIG. 10 shows the DNA sequence encoding the 134 amino acid soluble form of flt3 ligand from Lyman et al. (Oncogene 11:1165-1172, 1995).
DETAILED DESCRIPTION OF THE INVENTIONThe present invention encompasses multi-functional chimeric hematopoietic receptor agonists formed from covalently linked polypeptides, each of which may act through a different and specific cell receptor to initiate complementary biological activities. Hematopoiesis requires a complex series of cellular events in which stem cells generate continuously into large populations of maturing cells in all major lineages. There are currently at least 20 known regulators with hematopoietic proliferative activity. Most of these proliferative regulators can only stimulate one or another type of colony formation in vitro, the precise pattern of colony formation stimulated by each regulator is quite distinctive. No two regulators stimulate exactly the same pattern of colony formation, as evaluated by colony numbers or, more importantly, by the lineage and maturation pattern of the cells making up the developing colonies. Proliferative responses can most readily be analyzed in simplified in vitro culture systems. Three quite different parameters can be distinguished: alteration in colony size, alteration in colony numbers and cell lineage. Two or more factors may act on the progenitor cell, inducing the formation of larger number of progeny thereby increasing the colony size. Two or more factors may allow increased number of progenitor cells to proliferate either because distinct subsets of progenitors cells exist that respond exclusively to one factor or because some progenitors require stimulation by two or more factors before being able to respond. Activation of additional receptors on a cell by the use of two or more factors is likely to enhance the mitotic signal because of coalescence of initially differing signal pathways into a common final pathway reaching the nucleus (Metcalf, Nature 339:27, 1989).
Other mechanisms could explain synergy. For example, if one signaling pathway is limited by an intermediate activation of an additional signaling pathway which is caused by a second factor, then this may result in a super additive response. In some cases, activation of one receptor type can induce an enhanced expression of other receptors (Metcalf, Blood 82:3515-3523, 1993). Two or more factors may result in a different pattern of cell lineages than from a single factor. The use of multi-functional chimeric hematopoietic receptor agonists may have a potential clinical advantage resulting from a proliferative response that is not possible by any single factor.
The receptors of hematopoietic and other growth factors can be grouped into two distinct families of related proteins: (1) tyrosine kinase receptors, including those for epidermal growth factor, M-CSF (Sherr, Blood 75:1, 1990) and SCF (Yarden et al., EMBO J. 6:3341, 1987): and (2) hematopoietic receptors, not containing a tyrosine kinase domain, but exhibiting obvious homology in their extracellular domain (Bazan, PNAS USA 87:6934-6938, 1990). Included in this latter group are erythropoietin (EPO) (D'Andrea et al., Cell 57:277, 1989), GM-CSF (Gearing et al., EMBO J. 8:3667, 1989), IL-3 (Kitamura et al., Cell 66:1165, 1991), G-CSF (Fukunaga et al., J. Bio. Chem. 265:14008-15, 1990), IL-4 (Harada et al., PNAS USA 87:857, 1990), IL-5 (Takaki et al., EMBO J. 9:4367, 1990), IL-6 (Yamasaki et al., Science 241:825, 1988), IL-7 (Goodwin et al., Cell 60:941-51, 1990), LIF (Gearing et al., EMBO J. 10:2839, 1991) and IL-2 (Cosman et al., Mol-Immunol. 23: 935-94, 1986). Most of the latter group of receptors exists in a high-affinity form as heterodimers. After ligand binding, the specific a-chains become associated with at least one other receptor chain (b-chain, g-chain). Many of these factors share a common receptor subunit. The a-chains for GM-CSF, IL-3 and IL-5 share the same b-chain (Kitamura et al., Cell 66:1165, 1991), Takaki et al., EMBO J. 10:2833-8, 1991) and receptor complexes for IL-6, LIF and IL-11 share a common b-chain (gp130) (Taga et al., Cell 58:573-81, 1989; Gearing et al., Science 255:1434-7, 1992). The receptor complexes of IL-2, IL-4, IL-7, IL-9 and IL-15 share a common g-chain (Kondo et al., Science 262:1874, 1993; Russell et al., Science 266: 1042-1045, 1993; Noguchi et al., Science 262:1877, 1993; Giri et al., EMBO J. 13:2822-2830, 1994).
The use of a multiply acting hematopoietic factor may also have a potential advantage by reducing the demands placed on factor-producing cells and their induction systems. If there are limitations in the ability of a cell to produce a factor, then by lowering the required concentrations of each of the factors, and using them in combination may usefully reduce demands on the factor-producing cells. The use of a multiply acting hematopoietic factor may lower the amount of the factors that would be needed, probably reducing the likelihood of adverse side-effects.
Novel compounds of this invention are represented by a formula selected from the group consisting of:
R1-L1-R2, R2-L1-R1, R1-R2, and R2-R1
Where R1 and R2 are as defined above.
R2 is preferably a colony stimulating factor with a different but complementary activity than R1. By complementary activity is meant activity which enhances or changes the response to another cell modulator. The R1 polypeptide is joined either directly or through a linker segment to the R2 polypeptide. The term βdirectlyβ defines multi-functional chimeric hematopoietic receptor agonists in which the polypeptides are joined without a peptide linker. Thus L1 represents a chemical bond or polypeptide segment to which both R1 and R2 are joined in frame, most commonly L1 is a linear peptide to which R1 and R2 are joined by amide bonds linking the carboxy terminus of R1 to the amino terminus of L1 and carboxy terminus of L1 to the amino terminus of R2. By βjoined in frameβ is meant that there is no translation termination or disruption between the reading frames of the DNA encoding R1 and R2.
A non-exclusive list of other growth factors, i.e. colony stimulating factors (CSFs), are cytokines, lymphokines, interleukins, hematopoietic growth factors which can be joined to (I), (II) or (III) include GM-CSF, G-CSF, c-mpl ligand (also known as TPO or MGDF), M-CSF, erythropoietin (EPO), IL-1, IL-4, IL-2, IL-3, IL-S, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-15, LIF, flt3/flk2 ligand, human growth hormone, B-cell growth factor, B-cell differentiation factor, eosinophil differentiation factor and stem cell factor (SCF) also known as steel factor or c-kit ligand. Additionally, this invention encompasses the use of modified R1 or R2 molecules or mutated or modified DNA sequences encoding these R1 or R2 molecules. The present invention also includes multi-functional chimeric hematopoietic receptor agonists in which R1 or R2 is an hIL-3 variant, c-mpl ligand variant, or G-CSF variant. A βhIL-3 variantβ is defined as a hIL-3 molecule which has amino acid substitutions and/or portions of hIL-3 deleted as disclosed in WO 94/12638, WO 94/12639 and WO 95/00646, as well as other variants known in the art. A βc-mpl ligand variantβ is defined an c-mpl ligand molecule which has amino acid substitutions and/or portions of c-mpl ligand deleted, disclosed in U.S. application Ser. No. 08/383,035 as well as other variants known in the art. A βG-CSF variantβ is defined an G-CSF molecule which has amino acid substitutions and/or portions of G-CSF deleted, as disclosed herein, as well as other variants known in the art. In addition to the list above, IL-3 variants taught in WO 94/12639 and WO 94/12638, G-CSF receptor agonists disclosed in WO 97/12977, c-mpl receptor agonists disclosed in WO 97/12978, IL-3 receptor agonists disclosed in WO 97/12979 can be R1 or R2 of the present invention. As used herein βIL-3 variantsβ refer to IL-3 variants taught in WO 94/12639 and WO 94/12638. As used herein βfusion proteinsβ refer to fusion protein taught in WO 95/21197, and WO 95/21254. As used herein βG-CSF receptor agonistsβ refer to G-CSF receptor agonists disclosed in WO 97/12978. As used herein βc-mpl receptor agonistsβ refer to c-mpl receptor agonists disclosed in WO 97/12978. As used herein βIL-3 receptor agonistsβ refer to IL-3 receptor agonists disclosed in WO 97/12979. As used herein βmulti-functional receptor agonistsβ refer to multi-functional receptor agonists taught in WO 97/12985.
The linking group (L1) is generally a polypeptide of between 1 and 500 amino acids in length. The linkers joining the two molecules are preferably designed to (1) allow the two molecules to fold and act independently of each other, (2) not have a propensity for developing an ordered secondary structure which could interfere with the functional domains of the two proteins, (3) have minimal hydrophobic characteristics which could interact with the functional protein domains and (4) provide steric separation of R1 and R2 such that R1 and R2 could interact simultaneously with their corresponding receptors on a single cell. Typically surface amino acids in flexible protein regions include Gly, Asn and Ser. Virtually any permutation of amino acid sequences containing Gly, Asn and Ser would be expected to satisfy the above criteria for a linker sequence. Other neutral amino acids, such as Thr and Ala, may also be used in the linker sequence. Additional amino acids may also be included in the linkers due to the addition of unique restriction sites in the linker sequence to facilitate construction of the multi-functional chimeric hematopoietic receptor agonists.
Preferred L1 linkers of the present invention include sequences selected from the group of formulas:
| (Gly3Ser)n, | (SEQ ID NO:861) | ||
| (Gly4Ser)n, | (SEQ ID NO:862) | ||
| (Gly5Ser)n, | (SEQ ID NO:863) | ||
| (GlynSer)n, | (SQE ID NO:864) | ||
| or | |||
| (AlaGlySer)n). | (SEQ ID NO:865) |
One example of a highly-flexible linker is the glycine and serine-rich spacer region present within the pIII protein of the filamentous bacteriophages, e.g. bacteriophages M13 or fd (Schaller et al., PNAS USA 72: 737-741, 1975). This region provides a long, flexible spacer region between two domains of the pIII surface protein. The spacer region consists of the amino acid sequence:
| (SEQ ID NO:800) |
| Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser |
| Glu Gly Gly Gly Ser Glu Gly Gly Gly Ser Glu Gly |
| Gly Gly Ser Glu Gly Gly Gly Ser Gly Gly Gly Ser |
The present invention also includes linkers in which an endopeptidase recognition sequence is included. Such a cleavage site may be valuable to separate the individual components of the multi-functional chimeric hematopoietic receptor agonist to determine if they are properly folded and active in vitro. Examples of various endopeptidases include, but are not limited to, plasmin, enterokinase, kallikrein, urokinase, tissue plasminogen activator, clostripain, chymosin, collagenase, Russell's viper venom protease, postproline cleavage enzyme, V8 protease, Thrombin and factor Xa.
Peptide linker segments from the hinge region of heavy chain immunoglobulins IgG, IgA, IgM, IgD or IgE provide an angular relationship between the attached polypeptides. Especially useful are those hinge regions where the cysteines are replaced with serines. Preferred linkers of the present invention include sequences derived from murine IgG gamma 2b hinge region in which the cysteines have been changed to serines. These linkers may also include an endopeptidase cleavage site. Examples of such linkers include the following sequences:
| (SEQ ID NO:801) |
| Ile Ser Glu Pro Ser Gly Pro Ile Ser Thr Ile Asn | |
| Pro Ser Pro Pro Ser Lys Glu Ser His Lys Ser Pro | |
| and | |
| (SEQ ID NO:802) |
| Ile Glu Gly Arg Ile Ser Glu Pro Ser Gly Pro Ile | |
| Ser Thr Ile Asn Pro Ser Pro Pro Ser Lys Glu Ser | |
| His Lys Ser Pro. |
The present invention is, however, not limited by the form, size or number of linker sequences employed and the only requirement of the linker is that functionally it does not interfere with the folding and function of the individual molecules of the multi-functional chimeric hematopoietic receptor agonist.
Determination of the Linker L2The length of the amino acid sequence of the linker L2 to be used in R1 and/or R2 can be selected empirically or with guidance from structural information, or by using a combination of the two approaches.
When no structural information is available, a small series of linkers can be prepared for testing using a design whose length is varied in order to span a range from 0 to 50 β« and whose sequence is chosen in order to be consistent with surface exposure (hydrophilicity, Hopp & Woods, Mol. Immunol. 20: 483-489, 1983), Kyte & Doolittle, J. Mol. Biol. 157:105-132; solvent exposed surface area, Lee & Richards, J. Mol. Biol. 55:379-400, 1971) and the ability to adopt the necessary conformation with out deranging the conformation of R1 or R2 (conformationally flexible; Karplus & Schulz, Naturwissenschaften 72:212-213, 1985). Assuming an average of translation of 2.0 to 3.8 β« per residue, this would mean the length to test would be between 0 to 30 residues, with 0 to 15 residues being the preferred range. Exemplary of such an empirical series would be to construct linkers using a cassette sequence such as βGly-Gly-Gly-Serβ repeated n times, where n is 1, 2, 3 or 4. Those skilled in the art will recognize that there are many such sequences that vary in length or composition that can serve as linkers with the primary consideration being that they be neither excessively long nor short (cf., Sandhu, Critical Rev. Biotech. 12: 437-462, 1992); if they are too long, entropy effects will likely destabilize the three-dimensional fold, and may also make folding kinetically impractical, and if they are too short, they will likely destabilize the molecule because of torsional or steric strain.
Those skilled in the analysis of protein structural information will recognize that using the distance between the chain ends, defined as the distance between the c-alpha carbons, can be used to define the length of the sequence to be used, or at least to limit the number of possibilities that must be tested in an empirical selection of linkers. They will also recognize that it is sometimes the case that the positions of the ends of the polypeptide chain are ill-defined in structural models derived from x-ray diffraction or nuclear magnetic resonance spectroscopy data, and that when true, this situation will therefore need to be taken into account in order to properly estimate the length of the linker required. From those residues whose positions are well defined are selected two residues that are close in sequence to the chain ends, and the distance between their c-alpha carbons is used to calculate an approximate length for a linker between them. Using the calculated length as a guide, linkers with a range of number of residues (calculated using 2 to 3.8 β« per residue) are then selected. These linkers may be composed of the original sequence, shortened or lengthened as necessary, and when lengthened the additional residues may be chosen to be flexible and hydrophilic as described above; or optionally the original sequence may be substituted for using a series of linkers, one example being the βGly-Gly-Gly-Serβ cassette approach mentioned above; or optionally a combination of the original sequence and new sequence having the appropriate total length may be used.
Determination of the Amino and Carboxyl Termini of R1 and R2Sequences of R1 and R2 capable of folding to biologically active states can be prepared by appropriate selection of the beginning (amino terminus) and ending (carboxyl terminus) positions from within the original polypeptide chain while using the linker sequence L2 as described above. Amino and carboxyl termini are selected from within a common stretch of sequence, referred to as a breakpoint region, using the guidelines described below. A novel amino acid sequence is thus generated by selecting amino and carboxyl termini from within the same breakpoint region. In many cases the selection of the new termini will be such that the original position of the carboxyl terminus immediately preceded that of the amino terminus. However, those skilled in the art will recognize that selections of termini anywhere within the region may function, and that these will effectively lead to either deletions or additions to the amino or carboxyl portions of the new sequence.
It is a central tenet of molecular biology that the primary amino acid sequence of a protein dictates folding to the three-dimensional structure necessary for expression of its biological function. Methods are known to those skilled in the art to obtain and interpret three-dimensional structural information using x-ray diffraction of single protein crystals or nuclear magnetic resonance spectroscopy of protein solutions. Examples of structural information that are relevant to the identification of breakpoint regions include the location and type of protein secondary structure (alpha and 3-10 helices, parallel and anti-parallel beta sheets, chain reversals and turns, and loops; Kabsch & Sander, Biopolymers 22: 2577-2637, 1983), the degree of solvent exposure of amino acid residues, the extent and type of interactions of residues with one another (Chothia, Ann. Rev. Biochem. 53:537-572, 1984) and the static and dynamic distribution of conformations along the polypeptide chain (Alber & Mathews, Methods Enzymol. 154: 511-533, 1987). In some cases additional information is known about solvent exposure of residues; one example is a site of post-translational attachment of carbohydrate which is necessarily on the surface of the protein. When experimental structural information is not available, or is not feasible to obtain, methods are also available to analyze the primary amino acid sequence in order to make predictions of protein tertiary and secondary structure, solvent accessibility and the occurrence of turns and loops. Biochemical methods are also sometimes applicable for empirically determining surface exposure when direct structural methods are not feasible; for example, using the identification of sites of chain scission following limited proteolysis in order to infer surface exposure (Gentile & Salvatore, Eur. J. Biochem. 218:603-621, 1993)
Thus using either the experimentally derived structural information or predictive methods (e.g., Srinivisan & Rose Proteins: Struct., Funct. & Genetics, 22: 81-99, 1995) the parental amino acid sequence is inspected to classify regions according to whether or not they are integral to the maintenance of secondary and tertiary structure. The occurrence of sequences within regions that are known to be involved in periodic secondary structure (alpha and 3-10 helices, parallel and anti-parallel beta sheets) are regions that should be avoided. Similarly, regions of amino acid sequence that are observed or predicted to have a low degree of solvent exposure are more likely to be part of the so-called hydrophobic core of the protein and should also be avoided for selection of amino and carboxyl termini. In contrast, those regions that are known or predicted to be in surface turns or loops, and especially those regions that are known not to be required for biological activity, are the preferred sites for location of the extremes of the polypeptide chain. Continuous stretches of amino acid sequence that are preferred based on the above criteria are referred to as a breakpoint region.
Additional peptide sequences may also be added to facilitate purification or identification of multi-functional chimeric hematopoietic receptor agonist proteins (e.g., poly-His). A highly antigenic peptide may also be added that would enable rapid assay and facile purification of the multi-functional chimeric hematopoietic receptor agonist protein by a specific monoclonal antibody.
βMutant amino acid sequence,β βmutant proteinβ, βvariant proteinβ, βmuteinβ, or βmutant polypeptideβ refers to a polypeptide having an amino acid sequence which varies from a native sequence due to amino acid deletions, substitutions, or both, or is encoded by a nucleotide sequence intentionally made variant from a native sequence. βNative sequenceβ refers to an amino acid or nucleic acid sequence which is identical to a wild-type or native form of a gene or protein.
Hematopoietic growth factors can be characterized by their ability to stimulate colony formation by human hematopoietic progenitor cells. The colonies formed include erythroid, granulocyte, megakaryocyte, granulocytic macrophages and mixtures thereof. Many of the hematopoietic growth factors have demonstrated the ability to restore bone marrow function and peripheral blood cell populations to therapeutically beneficial levels in studies performed initially in primates and subsequently in humans. Many or all of these biological activities of hematopoietic growth factors involve signal transduction and high affinity receptor binding. Multi-functional chimeric hematopoietic receptor agonists of the present invention may exhibit useful properties such as having similar or greater biological activity when compared to a single factor or by having improved half-life or decreased adverse side effects, or a combination of these properties.
Multi-functional chimeric hematopoietic receptor agonists which have little or no agonist activity maybe useful as antagonists, as antigens for the production of antibodies for use in immunology or immunotherapy, as genetic probes or as intermediates used to construct other useful hIL-3 muteins.
Biological activity of the multi-functional chimeric hematopoietic receptor agonist proteins of the present invention can be determined by DNA synthesis in factor-dependent cell lines or by counting the colony forming units in an in vitro bone marrow assay.
The multi-functional chimeric hematopoietic receptor agonists of the present invention may have an improved therapeutic profile as compared to single acting hematopoietic agonists. For example, some multi-functional chimeric hematopoietic receptor agonists of the present invention may have a similar or more potent growth factor activity relative to other hematopoietic agonists without having a similar or corresponding increase in side-effects.
The present invention also includes the DNA sequences which code for the multi-functional chimeric hematopoietic receptor agonist proteins, DNA sequences which are substantially similar and perform substantially the same function, and DNA sequences which differ from the DNAs encoding the multi-functional chimeric hematopoietic receptor agonists of the invention only due to the degeneracy of the genetic code. Also included in the present invention are the oligonucleotide intermediates used to construct the mutant DNAs and the polypeptides coded for by these oligonucleotides.
Genetic engineering techniques now standard in the art (U.S. Pat. No. 4,935,233 and Sambrook et al., βMolecular Cloning A Laboratory Manualβ, Cold Spring Harbor Laboratory, 1989) may be used in the construction of the DNA sequences of the present invention. One such method is cassette mutagenesis (Wells et al., Gene 34:315-323, 1985) in which a portion of the coding sequence in a plasmid is replaced with synthetic oligonucleotides that encode the desired amino acid substitutions in a portion of the gene between two restriction sites.
Pairs of complementary synthetic oligonucleotides encoding the desired gene can be made and annealed to each other. The DNA sequence of the oligonucleotide would encode sequence for amino acids of desired gene with the exception of those substituted and/or deleted from the sequence.
Plasmid DNA can be treated with the chosen restriction endonucleases then ligated to the annealed oligonucleotides. The ligated mixtures can be used to transform competent JM101 cells to resistance to an appropriate antibiotic. Single colonies can be picked and the plasmid DNA examined by restriction analysis and/or DNA sequencing to identify plasmids with the desired genes.
Cloning of the DNA sequences of the novel multi-functional hematopoietic agonists wherein at least one of the with the DNA sequence of the other colony stimulating factor may be accomplished by the use of intermediate vectors.
Alternatively one gene can be cloned directly into a vector containing the other gene. Linkers and adapters can be used for joining the DNA sequences, as well as replacing lost sequences, where a restriction site was internal to the region of interest. Thus genetic material (DNA) encoding one polypeptide, peptide linker, and the other polypeptide is inserted into a suitable expression vector which is used to transform bacteria, yeast, insect cells or mammalian cells. The transformed organism is grown and the protein isolated by standard techniques. The resulting product is therefore a new protein which has a colony stimulating factor joined by a linker region to a second colony stimulating factor.
Another aspect of the present invention provides plasmid DNA vectors for use in the expression of these novel multi-functional chimeric hematopoietic receptor agonists. These vectors contain the novel DNA sequences described above which code for the novel polypeptides of the invention. Appropriate vectors which can transform microorganisms capable of expressing the multi-functional chimeric hematopoietic receptor agonists include expression vectors comprising nucleotide sequences coding for the multi-functional chimeric hematopoietic receptor agonists joined to transcriptional and translational regulatory sequences which are selected according to the host cells used.
Vectors incorporating modified sequences as described above are included in the present invention and are useful in the production of the multi-functional chimeric hematopoietic receptor agonist polypeptides. The vector employed in the method also contains selected regulatory sequences in operative association with the DNA coding sequences of the invention and which are capable of directing the replication and expression thereof in selected host cells.
As another aspect of the present invention, there is provided a method for producing the novel multi-functional chimeric hematopoietic receptor agonists. The method of the present invention involves culturing suitable cells or cell line, which has been transformed with a vector containing a DNA sequence coding for expression of a novel multi-functional chimeric hematopoietic receptor agonist. Suitable cells or cell lines may be bacterial cells. For example, the various strains of E. coli are well-known as host cells in the field of biotechnology. Examples of such strains include E. coli strains JM101 (Yanish-Perron et al. Gene 33: 103-119, 1985) and MON105 (Obukowicz et al., Applied Environmental Microbiology 58: 1511-1523, 1992). Also included in the present invention is the expression of the multi-functional chimeric hematopoietic receptor agonist protein utilizing a chromosomal expression vector for E. coli based on the bacteriophage Mu (Weinberg et al., Gene 126: 25-33, 1993). Various strains of B. subtilis may also be employed in this method. Many strains of yeast cells known to those skilled in the art are also available as host cells for expression of the polypeptides of the present invention. When expressed in the E. coli cytoplasm, the gene encoding the multi-functional chimeric hematopoietic receptor agonists of the present invention may also be constructed such that at the 5β² end of the gene codons are added to encode Metβ2-Alaβ1- or Metβ1 at the N-terminus of the protein. The N termini of proteins made in the cytoplasm of E. coli are affected by post-translational processing by methionine aminopeptidase (Ben Bassat et al., J. Bac. 169:751-757, 1987) and possibly by other peptidases so that upon expression the methionine is cleaved off the N-terminus. The multi-functional chimeric hematopoietic receptor agonists of the present invention may include multi-functional chimeric hematopoietic receptor agonist polypeptides having Metβ1, Alaβ1 or Metβ2-Alaβ1 at the N-terminus. These mutant multi-functional chimeric hematopoietic receptor agonists may also be expressed in E. coli by fusing a secretion signal peptide to the N-terminus. This signal peptide is cleaved from the polypeptide as part of the secretion process. Additional strategies for achieving high-level expression of genes in E. coli can be found in Savvas, C. M. (Microbiological Reviews 60; 512-538, 1996).
Also suitable for use in the present invention are mammalian cells, such as Chinese hamster ovary cells (CHO). General methods for expression of foreign genes in mammalian cells are reviewed in Kaufman, R. J., 1987) Genetic Engineering, Principles and Methods, Vol. 9, J. K. Setlow, editor, Plenum Press, New York. An expression vector is constructed in which a strong promoter capable of functioning in mammalian cells drives transcription of a eukaryotic secretion signal peptide coding region, which is translationally joined to the coding region for the multi-functional chimeric hematopoietic receptor agonist. For example, plasmids such as pcDNA I/Neo, pRc/RSV, and pRc/CMV (obtained from Invitrogen Corp., San Diego, Calif.) can be used. The eukaryotic secretion signal peptide coding region can be from the gene itself or it can be from another secreted mammalian protein (Bayne, M. L. et al., Proc. Natl. Acad. Sci. USA 84: 2638-2642, 1987). After construction of the vector containing the gene, the vector DNA is transfected into mammalian cells. Such cells can be, for example, the COS7, HeLa, BHK, CHO, or mouse L lines. The cells can be cultured, for example, in DMEM media (JRH Scientific). The polypeptide secreted into the media can be recovered by standard biochemical approaches following transient expression for 24-72 hours after transfection of the cells or after establishment of stable cell lines following selection for antibiotic resistance. The selection of suitable mammalian host cells and methods for transformation, culture, amplification, screening and product production and purification are known in the art. See, e.g., Gething and Sambrook, Nature, 293:620-625, 1981), or alternatively, Kaufman et al, Mol. Cell. Biol., 5(7):1750-1759, 1985) or Howley et al., U.S. Pat. No. 4,419,446. Another suitable mammalian cell line is the monkey COS-1 cell line. A similarly useful mammalian cell line is the CV-1 cell line.
Where desired, insect cells may be utilized as host cells in the method of the present invention. See, e.g., Miller et al., Genetic Engineering, 8:277-298 (Plenum Press 1986) and references cited therein. In addition, general methods for expression of foreign genes in insect cells using Baculovirus vectors are described in: Summers, M. D. and Smith, G. E., 1987)βA manual of methods for Baculovirus vectors and insect cell culture procedures, Texas Agricultural Experiment Station Bulletin No. 1555. An expression vector is constructed comprising a Baculovirus transfer vector, in which a strong Baculovirus promoter (such as the polyhedron promoter) drives transcription of a eukaryotic secretion signal peptide coding region, which is translationally joined to the coding region for the multi-functional chimeric hematopoietic receptor agonist polypeptide. For example, the plasmid pVL1392 (obtained from Invitrogen Corp., San Diego, Calif.) can be used. After construction of the vector carrying the gene encoding the multi-functional chimeric hematopoietic receptor agonist polypeptide, two micrograms of this DNA is co-transfected with one microgram of Baculovirus DNA (see Summers & Smith, 1987) into insect cells, strain SF9. Pure recombinant Baculovirus carrying the multi-functional chimeric hematopoietic receptor agonist is used to infect cells cultured, for example, in Excell 401 serum-free medium (JRH Biosciences, Lenexa, Kans.). The multi-functional chimeric hematopoietic receptor agonist secreted into the medium can be recovered by standard biochemical approaches. Supernatants from mammalian or insect cells expressing the multi-functional chimeric hematopoietic receptor agonist protein can be first concentrated using any of a number of commercial concentration units.
The multi-functional chimeric hematopoietic receptor agonists of the present invention may be useful in the treatment of diseases characterized by decreased levels of either myeloid, erythroid, lymphoid, or megakaryocyte cells of the hematopoietic system or combinations thereof. In addition, they may be used to activate mature myeloid and/or lymphoid cells. Among conditions susceptible to treatment with the polypeptides of the present invention is leukopenia, a reduction in the number of circulating leukocytes (white cells) in the peripheral blood. Leukopenia may be induced by exposure to certain viruses or to radiation. It is often a side effect of various forms of cancer therapy, e.g., exposure to chemotherapeutic drugs, radiation and of infection or hemorrhage. Therapeutic treatment of leukopenia with these multi-functional chimeric hematopoietic receptor agonists of the present invention may avoid undesirable side effects caused by treatment with presently available drugs.
The multi-functional chimeric hematopoietic receptor agonists of the present invention may be useful in the treatment of neutropenia and, for example, in the treatment of such conditions as aplastic anemia, cyclic neutropenia, idiopathic neutropenia, Chediak-Higashi syndrome, systemic lupus erythematosus (SLE), leukemia, myelodysplastic syndrome and myelofibrosis.
The multi-functional chimeric hematopoietic receptor agonist of the present invention may be useful in the treatment or prevention of thrombocytopenia. Currently the only therapy for thrombocytopenia is platelet transfusion which are costly and carry the significant risks of infection (HIV, HBV) and alloimunization. The multi-functional chimeric hematopoietic receptor agonist may alleviate or diminish the need for platelet transfusion. Severe thrombocytopenia may result from genetic defects such as Fanconi's Anemia, Wiscott-Aldrich, or May Hegglin syndromes. Acquired thrombocytopenia may result from auto- or allo-antibodies as in Immune Thrombocytopenia Purpura, Systemic Lupus Erythromatosis, hemolytic anemia, or fetal maternal incompatibility. In addition, splenomegaly, disseminated intravascular coagulation, thrombotic thrombocytopenic purpura, infection or prosthetic heart valves may result in thrombocytopenia. Severe thrombocytopenia may also result from chemotherapy and/or radiation therapy or cancer. Thrombocytopenia may also result from marrow invasion by carcinoma, lymphoma, leukemia or fibrosis.
The multi-functional chimeric hematopoietic receptor agonists of the present invention may be useful in the mobilization of hematopoietic progenitors and stem cells in peripheral blood. Peripheral blood derived progenitors have been shown to be effective in reconstituting patients in the setting of autologous marrow transplantation. Hematopoietic growth factors including G-CSF and GM-CSF have been shown to enhance the number of circulating progenitors and stem cells in the peripheral blood. This has simplified the procedure for peripheral stem cell collection and dramatically decreased the cost of the procedure by decreasing the number of pheresis required. The multi-functional chimeric hematopoietic receptor agonist may be useful in mobilization of stem cells and further enhance the efficacy of peripheral stem cell transplantation.
The multi-functional chimeric hematopoietic receptor agonists of the present invention may also be useful in the ex vivo expansion of hematopoietic progenitors and stem cells. Colony stimulating factors (CSFs), such as hIL-3, have been administered alone, co-administered with other CSFs, or in combination with bone marrow transplants subsequent to high dose chemotherapy to treat the neutropenia and thrombocytopenia which are often the result of such treatment. However the period of severe neutropenia and thrombocytopenia may not be totally eliminated. The myeloid lineage, which is comprised of monocytes (macrophages), granulocytes (including neutrophils) and megakaryocytes, is critical in preventing infections and bleeding which can be life-threatening. Neutropenia and thrombocytopenia may also be the result of disease, genetic disorders, drugs, toxins, radiation and many therapeutic treatments such as conventional oncology therapy.
Bone marrow transplants have been used to treat this patient population. However, several problems are associated with the use of bone marrow to reconstitute a compromised hematopoietic system including: 1) the number of stem cells in bone marrow, spleen, or peripheral blood is limited, 2) Graft Versus Host Disease, 3) graft rejection and 4) possible contamination with tumor cells. Stem cells make up a very small percentage of the nucleated cells in the bone marrow, spleen and peripheral blood. It is clear that a dose response exists such that a greater number of stem cells will enhance hematopoietic recovery. Therefore, the in vitro expansion of stem cells should enhance hematopoietic recovery and patient survival. Bone marrow from an allogeneic donor has been used to provide bone marrow for transplant. However, Graft Versus Host Disease and graft rejection limit bone marrow transplantation even in recipients with HLA-matched sibling donors. An alternative to allogeneic bone marrow transplants is autologous bone marrow transplants. In autologous bone marrow transplants, some of the patient's own marrow is harvested prior to myeloablative therapy, e.g. high dose chemotherapy, and is transplanted back into the patient afterwards. Autologous transplants eliminate the risk of Graft Versus Host Disease and graft rejection. However, autologous bone marrow transplants still present problems in terms of the limited number of stems cells in the marrow and possible contamination with tumor cells. The limited number of stem cells may be overcome by ex-vivo expansion of the stem cells. In addition, stem cells can be specifically isolated, based on the presence of specific surface antigens such as CD34+ in order to decrease tumor cell contamination of the marrow graft.
The following patents contain further details on separating stem cells, CD34+ cells, culturing the cells with hematopoietic factors, the use of the cells for the treatment of patients with hematopoietic disorders and the use of hematopoietic factors for cell expansion and gene therapy.
U.S. Pat. No. 5,061,620 relates to compositions comprising human hematopoietic stem cells provided by separating the stem cells from dedicated cells.
U.S. Pat. No. 5,199,942 describes a method for autologous hematopoietic cell transplantation comprising: (1) obtaining hematopoietic progenitor cells from a patient; (2) ex-vivo expansion of cells with a growth factor selected from the group consisting of IL-3, flt3 ligand, c-kit ligand, GM-CSF, IL-1, GM-CSF/IL-3 fusion protein and combinations thereof; (3) administering cellular preparation to a patient.
U.S. Pat. No. 5,240,856 relates to a cell separator that includes an apparatus for automatically controlling the cell separation process.
WO 91/16116 describes devices and methods for selectively isolating and separating target cells from a mixture of cells.
WO 91/18972 describes methods for in vitro culturing of bone marrow, by incubating suspension of bone marrow cells, using a hollow fiber bioreactor.
WO 92/18615 relates to a process for maintaining and expanding bone marrow cells, in a culture medium containing specific mixtures of cytokines, for use in transplants.
WO 93/08268 describes a method for selectively expanding stem cells, comprising the steps of (a) separating CD34+ stem cells from other cells and (b) incubating the separated cells in a selective medium, such that the stem cells are selectively expanded.
WO 93/18136 describes a process for in vitro support of mammalian cells derived from peripheral blood.
WO 93/18648 relates to a composition comprising human neutrophil precursor cells with a high content of myeloblasts and promyelocytes for treating genetic or acquired neutropenia.
WO 94/08039 describes a method of enrichment for human hematopoietic stem cells by selection for cells which express c-kit protein.
WO 94/11493 describes a stem cell population that are CD34+ and small in size, which are isolated using a counterflow elutriation method.
WO 94/27698 relates to a method combining immunoaffinity separation and continuous flow centrifugal separation for the selective separation of a nucleated heterogeneous cell population from a heterogeneous cell mixture.
WO 94/25848 describes a cell separation apparatus for collection and manipulation of target cells.
The long term culturing of highly enriched CD34+precursors of hematopoietic progenitor cells from human bone marrow in cultures containing IL-1a, IL-3, IL-6 or GM-CSF is discussed in Brandt et al J. Clin. Invest. 86:932-941, 1990).
One aspect of the present invention provides a method for selective ex-vivo expansion of stem cells. The term βstem cellβ refers to the totipotent hematopoietic stem cells as well as early precursors and progenitor cells which can be isolated from bone marrow, spleen or peripheral blood. The term βexpansionβ refers to the differentiation and proliferation of the cells. The present invention provides a method for selective ex-vivo expansion of stem cells, comprising the steps of: (a) separating stem cells from other cells, (b) culturing said separated stem cells with a selective media which contains multi-functional chimeric hematopoietic receptor agonist protein(s) and (c) harvesting said stems cells. Stem cells, as well as committed progenitor cells destined to become neutrophils, erythrocytes, platelets, etc. may be distinguished from most other cells by the presence or absence of particular progenitor marker antigens, such as CD34, that are present on the surface of these cells and/or by morphological characteristics. The phenotype for a highly enriched human stem cell fraction is reported as CD34+, Thyβ1+ and linβ, but it is to be understood that the present invention is not limited to the expansion of this stem cell population. The CD34+ enriched human stem cell fraction can be separated by a number of reported methods, including affinity columns or beads, magnetic beads or flow cytometry using antibodies directed to surface antigens such as the CD34+. Further, physical separation methods such as counterflow elutriation may be used to enrich hematopoietic progenitors. The CD34+ progenitors are heterogeneous, and may be divided into several sub-populations characterized by the presence or absence of co-expression of different lineage associated cell surface associated molecules. The most immature progenitor cells do not express any known lineage associated markers, such as HLA-DR or CD38, but they may express CD90(thy-1). Other surface antigens such as CD33, CD38, CD41, CD71, HLA-DR or c-kit can also be used to selectively isolate hematopoietic progenitors. The separated cells can be incubated in selected medium in a culture flask, sterile bag or in hollow fibers. Various colony stimulating factors may be utilized in order to selectively expand cells. Representative factors that have been utilized for ex-vivo expansion of bone marrow include, c-kit ligand, IL-3, G-CSF, GM-CSF, IL-1, IL-6, IL-11, flt-3 ligand or combinations thereof. The proliferation of the stem cells can be monitored by enumerating the number of stem cells and other cells, by standard techniques (e.g. hemacytometer, CFU, LTCIC) or by flow cytometry prior and subsequent to incubation.
Several methods for ex-vivo expansion of stem cells have been reported utilizing a number of selection methods and expansion using various colony stimulating factors including c-kit ligand (Brandt et al., Blood 83:1507-1514 [1994], McKenna et al., Blood 86:3413-3420 [1995]), IL-3 (Brandt et al., Blood 83:1507-1514 [1994], Sato et al., Blood 82:3600-3609 [1993]), G-CSF (Sato et al., Blood 82:3600-3609 [1993]), GM-CSF (Sato et al., Blood 82:3600-3609 [1993]), IL-1 (Muench et al., Blood 81:3463-3473 [1993]), IL-6 (Sato et al., Blood 82:3600-3609 [1993]), IL-11 (Lemoli et al., Exp. Hem. 21:1668-1672 [1993], Sato et al., Blood 82:3600-3609 [1993]), flt-3 ligand (McKenna et al., Blood 86:3413 3420 [1995]) and/or combinations thereof (Brandt et al., Blood 83:1507 1514 [1994], Haylock et al., Blood 80:1405-1412 [1992], Koller et al., Biotechnology 11:358-363 [1993], (Lemoli et al., Exp. Hem. 21:1668-1672 [1993]), McKenna et al., Blood 86:3413-3420 [1995], Muench et al., Blood 81:3463-3473 [1993], Patchen et al., Biotherapy 7:13-26 [1994], Sato et al., Blood 82:3600-3609 [1993], Smith et al., Exp. Hem. 21:870-877 [1993], Steen et al., Stem Cells 12:214-224 [1994], Tsujino et al., Exp. Hem. 21:1379-1386 [1993]). Among the individual colony stimulating factors, hIL-3 has been shown to be one of the most potent in expanding peripheral blood CD34+ cells (Sato et al., Blood 82:3600-3609 [1993], Kobayashi et al., Blood 73:1836-1841 [1989]). However, no single factor has been shown to be as effective as the combination of multiple factors. The present invention provides methods for ex vivo expansion that utilize multi-functional chimeric hematopoietic receptor agonists that are more effective than a single factor alone.
Another aspect of the invention provides methods of sustaining and/or expanding hematopoietic precursor cells which includes inoculating the cells into a culture vessel which contains a culture medium that has been conditioned by exposure to a stromal cell line such as HS-5 (WO 96/02662, Roecklein and Torok-Strob, Blood 85:997-1105, 1995) that has been supplemented with a multi-functional hematopoietic chimeric receptor agonist of the present invention.
It is also envisioned that uses of multi-functional hematopoietic chimeric receptor agonists of the present invention would include blood banking applications, where the EPO receptor agonists are given to a patent to increase the number of blood cells and blood products are removed from the patient, prior to some medical procedure. The blood products stored and transfused back into the patient after the medical procedure. Additionally, it is envisioned that uses of multi-functional hematopoietic chimeric receptor agonists would include giving the multi-functional hematopoietic chimeric receptor agonists to a blood donor prior to blood donation to increase the number of blood cells, thereby allowing the donor to safely give more blood.
Another projected clinical use of growth factors has been in the in vitro activation of hematopoietic progenitors and stem cells for gene therapy. Due to the long life-span of hematopoietic progenitor cells and the distribution of their daughter cells throughout the entire body, hematopoietic progenitor cells are good candidates for ex vivo gene transfection. In order to have the gene of interest incorporated into the genome of the hematopoietic progenitor or stem cell one needs to stimulate cell division and DNA replication. Hematopoietic stem cells cycle at a very low frequency which means that growth factors may be useful to promote gene transduction and thereby enhance the clinical prospects for gene therapy. Potential applications of gene therapy (review Crystal, Science 270:404-410 [1995]) include; 1) the treatment of many congenital metabolic disorders and immunodeficiencies (Kay and Woo, Trends Genet. 10:253-257 [1994]), 2) neurological disorders (Friedmann, Trends Genet. 10:210-214 [1994]), 3) cancer (Culver and Blaese, Trends Genet. 10:174-178 [1994]) and 4) infectious diseases (Gilboa and Smith, Trends Genet. 10:139-144 [1994]).
There are a variety of methods, known to those with skill in the art, for introducing genetic material into a host cell. A number of vectors, both viral and non-viral have been developed for transferring therapeutic genes into primary cells. Viral based vectors include; 1) replication deficient recombinant retrovirus (Boris-Lawrie and Temin, Curr. Opin. Genet. Dev. 3:102-109 [1993], Boris-Lawrie and Temin, Annal. New York Acad. Sci. 716:59-71 [1994], Miller, Current Top. Microbial. Immunol. 158:1-24 [1992]) and replication-deficient recombinant adenovirus (Berkner, BioTechniques 6:616-629 [1988], Berkner, Current Top. Microbiol. Immunol. 158:39-66 [1992], Brody and Crystal, Annal. New York Acad. Sci. 716:90-103 [1994]). Non-viral based vectors include protein/DNA complexes (Cristiano et al., PNAS USA. 90:2122-2126 [1993], Curiel et al., PNAS USA 88:8850-8854 [1991], Curiel, Annal. New York Acad. Sci. 716:36-58 [1994]), electroporation and liposome mediated delivery such as cationic liposomes (Farhood et al., Annal. New York Acad. Sci. 716:23-35 [1994]).
The present invention provides an improvement to the existing methods of expanding hematopoietic cells, which new genetic material has been introduced, in that it provides methods utilizing multi-functional chimeric hematopoietic receptor agonist proteins that have improved biological activity, including an activity not seen by any single colony stimulation factor.
Many drugs may cause bone marrow suppression or hematopoietic deficiencies. Examples of such drugs are AZT, DDI, alkylating agents and anti-metabolites used in chemotherapy, antibiotics such as chloramphenicol, penicillin, gancyclovir, daunomycin and sulfa drugs, phenothiazones, tranquilizers such as meprobamate, analgesics such as aminopyrine and dipyrone, anti-convulsants such as phenytoin or carbamazepine, antithyroids such as propylthiouracil and methimazole and diuretics. The multi-functional chimeric hematopoietic receptor agonists of the present invention may be useful in preventing or treating the bone marrow suppression or hematopoietic deficiencies which often occur in patients treated with these drugs.
Hematopoietic deficiencies may also occur as a result of viral, microbial or parasitic infections, burns and as a result of treatment for renal disease or renal failure, e.g., dialysis. The multi-functional chimeric hematopoietic receptor agonists of the present invention may be useful in treating such hematopoietic deficiencies.
The treatment of hematopoietic deficiency may include administration of a pharmaceutical composition containing the multi-functional chimeric hematopoietic receptor agonists to a patient. The multi-functional chimeric hematopoietic receptor agonists of the present invention may also be useful for the activation and amplification of hematopoietic precursor cells by treating these cells in vitro with the multi-functional chimeric hematopoietic receptor agonist proteins of the present invention prior to injecting the cells into a patient.
Various immunodeficiencies, e.g., in T and/or B lymphocytes, or immune disorders, e.g., rheumatoid arthritis, may also be beneficially affected by treatment with the multi-functional chimeric hematopoietic receptor agonists of the present invention. Immunodeficiencies may be the result of viral infections, e.g., HTLVI, HTLVII, HTLVIII, severe exposure to radiation, cancer therapy or the result of other medical treatment. The multi-functional chimeric hematopoietic receptor agonists of the present invention may also be employed, alone or in combination with other colony stimulating factors, in the treatment of other blood cell deficiencies, including thrombocytopenia (platelet deficiency), or anemia. Other uses for these novel polypeptides are the in vivo and ex vivo treatment of patients recovering from bone marrow transplants, and in the development of monoclonal and polyclonal antibodies generated by standard methods for diagnostic or therapeutic use.
Other aspects of the present invention are methods and therapeutic compositions for treating the conditions referred to above. Such compositions comprise a therapeutically effective amount of one or more of the multi-functional chimeric hematopoietic receptor agonists of the present invention in a mixture with a pharmaceutically acceptable carrier. This composition can be administered either parenterally, intravenously or subcutaneously. When administered, the therapeutic composition for use in this invention is preferably in the form of a pyrogen-free, parenterally acceptable aqueous solution. The preparation of such a parenterally acceptable protein solution, having due regard to pH, isotonicity, stability and the like, is within the skill of the art.
Another intended use of the multi-functional chimeric hematopoietic receptor agonists of the present invention is for the generation of larger numbers of dendritic cells, from precursors, to be used as adjuvants for immunization. Dendritic cells play a crucial role in the immune system. They are the professional antigen-presenting cells most efficient in the activation of resting T cells and are the major antigen-presenting cells for activation of naΓ―ve T cells in vivo and, thus, for initiation of primary immune responses. They efficiently internalize, process and present soluble tumor-specific antigens (Ag). Dendritic cells have the unique capacity to cluster naΓ―ve T cells and to respond to Ag encounter by rapid upregulation of the expression of major histocompatability complex (MHC) and co-stimulatory molecules, the production of cytokines and migration towards lymphatic organs. Since dendritic cells are of central importance for sensitizing the host against a neoantigen for CD4-dependent immune responses, they may also play a crucial role in the generation and regulation of tumor immunity.
Dendritic cells originate from a bone marrow CD34+precursor common to granulocytes and macrophages, and the existence of a separate dendritic cell colony-forming unit (CFU-DC) that give rise to pure dendritic cell colonies has been established in humans. In addition, a post-CFU CD14+ intermediate has been described with the potential to differentiate along the dendritic cell or the macrophage pathway under distinct cytokine conditions. This bipotential precursor is present in the bone marrow, cord blood and peripheral blood. Dendritic cells can be isolated based on specific cell surface markers, such as CD1a+, CD3β, CD4β, CD20β, CD40+, CD80+, and CD83+, to delineate the maturation of cultured dendritic cells.
Dendritic cells based strategies provide a method for enhancing immune response against tumors and infectious agents. AIDS is another disease for which dendritic cell based therapies can be used, since dendritic cells can play a major role in promoting HIV-1 replication. An immunotherapy requires the generation of dendritic cells from cancer patients, their in vitro exposure to tumor Ag, derived from surgically removed tumor masses, and reinjection of these cells into the tumor patients. Relatively crude membrane preparations of tumor cells will suffice as sources of tumor antigen, avoiding the necessity for molecular identification of the tumor antigen. The tumor antigen may also be synthetic peptides, carbohydrates, or nucleic acid sequences. In addition, concomitant administration of cytokines such as the multi-functional chimeric hematopoietic receptor agonists of the present invention may further facilitate the induction of tumor immunity. It is foreseen that the immunotherapy can be in an in vivo setting, wherein the multi-functional chimeric hematopoietic receptor agonists of the present invention is administered to a patient, having a tumor, alone or with other hematopoietic growth factors to increase the number of dendritic cells and endogenous tumor antigen is presented on the dendritic cells. It is also envisioned that in vivo immunotherapy can be with exogenous antigen. It is also envisioned that the immunotherapy treatment may include the mobilization of dendritic cell precursors or mature dendritic, by administering the multi-functional chimeric hematopoietic receptor agonists of the present invention alone or with other hematopoietic growth factors to the patient, removing the dendritic cell precursors or mature dendritic cells from the patient, exposing the dendritic cells to antigen and returning the dendritic cells to the patient. Furthermore, the dendritic cells that have been removed can be cultured ex vivo with the multi-functional chimeric hematopoietic receptor agonists of the present invention alone or with other hematopoietic growth factors to increase the number of dendritic cells prior to exposure to antigen. Dendritic cells based strategies also provide a method for reducing the immune response in auto-immune diseases.
Studies on dendritic cells have been greatly hampered by difficulties in preparing the cells in sufficient numbers and in a reasonably pure form. In an ex-vivo cell expansion setting, granulocyte-macrophage colony-stimulating factor (GM-CSF) and tumor necrosis factor-Ξ± (TNF-Ξ±) cooperate in the ex vivo generation of dendritic cells from hematopoietic progenitors (CD34+ cells) retrieved from bone marrow, cord blood, or peripheral blood and flk-2/flt-3 ligand and c-kit ligand (stem cell factor [SCF]) synergize to enhance the GM-CSF plus TNF-Ξ± induced generation of dendritic cells (Siena, S. et al. Experimental Hematology 23:1463-1471, 1995). Also provide is a method of ex vivo expansion of dendritic cell precursors or mature dendritic cells using the multi-functional chimeric hematopoietic receptor agonists of the present invention to provide sufficient quantities of dendritic cells for immunotherapy.
The dosage regimen involved in a method for treating the above-described conditions will be determined by the attending physician considering various factors which modify the action of drugs, e.g., the condition, body weight, sex and diet of the patient, the severity of any infection, time of administration and other clinical factors. Generally, a daily regimen may be in the range of 0.2-150 ΞΌg/kg of multi-functional chimeric hematopoietic receptor agonist protein per kilogram of body weight. Dosages would be adjusted relative to the activity of a given multi-functional chimeric hematopoietic receptor agonist protein and it would not be unreasonable to note that dosage regimens may include doses as low as 0.1 microgram and as high as 1 milligram per kilogram of body weight per day. In addition, there may exist specific circumstances where dosages of multi-functional chimeric hematopoietic receptor agonist would be adjusted higher or lower than the range of 0.2-150 micrograms per kilogram of body weight. These include co-administration with other colony stimulating factors or IL-3 variants or growth factors; co-administration with chemotherapeutic drugs and/or radiation; the use of glycosylated multi-functional chimeric hematopoietic receptor agonist protein; and various patient-related issues mentioned earlier in this section. As indicated above, the therapeutic method and compositions may also include co-administration with other human factors. A non-exclusive list of other appropriate colony stimulating factors (CSFs), cytokines, lymphokines, hematopoietic growth factors and interleukins for simultaneous or serial co-administration with the polypeptides of the present invention includes GM-CSF, G-CSF, c-mpl ligand (also known as TPO or MGDF), M-CSF, erythropoietin (EPO), IL-1, IL-4, IL-2, IL-3, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-15, IL-16, LIF, flt3/flk2 ligand, B-cell growth factor, B-cell differentiation factor and eosinophil differentiation factor, stem cell factor (SCF) also known as steel factor or c-kit ligand, or combinations thereof. The dosage recited above would be adjusted to compensate for such additional components in the therapeutic composition. Progress of the treated patient can be monitored by periodic assessment of the hematological profile, e.g., differential cell count and the like.
Materials and MethodsUnless noted otherwise, all specialty chemicals were obtained from Sigma, Co. (St. Louis, Mo.). Restriction endonucleases and T4 DNA ligase were obtained from New England Biolabs (Beverly, Mass.) or Boehringer Mannheim (Indianapolis, Ind.).
Transformation of E. coli StrainsE. coli strains, such as DH5aβ’ (Life Technologies, Gaithersburg, Md.) and TG1 (Amersham Corp., Arlington Heights, Ill.) are used for transformation of ligation reactions and are the source of plasmid DNA for transfecting mammalian cells. E. coli strains, such as JM101 (Yanisch-Perron, et al., Gene, 33: 103-119, 1985) and MON105 (Obukowicz, et al., Appl. and Envir. Micr., 58: 1511-1523, 1992) can be used for expressing the multi-functional chimeric hematopoietic receptor agonist of the present invention in the cytoplasm or periplasmic space.
MON105 ATCC#55204: F-, lambda-, IN(rrnD, rrE)1, rpoD+, rpoH358
DH5aβ’: F-, phi80dlacZdeltaM15, delta(lacZYA-argF)U169, deoR, recA1, endA1, hsdR17(rkβ, mk+), phoA, supE44lamda-, thi-1, gyrA96, relA1
TG1: delta(lac-pro), supE, thi-1, hsdD5/Fβ²(traD36, proA+B+, lacIq, lacZdeltaM15)
JM101 ATCC#33876: delta (pro lac), supE, thi, Fβ²(traD36, proA+B+, lacIq, lacZdeltaM15)
DH5aβ’ Subcloning efficiency cells are purchased as competent cells and are ready for transformation using the manufacturer's protocol, while both E. coli strains TG1 and MON105 are rendered competent to take up DNA using a CaCl2 method. Typically, 20 to 50 mL of cells are grown in LB medium (1% Bacto-tryptone, 0.5% Bacto-yeast extract, 150 mM NaCl) to a density of approximately 1.0 optical density unit at 600 nanometers (OD600) as measured by a Baush & Lomb Spectronic spectrophotometer (Rochester, N.Y.). The cells are collected by centrifugation and resuspended in one-fifth culture volume of CaCl2 solution (50 mM CaCl2, 10 mM Tris-Cl, pH7.4) and are held at 4Β° C. for 30 minutes. The cells are again collected by centrifugation and resuspended in one-tenth culture volume of CaCl2 solution. Ligated DNA is added to 0.2 mL of these cells, and the samples are held at 4Β° C. for 30-60 minutes. The samples are shifted to 42Β° C. for two minutes and 1.0 mL of LB is added prior to shaking the samples at 37Β° C. for one hour. Cells from these samples are spread on plates (LB medium plus 1.5% Bacto-agar) containing either ampicillin (100 micrograms/mL, ug/mL) when selecting for ampicillin-resistant transformants, or spectinomycin (75 ug/mL) when selecting for spectinomycin-resistant transformants. The plates are incubated overnight at 37Β° C. Colonies are picked and inoculated into LB plus appropriate antibiotic (100 ug/mL ampicillin or 75 ug/mL spectinomycin) and are grown at 37Β° C. while shaking.
Methods for Creation of Genes with New N-Terminus/C-TerminusMethod I. Creation of Genes with New N-Terminus/C-Terminus which Contain a Linker Region (L2).
Genes with new N-terminus/C-terminus which contain a linker region (L2) separating the original C-terminus and N-terminus can be made essentially following the method described in L. S. Mullins, et al (J. Am. Chem. Soc. 116, 5529-5533, 1994). Multiple steps of polymerase chain reaction (PCR) amplifications are used to rearrange the DNA sequence encoding the primary amino acid sequence of the protein. The steps are illustrated in FIG. 2.
In the first step, the first primer set (βnew startβ and βlinker startβ) is used to create and amplify, from the original gene sequence, the DNA fragment (βFragment Startβ) that contains the sequence encoding the new N-terminal portion of the new protein followed by the linker (L2) that connects the C-terminal and N-terminal ends of the original protein. In the second step, the second primer set (βnew stopβ and βlinker stopβ) is used to create and amplify, from the original gene sequence, the DNA fragment (βFragment Stopβ) that encodes the same linker as used above, followed by the new C-terminal portion of the new protein. The βnew startβ and βnew stopβ primers are designed to include the appropriate restriction sites which allow cloning of the new gene into expression plasmids. Typical PCR conditions are one cycle 95Β° C. melting for two minutes; 25 cycles 94Β° C. denaturation for one minute, 50Β° C. annealing for one minute and 72Β° C. extension for one minute; plus one cycle 72Β° C. extension for seven minutes. A Perkin Elmer GeneAmp PCR Core Reagents kit is used. A 100 ul reaction contains 100 pmole of each primer and one ug of template DNA; and 1ΓPCR buffer, 200 uM dGTP, 200 uM dATP, 200 uM dTTP, 200 uM dCTP, 2.5 units AmpliTaq DNA polymerase and 2 mM MgCl2. PCR reactions are performed in a Model 480 DNA thermal cycler (Perkin Elmer Corporation, Norwalk, Conn.).
βFragment Startβ and βFragment Stopβ, which have complementary sequence in the linker region and the coding sequence for the two amino acids on both sides of the linker, are joined together in a third PCR step to make the full-length gene encoding the new protein. The DNA fragments βFragment Startβ and βFragment Stopβ are resolved on a 1% TAE gel, stained with ethidium bromide and isolated using a Qiaex Gel Extraction kit (Qiagen). These fragments are combined in equimolar quantities, heated at 70Β° C. for ten minutes and slow cooled to allow annealing through their shared sequence in βlinker startβ and βlinker stopβ. In the third PCR step, primers βnew startβ and βnew stopβ are added to the annealed fragments to create and amplify the full-length new N-terminus/C-terminus gene. Typical PCR conditions are one cycle 95Β° C. melting for two minutes; 25 cycles 94Β° C. denaturation for one minute, 60Β° C. annealing for one minute and 72Β° C. extension for one minute; plus one cycle 72Β° C. extension for seven minutes. A Perkin Elmer GeneAmp PCR Core Reagents kit is used. A 100 ul reaction contains 100 pmole of each primer and approximately 0.5 ug of DNA; and 1ΓPCR buffer, 200 uM dGTP, 200 uM dATP, 200 uM dTTP, 200 uM dCTP, 2.5 units AmpliTaq DNA polymerase and 2 mM MgCl2. PCR reactions are purified using a Wizard PCR Preps kit (Promega).
Method II. Creation Of Genes with New N-Terminus/C-Terminus without a Linker Region.
New N-terminus/C-terminus genes without a linker joining the original N-terminus and C-terminus can be made using two steps of PCR amplification and a blunt end ligation. The steps are illustrated in FIG. 3. In the first step, the primer set (βnew startβ and βP-bl startβ) is used to create and amplify, from the original gene sequence, the DNA fragment (βFragment Startβ) that contains the sequence encoding the new N-terminal portion of the new protein. In the second step, the primer set (βnew stopβ and βP-bl stopβ) is used to create and amplify, from gene sequence, the DNA fragment (βFragment Stopβ) that contains the sequence encoding the new C-terminal portion of the new protein. The βnew startβ and βnew stopβ primers are designed to include appropriate restriction sites which allow cloning of the new gene into expression vectors. Typical PCR conditions are one cycle 95Β° C. melting for two minutes; 25 cycles 94Β° C. denaturation for one minute, 50Β° C. annealing for 45 seconds and 72Β° C. extension for 45 seconds. Deep Vent polymerase (New England Biolabs) is used to reduce the occurrence of overhangs in conditions recommended by the manufacturer. The βP-bl startβ and βP-bl stopβ primers are phosphorylated at the 5β² end to aid in the subsequent blunt end ligation of βFragment Startβ and βFragment Stopβ to each other. A 100 ul reaction contained 150 pmole of each primer and one ug of template DNA; and 1Γ Vent buffer (New England Biolabs), 300 uM dGTP, 300 uM dATP, 300 uM dTTP, 300 uM dCTP, and 1 unit Deep Vent polymerase. PCR reactions are performed in a Model 480 DNA thermal cycler (Perkin Elmer Corporation, Norwalk, Conn.). PCR reaction products are purified using a Wizard PCR Preps kit (Promega).
The primers are designed to include appropriate restriction sites which allow for the cloning of the new gene into expression vectors. Typically βFragment Startβ is designed to create NcoI restriction site, and βFragment Stopβ is designed to create a HindIII restriction site. Restriction digest reactions are purified using a Magic DNA Clean-up System kit (Promega). Fragments Start and Stop are resolved on a 1% TAE gel, stained with ethidium bromide and isolated using a Qiaex Gel Extraction kit (Qiagen). These fragments are combined with and annealed to the ends of the Λ3800 base pair NcoI/HindIII vector fragment of pMON3934 by heating at 50Β° C. for ten minutes and allowed to slow cool. The three fragments are ligated together using T4 DNA ligase (Boehringer Mannheim). The result is a plasmid containing the full-length new N-terminus/C-terminus gene. A portion of the ligation reaction is used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Plasmid DNA is purified and sequence confirmed as below.
Method III. Creation of New N-Terminus/C-Terminus Genes by Tandem-Duplication Method
New N-terminus/C-terminus genes can be made based on the method described in R. A. Horlick, et al Protein Eng. 5:427-431, 1992). Polymerase chain reaction (PCR) amplification of the new N-terminus/C-terminus genes is performed using a tandemly duplicated template DNA. The steps are illustrated in FIG. 3.
The tandemly-duplicated template DNA is created by cloning and contains two copies of the gene separated by DNA sequence encoding a linker connecting the original C- and N-terminal ends of the two copies of the gene. Specific primer sets are used to create and amplify a full-length new N terminus/C-terminus gene from the tandemly-duplicated template DNA. These primers are designed to include appropriate restriction sites which allow for the cloning of the new gene into expression vectors. Typical PCR conditions are one cycle 95Β° C. melting for two minutes; 25 cycles 94Β° C. denaturation for one minute, 5Β° C. annealing for one minute and 72Β° C. extension for one minute; plus one cycle 72Β° C. extension for seven minutes. A Perkin Elmer GeneAmp PCR Core Reagents kit (Perkin Elmer Corporation, Norwalk, Conn.) is used. A 100 ul reaction contains 100 pmole of each primer and one ug of template DNA; and 1ΓPCR buffer, 200 uM dGTP, 200 uM dATP, 200 uM dTTP, 200 uM dCTP, 2.5 units AmpliTaq DNA polymerase and 2 mM MgCl2. PCR reactions are performed in a Model 480 DNA thermal cycler (Perkin Elmer Corporation, Norwalk, Conn.). PCR reactions are purified using a Wizard PCR Preps kit (Promega).
Cloning of New N-Terminus/C-Terminus Genes into Multi-Functional Receptor Agonist Expression VectorsThe new N-terminus/C-terminus gene is digested with restriction endonucleases to create ends that are compatible to insertion into an expression vector containing another colony stimulating factor gene. This expression vector is likewise digested with restriction endonucleases to form compatible ends. After purification, the gene and the vector DNAs are combined and ligated using T4 DNA ligase. A portion of the ligation reaction is used to transform E. coli. Plasmid DNA is purified and sequenced to confirm the correct insert. The correct clones are grown for protein expression.
DNA Isolation and CharacterizationPlasmid DNA can be isolated by a number of different methods and using commercially available kits known to those skilled in the art. A few such methods are shown herein. Plasmid DNA is isolated using the Promega Wizards Miniprep kit (Madison, Wis.), the Qiagen QIAwell Plasmid isolation kits (Chatsworth, Calif.) or Qiagen Plasmid Midi kit. These kits follow the same general procedure for plasmid DNA isolation. Briefly, cells are pelleted by centrifugation (5000Γg), plasmid DNA released with sequential NaOH/acid treatment, and cellular debris is removed by centrifugation (10000Γg). The supernatant (containing the plasmid DNA) is loaded onto a column containing a DNA-binding resin, the column is washed, and plasmid DNA eluted with TE. After screening for the colonies with the plasmid of interest, the E. coli cells are inoculated into 50-100 mLs of LB plus appropriate antibiotic for overnight growth at 37Β° C. in an air incubator while shaking. The purified plasmid DNA is used for DNA sequencing, further restriction enzyme digestion, additional subcloning of DNA fragments and transfection into mammalian, E. coli or other cells.
Sequence ConfirmationPurified plasmid DNA is resuspended in dH2O and quantitated by measuring the absorbance at 260/280 nm in a Bausch and Lomb Spectronic 601 UV spectrometer. DNA samples are sequenced using ABI PRISMβ’ DyeDeoxyβ’ terminator sequencing chemistry (Applied Biosystems Division of Perkin Elmer Corporation, Lincoln City, Calif.) kits (Part Number 401388 or 402078) according to the manufacturers suggested protocol usually modified by the addition of 5% DMSO to the sequencing mixture. Sequencing reactions are performed in a Model 480 DNA thermal cycler (Perkin Elmer Corporation, Norwalk, Conn.) following the recommended amplification conditions. Samples are purified to remove excess dye terminators with Centri-Sepβ’ spin columns (Princeton Separations, Adelphia, N.J.) and lyophilized. Fluorescent dye labeled sequencing reactions are resuspended in deionized formamide, and sequenced on denaturing 4.75% polyacrylamide-8M urea gels using an ABI Model 373A automated DNA sequencer. Overlapping DNA sequence fragments are analyzed and assembled into master DNA contigs using Sequencher DNA analysis software (Gene Codes Corporation, Ann Arbor, Mich.).
Expression of Multi-Functional Receptor Agonists in Mammalian Cells Mammalian Cell Transfection/Production of Conditioned MediaThe BHK-21 cell line can be obtained from the ATCC (Rockville, Md.). The cells are cultured in Dulbecco's modified Eagle media (DMEM/high-glucose), supplemented to 2 mM (mM) L-glutamine and 10% fetal bovine serum (FBS). This formulation is designated BHK growth media. Selective media is BHK growth media supplemented with 453 units/mL hygromycin B (Calbiochem, San Diego, Calif.). The BHK-21 cell line was previously stably transfected with the HSV transactivating protein VP16, which transactivates the IE110 promoter found on the plasmid pMON3359 (See Hippenmeyer et al., Bio/Technology, pp. 1037-1041, 1993). The VP16 protein drives expression of genes inserted behind the IE110 promoter. BHK-21 cells expressing the transactivating protein VP16 are designated BHK-VP16. The plasmid pMON1118 (See Highkin et al., Poultry Sci., 70: 970-981, 1991) expresses the hygromycin resistance gene from the SV40 promoter. A similar plasmid is available from ATCC, pSV2-hph.
BHK-VP16 cells are seeded into a 60 millimeter (mm) tissue culture dish at 3Γ105 cells per dish 24 hours prior to transfection. Cells are transfected for 16 hours in 3 mL of βOPTIMEMββ’ (Gibco-BRL, Gaithersburg, Md.) containing 10 ug of plasmid DNA containing the gene of interest, 3 ug hygromycin resistance plasmid, pMON1118, and 80 ug of Gibco-BRL βLIPOFECTAMINEββ’ per dish. The media is subsequently aspirated and replaced with 3 mL of growth media. At 48 hours post-transfection, media from each dish is collected and assayed for activity (transient conditioned media). The cells are removed from the dish by trypsin-EDTA, diluted 1:10 and transferred to 100 mm tissue culture dishes containing 10 mL of selective media. After approximately 7 days in selective media, resistant cells grow into colonies several millimeters in diameter. The colonies are removed from the dish with filter paper (cut to approximately the same size as the colonies and soaked in trypsin/EDTA) and transferred to individual wells of a 24 well plate containing 1 mL of selective media. After the clones are grown to confluence, the conditioned media is re-assayed, and positive clones are expanded into growth media.
Expression of Multi-Functional Receptor Agonists in E. coliE. coli strain MON105 or JM101 harboring the plasmid of interest are grown at 37Β° C. in M9 plus casamino acids medium with shaking in a air incubator Model G25 from New Brunswick Scientific (Edison, N.J.). Growth is monitored at OD600 until it reaches a value of 1.0 at which time Nalidixic acid (10 milligrams/mL) in 0.1 N NaOH is added to a final concentration of 50 ΞΌg/mL. The cultures are then shaken at 37Β° C. for three to four additional hours. A high degree of aeration is maintained throughout culture period in order to achieve maximal production of the desired gene product. The cells are examined under a light microscope for the presence of inclusion bodies (IB). One mL aliquots of the culture are removed for analysis of protein content by boiling the pelleted cells, treating them with reducing buffer and electrophoresis via SDS-PAGE (see Maniatis et al. Molecular Cloning: A Laboratory Manual, 1982). The culture is centrifuged (5000Γg) to pellet the cells.
Inclusion Body Preparation, Extraction, Refolding, Dialysis, DEAE Chromatography, and Characterization of the Multi-Functional Chimeric Hematopoietic Receptor Agonists which Accumulate as Inclusion Bodies in E. Coli Isolation of Inclusion BodiesThe cell pellet from a 330 mL E. coli culture is resuspended in 15 mL of sonication buffer (10 mM 2-amino-2-(hydroxymethyl) 1,3-propanediol hydrochloride (Tris-HCl), pH 8.0+1 mM ethylenediaminetetraacetic acid (EDTA). These resuspended cells are sonicated using the microtip probe of a Sonicator Cell Disruptor (Model W-375, Heat Systems-Ultrasonics, Inc., Farmingdale, N.Y.). Three rounds of sonication in sonication buffer followed by centrifugation are employed to disrupt the cells and wash the inclusion bodies (IB). The first round of sonication is a 3 minute burst followed by a 1 minute burst, and the final two rounds of sonication are for 1 minute each.
Extraction and Refolding of Proteins from Inclusion Body Pellets:
Following the final centrifugation step, the IB pellet is resuspended in 10 mL of 50 mM Tris-HCl, pH 9.5, 8 M urea and 5 mM dithiothreitol (DTT) and stirred at room temperature for approximately 45 minutes to allow for denaturation of the expressed protein.
The extraction solution is transferred to a beaker containing 70 mL of 5 mM Tris-HCl, pH 9.5 and 2.3 M urea and gently stirred while exposed to air at 4Β° C. for 18 to 48 hours to allow the proteins to refold. Refolding is monitored by analysis on a Vydac (Hesperia, Ca.) C18 reversed phase high pressure liquid chromatography (RP-HPLC) column (0.46Γ25 cm). A linear gradient of 40% to 65% acetonitrile, containing 0.1% trifluoroacetic acid (TFA), is employed to monitor the refold. This gradient is developed over 30 minutes at a flow rate of 1.5 mL per minute. Denatured proteins generally elute later in the gradient than the refolded proteins.
Purification:
Following the refold, contaminating E. coli proteins are removed by acid precipitation. The pH of the refold solution is titrated to between pH 5.0 and pH 5.2 using 15% (v/v) acetic acid (HOAc). This solution is stirred at 4Β° C. for 2 hours and then centrifuged for 20 minutes at 12,000Γg to pellet any insoluble protein.
The supernatant from the acid precipitation step is dialyzed using a Spectra/Por 3 membrane with a molecular weight cut off (MWCO) of 3,500 daltons. The dialysis is against 2 changes of 4 liters (a 50-fold excess) of 10 mM Tris-HCl, pH 8.0 for a total of 18 hours. Dialysis lowers the sample conductivity and removes urea prior to DEAE chromatography. The sample is then centrifuged (20 minutes at 12,000Γg) to pellet any insoluble protein following dialysis.
A Bio-Rad Bio-Scale DEAE2 column (7Γ52 mm) is used for ion exchange chromatography. The column is equilibrated in a buffer containing 10 mM Tris-HCl, pH 8.0, and a O-to-500 mM sodium chloride (NaCl) gradient, in equilibration buffer, over 45 column volumes is used to elute the protein. A flow rate of 1.0 mL per minute is used throughout the run. Column fractions (2.0 mL per fraction) are collected across the gradient and analyzed by RP HPLC on a Vydac (Hesperia, Calif.)
C18 column (0.46Γ25 cm). A linear gradient of 40% to 65% acetonitrile, containing 0.1% trifluoroacetic acid (TFA), is employed. This gradient is developed over 30 minutes at a flow rate of 1.5 mL per minute. Pooled fractions are then dialyzed against 2 changes of 4 liters (50-to-500-fold excess) of 10 mM ammonium acetate (NH4Ac), pH 4.0 for a total of 18 hours. Dialysis is performed using a Spectra/Por 3 membrane with a MWCO of 3,500 daltons. Finally, the sample is sterile filtered using a 0.22 ΞΌm syringe filter (ΞΌStar LB syringe filter, Costar, Cambridge, Ma.), and stored at 4Β° C.
In some cases the folded proteins can be affinity purified using affinity reagents such as mabs or receptor subunits attached to a suitable matrix. Alternatively, (or in addition) purification can be accomplished using any of a variety of chromatographic methods such as: ion exchange, gel filtration or hydrophobic chromatography or reversed phase HPLC.
These and other protein purification methods are described in detail in Methods in Enzymology, Volume 182 βGuide to Protein Purificationβ edited by Murray Deutscher, Academic Press, San Diego, Calif. (1990).
Protein Characterization:
The purified protein is analyzed by RP-HPLC, electrospray mass spectrometry, and SDS-PAGE. The protein quantitation is done by amino acid composition, RP-HPLC, and Bradford protein determination. In some cases tryptic peptide mapping is performed in conjunction with electrospray mass spectrometry to confirm the identity of the protein.
AML Proliferation Assay for Bioactive Human Interleukin-3The factor-dependent cell line AML 193 was obtained from the American Type Culture Collection (ATCC, Rockville, Md.). This cell line, established from a patient with acute myelogenous leukemia, is a growth factor dependent cell line which displayed enhanced growth in GM-CSF supplemented medium (Lange, B., et al., Blood 70: 192, 1987; Valtieri, M., et al., J. Immunol. 138:4042, 1987). The ability of AML 193 cells to proliferate in the presence of human IL-3 has also been documented. (Santoli, D., et al., J. Immunol. 139: 348, 1987). A cell line variant was used, AML 193 1.3, which was adapted for long term growth in IL-3 by washing out the growth factors and starving the cytokine dependent AML 193 cells for growth factors for 24 hours. The cells are then replated at 1Γ105 cells/well in a 24 well plate in media containing 100 U/mL IL-3. It took approximately 2 months for the cells to grow rapidly in IL-3. These cells are maintained as AML 193 1.3 thereafter by supplementing tissue culture medium (see below) with human IL-3.
AML 193 1.3 cells are washed 6 times in cold Hanks balanced salt solution (HBSS, Gibco, Grand Island, N.Y.) by centrifuging cell suspensions at 250Γg for 10 minutes followed by decantation of the supernatant. Pelleted cells are resuspended in HBSS and the procedure is repeated until six wash cycles are completed. Cells washed six times by this procedure are resuspended in tissue culture medium at a density ranging from 2Γ105 to 5Γ105 viable cells/mL. This medium is prepared by supplementing Iscove's modified Dulbecco's Medium (IMDM, Hazelton, Lenexa, Kans.) with albumin, transferrin, lipids and 2-mercaptoethanol. Bovine albumin (Boehringer-Mannheim, Indianapolis, Ind.) is added at 500 ΞΌg/mL; human transferrin (Boehringer-Mannheim, Indianapolis, Ind.) is added at 100 Mg/mL; soybean lipid (Boehringer-Mannheim, Indianapolis, Ind.) is added at 50 ΞΌg/mL; and 2-mercaptoethanol (Sigma, St. Louis, Mo.) is added at 5Γ10β5 M.
Serial dilutions of human interleukin-3 or multi-functional chimeric hematopoietic receptor agonist proteins are made in triplicate series in tissue culture medium supplemented as stated above in 96 well Costar 3596 tissue culture plates. Each well contained 50 ΞΌl of medium containing interleukin-3 or multi-functional chimeric hematopoietic receptor agonist proteins once serial dilutions are completed. Control wells contained tissue culture medium alone (negative control). AML 193 1.3 cell suspensions prepared as above are added to each well by pipetting 50 ΞΌl (2.5Γ104 cells) into each well. Tissue culture plates are incubated at 37Β° C. with 5% CO2 in humidified air for 3 days. On day 3, 0.5 ΞΌCi 3H-thymidine (2 Ci/mM, New England Nuclear, Boston, Mass.) is added in 50 ΞΌl of tissue culture medium. Cultures are incubated at 37Β° C. with 5% CO2 in humidified air for 18-24 hours. Cellular DNA is harvested onto glass filter mats (Pharmacia LKB, Gaithersburg, Md.) using a TOMTEC cell harvester (TOMTEC, Orange, Conn.) which utilized a water wash cycle followed by a 70% ethanol wash cycle. Filter mats are allowed to air dry and then placed into sample bags to which scintillation fluid (Scintiverse II, Fisher Scientific, St. Louis, Mo. or BetaPlate Scintillation Fluid, Pharmacia LKB, Gaithersburg, Md.) is added. Beta emissions of samples from individual tissue culture wells are counted in a LKB BetaPlate model 1205 scintillation counter (Pharmacia LKB, Gaithersburg, Md.) and data is expressed as counts per minute of 3H-thymidine incorporated into cells from each tissue culture well. Activity of each human interleukin-3 preparation or multi-functional chimeric hematopoietic receptor agonist protein preparation is quantitated by measuring cell proliferation (3H-thymidine incorporation) induced by graded concentrations of interleukin-3 or multi-functional chimeric hematopoietic receptor agonist. Typically, concentration ranges from 0.05 pM-105 pM are quantitated in these assays. Activity is determined by measuring the dose of interleukin-3 or multi-functional chimeric hematopoietic receptor agonist protein which provides 50% of maximal proliferation (EC50=0.5Γ(maximum average counts per minute of 3H-thymidine incorporated per well among triplicate cultures of all concentrations of interleukin-3 testedβbackground proliferation measured by 3H-thymidine incorporation observed in triplicate cultures lacking interleukin-3). This EC50 value is also equivalent to 1 unit of bioactivity. Every assay is performed with native interleukin-3 as a reference standard so that relative activity levels could be assigned.
Typically, the multi-functional chimeric hematopoietic receptor agonist proteins were tested in a concentration range of 2000 pM to 0.06 pM titrated in serial 2 fold dilutions.
Activity for each sample was determined by the concentration which gave 50% of the maximal response by fitting a four-parameter logistic model to the data. It was observed that the upper plateau (maximal response) for the sample and the standard with which it was compared did not differ. Therefore relative potency calculation for each sample was determined from EC50 estimations for the sample and the standard as indicated above. AML 193.1.3 cells proliferate in response to hIL-3, hGM-CSF and hG-CSF. Therefore the following additional assays were performed for some samples to demonstrate that the G-CSF receptor agonist portion of the multi-functional chimeric hematopoietic receptor agonist proteins was active. The proliferation assay was performed with the multi-functional chimeric hematopoietic receptor agonist plus and minus neutralizing monoclonal antibodies to the hIL-3 receptor agonist portion. In addition, a fusion molecule with the factor Xa cleavage site was cleaved then purified and the halves of the molecule were assayed for proliferative activity. These experiments showed that both components of the multi-functional chimeric hematopoietic receptor agonist proteins were active.
TF1 c-mpl Ligand Dependent Proliferation AssayThe c-mpl ligand proliferative activity can be assayed using a subclone of the pluripotential human cell line TF1 (Kitamura et al., J. Cell Physiol 140:323-334. [1989]). TF1 cells are maintained in h-IL3 (100 U/mL). To establish a sub-clone responsive to c-mpl ligand, cells are maintained in passage media containing 10% supernatant from BHK cells transfected with the gene expressing the 1-153 form of c-mpl ligand (pMON26448). Most of the cells die, but a subset of cells survive. After dilution cloning, a c-mpl ligand responsive clone is selected, and these cells are split into passage media to a density of 0.3Γ106 cells/mL the day prior to assay set-up. Passage media for these cells is the following: RPMI 1640 (Gibco), 10% FBS (Harlan, Lot #91206), 10% c-mpl ligand supernatant from transfected BHK cells, 1 mM sodium pyruvate (Gibco), 2 mM glutamine (Gibco), and 100 ug/mL penicillin-streptomycin (Gibco). The next day, cells are harvested and washed twice in RPMI or IMDM media with a final wash in the ATL, or assay media. ATL medium consists of the following: IMDM (Gibco), 500 ug/mL of bovine serum albumin, 100 ug/mL of human transferrin, 50 ug/mL soybean lipids, 4Γ10-8M beta-mercaptoethanol and 2 mL of A9909 (Sigma, antibiotic solution) per 1000 mL of ATL. Cells are diluted in assay media to a final density of 0.25Γ106 cells/mL in a 96-well low evaporation plate (Costar) to a final volume of 50 ul. Transient supernatants (conditioned media) from transfected clones are added at a volume of 50 ul as duplicate samples at a final concentration of 50% and diluted three-fold to a final dilution of 1.8%. Triplicate samples of a dose curve of IL-3 variant pMON13288 starting at 1 ng/mL and diluted using three-fold dilutions to 0.0014 ng/mL is included as a positive control. Plates are incubated at 5% CO2 and 37Β° C. At day six of culture, the plate is pulsed with 0.5 Ci of 3H/well (NEN) in a volume of 20 ul/well and allowed to incubate at 5% CO2 and 37Β° C. for four hours. The plate is harvested and counted on a Betaplate counter.
MUTZ-2 Cell Proliferation AssayA cell line such as MUTZ-2, which is a human myeloid leukemia cell line (German Collection of Microorganisms and Cell Cultures, DSM ACC 271), can be used to determine the cell proliferative activity of flt3 receptor agonists. MUTZ-2 cultures are maintained with recombinant native flt3 ligand (20-100 ng/mL) in the growth medium. Eighteen hours prior to assay set-up, MUTZ-2 cells are washed in IMDM medium (Gibco) three times and are resuspended in IMDM medium alone at a concentration of 0.5-0.7Γ10E6 cells/mL and incubated at 37Β° C. and 5% CO2 to starve the cells of flt3 ligand. The day of the assay, standards and flt3 receptor agonists are diluted to two fold above desired final concentration in assay media in sterile tissue culture treated 96 well plates. Flt3 receptor agonists and standards are tested in triplicate. 50 ΞΌl of assay media is loaded into all wells except row A. 75 ΞΌl of the flt3 receptor agonists or standards are added to row A and 25 ΞΌl taken from that row and serial dilutions (1:3) performed on the rest of the plate (rows B through G). Row H remains as a media only control. The starved MUTZ-2 cells are washed two times in IMDM medium and resuspended in 50 ΞΌl assay media. 50 ΞΌl of cells are added to each well resulting in a final concentration of 0.25Γ10E6cells/mL. Assay plates containing cells are incubated at 37Β° C. and 5% CO2 for 44 hrs. Each well is then pulsed with 1 ΞΌCi/well of tritiated thymidine in a volume of 20 ΞΌl for four hours. Plates are then harvested and counted.
Other In Vitro Cell Based Proliferation AssaysOther in vitro cell based assays, known to those skilled in the art, may also be useful to determine the activity of the multi-functional chimeric hematopoietic receptor agonists depending on the factors that comprise the molecule in a similar manner as described in the AML 193.1.3 cell proliferation assay. The following are examples of other useful assays.
TF1 proliferation assay: TF1 is a pluripotential human cell line (Kitamura et al., J. Cell Physiol 140:323-334. [1989]) that responds to hIL-3.
32D proliferation assay: 32D is a murine IL-3 dependent cell line which does not respond to human IL-3 but does respond to human G-CSF which is not species restricted.
Baf/3 proliferation assay: Baf/3 is a murine IL-3 dependent cell line which does not respond to human IL-3 or human c-mpl ligand but does respond to human G-CSF which is not species restricted.
T1165 proliferation assay: T1165 cells are a IL-6 dependent murine cell line (Nordan et al., 1986) which respond to IL-6 and IL-11.
Human Plasma Clot meg-CSF Assay: Used to assay megakaryocyte colony formation activity (Mazur et al., 1981).
Transfected Cell LinesCell lines such as the murine Baf/3 cell line can be transfected with a colony stimulating factor receptor, such as the human G-CSF receptor or human c-mpl receptor, which the cell line does not have. These transfected cell lines can be used to determine the activity of the ligand for which the receptor has been transfected into the cell line.
One such transfected Baf/3 cell line was made by cloning the cDNA encoding c-mpl from a library made from a c-mpl responsive cell line and cloned into the multiple cloning site of the plasmid pcDNA3 (Invitrogen, San Diego Calif.). Baf/3 cells were transfected with the plasmid via electroporation. The cells were grown under G418 selection in the presence of mouse IL-3 in Wehi conditioned media. Clones were established through limited dilution.
In a similar manner the human G-CSF receptor can be transfected into the Baf/3 cell line and used to determine the bioactivity of the multi-functional chimeric hematopoietic receptor agonists.
Analysis of c-mpl Ligand Proliferative Activity Methods
1. Bone Marrow Proliferation Assay
a. CD34+ Cell Purification:
Bone marrow aspirates (15-20 mL) were obtained from normal allogeneic marrow donors after informed consent. Cells were diluted 1:3 in phosphate buffered saline (PBS, Gibco-BRL), 30 mL were layered over 15 mL Histopaque-1077 (Sigma) and centrifuged for 30 minutes at 300 RCF. The mononuclear interface layer was collected and washed in PBS. CD34+ cells were enriched from the mononuclear cell preparation using an affinity column per manufacturers instructions (CellPro, Inc., Bothell Wash.). After enrichment, the purity of CD34+ cells was 70% on average as determined by using flow cytometric analysis using anti-CD34 monoclonal antibody conjugated to fluorescein and anti-CD38 conjugated to phycoerythrin (Becton Dickinson, San Jose Calif.).
Cells were resuspended at 40,000 cells/mL in X-Vivo 10 media (Bio-Whittaker, Walkersville, Md.) and 1 mL was plated in 12-well tissue culture plates (Costar). The growth factor rhIL-3 was added at 100 ng/mL (pMON5873) was added to some wells. hIL3 variants were used at 10 ng/mL to 100 ng/mL. Conditioned media from BHK cells transfected with plasmid encoding c-mpl ligand or multi-functional chimeric hematopoietic receptor agonists were tested by addition of 100 ΞΌl of supernatant added to 1 mL cultures (approximately a 10% dilution). Cells were incubated at 37Β° C. for 8-14 days at 5% CO2 in a 37Β° C. humidified incubator.
b. Cell Harvest and Analysis:
At the end of the culture period a total cell count was obtained for each condition. For fluorescence analysis and ploidy determination cells were washed in megakaryocyte buffer (MK buffer, 13.6 mM sodium citrate, 1 mM theophylline, 2.2 ΞΌm PGE1, 11 mM glucose, 3% w/v BSA, in PBS, pH 7.4) (Tomer et al., Blood 70: 1735-1742, 1987) resuspended in 500 ΞΌl of MK buffer containing anti-CD41a FITC antibody (1:200, AMAC, Westbrook, Me.) and washed in MK buffer. For DNA analysis cells were permeablized in MK buffer containing 0.5% Tween 20 (Fisher, Fair Lawn N.J.) for 20 min. on ice followed by fixation in 0.5% Tween-20 and 1% paraformaldehyde (Fisher Chemical) for 30 minutes followed by incubation in propidium iodide (Calbiochem, La Jolla Calif.) (50 ΞΌg/mL) with RNA-ase (400 U/mL) in 55% v/v MK buffer (200mOsm) for 1-2 hours on ice.
Cells were analyzed on a FACScan or Vantage flow cytometer (Becton Dickinson, San Jose, Calif.). Green fluorescence (CD41a-FITC) was collected along with linear and log signals for red fluorescence (PI) to determine DNA ploidy. All cells were collected to determine the percent of cells that were CD41+. Data analysis was performed using software by LYSIS (Becton Dickinson, San Jose, Calif.). Percent of cells expressing the CD41 antigen was obtained from flow cytometry analysis(Percent). Absolute (Abs) number of CD41+ cells/mL was calculated by: (Abs)=(Cell Count)*(Percent)/100.
2. Megakaryocyte Fibrin Clot Assay.
CD34+ enriched population were isolated as described above. Cells were suspended at 25,000 cells/mL with or without cytokine(s) in a media consisting of a base Iscoves IMDM media supplemented with 0.3% BSA, 0.4 mg/mL apo-transferrin, 6.67 ΞΌM FeCl2, 25 ΞΌg/mL CaCl2, 25 ΞΌg/mL L-asparagine, 500 ΞΌg/mL e-amino-n-caproic acid and penicillin/streptomycin. Prior to plating into 35 mm plates, thrombin was added (0.25 Units/mL) to initiate clot formation. Cells were incubated at 37Β° C. for 13 days at 5% CO2 in a 37Β° C. humidified incubator.
At the end of the culture period plates were fixed with methanol:acetone (1:3), air dried and stored at Λ200Β° C. until staining. A peroxidase immunocytochemistry staining procedure was used (Zymed, Histostain-SP. San Francisco, Calif.) using a cocktail of primary monoclonal antibodies consisting of anti-CD41a, CD42 and CD61. Colonies were counted after staining and classified as negative, CFU-MK (small colonies, 1-2 foci and less that approx. 25 cells), BFU-MK (large, multi-foci colonies with >25 cells) or mixed colonies (mixture of both positive and negative cells.
Methylcellulose AssayThis assay reflects the ability of colony stimulating factors to stimulate normal bone marrow cells to produce different types of hematopoietic colonies in vitro (Bradley et al., Aust. Exp Biol. Sci. 44:287-300, 1966), Pluznik et al., J. Cell Comp. Physio 66:319-324, 1965).
Methods
Approximately 30 mL of fresh, normal, healthy bone marrow aspirate are obtained from individuals following informed consent. Under sterile conditions samples are diluted 1:5 with a 1ΓPBS (#14040.059 Life Technologies, Gaithersburg, Md.) solution in a 50 mL conical tube (#25339-50 Corning, Corning Md.). Ficoll (Histopaque 1077 Sigma H-8889) is layered under the diluted sample and centrifuged, 300Γg for 30 min. The mononuclear cell band is removed and washed two times in 1ΓPBS and once with 1% BSA PBS (CellPro Co., Bothel, Wash.). Mononuclear cells are counted and CD34+ cells are selected using the Ceprate LC (CD34) Kit (CellPro Co., Bothel, Wash.) column. This fractionation is performed since all stem and progenitor cells within the bone marrow display CD34 surface antigen.
Cultures are set up in triplicate with a final volume of 1.0 mL in a 35Γ10 mm petri dish (Nunc#174926). Culture medium is purchased from Terry Fox Labs. (HCC-4230 medium (Terry Fox Labs, Vancouver, B.C., Canada) and erythropoietin (Amgen, Thousand Oaks, Calif.) is added to the culture media. 3,000-10,000 CD34+ cells are added per dish. Recombinant IL-3, purified from mammalian cells or E. coli, and multi-functional chimeric hematopoietic receptor agonist proteins, in conditioned media from transfected mammalian cells or purified from conditioned media from transfected mammalian cells or E. coli, are added to give final concentrations ranging from 0.001 nM to 10 nM. Recombinant hIL-3, GM-CSF, c-mpl ligand and multi-functional chimeric hematopoietic receptor agonist are supplied in house. G-CSF (Neupogen) is from Amgen (Thousand Oaks Calf.). Cultures are resuspended using a 3 cc syringe and 1.0 mL is dispensed per dish. Control (baseline response) cultures received no colony stimulating factors. Positive control cultures received conditioned media (PHA stimulated human cells: Terry Fox Lab. H2400). Cultures are incubated at 37Β° C., 5% CO2 in humidified air.
Hematopoietic colonies which are defined as greater than 50 cells are counted on the day of peak response (days 10-11) using a Nikon inverted phase microscope with a 40Γ objective combination. Groups of cells containing fewer than 50 cells are referred to as clusters. Alternatively colonies can be identified by spreading the colonies on a slide and stained or they can be picked, resuspended and spun onto cytospin slides for staining.
Human Cord Blood Hemopoietic Growth Factor Assays
Bone marrow cells are traditionally used for in vitro assays of hematopoietic colony stimulating factor (CSF) activity. However, human bone marrow is not always available, and there is considerable variability between donors. Umbilical cord blood is comparable to bone marrow as a source of hematopoietic stem cells and progenitors (Broxmeyer et al., PNAS USA 89:4109-113, 1992; Mayani et al., Blood 81:3252-3258, 1993). In contrast to bone marrow, cord blood is more readily available on a regular basis. There is also a potential to reduce assay variability by pooling cells obtained fresh from several donors, or to create a bank of cryopreserved cells for this purpose. By modifying the culture conditions, and/or analyzing for lineage specific markers, it is be possible to assay specifically for granulocyte/macrophage colonies (CFU-GM), for megakaryocyte CSF activity, or for high proliferative potential colony forming cell (HPP-CFC) activity.
Methods
Mononuclear cells (MNC) are isolated from cord blood within 24 hr. of collection, using a standard density gradient (1.077 g/mL Histopaque). Cord blood MNC have been further enriched for stem cells and progenitors by several procedures, including immunomagnetic selection for CD14β, CD34+ cells; panning for SBAβ, CD34+ fraction using coated flasks from Applied Immune Science (Santa Clara, Calif.); and CD34+ selection using a CellPro (Bothell, Wash.) avidin column. Either freshly isolated or cryopreserved CD34+ cell enriched fractions are used for the assay. Duplicate cultures for each serial dilution of sample (concentration range from 1 pM to 1204 pM) are prepared with 1Γ104 cells in 1 ml of 0.9% methylcellulose containing medium without additional growth factors (Methocult H4230 from Stem Cell Technologies, Vancouver, BC.). In some experiments, Methocult H4330 containing erythropoietin (EPO) was used instead of Methocult H4230, or Stem Cell Factor (SCF), 50 ng/mL (Biosource International, Camarillo, Calif.) was added. After culturing for 7-9 days, colonies containing >30 cells are counted. In order to rule out subjective bias in scoring, assays are scored blind.
Additional details about recombinant DNA methods which may be used to create the variants, express them in bacteria, mammalian cells or insect cells, purification and refold of the desired proteins and assays for determining the bioactvity of the proteins may be found in co-filed Applications WO 95/00646, WO 94/12639, WO 94/12638, WO 95/20976, WO 95/21197, WO 95/20977, WO 95/21254 and U.S. Ser. No. 08/383,035 which are hereby incorporated by reference in their entirety.
Further details known to those skilled in the art may be found in T. Maniatis, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, 1982) and references cited therein, incorporated herein by reference; and in J. Sambrook, et al., Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory, 1989) and references cited therein, incorporated herein by reference.
| LENGTHY TABLE REFERENCED HERE |
| US20070081979A1-20070412-T00001 |
| Please refer to the end of the specification for access instructions. |
| LENGTHY TABLE REFERENCED HERE |
| US20070081979A1-20070412-T00002 |
| Please refer to the end of the specification for access instructions. |
| LENGTHY TABLE REFERENCED HERE |
| US20070081979A1-20070412-T00003 |
| Please refer to the end of the specification for access instructions. |
The following examples will illustrate the invention in greater detail although it will be understood that the invention is not limited to these specific examples.
EXAMPLE 1Construction of Parental BHK Expression Vector
A. Removal of AflIII Site from Mammalian Expression Plasmid.
A new mammalian expression vector was constructed to accept NcoI-HindIII or AflIII-HindIII gene fragments in-frame and 3β² to the hIL-3 receptor agonist pMON13146 (WO 94/12638) gene and a mouse IgG2b linker fragment. First, the single AflIII site was removed from pMON3934, which is a derivative of pMON3359. pMON3359 is a pUC18-based vector containing a mammalian expression cassette. The cassette includes a herpes simplex viral promoter IE110 (β800 to +120) followed by a modified human IL-3 signal peptide sequence and an SV40 late poly-adenylation (poly-A) signal which has been subcloned into the pUC18 polylinker (See Hippenmeyer et al., Bio/Technology, 1993, pp. 1037-1041). The modified human IL-3 signal sequence, which facilitates secretion of gene products outside of the cell, is flanked by a BamHI site on the 5β² end and a unique NcoI site on the 3β² end. A unique HindIII site is 3β² to the NcoI site and 5β² to the poly-A sequence. The DNA sequence encoding the signal peptide is shown below (restriction enzyme sites are indicated above). The ATG (methionine) codon within the NcoI site is in-frame with the initiator ATG of the signal peptide (underlined);
| (SEQ ID NO:857) |
| BamHI | |
| 5β²βGGATCCACCATGAGCCGCCTGCCCGTCCTGCTCCTGCTCCAACTCCT | |
| ββββββββββββNcoI | |
| GGTCCGCCCCGCCATGG |
The NcoI-HindIII fragment (ca. 425 bp) from pMON30245 was ligated to the NcoI-HindIII fragment (ca. 3800 bp) of the pMON30275. pMON30245 (WO 94/12638) contains the gene coding for hIL-3 receptor agonist pMON13416 joined to a mouse IgG2b hinge fragment. Immediately 3β² to the IgG2b hinge and 5β² to the HindIII site is an AflIII site. Genes can be cloned into the AflIII-HindIII sites as NcoI-HindIII or AflIII-HindIII fragments in frame with the hIL-3 variant pMON13416/IgG2b hinge to create novel chimeras. The NcoI site and the AflIII site have compatible overhangs and will ligate but both recognition sites are lost. The plasmid, pMON30304 containing the DNA sequence of (SEQ ID NO:1), coding for hIL-3 variant pMON13416 joined with a mouse IgG2b hinge region, was a result of this cloning.
EXAMPLE 2Construction of an Intermediate Plasmid Containing One Copy of the c-mpl Ligand (1-153) Gene of the Dimer Template
In order to generate a plasmid DNA with the coding sequence of c-mpl (1-153) ligand followed by a unique EcoRI restriction site, the gene is isolated via reverse transcriptase/polymerase chain reaction (RT/PCR). Human fetal (lot #38130) and adult liver (lot #46018) A+ RNA are obtained from Clontech (Palo Alto, Calif.) for source of c-mpl ligand messenger RNA (mRNA). The first strand cDNA reactions are carried out using a cDNA Cycleβ’ Kit obtained from Invitrogen (San Diego, Calif.). In the RT reaction, random primers and oligo dT primer are used to generate cDNA from a combination of human and fetal liver mRNA. For amplification of c-mpl ligand gene fragment encoding amino acids 1-153, the RT product serves as the template for PCR with a combination of the primers, Forward primer: c-mplNcoI (SEQ ID NO:317) and Reverse primer: Ecompl. The c-mplNcoI primer anneals to the c-mpl ligand gene (bases #279-311 based on c-mpl ligand sequence from Gene bank accession #L33410 or de Sauvage et al., Nature 369: 533-538 (1994)) and encodes a NcoI restriction enzyme site immediately 5β² to the first codon (Ser+1) of c-mpl ligand. The NcoI restriction enzyme site codes for methionine and alanine codons prior to Ser+1 and includes codon degeneracy for the Ala codon and the first four codons (Ser, Pro, Ala, & Pro) of c-mpl ligand. The Ecompl primer anneals to bases #720-737 of c-mpl ligand and encodes an EcoRI site (GAATTC) in-frame with the c-mpl ligand gene immediately following Arg-153. The EcoRI site creates Glu and Phe codons following Arg-153. The ca. 480 bp PCR product was purified, digested with NcoI and EcoRI and ligated to the NcoI-EcoRI vector fragment of pMON3993 (ca. 4550 bp.). pMON3993 was a derivative of pMON3359 (described in Example 1). The human IL-3 signal peptide sequence, which had been subcloned as a BamHI fragment into the unique BamHI site between the IE110 promoter and poly-A signal, contains an NcoI site at its 3β² end and is followed by a unique EcoRI site. The plasmid, pMON26458 containing the DNA sequence of (SEQ ID NO:2), coding for c-mpl ligand amino acids 1-153 (SEQ ID NO:467), was the result of this cloning.
EXAMPLE 3Construction of the Parental Plasmids Containing the Second Genes of the Dimer Templates
For amplification of c-mpl ligand gene fragments starting at amino acid 1 (Ser) with a termination codon following amino acid 153 (Arg), the RT reaction from Example 2 serves as the template for PCR with a combination of the following primers; c-mplNcoI (SEQ ID NO:317) (forward primer) and c-mplHindIII (SEQ ID NO:319) (reverse primer). The c-mplNcoI (SEQ ID NO:317) primer is described in Example 2. The c-mplHindIII (SEQ ID NO:319) primer, which anneals to bases #716-737 of c-mpl ligand, adds both a termination codon and a HindIII restriction enzyme site immediately following the final codon, Arg153.
Two types of PCR products are generated from the RT cDNA samples, one with a deletion of the codons for amino acids 112-115 and one without the deletion of these codons. The c-mpl ligand PCR products (ca. 480 bp) are digested with NcoI and HindIII restriction enzymes for transfer to a mammalian expression vector, pMON3934. pMON3934 is digested with NcoI and HindIII (ca. 3800 bp) and will accept the PCR products.
Plasmid, pMON32132 (SEQ ID NO:84), coding for c-mpl ligand amino acids 1-153 (SEQ ID NO:546) was a result of this cloning. Plasmid, pMON32134 (SEQ ID NO:86), coding for c-mpl ligand amino acids 1-153 (SEQ ID NO:548) was a result of this cloning. Plasmid, pMON32133 (SEQ ID NO:85), coding for c-mpl ligand amino acids 1-153 with a deletion of codons 112-115 (Ξ112-115) (SEQ ID NO:547) was also a result of this cloning.
EXAMPLE 4Generation of PCR Dimer Template 5L with a β112-115 Deletion in the Second c-mpl Ligand Gene
A PCR template for generating novel forms of c-mpl ligand is constructed by ligating the 3.7 Kbp BstXI/EcoRI fragment of pMON26458 to the 1 Kbp NcoI/BstXI fragment from pMON32133 (containing a deletion of amino acids 112-115) along with the EcoRI/AflIII 5L synthetic oligonucleotide linker 5L-5β² (SEQ ID NO:322) and 5L-3β² (SEQ ID NO:323).
The EcoRI end of the linker will ligate to the EcoRI end of pMON26458. The AflIII end of the linker will ligate to the NcoI site of pMON32133, and neither restriction site will be retained upon ligation. The BstXI sites of pMON26458 and pMON32133 will ligate as well. Plasmid, pMON28548, is a result of the cloning and contains the DNA sequence of (SEQ ID NO:3) which encodes amino acids 1-153 c-mpl ligand fused via a GluPheGlyGlyAsnMet (SEQ ID NO:783) linker to amino acids 1-153 c-mpl ligand that contains a deletion of amino acids 112-115 (SEQ ID NO:468).
EXAMPLE 5Generation of PCR Dimer Template 4L
A PCR template for generating novel forms of c-mpl ligand is constructed by ligating the 3.7 Kbp BstXI/EcoRI fragment of pMON26458 to the 1 Kbp NcoI/BstXI fragment from pMON32132 along with the EcoRI/AflIII 4L synthetic oligonucleotide linker 4L-5β² (SEQ ID NO:320) and 4L-3β² (SEQ ID NO:321).
The EcoRI end of the linker will ligate to the EcoRI end of pMON26458. The AflIII end of the linker will ligate to the NcoI site of pMON32132, and neither restriction site will be retained upon ligation. The BstXI sites of pMON26458 and pMON32132 will ligate as well. The plasmid, pMON28500, is a result of the cloning and contains the DNA sequence of (SEQ ID NO:4) which encodes amino acids 1-153 c-mpl ligand fused via a GluPheGlyAsnMetAla (SEQ ID NO:223) linker (4L) to amino acids 1-153 c-mpl ligand (SEQ ID NO:469).
EXAMPLE 6Generation of PCR Dimer Template 5L
A PCR template for generating novel forms of c-mpl ligand is constructed by ligating the 3.7 Kbp BstXI/EcoRI fragment of pMON26458 to the 1 Kbp NcoI/BstXI fragment from pMON32132 along with the EcoRI/AflIII 5L synthetic oligonucleotide linker 5L-5β² (SEQ ID NO:322) and 5L-3β² (SEQ ID NO:323).
The EcoRI end of the linker will ligate to the EcoRI end of pMON26458. The AflIII end of the linker will ligate to the NcoI site of pMON32132, and neither restriction site will be retained upon ligation. The BstXI sites of pMON26458 and pMON32132 will ligate as well. Plasmid, pMON28501 is a result of the cloning and contains the DNA sequence of (SEQ ID NO:4) which encodes amino acids 1-153 c-mpl ligand fused via a GluPheGlyGlyAsnMet (SEQ ID NO:783) linker (5L) to amino acids 1-153 c-mpl ligand (SEQ ID NO:470).
EXAMPLE 7Generation of PCR Dimer Templates 8L
A PCR template for generating novel forms of c-mpl ligand is constructed by ligating the 3.7 Kbp BstXI/EcoRI fragment of pMON26458 to the 1 Kbp NcoI/BstXI fragment from pMON32134 along with the EcoRI/AflIII 8L synthetic oligonucleotide linker 8L-5β² (SEQ ID NO:324) and 8L-3β² (SEQ ID NO:325).
The EcoRI end of the linker will ligate to the EcoRI end of pMON26458. The AflIII end of the linker will ligate to the NcoI site of pMON32134, and neither restriction site will be retained upon ligation. The BstXI sites of pMON26458 and pMON32134 will ligate as well. Plasmid, pMON28502 is a result of the cloning which contains the DNA sequence of (SEQ ID NO:6) and encodes amino acids 1-153 c-mpl ligand fused via a GluPheGlyGlyAsnGlyGlyAsnMetAla (SEQ ID NO:224) linker (8L) to amino acids 1-153 c-mpl ligand (SEQ ID NO:471).
EXAMPLES 8-44Generation of Novel c-mpl Ligand Genes with New N-Terminus and C-Terminus
A. PCR Generation of Genes Encoding Novel c-mpl Ligand Receptor Agonists.
Genes encoding novel c-mpl ligand receptor agonists were generated using Method III (Horlick et al., Prot. Eng. 5:427-433, 1992). The PCR reactions were carried out using dimer templates, pMONs 28500, 28501, 28502 or 28548 and one of the sets of synthetic primer sets below (The first number refers to the position of the first amino acid in the original sequence. For example, the 31-5β² and 31-3β² refers to the 5β² and 3β² oligo primers, receptively, for the sequence beginning at the codon corresponding to residue 31 of the original sequence.).
31-5β² (SEQ ID NO:326) and 31-3β² (SEQ ID NO:327), 35-5β² (SEQ ID NO:328) and 35-3β² (SEQ ID NO:329), 39-5β² (SEQ ID NO:330) and 39-3β² (SEQ ID NO:331), 43-5β² (SEQ ID NO:332) and 43-3β² (SEQ ID NO:333), 45-5β² (SEQ ID NO:334) and 45-3β² (SEQ ID NO:335), 49-5β² (SEQ ID NO:336) and 49-3β² (SEQ ID NO:337), 82-5β² (SEQ ID NO:338) and 82-3β² (SEQ ID NO:339), 109-5β² (SEQ ID NO:340) and 109-3β² (SEQ ID NO:341), 115-5β² (SEQ ID NO:342) and 115-3β² (SEQ ID NO:343), 120-5β² (SEQ ID NO:344) and 120-3β² (SEQ ID NO:345), 123-5β² (SEQ ID NO:346) and 123-3β² (SEQ ID NO:347), 126-5β² (SEQ ID NO:348) and 126-3β² (SEQ ID NO:349). The templates and oligonucleotide sets used in the PCR reactions are shown in Table 4. The products that were generated were about 480 bp and were purified via Magic PCR Clean up kits (Promega).
B. Subcloning of Novel c-mpl Receptor Agonist Gene Products into Mammalian Expression Vector for Generation of Chimeras.
The c-mpl receptor agonist gene PCR products were digested with NcoI and HindIII or AflIII and HindIII restriction enzymes (ca. 470 bp) for transfer to a mammalian expression vector. The expression vector, pMON30304, was digested with NcoI and HindIII (ca. 4200 bp) and accepts the PCR products as NcoI-HindIII or AflIII-HindIII fragments. The restriction digest of the PCR product and the resulting plasmids are shown in Table 4.
| TABLE 4 | ||||||
| PCR | ||||||
| Product | PCR Product | Resulting | Breakpoint | |||
| PCR | Primer | Restriction | Plasmid | in c-mpl | ||
| Example # | template | set | Digest | Linker | pMON | ligand |
| Example 8 | pMON28501 | 31 | NcoI/HindIII | 5L | 28505 | 30-31 |
| Example 9 | pMON28501 | 35 | AflIII/HindIII | 5L | 28506 | 34-35 |
| Example | pMON28501 | 39 | NcoI/HindIII | 5L | 28507 | 38-39 |
| 10 | ||||||
| Example | pMON28501 | 43 | NcoI/HindIII | 5L | 28508 | 42-43 |
| 11 | ||||||
| Example | pMON28501 | 45 | NcoI/HindIII | 5L | 28509 | 44-45 |
| 12 | ||||||
| Example | pMON28501 | 49 | NcoI/HindIII | 5L | 28510 | 48-49 |
| 13 | ||||||
| Example | pMON28501 | 82 | NcoI/HindIII | 5L | 28511 | 81-82 |
| 14 | ||||||
| Example | pMON28501 | 109 | NcoI/HindIII | 5L | 28512 | 108-109 |
| 15 | ||||||
| Example | pMON28501 | 116 | NcoI/HindIII | 5L | 28513 | 115-116 |
| 16 | ||||||
| Example | pMON28501 | 120 | NcoI/HindIII | 5L | 28514 | 119-120 |
| 17 | ||||||
| Example | pMON28501 | 123 | NcoI/HindIII | 5L | 28515 | 122-123 |
| 18 | ||||||
| Example | pMON28501 | 126 | NcoI/HindIII | 5L | 28516 | 125-126 |
| 19 | ||||||
| Example | pMON28500 | 31 | NcoI/HindIII | 4L | 28519 | 30-31 |
| 20 | ||||||
| Example | pMON28500 | 35 | AflIII/HindIII | 4L | 28520 | 34-35 |
| 21 | ||||||
| Example | pMON28500 | 39 | NcoI/HindIII | 4L | 28521 | 38-39 |
| 22 | ||||||
| Example | pMON28500 | 43 | NcoI/HindIII | 4L | 28522 | 42-43 |
| 23 | ||||||
| Example | pMON28500 | 45 | NcoI/HindIII | 4L | 28523 | 44-45 |
| 24 | ||||||
| Example | pMON28500 | 49 | NcoI/HindIII | 4L | 28524 | 48-49 |
| 25 | ||||||
| Example | pMON28500 | 82 | NcoI/HindIII | 4L | 28525 | 81-82 |
| 26 | ||||||
| Example | pMON28500 | 109 | NcoI/HindIII | 4L | 28526 | 108-109 |
| 27 | ||||||
| Example | pMON28500 | 116 | NcoI/HindIII | 4L | 28527 | 115-116 |
| 28 | ||||||
| Example | pMON28500 | 120 | NcoI/HindIII | 4L | 28528 | 119-120 |
| 29 | ||||||
| Example | pMON28500 | 123 | NcoI/HindIII | 4L | 28529 | 122-123 |
| 30 | ||||||
| Example | pMON28500 | 126 | NcoI/HindIII | 4L | 28530 | 125-126 |
| 31 | ||||||
| Example | pMON28502 | 31 | NcoI/HindIII | 8L | 28533 | 30-31 |
| 32 | ||||||
| Example | pMON28502 | 35 | AflIII/HindIII | 8L | 28534 | 34-35 |
| 33 | ||||||
| Example | pMON28502 | 39 | NcoI/HindIII | 8L | 28535 | 38-39 |
| 34 | ||||||
| Example | pMON28502 | 43 | NcoI/HindIII | 8L | 28536 | 42-43 |
| 35 | ||||||
| Example | pMON28502 | 45 | NcoI/HindIII | 8L | 28537 | 44-45 |
| 36 | ||||||
| Example | pMON28502 | 49 | NcoI/HindIII | 8L | 28538 | 48-49 |
| 37 | ||||||
| Example | pMON28502 | 82 | NcoI/HindIII | 8L | 28539 | 81-82 |
| 38 | ||||||
| Example | pMON28502 | 109 | NcoI/HindIII | 8L | 28540 | 108-109 |
| 39 | ||||||
| Example | pMON28502 | 116 | NcoI/HindIII | 8L | 28541 | 115-116 |
| 40 | ||||||
| Example | pMON28502 | 120 | NcoI/HindIII | 8L | 28542 | 119-120 |
| 41 | ||||||
| Example | pMON28502 | 123 | NcoI/HindIII | 8L | 28543 | 122-123 |
| 42 | ||||||
| Example | pMON28502 | 126 | NcoI/HindIII | 8L | 28544 | 125-126 |
| 43 | ||||||
| Example | pMON28548 | 123 | NcoI/HindIII | 5L | 28545 | 122-123 |
| 44 | ||||||
Construction of pMON15960
Construction of pMON15960, an intermediate plasmid used for constructing plasmids containing DNA sequences encoding G-CSF Ser17 with a new N-terminus and C-terminus. Plasmid pACYC177 (Chang, A. C. Y. and Cohen, S. N. J. Bacteriol. 134:1141-1156, 1978) DNA was digested with restriction enzymes HindIII and BamHI, resulting in a 3092 base pair HindIII, BamHI fragment. Plasmid, pMON13037 (WO 95/21254), DNA was digested with BglII and FspI, resulting in a 616 base pair BglII, FspI fragment. A second sample of plasmid, pMON13037, DNA was digested with NcoI and HindIII, resulting in a 556 base pair NcoI, HindIII fragment. The synthetic DNA oligonucleotides 1GGGSfor (SEQ ID NO:380) and 1GGGSrev (SEQ ID NO:381) were annealed to each other, and then digested with AflIII and FspI, resulting in a 21 base pair AflIII, FspI fragment. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and analyzed by restriction analysis to confirm the correct insert.
EXAMPLE 46Construction of pMON15981
Construction of pMON15981, a plasmid containing DNA sequences encoding a multi-functional hematopoietic receptor agonist. Plasmid, pMON15960, DNA was digested with restriction enzyme SmaI and used as template in a PCR reaction using synthetic DNA oligonucleotides 38 stop (SEQ ID NO:369) and 39 start (SEQ ID NO:368) as primers, resulting in the amplification of a DNA fragment of 576 base pairs. The amplified fragment was digested with restriction enzymes HindIII and NcoI, resulting in a HindIII, NcoI fragment of 558 base pairs. Plasmid, pMON13181, DNA was digested with HindIII and AflIII, resulting in a HindIII, AflIII fragment of 4068 base pairs. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis, and sequenced to confirm the correct insert. The plasmid, pMON15981, contains the DNA sequence of (SEQ ID NO:78) which encodes the following amino acid sequence:
| (SEQ ID NO:500) |
| Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile | |
| His His Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp | |
| Pro Asn Asn Leu Asn Asp Glu Asp Val Ser Ile Leu | |
| Met Asp Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser | |
| Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser | |
| Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys | |
| Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro | |
| Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg | |
| Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln | |
| Ala Gln Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly | |
| Ser Pro Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile | |
| Asn Pro Ser Pro Pro Ser Lys Glu Ser His Lys Ser | |
| Pro Asn Met Ala Tyr Lys Leu Cys His Pro Glu Glu | |
| Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp | |
| Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln | |
| Leu Ala Gly Cys Leu Ser Gln Leu His Ser Gly Leu | |
| Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly | |
| Ile Ser Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu | |
| Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp | |
| Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu | |
| Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser | |
| Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala | |
| Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg | |
| Val Leu Arg His Leu Ala Gln Pro Gly Gly Gly Ser | |
| Asp Met Ala Thr Pro Leu Gly Pro Ala Ser Ser Leu | |
| Pro Gln Ser Phe Leu Leu Lys Ser Leu Glu Gln Val | |
| Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu | |
| Lys Leu Cys Ala Thr |
Construction of pMON15982
Construction of pMON15982, a plasmid containing DNA sequences encoding a multi-functional hematopoietic receptor agonist. Plasmid, pMON15960, DNA was digested with restriction enzyme SmaI and used as template in a PCR reaction using synthetic DNA oligonucleotides 96 stop (SEQ ID NO:371) and 97 start (SEQ ID NO:370) as primers, resulting in the amplification of a DNA fragment of 576 base pairs. The amplified fragment was digested with restriction enzymes HindIII and NcoI, resulting in a HindIII, NcoI fragment of 558 base pairs. Plasmid, pMON13181, DNA was digested with HindIII and AflIII, resulting in a HindIII, AflIII fragment of 4068 base pairs. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. Coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis, and sequenced to confirm the correct insert. The plasmid, pMON15982, contains the DNA sequence of (SEQ ID NO:79) which encodes the following amino acid sequence:
| (SEQ ID NO:501) |
| Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile | |
| His His Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp | |
| Pro Asn Asn Leu Asn Asp Glu Asp Val Ser Ile Leu | |
| Met Asp Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser | |
| Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser | |
| Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys | |
| Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro | |
| Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg | |
| Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln | |
| Ala Gln Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly | |
| Ser Pro Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile | |
| Asn Pro Ser Pro Pro Ser Lys Glu Ser His Lys Ser | |
| Pro Asn Met Ala Pro Glu Leu Gly Pro Thr Leu Asp | |
| Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr | |
| Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala Pro | |
| Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala Phe | |
| Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu | |
| Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser | |
| Tyr Arg Val Leu Arg His Leu Ala Gln Pro Gly Gly | |
| Gly Ser Asp Met Ala Thr Pro Leu Gly Pro Ala Ser | |
| Ser Leu Pro Gln Ser Phe Leu Leu Lys Ser Leu Glu | |
| Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu | |
| Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His | |
| Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly | |
| Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln | |
| Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His | |
| Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala | |
| Leu Glu Gly Ile Ser |
Construction of pMON15965
Construction of pMON15965, a plasmid containing DNA sequences encoding a multi-functional hematopoietic receptor agonist. Plasmid, pMON15960, DNA was digested with restriction enzyme SmaI and used as template in a PCR reaction using synthetic DNA oligonucleotides 142 stop (SEQ ID NO:377) and 141 start (SEQ ID NO:376) as primers, resulting in the amplification of a DNA fragment of 576 base pairs. The amplified fragment was digested with restriction enzymes HindIII and NcoI, resulting in a HindIII, NcoI fragment of 558 base pairs. Plasmid, pMON13181, DNA was digested with HindIII and AflIII, resulting in a HindIII, AflIII fragment of 4068 base pairs. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis, and sequenced to confirm the correct insert. The plasmid, pMON15965, contains the DNA sequence of (SEQ ID NO:80) which encodes the following amino acid sequence:
| (SEQ ID NO:502) |
| Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile | |
| His His Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp | |
| Pro Asn Asn Leu Asn Asp Glu Asp Val Ser Ile Leu | |
| Met Asp Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser | |
| Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser | |
| Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys | |
| Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro | |
| Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg | |
| Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln | |
| Ala Gln Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly | |
| Ser Pro Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile | |
| Asn Pro Ser Pro Pro Ser Lys Glu Ser His Lys Ser | |
| Pro Asn Met Ala Ser Ala Phe Gln Arg Arg Ala Gly | |
| Gly Val Leu Val Ala Ser His Leu Gln Ser Phe Leu | |
| Glu Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln | |
| Pro Gly Gly Gly Ser Asp Met Ala Thr Pro Leu Gly | |
| Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu Lys | |
| Ser Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly | |
| Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys | |
| Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His | |
| Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys | |
| Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser | |
| Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly Leu | |
| Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu Gly | |
| Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp | |
| Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu | |
| Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala | |
| Met Pro Ala Phe Ala |
Construction of pMON15966
Construction of pMON15966, a plasmid containing DNA sequences encoding a multi-functional hematopoietic receptor agonist. Plasmid, pMON15960, DNA was digested with restriction enzyme SmaI and used as template in a PCR reaction using synthetic DNA oligonucleotides 126 stop (SEQ ID NO:372) and 125 start (SEQ ID NO:373) as primers, resulting in the amplification of a DNA fragment of 576 base pairs. The amplified fragment was digested with restriction enzymes HindIII and NcoI, resulting in a HindIII, NcoI fragment of 558 base pairs. Plasmid, pMON13181, DNA was digested with HindIII and AflIII, resulting in a HindIII, AflIII fragment of 4068 base pairs. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis, and sequenced to confirm the correct insert. The plasmid, pMON15966, contains the DNA sequence of (SEQ ID NO:81) which encodes the following amino acid sequence:
| (SEQ ID NO:503) |
| Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile | |
| His His Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp | |
| Pro Asn Asn Leu Asn Asp Glu Asp Val Ser Ile Leu | |
| Met Asp Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser | |
| Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser | |
| Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys | |
| Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro | |
| Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg | |
| Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln | |
| Ala Gln Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly | |
| Ser Pro Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile | |
| Asn Pro Ser Pro Pro Ser Lys Glu Ser His Lys Ser | |
| Pro Asn Met Ala Met Ala Pro Ala Leu Gln Pro Thr | |
| Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln | |
| Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu | |
| Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg | |
| His Leu Ala Gln Pro Gly Gly Gly Ser Asp Met Ala | |
| Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser | |
| Phe Leu Leu Lys Ser Leu Glu Gln Val Arg Lys Ile | |
| Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys | |
| Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val | |
| Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro | |
| Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala | |
| Gly Cys Leu Ser Gln Leu His Ser Gly Leu Phe Leu | |
| Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser | |
| Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu | |
| Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln | |
| Met Glu Glu Leu Gly |
Construction of pMON15967
Construction of pMON15967, a plasmid containing DNA sequences encoding a multi-functional hematopoietic receptor agonist. Plasmid, pMON15960, DNA was digested with restriction enzyme SmaI and used as template in a PCR reaction using synthetic DNA oligonucleotides 132 stop (SEQ ID NO:375) and 133 start (SEQ ID NO:374) as primers, resulting in the amplification of a DNA fragment of 576 base pairs. The amplified fragment was digested with restriction enzymes HindIII and NcoI, resulting in a HindIII, NcoI fragment of 558 base pairs. Plasmid, pMON13181, DNA was digested with HindIII and AflIII, resulting in a HindIII, AflIII fragment of 4068 base pairs. The restriction fragments were ligated, and the ligation reaction mixture was used to transform E. Coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis, and sequenced to confirm the correct insert. The plasmid, pMON15967, contains the DNA sequence of (SEQ ID NO: 82) which encodes the following amino acid sequence:
| SEQ ID NO:504 |
| Met Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile | |
| His His Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp | |
| Pro Asn Asn Leu Asn Asp Glu Asp Val Ser Ile Leu | |
| Met Asp Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser | |
| Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser | |
| Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys | |
| Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro | |
| Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg | |
| Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln | |
| Ala Gln Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly | |
| Ser Pro Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile | |
| Asn Pro Ser Pro Pro Ser Lys Glu Ser His Lys Ser | |
| Pro Asn Met Ala Thr Gln Gly Ala Met Pro Ala Phe | |
| Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu | |
| Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser | |
| Tyr Arg Val Leu Arg His Leu Ala Gln Pro Gly Gly | |
| Gly Ser Asp Met Ala Thr Pro Leu Gly Pro Ala Ser | |
| Ser Leu Pro Gln Ser Phe Leu Leu Lys Ser Leu Glu | |
| Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu | |
| Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His | |
| Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly | |
| Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln | |
| Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His | |
| Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala | |
| Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu | |
| Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr | |
| Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala | |
| Pro Ala Leu Gln Pro |
Construction of pMON13180, an Intermediate Plasmid Used for Constructing Plasmids that Contain DNA Sequence Encoding Multi-Functional Hematopoietic Receptor Agonists.
Plasmid, pMON13046 (WO 95/21254), DNA was digested with restriction endonucleases XmaI and SnaBI, resulting in a 4018 base pair vector fragment. The 4018 base pair XmaI-SnaBI fragment was purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.) in which the 25 base pair XmaI-SnaBI insert fragment is not retained. The complimentary pair of synthetic oligonucleotides, glyxa1 (SEQ ID NO:378) and glyxa2 (SEQ ID NO:379), were designed to remove sequence encoding a factor Xa cleavage site. When properly assembled these oligonucleotides also result in XmaI and SnaBI ends. The primers, Glyxa1 and glyxa2, were annealed in annealing buffer (20 mM Tris-HCl pH7.5, 10 mM MgCl2, 50 mM NaCl) by heating at 70Β° C. for ten minutes and allowed to slow cool. The 4018 base pair XmaI-SnaBI fragment from pMON13046 was ligated with the assembled oligonucleotides using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated from the transformants and analyzed using a PCR based assay. Plasmid DNA from selected transformants was sequenced to confirm the correct insertion of the oligonucleotides. The resulting plasmid was designated pMON13180 (SEQ ID NO:88).
EXAMPLE 52Construction of pMON13181, an Intermediate Plasmid Used for Constructing Plasmids that Contain DNA Sequences Encoding Multi-Functional Hematopoietic Receptor Agonists.
Plasmid, pMON13047 (WO 95/21254), DNA was digested with restriction endonucleases XmaI and SnaBI, resulting in a 4063 base pair vector fragment. The 4063 base pair XmaI-SnaBI fragment was purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.) in which the 25 base pair XmaI-SnaBI insert fragment is not retained. The complimentary pair of synthetic oligonucleotides, glyxa1 (SEQ ID NO:378) and glyxa2 (SEQ ID NO:379), were designed to remove sequence encoding the factor Xa cleavage site. When properly assembled these oligonucleotides also result in XmaI and SnaBI ends. Glyxa1 and glyxa2 were annealed in annealing buffer by heating at 70Β° C. for ten minutes and allowed to slow cool. The 4063 base pair XmaI-SnaBI fragment from pMON13047 was ligated with the assembled oligonucleotides using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated from the transformants and analyzed using a PCR based assay. Plasmid DNA from selected transformants was sequenced to confirm the correct insertion of the oligonucleotides. The resulting plasmid was designated pMON13181 (SEQ ID NO:87).
EXAMPLE 53Construction of pMON13182
The new N-terminus/C-terminus gene in pMON13182 was created using Method I as described in Materials and Methods. Fragment Start was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 39 start (SEQ ID NO:368) and L-11 start (SEQ ID NO:364). Fragment Stop was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 38 stop (SEQ ID NO:369) and L-11 stop (SEQ ID NO:365). The full-length new N terminus/C-terminus G-CSF Ser17 gene was created and amplified from the annealed Fragments Start and Stop using primers 39 start and 38 stop.
The resulting DNA fragment which contains the new gene was digested with restriction endonucleases NcoI and HindIII and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The intermediate plasmid, pMON13180, was digested with restriction endonucleases HindIII and AflIII, resulting in a 4023 base pair vector fragment, and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insert. The resulting plasmid was designated pMON13182.
E. coli strain JM101 was transformed with pMON13182 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON13182, contains the DNA sequence of (SEQ ID NO:17) which encodes the following amino acid sequence:
| (SEQ ID NO:472) |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile | |
| Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro | |
| Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile | |
| Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys | |
| Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln | |
| Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Gly Gly Ser Gly Gly Gly Ser Asn Met Ala Tyr | |
| Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly | |
| His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser | |
| Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu | |
| Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly | |
| Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu | |
| Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala | |
| Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu | |
| Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly | |
| Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg | |
| Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser | |
| Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu | |
| Ala Gln Pro Ser Gly Gly Ser Gly Gly Ser Gln Ser | |
| Phe Leu Leu Lys Ser Leu Glu Gln Val Arg Lys Ile | |
| Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys | |
| Ala Thr |
Construction of pMON13183
The new N-terminus/C-terminus gene in pMON13183 was created using Method I as described in Materials and Methods. βFragment Startβ was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 39 start (SEQ ID NO:368) and L-11 start (SEQ ID NO:364). Fragment Stop was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 38 stop (SEQ ID NO:369) and L-11 stop (SEQ ID NO:365). The full-length new N terminus/C-terminus G-CSF Ser17 gene was created and amplified from the annealed Fragments Start and Stop using 39 start and 38 stop.
The resulting DNA fragment which contains the new gene was digested with restriction endonucleases NcoI and HindIII and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The intermediate plasmid, pMON13181, was digested with restriction endonucleases HindIII and AflIII, resulting in a 4068 base pair vector fragment, and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insert. The resulting plasmid was designated pMON13183.
E. coli strain JM101 was transformed with pMON13183 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON13183, contains the DNA sequence of (SEQ ID NO:18) which encodes the following amino acid sequence:
| (SEQ ID NO:473) |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile | |
| Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro | |
| Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile | |
| Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys | |
| Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln | |
| Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile Asn Pro | |
| Ser Pro Pro Ser Lys Glu Ser His Lys Ser Pro Asn | |
| Met Ala Tyr Lys Leu Cys His Pro Glu Glu Leu Val | |
| Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro | |
| Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala | |
| Gly Cys Leu Ser Gln Leu His Ser Gly Leu Phe Leu | |
| Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser | |
| Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu | |
| Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln | |
| Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro | |
| Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe | |
| Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His | |
| Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu | |
| Arg His Leu Ala Gln Pro Ser Gly Gly Ser Gly Gly | |
| Ser Gln Ser Phe Leu Leu Lys Ser Leu Glu Gln Val | |
| Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu | |
| Lys Leu Cys Ala Thr |
Construction of pMON13184
The new N-terminus/C-terminus gene in pMON13184 was created using Method I as described in Materials and Methods. Fragment Start was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 97 start (SEQ ID NO:370) and L-11 start (SEQ ID NO:364). Fragment Stop was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 96 stop (SEQ ID NO:371) and L-11 stop (SEQ ID NO:365). The full-length new N terminus/C-terminus G-CSF Ser17 gene was created and amplified from the annealed Fragments Start and Stop using 97 start and 96 stop.
The resulting DNA fragment which contains the new gene was digested with restriction endonucleases NcoI and HindIII and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The intermediate plasmid, pMON13180, was digested with restriction endonucleases HindIII and AflIII, resulting in a 4023 base pair vector fragment, and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insert. The resulting plasmid was designated pMON13184.
E. coli strain JM101 was transformed with pMON13184 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON13184, contains the DNA sequence of (SEQ ID NO:19) which encodes the following amino acid sequence:
| (SEQ ID NO:474) |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile | |
| Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro | |
| Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile | |
| Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys | |
| Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln | |
| Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Gly Gly Ser Gly Gly Gly Ser Asn Met Ala Pro | |
| Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp | |
| Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met | |
| Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr | |
| Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln | |
| Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu | |
| Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg | |
| His Leu Ala Gln Pro Ser Gly Gly Ser Gly Gly Ser | |
| Gln Ser Phe Leu Leu Lys Ser Leu Glu Gln Val Arg | |
| Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys | |
| Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu | |
| Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp | |
| Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln | |
| Leu Ala Gly Cys Leu Ser Gln Leu His Ser Gly Leu | |
| Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly | |
| Ile Ser |
Construction of pMON13185
The new N-terminus/C-terminus gene in pMON13185 was created using Method I as described in Materials and Methods. Fragment Start was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 97 start (SEQ ID NO:370) and L-11 start (SEQ ID NO:364). Fragment Stop was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 96 stop (SEQ ID NO:371) and L-11 stop (SEQ ID NO:365). The full-length new N terminus/C-terminus G-CSF Ser17 gene was created and amplified from the annealed Fragments Start and Stop using 97 start and 96 stop.
The resulting DNA fragment which contains the new gene was digested with restriction endonucleases NcoI and HindIII and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The intermediate plasmid, pMON13181, was digested with restriction endonucleases HindIII and AflIII, resulting in a 4068 base pair vector fragment, and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insert. The resulting plasmid was designated pMON13185.
E. coli strain JM101 was transformed with pMON13185 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON13185, contains the DNA sequence of (SEQ ID NO:20) which encodes the following amino acid sequence:
| (SEQ ID NO:475) |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile | |
| Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro | |
| Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile | |
| Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys | |
| Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln | |
| Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile Asn Pro | |
| Ser Pro Pro Ser Lys Glu Ser His Lys Ser Pro Asn | |
| Met Ala Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu | |
| Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp | |
| Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu | |
| Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser | |
| Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala | |
| Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg | |
| Val Leu Arg His Leu Ala Gln Pro Ser Gly Gly Ser | |
| Gly Gly Ser Gln Ser Phe Leu Leu Lys Ser Leu Glu | |
| Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu | |
| Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His | |
| Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly | |
| Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln | |
| Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His | |
| Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala | |
| Leu Glu Gly Ile Ser |
Construction of pMON13186
The new N-terminus/C-terminus gene in pMON13186 was created using Method I as described in Materials and Methods. Fragment Start was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 126 start (SEQ ID NO:372) and L-11 start (SEQ ID NO:364). Fragment Stop was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 125 stop (SEQ ID NO:373) and L-11 stop (SEQ ID NO:365). The full-length new N terminus/C-terminus G-CSF Ser17 gene was created and amplified from the annealed Fragments Start and Stop using 126 start and 125 stop.
The resulting DNA fragment which contains the new gene was digested with restriction endonucleases NcoI and HindIII and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The intermediate plasmid, pMON13180, was digested with restriction endonucleases HindIII and AflIII, resulting in a 4023 base pair vector fragment, and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insert. The resulting plasmid was designated pMON13186.
E. coli strain JM101 was transformed with pMON13186 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON13186, contains the DNA sequence of (SEQ ID NO:21) which encodes the following amino acid sequence:
| (SEQ ID NO:476) |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile | |
| Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro | |
| Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile | |
| Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys | |
| Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln | |
| Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Gly Gly Ser Gly Gly Gly Ser Asn Met Ala Met | |
| Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro | |
| Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly | |
| Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu | |
| Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro | |
| Ser Gly Gly Ser Gly Gly Ser Gln Ser Phe Leu Leu | |
| Lys Ser Leu Glu Gln Val Arg Lys Ile Gln Gly Asp | |
| Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr | |
| Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly | |
| His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser | |
| Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu | |
| Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly | |
| Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu | |
| Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala | |
| Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu | |
| Leu Gly |
Construction of pMON13187
The new N-terminus/C-terminus gene in pMON13187 was created using Method I as described in Materials and Methods. Fragment Start was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 126 start (SEQ ID NO:372) and L-11 start (SEQ ID NO:364). Fragment Stop was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 125 stop (SEQ ID NO:373) and L-11 stop (SEQ ID NO:365). The full-length new N terminus/C-terminus G-CSF Ser17 gene was created and amplified from the annealed Fragments Start and Stop using 126 start and 125 stop.
The resulting DNA fragment which contains the new gene was digested with restriction endonucleases NcoI and HindIII and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The intermediate plasmid, pMON13181, was digested with restriction endonucleases HindIII and AflIII, resulting in a 4068 base pair vector fragment, and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insert. The resulting plasmid was designated pMON13187.
E. coli strain JM101 was transformed with pMON13187 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON13187, contains the DNA sequence of (SEQ ID NO:22) which encodes the following amino acid sequence:
| (SEQ ID NO:477) |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile | |
| Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro | |
| Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile | |
| Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys | |
| Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln | |
| Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile Asn Pro | |
| Ser Pro Pro Ser Lys Glu Ser His Lys Ser Pro Asn | |
| Met Ala Met Ala Pro Ala Leu Gln Pro Thr Gln Gly | |
| Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg | |
| Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser | |
| Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu | |
| Ala Gln Pro Ser Gly Gly Ser Gly Gly Ser Gln Ser | |
| Phe Leu Leu Lys Ser Leu Glu Gln Val Arg Lys Ile | |
| Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys | |
| Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val | |
| Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro | |
| Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala | |
| Gly Cys Leu Ser Gln Leu His Ser Gly Leu Phe Leu | |
| Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser | |
| Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu | |
| Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln | |
| Met Glu Glu Leu Gly |
Construction of pMON13188
The new N-terminus/C-terminus gene in pMON13188 was created using Method I as described in Materials and Methods. Fragment Start was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 133 start (SEQ ID NO:374) and L-11 start (SEQ ID NO:364). Fragment Stop was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 132 stop (SEQ ID NO:375) and L-11 stop (SEQ ID NO:365). The full-length new N terminus/C-terminus G-CSF Ser17 gene was created and amplified from the annealed Fragments Start and Stop using 133 start and 132 stop.
The resulting DNA fragment which contains the new gene was digested with restriction endonucleases NcoI and HindIII and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The intermediate plasmid, pMON13180, was digested with restriction endonucleases HindIII and AflIII, resulting in a 4023 base pair vector fragment, and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insert. The resulting plasmid was designated pMON13188.
E. coli strain JM101 was transformed with pMON13188 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON13188, contains the DNA sequence of (SEQ ID NO:23) which encodes the following amino acid sequence:
| (SEQ ID NO:478) |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile | |
| Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro | |
| Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile | |
| Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys | |
| Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln | |
| Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Gly Gly Ser Gly Gly Gly Ser Asn Met Ala Thr | |
| Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln | |
| Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu | |
| Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg | |
| His Leu Ala Gln Pro Ser Gly Gly Ser Gly Gly Ser | |
| Gln Ser Phe Leu Leu Lys Ser Leu Glu Gln Val Arg | |
| Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys | |
| Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu Glu | |
| Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp | |
| Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln | |
| Leu Ala Gly Cys Leu Ser Gln Leu His Ser Gly Leu | |
| Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly | |
| Ile Ser Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu | |
| Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp | |
| Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu | |
| Gln Pro |
Construction of pMON13189
The new N-terminus/C-terminus gene in pMON13189 was created using Method I as described in Materials and Methods. Fragment Start was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 133 start (SEQ ID NO:374) and L-11 start (SEQ ID NO:364). Fragment Stop was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 132 stop (SEQ ID NO:375) and L-11 stop (SEQ ID NO:365). The full-length new N terminus/C-terminus G-CSF Ser17 gene was created and amplified from the annealed Fragments Start and Stop using 133 start and 132 stop.
The resulting DNA fragment which contains the new gene was digested with restriction endonucleases NcoI and HindIII and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The intermediate plasmid, pMON13181, was digested with restriction endonucleases HindIII and AflIII, resulting in a 4068 base pair vector fragment, and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insert. The resulting plasmid was designated pMON13189.
E. coli strain JM101 was transformed with pMON13189 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON13189, contains the DNA sequence of (SEQ ID NO:24) which encodes the following amino acid sequence:
| (SEQ ID NO:479) |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile | |
| Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro | |
| Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile | |
| Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys | |
| Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln | |
| Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile Asn Pro | |
| Ser Pro Pro Ser Lys Glu Ser His Lys Ser Pro Asn | |
| Met Ala Thr Gln Gly Ala Met Pro Ala Phe Ala Ser | |
| Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala | |
| Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg | |
| Val Leu Arg His Leu Ala Gln Pro Ser Gly Gly Ser | |
| Gly Gly Ser Gln Ser Phe Leu Leu Lys Ser Leu Glu | |
| Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu | |
| Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His | |
| Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly | |
| Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln | |
| Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His | |
| Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala | |
| Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu | |
| Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr | |
| Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala | |
| Pro Ala Leu Gln Pro |
Construction of pMON13190
The new N-terminus/C-terminus gene in pMON13190 was created using Method I as described in Materials and Methods. Fragment Start was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 142 start (SEQ ID NO:376) and L-11 start (SEQ ID NO:364). Fragment Stop was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 141 stop (SEQ ID NO:377) and L-11 stop (SEQ ID NO:365). The full-length new N terminus/C-terminus G-CSF Ser17 gene was created and amplified from the annealed Fragments Start and Stop using 142 start and 141 stop.
The resulting DNA fragment which contains the new gene was digested with restriction endonucleases NcoI and HindIII and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The intermediate plasmid, pMON13180, was digested with restriction endonucleases HindIII and AflIII, resulting in a 4023 base pair vector fragment, and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insert. The resulting plasmid was designated pMON13190.
E. coli strain JM101 was transformed with pMON13190 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON13190, contains the DNA sequence of (SEQ ID NO:25) which encodes the following amino acid sequence:
| (SEQ ID NO:480) |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile | |
| Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro | |
| Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile | |
| Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys | |
| Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln | |
| Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Gly Gly Ser Gly Gly Gly Ser Asn Met Ala Ser | |
| Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala | |
| Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg | |
| Val Leu Arg His Leu Ala Gln Pro Ser Gly Gly Ser | |
| Gly Gly Ser Gln Ser Phe Leu Leu Lys Ser Leu Glu | |
| Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu | |
| Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His | |
| Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly | |
| Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln | |
| Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His | |
| Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala | |
| Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu | |
| Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr | |
| Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala | |
| Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro Ala | |
| Phe Ala |
Construction of pMON13191
The new N-terminus/C-terminus gene in pMON13191 was created using Method I as described in Materials and Methods. Fragment Start was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 142 start (SEQ ID NO:376) and L-11 start (SEQ ID NO:364). Fragment Stop was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 141 stop (SEQ ID NO:377) and L-11 stop (SEQ ID NO:365). The full-length new N terminus/C-terminus G-CSF Ser17 gene was created and amplified from the annealed Fragments Start and Stop using 142 start and 141 stop.
The resulting DNA fragment which contains the new gene was digested with restriction endonucleases NcoI and HindIII and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The intermediate plasmid, pMON13181, was digested with restriction endonucleases HindIII and AflIII, resulting in a 4068 base pair vector fragment, and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insert. The resulting plasmid was designated pMON13191.
E. coli strain JM101 was transformed with pMON13191 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON13191, contains the DNA sequence of (SEQ ID NO:26) which encodes the following amino acid sequence:
| (SEQ ID NO:481) |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile | |
| Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro | |
| Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile | |
| Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys | |
| Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln | |
| Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile Asn Pro | |
| Ser Pro Pro Ser Lys Glu Ser His Lys Ser Pro Asn | |
| Met Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val | |
| Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val | |
| Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro Ser | |
| Gly Gly Ser Gly Gly Ser Gln Ser Phe Leu Leu Lys | |
| Ser Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly | |
| Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys | |
| Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His | |
| Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys | |
| Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser | |
| Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly Leu | |
| Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu Gly | |
| Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp | |
| Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu | |
| Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala | |
| Met Pro Ala Phe Ala |
Construction of pMON13192
The new N-terminus/C-terminus gene in pMON13192 was created using Method II as described in Materials and Methods. Fragment Start was created and amplified from G-CSF sequence in pMON13037 using the primer set, 39 start (SEQ ID NO:368) and P-bl start (SEQ ID NO:366). Fragment Stop was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 38 stop (SEQ ID NO:369) and P-bl stop (SEQ ID NO:367). Fragment Start was digested with restriction endonuclease NcoI, and Fragment Stop was digested with restriction endonuclease HindIII. After purification, the digested Fragments Start and Stop were combined with and ligated to the approximately 3800 base pair NcoI-HindIII vector fragment of pMON3934.
The intermediate plasmid described above contained the full length new N-terminus/C-terminus G-CSF Ser17 gene and was digested with restriction endonucleases NcoI and HindIII. The digested DNA was resolved on a 1% TAE gel, stained with ethidium bromide and the full-length new N-terminus/C-terminus G-CSF Ser17 gene was isolated using Geneclean (Bio101, Vista, Calif.). The intermediate plasmid, pMON13180, was digested with restriction endonucleases HindIII and AflIII, resulting in a 4023 base pair vector fragment, and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insertion of the new gene. The resulting plasmid was designated pMON13192.
E. coli strain JM101 was transformed with pMON13192 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON13192, contains the DNA sequence of (SEQ ID NO:27) which encodes the following amino acid sequence:
| (SEQ ID NO:482) |
| 13192.Pept | |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile | |
| Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro | |
| Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile | |
| Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys | |
| Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln | |
| Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Gly Gly Ser Gly Gly Gly Ser Asn Met Ala Tyr | |
| Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly | |
| His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser | |
| Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu | |
| Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly | |
| Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu | |
| Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala | |
| Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu | |
| Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly | |
| Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg | |
| Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser | |
| Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu | |
| Ala Gln Pro Thr Pro Leu Gly Pro Ala Ser Ser Leu | |
| Pro Gln Ser Phe Leu Leu Lys Ser Leu Glu Gln Val | |
| Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu | |
| Lys Leu Cys Ala Thr |
Construction of pMON13193
The new N-terminus/C-terminus gene in pMON13193 was created using Method II as described in Materials and Methods. Fragment Start was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 39 start (SEQ ID NO:368) and P-bl start (SEQ ID NO:366). Fragment Stop was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 38 stop (SEQ ID NO:369) and P-bl stop (SEQ ID NO:367). Fragment Start was digested with restriction endonuclease NcoI, and Fragment Stop was digested with restriction endonuclease HindIII. After purification, the digested Fragments Start and Stop were combined with and ligated to the approximately 3800 base pair NcoI-HindIII vector fragment of pMON3934.
The intermediate plasmid described above contained the full length new N-terminus/C-terminus G-CSF Ser17 gene and was digested with restriction endonucleases NcoI and HindIII. The digested DNA was resolved on a 1% TAE gel, stained with ethidium bromide and the full-length new N-terminus/C-terminus G-CSF Ser17 gene was isolated using Geneclean (Bio101, Vista, Calif.). The intermediate plasmid, pMON13181, was digested with restriction endonucleases HindIII and AflIII, resulting in a 4068 base pair vector fragment, and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insertion of the new gene. The resulting plasmid was designated pMON13193.
E. coli strain JM101 was transformed with pMON13193 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON13193, contains the DNA sequence of (SEQ ID NO:28) encodes the following amino acid sequence:
| (SEQ ID NO:483) |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile | |
| Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro | |
| Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile | |
| Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys | |
| Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln | |
| Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile Asn Pro | |
| Ser Pro Pro Ser Lys Glu Ser His Lys Ser Pro Asn | |
| Met Ala Tyr Lys Leu Cys His Pro Glu Glu Leu Val | |
| Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro | |
| Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala | |
| Gly Cys Leu Ser Gln Leu His Ser Gly Leu Phe Leu | |
| Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser | |
| Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu | |
| Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln | |
| Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro | |
| Thr Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe | |
| Gln Arg Arg Ala Gly Gly Val Leu Val Ala Ser His | |
| Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu | |
| Arg His Leu Ala Gln Pro Thr Pro Leu Gly Pro Ala | |
| Ser Ser Leu Pro Gln Ser Phe Leu Leu Lys Ser Leu | |
| Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala | |
| Leu Gln Glu Lys Leu Cys Ala Thr |
Construction of pMON25190
The new N-terminus/C-terminus gene in pMON25190 was created using Method II as described in Materials and Methods. Fragment Start was created and amplified from G-CSF sequence in pMON13037 using the primer set, 97 start (SEQ ID NO:370) and P-bl start (SEQ ID NO:366). Fragment Stop was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 96 stop (SEQ ID NO:371) and P-bl stop (SEQ ID NO:367). Fragment Start was digested with restriction endonuclease NcoI, and Fragment Stop was digested with restriction endonuclease HindIII. After purification, the digested Fragments Start and Stop were combined with and ligated to the approximately 3800 base pair NcoI-HindIII vector fragment of pMON3934.
The intermediate plasmid described above contained the full length new N-terminus/C-terminus G-CSF Ser17 gene and was digested with restriction endonucleases NcoI and HindIII. The digested DNA was resolved on a 1% TAE gel, stained with ethidium bromide and the full-length new N-terminus/C-terminus G-CSF Ser17 gene was isolated using Geneclean (Bio101, Vista, Calif.). The intermediate plasmid, pMON13180, was digested with restriction endonucleases HindIII and AflIII, resulting in a 4023 base pair vector fragment, and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insertion of the new gene. The resulting plasmid was designated pMON25190.
E. coli strain JM101 was transformed with pMON25190 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON25190, contains the DNA sequence of (SEQ ID NO:29) which encodes the following amino acid sequence:
| (SEQ ID NO:484) |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile | |
| Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro | |
| Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile | |
| Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys | |
| Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln | |
| Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Gly Gly Ser Gly Gly Gly Ser Asn Met Ala Pro | |
| Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp | |
| Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met | |
| Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr | |
| Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln | |
| Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu | |
| Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg | |
| His Leu Ala Gln Pro Thr Pro Leu Gly Pro Ala Ser | |
| Ser Leu Pro Gln Ser Phe Leu Leu Lys Ser Leu Glu | |
| Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu | |
| Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His | |
| Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly | |
| Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln | |
| Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His | |
| Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala | |
| Leu Glu Gly Ile Ser |
Construction of pMON25191
The new N-terminus/C-terminus gene in pMON25191 was created using Method II as described in Materials and Methods. Fragment Start was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 97 start (SEQ ID NO:370) and P-bl start (SEQ ID NO:366). Fragment Stop was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 96 stop (SEQ ID NO:371) and P-bl stop (SEQ ID NO:367). Fragment Start was digested with restriction endonuclease NcoI, and Fragment Stop was digested with restriction endonuclease HindIII. After purification, the digested Fragments Start and Stop were combined with and ligated to the approximately 3800 base pair NcoI-HindIII vector fragment of pMON3934.
The intermediate plasmid described above contained the full length new N-terminus/C-terminus G-CSF Ser17 gene and was digested with restriction endonucleases NcoI and HindIII. The digested DNA was resolved on a 1% TAE gel, stained with ethidium bromide and the full-length new N-terminus/C-terminus G-CSF Ser17 gene was isolated using Geneclean (Bio101, Vista, Calif.). The intermediate plasmid, pMON13181, was digested with restriction endonucleases HindIII and AflIII, resulting in a 4068 base pair vector fragment, and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insertion of the new gene. The resulting plasmid was designated pMON25191.
E. coli strain JM101 was transformed with pMON25191 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON25191, contains the DNA sequence of (SEQ ID NO:30) which encodes the following amino acid sequence:
| (SEQ ID NO:485) |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile | |
| Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro | |
| Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile | |
| Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys | |
| Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln | |
| Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile Asn Pro | |
| Ser Pro Pro Ser Lys Glu Ser His Lys Ser Pro Asn | |
| Met Ala Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu | |
| Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp | |
| Gln Gln Met Glu Glu Leu Gly Met Ala Pro Ala Leu | |
| Gln Pro Thr Gln Gly Ala Met Pro Ala Phe Ala Ser | |
| Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala | |
| Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg | |
| Val Leu Arg His Leu Ala Gln Pro Thr Pro Leu Gly | |
| Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu Lys | |
| Ser Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly | |
| Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys | |
| Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His | |
| Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys | |
| Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser | |
| Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly Leu | |
| Leu Gln Ala Leu Glu Gly Ile Ser |
Construction of pMON13194
The new N-terminus/C-terminus gene in pMON13194 was created using Method II as described in Materials and Methods. Fragment Start was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 126 start (SEQ ID NO:372) and P-bl start (SEQ ID NO:366). Fragment Stop was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 125 stop (SEQ ID NO:371) and P-bl stop (SEQ ID NO:367). Fragment Start was digested with restriction endonuclease NcoI, and Fragment Stop was digested with restriction endonuclease HindIII. After purification, the digested Fragments Start and Stop were combined with and ligated to the approximately 3800 base pair NcoI-HindIII vector fragment of pMON3934.
The intermediate plasmid described above contained the full length new N-terminus/C-terminus G-CSF Ser17 gene and was digested with restriction endonucleases NcoI and HindIII. The digested DNA was resolved on a 1% TAE gel, stained with ethidium bromide and the full-length new N-terminus/C-terminus G-CSF Ser17 gene was isolated using Geneclean (Bio101, Vista, Calif.). The intermediate plasmid, pMON13180, was digested with restriction endonucleases HindIII and AflIII, resulting in a 4023 base pair vector fragment, and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insertion of the new gene. The resulting plasmid was designated pMON13194.
E. coli strain JM101 was transformed with pMON13194 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON13194, contains the DNA sequence of (SEQ ID NO:31) which encodes the following amino acid sequence:
| (SEQ ID NO:486) |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile | |
| Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro | |
| Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile | |
| Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys | |
| Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln | |
| Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Gly Gly Ser Gly Gly Gly Ser Asn Met Ala Met | |
| Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala Met Pro | |
| Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly | |
| Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu | |
| Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro | |
| Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser | |
| Phe Leu Leu Lys Ser Leu Glu Gln Val Arg Lys Ile | |
| Gln Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys | |
| Ala Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val | |
| Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro | |
| Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala | |
| Gly Cys Leu Ser Gln Leu His Ser Gly Leu Phe Leu | |
| Tyr Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser | |
| Pro Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu | |
| Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln | |
| Met Glu Glu Leu Gly |
Construction of pMON13195
The new N-terminus/C-terminus gene in pMON13195 was created using Method II as described in Materials and Methods. Fragment Start was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 126 start (SEQ ID NO:372 and P-bl start (SEQ ID NO:366). Fragment Stop was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 125 stop (SEQ ID NO:373) and P-bl stop (SEQ ID NO:367). Fragment Start was digested with restriction endonuclease NcoI, and Fragment Stop was digested with restriction endonuclease HindIII. After purification, the digested Fragments Start and Stop were combined with and ligated to the approximately 3800 base pair NcoI-HindIII vector fragment of pMON3934.
The intermediate plasmid described above contained the full length new N-terminus/C-terminus G-CSF Ser17 gene and was digested with restriction endonucleases NcoI and HindIII. The digested DNA was resolved on a 1% TAE gel, stained with ethidium bromide and the full-length new N-terminus/C-terminus G-CSF Ser17 gene was isolated using Geneclean (Bio101, Vista, Calif.). The intermediate plasmid, pMON13181, was digested with restriction endonucleases HindIII and AflIII, resulting in a 4068 base pair vector fragment, and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insertion of the new gene. The resulting plasmid was designated pMON13195.
E. coli strain JM101 was transformed with pMON13195 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON13195, contains the DNA sequence of (SEQ ID NO:32) which encodes the following amino acid sequence:
| (SEQ ID NO:487) |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile | |
| Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro | |
| Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile | |
| Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys | |
| Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln | |
| Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile Asn Pro | |
| Ser Pro Pro Ser Lys Glu Ser His Lys Ser Pro Asn | |
| Met Ala Met Ala Pro Ala Leu Gln Pro Thr Gln Gly | |
| Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg | |
| Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser | |
| Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu | |
| Ala Gln Pro Thr Pro Leu Gly Pro Ala Ser Ser Leu | |
| Pro Gln Ser Phe Leu Leu Lys Ser Leu Glu Gln Val | |
| Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu | |
| Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu | |
| Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro | |
| Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln Ala Leu | |
| Gln Leu Ala Gly Cys Leu Ser Gln Leu His Ser Gly | |
| Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala Leu Glu | |
| Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu Asp Thr | |
| Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile | |
| Trp Gln Gln Met Glu Glu Leu Gly |
Construction of pMON13196
The new N-terminus/C-terminus gene in pMON13196 was created using Method II as described in Materials and Methods. Fragment Start was created and amplified from G-CSF sequence in pMON13037 using the primer set, 133 start (SEQ ID NO:374) and P-bl start (SEQ ID NO:366). Fragment Stop was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 132 stop (SEQ ID NO:375) and P-bl stop (SEQ ID NO:367). Fragment Start was digested with restriction endonuclease NcoI, and Fragment Stop was digested with restriction endonuclease HindIII. After purification, the digested Fragments Start and Stop were combined with and ligated to the approximately 3800 base pair NcoI-HindIII vector fragment of pMON3934.
The intermediate plasmid described above contained the full length new N-terminus/C-terminus G-CSF Ser17 gene and was digested with restriction endonucleases NcoI and HindIII. The digested DNA was resolved on a 1% TAE gel, stained with ethidium bromide and the full-length new N-terminus/C-terminus G-CSF Ser17 gene was isolated using Geneclean (Bio101, Vista, Calif.). The intermediate plasmid, pMON13180, was digested with restriction endonucleases HindIII and AflIII, resulting in a 4023 base pair vector fragment, and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insertion of the new gene. The resulting plasmid was designated pMON13196.
E. coli strain JM101 was transformed with pMON13196 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON13196, contains the DNA sequence of (SEQ ID NO:33) which encodes the following amino acid sequence:
| (SEQ ID NO:488) |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile | |
| Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro | |
| Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile | |
| Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys | |
| Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln | |
| Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Gly Gly Ser Gly Gly Gly Ser Asn Met Ala Thr | |
| Gln Gly Ala Met Pro Ala Phe Ala Ser Ala Phe Gln | |
| Arg Arg Ala Gly Gly Val Leu Val Ala Ser His Leu | |
| Gln Ser Phe Leu Glu Val Ser Tyr Arg Val Leu Arg | |
| His Leu Ala Gln Pro Thr Pro Leu Gly Pro Ala Ser | |
| Ser Leu Pro Gln Ser Phe Leu Leu Lys Ser Leu Glu | |
| Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu | |
| Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His | |
| Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly | |
| Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln | |
| Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His | |
| Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala | |
| Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu | |
| Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr | |
| Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala | |
| Pro Ala Leu Gln Pro |
Construction of pMON13197
The new N-terminus/C-terminus gene in pMON13197 was created using Method II as described in Materials and Methods. Fragment Start was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 133 start (SEQ ID NO:374) and P-bl start (SEQ ID NO:366). Fragment Stop was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 132 stop (SEQ ID NO:375) and P-bl stop (SEQ ID NO:367). Fragment Start was digested with restriction endonuclease NcoI, and Fragment Stop was digested with restriction endonuclease HindIII. After purification, the digested Fragments Start and Stop were combined with and ligated to the approximately 3800 base pair NcoI-HindIII vector fragment of pMON3934.
The intermediate plasmid described above contained the full length new N-terminus/C-terminus G-CSF Ser17 gene and was digested with restriction endonucleases NcoI and HindIII. The digested DNA was resolved on a 1% TAE gel, stained with ethidium bromide and the full-length new N-terminus/C-terminus G-CSF Ser17 gene was isolated using Geneclean (Bio101, Vista, Calif.). The intermediate plasmid, pMON13181, was digested with restriction endonucleases HindIII and AflIII, resulting in a 4068 base pair vector fragment, and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insertion of the new gene. The resulting plasmid was designated pMON13197.
E. coli strain JM101 was transformed with pMON13197 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON13197, contains the DNA sequence of (SEQ ID NO:34) which encodes the following amino acid sequence:
| (SEQ ID NO:489) |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile | |
| Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro | |
| Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile | |
| Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys | |
| Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln | |
| Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Gly Gly Ser Gly Gly Gly Ser Asn Met Ala Tyr | |
| Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly | |
| His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser | |
| Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu | |
| Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly | |
| Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu | |
| Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala | |
| Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu | |
| Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly | |
| Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg | |
| Ala Gly Gly Val Leu Val Ala Ser His Leu Gln Ser | |
| Phe Leu Glu Val Ser Tyr Arg Val Leu Arg His Leu | |
| Ala Gln Pro Thr Pro Leu Gly Pro Ala Ser Ser Leu | |
| Pro Gln Ser Phe Leu Leu Lys Ser Leu Glu Gln Val | |
| Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu Gln Glu | |
| Lys Leu Cys Ala Thr |
Construction of pMON13198
The new N-terminus/C-terminus gene in pMON13198 was created using Method II as described in Materials and Methods. Fragment Start was created and amplified from G-CSF sequence in pMON13037 using the primer set, 142 start (SEQ ID NO:376) and P-bl start (SEQ ID NO:366). Fragment Stop was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 141 stop (SEQ ID NO:377) and P-bl stop (SEQ ID NO:367). Fragment Start was digested with restriction endonuclease NcoI, and Fragment Stop was digested with restriction endonuclease HindIII. After purification, the digested Fragments Start and Stop were combined with and ligated to the approximately 3800 base pair NcoI-HindIII vector fragment of pMON3934.
The intermediate plasmid described above contained the full length new N-terminus/C-terminus G-CSF Ser17 gene and was digested with restriction endonucleases NcoI and HindIII. The digested DNA was resolved on a 1% TAE gel, stained with ethidium bromide and the full-length new N-terminus/C-terminus G-CSF Ser17 gene was isolated using Geneclean (Bio101, Vista, Calif.). The intermediate plasmid, pMON13180, was digested with restriction endonucleases HindIII and AflIII, resulting in a 4023 base pair vector fragment, and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insertion of the new gene. The resulting plasmid was designated pMON13198.
E. coli strain JM101 was transformed with pMON13198 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON13198, contains the DNA sequence of (SEQ ID NO:35) which encodes the following amino acid sequence:
| (SEQ ID NO:490) |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile | |
| Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro | |
| Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile | |
| Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys | |
| Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln | |
| Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Gly Gly Ser Gly Gly Gly Ser Asn Met Ala Ser | |
| Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala | |
| Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg | |
| Val Leu Arg His Leu Ala Gln Pro Thr Pro Leu Gly | |
| Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu Lys | |
| Ser Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly | |
| Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys | |
| Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly His | |
| Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys | |
| Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser | |
| Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly Leu | |
| Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu Gly | |
| Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp | |
| Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu | |
| Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly Ala | |
| Met Pro Ala Phe Ala |
Construction of pMON13199
The new N-terminus/C-terminus gene in pMON13199 was created using Method II as described in Materials and Methods. Fragment Start was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 142 start (SEQ ID NO:376) and P-bl start (SEQ ID NO:366). Fragment Stop was created and amplified from G-CSF Ser17 sequence in pMON13037 using the primer set, 141 stop (SEQ ID NO:377) and P-bl stop (SEQ ID NO:367). Fragment Start was digested with restriction endonuclease NcoI, and Fragment Stop was digested with restriction endonuclease HindIII. After purification, the digested Fragments Start and Stop were combined with and ligated to the approximately 3800 base pair NcoI-HindIII vector fragment of pMON3934.
The intermediate plasmid described above contained the full length new N-terminus/C-terminus G-CSF Ser17 gene and was digested with restriction endonucleases NcoI and HindIII. The digested DNA was resolved on a 1% TAE gel, stained with ethidium bromide and the full-length new N-terminus/C-terminus G-CSF Ser17 gene was isolated using Geneclean (Bio101, Vista, Calif.). The intermediate plasmid, pMON13181, was digested with restriction endonucleases HindIII and AflIII, resulting in a 4068 base pair vector fragment, and purified using a Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insertion of the new gene. The resulting plasmid was designated pMON13199.
E. coli strain JM101 was transformed with pMON13199 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON13199, contains the DNA sequence of (SEQ ID NO:36) which encodes the following amino acid sequence:
| (SEQ ID NO:491) |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile | |
| Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro | |
| Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile | |
| Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys | |
| Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln | |
| Glu Gln Gln Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile Asn Pro | |
| Ser Pro Pro Ser Lys Glu Ser His Lys Ser Pro Asn | |
| Met Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val | |
| Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val | |
| Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro Thr | |
| Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe | |
| Leu Leu Lys Ser Leu Glu Gln Val Arg Lys Ile Gln | |
| Gly Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala | |
| Thr Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu | |
| Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu | |
| Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly | |
| Cys Leu Ser Gln Leu His Ser Gly Leu Phe Leu Tyr | |
| Gln Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro | |
| Glu Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp | |
| Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met | |
| Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr | |
| Gln Gly Ala Met Pro Ala Phe Ala |
Construction of Tandemly-Duplicated Plasmid Template, Syntan1
To create the tandemly-duplicated hIL-3 receptor agonist pMON13416 template, Syntan1, three DNAs were joined by means of ligation using T4 DNA ligase (Boehringer Mannheim). The three DNAs are: 1) pMON13046, containing hIL-3 receptor agonist pMON13416, digested with BstEII and SnaBI; 2) the annealed complimentary pair of synthetic oligonucleotides, L1syn.for (SEQ ID NO:352) and L1syn.rev (SEQ ID NO:353), which contain sequence encoding the linker that connects the C-terminal and N-terminal ends of the original protein and a small amount of surrounding pMON13416 sequence and which when properly assembled result in BstEII and ClaI ends; and 3) a portion of hIL-3 receptor agonist pMON13416 digested from pMON13046 with ClaI (DNA had been grown in the dam-cells, DM1 (Life Technologies)) and SnaBI. The digested DNAs were resolved on a 0.9% TAE gel, stained with ethidium bromide and isolated using Geneclean (Bio101).
A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Miniprep DNA was isolated from the transformants, and the transformants were screened using a PCR based assay. Plasmid DNA from selected transformants was sequenced to obtain the correct template. The resulting plasmid was designated syntan1 and contains the DNA sequence of (SEQ ID NO:7).
EXAMPLE 74Construction of Tandemly-Duplicated Template, Syntan3.
To create the tandemly-duplicated hIL-3 receptor agonist pMON13416 template, syntan3, three DNAs were joined by means of ligation using T4 DNA ligase (Boehringer Mannheim). The three DNAs are: 1) pMON13046, containing hIL-3 receptor agonist pMON13416, digested with BstEII and SnaBI; 2) the annealed complimentary pair of synthetic oligonucleotides, L3syn.for (SEQ ID NO:354) and L3syn.rev (SEQ ID NO:355), which contain sequence encoding the linker that connects the C-terminal and N-terminal ends of the original protein and a small amount of surrounding pMON13416 sequence and which when properly assembled result in BstEII and SnaBI ends; and 3) a portion of hIL-3 receptor agonist pMON13416 digested from pMON13046 with ClaI (DNA had been grown in the dam- cells, DM1 (Life Technologies)) and SnaBI. The digested DNAs were resolved on a 0.9% TAE gel, stained with ethidium bromide and isolated using Geneclean (Bio101).
A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Miniprep DNA was isolated from the transformants, and the transformants were screened using a PCR based assay.
Plasmid DNA from selected transformants was sequenced to obtain the correct template. The resulting plasmid was designated syntan3 and contains the DNA sequence of (SEQ ID NO:8).
EXAMPLE 75Construction of pMON31104
The new N-terminus/C-terminus gene in pMON31104 was created using Method III as described in Materials and Methods. The full length new N-terminus/C-terminus gene of hIL-3 receptor agonist pMON13416 was created and amplified from the intermediate plasmid, Syntan1, using the primer set 35 start (SEQ ID NO:356) and 34 rev (SEQ ID NO:357).
The resulting DNA fragment which contains the new gene was digested with restriction endonucleases NcoI and SnaBI. The digested DNA fragment was resolved on a 1% TAE gel, stained with ethidium bromide and isolated using Geneclean (Bio101, Vista, Calif.). The purified digested DNA fragment was ligated into the expression vector, pMON13189, using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). The pMON13189 DNA had been previously digested with NcoI and SnaBI to remove the hIL3 receptor agonist pMON13416 coding sequence and the 4254 base pair vector fragment was isolated using Geneclean (Bio101, Vista, Calif.) after resolution on a 0.8% TAE gel and staining with ethidium bromide. A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insert. The resulting plasmid was designated pMON31104.
E. coli strain JM101 was transformed with pMON31104 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON31104, contains the DNA sequence of (SEQ ID NO:9) which encodes the following amino acid sequence:
| (SEQ ID NO:492) |
| Leu Asp Pro Asn Asn Leu Asn Asp Glu Asp Val Ser | |
| Ile Leu Met Asp Arg Asn Leu Arg Leu Pro Asn Leu | |
| Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn | |
| Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln | |
| Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg | |
| His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu | |
| Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu | |
| Glu Gln Ala Gln Glu Gln Gln Gly Gly Gly Ser Asn | |
| Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu | |
| Lys Arg Pro Pro Ala Pro Leu Tyr Val Glu Gly Gly | |
| Gly Gly Ser Pro Gly Glu Pro Ser Gly Pro Ile Ser | |
| Thr Ile Asn Pro Ser Pro Pro Ser Lys Glu Ser His | |
| Lys Ser Pro Asn Met Ala Thr Gln Gly Ala Met Pro | |
| Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly | |
| Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu | |
| Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro | |
| Ser Gly Gly Ser Gly Gly Ser Gln Ser Phe Leu Leu | |
| Lys Ser Leu Glu Gln Val Arg Lys Ile Gln Gly Asp | |
| Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr | |
| Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly | |
| His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser | |
| Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu | |
| Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly | |
| Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu | |
| Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala | |
| Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu | |
| Leu Gly Met Ala Pro Ala Leu Gln Pro |
Construction of pMON31105
The new N-terminus/C-terminus gene in pMON31105 was created using Method III as described in Materials and Methods. The full length new N-terminus/C-terminus gene of hIL-3 receptor agonist pMON13416 was created and amplified from the intermediate plasmid, Syntan1, using the primer set 70 start (SEQ ID NO:358) and 69 rev (SEQ ID NO:359).
The resulting DNA fragment which contains the new gene was digested with restriction endonucleases NcoI and SnaBI. The digested DNA fragment was resolved on a 1% TAE gel, stained with ethidium bromide and isolated using Geneclean (Bio101, Vista, Calif.). The purified digested DNA fragment was ligated into the expression vector pMON13189, using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). The pMON13189 DNA had been previously digested with NcoI and SnaBI to remove the hIL3 receptor agonist pMON13416 coding sequence and the 4254 base pair vector fragment was isolated using Geneclean (Bio101, Vista, Calif.) after resolution on a 0.8% TAE gel and staining with ethidium bromide. A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insert. The resulting plasmid was designated pMON31105.
E. coli strain JM101 was transformed with pMON31105 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON31105, contains the DNA sequence of (SEQ ID NO:10) which encodes the protein with the following amino acid sequence:
| (SEQ ID NO:493) |
| Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu | |
| Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser | |
| Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln | |
| Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr | |
| Leu Glu Gln Ala Gln Glu Gln Gln Gly Gly Gly Ser | |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Tyr Val Glu Gly Gly | |
| Gly Gly Ser Pro Gly Glu Pro Ser Gly Pro Ile Ser | |
| Thr Ile Asn Pro Ser Pro Pro Ser Lys Glu Ser His | |
| Lys Ser Pro Asn Met Ala Thr Gln Gly Ala Met Pro | |
| Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly | |
| Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu | |
| Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro | |
| Ser Gly Gly Ser Gly Gly Ser Gln Ser Phe Leu Leu | |
| Lys Ser Leu Glu Gln Val Arg Lys Ile Gln Gly Asp | |
| Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr | |
| Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly | |
| His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser | |
| Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu | |
| Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly | |
| Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu | |
| Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala | |
| Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu | |
| Leu Gly Met Ala Pro Ala Leu Gln Pro |
Construction of pMON31106
The new N-terminus/C-terminus gene in pMON31106 was created using Method III as described in Materials and Methods. The full length new N-terminus/C-terminus gene of hIL-3 receptor agonist pMON13416 was created and amplified from the intermediate plasmid, Syntan1, using the primer set 91 start (SEQ ID NO:360) and 90 rev (SEQ ID NO:361).
The resulting DNA fragment which contains the new gene was digested with restriction endonucleases NcoI and SnaBI. The digested DNA fragment was resolved on a 1% TAE gel, stained with ethidium bromide and isolated using Geneclean (Bio101, Vista, Calif.). The purified digested DNA fragment was ligated into the expression vector pMON13189, using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). The pMON13189 DNA had been previously digested with NcoI and SnaBI to remove the hIL3 receptor agonist pMON13416 coding sequence and the 4254 base pair vector fragment was isolated using Geneclean (Bio101, Vista, Calif.) after resolution on a 0.8% TAE gel and staining with ethidium bromide. A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insert. The resulting plasmid was designated pMON31106.
E. coli strain JM101 was transformed with pMON31106 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON31106, contains the DNA sequence of (SEQ ID NO:1) which encodes the protein with the following amino acid sequence:
| (SEQ ID NO;494) |
| Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly | |
| Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr | |
| Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln Gly | |
| Gly Gly Ser Asn Cys Ser Ile Met Ile Asp Glu Ile | |
| Ile His His Leu Lys Arg Pro Pro Ala Pro Leu Leu | |
| Asp Pro Asn Asn Leu Asn Asp Glu Asp Val Ser Ile | |
| Leu Met Asp Arg Asn Leu Arg Leu Pro Asn Leu Glu | |
| Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn Ala | |
| Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro | |
| Cys Leu Pro Ser Ala Thr Ala Tyr Val Glu Gly Gly | |
| Gly Gly Ser Pro Gly Glu Pro Ser Gly Pro Ile Ser | |
| Thr Ile Asn Pro Ser Pro Pro Ser Lys Glu Ser His | |
| Lys Ser Pro Asn Met Ala Thr Gln Gly Ala Met Pro | |
| Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly | |
| Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu | |
| Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro | |
| Ser Gly Gly Ser Gly Gly Ser Gln Ser Phe Leu Leu | |
| Lys Ser Leu Glu Gln Val Arg Lys Ile Gln Gly Asp | |
| Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr | |
| Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly | |
| His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser | |
| Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu | |
| Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly | |
| Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu | |
| Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala | |
| Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu | |
| Leu Gly Met Ala Pro Ala Leu Gln Pro |
Construction of pMON31107
The new N-terminus/C-terminus gene in pMON31107 was created using Method III as described in Materials and Methods. The full length new N-terminus/C-terminus gene of hIL-3 receptor agonist pMON13416 was created and amplified from the intermediate plasmid, Syntan1, using the primer set 101 start (SEQ ID NO:362) and 100 rev (SEQ ID NO:363).
The resulting DNA fragment which contains the new gene was digested with restriction endonucleases NcoI and SnaBI. The digested The DNA fragment was resolved on a 1% TAE gel, stained with ethidium bromide and isolated using Geneclean (Bio101, Vista, Calif.). The purified digested DNA fragment was ligated into the expression vector pMON13189, using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). The pMON13189 DNA had been previously digested with NcoI and SnaBI to remove the hIL3 receptor agonist pMON13416 coding sequence and the 4254 base pair vector fragment was isolated using Geneclean (Bio101, Vista, Calif.) after resolution on a 0.8% TAE gel and staining with ethidium bromide. A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insert. The resulting plasmid was designated pMON31107.
E. coli strain JM101 was transformed with pMON31107 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON31107, contains the DNA sequence of (SEQ ID NO:12) which encodes the following amino acid sequence:
| (SEQ ID NO:495) |
| Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr | |
| Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln | |
| Gln Gly Gly Gly Ser Asn Cys Ser Ile Met Ile Asp | |
| Glu Ile Ile His His Leu Lys Arg Pro Pro Ala Pro | |
| Leu Leu Asp Pro Asn Asn Leu Asn Asp Glu Asp Val | |
| Ser Ile Leu Met Asp Arg Asn Leu Arg Leu Pro Asn | |
| Leu Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu | |
| Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu | |
| Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser | |
| Arg His Pro Ile Ile Ile Lys Tyr Val Glu Gly Gly | |
| Gly Gly Ser Pro Gly Glu Pro Ser Gly Pro Ile Ser | |
| Thr Ile Asn Pro Ser Pro Pro Ser Lys Glu Ser His | |
| Lys Ser Pro Asn Met Ala Thr Gln Gly Ala Met Pro | |
| Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly | |
| Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu | |
| Val Ser Tyr Arg Val Leu Arg His Leu Ala Gln Pro | |
| Ser Gly Gly Ser Gly Gly Ser Gln Ser Phe Leu Leu | |
| Lys Ser Leu Glu Gln Val Arg Lys Ile Gln Gly Asp | |
| Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr | |
| Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu Gly | |
| His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser | |
| Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu | |
| Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly | |
| Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu | |
| Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val Ala | |
| Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu Glu | |
| Leu Gly Met Ala Pro Ala Leu Gln Pro |
Construction of pMON31108
The new N-terminus/C-terminus gene in pMON31108 was created using Method III as described in Materials and Methods. The full length new N-terminus/C-terminus gene of hIL-3 receptor agonist pMON13416 was created and amplified from the intermediate plasmid, Syntan3, using the primer set 35 start (SEQ ID NO:356) and 34 rev (SEQ ID NO:357).
The resulting DNA fragment which contains the new gene was digested with restriction endonucleases NcoI and SnaBI. The digested DNA fragment was resolved on a 1% TAE gel, stained with ethidium bromide and isolated using Geneclean (Bio101, Vista, Calif.). The purified digested DNA fragment was ligated into the expression vector pMON13189, using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). The pMON13189 DNA had been previously digested with NcoI and SnaBI to remove the hIL3 receptor agonist pMON13416 coding sequence and the 4254 base pair vector fragment was isolated using Geneclean (Bio101, Vista, Calif.) after resolution on a 0.8% TAE gel and staining with ethidium bromide. A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insert. The resulting plasmid was designated pMON31108.
E. coli strain JM101 was transformed with pMON31108 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON31108, contains the DNA sequence of (SEQ ID NO:13) which encodes the following amino acid sequence:
| (SEQ ID NO:496) |
| Leu Asp Pro Asn Asn Leu Asn Asp Glu Asp Val Ser | |
| Ile Leu Met Asp Arg Asn Leu Arg Leu Pro Asn Leu | |
| Glu Ser Phe Val Arg Ala Val Lys Asn Leu Glu Asn | |
| Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu Gln | |
| Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser Arg | |
| His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln Glu | |
| Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr Leu | |
| Glu Gln Ala Gln Glu Gln Gln Gly Gly Gly Ser Gly | |
| Gly Gly Ser Gly Gly Gly Ser Asn Cys Ser Ile Met | |
| Ile Asp Glu Ile Ile His His Leu Lys Arg Pro Pro | |
| Ala Pro Leu Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile Asn Pro | |
| Ser Pro Pro Ser Lys Glu Ser His Lys Ser Pro Asn | |
| Met Ala Thr Gln Gly Ala Met Pro Ala Phe Ala Ser | |
| Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala | |
| Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg | |
| Val Leu Arg His Leu Ala Gln Pro Ser Gly Gly Ser | |
| Gly Gly Ser Gln Ser Phe Leu Leu Lys Ser Leu Glu | |
| Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu | |
| Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His | |
| Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly | |
| Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln | |
| Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His | |
| Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala | |
| Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu | |
| Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr | |
| Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala | |
| Pro Ala Leu Gln Pro |
Construction of pMON31109
The new N-terminus/C-terminus gene in pMON31109 was created using Method III as described in Materials and Methods. The full length new N-terminus/C-terminus gene of hIL-3 receptor agonist pMON13416 was created and amplified from the intermediate plasmid, Syntan3, using the primer set 70 start (SEQ ID NO:358) and 69 rev (SEQ ID NO:359).
The resulting DNA fragment which contains the new gene was digested with restriction endonucleases NcoI and SnaBI. The digested DNA fragment was resolved on a 1% TAE gel, stained with ethidium bromide and isolated using Geneclean (Bio101, Vista, Calif.). The purified digested DNA fragment was ligated into the expression vector-pMON13189, using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). The pMON13189 DNA had been previously digested with NcoI and SnaBI to remove the hIL3 receptor agonist pMON13416 coding sequence and the 4254 base pair vector fragment was isolated using Geneclean (Bio101, Vista, Calif.) after resolution on a 0.8% TAE gel and staining with ethidium bromide. A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insert. The resulting plasmid was designated pMON31109.
E. coli strain JM101 was transformed with pMON31109 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON31109, contains the DNA sequence of (SEQ ID NO:14) which encodes the following amino acid sequence:
| (SEQ ID NO:497) |
| Asn Ala Ser Gly Ile Glu Ala Ile Leu Arg Asn Leu | |
| Gln Pro Cys Leu Pro Ser Ala Thr Ala Ala Pro Ser | |
| Arg His Pro Ile Ile Ile Lys Ala Gly Asp Trp Gln | |
| Glu Phe Arg Glu Lys Leu Thr Phe Tyr Leu Val Thr | |
| Leu Glu Gln Ala Gln Glu Gln Gln Gly Gly Gly Ser | |
| Gly Gly Gly Ser Gly Gly Gly Ser Asn Cys Ser Ile | |
| Met Ile Asp Glu Ile Ile His His Leu Lys Arg Pro | |
| Pro Ala Pro Leu Leu Asp Pro Asn Asn Leu Asn Asp | |
| Glu Asp Val Ser Ile Leu Met Asp Arg Asn Leu Arg | |
| Leu Pro Asn Leu Glu Ser Phe Val Arg Ala Val Lys | |
| Asn Leu Glu Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile Asn Pro | |
| Ser Pro Pro Ser Lys Glu Ser His Lys Ser Pro Asn | |
| Met Ala Thr Gln Gly Ala Met Pro Ala Phe Ala Ser | |
| Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala | |
| Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg | |
| Val Leu Arg His Leu Ala Gln Pro Ser Gly Gly Ser | |
| Gly Gly Ser Gln Ser Phe Leu Leu Lys Ser Leu Glu | |
| Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu | |
| Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His | |
| Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly | |
| Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln | |
| Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His | |
| Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala | |
| Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu | |
| Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr | |
| Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala | |
| Pro Ala Leu Gln Pro |
Construction of pMON31110
The new N-terminus/C-terminus gene in pMON31110 was created using Method III as described in Materials and Methods. The full length new N-terminus/C-terminus gene of hIL-3 receptor agonist pMON13416 was created and amplified from the intermediate plasmid, Syntan3, using the primer set 91 start (SEQ ID NO:360) and 90 rev (SEQ ID NO:361).
The resulting DNA fragment which contains the new gene was digested with restriction endonucleases NcoI and SnaBI. The digested DNA fragment was resolved on a 1% TAE gel, stained with ethidium bromide and isolated using Geneclean (Bio101, Vista, Calif.). The purified digested DNA fragment was ligated into the expression vector pMON13189, using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). The pMON13189 DNA had been previously digested with NcoI and SnaBI to remove the hIL3 receptor agonist pMON13416 coding sequence and the 4254 base pair vector fragment was isolated using Geneclean (Bio101, Vista, Calif.) after resolution on a 0.8% TAE gel and staining with ethidium bromide. A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insert. The resulting plasmid was designated pMON31110.
E. coli strain JM101 was transformed with pMON31110 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON31110, contains the DNA sequence of (SEQ ID NO:15) which encodes the following amino acid sequence:
| (SEQ ID NO:498) |
| Ala Pro Ser Arg His Pro Ile Ile Ile Lys Ala Gly | |
| Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr Phe Tyr | |
| Leu Val Thr Leu Glu Gln Ala Gln Glu Gln Gln Gly | |
| Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser Asn | |
| Cys Ser Ile Met Ile Asp Glu Ile Ile His His Leu | |
| Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn Asn | |
| Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp Arg | |
| Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val Arg | |
| Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile Glu | |
| Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro Ser | |
| Ala Thr Ala Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile Asn Pro | |
| Ser Pro Pro Ser Lys Glu Ser His Lys Ser Pro Asn | |
| Met Ala Thr Gln Gly Ala Met Pro Ala Phe Ala Ser | |
| Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala | |
| Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg | |
| Val Leu Arg His Leu Ala Gln Pro Ser Gly Gly Ser | |
| Gly Gly Ser Gln Ser Phe Leu Leu Lys Ser Leu Glu | |
| Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu | |
| Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His | |
| Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly | |
| Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln | |
| Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His | |
| Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala | |
| Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu | |
| Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr | |
| Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala | |
| Pro Ala Leu Gln Pro |
Construction of pMON31111 The new N-terminus/C-terminus gene in pMON31111 was created using Method III as described in Materials and Methods. The full length new N-terminus/C-terminus gene of hIL-3 receptor agonist pMON13416 was created and amplified from the intermediate plasmid, Syntan3, using the primer set 101 start (SEQ ID NO:362) and 100 rev (SEQ ID NO:363).
The resulting DNA fragment which contains the new gene was digested with restriction endonucleases NcoI and SnaBI. The digested DNA fragment was resolved on a 1% TAE gel, stained with ethidium bromide and isolated using Geneclean (Bio101, Vista, Calif.). The purified digested DNA fragment was ligated into the expression vector pMON13189, using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). The pMON13189 DNA had been previously digested with NcoI and SnaBI to remove the hIL3 receptor agonist pMON13416 coding sequence and the 4254 base pair vector fragment was isolated using Geneclean (Bio101, Vista, Calif.) after resolution on a 0.8% TAE gel and staining with ethidium bromide. A portion of the ligation reaction was used to transform E. coli strain DH5Ξ± cells (Life Technologies, Gaithersburg, Md.). Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to confirm the correct insert. The resulting plasmid was designated pMON31111.
E. coli strain JM101 was transformed with pMON31111 for protein expression and protein isolation from inclusion bodies.
The plasmid, pMON31111, contains the DNA sequence of (SEQ ID NO:16) which encodes the following amino acid sequence:
| (SEQ ID NO:499) |
| Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys Leu Thr | |
| Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln Glu Gln | |
| Gln Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly | |
| Ser Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His | |
| His Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro | |
| Asn Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met | |
| Asp Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe | |
| Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly | |
| Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu | |
| Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile | |
| Ile Ile Lys Tyr Val Glu Gly Gly Gly Gly Ser Pro | |
| Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile Asn Pro | |
| Ser Pro Pro Ser Lys Glu Ser His Lys Ser Pro Asn | |
| Met Ala Thr Gln Gly Ala Met Pro Ala Phe Ala Ser | |
| Ala Phe Gln Arg Arg Ala Gly Gly Val Leu Val Ala | |
| Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr Arg | |
| Val Leu Arg His Leu Ala Gln Pro Ser Gly Gly Ser | |
| Gly Gly Ser Gln Ser Phe Leu Leu Lys Ser Leu Glu | |
| Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala Leu | |
| Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His | |
| Pro Glu Glu Leu Val Leu Leu Gly His Ser Leu Gly | |
| Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro Ser Gln | |
| Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln Leu His | |
| Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln Ala | |
| Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu | |
| Asp Thr Leu Gln Leu Asp Val Ala Asp Phe Ala Thr | |
| Thr Ile Trp Gln Gln Met Glu Glu Leu Gly Met Ala | |
| Pro Ala Leu Gln Pro |
Construction of pMON31112
Construction of pMON31112, a plasmid containing DNA sequence encoding a multi-functional hematopoietic receptor agonist which activates the hIL-3 receptor and G-CSF receptor. Plasmid, pMON13189 DNA was digested with restriction enzymes NcoI and XmaI resulting in an NcoI, XmaI vector fragment that was isolated and purified from a 0.8% agarose gel. The DNA from a second plasmid, pMON13222 (WO 94/12639, U.S. Ser. No. 08/411,796) was digested with NcoI and EcoRI resulting in a 281 base pair NcoI, EcoRI fragment. This fragment was isolated and purified from a 1.0% agarose gel. Two oligonucleotides SYNNOXA1.REQ (SEQ ID NO:350) and SYNNOXA2.REQ (SEQ ID NO:351) were annealed and ligated with the 281 base pair DNA fragment from pMON13222 to the DNA vector fragment from pMON13189. A portion of the ligation mixture was then transformed into E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis to show the presence of an EcoRV fragment, and sequenced to confirm the correct inserts.
The plasmid, pMON31112, contains the DNA sequence of (SEQ ID NO:37) which encodes the following amino acid sequence:
| (SEQ ID NO:505) |
| Met Ala Asn Cys Ser Asn Met Ile Asp Glu Ile Ile | |
| Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp | |
| Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu | |
| Met Asp Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala | |
| Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser | |
| Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys | |
| Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro | |
| Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg | |
| Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn | |
| Ala Gln Ala Gln Gln Tyr Val Glu Gly Gly Gly Gly | |
| Ser Pro Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile | |
| Asn Pro Ser Pro Pro Ser Lys Glu Ser His Lys Ser | |
| Pro Asn Met Ala Thr Gln Gly Ala Met Pro Ala Phe | |
| Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu | |
| Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser | |
| Tyr Arg Val Leu Arg His Leu Ala Gln Pro Ser Gly | |
| Gly Ser Gly Gly Ser Gln Ser Phe Leu Leu Lys Ser | |
| Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala | |
| Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu | |
| Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser | |
| Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro | |
| Ser Gln Ala Leu Glu Leu Ala Gly Cys Leu Ser Gln | |
| Leu His Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu | |
| Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro | |
| Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe | |
| Ala Thr Thr Ile Trp Gln Glu Met Glu Glu Leu Gly | |
| Met Ala Pro Ala Leu Gln Pro |
Construction of pMON31113, a plasmid containing DNA sequence encoding a multi-functional hematopoietic receptor agonist which activates the hIL-3 receptor and G-CSF receptor. Plasmid, pMON13197 DNA was digested with restriction enzymes NcoI and XmaI resulting in an NcoI, XmaI vector fragment that was isolated and purified from a 0.8% agarose gel. The DNA from a second plasmid, pMON13239 (WO 94/12639, U.S. Ser. No. 08/411,796) was digested with NcoI and EcoRI resulting in a 281 base pair NcoI, EcoRI fragment. This fragment was isolated and purified from a 1.0% agarose gel. Two oligonucleotides SYNNOXA1.REQ (SEQ ID NO:350) and SYNNOXA2.REQ (SEQ ID NO:351) were annealed and ligated with the 281 base pair DNA fragment from pMON13239 to the DNA vector fragment from pMON13197. A portion of the ligation mixture was then transformed into E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis to show the presence of an EcoRV fragment, and sequenced to confirm the correct inserts.
The plasmid, pMON31113, contains the DNA sequence of (SEQ ID NO:38) which encodes the following amino acid sequence:
| (SEQ ID NO:506) |
| Met Ala Asn Cys Ser Asn Met Ile Asp Glu Ile Ile | |
| Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp | |
| Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu | |
| Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala | |
| Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser | |
| Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys | |
| Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro | |
| Ile Ile Ile Arg Asp Gly Asp Trp Asn Glu Phe Arg | |
| Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn | |
| Ala Gln Ala Gln Gln Tyr Val Glu Gly Gly Gly Gly | |
| Ser Pro Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile | |
| Asn Pro Ser Pro Pro Ser Lys Glu Ser His Lys Ser | |
| Pro Asn Met Ala Thr Gln Gly Ala Met Pro Ala Phe | |
| Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu | |
| Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser | |
| Tyr Arg Val Leu Arg His Leu Ala Gln Pro Thr Pro | |
| Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu | |
| Leu Lys Ser Leu Glu Gln Val Arg Lys Ile Gln Gly | |
| Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr | |
| Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu | |
| Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser | |
| Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys | |
| Leu Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln | |
| Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu | |
| Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val | |
| Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu | |
| Glu Leu Gly Met Ala Pro Ala Leu Gln Pro | |
Construction of pMON31114
Construction of pMON31114, a plasmid containing DNA sequence encoding a multi-functional hematopoietic receptor agonist which activates the hIL-3 receptor and G-CSF receptor. Plasmid, pMON13189 DNA was digested with restriction enzymes NcoI and XmaI resulting in an NcoI, XmaI vector fragment that was isolated and purified from a 0.8% agarose gel. The DNA from a second plasmid, pMON13239 (WO 94/12639, U.S. Ser. No. 08/411,796), was digested with NcoI and EcoRI resulting in a 281 base pair NcoI, EcoRI fragment. This fragment was isolated and purified from a 1.0% agarose gel. Two oligonucleotides SYNNOXA1.REQ (SEQ ID NO:350) and SYNNOXA2.REQ (SEQ ID NO:351) were annealed and ligated with the 281 base pair DNA fragment from pMON13239 to the DNA vector fragment from pMON13189. A portion of the ligation mixture was then transformed into E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis to show the presence of an EcoRV fragment, and sequenced to confirm the correct inserts.
The plasmid, pMON31114, contains the DNA sequence of (SEQ ID NO:39) which encodes the following amino acid sequence:
| (SEQ ID NO:507) |
| Met Ala Asn Cys Ser Asn Met Ile Asp Glu Ile Ile | |
| Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp | |
| Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu | |
| Met Glu Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala | |
| Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser | |
| Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys | |
| Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro | |
| Ile Ile Ile Arg Asp Gly Asp Trp Asn Glu Phe Arg | |
| Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn | |
| Ala Gln Ala Gln Gln Tyr Val Glu Gly Gly Gly Gly | |
| Ser Pro Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile | |
| Asn Pro Ser Pro Pro Ser Lys Glu Ser His Lys Ser | |
| Pro Asn Met Ala Thr Gln Gly Ala Met Pro Ala Phe | |
| Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu | |
| Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser | |
| Tyr Arg Val Leu Arg His Leu Ala Gln Pro Ser Gly | |
| Gly Ser Gly Gly Ser Gln Ser Phe Leu Leu Lys Ser | |
| Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala | |
| Ala Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu | |
| Cys His Pro Glu Glu Leu Val Leu Leu Gly His Ser | |
| Leu Gly Ile Pro Trp Ala Pro Leu Ser Ser Cys Pro | |
| Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu Ser Gln | |
| Leu His Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu | |
| Gln Ala Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro | |
| Thr Leu Asp Thr Leu Gln Leu Asp Val Ala Asp Phe | |
| Ala Thr Thr Ile Trp Gln Gln Met Glu Glu Leu Gly | |
| Met Ala Pro Ala Leu Gln Pro |
Construction of pMON31115
Construction of pMON31115, a plasmid containing DNA sequence encoding a multi-functional hematopoietic receptor agonist which activates the hIL-3 receptor and G-CSF receptor. Plasmid, pMON13197 DNA was digested with restriction enzymes NcoI and XmaI resulting in an NcoI, XmaI vector fragment that was isolated and purified from a 0.8% agarose gel. The DNA from a second plasmid, pMON13222, was digested with NcoI and EcoRI resulting in a 281 base pair NcoI, EcoRI fragment. This fragment was isolated and purified from a 1.0% agarose gel. Two oligonucleotides SYNNOXA1.REQ (SEQ ID NO:350) and SYNNOXA2.REQ (SEQ ID NO:351) were annealed and ligated with the 281 base pair DNA fragment from pMON13222 to the DNA vector fragment from pMON13197. A portion of the ligation mixture was then transformed into E. coli K-12 strain JM101. Transformant bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated, analyzed by restriction analysis to show the presence of an EcoRV fragment, and sequenced to confirm the correct inserts.
The plasmid, pMON31115, contains the DNA sequence of (SEQ ID NO:40) which encodes the following amino acid sequence:
| (SEQ ID NO:508) |
| Met Ala Asn Cys Ser Asn Met Ile Asp Glu Ile Ile | |
| Thr His Leu Lys Gln Pro Pro Leu Pro Leu Leu Asp | |
| Phe Asn Asn Leu Asn Gly Glu Asp Gln Asp Ile Leu | |
| Met Asp Asn Asn Leu Arg Arg Pro Asn Leu Glu Ala | |
| Phe Asn Arg Ala Val Lys Ser Leu Gln Asn Ala Ser | |
| Ala Ile Glu Ser Ile Leu Lys Asn Leu Leu Pro Cys | |
| Leu Pro Leu Ala Thr Ala Ala Pro Thr Arg His Pro | |
| Ile His Ile Lys Asp Gly Asp Trp Asn Glu Phe Arg | |
| Arg Lys Leu Thr Phe Tyr Leu Lys Thr Leu Glu Asn | |
| Ala Gln Ala Gln Gln Tyr Val Glu Gly Gly Gly Gly | |
| Ser Pro Gly Glu Pro Ser Gly Pro Ile Ser Thr Ile | |
| Asn Pro Ser Pro Pro Ser Lys Glu Ser His Lys Ser | |
| Pro Asn Met Ala Thr Gln Gly Ala Met Pro Ala Phe | |
| Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly Val Leu | |
| Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser | |
| Tyr Arg Val Leu Arg His Leu Ala Gln Pro Thr Pro | |
| Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu | |
| Leu Lys Ser Leu Glu Gln Val Arg Lys Ile Gln Gly | |
| Asp Gly Ala Ala Leu Gln Glu Lys Leu Cys Ala Thr | |
| Tyr Lys Leu Cys His Pro Glu Glu Leu Val Leu Leu | |
| Gly His Ser Leu Gly Ile Pro Trp Ala Pro Leu Ser | |
| Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys | |
| Leu Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln | |
| Gly Leu Leu Gln Ala Leu Glu Gly Ile Ser Pro Glu | |
| Leu Gly Pro Thr Leu Asp Thr Leu Gln Leu Asp Val | |
| Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln Met Glu | |
| Glu Leu Gly Met Ala Pro Ala Leu Gln Pro |
Determination of the In Vitro Activity of Multi-Functional Hematopoietic Receptor Agonist Proteins
The protein concentration of the multi-functional hematopoietic receptor agonist protein can be determined using a sandwich ELISA based on an affinity purified polyclonal antibody. Alternatively the protein concentration can be determined by amino acid composition analysis. The bioactivity of the multi-functional hematopoietic receptor agonist can be determined in a number of in vitro assays. For example a multi-functional hematopoietic receptor agonist which binds the hIL-3 receptor and G-CSF receptor can be assayed in cell proliferation assays using cell lines expressing the hIL-3 and/or G-CSF receptors. One such assay is the AML-193 cell proliferation assay. AML-193 cells respond to IL-3 and G-CSF which allows for the combined bioactivity of the IL-3/G-CSF multi-functional hematopoietic receptor agonist to be determined. Another such assay is the TF1 cell proliferation assay.
In addition other factor dependent cell lines, such as M-NFS-60 (ATCC. CRL 1838) or 32D which are murine IL-3 dependent cell line, may be used. The activity of IL-3 is species specific whereas G-CSF is not, therefore the bioactivity of the G-CSF component of the IL-3/G-CSF multi-functional hematopoietic receptor agonist can be determined independently. Cell lines, such as BHK or murine Baf/3, which do not express the receptor for a given ligand can be transfected with a plasmid containing a gene encoding the desired receptor. An example of such a cell line is BaF3 transfected with the hG-CSF receptor (BaF3/hG-CSF). The activity of the multi-functional hematopoietic receptor agonist in these cell lines can be compared with hIL-3 or G-CSF alone or together. The bioactivity of examples of multi-functional hematopoietic receptor agonists of the present invention assayed in the BaF3/hG-CSF cell proliferation and TF1 cell proliferation assays is shown in Table 5 and Table 6. The bioactivity of the multi-functional hematopoietic receptor agonist is expressed as relative activity compared with a standard protein pMON13056 (WO 95/21254) which has IL-3 and G-CSF receptor binding activity. The bioactivity of examples of multi-functional hematopoietic receptor agonists of the present invention assayed in the BaF3/c-mpl cell proliferation and TF1 cell proliferation assays is shown in Table 7 and Table 8.
| TABLE 5 |
| CELL PROLIFERATIVE ACTIVITY |
| OF DUAL IL-3/G-CSF RECEPTOR AGONISTS |
| BaF3/hG-CSF receptor cell | TF1 | |
| proliferation assay | cell proliferation assay | |
| pMON | relative activity* | relative activity* |
| 13182 | 0.015 | 1.1 |
| 13183 | 0.02 | nd |
| 13184 | 0.01 | 0.3 |
| 13185 | 0.023 | 0.36 |
| 13186 | 0.36 | 0.45 |
| 13187 | 0.07 | 0.26 |
| 13188 | 0.64 | 1.3 |
| 13189 | 0.58 | 1.37 |
| 13190 | 0.045 | 1.2 |
| 13191 | 0.14 | 2.7 |
| 13192 | 0.09 | 2.2 |
| 13193 | 0.06 | 3.0 |
| 25190 | nd | nd |
| 25191 | 0.43 | 1.2 |
| 13194 | nd | nd |
| 13195 | 1.3 | 4.3 |
| 13196 | 0.66 | 0.5 |
| 13197 | 0.6 | 0.77 |
| 13198 | 0.6 | 0.5 |
| 13199 | nd | nd |
| 15982 | 0.7 | 1.9 |
| 15981 | 0.068 | 1.2 |
| 15965 | 0.7 | 0.82 |
| 15966 | 0.36 | 1.48 |
| 15967 | 0.62 | 1.37 |
nd = not determined |
||
*The bioactivity of the multi-functional hematopoietic receptor agonist is expressed as relative activity compared with a standard protein pMON13056. n = 3 or greater |
| TABLE 6 |
| CELL PROLIFERATIVE ACTIVITY |
| OF DUAL IL-3/G-CSF RECEPTOR AGONISTS |
| BaF3/hG-CSF receptor | TF1 | |
| cell proliferation assay | cell proliferation assay | |
| pMON | relative activity | relative activity |
| 31104 | + | + |
| 31105 | + | + |
| 31106 | + | + |
| 31107 | nd | nd |
| 31108 | + | + |
| 31109 | + | + |
| 31110 | nd | nd |
| 31111 | nd | nd |
| 31112 | + | + |
| 31113 | + | + |
| 31114 | + | + |
| 31115 | + | + |
| 31116 | nd | nd |
| 31117 | nd | nd |
nd = not determined |
||
β The bioactivity (n = 1 or 2) of the multi-functional hematopoietic receptor agonist is expressed as relative activity compared with a standard protein pMON13056. |
||
β+β indicates that the molecule was comparable to pMON13056. |
| TABLE 7 |
| CELL PROLIFERATION ACTIVITY |
| Baf3/c-mpl receptor | TF1 | |
| cell proliferation | cell proliferation | |
| assay | assay | |
| pMON | activity* | activity |
| 28505 | β | + |
| 28506 | β | + |
| 28507 | β | + |
| 28508 | β | + |
| 28509 | β | + |
| 28510 | β | + |
| 28511 | + | + |
| 28512 | + | + |
| 28513 | + | + |
| 28514 | + | + |
| 28519 | β | + |
| 28520 | β | + |
| 28521 | β | + |
| 28522 | β | + |
| 28523 | β | + |
| 28524 | β | + |
| 28525 | + | + |
| 28526 | + | + |
| 28533 | β | + |
| 28534 | β | + |
| 28535 | β | + |
| 28536 | β | + |
| 28537 | β | + |
| 28538 | β | + |
| 28539 | + | + |
| 28540 | + | + |
| 28541 | + | + |
| 28542 | + | + |
| 28543 | + | + |
| 28544 | + | + |
| 28545 | + | + |
*Activity measured in the Baf3 cell line transfected with the c-mpl receptor, relative to c-mpl ligand (1-153). |
||
β Activity measured relative to pMON13056. |
In a similar manner other factor dependent cell lines known to those skilled in the art can be used to measure the bioactivity of the desired multi-functional hematopoietic receptor agonist. The methylcellulose assay can be used to determine the effect of the multi-functional hematopoietic receptor agonists on the expansion of the hematopoietic progenitor cells and the pattern of the different types of hematopoietic colonies in vitro. The methylcellulose assay can provide an estimate of precursor frequency since one measures the frequency of progenitors per 100,000 input cells. Long term, stromal dependent cultures have been used to delineate primitive hematopoietic progenitors and stem cells. This assay can be used to determine whether the multi-functional hematopoietic receptor agonist stimulates the expansion of very primitive progenitors and/or stem cells. In addition, limiting dilution cultures can be performed which will indicate the frequency of primitive progenitors stimulated by the multi-functional hematopoietic receptor agonist.
| TABLE 8 | ||
| c-mpl receptor agonist | ||
| IL-3 agonist activity | activity | |
| (AML cell proliferation | (Baf/3-c-mpl cell | |
| pMON # | assay) | proliferation assay |
| 28505 | + | β |
| 28506 | + | β |
| 28507 | + | β |
| 28508 | + | β |
| 28509 | + | β |
| 28510 | + | β |
| 28511 | + | + |
| 28512 | + | + |
| 28513 | + | + |
| 28514 | + | + |
| 28515 | + | + |
| 28519 | + | β |
| 28520 | + | β |
| 28521 | + | β |
| 28522 | + | β |
| 28523 | + | β |
| 28524 | + | β |
| 28525 | + | + |
| 28526 | + | + |
| 28527 | + | + |
| 28528 | + | + |
| 28529 | + | + |
| 28535 | + | β |
| 28539 | + | + |
| 28540 | + | + |
| 28541 | + | + |
| 28542 | + | + |
| 28545 | + | + |
| 28551 | + | + |
| 28571 | + | + |
G-CSF variants which contain single or multiple amino acid substitutions were made using PCR mutagenesis techniques as described in WO 94/12639 and WO 94/12638. These and other variants (i.e. amino acid substitutions, insertions or deletions and N-terminal or C-terminal extensions) could also be made, by one skilled in the art, using a variety of other methods including synthetic gene assembly or site-directed mutagenesis (see Taylor et al., Nucl. Acids Res., 13: 7864-8785 [1985]; Kunkel et al., Proc. Natl. Acad. Sci. USA, 82: 488-492 [1985]; Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., [1989], (WO 94/12639) and (WO 94/12638)). These substitutions can be made one at a time or in combination with other amino acid substitutions, and/or deletions, and/or insertions and/or extensions. After sequence verification of the changes, the plasmid DNA can be transfected into an appropriate mammalian cell, insect cell or bacterial strain such as E. coli for production. Known variants of G-CSF, which are active, include substitutions at positions 1 (Thr to Ser, Arg or Gly, 2 (Pro to Leu), 3 (Leu to Arg or Ser) and 17 (Cys to Ser) and deletions of amino acids 1-11 (Kuga et al. Biochemicla and Biophysical Research Comm. 159:103-111 (1989)). These G-CSF amino acid substitution variants can be used as the template to create the G-CSF receptor agonists in which a new N-terminus and new C-terminus are created. Examples of G-CSF amino acid substitution variants are shown in Table 9.
EXAMPLE 89Bioactivity Determination of G-CSF Amino Acid Substitution Variants
G-CSF amino acid substitution variants can be assayed for cell proliferation activity using the Baf/3 cell line transfected with the human G-CSF receptor. The bioactivity of examples of G-CSF amino acid substitution variants is shown in Table 9 relative to native human G-CSF. A β+β indicates a comparable activity to native and a βββ indicates significantly reduced or no measurable activity.
| TABLE 9 |
| CELL PROLIFERATION ACTIVITY OF G-CSF |
| VARIANTS IN BAF3 CELL LINE TRANSFECTED |
| WITH THE HUMAN G-CSF RECEPTOR |
| aa position | native aa | mutant aa | activity* |
| 13 | Phe | Ser | + |
| 13 | Phe | His | + |
| 13 | Phe | Thr | + |
| 13 | Phe | Pro | + |
| 16 | Lys | Pro | + |
| 16 | Lys | Ser | + |
| 16 | Lys | Thr | + |
| 16 | Lys | His | + |
| 18 | Leu | Pro | + |
| 18 | Leu | Thr | + |
| 18 | Leu | His | + |
| 18 | Leu | Cys | + |
| 18 | Leu | Ile | + |
| 19 | Glu | Ala | β |
| 19 | Glu | Thr | β |
| 19 | Glu | Arg | β |
| 19 | Glu | Pro | β |
| 19 | Glu | Leu | β |
| 19 | Glu | Ser | β |
| 22 | Arg | Tyr | + |
| 22 | Arg | Ser | + |
| 22 | Arg | Ala | + |
| 22 | Arg | Thr | + |
| 24 | Ile | Pro | + |
| 24 | Ile | Leu | + |
| 24 | Ile | Tyr | + |
| 27 | Asp | Gly | + |
| 30 | Ala | Ile | + |
| 30 | Ala | Leu | + |
| 34 | Lys | Ser | + |
| 43 | His | Gly | + |
| 43 | His | Thr | + |
| 43 | His | Val | + |
| 43 | His | Lys | + |
| 43 | His | Trp | + |
| 43 | His | Ala | + |
| 43 | His | Arg | + |
| 43 | His | Cys | + |
| 43 | His | Leu | + |
| 44 | Pro | Arg | + |
| 44 | Pro | Asp | + |
| 44 | Pro | Val | + |
| 44 | Pro | Ala | + |
| 44 | Pro | His | + |
| 44 | Pro | Gln | + |
| 44 | Pro | Trp | + |
| 44 | Pro | Gly | + |
| 44 | Pro | Thr | + |
| 46 | Glu | Ala | + |
| 46 | Glu | Arg | + |
| 47 | Leu | Thr | + |
| 49 | Leu | Phe | + |
| 49 | Leu | Arg | + |
| 49 | Leu | Ser | + |
| 50 | Leu | His | + |
| 54 | Leu | His | + |
| 67 | Gln | Lys | + |
| 67 | Gln | Leu | + |
| 67 | Gln | Cys | + |
| 70 | Gln | Pro | + |
| 70 | Gln | Leu | + |
| 70 | Gln | Arg | + |
| 70 | Gln | Ser | + |
| 104 | Asp | Gly | + |
| 104 | Asp | Val | + |
| 108 | Leu | Ala | + |
| 108 | Leu | Val | + |
| 108 | Leu | Arg | + |
| 108 | Leu | Gly | + |
| 108 | Leu | Trp | + |
| 108 | Leu | Gln | + |
| 115 | Thr | His | + |
| 115 | Thr | Leu | + |
| 115 | Thr | Ala | + |
| 144 | Phe | His | + |
| 144 | Phe | Arg | + |
| 144 | Phe | Pro | + |
| 144 | Phe | Leu | + |
| 144 | Phe | Glu | + |
| 146 | Arg | Gln | + |
| 147 | Arg | Gln | + |
| 156 | His | Asp | β |
| 156 | His | Ser | + |
| 156 | His | Gly | + |
| 159 | Ser | Arg | + |
| 159 | Ser | Thr | + |
| 159 | Ser | Tyr | + |
| 159 | Ser | Val | + |
| 159 | Ser | Gly | + |
| 162 | Glu | Gly | β |
| 162 | Glu | Trp | + |
| 162 | Glu | Leu | + |
| 163 | Val | Arg | + |
| 163 | Val | Ala | + |
| 163 | Val | Gly | + |
| 165 | Tyr | Cys | nd |
| 169 | Ser | Leu | + |
| 169 | Ser | Cys | + |
| 169 | Ser | Arg | + |
| 170 | His | Arg | + |
| 170 | His | Ser | + |
*activity relative to native hG-CSF |
|||
nd = not determined |
Isolation of cDNA Encoding flt3 Ligand
Three flt3 ligand clones were amplified from human bone morrow poly A+ RNA (Clontech) using NCOFLT, HIND160, and HIND165 PCR primers (according to the manufacturer's suggested conditions). These amplified PCR products were gel purified and cloned into the BHK expression vector pMON5723 generating pMON30237 (NCOFLT+HIND160), pMON30238 (NCOFLT+HIND165), and a deletion clone pMON30239 (NCOFLT+HIND165). The deletion in pMON30239 is of amino acid residues 89 through
EXAMPLE 91Sequence rearranged flt3 receptor agonists were constructed using several methods and linker types. The first set of constructs containing the linker peptide (SerGlyGlyAsnGly)X (where X=1, 2, or 3) with the breakpoints 39/40, 65/66, and 89/90 were made using a two step PCR process described by Mullins et al. in which the front half and the back half of each final sequence rearranged molecule is made separately in the first PCR step, then the paired products of the first reaction step are combined in a second PCR step and extended in the absence of exogenous primers.
For example, to make the three 89/90 breakpoint precursor molecules with SerGlyGlyAsnGly SEQ ID NO:786, SerGlyGlyAsnGlySerGlyGlyAsnGly SEQ ID NO:787, and SerGlyGlyAsnGlySerGlyGlyAsnGlySerGlyGlyAsnGly SEQ ID NO:788 amino acid linkers (pMON32326, pMON32327 and pMON32328 respectively), six initial PCR products were generated. The following primer pairs were used in the first step PCR reaction: a) 89For/L5B; b) 89For/L10B; c) 89For/L15B; d) 89Rev/L5A; e) 89Rev/L10A; and f) 89Rev/L15A. The identical approach was used to make pMON32321 (39/40 breakpoint, primer pairs 39For/L10B and 39Rev/L10A) and pMON32325 (65/66 breakpoint, primer pairs 65For/L5B and 65Rev/L5A) precursors. Except as noted below, all subsequent PCR reactions utilized the components of the PCR Optimizer Kit (Invitrogen) and amplification conditions according to the manufacturers suggested protocol. Reactions were set up as follows: 50 pmol of each primer, 10 ul of 5Γ Buffer B [300 mM Tris-HCl (pH 8.5), 10 mM MgCl2, 75 mM (NH4)2SO4], 5 U Taq polymerase, and 100 ng of heat denatured DNA (in this example pMON30238) template were combined, and brought to 45 ul final volume with dH2O. Reactions were preincubated for 1-5 minute at 80Β° C., then 5 ul of 10 mM dNTP added to each reaction, and heat denatured for 2 minutes at 94Β° C. prior to amplification in a Perkin Elmer model 480 DNA thermal cycler. Seven DNA amplification cycles were done under the following conditions: heat denature for one minute at 94Β° C., two minutes annealing at 65Β° C., followed by a three minute extension at 72Β° C. Twenty three additional cycles consisting of a one minute heat denaturation at 94Β° C. followed by a four minute annealing/extension at 72Β° C. were done, followed by a final 7 minute extension cycle at 72Β° C. With the exception of pMON32328, the PCR amplification products were run out on a 1.2% TAE agarose gel, and the appropriate size bands (the major amplification product) were excised and purified using Geneclean II (Bio 101). Samples were resuspended in 10 ul dH2O. The amplification products for pMON32328 were purified directly using a Wizard PCR Clean UP kit (Promega), and DNA eluted in 50 ul dH2O.
The method to construct the precursors of pMON32322 (39/40 breakpoint, primer pairs 39For/L5B and 39Rev/L5A) was modified by increasing the amount of template to 1 ug, and by changing the PCR amplification conditions as follows: six cycles of 94Β° C., 1 minute, 65Β° C. for 2 minute, and 72Β° C. for 2Β½ minutes, followed by 15 cycles of 94Β° C. for 1 minute, 70Β° C. for 2 minutes, and 72Β° C. for 2 minutes, followed by a single 72Β° C. extension cycle for seven minutes.
The second PCR step utilized the gel-purified precursors from the first PCR step as a combination of primer/template as follows: 5 ul each of each precursor molecule (i.e. for pMON32328 the PCR products from primer pairs 89For/L5B and 89Rev/L5A), 10 ul of SX Buffer B, 5 U of Taq polymerase, and 24 ul dH2O. The reactions were heated for five minutes at 80Β° C., 5 ul of 10 mM dNTP was added, and the reactions heat denatured for 94Β° C. for two minutes. DNA amplification conditions were as follows: 15 cycles of 94Β° C. for one minute, 69Β° C. for two minutes, followed then by a three minute extension at 72Β° C. To allow for complete extension, the last cycle was followed by a single extension step at 72Β° C. for seven minutes. The 80 deg incubation time was reduced to two minutes and the number of cycles was decreased to ten cycles for pMON32325 (PCR products 65For/L5B and 65Rev/L5A). PCR reaction products of the appropriate size were gel purified on a 1.2% TAE agarose gel using Geneclean II. For pMON32322 (39For/L5B and 39Rev/L5A) the annealing temperature was reduced to 68Β° C., and the extension time reduced to two minutes. In addition, the PCR product was purified using a Wizard PCR Clean Up kit (Promega) according to the suppliers suggested protocol. The second PCR step was modified for pMON32326 (PCR products of 89For/L15B and 89Rev/L15A) as follows. Three sets of PCR reactions were set up identically as above, except for the sample buffer type (either 5Γ buffer B, D, or J-PCR Optimizer Kit). Composition of buffers D and J differ from buffer B only by pH or [MgCl2]. The [MgCl2] for buffer D is 3.5 mM, whereas the pH of buffer J is 9.5. The protocol was modified by increasing the number of PCR cycles 20, and 15 ul aliquots were withdrawn at the end of cycles 10, 15 and 20. Five uls of each aliquot timepoint were analyzed for the presence of amplified material on a 1.2% TBE agarose gel. The remainder of the buffer B, D, and J PCR reaction mixtures were pooled and subsequently purified using the Wizard PCR Clean Up Kit protocol. The DNA was eluted in 50 ul dH2O.
The purified samples from the second step PCR reaction were digested with NcoI/HindIII using one of two standardized digestion conditions. For Geneclean II purified samples, 10 ul of DNA were digested in a 20 ul reaction with 7.5 U each of NcoI/HindIII for two hours at 37Β° C., and gel purified on a 1.1% TAE agarose gel again with Geneclean II. Ligation-ready samples were resuspended in 10 ul dH2O. For pMON32322, 20 ul of sample was digested in a 50 ul reaction volume with 20U each of NcoI and HindIII for 3 hour at 37Β° C. 0.1 volume 3M NaOAc (pH 5.5) and 2.5 volume of EtOH were added, mixed, and stored at β20Β° C. overnight. The DNA was recovered by pelleting for 20 minutes at 13,000 rpm@ 4Β° C. in a Sigma Mk 202 microfuge. The DNA pellet was rinsed with chilled 70% EtOH, lyophilized, and resuspended in 10 ul dH2O.
EXAMPLE 92An alternate approach was used to construct pMON32320 (39/40 breakpoint, fifteen amino acid linker), pMON32323 (65/66 breakpoint, fifteen AA linker), and pMON32324 (65/66 breakpoint, ten amino acid linker). New primers (L15C, L15D, L15E) were designed to incorporate BamHI restriction site in the primer that was inframe to allow cloning into the BamHI site and maintain the proper reading frame. PCR reaction conditions for the first step were performed identically to that described for pMON32322, except that the following set of primer pairs were used: 65For/L15D and 65Rev/L15E (pMON32324); 39For/L15D and 39Rev/L15C (pMON32320); and 65For/L15D and 65Rev/L15C (pMON32323). The PCR reaction products were purified using a Wizard PCR Clean Up kit as described, and eluted in 50 ul dH2O. Samples were digested with either NcoI/BamHI (39For/L15D and 65For/L15D) or BamHI/HindIII (39Rev/L15C, 65Rev/L15C, and 65Rev/L15E). Restriction digests were performed as follows: 10 ul of purified PCR reaction products, 3 ul of 10Γ universal restriction buffer, 15 U of either NcoI or HindIII, 15 U of BamHI, in a final reaction volume of 30 ul. Reactions were incubated for 90 minutes at 37Β° C., and the PCR products gel purified on a 1.1% TAE agarose gel using Geneclean II. Ligation-ready DNA was resuspended in 10 ul dH2O.
Inserts were ligated to NcoI/HindIII digested pMON3977 (BHK mammalian expression vector) that had been treated with shrimp alkaline phosphatase (SAP) either in a three way (pMON32320, pMON32323, or pMON32324) or a two way (pMON32321, pMON32322, pMON32325, pMON32326, pMON32327 and pMON32328) ligation reaction as follows: 2.5 ul of insert (2 ul of each primer pair amplicon for pMON32320, pMON32323, and pMON32324) was added to 50 ng of vector in a ten ul reaction using standard ligation conditions. Two ul of each reaction was transformed with 100 ul of chemically competent DH5Ξ± cells (Gibco/BRL) following the manufacturers suggested protocol. Twenty five ul and 200 ul aliquots were plated out on LB plates containing 50 ug/ml ampicillin and incubated overnight. Isolated colonies were picked and DNA prepared from 50 ml overnight cultures using Qiagen DNA midiprep kits. DNA was quantitated by absorbance at A260/A280, and verified for correct insert size by agarose gel electrophoresis following digestion of 1 ug template with NcoI/HindIII restriction endonucleases. Samples containing inserts of the predicted size were sequenced in both orientations using vector-specific primers using an automated fluorescent DNA sequencer model 373A (Perkin Elmer ABI). Sequencing reactions were done in 20 ul reaction volumes using a Perkin Elmer model 480 DNA thermal cycler as follows: one ug of template, 3.2 pmol primer, 1 ul DMSO, 9.5 ul Taq terminator dideoxy premix Perkin Elmer ABI) were combined, and subjected to 25 cycles of sequencing amplification as follows: 30 seconds at 94Β° C., 15 second annealing at 50Β° C., followed by a four minute extension cycle at 60Β° C. Samples were purified using Centri-Sep spin columns (Princeton Separations) following the manufacturers suggested protocol, lyophilized, and submitted for sequence analysis. Samples containing the predicted amino acid sequence were selected for analysis and assigned pMON numbers.
EXAMPLE 93A similar approach used to construct pMON32320, pMON32323, and pMON32324 was utilized to introduce the second linker type (SerGlyGlySerGly)X where x=2 or 3, into two sequence rearranged sequences containing the 39/40 breakpoint (pMON32348 and 32350). The primer pairs were as follows: for pMON32348 the combinations of 339For2/339Rev3 and 339Rev2/339-10For3 and for pMON32350 the combinations of 339For2/339Rev3 and 339Rev2/339-15For3 were used to create three PCR amplification products. Each PCR amplification was set up as follows: to 100 ng of heat denatured pMON32320, 50 pmol of each primer pair, 10 ul of 5Γ Buffer B, 5 U of Taq polymerase and dH2O was added to a final volume of 45 ul. Reactions were preincubated as described before. Fifteen amplification cycles were done under the following conditions: heat denature at 94Β° C., one minute, followed by a two minute annealing step at 70Β° C., and a three minute extension at 72Β° C. After the last cycle, a single 72 deg extension step of 7 minutes was done. The PCR amplification products of primer pairs 339For2/339Rev3, 339Rev2/339-10For3, and 339Rev2/339-15For2 were purified using a Wizard PCR Clean Up kit (Promega), and eluted in 50 ul dH2O. NcoI/BamHI digests for the 339For2/339Rev3 primer pair as follows: 8 ul of DNA template was mixed with 2 ul universal restriction buffer and 10 U each of NcoI and BamHI in a 20 ul reaction volume, and incubated for 90 minutes at 37Β° C. The digestion products was purified using the Geneclean II direct purification protocol, and ligation ready DNA resuspended in 10 ul dH2O. The restriction digests and subsequent purification for the 339Rev2/339-10For3 and 339Rev2/339-15For2 amplification products were done identically as described for the 339For2/339Rev3 amplicon, except that 10 U of HindIII was substituted for NcoI. Standard ligations were done by adding to 50 ng NcoI/HindIII/SAP-treated, gel purified pMON3977, 0.5 ul 339For2/Rev3 amplicon, 1 ul of either 339Rev2/339-10For3 (pMON32348) or 339Rev2/339-15For3 (pMON32350) amplicons, 5U T4 DNA ligase, and 1 ul 10Γ ligase buffer in a 10 ul reaction volume for 60 minutes at ambient temperature. Subsequent steps leading to final DNA sequence confirmation were done as described above.
EXAMPLE 94A third type of linker, with a variable (GlyGlyGlySer)X repeat motif, was incorporated into another set of sequence rearranged flt3 receptor agonists from modularly constructed templates. These linker lengths were; 6 AA linker (GlyGlyGlySerGlyGly SEQ ID NO:792), 7 AA linker (GlyGlyGly SerGlyGlyGly SEQ ID NO:793), 10 AA linker (GlyGlyGlySerGlyGly GlySerGlyGly SEQ ID NO:794), 13 AA linker (GlyGlyGlySerGly GlyGlySerGlyGlyGlySerGly SEQ ID NO:795), 15 AA linker (GlyGlyGlySerGlyGlyGlySerGlyGlyGly SerGlyGlyGly SEQ ID NO:796); and 21 AA linker (GlyGlyGlySerGlyGlyGlySerGly GlyGlySerGlyGlyGlySerGlyGlyGlySerGly SEQ ID NO:797) amino acid residues. These modular templates, each comprising a dimer of hflt3 ligand separated by a BamHI-containing linker of unique length, were constructed as follows. Six intermediate PLASMID templates, FL3N, FL7N, FL11N, FL3C, FL4C, and FL10C, were constructed by PCR using paired primers and pMON30238 as template using cycling conditions similar to those employed for pMON32322. Per reaction, 50 pmol of each primer was added to 100 ng of heat-denatured template and the reactions assembled as described for pMON32322. Cycle conditions were as follows: seven cycles of 94Β° C., one minute; two minutes at 65Β° C., and 2.5 minutes at 72Β° C.; followed by ten cycles of one minute at 94Β° C., two minutes at 70Β° C., and 2.5 minutes at 72Β° C. A single seven minute extension at 72Β° C. completed the cycling reactions. The primer pairs used to construct each intermediate were; N-term/FLN3 (FL3N); N-term/FLN7 (FL7N); N-term/FLN11 (FL11N); C term/FLC3 (FL3C); C-term/FLC4 (FL4C); and C-term/FLC10 (FL10C). The PCR amplification products were purified with Wizard PCR Clean Up kits (Promega) and eluted in 50 ul dH2O. Purified DNA for the first subset, FL3N, FL7N, and FL11N, were digested with NcoI/BamHI, gel purified as described previously, and ligated to NcoI/BamHI/Sap-treated pSE420 vector DNA (Invitrogen). Intermediate templates of the second subset, FL3C, FL4C, and FL10C, were constructed in an identical manner except HindIII was utilized instead of NcoI. Subsequent steps leading to final DNA sequence confirmation were done as described above.
EXAMPLE 95To make the final six templates, the two subsets of intermediates in pSE420 were digested with either NcoI/BamHI (FL3N, FL7N, FL11N-subset 1) or BamHI/HindIII (FL3C, FL4C, FL10C-subset 2) and gel purified using Geneclean II as described previously. One intermediate amplicon from each subset were ligated to NcoI/HindIII/SAP-treated pMON3977 per reaction and transformed in DH5Ξ± cells as described previously using the following combinations to generate specific linker lengths: six AA linker (FL3N and FL3C), seven AA linker (FL3N and FL4C), ten AA linker (FL7N and FL3C), thirteen AA linker (FL3N and FL10C), fifteen AA linker (FL11N and FL4C), and 21 AA linker (FL11N and FL10C). DNA was prepared 50 ml overnight cultures from single colonies from each of the six combination as described above, analyzed for correct insert size by NcoI/HindIII restriction analysis, and used as template.
Primer pairs 39For/39Rev (39/40 breakpoint); 65For/65Rev (65/66 breakpoint) and 89For/89Rev (89/90 breakpoint) were used to PCR amplify each templates as described for pMON32322, except 75 pmol of each primer was used. Amplification conditions were modified as follows: six cycles of 94Β° C. for one minute, 2 minutes at 70Β° C., 2.5 minutes at 72Β° C.; followed by nine cycles of 94Β° C. for one minute, and three minutes at 72Β° C. After the last cycle, a final extension of six minutes at 72Β° C. allowed ample time for full extension of products. Samples were purified using a Wizard PCR Clean Up kit as described, and double digested with NcoI/HindIII. These amplification products were purified again using a Wizard PCR Clean Up kit. In addition, all six different linker length molecules for the 39/40 breakpoint were cloned into NcoI/HindIII/SAP-treated pMON3977 as single proteins (pMON32365, pMON32366, pMON32367, pMON32368, pMON32369 and 32370). Subsequent steps leading to final DNA sequence confirmation were done as described above.
EXAMPLE 96Genes encoding multi-functional chimeric receptor agonist molecules consisting of an IL-3 receptor agonist, of pMON13416 (WO 94/12638) joined via an IgG2b linker to either native flt3 ligand or sequence rearranged flt3 receptor agonists, Examples 91-93, were constructed. Inserts containing the desired sequence rearranged flt3 receptor agonists molecule were isolated from the parental plasmid as a NcoI/HindIII restriction fragment and ligated to pMON30304 digested with AflIII/Hind III/SAP Subsequent steps leading to final DNA sequence confirmation were done as described above.
The resulting plasmids, containing the DNA sequences encoding multi-functional chimeric molecules comprising an IL-3 receptor agonist (from pMON13416) and a sequence rearranged flt3 receptor agonist are indicated in Table 10.
| TABLE 10 | ||
| hflt3 ligand permutein | ||
| Resulting Plasmid | precursors | |
| pMON30247 | pMON30237 | |
| pMON30248 | pMON30238 | |
| pMON32332 | pMON32321 | |
| pMON32333 | pMON32320 | |
| pMON32334 | pMON32325 | |
| pMON32335 | pMON32324 | |
| pMON32336 | pMON32323 | |
| pMON32337 | pMON32328 | |
| pMON32338 | pMON32327 | |
| pMON32339 | pMON32326 | |
Genes encoding multi-functional chimeric receptor agonist molecules consisting of an IL-3 receptor agonist, of pMON13288 (WO 94/12638) joined via an IgG2b linker to either native flt3 ligand or sequence rearranged flt3 receptor agonists, Examples 91-93, were constructed. Inserts containing the desired sequence rearranged flt3 receptor agonists molecule were isolated from the parental plasmid as a NcoI/HindIII restriction fragment and ligated to pMON30311 digested with AflIII/Hind III/SAP Subsequent steps leading to final DNA sequence confirmation were done as described above.
The resulting plasmids, containing the DNA sequences encoding multi-functional chimeric molecules comprising an IL-3 receptor agonist (from pMON13288) and a sequence rearranged flt3 receptor agonist are indicated in Table 11.
| TABLE 11 | ||
| Resulting Plasmid | Flt3 ligand precursors | |
| pMON32364 | pMON30237 | |
| pMON32377 | pMON30238 | |
| pMON32352 | pMON32321 | |
| pMON32353 | pMON32320 | |
| pMON32354 | pMON32325 | |
| pMON32355 | pMON32324 | |
| pMON32356 | pMON32323 | |
| pMON32357 | pMON32328 | |
| pMON32358 | pMON32327 | |
| pMON32359 | pMON32326 | |
| pMON32360 | pMON32348 | |
| pMON32362 | pMON32350 | |
| pMON32396 | pMON30239 | |
Two chimeric molecules with the sequence rearranged hflt3 receptor agonist component at the N-terminus of the chimeric molecule were constructed via PCR using pMON32360 and pMON32362 plasmid DNA as the template and primer pairs N-term/134rev and N-term/139 rev to replace the stop codon at the C terminus of the native flt3 ligand molecules with an inframe SnaBI restriction site. Reaction mixtures were set up as described previously for pMON32322. Cycle conditions and were as follows: seven cycles of 94Β° C., one minute, 65Β° C., two minutes, and 72Β° C. 2Β½ minutes and an additional 10 amplification cycles were performed in which the annealing temperature was elevated from 65Β° C. to 70Β° C. Samples were purified using the Wizard PCR Purification kit and protocol, and eluted in 50 ul dH2O, 20 ul of each sample was digested with NcoI and SnaBI. Plasmid, pMON26431, DNA was digested with NcoI and SnaBI and ligated with the NcoI/SnaBI digested PCR reactions. Transformation of competent DH5Ξ± cells and subsequent steps leading to final DNA sequence confirmation were done as described above.
EXAMPLE 99Five additional hflt3 ligand breakpoints were made using the indicated primers 28/29(28For/28Rev), 34/35(34For/34Rev), 62/63 (62For/62Rev), 94/95 (94For/94Rev), and 98/99 (98For/98Rev) to amplify the ten and fifteen amino acid linker (GlyGlyGlySer)x as described above. The resulting PCR products were digested with NcoI/HindIII and ligated into pMON30311, digested with AflIII/HindIII/SAP as described previously. Transformation of competent DH5Ξ± cells and subsequent steps leading to final DNA sequence confirmation were done as described above.
EXAMPLE 100For enhanced expression of sequence rearranged hflt3 receptor agonists in E. coli, N-terminal specific primers coding for degenerate codons were used to re-engineer both the 1-134 and 1-139 forms of native hflt3 ligand in the E. coli expression vector pMON5723. Primer pairs FH3AFor/SCF.rev (Ala2) and Flt23For/SCF (Gly2) were used to PCR amplify a N-terminal degenerate mixture of sequences encoding native flt3 ligand using reaction conditions as described for pMON23222, except that the number of amplification cycles was reduced to fifteen cycles of 1 minute at 95Β° C., 2 minutes at 55Β° C., and 2 Β½ minutes at 72Β° C. Amplicons were purified using Wizard PCR Clean up kit (Promega), and eluted in 50 ul dH2O.
Restriction digestion with NcoI/HindIII and subsequent gel purification using Geneclean II was performed as previously described. Inserts were ligated to NcoI/HindIII/SAP-treated, gel-purified pMON5723 plasmid DNA, and transformed into competent DH5Ξ± cells as previously described. Aliquots of transformed cells were plated out on LB agarose media plates containing 75 ug/mL spectinomycin, incubated for 14-16 hours at 37Β° C., and colonies counted. After confirmation of colonies, the remainder of each transformation mixture was incubated overnight (14-16 hr) at 37Β° C. in 2Γ5 mL of LB media containing 75 ug/mL spectinomycin. Miniprep DNA was prepared using a Wizard DNA 373A Miniprep kit (Promega) following the recommended protocol. Purified miniprep DNA was eluted in 50 ul dH2O, and 1-2 ul used to transform chemically competent MON207 cells. 25 and 200 ul aliquots were plated out on LB media plates containing 75 ug/mL spectinomycin, and incubated for 12-15 hours at 37Β° C. 40-50 well-isolated colonies representing each original primer pair were selected and streaked out on LB/spectinomycin master plates, and incubated an additional 4-6 hours at 37Β° C.
Individual sequence rearranged hflt3 receptor agonist clones were screened for E. coli expression in a 96 well microtiter format to select for improved expression levels. Per well, 100 ul of minimal M9 media (including 1% casamino acids) was inoculated by a single colony (40-50 isolates were analyzed for each hflt3 PCR primer pair), and incubated at 37Β° C. at 200 rpm for 3-4 hr (I=0) and induced by addition of 5 ul/well of 1 mg/mL freshly prepared Nalidixic acid (in 0.1 N NaOH). After an additional four hours incubation at 37Β° C. (I=4), approximately 5-10 ul aliquots were withdrawn from each well, and analyzed by light microscopy for the presence of refractile bodies, and the results scored as a approximate percentage of cells containing refractile bodies to the total number of cells. The clones having the highest expression levels were selected for 10 mL benchtop scale expression studies as follows. Five mL overnight cultures were grown in LB media in the presence of 75 ug/mL spectinomycin at 37Β° C. To 10 mL freshly prepared minimal M9 (with 1% casamino acids) in 125 mL shake flasks, inoculation with sufficient overnight cells to achieve an initial reading of 20 Klett units was done, and then incubated for Λ3-4 hours at 37Β° C. with shaking until a density of Λ110-150 Klett units was reached (I=0) and induced with 50 ul of freshly prepared Nalidixic acid (10 mg/mL in 0.1 N NaOH). One mL aliquots were removed and the cells pelleted for one minute in a microfuge. The supernatants were removed by aspiration and the pellets stored at β20Β° C. until ready for SDS-PAGE analysis. The remainder of the induced cells were incubated for an additional four hours at 37Β° C. with shaking, after this time point (I=4) cell density (in Klett units) was measured. A one mL aliquot was removed from each sample, pelleted and stored as described above. Another 5-10 ul aliquot was removed from each flask and analyzed by light microscopy for the presence of retractile bodies. Pelleted samples were resuspended in a volume (in ul) of 2Γ loading buffer (including 1% B-mercaptoethanol) equal to the I=4 Klett value, boiled for 5 minutes, and 6-7 ul loaded on a 12% or 14% Tris-Glycine SDS polyacrylamide gel (Novex) and electrophoresed for 90 minutes at 90 volts. Gels were fixed, stained and prepared for drying according the suggested protocol (Novex). Clones were selected at this point for scale up fermentation based upon enhanced expression levels of a single induced protein band (I=4) corresponding to the predicted size when compared to the I=0 samples.
Midiprep DNA was also prepared from selected clones expressing high level of induced protein as described previously and steps leading to final DNA sequence confirmation were done exactly as described above. These clones were designated pMON32329, pMON32330, pMON32341, and pMON32342
EXAMPLE 101A set of multi-functional receptor agonist chimeric molecules comprising an IL-3 receptor agonist (from pMON13288) and native flt3 ligand were also constructed for expression in E. coli. The genes encoding the multi-functional receptor agonist chimeric molecules from pMON32364 and pMON32377 were released from the parental vector by digestion with NcoI/Hind III and ligated to pMON5677 vector, transformed into MON207 cells, and single isolates picked, as described above. These constructs were designated pMON32394 (insert from pMON32364) and pMON32395 (insert from pMON32377).
EXAMPLE 102A truncated Flt3 receptor was isolated as a 1.4 Kb PCR product using 50 pmol of the primers FLTAFLS1 and FLTR1N with approximately long of the plasmid pMON27184 as the template. The primers were designed to produce an AflIII restriction site just 5β² to the first Asn codon of the mature coding sequence, as well as an EcoRI restriction site just 5β² to the putative transmembrane region. The reaction was digested with AflIII and EcoRI using standard reaction conditions and ligated into the NcoI/EcoRI digested plasmid pMON26458. This plasmid contains the following DNA sequence: 5β²-GGATCCACCATGAGCCGCCTGCCCGTCCTGCTCCTGCTCCAACTCCTGGTCCGCCCCGCCAT GGCTAAAGCTT-3β² SEQ ID NO:857, encoding the IL-3 signal sequence. This sequence contains a BamHI restriction site on the 5β² end, and includes the ATG methionine as the first amino acid of the signal sequence 3β² to the BamHI site. This signal sequence is cleaved by the cell, leaving a 5β² Met/Ala generated by fusing the NcoI site from the signal sequence fused to the AflIII site of the receptor produced in the PCR reaction. The entire truncated form of the receptor along with the IL-3 signal sequence could be cut back out of the vector as a BamHI/EcoRI digest (hIL3L/hFflt3R).
The catalytic domain of pMON30298 (hG-CSFR) was reengineered to create an in frame EcoRI restriction site at the transmembrane/cytoplasmic bound via PCR as follows. To 0.5 ug of heat denatured pMON30298, 100 pmole each of primers HGCFfor and HGCFrev, 10 ul of 5Γ buffer J, 5 U of Taq polymerase, and dH2O were added to a final volume of 45 ul as described. PCR amplification was done as follows: six cycles (one minute at 94Β° C., two minutes at 64Β° C., and three minutes at 70Β° C.), followed by nine cycles (one minute at 94Β° C., four minutes at 70Β° C.). A final one minute extension of seven minutes at 70Β° C. was done. Ten ul of each PCR reaction were gel purified using Geneclean II as described previously, and eluted in 10 ul dH2O. Samples were digested with 10 U each of EcoRI and HindIII in 20 ul reactions for 90 minutes at 37Β° C. Samples were gel purified again (Geneclean II) as described previously, and eluted in 10 ul dH2O. Two ul of insert were ligated to 50 ng of NcoI/HindIII/phosphatased pSE420 vector in a 10 ul reaction as described previously. Transformation of competent DH5Ξ± cells and subsequent steps leading to final DNA sequence confirmation were done exactly as described above. Selected clones were then sequenced to verify the presence of the in frame EcoRI site as well as confirmation of the correct G-CSFR catalytic domain DNA sequence. Clones containing the predicted sequence were digested with EcoRI/HindIII as described previously and gel purified. Purified inserts of the hG-SCFR (EcoRI/HindIII) and hIL3L/hFlt3R (BamHI/EcoRI) fragments were ligated to BamHI/HindIII/phosphatased pcDNA 3.1 (β) vector (Invitrogen). Transformation of competent DH5Ξ± cells and subsequent steps leading to final DNA sequence confirmation were done as described above.
EXAMPLE 103Additional genes encoding sequence rearranged Flt3 ligands were constructed using the dimer template intermediates previously described. For sequence rearranged flt3 receptor agonists having the fifteen amino acid linker (GlyGlyGlySer)3GlyGlyGly SEQ ID NO:795, the dimer intermediates Flt4C.seq and Flt11N.seq were used as template. Breakpoints corresponding to Flt3 3 ligand amino acid residues 28/29, 34/35, 62/63, 94/95, and 98/99, were constructed using a PCR based approach using a PCR Optimizer kit (Invitrogen) and the following primer pairs; FL29For/FL29Rev, FL35For/FL35Rev, FL63For/FL63Rev, FL95For/FL95Rev, FL99For/FL99Rev as described IN Example 94. Amplification conditions were as follows: seven cycles of 94Β° C. for 1 min, 62Β° C. for 2 min, and 2.5 min at 70Β° C.; twelve cycles of 94Β° C. for 1 min, 68Β° C. for 2 min, and 70Β° C. for 2.5 min; followed by a final cycle of 7 min at 72Β° C. PCR products corresponding to the predicted insert size were digested with NcoI and HindIII, and gel purified as described previously using Gene Clean II (Bio 101) following the manufacturer's suggested protocol. Samples were resuspended in 10 ul final volume with dH2O. Inserts were cloned as single genes into the mammalian expression vector pMON3934 (NcoI/HindIII/SAP treated) and designated pMON35712, pMON35713, pMON35714, pMON35715, pMON35716, pMON35717 and pMON35718 respectively.
Genes encoding chimeric proteins comprising an IL-3 receptor agonist encoded by pMON13288 (WO 94/12638) herein referred to as βIL-3 receptor agonist Iβ, and sequence rearranged Flt3 ligand were prepared by cloning the purified, restriction-digested PCR products of the 28/29, 34/35, 62/63, 94/95, and 98/99 breakpoint primer pairs into AflIII/HindIII/SAP-treated pMON30311. The resulting plasmids were designated pMON32398, pMON35700, pMON35702, pMON35704, and pMON35706 respectively. In addition, the same primer pairs were used in conjunction with the dimer template intermediates Flt7N.seq and Flt3C.seq to construct the ten amino acid linker (GlyGlyGlySer)2GlyGly SEQ ID NO:793, forms of these IL-3 receptor agonist I/Flt3L chimeric proteins; pMON32397, pMON32399, pMON35701, pMON35703, and pMON35705 respectively.
EXAMPLE 104Genes encoding IL-3 receptor agonist I/Flt3L chimeric proteins containing the 21 amino acid residue linker (GlyGlyGlySer)5Gly SEQ ID NO:796 were constructed using a similar PCR approach using the dimer template intermediates Flt11N.seq and Flt10C.seq and the following primer pairs; Flt36/36Rev, Flt37/37Rev, Flt38/38Rev, Flt39/39Rev, Flt41/41Rev, Flt42/42Rev, and Flt43/43Rev. These primer pairs correspond to the following Flt3 ligand breakpoints 35/36; 36/37; 37/38; 38/39; 40/41; 41/42; and 42/43 (the 39/40 breakpoint was previously constructed as pMON32376) and were used for PCR amplification using the following cycle conditions: seven cycles of 94Β° C. for 1 min, 66Β° C. for 2 min, and 2.5 min at 70Β° C.; fifteen cycles of 94Β° C. for 1 min, and 70Β° C. for 4 min; followed by a final cycle of 7 min at 72Β° C. using the Invitrogen PCR Optimizer kit (Buffer B). Following DNA sequence confirmation these constructs were designated pMON35733, pMON35734, pMON35735, pMON35736, pMON35738, pMON35739, pMON35740, pMON35741, pMON35742 and pMON35743 respectively. PCR incorporation errors resulted in two single amino acid substitutions of the sequence rearranged Flt3 chimeric partner (pMON35741, 35/36 breakpoint; and pMON35743, 42/43 breakpoint) and one construct (pMON35742, 38/39 breakpoint) containing two amino acid substitutions Q133 to R33 and Q100 to R100 and L112 to P112 in the Flt3L moiety, constructed and tested as part of this series.
Additional Flt3L/IL-3 receptor agonist I chimeric proteins in which the alternate Flt3L breakpoints corresponding to Flt3 ligand amino acid residues 28/29, 34/35, 62/63, 65/66, 89/90, 94/95, and 98/99 previously described were also constructed with the fifteen amino acid linker (GlyGlyGlySer)3GlyGlyGly templates FLt4C and FLt11N. PCR reaction mixtures were similar to those described in Example 103, except that reverse primers encoding the C-terminus of the sequence rearranged Flt3 moieties were modified by replacing the HindIII restriction site with a SnaBI recognition sequence. PCR amplification cycle parameters were as follows: seven cycles of 94Β° C. for 1 min, 66Β° C. for 2 min, and 2.5 min at 70Β° C.; fourteen cycles of 94Β° C. for 1 min, and 70Β° C. for 4 min; followed by a final cycle of 7 min at 72Β° C. PCR clean up, restriction digestion and purification were done as described previously. Inserts were ligated to NcoI/SnaBI/SAP-treated pMON26431 (a BHK expression vector containing an IgG2b linker/IL-3 receptor agonist I moiety) as follows: 50 ng treated vector, insert (10:1 insert:vector), 1 unit of T4 DNA ligase (Gibco BRL), and 1 ul 10Γ ligase buffer in a 10 ul reaction volume. Ligations were incubated for one hour at ambient temperature, then 2 ul of each ligation were removed and used to transform 100 ul of chemically competent DH10B (alternatively, DH5Ξ±) cells (Gibco BRL) following the manufacturer's suggested protocol. One fifth and 1/25th volumes of each transformation mixture were plated out on LB agar plates supplemented with the appropriate antibiotic markers and incubated overnight (14-16 hours) at 37Β° C. Isolated colonies were picked, and DNA prepared using the Qiagen midiprep protocol as described previously.
Sequence analysis of selected clones were confirmed for 28/29 breakpoint (pMON35719), 34/35 breakpoint (pMON35720), 62/63 breakpoint (pMON35721), 65/66 breakpoint (pMON35722), 89/90 breakpoint (pMON35723), and 98/99 breakpoint (pMON35725). pMON35726 contains a single amino acid substitution (Leu94 to Phe94) for the 94/95 breakpoint. Flt3L/IL-3 receptor agonist I chimeric constructs with a Flt3L breakpoint of 39/40 and varying amino acid linker lengths of 10, 15, and 21 AA are represented by pMON35707, pMON35708, pMON35709, pMON35710 and pMON35711. These constructs were generated by PCR amplification of one of the following templates; pMON32373, pMON32375, or pMON32376, and the Flt3L-specific primer pair 39N TERM-1/SNAB1C TERM. Standard PCR reaction mixtures were set up as previously described, and DNA product amplified using the following parameters: seven cycles of 94Β° C. for 1 min, 62Β° C. for 2 min, and 2.5 min at 70Β° C.; twelve cycles of 94Β° C. for 1 min, 68Β° C. for 2 min, and 70Β° C. for 2.5 min; followed by a final cycle of 7 min at 72Β° C. PCR products corresponding to the predicted insert size were digested to completion with NcoI and SnaBI, gel purified, and cloned as described previously into the mammalian expression vector pMON26431 (NcoI/SnaBI/SAP treated) as Flt3L/IgG2b/IL-3 receptor agonist I chimeric proteins. Two of these constructs contained PCR incorporation errors in the sequence rearranged Flt3 chimeric partner which resulted in single amino acid substitutions F96 to L96, and E58 to G58 (pMON35710 and pMON35711).
EXAMPLE 105Another series of chimeric proteins, sequence rearranged Flt3L/IL-3 receptor agonist I with the breakpoints corresponding to Flt3 ligand amino acid residues 35/36, 36/37, 38/39, 40/41, 41/42, 42/43 and 65/66 previously described and a 21 amino acid linker were also constructed using selected IL-3 receptor agonist I/sequence rearranged Flt3L constructs as template (see Table 12 below). One exception was that a fifteen amino acid linker template (pMON35715) was used to construct the 65/66 breakpoint, pMON35771.
| TABLE 12 |
| Flt3L/IL-3 receptor agonist I IL-3 receptor |
| agonist I/Flt3L |
| Flt3L | ||||
| Construct | template | Breakpoint | Primer Pair | |
| pMON35744 | pMON35733 | 35/36 | Flt36/36Revβ² | |
| pMON35745 | pMON35734 | 36/37 | Flt37/37Revβ² | |
| pMON35746 | pMON35735 | 37/38 | Flt38/38Revβ² | |
| pMON35747 | pMON35736 | 38/39 | Flt39/39Revβ² | |
| pMON35748 | pMON35738 | 40/41 | Flt41/41Revβ² | |
| pMON35749 | pMON35739 | 41/42 | Flt42/42Revβ² | |
| pMON35750 | pMON35740 | 42/43 | Flt43/43Revβ² | |
| pMON35769 | pMON35743 | 42/43 | Flt43/43Revβ² | |
| pMON35771 | pMON35715 | 65/66 | 65For/66SnaBI | |
Primer pairs encoding the same restriction sites as those used to construct pMON35719-35725 were utilized. The reverse primers 36Revβ², 37 Revβ², 38 Revβ², 39 Revβ², 41 Revβ², 42 Revβ², and 43 Revβ², were used to create the in frame SnaBI site. The same forward primers Flt36, Flt37, Flt38, Flt39, Flt41, Flt42 and Flt43 were used. PCR reaction mixtures were identical to those described previously, however, with the exception of pMON35771, amplification conditions were modified as follows: 18 cycles of 94Β° C. for 1 min, 68Β° C. for 2 min, and 70Β° C. for 2.5 min; followed by a single extension cycle at 70Β° C. for 7 minutes. For pMON35771, amplification conditions were as follows: six cycles of 94Β° C. for 1 min, 66Β° C. for 2 min, and 2.5 min at 70Β° C.; fifteen cycles of 94Β° C. for 1 min, and 70Β° C. for 4 min; followed by a final cycle of 7 min at 72Β° C. Flt3-specific PCR amplification products were restriction digested, purified, and cloned into pMON26431 (a BHK expression vector containing an IgG2b linker/IL-3 receptor agonist I moiety) as described in Example 104.
One variant, pMON32179, was constructed as a 34/40 breakpoint using the PCR primer pair Flt40/34Rev and dimer template intermediates Flt11N.seq and Flt10C.seq. PCR amplification conditions and subsequent cloning were identical to that used to clone pMON35771.
Three additional Flt3L/IL-3 receptor agonist I chimera (38/39 breakpoint) were designed and constructed to test the effects of alternate linker lengths and composition. Using pMON35709 as template, the GlySer linker length was expanded to encompass 29 amino acid residues with the motif (GlyGlyGlySer)7Gly using the primer pairs BamFor1/38Rev (reaction product referred to as PCR A) and Flt38/BamRev1 (reaction product referred to as PCR B). The amplification conditions were as follows: six cycles of 94Β° C. for 1 min, 66Β° C. for 2 min, and 2.5 min at 70Β° C.; fifteen cycles of 94Β° C. for 1 min, and 70Β° C. for 4 min; followed by a final cycle of 7 min at 72Β° C. The resulting PCR products were cleaned up using a Promega PCR clean up kit, and digested with either NcoI/BamHI (PCR A) or BamHI/SnaBI (PCR B), gel purified and ligated to pMON26431 (a BHK expression vector containing an IgG2b linker/IL-3 receptor agonist I moiety) as described previously. The resulting construct was sequenced confirmed and designated pMON35774. In comparison, pMON35775 and 35776 different in that the GlySer linker was replaced by native Flt3L amino acid residues 140-154 (pMON35775) or 140-160 (pMON35776) containing a single amino acid substitution. PCR reaction conditions were identical as described for pMON35774, except the following primer pairs were used: 38For/Navfor and 38Rev/NavRevS (pMON35775); and 38For/Navfor and 38Rev/NavRevL (pMON35776). KasI was substituted for BamHI, otherwise the cloning steps of these PCR amplification products were identical to those employed for pMON35774. Sequence analysis revealed PCR induced errors in multiple isolates for both pMON35775 and 35776. To obtain the final correct sequences, it was necessary to redigest selected subclones with NarI/SnaBI and NcoI/NarI, and use these gel purified fragments to reclone the desired constructs.
Several Flt3L dimer chimeric molecules were also constructed for testing as BHK transients. pMON32173, consisting of two native Flt3L molecules linked by an IgG2b linker, was assembled from two pre-existing molecules as follows: the NcoI/SnaBI Flt3L-containing insert from pMON32393 was ligated to gel purified, NcoI/SnaBI cut, pMON32377 in which the IL-3 receptor agonist I chimeric partner had been released. Similarly, pMON35727 (39/40 breakpoint, fifteen amino acid linker) was assembled using the Flt3L insert from pMON35708 (as an NcoI/SnaBI insert) to gel purified pMON32375 in which the IL-3 receptor agonist I chimeric partner had been excised. The third Flt3L dimer, pMON32168, (39/40 breakpoint, 21 amino acid linker) was assembled as follows: the NcoI/SnaBI insert from pMON32165 (E. coli equivalent of pMON35709, assembled by subcloning the NcoI/BamHI fragment from pMON32163 and the BamHI/HindIII fragment of pMON35709 into NcoI/HindIII-digested pMON5723). The NcoI/SnaBI insert from pMON32165 (Flt3L 1-139 (39/40)L21) and the SnaBI/HindIII insert (IgG2b/Flt3L 1-139 (39/40)L21) from pMON32376 were subcloned into the E. coli production vector pMON5723, creating pMON32167. The NcoI/HindIII insert from pMON32167 was then subcloned into pMON30304, and designated pMON32168.
EXAMPLE 106A series of trimeric molecules, each consisting of two Flt3L moieties and a single copy of IL-3 receptor agonist I or IL-3 receptor agonist II (an IL-3 receptor agonist encoded by pMON13416 (WO 94/12638) herein referred to as βIL-3 receptor agonist IIβ), were also constructed from pre-existing molecules using restriction digested, gel purified fragments. pMON35728 was assembled using the NcoI/EcoRI (Flt3L/IgG2b/IL-3 receptor agonist I) insert from pMON32375 and the EcoRI/HindIII (IL-3 receptor agonist I/IgG2b/Flt3L) insert from pMON35708. The two fragments were then religated to NcoI/HindIII/SAP-treated mammalian expression vector pMON3934 and subcloned as described previously. pMON32205 (IL-3 receptor agonist II/IgG2B/Flt3 1-139/IgG2B/Flt3 1-139) was assembled by ligating the NcoI/HindIII fragment from pMON32173 into the AflIII/HindIII site of pMON30304. A similar approach was used to construct pMON32206 (IL-3 receptor agonist II/IgG2b/Flt3L (39/40)L21/IgG2b/Flt3L (39/40)L21). The NcoI/HindIII fragment from pMON32167 was gel and subcloned into the AflIII/Hind III-digested pMON30304 (which contains the IL-3 receptor agonist II/IgG2b-moiety). The plasmid pMON32207 (Flt3L (39/40)L21/IgG2b/Flt3L (39/40)L21)/G-CSF) was assembled by subcloning the gel purified NcoI/HindIII insert from pMON32170 into the intermediate pMON32198 (AflIII/HindIII).
pMON32208 (Flt3L 1-139/IgG2b/G-CSF/IgG2b/Flt3L1-139) was assembled by subcloning the gel purified SnaBI insert from pMON30320 (as IgG2b/G-CSF) into SnaBI-digested/SAP-treated pMON32173. pMON32204 was assembled by subcloning the NcoI/HindIII insert from pMON32173 into AflIII/HindIII-digested pMON30309 (which contains G-CSF/IgG2b). pMON32195 (Flt3L 1-139(39/40)L21/IgG2b/G-CSF/Flt3L 1-139(39/40)L21) was constructed by subcloning the NcoI/SacI insert from pMON32190 and the SacI/HindIII fragment from pMON32171 into NcoI/HindIII-digested pMON30304. pMON32196 (G-CSF/IgG2b/Flt3L 1-139(39/40)L21/IgG2b/Flt3L 1-139) was assembled by subcloning the NcoI/AflIII fragment from pMON30309 (as G-CSF/IgG2b) into NcoI/SAP-treated pMON32168 (Flt3L 1-139(39/40)L21/IgG2b/Flt3L 1-139), and confirming orientation by DNA sequence and restriction analysis. pMON32197 (G-CSF/IgG2b/Flt3L 1-139(39/40)L21/IgG2b/Flt3L 1-139 (39/40)L21) was constructed by subcloning the NcoI/HindIII insert of pMON32167 (Flt3L 1-139(39/40)L21/IgG2b/Flt3L 1-139 (39/40)L21) into the AflIII/HindIII site of pMON30309 (G-CSF/IgG2b).
EXAMPLE 108A series of Flt3L containing molecules was constructed as BHK transients by replacing IL-3 receptor agonist I or IL-3 receptor agonist II with G-CSF as the chimeric partner. For chimeric proteins expressed transiently and made using the BHK vector pMON3934, the G-CSF moiety could either encode Ser or Cys at position 17. For molecules used for either E. coli expression or expressed non-transiently in mammalian expression systems, position 17 of the G-CSF partner encoded Ser exclusively. Chimera of native Flt3L and G-CSF were made as BHK expression constructs in both orientations: G-CSF/IgG2b/Flt3L (pMON30329) and Flt3L/IgG2b/G-CSF (pMON32175). pMON30329 was assembled by subcloning the Flt3L 1-139 insert from pMON30238 (as a NcoI/Hind III digest) into pMON30309 (which contains G-CSF/IgG2b) digested with AflIII/HindIII, whereas pMON32175 was constructed using the gel-purified NcoI/SnaBI insert from pMON32393 to NcoI/SnaBI-digested pMON26420 (which contains the IgG2b/G-CSF gene). A third native G-CSF/Flt3L chimeric molecule, pMON32191, differs from pMON32175 in that it has a GlySer linker in place of the IgG2b chimeric linker and was designed for E. coli expression. pMON32191 was assembled using the same gel-purified NcoI/SnaBI insert from pMON32393 into NcoI/SnaBI-digested pMON31123 (which contains the GlySer/G-CSF gene). The BHK equivalent, pMON35767, was assembled by subcloning the gel-purified NcoI/HindIII chimeric gene from pMON32191 into the BHK vector pMON3934.
EXAMPLE 109Two series of sequence rearranged Flt3L chimera were constructed by replacing the IL-3 receptor agonist I component with G-CSF. The first set, with the orientation G-CSF/IgG2B/sequence rearranged Flt3L, were essentially assembled as follows: pMON30329 (G-CSF/IgG2B/Flt3L 1-139) was digested with SnaBI/HindIII, and the vector-containing G-CSF moiety gel-purified as described above. SnaBI/HindIII-digested inserts from the appropriate IL-3 receptor agonist I/Flt3L constructs shown below in Table !3 were then subcloned into pMON30329 (SnaBI/HindIII).
| TABLE 13 |
| G-CSF/IgG2b/Flt3L constructs and their IL-3 receptor agonist I analogues |
| pMON(IL-3 receptor | ||
| Flt3L breakpoint | pMON(G-CSF) | agonist I) |
| 35/36L21 | pMON32188 | pMON35733 |
| 89/90L21 | pMON32273 | pMON32389 |
| 37/38L21 | pMON35795 | pMON35735 |
| 38/39L21 | pMON35796 | pMON35736 |
| 40/41L21 | pMON35797 | pMON35738 |
| 41/42L21 | pMON35798 | pMON35739 |
| 42/43L21 | pMON35799 | pMON35740 |
pMON32169 (G-CSF/IgG2b/Flt3L 1-139 (39/40)L21) was assembled using the NcoI/BamHI insert from pMON32163 and the BamHI/HindIII insert from pMON32370 subcloned into the AflIII/HindIII-digested pMON30309. Three molecules in this series have no direct IL-3 receptor agonist I counterparts. The first, pMON39914, was assembled using the BHK expression vector pMON30309 (which contains G-CSF/IgG2b) digested with AflIII/HindIII, and the Flt3 1-139 (39/40)L29 insert from pMON32243 (as NcoI/HindIII). For pMON39915, the Flt3L 1-154 (39/40) gene from pMON32242 (as a NcoI/HindIII insert) was subcloned into the parental vector pMON30309. pMON39916 was assembled exactly as for pMON39915, except that the Flt3L 1-160 (39/40) insert from pMON32252 was utilized. pMONs 32242, 32243, and 32252 are E. coli expression constructs containing a non-chimeric, sequence rearranged Flt3L gene (as NcoI/HindIII). Finally, the insert from pMON35799 was subcloned into pMON5723 (as an NcoI/HindIII fragment) for expression in E. coli. This E. coli production plasmid was designated pMON39904.
EXAMPLE 110Many of the second series of G-CSF chimera with the orientation Flt3L/IgG2b/G-CSF were also constructed from their IL-3 receptor agonist I analogues as indicated below in Table 14.
| TABLE 14 |
| Flt3L/IgG2b/G-CSF constructs and their IL-3 receptor agonist I analogues |
| pMON(IL-3 receptor | ||
| Flt3L breakpoint | pMON(G-CSF) | agonist I) |
| 39/40L10 | pMON35751 | pMON35707 |
| 39/40L15 | pMON35752 | pMON35708 |
| 39/40L21 | pMON35753 | pMON35709 |
| 89/90L15 | pMON35754 | pMON35723 |
| 35/36L21 | pMON35755 | pMON35744 |
| 36/37L21 | pMON35756 | pMON35745 |
| 37/38L21 | pMON35757 | pMON35746 |
| 34/35L15 | pMON35759 | pMON35720 |
| 65/66L15 | pMON35760 | pMON35722 |
| 98/99L15 | pMON35765 | pMON35725 |
These constructs were assembled using NcoI/SnaBI-digested pMON36113 (a BHK vector containing the IgG2b/G-CSF gene) and specific NcoI/SnaBI-digested sequence rearranged Flt3L inserts from the Flt3L/IL-3 receptor agonist I chimeric proteins in Table above. The resulting plasmids were designated pMON32170, pMON32871, pMON32271, pMON32172, pMON32174, pMON35751, pMON35752, pMON35753, pMON35754, pMON35755, pMON35756, pMON35757, pMON35758, pMON35759, pMON35760, pMON35761, pMON35762, pMON35763, pMON35764, pMON35765, pMON35766, pMON35767, pMON35768, pMON35770, pMON35772, pMON35773, pMON35777, pMON35778, pMON35779, pMON35780, pMON35782 and pMON39908
pMON35777 and pMON35778 were constructed by PCR and assembled from the same NcoI/NarI and NarI/SnaBI inserts as described for pMON35775 and pMON35776, except that NcoI/SnaBI-digested pMON35751 was used as the parental vector containing the IgG2b/G-CSF gene. To construct the 39/40 breakpoint equivalent of pMON35778, the primer pair Flt40/SnaBI C-term was used to re-amplify pMON35778 template. Amplification conditions were done as described previously for pMON35771, except the initial Tanneal was lowered from 66 to 55Β° C. The resulting construct was designated pMON35782 (Flt3 1-160 (39/40)/IgG2b/G-CSF).
pMON32170 (Flt3L 1-139(39/40)L21/IgG2B/G-CSF) was assembled using the NcoI/SnaBI insert from pMON32165 ligated into NcoI/SnaBI-digested pMON26430 (which contains IgG2B/G-CSF). pMON35764 (Flt3L (38/39)L21/IgG2b/G-CSF) was cloned as follows: the sequence rearranged Flt3L insert was PCR amplified using as template pMON35736 and the primer pair Flt39/39Rev. Amplification conditions were identical to those employed for pMON35771, except the initial Tanneal was lowered from 66 to 56Β° C. The NcoI/SnaBI digested PCR amplification was subcloned into NcoI/SnaBI-digested pMON35754 containing the IgG2b/G-CSF gene. pMON35768 (Flt3L (38/39)L21/IgG2b/G-CSF) has a mutation at residue 15 (Ser to Phe) of the Flt3 chimeric partner. pMON35762 (Flt3 template pMON35739), pMON35763 (Flt3 template 35738), pMON35758 (Flt3 template 35740), pMON35770 (pMON35743 as Flt3L template were constructed exactly as described for pMON35764. pMON35772, a S125 to F125 mutant of the sequence rearranged Flt3 gene in pMON35760, was cloned by PCR using pMON35715 as Flt3 template and the primer pairs 65For/65SnaBI. PCR cycle conditions were identical to that used to amplify the Flt3 genes from pMON35733, pMON35734, pMON35735 and pMON35736 described previously. pMON35761 is a Q133 to R133 mutant of the sequence rearranged Flt3L gene in pMON35758. pMON35773 (Flt3L 1-139 (38/39)L29/IgG2B/G-CSF) was cloned as described previously for pMON35774, except pMON26430 (NcoI/SnaBI/SAP-treated) containing the IgG2b/G-CSF gene was used as parental vector.
To construct the 39/40 breakpoint equivalent, pMON35773 was used as template in a PCR amplification reaction with the primer pair Flt40/SnaBI C-term. Amplification was done exactly as described previously for pMON35771. The NcoI/SnaBI-digested amplification product was subcloned into pMON26430 (NcoI/SnaBI/SAP-treated), resulting in pMON35779 (Flt3L 1-139 (39/40)L29/IgG2B/G-CSF). pMON35780 is a variant of pMON35779 and encodes a single amino acid mutation (L60 to P60) in the sequence rearranged Flt3 chimeric partner. pMON32190 (Flt3L 1-139 (39/40)L21/GS/G-CSF) contains an alternate GlySer chimeric linker which replaces the IgG2b linker of pMON32170. The NcoI/SnaBI fragment Flt3L gene from pMON32165 (Flt3L 1-139 (39/40)L21/IgG2b/IL-3 receptor agonist I in the E. coli expression vector pMON5723) was subcloned into NcoI/SnaBI-digested pMON31123. The BHK expression equivalent, pMON35766, was constructed by subcloning the entire Flt3L/GlySer/G-CSF chimeric insert as an NcoI/HindIII fragment into pMON3934.
pMON39908 is similar to pMON35779, except the Flt3L amino acid residues 133-160 have been replaced by the amino acid sequence, VETVFHRVSQDGLDLLTS SEQ ID NO:798, which is homologous to an alternate splice variant of Flt3L (Genbank accession number HSU29874). pMON32190 was used as a PCR template with the following sets of primer pairs Flt40/XbaRev and SnaBICterm/XbaFor. Amplification conditions were done as described previously for pMON35771, except the initial Tanneal was lowered from 66 to 64Β° C. Both gel-purified PCR amplification products were digested with either NcoI/XbaI (Flt40/XbaRev PCR product) or XbaI/SnaBI (SnaBICterm/XbaFor PCR product) and subcloned into pMON26430 (NcoI/SnaBI/SAP-treated). pMON32273 (Flt3L 1-139 (39/40)L21/IgG2b/G-CSF) was constructed by PCR of pMON35777 with the primer pairs FltConNco/Grev to re-amplify the 38/39 Flt3L moiety as 39/40. The purified amplicon was digested with NcoI/SnaBI, and subcloned into the NcoI/SnaBI-digested pMON32191, and designated pMON32259 (for E. coli production). For BHK expression, the NcoI/HindIII insert from pMON32259 was subcloned into pMON3934 (NcoI/HindIII).
EXAMPLE 103Another series of chimeric proteins were constructed in which the Flt3L partner contained one or two Cys mutations (Table XIA and XIB). pMON35790 (Flt3L 1-139(C4βS4, C85βS85)/GS/G-CSF (Ser17)), was constructed by PCR using pMON32191 as template and the primer pairs C1For/C3Rev and C3For/139Rev in two reactions. pMON35791 (Flt3L 1-139(C93βS93, C132βS132)/GS/G-CSF (Ser17)), was also constructed by PCR using pMON32191 as template and the primer pairs C5For/C6Rev and C5Rev/N-term. Amplification conditions were done as described previously for pMON35771, except the initial Tanneal was lowered from 66 to 64Β° C. A second round of PCR was done using the amplicons (10 ul each) from the first round, and the PCR products were then purified, digested with NcoI/SnaBI, and subcloned into NcoI/SnaBI-digested pMON32191. PCR amplification conditions for the second round were modified as follows: the initial Tanneal was increased to 68Β° C., and the number of cycles increased from 6 to 15. No additional amplification was required. These constructs, pMON35787 (C4 βS4, C85βS85) and pMON35788 (C93βS93, C132βS132) were used for E. coli expression. The BHK expression equivalents, pMON35790 and 35791, were constructed by subcloning the correctly mutated Flt3L/GlySer/G-CSF chimeric inserts as NcoI/HindIII fragments into pMON3934. pMON35792 (Flt3L 1-132(C132βS132)/GlySer/G-CSF (Ser17)) was constructed by PCR using pMON32191 as template and the primer pair FLD1Rev/FltNTerm.
pMON39905 (Flt3L 1-139(C132βS132)/GlySer/G-CSF (Ser17)) was constructed by PCR using pMON32191 as template and the primer pair FLM1Rev/FltNTerm. pMON39906 (Flt3L 1-139(C127βS127/C32βS132)/GlySer/G-CSF (Ser17)) contains a single amino acid substitution at residue 127 of the sequence rearranged Flt3L partner, a result of a PCR induced error during the PCR amplification of pMON39905.
pMON32276 (Flt3L 1-139 (39/40)L21(C4βS4/C85βS85)/GlySer/G-CSF (Ser17)) was constructed by two rounds of PCR. Three initial amplicons were generated: PCR1 (pMON32190 template and primer pairs G10L/85N); PCR 7 (pMON32190 template and primer pairs 4N/85S); and PCR 4 (pMON32198 template and primer pairs 4S/3605Rev). For the second round, PCR1, 4 and 7 were re-amplified in a combined mixture, resulting in PCR A. PCR A was purified, digested with NcoI/SnaBI, and subcloned in pMON30277 (GlySer/G-CSF). The next three constructs were generated in a similar manner. pMON32277 (G-CSF (Ser17)/IgG2B/Flt3L 1-139 (39/40)L21(C4βS4/C85βS85)) first round PCR generated three initial amplicons: PCR1 (pMON32190 template and primer pairs G10L/85N); PCR 7 (pMON32190 template and primer pairs 4N/85S); and PCR 6 (pMON32169 template and primer pairs 4S/3605Rev). For the second round, PCR1, 6 and 7 were re-amplified in a combined mixture, resulting in PCR B. PCR B was purified, digested with NcoI/HindIII, and subcloned into NcoI/HindIII-digested pMON30309 (G-CSF(Ser17)/IgG2B). pMON32278 (Flt3L 1-139 (39/40)L21(C93βS93/C132βS132)/GlySer/G-CSF (Ser17)) first round PCR generated three initial amplicons: PCR2 (pMON32190 template and primer pairs G10L/93N); PCR 8 (pMON32190 template and primer pairs 132N/93S); and PCR 3 (pMON32198 template and primer pairs 132S/3605Rev). For the second round, PCR2, 3 and 8 were re-amplified in a combined mixture, resulting in PCR C. PCR C was purified, digested with NcoI/SnaBI, and subcloned in pMON30277 (GlySer/G-CSF). pMON32279 G-CSF (Ser17)/IgG2B/Flt3L 1-139 (39/40)L21(C93βS93/C132βS132)) first round PCR generated three initial amplicons: PCR2 (pMON32190 template and primer pairs G10L/93N); PCR 8 (pMON32190 template and primer pairs 132N/93S); and PCR 5 (pMON32169 template and primer pairs 132S/3605Rev). For the second round, PCR2, 5 and 8 were re-amplified in a combined mixture, resulting in PCR D. PCR D was purified, digested with NcoI/HindIII, and subcloned into NcoI/HindIII-digested pMON30309 (G-CSF(Ser17)/IgG2B).
EXAMPLE 112pMON39909 (Flt3L 1-139(39/40)L21/GS/G-CSF(Ser17)(133/132)) is one of two Flt3/G-CSF chimeric proteins in which both proteins the sequenced are rearranged. The NcoI/AflIII fragment from pMON32198 comprising the Flt3L 1-139(39/40)L21/GlySer gene was subcloned into NcoI/SAP-treated pMON25187 (E. coli production plasmid containing a single copy of G-CSF(Ser17)(133/132)). Following DNA sequence confirmation, the chimeric insert was subcloned into pMON3934 as an NcoI/HindIII fragment and designated pMON39909. pMON39910 (G-CSF(Ser17)(133/132/IgG2B/Flt3L 1-139(39/40)L21) was constructed by PCR using pMON25187 as template and the primer pair GPFor1/GPRev2. Amplification conditions were identical to those utilized for pMON39908. NcoI/SnaBI-digested G-CSF(Ser17)(133/132) was subcloned into the NcoI/SnaBI site of pMON32376 containing the IgG2B/Flt3L 1-139 (39/40)L21 gene.
EXAMPLE 113pMON40000 is the production plasmid modified from pC1neo (Promega) containing G-CSF(Ser17)/GlySer/Flt3L 1-139 (39/40)L21 for expression in NS0 cells (pMON32169 is the BHK equivalent). pMON40000 contains the CMV IE promoter/enhancer element, an IL-3 leader sequence immediately upstream of CSF(Ser17)/GlySer/Flt3L 1-139 (39/40)L21, truncated thymidine kinase promoter, SV40 late poly A signal sequence, and several DNAse 1 hypersensitive regions (part of IgH 3 min LCR).
EXAMPLE 114 Bioactivity of Multi-Functional Chimeric Hematopoietic Receptor Agonists
| TABLE 15 |
| IN VITRO MULTI-FUNCTIONAL CHIMERIC HEMATOPOIETIC |
| RECEPTOR AGONISTS BIOASSAY |
| BAF3/FLT3L | BAF3/FLT3L | CFU-GM | ||
| Clone | Proliferation1 | Proliferation2 | Colonies3 | |
| pMON30247 | ++ | + | + | |
| pMON32169 | +++ | +++ | ||
| pMON32175 | +++ | |||
| pMON32190 | +++ | |||
| pMON32191 | +++ | +++ | ||
| pMON32333 | + | |||
| pMON32342 | ++ | |||
| pMON32352 | + | + | ||
| pMON32360 | + | + | ||
| pMON35766 | + | |||
| pMON40000 | +++ | |||
| pMON400024 | ++ | +++ | ||
Legend: |
||||
+: Decreased potency (right shifted) compared to control |
||||
++: Equivalent potency to control (within 2 fold) |
||||
+++: Increased potency (left shifted) compared to control |
||||
1Compared to control: pMON30247 |
||||
2Compared to control: pMON32352 |
||||
3Compared to appropriate co-addition control |
||||
4Analyzed in pool of clones pMON40000 and pMON40002 |
| TABLE16 |
| EX VIVO MULTI-FUNCTIONAL CHIMERIC HEMATOPOIETIC |
| RECEPTOR AGONISTS BIOASSAY |
| Dendritic Cell | ||
| Hematopoietic Ex Vivo Expansion1 | Ex Vivo Expansion2 |
| Neutrophil | Mega-karyocyte | Fold | |||
| Clone (s) | Fold Expansion | Precursors | Precursors | Expansion | Function |
| pMON32175 | + | + | + | ||
| pMON32191 | + | + | ++ | ++ | ++ |
| pMON32360 | + | + | + | ++ | |
| Il-3 receptor | ++ | ++ | ++ | ||
| agonist I, | |||||
| MFR agonist | |||||
| I, MFR | |||||
| agonist II | |||||
| Il-3 receptor | +++ | ++ | +++ | ||
| agonist I, | |||||
| MFR agonist | |||||
| I, MFR | |||||
| agonist II, | |||||
| pMON30247 | |||||
| Il-3 receptor | +++ | ++ | ++ | ||
| agonist I, | |||||
| MFR agonist | |||||
| I, MFR | |||||
| agonist II, | |||||
| pMON32360 | |||||
| Il-3 receptor | ++ | ++ | ++ | ||
| agonist I, | |||||
| MFR agonist | |||||
| I, MFR | |||||
| agonist II, | |||||
| pMON32333 | |||||
| Il-3 receptor | +++ | +++ | +++ | ||
| agonist I, | |||||
| MFR agonist | |||||
| I, MFR | |||||
| agonist II, | |||||
| pMON32191 | |||||
| Il-3 receptor | ++ | +++ | +++ | ||
| agonist I, | |||||
| MFR agonist | |||||
| I, MFR | |||||
| agonist II, | |||||
| pMON32175 | |||||
| MFR agonist | + | + | +++ | ||
| II | |||||
| pMON32191 | |||||
| pMON30247 | +++ | ++ | |||
| pMON32352 | ++ | ||||
1Legend: |
|||||
+: Decreased activity compared to IL-3, IL-6, SCF, G-CSF (literature control) |
|||||
++: Equivalent activity to IL-3, IL-6, SCF, G-CSF ((literature control) (within 20%)) |
|||||
+++: Increased activity compared to IL-3, IL-6, SCF, G-CSF (literature control) |
|||||
Culture Condition: X-Vivo 10 Media, 37Β° C., 5% CO2, 11 day incubation |
|||||
2Legend: |
|||||
+: Decreased activity compared to GM-CSF, TNFa, SCF (literature control) |
|||||
++: Equivalent activity to GM-CSF, TNFa, SCF ((literature control) (within 20%)) |
|||||
+++: Increased activity compared to GM-CSF, TNFa, SCF (literature control) |
|||||
Culture Condition: |
|||||
IMDM-20 Media supplemented with 100 ng/ml GM-CSF, 100 ng/ml TNFa, 20 ng/ml SCF, at 37Β° C./5% CO2 for 18-22 days |
|||||
MFR agonist I = pMON31140 (WO 95/21197) |
|||||
MFR agonist II = pMON28571 (WO 97/12985) |
CD34+ enriched progenitor cells from human bone marrow were isolated and cultured at 5Γ104 cells/ml in X-Vivo 10+1% HSA with test cytokines and controls to assess cytokine expansion potential. Cells were expanded and replated at 5Γ104 cells/ml with new media and cytokines around day 5 depending on cell growth. On day 10 cells were harvested and characterized. Cells were collected from the plates and diluted to a concentration of 1Γ106 cells/ml. Total cell expansion was determined and cells were characterized for hematopoietic progenitor cells by CFU Pre- and Post Expansion in methylcellulose (Stem Cell Technologies, MethocultHCC3534). Expanded cells were also characterized by flow cytometry for lineage specific phenotyping: CD11b(PE)/CD15(FITC), CD34 (FITC), CD41a (FITC).
Dendritic Cell Ex Vivo Expansion Assay
CD34+ enriched progenitor cells from human bone marrow were isolated and cultured at 2Γ105 cells/ml in IMDM/20% FCS with test cytokines and controls to assess expansion potential. Cells were expanded and replated at 5Γ104cells/ml with new media and cytokines around day 5 depending on cell growth. On day 18-22 cells were harvested and characterized. Total cell expansion was determined expanded cells were characterized by flow cytometry for lineage specific phenotyping: HLAβDR+(PE)/CD1a+(FITC), CD86+(PE)/CD1a+(FITC), CD19β(FITC). Dendritic cell fold expansion was determined as the total cellular expansionΓ% HLAβDR+/CD1a+. The functional activity of the cells was determined using a 1-way mixed lymphocyte reaction. Washed, irradiated cultured dendritic cells were added in graded doses to allogeneic responder peripheral blood mononuclear cells in 96-well microtiter plates. The ability of the dendritic cells to serve as antigen presenting cells was determined by the degree of proliferation stimulated in the responding cell preparations, as measured by 3H thymidine incorporation.
EXAMPLE 116 Receptor Binding
| TABLE 17 |
| Receptor Binding Analyses: |
| Flt3-Fc | G-CSFR | IL-3Rβ³ | ||
| Compound | Kd (nM) | IC50 (nM) | IC50 (nM) | |
| pMON32342 | 26 β³ 7 | β | >1000 | |
| pMON30247 | 36 β³ 7 | β | 6.6 β³ 0.5 | |
| pMON32360 | β45 β³ 17 | β | 26 (2) | |
| pMON32352 | 56 β³ 5 | β | 13 β³ 4β | |
| pMON32191 | β37 β³ 14 | 0.33 β³ 0.01 | β | |
| Il-3 receptor | β | >1000 | 1.3 β³ 0.2 | |
| agonist II | ||||
| Il-3 receptor | β | >1000 | 3.7 β³ 0.6 | |
| agonist I | ||||
| G-CSF | β | 0.69 β³ 0.08 | >100β | |
Data are expressed as the mean β³ SEM from at least three experiments determined in triplicate, except pMON 32360 where only (2) experiments have been completed. |
The affinity of the Flt-3 agonist containing chimeric molecules was evaluated in receptor binding assays. BIACORE analysis was performed by directly immobilizing Flt3-Fc and the Kd value computed from determining the association and dissociation rate constants. Competitive binding assays were utilized for evaluating the interactions of the chimeric molecules with either the G-CSF receptor transfected in BaF3 cells or the β³ subunit of the IL-3 receptor expressed in BHK cells. The competition assays using these cells employed an agonist-specific radioligand and IC50 values were generated for the competing chimeras using logit-log analysis of dose-response curves.
EXAMPLE 117 In Vivo Bioactivity
| TABLE 18 |
| MURINE IN VIVO MULTI-FUNCTIONAL CHIMERIC HEMATOPOIETIC |
| RECEPTOR AGONISTS ASSAY DATA |
| Peripheral Blood | Spleen |
| I-Ab+/CD11c+ | I-Ab+/CD8+ | I-Ab+/CD11c+ | I-Ab+/CD8+ | CFU-GM/Spleen |
| Clone | DC cells/ul blood | DC cells/Spleen (Γ 10b) | Fold Increase |
| pMON30247 | ND | ND | 33.5 | 23.8 | 78 |
| pMON32342 | ND | ND | 8.0 | 4.5 | 2 |
| pMON32360 | ND | ND | 64.5 | 37.5 | 183 |
| pMON32191 | 17,089 | 2,379 | 133.5 | 78.9 | 53 |
C57BL/6 mice were injected subcutaneous with pMON30247, pMON32342 or pMON32360 (150 ug/day) or pMON32191(200ug/day) or Mouse Serum Albumin (MSA, 200 ug/day) for 10 days. On Day 11 terminal bleeds were done via cardiac puncture. Leukocytes counts were obtained on whole blood. Peripheral blood leukocytes were obtained by gradient centrifugation (Histopaque) followed by ammonium chloride lysis to further remove erythrocytes. Cells were stained for flow cytometery using direct fluorescein or phycoerythrin conjugated monoclonal antibodies (Pharmingen). Prior to staining non-specific Fc receptor binding was blocked using FcBlock (Pharmingen). Cells were analyzed on a FacScan flow cytometer (Becton/Dickinson). Percent positive cells were determined by integration and phenotype enumeration was calculated based on WBC count. Spleens from treated animals were removed aseptically, teased apart, in RPMI media with needles. A cell suspension was obtained using the flat end of a 5 cc syringe plunger followed by filtration through a cotton plug to remove clumps. Erythrocytes were removed by ammonium chloride lysis, cells were washed, resuspended and counted using a Coulter counter (Coulter Electronics). Cells were prepared for flow cytometry as described above. Phenotype was expressed as number of cells/spleen based on the percent of cells with a positive phenotype and total spleen WBC count. CFU cultures were obtained by plating 1.5Γ105 splenic cells/1 ml in triplicate wells of methylcellulose with murine cytokines w/o erythropoietin (Stem Cell Technologies). Cultures were incubated for 10 days at 37Β° C. and counted on an inverted microscope. A CFU was defined as a colony of cells with >50 cells. The fold increase of CFU/spleen was determined (total number of CFU/Spleen of test compound/total number of CFU/Spleen of MSA control). MSA control values for peripheral blood were 15 and 347 cells/ul for I-Ab+/CD11c+ and I-Ab+/CD8+ respectively. MSA control values for the splenic leukocytes were 2 and 1Γ106 cells/spleen for I-Ab+/CD11c+ and I-Ab+/CD8+ respectively.
Without further elaboration, it is believed that one skilled in the art can, using the preceding description, utilize the present invention to its fullest extent. The following preferred specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever.
More details concerning the molecular biology techniques, protein purification and bioassays can be found in WO 94/12639, WO 94/12638, WO 95/20976, WO 95/21197, WO 95/20977, WO 95/21254 and WO 96/23888, are hereby incorporated by reference in their entirety.
All references, patents or applications cited herein are incorporated by reference in their entirety as if written herein.
Various other examples will be apparent to the person skilled in the art after reading the present disclosure without departing from the spirit and scope of the invention. It is intended that all such other examples be included within the scope of the appended claims.
| LENGTHY TABLE |
| The patent application contains a lengthy table section. A copy of the table is available in electronic form from the USPTO web site (<![CDATA[http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20070081979A1]]>). An electronic copy of the table will also be available from the USPTO upon request and payment of the fee set forth in 37 CFR 1.19(b)(3). |
1. A hematopoietic protein comprising an amino acid sequence of the formula:
R1-L1-R2, R2-L1-R1, R1-R2, or R2-R1
wherein R1 is a human stem cell factor receptor agonist polypeptide, comprising; a modified stem cell factor amino acid sequence of the Formula:
| SEQ ID NO:465 |
| Glu Gly Ile Cys Arg Asn Arg Val Thr Asn Asn Val | |
| βββββββββββββββββββββββββββ10 | |
| Lys Asp Val Thr Lys Leu Val Ala Asn Leu Pro Lys | |
| βββββββββββββββββββββ20 | |
| Asp Tyr Met Ile Thr Leu Lys Tyr Val Pro Gly Met | |
| βββββββββββββββ30 | |
| Asp Val Leu Pro Ser His Cys Trp Ile Ser Glu Met | |
| βββββββββ40 | |
| Val Val Gln Leu Ser Asp Ser Leu Thr Asp Leu Leu | |
| βββ50ββββββββββββββββββββββββββββ60 | |
| Asp Lys Phe Ser Asn Ile Ser Glu Gly Leu Ser Asn | |
| βββββββββββββββββββββββββββ70 | |
| Tyr Ser Ile Ile Asp Lys Leu Val Asn Ile Val Asp | |
| βββββββββββββββββββββ80 | |
| Asp Leu Val Glu Cys Val Lys Glu Asn Ser Ser Lys | |
| βββββββββββββββ90 | |
| Asp Leu Lys Lys Ser Phe Lys Ser Pro Glu Pro Arg | |
| βββββββββ100 | |
| Leu Phe Thr Pro Glu Glu Phe Phe Arg Ile Phe Asn | |
| βββ110βββββββββββββββββββββββββββ120 | |
| Arg Ser Ile Asp Ala Phe Lys Asp Phe Val Val Ala | |
| βββββββββββββββββββββββββββ130 | |
| Ser Glu Thr Ser Asp Cys Val Val Ser Ser Thr Leu | |
| βββββββββββββββββββββ140 | |
| Ser Pro Glu Lys Asp Ser Arg Val Ser Val Thr Lys | |
| βββββββββββββββ150 | |
| Pro Phe Met Leu Pro Pro Val Ala Ala | |
| βββββββββ160 | |
wherein 1-23 amino acids are optionally deleted from the C-terminus of said stem cell factor receptor agonist polypeptide; and
wherein the N-terminus is joined to the C-terminus directly or through a linker (L2) capable of joining the N-terminus to the C-terminus and having new C- and N-termini at amino acids;
| 23-24 |
| 24-25 |
| 25-26 |
| 26-27 |
| 27-28 |
| 28-29 |
| 29-30 |
| 30-31 |
| 31-32 |
| 32-33 |
| 33-34 |
| 34-35 |
| 35-36 |
| 36-37 |
| 37-38 |
| 38-39 |
| 39-40 |
| 40-41 |
| 64-65 |
| 65-66 |
| 66-67 |
| 67-68 |
| 68-69 |
| 69-70 |
| 70-71 |
| 89-90 |
| 90-91 |
| 91-92 |
| 92-93 |
| 93-94 |
| 94-95 |
| 95-96 |
| 96-97 |
| 97-98 |
| 98-99 |
| β99-100 |
| 100-101 |
| 101-102 |
| 102-103 |
| 103-104 |
| 104-105 |
| 105-106 |
| 106-107 |
| 107-108 |
| 108-109 |
| 109-110 |
| 110-111 |
| respectively; |
R2 is selected from the group consisting of:
a polypeptide comprising; a modified human IL-3 amino acid sequence of the formula:
| SEQ ID NO:859 |
| Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser | |
| 1βββββββββββββββ5βββββββββββββββββββ10 | |
| Trp Val Asn Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββββββ15ββββββββββββββββ20 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| 25βββββββββββββββββ30ββββββββββββββββββ35 | |
| Xaa Xaa Asn Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββββββββββ40βββββββββββββββββ45 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββ50βββββββββββββββββ55βββββββββββββββββ60 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββββββββββββββ65βββββββββββββββββ70 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββββββ75βββββββββββββββββ80 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| 85βββββββββββββββββ90βββββββββββββββββ95 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Phe Xaa | |
| ββββββββββββ100βββββββββββββββββ105 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββ110βββββββββββββββββ115βββββββββββββββββ120 | |
| Xaa Xaa Xaa Gln Gln Thr Thr Leu Ser Leu Ala Ile | |
| ββββββββββββββββ125βββββββββββββββββ130 | |
| Phe | |
wherein Xaa at position 17 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;
Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg, or Gln;
Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala, or Cys;
Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;
Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;
Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly;
Xaa at position 23 is Ile, Val, Ala, Gly, Trp, Lys, Phe, Leu, Ser, or Arg;
Xaa at position 24 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro, or Ala;
Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala, or Trp;
Xaa at position 27 is Leu, Gly, Arg, Thr, Ser, or Ala;
Xaa at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;
Xaa at position 29 is Gln, Asn, Leu, Pro, Arg, or Val;
Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu, or Lys;
Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu, or Gln;
Xaa at position 32 is Leu, Val, Arg, Gln, Asn, Gly, Ala, or Glu;
Xaa at position 33 is Pro, Leu, Gln, Ala, Thr, or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;
Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln, or Val;
Xaa at position 36 is Asp, Leu, or Val;
Xaa at position 37 is Phe, Ser, Pro, Trp, or Ile;
Xaa at position 38 is Asn, or Ala;
Xaa at position 40 is Leu, Trp, or Arg;
Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met, or Pro;
Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala;
Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;
Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;
Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His;
Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;
Xaa at position 47 is Ile, Gly, Val, Ser, Arg, Pro, or His;
Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;
Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;
Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met;
Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;
Xaa at position 55 is Arg, Thr, Val, Ser, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Cys, Ser, Gin, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;
Xaa at position 57 is Asn or Gly;
Xaa at position 58 is Leu, Ser, Asp, Arg, Gin, Val, or Cys;
Xaa at position 59 is Glu Tyr, His, Leu, Pro, or Arg;
Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn, or Thr;
Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser;
Xaa at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp, or Ile;
Xaa at position 63 is Arg, Tyr, Trp, Lys, Ser, His, Pro, or Val;
Xaa at position 64 is Ala, Asn, Pro, Ser, or Lys;
Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe, or Ser;
Xaa at position 66 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;
Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;
Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;
Xaa at position 70 is Asn, Leu, Val, Trp, Pro, or Ala;
Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn;
Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;
Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;
Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala;
Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gin, or Leu;
Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;
Xaa at position 77 is Ile, Ser, Arg, Thr, or Leu;
Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;
Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, Gly, or Asp;
Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or Arg;
Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or Lys;
Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;
Xaa at position 83 is Pro, Ala, Thr, Trp, Arg, or Met;
Xaa at position 84 is Cys, Glu, Gly, Arg, Met, or Val;
Xaa at position 85 is Leu, Asn, Val, or Gln;
Xaa at position 86 is Pro, Cys, Arg, Ala, or Lys;
Xaa at position 87 is Leu, Ser, Trp, or Gly;
Xaa at position 88 is Ala, Lys, Arg, Val, or Trp;
Xaa at position 89 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser;
Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met;
Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;
Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala, or Pro;
Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile, or Tyr;
Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile, or Thr;
Xaa at position 97 is Ile, Val, Lys, Ala, or Asn;
Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro;
Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gin, Gly, Ser, Phe, or His;
Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln, or Pro;
Xaa at position 101 is Asp, Pro, Met, Lys, His, Thr, Val, Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu, or Gln;
Xaa at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;
Xaa at position 103 is Asp, or Ser;
Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe, or Gly;
Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;
Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro;
Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;
Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser, or Trp;
Xaa at position 111 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;
Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;
Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;
Xaa at position 116 is Lys, Leu, Pro, Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe, Gln, or Ile;
Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys, or Pro;
Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;
Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg;
Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val, or Gln;
Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;
Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 1 to 14 amino acids are optionally deleted from the N-terminus and/or from 1 to 15 amino acids are optionally deleted from the C-terminus of said modified human IL-3 amino acid sequence; wherein from 0 to 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3; and
wherein the N-terminus is joined to the C-terminus directly or through a linker (L2), capable of joining the N-terminus to the C-terminus and having new C- and N-termini at amino acids;
| 26-27 |
| 27-28 |
| 28-29 |
| 29-30 |
| 30-31 |
| 31-32 |
| 32-33 |
| 33-34 |
| 34-35 |
| 35-36 |
| 36-37 |
| 37-38 |
| 38-39 |
| 39-40 |
| 40-41 |
| 41-42 |
| 49-50 |
| 50-51 |
| 51-52 |
| 52-53 |
| 53-54 |
| 54-55 |
| 64-65 |
| 65-66 |
| 66-67 |
| 67-68 |
| 68-69 |
| 69-70 |
| 70-71 |
| 71-72 |
| 72-73 |
| 82-83 |
| 83-84 |
| 84-85 |
| 85-86 |
| 86-87 |
| 87-88 |
| 88-89 |
| 89-90 |
| 90-91 |
| 91-92 |
| 92-93 |
| 97-98 |
| 98-99 |
| β99-100 |
| 100-101 |
| 101-102 |
| 102-103 |
| or 103-104 |
| respectively; |
a polypeptide comprising; a modified human c-mpl ligand amino acid sequence of the formula:
| SEQ ID NO:860 |
| Ser Pro Ala Pro Pro Ala Cys Asp Leu Arg Val Leu | |
| 1ββββββββββββββ5ββββββββββββββββββ10 | |
| Ser Lys Leu Leu Arg Asp Ser His Val Leu His Ser | |
| βββββββββ15ββββββββββββββββββ20 | |
| Arg Leu Ser Gln Cys Pro Glu Val His Pro Leu Pro | |
| 25ββββββββββββββββββ30ββββββββββββββββββ35 | |
| Thr Pro Val Leu Leu Pro Ala Val Asp Phe Ser Leu | |
| ββββββββββββ40ββββββββββββββββββ45 | |
| Gly Glu Trp Lys Thr Gln Met Glu Glu Thr Lys Ala | |
| ββββ50ββββββββββββββββββ55ββββββββββββββββββ60 | |
| Gln Asp Ile Leu Gly Ala Val Thr Leu Leu Leu Glu | |
| ββββββββββββββββ65ββββββββββββββββββ70 | |
| Gly Val Met Ala Ala Arg Gly Gln Leu Gly Pro Thr | |
| ββββββββ75ββββββββββββββββββ80 | |
| Cys Leu Ser Ser Leu Leu Gly Gln Leu Ser Gly Gln | |
| 85βββββββββββββββββ90ββββββββββββββββββ95 | |
| Val Arg Leu Leu Leu Gly Ala Leu Gln Ser Leu Leu | |
| ββββββββββββ100βββββββββββββββββ105 | |
| Gly Thr Gln Xaa Xaa Xaa Xaa Gly Arg Thr Thr Ala | |
| ββββ110βββββββββββββββββ115βββββββββββββββββ120 | |
| His Lys Asp Pro Asn Ala Ile Phe Leu Ser Phe Gln | |
| ββββββββββββββββ125βββββββββββββββββ130 | |
| His Leu Leu Arg Gly Lys Val Arg Phe Leu Met Leu | |
| ββββββββ135βββββββββββββββββββ140 | |
| Val Gly Gly Ser Thr Leu Cys Val Arg | |
| 145βββββββββββββββββ150βββββββββ153 | |
wherein:
Xaa at position 112 is deleted or Leu, Ala, Val, Ile, Pro, Phe, Trp, or Met;
Xaa at position 113 is deleted or Pro, Phe, Ala, Val, Leu, Ile, Trp, or Met;
Xaa at position 114 is deleted or Pro, Phe, Ala, Val, Leu, Ile, Trp, or Met;
Xaa at position 115 is deleted or Gln, Gly, Ser, Thr, Tyr, or Asn; and
wherein the N-terminus is joined to the C-terminus directly or through a linker (L2) capable of joining the N-terminus to the C-terminus and having new C- and N-termini at amino acids;
| 26-27 |
| 27-28 |
| 28-29 |
| 29-30 |
| 30-31 |
| 32-33 |
| 33-34 |
| 34-35 |
| 36-37 |
| 37-38 |
| 38-39 |
| 40-41 |
| 41-42 |
| 42-43 |
| 43-44 |
| 44-45 |
| 46-47 |
| 47-48 |
| 48-49 |
| 50-51 |
| 51-52 |
| 52-53 |
| 53-54 |
| 54-55 |
| 55-56 |
| 56-57 |
| 57-58 |
| 58-59 |
| 59-60 |
| 78-79 |
| 79-80 |
| 80-81 |
| 81-82 |
| 82-83 |
| 83-84 |
| 84-85 |
| 85-86 |
| 86-87 |
| 87-88 |
| 88-89 |
| 108-109 |
| 109-110 |
| 110-111 |
| 111-112 |
| 112-113 |
| 113-114 |
| 114-115 |
| 115-116 |
| 116-117 |
| 117-118 |
| 118-119 |
| 119-120 |
| 120-121 |
| 121-122 |
| 122-123 |
| 123-124 |
| 124-125 |
| 125-126 |
| 126-127 |
| or |
| 127-128 |
| respectively; |
a colony stimulating factor, a cytokine, a lymphokine, an interleukin, and a hematopoietic growth factor; and
wherein L1 is a linker capable of linking R1 to R2;
said hematopoietic protein can optionally be immediately preceded by (methionineβ1), (alanineβ1) or (methionineβ2, alanineβ1).
2. A hematopoietic protein comprising; an amino acid sequence of the formula:
R1-L1-R2, R2-L1-R1, R1-R2, or R2-R1
wherein R1 is a human stem cell factor receptor agonist polypeptide, comprising; a modified stem cell factor amino acid sequence of the Formula:
| SEQ ID NO:465 |
| Glu Gly Ile Cys Arg Asn Arg Val Thr Asn Asn Val | |
| ββββββββββββββββββββββββββββββββββ10 | |
| Lys Asp Val Thr Lys Leu Val Ala Asn Leu Pro Lys | |
| ββββββββββββββββββββββββββββ20 | |
| Asp Tyr Met Ile Thr Leu Lys Tyr Val Pro Gly Met | |
| ββββββββββββββββββββ30 | |
| Asp Val Leu Pro Ser His Cys Trp Ile Ser Glu Met | |
| ββββββββββββ40 | |
| Val Val Gln Leu Ser Asp Ser Leu Thr Asp Leu Leu | |
| ββββ50ββββββββββββββββββββββββββββββββββββ60 | |
| Asp Lys Phe Ser Asn Ile Ser Glu Gly Leu Ser Asn | |
| βββββββββββββββββββββββββββββββββββββ70 | |
| Tyr Ser Ile Ile Asp Lys Leu Val Asn Ile Val Asp | |
| ββββββββββββββββββββββββββββ80 | |
| Asp Leu Val Glu Cys Val Lys Glu Asn Ser Ser Lys | |
| βββββββββββββββββββββ90 | |
| Asp Leu Lys Lys Ser Phe Lys Ser Pro Glu Pro Arg | |
| βββββββββββββ100 | |
| Leu Phe Thr Pro Glu Glu Phe Phe Arg Ile Phe Asn | |
| ββββ110βββββββββββββββββββββββββββββββββββββ120 | |
| Arg Ser Ile Asp Ala Phe Lys Asp Phe Val Val Ala | |
| βββββββββββββββββββββββββββββββββββββ130 | |
| Ser Glu Thr Ser Asp Cys Val Val Ser Ser Thr Leu | |
| βββββββββββββββββββββββββββββ140 | |
| Ser Pro Glu Lys Asp Ser Arg Val Ser Val Thr Lys | |
| βββββββββββββββββββββ150 | |
| Pro Phe Met Leu Pro Pro Val Ala Ala | |
| ββββββββββββ160ββββββββββββββββββ165 | |
wherein 1-23 amino acids are optionally deleted from the C-terminus of said stem cell factor receptor agonist polypeptide; and
wherein the N-terminus is joined to the C-terminus directly or through a linker (L2) capable of joining the N-terminus to the C-terminus and having new C- and N-termini at amino acids;
| 23-24 |
| 24-25 |
| 25-26 |
| 26-27 |
| 27-28 |
| 28-29 |
| 29-30 |
| 30-31 |
| 31-32 |
| 32-33 |
| 33-34 |
| 34-35 |
| 35-36 |
| 36-37 |
| 37-38 |
| 38-39 |
| 39-40 |
| 40-41 |
| 64-65 |
| 65-66 |
| 66-67 |
| 67-68 |
| 68-69 |
| 69-70 |
| 70-71 |
| 89-90 |
| 90-91 |
| 91-92 |
| 92-93 |
| 93-94 |
| 94-95 |
| 95-96 |
| 96-97 |
| 97-98 |
| 98-99 |
| β99-100 |
| 100-101 |
| 101-102 |
| 102-103 |
| 103-104 |
| 104-105 |
| 105-106 |
| 106-107 |
| 107-108 |
| 108-109 |
| 109-110 |
| 110-111 |
| respectively; |
R2 is selected from the group consisting of:
a polypeptide comprising; a modified human IL-3 amino acid sequence of the formula:
| SEQ ID NO:859 |
| Ala Pro Met Thr Gln Thr Thr Ser Leu Lys Thr Ser | |
| 1ββββββββββββββ5ββββββββββββββββββ10 | |
| Trp Val Asn Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββββββ15ββββββββββββββββββ20 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| 25βββββββββββββββββ30βββββββββββββββββ35 | |
| Xaa Xaa Asn Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββββββββββ40βββββββββββββββββ45 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββ50βββββββββββββββββ55βββββββββββββββββ60 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββββββββββββββ65βββββββββββββββββ70 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββββββ75βββββββββββββββββ80 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| 85βββββββββββββββββ90βββββββββββββββββ95 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Phe Xaa | |
| ββββββββββββ100βββββββββββββββββ105 | |
| Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa | |
| ββββ110βββββββββββββββββ115βββββββββββββββββ120 | |
| Xaa Xaa Xaa Gln Gln Thr Thr Leu Ser Leu Ala Ile | |
| ββββββββββββββββ125βββββββββββββββββ130 | |
| Phe | |
wherein Xaa at position 17 is Ser, Lys, Gly, Asp, Met, Gln, or Arg;
Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg, or Gln;
Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala, or Cys;
Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro, or Ala;
Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gin, Asn, Thr, Ser or Val;
Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gin, Leu, Val or Gly;
Xaa at position 23 is Ile, Val, Ala, Gly, Trp, Lys, Phe, Leu, Ser, or Arg;
Xaa at position 24 is Ile, Gly, Val, Arg, Ser, Phe, or Leu;
Xaa at position 25 is Thr, His, Gly, Gin, Arg, Pro, or Ala;
Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala, or Trp;
Xaa at position 27 is Leu, Gly, Arg, Thr, Ser, or Ala;
Xaa at position 28 is Lys, Arg, Leu, Gin, Gly, Pro, Val or Trp;
Xaa at position 29 is Gln, Asn, Leu, Pro, Arg, or Val;
Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gin, Ser, Leu, or Lys;
Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu, or Gin;
Xaa at position 32 is Leu, Val, Arg, Gin, Asn, Gly, Ala, or Glu;
Xaa at position 33 is Pro, Leu, Gin, Ala, Thr, or Glu;
Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gin, Thr, Arg, Ala, Phe, Ile or Met;
Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gin, or Val;
Xaa at position 36 is Asp, Leu, or Val;
Xaa at position 37 is Phe, Ser, Pro, Trp, or Ile;
Xaa at position 38 is Asn, or Ala;
Xaa at position 40 is Leu, Trp, or Arg;
Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met, or Pro;
Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala;
Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gin, Arg, Thr, Gly or Ser;
Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;
Xaa at position 45 is Gin, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His;
Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gin, Lys, His, Ala, Tyr, Ile, Val or Gly;
Xaa at position 47 is Ile, Gly, Val, Ser, Arg, Pro, or His;
Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;
Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His, or Asp;
Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gin;
Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr, or His;
Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr;
Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser, or Met;
Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gin, Asn, Lys, His, Ala or Leu;
Xaa at position 55 is Arg, Thr, Val, Ser, Leu, or Gly;
Xaa at position 56 is Pro, Gly, Cys, Ser, Gin, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;
Xaa at position 57 is Asn or Gly;
Xaa at position 58 is Leu, Ser, Asp, Arg, Gin, Val, or Cys;
Xaa at position 59 is Glu Tyr, His, Leu, Pro, or Arg; Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn, or Thr;
Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg, or Ser;
Xaa at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp, or Ile;
Xaa at position 63 is Arg, Tyr, Trp, Lys, Ser, His, Pro, or Val;
Xaa at position 64 is Ala, Asn, Pro, Ser, or Lys;
Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe, or Ser;
Xaa at position 66 is Lys, Ile, Arg, Val, Asn, Glu, or Ser;
Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro, or His;
Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr, or His;
Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly, or Leu;
Xaa at position 70 is Asn, Leu, Val, Trp, Pro, or Ala;
Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp, or Asn;
Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg, or Asp;
Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr, or Arg;
Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala;
Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln, or Leu;
Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly, or Asp;
Xaa at position 77 is Ile, Ser, Arg, Thr, or Leu;
Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly, or Arg;
Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, Gly, or Asp;
Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu, or Arg;
Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val, or Lys;
Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;
Xaa at position 83 is Pro, Ala, Thr, Trp, Arg, or Met;
Xaa at position 84 is Cys, Glu, Gly, Arg, Met, or Val;
Xaa at position 85 is Leu, Asn, Val, or Gln;
Xaa at position 86 is Pro, Cys, Arg, Ala, or Lys;
Xaa at position 87 is Leu, Ser, Trp, or Gly;
Xaa at position 88 is Ala, Lys, Arg, Val, or Trp;
Xaa at position 89 is Thr, Asp, Cys, Leu, Val, Glu, His, Asn, or Ser;
Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile, or Met;
Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp, or His;
Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;
Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu, or Arg;
Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala, or Pro;
Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile, or Tyr;
Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile, or Thr;
Xaa at position 97 is Ile, Val, Lys, Ala, or Asn;
Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro;
Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe, or His;
Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln, or Pro;
Xaa at position 101 is Asp, Pro, Met, Lys, His, Thr, Val, Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu, or Gln;
Xaa at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr, or Pro;
Xaa at position 103 is Asp, or Ser;
Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe, or Gly;
Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp, or His;
Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly, or Pro;
Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro;
Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;
Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser, or Trp;
Xaa at position 111 is Leu, Ile, Arg, Asp, or Met;
Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser, or Phe;
Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn;
Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg, or Leu;
Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp, or Met;
Xaa at position 116 is Lys, Leu, Pro, Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe, Gln, or Ile;
Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys, or Pro;
Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp, or Tyr;
Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr, or Arg;
Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val, or Gln;
Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;
Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr, or Cys;
Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr, or Leu;
wherein from 1 to 14 amino acids are optionally deleted from the N-terminus and/or from 1 to 15 amino acids are optionally deleted from the C-terminus of said modified human IL-3 amino acid sequence; wherein from 0 to 44 of the amino acids designated by Xaa are different from the corresponding amino acids of native (1-133) human interleukin-3; and
wherein the N-terminus is joined to the C-terminus directly or through a linker (L2), capable of joining the N-terminus to the C-terminus and having new C- and N-termini at amino acids;
| 26-27 |
| 27-28 |
| 28-29 |
| 29-30 |
| 30-31 |
| 31-32 |
| 32-33 |
| 33-34 |
| 34-35 |
| 35-36 |
| 36-37 |
| 37-38 |
| 38-39 |
| 39-40 |
| 40-41 |
| 41-42 |
| 49-50 |
| 50-51 |
| 51-52 |
| 52-53 |
| 53-54 |
| 54-55 |
| 64-65 |
| 65-66 |
| 66-67 |
| 67-68 |
| 68-69 |
| 69-70 |
| 70-71 |
| 71-72 |
| 72-73 |
| 82-83 |
| 83-84 |
| 84-85 |
| 85-86 |
| 86-87 |
| 87-88 |
| 88-89 |
| 89-90 |
| 90-91 |
| 91-92 |
| 92-93 |
| 97-98 |
| 98-99 |
| β99-100 |
| 100-101 |
| 101-102 |
| 102-103 |
| or |
| 103-104 |
| respectively; |
and
wherein L1 is a linker capable of linking R1 to R2;
said hematopoietic protein can optionally be immediately preceded by (methionineβ1), (alanineβ1) or (methionineβ2, alanineβ1).
3. The hematopoeitic protein of claim 2 wherein R2 is selected from the group consisting of:
| SEQ ID NO:803 |
| Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His | |
| His Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro | |
| Asn Asn Leu Asn Ala Glu Asp Val Asp Ile Leu Met | |
| Glu Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe | |
| Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly | |
| Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu | |
| Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile | |
| Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu | |
| Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala | |
| Gln Glu Gln Gln; | |
| SEQ ID NO:804 |
| Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His | |
| His Leu Lys Arg Pro Pro Asn Pro Leu Leu Asp Pro | |
| Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met | |
| Glu Arg Asn Leu Arg Thr Pro Asn Leu Leu Ala Phe | |
| Val Arg Ala Val Lys His Leu Glu Asn Ala Ser Gly | |
| Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu | |
| Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile | |
| Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu | |
| Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala | |
| Gln Glu Gln Gln; | |
| SEQ ID NO:805 |
| Ala Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His | |
| His Leu Lys Val Pro Pro Ala Pro Leu Leu Asp Ser | |
| Asn Asn Leu Asn Ser Glu Asp Met Asp Ile Leu Met | |
| Glu Arg Asn Leu Arg Leu Pro Asn Leu Leu Ala Phe | |
| Val Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly | |
| Ile Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu | |
| Pro Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile | |
| Ile Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu | |
| Lys Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala | |
| Gln Glu Gln Gln; | |
| and | |
| SEQ ID NO:806 |
| Asn Cys Ser Ile Met Ile Asp Glu Ile Ile His His | |
| Leu Lys Arg Pro Pro Ala Pro Leu Leu Asp Pro Asn | |
| Asn Leu Asn Asp Glu Asp Val Ser Ile Leu Met Asp | |
| Arg Asn Leu Arg Leu Pro Asn Leu Glu Ser Phe Val | |
| Arg Ala Val Lys Asn Leu Glu Asn Ala Ser Gly Ile | |
| Glu Ala Ile Leu Arg Asn Leu Gln Pro Cys Leu Pro | |
| Ser Ala Thr Ala Ala Pro Ser Arg His Pro Ile Ile | |
| Ile Lys Ala Gly Asp Trp Gln Glu Phe Arg Glu Lys | |
| Leu Thr Phe Tyr Leu Val Thr Leu Glu Gln Ala Gln | |
| Glu Gln Gln. | |
4. A hematopoietic protein comprising; an amino acid sequence of the formula:
R1-L1-R2, R2-L1-R1, R1-R2, or R2-R1
wherein R1 is a human stem cell factor receptor agonist polypeptide, comprising; a modified stem cell factor amino acid sequence of the Formula:
| SEQ ID NO:465 |
| Glu Gly Ile Cys Arg Asr Arg Val Thr Asn Asn Val | |
| βββββββββββββββββββββββββββββββββββββ10 | |
| Lys Asp Val Thr Lys Leu Val Ala Asn Leu Pro Lys | |
| ββββββββββββββββββββββββββββ20 | |
| Asp Tyr Met Ile Thr Leu Lys Tyr Val Pro Gly Met | |
| ββββββββββββββββββββ30 | |
| Asp Val Leu Pro Ser His Cys Trp Ile Ser Glu Met | |
| ββββββββββββ40 | |
| Val Val Gln Leu Ser Asp Ser Leu Thr Asp Leu Leu | |
| ββββ50βββββββββββββββββββββββββββββββββββββ60 | |
| Asp Lys Phe Ser Asn Ile Ser Glu Gly Leu Ser Asn | |
| ββββββββββββββββββββββββββββββββββββ70 | |
| Tyr Ser Ile Ile Asp Lys Leu Val Asn Ile Val Asp | |
| ββββββββββββββββββββββββββββ80 | |
| Asp Leu Val Glu Cys Val Lys Glu Asn Ser Ser Lys | |
| ββββββββββββββββββββ90 | |
| Asp Leu Lys Lys Ser Phe Lys Ser Pro Glu Pro Arg | |
| ββββββββββββ100 | |
| Leu Phe Thr Pro Glu Glu Phe Phe Arg Ile Phe Asn | |
| ββββ110βββββββββββββββββββββββββββββββββββββ120 | |
| Arg Ser Ile Asp Ala Phe Lys Asp Phe Val Val Ala | |
| ββββββββββββββββββββββββββββββββββββ130 | |
| Ser Glu Thr Ser Asp Cys Val Val Ser Ser Thr Leu | |
| ββββββββββββββββββββββββββββ140 | |
| Ser Pro Glu Lys Asp Ser Arg Val Ser Val Thr Lys | |
| ββββββββββββββββββββ150 | |
| Pro Phe Met Leu Pro Pro Val Ala Ala | |
| ββββββββββββ160βββββββββββββββββ165 | |
wherein 1-23 amino acids are optionally deleted from the C-terminus of said stem cell factor receptor agonist polypeptide; and
wherein the N-terminus is joined to the C-terminus directly or through a linker (L2) capable of joining the N-terminus to the C-terminus and having new C- and N-termini at amino acids;
| 23-24 |
| 24-25 |
| 25-26 |
| 26-27 |
| 27-28 |
| 28-29 |
| 29-30 |
| 30-31 |
| 31-32 |
| 32-33 |
| 33-34 |
| 34-35 |
| 35-36 |
| 36-37 |
| 37-38 |
| 38-39 |
| 39-40 |
| 40-41 |
| 64-65 |
| 65-66 |
| 66-67 |
| 67-68 |
| 68-69 |
| 69-70 |
| 70-71 |
| 89-90 |
| 90-91 |
| 91-92 |
| 92-93 |
| 93-94 |
| 94-95 |
| 95-96 |
| 96-97 |
| 97-98 |
| 98-99 |
| β99-100 |
| 100-101 |
| 101-102 |
| 102-103 |
| 103-104 |
| 104-105 |
| 105-106 |
| 106-107 |
| 107-108 |
| 108-109 |
| 109-110 |
| 110-111 |
| respectively; |
R2 is selected from the group consisting of:
a polypeptide comprising; a modified human c-mpl ligand amino acid sequence of the formula:
| SEQ ID NO:860 |
| Ser Pro Ala Pro Pro Ala Cys Asp Leu Arg Val Leu | |
| 1βββββββββββββββ5βββββββββββββββββββ10 | |
| Ser Lys Leu Leu Arg Asp Ser His Val Leu His Ser | |
| ββββββββ15βββββββββββββββββ20 | |
| Arg Leu Ser Gln Cys Pro Glu Val His Pro Leu Pro | |
| 25ββββββββββββββββββ30ββββββββββββββββββ35 | |
| Thr Pro Val Leu Leu Pro Ala Val Asp Phe Ser Leu | |
| ββββββββββββ40ββββββββββββββββββ45 | |
| Gly Glu Trp Lys Thr Gln Met Glu Glu Thr Lys Ala | |
| ββββ50ββββββββββββββββββ55ββββββββββββββββββ60 | |
| Gln Asp Ile Leu Gly Ala Val Thr Leu Leu Leu Glu | |
| ββββββββββββββββ65ββββββββββββββββββ70 | |
| Gly Val Met Ala Ala Arg Gly Gln Leu Gly Pro Thr | |
| ββββββββ75ββββββββββββββββββ80 | |
| Cys Leu Ser Ser Leu Leu Gly Gln Leu Ser Gly Gln | |
| 85ββββββββββββββββββ90ββββββββββββββββββ95 | |
| Val Arg Leu Leu Leu Gly Ala Leu Gln Ser Leu Leu | |
| ββββββββββββ100βββββββββββββββββ105 | |
| Gly Thr Gln Xaa Xaa Xaa Xaa Gly Arg Thr Thr Ala | |
| ββββ110βββββββββββββββββ120 | |
| His Lys Asp Pro Asn Ala Ile Phe Leu Ser Phe Gln | |
| ββββββββββββββββ125βββββββββββββββββ130 | |
| His Leu Leu Arg Gly Lys Val Arg Phe Leu Met Leu | |
| ββββββββ135βββββββββββββββββ140 | |
| Val Gly Gly Ser Thr Leu Cys Val Arg | |
| 145βββββββββββββββββ150ββββββββ153 | |
wherein;
Xaa at position 112 is deleted or Leu, Ala, Val, Ile, Pro, Phe, Trp, or Met;
Xaa at position 113 is deleted or Pro, Phe, Ala, Val, Leu, Ile, Trp, or Met;
Xaa at position 114 is deleted or Pro, Phe, Ala, Val, Leu, Ile, Trp, or Met;
Xaa at position 115 is deleted or Gln, Gly, Ser, Thr, Tyr, or Asn; and
wherein the N-terminus is joined to the C-terminus directly or through a linker (L2) capable of joining the N-terminus to the C-terminus and having new C- and N-termini at amino acids;
| 26-27 |
| 27-28 |
| 28-29 |
| 29-30 |
| 30-31 |
| 32-33 |
| 33-34 |
| 34-35 |
| 36-37 |
| 37-38 |
| 38-39 |
| 40-41 |
| 41-42 |
| 42-43 |
| 43-44 |
| 44-45 |
| 46-47 |
| 47-48 |
| 48-49 |
| 50-51 |
| 51-52 |
| 52-53 |
| 53-54 |
| 54-55 |
| 55-56 |
| 56-57 |
| 57-58 |
| 58-59 |
| 59-60 |
| 78-79 |
| 79-80 |
| 80-81 |
| 81-82 |
| 82-83 |
| 83-84 |
| 84-85 |
| 85-86 |
| 86-87 |
| 87-88 |
| 88-89 |
| 108-109 |
| 109-110 |
| 110-111 |
| 111-112 |
| 112-113 |
| 113-114 |
| 114-115 |
| 115-116 |
| 116-117 |
| 117-118 |
| 118-119 |
| 119-120 |
| 120-121 |
| 121-122 |
| 122-123 |
| 123-124 |
| 124-125 |
| 125-126 |
| 126-127 |
| or |
| 127-128 |
| respectively; |
and
wherein L1 is a linker capable of linking R1 to R2;
said hematopoietic protein can optionally be immediately preceded by (methionineβ1), (alanineβ1) or (methionineβ2, alanineβ1).
5. A hematopoietic protein comprising; an amino acid sequence of the formula:
R1-L1-R2, R2-L1-R1, R1-R2, or R2-R1
wherein R1 is a human stem cell factor receptor agonist polypeptide, comprising; a modified stem cell factor amino acid sequence of the Formula:
| SEQ ID NO:465 |
| Glu Gly Ile Cys Arg Asn Arg Val Thr Asn Asn Val | |
| ββββββββββββββββββββββββββββββββββββ10 | |
| Lys Asp Val Thr Lys Leu Val Ala Asn Leu Pro Lys | |
| ββββββββββββββββββββββββββββ20 | |
| Asp Tyr Met Ile Thr Leu Lys Tyr Val Pro Gly Met | |
| ββββββββββββββββββββ30 | |
| Asp Val Leu Pro Ser His Cys Trp Ile Ser Glu Met | |
| ββββββββββββ40 | |
| Val Val Gln Leu Ser Asp Ser Leu Thr Asp Leu Leu | |
| ββββ50ββββββββββββββββββββββββββββββββββββββ60 | |
| Asp Lys Phe Ser Asn Ile Ser Glu Gly Leu Ser Asn | |
| ββββββββββββββββββββββββββββββββββββ70 | |
| Tyr Ser Ile Ile Asp Lys Leu Val Asn Ile Val Asp | |
| ββββββββββββββββββββββββββββ80 | |
| Asp Leu Val Glu Cys Val Lys Glu Asn Ser Ser Lys | |
| ββββββββββββββββββββ90 | |
| Asp Leu Lys Lys Ser Phe Lys Ser Pro Glu Pro Arg | |
| ββββββββββββ100 | |
| Leu Phe Thr Pro Glu Glu Phe Phe Arg Ile Phe Asn | |
| ββββ110βββββββββββββββββββββββββββββββββββββ120 | |
| Arg Ser Ile Asp Ala Phe Lys Asp Phe Val Val Ala | |
| ββββββββββββββββββββββββββββββββββββ130 | |
| Ser Glu Thr Ser Asp Cys Val Val Ser Ser Thr Leu | |
| ββββββββββββββββββββββββββββ140 | |
| Ser Pro Glu Lys Asp Ser Arg Val Ser Val Thr Lys | |
| ββββββββββββββββββββ150 | |
| Pro Phe Met Leu Pro Pro Val Ala Ala | |
| ββββββββββββ160βββββββββββββββββ165 | |
wherein 1-23 amino acids are optionally deleted from the C-terminus of said stem cell factor receptor agonist polypeptide; and
wherein the N-terminus is joined to the C-terminus directly or through a linker (L2) capable of joining the N-terminus to the C-terminus and having new C- and N-termini at amino acids;
| 23-24 |
| 24-25 |
| 25-26 |
| 26-27 |
| 27-28 |
| 28-29 |
| 29-30 |
| 30-31 |
| 31-32 |
| 32-33 |
| 33-34 |
| 34-35 |
| 35-36 |
| 36-37 |
| 37-38 |
| 38-39 |
| 39-40 |
| 40-41 |
| 64-65 |
| 65-66 |
| 66-67 |
| 67-68 |
| 68-69 |
| 69-70 |
| 70-71 |
| 89-90 |
| 90-91 |
| 91-92 |
| 92-93 |
| 93-94 |
| 94-95 |
| 95-96 |
| 96-97 |
| 97-98 |
| 98-99 |
| β99-100 |
| 100-101 |
| 101-102 |
| 102-103 |
| 103-104 |
| 104-105 |
| 105-106 |
| 106-107 |
| 107-108 |
| 108-109 |
| 109-110 |
| 110-111 |
| respectively; |
R2 is selected from the group consisting of:
a colony stimulating factor, a cytokine, a lymphokine, an interleukin, and a hematopoietic growth factor; and
wherein L1 is a linker capable of linking R1 to R2;
said hematopoietic protein can optionally be immediately preceded by (methionineβ1), (alanineβ1) or (methionineβ2, alanineβ1).
6. The hematopoietic protein as recited in claim 1, 2, 3, 4 or 5 wherein said linker (L2) is selected from the group consisting of:
| Ser; | |
| Asn; | |
| Gly; | |
| Thr; | |
| Gly Ser; | |
| Ala Ala; | |
| Gly Ser Gly; | |
| Gly Gly Gly; | |
| Gly Asn Gly; | |
| Gly Ala Gly; | |
| Gly Thr Gly; | |
| Ala Ser Ala; | |
| Ala Ala Ala; | |
| SEQ ID NO:778 |
| Gly Gly Gly Ser; | |
| SEQ ID NO:779 |
| Gly Gly Gly Ser Gly Gly Gly Ser; | |
| SEQ ID NO:780 |
| Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser; | |
| SEQ ID NO:781 |
| Ser Gly Gly Ser Gly Gly Ser; | |
| SEQ ID NO:782 |
| Glu Phe Gly Asn Met; | |
| SEQ ID NO:783 |
| Glu Phe Gly Gly Asn Met; | |
| SEQ ID NO:784 |
| Glu Phe Gly Gly Asn Gly Gly Asn Met; | |
| SEQ ID NO:785 |
| Gly Gly Ser Asp Met Ala Gly; | |
| SEQ ID NO:786 |
| Ser Gly Gly Asn Gly; | |
| SEQ ID NO:787 |
| Ser Gly Gly Asn Gly Ser Gly Gly Asn Gly; | |
| SEQ ID NO:788 |
| Ser Gly Gly Asn Gly Ser Gly Gly Asn Gly Ser Gly | |
| Gly Asn Gly; | |
| SEQ ID NO:789 |
| Ser Gly Gly Ser Gly Ser Gly Gly Ser Gly; | |
| SEQ ID NO:790 |
| Ser Gly Gly Ser Gly Ser Gly Gly Ser Gly Ser Gly | |
| Gly Ser Gly; | |
| SEQ ID NO:791 |
| Gly Gly Gly Ser Gly Gly; | |
| SEQ ID NO:792 |
| Gly Gly Gly Ser Gly Gly Gly; | |
| SEQ ID NO:793 |
| Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly | |
| SEQ ID NO:794 |
| Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser | |
| Gly; | |
| SEQ ID NO:795 |
| Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser | |
| Gly Gly Gly; | |
| SEQ ID NO:796 |
| Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser | |
| Gly Gly Gly Ser Gly Gly Gly Ser Gly; | |
| SEQ ID NO:797 |
| Pro Pro Pro Trp Ser Pro Arg Pro Leu Gly Ala Thr | |
| Ala Pro Thr Ala Gly Gln Pro Pro Leu; | |
| SEQ ID NO:798 |
| Pro Pro Pro Trp Ser Pro Arg Pro Leu Gly Ala Thr | |
| Ala Pro Thr; | |
| and | |
| SEQ ID NO:799 |
| Val Glu Thr Val Phe His Arg Val Ser Gln Asp Gly | |
| Leu Leu Thr Ser. | |
7. The hematopoietic protein of claim 1 or 5, wherein said colony stimulating factor is selected from the group consisting of GM-CSF, G-CSF, G-CSF Ser17, c-mpl ligand (TPO), M-CSF, erythropoietin (EPO), IL-1, IL-4, IL-2, IL-3, IL-5, IL 6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-15, LIF, flt3/flk2 ligand, human growth hormone, B-cell growth factor, B-cell differentiation factor, eosinophil differentiation factor and stem cell factor (SCF).
8. The hematopoietic protein of claim 7 wherein said colony stimulating factor is selected from the group consisting of G-CSF, G-CSF Ser17, G-CSF Ala17 and c-mpl ligand (TPO).
9. A nucleic acid molecule encoding said hematopoietic protein of claim 1.
10. A nucleic acid molecule encoding said hematopoietic protein of claim 2.
11. A nucleic acid molecule encoding said hematopoietic protein of claim 3.
12. A nucleic acid molecule encoding said hematopoietic protein of claim 4.
13. A nucleic acid molecule encoding said hematopoietic protein of claim 5.
14. A nucleic acid molecule encoding said hematopoietic protein of claim 6.
15. A nucleic acid molecule encoding said hematopoietic protein of claim 7.
16. A nucleic acid molecule encoding said hematopoietic protein of claim 8.
17. A method of producing a hematopoietic protein comprising: growing under suitable nutrient conditions, a host cell transformed or transfected with a replicable vector comprising a nucleic acid molecule of claim 9, 10, 11, 12, 13, 14, 15 or 16 in a manner allowing expression of said hematopoietic protein and recovering said hematopoietic protein.
18. A pharmaceutical composition comprising; the hematopoietic protein according to claim 1, 2, 3, 4 or 5; and a pharmaceutically acceptable carrier.
19. A method of stimulating the production of hematopoietic cells in a patient comprising the step of administering an effective amount of the hematopoietic protein as recited in claim 1, 2, 3, 4 or 5 to said patient.
20. A method for selective ex vivo expansion of hematopoietic cells, comprising the steps of;
(a) culturing said hematopoietic cells in a culture medium comprising; the hematopoietic protein of claim 1; and
(b) harvesting said cultured cells.
21. A method for selective ex vivo expansion of hematopoietic cells, comprising the steps of:
(a) separating hematopoietic cells from other cells;
(b) culturing said separated hematopoietic cells in a culture medium comprising; the hematopoietic protein of claim 1; and
(c) harvesting said cultured cells.
22. A method for treatment of a patient having a hematopoietic disorder, comprising the steps of:
(a) removing hematopoietic cells from said patient;
(b) culturing said hematopoietic cells in a culture medium comprising; the hematopoietic protein of claim 1;
(c) harvesting said cultured cells; and
(d) transplanting said cultured cells into said patient.
23. A method for treatment of a patient having a hematopoietic disorder, comprising the steps of:
(a) removing hematopoietic cells from said patient;
(b) separating hematopoietic cells from other cells;
(c) culturing said separated hematopoietic cells in a culture medium comprising; the hematopoietic protein of claim 1;
(d) harvesting said cultured cells; and
(e) transplanting said cultured cells into said patient.
24. A method of human gene therapy, comprising the steps of:
(a) removing hematopoietic cells from a patient;
(b) separating said hematopoietic cells from other cells;
(c) culturing said separated hematopoietic cells in a culture medium comprising; the hematopoietic protein of claim 1;
(d) introducing DNA into said cultured cells;
(e) harvesting said transduced cells; and
(f) transplanting said transduced cells into said patient.
25. The method according to claim 20, 21, 22, 23 or 24 wherein said hematopoietic cells are CD34+ cells.
26. The method according to claim 20, 21, 22, 23 or 24 wherein said hematopoietic cells are peripheral blood cells.
27. A method for the production of dendritic cells comprising the steps of:
a) separating hematopoietic progenitor cells or CD34+ cells from other cells; and
b) culturing said hematopoietic progenitor cells or CD34+ cells in a growth medium, comprising the hematopoietic protein of claim 1, 2, 3, 4 or 5.
28. The method of claim 27, further comprising the step of pulsing said culturing hematopoietic progenitor cells or CD34+ cells with an antigen.
29. The method of claim 27, wherein said growth medium, further comprises one or more factor selected from the group consisting of; GM-CSF, IL-4, TNF-Ξ±, stem cell factor (SCF), flt-3 ligand, IL-3, an IL-3 variant, an IL-3 variant fusion protein, and a multi-functional receptor agonist.
30. The method of claim 28, wherein said growth medium, further comprises one or more factor selected from the group consisting of; GM-CSF, IL-4, TNF-Ξ±, stem cell factor (SCF), flt-3 ligand, IL-3, an IL-3 variant, an IL-3 variant fusion protein, and a multi-functional receptor agonist.
31. A method for treating a human having a tumor, infection or auto-immune disease, comprising the step of; administering the hematopoietic protein of claim 1, 2, 3, 4 or 5 to said human.
32. The method of claim 31, further comprising administrating one or more factor selected from the group consisting of; GM-CSF, IL-4, TNF-Ξ±, stem cell factor (SCF), flt-3 ligand, IL-3, an IL-3 variant, an IL-3 variant fusion protein, and a multi-functional receptor agonist.
33. The method of claim 31, further comprising the step of administering an antigen to said patient.
34. The method of claim 32, further comprising the step of administering an antigen to said patient.
35. A method for treating a human having a tumor, infection or auto-immune disease, comprising the step of:
a) mobilizing dendritic cell progenitors or mature dendritic cells by administering the hematopoietic protein of claim 1 to said human;
b) removing said dendritic cell precursors or mature dendritic cells by a blood draw or pheresis;
c) pulsing said dendritic cell precursors or mature dendritic cells with an antigen; and
d) returning said antigen pulsed dendritic cell precursors or mature dendritic cells to said human.
36. The method of claim 35, further comprising administering in step a), one or more factor selected from the group consisting of; GM-CSF, IL-4, TNF-Ξ±, stem cell factor (SCF), flt-3 ligand, IL-3, an IL-3 variant, an IL-3 variant fusion protein, and a multi-functional receptor agonist.
37. The method of claim 35, further comprising the step of culturing said dendritic cell precursors or mature dendritic cells from step b), in a growth medium, comprising; the hematopoietic protein of claim 1, 2, 3 or 4.
38. The method of claim 36, further comprising the step of culturing said dendritic cell precursors or mature dendritic cells from step b), in a growth medium, comprising; the hematopoietic protein of claim 1, 2, 3, 4 or 5.
39. The method of claim 37, wherein said growth medium, further comprises one or more factor selected from the group consisting of; GM-CSF, IL-4, TNF-Ξ±, stem cell factor (SCF), flt-3 ligand, IL-3, an IL-3 variant, an IL-3 variant fusion protein, and a multi-functional receptor agonist.
40. The method of claim 38, wherein said growth medium, further comprises one or more factor selected from the group consisting of; GM-CSF, IL-4, TNF-Ξ±, stem cell factor (SCF), flt-3 ligand, IL-3, an IL-3 variant, an IL-3 variant fusion protein, and a multi-functional receptor agonist.
41. A method for treating a human having a tumor, infection or auto-immune disease, comprising the steps of:
a) removing hematopoietic progenitor cells or CD34+cells from said human by a blood draw or pheresis;
b) culturing said hematopoietic progenitor cells or CD34+ cells in a growth medium, comprising the hematopoietic protein of claim 1 to produce dendritic cell precursors or mature dendritic cells; and
c) returning said dendritic cell precursors or mature dendritic cells to said human.
42. A method for treating a human having a tumor, infection or auto-immune disease, comprising the steps of:
a) removing hematopoietic progenitor cells or CD34+cells from said patient by a blood draw or pheresis;
b) culturing said hematopoietic progenitor cells or CD34+ cells in a growth medium, comprising the hematopoietic protein of claim 1 to produce dendritic cell precursors or mature dendritic cells;
c) pulsing said dendritic cell precursors or mature dendritic cells with an antigen; and
d) returning said antigen pulsed dendritic cell precursors or mature dendritic cells to said human.
43. The method of claim 41, further comprising the step of separating said hematopoietic progenitor cells or CD34+cells from other cells prior to culturing.
44. The method of claim 42, further comprising the step of separating said hematopoietic progenitor cells or CD34+cells from other cells prior to culturing.
45. The method of claim 42, wherein said culture medium further comprises one or more factor selected from the group consisting of: GM-CSF, IL-4, TNF-Ξ±, stem cell factor (SCF), flt-3 ligand, IL-3, an IL-3 variant, an IL-3 variant fusion protein, and a multi-functional receptor agonist.
46. The method of claim 43, wherein said culture medium further comprises one or more factor selected from the group consisting of: GM-CSF, IL-4, TNF-Ξ±, stem cell factor (SCF), flt-3 ligand, IL-3, an IL-3 variant, an IL-3 variant fusion protein, and a multi-functional receptor agonist.
47. The method of claim 44, wherein said culture medium further comprises one or more factor selected from the group consisting of: GM-CSF, IL-4, TNF-Ξ±, stem cell factor (SCF), flt-3 ligand, IL-3, an IL-3 variant, an IL-3 variant fusion protein, and a multi-functional receptor agonist.