US20070238116A1
2007-10-11
11/685,579
2007-03-13
The present invention provides compositions, kits and methods for rapid identification and quantification of bacteria by molecular mass and base composition analysis.
Get notified when new applications in this technology area are published.
C12Q1/689 » CPC main
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
C12Q2600/156 » CPC further
Oligonucleotides characterized by their use Polymorphic or mutational markers
C12Q1/6816 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Hybridisation assays characterised by the detection means
C12Q1/6858 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid amplification reactions Allele-specific amplification
C12Q2565/627 » CPC further
Nucleic acid analysis characterised by mode or means of detection; Detection means characterised by use of a special device being a mass spectrometer
C12Q2537/143 » CPC further
Reactions characterised by the reaction format or use of a specific feature the purpose or use of Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
C12Q1/68 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids
C07H21/04 IPC
Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
This application is a continuation of U.S. application Ser. No. 11/409,535, filed Apr. 21, 2006, which is a continuation-in-part of U.S. application Ser. No. 11/060,135, filed Feb. 17, 2005 which claims the benefit of priority to U.S. Provisional Application Ser. No. 60/545,425 filed Feb. 18, 2004; U.S. Provisional Application Ser. No. 60/559,754, filed Apr. 5, 2004; U.S. Provisional Application Ser. No. 60/632,862, filed Dec. 3, 2004; U.S. Provisional Application Ser. No. 60/639,068, filed Dec. 22, 2004; and U.S. Provisional Application Ser. No. 60/648,188, filed Jan. 28, 2005. U.S. application Ser. No. 11/409,535 is a also continuation-in-part of U.S. application Ser. No. 10/728,486, filed Dec. 5, 2003 which claims the benefit of priority to U.S. Provisional Application Ser. No. 60/501,926, filed Sep. 11, 2003. U.S. application Ser. No. 11/409,535 also claims the benefit of priority to: U.S. Provisional Application Ser. No. 60/674,118, filed Apr. 21, 2005; U.S. Provisional Application Ser. No. 60/705,631, filed Aug. 3, 2005; U.S. Provisional Application Ser. No. 60/732,539, filed Nov. 1, 2005; and U.S. Provisional Application Ser. No. 60/773,124, filed Feb. 13, 2006. Each of the above-referenced U.S. Applications is incorporated herein by reference in its entirety. Methods disclosed in U.S. application Ser. Nos. 09/891,793, 10/156,608, 10/405,756, 10/418,514, 10/660,122, 10/660,996, 10/660,997, 10/660,998, 10/728,486, 11/060,135, and 11/073,362, are commonly owned and incorporated herein by reference in their entirety for any purpose.
STATEMENT OF GOVERNMENT SUPPORTThis invention was made with United States Government support under CDC contract RO1 CI000099-01. The United States Government has certain rights in the invention.
SEQUENCE LISTINGThe present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled DIBIS0083USCIOSEQ.txt, created on Mar. 13, 2007 which is 252 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.
FIELD OF THE INVENTIONThe present invention provides compositions, kits and methods for rapid identification and quantification of bacteria by molecular mass and base composition analysis.
BACKGROUND OF THE INVENTIONA problem in determining the cause of a natural infectious outbreak or a bioterrorist attack is the sheer variety of organisms that can cause human disease. There are over 1400 organisms infectious to humans; many of these have the potential to emerge suddenly in a natural epidemic or to be used in a malicious attack by bioterrorists (Taylor et al. Philos. Trans. R. Soc. London B. Biol. Sci., 2001, 356, 983-989). This number does not include numerous strain variants, bioengineered versions, or pathogens that infect plants or animals.
Much of the new technology being developed for detection of biological weapons incorporates a polymerase chain reaction (PCR) step based upon the use of highly specific primers and probes designed to selectively detect certain pathogenic organisms. Although this approach is appropriate for the most obvious bioterrorist organisms, like smallpox and anthrax, experience has shown that it is very difficult to predict which of hundreds of possible pathogenic organisms might be employed in a terrorist attack. Likewise, naturally emerging human disease that has caused devastating consequence in public health has come from unexpected families of bacteria, viruses, fungi, or protozoa. Plants and animals also have their natural burden of infectious disease agents and there are equally important biosafety and security concerns for agriculture.
A major conundrum in public health protection, biodefense, and agricultural safety and security is that these disciplines need to be able to rapidly identify and characterize infectious agents, while there is no existing technology with the breadth of function to meet this need. Currently used methods for identification of bacteria rely upon culturing the bacterium to effect isolation from other organisms and to obtain sufficient quantities of nucleic acid followed by sequencing of the nucleic acid, both processes which are time and labor intensive.
Mass spectrometry provides detailed information about the molecules being analyzed, including high mass accuracy. It is also a process that can be easily automated. DNA chips with specific probes can only determine the presence or absence of specifically anticipated organisms. Because there are hundreds of thousands of species of benign bacteria, some very similar in sequence to threat organisms, even arrays with 10,000 probes lack the breadth needed to identify a particular organism.
The present invention provides oligonucleotide primers and compositions and kits containing the oligonucleotide primers, which define bacterial bioagent identifying amplicons and, upon amplification, produce corresponding amplification products whose molecular masses provide the means to identify bacteria, for example, at and below the species taxonomic level.
SUMMARY OF THE INVENTIONThe present invention provides compositions, kits and methods for rapid identification and quantification of bacteria by molecular mass and base composition analysis.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 456.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1261.
Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 456 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1261.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 288.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1269.
Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 288 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1269.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 698.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1420.
Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 698 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1420.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 217.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1167
Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 217 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1167.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 399.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1041.
Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 399 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1041.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 430.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1321.
Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 430 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1321.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 174.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 853.
Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 174 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 853.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 172.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1360.
Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 172 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1360.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 456 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1261.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 456 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1261 and further comprising one or more primer pairs wherein each member of said one or more primer pairs is of a length of 14 to 35 nucleobases and has 70% to 100% sequence identity with the corresponding member from the group of primer pairs represented by SEQ ID NOs: 288:1269, 698:1420, 217:1167, 399:1041, 430:1321, 174:853, and 172:1360.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 681.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1022.
Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 681 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1022.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 315.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1379.
Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 315 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1379.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 346.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 955.
Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 346 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 955.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 504.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1409.
Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 504 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1409.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 323.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1068.
Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 323 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1068.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 479.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 938.
Another embodiment is an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 479 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 938.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 681 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1022.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 681 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1022 and further comprising one or more primer pairs wherein each member of said one or more primer pairs is of a length of 14 to 35 nucleobases and has 70% to 100% sequence identity with the corresponding member from the group of primer pairs represented by SEQ ID NOs: 315:1379, 346:955, 504:1409, 323:1068, 479:938.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 583.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 923.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 583 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 923.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 454.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1418.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 454 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1418.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 250.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 902.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 250 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 902.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 384.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 878.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 384 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 878.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 694.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1215.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 694 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1215.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 194.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1173.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 194 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1173.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 375.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 890.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 375 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 890.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 656.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1224.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 656 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1224.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 618.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1157.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 618 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1157.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 302.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 852.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 302 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 852.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 199.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 889.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 199 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 889.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 596.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1169.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 596 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1169.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 150.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1242.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 150 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1242.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 166.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1069.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 166 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1069.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 166.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1168.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 166 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1168.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 583 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 923 and further comprising one or more primer pairs wherein each member of said one or more primer pairs is of a length of 14 to 35 nucleobases and has 70% to 100% sequence identity with the corresponding member from the group of primer pairs represented by SEQ ID NOs: 454:1418, 250:902, 384:878, 694:1215, 194:1173, 375:890, 656:1224, 618:1157, 302:852, 199:889, 596:1169, 150:1242, 166:1069 and 166:1168.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 437.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1137.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 437 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1137.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 530.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 891.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 530 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 891.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 474.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 869.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 474 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 869.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 268.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1284.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 268 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1284.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 418.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1301.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 418 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1301.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 318.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1300.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 318 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1300.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 440.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1076.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 440 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1076.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 219.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1013.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 219 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1013.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 437 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1137 and further comprising one or more primer pairs wherein each member of said one or more primer pairs is of a length of 14 to 35 nucleobases and has 70% to 100% sequence identity with the corresponding member from the group of primer pairs represented by SEQ ID NOs: 530:891, 474:869, 268:1284, 418:1301, 318:1300, 440:1076 and 219:1013.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 325.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1163.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 325 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1163.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 278.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1039.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 278 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1039.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 465.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1037.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 465 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1037.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 148.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1172.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 148 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1172.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 190.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1254.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 190 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1254.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 266.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1094.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 266 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1094.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 508.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1297.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 508 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1297.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 259.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1060.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 259 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1060.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 325 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1163 and further comprising one or more primer pairs wherein each member of said one or more primer pairs is of a length of 14 to 35 nucleobases and has 70% to 100% sequence identity with the corresponding member from the group of primer pairs represented by SEQ ID NOs: 278:1039: 465:1037, 148:1172, 190:1254, 266:1094, 508:1297 and 259:1060.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 376.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1265.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 376 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1265.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 267.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1341.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 267 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1341.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 705.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1056.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 705 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1056.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 710.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1259.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 710 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1259.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 374.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1111.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 374 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1111.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 545.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 978.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 545 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 978.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 249.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1095.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 249 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1095.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 195.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1376.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 195 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1376.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 311.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1014.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 311 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1014.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 365.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1052.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 365 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1052.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 527.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1071.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 527 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1071.
One embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 490.
Another embodiment is an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1182.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 490 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1182.
Another embodiment is a kit comprising an oligonucleotide primer pair including an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 376 and an oligonucleotide primer 14 to 35 nucleobases in length having at least 70% sequence identity with SEQ ID NO: 1265 and further comprising one or more primer pairs wherein each member of said one or more primer pairs is of a length of 14 to 35 nucleobases and has 70% to 100% sequence identity with the corresponding member from the group of primer pairs represented by SEQ ID NOs: 267:1341, 705:1056, 710:1259, 374:1111, 545:978, 249:1095, 195:1376, 311:1014, 365:1052, 527:1071 and 490:1182.
In some embodiments, either or both of the primers of a primer pair composition contain at least one modified nucleobase such as 5-propynyluracil or 5-propynylcytosine for example.
In some embodiments, either or both of the primers of the primer pair comprises at least one universal nucleobase such as inosine for example.
In some embodiments, either or both of the primers of the primer pair comprises at least one non-templated T residue on the 5′-end.
In some embodiments, either or both of the primers of the primer pair comprises at least one non-template tag.
In some embodiments, either or both of the primers of the primer pair comprises at least one molecular mass modifying tag.
In some embodiments, the present invention provides primers and compositions comprising pairs of primers, and kits containing the same, and methods for use in identification of bacteria. The primers are designed to produce amplification products of DNA encoding genes that have conserved and variable regions across different subgroups and genotypes of bacteria.
Some embodiments are kits that contain one or more of the primer pair compositions. In some embodiments, each member of the one or more primer pairs of the kit is of a length of 14 to 35 nucleobases and has 70% to 100% sequence identity with the corresponding member from any of the primer pairs listed in Table 2.
Some embodiments of the kits contain at least one calibration polynucleotide for use in quantitation of bacteria in a given sample, and also for use as a positive control for amplification.
Some embodiments of the kits contain at least one anion exchange functional group linked to a magnetic bead.
In some embodiments, the present invention also provides methods for identification of bacteria. Nucleic acid from the bacterium is amplified using the primers described above to obtain an amplification product. The molecular mass of the amplification product is measured. Optionally, the base composition of the amplification product is determined from the molecular mass. The molecular mass or base composition is compared with a plurality of molecular masses or base compositions of known analogous bacterial identifying amplicons, wherein a match between the molecular mass or base composition and a member of the plurality of molecular masses or base compositions identifies the bacterium. In some embodiments, the molecular mass is measured by mass spectrometry in a modality such as electrospray ionization (ESI) time of flight (TOF) mass spectrometry or ESI Fourier transform ion cyclotron resonance (FTICR) mass spectrometry, for example. Other mass spectrometry techniques can also be used to measure the molecular mass of bacterial bioagent identifying amplicons.
In some embodiments, the present invention is also directed to a method for determining the presence or absence of a bacterium in a sample. Nucleic acid from the sample is amplified using the composition described above to obtain an amplification product. The molecular mass of the amplification product is determined. Optionally, the base composition of the amplification product is determined from the molecular mass. The molecular mass or base composition of the amplification product is compared with the known molecular masses or base compositions of one or more known analogous bacterial bioagent identifying amplicons, wherein a match between the molecular mass or base composition of the amplification product and the molecular mass or base composition of one or more known bacterial bioagent identifying amplicons indicates the presence of the bacterium in the sample. In some embodiments, the molecular mass is measured by mass spectrometry.
In some embodiments, the present invention also provides methods for determination of the quantity of an unknown bacterium in a sample. The sample is contacted with the composition described above and a known quantity of a calibration polynucleotide comprising a calibration sequence. Nucleic acid from the unknown bacterium in the sample is concurrently amplified with the composition described above and nucleic acid from the calibration polynucleotide in the sample is concurrently amplified with the composition described above to obtain a first amplification product comprising a bacterial bioagent identifying amplicon and a second amplification product comprising a calibration amplicon. The molecular masses and abundances for the bacterial bioagent identifying amplicon and the calibration amplicon are determined. The bacterial bioagent identifying amplicon is distinguished from the calibration amplicon based on molecular mass and comparison of bacterial bioagent identifying amplicon abundance and calibration amplicon abundance indicates the quantity of bacterium in the sample. In some embodiments, the base composition of the bacterial bioagent identifying amplicon is determined.
In some embodiments, the present invention provides methods for detecting or quantifying bacteria by combining a nucleic acid amplification process with a mass determination process. In some embodiments, such methods identify or otherwise analyze the bacterium by comparing mass information from an amplification product with a calibration or control product. Such methods can be carried out in a highly multiplexed and/or parallel manner allowing for the analysis of as many as 300 samples per 24 hours on a single mass measurement platform. The accuracy of the mass determination methods in some embodiments of the present invention permits allows for the ability to discriminate between different bacteria such as, for example, various genotypes and drug resistant strains of Staphylococcus aureus.
BRIEF DESCRIPTION OF THE DRAWINGSThe foregoing summary of the invention, as well as the following detailed description of the invention, is better understood when read in conjunction with the accompanying drawings which are included by way of example and not by way of limitation.
FIG. 1: process diagram illustrating a representative primer pair selection process.
FIG. 2: process diagram illustrating an embodiment of the calibration method.
FIG. 3: common pathogenic bacteria and primer pair coverage. The primer pair number in the upper right hand corner of each polygon indicates that the primer pair can produce a bioagent identifying amplicon for all species within that polygon.
FIG. 4: a representative 3D diagram of base composition (axes A, G and C) of bioagent identifying amplicons obtained with primer pair number 14 (a precursor of primer pair number 348 which targets 16S rRNA). The diagram indicates that the experimentally determined base compositions of the clinical samples (labeled NHRC samples) closely match the base compositions expected for Streptococcus pyogenes and are distinct from the expected base compositions of other organisms.
FIG. 5: a representative mass spectrum of amplification products indicating the presence of bioagent identifying amplicons of Streptococcus pyogenes, Neisseria meningitidis, and Haemophilus influenzae obtained from amplification of nucleic acid from a clinical sample with primer pair number 349 which targets 23S rRNA. Experimentally determined molecular masses and base compositions for the sense strand of each amplification product are shown.
FIG. 6: a representative mass spectrum of amplification products representing a bioagent identifying amplicon of Streptococcus pyogenes, and a calibration amplicon obtained from amplification of nucleic acid from a clinical sample with primer pair number 356 which targets rplB. The experimentally determined molecular mass and base composition for the sense strand of the Streptococcus pyogenes amplification product is shown.
FIG. 7: a representative mass spectrum of an amplified nucleic acid mixture which contained the Ames strain of Bacillus anthracis, a known quantity of combination calibration polynucleotide (SEQ ID NO: 1464), and primer pair number 350 which targets the capC gene on the virulence plasmid pX02 of Bacillus anthracis. Calibration amplicons produced in the amplification reaction are visible in the mass spectrum as indicated and abundance data (peak height) are used to calculate the quantity of the Ames strain of Bacillus anthracis.
DEFINITIONSAs used herein, the term “abundance” refers to an amount. The amount may be described in terms of concentration which are common in molecular biology such as “copy number,” “pfu or plate-forming unit” which are well known to those with ordinary skill. Concentration may be relative to a known standard or may be absolute.
As used herein, the term “amplifiable nucleic acid” is used in reference to nucleic acids that may be amplified by any amplification method. It is contemplated that “amplifiable nucleic acid” also comprises “sample template.”
As used herein the term “amplification” refers to a special case of nucleic acid replication involving template specificity. It is to be contrasted with non-specific template replication (i.e., replication that is template-dependent but not dependent on a specific template). Template specificity is here distinguished from fidelity of replication (i.e., synthesis of the proper polynucleotide sequence) and nucleotide (ribo- or deoxyribo-) specificity. Template specificity is frequently described in terms of “target” specificity. Target sequences are “targets” in the sense that they are sought to be sorted out from other nucleic acid. Amplification techniques have been designed primarily for this sorting out. Template specificity is achieved in most amplification techniques by the choice of enzyme. Amplification enzymes are enzymes that, under conditions they are used, will process only specific sequences of nucleic acid in a heterogeneous mixture of nucleic acid. For example, in the case of Qβ replicase, MDV-1 RNA is the specific template for the replicase (D. L. Kacian et al., Proc. Natl. Acad. Sci. USA 69:3038 [1972]). Other nucleic acid will not be replicated by this amplification enzyme. Similarly, in the case of T7 RNA polymerase, this amplification enzyme has a stringent specificity for its own promoters (Chamberlin et al., Nature 228:227 [1970]). In the case of T4 DNA ligase, the enzyme will not ligate the two oligonucleotides or polynucleotides, where there is a mismatch between the oligonucleotide or polynucleotide substrate and the template at the ligation junction (D. Y. Wu and R. B. Wallace, Genomics 4:560 [1989]). Finally, Taq and Pfu polymerases, by virtue of their ability to function at high temperature, are found to display high specificity for the sequences bounded and thus defined by the primers; the high temperature results in thermodynamic conditions that favor primer hybridization with the target sequences and not hybridization with non-target sequences (H. A. Erlich (ed.), PCR Technology, Stockton Press [1989]).
As used herein, the term “amplification reagents” refers to those reagents (deoxyribonucleotide triphosphates, buffer, etc.), needed for amplification, excluding primers, nucleic acid template, and the amplification enzyme. Typically, amplification reagents along with other reaction components are placed and contained in a reaction vessel (test tube, microwell, etc.).
As used herein, the term “analogous” when used in context of comparison of bioagent identifying amplicons indicates that the bioagent identifying amplicons being compared are produced with the same pair of primers. For example, bioagent identifying amplicon “A” and bioagent identifying amplicon “B”, produced with the same pair of primers are analogous with respect to each other. Bioagent identifying amplicon “C”, produced with a different pair of primers is not analogous to either bioagent identifying amplicon “A” or bioagent identifying amplicon “B”.
As used herein, the term “anion exchange functional group” refers to a positively charged functional group capable of binding an anion through an electrostatic interaction. The most well known anion exchange functional groups are the amines, including primary, secondary, tertiary and quaternary amines.
The term “bacteria” or “bacterium” refers to any member of the groups of eubacteria and archaebacteria.
As used herein, a “base composition” is the exact number of each nucleobase (for example, A, T, C and G) in a segment of nucleic acid. For example, amplification of nucleic acid of Staphylococcus aureus strain carrying the lukS-PV gene with primer pair number 2095 (SEQ ID NOs: 456:1261) produces an amplification product 117 nucleobases in length from nucleic acid of the lukS-PV gene that has a base composition of A35 G17 C19 T46 (by convention—with reference to the sense strand of the amplification product). Because the molecular masses of each of the four natural nucleotides and chemical modifications thereof are known (if applicable), a measured molecular mass can be deconvoluted to a list of possible base compositions. Identification of a base composition of a sense strand which is complementary to the corresponding antisense strand in terms of base composition provides a confirmation of the true base composition of an unknown amplification product. For example, the base composition of the antisense strand of the 139 nucleobase amplification product described above is A46 G19 C17 T35.
As used herein, a “base composition probability cloud” is a representation of the diversity in base composition resulting from a variation in sequence that occurs among different isolates of a given species. The “base composition probability cloud” represents the base composition constraints for each species and is typically visualized using a pseudo four-dimensional plot.
In the context of this invention, a “bioagent” is any organism, cell, or virus, living or dead, or a nucleic acid derived from such an organism, cell or virus. Examples of bioagents include, but are not limited, to cells, (including but not limited to human clinical samples, bacterial cells and other pathogens), viruses, fungi, protists, parasites, and pathogenicity markers (including but not limited to: pathogenicity islands, antibiotic resistance genes, virulence factors, toxin genes and other bioregulating compounds). Samples may be alive or dead or in a vegetative state (for example, vegetative bacteria or spores) and may be encapsulated or bioengineered. In the context of this invention, a “pathogen” is a bioagent which causes a disease or disorder.
As used herein, a “bioagent division” is defined as group of bioagents above the species level and includes but is not limited to, orders, families, classes, clades, genera or other such groupings of bioagents above the species level.
As used herein, the term “bioagent identifying amplicon” refers to a polynucleotide that is amplified from a bioagent in an amplification reaction and which 1) provides sufficient variability to distinguish among bioagents from whose nucleic acid the bioagent identifying amplicon is produced and 2) whose molecular mass is amenable to a rapid and convenient molecular mass determination modality such as mass spectrometry, for example.
As used herein, the term “biological product” refers to any product originating from an organism. Biological products are often products of processes of biotechnology. Examples of biological products include, but are not limited to: cultured cell lines, cellular components, antibodies, proteins and other cell-derived biomolecules, growth media, growth harvest fluids, natural products and bio-pharmaceutical products.
The terms “biowarfare agent” and “bioweapon” are synonymous and refer to a bacterium, virus, fungus or protozoan that could be deployed as a weapon to cause bodily harm to individuals. Military or terrorist groups may be implicated in deployment of biowarfare agents.
In context of this invention, the term “broad range survey primer pair” refers to a primer pair designed to produce bioagent identifying amplicons across different broad groupings of bioagents. For example, the ribosomal RNA-targeted primer pairs are broad range survey primer pairs which have the capability of producing bacterial bioagent identifying amplicons for essentially all known bacteria. With respect to broad range primer pairs employed for identification of bacteria, a broad range survey primer pair for bacteria such as 16S rRNA primer pair number 346 (SEQ ID NOs: 202:1110) for example, will produce an bacterial bioagent identifying amplicon for essentially all known bacteria.
The term “calibration amplicon” refers to a nucleic acid segment representing an amplification product obtained by amplification of a calibration sequence with a pair of primers designed to produce a bioagent identifying amplicon.
The term “calibration sequence” refers to a polynucleotide sequence to which a given pair of primers hybridizes for the purpose of producing an internal (i.e: included in the reaction) calibration standard amplification product for use in determining the quantity of a bioagent in a sample. The calibration sequence may be expressly added to an amplification reaction, or may already be present in the sample prior to analysis.
The term “clade primer pair” refers to a primer pair designed to produce bioagent identifying amplicons for species belonging to a clade group. A clade primer pair may also be considered as a “speciating” primer pair which is useful for distinguishing among closely related species.
The term “codon” refers to a set of three adjoined nucleotides (triplet) that codes for an amino acid or a termination signal.
In context of this invention, the term “codon base composition analysis,” refers to determination of the base composition of an individual codon by obtaining a bioagent identifying amplicon that includes the codon. The bioagent identifying amplicon will at least include regions of the target nucleic acid sequence to which the primers hybridize for generation of the bioagent identifying amplicon as well as the codon being analyzed, located between the two primer hybridization regions.
As used herein, the terms “complementary” or “complementarity” are used in reference to polynucleotides (i.e., a sequence of nucleotides such as an oligonucleotide or a target nucleic acid) related by the base-pairing rules. For example, for the sequence “5′-A-G-T-3′,” is complementary to the sequence “3′-T-C-A-5′.” Complementarity may be “partial,” in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be “complete” or “total” complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon binding between nucleic acids. Either term may also be used in reference to individual nucleotides, especially within the context of polynucleotides. For example, a particular nucleotide within an oligonucleotide may be noted for its complementarity, or lack thereof, to a nucleotide within another nucleic acid strand, in contrast or comparison to the complementarity between the rest of the oligonucleotide and the nucleic acid strand.
The term “complement of a nucleic acid sequence” as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5′ end of one sequence is paired with the 3′ end of the other, is in “antiparallel association.” Certain bases not commonly found in natural nucleic acids may be included in the nucleic acids of the present invention and include, for example, inosine and 7-deazaguanine. Complementarity need not be perfect; stable duplexes may contain mismatched base pairs or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs. Where a first oligonucleotide is complementary to a region of a target nucleic acid and a second oligonucleotide has complementary to the same region (or a portion of this region) a “region of overlap” exists along the target nucleic acid. The degree of overlap will vary depending upon the extent of the complementarity.
In context of this invention, the term “division-wide primer pair” refers to a primer pair designed to produce bioagent identifying amplicons within sections of a broader spectrum of bioagents For example, primer pair number 352 (SEQ ID NOs: 687:1411), a division-wide primer pair, is designed to produce bacterial bioagent identifying amplicons for members of the Bacillus group of bacteria which comprises, for example, members of the genera Streptococci, Enterococci, and Staphylococci. Other division-wide primer pairs may be used to produce bacterial bioagent identifying amplicons for other groups of bacterial bioagents.
As used herein, the term “concurrently amplifying” used with respect to more than one amplification reaction refers to the act of simultaneously amplifying more than one nucleic acid in a single reaction mixture.
As used herein, the term “drill-down primer pair” refers to a primer pair designed to produce bioagent identifying amplicons for identification of sub-species characteristics or confirmation of a species assignment. For example, primerpair number 2146 (SEQ ID NOs: 437:1137), a drill-down Staphylococcus aureus genotyping primer pair, is designed to produce Staphylococcus aureus genotyping amplicons. Other drill-down primer pairs may be used to produce bioagent identifying amplicons for Staphylococcus aureus and other bacterial species.
The term “duplex” refers to the state of nucleic acids in which the base portions of the nucleotides on one strand are bound through hydrogen bonding the their complementary bases arrayed on a second strand. The condition of being in a duplex form reflects on the state of the bases of a nucleic acid. By virtue of base pairing, the strands of nucleic acid also generally assume the tertiary structure of a double helix, having a major and a minor groove. The assumption of the helical form is implicit in the act of becoming duplexed.
As used herein, the term “etiology” refers to the causes or origins, of diseases or abnormal physiological conditions.
The term “gene” refers to a DNA sequence that comprises control and coding sequences necessary for the production of an RNA having a non-coding function (e.g., a ribosomal or transfer RNA), a polypeptide or a precursor. The RNA or polypeptide can be encoded by a full length coding sequence or by any portion of the coding sequence so long as the desired activity or function is retained.
The terms “homology,” “homologous” and “sequence identity” refer to a degree of identity. There may be partial homology or complete homology. A partially homologous sequence is one that is less than 100% identical to another sequence. Determination of sequence identity is described in the following example: a primer 20 nucleobases in length which is otherwise identical to another 20 nucleobase primer but having two non-identical residues has 18 of 20 identical residues (18/20=0.9 or 90% sequence identity). In another example, a primer 15 nucleobases in length having all residues identical to a 15 nucleobase segment of a primer 20 nucleobases in length would have 15/20=0.75 or 75% sequence identity with the 20 nucleobase primer. In context of the present invention, sequence identity is meant to be properly determined when the query sequence and the subject sequence are both described and aligned in the 5′ to 3′ direction. Sequence alignment algorithms such as BLAST, will return results in two different alignment orientations. In the Plus/Plus orientation, both the query sequence and the subject sequence are aligned in the 5′ to 3′ direction. On the other hand, in the Plus/Minus orientation, the query sequence is in the 5′ to 3′ direction while the subject sequence is in the 3′ to 5′ direction. It should be understood that with respect to the primers of the present invention, sequence identity is properly determined when the alignment is designated as Plus/Plus. Sequence identity may also encompass alternate or modified nucleobases that perform in a functionally similar manner to the regular nucleobases adenine, thymine, guanine and cytosine with respect to hybridization and primer extension in amplification reactions. In a non-limiting example, if the 5-propynyl pyrimidines propyne C and/or propyne T replace one or more C or T residues in one primer which is otherwise identical to another primer in sequence and length, the two primers will have 100% sequence identity with each other. In another non-limiting example, Inosine (I) may be used as a replacement for G or T and effectively hybridize to C, A or U (uracil). Thus, if inosine replaces one or more C, A or U residues in one primer which is otherwise identical to another primer in sequence and length, the two primers will have 100% sequence identity with each other. Other such modified or universal bases may exist which would perform in a functionally similar manner for hybridization and amplification reactions and will be understood to fall within this definition of sequence identity.
As used herein, “housekeeping gene” refers to a gene encoding a protein or RNA involved in basic functions required for survival and reproduction of a bioagent. Housekeeping genes include, but are not limited to genes encoding RNA or proteins involved in translation, replication, recombination and repair, transcription, nucleotide metabolism, amino acid metabolism, lipid metabolism, energy generation, uptake, secretion and the like.
As used herein, the term “hybridization” is used in reference to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is influenced by such factors as the degree of complementary between the nucleic acids, stringency of the conditions involved, and the Tm of the formed hybrid. “Hybridization” methods involve the annealing of one nucleic acid to another, complementary nucleic acid, i.e., a nucleic acid having a complementary nucleotide sequence. The ability of two polymers of nucleic acid containing complementary sequences to find each other and anneal through base pairing interaction is a well-recognized phenomenon. The initial observations of the “hybridization” process by Marmur and Lane, Proc. Natl. Acad. Sci. USA 46:453 (1960) and Doty et al., Proc. Natl. Acad. Sci. USA 46:461 (1960) have been followed by the refinement of this process into an essential tool of modem biology.
The term “in silico” refers to processes taking place via computer calculations. For example, electronic PCR (ePCR) is a process analogous to ordinary PCR except that it is carried out using nucleic acid sequences and primer pair sequences stored on a computer formatted medium.
As used herein, “intelligent primers” are primers that are designed to bind to highly conserved sequence regions of a bioagent identifying amplicon that flank an intervening variable region and, upon amplification, yield amplification products which ideally provide enough variability to distinguish individual bioagents, and which are amenable to molecular mass analysis. By the term “highly conserved,” it is meant that the sequence regions exhibit between about 80-100%, or between about 90-100%, or between about 95-100% identity among all, or at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% of species or strains.
The “ligase chain reaction” (LCR; sometimes referred to as “Ligase Amplification Reaction” (LAR) described by Barany, Proc. Natl. Acad. Sci., 88:189 (1991); Barany, PCR Methods and Applic., 1:5 (1991); and Wu and Wallace, Genomics 4:560 (1989) has developed into a well-recognized alternative method for amplifying nucleic acids. In LCR, four oligonucleotides, two adjacent oligonucleotides which uniquely hybridize to one strand of target DNA, and a complementary set of adjacent oligonucleotides, that hybridize to the opposite strand are mixed and DNA ligase is added to the mixture. Provided that there is complete complementarity at the junction, ligase will covalently link each set of hybridized molecules. Importantly, in LCR, two probes are ligated together only when they base-pair with sequences in the target sample, without gaps or mismatches. Repeated cycles of denaturation, hybridization and ligation amplify a short segment of DNA. LCR has also been used in combination with PCR to achieve enhanced detection of single-base changes. However, because the four oligonucleotides used in this assay can pair to form two short ligatable fragments, there is the potential for the generation of target-independent background signal. The use of LCR for mutant screening is limited to the examination of specific nucleic acid positions.
The term “locked nucleic acid” or “LNA” refers to a nucleic acid analogue containing one or more 2′-O, 4′-C-methylene-β-D-ribofuranosyl nucleotide monomers in an RNA mimicking sugar conformation. LNA oligonucleotides display unprecedented hybridization affinity toward complementary single-stranded RNA and complementary single- or double-stranded DNA. LNA oligonucleotides induce A-type (RNA-like) duplex conformations. The primers of the present invention may contain LNA modifications.
As used herein, the term “mass-modifying tag” refers to any modification to a given nucleotide which results in an increase in mass relative to the analogous non-mass modified nucleotide. Mass-modifying tags can include heavy isotopes of one or more elements included in the nucleotide such as carbon-13 for example. Other possible modifications include addition of substituents such as iodine or bromine at the 5 position of the nucleobase for example.
The term “mass spectrometry” refers to measurement of the mass of atoms or molecules. The molecules are first converted to ions, which are separated using electric or magnetic fields according to the ratio of their mass to electric charge. The measured masses are used to identity the molecules.
The term “microorganism” as used herein means an organism too small to be observed with the unaided eye and includes, but is not limited to bacteria, virus, protozoans, fungi; and ciliates.
The term “multi-drug resistant” or multiple-drug resistant” refers to a microorganism which is resistant to more than one of the antibiotics or antimicrobial agents used in the treatment of said microorganism.
The term “multiplex PCR” refers to a PCR reaction where more than one primer set is included in the reaction pool allowing 2 or more different DNA targets to be amplified by PCR in a single reaction tube.
The term “non-template tag” refers to a stretch of at least three guanine or cytosine nucleobases of a primer used to produce a bioagent identifying amplicon which are not complementary to the template. A non-template tag is incorporated into a primer for the purpose of increasing the primer-duplex stability of later cycles of amplification by incorporation of extra G-C pairs which each have one additional hydrogen bond relative to an A-T pair.
The term “nucleic acid sequence” as used herein refers to the linear composition of the nucleic acid residues A, T, C or G or any modifications thereof, within an oligonucleotide, nucleotide or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin which may be single or double stranded, and represent the sense or antisense strand
As used herein, the term “nucleobase” is synonymous with other terms in use in the art including “nucleotide,” “deoxynucleotide,” “nucleotide residue,” “deoxynucleotide residue,” “nucleotide triphosphate (NTP),” or deoxynucleotide triphosphate (dNTP).
The term “nucleotide analog” as used herein refers to modified or non-naturally occurring nucleotides such as 5-propynyl pyrimidines (i.e., 5-propynyl-dTTP and 5-propynyl-dTCP), 7-deaza purines (i.e., 7-deaza-dATP and 7-deaza-dGTP). Nucleotide analogs include base analogs and comprise modified forms of deoxyribonucleotides as well as ribonucleotides.
The term “oligonucleotide” as used herein is defined as a molecule comprising two or more deoxyribonucleotides or ribonucleotides, preferably at least 5 nucleotides, more preferably at least about 13 to 35 nucleotides. The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. The oligonucleotide may be generated in any manner, including chemical synthesis, DNA replication, reverse transcription, PCR, or a combination thereof. Because mononucleotides are reacted to make oligonucleotides in a manner such that the 5′ phosphate of one mononucleotide pentose ring is attached to the 3′ oxygen of its neighbor in one direction via a phosphodiester linkage, an end of an oligonucleotide is referred to as the “5′-end” if its 5′ phosphate is not linked to the 3′ oxygen of a mononucleotide pentose ring and as the “3 ′-end” if its 3′ oxygen is not linked to a 5′ phosphate of a subsequent mononucleotide pentose ring. As used herein, a nucleic acid sequence, even if internal to a larger oligonucleotide, also may be said to have 5′ and 3′ ends. A first region along a nucleic acid strand is said to be upstream of another region if the 3′ end of the first region is before the 5′ end of the second region when moving along a strand of nucleic acid in a 5′ to 3′ direction. All oligonucleotide primers disclosed herein are understood to be presented in the 5′ to 3′ direction when reading left to right. When two different, non-overlapping oligonucleotides anneal to different regions of the same linear complementary nucleic acid sequence, and the 3′ end of one oligonucleotide points towards the 5′ end of the other, the former may be called the “upstream” oligonucleotide and the latter the “downstream” oligonucleotide. Similarly, when two overlapping oligonucleotides are hybridized to the same linear complementary nucleic acid sequence, with the first oligonucleotide positioned such that its 5′ end is upstream of the 5′ end of the second oligonucleotide, and the 3′ end of the first oligonucleotide is upstream of the 3′ end of the second oligonucleotide, the first oligonucleotide may be called the “upstream” oligonucleotide and the second oligonucleotide may be called the “downstream” oligonucleotide.
In the context of this invention, a “pathogen” is a bioagent which causes a disease or disorder.
As used herein, the terms “PCR product,” “PCR fragment,” and “amplification product” refer to the resultant mixture of compounds after two or more cycles of the PCR steps of denaturation, annealing and extension are complete. These terms encompass the case where there has been amplification of one or more segments of one or more target sequences.
The term “peptide nucleic acid” (“PNA”) as used herein refers to a molecule comprising bases or base analogs such as would be found in natural nucleic acid, but attached to a peptide backbone rather than the sugar-phosphate backbone typical of nucleic acids. The attachment of the bases to the peptide is such as to allow the bases to base pair with complementary bases of nucleic acid in a manner similar to that of an oligonucleotide. These small molecules, also designated anti gene agents, stop transcript elongation by binding to their complementary strand of nucleic acid (Nielsen, et al. Anticancer Drug Des. 8:53 63). The primers of the present invention may comprise PNAs.
The term “polymerase” refers to an enzyme having the ability to synthesize a complementary strand of nucleic acid from a starting template nucleic acid strand and free dNTPs.
As used herein, the term “polymerase chain reaction” (“PCR”) refers to the method of K. B. Mullis U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,965,188, hereby incorporated by reference, that describe a method for increasing the concentration of a segment of a target sequence in a mixture of genomic DNA without cloning or purification. This process for amplifying the target sequence consists of introducing a large excess of two oligonucleotide primers to the DNA mixture containing the desired target sequence, followed by a precise sequence of thermal cycling in the presence of a DNA polymerase. The two primers are complementary to their respective strands of the double stranded target sequence. To effect amplification, the mixture is denatured and the primers then annealed to their complementary sequences within the target molecule. Following annealing, the primers are extended with a polymerase so as to form a new pair of complementary strands. The steps of denaturation, primer annealing, and polymerase extension can be repeated many times (i.e., denaturation, annealing and extension constitute one “cycle”; there can be numerous “cycles”) to obtain a high concentration of an amplified segment of the desired target sequence. The length of the amplified segment of the desired target sequence is determined by the relative positions of the primers with respect to each other, and therefore, this length is a controllable parameter. By virtue of the repeating aspect of the process, the method is referred to as the “polymerase chain reaction” (hereinafter “PCR”). Because the desired amplified segments of the target sequence become the predominant sequences (in terms of concentration) in the mixture, they are said to be “PCR amplified.” With PCR, it is possible to amplify a single copy of a specific target sequence in genomic DNA to a level detectable by several different methodologies (e.g., hybridization with a labeled probe; incorporation of biotinylated primers followed by avidin-enzyme conjugate detection; incorporation of 32P-labeled deoxynucleotide triphosphates, such as dCTP or dATP, into the amplified segment). In addition to genomic DNA, any oligonucleotide or polynucleotide sequence can be amplified with the appropriate set of primer molecules. In particular, the amplified segments created by the PCR process itself are, themselves, efficient templates for subsequent PCR amplifications.
The term “polymerization means” or “polymerization agent” refers to any agent capable of facilitating the addition of nucleoside triphosphates to an oligonucleotide. Preferred polymerization means comprise DNA and RNA polymerases.
As used herein, the terms “pair of primers,” or “primer pair” are synonymous. A primer pair is used for amplification of a nucleic acid sequence. A pair of primers comprises a forward primer and a reverse primer. The forward primer hybridizes to a sense strand of a target gene sequence to be amplified and primes synthesis of an antisense strand (complementary to the sense strand) using the target sequence as a template. A reverse primer hybridizes to the antisense strand of a target gene sequence to be amplified and primes synthesis of a sense strand (complementary to the antisense strand) using the target sequence as a template.
The primers are designed to bind to highly conserved sequence regions of a bioagent identifying amplicon that flank an intervening variable region and yield amplification products which ideally provide enough variability to distinguish each individual bioagent, and which are amenable to molecular mass analysis. In some embodiments, the highly conserved sequence regions exhibit between about 80-100%, or between about 90-100%, or between about 95-100% identity, or between about 99-100% identity. The molecular mass of a given amplification product provides a means of identifying the bioagent from which it was obtained, due to the variability of the variable region. Thus design of the primers requires selection of a variable region with appropriate variability to resolve the identity of a given bioagent. Bioagent identifying amplicons are ideally specific to the identity of the bioagent.
Properties of the primers may include any number of properties related to structure including, but not limited to: nucleobase length which may be contiguous (linked together) or non-contiguous (for example, two or more contiguous segments which are joined by a linker or loop moiety), modified or universal nucleobases (used for specific purposes such as for example, increasing hybridization affinity, preventing non-templated adenylation and modifying molecular mass) percent complementarity to a given target sequences.
Properties of the primers also include functional features including, but not limited to, orientation of hybridization (forward or reverse) relative to a nucleic acid template. The coding or sense strand is the strand to which the forward priming primer hybridizes (forward priming orientation) while the reverse priming primer hybridizes to the non-coding or antisense strand (reverse priming orientation). The functional properties of a given primer pair also include the generic template nucleic acid to which the primer pair hybridizes. For example, identification of bioagents can be accomplished at different levels using primers suited to resolution of each individual level of identification. Broad range survey primers are designed with the objective of identifying a bioagent as a member of a particular division (e.g., an order, family, genus or other such grouping of bioagents above the species level of bioagents). In some embodiments, broad range survey intelligent primers are capable of identification of bioagents at the species or sub-species level. Other primers may have the functionality of producing bioagent identifying amplicons for members of a given taxonomic genus, clade, species, sub-species or genotype (including genetic variants which may include presence of virulence genes or antibiotic resistance genes or mutations). Additional functional properties of primer pairs include the functionality of performing amplification either singly (single primer pair per amplification reaction vessel) or in a multiplex fashion (multiple primer pairs and multiple amplification reactions within a single reaction vessel).
As used herein, the terms “purified” or “substantially purified” refer to molecules, either nucleic or amino acid sequences, that are removed from their natural environment, isolated or separated, and are at least 60% free, preferably 75% free, and most preferably 90% free from other components with which they are naturally associated. An “isolated polynucleotide” or “isolated oligonucleotide” is therefore a substantially purified polynucleotide.
The term “reverse transcriptase” refers to an enzyme having the ability to transcribe DNA from an RNA template. This enzymatic activity is known as reverse transcriptase activity. Reverse transcriptase activity is desirable in order to obtain DNA from RNA viruses which can then be amplified and analyzed by the methods of the present invention.
The term “ribosomal RNA” or “rRNA” refers to the primary ribonucleic acid constituent of ribosomes. Ribosomes are the protein-manufacturing organelles of cells and exist in the cytoplasm. Ribosomal RNAs are transcribed from the DNA genes encoding them.
The term “sample” in the present specification and claims is used in its broadest sense. On the one hand it is meant to include a specimen or culture (e.g., microbiological cultures). On the other hand, it is meant to include both biological and environmental samples. A sample may include a specimen of synthetic origin. Biological samples may be animal, including human, fluid, solid (e.g., stool) or tissue, as well as liquid and solid food and feed products and ingredients such as dairy items, vegetables, meat and meat by-products, and waste. Biological samples may be obtained from all of the various families of domestic animals, as well as feral or wild animals, including, but not limited to, such animals as ungulates, bear, fish, lagamorphs, rodents, etc. Environmental samples include environmental material such as surface matter, soil, water, air and industrial samples, as well as samples obtained from food and dairy processing instruments, apparatus, equipment, utensils, disposable and non-disposable items. These examples are not to be construed as limiting the sample types applicable to the present invention. The term “source of target nucleic acid” refers to any sample that contains nucleic acids (RNA or DNA). Particularly preferred sources of target nucleic acids are biological samples including, but not limited to blood, saliva, cerebral spinal fluid, pleural fluid, milk, lymph, sputum and semen.
As used herein, the term “sample template” refers to nucleic acid originating from a sample that is analyzed for the presence of “target” (defined below). In contrast, “background template” is used in reference to nucleic acid other than sample template that may or may not be present in a sample. Background template is often a contaminant. It may be the result of carryover, or it may be due to the presence of nucleic acid contaminants sought to be purified away from the sample. For example, nucleic acids from organisms other than those to be detected may be present as background in a test sample.
A “segment” is defined herein as a region of nucleic acid within a target sequence.
The “self-sustained sequence replication reaction” (3SR) (Guatelli et al., Proc. Natl. Acad. Sci., 87:1874-1878 [1990], with an erratum at Proc. Natl. Acad. Sci., 87:7797 [1990]) is a transcription-based in vitro amplification system (Kwok et al., Proc. Natl. Acad. Sci., 86:1173-1177 [1989]) that can exponentially amplify RNA sequences at a uniform temperature. The amplified RNA can then be utilized for mutation detection (Fahy et al., PCR Meth. Appl., 1:25-33 [1991]). In this method, an oligonucleotide primer is used to add a phage RNA polymerase promoter to the 5′ end of the sequence of interest. In a cocktail of enzymes and substrates that includes a second primer, reverse transcriptase, RNase H, RNA polymerase and ribo- and deoxyribonucleoside triphosphates, the target sequence undergoes repeated rounds of transcription, cDNA synthesis and second-strand synthesis to amplify the area of interest. The use of 3SR to detect mutations is kinetically limited to screening small segments of DNA (e.g., 200-300 base pairs).
As used herein, the term ““sequence alignment”” refers to a listing of multiple DNA or amino acid sequences and aligns them to highlight their similarities. The listings can be made using bioinformatics computer programs.
In context of this invention, the term “speciating primer pair” refers to a primer pair designed to produce a bioagent identifying amplicon with the diagnostic capability of identifying species members of a group of genera or a particular genus of bioagents. Primer pair number 2249 (SEQ ID NOs: 430:1321), for example, is a speciating primer pair used to distinguish Staphylococcus aureus from other species of the genus Staphylococcus.
As used herein, a “sub-species characteristic” is a genetic characteristic that provides the means to distinguish two members of the same bioagent species. For example, one viral strain could be distinguished from another viral strain of the same species by possessing a genetic change (e.g., for example, a nucleotide deletion, addition or substitution) in one of the viral genes, such as the RNA-dependent RNA polymerase. Sub-species characteristics such as virulence genes and drug—are responsible for the phenotypic differences among the different strains of bacteria.
As used herein, the term “target” is used in a broad sense to indicate the gene or genomic region being amplified by the primers. Because the present invention provides a plurality of amplification products from any given primer pair (depending on the bioagent being analyzed), multiple amplification products from different specific nucleic acid sequences may be obtained. Thus, the term “target” is not used to refer to a single specific nucleic acid sequence. The “target” is sought to be sorted out from other nucleic acid sequences and contains a sequence that has at least partial complementarity with an oligonucleotide primer. The target nucleic acid may comprise single- or double-stranded DNA or RNA. A “segment” is defined as a region of nucleic acid within the target sequence.
The term “template” refers to a strand of nucleic acid on which a complementary copy is built from nucleoside triphosphates through the activity of a template-dependent nucleic acid polymerase. Within a duplex the template strand is, by convention, depicted and described as the “bottom” strand. Similarly, the non-template strand is often depicted and described as the “top” strand.
As used herein, the term “Tm” is used in reference to the “melting temperature.” The melting temperature is the temperature at which a population of double-stranded nucleic acid molecules becomes half dissociated into single strands. Several equations for calculating the Tm of nucleic acids are well known in the art. As indicated by standard references, a simple estimate of the Tm value may be calculated by the equation: Tm=81.5+0.41(% G+C), when a nucleic acid is in aqueous solution at 1 M NaCl (see e.g., Anderson and Young, Quantitative Filter Hybridization, in Nucleic Acid Hybridization (1985). Other references (e.g., Allawi, H. T. & SantaLucia, J., Jr. Thermodynamics and NMR of internal G.T mismatches in DNA. Biochemistry 36, 10581-94 (1997) include more sophisticated computations which take structural and environmental, as well as sequence characteristics into account for the calculation of Tm.
The term “triangulation genotyping analysis” refers to a method of genotyping a bioagent by measurement of molecular masses or base compositions of amplification products, corresponding to bioagent identifying amplicons, obtained by amplification of regions of more than one gene. In this sense, the term “triangulation” refers to a method of establishing the accuracy of information by comparing three or more types of independent points of view bearing on the same findings. Triangulation genotyping analysis carried out with a plurality of triangulation genotyping analysis primers yields a plurality of base compositions that then provide a pattern or “barcode” from which a species type can be assigned. The species type may represent a previously known sub-species or strain, or may be a previously unknown strain having a specific and previously unobserved base composition barcode indicating the existence of a previously unknown genotype.
As used herein, the term “triangulation genotyping analysis primer pair” is a primer pair designed to produce bioagent identifying amplicons for determining species types in a triangulation genotyping analysis.
The employment of more than one bioagent identifying amplicon for identification of a bioagent is herein referred to as “triangulation identification.” Triangulation identification is pursued by analyzing a plurality of bioagent identifying amplicons produced with different primer pairs. This process is used to reduce false negative and false positive signals, and enable reconstruction of the origin of hybrid or otherwise engineered bioagents. For example, identification of the three part toxin genes typical of B. anthracis (Bowen et al., J. Appl. Microbiol., 1999, 87, 270-278) in the absence of the expected signatures from the B. anthracis genome would suggest a genetic engineering event.
In the context of this invention, the term “unknown bioagent” may mean either: (i) a bioagent whose existence is known (such as the well known bacterial species Staphylococcus aureus for example) but which is not known to be in a sample to be analyzed, or (ii) a bioagent whose existence is not known (for example, the SARS coronavirus was unknown prior to April 2003). For example, if the method for identification of coronaviruses disclosed in commonly owned U.S. patent Ser. No. 10/829,826 (incorporated herein by reference in its entirety) was to be employed prior to April 2003 to identify the SARS coronavirus in a clinical sample, both meanings of “unknown” bioagent are applicable since the SARS coronavirus was unknown to science prior to April, 2003 and since it was not known what bioagent (in this case a coronavirus) was present in the sample. On the other hand, if the method of U.S. patent Ser. No. 10/829,826 was to be employed subsequent to April 2003 to identify the SARS coronavirus in a clinical sample, only the first meaning (i) of “unknown” bioagent would apply since the SARS coronavirus became known to science subsequent to April 2003 and since it was not known what bioagent was present in the sample.
The term “variable sequence” as used herein refers to differences in nucleic acid sequence between two nucleic acids. For example, the genes of two different bacterial species may vary in sequence by the presence of single base substitutions and/or deletions or insertions of one or more nucleotides. These two forms of the structural gene are said to vary in sequence from one another. In the context of the present invention, “viral nucleic acid” includes, but is not limited to, DNA, RNA, or DNA that has been obtained from viral RNA, such as, for example, by performing a reverse transcription reaction. Viral RNA can either be single-stranded (of positive or negative polarity) or double-stranded.
The term “virus” refers to obligate, ultramicroscopic, parasites that are incapable of autonomous replication (i.e., replication requires the use of the host cell's machinery). Viruses can survive outside of a host cell but cannot replicate.
The term “wild-type” refers to a gene or a gene product that has the characteristics of that gene or gene product when isolated from a naturally occurring source. A wild-type gene is that which is most frequently observed in a population and is thus arbitrarily designated the “normal” or “wild-type” form of the gene. In contrast, the term “modified”, “mutant” or “polymorphic” refers to a gene or gene product that displays modifications in sequence and or functional properties (i.e., altered characteristics) when compared to the wild-type gene or gene product. It is noted that naturally-occurring mutants can be isolated; these are identified by the fact that they have altered characteristics when compared to the wild-type gene or gene product.
As used herein, a “wobble base” is a variation in a codon found at the third nucleotide position of a DNA triplet. Variations in conserved regions of sequence are often found at the third nucleotide position due to redundancy in the amino acid code.
DETAILED DESCRIPTION OF EMBODIMENTSA. Bioagent Identifying Amplicons
The present invention provides methods for detection and identification of unknown bioagents using bioagent identifying amplicons. Primers are selected to hybridize to conserved sequence regions of nucleic acids derived from a bioagent, and which bracket variable sequence regions to yield a bioagent identifying amplicon, which can be amplified and which is amenable to molecular mass determination. The molecular mass then provides a means to uniquely identify the bioagent without a requirement for prior knowledge of the possible identity of the bioagent. The molecular mass or corresponding base composition signature of the amplification product is then matched against a database of molecular masses or base composition signatures. A match is obtained when an experimentally-determined molecular mass or base composition of an analyzed amplification product is compared with known molecular masses or base compositions of known bioagent identifying amplicons and the experimentally determined molecular mass or base composition is the same as the molecular mass or base composition of one of the known bioagent identifying amplicons. Alternatively, the experimentally-determined molecular mass or base composition may be within experimental error of the molecular mass or base composition of a known bioagent identifying amplicon and still be classified as a match. In some cases, the match may also be classified using a probability of match model such as the models described in U.S. Ser. No. 11/073,362, which is commonly owned and incorporated herein by reference in entirety. Furthermore, the method can be applied to rapid parallel multiplex analyses, the results of which can be employed in a triangulation identification strategy. The present method provides rapid throughput and does not require nucleic acid sequencing of the amplified target sequence for bioagent detection and identification.
Despite enormous biological diversity, all forms of life on earth share sets of essential, common features in their genomes. Since genetic data provide the underlying basis for identification of bioagents by the methods of the present invention, it is necessary to select segments of nucleic acids which ideally provide enough variability to distinguish each individual bioagent and whose molecular mass is amenable to molecular mass determination.
Unlike bacterial genomes, which exhibit conservation of numerous genes (i.e. housekeeping genes) across all organisms, viruses do not share a gene that is essential and conserved among all virus families. Therefore, viral identification is achieved within smaller groups of related viruses, such as members of a particular virus family or genus. For example, RNA-dependent RNA polymerase is present in all single-stranded RNA viruses and can be used for broad priming as well as resolution within the virus family.
In some embodiments of the present invention, at least one bacterial nucleic acid segment is amplified in the process of identifying the bacterial bioagent. Thus, the nucleic acid segments that can be amplified by the primers disclosed herein and that provide enough variability to distinguish each individual bioagent and whose molecular masses are amenable to molecular mass determination are herein described as bioagent identifying amplicons.
In some embodiments of the present invention, bioagent identifying amplicons comprise from about 45 to about 150 nucleobases (i.e. from about 45 to about 200 linked nucleosides), although both longer and short regions may be used. One of ordinary skill in the art will appreciate that the invention embodies compounds of 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, and 150 nucleobases in length, or any range therewithin.
It is the combination of the portions of the bioagent nucleic acid segment to which the primers hybridize (hybridization sites) and the variable region between the primer hybridization sites that comprises the bioagent identifying amplicon. Thus, it can be said that a given bioagent identifying amplicon is “defined by” a given pair of primers.
In some embodiments, bioagent identifying amplicons amenable to molecular mass determination which are produced by the primers described herein are either of a length, size or mass compatible with the particular mode of molecular mass determination or compatible with a means of providing a predictable fragmentation pattern in order to obtain predictable fragments of a length compatible with the particular mode of molecular mass determination. Such means of providing a predictable fragmentation pattern of an amplification product include, but are not limited to, cleavage with chemical reagents, restriction enzymes or cleavage primers, for example. Thus, in some embodiments, bioagent identifying amplicons are larger than 150 nucleobases and are amenable to molecular mass determination following restriction digestion. Methods of using restriction enzymes and cleavage primers are well known to those with ordinary skill in the art.
In some embodiments, amplification products corresponding to bioagent identifying amplicons are obtained using the polymerase chain reaction (PCR) that is a routine method to those with ordinary skill in the molecular biology arts. Other amplification methods may be used such as ligase chain reaction (LCR), low-stringency single primer PCR, and multiple strand displacement amplification (MDA). These methods are also known to those with ordinary skill.
B. Primers and Primer Pairs
In some embodiments, the primers are designed to bind to conserved sequence regions of a bioagent identifying amplicon that flank an intervening variable region and yield amplification products which provide variability sufficient to distinguish each individual bioagent, and which are amenable to molecular mass analysis. In some embodiments, the highly conserved sequence regions exhibit between about 80-100%, or between about 90-100%, or between about 95-100% identity, or between about 99-100% identity. The molecular mass of a given amplification product provides a means of identifying the bioagent from which it was obtained, due to the variability of the variable region. Thus, design of the primers involves selection of a variable region with sufficient variability to resolve the identity of a given bioagent. In some embodiments, bioagent identifying amplicons are specific to the identity of the bioagent.
In some embodiments, identification of bioagents is accomplished at different levels using primers suited to resolution of each individual level of identification. Broad range survey primers are designed with the objective of identifying a bioagent as a member of a particular division (e.g., an order, family, genus or other such grouping of bioagents above the species level of bioagents). In some embodiments, broad range survey intelligent primers are capable of identification of bioagents at the species or sub-species level. Examples of broad range survey primers include, but are not limited to: primer pair numbers: 346 (SEQ ID NOs: 202:1110), 347 (SEQ ID NOs: 560:1278), 348 SEQ ID NOs: 706:895), and 361 (SEQ ID NOs: 697:1398) which target DNA encoding 16S rRNA, and primer pair numbers 349 (SEQ ID NOs: 401:1156) and 360 (SEQ ID NOs: 409:1434) which target DNA encoding 23S rRNA.
In some embodiments, drill-down primers are designed with the objective of identifying a bioagent at the sub-species level (including strains, subtypes, variants and isolates) based on sub-species characteristics which may, for example, include single nucleotide polymorphisms (SNPs), variable number tandem repeats (VNTRs), deletions, drug resistance mutations or any other modification of a nucleic acid sequence of a bioagent relative to other members of a species having different sub-species characteristics. Drill-down intelligent primers are not always required for identification at the sub-species level because broad range survey intelligent primers may, in some cases provide sufficient identification resolution to accomplishing this identification objective. Examples of drill-down primers include, but are not limited to: confirmation primer pairs such as primer pair numbers 351 (SEQ ID NOs: 355:1423) and 353 (SEQ ID NOs: 220:1394), which target the pXOI virulence plasmid of Bacillus anthracis. Other examples of drill-down primer pairs are found in sets of triangulation genotyping primer pairs such as, for example, the primer pair number 2146 (SEQ ID NOs: 437:1137) which targets the arcC gene (encoding carmabate kinase) and is included in an 8 primer pair panel or kit for use in genotyping Staphylococcus aureus, or in other panels or kits of primer pairs used for determining drug-resistant bacterial strains, such as, for example, primer pair number 2095 (SEQ ID NOs: 456:1261) which targets the pv-luk gene (encoding Panton-Valentine leukocidin) and is included in an 8 primer pair panel or kit for use in identification of drug resistant strains of Staphylococcus aureus.
A representative process flow diagram used for primer selection and validation process is outlined in FIG. 1. For each group of organisms, candidate target sequences are identified (200) from which nucleotide alignments are created (210) and analyzed (220). Primers are then designed by selecting appropriate priming regions (230) to facilitate the selection of candidate primer pairs (240). The primer pairs are then subjected to in silico analysis by electronic PCR (ePCR) (300) wherein bioagent identifying amplicons are obtained from sequence databases such as GenBank or other sequence collections (310) and checked for specificity in silico (320). Bioagent identifying amplicons obtained from GenBank sequences (310) can also be analyzed by a probability model which predicts the capability of a given amplicon to identify unknown bioagents such that the base compositions of amplicons with favorable probability scores are then stored in a base composition database (325). Alternatively, base compositions of the bioagent identifying amplicons obtained from the primers and GenBank sequences can be directly entered into the base composition database (330). Candidate primer pairs (240) are validated by testing their ability to hybridize to target nucleic acid by an in vitro amplification by a method such as PCR analysis (400) of nucleic acid from a collection of organisms (410). Amplification products thus obtained are analyzed by gel electrophoresis or by mass spectrometry to confirm the sensitivity, specificity and reproducibility of the primers used to obtain the amplification products (420).
Many of the important pathogens, including the organisms of greatest concern as biowarfare agents, have been completely sequenced. This effort has greatly facilitated the design of primers for the detection of unknown bioagents. The combination of broad-range priming with division-wide and drill-down priming has been used very successfully in several applications of the technology, including environmental surveillance for biowarfare threat agents and clinical sample analysis for medically important pathogens.
Synthesis of primers is well known and routine in the art. The primers may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed.
In some embodiments primers are employed as compositions for use in methods for identification of bacterial bioagents as follows: a primer pair composition is contacted with nucleic acid (such as, for example, bacterial DNA or DNA reverse transcribed from the rRNA) of an unknown bacterial bioagent. The nucleic acid is then amplified by a nucleic acid amplification technique, such as PCR for example, to obtain an amplification product that represents a bioagent identifying amplicon. The molecular mass of each strand of the double-stranded amplification product is determined by a molecular mass measurement technique such as mass spectrometry for example, wherein the two strands of the double-stranded amplification product are separated during the ionization process. In some embodiments, the mass spectrometry is electrospray Fourier transform ion cyclotron resonance mass spectrometry (ESI-FTICR-MS) or electrospray time of flight mass spectrometry (ESI-TOF-MS). A list of possible base compositions can be generated for the molecular mass value obtained for each strand and the choice of the correct base composition from the list is facilitated by matching the base composition of one strand with a complementary base composition of the other strand. The molecular mass or base composition thus determined is then compared with a database of molecular masses or base compositions of analogous bioagent identifying amplicons for known viral bioagents. A match between the molecular mass or base composition of the amplification product and the molecular mass or base composition of an analogous bioagent identifying amplicon for a known viral bioagent indicates the identity of the unknown bioagent. In some embodiments, the primer pair used is one of the primer pairs of Table 2. In some embodiments, the method is repeated using one or more different primer pairs to resolve possible ambiguities in the identification process or to improve the confidence level for the identification assignment.
In some embodiments, a bioagent identifying amplicon may be produced using only a single primer (either the forward or reverse primer of any given primer pair), provided an appropriate amplification method is chosen, such as, for example, low stringency single primer PCR (LSSP-PCR). Adaptation of this amplification method in order to produce bioagent identifying amplicons can be accomplished by one with ordinary skill in the art without undue experimentation.
In some embodiments, the oligonucleotide primers are broad range survey primers which hybridize to conserved regions of nucleic acid encoding the hexon gene of all (or between 80% and 100%, between 85% and 100%, between 90% and 100% or between 95% and 100%) known bacteria and produce bacterial bioagent identifying amplicons.
In some cases, the molecular mass or base composition of a bacterial bioagent identifying amplicon defined by a broad range survey primer pair does not provide enough resolution to unambiguously identify a bacterial bioagent at or below the species level. These cases benefit from further analysis of one or more bacterial bioagent identifying amplicons generated from at least one additional broad range survey primer pair or from at least one additional division-wide primer pair. The employment of more than one bioagent identifying amplicon for identification of a bioagent is herein referred to as triangulation identification.
In other embodiments, the oligonucleotide primers are division-wide primers which hybridize to nucleic acid encoding genes of species within a genus of bacteria. In other embodiments, the oligonucleotide primers are drill-down primers which enable the identification of sub-species characteristics. Drill down primers provide the functionality of producing bioagent identifying amplicons for drill-down analyses such as strain typing when contacted with nucleic acid under amplification conditions. Identification of such sub-species characteristics is often critical for determining proper clinical treatment of viral infections. In some embodiments, sub-species characteristics are identified using only broad range survey primers and division-wide and drill-down primers are not used.
In some embodiments, the primers used for amplification hybridize to and amplify genomic DNA, and DNA of bacterial plasmids.
In some embodiments, various computer software programs may be used to aid in design of primers for amplification reactions such as Primer Premier 5 (Premier Biosoft, Palo Alto, Calif.) or OLIGO Primer Analysis Software (Molecular Biology Insights, Cascade, Colo.). These programs allow the user to input desired hybridization conditions such as melting temperature of a primer-template duplex for example. In some embodiments, an in silico PCR search algorithm, such as (ePCR) is used to analyze primer specificity across a plurality of template sequences which can be readily obtained from public sequence databases such as GenBank for example. An existing RNA structure search algorithm (Macke et al., Nucl. Acids Res., 2001, 29, 4724-4735, which is incorporated herein by reference in its entirety) has been modified to include PCR parameters such as hybridization conditions, mismatches, and thermodynamic calculations (SantaLucia, Proc. Natl. Acad. Sci. U.S.A., 1998, 95, 1460-1465, which is incorporated herein by reference in its entirety). This also provides information on primer specificity of the selected primer pairs. In some embodiments, the hybridization conditions applied to the algorithm can limit the results of primer specificity obtained from the algorithm. In some embodiments, the melting temperature threshold for the primer template duplex is specified to be 35° C. or a higher temperature. In some embodiments the number of acceptable mismatches is specified to be seven mismatches or less. In some embodiments, the buffer components and concentrations and primer concentrations may be specified and incorporated into the algorithm, for example, an appropriate primer concentration is about 250 nM and appropriate buffer components are 50 mM sodium or potassium and 1.5 mM Mg2+.
One with ordinary skill in the art of design of amplification primers will recognize that a given primer need not hybridize with 100% complementarity in order to effectively prime the synthesis of a complementary nucleic acid strand in an amplification reaction. Moreover, a primer may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event. (e.g., for example, a loop structure or a hairpin structure). The primers of the present invention may comprise at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity with any of the primers listed in Table 2. Thus, in some embodiments of the present invention, an extent of variation of 70% to 100%, or any range therewithin, of the sequence identity is possible relative to the specific primer sequences disclosed herein. Determination of sequence identity is described in the following example: a primer 20 nucleobases in length which is identical to another 20 nucleobase primer having two non-identical residues has 18 of 20 identical residues (18/20=0.9 or 90% sequence identity). In another example, a primer 15 nucleobases in length having all residues identical to a 15 nucleobase segment of primer 20 nucleobases in length would have 15/20=0.75 or 75% sequence identity with the 20 nucleobase primer.
Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for UNIX, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489). In some embodiments, complementarity of primers with respect to the conserved priming regions of viral nucleic acid is between about 70% and about 75% 80%. In other embodiments, homology, sequence identity or complementarity, is between about 75% and about 80%. In yet other embodiments, homology, sequence identity or complementarity, is at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or is 100%.
In some embodiments, the primers described herein comprise at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 98%, or at least 99%, or 100% (or any range therewithin) sequence identity with the primer sequences specifically disclosed herein.
One with ordinary skill is able to calculate percent sequence identity or percent sequence homology and able to determine, without undue experimentation, the effects of variation of primer sequence identity on the function of the primer in its role in priming synthesis of a complementary strand of nucleic acid for production of an amplification product of a corresponding bioagent identifying amplicon.
In one embodiment, the primers are at least 13 nucleobases in length. In another embodiment, the primers are less than 36 nucleobases in length.
In some embodiments of the present invention, the oligonucleotide primers are 13 to 35 nucleobases in length (13 to 35 linked nucleotide residues). These embodiments comprise oligonucleotide primers 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35 nucleobases in length, or any range therewithin. The present invention contemplates using both longer and shorter primers. Furthermore, the primers may also be linked to one or more other desired moieties, including, but not limited to, affinity groups, ligands, regions of nucleic acid that are not complementary to the nucleic acid to be amplified, labels, etc. Primers may also form hairpin structures. For example, hairpin primers may be used to amplify short target nucleic acid molecules. The presence of the hairpin may stabilize the amplification complex (see e.g., TAQMAN MicroRNA Assays, Applied Biosystems, Foster City, Calif.).
In some embodiments, any oligonucleotide primer pair may have one or both primers with less then 70% sequence homology with a corresponding member of any of the primer pairs of Table 2 if the primer pair has the capability of producing an amplification product corresponding to a bioagent identifying amplicon. In other embodiments, any oligonucleotide primer pair may have one or both primers with a length greater than 35 nucleobases if the primer pair has the capability of producing an amplification product corresponding to a bioagent identifying amplicon.
In some embodiments, the function of a given primer may be substituted by a combination of two or more primers segments that hybridize adjacent to each other or that are linked by a nucleic acid loop structure or linker which allows a polymerase to extend the two or more primers in an amplification reaction.
In some embodiments, the primer pairs used for obtaining bioagent identifying amplicons are the primer pairs of Table 2. In other embodiments, other combinations of primer pairs are possible by combining certain members of the forward primers with certain members of the reverse primers. An example can be seen in Table 2 for two primer pair combinations of forward primer 16S_EC—789—810_F (SEQ ID NO:206), with the reverse primers 16S_EC—880—894_R (SEQ ID NO: 796), or 16S_EC—882—899_R or (SEQ ID NO: 818). Arriving at a favorable alternate combination of primers in a primer pair depends upon the properties of the primer pair, most notably the size of the bioagent identifying amplicon that would be produced by the primer pair, which preferably is between about 45 to about 150 nucleobases in length. Alternatively, a bioagent identifying amplicon longer than 150 nucleobases in length could be cleaved into smaller segments by cleavage reagents such as chemical reagents, or restriction enzymes, for example.
In some embodiments, the primers are configured to amplify nucleic acid of a bioagent to produce amplification products that can be measured by mass spectrometry and from whose molecular masses candidate base compositions can be readily calculated.
In some embodiments, any given primer comprises a modification comprising the addition of a non-templated T residue to the 5′ end of the primer (i.e., the added T residue does not necessarily hybridize to the nucleic acid being amplified). The addition of a non-templated T residue has an effect of minimizing the addition of non-templated adenosine residues as a result of the non-specific enzyme activity of Taq polymerase (Magnuson et al., Biotechniques, 1996, 21, 700-709), an occurrence which may lead to ambiguous results arising from molecular mass analysis.
In some embodiments of the present invention, primers may contain one or more universal bases. Because any variation (due to codon wobble in the 3rd position) in the conserved regions among species is likely to occur in the third position of a DNA (or RNA) triplet, oligonucleotide primers can be designed such that the nucleotide corresponding to this position is a base which can bind to more than one nucleotide, referred to herein as a “universal nucleobase.” For example, under this “wobble” pairing, inosine (I) binds to U, C or A; guanine (G) binds to U or C, and uridine (U) binds to U or C. Other examples of universal nucleobases include nitroindoles such as 5-nitroindole or 3-nitropyrrole (Loakes et al., Nucleosides and Nucleotides, 1995, 14, 1001-1003), the degenerate nucleotides dP or dK (Hill et al.), an acyclic nucleoside analog containing 5-nitroindazole (Van Aerschot et al., Nucleosides and Nucleotides, 1995, 14, 1053-1056) or the purine analog 1-(2-deoxy-β-D-riboftiranosyl)-imidazole-4-carboxamide (Sala et al., Nucl. Acids Res., 1996, 24, 3302-3306).
In some embodiments, to compensate for the somewhat weaker binding by the wobble base, the oligonucleotide primers are designed such that the first and second positions of each triplet are occupied by nucleotide analogs that bind with greater affinity than the unmodified nucleotide. Examples of these analogs include, but are not limited to, 2,6-diaminopurine which binds to thymine, 5-propynyluracil (also known as propynylated thymine) which binds to adenine and 5-propynylcytosine and phenoxazines, including G-clamp, which binds to G. Propynylated pyrimidines are described in U.S. Pat. Nos. 5,645,985, 5,830,653 and 5,484,908, each of which is commonly owned and incorporated herein by reference in its entirety. Propynylated primers are described in U.S Pre-Grant Publication No. 2003-0170682, which is also commonly owned and incorporated herein by reference in its entirety. Phenoxazines are described in U.S. Pat. Nos. 5,502,177, 5,763,588, and 6,005,096, each of which is incorporated herein by reference in its entirety. G-clamps are described in U.S. Pat. Nos. 6,007,992 and 6,028,183, each of which is incorporated herein by reference in its entirety.
In some embodiments, primer hybridization is enhanced using primers containing 5-propynyl deoxy-cytidine and deoxy-thymidine nucleotides. These modified primers offer increased affinity and base pairing selectivity.
In some embodiments, non-template primer tags are used to increase the melting temperature (Tm) of a primer-template duplex in order to improve amplification efficiency. A non-template tag is at least three consecutive A or T nucleotide residues on a primer which are not complementary to the template. In any given non-template tag, A can be replaced by C or G and T can also be replaced by C or G. Although Watson-Crick hybridization is not expected to occur for a non-template tag relative to the template, the extra hydrogen bond in a G-C pair relative to an A-T pair confers increased stability of the primer-template duplex and improves amplification efficiency for subsequent cycles of amplification when the primers hybridize to strands synthesized in previous cycles.
In other embodiments, propynylated tags may be used in a manner similar to that of the non-template tag, wherein two or more 5-propynylcytidine or 5-propynyluridine residues replace template matching residues on a primer. In other embodiments, a primer contains a modified internucleoside linkage such as a phosphorothioate linkage, for example.
In some embodiments, the primers contain mass-modifying tags. Reducing the total number of possible base compositions of a nucleic acid of specific molecular weight provides a means of avoiding a persistent source of ambiguity in determination of base composition of amplification products. Addition of mass-modifying tags to certain nucleobases of a given primer will result in simplification of de novo determination of base composition of a given bioagent identifying amplicon from its molecular mass.
In some embodiments of the present invention, the mass modified nucleobase comprises one or more of the following: for example, 7-deaza-2′-deoxyadenosine-5-triphosphate, 5-iodo-2′-deoxyuridine-5′-triphosphate, 5-bromo-2′-deoxyuridine-5′-triphosphate, 5-bromo-2′-deoxycytidine-5′-triphosphate, 5-iodo-2′-deoxycytidine-5′-triphosphate, 5-hydroxy-2′-deoxyuridine-5′-triphosphate, 4-thiothymidine-5′-triphosphate, 5-aza-2′-deoxyuridine-5′-triphosphate, 5-fluoro-2′-deoxyuridine-5′-triphosphate, O6-methyl-2′-deoxyguanosine-5′-triphosphate, N2-methyl-2′-deoxyguanosine-5′-triphosphate, 8-oxo-2′-deoxyguanosine-5′-triphosphate or thiothymidine-5′-triphosphate. In some embodiments, the mass-modified nucleobase comprises 15N or 13C or both 15N and 13C.
In some embodiments, multiplex amplification is performed where multiple bioagent identifying amplicons are amplified with a plurality of primer pairs. The advantages of multiplexing are that fewer reaction containers (for example, wells of a 96- or 384-well plate) are needed for each molecular mass measurement, providing time, resource and cost savings because additional bioagent identification data can be obtained within a single analysis. Multiplex amplification methods are well known to those with ordinary skill and can be developed without undue experimentation. However, in some embodiments, one useful and non-obvious step in selecting a plurality candidate bioagent identifying amplicons for multiplex amplification is to ensure that each strand of each amplification product will be sufficiently different in molecular mass that mass spectral signals will not overlap and lead to ambiguous analysis results. In some embodiments, a 10 Da difference in mass of two strands of one or more amplification products is sufficient to avoid overlap of mass spectral peaks.
In some embodiments, as an alternative to multiplex amplification, single amplification reactions can be pooled before analysis by mass spectrometry. In these embodiments, as for multiplex amplification embodiments, it is useful to select a plurality of candidate bioagent identifying amplicons to ensure that each strand of each amplification product will be sufficiently different in molecular mass that mass spectral signals will not overlap and lead to ambiguous analysis results.
C Determination of Molecular Mass of Bioagent Identifying Amplicons
In some embodiments, the molecular mass of a given bioagent identifying amplicon is determined by mass spectrometry. Mass spectrometry has several advantages, not the least of which is high bandwidth characterized by the ability to separate (and isolate) many molecular peaks across a broad range of mass to charge ratio (m/z). Thus mass spectrometry is intrinsically a parallel detection scheme without the need for radioactive or fluorescent labels, since every amplification product is identified by its molecular mass. The current state of the art in mass spectrometry is such that less than femtomole quantities of material can be readily analyzed to afford information about the molecular contents of the sample. An accurate assessment of the molecular mass of the material can be quickly obtained, irrespective of whether the molecular weight of the sample is several hundred, or in excess of one hundred thousand atomic mass units (amu) or Daltons.
In some embodiments, intact molecular ions are generated from amplification products using one of a variety of ionization techniques to convert the sample to gas phase. These ionization methods include, but are not limited to, electrospray ionization (ES), matrix-assisted laser desorption ionization (MALDI) and fast atom bombardment (FAB). Upon ionization, several peaks are observed from one sample due to the formation of ions with different charges. Averaging the multiple readings of molecular mass obtained from a single mass spectrum affords an estimate of molecular mass of the bioagent identifying amplicon. Electrospray ionization mass spectrometry (ESI-MS) is particularly useful for very high molecular weight polymers such as proteins and nucleic acids having molecular weights greater than 10 kDa, since it yields a distribution of multiply-charged molecules of the sample without causing a significant amount of fragmentation.
The mass detectors used in the methods of the present invention include, but are not limited to, Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR-MS), time of flight (TOF), ion trap, quadrupole, magnetic sector, Q-TOF, and triple quadrupole.
D. Base Compositions of Bioagent Identifying Amplicons
Although the molecular mass of amplification products obtained using intelligent primers provides a means for identification of bioagents, conversion of molecular mass data to a base composition signature is useful for certain analyses. As used herein, “base composition” is the exact number of each nucleobase (A, T, C and G) determined from the molecular mass of a bioagent identifying amplicon. In some embodiments, a base composition provides an index of a specific organism. Base compositions can be calculated from known sequences of known bioagent identifying amplicons and can be experimentally determined by measuring the molecular mass of a given bioagent identifying amplicon, followed by determination of all possible base compositions which are consistent with the measured molecular mass within acceptable experimental error. The following example illustrates determination of base composition from an experimentally obtained molecular mass of a 46-mer amplification product originating at position 1337 of the 16S rRNA of Bacillus anthracis. The forward and reverse strands of the amplification product have measured molecular masses of 14208 and 14079 Da, respectively. The possible base compositions derived from the molecular masses of the forward and reverse strands for the B. anthracis products are listed in Table 1.
| TABLE 1 |
| Possible Base Compositions for B. anthracis 46mer Amplification Product |
| Calc. Mass | Mass Error | Base | Calc. Mass | Mass Error | Base |
| Forward | Forward | Composition of | Reverse | Reverse | Composition of |
| Strand | Strand | Forward Strand | Strand | Strand | Reverse Strand |
| 14208.2935 | 0.079520 | A1 G17 C10 T18 | 14079.2624 | 0.080600 | A0 G14 C13 T19 |
| 14208.3160 | 0.056980 | A1 G20 C15 T10 | 14079.2849 | 0.058060 | A0 G17 C18 T11 |
| 14208.3386 | 0.034440 | A1 G23 C20 T2 | 14079.3075 | 0.035520 | A0 G20 C23 T3 |
| 14208.3074 | 0.065560 | A6 G11 C3 T26 | 14079.2538 | 0.089180 | A5 G5 C1 T35 |
| 14208.3300 | 0.043020 | A6 G14 C8 T18 | 14079.2764 | 0.066640 | A5 G8 C6 T27 |
| 14208.3525 | 0.020480 | A6 G17 C13 T10 | 14079.2989 | 0.044100 | A5 G11 C11 T19 |
| 14208.3751 | 0.002060 | A6 G20 C18 T2 | 14079.3214 | 0.021560 | A5 G14 C16 T11 |
| 14208.3439 | 0.029060 | A11 G8 C1 T26 | 14079.3440 | 0.000980 | A5 G17 C21 T3 |
| 14208.3665 | 0.006520 | A11 G11 C6 T18 | 14079.3129 | 0.030140 | A10 G5 C4 T27 |
| 14208.3890 | 0.016020 | A11 G14 C11 T10 | 14079.3354 | 0.007600 | A10 G8 C9 T19 |
| 14208.4116 | 0.038560 | A11 G17 C16 T2 | 14079.3579 | 0.014940 | A10 G11 C14 T11 |
| 14208.4030 | 0.029980 | A16 G8 C4 T18 | 14079.3805 | 0.037480 | A10 G14 C19 T3 |
| 14208.4255 | 0.052520 | A16 G11 C9 T10 | 14079.3494 | 0.006360 | A15 G2 C2 T27 |
| 14208.4481 | 0.075060 | A16 G14 C14 T2 | 14079.3719 | 0.028900 | A15 G5 C7 T19 |
| 14208.4395 | 0.066480 | A21 G5 C2 T18 | 14079.3944 | 0.051440 | A15 G8 C12 T11 |
| 14208.4620 | 0.089020 | A21 G8 C7 T10 | 14079.4170 | 0.073980 | A15 G11 C17 T3 |
| — | — | — | 14079.4084 | 0.065400 | A20 G2 C5 T19 |
| — | — | — | 14079.4309 | 0.087940 | A20 G5 C10 T13 |
Among the 16 possible base compositions for the forward strand and the 18 possible base compositions for the reverse strand that were calculated, only one pair (shown in bold) are complementary base compositions, which indicates the true base composition of the amplification product. It should be recognized that this logic is applicable for determination of base compositions of any bioagent identifying amplicon, regardless of the class of bioagent from which the corresponding amplification product was obtained.
In some embodiments, assignment of previously unobserved base compositions (also known as “true unknown base compositions”) to a given phylogeny can be accomplished via the use of pattern classifier model algorithms. Base compositions, like sequences, vary slightly from strain to strain within species, for example. In some embodiments, the pattern classifier model is the mutational probability model. On other embodiments, the pattern classifier is the polytope model. The mutational probability model and polytope model are both commonly owned and described in U.S. patent application Ser. No. 11/073,362 which is incorporated herein by reference in entirety.
In one embodiment, it is possible to manage this diversity by building “base composition probability clouds” around the composition constraints for each species. This permits identification of organisms in a fashion similar to sequence analysis. A “pseudo four-dimensional plot” can be used to visualize the concept of base composition probability clouds. Optimal primer design requires optimal choice of bioagent identifying amplicons and maximizes the separation between the base composition signatures of individual bioagents. Areas where clouds overlap indicate regions that may result in a misclassification, a problem which is overcome by a triangulation identification process using bioagent identifying amplicons not affected by overlap of base composition probability clouds.
In some embodiments, base composition probability clouds provide the means for screening potential primer pairs in order to avoid potential misclassifications of base compositions. In other embodiments, base composition probability clouds provide the means for predicting the identity of a bioagent whose assigned base composition was not previously observed and/or indexed in a bioagent identifying amplicon base composition database due to evolutionary transitions in its nucleic acid sequence. Thus, in contrast to probe-based techniques, mass spectrometry determination of base composition does not require prior knowledge of the composition or sequence in order to make the measurement.
The present invention provides bioagent classifying information similar to DNA sequencing and phylogenetic analysis at a level sufficient to identify a given bioagent. Furthermore, the process of determination of a previously unknown base composition for a given bioagent (for example, in a case where sequence information is unavailable) has downstream utility by providing additional bioagent indexing information with which to populate base composition databases. The process of future bioagent identification is thus greatly improved as more BCS indexes become available in base composition databases.
E. Triangulation Identification
In some cases, a molecular mass of a single bioagent identifying amplicon alone does not provide enough resolution to unambiguously identify a given bioagent. The employment of more than one bioagent identifying amplicon for identification of a bioagent is herein referred to as “triangulation identification.” Triangulation identification is pursued by determining the molecular masses of a plurality of bioagent identifying amplicons selected within a plurality of housekeeping genes. This process is used to reduce false negative and false positive signals, and enable reconstruction of the origin of hybrid or otherwise engineered bioagents. For example, identification of the three part toxin genes typical of B. anthracis (Bowen et al., J. Appl. Microbiol., 1999, 87, 270-278) in the absence of the expected signatures from the B. anthracis genome would suggest a genetic engineering event.
In some embodiments, the triangulation identification process can be pursued by characterization of bioagent identifying amplicons in a massively parallel fashion using the polymerase chain reaction (PCR), such as multiplex PCR where multiple primers are employed in the same amplification reaction mixture, or PCR in multi-well plate format wherein a different and unique pair of primers is used in multiple wells containing otherwise identical reaction mixtures. Such multiplex and multi-well PCR methods are well known to those with ordinary skill in the arts of rapid throughput amplification of nucleic acids. In other related embodiments, one PCR reaction per well or container may be carried out, followed by an amplicon pooling step wherein the amplification products of different wells are combined in a single well or container which is then subjected to molecular mass analysis. The combination of pooled amplicons can be chosen such that the expected ranges of molecular masses of individual amplicons are not overlapping and thus will not complicate identification of signals.
F. Codon Base Composition Analysis
In some embodiments of the present invention, one or more nucleotide substitutions within a codon of a gene of an infectious organism confer drug resistance upon an organism which can be determined by codon base composition analysis. The organism can be a bacterium, virus, fungus or protozoan.
In some embodiments, the amplification product containing the codon being analyzed is of a length of about 35 to about 200 nucleobases. The primers employed in obtaining the amplification product can hybridize to upstream and downstream sequences directly adjacent to the codon, or can hybridize to upstream and downstream sequences one or more sequence positions away from the codon. The primers may have between about 70% to 100% sequence complementarity with the sequence of the gene containing the codon being analyzed.
In some embodiments, the codon base composition analysis is undertaken
In some embodiments, the codon analysis is undertaken for the purpose of investigating genetic disease in an individual. In other embodiments, the codon analysis is undertaken for the purpose of investigating a drug resistance mutation or any other deleterious mutation in an infectious organism such as a bacterium, virus, fungus or protozoan. In some embodiments, the bioagent is a bacterium identified in a biological product.
In some embodiments, the molecular mass of an amplification product containing the codon being analyzed is measured by mass spectrometry. The mass spectrometry can be either electrospray (ESI) mass spectrometry or matrix-assisted laser desorption ionization (MALDI) mass spectrometry. Time-of-flight (TOF) is an example of one mode of mass spectrometry compatible with the analyses of the present invention.
The methods of the present invention can also be employed to determine the relative abundance of drug resistant strains of the organism being analyzed. Relative abundances can be calculated from amplitudes of mass spectral signals with relation to internal calibrants. In some embodiments, known quantities of internal amplification calibrants can be included in the amplification reactions and abundances of analyte amplification product estimated in relation to the known quantities of the calibrants.
In some embodiments, upon identification of one or more drug-resistant strains of an infectious organism infecting an individual, one or more alternative treatments can be devised to treat the individual.
G. Determination of the Quantity of a Bioagent
In some embodiments, the identity and quantity of an unknown bioagent can be determined using the process illustrated in FIG. 2. Primers (500) and a known quantity of a calibration polynucleotide (505) are added to a sample containing nucleic acid of an unknown bioagent. The total nucleic acid in the sample is then subjected to an amplification reaction (510) to obtain amplification products. The molecular masses of amplification products are determined (515) from which are obtained molecular mass and abundance data. The molecular mass of the bioagent identifying amplicon (520) provides the means for its identification (525) and the molecular mass of the calibration amplicon obtained from the calibration polynucleotide (530) provides the means for its identification (535). The abundance data of the bioagent identifying amplicon is recorded (540) and the abundance data for the calibration data is recorded (545), both of which are used in a calculation (550) which determines the quantity of unknown bioagent in the sample.
A sample comprising an unknown bioagent is contacted with a pair of primers that provide the means for amplification of nucleic acid from the bioagent, and a known quantity of a polynucleotide that comprises a calibration sequence. The nucleic acids of the bioagent and of the calibration sequence are amplified and the rate of amplification is reasonably assumed to be similar for the nucleic acid of the bioagent and of the calibration sequence. The amplification reaction then produces two amplification products: a bioagent identifying amplicon and a calibration amplicon. The bioagent identifying amplicon and the calibration amplicon should be distinguishable by molecular mass while being amplified at essentially the same rate. Effecting differential molecular masses can be accomplished by choosing as a calibration sequence, a representative bioagent identifying amplicon (from a specific species of bioagent) and performing, for example, a 2-8 nucleobase deletion or insertion within the variable region between the two priming sites. The amplified sample containing the bioagent identifying amplicon and the calibration amplicon is then subjected to molecular mass analysis by mass spectrometry, for example. The resulting molecular mass analysis of the nucleic acid of the bioagent and of the calibration sequence provides molecular mass data and abundance data for the nucleic acid of the bioagent and of the calibration sequence. The molecular mass data obtained for the nucleic acid of the bioagent enables identification of the unknown bioagent and the abundance data enables calculation of the quantity of the bioagent, based on the knowledge of the quantity of calibration polynucleotide contacted with the sample.
In some embodiments, construction of a standard curve where the amount of calibration polynucleotide spiked into the sample is varied provides additional resolution and improved confidence for the determination of the quantity of bioagent in the sample. The use of standard curves for analytical determination of molecular quantities is well known to one with ordinary skill and can be performed without undue experimentation.
In some embodiments, multiplex amplification is performed where multiple bioagent identifying amplicons are amplified with multiple primer pairs which also amplify the corresponding standard calibration sequences. In this or other embodiments, the standard calibration sequences are optionally included within a single vector which functions as the calibration polynucleotide. Multiplex amplification methods are well known to those with ordinary skill and can be performed without undue experimentation.
In some embodiments, the calibrant polynucleotide is used as an internal positive control to confirm that amplification conditions and subsequent analysis steps are successful in producing a measurable amplicon. Even in the absence of copies of the genome of a bioagent, the calibration polynucleotide should give rise to a calibration amplicon. Failure to produce a measurable calibration amplicon indicates a failure of amplification or subsequent analysis step such as amplicon purification or molecular mass determination. Reaching a conclusion that such failures have occurred is in itself, a useful event.
In some embodiments, the calibration sequence is comprised of DNA. In some embodiments, the calibration sequence is comprised of RNA.
In some embodiments, the calibration sequence is inserted into a vector that itself functions as the calibration polynucleotide. In some embodiments, more than one calibration sequence is inserted into the vector that functions as the calibration polynucleotide. Such a calibration polynucleotide is herein termed a “combination calibration polynucleotide.” The process of inserting polynucleotides into vectors is routine to those skilled in the art and can be accomplished without undue experimentation. Thus, it should be recognized that the calibration method should not be limited to the embodiments described herein. The calibration method can be applied for determination of the quantity of any bioagent identifying amplicon when an appropriate standard calibrant polynucleotide sequence is designed and used. The process of choosing an appropriate vector for insertion of a calibrant is also a routine operation that can be accomplished by one with ordinary skill without undue experimentation.
H. Identification of Bacteria
In other embodiments of the present invention, the primer pairs produce bioagent identifying amplicons within stable and highly conserved regions of bacteria. The advantage to characterization of an amplicon defined by priming regions that fall within a highly conserved region is that there is a low probability that the region will evolve past the point of primer recognition, in which case, the primer hybridization of the amplification step would fail. Such a primer set is thus useful as a broad range survey-type primer. In another embodiment of the present invention, the intelligent primers produce bioagent identifying amplicons including a region which evolves more quickly than the stable region described above. The advantage of characterization bioagent identifying amplicon corresponding to an evolving genomic region is that it is useful for distinguishing emerging strain variants or the presence of virulence genes, drug resistance genes, or codon mutations that induce drug resistance.
The present invention also has significant advantages as a platform for identification of diseases caused by emerging bacterial strains such as, for example, drug-resistant strains of Staphylococcus aureus. The present invention eliminates the need for prior knowledge of bioagent sequence to generate hybridization probes. This is possible because the methods are not confounded by naturally occurring evolutionary variations occurring in the sequence acting as the template for production of the bioagent identifying amplicon. Measurement of molecular mass and determination of base composition is accomplished in an unbiased manner without sequence prejudice.
Another embodiment of the present invention also provides a means of tracking the spread of a bacterium, such as a particular drug-resistant strain when a plurality of samples obtained from different locations are analyzed by the methods described above in an epidemiological setting. In one embodiment, a plurality of samples from a plurality of different locations is analyzed with primer pairs which produce bioagent identifying amplicons, a subset of which contains a specific drug-resistant bacterial strain. The corresponding locations of the members of the drug-resistant strain subset indicate the spread of the specific drug-resistant strain to the corresponding locations.
I. Kits
The present invention also provides kits for carrying out the methods described herein. In some embodiments, the kit may comprise a sufficient quantity of one or more primer pairs to perform an amplification reaction on a target polynucleotide from a bioagent to form a bioagent identifying amplicon. In some embodiments, the kit may comprise from one to fifty primer pairs, from one to twenty primer pairs, from one to ten primer pairs, or from two to five primer pairs. In some embodiments, the kit may comprise one or more primer pairs recited in Table 2.
In some embodiments, the kit comprises one or more broad range survey primer(s), division wide primer(s), or drill-down primer(s), or any combination thereof. If a given problem involves identification of a specific bioagent, the solution to the problem may require the selection of a particular combination of primers to provide the solution to the problem. A kit may be designed so as to comprise particular primer pairs for identification of a particular bioagent. A drill-down kit may be used, for example, to distinguish different genotypes or strains, drug-resistant, or otherwise. In some embodiments, the primer pair components of any of these kits may be additionally combined to comprise additional combinations of broad range survey primers and division-wide primers so as to be able to identify a bacterium.
In some embodiments, the kit contains standardized calibration polynucleotides for use as internal amplification calibrants. Internal calibrants are described in commonly owned U.S. Patent Application Ser. No. 60/545,425 which is incorporated herein by reference in its entirety.
In some embodiments, the kit comprises a sufficient quantity of reverse transcriptase (if RNA is to be analyzed for example), a DNA polymerase, suitable nucleoside triphosphates (including alternative dNTPs such as inosine or modified dNTPs such as the 5-propynyl pyrimidines or any dNTP containing molecular mass-modifying tags such as those described above), a DNA ligase, and/or reaction buffer, or any combination thereof, for the amplification processes described above. A kit may further include instructions pertinent for the particular embodiment of the kit, such instructions describing the primer pairs and amplification conditions for operation of the method. A kit may also comprise amplification reaction containers such as microcentrifuge tubes and the like. A kit may also comprise reagents or other materials for isolating bioagent nucleic acid or bioagent identifying amplicons from amplification, including, for example, detergents, solvents, or ion exchange resins which may be linked to magnetic beads. A kit may also comprise a table of measured or calculated molecular masses and/or base compositions of bioagents using the primer pairs of the kit.
Some embodiments are kits that contain one or more survey bacterial primer pairs represented by primer pair compositions wherein each member of each pair of primers has 70% to 100% sequence identity with the corresponding member from the group of primer pairs represented by any of the primer pairs of Table 5. The survey primer pairs may include broad range primer pairs which hybridize to ribosomal RNA, and may also include division-wide primer pairs which hybridize to housekeeping genes such as rplB, tufb, rpoB, rpoC, valS, and infb, for example.
In some embodiments, a kit may contain one or more survey bacterial primer pairs and one or more triangulation genotyping analysis primer pairs such as the primer pairs of Tables 8, 12, 14, 19, 21, 23, or 24. In some embodiments, the kit may represent a less expansive genotyping analysis but include triangulation genotyping analysis primer pairs for more than one genus or species of bacteria. For example, a kit for surveying nosocomial infections at a health care facility may include, for example, one or more broad range survey primer pairs, one or more division wide primer pairs, one or more Acinetobacter baumannii triangulation genotyping analysis primer pairs and one or more Staphylococcus aureus triangulation genotyping analysis primer pairs. One with ordinary skill will be capable of analyzing in silico amplification data to determine which primer pairs will be able to provide optimal identification resolution for the bacterial bioagents of interest.
In some embodiments, a kit may be assembled for identification of strains of bacteria involved in contamination of food. An example of such a kit embodiment is a kit comprising one or more bacterial survey primer pairs of Table 5 with one or more triangulation genotyping analysis primer pairs of Table 12 which provide strain resolving capabilities for identification of specific strains of Campylobacter jejuni.
Some embodiments of the kits are 96-well or 384-well plates with a plurality of wells containing any or all of the following components: dNTPs, buffer salts, Mg2+, betaine, and primer pairs. In some embodiments, a polymerase is also included in the plurality of wells of the 96-well or 384-well plates.
Some embodiments of the kit contain instructions for PCR and mass spectrometry analysis of amplification products obtained using the primer pairs of the kits.
Some embodiments of the kit include a barcode which uniquely identifies the kit and the components contained therein according to production lots and may also include any other information relative to the components such as concentrations, storage temperatures, etc. The barcode may also include analysis information to be read by optical barcode readers and sent to a computer controlling amplification, purification and mass spectrometric measurements. In some embodiments, the barcode provides access to a subset of base compositions in a base composition database which is in digital communication with base composition analysis software such that a base composition measured with primer pairs from a given kit can be compared with known base compositions of bioagent identifying amplicons defined by the primer pairs of that kit.
In some embodiments, the kit contains a database of base compositions of bioagent identifying amplicons defined by the primer pairs of the kit. The database is stored on a convenient computer readable medium such as a compact disk or USB drive, for example.
In some embodiments, the kit includes a computer program stored on a computer formatted medium (such as a compact disk or portable USB disk drive, for example) comprising instructions which direct a processor to analyze data obtained from the use of the primer pairs of the present invention. The instructions of the software transform data related to amplification products into a molecular mass or base composition which is a useful concrete and tangible result used in identification and/or classification of bioagents. In some embodiments, the kits of the present invention contain all of the reagents sufficient to carry out one or more of the methods described herein.
While the present invention has been described with specificity in accordance with certain of its embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same. In order that the invention disclosed herein may be more efficiently understood, examples are provided below. It should be understood that these examples are for illustrative purposes only and are not to be construed as limiting the invention in any manner.
EXAMPLES Example 1 Design and Validation of Primers that Define Bioagent Identifying Amplicons for Identification of BacteriaFor design of primers that define bacterial bioagent identifying amplicons, a series of bacterial genome segment sequences were obtained, aligned and scanned for regions where pairs of PCR primers would amplify products of about 45 to about 150 nucleotides in length and distinguish subgroups and/or individual strains from each other by their molecular masses or base compositions. A typical process shown in FIG. 1 is employed for this type of analysis.
A database of expected base compositions for each primer region was generated using an in silico PCR search algorithm, such as (ePCR). An existing RNA structure search algorithm (Macke et al., Nucl. Acids Res., 2001, 29, 4724-4735, which is incorporated herein by reference in its entirety) has been modified to include PCR parameters such as hybridization conditions, mismatches, and thermodynamic calculations (SantaLucia, Proc. Natl. Acad. Sci. U.S.A., 1998, 95, 1460-1465, which is incorporated herein by reference in its entirety). This also provides information on primer specificity of the selected primer pairs.
Table 2 represents a collection of primers (sorted by primer pair number) designed to identify bacteria using the methods described herein. The primer pair number is an in-house database index number. Primer sites were identified on segments of genes, such as, for example, the 16S rRNA gene. The forward or reverse primer name shown in Table 2 indicates the gene region of the bacterial genome to which the primer hybridizes relative to a reference sequence. In Table 2, for example, the forward primer name 16 S_EC—1077—1106_F indicates that the forward primer (_F) hybridizes to residues 1077-1106 of the reference sequence represented by a sequence extraction of coordinates 4033120.403-4661 from GenBank gi number 16127994 (as indicated in Table 3). As an additional example: the forward primer name BONTA_X52066—450—473 indicates that the primer hybridizes to residues 450-437 of the gene encoding Clostridium botulinum neurotoxin type A (BoNT/A) represented by GenBank Accession No. X52066 (primer pair name codes appearing in Table 2 are defined in Table 3. One with ordinary skill knows how to obtain individual gene sequences or portions thereof from genomic sequences present in GenBank. In Table 2, Tp=5-propynyluracil; Cp=5-propynylcytosine; *=phosphorothioate linkage; I=inosine. T. GenBank Accession Numbers for reference sequences of bacteria are shown in Table 3 (below). In some cases, the reference sequences are extractions from bacterial genomic sequences or complements thereof.
| TABLE 2 | |
| Primer Pairs for Identification of Bacteria |
| Primer | Forward | Forward | |||
| Pair | SEQ | SEQ |
| Number | Forward Primer Name | Forward Sequence | ID NO: | Reverse Primer Name | Reverse Sequence | ID NO: |
| 1 | 16S_EC_1077_1106_F | GTGAGATGTTGGGTTAAGTCCCGTAACGAG | 134 | 16S_EC_1175_1195_R | GACGTCATCCCCACCTTCCTC | 809 | |
| 2 | 16S_EC_1082_1106_F | ATGTTGGGTTAAGTCCCGCAACGAG | 38 | 16S_EC_1175_1197_R | TTGACGTCATCCCCACCTTCCTC | 1398 | |
| 3 | 16S_EC_1090_1111_F | TTAAGTCCCCCAACGATCGCAA | 651 | 16S_EC_1175_1196_R | TGACGTCATCCCCACCTTCCTC | 1159 | |
| 4 | 16S_EC_1222_1241_F | GCTACACACGTGCTACAATG | 114 | 16S_EC_1303_1323_R | CGAGTTGCAGACTGCGATCCG | 787 | |
| 5 | 16S_EC_1332_1353_F | AAGTCGGAATCGCTAGTAATCG | 10 | 16S_EC_1389_1407_R | GACGGGCGGTGTGTACAAG | 806 | |
| 6 | 16S_EC_30_54_F | TGAACCCTCCTGGCATGCTTAACAC | 429 | 16S_EC_105_126_R | TACGCATTACTCACCCGTCCGC | 897 | |
| 7 | 16S_EC_38_64_F | GTGGCATGCCTAATACATGCAAGTCG | 136 | 16S_EC_101_120_R | TTACTCACCCGTCCGCCGCT | 1365 | |
| 8 | 16S_EC_49_68_F | TAACACATGCAAGTCCAACG | 152 | 16S_EC_104_120_R | TTACTCACCCGTCCGCC | 1364 | |
| 9 | 16S_EC_683_700_F | GTGTAGCGGTGAAATGCG | 137 | 16S_EC_774_795_R | GTATCTAATCCTGTTTGCTCCC | 839 | |
| 10 | 16S_EC_713_732_F | AGAACACCGATGGCGAAGGC | 21 | 16S_EC_789_809_R | CGTGGACTACCAGGGTATCTA | 798 | |
| 11 | 16S_EC_785_806_F | GGATTAGAGACCCTGGTAGTCC | 118 | 16S_EC_880_897_R | GGCCGTACTCCCCAGGCG | 830 | |
| 12 | 16S_EC_785_810_F | GGATTAGATACCCTGGTAGTCCACGC | 119 | 16S_EC_880_897_2_R | GGCCGTACTCCCCAGGCG | 830 | |
| 13 | 16S_EC_789_810_F | TACATACCCTGGTAGTCCACGC | 206 | 16S_EC_880_894_R | CGTACTCCCCACGCG | 796 | |
| 14 | 16S_EC_960_981_F | TTCGATGCAACGCGAAGAACCT | 672 | 16S_EC_1054_1073_R | ACGAGCTGACGACAGCCATG | 735 | |
| 15 | 16S_EC_969_985_F | ACGCGAAGAACCTTACC | 19 | 16S_EC_1061_1078_R | ACGACACGAGCTGACGAC | 734 | |
| 16 | 23S_EC_1826_1843_F | CTGACACCTGCCCGGTGC | 80 | 23S_EC_1906_1924_R | GACCGTTATAGTTACGGCC | 805 | |
| 17 | 23S_EC_2645_2669_F | TCTGTCCCTAGTACGAGAGGACCGG | 408 | 23S_EC_2744_2761_R | TGCTTAGATGCTTTCAGC | 1252 | |
| 18 | 23S_EC_2645_2669_2_F | CTGTCCCTAGTACGAGAGGACCGG | 83 | 23S_EC_2751_2767_R | GTTTCATGCTTAGATGCTTTCAGC | 846 | |
| 19 | 23S_EC_493_518_F | GGGGAGTGAAAGAGATCCTGAAACCG | 125 | 23S_EC_551_571_R | ACAAAAGGTACGCCGTCACCC | 717 | |
| 20 | 23S_EC_493_518_2_F | GGGGAGTGAAACAGATCCTGAAACCG | 125 | 23S_EC_551_571_2_R | ACAAAAGGCACGCCATCACCC | 716 | |
| 21 | 23S_EC_971_992_F | CGAGAGGGAAACAACCCAGACC | 66 | 23S_EC_1059_1077_R | TGGCTGCTTCTAAGCCAAC | 1282 | |
| 22 | CAPC_BA 104_131_F | GTTATTTAGCACTCGTTTTTAATCAGCC | 139 | CAPC_BA_180_205_R | TGAATCTTGAAACACCATACGTAACG | 1150 | |
| 23 | CAPC_BA_114_133_F | ACTCGTTTTTAATCAGCCCG | 20 | CAPC_BA_185_205_R | TGAATCTTGAAACACCATACG | 1149 | |
| 24 | CAPC_BA_274_303_F | GATTATTGTTATCCTGTTATGCCATTTGAG | 109 | CAPC_BA_349_376_R | GTAACCCTTGTCTTTGAATTGTATTTGC | 837 | |
| 25 | CAPC_BA_276_296_F | TTATTGTTATCCTGTTATGCC | 663 | CAPC_BA_358_377_R | GGTAACCCTTGTCTTTGAAT | 834 | |
| 26 | CAPC_BA_281_301_F | GTTATCCTCTTATGCCATTTG | 138 | CAPC_BA_361_378_R | TGGTAACCCTTGTCTTTG | 1298 | |
| 27 | CAPC_BA_315_334_F | CCGTGGTATTGGAGTTATTG | 59 | CAPC_BA_361_378_R | TGGTAACCCTTGTCTTTG | 1298 | |
| 28 | CYA_BA_1055_1072_F | GAAAGAGTTCGGATTGGG | 92 | CYA_BA_1112_1130_R | TGTTGACCATGCTTCTTAG | 1352 | |
| 29 | CYA_BA_1349_1370_F | ACAACGAAGTACAATACAAGAC | 12 | CYA_BA_1447_1426_R | CTTCTACATTTTTAGCCATCAC | 800 | |
| 30 | CYA_BA_1353_1379_F | CGAAGTACAATACAAGACAAAAGAAGG | 64 | CYA_BA_1449_1467_R | TGTTAACGGCTTCAAGACCC | 1342 | |
| 31 | CYA_BA_1359_1379_F | ACAATACAAGACAAAAGAAGG | 13 | CYA_BA_1447_1461_R | CGGCTTCAAGACCCC | 794 | |
| 32 | CYA_BA_914_937_F | CAGGTTTAGTACCAGAACATGCAG | 53 | CYA_BA_999_1026_R | ACCACTTTTAATAAGGTTTGTAGCTAAC | 728 | |
| 33 | CYA_BA_916_935_F | GGTTTAGTACCAGAACATGC | 131 | CYA_BA_1003_1025_R | CCACTTTTAATAAGGTTTGTAGC | 768 | |
| 34 | INFB_EC_1365_1393_F | TGCTCGTGGTGCACAAGTAACGGATATTA | 524 | INFB_EC_1439_1467_R | TGCTGCTTTCGCATGGTTAATTGCTTCAA | 1248 | |
| 35 | LEF_BA_1033_1052_F | TCAAGAAGAAAAAGAGC | 254 | LEF_BA_1119_1135_R | GAATATCAATTTGTAGC | 803 | |
| 36 | LEF_BA_1036_1066_F | CAAGAAGAAAAAGAGCTTCTAAAAAGAATAC | 44 | LEF_BA_1119_1149_R | AGATAAAGAATCACGAATATCAATTTGTAGC | 745 | |
| 37 | LEF_BA_756_781_F | AGCTTTTGCATATTATATCGAGCCAC | 26 | LEF_BA_843_872_R | TCTTCCAAGGATAGATTTATTTCTTGTTCG | 1135 | |
| 38 | LEF_BA_758_778_F | CTTTTGCATATTATATCGAGC | 90 | LEF_BA_843_865_R | AGGATAGATTTATTTCTTGTTCG | 748 | |
| 39 | LEF_BA_795_813_F | TTTACAGCTTTATGCACCG | 700 | LEF_BA_883_900_R | TCTTGACAGCATCCGTTG | 1140 | |
| 40 | LEF_BA_883_889_F | CAACGGATGCTGGCAAG | 43 | LEF_BA_939_958_R | CAGATAAAGAATCGCTCCAG | 762 | |
| 41 | PAG_BA_122_142_F | CAGAATCAAGTTCCCAGGGG | 49 | PAG_BA_190_209_R | CCTGTAGTAGAAGAGGTAAC | 781 | |
| 42 | PAG_BA_123_145_F | AGAATCAAGTTCCCAGGGGTTAC | 22 | PAG_BA_187_210_R | CCCTGTAGTAGAAGAGGTAACCAC | 774 | |
| 43 | PAG_BA_269_287_F | AATCTGCTATTTGGTCAGG | 11 | PAG_BA_326_344_R | TGATTATCAGCGGAAGTAG | 1186 | |
| 44 | PAG_BA_655_675_F | GAAGGATATACGGTTGATGTC | 93 | PAG_BA_755_772_R | CCGTGCTCCATTTTTCAG | 778 | |
| 45 | PAG_BA_753_772_F | TCCTGAAAAATGGAGCACGG | 341 | PAG_BA_849_868_R | TCGGATAAGCTGCCACAAGG | 1089 | |
| 46 | PAG_BA_763_781_F | TGGAGCACGGCTTCTGATC | 552 | PAG_BA_849_868_R | TCGGATAAGCTGCCACAAGG | 1089 | |
| 47 | RPOC_EC_1018_1045_F | CAAAACTTATTAGGTAAGCGTGTTGACT | 39 | RPOC_EC_1095_1124_R | TCAAGCGCCATTTCTTTTGGTAAACCACAT | 959 | |
| 48 | RPOC_EC_1018_1045_2_F | CAAAACTTATTAGGTAAGCGTGTTGACT | 39 | RPOC_EC_1095_1124_2_R | TCAAGCGCCATCTCTTTCGGTAATCCACAT | 958 | |
| 49 | RPOC_EC_114_140_F | TAAGAAGCCGGAAACCATCAACTACCG | 158 | RPOC_EC_213_232_R | GGCGCTTGTACTTACCGCAC | 831 | |
| 50 | RPOC_EC_2178_2196_F | TGATTCTGGTGCCCGTGGT | 478 | RPOC_EC_2225_2246_R | TTGGCCATCAGGCCACGCATAC | 1414 | |
| 51 | RPOC_EC_2178_2196_2_F | TGATTCCGGTGCCCGTGGT | 477 | RPOC_EC_2225_2246_2_R | TTGGCCATCAGACCACGCATAC | 1413 | |
| 52 | RPOC_EC_2218_2241_F | CTGGCAGGTATGCGTGGTCTGATG | 81 | RPOC_EC_2313_2337_R | CGCACCGTGGGTTGAGATGAAGTAC | 790 | |
| 53 | RPOC_EC_2218_2241_2_F | CTTGCTGGTATGCGTGGTCTGATG | 86 | RPOC_EC_2313_2337_2_R | CGCACCATGCGTAGAGATGAAGTAC | 789 | |
| 54 | RPOC_EC_808_833_F | CGTCGGGTGATTAACCGTAACAACCG | 75 | RPOC_EC_885_889_R | GTTTTTCGTTGCGTACGATGATGTC | 847 | |
| 55 | RPOC_EC_808_833_2_F | CGTCGTGTAATTAACCGTAACAACCG | 76 | RPOC_EC_865_891_R | ACGTTTTTCGTTTTGAACGATAATGCT | 741 | |
| 56 | RPOC_EC_993_1019_F | CAAAGGTAAGCAAGGTCGTTTCCGTCA | 41 | RPOC_EC_1036_1059_R | CGAACGGCCTGAGTAGTCAACACG | 785 | |
| 57 | RPOC_EC_993_1019_2_F | CAAAGGTAAGCAAGGACGTTTCCGTCA | 40 | RPOC_EC_1036_1059_2_R | CGAACGGCCAGAGTAGTCAACACG | 784 | |
| 58 | SSPE_BA_115_137_F | CAAGCAAACGCACAATCAGAAGC | 45 | SSPE_BA_197_222_R | TGCACGTCTGTTTCAGTTGCAAATTC | 1201 | |
| 59 | TUFB_EC_239_259_F | TAGACTGCCCAGGACACGCTG | 204 | TUFB_EC_283_303_R | GCCGTCCATCTGAGCAGCACC | 815 | |
| 60 | TUFB_EC_239_259_2_F | TTGACTGCCCAGGTCACGCTG | 678 | TUFB_EC_283_303_2_R | GCCGTCCATTTGAGCAGCACC | 816 | |
| 61 | TUFB_EC_976_1000_F | AACTACCGTCCGCAGTTCTACTTCC | 4 | TUFB_EC_1045_1068_R | GTTGTCGCCAGGCATAACCATTTC | 845 | |
| 62 | TUFB_EC_976_1000_2_F | AACTACCGTCCTCAGTTCTACTTCC | 5 | TUFB_EC_1045_1068_2_R | GTTGTCACCAGGCATTACCATTTC | 844 | |
| 63 | TUFB_EC_985_1012_F | CCACAGTTCTACTTCCGTACTACTGACG | 56 | TUFB_EC_1033_1062_R | TCCAGGCATTACCATTTCTACTCCTTCTGG | 1006 | |
| 66 | RPLB_EC_650_679_F | GACCTACAGTAAGAGGTTCTGTAATGAACC | 98 | RPLB_EC_739_762_R | TCCAAGTGCTGGTTTACCCCATGG | 999 | |
| 67 | RPLB_EC_688_710_F | CATCCACACGGTGGTGGTGAAGG | 54 | RPLB_EC_736_757_R | GTGCTGGTTTACCCCATGGAGT | 842 | |
| 68 | RPOC_EC_1036_1060_F | CGTGTTGACTATTCGGGGCGTTCAG | 78 | RPOC_EC_1097_1126_R | ATTCAAGAGCCATTTCTTTTGGTAAACCAC | 754 | |
| 69 | RPOB_EC_3762_3790_F | TCAACAACCTCTTGGAGGTAAAGCTCAGT | 248 | RPOB_EC_3836_3865_R | TTTCTTGAAGAGTATGAGCTGCTCCGTAAG | 1435 | |
| 70 | RPLB_EC_688_710_F | CATCCACACGGTGGTGGTGAAGG | 54 | RPLB_EC_743_771_R | TGTTTTGTATCCAAGTGCTGGTTTACCCC | 1356 | |
| 71 | VALS_EC_1105_1124_F | CGTGGCGGCGTGGTTATCGA | 77 | VALS_EC_1195_1218_R | CGGTACGAACTGGATGTCGCCGTT | 795 | |
| 72 | RPOB_EC_1845_1866_F | TATCGCTCAGGCGAACTCCAAC | 233 | RPOB_EC_1909_1929_R | GCTGGATTCGCCTTTGCTACG | 825 | |
| 73 | RPLB_EC_669_698_F | TGTAATGAACCCTAATGACCATCCACACGG | 623 | RPLB_EC_735_761_R | CCAAGTGCTGGTTTACCCCATGGAGTA | 767 | |
| 74 | RPLB_EC_671_700_F | TAATGAACCCTAATGACCATCCACACGGTG | 169 | RPLB_EC_737_762_R | TCCAAGTGCTGGTTTACCCCATGGAG | 1000 | |
| 75 | SP101_SPET11_1_29_F | AACCTTAATTGGAAAGAAACCCAAGAAGT | 2 | SP101_SPET11_92_116_R | CCTACCCAACGTTCACCAAGGGCAG | 779 | |
| 76 | SP101_SPET11_118_147_F | GCTGGTGAAAATAACCCAGATGTCGTCTTC | 115 | SP101_SPET11_213_238_R | TGTGGCCGATTTCACCACCTGCTCCT | 1340 | |
| 77 | SP101_SPET11_216_243_F | AGCAGGTGGTGAAATCGGCCACATGATT | 24 | SP101_SPET11_308_333_R | TGCCACTTTGACAACTCCTGTTGCTG | 1209 | |
| 78 | SP101_SPET11_266_295_F | CTTGTACTTGTGGCTCACACGGCTGTTTGG | 89 | SP101_SPET11_355_380_R | GCTGCTTTGATGGCTGAATCCCCTTC | 824 | |
| 79 | SP101_SPET11_322_344_F | GTCAAAGTGGCACGTTTACTGGC | 132 | SP101_SPET11_423_441_R | ATCCCCTGCTTCTGCTGCC | 753 | |
| 80 | SP101_SPET11_358_387_F | GGGGATTCAGCCATCAAAGCAGCTATTGAC | 126 | SP101_SPET11_448_473_R | CCAACCTTTTCCACAACAGAATCAGC | 766 | |
| 81 | SP101_SPET11_600_629_F | CCTTACTTCGAACTATGAATCTTTTGGAAG | 62 | SP101_SPET11_686_714_R | CCCATTTTTTCACGCATGCTGAAAATATC | 772 | |
| 82 | SP101_SPET11_658_684_F | GGGGATTGATATCACCGATAAGAAGAA | 127 | SP101_SPET11_756_784_R | GATTGGCGATAAAGTGATATTTTCTAAAA | 813 | |
| 83 | SP101_SPET11_776_801_F | TCGCCAATCAAAACTAAGGGAATGGC | 364 | SP101_SPET11_871_896_R | GCCCACCAGAAAGACTAGCAGGATAA | 814 | |
| 84 | SP101_SPET11_893_921_F | GGGCAACAGCAGCGGATTGCGATTGCGCG | 123 | SP101_SPET11_988_1012_R | CATGACAGCCAAGACCTCACCCACC | 763 | |
| 85 | SP101_SPET11_1154_1179_F | CAATACCGCAACAGCGGTGGCTTGGG | 47 | SP101_SPET11_1251_1277_R | GACCCCAACCTGGCCTTTTGTCGTTGA | 804 | |
| 86 | SP101_SPET11_1314_1336_F | CGCAAAAAAATCCAGCTATTAGC | 68 | SP101_SPET11_1403_1431_R | AAACTATTTTTTTAGCTATACTCGAACAC | 711 | |
| 87 | SP101_SPET11_1408_1437_F | CGAGTATAGCTAAAAAAATAGTTTATGACA | 67 | SP101_SPET11_1486_1515_R | GGATAATTGGTCGTAACAAGGGATAGTGAC | 828 | |
| 88 | SP101_SPET11_1688_1716_F | CCTATATTAATCCTTTACAGAAACTCGCT | 60 | SP101_SPET11_1783_1808_R | ATATGATTATCATTCAACTGCGGCCG | 752 | |
| 89 | SP101_SPET11_1711_1733_F | CTGCCTAAAACTTTGGCAACGGT | 82 | SP101_SPET11_1808_1835_R | GCGTGACGACCTTCTTGAATTGTAATCA | 821 | |
| 90 | SP101_SPET11_1807_1835_F | ATGATTACAATTCAACAAGGTCGTCACCC | 33 | SP101_SPET11_1901_1927_R | TTCCACCTCTAATCACCTCAATACTCC | 1412 | |
| 91 | SP101_SPET11_1967_1991_F | TAACCCTTATCATCCCCCACATCCC | 155 | SP101_SPET11_2062_2083_R | ATTCCCCACAAATCAAATCATC | 755 | |
| 92 | SP101_SPET11_2260_2283_F | CACACACCCTTTTATCCTATCACC | 50 | SP101_SPET11_2375_2397_R | TCTCCCTCACCTCCTCTTTTACA | 1131 | |
| 93 | SP101_SPET11_2375_2399_F | TCTAAAACACCACCTCACCCACAAC | 390 | SP101_SPET11_2470_2497_R | ACCTCCTACATCACCTTCTCCCATCCCC | 747 | |
| 94 | SP101_SPET11_2468_2487_F | ATCCCCATCCCACAACCTCA | 35 | SP101_SPET11_2543_2570_R | CCATAAGGTCACCCTCACCATTCAAACC | 770 | |
| 95 | SP101_SPET11_2961_2984_F | ACCATCACACAACCCATTTTCACA | 15 | SP101_SPET11_3023_3045_R | CCAATTTACCAGCCATACACACC | 827 | |
| 96 | SP101_SPET11_3075_2103_F | GATCACTTTTTACCTAATCCTCACCCAGC | 108 | SP101_SPET11_3168_3196_R | AATCCACCACCATCTTCCAAACATTTCTC | 715 | |
| 97 | SP101_SPET11_3386_3403_F | ACCCTAAACCTCAACCTT | 25 | SP101_SPET11_3480_3506_R | CCACCACTTACTCTCCCCTCATCTTTC | 769 | |
| 98 | SP101_SPET11_3511_3535_F | CCTTCACCAATCAATCATCCACCAC | 116 | SP101_SPET11_3605_3629_R | CCCTCTACACCTCCACTTCCATAAC | 832 | |
| 111 | RPOB_EC_3775_3803_F | CTTCCACCTAACTCTCATTTTCCTCCGCA | 87 | RPOB_EC_3829_3858_R | CCTATAACCTCCACCATAACCTTCTAATCC | 797 | |
| 112 | VALS_EC_1833_1850_F | CCACCCCCTCCCCTTCAC | 65 | VALS_EC_1920_1943_R | GCGTTCCACACCTTCTTCCACAAC | 822 | |
| 113 | RPOB_EC_1336_1353_F | CACCACCTCCCCAACCCT | 97 | RPOB_EC_1438_1455_R | TTCCCTCTCCCCCTCCCC | 1386 | |
| 114 | TUFB_EC_225_251_F | GCACTATCCACACCTACATTCTCCTCC | 111 | TUFB_EC_284_309_ | TATACCACCATCCATCTCACCCCCAC | 930 | |
| 115 | DNAK_EC_428_449_F | CCCCCTACTTCAACCACACCCA | 72 | DNAK_EC_503_522_R | CGCCCTCGCCTCCTTCATCA | 792 | |
| 116 | VALS_EC_1920_1943_F | CTTCTCCAACAACCTCTCCAACCC | 85 | VALS_EC_1948_1970_R | TCGCACTTCATCACCACCAACCC | 1075 | |
| 117 | TUFB_EC_757_774_F | AACACCACCTCCACCCCC | 6 | TUFB_EC_849_867_R | GCGCTCCACCTCTTCACCC | 819 | |
| 118 | 23S_EC_2646_2667_F | CTCTTCTTACTACCACACCACC | 84 | 23S_EC_2745_2765_R | TTCGTGCTTACATCCTTTCAC | 1389 | |
| 119 | 16S_EC_969_985_1P-F | ACGCCAACAACCTTACpC | 19 | 16S_EC_1061_1078_2P_R | ACGACACGAGCpTpGACGAC | 733 | |
| 120 | 16S_EC_972_985_2P_F | CCAACAACpCpTTACC | 63 | 16S_EC_1064_1075_2P_R | ACACGAGCpTpGAC | 727 | |
| 121 | 16S_EC_972_985_F | CGAAGAACCTTACC | 63 | 16S_EC_1064_1075_R | ACACGAGCTCAC | 727 | |
| 122 | TRNA_ILE-RRNH_EC_32_50.2_F | CCTCATAACCCTCACCTCC | 61 | 23S_EC_40_59_R | ACCTCCTTCATCCCCTCTCA | 740 | |
| 123 | 23S_EC_-7_15_F | GTTGTGAGGTTAACCCACTAAG | 140 | 23S_EC_430_450_R | CTATCCCTCACTCACCACTAT | 799 | |
| 124 | 23S_EC_-7_15_F | CTTCTCACCTTAACCCACTAAG | 141 | 23S_EC_891_910_R | TTCCATCGCCTTCCTAACTC | 1403 | |
| 125 | 23S_EC_430_450_F | ATACTCCTCACTCACCCATAC | 30 | 23S_EC_1424_1442_R | AACATACCCTTCTCCCTCC | 712 | |
| 126 | 23S_EC_891_910_F | CACTTACCAACCCCATCCAA | 100 | 23S_EC_1908_1931_R | TACCTTACCACCCTTATACTTACC | 893 | |
| 127 | 23S_EC_1424_1442_F | GGACGGAGAAGGCTATGTT | 117 | 23S_EC_2475_2494_R | CCAAACACCGCCGTCGATAT | 765 | |
| 128 | 23S_EC_1908_1931_F | CGTAACTATAACGGTCCTAAGGTA | 73 | 23S_EC_2833_2852_R | GCTTACACACCCGGCCTATC | 826 | |
| 129 | 23S_EC_2475_2494_F | ATATCGACGGCGGTGTTTGG | 31 | TRNA_ASP-RRNH_EC_23_41.2_R | GCGTGACAGGCAGGTATTC | 820 | |
| 131 | 16S_EC_-60_-39_F | AGTCTCAAGAGTGAACACGTAA | 28 | 16S_EC_508_525_R | GCTGCTGGCACGGAGTTA | 823 | |
| 132 | 16S_EC_326_345_F | GACACGGTCCAGACTCCTAC | 95 | 16S_EC_1041_1058_R | CCATGCAGCACCTGTCTC | 771 | |
| 133 | 16S_EC_705_724_F | GATCTGGAGGAATACCGGTG | 107 | 16S_EC_1493_1512_R | ACGGTTACCTTGTTACGACT | 739 | |
| 134 | 16S_EC_1268_1287_F | GAGAGCAAGCGGACCTCATA | 101 | TRNA_ALA-RRNH_EC_30_46.2_R | CCTCCTGCGTGCAAAGC | 780 | |
| 135 | 16S_EC_969_985_F | ACGCGAAGAACCTTACC | 19 | 16S_EC_1061_1078.2_R | ACAACACGAGCTGACGAC | 719 | |
| 137 | 16S_EC_969_985_F | ACGCGAAGAACCTTACC | 19 | 16S_EC_1061_1078.2_I14_R | ACAACACGAGCTGICGAC | 721 | |
| 138 | 16S_EC_969_985_F | ACGCGAAGAACCTTACC | 19 | 16S_EC_1061_1078.2_I12_R | ACAACACGAGCIGACGAC | 718 | |
| 139 | 16S_EC_969_985_F | ACGCGAAGAACCTTACC | 19 | 16S_EC_1061_1078.2_I11_R | ACAACACGAGITGACGAC | 722 | |
| 140 | 16S_EC_969_985_F | ACGCGAAGAACCTTACC | 19 | 16S_EC_1061_1078.2_I16_R | ACAACACGAGCTGACIAC | 720 | |
| 141 | 16S_EC_969_985_F | ACGCGAAGAACCTTACC | 19 | 16S_EC_1061_1078.2_2I_R | ACAACACGATCTIACGAC | 723 | |
| 142 | 16S_EC_969_985_F | ACGCGAAGAACCTTACC | 19 | 16S_EC_1061_1078.2_3I_R | ACAACACIAICTIACGAC | 724 | |
| 143 | 16S_EC_969_985_F | ACGCGAAGAACCTTACC | 19 | 16S_EC_1061_1078.2_4I_R | ACAACACIAICTIACIAC | 725 | |
| 147 | 23S_EC_2652_2669_F | CTAGTACGAGAGGACCGG | 79 | 23S_EC_2741_2760_R | ACTTAGATGCTTTCAGCGGT | 743 | |
| 158 | 16S_EC_683_700_F | GTGTAGCGGTGAAATGCG | 137 | 16S_EC_880_894_R | CGTACTCCCCAGGCG | 796 | |
| 159 | 16S_EC_1100_1116_F | CAACGAGCGCAACCCTT | 42 | 16S_EC_1174_1188_R | TCCCCACCTTCCTCC | 1019 | |
| 215 | SSPE_BA_121_137_F | AACGCACAATCAGAAGC | 3 | SSPE_BA_197_216_R | TCTGTTTCAGTTGCAAATTC | 1132 | |
| 220 | GROL_EC_941_959_F | TGGAAGATCTGGGTCAGGC | 544 | GROL_EC_1039_1060_R | CAATCTGCTGACGGATCTGAGC | 759 | |
| 221 | INFB_EC_1103_1124_F | GTCGTGAAAACGAGCTGGAAGA | 133 | INFB_EC_1174_1191_R | CATGATGGTCACAACCGG | 764 | |
| 222 | HFLB_EC_1082_1102_F | TCGCGAACCTGGTGAACGAAGC | 569 | HFLB_EC_1144_1168_R | CTTTCGCTTTCTCGAACTCAACCAT | 802 | |
| 223 | INFB_EC_1969_1994_F | CGTCAGGGTAAATTCCGTGAAGTTAA | 74 | INFB_EC_2038_2058_R | AACTTCGCCTTCGGTCATGTT | 713 | |
| 224 | GROL_EC_219_242_F | GGTGAAAGAAGTTGCCTCTAAAGC | 128 | GROL_EC_328_350_R | TTCAGGTCCATCGGGTTCATGCC | 1377 | |
| 225 | VALS_EC_1105_1124_F | CGTGGCGGCGTGGTTATCGA | 77 | VALS_EC_1195_1214_R | ACGAACTGGATGTCGCCGTT | 732 | |
| 226 | 16S_EC_556_575_F | CGGAATTACTGGGCGTAAAG | 70 | 16S_EC_683_700_R | CGCATTTCACCGCTACAC | 791 | |
| 227 | RPOC_EC_1256_1277_F | ACCCAGTGCTGCTGAACCGTCC | 16 | RPOC_EC_1295_1315_R | GTTCAAATGCCTGGATACCCA | 843 | |
| 228 | 169_EC_774_795_F | GGGAGCAAACAGGATTAGATAC | 122 | 16S_EC_880_894_R | CGTACPCCCCAGGCG | 796 | |
| 229 | RPOC_EC_1584_1604_F | TGGCCCGAAAGAAGCTGAGCG | 567 | RPOC_EC_1623_1643_R | ACGCGGGCATGCAGAGATGCC | 737 | |
| 230 | 16S_EC_1082_1100_F | ATGTTGGGTTAAGTCCCGC | 37 | 16S_EC_1177_1196_R | TGACGTCATCCCCACCTTCC | 1158 | |
| 231 | 16S_EC_1389_1407_F | CTTGTACACACCGCCCGTC | 88 | 16S_EC_1525_1541_R | AAGGAGGTGATCCAGCC | 714 | |
| 232 | 16S_EC_1303_1323_F | CGGATTGGAGTCTGCAACTCG | 71 | 16S_EC_1389_1407_R | GACGGGCGGTGTGTACAAG | 808 | |
| 233 | 23S_EC_23_37_F | GGTGGATGCCTTGGC | 129 | 23S_EC_115_130_R | GGGTTTCCCCATTCGG | 833 | |
| 234 | 23S_EC_187_207_F | GGGAACTGAAACATCTAAGTA | 121 | 23S_EC_242_256_R | TTCGCTCGCCGCTAC | 1385 | |
| 235 | 23S_EC_1602_1620_F | TACCCCAAACCGACACAGG | 184 | 23S_EC_1686_1703_R | CCTTCTCCCGAAGTTACG | 782 | |
| 236 | 23S_EC_1685_1703_F | CCGTAACTTCGGGAGAAGG | 58 | 23S_EC_1828_1842_R | CACCGGGCAGGCGTC | 760 | |
| 237 | 23S_EC_1827_1843_F | GACGCCTGCCCGGTGC | 99 | 23S_EC_1929_1949_R | CCGACAAGGAATTTCGCTACC | 775 | |
| 238 | 23S_EC_2434_2456_F | AAGGTACTCCGGGGATAACAGGC | 9 | 23S_EC_2490_2511_R | AGCCGACATCGAGGTGCCAAAC | 746 | |
| 239 | 23S_EC_2599_2616_F | GACAGTTCGGTCCCTATC | 96 | 23S_EC_2653_2669_R | CCGGTCCTCTCGTACTA | 777 | |
| 240 | 23S_EC_2653_2669_F | TAGTACGAGAGGACCGG | 227 | 23S_EC_2737_2758_R | TTAGATGCTTTCAGCACTTATC | 1369 | |
| 241 | 23S_BS_-68_-44_F | AAACTACATAACAGTAGACATCAC | 1 | 23S_BS_5_21_R | GTGCGCCCTTTCTAACTT | 841 | |
| 242 | 16S_EC_8_27_F | AGAGTTTGATCATGGCTCAG | 23 | 16S_EC_342_358_R | ACTGCTGCCTCCCGTAG | 742 | |
| 243 | 16S_EC_314_332_F | CACTGGAACTGAGACACGG | 48 | 16S_EC_556_575_R | CTTTACGCCCAGTAATTCCG | 801 | |
| 244 | 16S_EC_518_536_F | CCAGCACCCGCCCTAATAC | 57 | 16S_EC_774_795_R | GTATCTAATCCTGTTTGCTCCC | 839 | |
| 245 | 16S_EC_683_700_F | GTGTAGCGGTGAAATGCG | 137 | 16S_EC_967_985_R | GGTAAGGTTCTTCGCGTTG | 835 | |
| 246 | 16S_EC_937_954_F | AAGCCGTGGAGCATGTGG | 7 | 16S_EC_1220_1240_R | ATTGTAGCACGTGTGTAGCCC | 757 | |
| 247 | 16S_EC_1195_1213_F | CAAGTCACCATGSCCCTTA | 46 | 16S_EC_1525_1541_R | AAGGAGGTGATCCAGCC | 714 | |
| 248 | 16S_EC_8_27_F | AGAGTTTGATCATGCCTCAG | 23 | 16S_EC_1525_1541_R | AAGGAGGTGATCCAGCC | 714 | |
| 249 | 23S_EC_1831_1849_F | ACCTGCCCACTGCTGGAAG | 18 | 23S_EC_1919_1936_R | TCGCTACCTTAGGACCGT | 1080 | |
| 250 | 16S_EC_1387_1407_F | GCCTTCTACACACCTCCCGTC | 112 | 16S_EC_1494_1513_R | CACCCCTACCTTGTTACCAC | 761 | |
| 251 | 16S_EC_1390_1411_F | TTGTACACACCGCCCGTCATAC | 693 | 16S_EC_1486_1505_R | CCTTCTTACGACTTCACCCC | 783 | |
| 252 | 16S_EC_1367_1387_F | TACGGTGAATACGTTCCCGGG | 191 | 16S_EC_1485_1506_R | ACCTTGTTACGACTTCACCCCA | 731 | |
| 253 | 16S_EC_804_822_F | ACCACGCCCTAAACGATGA | 14 | 16S_EC_909_929_R | CCCCCGTCAATTCCTTTGAGT | 773 | |
| 254 | 16S_EC_791_812_F | GATACCCTGGTAGTCCACACCG | 106 | 16S_EC_886_904_R | GCCTTGCGACCGTACTCCC | 817 | |
| 255 | 16S_EC_789_810_F | TAGATACCCTGGTAGTCCACGC | 206 | 16S_EC_882_899_R | GCGACCGTACTCCCCAGG | 818 | |
| 256 | 16S_EC_1092_1109_F | TAGTCCCGCAACGACCGC | 228 | 16S_EC_1174_1195_R | GACGTCATCCCCACCTTCCTCC | 810 | |
| 257 | 23S_EC_2586_2607_F | TACAACGTCGCGAGACAGTTCC | 203 | 23S_EC_2658_2677_R | AGTCCATCCCGGTCCTCTCG | 749 | |
| 258 | RNASEP_SA_31_49_F | GAGGAAAGTCCATGCTCAC | 103 | RNASEP_SA_358_379_R | ATAAGCCATGTTCTGTTCCATC | 750 | |
| 258 | RNASEP_SA_31_49_F | GACGAAAGTCCATGCTCAC | 103 | RNASEP_EC_345_362_R | ATAAGCCGGGTTCTGTCG | 751 | |
| 258 | RNASEP_SA_31_49_F | GAGGAAACTCCATGCTCAC | 103 | RNASEP_BS_363_384_R | GTAAGCCATGTTTTGTTCCATC | 838 | |
| 258 | RNASEP_BS_43_61_F | CAGGAAAGTCCATCCTCGC | 104 | RNASEP_SA_358_379_R | ATAAGCCATCTTCTGTTCCATC | 750 | |
| 258 | RNASEP_BS_43_61_F | GAGGAAAGTCCATGCTCGC | 104 | RNASEP_EC_345_362_R | ATAAGCCGGGTTCTGTCG | 751 | |
| 258 | RNASEP_BS_43_61_F | GAGGAAAGTCCATGCTCGC | 104 | RNASEP_BS_363_384_R | GTAAGCCATGTTTTGTTCCATC | 838 | |
| 258 | RNASEP_EC_61_77_F | GAGGAAAGTCCGGGCTC | 105 | RNASEP_SA_358_379_R | ATAAGCCATGTTCTGTTCCATC | 750 | |
| 258 | RNASEP_EC_61_77_F | CACCAAAGTCCGGGCTC | 105 | RNASEP_EC_345_362_R | ATAAGCCGGGTTCTGTCG | 751 | |
| 258 | RNASEP_EC_61_77_F | GACGAAAGTCCGGGCTC | 105 | RNASEP_BS_363_384_R | GTAAGCCATGTTTTGTTCCATC | 838 | |
| 259 | RNASEP_BS_43_61_F | GAGGAAAGTCCATGCTCGC | 104 | RNASEP_BS_363_384_R | GTAAGCCATGTTTTGTTCCATC | 838 | |
| 260 | RNASEP_EC_61_77_F | GAGGAAACTCCGGGCTC | 105 | RNASEP_EC_345_362_R | ATAAGCCGGGTTCTCTCG | 751 | |
| 262 | RNASEP_SA_31_49_F | GAGGAAACTCCATGCTCAC | 103 | RNASEP_SA_358_379_R | ATAACCCATGTTCTGTTCCATC | 750 | |
| 263 | 16S_EC_1082_1100_F | ATGTTGGGTTAAGTCCCGC | 37 | 16S_EC_1525_1541_R | AAGGAGGTGATCCAGCC | 714 | |
| 264 | 16S_EC_556_575_F | CGGAATTACTGGGCGTAAAG | 70 | 16S_EC_774_795_R | GTATCTAATCCTGTTTGCTCCC | 839 | |
| 265 | 16S_EC_1082_1100_F | ATGTTGGGTTAACTCCCGC | 37 | 16S_EC_1177_1196_10G_R | TGACGTCATGCCCACCTTCC | 1160 | |
| 266 | 16S_EC_1082_1100_F | ATCTTGGGTTAAGTCCCGC | 37 | 16S_EC_1177_1196_10G_11G_R | TGACGTCATGGCCACCTTCC | 1161 | |
| 268 | YAED_EC_513_532_F_MOD | GGTGTTAAATAGCCTGGCAG | 130 | TRNA_ALA-RRNH_EC_30_49_F_MOD | AGACCTCCTGCGTGCAAAGC | 744 | |
| 269 | 16S_EC_1082_1100_F_MOD | ATGTTGGGTTAAGTCCCGC | 37 | 16S_EC_1177_1196_R_MOD | TGACGTCATCCCCACCTTCC | 1158 | |
| 270 | 23S_EC_2586_2607_F_MOD | TAGAACGTCGCGAGACAGTTCG | 203 | 23S_EC_2658_2677_R_MOD | AGTCCATCCCGGTCCTCTCG | 749 | |
| 272 | 16S_EC_969_985_F | ACGCGAAGAACCTTACC | 19 | 16S_EC_1389_1407_R | GACGGGCGGTGTGTACAAG | 807 | |
| 273 | 16S_EC_683_700_F | GTGTAGCGGTGAAATGCG | 137 | 16S_EC_1303_1323_R | CGAGTTGCAGACTGCGATCCG | 788 | |
| 274 | 16S_EC_49_68_F | TAACACATGCAAGTCGAACG | 152 | 16S_EC_880_894_R | CGTACTCCCCAGGCG | 796 | |
| 275 | 16S_EC_49_68_F | TAACACATGCAAGTCGAACG | 152 | 16S_EC_1061_1078_R | ACGACACGAGCTGACGAC | 734 | |
| 277 | CYA_BA_1349_1370_F | ACAACGAAGTACAATACAAGAC | 12 | CYA_BA_1426_1447_R | CTTCTACATTTTTAGCCATCAC | 800 | |
| 278 | 16S_EC_1090_1111_2_F | TTAAGTCCCGCAACGAGCGCAA | 650 | 16S_EC_1175_1196_R | TGACGTCATCCCCACCTTCCTC | 1159 | |
| 279 | 165_EC_405_432_F | TGAGTGATGAAGGCCTTAGGGTTGTAAA | 464 | 16S_EC_507_527_R | CGGCTGCTGGCACGAAGTTAG | 793 | |
| 280 | GROL_EC_496_518_F | ATGGACAAGGTTGGCAAGGAAGG | 34 | GROL_EC_577_596_R | TAGCCGCGGTCGAATTGCAT | 914 | |
| 281 | GROL_EC_511_536_F | AAGGAAGGCGTGATCACCGTTGAAGA | 8 | GROL_EC_571_593_R | CCGCGGTCGAATTGCATGCCTTC | 776 | |
| 288 | RPOB_EC_3802_3821_F | CAGCGTTTCGGCGAAATGGA | 51 | RPOB_EC_3862_3885_R | CGACTTGACGGTTAACATTTCCTG | 786 | |
| 289 | RPOB_EC_3799_3821_F | GGGCAGCGTTTCGGCGAAATGGA | 124 | RPOB_EC_3862_3888_R | GTCCGACTTGACGGTCAACATTTCCTG | 840 | |
| 290 | RPOC_EC_2146_2174_F | CAGGAGTCGTTCAACTCGATGAT | 52 | RPOC_EC_2227_2245_R | ACGCCATCAGGCCACGCAT | 736 | |
| 291 | ASPS_EC_405_422_F | GCACAACCTGCGGCTGCG | 110 | ASPS_EC_521_538_R | ACGGCACGAGGTAGTCGC | 738 | |
| 292 | RPOC_EC_1374_1393_F | CGCCGACTTCGACGGTGACC | 69 | RPOC_EC_1437_1455_R | GAGCATCAGCGTGCGTGCT | 811 | |
| 293 | TUFB_EC_957_979_F | CCACACGCCGTTCTTCAACAACT | 55 | TUFB_EC_1034_1058_R | GGCATCACCATTTCCTTGTCCTTCG | 829 | |
| 294 | 16S_EC_733_F | GAGAGTTTGATCCTGGCTCAGAACGAA | 102 | 16S_EC_101_122_R | TGTTACTCACCCGTCTGCCACT | 1345 | |
| 295 | VALS_EC_610_649_F | ACCGAGCAAGGAGACCAGC | 17 | VALS_EC_705_727_R | TATAACGCACATCGTCAGGGTGA | 929 | |
| 344 | 16S_EC_971_990_F | GCGAAGAACCTTACCAGGTC | 113 | 16S_EC_1043_1062_R | ACAACCATGCACCACCTGTC | 726 | |
| 346 | 16S_EC_713_732_TMOD_F | TAGAACACCGATGGCGAAGGC | 202 | 16S_EC_789_809_TMOD_R | TCGTGGACTACCAGGGTATCTA | 1110 | |
| 347 | 16S_EC_785_806_TMOD_F | TGGATTAGAGACCCTGGTAGTCC | 560 | 16S_EC_880_897_TMOD_R | TGGCCGTACTCCCCAGGCG | 1278 | |
| 348 | 16S_EC_960_981_TMOD_F | TTTCGATGCAACGCGAAGAACCT | 706 | 16S_EC_1054_1073_TMOD_R | TACGAGCTGACGACAGCCATG | 895 | |
| 349 | 23S_EC_1826_1843_TMOD_F | TCTGACACCTGCCCGGTGC | 401 | 23S_EC_1906_1924_TMOD_R | TGACCGTTATAGTTACGGCC | 1156 | |
| 350 | CAPC_BA_274_303_TMOD_F | TGATTATTGTTATCCTGTTATGCCATTTGAG | 476 | CAPC_BA_349_376_TMOD_R | TGTAACCCTTGTCTTTGAATTGTATTTGC | 1314 | |
| 351 | CYA_BA_1353_1379_TMOD_F | TCGAAGTACAATACAAGACAAAAGAAGG | 355 | CYA_BA_1448_1467_TMOD_R | TTGTTAACGGCTTCAAGACCC | 1423 | |
| 352 | INFB_EC_1365_1393_TMOD_F | TTGCTCGTGGTGCACAAGTAACGGATATTA | 687 | INFB_EC_1439_1467_TMOD_R | TTGCTGCTTTCGCATGGTTAATTGCTTCAA | 1411 | |
| 353 | LEF_BA_756_781_TMOD_F | GCTAGCTTTTGCATATTATATCGAGCCAC | 220 | LEF_BA_843_872_TMOD_R | TTCTTCCAAGGATAGATTTATTTCTTGTTCG | 1394 | |
| 354 | RPOC_EC_2218_2241_TMOD_F | TCTGGCAGGTATCCGTGGTCTGATG | 405 | RPOC_EC_2313_2337_TMOD_R | TCGCACCGTGGGTTGAGATCAAGTAC | 1072 | |
| 355 | SSPE_BA_115_137_TMOD_F | TCAAGCAAACGCACAATCAGAAGC | 255 | SSPE_BA_197_222_TMOD_R | TTGCAGGTCTGTTTCAGTTGCAAATTC | 1402 | |
| 356 | RPLB_EC_650_679_TMOD_F | TGACCTACAGTAAGAGGTTCTGTAATGAACC | 449 | RPLB_EC_739_762_TMOD_R | TTCCAAGTGCTGGTTTACCCCATGG | 1380 | |
| 357 | RPLB_EC_688_710_TMOD_F | TCATCCACACGGTGGTGGTGAAGG | 296 | RPLB_EC_736_579_TMOD_R | TCTGCTGGTTTACCCCATGGAGT | 1337 | |
| 358 | VALS_EC_1105_1124_TMOD_F | TCGTGGCGGCGTGGTTATCGA | 385 | VALS_EC_1195_1218_TMOD_R | TCGGTACGAACTGGATGTCGCCGTT | 1093 | |
| 359 | RPOB_EC_1845_1866_TMOD_F | TTATCGCTCAGGCGAACTCCAAC | 659 | RPOB_EC_1909_1929_TMOD_R | TGCTGGATTCCCCTTTGCTACG | 1250 | |
| 360 | 23S_EC_2646_2667_TMOD_F | TCTGTTCTTAGTACGAGAGGACC | 409 | 23S_EC_2745_2765_TMOD_R | TTTCGTGCTTAGATGCTTTCAG | 1434 | |
| 361 | 16S_EC_1090_1111_2_TMOD_F | TTTAAGTCCCSCAACGAGCGCAA | 697 | 16S_EC_1175_1196_TMOD_R | TTGACGTCATCCCCACCTTCCTC | 1398 | |
| 362 | RPOB_EC_3799_3821_TMOD_F | TGGGCAGCGTTTCCGCGAAATGGA | 581 | RPOB_EC_3862_3888_TMOD_R | TGTCCGACTTGACGGTCAACATTTCCTG | 1325 | |
| 363 | RPOC_EC_2146_2174_TMOD_F | TCAGGAGTCGTTCAACTCGATCTACATGAT | 284 | RPOC_EC_2227_2245_TMOD_R | TACGCCATCAGGCCACGCAT | 898 | |
| 364 | RPOC_EC_1374_1393_TMOD_F | TCGCCGACTTCGACGGTGACC | 367 | RPOC_EC_1437_1455_TMOD_R | TGAGCATCAGCGTGCGTCCT | 1166 | |
| 367 | TUFB_EC_957_979_TMOD_F | TCCACACGCCGTTCTTCAACAACT | 308 | TUFB_EC_1034_1058_TMOD_R | TGGCATCACCATTTCCTTGTCCTTCG | 1276 | |
| 423 | SP101_SPET11_893_921_TMOD_F | TGGGCAACACCAGCGGATTGCGATTGCGCG | 580 | SP101_SPET11_988_1012_TMOD_R | TCATGACAGCCAAGACCTCACCCACC | 990 | |
| 424 | SP101_SPET11_1154_1179_TMOD_F | GTCAATACCGCAACAGCGGTGGCTTGG | 258 | SP101_SPET11_1251_1277_TMOD_R | TGACCCCAACCTGGCCTTTTCTCGTTGA | 1155 | |
| 425 | SP101_SPET11_118_147_TMOD_F | TGCTGGTCAAAATAACCCAGATGTCGTCTTC | 528 | SP101_SPET11_213_238_TMOD_R | TTGTGGCCGATTTCACCACCTGCTCCT | 1422 | |
| 426 | SP101_SPET11_1314_1336_TMOD_F | TCGCAAAAAAATCCAGCTATTAGC | 363 | SP101_SPET11_1403_1431_TMOD_R | TAAACTATTTTTTTAGCTATACTCGAACAC | 849 | |
| 427 | SP101_SPET11_1408_1437_TMOD_F | TCGAGTATAGCTAAAAAAATAGTTTATGACA | 359 | SP101_SPET11_1486_1515_TMOD_R | TGGATAATTGGTCCTAACAAGGGATAGTGAG | 1268 | |
| 428 | SP101_SPET11_1688_1716_TMOD_F | TCCTATATTAATCGTTTACAGAAACTGGCT | 334 | SP101_SPET11_1783_1808_TMOD_R | TATATGATTATCATTGAACTGCGGCCG | 932 | |
| 429 | SP101_SPET11_1711_1733_TMOD_F | TCTGGCTAAAACTTTGGCAACGGT | 406 | SP101_SPET11_1808_1835_TMOD_R | TGCGTGACGACCTTCTTGAATTGTAATCA | 1239 | |
| 430 | SP101_SPET11_1807_1835_TMOD_F | TATGATTACAATTCAAGAAGGTCGTCACGC | 235 | SP101_SPET11_1901_1927_TMOD_R | TTTGGACCTGTAATCAGCTGAATACTGG | 1439 | |
| 431 | SP101_SPET11_1967_1991_TMOD_F | TTAACGGTTATCATGGCCCAGATGGG | 649 | SP101_SPET11_2062_2083_TMOD_R | TATTGCCCAGAAATCAAATCATC | 940 | |
| 432 | SP101_SPET11_216_243_TMOD_F | TAGCAGGTGGTGAAATCGGCCACATGATT | 210 | SP101_SPET11_308_333_TMOD_R | TTGCCACTTTGACAACTCCTGTTGCTG | 1404 | |
| 433 | SP101_SPET11_2260_2283_TMOD_F | TCAGACACCGTTTTATCCTATCAGC | 272 | SP101_SPET11_2375_2397_TMOD_R | TTCTCGGTGACCTGGTGTTTTAGA | 1393 | |
| 434 | SP101_SPET11_2375_2399_TMOD_F | TTCTAAAACACCAGGTCACCCAGAAG | 675 | SP101_SPET11_2470_2497_TMOD_R | TAGCTGCTACATCACCTTCTGCCATGCCC | 918 | |
| 435 | SP101_SPET11_2468_2487_TMOD_F | TATCGCCATGGCAGAAGCTCA | 238 | SP101_SPET11_2543_2570_TMOD_R | TCCATAAGGTCACCGTCACCATTCAAACC | 1007 | |
| 436 | SP101_SPET11_266295_TMOD_F | TCTTCTACTTGTGGCTCACACCCCTGTTTGG | 417 | SP101_SPET11_355_380_TMOD_R | TGCTGCTTTGATGGCTGAATCCCCTTC | 1249 | |
| 437 | SP101_SPET11_2961_2984_TMOD_F | TACCATGACAGAACCCATTTTGACA | 183 | SP101_SPET11_3023_3045_TMOD_R | TGGAATTTACCAGCGATAGACACC | 1264 | |
| 438 | SP101_SPET11_3075_3103_TMOD_F | TGATGACTTTTTAGCTAATGGTCAGGCAGC | 473 | SP101_SPET11_3168_3196_TMOD_R | TAATCGACCACCATCTTGGAAAGATTTCTC | 875 | |
| 439 | SP101_SPET11_322_344_TMOD_F | TCTCAAAGTGGCACCTTTACTGGC | 631 | SP101_SPET11_423_441_TMOD_R | TATCCCCTGCTTCTCCTGCC | 934 | |
| 440 | SP101_SPET11_3386_3403_TMOD_F | TACCCTAAAGGTGAACCTT | 215 | SP101_SPET11_3480_3506_TMOD_R | TCCAGCAGTTACTGTCCCCTCATCTTTG | 1005 | |
| 441 | SP101_SPET11_3511_3535_TMOD_F | TGCTTCACCAATCAATGATCGAGCAG | 531 | SP101_SPET11_3605_3629_TMOD_R | TGGGTCTACACCTGCACTTGCATAAC | 1294 | |
| 442 | SP101_SPET11_358_387_TMOD_F | TGGCCATTCAGCCATCAAACCACCTATTGAC | 588 | SP101_SPET11_448_473_TMOD_R | TCCAACCTTTTCCACAACAGAATCAGC | 998 | |
| 443 | SP101_SPET11_600_629_TMOD_F | TCCTTACTTCGAACTATGAATCTTTTGGAAG | 348 | SP101_SPET11_686_714_TMOD_R | TCCCATTTTTTCACGCATGCTCAAAATATC | 1018 | |
| 444 | SP101_SPET11_658_684_TMOD_F | TGGGCATTCATATCACCGATAACAACAA | 589 | SP101_SPET11_756_784_TMOD_R | TGATTCCCGATAAACTCATATTTTCTAAAA | 1189 | |
| 445 | SP101_SPET11_776_801_TMOD_F | TTCCCCAATCAAAACTAACGGAATGGC | 673 | SP101_SPET11_871_896_TMOD_R | TGCCCACCAGAAAGACTAGCAGGATAA | 1217 | |
| 446 | SP101_SPET11_1_29_TMOD_F | TAACCTTAATTGGAAAGAAACCCAAGAAGT | 154 | SP101_SPET11_92_116_TMOD_R | TCCTACCCAACCTTCACCAAGCGCAG | 1044 | |
| 447 | SP101_SPET11_364_385_F | TCAGCCATCAAAGCAGCTATTG | 276 | SP101_SPET11_448_471_R | TACCTTTTCCACAACAGAATCAGC | 894 | |
| 448 | SP101_SPET11_3085_3104_F | TACCTAATGGTCACGCAGCC | 216 | SF101_SPET11_3170_3194_R | TCCACCACCATCTTCCAAAGATTTC | 1066 | |
| 449 | RPLB_EC_690_710_F | TCCACACCCTGGTGGTGAAGG | 309 | RPLB_EC_737_758_R | TGTGCTGGTTTACCCCATGGAG | 1336 | |
| 481 | BONTA_X52066_538_552_F | TATGGCTCTACTCAA | 239 | BONTA_X52066_647_660_R | TGTTACTGCTGGAT | 1346 | |
| 482 | BONTA_X52066_538_552P_F | TA*TpGGC*Tp*Cp*TpA*Cp*Tp*CpAA | 143 | BONTA_X52066_647_660P_R | TG*Tp*TpA*Cp*TpG*Cp*TpGGAT | 1146 | |
| 483 | BONTA_X52066_701_720_F | GAATAGCAATTAATCCAAAT | 94 | BONTA_X52066_759_775_R | TTACTTCTAACCCACTC | 1367 | |
| 484 | BONTA_X52066_701_720P_F | GAA*TpAG*CpAA*Tp*TpAA*Tp*Cp*CpA | 91 | BONTA_X52066_759_775P_R | TTA*Cp*Tp*Tp*Cp*TpAA*Cp*Cp*CpA* | 1359 | |
| AAT | Cp*TpC | ||||||
| 485 | BONTA_X52066_450_473_F | TCTAGTAATAATACCACCCTCAGC | 393 | BONTA_X52066_517_539_R | TAACCATTTCCCGTAAGATTCAA | 859 | |
| 486 | BONTA_X52066_450_473P_F | T*Cp*TpAGTAATAATAGGA*Cp*Cp*Cp*T | 142 | BONTA_X52066_517_539P_R | TAACCA*Tp*Tp*Tp*CpGCGTAACA*Tp*T | 857 | |
| p*CpAGC | p*CpAA | ||||||
| 487 | BONTA_X52066_591_620_F | TCAGTCACTTCAACTTGATACAAATCCTCT | 463 | BONTA_X52066_644_671_R | TCATGTCCTAATGTTACTCCTCGATCTG | 992 | |
| 608 | SSPE_BA_156_168p_F | TGGTPGCPTpAGCpATT | 616 | SSPE_BA_243_255p_R | TgCpAGCpTGATPTpGT | 1241 | |
| 609 | SSPE_BA_75_89p_F | TACpAGAGTpTpTpGCpGAC | 192 | SSPE_BA_163_1775_R | TGTgCTpTpTpGAATpGCpT | 1338 | |
| 610 | SSPE_BA_150_168P_F | TGCTTCTGGTpGCpTpAGCpATT | 533 | SSPE_BA_243_264P_R | TGATTCTTTTGCpAGCpTGATpTpGT | 1191 | |
| 611 | SSPE_BA_72_89P_F | TGGTACpAGAGTpTpTpGCpGAC | 602 | SSPE_BA_163_182P_R | TCATTTGTGCTpTpTpGAATpGCpT | 995 | |
| 612 | SSPE_BA_114_137P_F | TCAAGCAAACGCACAATpCpAGAAGC | 255 | SSPE_BA_196_222P_R | TTGCACGTCpTpGTTTCAGTTGCAAATTC | 1401 | |
| 699 | SSPE_BA_123_153_F | TCCACAATCAGAACCTAAGAAAGCGCAAGCT | 488 | SSPE_BA_202_231_R | TTTCACAGCATGCACGTCTGTTTCAGTTGC | 1431 | |
| 700 | SSPE_BA_156_168_F | TGGTGCTAGCATT | 612 | SSPE_BA_243_255_R | TGCAGCPCATTGT | 1202 | |
| 701 | SSPE_BA_75_89_F | TACAGAGTTTGCGAC | 179 | SSPE_BA_163_177_R | TGTGCTTTGAATGCT | 1338 | |
| 702 | SSPE_BA_150_168_F | TGCTTCTGGTGCTAGCATT | 533 | SSPE_BA_243_264_R | TGATTGTTTTCCAGCTGATTGT | 1190 | |
| 703 | SSPE_BA_72_89_F | TGGTACAGAGTTTGCGAC | 600 | SSPE_BA_163_182_R | TCATTTGTGCTTTGAATGCT | 995 | |
| 704 | SSPE_BA_146_168_F | TGCAAGCTTCTCGTGCTAGCATT | 484 | SSPE_BA_242_267_R | TTGTGATTGTTTTGCAGCTGATTGTG | 1421 | |
| 705 | SSPE_BA_63_89_F | TGCTAGTTATGGTACAGAGTTTGCCAC | 518 | SSPE_BA_163_191_R | TCATAACTAGCATTTGTGCTTTGAATGCT | 986 | |
| 706 | SSPE_BA_114_137_F | TCAAGCAAACGCACAATCAGAAGC | 255 | SSPE_BA_196_222_R | TTGCACGTCTGTTTCAGTTGCAAATTC | 1402 | |
| 770 | PLA_AF053945_7377_7402_F | TGACATCCGCCTCACGTTATTATGGT | 442 | PLA_AF053945_7434_7462_R | TGTAAATTCCGCAAAGACTTTCGCATTAG | 1313 | |
| 771 | PLA_AF053945_7382_7404_F | TCCGGCTCACGTTATTATGGTAC | 327 | PLA_AF053945_7482_7502_R | TGGTCTGAGTACCTCCTTTGC | 1304 | |
| 772 | PLA_AF053945_7481_7503_F | TGCAAAGGAGGTACTCAGACCAT | 481 | PLA_AF053945_7539_7562_R | TATTGGAAATACCGGCAGCATCTC | 943 | |
| 773 | PLA_AF053945_7186_7211_F | TTATACCCGAAACTTCCCCAAAGGAG | 657 | PLA_AF053945_7257_7280_R | TAATGCGATACTGGCCTGCAAGTC | 879 | |
| 774 | CAF1_AF053947_33407_33430_F | TCAGTTCCGTTACCGCCATTGCAT | 292 | CAF1_AF053947_33494_33514_R | TCCGGGCTGGTTCAACAAGAC | 1235 | |
| 775 | CAF1_AF053947_33515_33541_F | TCACTCTTACATATAAGCAAGGCGCTC | 270 | CAF1_AF053947_33595_33621_R | TCCTCTTTTATAGCCGCCAAGAGTAAG | 1053 | |
| 776 | CAF1_AF053947_33435_33457_F | TGGAACTATTGCAACTGCTAATG | 542 | CAF1_AF053947_33499_33517_R | TGATGCGGGCTGGTTCAAC | 1183 | |
| 777 | CAF1_AF053947_33687_33716_F | TCAGGATGGAAATAACCACCAATTCACTAC | 286 | CAF1_AF053947_33755_33782_R | TCAAGGTTCTCACCGTTTACCTTAGCAG | 962 | |
| 778 | INV_U22457_515_539_F | TGGCTCCTTGGTATGACTCTGCTTC | 573 | INV_U22457_571_598_R | TGTTAACTGTGTTGCCGCTGTCTTTATT | 1343 | |
| 779 | INV_U22457_699_724_F | TGCTGACGCCTGGACCGATTATTTAC | 525 | INV_U22457_753_776_R | TCACGCGACGAGTGCCATCCATTG | 976 | |
| 780 | INV_U22457_834_858_F | TTATTTACCTGCACTCCCACAACTG | 664 | INV_U22457_942_966_R | TGACCCAAAGCTGAAAGCTTTACTG | 1154 | |
| 781 | INV_U22457_1558_1581_F | TCCTAACAGAGCCTTATAGGCCCA | 597 | INV_U22457_1619_1643_R | TGCGTTGCAGATTATCTTTACCAA | 1408 | |
| 782 | LL_NC003143_2366996_2367019_F | TGTAGCCGCTAAGCACTACCATCC | 627 | LL_NC003143_2367073_2367097_R | TCTCATCCCGATATTACCGCCATGA | 1123 | |
| 783 | LL_NC003143_2367172_2367194_F | TGGACGGCATCACGATTCTCTAC | 550 | LL_NC003143_2367249_2367271_R | TGGCAACAGCTCAACACCTTTGG | 1272 | |
| 874 | RPLB_EC_649_679_F | TGICCIACIGTIIGIGGTTCTGTAATGAACC | 620 | RPLB_EC_739_762_TMOD_R | TTCCAAGTGCTGGTTTACCCCATGG | 1380 | |
| 875 | RPLB_EC_642_679P_F | TpCpCpTpTpGITpGICCIACIGTIIGIGGT | 646 | RPLB_EC_739_762_TMOD_R | TTCCAAGTGCTGGTTTACCCCATGG | 1380 | |
| TCTGTAATGAACC | |||||||
| 876 | MECIA_Y14051_3315_3341_F | TTACACATATCCTGAGCAATGAACTGA | 653 | MECIA_Y14051_3367_3393_R | TGTGATATGGAGGTGTAGAAGGTGTTA | 1333 | |
| 877 | MECA_Y14051_3774_3802_F | TAAAACAAACTACGGTAACATTGATCGCA | 144 | MECA_Y14051_3828_3854_R | TCCCAATCTAACTTCCACATACCATCT | 1015 | |
| 878 | MECA_Y14051_3645_3670_F | TGAAGTAGAAATGACTCAACGTCCGA | 434 | MECA_Y14051_3690_3719_R | TGATCCTGAATGTTTATATCTTTAACGCCT | 1181 | |
| 879 | MECA_Y14051_4507_4530_F | TCAGGTACTGCTATCCACCCTCAA | 288 | MECA_Y14051_4555_4581_R | TGGATAGACGTCATATGAAGGTGTGCT | 1269 | |
| 880 | MECA_Y14051_4510_4530_F | TGTACTGCTATCCACCCTCAA | 626 | MECA_Y14051_4586_4610_R | TATTCTTCGTTACTCATGCCATACA | 938 | |
| 881 | MECA_Y14051_4669_4698_F | TCACCAGGTTCAACTCAAAAAATATTAACA | 262 | MECA_Y14051_4765_4793_R | TAACCACCCCAAGATTTATCTTTTTGCCA | 858 | |
| 882 | MECA_Y14051_4520_4530P_F | TCpCpACpCpCpTpCpAA | 389 | MECA_Y14051_4590_4600P_R | TpACpTpCpATpGCpCpA | 1357 | |
| 883 | MECA_Y14051_4520_4530P_F | TCpCpACpCpCpTpCpAA | 389 | MECA_Y14051_4600_4610P_R | TpATpTpCpTpTpCpGTpT | 1358 | |
| 902 | TRPE_AY094355_1467_1491_F | ATGTCGATTGCAATCCGTACTTCTG | 36 | TRPE_AY094355_1569_1592_R | TGCGCGAGCTTTTATTTGGGTTTC | 1231 | |
| 903 | TRPE_AY094355_1445_1471_F | TCCATGGCATGGTGAAATGGATATGTC | 557 | TRPE_AY094355_1551_1580_R | TATTTGGGTTTCATTCCACTCAGATTCTGG | 944 | |
| 904 | TRPE_AY094355_1278_1303_F | TCAAATGTACAAGGTGAAGTGCGTGA | 247 | TRPE_AY094355_1392_1418_R | TCCTCTTTTCACACCCTCTACTTCATC | 1048 | |
| 905 | TRPE_AY094355_1064_1086_F | TCGACCTTTGGCAGGARCTAGAC | 357 | TRPE_AY094355_1171_1196_R | TACATCGTTTCGCCCAAGATCAATCA | 885 | |
| 906 | TRPE_AY094355_666_688_F | GTGCATGCGGATACAGAGCAGAG | 135 | TRPE_AY094355_769_791_R | TTCAAAATGCGGAGGCGTATGTG | 1372 | |
| 907 | TRPE_AY094355_757_776_F | TGCAAGCGCGACCACATACG | 483 | TRPE_AY094355_864_883_R | TGCCCAGGTACAACCTGCAT | 1218 | |
| 908 | RECA_AF251469_43_68_F | TGGTACATGTGCCTTCATTGATGCTG | 601 | RECA_AF251469_140_163_R | TTCAAGTGCTTGCTCACCATTGTC | 1375 | |
| 909 | RECA_AF251469_169_190_F | TGACATGCTTGTCCGTTCAGGC | 446 | RECA_AF251469_277_300_R | TGGCTCATAAGACGCGCTTGTACA | 1280 | |
| 910 | PARC_X95819_87_110_F | TGGTGACTCGGCATCTTATGAAGC | 609 | PARC_X95819_201_222_R | TTCGGTATAACGCATCGCAGCA | 1387 | |
| 911 | PARC_X95819_87_110_F | TGGTGACTCGGCATGTTATGAAGC | 609 | PARC_X95819_192_219_R | GGTATAACGCATCGCAGCAAAAGATTTA | 836 | |
| 912 | PARC_X95819_123_147_F | GGCTCAGCCATTTAGTTACCGCTAT | 120 | PARC_X95819_232_260_R | TCGCTCACCAATAATTCACTATAAGCCGA | 1081 | |
| 913 | PARC_X95819_43_63_F | TCAGCGCGTACAGTGCGTCAT | 277 | PARC_X95819_143_170_R | TTCCCCTGACCTTCGATTAARGGATAGC | 1383 | |
| 914 | OMPA_AY485227_272_301_F | TTACTCCATTATTGCTTGGTTACACTTTCC | 655 | OMPA_AY485227_364_388_R | GAGCTGCGCCAACGAATAAATCGTC | 812 | |
| 915 | OMPA_AY465227_379_401_F | TGCGCAGCTCTTGGTATCGAGTT | 509 | OMPA_AY485227_492_519_R | TGCCGTAACATAGAAGTTACCGTTGATT | 1223 | |
| 916 | OMPA_AY485227_311_335_F | TACACAACAATGGCGGTAAAGATGG | 178 | OMPA_AY485227_424_453_R | TACGTCGCCTTTAACTTGGTTATATTCAGC | 901 | |
| 917 | OMPA_AY485227_415_441_F | TGCCTCGAAGCTGAATATAACCAAGTT | 506 | OMPA_AY485227_514_546_R | TCGGGCGTAGTTTTTAGTAATTAAATCAGAA | 1092 | |
| GT | |||||||
| 918 | OMPA_AY485227_494_520_F | TCAACGGTAACTTCTATGTTACTTCTG | 252 | OMPA_AY485227_569_596_R | TCGTCGTATTTATAGTGACCAGCACCTA | 1108 | |
| 919 | OMPA_AY485227_515_77_F | TCAAGCCGTACGTATTATTAGGTGCTG | 257 | OMPA_AY485227_658_680_R | TTTAAGCGCCAGAAAGCACCAAC | 1425 | |
| 920 | OMPA_AY485227_555_581_F | TCCGTACGTATTATTAGGTGCTGGTCA | 328 | OMPA_AY485227_635_662_R | TCAACACCAGCGTTACCTAAAGTACCTT | 954 | |
| 921 | OMPA_AY485227_556_583_F | TCGTACGTATTATTAGGTGCTGGTCACT | 379 | OMPA_AY485227_659_683_R | TCGTTTAAGCGCCAGAAAGCACCAA | 1114 | |
| 922 | OMPA_AY485227_657_679_F | TGTTGGTGCTTTCTGGCGCTTAA | 645 | OMPA_AY485227_739_765_R | TAAGCCAGCAAGAGCTGTATAGTTCCA | 871 | |
| 923 | OMPA_AY485227_660_683_F | TGGTGCTTTCTGGCGCTTAAACGA | 613 | OMPA_AY485227_786_807_R | TACAGGAGCAGCAGGCTTCAAG | 884 | |
| 924 | GYRA_AF100557_4_23_F | TCTGCCCGTGTCGTTGGTGA | 402 | GYRA_AF100557_119_142_R | TCGAACCGAAGTTACCCTGACCAT | 1063 | |
| 925 | GYRA_AF100557_70_94_F | TCCATTGTTCGTATGGCTCAAGACT | 316 | GYRA_AF100557_178_201_R | TGCCAGCTTAGTCATACGGACTTC | 1211 | |
| 926 | GYRB_AB008700_19_40_F | TCAGGTGGCTTACACGGCGTAG | 289 | GYRB_AB008700_111_140_R | TATTGCGGATCACCATGATGATATTCTTGC | 941 | |
| 927 | GYRB_AB008700_265_292_F | TCTTTCTTGAATGCTGGTGTACGTATCG | 420 | GYRB_AB008700_369_395_R | TCGTTGAGATGGTTTTTACCTTCGTTG | 1113 | |
| 928 | GYRB_AB008700_368_394_F | TCAACGAAGGTAAAAACCATCTCAACG | 251 | GYRB_AB008700_466_494_R | TTTGTGAAACAGCGAACATTTTCTTGGTA | 1440 | |
| 929 | GYRB_AB008700_477_504_F | TGTTCGCTGTTTCACAAACAACATTCCA | 641 | GYRB_AB008700_611_632_R | TCACGCGCATCATCACCAGTCA | 977 | |
| 930 | GYRB_AB008700_760_787_F | TACTTACTTGAGAATCCACAAGCTGCAA | 198 | GYRB_AB008700_862_888_R | ACCTGCAATATCTAATGCACTCTTACG | 729 | |
| 931 | WAAA_Z96925_2_29_F | TCTTGCTCTTTCGTGAGTTCAGTAAATG | 416 | WAAA_Z96925_115_138_R | CAAGCGGTTTGCCTCAAATAGTCA | 758 | |
| 932 | WAAA_Z96925_286_311_F | TCGATCTGGTTTCATGCTGTTTCAGT | 360 | WAAA_Z96925_394_412_R | TGGCACGAGCCTGACCTGT | 1274 | |
| 939 | RPOB_EC_3798_3821_F | TGGGCAGCGTTTCGGCGAAATGGA | 581 | RPOB_EC_3862_3889_R | TGTCCGACTTGACGGTCAGCATTTCCTG | 1326 | |
| 940 | RPOB_EC_3798_3821_F | TGGGCAGCGTTTCGGCGAAATGGA | 581 | RPOB_EC_3862_3889_2_R | TGTCCGACTTGACGGTTAGCATTTCCTG | 1327 | |
| 941 | TUFB_EC_275_299_F | TGATCACTGGTGCTGCTCAGATGGA | 468 | TUFB_EC_337_362_R | TGGATGTGCTCACGAGTCTGTGGCAT | 1271 | |
| 942 | TUFB_EC_251_278_F | TGCACGCCGACTATGTTAAGAACATGAT | 493 | TUFB_EC_337_360_R | TATGTGCTCACGAGTTTGCGGCAT | 937 | |
| 949 | GYRB_AB008700_760_787_F | TACTTACTTGAGAATCCACAAGCTGCAA | 198 | GYRB_AB008700_862_888_2_R | TCCTGCAATATCTAATGCACTCTTACG | 1050 | |
| 958 | RPOC_EC_2223_2243_F | TGGTATGCGTGGTGTGATGGC | 605 | RPOC_EC_2329_2352_R | TGCTAGACCTTTACGTGCACCGTG | 1243 | |
| 959 | RPOC_EC_918_938_F | TCTGGATAACGGTCGTCGCGG | 404 | RPOC_EC_1009_1031_R | TCCAGCAGGTTCTGACGGAAACG | 1004 | |
| 960 | RPOC_EC_2334_2357_F | TGCTCGTAAGGGTCTGGCGGATAC | 523 | RPOC_EC_2380_2403_R | TACTAGACGACGGGTCAGGTAACC | 905 | |
| 961 | RPOC_EC_917_938_F | TATTGGACAACGGTCGTCGCGG | 242 | RPOC_EC_1009_1034_R | TTACCGACCAGGTTCTGACGGAAACG | 1362 | |
| 962 | RPOB_EC_2005_2027_F | TCGTTCCTGGAACACGATGACGC | 387 | RPOB_EC_2041_2064_R | TTGACGTTGCATGTTCGAGCCCAT | 1399 | |
| 963 | RPOB_EC_1527_1549_F | TCAGCTGTCGCAGTTCATGGACC | 282 | RPOB_EC_1630_1649_R | TCGTCGCGGACTTCGAAGCC | 1104 | |
| 964 | INFB_EC_1347_1367_F | TGCCTTTACCCCAATCCGTGC | 515 | INFB_EC_1414_1432_R | TCGGCATCACGCCGTCGTC | 1090 | |
| 965 | VALS_EC_1128_1151_F | TATGCTGACCGACCAGTGGTACGT | 237 | VALS_EC_1231_1257_R | TTCGCGCATCCAGGAGAAGTACATGTT | 1384 | |
| 978 | RPOC_EC_2145_2175_F | TCAGGAGTCGTTCAACTCGATCTACATGATG | 285 | RPOC_EC_2228_2247_R | TTACGCCATCAGGCCACGCA | 1363 | |
| 1045 | CJST_CJ_1668_1700_F | TGCTCGAGTGACTGACTTTGCTAAATTTAGA | 522 | CJST_CJ_1774_1799_R | TGAGCGTGTGGAAAAGGACTTGGATG | 1170 | |
| GA | |||||||
| 1046 | CJST_CJ_2171_2197_F | TCCTTTCGTGGTCGTAGATGAAAAAGC | 388 | CJST_CJ_2283_2313_R | TCTCTTTCAAAGCACCATTGCTCATTATAGT | 1126 | |
| 1047 | CJST_CJ_584_616_F | TCCAGGACAAATGTATGAAAAATCTCCAAGA | 315 | CJST_CJ_663_692_R | TTCATTTTCTGCTCCAAAGTAAGCAGTATC | 1379 | |
| 1048 | CJST_CJ_360_394_F | TCCTGTTATCCCTGAAGTAGTTAATCAACTT | 346 | CJST_CJ_442_476_R | TCAACTGGTTCAAAAACATTAAGTTGTAATT | 955 | |
| TGTT | GTCC | ||||||
| 1049 | CJST_CJ_2636_2668_F | TGCCTACAAGATCTTAAAAATTTCCGCCAAC | 504 | CJST_CJ_2753_2777_R | TTGCTGCCATAGCAAACCCTACACC | 1409 | |
| TT | |||||||
| 1050 | CJST_CJ_1290_1320_F | TGGCTTATCCAAATTTAGATCGTGGTTTTAC | 575 | CJST_CJ_1406_1433_R | TTTGCTCATGATCTGCATCAAGCATAAA | 1437 | |
| 1051 | CJST_CJ_3267_3293_F | TTTGATTTTACGCCGTCCTCCAGGTCC | 707 | CJST_CJ_3356_3385_R | TCAAAGAACCCGCACCTAATTCATCATTTA | 951 | |
| 1052 | CJST_CJ_5_39_F | TACCCGAAGATATACAAAGAGTATTACAAGC | 222 | CJST_CJ_104_137_R | TCCCTTATTTTTCTTTCTACTACCTTCGCAT | 1029 | |
| TAGA | AAT | ||||||
| 1053 | CJST_CJ_1080_1110_F | TTCACCCTATCCACCGTCTTTTCGATTCTTT | 681 | CJST_CJ_1166_1198_R | TCCCCTCATGTTTAAATCATCACCATAAAAA | 1022 | |
| GC | |||||||
| 1054 | CJST_CJ_2060_2090_F | TCCCGGACTTAATATCAATGAAAATTGTGGA | 323 | CJST_CJ_2148_2174_R | TCGATCCCCATCACCATCAAAACCAAA | 1068 | |
| 1055 | CJST_CJ_2869_2895_F | TGAAGCTTGTTCTTTACCACCACTTCA | 432 | CJST_CJ_2979_3007_R | TCCTCCTTCTCCCTCAAAACGCATTTTTA | 1045 | |
| 1056 | CJST_CJ_1880_1910_F | TCCCAATTAATTCTCCCATTTTTCCAGGTAT | 317 | CJST_CJ_1981_2011_R | TGGTTCTTACTTGCTTTGCATAAACTTTCCA | 1309 | |
| 1057 | CJST_CJ_2185_2212_F | TAGATGAAAAGGGCCAACTGCCTAATCC | 208 | CJST_CJ_2283_2316_R | TGAATTCTTTCAAAGCACCATTCCTCATTAT | 1152 | |
| ACT | |||||||
| 1058 | CJST_CJ_1643_1670_F | TTATCCTTTCTGCACCTACTCCTTATCC | 660 | CJST_CJ_1724_1752_R | TGCAATCTCTCCTATCTCAGCAAAAACAT | 1198 | |
| 1059 | CJST_CJ_2165_2194_F | TCCCCATCCTTTCCTCCTTCTACATCAAAA | 511 | CJST_CJ_2247_2278_R | TCCACACTCCATTCTAATTTACCTTCTTCTT | 1002 | |
| T | |||||||
| 1060 | CJST_CJ_599_632_F | TGAAAAATCTCCAACAACCATACCAAAAAAA | 424 | CJST_CJ_711_743_R | TCCCCAACAATCACTTCTATCAACTATTTTT | 1024 | |
| CCA | AC | ||||||
| 1061 | CJST_CJ_360_393_F | TCCTCTTATCCCTCAACTACTTAATCAACTT | 345 | CJST_CJ_443_477_R | TACAACTCCTTCAAAAACATTAACCTCTAAT | 882 | |
| TCT | TCTC | ||||||
| 1062 | CJST_CJ_2678_2703_F | TCCCCACCACACCCTCAAATTTCAAC | 321 | CJST_CJ_2760_2787_R | TCTCCTTTTTTTCCTCCCATACCAAACC | 1339 | |
| 1063 | CJST_CJ_1268_1299_F | ACTTATAAACACCCCTTTCCTATCCCTTATC | 29 | CJST_CJ_1349_1379_R | TCCCTTTAACCTCTACATCATCCTAACCATA | 1096 | |
| C | |||||||
| 1064 | CJST_CJ_1680_1713_F | TGATTTTGCTAAATTTAGAGAAATTGCGGAT | 479 | CJST_CJ_1795_1822_R | TATGTGTAGTTGAGCTTACTACATGAGC | 938 | |
| GAA | |||||||
| 1065 | CJST_CJ_2857_2887_F | TGGCATTTCTTATGAAGCTTGTTCTTTAGCA | 565 | CJST_CJ_2965_2998_R | TGCTTCAAAACGCATTTTTACATTTTTCGTT | 1253 | |
| AAAG | |||||||
| 1070 | RNASEP_BKM_580_599_F | TGCGGGTAGGGAGCTTGAGC | 512 | RNASEP_BKM_665_686_R | TCCGATAAGCCGGATTCTGTGC | 1034 | |
| 1071 | RNASEP_BKM_616_637_F | TCCTAGAGGAATGGCTGCCACG | 333 | RNASEP_BKM_665_687_R | TGCCGATAAGCCGGATTCTGTGC | 1222 | |
| 1072 | RNASEP_BDP_574_592_F | TGGCACGGCCATCTCCGTG | 561 | RNASEP_BDP_616_635_R | TCGTTTGACCCTGTCATGCCG | 1115 | |
| 1073 | 23S_BRM_1110_1129_F | TGCGCGGAAGATGTAACGGG | 510 | 23S_BRM_1176_1201_R | TCGCAGGCTTACAGAACGCTCTCCTA | 1074 | |
| 1074 | 23S_BRM_515_536_F | TGCATACAAACAGTCGGAGCCT | 496 | 23S_BRM_616_635_R | TCGGACTCGCTTTCGCTACG | 1088 | |
| 1075 | RNASEP_CLB_459_487_F | TAAGGATAGTGCAACAGAGATATACCGCC | 162 | RNASEP_CLB_498_526_R | TGCTCTTACCTCACCGTTCCACCCTTACC | 1247 | |
| 1076 | RNASEP_CLB_459_487_F | TAAGGATAGTGCAACAGAGATATACCGCC | 162 | RNASEP_CLB_498_522_R | TTTACCTCGCCTTTCCACCCTTACC | 1426 | |
| 1077 | ICD_CXB_93_120_F | TCCTGACCGACCCATTATTCCCTTTATC | 343 | ICD_CXB_172_194_R | TAGGATTTTTCCACGGCGGCATC | 921 | |
| 1078 | ICD_CXB_92_120_F | TTCCTGACCGACCCATTATTCCCTTTATC | 671 | ICD_CXB_172_194_R | TAGGATTTTTCCACGGCGGCATC | 921 | |
| 1079 | ICD_CXB_176_198_F | TCCCCGTGGAAAAATCCTACGCT | 369 | ICD_CXB_224_247_R | TAGCCTTTTCTCCGGCGTAGATCT | 916 | |
| 1080 | IS1111A_NC002971_6866_6891_F | TCAGTATGTATCCACCGTAGCCAGTC | 290 | IS1111A_NC002971_6928_6954_R | TAAACCTCCGATACCAATGGTTCGCTC | 848 | |
| 1081 | IS1111A_NC002971_7456_7483_F | TGGGTGACATTCATCAATTTCATCGTTC | 594 | IS1111A_NC002971_7529_7554_R | TCAACAACACCTCCTTATTCCCACTC | 952 | |
| 1082 | RNASEP_RKB_419_448_F | TCGTAAGAGCGCACCGGTAAGTTGGTAACA | 599 | RNASEP_RKP_542_565_R | TCAAGCGATCTACCCGCATTACAA | 957 | |
| 1083 | RNASEP_RKB_422_443_F | TAAGAGCGCACCGGTAAGTTGG | 159 | RNASEP_RKP_542_565_R | TCAAGCGATCTACCCGCATTACAA | 957 | |
| 1084 | RNASEP_RKP_466_491_F | TCCACCAAGAGCAAGATCAAATAGGC | 310 | RNASEP_RKP_542_565_R | TCAACCGATCTACCCGCATTACAA | 957 | |
| 1085 | RNASEP_8KB_264_287_F | TCTAAATGGTCGTGCAGTTGCGTG | 391 | RNASEP_RKP_295_321_R | TCTATAGAGTCCGGACTTTCCTCGTGA | 1119 | |
| 1086 | RNASEP_8KB_426_448_F | TGCATACCGGTAAGTTGGCAACA | 497 | RNASEP_RKP_542_565_R | TCAAGCGATCTACGCGCATTACAA | 957 | |
| 1087 | OMPB_RKB_860_890_F | TTACAGGAAGTTTAGGTGGTAATCTAAAAGG | 654 | OMPB_RKP_972_996_R | TCCTGCAGCTCTACCTGCTCCATTA | 1051 | |
| 1088 | OMPB_RKB_1192_1221_F | TCTACTGATTTTGGTAATCTTGCAGCACAG | 392 | OMPB_RKP_1288_1315_R | TAGCAgCAAAAGTTATCACACCTGCAGT | 910 | |
| 1089 | OMPB_RKP_3417_3440_F | TGCAAGTGGTACTTCAACATGGGG | 485 | OMPB_RKP_3520_3550_R | TGGTTGTAGTTCCTGTAGTTGTTGCATTAAC | 1310 | |
| 1090 | GLTA_RKP_1043_1072_F | TGGGACTTGAAGCTATCGCTCTTAAAGATG | 576 | GLTA_RKP_1138_1162_R | TGAACATTTGCGACGGTATACCCAT | 1147 | |
| 1091 | GLTA_RKP_400_428_F | TCTTCTCATCCTATGGCTATTATGCTTGC | 413 | GLTA_RKP_499_529_R | TGGTGGGTATCTTAGCAATCATTCTAATAGC | 1305 | |
| 1092 | GLTA_RKP_1023_1055_F | TCCGTTCTTACAAATAGCAATAGAACTTGAA | 330 | GLTA_RKP_1129_1156_R | TTGGCGACGGTATACCCATAGCTTTATA | 1415 | |
| GC | |||||||
| 1093 | GLTA_RKP_1043_1072_2_F | TGGAGCTTGAAGCTATCGCTCTTAAAGATG | 553 | GLTA_RKP_1138_1162_R | TGAACATTTGCGACGGTATACCCAT | 1147 | |
| 1094 | GLTA_RKP_1043_1072_3_F | TGGAACTTGAAGCTCTCGCTCTTAAAGATG | 543 | GLTA_RKP_1138_1164_R | TGTGAACATTTGCGACGGTATACCCAT | 1330 | |
| 1095 | GLTA_RKP_400_428_F | TCTTCTCATCCTATGGCTATTATGCTTGC | 413 | GLTA_RKP_505_534_R | TGCGATGGTAGGTATCTTAGCAATCATTCT | 1230 | |
| 1096 | CTXA_VBC_117_142_F | TCTTAPGCCAAGAGGACAGAGTGAGT | 410 | CTXA_VBC_194_218_R | TGCCTAACAAATCCCGTCTGAGTTC | 1226 | |
| 1097 | CTXA_VBC_351_377_F | TGTATTAGGGGCATACAGTCCTCATCC | 630 | CTXA_VBC_441_466_R | TGTCATCAAGCACCCCAAAATGAACT | 1324 | |
| 1098 | RNASEP_VBC_331_349_F | TCCGCGGAGTTGACTGGGT | 325 | RNASEP_VBC_388_414_R | TGACTTTCCTCCCCCTTATCAGTCTCC | 1163 | |
| 1099 | TOXR_VBC_135_158_F | TCGATTAGGCAGCAACGAAAGCCG | 362 | TOXR_VBC_221_246_R | TTCAAAACCTTGCTCTCGCCAAACAA | 1370 | |
| 1100 | ASD_FRT_1_29_F | TTGCTTAAAGTTGGTTTTATTGGTTGGCG | 690 | ASD_FRT_86_116_R | TGAGATGTCGAAAAAAACGTTGGCAAAATAC | 1164 | |
| 1101 | ASD_FRT_43_76_F | TCAGTTTTAATGTCTCGTATGATCGAATCAA | 295 | ASD_FRT_129_156_R | TCCATATTGTTGCATAAAACCTGTTGGC | 1009 | |
| AAG | |||||||
| 1102 | GALE_FRT_168_199_F | TTATCAGCTAGACCTTTTAGGTAAAGCTAAG | 658 | GALE_FRT_241_269_R | TCACCTACAGCTTTAAAGCCAGCAAAATG | 973 | |
| C | |||||||
| 1103 | GALE_FRT_834_865_F | TCAAAAAGCCCTAGGTAAAGAGATTCCATAT | 245 | GALE_FRT_901_925_R | TAGCCTTGGCAACATCAGCAAAACT | 915 | |
| C | |||||||
| 1104 | GALE_FRT_308_339_F | TCCAAGGTACACTAAACTTACTTGAGCTAAT | 306 | GALE_FRT_390_422_R | TCTTCTGTAAAGGGTGGTTTATTATTCATCC | 1136 | |
| G | CA | ||||||
| 1105 | IPAH_SGF_258_277_F | TGAGGACCGTGTCGCGCTCA | 458 | IPAH_SGF_301_327_R | TCCTTCTGATGCCTGATGGACCAGGAG | 1055 | |
| 1106 | IPAH_SGF_113_134_F | TCCTTGACCGCCTTTCCGATAC | 350 | IPAH_SGF_172_191_R | TTTTCCAGCCATGCAGCGAC | 1441 | |
| 1107 | IPAH_SGF_462_486_F | TCAGACCATGCTCGCAGAGAAACTT | 271 | IPAH_SGF_522_540_R | TGTCACTCCCGACACGCCA | 1322 | |
| 1111 | RNASEP_BRM_461_488_F | TAAACCCCATCGGGAGCAAGACCGAATA | 147 | RNASEP_BRM_542_561_R | TGCCTCGCGCAACCTACCCG | 1227 | |
| 1112 | RNASEP_BRM_325_347_F | TACCCCAGGGAAAGTGCCACAGA | 185 | RNASEP_BRM_402_428_R | TCTCTTACCCCACCCTTTCACCCTTAC | 1125 | |
| 1128 | HUPB_CJ_113_134_F | TAGTTGCTCAAACAGCTGGGCT | 230 | HUPB_CJ_157_188_R | TCCCTAATAGTAGAAATAACTGCATCAGTAG | 1028 | |
| C | |||||||
| 1129 | HUPB_CJ_76_102_F | TCCCGGAGCTTTTATGACTAAAGCAGAT | 324 | HUPB_CJ_157_188_R | TCCCTAATAGTAGAAATAACTGCATCAGTAG | 1028 | |
| C | |||||||
| 1130 | HUPB_CJ_76_102_F | TCCCGGAGCTTTTATGACTAAAGCAGAT | 324 | HUPB_CJ_114_135_R | TAGCCCAGCTGTTTGAGCAACT | 913 | |
| 1151 | AB_MLST-11-OIF007_62_91_F | TGAGATTGCTGAACATTTAATGCTGATTGA | 454 | AB_MLST-11-OIF007_169_203_R | TTGTACATTTGAAACAATATGCATGACATGT | 1418 | |
| GAAT | |||||||
| 1152 | AB_MLST-11-OIF007_185_214_F | TATTGTTTCAAATGTACAAGGTGAAGTGCG | 243 | AB_MLST-11-OIF007_291_324_R | TCACAGGTTCTACTTCATCAATAATTTCCAT | 969 | |
| TGC | |||||||
| 1153 | AB_MLST-11-OIF007_260_289_F | TGGAACGTTATCAGGTGCCCCAAAAATTCG | 541 | AB_MLST-11-OIF007_364_393_R | TTGCAATCGACATATCCATTTCACCATGCC | 1400 | |
| 1154 | AB_MLST-11-OIF007_206_239_F | TGAAGTGCGTGATGATATCGATGCACTTGAT | 436 | AB_MLST-11-OIF007_318_344_R | TCCGCCAAAAACTCCCCTTTTCACAGG | 1036 | |
| GTA | |||||||
| 1155 | AB_MLST-11-OIF007_522_552_F | TCGGTTTAGTAAAAGAACGTATTGCTCAACC | 378 | AB_MLST-11-OIF007_587_610_R | TTCTGCTTGAGGAATAGTGCGTGG | 1392 | |
| 1156 | AB_MLST-11-OIF007_547_571_F | TCAACCTGACTGCGTGAATGGTTGT | 250 | AB_MLST-11-OIF007_656_686_R | TACGTTCTACGATTTCTTCATCAGGTACATC | 902 | |
| 1157 | AB_MLST-11-OIF007_601_627_F | TCAAGCAGAAGCTTTGGAAGAAGAAGG | 256 | AB_MLST-11-OIF007_710_736_R | TACAACGTGATAAACACGACCAGAAGC | 881 | |
| 1158 | AB_MLST-11-OIF007_1202_1225_F | TCGTGCCCGCAATTTGCATAAAGC | 384 | AB_MLST-11-OIF007_1266_1296_R | TAATGCCGGGTAGTGCAATCCATTCTTCTAG | 878 | |
| 1159 | AB_MLST-11-OIF007_1202_1225_F | TCGTGCCCGCAATTTGCATAAAGC | 384 | AB_MLST-11-OIF007_1299_1316_R | TGCACCTGCGGTCGAGCG | 1199 | |
| 1160 | AB_MLST-11-OIF007_1234_1264_F | TTGTAGCACAGCAAGGCAAATTTCCTGAAAC | 694 | AB_MLST-11-OIF007_1335_1362_R | TGCCATCCATAATCACGCCATACTGACG | 1215 | |
| 1161 | AB_MLST-11-OIF007_1327_1356_F | TAGGTTTACGTCAGTATGGCGTGATTATGG | 225 | AB_MLST-11-OIF007_1422_1448_R | TGCCAGTTTCCACATTTCACGTTCGTG | 1212 | |
| 1162 | AB_MLST-11-OIF007_1345_1369_F | TCGTGATTATGGATGGCAACGTGAA | 383 | AB_MLST-11-OIF007_1470_1494_R | TCGCTTGAGTGTAGTCATGATTGCG | 1083 | |
| 1163 | AB_MLST-11-OIF007_1351_1375_F | TTATGGATGGCAACGTGAAACGCGT | 662 | AB_MLST-11-OIF007_1470_1494_R | TCGCTTGAGTGTAGTCATGATTGCG | 1083 | |
| 1164 | AB_MLST-11-OIF007_1387_1412_F | TCTTTGCCATTGAAGATGACTTAAGC | 422 | AB_MLST-11-OIF007_1470_1494_R | TCGCTTGAGTGTAGTCATGATTGCG | 1083 | |
| 1165 | AB_MLST-11-OIF007_1542_1569_F | TACTAGCGGTAAGCTTAAACAAGATTGC | 194 | AB_MLST-11-OIF007_1656_1680_R | TGAGTCGGGTTCACTTTACCTGGCA | 1173 | |
| 1166 | AB_MLST-11-OIF007_1566_1593_F | TTGCCAATGATATTCGTTGGTTAGCAAG | 684 | AB_MLST-11-OIF007_1656_1680_R | TGAGTCGGGTTCACTTTACCTGGCA | 1173 | |
| 1167 | AB_MLST-11-OIF007_1611_1638_F | TCGGCGAAATCCGTATTCCTGAAAATGA | 375 | AB_MLST-11-OIF007_1731_1757_R | TACCGGAAGCACCAGCGACATTAATAG | 890 | |
| 1168 | AB_MLST-11-OIF007_726_1752_F | TACCACTATTAATGTCGCTGGTGCTTC | 182 | AB_MLST-11-OIF007_1790_1821_R | TGCAACTGAATAGATTGCAGTAAGTTATAAG | 1195 | |
| C | |||||||
| 1169 | AB_MLST-11-OIF007_1792_1826_F | TTATAACTTACTGCAATCTATTCAGTTGCTT | 656 | AB_MLST-11-OIF007_1876_1909_R | TGAATTATGCAAGAAGTGATCAATTTTCTCA | 1151 | |
| GGTG | CGA | ||||||
| 1170 | AB_MLST-11-OIF007_1792_1826_F | TTATAACTTACTGCAATCTATTCAGTTGCTT | 656 | AB_MLST-11-OIF007_1895_1927_R | TGCCGTAACTAACATAAGAGAATTATGCAAG | 1224 | |
| GGTG | AA | ||||||
| 1171 | AB_MLST-11-OIF007_1970_2002_F | TGGTTATGTACCAAATACTTTGTCTGAAGAT | 618 | AB_MLST-11-OIF007_2097_2118_R | TGACGGCATCGATACCACCGTC | 1157 | |
| GG | |||||||
| 1172 | RNASEP_BRM_461_488_F | TAAACCCCATCGGGAGCAAGACCGAATA | 147 | RNASEP_BRM_542_561_2_R | TGCCTCGTGCAACCCACCCG | 1228 | |
| 2000 | CTXB_NC002505_46_70_F | TCAGCGTATGCACATGGAACTCCTC | 278 | CTXB_NC002505_132_162_R | TCCGGCTAGAGATTCTGTATACGACAATATC | 1039 | |
| 2001 | FUR_NC002505_87_113_F | TGAGTGCCAACATATCAGTGCTGAAGA | 465 | FUR_NC002505_205_228_R | TCCGCCTTCAAAATGGTGGCGAGT | 1037 | |
| 2002 | FUR_NC002505_87_113_F | TGAGTGCCAACATATCAGTGCTGAAGA | 465 | FUR_50002505_178_205_R | TCACGATACCTGCATCATCAAATTGGTT | 974 | |
| 2003 | GAPA_NC002505_533_560_F | TCGACAACACCATTATCTATGGTGTGAA | 356 | GAPA_NC002505_646_671_R | TCAGAATCGATGCCAAATGCGTCATC | 980 | |
| 2004 | GAPA_NC002505_694_721_F | TCAATGAACGACCAACAAGTGATTGATG | 259 | GAPA_NC002505_769_798_R | TCCTCTATGCAACTTAGTATCAACAGGAAT | 1046 | |
| 2005 | GAPA_NC002505_753_782_F | TGCTAGTCAATCTATCATTCCGGTTGATAC | 517 | GAPA_NC002505_856_881_R | TCCATCGCAGTCACGTTTACTGTTGG | 1011 | |
| 2006 | GYRB_NC002505_2_32_F | TGCCGGACAATTACGATTCATCGAGTATTAA | 501 | GYRB_NC0025O5_109_134_R | TCCACCACCTCAAAGACCATGTGGTG | 1003 | |
| 2007 | GYRB_NC002505_123_152_F | TGAGGTGGTGGATAACTCAATTGATGAAGC | 460 | GYRB_NC002505_199_225_R | TCCGTCATCGCTGACAGAAACTGAGTT | 1042 | |
| 2008 | GYRB_NC002505_768_794_F | TATGCAGTGGAACGATGGTTTCCAAGA | 236 | GYRB_NC002505_832_860_R | TGGAAACCGGCTAAGTGAGTACCACCATC | 1262 | |
| 2009 | GYRB_NC002505_837_860_F | TGGTACTCACTTAGCGGGTTTCCG | 603 | GYRB_NC002505_937_957_R | TCCTTCACGCGCATCATCACC | 1054 | |
| 2010 | GYRB_NC002505_934_956_F | TCGGGTGATGATGCGCGTGAAGG | 377 | GYRB_NC002505_982_1007_R | TGGCTTGAGAATTTAGGATCCGGCAC | 1283 | |
| 2011 | GYRB_NC002505_1161_1190_F | TAAAGCCCGTGAAATGACTCGTCGTAAAGG | 148 | GYRB_NC002505_1255_1284_R | TGAGTCACCCTCCACAATGTATAGTTCAGA | 1172 | |
| 2012 | OMPU_NC002505_85_110_Y | TACGCTGACGGAATCAACCAAAGCGG | 190 | OMPU_NC002505_154_180_R | TGCTTCAGCACGGCCACCAACTTCTAG | 1254 | |
| 2013 | OMPU_NC002505_258_283_F | TGACGGCCTATACGGTGTTGGTTTCT | 451 | OMPU_NC002505_346_369_R | TCCGAGACCAGCGTAGGTGTAACG | 1033 | |
| 2014 | OMPU_NC002505_431_455_F | TCACCGATATCATGGCTTACCACGG | 266 | OMPU_NC002505_544_567_R | TCGGTCAGCAAAACGGTAGCTTGC | 1094 | |
| 2015 | OMPU_NC002505_533_557_F | TAGGCGTGAAAGCAAGCTACCGTTT | 223 | OMPU_NC002505_625_651_R | TAGAGAGTAGCCATCTTCACCGTTGTC | 908 | |
| 2016 | OMPU_NC002505_689_713_F | TAGGTGCTGGTTACGCAGATCAAGA | 224 | OMPU_NC002505_725_751_R | TGGGGTAAGACGCGGCTAGCATGTATT | 1291 | |
| 2017 | OMPU_NC002505_727_747_F | TACATGCTAGCCGCGTCTTAC | 181 | OMPU_NC002505_811_835_R | TAGCAGCTAGCTCGTAACCAGTGTA | 911 | |
| 2018 | OMPU_NC002505_931_953_F | TACTACTTCAAGCCGAACTTCCG | 193 | OMPU_NC002505_1033_1053_R | TTAGAAGTCGTAACGTGGACC | 1368 | |
| 2019 | OMPU_NC002505_927_953_F | TACTTACTACTTCAAGCCGAACTTCCG | 197 | OMPU_NC002505_1033_1054_R | TGGTTAGAAGTCGTAACGTGGACC | 1307 | |
| 2020 | TCPA_NC002505_48_73_F | TCACGATAAGAAAACCGGTCAAGAGG | 269 | TCPA_NC002505_148_170_R | TTCTGCGAATCAATCGCACGCTG | 1391 | |
| 2021 | TDH_NC004605_265_289_F | TGGCTGACATCCTACATGACTGTGA | 574 | TDH_NC004605_357_386_R | TGTTGAAGCTGTACTTGACCTGATTTTACG | 1351 | |
| 2022 | VVHA_NC004460_772_802_F | TCTTATTCCAACTTCAAACCGAACTATGACG | 412 | VVHA_NC004460_862_886_R | TACCAAAGCGTGCACGATAGTTGAG | 887 | |
| 2023 | 23S_EC_2643_2667_F | TGCCTGTTCTTAGTACGAGAGGACC | 508 | 23S_EC_2746_2770_R | TGGGTTTCGCGCTTAGATGCTTTCA | 1297 | |
| 2024 | 16S_EC_713_732_TMOD_F | TAGAACACCGATGGCGAAGGC | 202 | 16S_EC_789_811_R | TGCGTGGACTACCAGGGTATCTA | 1240 | |
| 2025 | 16S_EC_784_806_F | TGGATTAGAGACCCTGGTAGTCC | 560 | 16S_EC_880_897_TMOD_R | TGGCCGTACTCCCCAGGCG | 1278 | |
| 2026 | 16S_EC_959_981_F | TGTCGATGCAACGCGAAGAACCT | 634 | 16S_EC_1052_1074_R | TACGAGCTGACGACAGCCATGCA | 896 | |
| 2027 | TUFB_EC_956_979_F | TGCACACGCCGTTCTTCAACAACT | 489 | TUFB_EC_1034_1058_2_R | TGCATCACCATTTCCTTGTCCTTCG | 1204 | |
| 2028 | RPOC_EC_2146_2174_TMOD_F | TCAGGAGTCGTTCAACTCGATCTACATGAT | 284 | RPOC_EC_2227_2249_R | TGCTAGGCCATCAGGCCACGCAT | 1244 | |
| 2029 | RPOB_EC_1841_1866_F | TGGTTATCGCTCAGGCGAACTCCAAC | 617 | RPOB_EC_1909_1929_TMOD_R | TGCTGGATTCGCCTTTGCTACG | 1250 | |
| 2030 | RPLB_EC_650_979_TMOD_F | TGACCTACAGTAAGAGGTTCTGTAATGAACC | 449 | RPLB_EC_739_763_R | TGCCAAGTGCTGGTTTACCCCATGG | 1208 | |
| 2031 | RPLB_EC_690_710_F | TCCACACGGTGGTGGTGAAGG | 309 | RPLB_EC_737_760_R | TGGGTGCTGGTTTACCCCATGGAG | 1295 | |
| 2032 | INFB_EC_1366_1393_F | TCTCGTGGTGCACAAGTAACGGATATTA | 397 | INFB_EC_1439_1469_R | TGTGCTGCTTTCGCATGGTTAATTGCTTCAA | 1335 | |
| 2033 | VALS_EC_1105_1124_TMOD_F | TCGTGGCGGCGTGCGTATCGA | 385 | VALS_EC_1195_1219_R | TGGGTACGAACTGGATGTCGCCGTT | 1292 | |
| 2034 | SSPE_BA_113_137_F | TGCAAGCAAACGCACAATCAGAAGC | 482 | SSPE_BA_197_222_TMOD_R | TTGCACGTCTGTTTCAGTTGCAAATTC | 1402 | |
| 2035 | RPOC_EC_2218_2241_TMOD_F | TCTGGCAGGTATGCGTGGTCTGATG | 405 | RPOC_EC_2313_2338_R | TGGCACCGTGGGTTGAGATGAAGTAC | 1273 | |
| 2056 | MECI-R_NC003923-41798-41609_33_ | TTTACACATATCGTGAGCAATGAACTGA | 698 | MECI-R_NC003923-41798-41609_86_ | TTGTGATATGGAGGTGTAGAAGGTGTTA | 1420 | |
| 60_F | 113_R | ||||||
| 2057 | AGR-III_NC003923-2108074- | TCACCAGTTTGCCACGTATCTTCAA | 263 | AGR-III_NC003923-2108074- | ACCTGCATCCCTAAACGTACTTGC | 730 | |
| 2109507_1_23_F | 2109507_56_79_R | ||||||
| 2058 | AGR-III_NC003923-2108074- | TGAGCTTTTAGTTGACTTTTTCAACAGC | 457 | AGR-III_NC003923-2108074- | TACTTCAGCTTCGTCCAATAAAAAATCACAA | 906 | |
| 2109507-569_596_F | 2109507_622_653_R | T | |||||
| 2059 | AGR-III_NC003923-2108074- | TTTCACACAGCGTGTTTATAGTTCTACCA | 701 | AGR-III_N0003923-2108074- | TGTAGGCAAGTGCATAAGAAATTGATACA | 1319 | |
| 2109507_1024_1052_F | 2109507_1070_1098_R | ||||||
| 2060 | AGR-I_AJ617706_622_651_F | TGGTGACTTCATAATGGATGAAGTTGAAGT | 610 | AGR-I_AJ617706_694_726_R | TCCCCATTTAATAATTCCACCTACTATCACA | 1021 | |
| CT | |||||||
| 2061 | AGR-I_AJ617706_580_611_F | TGGGATTTTAAAAAACATTGGTAACATCGCA | 579 | AGR-I_AJ617706_626_655_R | TGCTACTTCAACTTCATCCATTATGAAGTC | 1302 | |
| G | |||||||
| 2062 | AGR-II_NC002745-2079448- | TCTTGCAGCAGTTTATTTGATGAACCTAAAG | 415 | AGR-II_NC002745-2079448- | TTGTTTATTGTTTCCATATGCTACACACTTT | 1424 | |
| 2080879_620_651_F | T | 2080879_700_731_R | C | ||||
| 2063 | AGR-II_NC002745-2079448- | TGTACCCGCTGAATTAACGAATTTATACGAC | 624 | AGR-II_NC002745-2079448- | TCGCCATAGCTAAGTTGTTTATTGTTTCCAT | 1077 | |
| 2080879_649_679_F | 2080879_715_745_R | ||||||
| 2064 | AGR-IV_AJ617711_931_961_F | TGGTATTCTATTTTCCTGATAATCACCTCGC | 606 | AGR-IV_AJ617711_1004_1035_R | TGCGCTATCAACGATTTTGACAATATATGTG | 1233 | |
| A | |||||||
| 2065 | AGR-IV_AJ617711_250_283_F | TGGCACTCTTGCCTTTAATATTAGTAAACTA | 562 | AGR-IV_AJ617711_309_335_R | TCCCATACCTATGGCGATAACTGTCAT | 1017 | |
| TCA | |||||||
| 2066 | BLAZ_NC002952 | TCCACTTATCGCAAATGGAAAATTAAGCAA | 312 | BLAZ_NC002952 | TGGCCACTTTTATCAGCAACCTTACAGTC | 1277 | |
| (1913827 . . . 1914672)_68_68_F | (1913827 . . . 1914672)_68_68_R | ||||||
| 2067 | BLAZ_NC002952 | TGCACTTATCGCAAATGGAAAATTAAGCAA | 494 | BLAZ_NC002952 | TAGTCTTTTGGAACACCGTCTTTAATTAAAG | 926 | |
| (1913827 . . . 1914672)_68_68_2_ | (1913827 . . . 1914672)_68_68_ | T | |||||
| F | 2_R | ||||||
| 2068 | BLAZ_NC002952 | TGATACTTCAACGCCTGCTGCTTTC | 467 | BLAZ_NC002952 | TGGAACACCGTCTTTAATTAAAGTATCTCC | 1263 | |
| (1913827 . . . 1914672)_68_68_3_ | (1913827 . . . 1914672)_68_68_ | ||||||
| F | 3_R | ||||||
| 2069 | BLAZ_NC002952 | TATACTTCAACGCCTGCTGCTTTC | 232 | BLAZ_NC002952 | TCTTTTCTTTGCTTAATTTTCCATTTGCGAT | 1145 | |
| (1913827 . . . 1914872)_68_68_4_ | (1913827 . . . 1914672)_68_68_ | ||||||
| F | 4_R | ||||||
| 2070 | BLAZ_NC002952 | TGCAATTGCTTTAGTTTTAAGTGCATGTAAT | 487 | BLAZ_NC002952 | TTACTTCCTTACCACTTTTAGTATCTAAAGC | 1366 | |
| (1913827 . . . 1914872)_1_33_F | TC | (1913827 . . . 1914672)_34_67_R | ATA | ||||
| 2071 | BLAZ_NC002952 | TCCTTGCTTTAGTTTTAAGTGCATGTAATTC | 351 | BLAZ_NC002952 | TGGGGACTTCCTTACCACTTTTAGTATCTAA | 1289 | |
| (1913827 . . . 1914672)_3_34_F | AA | (1913827 . . . 1914672)_40_68_R | |||||
| 2072 | BSA-A_NC003923-1304065-1303589_ | TAGCGAATGTGGCTTTACTTCACAATT | 214 | BSA-A_NC003923-1304065-1303589_ | TGCAAGGGAAACCTAGAATTACAAACCCT | 1197 | |
| 99_125_F | 165_193_R | ||||||
| 2073 | BSA-A_NC003923-1304065-1303589_ | ATCAATTTGGTGGCCAAGAACCTGG | 32 | BSA-A_NC003923-1304065-1303589_ | TGCATAGGGAAGGTAACACCATAGTT | 1203 | |
| 194_218_F | 253_278_R | ||||||
| 2074 | BSA-A_NC003923-1304065-1303589_ | TTGACTGCGGCACAACACGGAT | 679 | BSA-A_NC003923-1304065-1303589_ | TAACAACGTTACCTTCGCGATCCACTAA | 856 | |
| 328_349_F | 388_415_R | ||||||
| 2075 | BSA-A_NC003923-1304065-1303589_ | TGCTATGGTGTTACCTTCCCTATGCA | 519 | BSA-A_NC003923-1304065-1303589_ | TGTTGTGCCCCAGTCAAATATCTAAATA | 1353 | |
| 253_278_F | 317_344_R | ||||||
| 2076 | BSA-B_NC003923-1917149-1914156_ | TAGCAACAAATATATCTGAAGCAGCGTACT | 209 | BSA-B_NC003923-1917149-1914156_ | TGTGAAGAACTTTCAAATCTGTGAATCCA | 1331 | |
| 953_982_F | 1011_1039_R | ||||||
| 2077 | BSA-B_NC003923-1917149-1914156_ | TGAAAAGTATGGATTTGAACAACTCGTGAAT | 426 | BSA-B_NC003923-1917149-1914156_ | TCTTCTTGAAAAATTGTTGTCCCGAAAC | 1138 | |
| 1050_1081_F | A | 1109_1136_R | |||||
| 2078 | BSA-B_NC003923-1917149-1914156_ | TCATTATCATGCGCCAATGAGTGCAGA | 300 | BSA-B_NC003923-1917149-1914156_ | TGGACTAATAACAATGAGCTCATTGTACTGA | 1267 | |
| 1260_1286_F | 1323_1353_R | ||||||
| 2079 | BSA-B_WC003923-1917149-1914156_ | TTTCATCTTATCGAGGACCCGAAATCGA | 703 | BSA-B_NC003923-1917149-1914156_ | TGAATATGTAATGCAAACCAGTCTTTGTCAT | 1148 | |
| 2126_2153_F | 2186_2216_R | ||||||
| 2080 | ERMA_NC002952-55890-56621_366_ | TCGCTATCTTATCGTTGAGAAGGGATT | 372 | ERMA_NC002952-55890-56621_487_ | TCAGTCTACACTTGGCTTAGGATGAAA | 1174 | |
| 392_F | 513_R | ||||||
| 2081 | ERMA_NC002952-55890-56621_366_ | TAGCTATCTTATCGTTGAGAAGGGATTTGC | 217 | ERMA_NC002952-55890-56621_438_ | TGAGCATTTTTATATCCATCTCCACCAT | 1167 | |
| 395_F | 465_R | ||||||
| 2082 | ERMA_NC002952-55890-56621_374_ | TGATCGTTGAGAAGGGATTTGCCAAAAGA | 470 | ERMA_NC002952-55890-56621_473_ | TCTTGGCTTAGGATGAAAATATAGTGGTGGT | 1143 | |
| 402_F | 504_R | A | |||||
| 2083 | ERMA_NC002952-55890-56621_404_ | TGCAAAATCTGCAACGAGCTTTGG | 480 | ERMA_NC002952-55890-56621_ | TCAATACAGAGTCTACACTTGGCTTAGGAT | 964 | |
| 427_F | 491_520_R | ||||||
| 2084 | ERMA_NC002952-55890-56621_489_ | TCATCCTAAGCCAAGTGTAGACTCTGTA | 297 | ERMA_NC002952-55890-56621_586_ | TGGACGATATTCACGGTTTACCCACTTATA | 1266 | |
| 516_F | 615_R | ||||||
| 2085 | ERMA_NC002952-55890-56621_586_ | TATAAGTGGGTAAACCGTGAATATCGTGT | 231 | ERMA_NC002952-55890-56621_640_ | TTCACATTTGCATGCTTCAAAGCCTG | 1397 | |
| 614_F | 665_R | ||||||
| 2086 | ERMA_NC005908-2004-2738_85_116_F | TCTGAACATGATAATATCTTTGAAATCGGCT | 399 | ERMA_NC005908-2004-2738_173_ | TCCGTAGTTTTGCATAATTTATGGTCTATTT | 1041 | |
| C | 206_R | CAA | |||||
| 2087 | ERMC_NC005908-2004-2738_90_120_F | TCATGATAATATCTTTGAAATCGGCTCAGGA | 298 | ERMA_NC005908-2004-2738_160_ | TTTATGGTCTATTTCAATGGCAGTTACGAA | 1429 | |
| 189_R | |||||||
| 2088 | ERMC_NC005908-2004-2738_115_139_ | TCAGGAAAAGGGCATTTTACCCTTG | 283 | ERMC_NC005908-2004-2738_161_ | TATGGTCTATTTCAATGGCAGTTACGA | 936 | |
| F | 187_R | ||||||
| 2089 | ERMC_NC005908-2004-2738_374_397_ | TAATCGTGGAATACGGGTTTGCTA | 168 | ERMC_NC005908-2004-2738_425_ | TCAACTTCTGCCATTAAAAGTAATGCCA | 956 | |
| F | 452_R | ||||||
| 2090 | ERMC_NC005908-2004-2738_101_125_ | TCTTTGAAATCGGCTCAGGAAAAGG | 421 | ERMC_NC005908-2004-2738_159_ | TGATGGTCTATTTCAATGGCAGTTACGAAA | 1185 | |
| F | 188_R | ||||||
| 2091 | ERMB_Y13600-625-1362_291_321_F | TGTTGGGAGTATTCCTTACCATTTAAGCACA | 644 | ERMB_Y13600-625-1362_352_380_R | TCAACAATCAGATAGATGTCAGACGCATG | 953 | |
| 2092 | ERMB_Y13600-625-1362_344_367_F | TGGAAAGCCATGCGTCTGACATCT | 536 | ERMB_Y13600-625-1362_415_437_R | TGCAAGAGCAACCCTAGTGTTCG | 1196 | |
| 2093 | ERMB_Y13600-625-1362_404_429_F | TGGATATTCACCGAACACTAGGGTTG | 556 | ERMB_Y13600-625-1362_471_393_R | TAGGATGAAAGCATTCCGCTGGC | 919 | |
| 2094 | ERMB_Y13600-625-1362_465_487_F | TAAGCTGCCAGCGGAATGCTTTC | 161 | ERMB_Y13600-625-1362_521_545_R | TCATCTGTGGTATGGCGGGTAAGTT | 989 | |
| 2095 | PVLUK_NC003923-1529595-1531285_ | TGAGCTGCATCAACTGTATTGGATAG | 456 | PVLUK_NC003923-1529595-1531285_ | TGGAAAACTCATGAAATTAAAGTGAAAGGA | 1261 | |
| 688_713_F | 775_804_R | ||||||
| 2096 | PVLUK_NC003923-1529595-1531285_ | TGGAACAAAATAGTCTCTCGGATTTTGACT | 539 | PVLUK_NC003923-1529595-1531285_ | TCATTAGGTAAAATGTCTGGACATGATCCAA | 993 | |
| 1039_1068_F | 1095_1125_R | ||||||
| 2097 | PVLUK_NC003923-1529595-1531285_ | TGAGTAACATCCATATTTCTGCCATACGT | 461 | PVLUK_NC003923-1529595-1531285_ | TCTCATGAAAAAGGCTCAGGAGATACAAG | 1124 | |
| 908_936_F | 950_978_R | ||||||
| 2098 | PVLUK_NC003923-1529595-1531285_ | TCGGAATCTGATGTTGCAGTTGTT | 373 | PVLUK_NC003923-1529595-1531285_ | TCACACCTGTAAGTGAGAAAAAGGTTGAT | 968 | |
| 610_633_F | 654_682_R | ||||||
| 2099 | SA442_NC003923-2538576-2538831_ | TGCGGTACACGATATTCTTCACGA | 635 | SA442_NC003923-2538576-2538831_ | TTTCCGATGCAACGTAATGAGATTTCA | 1433 | |
| 11_35_F | 98_124_R | ||||||
| 2100 | SA442_NC003923-2538576-2538831_ | TGAAATCTCATTACGTTGCATCGGAAA | 427 | SA442_NC003923-2538576-2538831_ | TCGTATGACCAGCTTCGGTACTACTA | 1098 | |
| 98_124_F | 163_188_R | ||||||
| 2101 | SA442_NC003923-2538576-2538831_ | TCTCATTACGTTGCATCGGAAACA | 395 | SA442_NC003923-2538576-2538831_ | TTTATGACCAGCTTCGGTACTACTAAA | 1428 | |
| 103_126_F | 161_187_R | ||||||
| 2102 | SA442_NC003923-2538576-2538831_ | TAGTACCGAAGCTGGTCATACGA | 226 | SA442_NC003923-2538576-2538831_ | TGATAATCAAGGGAAACCTTTTTCACG | 1179 | |
| 166_188_F | 231_257_R | ||||||
| 2103 | SEA_NC003923-2052219-2051456_ | TGCAGGGAACAGCTTTAGGCA | 495 | SEA_NC003923-2052219-2051456_ | TCGATCGTGACTCTCTTTATTTTCAGTT | 1070 | |
| 115_135_F | 173_200_R | ||||||
| 2104 | SEA_NC003923-2052219-2051456_ | TAACTCTGATGTTTTTGATGGGAAGCT | 156 | SEA_NC003923-2052219-2051456_ | TGTAATTAACCGAAGGTTCTGTAGAAGTATG | 1315 | |
| 572_598_F | 621_651_R | ||||||
| 2105 | SEA_NC003923-2052219-2051456_ | TGTATGGTCCTGTAACGTTACATGATAATAA | 629 | SEA_NC003923-2052219-2051456_ | TAACCGTTTCCAAAGGTACTCTATTTTCT | 861 | |
| 382_414_F | TC | 464_492_R | |||||
| 2106 | SEA_NC003923-2052219-2051456_ | TTGTATGTATGGTGGTGTAACGTTACATGA | 695 | SEA_NC003923-2052219-2051456_ | TAACCGTTTCCAAACGTACTGTATTTTGTTT | 862 | |
| 377_406_F | 459_492_R | ACC | |||||
| 2107 | SEB_NC002758-2135540-2135140_ | TTTCACATGTAATTTTGATATTCCCACTGA | 702 | SEA_NC002758-2135540-2135140_ | TCATCTGGTTTAGCATCTGGTTGACT | 988 | |
| 208_237_F | 273_298_R | ||||||
| 2108 | SEB_NC002758-2135540-2135140_ | TATTTCACATCTAATTTTGATATTCGCACT | 244 | SEA_NC002758-2135540-2135140_ | TGCAACTCATCTGGTTTAGGATCT | 1194 | |
| 206_235_F | 281_304_R | ||||||
| 2109 | SEB_NC002758-2135540-2135140_ | TAACAACTCCCCTTATCAAACGGGATATA | 151 | SEB_NC002758-2135540-2135140_ | TGTGCAGGCATCATGTCATACCAA | 1334 | |
| 402_402_F | 402_402_R | ||||||
| 2110 | SEB_NC002758-2135540-2135140_ | TTGTATGTATGCTGGTGTAACTGAGCA | 696 | SEB_NC002758-2135540-2135140_ | TTACCATCTTCAAATACCCGAACAGTAA | 1361 | |
| 402_402_2_F | 402_402_2_R | ||||||
| 2111 | SEC_NC003923-851678-852768_ | TTAACATGAAGGAAACCACTTTGATAATGG | 648 | SEC_NC003923-851678-852768_620_ | TGAGTTTGCACTTCAAAAGAAATTGTGT | 1177 | |
| 546_574_F | 647_R | ||||||
| 2112 | SEC_NC003923-851678-852768_ | TGGAATAACAAAACATGAAGCAAACCACTT | 546 | SEC_NC003923-851678-852768_619_ | TCAGTTTCCACTTCAAAAGAAATTCTGTT | 985 | |
| 537_566_F | 647_R | ||||||
| 2113 | SEC_NC003923-851678-852768_ | CGAGTTTAACACTTCACCATATGAAACAGG | 466 | SEC_NC003923-851678-852768_794_ | TCGCCTGGTGCACGCATCATAT | 1078 | |
| 720_749_F | 815_R | ||||||
| 2114 | SEC_NC003923-851678-852768_ | TGGTATCATATGATCCCTGCACCA | 604 | SEC_NC003923-851678-852768_853_ | TCTTCACACTTTTAGAATCAACCGTTTTATT | 1133 | |
| 787_810_F | 886_R | GTC | |||||
| 2115 | SED_M28521_657_682_F | TGGTGGTGAAATACATAGGACTGCTT | 615 | SED_M28521_741_770_R | TGTACACCATTTATCCACAAATTCATTGGT | 1318 | |
| 2116 | SED_M28521_690_711_F | TGGAGGTGTCACTCCACACGAA | 554 | SED_M28521_739_770_R | TGGGCACCATTTATCCACAAATTCATTGGTA | 1288 | |
| T | |||||||
| 2117 | SED_M28521_833_854_F | TTGCACAAGCAAGGCGCTATTT | 683 | SED_M28521_888_911_R | TCGCGCTGTATTTTTCCTCCGAGA | 1079 | |
| 2118 | SED_M28521_962_987_F | TGGATCTTAAGCCTGATTTTCCCGAA | 559 | SED_M28521_1022_1048_R | TGTCAATATGAAGGTGCTCTGTGCATA | 1320 | |
| 2119 | SEA-SEE_NC002952-2131289- | TTTACACTACTTTTATTCATTGCCCTAACG | 699 | SEA-SEE_NC002952-2131289- | TCATTTATTTCTTCGCTTTTCTCGCTAC | 994 | |
| 2130703_16_45_F | 2130703_71_98_R | ||||||
| 2120 | SEA-SEE_NC002952-2131289- | TGATCATCCGTGGTATAACGATTTATTACT | 469 | SEA-SEE_NC002952-2131289- | TAACCACCATATAAGTCTACTTTTTTCCCTT | 870 | |
| 2130703_249_278_F | 2130703_314_344_R | ||||||
| 2121 | SEE_NC002952-2131289-2130703_ | TGACATGATAATAACCGATTGACCGAAGA | 445 | SEE_NC002952-2131289-2130703_ | TCTATAGGTACTGTAGTTTGTTTTCCGTCT | 1120 | |
| 409_437_F | 465_494_R | ||||||
| 2122 | SEE_NC002952-2131289-2130703_ | TGTTCAAGAGCTAGATCTTCAGGCAA | 640 | SEE_NC002952-2131289-2130703_ | TTTGCACCTTACCGCCAAAGCT | 1436 | |
| 525_550_F | 586_586_R | ||||||
| 2123 | SEE_NC002952-2131289-2130703_ | TGTTCAAGAGCTAGATCTTCAGGCA | 639 | SEE_NC002952-2131289-2130703_ | TACCTTACCGCCAAAGCTGTCT | 892 | |
| 525_549_F | 586_586_2_R | ||||||
| 2124 | SEE_NC002952-2131289-2130703_ | TCTGGAGGCACACCAAATAAAACA | 403 | SEE_NC002952-2131289-2130703_ | TCCGTCTATCCACAAGTTAATTGGTACT | 1043 | |
| 361_384_F | 444_471_R | ||||||
| 2125 | SEG_NC002758-1955100-1954171_ | TGCTCAACCCGATCCTAAATTAGACGA | 520 | SEG_NC002758-1955100-1954171_ | TAACTCCTCTTCCTTCAACAGGTGGA | 863 | |
| 225_251_F | 321_346_R | ||||||
| 2126 | SEG_NC002758-1955100-1954171_ | TGGACAATAGACAATCACTTGGATTTACA | 548 | SEG_NC002758-1955100-1954171_ | TGCTTTGTAATCTAGTTCCTGAATAGTAACC | 1260 | |
| 623_651_F | 671_702_R | A | |||||
| 2127 | SEG_NC002758-1955100-1954171_ | TGGAGGTTGTTGTATGTATGGTGGT | 555 | SEG_NC002758-1955100-1954171_ | TGTCTATTGTCGATTGTTACCTGTACAGT | 1329 | |
| 540_564_F | 607_635_R | ||||||
| 2128 | SEG_NC002758-1955100-1954171_ | TACAAAGCAAGACACTGGCTCACTA | 173 | SEG_NC002758-1955100-1954171_ | TGATTCAAATGCAGAACCATCAAACTCG | 1187 | |
| 694_718_F | 735_762_R | ||||||
| 2129 | SEH_NC002953-60024-60977_449_ | TTGCAACTGCTGATTTAGCTCAGA | 682 | SEH_NC002953-60024-60977_547_ | TAGTGTTGTACCTCCATATAGACATTCAGA | 927 | |
| 472_F | 576_R | ||||||
| 2130 | SEH_NC002953-60024-60977_408_ | TAGAAATCAAGGTGATAGTGGCAATGA | 201 | SEH_NC002953-60024-60977_450_ | TTCTGAGCTAAATCAGCAGTTGCA | 1390 | |
| 434_F | 473_R | ||||||
| 2131 | SEH_NC002953-60024-60977_547_ | TCTGAATGTCTATATGGAGGTACAACACTA | 400 | SEH_NC002953-60024-60977_608_ | TACCATCTACCCAAACATTAGCACCAA | 888 | |
| 576_F | 634_R | ||||||
| 2132 | SEH_NC002953-60024-60977_546_ | TTCTGAATGTCTATATGGAGGTACAACACT | 677 | SEH_NC002953-60024-60977_594_ | TAGCACCAATCACCCTTTCCTGT | 909 | |
| 575_F | 616_R | ||||||
| 2133 | SEI_NC002758-1957830-1956949_ | TCAACTCGAATTTTCAACAGGTACCA | 253 | SEI_NC002758-1957830-1956949_ | TCACAAGGACCATTATAATCAATGCCAA | 966 | |
| 324_349_F | 419_446_R | ||||||
| 2134 | SEI_NC002758-1957830-1956949_ | TTCAACAGGTACCAATGATTTGATCTCA | 666 | SEI_NC002758-1957830-1956949_ | TGTACAAGGACCATTATAATCAATGCCA | 1316 | |
| 336_363_F | 420_447_R | ||||||
| 2135 | SEI_NC002758-1957830-1956949_ | TGATCTCAGAATCTAATAATTGGGACGAA | 471 | SEI_NC002758-1957830-1956949_ | TCTGGCCCCTCCATACATGTATTTAG | 1129 | |
| 356_384_F | 449_474_R | ||||||
| 2136 | SEI_NC002758-1957830-1956949_ | TCTCAAGGTGATATTGGTGTAGGTAACTTAA | 394 | SEI_NC002758-1957830-1956949_ | TGGGTAGGTTTTTATCTGTGACGCCTT | 1293 | |
| 223_253_F | 290_316_R | ||||||
| 2137 | SEJ_AF053140_1307_1332_F | TGTGGAGTAACACTGCATGAAAACAA | 637 | SEJ_AF053140_1381_1404_R | TCTAGCGGAACAACAGTTCTGATG | 1118 | |
| 2138 | SEJ_AF053140_1378_1403_F | TAGCATCAGAACTGTTGTTCCGCTAG | 211 | SEJ_AF053140_1429_1458_R | TCCTGAAGATCTAGTTCTTGAATGGTTACT | 1049 | |
| 2139 | SEJ_AF053140_1431_1459_F | TAACCATTCAAGAACTAGATCTTCAGGCA | 153 | SEJ_AF053140_1500_1531_R | TAGTCCTTTCTGAATTTTACCATCAAAGGTA | 925 | |
| C | |||||||
| 2140 | SEJ_AF053140_1434_1461_F | TCATTCAAGAACTAGATCTTCAGGCAAG | 301 | SEJ_AF053140_1521_1549_R | TCAGGTATGAAACACGATTAGTCCTTTCT | 984 | |
| 2141 | TSST_NC002758-2137564-2138293_ | TGGTTTAGATAATTCCTTAGGATCTATGCGT | 619 | TSST_NC002758-2137564-2138293_ | TGTAAAAGCAGGGCTATAATAAGGACTC | 1312 | |
| 206_236_F | 278_305_R | ||||||
| 2142 | TSST_NC002758-2137564-2138293_ | TGCGTATAAAAAACACAGATGGCAGCA | 514 | TSST_NC002758-2137564-2138293_ | TGCCCTTTTGTAAAAGCAGGGCTAT | 1221 | |
| 232_258_F | 289_313_R | ||||||
| 2143 | TSST_NC002758-2137564-2138293_ | TCCAAATAAGTGGCGTTACAAATACTGAA | 304 | TSST_NC002758-2137564-2138293_ | TACTTTAAGGGGCTATCTTTACCATGAACCT | 907 | |
| 382_410_F | 448_478_R | ||||||
| 2144 | TSST_NC002758-2137564-2138293_ | TCTTTTACAAAAGGGGAAAAAGTTGACTT | 423 | TSST_NC002758-2137564-2138293_ | TAAGTTCCTTCGCTAGTATGTTGGCTT | 874 | |
| 297_325_F | 347_373_R | ||||||
| 2145 | ARCC_NC003923-2725050-2724595_ | TCGCCGGCAATGCCATTGGATA | 368 | ARCC_NC003923-2725050-2724595_ | TGAGTTAAAATGCGATTGATTTCAGTTTCCA | 1175 | |
| 37_58_F | 97_128_R | A | |||||
| 2146 | ARCC_NC003923-2725050-2724595_ | TGAATAGTGATAGAACTGTAGGCACAATCGT | 437 | ARCC_NC003923-2725050-2724595_ | TCTTCTTCTTTCGTATAAAAAGGACCAATTG | 1137 | |
| 131_161_F | 214_245_R | G | |||||
| 2147 | ARCC_NC003923-2725050-2724595_ | TTGGTCCTTTTTATACGAAAGAAGAAGTTGA | 691 | ARCC_NC003923-2725050-2724595_ | TGGTGTTCTAGTATAGATTGAGGTAGTGGTG | 1306 | |
| 218_249_F | A | 322_353_R | A | ||||
| 2148 | AROE_NC003923-1674726-1674277_ | TTGCGAATAGAACGATGGCTCGT | 686 | AROE_NC003923-1674726-1674277_ | TCGAATTCAGCTAAATACTTTTCAGCATCT | 1064 | |
| 371_393_F | 435_464_R | ||||||
| 2149 | AROE_NC003923-1674726-1674277_ | TGGGGCTTTAAATATTCCAATTGAAGATTTT | 590 | AROE_NC003923-1674726-1674277_ | TACCTGCATTAATCGCTTGTTCATCAA | 891 | |
| 30_62_F | CA | 155_181_R | |||||
| 2150 | AROE_NC003923-1674726-1674277_ | TGATGGCAAGTGGATAGGGTATAATACAG | 474 | AROE_NC003923-1674726-1674277_ | TAAGCAATACCTTTACTTGCACCACCTG | 869 | |
| 204_232_F | 308_335_R | ||||||
| 2151 | GLPF_NC003923-1296927-1297391_ | TGCACCGGCTATTAAGAATTACTTTGCCAAC | 491 | GLPF_NC003923-1296927-1297391_ | TGCAACAATTAATGCTCCGACAATTAAAGGA | 1193 | |
| 270_301_F | T | 382_414_R | TT | ||||
| 2152 | GLPF_NC003923-1296927-1297391_ | TGGATGGGGATTAGCGGTTACAATG | 558 | GLPF_NC003923-1296927-1297391_ | TAAAGACACCGCTGGGTTTAAATGTGCA | 850 | |
| 27_51_F | 81_108_R | ||||||
| 2153 | GLPF_NC003923-1296927-1297391_ | TAGCTGGCGCGAAATTAGGTGT | 218 | GLPF_NC003923-1296927-1297391_ | TCACCGATAAATAAAATACCTAAAGTTAATG | 972 | |
| 239_260_F | 323_359_R | CCATTG | |||||
| 2154 | GMK_NC003923-1190906-1191334_ | TACTTTTTTAAAACTAGGGATGCGTTTGAAG | 200 | GMK_NC003923-1190906-1191334_ | TGATATTGAACTGGTGTACCATAATAGTTGC | 1180 | |
| 91_122_F | C | 166_197_R | C | ||||
| 2155 | GMK_NC003923-1190906-1191334_ | TGAAGTAGAAGGTGCAAAGCAAGTTAGA | 435 | GMK_NC003923-1190906-1191334_ | TCGCTCTCTCAAGTGATCTAAACTTGGAG | 1082 | |
| 240_267_F | 305_333_R | ||||||
| 2156 | GMK_NC003923-1190906-1191334_ | TCACCTCCAAGTTTAGATCACTTGAGAGA | 268 | GMK_NC003923-1190906-1191334_ | TGGGACGTAATCGTATAAATTCATCATTTC | 1284 | |
| 301_329_F | 403_432_R | ||||||
| 2157 | PTA_NC003923-628885-629355_237_ | TCTTGTTTATGCTGGTAAAGCAGATGG | 418 | PTA_NC003923-628885-629355_314_ | TGGTACACCTGGTTTCGTTTTGATGATTTGT | 1301 | |
| 263_F | 345_R | A | |||||
| 2158 | PTA_NC003923-628885-629355_141_ | TGAATTAGTTCAATCATTTGTTGAACGACGT | 439 | PTA_NC003923-628885-629355_211_ | TGCATTGTACCGAAGTAGTTCACATTGTT | 1207 | |
| 171_F | 239_R | ||||||
| 2159 | PTA_NC003923-628885-629355_328_ | TCCAAACCAGGTGTATCAAGAACATCAGG | 303 | PTA_NC003923-628885-629355_393_ | TGTTCTGGATTCATTGCACAATCACCAAAG | 1349 | |
| 356_F | 422_R | ||||||
| 2160 | TPI_NC003923-830671-831072_131_ | TGCAAGTTAAGAAAGCTGTTGCAGGTTTAT | 486 | TPI_NC003923-830671-831072_209_ | TGAGATGTTGATGATTTACCAGTTCCGATTG | 1165 | |
| 160_F | 239_R | ||||||
| 2161 | TPI_NC003923-830671-831072_1_34_ | TCCCACGAAACAGATGAAGAAATTAACAAAA | 318 | TPI_NC003923-830671-831072_97_ | TGGTACAACATCGTTAGCTTTACCACTTTCA | 1300 | |
| F | AAG | 129_R | CG | ||||
| 2162 | TPI_NC003923-830671-831072_199_ | TCAAACTGGGCAATCGGAACTGGTAAATC | 246 | TPI_NC003923-830671-831072_253_ | TGGCAGCAATAGTTTGACGTACAAATGCACA | 1275 | |
| 227_F | 286_R | CAT | |||||
| 2163 | YQI_NC003923-378916-379431_142_ | TGAATTGCTGCTATGAAAGGTGGCTT | 440 | YQI_NC003923-378916-379431_259_ | TCGCCAGCTACCACGATGTCATTTTC | 1076 | |
| 167_F | 284_R | ||||||
| 2164 | YQI_NC003923-378916-379431_44_ | TACAACATATTATTAAAGAGACGGGTTTGAA | 175 | YQI_NC003923-378916-379431_120_ | TTCGTGCTGGATTTTGTCCTTGTCCT | 1388 | |
| 77_F | TCC | 145_R | |||||
| 2165 | YQI_NC003923-378916-379431_135_ | TCCAGCACGAATTGCTGCTATGAAAG | 314 | YQI_NC003923-378916-379431_193_ | TCCAACCCAGAACCACATACTTTATTCAC | 997 | |
| 160_F | 221_R | ||||||
| 2166 | YQI_NC003923-378916-379431_275_ | TAGCTGGCGGTATGGAGAATATGTCT | 219 | YQI_NC003923-378916-379431_364_ | TCCATCTGTTAAACCATCATATACCATGCTA | 1013 | |
| 300_F | 396_R | TC | |||||
| 2167 | BLAZ_ | TCCACTTATCCCAAATGGAAAATTAAGCAA | 312 | BLAZ_(1913827 . . . 1914672)_ | TGGCCACTTTTATCAGCAACCTTACAGTC | 1277 | |
| (1913827 . . . 1914672)_546_ | 655_683_R | ||||||
| 575_F | |||||||
| 2168 | BLAZ_ | TGCACTTATCGCAATGGAAAATTAAGCAA | 494 | BLAZ_(1913827 . . . 1914672)_ | TAGTCTTTTGGAACACCGTCTTTAATTAAAG | 926 | |
| (1913827 . . . 1914672)_546_ | 628_659_R | T | |||||
| 575_2_F | |||||||
| 2169 | BLAZ_ | TGATACTTCAACGCCTGCTGCTTTC | 467 | BLAZ_(1913827 . . . 1914672)_ | TGGAACACCGTCTTTAATTAAAGTATCTCC | 1263 | |
| (1913827 . . . 1914672)_507_ | 622_651_R | ||||||
| 531_F | |||||||
| 2170 | BLAZ_ | TATACTTCAACGCCTGCTGCTTTC | 232 | BLAZ_(1913827 . . . 1914672)_ | TCTTTTCTTTGCTTAATTTTCCATTTGCGAT | 1145 | |
| (1913827 . . . 1914672)_508_ | 553_583_R | ||||||
| 531_F | |||||||
| 2171 | BLAZ_ | TGCAATTGCTTTAGTTTTAAGTGCATGTAAT | 487 | BLAZ_(1913827 . . . 1914672)_ | TTACTTCCTTACCACTTTTAGTATCTAAAGC | 1366 | |
| (1913827 . . . 1914672)_24_56_F | TC | 121_154_R | ATA | ||||
| 2172 | BLAZ_ | TCCTTGCTTTAGTTTTAAGTGCATGTAATTC | 351 | BLAZ_(1913827 . . . 1914672)_ | TGGGGACTTCCTTACCACTTTTAGTATCTAA | 1289 | |
| (1913827 . . . 1914672)_26_58_F | AA | 127_157_R | |||||
| 2173 | BLAZ_NC002952-1913827-1914872_ | TCCACTTATCGCAAATGGAAAATTAAGCAA | 312 | BLAZ_NC002952-1913827-191467)_ | TGGCCACTTTTATCAGCAACCTTACAGTC | 1277 | |
| 546_575_F | 655_683_R | ||||||
| 2174 | BLAZ_NC002952-1913827-1914672_ | TGCACTTATCCCAAATGGAAAATTAAGCAA | 494 | BLAZ_NC002952-1913827-1914672_ | TAGTCTTTTGGAACACCGTCTTTAATTAAAG | 926 | |
| 546_575_2_F | 628_659_R | T | |||||
| 2175 | BLAZ_NC002952-1913827-1914672_ | TGATACTTCAACGCCTGCTGCTTTC | 467 | BLAZ_NC002952-1913827-1914672_ | TGGAACACCGTCTTTAATTAAAGTATCTCC | 1263 | |
| 507_531_F | 622_651_R | ||||||
| 2176 | BLAZ_NC002952-1913827-1914672_ | TATACTTCAACGCCTCCTGCTTTC | 232 | BLAZ_NC002952-1913827-1914672_ | TCTTTTCTTTGCTTAATTTTCCATTTGCGAT | 1145 | |
| 508_531_F | 553_583_R | ||||||
| 2177 | BLAZ_NC002952-1913827-1914672_ | TGCAATTGCTTTAGTTTTAAGTGCATGTAAT | 487 | BLAZ_NC002952-1913827-1914672_ | TTACTTCCTTACCACTTTTAGTATCTAAAGC | 1366 | |
| 24_56_F | TC | 121_154_R | ATA | ||||
| 2178 | BLAZ_NC002952-1913827-1914672_ | TCCTTGCTTTAGTTTTAAGTCCATGTAATTC | 351 | BLAZ_NC002952-1913827-1914672_ | TGGGGACTTCCTTACCACTTTTAGTATCTAA | 1289 | |
| 26_58_F | AA | 127_157_R | |||||
| 2247 | TUFB_NC002758-615038-616222_ | TGTTGAACGTGGTCAAATCAAAGTTCGTG | 643 | TUFB_NC002758-615038-616222_ | TGTCACCAGCTTCAGCCTACTCTAATAA | 1321 | |
| 693_721_F | 793_820_R | ||||||
| 2248 | TUFB_NC002758-615038-616222_ | TCGTCTTCAACGTGGTCAAATCAAAGT | 386 | TUFB_NC002758-615038-616222_ | TGTCACCAGCTTCACCCTACTCTAATAA | 1321 | |
| 690_716_F | 793_820_R | ||||||
| 2249 | TUFB_NC002758-615038-616222_ | TCAACGTGGTCAAATCAAAGTTGGTGAAGA | 430 | TUFB_NC002758-615038-616222_ | TGTCACCAGCTTCAGCCTAGTCTAATAA | 1321 | |
| 696_725_F | 793_820_R | ||||||
| 2250 | TUFB_NC002758-615038-616222_488_ | TCCCAGCTCACGATGTACCTGTAATC | 320 | TUFB_NC002758-615038-616222_ | TGGTTTGTCAGAATCACGTTCTGGAGTTGG | 1311 | |
| 513_F | 601_630_R | ||||||
| 2251 | TUFB_NC002758-615038-616222_945_ | TGAAGGTGGACGTCACACTCCATTCTTC | 433 | TUFB_NC002758-615038-616222_ | TAGGCATAACCATTTCAGTACCTTCTGGTAA | 922 | |
| 972_F | 1030_1060_R | ||||||
| 2252 | TUFB_NC002758-615038-616222_333_ | TCCAATGCCACAAACTCGTGAACA | 307 | TUFB_NC002758-615038-616222_ | TTCCATTTCAACTAATTCTAATAATTCTTCA | 1382 | |
| 356_F | 424_459_R | TCGTC | |||||
| 2253 | NUC_NC002758-894288-894974_402_ | TCCTGAAGCAAGTGCATTTACGA | 342 | NUC_NC002758-894288-894974_483_ | TACGCTAAGCCACGTCCATATTTATCA | 899 | |
| 424_F | 509_R | ||||||
| 2254 | NUC_NC002758-894288-894974_53_ | TCCTTATAGGGATCCCTATCAGTAATGTT | 349 | NUC_NC002758-894288-894974_165_ | TGTTTGTGATGCATTTGCTGAGCTA | 1354 | |
| 81_F | 189_R | ||||||
| 2255 | NUC_NC002758-894288-894974_169_ | TCAGCAAATGCATCACAAACAGATAA | 273 | NUC_NC002758-894288-894974_222_ | TAGTTGAAGTTCCACTATATACTGTTGGA | 928 | |
| 194_F | 250_R | ||||||
| 2256 | NUC_NC002758-894288-894974_316_ | TACAAAGGTCAACCAATGACATTCAGACTA | 174 | NUC_NC002758-894288-894974_396_ | TAAATGCACTTGCTTCAGGGCCATAT | 853 | |
| 345_F | 421_R | ||||||
| 2270 | RPOB_EC_3798_3821_1_F | TGGCCAGCGCTTCGGTGAAATGGA | 566 | RFOB_EC_3868_3895_R | TCACGTCGTCCGACTTCACGGTCAGCAT | 979 | |
| 2271 | RFOB_EC_3789_3812_F | TCAGTTCGGCGGTCAGCGCTTCGG | 294 | RPOB_EC_3860_3890_R | TCGTCGGACTTAACGGTCAGCATTTCCTGCA | 1107 | |
| 2272 | RPOB_EC_3789_3812_F | TCAGTTCGGCGGTCAGCGCTTCGG | 294 | RPOB_EC_3860_3890_2_R | TCGTCCGACTTAACGGTCAGCATTTCCTGCA | 1102 | |
| 2273 | RPOB_EC_3789_3812_F | TCAGTTCGGCGGTCAGCGCTTCGG | 294 | RPOB_EC_3862_3890_R | TCGTCGGACTTAACGGTCAGCATTTCCTG | 1106 | |
| 2274 | RPOB_EC_3789_3812_F | TCAGTTCGGCGGTCAGCGCTTCGG | 294 | RPOB_EC_3862_3890_2_R | TCGTCCGACTTAACGGTCAGCATTTCCTG | 1101 | |
| 2275 | RPOB_EC_3793_3812_F | TTCGGCGGTCAGCCCTTCGG | 674 | RPOB_EC_3865_3890_R | TCGTCGGACTTAACGGTCAGCATTTC | 1105 | |
| 2276 | RPOB_EC_3793_3812_F | TTCGGCGGTCAGCCCTTCGG | 674 | RPOB_EC_3865_3890_2_R | TCGTCCGACTTAAGGCTCAGCATTTC | 1100 | |
| 2309 | MUPR_X75439_1658_1689_F | TCCTTTGATATATTATGCGATGGAAGGTTGG | 352 | MUPR_X75439_1744_1773_R | TCCCTTCCTTAATATGAGAAGGAAACCACT | 1030 | |
| T | |||||||
| 2310 | MUPR_X75439_1330_1353_F | TTCCTCCTTTTGAAACCGACGGTT | 669 | MUPR_X75439_1413_1441_R | TGAGCTGGTCCTATATGAACAATACCAGT | 1171 | |
| 2312 | MUPR_X75439_1314_1338_F | TTTCCTCCTTTTGAAAGCGACGGTT | 704 | MUPR_X75439_1381_1409_R | TATATGAACAATACCAGTTCCTTCTGAGT | 931 | |
| 2313 | MUPR_X75439_2486_2516_F | TAATTGGGCTCTTTCTCGCTTAAACACCTTA | 172 | MUPR_X75439_2548_2574_R | TTAATCTGGCTGCGGAAGTGAAATCGT | 1360 | |
| 2314 | MUPR_X75439_2547_2572_F | TACGATTTCACTTCCGCAGCCAGATT | 188 | MUPR_X75439_2605_2630_R | TCGTCCTCTCGAATCTCCGATATACC | 1103 | |
| 2315 | MUPR_X75439_2666_2696_F | TGCGTACAATACCGTTTATGAAATTTTAACA | 513 | MUPR_X75439_2711_2740_R | TCAGATATAAATGGAACAAATGGAGCCACT | 981 | |
| 2316 | MUPR_X75439_2813_2843_F | TAATCAAGCATTGGAAGATGAAATGCATACC | 165 | MUPR_X75439_2867_2890_R | TCTGCATTTTTGCGAGCCTCTCTA | 1127 | |
| 2317 | MUPR_X75439_884_914_F | TGACATGGACTCCCCCTATATAACTCTTGAG | 447 | MUPR_X75439_977_1007_R | TGTACAATAAGGAGTCACCTTATGTCCCTTA | 1317 | |
| 2318 | CTXA_NC002505-1568114-1567341_ | TGGTCTTATGCCAAGAGGACAGAGTCAGT | 608 | CTXA_NC002505-1568114-1567341_ | TCGTGCCTAACAAATCCCGTCTGAGTTC | 1109 | |
| 114_142_F | 194_221_R | ||||||
| 2319 | CTXA_NC002505-1568114-1567341_ | TCTTATGCCAAGAGGACAGAGTGAGTACT | 411 | CTXA_NC002505-1568114-1567341_ | TCGTCCCTAACAAATCCCGTCTGAGTTC | 1109 | |
| 117_145_F | 194_221_R | ||||||
| 2320 | CTXA_NC002505-1568114-1567341_ | TGGTCTTATGCCAAGAGGACAGAGTGAGT | 608 | CTXA_NC002505-1568114-1567341_ | TAACAAATCCCCTCTGAGTTCCTCTTGCA | 855 | |
| 114_142_F | 186_214_R | ||||||
| 2321 | CTXA_NC002505-1568114-1567341_ | TCTTATGCCAAGAGGACAGAGTGAGTACT | 411 | CTXA_NC002505-1568114_1567341_ | TAACAAATCCCGTCTGAGTTCCTCTTGCA | 855 | |
| 117_145_F | 186_214_R | ||||||
| 2322 | CTXA_NC002505-1568114-1567341_ | AGGACAGAGTCACTACTTTGACCGAGGT | 27 | CTXA_NJ002505-1568114-1567341_ | TCCCGTCTGAGTTCCTCTTGCATGATCA | 1027 | |
| 129_156_F | 180_207_R | ||||||
| 2323 | CTXA_NC002505-1568114-1567341_ | TGCCAAGAGGACAGAGTGAGTACTTTGA | 500 | CTXA_NC002505-1568114-1567341_ | TAACAAATCCCGTCTGAGTTCCTCTTGCA | 855 | |
| 122149_F | 186_214_R | ||||||
| 2324 | INV_U22457-74-3772_831_858_F | TGCTTATTTACCTGCACTCCCACAACTG | 530 | INV_U22457-74-3772_942_966_R | TGACCCAAAGCTGAAAGCTTTACTG | 1154 | |
| 2325 | INV_U22457-74-3772_827_857_F | TGAATGCTTATTTACCTGCACTCCCACAACT | 438 | INV_U22457-74-3772_942_970_R | TAACTGACCCAAAGCTGAAAGCTTTACTC | 864 | |
| 2326 | INV_U22457-74-3772_1555_1581_F | TGCTGGTAACAGAGCCTTATAGGCGCA | 526 | INV_U22457-74-3772_1619_1647_R | TGGGTTGCGTTGCAGATTATCTTTACCAA | 1296 | |
| 2327 | INV_U22457-74-3772_1558_1585_F | TGGTAACAGAGCCTTATAGGCGCATACG | 598 | INV_U22457-74-3772_1622_1652_R | TCATAAGGGTTGCGTTGCAGATTATCTTTAC | 987 | |
| 2328 | ASD_NC006570-439714-438608_3_37_ | TGAGGGTTTTATGCTTAAAGTTGGTTTTATT | 459 | ASD_NC006570-439714-438608_54_ | TGATTCGATCATACGAGACATTAAAACTGAG | 1188 | |
| F | GGTT | 84_R | |||||
| 2329 | ASD_NC006570-439714-438608_18_ | TAAAGTTGGTTTTATTGGTTGGCGCGGA | 149 | ASD_NC006570-439714-438608_66_ | TCAAAATCTTTTGATTCGATCATACGAGAC | 948 | |
| 45_F | 95_R | ||||||
| 2330 | ASD_NC006570-439714-438608_17_ | TTAAAGTTGGTTTTATTGGTTGGCGCGGA | 647 | ASD_NC006570-439714-438608_67_ | TCCCAATCTTTTGATTCGATCATACGAGA | 1016 | |
| 45_F | 95_R | ||||||
| 2331 | ASD_NC006570-439714-438608_9_ | TTTTATGCTTAAAGTTGGTTTTATTGGTTGG | 709 | ASD_NC006570-439714-438608_107_ | TCTGCCTGAGATGTCGAAAAAAACGTTG | 1128 | |
| 40_F | C | 134_R | |||||
| 2332 | GALE_AF513299_171_200_F | TCAGCTAGACCTTTTAGGTAAAGCTAAGCT | 280 | GALE_AF513299_241_271_R | TCTCACCTACAGCTTTAAAGCCAGCAAAATG | 1122 | |
| 2333 | GALE_AF513299_168_199_F | TTATCAGCTAGACCTTTTAGGTAAAGCTAAG | 658 | GALE_AF513299_245_271_R | TCTCACCTACAGCTTTAAAGCCAGCAA | 1121 | |
| C | |||||||
| 2334 | GALE_AF513299_168_199_F | TTATCAGCTAGACCTTTTAGGTAAAGCTAAG | 658 | GALE_AF513299_233_264_R | TACAGCTTTAAAGCCAGCAAAATGAATTACA | 883 | |
| C | G | ||||||
| 2335 | GALE_AF513299_169_198_F | TCCCAGCTAGACCTTTTAGGTAAAGCTAAG | 319 | GALE_AF513299_252_279_R | TTCAACACTCTCACCTACAGCTTTAAAG | 1374 | |
| 2336 | PLA_AF053945_7371_7403_F | TTGAGAAGACATCCGGCTCACGTTATTATGG | 680 | PLA_AF053945_7434_7468_R | TACGTATGTAAATTCCGCAAAGACTTTGGCA | 900 | |
| TA | TTAG | ||||||
| 2337 | PLA_AF053945_7377_7403_F | TGACATCCGGCTCACGTTATTATGGTA | 443 | PLA_AF053945_7428_7745_R | TCCGCAAAGACTTTGGCATTAGGTGTGA | 1035 | |
| 2338 | PLA_AF053945_7737_7404_F | TGACATCCGGCTCACGTTATTATGGTAC | 444 | PLA_AF053945_7430_7460_R | TAAATTCCGCAAAGACTTTGGCATTAGGTGT | 854 | |
| 2339 | CAF_AF053947_33412_33441_F | TCCGTTATCGCCATTGCATTATTTGGAACT | 329 | CAF_AF053947_33498_33523_R | TAAGAGTGATGCGGGCTGGTTCAACA | 866 | |
| 2340 | CAF_AF053947_33426_33458_F | TGCATTATTTGGAACTATTGCAACTGCTAAT | 499 | CAF_AF053947_33483_33507_R | TGGTTCAACAAGAGTTGCCGTTGCA | 1308 | |
| GC | |||||||
| 2341 | CAF_AF053947_33407_33429_F | TCAGTTCCGTTATCGCCATTGCA | 291 | CAF_AF053947_33483_33504_R | TTCAACAAGAGTTGCCGTTGCA | 1373 | |
| 2342 | CAF_AF053947_33407_33431_F | TCAGTTCCGTTATCGCCATTGCATT | 293 | CAF_AF053947_33494_33517_R | TGATGCGGGCTGGTTCAACAAGAG | 1184 | |
| 2344 | GAPA_NC_002505_1_28_F_1 | TCAATGAACGATCAACAAGTGATTGATG | 260 | GAPA_NC_002505_29_58_R_1 | TCCTTTATGCAACTTGGTATCAACAGGAAT | 1060 | |
| 2472 | OMPA_NC000117_68_89_F | TGCCTGTAGGGAATCCTGCTGA | 507 | OMPA_NC000117_145_167_R | TCACACCAAGTAGTGCAAGGATC | 967 | |
| 2473 | OMPA_NC000117_798_821_F | TGATTACCATGAGTGGCAAGCAAG | 475 | OMPA_NC000117_865_893_R | TCAAAACTTGCTCTAGACCATTTAACTCC | 947 | |
| 2474 | OMPA_NC000117_645_671_F | TGCTCAATCTAAACCTAAAGTCGAAGA | 521 | OMPA_NC000117_757_777_R | TGTCGCAGCATCTGTTCCTGC | 1328 | |
| 2475 | OMPA_NC000117_947_973_F | TAACTGCATGGAACCCTTCTTTACTAG | 157 | OMPA_NC000117_1011_1040_R | TGACAGGACACAATCTGCATGAAGTCTGAG | 1153 | |
| 2476 | OMPA_NC000117_774_795_F | TACTGGAACAAAGTCTGCGACC | 196 | OMPA_NC000117_871_894_R | TTCAAAAGTTGCTCGAGACCATTG | 1371 | |
| 2477 | OMPA_NC000117_457_483_F | TTCTATCTCGTTGGTTTATTCGGAGTT | 676 | OMPA_NC000117_511_534_R | TAAAGAGACGTTTGGTAGTTCATTTGC | 851 | |
| 2478 | OMPA_NC000117_687_710_F | TACCCCAGCACAATTTGTGATTCA | 212 | OMPA_NC000117_787_816_R | TTGCCATTCATGGTATTTAAGTGTAGCAGA | 1406 | |
| 2479 | OMPA_NC000117_540_566_F | TGGCGTAGTAGAGCTATTTACAGACAC | 571 | OMPA_NC000117_649_672_R | TTCTTGAACGCGAGGTTTCGATTG | 1395 | |
| 2480 | OMPA_NC000117_338_360_F | TGCACGATGCGGAATGGTTCACA | 492 | OMPA_NC00117_417_444_R | TCCTTTAAAATAACCGCTAGTAGCTCCT | 1058 | |
| 2481 | OMP2_NC000117_18_40_F | TATGACCAAACTCATCAGACGAG | 234 | OMP2_NC000117_71_91_R | TCCCGCTGGCAAATAAACTCG | 1025 | |
| 2482 | OMP2_NC000117_354_382_F | TGCTACGGTAGGATCTCCTTATCCTATTG | 516 | OMP2_NC000117_445_471_R | TGGATCACTCCTTACGAACTCAGCTTC | 1270 | |
| 2483 | OMP2_NC000117_1297_1319_F | TGGAAAGGTGTTGCAGCTACTCA | 537 | OMP2_NC000117_1396_1419_R | TACGTTTGTATCTTCTGCAGAACC | 903 | |
| 2484 | OMP2_NC000117_1465_1493_F | TCTGGTCCAACAAAAGGAACGATTACAGG | 407 | OMP2_NC000117_1541_1569_R | TCCTTTCAATGTTACAGAAAACTCTACAG | 1062 | |
| 2485 | OMP2_NC000117_44_66_F | TGACGATCTTCGCGGTGACTAGT | 450 | OMP2_NC000117_120_148_R | TGTCAGCTAAGCTAATAACGTTTGTAGAG | 1323 | |
| 2486 | OMP2_NC000117_166_190_F | TGACAGCGAAGAAGGTTAGACTTGTCC | 441 | OMP2_NC000117_240_2619_R | TTGACATCGTCCCTCTTCACAG | 1396 | |
| 2487 | GYRA_NC000117_514_536_F | TCAGGCATTGCGGTTGGGATGGC | 287 | GYRA_NC000117_640_660_R | TGCTGTAGGGAAATCAGGGCC | 1251 | |
| 2488 | GYRA_NC000117_801_827_F | TGTGAATAAATCACGATTGATTGAGCA | 636 | GYRA_NC000117_871_893_R | TTGTCAGACTCATCGCGAACATC | 1419 | |
| 2489 | GYRA_NC002952_219_242_F | TGTCATGGGTAAATATCACCCTCA | 632 | GYRA_NC002952_319_345_R | TCCATCCATAGAACCAAAGTTACCTTG | 1010 | |
| 2490 | GYRA_NC002952_964_983_F | TACAAGCACTCCCAGCTGCA | 176 | GYRA_NC002952_1024_1041_R | TCGCAGCGTGCGTGGCAC | 1073 | |
| 2491 | GYRA_NC002952_1505_1520_F | TCGCCCGCGAGGACGT | 366 | GYRA_NC002952_1546_1562_R | TTGGTGCGCTTGGCGTA | 1416 | |
| 2492 | GYRA_NC002952_59_81_F | TCAGCTACATCGACTATGCGATG | 279 | GYRA_NC002952_124_143_R | TGGCGATGCACTGGCTTGAG | 1279 | |
| 2493 | GYRA_NC002952_216_239_F | TGACGTCATCGGTAAGTACCACCC | 452 | GYRA_NC002952_313_333_R | TCCGAAGTTGCCCTGGCCGTC | 1032 | |
| 2494 | GYRA_NC002952_219_242_2_F | TGTACTCGGTAAGTATCACCCGCA | 625 | GYRA_NC002952_308_330_R | TAAGTTACCTTGCCCGTCAACCA | 873 | |
| 2495 | GYRA_NC002952_115_141_F | TGAGATGGATTTAAACCTGTTCACCGC | 453 | GYRA_NC002952_220_242_R | TGCGGGTGATACrPACCGAGTAC | 1236 | |
| 2496 | GYRA_NC002952_517_539_F | TCAGGCATTGCGGTTGGGATGGC | 287 | GYRA_NC002952_643_663_R | TGCTGTAGGGAAATCAGGGCC | 1251 | |
| 2497 | GYRA_NC002952_273_293_F | TCGTATGGCTCAATGGTGGAG | 380 | GYRA_NC002952_338_360_R | TGCGGCAGCACTATCACCATCCA | 1234 | |
| 2498 | GYRA_NC000912_257_278_F | TGAGTAAGTTCCACCCGCACGG | 462 | GYRA_NC000912_346_370_R | TCGAGCCGAAGTTACCCTGTCCGTC | 1067 | |
| 2504 | ARCO_NC003923-2725050-2724595_ | TAGTpGATpAGAACpTpGTAGGCpACpAATp | 229 | ARCC_NC003923-2725050-2724595_ | TCpTpTpTpCpGTATAAAAAGGACpCpAATp | 1116 | |
| 135_161P_F | CpGT | 214_239P_R | TpGG | ||||
| 2505 | PTA_NC003923-628885-629355_237_ | TCTTGTpTpTpATGCpTpGGTAAAGCAGATG | 417 | PTA_NC003923-628885-629355_314_ | TACpACpCPTGGTpTpTpCpGTpTpTpTpGA | 904 | |
| 263P_F | G | 342P_R | TGATpTpTpGTA | ||||
| 2517 | CJMLST_ST1_1852_1883_F | TTTGCGGATGAAGTAGGTGCCTATCTTTTTG | 708 | CJMLST_ST1_1945_1977_R | TGTTTTATGTGTAGTTGAGCTTACTACATGA | 1355 | |
| C | GC | ||||||
| 2518 | CJMLST_ST1_2963_2992_F | TGAAATTGCTACAGGCCCTTTAGGACAAGG | 428 | CJMLST_ST1_3073_3097_R | TCCCCATCTCCGCAAAGACAATAAA | 1020 | |
| 2519 | CJMLST_ST1_2350_2378_F | TGCTTTTGATGGTGATGCAGATCGTTTGG | 535 | CJMLST_ST1_2447_2481_R | TCTACAACACTTGATTGTAATTTGCCTTGTT | 1117 | |
| CTTT | |||||||
| 2520 | CJMLST_ST1_654_684_F | TATGTCCAAGAAGCATAGCAAAAAAAGCAAT | 240 | CJMLST_3T1_725_756_R | TCGGAAACAAAGAATTCATTTTCTGGTCCAA | 1084 | |
| A | |||||||
| 2521 | CJMLST_ST1_360_395_F | TCCTGTTATTCCTGAAGTAGTTAATCAAGTT | 347 | CJMLST_ST1_454_487_R | TGCTATATGCTACAACTGGTTCAAAAACATT | 1245 | |
| TGTTA | AAG | ||||||
| 2522 | CJMLST_ST1_1231_1258_F | TGGCAGTTTTACAAGGTGCTGTTTCATC | 564 | CJMLST_ST1_1312_1340_R | TTTAGCTACTATTCTAGCTGCCATTTCCA | 1427 | |
| 2523 | CJMLST_ST1_3543_3574_F | TGCTGTAGCTTATCGCGAAATGTCTTTGATT | 529 | CJMLST_ST1_3656_3685_R | TCAAAGAACCAGCACCTAATTCATCATTTA | 950 | |
| T | |||||||
| 2524 | CJMLST_ST1_1_17_F | TAAAACTTTTGCCGTAATGATGGGTGAAGAT | 145 | CJMLST_ST1_55_84_R | TGTTCCAATAGCAGTTCCGCCCAAATTGAT | 1348 | |
| AT | |||||||
| 2525 | CJMLST_ST1_1312_1342_F | TGGAAATGGCAGCTAGAATAGTAGCTAAAAT | 538 | CJMLST_ST1_1383_1417_R | TTTCCCCGATCTAAATTTGGATAAGCCATAG | 1432 | |
| GAAA | |||||||
| 2526 | CJMLST_ST1_2254_2286_F | TGGGCCTAATGGGCTTAATATCAATGAAAAT | 582 | CJMLST_ST1_2352_2379_R | TCCAAACGATCTGCATCACCATCAAAAG | 996 | |
| TG | |||||||
| 2527 | CJMLST_ST1_1380_1411_F | TGCTTTCCTATGGCTTATCCAAATTTAGATC | 534 | CJMLST_ST1_1486_1520_R | TGCATGAAGCATAAAAACTGTATCAAGTGCT | 1205 | |
| G | TTTA | ||||||
| 2528 | CJMLST_ST1_3413_3437_F | TTGTAAATGCCGGTGCTTCAGATCC | 692 | CJMLST_ST1_3511_3542_R | TGCTTGCTCAAATCATCATAAACAATTAAAG | 1257 | |
| C | |||||||
| 2529 | CJMLST_ST1_1130_1156_F | TACGCGTCTTGAAGCGTTTCGTTATGA | 189 | CJMLST_ST1_1203_1230_R | TAGGATGAGCATTATCAGGGAAAGAATC | 920 | |
| 2530 | CJMLST_ST1_2840_2872_F | TGGGGCTTTGCTTTATAGTTTTTTACATTTA | 591 | CJMLST_ST1_2940_2973_R | TAGCGATTTCTACTCCTAGAGTTGAAATTTC | 917 | |
| AG | AGG | ||||||
| 2531 | CJMLST_ST1_2058_2084_F | TATTCAAGGTGGTCCTTTGATGCATGT | 241 | CJMLST_ST1_2131_2162_R | TTGGTTCTTACTTGTTTTGCATAAACTTTCC | 1417 | |
| A | |||||||
| 2532 | CJMLST_ST1_553_585_F | TCCTGATGCTCAAAGTGCTTTTTTAGATCCT | 344 | CJMLST_ST1_655_685_R | TATTGCTTTTTTTGCTATGCTTCTTGGACAT | 942 | |
| TT | |||||||
| 2564 | GLTA_NC002163-1604930-1604529_ | TCATGTTGAGCTTAAACCTATAGAAGTAAAA | 299 | GLTA_NC002163-1604930-1604529_ | TTTTGCTCATGATCTGCATGAAGCATAAA | 1443 | |
| 306_338_F | GC | 352_380_R | |||||
| 2565 | UNCA_NC002163-112166-112647_80_ | TCCCCCACCCTTTAATTGTTTATGATGATTT | 322 | UNCA_NC002163-112166-112647_ | TCGACCTGGAGGACGACGTAAAATCA | 1065 | |
| 113_F | GAG | 146_171_R | |||||
| 2566 | UNCA_NC002163-112166-112647_233_ | TAATGATGAATTAGGTGCGGGTTCTTT | 170 | UNCA_NC002163-112166-112647_ | TGGGATAACATTGGTTGGAATATAAGCAGAA | 1285 | |
| 259_F | 294_329_R | ACATC | |||||
| 2567 | PGM_NC002163-327773-328270_273_ | TCTTGATACTTGTAATGTGGGCGATAAATAT | 414 | PGM_NC002163-327773-328270_365_ | TCCATCGCCAGTTTTTGCATAATCGCTAAAA | 1012 | |
| 305_F | GT | 396_R | A | ||||
| 2568 | TKT_NC002163-1569415-1569873_ | TTATGAAGCGTGTTCTTTAGCAGCACTTCA | 661 | TKT_NC002163-1569415-1569873_ | TCAAAACGCATTTTTACATCTTCGTTAAAGG | 946 | |
| 255_284_F | 350_383_R | CTA | |||||
| 2570 | GLTA_NC002163-1604930-1604529_ | TCGTCTTTTTGATTCTTTCCCTGATAATGC | 381 | GLTA_NC002163-1604930-1604529_ | TGTTCATGTTTAAATGATCAGGATAAAAAGC | 1347 | |
| 39_68_F | 109_142_R | ACT | |||||
| 2571 | TKT_NC002163-1569415-1569903_33_ | TGATCTTAAAAATTTCCGCCAACTTCATTC | 472 | TKT_NC002163-1569415-15699039_ | TGCCATAGCAAAGCCTACAGCATT | 1214 | |
| 62_F | 139_162_R | ||||||
| 2572 | TKT_NC002163-1569415-1569903_ | TAAGGTTTATTGTCTTTGTGGAGATGGGGAT | 164 | TKT_NC002163-1569415-1569903_ | TACATCTCCTTCGATAGAAATTTCATTGCTA | 886 | |
| 207_239_F | TT | 313_345_R | TC | ||||
| 2573 | TKT_NC002163-1569415-1569903_ | TAGCCTTTAACGAAAATGTAAAAATGCGTTT | 213 | TKT_NC002163-1569415-1569903_ | TAAGACAAGGTTTTGTGGATTTTTTACCTTG | 865 | |
| 350_383_F | TGA | 449_481_R | TT | ||||
| 2574 | TKT_NC002163-1569415-1569903_ | TTCAAAAACTCCAGGCCATCCTGAAATTTCA | 665 | TKT_NC002163-1569415-1569903_ | TTGCCATAGCAAAGCCTACAGCATT | 1405 | |
| 60_92_F | AC | 139_163_R | |||||
| 2575 | GLTA_NC002163-1604930-1604529_ | TCGTCTTTTTGATTCTTTCCCTGATAATGCT | 382 | GLTA_NC002163-1604930-1604529_ | TGCCATTTCCATGTACTCTTCTCTAACATT | 1216 | |
| 39_70_F | C | 139_168_R | |||||
| 2576 | GLYA_NC002163-367572-368079_386_ | TCAGCTATTTTTCCAGGTATCCAAGCTGG | 281 | GLYA_NC002163-367572-368079_ | ATTGCTTCTTACTTGCTTAGCATAAATTTTC | 756 | |
| 414_F | 476_508_R | CA | |||||
| 2577 | GLYA_NC002163-367572-368079_148_ | TGGTGCGAGTGCTTATGCTCGTATTAT | 611 | GLYA_NC002163-367572-368079_ | TGCTCACCTGCTACAACAAGTCCAGCAAT | 1246 | |
| 174_F | 242_270_R | ||||||
| 2578 | GLYA_NC002163-367572-368079_298_ | TGTAAGCTCTACAACCCACAAAACCTTACG | 622 | GLYA_NC002163-367572-368079_ | TTCCACCTTGGATACCTGGAAAAATAGCTGA | 1381 | |
| 327_F | 384_416_R | AT | |||||
| 2579 | GLYA_NC002163-367572-368079_1_ | TGGTGGACATTTAACACATGGTGCAAA | 614 | GLYA_NC002163-367572-368079_52_ | TCAAGCTCTACACCATAAAAAAAGCTCTCA | 961 | |
| 27_F | 81_R | ||||||
| 2580 | PGM_NC002163-327746-328270_254_ | TGAGCAATGGGGCTTTGAAAGAATTTTTAAA | 455 | PGM_NC002163-327746-328270_356_ | TTTGCTCTCCGCCAAAGTTTCCAC | 1438 | |
| 285_F | T | 379_R | |||||
| 2581 | PGM_NC002163-327746-328270_153_ | TGAAAAGGGTGAAGTAGCAAATCGAGATAG | 425 | PGM_NC002163-327746-328270_241_ | TGCCCCATTGCTCATGATAGTAGCTAC | 1219 | |
| 182_F | 267_R | ||||||
| 2582 | PGM_NC002163-327746-328270_19_ | TGGCCTAATGGGCTTAATATCAATGAAAATT | 568 | PGM_NC002163-327746-328270_79_ | TGCACGCAAACGCTTTACTTCAGC | 1200 | |
| 50_F | G | 102_R | |||||
| 2583 | UNCA_NC002163-112166-112647_114_ | TAAGCATGCTGTGGCTTATCGTGAAATG | 160 | UNCA_NC002163-112166-112647_ | TGCCCTTTCTAAAAGTCTTGAGTGAAGATA | 1220 | |
| 141_F | 196_225_R | ||||||
| 2584 | UNCA_NC002163-112166-112647_3_ | TGCTTCGGATCCAGCAGCACTTCAATA | 532 | UNCA_NC002163-112166-112647_88_ | TGCATGCTTACTCAAATCATCATAAACAATT | 1206 | |
| 29_F | 123_R | AAAGC | |||||
| 2585 | ASPA_NC002163-96692-97166_308_ | TTAATTTGCCAAAAATGCAACCAGGTAG | 652 | ASPA_NC002163-96692-97166_403_ | TGCAAAAGTAACGGTTACATCTGCTCCAAT | 1192 | |
| 335_F | 432_R | ||||||
| 2586 | ASPA_NC002163-96692-97166_228_ | TCGCGTTGCAACAAAACTTTCTAAAGTATGT | 370 | ASPA_NC002163-96692-97166_316_ | TCATGATAGAACTACCTGGTTGCATTTTTGG | 991 | |
| 258_F | 346_R | ||||||
| 2587 | GLNA_NC002163-658085-657609_244_ | TGGAATGATGATAAAGATTTCGCAGATAGCT | 547 | GLNA_NC002163-658085-657609_ | TGAGTTTGAACCATTTCAGAGCGAATATCTA | 1176 | |
| 275_F | A | 340_371_R | C | ||||
| 2588 | TKT_NC002163-1569415-1569903_ | TCGCTACAGGCCCTTTAGGACAAG | 371 | TKT_NC002163-1569415-1569903_ | TCCCCATCTCCGCAAAGACAATAAA | 1020 | |
| 107_130_F | 212_236_R | ||||||
| 2589 | TKT_NC002163-1569415-1569903_ | TGTTCTTTAGCAGGACTTCACAAACTTGATA | 642 | TKT_NC002163-1569415-1569903_ | TCCTTGTGCTTCAAAACGCATTTTTACATTT | 1057 | |
| 265_296_F | A | 361_393_R | TC | ||||
| 2590 | GLYA_NC002163-367572-368095_214_ | TGCCTATCTTTTTGCTGATATAGCACATATT | 505 | GLYA_NC002163-367572-368095_ | TCCTCTTGGGCCACGCAAAGTTTT | 1047 | |
| 246_F | GC | 317_340_R | |||||
| 2591 | GLYA_NC002163-367572-368095_415_ | TCCTTTGATGCATGTAATTGCTGCAAAAGC | 353 | GLYA_NC002163-367572-368095_ | TCTTGAGCATTGGTTCTTACTTGTTTTGCAT | 1141 | |
| 444_F | 485_516_R | A | |||||
| 2592 | PGM_NC0021632_21_54_F | TCCTAATGGACTTAATATCAATGAAAATTGT | 332 | PGM_NC002163_116_142_R | TCAAACGATCCGCATCACCATCAAAAG | 949 | |
| GGA | |||||||
| 2593 | PGM_NC00216_149_176_F | TAGATGAAAAAGGCGAAGTCGCTAATGG | 207 | PGM_NC002163_247_277_R | TCCCCTTTAAAGCACCATTACTCATTATAGT | 1023 | |
| 2594 | GLNA_NC002163-658085-657609_79_ | TGTCCAAGAAGCATAGCAAAAAAAGCAA | 633 | GLNA_NC002163-658085-657609_ | TCAAAAACAAAGAATTCATTTTCTGGTCCAA | 945 | |
| 106_F | 148_179_R | A | |||||
| 2595 | ASPA_NC002163-96685-97196_367_ | TCCTGTTATTCCTGAAGTAGTTAATCAAGTT | 347 | ASPA_NC002163-96685-97196_467_ | TCAAGCTATATGCTACAACTGGTTCAAAAAC | 960 | |
| 402_F | TGTTA | 497_R | |||||
| 2596 | ASPA_NC002163-96685-97196_1_33_F | TGCCGTAATGATAGGTGAAGATATACAAAGA | 502 | ASPA_NC002163-96685-97196_95_ | TACAACCTTCGGATAATCAGGATGAGAATTA | 880 | |
| GT | 127_R | AT | |||||
| 2597 | ASPA_NC002163-96685-97196_85_ | TGGAACAGGAATTAATTCTCATCCTGATTAT | 540 | ASPA_NC002163-96685-97196_185_ | TAAGCTCCCGTATCTTGAGTCGCCTC | 872 | |
| 117_F | CC | 210_R | |||||
| 2598 | PGM_NC002163-327746-328270_165_ | TGGCAGCTAGAATAGTAGCTAAAATCCCTAC | 563 | PGM_NC002163-327746-328270_ | TCACGATCTAAATTTGGATAAGCCATAGGAA | 975 | |
| 195_F | 230_261_R | A | |||||
| 2599 | PGM_NC002163-327746-328270_252_ | TGGGTCGTGGTTTTACAGAAAATTTCTTATA | 593 | PGM_NC002163-327746-328270_ | TTTTGCTCATGATCTGCATGAAGCATAAA | 1443 | |
| 286_F | TATG | 353_381_R | |||||
| 2600 | PGM_NC002163-327746-328270_1_ | TGGGATGAAAAAGCGTTCTTTTATCCATCA | 577 | PGM_NC002163-327746-328270_95_ | TGATAAAAAGCACTAAGCGATGAAACAGC | 1178 | |
| 30_F | 123_R | ||||||
| 2601 | PGM_NC002163-327746-328270_220_ | TAAACACGGCTTTCCTATGGCTTATCCAAAT | 146 | PGM_NC002163-327746-328270_314_ | TCAAGTGCTTTTACTTCTATAGGTTTAAGCT | 963 | |
| 250_F | 345_R | C | |||||
| 2602 | UNCA_NC002163-112166-112647_123_ | TGTAGCTTATCGCGAAATGTCTTTGATTTT | 628 | UNCA_NC002163-112166-112647_ | TGCTTGCTCTTTCAAGCAGTCTTGAATGAAG | 1258 | |
| 152_F | 199_229_R | ||||||
| 2603 | UNCA_NC002163-112166-112647_333_ | TCCAGATGGACAAATTTTCTTAGAAACTGAT | 313 | UNCA_NC002163-112166-112647_ | TCCGAAACTTGTTTTGTAGCTTTAATTTGAG | 1031 | |
| 365_F | TT | 430_461_R | C | ||||
| 2734 | GYRA_AY291534_237_264_F | TCACCCTCATGGTGATTCAGCTGTTTAT | 265 | GYRA_AY291534_268_288_R | TTGCGCCATACGTACCATCGT | 1407 | |
| 2735 | GYRA_AY291534_224_252_F | TAATCGGTAAGTATCACCCTCATGGTGAT | 167 | GYRA_AY291534_256_285_R | TGCCATACGTACCATCGTTTCATAAACAGC | 1213 | |
| 2736 | GYRA_AY291534_170_198_F | TAGCAATTACGGCTGATAAAGCGTATAAA | 221 | GYRA_AY291534_268_288_R | TTGCGCCATACGTACCATCGT | 1407 | |
| 2737 | GYRA_AY291534_224_252_F | TAATCGGTAAGTATCACCCTCATGGTGAT | 167 | GYRA_AY291534_319_346_R | TATCGACAGATCCAAAGTTACCATGCCC | 935 | |
| 2738 | GYRA_NC002953-7005-9668_166_195_ | TAAGGTATGACACCGGATAAATCATATAAA | 163 | GYRA_NC002953-7005-9668_265_ | TCTTGAGCCATACGTACCATTGC | 1142 | |
| F | 287_R | ||||||
| 2739 | GYRA_NC002953-7005-9668_221_249_ | TAATGGGTAAATATCACCCTCATGGTGAC | 171 | GYRA_NC002953-7005-9668_316_ | TATCCATTGAACCAAAGTTACCTTGGCC | 933 | |
| F | 343_R | ||||||
| 2740 | GYRA_NC002953-7005-9668_221_249_ | TAATGGGTAAATATCACCCTCATGGTGAC | 171 | GYRA_NC002953-7005-9668_253_ | TAGCCATACGTACCATTGCTTCATAAATAGA | 912 | |
| F | 283_R | ||||||
| 2741 | GYRA_NC002953-7005-9668_234_261_ | TCACCCTCATGGTGACTCATCTATTTAT | 264 | GYRA_NC002953-7005-9668_265_ | TCTTGAGCCATACGTACCATTGC | 1142 | |
| F | 287_R | ||||||
| 2842 | CAPC_AF188935-56074-55628_271_ | TGGGATTATTGTTATCCTGTTATGCCATTTG | 578 | CAPC_AF188935-56074-55628_348_ | TGGTAACCCTTGTCTTTGAATTGTATTTGCA | 1299 | |
| 304_F | AGA | 378_R | |||||
| 2843 | CAPC_AF188935-56074-55628_273_ | TGATTATTGTTATCCTGTTATGCpCpATpTp | 476 | CAPC_AF188935-56074-55628_349_ | TGTAACCCTTGTCTTTGAATpTpGTATpTpT | 1314 | |
| 303P_F | TpGAG | 377P_R | pGC | ||||
| 2844 | CAPC_AF188935-56074-55628_268_ | TCCGTTGATTATTGTTATCCTGTTATGCCAT | 331 | CAPC_AF188935-56074-55628_349_ | TGTTAATGGTAACCCTTGTCTTTGAATTGTA | 1344 | |
| 303_F | TTGAG | 384_R | TTTGC | ||||
| 2845 | CAPC_AF188935-56074-55628_268_ | TCCGTTGATTATTGTTATCCTGTTATGCCAT | 331 | CAPC_AF188935-56074-55628_337_ | TAACCCTTGTCTTTGAATTGTATTTGCAATT | 860 | |
| 303_F | TTGAG | 375_R | AATCCTGG | ||||
| 2846 | PARC_X95819_33_58_F | TCCAAAAAAATCAGCGCGTACAGTGG | 302 | PARC_X95819_121_153_R | TAAAGGATAGCGGTAACTAAATGGCTGAGCC | 852 | |
| AT | |||||||
| 2847 | PARC_X95819_65_92_F | TACTTGGTAAATACCACCCACATGGTGA | 199 | PARC_X95819_157_178_R | TACCCCAGTTCCCCTGACCTTC | 889 | |
| 2848 | PARC_X95819_69_93_F | TGGTAAATACCACCCACATGGTGAC | 596 | PARC_X95819_97_128_R | TGAGCCATGAGTACCATGGCTTCATAACATG | 1169 | |
| C | |||||||
| 2849 | PARC_NC003997-3362578-3365001_ | TTCCGTARGTCGGCTAAAACAGTCG | 668 | PARC_NC003997-3362578-3365001_ | TCCAAGTTTGACTTAAACGTACCATCGC | 1001 | |
| 181_205_F | 256_283_R | ||||||
| 2850 | PARC_NC003997-3362578-3365001_ | TGTAACTATCACCCGCACGGTGAT | 621 | PARC_NC003997-3362578-3365001_ | TCGTCAACACTACCATTATTACCATGCATCT | 1099 | |
| 217_240_F | 304_335_R | C | |||||
| 2851 | PARC_NC003997-3362578-3365001_ | TGTAACTATCACCCGCACGGTGAT | 621 | PARC_NC003997-3362578-3365001_ | TGACTTAAACGTACCATCGCTTCATATACAG | 1162 | |
| 217_240_F | 244_275_R | A | |||||
| 2852 | GYRA_AY642140_1_24_F | TAAATCTGCCCGTGTCGTTGGTGAC | 150 | GYRA_AY642140_71_100_R | TGCTAAAGTCTTGAGCCATACGAACAATGG | 1242 | |
| 2853 | GYRA_AY6421402_26_54_F | TAATCGGTAAATATCACCCGCATGGTGAC | 166 | GYRA_AY642140_121_146_R | TCGATCGAACCGAAGTTACCCTGACC | 1069 | |
| 2854 | GYRA_AY6421402_26_54_F | TAATCGGTAAATATCACCCGCATGGTGAC | 166 | GYRA_AY642140_58_89_R | TGAGCCATACGAACAATGGTTTCATAAACAG | 1168 | |
| C | |||||||
| 2860 | CYA_AF065404_1348_1379_F | TCCARCGARGTACAATACAAGACAAAAGAAG | 305 | CYA_AF065404_1448_1472_R | TCAGCTGTTAACGGCTTCAAGACCC | 983 | |
| G | |||||||
| 2861 | LEF_BA_AF065404_751_781_F | TCGAAAGCTTTTGCATATTATATCGAGCCAC | 354 | LEF_BA_AF065404_843_881_R | TCTTTAAGTTCTTCCAAGGATAGATTTATTT | 1144 | |
| CTTGTTCG | |||||||
| 2862 | LEF_BA_AF065404_762_788_F | TGCATATTATATCGAGCCACAGCATCG | 498 | LEF_BA_AF065404_843_881_R | TCTTTAAGTTCTTCCAAGGATAGATTTATTT | 1144 | |
| CTTGTTCG | |||||||
| 2917 | MUTS_AY698802_106_125_F | TCCGCTGAATCTGTCGCCGC | 326 | MUTS_AY698802_172_193_R | TGCGGTCTGGCGCATATAGGTA | 1237 | |
| 2918 | MUTS_AY698802_172_192_F | TACCTATATGCGCCAGACCGC | 187 | MUTS_AY698802_228_252_R | TCAATCTCGACTTTTTGTGCCGGTA | 965 | |
| 2919 | MUTS_AY698802_228_252_F | TACCGGCGCAAAAAGTCGAGATTGG | 186 | MUTS_AY698802_314_342_R | TCGGTTTCAGTCATCTCCACCATAAAGGT | 1097 | |
| 2920 | MUTS_AY698802_315_342_F | TCTTTATGGTGGAGATGACTGAAACCGA | 419 | MUTS_AY698802_413_433_R | TGCCAGCGACAGACCATCGTA | 1210 | |
| 2921 | MUTS_AY698802_394_411_F | TGGGCGTGGAACGTCCAC | 585 | MUTS_AY698802_497_519_R | TCCGGTAACTGGGTCAGCTCGAA | 1040 | |
| 2922 | AB_MLST-11-OIF007_991_1018_F | TGGGcGATGCTGCgAAATGGTTAAAAGA | 583 | AB_MLST-11-OIF007_1110_1137_R | TAGTATCACCACGTACACCCGGATCAGT | 923 | |
| 2927 | GAPA_NC002505_694_721_F | TCAATGAACGACCAACAAGTGATTGATG | 259 | GAPA_NC_002505_29_58_R_1 | TCCTTTATGCAACTTGGTATCAACAGGAAT | 1060 | |
| 2928 | GAPA_NC002505_694_721_2_F | TCGATGAACGACCAACAAGTGATTGATG | 361 | GAPA_NC002505_769_798_2_R | TCCTTTATGCAACTTGGTATCAACCGGAAT | 1061 | |
| 2929 | GAPA_NC002505_694_721_2_F | TCGATGAACGACCAACARGTGATTGATG | 361 | GAPA_NC002505_769_798_3_R | TCCTTTATGCAACTTAGTATCAACCGGAAT | 1059 | |
| 2932 | INFB_EC_1364_1394_F | TTGCTCCTCCTGCACAAGTAACGGATATTAC | 688 | INFB_EC_1439_1468_R | TTGCTCCTTTCCCATGGTTAATCGCTTCAA | 1410 | |
| 2933 | INFB_EC_1364_1394_2_F | TTGCTCGTGGTGCAIAAGTAACCCATATIAC | 689 | INFB_EC_1439_1468_R | TTGCTGCTTTCGCATGGTTAATCCCTTCAA | 1410 | |
| 2934 | INFB_EC_80_110_F | TTGCCCCCCGTCCGGAAGTAACCGATATTAC | 685 | INFB_EC_1439_1468_R | TTGCTGCTTTCCCATGGTTAATCCCTTCAA | 1410 | |
| 2949 | ACS_NC002516-970624-971013_299_ | TCGGCGCCTCCCTCATCA | 376 | ACS_NC002516-970624-971013_364_ | TGGACCACGCCGAAGAACCC | 1265 | |
| 316_F | 383_R | ||||||
| 2950 | ARC_NC002516-26883-27380_4_26_F | TCACCGTCCCCTTCAAGGAAGAG | 267 | ARO_NC002516-26883-27380_111_ | TCTCTTGTCGCCGCCCAC | 1341 | |
| 128_R | |||||||
| 2951 | ARC_NC002516-26883-27380_356_ | TTTCGAAGGGCCTTTCGACCTG | 705 | ARO_NC002516-26883-27380_459_ | TCCTTGGCATACATCATGTCCTACCA | 1056 | |
| 377_F | 484_R | ||||||
| 2952 | GUA_NC002516-4226546-4226174_23_ | TGGACTCCTCGGTGGTCGC | 551 | GUA_NC002516-4226546-4226174_ | TCGGCGAACATCGCCATCAC | 1091 | |
| 41_F | 127_146_R | ||||||
| 2953 | GUA_NC002516-4226546-4226174_ | TCACCAGGTGATGGCCATCTTCG | 448 | GUA_NC002516-4226546-4226174_ | TGCTTCTCTTCCGGGTCCGC | 1256 | |
| 120_142_F | 214_233_R | ||||||
| 2954 | GUA_NC002516-4226546-4226174_ | TTTTGAACCTCATCCGTGCCAACC | 710 | GUA_NC002516-4226546-4226174_ | TGCTTCCTGGCTTCTTCCTCGAA | 1259 | |
| 155_178_F | 265_287_R | ||||||
| 2955 | GCU_NC002516-4226546-4226174_ | TTCCTCCCCCGCCTGGC | 670 | GUA_NC002516-4226546-4226174_ | TCCCACGAACTTCACGTCCTGC | 1229 | |
| 190_206_F | 288_309_R | ||||||
| 2956 | GUA_NC002516-4226546-4226174_ | TCGGCCGCACCTTCATCGAAGT | 374 | GUA_NC002516-4226546-4226174_ | TCGTGGGCCTTCCCGGT | 1111 | |
| 242_263_F | 355_371_R | ||||||
| 2957 | MUT_NC002516-5551158-5550717_5_ | TGCAACTCATCAAGCGCCTCCC | 545 | MUT_NC002516-5551158-5550717_ | TCACGGGCCAGCTCGTCT | 978 | |
| 26_F | 99_116_R | ||||||
| 2958 | MUT_NC002516-5551158-5550717_ | TCGAGCAGGCCCTCCCG | 358 | MUT_NC002516-5551158-5550717_ | TCACCATGCGCCCGTTCACATA | 971 | |
| 152_168_F | 256_277_R | ||||||
| 2959 | NUO_NC002516-2984589-2984954_8_ | TCAACCTCGGCCCGAACCA | 249 | NUO_NC002516-2984589-2984954_ | TCCGTGGTGGTACCCGATCTC | 1095 | |
| 26_F | 97_117_R | ||||||
| 2960 | NUO_NC002516-2984589-2984954_ | TACTCTCCCTGGAGAACCTCGC | 195 | NUO_NC002516-2984589-2984954_ | TTCAGGTACAGCAGGTGGTTCAGGAT | 1376 | |
| 218_239_F | 301_326_R | ||||||
| 2961 | PPS_NC002516-1915014-1915383_44_ | TCCACGGTCATGGAGCGCTA | 311 | PPS_NC002516-1915014-1915383_ | TCCATTTCCGACACGTCGTTGATCAC | 1014 | |
| 63_F | 140_165_R | ||||||
| 2962 | PPS_NC002516-1915014-1915383_ | TCGCCATCGTCACCAACCG | 365 | PBS_NC002516-1915014-1915383_ | TCCTCGCCATCCTGCAGGAT | 1052 | |
| 240_258_F | 341_360_R | ||||||
| 2963 | TRP_NC002516-671831-672273_24_ | TGCTCGTACGGGTCGAGGA | 527 | TRP_NC002516-671831-672273_131_ | TCGATCTCCTTGGCCTCCGA | 1071 | |
| 42_F | 150_R | ||||||
| 2964 | TRP_NC002516-671831-672273_261_ | TGCACATCGTGTCCAACGTCAC | 490 | TRP_NC002516-671831-672273_362_ | TGATCTCCATGGCGCGGATCTT | 1182 | |
| 282_F | 383_R | ||||||
| 2972 | AB_MLST-11-OIF007_1007_1034_F | TGGGIGATGCTGCIAAATGGTTAAAAGA | 592 | AB_MLST-11-OIF007_1126_1153_R | TAGTATCACCACGTACICCIGGATCAGT | 924 | |
| 2993 | OMPU_NC002505-674828-675880_428_ | TTCCCACCGATATCATGGCTTACCACGG | 667 | OMPU_NC002505_544_567_R | TCGGTCAGCAAAACGGTAGCTTGC | 1094 | |
| 455_F | |||||||
| 2994 | GAPA_NC002505-506780-507937_691_ | TCCTCAATGAACGAICAACAAGTGATTGATG | 335 | GAPA_NC002505-506780-507937_ | TTTTCCCTTTATGCAACTTAGTATCAACIGG | 1442 | |
| 721_F | 769_802_R | AAT | |||||
| 2995 | GAPA_NC002505-506780-507937_691_ | TCCTCIATGAACGAICAACAAGTGATTGATG | 339 | GAPA_NC002505-506780-507937_ | TCCATACCTTTATGCAACTTIGTATCAACIG | 1008 | |
| 721_2_F | 769_803_R | GAAT | |||||
| 2996 | GAPA_NC002505-506780-507937_691_ | TCTCGATGAACGACCAACAAGTGATTGATG | 396 | GAPA_NC002505-506780-507937_ | TCGGAAATATTCTTTCAATACCTTTATGCAA | 1085 | |
| 721_F | 785_817_R | CT | |||||
| 2997 | GAPA_NC002505-506780-507937_691_ | TCCTCGATGAACGAICAACAAGTIATTGATG | 337 | GAPA_NC002505-506780-507937_ | TCGGAAATATTCTTTCAATACCTTTATGCAA | 1085 | |
| 721_3_F | 785_817_R | CT | |||||
| 2998 | GAPA_NC002505-506780-507937_691_ | TCCTCAATGAATGATCAACAAGTGATTGATG | 336 | GAPA_NC002505-506780-507937_ | TCGGAAATATTCTTTCAATICCTTTITGCAA | 1087 | |
| 721_4_F | 784_817_R | CTT | |||||
| 2999 | GAPA_NC002505-506780-507937_691_ | TCCTCIATGAAIGAICAACAAGTIATTGATG | 340 | GAPA_NC002505-506780-507937_ | TCGGAAATATTCTTTCAATACCTTTATGCAA | 1086 | |
| 721_5_F | 784_817_2_R | CTT | |||||
| 3000 | GAPA_NC002505-506780-507937_691_ | TCCTCGATGAATGAICAACAAGTIATTGATG | 338 | GAPA_NC002505-506780-507937_ | TTTCAATACCTTTATGCAACTTIGTATCAAC | 1430 | |
| 721_6_F | 769_805_R | IGGAAT | |||||
| 3001 | CTXB_NC002505-1566967-1567341_ | TCAGCATATGCACATGGAACACCTCA | 275 | CTXB_NC002505-1566967-1567341_ | TCCCGGCTAGAGATTCTGTATACGA | 1026 | |
| 46_71_F | 139_163_R | ||||||
| 3002 | CTXB_NC002505-1566967-1567341_ | TCAGCATATGCACATGGAACACCTC | 274 | CTXB_NC002505-1566967-1567341_ | TCCGGCTAGAGATTCTGTATACGAAAATATC | 1038 | |
| 46_70_F | 132_162_R | ||||||
| 3003 | CTXB_NC002505-1566967-1567341_ | TCAGCATATGCACATGGAACACCTC | 274 | CTXB_NC002505-1566967-1567341_ | TGCCGTATACGAAAATATCTTATCATTTAGC | 1225 | |
| 46_70_F | 118_150_R | GT | |||||
| 3004 | TUFB_NC002758-615038-616222_ | TACAGGCCGTGTTGAACGTGG | 180 | TUFB_NC002758-615038-616222_ | TCAGCGTAGTCTAATAATTTACGGAACATTT | 982 | |
| 684_704_F | 778_809_R | C | |||||
| 3005 | TUFB_NC002758-615038-616222_688_ | TGCCGTGTTGAACGTGGTCAAAT | 503 | TUFB_NC002758-615038-616222_ | TGCTTCAGCGTAGTCTAATAATTTACGGAAC | 1255 | |
| 710_F | 783_813_R | ||||||
| 3006 | TUFB_NC002758-615038-616222_700_ | TGTGGTCAAATCAAAGTTGGTGAAGAA | 638 | TUFB_NC002758-615038-616222_ | TGCGTAGTCTAATAATTTACGGAACATTTC | 1238 | |
| 726_F | 778_807_R | ||||||
| 3007 | TUFB_NC002758-615038-616222_702_ | TGGTCAAATCAAAGTTGGTGAAGAA | 607 | TUFB_NC002758-615038-616222_ | TGCGTAGTCTAATAATTTACGGAACATTTC | 1238 | |
| 726_F | 778_807_R | ||||||
| 3008 | TUFB_NC002758-615038-616222_686_ | TGAACGTGGTCAAATCAAAGTTGGTGAAGAA | 431 | TUFB_NC002758-615038-616222_ | TCACCAGCTTCAGCGTAGTCTAATAATTTAC | 970 | |
| 726_F | 785_818_R | GGA | |||||
| 3009 | TUFB_NC002758-615038-616222_690_ | TCGTGTTGAACGTGGTCAAATCAAAGT | 386 | TUFB_NC002758-615038-616222_ | TCTTCAGCGTAGTCTAATAATTTACGGAACA | 1134 | |
| 716_F | 778_812_R | TTTC | |||||
| 3010 | MECI-R_NC003923-41798-41609_36_ | TCACATATCGTGAGCAATGAACTG | 261 | MECI-R_NC003923-41798-41609_89_ | TGTGATATGGAGGTGTAGAAGGTG | 1332 | |
| 59_F | 112_R | ||||||
| 3011 | MECI-R_NC003923-41798-41609_40_ | TGGGCGTGAGCAATGAACTGATTATAC | 584 | MECI-R_NC003923-41798-41609_81_ | TGGGATGGAGGTGTAGAAGGTGTTATCATC | 1287 | |
| 66_F | 110_R | ||||||
| 3012 | MECI-R_NC003923-41798-41609_33_ | TGGACACATATCGTGAGCAATGAACTGA | 549 | MECI-R_NC003923-41798-41609_81_ | TGGGATGGAGGTGTAGAAGGTGTTATCATC | 1286 | |
| 60_2_F | 110_R | ||||||
| 3013 | MECI-R_NC003923-41798-41609_29_ | TGGGTTTACACATATCGTGAGCAATGAACTG | 595 | MECI-R_NC003923-41798-41609_81_ | TGGGGATATGGAGGTGTAGAAGGTGTTATCA | 1290 | |
| 60_F | A | 113_R | TC | ||||
| 3014 | MUPR_X75439_2490_2514_F | TGGGCTCTTTCTCGCTTAAACACCT | 587 | MUPR_X75439_2548_2570_R | TCTGGCTGCGGAAGTGAAATCGT | 1130 | |
| 3015 | MUPR_X75439_2490_2513_F | TGGGCTCTTTCTCGCTTAAACACC | 586 | MUPR_X75439_2547_2568_R | TGGCTGCGGAAGTGAAATCGTA | 1281 | |
| 3016 | MUPR_X75439_2482_2510_F | TAGATAATTGGGCTCTTTCTCGCTTAAAC | 205 | MUPR_X75439_2551_2573_R | TAATCTGGCTGCGGAAGTGAAAT | 876 | |
| 3017 | MUPR_X75439_2490_2514_F | TGGGCTCTTTCTCGCTTAAACACCT | 587 | MUPR_X75439_2549_2573_R | TAATCTGGCTGCGGAAGTGAAATCG | 877 | |
| 3018 | MUPR_X75439_2482_2510_F | TAGATAATTGGGCTCTTTCTCGCTTAAAC | 205 | MUPR_X75439_2559_2589_R | TGGTATATTCGTTAATTAATCTGGCTGCGGA | 1303 | |
| 3019 | MUPR_X75439_2490_2514_F | TGGGCTCTTTCTCGCTTAAACACCT | 587 | MUPR_X75439_2554_2581_R | TCGTTAATTAATCTGGCTGCGGAAGTGA | 1112 | |
| 3020 | AROE_NC003923-1674726-1674277_ | TGATGGCAAGTGGATAGGGTATAATACAG | 474 | AROE_NC003923-1674726-1674277_ | TAAGCAATACCTTTACTTGCACCACCT | 868 | |
| 204_232_F | 309_335_R | ||||||
| 3021 | AROE_NC003923-1674726-1674277_ | TGGCGAGTGGATAGGGTATAATACAG | 570 | AROE_NC003923-1674726-1674277_ | TTCATAAGCAATACCTTTACTTGCACCAC | 1378 | |
| 207_232_F | 311_339_R | ||||||
| 3022 | AROE_NC003923-1674726-1674277_ | TGGCpAAGTpGGATpAGGGTpATpAATpACp | 572 | AROE_NC003923-1674726-1674277_ | TAAGCAATACCpTpTpTpACTpTpGCpACpC | 867 | |
| 207_232P_F | AG | 311_335P_R | pAC | ||||
| 3023 | ARCC_NC003923-2725050-2724595_ | TCTGAAATGAATAGTGATAGAACTGTAGGCA | 398 | ARCC_NC003923-2725050-2724595_ | TCTTCTTCTTTCGTATAAAAAGGACCAATTG | 1137 | |
| 124_155_F | C | 214_245_R | G | ||||
| 3024 | ARCC_NC003923-2725050-2724595_ | TGAATAGTGATAGAACTGTAGGCACAATCGT | 437 | ARCC_NC003923-2725050-2724595_ | TCTTCTTTCGTATAAAAAGGACCAATTGGTT | 1139 | |
| 131_161_F | 212_242_R | ||||||
| 3025 | ARCC_NC003923-2725050-2724595_ | TGAATAGTGATAGAACTGTAGGCACAATCGT | 437 | ARCC_NC003923-2725050-2724595_ | TGCGCTAATTCTTCAACTTCTTCTTTCGT | 1232 | |
| 131_161_F | 232_260_R | ||||||
| 3026 | PTA_NC003923-628885-629355_231_ | TACAATGCTTGTTTATGCTGGTAAAGCAG | 177 | PTA_NC003923-628885-629355_322_ | TGTTCTTGATACACCTGGTTTCGTTTTGAT | 1350 | |
| 259_F | 351_R | ||||||
| 3027 | PTA_NC003923-628885-629355_231_ | TACAATGCTTGTTTATGCTGGTAAAGCAG | 177 | PTA_NC003923-628885-629355_314_ | TGGTACACCTGGTTTCGTTTTGATGATTTGT | 1301 | |
| 259_F | 345_R | A | |||||
| 3028 | PTA_NC003923-628885-629355_237_ | TCTTGTTTATGCTGGTAAAGCAGATGG | 418 | PTA_NC003923-628885-629355_322_ | TGTTCTTGATACACCTGGTTTCGTTTTGAT | 1350 | |
| 263_F | 351_R | ||||||
Primer pair name codes and reference sequences are shown in Table 3. The primer name code typically represents the gene to which the given primer pair is targeted. The primer pair name may include specific coordinates with respect to a reference sequence defined by an extraction of a section of sequence or defined by a GenBank gi number, or the corresponding complementary sequence of the extraction, or the entire GenBank gi number as indicated by the label “no extraction.” Where “no extraction” is indicated for a reference sequence, the coordinates of a primer pair named to the reference sequence are with respect to the GenBank gi listing. Gene abbreviations are shown in bold type in the “Gene Name” column.
To determine the exact primer hybridization coordinates of a given pair of primers on a given bioagent nucleic acid sequence and to determine the sequences, molecular masses and base compositions of an amplification product to be obtained upon amplification of nucleic acid of a known bioagent with known sequence information in the region of interest with a given pair of primers, one with ordinary skill in bioinformatics is capable of obtaining alignments of the primers of the present invention with the GenBank gi number of the relevant nucleic acid sequence of the known bioagent. For example, the reference sequence GenBank gi numbers (Table 3) provide the identities of the sequences which can be obtained from GenBank. Alignments can be done using a bioinformatics tool such as BLASTn provided to the public by NCBI (Bethesda, Md.). Alternatively, a relevant GenBank sequence may be downloaded and imported into custom programmed or commercially available bioinformatics programs wherein the alignment can be carried out to determine the primer hybridization coordinates and the sequences, molecular masses and base compositions of the amplification product. For example, to obtain the hybridization coordinates of primer pair number 2095 (SEQ ID NOs: 456:1261), First the forward primer (SEQ ID NO: 456) is subjected to a BLASTn search on the publicly available NCBI BLAST website. “RefSeq_Genomic” is chosen as the BLAST database since the gi numbers refer to genomic sequences. The BLAST query is then performed. Among the top results returned is a match to GenBank gi number 21281729 (Accession Number NC—003923). The result shown below, indicates that the forward primer hybridizes to positions 1530282.1530307 of the genomic sequence of Staphylococcus aureus subsp. aureus MW2 (represented by gi number 21281729).
| Staphylococcus aureus subsp. aureus MW2, complete | |
| genome | |
| Length = 2820462 | |
| Features in this part of subject sequence: | |
| Panton-Valentine leukocidin chain F precursor | |
| Score = 52.0 bits (26), Expect = 2e−05 | |
| Identities = 26/26 (100%), Gaps = 0/26 (0%) | |
| Strand = Plus/Plus | |
| Query | 1 | TGAGCTGCATCAACTGTATTGGATAG | 26 | |
| |||||||||||||||||||||||||| | ||||
| Sbjct | 1530282 | TGAGCTGCATCAACTGTATTGGATAG | 1530307 |
The hybridization coordinates of the reverse primer (SEQ ID NO: 1261) can be determined in a similar manner and thus, the bioagent identifying amplicon can be defined in terms of genomic coordinates. The query/subject arrangement of the result would be presented in Strand=Plus/Minus format because the reverse strand hybridizes to the reverse complement of the genomic sequence. HThe preceding sequence analyses are well known to one with ordinary skill in bioinformatics and thus, Table 3 contains sufficient information to determine the primer hybridization coordinates of any of the primers of Table 2 to the applicable reference sequences described therein.
| TABLE 3 |
| Primer Name Codes and Reference Sequence |
| Reference | |||
| GenBank gi | |||
| Primer name code | Gene Name | Organism | number |
| 16S_EC | 16S rRNA (16S ribosomal RNA gene) | Escherichia coli | 16127994 |
| 23S_EC | 23S rRNA (23S ribosomal RNA gene) | Escherichia coli | 16127994 |
| CAPC_BA | capC (capsule biosynthesis gene) | Bacillus anthracis | 6470151 |
| CYA_BA | cya (cyclic AMP gene) | Bacillus anthracis | 4894216 |
| DNAK_EC | dnaK (chaperone dnaK gene) | Escherichia coli | 16127994 |
| GROL_EC | groL (chaperonin groL) | Escherichia coli | 16127994 |
| HFLB_EC | hflb (cell division protein peptidase | Escherichia coli | 16127994 |
| ftsH) | |||
| INFB_EC | infB (protein chain initiation factor | Escherichia coli | 16127994 |
| infB gene) | |||
| LEF_BA | lef (lethal factor) | Bacillus anthracis | 21392688 |
| PAG_BA | pag (protective antigen) | Bacillus anthracis | 21392688 |
| RPLB_EC | rplB (50S ribosomal protein L2) | Escherichia coli | 16127994 |
| RPOB_EC | rpoB (DNA-directed RNA polymerase beta | Escherichia coli | 6127994 |
| chain) | |||
| RPOC_EC | rpoC (DNA-directed RNA polymerase | Escherichia coli | 16127994 |
| beta′ chain) | |||
| SP101ET_SPET_11 | Artificial Sequence Concatenation | Artificial | 15674250 |
| comprising: | Sequence* - | ||
| gki (glucose kinase) | partial gene | ||
| gtr (glutamine transporter protein) | sequences of | ||
| murI (glutamate racemase) | Streptococcus | ||
| mutS (DNA mismatch repair protein) | pyogenes | ||
| xpt (xanthine phosphoribosyl | |||
| transferase) | |||
| yqiL (acetyl-CoA-acetyl transferase) | |||
| tkt (transketolase) | |||
| SSPE_BA | sspE (small acid-soluble spore | Bacillus anthracis | 30253828 |
| protein) | |||
| TUFB_EC | tufB (Elongation factor Tu) | Escherichia coli | 16127994 |
| VALS_EC | valS (Valyl-tRNA synthetase) | Escherichia coli | 16127994 |
| ASPS_EC | aspS (Aspartyl-tRNA synthetase) | Escherichia coli | 16127994 |
| CAF1_AF053947 | caf1 (capsular protein caf1) | Yersinia pestis | 2996286 |
| INV_U22457 | inv (invasin) | Yersinia pestis | 1256565 |
| LL_NC003143 | Y. pestis specific chromosomal genes - | Yersinia pestis | 16120353 |
| difference region | |||
| BONTA_X52066 | BoNT/A (neurotoxin type A) | Clostridium | 40381 |
| botulinum | |||
| MECA_Y14051 | mecA methicillin resistance gene | Staphylococcus | 2791983 |
| aureus | |||
| TRPE_AY094355 | trpE (anthranilate synthase (large | Acinetobacter | 20853695 |
| component)) | baumanii | ||
| RECA_AF251469 | recA (recombinase A) | Acinetobacter | 9965210 |
| baumanii | |||
| GYRA_AF100557 | gyrA (DNA gyrase subunit A) | Acinetobacter | 4240540 |
| baumanii | |||
| GYRB_AB008700 | gyrB (DNA gyrase subunit B) | Acinetobacter | 4514436 |
| baumanii | |||
| WAAA_Z96925 | waaA (3-deoxy-D-manno-octulosonic-acid | Acinetobacter | 2765828 |
| transferase) | baumanii | ||
| CJST_CJ | Artificial Sequence Concatenation | Artificial | 15791399 |
| comprising: | Sequence* - | ||
| tkt (transketolase) | partial gene | ||
| glyA (serine hydroxymethyltransferase) | sequences of | ||
| gltA (citrate synthase) | Campylobacter | ||
| aspA (aspartate ammonia lyase) | jejuni | ||
| glnA (glutamine synthase) | |||
| pgm (phosphoglycerate mutase) | |||
| uncA (ATP synthetase alpha chain) | |||
| RNASEP_BDP | RNase P (ribonuclease P) | Bordetella | 33591275 |
| pertussis | |||
| RNASEP_BKM | RNase P (ribonuclease P) | Burkholderia | 53723370 |
| mallei | |||
| RNASEP_BS | RNase P (ribonuclease P) | Bacillus subtilis | 16077068 |
| RNASEP_CLB | RNase P (ribonuclease P) | Clostridium | 18308982 |
| perfringens | |||
| RNASEP_EC | RNase P (ribonuclease P) | Escherichia coli | 16127994 |
| RNASEP_RKP | RNase P (ribonuclease P) | Rickettsia | 15603881 |
| prowazekii | |||
| RNASEP_SA | RNase P (ribonuclease P) | Staphylococcus | 15922990 |
| aureus | |||
| RNASEP_VBC | RNase P (ribonuclease P) | Vibrio cholerae | 15640032 |
| ICD_CXB | icd (isocitrate dehydrogenase) | Coxiella burnetii | 29732244 |
| IS1111A | multi-locus IS1111A insertion element | Acinetobacter | 29732244 |
| baumannii | |||
| OMPA_AY485227 | ompA (outer membrane protein A) | Rickettsia | 40287451 |
| prowazekii | |||
| OMPB_RKP | ompB (outer membrane protein B) | Rickettsia | 15603881 |
| prowazekii | |||
| GLTA_RKP | gltA (citrate synthase) | Vibrio cholerae | 15603881 |
| TOXR_VBC | toxR (transcription regulator toxR) | Francisella | 15640032 |
| tularensis | |||
| ASD_FRT | asd (Aspartate semialdehyde | Francisella | 56707187 |
| dehydrogenase) | tularensis | ||
| GALE_FRT | galE (UDP-glucose 4-epimerase) | Shigella flexneri | 56707187 |
| IPAH_SGF | ipaH (invasion plasmid antigen) | Campylobacter | 30061571 |
| jejuni | |||
| HUPB_CJ | hupB (DNA-binding protein Hu-beta) | Coxiella burnetii | 15791399 |
| AB_MLST | Artificial Sequence Concatenation | Artificial | Sequenced |
| comprising: | Sequence* - | in-house | |
| trpE (anthranilate synthase component | partial gene | (SEQ ID | |
| I)) | sequences of | NO: 1444) | |
| adk (adenylate kinase) | Acinetobacter | ||
| mutY (adenine glycosylase) | baumannii | ||
| fumC (fumarate hydratase) | |||
| efp (elongation factor p) | |||
| ppa (pyrophosphate phospho- | |||
| hydratase | |||
| MUPR_X75439 | mupR (mupriocin resistance gene) | Staphylococcus | 438226 |
| aureus | |||
| PARC_X95819 | parC (topoisomerase IV) | Acinetobacter | 1212748 |
| baumannii | |||
| SED_M28521 | sed (enterotoxin D) | Staphylococcus | 1492109 |
| aureus | |||
| PLA_AF053945 | pla (plasminogen activator) | Yersinia pestis | 2996216 |
| SEJ_AF053140 | sej (enterotoxin J) | Staphylococcus | 3372540 |
| aureus | |||
| GYRA_NC000912 | gyrA (DNA gyrase subunit A) | Mycoplasma | 13507739 |
| pneumoniae | |||
| ACS_NC002516 | acsA (Acetyl CoA Synthase) | Pseudomonas | 15595198 |
| aeruginosa | |||
| ARO_NC002516 | aroE (shikimate 5-dehydrogenase | Pseudomonas | 15595198 |
| aeruginosa | |||
| GUA_NC002516 | guaA (GMP synthase) | Pseudomonas | 15595198 |
| aeruginosa | |||
| MUT_NC002516 | mutL (DNA mismatch repair protein) | Pseudomonas | 15595198 |
| aeruginosa | |||
| NUO_NC002516 | nuoD (NADH dehydrogenase I chain C, D) | Pseudomonas | 15595198 |
| aeruginosa | |||
| PPS_NC002516 | ppsA (Phosphoenolpyruvate synthase) | Pseudomonas | 15595198 |
| aeruginosa | |||
| TRP_NC002516 | trpE (Anthranilate synthetase | Pseudomonas | 15595198 |
| component I) | aeruginosa | ||
| OMP2_NC000117 | ompB (outer membrane protein B) | Chlamydia | 15604717 |
| trachomatis | |||
| OMPA_NC000117 | ompA (outer membrane protein B) | Chlamydia | 15604717 |
| trachomatis | |||
| GYRA_NC000117 | gyrA (DNA gyrase subunit A) | Chlamydia | 15604717 |
| trachomatis | |||
| CTXA_NC002505 | ctxA (Cholera toxin A subunit) | Vibrio cholerae | 15640032 |
| CTXB_NC002505 | ctxB (Cholera toxin B subunit) | Vibrio cholerae | 15640032 |
| FUR_NC002505 | fur (ferric uptake regulator protein) | Vibrio cholerae | 15640032 |
| GAPA_NC_002505 | gapA (glyceraldehyde-3-phosphate | Vibrio cholerae | 15640032 |
| dehydrogenase) | |||
| GYRB_NC002505 | gyrB (DNA gyrase subunit B) | Vibrio cholerae | 15640032 |
| OMPU_NC002505 | ompU (outer membrane protein) | Vibrio cholerae | 15640032 |
| TCPA_NC002505 | tcpA (toxin-coregulated pilus) | Vibrio cholerae | 15640032 |
| ASPA_NC002163 | aspA (aspartate ammonia lyase) | Campylobacter | 15791399 |
| jejuni | |||
| GLNA_NC002163 | glnA (glutamine synthetase) | Campylobacter | 15791399 |
| jejuni | |||
| GLTA_NC002163 | gltA (glutamate synthase) | Campylobacter | 15791399 |
| jejuni | |||
| GLYA_NC002163 | glyA (serine hydroxymethyltransferase) | Campylobacter | 15791399 |
| jejuni | |||
| PGM_NC002163 | pgm (phosphoglyceromutase) | Campylobacter | 15791399 |
| jejuni | |||
| TKT_NC002163 | tkt (transketolase) | Campylobacter | 15791399 |
| jejuni | |||
| UNCA_NC002163 | uncA (ATP synthetase alpha chain) | Campylobacter | 15791399 |
| jejuni | |||
| AGR-III_NC003923 | agr-III (accessory gene regulator-III) | Staphylococcus | 21281729 |
| aureus | |||
| ARCC_NC003923 | arcC (carbamate kinase) | Staphylococcus | 21281729 |
| aureus | |||
| AROE_NC003923 | aroE (shikimate 5-dehydrogenase | Staphylococcus | 21281729 |
| aureus | |||
| BSA-A_NC003923 | bsa-a (glutathione peroxidase) | Staphylococcus | 21281729 |
| aureus | |||
| BSA-B_NC003923 | bsa-b (epidermin biosynthesis protein | Staphylococcus | 21281729 |
| EpiB) | aureus | ||
| GLPF_NC003923 | glpF (glycerol transporter) | Staphylococcus | 21281729 |
| aureus | |||
| GMK_NC003923 | gmk (guanylate kinase) | Staphylococcus | 21281729 |
| aureus | |||
| MECI-R_NC003923 | mecR1 (truncated methicillin | Staphylococcus | 21281729 |
| resistance protein) | aureus | ||
| PTA_NC003923 | pta (phosphate acetyltransferase) | Staphylococcus | 21281729 |
| aureus | |||
| PVLUK_NC003923 | pvluk (Panton-Valentine leukocidin | Staphylococcus | 21281729 |
| chain F precursor) | aureus | ||
| SA442_NC003923 | sa442 gene | Staphylococcus | 21281729 |
| aureus | |||
| SEA_NC003923 | sea (staphylococcal enterotoxin A | Staphylococcus | 21281729 |
| precursor) | aureus | ||
| SEC_NC003923 | sec4 (enterotoxin type C precursor) | Staphylococcus | 21281729 |
| aureus | |||
| TPI_NC003923 | tpi (triosephosphate isomerase) | Staphylococcus | 21281729 |
| aureus | |||
| YQI_NC003923 | yqi (acetyl-CoA C-acetyltransferase | Staphylococcus | 21281729 |
| homologue) | aureus | ||
| GALE_AF513299 | galE (galactose epimerase) | Francisella | 23506418 |
| tularensis | |||
| VVHA_NC004460 | vVhA (cytotoxin, cytolysin precursor) | Vibrio vulnificus | 27366463 |
| TDH_NC004605 | tdh (thermostable direct hemolysin A) | Vibrio | 28899855 |
| parahaemolyticus | |||
| AGR-II_NC002745 | agr-II (accessory gene regulator-II) | Staphylococcus | 29165615 |
| aureus | |||
| PARC_NC003997 | parC (topoisomerase IV) | Bacillus anthracis | 30260195 |
| GYRA_AY291534 | gyrA (DNA gyrase subunit A) | Bacillus anthracis | 31323274 |
| AGR-I_AJ617706 | agr-I (accessory gene regulator-I) | Staphylococcus | 46019543 |
| aureus | |||
| AGR-IV_AJ617711 | agr-IV (accessory gene regulator-III) | Staphylococcus | 46019563 |
| aureus | |||
| BLAZ_NC002952 | blaZ (beta lactamase III) | Staphylococcus | 49482253 |
| aureus | |||
| ERMA_NC002952 | ermA (rRNA methyltransferase A) | Staphylococcus | 49482253 |
| aureus | |||
| ERMB_Y13600 | ermB (rRNA methyltransferase B) | Staphylococcus | 49482253 |
| aureus | |||
| SEA-SEE_NC002952 | sea (staphylococcal enterotoxin A | Staphylococcus | 49482253 |
| precursor) | aureus | ||
| SEA-SEE_NC002952 | sea (staphylococcal enterotoxin A | Staphylococcus | 49482253 |
| precursor) | aureus | ||
| SEE_NC002952 | sea (staphylococcal enterotoxin A | Staphylococcus | 49482253 |
| precursor) | aureus | ||
| SEH_NC002953 | seh (staphylococcal enterotoxin H) | Staphylococcus | 49484912 |
| aureus | |||
| ERMC_NC005908 | ermC (rRNA methyltransferase C) | Staphylococcus | 49489772 |
| aureus | |||
| MUTS_AY698802 | mutS (DNA mismatch repair protein) | Shigella boydii | 52698233 |
| NUC_NC002758 | nuc (staphylococcal nuclease) | Staphylococcus | 57634611 |
| aureus | |||
| SEB_NC002758 | seb (enterotoxin type B precursor) | Staphylococcus | 57634611 |
| aureus | |||
| SEG_NC002758 | seg (staphylococcal enterotoxin G) | Staphylococcus | 57634611 |
| aureus | |||
| SEI_NC002758 | sei (staphylococcal enterotoxin I) | Staphylococcus | 57634611 |
| aureus | |||
| TSST_NC002758 | tsst (toxic shock syndrome toxin-1) | Staphylococcus | 57634611 |
| aureus | |||
| TUFB_NC002758 | tufB (Elongation factor Tu) | Staphylococcus | 57634611 |
| aureus | |||
Note: artificial reference sequences represent concatenations of partial gene extractions from the indicated reference gi number. Partial sequences were used to create the concatenated sequence because complete gene sequences were not necessary for primer design.
Example 2 Sample Preparation and PCRGenomic DNA was prepared from samples using the DNeasy Tissue Kit (Qiagen, Valencia, Calif.) according to the manufacturer's protocols.
All PCR reactions were assembled in 50 μL reaction volumes in a 96-well microtiter plate format using a Packard MPII liquid handling robotic platform and M. J. Dyad thermocyclers (MJ research, Waltham, Mass.) or Eppendorf Mastercycler thermocyclers (Eppendorf, Westbury, N.Y.). The PCR reaction mixture consisted of 4 units of Amplitaq Gold, 1× buffer II (Applied Biosystems, Foster City, Calif.), 1.5 mM MgCl2, 0.4 M betaine, 800 μl dNTP mixture and 250 nM of each primer. The following typical PCR conditions were used: 95° C. for 10 min followed by 8 cycles of 95° C. for 30 seconds, 48° C. for 30 seconds, and 72° C. 30 seconds with the 48° C. annealing temperature increasing 0.9° C. with each of the eight cycles. The PCR was then continued for 37 additional cycles of 95° C. for 15 seconds, 56° C. for 20 seconds, and 72° C. 20 seconds.
Example 3 Purification of PCR Products for Mass Spectrometry with Ion Exchange Resin-Magnetic BeadsFor solution capture of nucleic acids with ion exchange resin linked to magnetic beads, 25 μl of a 2.5 mg/mL suspension of BioClone amine terminated superparamagnetic beads were added to 25 to 50 μl of a PCR (or RT-PCR) reaction containing approximately 10 pM of a typical PCR amplification product. The above suspension was mixed for approximately 5 minutes by vortexing or pipetting, after which the liquid was removed after using a magnetic separator. The beads containing bound PCR amplification product were then washed three times with 50mM ammonium bicarbonate/50% MeOH or 100 mM ammonium bicarbonate/50% MeOH, followed by three more washes with 50% MeOH. The bound PCR amplicon was eluted with a solution of 25 mM piperidine, 25 mM imidazole, 35% MeOH which included peptide calibration standards.
Example 4 Mass Spectrometry and Base Composition AnalysisThe ESI-FTICR mass spectrometer is based on a Bruker Daltonics (Billerica, Mass.) Apex II 70e electrospray ionization Fourier transform ion cyclotron resonance mass spectrometer that employs an actively shielded 7 Tesla superconducting magnet. The active shielding constrains the majority of the fringing magnetic field from the superconducting magnet to a relatively small volume. Thus, components that might be adversely affected by stray magnetic fields, such as CRT monitors, robotic components, and other electronics, can operate in close proximity to the FTICR spectrometer. All aspects of pulse sequence control and data acquisition were performed on a 600 MHz Pentium II data station running Bruker's Xmass software under Windows NT 4.0 operating system. Sample aliquots, typically 15 μl, were extracted directly from 96-well microtiter plates using a CTC HTS PAL autosampler (LEAP Technologies, Carrboro, N.C.) triggered by the FTICR data station. Samples were injected directly into a 10 μl sample loop integrated with a fluidics handling system that supplies the 100 μl/hr flow rate to the ESI source. Ions were formed via electrospray ionization in a modified Analytica (Branford, Conn.) source employing an off axis, grounded electrospray probe positioned approximately 1.5 cm from the metalized terminus of a glass desolvation capillary. The atmospheric pressure end of the glass capillary was biased at 6000 V relative to the ESI needle during data acquisition. A counter-current flow of dry N2 was employed to assist in the desolvation process. Ions were accumulated in an external ion reservoir comprised of an rf-only hexapole, a skimmer cone, and an auxiliary gate electrode, prior to injection into the trapped ion cell where they were mass analyzed. Ionization duty cycles greater than 99% were achieved by simultaneously accumulating ions in the external ion reservoir during ion detection. Each detection event consisted of 1M data points digitized over 2.3 s. To improve the signal-to-noise ratio (S/N), 32 scans were co-added for a total data acquisition time of 74 s.
The ESI-TOF mass spectrometer is based on a Bruker Daltonics MicroTOF™. Ions from the ESI source undergo orthogonal ion extraction and are focused in a reflectron prior to detection. The TOF and FTICR are equipped with the same automated sample handling and fluidics described above. Ions are formed in the standard MicroTOF™ ESI source that is equipped with the same off-axis sprayer and glass capillary as the FTICR ESI source. Consequently, source conditions were the same as those described above. External ion accumulation was also employed to improve ionization duty cycle during data acquisition. Each detection event on the TOF was comprised of 75,000 data points digitized over 75 μs.
The sample delivery scheme allows sample aliquots to be rapidly injected into the electrospray source at high flow rate and subsequently be electrosprayed at a much lower flow rate for improved ESI sensitivity. Prior to injecting a sample, a bolus of buffer was injected at a high flow rate to rinse the transfer line and spray needle to avoid sample contamination/carryover. Following the rinse step, the autosampler injected the next sample and the flow rate was switched to low flow. Following a brief equilibration delay, data acquisition commenced. As spectra were co-added, the autosampler continued rinsing the syringe and picking up buffer to rinse the injector and sample transfer line. In general, two syringe rinses and one injector rinse were required to minimize sample carryover. During a routine screening protocol a new sample mixture was injected every 106 seconds. More recently a fast wash station for the syringe needle has been implemented which, when combined with shorter acquisition times, facilitates the acquisition of mass spectra at a rate of just under one spectrum/minute.
Raw mass spectra were post-calibrated with an internal mass standard and deconvoluted to monoisotopic molecular masses. Unambiguous base compositions were derived from the exact mass measurements of the complementary single-stranded oligonucleotides. Quantitative results are obtained by comparing the peak heights with an internal PCR calibration standard present in every PCR well at 500 molecules per well. Calibration methods are commonly owned and disclosed in U.S. Provisional Patent Application Ser. No. 60/545,425 which is incorporated herein by reference in entirety.
Example 5 De Novo Determination of Base Composition of Amplification Products using Molecular Mass Modified Deoxynucleotide TriphosphatesBecause the molecular masses of the four natural nucleobases have a relatively narrow molecular mass range (A=313.058, G=329.052, C=289.046, T=304.046—See Table 4), a persistent source of ambiguity in assignment of base composition can occur as follows: two nucleic acid strands having different base composition may have a difference of about 1 Da when the base composition difference between the two strands is GA (−15.994) combined with CT (+15.000). For example, one 99-mer nucleic acid strand having a base composition of A27G30C21T21 has a theoretical molecular mass of 30779.058 while another 99-mer nucleic acid strand having a base composition of A26G31C22T20 has a theoretical molecular mass of 30780.052. A 1 Da difference in molecular mass may be within the experimental error of a molecular mass measurement and thus, the relatively narrow molecular mass range of the four natural nucleobases imposes an uncertainty factor.
The present invention provides for a means for removing this theoretical 1 Da uncertainty factor through amplification of a nucleic acid with one mass-tagged nucleobase and three natural nucleobases. The term “nucleobase” as used herein is synonymous with other terms in use in the art including “nucleotide,” “deoxynucleotide,” “nucleotide residue,” “deoxynucleotide residue,” “nucleotide triphosphate (NTP),” or deoxynucleotide triphosphate (dNTP).
Addition of significant mass to one of the 4 nucleobases (dNTPs) in an amplification reaction, or in the primers themselves, will result in a significant difference in mass of the resulting amplification product (significantly greater than 1 Da) arising from ambiguities arising from the GA combined with CT event (Table 4). Thus, the same the GA (−15.994) event combined with 5-Iodo-CT (−110.900) event would result in a molecular mass difference of 126.894. If the molecular mass of the base composition A27G305-Iodo-C21T21, (33422.958) is compared with A26G315-Iodo-C22T20, (33549.852) the theoretical molecular mass difference is +126.894. The experimental error of a molecular mass measurement is not significant with regard to this molecular mass difference. Furthermore, the only base composition consistent with a measured molecular mass of the 99-mer nucleic acid is A27G305-Iodo-C21T21. In contrast, the analogous amplification without the mass tag has 18 possible base compositions.
| TABLE 4 |
| Molecular Masses of Natural Nucleobases and the Mass-Modified |
| Nucleobase 5-Iodo-C and Molecular Mass Differences |
| Resulting from Transitions |
| Nucleobase | Molecular Mass | Transition | Molecular Mass |
| A | 313.058 | A-->T | −9.012 |
| A | 313.058 | A-->C | −24.012 |
| A | 313.058 | A-->5-Iodo-C | 101.888 |
| A | 313.058 | A-->G | 15.994 |
| T | 304.046 | T-->A | 9.012 |
| T | 304.046 | T-->C | −15.000 |
| T | 304.046 | T-->5-Iodo-C | 110.900 |
| T | 304.046 | T-->G | 25.006 |
| C | 289.046 | C-->A | 24.012 |
| C | 289.046 | C-->T | 15.000 |
| C | 289.046 | C-->G | 40.006 |
| 5-Iodo-C | 414.946 | 5-Iodo-C-->A | −101.888 |
| 5-Iodo-C | 414.946 | 5-Iodo-C-->T | −110.900 |
| 5-Iodo-C | 414.946 | 5-Iodo-C-->G | −85.894 |
| G | 329.052 | G-->A | −15.994 |
| G | 329.052 | G-->T | −25.006 |
| G | 329.052 | G-->C | −40.006 |
| G | 329.052 | G-->5-Iodo-C | 85.894 |
Mass spectra of bioagent-identifying amplicons were analyzed independently using a maximum-likelihood processor, such as is widely used in radar signal processing. This processor, referred to as GenX, first makes maximum likelihood estimates of the input to the mass spectrometer for each primer by running matched filters for each base composition aggregate on the input data. This includes the GenX response to a calibrant for each primer.
The algorithm emphasizes performance predictions culminating in probability-of-detection versus probability-of-false-alarm plots for conditions involving complex backgrounds of naturally occurring organisms and environmental contaminants. Matched filters consist of a priori expectations of signal values given the set of primers used for each of the bioagents. A genomic sequence database is used to define the mass base count matched filters. The database contains the sequences of known bacterial bioagents and includes threat organisms as well as benign background organisms. The latter is used to estimate and subtract the spectral signature produced by the background organisms. A maximum likelihood detection of known background organisms is implemented using matched filters and a running-sum estimate of the noise covariance. Background signal strengths are estimated and used along with the matched filters to form signatures which are then subtracted. The maximum likelihood process is applied to this “cleaned up” data in a similar manner employing matched filters for the organisms and a running-sum estimate of the noise-covariance for the cleaned up data.
The amplitudes of all base compositions of bioagent-identifying amplicons for each primer are calibrated and a final maximum likelihood amplitude estimate per organism is made based upon the multiple single primer estimates. Models of all system noise are factored into this two-stage maximum likelihood calculation. The processor reports the number of molecules of each base composition contained in the spectra. The quantity of amplification product corresponding to the appropriate primer set is reported as well as the quantities of primers remaining upon completion of the amplification reaction.
Base count blurring can be carried out as follows. “Electronic PCR” can be conducted on nucleotide sequences of the desired bioagents to obtain the different expected base counts that could be obtained for each primer pair. See for example, ncbi.nlm.nih.gov/sutils/e-pcr/; Schuler, Genome Res. 7:541-50, 1997. In one illustrative embodiment, one or more spreadsheets, such as Microsoft Excel workbooks contain a plurality of worksheets. First in this example, there is a worksheet with a name similar to the workbook name; this worksheet contains the raw electronic PCR data. Second, there is a worksheet named “filtered bioagents base count” that contains bioagent name and base count; there is a separate record for each strain after removing sequences that are not identified with a genus and species and removing all sequences for bioagents with less than 10 strains. Third, there is a worksheet, “Sheet1” that contains the frequency of substitutions, insertions, or deletions for this primer pair. This data is generated by first creating a pivot table from the data in the “filtered bioagents base count” worksheet and then executing an Excel VBA macro. The macro creates a table of differences in base counts for bioagents of the same species, but different strains. One of ordinary skill in the art may understand additional pathways for obtaining similar table differences without undo experimentation.
Application of an exemplary script, involves the user defining a threshold that specifies the fraction of the strains that are represented by the reference set of base counts for each bioagent. The reference set of base counts for each bioagent may contain as many different base counts as are needed to meet or exceed the threshold. The set of reference base counts is defined by taking the most abundant strain's base type composition and adding it to the reference set and then the next most abundant strain's base type composition is added until the threshold is met or exceeded. The current set of data was obtained using a threshold of 55%, which was obtained empirically.
For each base count not included in the reference base count set for that bioagent, the script then proceeds to determine the manner in which the current base count differs from each of the base counts in the reference set. This difference may be represented as a combination of substitutions, Si=Xi, and insertions, Ii=Yi, or deletions, Di=Zi. If there is more than one reference base count, then the reported difference is chosen using rules that aim to minimize the number of changes and, in instances with the same number of changes, minimize the number of insertions or deletions. Therefore, the primary rule is to identify the difference with the minimum sum (Xi+Yi) or (Xi+Zi), e.g., one insertion rather than two substitutions. If there are two or more differences with the minimum sum, then the one that will be reported is the one that contains the most substitutions.
Differences between a base count and a reference composition are categorized as one, two, or more substitutions, one, two, or more insertions, one, two, or more deletions, and combinations of substitutions and insertions or deletions. The different classes of nucleobase changes and their probabilities of occurrence have been delineated in U.S. Patent Application Publication No. 2004209260 (U.S. application Ser. No. 10/418,514) which is incorporated herein by reference in entirety.
Example 6 Use of Broad Range Survey and Division Wide Primer Pairs for Identification of Bacteria in an Epidemic Surveillance InvestigationThis investigation employed a set of 16 primer pairs which is herein designated the “surveillance primer set” and comprises broad range survey primer pairs, division wide primer pairs and a single Bacillus lade primer pair. The surveillance primer set is shown in Table 5 and consists of primer pairs originally listed in Table 2. This surveillance set comprises primers with T modifications (note TMOD designation in primer names) which constitutes a functional improvement with regard to prevention of non-templated adenylation (vide supra) relative to originally selected primers which are displayed below in the same row. Primer pair 449 (non-T modified) has been modified twice. Its predecessors are primer pairs 70 and 357, displayed below in the same row. Primer pair 360 has also been modified twice and its predecessors are primer pairs 17 and 118.
| TABLE 5 |
| Bacterial Primer Pairs of the Surveillance Primer Set |
| Forward | Reverse | ||||
| Primer | Primer | Primer | |||
| Pair | (SEQ ID | (SEQ ID | |||
| No. | Forward Primer Name | NO:) | Reverse Primer Name | NO:) | Target Gene |
| 346 | 16S_EC_713_732_TMOD_F | 202 | 16S_EC_789_809_TMOD_R | 1110 | 16S rRNA |
| 10 | 16S_EC_713_732_F | 21 | 16S_EC_789_809 | 798 | 16S rRNA |
| 347 | 16S_EC_785_806_TMOD_F | 560 | 16S_EC_880_897_TMOD_R | 1278 | 16S rRNA |
| 11 | 16S_EC_785_806_F | 118 | 16S_EC_880_897_R | 830 | 16S rRNA |
| 348 | 16S_EC_960_981_TMOD_F | 706 | 16S_EC_1054_1073_TMOD_R | 895 | 16S rRNA |
| 14 | 16S_EC_960_981_F | 672 | 16S_EC_1054_1073_R | 735 | 16S rRNA |
| 349 | 23S_EC_1826_1843_TMOD_F | 401 | 23S_EC_1906_1924_TMOD_R | 1156 | 23S rRNA |
| 16 | 23S_EC_1826_1843_F | 80 | 23S_EC_1906_1924_R | 805 | 23S rRNA |
| 352 | INFB_EC_1365_1393_TMOD_F | 687 | INFB_EC_1439_1467_TMOD_R | 1411 | infB |
| 34 | INFB_EC_1365_1393_F | 524 | INFB_EC_1439_1467_R | 1248 | infB |
| 354 | RPOC_EC_2218_2241_TMOD_F | 405 | RPOC_EC_2313_2337_TMOD_R | 1072 | rpoC |
| 52 | RPOC_EC_2218_2241_F | 81 | RPOC_EC_2313_2337_R | 790 | rpoC |
| 355 | SSPE_BA_115_137_TMOD_F | 255 | SSPE_BA_197_222_TMOD_R | 1402 | sspE |
| 58 | SSPE_BA_115_137_F | 45 | SSPE_BA_197_222_R | 1201 | sspE |
| 356 | RPLB_EC_650_679_TMOD_F | 232 | RPLB_EC_739_762_TMOD_R | 592 | rplB |
| 66 | RPLB_EC_650_679_F | 98 | RPLB_EC_739_762_R | 999 | rplB |
| 358 | VALS_EC_1105_1124_TMOD_F | 385 | VALS_EC_1195_1218_TMOD_R | 1093 | valS |
| 71 | VALS_EC_1105_1124_F | 77 | VALS_EC_1195_1218_R | 795 | valS |
| 359 | RPOB_EC_1845_1866_TMOD_F | 659 | RPOB_EC_1909_1929_TMOD_R | 1250 | rpoB |
| 72 | RPOB_EC_1845_1866_F | 233 | RPOB_EC_1909_1929_R | 825 | rpoB |
| 360 | 23S_EC_2646_2667_TMOD_F | 409 | 23S_EC_2745_2765_TMOD_R | 1434 | 23S rRNA |
| 118 | 23S_EC_2646_2667_F | 84 | 23S_EC_2745_2765_R | 1389 | 23S rRNA |
| 17 | 23S_EC_2645_2669_F | 408 | 23S_EC_2744_2761_R | 1252 | 23S rRNA |
| 361 | 16S_EC_1090_1111_2_TMOD_F | 697 | 16S_EC_1175_1196_TMOD_R | 1398 | 16S rRNA |
| 3 | 16S_EC_1090_1111_2_F | 651 | 16S_EC_1175_1196_R | 1159 | 16S rRNA |
| 362 | RPOB_EC_3799_3821_TMOD_F | 581 | RPOB_EC_3862_3888_TMOD_R | 1325 | rpoB |
| 289 | RPOB_EC_3799_3821_F | 124 | RPOB_EC_3862_3888_R | 840 | rpoB |
| 363 | RPOC_EC_2146_2174_TMOD_F | 284 | RPOC_EC_2227_2245_TMOD_R | 898 | rpoC |
| 290 | RPOC_EC_2146_2174_F | 52 | RPOC_EC_2227_2245_R | 736 | rpoC |
| 367 | TUFB_EC_957_979_TMOD_F | 308 | TUFB_EC_1034_1058_TMOD_R | 1276 | tufB |
| 293 | TUFB_EC_957_979_F | 55 | TUFB_EC_1034_1058_R | 829 | tufB |
| 449 | RPLB_EC_690_710_F | 309 | RPLB_EC_737_758_R | 1336 | rplB |
| 357 | RPLB_EC_688_710_TMOD_F | 296 | RPLB_EC_736_757_TMOD_R | 1337 | rplB |
| 67 | RPLB_EC_688_710_F | 54 | RPLB_EC_736_757_R | 842 | rplB |
The 16 primer pairs of the surveillance set are used to produce bioagent identifying amplicons whose base compositions are sufficiently different amongst all known bacteria at the species level to identify, at a reasonable confidence level, any given bacterium at the species level. As shown in Tables 6A-E, common respiratory bacterial pathogens can be distinguished by the base compositions of bioagent identifying amplicons obtained using the 16 primer pairs of the surveillance set. In some cases, triangulation identification improves the confidence level for species assignment. For example, nucleic acid from Streptococcus pyogenes can be amplified by nine of the sixteen surveillance primer pairs and Streptococcus pneumoniae can be amplified by ten of the sixteen surveillance primer pairs. The base compositions of the bioagent identifying amplicons are identical for only one of the analogous bioagent identifying amplicons and differ in all of the remaining analogous bioagent identifying amplicons by up to four bases per bioagent identifying amplicon. The resolving power of the surveillance set was confirmed by determination of base compositions for 120 isolates of respiratory pathogens representing 70 different bacterial species and the results indicated that natural variations (usually only one or two base substitutions per bioagent identifying amplicon) amongst multiple isolates of the same species did not prevent correct identification of major pathogenic organisms at the species level.
Bacillus anthracis is a well known biological warfare agent which has emerged in domestic terrorism in recent years. Since it was envisioned to produce bioagent identifying amplicons for identification of Bacillus anthracis, additional drill-down analysis primers were designed to target genes present on virulence plasmids of Bacillus anthracis so that additional confidence could be reached in positive identification of this pathogenic organism. Three drill-down analysis primers were designed and are listed in Tables 2 and 6. In Table 6, the drill-down set comprises primers with T modifications (note TMOD designation in primer names) which constitutes a functional improvement with regard to prevention of non-templated adenylation (vide supra) relative to originally selected primers which are displayed below in the same row.
| TABLE 6 |
| Drill-Down Primer Pairs for Confirmation of Identification of Bacillus anthracis |
| Forward | Reverse | ||||
| Primer | Primer | Primer | |||
| Pair | (SEQ ID | (SEQ ID | |||
| No. | Forward Primer Name | NO:) | Reverse Primer Name | NO:) | Target Gene |
| 350 | CAPC_BA_274_303_TMOD_F | 476 | CAPC_BA_349_376_TMOD_R | 1314 | capC |
| 24 | CAPC_BA_274_303_F | 109 | CAPC_BA_349_376_R | 837 | capC |
| 351 | CYA_BA_1353_1379_TMOD_F | 355 | CYA_BA_1448_1467_TMOD_R | 1423 | cyA |
| 30 | CYA_BA_1353_1379_F | 64 | CYA_BA_1448_1467_R | 1342 | cyA |
| 353 | LEF_BA_756_781_TMOD_F | 220 | LEF_BA_843_872_TMOD_R | 1394 | lef |
| 37 | LEF_BA_756_781_F | 26 | LEF_BA_843_872_R | 1135 | lef |
Phylogenetic coverage of bacterial space of the sixteen surveillance primers of Table 5 and the three Bacillus anthracis drill-down primers of Table 6 is shown in FIG. 3 which lists common pathogenic bacteria. FIG. 3 is not meant to be comprehensive in illustrating all species identified by the primers. Only pathogenic bacteria are listed as representative examples of the bacterial species that can be identified by the primers and methods of the present invention. Nucleic acid of groups of bacteria enclosed within the polygons of FIG. 3 can be amplified to obtain bioagent identifying amplicons using the primer pair numbers listed in the upper right hand corner of each polygon. Primer coverage for polygons within polygons is additive. As an illustrative example, bioagent identifying amplicons can be obtained for Chlamydia trachomatis by amplification with, for example, primer pairs 346-349, 360 and 361, but not with any of the remaining primers of the surveillance primer set. On the other hand, bioagent identifying amplicons can be obtained from nucleic acid originating from Bacillus anthracis (located within 5 successive polygons) using, for example, any of the following primer pairs: 346-349, 360, 361 (base polygon), 356, 449 (second polygon), 352 (third polygon), 355 (fourth polygon), 350, 351 and 353 (fifth polygon). Multiple coverage of a given organism with multiple primers provides for increased confidence level in identification of the organism as a result of enabling broad triangulation identification.
In Tables 7A-E, base compositions of respiratory pathogens for primer target regions are shown. Two entries in a cell, represent variation in ribosomal DNA operons. The most predominant base composition is shown first and the minor (frequently a single operon) is indicated by an asterisk (*). Entries with NO DATA mean that the primer would not be expected to prime this species due to mismatches between the primer and target region, as determined by theoretical PCR.
| TABLE 7A |
| Base Compositions of Common Respiratory Pathogens for Bioagent Identifying |
| Amplicons Corresponding to Primer Pair Nos: 346,347 and 348 |
| Primer 346 | Primer 347 | Primer 348 | ||
| Organism | Strain | [A G C T] | [A G C T] | [A G C T] |
| Klebsiella | MGH78578 | [29 32 25 13] | [23 38 28 26] | [26 32 28 30] |
| pneumoniae | [29 31 25 13]* | [23 37 28 26]* | [26 31 28 30]* | |
| Yersinia pestis | CO-92 Biovar | [29 32 25 13] | [22 39 28 26] | [29 30 28 29] |
| Orientalis | [30 30 27 29 ]* | |||
| Yersinia pestis | KIM5 P12 (Biovar | [29 32 25 13] | [22 39 28 26] | [29 30 28 29] |
| Mediaevalis) | ||||
| Yersinia pestis | 91001 | [29 32 25 13] | [22 39 28 26] | [29 30 28 29] |
| [30 30 27 29 ]* | ||||
| Haemophilus | KW20 | [28 31 23 17] | [24 37 25 27] | [29 30 28 29] |
| influenzae | ||||
| Pseudomonas | PAO1 | [30 31 23 15] | [26 36 29 24] | [26 32 29 29] |
| aeruginosa | [27 36 29 23]* | |||
| Pseudomonas | Pf0-1 | [30 31 23 15] | [26 35 29 25] | [28 31 28 29] |
| fluorescens | ||||
| Pseudomonas | KT2440 | [30 31 23 15] | [28 33 27 27] | [27 32 29 28] |
| putida | ||||
| Legionella | Philadelphia-1 | [30 30 24 15] | [33 33 23 27] | [29 28 28 31] |
| pneumophila | ||||
| Francisella | schu 4 | [32 29 22 16] | [28 38 26 26] | [25 32 28 31] |
| tularensis | ||||
| Bordetella | Tohama I | [30 29 24 16] | [23 37 30 24] | [30 32 30 26] |
| pertussis | ||||
| Burkholderia | J2315 | [29 29 27 14] | [27 32 26 29] | [27 36 31 24] |
| cepacia | [20 42 35 19]* | |||
| Burkholderia | K96243 | [29 29 27 14] | [27 32 26 29] | [27 36 31 24] |
| pseudomallei | ||||
| Neisseria | FA 1090, ATCC | [29 28 24 18] | [27 34 26 28] | [24 36 29 27] |
| gonorrhoeae | 700825 | |||
| Neisseria | MC58 (serogroup B) | [29 28 26 16] | [27 34 27 27] | [25 35 30 26] |
| meningitidis | ||||
| Neisseria | serogroup C, FAM18 | [29 28 26 16] | [27 34 27 27] | [25 35 30 26] |
| meningitidis | ||||
| Neisseria | Z2491 (serogroup A) | [29 28 26 16] | [27 34 27 27] | [25 35 30 26] |
| meningitidis | ||||
| Chlamydophila | TW-183 | [31 27 22 19] | NO DATA | [32 27 27 29] |
| pneumoniae | ||||
| Chlamydophila | AR39 | [31 27 22 19] | NO DATA | [32 27 27 29] |
| pneumoniae | ||||
| Chlamydophila | CWL029 | [31 27 22 19] | NO DATA | [32 27 27 29] |
| pneumoniae | ||||
| Chlamydophila | J138 | [31 27 22 19] | NO DATA | [32 27 27 29] |
| pneumoniae | ||||
| Corynebacterium | NCTC13129 | [29 34 21 15] | [22 38 31 25] | [22 33 25 34] |
| diphtheriae | ||||
| Mycobacterium | k10 | [27 36 21 15] | [22 37 30 28] | [21 36 27 30] |
| avium | ||||
| Mycobacterium | 104 | [27 36 21 15] | [22 37 30 28] | [21 36 27 30] |
| avium | ||||
| Mycobacterium | CSU#93 | [27 36 21 15] | [22 37 30 28] | [21 36 27 30] |
| tuberculosis | ||||
| Mycobacterium | CDC 1551 | [27 36 21 15] | [22 37 30 28] | [21 36 27 30] |
| tuberculosis | ||||
| Mycobacterium | H37Rv (lab strain) | [27 36 21 15] | [22 37 30 28] | [21 36 27 30] |
| tuberculosis | ||||
| Mycoplasma | M129 | [31 29 19 20] | NO DATA | NO DATA |
| pneumoniae | ||||
| Staphylococcus | MRSA252 | [27 30 21 21] | [25 35 30 26] | [30 29 30 29] |
| aureus | [29 31 30 29]* | |||
| Staphylococcus | MSSA476 | [27 30 21 21] | [25 35 30 26] | [30 29 30 29] |
| aureus | [30 29 29 30]* | |||
| Staphylococcus | COL | [27 30 21 21] | [25 35 30 26] | [30 29 30 29] |
| aureus | [30 29 29 30]* | |||
| Staphylococcus | Mu50 | [27 30 21 21] | [25 35 30 26] | [30 29 30 29] |
| aureus | [30 29 29 30]* | |||
| Staphylococcus | MW2 | [27 30 21 21] | [25 35 30 26] | [30 29 30 29] |
| aureus | [30 29 29 30]* | |||
| Staphylococcus | N315 | [27 30 21 21] | [25 35 30 26] | [30 29 30 29] |
| aureus | [30 29 29 30]* | |||
| Staphylococcus | NCTC 8325 | [27 30 21 21] | [25 35 30 26] | [30 29 30 29] |
| aureus | [25 35 31 26]* | [30 29 29 30] | ||
| Streptococcus | NEM316 | [26 32 23 18] | [24 36 31 25] | [25 32 29 30] |
| agalactiae | [24 36 30 26]* | |||
| Streptococcus | NC_002955 | [26 32 23 18] | [23 37 31 25] | [29 30 25 32] |
| equi | ||||
| Streptococcus | MGAS8232 | [26 32 23 18] | [24 37 30 25] | [25 31 29 31] |
| pyogenes | ||||
| Streptococcus | MGAS315 | [26 32 23 18] | [24 37 30 25] | [25 31 29 31] |
| pyogenes | ||||
| Streptococcus | SSI-1 | [26 32 23 18] | [24 37 30 25] | [25 31 29 31] |
| pyogenes | ||||
| Streptococcus | MGAS10394 | [26 32 23 18] | [24 37 30 25] | [25 31 29 31] |
| pyogenes | ||||
| Streptococcus | Manfredo (M5) | [26 32 23 18] | [24 37 30 25] | [25 31 29 31] |
| pyogenes | ||||
| Streptococcus | SF370 (M1) | [26 32 23 18] | [24 37 30 25] | [25 31 29 31] |
| pyogenes | ||||
| Streptococcus | 670 | [26 32 23 18] | [25 35 28 28] | [25 32 29 30] |
| pneumoniae | ||||
| Streptococcus | R6 | [26 32 23 18] | [25 35 28 28] | [25 32 29 30] |
| pneumoniae | ||||
| Streptococcus | TIGR4 | [26 32 23 18] | [25 35 28 28] | [25 32 30 29] |
| pneumoniae | ||||
| Streptococcus | NCTC7868 | [25 33 23 18] | [24 36 31 25] | [25 31 29 31] |
| gordonii | ||||
| Streptococcus | NCTC 12261 | [26 32 23 18] | [25 35 30 26] | [25 32 29 30] |
| mitis | [24 31 35 29]* | |||
| Streptococcus | UA159 | [24 32 24 19] | [25 37 30 24] | [28 31 26 31] |
| mutans | ||||
| TABLE 7B |
| Base Compositions of Common Respiratory Pathogens for Bioagent Identifying |
| Amplicons Corresponding to Primer Pair Nos: 349, 360, and 356 |
| Primer 349 | Primer 360 | Primer 356 | ||
| Organism | Strain | [A G C T] | [A G C T] | [A G C T] |
| Klebsiella | MGH78578 | [25 31 25 22] | [33 37 25 27] | NO DATA |
| pneumoniae | ||||
| Yersinia pestis | CO-92 Biovar | [25 31 27 20] | [34 35 25 28] | NO DATA |
| Orientalis | [25 32 26 20]* | |||
| Yersinia pestis | KIM5 P12 (Biovar | [25 31 27 20] | [34 35 25 28] | NO DATA |
| Mediaevalis) | [25 32 26 20]* | |||
| Yersinia pestis | 91001 | [25 31 27 20] | [34 35 25 28] | NO DATA |
| Haemophilus | KW20 | [28 28 25 20] | [32 38 25 27] | NO DATA |
| influenzae | ||||
| Pseudomonas | PAO1 | [24 31 26 20] | [31 36 27 27] | NO DATA |
| aeruginosa | [31 36 27 28]* | |||
| Pseudomonas | Pf0-1 | NO DATA | [30 37 27 28] | NO DATA |
| fluorescens | [30 37 27 28] | |||
| Pseudomonas | KT2440 | [24 31 26 20] | [30 37 27 28] | NO DATA |
| putida | ||||
| Legionella | Philadelphia-1 | [23 30 25 23] | [30 39 29 24] | NO DATA |
| pneumophila | ||||
| Francisella | schu 4 | [26 31 25 19] | [32 36 27 27] | NO DATA |
| tularensis | ||||
| Bordetella | Tohama I | [21 29 24 18] | [33 36 26 27] | NO DATA |
| pertussis | ||||
| Burkholderia | J2315 | [23 27 22 20] | [31 37 28 26] | NO DATA |
| cepacia | ||||
| Burkholderia | K96243 | [23 27 22 20] | [31 37 28 26] | NO DATA |
| pseudomallei | ||||
| Neisseria | FA 1090, ATCC 700825 | [24 27 24 17] | [34 37 25 26] | NO DATA |
| gonorrhoeae | ||||
| Neisseria | MC58 (serogroup B) | [25 27 22 18] | [34 37 25 26] | NO DATA |
| meningitidis | ||||
| Neisseria | serogroup C, FAM18 | [25 26 23 18] | [34 37 25 26] | NO DATA |
| meningitidis | ||||
| Neisseria | Z2491 (serogroup A) | [25 26 23 18] | [34 37 25 26] | NO DATA |
| meningitidis | ||||
| Chlamydophila | TW-183 | [30 28 27 18] | NO DATA | NO DATA |
| pneumoniae | ||||
| Chlamydophila | AR39 | [30 28 27 18] | NO DATA | NO DATA |
| pneumoniae | ||||
| Chlamydophila | CWL029 | [30 28 27 18] | NO DATA | NO DATA |
| pneumoniae | ||||
| Chlamydophila | J138 | [30 28 27 18] | NO DATA | NO DATA |
| pneumoniae | ||||
| Corynebacterium | NCTC13129 | NO DATA | [29 40 28 25] | NO DATA |
| diphtheriae | ||||
| Mycobacterium | k10 | NO DATA | [33 35 32 22] | NO DATA |
| avium | ||||
| Mycobacterium | 104 | NO DATA | [33 35 32 22] | NO DATA |
| avium | ||||
| Mycobacterium | CSU#93 | NO DATA | [30 36 34 22] | NO DATA |
| tuberculosis | ||||
| Mycobacterium | CDC 1551 | NO DATA | [30 36 34 22] | NO DATA |
| tuberculosis | ||||
| Mycobacterium | H37Rv (lab strain) | NO DATA | [30 36 34 22] | NO DATA |
| tuberculosis | ||||
| Mycoplasma | M129 | [28 30 24 19] | [34 31 29 28] | NO DATA |
| pneumoniae | ||||
| Staphylococcus | MRSA252 | [26 30 25 20] | [31 38 24 29] | [33 30 31 27] |
| aureus | ||||
| Staphylococcus | MSSA476 | [26 30 25 20] | [31 38 24 29] | [33 30 31 27] |
| aureus | ||||
| Staphylococcus | COL | [26 30 25 20] | [31 38 24 29] | [33 30 31 27] |
| aureus | ||||
| Staphylococcus | Mu50 | [26 30 25 20] | [31 38 24 29] | [33 30 31 27] |
| aureus | ||||
| Staphylococcus | MW2 | [26 30 25 20] | [31 38 24 29] | [33 30 31 27] |
| aureus | ||||
| Staphylococcus | N315 | [26 30 25 20] | [31 38 24 29] | [33 30 31 27] |
| aureus | ||||
| Staphylococcus | NCTC 8325 | [26 30 25 20] | [31 38 24 29] | [33 30 31 27] |
| aureus | ||||
| Streptococcus | NEM316 | [28 31 22 20] | [33 37 24 28] | [37 30 28 26] |
| agalactiae | ||||
| Streptococcus | NC_002955 | [28 31 23 19] | [33 38 24 27] | [37 31 28 25] |
| equi | ||||
| Streptococcus | MGAS8232 | [28 31 23 19] | [33 37 24 28] | [38 31 29 23] |
| pyogenes | ||||
| Streptococcus | MGAS315 | [28 31 23 19] | [33 37 24 28] | [38 31 29 23] |
| pyogenes | ||||
| Streptococcus | SSI-1 | [28 31 23 19] | [33 37 24 28] | [38 31 29 23] |
| pyogenes | ||||
| Streptococcus | MGAS10394 | [28 31 23 19] | [33 37 24 28] | [38 31 29 23] |
| pyogenes | ||||
| Streptococcus | Manfredo (M5) | [28 31 23 19] | [33 37 24 28] | [38 31 29 23] |
| pyogenes | ||||
| Streptococcus | SF370 (M1) | [28 31 23 19] | [33 37 24 28] | [38 31 29 23] |
| pyogenes | [28 31 22 20]* | |||
| Streptococcus | 670 | [28 31 22 20] | [34 36 24 28] | [37 30 29 25] |
| pneumoniae | ||||
| Streptococcus | R6 | [28 31 22 20] | [34 36 24 28] | [37 30 29 25] |
| pneumoniae | ||||
| Streptococcus | TIGR4 | [28 31 22 20] | [34 36 24 28] | [37 30 29 25] |
| pneumoniae | ||||
| Streptococcus | NCTC7868 | [28 32 23 20] | [34 36 24 28] | [36 31 29 25] |
| gordonii | ||||
| Streptococcus | NCTC 12261 | [28 31 22 20] | [34 36 24 28] | [37 30 29 25] |
| mitis | [29 30 22 20]* | |||
| Streptococcus | UA159 | [26 32 23 22] | [34 37 24 27] | NO DATA |
| mutans | ||||
| TABLE 7C |
| Base Compositions of Common Respiratory Pathogens for Bioagent Identifying |
| Amplicons Corresponding to Primer Pair Nos: 449, 354, and 352 |
| Primer 449 | Primer 354 | Primer 352 | ||
| Organism | Strain | [A G C T] | [A G C T] | [A G C T] |
| Klebsiella | MGH78578 | NO DATA | [27 33 36 26] | NO DATA |
| pneumoniae | ||||
| Yersinia pestis | CO-92 Biovar | NO DATA | [29 31 33 29] | [32 28 20 25] |
| Orientalis | ||||
| Yersinia pestis | KIM5 P12 (Biovar | NO DATA | [29 31 33 29] | [32 28 20 25] |
| Mediaevalis) | ||||
| Yersinia pestis | 91001 | NO DATA | [29 31 33 29] | NO DATA |
| Haemophilus | KW20 | NO DATA | [30 29 31 32] | NO DATA |
| influenzae | ||||
| Pseudomonas | PAO1 | NO DATA | [26 33 39 24] | NO DATA |
| aeruginosa | ||||
| Pseudomonas | Pf0-1 | NO DATA | [26 33 34 29] | NO DATA |
| fluorescens | ||||
| Pseudomonas | KT2440 | NO DATA | [25 34 36 27] | NO DATA |
| putida | ||||
| Legionella | Philadelphia-1 | NO DATA | NO DATA | NO DATA |
| pneumophila | ||||
| Francisella | schu 4 | NO DATA | [33 32 25 32] | NO DATA |
| tularensis | ||||
| Bordetella | Tohama I | NO DATA | [26 33 39 24] | NO DATA |
| pertussis | ||||
| Burkholderia | J2315 | NO DATA | [25 37 33 27] | NO DATA |
| cepacia | ||||
| Burkholderia | K96243 | NO DATA | [25 37 34 26] | NO DATA |
| pseudomallei | ||||
| Neisseria | FA 1090, ATCC 700825 | [17 23 22 10] | [29 31 32 30] | NO DATA |
| gonorrhoeae | ||||
| Neisseria | MC58 (serogroup B) | NO DATA | [29 30 32 31] | NO DATA |
| meningitidis | ||||
| Neisseria | serogroup C, FAM18 | NO DATA | [29 30 32 31] | NO DATA |
| meningitidis | ||||
| Neisseria | Z2491 (serogroup A) | NO DATA | [29 30 32 31] | NO DATA |
| meningitidis | ||||
| Chlamydophila | TW-183 | NO DATA | NO DATA | NO DATA |
| pneumoniae | ||||
| Chlamydophila | AR39 | NO DATA | NO DATA | NO DATA |
| pneumoniae | ||||
| Chlamydophila | CWL029 | NO DATA | NO DATA | NO DATA |
| pneumoniae | ||||
| Chlamydophila | J138 | NO DATA | NO DATA | NO DATA |
| pneumoniae | ||||
| Corynebacterium | NCTC13129 | NO DATA | NO DATA | NO DATA |
| diphtheriae | ||||
| Mycobacterium | k10 | NO DATA | NO DATA | NO DATA |
| avium | ||||
| Mycobacterium | 104 | NO DATA | NO DATA | NO DATA |
| avium | ||||
| Mycobacterium | CSU#93 | NO DATA | NO DATA | NO DATA |
| tuberculosis | ||||
| Mycobacterium | CDC 1551 | NO DATA | NO DATA | NO DATA |
| tuberculosis | ||||
| Mycobacterium | H37Rv (lab strain) | NO DATA | NO DATA | NO DATA |
| tuberculosis | ||||
| Mycoplasma | M129 | NO DATA | NO DATA | NO DATA |
| pneumoniae | ||||
| Staphylococcus | MRSA252 | [17 20 21 17] | [30 27 30 35] | [36 24 19 26] |
| aureus | ||||
| Staphylococcus | MSSA476 | [17 20 21 17] | [30 27 30 35] | [36 24 19 26] |
| aureus | ||||
| Staphylococcus | COL | [17 20 21 17] | [30 27 30 35] | [35 24 19 27] |
| aureus | ||||
| Staphylococcus | Mu50 | [17 20 21 17] | [30 27 30 35] | [36 24 19 26] |
| aureus | ||||
| Staphylococcus | MW2 | [17 20 21 17] | [30 27 30 35] | [36 24 19 26] |
| aureus | ||||
| Staphylococcus | N315 | [17 20 21 17] | [30 27 30 35] | [36 24 19 26] |
| aureus | ||||
| Staphylococcus | NCTC 8325 | [17 20 21 17] | [30 27 30 35] | [35 24 19 27] |
| aureus | ||||
| Streptococcus | NEM316 | [22 20 19 14] | [26 31 27 38] | [29 26 22 28] |
| agalactiae | ||||
| Streptococcus | NC_002955 | [22 21 19 13] | NO DATA | NO DATA |
| equi | ||||
| Streptococcus | MGAS8232 | [23 21 19 12] | [24 32 30 36] | NO DATA |
| pyogenes | ||||
| Streptococcus | MGAS315 | [23 21 19 12] | [24 32 30 36] | NO DATA |
| pyogenes | ||||
| Streptococcus | SSI-1 | [23 21 19 12] | [24 32 30 36] | NO DATA |
| pyogenes | ||||
| Streptococcus | MGAS10394 | [23 21 19 12] | [24 32 30 36] | NO DATA |
| pyogenes | ||||
| Streptococcus | Manfredo (M5) | [23 21 19 12] | [24 32 30 36] | NO DATA |
| pyogenes | ||||
| Streptococcus | SF370 (M1) | [23 21 19 12] | [24 32 30 36] | NO DATA |
| pyogenes | ||||
| Streptococcus | 670 | [22 20 19 14] | [25 33 29 35] | [30 29 21 25] |
| pneumoniae | ||||
| Streptococcus | R6 | [22 20 19 14] | [25 33 29 35] | [30 29 21 25] |
| pneumoniae | ||||
| Streptococcus | TIGR4 | [22 20 19 14] | [25 33 29 35] | [30 29 21 25] |
| pneumoniae | ||||
| Streptococcus | NCTC7868 | [21 21 19 14] | NO DATA | [29 26 22 28] |
| gordonii | ||||
| Streptococcus | NCTC 12261 | [22 20 19 14] | [26 30 32 34] | NO DATA |
| mitis | ||||
| Streptococcus | UA159 | NO DATA | NO DATA | NO DATA |
| mutans | ||||
| TABLE 7D |
| Base Compositions of Common Respiratory Pathogens for Bioagent Identifying |
| Amplicons Corresponding to Primer Pair Nos: 355, 358, and 359 |
| Primer 355 | Primer 358 | Primer 359 | ||
| Organism | Strain | [A G C T] | [A G C T] | [A G C T] |
| Klebsiella | MGH78578 | NO DATA | [24 39 33 20] | [25 21 24 17] |
| pneumoniae | ||||
| Yersinia pestis | CO-92 Biovar | NO DATA | [26 34 35 21] | [23 23 19 22] |
| Orientalis | ||||
| Yersinia pestis | KIM5 P12 (Biovar | NO DATA | [26 34 35 21] | [23 23 19 22] |
| Mediaevalis) | ||||
| Yersinia pestis | 91001 | NO DATA | [26 34 35 21] | [23 23 19 22] |
| Haemophilus | KW20 | NO DATA | NO DATA | NO DATA |
| influenzae | ||||
| Pseudomonas | PAO1 | NO DATA | NO DATA | NO DATA |
| aeruginosa | ||||
| Pseudomonas | Pf0-1 | NO DATA | NO DATA | NO DATA |
| fluorescens | ||||
| Pseudomonas | KT2440 | NO DATA | [21 37 37 21] | NO DATA |
| putida | ||||
| Legionella | Philadelphia-1 | NO DATA | NO DATA | NO DATA |
| pneumophila | ||||
| Francisella | schu 4 | NO DATA | NO DATA | NO DATA |
| tularensis | ||||
| Bordetella | Tohama I | NO DATA | NO DATA | NO DATA |
| pertussis | ||||
| Burkholderia | J2315 | NO DATA | NO DATA | NO DATA |
| cepacia | ||||
| Burkholderia | K96243 | NO DATA | NO DATA | NO DATA |
| pseudomallei | ||||
| Neisseria | FA 1090, ATCC 700825 | NO DATA | NO DATA | NO DATA |
| gonorrhoeae | ||||
| Neisseria | MC58 (serogroup B) | NO DATA | NO DATA | NO DATA |
| meningitidis | ||||
| Neisseria | serogroup C, FAM18 | NO DATA | NO DATA | NO DATA |
| meningitidis | ||||
| Neisseria | Z2491 (serogroup A) | NO DATA | NO DATA | NO DATA |
| meningitidis | ||||
| Chlamydophila | TW-183 | NO DATA | NO DATA | NO DATA |
| pneumoniae | ||||
| Chlamydophila | AR39 | NO DATA | NO DATA | NO DATA |
| pneumoniae | ||||
| Chlamydophila | CWL029 | NO DATA | NO DATA | NO DATA |
| pneumoniae | ||||
| Chlamydophila | J138 | NO DATA | NO DATA | NO DATA |
| pneumoniae | ||||
| Corynebacterium | NCTC13129 | NO DATA | NO DATA | NO DATA |
| diphtheriae | ||||
| Mycobacterium | k10 | NO DATA | NO DATA | NO DATA |
| avium | ||||
| Mycobacterium | 104 | NO DATA | NO DATA | NO DATA |
| avium | ||||
| Mycobacterium | CSU#93 | NO DATA | NO DATA | NO DATA |
| tuberculosis | ||||
| Mycobacterium | CDC 1551 | NO DATA | NO DATA | NO DATA |
| tuberculosis | ||||
| Mycobacterium | H37Rv (lab strain) | NO DATA | NO DATA | NO DATA |
| tuberculosis | ||||
| Mycoplasma | M129 | NO DATA | NO DATA | NO DATA |
| pneumoniae | ||||
| Staphylococcus | MRSA252 | NO DATA | NO DATA | NO DATA |
| aureus | ||||
| Staphylococcus | MSSA476 | NO DATA | NO DATA | NO DATA |
| aureus | ||||
| Staphylococcus | COL | NO DATA | NO DATA | NO DATA |
| aureus | ||||
| Staphylococcus | Mu50 | NO DATA | NO DATA | NO DATA |
| aureus | ||||
| Staphylococcus | MW2 | NO DATA | NO DATA | NO DATA |
| aureus | ||||
| Staphylococcus | N315 | NO DATA | NO DATA | NO DATA |
| aureus | ||||
| Staphylococcus | NCTC 8325 | NO DATA | NO DATA | NO DATA |
| aureus | ||||
| Streptococcus | NEM316 | NO DATA | NO DATA | NO DATA |
| agalactiae | ||||
| Streptococcus | NC_002955 | NO DATA | NO DATA | NO DATA |
| equi | ||||
| Streptococcus | MGAS8232 | NO DATA | NO DATA | NO DATA |
| pyogenes | ||||
| Streptococcus | MGAS315 | NO DATA | NO DATA | NO DATA |
| pyogenes | ||||
| Streptococcus | SSI-1 | NO DATA | NO DATA | NO DATA |
| pyogenes | ||||
| Streptococcus | MGAS10394 | NO DATA | NO DATA | NO DATA |
| pyogenes | ||||
| Streptococcus | Manfredo (M5) | NO DATA | NO DATA | NO DATA |
| pyogenes | ||||
| Streptococcus | SF370 (M1) | NO DATA | NO DATA | NO DATA |
| pyogenes | ||||
| Streptococcus | 670 | NO DATA | NO DATA | NO DATA |
| pneumoniae | ||||
| Streptococcus | R6 | NO DATA | NO DATA | NO DATA |
| pneumoniae | ||||
| Streptococcus | TIGR4 | NO DATA | NO DATA | NO DATA |
| pneumoniae | ||||
| Streptococcus | NCTC7868 | NO DATA | NO DATA | NO DATA |
| gordonii | ||||
| Streptococcus | NCTC 12261 | NO DATA | NO DATA | NO DATA |
| mitis | ||||
| Streptococcus | UA159 | NO DATA | NO DATA | NO DATA |
| mutans | ||||
| TABLE 7E |
| Base Compositions of Common Respiratory Pathogens for Bioagent Identifying |
| Amplicons Corresponding to Primer Pair Nos: 362, 363, and 367 |
| Primer 362 | Primer 363 | Primer 367 | ||
| Organism | Strain | [A G C T] | [A G C T] | [A G C T] |
| Klebsiella | MGH78578 | [21 33 22 16] | [16 34 26 26] | NO DATA |
| pneumoniae | ||||
| Yersinia pestis | CO-92 Biovar | [20 34 18 20] | NO DATA | NO DATA |
| Orientalis | ||||
| Yersinia pestis | KIM5 P12 (Biovar | [20 34 18 20] | NO DATA | NO DATA |
| Mediaevalis) | ||||
| Yersinia pestis | 91001 | [20 34 18 20] | NO DATA | NO DATA |
| Haemophilus | KW20 | NO DATA | NO DATA | NO DATA |
| influenzae | ||||
| Pseudomonas | PAO1 | [19 35 21 17] | [16 36 28 22] | NO DATA |
| aeruginosa | ||||
| Pseudomonas | Pf0-1 | NO DATA | [18 35 26 23] | NO DATA |
| fluorescens | ||||
| Pseudomonas | KT2440 | NO DATA | [16 35 28 23] | NO DATA |
| putida | ||||
| Legionella | Philadelphia-1 | NO DATA | NO DATA | NO DATA |
| pneumophila | ||||
| Francisella | schu 4 | NO DATA | NO DATA | NO DATA |
| tularensis | ||||
| Bordetella | Tohama I | [20 31 24 17] | [15 34 32 21] | [26 25 34 19] |
| pertussis | ||||
| Burkholderia | J2315 | [20 33 21 18] | [15 36 26 25] | [25 27 32 20] |
| cepacia | ||||
| Burkholderia | K96243 | [19 34 19 20] | [15 37 28 22] | [25 27 32 20] |
| pseudomallei | ||||
| Neisseria | FA 1090, ATCC 700825 | NO DATA | NO DATA | NO DATA |
| gonorrhoeae | ||||
| Neisseria | MC58 (serogroup B) | NO DATA | NO DATA | NO DATA |
| meningitidis | ||||
| Neisseria | serogroup C, FAM18 | NO DATA | NO DATA | NO DATA |
| meningitidis | ||||
| Neisseria | Z2491 (serogroup A) | NO DATA | NO DATA | NO DATA |
| meningitidis | ||||
| Chlamydophila | TW-183 | NO DATA | NO DATA | NO DATA |
| pneumoniae | ||||
| Chlamydophila | AR39 | NO DATA | NO DATA | NO DATA |
| pneumoniae | ||||
| Chlamydophila | CWL029 | NO DATA | NO DATA | NO DATA |
| pneumoniae | ||||
| Chlamydophila | J138 | NO DATA | NO DATA | NO DATA |
| pneumoniae | ||||
| Corynebacterium | NCTC13129 | NO DATA | NO DATA | NO DATA |
| diphtheriae | ||||
| Mycobacterium | k10 | [19 34 23 16] | NO DATA | [24 26 35 19] |
| avium | ||||
| Mycobacterium | 104 | [19 34 23 16] | NO DATA | [24 26 35 19] |
| avium | ||||
| Mycobacterium | CSU#93 | [19 31 25 17] | NO DATA | [25 25 34 20] |
| tuberculosis | ||||
| Mycobacterium | CDC 1551 | [19 31 24 18] | NO DATA | [25 25 34 20] |
| tuberculosis | ||||
| Mycobacterium | H37Rv (lab strain) | [19 31 24 18] | NO DATA | [25 25 34 20] |
| tuberculosis | ||||
| Mycoplasma | M129 | NO DATA | NO DATA | NO DATA |
| pneumoniae | ||||
| Staphylococcus | MRSA252 | NO DATA | NO DATA | NO DATA |
| aureus | ||||
| Staphylococcus | MSSA476 | NO DATA | NO DATA | NO DATA |
| aureus | ||||
| Staphylococcus | COL | NO DATA | NO DATA | NO DATA |
| aureus | ||||
| Staphylococcus | Mu50 | NO DATA | NO DATA | NO DATA |
| aureus | ||||
| Staphylococcus | MW2 | NO DATA | NO DATA | NO DATA |
| aureus | ||||
| Staphylococcus | N315 | NO DATA | NO DATA | NO DATA |
| aureus | ||||
| Staphylococcus | NCTC 8325 | NO DATA | NO DATA | NO DATA |
| aureus | ||||
| Streptococcus | NEM316 | NO DATA | NO DATA | NO DATA |
| agalactiae | ||||
| Streptococcus | NC_002955 | NO DATA | NO DATA | NO DATA |
| equi | ||||
| Streptococcus | MGAS8232 | NO DATA | NO DATA | NO DATA |
| pyogenes | ||||
| Streptococcus | MGAS315 | NO DATA | NO DATA | NO DATA |
| pyogenes | ||||
| Streptococcus | SSI-1 | NO DATA | NO DATA | NO DATA |
| pyogenes | ||||
| Streptococcus | MGAS10394 | NO DATA | NO DATA | NO DATA |
| pyogenes | ||||
| Streptococcus | Manfredo (M5) | NO DATA | NO DATA | NO DATA |
| pyogenes | ||||
| Streptococcus | SF370 (M1) | NO DATA | NO DATA | NO DATA |
| pyogenes | ||||
| Streptococcus | 670 | NO DATA | NO DATA | NO DATA |
| pneumoniae | ||||
| Streptococcus | R6 | [20 30 19 23] | NO DATA | NO DATA |
| pneumoniae | ||||
| Streptococcus | TIGR4 | [20 30 19 23] | NO DATA | NO DATA |
| pneumoniae | ||||
| Streptococcus | NCTC7868 | NO DATA | NO DATA | NO DATA |
| gordonii | ||||
| Streptococcus | NCTC 12261 | NO DATA | NO DATA | NO DATA |
| mitis | ||||
| Streptococcus | UA159 | NO DATA | NO DATA | NO DATA |
| mutans | ||||
Four sets of throat samples from military recruits at different military facilities taken at different time points were analyzed using the primers of the present invention. The first set was collected at a military training center from November 1 to Dec. 20, 2002 during one of the most severe outbreaks of pneumonia associated with group A Streptococcus in the United States since 1968. During this outbreak, fifty-one throat swabs were taken from both healthy and hospitalized recruits and plated on blood agar for selection of putative group A Streptococcus colonies. A second set of 15 original patient specimens was taken during the height of this group A Streptococcus-associated respiratory disease outbreak. The third set were historical samples, including twenty-seven isolates of group A Streptococcus, from disease outbreaks at this and other military training facilities during previous years. The fourth set of samples was collected from five geographically separated military facilities in the continental U.S. in the winter immediately following the severe November/December 2002 outbreak.
Pure colonies isolated from group A Streptococcus-selective media from all four collection periods were analyzed with the surveillance primer set. All samples showed base compositions that precisely matched the four completely sequenced strains of Streptococcus pyogenes. Shown in FIG. 4 is a 3D diagram of base composition (axes A, G and C) of bioagent identifying amplicons obtained with primer pair number 14 (a precursor of primer pair number 348 which targets 16S rRNA). The diagram indicates that the experimentally determined base compositions of the clinical samples closely match the base compositions expected for Streptococcus pyogenes and are distinct from the expected base compositions of other organisms.
In addition to the identification of Streptococcus pyogenes, other potentially pathogenic organisms were identified concurrently. Mass spectral analysis of a sample whose nucleic acid was amplified by primer pair number 349 (SEQ ID NOs: 401:1156) exhibited signals of bioagent identifying amplicons with molecular masses that were found to correspond to analogous base compositions of bioagent identifying amplicons of Streptococcus pyogenes (A27 G32 C24 T18), Neisseria meningitidis (A25 G27 C22 T18), and Haemophilus influenzae (A28 G28 C25 T20) (see FIG. 5 and Table 7B). These organisms were present in a ratio of 4:5:20 as determined by comparison of peak heights with peak height of an internal PCR calibration standard as described in commonly owned U.S. Patent Application Ser. No. 60/545,425 which is incorporated herein by reference in its entirety.
Since certain division-wide primers that target housekeeping genes are designed to provide coverage of specific divisions of bacteria to increase the confidence level for identification of bacterial species, they are not expected to yield bioagent identifying amplicons for organisms outside of the specific divisions. For example, primer pair number 356 (SEQ ID NOs: 449:1380) primarily amplifies the nucleic acid of members of the classes Bacilli and Clostridia and is not expected to amplify proteobacteria such as Neisseria meningitidis and Haemophilus influenzae. As expected, analysis of the mass spectrum of amplification products obtained with primer pair number 356 does not indicate the presence of Neisseria meningitidis and Haemophilus influenzae but does indicate the presence of Streptococcus pyogenes (FIGS. 3 and 6, Table 7B). Thus, these primers or types of primers can confirm the absence of particular bioagents from a sample.
The 15 throat swabs from military recruits were found to contain a relatively small set of microbes in high abundance. The most common were Haemophilus influenza, Neisseria meningitides, and Streptococcus pyogenes. Staphylococcus epidermidis, Moraxella cattarhalis, Corynebacterium pseudodiphtheriticum, and Staphylococcus aureus were present in fewer samples. An equal number of samples from healthy volunteers from three different geographic locations, were identically analyzed. Results indicated that the healthy volunteers have bacterial flora dominated by multiple, commensal non-beta-hemolytic Streptococcal species, including the viridans group streptococci (S. parasangunis, S. vestibularis, S. mitis, S. oralis and S. pneumoniae; data not shown), and none of the organisms found in the military recruits were found in the healthy controls at concentrations detectable by mass spectrometry. Thus, the military recruits in the midst of a respiratory disease outbreak had a dramatically different microbial population than that experienced by the general population in the absence of epidemic disease.
Example 7 Triangulation Genotyping Analysis for Determination of emm-Type of Streptococcus pyogenes in Epidemic SurveillanceAs a continuation of the epidemic surveillance investigation of Example 6, determination of sub-species characteristics (genotyping) of Streptococcus pyogenes, was carried out based on a strategy that generates strain-specific signatures according to the rationale of Multi-Locus Sequence Typing (MLST). In classic MLST analysis, internal fragments of several housekeeping genes are amplified and sequenced (Enright et al. Infection and Immunity, 2001, 69, 2416-2427). In classic MLST analysis, internal fragments of several housekeeping genes are amplified and sequenced. In the present investigation, bioagent identifying amplicons from housekeeping genes were produced using drill-down primers and analyzed by mass spectrometry. Since mass spectral analysis results in molecular mass, from which base composition can be determined, the challenge was to determine whether resolution of emm classification of strains of Streptococcus pyogenes could be determined.
For the purpose of development of a triangulation genotyping assay, an alignment was constructed of concatenated alleles of seven MLST housekeeping genes (glucose kinase (gki), glutamine transporter protein (gtr), glutamate racemase (murI), DNA mismatch repair protein (mutS), xanthine phosphoribosyl transferase (xpt), and acetyl-CoA acetyl transferase (yqiL)) from each of the 212 previously emm-typed strains of Streptococcus pyogenes. From this alignment, the number and location of primer pairs that would maximize strain identification via base composition was determined. As a result, 6 primer pairs were chosen as standard drill-down primers for determination of emm-type of Streptococcus pyogenes. These six primer pairs are displayed in Table 8. This drill-down set comprises primers with T modifications (note TMOD designation in primer names) which constitutes a functional improvement with regard to prevention of non-templated adenylation (vide supra) relative to originally selected primers which are displayed below in the same row.
| TABLE 8 |
| Triangulation Genotyping Analysis Primer Pairs for Group A Streptococcus Drill-Down |
| Reverse | |||||
| Primer | |||||
| Primer | Forward Primer | (SEQ | Target | ||
| Pair No. | Forward Primer Name | (SEQ ID NO:) | Reverse Primer Name | ID NO:) | Gene |
| 442 | SP101_SPET11_358_387_TMOD_F | 588 | SP101_SPET11_448_473_TMOD_R | 998 | gki |
| 80 | SP101_SPET11_358_387_F | 126 | SP101_SPET11_448_473_TMOD_R | 766 | gki |
| 443 | SP101_SPET11_600_629_TMOD_F | 348 | SP101_SPET11_686_714_TMOD_R | 1018 | gtr |
| 81 | SP101_SPET11_600_629_F | 62 | SP101_SPET11_686_714_R | 772 | gtr |
| 426 | SP101_SPET11_1314_1336_TMOD_F | 363 | SP101_SPET11_1403_1431_TMOD_R | 849 | murI |
| 86 | SP101_SPET11_1314_1336_F | 68 | SP101_SPET11_1403_1431_R | 711 | murI |
| 430 | SP101_SPET11_1807_1835_TMOD_F | 235 | SP101_SPET11_1901_1927_TMOD_R | 1439 | mutS |
| 90 | SP101_SPET11_1807_1835_F | 33 | SP101_SPET11_1901_1927_R | 1412 | mutS |
| 438 | SP101_SPET11_3075_3103_TMOD_F | 473 | SP101_SPET11_3168_3196_TMOD_R | 875 | xpt |
| 96 | SP101_SPET11_3075_3103_F | 108 | SP101_SPET11_3168_3196_R | 715 | xpt |
| 441 | SP101_SPET11_3511_3535_TMOD_F | 531 | SP101_SPET11_3605_3629_TMOD_R | 1294 | yqiL |
| 98 | SP101_SPET11_3511_3535_F | 116 | SP101_SPET11_3605_3629_R | 832 | yqiL |
The primers of Table 8 were used to produce bioagent identifying amplicons from nucleic acid present in the clinical samples. The bioagent identifying amplicons which were subsequently analyzed by mass spectrometry and base compositions corresponding to the molecular masses were calculated.
Of the 51 samples taken during the peak of the November/December 2002 epidemic (Table 9A-C rows 1-3), all except three samples were found to represent emm3, a Group A Streptococcus genotype previously associated with high respiratory virulence. The three outliers were from samples obtained from healthy individuals and probably represent non-epidemic strains. Archived samples (Tables 9A-C rows 5-13) from historical collections showed a greater heterogeneity of base compositions and emm types as would be expected from different epidemics occurring at different places and dates. The results of the mass spectrometry analysis and emm gene sequencing were found to be concordant for the epidemic and historical samples.
| TABLE 9A |
| Base Composition Analysis of Bioagent Identifying Amplicons of Group A Streptococcus |
| samples from Six Military Installations Obtained with Primer Pair Nos. 426 and 430 |
| emm-type by | m urI | mutS | ||||
| # of | Mass | emm-Gene | Location | (Primer Pair | (Primer Pair | |
| Instances | Spectrometry | Sequencing | (sample) | Year | No. 426) | No. 430) |
| 48 | 3 | 3 | MCRD San | 2002 | A39 G25 C20 T34 | A38 G27 C23 T33 |
| 2 | 6 | 6 | Diego | A40 G24 C20 T34 | A38 G27 C23 T33 | |
| 1 | 28 | 28 | (Cultured) | A39 G25 C20 T34 | A38 G27 C23 T33 | |
| 15 | 3 | ND | A39 G25 C20 T34 | A38 G27 C23 T33 | ||
| 6 | 3 | 3 | NHRC San | 2003 | A39 G25 C20 T34 | A38 G27 C23 T33 |
| 3 | 5, 58 | 5 | Diego- | A40 G24 C20 T34 | A38 G27 C23 T33 | |
| 6 | 6 | 6 | Archive | A40 G24 C20 T34 | A38 G27 C23 T33 | |
| 1 | 11 | 11 | (Cultured) | A39 G25 C20 T34 | A38 G27 C23 T33 | |
| 3 | 12 | 12 | A40 G24 C20 T34 | A38 G26 C24 T33 | ||
| 1 | 22 | 22 | A39 G25 C20 T34 | A38 G27 C23 T33 | ||
| 3 | 25, 75 | 75 | A39 G25 C20 T34 | A38 G27 C23 T33 | ||
| 4 | 44/61, 82, 9 | 44/61 | A40 G24 C20 T34 | A38 G26 C24 T33 | ||
| 2 | 53, 91 | 91 | A39 G25 C20 T34 | A38 G27 C23 T33 | ||
| 1 | 2 | 2 | Ft. | 2003 | A39 G25 C20 T34 | A38 G27 C24 T32 |
| 2 | 3 | 3 | Leonard | A39 G25 C20 T34 | A38 G27 C24 T33 | |
| 1 | 4 | 4 | Wood | A39 G25 C20 T34 | A38 G27 C23 T33 | |
| 1 | 6 | 6 | (Cultured) | A40 G24 C20 T34 | A38 G27 C23 T33 | |
| 11 | 25 or 75 | 75 | A39 G25 C20 T34 | A38 G27 C23 T33 | ||
| 1 | 25, 75, 33, | 75 | A39 G25 C20 T34 | A38 G27 C23 T33 | ||
| 34, 4, 52, 84 | ||||||
| 1 | 44/61 or 82 | 44/61 | A40 G24 C20 T34 | A38 G26 C24 T33 | ||
| or 9 | 44/61 | |||||
| 2 | 5 or 58 | 5 | A40 G24 C20 T34 | A38 G27 C23 T33 | ||
| 3 | 1 | 1 | Ft. Sill | 2003 | A40 G24 C20 T34 | A38 G27 C23 T33 |
| 2 | 3 | 3 | (Cultured) | A39 G25 C20 T34 | A38 G27 C23 T33 | |
| 1 | 4 | 4 | A39 G25 C20 T34 | A38 G27 C23 T33 | ||
| 1 | 28 | 28 | A39 G25 C20 T34 | A38 G27 C23 T33 | ||
| 1 | 3 | 3 | Ft. | 2003 | A39 G25 C20 T34 | A38 G27 C23 T33 |
| 1 | 4 | 4 | Benning | A39 G25 C20 T34 | A38 G27 C23 T33 | |
| 3 | 6 | 6 | (Cultured) | A40 G24 C20 T34 | A38 G27 C23 T33 | |
| 1 | 11 | 11 | A39 G25 C20 T34 | A38 G27 C23 T33 | ||
| 1 | 13 | 94** | A40 G24 C20 T34 | A38 G27 C23 T33 | ||
| 1 | 44/61 or 82 | 82 | A40 G24 C20 T34 | A38 G26 C24 T33 | ||
| or 9 | ||||||
| 1 | 5 or 58 | 58 | A40 G24 C20 T34 | A38 G27 C23 T33 | ||
| 1 | 78 or 89 | 89 | A39 G25 C20 T34 | A38 G27 C23 T33 | ||
| 2 | 5 or 58 | ND | Lackland | 2003 | A40 G24 C20 T34 | A38 G27 C23 T33 |
| 1 | 2 | AFB | A39 G25 C20 T34 | A38 G27 C24 T32 | ||
| 1 | 81 or 90 | (Throat | A40 G24 C20 T34 | A38 G27 C23 T33 | ||
| 1 | 78 | Swabs) | A38 G26 C20 T34 | A38 G27 C23 T33 | ||
| 3*** | No detection | No detection | No detection | |||
| 7 | 3 | ND | MCRD San | 2002 | A39 G25 C20 T34 | A38 G27 C23 T33 |
| 1 | 3 | ND | Diego | No detection | A38 G27 C23 T33 | |
| 1 | 3 | ND | (Throat | No detection | No detection | |
| 1 | 3 | ND | Swabs) | No detection | No detection | |
| 2 | 3 | ND | No detection | A38 G27 C23 T33 | ||
| 3 | No detection | ND | No detection | No detection | ||
| TABLE 9B |
| Base Composition Analysis of Bioagent Identifying Amplicons of Group A Streptococcus |
| samples from Six Military Installations Obtained with Primer Pair Nos. 438 and 441 |
| emm-type by | xpt | yqiL | ||||
| # of | Mass | emm-Gene | Location | (Primer Pair | (Primer Pair | |
| Instances | Spectrometry | Sequencing | (sample) | Year | No. 438) | No. 441) |
| 48 | 3 | 3 | MCRD San | 2002 | A30 G36 C20 T36 | A40 G29 C19 T31 |
| 2 | 6 | 6 | Diego | A30 G36 C20 T36 | A40 G29 C19 T31 | |
| 1 | 28 | 28 | (Cultured) | A30 G36 C20 T36 | A41 G28 C18 T32 | |
| 15 | 3 | ND | A30 G36 C20 T36 | A40 G29 C19 T31 | ||
| 6 | 3 | 3 | NHRC San | 2003 | A30 G36 C20 T36 | A40 G29 C19 T31 |
| 3 | 5, 58 | 5 | Diego- | A30 G36 C20 T36 | A40 G29 C19 T31 | |
| 6 | 6 | 6 | Archive | A30 G36 C20 T36 | A40 G29 C19 T31 | |
| 1 | 11 | 11 | (Cultured) | A30 G36 C20 T36 | A40 G29 C19 T31 | |
| 3 | 12 | 12 | A30 G36 C19 T37 | A40 G29 C19 T31 | ||
| 1 | 22 | 22 | A30 G36 C20 T36 | A40 G29 C19 T31 | ||
| 3 | 25, 75 | 75 | A30 G36 C20 T36 | A40 G29 C19 T31 | ||
| 4 | 44/61, 82, 9 | 44/61 | A30 G36 C20 T36 | A41 G28 C19 T31 | ||
| 2 | 53, 91 | 91 | A30 G36 C19 T37 | A40 G29 C19 T31 | ||
| 1 | 2 | 2 | Ft. | 2003 | A30 G36 C20 T36 | A40 G29 C19 T31 |
| 2 | 3 | 3 | Leonard | A30 G36 C20 T36 | A40 G29 C19 T31 | |
| 1 | 4 | 4 | Wood | A30 G36 C19 T37 | A41 G28 C19 T31 | |
| 1 | 6 | 6 | (Cultured) | A30 G36 C20 T36 | A40 G29 C19 T31 | |
| 11 | 25 or 75 | 75 | A30 G36 C19 T37 | A40 G29 C19 T31 | ||
| 1 | 25, 75, 33, | 75 | A30 G36 C19 T37 | A40 G29 C19 T31 | ||
| 34, 4, 52, 84 | ||||||
| 1 | 44/61 or 82 | 44/61 | A30 G36 C20 T36 | A41 G28 C19 T31 | ||
| or 9 | ||||||
| 2 | 5 or 58 | 5 | A30 G36 C20 T36 | A40 G29 C19 T31 | ||
| 3 | 1 | 1 | Ft. Sill | 2003 | A30 G36 C19 T37 | A40 G29 C19 T31 |
| 2 | 3 | 3 | (Cultured) | A30 G36 C20 T36 | A40 G29 C19 T31 | |
| 1 | 4 | 4 | A30 G36 C19 T37 | A41 G28 C19 T31 | ||
| 1 | 28 | 28 | A30 G36 C20 T36 | A41 G28 C18 T32 | ||
| 1 | 3 | 3 | Ft. | 2003 | A30 G36 C20 T36 | A40 G29 C19 T31 |
| 1 | 4 | 4 | Benning | A30 G36 C19 T37 | A41 G28 C19 T31 | |
| 3 | 6 | 6 | (Cultured) | A30 G36 C20 T36 | A40 G29 C19 T31 | |
| 1 | 11 | 11 | A30 G36 C20 T36 | A40 G29 C19 T31 | ||
| 1 | 13 | 94** | A30 G36 C20 T36 | A41 G28 C19 T31 | ||
| 1 | 44/61 or 82 | 82 | A30 G36 C20 T36 | A41 G28 C19 T31 | ||
| or 9 | ||||||
| 1 | 5 or 58 | 58 | A30 G36 C20 T36 | A40 G29 C19 T31 | ||
| 1 | 78 or 89 | 89 | A30 G36 C20 T36 | A41 G28 C19 T31 | ||
| 2 | 5 or 58 | ND | Lackland | 2003 | A30 G36 C20 T36 | A40 G29 C19 31 |
| 1 | 2 | AFB | A30 G36 C20 T36 | A40 G29 C19 T31 | ||
| 1 | 81 or 90 | (Throat | A30 G36 C20 T36 | A40 G29 C19 T31 | ||
| 1 | 78 | Swabs) | A30 G36 C20 T36 | A41 G28 C19 T31 | ||
| 3*** | No detection | No detection | No detection | |||
| 7 | 3 | ND | MCRD San | 2002 | A30 G36 C20 T36 | A40 G29 C19 T31 |
| 1 | 3 | ND | Diego | A30 G36 C20 T36 | A40 G29 C19 T31 | |
| 1 | 3 | ND | (Throat | A30 G36 C20 T36 | No detection | |
| 1 | 3 | ND | Swabs) | No detection | A40 G29 C19 T31 | |
| 2 | 3 | ND | ND | A30 G36 C20 T36 | A40 G29 C19 T31 | |
| 3 | No detection | ND | No detection | No detection | ||
| TABLE 9C |
| Base Composition Analysis of Bioagent Identifying Amplicons of Group A Streptococcus |
| samples from Six Military Installations Obtained with Primer Pair Nos. 438 and 441 |
| emm-type by | gki | gtr | ||||
| # of | Mass | emm-Gene | Location | (Primer Pair | ((Primer Pair | |
| Instances | Spectrometry | Sequencing | (sample) | Year | No. 442) | No. 443) |
| 48 | 3 | 3 | MCRD San | 2002 | A32 G35 C17 T32 | A39 G28 G16 T32 |
| 2 | 6 | 6 | Diego | A31 G35 C17 T33 | A39 G28 C15 T33 | |
| 1 | 28 | 28 | (Cultured) | A30 G36 C17 T33 | A39 G28 C16 T32 | |
| 15 | 3 | ND | A32 G35 C17 T32 | A39 G28 C16 T32 | ||
| 6 | 3 | 3 | NHRC San | 2003 | A32 G35 C17 T32 | A39 G28 C16 T32 |
| 3 | 5, 58 | 5 | Diego- | A30 G36 C20 T30 | A39 G28 C15 T33 | |
| 6 | 6 | 6 | Archive | A31 G35 C17 T33 | A39 G28 C15 T33 | |
| 1 | 11 | 11 | (Cultured) | A30 G36 C20 T30 | A39 G28 C16 T32 | |
| 3 | 12 | 12 | A31 G35 C17 T33 | A39 G28 C15 T33 | ||
| 1 | 22 | 22 | A31 G35 C17 T33 | A38 G29 C15 T33 | ||
| 3 | 25, 75 | 75 | A30 G36 C17 T33 | A39 G28 C15 T33 | ||
| 4 | 44/61, 82, 9 | 44/61 | A30 G36 C18 T32 | A39 G28 C15 T33 | ||
| 2 | 53, 91 | 91 | A32 G35 C17 T32 | A39 G28 C16 T32 | ||
| 1 | 2 | 2 | Ft. | 2003 | A30 G36 C17 T33 | A39 G28 C15 T33 |
| 2 | 3 | 3 | Leonard | A32 G35 C17 T32 | A39 G28 C16 T32 | |
| 1 | 4 | 4 | Wood | A31 G35 C17 T33 | A39 G28 C15 T33 | |
| 1 | 6 | 6 | (Cultured) | A31 G35 C17 T33 | A39 G28 C15 T33 | |
| 11 | 25 or 75 | A30 G36 C17 T33 | A39 G28 C15 T33 | |||
| 1 | 25,75, 33, | 75 | A30 G36 C17 T33 | A39 G28 C15 T33 | ||
| 34, 4, 52, 84 | ||||||
| 1 | 44/61 or 82 | 44/61 | A30 G36 C18 T32 | A39 G28 C15 T33 | ||
| or 9 | ||||||
| 2 | 5 or 58 | 5 | A30 G36 C20 T30 | A39 G28 C15 T33 | ||
| 3 | 1 | 1 | Ft. Sill | 2003 | A30 G36 C18 T32 | A39 G28 C15 T33 |
| 2 | 3 | 3 | (Cultured) | A32 G35 C17 T32 | A39 G28 C16 T32 | |
| 1 | 4 | 4 | A31 G35 C17 T33 | A39 G28 C15 T33 | ||
| 1 | 28 | 28 | A30 G36 C17 T33 | A39 G28 C16 T32 | ||
| 1 | 3 | 3 | Ft. | 2003 | A32 G35 C17 T32 | A39 G28 C16 T32 |
| 1 | 4 | 4 | Benning | A31 G35 C17 T33 | A39 G28 C15 T33 | |
| 3 | 6 | 6 | (Cultured) | A31 G35 C17 T33 | A39 G28 C15 T33 | |
| 1 | 11 | 11 | A30 G36 C20 T30 | A39 G28 C16 T32 | ||
| 1 | 13 | 94** | A30 G36 C19 T31 | A39 G28 C15 T33 | ||
| 1 | 44/61 or 82 | 82 | A30 G36 C18 T32 | A39 G28 C15 T33 | ||
| or 9 | ||||||
| 1 | 5 or 58 | 58 | A30 G36 C20 T30 | A39 G28 C15 T33 | ||
| 1 | 78 or 89 | 89 | A30 G36 C18 T32 | A39 G28 C15 T33 | ||
| 2 | 5 or 58 | ND | Lecklend | 2003 | A30 G36 C20 T30 | A39 G28 C15 T33 |
| 1 | 2 | AFB | A30 G36 C17 T33 | A39 G28 C15 T33 | ||
| 1 | 81 or 90 | (Throat | A30 G36 C17 T33 | A39 G28 C15 T33 | ||
| 1 | 78 | Swabs) | A30 G36 C18 T32 | A39 G28 C15 T33 | ||
| 3*** | No detection | No detection | No detection | |||
| 7 | 3 | ND | MCRD San | 2002 | A32 G35 C17 T32 | A39 G28 C16 T32 |
| 1 | 3 | ND | Diego | No detection | No detection | |
| 1 | 3 | ND | (Throat | A32 G35 C17 T32 | A39 G28 C16 T32 | |
| 1 | 3 | ND | Swabs) | A32 G35 C17 T32 | No detection | |
| 2 | 3 | ND | A32 G35 C17 T32 | No detection | ||
| 3 | No detection | ND | No detection | No detection | ||
This example describes the design of 19 calibrant polynucleotides based on bacterial bioagent identifying amplicons corresponding to the primers of the broad surveillance set (Table 5) and the Bacillus anthracis drill-down set (Table 6).
Calibration sequences were designed to simulate bacterial bioagent identifying amplicons produced by the T modified primer pairs shown in Tables 5 and 6 (primer names have the designation “TMOD”). The calibration sequences were chosen as a representative member of the section of bacterial genome from specific bacterial species which would be amplified by a given primer pair. The model bacterial species upon which the calibration sequences are based are also shown in Table 10. For example, the calibration sequence chosen to correspond to an amplicon produced by primer pair no. 361 is SEQ ID NO: 1445. In Table 10, the forward OF) or reverse OR) primer name indicates the coordinates of an extraction representing a gene of a standard reference bacterial genome to which the primer hybridizes e.g.: the forward primer name 16 S_EC—713—732_TMOD_F indicates that the forward primer hybridizes to residues 713-732 of the gene encoding 16S ribosomal RNA in an E. coli reference sequence (in this case, the reference sequence is an extraction consisting of residues 4033120-4034661 of the genomic sequence of E. coli K12 (GenBank gi number 16127994). Additional gene coordinate reference information is shown in Table 11. The designation “TMOD” in the primer names indicates that the 5′ end of the primer has been modified with a non-matched template T residue which prevents the PCR polymerase from adding non-templated adenosine residues to the 5′ end of the amplification product, an occurrence which may result in miscalculation of base composition from molecular mass data (vide supra).
The 19 calibration sequences described in Tables 10 and 11 were combined into a single calibration polynucleotide sequence (SEQ ID NO: 1464—which is herein designated a “combination calibration polynucleotide”) which was then cloned into a pCR®-Blunt vector (Invitrogen, Carlsbad, Calif.). This combination calibration polynucleotide can be used in conjunction with the primers of Tables 5 or 6 as an internal standard to produce calibration amplicons for use in determination of the quantity of any bacterial bioagent. Thus, for example, when the combination calibration polynucleotide vector is present in an amplification reaction mixture, a calibration amplicon based on primer pair 346 (16S rRNA) will be produced in an amplification reaction with primer pair 346 and a calibration amplicon based on primer pair 363 (rpoC) will be produced with primer pair 363. Coordinates of each of the 19 calibration sequences within the calibration polynucleotide (SEQ ID NO: 1464) are indicated in Table 11.
| TABLE 10 |
| Bacterial Primer Pairs for Production of Bacterial Bioagent Identifying |
| Amplicons and Corresponding Representative Calibration Sequences |
| Forward | Reverse | Calibration | Calibration | |||
| Primer | Primer | Sequence | Sequence | |||
| Primer | (SEQ ID | (SEQ ID | Model | (SEQ ID | ||
| Pair No. | Forward Primer Name | No:) | Reverse Primer Name | No:) | Species | No:) |
| 361 | 16S_EC_1090 1111_2_TMOD_F | 697 | 16S_EC_1175_1196_TMOD_R | 1398 | Bacillus | 1445 |
| anthracis | ||||||
| 346 | 16S_EC_713_732_TMOD_F | 202 | 16S_EC_789_809_TMOD_R | 1110 | Bacillus | 1446 |
| anthracis | ||||||
| 347 | 16S_EC_785_806_TMOD_F | 560 | 16S_EC_880_897_TMOD_R | 1278 | Bacillus | 1447 |
| anthracis | ||||||
| 348 | 16S_EC_960_981_TMOD_F | 706 | 16S_EC_1054_1073_TMOD_R | 895 | Bacillus | 1448 |
| anthracis | ||||||
| 349 | 23S_EC_1826_1843_TMOD_F | 401 | 23S_EC_1906_1924_TMOD_R | 1156 | Bacillus | 1449 |
| anthracis | ||||||
| 360 | 23S_EC_2646_2667_TMOD_F | 409 | 23S_EC_2745_2765_TMOD_R | 1434 | Bacillus | 1450 |
| anthracis | ||||||
| 350 | CAPC_BA_274_303_TMOD_F | 476 | CAPC_BA_349_376_TMOD_R | 1314 | Bacillus | 1451 |
| anthracis | ||||||
| 351 | CYA_BA_1353_1379_TMOD_F | 355 | CYA_BA_1448_1467_TMOD_R | 1423 | Bacillus | 1452 |
| anthracis | ||||||
| 352 | INFB_EC_1365_1393_TMOD_F | 687 | INFB_EC_1439_1467_TMOD_R | 1411 | Bacillus | 1453 |
| anthracis | ||||||
| 353 | LEF_BA_756_781_TMOD_F | 220 | LEF_BA_843_872_TMOD_R | 1394 | Bacillus | 1454 |
| anthracis | ||||||
| 356 | RPLB_EC_650_679_TMOD_F | 449 | RPLB_EC_739_762_TMOD_R | 1380 | Clostridium | 1455 |
| botulinum | ||||||
| 449 | RPLB_EC_690_710_F | 309 | RPLB_EC_737_758_R | 1336 | Clostridium | 1456 |
| botulinum | ||||||
| 359 | RPOB_EC_1845_1866_TMOD_F | 659 | RPOB_EC_1909_1929_TMOD_R | 1250 | Yersinia | 1457 |
| Pestis | ||||||
| 362 | RPOB_EC_3799_3821_TMOD_F | 581 | RPOB_EC_3862_3888_TMOD_R | 1325 | Burkholderia | 1458 |
| mallei | ||||||
| 363 | RPOC_EC_2146_2174_TMOD_F | 284 | RPOC_EC_2227_2245_TMOD_R | 898 | Burkholderia | 1459 |
| mallei | ||||||
| 354 | RPOC_EC_2218_2241_TMOD_F | 405 | RPOC_EC_2313_2337_TMOD_R | 1072 | Bacillus | 1460 |
| anthracis | ||||||
| 355 | SSPE_BA_115_137_TMOD_F | 255 | SSPE_BA_197_222_TMOD_R | 1402 | Bacillus | 1461 |
| anthracis | ||||||
| 367 | TUFB_EC_957_979_TMOD_F | 308 | TUFB_EC_1034_1058_TMOD_R | 1276 | Burkholderia | 1462 |
| mallei | ||||||
| 358 | VALS_EC_1105_1124_TMOD_F | 385 | VALS_EC_1195_1218_TMOD_R | 1093 | Yersinia | 1463 |
| Pestis | ||||||
| TABLE 11 |
| Primer Pair Gene Coordinate References and Calibration Polynucleotide Sequence |
| Coordinates within the Combination Calibration Polynucleotide |
| Coordinates of | ||||
| Gene Extraction | Calibration Sequence in | |||
| Bacterial | Coordinates | Reference GenBank GI | Combination Calibration | |
| Gene and | of Genomic or Plasmid | No. of Genomic (G) or | Primer | Polynucleotide (SEQ ID |
| Species | Sequence | Plasmid (P) Sequence | Pair No. | NO: 1464) |
| 16S E. coli | 4033120 . . . 4034661 | 16127994 (G) | 346 | 16 . . . 109 |
| 16S E. coli | 4033120 . . . 4034661 | 16127994 (G) | 347 | 83 . . . 190 |
| 16S E. coli | 4033120 . . . 4034661 | 16127994 (G) | 348 | 246 . . . 353 |
| 16S E. coli | 4033120 . . . 4034661 | 16127994 (G) | 361 | 368 . . . 469 |
| 23S E. coli | 4166220 . . . 4169123 | 16127994 (G) | 349 | 743 . . . 837 |
| 23S E. coli | 4166220 . . . 4169123 | 16127994 (G) | 360 | 865 . . . 981 |
| rpoB E. coli. | 4178823 . . . 4182851 | 16127994 (G) | 359 | 1591 . . . 1672 |
| (complement strand) | ||||
| rpoB E. coli | 4178823 . . . 4182851 | 16127994 (G) | 362 | 2081 . . . 2167 |
| (complement strand) | ||||
| rpoC E. coli | 4182928 . . . 4187151 | 16127994 (G) | 354 | 1810 . . . 1926 |
| rpoC E. coli | 4182928 . . . 4187151 | 16127994 (G) | 363 | 2183 . . . 2279 |
| infB E. coli | 3313655 . . . 3310983 | 16127994 (G) | 352 | 1692 . . . 1791 |
| (complement strand) | ||||
| tufB E. coli | 4173523 . . . 4174707 | 16127994 (G) | 367 | 2400 . . . 2498 |
| rplB E. coli | 3449001 . . . 3448180 | 16127994 (G) | 356 | 1945 . . . 2060 |
| rplB E. coli | 3449001 . . . 3448180 | 16127994 (G) | 449 | 1986 . . . 2055 |
| valS E. coli | 4481405 . . . 4478550 | 16127994 (G) | 358 | 1462 . . . 1572 |
| (complement strand) | ||||
| capC | 56074 . . . 55628 | 6470151 (P) | 350 | 2517 . . . 2616 |
| B. anthracis | (complement strand) | |||
| cya | 156626 . . . 154288 | 4894216 (P) | 351 | 1338 . . . 1449 |
| B. anthracis | (complement strand) | |||
| lef | 127442 . . . 129921 | 4894216 (P) | 353 | 1121 . . . 1234 |
| B. anthracis | ||||
| sspE | 226496 . . . 226783 | 30253828 (G) | 355 | 1007-1104 |
| B. anthracis | ||||
The process described in this example is shown in FIG. 2. The capC gene is a gene involved in capsule synthesis which resides on the pX02 plasmid of Bacillus anthracis. Primer pair number 350 (see Tables 10 and 11) was designed to identify Bacillus anthracis via production of a bacterial bioagent identifying amplicon. Known quantities of the combination calibration polynucleotide vector described in Example 8 were added to amplification mixtures containing bacterial bioagent nucleic acid from a mixture of microbes which included the Ames strain of Bacillus anthracis. Upon amplification of the bacterial bioagent nucleic acid and the combination calibration polynucleotide vector with primer pair no. 350, bacterial bioagent identifying amplicons and calibration amplicons were obtained and characterized by mass spectrometry. A mass spectrum measured for the amplification reaction is shown in FIG. 7. The molecular masses of the bioagent identifying amplicons provided the means for identification of the bioagent from which they were obtained (Ames strain of Bacillus anthracis) and the molecular masses of the calibration amplicons provided the means for their identification as well. The relationship between the abundance (peak height) of the calibration amplicon signals and the bacterial bioagent identifying amplicon signals provides the means of calculation of the copies of the pX02 plasmid of the Ames strain of Bacillus anthracis. Methods of calculating quantities of molecules based on internal calibration procedures are well known to those of ordinary skill in the art.
Averaging the results of 10 repetitions of the experiment described above, enabled a calculation that indicated that the quantity of Ames strain of Bacillus anthracis present in the sample corresponds to approximately 10 copies of pX02 plasmid.
Example 10 Triangulation Genotyping Analysis of Campylobacter SpeciesA series of triangulation genotyping analysis primers were designed as described in Example 1 with the objective of identification of different strains of Campylobacter jejuni. The primers are listed in Table 12 with the designation “CJST_CJ.” Housekeeping genes to which the primers hybridize and produce bioagent identifying amplicons include: tkt (transketolase), glyA (serine hydroxymethyltransferase), gltA (citrate synthase), aspA (aspartate ammonia lyase), gInA (glutamine synthase), pgm (phosphoglycerate mutase), and uncA (ATP synthetase alpha chain).
| TABLE 12 |
| Campylobacter Genotyping Primer Pairs |
| Primer | |||||
| Pair | Forward Primer | Reverse Primer | |||
| No. | Forward Primer Name | (SEQ ID NO:) | Reverse Primer Name | (SEQ ID NO:) | Target Gene |
| 1053 | CJST_CJ_1080_1110_F | 681 | CJST_CJ_1166_1198_R | 1022 | gltA |
| 1047 | CJST_CJ_584_616_F | 315 | CJST_CJ_663_692_R | 1379 | glnA |
| 1048 | CJST_CJ_360_394_F | 346 | CJST_CJ_442_476_R | 955 | aspA |
| 1049 | CJST_CJ_2636_2668_F | 504 | CJST_CJ_2753_2777_R | 1409 | tkt |
| 1054 | CJST_CJ_2060_2090_F | 323 | CJST_CJ_2148_2174_R | 1068 | pgm |
| 1064 | CJST_CJ_1680_1713_F | 479 | CJST_CJ_1795_1822_R | 938 | glyA |
The primers were used to amplify nucleic acid from 50 food product samples provided by the USDA, 25 of which contained Campylobacter jejuni and 25 of which contained Campylobacter coli. Primers used in this study were developed primarily for the discrimination of Campylobacter jejuni clonal complexes and for distinguishing Campylobacter jejuni from Campylobacter coli. Finer discrimination between Campylobacter coli types is also possible by using specific primers targeted to loci where closely-related Campylobacter coli isolates demonstrate polymnorphisms between strains. The conclusions of the comparison of base composition analysis with sequence analysis are shown in Tables 13A-C.
| TABLE 13A |
| Results of Base Composition Analysis of 50 Campylobacter Samples with Drill-down |
| MLST Primer Pair Nos: 1048 and 1047 |
| Base | Base | ||||||
| Composition of | Composition of | ||||||
| MLST type or | Bioagent | Bioagent | |||||
| Clonal | MLST Type | Identifying | Identifying | ||||
| Complex by | or Clonal | Amplicon | Amplicon | ||||
| Base | Complex by | Obtained with | Obtained with | ||||
| Isolate | Composition | Sequence | Primer Pair No: | Primer Pair | |||
| Group | Species | origin | analysis | analysis | Strain | 1048 (aspA) | No: 1047 (glnA) |
| J-1 | C. jejuni | Goose | ST 690/ | ST 991 | RM3673 | A30 G25 C16 T46 | A47 G21 C16 T25 |
| 692/707/991 | |||||||
| J-2 | C. jejuni | Human | Complex | ST 356, | RM4192 | A30 G25 C16 T46 | A48 G21 C17 T23 |
| 206/48/353 | complex | ||||||
| 353 | |||||||
| J-3 | C. jejuni | Human | Complex | ST 436 | RM4194 | A30 G25 C15 T47 | A48 G21 C18 T22 |
| 354/179 | |||||||
| J-4 | C. jejuni | Human | Complex 257 | ST 257, | RM4197 | A30 G25 C16 T46 | A48 G21 C18 T22 |
| complex | |||||||
| 257 | |||||||
| J-5 | C. jejuni | Human | Complex 52 | ST 52, | RM4277 | A30 G25 C16 T46 | A48 G21 C17 T23 |
| complex 52 | |||||||
| J-6 | C. jejuni | Human | Complex 443 | ST 51, | RM4275 | A30 G25 C15 T47 | A48 G21 C17 T23 |
| complex | RM4279 | A30 G25 C15 T47 | A48 G21 C17 T23 | ||||
| 443 | |||||||
| J-7 | C. jejuni | Human | Complex 42 | ST 604, | RM1864 | A30 G25 C15 T47 | A48 G21 C18 T22 |
| complex 42 | |||||||
| J-8 | C. jejuni | Human | Complex | ST 362, | RM3193 | A30 G25 C15 T47 | A48 G21 C18 T22 |
| 42/49/362 | complex | ||||||
| 362 | |||||||
| J-9 | C. jejuni | Human | Complex | ST 147, | RM3203 | A30 G25 C15 T47 | A47 G21 C18 T23 |
| 45/283 | Complex 45 | ||||||
| C. jejuni | Human | Consistent | ST 828 | RM4183 | A31 G27 C20 T39 | A48 G21 C16 T24 | |
| C-1 | C. coli | with 74 | ST 832 | RM1169 | A31 G27 C20 T39 | A48 G21 C16 T24 | |
| closely | ST 1056 | RM1857 | A31 G27 C20 T39 | A48 G21 C16 T24 | |||
| Poultry | related | ST 889 | RM1166 | A31 G27 C20 T39 | A48 G21 C16 T24 | ||
| sequence | ST 829 | RM1182 | A31 G27 C20 T39 | A48 G21 C16 T24 | |||
| types (none | ST 1050 | RM1518 | A31 G27 C20 T39 | A48 G21 C16 T24 | |||
| belong to a | ST 1051 | RM1521 | A31 G27 C20 T39 | A48 G21 C16 T24 | |||
| clonal | ST 1053 | RM1523 | A31 G27 C20 T39 | A48 G21 C16 T24 | |||
| complex) | ST 1055 | RM1527 | A31 G27 C20 T39 | A48 G21 C16 T24 | |||
| ST 1017 | RM1529 | A31 G27 C20 T39 | A48 G21 C16 T24 | ||||
| ST 860 | RM1840 | A31 G27 C20 T39 | A48 G21 C16 T24 | ||||
| ST 1063 | RM2219 | A31 G27 C20 T39 | A48 G21 C16 T24 | ||||
| ST 1066 | RM2241 | A31 G27 C20 T39 | A48 G21 C16 T24 | ||||
| ST 1067 | RM2243 | A31 G27 C20 T39 | A48 G21 C16 T24 | ||||
| ST 1068 | RM2439 | A31 G27 C20 T39 | A48 G21 C16 T24 | ||||
| Swine | ST 1016 | RM3230 | A31 G27 C20 T39 | A48 G21 C16 T24 | |||
| ST 1069 | RM3231 | A31 G27 C20 T39 | A48 G21 C16 T24 | ||||
| ST 1061 | RM1904 | A31 G27 C20 T39 | A48 G21 C16 T24 | ||||
| Unknown | ST 825 | RM1534 | A31 G27 C20 T39 | A48 G21 C16 T24 | |||
| ST 901 | RM1505 | A31 G27 C20 T39 | A48 G21 C16 T24 | ||||
| C-2 | C. coli | Human | ST 895 | ST 895 | RM1532 | A31 G27 C19 T40 | A48 G21 C16 T24 |
| C-3 | C. coli | Poultry | Consistent | ST 1064 | RM2223 | A31 G27 C20 T39 | A48 G21 C16 T24 |
| with 63 | ST 1082 | RM1178 | A31 G27 C20 T39 | A48 G21 C16 T24 | |||
| closely | ST 1054 | RM1525 | A31 G27 C20 T39 | A48 G21 C16 T24 | |||
| related | ST 1049 | RM1517 | A31 G27 C20 T39 | A48 G21 C16 T24 | |||
| Marmoset | sequence | ST 891 | RM1531 | A31 G27 C20 T39 | A48 G21 C16 T24 | ||
| types (none | |||||||
| belong to a | |||||||
| clonal | |||||||
| complex) | |||||||
| TABLE 13B |
| Results of Base Composition Analysis of 50 Campylobacter Samples with Drill- |
| down MLST Primer Pair Nos: 1053 and 1064 |
| Base | Base | ||||||
| Composition of | Composition of | ||||||
| MLST type or | Bioagent | Bioagent | |||||
| Clonal | MLST Type | Identifying | Identifying | ||||
| Complex by | or Clonal | Amplicon | Amplicon | ||||
| Base | Complex by | Obtained with | Obtained with | ||||
| Isolate | Composition | Sequence | Primer Pair | Primer Pair | |||
| Group | Species | origin | analysis | analysis | Strain | No: 1053 (gltA) | No: 1064 (glyA) |
| J-1 | C. jejuni | Goose | ST 690/ | ST 991 | RM3673 | A24 G25 C23 T47 | A40 G29 C29 T45 |
| 692/707/991 | |||||||
| J-2 | C. jejuni | Human | Complex | ST 356, | RM4192 | A24 G25 C23 T47 | A40 G29 C29 T45 |
| 206/48/353 | complex | ||||||
| 353 | |||||||
| J-3 | C. jejuni | Human | Complex | ST 436 | RM4194 | A24 G25 C23 T47 | A40 G29 C29 T45 |
| 354/179 | |||||||
| J-4 | C. jejuni | Human | Complex 257 | ST 257, | RM4197 | A24 G25 C23 T47 | A40 G29 C29 T45 |
| complex | |||||||
| 257 | |||||||
| J-5 | C. jejuni | Human | Complex 52 | ST 52, | RM4277 | A24 G25 C23 T47 | A39 G30 C26 T48 |
| complex 52 | |||||||
| J-6 | C. jejuni | Human | Complex 443 | ST 51, | RM4275 | A24 G25 C23 T47 | A39 G30 C28 T46 |
| complex | RM4279 | A24 G25 C23 T47 | A39 G30 C28 T46 | ||||
| 443 | |||||||
| J-7 | C. jejuni | Human | Complex 42 | ST 604, | RM1864 | A24 G25 C23 T47 | A39 G30 C26 T48 |
| complex 42 | |||||||
| J-8 | C. jejuni | Human | Complex | ST 362, | RM3193 | A24 G25 C23 T47 | A38 G31 C28 T46 |
| 42/49/362 | complex | ||||||
| 362 | |||||||
| J-9 | C. jejuni | Human | Complex | ST 147, | RM3203 | A24 G25 C23 T47 | A38 G31 C28 T46 |
| 45/283 | Complex 45 | ||||||
| C. jejuni | Human | Consistent | ST 828 | RM4183 | A23 G24 C26 T46 | A39 G30 C27 T47 | |
| C-1 | C. coli | with 74 | ST 832 | RM1169 | A23 G24 C26 T46 | A39 G30 C27 T47 | |
| closely | ST 1056 | RM1857 | A23 G24 C26 T46 | A39 G30 C27 T47 | |||
| Poultry | related | ST 889 | RM1166 | A23 G24 C26 T46 | A39 G30 C27 T47 | ||
| sequence | ST 829 | RM1182 | A23 G24 C26 T46 | A39 G30 C27 T47 | |||
| types (none | ST 1050 | RM1518 | A23 G24 C26 T46 | A39 G30 C27 T47 | |||
| belong to a | ST 1051 | RM1521 | A23 G24 C26 T46 | A39 G30 C27 T47 | |||
| clonal | ST 1053 | RM1523 | A23 G24 C26 T46 | A39 G30 C27 T47 | |||
| complex) | ST 1055 | RM1527 | A23 G24 C26 T46 | A39 G30 C27 T47 | |||
| ST 1017 | RM1529 | A23 G24 C26 T46 | A39 G30 C27 T47 | ||||
| ST 860 | RM1840 | A23 G24 C26 T46 | A39 G30 C27 T47 | ||||
| ST 1063 | RM2219 | A23 G24 C26 T46 | A39 G30 C27 T47 | ||||
| ST 1066 | RM2241 | A23 G24 C26 T46 | A39 G30 C27 T47 | ||||
| ST 1067 | RM2243 | A23 G24 C26 T46 | A39 G30 C27 T47 | ||||
| ST 1068 | RM2439 | A23 G24 C26 T46 | A39 G30 C27 T47 | ||||
| Swine | ST 1016 | RM3230 | A23 G24 C26 T46 | A39 G30 C27 T47 | |||
| ST 1069 | RM3231 | A23 G24 C26 T46 | NO DATA | ||||
| ST 1061 | RM1904 | A23 G24 C26 T46 | A39 G30 C27 T47 | ||||
| Unknown | ST 825 | RM1534 | A23 G24 C26 T46 | A39 G30 C27 T47 | |||
| ST 901 | RM1505 | A23 G24 C26 T46 | A39 G30 C27 T47 | ||||
| C-2 | C. coli | Human | ST 895 | ST 895 | RM1532 | A23 G24 C26 T46 | A39 G30 C27 T47 |
| C-3 | C. coli | Poultry | Consistent | ST 1064 | RM2223 | A23 G24 C26 T46 | A39 G30 C27 T47 |
| with 63 | ST 1082 | RM1178 | A23 G24 C26 T46 | A39 G30 C27 T47 | |||
| closely | ST 1054 | RM1525 | A23 G24 C25 T47 | A39 G30 C27 T47 | |||
| related | ST 1049 | RM1517 | A23 G24 C26 T46 | A39 G30 C27 T47 | |||
| Marmoset | sequence | ST 891 | RM1531 | A23 G24 C26 T46 | A39 G30 C27 T47 | ||
| types (none | |||||||
| belong to a | |||||||
| clonal | |||||||
| complex) | |||||||
| TABLE 13C |
| Results of Base Composition Analysis of 50 Campylobacter Samples with Drill- |
| down MLST Primer Pair Nos: 1054 and 1049 |
| Base | Base | ||||||
| Composition of | Composition of | ||||||
| MLST type or | Bioagent | Bioagent | |||||
| Clonal | MLST Type | Identifying | Identifying | ||||
| Complex by | or Clonal | Amplicon | Amplicon | ||||
| Base | Complex by | Obtained with | Obtained with | ||||
| Isolate | Composition | Sequence | Primer Pair No: | Primer Pair | |||
| Group | Species | origin | analysis | analysis | Strain | 1054 (pgm) | No: 1049 (tkt) |
| J-1 | C. jejuni | Goose | ST 690/ | ST 991 | RM3673 | A26 G33 C18 T38 | A41 G28 C35 T38 |
| 692/707/991 | |||||||
| J-2 | C. jejuni | Human | Complex | ST 356, | RM4192 | A26 G33 C19 T37 | A41 G28 C36 T37 |
| 206/48/353 | complex | ||||||
| 353 | |||||||
| J-3 | C. jejuni | Human | Complex | ST 436 | RM4194 | A27 G32 C19 T37 | A42 G28 C36 T36 |
| 354/179 | |||||||
| J-4 | C. jejuni | Human | Complex 257 | ST 257, | RM4197 | A27 G32 C19 T37 | A41 G29 C35 T37 |
| complex | |||||||
| 257 | |||||||
| J-5 | C. jejuni | Human | Complex 52 | ST 52 | RM4277 | A26 G33 C18 T38 | A41 G28 C36 T37 |
| complex 52 | |||||||
| J-6 | C. jejuni | Human | Complex 443 | ST 51, | RM4275 | A27 G31 C19 T38 | A41 G28 C36 T37 |
| complex | RM4279 | A27 G31 C19 T38 | A41 G28 C36 T37 | ||||
| 443 | |||||||
| J-7 | C. jejuni | Human | Complex 42 | ST 604, | RM1864 | A27 G32 C19 T37 | A42 G28 C35 T37 |
| complex 42 | |||||||
| J-8 | C. jejuni | Human | Complex | ST 362, | RM3193 | A26 G33 C19 T37 | A42 G28 C35 T37 |
| 42/49/362 | complex | ||||||
| 362 | |||||||
| J-9 | C. jejuni | Human | Complex | ST 147, | RM3203 | A28 G31 C19 T37 | A43 G28 C36 T35 |
| 45/283 | Complex 45 | ||||||
| C. jejuni | Human | Consistent | ST 828 | RM4183 | A27 G30 C19 T39 | A46 G28 C32 T36 | |
| C-1 | C. coli | with 74 | ST 832 | RM1169 | A27 G30 C19 T39 | A46 G28 C32 T36 | |
| closely | ST 1056 | RM1857 | A27 G30 C19 T39 | A46 G28 C32 T36 | |||
| Poultry | related | ST 889 | RM1166 | A27 G30 C19 T39 | A46 G28 C32 T36 | ||
| sequence | ST 829 | RM1182 | A27 G30 C19 T39 | A46 G28 C32 T36 | |||
| types (none | ST 1050 | RM1518 | A27 G30 C19 T39 | A46 G28 C32 T36 | |||
| belong to a | ST 1051 | RM1521 | A27 G30 C19 T39 | A46 G28 C32 T36 | |||
| clonal | ST 1053 | RM1523 | A27 G30 C19 T39 | A46 G28 C32 T36 | |||
| complex) | ST 1055 | RM1527 | A27 G30 C19 T39 | A46 G28 C32 T36 | |||
| ST 1017 | RM1529 | A27 G30 C19 T39 | A46 G28 C32 T36 | ||||
| ST 860 | RM1840 | A27 G30 C19 T39 | A46 G28 C32 T36 | ||||
| ST 1063 | RM2219 | A27 G30 C19 T39 | A46 G28 C32 T36 | ||||
| ST 1066 | RM2241 | A27 G30 C19 T39 | A46 G28 C32 T36 | ||||
| ST 1067 | RM2243 | A27 G30 C19 T39 | A46 G28 C32 T36 | ||||
| ST 1068 | RM2439 | A27 G30 C19 T39 | A46 G28 C32 T36 | ||||
| Swine | ST 1016 | RM3230 | A27 G30 C19 T39 | A46 G28 C32 T36 | |||
| ST 1069 | RM3231 | A27 G30 C19 T39 | A46 G28 C32 T36 | ||||
| ST 1061 | RM1904 | A27 G30 C19 T39 | A46 G28 C32 T36 | ||||
| Unknown | ST 825 | RM1534 | A27 G30 C19 T39 | A46 G28 C32 T36 | |||
| ST 901 | RM1505 | A27 G30 C19 T39 | A46 G28 C32 T36 | ||||
| C-2 | C. coli | Human | ST 895 | ST 895 | RM1532 | A27 G30 C19 T39 | A45 G29 C32 T36 |
| C-3 | C. coli | Poultry | Consistent | ST 1064 | RM2223 | A27 G30 C19 T39 | A45 G29 C32 T36 |
| with 63 | ST 1082 | RM1178 | A27 G30 C19 T39 | A45 G29 C32 T36 | |||
| closely | ST 1054 | RM1525 | A27 G30 C19 T39 | A45 G29 C32 T36 | |||
| related | ST 1049 | RM1517 | A27 G30 C19 T39 | A45 G29 C32 T36 | |||
| Marmoset | sequence | ST 891 | RM1531 | A27 G30 C19 T39 | A45 G29 C32 T36 | ||
| types (none | |||||||
| belong to a | |||||||
| clonal | |||||||
| complex) | |||||||
The base composition analysis method was successful in identification of 12 different strain groups. Campylobacter jejuni and Campylobacter coli are generally differentiated by all loci. Ten clearly differentiated Campylobacter jejuni isolates and 2 major Campylobacter coli groups were identified even though the primers were designed for strain typing of Campylobacter jejuni. One isolate (RM4183) which was designated as Campylobacter jejuni was found to group with Campylobacter coli and also appears to actually be Campylobacter coli by full MLST sequencing.
Example 11 Identification of Acinetobacter baumannii Using Broad Range Survey and Division-WidePrimers in Epidemiological Surveillance
To test the capability of the broad range survey and division-wide primer sets of Table 5 in identification of Acinetobacter species, 183 clinical samples were obtained from individuals participating in, or in contact with individuals participating in Operation Iraqi Freedom (including US service personnel, US civilian patients at the Walter Reed Army Institute of Research (WRAIR), medical staff, Iraqi civilians and enemy prisoners. In addition, 34 environmental samples were obtained from hospitals in Iraq, Kuwait, Germany, the United States and the USNS Comfort, a hospital ship.
Upon amplification of nucleic acid obtained from the clinical samples, primer pairs 346-349, 360, 361, 354, 362 and 363 (Table 5) all produced bacterial bioagent amplicons which identified Acinetobacter baumannii in 215 of 217 samples. The organism Klebsiella pneumoniae was identified in the remaining two samples. In addition, 14 different strain types (containing single nucleotide polymorphisms relative to a reference strain of Acinetobacter baumannii) were identified and assigned arbitrary numbers from 1 to 14. Strain type 1 was found in 134 of the sample isolates and strains 3 and 7 were found in 46 and 9 of the isolates respectively.
The epidemiology of strain type 7 of Acinetobacter baumannii was investigated. Strain 7 was found in 4 patients and 5 environmental samples (from field hospitals in Iraq and Kuwait). The index patient infected with strain 7 was a pre-war patient who had a traumatic amputation in March of 2003 and was treated at a Kuwaiti hospital. The patient was subsequently transferred to a hospital in Germany and then to WRAIR. Two other patients from Kuwait infected with strain 7 were found to be non-infectious and were not further monitored. The fourth patient was diagnosed with a strain 7 infection in September of 2003 at WRAIR. Since the fourth patient was not related involved in Operation Iraqi Freedom, it was inferred that the fourth patient was the subject of a nosocomial infection acquired at WRAIR as a result of the spread of strain 7 from the index patient.
The epidemiology of strain type 3 of Acinetobacter baumannii was also investigated. Strain type 3 was found in 46 samples, all of which were from patients (US service members, Iraqi civilians and enemy prisoners) who were treated on the USNS Comfort hospital ship and subsequently returned to Iraq or Kuwait. The occurrence of strain type 3 in a single locale may provide evidence that at least some of the infections at that locale were a result of nosocomial infections.
This example thus illustrates an embodiment of the present invention wherein the methods of analysis of bacterial bioagent identifying amplicons provide the means for epidemiological surveillance.
Example 12 Selection and Use of Triangulation Genotyping Analysis Primer Pairs for Acinetobacter baumaniiTo combine the power of high-throughput mass spectrometric analysis of bioagent identifying amplicons with the sub-species characteristic resolving power provided by triangulation genotyping analysis, an additional 21 primer pairs were selected based on analysis of housekeeping genes of the genus Acinetobacter. Genes to which the drill-down triangulation genotyping analysis primers hybridize for production of bacterial bioagent identifying amplicons include anthranilate synthase component I (trpE), adenylate kinase (adk), adenine glycosylase (mutY), fulmarate hydratase (fumC), and pyrophosphate phospho-hydratase (ppa). These 21 primer pairs are indicated with reference to sequence listings in Table 14. Primer pair numbers 1151-1154 hybridize to and amplify segments of trpE. Primer pair numbers 1155-1157 hybridize to and amplify segments of adk. Primer pair numbers 1158-1164 hybridize to and amplify segments of muty. Primer pair numbers 1165-1170 hybridize to and amplify segments of fumC. Primer pair number 1171 hybridizes to and amplifies a segment of ppa. Primer pair numbers: 2846-2848 hybridize to and amplify segments of the parC gene of DNA topoisomerase which include a codon known to confer quinolone drug resistance upon sub-types of Acinetobacter baumannii. Primer pair numbers 2852-2854 hybridize to and amplify segments of the gyrA gene of DNA gyrase which include a codon known to confer quinolone drug resistance upon sub-types of Acinetobacter baumannii. Primer pair numbers 2922 and 2972 are speciating primers which are useful for identifying different species members of the genus Acinebacter. The primer names given in Table 14A (with the exception of primer pair numbers 2846-2848, 2852-2854) indicate the coordinates to which the primers hybridize to a reference sequence which comprises a concatenation of the genes TrpE, efp (elongation factor p), adk, mutT, fumC, and ppa. For example, the forward primer of primer pair 1151 is named AB_MLST-11-OIF007—62—91_F because it hybridizes to the Acinetobacter primer reference sequence of strain type 11 in sample 007 of Operation Iraqi Freedom (OIF) at positions 62 to 91. DNA was sequenced from strain type 11 and from this sequence data and an artificial concatenated sequence of partial gene extractions was assembled for use in design of the triangulation genotyping analysis primers. The stretches of arbitrary residues “N”s in the concatenated sequence were added for the convenience of separation of the partial gene extractions (40N for AB_MLST (SEQ ID NO: 1444)).
The hybridization coordinates of primer pair numbers 2846-2848 are with respect to GenBank Accession number X95819. The hybridization coordinates of primer pair numbers 2852-2854 are with respect to GenBank Accession number AY642140. Sequence residue “I” appearing in the forward and reverse primers of primer pair number 2972 represents inosine.
| TABLE 14A |
| Triangulation Genotyping Analysis Primer Pairs for Identification of Sub-species |
| characteristics (Strain Type) of Members of the Bacterial Genus Acinetobacter |
| Primer | Forward Primer | Reverse Primer | ||
| Pair No. | Forward Primer Name | (SEQ ID NO:) | Reverse Primer Name | (SEQ ID NO:) |
| 1151 | AB_MLST-11-OIF007_62_91_F | 454 | AB_MLST-11-OIF007_169_203_R | 1418 |
| 1152 | AB_MLST-11-OIF007_185_214_F | 243 | AB_MLST-11-OIF007_291_324_R | 969 |
| 1153 | AB_MLST-11-OIF007_260_289_F | 541 | AB_MLST-11-OIF007_364_393_R | 1400 |
| 1154 | AB_MLST-11-OIF007_206_239_F | 436 | AB_MLST-11-OIF007_318_344_R | 1036 |
| 1155 | AB_MLST-11-OIF007_522_552_F | 378 | AB_MLST-11-OIF007_587_610_R | 1392 |
| 1156 | AB_MLST-11-OIF007_547_571_F | 250 | AB_MLST-11-OIF007_656_686_R | 902 |
| 1157 | AB_MLST-11-OIF007_601_627_F | 256 | AB_MLST-11-OIF007_710_736_R | 881 |
| 1158 | AB_MLST-11-OIF007_1202_1225_F | 384 | AB_MLST-11-OIF007_1266_1296_R | 878 |
| 1159 | AB_MLST-11-OIF007_1202_1225_F | 384 | AB_MLST-11-OIF007_1299_1316_R | 1199 |
| 1160 | AB_MLST-11-OIF007_1234_1264_F | 694 | AB_MLST-11-OIF007_1335_1362_R | 1215 |
| 1161 | AB_MLST-11-OIF007_1327_1356_F | 225 | AB_MLST-11-OIF007_1422_1448_R | 1212 |
| 1162 | AB_MLST-11-OIF007_1345_1369_F | 383 | AB_MLST-11-OIF007_1470_1494_R | 1083 |
| 1163 | AB_MLST-11-OIF007_1351_1375_F | 662 | AB_MLST-11-OIF007_1470_1494_R | 1083 |
| 1164 | AB_MLST-11-OIF007_1387_1412_F | 422 | AB_MLST-11-OIF007_1470_1494_R | 1083 |
| 1165 | AB_MLST-11-OIF007_1542_1569_F | 194 | AB_MLST-11-OIF007_1656_1680_R | 1173 |
| 1166 | AB_MLST-11-OIF007_1566_1593_F | 684 | AB_MLST-11-OIF007_1656_1680_R | 1173 |
| 1167 | AB_MLST-11-OIF007_1611_1638_F | 375 | AB_MLST-11-OIF007_1731_1757_R | 890 |
| 1168 | AB_MLST-11-OIF007_1726_1752_F | 182 | AB_MLST-11-OIF007_1790_1821_R | 1195 |
| 1169 | AB_MLST-11-OIF007_1792_1826_F | 656 | AB_MLST-11-OIF007_1876_1909_R | 1151 |
| 1170 | AB_MLST-11-OIF007_1792_1826_F | 656 | AB_MLST-11-OIF007_1895_1927_R | 1224 |
| 1171 | AB_MLST-11-OIF007_1970_2002_F | 618 | AB_MLST-11-OIF007_2097_2118_R | 1157 |
| 2846 | PARC_X95819_33_58_F | 302 | PARC_X95819_121_153_R | 852 |
| 2847 | PARC_X95819_33_58_F | 199 | PARC_X95819_157_178_R | 889 |
| 2848 | PARC_X95819_33_58_F | 596 | PARC_X95819_97_128_R | 1169 |
| 2852 | GYRA_AY642140_−1_24_F | 150 | GYRA_AY642140_71_100_R | 1242 |
| 2853 | GYRA_AY642140_26_54_F | 166 | GYRA_AY642140_121_146_R | 1069 |
| 2854 | GYRA_AY642140_26_54_F | 166 | GYRA_AY642140_58_89_R | 1168 |
| 2922 | AB_MLST-11-OIF007_991_1018_F | 583 | AB_MLST-11-OIF007_1110_1137_R | 923 |
| 2972 | AB_MLST-11-OIF007_1007_1034_F | 592 | AB_MLST-11-OIF007_1126_1153_R | 924 |
| TABLE 14B | |
| Triangulation Genotyping Analysis Primer Pairs for Identification of | |
| Sub-species characteristics (Strain Type) of Members of the Bacterial | |
| Genus Acinetobacter |
| Forward | Reverse |
| Primer | Primer | Primer | |||
| Pair | (SEQ | (SEQ |
| No. | ID NO:) | SEQUENCE | ID NO:) | SEQUENCE |
| 1151 | 454 | TGAGATTGCTGAACATTTAATGCTGATTGA | 1418 | TTGTACATTTGAAACAATATGCATGACATGTGAAT | |
| 1152 | 243 | TATTGTTTCAAATGTACAAGGTGAAGTGCG | 969 | TCACAGGTTCTACTTCATCAATAATTTCCATTGC | |
| 1153 | 541 | TGGAACGTTATCAGGTGCCCCAAAAATTCG | 1400 | TTGCAATCGACATATCCATTTCACCATGCC | |
| 1154 | 436 | TGAAGTGCGTGATGATATCGATGCACTTGATGTA | 1036 | TCCGCCAAAAACTCCCCTTTTCACAGG | |
| 1155 | 378 | TCGGTTTAGTAAAAGAACGTATTGCTCAACC | 1392 | TTCTGCTTGAGGAATAGTGCGTGG | |
| 1156 | 250 | TCAACCTGACTGCGTGAATGGTTGT | 902 | TACGTTCTACGATTTCTTCATCAGGTACATC | |
| 1157 | 256 | TCAAGCAGAAGCTTTGGAAGAAGAAGG | 881 | TACAACGTGATAAACACGACCAGAAGC | |
| 1158 | 384 | TCGTGCCCGCAATTTGCATAAAGC | 878 | TAATGCCGGGTAGTGCAATCCATTCTTCTAG | |
| 1159 | 384 | TCGTGCCCGCAATTTGCATAAAGC | 1199 | TGCACCTGCGGTCGAGCG | |
| 1160 | 694 | TTGTAGCACAGCAAGGCAAATTTCCTGAAAC | 1215 | TGCCATCCATAATCACGCCATACTGACG | |
| 1161 | 225 | TAGGTTTACGTCAGTATGGCGTGATTATGG | 1212 | TGCCAGTTTCCACATTTCACGTTCGTG | |
| 1162 | 383 | TCGTGATTATGGATGGCAACGTGAA | 1083 | TCGCTTGAGTGTAGTCATGATTGCG | |
| 1163 | 662 | TTATGGATGGCAACGTGAAACGCGT | 1083 | TCGCTTGAGTGTAGTCATGATTGCG | |
| 1164 | 422 | TCTTTGCCATTGAAGATGACTTAAGC | 1083 | TCGCTTGAGTGTAGTCATGATTGCG | |
| 1165 | 194 | TACTAGCGGTAAGCTTAAACAAGATTGC | 1173 | TGAGTCGGGTTCACTTTACCTGGCA | |
| 1166 | 684 | TTGCCAATGATATTCGTTGGTTAGCAAG | 1173 | TGAGTCGGGTTCACTTTACCTGGCA | |
| 1167 | 375 | TCGGCGAAATCCGTATTCCTGAAAATGA | 890 | TACCGGAAGCACCAGCGACATTAATAG | |
| 1168 | 182 | TACCACTATTAATGTCGCTGGTGCTTC | 1195 | TGCAACTGAATAGATTGCAGTAAGTTATAAGC | |
| 1169 | 656 | TTATAACTTACTGCAATCTATTCAGTTGCTTGGTG | 1151 | TGAATTATGCAAGAAGTGATCAATTTTCTCACGA | |
| 1170 | 656 | TTATAACTTACTGCAATCTATTCAGTTGCTTGGTG | 1224 | TGCCGTAACTAACATAAGAGAATTATGCAAGAA | |
| 1171 | 618 | TGGTTATGTACCAAATACTTTGTCTGAAGATGG | 1157 | TGACGGCATCGATACCACCGTC | |
| 2846 | 302 | TCCAAAAAAATCAGCGCGTACAGTGG | 852 | TAAAGGATAGCGGTAACTAAATGGCTGAGCCAT | |
| 2847 | 199 | TACTTGGTAAATACCACCCACATGGTGA | 889 | TACCCCAGTTCCCCTGACCTTC | |
| 2848 | 596 | TGGTAAATACCACCCACATGGTGAC | 1169 | TGAGCCATGAGTACCATGGCTTCATAACATGC | |
| 2852 | 150 | TAAATCTGCCCGTGTCGTTGGTGAC | 1242 | TGCTAAAGTCTTGAGCCATACGAACAATGG | |
| 2853 | 166 | TAATCGGTAAATATCACCCGCATGGTGAC | 1069 | TCGATCGAACCGAAGTTACCCTGACC | |
| 2854 | 166 | TAATCGGTAAATATCACCCGCATGGTGAC | 1168 | TGAGCCATACGAACAATGGTTTCATAAACAGC | |
| 2922 | 583 | TGGGCGATGCTGCGAAATGGTTAAAAGA | 923 | TAGTATCACCACGTACACCCGGATCAGT | |
| 2972 | 592 | TGGGIGATGCTGCIAAATGGTTAAAAGA | 924 | TAGTATCACCACGTACICCIGGATCAGT | |
Analysis of bioagent identifying amplicons obtained using the primers of Table 14B for over 200 samples from Operation Iraqi Freedom resulted in the identification of 50 distinct strain type clusters. The largest cluster, designated strain type 11 (ST11) includes 42 sample isolates, all of which were obtained from US service personnel and Iraqi civilians treated at the 28th Combat Support Hospital in Baghdad. Several of these individuals were also treated on the hospital ship USNS Comfort. These observations are indicative of significant epidemiological correlation/linkage.
All of the sample isolates were tested against a broad panel of antibiotics to characterize their antibiotic resistance profiles. As an example of a representative result from antibiotic susceptibility testing, ST11 was found to consist of four different clusters of isolates, each with a varying degree of sensitivity/resistance to the various antibiotics tested which included penicillins, extended spectrum penicillins, cephalosporins, carbepenem, protein synthesis inhibitors, nucleic acid synthesis inhibitors, anti-metabolites, and anti-cell membrane antibiotics. Thus, the genotyping power of bacterial bioagent identifying amplicons, particularly drill-down bacterial bioagent identifying amplicons, has the potential to increase the understanding of the transmission of infections in combat casualties, to identify the source of infection in the environment, to track hospital transmission of nosocomial infections, and to rapidly characterize drug-resistance profiles which enable development of effective infection control measures on a time-scale previously not achievable.
Example 13 Triangulation Genotyping Analysis and Codon Analysis of Acinetobacter baumannii Samples from Two Health Care FacilitiesIn this investigation, 88 clinical samples were obtained from Walter Reed Hospital and 95 clinical samples were obtained from Northwestern Medical Center. All samples from both healthcare facilities were suspected of containing sub-types of Acinetobacter baumannii, at least some of which were expected to be resistant to quinolone drugs. Each of the 183 samples was analyzed by the method of the present invention. DNA was extracted from each of the samples and amplified with eight triangulation genotyping analysis primer pairs represented by primer pair numbers: 1151, 1156, 1158, 1160, 1165, 1167, 1170, and 1171. The DNA was also amplified with speciating primer pair number 2922 and codon analysis primer pair numbers 2846-2848 which interrogate a codon present in the parc gene, and primer pair numbers 2852-2854 which bracket a codon present in the gyrA gene. The parC and gyrA codon mutations are both responsible for causing drug resistance in Acinetobacter baumannii. During evolution of drug resistant strains, the gyrA mutation usually occurs before the parC mutation. Amplification products were measured by ESI-TOF mass spectrometry as indicated in Example 4. The base compositions of the amplification products were calculated from the average molecular masses of the amplification products and are shown in Tables 15-18. The entries in each of the tables are grouped according to strain type number, which is an arbitrary number assigned to Acinetobacter baumannii strains in the order of observance beginning from the triangulation genotyping analysis OIF genotyping study described in Example 12. For example, strain type 11 which appears in samples from the Walter Reed Hospital is the same strain as the strain type 11 mentioned in Example 12. Ibis# refers to the order in which each sample was analyzed. Isolate refers to the original sample isolate numbering system used at the location from which the samples were obtained (either Walter Reed Hospital or Northwestern Medical Center). ST=strain type. ND=not detected. Base compositions highlighted with bold type indicate that the base composition is a unique base composition for the amplification product obtained with the pair of primers indicated.
| TABLE 15A |
| Base Compositions of Amplification Products of 88 A. baumannii Samples Obtained from |
| Walter Reed Hospital and Amplified with Codon Analysis Primer Pairs Targeting the gyrA Gene |
| PP No: 2852 | PP No: 2853 | PP No: 2854 | ||||
| Species | Ibis# | Isolate | ST | gyrA | gyrA | gyrA |
| A. baumannii | 20 | 1082 | 1 | A25G23C22T31 | A29G28C22T42 | A17G13C14T20 |
| A. baumannii | 13 | 854 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 22 | 1162 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 27 | 1230 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 31 | 1367 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 37 | 1459 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 55 | 1700 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 64 | 1777 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 73 | 1861 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 74 | 1877 | 10 | ND | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 86 | 1972 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 3 | 684 | 11 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 6 | 720 | 11 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 7 | 726 | 11 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 19 | 1079 | 11 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 21 | 1123 | 11 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 23 | 1188 | 11 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 33 | 1417 | 11 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 34 | 1431 | 11 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 38 | 1496 | 11 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 40 | 1523 | 11 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 42 | 1640 | 11 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 50 | 1666 | 11 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 51 | 1668 | 11 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 52 | 1695 | 11 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 65 | 1781 | 11 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 44 | 1649 | 12 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 49A | 1658.1 | 12 | A25G23C22T31 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 49B | 1658.2 | 12 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 56 | 1707 | 12 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 80 | 1893 | 12 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 5 | 693 | 14 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 8 | 749 | 14 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 10 | 839 | 14 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 14 | 865 | 14 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 16 | 888 | 14 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 29 | 1326 | 14 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 35 | 1440 | 14 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 41 | 1524 | 14 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 46 | 1652 | 14 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 47 | 1653 | 14 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 48 | 1657 | 14 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 57 | 1709 | 14 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 61 | 1727 | 14 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 63 | 1762 | 14 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 67 | 1806 | 14 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 75 | 1881 | 14 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 77 | 1886 | 14 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 1 | 649 | 46 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 2 | 653 | 46 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 39 | 1497 | 16 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 24 | 1198 | 15 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 28 | 1243 | 15 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 43 | 1648 | 15 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 62 | 1746 | 15 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 4 | 689 | 15 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 68 | 1822 | 3 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 69 | 1823A | 3 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 70 | 1823B | 3 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 71 | 1826 | 3 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 72 | 1860 | 3 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 81 | 1924 | 3 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 82 | 1929 | 3 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 85 | 1966 | 3 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 11 | 841 | 3 | A25G23C22T31 | A29G28C22T42 | A17G13C14T20 |
| A. baumannii | 32 | 1415 | 24 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 45 | 1651 | 24 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 54 | 1697 | 24 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 58 | 1712 | 24 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 60 | 1725 | 24 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 66 | 1802 | 24 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 76 | 1883 | 24 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 78 | 1891 | 24 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 79 | 1892 | 24 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 83 | 1947 | 24 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 84 | 1964 | 24 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 53 | 1696 | 24 | A25G23C22T31 | A29G28C22T42 | A17G13C14T20 |
| A. baumannii | 36 | 1458 | 49 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 59 | 1716 | 9 | A25G23C22T31 | A29G28C22T42 | A17G13C14T20 |
| A. baumannii | 9 | 805 | 30 | A25G23C22T31 | A29G28C22T42 | A17G13C14T20 |
| A. baumannii | 18 | 967 | 39 | A25G23C22T31 | A29G28C22T42 | A17G13C14T20 |
| A. baumannii | 30 | 1322 | 48 | A25G23C22T31 | A29G28C22T42 | A17G13C14T20 |
| A. baumannii | 26 | 1218 | 50 | A25G23C22T31 | A29G28C22T42 | A17G13C14T20 |
| A. sp. 13TU | 15 | 875 | A1 | A25G23C22T31 | A29G28C22T42 | A17G13C14T20 |
| A. sp. 13TU | 17 | 895 | A1 | A25G23C22T31 | A29G28C22T42 | A17G13C14T20 |
| A. sp. 3 | 12 | 853 | B7 | A25G22C22T32 | A30G29C22T40 | A17G13C14T20 |
| A. johnsonii | 25 | 1202 | NEW1 | A25G22C22T32 | A30G29C22T40 | A17G13C14T20 |
| A. sp. 2082 | 87 | 2082 | NEW2 | A25G22C22T32 | A31G28C22T40 | A17G13C14T20 |
| TABLE 15B |
| Base Compositions Determined from A. baumannii DNA Samples Obtained from Walter |
| Reed Hospital and Amplified with Codon Analysis Primer Pairs Targeting the parC Gene |
| PP No: 2846 | PP No: 2847 | PP No: 2848 | ||||
| Species | Ibis# | Isolate | ST | parC | parC | parC |
| A. baumannii | 20 | 1082 | 1 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 13 | 854 | 10 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 22 | 1162 | 10 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 27 | 1230 | 10 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 31 | 1367 | 10 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 37 | 1459 | 10 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 55 | 1700 | 10 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 64 | 1777 | 10 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 73 | 1861 | 10 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 74 | 1877 | 10 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 86 | 1972 | 10 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 3 | 684 | 11 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 6 | 720 | 11 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 7 | 726 | 11 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 19 | 1079 | 11 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 21 | 1123 | 11 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 23 | 1188 | 11 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 33 | 1417 | 11 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 34 | 1431 | 11 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 38 | 1496 | 11 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 40 | 1523 | 11 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 42 | 1640 | 11 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 50 | 1666 | 11 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 51 | 1668 | 11 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 52 | 1695 | 11 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 65 | 1781 | 11 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 44 | 1649 | 12 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 49A | 1658.1 | 12 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 49B | 1658.2 | 12 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 56 | 1707 | 12 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 80 | 1893 | 12 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 5 | 693 | 14 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 8 | 749 | 14 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 10 | 839 | 14 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 14 | 865 | 14 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 16 | 888 | 14 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 29 | 1326 | 14 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 35 | 1440 | 14 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 41 | 1524 | 14 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 46 | 1652 | 14 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 47 | 1653 | 14 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 48 | 1657 | 14 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 57 | 1709 | 14 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 61 | 1727 | 14 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 63 | 1762 | 14 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 67 | 1806 | 14 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 75 | 1881 | 14 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 77 | 1886 | 14 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 1 | 649 | 46 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 2 | 653 | 46 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 39 | 1497 | 16 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 24 | 1198 | 15 | A33G26C28T34 | A29G29C23T33 | A16G14C14T16 |
| A. baumannii | 28 | 1243 | 15 | A33G26C28T34 | A29G29C23T33 | A16G14C14T16 |
| A. baumannii | 43 | 1648 | 15 | A33G26C28T34 | A29G29C23T33 | A16G14C14T16 |
| A. baumannii | 62 | 1746 | 15 | A33G26C28T34 | A29G29C23T33 | A16G14C14T16 |
| A. baumannii | 4 | 689 | 15 | A34G25C29T33 | A30G27C26T31 | A16G14C15T15 |
| A. baumannii | 68 | 1822 | 3 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 69 | 1823A | 3 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 70 | 1823B | 3 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 71 | 1826 | 3 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 72 | 1860 | 3 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 81 | 1924 | 3 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 82 | 1929 | 3 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 85 | 1966 | 3 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 11 | 841 | 3 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 32 | 1415 | 24 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 45 | 1651 | 24 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 54 | 1697 | 24 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 58 | 1712 | 24 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 60 | 1725 | 24 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 66 | 1802 | 24 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 76 | 1883 | 24 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 78 | 1891 | 24 | A34G25C29T33 | A30G27C26T31 | A16G14C15T15 |
| A. baumannii | 79 | 1892 | 24 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 83 | 1947 | 24 | A34G25C29T33 | A30G27C26T31 | A16G14C15T15 |
| A. baumannii | 84 | 1964 | 24 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 53 | 1696 | 24 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 36 | 1458 | 49 | A34G26C29T32 | A30G28C24T32 | A16G14C15T15 |
| A. baumannii | 59 | 1716 | 9 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 9 | 805 | 30 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 18 | 967 | 39 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 30 | 1322 | 48 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 26 | 1218 | 50 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. sp. 13TU | 15 | 875 | A1 | A32G26C28T35 | A28G28C24T34 | A16G14C15T15 |
| A. sp. 13TU | 17 | 895 | A1 | A32G26C28T35 | A28G28C24T34 | A16G14C15T15 |
| A. sp. 3 | 12 | 853 | B7 | A29G26C27T39 | A26G32C21T35 | A16G14C15T15 |
| A. johnsonii | 25 | 1202 | NEW1 | A32G28C26T35 | A29G29C22T34 | A16G14C15T15 |
| A. sp. 2082 | 87 | 2082 | NEW2 | A33G27C26T35 | A31G28C20T35 | A16G14C15T15 |
| TABLE 16A |
| Base Compositions Determined from A. baumannii DNA Samples Obtained from |
| Northwestern Medical Center and Amplified with Codon Analysis Primer Pairs Targeting the |
| gyrA Gene |
| PP No: 2852 | PP No: 2853 | PP No: 2854 | ||||
| Species | Ibis# | Isolate | ST | gyrA | gyrA | gyrA |
| A. baumannii | 54 | 536 | 3 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 87 | 665 | 3 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 8 | 80 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 9 | 91 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 10 | 92 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 11 | 131 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 12 | 137 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 21 | 218 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 26 | 242 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 94 | 678 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 1 | 9 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 2 | 13 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 3 | 19 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 4 | 24 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 5 | 36 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 6 | 39 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 13 | 139 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 15 | 165 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 16 | 170 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 17 | 186 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 20 | 202 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 22 | 221 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 24 | 234 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 25 | 239 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 33 | 370 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 34 | 389 | 10 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 19 | 201 | 14 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 27 | 257 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 29 | 301 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 31 | 354 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 36 | 422 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 37 | 424 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 38 | 434 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 39 | 473 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 40 | 482 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 44 | 512 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 45 | 516 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 47 | 522 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 48 | 526 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 50 | 528 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 52 | 531 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 53 | 533 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 56 | 542 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 59 | 550 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 62 | 556 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 64 | 557 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 70 | 588 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 73 | 603 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 74 | 605 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 75 | 606 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 77 | 611 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 79 | 622 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 83 | 643 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 85 | 653 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 89 | 669 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 93 | 674 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 23 | 228 | 51 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 32 | 369 | 52 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 35 | 393 | 52 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 30 | 339 | 53 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 41 | 485 | 53 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 42 | 493 | 53 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 43 | 502 | 53 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 46 | 520 | 53 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 49 | 527 | 53 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 51 | 529 | 53 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 65 | 562 | 53 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 68 | 579 | 53 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 57 | 546 | 54 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 58 | 548 | 54 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 60 | 552 | 54 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 61 | 555 | 54 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 63 | 557 | 54 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 66 | 570 | 54 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 67 | 578 | 54 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 69 | 584 | 54 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 71 | 593 | 54 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 72 | 602 | 54 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 76 | 609 | 54 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 78 | 621 | 54 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 80 | 625 | 54 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 81 | 628 | 54 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 82 | 632 | 54 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 84 | 649 | 54 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 86 | 655 | 54 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 88 | 668 | 54 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 90 | 671 | 54 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 91 | 672 | 54 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 92 | 673 | 54 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 18 | 196 | 55 | A25G23C22T31 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 55 | 537 | 27 | A25G23C21T32 | A29G28C21T43 | A17G13C13T21 |
| A. baumannii | 28 | 263 | 27 | A25G23C22T31 | A29G28C22T42 | A17G13C14T20 |
| A. sp. 3 | 14 | 164 | B7 | A25G22C22T32 | A30G29C22T40 | A17G13C14T20 |
| mixture | 7 | 71 | — | ND | ND | A17G13C15T19 |
| TABLE 16B |
| Base Compositions Determined from A. baumannii DNA Samples Obtained from |
| Northwestern Medical Center and Amplified with Codon Analysis Primer Pairs Targeting the |
| parC Gene |
| PP No: 2846 | PP No: 2847 | PP No: 2848 | ||||
| Species | Ibis# | Isolate | ST | parC | parC | parC |
| A. baumannii | 54 | 536 | 3 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 87 | 665 | 3 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 8 | 80 | 10 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 9 | 91 | 10 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 10 | 92 | 10 | A33G26C28T34 | A29G28C25T32 | ND |
| A. baumannii | 11 | 131 | 10 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 12 | 137 | 10 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 21 | 218 | 10 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 26 | 242 | 10 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 94 | 678 | 10 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 1 | 9 | 10 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 2 | 13 | 10 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 3 | 19 | 10 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 4 | 24 | 10 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 5 | 36 | 10 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 6 | 39 | 10 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 13 | 139 | 10 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 15 | 165 | 10 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 16 | 170 | 10 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 17 | 186 | 10 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 20 | 202 | 10 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 22 | 221 | 10 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 24 | 234 | 10 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 25 | 239 | 10 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 33 | 370 | 10 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 34 | 389 | 10 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 19 | 201 | 14 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 27 | 257 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 29 | 301 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 31 | 354 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 36 | 422 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 37 | 424 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 38 | 434 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 39 | 473 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 40 | 482 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 44 | 512 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 45 | 516 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 47 | 522 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 48 | 526 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 50 | 528 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 52 | 531 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 53 | 533 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 56 | 542 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 59 | 550 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 62 | 556 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 64 | 557 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 70 | 588 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 73 | 603 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 74 | 605 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 75 | 606 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 77 | 611 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 79 | 622 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 83 | 643 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 85 | 653 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 89 | 669 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 93 | 674 | 51 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 23 | 228 | 51 | A34G25C29T33 | A30G27C26T31 | A16G14C15T15 |
| A. baumannii | 32 | 369 | 52 | A34G25C28T34 | A30G27C25T32 | A16G14C14T16 |
| A. baumannii | 35 | 393 | 52 | A34G25C28T34 | A30G27C25T32 | A16G14C14T16 |
| A. baumannii | 30 | 339 | 53 | A34G25C29T33 | A30G27C26T31 | A16G14C15T15 |
| A. baumannii | 41 | 485 | 53 | A34G25C29T33 | A30G27C26T31 | A16G14C15T15 |
| A. baumannii | 42 | 493 | 53 | A34G25C29T33 | A30G27C26T31 | A16G14C15T15 |
| A. baumannii | 43 | 502 | 53 | A34G25C29T33 | A30G27C26T31 | A16G14C15T15 |
| A. baumannii | 46 | 520 | 53 | A34G25C29T33 | A30G27C26T31 | A16G14C15T15 |
| A. baumannii | 49 | 527 | 53 | A34G25C29T33 | A30G27C26T31 | A16G14C15T15 |
| A. baumannii | 51 | 529 | 53 | A34G25C29T33 | A30G27C26T31 | A16G14C15T15 |
| A. baumannii | 65 | 562 | 53 | A34G25C29T33 | A30G27C26T31 | A16G14C15T15 |
| A. baumannii | 68 | 579 | 53 | A34G25C29T33 | A30G27C26T31 | A16G14C15T15 |
| A. baumannii | 57 | 546 | 54 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 58 | 548 | 54 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 60 | 552 | 54 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 61 | 555 | 54 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 63 | 557 | 54 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 66 | 570 | 54 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 67 | 578 | 54 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 69 | 584 | 54 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 71 | 593 | 54 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 72 | 602 | 54 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 76 | 609 | 54 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 78 | 621 | 54 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 80 | 625 | 54 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 81 | 628 | 54 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 82 | 632 | 54 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 84 | 649 | 54 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 86 | 655 | 54 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 88 | 668 | 54 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 90 | 671 | 54 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 91 | 672 | 54 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 92 | 673 | 54 | A33G26C28T34 | A29G28C25T32 | A16G14C14T16 |
| A. baumannii | 18 | 196 | 55 | A33G27C28T33 | A29G28C25T31 | A15G14C15T16 |
| A. baumannii | 55 | 537 | 27 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. baumannii | 28 | 263 | 27 | A33G26C29T33 | A29G28C26T31 | A16G14C15T15 |
| A. sp. 3 | 14 | 164 | B7 | A35G25C29T32 | A30G28C17T39 | A16G14C15T15 |
| mixture | 7 | 71 | — | ND | ND | A17G14C15T14 |
| TABLE 17A |
| Base Compositions Determined from A. baumannii DNA Samples Obtained from Walter |
| Reed Hospital and Amplified with Speciating Primer Pair No. 2922 and Triangulation |
| Genotyping Analysis Primer Pair Nos. 1151 and 1156 |
| PP No: 2922 | PP No: 1151 | PP No: 1156 | ||||
| Species | Ibis# | Isolate | ST | efp | trpE | Adk |
| A. baumannii | 20 | 1082 | 1 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 13 | 854 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 22 | 1162 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 27 | 1230 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 31 | 1367 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 37 | 1459 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 55 | 1700 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 64 | 1777 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 73 | 1861 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 74 | 1877 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 86 | 1972 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 3 | 684 | 11 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 6 | 720 | 11 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 7 | 726 | 11 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 19 | 1079 | 11 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 21 | 1123 | 11 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 23 | 1188 | 11 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 33 | 1417 | 11 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 34 | 1431 | 11 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 38 | 1496 | 11 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 40 | 1523 | 11 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 42 | 1640 | 11 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 50 | 1666 | 11 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 51 | 1668 | 11 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 52 | 1695 | 11 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 65 | 1781 | 11 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 44 | 1649 | 12 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 49A | 1658.1 | 12 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 49B | 1658.2 | 12 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 56 | 1707 | 12 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 80 | 1893 | 12 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 5 | 693 | 14 | A44G35C25T43 | A44G35C22T41 | A44G32C27T37 |
| A. baumannii | 8 | 749 | 14 | A44G35C25T43 | A44G35C22T41 | A44G32C27T37 |
| A. baumannii | 10 | 839 | 14 | A44G35C25T43 | A44G35C22T41 | A44G32C27T37 |
| A. baumannii | 14 | 865 | 14 | A44G35C25T43 | A44G35C22T41 | A44G32C27T37 |
| A. baumannii | 16 | 888 | 14 | A44G35C25T43 | A44G35C22T41 | A44G32C27T37 |
| A. baumannii | 29 | 1326 | 14 | A44G35C25T43 | A44G35C22T41 | A44G32C27T37 |
| A. baumannii | 35 | 1440 | 14 | A44G35C25T43 | ND | A44G32C27T37 |
| A. baumannii | 41 | 1524 | 14 | A44G35C25T43 | A44G35C22T41 | A44G32C27T37 |
| A. baumannii | 46 | 1652 | 14 | A44G35C25T43 | A44G35C22T41 | A44G32C27T37 |
| A. baumannii | 47 | 1653 | 14 | A44G35C25T43 | A44G35C22T41 | A44G32C27T37 |
| A. baumannii | 48 | 1657 | 14 | A44G35C25T43 | A44G35C22T41 | A44G32C27T37 |
| A. baumannii | 57 | 1709 | 14 | A44G35C25T43 | A44G35C22T41 | A44G32C27T37 |
| A. baumannii | 61 | 1727 | 14 | A44G35C25T43 | A44G35C22T41 | A44G32C27T37 |
| A. baumannii | 63 | 1762 | 14 | A44G35C25T43 | A44G35C22T41 | A44G32C27T37 |
| A. baumannii | 67 | 1806 | 14 | A44G35C25T43 | A44G35C22T41 | A44G32C27T37 |
| A. baumannii | 75 | 1881 | 14 | A44G35C25T43 | A44G35C22T41 | A44G32C27T37 |
| A. baumannii | 77 | 1886 | 14 | A44G35C25T43 | A44G35C22T41 | A44G32C27T37 |
| A. baumannii | 1 | 649 | 46 | A44G35C25T43 | A44G35C22T41 | A44G32C26T38 |
| A. baumannii | 2 | 653 | 46 | A44G35C25T43 | A44G35C22T41 | A44G32C26T38 |
| A. baumannii | 39 | 1497 | 16 | A44G35C25T43 | A44G35C22T41 | A44G32C27T37 |
| A. baumannii | 24 | 1198 | 15 | A44G35C25T43 | A44G35C22T41 | A44G32C26T38 |
| A. baumannii | 28 | 1243 | 15 | A44G35C25T43 | A44G35C22T41 | A44G32C26T38 |
| A. baumannii | 43 | 1648 | 15 | A44G35C25T43 | A44G35C22T41 | A44G32C26T38 |
| A. baumannii | 62 | 1746 | 15 | A44G35C25T43 | A44G35C22T41 | A44G32C26T38 |
| A. baumannii | 4 | 689 | 15 | A44G35C25T43 | A44G35C22T41 | A44G32C26T38 |
| A. baumannii | 68 | 1822 | 3 | A44G35C24T44 | A44G35C22T41 | A44G32C26T38 |
| A. baumannii | 69 | 1823A | 3 | A44G35C24T44 | A44G35C22T41 | A44G32C26T38 |
| A. baumannii | 70 | 1823B | 3 | A44G35C24T44 | A44G35C22T41 | A44G32C26T38 |
| A. baumannii | 71 | 1826 | 3 | A44G35C24T44 | A44G35C22T41 | A44G32C26T38 |
| A. baumannii | 72 | 1860 | 3 | A44G35C24T44 | A44G35C22T41 | A44G32C26T38 |
| A. baumannii | 81 | 1924 | 3 | A44G35C24T44 | A44G35C22T41 | A44G32C26T38 |
| A. baumannii | 82 | 1929 | 3 | A44G35C24T44 | A44G35C22T41 | A44G32C26T38 |
| A. baumannii | 85 | 1966 | 3 | A44G35C24T44 | A44G35C22T41 | A44G32C26T38 |
| A. baumannii | 11 | 841 | 3 | A44G35C24T44 | A44G35C22T41 | A44G32C26T38 |
| A. baumannii | 32 | 1415 | 24 | A44G35C25T43 | A43G36C20T43 | A44G32C27T37 |
| A. baumannii | 45 | 1651 | 24 | A44G35C25T43 | A43G36C20T43 | A44G32C27T37 |
| A. baumannii | 54 | 1697 | 24 | A44G35C25T43 | A43G36C20T43 | A44G32C27T37 |
| A. baumannii | 58 | 1712 | 24 | A44G35C25T43 | A43G36C20T43 | A44G32C27T37 |
| A. baumannii | 60 | 1725 | 24 | A44G35C25T43 | A43G36C20T43 | A44G32C27T37 |
| A. baumannii | 66 | 1802 | 24 | A44G35C25T43 | A43G36C20T43 | A44G32C27T37 |
| A. baumannii | 76 | 1883 | 24 | ND | A43G36C20T43 | A44G32C27T37 |
| A. baumannii | 78 | 1891 | 24 | A44G35C25T43 | A43G36C20T43 | A44G32C27T37 |
| A. baumannii | 79 | 1892 | 24 | A44G35C25T43 | A43G36C20T43 | A44G32C27T37 |
| A. baumannii | 83 | 1947 | 24 | A44G35C25T43 | A43G36C20T43 | A44G32C27T37 |
| A. baumannii | 84 | 1964 | 24 | A44G35C25T43 | A43G36C20T43 | A44G32C27T37 |
| A. baumannii | 53 | 1696 | 24 | A44G35C25T43 | A43G36C20T43 | A44G32C27T37 |
| A. baumannii | 36 | 1458 | 49 | A44G35C25T43 | A44G35C22T41 | A44G32C27T37 |
| A. baumannii | 59 | 1716 | 9 | A44G35C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 9 | 805 | 30 | A44G35C25T43 | A44G35C19T44 | A44G32C27T37 |
| A. baumannii | 18 | 967 | 39 | A45G34C25T43 | A44G35C22T41 | A44G32C26T38 |
| A. baumannii | 30 | 1322 | 48 | A44G35C25T43 | A43G36C20T43 | A44G32C27T37 |
| A. baumannii | 26 | 1218 | 50 | A44G35C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. sp. 13TU | 15 | 875 | A1 | A47G33C24T43 | A46G32C20T44 | A44G33C27T36 |
| A. sp. 13TU | 17 | 895 | A1 | A47G33C24T43 | A46G32C20T44 | A44G33C27T36 |
| A. sp. 3 | 12 | 853 | B7 | A46G35C24T42 | A42G34C20T46 | A43G33C24T40 |
| A. johnsonii | 25 | 1202 | NEW1 | A46G35C23T43 | A42G35C21T44 | A43G33C23T41 |
| A. sp. 2082 | 87 | 2082 | NEW2 | A46G36C22T43 | A42G32C20T48 | A42G34C23T41 |
| TABLE 17B |
| Base Compositions Determined from A. baumannii DNA Samples Obtained from Walter |
| Reed Hospital and Amplified with Triangulation Genotyping Analysis Primer Pair Nos. 1158 and |
| 1160 and 1165 |
| PP No: 1158 | PP No: 1160 | PP No: 1165 | ||||
| Species | Ibis# | Isolate | ST | mutY | mutY | fumC |
| A. baumannii | 20 | 1082 | 1 | A27G21C25T22 | A32G35C29T33 | A40G33C30T36 |
| A. baumannii | 13 | 854 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 22 | 1162 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 27 | 1230 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 31 | 1367 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 37 | 1459 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 55 | 1700 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 64 | 1777 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 73 | 1861 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 74 | 1877 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 86 | 1972 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 3 | 684 | 11 | A27G21C25T22 | A32G34C28T35 | A40G33C30T36 |
| A. baumannii | 6 | 720 | 11 | A27G21C25T22 | A32G34C28T35 | A40G33C30T36 |
| A. baumannii | 7 | 726 | 11 | A27G21C25T22 | A32G34C28T35 | A40G33C30T36 |
| A. baumannii | 19 | 1079 | 11 | A27G21C25T22 | A32G34C28T35 | A40G33C30T36 |
| A. baumannii | 21 | 1123 | 11 | A27G21C25T22 | A32G34C28T35 | A40G33C30T36 |
| A. baumannii | 23 | 1188 | 11 | A27G21C25T22 | A32G34C28T35 | A40G33C30T36 |
| A. baumannii | 33 | 1417 | 11 | A27G21C25T22 | A32G34C28T35 | A40G33C30T36 |
| A. baumannii | 34 | 1431 | 11 | A27G21C25T22 | A32G34C28T35 | A40G33C30T36 |
| A. baumannii | 38 | 1496 | 11 | A27G21C25T22 | A32G34C28T35 | A40G33C30T36 |
| A. baumannii | 40 | 1523 | 11 | A27G21C25T22 | A32G34C28T35 | A40G33C30T36 |
| A. baumannii | 42 | 1640 | 11 | A27G21C25T22 | A32G34C28T35 | A40G33C30T36 |
| A. baumannii | 50 | 1666 | 11 | A27G21C25T22 | A32G34C28T35 | A40G33C30T36 |
| A. baumannii | 51 | 1668 | 11 | A27G21C25T22 | A32G34C28T35 | A40G33C30T36 |
| A. baumannii | 52 | 1695 | 11 | A27G21C25T22 | A32G34C28T35 | A40G33C30T36 |
| A. baumannii | 65 | 1781 | 11 | A27G21C25T22 | A32G34C28T35 | A40G33C30T36 |
| A. baumannii | 44 | 1649 | 12 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 49A | 1658.1 | 12 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 49B | 1658.2 | 12 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 56 | 1707 | 12 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 80 | 1893 | 12 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 5 | 693 | 14 | A27G21C25T22 | A31G36C28T34 | A40G33C29T37 |
| A. baumannii | 8 | 749 | 14 | A27G21C25T22 | A31G36C28T34 | A40G33C29T37 |
| A. baumannii | 10 | 839 | 14 | A27G21C25T22 | A31G36C28T34 | A40G33C29T37 |
| A. baumannii | 14 | 865 | 14 | A27G21C25T22 | A31G36C28T34 | A40G33C29T37 |
| A. baumannii | 16 | 888 | 14 | A27G21C25T22 | A31G36C28T34 | A40G33C29T37 |
| A. baumannii | 29 | 1326 | 14 | A27G21C25T22 | A31G36C28T34 | A40G33C29T37 |
| A. baumannii | 35 | 1440 | 14 | A27G21C25T22 | A31G36C28T34 | A40G33C29T37 |
| A. baumannii | 41 | 1524 | 14 | A27G21C25T22 | A31G36C28T34 | A40G33C29T37 |
| A. baumannii | 46 | 1652 | 14 | A27G21C25T22 | A31G36C28T34 | A40G33C29T37 |
| A. baumannii | 47 | 1653 | 14 | A27G21C25T22 | A31G36C28T34 | A40G33C29T37 |
| A. baumannii | 48 | 1657 | 14 | A27G21C25T22 | A31G36C28T34 | A40G33C29T37 |
| A. baumannii | 57 | 1709 | 14 | A27G21C25T22 | A31G36C28T34 | A40G33C29T37 |
| A. baumannii | 61 | 1727 | 14 | A27G21C25T22 | A31G36C28T34 | A40G33C29T37 |
| A. baumannii | 63 | 1762 | 14 | A27G21C25T22 | A31G36C28T34 | A40G33C29T37 |
| A. baumannii | 67 | 1806 | 14 | A27G21C25T22 | A31G36C28T34 | A40G33C29T37 |
| A. baumannii | 75 | 1881 | 14 | A27G21C25T22 | A31G36C28T34 | A40G33C29T37 |
| A. baumannii | 77 | 1886 | 14 | A27G21C25T22 | A31G36C28T34 | A40G33C29T37 |
| A. baumannii | 1 | 649 | 46 | A29G19C26T21 | A31G35C29T34 | A40G33C29T37 |
| A. baumannii | 2 | 653 | 46 | A29G19C26T21 | A31G35C29T34 | A40G33C29T37 |
| A. baumannii | 39 | 1497 | 16 | A29G19C26T21 | A31G35C29T34 | A40G34C29T36 |
| A. baumannii | 24 | 1198 | 15 | A29G19C26T21 | A31G35C29T34 | A40G33C29T37 |
| A. baumannii | 28 | 1243 | 15 | A29G19C26T21 | A31G35C29T34 | A40G33C29T37 |
| A. baumannii | 43 | 1648 | 15 | A29G19C26T21 | A31G35C29T34 | A40G33C29T37 |
| A. baumannii | 62 | 1746 | 15 | A29G19C26T21 | A31G35C29T34 | A40G33C29T37 |
| A. baumannii | 4 | 689 | 15 | A29G19C26T21 | A31G35C29T34 | A40G33C29T37 |
| A. baumannii | 68 | 1822 | 3 | A27G20C27T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 69 | 1823A | 3 | A27G20C27T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 70 | 1823B | 3 | A27G20C27T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 71 | 1826 | 3 | A27G20C27T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 72 | 1860 | 3 | A27G20C27T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 81 | 1924 | 3 | A27G20C27T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 82 | 1929 | 3 | A27G20C27T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 85 | 1966 | 3 | A27G20C27T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 11 | 841 | 3 | A27G20C27T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 32 | 1415 | 24 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 45 | 1651 | 24 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 54 | 1697 | 24 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 58 | 1712 | 24 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 60 | 1725 | 24 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 66 | 1802 | 24 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 76 | 1883 | 24 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 78 | 1891 | 24 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 79 | 1892 | 24 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 83 | 1947 | 24 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 84 | 1964 | 24 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 53 | 1696 | 24 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 36 | 1458 | 49 | A27G20C27T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 59 | 1716 | 9 | A27G21C25T22 | A32G35C28T34 | A39G33C30T37 |
| A. baumannii | 9 | 805 | 30 | A27G21C25T22 | A32G35C28T34 | A39G33C30T37 |
| A. baumannii | 18 | 967 | 39 | A27G21C26T21 | A32G35C28T34 | A39G33C30T37 |
| A. baumannii | 30 | 1322 | 48 | A28G21C24T22 | A32G35C29T33 | A40G33C30T36 |
| A. baumannii | 26 | 1218 | 50 | A27G21C25T22 | A31G36C28T34 | A40G33C29T37 |
| A. sp. 13TU | 15 | 875 | A1 | A27G21C25T22 | A30G36C26T37 | A41G34C28T36 |
| A. sp. 13TU | 17 | 895 | A1 | A27G21C25T22 | A30G36C26T37 | A41G34C28T36 |
| A. sp. 3 | 12 | 853 | B7 | A26G23C23T23 | A30G36C27T36 | A39G37C26T37 |
| A. johnsonii | 25 | 1202 | NEW1 | A25G23C24T23 | A30G35C30T34 | A38G37C26T38 |
| A. sp. 2082 | 87 | 2082 | NEW2 | A26G22C24T23 | A31G35C28T35 | A42G34C27T36 |
| TABLE 17C |
| Base Compositions Determined from A. baumannii DNA Samples Obtained from Walter |
| Reed Hospital and Amplified with Triangulation Genotyping Analysis Primer Pair Nos. 1167 and |
| 1170 and 1171 |
| PP No: 1167 | PP No: 1170 | PP No: 1171 | ||||
| Species | Ibis# | Isolate | ST | fumC | fumC | ppa |
| A. baumannii | 20 | 1082 | 1 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 13 | 854 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 22 | 1162 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 27 | 1230 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 31 | 1367 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 37 | 1459 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 55 | 1700 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 64 | 1777 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 73 | 1861 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 74 | 1877 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 86 | 1972 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 3 | 684 | 11 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 6 | 720 | 11 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 7 | 726 | 11 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 19 | 1079 | 11 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 21 | 1123 | 11 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 23 | 1188 | 11 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 33 | 1417 | 11 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 34 | 1431 | 11 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 38 | 1496 | 11 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 40 | 1523 | 11 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 42 | 1640 | 11 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 50 | 1666 | 11 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 51 | 1668 | 11 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 52 | 1695 | 11 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 65 | 1781 | 11 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 44 | 1649 | 12 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 49A | 1658.1 | 12 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 49B | 1658.2 | 12 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 56 | 1707 | 12 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 80 | 1893 | 12 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 5 | 693 | 14 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 8 | 749 | 14 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 10 | 839 | 14 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 14 | 865 | 14 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 16 | 888 | 14 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 29 | 1326 | 14 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 35 | 1440 | 14 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 41 | 1524 | 14 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 46 | 1652 | 14 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 47 | 1653 | 14 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 48 | 1657 | 14 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 57 | 1709 | 14 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 61 | 1727 | 14 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 63 | 1762 | 14 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 67 | 1806 | 14 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 75 | 1881 | 14 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 77 | 1886 | 14 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 1 | 649 | 46 | A41G35C32T39 | A37G28C20T51 | A35G37C32T45 |
| A. baumannii | 2 | 653 | 46 | A41G35C32T39 | A37G28C20T51 | A35G37C32T45 |
| A. baumannii | 39 | 1497 | 16 | A41G35C32T39 | A37G28C20T51 | A35G37C30T47 |
| A. baumannii | 24 | 1198 | 15 | A41G35C32T39 | A37G28C20T51 | A35G37C30T47 |
| A. baumannii | 28 | 1243 | 15 | A41G35C32T39 | A37G28C20T51 | A35G37C30T47 |
| A. baumannii | 43 | 1648 | 15 | A41G35C32T39 | A37G28C20T51 | A35G37C30T47 |
| A. baumannii | 62 | 1746 | 15 | A41G35C32T39 | A37G28C20T51 | A35G37C30T47 |
| A. baumannii | 4 | 689 | 15 | A41G35C32T39 | A37G28C20T51 | A35G37C30T47 |
| A. baumannii | 68 | 1822 | 3 | A41G34C35T37 | A38G27C20T51 | A35G37C31T46 |
| A. baumannii | 69 | 1823A | 3 | A41G34C35T37 | A38G27C20T51 | A35G37C31T46 |
| A. baumannii | 70 | 1823B | 3 | A41G34C35T37 | A38G27C20T51 | A35G37C31T46 |
| A. baumannii | 71 | 1826 | 3 | A41G34C35T37 | A38G27C20T51 | A35G37C31T46 |
| A. baumannii | 72 | 1860 | 3 | A41G34C35T37 | A38G27C20T51 | A35G37C31T46 |
| A. baumannii | 81 | 1924 | 3 | A41G34C35T37 | A38G27C20T51 | A35G37C31T46 |
| A. baumannii | 82 | 1929 | 3 | A41G34C35T37 | A38G27C20T51 | A35G37C31T46 |
| A. baumannii | 85 | 1966 | 3 | A41G34C35T37 | A38G27C20T51 | A35G37C31T46 |
| A. baumannii | 11 | 841 | 3 | A41G34C35T37 | A38G27C20T51 | A35G37C31T46 |
| A. baumannii | 32 | 1415 | 24 | A40G35C34T38 | A39G26C22T49 | A35G37C33T44 |
| A. baumannii | 45 | 1651 | 24 | A40G35C34T38 | A39G26C22T49 | A35G37C33T44 |
| A. baumannii | 54 | 1697 | 24 | A40G35C34T38 | A39G26C22T49 | A35G37C33T44 |
| A. baumannii | 58 | 1712 | 24 | A40G35C34T38 | A39G26C22T49 | A35G37C33T44 |
| A. baumannii | 60 | 1725 | 24 | A40G35C34T38 | A39G26C22T49 | A35G37C33T44 |
| A. baumannii | 66 | 1802 | 24 | A40G35C34T38 | A39G26C22T49 | A35G37C33T44 |
| A. baumannii | 76 | 1883 | 24 | A40G35C34T38 | A39G26C22T49 | A35G37C33T44 |
| A. baumannii | 78 | 1891 | 24 | A40G35C34T38 | A39G26C22T49 | A35G37C33T44 |
| A. baumannii | 79 | 1892 | 24 | A40G35C34T38 | A39G26C22T49 | A35G37C33T44 |
| A. baumannii | 83 | 1947 | 24 | A40G35C34T38 | A39G26C22T49 | A35G37C33T44 |
| A. baumannii | 84 | 1964 | 24 | A40G35C34T38 | A39G26C22T49 | A35G37C33T44 |
| A. baumannii | 53 | 1696 | 24 | A40G35C34T38 | A39G26C22T49 | A35G37C33T44 |
| A. baumannii | 36 | 1458 | 49 | A40G35C34T38 | A39G26C22T49 | A35G37C30T47 |
| A. baumannii | 59 | 1716 | 9 | A40G35C32T40 | A38G27C20T51 | A36G35C31T47 |
| A. baumannii | 9 | 805 | 30 | A40G35C32T40 | A38G27C21T50 | A35G36C29T49 |
| A. baumannii | 18 | 967 | 39 | A40G35C33T39 | A38G27C20T51 | A35G37C30T47 |
| A. baumannii | 30 | 1322 | 48 | A40G35C35T37 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 26 | 1218 | 50 | A40G35C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. sp. 13TU | 15 | 875 | A1 | A41G39C31T36 | A37G26C24T49 | A34G38C31T46 |
| A. sp. 13TU | 17 | 895 | A1 | A41G39C31T36 | A37G26C24T49 | A34G38C31T46 |
| A. sp. 3 | 12 | 853 | B7 | A43G37C30T37 | A36G27C24T49 | A34G37C31T47 |
| A. johnsonii | 25 | 1202 | NEW1 | A42G38C31T36 | A40G27C19T50 | A35G37C32T45 |
| A. sp. 2082 | 87 | 2082 | NEW2 | A43G37C32T35 | A37G26C21T52 | A35G38C31T45 |
| TABLE 18A |
| Base Compositions Determined from A. baumannii DNA Samples Obtained from |
| Northwestern Medical Center and Amplified with Speciating Primer Pair No. 2922 and |
| Triangulation Genotyping Analysis Primer Pair Nos. 1151 and 1156 |
| PP No: 2922 | PP No: 1151 | PP No: 1156 | ||||
| Species | Ibis# | Isolate | ST | efp | trpE | adk |
| A. baumannii | 54 | 536 | 3 | A44G35C24T44 | A44G35C22T41 | A44G32C26T38 |
| A. baumannii | 87 | 665 | 3 | A44G35C24T44 | A44G35C22T41 | A44G32C26T38 |
| A. baumannii | 8 | 80 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 9 | 91 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 10 | 92 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 11 | 131 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 12 | 137 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 21 | 218 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 26 | 242 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 94 | 678 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 1 | 9 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 2 | 13 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 3 | 19 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 4 | 24 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 5 | 36 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 6 | 39 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 13 | 139 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 15 | 165 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 16 | 170 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 17 | 186 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 20 | 202 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 22 | 221 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 24 | 234 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 25 | 239 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 33 | 370 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 34 | 389 | 10 | A45G34C25T43 | A44G35C21T42 | A44G32C26T38 |
| A. baumannii | 19 | 201 | 14 | A44G35C25T43 | A44G35C22T41 | A44G32C27T37 |
| A. baumannii | 27 | 257 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 29 | 301 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 31 | 354 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 36 | 422 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 37 | 424 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 38 | 434 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 39 | 473 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 40 | 482 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 44 | 512 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 45 | 516 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 47 | 522 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 48 | 526 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 50 | 528 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 52 | 531 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 53 | 533 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 56 | 542 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 59 | 550 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 62 | 556 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 64 | 557 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 70 | 588 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 73 | 603 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 74 | 605 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 75 | 606 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 77 | 611 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 79 | 622 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 83 | 643 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 85 | 653 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 89 | 669 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 93 | 674 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 23 | 228 | 51 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 32 | 369 | 52 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 35 | 393 | 52 | A44G35C25T43 | A43G36C20T43 | A44G32C26T38 |
| A. baumannii | 30 | 339 | 53 | A44G35C25T43 | A44G35C19T44 | A44G32C27T37 |
| A. baumannii | 41 | 485 | 53 | A44G35C25T43 | A44G35C19T44 | A44G32C27T37 |
| A. baumannii | 42 | 493 | 53 | A44G35C25T43 | A44G35C19T44 | A44G32C27T37 |
| A. baumannii | 43 | 502 | 53 | A44G35C25T43 | A44G35C19T44 | A44G32C27T37 |
| A. baumannii | 46 | 520 | 53 | A44G35C25T43 | A44G35C19T44 | A44G32C27T37 |
| A. baumannii | 49 | 527 | 53 | A44G35C25T43 | A44G35C19T44 | A44G32C27T37 |
| A. baumannii | 51 | 529 | 53 | A44G35C25T43 | A44G35C19T44 | A44G32C27T37 |
| A. baumannii | 65 | 562 | 53 | A44G35C25T43 | A44G35C19T44 | A44G32C27T37 |
| A. baumannii | 68 | 579 | 53 | A44G35C25T43 | A44G35C19T44 | A44G32C27T37 |
| A. baumannii | 57 | 546 | 54 | A44G35C25T43 | A44G35C20T43 | A44G32C26T38 |
| A. baumannii | 58 | 548 | 54 | A44G35C25T43 | A44G35C20T43 | A44G32C26T38 |
| A. baumannii | 60 | 552 | 54 | A44G35C25T43 | A44G35C20T43 | A44G32C26T38 |
| A. baumannii | 61 | 555 | 54 | A44G35C25T43 | A44G35C20T43 | A44G32C26T38 |
| A. baumannii | 63 | 557 | 54 | A44G35C25T43 | A44G35C20T43 | A44G32C26T38 |
| A. baumannii | 66 | 570 | 54 | A44G35C25T43 | A44G35C20T43 | A44G32C26T38 |
| A. baumannii | 67 | 578 | 54 | A44G35C25T43 | A44G35C20T43 | A44G32C26T38 |
| A. baumannii | 69 | 584 | 54 | A44G35C25T43 | A44G35C20T43 | A44G32C26T38 |
| A. baumannii | 71 | 593 | 54 | A44G35C25T43 | A44G35C20T43 | A44G32C26T38 |
| A. baumannii | 72 | 602 | 54 | A44G35C25T43 | A44G35C20T43 | A44G32C26T38 |
| A. baumannii | 76 | 609 | 54 | A44G35C25T43 | A44G35C20T43 | A44G32C26T38 |
| A. baumannii | 78 | 621 | 54 | A44G35C25T43 | A44G35C20T43 | A44G32C26T38 |
| A. baumannii | 80 | 625 | 54 | A44G35C25T43 | A44G35C20T43 | A44G32C26T38 |
| A. baumannii | 81 | 628 | 54 | A44G35C25T43 | A44G35C20T43 | A44G32C26T38 |
| A. baumannii | 82 | 632 | 54 | A44G35C25T43 | A44G35C20T43 | A44G32C26T38 |
| A. baumannii | 84 | 649 | 54 | A44G35C25T43 | A44G35C20T43 | A44G32C26T38 |
| A. baumannii | 86 | 655 | 54 | A44G35C25T43 | A44G35C20T43 | A44G32C26T38 |
| A. baumannii | 88 | 668 | 54 | A44G35C25T43 | A44G35C20T43 | A44G32C26T38 |
| A. baumannii | 90 | 671 | 54 | A44G35C25T43 | A44G35C20T43 | A44G32C26T38 |
| A. baumannii | 91 | 672 | 54 | A44G35C25T43 | A44G35C20T43 | A44G32C26T38 |
| A. baumannii | 92 | 673 | 54 | A44G35C25T43 | A44G35C20T43 | A44G32C26T38 |
| A. baumannii | 18 | 196 | 55 | A44G35C25T43 | A44G35C20T43 | A44G32C27T37 |
| A. baumannii | 55 | 537 | 27 | A44G35C25T43 | A44G35C19T44 | A44G32C27T37 |
| A. baumannii | 28 | 263 | 27 | A44G35C25T43 | A44G35C19T44 | A44G32C27T37 |
| A. sp. 3 | 14 | 164 | B7 | A46G35C24T42 | A42G34C20T46 | A43G33C24T40 |
| mixture | 7 | 71 | ? | mixture | ND | ND |
| TABLE 18B |
| Base Compositions Determined from A. baumannii DNA Samples Obtained from |
| Northwestern Medical Center and Amplified with Triangulation Genotyping Analysis Primer |
| Pair Nos. 1158, 1160 and 1165 |
| PP No: 1158 | PP No: 1160 | PP No: 1165 | ||||
| Species | Ibis# | Isolate | ST | mutY | mutY | fumC |
| A. baumannii | 54 | 536 | 3 | A27G20C27T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 87 | 665 | 3 | A27G20C27T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 8 | 80 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 9 | 91 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 10 | 92 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 11 | 131 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 12 | 137 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 21 | 218 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 26 | 242 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 94 | 678 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 1 | 9 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 2 | 13 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 3 | 19 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 4 | 24 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 5 | 36 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 6 | 39 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 13 | 139 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 15 | 165 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 16 | 170 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 17 | 186 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 20 | 202 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 22 | 221 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 24 | 234 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 25 | 239 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 33 | 370 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 34 | 389 | 10 | A27G21C26T21 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 19 | 201 | 14 | A27G21C25T22 | A31G36C28T34 | A40G33C29T37 |
| A. baumannii | 27 | 257 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 29 | 301 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 31 | 354 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 36 | 422 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 37 | 424 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 38 | 434 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 39 | 473 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 40 | 482 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 44 | 512 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 45 | 516 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 47 | 522 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 48 | 526 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 50 | 528 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 52 | 531 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 53 | 533 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 56 | 542 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 59 | 550 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 62 | 556 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 64 | 557 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 70 | 588 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 73 | 603 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 74 | 605 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 75 | 606 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 77 | 611 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 79 | 622 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 83 | 643 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 85 | 653 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 89 | 669 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 93 | 674 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 23 | 228 | 51 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 32 | 369 | 52 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 35 | 393 | 52 | A27G21C25T22 | A32G35C28T34 | A40G33C29T37 |
| A. baumannii | 30 | 339 | 53 | A28G20C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 41 | 485 | 53 | A28G20C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 42 | 493 | 53 | A28G20C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 43 | 502 | 53 | A28G20C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 46 | 520 | 53 | A28G20C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 49 | 527 | 53 | A28G20C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 51 | 529 | 53 | A28G20C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 65 | 562 | 53 | A28G20C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 68 | 579 | 53 | A28G20C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 57 | 546 | 54 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 58 | 548 | 54 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 60 | 552 | 54 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 61 | 555 | 54 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 63 | 557 | 54 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 66 | 570 | 54 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 67 | 578 | 54 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 69 | 584 | 54 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 71 | 593 | 54 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 72 | 602 | 54 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 76 | 609 | 54 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 78 | 621 | 54 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 80 | 625 | 54 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 81 | 628 | 54 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 82 | 632 | 54 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 84 | 649 | 54 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 86 | 655 | 54 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 88 | 668 | 54 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 90 | 671 | 54 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 91 | 672 | 54 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 92 | 673 | 54 | A27G21C26T21 | A32G34C29T34 | A40G33C30T36 |
| A. baumannii | 18 | 196 | 55 | A27G21C25T22 | A31G36C27T35 | A40G33C29T37 |
| A. baumannii | 55 | 537 | 27 | A27G21C25T22 | A32G35C28T34 | A40G33C30T36 |
| A. baumannii | 28 | 263 | 27 | A27G21C25T22 | A32G35C28T34 | A40G33C30T36 |
| A. sp. 3 | 14 | 164 | B7 | A26G23C23T23 | A30G36C27T36 | A39G37C26T37 |
| mixture | 7 | 71 | ? | ND | ND | ND |
| TABLE 18C |
| Base Compositions Determined from A. baumannii DNA Samples Obtained from |
| Northwestern Medical Center and Amplified with Triangulation Genotyping Analysis Primer |
| Pair Nos. 1167, 1170 and 1171 |
| PP No: 1167 | PP No: 1170 | PP No: 1171 | ||||
| Species | Ibis# | Isolate | ST | fumC | fumC | ppa |
| A. baumannii | 54 | 536 | 3 | A41G34C35T37 | A38G27C20T51 | A35G37C31T46 |
| A. baumannii | 87 | 665 | 3 | A41G34C35T37 | A38G27C20T51 | A35G37C31T46 |
| A. baumannii | 8 | 80 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 9 | 91 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 10 | 92 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 11 | 131 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 12 | 137 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 21 | 218 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 26 | 242 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 94 | 678 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 1 | 9 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 2 | 13 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 3 | 19 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 4 | 24 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 5 | 36 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 6 | 39 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 13 | 139 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 15 | 165 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 16 | 170 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 17 | 186 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 20 | 202 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 22 | 221 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 24 | 234 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 25 | 239 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 33 | 370 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 34 | 389 | 10 | A41G34C34T38 | A38G27C21T50 | A35G37C33T44 |
| A. baumannii | 19 | 201 | 14 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 27 | 257 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 29 | 301 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 31 | 354 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 36 | 422 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 37 | 424 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 38 | 434 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 39 | 473 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 40 | 482 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 44 | 512 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 45 | 516 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 47 | 522 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 48 | 526 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 50 | 528 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 52 | 531 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 53 | 533 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 56 | 542 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 59 | 550 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 62 | 556 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 64 | 557 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 70 | 588 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 73 | 603 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 74 | 605 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 75 | 606 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 77 | 611 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 79 | 622 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 83 | 643 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 85 | 653 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 89 | 669 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 93 | 674 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 23 | 228 | 51 | A40G35C34T38 | A38G27C21T50 | A35G37C30T47 |
| A. baumannii | 32 | 369 | 52 | A40G35C34T38 | A38G27C21T50 | A35G37C31T46 |
| A. baumannii | 35 | 393 | 52 | A40G35C34T38 | A38G27C21T50 | A35G37C31T46 |
| A. baumannii | 30 | 339 | 53 | A40G35C35T37 | A38G27C21T50 | A35G37C31T46 |
| A. baumannii | 41 | 485 | 53 | A40G35C35T37 | A38G27C21T50 | A35G37C31T46 |
| A. baumannii | 42 | 493 | 53 | A40G35C35T37 | A38G27C21T50 | A35G37C31T46 |
| A. baumannii | 43 | 502 | 53 | A40G35C35T37 | A38G27C21T50 | A35G37C31T46 |
| A. baumannii | 46 | 520 | 53 | A40G35C35T37 | A38G27C21T50 | A35G37C31T46 |
| A. baumannii | 49 | 527 | 53 | A40G35C35T37 | A38G27C21T50 | A35G37C31T46 |
| A. baumannii | 51 | 529 | 53 | A40G35C35T37 | A38G27C21T50 | A35G37C31T46 |
| A. baumannii | 65 | 562 | 53 | A40G35C35T37 | A38G27C21T50 | A35G37C31T46 |
| A. baumannii | 68 | 579 | 53 | A40G35C35T37 | A38G27C21T50 | A35G37C31T46 |
| A. baumannii | 57 | 546 | 54 | A40G35C34T38 | A39G26C22T49 | A35G37C31T46 |
| A. baumannii | 58 | 548 | 54 | A40G35C34T38 | A39G26C22T49 | A35G37C31T46 |
| A. baumannii | 60 | 552 | 54 | A40G35C34T38 | A39G26C22T49 | A35G37C31T46 |
| A. baumannii | 61 | 555 | 54 | A40G35C34T38 | A39G26C22T49 | A35G37C31T46 |
| A. baumannii | 63 | 557 | 54 | A40G35C34T38 | A39G26C22T49 | A35G37C31T46 |
| A. baumannii | 66 | 570 | 54 | A40G35C34T38 | A39G26C22T49 | A35G37C31T46 |
| A. baumannii | 67 | 578 | 54 | A40G35C34T38 | A39G26C22T49 | A35G37C31T46 |
| A. baumannii | 69 | 584 | 54 | A40G35C34T38 | A39G26C22T49 | A35G37C31T46 |
| A. baumannii | 71 | 593 | 54 | A40G35C34T38 | A39G26C22T49 | A35G37C31T46 |
| A. baumannii | 72 | 602 | 54 | A40G35C34T38 | A39G26C22T49 | A35G37C31T46 |
| A. baumannii | 76 | 609 | 54 | A40G35C34T38 | A39G26C22T49 | A35G37C31T46 |
| A. baumannii | 78 | 621 | 54 | A40G35C34T38 | A39G26C22T49 | A35G37C31T46 |
| A. baumannii | 80 | 625 | 54 | A40G35C34T38 | A39G26C22T49 | A35G37C31T46 |
| A. baumannii | 81 | 628 | 54 | A40G35C34T38 | A39G26C22T49 | A35G37C31T46 |
| A. baumannii | 82 | 632 | 54 | A40G35C34T38 | A39G26C22T49 | A35G37C31T46 |
| A. baumannii | 84 | 649 | 54 | A40G35C34T38 | A39G26C22T49 | A35G37C31T46 |
| A. baumannii | 86 | 655 | 54 | A40G35C34T38 | A39G26C22T49 | A35G37C31T46 |
| A. baumannii | 88 | 668 | 54 | A40G35C34T38 | A39G26C22T49 | A35G37C31T46 |
| A. baumannii | 90 | 671 | 54 | A40G35C34T38 | A39G26C22T49 | A35G37C31T46 |
| A. baumannii | 91 | 672 | 54 | A40G35C34T38 | A39G26C22T49 | A35G37C31T46 |
| A. baumannii | 92 | 673 | 54 | A40G35C34T38 | A39G26C22T49 | A35G37C31T46 |
| A. baumannii | 18 | 196 | 55 | A42G34C33T38 | A38G27C20T51 | A35G37C31T46 |
| A. baumannii | 55 | 537 | 27 | A40G35C33T39 | A38G27C20T51 | A35G37C33T44 |
| A. baumannii | 28 | 263 | 27 | A40G35C33T39 | A38G27C20T51 | A35G37C33T44 |
| A. sp. 3 | 14 | 164 | B7 | A43G37C30T37 | A36G27C24T49 | A34G37C31T47 |
| mixture | 7 | 71 | — | ND | ND | ND |
Base composition analysis of the samples obtained from Walter Reed hospital indicated that a majority of the strain types identified were the same strain types already characterized by the OIF study of Example 12. This is not surprising since at least some patients from which clinical samples were obtained in OIF were transferred to the Walter Reed Hospital (WRAI). Examples of these common strain types include: ST10, ST11, ST12, ST14, ST15, ST16 and ST46. A strong correlation was noted between these strain types and the presence of mutations in the gyrA and parC which confer quinolone drug resistance.
In contrast, the results of base composition analysis of samples obtained from Northwestern Medical Center indicate the presence of 4 major strain types: ST10, ST51, ST53 and ST54. All of these strain types have the gyrA quinolone resistance mutation and most also have the parC quinolone resistance mutation, with the exception of ST35. This observation is consistent with the current understanding that the gyrA mutation generally appears before the parC mutation and suggests that the acquisition of these drug resistance mutations is rather recent and that resistant isolates are taking over the wild-type isolates. Another interesting observation was that a single isolate of ST3 (isolate 841) displays a triangulation genotyping analysis pattern similar to other isolates of ST3, but the codon analysis amplification product base compositions indicate that this isolate has not yet undergone the quinolone resistance mutations in gyrA and parC.
The six isolates that represent species other than Acinetobacter baumannii in the samples obtained from the Walter Reed Hospital were each found to not carry the drug resistance mutations.
The results described above involved analysis of 183 samples using the methods and compositions of the present invention. Results were provided to collaborators at the Walter Reed hospital and Northwestern Medical center within a week of obtaining samples. This example highlights the rapid throughout characteristics of the analysis platform and the resolving power of triangulation genotyping analysis and codon analysis for identification of and determination of drug resistance in bacteria.
Example 14 Identification of Drug Resistance Genes and Virulence Factors in Staphylococcus aureusAn eight primer pair panel was designed for identification of drug resistance genes and virulence factors of Staphylococcus aureus and is shown in Table 19. The primer sequences are found in Table 2 and are cross-referenced by the primer pair numbers, primer pair names or SEQ ID NOs listed in Table 19.
| TABLE 19 |
| Primer Pairs for Identification of Drug Resistance Genes and Virulence Factors in Staphylococcus |
| aureus |
| Forward | Reverse | ||||
| Primer | Primer | Primer | |||
| Pair | (SEQ ID | (SEQ ID | Target | ||
| No. | Forward Primer Name | NO:) | Reverse Primer Name | NO:) | Gene |
| 879 | MECA_Y14051_4507_4530_F | 288 | MECA_Y14051_4555_4581_R | 1269 | mecA |
| 2056 | MECI-R_NC003923-41798- | 698 | MECI-R_NC003923-41798- | 1420 | MecI-R |
| 41609_33_60_F | 41609_86_113_R | ||||
| 2081 | ERMA_NC002952-55890- | 217 | ERMA_NC002952-55890- | 1167 | ermA |
| 56621_366_395_F | 56621_438_465_R | ||||
| 2086 | ERMC_NC005908-2004- | 399 | ERMC_NC005908-2004- | 1041 | ermC |
| 2738_85_116_F | 2738_173_206_R | ||||
| 2095 | PVLUK_NC003923-1529595- | 456 | PVLUK_NC003923-1529595- | 1261 | Pv-luk |
| 1531285_688_713_F | 1531285_775_804_R | ||||
| 2249 | TUFB_NC002758-615038- | 430 | TUFB_NC002758-615038- | 1321 | tufB |
| 616222_696_725_F | 616222_793_820_R | ||||
| 2256 | NUC_NC002758-894288- | 174 | NUC_NC002758-894288- | 853 | Nuc |
| 894974_316_345_F | 894974_396_421_R | ||||
| 2313 | MUPR_X75439_2486_2516_F | 172 | MUPR_X75439_2548_2574_R | 1360 | mupR |
Primer pair numbers 2256 and 2249 are confirmation primers designed with the aim of high level identification of Staphylococcus aureus. The nuc gene is a Staphylococcus aureus-specific marker gene. The tufB gene is a universal housekeeping gene but the bioagent identifying amplicon defined by primer pair number 2249 provides a unique base composition (A43 G28 C19 T35) which distinguishes Staphylococcus aureus from other members of the genus Staphylococcus.
High level methicillin resistance in a given strain of Staphylococcus aureus is indicated by bioagent identifying amplicons defined by primer pair numbers 879 and 2056. Analyses have indicated that primer pair number 879 is not expected to prime S. sciuri homolog or Enterococcus faecalis/faciem ampicillin-resistant PBP5 homologs.
Macrolide and erythromycin resistance in a given strain of Staphylococcus aureus is indicated by bioagent identifying amplicons defined by primer pair numbers 2081 and 2086.
Resistance to mupriocin in a given strain of Staphylococcus aureus is indicated by bioagent identifying amplicons defined by primer pair number 2313.
Virulence in a given strain of Staphylococcus aureus is indicated by bioagent identifying amplicons defined by primer pair number 2095. This primer pair can simultaneously and identify the pvl (lukS-PV) gene and the lukd gene which encodes a homologous enterotoxin. A bioagent identifying amplicon of the lukD gene has a six nucleobase length difference relative to the lukS-PV gene.
A total of 32 blinded samples of different strains of Staphylococcus aureus were provided by the Center for Disease Control (CDC). Each sample was analyzed by PCR amplification with the eight primer pair panel, followed by purification and measurement of molecular masses of the amplification products by mass spectrometry. Base compositions for the amplification products were calculated. The base compositions provide the information summarized above for each primer pair. The results are shown in Tables 20A and B. One result noted upon un-blinding of the samples is that each of the PVL+identifications agreed with PVL+ identified in the same samples by standard PCR assays. These results indicate that the panel of eight primer pairs is useful for identification of drug resistance and virulence sub-species characteristics for Staphylococcus aureus. It is expected that a kit comprising one or more of the members of this panel will be a useful embodiment of the present invention.
| TABLE 20A |
| Drug Resistance and Virulence Identified in Blinded Samples |
| of Various Strains of Staphylococcus aureus with Primer |
| Pair Nos. 2081, 2086, 2095 and 2256 |
| Primer | Primer | |||
| Sample | Pair No. | Primer Pair No. | Primer Pair No. | Pair No. |
| Index No. | 2081 (ermA) | 2086 (ermC) | 2095 (pv-luk) | 2256 (nuc) |
| CDC0010 | − | − | PVL−/lukD+ | + |
| CDC0015 | − | − | PVL+/lukD+ | + |
| CDC0019 | − | + | PVL−/lukD+ | + |
| CDC0026 | + | − | PVL−/lukD+ | + |
| CDC0030 | + | − | PVL−/lukD+ | + |
| CDC004 | − | − | PVL+/lukD+ | + |
| CDC0014 | − | + | PVL+/lukD+ | + |
| CDC008 | − | − | PVL−/lukD+ | + |
| CDC001 | + | − | PVL−/lukD+ | + |
| CDC0022 | + | − | PVL−/lukD+ | + |
| CDC006 | + | − | PVL−/lukD+ | + |
| CDC007 | − | − | PVL−/lukD+ | + |
| CDCVRSA1 | + | − | PVL−/lukD+ | + |
| CDCVRSA2 | + | + | PVL−/lukD+ | + |
| CDC0011 | + | − | PVL−/lukD+ | + |
| CDC0012 | − | − | PVL+/lukD− | + |
| CDC0021 | + | − | PVL−/lukD+ | + |
| CDC0023 | + | − | PVL−/lukD+ | + |
| CDC0025 | + | − | PVL−/lukD+ | + |
| CDC005 | − | − | PVL−/lukD+ | + |
| CDC0018 | + | − | PVL+/lukD− | + |
| CDC002 | − | − | PVL−/lukD+ | + |
| CDC0028 | + | − | PVL−/lukD+ | + |
| CDC003 | − | − | PVL−/lukD+ | + |
| CDC0013 | − | − | PVL+/lukD+ | + |
| CDC0016 | − | − | PVL−/lukD+ | + |
| CDC0027 | + | − | PVL−/lukD+ | + |
| CDC0029 | − | − | PVL+/lukD+ | + |
| CDC0020 | − | + | PVL−/lukD+ | + |
| CDC0024 | − | − | PVL−/lukD+ | + |
| CDC0031 | − | − | PVL−/lukD+ | + |
| TABLE 20B |
| Drug Resistance and Virulence Identified in Blinded Samples of Various Strains of |
| Staphylococcus aureus with Primer Pair Nos. 2249, 879, 2056, and 2313 |
| Sample | Primer Pair No. 2249 | Primer Pair No. | Primer Pair No. | Primer Pair No. |
| Index No. | (tufB) | 879 (mecA) | 2056 (mecI-R) | 2313 (mupR) |
| CDC0010 | Staphylococcus aureus | + | + | − |
| CDC0015 | Staphylococcus aureus | − | − | − |
| CDC0019 | Staphylococcus aureus | + | + | − |
| CDC0026 | Staphylococcus aureus | + | + | − |
| CDC0030 | Staphylococcus aureus | + | + | − |
| CDC004 | Staphylococcus aureus | + | + | − |
| CDC0014 | Staphylococcus aureus | + | + | − |
| CDC008 | Staphylococcus aureus | + | + | − |
| CDC001 | Staphylococcus aureus | + | + | − |
| CDC0022 | Staphylococcus aureus | + | + | − |
| CDC006 | Staphylococcus aureus | + | + | + |
| CDC007 | Staphylococcus aureus | + | + | − |
| CDCVRSA1 | Staphylococcus aureus | + | + | − |
| CDCVRSA2 | Staphylococcus aureus | + | + | − |
| CDC0011 | Staphylococcus aureus | − | − | − |
| CDC0012 | Staphylococcus aureus | + | + | − |
| CDC0021 | Staphylococcus aureus | + | + | − |
| CDC0023 | Staphylococcus aureus | + | + | − |
| CDC0025 | Staphylococcus aureus | + | + | − |
| CDC005 | Staphylococcus aureus | + | + | − |
| CDC0018 | Staphylococcus aureus | + | + | − |
| CDC002 | Staphylococcus aureus | + | + | − |
| CDC0028 | Staphylococcus aureus | + | + | − |
| CDC003 | Staphylococcus aureus | + | + | − |
| CDC0013 | Staphylococcus aureus | + | + | − |
| CDC0016 | Staphylococcus aureus | + | + | − |
| CDC0027 | Staphylococcus aureus | + | + | − |
| CDC0029 | Staphylococcus aureus | + | + | − |
| CDC0020 | Staphylococcus aureus | − | − | − |
| CDC0024 | Staphylococcus aureus | + | + | − |
| CDC0031 | Staphylococcus scleiferi | − | − | − |
To combine the power of high-throughput mass spectrometric analysis of bioagent identifying amplicons with the sub-species characteristic resolving power provided by triangulation genotyping analysis, a panel of eight triangulation genotyping analysis primer pairs was selected. The primer pairs are designed to produce bioagent identifying amplicons within six different housekeeping genes which are listed in Table 21. The primer sequences are found in Table 2 and are cross-referenced by the primer pair numbers, primer pair names or SEQ ID NOs listed in Table 21.
| TABLE 21 |
| Primer Pairs for Triangulation Genotyping Analysis of Staphylococcus aureus |
| Forward | Reverse | ||||
| Primer | Primer | Primer | |||
| Pair | (SEQ ID | (SEQ ID | Target | ||
| No. | Forward Primer Name | NO:) | Reverse Primer Name | NO:) | Gene |
| 2146 | ARCC_NC003923-2725050- | 437 | ARCC_NC003923-2725050- | 1137 | arcC |
| 2724595_131_161_F | 2724595_214_245_R | ||||
| 2149 | AROE_NC003923-1674726- | 530 | AROE_NC003923-1674726- | 891 | aroE |
| 1674277_30_62_F | 1674277_155_181_R | ||||
| 2150 | AROE_NC003923-1674726- | 474 | AROE_NC003923-1674726- | 869 | aroE |
| 1674277_204_232_F | 1674277_308_335_R | ||||
| 2156 | GMK_NC003923-1190906- | 268 | GMK_NC003923-1190906- | 1284 | gmk |
| 1191334_301_329_F | 1191334_403_432_R | ||||
| 2157 | PTA_NC003923-628885- | 418 | PTA_NC003923-628885- | 1301 | pta |
| 629355_237_263_F | 629355_314_345_R | ||||
| 2161 | TPI_NC003923-830671- | 318 | TPI_NC003923-830671- | 1300 | tpi |
| 831072_1_34_F | 831072_97_129_R | ||||
| 2163 | YQI_NC003923-378916- | 440 | YQI_NC003923-378916- | 1076 | yqi |
| 379431_142_167_F | 379431_259_284_R | ||||
| 2166 | YQI_NC003923-378916- | 219 | YQI_NC003923-378916- | 1013 | yqi |
| 379431_275_300_F | 379431_364_396_R | ||||
The same samples analyzed for drug resistance and virulence in Example 14 were subjected to triangulation genotyping analysis. The primer pairs of Table 21 were used to produce amplification products by PCR, which were subsequently purified and measured by mass spectrometry. Base compositions were calculated from the molecular masses and are shown in Tables 22A and 22B.
| TABLE 22A |
| Triangulation Genotyping Analysis of Blinded Samples of Various Strains of |
| Staphylococcus aureus with Primer Pair Nos. 2146, 2149, 2150 and 2156 |
| Sample | Primer Pair No. | Primer Pair No. | Primer Pair No. | Primer Pair No. | |
| Index No. | Strain | 2146 (arcC) | 2149 (aroE) | 2150 (aroE) | 2156 (gmk) |
| CDC0010 | COL | A44 G24 C18 T29 | A59 G24 C18 T51 | A40 G36 C13 T43 | A50 G30 C20 T32 |
| CDC0015 | COL | A44 G24 C18 T29 | A59 G24 C18 T51 | A40 G36 C13 T43 | A50 G30 C20 T32 |
| CDC0019 | COL | A44 G24 C18 T29 | A59 G24 C18 T51 | A40 G36 C13 T43 | A50 G30 C20 T32 |
| CDC0026 | COL | A44 G24 C18 T29 | A59 G24 C18 T51 | A40 G36 C13 T43 | A50 G30 C20 T32 |
| CDC0030 | COL | A44 G24 C18 T29 | A59 G24 C18 T51 | A40 G36 C13 T43 | A50 G30 C20 T32 |
| CDC004 | COL | A44 G24 C18 T29 | A59 G24 C18 T51 | A40 G36 C13 T43 | A50 G30 C20 T32 |
| CDC0014 | COL | A44 G24 C18 T29 | A59 G24 C18 T51 | A40 G36 C13 T43 | A50 G30 C20 T32 |
| CDC008 | ???? | A44 G24 C18 T29 | A59 G24 C18 T51 | A40 G36 C13 T43 | A50 G30 C20 T32 |
| CDC001 | Mu50 | A45 G23 C20 T27 | A58 G24 C18 T52 | A40 G36 C13 T43 | A51 G29 C21 T31 |
| CDC0022 | Mu50 | A45 G23 C20 T27 | A58 G24 C18 T52 | A40 G36 C13 T43 | A51 G29 C21 T31 |
| CDC006 | Mu50 | A45 G23 C20 T27 | A58 G24 C18 T52 | A40 G36 C13 T43 | A51 G29 C21 T31 |
| CDC0011 | MRSA252 | A45 G24 C18 T28 | A58 G24 C19 T51 | A41 G36 C12 T43 | A51 G29 C21 T31 |
| CDC0012 | MRSA252 | A45 G24 C18 T28 | A58 G24 C19 T51 | A41 G36 C12 T43 | A51 G29 C21 T31 |
| CDC0021 | MRSA252 | A45 G24 C18 T28 | A58 G24 C19 T51 | A41 G36 C12 T43 | A51 G29 C21 T31 |
| CDC0023 | ST: 110 | A45 G24 C18 T28 | A59 G24 C18 T51 | A40 G36 C13 T43 | A50 G30 C20 T32 |
| CDC0025 | ST: 110 | A45 G24 C18 T28 | A59 G24 C18 T51 | A40 G36 C13 T43 | A50 G30 C20 T32 |
| CDC005 | ST: 338 | A44 G24 C18 T29 | A59 G23 C19 T51 | A40 G36 C14 T42 | A51 G29 C21 T31 |
| CDC0018 | ST: 338 | A44 G24 C18 T29 | A59 G23 C19 T51 | A40 G36 C14 T42 | A51 G29 C21 T31 |
| CDC002 | ST: 108 | A46 G23 C20 T26 | A58 G24 C19 T51 | A42 G36 C12 T42 | A51 G29 C20 T32 |
| CDC0028 | ST: 108 | A46 G23 C20 T26 | A58 G24 C19 T51 | A42 G36 C12 T42 | A51 G29 C20 T32 |
| CDC003 | ST: 107 | A45 G23 C20 T27 | A58 G24 C18 T52 | A40 G36 C13 T43 | A51 G29 C21 T31 |
| CDC00C13 | ST: 12 | ND | A59 G24 C18 T51 | A40 G36 C13 T43 | A51 G29 C21 T31 |
| CDC0016 | ST: 120 | A45 G23 C18 T29 | A58 G24 C19 T51 | A40 G37 C13 T42 | A51 G29 C21 T31 |
| CDC0027 | ST: 105 | A45 G23 C20 T27 | A58 G24 C18 T52 | A40 G36 C13 T43 | A51 G29 C21 T31 |
| CDC0029 | MSSA476 | A45 G23 C20 T27 | A58 G24 C19 T51 | A40 G36 C13 T43 | A50 G30 C20 T32 |
| CDC0020 | ST: 15 | A44 G23 C21 T27 | A59 G23 C18 T52 | A40 G36 C13 T43 | A50 G30 C20 T32 |
| CDC0024 | ST: 137 | A45 G23 C20 T27 | A57 G25 C19 T51 | A40 G36 C13 T43 | A51 G29 C22 T30 |
| CDC0031 | *** | No product | No product | No product | No product |
| TABLE 22B |
| Triangulation Genotyping Analysis of Blinded Samples of Various Strains of |
| Staphylococcus aureus with Primer Pair Nos. 2146, 2149, 2150 and 2156 |
| Sample | Primer Pair No. | Primer Pair No. | Primer Pair No. | Primer Pair No. | |
| Index No. | Strain | 2157 (pta) | 2161 (tpi) | 2163 (yqi) | 2166 (yqi) |
| CDC0010 | COL | A32 G25 C23 T29 | A51 G28 C22 T28 | A41 G37 C22 T43 | A37 G30 C18 T37 |
| CDC0015 | COL | A32 G25 C23 T29 | A51 G28 C22 T28 | A41 G37 C22 T43 | A37 G30 C18 T37 |
| CDC0019 | COL | A32 G25 C23 T29 | A51 G28 C22 T28 | A41 G37 C22 T43 | A37 G30 C18 T37 |
| CDC0026 | COL | A32 G25 C23 T29 | A51 G28 C22 T28 | A41 G37 C22 T43 | A37 G30 C18 T37 |
| CDC0030 | COL | A32 G25 C23 T29 | A51 G28 C22 T28 | A41 G37 C22 T43 | A37 G30 C18 T37 |
| CDC004 | COL | A32 G25 C23 T29 | A51 G28 C22 T28 | A41 G37 C22 T43 | A37 G30 C18 T37 |
| CDC0014 | COL | A32 G25 C23 T29 | A51 G28 C22 T28 | A41 G37 C22 T43 | A37 G30 C18 T37 |
| CDC008 | unknown | A32 G25 C23 T29 | A51 G28 C22 T28 | A41 G37 C22 T43 | A37 G30 C18 T37 |
| CDC001 | Mu50 | A33 G25 C22 T29 | A50 G28 C22 T29 | A42 G36 C22 T43 | A36 G31 C19 T36 |
| CDC0022 | Mu50 | A33 G25 C22 T29 | A50 G28 C22 T29 | A42 G36 C22 T43 | A36 G31 C19 T36 |
| CDC006 | Mu50 | A33 G25 C22 T29 | A50 G28 C22 T29 | A42 G36 C22 T43 | A36 G31 C19 T36 |
| CDC0011 | MRSA252 | A32 G25 C23 T29 | A50 G28 C22 T29 | A42 G36 C22 T43 | A37 G30 C18 T37 |
| CDC0012 | MRSA252 | A32 G25 C23 T29 | A50 G28 C22 T29 | A42 G36 C22 T43 | A37 G30 C18 T37 |
| CDC0021 | MRSA252 | A32 G25 C23 T29 | A50 G28 C22 T29 | A42 G36 C22 T43 | A37 G30 C18 T37 |
| CDC0023 | ST: 110 | A32 G25 C23 T29 | A51 G28 C22 T28 | A41 G37 C22 T43 | A37 G30 C18 T37 |
| CDC0025 | ST: 110 | A32 G25 C23 T29 | A51 G28 C22 T28 | A41 G37 C22 T43 | A37 G30 C18 T37 |
| CDC005 | ST: 338 | A32 G25 C24 T28 | A51 G27 C21 T30 | A42 G36 C22 T43 | A37 G30 C18 T37 |
| CDC0018 | ST: 338 | A32 G25 C24 T28 | A51 G27 C21 T30 | A42 G36 C22 T43 | A37 G30 C18 T37 |
| CDC002 | ST: 108 | A33 G25 C23 T28 | A50 G28 C22 T29 | A42 G36 C22 T43 | A37 G30 C18 T37 |
| CDC0028 | ST: 108 | A33 G25 C23 T28 | A50 G28 C22 T29 | A42 G36 C22 T43 | A37 G30 C18 T37 |
| CDC003 | ST: 107 | A33 G25 C23 T29 | A51 G28 C22 T28 | A41 G37 C22 T43 | A37 G30 C18 T37 |
| CDC0013 | ST: 12 | A32 G25 C23 T29 | A51 G28 C22 T28 | A42 G36 C22 T43 | A37 G30 C18 T37 |
| CDC0016 | ST: 120 | A32 G25 C24 T28 | A50 G28 C21 T30 | A42 G36 C22 T43 | A37 G30 C18 T37 |
| CDC0027 | ST: 105 | A33 G25 C22 T29 | A50 G28 C22 T29 | A43 G36 C21 T43 | A36 G31 C19 T36 |
| CDC0029 | MSSA476 | A33 G25 C22 T29 | A50 G28 C22 T29 | A42 G36 C22 T43 | A36 G31 C19 T36 |
| CDC0020 | ST: 15 | A33 G25 C22 T29 | A50 G28 C21 T30 | A42 G36 C22 T43 | A36 G31 C18 T37 |
| CDC0024 | ST: 137 | A33 G25 C22 T29 | A51 G28 C22 T28 | A42 G36 C22 T43 | A37 G30 C18 T37 |
| CDC0031 | *** | A34 G25 C25 T25 | A51 G27 C24 T27 | No product | No product |
Note: *** The sample CDC0031 was identified as Staphylococcus scleiferi as indicated in Example 14. Thus, the triangulation genotyping primers designed for Staphylococcus aureus would generally not be expected to prime and produce amplification products of this organism. Tables 22A and 22B indicate that amplification products are obtained for this organism only with primer pair numbers 2157 and 2161.
A total of thirteen different genotypes of Staphylococcus aureus were identified according to the unique combinations of base compositions across the eight different bioagent identifying amplicons obtained with the eight primer pairs. These results indicate that this eight primer pair panel is useful for analysis of unknown or newly emerging strains of Staphylococcus aureus. It is expected that a kit comprising one or more of the members of this panel will be a useful embodiment of the present invention.
Example 16 Selection and Use of Triangulation Genotyping Analysis Primer Pairs for Members of the Bacterial Genus VibrioTo combine the power of high-throughput mass spectrometric analysis of bioagent identifying amplicons with the sub-species characteristic resolving power provided by triangulation genotyping analysis, a panel of eight triangulation genotyping analysis primer pairs was selected. The primer pairs are designed to produce bioagent identifying amplicons within seven different housekeeping genes which are listed in Table 23. The primer sequences are found in Table 2 and are cross-referenced by the primer pair numbers, primer pair names or SEQ ID NOs listed in Table 23.
| TABLE 23 |
| Primer Pairs for Triangulation Genotyping Analysis of Members of the Bacterial Genus Vibrio |
| Forward | Reverse | ||||
| Primer | Primer | Primer | |||
| Pair | (SEQ | (SEQ | Target | ||
| No. | Forward Primer Name | ID NO:) | Reverse Primer Name | ID NO:) | Gene |
| 1098 | RNASEP_VBC_331_349_F | 325 | RNASEP_VBC_388_414_R | 1163 | RNAse P |
| 2000 | CTXB_NC002505_46_70_F | 278 | CTXB_NC002505_132_162_R | 1039 | ctxB |
| 2001 | FUR_NC002505_87_113_F | 465 | FUR_NC002505_205_228_R | 1037 | fur |
| 2011 | GYRB_NC002505_1161_1190_F | 148 | GYRB_NC002505_1255_1284_R | 1172 | gyrB |
| 2012 | OMPU_NC002505_85_110_F | 190 | OMPU_NC002505_154_180_R | 1254 | ompU |
| 2014 | OMPU_NC002505_431_455_F | 266 | OMPU_NC002505_544_567_R | 1094 | ompU |
| 2323 | CTXA_NC002505-1568114-1567341_122_149_F | 508 | CTXA_NC002505-1568114-1567341_186_214_R | 1297 | ctxA |
| 2927 | GAPA_NC002505_694_721_F | 259 | GAPA_NC_002505_29_58_R | 1060 | gapA |
A group of 50 bacterial isolates containing multiple strains of both environmental and clinical isolates of Vibrio cholerae, 9 other Vibrio species, and 3 species of Photobacteria were tested using this panel of primer pairs. Base compositions of amplification products obtained with these 8 primer pairs were used to distinguish amongst various species tested, including sub-species differentiation within Vibrio cholerae isolates. For instance, the non-O1/non-O139 isolates were clearly resolved from the O1 and the O139 isolates, as were several of the environmental isolates of Vibrio cholerae from the clinical isolates.
It is expected that a kit comprising one or more of the members of this panel will be a useful embodiment of the present invention.
Example 17 Selection and Use of Triangulation Genotyping Analysis Primer Pairs for Members of the Bacterial Genus PseudomonasTo combine the power of high-throughput mass spectrometric analysis of bioagent identifying amplicons with the sub-species characteristic resolving power provided by triangulation genotyping analysis, a panel of twelve triangulation genotyping analysis primer pairs was selected. The primer pairs are designed to produce bioagent identifying amplicons within seven different housekeeping genes which are listed in Table 24. The primer sequences are found in Table 2 and are cross-referenced by the primer pair numbers, primer pair names or SEQ ID NOs listed in Table 24.
| TABLE 24 |
| Primer Pairs for Triangulation Genotyping Analysis of Members of the Bacterial Genus Pseudomonas |
| Forward | Reverse | ||||
| Primer | Primer | ||||
| Primer Pair | (SEQ | (SEQ ID | Target | ||
| No. | Forward Primer Name | ID NO:) | Reverse Primer Name | NO:) | Gene |
| 2949 | ACS_NC002516-970624-971013_299_316_F | 376 | ACS_NC002516-970624-971013_364_383_R | 1265 | acsA |
| 2950 | ARO_NC002516-26883-27380_4_26_F | 267 | ARO_NC002516-26883-27380_111_128_R | 1341 | aroE |
| 2951 | ARO_NC002516-26883-27380_356_377_F | 705 | ARO_NC002516-26883-27380_459_484_R | 1056 | aroE |
| 2954 | GUA_NC002516-4226546-4226174_155_178_F | 710 | GUA_NC002516-4226546-4226174_265_287_R | 1259 | guaA |
| 2956 | GUA_NC002516-4226546-4226174_242_263_F | 374 | GUA_NC002516-4226546-4226174_355_371_R | 1111 | guaA |
| 2957 | MUT_NC002516-5551158-5550717_5_26_F | 545 | MUT_NC002516-5551158-5550717_99_116_R | 978 | mutL |
| 2959 | NUO_NC002516-2984589-2984954_8_26_F | 249 | NUO_NC002516-2984589-2984954_97_117_R | 1095 | nuoD |
| 2960 | NUO_NC002516-2984589-2984954_218_239_F | 195 | NUO_NC002516-2984589-2984954_301_326_R | 1376 | nuoD |
| 2961 | PPS_NC002516-1915014-1915383_44_63_F | 311 | PPS_NC002516-1915014-1915383_140_165_R | 1014 | pps |
| 2962 | PPS_NC002516-1915014-1915383_240_258_F | 365 | PPS_NC002516-1915014-1915383_341_360_R | 1052 | pps |
| 2963 | TRP_NC002516-671831-672273_24_42_F | 527 | TRP_NC002516-671831-672273_131_150_R | 1071 | trpE |
| 2964 | TRP_NC002516-671831-672273_261_282_F | 490 | TRP_NC002516-671831-672273_362_383_R | 1182 | trpE |
It is expected that a kit comprising one or more of the members of this panel will be a useful embodiment of the present invention.
The present invention includes any combination of the various species and subgeneric groupings falling within the generic disclosure. This invention therefore includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
While in accordance with the patent statutes, description of the various embodiments and examples have been provided, the scope of the invention is not to be limited thereto or thereby. Modifications and alterations of the present invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention.
Therefore, it will be appreciated that the scope of this invention is to be defined by the appended claims, rather than by the specific examples which have been presented by way of example.
Each reference (including, but not limited to, journal articles, U.S. and non-U.S. patents, patent application publications, international patent application publications, gene bank gi or accession numbers, internet web sites, and the like) cited in the present application is incorporated herein by reference in its entirety.
1. An oligonucleotide primer pair comprising a forward primer and a reverse primer, each comprising between 13 and 35 linked nucleotides in length, configured to generate an amplicon that is between 45 and 200 linked nucleotides in length, said forward primer configured to hybridize with at least 80% complementarity to a first portion of a region of Genbank gi number: 57634611, and said reverse primer configured to hybridize with at least 80% complementarity to a second portion of said region of Genbank gi number: 57634611, wherein said region of Genbank gi number: 57634611 begins with the 5′ end of SEQ ID NO.: 180, and extends to the 5′ end of SEQ ID NO.: 1321.
2. The oligonucleotide primer pair of claim 1, wherein said forward primer comprises at least 90% complementarity to said first portion of said region of Genbank gi number 57634611, and wherein said first portion is within a region beginning with the 5′ end of SEQ ID NO: 180 and extending to the 3′ end of SEQ ID NO.: 607.
3. The oligonucleotide primer pair of claim 2, wherein said forward primer comprises at least 95% complementarity to said first portion.
4. The oligonucleotide primer pair of claim 3, wherein said forward primer comprises 100% complementarity to said first portion.
5. The oligonucleotide primer pair of claim 1, wherein said reverse primer comprises at least 90% complementarity to said second portion of said region of Genbank gi number 57634611, and wherein said second portion is within a region beginning with the 3′ end of SEQ ID NO: 982 and extending to the 5′ end of SEQ ID NO.: 1321.
6. The oligonucleotide primer pair of claim 5, wherein said reverse primer comprises at least 95% complementarity to said second portion.
7. The oligonucleotide primer pair of claim 6, wherein said reverse primer comprises 100% complementarity to said second portion.
8. The oligonucleotide primer pair of claim 1, wherein said forward primer comprises at least 70% sequence identity with SEQ ID NO: 430.
9. The oligonucleotide primer pair of claim 1, wherein said forward primer is SEQ ID NO: 430.
10. The oligonucleotide primer pair of claim 1, wherein said reverse primer comprises at least 70% sequence identity with SEQ ID NO: 1321.
11. The oligonucleotide primer pair of claim 1, wherein said reverse primer is SEQ ID NO: 1321.
12. The oligonucleotide primer pair of claim 1, wherein at least one of said forward primer and said reverse primer comprises at least one modified nucleobase.
13. The oligonucleotide primer pair of claim 12, wherein at least one of said at least one modified nucleobase is a mass modified nucleobase.
14. The oligonucleotide primer pair of claim 13, wherein said mass modified nucleobase is 5-Iodo-C.
15. The composition of claim 13, wherein said mass modified nucleobase comprises a molecular mass modifying tag.
16. The oligonucleotide primer pair of claim 12, wherein at least one of said at least one modified nucleobase is a universal nucleobase.
17. The oligonucleotide primer pair of claim 16, wherein said universal nucleobase is inosine.
18. The oligonucleotide primer pair of claim 1, wherein at least one of said forward primer and said reverse primer comprises a non-templated T residue at its 5′ end.
19. A kit for identifying a Staphylococcus aureus bioagent comprising:
i) a first oligonucleotide primer pair comprising a forward primer and a reverse primer, each comprising between 13 and 35 linked nucleotides in length, configured to generate an amplicon that is between 45 and 200 linked nucleotides in length, said forward primer configured to hybridize with at least 80% complementarity to a first portion of a region of Genbank gi number: 57634611, and said reverse primer configured to hybridize with at least 80% complementarity to a second portion of said region of Genbank gi number: 57634611, wherein said region of Genbank gi number: 57634611 begins with the 5′ end of SEQ ID NO.: 180, and extends to the 5′ end of SEQ ID NO.: 1321; and
ii) at least one additional primer pair, wherein the primers of each of said at least one additional primer pair are designed to hybridize to conserved sequence regions within a Staphylococcus aureus gene selected from the group consisting of mecA, mecR1, ermA, ermC, pvluk, mupR, and nuc.
20. The kit of claim 19 wherein each of said at least one additional primer pair comprises SEQ ID NO: 217:SEQ ID NO: 1167, SEQ ID NO: 399:SEQ ID NO: 1041, SEQ ID NO: 456:SEQ ID NO: 1261, SEQ ID NO: 174:SEQ ID NO: 853, SEQ ID NO: 288:SEQ ID NO: 1269, SEQ ID NO: 698:SEQ ID NO: 1420, or SEQ ID NO: 205:SEQ ID NO: 876.
21. The kit of claim 19 wherein said first oligonucleotide primer pair and said at least one additional primer pair consists of eight oligonucleotide primer pairs having at least 70% sequence identity with the primer pairs: SEQ ID NO: 217:SEQ ID NO: 1167, SEQ ID NO: 399:SEQ ID NO: 1041, SEQ ID NO: 456:SEQ ID NO: 1261, SEQ ID NO: 430:SEQ ID NO: 1321, SEQ ID NO: 288:SEQ ID NO: 1269, SEQ ID NO: 698:SEQ ID NO: 1420, SEQ ID NO: 205:SEQ ID NO: 876, and SEQ ID NO: 174:SEQ ID NO: 853.
22. A method for identifying a Staphylococcus aureus bioagent in a sample comprising:
a) amplifying a nucleic acid from said sample using an oligonucleotide primer pair comprising a forward primer and a reverse primer, each comprising between 13 and 35 linked nucleotides in length, said forward primer configured to hybridize with at least 80% complementarity to a first portion of a region of Genbank gi number: 57634611, and said reverse primer configured to hybridize with at least 80% complementarity to a second portion of said region of Genbank gi number: 57634611, wherein said region of Genbank gi number: 57634611 begins with the 5′ end of SEQ ID NO.: 180, and extends to the 5′ end of SEQ ID NO.: 1321, wherein said amplifying generates at least one amplification product that comprises between 45 and 200 linked nucleotides; and
b) determining the molecular mass of said at least one amplification product by mass spectrometry.
23. The method of claim 22 further comprising comparing said determined molecular mass to a database comprising a plurality of molecular masses of bioagent identifying amplicons, wherein a match between said determined molecular mass and a molecular mass comprised in said database identifies said Staphylococcus aureus bioagent in said sample.
24. The method of claim 22 further comprising calculating a base composition of said at least one amplification product using said molecular mass.
25. The method of claim 24 further comprising comparing said calculated base composition to a database comprising a plurality of base compositions of bioagent identifying amplicons, wherein a match between said calculated base composition and a base composition comprised in said database identifies said Staphylococcus aureus bioagent in said sample.
26. The method of claim 22, wherein said forward primer comprises at least 70% sequence identity with SEQ ID NO: 430.
27. The method of claim 22, wherein said reverse primer comprises at least 70% sequence identity with SEQ ID NO: 1321.
28. The method of claim 22 further comprising repeating said amplifying and determining steps using at least one additional oligonucleotide primer pair wherein the primers of each of said at least one additional primer pair are designed to hybridize to conserved sequence regions within a Staphylococcus aureus gene selected from the group consisting of mecA, mecR1, ermA, ermC, pvluk, tufb, mupR, and nuc.
29. The method of claim 22, wherein said identifying comprises detecting the presence of said Staphylococcus aureus bioagent in said sample.
30. The method of claim 22, wherein said identifying comprises determining either the sensitivity or the resistance of said Staphylococcus aureus bioagent in said sample to one or more antibiotics.
31. The method of claim 22, wherein said identifying comprises identifying a sub-species characteristic, strain, or genotype of said Staphylococcus aureus bioagent in said sample.