US20080060098A1
2008-03-06
11/810,795
2007-06-07
The invention discloses maize bZIP transcriptional factors, namely, ABP2, ABP4 and ABP9, the genes encoding these factors, and the use thereof. The transcriptional factors are proteins having an amino acid sequence set forth in SEQ ID NO: 2, 4, or 6, or proteins derived therefrom by substitution, deletion or addition of one or more amino acid residues of SEQ ID NO: 2, 4, or 6, and having the same activity as a protein shown by SEQ ID NO: 2, 4, or 6. The ABP2, ABP4 and ABP9 genes encoding these factors, respectively, are the DNA sequences having an identity of more than 90% with a sequence shown by SEQ ID NO: 1, 3 or 5 and the encoded proteins having such same functions. These genes are important for breeding plant varieties with an enhanced tolerance to abiotic stresses and for improving plant tolerance to abiotic stresses.
Get notified when new applications in this technology area are published.
C07K14/415 » CPC main
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
A01H5/00 IPC
Products
A01H5/00 IPC
Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
C12N1/20 IPC
Microorganisms, e.g. protozoa; Compositions thereof ; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor Bacteria; Culture media therefor
C12N15/00 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
C12N15/11 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology DNA or RNA fragments; Modified forms thereof
C12N5/06 IPC
Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor Animal cells or tissues; Human cells or tissues
This application is a divisional application of U.S. Ser. No. 11/046,255 filed Jan. 28, 2005, which is a continuation of PCT/CN03/00599 filed Jul. 28, 2003, which in turn claims priority from Chinese Patent Application No. 02127187.9, filed on Jul. 30, 2002.
FIELD OF THE INVENTIONThe present invention relates to transcription factors, genes encoding the transcription factors, and the use of such transcription factors and genes in the field of plant genetic engineering. More especially, the invention relates to maize bZIP transcription factors, genes encoding maize bZIP transcription factors, the use of such bZIP transcription factors and genes.
BACKGROUND OF THE INVENTIONUpon exposure to abiotic stresses such as drought, high salinity, low temperature and etc., plant will not simply passively endure the stressful conditions. In stead, plant will actively cope with the environmental stresses through eliciting responses of its in-built defense system, including, e.g., biosynthesis of new proteins, changes in metabolism, accumulation of stress-tolerant chemicals, and so on (Hans J. Plant cell. 1995, 7: 1099-1111). Many proteins are involved in plant response to abiotic stresses (Ashwani Pareek. Current Science. 1999, 75: 1170-1174) and they act coordinatively to enhance tolerance by modulating biochemical, metabolic and physiological adaptions. Studies have shown that enhancing the expression of single effector protein genes was not able to significantly improve plant performance under stress conditions.
Under abiotic stress conditions, many proteins induced in plant are involved in tolerance to abiotic stresses. The genes encoding some of the proteins have been cloned (Anil Grover. Current Science. 1998, 75: 689-695). In efforts to increase plant tolerance to abiotic stresses, such as cold, drought and salt, many stress-related genes from various sources have been cloned and transformed into different plant species (Shavindra Bajaj. Molecular Breeding. 1999, 5:493-503). The proteins encoded by those cloned genes can be classified into three groups: 1) Enzymes involved in the synthesis of osmolyte. For example, the introduction of gene mtlD derived from E. coli into tobacco increased the content of mannitol in the crop. Transgenic tobacco or rice over-expressing P5CS gene elevated its content of proline. The introduction of codA gene into arabidopsis or rice increased the content of glycine betaine in transgenic plants (Sakamoto A. PMB. 1998, 38:1011-1019). 2) Late Embryogenesis Abundant (LEA) and related proteins. for example, constitutive expression of cor15a gene in arabidopsis discouraged the formation of freeze-induced harmful membrane structures (Steponkus P L. PNAS. 1998, 95:14570-14575). 3) Proteins related to oxidative stress. For example, over-expressing of Mn-SOD gene in alfalfa (Mckersic B D. Plant Physiol. 1996, 111:1177-1181) and of GST gene in tobacco increased tolerance to stresses. However, although the expression of single effector genes in transgenic plants can enhance an aspect of plant stress responses under experimental conditions, the overall performance of the transgenic plants under stresses was not largely improved. Recently, the gene encoding an tolerance-related transcription factor CBF1 (C-repeat Binding Factor) was over-expressed in arabidopsis and showed that CBF1 enhanced the expression of a series of cold-related effector genes. Moreover, Compared with the above described plants over-expressing single effector genes, the enhanced expression of CBF1 significantly improved the cold tolerance in transgenic arabidopsis plants (Kirsten R. Science. 1998, 280:104-106). Similarly, over expression of transcription factor DREB1A gene in arabidopsis induced multiple stress-related genes and largely increased plant tolerance to salt, cold and drought stresses (Mie Kasuga. Nature Biotechnology. 1999, 17: 287-291).
Studies show that plants produce a large amount of reactive oxygen species (ROS) under stress conditions such as drought, salinity and low temperature, leading to oxidative stress. (Zhu J K. Trends Plant Sci. 2001, 6:66-71). Because ROS are highly active, they can lead to serious damages to cells, for example, membrane peroxidation, inactivation of key enzymes, DNA lesions and etc. Therefore, the scavenging of excess ROS is critical for plants to increase tolerance to abiotic stresses. Catalase (e.g., CAT1) plays an important role in the scavenging of ROS. However, under stress conditions, the plant's ability for induction of its endogenous anti-oxidant system is poor, which limits the further increase of plant tolerance. Therefore, the cloning of genes encoding the transcription factors that regulate the expression of Cat1 will not only further our understanding on ROS signal tranduction pathway, but provide strategies for generating new crop varieties with enhanced tolerance to stresses such as drought, salt, cold and etc. This is because such trans-acting factor can regulate the expression of anti-oxidant genes including Cat1, as well as other stress-responsive genes.
ABRE is an ABA (abscisic acid) responsive element located in the promoter region of many stress responsive genes, which is characterized by (C/G/T)ACGTG(G/T)(A/C) (SEQ ID NO: 31) sequence (Chen W Q. Plant Cell. 2001, 14:559-574). The promoter region of Cat1 contains two ABRE-like DNA sequence, namely ABRE1 and ABRE2. Deletion analysis shows that ABRE2 (5′-GAAGTCCACGTGGAGGTGG) (SEQ ID NO: 7) is the cis-element necessary for the regulation of Cat1 by ABA. The expression of Cat1 increases along with the elevation of ABA content during maize embryogenesis, a process in which seeds accumulate nutrients and undergo deccicated as well as induction of tolerance to dehydration. Previous study showed that there existed trans-acting factors interacting with ABRE2 in cells during maize embryogenesis. The trans-acting factors can be classified into two groups, one is ABA-dependent (namely Cat1 promoter Binding Factor 1, CBF1), and the other is ABA-independent (namely Cat1 promoter Binding Factor 2, CBF2) (Lingqing M. Guan, The Plant Journal. 2000, 22(2): 87-95). These transcription factors have not been cloned up to now.
SUMMARY OF INVENTIONThe object of the present invention is to provide maize bZIP transcription factors and the encoding genes thereof.
The maize bZIP transcription factors provided by the invention are isolated from maize and named as ABRE Binding Proteins ABP2, ABP4 and ABP9, respectively. They are the proteins having the amino acid sequence shown by SEQ ID NO 2, 4 or 6 in the sequence listing, or the proteins derived from the sequence shown by SEQ ID NO 2, 4 or 6, by substitution, deletion or addition of one or more amino acid residues, and with the same activity to the proteins of the amino acid sequence shown by SEQ ID NO 2, 4 or 6.
ABP2 represents the protein having the amino acid sequence shown by SEQ ID NO 2 in the sequence listing and comprising 351 amino acid residues.
ABP4 represents the protein having the amino acid sequence shown by SEQ ID NO 4 in the sequence listing and comprising 360 amino acid residues.
ABP9 represents the protein having the amino acid residue sequence shown by SEQ ID NO 6 in the sequence listing and comprising 385 amino acid residues.
A BLAST analysis is performed by inputting the protein sequences of ABP2, ABP4 and ABP9 of the invention into GenBank. The result shows that ABP2, ABP4 and ABP9 belong to the family of bZIP transcription factors. Compared with the reported bZIP transcription factors, ABP2, ABP4 and ABP9 each has low homology in amino acid sequence with the known factors.
The invention constructs a cDNA library with maize embryos of 17 days post pollination (17 dpp), using Not I adapter: 5′-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15 (SEQ ID NO: 8)-3′ as a primer. And the capacity of the constructed cDNA library is 5.2×106 cfu.
The invention designs and synthesizes the following primers: Primers for reverse-transcription:
| (SEQ ID NO: 9) |
| ABP2 rv2: 5′-GCG ACA GCG ACG ACA GAT CA-3′ | ||
| (SEQ ID NO: 10) |
| ABP4 rv2: 5′-AGC GCC AGA AGC GGA GGC CA-3′ | ||
| (SEQ ID NO: 11) |
| ABP9 rv2: 5′-CCT TCA CCA GGA AGT CCT CCA-3′ |
Primers for PCR:
| (SEQ ID NO: 12) |
| AUAP fw: | 5′-GGC CAC GCG TCG ACT AGT AC-3′ | ||
| (SEQ ID NO: 13) |
| ABP2 rv3: | 5′-AGG AAC TCC TCC AGA GTC AT-3′ | ||
| (SEQ ID NO: 14) |
| ABP4 rv3: | 5′-TCG TCG AAC GTC AAC GAG TAG-3′ | ||
| (SEQ ID NO: 15) |
| ABP9 rv3: | 5′-AAC CAA TCC TCC GTT CTC ACC-3′ |
By using the methods of reverse transcriptase-polymerase chain reaction (RT-PCR) and RACE, the invention clones the genes encoding maize bZIP transcription factors from maize embryos. The genes ABP2, ABP4 and ABP9 which respectively encode maize bZIP transcription factors ABP2, ABP4 and ABP9 are the DNA sequences sharing at least 90% homology to the DNA sequences defined by SEQ ID NO: 1, 3 and 5 respectively in the sequence listing, and accordingly encoding proteins with the same functions. ABP2 gene represents the DNA sequence shown by SEQ ID NO:1 in the sequence listing, consisting of 1485 bp. The open reading frame of the gene is the DNA sequence from 114 to 1056 bases, beginning at the 5′ end. ABP4 gene represents the DNA sequence shown by SEQ ID NO:3 in the sequence listing, consisting of 1835 bp. The open reading frame of the gene is the DNA sequence from 93 to 1175 bases, beginning at the 5′ end. ABP9 gene is the DNA sequence shown by SEQ ID NO:5 in the sequence listing, consisting of 1510 bp. The open reading frame of the gene is the DNA sequence from 45 to 1202 bases, beginning at the 5′ end.
By constructing each of the cloned genes of ABP2, ABP4 and ABP9 into the yeast expression vector pPC86, the invention studies the in vivo binding specificity of proteins ABP2, ABP4 and ABP9 with ABRE. The result shows that the products of the genes ABP2, ABP4, and ABP9 all have ABRE-binding specificity in yeast cells. By constructing each of the cloned genes of ABP2, ABP4 and ABP9 into the prokaryote expression vector pGEX4T-1, the invention studies the in vitro binding specificity of ABP2, ABP4 and ABP9 with ABRE. The result shows that the products of the genes ABP2, ABP4 and ABP9 all have ABRE-binding specificity in vitro and can specifically bind to the ABRE cis-element that contains core sequence of (C/G/T) ACGTG (G/T) (A/C).
By constructing the cloned genes of ABP2, ABP4 and ABP9 respectively into the yeast expression vector YepGAP and plant expression vector pBI121, the invention studies the in vivo binding specificity of ABP2, ABP4 and ABP9 to ABRE and the transcriptional activation function thereof in yeast and maize cells. The result shows that each of the products of the genes ABP2, ABP4, and ABP9 has ABRE-binding specificity in yeast cells and suspended maize cells. The result also shows that the products of those genes have the function of transcriptional activation. Thus, the products of the genes ABP2, ABP4, and ABP9 are transcription factors that have the ABRE binding specificity and the transcriptional activation function. In addition, the genes ABP2, ABP4, and ABP9 can be expressed through the induction of stress conditions such as salt, drought, hydrogen peroxide, ABA and etc.
The genes ABP2, ABP4, and ABP9 are respectively constructed into plant transformation vectors pBI121 and pZP212. The resulted recombinant plasmids pZP212-ABP2, pZP212-ABP4 and pBI121-ABP9 were then respectively transformed into Agrobacterium and transgenic Arabidopsis plants were obtained by plant transformation using the resultant Agrobacterium recombinants. Survival analysis of the transgenic plants under different stress conditions shows that ABP2, ABP4 and ABP9 each can improve plant tolerance to abiotic stresses, for example, cold, salt and drought. The expression vectors and cell lines containing the inventive genes ABP2, ABP4, and ABP9, as well as the plant varieties harboring inventive genes with improved tolerance to abiotic stresses will also be in the scope of the invention.
The present invention successfully isolated and cloned from maize the genes ABP2, ABP4, and ABP9 encoding the transcription factors having ABRE binding specificity. This work will not only help to understand the ROS signal transduction pathway, but also provide strategies for generation of crop varieties with improved tolerance to stresses, such as drought, salinity and cold. The transcription factors expressed by the inventive genes can interact with the ABRE cis-element in the promoter region of multiple genes related to tolerance to abiotic stresses, and regulate the expression of the stress-related genes, and improve plant tolerance to abiotic stresses.
Further areas of applicability of the present invention will become apparent from the detailed description provided hereinafter. It should be understood that the detailed description and specific examples, while indicating the preferred embodiment of the invention, are intended for purposes of illustration only and are not intended to limit the scope of the invention.
BRIEF DESCRIPTION OF THE DRAWINGSThe file of this patent contains at least one drawing executed in color. Copies of this patent with color drawing(s) will be provided by the Patent and Trademark Office upon request of the necessary fee.
The present invention will become more fully understood from the detailed description and the accompanying drawings, wherein:
FIG. 1 shows the growth of yeast, showing the in vivo binding specificity of ABP2, ABP4 and ABP9 with ABRE;
FIG. 2 illustrates the result of non-denature polyacrylamide gel electrophoresis, showing the in vitro binding specificity of ABP2, ABP4 and ABP9 to ABRE;
FIG. 3 illustrates the growth of yeast, showing the in vivo ABRE binding specificity and the transcriptional activation function of ABP2, ABP4 and ABP9 in yeast;
FIG. 4 shows the transformed maize suspension cells, showing the ABRE binding specificity and transcriptional activation function of ABP2, ABP4 and ABP9 in maize cells;
FIG. 5 demonstrates the electrophoresis pattern of PCR, showing the induction of ABP2, ABP4 and ABP9 under stress conditions, i.e., salt, drought, hydrogen peroxide, ABA, low temperature. The conditions for PCR were 94° C. 2 min, 94° C. 30 sec, 72° C. 50 sec for 30 cycles and 72° C. 5 min. The electrophoresis result shows the expression of the genes ABP2, ABP4, and ABP9 can be induced by salt (FIGS. 5A, B and C), drought (FIGS. 5J and K), ABA (L, M and N), hydrogen peroxide (F and G). In FIG. 5, A stands for CK1, B for 1% Nacl, C for 0.8% NaCl, D for 0.6% NaCl, E for 150 mM H2O2, F for 60 mM H2O2, G for 10 mM H2O2, H for H2O, I for 13% H2O, J for 10% H2O, K for 8% H2O, L for 10−6M ABA, M for 10−5M ABA, N for 10−4M ABA, 0 for 4° C. and P for CK2;
FIG. 6 is a construction diagram of plant expression vectors of ABP2, ABP4 or ABP9, showing the physical map of the expression vectors;
FIG. 7 shows the survival test of ABP2, ABP4 and ABP9 transgenic Arabidopsis under salt stress, as compared to non-transgenic Arabidopsis (“comparison”);
FIG. 8 shows the survival test of ABP2, ABP4 and ABP9 transgenic Arabidopsis under freezing temperature, as compared to non-transgenic Arabidopsis (“comparison”); and
FIG. 9 shows the survival test of ABP2, ABP4 and ABP9 transgenic Arabidopsis under drought stress.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Example 1 Cloning and screening the genes encoding maize bZIP transcription factorsMaterials and Methods
1) Maize material: immature embryos of 17 days post pollination (17 dpp) from maize variety Qi 319.
2) Strains: E. coli DH5α, DH10B and JM109, and yeast strains yWAM2 (Leu−, His−, Trp−).
3) Vectors: pBSK+, pRS315 and pPC86.
4) Restriction enzymes and modifying enzymes: restriction endonuclease and modifying enzyme are purchased from Promega Corp., New England Biolab, Inc. and Gibco Corporation.
5) Chemical reagents: the reagents for yeast culture are purchased from Sigma Chemical Company Ltd. and Oxford Corporation; the other chemical reagents are made in China (analytical pure).
6) Kits: Wizard™ Minipreps DNA Purification System and Wizard™ Maxipreps DNA Purification System available from Promega Corp. are used to extract plasmid DNA; DNA fragment quick purification/retrieve kit available from Ding Guo Biotechnology Ltd. is used to retrieve DNA; RNAgents Total RNA Isolation System kit and PolyATtract mRNA Isolation System available form Promega Corp. are used to extract RNA; and SuperScript™ Plasmid System for cDNA Synthesis and Plasmid Cloning kit available from GibcoBRL Company are used to construct the library.
7) Synthesis of primers: performed by Beijing Sai Bai Sheng Bioengineering Company and Shanghai Bioasia Biotechnology Co., Ltd.
8) Sequencing: performed by Shanghai Bioasia Biotechnology Co., Ltd.
Procedure of the Experiments
1) Total RNA Extraction and mRNA Isolation:
2) Construction of cDNA library with mRNA from maize 17dpp embryos.
Not I adapter:
| (SEQ ID NO: 8) |
| 5′-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15-3′. |
Sal I adapter was added and ligated to the double-strand cDNA synthesized:
| 5′-TCGACCCACGCGTCCG-3′; | (SEQ ID NO: 16) | ||
| 3′-GGGTGCGCAGGCp-5′. | (SEQ ID no: 17) |
3) Amplification of the cDNA library:
4) Construction of bait vector harboring 4mer ABRE and specificity-testing vector containing 4mer mutant ABRE (mABRE):
Synthesize the primers: mABRE(+):
5) Screening the 17dpp cDNA library:
6) Acquirement of the full-length cDNA sequences of ABP2, ABP4 and ABP9:
The primers for reverse transcription:
| (SEQ ID NO: 9) |
| ABP2 rv2: 5′-GCGACAGCGACGACAGATCA-3′ | ||
| (SEQ ID NO: 10) |
| ABP4 rv2: 5′-AGCGCCAGAAGCGGAGGCCA-3′ | ||
| (SEQ ID NO: 11) |
| ABP9 rv2: 5′-CCTTCACCAGGAAGTCCTCCA-3′ |
The primers for PCR:
| (SEQ ID NO: 12) |
| AUAP fw: | 5′-GGCCACGCGTCGACTAGTAC-3′ | ||
| (SEQ ID NO: 13) |
| ABP2 rv3: | 5′-AGGAACTCCTCCAGAGTCAT-3′ | ||
| (SEQ ID NO: 14) |
| ABP4 rv3: | 5′-TCGTCGAACGTCAACGAGTAG-3′ | ||
| (SEQ ID NO: 15) |
| ABP9 rv3: | 5′-AACCAATCCTCCGTTCTCACC-3′ |
In vivo ABRE-binding specificity analysis of ABP2, ABP4 and ABP9 Transform plasmids pRSA4(Leu+) and pRSmA4(Leu+) respectively into yWAM2 yeast and obtain yA4 and ymA4 yeast strains. Transform yA4 and ymA4 yeast with each of the ABP2, ABP4 and ABP9 plasmids obtained through screening the library. Incubate on His− selective medium for 3-5 days at 28° C. Only yA4 yeast transformed with ABP2, ABP4 or ABP9 plasmid can grow while, ymA4 yeast transformed with ABP2, ABP4 or ABP9 plasmid cannot grow. The result means that ABP2, ABP4 or ABP9 is able to specifically bind to ABRE element in yeast and activate the expression of the reporter gene HIS3, thereby having the ability of growing in His− selective medium (FIG. 1B). In contrast, because ABP2, ABP4 or ABP9 cannot bind to mABRE and thereby cannot activate the expression of the reporter gene HIS3 that makes yeast not to grow on His− selective medium (FIG. 1A). Therefore, ABP2, ABP4 and ABP9 have the in vivo ABRE-binding specificity in yeast cells.
Example 3 Analysis of In Vitro ABRE-Binding Specificity of ABP2, ABP4 and ABP9 (EMSA Test)1) Purification of proteins ABP2, ABP4 and ABP9:
Clone the full-length genes ABP2, ABP4 or ABP9 into prokaryote expression vector pGEX4T-1 and then transform into strain BL21. Induce the expression with 0.3 mM IPTG at 37° C. for 2-3 hours. SDS-PAGE electrophoresis shows the specific expression bands of ABP2, ABP4 and ABP9. The purification of proteins ABP2, ABP4 and ABP9 is performed as MicroSpin™ GST Purification ModuLe protocol available from Pharmacia Corporation. The purified proteins are used for the EMSA test.
2) Isotope labeling of ABRE and mABRE:
Use DNA 5′ End-Labeling System of Promega Corp to label probes. The reaction system is: 1 μl of ABRE (or mABRE), 5 μl of T4 PNK 10× buffer, 3 μl of γ-32P-ATP, 2 μl of T4 PNK (10 U/μl), and 39 μl of H2O. React at 37° C. for 20 minutes. Add 2 μl of 0.5M EDTA and stop the reaction at 68° C. for 10, minutes. Then keep at 37° C. for 10 minutes. Store at 4° C. for use.
Binding Reaction of Proteins ABP2, ABP4, and ABP9 with DNA:
Add 4 μl of 5× binding buffer (125 ml HEPES-KOH pH7.6, 50% glycerol, 250 mM KCl). Add 4 μg (9 μl) of each of the proteins ABP2, ABP4, ABP9 and GST. Add 1 μl of 1M DTT, 1 μl of probe of the above-labeled ABRE (or N-ABRE) and 4 μl of H2O. Incubate on ice for 30 minutes. Add 3 μl of sample buffer (0.025% bromophenol blue in sterile H2O) and perform polyacrylamide gel electrophoresis analysis.
4) Non-denature polyacrylamide gel electrophoresis:
1) Transcription Activation Test in Yeast Cells
2) Test of transcription activation function in maize cells
Construction of reporter plasmid: pIG46 vector is digested with Xho I and filled in with T4 DNA polymerase. Digest 4mer ABRE in vector pBluescript II SK+ with Sma I and Ecl136 II. Retrieve the DNA fragment of the size of about 80 bp used to ligate with the vector. Transform E. coli DH5α and extract the plasmid. Identify through enzyme digestion. The sequencing result shows that ABRE has been ligated upstream of 35S mini promoter.
Construction of effector plasmids of ABP2, ABP4 and ABP9: The full-length cDNA of the genes ABP2, ABP4 and ABP9 (Xba I, Xho I) is constructed into plant expression vector pBI221 and obtain plasmids pBI221-ABP2, ABP4 and ABP9. Co-transform the reporter plasmid and effector plasmid into maize cells by bombardment. The materials for transformation are the maize suspension cells and the transformation method may refer to The Practical Methods of Molecular Biology and Biotechnology in Plant edited by B. R. Greenter and J. E. Tompson. The result shows that the reporter gene is not expressed when solely transformed with reporter plasmid (FIG. 4A) while it is significantly expressed when co-transformed with pIG46 and pBI221-ABP2, ABP4 or ABP9 (FIGS. 4B, C and D). Therefore, the proteins ABP2, ABP4 and ABP9 not only have the ABRE binding specificity in maize cells, but also have the transcription activation function.
Example 5 Analysis of the Expression Specificity of ABP2, ABP4 and ABP9 Under Abiotic Stresses1) Treatment of maize materials: take maize seed and imbibe water for 24 hours. After planting in pot, grow at 28° C. with 12 hours photoperiod for about 20 days. Treat the plants at the development stage of three leaves with different conditions.
2) Extract of RNA and removal of DNA:
3) RT-PCR:
4) PCR amplification of the genes ABP2, ABP4, and ABP9:
i. ABP2: Design the primers for PCR amplification as follows (to amplify the fragment of 548 bp):
| FW1 | 5′-TGATCTGTCGTCGCTGTCGC-3′ | (SEQ ID NO: 24) | |
| RV | 5′-ACTCCAGGTTACTTGCATTAT-3′ | (SEQ ID NO: 25) |
ii. ABP4: Design the primers for PCR amplification as follows (to amplify the fragment of 632 bp):
| W1R 5′-TCGGTTATTCCCAATACACA-3′ | (SEQ ID NO: 26) | |
| W2F 5′-AGCAGCGGTGAACCAGCTTG-3′ | (SEQ ID NO: 27) |
iii. ABP9: Design the primers for PCR amplification as follows (to amplify the fragment of 937 bp):
| FW1 | 5′-CATGACGCTGGAGGACTTCCT-3′ | (SEQ ID NO: 28) | |
| RV | 5′-TTGACGAAAACACAGAGC-3′ | (SEQ ID NO: 29) |
1) Transformation of arabidopsis with the genes ABP2, ABP4 and ABP9:
The cultivation of Agrobacterium
2) Extraction of genomic DNA from antibiotics-resistant arabidopsis plants:
3) PCR assay of transgenic arabidopsis:
| forward primer:35S promoter: |
| (SEQ ID NO: 30) |
| 5′-TCTGCCGACAGTGGTCCCAA-3′ | ||
| reverse primer:ABP2 |
| (SEQ ID NO: 13) |
| rv3: | 5′-AGG AAC TCC TCG AGA GTC AT-3′ | ||
| (SEQ ID NO: 14) |
| ABP4 rv3: | 5′-TCG TCG AAC GTC AAC GAG TAG-3′ | ||
| (SEQ ID NO: 15) |
| ABP9 rv3: | 5′-AAC CAA TCC TCC GTT CTC ACC-3′ |
1) cold tolerance: place the transgenic plants and the non-trangenic plants at −6° C. for 6 hours. Then transfer into the normal growth conditions for recovery cultivation. The result shows that the survival rate of the transgenic plant is 80% while that of the non-transgenic plant is 10%. Therefore, ABP2, ABP4, and ABP9 are able to improve the cold tolerance of plants as shown in FIG. 7.
2) salt tolerance: place the transgenic plants and the non-transgenic plants in 600 mM NaCl solution and immerse for 3 hours. Grow at 22° C. for 24 hours, under light. Transfer into the normal growth conditions for arabidopsis for recovery cultivation. The result shows that the survival rate of the transgenic plant is 80% while that of the non-transgenic plant is 15%. Therefore, ABP2, ABP4, and ABP9 are able to improve the salt tolerance of plants as shown in FIG. 8.
3) drought tolerance: place the transgenic plants and the non-transgenic plants under the normal growth conditions for arabidopsis. Continuously cultivate for 15-20 days without supplying water. The result shows that the survival rate of the transgenic plant is 90% while that of the non-transgenic plant is 5%. Therefore, ABP2, ABP4 and ABP9 are able to significantly improve the drought tolerance of plants as shown in FIG. 9, wherein the capital letter A stands for transgenic plant, B for non-transgenic plant.
APPLICATION IN INDUSTRY AND AGRICULTUREThe invention has successfully cloned the genes encoding maize bZIP transcription factors ABP2, ABP4, and ABP9, respectively. Furthermore, the invention has successfully introduced the genes into arabidopsis and obtains novel arabidopsis with enhanced tolerance to abiotic stresses. The work will have important theoretic and practical significance to breed new plant varieties with improved tolerance to abiotic stresses.
1. An isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO:1 or a nucleotide sequence encoding a protein which comprises the amino acid sequence of SEQ ID NO:2 representing maize bZIP transcriptional factor ABP4.
2. An expression vector comprising the isolated nucleic acid according to claim 1.
3. The expression vector according to claim 2 wherein said expression vector is pZP212-ABP2.
4. A cell line transformed with the isolated nucleic acid according to claim 1.
5. A chimeric plant expression vector, said vector comprising in the 5′ to 3′ direction:
a heterologous promoter that is capable of effecting mRNA transcription in a selected plant cell to be transformed, operably linked to
a structural DNA sequence encoding SEQ ID NO:2 that induces abiotic stress tolerance and operably linked to
a non-translated region of a gene, said region comprises a signal sequence for polyadenylation of mRNA.
6. A vector capable of introducing at least one regulatory gene encoding a protein into a plant, the vector comprising:
(a) the nucleotide sequence of SEQ ID NO: 1 or
(b) a nucleotide sequence encoding a protein comprising the amino acid sequence of SEQ ID NO:2 and a promoter operably linked to the nucleotide sequence of (a) or (b).
7. The vector according to claim 6, further comprising a transcription terminator sequence operably linked to the nucleotide sequence of (a) or (b).
8. The vector according to claim 6, further comprising a nucleotide sequence encoding a selective marker.
9. An Agrobacterium tumefaciens transformed with the vector according to claim 6.
10. A plant material endued with abiotic stress tolerance by being transformed with an Agrobacterium tumefaciens according to claim 9, wherein said abiotic stress tolerance is selected from the group consisting of drought tolerance, cold tolerance and Salinity tolerance.
11. A plant material transformed with a nucleic acid molecule which encodes a protein comprising the sequences, as set forth in SEQ ID NO: 2.