Patent application title:

Maize bZIP transcription factors and genes encoding the same and use thereof

Publication number:

US20080060098A1

Publication date:
Application number:

11/810,795

Filed date:

2007-06-07

Abstract:

The invention discloses maize bZIP transcriptional factors, namely, ABP2, ABP4 and ABP9, the genes encoding these factors, and the use thereof. The transcriptional factors are proteins having an amino acid sequence set forth in SEQ ID NO: 2, 4, or 6, or proteins derived therefrom by substitution, deletion or addition of one or more amino acid residues of SEQ ID NO: 2, 4, or 6, and having the same activity as a protein shown by SEQ ID NO: 2, 4, or 6. The ABP2, ABP4 and ABP9 genes encoding these factors, respectively, are the DNA sequences having an identity of more than 90% with a sequence shown by SEQ ID NO: 1, 3 or 5 and the encoded proteins having such same functions. These genes are important for breeding plant varieties with an enhanced tolerance to abiotic stresses and for improving plant tolerance to abiotic stresses.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C07K14/415 »  CPC main

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants

A01H5/00 IPC

Products

A01H5/00 IPC

Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy

C12N1/20 IPC

Microorganisms, e.g. protozoa; Compositions thereof ; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor Bacteria; Culture media therefor

C12N15/00 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor

C12N15/11 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology DNA or RNA fragments; Modified forms thereof

C12N5/06 IPC

Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor Animal cells or tissues; Human cells or tissues

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a divisional application of U.S. Ser. No. 11/046,255 filed Jan. 28, 2005, which is a continuation of PCT/CN03/00599 filed Jul. 28, 2003, which in turn claims priority from Chinese Patent Application No. 02127187.9, filed on Jul. 30, 2002.

FIELD OF THE INVENTION

The present invention relates to transcription factors, genes encoding the transcription factors, and the use of such transcription factors and genes in the field of plant genetic engineering. More especially, the invention relates to maize bZIP transcription factors, genes encoding maize bZIP transcription factors, the use of such bZIP transcription factors and genes.

BACKGROUND OF THE INVENTION

Upon exposure to abiotic stresses such as drought, high salinity, low temperature and etc., plant will not simply passively endure the stressful conditions. In stead, plant will actively cope with the environmental stresses through eliciting responses of its in-built defense system, including, e.g., biosynthesis of new proteins, changes in metabolism, accumulation of stress-tolerant chemicals, and so on (Hans J. Plant cell. 1995, 7: 1099-1111). Many proteins are involved in plant response to abiotic stresses (Ashwani Pareek. Current Science. 1999, 75: 1170-1174) and they act coordinatively to enhance tolerance by modulating biochemical, metabolic and physiological adaptions. Studies have shown that enhancing the expression of single effector protein genes was not able to significantly improve plant performance under stress conditions.

Under abiotic stress conditions, many proteins induced in plant are involved in tolerance to abiotic stresses. The genes encoding some of the proteins have been cloned (Anil Grover. Current Science. 1998, 75: 689-695). In efforts to increase plant tolerance to abiotic stresses, such as cold, drought and salt, many stress-related genes from various sources have been cloned and transformed into different plant species (Shavindra Bajaj. Molecular Breeding. 1999, 5:493-503). The proteins encoded by those cloned genes can be classified into three groups: 1) Enzymes involved in the synthesis of osmolyte. For example, the introduction of gene mtlD derived from E. coli into tobacco increased the content of mannitol in the crop. Transgenic tobacco or rice over-expressing P5CS gene elevated its content of proline. The introduction of codA gene into arabidopsis or rice increased the content of glycine betaine in transgenic plants (Sakamoto A. PMB. 1998, 38:1011-1019). 2) Late Embryogenesis Abundant (LEA) and related proteins. for example, constitutive expression of cor15a gene in arabidopsis discouraged the formation of freeze-induced harmful membrane structures (Steponkus P L. PNAS. 1998, 95:14570-14575). 3) Proteins related to oxidative stress. For example, over-expressing of Mn-SOD gene in alfalfa (Mckersic B D. Plant Physiol. 1996, 111:1177-1181) and of GST gene in tobacco increased tolerance to stresses. However, although the expression of single effector genes in transgenic plants can enhance an aspect of plant stress responses under experimental conditions, the overall performance of the transgenic plants under stresses was not largely improved. Recently, the gene encoding an tolerance-related transcription factor CBF1 (C-repeat Binding Factor) was over-expressed in arabidopsis and showed that CBF1 enhanced the expression of a series of cold-related effector genes. Moreover, Compared with the above described plants over-expressing single effector genes, the enhanced expression of CBF1 significantly improved the cold tolerance in transgenic arabidopsis plants (Kirsten R. Science. 1998, 280:104-106). Similarly, over expression of transcription factor DREB1A gene in arabidopsis induced multiple stress-related genes and largely increased plant tolerance to salt, cold and drought stresses (Mie Kasuga. Nature Biotechnology. 1999, 17: 287-291).

Studies show that plants produce a large amount of reactive oxygen species (ROS) under stress conditions such as drought, salinity and low temperature, leading to oxidative stress. (Zhu J K. Trends Plant Sci. 2001, 6:66-71). Because ROS are highly active, they can lead to serious damages to cells, for example, membrane peroxidation, inactivation of key enzymes, DNA lesions and etc. Therefore, the scavenging of excess ROS is critical for plants to increase tolerance to abiotic stresses. Catalase (e.g., CAT1) plays an important role in the scavenging of ROS. However, under stress conditions, the plant's ability for induction of its endogenous anti-oxidant system is poor, which limits the further increase of plant tolerance. Therefore, the cloning of genes encoding the transcription factors that regulate the expression of Cat1 will not only further our understanding on ROS signal tranduction pathway, but provide strategies for generating new crop varieties with enhanced tolerance to stresses such as drought, salt, cold and etc. This is because such trans-acting factor can regulate the expression of anti-oxidant genes including Cat1, as well as other stress-responsive genes.

ABRE is an ABA (abscisic acid) responsive element located in the promoter region of many stress responsive genes, which is characterized by (C/G/T)ACGTG(G/T)(A/C) (SEQ ID NO: 31) sequence (Chen W Q. Plant Cell. 2001, 14:559-574). The promoter region of Cat1 contains two ABRE-like DNA sequence, namely ABRE1 and ABRE2. Deletion analysis shows that ABRE2 (5′-GAAGTCCACGTGGAGGTGG) (SEQ ID NO: 7) is the cis-element necessary for the regulation of Cat1 by ABA. The expression of Cat1 increases along with the elevation of ABA content during maize embryogenesis, a process in which seeds accumulate nutrients and undergo deccicated as well as induction of tolerance to dehydration. Previous study showed that there existed trans-acting factors interacting with ABRE2 in cells during maize embryogenesis. The trans-acting factors can be classified into two groups, one is ABA-dependent (namely Cat1 promoter Binding Factor 1, CBF1), and the other is ABA-independent (namely Cat1 promoter Binding Factor 2, CBF2) (Lingqing M. Guan, The Plant Journal. 2000, 22(2): 87-95). These transcription factors have not been cloned up to now.

SUMMARY OF INVENTION

The object of the present invention is to provide maize bZIP transcription factors and the encoding genes thereof.

The maize bZIP transcription factors provided by the invention are isolated from maize and named as ABRE Binding Proteins ABP2, ABP4 and ABP9, respectively. They are the proteins having the amino acid sequence shown by SEQ ID NO 2, 4 or 6 in the sequence listing, or the proteins derived from the sequence shown by SEQ ID NO 2, 4 or 6, by substitution, deletion or addition of one or more amino acid residues, and with the same activity to the proteins of the amino acid sequence shown by SEQ ID NO 2, 4 or 6.

ABP2 represents the protein having the amino acid sequence shown by SEQ ID NO 2 in the sequence listing and comprising 351 amino acid residues.

ABP4 represents the protein having the amino acid sequence shown by SEQ ID NO 4 in the sequence listing and comprising 360 amino acid residues.

ABP9 represents the protein having the amino acid residue sequence shown by SEQ ID NO 6 in the sequence listing and comprising 385 amino acid residues.

A BLAST analysis is performed by inputting the protein sequences of ABP2, ABP4 and ABP9 of the invention into GenBank. The result shows that ABP2, ABP4 and ABP9 belong to the family of bZIP transcription factors. Compared with the reported bZIP transcription factors, ABP2, ABP4 and ABP9 each has low homology in amino acid sequence with the known factors.

The invention constructs a cDNA library with maize embryos of 17 days post pollination (17 dpp), using Not I adapter: 5′-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15 (SEQ ID NO: 8)-3′ as a primer. And the capacity of the constructed cDNA library is 5.2×106 cfu.

The invention designs and synthesizes the following primers: Primers for reverse-transcription:

(SEQ ID NO: 9)
ABP2 rv2: 5′-GCG ACA GCG ACG ACA GAT CA-3′
(SEQ ID NO: 10)
ABP4 rv2: 5′-AGC GCC AGA AGC GGA GGC CA-3′
(SEQ ID NO: 11)
ABP9 rv2: 5′-CCT TCA CCA GGA AGT CCT CCA-3′

Primers for PCR:

(SEQ ID NO: 12)
AUAP fw: 5′-GGC CAC GCG TCG ACT AGT AC-3′
(SEQ ID NO: 13)
ABP2 rv3: 5′-AGG AAC TCC TCC AGA GTC AT-3′
(SEQ ID NO: 14)
ABP4 rv3: 5′-TCG TCG AAC GTC AAC GAG TAG-3′
(SEQ ID NO: 15)
ABP9 rv3: 5′-AAC CAA TCC TCC GTT CTC ACC-3′

By using the methods of reverse transcriptase-polymerase chain reaction (RT-PCR) and RACE, the invention clones the genes encoding maize bZIP transcription factors from maize embryos. The genes ABP2, ABP4 and ABP9 which respectively encode maize bZIP transcription factors ABP2, ABP4 and ABP9 are the DNA sequences sharing at least 90% homology to the DNA sequences defined by SEQ ID NO: 1, 3 and 5 respectively in the sequence listing, and accordingly encoding proteins with the same functions. ABP2 gene represents the DNA sequence shown by SEQ ID NO:1 in the sequence listing, consisting of 1485 bp. The open reading frame of the gene is the DNA sequence from 114 to 1056 bases, beginning at the 5′ end. ABP4 gene represents the DNA sequence shown by SEQ ID NO:3 in the sequence listing, consisting of 1835 bp. The open reading frame of the gene is the DNA sequence from 93 to 1175 bases, beginning at the 5′ end. ABP9 gene is the DNA sequence shown by SEQ ID NO:5 in the sequence listing, consisting of 1510 bp. The open reading frame of the gene is the DNA sequence from 45 to 1202 bases, beginning at the 5′ end.

By constructing each of the cloned genes of ABP2, ABP4 and ABP9 into the yeast expression vector pPC86, the invention studies the in vivo binding specificity of proteins ABP2, ABP4 and ABP9 with ABRE. The result shows that the products of the genes ABP2, ABP4, and ABP9 all have ABRE-binding specificity in yeast cells. By constructing each of the cloned genes of ABP2, ABP4 and ABP9 into the prokaryote expression vector pGEX4T-1, the invention studies the in vitro binding specificity of ABP2, ABP4 and ABP9 with ABRE. The result shows that the products of the genes ABP2, ABP4 and ABP9 all have ABRE-binding specificity in vitro and can specifically bind to the ABRE cis-element that contains core sequence of (C/G/T) ACGTG (G/T) (A/C).

By constructing the cloned genes of ABP2, ABP4 and ABP9 respectively into the yeast expression vector YepGAP and plant expression vector pBI121, the invention studies the in vivo binding specificity of ABP2, ABP4 and ABP9 to ABRE and the transcriptional activation function thereof in yeast and maize cells. The result shows that each of the products of the genes ABP2, ABP4, and ABP9 has ABRE-binding specificity in yeast cells and suspended maize cells. The result also shows that the products of those genes have the function of transcriptional activation. Thus, the products of the genes ABP2, ABP4, and ABP9 are transcription factors that have the ABRE binding specificity and the transcriptional activation function. In addition, the genes ABP2, ABP4, and ABP9 can be expressed through the induction of stress conditions such as salt, drought, hydrogen peroxide, ABA and etc.

The genes ABP2, ABP4, and ABP9 are respectively constructed into plant transformation vectors pBI121 and pZP212. The resulted recombinant plasmids pZP212-ABP2, pZP212-ABP4 and pBI121-ABP9 were then respectively transformed into Agrobacterium and transgenic Arabidopsis plants were obtained by plant transformation using the resultant Agrobacterium recombinants. Survival analysis of the transgenic plants under different stress conditions shows that ABP2, ABP4 and ABP9 each can improve plant tolerance to abiotic stresses, for example, cold, salt and drought. The expression vectors and cell lines containing the inventive genes ABP2, ABP4, and ABP9, as well as the plant varieties harboring inventive genes with improved tolerance to abiotic stresses will also be in the scope of the invention.

The present invention successfully isolated and cloned from maize the genes ABP2, ABP4, and ABP9 encoding the transcription factors having ABRE binding specificity. This work will not only help to understand the ROS signal transduction pathway, but also provide strategies for generation of crop varieties with improved tolerance to stresses, such as drought, salinity and cold. The transcription factors expressed by the inventive genes can interact with the ABRE cis-element in the promoter region of multiple genes related to tolerance to abiotic stresses, and regulate the expression of the stress-related genes, and improve plant tolerance to abiotic stresses.

Further areas of applicability of the present invention will become apparent from the detailed description provided hereinafter. It should be understood that the detailed description and specific examples, while indicating the preferred embodiment of the invention, are intended for purposes of illustration only and are not intended to limit the scope of the invention.

BRIEF DESCRIPTION OF THE DRAWINGS

The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawing(s) will be provided by the Patent and Trademark Office upon request of the necessary fee.

The present invention will become more fully understood from the detailed description and the accompanying drawings, wherein:

FIG. 1 shows the growth of yeast, showing the in vivo binding specificity of ABP2, ABP4 and ABP9 with ABRE;

FIG. 2 illustrates the result of non-denature polyacrylamide gel electrophoresis, showing the in vitro binding specificity of ABP2, ABP4 and ABP9 to ABRE;

FIG. 3 illustrates the growth of yeast, showing the in vivo ABRE binding specificity and the transcriptional activation function of ABP2, ABP4 and ABP9 in yeast;

FIG. 4 shows the transformed maize suspension cells, showing the ABRE binding specificity and transcriptional activation function of ABP2, ABP4 and ABP9 in maize cells;

FIG. 5 demonstrates the electrophoresis pattern of PCR, showing the induction of ABP2, ABP4 and ABP9 under stress conditions, i.e., salt, drought, hydrogen peroxide, ABA, low temperature. The conditions for PCR were 94° C. 2 min, 94° C. 30 sec, 72° C. 50 sec for 30 cycles and 72° C. 5 min. The electrophoresis result shows the expression of the genes ABP2, ABP4, and ABP9 can be induced by salt (FIGS. 5A, B and C), drought (FIGS. 5J and K), ABA (L, M and N), hydrogen peroxide (F and G). In FIG. 5, A stands for CK1, B for 1% Nacl, C for 0.8% NaCl, D for 0.6% NaCl, E for 150 mM H2O2, F for 60 mM H2O2, G for 10 mM H2O2, H for H2O, I for 13% H2O, J for 10% H2O, K for 8% H2O, L for 10−6M ABA, M for 10−5M ABA, N for 10−4M ABA, 0 for 4° C. and P for CK2;

FIG. 6 is a construction diagram of plant expression vectors of ABP2, ABP4 or ABP9, showing the physical map of the expression vectors;

FIG. 7 shows the survival test of ABP2, ABP4 and ABP9 transgenic Arabidopsis under salt stress, as compared to non-transgenic Arabidopsis (“comparison”);

FIG. 8 shows the survival test of ABP2, ABP4 and ABP9 transgenic Arabidopsis under freezing temperature, as compared to non-transgenic Arabidopsis (“comparison”); and

FIG. 9 shows the survival test of ABP2, ABP4 and ABP9 transgenic Arabidopsis under drought stress.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Example 1 Cloning and screening the genes encoding maize bZIP transcription factors

Materials and Methods

1) Maize material: immature embryos of 17 days post pollination (17 dpp) from maize variety Qi 319.

2) Strains: E. coli DH5α, DH10B and JM109, and yeast strains yWAM2 (Leu, His, Trp).

3) Vectors: pBSK+, pRS315 and pPC86.

4) Restriction enzymes and modifying enzymes: restriction endonuclease and modifying enzyme are purchased from Promega Corp., New England Biolab, Inc. and Gibco Corporation.

5) Chemical reagents: the reagents for yeast culture are purchased from Sigma Chemical Company Ltd. and Oxford Corporation; the other chemical reagents are made in China (analytical pure).

6) Kits: Wizard™ Minipreps DNA Purification System and Wizard™ Maxipreps DNA Purification System available from Promega Corp. are used to extract plasmid DNA; DNA fragment quick purification/retrieve kit available from Ding Guo Biotechnology Ltd. is used to retrieve DNA; RNAgents Total RNA Isolation System kit and PolyATtract mRNA Isolation System available form Promega Corp. are used to extract RNA; and SuperScript™ Plasmid System for cDNA Synthesis and Plasmid Cloning kit available from GibcoBRL Company are used to construct the library.

7) Synthesis of primers: performed by Beijing Sai Bai Sheng Bioengineering Company and Shanghai Bioasia Biotechnology Co., Ltd.

8) Sequencing: performed by Shanghai Bioasia Biotechnology Co., Ltd.

Procedure of the Experiments

1) Total RNA Extraction and mRNA Isolation:

    • The total RNA extraction and the mRNA isolation are performed according to RNAgents Total RNA Isolation System kit and PolyATtract mRNA Isolation System available from Promega Corp., respectively. Weigh 1 g of maize 17 dpp embryos, extract 2.834 mg of total RNA, and isolate 43.7 μg of mRNA.

2) Construction of cDNA library with mRNA from maize 17dpp embryos.

    • The construction is performed according to the protocol of SuperScript™ Plasmid System for cDNA Synthesis and Plasmid Cloning kit available from GibcoBRL Company. 5 μg of mRNA extracted from 17dpp embryos was used to construct the cDNA library. The primer used in reverse transcription is:

Not I adapter:

(SEQ ID NO: 8)
5′-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15-3′.

Sal I adapter was added and ligated to the double-strand cDNA synthesized:

5′-TCGACCCACGCGTCCG-3′; (SEQ ID NO: 16)
3′-GGGTGCGCAGGCp-5′. (SEQ ID no: 17)

    • Digest the ligation products with Not I and construct them into vector pPC86 (Trp+). The vector was digested with Sal I and Not I, and purified. The construct was used to transform E. coli. DH10B and a cDNA library with the library capacity of 5.2×106 cfu was obtained.

3) Amplification of the cDNA library:

    • Prepare 4 L of 2×LB culture medium (20 g/L Bacto-tryptone, 10 g/L Bacto-yeast extract, 10 g/L NaCl, 3 g/L SeaPrep agarose, adjust to pH 7.0). Autoclave at 121° C. for 30 min. Incubate at 37° C. for 2 hours. Add penicillin G to a final concentration of 200 mg/L. To the medium, add the library up to a concentration of 106 cfu/L. Mix well and aliquot 20-30 mL into 50-mL culture tubes. Ice-bath for 1 hour. Grow at 30° C. for 40 hours. Centrifuge at 8000 rpm for 10 min to collect the cells. Discard the supernatant. Add 200 mL of 2×LB (12.5% glycerol) to suspend the cells. Aliquot into 10 mL/each container and store at −70° C. for later use.

4) Construction of bait vector harboring 4mer ABRE and specificity-testing vector containing 4mer mutant ABRE (mABRE):

    • Synthesize the primers of ABRE(+)
    • 5′GAAGTCCACGTGGAGGTGG3′ (SEQ ID NO: 18) and ABRE(−)
    • 5′TCCCACCTCCACGTGGACT3′ (SEQ ID NO: 19). Remove 20 μl (1 μg/μl) of ABRE(+) and ABRE(−) respectively, and mix well. Add 4 μl of 3M NaOAc and 100 μl of absolute ethanol. Place at −20° for 30 minutes. Centrifuge at 12000 rpm to pellet DNA. Wash once with 70% ethanol and dry. Add 6.5 μl of sterile H2O and 1 μl of 10×T4 polynucleotide kinase buffer. Then, anneal. The conditions for annealing are 88°, 2 min; 65°, 10 min; 37°, 10 min; 25°, 5 min. Add 1.5 μl of 20 mM ATP and 1 μl of T4 polynucleotide kinase. React at 37° for 2 hours. Extract with each of phenol-chloroform and chloroform once, respectively. Precipitate DNA with absolute ethanol. Then add 2 μl of 10× ligase buffer, 1 μl of ligase (5 units/μl) and 17 μl of sterile H2O to ligate overnight. Perform gel electrophoresis with 2% agarose and isolate the DNA fragment of the size of about 80 bp. Clone the fragment into vector pBSK+ (digestion with Spe I and filling-in) and carry out sequencing. Obtain plasmid pA4.

Synthesize the primers: mABRE(+):

    • 5′-GAAGTAACATGTTCGGTGG-3′ (SEQ ID NO: 20);
    • mABRE(−): 5′ TCCCACCGAACATGTTACT 3′ (SEQ ID NO: 21). By the similar method as above, obtain plasmid pmA4.
    • Double-digest Vector pRS315His(Leu+) with BamH I and Xba I and purified. Similarly, digest plasmids pA4 and pmA4, and purified. Clone 4mer ABRE and 4mer mABRE into pRS315His, and obtain bait vector pRSA4(Leu+) and specificity-testing vector pRSmA4(Leu+), respectively.

5) Screening the 17dpp cDNA library:

    • Prepare yWAM2 competent cells. Transform pRSA4 into yeast strain yWAM2(Leu, His, Trp) and obtain the yeast strain yA4 (His, Trp) containing pRSA4. The transformation may be performed according to Two Hybrid System TRAFO Protocol. Screen the library by the transformation of yA4 yeast with 17dpp library DNA. Spread the transformed cells on His selective medium and incubate at 28° C. for 3-5 days. When yeast colonies grow out, extract plasmid DNAs. The extraction method refers to Method I: Quick Plasmid DNA Preparations from Yeast (Christine Guthrie 1991). Transform E. Coli DH5α with the extracted plasmids and then extract plasmid DNAs from the resultant transformants. Analyze by enzyme-digestion. Perform sequencing and obtain the DNA sequences of the positive clones. Then analyze the sequences.

6) Acquirement of the full-length cDNA sequences of ABP2, ABP4 and ABP9:

    • The full-length cDNA sequences of ABP2, ABP4 and ABP9 are obtained by the method of 5′RACE. It is operated according to 5′RACE System for Rapid Amplification of cDNA Ends, Version 2.0 kit available from GibcoBRL Company.

The primers for reverse transcription:

(SEQ ID NO: 9)
ABP2 rv2: 5′-GCGACAGCGACGACAGATCA-3′
(SEQ ID NO: 10)
ABP4 rv2: 5′-AGCGCCAGAAGCGGAGGCCA-3′
(SEQ ID NO: 11)
ABP9 rv2: 5′-CCTTCACCAGGAAGTCCTCCA-3′

The primers for PCR:

(SEQ ID NO: 12)
AUAP fw: 5′-GGCCACGCGTCGACTAGTAC-3′
(SEQ ID NO: 13)
ABP2 rv3: 5′-AGGAACTCCTCCAGAGTCAT-3′
(SEQ ID NO: 14)
ABP4 rv3: 5′-TCGTCGAACGTCAACGAGTAG-3′
(SEQ ID NO: 15)
ABP9 rv3: 5′-AACCAATCCTCCGTTCTCACC-3′

    • The conditions for PCR are 94° C. 3 min, 94° C. 30 sec, 60° C. 30 sec, 72° C. 1 min for 35 cycles, and then 72° C., 5 min. Isolate the amplified DNA fragments with 1% agarose gel and retrieve the target fragments. Ligate it into pGEM-T easy vector and transform E. coli. JM109. Identify clones by enzyme-digestion and then perform sequencing. Obtain the full-length cDNA sequences of the genes of ABP2, ABP4, and ABP9, respectively, which were named as sequences 1, 3 and 5 in the sequence listing. Based upon the cDNA sequences, the predicted proteins have the amino acid sequences set forth by sequences 2, 4 and 6 in the sequence listing.
Example 2

In vivo ABRE-binding specificity analysis of ABP2, ABP4 and ABP9 Transform plasmids pRSA4(Leu+) and pRSmA4(Leu+) respectively into yWAM2 yeast and obtain yA4 and ymA4 yeast strains. Transform yA4 and ymA4 yeast with each of the ABP2, ABP4 and ABP9 plasmids obtained through screening the library. Incubate on His selective medium for 3-5 days at 28° C. Only yA4 yeast transformed with ABP2, ABP4 or ABP9 plasmid can grow while, ymA4 yeast transformed with ABP2, ABP4 or ABP9 plasmid cannot grow. The result means that ABP2, ABP4 or ABP9 is able to specifically bind to ABRE element in yeast and activate the expression of the reporter gene HIS3, thereby having the ability of growing in His selective medium (FIG. 1B). In contrast, because ABP2, ABP4 or ABP9 cannot bind to mABRE and thereby cannot activate the expression of the reporter gene HIS3 that makes yeast not to grow on His selective medium (FIG. 1A). Therefore, ABP2, ABP4 and ABP9 have the in vivo ABRE-binding specificity in yeast cells.

Example 3 Analysis of In Vitro ABRE-Binding Specificity of ABP2, ABP4 and ABP9 (EMSA Test)

1) Purification of proteins ABP2, ABP4 and ABP9:

Clone the full-length genes ABP2, ABP4 or ABP9 into prokaryote expression vector pGEX4T-1 and then transform into strain BL21. Induce the expression with 0.3 mM IPTG at 37° C. for 2-3 hours. SDS-PAGE electrophoresis shows the specific expression bands of ABP2, ABP4 and ABP9. The purification of proteins ABP2, ABP4 and ABP9 is performed as MicroSpin™ GST Purification ModuLe protocol available from Pharmacia Corporation. The purified proteins are used for the EMSA test.

2) Isotope labeling of ABRE and mABRE:

Use DNA 5′ End-Labeling System of Promega Corp to label probes. The reaction system is: 1 μl of ABRE (or mABRE), 5 μl of T4 PNK 10× buffer, 3 μl of γ-32P-ATP, 2 μl of T4 PNK (10 U/μl), and 39 μl of H2O. React at 37° C. for 20 minutes. Add 2 μl of 0.5M EDTA and stop the reaction at 68° C. for 10, minutes. Then keep at 37° C. for 10 minutes. Store at 4° C. for use.

Binding Reaction of Proteins ABP2, ABP4, and ABP9 with DNA:

Add 4 μl of 5× binding buffer (125 ml HEPES-KOH pH7.6, 50% glycerol, 250 mM KCl). Add 4 μg (9 μl) of each of the proteins ABP2, ABP4, ABP9 and GST. Add 1 μl of 1M DTT, 1 μl of probe of the above-labeled ABRE (or N-ABRE) and 4 μl of H2O. Incubate on ice for 30 minutes. Add 3 μl of sample buffer (0.025% bromophenol blue in sterile H2O) and perform polyacrylamide gel electrophoresis analysis.

4) Non-denature polyacrylamide gel electrophoresis:

    • Preparation of polyacrylamide gel (5.4%):
      • Set up the gel mixture of 9 ml of 30%, acrylamide, 5 ml of 10× electrophoresis buffer (142.7 g/L glycin, 3.92 g/L EDTA, 30.28 g/L Tris), 2.5 ml of 50% glycerol, 33 ml of deionized water, 400 μl of 10% APS, and 25 μl of TEMED. After completion of polymerization, perform gel electrophoresis with 1× electrophoresis buffer, including pre-running for 10 minutes (300V), loading the samples and electrophoresis for 1 hour (300V). Stick the gel with filter paper to peel, off. Seal the peeled gel with Saran wrap and expose to X ray film for 1 hour. Wash the film, develop for 2 minutes and fix for 5 minutes. The result shows that there exists a band of ABRE retarded significantly by proteins ABP2, ABP4 and ABP9 while there does not exist a band of mABRE retarded by them (FIG. 2). This means that the products of the genes ABP2, ABP4, and ABP9 also have the ABRE binding specificity in vitro.
Example 4 ABRE Binding Specificity and Transcription Activation Function of ABP2, ABP4 and ABP9 in Yeast and Maize Cells

1) Transcription Activation Test in Yeast Cells

    • Construct the genes ABP2, ABP4 and ABP9 into yeast expression vector YepGAP(Trp+) to obtain plasmids YepGAPABP-2, YepGAPABP-4 and YepGAPABP-9 containing the full-length cDNA of the genes ABP2, ABP4, and ABP9, respectively. Transform them into yA4 and ymA4 yeast and incubate the transformed yeast in His selective medium at 28° C. for 3˜5 days. The result shows that yA4 transformed by plasmid YepGAPABP-2, YepGAPABP-4, YepGAPABP-9 can grow (FIGS. 3B, D and F) while ymA4 transformed by them cannot grow (FIGS. 3A, C and E). Therefore, ABP2, ABP4 and ABP9 not only have the ABRE binding specificity in yeast cells, but also have the transcription activation function. In FIG. 3, the capital letter A stands for ymA4+ABP2, B for yA4+ABP2, C for ymA4+ABP4, D for yA4+ABP4, E for ymA4+ABP9 and F for yA4+ABP9.

2) Test of transcription activation function in maize cells

Construction of reporter plasmid: pIG46 vector is digested with Xho I and filled in with T4 DNA polymerase. Digest 4mer ABRE in vector pBluescript II SK+ with Sma I and Ecl136 II. Retrieve the DNA fragment of the size of about 80 bp used to ligate with the vector. Transform E. coli DH5α and extract the plasmid. Identify through enzyme digestion. The sequencing result shows that ABRE has been ligated upstream of 35S mini promoter.

Construction of effector plasmids of ABP2, ABP4 and ABP9: The full-length cDNA of the genes ABP2, ABP4 and ABP9 (Xba I, Xho I) is constructed into plant expression vector pBI221 and obtain plasmids pBI221-ABP2, ABP4 and ABP9. Co-transform the reporter plasmid and effector plasmid into maize cells by bombardment. The materials for transformation are the maize suspension cells and the transformation method may refer to The Practical Methods of Molecular Biology and Biotechnology in Plant edited by B. R. Greenter and J. E. Tompson. The result shows that the reporter gene is not expressed when solely transformed with reporter plasmid (FIG. 4A) while it is significantly expressed when co-transformed with pIG46 and pBI221-ABP2, ABP4 or ABP9 (FIGS. 4B, C and D). Therefore, the proteins ABP2, ABP4 and ABP9 not only have the ABRE binding specificity in maize cells, but also have the transcription activation function.

Example 5 Analysis of the Expression Specificity of ABP2, ABP4 and ABP9 Under Abiotic Stresses

1) Treatment of maize materials: take maize seed and imbibe water for 24 hours. After planting in pot, grow at 28° C. with 12 hours photoperiod for about 20 days. Treat the plants at the development stage of three leaves with different conditions.

    • i. cold treatment: place the maize seedling in a 2° C. chamber and grow for 48 hours with 12 hours photoperiod. Take out and wash off the soil on the root. Freeze with liquid nitrogen and store at −80° C. for use.
    • ii. salt treatment: place maize seedling in 0.6%, 0.8% and 1% NaCl solution, respectively. Grow with 12 hours photoperiod for 3 days. Take out and wash off the soil on the root. Freeze with liquid nitrogen and store at −80° C. for use.
    • iii. drought treatment: place maize seedling in the soil containing 8% (prepared by mixing 920 g of dry soil and 80 mL of water), 10% and 13% of water, respectively. Grow for 3 days, with 12 hours photoperiod. Take out and wash off the soil on the root. Freeze with liquid nitrogen and store at −80° C. for use.
    • iv. ABA treatment: place maize seedling in the solutions of 10−4M,10−5M,10−6M ABA respectively (weigh 5 mg of ABA and dissolve in 0.1N KOH. Add into 95 mL of water up to a final concentration of 10−4M). Grow for 24 hours, with 12 hours photoperiod. Take out and wash off the soil on the root. freeze with liquid nitrogen and store at −80° C. for use.
    • v. H2O2 treatment: place maize seedling in the aqueous solutions of 10 mM H2O2 (1.13 ml of 30% H2O2/l), 60 mM H2O2 (6.78 ml of 30% H2O2/l), 150 mM H2O2 (14.95 ml of 30% H2O2/l). Grow for 24 hours, with 12 hours photoperiod. Take out and wash off the soil on the root. Deepfreeze with liquid nitrogen and store at −80° C. for use.
    • vi. water treatment: place maize seedling in water. Grow for 24 hours with 12 hours photoperiod. Freeze and store at −80° C.
    • vii. control: take the non-treated seedling and freeze at −80° C. as the control group.

2) Extract of RNA and removal of DNA:

    • i. take about 200 mg of the treated maize materials and ground under the protection of liquid nitrogen. The method of RNA extract refers to RNAgents Total RNA Isolation System kit available from Promega Corp.
    • ii. dissolve RNA in 85 μl of water. Add 10 μl of 10× buffer and 5 μl of RQ1 RNase Free DNase (1 U/μl). Incubate at 37° C. for 15 minutes to eliminate the DNA contamination.
    • iii. add 100 μl of phenol-chloroform to extract once. Remove the supernatant and precipitate RNA with equal volume of isopropanol. Wash once with 70% ethanol and dissolve in 50 μl of water.
    • iv. adjust the concentration of RNA to 1 μg/μl.

3) RT-PCR:

    • Add 1 μl of Oligo dT18 (0.5 μg/μl), 5 μl of RNA (1 μg/μl), 1 μl of dNTP (10 mM) and 27 μl of H2O. Treat at 65° C. for 5 minutes and at 0° C. for 2 minutes. Add 10 μl of 5× buffer, 5 μl of DTT (100 mM), and 10 U of RNase Inhibitor (40 U/μl). Treat at 42° C. for 2-5 minutes. Add 1 μl of SuperScipt II (200 u/μl). React at 42° C. for 50 minutes. Inactivate at 70° C. for 15 minutes for use.
    • The relative quantification of cDNA template and the design of interior label primers: Based upon the DNA sequence of maize actin gene (Maize Actin1 gene: Accession NO. J01238) in GenBank, design the following primers:
      • mact1 F:5′-CACCTTCTACAACGAGCTCCG-3′ (SEQ ID NO: 22)
      • mAct1 R:5′-TAATCAAGG GCAACGTAGGCA-3′ (SEQ ID NO: 23)
    • Use the primers to perform the amplification. If it is amplified from cDNA, a 405 bp band will be amplified. And if it is amplified from genomic DNA, a 512 bp band will be amplified (containing a intron of 107 bp).
    • The reaction mixture for PCR: 1 μl of template, 10 μl of 2×PCR buffer, 1 μl of 10 mM dNTP, 1 μl of 10 μM mAct1 F, 1 μl of 10 μM mAct1 R, 1 U of Taq and 6 μl of sterile H2O.
    • The conditions for PCR are 94° C. 2 min, 94° C. 30 sec, 55° C. 30 sec, 72° C. 30 sec for 30 cycles, and 72° C. 5 min.
    • Based upon the electrophoresis result of PCR product, dilute the template DNA and adjust the amount of template DNA to be used. When the bands to be amplified by using mAct1 F and mAct1 R primers are substantially consistent, the amount of template cDNA in the samples is substantially consistent.

4) PCR amplification of the genes ABP2, ABP4, and ABP9:

i. ABP2: Design the primers for PCR amplification as follows (to amplify the fragment of 548 bp):

FW1 5′-TGATCTGTCGTCGCTGTCGC-3′ (SEQ ID NO: 24)
RV 5′-ACTCCAGGTTACTTGCATTAT-3′ (SEQ ID NO: 25)

      • The PCR system: 1 μl of template, 10 μl of 2×PCR buffer, 1 μl of 10 mM dNTP, 1 μl of 10 μM mAct1 F, 1 μl of 10 μM mAct1 R, 1 U of Taq and 6 μl of sterile H2O.
    • The PCR conditions are 94° C. 2 min, 94° C. 30 sec, 55° C. 30 sec, 72° C. 30 sec for 30 cycles, and 72° 5 min.

ii. ABP4: Design the primers for PCR amplification as follows (to amplify the fragment of 632 bp):

W1R 5′-TCGGTTATTCCCAATACACA-3′ (SEQ ID NO: 26)
W2F 5′-AGCAGCGGTGAACCAGCTTG-3′ (SEQ ID NO: 27)

    • The PCR system: 1 μl of template, 10 μl of 2×PCR buffer, 1 μl of 10 mM dNTP, 1 μl of 10 μl mAct1 F, 1 μl of 10 μM mAct1 R, 1 U of Taq and 6 μl of sterile H2O.
    • The conditions for PCR are 94° C. 2 min, 94° C. 30 sec, 55° C. 30 sec, 72° C. 30 sec for 30 cycles, and 72° C. 5 min.

iii. ABP9: Design the primers for PCR amplification as follows (to amplify the fragment of 937 bp):

FW1 5′-CATGACGCTGGAGGACTTCCT-3′ (SEQ ID NO: 28)
RV 5′-TTGACGAAAACACAGAGC-3′ (SEQ ID NO: 29)

    • The PCR system: 1 μl of template, 10 μl of 2×PCR buffer, 1 μl of 10 mM dNTP, 1 μl of 10 μM mAct1 F, 1 μl of 10 μM mAct1 R, 1 U of Taq and 6 μl of sterile H2O.
    • The conditions for PCR are 94° C. 2 min, 94° C. 30 sec, 55° C. 30 sec, 72° C. 50 sec for 30 cycles and 72° C. 5 min. The electrophoresis result shows the expression of the genes ABP2, ABP4, and ABP9 can be induced by salt (FIGS. 5A, B and C), drought (FIGS. 5J and K), ABA (L, M and N), hydrogen peroxide (F and G). In FIG. 5, A stands for CK1, B for 1% NaCl, C for 0.8% NaCl, D for 0.6% NaCl, E for 150 mM H2O2, F for 60 mM H2O2, G for 10 mM H2O2, H for H2O, I for 13% H2O, J for 10% H2O, K for 8% H2O, L for 10−6M ABA, M for 10−5M ABA, N for 10−4M ABA, O for 4° C. and P for CK2.
Example 6 Construction of Transgenic Expression Vectors of ABP2, ABP4 and ABP9

1) Transformation of arabidopsis with the genes ABP2, ABP4 and ABP9:

    • The cultivation of Arabidopsis
    • Vernalize arabidopsis seed at 4° C. for 2-3 day and plant 7-10 seeds in each pot (the rate of nutritive earth to vermiculite is 2:1). Grow in the greenhouse (at 22° C. with 16 hours light-treatment). After the arabidopsis grow out the primary bolting, snip off it. When the arabidopsis grow out many secondary boltings and a few of them begin to produce legumen, the plants can be used for transformation.

The cultivation of Agrobacterium

    • Pick a single colony of Agrobacterium and inoculate into 3 ml of YEB (50 mg/L Kan and 50 mg/l refampicin). Incubate at 28° C. with rotation at 250 rpm for) 30 hours. 1:400 inoculate the seed culture into 200 ml of fresh YEB (50 mg/l Kan and 50 mg/L refampicin) and incubate at 28° C. with rotation at 250 rpm for about 14 hours until OD600 is about 1.5. Harvest the cells by centrifugation at 7500 rpm at 4° C. for 10 minutes. Re-suspend the cells in two volumes of liquid MS (400 ml) (½ MS salt +5% sucrose, pH5.7. Sterilized at 121° C. for 15 minutes). Immediately before use, add 6-BA to a final concentration of 0.044 μM, VB6 to a final concentration of 1 mg/l, VB 1 to a final concentration of 10 mg/l, and SILWET to a final concentration of 0.02%).
    • i. Construction of plant expression vectors and transformation of Agrobacterium
    • Construct genes ABP2, ABP4 and ABP9 into vectors pBI121 and pZP212 to obtain pZP212-ABP2, pZP212-ABP4 and pBI121-ABP9 (FIG. 6), respectively. Transform JM109, extract the plasmids and identify with digestion of enzymes. Pick out the desired clone, perform DNA sequencing and transform it into Agrobacterium LBA4404.
    • ii. Transformation of arabidopsis
    • Dip the bud of arabidopsis into Agrobacterium suspension under vacuum (25 IN Hg) for 5 minutes. After the transformation is over, cover the pot with a plastic bag. Place in horizontal direction. Let it grow under low light intensity for 24-48 hours. Then transfer to the normal conditions for further growth.
    • iii. seed collection and screening
    • Weigh 25-30 mg of seeds collected from above transformation-treated plants and place into 1.5-mL centrifuge tube. Add 1 ml of 75% ethanol (containing 0.05% Tween 20) and shake in a shaker for 10 minutes (300 rpm). Centrifuge and discard the supernatant. Add 1 ml of 95% ethanol to wash one time, centrifuge and discard the supernatant. Repeat once. Add 0.3 ml of 100% ethanol and place on sterile filter paper under hood and blow-dry. Spread the blow-dried seeds on ½ MS plate (50 mg/l Kan) and place at 4° C. for 2 days. Grow at 22° C. and with 16 hours photoperiod. Transfer the antibiotics-resistant plants (T0 generation) into pots for further cultivation and collect the seeds to perform the screening of T1 generation.

2) Extraction of genomic DNA from antibiotics-resistant arabidopsis plants:

    • i. Ground 0.1-0.2 g of plant leaves under liquid nitrogen and transfer into 1.5-ml centrifuge tube.
    • ii. Add 0.7 ml of CTAB (100 mM Tris, 1.4 M NaCl, 20 mM EDTA, 2% CTAB, 0.1% mercaptoethanol) and place at 60° C. for 30 minutes. Note: turn over at an interval of 10 minutes.
    • iii. Add 0.7 ml of phenol:chloroform (1:1) and turn over for several times. Centrifuge at 10000 rpm for 5 minutes. Transfer the supernatant to a fresh centrifuge tube, add equal volume of chloroform:isopentanol (24:1), nix well, and centrifuge at 10000 rpm for 5 minutes. Transfer the supernatant to another fresh centrifuge tube.
    • iv. Add equal volume of isopropanol and turn over to mix well. Centrifuge at 10000 rpm for 10 minutes. Discard the supernatant. Wash once with 70% ethanol. Vacuum-dry. Dissolve in 50 μl of sterile H2O for PCR assay.

3) PCR assay of transgenic arabidopsis:

forward primer:35S promoter:
(SEQ ID NO: 30)
5′-TCTGCCGACAGTGGTCCCAA-3′
reverse primer:ABP2
(SEQ ID NO: 13)
rv3: 5′-AGG AAC TCC TCG AGA GTC AT-3′
(SEQ ID NO: 14)
ABP4 rv3: 5′-TCG TCG AAC GTC AAC GAG TAG-3′
(SEQ ID NO: 15)
ABP9 rv3: 5′-AAC CAA TCC TCC GTT CTC ACC-3′

    • The reaction system (20 μl): 1 μl (20 ng˜50 ng) of DNA from transgenic plant, 2 μl of 10× buffer, 2 μl of MgCl2(2.5 mM), 0.2 μl of Taq enzyme, 2 μl of dNTP (2.5 mM). Add 10 μM of each primer. Add sterile H2O up to the volume of 20 μl.
    • The reaction conditions are 94° C., 5 minutes; 94° C., 45 second; 60° C., 45 second; 72° C., 45 second for 35 cycles. Extend at 72° C. for 5 minutes. Identify the PCR positive plants.
Example 7 Survival Analysis of Transgenic Plants of ABP2, ABP4 and ABP9 Under Stresses.

1) cold tolerance: place the transgenic plants and the non-trangenic plants at −6° C. for 6 hours. Then transfer into the normal growth conditions for recovery cultivation. The result shows that the survival rate of the transgenic plant is 80% while that of the non-transgenic plant is 10%. Therefore, ABP2, ABP4, and ABP9 are able to improve the cold tolerance of plants as shown in FIG. 7.

2) salt tolerance: place the transgenic plants and the non-transgenic plants in 600 mM NaCl solution and immerse for 3 hours. Grow at 22° C. for 24 hours, under light. Transfer into the normal growth conditions for arabidopsis for recovery cultivation. The result shows that the survival rate of the transgenic plant is 80% while that of the non-transgenic plant is 15%. Therefore, ABP2, ABP4, and ABP9 are able to improve the salt tolerance of plants as shown in FIG. 8.

3) drought tolerance: place the transgenic plants and the non-transgenic plants under the normal growth conditions for arabidopsis. Continuously cultivate for 15-20 days without supplying water. The result shows that the survival rate of the transgenic plant is 90% while that of the non-transgenic plant is 5%. Therefore, ABP2, ABP4 and ABP9 are able to significantly improve the drought tolerance of plants as shown in FIG. 9, wherein the capital letter A stands for transgenic plant, B for non-transgenic plant.

APPLICATION IN INDUSTRY AND AGRICULTURE

The invention has successfully cloned the genes encoding maize bZIP transcription factors ABP2, ABP4, and ABP9, respectively. Furthermore, the invention has successfully introduced the genes into arabidopsis and obtains novel arabidopsis with enhanced tolerance to abiotic stresses. The work will have important theoretic and practical significance to breed new plant varieties with improved tolerance to abiotic stresses.

Claims

What is claimed is:

1. An isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO:1 or a nucleotide sequence encoding a protein which comprises the amino acid sequence of SEQ ID NO:2 representing maize bZIP transcriptional factor ABP4.

2. An expression vector comprising the isolated nucleic acid according to claim 1.

3. The expression vector according to claim 2 wherein said expression vector is pZP212-ABP2.

4. A cell line transformed with the isolated nucleic acid according to claim 1.

5. A chimeric plant expression vector, said vector comprising in the 5′ to 3′ direction:

a heterologous promoter that is capable of effecting mRNA transcription in a selected plant cell to be transformed, operably linked to

a structural DNA sequence encoding SEQ ID NO:2 that induces abiotic stress tolerance and operably linked to

a non-translated region of a gene, said region comprises a signal sequence for polyadenylation of mRNA.

6. A vector capable of introducing at least one regulatory gene encoding a protein into a plant, the vector comprising:

(a) the nucleotide sequence of SEQ ID NO: 1 or

(b) a nucleotide sequence encoding a protein comprising the amino acid sequence of SEQ ID NO:2 and a promoter operably linked to the nucleotide sequence of (a) or (b).

7. The vector according to claim 6, further comprising a transcription terminator sequence operably linked to the nucleotide sequence of (a) or (b).

8. The vector according to claim 6, further comprising a nucleotide sequence encoding a selective marker.

9. An Agrobacterium tumefaciens transformed with the vector according to claim 6.

10. A plant material endued with abiotic stress tolerance by being transformed with an Agrobacterium tumefaciens according to claim 9, wherein said abiotic stress tolerance is selected from the group consisting of drought tolerance, cold tolerance and Salinity tolerance.

11. A plant material transformed with a nucleic acid molecule which encodes a protein comprising the sequences, as set forth in SEQ ID NO: 2.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: