US20090142351A1
2009-06-04
11/978,832
2007-10-29
A novel gene PGC-3, and its role in regulating the transcriptional activity of PPARγ in adipose tissue. PGC-3 is highly expressed in human white adipose tissue and has utility in the development of new therapeutic agents for use in the treatment of obesity and other related disorders such as non-insulin dependent diabetes mellitus, insulin resistance syndrome, dyslipidemia, and atherosclerosis.
Get notified when new applications in this technology area are published.
C07K14/5759 » CPC main
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans; Hormones Products of obesity genes, e.g. leptin, obese (OB), tub, fat
A61P3/00 » CPC further
Drugs for disorders of the metabolism
A61P3/06 » CPC further
Drugs for disorders of the metabolism Antihyperlipidemics
A61P3/10 » CPC further
Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
A61P9/10 » CPC further
Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
A61K38/00 » CPC further
Medicinal preparations containing peptides
A61K39/395 IPC
Medicinal preparations containing antigens or antibodies Antibodies ; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
C07K16/18 IPC
Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
A61P3/04 » CPC further
Drugs for disorders of the metabolism Anorexiants; Antiobesity agents
This application is a divisional of U.S. application Ser. No. 10/380,492, filed Mar. 12, 2003, which is a national stage filing under 35 U.S.C. 371 of International Application No. PCT/GB01/04074, filed Sep. 12, 2001, which claims priority from United Kingdom Application No. 0022670.4, filed Sep. 15, 2000, the specifications of all of which are incorporated by reference herein. International Application No. PCT/GB01/04074 was published under PCT Article 21(2) in English.
This invention relates to the regulation of metabolism and in particular to human genes involved in obesity. The invention further relates to proteins encoded by the genes and to means of regulating their biological activity. In addition the invention relates to the use of the genes and proteins to identify therapeutic agents for controlling obesity and other related disorders such as non-insulin dependent diabetes mellitus (NIDDM), insulin resistance syndrome, dyslipidemia, and atherosclerosis.
Obesity results from an excessive accumulation of adipose tissue and is a growing public health problem in developed and developing countries. Highly overweight individuals show significant increases in the occurrence of NIDDM, coronary heart disease, some cancers and digestive diseases.
Current treatment is unsatisfactory and new drugs need to be developed. A major problem is that the mechanisms regulating obesity, and the role of increased adiposity in the development of metabolic dysfunction are unclear. What is apparent is that obesity results from an imbalance between energy intake and expenditure. Energy expenditure can be affected by alterations in basal metabolism, physical activity and adaptive thermogenesis.
Peroxisome proliferator-activated receptor-γ (PPARγ) is a recently identified member of the peroxisome proliferator-activated receptor family of nuclear hormone receptors (Tontonoz et al., Genes Dev. (1994) 8, 1224-1234). The expression of this protein is induced very early in the adipocyte differentiation process and, when expressed ectopically in fibroblastic cells, induces adipogenesis in response to activators of the receptor. Synthetic and naturally occurring ligands for PPARγ have been identified. Thiazolidinediones (TZDs), a class of insulin sensitising agents which are used for the treatment of NIDDM, have been shown to bind to and activate PPARγ. TZDs promote adipocyte differentiation of murine and human preadipocytes to mature, fat storing adipocytes. TZD activation of PPARγ has also been shown to regulate transcription of many adipocyte genes. In addition to the presence of a ligand, the activity of PPARγ has been shown to be influenced by the presence of coactivators and corepressors. When co-expressed in cells alongside PPARγ these proteins have been shown to greatly increase or repress the transcriptional activity of PPARγ. Differences in expression of these coactivators and corepressors between cell types may explain the observed differences in PPARγ mediated transcriptional activity between cells from different tissues.
One such coactivator is PGC-1 (Puigserver et al., Cell (1998) 92, 829-839). The expression of this 90 kDa nuclear protein is greatly increased in muscle and brown fat of mice upon their exposure to cold temperatures. Co-expression of PGC-1 with PPARγ has been shown to activate aspects of the adaptive thermogenic program.
However, PGC-1 is not expressed in white adipose tissue which makes up the majority of adipose tissue found in humans. The identification of a protein which regulates the activity of PPARγ in white adipose tissue is thus of great importance in understanding the development of human obesity.
In the present invention we disclose the cloning and identification of PGC-3, and its role in regulating the transcriptional activity of PPARγ in adipose tissue. PGC-3 is highly expressed in human white adipose tissue and shares sequence homology with PGC-1 in domains known to be responsible for distinct activity of the protein. Two distinct variants of PGC-3 have been identified, termed PGC-3a and PGC-3b, which arise from alternative splicing of the PGC-3 gene. A further splice variant has been identified, termed PGC-3c. Full length cDNA and protein sequences for each of the splice variants are provided. The invention further discloses that PGC-3 has utility in the development of new therapeutic agents for use in the treatment of obesity and other related disorders such as non-insulin dependent diabetes mellitus, insulin resistance syndrome, dyslipidemia, and atherosclerosis. The invention further provides methods for the identification of such therapeutic agents.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which this invention belongs. All publications and patents referred to herein are incorporated by reference.
The term “PGC-3” as used herein encompasses both of the splice variants, PGC-3a and PGC-3b, as well as PGC-3c.
According to one aspect of the present invention we provide an isolated and purified polynucleotide molecule comprising a nucleic acid sequence which encodes a polypeptide having at least about 90% homology to a member selected from any one of
(a) (SEQ ID NO:2, SEQ ID NO:2 positions 1-600, SEQ ID NO:2 positions 400-1002, and SEQ ID NO:2 positions 200-800)
or
(b) (SEQ ID NO:4, SEQ ID NO:4 positions 1-600, SEQ ID NO:4 positions 400-996, and SEQ ID NO:4 positions 200-800)
or
(c) (SEQ ID NO:8, SEQ ID NO:8 positions 1-600, SEQ ID NO:4 positions 400-1023, and SEQ ID NO:4 positions 200-800
Isolated and purified polynucleotides of the present invention include sequences which comprise the human PGC-3a cDNA sequence set out in SEQ ID NO:1 and the human PGC-3b cDNA sequence set out in SEQ ID NO:3 and the human PGC-3c cDNA sequence set out in SEQ ID NO:7.
In addition we have also identified and sequenced a rat clone having a high degree of homology to PGC-3 (cf. Example 5). Polynucleotide and polypeptide molecules based on the rat PGC-3 sequence may be used by analogy with the human sequences. The rat sequence shows a high degree of sequence homology (78% sequence identity and rats are therefore expected to be useful in animal models of metabolism.
Therefore in a further aspect of the invention we provide an isolated and purified polynucleotide molecule comprising a nucleic acid sequence which encodes a polypeptide having at least about 90% homology to any one of SEQ ID NO:9, SEQ ID NO:9 positions 1-600, SEQ ID NO:2 positions 400-990, and SEQ ID NO:9 positions 200-800.
In a further aspect of the invention we provide fragments of the isolated and purified polynucleotide molecules of the present invention. By fragments we mean contiguous regions of the polynucleotide molecule including complementary DNA and RNA sequences, starting with short sequences useful as probes or primers of say about 8-50 bases, such as 10-30 bases or 15-35 bases, to longer sequences of up to 50, 100, 200, 500 or 1000 bases. Indeed any convenient fragment of the polynucleotide molecule may be a useful fragment for further research, therapeutic or diagnostic purposes. Further convenient fragments include those whose terminii are defined by restriction sites within the molecule of one or more kinds, such as any combination of Rsa1, Alu1 and Hinf1.
In a further aspect we provide homologues and orthologues of the isolated and purified polynucleotide molecules of the present invention. Preferred homologues and orthologues are polynucleotide molecules which display greater than 80% sequence homology, conveniently greater than 85%, for example 90%, to the PGC-3 cDNA sequences set out in SEQ ID NO:1 and SEQ ID NO:3. A homologue may be a polynucleotide molecule from the same species i.e. a homologous family member, alternatively, the homologue may be a similar polynucleotide molecule from a different species such as human, useful in developing new therapies for the treatment of IRS and other related disorders such as NIDDM, obesity and atherosclerosis. By the term orthologue we mean a functionally equivalent molecule in another species. The full sequences of the individual homologues and orthologues may be determined using conventional techniques such as hybridisation, PCR and sequencing techniques, starting with any convenient part of the sequence set out in SEQ ID NO: 1 or SEQ ID NO:3.
In a further aspect of the invention we provide isolated and purified polynucleotide molecules capable of specifically hybridising to the polynucleotide molecules of the present invention. By specifically hybridising we mean that the polynucleotide hybridises by base-pair interactions, under stringent conditions, to the polynucleotide molecules of the present invention or to the corresponding complementary sequences. Experimental procedures for hybridisation under stringent conditions are well known to persons skilled in the art. For example, hybridisation filters may be incubated overnight at 42° C. in a solution comprising 50% formamide, 5×SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH7.6) 5×Denhardt's solution, 10% dextran sulphate, and 20 μg/ml denatured salmon sperm DNA; followed by washing the filters in 0.1×SSC at about 65° C. Hybridisation techniques are thoroughly described in Sambrook J., Fritsch E. F. and Maniatis T., Molecular Cloning a Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989.
In a further aspect we provide an expression vector comprising a polynucleotide molecule of the present invention.
A variety of mammalian expression vectors may be used to express the recombinant polypeptides of the present invention. Commercially available mammalian expression vectors which are suitable for recombinant expression include, pcDNA3 (Invitrogen), pMC1neo (Stratagene), pXT1 (Stratagene), pSG5 (Stratagene), EBO-pSV2-neo (ATCC 37593), pBPV-1(8-2) (ATCC 37110), pdBPV-MMTneo(342-12) (ATCC 37224), pRSVgpt (ATCC 37199), pRSVneo (ATCC 37198), pSV2-dhfr (ATCC 37146), pUCTag (ATCC 37460), IZD35 (ATCC 37565), pLXIN, pSIR (CLONTECH), and pIRES-EGFP (CLONTECH).
Baculoviral expression systems may also be used with the present invention to produce high yields of biologically active polypeptides. Preferred vectors include the CLONTECH, BacPak™ Baculovirus expression system and protocols which are commercially available (CLONTECH, Palo Alto, Calif.).
Further preferred vectors include vectors for use with the mouse erythroleukaemia cell (MEL cell) expression system comprising the human beta globin gene locus control region (Davies et al., J. of Pharmacol. and Toxicol. Methods 33, 153-158).
Vectors comprising one or more polynucleotide molecules of the present invention may then be purified and introduced into appropriate host cells. Therefore in a further aspect we provide a transformed host cell comprising a polynucleotide molecule of the present invention.
The polypeptides of the present invention may be expressed in a variety of hosts such as bacteria, plant cells, insect cells, fungal cells and human and animal cells. Eukaryotic recombinant host cells are especially preferred. Examples include yeast, mammalian cells including cell lines of human, bovine, porcine, monkey and rodent origin, and insect cells including Drosophila and silkworm derived cell lines. Cell lines derived from mammalian species which may be used and which are commercially available include, L cells L-M(TK−) (ATCC CCL 1.3), L cells L-M (ATCC CCL 1.2), HEK 293 (ATCC CRL 1573), Raji (ATCC CCL 86), CV-1 (ATCC CCL 70), COS-1 (ATCC CRL 1650), COS-7 (ATCC CRL 1651), CHO-K1 (ATCC CCL 61), 3T3 (ATCC CCL 92), NIH/3T3 (ATCC CRL 1658), HeLa (ATCC CCL 2), C127I (ATCC CRL 1616), BS-C-1 (ATCC CCL 26) and MRC-5 (ATCC CCL 171).
The expression vector may be introduced into host cells to express a polypeptide of the present invention via any one of a number of techniques including calcium phosphate transformation, DEAE-dextran transformation, cationic lipid mediated lipofection, electroporation or infection
The transformed host cells are propagated and cloned, for example by limiting dilution, and analysed to determine the expression level of recombinant polypeptide. Identification of transformed host cells which express a polypeptide of the present invention may be achieved by several means including immunological reactivity with antibodies described herein and/or the detection of biological activity.
Polypeptides of the present invention may be expressed as fusion proteins, for example with one or more additional polypeptide domains added to facilitate protein purification. Examples of such additional polypeptides include metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilised metals (Porath, J., Protein Exp. Purif. 3:263 (1992)), protein A domains that allow purification on immobilised immunoglobulin, and the domain utilised in the FLAGS extension/affinity purification system (Immunex Corp, Seattle Wash.). The inclusion of cleavable linker sequences such as Factor XA or enterokinase (Invitrogen, San Diego Calif.) between the purification domain and the coding region is useful to facilitate purification. A preferred protein purification system is the CLONTECH, TALON™ nondenaturing protein purification kit for purifying 6×His-tagged proteins under native conditions (CLONTECH, Palo Alto, Calif.).
Therefore in a further aspect we provide a method for producing a polypeptide of the present invention, which method comprises culturing a transformed host cell comprising a polynucleotide of the present invention under conditions suitable for the expression of said polypeptide.
In a further aspect of the present invention we provide a purified polypeptide comprising the human PGC-3a amino acid sequence set out in SEQ ID NO:2 or a variant of SEQ ID NO:2 having at least about 90% homology to a member selected from (SEQ ID NO:2 positions 1-600, SEQ ID NO:2 positions 400-1002, SEQ ID NO:2 positions 200-800), or a biologically active fragment thereof.
In a further aspect of the present invention we provide a purified polypeptide comprising the human PGC-3b amino acid sequence set out in SEQ ID NO:4 or a variant of SEQ ID NO:4 having at least about 90% homology to a member selected from (SEQ ID NO:4 positions 1-600, SEQ ID NO:4 positions 400-996, SEQ ID NO:4 positions 200-800), or a biologically active fragment thereof.
In a further aspect of the present invention we provide a purified polypeptide comprising the human PGC-3c amino acid sequence set out in SEQ ID NO:8 or a variant of SEQ ID NO:8 having at least about 90% homology to a member selected from (SEQ ID NO:8 positions 1-600, SEQ ID NO:8 positions 400-1023, SEQ ID NO:8 positions 200-800), or a biologically active fragment thereof.
In a further aspect of the present invention we provide a purified polypeptide comprising the rat PGC-3 amino acid sequence set out in SEQ ID NO:10 or a variant of SEQ ID NO:10 having at least about 90% homology to a member selected from (SEQ ID NO:10 positions 1-600, SEQ ID NO:10 positions 400-990, SEQ ID NO:10 positions 200-800), or a biologically active fragment thereof.
A variant is a polynucleotide or polypeptide which differs from a reference polynucleotide or polypeptide, but which retains some of its essential characteristics. For example, a variant of a PGC-3 polypeptide may have an amino acid sequence that is different by one or more amino acid substitutions, deletions and/or additions. The variant may have conservative changes (amino acid similarity), wherein a substituted amino acid has similar structural or chemical properties, for example, the replacement of leucine with isoleucine. Alternatively, a variant may have nonconservative changes, e.g., replacement of a glycine with a tryptophan. Guidance in determining which and how many amino acid residues may be substituted, inserted or deleted and the effect this will have on biological activity may be reasonably inferred from the present disclosure by a person skilled in the art and may further be found using computer programs well known in the art, for example, DNAStar software.
Amino acid substitutions may be made, for instance, on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues. Negatively charged amino acids, for example, include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values include leucine, isoleucine, valine, glycine, alanine; asparagine, glutamine; serine, threonine, phenylalanine, and tyrosine.
Suitable substitutions of amino acids include the use of a chemically derivatised residue in place of a non-derivatised residue. D-isomers and other known derivatives may also be substituted for the naturally occurring amino acids. See, e.g., U.S. Pat. No. 5,652,369, Amino Acid Derivatives, issued Jul. 29, 1997. Example substitutions are set forth in Table 1.
“Homology” as used in this description is a measure of the similarity or identity of nucleotide sequences or amino acid sequences. In order to characterise the homology, subject sequences are aligned so that the highest order identity match is obtained. Identity can be calculated using published techniques. Computer program methods to determine identity between two sequences, for example, include DNAStar software (DNAStar Inc., Madison, Wis.); the GCG program package (Devereux, J., et al., Nucleic Acids Research 1984, 12(1):387); and BLASTP, BLASTN, FASTA (Atschul, S. F. et al., J Molec Biol 1990, 215:403). Homology as defined herein is determined conventionally using the well known computer program, BESTFIT (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis., 53711). When using BESTFIT or another sequence alignment program to determine the similarity of a particular sequence to a reference sequence, the parameters are typically set such that the percentage identity is calculated over the full length of the reference nucleotide sequence or amino acid sequence and that gaps in homology of up to about 10% of the total number of nucleotides or amino acid residues in the reference sequence are allowed.
In a further aspect we provide polymorphic variants of the polynucleotides and polypeptides of the present invention. Polymorphisms are variations in polynucleotide or polypeptide sequences between one individual and another. DNA polymorphisms may lead to variations in amino acid sequence and consequently to altered protein structure and functional activity. Polymorphisms may also affect mRNA synthesis, maturation, transport and stability. Polymorphisms which do not result in amino acid changes (silent polymorphisms) or which do not alter any known consensus sequences may nevertheless have a biological effect, for example by altering mRNA folding or stability.
Knowledge of polymorphisms may be used to help identify patients most suited to therapy with particular pharmaceutical agents (this is often termed “pharmacogenetics”). Pharmacogenetics may also be used in pharmaceutical research to assist the drug selection process. Polymorphisms may be used in mapping the human genome and to elucidate the genetic component of diseases. The reader is directed to the following references for background details on pharmacogenetics and other uses of polymorphism detection: Linder et al. (1997), Clinical Chemistry, 43, 254; Marshall (1997), Nature Biotechnology, 15, 1249; International Patent Application WO 97/40462, Spectra Biomedical; and Schafer et al. (1998), Nature Biotechnology, 16, 33.
The polypeptides of the present invention may be genetically engineered in such a way that their interaction with other intracellular and membrane associated proteins are maintained but their effector function and biological activity are removed. A polypeptide genetically modified in this way is known as a dominant negative mutant. In the construction of a dominant negative mutant at least one amino acid residue position at a site required for activity in the native peptide is changed to produce a peptide which has reduced activity or which is devoid of detectable activity. Overexpression of the dominant negative mutant in an appropriate cell type down-regulates the effect of the endogenous polypeptide, thereby revealing the biological mechanisms involved in the control of metabolism.
Similarly, the polypeptides of the present invention may be genetically engineered in such a way that their effector function and biological activity are enhanced. The resultant overactive polypeptide is known as a dominant positive mutant. At least one amino acid residue position at a site required for activity in the native peptide is changed to produce a peptide which has enhanced activity. Overexpression of a dominant positive mutant in an appropriate cell type amplifies the response of the endogenous native polypeptide highlighting the regulatory mechanisms controlling cell metabolism.
Therefore in a further aspect we provide dominant negative and dominant positive mutants of the polypeptides of the present invention.
Novel sequences disclosed herein, may be used in another embodiment of the invention to regulate expression of PGC-3 genes in cells by the use of antisense constructs. For example an antisense expression construct may be readily constructed using the pREP10 vector (Invitrogen Corporation). Transcripts are expected to modulate translation of the gene in cells transfected with the construct. Antisense transcripts are effective for modulating translation of the native gene transcript, and are capable of altering the effects (e.g., regulation of tissue physiology) herein described. Oligonucleotides which are complementary to and hybridisable with any portion of mRNA disclosed herein are contemplated for therapeutic use. U.S. Pat. No. 5,639,595, “Identification of Novel Drugs and Reagents”, issued Jun. 17, 1997, wherein methods of identifying oligonucleotide sequences that display in vivo activity are thoroughly described, is herein incorporated by reference. Antisense molecules may also be synthesised for use in antisense therapy, using techniques known to persons skilled in the art. These antisense molecules may be DNA, stable derivatives of DNA such as phosphorothioates or methylphosphonates, RNA, stable derivatives of RNA such as 2′-O-alkylRNA, or other oligonucleotide mimetics. U.S. Pat. No. 5,652,355, “Hybrid Oligonucleotide Phosphorothioates”, issued Jul. 29, 1997, and U.S. Pat. No. 5,652,356, “Inverted Chimeric and Hybrid Oligonucleotides”, issued Jul. 29, 1997, which describe the synthesis and effect of physiologically-stable antisense molecules, are incorporated by reference. Antisense molecules may be introduced into cells by microinjection, liposome encapsulation or by expression from vectors harboring the antisense sequence.
In a further aspect we provide an antibody specific for a polypeptide of the present invention.
Antibodies can be prepared using any suitable method, for example, purified polypeptide may be utilised to prepare specific antibodies. The term “antibodies” includes polyclonal antibodies, monoclonal antibodies, and the various types of antibody constructs such as for example F(ab′)2, Fab and single chain Fv. Antibodies are defined to be specifically binding if they bind the antigen with a Ka of greater than or equal to about 107M−1. Affinity of binding can be determined using conventional techniques, for example those described by Scatchard et al., Ann. N.Y. Acad. Sci., 51:660 (1949).
Polyclonal antibodies can be readily generated from a variety of sources, for example, horses, cows, goats, sheep, dogs, chickens, rabbits, mice or rats, using procedures that are well-known in the art. In general, antigen is administered to the host animal typically through parenteral injection. The immunogenicity of antigen may be enhanced through the use of an adjuvant, for example, Freund's complete or incomplete adjuvant. Following booster immunisations, small samples of serum are collected and tested for reactivity to antigen. Examples of various assays useful for such determination include those described in: Antibodies: A Laboratory Manual, Harlow and Lane (eds.), Cold Spring Harbor Laboratory Press, 1988; as well as procedures such as countercurrent immuno-electrophoresis (CIEP), radioimmunoassay, radioimmunoprecipitation, enzyme-linked immuno-sorbent assays (ELISA), dot blot assays, and sandwich assays, see U.S. Pat. Nos. 4,376,110 and 4,486,530.
Monoclonal antibodies may be readily prepared using well-known procedures, see for example, the procedures described in U.S. Pat. Nos. RE 32,011, 4,902,614, 4,543,439 and 4,411,993; Monoclonal Antibodies, Hybridomas: A New Dimension in Biological Analyses, Plenum Press, Kennett, McKearn, and Bechtol (eds.), (1980).
The monoclonal antibodies of the invention can be produced using alternative techniques, such as those described by Alting-Mees et al., “Monoclonal Antibody Expression Libraries: A Rapid Alternative to Hybridomas”, Strategies in Molecular Biology 3: 1-9 (1990) which is incorporated herein by reference. Similarly, binding partners can be constructed using recombinant DNA techniques to incorporate the variable regions of a gene that encodes a specific binding antibody. Such a technique is described in Larrick et al., Biotechnology, 7: 394 (1989).
Once isolated and purified, the antibodies may be used to detect the presence of antigen in a sample using established assay protocols.
In a further aspect of the invention we provide a method for identifying a therapeutic agent capable of modulating the activity of PGC-3 for use in the regulation of metabolism, which method comprises:
(i) contacting a candidate compound modulator with a PGC-3 polypeptide comprising any one of
(a) the amino acid sequence set out in SEQ ID NO:2 or a variant of SEQ ID NO:2 having at least about 90% homology to a member selected from (SEQ ID NO:2 positions 1-600, SEQ ID NO:2 positions 400-1002, SEQ ID NO:2 positions 200-800) or a biologically active fragment thereof;
or
(b) the amino acid sequence set out in SEQ ID NO:4 or a variant of SEQ ID NO:4 having at least about 90% homology to a member selected from (SEQ ID NO:4 positions 1-600, SEQ ID NO:4 positions 400-996, SEQ ID NO:4 positions 200-800) or a biologically active fragment thereof;
or
(c) the amino acid sequence set out in SEQ ID NO:8 or a variant of SEQ ID NO:8 having at least about 90% homology to a member selected from (SEQ ID NO:8 positions 1-600, SEQ ID NO:8 positions 400-996, SEQ ID NO:8 positions 200-800) or a biologically active fragment thereof;
and
(ii) measuring an effect of the candidate compound modulator on the activity of the PGC-3 polypeptide.
Activity as used herein refers to the ability of the therapeutic agent to mediate cell processes related to insulin resistance syndrome and other related disorders such as non-insulin dependent diabetes mellitus, dyslipidemia, obesity and atherosclerosis.
Modulation of the activity of PGC-3 comprises either stimulation or inhibition. Thus a therapeutic agent capable of modulating the activity of PGC-3 is an agent that either stimulates or inhibits the activity of PGC-3. The terms “modulator of PGC-3 activity” and “PGC-3 modulator” are also used herein to refer to an agent that either stimulates or inhibits the activity of PGC-3. The therapeutic agents of the invention have utility in the regulation of metabolism; in particular in obesity and the control of insulin resistance syndrome and other related disorders such as non-insulin dependent diabetes mellitus, dyslipidemia, and atherosclerosis.
In a further aspect of the invention we provide a screen for identifying compounds which modulate the activity of PGC-3, the invention extends to such a screen and to the use of compounds obtainable therefrom to modulate the activity of PGC-3 in vivo.
Potential therapeutic agents which may be tested in the screen include simple organic molecules, commonly known as “small molecules”, for example those having a molecular weight of less than 2000 Daltons. The screen may also be used to screen compound libraries such as peptide libraries, including synthetic peptide libraries and peptide phage libraries. Other suitable molecules include antibodies, nucleotide sequences and any other molecules which modulate the activity of PGC-3.
Once an inhibitor or stimulator of PGC-3 activity is identified then medicinal chemistry techniques can be applied to further refine its properties, for example to enhance efficacy and/or reduce side effects.
It will be appreciated that there are many screening procedures which may be employed to perform the present invention. Examples of suitable screening procedures which may be used to identify a PGC-3 modulator for use in the regulation of metabolism include rapid filtration of equilibrium binding mixtures, enzyme linked immunosorbent assays (ELISA), radioimmunoassays (RIA) and fluorescence resonance energy transfer assays (FRET). For further information on FRET the reader is directed to International Patent Application WO 94/28166 (Zeneca). Methods to identify potential drug candidates have been reviewed by Bevan P et al., 1995, TIBTECH 13 115.
A preferred method for identifying a compound capable of modulating the activity of PGC-3 is a scintillation proximity assay (SPA). SPA involves the use of fluomicrospheres coated with acceptor molecules, such as receptors, to which a ligand will bind selectively in a reversible manner (N Bosworth & P Towers, Nature, 341, 167-168, 1989). The technique requires the use of a ligand labelled with an isotope that emits low energy radiation which is dissipated easily into an aqueous medium. At any point during an assay, bound labelled ligands will be in close proximity to the fluomicrospheres, allowing the emitted energy to activate the fluor and produce light. In contrast, the vast majority of unbound labelled ligands will be too far from the fluomicrospheres to enable the transfer of energy. Bound ligands produce light but free ligands do not, allowing the extent of ligand binding to be measured without the need to separate bound and free ligand.
Cellular assay systems may be used to further identify PGC-3 modulators for use in the regulation of metabolism.
Therefore in a further aspect of the invention the candidate compound modulator is contacted with a host-cell which expresses an PGC-3 polypeptide (as hereindefined).
A preferred cellular assay system for use in the method of the invention is a two-hybrid assay system. The two-hybrid system utilises the ability of a pair of interacting proteins to bring the activation domain of a transcription factor into close proximity with its DNA-binding domain, restoring the functional activity of the transcription factor and inducing the expression of a reporter gene (S Fields & O Song, Nature, 340, 245-246, 1989). Commercially available systems such as the Clontech Matchmaker™ systems and protocols may be used with the present invention.
Other preferred cellular assay systems include measurement of changes in the levels of intracellular signalling molecules such as cyclic-AMP, intracellular calcium ions, or arachidonic acid metabolite release. These may all be measured using standard published procedures and commercially available reagents. In addition the polynucleotides of the present invention may be transfected into appropriate cell lines that have been transfected with a “reporter” gene such as bacterial lacZ, luciferase, aequorin or green fluorescent protein that will “report” these intracellular changes (Egerton et al, J. Mol, Endocrinol, 1995, 14(2), 179-189).
In a further aspect of the present invention we provide a novel PGC-3 modulator, or a pharmaceutically acceptable salt thereof, for use in a method of treatment of metabolic diseases of the human or animal body by therapy.
Examples of metabolic diseases which may be treated using a compound of the invention include insulin resistance syndrome, non-insulin dependent diabetes mellitus, dyslipidemia, obesity and atherosclerosis.
According to a further aspect of the invention, we provide a pharmaceutical composition which comprises a novel PGC-3 modulator, or a pharmaceutically acceptable salt thereof, in association with a pharmaceutically acceptable diluent or carrier.
The composition may be in the form suitable for oral use, for example a tablet, capsule, aqueous or oily solution, suspension or emulsion; for topical use, for example a cream, ointment, gel or an aqueous or oily solution or suspension; for nasal use, for example a snuff, nasal spray or nasal drops; for rectal use, for example a suppository; for administration by inhalation, for example as a finely divided powder such as a dry powder, a microcrystalline form or a liquid aerosol; for sub-lingual or buccal use, for example a tablet or capsule; or for parenteral use (including intravenous, subcutaneous, intramuscular, intravascular or infusion), for example a sterile aqueous or oily solution or suspension. In general, the above compositions may be prepared in a conventional manner using conventional excipients.
The invention also provides a method of treating a metabolic disease or medical condition mediated alone or in part by PGC-3, which comprises administering to a warm-blooded animal requiring such treatment an effective amount of an PGC-3 modulator as defined above.
The invention also provides the use of an PGC-3 modulator in the production of a medicament for use in the treatment of a metabolic disease.
The amount of active ingredient that is combined with one or more excipients to produce a single dosage form will necessarily vary depending on the subject treated and the particular route of administration. For example, a formulation intended for oral administration to humans will generally contain for example, from 0.5 mg to 2 g of active agent compounded with an appropriate and convenient amount of excipients which may vary from about 5 to about 98 percent by weight of the total composition. Dosage unit forms will generally contain about 1 mg to about 500 mg of an active ingredient.
The size of the dose for therapeutic or prophylactic purposes of an PGC-3 modulator will naturally vary according to the nature and severity of the immune disease, the age and sex of the patient, and the route of administration, according to well known principles of medicine.
In using an PGC-3 modulator for therapeutic or prophylactic purposes it will generally be administered so that a daily dose in the range for example 0.5 mg to 75 mg per kg body weight is received, given if required in divided doses. In general lower doses will be administered when a parenteral route is employed. Thus for example, for intravenous administration, a dose in the range for example 0.5 mg to 30 mg per kg body weight will generally be used. Similarly, for administration by inhalation a dose in the range for example 0.5 mg to 25 mg per kg body weight will be used.
The invention will now be illustrated but not limited by reference to the following Tables, Examples and Figures. Unless indicated otherwise, the techniques used are those detailed in well known molecular biology textbooks such as Sambrook, Fritsch & Maniatis, Molecular Cloning a Laboratory Manual, second edition, 1989, Cold Spring Harbor Laboratory Press.
SEQ ID NO:1 shows the full length human PGC-3a cDNA
SEQ ID NO:2 shows human PGC-3a protein sequence
SEQ ID NO:3 shows human PGC-3b cDNA
SEQ ID NO:4 shows human PGC-3b protein sequence
SEQ ID NO:5 shows the sequence of the 3′ RACE product isolated from human adipocyte cDNA.
SEQ ID NO:6 shows the sequence of the 5′RACE product isolated from human heart cDNA.
SEQ ID NO:7 shows human PGC-3c cDNA
SEQ ID NO 8 shows human PGC-3c protein sequence
SEQ ID NO 9 shows the full length rat PGC-3 cDNA
SEQ ID NO 10 shows rat PGC-3 protein sequence
FIG. 1 shows specific PCR products of 561 bp for PGC-3b and 491 bp for PGC-3a, isolated from breast adipose tissue cDNA, in lanes 1 and 2 respectively. The PGC-3b specific PCR product was obtained using PCR primers CME9830 and CME9831 (Table 2). The PGC-3a specific PCR product was obtained using PCR primers CME9830 and CME9850 (Table 2).
FIG. 2 shows a comparison of PGC-3a and PGC-3b with PGC-1, indicating that the molecules share regions of sequence homology in particular locations which are believed to be important for biological activity.
FIG. 3 shows a comparison of human PGC-3a and rat PGC-3 protein sequences indicating that the molecules share a high degree of sequence homology.
FIG. 4 shows the mean relative expression of PGC-3 mRNA in a range of human tissues. Quantitative real-time PCR was undertaken in quadruplicate on cDNA samples derived from the human tissues listed using Taqman™ fluorescent PCR technology (PE. Applied Biosystems). The normalised ratio of expression of PGC-3 relative to a housekeeping gene (GAPDH) was calculated for all tissues. SC=subcutaneous. Where multiple samples of the same tissue type were assayed the sample number is given, eg Omental adipocyte S24 refers to the data obtained from the omental adipocyte sample number 24. AU=arbitrary units.
| TABLE 1 |
| Examples of conservative amino acid substitutions |
| Original residue | Example conservative substitutions | |
| Ala (A) | Gly; Ser; Val; Leu; Ile; Pro | |
| Arg (R) | Lys; His; Gln; Asn | |
| Asn (N) | Gln; His; Lys; Arg | |
| Asp (D) | Glu | |
| Cys (C) | Ser | |
| Gln (Q) | Asn | |
| Glu (E) | Asp | |
| Gly (G) | Ala; Pro | |
| His (H) | Asn; Gln; Arg; Lys | |
| Ile (I) | Leu; Val; Met; Ala; Phe | |
| Leu (L) | Ile; Val; Met; Ala; Phe | |
| Lys (K) | Arg; Gln; His; Asn | |
| Met (M) | Leu; Tyr; Ile; Phe | |
| Phe (F) | Met; Leu; Tyr; Val; Ile; Ala | |
| Pro (P) | Ala; Gly | |
| Ser (S) | Thr | |
| Thr (T) | Ser | |
| Trp (W) | Tyr; Phe | |
| Tyr (Y) | Trp; Phe; Thr; Ser | |
| Val (V) | Ile; Leu; Met; Phe; Ala | |
| TABLE 2 | |
| Primer sequences |
| Primer | Sequence |
| forward primer CME 9748 | 5′ GTCACAAAGCGACCCAACTT 3′ | (SEQ ID NO: 11) | |
| reverse primer CME 9749 | 5′ GAGTCATGGTCTCCAAAGGAAC 3′ | (SEQ ID NO: 12) | |
| AP1 adaptor primer | 5′ CCATCCTAATACGACTCACTATAGGGC 3′ | (SEQ ID NO: 13) | |
| CME 9830 forward primer | 5′ GCCACTCGAAGGAACTTCAGAT 3′ | (SEQ ID NO: 14) | |
| CME 9850 reverse primer B | 5′ GGGTTAAGGCTGTTATCAATGC 3′ | (SEQ ID NO: 15) | |
| CME 9831 reverse primer A | 5′ AGGCCAGAAGAGAAACAGGATG 3′ | (SEQ ID NO: 16) | |
| CME 9726 sequencing primer | 5′ CTTCTCCTGTTCCTTTGGAGAC 3′ | (SEQ ID NO: 17) | |
| CME 9727 sequencing primer | 5′ TGGGGTTCACTTGAGGATTG 3′ | (SEQ ID NO: 18) | |
| CME 9778 sequencing primer | 5′ ATTCAAAATCTCTTCCAGCGAC 3′ | (SEQ ID NO: 19) | |
| CME 9776 sequencing primer | 5′ GAAGACAGAAGCTGTGATGCTG 3′ | (SEQ ID NO: 20) | |
| TABLE 3 | |
| Primers used in Example 4 |
| Primer | Sequence |
| SP1A | 5′-CATCACAGAGCACGTCTTGAG-3′ | (SEQ ID NO: 21) | |
| SP2A | 5′-CATGTAGCGTATGAGTTGCACCATC-3′ | (SEQ ID NO: 22) | |
| Oligo d(T)-anchor primer | 5′-GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTT | (SEQ ID NO: 23) | |
| TV-3′ | |||
| V = A, C or G | |||
| PCR anchor primer | 5′-GACCACGCGTATCGATGTCGAC-3 | (SEQ ID NO: 24) | |
| TABLE 4 | |
| Details of primers used to sequence rat PGC-3 |
| Primer | primer sequence (5′ −> 3′) |
| CVGI169 | TTGGGTAACGCCAGGGTTTTCCCAGTCAC | (SEQ ID | |
| NO: 25) | |||
| CVGI170 | CCCCAGGCTTTACACTTTATGCTTCCGGC | (SEQ ID | |
| NO: 26) | |||
| CVGI171 | GCCAGTACAGCCCTGATGAT | (SEQ ID | |
| NO: 27) | |||
| CVGI172 | TCCCCAGTGTCTGAAGTGGATG | (SEQ ID | |
| NO: 28) | |||
| CVGI281 | CTCATTCGCTACATGCATACCT | (SEQ ID | |
| NO: 29) | |||
| CVGI282 | CGGCCTTGTGTCAAGGTGGATG | (SEQ ID | |
| NO: 30) | |||
| CVGI283 | CTTCTGGACTGAGTTCTCCATC | (SEQ ID | |
| NO: 31) | |||
| CVGI390 | CAGGAGACTGAATCCAGAGCTG | (SEQ ID | |
| NO: 32) | |||
| CVGI391 | GACAGTAGTCAAGGCCAGCAGC | (SEQ ID | |
| NO: 33) | |||
| CVGI457 | GAGACCATGACTACTGCCAGGT | (SEQ ID | |
| NO: 34) | |||
| CVGI458 | ACCGCTCTGGAGGAGGAAGACT | (SEQ ID | |
| NO: 35) | |||
| CVGI535 | TTAAGCCTTAACCCTTTGAGGA | (SEQ ID | |
| NO: 36) | |||
| CVGI536 | GGCCCAGATACACCGACTATGA | (SEQ ID | |
| NO: 37) | |||
PCR primers CME 9748 and CME 9749, listed in Table 2 were synthesised and used to amplify a 347 bp product from human adipose cDNA (Human adipocyte Marathon Ready cDNA, Clontech Cat.#7447-1, Clontech, Basingstoke, UK).
A technique known as Rapid Amplification of cDNA Ends (RACE) was then used to amplify the 3′ end of the PGC-3 cDNA. RACE is a commonly used molecular biological technique which enables the user to extend and identify sequence along a cDNA template in one direction. This allows the user to obtain a complete cDNA sequence starting from a small piece of cDNA sequence. For a more complete description of the method refer to Chenchick A, Moqadam F and Siebert P. 1996 Laboratory guide to RNA: isolation, analysis and synthesis. Wiley-Liss Inc. p 273-321. In this case we used a commercially available RACE PCR kit, the Human adipocyte Marathon Ready™ cDNA (Clontech, Basingstoke, UK). It is a premade human adipocyte “library” of adaptor-ligated double stranded cDNA ready for performing both 5′ and 3′ RACE from the same template. The PGC-3 gene specific primer CME 9748 (Table 2) was used in a Marathon RACE reaction with the AP1 adapter primer (Table 2) supplied by Clontech and the Marathon Ready™ cDNA according to the manufacturer's instructions.
A 1.5 kb PCR product was amplified in the reaction and separated from non-specific DNA by agarose gel electrophoresis using a 1.5% agarose gel and visualised by ethidium bromide staining. The 1.5 kb PCR product was isolated from the gel using a DNA extraction kit (Qiaex II™, Qiagen) and the purified PCR product cloned into PCR2.1™ vector using a TOPO TA™ Cloning kit (Invitrogen), according to the manufacturer's instructions. The cloned PCR product was fully sequenced using the vector M13 sequencing primers supplied in the kit (Invitrogen) and the PGC-3 gene specific sequencing primers CME 9726, CME 9727, CME 9778 and CME 9776 (listed in Table 2). The sequence of the 3′RACE product is shown in FIG. 5 (SEQ ID NO: 5). The predicted protein sequence of the 3′ end of SEQ ID NO:7 was found to be 50% identical to the sequence for human PGC-1 over a 135 aa region (see FIG. 7). This small region of SEQ ID NO:7 also shared 53% identity to the rat PGC-1 sequence (EMBL accession number: AB025784).
Two variants of PGC-3 have been found with cDNA sequence which differ at the 3′ end. We have named these two variants PGC-3a and PGC-3b.
Primers CME 9830 and CME 9850 (Table 2) were synthesised based on the PGC-3a 3′ RACE product sequence. These were used to PCR screen the Origene human heart cDNA library master plate (ORIGENE LHT-1001, Origene, USA) according to the manufacturers instructions.
PCR screening of the master plate identified several wells positive for PGC-3a cDNA. The subplates corresponding to these wells were obtained from Origene and a subsequent round of PCR screening was performed to identify individual clones containing PGC-3a cDNA.
Clones containing PGC-3a were identified and sequenced. This resulted in the isolation of the complete cDNA sequence for PGC-3a (SEQ ID NO:1). The PGC-3a cDNA sequence comprises a coding region of 3009 nucleotides, that encode a protein of 1002 amino acids with a calculated molecular mass of 110 kDa and an estimated isoelectric point of 4.933. The protein sequence for PGC-3a is shown in SEQ ID NO:2.
PCR primers were synthesised which would specifically amplify either PGC-3a or PGC-3b (CME 9830, CME 9831, CME 9850, Table 2).
To investigate whether both PGC-3a and PGC-3b were expressed by human breast adipocytes, PCRs were carried out using the above primers to amplify PGC-3a and PGC-3b from human breast adipocyte cDNA. The PCR conditions used were 94° C. for 1 minute then 30 cycles of 94° C. for 30 sec, then 68° C. for 4 minutes. The DNA polymerase used was Extensor™ from Advanced Biotechnologies. PCR was performed according to standard procedure described in Molecular Cloning, a laboratory manual, Sambrook, Fritsch and Maniatis Second Ed 1989). The forward PCR primer (CME 9830) was used in combination with either reverse PCR primer A (CME 9831) designed specifically to amplify PGC-3b (sequence 2) or reverse primer B (CME 9850) designed specifically to amplify sequence 3 PGC-3a (3′ RACE product).
Specific PCR products of 561 bp for PGC-3b (CME9830/CME 9831) and 491 bp for PGC-3a (CME9830/CME9850) were obtained, as shown in FIG. 1 in lanes 1 and 2 respectively.
The complete cDNA sequence for PGC-3b is shown in SEQ ID NO:3. The PGC-3b cDNA sequence comprises a coding region of 2991 nucleotides encoding a protein of 996 amino acids. The protein sequence for PGC-3b is shown in SEQ ID NO:4.
The technique known as RACE as described in example 1 was used to amplify the 5′ end of the PGC-3c cDNA. This procedure was undertaken using the Roche 5′/3′RACE kit (Cat. No. 1 734 792) and followed the manufacturer's instructions. First strand cDNA was synthesized from total human heart RNA (Stratagene, Cat. No. 735012-41) using a gene specific primer (SP1A, listed in Table 3), AMV reverse transcriptase (supplied in kit) and deoxynucleotide mix (supplied in kit). The first strand cDNA was purified using High Pure PCR Product Purification Kit (Roche Diagnostics Corporation, Indianapolis, Ind., USA—Cat No. 1 732 668) according to the manufacturer's instructions. A homopolymeric A-tail was then added to the 3′ end of the cDNA using terminate transferase using reagents and instructions supplied with the kit. The cDNA was then amplified by PCR using a gene specific primer (SP2A, see table 3) and an oligo dT-anchor primer (see table 3). The obtained cDNA was further amplified by a second PCR using a nested specific primer (SP3A, see Table 3) and a PCR anchor primer (see table 3). Resulting 5′RACE products were cloned into a vector. The cloned PCR products were fully sequenced. The sequence of the 5′RACE product is shown in Figure SEQ ID NO: 6. The full length cDNA sequence of PGC-3c is shown in SEQ ID NO: 7. The predicted protein sequence of PGC-3c is shown in SEQ ID NO: 8.
Homology searching using the human PGC-3 cDNA sequence identified a rat clone in a proprietary database that had a high level of homology to PGC-3. This clone was obtained and sequenced using primers CVGI169, CVGI170, CVGI171, CVGI172, CVGI281, CVGI282, CVGI283, CVGI390, CVGI391, CVGI457, CVGI458, CVGI535 (see table 4 for sequence information). The full length rat PGC-3 cDNA sequence is shown in SEQ ID NO: 9. The predicted protein sequence of rat PGC-3 is shown in Figure SEQ ID NO: 10. FIG. 13 shows a comparison of human PGC-3a and rat PGC-3 protein sequences, indicating that the molecules have a high degree of sequence homology (greater than 78% identity).
Total RNA was extracted from human adipocytes using TRI reagent (Sigma-Aldrich) following the manufacturer's suggested protocol. Two micrograms of total RNA from each adipocyte samples was used to generate cDNA, using the Promega reverse transcription system (Promega; catalogue number A3500) according to the manufacturer's instructions. The heart, skeletal muscle, kidney, liver, lung, heart and pancreas cDNAs were obtained from Clontech (Clontech, catalogue numbers K1420-1 and K1421-1). Probe and primer sequences were designed for PGC-3 and were: PGC-3 forward primer; 5′-TGCTGGCCCAGATACACTGA-3′ (SEQ ID NO: 38). PGC-3 reverse primer; 5′-GGCTGTTATCAATGCAGGCTC-3′ (SEQ ID NO: 39). PGC-3 probe; 5-FAM-CGTCAGGGAAAAGCAAGTATGAAGCCAT-TAMRA-3′ (SEQ ID NO: 40). Taqman PCR assays for each target gene were performed in quadruplicate in 96 well plates on an ABI Prism 7700 Sequence Detection system (PE Applied Biosystems). For each 25 □l Taqman reaction 0.01-1 ng cDNA was mixed with final concentrations of 1× Taqman Universal PCR Mastermix (PE Applied Biosystems), 300 nM forward and reverse primers and 200 nM probe. PCR parameters were 50° C. for 2 minutes, 95° C. for 10 minutes, 40 cycles of 95° C. for 15 seconds and 60° C. for 1 min. Results were analysed by the comparative Ct method as previously described in ABI Prism 7700 User Bulletin #2 (PE Applied Biosystems). Briefly, for each PCR, a threshold cycle (Ct) was calculated. This refers to the PCR cycle where amplified DNA is detectable above an arbitrary threshold. Ct values are semi-quantitative and are related to the amount of target sequence present within a particular cDNA sample. Quadruplicate Ct samples were averaged and normalised by dividing with Ct values obtained for a housekeeping gene (GAPDH; supplied by PE Applied Biosystems). This gives a mean □Ct value for each cDNA. These values can be directly compared between different cDNA samples to give relative expression values for each target gene. FIG. 4 shows the mean relative expression of PGC-3 mRNA in the human tissues listed above. Where multiple samples of the same tissue type were assayed the sample number is given, eg Omental adipocyte S24 refers to the data obtained from the omental adipocyte sample number 24. These results demonstrate that PGC-3 is highly expressed in human breast adipocytes, omental adipocytes and subcutaneous adipocytes. High levels of expression of PGC-3 were also observed in lung and heart samples. Expression of PGC-3 was lower in human kidney, skeletal muscle, pancreas and liver samples.
1. An antibody or antigen-binding fragment thereof, wherein the antibody specifically binds a PGC-3 polypeptide selected from any one of
(a) a human PGC-3a polypeptide or a variant having at least about 90% homology to a member selected from (SEQ ID NO:2, SEQ ID NO:2 positions 1-600, SEQ ID NO:2 positions 400-1002, SEQ ID NO:2 positions 200-800), or a biologically active fragment thereof;
or
(b) a human PGC-3b polypeptide or a variant having at least about 90% homology to a member selected from (SEQ ID NO:4, SEQ ID NO:4 positions 1-600, SEQ ID NO:4 positions 400-996, SEQ ID NO:4 positions 200-800), or a biologically active fragment thereof;
or
(c) a human PGC-3c polypeptide or a variant having at least about 90% homology to a member selected from (SEQ ID NO:8, SEQ ID NO:8 positions 1-600, SEQ ID NO:8 positions 400-1023, SEQ ID NO:8 positions 200-800), or a biologically active fragment thereof.
2. The antibody or antigen-binding fragment thereof of claim 1, wherein the antibody binds a polypeptide comprising a human PGC-3a polypeptide or a variant having at least about 90% homology to a member selected from (SEQ ID NO:2, SEQ ID NO:2 positions 1-600, SEQ ID NO:2 positions 400-1002, SEQ ID NO:2 positions 200-800), or a biologically active fragment thereof.
3. The antibody or antigen-binding fragment thereof of claim 1, wherein the antibody binds a polypeptide comprising the human PGC-3b amino acid sequence set out in SEQ ID NO:4 or a variant of SEQ ID NO:4 having at least about 90% homology to a member selected from (SEQ ID NO:4 positions 1-600, SEQ ID NO:4 positions 400-996, SEQ ID NO:4 positions 200-800), or a biologically active fragment thereof.
4. The antibody or antigen-binding fragment thereof of claim 1, wherein the antibody binds a polypeptide comprising a human PGC-3c polypeptide or a variant having at least about 90% homology to a member selected from (SEQ ID NO:8, SEQ ID NO:8 positions 1-600, SEQ ID NO:8 positions 400-1023, SEQ ID NO:8 positions 200-800), or a biologically active fragment thereof.
5. The antibody or antigen-binding fragment thereof according to claim 1, wherein said antibody or antibody fragment is selected from a polyclonal antibody, a monoclonal antibody or antibody fragment, F(ab′)2, Fab and single chain Fv.
6. The antibody or antigen-binding fragment thereof according to claim 5, wherein said antibody is a monoclonal antibody.
7. The antibody or antigen-binding fragment thereof according to claim 5, wherein said antibody is a polyclonal antibody.
8. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody binds to a PGC-3 polypeptide with a Ka of greater than or equal to about 107M−1.
9. The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody modulates the activity of PGC-3.
10. The antibody or antigen-binding fragment thereof according to claim 9, wherein the antibody stimulates the activity of PGC-3.
11. The antibody or antigen-binding fragment thereof according to claim 9, wherein the antibody inhibits the activity of PGC-3.
12. The antibody or antigen-binding fragment thereof according to claim 9, wherein the activity of PGC-3 is mediating cell processes related to a condition selected from insulin resistance syndrome, non-insulin dependent diabetes mellitus, dyslipidemia, obesity or atherosclerosis.
13. The antibody or antigen-binding fragment thereof according to claim 1, in admixture with one or more pharmaceutically acceptable diluents or carriers.
14. The antibody or antigen-binding fragment thereof according to claim 13, wherein said PGC-3 antibody modulates the activity of PGC-3.
15. The antibody or antigen-binding fragment thereof according to claim 14, wherein the antibody stimulates the activity of PGC-3.
16. The antibody or antigen-binding fragment thereof according to claim 14, wherein the antibody inhibits the activity of PGC-3.
17. The antibody or antigen-binding fragment thereof according to claim 13, wherein said antibody or antibody fragment is selected from a polyclonal antibody, a monoclonal antibody or antibody fragment, F(ab′)2, Fab and single chain Fv.
18. The antibody or antigen-binding fragment thereof according to claim 17, wherein said antibody is a monoclonal antibody.
19. The antibody or antigen-binding fragment thereof according to claim 17, wherein said antibody is a polyclonal antibody.
20. A method of treating a metabolic disease or medical condition mediated alone or in part by PGC-3, which comprises administering to a warm-blooded animal requiring such treatment an effective amount of a PGC-3 antibody or antigen-binding fragment thereof as claimed in claim 1.
21. The method of claim 20, wherein the metabolic disease or medical condition mediated alone or in part by PGC-3 is selected from insulin resistance syndrome, non-insulin dependent diabetes mellitus, dyslipidemia, obesity or atherosclerosis.
22. The method of claim 20, wherein said PGC-3 antibody or antigen-binding fragment thereof modulates the activity of PGC-3.
23. The method of claim 22, wherein the antibody or antigen-binding fragment thereof stimulates the activity of PGC-3.
24. The method of claim 22, wherein the antibody or antigen-binding fragment thereof inhibits the activity of PGC-3.
25. The method of claim 20, wherein said antibody or antibody fragment thereof is selected from a polyclonal antibody, a monoclonal antibody or antibody fragment, F(ab′)2, Fab and single chain Fv.