Description
This application is a continuation-in-part of United States provisional application No. 06/198,069, filed Apr. 17, 2000, a continuation-in-part of U.S. patent application Ser. No. 09/837,306, filed on Apr. 17, 2001, and a continuation-in-part of U.S. application Ser. No. XX/XXX,XXX, filed by Express Mail(EI125454535US) on Oct. 25, 2001. All of the earlier applications are specifically incorporated by reference herein.
The present invention relates to libraries of genetic packages that display and/or express a member of a diverse family of peptides, polypeptides or proteins and collectively display and/or express at least a portion of the diversity of the family. In an alternative embodiment, the invention relates to libraries that include a member of a diverse family of peptides, polypeptides or proteins and collectively comprise at least a portion of the diversity of the family. In a preferred embodiment, the displayed and/or expressed polypeptides are human Fabs.
More specifically, the invention is directed to the methods of cleaving single-stranded nucleic acids at chosen locations, the cleaved nucleic acids encoding, at least in part, the peptides, polypeptides or proteins displayed on the genetic packages of, and/or expressed in, the libraries of the invention. In a preferred embodiment, the genetic packages are filamentous phage or phagemids or yeast.
The present invention further relates to vectors for displaying and/or expressing a diverse family of peptides, polypeptides or proteins.
The present invention further relates to methods of screening the libraries of the invention and to the peptides, polypeptides and proteins identified by such screening.
BACKGROUND OF THE INVENTION
It is now common practice in the art to prepare libraries of genetic packages that display, express or comprise a member of a diverse family of peptides, polypeptides or proteins and collectively display, express or comprise at least a portion of the diversity of the family. In many common libraries, the peptides, polypeptides or proteins are related to antibodies. Often, they are Fabs or single chain antibodies.
In general, the DNAs that encode members of the families to be displayed and/or expressed must be amplified before they are cloned and used to display and/or express the desired member. Such amplification typically makes use of forward and backward primers.
Such primers can be complementary to sequences native to the DNA to be amplified or complementary to oligonucleotides attached at the 5′ or 3′ ends of that DNA. Primers that are complementary to sequences native to the DNA to be amplified are disadvantaged in that they bias the members of the families to be displayed. Only those members that contain a sequence in the native DNA that is substantially complementary to the primer will be amplified. Those that do not will be absent from the family. For those members that are amplified, any diversity within the primer region will be suppressed.
For example, in European patent 368,684 B1, the primer that is used is at the 5′ end of the VH region of an antibody gene. It anneals to a sequence region in the native DNA that is said to be “sufficiently well conserved” within a single species. Such primer will bias the members amplified to those having this “conserved” region. Any diversity within this region is extinguished.
It is generally accepted that human antibody genes arise through a process that involves a combinatorial selection of V and J or V, D, and J followed by somatic mutations. Although most diversity occurs in the Complementary Determining Regions (CDRs), diversity also occurs in the more conserved Framework Regions (FRs) and at least some of this diversity confers or enhances specific binding to antigens (Ag). As a consequence, libraries should contain as much of the CDR and FR diversity as possible.
To clone the amplified DNAs of the peptides, polypeptides or proteins that they encode for display on a genetic package and/or for expression, the DNAs must be cleaved to produce appropriate ends for ligation to a vector. Such cleavage is generally effected using restriction endonuclease recognition sites carried on the primers. When the primers are at the 5′ end of DNA produced from reverse transcription of RNA, such restriction leaves deleterious 5′ untranslated regions in the amplified DNA. These regions interfere with expression of the cloned genes and thus the display of the peptides, polypeptides and proteins coded for by them.
SUMMARY OF THE INVENTION
It is an object of this invention to provide novel methods for constructing libraries that display, express or comprise a member of a diverse family of peptides, polypeptides or proteins and collectively display, express or comprise at least a portion of the diversity of the family. These methods are not biased toward DNAs that contain native sequences that are complementary to the primers used for amplification. They also enable any sequences that may be deleterious to expression to be removed from the amplified DNA before cloning and displaying and/or expressing.
It is another object of this invention to provide a method for cleaving single-stranded nucleic acid sequences at a desired location, the method comprising the steps of:
-
- (i) contacting the nucleic acid with a single-stranded oligonucleotide, the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired and including a sequence that with its complement in the nucleic acid forms a restriction endonuclease recognition site that on restriction results in cleavage of the nucleic acid at the desired location; and
- (ii) cleaving the nucleic acid solely at the recognition site formed by the complementation of the nucleic acid and the oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature.
It is a further object of this invention to provide an alternative method for cleaving single-stranded nucleic acid sequences at a desired location, the method comprising the steps of:
-
- (i) contacting the nucleic acid with a partially double-stranded oligonucleotide, the single-stranded region of the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired, and the double-stranded region of the oligonucleotide having a restriction endonuclease recognition site; and
- (ii) cleaving the nucleic acid solely at the cleavage site formed by the complementation of the nucleic acid and the single-stranded region of the oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature.
In an alternative embodiment of this object of the invention, the restriction endonuclease recognition site is not initially located in the double-stranded part of the oligonucleotide. Instead, it is part of an amplification primer, which primer is complementary to the double-stranded region of the oligonucleotide. On amplification of the DNA-partially double-stranded combination, the restriction endonuclease recognition site carried on the primer becomes part of the DNA. It can then be used to cleave the DNA.
Preferably, the restriction endonuclease recognition site is that of a Type II-S restriction endonuclease whose cleavage site is located at a known distance from its recognition site.
It is another object of the present invention to provide a method of capturing DNA molecules that comprise a member of a diverse family of DNAs and collectively comprise at least a portion of the diversity of the family. These DNA molecules in single-stranded form have been cleaved by one of the methods of this invention. This method involves ligating the individual single-stranded DNA members of the family to a partially duplex DNA complex. The method comprises the steps of:
-
- (i) contacting a single-stranded nucleic acid sequence that has been cleaved with a restriction endonuclease with a partially double-stranded oligonucleotide, the single-stranded region of the oligonucleotide being functionally complementary to the nucleic acid in the region that remains after cleavage, the double-stranded region of the oligonucleotide including any sequences necessary to return the sequences that remain after cleavage into proper reading frame for expression and containing a restriction endonuclease recognition site 5′ of those sequences; and
- (ii) cleaving the partially double-stranded oligonucleotide sequence solely at the restriction endonuclease cleavage site contained within the double-stranded region of the partially double-stranded oligonucleotide.
As before, in this object of the invention, the restriction endonuclease recognition site need not be located in the double-stranded portion of the oligonucleotide. Instead, it can be introduced on amplification with an amplification primer that is used to amplify the DNA-partially double-stranded oligonucleotide combination.
It is another object of this invention to prepare libraries, that display, express or comprise a diverse family of peptides, polypeptides or proteins and collectively display, express or comprise at least part of the diversity of the family, using the methods and DNAs described above.
It is an object of this invention to screen those libraries to identify useful peptides, polypeptides and proteins and to use those substances in human therapy.
Additional objects of the invention are reflected in claims 1-116. Each of these claims is specifically incorporated by reference in this specification.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a schematic of various methods that may be employed to amplify VH genes without using primers specific for VH sequences.
FIG. 2 is a schematic of various methods that may be employed to amplify VL genes without using primers specific for VL sequences.
FIG. 3 is a schematic of RACE amplification of antibody heavy and light chains.
FIG. 4 depicts gel analysis of amplification products obtained after the primary PCR reaction from 4 different patient samples.
FIG. 5 depicts gel analysis of cleaved kappa DNA from Example 2.
FIG. 6 depicts gel analysis of extender-cleaved kappa DNA from Example 2.
FIG. 7 depicts gel analysis of the PCR product from the extender-kappa amplification from Example 2.
FIG. 8 depicts gel analysis of purified PCR product from the extender-kappa amplification from Example 2.
FIG. 9 depicts gel analysis of cleaved and ligated kappa light chains from Example 2.
FIG. 10 is a schematic of the design for CDR1 and CDR2 synthetic diversity.
FIG. 11 is a schemaitc of the cloning schedule for construction of the heavy chain repertoire.
FIG. 12 is a schematic of the cleavage and ligation of the antibody light chain.
FIG. 13 depicts gel analysis of cleaved and ligated lambda light chains from Example 4.
FIG. 14 is a schematic of the cleavage and ligation of the antibody heavy chain.
FIG. 15 depicts gel analysis of cleaved and ligated lambda light chains from Example 5.
FIG. 16 is a schematic of a phage display vector.
FIG. 17 is a schematic of a Fab cassette.
FIG. 18 is a schematic of a process for incorporating fixed FR1 residues in an antibody lambda sequence.
FIG. 19 is a schematic of a process for incorporating fixed FR1 residues in an antibody kappa sequence.
FIG. 20 is a schematic of a process for incorporating fixed FR1 residues in an antibody heavy chain sequence.
TERMS
In this application, the following terms and abbreviations are used:
|
|
|
|
|
Sense strand |
The upper strand of ds DNA as |
|
|
usually written. In the sense |
|
|
strand, 5′-ATG-3′ codes for |
|
|
Met. |
|
Antisense strand |
The lower strand of ds DNA as |
|
|
usually written. In the |
|
|
antisense strand, 3′-TAC-5′ |
|
|
would correspond to a Met |
|
|
codon in the sense strand. |
|
Forward primer |
A “forward” primer is |
|
|
complementary to a part of the |
|
|
sense strand and primes for |
|
|
synthesis of a new antisense- |
|
|
strand molecule. “Forward |
|
|
primer” and “lower-strand |
|
|
primer” are equivalent. |
|
Backward primer |
A “backward” primer is |
|
|
complementary to a part of the |
|
|
antisense strand and primes |
|
|
for synthesis of a new sense- |
|
|
strand molecule. “Backward |
|
|
primer” and “top-strand |
|
|
primer” are equivalent. |
|
Bases |
Bases are specified either by |
|
|
their position in a vector or |
|
|
gene as their position within |
|
|
a gene by codon and base. For |
|
|
example, “89.1” is the first |
|
|
base of codon 89, 89.2 is the |
|
|
second base of codon 89. |
|
Sv |
Streptavidin |
|
Ap |
Ampicillin |
|
apR |
A gene conferring ampicillin |
|
|
resistance. |
|
RERS |
Restriction endonuclease |
|
|
recognition site |
|
RE |
Restriction endonuclease - |
|
|
cleaves preferentially at RERS |
|
URE |
Universal restriction |
|
|
endonuclease |
|
Functionally |
Two sequences are sufficiently |
|
complementary |
complementary so as to anneal |
|
|
under the chosen conditions. |
|
AA |
Amino acid |
|
PCR |
Polymerization chain reaction |
|
GLGs |
Germline genes |
|
An |
Antibody: an immunoglobin. |
|
|
The term also covers any |
|
|
protein having a binding |
|
|
domain which is homologous to |
|
|
an immunoglobin binding |
|
|
domain. A few examples of |
|
|
antibodies within this |
|
|
definition are, inter alia, |
|
|
immunoglobin isotypes and the |
|
|
Fab, F(ab1)2, scfv, Fv, dAb and |
|
|
Fd fragments. |
|
Fab |
Two chain molecule comprising |
|
|
an An light chain and part of |
|
|
a heavy-chain. |
|
scFv |
A single-chain Ab comprising |
|
|
either VH::linker::VL or |
|
|
VL::linker::VH |
|
w.t. |
Wild type |
|
HC |
Heavy chain |
|
LC |
Light chain |
|
VK |
A variable domain of a Kappa |
|
|
light chain. |
|
VH |
A variable domain of a heavy |
|
|
chain. |
|
VL |
A variable domain of a lambda |
|
|
light chain. |
|
|
In this application when it is said that nucleic acids are cleaved solely at the cleavage site of a restriction endonuclease, it should be understood that minor cleavage may occur at random, e.g., at non-specific sites other than the specific cleavage site that is characteristic of the restriction endonuclease. The skilled worker will recognize that such non-specific, random cleavage is the usual occurrence. Accordingly, “solely at the cleavage site” of a restriction endonuclease means that cleavage occurs preferentially at the site characteristic of that endonuclease.
As used in this application and claims, the term “cleavage site formed by the complementation of the nucleic acid and the single-stranded region of the oligonucleotide” includes cleavage sites formed by the single-stranded portion of the partially double-stranded ologonucleotide duplexing with the single-stranded DNA, cleavage sites in the double-stranded portion of the partially double-stranded oligonucleotide, and cleavage sites introduced by the amplification primer used to amplify the single-stranded DNA-partially double-stranded oligonucleotide combination.
In the two methods of this invention for preparing single-stranded nucleic acid sequences, the first of those cleavage sites is preferred. In the methods of this invention for capturing diversity and cloning a family of diverse nucleic acid sequences, the latter two cleavage sites are preferred.
In this application, all references referred to are specifically incorporated by reference.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The nucleic acid sequences that are useful in the methods of this invention, i.e., those that encode at least in part the individual peptides, polypeptides and proteins displayed, or expressed in or comprising the libraries of this invention, may be native, synthetic or a combination thereof. They may be mRNA, DNA or cDNA. In the preferred embodiment, the nucleic acids encode antibodies. Most preferably, they encode Fabs.
The nucleic acids useful in this invention may be naturally diverse, synthetic diversity may be introduced into those naturally diverse members, or the diversity may be entirely synthetic. For example, synthetic diversity can be introduced into one or more CDRs of antibody genes. Preferably, it is introduced into CDR1 and CDR2 of immunoglobulins. Preferably, natural diversity is captured in the CDR3 regions of the immunoglogin genes of this invention from B cells. Most preferably, the nucleic acids of this invention comprise a population of immunoglobin genes that comprise synthetic diversity in at least one, and more preferably both of the CDR1 and CDR2 and diversity in CDR3 captured from B cells.
Synthetic diversity may be created, for example, through the use of TRIM technology (U.S. Pat. No. 5,869,644). TRIM technology allows control over exactly which amino-acid types are allowed at variegated positions and in what proportions. In TRIM technology, codons to be diversified are synthesized using mixtures of trinucleotides. This allows any set of amino acid types to be included in any proportion.
Another alternative that may be used to generate diversified DNA is mixed oligonucleotide synthesis. With TRIM technology, one could allow Ala and Trp. With mixed oligonucleotide synthesis, a mixture that included Ala and Trp would also necessarily include Ser and Gly. The amino-acid types allowed at the variegated positions are picked with reference to the structure of antibodies, or other peptides, polypeptides or proteins of the family, the observed diversity in germline genes, the observed somatic mutations frequently observed, and the desired areas and types of variegation.
In a preferred embodiment of this invention, the nucleic acid sequences for at least one CDR or other region of the peptides, polypeptides or proteins of the family are cDNAs produced by reverse transcription from mRNA. More preferably, the mRNAs are obtained from peripheral blood cells, bone marrow cells, spleen cells or lymph node cells (such as B-lymphocytes or plasma cells) that express members of naturally diverse sets of related genes. More preferable, the mRNAs encode a diverse family of antibodies. Most preferably, the mRNAs are obtained from patients suffering from at least one autoimmune disorder or cancer. Preferably, mRNAs containing a high diversity of autoimmune diseases, such as systemic lupus erythematosus, systemic sclerosis, rheumatoid arthritis, antiphospholipid syndrome and vasculitis are used.
In a preferred embodiment of this invention, the cDNAs are produced from the mRNAs using reverse transcription. In this preferred embodiment, the mRNAs are separated from the cell and degraded using standard methods, such that only the full length (i.e., capped) mRNAs remain. The cap is then removed and reverse transcription used to produce the cDNAs.
The reverse transcription of the first (antisense) strand can be done in any manner with any suitable primer. See, e.g., H J de Haard et al., Journal of Biological Chemistry, 274(26):18218-30 (1999). In the preferred embodiment of this invention where the mRNAs encode antibodies, primers that are complementary to the constant regions of antibody genes may be used. Those primers are useful because they do not generate bias toward subclasses of antibodies. In another embodiment, poly-dT primers may be used (and may be preferred for the heavy-chain genes). Alternatively, sequences complementary to the primer may be attached to the termini of the antisense strand.
In one preferred embodiment of this invention, the reverse transcriptase primer may be biotinylated, thus allowing the cDNA product to be immobilized on streptavidin (Sv) beads. Immobilization can also be effected using a primer labeled at the 5′ end with one of a) free amine group, b) thiol, c) carboxylic acid, or d) another group not found in DNA that can react to form a strong bond to a known partner on an insoluble medium. If, for example, a free amine (preferably primary amine) is provided at the 5′ end of a DNA primer, this amine can be reacted with carboxylic acid groups on a polymer bead using standard amide-forming chemistry. If such preferred immobilization is used during reverse transcription, the top strand RNA is degraded using well-known enzymes, such as a combination of RNAseH and RNAseA, either before or after immobilization.
The nucleic acid sequences useful in the methods of this invention are generally amplified before being used to display and/or express the peptides, polypeptides or proteins that they encode. Prior to amplification, the single-stranded DNAs may be cleaved using either of the methods described before. Alternatively, the single-stranded DNAs may be amplified and then cleaved using one of those methods.
Any of the well known methods for amplifying nucleic acid sequences may be used for such amplification. Methods that maximize, and do not bias, diversity are preferred. In a preferred embodiment of this invention where the nucleic acid sequences are derived from antibody genes, the present invention preferably utilizes primers in the constant regions of the heavy and light chain genes and primers to a synthetic sequence that are attached at the 5′ end of the sense strand. Priming at such synthetic sequence avoids the use of sequences within the variable regions of the antibody genes. Those variable region priming sites generate bias against V genes that are either of rare subclasses or that have been mutated at the priming sites. This bias is partly due to suppression of diversity within the primer region and partly due to lack of priming when many mutations are present in the region complementary to the primer. The methods disclosed in this invention have the advantage of not biasing the population of amplified antibody genes for particular V gene types.
The synthetic sequences may be attached to the 5′ end of the DNA strand by various methods well known for ligating DNA sequences together. RT CapExtention is one preferred method.
In RT CapExtention (derived from Smart PCR(™)), a short overlap (5′- . . . GGG-3′ in the upper-strand primer (USP-GGG) complements 3′-CCC . . . . 5′ in the lower strand) and reverse transcriptases are used so that the reverse complement of the upper-strand primer is attached to the lower strand.
FIGS. 1 and 2 show schematics to amplify VH and VL genes using RT CapExtention. FIG. 1 shows a schematic of the amplification of VH genes. FIG. 1, Panel A shows a primer specific to the poly-dT region of the 3′ UTR priming synthesis of the first, lower strand. Primers that bind in the constant region are also suitable. Panel B shows the lower strand extended at its 3′ end by three Cs that are not complementary to the mRNA. Panel C shows the result of annealing a synthetic top-strand primer ending in three GGGs that hybridize to the 3′ terminal CCCs and extending the reverse transcription extending the lower strand by the reverse complement of the synthetic primer sequence. Panel D shows the result of PCR amplification using a 5′ biotinylated synthetic top-strand primer that replicates the 5′ end of the synthetic primer of panel C and a bottom-strand primer complementary to part of the constant domain. Panel E shows immobilized double-stranded (ds) cDNA obtained by using a 5′-biotinylated top-strand primer.
FIG. 2 shows a similar schematic for amplification of VL genes. FIG. 2, Panel A shows a primer specific to the constant region at or near the 3′ end priming synthesis of the first, lower strand. Primers that bind in the poly-dT region are also suitable. Panel B shows the lower strand extended at its 3′ end by three Cs that are not complementary to the mRNA. Panel C shows the result of annealing a synthetic top-strand primer ending in three GGGs that hybridize to the 3′ terminal CCCs and extending the reverse transcription extending the lower strand by the reverse complement of the synthetic primer sequence. Panel D shows the result of PCR amplification using a 5′ biotinylated synthetic top-strand primer that replicates the 5′ end of the synthetic primer of panel C and a bottom-strand primer complementary to part of the constant domain. The bottom-strand primer also contains a useful restriction endonuclease site, such as AscI. Panel E shows immobilized ds cDNA obtained by using a 5′-biotinylated top-strand primer.
In FIGS. 1 and 2, each V gene consists of a 5′ untranslated region (UTR) and a secretion signal, followed by the variable region, followed by a constant region, followed by a 3′ untranslated region (which typically ends in poly-A). An initial primer for reverse transcription may be complementary to the constant region or to the poly A segment of the 3′-UTR. For human heavy-chain genes, a primer of 15 T is preferred. Reverse transcriptases attach several C residues to the 3′ end of the newly synthesized DNA. RT CapExtention exploits this feature. The reverse transcription reaction is first run with only a lower-strand primer. After about 1 hour, a primer ending in GGG (USP-GGG) and more RTase are added. This causes the lower-strand cDNA to be extended by the reverse complement of the USP-GGG up to the final GGG. Using one primer identical to part of the attached synthetic sequence and a second primer complementary to a region of known sequence at the 3′ end of the sense strand, all the V genes are amplified irrespective of their V gene subclass.
In another preferred embodiment, synthetic sequences may be added by Rapid Amplification of cDNA Ends (RACE) (see Frohman, M. A., Dush, M. K., & Martin, G. R. (1988) Proc. Natl. Acad. Sci. USA (85): 8998-9002).
FIG. 1 shows a schematic of RACE amplification of antibody heavy and light chains. First, mRNA is selected by treating total or poly(A+) RNA with calf intestinal phosphatase (CIP) to remove the 5′-phosphate from all molecules that have them such as ribosomal RNA, fragmented mRNA, tRNA and genomic DNA. Full length mRNA (containing a protective 7-methyl cap structure) is uneffected. The RNA is then treated with tobacco acid pyrophosphatase (TAP) to remove the cap structure from full length mRNAs leaving a 5′-monophosphate group. Next, a synthetic RNA adaptor is ligated to the RNA population, only molecules which have a 5-phosphate (uncapped, full length mRNAs) will accept the adaptor. Reverse trascriptase reactions using an oligodT primer, and nested PCR (using one adaptor primer (located in the 5′ synthetic adaptor) and one primer for the gene) are then used to amplify the desired transcript.
In a preferred embodiment of this invention, the upper strand or lower strand primer may be also biotinylated or labeled at the 5′ end with one of a) free amino group, b) thiol, c) carboxylic acid and d) another group not found in DNA that can react to form a strong bond to a known partner as an insoluble medium. These can then be used to immobilize the labeled strand after amplification. The immobilized DNA can be either single or double-stranded.
After amplification (using e.g., RT CapExtension or RACE), the DNAs of this invention are rendered single-stranded. For example, the strands can be separated by using a biotinylated primer, capturing the biotinylated product on streptavidin beads, denaturing the DNA, and washing away the complementary strand. Depending on which end of the captured DNA is wanted, one will choose to immobilize either the upper (sense) strand or the lower (antisense) strand.
To prepare the single-stranded amplified DNAs for cloning into genetic packages so as to effect display of, or for expression of, the peptides, polypeptides or proteins encoded, at least in part, by those DNAs, they must be manipulated to provide ends suitable for cloning and display and/or expression. In particular, any 5′ untranslated regions and mammalian signal sequences must be removed and replaced, in frame, by a suitable signal sequence that functions in the display or expression host. Additionally, parts of the variable domains (in antibody genes) may be removed and replaced by synthetic segments containing synthetic diversity. The diversity of other gene families may likewise be expanded with synthetic diversity.
According to the methods of this invention, there are two ways to manipulate the single-stranded DNAs for display and/or expression. The first method comprises the steps of:
-
- (i) contacting the nucleic acid with a single-stranded oligonucleotide, the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired and including a sequence that with its complement in the nucleic acid forms a restriction endonuclease recognition site that on restriction results in cleavage of the nucleic acid at the desired location; and
- (ii) cleaving the nucleic acid solely at the recognition site formed by the complementation of the nucleic acid and the oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature.
In this first method, short oligonucleotides are annealed to the single-stranded DNA so that restriction endonuclease recognition sites formed within the now locally double-stranded regions of the DNA can be cleaved. In particular, a recognition site that occurs at the same position in a substantial fraction of the single-stranded DNAs is identical.
For antibody genes, this can be done using a catalog of germline sequences. See, e.g., “http://www.mrc-cpe.cam.ac.uk/imt-doc/restricted/ok.htm l.” Updates can be obtained from this site under the heading “Amino acid and nucleotide sequence alignments.” For other families, similar comparisons exist and may be used to select appropriate regions for cleavage and to maintain diversity.
For example, Table 1 depicts the DNA sequences of the FR3 regions of the 51 known human VH germline genes. In this region, the genes contain restriction endonuclease recognition sites shown in Table 2. Restriction endonucleases that cleave a large fraction of germline genes at the same site are preferred over endonucleases that cut at a variety of sites. Furthermore, it is preferred that there be only one site for the restriction endonucleases within the region to which the short oligonucleotide binds on the single-stranded DNA, e.g., about 10 bases on either side of the restriction endonuclease recognition site.
An enzyme that cleaves downstream in FR3 is also more preferable because it captures fewer mutations in the framework. This may be advantageous is some cases. However, it is well known that framework mutations exist and confer and enhance antibody binding. The present invention, by choice of appropriate restriction site, allows all or part of FR3 diversity to be captured. Hence, the method also allows extensive diversity to be captured.
Finally, in the methods of this invention restriction endonucleases that are active between about 37° C. and about 75° C. are used. Preferably, restriction endonucleases that are active between about 45° C. and about 75° C. may be used. More preferably, enzymes that are active above 50° C., and most preferably active about 55° C., are used. Such temperatures maintain the nucleic acid sequence to be cleaved in substantially single-stranded form.
Enzymes shown in Table 2 that cut many of the heavy chain FR3 germline genes at a single position include: MaeIII(24@4), Tsp45I(21@4), HphI(44@5), BsaJI(23@65), AluI(23@47), BlpI(21@48), DdeI(29@58), BglII(10@61), MslI(44@72), BsiEI(23@74), EaeI(23@74), EagI(23@74), HaeIII(25@75), Bst4CI(51@86), HpyCH4III(51@86), HinfI(38@2), MlyI(18@2), PleI(18@2), MnlI(31@67), HpyCH4V(21@44), BsmAI(16@11), BpmI(19@12), XmnI(12@30), and SacI(11@51). (The notation used means, for example, that BsmAI cuts 16 of the FR3 germline genes with a restriction endonuclease recognition site beginning at base 11 of FR3.)
For cleavage of human heavy chains in FR3, the preferred restriction endonucleases are: Bst4CI (or TaaI or HpyCH4III), BlpI, HpyCH4V, and MslI. Because ACNGT (the restriction endonuclease recognition site for Bst4CI, TaaI, and HpyCH4III) is found at a consistent site in all the human FR3 germline genes, one of those enzymes is the most preferred for capture of heavy chain CDR3 diversity. BlpI and HpyCH4V are complementary. BlpI cuts most members of the VH1 and VH4 families while HpyCH4V cuts most members of the VH3, VH5, VH6, and VH7 families. Neither enzyme cuts VH2s, but this is a very small family, containing only three members. Thus, these enzymes may also be used in preferred embodiments of the methods of this invention.
The restriction endonucleases HpyCH4III, Bst4CI, and TaaI all recognize 5′-ACnGT-3′ and cut upper strand DNA after n and lower strand DNA before the base complementary to n. This is the most preferred restriction endonuclease recognition site for this method on human heavy chains because it is found in all germline genes. Furthermore, the restriction endonuclease recognition region (ACnGT) matches the second and third bases of a tyrosine codon (tay) and the following cysteine codon (tgy) as shown in Table 3. These codons are highly conserved, especially the cysteine in mature antibody genes.
Table 4 E shows the distinct oligonucleotides of length 22 (except the last one which is of length 20) bases. Table 5 C shows the analysis of 1617 actual heavy chain antibody genes. Of these, 1511 have the site and match one of the candidate oligonucleotides to within 4 mismatches. Eight oligonucleotides account for most of the matches and are given in Table 4 F.1. The 8 oligonucleotides are very similar so that it is likely that satisfactory cleavage will be achieved with only one oligonucleotide (such as H43.77.97.1-02#1) by adjusting temperature, pH, salinity, and the like. One or two oligonucleotides may likewise suffice whenever the germline gene sequences differ very little and especially if they differ very little close to the restriction endonuclease recognition region to be cleaved. Table 5 D shows a repeat analysis of 1617 actual heavy chain antibody genes using only the 8 chosen oligonucleotides. This shows that 1463 of the sequences match at least one of the oligonucleotides to within 4 mismatches and have the site as expected. Only 7 sequences have a second HpyCH4III restriction endonuclease recognition region in this region.
Another illustration of choosing an appropriate restriction endonuclease recognition site involves cleavage in FR1 of human heavy chains. Cleavage in FR1 allows capture of the entire CDR diversity of the heavy chain.
The germline genes for human heavy chain FR1 are shown in Table 6. Table 7 shows the restriction endonuclease recognition sites found in human germline genes FR1s. The preferred sites are BsgI(GTGCAG;39@4), BsoFI(GCngc;43@6,11@9,2@3,1@12), TseI(Gcwgc;43@6,11@9,2@3,1@12), MspA1I(CMGckg;46@7,2@1), PvuII(CAGctg;46@7,2@1), AluI(AGct;48@82@2), DdeI(Ctnag;22@52,9@48), HphI(tcacc;22@80), BssKI(Nccngg;35@39,2@40), BsaJI(Ccnngg;32@40,2@41), BstNI(CCwgg;33@40), ScrFI(CCngg;35@40,2@41), Eco0109I(RGgnccy;22@46, 11@43), Sau96I(Ggncc;23@47,11@44), AvaII(Ggwcc;23@47,4@44), PpuMI(RGgwccy;22@46,4@43), BsmFI(gtccc;20@48), HinfI(Gantc;34@16,21@56,21@77), TfiI(21@77), MlyI(GAGTC;34@16), MlyI(gactc;21@56), and AlwNI(CAGnnnctg;22@68). The more preferred sites are MspAI and PvuII. MspAI and PvuII have 46 sites at 7-12 and 2 at 1-6. To avoid cleavage at both sites, oligonucleotides are used that do not fully cover the site at 1-6. Thus, the DNA will not be cleaved at that site. We have shown that DNA that extends 3, 4, or 5 bases beyond a PvuII-site can be cleaved efficiently.
Another illustration of choosing an appropriate restriction endonuclease recognition site involves cleavage in FR1 of human kappa light chains. Table 8 shows the human kappa FR1 germline genes and Table 9 shows restriction endonuclease recognition sites that are found in a substantial number of human kappa FR1 germline genes at consistent locations. Of the restriction endonuclease recognition sites listed, BsmAI and PflFI are the most preferred enzymes. BsmAI sites are found at base 18 in 35 of 40 germline genes. PflFI sites are found in 35 of 40 germline genes at base 12.
Another example of choosing an appropriate restriction endonuclease recognition site involves cleavage in FR1 of the human lambda light chain. Table 10 shows the 31 known human lambda FR1 germline gene sequences. Table 11 shows restriction endonuclease recognition sites found in human lambda FR1 germline genes. HinfI and DdeI are the most preferred restriction endonucleases for cutting human lambda chains in FR1.
After the appropriate site or sites for cleavage are chosen, one or more short oligonucleotides are prepared so as to functionally complement, alone or in combination, the chosen recognition site. The oligonucleotides also include sequences that flank the recognition site in the majority of the amplified genes. This flanking region allows the sequence to anneal to the single-stranded DNA sufficiently to allow cleavage by the restriction endonuclease specific for the site chosen.
The actual length and sequence of the oligonucleotide depends on the recognition site and the conditions to be used for contacting and cleavage. The length must be sufficient so that the oligonucleotide is functionally complementary to the single-stranded DNA over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location.
Typically, the oligonucleotides of this preferred method of the invention are about 17 to about 30 nucleotides in length. Below about 17 bases, annealing is too weak and above 30 bases there can be a loss of specificity. A preferred length is 18 to 24 bases.
Oligonucleotides of this length need not be identical complements of the germline genes. Rather, a few mismatches taken may be tolerated. Preferably, however, no more than 1-3 mismatches are allowed. Such mismatches do not adversely affect annealing of the oligonucleotide to the single-stranded DNA. Hence, the two DNAs are said to be functionally complementary.
The second method to manipulate the single-stranded DNAs of this invention for display and/or expression comprises the steps of:
-
- (i) contacting the nucleic acid with a partially double-stranded oligonucleotide, the single-stranded region of the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired, and the double-stranded region of the oligonucleotide having a restriction endonuclease recognition site; and
- (ii) cleaving the nucleic acid solely at the cleavage site formed by the complementation of the nucleic acid and the single-stranded region of the oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature.
As explained above, the cleavage site may be formed by the single-stranded portion of the partially double-stranded oligonucleotide duplexing with the single-stranded DNA, the cleavage site may be carried in the double-stranded portion of the partially double-stranded oligonucleotide, or the cleavage site may be introduced by the amplification primer used to amplify the single-stranded DNA-partially double-stranded oligonucleotide combination. In this embodiment, the first is preferred. And, the restriction endonuclease recognition site may be located in either the double-stranded portion of the oligonucleotide or introduced by the amplification primer, which is complementary to that double-stranded region, as used to amplify the combination.
Preferably, the restriction endonuclease site is that of a Type II-S restriction endonuclease, whose cleavage site is located at a known distance from its recognition site.
This second method, preferably, employs Universal Restriction Endonucleases (“URE”). UREs are partially double-stranded oligonucleotides. The single-stranded portion or overlap of the URE consists of a DNA adapter that is functionally complementary to the sequence to be cleaved in the single-stranded DNA. The double-stranded portion consists of a restriction endonuclease recognition site, preferably type II-S.
The URE method of this invention is specific and precise and can tolerate some (e.g., 1-3) mismatches in the complementary regions, i.e., it is functionally complementary to that region. Further, conditions under which the URE is used can be adjusted so that most of the genes that are amplified can be cut, reducing bias in the library produced from those genes.
The sequence of the single-stranded DNA adapter or overlap portion of the URE typically consists of about 14-22 bases. However, longer or shorter adapters may be used. The size depends on the ability of the adapter to associate with its functional complement in the single-stranded DNA and the temperature used for contacting the URE and the single-stranded DNA at the temperature used for cleaving the DNA with the restriction enzyme. The adapter must be functionally complementary to the single-stranded DNA over a large enough region to allow the two strands to associate such that the cleavage may occur at the chosen temperature and at the desired location. We prefer singe-stranded or overlap portions of 14-17 bases in length, and more preferably 18-20 bases in length.
The site chosen for cleavage using the URE is preferably one that is substantially conserved in the family of amplified DNAs. As compared to the first cleavage method of this invention, these sites do not need to be endonuclease recognition sites. However, like the first method, the sites chosen can be synthetic rather than existing in the native DNA. Such sites may be chosen by references to the sequences of known antibodies or other families of genes. For example, the sequences of many germline genes are reported at http://www.mrc-cpe.cam.ac.uk/imt-doc/restricted/ok.html. For example, one preferred site occurs near the end of FR3—codon 89 through the second base of codon 93. CDR3 begins at codon 95.
The sequences of 79 human heavy-chain genes are also available at http://www.ncbi.nlm.nih.gov/entre2/nucleotide.html. This site can be used to identify appropriate sequences for URE cleavage according to the methods of this invention. See, e.g., Table 12B.
Most preferably, one or more sequences are identified using these sites or other available sequence information. These sequences together are present in a substantial fraction of the amplified DNAs. For example, multiple sequences could be used to allow for known diversity in germline genes or for frequent somatic mutations. Synthetic degenerate sequences could also be used. Preferably, a sequence(s) that occurs in at least 65% of genes examined with no more than 2-3 mismatches is chosen.
URE single-stranded adapters or overlaps are then made to be complementary to the chosen regions. Conditions for using the UREs are determined empirically. These conditions should allow cleavage of DNA that contains the functionally complementary sequences with no more than 2 or 3 mismatches but that do not allow cleavage of DNA lacking such sequences.
As described above, the double-stranded portion of the URE includes an endonuclease recognition site, preferably a Type II-S recognition site. Any enzyme that is active at a temperature necessary to maintain the single-stranded DNA substantially in that form and to allow the single-stranded DNA adapter portion of the URE to anneal long enough to the single-stranded DNA to permit cleavage at the desired site may be used.
The preferred Type II-S enzymes for use in the URE methods of this invention provide asymmetrical cleavage of the single-stranded DNA. Among these are the enzymes listed in Table 13. The most preferred Type II-S enzyme is FokI.
When the preferred FokI containing URE is used, several conditions are preferably used to effect cleavage:
-
- 1) Excess of the URE over target DNA should be present to activate the enzyme. URE present only in equimolar amounts to the target DNA would yield poor cleavage of ssDNA because the amount of active enzyme available would be limiting.
- 2) An activator may be used to activate part of the FokI enzyme to dimerize without causing cleavage. Examples of appropriate activators are shown in Table 14.
- 3) The cleavage reaction is performed at a temperature between 45°-75° C., preferably above 50° C. and most preferably above 55° C.
The UREs used in the prior art contained a 14-base single-stranded segment, a 10-base stem (containing a FokI site), followed by the palindrome of the 10-base stem. While such UREs may be used in the methods of this invention, the preferred UREs of this invention also include a segment of three to eight bases (a loop) between the FokI restriction endonuclease recognition site containing segments. In the preferred embodiment, the stem (containing the FokI site) and its palindrome are also longer than 10 bases. Preferably, they are 10-14 bases in length. Examples of these “lollipop” URE adapters are shown in Table 15.
One example of using a URE to cleave an single-stranded DNA involves the FR3 region of human heavy chain. Table 16 shows an analysis of 840 full-length mature human heavy chains with the URE recognition sequences shown. The vast majority (718/840=0.85) will be recognized with 2 or fewer mismatches using five UREs (VHS881-1.1, VHS881-1.2, VHS881-2.1, VHS881-4.1, and VHS881-9.1). Each has a 20-base adaptor sequence to complement the germline gene, a ten-base stem segment containing a FokI site, a five base loop, and the reverse complement of the first stem segment. Annealing those adapters, alone or in combination, to single-stranded antisense heavy chain DNA and treating with FokI in the presence of, e.g., the activator FOKIact, will lead to cleavage of the antisense strand at the position indicated.
Another example of using a URE(s) to cleave a single-stranded DNA involves the FR1 region of the human Kappa light chains. Table 17 shows an analysis of 182 full-length human kappa chains for matching by the four 19-base probe sequences shown. Ninety-six percent of the sequences match one of the probes with 2 or fewer mismatches. The URE adapters shown in Table 17 are for cleavage of the sense strand of kappa chains. Thus, the adaptor sequences are the reverse complement of the germline gene sequences. The URE consists of a ten-base stem, a five base loop, the reverse complement of the stem and the complementation sequence. The loop shown here is TTGTT, but other sequences could be used. Its function is to interrupt the palindrome of the stems so that formation of a lollypop monomer is favored over dimerization. Table 17 also shows where the sense strand is cleaved.
Another example of using a URE to cleave a single-stranded DNA involves the human lambda light chain. Table 18 shows analysis of 128 human lambda light chains for matching the four 19-base probes shown. With three or fewer mismatches, 88 of 128 (69%) of the chains match one of the probes. Table 18 also shows URE adapters corresponding to these probes. Annealing these adapters to upper-strand ssDNA of lambda chains and treatment with FokI in the presence of FOKIact at a temperature at or above 45° C. will lead to specific and precise cleavage of the chains.
The conditions under which the short oligonucleotide sequences of the first method and the UREs of the second method are contacted with the single-stranded DNAs may be empirically determined. The conditions must be such that the single-stranded DNA remains in substantially single-stranded form. More particularly, the conditions must be such that the single-stranded DNA does not form loops that may interfere with its association with the oligonucleotide sequence or the URE or that may themselves provide sites for cleavage by the chosen restriction endonuclease.
The effectiveness and specificity of short oligonucleotides (first method) and UREs (second method) can be adjusted by controlling the concentrations of the URE adapters/oligonucleotides and substrate DNA, the temperature, the pH, the concentration of metal ions, the ionic strength, the concentration of chaotropes (such as urea and formamide), the concentration of the restriction endonuclease(e.g., FokI), and the time of the digestion. These conditions can be optimized with synthetic oligonucleotides having: 1) target germline gene sequences, 2) mutated target gene sequences, or 3) somewhat related non-target sequences. The goal is to cleave most of the target sequences and minimal amounts of non-targets.
In accordance with this invention, the single-stranded DNA is maintained in substantially that form using a temperature between about 37° C. and about 75° C. Preferably, a temperature between about 45° C. and about 75° C. is used. More preferably, a temperature between 50° C. and 60° C., most preferably between 55° C. and 60° C., is used. These temperatures are employed both when contacting the DNA with the oligonucleotide or URE and when cleaving the DNA using the methods of this invention.
The two cleavage methods of this invention have several advantages. The first method allows the individual members of the family of single-stranded DNAs to be cleaved preferentially at one substantially conserved endonuclease recognition site. The method also does not require an endonuclease recognition site to be built into the reverse transcription or amplification primers. Any native or synthetic site in the family can be used.
The second method has both of these advantages. In addition, the preferred URE method allows the single-stranded DNAs to be cleaved at positions where no endoniuclease recognition site naturally occurs or has been synthetically constructed.
Most importantly, both cleavage methods permit the use of 5′ and 3′ primers so as to maximize diversity and then cleavage to remove unwanted or deleterious sequences before cloning, display and/or expression.
After cleavage of the amplified DNAs using one of the methods of this invention, the DNA is prepared for cloning, display and/or expression. This is done by using a partially duplexed synthetic DNA adapter, whose terminal sequence is based on the specific cleavage site at which the amplified DNA has been cleaved.
The synthetic DNA is designed such that when it is ligated to the cleaved single-stranded DNA in proper reading frame so that the desired peptide, polypeptide or protein can be displayed on the surface of the genetic package and/or expressed. Preferably, the double-stranded portion of the adapter comprises the sequence of several codons that encode the amino acid sequence characteristic of the family of peptides, polypeptides or proteins up to the cleavage site. For human heavy chains, the amino acids of the 3-23 framework are preferably used to provide the sequences required for expression of the cleaved DNA.
Preferably, the double-stranded portion of the adapter is about 12 to 100 bases in length. More preferably, about 20 to 100 bases are used. The double-standard region of the adapter also preferably contains at least one endonuclease recognition site useful for cloning the DNA into a suitable display and/or expression vector (or a recipient vector used to archive the diversity). This endonuclease restriction site may be native to the germline gene sequences used to extend the DNA sequence. It may be also constructed using degenerate sequences to the native germline gene sequences. Or, it may be wholly synthetic.
The single-stranded portion of the adapter is complementary to the region of the cleavage in the single-stranded DNA. The overlap can be from about 2 bases up to about 15 bases. The longer the overlap, the more efficient the ligation is likely to be. A preferred length for the overlap is 7 to 10. This allows some mismatches in the region so that diversity in this region may be captured.
The single-stranded region or overlap of the partially duplexed adapter is advantageous because it allows DNA cleaved at the chosen site, but not other fragments to be captured. Such fragments would contaminate the library with genes encoding sequences that will not fold into proper antibodies and are likely to be non-specifically sticky.
One illustration of the use of a partially duplexed adaptor in the methods of this invention involves ligating such adaptor to a human FR3 region that has been cleaved, as described above, at 5′-ACnGT-3′ using HpyCH4III, Bst4CI or TaaI.
Table 4 F.2 shows the bottom strand of the double-stranded portion of the adaptor for ligation to the cleaved bottom-strand DNA. Since the HpyCH4III-Site is so far to the right (as shown in Table 3), a sequence that includes the AflII-site as well as the XbaI site can be added. This bottom strand portion of the partially-duplexed adaptor, H43.XAExt, incorporates both XbaI and AflII-sites. The top strand of the double-stranded portion of the adaptor has neither site (due to planned mismatches in the segments opposite the XbaI and AflII-Sites of H43.XAExt), but will anneal very tightly to H43.XAExt. H43AExt contains only the AflII-site and is to be used with the top strands H43.ABr1 and H43.ABr2 (which have intentional alterations to destroy the AflII-site).
After ligation, the desired, captured DNA can be PCR amplified again, if desired, using in the preferred embodiment a primer to the downstream constant region of the antibody gene and a primer to part of the double-standard region of the adapter. The primers may also carry restriction endonuclease sites for use in cloning the amplified DNA.
After ligation, and perhaps amplification, of the partially double-stranded adapter to the single-stranded amplified DNA, the composite DNA is cleaved at chosen 5′ and 3′ endonuclease recognition sites.
The cleavage sites useful for cloning depend on the phage or phagemid or other vectors into which the cassette will be inserted and the available sites in the antibody genes. Table 19 provides restriction endonuclease data for 75 human light chains. Table 20 shows corresponding data for 79 human heavy chains. In each Table, the endonucleases are ordered by increasing frequency of cutting. In these Tables, Nch is the number of chains cut by the enzyme and Ns is the number of sites (some chains have more than one site).
From this analysis, SfiI, NotI, AflII, ApaLI, and AscI are very suitable. SfiI and NotI are preferably used in pCES1 to insert the heavy-chain display segment. ApaLI and AscI are preferably used in pCES1 to insert the light-chain display segment.
BstEII-sites occur in 97% of germ-line JH genes. In rearranged V genes, only 54/79 (68%) of heavy-chain genes contain a BstEII-Site and 7/61 of these contain two sites. Thus, 47/79 (59%) contain a single BstEII-Site. An alternative to using BstEII is to cleave via UREs at the end of JH and ligate to a synthetic oligonucleotide that encodes part of CH1.
One example of preparing a family of DNA sequences using the methods of this invention involves capturing human CDR 3 diversity. As described above, mRNAs from various autoimmune patients are reverse transcribed into lower strand cDNA. After the top strand RNA is degraded, the lower strand is immobilized and a short oligonucleotide used to cleave the cDNA upstream of CDR3. A partially duplexed synthetic DNA adapter is then annealed to the DNA and the DNA is amplified using a primer to the adapter and a primer to the constant region (after FR4). The DNA is then cleaved using BstEII (in FR4) and a restriction endonuclease appropriate to the partially double-stranded adapter (e.g., XbaI and AfilII (in FR3)). The DNA is then ligated into a synthetic VH skeleton such as 3-23.
One example of preparing a single-stranded DNA that was cleaved using the URE method involves the human Kappa chain. The cleavage site in the sense strand of this chain is depicted in Table 17. The oligonucleotide kapextURE is annealed to the oligonucleotides (kaBR01UR, kaBR02UR, kaBR03UR, and kaBR04UR) to form a partially duplex DNA. This DNA is then ligated to the cleaved soluble kappa chains. The ligation product is then amplified using primers kapextUREPCR and CKForeAsc (which inserts a AscI site after the end of C kappa). This product is then cleaved with ApaLI and AscI and ligated to similarly cut recipient vector.
Another example involves the cleavage of lambda light chains, illustrated in Table 18. After cleavage, an extender (ON_LamEx133) and four bridge oligonucleotides (ON_LamB1-133, ON_LamB2-133, ON_LamB3-133, and ON_LamB4-133) are annealed to form a partially duplex DNA. That DNA is ligated to the cleaved lambda-chain sense strands. After ligation, the DNA is amplified with ON_Lam133PCR and a forward primer specific to the lambda constant domain, such as CL2ForeAsc or CL7ForeAsc (Table 130).
In human heavy chains, one can cleave almost all genes in FR4 (downstream, i.e., toward the 3′ end of the sense strand, of CDR3) at a BstEII-Site that occurs at a constant position in a very large fraction of human heavy-chain V genes. One then needs a site in FR3, if only CDR3 diversity is to be captured, in FR2, if CDR2 and CDR3 diversity is wanted, or in FR1, if all the CDR diversity is wanted. These sites are preferably inserted as part of the partially double-stranded adaptor.
The preferred process of this invention is to provide recipient vectors (e.g., for display and/or expression) having sites that allow cloning of either light or heavy chains. Such vectors are well known and widely used in the art. A preferred phage display vector in accordance with this invention is phage MALIA3. This displays in gene III. The sequence of the phage MALIA3 is shown in Table 21A (annotated) and Table 21B (condensed).
The DNA encoding the selected regions of the light or heavy chains can be transferred to the vectors using endonucleases that cut either light or heavy chains only very rarely. For example, light chains may be captured with ApaLI and AscI. Heavy-chain genes are preferably cloned into a recipient vector having SfiI, NcoI, XbaI, AflII, BstEII, ApaI, and NotI sites. The light chains are preferably moved into the library as ApaLI-AscI fragments. The heavy chains are preferably moved into the library as SfiI-NotI fragments.
Most preferably, the display is had on the surface of a derivative of M13 phage. The most preferred vector contains all the genes of M13, an antibiotic resistance gene, and the display cassette. The preferred vector is provided with restriction sites that allow introduction and excision of members of the diverse family of genes, as cassettes. The preferred vector is stable against rearrangement under the growth conditions used to amplify phage.
In another embodiment of this invention, the diversity captured by the methods of the present invention may be displayed and/or expressed in a phagemid vector (e.g., pCES1) that displays and/or expresses the peptide, polypeptide or protein. Such vectors may also be used to store the diversity for subsequent display and/or expression using other vectors or phage.
In another embodiment of this invention, the diversity captured by the methods of the present invention may be displayed and/or expressed in a yeast vector.
In another embodiment, the mode of display may be through a short linker to anchor domains—one possible anchor comprising the final portion of M13 III (“IIIstump”) and a second possible anchor being the full length III mature protein.
The IIIstump fragment contains enough of M13 III to assemble into phage but not the domains involved in mediating infectivity. Because the w.t. III proteins are present the phage is unlikely to delete the antibody genes and phage that do delete these segments receive only a very small growth advantage. For each of the anchor domains, the DNA encodes the w.t. AA sequence, but differs from the w.t. DNA sequence to a very high extent. This will greatly reduce the potential for homologous recombination between the anchor and the w.t. gene that is also present (see Example 6).
Most preferably, the present invention uses a complete phage carrying an antibiotic-resistance gene (such as an ampicillin-resistance gene) and the display cassette. Because the w.t. iii and possibly viii genes are present, the w.t. proteins are also present. The display cassette is transcribed from a regulatable promoter (e.g., PLacZ). Use of a regulatable promoter allows control of the ratio of the fusion display gene to the corresponding w.t. coat protein. This ratio determines the average number of copies of the display fusion per phage (or phagemid) particle.
Another aspect of the invention is a method of displaying peptides, polypeptides or proteins (and particularly Fabs) on filamentous phage. In the most preferred embodiment this method displays FABs and comprises:
-
- a) obtaining a cassette capturing a diversity of segments of DNA encoding the elements:
- Preg::RBS1::SS1::VL::CL::stop::RBS2::SS2::VH::CH1:: linker::anchor::stop::,
where Preg is a regulatable promoter, RBS1 is a first ribosome binding site, SS1 is a signal sequence operable in the host strain, VL is a member of a diverse set of light-chain variable regions, CL is a light-chain constant region, stop is one or more stop codons, RBS2 is a second ribosome binding site, SS2 is a second signal sequence operable in the host strain, VH is a member of a diverse set of heavy-chain variable regions, CH1 is an antibody heavy-chain first constant domain, linker is a sequence of amino acids of one to about 50 residues, anchor is a protein that will assemble into the filamentous phage particle and stop is a second example of one or more stop codons; and
- b) positioning that cassette within the phage genome to maximize the viability of the phage and to minimize the potential for deletion of the cassette or parts thereof.
The DNA encoding the anchor protein in the above preferred cassette should be designed to encode the same (or a closely related) amino acid sequence as is found in one of the coat proteins of the phage, but with a distinct DNA sequence. This is to prevent unwanted homologous recombination with the w.t. gene. In addition, the cassette should be placed in the intergenic region. The positioning and orientation of the display cassette can influence the behavior of the phage.
In one embodiment of the invention, a transcription terminator may be placed after the second stop of the display cassette above (e.g., Trp). This will reduce interaction between the display cassette and other genes in the phage antibody display vector.
In another embodiment of the methods of this invention, the phage or phagemid can display and/or express proteins other than Fab, by replacing the Fab portions indicated above, with other protein genes.
Various hosts can be used the display and/or expression aspect of this invention. Such hosts are well known in the art. In the preferred embodiment, where Fabs are being displayed and/or expressed, the preferred host should grow at 30° C. and be RecA− (to reduce unwanted genetic recombination) and EndA− (to make recovery of RF DNA easier). It is also preferred that the host strain be easily transformed by electroporation.
XL1-Blue MRF′ satisfies most of these preferences, but does not grow well at 30° C. XL1-Blue MRF′ does grow slowly at 38° C. and thus is an acceptable host. TG-1 is also an acceptable host although it is RecA+ and EndA+. XL1-Blue MRF′ is more preferred for the intermediate host used to accumulate diversity prior to final construction of the library.
After display and/or expression, the libraries of this invention may be screened using well known and conventionally used techniques. The selected peptides, polypeptides or proteins may then be used to treat disease. Generally, the peptides, polypeptides or proteins for use in therapy or in pharmaceutical compositions are produced by isolating the DNA encoding the desired peptide, polypeptide or protein from the member of the library selected. That DNA is then used in conventional methods to produce the peptide, polypeptides or protein it encodes in appropriate host cells, preferably mammalian host cells, e.g., CHO cells. After isolation, the peptide, polypeptide or protein is used alone or with pharmaceutically acceptable compositions in therapy to treat disease.
EXAMPLES
Example 1
RACE Amplification of Heavy and Light Chain Antibody Repertoires from Autoimmune Patients.
Total RNA was isolated from individual blood samples (50 ml) of 11 patients using a RNAzol™ kit (CINNA/Biotecx), as described by the manufacturer. The patients were diagnosed as follows:
-
- 1. SLE and phospholipid syndrome
- 2. limited systemic sclerosis
- 3. SLE and Sjogren syndrome
- 4. Limited Systemic sclerosis
- 5. Reumatoid Arthritis with active vasculitis
- 6. Limited systemic sclerosis and Sjogren Syndrome
- 7. Reumatoid Artritis and (not active) vasculitis
- 8. SLE and Sjogren syndrome
- 9. SLE
- 10. SLE and (active) glomerulonephritis
- 11. Polyarthritis/Raynauds Phenomen
From these 11 samples of total RNA, Poly-A+ RNA was isolated using Promega PolyATtract® mRNA Isolation kit (Promega).
250 ng of each poly-A+ RNA sample was used to amplify antibody heavy and light chains with the GeneRAacer™ kit (Invitrogen cat no. L1500-01). A schematic overview of the RACE procedure is shown in FIG. 3.
Using the general protocol of the GeneRAacer™ kit, an RNA adaptor was ligated to the 5′ end of all mRNAs. Next, a reverse transcriptase reaction was performed in the presence of oligo(dT15) specific primer under conditions described by the manufacturer in the GeneRAacer™ kit.
⅕ of the cDNA from the reverse transcriptase reaction was used in a 20 ul PCR reaction. For amplification of the heavy chain IgM repertoire, a forward primer based on the CH1 chain of IgM [HuCmFOR] and a backward primer based on the ligated synthetic adaptor sequence [5′A] were used. (See Table 22).
For amplification of the kappa and lambda light chains, a forward primer that contains the 3′ coding-end of the cDNA [HuCkFor and HuCLFor2+HuCLfor7] and a backward primer based on the ligated synthetic adapter sequence [5′A] was used (See Table 22). Specific amplification products after 30 cycles of primary PCR were obtained.
FIG. 4 shows the amplification products obtained after the primary PCR reaction from 4 different patient samples. 8 ul primary PCR product from 4 different patients was analyzed on a agarose gel [labeled 1, 2, 3 and 4]. For the heavy chain, a product of approximately 950 nt is obtained while for the kappa and lambda light chains the product is approximately 850 nt. M1-2 are molecular weight markers.
PCR products were also analyzed by DNA sequencing [10 clones from the lambda, kappa or heavy chain repertoires]. All sequenced antibody genes recovered contained the full coding sequence as well as the 5′ leader sequence and the V gene diversity was the expected diversity (compared to literature data).
50 ng of all samples from all 11 individual amplified samples were mixed for heavy, lambda light or kappa light chains and used in secondary PCR reactions.
In all secondary PCRs approximately 1 ng template DNA from the primary PCR mixture was used in multiple 50 ul PCR reactions [25 cycles].
For the heavy chain, a nested biotinylated forward primer [HuCm-Nested] was used, and a nested 5′end backward primer located in the synthetic adapter-sequence [5′NA] was used. The 5′end lower-strand of the heavy chain was biotinylated.
For the light chains, a 5′end biotinylated nested primer in the synthetic adapter was used [5′NA] in combination with a 3′end primer in the constant region of Ckappa and Clambda, extended with a sequence coding for the AscI restriction site [kappa: HuCkForAscI, Lambda: HuCL2-FOR-ASC+HuCL7-FOR-ASC]. [5′end Top strand DNA was biotinylated]. After gel-analysis the secondary PCR products were pooled and purified with Promega Wizzard PCR cleanup. Approximately 25 ug biotinylated heavy chain, lambda and kappa light chain DNA was isolated from the 11 patients.
Example 2
Capturing Kappa Chains with BsmAI.
A repertoire of human-kappa chain mRNAs was prepared using the RACE method of Example 1 from a collection of patients having various autoimmune diseases.
This Example followed the protocol of Example 1. Approximately 2 micrograms (ug) of human kappa-chain (Igkappa) gene PACE material with biotin attached to 5′-end of upper strand was immobilized as in Example 1 on 200 microliters (μL) of Seradyn magnetic beads. The lower strand was removed by washing the DNA with 2 aliquots 200 μL of 0.1 M NaOH (pH 13) for 3 minutes for the first aliquot followed by 30 seconds for the second aliquot. The beads were neutralized with 200 μL of 10 mM Tris (pH 7.5) 100 mM NaCl. The short oligonucleotides shown in Table 23 were added in 40 fold molar excess in 100 μL of NEB buffer 2 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM dithiothreitol pH 7.9) to the dry beads. The mixture was incubated at 95° C. for 5 minutes then cooled down to 55° C. over 30 minutes. Excess oligonucleotide was washed away with 2 washes of NEB buffer 3 (100 mM NaCl, 50 mM Tris-HCl, 10 MM MgCl2, 1 mM dithiothreitol pH 7.9). Ten units of BsmAI (NEB) were added in NEB buffer 3 and incubated for 1 h at 55° C. The cleaved downstream DNA was collected and purified over a Qiagen PCR purification column (FIGS. 5 and 6).
FIG. 5 shows an analysis of digested kappa single-stranded DNA. Approximately 151.5 pmol of adapter was annealed to 3.79 pmol of immobilized kappa single-stranded DNA followed by digestion with 15 U of BsmAI. The supernatant containing the desired DNA was removed and analyzed by 5% polyacrylamide gel along with the remaining beads which contained uncleaved full length kappa DNA. 189 pmol of cleaved single-stranded DNA was purified for further analysis. Five percent of the original full length ssDNA remained on the beads.
FIG. 6 shows an analysis of the extender—cleaved kappa ligation. 180 pmol of pre-annealed bridge/extender was ligated to 1.8 pmol of BsmAl digested single-stranded DNA. The ligated DNA was purified by Qiagen PCR purification column and analyzed on a 5% polyacrylamide gel. Results indicated that the ligation of extender to single-stranded DNA was 95% efficient.
A partially double-stranded adaptor was prepared using the oligonucleotide shown in Table 23. The adaptor was added to the single-stranded DNA in 100 fold molar excess along with 1000 units of T4 DNA ligase and incubated overnight at 16° C. The excess oligonucleotide was removed with a Qiagen PCR purification column. The ligated material was amplified by PCR using the primers kapPCRt1 and kapfor shown in Table 23 for 10 cycles with the program shown in Table 24.
The soluble PCR product was run on a gel and showed a band of approximately 700 n, as expected (FIGS. 7 and 8). The DNA was cleaved with enzymes ApaLI and AscI, gel purified, and ligated to similarly cleaved vector pCES1.
FIG. 7 shows an analysis of the PCR product from the extender-kappa amplification. Ligated extender-kappa single-stranded DNA was amplified with primers specific to the extender and to the constant region of the light chain. Two different template concentrations, 10 ng versus 50 ng, were used as template and 13 cycles were used to generate approximately 1.5 ug of dsDNA as shown by 0.8% agarose gel analysis.
FIG. 8 shows an analysis of the purified PCR product from the extender-kappa amplification. Approximately 5 ug of PCR amplified extender-kappa double-stranded DNA was run out on a 0.8% agarose gel, cut out, and extracted with a GFX gel purification column. By gel analysis, 3.5 ug of double-stranded DNA was prepared.
The assay for capturing kappa chains with BsmA1 was repeated and produced similar results. FIG. 9A shows the DNA after it was cleaved and collected and purified over a Qiagen PCR purification column. FIG. 9B shows the partially double-stranded adaptor ligated to the single-stranded DNA. This ligated material was then amplified (FIG. 9C). The gel showed a band of approximately 700 n.
Table 25 shows the DNA sequence of a kappa light chain captured by this procedure. Table 26 shows a second sequence captured by this procedure. The closest bridge sequence was complementary to the sequence 5′-agccacc-3′, but the sequence captured reads 5′-Tgccacc-3′, showing that some mismatch in the overlapped region is tolerated.
Example 3
Construction of Synthetic CDR1 and CDR2 Diversity in V-3-23 VH Framework.
Synthetic diversity in Complementary Determinant Region (CDR) 1 and 2 was created in the 3-23 VH framework in a two step process: first, a vector containing the 3-23 VH framework was constructed; and then, a synthetic CDR 1 and 2 was assembled and cloned into this vector.
For construction of the 3-23 VH framework, 8 oligonucleotides and two PCR primers (long oligonucleotides—TOPFR1A, BOTFR1B, BOTFR2, BOTFR3, F06, BoTFR4, ON-vgC1, and ON-vgC2 and primers—SFPRMET and BOTPcRPRIM, shown in Table 27) that overlap were designed based on the Genebank sequence of 3-23 VH framework region. The design incorporated at least one useful restriction site in each framework region, as shown in Table 27. In Table 27, the segments that were synthesized are shown as bold, the overlapping regions are underscored, and the PCR priming regions at each end are underscored.
A mixture of these 8 oligos was combined at a final concentration of 2.5 uM in a 20 ul PCR reaction. The PCR mixture contained 200 uM dNTPs, 2.5 mM MgCl2, 0.02 U Pfu Turbo™ DNA Polymerase, 1 U Qiagen HotStart Taq DNA Polymerase, and 1×Qiagen PCR buffer. The PCR program consisted of 10 cycles of 94° C. for 30s, 55° C. for 30s, and 72° C. for 30s.
The assembled 3-23 VH DNA sequence was then amplified, using 2.5 ul of a 10-fold dilution from the initial PCR in 100 ul PCR reaction. The PCR reaction contained 200 uM dNTPs, 2.5 mM MgCl2, 0.02 U Pfu Turbo™ DNA Polymerase, 1 U Qiagen HotStart Taq DNA Polymerase, 1×Qiagen PCR Buffer and 2 outside primers (SFPRMET and BOTPCRPRIM) at a concentration of 1 uM. The PCR program consisted of 23 cycles at 94° C. for 30s, 55° C. for 30s, and 72° C. for 60s. The 3-23 VH DNA sequence was digested and cloned into pCES1 (phagemid vector) using the SfiI and BstEII restriction endonuclease sites. All restriction enzymes mentioned herein were supplied by New England BioLabs, Beverly, Mass. and used as per the manufacturer's instructions.
Stuffer sequences (shown in Table 28 and Table 29) were introduced into pCES1 to replace CDR1/CDR2 sequences (900 bases between BspEI and XbaI RE sites) and CDR3 sequences (358 bases between AflII and BstEII) prior to cloning the CDR1/CDR2 diversity. This new vector was termed pCES5 and its sequence is given in Table 29.
Having stuffers in place of the CDRs avoids the risk that a parental sequence would be over-represented in the library. The stuffer sequences are fragments from the penicillase gene of E. coli. The CDR1-2 stuffer contains restriction sites for BglII, Bsu36I, BclI, XcmI, MluI, PvuII, HpaI, and HincII, the underscored sites being unique within the vector pCES5. The stuffer that replaces CDR3 contains the unique restriction endonuclease site RsrII.
A schematic representation of the design for CDR1 and CDR2 synthetic diversity is shown FIG. 10. The design was based on the presence of mutations in DP47/3-23 and related germline genes. Diversity was designed to be introduced at the positions within CDR1 and CDR2 indicated by the numbers in FIG. 10. The diversity at each position was chosen to be one of the three following schemes: 1=ADEFGHIKLMNPQRSTVWY; 2=YRWVGS; 3=PS, in which letters encode equimolar mixes of the indicated amino acids.
For the construction of the CDR1 and CDR2 diversity, 4 overlapping oligonucleotides (ON-vgC1, ON_Br12, ON_CD2Xba, and ON-vgC2, shown in Table 27 and Table 30) encoding CDR1/2, plus flanking regions, were designed. A mixture of these 4 oligos was combined at a final concentration of 2.5 uM in a 40 ul PCR reaction. Two of the 4 oligos contained variegated sequences positioned at the CDR1 and the CDR2. The PCR mixture contained 200 uM dNTPs, 2.5 U Pwo DNA Polymerase (Roche), and 1×Pwo PCR buffer with 2 mM MgSO4. The PCR program consisted of 10 cycles at 94° C. for 30s, 60° C. for 30s, and 72° C. for 60s. This assembled CDR1/2 DNA sequence was amplified, using 2.5 ul of the mixture in 100 ul PCR reaction. The PCR reaction contained 200 uM dNTPs, 2.5 U Pwo DNA Polymerase, 1×Pwo PCR Buffer with 2 mM MgSO4 and 2 outside primers at a concentration of 1 uM. The PCR program consisted of 10 cycles at 94° C. for 30s, 60° C. for 30s, and 72° C. for 60s. These variegated sequences were digested and cloned into the 3-23 VH framework in place of the CDR1/2 stuffer.
We obtained approximately 7×107 independent transformants. CDR3 diversity either from donor populations or from synthetic DNA can be cloned into the vector containing synthetic CDR1 and CDR 2 diversity.
A schematic representation of this procedure is shown in FIG. 11. A sequence encoding the FR-regions of the human V3-23 gene segment and CDR regions with synthetic diversity was made by oligonucleotide assembly and cloning via BspE1 and Xbal sites into a vector that complements the FR1 and FR3 regions. Into this library of synthetic VH segments, the complementary VH-CDR3 sequence (top right) was cloned via Xbal an BstEll sites. The resulting cloned CH genes contain a combination of designed synthetic diversity and natural diversity (see FIG. 11).
Example 4
Cleavage and Ligation of the Lambda Light Chains with HinfI.
A schematic of the cleavage and ligation of antibody light chains is shown in FIGS. 12A and 12B. Approximately 2 ug of biotinylated human Lambda DNA prepared as described in Example 1 was immobilized on 200 ul Seradyn magnetic beads. The lower strand was removed by incubation of the DNA with 200 ul of 0.1 M NaOH (pH=13) for 3 minutes, the supernatant was removed and an additional washing of 30 seconds with 200 ul of 0.1 M NaOH was performed. Supernatant was removed and the beads were neutralized with 200 ul of 10 mM Tris (pH=7.5), 100 mM NaCl. 2 additional washes with 200 ul NEB2 buffer 2, containing 10 mM Tris (pH=7.9), 50 mM NaCl, 10 mM MgCl2 and 1 mM dithiothreitol, were performed. After immobilization, the amount of ssDNA was estimated on a 5% PAGE-UREA gel.
About 0.8 ug ssDNA was recovered and incubated in 100 ul NEB2 buffer 2 containing 80 molar fold excess of an equimolar mix of ON_Lam1aB7, ON_Lam2aB7, ON_Lam31B7 and ON_Lam3rB7 [each oligo in 20 fold molar excess] (see Table 31).
The mixture was incubated at 95° C. for 5 minutes and then slowly cooled down to 50° C. over a period of 30 minutes. Excess of oligonucleotide was washed away with 2 washes of 200 ul of NEB buffer 2. 4 U/ug of Hinf I was added and incubated for 1 hour at 50° C. Beads were mixed every 10 minutes.
After incubation the sample was purified over a Qiagen PCR purification column and was subsequently analysed on a 5% PAGE-urea gel (see FIG. 13A, cleavage was more than 70% efficient).
A schematic of the ligation of the cleaved light chains is shown in FIG. 12B. A mix of bridge/extender pairs was prepared from the Brg/Ext oligo's listed in Table 31 (total molar excess 100 fold) in 1000 U of T4 DNA Ligase (NEB) and incubated overnight at 16° C. After ligation of the DNA, the excess oligonucleotide was removed with a Qiagen PCR purification column and ligation was checked on a Urea-PAGE gel (see FIG. 13B; ligation was more than 95% efficient).
Multiple PCRs were performed containing 10 ng of the ligated material in an 50 ul PCR reaction using 25 pMol ON lamPlePCR and 25 pmol of an equimolar mix of Hu-CL2AscI/HuCL7AscI primer (see Example 1).
PCR was performed at 60° C. for 15 cycles using Pfu polymerase. About 1 ug of dsDNA was recovered per PCR (see FIG. 13C) and cleaved with ApaL1 and AscI for cloning the lambda light chains in pCES2.
Example 5
Capture of Human Heavy-chain CDR3 Population.
A schematic of the cleavage and ligation of antibody light chains is shown in FIGS. 14A and 14B.
Approximately 3 ug of human heavy-chain (IgM) gene RACE material with biotin attached to 5′-end of lower strand was immobilized on 300 uL of Seradyn magnetic beads. The upper strand was removed by washing the DNA with 2 aliquots 300 uL of 0.1 M NaOH (pH 13) for 3 minutes for the first aliquot followed by 30 seconds for the second aliquot. The beads were neutralized with 300 uL of 10 mM Tris (pH 7.5) 100 mM NaCl. The REdaptors (oligonucleotides used to make single-stranded DNA locally double-stranded) shown in Table 32 were added in 30 fold molar excess in 200 uL of NEB buffer 4 (50 mM Potasium Acetate, 20 mM Tris-Acetate, 10 mM Magnesuim Acetate, 1 mM dithiothreitol pH 7.9) to the dry beads. The REadaptors were incubated with the single-stranded DNA at 80 ° C. for 5 minutes then cooled down to 55 ° C. over 30 minutes. Excess REdaptors were washed away with 2 washes of NEB buffer 4. Fifteen units of HpyCH4III (NEB) were added in NEB buffer 4 and incubated for 1 hour at 55° C. The cleaved downstream DNA remaining on the beads was removed from the beads using a Qiagen Nucleotide removal column (see FIG. 15).
The Bridge/Extender pairs shown in Table 33 were added in 25 molar excess along with 1200 units of T4 DNA ligase and incubated overnight at 16 ° C. Excess Bridge/Extender was removed with a Qiagen PCR purification column. The ligated material was amplified by PCR using primers H43.XAExtPCR2 and Hucumnest shown in Table 34 for 10 cycles with the program shown in Table 35.
The soluble PCR product was run on a gel and showed a band of approximately 500 n, as expected (see FIG. 15B). The DNA was cleaved with enzymes SfiI and NotI, gel purified, and ligated to similarly cleaved vector PCES1.
Example 6
Description of Phage Display Vector CJRA05, a Member of the Library Built in Vector DY3F7.
Table 36 contains an annotated DNA sequence of a member of the library, CJRA05, see FIG. 16. Table 36 is to be read as follows: on each line everything that follows an exclamation mark “!” is a comment. All occurrences of A, C, G, and T before “!” are the DNA sequence. Case is used only to show that certain bases constitute special features, such as restriction sites, ribosome binding sites, and the like, which are labeled below the DNA. CJRA05 is a derivative of phage DY3F7, obtained by cloning an ApaLI to NotI fragment into these sites in DY3F31. DY3F31 is like DY3F7 except that the light chain and heavy chain genes have been replaced by “stuffer” DNA that does not code for any antibody. DY3F7 contains an antibody that binds streptavidin, but did not come from the present library.
The phage genes start with gene ii and continue with genes x, v, vii, ix, viii, iii, vi, i, and iv. Gene iii has been slightly modified in that eight codons have been inserted between the signal sequence and the mature protein and the final amino acids of the signal sequence have been altered. This allows restriction enzyme recognition sites EagI and XbaI to be present. Following gene iv is the phage origin of replication (ori). After ori is bla which confers resistance to ampicillin (ApR). The phage genes and bla are transcribed in the same sense.
After bla, is the Fab cassette (illustrated in FIG. 17) comprising:
-
- a) PlacZ promoter,
- b) A first Ribosome Binding Site (RBS1),
- c) The signal sequence form M13 iii,
- d) An ApaLI RERS,
- e) A light chain (a kappa L20::JK1 shortened by one codon at the V-J boundary in this case),
- f) An AscI RERS,
- g) A second Ribosome Binding Site (RBS2),
- h) A signal sequence, preferably PelB, which contains,
- i) An SfiI RERS,
- j) A synthetic 3-23 V region with diversity in CDR1 and CDR2,
- k) A captured CDR3,
- l) A partially synthetic J region (FR4 after BstEII),
- m) CH1,
- n) A NotI RERS,
- o) A His6 tag,
- p) A cMyc tag,
- q) An amber codon,
- r) An anchor DNA that encodes the same amino-acid sequence as codons 273 to 424 of M13 iii (as shown in Table 37).
- s) Two stop codons,
- t) An AvrII RERS, and
- u) A trp terminator.
The anchor (item r) encodes the same amino-acid sequence as do codons 273 to 424 of M13 iii but the DNA is approximately as different as possible from the wild-type DNA sequence. In Table 36, the III′ stump runs from base 8997 to base 9455. Below the DNA, as comments, are the differences with wild-type iii for the comparable codons with “!W.T” at the ends of these lines. Note that Met and Trp have only a single codon and must be left as is. These AA types are rare. Ser codons can be changed at all three base, while Leu and Arg codons can be changed at two.
In most cases, one base change can be introduced per codon. This has three advantages: 1) recombination with the wild-type gene carried elsewhere on the phage is less likely, 2) new restriction sites can be introduced, facilitating construction; and 3) sequencing primers that bind in only one of the two regions can be designed.
The fragment of M13 III shown in CJRA05 is the preferred length for the anchor segment. Alternative longer or shorter anchor segments defined by reference to whole mature III protein may also be utilized.
The sequence of M13 III consists of the following elements: Signal Sequence::Domain 1 (D1)::Linker 1 (L1)::Domain 2 (D2)::Linker 2 (L2)::Domain 3 (D3)::Transmembrane Segment (TM)::Intracellular anchor (IC) (see Table 38).
The pIII anchor (also known as trpIII) preferably consists of D2::L2::D3::TM::IC. Another embodiment for the pIII anchor consists of D2′::L2::D3::TM::IC (where D2′ comprises the last 21 residues of D2 with the first 109 residues deleted). A further embodiment of the pIII anchor consists of D2′ (C>S)::L2::D3::TM::IC (where D2′ (C>S) is D2′ with the single C converted to S), and d) D3::TM::IC.
Table 38 shows a gene fragment comprising the NotI site, His6 tag, cMyc tag, an amber codon, a recombinant enterokinase cleavage site, and the whole of mature M13 III protein. The DNA used to encode this sequence is intentionally very different from the DNA of wild-type gene iii as shown by the lines denoted “W.T.” containing the w.t. bases where these differ from this gene. III is divided into domains denoted “domain 1”, “linker 1”, “domain 2”, “linker 2”, “domain 3”, “transmembrane segment”, and “intracellular anchor”.
Alternative preferred anchor segments (defined by reference to the sequence of Table 38) include:
-
- codons 1-29 joined to codons 104-435, deleting domain 1 and retaining linker 1 to the end;
- codons 1-38 joined to codons 104-435, deleting domain 1 and retaining the rEK cleavage site plus linker 1 to the end from III;
- codons 1-29 joined to codons 236-435, deleting domain 1, linker 1, and most of domain 2 and retaining linker 2 to the end;
- codons 1-38 joined to codons 236-435, deleting domain 1, linker 1, and most of domain 2 and retaining linker 2 to the end and the rEK cleavage site;
- codons 1-29 joined to codons 236-435 and changing codon 240 to Ser(e.g., agc), deleting domain 1, linker 1, and most of domain 2 and retaining linker 2 to the end; and
- codons 1-38 joined to codons 236-435 and changing codon 240 to Ser(e.g., agc), deleting domain 1, linker 1, and most of domain 2 and retaining linker 2 to the end and the rEK cleavage site.
The constructs would most readily be made by methods similar to those of Wang and Wilkinson (Biotechnigues 2001: 31(4)722-724) in which PCR is used to copy the vector except the part to be deleted and matching restriction sites are introduced or retained at either end of the part to be kept. Table 39 shows the oligonucleotides to be used in deleting parts of the III anchor segment. The DNA shown in Table 38 has an NheI site before the DINDDRMA recombinant enterokinase cleavage site (rEKCS). If NheI is used in the deletion process with this DNA, the rEKCS site would be lost. This site could be quite useful in cleaving Fabs from the phage and might facilitate capture of very high-affinity antibodies. One could mutagenize this sequence so that the NheI site would follow the rEKCS site, an Ala Ser amino-acid sequence is already present. Alternatively, one could use SphI for the deletions. This would involve a slight change in amino acid sequence but would be of no consequence.
Example 7
Selection of Antigen Binders from an Enriched Library of Human Antibodies Using Phage Vector DY3F31.
In this example the human antibody library used is described in de Haard et al., (Journal of Biological Chemistry, 274 (26): 18218-30 (1999). This library, consisting of a large non-immune human Fab phagemid library, was first enriched on antigen, either on streptavidin or on phenyl-oxazolone (phOx). The methods for this are well known in the art. Two preselected Fab libraries, the first one selected once on immobilized phOx-BSA (R1-ox) and the second one selected twice on streptavidin (R2-strep), were chosen for recloning.
These enriched repertoires of phage antibodies, in which only a very low percentage have binding activity to the antigen used in selection, were confirmed by screening clones in an ELISA for antigen binding. The selected Fab genes were transferred from the phagemid vector of this library to the DY3F31 vector via ApaL1-Not1 restriction sites.
DNA from the DY3F31 phage vector was pretreated with ATP dependent DNAse to remove chromosomal DNA and then digested with ApaL1 and Not1. An extra digestion with AscI was performed in between to prevent self-ligation of the vector. The ApaL1/NotI Fab fragment from the preselected libraries was subsequently ligated to the vector DNA and transformed into competent XL1-blue MRF′ cells.
Libraries were made using vector:insert ratios of 1:2 for phOx-library and 1:3 for STREP library, and using 100 ng ligated DNA per 50 μl of electroporation-competent cells (electroporation conditions : one shock of 1700 V, 1 hour recovery of cells in rich SOC medium, plating on amplicillin-containing agar plates).
This transformation resulted in a library size of 1.6×106 for R1-ox in DY3F31 and 2.1×106 for R2-strep in DY3F31. Sixteen colonies from each library were screened for insert, and all showed the correct size insert (±1400 bp) (for both libraries).
Phage was prepared from these Fab libraries as follows. A representative sample of the library was inoculated in medium with ampicillin and glucose, and at OD 0.5, the medium exchanged for ampicillin and 1 mM IPTG. After overnight growth at 37 ° C., phage was harvested from the supernatant by PEG-NaCl precipitation. Phage was used for selection on antigen. R1-ox was selected on phOx-BSA coated by passive adsorption onto immunotubes and R2-strep on streptavidin coated paramagnetic beads (Dynal, Norway), in procedures described in de Haard et. al. and Marks et. al., Journal of Molecular Biology, 222(3): 581-97 (1991). Phage titers and enrichments are given in Table 40.
Clones from these selected libraries, dubbed R2-ox and R3-strep respectively, were screened for binding to their antigens in ELISA. 44 clones from each selection were picked randomly and screened as phage or soluble Fab for binding in ELISA. For the libraries in DY3F31, clones were first grown in 2TY-2% glucose-50 μg/ml AMP to an OD600 of approximately 0.5, and then grown overnight in 2TY-50 μg/ml AMP +/−1 mM IPTG. Induction with IPTG may result in the production of both phage-Fab and soluble Fab. Therefore the (same) clones were also grown without IPTG. Table 41 shows the results of an ELISA screening of the resulting supernatant, either for the detection of phage particles with antigen binding (Anti-M13 HRP=anti-phage antibody), or for the detection of human Fabs, be it on phage or as soluble fragments, either with using the anti-myc antibody 9E10 which detects the myc-tag that every Fab carries at the C-terminal end of the heavy chain followed by a HRP-labeled rabbit-anti-Mouse serum (column 9E10/RAM-HRP), or with anti-light chain reagent followed by a HRP-labeled goat-anti-rabbit antiserum(anti-CK/CL Gar-HRP).
The results shows that in both cases antigen-binders are identified in the library, with as Fabs on phage or with the anti-Fab reagents (Table 41). IPTG induction yields an increase in the number of positives. Also it can be seen that for the phOx-clones, the phage ELISA yields more positives than the soluble Fab ELISA, most likely due to the avid binding of phage. Twenty four of the ELISA-positive clones were screened using PCR of the Fab-insert from the vector, followed by digestion with BstNI. This yielded 17 different patterns for the phOx-binding Fab's in 23 samples that were correctly analyzed, and 6 out of 24 for the streptavidin binding clones. Thus, the data from the selection and screening from this pre-enriched non-immune Fab library show that the DY3F31 vector is suitable for display and selection of Fab fragments, and provides both soluble Fab and Fab on phage for screening experiments after selection.
Example 8
Selection of Phage-antibody Libraries on Streptavidin Magnetic Beads.
The following example describes a selection in which one first depletes a sample of the library of binders to streptavidin and optionally of binders to a non-target (i.e., a molecule other than the target that one does not want the selected Fab to bind). It is hypothesized that one has a molecule, termed a “competitive ligand”, which binds the target and that an antibody which binds at the same site would be especially useful.
For this procedure Streptavidin Magnetic Beads (Dynal) were blocked once with blocking solution (2% Marvel Milk, PBS (pH 7.4), 0.01% Tween-20 (“2% MPBST”)) for 60 minutes at room temperature and then washed five times with 2% MPBST. 450 μL of beads were blocked for each depletion and subsequent selection set.
Per selection, 6.25 μL of biotinylated depletion target (1 mg/mL stock in PBST) was added to 0.250 mL of washed, blocked beads (from step 1). The target was allowed to bind overnight, with tumbling, at 4° C. The next day, the beads are washed 5 times with PBST.
Per selection, 0.010 mL of biotinylated target antigen (1 mg/mL stock in PBST) was added to 0.100 mL of blocked and washed beads (from step 1). The antigen was allowed to bind overnight, with tumbling, at 4° C. The next day, the beads were washed 5 times with PBST.
In round 1, 2×1012 up to 1013 plaque forming units (pfu) per selection were blocked against non-specific binding by adding to 0.500 mL of 2% MPBS (=2% MPBST without Tween) for 1 hr at RT (tumble). In later rounds, 1011 pfu per selection were blocked as done in round 1.
Each phage pool was incubated with 50 μL of depletion target beads (final wash supernatant removed just before use) on a Labquake rotator for 10 min at room temperature. After incubation, the phage supernatant was removed and incubated with another 50 μL of depletion target beads. This was repeated 3 more times using depletion target beads and twice using blocked streptavidin beads for a total of 7 rounds of depletion, so each phage pool required 350 μL of depletion beads.
A small sample of each depleted library pool was taken for titering. Each library pool was added to 0.100 mL of target beads (final wash supernatant was removed just before use) and allowed to incubate for 2 hours at room temperature (tumble).
Beads were then washed as rapidly as possible (e.g.,3 minutes total) with 5×0.500 mL PBST and then 2× with PBS. Phage still bound to beads after the washing were eluted once with 0.250 mL of competitive ligand (˜1 μμM) in PBST for 1 hour at room temperature on a Labquake rotator. The eluate was removed, mixed with 0.500 mL Minimal A salts solution and saved. For a second selection, 0.500 mL 100 mM TEA was used for elution for 10 min at RT, then neutralized in a mix of 0.250 mL of 1 M Tris, pH 7.4+0.500 mL Min A salts.
After the first selection elution, the beads can be eluted again with 0.300 mL of non-biotinylated target (1 mg/mL) for 1 hr at RT on a Labquake rotator. Eluted phage are added to 0.450 mL Minimal A salts.
Three eluates (competitor from 1st selection, target from 1st selection and neutralized TEA elution from 2nd selection) were kept separate and a small aliquot taken from each for titering. 0.500 mL Minimal A salts were added to the remaining bead aliquots after competitor and target elution and after TEA elution. Take a small aliquot from each was taken for tittering.
Each elution and each set of eluted beads was mixed with 2×YT and an aliquot (e.g., 1 mL with 1. E 10/mL) of XL1-Blue MRF′ E. coli cells (or other F′ cell line) which had been chilled on ice after having been grown to mid-logarithmic phase, starved and concentrated (see procedure below—“Mid-Log prep of XL-1 blue MRF′ cells for infection”).
After approximately 30 minutes at room temperature, the phage/cell mixtures were spread onto Bio-Assay Dishes (243×243×18 mm, Nalge Nunc) containing 2×YT, 1 mM IPTG agar. The plates were incubated overnight at 30° C. The next day, each amplified phage culture was harvested from its respective plate. The plate was flooded with 35 mL TBS or LB, and cells were scraped from the plate. The resuspended cells were transferred to a centrifuge bottle. An additional 20 mL TBS or LB was used to remove any cells from the plate and pooled with the cells in the centrifuge bottle. The cells were centrifuged out, and phage in the supernatant was recovered by PEG precipitation. Over the next day, the amplified phage preps were titered.
In the first round, two selections yielded five amplified eluates. These amplified eluates were panned for 2-3 more additional rounds of selection using ˜1. E 12 input phage/round. For each additional round, the depletion and target beads were prepared the night before the round was initiated.
For the elution steps in subsequent rounds, all elutions up to the elution step from which the amplified elution came from were done, and the previous elutions were treated as washes. For the bead infection amplified phage, for example, the competitive ligand and target elutions were done and then tossed as washes (see below). Then the beads were used to infect E. coli. Two pools, therefore, yielded a total of 5 final elutions at the end of the selection.
-
- 1st selection set
- A. Ligand amplified elution: elute w/ligand for 1 hr, keep as elution
- B. Target amplified elution: elute w/ligand for 1 hr, toss as wash elute w/target for 1 hr, keep as elution
- C. Bead infect. amp. elution: elute w/ligand for 1 hr, toss as wash elute w/target for 1 hr, toss as wash elute w/cell infection, keep as elution
- 2nd selection set
- A. TEA amplified elution; elute w/TEA 10 min, keep as elution
- B. Bead infect. amp. elution; elute w/TEA 10 min, toss as wash elute w/cell infection, keep as elution
Mid-log Prep of XL1 Blue MRF′ Cells for Infection
(Based on Barbas et al. Phage Display Manual Procedure)
Culture XL1 blue MRF′ in NZCYM (12.5 mg/mL tet) at 37° C. and 250 rpm overnight. Started a 500 mL culture in 2 liter flask by diluting cells 1/50 in NZCYM/tet (10 mL overnight culture added) and incubated at 37° C. at 250 rpm until OD600 of 0.45 (1.5-2 hrs) was reached. Shaking was reduced to 100 rpm for 10 min. When OD600 reached between 0.55-0.65, cells were transferred to 2×250 mL centrifuge bottles, centrifuged at 600 g for 15 min at 4° C. Supernatant was poured off. Residual liquid was removed with a pipette.
The pellets were gently resuspended (not pipetting up and down) in the original volume of 1×Minimal A salts at room temp. The resuspended cells were transferred back into 2-liter flask, shaken at 100 rpm for 45 min at 37° C. This process was performed in order to starve the cells and restore pili. The cells were transferred to 2×250 mL centrifuge bottles, and centrifuged as earlier.
The cells were gently resuspended in ice cold Minimal A salts (5 mL per 500 mL original culture). The cells were put on ice for use in infections as soon as possible.
The phage eluates were brought up to 7.5 mL with 2×YT medium and 2.5 mL of cells were added. Beads were brought up to 3 mL with 2×YT and 1 mL of cells were added. Incubated at 37° C. for 30 min. The cells were plated on 2×YT, 1 mM IPTG agar large NUNC plates and incubated for 18 hr at 30° C.
Example 9
Incorporation of Synthetic Region in FR1/3 Region.
Described below are examples for incorporating of fixed residues in antibody sequences for light chain kappa and lambda genes, and for heavy chains. The experimental conditions and oligonucleotides used for the examples below have been described in previous examples (e.g., Examples 3 & 4).
The process for incorporating fixed FR1 residues in an antibody lambda sequence consists of 3 steps (see FIG. 18): (1) annealing of single-stranded DNA material encoding VL genes to a partially complementary oligonucleotide mix (indicated with Ext and Bridge), to anneal in this example to the region encoding residues 5-7 of the FR1 of the lambda genes (indicated with X . . . X; within the lambda genes the overlap may sometimes not be perfect); (2) ligation of this complex; (3) PCR of the ligated material with the indicated primer (‘PCRpr’) and for example one primer based within the VL gene. In this process the first few residues of all lambda genes will be encoded by the sequences present in the oligonucleotides (Ext., Bridge or PCRpr). After the PCR, the lambda genes can be cloned using the indicated restriction site for ApaLI.
The process for incorporating fixed FR1 residues in an antibody kappa sequence (FIG. 19) consists of 3 steps: (1) annealing of single-stranded DNA material encoding VK genes to a partially complementary oligonucleotide mix (indicated with Ext and Bri), to anneal in this example to the region encoding residues 8-10 of the FR1 of the kappa genes (indicated with X . . . X; within the kappa genes the overlap may sometimes not be perfect) ; (2) ligation of this complex; (3) PCR of the ligated material with the indicated primer (‘PCRpr’) and for example one primer based within the VK gene. In this process the first few (8) residues of all kappa genes will be encode by the sequences present in the oligonucleotides (Ext., Bridge or PCRpr.). After the PCR, the kappa genes can be cloned using the indicated restriction site for ApaLI.
The process of incorporating fixed FR3 residues in a antibody heavy chain sequence (FIG. 20) consists of 3 steps: (1) annealing of single-stranded DNA material encoding part of the VH genes (for example encoding FR3, CDR3 and FR4 regions) to a partially complementary oligonucleotide mix (indicated with Ext and Bridge), to anneal in this example to the region encoding residues 92-94 (within the FR3 region) of VH genes (indicated with X . . . X; within the VH genes the overlap may sometimes not be perfect); (2) ligation of this complex; (3) PCR of the ligated material with the indicated primer (‘PCRpr’) and for example one primer based within the VH gene (such as in the FR4 region). In this process certain residues of all VH genes will be encoded by the sequences present in the oligonucleotides used here, in particular from PCRpr (for residues 70-73), or from Ext/Bridge oligonucleotides (residues 74-91). After the PCR, the partial VH genes can be cloned using the indicated restriction site for XbaI.
It will be understood that the foregoing is only illustrative of the principles of this invention and that various modifications can be made by those skilled in the art without departing from the scope of and sprit of the invention.
| TABLE 1 |
|
|
| Human GLG FR3 sequences |
|
|
| ! VH1 |
|
| ! 66 67 68 69 70 71 72 73 74 75 76 77 78 7980 |
| agg gtc aco atg acc agg gac acg too atc agc aca gcc tac atg |
| ! 81 82 82a 82b 82c 83 84 85 86 87 88 89 90 91 92 |
| gag ctg agc agg ctg aga tot gac gac acg gcc gtg tat tac tgt |
| ! 93 94 95 |
| |
| gcg aga ga ! 1-02# 1 |
| aga gtc acc att acc agg gac aca too gcg agc aca gcc tac atg |
| gag ctg agc agc ctg aga tct gaa gac acg gct gtg tat tac tgt |
| |
| gcg aga ga ! 1-03# 2 |
| aga gto acc atg acc agg aac acc too ata agc aca gcc tac atg |
| gag ctg agc agc ctg aga tct gag gac acg gcc gtg tat tac tgt |
| |
| gcg aga gg ! 1-08# 3 |
| aga gtc acc atg acc aca gac aca tcc acg agc aca gcc tac atg |
| gag ctg agg agc ctg aga tct gac gac acg gcc gtg tat tac tgt |
| |
| gcg aga ga ! 1-18# 4 |
| aga gtc acc atg acc gag gac aca tct aca gac aca gcc tac atg |
| gag ctg agc agc ctg aga tct gag gac acg gcc gtg tat tac tgt |
| |
| gca aca ga ! 1-24# 5 |
| aga gtc acc att acc agg gac agg tct atg agc aca gcc tac atg |
| gag ctg agc agc ctg aga tct gag gac aca gcc atg tat tac tgt |
| |
| gca aga ta ! 1-45# 6 |
| aga gtc acc atg acc agg gac acg tcc acg agc aca gtc tac atg |
| gag ctg agc agc ctg aga tct gag gac acg gcc gtg tat tac tgt |
| |
| gcg aga ga ! 1-46# 7 |
| aga gtc acc att acc agg gac atg tcc aca agc aca gcc tac atg |
| gag ctg agc agc ctg aga tcc gag gac acg gcc gtg tat tac tgt |
| |
| gcg gca ga ! 1-58# 8 |
| aga gtc acg att acc gcg gac gaa tcc acg agc aca gcc tac atg |
| gag ctg agc agc ctg aga tct gag gac acg gcc gtg tat tac tgt |
| |
| gcg aga ga ! 1-69# 9 |
| aga gtc acg att acc gag gac aaa tcc acg agc aca gcc tac atg |
| gag ctg agc agc ctg aga tct gag gac acg gcc gtg tat tac tgt |
| |
| gcg aga ga ! 1-e# 10. |
| aga gtc acc ata acc gcg gac acg tct aca gac aca gcc tac atg |
| gag ctg agc agc ctg aga tct gag gac acg gcc gtg tat tac tgt |
| |
| gca aca ga ! 1-f# 11 |
| ! VH2 |
| agg ctc acc atc acc aag gac acc tcc aaa aaccag gtg gtc ctt |
| aca atg acc aac atg gac cct gtg gac aca gcc aca tat tac tgt |
| gca cac aga c ! 2-05# 12 |
| |
| agg ctc acc atc tcc aag gac acc tcc aaa agc cag gtg gtc ctt |
| acc atg acc aac atg gac cct gtg gac aca gcc aca tat tac tgt |
| gca cgg ata c ! 2-26# 13 |
| |
| agg ctc acc atc tcc aag gac acc tcc aaa aac cag gtg gtc ctt |
| aca atg acc aac atg gac cct gtg gac aca gcc acg tat tac tgt |
| gca cgg ata c ! 2-70# 14 |
| |
| ! VH3 |
| cga ttc acc atc tcc aga gac aac gcc aag aac tca ctg tat ctg |
| caa atg aac agc ctg aga gcc gag gac acg gct gtg tat tac tgt |
| gcg aga ga ! 3-07# 15 |
| |
| cga ttc acc atc tcc aga gac aac gcc aag aac tcc ctg tat ctg |
| caa atg aac agt ctg aga gct gag gac acg gcc ttg tat tac tgt |
| gca aaa gat a ! 3-09# 16 |
| |
| cga ttc acc atc tcc aga gac aac gcc aag aac tca ctg tat ctg |
| caa atg aac agc ctg aga gcc gag gac acg gcc gtg tat tac tgt |
| gcg aga ga ! 3-11# 17 |
| |
| cga ttc acc atc tcc aga gac aac gcc aag aac tca ctg tat ctg |
| caa atg aac agc ctg aga gcc gag gac acg gcc gtg tat tac tgt |
| gcg aga ga ! 3-13# 18 |
| |
| aga ttc acc atc tca aga gat gat tca aaa aac acg ctg tat ctg |
| caa atg aac agc ctg aaa acc gag gac aca gcc gtg tat tac tgt |
| acc aca ga ! 3-15# 19 |
| |
| cga ttc acc atc tcc aga gac aac gcc aag aac tcc ctg tat ctg |
| caa atg aac agt ctg aga gcc gag gac acg gcc ttg tat cac tgt |
| gcg aga ga ! 3-20# 20 |
| |
| cga ttc acc atc tcc aga gac aac gcc aag aac tca ctg tat ctg |
| caa atg aac agc ctg aga gcc gag gac acg gct gtg tat tac tgt |
| gcg aga ga ! 3-21# 21 |
| |
| cgg ttc acc atc tcc aga gac aat tcc aag aac acg ctg tat ctg |
| caa atg aac agc ctg aga gcc gag gac acg gcc gta tat tac tgt |
| gcg aaa ga ! 3-23# 22 |
| |
| cga ttc acc atc tcc aga gac aat tcc aag aac acg ctg tat ctg |
| caa atg aac agc ctg aga gct gag gac acg gct gtg tat tac tgt |
| gcg aaa ga ! 3-30# 23 |
| |
| cga ttc acc atc tcc aga gac aat tcc aag aac acg ctg tat ctg |
| caa atg aac agc ctg aga gct gag gac acg gct gtg tat tac tgt |
| gcg aga ga ! 3303# 24 |
| |
| cga tte acc atc tcc aga gac aat tcc aag aac acg ctg tat ctg |
| caa atg aac acc ctg aga gct gag gac acg gct gtg tat tac tgt |
| gcg aaa ga ! 3305# 25 |
| |
| cga ttc acc atc tcc aga gac aat tcc aag aac acg ctg tat ctg |
| caa atg aae agc ctg aga gcc gag gac acg gct gtg tat tac tgt |
| gcg aga ga ! 3-33# 26 |
| |
| cga ttc acc ate tcc aga gac aae acc aaa aac tcc ctg tat ctg |
| caa atg aac agt ctg aga act gag gac aee gee ttg tat tac tgt |
| gca aaa gat a! 3-43# 27 |
| |
| cga ttc acc atc tcc aga gac aat gcc aag aac tca ctg tat ctg |
| caa atg aac agc ctg aga gac gag gac acg gct gtg tat tac tgt |
| gcg aga ga ! 3-48# 28 |
| |
| aga ttc acc atc tca aga gat ggt tcc aaa agc atc gcc tat ctg |
| caa atg aae acc ctg aaa acc gag gac aca gcc gtg tat tac tgt |
| act aga ga ! 3-49# 29 |
| |
| cga ttc acc atc tcc aga gac aat tcc aag aac acg ctg tat ctt |
| caa atg aac acc ctg aga gcc gag gac acg gcc gtg tat tac tgt |
| gcg aga ga ! 3-53# 30 |
| |
| aga tte acc atc tcc aga gac aat tcc aag aac acg ctg tat ctt |
| caa atg ggc acc ctg aga gct gag gac atg gct gtg tat tac tgt |
| gcg aga ga ! 3-64# 31 |
| |
| aga ttc acc atc tcc aga gac aat tcc aag aac acg ctg tat ctt |
| caa atg aac agc ctg aga gct gag gac acg gct gtg tat tac tgt |
| gcg aga ga ! 3-66# 32 |
| |
| aga ttc acc atc tca aga gat gat tca aag aac tca ctg tat ctg |
| caa atg aac agc ctg aaa acc gag gac acg gcc gtg tat tac tgt |
| gct aga ga ! 3-72# 33 |
| |
| agg ttc acc atc tcc aga gat gat tca aag aac acg gcg tat ctg |
| caa atg aac agc ctg aaa acc gag gac acg gcc gtg tat tac tgt |
| act aga ca ! 3-73# 34 |
| |
| cga ttc acc atc tcc aga gac aac gcc aag aac acg ctg tat ctg |
| caa atg aac agt ctg aga gcc gag gac acg gct gtg tat tac tgt |
| gea aga ga ! 3-74# 35 |
| |
| aga ttc acc atc tcc aga gac aat tcc aag aac acg ctg eat ctt |
| caa atg aac agc ctg aga gct gag gac acg gct gtg tat tac tgt |
| aag aaa ga ! 3-d# 36 |
| |
| ! VH4 |
| cga gtc acc ata tca gta gac aag tcc aag aac cag ttc tcc ctg |
| aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt |
| gcg aga ga ! 4-04# 37 |
| |
| cga gtc acc atg tca gta gac acg tcc aag aac cag ttc tcc ctg |
| aag ctg agc tct gtg acc gcc gtg gac acg gcc gtg tat tac tgt |
| gcg aga aa ! 4-28# 38 |
| |
| cga gtt acc ata tca gta gac acg tct aag aac cag ttc tcc ctg |
| aag ctg agc tct gtg act gcc gcg gac acg gce gtg tat tac tgt |
| gcg aga ga ! 4301# 39 |
| |
| cga gtc acc ata tca gta gac agg tcc aag aac cag ttc tcc ctg |
| aag ctg agc tct gtg acc gcc gcg gac acg gcc gtg tat tac tgt |
| gce aga ga ! 4302# 40 |
| |
| cga gtt acc ata tca gta gac acg tcc aag aac cag ttc tcc ctg |
| aag ctg agc tct gtg act gcc gca gac acg gcc gtg tat tac tgt |
| gcc aga ga ! 4304# 41 |
| |
| cga gtt acc ata tca gta gac acg tct aag aac cag ttc tcc ctg |
| aag ctg agc tct gtg act gcc gcg gac acg gcc gtg tat tac tgt |
| gcg aga ga ! 4-31# 42 |
| |
| cga gtc acc ata tca gta gac acg tcc aag aac cag ttc tcc ctg |
| aag ctg agc tct gtg acc gcc gcg gac acg gct gtg tat tac tgt |
| gcg aga ga ! 4-34# 43 |
| |
| cga gtc acc ata tcc gta gac acg tcc aag aac cag ttc tcc ctg |
| aag ctg agc tct gtg acc gcc gca gac acg gct gtg tat tac tgt |
| gcg aga ca ! 4-39# 44 |
| |
| cga gtc acc ata tca gta gac acg tcc aag aac cag ttc tcc ctg |
| aag ctg agc tct gtg acc gct gcg gac acg gcc gtg tat tac tgt |
| gcg aga ga ! 4-59# 45 |
| |
| cga gtc acc ata tca gta gac acg tcc aag aac cag ttc tcc ctg |
| aag ctg agc tct gtg acc gct gcg gac acg gcc gtg tat tac tgt |
| gcg aga ga ! 4-61# 46 |
| |
| cga gtc acc ata tca gta gac acg tcc aag aac cag ttc tcc ctg |
| aag ctg agc tct gtg acc gcc gca gac acg gcc gtg tat tac tgt |
| gcg aga ga ! 4-b# 47 |
| |
| ! VH5 |
| cag gtc acc atc tca gcc gac aag tcc atc agc acc gcc tac ctg |
| cag tgg agc agc ctg aag gcc teg gac acc gcc atg tat tac tgt |
| gcg aga ca ! 5-51# 48 |
| |
| cac gtc acc atc tca gct gac aag tcc atc agc act gcc tac ctg |
| cag tgg agc agc ctg aag gcc tcg gac acc gcc atg tat tac tgt |
| gcg aga ! 5-a# 49 |
| |
| ! VH6 |
| cga ata acc atc aac eca gac aca tcc aag aac cag ttc tcc ctg |
| cag ctg aac tct gtg act ccc gag gac acg gct gtg tat tac tgt |
| gca aga ga ! 6-1# 50 |
| |
| ! VH7 |
| cgg ttt gtc ttc tcc ttg gac acc tct gtc agc acg gca tat ctg |
| cag atc tgc agc cta aag gct gag gac act gcc gtg tat tac tgt |
| gcg aga ga ! 74.1# 51 |
|
| TABLE 2 |
|
|
| Enzymes that either cut 15 or more human GLGs or have 5+-base |
| recognition in FR3 |
|
|
|
REname |
|
#sites |
|
Recognition |
|
GLGid#:base# |
GLGid#:base# |
GLGid#:base#. . . |
|
|
|
There are 2 hits at base# 3 |
|
1:4 |
2:4 |
3:4 |
4:4 |
5:4 |
6:4 |
|
7:4 |
8:4 |
9:4 |
10:4 |
11:4 |
37:4 |
|
37:58 |
38:4 |
38:58 |
39:4 |
39:58 |
40:4 |
|
40:58 |
41:4 |
41:58 |
42:4 |
42:58 |
43:4 |
|
43:58 |
44:4 |
44:58 |
45:4 |
45:58 |
46:4 |
|
46:58 |
47:4 |
47:58 |
48:4 |
49:4 |
50:58 |
|
There are 24 hits at base# 4 |
|
1:4 |
2:4 |
3:4 |
4:4 |
5:4 |
6:4 |
|
7:4 |
8:4 |
9:4 |
10:4 |
11:4 |
37:4 |
|
37:58 |
38:4 |
38:58 |
39:58 |
40:4 |
40:58 |
|
41:58 |
42:58 |
43:4 |
43:58 |
44:4 |
44:58 |
|
45:4 |
45:58 |
46:4 |
46:58 |
47:4 |
47:58 |
|
48:4 |
49:4 |
50:58 |
|
There are 21 hits at base# 4 |
|
1:5 |
2:5 |
3:5 |
4:5 |
5:5 |
6:5 |
|
7:5 |
8:5 |
11:5 |
12:5 |
12:11 |
13:5 |
|
14:5 |
15:5 |
16:5 |
17:5 |
18:5 |
19:5 |
|
20:5 |
21:5 |
22:5 |
23:5 |
24:5 |
25:5 |
|
26:5 |
27:5 |
28:5 |
29:5 |
30:5 |
31:5 |
|
32:5 |
33:5 |
34:5 |
35:5 |
36:5 |
37:5 |
|
38:5 |
40:5 |
43:5 |
44:5 |
45:5 |
46:5 |
|
47:5 |
48:5 |
49:5 |
|
There are 44 hits at base# 5 |
|
1:9 |
1:42 |
2:42 |
3:9 |
3:42 |
4:9 |
|
4:42 |
5:9 |
5:42 |
6:42 |
6:78 |
7:9 |
|
7:42 |
8:21 |
8:42 |
9:42 |
10:42 |
11:42 |
|
12:57 |
13:48 |
13:57 |
14:57 |
31:72 |
38:9 |
|
48:78 |
49:78 |
|
There are 11 hits at base# 42 |
|
There are 1 hits at base# 48 Could cause raggedness. |
|
1:14 |
2:14 |
5:14 |
6:14 |
7:14 |
8:14 |
|
8:65 |
9:14 |
10:14 |
11:14 |
12:14 |
13:14 |
|
14:14 |
15:65 |
17:14 |
17:65 |
18:65 |
19:65 |
|
20:65 |
21:65 |
22:65 |
26:65 |
29:65 |
30:65 |
|
33:65 |
34:65 |
35:65 |
37:65 |
38:65 |
39:65 |
|
40:65 |
42:65 |
43:65 |
48:65 |
49:65 |
50:65 |
|
51:14 |
|
There are 23 hits at base# 65 |
|
There are 14 hits at base# 14 |
|
1:47 |
2:47 |
3:47 |
4:47 |
5:47 |
6:47 |
|
7:47 |
8:47 |
9:47 |
10:47 |
11:47 |
16:63 |
|
23:63 |
24:63 |
25:63 |
31:63 |
32:63 |
36:63 |
|
37:47 |
37:52 |
38:47 |
38:52 |
39:47 |
39:52 |
|
40:47 |
40:52 |
41:47 |
41:52 |
42:47 |
42:52 |
|
43:47 |
43:52 |
44:47 |
44:52 |
45:47 |
45:52 |
|
46:47 |
46:52 |
47:47 |
47:52 |
49:15 |
50:47 |
|
There are 23 hits at base# 47 |
|
There are 11 hits at base# 52 Only 5 bases from 47 |
|
1:48 |
2:48 |
3:48 |
5:48 |
6:48 |
7:48 |
|
8:48 |
9:48 |
10:48 |
11:48 |
37:48 |
38:48 |
|
39:48 |
40:48 |
41:48 |
42:48 |
43:48 |
44:48 |
|
45:48 |
46:48 |
47:48 |
|
There are 21 hits at base# 48 |
|
1:48 |
2:28 |
19:36 |
22:36 |
23:36 |
24:36 |
|
25:36 |
26:36 |
35:36 |
37:67 |
39:67 |
40:67 |
|
41:67 |
42:67 |
43:67 |
44:67 |
45:67 |
46:67 |
|
47:67 |
|
There are 10 hits at base# 67 |
|
There are 7 hits at base# 36 |
|
1:49 |
1:58 |
2:49 |
2:58 |
3:49 |
3:58 |
|
3:65 |
4:49 |
4:58 |
5:49 |
5:58 |
5:65 |
|
6:49 |
6:58 |
6:65 |
7:49 |
7:58 |
7:65 |
|
8:49 |
8:58 |
9:49 |
9:58 |
9:65 |
10:49 |
|
10:58 |
10:65 |
11:49 |
11:58 |
11:65 |
15:58 |
|
16:58 |
16:65 |
17:58 |
18:58 |
20:58 |
21:58 |
|
22:58 |
23:58 |
23:65 |
24:58 |
24:65 |
25:58 |
|
25:65 |
26:58 |
27:58 |
27:65 |
28:58 |
30:58 |
|
31:58 |
31:65 |
32:58 |
32:65 |
35:58 |
36:58 |
|
36:65 |
37:49 |
38:49 |
39:26 |
39:49 |
40:49 |
|
41:49 |
42:26 |
42:49 |
43:49 |
44:49 |
45:49 |
|
46:49 |
47:49 |
48:12 |
49:12 |
51:65 |
|
There are 29 hits at base# 58 |
|
There are 22 hits at base# 49 Only nine base from 58 |
|
There are 16 hits at base# 65 Only seven bases from 58 |
|
1:61 |
2:61 |
3:61 |
4:61 |
5:61 |
6:61 |
|
7:61 |
9:61 |
10:61 |
11:61 |
51:47 |
|
There are 10 hits at base# 61 |
|
1:61 |
2:61 |
3:61 |
4:61 |
5:61 |
6:61 |
|
7:61 |
8:61 |
9:61 |
10:61 |
11:61 |
51:47 |
|
There are 11 hits at base# 61 |
|
1:64 |
2:64 |
3:64 |
4:64 |
5:64 |
6:64 |
|
7:64 |
8:64 |
9:64 |
10:64 |
11:64 |
16:57 |
|
20:57 |
27:57 |
35:57 |
48:67 |
49:67 |
|
There are 11 hits at base# 64 |
|
There are 4 hits at base# 57 |
|
There are 2 hits at base# 67 Could be ragged. |
|
1:72 |
2:72 |
3:72 |
4:72 |
5:72 |
6:72 |
|
7:72 |
8:72 |
9:72 |
10:72 |
11:72 |
15:72 |
|
17:72 |
18:72 |
19:72 |
21:72 |
23:72 |
24:72 |
|
25:72 |
26:72 |
28:72 |
29:72 |
30:72 |
31:72 |
|
32:72 |
33:72 |
34:72 |
35:72 |
36:72 |
37:72 |
|
38:72 |
39:72 |
40:72 |
41:72 |
42:72 |
43:72 |
|
44:72 |
45:72 |
46:72 |
47:72 |
48:72 |
49:72 |
|
50:72 |
51:72 |
|
There are 44 hits at base# 72 |
|
1:74 |
3:74 |
4:74 |
5:74 |
7:74 |
8:74 |
|
9:74 |
10:74 |
11:74 |
17:74 |
22:74 |
30:74 |
|
33:74 |
34:74 |
37:74 |
38:74 |
39:74 |
40:74 |
|
41:74 |
42:74 |
45:74 |
46:74 |
47:74 |
|
There are 23 hits at base# 74 |
|
1:74 |
3:74 |
4:74 |
5:74 |
7:74 |
8:74 |
|
9:74 |
10:74 |
11:74 |
17:74 |
22:74 |
30:74 |
|
33:74 |
34:74 |
37:74 |
38:74 |
39:74 |
40:74 |
|
41:74 |
42:74 |
45:74 |
46:74 |
47:74 |
|
There are 23 hits at base# 74 |
|
1:74 |
3:74 |
4:74 |
5:74 |
7:74 |
8:74 |
|
9:74 |
10:74 |
11:74 |
17:74 |
22:74 |
30:74 |
|
33:74 |
34:74 |
37:74 |
38:74 |
39:74 |
40:74 |
|
41:74 |
42:74 |
45:74 |
46:74 |
47:74 |
|
There are 23 hits at base# 74 |
|
1:75 |
3:75 |
4:75 |
5:75 |
7:75 |
8:75 |
|
9:75 |
10:75 |
11:75 |
16:75 |
17:75 |
20:75 |
|
22:75 |
30:75 |
33:75 |
34:75 |
37:75 |
38:75 |
|
39:75 |
40:75 |
41:75 |
42:75 |
45:75 |
46:75 |
|
47:75 |
48:63 |
49:63 |
|
There are 25 hits at base # 75 |
|
Bst4CI ACNgt 65° C. 63 Sites There is a third isoschismer |
|
1:86 |
2:86 |
3:86 |
4:86 |
5:86 |
6:86 |
|
7:34 |
7:86 |
8:86 |
9:86 |
10:86 |
11:86 |
|
12:86 |
13:86 |
14:86 |
15:36 |
15:86 |
16:53 |
|
16:86 |
17:36 |
17:86 |
18:86 |
19:86 |
20:53 |
|
20:86 |
21:36 |
21:86 |
22:0 |
22:86 |
23:86 |
|
24:86 |
25:86 |
26:86 |
27:53 |
27:86 |
28:36 |
|
28:86 |
29:86 |
30:86 |
31:86 |
32:86 |
33:36 |
|
33:86 |
34:86 |
35:53 |
35:86 |
36:86 |
37:86 |
|
38:86 |
39:86 |
40:86 |
41:86 |
42:86 |
43:86 |
|
44:86 |
45:86 |
46:86 |
47:86 |
48:86 |
49:86 |
|
50:86 |
51:0 |
51:86 |
|
There are 51 hits at base# 86 All the other sites are well away |
|
1:86 |
2:86 |
3:86 |
4:86 |
5:86 |
6:86 |
|
7:34 |
7:86 |
8:86 |
9:86 |
10:86 |
11:86 |
|
12:86 |
13:86 |
14:86 |
15:36 |
15:86 |
16:53 |
|
16:86 |
17:36 |
17:86 |
18:86 |
19:86 |
20:53 |
|
20:86 |
21:36 |
21:86 |
22:0 |
22:86 |
23:86 |
|
24:86 |
25:86 |
26:86 |
27:53 |
27:86 |
28:36 |
|
28:86 |
29:86 |
30:86 |
31:86 |
32:86 |
33:36 |
|
33:86 |
34:86 |
35:53 |
35:86 |
36:86 |
37:86 |
|
38:86 |
39:86 |
40:86 |
41:86 |
42:86 |
43:86 |
|
44:86 |
45:86 |
46:86 |
47:86 |
48:86 |
49:86 |
|
50:86 |
51:0 |
51:86 |
|
There are 51 hits at base# 86 |
|
2:2 |
3:2 |
4:2 |
5:2 |
6:2 |
7:2 |
|
8:2 |
9:2 |
9:22 |
10:2 |
11:2 |
15:2 |
|
16:2 |
17:2 |
18:2 |
19:2 |
19:22 |
20:2 |
|
21:2 |
23:2 |
24:2 |
25:2 |
26:2 |
27:2 |
|
28:2 |
29:2 |
30:2 |
31:2 |
32:2 |
33:2 |
|
33:22 |
34:22 |
35:2 |
36:2 |
37:2 |
38:2 |
|
40:2 |
43:2 |
44:2 |
45:2 |
46:2 |
47:2 |
|
50:60 |
|
There are 38 hits at base# 2 |
|
2:2 |
3:2 |
4:2 |
5:2 |
6:2 |
7:2 |
|
8:2 |
9:2 |
10:2 |
11:2 |
37:2 |
38:2 |
|
40:2 |
43:2 |
44:2 |
45:2 |
46:2 |
47:2 |
|
There are 18 hits at base# 2 |
|
2:2 |
3:2 |
4:2 |
5:2 |
6:2 |
7:2 |
|
8:2 |
9:2 |
10:2 |
11:2 |
37:2 |
38:2 |
|
40:2 |
43:2 |
44:2 |
45:2 |
46:2 |
47:2 |
|
There are 18 hits at base# 2 |
|
2:26 |
9:14 |
10:14 |
11:14 |
27:74 |
37:62 |
|
37:65 |
38:62 |
39:65 |
40:62 |
40:65 |
41:65 |
|
42:65 |
43:62 |
43:65 |
44:62 |
44:65 |
45:62 |
|
46:62 |
47:62 |
47:65 |
48:35 |
48:74 |
49:74 |
|
There are 8 hits at base# 62 |
|
There are 8 hits at base# 65 |
|
There are 3 hits at base# 14 |
|
There are 3 hits at base# 74 |
|
There are 1 hits at base# 26 |
|
There are 1 hits at base# 35 |
|
8:91 |
9:16 |
10:16 |
11:16 |
37:67 |
39:67 |
|
40:67 |
42:67 |
43:67 |
45:67 |
46:67 |
|
There are 7 hits at base# 67 |
|
There are 3 hits at base# 16 |
|
There are 1 hits at base# 91 |
|
2:30 |
4:30 |
6:30 |
7:30 |
9:30 |
10:30 |
|
12:89 |
13:89 |
14:89 |
37:51 |
38:51 |
39:51 |
|
40:51 |
41:51 |
42:51 |
43:51 |
44:51 |
45:51 |
|
46:51 |
47:51 |
|
There are 11 hits at base# 51 |
|
2:30 |
4:30 |
6:30 |
7:30 |
9:30 |
10:30 |
|
12:89 |
13:89 |
14:89 |
37:51 |
38:51 |
39:51 |
|
40:51 |
41:51 |
42:51 |
43:51 |
44:51 |
45:51 |
|
46:51 |
47:51 |
|
There are 11 hits at base# 51 |
|
2:30 |
4:30 |
6:30 |
7:30 |
9:30 |
10:30 |
|
12:89 |
13:89 |
14:89 |
37:51 |
38:51 |
39:51 |
|
40:51 |
41:51 |
42:51 |
43:51 |
44:51 |
45:51 |
|
46:51 |
47:51 |
|
There are 11 hits at base# 51 |
|
2:53 |
3:53 |
5:53 |
6:53 |
7:53 |
8:53 |
|
8:91 |
9:53 |
10:53 |
11:53 |
31:53 |
36:36 |
|
37:64 |
39:64 |
40:64 |
41:64 |
42:64 |
43:64 |
|
44:64 |
45:64 |
46:64 |
47:64 |
48:53 |
49:53 |
|
50:45 |
51:53 |
|
There are 13 hits at base# 53 |
|
There are 10 hits at base# 64 |
|
2:53 |
3:53 |
5:53 |
6:53 |
7:53 |
8:53 |
|
9:53 |
10:53 |
11:53 |
31:53 |
36:36 |
45:64 |
|
46:64 |
48:53 |
49:53 |
50:45 |
51:53 |
|
There are 13 hits at base# 53 |
|
3:67 |
3:95 |
4:51 |
5:16 |
5:67 |
6:67 |
|
7:67 |
8:67 |
9:67 |
10:67 |
11:67 |
15:67 |
|
16:67 |
17:67 |
19:67 |
20:67 |
21:67 |
22:67 |
|
23:67 |
24:67 |
25:67 |
26:67 |
27:67 |
28:67 |
|
29:67 |
30:67 |
31:67 |
32:67 |
33:67 |
34:67 |
|
35:67 |
36:67 |
50:67 |
51:67 |
|
There are 31 hits at base# 67 |
|
5:90 |
6:90 |
11:90 |
12:90 |
13:90 |
14:90 |
|
15:44 |
16:44 |
16:90 |
17:44 |
18:90 |
19:44 |
|
20:44 |
21:44 |
22:44 |
23:44 |
24:44 |
25:44 |
|
26:44 |
27:44 |
27:90 |
28:44 |
29:44 |
33:44 |
|
34:44 |
35:44 |
35:90 |
36:38 |
48:44 |
49:44 |
|
50:44 |
50:90 |
51:44 |
51:52 |
|
There are 21 hits at base# 44 |
|
There are 1 hits at base# 52 |
|
AccI GTmkac |
13 |
5-base recognition |
|
7:37 |
11:24 |
37:16 |
38:16 |
39:16 |
40:16 |
|
41:16 |
42:16 |
43:16 |
44:16 |
45:16 |
46:16 |
|
47:16 |
|
There are 11 hits at base# 16 |
|
SacII CCGCgg |
8 |
6-base recognition |
|
9:14 |
10:14 |
11:14 |
37:65 |
39:65 |
40:65 |
|
42:65 |
43:65 |
|
There are 5 hits at base# 65 |
|
There are 3 hits at base# 14 |
|
9:22 |
15:2 |
16:2 |
17:2 |
18:2 |
19:2 |
|
19:22 |
20:2 |
21:2 |
23:2 |
24:2 |
25:2 |
|
26:2 |
27:2 |
28:2 |
29:2 |
30:2 |
31:2 |
|
32:2 |
33:2 |
33:22 |
34:22 |
35:2 |
36:2 |
|
There are 20 hits at base# 2 |
|
15:11 |
16:11 |
20:11 |
21:11 |
22:11 |
23:11 |
|
24:11 |
25:11 |
26:11 |
27:11 |
28:11 |
28:56 |
|
30:11 |
31:11 |
32:11 |
35:11 |
36:11 |
44:87 |
|
48:87 |
|
There are 16 hits at base# 11 |
|
15:12 |
16:12 |
17:12 |
18:12 |
20:12 |
21:12 |
|
22:12 |
23:12 |
24:12 |
25:12 |
26:12 |
27:12 |
|
28:12 |
30:12 |
31:12 |
32:12 |
34:12 |
35:12 |
|
36:12 |
|
There are 19 hits at base# 12 |
|
37:30 |
38:30 |
39:30 |
40:30 |
41:30 |
42:30 |
|
43:30 |
44:30 |
45:30 |
46:30 |
47:30 |
50:30 |
|
There are 12 hits at base# 30 |
|
37:32 |
38:32 |
39:32 |
40:32 |
41:32 |
42:32 |
|
43:32 |
44:32 |
45:32 |
46:32 |
47:32 |
50:32 |
|
There are 12 hits at base# 32 |
|
37:51 |
38:51 |
39:51 |
40:51 |
41:51 |
42:51 |
|
43:51 |
44:51 |
45:51 |
46:51 |
47:51 |
|
There are 11 hits at base# 51 |
|
37:51 |
38:51 |
39:51 |
40:51 |
41:51 |
42:51 |
|
43:51 |
44:51 |
45:51 |
46:51 |
47:51 |
|
There are 11 hits at base# 51 |
|
37:51 |
38:51 |
39:51 |
40:51 |
41:51 |
42:51 |
|
43:51 |
44:51 |
45:51 |
46:51 |
47:51 |
|
There are 11 hits at base# 51 |
|
|
| TABLE 3 |
|
|
| Synthetic 3-23 FR3 of human heavy chains showning positions of possible |
|
| cleavagc sites |
|
|
| ! Sites engineered into the synthetic gene are shown in upper case |
|
| DNA |
| ! with the RE name bctween vertical bars (as in | XbaI |). |
| ! RERSa frequently found in GLGs are shown below the synthetic |
| sequence |
| ! with the name to the right (as in gtn ac = MaeIII(24), indicating |
| that |
| ! 24 of the 51 GLGs contain the site) |
| ! |
| ! |---FR3--- |
| ! 89 90 (codon |
| # in |
| ! R F |
| synthetic 3-23) |
| |cgc|ttc| 6 |
| ! Allowed DNA |cgn|tty| |
| ! |agr| |
| ! ga ntc = |
| HinfI(38) |
| ! ga gtc = |
| PleI(18) |
| ! ga wtc = |
| TfiI(20) |
| ! gtn ac = |
| MaeIII(24) |
| ! gts ac = |
| Tsp45I(21) |
| ! tc acc = |
| HphI(44) |
| ! |
| ! --------FR3-------------------------------------------------- |
| ! 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 |
| ! T I S R D N S K N T L Y L Q M |
| |act|atc|TCT|AGA|gac|aac|tct|aag|aat|act|ctc|tac|ttg|cag|atg| |
| 51 |
| !allowed|acn|ath|tcn|cgn|gay|aay|tcn|aar|aay|acn|ttr|tay|ttr|car|atg| |
| ! |agy|agr| |agy| |ctn| |ctn| |
| ! | ga|gac = BsmAI(16) ag ct = |
| AluI(23) |
| ! c|tcc ag = BpmI(19) g ctn agc = |
| BlpI(21) |
| ! | | g aan nnn ttt = XmnI(12) |
| ! | XbaI | tg ca = |
| HpyCH4V(21) |
| ! |
| ! ---FR3----------------------------------------------------->| |
| ! 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 |
| ! N S L R A E D T A V Y Y C A K |
| |aac|agC|TTA|AGg|gct|gag|gac|aCT|GCA|Gtc|tac|tat|tgc|gct|aaa| 96 |
| !allowed|aay|tcn|ttr|cgn|gcn|gar|gay|acn|gcn|gtn|tay|tay|tgy|gcn|aar| |
| ! |agy|ctn|agr| | | |
| ! | | cc nng g = BsaJI(23) ac ngt = Bst4CI(51) |
| ! | aga tct = BglII(10) | ac ngt = |
| HpyCH4III(51) |
| ! | Rga tcY = BstYI(11) | ac ngt = TaaI(51) |
| ! | | c ayn nnn rtc = MslI(44) |
| ! | | cg ryc g = BsiEI(23) |
| ! | | yg gcc r = EagI(23) |
| ! | | cg gcc g = EagI(23) |
| ! | | |g gcc = HaeIII(25) |
| ! | | gag g = MnlI(31)| |
| ! |AflII | | PstI | |
|
| TABLE 4 |
|
|
| REdaptors, Extenders, and Bridges used for Cleavacc and |
|
| Capture of Human Heavy Chains in FR3. |
|
|
| A: HpyCH4V Probes of actual human HC genes |
|
| !HpyCH4V in FR3 of human HC, bases 35-56; only those with TGca site |
| TGca; 10, |
| RE recognltion:tgca |
of length 4 is expected at |
|
| 10 |
| 1 |
6-1 |
agttctccctgcagctgaactc |
|
| 2 |
3-11,3-07, 3-21, 3-72,3-48 |
cactgtatctgcaaatgaacag |
| 3 |
3-09, 3-43,3-20 |
ccctgtatctgcaaatgaacag |
| 4 |
5-51 |
ccgcctacctgcagtggagcag |
| 5 |
3-15,3-30,3-30.5,3-30.3,3-74,3-23,3-33 |
cgctgtatctgcaaatgaacag |
| 6 |
7-4.1 |
cggcatatctgcagatctgcag |
| 7 |
3-73 |
cggcgtatctgcaaatgaacag |
| 8 |
5-a |
actgcctacctgcagtggagcag |
| 9 |
3-49 |
tcgcctatctgcaaatgaacag |
|
B: HpyCH4V REdaptors, Extenders, and Bridges |
|
|
B.1 PEdaptors |
|
! Cutting HC lower strand: |
|
! TmKeller for 100 mM NaCl, zero formamide |
|
! Edapters for cleavage |
TmW |
TmK |
|
|
(ON_HCFR36-1) |
5′-agttctcccTGCAgctgaactc-3′ |
68.0 |
64.5 |
|
|
(ON_HCFR36-1A) |
5′-ttctcccTGCAgctgaactc-3′ |
62.0 |
62.5 |
|
(ON_HCFR36-1B) |
5′-ttctcccTGCAgctgaac-3′ |
56.0 |
59.9 |
|
(ON_HCFR33-15) |
5′-cgctgtatcTGCAaatgaacag3′ |
64.0 |
60.8 |
|
(ON_HCFR33-15A) |
5′-ctgtatcTGCAaatgaacag-3′ |
56.0 |
56.3 |
|
(ON_HCFR33-15B) |
5′-tgtatcTGCAaatgaac-3′ |
50.0 |
53.1 |
|
(ON_HCFR33-11) |
5′-cactgtatcTGCAaatgaacag-3′ |
62.0 |
58.9 |
|
(ON_HCFR35-51) |
5′-ccgcctaccTGCAgtggagcag-3′ |
74.0 |
70.1 |
|
B.2 Segment of synthetic 3-23 gene into which captured CDR3 is to |
|
|
be cloned |
|
! XbaI . . . |
|
!D323* cgCttcacTaag tcT aga gac aaC tcT aag aaT acT ctC taC |
|
! scab........designed gene 3-23 gene................ |
|
! |
|
! HpyCH4V |
|
! .. .. AflII . . . |
|
! Ttg caG atg aac agc TtA agG . . . |
|
! .............................. . . . |
|
B.3 Extender and Bridges |
|
! Extender (bottom strand): |
|
(ON_HCHpyEx01) 5′-cAAgTAgAgAgTATTcTTAgAgTTgTcTcTAgAcTTAgTgAAgcg-3′ |
|
! ON_HCHpyEx01 is the reverse complement of |
|
! 5′-cgCttcacTaag tcT aga gac aaC tcT aag aaT acT ctC taC Ttg -3′ |
|
! |
|
! Bridges (top strand, 9-base overlap) |
|
! |
|
(ON_HCHpyBr016-1) 5′-cgCttcacTaag tcT aga gac aaC tcT aag- |
|
aaT acT ctC taC Ttg CAgctgaac-3′ {(3′-term C is |
|
blocked) |
|
! |
|
! 3-15 et al. + 3-11 |
|
(ON_HCHpyBr023-15) 5′-cgCttcacTaag tcT aga gac aaC tcT aag- |
|
aaT acT ctC taC Ttg CAaatgaac-3′ {3′-term C is |
|
blocked) |
|
! |
|
! 5-51 |
|
(ON_1-ICHpyBr045-51) 5′-cgCttcacTaag tcT aga gac aaC tcT aag- |
|
aaT acT ctC taC Ttg CAgtggagc-3′ (3′-term C is |
|
blocked) |
|
! |
|
! PCR primer (top strand) |
|
! |
|
(ON_HCHpyPCR) 5′-cgCttcacTaag tcT aca gac-3′ |
|
! |
| C: BipI Probes from human HC GLGs |
|
| 1 |
1-58, 1-03, 1-08, 1-69, 1-24, 1-45, 1-46, 1-f, 1-e |
|
|
| 6 |
3303,3-33,3-07,3-11,3-30,3-21,3-23,3305,3-48 |
|
|
| 11 |
4301,4-28,4302,4-04,4304,4-31,4-34,4-39,4-59,4-61,4-b |
|
|
|
D: BlpI REdaptors, Extenders, and Bridges |
|
|
D.1 BEdaptors |
|
|
|
TmW |
TmK |
|
|
(B1pF3HC1-58) |
5′-ac atg gaG CTG AGC agcctg ag-3′ |
70 |
66. |
|
|
|
4 |
|
(B1pF3HC6-1) |
5′-cc ctg aag ctg agc tctgtg ac-3′ |
70 |
66. |
|
|
|
4 |
|
B1pF3HC6-1 matches 4-30.1, not 6-1. |
|
|
D.2 Segment of synthetic 3-23 gene into which captured CDR3 is to |
|
be cloned |
|
! |
|
Blp| |
|
! |
|
! XbaI . . . |
|
... ... |
|
!D323* cgCttcacTaag TCT AGA gac aaC tcT aag aaT acT ctC taC Ttg |
|
caG atg aac |
|
! |
|
! AtlII . . . |
|
! agC TTA AGG |
|
D.3 Extender and Bridges |
|
! Bridges |
|
(BlpF3Br1) 5′-cgCttcacTcag tcT aga gaT aeC AGT aaA aaT acT TtG- |
|
taC Ttg caG Ctg a|GC agc ctg-3′ |
|
(BlpF3Br2) 5′-cgCttcacTcag tcT aga gaT aaC AGT aaA aaT acT TtG- |
|
taC Ttg caG Ctg a|gc tct gtg-3′ |
|
! | lower strand is cut here |
|
! Extender |
|
(BlpF3Ext) 5′- |
|
TcAgcTgcAAgTAcAAAgTATTTTTAcTgTTATcTcTAgAgAcTgAgTgAAgcg-3′ |
|
! BlpF3Ext is the reverse complement of: |
|
! 5′-cgCttcacTcag tcT aga gaT aaC AGT aaA aaT acT TtG taC Ttg caG |
|
Ctg a-3′ |
|
! |
|
(BlpF3PCR) 5′-cgCttcacTcag tcT aga gaT aaC-3′ |
| E: HpyCH4III Distinct GLG sequences surrounding site, bases 77-98 |
|
| 1 |
102#118#4,146#7,169#9,1e#10,311#17,353#30,404#37,4301 |
|
|
| 2 |
103#2,307#15,321#21,3303#24,333#26,348#28,364#31,366#32 |
|
|
|
F: HypCH4III PEdaptors, Extenders, and Bridges |
|
|
F.1 PEdaptors |
|
! ONs for cleavacc of HC(lower) in FR3(bases 77-97) |
|
! For cleavacc with HpyCH4III, Bst4CI, or Taa| |
|
! cleavage is in lower chain before base 88. |
|
! 77 788 888 888 889 999 999 9 |
|
! 78 901 234 567 890 123 456 7 |
Tmw |
|
|
Tmk |
|
|
|
|
(H43.77.97.1-02#1) |
5′-cc gtg tat tAC TGT gcg aga g-3′ |
6462.6 |
|
(H43.77.97.1-03#2) |
5′-ct gtg tat tAC TGT gcg aga g-3′ |
6260.6 |
|
(H43.77.97.108#3) |
5′-cc gtg tat tAC TGT gcg aga g-3′ |
6462.6 |
|
(H43.77.97.323#22) |
5′-cc gta tat tac tgt gcg aaa g-3′ |
6058.7 |
|
(H43.77.97.330#23) |
5′-ct gtg tat tac tgt gcg aaa g-3′ |
6058.7 |
|
(H43.77.97.439#44) |
5′-ct gtg tat tac tgt gcg aga c-3′ |
6260.6 |
|
(H43.77.97.551#48) |
5′-cc atg tat tac tgt gcg aga -3′ |
6260.6 |
|
(H43.77.97.5a#49) |
5′-cc atg tat tAC TGT gcg aga -3′ |
5858.3 |
|
F.2 Extender and Bridges |
|
|
! XbaI and Afill sites in bridges are bunged |
|
(H43.XABr1) 5′-ggtgtagtga- |
|
|TCT|AGt|gac|aac|tct |aag|aat|act|ctc|tac|ttg|cag|atg|- |
|
|aac|agC|TTt|AGg|gct|gag|gac|aCT|GCA|Gtc|tac tat tgt gcg aga-3′ |
|
(H43.XABr2) 5′-ggtgtagtga- |
|
|TCT |AGt|gac|aac|tct |aag|aat|act|ctc|tad ttg|cag|atg|- |
|
|aac|agC|TTt|AGg|gct|gag|gac|aCT|GCA|Gtc|tac|tat tgt gcg aaa-3′ |
|
(H43.XAExt) 5′-ATAgTAgAcT gcAgTgTccT cAgcccTTAA gcTgTTcATc |
|
TgCAAgTAgA- |
|
gAgTATTcTT AgAgTTgTcT cTAgATcACT AcAcc-3′ |
|
!H43.XAExt is the reverse complement of |
|
! 5′-ggtgtagtga- |
|
! |TCT|AGA|gac|aac|tct|aag|aat|act|ctg|tac|ttg|cag|atg|- |
|
! |aac|agC|TTt|AGg|gct|gag|gac|aCT|GCA|Gtc|tac|tat-3′ |
|
(H43.XAPCR) 5′-ggtgtagtga |TCT|AGA|gac|aac-3′ |
|
! XbaI and AflII sites in bridges are bunged |
|
(H43.ABr1) 5′-ggtgtagtga- |
|
|aac|agC|TTt|AGg|gct|gag|gac|aCT|GCA|Gtc|tac|tat tgt gcg aga-3′ |
|
(H43.ABr2) 5′-ggtgtagtga- |
|
|aac|agC|TTA|AGg|gct|gag|gac|aCT|GCA|Gtc|tac|tat tgt gcg aaa-3′ |
|
(H43.AExt) 5′-ATAgTAgAcTgcAgTgTccTcAgcccTTAAgcTgTTTcAcTAcAcc-3′ |
|
! (H43.AExt) is the reverse complement of 5′-ggtgtagtga- |
|
! |aac|agC|TTA|AGg|gct|gag|gac|aCT|GCA|Gtc|tac|tat-3′ |
|
(H43.APCR) 5′-ggtgtagtga |aac|agC|TTA|AGg|gct|-3′ |
|
|
| TABLE 5 |
|
|
| Analysis of frequency of matching REdaptors in actual V genes |
|
|
| A: HpyCH4V in HC at bases 35-56 |
|
|
Number of mismatches.....................Number |
|
|
|
| Id |
Ntct |
0 |
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
9 |
10 |
Cut |
Id |
Probe |
|
| 1 |
510 |
5 |
11 |
274 |
92 |
61 |
25 |
22 |
11 |
1 |
3 |
5443 |
6-1 |
agttctcccTGCAgctgaactc |
| 2 |
192 |
54 |
42 |
32 |
24 |
15 |
2 |
3 |
10 |
3 |
1 |
6 |
167 |
3-11 |
cactgtatcTGCAaatgaacag |
| 3 |
58 |
19 |
7 |
17 |
6 |
5 |
1 |
0 |
1 |
0 |
2 |
0 |
543-09 |
ccctgtatcTGCAaatgaacag |
| 4 |
267 |
42 |
33 |
9 |
8 |
8 |
82 |
43 |
22 |
8 |
11 |
1 |
100 |
5-51 |
ccgcctaccTGCAgtggagcag |
| 5 |
250 |
111 |
59 |
41 |
24 |
7 |
5 |
1 |
0 |
0 |
2 |
0 242 |
3-15 |
cgctgtatcTGCAaatgaacag |
| 6 |
7 |
0 |
2 |
0 |
1 |
0 |
0 |
0 |
0 |
0 |
4 |
0 |
3 |
74.1 |
cggcatatcTGCAgatctgcag |
| 7 |
7 |
0 |
2 |
2 |
0 |
0 |
2 |
1 |
0 |
0 |
0 |
0 |
4 |
3-73 |
cggcgtatcTGCAaatgaacag |
| 8 |
26 |
10 |
4 |
1 |
3 |
1 |
2 |
1 |
3 |
1 |
0 |
0 |
19 |
5-a |
ctgcctaccTGCAgtggagcag |
| 9 |
21 |
8 |
2 |
3 |
1 |
6 |
1 |
0 |
0 |
0 |
0 |
0 |
20 |
3-49 |
tcgcctatcTGCAaatgaacag |
|
1338 |
249 |
162 |
379 |
149 |
103 |
120 |
71 |
47 |
13 |
23 |
12 |
1052 |
|
|
|
|
249 |
411 |
790 |
939 |
|
1162 |
|
1280 |
|
1316 |
|
|
|
|
|
|
|
|
|
|
1042 |
|
1233 |
|
1293 |
|
1338 |
|
|
Id |
Probe |
dotted probe |
|
|
|
6-1 |
agttctcccTGCAgctgaactc |
agttctcccTGCAgctgaactc |
|
3-11 |
cactgtatcTGCAaatgaacag |
cac.g.at.....aa.....ag |
|
3-09 |
ccctgtatcTGCAaatgaacag |
ccc.g.at.....aa.....ag |
|
5-51 |
ccgcctaccTGCAgtggagcag |
ccgc..a.......tg..g.ag |
|
3-15 |
cgctgtatcTGCAaatgaacag |
c.c.g.at.....aa.....ag |
|
7-4.1 |
cggcatatcTGCAgatctgcag |
c.gca.at......a.ctg.ag |
|
3-73 |
cggcgtatcTGCAaatgaacag |
c.gcg.at.....aa.....ag |
|
5-a |
ctgcctaccTGCAgtggaacag |
ctgc..a.......tg..g.ag |
|
3-49 |
tcgcctatcTGCAaatgaacag |
tcgc..at.....aa.....ag |
|
Seqs with the expected RE site only.......1004 |
|
(Counts only cases with 4 or fewer mismatches) |
|
Seqs with only an unexpected site......... 0 |
|
Seqs with both expected and unexpected.... 48 |
|
(Counts only cases with 4 or fewer mismatches) |
|
Seqs with no sites........................ 0 |
|
|
| Id |
Ntot |
0 |
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
Ncut |
Name |
|
|
| 1 |
133 |
73 |
16 |
11 |
13 |
6 |
9 |
1 |
4 |
0 |
119 |
1-58 |
acatggaGCTGAGCagcctgag |
|
| 2 |
14 |
11 |
1 |
0 |
0 |
0 |
0 |
1 |
0 |
1 |
12 |
1-02 |
acatggagctgagcaggctgag |
| 3 |
34 |
17 |
8 |
2 |
6 |
1 |
0 |
0 |
0 |
0 |
0 |
1-18 |
acatggagctgaggagcctgag |
| 4 |
120 |
50 |
32 |
16 |
10 |
9 |
1 |
1 |
1 |
0 |
2 |
5-51 |
acctgcagtggagcagcctgaa |
| 5 |
55 |
13 |
11 |
10 |
17 |
3 |
1 |
0 |
0 |
0 |
0 |
3-15 |
atctgcaaatgaacagcctgaa |
| 6 |
340 |
186 |
88 |
41 |
15 |
6 |
3 |
0 |
1 |
0 |
0 |
3303 |
atctgcaaatgaacagcctgag |
| 7 |
82 |
25 |
16 |
25 |
12 |
1 |
3 |
0 |
0 |
0 |
0 |
3-20 |
atctgcaaatgaacagtctgag |
| 8 |
3 |
0 |
2 |
0 |
1 |
0 |
0 |
0 |
0 |
0 |
0 |
74.1 |
atctgcagatctgcagcctaaa |
| 9 |
23 |
18 |
2 |
2 |
1 |
0 |
0 |
0 |
0 |
0 |
0 |
3-66 |
atcttcaaatgaacagcctgag |
| 10 |
2 |
1 |
0 |
1 |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
3-66 |
atcttcaaatgggcagcctgag |
| 11 |
486 |
249 |
78 |
81 |
38 |
21 |
10 |
4 |
4 |
1 |
467 |
4301 |
ccctgaagctgagctctgtgac |
| 12 |
16 |
6 |
3 |
1 |
0 |
1 |
1 |
3 |
1 |
0 |
1 |
6-1 |
ccctgcagctgaactctgtgac |
| 13 |
28 |
15 |
8 |
2 |
2 |
1 |
0 |
0 |
0 |
0 |
0 |
2-70 |
tccttacaatgaccaacatgga |
| 14 |
2 |
0 |
2 |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
2-26 |
tccttaccatgaccaacatgga |
|
|
Name |
Full seguence |
Dot mode |
|
|
|
1-58 |
acatggacCTGAGCagcctgag |
acatggaGCTGAGCagcctgag |
|
1-02 |
acatggagctgagcaggctgag |
...............g...... |
|
1-18 |
acatggagctgaggagcctgag |
............g......... |
|
5-51 |
acctgcagtggagcagcctga& |
..c..c..tg...........a |
|
3-15 |
atctgcaaatgaacagcctgaa |
.tc..c.aa...a........a |
|
3-30.3 |
atctgcaaatgaacagcctgag |
.tc..c.aa..a.......... |
|
3-20 |
atctgcaaatgaacagtctgag |
.tc..c.aa...a...t..... |
|
7-4.1 |
atctgcagatctgcagcctaaa |
.tc..c..a.ct.......a.a |
|
3-66 |
atcttcaaatgaacagcctgag |
.tc.tc.aa...a......... |
|
3-64 |
atcttcaaatgggcagcctgag |
.tc.tc.aa..g.......... |
|
4-30.1 |
ccctgaagctgagctctgtgacc |
c.c..a........tctg...c |
|
6-1 |
ccctgcagctgaactctgtgac |
c.c..c......a.tctg...c |
|
2-70 |
tccttacaatgaccaacatggat |
t.c.tacaa...c..a.a..ga |
|
2-26 |
tccttaccatgaccaacatggat |
t.c.tacca...c..a.a..ga |
|
Seqs with the expected RE site only....... 597 (counting seguences with 4 or fewer mismatches) |
|
Seqs with only an unexpected site......... 2 |
|
Seqs with both expected and unexpected.... 2 |
|
Seqs with no sites........................ 686 |
|
|
| C. HpyCH4III, Bst4CI, or TaaI in HC |
|
| In scoring whether the RE site of interest is present, only ONs that have 4 or fewer mismatches are counted |
| Number of sequences.......... 1617 |
| Id |
Ntot |
0 |
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
Ncut |
|
acngt |
acngt |
|
| 1 |
244 |
78 |
92 |
43 |
18 |
10 |
1 |
2 |
0 |
0 |
241 |
102#1,1 |
ccgtgtattACTGTgcgagaga |
ccgtgtattactgtgcgagaga |
|
| 2 |
457 |
69 |
150 |
115 |
66 |
34 |
11 |
8 |
3 |
1 |
434 |
103#2,3 |
ctgtgtattactgtgcgagaga |
.t.................... |
| 3 |
173 |
52 |
45 |
36 |
22 |
14 |
3 |
0 |
0 |
1 |
169 |
108#3 |
ccgtgtattactgtgcgagagg |
.....................g |
| 4 |
16 |
0 |
3 |
2 |
2 |
1 |
6 |
0 |
1 |
1 |
8 |
124#5,1 |
ccgtgtattactgtgcaacaga |
.................a.c.. |
| 5 |
4 |
0 |
0 |
1 |
0 |
1 |
1 |
0 |
1 |
0 |
2 |
145#6 |
ccatgtattactgtgcaagata |
..a..............a...t |
| 6 |
15 |
1 |
0 |
1 |
0 |
6 |
4 |
1 |
1 |
1 |
8 |
158#8 |
ccgtgtattactgtgcggcaga |
................gc.... |
| 7 |
23 |
4 |
8 |
5 |
2 |
2 |
1 |
1 |
0 |
0 |
21 |
205#12 |
ccacatattactgtgcacacag |
..aca...........acacag |
| 8 |
9 |
1 |
1 |
1 |
0 |
3 |
2 |
1 |
0 |
0 |
6 |
226#13 |
ccacatattactgtgcacggat |
..aca...........ac.gat |
| 9 |
7 |
1 |
3 |
1 |
1 |
0 |
0 |
1 |
0 |
0 |
6 |
270#14 |
ccacgtattactgtgacggat |
..ac............ac.gat |
| 10 |
23 |
7 |
3 |
5 |
5 |
2 |
1 |
0 |
0 |
0 |
22 |
309#16, |
ccttgtattactgtgcaaaaga |
..t.............a.a... |
| 11 |
35 |
5 |
10 |
7 |
6 |
3 |
3 |
0 |
1 |
0 |
31 |
313#18, |
ctgtgtattactgtgcaagaga |
.t..............a..... |
| 12 |
18 |
2 |
3 |
2 |
2 |
6 |
1 |
0 |
2 |
0 |
15 |
315#19 |
ccgtgtattactgtaccacaga |
..............a.c.c... |
| 13 |
3 |
1 |
2 |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
3 |
320#20 |
ccttgtatcactgtgcgagaga |
..t......c............ |
| 14 |
117 |
29 |
23 |
28 |
22 |
8 |
4 |
2 |
1 |
0 |
110 |
323#22 |
ccgtatattacttggcgaaaga |
.....a................ |
| 15 |
75 |
21 |
25 |
13 |
9 |
1 |
4 |
2 |
0 |
0 |
69 |
330#23, |
ctgtgtattactgtgcgaaaga |
.t...............a.... |
| 16 |
14 |
2 |
2 |
2 |
3 |
0 |
3 |
1 |
1 |
0 |
9 |
349#29 |
ccgtgtattactgtactagaga |
..............a.t..... |
| 17 |
2 |
0 |
0 |
1 |
0 |
0 |
1 |
0 |
0 |
0 |
1 |
372#33 |
ccgtgtattactgtgctagaga |
.................t.... |
| 18 |
1 |
0 |
0 |
1 |
0 |
0 |
0 |
0 |
0 |
0 |
1 |
373#34 |
ccgtgtattactgtaagaaaga |
...............aa..a.. |
| 19 |
2 |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
2 |
0 |
3d#36 |
ctgtgtattactgtaagaaaga |
.t...........aa..a.... |
| 20 |
34 |
4 |
9 |
9 |
4 |
5 |
3 |
0 |
0 |
0 |
31 |
428#38 |
ccgtgtattactgtgcgagaaa |
.....................a |
| 21 |
17 |
5 |
4 |
2 |
2 |
3 |
1 |
0 |
0 |
0 |
16 |
4302#40 |
ccgtgtattactgtgcgagaca |
................c..... |
| 22 |
75 |
15 |
17 |
24 |
7 |
10 |
1 |
1 |
0 |
0 |
73 |
439#44 |
ctgtgtattactgtgcgagaca |
.t..................c. |
| 23 |
40 |
14 |
15 |
4 |
5 |
1 |
0 |
1 |
0 |
0 |
39 |
551#48 |
ccatgtattactgtgagagaca |
..a.................c. |
| 24 |
213 |
26 |
56 |
60 |
42 |
20 |
7 |
2 |
0 |
0 |
204 |
5a#49 |
ccatgtattactgtgcgagaAA |
..a.................AA |
| Group |
337 |
471 |
363 |
218 |
130 |
58 |
23 |
11 |
6 |
|
| Cumulative |
337 |
808 |
1171 |
1389 |
1519 |
1577 |
1600 |
1611 |
1617 |
| Seqs with the expected RE site only.......1511 |
| Seqs with only en unexpected site......... 0 |
| Seqs with both expected and unexpected.... 8 |
| Seqs with no sites........................ 0 |
|
| TABLE 5D |
|
|
| Analysis repeated using only 8 best REdaptors |
|
|
| Id Ntot 0 1 2 3 4 5 6 7 8+ |
|
| 1 301 78 101 54 32 16 9 10 1 0 281 102#1 |
| ccgtgtattactgtgcgagaga |
| 2 493 69 155 125 73 37 14 11 3 6 459 103#2 |
| ctgtgtattactgtgcgagaga |
| 3 189 52 45 38 23 18 5 4 1 3 176 108#3 |
| ccgtgtattactgtgcgagagg |
| 4 127 29 23 28 24 10 6 5 2 0 114 323#22 |
| ccgtatattactgtgcgaaaga |
| 5 78 21 25 14 11 1 4 2 0 0 72 330#23 |
| ctgtgtattactgtgcgaaaga |
| 6 79 15 17 25 8 11 1 2 0 0 76 439#44 |
| ctgtgtattactgtgcgagaca |
| 7 43 14 15 5 5 3 0 1 0 0 42 551#48 |
| ccatgtattactgtgcgagaca |
| 8 307 26 63 72 51 38 24 14 13 6 250 5a#49 |
| ccatgtattactgtgcgaga |
| 1 102#1 ccgtgtattactgtgcgagaga ccgtgtattactgtgcgagaga |
| 2 103#2 ctgtgtattactgtgcgagaga .t.................... |
| 3 108#3 ccgtgtattactgtgcgagagg .....................g |
| 4 323#22 ccgtatattactgtgcgaaaga ....a.............a... |
| 5 330#23 ctgtgtattactgtgcgaaaga .t.................a.. |
| 6 439#44 ctgtgtattactgtgcgagaca .t..................c. |
| 7 551#48 ccatgtattactgtgcgagaca ..a.................c. |
| 8 5a#49 ccatgtattactgtgcgagaAA ..a.................AA |
| Seqs with the expected RE site only.......1463/1617 |
| Seqs with only an unexpected site......... 0 |
| Seqs with both expected and unexpected.... 7 |
| Seqs with no sites........................ 0 |
|
| TABLE 6 |
|
|
| Human HC GLG FR1 Seguences |
|
| VH Exon—Nucleotide sequence alignment |
|
|
| VH1 |
|
|
| 1-02 |
CAG GTG CAG CTG GTG CAG TCT GGG GCT GAG GTG AAG AAG CCT GGG GCC TCA GTG AAG |
|
GTC TCC TGC AAG GCT TCT GGA TAC ACC TTC ACC |
| |
| 1-03 |
cag gtC cag ctT gtg cag tct ggg gct gag gtg aag aag cct ggg gcc toa gtg aag |
|
gtT tcc tgc aag gct tct gga tac aoc ttc acT |
| |
| 1-08 |
cag gtg cag ctg gtg cag tct ggg gct gag gtg aag aag cct ggg gcc tca gtg aag |
|
gtc tcc tgc aag gct tct gga tac acc ttc acc |
| |
| 1-18 |
cag gtT cag ctg gtg cag tct ggA gct gag gtg aag aag cct ggg gcc tca gtg aag |
|
gtc tcc tgc aag gct tct ggT tac acc ttT acc |
| |
| 1-24 |
cag gtC cag ctg gtA cag tct ggg gct gag gtg aag aag cct ggg gcc tca gtg aag |
|
gtc tcc tgc aag gTt tcC gga tac acc Ctc acT |
| |
| 1-45 |
cag Atg cag ctg gtg cag tct ggg gct gag gtg aag aag Act ggg Tcc toa gtg aag |
|
gtT tcc tgc aag gct tcC gga tac acc ttc acc |
| |
| 1-46 |
cag gtg cag ctg gtg cag tct ggg gct gag gtg aag aag cct ggg gcc tca gtg aag |
|
gtT tcc tgc aag gcA tct gga tac acc ttc acc |
| |
| 1-58 |
caA Atg cag ctg gtg cag tct ggg Cct gag gtg aag aag cct ggg Acc tca gtg aag |
|
gtc tcc tgc aag gct tct gga tTc acc ttT acT |
| |
| 1-69 |
cag gtg cag ctg gtg cag tct ggg gct gag gtg aag aag cct ggg Tcc tcG gtg aag |
|
gtc tcc tgc aag gct tct gga GGo acc ttc aGc |
| |
| 1-e |
cag gtg cag ctg gtg cag tct ggg gct gag gtg aag aag cct ggg Tcc tcG gtg aag |
|
gtc tcc tgc aag gct tct gga GGc acc ttc aGc |
| |
| 1-f |
Gag gtC cag ctg gtA cag tct ggg gct gag gtg aag aag cct ggg gcT Aca gtg aaA |
|
Atc tcc tgc aag gTt tct gga tac acc ttc acc |
| |
| VH2 |
| 2-05 |
CAG ATC ACC TTG AAG GAG TCT GGT CCT ACG CTG GTG AAA CCC ACA CAG ACC CTC ACG |
|
CTG ACC TGC ACC TTC TCT GGG TTC TCA CTC AGC |
| |
| 2-26 |
cag Gtc acc ttg aag gag tct ggt cct GTg ctg gtg aaa ccc aca Gag acc ctc acg |
|
ctg acc tgc acc Gtc tct ggg ttc tca ctc agc |
| |
| 2-70 |
cag Gtc acc ttg aag gag tct ggt cct Gcg ctg gtg aaa ccc aca cag acc ctc acA |
|
ctg acc tgc acc ttc tct ggg ttc tca ctc agc |
| |
| VH3 |
| 3-07 |
GAG GTG CAG CTG GTG GAG TCT GGG GGA GGC TTG GTC CAG CCT GGG GGG TCC CTG AGA |
|
CTC TCC TGT GCA GCC TCT GGA TTC ACC TTT AGT |
| |
| 3-09 |
gaA gtg cag ctg gtg gag tct ggg gga ggc ttg gtA cag cct ggC Agg tcc ctg aga |
|
ctc tcc tgt gca gcc tct gga ttc acc ttt GAt |
| |
| 3-11 |
Cag gtg cag ctg gtg gag tct ggg gga ggc ttg gtc Aag cct ggA ggg tcc ctg aga |
|
ctc tcc tgt gca gcc tct gga ttc acc ttC agt |
| |
| 3-13 |
gag gtg cag ctg gtg gag tct ggg gga ggc ttg gtA cag cct ggg ggg tcc ctg aga |
|
ctc tcc tgt gca gcc tct gga ttc acc ttC agt |
| |
| 3-15 |
gag gtg cag ctg gtg gag tct ggg gga ggc ttg gtA Aag cct ggg ggg tcc otT aga |
|
ctc tcc tgt gca gcc tct gga ttc acT ttC agt |
| |
| 3-20 |
gag gtg cag ctg gtg gag tct ggg gga ggT Gtg gtA cGg cct ggg ggg tcc ctg aga |
|
ctc tcc tgt gca gcc tct gga ttc acc ttt GAt |
| |
| 3-21 |
gag gtg cag ctg gtg gag tct ggg gga ggc Ctg gtc Aag cct ggg ggg tcc ctg aga |
|
ctc tcc tgt gca gcc tct gga ttc acc ttC agt |
| |
| 3-23 |
gag gtg cag ctg Ttg gag tct ggg gga ggc ttg gTA cag cct ggg ggg tcc ctg aga |
|
ctc tcc tgt gca gcc tct gga ttc acc ttt agC |
| |
| 3-30 |
Cag gtg cag ctg gtg gag tct ggg gga ggc Gtg gtc cag cct ggg Agg tcc ctg aga |
|
ctc tcc tgt gca gcc tct gga ttc acc ttC agt |
| |
| 3-30.3 |
Cag gtg cag ctg gtg gag tct ggg gga ggc Gtg gtc cag cct ggg Agg tcc ctg aga |
|
ctc tcc tgt gca gcc tct gga ttc acc ttC agt |
| |
| 3-30.5 |
Cag gtg cag ctg gtg gag tct ggg gga ggc Gtg gtc cag cct ggg Agg tcc ctg aga |
|
ctc tcc tgt gca gcc tct gga ttc acc ttC agt |
| |
| 3-33 |
Cag gtg cag ctg gtg gag tct ggg gga ggc Gtg gtc cag cct ggg Agg tcc ctg aga |
|
ctc tcc tgt gca gcG tct gga ttc acc ttC agt |
| |
| 3-43 |
gaA gtg cag ctg gtg gag tct ggg gga gTc Gtg gtA cag cct ggg ggg tcc ctg aga |
|
ctc tcc tgt gca gcc tct gga ttc acc ttt GAt |
| |
| 3-48 |
gag gtg cag ctg gtg gag tct ggg gga ggc ttg gtA cag cct ggg ggg tcc ctg aga |
|
ctc tcc tgt gca gcc tct gga ttc acc ttC agt |
| |
| 3-49 |
gag gtg cag ctg gtg gag tct ggg gga ggc ttg gtA cag ccA ggg Cgg tcc ctg aga |
|
ctc tcc tgt Aca gcT tct gga ttc acc ttt Ggt |
| |
| 3-53 |
gag gtg cag ctg gtg gag Act ggA gga ggc ttg Atc cag cct ggg ggg tcc ctg aga |
|
ctc tcc tgt gca gcc tct ggG ttc acc GtC agt |
| |
| 3-64 |
gag gtg cag ctg gtg gag tct ggg gga ggc ttg gtc cag cct ggg ggg tcc ctg aga |
|
ctc tcc tgt gca gcc tct gga ttc acc ttC agt |
| |
| 3-66 |
gag gtg cag ctg gtg gag tct ggg gga ggc ttg gtc cag cct ggg ggg tcc ctg aga |
|
ctc tcc tgt gca gcc tct gga ttc acc Gtc agt |
| |
| 3-72 |
gag gtg cag ctg gtg gag tct ggg gga ggc ttg gtc cag cct ggA ggg tcc ctg aga |
|
ctc tcc tgt gca gcc tct gga ttc acc ttC agt |
| |
| 3-73 |
gag gtg cag ctg gtg gag tct ggg gga ggc ttg gtc cag cct ggg ggg tcc ctg aAa |
|
ctc tcc tgt gca gcc tct ggGttc acc ttC agt |
| |
| 3-74 |
gag gtg cag ctg gtg gag tcC ggg gga ggc ttA gtT cag cct ggg ggg tcc ctg aga |
|
ctc tcc tgt gca gcc tct gga ttc acc ttC agt |
| |
| 3-d |
gag gtg cag ctg gtg gag tct Cgg gga gTc ttg gtA cag cct ggg ggg tcc ctg aga |
|
ctc tcc tgt gca gcc tct gga ttc acc GtC agt |
| |
| VH4 |
| 4-04 |
CAG GTG CAG CTG CAG GAG TCG GGC CCA GGA CTG GTG AAG CCT TCG GGG ACC CTG TCC |
|
CTC ACC TGC GCT GTC TCT GGT GGC TCC ATC AGC |
| |
| 4-28 |
cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcg gAC acc ctg tcc |
|
ctc acc tgc gct gtc tct ggt TAc tcc atc agc |
| |
| 4-30.1 |
cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcA CAg acc ctg tcc |
|
ctc acc tgc Act gtc tct ggt ggc tcc atc agc |
| |
| 4-30.2 |
cag Ctg cag ctg cag gag tcC ggc Tca gga ctg gtg aag cct tcA CAg acc ctg tcc |
|
ctc acc tgc gct gtc tct ggt ggc tcc atc agc |
| |
| 4-30.4 |
cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcA CAg acc ctg tcc |
|
ctc acc tgc Act gtc tct ggt ggc tcc atc agc |
| |
| 4-31 |
cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcA CAg acc ctg tcc |
|
ctc acc tgc Act gtc tct ggt ggc tcc atc agc |
| |
| 4-34 |
cag gtg cag ctA cag Cag tGg ggc Gca gga ctg Ttg aag cct tcg gAg acc ctg tcc |
|
ctc acc tgc gct gtc tAt ggt ggG tcc Ttc agT |
| |
| 4-39 |
cag Ctg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tct gAg acc ctg tcc |
|
ctc acc tgc Act gtc tct ggt ggc tcc atc agt |
| |
| 4-59 |
cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcg gAg acc ctg tcc |
|
ctc acc tgc Act gtc tct ggt ggc tcc atc agT |
| |
| 4-61 |
cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcg gAg acc ctg tcc |
|
ctc acc tgc Act gtc tct ggt ggc tcc Gtc agc |
| |
| 4-b |
cag gtg cag ctg cag gag tcg ggc cca gga ctg gtg aag cct tcg gAg acc ctg tcc |
|
ctc acc tgc gct gtc tct ggt TAc tcc atc agc |
| |
| VH5 |
| 5-51 |
GAG GTG CAG CTG GTG CAG TCT GGA GCA GAG GTG AAA AAG CCC GGG GAG TCT CTG AAG |
|
ATC TCC TGT AAG GGT TCT GGA TAC AGC TTT ACC |
| |
| 5-a |
gaA gtg cag ctg gtg cag tct gga gca gag gtg aas aag ccc ggg gag tct ctg aGg |
|
atc tcc tgt aag ggt tct gga tac agc ttt acc |
| |
| VH6 |
| 6-1 |
CAG GTA CAG CTG CAG CAG TCA GGT CCA GGA CTG GTG AAG CCC TCG CAG ACC CTC TCA |
|
CTC ACC TGT GCC ATC TCC GGG GAC AGT GTC TCT |
| |
| VH7 |
| 7-4.1 |
CAG GTG CAG CTG GTG CAA TCT GGG TCT GAG TTG AAG AAG CCT GGG GCC TCA GTG AAG |
|
GTT TCC TGC AAG GCT TCT GGA TAC ACC TTC ACT |
|
| TABLE 7 |
|
|
| RERS sites in Human HC GLG FR1s where there are at least 20 GLGs cut |
|
|
| BsgI GTGCAG |
71 |
(cuts 16/14 bases to right) |
| 1:4 |
1:13 |
2:13 |
3:4 |
3:13 |
4:13 |
|
|
| 6:13 |
7:4 |
7:13 |
8:13 |
9:4 |
9:13 |
| 10:4 |
10:13 |
15:4 |
15:65 |
16:4 |
16:65 |
| 17:4 |
17:65 |
18:4 |
18:65 |
19:4 |
19:65 |
| 20:4 |
20:65 |
21:4 |
21:65 |
22:4 |
22:65 |
| 23:4 |
23:65 |
24:4 |
24:65 |
25:4 |
25:65 |
| 26:4 |
26:65 |
27:4 |
27:65 |
28:4 |
28:65 |
| 29:4 |
30:4 |
30:65 |
31:4 |
31:65 |
32:4 |
| 32:65 |
33:4 |
33:65 |
34:4 |
34:65 |
35:4 |
| 35:65 |
36:4 |
36:65 |
37:4 |
38:4 |
39:4 |
| 41:4 |
42:4 |
43:4 |
45:4 |
46:4 |
47:4 |
| 48:4 |
48:13 |
49:4 |
49:13 |
51:4 |
| There are 39 hits at base# 4 |
| There are 21 hits at base# 65 |
| 12:63 |
13:63 |
14:63 |
39:63 |
41:63 |
42:63 |
| 44:63 |
45:63 |
46:63 |
| 1:6 |
3:6 |
6:6 |
7:6 |
8:6 |
9:6 |
| 10:6 |
15:6 |
15:67 |
16:6 |
16:67 |
17:6 |
| 17:67 |
18:6 |
18:67 |
19:6 |
19:67 |
20:6 |
| 20:67 |
21:6 |
21:67 |
22:6 |
22:67 |
23:6 |
| 23:67 |
24:6 |
24:67 |
25:6 |
25:67 |
26:6 |
| 26:67 |
27:6 |
27:67 |
28:6 |
28:67 |
29:6 |
| 30:6 |
30:67 |
31:6 |
31:67 |
32:6 |
32:67 |
| 33:6 |
33:67 |
34:6 |
34:67 |
35:6 |
35:67 |
| 36:6 |
36:67 |
37:6 |
38:6 |
39:6 |
40:6 |
| 41:6 |
42:6 |
43:6 |
44:6 |
45:6 |
46:6 |
| 47:6 |
48:6 |
49:6 |
50:12 |
51:6 |
| There are 43 hits at base# 6 Bolded sites very near sites |
| listed below |
| There are 21 hits at base# 67 |
| 37:9 |
38:9 |
39:9 |
40:3 |
40:9 |
41:9 |
| 42:9 |
44:3 |
44:9 |
45:9 |
46:9 |
47:9 |
| 50:9 |
| There are 11 hits at base# 9 |
| 1:6 |
3:6 |
6:6 |
7:6 |
8:6 |
9:6 |
| 10:6 |
15:6 |
15:67 |
16:6 |
16:67 |
17:6 |
| 17:67 |
18:6 |
18:67 |
19:6 |
19:67 |
20:6 |
| 20:67 |
21:6 |
21:67 |
22:6 |
22:67 |
23:6 |
| 23:67 |
24:6 |
24:67 |
25:6 |
25:67 |
26:6 |
| 26:67 |
27:6 |
27:67 |
28:6 |
28:67 |
29:6 |
| 30:6 |
30:67 |
31:6 |
31:67 |
32:6 |
32:67 |
| 33:6 |
33:67 |
34:6 |
34:67 |
35:6 |
35:67 |
| 36:6 |
36:67 |
37:6 |
37:9 |
38:6 |
38:9 |
| 39:6 |
39:9 |
40:3 |
40:6 |
40:9 |
41:6 |
| 41:9 |
42:6 |
42:9 |
43:6 |
44:3 |
44:6 |
| 44:9 |
45:6 |
45:9 |
46:6 |
46:9 |
47:6 |
| 47:9 |
48:6 |
49:6 |
50:9 |
50:12 |
51:6 |
| There are 43 hits at base# 6 These often occur together. |
| There are 11 hits at base# 9 |
| There are 2 hits at base# 3 |
| There are 21 hits at base# 67 |
| 1:6 |
3:6 |
6:6 |
7:6 |
8:6 |
9:6 |
| 10:6 |
15:6 |
15:67 |
16:6 |
16:67 |
17:6 |
| 17:67 |
18:6 |
18:67 |
19:6 |
19:67 |
20:6 |
| 20:67 |
21:6 |
21:67 |
22:6 |
22:67 |
23:6 |
| 23:67 |
24:6 |
24:67 |
25:6 |
25:67 |
26:6 |
| 26:67 |
27:6 |
27:67 |
28:6 |
28:67 |
29:6 |
| 30:6 |
30:67 |
31:6 |
31:67 |
32:6 |
32:67 |
| 33:6 |
33:67 |
34:6 |
34:67 |
35:6 |
35:67 |
| 36:6 |
36:67 |
37:6 |
37:9 |
38:6 |
38:9 |
| 39:6 |
39:9 |
40:3 |
40:6 |
40:9 |
41:6 |
| 41:9 |
42:6 |
42:9 |
43:6 |
44:3 |
44:6 |
| 44:9 |
45:6 |
45:9 |
46:6 |
46:9 |
47:6 |
| 47:9 |
48:6 |
49:6 |
50:9 |
50:12 |
51:6 |
| There are 43 hits at base# 6 Often together. |
| There are 11 hits at base# 9 |
| There are 2 hits at base# 3 |
| There are 1 hits at base# 12 |
| There are 21 hits at base# 67 |
| 1:7 |
3:7 |
4:7 |
5:7 |
6:7 |
7:7 |
| 8:7 |
9:7 |
10:7 |
11:7 |
15:7 |
16:7 |
| 17:7 |
18:7 |
19:7 |
20:7 |
21:7 |
22:7 |
| 23:7 |
24:7 |
25:7 |
26:7 |
27:7 |
28:7 |
| 29:7 |
30:7 |
31:7 |
32:7 |
33:7 |
34:7 |
| 35:7 |
36:7 |
37:7 |
38:7 |
39:7 |
40:1 |
| 40:7 |
41:7 |
42:7 |
44:1 |
44:7 |
45:7 |
| 46:7 |
47:7 |
48:7 |
49:7 |
50:7 |
51:7 |
| There are 46 hits at base# 7 |
| 1:7 |
3:7 |
4:7 |
5:7 |
6:7 |
7:7 |
| 8:7 |
9:7 |
10:7 |
11:7 |
15:7 |
16:7 |
| 17:7 |
18:7 |
19:7 |
20:7 |
21:7 |
22:7 |
| 23:7 |
24:7 |
25:7 |
26:7 |
27:7 |
28:7 |
| 29:7 |
30:7 |
31:7 |
32:7 |
33:7 |
34:7 |
| 35:7 |
36:7 |
37:7 |
38:7 |
39:7 |
40:1 |
| 40:7 |
41:7 |
42:7 |
44:1 |
44:7 |
45:7 |
| 46:7 |
47:7 |
48:7 |
49:7 |
50:7 |
51:7 |
| There are 46 hits at base# 7 |
| There are 2 hits at base# 1 |
| 1:8 |
2:8 |
3:8 |
4:8 |
4:24 |
5:8 |
| 6:8 |
7:8 |
8:8 |
9:8 |
10:8 |
11:8 |
| 15:8 |
16:8 |
17:8 |
18:8 |
19:8 |
20:8 |
| 21:8 |
22:8 |
23:8 |
24:8 |
25:8 |
26:8 |
| 27:8 |
28:8 |
29:8 |
29:69 |
30:8 |
31:8 |
| 32:8 |
33:8 |
34:8 |
35:8 |
36:8 |
37:8 |
| 38:8 |
39:8 |
40:2 |
40:8 |
41:8 |
42:8 |
| 43:8 |
44:2 |
44:8 |
45:8 |
46:8 |
47:8 |
| 48:8 |
48:82 |
49:8 |
49:82 |
50:8 |
51:8 |
| Threre are 48 hits at base# 8 |
| There are 2 hits at base# 2 |
| 1:26 |
1:48 |
2:26 |
2:48 |
3:26 |
3:48 |
| 4:26 |
4:48 |
5:26 |
5:48 |
6:26 |
6:48 |
| 7:26 |
7:48 |
8:26 |
8:48 |
9:26 |
10:26 |
| 11:26 |
12:85 |
13:85 |
14:85 |
15:52 |
16:52 |
| 17:52 |
18:52 |
19:52 |
20:52 |
21:52 |
22:52 |
| 23:52 |
24:52 |
25:52 |
26:52 |
27:52 |
28:52 |
| 29:52 |
30:52 |
31:52 |
32:52 |
33:52 |
35:30 |
| 35:52 |
36:52 |
40:24 |
49:52 |
51:26 |
51:48 |
| There are 22 hits at base# 52 52 and 48 never together. |
| There are 9 hits at base# 48 |
| There are 12 hits at base# 26 26 and 24 never together. |
| 1:86 |
3:86 |
6:86 |
7:86 |
8:80 |
11:86 |
| 12:5 |
13:5 |
14:5 |
15:80 |
16:80 |
17:80 |
| 18:80 |
20:80 |
21:80 |
22:80 |
23:80 |
24:80 |
| 25:80 |
26:80 |
27:80 |
28:80 |
29:80 |
30:80 |
| 31:80 |
32:80 |
33:80 |
34:80 |
35:80 |
36:80 |
| 37:59 |
38:59 |
39:59 |
40:59 |
41:59 |
42:59 |
| 43:59 |
44:59 |
45:59 |
46:59 |
47:59 |
50:59 |
| There are 22 hits at base# 80 80 and 86 never together |
| There are 5 hits at base# 86 |
| There are 12 hits at base# 59 |
| 1:39 |
2:39 |
3:39 |
4:39 |
5:39 |
7:39 |
| 8:39 |
9:39 |
10:39 |
11:39 |
15:39 |
16:39 |
| 17:39 |
18:39 |
19:39 |
20:39 |
21:29 |
21:39 |
| 22:39 |
23:39 |
24:39 |
25:39 |
26:39 |
27:39 |
| 28:39 |
29:39 |
30:39 |
31:39 |
32:39 |
33:39 |
| 34:39 |
35:19 |
35:39 |
36:39 |
37:24 |
38:24 |
| 39:24 |
41:24 |
42:24 |
44:24 |
45:24 |
46:24 |
| 47:24 |
48:39 |
48:40 |
49:39 |
49:40 |
50:24 |
| 50:73 |
51:39 |
| There are 35 hits at base# 39 39 and 40 together twice. |
| There are 2 hits at base# 40 |
| 1:40 |
2:40 |
3:40 |
4:40 |
5:40 |
7:40 |
| 8:40 |
9:40 |
9:47 |
10:40 |
10:47 |
11:40 |
| 15:40 |
18:40 |
19:40 |
20:40 |
21:40 |
22:40 |
| 23:40 |
24:40 |
25:40 |
26:40 |
27:40 |
28:40 |
| 29:40 |
30:40 |
31:40 |
32:40 |
34:40 |
35:20 |
| 35:40 |
36:40 |
37:24 |
38:24 |
39:24 |
41:24 |
| 42:24 |
44:24 |
45:24 |
46:24 |
47:24 |
48:40 |
| 48:41 |
49:40 |
49:41 |
50:74 |
51:40 |
| There are 32 hits at base# 40 40 and 41 together twice |
| There are 2 hits at base# 41 |
| There are 9 hits at base# 24 |
| There are 2 hits at base# 47 |
| BstNI CCwgg |
44 |
|
| PspGI ccwgg |
| 1:40 |
2:40 |
3:40 |
4:40 |
5:40 |
7:40 |
| 8:40 |
9:40 |
10:40 |
11:40 |
15:40 |
16:40 |
| 17:40 |
18:40 |
19:40 |
20:40 |
21:30 |
21:40 |
| 22:40 |
23:40 |
24:40 |
25:40 |
26:40 |
27:40 |
| 28:40 |
29:40 |
30:40 |
31:40 |
32:40 |
33:40 |
| 34:40 |
35:40 |
36:40 |
37:25 |
38:25 |
39:25 |
| 41:25 |
42:25 |
44:25 |
45:25 |
46:25 |
47:25 |
| 50:25 |
51:40 |
| There are 33 hits at base# 40 |
| 1:40 |
2:40 |
3:40 |
4:40 |
5:40 |
7:40 |
| 8:40 |
9:40 |
10:40 |
11:40 |
15:40 |
16:40 |
| 17:40 |
18:40 |
19:40 |
20:40 |
21:30 |
21:40 |
| 22:40 |
23:40 |
24:40 |
25:40 |
26:40 |
27:40 |
| 28:40 |
29:40 |
30:40 |
31:40 |
32:40 |
33:40 |
| 34:40 |
35:20 |
35:40 |
36:40 |
37:25 |
38:25 |
| 39:25 |
41:25 |
42:25 |
44:25 |
45:25 |
46:25 |
| 47:25 |
48:40 |
48:41 |
49:40 |
49:41 |
50:25 |
| 50:74 |
51:40 |
| There are 35 hits at base# 40 |
| There are 2 hits at base# 41 |
| 1:43 |
2:43 |
3:43 |
4:43 |
5:43 |
6:43 |
| 7:43 |
8:43 |
9:43 |
10:43 |
15:46 |
16:46 |
| 17:46 |
18:46 |
19:46 |
20:46 |
21:46 |
22:46 |
| 23:46 |
24:46 |
25:46 |
26:46 |
27:46 |
28:46 |
| 30:46 |
31:46 |
32:46 |
33:46 |
34:46 |
35:46 |
| 36:46 |
37:46 |
43:79 |
51:43 |
| There are 22 hits at base# 46 46 and 43 never together |
| There are 11 hits at base# 43 |
| 1:43 |
2:43 |
3:43 |
4:43 |
5:43 |
6:43 |
| 7:43 |
8:43 |
9:43 |
9:79 |
10:43 |
10:79 |
| 15:46 |
15:47 |
16:47 |
17:46 |
17:47 |
18:46 |
| 18:47 |
19:46 |
19:47 |
20:46 |
20:47 |
21:46 |
| 21:47 |
22:46 |
22:47 |
23:47 |
24:47 |
25:47 |
| 26:47 |
27:46 |
27:47 |
28:46 |
28:47 |
29:47 |
| 30:46 |
30:47 |
31:46 |
31:47 |
32:46 |
32:47 |
| 33:46 |
33:47 |
34:46 |
34:47 |
35:46 |
35:47 |
| 36:46 |
36:47 |
37:21 |
37:46 |
37:47 |
37:79 |
| 38:21 |
39:21 |
39:79 |
40:79 |
41:21 |
41:79 |
| 42:21 |
42:79 |
43:79 |
44:21 |
44:79 |
45:21 |
| 45:79 |
46:21 |
46:79 |
47:21 |
51:43 |
| There are 23 hits at base# 47 46 & 47 often together |
| There are 17 hits at base# 46 There are 11 hits at base# 43 |
| 1:44 |
2:3 |
2:44 |
3:44 |
4:44 |
5:3 |
5:44 |
6:44 |
| 7:44 |
8:22 |
8:44 |
9:44 |
10:44 |
11:3 |
12:22 |
13:22 |
| 14:22 |
15:33 |
15:47 |
16:47 |
17:47 |
18:47 |
19:47 |
20:47 |
| 21:47 |
22:47 |
23:33 |
23:47 |
24:33 |
24:47 |
25:33 |
25:47 |
| 26:33 |
26:47 |
27:47 |
28:47 |
29:47 |
30:47 |
31:33 |
31:47 |
| 32:33 |
32:47 |
33:33 |
33:47 |
34:33 |
34:47 |
35:47 |
36:47 |
| 37:21 |
37:22 |
37:47 |
38:21 |
38:22 |
39:21 |
39:22 |
41:21 |
| 41:22 |
42:21 |
42:22 |
43:80 |
44:21 |
44:22 |
45:21 |
45:22 |
| 46:21 |
46:22 |
47:21 |
47:22 |
50:22 |
51:44 |
| There are 23 hits at base# 47 These do not occur together. |
| There are 11 hits at base# 44 |
| There are 14 hits at base# 22 These do occur together. |
| There are 9 hits at base# 21 |
| 1:58 |
3:58 |
4:58 |
5:58 |
8:58 |
9:58 |
| 10:58 |
13:70 |
36:18 |
37:70 |
38:70 |
39:70 |
| 40:70 |
41:70 |
42:70 |
44:70 |
45:70 |
46:70 |
| 47:70 |
48:48 |
49:48 |
50:85 |
| There are 11 hits at base# 70 |
| 13:40 |
15:48 |
16:48 |
17:48 |
18:48 |
20:48 |
| 21:48 |
22:48 |
23:48 |
24:48 |
25:48 |
26:48 |
| 27:48 |
28:48 |
29:48 |
30:10 |
30:48 |
31:48 |
| 32:48 |
33:48 |
35:48 |
36:48 |
43:40 |
44:40 |
| 45:40 |
46:40 |
47:40 |
| There are 20 hits at base# 48 |
| AvaII Ggwcc |
44 |
|
| Sau96I ($M.HaeIII) |
44 |
| Ggwcc |
| 2:3 |
5:3 |
6:44 |
8:44 |
9:44 |
10:44 |
| 11:3 |
12:22 |
13:22 |
14:22 |
15:33 |
15:47 |
| 16:47 |
17:47 |
18:47 |
19:47 |
20:47 |
21:47 |
| 22:47 |
23:33 |
23:47 |
24:33 |
24:47 |
25:33 |
| 25:47 |
26:33 |
26:47 |
27:47 |
28:47 |
29:47 |
| 30:47 |
31:33 |
31:47 |
32:33 |
32:47 |
33:33 |
| 33:47 |
34:33 |
34:47 |
35:47 |
36:47 |
37:47 |
| 43:80 |
50:22 |
| There are 23 hits at base# 47 44 & 47 never together |
| There are 4 hits at base# 44 |
| 6:43 |
8:43 |
9:43 |
10:43 |
15:46 |
16:46 |
| 17:46 |
18:46 |
19:46 |
20:46 |
21:46 |
22:46 |
| 23:46 |
24:46 |
25:46 |
26:46 |
27:46 |
28:46 |
| 30:46 |
31:46 |
32:46 |
33:46 |
34:46 |
35:46 |
| 36:46 |
37:46 |
43:79 |
| There are 22 hits at base# 46 43 and 46 never occur together. |
| There are 4 hits at base# 43 |
| 15:48 |
16:48 |
17:48 |
1:0 |
1:0 |
20:48 |
| 21:48 |
22:48 |
23:48 |
24:48 |
25:48 |
26:48 |
| 27:48 |
28:48 |
29:48 |
30:48 |
31:48 |
32:48 |
| 33:48 |
34:48 |
35:48 |
36:48 |
37:54 |
38:54 |
| 39:54 |
40:54 |
41:54 |
42:54 |
43:54 |
44:54 |
| 45:54 |
46:54 |
47:54 |
| There are 20 hits at base# 48 |
| There are 11 hits at base# 54 |
| 8:77 |
12:16 |
13:16 |
14:16 |
15:16 |
15:56 |
| 15:77 |
16:16 |
16:56 |
16:77 |
17:16 |
17:56 |
| 17:77 |
18:16 |
18:56 |
18:77 |
19:16 |
19:56 |
| 19:77 |
20:16 |
20:56 |
20:77 |
21:16 |
21:56 |
| 21:77 |
22:16 |
22:56 |
22:77 |
23:16 |
23:56 |
| 23:77 |
24:16 |
24:56 |
24:77 |
25:16 |
25:56 |
| 25:77 |
26:16 |
26:56 |
26:77 |
27:16 |
27:26 |
| 27:56 |
27:77 |
28:16 |
28:56 |
28:77 |
29:16 |
| 29:56 |
29:77 |
30:56 |
31:16 |
31:56 |
31:77 |
| 32:16 |
32:56 |
32:77 |
33:16 |
33:56 |
33:77 |
| 34:16 |
35:16 |
35:56 |
35:77 |
36:16 |
36:26 |
| 36:56 |
36:77 |
37:16 |
38:16 |
39:16 |
40:16 |
| 41:16 |
42:16 |
44:16 |
45:16 |
46:16 |
47:16 |
| 48:46 |
49:46 |
| There are 34 hits at base# 16 |
| 8:77 |
15:77 |
16:77 |
17:77 |
18:77 |
19:77 |
| 20:77 |
21:77 |
22:77 |
23:77 |
24:77 |
25:77 |
| 26:77 |
27:77 |
28:77 |
29:77 |
31:77 |
32:77 |
| 33:77 |
35:77 |
36:77 |
| There are 21 hits at base# 77 |
| 12:16 |
13:16 |
14:16 |
15:16 |
16:16 |
17:16 |
| 18:16 |
19:16 |
20:16 |
21:16 |
22:16 |
23:16 |
| 24:16 |
25:16 |
26:16 |
27:16 |
27:26 |
28:16 |
| 29:16 |
31:16 |
32:16 |
33:16 |
34:16 |
35:16 |
| 36:16 |
36:26 |
37:16 |
38:16 |
39:16 |
40:16 |
| 41:16 |
42:16 |
44:16 |
45:16 |
46:16 |
47:16 |
| 48:46 |
49:46 |
| There are 34 hits at base# 16 |
| 15:56 |
16:56 |
17:56 |
18:56 |
19:56 |
20:56 |
| 21:56 |
22:56 |
23:56 |
24:56 |
25:56 |
26:56 |
| 27:56 |
28:56 |
29:56 |
30:56 |
31:56 |
32:56 |
| 33:56 |
35:56 |
36:56 |
| There are 21 hits at base# 56 |
| 12:16 |
13:16 |
14:16 |
15:16 |
16:16 |
17:16 |
| 18:16 |
19:16 |
20:16 |
21:16 |
22:16 |
23:16 |
| 24:16 |
25:16 |
26:16 |
27:16 |
27:26 |
28:16 |
| 29:16 |
31:16 |
32:16 |
33:16 |
34:16 |
35:16 |
| 36:16 |
36:26 |
37:16 |
38:16 |
39:16 |
40:16 |
| 41:16 |
42:16 |
44:16 |
45:16 |
46:16 |
47:16 |
| 48:46 |
49:46 |
| There are 34 hits at base# 16 |
| 15:56 |
16:56 |
17:56 |
18:56 |
19:56 |
20:56 |
| 21:56 |
22:56 |
23:56 |
24:56 |
25:56 |
26:56 |
| 27:56 |
28:56 |
29:56 |
30:56 |
31:56 |
32:56 |
| 33:56 |
35:56 |
36:56 |
| There are 21 hits at base# 56 |
| 15:68 |
16:68 |
17:68 |
18:68 |
19:68 |
20:68 |
| 21:68 |
22:68 |
23:68 |
24:68 |
25:68 |
26:68 |
| 27:68 |
28:68 |
29:68 |
30:68 |
31:68 |
32:68 |
| 33:68 |
34:68 |
35:68 |
36:68 |
39:46 |
40:46 |
| 41:46 |
42:46 |
| There are 22 hits at base# 68 |
|
| ! 1 2 3 4 5 6 7 8 9 11 12 |
|
|
| |
| GAC ATC CAG ATG ACC CAG TCT CCA TCC TGC CTG TCT |
| |
| ! 13 14 15 16 17 18 19 20 21 22 23 |
| |
| GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC ! |
O12 |
| |
| GAC ATC CAG ATG ACC CAG TCT CCA TGC TGC CTG TCT |
| |
| GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC ! |
O2 |
| |
| GAC ATC CAG ATG ACC CAG TCT CCA TGC TGC CTG TCT |
| |
| GCA TCT GTA GGA GAC AGA GTC ACC ACC ACT TGC ! |
O18 |
| |
| GAC ATC CAG ATG ACC CAG TCT CCA TGC TGC CTG TCT |
| |
| GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC ! |
O8 |
| |
| GAC ATC CAG ATG ACC CAG TCT CCA TGC TGC CTG TCT |
| |
| GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC ! |
A20 |
| |
| GAC ATC CAG ATG ACC CAG TCT CCA TGC TGC CTG TCT |
| |
| GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC ! |
A30 |
| |
| AAC ATC CAG ATG ACC CAG TCT CCA TCT GCC ATG TCT |
| |
| GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGT ! |
L14 |
| |
| GAC ATC CAG ATG ACC CAG TCT CCA TGC TCA CTG TCT |
| |
| CCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGT ! |
L1 |
| |
| GAC ATC CAG ATC ACC CAG TCT CCA TGC TCA GTC TCT |
| |
| CCA TCT CTA GGA GAC AGA GTC ACC ATC ACT TGT ! |
L15 |
| |
| GCC ATC CAG TTG ACC CAG TCT CCA TGC TGC CTG TCT |
| |
| GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC ! |
L4 |
| |
| GCC ATC CAG TTG ACC CAG TCT CCA TGC TGC CTG TCT |
| |
| GCA TCT CTA GGA GAC AGA GTC ACC ATC ACT TGC ! |
L18 |
| |
| GAC ATC CAG ATG ACC CAG TCT CCA TCT TGC GTG TCT |
| |
| GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TCT ! |
L5 |
| |
| GAC ATC CAG ATG ACC CAG TCT CCA TCT TCT GTG TCT |
| |
| CCA TCT CTA CGA GAC ACA GTC ACC ATC ACT TGT ! |
L19 |
| |
| GAC ATC CAG TTG ACC CAG TCT CCA TGC TTC GTC TCT |
| |
| GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC ! |
L8 |
| |
| GAC ATC CCG ATC ACC CAG TCT CCA TTC TGC GTC TCT |
| |
| CCA TCT CTA CGA GAC AGA GTC ACC ATC ACT TGC ! |
L23 |
| |
| GCC ATC CGG ATC ACC CAG TCT CCA TCC TCA TTC TCT |
| |
| GCA TCT ACA GGA GAC AGA GTC ACC ATC ACT TCT ! |
L9 |
| |
| GTC ATC TGG ATG ACC CAG TCT CCA TGC TTA GTC TCT |
| |
| GCA TCT ACA GGA GAC AGA GTC ACC ATC AGT TGT ! |
L24 |
| |
| GCC ATC CAG ATG ACC CAG TCT CCA TGC TGC CTG TCT |
| |
| GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC ! |
L11 |
| |
| GAC ATC CAG ATG ACC CAG TCT CCT TGC ACC CTG TCT |
| |
| GCA TCT GTA GGA GAC AGA GTC ACC ATC ACT TGC ! |
L12 |
| |
| GAT ATT GTG ATG ACC CAG ACT CCA GTC TGC CTG CCC |
| |
| GTC ACC CCT GGA GAG CCG GCC TGC ATC TGC TGC ! |
O11 |
| |
| GAT ATT GTG ATG ACC CAG ACT CCA GTC TGC CTG CCC |
| |
| GTC ACC CCT GGA GAG CCG GCC TGC ATC TGC TGC ! |
O1 |
| |
| GAT GTT GTG ATG ACT CAG TCT CCA GTC TGC CTG CCC |
| |
| GTC ACC CTT GGA CAG CCG GCC TGC ATC TGC TGC ! |
A17 |
| |
| GAT GTT GTG ATG ACT CAG TCT CCA GTC TGC CTG CCC |
| |
| GTC ACC CTT GGA CAG CCG GCC TGC ATC TGC TGC ! |
A1 |
| |
| GAT ATT GTG ATG ACC CAG ACT CCA GTC TCT CTG TGC |
| |
| GTC ACC CCT GGA CAG CCG GCC TGC ATC TGC TGC ! |
A18 |
| |
| GAT ATT GTG ATG ACC CAG ACT CCA GTC TCT GTC TGC |
| |
| GTC ACC CCT GGA CAG CCG GCC TGC ATC TGC TGC ! |
A2 |
| |
| GAT ATT GTG ATG ACT CAG TCT CCA GTC TGC CTG CCC |
| |
| GTC ACC CCT GGA GAG CCG GCC TGC ATC TGC TGC ! |
A19 |
| |
| GAT ATT GTG ATG ACT CAG TCT CCA GTC TGC CTG CCC |
| |
| GTC ACC CCT GGA GAG CCG GCC TGC ATC TGC TGC ! |
A3 |
| |
| GAT ATT GTG ATG ACC CAG ACT CCA GTC TGC TCA CCT |
| |
| GTC ACC CTT GGA CAG CCG GCC TGC ATC TGC TGC ! |
A23 |
| |
| GAA ATT GTG TTG ACG CAG TCT CCA GGC ACC CTG TCT |
| |
| TTG TCT CCA GGG GAA AGA GCC ACC GTC TGC TGC ! |
A27 |
| |
| GAA ATT GTG TTG ACG CAG TCT CCA GCC ACC CTG TCT |
| |
| TTG TCT CCA GGG GAA AGA GCC ACC GTC TGC TGC ! |
A11 |
| |
| GAA ATA GTG ATG ACG CAG TCT CCA GCC ACC CTG TCT |
| |
| GTG TCT CCA GGG GAA AGA GCC ACC GTC TGC TGC ! |
L2 |
| |
| GAA ATA GTG ATG ACG CAG TCT CCA CCC ACC CTG TCT |
| |
| GTG TCT CCA GGG GAA AGA CCC ACC GTC TGC TGC ! |
L16 |
| |
| GAA ATT GTG TTG ACA CAG TCT CCA CCC ACC CTG TCT |
| |
| TTG TCT CCA GGG GAA AGA GCC ACC GTC TGC TGC ! |
L6 |
| |
| GAA ATT GTG TTG ACA CAG TCT CCA CCC ACC GTC TCT |
| |
| TTG TCT CCA GGG GAA AGA GCC ACC GTC TGC TGC ! |
L20 |
| |
| GAA ATT GTA ATG ACA CAG TCT CCA GCC ACC CTG TCT |
| |
| TTG TCT CCA GGG GAA AGA GCC ACC GTC TGC TGC ! |
L25 |
| |
| GAC ATC GTG ATG ACC CAG TCT CCA GAC TGC CTG GCT |
| |
| GTG TCT CTG GGC GAG AGG GCC ACC ATC AAC TGC ! |
B3 |
| |
| GAA ACG ACA GTC ACG CAG TCT CCA GCA TTC ATG TCA |
| |
| GCG ACT CCA GGA GAC AAA GTC AAC ATC TGC TGC ! |
B2 |
| |
| GAA ATT GTG CTG ACT CAG TCT CCA GAC TTT CAG TCT |
| |
| GTG ACT CCA AAG GAG AAA GTC ACC ATC ACC TGC ! |
A26 |
| |
| GAA ATT GTG CTG ACT CAG TCT CCA GAC TTT CAG TCT |
| |
| GTG ACT CCA AAG GAG AAA GTC ACC ATC ACC TGC ! |
A10 |
| |
| GAT GTT GTG ATG ACA CAG TCT CCA GCT TTC GTC TCT |
| |
| GTG ACT CCA GGG GAG AAA GTC ACC ATC ACC TGC ! |
A14 |
|
| TABLE 9 |
|
|
| RERS sites found in Human Kappa FR1 GLGs |
|
|
|
MslI |
--> |
<-- |
--> |
PflFI |
BsrI |
BsmAI |
MnlI |
4V |
|
|
| O12 |
1-69 |
3 |
3 |
23 |
|
12 |
49 |
|
15 |
18 |
47 |
26 |
|
36 |
| O2 |
101-169 |
103 |
103 |
123 |
|
112 |
149 |
|
115 |
118 |
147 |
126 |
|
136 |
| O18 |
201—269 |
203 |
203 |
223 |
|
212 |
249 |
|
215 |
218 |
247 |
226 |
|
236 |
| O8 |
301-369 |
303 |
303 |
323 |
|
312 |
349 |
|
315 |
318 |
347 |
326 |
|
336 |
| A20 |
401-469 |
403 |
403 |
423 |
|
412 |
449 |
|
415 |
418 |
447 |
426 |
|
436 |
| A30 |
501-569 |
503 |
503 |
523 |
|
512 |
549 |
|
515 |
518 |
547 |
526 |
|
536 |
| L14 |
601-669 |
603 |
603 |
|
|
612 |
649 |
|
615 |
618 |
647 |
— |
|
636 |
| L1 |
701-769 |
703 |
703 |
723 |
|
712 |
749 |
|
715 |
718 |
747 |
726 |
|
736 |
| L15 |
801-869 |
803 |
803 |
823 |
|
812 |
849 |
|
815 |
818 |
847 |
826 |
|
836 |
| L4 |
901-969 |
— |
903 |
923 |
|
912 |
949 |
906 |
915 |
918 |
947 |
926 |
|
936 |
| L18 |
1001-1069 |
— |
1003 |
|
|
1012 |
1049 |
1006 |
1015 |
1018 |
1047 |
1026 |
|
1036 |
| L5 |
1101-1169 |
1103 |
— |
|
|
1112 |
1149 |
|
1115 |
1118 |
1147 |
— |
|
1136 |
| L19 |
1201-1269 |
1203 |
1203 |
|
|
1212 |
1249 |
|
1215 |
1218 |
1247 |
— |
|
1236 |
| L8 |
1301-1369 |
— |
1303 |
1323 |
|
1312 |
1349 |
1306 |
1315 |
1318 |
1347 |
— |
|
1336 |
| L23 |
1401-1469 |
1403 |
1403 |
1408 |
|
1412 |
1449 |
|
1415 |
1418 |
1447 |
— |
|
1436 |
| L9 |
1501-1569 |
1503 |
1503 |
1508 |
1523 |
1512 |
1549 |
|
1515 |
1518 |
1547 |
1526 |
|
1536 |
| L24 |
1601-1669 |
1603 |
|
1608 |
1623 |
1612 |
1649 |
|
1615 |
1618 |
1647 |
— |
|
1636 |
| L11 |
1701-1769 |
1703 |
1703 |
|
1723 |
1712 |
1749 |
|
1715 |
1718 |
1747 |
1726 |
|
1736 |
| L12 |
1801-1869 |
1803 |
1803 |
|
|
1812 |
1849 |
|
1815 |
1818 |
1847 |
— |
|
1836 |
| VKII |
| O11 |
1901-1969 |
— |
— |
|
|
— |
|
— |
|
— |
|
|
1956 |
— |
| O1 |
2001-2069 |
— |
— |
|
|
— |
|
— |
|
|
|
|
2056 |
— |
| A17 |
2101-2169 |
— |
— |
|
|
2112 |
|
— |
|
2118 |
|
|
2156 |
— |
| A1 |
2201-2269 |
— |
— |
|
|
2212 |
|
— |
|
2218 |
|
|
2256 |
— |
| A18 |
2301-2369 |
— |
— |
|
|
— |
|
— |
|
— |
|
|
2356 |
— |
| A2 |
2401-2469 |
— |
— |
|
|
— |
|
— |
|
— |
|
|
2456 |
— |
| A19 |
2501-2569 |
— |
— |
|
|
2512 |
|
— |
|
2518 |
|
|
2556 |
— |
| A3 |
2601-2669 |
— |
— |
|
|
2612 |
|
— |
|
2618 |
|
|
2656 |
— |
| A23 |
2701-2769 |
— |
— |
|
|
— |
|
— |
|
— |
|
2729 |
2756 |
— |
| A27 |
2801-2869 |
— |
— |
|
|
2812 |
|
— |
|
2818 |
2839 |
|
2860 |
— |
| A11 |
2901-2969 |
— |
— |
|
|
2912 |
|
— |
|
2918 |
2939 |
|
2960 |
— |
| L2 |
3001-3069 |
— |
— |
|
|
3012 |
|
— |
|
3018 |
3039 |
|
3060 |
— |
| L16 |
3101-3169 |
— |
— |
|
|
3112 |
|
— |
|
3118 |
3139 |
|
3160 |
— |
| L6 |
3201-3269 |
— |
— |
|
|
3212 |
|
— |
|
3218 |
3239 |
|
3260 |
— |
| L20 |
3301-3369 |
— |
— |
|
|
3312 |
|
— |
|
3318 |
3339 |
|
3360 |
— |
| L25 |
3401-3469 |
— |
— |
|
|
3412 |
|
— |
|
3418 |
3439 |
|
3460 |
— |
| B3 |
3501-3569 |
3503 |
— |
|
|
3512 |
|
3515 |
|
3518 |
3539 |
3551< |
|
— |
| VKV |
| B2 |
3601-3669 |
— |
— |
|
|
|
3649 |
— |
|
3618 |
3647 |
|
|
— |
| A26 |
3701-3769 |
— |
— |
|
|
3712 |
|
— |
|
3718 |
|
|
|
— |
| A10 |
3801-3869 |
— |
— |
|
|
3812 |
|
— |
|
3818 |
|
|
|
— |
| A14 |
3901-3969 |
— |
— |
|
|
3912 |
|
— |
|
3918 |
|
3930> |
|
— |
|
|
MlyI |
Tsp45I same |
HphI |
MspI |
|
SfaNI |
SfcI |
HinfI |
--> |
--> |
<-- |
sites |
xx38 |
xx56 |
xx62 |
xx06 |
xx52 |
|
|
| O12 |
1-69 |
37 |
41 |
|
53 |
|
53 |
|
|
55 |
|
56 |
|
— |
|
| O2 |
101-169 |
137 |
141 |
|
153 |
|
153 |
|
|
155 |
|
156 |
|
— |
| O18 |
201-269 |
237 |
241 |
|
253 |
|
253 |
|
|
255 |
|
256 |
|
— |
| O8 |
301-369 |
337 |
341 |
|
353 |
|
353 |
|
|
355 |
|
356 |
|
— |
| A20 |
401-469 |
437 |
441 |
|
453 |
|
453 |
|
|
455 |
|
456 |
|
— |
| A30 |
501-569 |
537 |
541 |
|
553 |
|
553 |
|
|
555 |
|
556 |
|
— |
| L14 |
601-669 |
637 |
641 |
|
653 |
|
653 |
|
|
655 |
|
656 |
|
— |
| L1 |
701-769 |
737 |
741 |
|
753 |
|
753 |
|
|
755 |
|
756 |
|
— |
| L15 |
801-869 |
837 |
841 |
|
853 |
|
853 |
|
|
855 |
|
856 |
|
— |
| L4 |
901-969 |
937 |
941 |
|
953 |
|
953 |
|
|
955 |
|
956 |
|
— |
| L18 |
1001-1069 |
1037 |
1041 |
|
1053 |
|
1053 |
|
|
1055 |
|
1056 |
|
— |
| L5 |
1101-1169 |
1137 |
1141 |
|
1153 |
|
1153 |
|
|
1155 |
|
1156 |
|
— |
| L19 |
1201-1269 |
1237 |
1241 |
|
1253 |
|
1253 |
|
|
1255 |
|
1256 |
|
— |
| L8 |
1301-1369 |
1337 |
1341 |
|
1353 |
|
1353 |
|
|
1355 |
|
1356 |
|
— |
| L23 |
1401-1469 |
1437 |
1441 |
|
1453 |
|
1453 |
|
|
1455 |
|
1456 |
|
1406 |
| L9 |
1501-1569 |
1537 |
1541 |
|
1553 |
|
1553 |
|
|
1555 |
|
1556 |
|
1506 |
| L24 |
1601-1669 |
1637 |
1641 |
|
1653 |
|
1653 |
|
|
1655 |
|
1656 |
|
|
| L11 |
1701-1769 |
1737 |
1741 |
|
1753 |
|
1753 |
|
|
1755 |
|
1756 |
| L12 |
1801-1869 |
1837 |
1841 |
|
1853 |
|
1853 |
|
|
1855 |
|
1856 |
| VKII |
| O11 |
1901-1969 |
— |
— |
|
1918 |
|
1918 |
|
1937 |
|
1938 |
|
|
|
1952 |
| O1 |
2001-2069 |
— |
— |
|
2018 |
|
2018 |
|
2037 |
|
2038 |
|
|
|
2052 |
| A17 |
2101-2169 |
— |
— |
2112 |
|
2112 |
|
|
2137 |
|
2138 |
|
|
|
2152 |
| A1 |
2201-2269 |
— |
— |
2212 |
|
2212 |
|
|
2237 |
|
2238 |
|
|
|
2252 |
| A18 |
2301-2369 |
— |
— |
|
2318 |
|
2318 |
|
2337 |
|
2338 |
|
|
|
2352 |
| A2 |
2401-2469 |
— |
— |
|
2418 |
|
2418 |
|
2437 |
|
2438 |
|
|
|
2452 |
| A19 |
2501-2569 |
— |
— |
2512 |
|
2512 |
|
|
2537 |
|
2538 |
|
|
|
2552 |
| A3 |
2601-2669 |
— |
— |
2612 |
|
2612 |
|
|
2637 |
|
2638 |
|
|
|
2652 |
| A23 |
2701-2769 |
— |
— |
|
2718 |
|
2718 |
|
2737 |
|
2731* |
2738* |
|
— |
| A27 |
2801-2869 |
— |
— |
— |
|
— |
|
|
|
|
|
|
|
— |
|
| A11 |
2901-2969 |
— |
— |
— |
|
— |
|
|
|
|
|
|
|
— |
| L2 |
3001-3069 |
— |
— |
— |
|
— |
|
|
|
|
|
|
|
— |
| L16 |
3101-3169 |
— |
— |
— |
|
— |
|
|
|
|
|
|
|
— |
| L6 |
3201-3269 |
— |
— |
— |
|
— |
|
|
|
|
|
|
|
— |
| L20 |
3301-3369 |
— |
— |
— |
|
— |
|
|
|
|
|
|
|
— |
| L25 |
3401-3469 |
— |
— |
— |
|
— |
|
|
|
|
|
|
|
— |
| B3 |
3501-3569 |
— |
— |
|
3525 |
|
3525 |
|
|
|
|
|
|
— |
|
| VKV |
| B2 |
3601-3669 |
— |
— |
|
3639 |
|
3639 |
|
|
|
|
|
|
— |
| A26 |
3701-3769 |
— |
— |
3712 |
3739 |
3712 |
3739 |
|
3737 |
3755 |
|
3756 |
3762 |
— |
|
| A10 |
3801-3869 |
— |
— |
3812 |
3839 |
3812 |
3839 |
|
3837 |
3855 |
|
3856 |
3862 |
— |
| A14 |
3901-3969 |
— |
— |
|
3939 |
|
3939 |
|
3937 |
3955 |
|
3956 |
3962 |
— |
|
|
|
BsaJI |
BssKI (NstNI) |
xx20 |
xx41 |
xx44 |
NaeI |
|
|
xx29 |
xx42 |
xx43 |
xx22 |
xx30 |
xx43 |
--> |
--> |
<-- |
NgoMIV |
HaeIII |
Tsp509I |
|
|
| O12 |
1-69 |
— |
|
|
— |
|
|
— |
|
|
— |
— |
— |
| O2 |
101-169 |
— |
|
|
— |
|
|
— |
|
|
— |
— |
— |
| O18 |
201-269 |
— |
|
|
— |
|
|
— |
|
|
— |
— |
— |
| O8 |
301-369 |
— |
|
|
— |
|
|
— |
|
|
— |
— |
— |
| A20 |
401-469 |
— |
|
|
— |
|
|
— |
|
|
— |
— |
— |
| A30 |
501-569 |
— |
|
|
— |
|
|
— |
|
|
— |
— |
— |
| L14 |
601-669 |
— |
|
|
— |
|
|
— |
|
|
— |
— |
— |
| L1 |
701-769 |
— |
|
|
— |
|
|
— |
|
|
— |
— |
— |
| L15 |
801-869 |
— |
|
|
— |
|
|
— |
|
|
— |
— |
— |
| L4 |
901-969 |
— |
|
|
— |
|
|
— |
|
|
— |
— |
— |
| L18 |
1001-1069 |
— |
|
|
— |
|
|
— |
|
|
— |
— |
— |
| L5 |
1101-1169 |
— |
|
|
— |
|
|
— |
|
|
— |
— |
— |
| L19 |
1201-1269 |
— |
|
|
— |
|
|
— |
|
|
— |
— |
— |
| L8 |
1301-1369 |
— |
|
|
— |
|
|
— |
|
|
— |
— |
— |
| L23 |
1401-1469 |
— |
— |
— |
— |
— |
— |
| L9 |
1501-1569 |
— |
|
|
— |
|
|
— |
|
|
— |
— |
— |
| L24 |
1601-1669 |
— |
|
|
— |
|
|
— |
|
|
— |
— |
— |
| L11 |
1701-1769 |
— |
|
|
— |
|
|
— |
|
|
— |
— |
— |
| L12 |
1801-1869 |
— |
|
|
— |
|
|
— |
|
|
— |
— |
— |
| VKII |
| O11 |
1901-1969 |
|
1942 |
|
|
1943 |
|
|
1944 |
|
1951 |
1954 |
— |
| O1 |
2001-2069 |
|
2042 |
|
|
2043 |
|
|
2044 |
|
2051 |
2054 |
— |
| A17 |
2101-2169 |
|
2142 |
|
— |
|
|
— |
|
|
2151 |
2154 |
— |
| A1 |
2201-2269 |
|
2242 |
|
— |
|
|
— |
|
|
2251 |
2254 |
— |
| A18 |
2301-2369 |
|
2342 |
|
|
2343 |
|
— |
|
|
2351 |
2354 |
— |
| A2 |
2401-2469 |
|
2442 |
|
|
2443 |
|
— |
|
|
2451 |
2454 |
— |
| A19 |
2501-2569 |
|
2542 |
|
|
2543 |
|
|
2544 |
|
2551 |
2554 |
— |
| A3 |
2601-2669 |
|
2642 |
|
|
2643 |
|
|
2644 |
|
2651 |
2654 |
— |
| A23 |
2701-2769 |
|
2742 |
|
— |
|
— |
|
|
|
2751 |
2754 |
— |
| A27 |
2801-2869 |
|
2843 |
|
2822 |
2843 |
|
2820 |
2841 |
|
— |
— |
2803 |
| A11 |
2901-2969 |
|
2943 |
|
|
2943 |
|
2920 |
2941 |
|
— |
— |
2903 |
| L2 |
3001-3069 |
|
3043 |
|
|
3043 |
|
|
3041 |
— |
|
— |
— |
| L16 |
3101-3169 |
|
3143 |
|
|
3143 |
|
3120 |
3141 |
|
— |
— |
— |
| L6 |
3201-3269 |
|
3243 |
|
|
3243 |
|
3220 |
3241 |
|
— |
— |
3203 |
| L20 |
3301-3369 |
|
3343 |
|
|
3343 |
|
3320 |
3341 |
|
— |
— |
3303 |
| L25 |
3401-3469 |
|
3443 |
|
|
3443 |
|
3420 |
3441 |
|
— |
— |
3403 |
| B3 |
3501-3569 |
3529 |
|
|
|
3530 |
|
3520 |
|
|
— |
3554 |
|
| VKV |
| B2 |
3601-3669 |
|
|
|
|
3643 |
|
3620 |
3641 |
|
— |
— |
| A26 |
3701-3769 |
|
|
|
— |
|
|
3720 |
|
|
— |
— |
3703 |
| A10 |
3801-3869 |
|
|
|
— |
|
|
3820 |
|
|
— |
— |
3803 |
| A14 |
3901-3969 |
|
3943 |
|
|
3943 |
|
3920 |
3941 |
|
— |
— |
— |
|
| TABLE 10 |
|
|
| Lambda FR1 GLG sequences |
|
|
| ! VL1 |
|
|
|
CAG TCT GTG CTG ACT CAG CCA CCC TCG GTG TCT GAA |
| |
|
GCC CCC AGG CAG AGG GTC ACC ATO TCC TGT ! 1a |
| |
|
cag tct gtg ctg acG cag ccG ccc tcA gtg tct gGG |
| |
|
gcc ccA Ggg cag agg gtc acc atc tcc tgC ! 1e |
| |
|
cag tct gtg ctg act cag cca ccc tcA gcg tct gGG |
| |
|
Acc ccc Ggg cag agg gtc acc atc tcT tgt ! 1c |
| |
|
cag tct gtg ctg act cag cca ccc tcA gCg tct gGG |
| |
|
Acc ccc Ggg cag agg gtc acc atc tcT tgt ! 1c |
| |
|
cag tct gtg ctg acG cag ccG ccc tcA gtg tot gGG |
| |
|
gcc ccA GgA cag aAg gtc acc atc tcc tgC ! 1b |
| |
| ! VL2 |
|
CAG TCT GCC CTG ACT CAG CCT CCC TCC GCG TCC GGG |
| |
|
TCT CCT GGA CAG TCA GTC ACC ATC TCC TGC ! 2c |
| |
|
cag tct gcc ctg act cag cct cGc tcA gTg tcc ggg |
| |
|
tct cct gga cag tca gtc acc atc tcc tgc! 2e |
| |
|
cag tct gcc ctg act cag cct Gcc tcc gTg tcT ggg |
| |
|
tct cct gga cag tcG Atc acc atc tcc tgc ! 2a2 |
| |
|
cag tct gcc ctg act cag cct ccc tcc gTg tcc ggg |
| |
|
tct cct gga cag tca gtc acc atc tcc tgc ! 2d |
| |
|
cag tct gcc ctg act cag cct Gcc tcc gTg tcT ggg |
| |
|
tct cct gga cag tcG Atc acc atc tcc tgc ! 2b2 |
| |
| ! VL3 |
|
TCC TAT GAG CTG ACT CAG CCA CCC TCA GTG TCC GTG |
| |
|
TCC CCA GGA CAG ACA GCC AGC ATC ACC TGC! 3r |
| |
|
tcc tat gag ctg act cag cca cTc tca gtg tcA gtg |
| |
|
Gcc cTG gga cag acG gcc agG atT acc tgT ! 3j |
| |
|
tcc tat gag ctg acA cag cca ccc tcG gtg toA gtg |
| |
|
tcc cca gga caA acG gcc agG atc acc tgc! 3p |
| |
|
tcc tat gag ctg acA cag cca ccc tcG gtg tcA gtg |
| |
|
tcc cTa gga cag aTG gcc agG atc acc tgc ! 3a |
| |
|
tcT tct gag ctg act cag GAC ccT GcT gtg tcT gtg |
| |
|
Gcc TTG gga cag aca gTc agG atc acA tgc ! 3l |
| |
|
tcc tat gTg ctg act cag cca ccc tca gtg tcA gtg |
| |
|
Gcc cca gga Aag acG gcc agG atT acc tgT ! 3h |
| |
|
tcc tat gag ctg acA cag cTa ccc tcG gtg tcA gtg |
| |
|
tcc cca gga cag aca gcc agG atc acc tgc ! 3e |
| |
|
tcc tat gag ctg aTG cag cca ccc tcG gtg tcA gtg |
| |
|
tcc cca gga cag acG gcc agG atc acc tgc ! 3m |
| |
|
tcc tat gag ctg acA cag cca Tcc tca gtg tcA gtg |
| |
|
tcT ccG gga cag aca gcc agG atc acc tgc ! V2-19 |
| |
| ! VL4 |
|
CTG CCT GTG CTG ACT CAG CCC CCG TCT GCA TCT GCC |
| |
|
TTG CTG GGA GCC TCG ATC AAG CTC ACC TGC ! 4c |
| |
|
cAg cct gtg ctg act caA TcA TcC tct gcC tct gcT |
| |
|
tCC ctg gga Tcc tcg Gtc aag ctc acc tgc ! 4a |
| |
|
cAg cTt gtg ctg act caA TcG ccC tct gcC tct gcc |
| |
|
tCC ctg gga gcc tcg Gtc aag ctc acc tgc ! 4b |
| |
| ! VL5 |
|
CAG CCT GTC CTG ACT CAG CCA CCT TCC TCC TCC GCA |
| |
|
TCT CCT GGA GAA TCC GCC AGA CTC ACC TGC ! 5e |
| |
|
cag Gct gtg ctg act cag ccG Gct tcc CTc tcT gca |
| |
|
tct cct gga gCa tcA gcc agT ctc acc tgc ! 5c |
| |
|
cag cct gtg ctg act cag cca Tct tcc CAT tcT gca |
| |
|
tct Tct gga gCa tcA gTc aga ctc acc tgc ! 5b |
| |
| ! VL6 |
|
AAT TTT ATG CTG ACT CAG CCC CAC TCT GTG TCG GAG |
| |
|
TCT CCG GGG AAG ACG GTA ACC ATC TCC TGC ! 6a |
| |
| ! VL7 |
|
GAC ACT GTG GTG ACT CAG GAG CCC TCA CTG ACT GTG |
| |
|
TCC CCA GGA GGG ACA GTC ACT CTC ACC TGT ! 7a |
| |
|
cag Gct gtg gtg act cag gag ccc tca ctg act gtg |
| |
|
tcc cca gga ggg aca gtc act ctc acc tgt ! 7b |
| |
| ! VL8 |
|
CAG ACT GTG GTG ACC CAG GAG CCA TCG TTC TCA GTG |
| |
|
TCC CCT GGA GGG ACA GTC ACA CTC ACT TGT ! 8a |
| |
| ! VL9 |
|
CAG CCT GTG CTG ACT CAG CCA CCT TCT GCA TCA GCC |
| |
|
TCC CTG GGA GCC TCG GTC ACA CTC ACC TGC ! 9a |
| |
| ! VL10 |
|
CAG GCA GGG CTG ACT CAG CCA CCC TCG GTG TCC AAG |
| |
|
GGC TTG AGA CAG ACC GCC ACA CTC ACC TGC ! 10a |
|
| TABLE 11 |
|
|
| RERSs found in human lambda FR1 GLGs |
|
|
| ! There are 31 lambda GLGs |
|
| MlyT NnnnnnGACTC 25 |
| 1: 6 3: 6 4: 6 6: 6 7: 6 8: 6 |
| 9: 6 10: 6 11: 6 12: 6 15: 6 16: 6 |
| 20: 6 21: 6 22: 6 23: 6 23: 50 24: 6 |
| 25: 6 25: 50 26: 6 27: 6 28: 6 30: 6 |
| 31: 6 |
| |
| There are 23 hits at base# 6 |
| -″- GAGTCNNNNNn 1 |
| 26: 34 |
| MwoI GCNNNNNnngc 20 |
| 1: 9 2: 9 3: 9 4: 9 11: 9 11: 56 |
| 12: 9 13: 9 14: 9 16: 9 17: 9 18: 9 |
| 19: 9 20: 9 23: 9 24: 9 25: 9 26: 9 |
| 30: 9 31: 9 |
| |
| There are 19 hits at base# 9 |
| HinfI Gantc 27 |
| 1: 12 3: 12 4: 12 6: 12 7: 12 8: 12 |
| 9: 12 10: 12 11: 12 12: 12 15: 12 16: 12 |
| 20: 12 21: 12 22: 12 23: 12 23: 46 23: 56 |
| 24: 12 25: 12 25: 56 26: 12 26: 34 27: 12 |
| 28: 12 30: 12 31: 12 |
| |
| There are 23 hits at base# 12 |
| PleI gactc 25 |
| 1: 12 3: 12 4: 12 6: 12 7: 12 8: 12 |
| 9: 12 10: 12 11: 12 12: 12 15: 12 16: 12 |
| 20: 12 21: 12 22: 12 23: 12 23: 56 24: 12 |
| 25: 12 25: 56 26: 12 27: 12 28: 12 30: 12 |
| 31: 12 |
| |
| There are 23 hits at base# 12 |
| -″- gagtc 1 |
| 26: 34 |
| DdeI Ctnag 32 |
| 1: 14 2: 24 3: 14 3: 24 4: 14 4: 24 |
| 5: 24 6: 14 7: 14 7: 24 8: 14 9: 14 |
| 10: 14 11: 14 11: 24 12: 14 12: 24 15: 5 |
| 15: 14 16: 14 16: 24 19: 24 20: 14 23: 14 |
| 24: 14 25: 14 26: 14 27: 14 28: 14 29: 30 |
| 30: 14 31: 14 |
| |
| There are 21 hits at base# 14 |
| BsaJI Ccnngg 38 |
| 1: 23 1: 40 2: 39 2: 40 3: 39 3: 40 |
| 4: 39 4: 40 5: 39 11: 39 12: 38 12: 39 |
| 13: 23 13: 39 14: 23 14: 39 15: 38 16: 39 |
| 17: 23 17: 39 18: 23 18: 39 21: 38 21: 39 |
| 21: 47 22: 38 22: 39 22: 47 26: 40 27: 39 |
| 28: 39 29: 14 29: 39 30: 38 30: 39 30: 47 |
| 31: 23 31: 32 |
| |
| There are 17 hits at base# 39 |
| There are 5 hits at base# 38 |
| There are 5 hits at base# 40 Makes cleavage ragged. |
| MnlI cctc 35 |
| 1: 23 2: 23 3: 23 4: 23 5: 23 6: 19 |
| 6: 23 7: 19 8: 23 9: 19 9: 23 10: 23 |
| 11: 23 13: 23 14: 23 16: 23 17: 23 18: 23 |
| 19: 23 20: 47 21: 23 21: 29 21: 47 22: 23 |
| 22: 29 22: 35 22: 47 23: 26 23: 29 24: 27 |
| 27: 23 28: 23 30: 35 30: 47 31: 23 |
| |
| There are 21 hits at base# 23 |
| There are 3 hits at base# 19 |
| There are 3 hits at base# 29 |
| There are 1 hits at base# 26 |
| There are 1 hits at base# 27 |
| These could make cleavage ragged. |
| -″- gagg 7 |
| 1: 48 2: 48 3: 48 4: 48 27: 44 28: 44 |
| 29: 44 |
| |
| BssKI Nccnqg 39 |
| 1: 40 2: 39 3: 39 3: 40 4: 39 4: 40 |
| 5: 39 6: 31 6: 39 7: 31 7: 39 8: 39 |
| 9: 31 9: 39 10: 39 11: 39 12: 38 12: 52 |
| 13: 39 13: 52 14: 52 16: 39 16: 52 17: 39 |
| 17: 52 18: 39 18: 52 19: 39 19: 52 21: 38 |
| 22: 38 23: 39 24: 39 26: 39 27: 39 28: 39 |
| 29: 14 29: 39 30: 38 |
| |
| There are 21 hits at base# 39 |
| There are 4 hits at base# 38 |
| There are 3 hits at base# 31 |
| There are 3 hits at base# 40 Ragged |
| BstNI CCwqg 30 |
| 1: 41 2:40 5: 40 6: 40 7: 40 8: 40 |
| 9: 40 10: 40 11: 40 12: 39 12: 53 13: 40 |
| 13: 53 14: 53 16: 40 16: 53 17: 40 17: 53 |
| 18: 40 18: 53 19: 53 21: 39 22: 39 23: 40 |
| 24: 40 27: 40 28: 40 29: 15 29: 40 30: 39 |
| |
| There are 17 hits at base# 40 |
| There are 7 hits at base# 53 |
| There are 4 hits at base# 39 |
| There are 1 hits at base# 41 Ragged |
| PspGI ccwgg 30 |
| 1: 41 2: 40 5: 40 6: 40 7: 40 8: 40 |
| 9: 40 10: 40 11: 40 12: 39 12: 53 13: 40 |
| 13: 53 14: 53 16: 40 16: 53 17: 40 17: 53 |
| 18: 40 18: 53 19: 53 21: 39 22: 39 23: 40 |
| 24: 40 27: 40 28: 40 29: 15 29: 40 30: 39 |
| |
| There are 17 hits at base# 40 |
| There are 7 hits at base# 53 |
| There are 4 hits at base# 39 |
| There are 1 hits at base# 41 |
| ScrFI CCngg 39 |
| 1: 41 2: 40 3: 40 3: 41 4: 40 4: 41 |
| 5: 40 6: 32 6: 40 7: 32 7: 40 8: 40 |
| 9: 32 9: 40 10: 40 11: 40 12: 39 12: 53 |
| 13: 40 13: 53 14: 53 16: 40 16: 53 17: 40 |
| 17: 53 18: 40 18: 53 19: 40 19: 53 21: 39 |
| 22: 39 23: 40 24: 40 26: 40 27: 40 28: 40 |
| 29: 15 29: 40 30: 39 |
| |
| There are 21 hits at base# 40 |
| There are 4 hits at base# 39 |
| There are 3 hits at base# 41 |
| MaeIII gtnac 16 |
| 1: 52 2: 52 3: 52 4: 52 5: 52 6: 52 |
| 7: 52 9: 52 26: 52 27: 10 27: 52 28: 10 |
| 28: 52 29: 10 29: 52 30: 52 |
| |
| There are 13 hits at base# 52 |
| Tsp45I gtsac 15 |
| 1: 52 2: 52 3: 52 4: 52 5: 52 6: 52 |
| 7: 52 9: 52 27: 10 27: 52 28: 10 28: 52 |
| 29: 10 29: 52 30: 52 |
| |
| There are 12 hits at base# 52 |
| HphI tcacc 26 |
| 1: 53 2: 53 3: 53 4: 53 5: 53 6: 53 |
| 7: 53 8: 53 9: 53 10: 53 11: 59 13: 59 |
| 14: 59 17: 59 18: 59 19: 59 20: 59 21: 59 |
| 22: 59 23: 59 24: 59 25: 59 27: 59 28: 59 |
| 30: 59 31: 59 |
| |
| There are 16 hits at base# 59 |
| There are 10 hits at base# 53 |
| BspMI ACCTGCNNNNn 14 |
| 11: 61 13:61 14: 61 17: 61 18: 61 19: 61 |
| 20: 61 21:61 22: 61 23: 61 24: 61 25: 61 |
| 30: 61 31:61 |
| |
| There are 14 hits at base# 61 Goes into CDR1 |
|
| TABLE 12 |
|
|
| Matches to URE FR3 adapters in 79 human HC. |
|
|
| A. List of Heavy-chains genes sampled |
|
| AF008566 |
AF103367 |
HSA235674 |
HSU94417 |
S83240 |
|
| AF035043 |
AF103368 |
HSA235673 |
HSU94418 |
SABVH369 |
| AF103026 |
AF103369 |
HSA240559 |
H5U96389 |
SADEIGVH |
| af103033 |
AF103370 |
HSCB201 |
HSU96391 |
SAH2IGVH |
| AF103061 |
af103371 |
HSIGGVHC |
HSU96392 |
SDA3IGVH |
| Af103072 |
AF103372 |
HSU44791 |
HSU96395 |
SIGVHTTD |
| af103078 |
AF158381 |
HSU44793 |
HSZ93849 |
SUK4TGVH |
| AF103099 |
E05213 |
HSU82771 |
HSZ93850 |
| AF103102 |
E05886 |
HSU82949 |
HSZ93851 |
| AF103103 |
E05887 |
HSU82950 |
HSZ93853 |
| AF103174 |
HSA235661 |
HSU82952 |
HSZ93855 |
| AF103186 |
HSA235664 |
HSU82961 |
HSZ93857 |
| af103187 |
HSA235660 |
HSU86522 |
HSZ93860 |
| AF103195 |
HSA235659 |
HSU86523 |
HSZ93863 |
| af103277 |
HSA235678 |
HSU92452 |
MCOMFRAA |
| af103286 |
HSA235677 |
HSU94412 |
MCOMFRVA |
| AF103309 |
HSA235676 |
HSU94415 |
S82745 |
| af103343 |
HSA235675 |
HSU94416 |
S82764 |
|
| TABLE 12B |
|
|
| Testing all distinct GLGs from bases 89.1 to 93.2 |
|
| of the heavy variable domain |
| Id |
|
|
|
|
|
|
|
|
SEQ |
| NO: |
Nb |
0 |
1 |
2 |
3 |
4 |
|
|
ID |
|
| 1 |
38 |
15 |
11 |
10 |
0 |
2 |
Seq1 |
gtgtattactgtgc |
25 |
|
| 2 |
19 |
7 |
6 |
4 |
2 |
0 |
Seq2 |
gtAtattactgtgc |
26 |
| 3 |
1 |
0 |
0 |
1 |
0 |
0 |
Seq3 |
gtgtattactgtAA |
27 |
| 4 |
7 |
1 |
5 |
1 |
0 |
0 |
Seq4 |
gtgtattactgtAc |
28 |
| 5 |
0 |
0 |
0 |
0 |
0 |
0 |
Seq5 |
Ttgtattactgtgc |
29 |
| 6 |
0 |
0 |
0 |
0 |
0 |
0 |
Seq6 |
Ttgtatcactgtgc |
30 |
| 7 |
3 |
1 |
0 |
1 |
1 |
0 |
Seq7 |
ACAtattactgtgc |
31 |
| 8 |
2 |
0 |
2 |
0 |
0 |
0 |
Seq8 |
ACgtattactgtgc |
32 |
| 9 |
9 |
2 |
2 |
4 |
1 |
0 |
Seq9 |
ATatattactatac |
33 |
| Group |
|
26 |
26 |
21 |
4 |
2 |
| Cumula- |
|
26 |
52 |
73 |
77 |
79 |
| tivet |
|
| TABLE 12C |
|
|
| Most important URE recognition seqs in FR3 Heavy |
|
|
| 1 |
VRSzy1 |
GTGtattactgtgc |
(ON_SHC103) |
(SEQ ID NO:25) |
|
| |
| 2 |
VHSzy2 |
GTAtattactgtgc |
(ON_SHC323) |
(SEQ ID NO:26) |
| |
| 3 |
VHSzy4 |
GTGtattactgtac |
(ON_SHC349) |
(SEQ ID NO:28) |
| |
| 4 |
VHSzy9 |
ATGtattactgtgc |
(ON_SHC5a) |
(SEQ ID NO:33) |
|
| TABLE 12D |
|
|
| testing 79 human HC V genes with four probes |
|
|
|
Number of sequences. . . |
79 |
|
|
Number of bases. . . |
29143 |
|
|
| Id |
Best |
0 |
1 |
2 |
3 |
4 |
5 |
|
|
|
|
|
| 1 |
39 |
15 |
11 |
10 |
1 |
2 |
0 |
Seq1 |
gtgtattactgtgc |
(SEQ ID NO:25) |
| |
| 2 |
22 |
7 |
6 |
5 |
3 |
0 |
1 |
Seq2 |
gtAtattactgtgc |
(SEQ ID NO:26) |
| |
| 3 |
7 |
1 |
5 |
1 |
0 |
0 |
0 |
Seq4 |
gtgtattactgtAc |
(SEQ ID NO:28) |
| |
| 4 |
11 |
2 |
4 |
4 |
1 |
0 |
0 |
Seq9 |
ATgtattactgtgc |
(SEQ ID NO:33) |
| Group |
25 |
26 |
20 |
5 |
2 |
|
|
| Cumu- |
25 |
51 |
71 |
76 |
78 |
| lative |
|
One sequence has five mismatches with sequences 2, 4, and 9; it is scored as best for 2.
|
Id is the number of the adapter.
|
| Best is the number of sequence for which the identified adapter was the best available. |
| The rest of the table shows how well the sequences match the adapters. For example, there are 10 sequences that match VHSzy1 (Id=1) with 2 mismatches and are worse for all other adapters. In this sample, 90% come within 2 bases of one of the four adapters. |
| TABLE 13 |
|
|
| The following list of enzymes was taken from |
|
| htttp//rebase.neb.com/cgi-bin/asymmlist. |
|
|
| I have removed the enzymes that a) cut within the recognition, b) cut on |
|
| both sides of the recognition, or c) have fewer than 2 bases between |
| recognition and closest cut site. |
| |
| REBASE Enzymes |
| Apr. 13, 2001 |
|
| Type II restriction enzymes with asymmetric recognition sequences: |
| Enzymes |
Recognition Sequence |
Isoschizomers |
Suppliers |
|
| AarI |
CACCTGCNNNN{circumflex over ( )}NNNN— |
— |
y |
| AceIII |
CAGCTCNNNNNNN{circumflex over ( )}NNNN— |
— |
— |
| Bbr7I |
GAAGACNNNNNNN{circumflex over ( )}NNNN— |
— |
— |
| BbvI |
GCAGCNNNNNNNN{circumflex over ( )}NNNN— |
— |
y |
| BbvII |
GAAGACNN{circumflex over ( )}NNNN— |
| Bce83I |
CTTGAGNNNNNNNNNNNNNN_NN{circumflex over ( )} |
— |
— |
| BceAI |
ACGGCNNNNNNNNNNNN{circumflex over ( )}NN— |
— |
y |
| BcefI |
ACGGCNNNNNNNNNNNN{circumflex over ( )}N— |
— |
— |
| BciVI |
GTATCCNNNNN_N{circumflex over ( )} |
BfuI |
y |
| BfiI |
ACTGGGNNNN_N{circumflex over ( )} |
BmrI |
y |
| BinI |
GGATCNNNN{circumflex over ( )}N— |
| BscAI |
GCATCNNNN{circumflex over ( )}NN— |
— |
— |
| BseRI |
GAGGAGNNNNNNNN_NN{circumflex over ( )} |
— |
y |
| BsmFI |
GGGACNNNNNNNNNN{circumflex over ( )}NNNN— |
BspLU11III |
y |
| BspMI |
ACCTGCNNNN{circumflex over ( )}NNNN— |
Acc36I |
y |
| EciI |
GGCGGANNNNNNNNN_NN{circumflex over ( )} |
— |
y |
| Eco57I |
CTGAAGNNNNNNNNNNNNNN_NN{circumflex over ( )} |
BspKT5I |
y |
| FauI |
CCCGCNNNN{circumflex over ( )}NN— |
BstFZ438I |
y |
| FokI |
GGATGNNNNNNNNN{circumflex over ( )}NNNN— |
BstPZ418I |
y |
| GsuI |
CTGGAGNNNNNNNNNNNNNN_NN{circumflex over ( )} |
— |
y |
| HgaI |
GACGCNNNNN{circumflex over ( )}NNNNN— |
— |
y |
| HphI |
GGTGANNNNNNN_N{circumflex over ( )} |
AsuHPI |
y |
| MboII |
GAAGANNNNNNN_N{circumflex over ( )} |
— |
y |
| MlyI |
GAGTCNNNNN{circumflex over ( )} |
SchI |
y |
| MmeI |
TCCRACNNNNNNNNNNNNNNNNNN—NN{circumflex over ( )} |
— |
— |
| MnlI |
CCTCNNNNNN_N{circumflex over ( )} |
— |
y |
| Plel |
GAGTCNNNN{circumflex over ( )}N— |
PpsI |
y |
| RleAI |
CCCACANNNNNNNNN_NNN{circumflex over ( )} |
— |
| SfaNI |
GCATCNNNNN{circumflex over ( )}NNNN— |
BspST5I |
y |
| SspD5I |
GGTGANNNNNNNN{circumflex over ( )} |
— |
— |
| Sth132I |
CCCGNNNN{circumflex over ( )}NNNN— |
— |
— |
| StsI |
GGATGNNNNNNNNNN{circumflex over ( )}NNNN— |
— |
— |
| TaqII |
GACCGANNNNNNNNN_NN{circumflex over ( )}, CACCCANNNNNNNNN_NN{circumflex over ( )} |
— |
— |
| Tth111II |
CAARCANNNNNNNNN_NN{circumflex over ( )} |
— |
— |
| UbaPI |
CGAACG |
— |
— |
|
The notation is {circumflex over ( )} means cut the upper strand and _ means cut the lower strand. If the upper and lower strand are cut at the same place, then only {circumflex over ( )} appears.
|
| TABLE 14 |
|
|
| (FOKIact) 5′-cAcATccgTg TT cAcggATgTg-3′ |
|
| (VHEx881) 5′-AATAgTAgAc TgcAgTgTcc TcAgcccTTA AgcTgTTcAT cTgcAAgTAg- |
| AgAgTATTcT TAgAgTTgTc TcTAgAcTTA gTgAAgcg-3′ |
| ! note that VHEx881 is the reverse complement of the ON below |
| ! [RC] 5′-cgCttcacTaag- |
| ! Scab........ |
| ! Synthetic 3-23 as in Table 206 |
| ! |TCT|AGA|gac|aac|aac|tct|aag|aat|act|ctc|tac|ttg|cag|atg|- |
| ! XbaI. . . |
| ! aac|agC|TTA|AGg|gct|gag|gac|aCT|GCC|Gtc|tac|tat|t-3′ |
| ! AflII . . . |
| (VHBA881) 5′-cgCttcacTaag- |
| TCT|AGA|gac|aac|tct|aag|aat|act|ctc|tac|ttg|cag|atg|- |
| aac|agC|TTA|AGg|gct|gag|gac|aCT|GCA|Gtc|tac|tat|tgt gcg ag-3′ |
| (VHBB881) 5′-cgCttcacTaag- |
| TCT|AGA|gac|aac|tct|aag|aat|act|ctc|tac|ttg|cag|atg|- |
| aac|agC|TTA|AGg|gct|gag|gac|aCT|GCA|Gtc|tac|tat|tgt Acg ag-3′ |
| (VH881PCR) 5′-cgCttcacTaag|TCT|AGA|gac|aac -3′ |
|
| TABLE 15 |
|
|
| Use of FokI as “Universal Restriction Enzyme” |
|
|
| FokI — for dsDNA, | represents sites of cleavage |
| |
| sites of cleavage |
| 5′-cacGGATGtg--nnnnnnn|nnnnnnn-3′ (SEQ ID NO:15) |
| 3′-gtgCCTACac--nnnnnnnnnnn|nnn-5′ (SEQ ID NO:16) |
| RECOG |
| NITion of FokI |
| |
| Case I |
| |
| 5′-...gtg|tatt-actgtgc..Substrate....-3′ (SEQ ID NO:17) |
| 3′-cac-ata|tgacacg—| |
| gtGTAGGcac\ |
| 5′-caCATCCgtg/ (SEQ ID NO:18) |
| |
| Case II |
| |
| 5′-...gtgtatt|agac-tgc..Substrate....-3′ (SEQ ID NO:19) |
| |—cacataa-tctg|acg-5′ |
| /gtgCCTACac |
| \cacGGATGtg-3′ (SEQ ID NO:20) |
| |
| Case III (Case I rotated 180 degrees) |
| |
| /gtgCCTACac-5′ |
| \cacGGATGtg—| |
| gtgtctt|acag-tcc-3′ Adapter (SEQ ID NO:21) |
| 3′-...cacagaa-tgtc|agg..substrate....-5′ (SEQ ID NO:22) |
| |
| Case IV (Case II rotated 180 degrees) |
| |
| 3′- gtGTAGGcac\ (SEQ ID NO:23) |
| |—caCATCCgtg/ |
| 5′-gag|tctc-actgagc |
| Substrate 3′-...ctc-agag|tgactcg...-5′ (SEQ ID NO:24) |
| |
| Improved FokI adapters |
| |
| Fok— for dsDNA, | represents sites of cleavage |
| |
| Case I |
| Stem 11, loop 5, stem 11, recognition 17 |
| |
| 5′-...catgtg|tatt-actgtgc..Substrate....-3′ |
| 3′-gtacac-ataa|tgacacg—| |-T—| |
| gtGTAGGcacG T |
| 5′- caCATCCgtgc C |
| |-TT-| |
| |
| Case II |
| Stem 10, loop 5, stem 10, recognition 18 |
| |
| 5′-...gtgtatt|agac-tgctgcc..Substrate....-3′ |
| |-T-| |—cacataa-tctg|acgacgg-5′ |
| T gtgCCTACac |
| C cacGGATGtg-3′ |
| |-TT-| |
| |
| Case III (Case I rotated 180 degrees) |
| Stem 11, loop 5, stem 11, recognition 20 |
| |
| |-T-| |
| T TgtgCCTACac-5′ |
| G AcacGGATGtg—| |
| |-TT-| gtgtctt|acag-tccattctg-3′ Adapter |
| 3′-...cacagaa-tgtc|aggtaagac..substrate....-5′ |
| |
| Case IV (Case II rotated 180 degrees) |
| Stem 11, loop 4, stem 11, recognition 17 |
| |-T-| |
| 3′- gtGTAGGcacc T |
| |—caCATCCgtgg T |
| 5′-atcgag|tctc-actgagc |-T-| |
| Substrate 3′-...tagctc-agag|tgactcg...-5′ |
| |
| BseRI |
| | sites of cleavage |
| 5′-cacGAGGAGnnnnnnnnnn|nnnnn-3′ |
| 3′-gtgctcctcnnnnnnnn|nnnnnnn-5′ |
| RECOG |
| NITion of BseRI |
| |
| Stem 11, loop 5, stem 11, recognition 19 |
| |
| 3′-.......gaacat|cg-ttaagccagta.....5′ |
| |-T-T-| cttgta-gc|aattcggtcat-3′ |
| C GCTGAGGAGTC--| |
| T cgactcctcag-5′ An adapter for BseRI to cleave the substrate above. |
| |-T—| |
|
| TABLE 16 |
|
|
| Human heavy chans bases 88.1 to 94.2 |
|
|
| Number of sequences.......... 840 |
|
|
Number of Mismatchers......... |
|
Probe |
|
| Id |
Ntot |
0 |
1 |
2 |
3 |
4 |
5 |
6 |
7 |
Name |
Sequence............ |
Dot form............ |
|
| 1 |
364 |
152 |
97 |
76 |
26 |
7 |
4 |
2 |
0 |
VHS881-1.1 |
gctgtgtattactgtgcgag |
gctgtgtattactgtgcgag |
| |
| 2 |
265 |
150 |
60 |
33 |
13 |
5 |
4 |
0 |
0 |
VHS881-1.2 |
gccgtgtattactgtgcgag |
..c................. |
| |
| 3 |
96 |
14 |
34 |
16 |
10 |
5 |
7 |
9 |
1 |
VHS881-2.1 |
gccgtatattactgtgcgag |
..c..a.............. |
| |
| 4 |
20 |
0 |
3 |
4 |
9 |
2 |
2 |
0 |
0 |
VHS881-4.1 |
gccgtgtattactgtacgag |
..c............a.... |
| |
| 5 |
95 |
25 |
36 |
18 |
11 |
2 |
2 |
0 |
1 |
VH5881-9.1 |
gccatgtattactgtgcgag |
..ca................ |
|
840 |
341 |
230 |
147 |
69 |
21 |
19 |
11 |
2 |
|
|
|
|
|
341 |
571 |
718 |
787 |
808 |
827 |
838 |
840 |
|
|
|
|
|
|
88 89 90 91 92 93 94 95 Codon number as in Table 195 |
|
|
|
Recognition........... |
Stem...... |
Loop. |
Stem...... |
|
|
|
(VHS881-1.1) |
5′-gctgtgtat|tact-gtgcgag |
cAcATccgTg |
TTgTT |
cAcggATgTg-3′ |
|
|
|
(VHS881-1.2) |
5′-gccgtgtat|tact-gtgcgag |
cAcATccgTg |
TTgTT |
cAcggATgTg-3′ |
|
|
|
(VHS881-2.1) |
5′-gccgtatat|tact-gtgcgag |
cAcATccgTg |
TTgTT |
cAcggATgTg-3′ |
|
|
|
(VHS881-9.1) |
5′-gccatgtat|tact-gtgcgag |
cAcATccgTg |
TTgTT |
cAcggATgTg-3′ |
|
| site of substrate cleavage |
|
|
|
|
(FOKIact) 5′cAcATccgTg TTgTT cAcggATgTg-3′ |
|
|
|
|
(VHEx881) 5′-AATAgTAgAc TgcAgTgTcc TcAgcccTTA AgcTgTTcAT cTgcAAgTAg- |
|
AgAgTATTcT TAgAgTTgTc TcTAgAcTTA gTgAAgcg-3′ |
|
! note that VHEx881 is the reverse complement of the ON below |
|
! [RC] 5′cgCttcacTaag- |
|
! Scab........ |
|
! Synthetic 3-23 as in Table 206 |
|
! |TCT|AGA|gac|aac|tct|aag|aat|act|ctc|tac|ttg|cag|atg|- |
|
! XbaI... |
|
! |aac|agC|TTA|AGg|gct|gag|aCT|GCA|Gtc|tac|tat|t-3′ |
|
! AflII... |
|
(VHBA881) 5′-cgCttcacTaag- |
|
|TCT|AGA|gac|aac|tct|aag|aat|act|ctc|tac|ttg|cag|atg|- |
|
|aac|agC|TTA|AGg|gct|gag|gac|aCT|GCA|Gtc|tac|tat|tgt gcg ag-3′ |
|
(VHBB881) 5′-cgCttcacTaag- |
|
|TCT|AGA|gac|aac|tct|aag|aat|act|ctc|tac|ttg|cag|atg|- |
|
|aac|agC|TTA|AGg|gct|gag|gac|aCT|GCA|Gtc|tac|tat|tgt Acg ag-3′ |
|
(VH881PCR) 5′-cgCttcacTaag|TCT|AGA|gac|aac-3′ |
|
|
| TABLE 17 |
|
|
| Kappa, bases 12-30 |
|
|
| ! |
|
|
|
|
|
|
|
|
|
|
|
|
|
| ! |
ID |
Ntot |
0 |
1 |
2 |
3 |
4 |
5 |
6 |
Name |
Sequence........... |
Dot Form.......... |
|
| ! |
1 |
84 |
40 |
21 |
20 |
1 |
2 |
0 |
0 |
SK12O12 |
gaccagtctccatcctcc |
gacccagtctccatcctcc |
| |
| ! |
2 |
32 |
19 |
3 |
6 |
2 |
1 |
0 |
1 |
SK12A17 |
gactcagtctccactctcc |
...t.........ct.... |
| |
| ! |
3 |
26 |
17 |
8 |
1 |
0 |
0 |
0 |
0 |
SK12A27 |
gacgcagtctccaggcacc |
...g.........gg.aa.. |
| |
| ! |
4 |
40 |
21 |
18 |
1 |
0 |
0 |
0 |
0 |
SK12A11 |
gacgcagtctccagccacc |
...g.........g..a.. |
| ! |
|
182 |
97 |
50 |
28 |
3 |
3 |
0 |
1 |
|
|
|
| ! |
|
|
97 |
147 |
175 |
178 |
181 |
181 |
182 |
|
|
|
|
| ! |
|
| URE adapters: |
| ! Stem...... Loop. Stem...... Recognition........ |
| (SzKB1230-O12) 5′-cAcATccgTg TTgTT cAcggATgTg ggAggATggAgAcTgggTc-3′ |
| ! [RC] 5′-gaccagtctccatcctcc cAcATccgTG AAcAA cAcggATgTg-3′ |
| ! Recognition........ Stem...... loop. Stem...... |
| ! FokI. Foki. |
| ! |
| ! Stem...... Loop. Stem...... Recognition........ |
| (SzKB1230-A17) 5′cAcATccgTg TTgTT cAcggATgTg ggAgAgTggAgAcTgAgTc-3′ |
| ! [RC] 5′-gactcagtctccactctcc cAcATccTg AAcAA cAcggATgTg-3′ |
| ! Recognition......... Stem...... loop. Stem...... |
| ! FokI. FokI. |
| |
| ! |
| ! Stem...... Loop. Stem...... Recognition........ |
| (SzKB1230-A27) 5′-cAcATccgTg TTgTT cAcggATgTg ggTgccTggAgAcTgcgTc-3′ |
| ! [RC] 5′-gacgcagtctccaggcacc cAcATccgTg AAcAA cAcggATgTg-3′ |
| ! Recognition........ Stem...... loop. Stem...... |
| ! FokI. FokI. |
| ! |
| ! Stem...... Loop. Stem...... Recognition........ |
| (SzKB1230-A11) 5′-cAcAtccgTg TTgTT cAcggATgTg ggTggcTggAgAcTgcgTc-3′ |
| ! [RC] 5′-gacgcagtctccagccacc cAcATccgTg AAcAA cAcggATgTg-3′ |
| ! Recognition........ Stem...... loop. Stem...... |
| ! FokI. FokI. |
| |
| What happens in the upper strand: |
| |
| (SzKB1230-O12*) 5′-gac cca gtc|tcc a-tc ctc c-3′ |
| ! | Site of cleavage in substrate |
| ! |
| (SzKB1230-A17*) 5′-gac tca gtc|tcc a-ct ctc c-3′ |
| ! |
| (SzKB1230-A27*) 5′-gac gca gtc|tcc a-gg cac c-3′ |
| ! |
| (SzKB1230-A11*) 5′-gac gca gtc|tcc a-gc cac c-3′ |
| |
| (kapextURE) 5′-ccTctactctTgTcAcAgTgcAcAA gAc ATc cAg-3′ !sense strand |
| Scab.............ApaLI. |
| |
| (kapextUREPCR) 5′-ccTctactctTgTcAcAgTg-3′ |
| Scab... ......... |
| |
| (kaBRO1UR) 5′-ggAggATggA cTggATgTcT TgTgcAcTgT gAcAAgAgTA gAgg-3′ |
| ! [RC] 5′-ccTctactctTgTcAcAgTgcAcAA gAc ATc cAg tcc a-tc ctc c-3′ ON above is R.C. of this one |
| (kaBRO2UR) 5′-ggAgAgTggA cTggATgTcT TgTgcAcTgT gAcAAgAgTA gAgg-3′ |
| ! [RC] 5′-ccTctactctTgTcAcAgTgcAcAA gAc ATc cAg tcc a-ct ctc c-3′ ON above is R.C. of this one |
| (kaBRO3UR) 5′-ggTgccTggA cTggATgTcT TgTgcAcTgT gAcAAgAgTA gAgg-3′ |
| ! [RC] 5′-ccTctactctTgTcAcAgTgcAcAA gAc ATc cAg tcc a-gg cac c-3′ ON above is R.C. of this one |
| (kaBRO4UR) 5′-ggTggcTggA cTggATgTcT TgTgcAcTgT gAcAAgAgTA gAgg-3′ |
| ! [RC] 5′-ccTctactctTgTcAcAgTgcAcAA gAc ATc cAg tcc a-gc cac c-3′ |
| Scab.............ApaLI. |
|
| TABLE 18 |
|
|
| Lambda URE adapters bases 13.3 to 19.3 |
|
|
| ! |
|
| ! Number of sequences.......... 128 |
| ! |
| ! |
|
|
Number of mismatches.............. |
|
|
| ! |
Id |
Ntot |
0 |
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
Name |
Sequence........... |
Dot form........... |
|
| ! |
1 |
58 |
45 |
7 |
1 |
0 |
0 |
0 |
2 |
2 |
1 |
VL133-2a2 |
gtctcctggacagtcgatc |
gtctcctggacagtcgatc |
| |
| ! |
2 |
16 |
10 |
1 |
0 |
1 |
0 |
1 |
1 |
0 |
2 |
VL122-3I |
ggccttgggacagacagtc |
gcttg......a.ag.. |
| |
| ! |
3 |
17 |
6 |
0 |
0 |
0 |
4 |
1 |
1 |
5 |
0 |
VL133-2c |
gtctcctggacagtcagtc |
............ag.. |
| |
| ! |
4 |
37 |
3 |
0 |
10 |
4 |
4 |
3 |
7 |
4 |
2 |
VL133-1c |
ggccccagggcagagggtc |
g.c..a..g...a..g.. |
| ! |
|
128 |
64 |
8 |
11 |
5 |
8 |
5 |
11 |
11 |
5 |
|
|
|
| ! |
|
|
64 |
72 |
83 |
88 |
96 |
101 |
112 |
123 |
128 |
|
|
|
|
| ! Stem...... loop. Stem...... Recognition........ |
| VL133-2a2) 5′cAcATccgTg TTgTT cAcggATgTggATcgAcTgTccAggAgAc-3′ |
| ! [RC] 5′-gtctcctggacagtcgatc cAcATccTg AAcAA cAcggATgTg-3′ |
| ! Recognition........ Stem...... Loop. Stern...... |
| ! Stern...... loop. Stem...... Recognition........ |
| (VL133-31) 5′-cAcATccgTg TTgTT cAcggATgTggAcTgTcTgTcccAAggcc-3′ |
| ! [RC] 5′-ggccttgggacagacagtc cAcATccgTg AAcAA cAcggATgTg-3′ |
| ! Recognition........ Stern...... Loop. Stern...... |
| ! Stern...... loop. Stern...... Recognition........ |
| (VL133-2c) 5′cAcATccgTgTTgTT cAcggATgTg gAcTgAcTgTccAggAgAc-3′ |
| ! [RC] 5′-gtctcctggacagtcagtc cAATccgTg AAcAA cAcggATgTg-3′ |
| ! Recognition........ Stern...... Loop. Stern...... |
| ! Stern...... loop. Stern...... Recognition........ |
| (VL133-1c) 5′-cAcATccgTg TTgTT cAcggATgTg gAcccTcTgcccTggggcc-3′ |
| ! [RC] 5′-ggccccagggcagagggtc cAcATccgTg AAcAA cacggATgTg-3′ |
| What happens in the top strand: |
| ! | site cleavage in the upper strand |
| (VL133-2a2*) 5′-g tct cct g|ga cag tcg atc |
| ! |
| (VL133-31*) 5′-g gcc ttg g|ga cag aca gtc |
| ! |
| (VL133-2c*) 5′-g tct cct g|ga cag tca gtc |
| ! |
| (VL133-1c*) 5′-g gcc cca g|gg cag agg gtc |
| ! |
| ! The following Extenders and Bridges all encode the AA sequence of 2a2 for codons 1-15 |
| ! 1 |
| (ON_LamEx133) 5′-ccTcTgAcTgAgT gcA cAg - |
| ! 2 3 4 5 6 7 8 9 10 11 12 |
| AGt gcT TtA acC caA ccG gcT AGT gtT AGC ggT- |
| ! |
| ! 13 14 15 |
| tcC ccG g! 2a2 |
| ! 1 |
| (ON_LamB1-133) [RC] 5′-ccTcTgAcTgAgT gcA cAg - |
| ! |
| ! 2 3 4 5 6 7 8 9 10 11 12 |
| AGt gcT TtA acC caA ccG gcT AGT gtT AGC ggT- |
| ! |
| ! 13 14 15 |
| tcC ccG g ga cag tcg at-3′ !2a2 N.B. the sctuA seq is the |
| ! reverse complement of the |
| ! one shown. |
| ! |
| (ON_LamB2-133) [RC] 5′-ccTcTgAcTgAgT gcA cAg - |
| ! |
| ! 2 3 4 5 6 7 8 9 10 11 12 |
| AGt gcT TtA acC caA ccG gcT AGT gtT AGC ggT- |
| ! |
| ! 13 14 15 |
| tcC ccG g ga cag aca gt-3′ |3l N.B. the actual seq is the |
| ! reverse complement of the |
| ! one shown. |
| ! |
| ! |
| (ON_LamB3-133) [RC] 5′-ccTcTgAcTgAgT gcA cAg - |
| ! |
| ! 2 3 4 5 6 7 8 9 10 11 12 |
| AGt gcT TtA acC caA ccG gcT AGT gtT AGC ggT- |
| ! |
| 13 14 15 |
| tcC ccG g ga cag tcagt -3′! 2c N.B. the actual seq is the |
| ! reverse complement of the |
| ! one shown. |
| !(ON_LamE4-133) [RC] 5′-ccTcTgAcTgAgT gcA cAg - |
| ! |
| ! 2 3 4 5 6 7 8 9 10 11 12 |
| AGt gcT TtA acC caA ccG gcT AGT gtT AGC gqT-s |
| ! |
| ! 13 14 15 |
| tcC ccG g gg cag agg gt-3′ ! 1c N.B. the actual seq is the |
| ! reverse complement off the |
| ! one shown. |
| (ON_Lam133PCR) 5′-ccTcTgAcTgAgT gcA cAg AGt gc-3′ |
|
| TABLE 19 |
|
|
| Cleavage of 75 human light chains. |
|
|
|
|
|
Planned location of |
|
| Enzyme |
Recognition |
Nch |
Ns |
site |
|
| AfeI |
AGCgct |
0 |
0 |
|
|
| |
| AflII |
Cttaag |
0 |
0 |
HC FR3 |
| |
| Agel |
Accggt |
0 |
0 |
| |
| AscI |
GGcgcgcc |
0 |
0 |
After LC |
| |
| BglII |
Agatct |
0 |
0 |
| |
| BsiWI |
Cgtacg |
0 |
0 |
| |
| BspDI |
ATcgat |
0 |
0 |
| |
| BssHII |
Gcgcgc |
0 |
0 |
| |
| BstBI |
TTcgaa |
0 |
0 |
| |
| DraIII |
CACNNNgtg |
0 |
0 |
| |
| EagI |
Cggccg |
0 |
0 |
| |
| FseI |
GGCCGGcc |
0 |
0 |
| |
| FspI |
TGCgca |
0 |
0 |
| |
| HpaI |
GTTaac |
0 |
0 |
| |
| HfeI |
Caattg |
0 |
0 |
MC FRi |
| |
| MluI |
Acgcgt |
0 |
0 |
| |
| NcoI |
Ccatgg |
0 |
0 |
Heavy chain signal |
| |
| NheI |
Gctagc |
0 |
0 |
HC/anchor linker |
| |
| NotI |
GCggccgc |
0 |
0 |
In linker after MC |
| |
| NruI |
TCGcga |
0 |
0 |
| |
| Pad |
TTAATtaa |
0 |
0 |
| |
| PmeI |
GTTTaaac |
0 |
0 |
| |
| PmlI |
CACgtg |
0 |
0 |
| |
| PvuI |
CGATcg |
0 |
0 |
| |
| SacII |
CCGCgg |
0 |
0 |
| |
| SaiI |
Gtcgac |
0 |
0 |
| |
| SfiI |
GGCC1-NNNnggcc |
0 |
0 |
Heavy Chain signal |
| |
| SgfI |
GCGATcgc |
0 |
0 |
| |
| SnaBI |
TACgta |
0 |
0 |
| |
| StuI |
AGGcct |
0 |
0 |
| |
| XbaI |
Tctaga |
0 |
0 |
MC FR3 |
| |
| AatII |
GACGTc |
1 |
1 |
| |
| AciI |
AAcgtt |
1 |
1 |
| |
| AseI |
ATtaat |
1 |
1 |
| |
| BsmI |
GAATGCN |
1 |
1 |
| |
| EspEI |
Tccgga |
1 |
1 |
MC FR1 |
| |
| BstXI |
CCANNNNNntgg |
1 |
1 |
MC FR2 |
| |
| DrdI |
GACNNNNnngtc |
1 |
1 |
| |
| HindIII |
Aagctt |
1 |
1 |
| |
| PciI |
Acatgt |
1 |
1 |
| |
| SapI |
gaagagc |
1 |
1 |
| |
| Scal |
AGTact |
1 |
1 |
| |
| SexAl |
Accwggt |
1 |
1 |
| |
| Spel |
Actagt |
1 |
1 |
| |
| TiiI |
Ctcgag |
1 |
1 |
| |
| XhoI |
Ctcgag |
1 |
1 |
| |
| BcgI |
cgannnnnntgc |
2 |
2 |
| |
| BlpI |
GCtnagc |
2 |
2 |
| |
| BssSI |
Ctcgtg |
2 |
2 |
| |
| EstAPI |
GCANNNNntgc |
2 |
2 |
| |
| EspI |
GCtnagc |
2 |
2 |
| |
| KasI |
Ggcgcc |
2 |
2 |
| |
| PflMI |
CCANNNNntgg |
2 |
2 |
| |
| XrnnI |
GAANNnnttc |
2 |
2 |
| |
| ApaLI |
Gtgcac |
3 |
3 |
LC signal seq |
| |
| NaeI |
GCCggc |
3 |
3 |
| |
| NgoMI |
Gccggc |
3 |
3 |
| |
| PvuII |
CAGctg |
3 |
3 |
| |
| RsrII |
CGgwccg |
3 |
3 |
| |
| BsrBI |
GAGcgg |
4 |
4 |
| |
| BsrDI |
GCAPLTGNNn |
4 |
4 |
| |
| BstZl7I |
GTAtac |
4 |
4 |
| |
| EcoRI |
Gaattc |
4 |
4 |
| |
| SphI |
GCATGc |
4 |
4 |
| |
| SspI |
AATatt |
4 |
4 |
| |
| AccI |
GTmkac |
5 |
5 |
| |
| BclI |
Tgatca |
5 |
5 |
| |
| BsmBI |
Nnnnnngagacg |
5 |
5 |
| |
| BsrGI |
Tgtaca |
5 |
5 |
| |
| Dral |
TTTaaa |
6 |
6 |
| |
| NdeI |
CAtatg |
6 |
6 |
HC FR4 |
| |
| Swal |
ATTTaaat |
6 |
6 |
| |
| BamHI |
Ggatcc |
7 |
7 |
| |
| Sad |
GAGCTc |
7 |
7 |
| |
| BciVI |
GTATCCNNNNNN |
8 |
8 |
| |
| BsaBI |
GATNNnnatc |
8 |
8 |
| |
| NsiI |
ATGCAt |
8 |
8 |
| |
| Espl20I |
Gggccc |
9 |
9 |
CH1 |
| |
| Apal |
GGGCCc |
9 |
9 |
CH3. |
| |
| PspOOMI |
Gggccc |
9 |
9 |
| |
| BspHI |
Tcatga |
9 |
11 |
| |
| EcoRV |
GATatc |
9 |
9 |
| |
| AhdI |
GACNNNnngtC |
11 |
11 |
| |
| BbsI |
GAAGAC |
11 |
14 |
| |
| PsiI |
TTAtaa |
12 |
12 |
| |
| BsaI |
GGTCTCNnnnn |
13 |
15 |
| |
| XmaI |
Cccggg |
13 |
14 |
| |
| Aval |
Cycgrg |
14 |
16 |
| |
| BglI |
GCCNNNNnggc |
14 |
17 |
| |
| AiwNI |
CAGNNNctg |
16 |
16 |
| |
| BspMI |
ACCTGC |
17 |
19 |
| |
| XcmI |
CCANNNNNnnnntgg |
17 |
26 |
| |
| EstEZI |
Ggtnacc |
19 |
22 |
HC FR4 |
| |
| Sse8387I |
CCTGCAgg |
20 |
20 |
| |
| AvrII |
Cctagg |
22 |
22 |
| |
| HincII |
GTYraC |
22 |
22 |
| |
| EsgI |
GTGCAG |
27 |
29 |
| |
| MscI |
TGGcca |
30 |
34 |
| |
| BseRI |
NNnnnnnnnnctcctc |
32 |
35 |
| |
| Bsu36I |
CCtnagg |
35 |
37 |
| |
| PstI |
CTGCAg |
35 |
40 |
| |
| EciI |
nnnnnnnnntccgcc |
38 |
40 |
| |
| PpuMI |
RGgwccy |
41 |
50 |
| |
| StyI |
Ccwwgg |
44 |
73 |
| |
| EcoO109I |
RGgnccy |
46 |
70 |
| |
| Acc65I |
Ggtacc |
50 |
51 |
| |
| KpnI |
GGTACc |
50 |
51 |
| |
| BpmI |
ctccag |
53 |
82 |
| |
| AvaII |
Ggwcc |
71 |
124 |
|
*cleavage occurs in the top strand after the last upper-case base. For REs that cut palindromic sequences, the lower strand is cut at the symmetrical site.
|
| TABLE 20 |
|
|
| Cleavage of 79 human heavy chains |
|
|
|
|
|
Planned location of |
|
| Enzyme |
Recognition |
Nch |
Ns |
site |
|
| AfeI |
AGCgct |
0 |
0 |
|
|
| |
| AflII |
Cttaag |
0 |
0 |
NC FR3 |
| |
| AscI |
GGcgcgcc |
0 |
0 |
After LC |
| |
| BsiWI |
Cgtacg |
0 |
0 |
| |
| BspDI |
ATcgat |
0 |
0 |
| |
| BssHII |
Gcgcgc |
0 |
0 |
| |
| FseI |
GGCCGGcc |
0 |
0 |
| |
| HpaI |
GTTaac |
0 |
0 |
| |
| NheI |
Gctagc |
0 |
0 |
NC Linker |
| |
| NotI |
GCggccgc |
0 |
0 |
In linker, NC/anchor |
| |
| NruI |
TCGcga |
0 |
0 |
| |
| NsiI |
ATGCAt |
0 |
0 |
| |
| PacT |
TTAATtaa |
0 |
0 |
| |
| PciI |
Acatgt |
0 |
0 |
| |
| PmeI |
GTTTaaac |
0 |
0 |
| |
| PvuI |
CGATcg |
0 |
0 |
| |
| RsrII |
CGgwccg |
0 |
0 |
| |
| SapI |
gaagagc |
0 |
0 |
| |
| SfiI |
GGCCNNNNnggcc |
0 |
0 |
NC signal seq |
| |
| SgfI |
GCGATcgc |
0 |
0 |
| |
| SwaT |
ATTTaaat |
0 |
0 |
| |
| AcII |
AAcgtt |
1 |
1 |
| |
| AgeT |
Accggt |
1 |
1 |
| |
| AseI |
ATtaat |
1 |
1 |
| |
| AvrII |
Cctagg |
1 |
1 |
| |
| EsmI |
GAATGCN |
1 |
1 |
| |
| BsrBI |
GAGcgg |
1 |
1 |
| |
| BsrDI |
GCAATGNNn |
1 |
1 |
| |
| DraI |
TTTaaa |
1 |
1 |
| |
| FspI |
TGCgca |
1 |
1 |
| |
| HindIII |
Aagctt |
1 |
1 |
| |
| MfeI |
Caattg |
1 |
1 |
NC FR1 |
| |
| NaeI |
GCCggc |
1 |
1 |
| |
| NgoMI |
Gccggc |
1 |
1 |
| |
| SpeI |
Actagt |
1 |
1 |
| |
| Acc65I |
Ggtacc |
2 |
2 |
| |
| BstEI |
TTcgaa |
2 |
2 |
| |
| KpnI |
GGTACc |
2 |
2 |
| |
| MIuI |
Acgcgt |
2 |
2 |
| |
| NcoI |
Ccatgg |
2 |
2 |
In NC signal seq |
| |
| NdeI |
CAtatg |
2 |
2 |
NC FR4 |
| |
| PmlT |
CACgtg |
2 |
2 |
| |
| XcmI |
CCANNNNNnnnntgg |
2 |
2 |
| |
| BcgI |
cgannnnnntgc |
3 |
3 |
| |
| EdI |
Tgatca |
3 |
3 |
| |
| EglI |
GCCNNNNnggc |
3 |
3 |
| |
| BsaBI |
GATNNnnatc |
3 |
3 |
| |
| EsrGI |
Tgtaca |
3 |
3 |
| |
| SnaBI |
TACgta |
3 |
3 |
| |
| SseE387I |
CCTGCAgg |
3 |
3 |
| |
| ApaLI |
Gtgcac |
4 |
4 |
LC Signal/FRi |
| |
| EspHI |
Tcatga |
4 |
4 |
| |
| BssSI |
Ctcgtg |
4 |
4 |
| |
| PsiI |
TTAtaa |
4 |
5 |
| |
| SphI |
GCATGc 4 |
4 |
| |
| AhciI |
GACNNNnngtc 5 |
5 |
| |
| EspHI |
Tccgga 5 |
5 |
HC FR1 |
| |
| MscI |
TGGcca 5 |
5 |
| |
| Sad |
GAGCTc 5 |
5 |
| |
| Scal |
AGTact 5 |
5 |
| |
| SexAl |
Accwggt 5 |
6 |
| |
| SspI |
AATatt 5 |
5 |
| |
| TliI |
Ctcgag 5 |
5 |
| |
| XhoI |
Ctcgag 5 |
5 |
| |
| BbsI |
GAAGAC 7 |
8 |
| |
| EstAPI |
GCANNNNntgc 7 |
8 |
| |
| BstZl7I |
GTAtac 7 |
7 |
| |
| EcoRV |
GATatc 7 |
7 |
| |
| EcoRI |
Gaattc 8 |
8 |
| |
| SipI |
GCtnagc 9 |
9 |
| |
| Bsu36I |
CCtnagg 9 |
9 |
| |
| DraIII |
CACNNNgtg 9 |
9 |
| |
| EspI |
GCtnagc 9 |
9 |
| |
| StuI |
AGGcct 9 |
13 |
| |
| XbaI |
Totaga 9 |
9 |
HC FR3 |
| |
| Bsp120I |
Gggccc |
10 |
11 |
CH1 |
| |
| ApaI |
GGGCCC10 |
11 |
CH1 |
| |
| PspOOMI |
Gggccc |
10 |
11 |
| |
| BciVI |
GTATCCNNNNNN |
11 |
11 |
| |
| Sail |
Gtcgac |
11 |
12 |
| |
| DrdI |
GACNNNNnngtc |
12 |
12 |
| |
| KasI |
Ggcgcc |
12 |
12 |
| |
| XmaI |
Cccggg |
12 |
14 |
| |
| BglII |
Agatot |
14 |
14 |
| |
| HincII |
GTYrac |
16 |
18 |
| |
| BainHI |
Ggatcc |
17 |
17 |
| |
| Pf1MI |
CCANNNNntgg |
17 |
18 |
| |
| BsmBI |
Nnnnnngagacg |
18 |
21 |
| |
| BstXI |
CCANNNNNntgg |
18 |
19 |
HC FR2 |
| |
| XmnI |
GAANNnnttc |
18 |
18 |
| |
| SaclI |
CCGCgg |
19 |
19 |
| |
| PstI |
CTGCAg |
20 |
24 |
| |
| PvuII |
CAGctg |
20 |
22 |
| |
| AvaI |
Cycgrg |
21 |
24 |
| |
| EagI |
Cggccg |
21 |
22 |
| |
| AatII |
GACGTc |
22 |
22 |
| |
| BspMI |
ACCTGC |
27 |
33 |
| |
| AccI |
GTmkac |
30 |
43 |
| |
| StyI |
Ccwwgg |
36 |
49 |
| |
| AlWNI |
CAGNNNctg |
38 |
44 |
| |
| BsaI |
GGTCTCNnnnn |
38 |
44 |
| |
| PpuMI |
RGgwccy |
43 |
46 |
| |
| BsgI |
GTGCAG |
44 |
54 |
| |
| BseRI |
NNnnnnnnnctcctc |
48 |
60 |
| |
| EciI |
nnnnnnnntccgcc |
52 |
57 |
| |
| EstEII |
Ggtnacc |
54 |
61 |
HC Fr4, 47/79 have one |
| |
| EcoO109I |
RGgnccy |
54 |
86 |
| |
| BpmI |
ctccag |
60 |
121 |
| |
| AvaII |
Ggwcc |
71 |
140 |
|
| TABLE 21 |
|
|
| MALIA3, annotated |
|
|
| ! MALIA3 9532 bases |
|
| !---------------------------------------------------------------------- |
|
1 |
aat gct act act att agt aga att gat gcc acc ttt tca gct cgc gcc |
|
|
49 |
cca aat gaa aat ata gct aaa cag gtt att gac cat ttg cga aat gta |
|
| |
|
97 |
tct aat ggt caa act aaa tct act cgt tcg cag aat tgg gaa tca act |
| |
|
145 |
gtt aca tgg aat gaa act ttc aga cac cgt act tta gtt gca tat tta |
| |
|
193 |
aaa cat gtt gag cta cag cac cag att cag caa tta agc tct aag cca |
| |
|
241 |
ttc gca aaa atg acc tct tat caa aag gag caa tta aag gta ctc tct |
| |
|
289 |
aat cct gac ctg ttg gag ttt gct ttc ggtctg gtt cgc ttt gaa gct |
| |
|
337 |
cga att aaa acg cga tat ttg aag tct ttc ggg ctt cct ctt aat ctt |
| |
|
385 |
ttt gat gca atc cgc ttt gct tct gac tat aat agt cag ggtaaa gac |
| |
|
433 |
ctg att ttt gat tta tgg tca ttc tcg ttt tct gaa ctg ttt aaa gca |
| |
|
481 |
ttt gag ggg gat tca ATG aat att tat gac gat ttc gca gta ttg gac |
| ! |
|
RES?...... Start gene x, ii continues |
|
529 |
gct atc cag tct aaa cat ttt act att acc ccc tct ggc aaa act tct |
| |
|
577 |
ttt gca aaa gcc tct cgc tat ttt ggtttt tat cgt cgt ctg gta aac |
| |
|
625 |
gag ggttat gat agt gtt gct ctt act atg cct cgt aat ttc ttt tgg |
| |
|
673 |
cgt tat gta tct gca tta gtt gaa tgt ggtatt cct aaa tct caa ctg |
| |
|
721 |
atg aat ctt tct acc tgt aat aat gtt ggt ccg tta gtt cgt ttt att |
| |
|
769 |
aac gta gat ttt tct ttc caa cgt cct gac tgg tat aat gag cca gtt |
| |
|
817 |
ctt aaa atc gca TAA |
| ! |
|
End X & II |
|
832 |
ggtaattca ca |
| ! |
| ! |
|
M1 ES Q10 T15 |
|
843 |
ATG att aaa gtt gaa att aaa cca tct caa gcc caa ttt act act cgt |
| ! |
|
Start gene V |
| ! |
| ! |
|
S17 S20 P25 E30 |
|
891 |
tct ggt gtt tct cgt cag ggc aag cct tat tca ctg aat gag cag ctt |
| ! |
| ! |
|
V35 E40 V45 |
|
939 |
tgt tac gtt gat ttg ggtaat gaa tat ccg gtt ctt gtc aag att act |
| ! |
| ! |
|
D50 A55 L60 |
|
987 |
ctt gat gaa ggtcag cca gcc tat gcg cct ggtcTG TAC Acc gtt cat |
| ! |
|
BsrGI... |
| ! |
|
L65 V70 S75 R80 |
|
1035 |
ctg ttc tct ttc aaa gtt ggtcag ttc ggtttc ctt atg att gac cgt |
| ! |
| ! |
|
P85 K87 end of V |
|
1083 |
ctg cgc ctc gtt ccg gct aag TAA C |
| ! |
|
1108 |
ATG gag cag gtc gcg gat ttc gac aca att tat cag gcg atg |
| ! |
|
Start gene VII |
| ! |
|
1150 |
ata caa atc ttc gtt gta ctt tgt ttc gcg ctt ggt ata atc |
| ! |
| ! |
|
VII and IX overlap. |
| ! |
|
S2 V3 L4 V5 S10 |
|
1192 |
gct ggg ggt caa agA TGA gt gtt tta gtg tat tct ttc gcc tct ttc gtt |
| ! |
|
End VII |
| ! |
|
|start IX |
| ! |
|
L13 W15 G20 T25 E29 |
|
1242 |
tta ggt tgg tgc ctt cgt agt ggc att acg tat ttt acc cgt tta atg gaa |
| ! |
|
1293 |
act ttc tc |
| ! |
| ! |
|
.... stop of IX, IX and VIII overlap by four bases |
|
1301 |
ATG aaa aag tct tta gtc ctc aaa gcc tct gta gcc gtt gct acc ctc |
| ! |
|
Start signal sequence of viii. |
| ! |
|
1349 |
gtt cog atg ctg tct ttc gct gct gag ggt gac gat ccc gca aaa gcg |
| ! |
|
mature VIII ---> |
|
1397 |
gcc ttt aac tcc ctg caa gcc tca gcg acc gaa tat atc ggt tat gcg |
| |
|
1445 |
tgg gcg atg gtt ggt gtc att |
| |
|
1466 |
gtc ggc gca act atc ggt atc aag ctg ttt aag |
| |
|
1499 |
aaa ttc acc tcg aaa gca ! 1515 |
| ! |
|
|........... −35 .. |
| ! |
|
1517 |
agc tga taaaccgat acaattaaag gctccttttg |
| ! |
|
..... −10 ... |
| ! |
|
1552 |
gagccttttt ttttGGAGAt ttt ! S.D. underlined |
| ! |
| ! |
|
>----------- III signal sequence -----------------------------> |
| ! |
|
M K K L L F A I P L V |
|
1575 |
caac GTG aaa aaa tta tta ttc gca att cct tta gtt ! 1611 |
| ! |
| ! |
|
V P F Y S H S A Q |
|
1612 |
gtt cct ttc tat tct cac aGT gcA Cag tCT |
| ! |
|
ApaLI... |
| ! |
|
1642 |
GTC GTG ACG CAG CCG CCC TCA GTG TCT GGG GCC CCA GGG CAG |
| |
|
|
AGG GTC ACC ATC TCC TGC ACT GGG AGC AGC TCC AAC ATC GGG GCA |
| ! |
|
BstEII... |
|
1729 |
GGT TAT GAT GTA CAC TGG TAC CAG CAG CTT CCA GGA ACA GCC CCC AAA |
| |
|
1777 |
CTC CTC ATC TAT GGT AAC AGC AAT CGG CCC TCA GGG GTC CCT GAC CGA |
| |
|
1825 |
TTC TCT GGC TCC AAG TCT GGC ACC TCA GCC TCC CTG GCC ATC ACT |
| |
|
1870 |
GGG CTC CAG GCT GAG GAT GAG GCT GAT TAT |
| |
|
1900 |
TAC TGC CAG TCC TAT GAC AGC AGC CTG AGI |
| |
|
1930 |
GGC CTT TAT GTC TTC GGA ACT GGG ACC AAG GTC ACC GTC |
| ! |
|
BstEII... |
|
1969 |
CTA GGT CAG CCC AAG GCC AAC CCC ACT GTC ACT |
| |
|
2002 |
CTG TTC CCG CCC TCC TCT GAG GAG CTC CAA GCC AAC AAG GCC ACA CTA |
| |
|
2050 |
GTG TGT CTG ATC AGT GAC TTC TAC CCG GGA GCT GTG ACA GTG GCC TGG |
| |
|
2098 |
AAG GCA GAT AGC AGC CCC GTC AAG GCG GGA GTG GAG ACC ACC ACA CCC |
| |
|
2146 |
TCC AAA CAA AGC AAC AAC AAG TAC GCG GCC AGC AGC TAT CTG AGC CTG |
| |
|
2194 |
ACG CCT GAG CAG TGG AAG TCC CAC AGA AGC TAC AGC TGC CAG GTC ACG |
| |
|
2242 |
CAT GAA GGG AGC ACC GTG GAG AAG ACA GTG GCC CCT ACA GAA TGT |
| |
|
2290 |
TAA TAA ACCG CCTCCACCGG GCGCGCCAAT TCTATTTCAA GGAGACAGTC ATA |
| ! |
|
AscI..... |
| ! |
| ! |
|
PelB signal----------------------------------------> |
| ! |
|
M K Y L L P T A A A G L L L L |
|
2343 |
ATG AAA TAC CTA TTG CCT ACG GCA GCC GCT GGA TTG TTA TTA CTC |
| ! |
| ! |
|
16 17 18 19 20 21 22 |
| ! |
|
A A Q P A M A |
|
2388 |
gcG GCC cag ccG GCC atg gcc |
| ! |
|
SfiI............. |
| ! |
|
NgoMI...(1/2) |
| ! |
|
NcoI......... |
| ! |
| ! |
|
FR1 (DP47/V3-23)--------------- |
| ! |
|
23 24 25 26 27 28 29 30 |
| ! |
|
E V Q L L E S G |
|
2409 |
gaa|gtt|CAA|TTG|tta|gag |
| tct|ggt| |
| ! |
|
|MfeI | |
| ! |
| ! |
|
--------------FR1-------------------------------------------- |
| ! |
|
31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 |
| ! |
|
G G L V Q P G G S L R L S C A |
|
2433 |
|ggc|ggt|ctt|gtt|cag|cct|ggt|ggt|tct|tta|cgt|ctt|tct|tgc|gct| |
| ! |
| ! |
|
----FR1---------------->|...CDR1................|---FR2------ |
| ! |
|
46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 |
| ! |
|
A S G F I F S S Y A M S W V R |
|
2478 |
|gct|TCC|GGA|ttc|act|ttc|tct|tCG|TAC|Gct|atg|tct|tgg|gtt|cgc| |
| ! |
|
| BspEI | | BsiwW| |BstXI. |
| ! |
| ! |
|
-------FR2-------------------------------->|...CDR2........ |
| ! |
|
61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 |
| ! |
|
Q A P G K G L K W V S A I S G |
|
2523 |
|CAa|gct|ccT|GGt|aaa|ggt|ttg|gag|tgg|gtt|tct|gct|atc|tct|ggt| |
|
! ...BstXI | |
|
|
! |
|
! |
.....CDR2............................................|---FR3--- |
| ! |
|
76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 |
|
| ! |
|
S G G S T Y Y A D S K G R F |
|
2568 |
|tct|ggt|ggc|agt|act|tac|tat|gct|gac|tcc|gtt|aaa|ggt|cgc|ttc| |
| ! |
| ! |
| ! |
|
--------FR3-------------------------------------------------- |
| ! |
|
91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 |
| ! |
|
T I S R D N S K N I L Y L Q M |
|
2613 |
|act|atc|TCT|AGA|gac|aac|tct|aag|aat|act|ctc|tac|ttg|cag|atg| |
| ! |
|
| XbaI | |
| ! |
| ! |
|
---FR3----------------------------------------------------->| |
| ! |
|
106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 |
| ! |
|
N S L R A E D T A V Y Y C A K |
|
2658 |
|aac|agC|TTA|AGg|gct|gag|gac|aCT|GCA|Gtc|tac|tat|tgc|gct|aaa| |
| ! |
|
|AflII | | PstI | |
| ! |
| ! |
|
.......CDR3.................|----FR4------------------------- |
| ! |
|
121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 |
| ! |
|
D Y E G T G Y A F D I W G Q G |
|
2703 |
|gac|tat|gaa|ggt|act|ggt|tat|gct|ttc|gaC|ATA|TGg|ggt|caa|ggt| |
| ! |
|
| NdeI |(1/4) |
| ! |
| ! |
|
--------------FR4---------->| |
| ! |
|
136 137 138 139 140 141 142 |
| ! |
|
T M V I V S S |
|
2748 |
|act|atG|GTC|ACC|gtc|tct|agt |
| ! |
|
| BstEII | |
| ! From BstEII onwards, pV323 is same as pCES1, except as noted. |
|
| ! EstEII sites may occur in light chains; not likely to be unique in final |
| ! vector. |
| ! |
|
|
|
| ! |
|
143 144 145 146 147 148 149 150 151 152 |
| ! |
|
A S I K G P S V F P |
|
2769 |
gcc ttc acc aaG GGC CCa tcg GTC TTC ccc |
| ! |
|
Bsp120I. BbsI...(2/2) |
| ! |
|
ApaI.... |
| ! |
| ! |
|
153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 |
| ! |
|
L A P S S K S T S G G T A A L |
|
2799 |
ctg gca ccc TCC TCc aag agc acc tct ggg ggc aca gcg gcc ctg |
| ! |
|
BseRI...(2/2) |
| ! |
| ! |
|
168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 |
| ! |
|
G C L V K D Y F P E P |
|
2844 |
ggc tgc ctg GTC AAG GAC TAC TTC CCC gaA CCG GTg acg gtg tcg |
| ! |
|
AgeI.... |
| ! |
| ! |
|
183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 |
| ! |
|
W N S G A L I S G V H T F P A |
|
2889 |
tgg aac tca GGC GCC ctg acc agc ggc gtc cac acc ttc ccg gct |
| ! |
|
KasI...(1/4) |
| ! |
| ! |
|
198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 |
| ! |
|
V L Q S S G L Y S L S S V V T |
|
2934 |
gtc cta cag tCt agc GGa ctc tac ttc ctc agc agc gta gtg acc |
| ! |
|
(Bsu36I...)(knocked out) |
| ! |
| ! |
|
213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 |
| ! |
|
V P S S S L G T Q T Y I C N V |
|
2979 |
gtg CCC tCt tct agc tTG Ggc acc cag acc tac ctc tgc cac gtg |
| ! |
|
(BstXI...........)N.B. destruction of BstXI & BpmI sites. |
| ! |
| ! |
|
228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 |
| ! |
|
N H K P S N T K V D K |
|
3024 |
aat cac aag ccc agc aac acc acg gtg gac aag aaa gtt gag ccc |
| ! |
| ! |
|
243 244 245 |
| ! |
|
K S C A A A H H H H H H S A |
|
3069 |
aaa tct tgt GCG GCC GCt cat cac cac cat cat cac tct gct |
| ! |
|
NotI...... |
| ! |
| ! |
|
E Q K L I S E E D L N G A A |
|
3111 |
gaa caa aaa ctc ctc tca gaa gag gct ctg act ggt gcc gcc |
| ! |
| ! |
| ! |
|
D I N D D R M A S G A |
|
3153 |
GAT ATC acc gat gat cgt atg gct AGC ggc gcc |
| ! |
|
rEK cleavage site.......... NheI... KasI... |
| ! |
|
EcoRV.. |
| ! |
| ! |
Domain 1 ------------------------------------------------------------ |
|
| ! |
|
A E I V E S C L A |
|
|
3183 |
gct gaa act gtt gac cgt tgt tta gca |
| ! |
| ! |
| ! |
|
K P H T E I S F |
|
3210 |
caa ccc cat aca gcc aat tca ttt |
| ! |
| ! |
|
T N V W K D D K T |
|
3234 |
aCT AAC GTC TGG AAA GAC GAC AAA ACt |
| ! |
| ! |
|
L D R Y A N Y E G C L W N A T G V |
|
3261 |
tta gat cgt tac gct aac tat gag ggttgt ctg tgG AAT GCt aca ggc gtt |
| ! |
|
BsmI____ |
| ! |
| ! |
|
V V C T G D E T Q C Y G T W V P I |
|
3312 |
gta gtt tgt act ggt GAC GAA ACT CAG TGT TAC GGT ACA TGG GTT cct att |
| ! |
| ! |
|
G L A I P E N |
|
3363 |
ggg ctt gct atc cct gaa aat |
| ! |
| ! L1 linker ------------------------------------ |
|
| ! |
|
E G G G S E G G G S |
|
|
3384 |
gag ggt ggt ggc tct gag ggt ggc ggt tct |
| ! |
| ! |
|
E C G G S E G G G S |
|
3414 |
gag ggt ggc ggt tct gag ggt ggc ggt act |
| ! |
| ! |
Domain 2 ------------------------------------ |
|
|
3444 |
aaa cct cct gag tac ggtgat aca cct att ccg ggc tat act tat atc aac |
|
| |
|
3495 |
cct ctc gac ggc act tat ccg cct ggtact gag caa aac ccc gct aat cct |
| |
|
3546 |
aat cct tct ctt GAG GAG tct cag cct ctt aat act ttc atg ttt cag aat |
| ! |
|
EseRI |
|
3597 |
aat agg ttc cga aat agg cag ggg gca tta act gtt tat acg ggc act |
| |
|
3645 |
gtt act caa ggc act gac ccc gtt aaa act tat tac cag tac act cct |
| |
|
3693 |
gta tca tca aaa gcc atg tat gac gct tac tgg aac ggt aaa ttC AGA |
| ! |
|
AlwNI |
|
3741 |
GAC TGc gct ttc cat tct ggc ttt aat gaa gat cca ttc gtt tgt gaa |
| ! |
|
AlwNI |
|
3789 |
tat caa ggc caa tcg tct gac ctg cct caa cct cct gto aat gct |
| ! |
|
3834 |
ggc ggc ggc tct |
| ! |
start L2 ------------------------------------------------------------ |
|
|
3846 |
ggt ggt ggt tct |
|
| |
|
3858 |
ggt ggc ggc tct |
| |
|
3870 |
gag ggt ggt ggc tct gag ggt ggc ggt tct |
| |
|
3900 |
gag ggt ggc ggc tct gag gga ggc ggt tcc |
| |
|
3930 |
ggt ggt ggc tct ggt ! end L2 |
| ! |
| ! Domain 3 -------------------------------------------------------------- |
|
| ! |
|
S G D F D Y E K M A N A N K G A |
|
|
3945 |
tcc ggt gat ttt gat tat gaa aag atg gca aac gct aat aag ggg gct |
| ! |
| ! |
|
M T E N A D E N A L Q S D A K G |
|
3993 |
atg acc gaa aat gcc gat gaa aac gcg cta cag tct gac gct aaa ggc |
| ! |
| ! |
|
K L D S V A I D Y G A A I D G F |
|
4041 |
aaa ctt gat tct gtc gct act gat tac ggt gct gct atc gat ggt ttc |
| ! |
| ! |
|
I C D V S G L A N G N G A T G D |
|
4089 |
att ggt gac gtt tcc ggc ctt gct aat ggt aat ggt gct act ggt gat |
| ! |
| ! |
|
F A C S N S Q M A Q V G D G D N |
|
4137 |
ttt gct ggc tct aat tcc caa atg gct caa gtc ggt gac ggt gat aat |
| ! |
| ! |
|
S P L M N N F R Q Y L P S L P Q |
|
4185 |
tca cct tta atg aat aat ttc cgt caa tat tta cct tcc ctc cct caa |
| ! |
| ! |
|
S V K C R P F V F S A G K P Y E |
|
4233 |
tcg gtt gaa tgt cgc cct ttt gtc ttt agc gct ggt aaa cca tat gaa |
| ! |
| ! |
|
F S I U C U K I N L F R |
|
4281 |
ttt tct att gat tgt gac aaa ata aac tta ttc cgt |
| ! |
|
End Domain 3 |
| ! |
| ! |
|
G V F A F L L Y V A T F M Y V F140 |
|
4317 |
ggt gtc ttt gcg ttt ctt tta tat gtt gcc acc ttt atg tat gta ttt |
| ! |
|
start transmembrane segment |
| ! |
| ! |
|
S T F A N I L |
|
4365 |
tct acg ttt gct aac ata ctg |
| ! |
| ! |
|
R N K E S |
|
4386 |
cgt aat aag gag tct TAA ! stop of iii |
| ! |
|
|
|
| ! |
|
M1 P2 V L L5 G I P L L10 L R F L G15 |
|
4404 |
tc ATG cca gtt ctt ttg ggt att ccg tta tta ttg cgt ttc ctc ggt |
| ! |
|
Start VI |
| ! |
|
4451 |
ttc ctt ctg gta act ttg ttc ggc tat ctg ctt act ttt ctt aaa aag |
| |
|
4499 |
ggc ttc ggt aag ata gct att gct att tca ttg ttt ctt gct ctt att |
| |
|
4547 |
att ggg ctt aac tca att ctt gtg ggt tat ctc tct gat att agc gct |
| |
|
4595 |
caa tta ccc tct gac ttt gtt cag ggt gtt cag tta att ctc ccg tct |
| |
|
4643 |
aat gcg ctt ccc tgt ttt tat gtt att ctc tct gta aag gct gct att |
| |
|
4691 |
ttc att ttt gac gtt aaa caa aaa atc gtt tct tat ttg gat tgg gat |
| ! |
| ! |
|
M1 A2 V3 F5 L10 G13 |
|
4739 |
aaa TAA t ATG gct gtt tat ttt gta act ggc aaa tta ggc tct gga |
| ! |
|
end VI Start gene I |
| ! |
| ! |
|
14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 |
| ! |
|
K T L V S V G K I Q D K I V A |
|
4785 |
aag acg ctc gtt agc gtt ggt acg att cag gat aaa att gta gct |
| ! |
| ! |
|
29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 |
| ! |
|
G C K I A I N L D L P L Q N L |
|
4830 |
ggg tgc aaa ata gca act aat ctt gat tta agg ctt caa aac ctc |
| ! |
| ! |
|
44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 |
| ! |
|
P Q V G R F A K T P R V L R I |
|
4875 |
ccg caa gtc ggg agg ttc gct aaa acg cct cgc gtt ctt aga ata |
| ! |
| ! |
|
59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 |
| ! |
|
P D K P S I S D L L A I G R G |
|
4920 |
ccg gat aag cct tct ata tct gat ttg ctt gct att ggg cgc ggt |
| ! |
| ! |
|
74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 |
| ! |
|
N D S Y D E N K N G L L V L V D |
|
4965 |
aat gat tcc tac gat gaa aat aaa aac ggc ttg ctt gtt ctc gat |
| ! |
| ! |
|
89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 |
| ! |
|
E C G T W F N T R S W N D K E |
|
5010 |
gag tgc ggt act tgg ttt aat acc cgt tct tgg aat gat aag gaa |
| ! |
| ! |
|
104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 |
| ! |
|
R Q P I I D W F L H A R K L G |
|
5055 |
aga cag ccg att att gat tgg ttt cta cat gct cgt aaa tta gga |
| ! |
| ! |
|
119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 |
| ! |
|
W D I I F L V Q D L S I V D K |
|
5100 |
tgg gat att att ttt ctt gtt cag gac tta tct att gtt gat aaa |
| ! |
| ! |
|
134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 |
| ! |
|
Q A R S A L A E H V V Y C R R |
|
5145 |
cag gcg cgt tct gca tta gct gaa cat gtt ggt tat tgt cgt cgt |
| ! |
| ! |
|
149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 |
| ! |
|
L D R I T L P F V G I L Y S L |
|
5190 |
ctg gac aga att act tta cct ttt gtc ggt act tta tat tct ctt |
| ! |
| ! |
|
164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 |
| ! |
|
I I G S K M P L P K L H V G V |
|
5235 |
att act ggc tcg aaa atg cct ctg cct aaa tta cat gtt ggc gtt |
| ! |
| ! |
|
179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 |
| ! |
|
V K Y G D S Q L S P I V E R W |
|
5280 |
gtt aaa tat ggc gat tct caa tta agc cct act gtt gag cgt tgg |
| ! |
| ! |
|
194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 |
| ! |
|
L Y T G K N L Y N A Y D T K Q |
|
5325 |
ctt tat act ggt aag aat ttg tat aac gca tat gat act aaa cag |
| ! |
| ! |
|
209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 |
| ! |
|
A F S S N Y D S G V Y S Y L I |
|
5370 |
gct ttt tct agt aat tat gat ttc ggt gtt tat tct tat tta acg |
| ! |
| ! |
|
224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 |
| ! |
|
P Y L S H G R Y F K P L N L G |
|
5415 |
cct tat tta tca cac ggt cgg tat ttc aaa cca tta aat tta ggt |
| ! |
| ! |
|
239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 |
| ! |
|
Q K M K L I K I Y L K K F S R |
|
5460 |
cag aag atg aaa tta act aaa ata tat ttg aaa aag ttt tct cgc |
| ! |
| ! |
|
254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 |
| ! |
|
V L C L A I G F A S A F I Y S |
|
5505 |
gtt ctt tgt ctt gcg att gga ttt gca tca gca ttt aca tat agt |
| ! |
| ! |
|
269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 |
| ! |
|
Y I T Q P K P E V K K V V S Q |
|
5550 |
tat ata acc caa cct aag ccg gag gtt aaa aag gta gtc tct cag |
| ! |
| ! |
|
284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 |
| ! |
|
T Y D F D K F T I D S S Q R L |
|
5595 |
acc tat gat ttt gat aaa ttc act att gac tct tct cag cgt ctt |
| ! |
| ! |
|
299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 |
| ! |
|
N L S Y P Y V F K D S K G K L |
|
5640 |
aat cta agc tat cgc tat gtt ttc aag gat tct aag gga aaa TTA |
| ! |
|
PacI |
| ! |
| ! |
|
314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 |
| ! |
|
I N S D D L Q K Q G Y S L I Y |
|
5685 |
ATT AAt agc gac gat tta cag aag caa ggt tat tca ctc aca tat |
| 49 |
|
|
|
| ! |
|
329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 |
| ! |
|
i I D L C I V S I K K G N S N E |
|
5730 |
att gat tta tgt act gtt ttc att aaa aaa ggt aat tca aAT Gaa |
|
| ! |
|
Start IV |
| ! |
| ! |
|
344 345 346 347 348 349 |
| ! |
i I V K C N .End of I |
|
| ! |
iv L3 L N5 V 17 N F V10 |
|
5775 |
att gtt aaa tgt aat TAA T TTT GTT |
|
|
5800 |
ttc ttg atg ttt ggt tca tca tct tct ttt gct cag gta att gaa atg |
| |
|
5848 |
aat aat tcg cct ctg cgc gat ttt gta act tgg tat tca aag caa tca |
| |
|
5896 |
ggc gaa ttc ggt att ggt tct ccc gat gta aaa ggt act gtt act gta |
| |
|
5944 |
tat tca tct gac ggt aaa cct gaa aat cta cgc aat ttc ttt att tct |
| |
|
5992 |
ggt tta cgt gct aat aat ttt gat atg ggt ggt tca att cct tcc ata |
| |
|
6040 |
att cag aag tat aat cca aac aat cag gat tat att gat gaa ttg cca |
| |
|
6088 |
tca tct gat aat cag gaa tat gat gat aat ttc gct cct tct ggt ggt |
| |
|
6136 |
ttc ttt ggt ccg caa aat gat aat ggt act caa act ttt aaa att att |
| |
|
6184 |
aac ggt cgg gca aag gat tta ata cga gtt gtc gaa ttg ttt gta aag |
| |
|
6280 |
cta tta gtt ggt TCT gca cct aaa gat att tta gat aac ctt cct caa |
| ! |
|
ApaLI removed |
|
6328 |
ttc ctt tct act gtt gat ttg cca act gac cag ata ttg att gag ggt |
| |
|
6376 |
ttg ata ttt gag gtt cag caa ggt gat gct tta gat ttt tca ttt gct |
| |
|
6424 |
gct ggc tct cag cgt ggc act gtt gca ggc ggt gtt aat act gac cgc |
| |
|
6472 |
ctc acc tct gtt tta tct tct gct ggt ggt tcg ttc ggt att ttt aat |
| |
|
6520 |
ggc gat gtt tta ggg cta tca gtt cgc gca tta aag act aat agc cat |
| |
|
6568 |
tca aaa ata ttg tct gtg cca cgt att ctt acg ctt tca ggt cag aag |
| |
|
6616 |
ggt tct atc tct gtT GGC CAg aat gtc cct ttt att act ggt cgt gtg |
| ! |
|
MscI |
|
6664 |
act ggt gaa tct gcc aat gta aat aat cca ttt cag acg att gag cgt |
| |
|
6712 |
caa aat gta ggt att ttc atg agc gtt ttt cct gtt gca atg gct ggc |
| |
|
6760 |
ggt aat att gtt ctg gat att acc agc aag gcc gat agt ttg agt tct |
| |
|
6808 |
tct act cag gca agt gat gtt att act aat caa aga agt att gct aca |
| |
|
6856 |
acg gtt aat ttg cgt gat gga cag act ctt tta ctc ggt ggc ctc act |
| |
|
6904 |
gat tat aaa aac act tct caa gat tct ggc gta ccg ttc ctg tct aaa |
| |
|
6952 |
atc oct tta atc ggc ctc ctg ttt agc ttc cgc tct gat ttc aac gag |
| |
|
7000 |
gaa agc acg tta tac gtg ctc gtc aaa gca acc ata gta cgc gcc ctg |
| |
|
7048 |
TAG cggcgcatt |
| ! |
|
End IV |
|
7060 |
aagcgcggcg ggtgtggtgg ttacgcgcag cgtgaccgct acacttgcca gcgccctagc |
| |
|
7120 |
gcccgctcct ttcgctttct tcccttcctt tctcgccacg ttcGCCGGCt ttccccgtca |
| ! |
|
NgoMI_ |
|
7180 |
agctctaaat cgggggctcc ctttagggtt ccgatttagt gctttacggc acctcgaccc |
| |
|
7240 |
caaaaaactt gatttgggtg atggttCACG TAGTGggcca tcgccctgat agacggtttt |
| ! |
|
DraIII |
|
7300 |
tcgccctttG ACGTTGGAGT Ccacgttctt taatagtgga ctcttgttcc aaactggaac |
| ! |
|
DrdI |
|
7360 |
aacactcaac cctatctcgg gctattcttt tgatttataa gggattttgc cgatttcgga |
| |
|
7420 |
accaccatca aacaggattt tcgcctgctg gggcaaacca gcgtggaccg cttgctgcaa |
| |
|
7480 |
ctctctcagg gccaggcggt gaagggcaat CAGCTGttgc cCGTCTCact ggtgaaaaga |
| ! |
|
PvuII. BsmBI. |
|
7540 |
aaaaccaccc tGGATCC AAGCTI |
| ! |
|
BamHI HindIII (1/2) |
| ! |
|
Insert carrying bla gene |
|
7563 |
gcaggtg gcacttttcg gggaaatgtg cgcggaaccc |
|
7600 |
ctatttgttt atttttctaa atacattcaa atatGTATCC gctcatgaga caataaccct |
| ! |
|
BciVI |
|
7660 |
gataaatgct tcaataatat tgaaaaAGGA AGAgt |
| ! |
|
RBSsI.?... |
| ! |
|
Start bla gene |
|
7695 |
ATG agt att caa cat ttc cgt gtc gcc ctt att ccc ttt ttt gcg gca ttt |
| |
|
7746 |
tgc ctt cct gtt ttt gct cac cca gaa acg ctg gtg aaa gta aaa gat gct |
| |
|
7797 |
gaa gat cag ttg ggc gCA CGA Gtg ggt tac atc gaa ctg gat ctc aac agc |
| ! |
|
BssSI... |
| ! |
|
ApaLI removed |
|
7848 |
ggt aag atc ctt gag agt ttt cgc ccc gaa gaa cgt ttt cca atg atg agc |
| |
|
7899 |
act ttt aaa gtt ctg cta tgt cat aca cta tta ttc cgt att gac gcc ggg |
| |
|
7950 |
caa gaG CAA CTC GGT CGc cgg gcg cgg tat tct cag aat gac ttg gtt gAG |
| ! |
|
BcgI ScaI |
|
8001 |
TAC Tca cca gtc aca gaa acg cat ctt acg gat ggc atg aca gta aga gaa |
| ! |
|
ScaI |
|
8052 |
tta tgc agt gct gcc ata acc atg agt gat aac act gcg gcc aac tta ctt |
| |
|
8103 |
ctg aca aCG ATC Gga gga ccg aag gag cta acc gct ttt ttg cac aac atg |
| ! |
|
PvuI |
|
8154 |
ggg gat cat gta act cgc ctt gat cgt tgg gaa ccg gag ctg aat gaa gcc |
| |
|
8205 |
ata cca aac gac gag cgt gac acc acg atg cct gta gca atg cca aca acg |
| |
|
8256 |
tTG CGC Aaa cta tta act ggc gaa cta ctt act cta gct ttc cgg caa caa |
| ! |
|
FspI.... |
| ! |
|
8307 |
tta ata gac tgg atg gag gcg gat aaa gtt gca gga cca ctt ctg cgc tcg |
| |
|
8358 |
GCC ctt ccG GOt ggc tgg ttt att gct gat aaa tct gga gcc ggt gag cgt |
| ! |
|
BglI |
|
8409 |
gGG TCT Cgc ggt atc att gca gca ctg ggg cca gat ggt aag ccc ttc cgt |
| ! |
|
BsaI |
|
8460 |
atc gta gtt atc tac acG ACg ggg aGT Cag gca act atg gat gaa cga aat |
| ! |
|
AhdI |
|
8511 |
aga cag atc gct gag ata ggt gcc tca ctg att aag cat tgg TAA ctgt |
| ! |
|
stop |
|
8560 |
cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa |
| |
|
8620 |
ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt |
| |
|
8680 |
cgttccactg tacgtaagac cccc |
| |
|
8704 |
AAGCTT GTCGAC tgaa tggcgaatgg cgctttgcct |
| ! |
|
HindIII SalI.. |
| ! |
|
(2/2) HincII |
|
8740 |
ggtttccggc accagaagcg gtgccggaaa gctggctgga gtgcgatctt |
| ! |
|
8790 |
CCTGAGG |
| ! |
|
Bsu36I_ |
|
8797 |
ccgat actgtcgtcg tcccctcaaa ctggcagatg |
| |
|
8832 |
cacggt tacg atgcgcccat ctacaccaac gtaacctatc ccattacggt caatccgccg |
| |
|
8892 |
tttgttccca cggagaatcc gacgggttgt tactcgctca catttaatgt tgatgaaagc |
| |
|
8952 |
tggctacagg aaggccagac gcgaattatt tttgatggcg ttcctattgg ttaaaaaatg |
| |
|
9012 |
agctgattta acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaATTTAAA |
| ! |
|
SwaI... |
|
9072 |
Tatttgctta tacaatcttc ctgtttttgg ggcttttctg attatcaacc GGGGTAcat |
| ! |
|
RBS |
|
9131 |
ATG att gac atg cta gtt tta cga tta ccg ttc atc gat tct ctt gtt tgc |
| ! |
|
Start gene II |
|
9182 |
ttc aga ctc tca ggc aat gac ctg ata gcc ttt gtA GAT CTc tca aaa ata |
| ! |
|
BglII... |
|
9233 |
gct acc ctc ttc ggc atg aat tta tca gct aga acg gtt gaa tat cat att |
| |
|
9284 |
gat ggt gat ttg act gtc ttc ggc ctt tct cac cct ttt gaa tct tta cct |
| |
|
9335 |
aca cat tac tca ggc att gca ttt aaa ata tat gag ggt tct aaa aat ttt |
| |
|
9386 |
tat cct tgc gtt gaa ata aag gct tct ccc gca aaa gta tta cag ggt cat |
| |
|
9437 |
aat gtt ttt ggt aca acc gat tta gct tta tgc tct gag gct tta ttg ctt |
| |
|
9488 |
aat ttt gct aat tct ttg cct tgc ctg tat gat tta ttg gat gtt ! 9532 |
| TABLE 212 |
|
|
| Sequence of MALIA3, condensed |
|
|
| LOCUS |
|
|
| ORIGIN |
MALIA3 9532 CIRCULAR |
| 1 |
AATGCTACTA CTATTAGTAG AATTGATGCC ACCTTTTCAG CTCGCGCCCC AAATGAAAAI |
|
| |
| 61 |
ATAGCTAAAC AGGTTATTGA CCATTTGCGA AATGTATCTA ATGGTCAAAC TAAATCTACT |
| |
| 121 |
CGTTCGCAGA ATTGGGAATC AACTGTTACA TGGAATGAAA CTTCCAGACA CCGTACTTTA |
| |
| 181 |
GTTGCATATT TAAAACATGT TGAGCTACAG CACCAGATTC AGCAATTAAG CTCTAAGCCA |
| |
| 241 |
TCCGCAAAAA TGACCTCTTA TCAAAAGGAG CAATTAAAGG TACTCTCTAA TCCTGACCTG |
| |
| 361 |
TCTTTCGGGC TTCCTCTTAA TCTTTTTGAT GCAATCCGCT TTGCTTCTGA CTATAATAGT |
| |
| 421 |
CAGGGTAAAG ACCTGATTTT TGATTTATGG TCATTCTCGT TTTCTGAACT GTTTAAAGCA |
| |
| 481 |
TTTGAGGGGG ATTCAATGAA TATTTATGAC GATTCCGCAG TATTGGACGC TATCCAGTCT |
| |
| 541 |
AAACATTTTA CTATTACCCC CTCTGGCAAA ACTTCTTTTG CAAAAGCCTC TCGCTATTTT |
| |
| 601 |
GGTTTTTATC GTCGTCTGGT AAACGAGGGT TATGATAGTG TTGCTCTTAC TATGCCTCGT |
| |
| 661 |
AATTCCTTTT GGCGTTATGT ATCTGCATTA GTTGAATGTG GTATTCCTAA ATCTCAACTG |
| |
| 721 |
ATGAATCTTT CTACCTGTAA TAATGTTGTT CCGTTAGTTC &TTTTATTAA CGTAGATTTT |
| |
| 781 |
TCTTCCCAAC GTCCTGACTG GTATAATGAG CCAGTTCTTA AAATCGCATA AGGTAATTCA |
| |
| 841 |
CAATGATTAA AGTTGAAATT AAACCATCTC AAGCCCAATT TACTACTCGT TCTGGTGTTT |
| |
| 901 |
CTCGTCAGGG CAAGCCTTAT TCACTGAATG AGCAGCTTTG TTACGTTGAT TTGGGTAATG |
| |
| 961 |
AATATCCGGT TCTTGTCAAG ATTACTCTTG ATGAAGGTCA GCCAGCCTAT GCGCCTGGTC |
| |
| 1021 |
TGTACACCGT TCATCTGTCC TCTTTCAAAG TTGGTCAGTT CGGTTCCCTT ATGATTGACC |
| |
| 1081 |
GTCTGCGCCT CGTTCCGGCT AAGTAACATG GAGCAGGTCG CGGATTTCGA CACAATTTAT |
| |
| 1141 |
CAGGCGATGA TACAAATCTC CGTTGTACTT TGTTTCGCGC TTGGTATAAT CGCTGGGGGT |
| |
| 1201 |
CAAAGATGAG TGTTTTAGTG TATTCTTTCG CCTCTTTCGT TTTAGGTTGG TGCCTTCGTA |
| |
| 1261 |
GTGGCATTAC GTATTTTACC CGTTTAATGG AAACTTCCTC ATGAAAAAGT CTTTAGTCCT |
| |
| 1321 |
CAAAGCCTCT GTAGCCGTTG CTACCCTCGT TCCGATGCTG TCTTTCGCTG CTGAGGGTGA |
| |
| 1381 |
CGATCCCGCA AAAGCGGCCT TTAACTCCCT GCAAGCCTCA GCGACCGAAT ATATCGGTTA |
| |
| 1441 |
TGCGTGGGCG ATGGTTGTTG TCATTGTCGG CGCAACTATC GGTATCAAGC TGTTTAAGAA |
| |
| 1501 |
ATTCACCTCG AAAGCAAGCT GATAAACCGA TACAATTAAA GGCTCCTTTT GGAGCCTTTT |
| |
| 1561 |
TTTTTGGAGA TTTTCAACGT GAAAAAATTA TTATTCGCAA TTCCTTTAGT TGTTCCTTTC |
| |
| 1621 |
TATTCTCACA GTGCACAGTC TGTCGTGACG CAGCCGCCCT CAGTGTCTGG GGCCCCAGGG |
| |
| 1681 |
CAGAGGGTCA CCATCTCCTG CACTGGGAGC AGCTCCAACA TCGGGGCAGG TTATGATGTA |
| |
| 1741 |
CACTGGTACC AGCAGCTTCC AGGAACAGCC CCCAAACTCC TCATCTATGG TAACAGCAAT |
| |
| 1801 |
CGGCCCTCAG GGGTCCCTGA CCGATTCTCT GGCTCCAAGT CTGGCACCTC AGCCTCCCTG |
| |
| 1861 |
GCCATCACTG GGCTCCAGGC TGAGGATGAG GCTGATTATT ACTGCCAGTC CTATGACAGC |
| |
| 1921 |
AGCCTGAGTG GCCTTTATGT CTTCGGAACT GGGACCAAGG TCACCGTCCT AGGTCAGCCC |
| |
| 1981 |
AAGGCCAACC CCACTGTCAC TCTGTTCCCG CCCTCCTCTG AGGAGCTCCA AGCCAACAAG |
| |
| 2041 |
GCCACACTAG TGTGTCTGAT CAGTGACTTC TACCCGGGAG CTGTGACAGT GGCCTGGAAG |
| |
| 2101 |
GCAGATAGCA GCCCCGTCAA GGCGGGAGTG GAGACCACCA CACCCTCCAA ACAAAGCAAC |
| |
| 2161 |
AACAAGTACG CGGCCAGCAG CTATCTGAGC CTGACGCCTG AGCAGTGGAA GTCCCACAGA |
| |
| 2221 |
AGCTACAGCT GCCAGGTCAC GCATGAAGGG AGCACCGTGG AGAAGACAGT GGCCCCTACA |
| |
| 2281 |
GAATGTTCAT AATAAACCGC CTCCACCGGG CGCGCCAATT CTATTTCAAG GAGACAGTCA |
| |
| 2341 |
TAATGAAATA CCTATTGCCT ACGGCAGCCG CTGGATTGTT ATTACTCGCG GCCCAGCCGG |
| |
| 2401 |
CCATGGCCGA AGTTCAATTG TTAGAGTCTG GTGGCGGTCT TGTTCAGCCT GGTGGTTCTT |
| |
| 2461 |
TACGTCTTTC TTGCGCTGCT TCCGGATTCA CTTTCTCTTC GTACGCTATG TCTTGGGTTC |
| |
| 2521 |
GCCAAGCTCC TGGTAAAGGT TTGGAGTGGG TTTCTGCTAT CTCTGGTTCT GGTGGCAGTA |
| |
| 2581 |
CTTACTATGC TGACTCCGTT AAAGGTCGCT TCACTATCTC TAGAGACAAC TCTAAGAATA |
| |
| 2641 |
CTCTCTACTT GCAGATGAAC AGCTTAAGGG CTGAGGACAC TGCAGTCTAC TATTGCGCTA |
| |
| 2701 |
AAGACTATGA AGGTACTGGT TATGCTTTCG ACATATGGGG TCAAGGTACT ATGGTCACCG |
| |
| 2761 |
TCTCTAGTGC CTCCACCAAG GGCCCATCGG TCTTCCCCCT GGCACCCTCC TCCAAGAGCA |
| |
| 2821 |
CCTCTGGGGG CACAGCGGCC CTGGGCTGCC TGGTCAAGGA CTACTTCCCC GAACCGGTGA |
| |
| 2881 |
CGGTGTCGTG GAACTCAGGC GCCCTGACCA GCGGCGTCCA CACCTTCCCG GCTGTCCTAC |
| |
| 2941 |
AGTCTAGCGG ACTCTACTCC CTCAGCAGCG TAGTGACCGT GCCCTCTTCT AGCTTGGGCA |
| |
| 3001 |
CCCAGACCTA CATCTGCAAC GTGAATCACA AGCCCAGCAA CACCAAGGTG GACAAGAAAG |
| |
| 3061 |
TTGAGCCCAA ATCTTGTGCG GCCGCTCATC ACCACCATCA TCACTCTGCT GAACAAAAAC |
| |
| 3121 |
TCATCTCAGA AGAGGATCTG AATGGTGCCG CAGATATCAA CGATGATCGT ATGGCTGGCG |
| |
| 3181 |
CCGCTGAAAC TGTTGAAAGT TGTTTAGCAA AACCCCATAC AGAAAATTCA TTTACTAACG |
| |
| 3241 |
TCTGGAAAGA CGACAAAACT TTAGATCGTT ACGCTAACTA TGAGGGTTGT CTGTGGAATG |
| |
| 3301 |
CTACAGGCGT TGTAGTTTGT ACTGGTGACG AAACTCAGTG TTACGGTACA TGGGTTCCTA |
| |
| 3361 |
TTGGGCTTGC TATCCCTGAA AATGAGGGTG GTGGCTCTGA GGGTGGCGGT TCTGAGGGTG |
| |
| 3421 |
GCGGTTCTGA GGGTGGCGGT ACTAAACCTC CTGAGTACGG TGATACACCT ATTCCGGGCT |
| |
| 3481 |
ATACTTATAT CAACCCTCTC GACGGCACTT ATCCGCCTGG TACTGAGCAA AACCCCGCTA |
| |
| 3541 |
ATCCTAATCC TTCTCTTGAG GAGTCTCAGC CTCTTAATAC TTTCATGTTT CAGAATAATA |
| |
| 3601 |
GGTTCCGAAA TAGGCAAGGG GCATTAACTG TTTATACGGG CACTGTTACT CAAGGCACTG |
| |
| 3661 |
ACCCCGTTAA AACTTATTAC CAGTACACTC CTGTATCATC AAAAGCCATG TATGACGCTT |
| |
| 3721 |
ACTGGAACGG TAAATTCAGA GACTGCGCTT TCCATTCTGG CTTTAATGAA GATCCATTCG |
| |
| 3781 |
TTTGTGAATA TCAAGGCCAA TCGTCTGACC TGCCTCAACC TCCTGTCAAT GCTGGCGGCG |
| |
| 3841 |
GCTCTGGTCG TGGTTCTGGT GGCGGCTCTG AGGGTGGTGG CTCTGAGGGT GGCGGTTCTG |
| |
| 3901 |
AGGGTGGCGG CTCTGAGGGA GGCGGTTCCG GTGGTGGCTC TGGTTCCGGT GATTTTGATT |
| |
| 3961 |
ATGAAAAGAT GGCAAACGCT AATAAGGGGG CTATGACCGA AAATGCCGAT GAAAACGCGC |
| |
| 4021 |
TACAGTCTGA CGCTAAAGGC AAACTTGATT CTGTCGCTAC TGATTACGGT GCTGCTATCG |
| |
| 4081 |
ATGGTTTCAT TGGTGACGTT TCCGGCCTTG CTAATGGTAA TGGTGCTACT GGTGATTTTG |
| |
| 4141 |
CTGGCTCTAA TTCCCAAATG GCTCAAGTCG GTGACGGTGA TAATTCACCT TTAATGAATA |
| |
| 4201 |
ATTTCCGTCA ATATTTACCT TCCCTCCCTC AATCGGTTGA ATGTCGCCCT TTTGTCTTTA |
| |
| 4261 |
GCGCTGGTAA ACCATATGAA TTTTCTATTG ATTGTGACAA AATAAACTTA TTCCGTGGTG |
| |
| 4321 |
TCTTTGCGTT TCTTTTATAT GTTGCCACCT TTATGTATGT ATTTTCTACG TTTGCTAACA |
| |
| 4381 |
TACTGCGTAA TAAGGAGTCT TAATCATGCC AGTTCTTTTG GGTATTCCGT TATTATTGCG |
| |
| 4441 |
TTTCCTCGGT TTCCTTCTGG TAACTTTGTT CGGCTATCTG CTTACTTTTC TTAAAAAGGG |
| |
| 4501 |
CTTCGGTAAG ATAGCTATTG CTATTTCATT GTTTCTTGCT CTTATTATTG GGCTTAACTC |
| |
| 4561 |
AATTCTTGTG GGTTATCTCT CTGATATTAG CGCTCAATTA CCCTCTGACT TTGTTCAGGG |
| |
| 4621 |
TGTTCAGTTA ATTCTCCCGT CTAATGCGCT TCCCTGTTTT TATGTTATTC TCTCTGTAAA |
| |
| 4681 |
GGCTGCTATT TTCATTTTTG ACGTTAAACA AAAAATCGTT TCTTATTTGG ATTGGGATAA |
| |
| 4741 |
ATAATATGGC TGTTTATTTT GTAACTGGCA AATTAGGCTC TGGAAAGACG CTCGTTAGCG |
| |
| 4801 |
TTGGTAAGAT TCAGGATAAA ATTGTAGCTG GGTGCAAAAT AGCAACTAAT CTTGATTTAA |
| |
| 4861 |
GGCTTCAAAA CCTCCCGCAA GTCGGGAGGT TCGCTAAAAC GCCTCGCGTT CTTAGAATAC |
| |
| 4921 |
CGGATAAGCC TTCTATATCT GATTTGCTTG CTATTGGGCG CGGTAATGAT TCCTACGATG |
| |
| 4981 |
AAAATAAAAA CGGCTTGCTT GTTCTCGATG AGTGCGGTAC TTGGTTTAAT ACCCGTTCTT |
| |
| 5041 |
GGAATGATAA GGAAAGACAG CCGATTATTG ATTGGTTTCT ACATGCTCGT AAATTAGGAT |
| |
| 5101 |
GGGATATTAT TTTTCTTGTT CAGGACTTAT CTATTGTTGA TAAACAGGCG CGTTCTGCAT |
| |
| 5161 |
TAGCTGAACA TGTTGTTTAT TGTCGTCGTC TGGACAGAAT TACTTTACCT TTTGTCGGTA |
| |
| 5221 |
CTTTATATTC TCTTATTACT GGCTCGAAAA TGCCTCTGCC TAAATTACAT GTTGGCGTTG |
| |
| 5281 |
TTAAATATGG CGATTCTCAA TTAAGCCCTA CTGTTGAGCG TTGGCTTTAT ACTGGTAAGA |
| |
| 5341 |
ATTTGTATAA CGCATATGAT ACTAAACAGG CTTTTTCTAG TAATTATGAT TCCGGTGTTT |
| |
| 5401 |
ATTCTTATTT AACGCCTTAT TTATCACACG GTCGGTATTT CAAACCATTA AATTTAGGTC |
| |
| 5461 |
AGAAGATGAA ATTAACTAAA ATATATTTGA AAAAGTTTTC TCGCGTTCTT TGTCTTGCGA |
| |
| 5521 |
TTGGATTTGC ATCAGCATTT ACATATAGTT ATATAACCCA ACCTAAGCCG GAGGTTAAAA |
| |
| 5581 |
AGGTAGTCTC TCAGACCTAT GATTTTGATA AATTCACTAT TGACTCTTCT CAGCGTCTTA |
| |
| 5641 |
ATCTAAGCTA TCGCTATGTT TTCAAGGATT CTAAGGGAAA ATTAATTAAT AGCGACGATT |
| |
| 5701 |
TACAGAAGCA AGGTTATTCA CTCACATATA TTGATTTATG TACTGTTTCC ATTAAAAAAG |
| |
| 5761 |
GTAATTCAAA TGAAATTGTT AAATGTAATT AATTTTGTTT TCTTGATGTT TGTTTCATCA |
| |
| 5821 |
TCTTCTTTTG CTCAGGT0AT TGAAATGAAT AATTCGCCTC TGCGCGATTT TGTAACTTGG |
| |
| 5881 |
TATTCAAAGC AATCAGGCGA ATCCGTTATT GTTTCTCCCG ATGTAAAAGG TACTGTTACT |
| |
| 5941 |
GTATATTCAT CTGACGTTAA ACCTGAAAAT CTACGCAATT TCTTTATTTC TGTTTTACGT |
| |
| 6001 |
GCTAATAATT TTGATATGGT TGGTTCAATT CCTTCCATAA TTCAGAAGTA TAATCCAAAC |
| |
| 6061 |
AATCAGGATT ATATTGATGA ATTGCCATCA TCTGATAATC AGGAATATGA TGATAATTCC |
| |
| 6121 |
GCTCCTTCTG GTGGTTTCTT TGTTCCGCAA AATGATAATG TTACTCAAAC TTTTAAAATT |
| |
| 6181 |
AATAACGTTC GGGCAAAGGA TTTAATACGA GTTGTCGAAT TGTTTGTAAA GTCTAATACT |
| |
| 6241 |
TCTAAkTCCT CAAATGTATT ATCTATTGAC GGCTCTAATC TATTAGTTGT TTCTGCACCT |
| |
| 6301 |
AAAGATATTT TAGATAACCT TCCTCAATTC CTTTCTACTG TTGATTTGCC AACTGACCAG |
| |
| 6361 |
ATATTGATTG AGGGTTTGAT ATTTGAGGTT CAGCAAGGTG ATGCTTTAGA TTTTTCATTT |
| |
| 6421 |
GCTGCTGGCT CTCAGCGTGG CACTGTTGCA GGCGGTGTTA ATACTGACCG CCTCACCTCT |
| |
| 6481 |
GTTTTATCTT CTGCTGGTGG TTCGTTCGGT ATTTTTAATG GCGATGTTTT AGGGCTATCA |
| |
| 6541 |
GTTCGCGCAT TAAAGACTAA TAGCCATTCA AAAATATTGT CTGTGCCACG TATTCTTACG |
| |
| 6601 |
CTTTCAGGTC AGAAGGGTTC TATCTCTGTT GGCCAGAATG TCCCTTTTAT TACTGGTCGT |
| |
| 6661 |
GTGACTGGTG AATCTGCCAA TGTAAATAAT CCATTTCAGA CGATTGAGCG TCAAAATGTA |
| |
| 6721 |
GGTATTTCCA TGAGCGTTTT TCCTGTTGCA ATGGCTGGCG GTAATATTGT TCTGGATATT |
| |
| 6781 |
ACCAGCAAGG CCGATAGTTT GAGTTCTTCT ACTCAGGCAA GTGATGTTAT TACTAATCAA |
| |
| 6841 |
AGAAGTATTG CTACAACGGT TAATTTGCGT GATGGACAGA CTCTTTTACT CGGTGGCCTC |
| |
| 6901 |
ACTGATTATA AAAACACTTC TCAAGATTCT GGCGTACCGT TCCTGTCTAA AATCCCTTTA |
| |
| 6961 |
ATCGGCCTCC TGTTTAGCTC CCGCTCTGAT TCCAACGAGG AAAGCACGTT ATACGTGCTC |
| |
| 7021 |
GTCAAAGCAA CCATAGTACG CGCCCTGTAG CGGCGCATTA AGCGCGGCGG GTGTGGTGGT |
| |
| 7081 |
TACGCGCAGC GTGACCGCTA CACTTGCCAG CGCCCTAGCG CCCGCTCCTT TCGCTTTCTT |
| |
| 7141 |
CCCTTCCTTT CTCGCCACGT TCGCCGGCTT TCCCCGTCAA GCTCTAAATC GGGGGCTCCC |
| |
| 7201 |
TTTAGGGTTC CGATTTAGTG CTTTACGGCA CCTCGACCCC AAAAAACTTG ATTTGGGTGA |
| |
| 7261 |
TGGTTCACGT AGTGGGCCAT CGCCCTGATA GACGGTTTTT CGCCCTTTGA CGTTGGAGTC |
| |
| 7321 |
CACGTTCTTT AATAGTGGAC TCTTGTTCCA AACTGGAACA ACACTCAACC CTATCTCGGG |
| |
| 7381 |
CTATTCTTTT GATTTATAAG GGATTTTGCC GATTTCGGAA CCACCATCAA ACAGGATTTT |
| |
| 7441 |
CGCCTGCTGG GGCAAACCAG CGTGGACCGC TTGCTGCAAC TCTCTCAGGG CCAGGCGGTG |
| |
| 7501 |
AAGGGCAATC AGCTGTTGCC CGTCTCACTG GTGAAAAGAA AAACCACCCT GGATCCAAGC |
| |
| 7561 |
TTGCAGGTGG CACTTTTCGG GGAAATGTGC GCGGAACCCC TATTTGTTTA TTTTTCTAAA |
| |
| 7621 |
TACATTCAAA TATGTATCCG CTCATGAGAC AATAACCCTG ATAAATGCTT CAATAATATT |
| |
| 7681 |
GAAAAAGGAA GAGTATGAGT ATTCAACATT TCCGTGTCGC CCTTATTCCC TTTTTTGCGG |
| |
| 7741 |
CATTTTGCCT TCCTGTTTTT GCTCACCCAG AAACGCTGGT GAAAGTAAAA GATGCTGAAG |
| |
| 7801 |
ATCAGTTGGG CGCACGAGTG GGTTACATCG AACTGGATCT CAACAGCGGT AAGATCCTTG |
| |
| 7861 |
AGAGTTTTCG CCCCGAAGAA CGTTTTCCAA TGATGAGCAC TTTTAAAGTT CTGCTATGTC |
| |
| 7921 |
ATACACTATT ATCCCGTATT GACGCCGGGC AAGAGCAACT CGGTCGCCGG GCGCGGTATT |
| |
| 7981 |
CTCAGAATGA CTTGGTTGAG TACTCACCAG TCACAGAAAA GCATCTTACG GATGGCATGA |
| |
| 8041 |
CAGTAAGAGA ATTATGCAGT GCTGCCATAA CCATGAGTGA TAACACTGCG GCCAACTTAC |
| |
| 8101 |
TTCTGACAAC GATCGGAGGA CCGAAGGAGC TAACCGCTTT TTTGCACAAC ATGGGGGATC |
| |
| 8161 |
ATGTAACTCG CCTTGATCGT TGGGAACCGG AGCTGAATGA AGCCATACCA AACGACGAGC |
| |
| 8221 |
GTGACACCAC GATGCCTGTA GCAATGCCAA CAACGTTGCG CAAACTATTA ACTGGCGAAC |
| |
| 8281 |
TACTTACTCT AGCTTCCCGG CAACAATTAA TAGACTGGAT GGAGGCGGAT AAAGTTGCAG |
| |
| 8341 |
GACCACTTCT GCGCTCGGCC CTTCCGGCTG GCTGGTTTAT TGCTGATAAA TCTGGAGCCG |
| |
| 8401 |
GTGAGCGTGG GTCTCGCGGT ATCATTGCAG CACTGGGGCC AGATGGTAAG CCCTCCCGTA |
| |
| 8461 |
TCGTAGTTAT CTACACGACG GGGAGTCAGG CAACTATGGA TGAACGAAAT AGACAGATCG |
| |
| 8521 |
CTGAGATAGG TGCCTCACTG ATTAAGCATT GGTAACTGTC AGACCAAGTT TACTCATATA |
| |
| 8581 |
TACTTTAGAT TGATTTAAAA CTTCATTTTT AAATTTAAAG GATCTAGGTG AAGATCCTTT |
| |
| 8641 |
TTGATAATCT CATGACCAAA ATCCCTTAAC GTGAGTTTTC GTTCCACTGT ACGTAAGACC |
| |
| 8701 |
CCCAAGCTTG TCGACTGAAT GGCGAATGGC GCTTTGCCTG GTTTCCGGCA CCAGAAGCGG |
| |
| 8761 |
TGCCGGAAAG CTGGCTGGAG TGCGATCTTC CTGAGGCCGA TACTGTCGTC GTCCCCTCAA |
| |
| 8821 |
ACTGGCAGAT GCACGGTTAC GATGCGCCCA TCTACACCAA CGTAACCTAT CCCATTACGG |
| |
| 8881 |
TCAATCCGCC GTTTGTTCCC ACGGAGAATC CGACGGGTTG TTACTCGCTC ACATTTAATG |
| |
| 8941 |
TTGATGAAAG CTGGCTACAG GAAGGCCAGA CGCGAATTAT TTTTGATGGC GTTCCTATTG |
| |
| 9001 |
GTTAAAAAAT GAGCTGATTT AACAAAAATT TAACGCGAAT TTTAACAAAA TATTAACGTT |
| |
| 9061 |
TACAATTTAA ATATTTGCTT ATACAATCTT CCTGTTTTTG GGGCTTTTCT GATTATCAAC |
| |
| 9121 |
CGGGGTACAT ATGATTGACA TGCTAGTTTT ACGATTACCG TTCATCGATT CTCTTGTTTG |
| |
| 9181 |
CTCCAGACTC TCAGGCAATG ACCTGATAGC CTTTGTAGAT CTCTCAAAAA TAGCTACCCT |
| |
| 9241 |
CTCCGGCATG AATTTATCAG CTAGAACGGT TGAATATCAT ATTGATGGTG ATTTGACTGT |
| |
| 9301 |
CTCCGGCCTT TCTCACCCTT TTGAATCTTT ACCTACACAT TACTCAGGCA TTGCATTTAA |
| |
| 9361 |
AATATATGAG GGTTCTAAAA ATTTTTATCC TTGCGTTGAA ATAAAGGCTT CTCCCGCAAA |
| |
| 9421 |
AGTATTACAG GGTCATAATG TTTTTGGTAC AACCGATTTA GCTTTATGCT CTGAGGCTTT |
| |
| 9481 |
ATTGCTTAAT TTTGCTAATT CTTTGCCTTG CCTGTATGAT TTATTGGATG TT |
|
| TABLE 22 |
|
|
| Primers used in RACE amplification: |
|
|
| Heavy chain |
|
|
| Hucμ-FOR (1st PCR) |
5′-TGG AAG AGG CAC GTT CTT TTC TTT-3′ |
| |
| HuCμ-Nested (2nd PCR) |
5′-CTT TTC TTT GTT GCC GTT GGG GTG-3′ |
| |
| Kappa light chain |
| HuCkFor (1st PCR) |
5′-ACA CTC TCC CCT GTT GAA GCT CTT-3′ |
| |
| HuCkForAscI (2nd PCR) |
5′-ACC GCC TCC ACC GGG CGC GCC TTA TTA ACA CTC TCC CCT GTT GAA GCT CTT-3′ |
| |
| Lamba light chain |
| HuClambdaFor (1st PCR) |
| HuCL2-FOR |
5′-TGA ACA TTC TGT AGG GGC CAC TG-3′ |
| |
| HuCL7-FOR |
5′-AGA GCA TTC TGC AGG GGC CAC TG-3′ |
| |
| HuClambdaForAscI (2nd PCR) |
| HuCL2-FOR-ASC |
5′-ACC GCC TCC ACC GGG CGC GCC TTA TTA TGA ACA TTC |
|
TGT AGG GGC CAC TG-3′ |
| |
| HuCL7-FOR-ASC |
5′-ACC GCC TCC ACC GGG CGC GCC TTA TTA AGA GCA TTC |
|
TGC AGG GGC CAC TG-3′ |
| |
| GeneRAcer |
5′ Primers provided with the kit (Invitrogen) |
| 5′A 1st PCR |
5′CGACTGGAGCACGAGGACACTGA 3′ |
| |
| 5′NA 2nd pCR |
5′GGACACTGACATGGACTGAAGGAGTA-3′ |
|
| TABLE 23 |
|
|
| ONs used in Capture of kappa light chains using CJ method and BsmAI |
|
|
| REdapters (6) |
|
|
| ON_20SK15012 |
gggAggATggAgAcTgggTc |
| |
| ON_20SK15L12 |
gggAAgATggAgAcTgggTc |
| |
| ON_20SK15A17 |
gggAgAgTggAgAcTgAgTc |
| |
| ON_20SK15A27 |
gggTgccTggAgAcTgcgTc |
| |
| ON_20SK15A11 |
gggTggcTggAgAcTgcgTc |
| |
| ON_20SK15B |
gggAgTcTggAgAcTgggTc |
| |
| Bridges (6) |
| kapbri1012 |
gggAggATggAgAcTgggTcATcTggATgTcTTgTgcAcTgTgAcAgAgg |
| |
| kapbrilL12 |
gggAAgATggAgAcTgggTcATcTggATgTcTTgTgcAcTgTgAcAgAgg |
| |
| kapbrilA17 |
gggTgccTggAgAcTgggTcATcTggATgTcTTgTgcAcTgTgAcAgAgg |
| |
| kapbrilA27 |
gggTgccTggAgAcTgggTcATcTggATgTcTTgTgcAcTgTgAcAgAgg |
| |
| kapbrilA11 |
gggTggcTggAgAcTgggTcATcTggATgTcTTgTgcAcTgTgAcAgAgg |
| |
| kapbri1B3 |
gggAgTcTggAgAcTgggTcATcTggATgTcTTgTgcAcTgTgAcAgAgg |
| |
| Extender (5′ biotinylated) |
| kapextlbio |
ccTcTgTcAcAgTgcAcAAgAcATccAgATgAcccAgTcTcc |
| |
| Primers |
| kaPCRt1 |
ccTcTgTcAcAgTgcAcAAgAc |
| |
| kapfor |
5′-aca ctc tcc cct gtt gaa gct ctt-3′ |
|
All ONs are written 5′ to 3′.
|
| TABLE 24 |
|
|
| PCR program for amplification of kappa DNA |
|
|
|
95° C. |
5 minutes |
|
95° C. |
15 seconds |
|
65° C. |
30 seconds |
|
72° C. |
1 minute |
|
72° C. |
7 minutes |
|
4° C. |
hold |
|
Reagents (100 ul reaction): |
|
Template |
50 ng |
|
10x turbo PCR buffer |
1x |
|
turbo Pfu |
4U |
|
dNTPs |
200 μM each |
|
kaPCRt1 |
300 nM |
|
kapfor |
300 nM |
|
|
| TABLE 25 |
|
|
| h3401-h2 captured Via Cl with BsmAI |
|
|
| ! |
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 |
| ! |
S A Q D I Q M T Q S P A T L S |
|
aGT GCA Caa gac atc cag atg ace cag tct cca gcc acc ctg tct |
| ! |
ApaLI... a gcc acc ! L25,L6,L20,L2,L16,A11 |
| ! |
Extender.................................Bridge... |
| |
| ! |
16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 |
| ! |
I V S P G E R A T L S C R A S Q |
|
gtg tct cca ggg gaa agg gcc acc ctc ttc tgc agg gcc agt cag |
| |
| ! |
31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 |
| ! |
S V S N N L A W Y Q Q K P G Q |
|
agt gtt agt aac aac tta gcc tgg tac cag cag aaa cct ggc cag |
| |
| ! |
46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 |
| ! |
V P R L L I Y G A S T R A T D |
|
gtt ccc agg ctc ctc atc tat ggt gca ttc acc agg gcc act gat |
| |
| ! |
61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 |
| ! |
I P A R F S G S G S G T D F T |
|
atc cca gcc agg ttc agt ggc agt ggg tct ggg aca gac ttc act |
| |
| ! |
76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 |
| ! |
L T I S R L E P E D F A V Y Y |
|
ctc acc atc agc aga ctg gag cct gaa gat ttt gca gtg tat tac |
| |
| ! |
91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 |
| ! |
C Q R Y G S S P G W T F G Q G |
|
tgt cag cgg tat ggt agc tca ccg ggg tgg acg ttc ggc caa ggg |
| |
| ! |
106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 |
| ! |
T K V E I K R T V A A P S V F |
|
acc aag gtg gaa atc aaa cga act gtg gct gca cca tct gtc ttc |
| |
| ! |
121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 |
| ! |
I F P P S D E Q L K S G T A S |
|
atc ttc ccg cca tct gat gag cag ttg aaa tct gga act gcc tct |
| |
| ! |
136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 |
| ! |
V V C L L N N F Y P R E A K V |
|
gtt gtg tgc ctg clg aat aac ttc tat ccc aga gag gcc aaa gta |
| |
| ! |
151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 |
| ! |
Q W K V D N A L Q S G N S Q E |
|
cag tgg aag gtg gat aac gcc ctc caa tcg ggt aac ttc cag gag |
| |
| ! |
166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 |
| ! |
S V T E Q D S K D S T Y S L S |
|
agt gtc aca gag cag gac agc aag gac agc acc tac agc ctc agc |
| |
| ! |
181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 |
| ! |
S T L T L S K A D Y E K H K V |
|
agc acc ctg acg ctg agc aaa gca gac tac gag aaa cac aaa gtc |
| |
| ! |
196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 |
| ! |
Y A C E V T H Q G L S S P V I |
|
tac gcc tgc gaa gtc acc cat cag ggc ctg agc tcg cct gtc aca |
| |
| ! |
211 212 213 214 215 216 217 218 219 220 221 222 223 |
| ! |
K S F N K G E C K G E F A |
|
aag agc ttc aac aaa gga gag tgt aag ggc gaa ttc gc..... |
|
| TABLE 26 |
|
|
| h3401-d8 KAPPA captured with CJ and BsmAI |
|
|
| ! |
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 |
|
| ! |
S A Q D I Q M T Q S P A T L S |
|
aGT GCA Caa gac atc cag atg acc cag tct cct gcc acc ctg tct |
| ! |
ApaLI...Extender...........................a gcc acc ! L25,L6,L20,L2,L16,A11 |
| ! |
A GCC ACC CTG TCT ! L2 |
| |
| ! |
16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 |
| ! |
V S P G E R A T L S C R A S Q |
|
gtg tct cca ggt gaa aga gcc acc dc ttc tgc agg gcc agt cag |
| ! |
GTG TCT CCA GGG GAA AGA GCC ACC CTC TCC TGC ! L2 |
| |
| ! |
31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 |
| ! |
N L L S N L A W Y Q Q K P G Q |
|
aat cct ctc agc aac tta gcc tgg tac cag cag aaa cct ggc cag |
| |
| ! |
46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 |
| ! |
A P R L L I Y G A S T G A I G |
|
gct ccc agg ctc ctc atc tat ggt gct ttc acc ggg gcc att ggt |
| |
| ! |
61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 |
| ! |
I P A R F S G S G S G T E F I |
|
atc cca gcc agg ttc agt ggc agt ggg tct ggg aca gag ttc act |
| |
| ! |
76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 |
| ! |
L T I S S L Q S E D F A V Y F |
|
ctc acc atc agc agc ctg cag tct gaa gat ttt gca gtg tat ttc |
| |
| ! |
91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 |
| ! |
C Q Q Y G T S P P T F G G G I |
|
tgt cag cag tat ggt acc tca ccg ccc act ttc ggc gga ggg acc |
| |
| ! |
106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 |
| ! |
K V E I K R T V A A P S V F I |
|
aag gtg gag atc aaa cga act gtg gct gca cca tct gtc ttc atc |
| |
| ! |
121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 |
| ! |
F P P S D E Q L K S G T A S V |
|
ttc ccg cca tct gat gag cag ttg aaa tct gga act gcc tct gtt |
| |
| ! |
136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 |
| ! |
V C P L N N F Y P R E A K V Q |
|
gtg tgc ccg ctg aat aac ttc tat ccc aga gag gcc aaa gta cag |
| |
| ! |
151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 |
| ! |
W K V D N A L Q S G N S Q E S |
|
tgg aag gtg gat aac gcc ctc caa tcg ggt aac ttc cag gag agt |
| |
| ! |
166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 |
| ! |
V T E Q D N K D S T Y S L S S |
|
gtc aca gag cag gac aac aag gac agc acc tac agc ctc agc agc |
| |
| ! |
181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 |
| ! |
T L T L S K V D Y E K H E Y |
|
acc ctg acg ctg agc aaa gta gac tac gag aaa cac gaa gtc tac |
| |
| ! |
196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 |
| ! |
A C E V T H Q G L S S P V T K |
|
gcc tgc gaa gtc acc cat cag ggc ctt agc tcg ccc gtc acg aag |
| |
| ! |
211 212 213 214 215 216 217 218 219 220 221 222 223 |
| ! |
S F N R G E C K K E F V |
|
agc ttc aac agg gga gag tgt aag aaa gaa ttc gtt t |
|
| TABLE 27 |
|
|
| V3-23 VH framework with variegated codons shown |
|
|
| ! |
|
|
| ! |
17 18 19 20 21 22 |
| ! |
A Q P A M A |
|
5′-ctg tct gaa cG GCC cag ccG GCC atg gcc 29 |
|
3′-gac aga ctt gc cgg gtc ggc cgg tac cgg |
| ! |
Scab.........SfiI............. |
| ! |
NgoMI... |
| ! |
NcoI... |
| ! |
| ! |
FR1(DP47/V3-23)--------------- |
| ! |
23 24 25 26 27 28 29 30 |
| ! |
E V Q L L E S G |
|
gaa|gtt|CAA|TTG|tta|gag|tct|ggt| 53 |
| ! |
ctt|caa|gtt|aac|aat|ctc|aga|cca| |
| ! |
|MfeI | |
| ! |
| ! |
--------------FR1-------------------------------------------- |
| ! |
31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 |
| ! |
G G L V Q P G G S L R L S C A |
|
|ggc|ggt|ctt|gtt|cag|cct|ggt|ggt|tct|tta|cgt|ctt|tct|tgc|gct| 98 |
| ! |
|ccg|cca|gaa|caa|gtc|gga|cca|cca|aga|aat|gca|gaa|aga|acg|cga| |
| ! |
| ! |
Sites to be varied---> *** *** *** |
| ! |
----FR1---------------->|...CDR1................|---FR2------ |
| ! |
46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 |
| ! |
A S G F T F S S Y A M S W V R |
|
|gct|TCC|GGA|ttc|act|ttc|tct|tCG|TAC|Gct|atg|tct|tgg|gtt|cgC| 143 |
| ! |
|cga|agg|cct|aag|tga|aag|aga|agc|atg|cga|tac|aga|acc|caa|gcg| |
| ! |
| BspEI | |BsiWI| |BstXI. |
| ! |
| ! |
Sites to be varies-->*** *** *** |
| ! |
61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 |
| ! |
Q A P G K G L E W V S A I S G |
|
|CAa|gct|ccT|GGt|aaa|ggt|ttg|gag|tgg|gtt|tct|gct|atc|tct|ggt| 188 |
| ! |
|gtt|cga|gga|cca|ttt|cca|aac|ctc|acc|caa|aga|cga|tag|aga|cca| |
| ! |
...BstXI | |
| ! |
| ! |
*** *** |
| ! |
.....CDR2............................................|---FR3--- |
| ! |
76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 |
| ! |
S G G S T Y Y A D S V K G R F |
|
|tct|ggt|ggc|agt|act|tac|tat|gct|gac|tcc|gtt|aaa|ggt|cgc|ttc| 233 |
| ! |
|aga|cca|ccg|tca|tga|atg|ata|cga|ctg|agg|caa|ttt|cca|gcg|aag| |
| ! |
| ! |
--------FR3-------------------------------------------------- |
| ! |
91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 |
| ! |
T I S R D N S K N T L Y L Q M |
|
|act|atc|TCT|AGA|gac|aac|tct|aag|aat|act|ctc|tac|ttg|cag|atg| 278 |
| ! |
|tga|tag|aga|tct|ctg|ttg|aga|ttc|tta|tga|gag|atg|aac|gtc|tac| |
| ! |
| XbaI | |
| ! |
| ! |
---FR3----------------------------------------------------->| |
| ! |
106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 |
| ! |
N S L R A E D T A V Y Y C A K |
| ! |
|acc|agC|TTA|AGg|gct|gag|gac|aCT|GCA|Gtc|tac|tat|tgc|gct|aaa| 323 |
| ! |
|ttg|tcg|aat|tcc|cga|ctc|ctg|tga|cgt|cag|atg|ata|acg|cga|ttt| |
| ! |
|AflII | | PstI | |
| ! |
| ! |
..... CDR3.................|----FR4------------------------- |
| ! |
121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 |
| ! |
D Y E G T G Y A F D I W G Q G |
|
|gac|tat|gaa|ggt|act|ggt|tat|gct|ttc|gaC|ATA|TGg|ggt|caa|ggt| 368 |
| ! |
|ctg|ata|ctt|cca|tga|cca|ata|cga|aag|ctg|tat|acc|cca|gtt|cca| |
| ! |
| NdeI | |
| ! |
| ! |
--------------FR4---------->| |
| ! |
136 137 138 139 140 141 142 |
| ! |
T M V T V S S |
|
|act|atG|GTC|ACC|gtc|tct|agt- 389 |
| ! |
tga|tac|cag|tgg|cag|aga|tca- |
| ! |
| BstEII | |
| ! |
| ! |
143 144 145 146 147 148 149 150 151 152 |
| ! |
A S T K G P S V F P |
|
gcc tcc ace aaG GGC CCa tcg GTC TTC ccc-3′ 419 |
| ! |
cgg agg tgg ttc ccg ggt agc cag aag ggg-5′ |
| ! |
Bsp120I. BbsI...(2/2) |
| ! |
ApaI.... |
| (SFPRMET) 5′-ctg tct gaa cG GCC cag ccG-3′ |
|
| (TOPFRIA) 5′-ctg tct gaa cG GCC cag ccG GCC atg gcc- |
| |gaa|gtt|CAA|TTG|tta|gag|tct|ggt|- |
| |ggc|ggt|ctt|gtt|cag|cct|ggt|tct|tta-3′ |
| (BOTFR1B) 3′-caa|gtc|gga|cca|cca|aga|aat|gca|gaa|aga|acg|cga|- |
| |cga|agg|tga|aag|tga|aag-5′ ! bottom strand |
| (BOTFR2) 3′-acc|caa|gcg|- |
| |gtt|cga|gga|cca|ttt|cca|aac|ctc|acc|caa|aga|-5′ ! bottom strand |
| (BOTFR3) 3′-a|cga|ctg|agg|caa|ttt|cca|gcg|aag|- |
| |tga|tag|aga|tct|ctg|ttg|aga|ttc|tta|tga|gag|atg|aac|gtc|tac| |
| |ttg|tcg|aat|tgc|cga|ctc|ctg|tga-5′ |
| (F06) 5′-gC|TTA|AGg|gct|gag|gac|aCT|GCA|Gtc|tac|tat|tgc|gct|aaa|- |
| |gac|tat|gaa|ggt|act|ggt|tat|gct|ttc|gaC|ATA|TGg|ggt|c-3′ |
| (BOTFR4) 3′-cga|aag|ctg|tat|acc|cca|gtt|cca- |
| |tga|tac|cag|tgg|cag|aga|tca- |
| cgg agg tgg ttc ccg ggt agc cag aag ggg-5′ ! bottom strand |
| (BOTPRCPRIM) 3′-gg ttc ccg ggt agc cag aag ggg-5′ |
| ! |
| ! CDR1 diversity |
| ! |
| (ON-vgC1) 5′-|gct|TCC|GGA|ttc|act|ttc|tct|<|>|TAC|<|>|atg<|>|- |
| ! CDR1...................6859 |
| |tgg|gtt|cuG|CAa|gct|ccT|GG-3′ |
| ! |
| !<|> stands for an equimolar mix of {ADEFGHIKLMNPQRSTVWY}; no C |
| ! (this is not a sequence) |
| ! |
| ! CDR2 diversity |
| ! |
| (ON-vgc2) 5′-ggt|ttg|gag|tgg|gtt|tct|<2>|atc|>2>|<3>|- |
| ! CDR2............ |
| tct|ggt|ggc|<1>|act|<|>|tat|gct|gac|tcc|gtt|aaa|ggg-3′ |
| ! CDR2................................................ |
| ! <1> is an equimolar mixture of {ADEFGHIIKLMNPQRSTVWY}; no C |
| ! <2> is an equimolar mixture of {YRWVGS}; no ACDEFHIKLMNPQT |
| ! <3> is an equimolar mixture of {PS}; no ACDEFGHIKLMNQRTVWY |
|
| TABLE 28 |
|
|
| Stuffer used in VH |
|
|
| 1 |
TCCGGAGCTT CAGATCTGTT TGCCTTTTTG TGGGGTGGTG CAGATCGCGT TACGGAGATC |
|
| |
| 61 |
GACCGACTGC TTGAGCAAAA GCCACGCTTA ACTGCTGATC AGGCATGGGA TGTTATTCGC |
| |
| 121 |
CAAACCAGTC GTCAGGATCT TAACCTGAGG CTTTTTTTAC CTACTCTGCA AGCAGCGACA |
| |
| 181 |
TCTGGTTTGA CACAGAGCGA TCCGCGTCGT CAGTTGGTAG AAACATTAAC ACGTTGGGAT |
| |
| 241 |
GGCATCAATT TGCTTAATGA TGATGGTAAA ACCTGGCAGC AGCCAGGCTC TGCCATCCTG |
| |
| 301 |
AACGTTTGGC TGACCAGTAT GTTGAAGCGT ACCGTAGTGG CTGCCGTACC TATGCCATTT |
| |
| 361 |
GATAAGTGGT ACAGCGCCAG TGGCTACGAA ACAACCCAGG ACGGCCCAAC TGGTTCGCTG |
| |
| 421 |
AATATAAGTG TTGGAGCAAA AATTTTGTAT GAGGCGGTGC AGGGAGACAA ATCACCAATC |
| |
| 481 |
CCACAGGCGG TTGATCTGTT TGCTGGGAAA CCACAGCAGG AGGTTGTGTT GGCTGCGCTG |
| |
| 541 |
GAAGATACCT GGGAGACTCT TTCCAAACGC TATGGCAATA ATGTGAGTAA CTGGAAAACA |
| |
| 601 |
CCTGCAATGG CCTTAACGTT CCGGGCAAAT AATTTCTTTG GTGTACCGCA GGCCGCAGCG |
| |
| 661 |
GAAGAAACGC GTCATCAGGC GGAGTATCAA AACCGTGGAA CAGAAAACGA TATGATTGTT |
| |
| 721 |
TTCTCACCAA CGACAAGCGA TCGTCCTGTG CTTGCCTGGG ATGTGGTCGC ACCCGGTCAG |
| |
| 781 |
AGTGGGTTTA TTGCTCCCGA TGGAACAGTT GATAAGCACT ATGAAGATCA GCTGAAAATG |
| |
| 841 |
TACGAAAATT TTGGCCGTAA GTCGCTCTGG TTAACGAAGC AGGATGTGGA GGCGCATAAG |
| |
| 901 |
GAGTCGTCTA GA |
|
| TABLE 29 |
|
|
| DNA sequence of pCES5 |
|
|
| ! pCES5 6680 bases = pCes4 with stuffers in CDR1-2 and CDR3 2000.12.13 |
|
| ! |
| ! Ngene = 6680 |
| !φUseful REs (cut MAnoLI fewer than 3 times) 2000.06.05 |
| ! |
| ! Non-cutters |
| !Acc65I Ggtacc AfeI AGCgct AvrII Cctagg |
| |
| !BsaBI GATNNnnatc BsiWI Cgtacg BsmFI Nnnnnnnnnnnnnnngtccc |
| |
| !BsrGI Tgtaca BstAPI GCANNNNntgc BstBI TTcgaa |
| |
| !BstZI7I GTAtac BtrI CACgtg Ec1136I GAGctc |
| |
| !EcoRV GATatc FseI GGCCGGcc KpnI GGTACc |
| |
| !MscI TGGcca NruI TCGcga NsiI ATGCAt |
| |
| !PacI TTAATtaa PmeI GTTTaaac PmlI CACgtg |
| |
| PpuMI RGgwccy PshAI GACNNnngtc SacI GAGCTc |
| |
| !SacIl CCGCgg SbfI CCTGCAgg SexAI Accwggt |
| |
| !SgfI GCGATcgc SnaBI TACgta SpeI Actagt |
| |
| !SphI GCATGc SseS387I CCTGCAgg StuI AGGect |
| |
| !SwaI ATTTanat XmaI Cccggg |
| ! |
| ! cutters |
| ! Enzymes that cut more than 3 times |
| !ALwNI CAGNNNctg 5 |
| |
| !BsgI ctgcac 4 |
| |
| !BsrFI Rccggy 5 |
| |
| !EarI CTCTTCNnnn 4 |
| |
| !FauI nNNNNNNGCGGG 10 |
| ! |
| ! Enzymes that cut from 1 to 3 times. |
| ! |
| !EcoO109I RGgnccy 3 7 2636 4208 |
| |
| !BssSI Ctcgtg 1 12 |
| |
| !-″- Cacgag 1 1703 |
| |
| !BspHI Tcatga 3 43 148 1156 |
| |
| !AatII GACGTc 1 65 |
| |
| !BciVI GTATCCNNNNNN 2 140 1607 |
| |
| !Eco57I CTGAAG 1 301 |
| |
| !-″- cttcag 2 1349 |
| |
| !AvaI Cycgrg 3 319 2347 6137 |
| |
| !BsiHKAI GWGCWc 3 401 2321 4245 |
| |
| !HgiAI GWGCWc 3 401 2321 4245 |
| |
| !BcgI gcannnnnntcg 1 461 |
| |
| !ScaI AGTact 1 505 |
| |
| !PvuI CGATcg 3 616 3598 5926 |
| |
| !FspI TGCgca 2 763 5946 |
| |
| !BglI GCCNNNNnggc 3 864 2771 5952 |
| |
| !BpmI CTGGAG 1 898 |
| |
| !-″- ctccag 1 4413 |
| |
| !BsaI GGTCTCNnnnn 1 916 |
| |
| !AhdI GACNNNnngtc 1 983 |
| |
| !Eaml 1051 GACNNNnngtc 1 983 |
| |
| !DrdI GACNNNNnngtc 3 1768 6197 6579 |
| |
| !SapI gaagagc 1 1998 |
| |
| !PvuII CACctg 3 2054 3689 5896 |
| |
| !PfIMI CCANNNNntgg 3 2233 3943 3991 |
| |
| !HindIII Aagctt 1 2235 |
| |
| !ApaLI Gtgcac 1 2321 |
| |
| !BspMI Nnnnnnnnnngcaggt 1 2328 |
| |
| !-″- ACCTGCNNNNn 2 3460 |
| |
| !PstI CTGCAg 1 2335 |
| |
| !AccI GTmkac 2 2341 2611 |
| |
| !HincII GTYrac 2 2341 3730 |
| |
| !SalI Gtcgac 1 2341 |
| |
| !ThiI Ctcgag 1 2347 |
| |
| !XhoI Ctcgag 1 2347 |
| |
| !BbsI gtcttc 2 2383 4219 |
| |
| !BlpI GCtnagc 1 2580 |
| |
| !ElpI GCtnagc 1 2580 |
| |
| !SgrAI CRccggyg 1 2648 |
| |
| !AgeI Acggt 2 2649 4302 |
| |
| !AscI GCcgcgcc 1 2689 |
| |
| !BssHII Gcgcgc 1 2690 |
| |
| !SfiI GGCCNNNNnggcc 1 2770 |
| |
| !NaeI GCGggc 2 2776 6349 |
| |
| !NgoMIV Gccggc 2 2776 6349 |
| |
| !BtgI Ccrygg 3 2781 3553 5712 |
| |
| !DsaI Ccrygg 3 2781 3553 5712 |
| |
| !NcoI Ccatgg 1 2781 |
| |
| !StyI Ccwwagg 3 2781 4205 4472 |
| |
| !MfeI Caattg 2795 |
| |
| !BspEI Tccgga 1 2861 |
| |
| !BglII Agatct 1 2872 |
| |
| !BclI Tgatca 1 2956 |
| |
| !Bsu36I CCtnagg 3 3003 4143 4373 |
| |
| !XcmI CCANNNNNnnnntgg 1 3215 |
| |
| !MluI Acgcgt 1 3527 |
| |
| !HpaI GTTaac 1 3730 |
| |
| !XbaI Tctaga 1 3767 |
| ! |
| !AflII Cttaag 1 3811 |
| |
| !BsmI NGcattc 1 3821 |
| |
| !-″- GAATGCN 1 4695 |
| |
| !RsrII CGgwccg 1 3827 |
| |
| !NheI Gctagc 1 4166 |
| |
| !BstEII Ggtnacc 1 4182 |
| |
| !BsmBI CGTCTCNnnnn 2 4188 6625 |
| |
| !-″- Nnnnnngagacg 1 6673 |
| |
| !ApaI GGGCCc 1 4209 |
| |
| !BanII GRCCYc 3 4209 4492 6319 |
| |
| Bsp120I Gggccc 1 4209 |
| |
| !PspOMI Gggccc 1 4209 |
| |
| !BseRI NNnnnnnnnnctcctc 1 4226 |
| |
| !-″- GAGGAGNNNNNNNNN 1 4957 |
| |
| !EcoNI CCTNNnnnagg 1 4278 |
| |
| !PflFI GACNnngtc 1 4308 |
| |
| !Tth111I GACNnngtc 1 4308 |
| |
| !KasI Ggcgcc 2 4327 5967 |
| |
| !BstXI CCANNNNNNntgg 1 4415 |
| |
| !NotI GCggccgc 1 4507 |
| |
| !EagI Cggccg 1 4508 |
| |
| !BamHI Ggatcc 1 5169 |
| |
| !BspDI ATcgat 1 5476 |
| |
| !NdeI CAtatg 1 5672 |
| |
| !EcoRI Gaattc 1 5806 |
| |
| !PsiI TTAtaa 1 6118 |
| |
| !DraIII CACNNNNgtg 1 6243 |
| |
| !BsaAI YACgtr 1 6246 |
| !---------------------------------------------------------------------------- |
|
1 |
gacgaaaggg cCTCGTGata cgcctatttt tataggttaa tgtcatgata ataatggttt |
|
|
|
BssSL(1/2) |
|
61 |
cttaGACGTC aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt |
| ! |
|
AatII. |
|
121 |
tctaaataca ttcaaatatG TATCCgctca tgagacaata accctgataa atgcttcaat |
| ! |
|
BeiVI..(1 of 2) |
|
181 |
aatattgaaa aaggaagagt |
| ! Base # 201 to 1061 = ApR gene from pUC119 with some RE sites removed |
|
| ! |
| ! |
|
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 |
|
| ! |
|
fM S T Q H G R V A L A L I P F F A |
|
201 |
atg agt att caa cat ttc cgt gtc gcc ctt att ccc ttt ttt gcg |
| ! |
| ! |
|
16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 |
| ! |
|
A F C L P V F A H P E T L V K |
|
246 |
gca ttt tgc ctt ctt gtt ttt gct cac cca gaa acg ctg gtg aaa |
| ! |
| ! |
|
31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 |
| ! |
|
V K D A E D Q L G A R V G Y I |
|
291 |
gta aaa gat gct gaa gat cag ttg ggt gcc cga gtg ggt tac atc |
| ! |
|
46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 |
| ! |
|
E L D L N S G K I L E S F R P |
|
336 |
gaa ctg gat ctc aac agc ggt aag atc ctt gag agt ttt cgc ccc |
| ! |
| ! |
|
61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 |
| ! |
|
E E R F P M M S T F K V L L C |
|
381 |
gaa gaa cgt ttt cca atg atg agc act ttt aaa gtt ctg cta tgt |
| ! |
| ! |
|
76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 |
| ! |
|
G A V L S R I D A G Q E Q L G |
|
426 |
ggc gcg gta tta tcc cgt att gac gcc ggg caa gaG CAa ctc ggT |
| ! |
|
BcgI............ |
| ! |
| ! |
|
91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 |
| ! |
|
R R I H Y S Q N D L V E Y S P |
|
471 |
CGc cgc ata cac tat tct cag aat gac ttg gtt gAG TAC Tca cca |
| ! |
|
106 107 108 109 110 112 113 114 115 116 117 118 119 120 |
| ! |
|
V T E K H L T D G M T V R E L |
|
516 |
gtc aca gaa aag cat ctt acg gat ggc atg aca gta aga gaa tta |
| ! |
| ! |
|
121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 |
| ! |
|
C S A A A I T M S D N T A A N L |
|
561 |
tgc agt gct gcc ata acc atg agt gat aac act gcg gcc aac tta |
| ! |
| ! |
|
136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 |
| ! |
|
L L T T I G G P K E L T A F L |
|
606 |
ctt ctg aca aCG ATC Gga gga ccg aag gag cta acc gct ttt ttg |
| ! |
|
PvuI....(1/2) |
| ! |
| ! |
|
151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 |
| ! |
|
H N M G D H V T R L D R W E P |
|
651 |
cac aac atg ggg gat cat gta act gcg ctt gat cgt tgg gaa ccg |
| ! |
| ! |
|
166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 |
| ! |
|
E L N E A I P N D E R D T T M |
|
696 |
gag ctg aat gaa gcc ata cca aac gac gag cgt gac acc acg atg |
| ! |
| ! |
|
181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 |
| ! |
|
P V A M A T T L R K L L T G E |
|
741 |
cct gta GCA ATG gca aca acg tTG CGC Aaa cta tta act ggc gaa |
| ! |
|
BsrDI..(1/2) FspI....(1/2) |
| ! |
| ! |
|
196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 |
| ! |
|
L L T L A S R Q Q L I D W M E |
|
786 |
cta ctt act cta gct tcc cgg caa caa tta ata gac tgg atg gag |
| ! |
| ! |
|
211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 |
| ! |
|
A D K V A G A P L L R S A L P A |
|
831 |
gcg gat aaa gtt gca gga cca ctt ctg cgc tcg gcc ctt ccg gct |
| ! |
| ! |
|
226 227 228 229 230 231 232 233 234 235 236 240 |
| ! |
|
G W F I A D K S G A G E R G S |
|
876 |
ggc tgg ttt att gct gat aaa tCT GGA Gcc ggt gag cgt gGG TCT |
| ! |
|
BpmI....(1/2) BsaI.... |
| ! |
| ! |
|
241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 |
| ! |
|
R G I I A A L G P D G K P S R |
|
921 |
Cgc ggt atC ATT GCa gca ctg ggg cca gat ggt aag ccc tcc cgt |
| ! BsaI...... BsrDI...(2/2) |
|
| ! |
| ! |
|
256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 |
|
| ! |
|
I V V I Y T T G S Q A T M D E |
|
966 |
atc gta gtt atc tac acG ACg ggg aGT Cag gca act atg gat gaa |
| ! |
|
AdhI........... |
| ! |
| ! |
|
271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 |
| ! |
|
R N R Q I A E I G A S L I K H |
|
1011 |
cga aat aga cag atc gct gag ata ggt gcc tca ctg att aag cat |
| ! |
| ! |
|
286 287 |
| ! |
|
W |
|
1056 |
tgg taa |
| |
|
1062 |
ctgtcagac caagtttact |
| |
|
1081 |
catatact ttagattgattaaaacttc atttttaatt taaaaggatc taggtgaaga |
| |
|
1141 |
tccttttttga tatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagct |
| |
|
1201 |
cagacccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct |
| |
|
1261 |
gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaaagagc |
| |
|
1321 |
taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc |
| |
|
1381 |
ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc |
| |
|
1441 |
tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg |
| |
|
1501 |
ggttggactc aagacgatag ttaccggata aggcgcagcg gtcggggctga acggggggtt |
| |
|
1561 |
cgtgcataca gcccagcttg gagcgaagga cctacaccga actgagatac ctacagcgtg |
| |
|
1621 |
agcattgaga aagcgccacg cttcccgaag ggagaaaggc ggacagGTAT CCggtaagcg |
| ! |
|
BciVI..(2 of 2) |
|
1681 |
gcagggtcgg aacaggagag cgCACGAGgg agcttccagg gggaaacgcc tggtatctt |
| ! |
|
BssSI.(2/2) |
|
1741 |
atagtcctgt cgggtttcgc cacctcgac ttgagcgtcg atttttgtga tgctcgtcag |
| |
|
1801 |
ggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt |
| |
|
1861 |
gctggccttt tgctcACATG Ttctttcctg cgttatcccc tgattctgtg gataaccgta |
| ! |
|
PciI... |
|
1921 |
ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgagcgagt |
| |
|
1981 |
cagtgagcga ggaagcgGAA GAGCgcccaa tacgcaaacc gcctctccccc gcgcgttggc |
| ! |
|
SapI... |
|
2041 |
cgattcatta atgCAGCTGg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca |
| ! |
|
PvuIL.(1/3) |
|
2101 |
acgcaatTAA TGTgagttag ctcactcatt aggacccca ggcTTACAc tttatgcttc |
| ! |
|
..−35.. Plac ..−10. |
|
2161 |
cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacaCAGGA AACAGCTATG |
| ! |
|
M13Rev_seq_primer |
|
2221 |
ACcatgatta cgCCAAGCTT TGG agcctttt tttttggaga ttttcaac |
| ! |
|
PflMI..... |
| ! |
|
Hind3. |
| ! signal:linker::CLight |
|
| ! |
| ! |
|
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 |
| ! |
|
fM K K L L F A I P L V V P F Y |
|
2269 |
gtg aaa aaa tta tta ttc gca att cct tta gtt gtt cct ttc tat |
| ! |
| ! |
|
Linker........... ................End of FR4 |
| ! |
|
16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 |
| ! |
|
S H S A Q V Q L Q V D L E I K |
|
2314 |
tct cac aGT GCA Cag gtc caa CTG CAG GTC GAC CTC GAG atc aaa |
| ! |
|
ApaLI...... PstI... BspMI... |
| ! |
|
SalI... |
| ! |
|
AccI...(1/2) |
| ! |
|
HincIII.(1/2) |
| ! |
| ! Vlight domains could be cloned in as ApaLI-XhoI fragments. |
| ! VL-CL (kappa) segments can be cloned in as ApaLI-AscI fragments <-------- |
| ! |
| ! |
|
Ckappa---------------------------------------------------- |
| ! |
|
31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 |
| ! |
|
R G T V A A P S V F I F P P S |
|
2359 |
cgt gga act gtg gct gca cca tct GTC TTC atc ttc ccg cca tct |
| ! |
|
BbsI...(1/2) |
| ! |
| ! |
|
46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 |
| ! |
|
D E Q L K S G T A S V V C L L |
|
2404 |
gat gag cag ttg aaa tct gga act gcc tct gtt gtg tgc ctg ctg |
| ! |
| ! |
|
61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 |
| ! |
|
N N F Y P R E A K V Q W K V D |
|
2449 |
aat aac ttc tat ccc aga gag gcc aaa gta cag tgg aag gtg gat |
| ! |
| ! |
|
76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 |
| ! |
|
N A L Q S G N S Q E S V T E Q |
|
2494 |
aac gcc ctc caa tcg ggt aac tcc cag gag agt gtc aca gag cag |
| ! |
| ! |
|
91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 |
| ! |
|
D S K D S T Y S L S S T L T L |
|
2539 |
gac agc aag gac agc acc tac agc ctc agc acc ctg acG CTG |
| ! |
|
EspI... |
| ! |
| ! |
|
106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 |
| ! |
|
S K A D Y E K H K V Y A C E V |
|
2584 |
AGC aaa gca gac tac gag aaa cac aaa GTC TAC gcc tgc gaa gtc |
| ! ...ESpI.... AccI...(2/2) |
|
| ! |
| ! |
|
121 122 123 124 125 126 127 128 130 131 132 133 134 135 |
|
| ! |
|
T H Q G L S S P V T K S F N R |
|
2629 |
acc cat cag ggc ctg agt tCA CCG GTg aca aag agc ttc aac agg |
| ! |
|
AgeI....(1/2) |
| ! |
| ! |
|
136 137 138 139 140 |
| ! |
|
G E C |
|
2674 |
gga gag tgt taa taa GG CGCGCCaatt |
| ! |
|
AscI..... |
| ! |
|
BssHII. |
| ! |
|
2701 |
ctatttcaag gagacagtca ta |
| ! |
| ! PelB::3-23(stuffed)::CH1::III fusion gene |
|
| ! |
| ! |
|
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 |
| ! |
|
M K Y L L P T A A A G L L L L |
|
2723 |
atg aaa tac cta ttg cct acg gca gcc gct gga ttg tta tta ctc |
| ! |
| !--------------------------- |
|
| ! |
| ! |
|
16 17 18 19 20 21 22 |
| ! |
|
A A Q P A M A M A |
|
2768 |
gcG GCC cag ccG GCC atg gcc |
| ! |
|
SfiI............. |
| ! |
|
NgoMIV..(1/2) |
| ! |
|
NcoI.... |
| ! |
| ! |
|
Fr1(dp47/V3-23)--------------- |
| ! |
|
23 24 25 26 27 28 29 30 |
| ! |
|
E V Q L L E S G |
|
2789 |
gaa|gtt|CAA|TTG|tta|gag|tct|ggt| |
| ! |
|
| MfeI | |
| ! |
| ! |
|
--------------FR1-------------------------------------------- |
| ! |
|
31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 |
| ! |
|
G G L V Q P G G S L R L S C A |
|
2813 |
|ggc|ggt|ctt|gtt|cag|cct|ggt|tct|tta|cgt|ctt|tct|tgc|gct| |
| ! |
| ! |
|
----FR1----- |
| ! |
|
46 47 48 |
| ! |
|
A S G |
|
2858 |
|gct|TCC|GGA| |
| ! |
|
| BspEI | |
| ! |
| ! |
|
Stuffer for CDR1, FR2, and CDR2---------------------------------> |
| ! |
|
There are no stop codons in this stuffer. |
|
2867 |
gcttcAGATC Tgtttgcctt |
| ! |
|
BglII.. |
|
2887 |
tttgtggggt ggtgcagatc gcgttacgga gatcgaccga ctgcttgagc aaaagccacg |
| |
|
2947 |
cttaactgcT GATCAggcat gggatgttat tcgccaaaacc agtcgtcagg atcttaacct |
| ! |
|
BclI... |
|
3007 |
gaggcttttt ttacctactc tgcaagcagc gacatctggt ttgacacaga gcgatccgcg |
| |
|
3067 |
tcgtcagttg gtagaaacat taacagttg ggatggcatc aatttgctta atgatgatgg |
| |
|
3127 |
taaaacctgg cagcagccag gctctgccat cctgaacgtt tggctgacca gtatgttgaa |
| |
|
3187 |
gcgtaccgta gtggctgccg tacctatgCC Atttgataag TGGtacagcg ccagtggcta |
| ! |
|
XcmI............. |
|
3247 |
cgaaacaacc caggacggcc caactggttc gctgaatata agtgttggag caaaaaattt |
| |
|
3307 |
gtatgaggcg gtgcagggag acaaatcacc aatcccacag gcggttgatc tgtttgctgg |
| |
|
3367 |
gaaaccacag caggaggttg tgttggctgc gctggaagat acctgggaga ctctttccaa |
| |
|
3427 |
acgctatggc aataatgtga gtaactggaa aacacctgca atggccttaa cgttccgggc |
| |
|
3487 |
aaataatttc tttggtgtac cgcaggccgc agcggaagaa ACGCGTcatc aggcggagta |
| ! |
|
MluI.. |
|
3547 |
tcaaaaaccgt ggacagaaa acgatatgat tgttttctca ccaacgacaa gcgatcgtcc |
| |
|
3607 |
tgtgcttgcc tgggatgtgg tcgcacccgg tcagagtggg tttattgctc ccgatggaac |
| |
|
3667 |
agttgataag cactatgaag atcagctgaa aatgtacgaa aattttggcc gtaagtcgct |
| ! |
|
PvuII. |
|
3727 |
ctgGTTAACg aagcaggatg tggagggca taaggagtcg |
| ! |
|
HpaI |
| ! |
|
HindII(2/2) |
| ! |
| ! |
|
--------FR3-------------------------------------------------- |
| ! |
|
4 5 6 7 8 9 10 11 12 13 14 15 16 |
| ! |
|
93 94 95 96 97 98 99 100 101 102 103 104 105 |
| ! |
|
S R D N S K N T L Y L Q M |
|
3767 |
|TCT|AGA|gac|aac|tct|aag|aat|act|ctc|tac|ttg|cag|atg| |
| ! |
|
| XbaI | |
| ! |
| ! |
|
---FR3----------------------------------------------------->| |
| ! |
|
17 18 19 20 |
| ! |
|
106 107 108 109 |
| ! |
|
N S L s l s i r s g |
|
3806 |
|aac|agC|TTA|AG t ctg agc att CGG TCC G |
| ! |
|
|AfIII | RsrII.. |
| ! |
| ! |
|
q h s p t |
|
3834 |
gg caa cat tct cca aac tga ccagacga cacaaacggc |
| |
|
3872 |
ttacgctaaa tcccgcgcat gggatggtaa agaggtggcg tctttgctgg cctggactca |
| |
|
3932 |
tcagatgaag gccaaaaatt ggcaggagtg gacacagcag gcagcgaaac aagcactgac |
| |
|
3992 |
catcaactgg tactatgctg atgtaaacgg caatattggt tatgttcata ctggtgctta |
| |
|
4052 |
tccagatcgt caatcaggcc atgatccgcg attacccgtt cctggtacgg gaaaatggga |
| |
|
4112 |
ctggaaaggg ctattgcctt ttgaaatgaa ccctaaggtg tataaccccc ag |
| |
|
4164 |
aa GCTAGC ctgcggcttc |
| ! |
|
NHeI.. |
| ! |
|
4182 |
G|GTC|AAC| gtc tca agc |
| ! |
|
| BstEII | |
| ! |
| ! |
|
136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 |
| ! |
|
A S T K G P S V F P L A P S S |
|
4198 |
gcc tcc acc aag ggc cca tcg gtc ttc ccc ctg gca ccc tcc tcc |
| ! |
| ! |
|
151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 |
| ! |
|
K S T S G G T A A L G C L V K |
|
4243 |
aag agc acc tct ggg ggc aca gcg gcc ctg ggc tgc ctg gtc aag |
| ! |
| ! |
|
166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 |
| ! |
|
D Y G P E P V T V S W N S G A |
|
4288 |
gac tac ttc ccc gaa ccg gtg acg gtg tcg tgg aac tca ggc gcc |
| ! |
| ! |
|
181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 |
| ! |
|
L T S G V H T G P A V L Q S S |
|
4333 |
ctg acc agc ggc gtc cac acc ttc ccg gct gtc cta cag tcc tca |
| ! |
| ! |
|
196 197 198 199 190 200 201 202 203 204 205 206 207 208 209 210 |
| ! |
|
G L Y S L S S V V T V P S S S |
|
4378 |
gga ctc tac tcc ctc agc agc gta gtg acc gtg ccc tcc agc agc |
| ! |
| ! |
|
211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 |
| ! |
|
L G T Q T Y I C N V N H K P S |
|
4423 |
ttg ggc acc cag acc tac atc tgc aac gtg aat cac aag ccc agc |
| ! |
| ! |
|
226 227 228 229 230 231 232 233 234 235 236 237 238 |
| ! |
|
N T K V D K K V E P K S C |
|
4468 |
aac acc aag gtg gac aaG AAA GTT GAG CCC AAA TCT TGT |
| ! |
|
ON-TQHCforw...................... |
| ! |
| ! |
|
Poly His linker |
| ! |
|
139 140 141 142 143 144 145 146 147 148 149 150 |
| ! |
|
A A A H H H H H H G A A |
|
4507 |
GCG GCC GCa cat cat cat cac cat cac ggg gcc gca |
| ! |
|
NotI...... |
| ! |
|
EagI.... |
| ! |
| ! |
|
151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 |
| ! |
|
E Q K L I S E E D L N G A A |
|
4543 |
gaa caa aaa ctc atc tca gaa gag gat ctg aat ggg gcc gca tag |
| ! |
| ! |
|
Mature III------------------------------------------------>... |
| ! |
|
166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 |
| ! |
|
T V E S C L A K P H T E N S F |
|
4588 |
act gtt gaa agt tgt tta gca aaa cct cat aca gaa aat tca ttt |
| ! |
| ! |
|
181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 |
| ! |
|
T N V W K D D K T L D R Y A N |
|
4633 |
act aac gtc tgg aaa gac gac aaa act ta gat cgt tac gct aac |
| ! |
| ! |
|
196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 |
| ! |
|
Y E G C L W N A T G V V V C T |
|
4678 |
tat gag ggc tgt ctg tgG AAT GCt aca ggc gtt gtg gtt tgt act |
| ! |
|
BsmI.... |
| ! |
| ! |
|
211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 |
| ! |
|
G D E T Q C Y G T W V P I G L |
|
4723 |
ggt gac gaa act cag tgt tac ggt aca tgg gtt cct att ggg ctt |
| ! |
| ! |
|
226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 |
| ! |
|
A I P E N E G G G S E G G G S |
|
4768 |
gct atc cct gaa aat gag ggt ggt ggc tct gag ggt ggc ggt tct |
| ! |
| ! |
|
241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 |
| ! |
|
E G G G S E G G G T K P P E Y |
|
4813 |
gag ggt ggc ggt tct gag ggt ggc ggt act aaa cct cct gag tac |
| ! |
| ! |
|
256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 |
| ! |
|
G D T P I P G T Y I N P L D |
|
4858 |
ggt gat aca cct att ccg ggc tat act tat atc aac cct ctg gac |
| ! |
| ! |
|
271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 |
| ! |
|
G T Y P P G T E Q N P A N P N |
|
4903 |
ggc act tat ccg cct ggt act gag caa aac ccc gct aat cct aat |
| ! |
| ! |
|
286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 |
| ! |
|
P S L E E S Q P L N T F M F Q |
|
4948 |
cct tct ctt GAG GAG tct cag cct ctt aat act ttc atg ttt cag |
| ! |
|
BseRI..(2/2) |
| ! |
| ! |
|
301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 |
| ! |
|
N N R F R N R Q G A L T V Y T |
|
4993 |
aat aat agg ttc cga aat agg cag ggt gca tta act gtt tat acg |
| ! |
| ! |
|
316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 |
| ! |
|
G T V T Q G T D P V K T Y Y Q |
|
5038 |
ggc act gtt act caa ggc act gac ccc gtt aaa act tat tac cag |
| ! |
| ! |
|
331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 |
| ! |
|
Y T P V S S K A M Y D A Y W N |
|
5083 |
tac act cct gta tca tca aaa gcc atg tat gac gct tac tgg aac |
| ! |
| ! |
|
346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 |
| ! |
|
G K F R D C A F H S G F N E D |
|
5128 |
ggt aaa ttc aga gac tgc gct ttc cat tct ggc ttt aat gaG GAT |
| ! |
|
BamHI.. |
| ! |
| ! |
|
361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 |
| ! |
|
P F V C E Y Q G Q S S D L P Q |
|
5173 |
CCa ttc gtt tgt gaa tat caa ggc caa tcg tct gAC CTG Cct caa |
| ! |
BamHI... BspMI...(2/2) |
|
| ! |
| ! |
|
376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 |
| ! |
|
P P V N A G G G S G G G S G G |
|
5218 |
cct cct gtc aat gct ggc ggc ggc tct ggt ggt ggt tct ggt ggc |
| ! |
| ! |
|
391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 |
| ! |
|
G S E G G G S E G G G S E G G |
|
5263 |
ggc tct gag ggt ggc ggc tct gag ggt ggc ggt tct gag ggt ggc |
| ! |
| ! |
|
406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 |
| ! |
|
G S E G G G S G G G S G S G D |
|
5308 |
ggc tct gag ggt ggc ggt tcc ggt ggc ggc tcc ggt tcc ggt gat |
| ! |
| ! |
|
421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 |
| ! |
|
F D Y E K M A N A N K G A M T |
|
5353 |
ttt gat tat gaa aaa atg gca aac gct aat aag ggg gct atg acc |
| ! |
| ! |
|
436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 |
| ! |
|
E N A D E N A L Q S D A K G K |
|
5398 |
gaa aat gcc gat gaa aac gcg cta cag tct gac gct aaa ggc aaa |
| ! |
| ! |
|
451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 |
| ! |
|
L D S V A T D Y G A A I D G F |
|
5443 |
ctt gat tct gtc gct act gat tac ggt gct gct ATC GAT ggt ttc |
| ! |
|
BspDI.. |
| ! |
| ! |
|
466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 |
| ! |
|
I G D V S G L A N G N G A T G |
|
5488 |
att ggt gac gtt tcc ggc ctt gct aat ggt aat ggt gct act ggt |
| ! |
| ! |
|
481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 |
| ! |
|
D F A G S N S Q M A Q V G D G |
|
5533 |
gat ttt gct ggc tct aat tcc caa atg gct caa gtc ggt gac ggt |
| ! |
| ! |
|
496 497 498 500 501 502 503 504 505 506 507 508 509 510 |
| ! |
|
D N S P L M N N F R Q Y L P S |
|
5578 |
gat aat tca cct tta atg aat aat ttc cgt caa tat tta cct tct |
| ! |
| ! |
|
511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 |
| ! |
|
L P Q S V E C R P Y V F G A G |
|
5623 |
ttg cct cag tcg gtt gaa tgt cgc cct tat gtc ttt ggc gct ggt |
| ! |
| ! |
|
526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 |
| ! |
|
K P Y E F S I D C D K I N L F |
|
5668 |
aaa cCA TAT Gaa ttt tct att gat tgt gac aaa ata aac tta ttc |
| ! |
|
NdeI.. . |
| ! |
| ! |
|
541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 |
| ! |
|
R G V F A F L L Y V A T F M Y |
|
5713 |
cgt ggt gtc ttt gcg ttt ctt tta tat gtt gcc acc ttt atg tat |
| ! |
| ! |
|
556 557 558 559 560 561 562 563 563 564 565 566 567 568 569 570 |
| ! |
|
V F S T F A N I L R N K E S |
|
5758 |
gta ttt tcg acg ttt gct aac ata ctg cgt aat aag gag tct taa |
| ! |
| ! |
|
571 |
| ! |
| ! |
5803 |
taa GAATTC |
| ! |
|
EcoRI |
|
5812 |
actggccgt cgttttacaa cgtcgtgact gggaaaaacc tggcgttacc caattaatc |
| |
|
5871 |
gccttgcagc acatccccct ttcgccagct ggcgtaatag cgaagaggcc cgcacCGATC |
| ! |
|
PvuI.. |
|
5931 |
Gcccttccca acagtTGCGC Agcctgaatg gcgaatGGCG CCgatgcgg tattttctcc |
| ! |
...PvuI...(3/3) FspI..(2/2) KasI...(2/2) |
|
|
5991 |
ttacgcatct gtgcggtatt tcacaccgca tataaattgt aaacgttaat attttgttaa |
|
| |
|
6051 |
aattcgcgtt aaatttttgt taaatcagct cattttttaa ccaataggcc gaaatcggca |
| |
|
6111 |
aaatcccTTA TAAatcaaaa gaatagcccg agatagggtt gagtgggtt ccagtttgga |
| ! |
|
PsiI... |
|
6171 |
acaagagtcc actattaaag aacgtggact ccaacgtcaa agggcgaaaa accgtctatc |
| |
|
6231 |
agggcgatgg ccCACtacGT Gaaccatcac ccaaatcaag tttttggggg tcgaggtgcc |
| ! |
|
DraIII.... |
|
6291 |
gtaaagcact aaatcggaac cctaaaggga gcccccgatt tagagcttga cgggaaaGC |
| ! |
|
NgoMIV.. |
|
6351 |
GCCGgaacgt ggcgagaaag gaagggaaga aagcgaaagg agcgggcgct agggcgctgg |
|
6411 |
caagtgtagc ggtcacgctg cgcgtaacca ccacacccaga cgcgcttaat gcgccgctac |
|
| |
|
6471 |
agggcgcgta ctatggttgc tttgacgggt gcagtctcag tacaatctgc tctgatgccg |
| |
|
6531 |
catagttaag ccagccccga cacccgccaa cacccgctga cgcgccctga cgggcttgtc |
| |
|
6591 |
tgctcccggc atccgcttac agacaagctg tgaccgtctc cgggagctgc atgtgtcaga |
| |
|
6651 |
ggttttcacc gtcatcaccg aaacgcgcga |
|
| TABLE 30 |
|
|
| Oligonucleotides used to clone CDR1/2 diversity |
|
| All sequences are 5′ to 3′. |
|
|
| 1) ON_CDLBsp, 30 bases |
|
| A c c T c A c T g g c T T c c g g A |
| 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 |
| |
| T T c A c T T T c T c T |
| 19 20 21 22 23 24 25 26 27 28 29 30 |
| |
| 2) ON_Br12, 42 bases |
| A g A A A c c c A c T c c A A A C c |
| 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 |
| |
| T T T A c c A g g A g c T T g g c g |
| 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 |
| |
| A A c c c A |
| 37 38 39 40 41 42 |
| |
| 3) ON13 CD2Xba, 51 bases |
| g g A A g g c A g T g A T C T A g A |
| 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 |
| |
| g A T A g T g A A g c g A c c T T T |
| 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 |
| |
| A A c g g A g T c A g c A T A |
| 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 |
| |
| 4) ON_BotXba, 23 bases |
| g g A A g g c A g T g A T c T A g A |
| 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 |
| |
| g A T A g |
| 19 20 21 22 23 |
|
| TABLE 31 |
|
|
| Bridge/Extender Oligonucleotides |
|
|
| ON_Lam1aB7(rc) |
.........................GTGCTGACTCAGCCACCCTC. |
20 |
|
| |
| ON_Lam2aB7(rc) |
........................GCCCTGACTCAGCCTGCCTC. |
20 |
| |
| ON_Lam31B7(rc) |
.......................GAGCTGACTCAGGACCCTGC |
20 |
| |
| ON_Lam3rB7(cc) |
........................GAGCTGACTGAGCCACGCTC. |
20 |
| |
| ON_LamHf1cBrg(rc) |
CCTCGACAGCGAAGTGCACAGAGCGTCTTGACTGAGCC....... |
38 |
| |
| ON_LamHf1cExc |
CCTCGACAGCGAAGTGCACAGAGCGTCTTG............... |
30 |
| |
| ON_LamNf2b2Brg(rc) |
CCTCGACAGCGAAGTGCACAGAGCGCTTTGACTCAGCC....... |
38 |
| |
| ON_LamNf2b2Ext |
CCTCGACAGCGAGTGCACAGAGCGCTTTG............... |
30 |
| |
| ON_LarnHf2dBrg(rc) |
CCTCGACAGCTAAGTGCACAGAGCGCTTTGACTCAGCC....... |
38 |
| |
| ON_LamNf2dExt |
CCTCGACAGCGAAGTGCACAGAGCGCTTTG............... |
30 |
| |
| ON_LarnH3rBrg(rc) |
CCTCGACAGCGAAGTGCACAGAGCGAATTGACTCAGCC....... |
38 |
| |
| ON_LamHf3rExt |
CCTCCACAGCGAAGTGCACAGAGCCAATTG............... |
30 |
| |
| ON_LamNf3rBrg(rc) |
CCTCGACAGCGAAGTGCACAGTACGAATTGACTCAGCC....... |
38 |
| |
| ON_LemHf3rExt |
CCTCGACAGCGAAGTGCACAGTACGAATTG............... |
30 |
| |
| ON_lamPlePCR |
CCTCGACAGCGAACTGCACAG........................ |
21 |
| Consensus |
|
| TABLE 32 |
|
|
| Oligonucleotides used to make SSDNA locally |
|
| double-stranded |
|
|
| Adapters (8) |
|
|
| H43 HF3.1-02#1 |
5′-cc gtg tat tac tgt gcg aga g-3′ |
| |
| H43.77.97.1-03#2 |
5′-ct gtg tat tac tgt gcg aga g-3′ |
| |
| H43.77.97.323 #22 |
5′-cc gta tat tac tgt gcg aaa g-3′ |
| |
| H43.77.97.330 #23 |
5′-ct gtg tat tac tgt gcg aaa c-3′ |
| |
| H43.77.97.439 #44 |
5′-ct gtg tat tac tgt gcg aga c-3′ |
| |
| H43.77.97.551 #48 |
5′-cc atg tat tac tgt gcg aga c-3′ |
|
| TABLE 33 |
|
|
| Bridge/extender pairs |
|
|
| Bridges (2) |
|
| H43.XABr1 |
| 5′ggtgtagtgaTCTAGtgacaactctaagaatactctctacttgcagat |
| gaacagCTTtAGggctgaggacaCTGCAGtctactattgtgcgaga-3′ |
| |
| H43.XABr2 |
| 5′ggtgtagtgaTCTAGtgacaactctaagaatactctctacttgcagat |
| gaacagCTTtAGggctgaggacaCTGCACtctactattgtgcgaaa-3′ |
| |
| Extender |
| H-43.XAExt |
| 5′ATAgTAgAcTgcAgTgTccTcAgcccTTAAgcTgTTcATcTgcAAgTA |
| gAgAgTATTcTTAgAgTTgTcTcTAgATcAcTAcAcc-3′ |
|
|
Primers |
|
|
|
H43.XAPCR2 |
gactgggTgTAgTgATCTAg |
|
|
|
Hucmnest |
cttttctttgtgccgttggggtg |
|
|
| TABLE 35 |
|
|
| PCR program for amplification of |
| heavy chain CDR3 DNA |
|
|
| 95 degrees C. |
5 minutes |
|
| 95 degrees C. |
20 seconds |
| 60 degrees C. |
30 seconds |
repeat 20x |
| 72 degrees C. |
1 minute |
| 72 degrees C. |
7 minutes |
| 4 degrees C. |
hold |
| Reagents (100 ul reaction) |
| Template |
5 ul ligation mix |
| 10x PCR buffer |
1x |
| Taq |
5U |
| dNTPs |
200 uM each |
| MgCl2 |
2 mM |
| H43.XAPCR2-biotin |
400 nM |
| Hucmnest |
200 nM |
|
| !TABLE 36 |
|
|
| Annotated sequence of CJR DY3F7(CJR-A05) 10251 bases |
|
|
| !BclI Tgatca |
BsiWI Cgtacg |
BssSI Cacgag |
|
| |
| !BstZ17I GTAtac |
BtrI CACgrg |
EcoRV GATatc |
| |
| !FseI GGCCGGcc |
HpaI GTTaac |
MluT Acgcgt |
| |
| !PmeI GTTTaaac |
PmlI CACgtg |
PpuMI RGgwccy |
| |
| !RsrII CGgwccg |
SapI GCTCTTC |
SexAI Accwggt |
| |
| !SgfI GCGATcgc |
SgrAI CRccgggg |
SphI GCATGc |
| |
| !StuI AGGcct |
XmaI Cccggg |
| ! |
|
| ! cutters |
| ! |
| ! Enzymes that cut from 1 to 4 times and other features |
| !End of genes II and X |
|
829 |
|
| !Start gene V |
|
843 |
| !BsrGI Tgtaca |
1 |
1021 |
| !BspMI Nnnnnnnnngcaggt |
3 |
1104 5997 9183 |
| !-″- ACCTGCNNNNn |
1 |
2281 |
| !End of gene V |
|
1106 |
| !Start gene VII |
|
1108 |
| !BsaBI GATNNnnatc |
2 |
1149 3967 |
| !Start gene IX |
|
1208 |
| !End gene VII |
|
1211 |
| !SnaBI TACgta |
2 |
1268 7133 |
| !BspHI Tcatga |
3 |
1299 6085 7093 |
| !Start gene VIII |
|
1301 |
| !End gene IX |
|
1304 |
| !End gene VIII |
|
1522 |
| !Start gene III |
|
1578 |
| !EagI Cggccg |
2 |
1630 8905 |
| !XbaI Tctaga |
2 |
1643 8436 |
| !KasI Ggcgcc |
4 |
1650 8724 9039 9120 |
| !BsmI GAATGCN |
2 |
1769 9065 |
| !BseRI GAGGAGNNNNNNNNNN |
2 |
2031 8516 |
| !-″- NNnnnnnnnnctcctc |
2 |
7603 8623 |
| !AlwNI CAGNNNctg |
3 |
2210 8072 8182 |
| !BspDI ATcgat |
2 |
2520 9883 |
| !NdeI CAtatg |
3 |
2716 3796 9847 |
| !End gene III |
|
2846 |
| !Start gene VI |
|
2848 |
| !AfeI AGCgct |
1 |
3032 |
| !End gene VI |
|
3187 |
| !Start gene I |
|
3189 |
| !EarI CTCTTCNnnn |
2 |
4067 9274 |
| !-″- Nnnnngaagag |
2 |
6126 8953 |
| !PacI TTAATtaa |
1 |
4125 |
| !Start gene IV |
|
4213 |
| !End gene I |
|
4235 |
| !BsmFI Nnnnnnnnnnnnnnngtccc |
2 |
5068 9515 |
| !MscI TGGcca |
3 |
5073 7597 9160 |
| !PsiI TTAtaa |
2 |
5349 5837 |
| !End gene IV |
|
5493 |
| !Start on |
5494 |
| !NgoMIV Gccggc |
3 |
5606 8213 9315 |
| !BanII GRGCYc |
4 |
5636 8080 8606 8889 |
| !DraIII CACNNNgtg |
1 |
5709 |
| !DrdI GACNNNNnngtc |
1 |
5752 |
| !AvaI Cycgrg |
2 |
5818 7240 |
| !PvuII CAGctg |
1 |
5953 |
| !BsmBI CGTCTCNnnnn |
3 |
5964 8585 9271 |
| !End ori region |
|
5993 |
| !BamHI Ggatcc |
1 |
5994 |
| !HindIII Aagctt |
3 |
6000 7147 7384 |
| !BciVI GTATCCNNNNNN |
1 |
6077 |
| !Start bla |
|
6138 |
| !Eco57I CTGAAG |
2 |
6238 7716 |
| !SpeI Actagt |
1 |
6257 |
| !BcgI gcannnnnntcg |
1 |
6398 |
| !ScaI AGTact |
1 |
6442 |
| !PvuI CGATcg |
1 |
6553 |
| !FspI TGCgca |
1 |
6700 |
| !BglI GCCNNNNnggc |
3 |
6801 8208 8976 |
| !BsaI GGTCTCNnnnn |
1 |
6853 |
| !AhdI GACNNNnngtc |
1 |
6920 |
| !Eam1105I GACNNNnngtc |
1 |
6920 |
| !End bla |
|
6998 |
| !AccI GTmkac |
2 |
7153 8048 |
| !HincII GTYrac |
1 |
7153 |
| !SalI Gtcgac |
1 |
7153 |
| !XhoI Ctcgag |
1 |
7240 |
| !Start PlacZ region |
|
7246 |
| !End PlacZ region |
|
7381 |
| !PflMI CCANNNNntgg |
1 |
7382 |
| !RBS1 |
|
7405 |
| !start M13-iii signal seq for LC |
7418 |
|
| !ApaLI Gtgcac |
1 |
7470 |
|
| !end M13-iii signal seq |
|
7471 |
| !Start light chain kappa L20:JK |
1 |
7472 |
| !PflFI GACNnngtc |
3 |
7489 8705 9099 |
| !SbfI CCTGCAgg |
1 |
7542 |
| !PstI CTGCAg |
1 |
7543 |
| !KpnI GGTACc |
1 |
7581 |
| !XcmI CCANNNNNnnnntgg |
2 |
7585 9215 |
| !NsiI ATGCAt |
2 |
7626 9503 |
| !BsgI ctgcac |
1 |
7809 |
| !BbsI gtcttc |
2 |
7820 8616 |
| !BlpI GCtnagc |
1 |
8017 |
| !EspI GCtnagc |
1 |
8017 |
| !EcoO109I RGgnccy |
2 |
8073 8605 |
| !Ecl136I GACctc |
1 |
8080 |
| !SacT GASCTc |
1 |
8080 |
| !End light chain |
|
8122 |
| !AscI GGcgcgcc |
1 |
8126 |
| !BssHII Gcgcgc |
1 |
8127 |
| !RBS2 |
|
8147 |
| !SfiI GGCCNNNNnggcc |
1 |
8207 |
| !NcoI Ccatgg |
1 |
8218 |
| !Start 3-23, FR1 |
|
8226 |
| !MfeI Caattg |
1 |
6232 |
| !BspEI Tccgga |
1 |
8298 |
| !Start CDR1 |
|
8316 |
| !Start FR2 |
|
8331 |
| !BstXI CCANNNNNntgg |
2 |
8339 8812 |
| !EcoNI CCTNNnnnagg |
2 |
8346 8675 |
| !Start FR3 |
|
8373 |
| !XhaI Tctaga |
2 |
8436 1643 |
| !AflII Cttaag |
1 |
8480 |
| !Start CDR3 |
|
8520 |
| !AatII GACGTc |
1 |
8556 |
| !Start FR4 |
|
8562 |
| !PshAI GACNNnngcc |
2 |
8573 9231 |
| !BstEII Ggtnacc |
1 |
8579 |
| !Start CH1 |
|
8595 |
| !ApaI GGGCCc |
1 |
8606 |
| !Bsp120I Gggccc |
1 |
8606 |
| !PspOMI Gggccc |
1 |
8606 |
| !AgeI Accggt |
1 |
8699 |
| !Bsu36I CCtnagg |
2 |
8770 9509 |
| !End of CH1 |
|
8903 |
| !NotI GCggccgc |
1 |
8904 |
| !Start His6 tag |
|
8913 |
| !Start cMyc tag |
|
8931 |
| !Amber codon |
|
8982 |
| !NheI Gctagc |
1 |
8985 |
| !Start M13 III Domain 3 |
|
8997 |
| !Nrul TCGcga |
1 |
9106 |
| !BstEI TTcgaa |
1 |
9197 |
| !EcoRI Gaattc |
1 |
9200 |
| !XcmI CCANNNNNnnnntgg |
1 |
9215 |
| !BstAPI GCANNNNntgc |
1 |
9337 |
| !SacII CCGCgg |
1 |
9365 |
| !End IIIstump anchor |
|
9455 |
| !AvrII Cctagg |
1 |
9462 |
| !trp terminator |
|
9470 |
| !SwaI ATTTaaat |
1 |
9784 |
| !Start gene II |
|
9850 |
| !BglII Agatct |
1 |
9936 |
| !---------------------------------------------------------------------- |
|
|
1 |
aat gct act act att agt aga att gat gcc acc ttt tca gct cgc gcc |
|
|
49 |
cca aat gaa aat ata gct aaa cag gtt att gac cat ttg cga aat gta |
|
| |
|
97 |
tct aat ggt caa act aaa tct act cgt tcg cag aat tgg gaa tca act |
| |
|
145 |
gtt aTa tgg aat gaa act tcc aga cac cgt act tta gtt gca tat tta |
| |
|
193 |
aaa cat gtt gag cta cag caT TaT att cag caa tta agc tct aag cca |
| |
|
241 |
tcc gca aaa atg acc tct tat caa aag gag caa tta aag gta ctc tct |
| |
|
289 |
aat cct gac ctg ttg gag ttt gct tcc ggt ctg gtt cgc ttt gaa gct |
| |
|
337 |
cga att aaa acg cga tat ttg aag tct ttc ggg ctt cct ctt aat ctt |
| |
|
385 |
ttt gat gca atc cgc ttt gct tct gac tat aat agt cag ggt aaa gac |
| |
|
433 |
ctg att ttt gat tta tgg tca ttc tcg ctt tct gaa ctg ttt aaa gca |
| |
|
481 |
ttt gag ggg gat tca ATG aat att tat gac gat tcc gca gta ttg gac |
| ! |
|
Start gene x, ii continues |
|
529 |
gct atc cag tct aaa cat ttt act att acc ccc tct ggc aaa act tct |
| |
|
577 |
ttt gca aaa gcc tct cgc tat ttt ggt ttc tat cgt cgt ctg gta aac |
| |
|
625 |
gag ggt tat gac agt gtt gct ctt act acg cct cgt aat tcc ttt tgg |
| |
|
673 |
cgt tat gta tct gca tta gtt gaa tgt ggt att cct aaa tct caa ctg |
| |
|
721 |
atg aat cct tct acc tgt aat aat gtt gtt ccg tta gtt cgt ttt att |
| |
|
789 |
aac gta gat ttt tct tcc caa cgt cct gac tgg tat aat gag cca gtt |
| |
|
817 |
ctt aaa atc gca TAA |
| ! |
|
End X & II |
|
832 |
ggtaattca ca |
| ! |
| ! |
|
M1 ES Q10 T15 |
|
843 |
ATG att aaa gtc gaa act aaa oca tct caa gcc caa ttt act act cgt |
| ! |
|
Start gene V |
| ! |
| ! |
|
S17 S20 P25 E30 |
|
891 |
tct ggt gtt tct cgt cag ggc aag cct tat tca ctg aac gag cag ctt |
| ! |
| ! |
|
V35 E40 V45 |
|
939 |
cgt tac ggt gat tcg ggt aac gaa tat ccg gtt gtt gtc aag att act |
| ! |
| ! |
|
D50 A55 L60 |
|
987 |
ctt gac gaa ggc ccg cca gcc tat gcg cct ggt cTG TAC Acc gtt cat |
| ! |
|
BsrGI... |
| ! |
|
L85 V70 S75 R80 |
|
1035 |
ctg tcc tct ttc aaa gtt ggt cag ttc ggt tcc ctt atg att gac cgt |
| ! |
| ! |
|
P85 K87 end of V |
|
1083 |
ctg cgc ctc gtt ccg gct aag TAA C |
| ! |
|
1108 |
ATG gag cag gtc gcg gat ttc gac aca att tat cag gcg atg |
| ! |
|
Start gene VII |
| ! |
|
1150 |
ata caa atc tcc gtt gta ctt tgt ttc gcg ctt ggt ata atc |
| ! |
| ! |
|
VII end IX overlap. |
| ! |
|
..... S2 V3 L4 V5 S10 |
|
1192 |
gct ggg ggt caa agA TGA gt gtt tta gtg tat cct ttT gcc tct ttc gtt |
| ! |
|
End VII |
| ! |
|
|start IX |
| ! |
|
L13 W15 G20 T25 E29 |
|
1242 |
tta ggt tgg tgc ctt cgt agt ggc att acg tat ttt acc cgt tta atg gaa |
| ! |
|
1293 |
act tcc tc |
| ! |
| ! |
|
.... stop of IX, IX end VIII overlap by four bases |
|
1301 |
ATG aaa aag tct tta gtc ctc aaa gcc tcc gta gcc gtt gct acc ctc |
| ! |
|
Start signal sequence of viii. |
| ! |
|
1349 |
gtt ccg atg ctg tct ttc gct gct gag ggt gac get ccc gca aaa gcg |
| ! |
|
mature VIII ---> |
|
1397 |
gcc ttt aac tcc ctg caa gcc tca gcg acc gaa tat atc ggt tat gcg |
| |
|
1445 |
tgg gcg atg gtt gtt gtc att |
| |
|
1468 |
gtc ggc gca act atc ggt atc aag ctg ttt aag |
| ! |
| ! |
bases 1499-1539 are probable promoter for iii |
|
|
1499 |
aaa ttc acc tcg aaa gca ! 1515 |
|
| ! |
|
........... −35 .. |
| ! |
|
1517 |
agc tga oaaaccgat acaattaaag gctcctttcg |
| ! |
|
..... −10 ... |
| ! |
|
1552 |
gagccttttt ttt SCAGAt ttt ! S.D. uppercase, there may be 9 Ts |
| ! |
| ! |
|
<------ III signal sequence -----------------------------> |
| ! |
|
M K K L L F A I P L V V P F |
|
1574 |
caac GTG aaa aaa tta tta ttc gca att ccc tta gct gct cct ttc ! |
|
1620 |
| ! |
| ! |
|
Y S G A A S S H L D S A |
|
1620 |
tat tct ggc gCG GCC Gaa tca caT CTA SAc ggc gcc |
| ! |
|
EagI.... XbaI.... |
| ! |
| ! |
Domain 1 ------------------------------------------------------------ |
|
| ! |
|
A S T V K S C L A |
|
|
1656 |
gct gaa act gct gaa agt tgt tta gca |
| ! |
| ! |
|
K S H T K I S F T N V W K D D K T |
|
1693 |
aaA Tcc cat aca gaa aat tca tta aCT AAC GTC TGG AAA GAC SAC AAA ACt |
| ! |
| ! |
|
L D R Y A N Y E G S L W N A T G V |
|
1734 |
tta gat cgt tac gct aac tat gag ggC tgt ctg tgG AAT SCt aca ggc gtt |
| ! |
|
BsmI.... |
| ! |
| ! |
|
V V C T S D K T Q C Y S T W V P I |
|
1785 |
gta gtt tgt act ggt SAC GAA ACT CAG TGT TAC GGT ACA TSG STT ccc att |
| ! |
| ! |
|
G L A I P K N |
|
1836 |
ggg ctt gct atc cct gaa aat |
| ! |
|
L1 linker ------------------------------------ |
|
| ! |
|
E S S G S K G G S S |
|
|
1857 |
gag ggt ggt ggc tct gag ggt ggc ggt tct |
| ! |
| ! |
|
E G G G S K G S G T |
|
1887 |
gag ggt ggc ggt tct gag ggt ggc ggt act |
| ! |
|
Domain 2 ------------------------------------ |
|
|
1917 |
aaa cct cct gag tac ggt gat aca cct att ccg ggc tat act tat atc aac |
|
| |
|
1968 |
cct ctc gac ggc act tat ccg cct ggt act gag caa aac ccc gct aat cct |
| |
|
2019 |
aat cct tct cct GAG GAG tcc cag cct ctt aat act ttc atg ttt cag aac |
| ! |
|
BseRI.. |
|
2070 |
aat agg tcc cga aat agg cag ggg gca tta act gtt cat acg ggc acc |
| |
|
2118 |
gct act caa ggc act gac ccc gtt aaa act tac tac cag tac act cct |
| |
|
2166 |
gta tca tca aaa gcc atg tat gac gct tac tgg tac ggt aaa ttC AGA |
| ! |
|
2214 |
GAG TGc gct ttc cat tct ggc tct aac gaG gat TTa ttT gtt cgc gaa |
|
| ! |
|
AlwNI |
|
2262 |
tat caa ggc caa tcg tct gac ctg cct caa cct cct gtc aat gct |
| ! |
|
2307 |
ggc ggc ggc tct |
| ! |
start L2 ------------------------------------------------------------- |
|
|
2319 |
ggt ggt ggt tct |
|
| |
|
2331 |
ggt ggc ggc tct |
| |
|
2343 |
gag ggc ggt ggc tct gag gga ggc ggt |
| |
|
2373 |
ggt ggt ggc tct ggt ! end L2 |
| ! |
| ! |
Many published sequences of M13-derived phage have a longer linker |
|
| ! |
than shown here by repeats of the EGGGS motif two more times. |
| ! |
| ! |
Domain 3-------------------------------------------------------------- |
| ! |
|
S G D B D Y E K M A N A N K G A |
|
|
2388 |
tcc ggt gat tct gat tat gaa aag atg gca aac gct aat aag ggg gct |
| ! |
| ! |
|
M T K N A D K N A I Q S D A K G |
|
2436 |
atg acc gaa aat gcc gat gaa aac gcg cta cag tct gac gct aaa ggc |
| ! |
| ! |
|
K L D S V A T D Y C A A M D G F |
|
2484 |
aaa ctt gat tct gtc gct act gat tac ggt gct gct atc gat ggt ttc |
| ! |
| ! |
|
I C D V S G L A N G N C A T C D |
|
2532 |
att ggt gac gtt tcc ggc otc gct aat ggt ast ggt gct gct ggt gat |
| ! |
| ! |
|
F A G S N S Q I A Q V G D G D N |
|
2580 |
ttt gct ggc tct aat tcc cac atg gct caa gtc ggt gac ggt gat aat |
| ! |
| ! |
|
S P I N N B R Q V L P S I P Q |
|
2628 |
tca cct tta atg aat aat ttc cgt caa tat tta cct tcc ctc cct cac |
| ! |
| ! |
|
S V K C P P B V B C A C K P Y E |
|
2676 |
tcg gtt gaa tgt cgc cct ttt gcc ctt ggc gct ggc asa cca tat gaa |
| ! |
| ! |
|
I B S I D C D K I N L B R |
|
2724 |
ttt tct att gat tgt gac aaa ata aac tta ttc cgt |
| ! |
|
End Domain 3 |
| ! |
| ! |
|
G V B A B I I V V A T B M V V |
|
2760 |
ggc gtc ttt gcg ttt ctt tta tat gtc gcc acc ttt atg tat gta ctt |
|
| ! |
|
start transmembrane segment |
| ! |
| ! |
|
S T B A N I L |
|
2808 |
tct acg ttt gct aac ata ctg |
| ! |
| ! |
|
R N K F S |
|
2829 |
cgt aat aag gag tct TAA ! step of iii |
| ! |
|
M1 P2 V L L5 G I P L L10 L R F L G15 |
|
2847 |
tc ATG cca gtt ctt ttg ggt att ccg tca tta ttg cgt ttc ctc ggt |
| ! |
|
Start VI |
| ! |
|
2894 |
ttc ctt ctg gta act ttg ttc ggc tat ctg ctt act ttt ctt aaa aag |
| |
|
2942 |
ggc ttc ggt aag ata gct att gct att tca ttg ttt ctt gct ctt atc |
| |
|
2990 |
atc ggg ctc aac cca att ctt gtg ggc tac ctc tct gat att agc gct |
| |
|
3038 |
caa tta ccc tct gac ttt gct cag ggc gct cag tta att ctc ccg tct |
| |
|
3086 |
aat gcg ctt ccc tgt ttt tac gtc att ccc cct gta aag gcc gct act |
| |
|
3134 |
tcc att tct gac gtt aaa caa aaa atc gtt tct tat ttg gat tgg gac |
| ! |
| ! |
|
M1 A2 V3 F5 L10 G13 |
|
3182 |
aaa TAA t ATG gct gtt tat ttt gta act ggc aaa tta ggc tct gga |
| ! |
|
end VI Start gene I |
| ! |
| ! |
|
K T L V S V G K I Q D K I V A |
|
3228 |
aag acg ctc gct agc gtt ggc aag att cag gac aaa att gta gct |
| ! |
| ! |
|
G C K I A T N L D L K L Q N L |
| |
|
3273 |
ggg tgc aca cta gca act aat ctt gct tta cgg ctt ccc ccc ctc |
| ! |
|
P Q V C R F A K T P K V L K I |
|
3318 |
ccg ccc gtc ggg cgg ttc gct caa ccg cct cgc gtt cct aga ata |
| ! |
| ! |
|
P D K P S I S D L L A I G K C |
|
3363 |
ccg gct aag cct tct cta tct gct ttg ctc gct act ggg cgc ggt |
| ! |
| ! |
|
N D S V D E N K N C L L V L D |
|
3408 |
aat gct tcc tac gct gcc aat cca ccc ggc ctg ctt gtt ctc gct |
| ! |
| ! |
|
E C G T W F N T R S W N D K E |
|
3453 |
gag tgc ggt act tgg ttt aat acc cgt tct tgg aat gct aag gcc |
| ! |
| ! |
|
R Q P I I D W F L H A K K L G |
|
3498 |
agc cag ccg att gct tgg ttt cta aat gct cgt caa cta gga |
| ! |
| ! |
|
W D I I F L V Q D L S I V D K |
|
3543 |
tgg gct ctt cct ttt ctc gtt ccg gac tcc ccc cct gtt gac cac |
| ! |
| ! |
|
Q A R S A L A E H V V Y C R R |
|
3588 |
ccg gcg cgc tct gca ttc gct gcc ccc gtt gtt aat tgt cgt cgt |
| ! |
| ! |
|
L D K I T L P F V G T L Y S L |
|
3633 |
ctg gac agc ctc act tta cct ttt gtc ggt acc tta tat tct cct |
| ! |
| ! |
|
I T G S K N P L P K L H V C V |
|
3678 |
att act ggc tcg cca atg cct ctg ccc cca tta aat gtt ggc gct |
| ! |
| ! |
|
V K V G D S Q L S P T V K K N |
|
3723 |
gtt aaa tat ggc gat tct caa tta agc cct act gtt gag cgt tgg |
| ! |
| ! |
|
L Y T G K N L V N A V D T K Q |
|
3768 |
ctt tat act ggt aag aat ttg tat aac gca tac gat acc aaa cag |
| ! |
| ! |
|
A F S S N V D S G V Y S Y L T |
|
3813 |
gct ttt tct agt aat tat gat tcc ggc gtt tat tct tat tta acg |
| ! |
| ! |
|
P V L S H G R V F K P L N L G |
|
3858 |
cct tat tta tca cac ggt cgg tat ttc aaa cca tta aat tta ggt |
| ! |
| ! |
|
Q K M K L T K I V L K K F S R |
|
3903 |
cag aag atg aaa tta act aaa ata tat ctg aaa aag ttt tct cgc |
| ! |
| ! |
|
V L C L A I C F A S A F T Y S |
|
3948 |
gtt ctt tgc ctt gcg att gga ttt gca tca gca ttt aca tat agt |
| ! |
| ! |
|
V I T Q P K F F V K K V V S Q |
|
3993 |
tat aca acc caa cct aag ccg gag gct aaa aag gta gtc tct cag |
| ! |
| ! |
|
T Y D F D K F T I B S S Q K L |
|
4038 |
acc tat gat ttt gat aaa ttc act att gac tct tct cag cgt ctt |
| ! |
| ! |
|
N L S V K V V F K B S K G K L |
|
4083 |
aat cta agc tat cgc tat gtt ttc aag gat tct aag gga aaa TTA |
| ! |
|
PacI |
| ! |
| ! |
|
I N S D D L Q K Q G V S L T Y |
|
4128 |
ATT AAt agc gac gat cta cag aag caa ggt tat tca ctc aca tat |
| ! |
|
i I D L C T V S I K K G N S N E |
|
|
4173 |
att gat tta tgt act gtt tcc att aaa aaa ggt aat tca aAT Gaa |
|
| ! |
|
Start |
| 49 |
i I V K C N End of I |
|
| ! |
iv L3 L N5 V I7 N F V10 |
|
4218 |
att gtt aaa tgt aat TAA T TTT GTT |
|
|
4243 |
ttc ttg acg ttt gtt tca tca tct tct ttc gct cag gta att gaa atg |
|
| |
|
4291 |
aat aat tcg cct ctg cgc gat ttt gta act tgg tac tca aag caa tca |
| |
|
4339 |
ggc gaa tcc gtt att gtt tct ccc gat gta aaa ggt act gtt act gta |
| |
|
4387 |
aat cca tct gac gtt aaa cct gaa aat cta cgc aat tcc ctt att tct |
| |
|
4435 |
gct tta cgc gcA aac aat ctc gat atg gtA ggt tcT aAC cct tcc act |
| |
|
4483 |
att cag aag tat aat cca aac aat cag gat tat atc gat gaa ttg cca |
| |
|
4531 |
tca tct gat aat cag gaa tat gat gat aac ccc gct ccc cct ggc ggt |
| |
|
4579 |
ttc ttt gtt ccg caa aat gat aat gtt act caa act tct aaa act aat |
| |
|
4627 |
aac gct cgg gca aag gat cta ata cga gtt gtc gaa ttg ctc gta aag |
| |
|
4675 |
tct aat acc tct aaa tcc tca aat gta tta tct att gac ggc tct aat |
| |
|
4723 |
cta cta gtt gtt agt gcT cct aaa gat atc tta gat aac ctc ccc caa |
| |
|
4771 |
ttc ctt tcA act gtt gat ttg cca act gac cag ata ttg att gag ggt |
| |
|
4819 |
ttg ata ttt gag gtt cag caa ggt gat gct tta gac ttt tca ttt gct |
| |
|
4867 |
gct ggc tct cag cgt ggc act gtt gca ggc ggt gtt aat act gac cgc |
| |
|
4915 |
ctc acc tct gtt tta tct tct gct ggt ggt tcg ttc ggt att ttt aat |
| |
|
4963 |
ggc gat gtt tta ggg cta tca gtt cgc gcc tta aag act aat agc aat |
| |
|
5011 |
tca aaa ata ttg tct gtg cca cgt att cct aag ctt tca ggt cag aag |
| |
|
5059 |
ggt tcc agc tct gtT GGC CAg aat gtc cct ctt att act ggt ctg gcg |
| ! |
|
MscI.... |
|
5107 |
act ggt gaa tcc gcc aat gta aat aat cca ttc cag aag att gag ctg |
| |
|
5155 |
caa aat gta ggt att tcc atg agc gct ctt cct gct gca atg gct ggc |
| |
|
5203 |
ggt aat att gtt ctg gat att acc agc aag gcc gat agt ttg agt tct |
| |
|
5251 |
cct act cag gca agt gat gtt att act aat caa aga agt att gct acc |
| |
|
5299 |
aag gtt aat ttg cgc gat gga cag act ctt cta ctc ggt ggc ctc act |
| |
|
5347 |
gat tat aaa aac act tct caG gat tct ggc gta ccg ttc ctg tct aaa |
| |
|
5395 |
atc cct tta agc ggc ctc ctg ttt agc tcc cgc tct gat teT aac gag |
| |
|
5443 |
gaa agc aag tta tac gtg ctc gtc aaa gca acc ata gta cgc gcc ctg |
| |
|
5491 |
TAG cggcgcatt |
| ! |
|
End IV |
|
5503 |
aagcgcggeg ggtgtggtgg ttccgcgcag cgtgaccgct acacttgcca gcgccctagc |
| |
|
5563 |
gcccgctcct ttcgctttct tcccttcctt tctcgccaag ttcGCCGGCt ttccccgcca |
| ! |
|
NgoMI. |
|
5623 |
agctctaaat cgggggcccc ccttagggtt ccgatttagt gctttacggc acctcgaccc |
| |
|
5683 |
caaaaaactt gattcgggtg atggttCACG TAGTGggcca tcgccctgat agacggtttt |
| ! |
|
DraIII.... |
|
5743 |
tcgccctttG ACGTTGGAGT Ccaagttctt taatagtgga ctcttgttcc aaactggaac |
| ! |
|
DrdI.......... |
|
5903 |
aacactcaac cctatctcgg gctattcttt tgatttataa gggattttgc cgatttcgga |
| |
|
5863 |
accacaatca aacaggattt tcgcctgctg gggcaaacca gctgggaccg cttgccgcaa |
| |
|
5923 |
ctctctcagg gccaggcggt gaagggcaat CAGCTGctgc cCGTCTCact ggtgaaaaga |
| ! |
|
PvuII. BsmBI. |
|
5983 |
aaaaccaccc tGGATCC AAGCTT |
| ! |
|
BamHI HindIII (1/2) |
| ! |
|
Insert carrying bla gene |
|
6006 |
gcaggtg gcacttctcg gggaaatgtg cgcggcaccc |
| |
|
6043 |
ctatttgctt atttctctaa atacatcccc atatGTATCC gctcatgaga caataacct |
| ! |
|
BciVI |
|
6103 |
gacaaacgct ccaataatat tgaaaaAGGA AGAgt |
| ! |
|
RBS.?... |
| ! |
|
Start bla gene |
|
6138 |
ATG agt att caa aat ttc cgt gtc gcc ctt att ccc ttt ttt gag gca ttt |
| |
|
6189 |
tgc ctt cct gtt ttt gct ccc cca gaa acg ctg gtg aaa gta aaa gat gct |
| |
|
6240 |
gaa gat cag ttg ggC gcA CTA GTg ggt tac atc gaa ctg gat atc aac agc |
| ! |
|
SpeI.... |
| ! |
|
ApaLI & BssSI Removed |
|
6291 |
ggt aag atc ctt gag agt ttt cgc ccc gaa gaa cgt ttt cca atg atg agc |
| |
|
6342 |
act ttt aaa gtc ctg cta tgt GGC GcG Gta tta tcc cgt att gac gcc ggg |
| |
|
6393 |
caa gaG CAA CTC GGT CGc agc ATA cAC tat tct cag aat gac ttg gtt gAG |
| ! |
|
BcgI............ |
|
6444 |
TAC Tca cca gtc aca gaa aag aat ctt acg gat ggc atg aca gta aga gaa |
|
| ! |
|
Scal. |
|
6495 |
tta cgc agt gct gcc ata acc atg agc gat aac act gcg gcc aac tta ctt |
| |
|
6546 |
ctg aca aCG ATC Gga gga ccg aag gag cta acc gct ttt ttg cac aac atg |
| ! |
|
PvuI.... |
|
6597 |
ggg gat aat gta act agc ctt gat cgt tgg gaa ccg gag ctg aat gaa gac |
| |
|
6648 |
ata cca aac gac gag cgt gac acc aag atg aat gta gca atg Gca aca aag |
| |
|
6699 |
tTG CGC Aaa cta tta act ggc gaa cta ctt act ata gct tcc cgg aaa caa |
| ! |
|
FspI.... |
| ! |
|
6750 |
tta ata gac tgg atg gag gcg gat aaa gtt gca gga cca ctt ctg agc tcg |
| |
|
6801 |
GCC ctt ccG GCt ggc tgg ttt att gct gat aaa tat gga gac ggt gag agt |
| ! |
|
BglI.......... |
|
6852 |
gGG TCT Cgc ggt atc att gca gca ctg ggg cca gat ggt aag ccc tcc agt |
| ! |
|
BsaI.... |
|
6903 |
atc gta gtt atc tac acG ACg ggg aGT Cag gca act atg gat gaa cga aat |
| ! |
|
AhdI........... |
|
6954 |
aga cag atc gct gag ata ggt gcc tca ccg att aag aat tgg TAA ctgt |
| ! |
|
stop |
|
7003 |
cagaccaagc ttactaatat atactttaga ttgatttaaa acttaatttt taatttaaaa |
| |
|
7063 |
ggatataggt gaagatcctc tttgataatc tcatgaccaa aatccattaa cgtgagtttt |
| |
|
7123 |
cgttccactg tacgtaagac cccc |
| |
|
7147 |
AAGCTT GTCGAG tgaa tggcgaatgg cgctttgcct |
| ! |
|
HindIII SalI.. |
| ! |
|
(2/2) HincII |
|
7183 |
ggtttccggc accagaagcg gcgccggaaa gctggctgga gcgcgatctt |
| ! |
| ! |
Start of Fab-display cacsettc, the Fab DSR-A05, selected for |
|
| ! |
binding to a protein antigen. |
| ! |
| ! |
xBsu36I XhoI.. |
|
| ! |
| ! |
PlacZ promoter is in the following block |
|
7246 |
cgcaacgc aactaatgtg agttagctca |
| |
|
7274 |
ctcattaggc accccaggct ttacacttta tgcttccggc tcgtatgttg |
| |
|
7324 |
tgtggaattg tgagcggata acaatttccc acaggaaaca gctatgacca |
| |
|
7374 |
tgattacgCC AagcttTGGa gccttttttt tggagatttt caac |
| ! |
|
PflMI |
| ! |
|
Hind3. (there are 3) |
| ! |
Gene iii signal sequence: |
|
| ! |
|
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 |
| ! |
|
M K K L L F A I P L V Y |
|
7418 |
gtg aaa aaa tta tta ttc gca att cct tta gtt gtt cct ttc tat |
| ! |
| ! |
|
16 17 18 Start light chain (L20:JK1) |
| ! |
|
S H S A Q D I Q M T Q S P A |
|
7463 |
tct cac aGT GCA Caa aat atc tac acc act tac cct cca gct |
| ! |
|
ApaLI... |
| ! |
|
Sequence supplied by extender............ |
| ! |
| ! |
|
T L S L |
|
7505 |
acc ctg tct ttg |
| ! |
| ! |
|
S P G E R A T L S C R A A S Q G |
|
7517 |
tcc cca ggg gaa agc gct act ctt tcc tgc agg gct ctg tag Ggt |
| ! |
|
V S S Y L A N Y Q Q K P G Q A |
|
7562 |
gtt agc agc tat tta gct tgg tac cag cag aaa cct ggc tag gct |
| ! |
| ! |
|
P R L L I V D A S S R A T G I |
|
7607 |
ccc agg ctt ctt atc tat gAt gtc tcc aAc agg gct act ggc atc |
| ! |
| ! |
|
P A R F S G S G F G T D F T L |
|
7652 |
tcc gct cgg ttc ctg ggc ctg ggg Cct ggg acc gac ttc act ctt |
| ! |
| ! |
|
T I S S L E P E D F A V Y Y C |
|
7697 |
ctc ctc cgc agC ctA gag tct gcc gct ttt gtc gtT tat tac tgt |
| ! |
| ! |
|
Q Q R S N H P W I F G Q G T R |
|
7742 |
cag cag CGt aAc tgg aat ccg tgg ACG TTC GGC CAA GGG ACC AAG |
| ! |
| ! |
|
V E I K K T V A A P S V F I F |
|
7787 |
gtg gcc ctc aaa cga act gtg gCT GCA Cca tct gtc ttc ctc ttc |
| ! |
|
BsgI.... |
| ! |
| ! |
|
P P S D E Q L K S G T A S V V |
|
7832 |
ccg tcc tct gct gag cag ttg ccc tct gga act gct tct gtt gtg |
| ! |
| ! |
|
C L L N N F Y P K E A K V Q W |
|
7877 |
tgc ctg ctg aat ccc ttc tat ccc agc gag gcc aaa gta cag tgg |
| ! |
| ! |
|
K V D N A L Q S G N S Q E S V |
|
7922 |
aag gtg gct aat gct ctt tcc tcg ggt ccc tcc cag gag agt gct |
| ! |
| ! |
|
T E R D D S K D S T Y S L S S T |
|
7967 |
aca gag cgg gct agc aag gac agc acc tac agc ctt agc agc ctc |
| ! |
| ! |
|
L T L S K A D Y F K H K V Y A |
|
8012 |
ctg acG CTG AGc aaa gca gac tac gag caa ccc ccc gtc tac gct |
| ! |
|
EspI..... |
| ! |
| ! |
|
C E V T H Q G L S S P V T K S |
|
8057 |
tgc gaa gtc acc aat cag ggc ctG AGC Tcg ccc gtc aca aag agc |
| ! |
|
SacI.... |
| ! |
| ! |
|
F N R G E C . . |
|
8102 |
ttc aac agg gga gag tgt caa taa |
| |
|
8128 |
GGCGCG CCaattctat ttcaaGGAGA cagtaata |
| ! |
|
AscI..... RBS2. |
| ! |
| ! |
|
PelB signal sequence------(22 codons)-----> |
| ! |
|
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 |
| ! |
|
M K Y L L P T A A A A L L L L |
|
8160 |
aag aaa tac cta ttg cct aag gca gcc gct gga ttg tta tta ctc |
| ! |
| ! |
|
...PelB signal------------> Scare VH, FR1-----------------> |
| ! |
|
16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 |
| ! |
|
A A Q P A M A K V Q L L E S G |
|
8205 |
gcG GCC cag ccG GCC atg gcc gaa gtt CAA TTG tta gag tct ggt |
| ! |
|
SfiI............. MfeI... |
| ! |
|
NcoI.... |
| ! |
| ! |
|
31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 |
| ! |
|
G G L V Q P G G S L R L S C A |
|
8250 |
ggc ggt ctt gtt cag cct ggt ggt tct tta cgt ctt tct tgc gct |
| ! |
| ! |
|
...FR1--------------------> CDR1--------------> FR2--------> |
| ! |
|
46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 |
| ! |
|
A S G F I F S T V K N R W V R |
|
8295 |
gct TCC GGA ttc act ttc tct act tac gag atg ctg tgg gtt cgC |
| ! |
|
BspE71.. |
| ! |
|
FR2--------------------------------------> CDR2 ----------> |
|
| ! |
|
61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 |
| ! |
|
Q A P G K G L K W V S Y I A P |
|
8340 |
CAa gct ccT GGt aaa ggt ttg gag tgg gtc tct tat agc gct cct |
| ! |
BstXI................ |
|
| ! |
| ! |
...CDR2---------------------------------------------> FR3----> |
| ! |
|
76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 |
| ! |
|
S G G D T A Y A D S V K G R F |
|
8385 |
tct ggt ggc gat aet gct tat gct gae ccc gtt aaa ggt cgc ttc |
| ! |
| ! |
|
91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 |
| ! |
|
T I S R D N S K N T L V L Q N |
|
8430 |
act atc TGT AGA gac aac tct aag aat act ctc tac ttg cag atg |
| ! |
|
XbaI... |
| ! |
|
Supplied by extender------------------------------- |
| ! |
| ! |
|
-----------------------------------------FR3--------------> |
| ! |
|
106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 |
| ! |
|
N S L R A K D T A V Y Y C A R |
|
8475 |
aac agC TTA AGg gct gag gac act gca gtc tac tat tgt gcg agg |
| ! |
|
AflII... |
| ! |
|
from extender---------------------------------> |
| ! |
| ! |
|
CDR3--------------------------------------------------> |
| ! |
|
121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 |
|
| ! |
|
R L D G Y I S Y Y V G M D V W |
|
8520 |
agg ctc gat ggc tat att tcc tac tac tac ggt atg GAC GTC tgg |
| ! |
|
AatII.. |
| ! |
| ! |
|
136 137 138 139 140 141 142 143 144 145 |
| ! |
|
G Q C T T V T V S S |
|
8565 |
ggc caa ggg acc acG GTC ACC gtc tca agc |
| ! |
|
BstEII... |
| ! |
| ! |
|
CH1 of IgG1----------> |
| ! |
|
A S T K G P S V F P L A P S S |
|
8595 |
gcc tcc acc aag ggc cca tcg gcc ttc ccc ctg gca ccc tcc ccc |
| ! |
| ! |
|
K S T S G G T A A L G C L V K |
|
8640 |
aag agc acc tct ggg ggc aca gcg gcc ctg ggc tgc ctg gtc aag |
| ! |
| ! |
|
D V F P E P V I V S W N S G A |
|
8685 |
gac tac ttc ccc gaa ccg gtg acg gtg tcg tgg aac tca ggc gcc |
| ! |
| ! |
|
L T S G V H T F P A V L Q S S |
|
8730 |
ctg acc agc ggc gtc cac acc ctc ccg gct gtc cta cag tcc TCA |
| ! |
|
G L Y S L S S V V I V P S S S |
|
8775 |
GGa ctc tac tcc ctc agc agc gta gtg acc gtg ccc tcc agc agc |
| ! |
|
L G T Q T Y I C N V N H K P S |
|
|
8820 |
ttg ggc acc cag acc tac agc tgc aac gtg aat cac aag ccc agc |
| ! |
| ! |
|
N T K V D K K V F P K S C A A |
|
8865 |
aac acc aag gtg gac aag aaa gtt gag ccc aaa tcc tgt GCG GCC |
| ! |
|
A H H H H H H G A A F Q K L |
|
|
8910 |
GCa aat aat aat cac aat cac ggg gcc gca gaa caa aaa ctc agc |
| ! |
..NoeI.... H6 tag.................Myc- |
|
| Tag........................ |
|
| ! |
| ! |
|
S E E D L N G A A q A S S A |
|
|
8955 |
tca gaa gag gat ctg aat ggg gcc gca cag GCT AGC tct gct |
| ! |
|
Myc-Taq.................... ... NheI... |
| ! |
|
Amber |
| ! |
| ! |
III′stump |
|
| ! |
| ! |
Domain 3 of III ------------------------------------------------------- |
| ! |
| ! |
|
S G D F D Y E K N A N A N K G A |
|
8997 |
agc ggc gac ttc gac tac gag aaa atg gct aat gcc aac aaa GGC GCC |
| ! |
|
tcc t t t t t a g a c t t g g t !W.T. |
| ! |
| ! |
|
M T K N A D E N A L Q S D A K G |
|
|
9045 |
atG ACT GAG AAC GCT GAC GAG aat gct ttg caa agc gat gcc aag ggt |
| ! |
|
c a t c t a c g c a g t c t c t a c !W.T. |
| ! |
| ! |
|
K L D S V A T D Y G A A I D G F |
|
9093 |
aag tta gac agc gTC GCG Aoo gac tat GGC GOD gcc ATO GAc ggc ttt |
| ! |
|
a c t t tct t t t c t t t t t c !W.T. |
| ! |
|
NruI.... KasI...(3/4) |
| ! |
| ! |
|
I G I D V S G L A N G N G A T G D |
|
9141 |
atc ggc gat gcc agt ggt tTG GCC Aac ggc aac gga gcc acc gga gac |
| ! |
|
t t c t tcc c c t t t t t t t t t t !W.T. |
| ! |
|
MscI....(3/3) |
| ! |
| ! |
|
F A G S N S Q M A Q V G D G D N |
|
9189 |
ttc GCA GGT tcG AAT TGt cag atg gcC CAG GTT GGA GAT GGg gac aac |
| ! |
|
t t c t c a t a c t c t t t !W.T. |
| ! |
|
BspMI.. (2/2) XcmI................ |
| ! |
|
EcoRI... |
| ! |
| ! |
|
S P L N N N F K Q Y L P S L P Q |
|
9237 |
agt ccg ctt atg aac aac ttt aga cag tac ctt ccg tct ctt ccg cag |
| ! |
|
tca t t a t t c c t a t t a t c c t a !W.T. |
| ! |
| ! |
|
S V E C R P F V F S A G K P Y E |
|
9285 |
agt gtc gag tgc cgt cca ttc gtt ttc tcc gcc ggc aag cct tac gag |
| ! |
|
tcg t a t c t t c t agc t t a a t a !W.T. |
| ! |
| ! |
|
F S I D C I D K I N L F R |
|
9333 |
ttc aGC Atc gac TGC gat aag atc aat ctt ttC CGC |
| ! |
|
t tct t t t c a a c t a c t !W.T. |
| ! |
|
BatAPI........ SacII... |
| ! |
|
End Domain 3 |
| ! |
| ! |
|
G V F A F L L V V A T F N V V F |
|
9369 |
GGc gtt ttc gct tcc ttg cta tac gtc gct act ttc atg tac gtt ttc |
| ! |
|
t c t g t c t t a t t c c t t a t !W.T. |
| ! |
|
start transmembrane segment |
| ! |
| ! |
|
S T F A N I L R N K E S |
|
9417 |
aCC ACT TTC GCC AAT ATT TTA Cgc aac aaa gaa agc |
| ! |
|
tct g t t c a c g t t g g tct !W.T. |
| ! |
|
Intraccellular anchor. |
| ! |
| ! |
|
. . |
|
9453 |
tag tga tct CCT AGG |
| ! |
|
AvrII.. |
| ! |
|
9468 |
aag ccc gcc taa tga gcg ggc ctt tct ttt ct ggt |
| ! |
|
| Trp terminator | |
| ! |
|
9503 |
ATGCAT CCTGAGC ccgat actgtcgtcg tcccctcaaa ccggcagatg |
|
| ! |
|
NsiI.. Bsu36I.(3/3) |
|
9551 |
cacggtcacg atgcgcccat ctacaccaac gcgacctatc ccactacggt caacccgccg |
| |
|
9611 |
tttgttccca cggagaatcc gacgggttgt tactcgctca aatttaatgt tgatgaaagc |
| |
|
9671 |
tggctacagg aaggccagac gcgaattatt tttgatggcg ttcctattgg tcagaaaatg |
| |
|
9731 |
agctgactta accaaaattt aaTgcgaatt ttaacaaaat attaacgttt acaATTTAAA |
| ! |
|
9791 |
Tatttgctta tacaatcttc ctgtctctgg ggcttttctg attatcaacc GGGGTAaat |
|
| |
|
9850 |
ATG att gac atg cta gtt tta cga tta ccg ttc atc gat tct ctt gtt tgc |
| ! |
|
Start gene II |
|
9901 |
tcc aga ctc tca ggc aat gac ctg ata gcc ttt gtA GAT CTc tca aaa ata |
| ! |
|
BglII... |
|
9952 |
gct acc ctc tcc ggc atT aat tta tca gct aga acg gct gaa tat aat att |
| |
|
10003 |
gat ggt gat ttg act gtc tcc ggc ctc cct cac ccc ctt gaa tct tta cct |
| |
|
10054 |
aca aat tac tca ggc att gca ctt aaa ata tat gag ggt tct aaa aat ttt |
| |
|
10105 |
tat cct tgc gtt gaa ata aag gct tct ccc gca aaa gta tta cag ggt aat |
| |
|
10156 |
aat gtt ttt ggt aca acc gat tta gct cta tgc tct gag gct tta ttg ctt |
| |
|
10207 |
aat ttt gct aat tct ttg cct tgc ctg tat gat tta ttg gat gtt ! |
| !------------------------ End of Table ------------------------------- |
|
| !TABLE 37 |
|
|
| DNA seq of w.t. M13 gene iii |
|
|
| ! |
|
|
|
| ! |
|
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 |
| ! |
|
fM K K L L F A I P L V V P F Y |
|
1579 |
gtg aaa aaa tta tta ctc gca att act tta gtt gtt cct ttc tat |
| ! |
|
Signal sequence............................................ |
| ! |
| ! |
|
16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 |
| ! |
|
S H S A E T V E S C L A K P H |
|
1624 |
tct cac tcc gct gaa act gtt gaa agt tgt tta gca aaa ccc cat |
| ! |
Signal sequence> Domain 1--------------------------------------- |
| ! |
| ! |
|
31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 |
|
| ! |
|
T E N S F T N V N K D D K T L |
|
1669 |
aca gaa aat tca ctt act aac gtc tgg aaa gac gac aaa act tta |
| ! |
|
Domain 1--------------------------------------------------- |
| ! |
| ! |
|
46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 |
| ! |
|
D R Y A N Y S G C L N N A T G |
|
1714 |
gat cgt tac gct aac tat gag ggc tgt ctg tgG AAT GCt aca ggc |
| ! |
|
BsmI.... |
| ! |
|
Domain 1--------------------------------------------------- |
| ! |
| ! |
|
61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 |
| ! |
|
V V V C T G D E T Q C Y C T N |
|
1759 |
gtt gta gtt tgt act ggt gac gaa act cag tgt tac ggt aca tgg |
| ! |
|
Domain 1--------------------------------------------------- |
| ! |
| ! |
|
76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 |
| ! |
|
V P I G L A I P E N S G G G S |
|
1804 |
gtt cct att ggg ctt gct agc cct gaa aat gag ggt ggt ggc tct |
| ! |
|
Domain 1------------------------------> Linker 1----------- |
| ! |
| ! |
|
91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 |
| ! |
|
S G C C S E G G G S S G G G T |
|
1849 |
gag ggt ggc ggt tct gag ggc ggc ggt tct gag ggt ggc ggt act |
| ! |
|
Linker 1--------------------------------------------------> |
| ! |
| ! |
|
106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 |
| ! |
|
K P P E Y G D T P I P G Y T Y |
|
1894 |
aaa cct ccc gag tac ggt gat acc cct att ccg ggc tat act aat |
| ! |
|
Domain 2--------------------------------------------------- |
| ! |
| ! |
|
121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 |
| ! |
|
I N P L D G T Y P P G T S Q N |
|
1939 |
agc aac ccc ctc gac ggc act taT CCG CGt ggt act gag caa aac |
| ! |
|
EciI.... |
| ! |
|
Domain 2--------------------------------------------------- |
| ! |
| ! |
|
136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 |
| ! |
|
P A N P N P E L F S S Q P L N |
|
1984 |
ccc gct aat cct aat cct tct ctt GAG GAG tct cag cct ctt aac |
| ! |
|
BseRI.. |
| ! |
|
Domain 2--------------------------------------------------- |
| ! |
| ! |
|
151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 |
| ! |
|
T F N F Q N N R F R N R Q S A |
|
2029 |
act ttc atg ctt cag aat aat agg ttc ega aat agg cag ggg gca |
| ! |
|
Domain 2--------------------------------------------------- |
| ! |
| ! |
|
166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 |
| ! |
|
L T V Y I G T V T Q G T D P V |
|
2074 |
tta act gtt tat aag ggc act gtt act caa ggc act gac ccc gtt |
| ! |
|
Domain 2--------------------------------------------------- |
| ! |
| ! |
|
181 182 183 184 185 188 187 188 189 190 191 192 193 194 195 |
| ! |
|
K T V Y Q V T P V S S K A N Y |
|
2119 |
aaa act aat tac cag tec act ccc gta tca tca aaa gcc atg tat |
| ! |
|
Domain 2--------------------------------------------------- |
| ! |
| ! |
|
196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 |
| ! |
|
D A Y W N G K F R V C A F H S |
|
2164 |
gac gct tac tgg aac ggt aaa ttC AGa gaC TGc gct ttc aat tct |
| ! |
|
AlwNI....... |
| ! |
|
Domain 2--------------------------------------------------- |
| ! |
| ! |
|
211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 |
| ! |
|
G F N E D P F V C E Y Q G Q S |
|
2209 |
ggc ttt aat gaG GAT CCa ctc gtt tgt caa ggc caa ggc caa tcg |
| ! |
|
BamHI... |
| ! |
|
Domain 2--------------------------------------------------- |
| ! |
| ! |
|
226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 |
| ! |
|
S D L P Q P P V N A G G C S C |
|
2254 |
tct gac ctg cct caa cct cct gcc aat gct ggc ggc ggc tct ggt |
| ! |
|
Domain 2------------------------------> Linker 2----------- |
| ! |
| ! |
|
241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 |
| ! |
|
G G S C G G S K C C G S K G C |
|
2299 |
ggt ggt Oct ggt ggc ggc tct gag ggt ggt ggc tct gag ggt ggc |
| ! |
|
Linker 2--------------------------------------------------- |
| ! |
| ! |
|
256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 |
| ! |
|
G S K G G G S E G C G S G G G |
|
2344 |
ggt tct gag ggt ggc ggc tct gag gga ggc ggt tcc ggt ggt ggc |
| ! |
|
Linker 2--------------------------------------------------- |
| ! |
| ! |
|
271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 |
| ! |
|
S G S C G F D Y K K N A N A N |
|
2389 |
tct ggt tcc ggt gct ctt gat tat gaa aag atg gca aac gct aat |
| !Linker 2> Domain 3------------------------------------------- |
| ! |
| ! |
|
286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 |
|
| ! |
|
K G A M T K N A D E N A L Q S |
|
2434 |
aag ggg gct atg acc gaa aat gcc gct gaa aac gcg cta cag tct |
| ! |
|
Domain 3--------------------------------------------------- |
| ! |
| ! |
|
301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 |
| ! |
|
D A K C K L D S V A T D Y G A |
|
2479 |
gac gct aea ggc caa ctt gct tct gtc gct act gct tac ggt gct |
| ! |
|
Domain 3--------------------------------------------------- |
| ! |
| ! |
|
316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 |
| ! |
|
A I D G F I G D V S G L A N G |
|
2524 |
gct ctc gct ggt tcc att ggt gcc gtt tcc ggc cct gct aat ggt |
| ! |
|
Domain 3--------------------------------------------------- |
| ! |
| ! |
|
331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 |
| ! |
|
N C A T G D F A G S N S Q M A |
|
2569 |
aat ggt gct act ggt gct ttt gct ggc tct aat tcc ccc atg gcc |
| ! |
|
Domain 3--------------------------------------------------- |
| ! |
| ! |
|
346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 |
| ! |
|
Q V G D G D N S P L M N N F R |
|
2614 |
caa gtc ggt gac ggt gat aat cca cct tta atg aat aat ttc cgt |
| ! |
|
Domain 3--------------------------------------------------- |
| ! |
| ! |
|
361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 |
| ! |
|
Q Y L P S L P Q S V K C R P F |
|
2659 |
caa tat tta cct tcc ctc cct caa rcg gct gaa tgt cgc cct ttt |
| ! |
|
Domain 3--------------------------------------------------- |
| ! |
| ! |
|
376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 |
| ! |
|
V F S A G K P Y K F S I D C D |
|
2704 |
gtc ttc agc gct ggt aaa cca tat gaa ttc tct att gat tgt gac |
| ! |
|
Domain 3--------------------------------------------------- |
| |
| ! |
|
391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 |
| ! |
|
K I N L F R G V F A F L L Y V |
|
2749 |
aaa ata aac tca tcc cgt ggt gcc ttt gcg ttt ctt tta tac gct |
| ! |
|
Domain 3--------------> Transmembrane segment-------------- |
| ! |
| ! |
|
406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 |
| ! |
|
A T F M Y V F S T F A N I L R |
|
2794 |
gcc acc ttt atg tat gta ttt tct acg ttt gct aac ata ctg cgt |
| ! |
|
Transmembrane segment---------------------------------> ICA-- |
| ! |
| ! |
|
421 422 423 424 425 |
| ! |
|
N K K S . |
|
2839 |
aat aag gag cct taa ! 2853 |
| ! |
|
ICA-----------> ICA = intracellular anchor |
| ! |
| !------------------ End of Table ----------------------------------------- |
|
| TABLE 38 |
|
|
| Whole mature III anchor M13-III |
|
| derived anchor with racorded DNA |
|
|
| ! |
|
|
|
| ! |
|
1 2 3 |
| ! |
|
A A A |
|
1 |
GCG gcc gca |
| ! |
|
NotI...... |
| ! |
| ! |
|
4 5 6 7 8 9 10 11 12 13 14 15 16 17 |
| ! |
|
H H H H H H C A A E Q K L I |
|
10 |
cat cat cat cac aat cac ggg gcc gca gaa caa aaa ctc atc |
| ! |
| ! |
|
18 19 20 21 22 23 24 25 26 27 28 29 |
| ! |
|
S E S D L N G A A . A S |
|
52 |
tca gaa gag gct ctg aat ggg gcc gca Tag GCT AGC |
| ! |
|
NheI... |
| ! |
| ! |
|
30 31 32 33 34 35 36 37 38 39 |
| ! |
|
D I N D D R M A S T |
|
88 |
GAT ATC cac gat gat cgt atg gct tct act |
| ! |
(ON_C37hor) [RC] 5-c aac gat gat cgt atg gcG CAt Gct gcc gag aca g-3′ |
|
| ! |
|
EcoRV.. |
|
| ! |
|
Enterokinase cleavage site. |
| ! |
| ! |
Start mature III (recorded) Domain 1 ----> |
|
| ! |
|
40 41 42 43 |
|
| ! |
|
A S T V |
|
118 |
|gcC|gaG|acA|gtC| |
| ! |
|
t a t t ! W.T. |
| ! |
| ! |
|
44 45 48 47 48 49 50 51 52 53 54 55 58 57 58 |
| ! |
|
E S C L A K P H I S N S F I N |
|
130 |
|gaa|TCC|tgC|CTG|GCC|AaG|ccT|caC|acT|gaG|aat|AGT|ttC|aCA|Aat| |
| ! |
|
agt t t a a a c t a a tca t t c |
| ! |
|
MscI.... |
|
| ! |
| ! |
|
59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 |
| ! |
|
V W K D D K T L D R V A N V S |
|
175 |
|gtg|TGG|aaG|gaT|gaT|aaG|acC|CtT|gAT|CGA|TaT|gcC|aaT|taC|gcA| |
| ! |
|
c a c c a t t a t c t c t g ! W.T. |
| ! |
|
BspDI... |
| ! |
| ! |
|
74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 |
| ! |
|
G C L N N A I G V V V C I C D |
|
220 |
|ggC|tgC|Tta|tgg|aat|gcC|ACC|GGC|GtC|gtT|gtC|TGC|ACG|ggC|gaT| |
| ! |
|
t t c g t a t a t t t t c ! W.T. |
| ! |
|
SgrAI...... BsgI.... |
| ! |
| ! |
|
89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 |
| ! |
|
E T Q C V G I N V P I G L A I |
|
265 |
|gaG|acA|caA|tgC|taT|ggC|ACG|TCg|gtC|ccG|atA|gGC|TTA|GCC|atA| |
| ! |
|
a t g t c t a t t t g c t t c ! W.T. |
| ! |
|
PmlI.... BlpI..... |
| ! |
| ! |
Domain 1-----> Linker 1----------------> |
|
| ! |
|
104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 |
|
| ! |
|
P E N E G G C S F G G G S K G |
|
310 |
|ccG|gaG|aaC|gaA|ggC|ggC|ggT|AGC|gaA|ggC|ggT|ggC|AGC|gaA|ggC| |
| ! |
|
t a t g t t c tct g t c t tct g t ! W.T. |
| ! |
| ! |
|
Linker 1----------------------> Domain 2---------------> |
| ! |
|
119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 |
| ! |
|
G C S F C G G T K P P F Y G D |
|
355 |
|ggT|GGA|TGC|gaA|ggA|ggT|ggA|acC|aaG|ccG|ccG|gaA|taT|ggC|gaC| |
| ! |
|
c t t g t c t t a t t g c t t ! W.T. |
| ! |
|
BamHI..(2/2) |
| ! |
| ! |
|
134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 |
| ! |
|
T P I P G Y T Y I N P L D G T |
|
400 |
|acT|ccC|atA|CCT|GCT|taC|acC|taC|atT|aaT|ccG|TtA|gaT|ggA|acC| |
| ! |
|
a t t g c c t t c a t c c a a t ! W.T. |
| ! |
|
SexAI.... |
| ! |
| ! |
|
149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 |
| ! |
|
Y P P G T F Q N P A N P N P S |
|
445 |
|taC|caT|ccG|ggC|acC|gaA|caC|aaT|ccT|gcC|aaC|caG|caC|acA|AGC| |
| ! |
|
T G t t t g a c a t t t t ttc ! W.T. |
| ! |
| ! |
|
164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 |
|
| ! |
|
L F E S Q P L N T F M F Q N N |
|
490 |
|TTA|gaA|gaA|AGC|caA|aaG|TaA|aaC|acC|ttT|atg|ttC|caA|aaC|aaC| |
| ! |
|
c t G G tct g t c t t t a t g t t ! W.T. |
| ! |
|
179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 |
|
| ! |
|
Y F P N P Q G A L T V Y T G T |
|
535 |
|CgT|ttT|AgG|aaC|CgT|CaA|gCT|GCT|CtT|acC|gTG|TAC|AcT|ggA|acC| |
| ! |
|
a g c c a t a g g g a t a t t t g c t ! W.T. |
| ! |
|
HgiAI... BsrGI... |
| ! |
| ! |
|
194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 |
| ! |
|
V T Q G T D P V K T Y Y Q Y T |
|
580 |
|gtC|aaC|aaG|GGT|ACC|gaT|ccT|gtC|aaC|taC|taT|caA|taT|aaC| |
| ! |
|
t t a c t a a t a t t a g a t ! W.T. |
| ! |
|
KpnI... |
| ! |
| ! |
|
209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 |
| ! |
|
P V S S K A N Y D A Y N N G K |
|
625 |
|caG|gtC|TCG|AGt|aaG|gcT|atg|taC|gaT|gcC|taT|tgg|aaT|ggC|aaC| |
| ! |
|
t a a tca a c t a t a a t a ! W.T. |
| ! |
|
BsaI.... |
| ! |
|
XhoI.... |
| ! |
| ! |
|
224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 |
| ! |
|
F R D C A F H S G F N F D P F |
|
670 |
|ttT|CgT|gaT|tgT|gcC|taT|caC|AGC|ggT|ttC|aaC|gaa|gac|CCt|ttT| |
| ! |
|
C A a C a t c t tct c t t G T a c ! W.T. |
| ! |
| ! |
|
239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 |
| ! |
|
V C E Y Q G Q S S D L P Q P P |
|
715 |
|gtC|tgC|gaG|taC|caG|ggT|caG|AGT|AGC|gaT|TcA|ccG|caG|ccA|CCG| |
| ! |
|
t t a t a c a tcg tct c c g t a t t ! W.T. |
| ! DrdI..... |
|
| AgeI..... |
| ! Domain 2--------> Linker 2---------------------> |
| ! |
|
254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 |
|
| ! |
|
V N A G G G S G G G S G G G S |
|
760 |
|GTT|AAC|gcG|ggT|ggT|ggT|AGC|ggC|ggA|ggC|AGC|ggC|ggT|ggT|AGC| |
| ! |
|
c t t c c c tct t t t t tct t c c tct |
| ! |
|
Hpa... |
|
| ! |
|
HincII. |
| ! |
| ! |
|
Linker 2----------------------------------------------> |
| ! |
|
269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 |
| ! |
|
E G G G S K G G G S G G G S C |
|
805 |
|gaA|ggC|ggA|ggT|AGC|gaA|ggA|ggT|ggC|AGC|ggA|ggC|ggT|AGC|ggC| |
| ! |
|
g t t c tct g t c t tct g t c tct t |
| ! |
|
------------Domain 3-------------------> |
|
| ! |
|
284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 |
| ! |
|
S G D F D Y K K N A N A N K G |
|
850 |
|AGT|ggC|gac|ttc|gac|tac|gag|aaa|atg|gct|aat|gcc|aac|aaa|GGC| |
| ! |
|
tcc t t t t t a g a c t t g g ! W.T. |
| ! |
| ! |
|
299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 |
|
| ! |
|
A M K N A D K N A L Q S D A |
|
895 |
|GCC|atg|act|gag|aac|gcc|gac|gaG|AAT|GCA|ctg|caa|agt|gat|gCC| |
| ! |
|
t c a t c t a c g a g tct c t ! W.T. |
| ! |
|
314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 |
|
| ! |
|
K G K L D S V A T D Y C A A I |
|
940 |
|AAG|GGt|aag|tta|gac|agc|gTC|GCc|Aca|gac|tat|ggT|GCt|gac|atc| |
| ! |
|
a c a c t tct t t t c t ! W.T. |
| ! |
Sty...... PflFI...... |
|
| ! |
| ! |
|
329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 |
| ! |
|
D C F G D V S C L A N C N G |
|
985 |
|gac|ggc|ttt|atc|ggc|gat|gtc|agt|ggt|ctg|gct|aac|ggc|aac|gga| |
| ! |
|
t t c t t c t tcc c c t t t t t t ! W.T. |
| ! |
| ! |
|
344 345 346 347 348 349 350 351 352 353 |
| ! |
|
A T G D F A G S N S |
|
1030 |
|gcc|acc|gga|gac|ctc|GCA|GGT|tcG|AAT|TCt| |
| ! |
|
t t t t t t c t c ! W.T. |
| ! |
|
BstBI... |
| ! |
|
EcoRI... |
| ! |
|
BspMI.. |
| ! |
| ! |
|
354 355 356 357 358 359 360 361 362 363 |
| ! |
|
Q M A Q V G D G D N |
|
1060 |
cag atg gcC CAG GTT GGA GAT GGg gac aac |
| ! |
|
a t a c t c t t t ! W.T. |
| ! |
|
XcmI................ |
| ! |
| ! |
|
364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 |
| ! |
|
S P L K N N F R Q Y L P S L P Q |
|
1090 |
agt ccg ctt atg cac aac tct aga cag cac ctt ccg cct ctt ccg cag |
| ! |
|
tca t t a t t c c t a t t a t c c t a ! W.T. |
| ! |
| ! |
|
380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 |
| ! |
|
S V K C R P F V F S A G K P Y E |
|
1138 |
agt gtc gag tgc cgt cca ttc gtt ttc tct gcc ggc aag cct tac gag |
| ! |
|
tcg t a t c t t c t agc t t a a t a ! W.T. |
| ! |
| ! |
|
Domain 3-------------------------------> |
| ! |
|
396 397 398 399 400 401 402 403 404 405 406 407 |
| ! |
|
F S I D C D K N L F K |
|
1186 |
ttc aGC Atc gac TGC gct cag atc aat ctt ttC CGC |
| ! |
|
t tct t t t c a a c t a t |
| ! |
|
BstAPI........ SacII... |
| ! |
| ! |
|
transmembrane segment-------------> |
| ! |
|
408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 |
| ! |
|
G V F A F L L Y V A T F K V V F |
|
1222 |
GGc gtt ctc gct ttc ttg cta tac gcc gct act ttc atg tac gtt ttc |
| ! |
|
t c t g t c t t a t t c c t t a t ! W.T. |
| ! |
| ! |
|
424 425 426 427 428 429 430 431 432 433 434 435 |
| ! |
|
S T F A N L R N K E S |
|
1270 |
aGC ACT TTC GCC AAT ATT TTA Cgc aac aaa gaa agc |
| ! |
|
tct g t t c a c g t t g g tct ! W.T. |
| ! |
|
Intracellular anchor. |
| ! |
| ! |
|
. . |
|
1306 |
tag tga tct CCT AGG |
| ! |
|
AvrII.. |
| ! |
|
1321 |
aag ccc gcc taa tga gcg ggc ttt ttt ttt ct ggt |
| ! |
|
| Trp terminator | |
| ! |
| ! End Feb cassette |
|
| !---------------------------- End of Table ------------------------- |
|
| TABLE 39 |
|
|
| ONs to make deletions in III |
|
|
| ! ONs for use with NheI |
|
| ! |
| (ON_G29bot) 5′-c gTT gAT ATc gcT Agc cTA Tgc-3′ |
| ! 22 |
| ! this is the reverse complement of 5′-gca cag gct agc gat atc aac g-3′ |
| ! NheI... scab......... |
| (ON_G104top) 5′-g|ata|ggc|tta|gcT|aGC|ccg|gag|aac|gaa|gg-3′ |
| ! 30 |
| ! Scab..........NheI... 104 105 106 107 108 |
| (ON_G236top) 5′-c|ttt|cac|agc|ggt|ttc|GCT|AGC|gac|ccc|ttt|gtc|tgc-3′ |
| ! 37 |
| ! NheI... 236 237 238 239 240 |
| (ON_G236tCS) 5′-c|ttt|cac|agc|ggt|tcc|GCT|AGC|gac|cct|ctc|gcc|Agc- |
| ! NheI... 236 237 238 239 240 |
| gag|tac|cag|ggt|c-3′ |
| ! 50 |
| ! ONs for use with SphI G CAT Gc |
| (ON_X37bot) 5′-gAc TgT cTc ggc Agc ATg cgc cAT Acg ATc ATc gTT g 3′ |
| ! 37 |
| ! N D D R M A H A |
| !(ON_X37bot)=[RC] 5′-c cac gat gat cgt atg gcG CAt Gct gcc gag aca gtc -3′ |
| ! SphI....Scab........... |
| (ON_X104top) 5′-g|gtG|ccg|agc|ggc|ttG|CAT|GCa|ccg|gag|ccc|gaa|gg-3′ |
| ! 36 |
| ! Scab................SphI.... 104 105 106 107 108 |
| (ON_X236top) 5′-c|ttt|ccc|cgc|ggt|ttG|CaT|gCa|gac|cct|ttt|gtc|tgc-3′ |
| ! 37 |
| ! Sph.... 236 237 238 239 240 |
| (ON_X236tCS) 5′-c|ttt|ccc|agc|ggt|ttG|CaT|gCa|gac|ccc|ttt|gtc|Agc- |
| NheI... 236 237 238 239 240 |
| gag|tac|cag|ggt|c-3′ |
| ! 50 |
|
| TABLE 40 |
|
|
| Phage titers and enrichments of selections with |
| a DY3F31-based human Fab library |
|
|
|
Output/input |
|
Input (total cfu) |
Output (total cfu) |
ratio |
|
|
| R1-ox selected on |
4.5 × 1012 |
3.4 × 105 |
7.5 × 10−8 |
| phOx-BSA |
| R2-Strep selected |
9.2 × 1012 |
3 × 108 |
3.3 × 10−5 |
| on Strep-beads |
|
| TABLE 41 |
|
|
| Frequency of ELISA positives in |
| DY3F31-based Fab libraries |
|
Anti-M13 |
9E10/RAM- |
Anti-CK/CL |
|
HRP |
HRP |
Gar-HRP |
|
|
| P2-ox (with IPTG induction) |
18/44 |
10/44 |
10/44 |
| P2-ox (without IPTG) |
13/44 |
ND |
ND |
| R3-strep (with IPTG) |
39/44 |
38/44 |
36/44 |
| R3-strep (without IPTG) |
33/44 |
ND |
ND |
|
Claims
We claim:
1. A method for cleaving single-stranded nucleic acid sequences at a desired location, the method comprising the steps of:
(i) contacting the nucleic acid with a single-stranded oligonucleotide, the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired and including a sequence that with its complement in the nucleic acid forms a restriction endonuclease recognition site that on restriction results in cleavage of the nucleic acid at the desired location; and
(ii) cleaving the nucleic acid solely at the recognition site formed by the complementation of the nucleic acid and the oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature.
2. A method for cleaving single-stranded nucleic acid sequences at a desired location, the method comprising the steps of:
(i) contacting the nucleic acid with a partially double-stranded oligonucleotide, the single-stranded region of the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired, and the double-stranded region of the oligonucleotide having a restriction endonuclease recognition site; and
(ii) cleaving the nucleic acid solely at the restriction endonuclease recognition site formed by the complementation of the nucleic acid and the single-stranded region of the oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature.
3. In a method for displaying a member of a diverse family of peptides, polypeptides or proteins on the surface of a genetic package and collectively displaying at least a part of the diversity of the family, the improvement being characterized in that the displayed peptide, polypeptide or protein is encoded at least in part by a nucleic acid that has been cleaved at a desired location by a method comprising the steps of:
(i) contacting the nucleic acid with a single-stranded oligonucleotide, the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired and including a sequence that with its complement in the nucleic acid forms a restriction endonuclease recognition site that on restriction results in cleavage of the nucleic acid at the desired location; and
(ii) cleaving the nucleic acid solely at the recognition site formed by the complementation of the nucleic acid and the oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature.
4. In a method for displaying a member of a diverse family of peptides, polypeptides or proteins on the surface of a genetic package and collectively displaying at least a part of the diversity of the family, the improvement being characterized in that the displayed peptide, polypeptide or protein is encoded by a DNA sequence comprising a nucleic acid that has been cleaved at a desired location by
(i) contacting the nucleic acid with a partially double-stranded oligonucleotide, the single-stranded region of the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired, and the double-stranded region of the oligonucleotide having a restriction endonuclease recognition site; and
(ii) cleaving the nucleic acid solely at the restriction endonuclease recognition cleavage site formed by the complementation of the nucleic acid and the single-stranded region of the oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature.
5. A method for displaying a member of a diverse family of peptides, polypeptides or proteins on the surface of a genetic package and collectively displaying at least a part of the diversity of the family, the method comprising the steps of:
(i) preparing a collection of nucleic acids that code at least in part for members of the diverse family;
(ii) rendering the nucleic acids single-stranded;
(iii) cleaving the single-stranded nucleic acids at a desired location by a method comprising the steps of:
(a) contacting the nucleic acid with a single-stranded oligonucleotide, the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired and including a sequence that with its complement in the nucleic acid forms a restriction endonuclease recognition site that on restriction results in cleavage of the nucleic acid at the desired location; and
(b) cleaving the nucleic acid solely at the recognition site formed by the complementation of the nucleic acid and the oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature; and
(iv) displaying a member of the family of peptides, polypeptides or proteins coded, at least in part, by the cleaved nucleic acids on the surface of the genetic package and collectively displaying at least a portion of the diversity of the family.
6. A method for displaying a member of a diverse family of peptides, polypeptides or proteins on the surface of a genetic package and collectively displaying at least a portion of the diversity of the family, the method comprising the steps of:
(i) preparing a collection of nucleic acids that code, at least in part, for members of the diverse family;
(ii) rendering the nucleic acids single-stranded;
(iii) cleaving the single-stranded nucleic acids at a desired location by a method comprising the steps of:
(a) contacting the nucleic acid with a partially double-stranded oligonucleotide, the single-stranded region of the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired, and the double-stranded region of the oligonucleotide having a restriction endonuclease recognition site; and
(b) cleaving the nucleic acid solely at the restriction endonuclease recognition cleavage site formed by the complementation of the nucleic acid and the single-stranded region of the oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the restriction being carried out using a cleavage endonuclease that is active at the chosen temperature; and
(iv) displaying a member of the family of peptides, polypeptides or proteins coded, at least in part, by the cleaved nucleic acids on the surface of the genetic package and collectively displaying at least a portion of the diversity of the family.
7. In a method for expressing a member of a diverse family of peptides, polypeptides or proteins and collectively expressing at least a part of the diversity of the family, the improvement being characterized in that the expressed peptide, polypeptide or protein is encoded at least in part by a nucleic acid that has been cleaved at a desired location by a method comprising the steps of:
(i) contacting the nucleic acid with a single-stranded oligonucleotide, the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired and including a sequence that with its complement in the nucleic acid forms a restriction endonuclease recognition site that on restriction results in cleavage of the nucleic acid at the desired location; and
(ii) cleaving the nucleic acid solely at the recognition site formed by the complementation of the nucleic acid and the oligonucleotide; the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature.
8. In a method for expressing a member of a diverse family of peptides, polypeptides or proteins and collectively expressing at least a part of the diversity of the family, the improvement being characterized in that the expressed peptide, polypeptide or protein is encoded by a DNA sequence comprising a nucleic acid that has been cleaved at a desired location by
(i) contacting the nucleic acid with a partially double-stranded oligonucleotide, the single-stranded region of the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired, and the double-stranded region of the oligonucleotide having a restriction endonuclease recognition site; and
(ii) cleaving the nucleic acid solely at the restriction endonuclease recognition cleavage site formed by the complementation of the nucleic acid and the single-stranded region of the oligonucleotide; the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature.
9. A method for expressing a member of a diverse family of peptides, polypeptides or proteins and collectively expressing at least a part of the diversity of the family, the method comprising the steps of:
(i) preparing a collection of nucleic acids that code at least in part for members of the diverse family;
(ii) rendering the nucleic acids single-stranded;
(iii) cleaving the single-stranded nucleic acids at a desired location by a method comprising the steps of:
(a) contacting the nucleic acid with a single-stranded oligonucleotide, the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired and including a sequence that with its complement in the nucleic acid forms a restriction endonuclease recognition site that on restriction results in cleavage of the nucleic acid at the desired location; and
(b) cleaving the nucleic acid solely at the recognition site formed by the complementation of the nucleic acid and the oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature; and
(iv) expressing a member of the family of peptides, polypeptides or proteins coded, at least in part, by the cleaved nucleic acids and collectively expressing at least a portion of the diversity of the family.
10. A method for expressing a member of a diverse family of peptides, polypeptides or proteins and collectively expressing at least a portion of the diversity of the family, the method comprising the steps of:
(i) preparing a collection of nucleic acids that code, at least in part, for members of the diverse family;
(ii) rendering the nucleic acids single-stranded;
(iii) cleaving the single-stranded nucleic acids at a desired location by a method comprising the steps of:
(a) contacting the nucleic acid with a partially double-stranded oligonucleotide, the single-stranded region of the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired, and the double-stranded region of the oligonucleotide having a restriction endonuclease recognition site; and
(b) cleaving the nucleic acid solely at the restriction endonuclease recognition cleavage site formed by the complementation of the nucleic acid and the single-stranded region of the oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the restriction being carried out using a cleavage endonuclease that is active at the chosen temperature; and
(iv) expressing a member of the family of peptides, polypeptides or proteins coded, at least in part, by the cleaved nucleic acids and collectively expressing at least a portion of the diversity of the family.
11. A library comprising a collection of genetic packages that display a member of a diverse family of peptides, polypeptides or proteins and collectively display at least a portion of the diversity of the family, the library being produced using the methods of claims 3, 4, 5 or 6.
12. A library comprising a collection of genetic packages that display a member of a diverse family of peptides, polypeptides or proteins and that collectively display at least a portion of the family, the displayed peptides, polypeptides or proteins being encoded by DNA sequences comprising at least in part sequences produced by cleaving single-stranded nucleic acid sequences at a desired location by a method comprising the steps of:
(i) contacting the nucleic acid with a single-stranded oligonucleotide, the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired and including a sequence that with its complement in the nucleic acid forms a restriction endonuclease recognition site that on restriction results in cleavage of the nucleic acid at the desired location; and
(ii) cleaving the nucleic acid solely at the recognition site formed by the complementation of the nucleic acid and the oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature.
13. A library comprising a collection of genetic packages that display a member of a diverse family of peptides, polypeptides or proteins and that collectively display at least a portion of the diversity of the family of the displayed peptides, polypeptides or proteins being encoded by DNA sequences comprising at least in part sequences produced by cleaving single-stranded nucleic acid sequences at a desired location by a method comprising the steps of:
(i) contacting the nucleic acid with a partially double-stranded oligonucleotide, the single-stranded region of the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired, and the double-stranded region of the oligonucleotide having a restriction endonuclease recognition site; and
(ii) cleaving the nucleic acid solely at the restriction endonuclease recognition cleavage site formed by the complementation of the nucleic acid and the single-stranded region of the oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature.
14. A library comprising a collection of members of a diverse family of peptides, polypeptides or proteins and collectively comprising at least a portion of the diversity of the family, the library being produced using the methods of claims 7, 8, 9 or 10.
15. A library comprising a collection of members of a diverse family of peptides, polypeptides or proteins and collectively comprising at least a portion of diversity of the family, the peptides, polypeptides or proteins being encoded by DNA sequences comprising at least in part sequences produced by cleaving single-stranded nucleic acid sequences at a desired location by a method comprising the steps of:
(i) contacting the nucleic acid with a single-stranded oligonucleotide, the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired and including a sequence that with its complement in the nucleic acid forms a restriction endonuclease recognition site that on restriction results in cleavage of the nucleic acid at the desired location; and
(ii) cleaving the nucleic acid solely at the recognition site formed by the complementation of the nucleic acid and the oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature.
16. A library comprising a collection of members of a diverse family of peptides, polypeptides or proteins and collectively comprising at least a portion of the diversity of the family, the peptides, polypeptides or proteins being encoded by DNA sequences comprising at least in part sequences produced by cleaving single-stranded nucleic acid sequences at a desired location by a method comprising the steps of:
(i) contacting the nucleic acid with a partially double-stranded oligonucleotide, the single-stranded region of the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired, and the double-stranded region of the oligonucleotide having a restriction endonuclease recognition site; and
(ii) cleaving the nucleic acid solely at the restriction endonuclease recognition cleavage site formed by the complementation of the nucleic acid and the single-stranded region of the oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature.
17. A library of claims 11, 12 or 13 wherein the genetic packages are selected from the group of phage, phagemid or yeast.
18. A library of claims 17 wherein the genetic packages are selected are phage or phagemid.
19. The methods or libraries according claims 2, 4, 6, 8, 10, 13 or 16 wherein in the restriction endonuclease recognition site is for a Type II-S restriction endonuclease.
20. The methods or libraries according to claims 1 to 19, wherein the nucleic acid is cDNA.
21. The methods or libraries according to any one of claims 1 to 20, wherein the nucleic acids encode at least a portion of an immunoglobulin.
22. The methods or libraries according to claim 21, wherein the immunoglobulin comprises a Fab or single chain Fv.
23. The methods or libraries according to claim 21 or 22, wherein the immunoglobulin comprises at least portion of a heavy chain.
24. The method or libraries according to claim 23, wherein the heavy chain is IgM, IgG, IgA, IgE or IgD.
25. The methods or libraries according to claim 23 or 24, wherein at least a portion of the heavy chain is human.
26. The methods or libraries according to claim 21 or 22, wherein the immunoglobulin comprises at least a portion of FR1.
27. The methods or libraries according to claim 26, wherein at least a portion of the FR1 is human.
28. The methods or libraries according to claim 21 or 22, wherein the immunoglobulin comprises at least a portion of a light chain.
29. The methods or libraries according to claim 28, wherein at least a portion of the light chain is human.
30. The methods or libraries according to any one of claims 1 to 16, wherein the nucleic acid sequences are at least in part derived from patients suffering from at least one autoimmune disease and/or cancer.
31. The methods or libraries according to claim 30, wherein the autoimmune disease is selected from the group comprising lupus, erythematosus, systemic sclerosis, rheumatoid arthritis, antiphosolipid syndrome or vasculitis.
32. The methods or libraries according to claim 30, wherein the nucleic acids are at least in part isolated from the group comprising peripheral blood cells, bone marrow cells spleen cells or lymph node cells.
33. The methods according to claim 5, 6, 9 or 10 further comprising at least one nucleic acid amplification step between one or more of steps (i) and (ii), steps (ii) and (iii) or between steps (iii) and (iv).
34. The method according to claim 33, wherein amplification primers for the amplification step are functionally complementary to a constant region of the nucleic acids.
35. The method according to claim 34, wherein the constant region is genetically constant in the nucleic acids.
36. The method according to claim 35, wherein the genetically constant region is a part of the genome of immunoglobulin genes selected from the group of IgM, IgG, IgA, IgE or IgD.
37. The method according to claim 34, wherein the constant region is exogenous to the nucleic acids.
38. The methods according to claim 33, wherein the amplification step uses geneRACE™.
39. The methods or libraries according to any one of claims 1 to 16, wherein the chosen temperature is between 37° C. and 75° C.
40. The methods or libraries according to claim 39, wherein the chosen temperature is between 45° C. and 75° C.
41. The methods or libraries according to claim 40, wherein the chosen temperature is between 50° C. and 60° C.
42. The methods or libraries according to claim 41, wherein the chosen temperature is between 55° C. and 60° C.
43. The methods or libraries according to claim 1, 3, 5, 7, 9, 12 or 15, wherein the length of the single-stranded oligonucleotide is between 17 and 30 bases.
44. The methods or libraries according to claim 43, wherein the length of the single-stranded oligonucleotide is between 18 and 24 bases.
45. The methods or libraries according to claim 1, 3, 5, 7, 9, 12 or 15, wherein the restriction endonuclease is selected from the group comprising MaeIII, Tsp45I, HphI, BsaJI, AluI, BlpI, DdeI, BglII, MslI, BsiEI, EaeI, EagI, HaeIII, Bst4CI, HpyCH4III, HinfI, MlyI, PleI, MnlI, HpyCH4V, BsmAI, BpmI, XmnI, or SacI.
46. The methods or libraries according to claim 45, wherein the restriction endonuclease is selected from the group comprising Bst4CI, TaaI, HpyCH4III, BlpI, HpyCH4V or MslI.
47. The methods or libraries according to claim 2, 4, 6, 8, 10, 13 or 16, wherein the length of the single-stranded region of the partially double-stranded oligonucleotide is between 14 and 22 bases.
48. The methods or libraries according to claim 47, wherein the length of the single-stranded region of the partially double-stranded oligonucleotide is between 14 and 17 bases.
49. The methods or libraries according to claim 47, wherein the length of the single-stranded region of the oligonucleotide is between 18 and 20 bases.
50. The methods or libraries according to claim 2, 4, 6, 8, 10, 13 or 16, wherein the length of the double-stranded region of the partially double-stranded oligonucleotide is between 10 and 14 base pairs formed by a stem and its palindrome.
51. The methods or libraries according to claim 50 wherein, the partially double-stranded oligonucleotide comprises a loop of 3 to 8 bases between the stem and the palindrome.
52. The methods or libraries according to claim 19 wherein the Type II-S restriction endonuclease is selected from the group comprising AarICAC, AceIII, Bbr7I, BbvI, BbvII, Bce83I, BceAI, BcefI, BciVI, BfiI, BinI, BscAI, BseRI, BsmFI, BspMI, EciI, Eco57I, FauI, FokI, GsuI, HgaI, HphI, MboII, MlyI, MmeI, MnlI, PleI, RleAI, SfaNI, SspD5I, Sth132I, StsI, TaqII, Tth111II, or UbaPI.
53. The methods or libraries according to claim 52, wherein the Type II-S restriction endonuclease is FokI.
54. A method for preparing single-stranded nucleic acids, the method comprising the steps of:
(i) contacting a single-stranded nucleic acid sequence that has been cleaved with a restriction endonuclease with a partially double-stranded oligonucleotide, the single-stranded region of the oligonucleotide being functionally complementary to the nucleic acids in the region that remains after cleavage, the double-stranded region of the oligonucleotide including any sequences necessary to return the sequences that remain after cleavage into proper and original reading frame for expression and containing a restriction endonuclease recognition site 5′ of those sequences; and
(ii) cleaving the partially double-stranded oligonucleotide sequence solely at the restriction endonuclease recognition site contained within the double-stranded region of the partially double-stranded oligonucleotide.
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature.
55. The method according to claim 54, wherein the length of the single-stranded portion of the partially double-stranded oligonucleotide is between 2 and 15 bases.
56. The method according to claim 55, wherein the length of the single-stranded portion of the partially double-stranded oligonucleotide is between 7 and 10 bases.
57. The method according to claim 54, wherein the length of the double-stranded portion of the partially double-stranded oligonucleotide is between 12 and 100 base pairs.
58. The method according to claim 57, wherein the length of the double-stranded portion of the partially double-stranded oligonucleotide is between 20 and 100 base pairs.
59. A method for preparing a library comprising a collection of genetic packages that display a member of a diverse family of peptides, polypeptides or proteins and that collectively display at least a portion of the family comprising the steps:
(i) preparing a collection of nucleic acids that code at least in part for members of the diverse family;
(ii) rendering the nucleic acids single-stranded;
(iii) cleaving the single-stranded nucleic acids at a desired location by a method comprising the steps of:
(a) contacting the nucleic acid with a single-stranded oligonucleotide, the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired and including a sequence that with its complement in the nucleic acid forms a restriction endonuclease recognition site that on restriction results in cleavage of the nucleic acid at the desired location; and
(b) cleaving the nucleic acid solely at the recognition site formed by the complementation of the nucleic acid and the oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature;
(iv) contacting the nucleic acid with a partially double-stranded oligonucleotide, the single-stranded region of the oligonucleotide being functionally complementary to the nucleic acids in the region that remains after the cleavage in step (iii) has been effected, and the double-stranded region of the oligonucleotide including any sequences necessary to return the sequences that remain after cleavage into proper and original reading frame for display and containing a restriction endonuclease recognition site 5′ of those sequences that is different from the restriction site used in step (iii); and
(v) cleaving the nucleic acid solely at the restriction endonuclease recognition cleavage site contained within the double-stranded region of the partially double-stranded oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the restriction being carried out using a cleavage endonuclease that is active at the chosen temperature; and
(vi) displaying a member of the family of peptides, polypeptides or proteins coded, at least in part, by the cleaved nucleic acids on the surface of the genetic package and collectively displaying at least a portion of the diversity of the family.
60. A method for preparing a library comprising a collection of members of a diverse family of peptides, polypeptides or proteins and collectively comprising at least a portion of the family comprising the steps:
(i) preparing a collection of nucleic acids that code at least in part for members of the diverse family;
(ii) rendering the nucleic acids single-stranded;
(iii) cleaving the single-stranded nucleic acids at a desired location by a method comprising the steps of:
(a) contacting the nucleic acid with a single-stranded oligonucleotide, the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired and including a sequence that with its complement in the nucleic acid forms a restriction endonuclease recognition site that on restriction results in cleavage of the nucleic acid at the desired location; and
(b) cleaving the nucleic acid solely at the recognition site formed by the complementation of the nucleic acid and the oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature;
(iv) contacting the nucleic acid with a partially double-stranded oligonucleotide, the single-stranded region of the oligonucleotide being functionally complementary to the nucleic acids in the region that remains after the cleavage in step (iii) has been effected, and the double-stranded region of the oligonucleotide including any sequence necessary to return the sequences that remain after cleavage into proper and original reading frame for expression and containing a restriction endonuclease recognition site 5′ of those sequences that is different from the restriction site used in step (iii); and
(v) cleaving the nucleic acid solely at the restriction endonuclease recognition cleavage site contained within the double-stranded region of the partially double-stranded oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the restriction being carried out using a cleavage endonuclease that is active at the chosen temperature; and
(vi) expressing a member of the family of peptides, polypeptides or proteins coded, at least in part, by the cleaved nucleic acids and collectively expressing at least a portion of the diversity of the family.
61. The methods according to claim 59 or 60, further comprising at least one nucleic acid amplification step between one or more of steps (i) and (ii), steps (ii) and (iii), steps (iii) and (iv) and steps (iv) and (v).
62. A library comprising a collection of genetic packages that display a member of a diverse family of peptides, polypeptides or proteins and collectively display at least a portion of the diversity of the family, the library being produced using the methods of claims 59 or 61.
63. A library comprising a collection of members of a diverse family of peptides, polypeptides or proteins and collectively comprise at least a portion of the diversity of the family, the library being produced using the methods of claims 60 or 61.
64. The methods and libraries according to any one of claim 59 to 63, wherein the members of the library encode immunoglobulins.
65. The method and libraries according to claim 64, wherein the double-stranded region of the oligonucleotide encodes at least a part of a framework sequence of an immunoglobulin.
66. The method and libraries according to claim 65, wherein the framework sequence comprises framework 1 of an antibody.
67. The method and libraries according to claim 66, wherein the framework sequence comprises framework 1 of a variable domain of a light chain.
68. The method and libraries according to claim 66, wherein the framework sequence comprises framework 1 of a variable domain of a heavy chain.
69. The method and libraries according to claim 65, wherein the framework sequence comprises framework 3 of an antibody.
70. The method and libraries according to claim 69, wherein the framework sequence comprises framework 3 of a variable domain of a light chain.
71. The method and libraries according to claim 69, wherein the framework sequence is framework 3 of a variable domain of a heavy chain.
72. The method and libraries according to claim 66, wherein the 5′ primer is complementary to a region outside framework 1.
73. The method according to claim 61, wherein amplification primers for the amplification step are functionally complementary to a constant region of the nucleic acids.
74. The method according to claim 73, wherein the constant region is genetically constant in the nucleic acids.
75. The method according to claim 74, wherein the genetically constant region is part of the genome of immunoglobulin genes selected from the group of IgM, IgG, IgA, IgE or IgD.
76. The method according to claim 73, wherein the constant region is exogenous to the nucleic acids.
77. The methods according to claim 61, wherein the amplification step uses geneRACE™.
78. A vector comprising:
(i) a DNA sequence encoding an antibody variable region linked to a version of PIII anchor which does not mediate infection of phage particles; and
(ii) wild-type gene III.
79. The vector according to claim 78, wherein the DNA encodes a Fab.
80. The vector according to claim 78, wherein the DNA encodes heavy chain VHCH1.
81. The vector according to claim 80, wherein the heavy chain VHCH1 is linked to trpIII.
82. The vector according to claim 78, wherein the DNA encodes light chain VLCL.
83. The vector according to claim 82, wherein the light chain VLCL is linked to trpIII.
84. The vector according to claim 78, wherein the DNA encodes scFv.
85. The vector according to claim 84, wherein the scFv is VL-VH.
86. The vector according to claim 84, wherein the scFv is VH-VL.
87. The vector according to claim 78, wherein the DNA sequence encoding an antibody variable region linked to a version of PIII anchor further comprises an inducible promoter.
88. The vector according to claim 87, wherein the inducible promoter regulates expression of the DNA sequence encoding an antibody variable region linked to a version of PIII anchor.
89. The vector according to claim 78, wherein the DNA sequence encoding an antibody variable region linked to a version of PIII anchor further comprises an amber stop codon.
90. The vector according to claim 89, wherein the DNA encoding the amber stop codon is located between the antibody variable region and the version of pIII.
91. The vector according to any one of claims 78 to 90 wherein the vector is phage or phagemid.
92. A method for producing a population of immunoglobulin genes that comprises steps of:
(i) introducing synthetic diversity into at least one of CDR1 or CDR2 of those genes; and
(ii) combining the diversity from step (i) with CDR3 diversity captured from B cells.
93. The method according to claim 92, wherein synthetic diversity is introduced into both CDR1 and CDR2.
94. A method for producing a library of immunoglobulin genes that comprises
(i) introducing synthetic diversity into at least one of CDR1 or CDR2 of those genes; and
(ii) combining the diversity from step (i) with CDR3 diversity captured from B cells.
95. The method according to claim 94, wherein synthetic diversity is introduced into both CDR1 and CDR2.
96. A library of immunoglobulins that comprise members with at least one variable domain in which at least one of CDR1 and CDR2 contain synthetic diversity and CDR3 diversity is captured from B cells.
97. A library according to claim 96, where both CDR1 and CDR2 contain synthetic diversity.
98. The vector according to claim 78, wherein the version of PIII anchor is characterized by a wild type amino acid sequence and is encoded by a non-wild type degenerate DNA sequence to a very high extent.
99. In a method for displaying a member of a diverse family of peptides, polypeptides or proteins on the surface of a genetic package and collectively displaying at least a part of the diversity of the family, the improvement being characterized in that the displayed peptide, polypeptide or protein is encoded by a DNA sequence comprising a nucleic acid that has been cleaved at a desired location by
(i) contacting the nucleic acid with a partially double-stranded oligonucleotide, the single-stranded region of the oligonucleotide being functionally complementary to the nucleic acid at its 5′ terminal and
(ii) cleaving the nucleic acid solely at a restriction endonuclease cleavage site located in the double-stranded region of the oligonucleotide or amplifying the nucleic acid using a primer at least in part functionally complementary to at least a part of the double-stranded region of the oligonucleotide, the primer also introducing on amplification an endonuclease cleavage site and cleaving the amplified nucleic acid sequence solely at that site;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature.
100. A method for displaying a member of a diverse family of peptides, polypeptides or proteins on the surface of a genetic package and collectively displaying at least a portion of the diversity of the family, the method comprising the steps of:
(i) preparing a collection of nucleic acids that code, at least in part, for members of the diverse family;
(ii) rendering the nucleic acids single-stranded;
(iii) cleaving the single-stranded nucleic acids at a desired location by a method comprising the steps of:
(a) contacting the nucleic acid with a partially double-stranded oligonucleotide, the single-stranded region of the oligonucleotide being functionally complementary to the nucleic acid at its 5′ terminal region; and
(b) cleaving the nucleic acid solely at a restriction endonuclease cleavage site located in the double-stranded region of the oligonucleotide or amplifying the nucleic acid using a primer at least in part functionally complementary to at least a part of the double-stranded region of the oligonucleotide, the primer also introducing on amplification an endonuclease cleavage site and cleaving the amplified nucleic acid sequence solely at that site;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the restriction being carried out using a cleavage endonuclease that is active at the chosen temperature; and
(iv) displaying a member of the family of peptides, polypeptides or proteins coded, at least in part, by the cleaved nucleic acids on the surface of the genetic package and collectively displaying at least a portion of the diversity of the family.
101. In a method for expressing a member of a diverse family of peptides, polypeptides or proteins and collectively expressing at least a part of the diversity of the family, the improvement being characterized in that the expressed peptide, polypeptide or protein is encoded by a DNA sequence comprising a nucleic acid that has been cleaved at a desired location by
(i) contacting the nucleic acid with a partially double-stranded oligonucleotide, the single-stranded region of the oligonucleotide being functionally complementary to the nucleic acid at its 5′ terminal region; and
(ii) cleaving the nucleic acid solely at the restriction endonuclease cleavage site located in the double-stranded region of the oligonucleotide or amplifying the nucleic acid using a primer at least in part functionally complementary to at least a part of the double-stranded region of the oligonucleotide, the primer also introducing on amplification an endonuclease cleavage site and cleaving the amplified nucleic acid sequence solely at that site;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature.
102. A method for expressing a member of a diverse family of peptides, polypeptides or proteins and collectively expressing at least a portion of the diversity of the family, the method comprising the steps of:
(i) preparing a collection of nucleic acids that code, at least in part, for members of the diverse family;
(ii) rendering the nucleic acids single-stranded;
(iii) cleaving the single-stranded nucleic acids at a desired location by a method comprising the steps of:
(a) contacting the nucleic acid with a partially double-stranded oligonucleotide, the single-stranded region of the oligonucleotide being functionally complementary to the nucleic acid at its 5′ terminal region; and
(b) cleaving the nucleic acid solely at a restriction endonuclease cleavage site located in the double-stranded region of the nucleotide; or amplifying the nucleic acid using a primer at least in part functionally complementary to at least a part of the double-stranded region of the oligonucleotide, the primer also introducing on amplification an endonuclease cleavage site and cleaving the amplified nucleic acid sequence solely at that site;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the restriction being carried out using a cleavage endonuclease that is active at the chosen temperature; and
(iv) expressing a member of the family of peptides, polypeptides or proteins coded, at least in part, by the cleaved nucleic acids and collectively expressing at least a portion of the diversity of the family.
103. A method for preparing a library comprising a collection of genetic packages that display a member of a diverse family of peptides, polypeptides or proteins and that collectively display at least a portion of the family comprising the steps:
(i) preparing a collection of nucleic acids that code at least in part for members of the diverse family;
(ii) rendering the nucleic acids single-stranded;
(iii) cleaving the single-stranded nucleic acids at a desired location by a method comprising the steps of:
(a) contacting the nucleic acid with a single-stranded oligonucleotide, the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired and including a sequence that with its complement in the nucleic acid forms a restriction endonuclease recognition site that on restriction results in cleavage of the nucleic acid at the desired location; and
(b) cleaving the nucleic acid solely at the recognition site formed by the complementation of the nucleic acid and the oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature;
(iv) contacting the nucleic acid with a partially double-stranded oligonucleotide, the single-stranded region of the oligonucleotide being functionally complementary to the nucleic acids in the 5′ terminal region that remains after the cleavage in step (iii) has been effected, and the double-stranded region of the oligonucleotide including any sequences necessary to return the sequences that remain after cleavage into proper and original reading frame for display; and
(v) cleaving the nucleic acid solely at a restriction endonuclease cleavage site contained within the double-stranded region of the partially double-stranded oligonucleotide, the site being different from that used in step (iii) or amplifying the nucleic acid using a primer at least in part functionally complementary to at least a part of the double-stranded region of the oligonucleotide, the primer also introducing on amplification an endonuclease cleavage site and cleaving the amplified nucleic acid sequence solely at that site;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the restriction being carried out using a cleavage endonuclease that is active at the chosen temperature; and
(vi) displaying a member of the family of peptides, polypeptides or proteins coded, at least in part, by the cleaved nucleic acids on the surface of the genetic package and collectively displaying at least a portion of the diversity of the family.
104. A method for preparing a library comprising a collection of members of a diverse family of peptides, polypeptides or proteins and collectively comprising at least a portion of the family comprising the steps:
(i) preparing a collection of nucleic acids that code at least in part for members of the diverse family;
(ii) rendering the nucleic acids single-stranded;
(iii) cleaving the single-stranded nucleic acids at a desired location by a method comprising the steps of:
(a) contacting the nucleic acid with a single-stranded oligonucleotide, the oligonucleotide being functionally complementary to the nucleic acid in the region in which cleavage is desired and including a sequence that with its complement in the nucleic acid forms a restriction endonuclease recognition site that on restriction results in cleavage of the nucleic acid at the desired location; and
(b) cleaving the nucleic acid solely at the recognition site formed by the complementation of the nucleic acid and the oligonucleotide;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the cleavage being carried out using a restriction endonuclease that is active at the chosen temperature;
(iv) contacting the nucleic acid with a partially double-stranded oligonucleotide, the single-stranded region of the oligonucleotide being functionally complementary to the nucleic acids in the 5′ terminal region that remains after the cleavage in step (iii) has been effected, and the double-stranded region of the oligonucleotide including any sequence necessary to return the sequences that remain after cleavage into proper and original reading frame for expression; and
(v) cleaving the nucleic acid solely at a restriction endonuclease cleavage site contained within the double-stranded region of the partially double-stranded oligonucleotide, the site being different from that used in step (iii) or amplifying the nucleic acid using a primer at least in part functionally complementary to at least a part of the double-stranded region of the oligonucleotide, the primer introducing on amplification an endonuclease cleavage site and cleaving the amplified nucleic acid sequence solely at that site;
the contacting and the cleaving steps being performed at a temperature sufficient to maintain the nucleic acid in substantially single-stranded form, the oligonucleotide being functionally complementary to the nucleic acid over a large enough region to allow the two strands to associate such that cleavage may occur at the chosen temperature and at the desired location, and the restriction being carried out using a cleavage endonuclease that is active at the chosen temperature; and
(vi) expressing a member of the family of peptides, polypeptides or proteins coded, at least in part, by the cleaved nucleic acids and collectively expressing at least a portion of the diversity of the family.
105. A library of immunoglobins comprising members having at least one variable domain in which one or both of the CDR 1 and CDR 2 have synthetic diversity and the CDR 3 has diversity captured from B-Cells.
106. The library according to claim 104, wherein a first variable domain has synthetic diversity in CDR 1 and CDR 2 and has diversity in CDR 3 captured from B-cells and a second variable domain has diversity captured from B-cells.
107. The library according to claim 104 or 105, wherein the variable domain is selected from the group of VH or VL.
108. A method for cleaving a nucleic acid sequence at a desired location, the method comprising the steps of:
(i) contacting a single-stranded nucleic acid sequence with a partially double-stranded oligonucleotide, the single-stranded region of the oligonucleotide being functionally complementary to the 5′ terminal region of the nucleic acid sequence, the double-stranded region of the oligonucleotide including any sequences necessary to return the sequence in the single-stranded nucleic acid sequence into proper and original reading frame for expression; and
(ii) cleaving the partially double-stranded oligonucleotide-single-stranded nucleic acid combination solely at a restriction endonuclease cleavage site contained within the double-stranded oligonucleotide or amplifying the combination using a primer at least in part functionally complementary to at least part of the double-stranded region of the oligonucleotide, the primer introducing during amplification an endonuclease cleavage site and cleaving the amplified sequence solely at the site.
109. The method according to claim 108, wherein the length of the single-stranded portion of the partially double-stranded oligonucleotide is between 2 and 15 bases.
110. The method according to claim 109, wherein the length of the single-stranded portion of the partially double-stranded oligonucleotide is between 7 and 10 bases.
111. The method according to claim 108, wherein the length of the double-stranded portion of the partially double-stranded oligonucleotide is between 12 and 100 base pairs.
112. The method according to claim 111, wherein the length of the double-stranded portion of the partially double-stranded oligonucleotide is between 20 and 100 base pairs.
113. The methods according to any one of claims 99 to 104 and 108, further comprising at least one nucleic acid amplification step between one or more of steps (i) and (ii), steps (ii) and (iii), steps (iii) and (iv) and steps (iv) and (v).
114. A library comprising a collection of genetic packages that display a member of a diverse family of peptides, polypeptides or proteins and collectively display at least a portion of the diversity of the family, the library being produced using the methods of claims 99, 100, 103 or 113.
115. A library comprising a collection of members of a diverse family of peptides, polypeptides or proteins and collectively comprise at least a portion of the diversity of the family, the library being produced using the methods of claims 101, 102, 104 or 113.
116. The methods and libraries according to any one of claims 99 to 104 or 113, wherein the members of the library encode immunoglobulins.