Patent application title:

ANTITUMOR AGENT FOR THYROID CANCER

Publication number:

US20090209580A1

Publication date:
Application number:

12/301,353

Filed date:

2007-05-17

Abstract:

The objective of the present invention is to provide a pharmaceutical composition and a therapeutic method that are specifically effective against at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract.

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide and analogs thereof are specifically effective against at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12Q1/6886 »  CPC main

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer

A61P1/00 »  CPC further

Drugs for disorders of the alimentary tract or the digestive system

A61P5/18 »  CPC further

Drugs for disorders of the endocrine system of the parathyroid hormones

A61P35/00 »  CPC further

Antineoplastic agents

A61P43/00 »  CPC further

Drugs for specific purposes, not provided for in groups -

C07D215/22 »  CPC further

Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms; Oxygen atoms attached in position 2 or 4

C12Q2600/106 »  CPC further

Oligonucleotides characterized by their use Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism

A61K31/47 »  CPC further

Medicinal preparations containing organic active ingredients; Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom Quinolines; Isoquinolines

C07D215/00 IPC

Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems

C12Q1/48 IPC

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving transferase

C12Q1/68 IPC

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids

G01N33/573 IPC

Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing; Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes

Description

CROSS REFERENCE TO PRIOR RELATED APPLICATIONS

This application is a U.S. national phase application under 35 U.S.C. § 371 of International Patent Application No. PCT/JP2007/060560, filed on May 17, 2007, and claims the benefit of U.S. Provisional Patent Application No. 60/747,570, filed on May 18, 2006, both of which are incorporated by reference herein. The International Application was published in Japanese on Nov. 29, 2007, as International Publication No. WO 2007/136103 A1 under PCT Article 21(2).

FIELD OF THE INVENTION

The present invention relates to a therapeutic agent and a method containing a substance that inhibits RET kinase activity (hereinafter, also referred to as an “RET kinase inhibiting substance”) for treating at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract, to use of an RET kinase inhibiting substance for producing said therapeutic agent and to an RET kinase inhibiting substance for said therapeutic agent.

The present invention also relates to a therapeutic agent and a method containing an RET kinase inhibiting substance for treating thyroid carcinoma, to use of an RET kinase inhibiting substance for producing said therapeutic agent and to an RET kinase inhibiting substance for said therapeutic agent.

Moreover, the present invention relates to a pharmaceutical composition containing an RET kinase inhibiting substance for administering to an organism having a cell expressing mutant RET, to a method for treating a disease including administration to an organism having a cell expressing mutant RET, to use of an RET kinase inhibiting substance for producing said pharmaceutical composition and to an RET kinase inhibiting substance for said pharmaceutical composition.

The present invention also relates to an RET kinase inhibitor.

Furthermore, the present invention relates to a method for predicting the effect of an RET kinase inhibiting substance on a patient using the presence or the absence of RET mutation in the cell as an indication.

BACKGROUND OF THE INVENTION

RET is one of the receptor tyrosine kinases and is a cell surface molecule that transduces signals for cell growth and differentiation.

RET mutation is known to be involved in diseases such as multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, sporadic medullary thyroid carcinoma, papillary thyroid carcinoma and Hirschsprung disease. (Oncogene, 19, 5590-5597, 2000; Cancer Research, 15, 7284-7290, 2002.) RET kinase inhibiting substance has been suggested as a potentially effective therapeutic agent for said diseases. (Oncogene, 19, 5590-5597, 2000; Cancer Research, 15, 7284-7290, 2002.)

Mutation of one of five cysteine residues at codons 609, 611, 618, 620 and 634 of RET is found in 93-98% of the patients with multiple endocrine neoplasia, type IIA, where mutation at RET codon 634 is found most frequently. (Cancer Research, 66, 1177-1180, 2006; Journal of Clinical Endocrinology and Metabolism, 88, 5438-5443, 2003.)

On the other hand, mutation M918T (mutation from methionine to tyrosine at codon 918) of RET is found in 95% of the patients with multiple endocrine neoplasia, type IIB. (Journal of Clinical Endocrinology and Metabolism, 88, 5438-5443, 2003.)

Mutation at one of RET codons 609, 611, 618, 620, 634, 768, 790, 791, 804 and 891 is found in many of the patients with familial medullary thyroid carcinoma. (Journal of Clinical Endocrinology and Metabolism, 88, 5438-5443, 2003.)

All of these point mutations are known to cause constant ligand-independent RET activation. (Cancer Research, 66, 1177-1180, 2006; Journal of Clinical Endocrinology and Metabolism, 88, 5438-5443, 2003.)

A syndrome of multiple endocrine neoplasia, type IIA is characterized by medullary thyroid carcinoma, pheochromocytoma and parathyroid hyperplasia whereas a syndrome of multiple endocrine neoplasia, type IIB is associated with medullary thyroid carcinoma, pheochromocytoma and mucosal neuromas of the gastrointestinal tract. Chief symptom of syndrome of familial medullary thyroid carcinoma is medullary thyroid carcinoma. (Journal of Clinical Endocrinology and Metabolism, 89, 4142-4145, 2004.)

Point mutation of RET somatic cells is found in about 40% of the patients with sporadic medullary thyroid carcinoma while mutations are mostly found at codon 918. (Journal of Clinical Endocrinology and Metabolism, 89, 5823-5827, 2004.)

Moreover, a fusion gene of RET gene and other gene, namely, rearrangement of RET gene, is found in papillary thyroid carcinoma due to chromosomal inversions or chromosomal translocation. The fusion protein generated via RET gene rearrangement is known to lead to ligand-independent dimerization and constant RET activation. (Endocrinology, 145, 5448-5451, 2004.)

Hirschsprung disease is characterized by persistent constipation and intestinal dilatation in newborns caused by abnormal colonic nerve plexus. One of the causes of Hirschsprung disease is known to be RET mutation. (Proceedings of the National Academy of Sciences of the United States of America, 102, 8949-8954, 2005.)

RET mutation has been reported to cause scaffold-independent proliferation and tumorigenesis in NIH3T3 cells. (Cancer Research, 15, 7284-7290, 2002.)

RET kinase inhibiting substance ZD6474 has been reported to suppress scaffold-independent proliferation in NIH3T3 cells transformed with mutant RET and inhibited tumor formation after infusion of said cells into nude mice. (Cancer Research, 15, 7284-7290, 2002.)

RET kinase inhibiting substance BAY 43-9006 has been reported to reduce the size of tumor in a model for subcutaneous transplantation of human medullary thyroid carcinoma cell line (TT). (Journal of the National Cancer Institute, 98, 326-334, 2006.)

Hence, RET kinase inhibiting substances are suggested to induce cell growth inhibition for cells expressing mutant RET and show antitumor effect against these tumor cells. RET kinase inhibiting substances also appear to be effective against diseases caused by RET mutation.

Thus, RET kinase inhibiting substances are expected to be effective against multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia, mucosal neuromas of the gastrointestinal tract and thyroid carcinoma.

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide and analogs thereof are known as angiogenesis inhibiting substances. (International Publication No. 02/32872, pamphlet; International Publication No. 2004/080462, pamphlet; International Publication No. 2005/063713, pamphlet.)

However, none has reported as to what 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide and analogs thereof have RET kinase-inhibiting activity.

SUMMARY OF THE INVENTION

The present invention was achieved regarding the circumstances described above and the problems to be solved by the invention are to provide a therapeutic agent and a method for treating at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract as well as thyroid carcinoma, and to provide a pharmaceutical composition and a therapeutic method highly effective for organisms including cells expressing mutant RET. Another problem to be solved by the invention is to provide an RET kinase inhibitor. Yet another problem to be solved by the invention is to provide a method for predicting the effect of 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide and analogs thereof.

In order to solve the above-mentioned problems, the present inventors have gone through keen research and found that 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide has RET kinase-inhibiting activity and that 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide and analogs thereof are highly effective against at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract as well as thyroid carcinoma. The present inventors have also found that 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide and analogs thereof are highly effective for organisms including cells expressing mutant RET and further found that the effect of 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide and analogs thereof can be predicted using the presence or the absence of RET mutation in the cell as an indication.

Thus, the present invention relates to a therapeutic agent containing an RET kinase inhibiting substance for treating at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract.

It also relates to a therapeutic agent for treating thyroid carcinoma, containing an RET kinase inhibiting substance.

It further relates to a pharmaceutical composition containing an RET kinase inhibiting substance for administering to an organism containing a cell expressing mutant RET.

It further relates to a method for treating at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract, the method including administering an effective amount of an RET kinase inhibiting substance to a patient.

It further relates to a method for treating thyroid carcinoma, including administering an effective amount of an RET kinase inhibiting substance to a patient.

It further relates to a method for treating a disease, including administering an effective amount of an RET kinase inhibiting substance to an organism containing a cell expressing mutant RET.

It further relates to use of an RET kinase inhibiting substance for producing a therapeutic agent for treating at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract.

It further relates to use of an RET kinase inhibiting substance for producing a therapeutic agent for treating thyroid carcinoma.

It further relates to use of an RET kinase inhibiting substance for producing a pharmaceutical composition containing the RET kinase inhibiting substance, for administering to an organism containing a cell expressing mutant RET.

It further relates to an RET kinase inhibiting substance for a therapeutic agent for treating at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract.

It further relates to an RET kinase inhibiting substance for a therapeutic agent for treating thyroid carcinoma.

It further relates to an RET kinase inhibiting substance for a pharmaceutical composition containing the RET kinase inhibiting substance, for administering to an organism containing a cell expressing mutant RET.

It further relates to a method for predicting whether a patient is highly sensitive to an RET kinase inhibiting substance, including using the presence or the absence of RET mutation in the cell as an indication.

It further relates to a method for analyzing sensitivity of a cell to an RET kinase inhibiting substance, including determining the presence or the absence of RET mutation in the cell.

It further relates to a method for selecting a cell highly sensitive to an RET kinase inhibiting substance, including determining the presence or the absence of RET mutation in the cell.

It further relates to a method for selecting a patient highly sensitive to an RET kinase inhibiting substance, including determining the presence or the absence of RET mutation in the cell.

It further relates to a method for classifying a patient according to the result obtained from an analysis of sensitivity of the patient to an RET kinase inhibiting substance, including determining the presence or the absence of RET mutation in the cell.

It further relates to a method for selecting a patient intended for administration of an RET kinase inhibiting substance, including determining the presence or the absence of RET mutation in the cell, and selecting a patient containing a cell expressing mutant RET from the determination results.

It further relates to a method for predicting a therapeutic effect of an RET kinase inhibiting substance on a patient, including determining the presence or the absence of RET mutation in a cell.

It further relates to a method for determining the presence or the absence of RET mutation in the cell from a patient for predicting the sensitivity of the patient to an RET kinase inhibiting substance.

Said RET kinase inhibiting substance may be a compound represented by General Formula (I)

[wherein, R1 represents a group represented by Formula —V1—V2—V3 (wherein, V1 represents C1-6 alkylene group that may have a substituent; V2 represents a single bond, an oxygen atom, a sulfur atom, carbonyl group, sulfinyl group, sulfonyl group, group represented by Formula —CONR6—, group represented by Formula —SO2NR6—, group represented by Formula —NR6SO2—, group represented by Formula —NR6CO— or group represented by Formula —NR6— (wherein, R6 represents a hydrogen atom, C1-6 alkyl group that may have a substituent or C3-8 cycloalkyl group that may have a substituent); V3 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent);

R2 represents cyano group, C1-6 alkoxy group that may have a substituent, carboxyl group, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVa11Va12 (wherein, Va11 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent; Va12 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent, 3-10-membered non-aromatic heterocyclic group that may have a substituent, hydroxyl group, C1-6 alkoxy group that may have a substituent or C3-8 cycloalkoxy group that may have a substituent);

Y1 represents a group represented by Formula

(wherein, R7 and R8 each independently represent a hydrogen atom, a halogen atom, cyano group, nitro group, amino group, C1-6 alkyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C1-6 alkoxy group that may have a substituent, C1-6 alkylthio group that may have a substituent, formyl group, C2-7 acyl group that may have a substituent, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVd1Vd2 (wherein, Vd1 and Vd2 each independently represent a hydrogen atom or C1-6 alkyl group that may have a substituent);

W1 and W2 each independently represent a carbon atom or a nitrogen atom that may have a substituent);

R3 and R4 each independently represent a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C2-7 acyl group that may have a substituent or C2-7 alkoxycarbonyl group that may have a substituent; and

R5 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent],

a pharmacologically acceptable salt thereof or a solvate thereof.

Moreover, the RET kinase inhibiting substance may be at least one compound selected from 5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrrole-3-carboxylic acid (2-diethylaminoethyl)amide, N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N′-(5-methyl-3-isoxazolyl)urea and 4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)propoxy]quinazoline, a pharmacologically acceptable salt thereof or a solvate thereof.

The present invention further relates to an RET kinase inhibitor containing the compound represented by General Formula (I), a pharmacologically acceptable salt thereof or a solvate thereof.

It further relates to an RET kinase inhibitor containing at least one compound selected from

  • 5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrrole-3-carboxylic acid(2-diethylaminoethyl)amide,
  • N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N′-(5-methyl-3-isoxazolyl)urea and
  • 4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)propoxy]quinazoline,

a pharmacologically acceptable salt thereof or a solvate thereof.

The present invention also relates to a therapeutic agent containing 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof for treating at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract.

It further relates to a therapeutic agent containing 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof for treating thyroid carcinoma.

It further relates to a pharmaceutical composition containing 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof for administering to an organism containing a cell expressing mutant RET.

It further relates to a method for treating at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract, the method including administering an effective amount of 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof to a patient.

It further relates to a method for treating thyroid carcinoma, including administering an effective amount of 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof to a patient.

It further relates to a method for treating a disease, including administering an effective amount of 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof to an organism containing a cell expressing mutant RET.

It further relates to use of 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof for producing a therapeutic agent for treating at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract.

It further relates to use of 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof for producing a therapeutic agent for treating thyroid carcinoma.

It further relates to use of 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof for producing a pharmaceutical composition containing an RET kinase inhibiting substance for administering to an organism containing a cell expressing mutant RET.

It further relates to 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof for a therapeutic agent for treating at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract.

It further relates to 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof for a therapeutic agent for treating thyroid carcinoma.

It further relates to 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof for a pharmaceutical composition containing an RET kinase inhibiting substance for administering to an organism containing a cell expressing mutant RET.

It further relates to a method for predicting whether a patient is highly sensitive to 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof, the method including using the presence or the absence of RET mutation in the cell as an indication.

It further relates to a method for analyzing sensitivity of a cell to 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof, the method including determining the presence or the absence of RET mutation in the cell.

It further relates to a method for selecting a cell highly sensitive to 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof, the method including determining the presence or the absence of RET mutation in the cell.

It further relates to a method for selecting a patient highly sensitive to 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof, the method including determining the presence or the absence of RET mutation in the cell.

It further relates to a method for classifying a patient according to the result obtained from an analysis of sensitivity of the patient to 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof, the method including determining the presence or the absence of RET mutation in the cell.

It further relates to a method for selecting a patient intended for administration of 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof, the method including determining the presence or the absence of RET mutation in the cell and selecting a patient containing a cell expressing mutant RET from the determination results.

It further relates to a method for predicting a therapeutic effect of 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof on a patient, the method including determining the presence or the absence of RET mutation in a cell.

It further relates to a method for determining the presence or the absence of RET mutation in the cell from a patient, for predicting the sensitivity of the patient to 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof.

It further relates to an RET kinase inhibitor containing 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof.

The present invention provides a therapeutic agent and a method containing an RET kinase inhibiting substance for treating at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract, use of an RET kinase inhibiting substance for producing said therapeutic agent and an RET kinase inhibiting substance for said therapeutic agent.

The present invention also provides a therapeutic agent and a method containing an RET kinase inhibiting substance for treating thyroid carcinoma, use of an RET kinase inhibiting substance for producing said therapeutic agent and an RET kinase inhibiting substance for said therapeutic agent.

The present invention further provides a pharmaceutical composition containing an RET kinase inhibiting substance for administering to an organism having a cell expressing mutant RET, a method for treating a disease including administering to an organism having a cell expressing mutant RET, use of an RET kinase inhibiting substance for producing said pharmaceutical composition and an RET kinase inhibiting substance for said pharmaceutical composition.

The present invention also provides an RET kinase inhibitor.

In addition, the present invention provides a method for predicting the effect of an RET kinase inhibiting substance.

More specifically, the effect of an RET kinase inhibiting substance can be predicted by using the presence or the absence of RET mutation in the cell as an indication.

Since the method according to the invention enables one to predict the effect of the compound without administering the compound to the patient, it has become possible to select a patient who is expected to be more susceptible to the compound. Thus, contribution to the patient's QOL has become possible.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows an effect of 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide on activations of RET kinase and Erk1/2 (indication being phosphorylation) in human medullary thyroid carcinoma cell line (TT) in culture. The leftmost lane is the determination of RET kinase and Erk1/2 activations (indication being phosphorylation) without addition of a test substance.

FIG. 2 shows an antitumor effect of 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide in a model for subcutaneous transplantation of human medullary thyroid carcinoma cell line (TT).

FIG. 3 shows an effect of 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide on an RET kinase in a tumor tissue of a model for subcutaneous transplantation of human medullary thyroid carcinoma cell line (TT). (A) shows the effect on RET phosphorylation 2 hours after oral administration of the test substance at each dosage (10, 30 or 100 mg/kg) while (B) shows the effect on RET phosphorylation 2, 8, 12 or 24 hours after administration of the test substance at 100 mg/kg.

DETAILED DESCRIPTION OF THE INVENTION

Hereinafter, embodiments of the present invention will be described. The following embodiments illustrate the present invention, which are not intended to limit the present invention. The present invention may be carried out in various embodiments without departing from the scope of the invention.

The documents, laid-open patent applications, patent publications and other patent documents cited herein are hereby incorporated by reference.

1. Therapeutic Agent, Pharmaceutical Composition and Therapeutic Method of the Invention

(1) RET

According to the present invention, RET is a protein encoded by ret proto-oncogene, for example, a polypeptide composed of an amino acid sequence represented by SEQ ID NO: 2 (GenBank Accession No: NM—020975) or SEQ ID NO: 4 (GenBank Accession No: NM—020630). The amino acid sequences represented by SEQ ID NO: 2 and SEQ ID NO: 4 have lengths 1114aa and 1072aa, respectively.

The ret proto-oncogene is, for example, a polynucleotide 181-3522 of the nucleotide sequence represented by SEQ ID NO: 1 (GenBank Accession No: NM—020975), or a polynucleotide 181-3396 of the nucleotide sequence represented by SEQ ID NO: 3 (GenBank Accession No: NM—020630).

Herein, these RETs may also be referred to as “wild-type RETs”.

(2) Mutant RET

According to the present invention, mutant RET is a polypeptide containing a mutated version of the wild-type RET amino acid sequence, for example, an amino acid sequence having one or several amino acids deleted, substituted, added or varied by a combination thereof in the amino acid sequence represented by SEQ ID NO: 2 or 4. An example includes a polypeptide having RET kinase activity. Preferably, mutant RET may be, for example, a polypeptide having RET kinase activity and including an amino acid sequence having one amino acid substituted in the amino acid sequence of wild-type RET (e.g., the amino acid sequence represented by SEQ ID NO: 2 or 4).

Herein, “RET kinase activity” refers to a capacity of RET to phosphorylate a tyrosine residue of itself or other protein.

Examples of mutant RETs include polypeptides including the sequences described in (i)-(xix) below.

(i) An amino acid sequence having glycine at 321 substituted with other amino acid, preferably arginine, in the amino acid sequence represented by SEQ ID NO: 2 or 4 (Journal of Endocrinology Investigation, 28, 905-909, 2005.).

(ii) An amino acid sequence having glycine at 533 substituted with other amino acid, preferably cysteine, in the amino acid sequence represented by SEQ ID NO: 2 or 4 (Journal of Clinical Endocrinology and Metabolism, 88, 5438-5443, 2003.).

(iii) An amino acid sequence having cysteine at 609 substituted with other amino acid, preferably serine, in the amino acid sequence represented by SEQ ID NO: 2 or 4 (Clin Endocrinol, 63, 676-682, 2005.).

(iv) An amino acid sequence having cysteine at 611 substituted with other amino acid, preferably serine, tyrosine or phenylalanine, in the amino acid sequence represented by SEQ ID NO: 2 or 4 (European Journal of Human Genetics, 11, 364-368, 2003, Journal of Clinical Endocrinology and Metabolism, 86, 1104-1109, 2001.).

(v) An amino acid sequence having cysteine at 618 substituted with other amino acid, preferably arginine, serine, glycine or phenylalanine, in the amino acid sequence represented by SEQ ID NO: 2 or 4 (American Journal of Pathology, 168, 1262-1275, 2006, Journal of Clinical Endocrinology and Metabolism, 86, 1104-1109, 2001.).

(vi) An amino acid sequence having cysteine at 620 substituted with other amino acid, preferably arginine or serine, in the amino acid sequence represented by SEQ ID NO: 2 or 4 (American Journal of Pathology, 168, 1262-1275, 2006, Journal of Clinical Endocrinology and Metabolism, 86, 1104-1109, 2001.).

(vii) An amino acid sequence having cysteine at 630 substituted with other amino acid, preferably arginine or tyrosine, in the amino acid sequence represented by SEQ ID NO: 2 or 4 (Thyroid, 15, 668-671, 2005, Biochemical and Biophysical Research Communications, 255, 587-590, 1999.).

(viii) An amino acid sequence having aspartic acid at 631 substituted with other amino acid, preferably tyrosine, glycine, asparagine or alanine, in the amino acid sequence represented by SEQ ID NO: 2 or 4 (Biochemical and Biophysical Research Communications, 255, 587-590, 1999.).

(ix) An amino acid sequence having cysteine at 634 substituted with other amino acid, preferably arginine, glycine, tyrosine, phenylalanine, serine or tryptophan, in the amino acid sequence represented by SEQ ID NO: 2 or 4 (Biochemical and Biophysical Research Communications, 255, 587-590, 1999, Journal of Clinical Endocrinology and Metabolism, 86, 1104-1109, 2001, Biochemical and Biophysical Research Communications, 207, 1022-1028, 1995.).

(x) An amino acid sequence having glycine at 691 substituted with other amino acid, preferably serine, in the amino acid sequence represented by SEQ ID NO: 2 or 4 (Cancer Research, 66, 1177-1180, 2006.).

(xi) An amino acid sequence having glutamic acid at 768 substituted with other amino acid, preferably aspartic acid, in the amino acid sequence represented by SEQ ID NO: 2 or 4 (Clinical Chemistry, 50, 522-529, 2004, Journal of Clinical Endocrinology and Metabolism, 86, 1104-1109, 2001.).

(xii) An amino acid sequence having leucine at 790 substituted with other amino acid, preferably phenylalanine, in the amino acid sequence represented by SEQ ID NO: 2 or 4 (Journal of Clinical Endocrinology and Metabolism, 83, 770-774, 1998, Journal of Clinical Endocrinology and Metabolism, 86, 1104-1109, 2001.).

(xiii) An amino acid sequence having tyrosine at 791 substituted with other amino acid, preferably phenylalanine, in the amino acid sequence represented by SEQ ID NO: 2 or 4 (Journal of Clinical Endocrinology and Metabolism, 83, 770-774, 1998.).

(xiv) An amino acid sequence having valine at 804 substituted with other amino acid, preferably methionine, in the amino acid sequence represented by SEQ ID NO: 2 or 4 (Journal of Clinical Endocrinology and Metabolism, 86, 1104-1109, 2001.).

(xv) An amino acid sequence having tyrosine at 806 substituted with other amino acid, preferably cysteine, in the amino acid sequence represented by SEQ ID NO: 2 or 4 (Japanese Journal of Cancer Research, 90, 1-5, 1999.).

(xvi) An amino acid sequence having arginine at 844 substituted with other amino acid, preferably leucine, in the amino acid sequence represented by SEQ ID NO: 2 or 4 (Exp Clin Endocrinol Diabetes, 108, 128-132, 2000.).

(xvii) An amino acid sequence having alanine at 883 substituted with other amino acid, preferably phenylalanine or tyrosine, in the amino acid sequence represented by SEQ ID NO: 2 or 4 (European Journal of Endocrinology, 142, 573-575, 2000, Journal of Clinical Endocrinology and Metabolism, 89, 5823-5827, 2004.).

(xviii) An amino acid sequence having serine at 891 substituted with other amino acid, preferably alanine, in the amino acid sequence represented by SEQ ID NO: 2 or 4 (Journal of Clinical Endocrinology and Metabolism, 89, 4142-4145, 2004.).

(xix) An amino acid sequence having methionine at 918 substituted with other amino acid, preferably threonine, in the amino acid sequence represented by SEQ ID NO: 2 or 4 (Clinical Cancer Research, 8, 457-463, 2002.).

In addition, mutant RETs may be those including at least one of the substitutions indicated in (i)-(xix) above, specifically those including mutation sites where at least one amino acid selected from amino acids at codons 321, 533, 609, 611, 618, 620, 630, 631, 634, 691, 768, 790, 791, 804, 806, 844, 883, 891 and 918 is substituted with other amino acid, in the amino acid sequence represented by SEQ ID NO: 2 or 4. For example, a polypeptide including an amino acid sequence containing a mutation site where valine at position 804 is substituted with other amino acid and a mutation site where tyrosine at position 806 is substituted with other amino acid in the amino acid sequence represented by SEQ ID NO: 2 is contained in mutant RET. Herein, the number and the combination of the substitutions of (i)-(xix) above to be included in mutant RET are not particularly limited.

According to the present invention, mutant RET is preferably a polypeptide including a sequence represented by (iii), (iv), (v), (vi), (ix), (xi), (xii), (xiii), (xiv), (xviii) or (xix) above, more preferably a sequence represented by (ix) or (xix).

Herein, alphabetical notation of amino acids is expressed in generally used three-letter or single-letter codes. The alphabet preceding the number indicates single-letter code of the amino acid to be substituted, the alphabet following the number indicates single-letter code of the amino acid that replaces the original amino acid, and the number indicates the position of the amino acid in the amino acid sequence. For example, as indicated in (xix) above, when methionine at position 918 is substituted with threonine, it may be indicated as “M918T”.

Moreover, the number following the codon may indicate the position of the amino acid in the amino acid sequence. For example, “an amino acid at codon 918” refers to 918th amino acid in the amino acid sequence.

According to the present invention, mutant RET may be a polypeptide having RET kinase activity and encoded by rearranged gene between gene encoding wild-type RET (hereinafter, also referred to as “RET gene”) and other gene. Moreover, mutant RET of the invention is, for example, a polypeptide having RET kinase activity and encoded by a polynucleotide in which the polynucleotide having the nucleotide sequence represented by SEQ ID NO: 1 or 3 is partially rearranged with other gene. Furthermore, mutant RET of the invention is, for example, a polypeptide having RET kinase activity and encoded by a polynucleotide in which the polynucleotide 181-3522 of SEQ ID NO: 1 or polynucleotide 181-3396 of SEQ ID NO: 3 is rearranged with other gene.

Herein, “gene rearrangement” refers to recombination between genes that results in new gene.

Examples of mutant RETs include polypeptides of (i)-(xi) below. Embodiments of gene rearrangement for the polypeptides of (i)-(xi) below are described in the literature mentioned in parentheses.

(i) A polypeptide encoded by a rearranged gene (also referred to as “RET/PTC1”) between RET gene and H4 (also referred to as CCDC6, coiled-coil domain containing 6 or D10S170; GenBank Accession No: NM—005436) gene (European Journal of Cancer, 41, 816-821, 2005, Cell, 60, 557-563, 1990.).

(ii) A polypeptide encoded by a rearranged gene (also referred to as “RET/PTC2”) between RET gene and RIα (also referred to as PRKAR1A, cAMP-dependent regulatory type I alpha; GenBank Accession No: NM—212471) gene (Eur J Endocrinology, 147, 741-745, 2002.).

(iii) A polypeptide encoded by a rearranged gene (also referred to as “RET/PTC3”) between RET gene and ELE1 (also referred to as NCOA4, nuclear receptor coactivator 4 or RFG; GenBank Accession No: NM—005437) gene (European Journal of Cancer, 41, 816-821, 2005.).

(iv) A polypeptide encoded by a rearranged gene (also referred to as “RET/PTC4”) between RET gene and ELE1 (also referred to as NCOA4, nuclear receptor coactivator 4 or RFG; GenBank Accession No: NM—005437) gene (Oncogene, 13, 1093-1097, 1996.).

(v) A polypeptide encoded by a rearranged gene (also referred to as “RET/PTC5”) between RET gene and RFG5 (also referred to as GOLGA5, golgin-84; GenBank Accession No: NM—005113) gene (Cancer Research, 58, 198-203, 1998.).

(vi) A polypeptide encoded by a rearranged gene (also referred to as “RET/PTC6”) between RET gene and hTIF (also referred to as TRIM24, tripartite motif-containing 24 or PTC6; GenBank Accession No: NM—003852) gene (Oncogene, 18, 4388-4393, 1999.).

(vii) A polypeptide encoded by a rearranged gene (also referred to as “RET/PTC7”) between RET gene and RFG7 (also referred to as TRIM33, tripartite motif-containing 33, PTC7; GenBank Accession No: NM—033020) gene (Cancer Research, 60, 2786-2789, 2000.).

(viii) A polypeptide encoded by a rearranged gene (also referred to as “RET/PTC8”) between RET gene and kinectin (also referred to as KTN1, kinectin 1; GenBank Accession No: NM—182926) gene (Cancer Research, 60, 7028-7032, 2000, Cancer Research, 60, 2786-2789, 2000.).

(ix) A polypeptide encoded by a rearranged gene (also referred to as “RET/ELKS”) between RET gene and ELKS (also referred to as RAB6IP2 or RAB6 interacting protein 2; GenBank Accession No: NM—178037) gene (Genes Chromosomes Cancer, 25, 97-103, 1999.).

(x) A polypeptide encoded by a rearranged gene (also referred to as “RET/PCM-1”) between RET gene and PCM-1 (also referred to as PCM1 or pericentriolar material 1; GenBank Accession No: NM—006197) gene (Oncogene, 19, 4236-4242, 2000.).

(xi) A polypeptide encoded by a rearranged gene (also referred to as “RFP-RET”) between RET gene and gene RFP (also referred to as ret finger protein; GenBank Accession No: NM—006510) (Endocrinology, 145, 5448-5451, 2004.).

The presence or the absence of RET mutation can be verified through analysis of sequence of RET gene or sequence of RET gene transcript, i.e., mRNA. Analysis procedure may, for example, be dideoxynucleotide chain termination method (Sanger et al. (1977), Proc. Natl. Acad. Sci. USA 74: 5463). The sequence can be analyzed using a suitable DNA sequencer.

Alternatively, the presence or the absence of RET mutation may be analyzed, for example, by a technique such as in situ hybridization, northern blot analysis, DNA microarray, RT-PCR or SSCP-PCR (Single-Strand Conformation Polymorphism-PCR). These techniques can be carried out according to routine procedures (Clinical Cancer Research, 8, 457-463, 2002.).

The presence or the absence of RET mutation may also be analyzed, for example, by an immunochemical method (e.g., immunohistochemical method, immunoprecipitation, western blot, flow cytometry, ELISA, RIA, etc.). These techniques can be carried out according to routine procedures.

The primer sequences for PCR to analyze the presence or the absence of mutant RET can be designed according to a routine procedure. For example, the primer sequences can be designed using Primer Expression (Perkin-Elmer Applied Biosystems).

In order to analyze the presence or the absence of mutant RET, for example, primers mentioned in Table 1 may be used. For example, for analyzing RET/PTC1, polynucleotides having the sequences represented by SEQ ID NOS: 5 and 6 can be employed as primers.

TABLE 1
Mutant RET intended
for analysis Primer 1 Primer 2
RET/PTC1 SEQ ID NO: 5 SEQ ID NO: 6
RET/PTC2 SEQ ID NO: 7 SEQ ID NO: 6
RET/PTC3 SEQ ID NO: 8 SEQ ID NO: 9
RET/PTC4 SEQ ID NO: 10 SEQ ID NO: 11
RET/PTC5 SEQ ID NO: 12 SEQ ID NO: 13
RET/PTC6 SEQ ID NO: 12 SEQ ID NO: 14
RET/PTC7 SEQ ID NO: 12 SEQ ID NO: 15
RET/PTC8 SEQ ID NO: 12 SEQ ID NO: 16
RET/ELKS SEQ ID NO: 17 SEQ ID NO: 18
RET/PCM-1 SEQ ID NO: 19 SEQ ID NO: 20

Table 1 indicates some of the exemplary primers for mutant RETs intended for analysis.

The nucleotide sequences represented by SEQ ID NOS: 5-20 are shown below.

ATT GTC ATC TCG CCG TTC SEQ ID NO: 5
TGC TTC AGG ACG TTG AAC SEQ ID NO: 6
TAT CGC AGG AGA GAC TGT GAT SEQ ID NO: 7
TGG AGA AGA GAG GCT GTA TC SEQ ID NO: 8
CGT TGC CTT GAC TTT TC SEQ ID NO: 9
TGC CCC TTC AGT GTT CCT ACT SEQ ID NO: 10
CTT GAT AAC ACT GGC AGG TT SEQ ID NO: 11
GAG GCG TTC TCT TTC AGC AT SEQ ID NO: 12
TGG AAG AAC TTC GGC ATG AG SEQ ID NO: 13
GAA TTC ACA GCC ACC AAG TG SEQ ID NO: 14
CTA CTT AGC TTT CCA AGT GG SEQ ID NO: 15
GGG ACA GAC ACC TTT GGA AAT A SEQ ID NO: 16
GTTGAAGGAGTCCTTGACTG SEQ ID NO: 17
CTTTCAGCATCTTCACGG SEQ ID NO: 18
AGTGAAGTTTCTACCATCC SEQ ID NO: 19
GGCGTTCTCTTTCAGCATCT SEQ ID NO: 20

(3) Cell Expressing Mutant RET

According to the present invention, a cell expressing mutant RET is preferably a cell from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia or mucosal neuromas of the gastrointestinal tract. Alternatively, a cell expressing mutant RET, according to the present invention, is preferably a cell from thyroid carcinoma.

(4) RET Kinase Inhibiting Substance of the Invention

Herein, a “halogen atom” refers to a fluorine atom, a chlorine atom, a bromine atom or an iodine atom.

Preferable examples of a “halogen atom” include a fluorine atom and a chlorine atom.

Herein, “C1-6 alkyl group” refers to linear or branched alkyl group with a carbon number of 1-6, specific examples being methyl group, ethyl group, 1-propyl group (n-propyl group), 2-propyl group (i-propyl group), 2-methyl-1-propyl group (1-butyl group), 2-methyl-2-propyl group (t-butyl group), 1-butyl group (n-butyl group), 2-butyl group (s-butyl group), 1-pentyl group, 2-pentyl group, 3-pentyl group, 2-methyl-1-butyl group, 3-methyl-1-butyl group, 2-methyl-2-butyl group, 3-methyl-2-butyl group, 2,2-dimethyl-1-propyl group, 1-hexyl group, 2-hexyl group, 3-hexyl group, 2-methyl-1-pentyl group, 3-methyl-1-pentyl group, 4-methyl-1-pentyl group, 2-methyl-2-pentyl group, 3-methyl-2-pentyl group, 4-methyl-2-pentyl group, 2-methyl-3-pentyl group, 3-methyl-3-pentyl group, 2,3-dimethyl-1-butyl group, 3,3-dimethyl-1-butyl group, 2,2-dimethyl-1-butyl group, 2-ethyl-1-butyl group, 3,3-dimethyl-2-butyl group and 2,3-dimethyl-2-butyl group.

Preferable examples of “C1-6 alkyl group” include methyl group, ethyl group, 1-propyl group, 2-propyl group, 2-methyl-1-propyl group, 2-methyl-2-propyl group, 1-butyl group and 2-butyl group.

Herein, “C1-6 alkylene group” refers to divalent group derived from “C1-6 alkyl group” defined above by removing any one hydrogen atom therefrom, and specific examples include methylene group, 1,2-ethylene group, 1,1-ethylene group, 1,3-propylene group, tetramethylene group, pentamethylene group and hexamethylene group.

Herein, “C2-6 alkenyl group” refers to linear or branched alkenyl group having one double bond and a carbon number of 2-6, and specific examples include ethenyl group (vinyl group), 1-propenyl group, 2-propenyl group (allyl group), 1-butenyl group, 2-butenyl group, 3-butenyl group, pentenyl group and hexenyl group.

Herein, “C2-6 alkynyl group” refers to linear or branched alkynyl group having one triple bond and a carbon number of 2-6, and specific examples include ethinyl group, 1-propynyl group, 2-propynyl group, 1-butynyl group, 2-butynyl group, 3-butynyl group, pentynyl group and hexynyl group.

Herein, “C3-8 cycloalkyl group” refers to monocyclic or bicyclic saturated aliphatic hydrocarbon group with a carbon number of 3-8, and specific examples include cyclopropyl group, cyclobutyl group, cyclopentyl group, cyclohexyl group, cycloheptyl group, cyclooctyl group, bicyclo[2.1.0]pentyl group, bicyclo[3.1.0]hexyl group, bicyclo[2.1.1]hexyl group, bicyclo[4.1.0]heptyl group, bicyclo[2.2.1]heptyl group (norbornyl group), bicyclo[3.3.0]octyl group, bicyclo[3.2.1]octyl group and bicyclo[2.2.2]octyl group.

Preferable examples of “C3-8 cycloalkyl group” include cyclopropyl group, cyclobutyl group and cyclopentyl group.

Herein, “C6-10 aryl group” refers to aromatic hydrocarbon cyclic group with a carbon number of 6-10, and specific examples include phenyl group, 1-naphthyl group, 2-naphthyl group, indenyl group and azulenyl group.

A preferable example of “C6-10 aryl group” includes phenyl group.

Herein, “a heteroatom” refers to a nitrogen atom, an oxygen atom or a sulfur atom.

Herein, “5-10-membered heteroaryl group” refers to aromatic cyclic group having 5-10 atoms forming the ring including 1-5 heteroatoms, and specific examples include furyl group, thienyl group, pyrrolyl group, imidazolyl group, triazolyl group, tetrazolyl group, thiazolyl group, pyrazolyl group, oxazolyl group, isoxazolyl group, isothiazolyl group, furazanyl group, thiadiazolyl group, oxadiazolyl group, pyridyl group, pyrazinyl group, pyridazinyl group, pyrimidinyl group, triazinyl group, purinyl group, pteridinyl group, quinolyl group, isoquinolyl group, naphthyridinyl group, quinoxalinyl group, cinnolinyl group, quinazolinyl group, phthalazinyl group, imidazopyridyl group, imidazothiazolyl group, imidazoxazolyl group, benzothiazolyl group, benzoxazolyl group, benzimidazolyl group, indolyl group, isoindolyl group, indazolyl group, pyrrolopyridyl group, thienopyridyl group, furopyridyl group, benzothiadiazolyl group, benzoxadiazolyl group, pyridopyrimidinyl group, benzofuryl group, benzothienyl group and thienofuryl group.

Preferable examples of “5-10-membered heteroaryl group” include furyl group, thienyl group, pyrrolyl group, imidazolyl group, thiazolyl group, pyrazolyl group, oxazolyl group, isoxazolyl group, isothiazolyl group, pyridyl group and pyrimidinyl group.

Herein, “3-10-membered non-aromatic heterocyclic group”:

(a) has 3-10 atoms forming the ring;

(b) has 1-2 heteroatoms included in the atoms forming the ring;

(c) may include 1-2 double bonds in the ring;

(d) may have 1-3 carbonyl groups, sulfinyl groups or sulfonyl groups in the ring; and

(e) is non-aromatic monocyclic or bicyclic group, where when a nitrogen atom is included in the atoms forming the ring, the nitrogen atom may have a binding hand.

Specific examples include aziridinyl group, azetidinyl group, pyrrolidinyl group, piperidinyl group, azepanyl group, azocinyl group, piperazinyl group, diazepanyl group, diazocanyl group, diazabicyclo[2.2.1]heptyl group, morpholinyl group, thiomorpholinyl group, 1,1-dioxothiomorpholinyl group, oxiranyl group, oxetanyl group, tetrahydrofuryl group, dioxoranyl group, tetrahydropyranyl group, dioxanyl group, tetrahydrothienyl group, tetrahydrothiopyranyl group, oxazolidinyl group and thiazolidinyl group.

Preferable examples of “3-10-membered non-aromatic heterocyclic group” include aziridinyl group, azetidinyl group, pyrrolidinyl group, piperidinyl group, azepanyl group, piperazinyl group, diazepanyl group, morpholinyl group, thiomorpholinyl group, 1,1-dioxothiomorpholinyl group, tetrahydrofuryl group and tetrahydropyranyl group.

Herein, “C1-6 alkoxy group” refers to group in which an oxygen atom is bound to the terminal of “C1-6 alkyl group” defined above, and specific examples include methoxy group, ethoxy group, 1-propoxy group (n-propoxy group), 2-propoxy group (1-propoxy group), 2-methyl-1-propoxy group (1-butoxy group), 2-methyl-2-propoxy group (t-butoxy group), 1-butoxy group (n-butoxy group), 2-butoxy group (s-butoxy group), 1-pentyloxy group, 2-pentyloxy group, 3-pentyloxy group, 2-methyl-1-butoxy group, 3-methyl-1-butoxy group, 2-methyl-2-butoxy group, 3-methyl-2-butoxy group, 2,2-dimethyl-1-propoxy group, 1-hexyloxy group, 2-hexyloxy group, 3-hexyloxy group, 2-methyl-1-pentyloxy group, 3-methyl-1-pentyloxy group, 4-methyl-1-pentyloxy group, 2-methyl-2-pentyloxy group, 3-methyl-2-pentyloxy group, 4-methyl-2-pentyloxy group, 2-methyl-3-pentyloxy group, 3-methyl-3-pentyloxy group, 2,3-dimethyl-1-butoxy group, 3,3-dimethyl-1-butoxy group, 2,2-dimethyl-1-butoxy group, 2-ethyl-1-butoxy group, 3,3-dimethyl-2-butoxy group and 2,3-dimethyl-2-butoxy group.

Preferable examples of “C1-6 alkoxy group” include methoxy group, ethoxy group, 1-propoxy group, 2-propoxy group, 2-methyl-1-propoxy group, 2-methyl-2-propoxy group, 1-butoxy group and 2-butoxy group.

Herein, “C1-6 alkylthio group” refers to group in which a sulfur atom is bound to the terminal of “C1-6 alkyl group” defined above, and specific examples include methylthio group, ethylthio group, 1-propylthio group (n-propylthio group), 2-propylthio group (i-propylthio group), 2-methyl-1-propylthio group (1-butylthio group), 2-methyl-2-propylthio group (t-butylthio group), 1-butylthio group (n-butylthio group), 2-butylthio group (s-butylthio group), 1-pentylthio group, 2-pentylthio group, 3-pentylthio group, 2-methyl-1-butylthio group, 3-methyl-1-butylthio group, 2-methyl-2-butylthio group, 3-methyl-2-butylthio group, 2,2-dimethyl-1-propylthio group, 1-hexylthio group, 2-hexylthio group, 3-hexylthio group, 2-methyl-1-pentylthio group, 3-methyl-1-pentylthio group, 4-methyl-1-pentylthio group, 2-methyl-2-pentylthio group, 3-methyl-2-pentylthio group, 4-methyl-2-pentylthio group, 2-methyl-3-pentylthio group, 3-methyl-3-pentylthio group, 2,3-dimethyl-1-butylthio group, 3,3-dimethyl-1-butylthio group, 2,2-dimethyl-1-butylthio group, 2-ethyl-1-butylthio group, 3,3-dimethyl-2-butylthio group and 2,3-dimethyl-2-butylthio group.

Preferable examples of “C1-6 alkylthio group” include methylthio group, ethylthio group, 1-propylthio group (n-propylthio group), 2-propylthio group (i-propylthio group), 2-methyl-1-propylthio group (1-butylthio group), 2-methyl-2-propylthio group (t-butylthio group), 1-butylthio group (n-butylthio group) and 2-butylthio group (s-butylthio group).

Herein, “C3-8 cycloalkoxy group” refers to group in which an oxygen atom is bound to the terminal of “C3-8 cycloalkyl group” defined above, and specific examples include cyclopropoxy group, cyclobutoxy group, cyclopentyloxy group, cyclohexyloxy group, cycloheptyloxy group, cyclooctyloxy group, bicyclo[2.1.0]pentyloxy group, bicyclo[3.1.0]hexyloxy group, bicyclo[2.1.1]hexyloxy group, bicyclo[4.1.0]heptyloxy group, bicyclo[2.2.1]heptyloxy group (norbornyloxy group), bicyclo[3.3.0]octyloxy group, bicyclo[3.2.1]octyloxy group and bicyclo[2.2.2]octyloxy group.

Preferable examples of “C3-8 cycloalkoxy group” include cyclopropoxy group, cyclobutoxy group and cyclopentyloxy group.

Herein, “mono-C1-6 alkylamino group” refers to group in which a hydrogen atom in amino group is substituted with “C1-6 alkyl group” defined above, and specific examples include methylamino group, ethylamino group, 1-propylamino group (n-propylamino group), 2-propylamino group (i-propylamino group), 2-methyl-1-propylamino group (1-butylamino group), 2-methyl-2-propylamino group (t-butylamino group), 1-butylamino group (n-butylamino group), 2-butylamino group (s-butylamino group), 1-pentylamino group, 2-pentylamino group, 3-pentylamino group, 2-methyl-1-butylamino group, 3-methyl-1-butylamino group, 2-methyl-2-butylamino group, 3-methyl-2-butylamino group, 2,2-dimethyl-1-propylamino group, 1-hexylamino group, 2-hexylamino group, 3-hexylamino group, 2-methyl-1-pentylamino group, 3-methyl-1-pentylamino group, 4-methyl-1-pentylamino group, 2-methyl-2-pentylamino group, 3-methyl-2-pentylamino group, 4-methyl-2-pentylamino group, 2-methyl-3-pentylamino group, 3-methyl-3-pentylamino group, 2,3-dimethyl-1-butylamino group, 3,3-dimethyl-1-butylamino group, 2,2-dimethyl-1-butylamino group, 2-ethyl-1-butylamino group, 3,3-dimethyl-2-butylamino group and 2,3-dimethyl-2-butylamino group.

Herein, “di-C1-6 alkylamino group” refers to group in which two hydrogen atoms in amino group are substituted with identical or different “C1-6 alkyl group” defined above, and specific examples include N,N-dimethylamino group, N,N-diethylamino group, N,N-di-n-propylamino group, N,N-di-1-propylamino group, N,N-di-n-butylamino group, N,N-di-1-butylamino group, N,N-di-s-butylamino group, N,N-di-t-butylamino group, N-ethyl-N-methylamino group, N-n-propyl-N-methylamino group, N-1-propyl-N-methylamino group, N-n-butyl-N-methylamino group, N-1-butyl-N-methylamino group, N-s-butyl-N-methylamino group and N-t-butyl-N-methylamino group.

Herein, “C2-7 acyl group” refers to carbonyl group bound with “C1-6 alkyl group” defined above, and specific examples include acetyl group, propionyl group, isopropionyl group, butyryl group, isobutyryl group, valeryl group, isovaleryl group and pivaloyl group.

Herein, “C2-7 alkoxycarbonyl group” refers to carbonyl group bound with “C1-6 alkoxy group” defined above, and specific examples include methoxycarbonyl group, ethoxycarbonyl group, 1-propyloxycarbonyl group, 2-propyloxycarbonyl group and 2-methyl-2-propoxy carbonyl group.

Herein, “that may have a substituent” means “that may have one or more substituents at substitutable positions in any combination”, and specific examples of the substituent include a halogen atom, hydroxyl group, thiol group, nitro group, cyano group, formyl group, carboxyl group, amino group, silyl group, methanesulfonyl group, C1-6 alkyl group, C2-6 alkenyl group, C2-6 alkynyl group, C3-8 cycloalkyl group, C6-10 aryl group, 5-10-membered heteroaryl group, 3-10-membered non-aromatic heterocyclic group, C1-6 alkoxy group, C1-6 alkylthio group, C3-8 cycloalkoxy group, mono-C1-6 alkylamino group, di-C1-6 alkylamino group, C2-7 acyl group and C2-7 alkoxycarbonyl group. In this case, C1-6 alkyl group, C2-6 alkenyl group, C2-6 alkynyl group, C3-8 cycloalkyl group, C6-10 aryl group, 5-10-membered heteroaryl group, 3-10-membered non-aromatic heterocyclic group, C1-6 alkoxy group, C1-6 alkylthio group, C3-8 cycloalkoxy group, mono-C1-6 alkylamino group, di-C1-6 alkylamino group, C2-7 acyl group and C2-7 alkoxycarbonyl group may each independently have 1-3 groups selected from the following substituent groups.

<Substituent Groups>

A halogen atom, hydroxyl group, thiol group, nitro group, cyano group, C1-6 alkyl group, C3-8 cycloalkyl group, C2-6 alkenyl group, C2-6 alkynyl group, C6-10 aryl group, 5-10-membered heteroaryl group, 3-10-membered non-aromatic heterocyclic group, C1-6 alkoxy group and C1-6 alkylthio group.

According to the present invention, an RET kinase inhibiting substance may, for example, be a compound represented by General Formula (I)

(i) R1

R1 represents a group represented by Formula —V1—V2—V3 (wherein, V1 represents C1-6 alkylene group that may have a substituent; V2 represents a single bond, an oxygen atom, a sulfur atom, carbonyl group, sulfinyl group, sulfonyl group, group represented by Formula —CONR6—, group represented by Formula —SO2NR6—, group represented by Formula —NR6SO2—, group represented by Formula —NR6CO— or group represented by Formula —NR6— (wherein, R6 represents a hydrogen atom, C1-6 alkyl group that may have a substituent or C3-8 cycloalkyl group that may have a substituent); V3 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent).

A preferable example of R1 includes C1-6 alkyl group. In this case, R1 may have a substituent selected from 3-10-membered non-aromatic heterocyclic group which may have C1-6 alkyl group, hydroxyl group, C1-6 alkoxy group, amino group, mono-C1-6 alkylamino group and di-C1-6 alkylamino group.

More preferable examples of R1 include methyl group and group represented by any one of the following Formulae

(wherein, Ra3 represents methyl group; Ra1 represents a hydrogen atom or hydroxyl group; Ra2 represents methoxy group, ethoxy group, 1-pyrrolidinyl group, 1-piperidinyl group, 4-morpholinyl group, dimethylamino group or diethylamino group).

Still more preferable examples of R1 include methyl group and 2-methoxyethyl group.

(ii) R2

R2 represents cyano group, C1-6 alkoxy group that may have a substituent, carboxyl group, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVa11Va12 (wherein, Va11 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent; Va12 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent, 3-10-membered non-aromatic heterocyclic group that may have a substituent, hydroxyl group, C1-6 alkoxy group that may have a substituent or C3-8 cycloalkoxy group that may have a substituent).

Preferable examples of R2 include cyano group or group represented by Formula —CONVa11Va12 (wherein, Va11 and Va12 have the same meaning as defined above).

More preferable examples of R2 include cyano group or group represented by Formula —CONHVa16 (wherein, Va16 represents a hydrogen atom, C1-6 alkyl group, C3-8 cycloalkyl group, C1-6 alkoxy group or C3-8 cycloalkoxy group, where Va16 may have a substituent selected from a halogen atom, cyano group, hydroxyl group and C1-6 alkoxy group).

Still more preferable example of R2 includes a group represented by Formula —CONHVa17 (wherein, Va17 represents a hydrogen atom, C1-6 alkyl group or C1-6 alkoxy group).

The most preferable example of R2 includes a group represented by Formula —CONHVa18 (wherein, Va18 represents a hydrogen atom, methyl group or methoxy group).

(iii) Y1

Y1 represents a group represented by Formula

(wherein, R7 and R8 each independently represent a hydrogen atom, a halogen atom, cyano group, nitro group, amino group, C1-6 alkyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C1-6 alkoxy group that may have a substituent, C1-6 alkylthio group that may have a substituent, formyl group, C2-7 acyl group that may have a substituent, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVd1Vd2 (wherein, Vd1 and Vd2 each independently represent a hydrogen atom or C1-6 alkyl group that may have a substituent); and

W1 and W2 each independently represent a carbon atom or a nitrogen atom that may have a substituent).

A preferable example of Y1 includes a group represented by Formula

(wherein, R71 represents a hydrogen atom or a halogen atom).

(iv) R3 and R4

R3 and R4 each independently represent a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C2-7 acyl group that may have a substituent or C2-7 alkoxycarbonyl group that may have a substituent.

A preferable example of R3 and R4 includes a hydrogen atom.

(v) R5

R5 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent.

Preferable examples of R5 include a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent.

More preferable examples of R5 include a hydrogen atom, C1-6 alkyl group, C3-8 cycloalkyl group and C6-10 aryl group (where R5 may have at least one substituent selected from a halogen atom and methanesulfonyl group).

More preferable examples of R5 include methyl group, ethyl group or cyclopropyl group.

Moreover, preferable examples of the compound represented by General Formula (I) include:

  • N-(4-(6-cyano-7-(2-methoxyethoxy)-4-quinolyl)oxy-2-fluorophenyl)-N′-(4-fluorophenyl)urea;
  • N-(2-chloro-4-((6-cyano-7-((1-methyl-4-piperidyl)methoxy)-4-quinolyl)oxy)phenyl)-N′-cyclopropylurea;
  • N-(4-((6-cyano-7-(((2R)-3-(diethylamino)-2-hydroxypropyl)oxy)-4-quinolyl)oxy)phenyl)-N′-(4-fluorophenyl)urea;
  • N-(4-((6-cyano-7-(((2R)-2-hydroxy-3-(1-pyrrolidino)propyl)oxy)-4-quinolyl)oxy)phenyl)-N′-(4-fluorophenyl)urea;
  • 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;
  • 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-methoxyethoxy)-6-quinolinecarboxamide;
  • N6-cyclopropyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;
  • N6-(2-methoxyethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;
  • N6-(2-fluoroethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;
  • N6-methoxy-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;
  • N6-methyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;
  • N6-ethyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;
  • 4-(3-fluoro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-methoxyethoxy)-6-quinolinecarboxamide;
  • 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-hydroxyethoxy)-6-quinolinecarboxamide;
  • 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-((2S)-2,3-dihydroxypropyl)oxy-6-quinolinecarboxamide;
  • 4-(3-chloro-4-(methylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;
  • 4-(3-chloro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;
  • N6-methoxy-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;
  • 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-ethoxyethoxy)-6-quinolinecarboxamide;
  • 4-(4-((cyclopropylamino)carbonyl)aminophenoxy)-7-(2-methoxyethoxy)-6-quinolinecarboxamide;
  • N-(2-fluoro-4-((6-carbamoyl-7-methoxy-4-quinolyl)oxy)phenyl)-N′-cyclopropylurea;
  • N6-(2-hydroxyethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;
  • 4-(3-chloro-4-(1-propylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;
  • 4-(3-chloro-4-(cis-2-fluoro-cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;
  • N6-methyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-(2-methoxyethoxy)-6-quinolinecarboxamide;
  • N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;
  • 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-(4-morpholino) ethoxy)-6-quinolinecarboxamide;
  • 4-(3-chloro-4-(2-fluoroethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;
  • N6-((2R)tetrahydro-2-furanylmethyl)-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;
  • 4-(3-fluoro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;
  • 4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-((2R)-2-hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;
  • N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((2R)-3-diethylamino-2-hydroxypropoxy)-6-quinolinecarboxamide;
  • N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((2R)-3-diethylamino-2-hydroxypropoxy)-6-quinolinecarboxamide;
  • N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((2R)-2-hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;
  • N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((2R)-2-hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;
  • N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((1-methyl-4-piperidyl)methoxy)-6-quinolinecarboxamide;
  • N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((1-methyl-4-piperidyl)methoxy)-6-quinolinecarboxamide;
  • N-(4-(6-cyano-7-(2-methoxyethoxy)-4-quinolyl)oxy-2-fluorophenyl)-N′-cyclopropylurea;
  • N-(4-(6-cyano-7-(3-(4-morpholino)propoxy)-4-quinolyl)oxyphenyl)-N′-(3-(methylsulfonyl)phenyl)urea;
  • 4-(4-((cyclopropylamino)carbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;
  • 4-(3-fluoro-4-((2-fluoroethylamino)carbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;
  • N6-(2-ethoxyethyl)-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;
  • 4-(4-(3-ethylureido)-3-fluoro-phenoxy)-7-methoxyquinoline-6-carboxylic acid (2-cyanoethyl)amide; and
  • N-(4-(6-(2-cyanoethyl)carbamoyl-7-methoxy-4-quinolyl)oxy-2-fluorophenyl)-N′-cyclopropylurea.

More preferable examples of the compound represented by General Formula (I) include:

  • 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;
  • 4-(3-chloro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;
  • N6-methoxy-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;
  • 4-(3-chloro-4-(methylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide; and
  • N6-methoxy-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide.

A still more preferable example of the compound represented by General Formula (I) further includes 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide (see Formula (II)).

The most preferable example of the RET kinase inhibiting substance includes methanesulfonate of 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide.

The compound represented by General Formula (I) can be produced by a known method, for example, methods described in International publication No. 02/32872 pamphlet (WO02/32872) and International publication No. 2005/063713 pamphlet (WO2005/063713).

In addition, an RET kinase inhibiting substance of the invention is, for example: 5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrrole-3-carboxylic acid(2-diethylaminoethyl)amide (hereinafter, also referred to as “SU11248”; Clinical Cancer Research, 9, 327-337, 2003, Journal of Medicinal Chemistry, 46: 1116-9, 2003, WO0/060814) (see Formula (III))

N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N′-(5-methyl-3-isoxazolyl)urea (hereinafter, also referred to as “KRN951”; WO02/088110) (see Formula (IV))

4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)propoxy]quinazoline (hereinafter, also referred to as “AZD2171”; Cancer Research. 65:4389-400, 2005, WO00/47212) (see Formula (V))

SU11248, KRN951 and AZD2171 can be produced according to a known method. They can be produced, for example, according to the methods described in the respective literatures.

According to the present invention, the RET kinase inhibiting substance may form a pharmacologically acceptable salt with acid or base. According to the present invention, the RET kinase inhibiting substance also includes such pharmacologically acceptable salts. Examples of salts formed with acid include inorganic acid salts such as hydrochloride, hydrobromate, sulfate and phosphate, and organic acid salts such as formic acid, acetic acid, lactic acid, succinic acid, fumaric acid, maleic acid, citric acid, tartaric acid, stearic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid and trifluoroacetic acid. Examples of salts formed with base include alkali metal salts such as sodium salt and potassium salt, alkaline earth metal salts such as calcium salt and magnesium salt, organic base salts such as trimethylamine, triethylamine, pyridine, picoline, dicyclohexylamine, N,N′-dibenzyl ethylenediamine, arginine and lysine and ammonium salt.

Furthermore, according to the present invention, the RET kinase inhibiting substance also includes, if any, solvates and enantiomers of these compounds. Examples of solvates include hydrates and nonhydrates, preferably hydrates. Examples of solvents include water, alcohols (for example, methanol, ethanol, n-propanol) and dimethylformamide.

Moreover, according to the present invention, the RET kinase inhibiting substance may be crystalline or amorphous. If a crystalline polymorph is present, it may be a single polymorph or a mixture of polymorphs in any crystalline shape.

According to the present invention, the RET kinase inhibiting substance includes RET kinase inhibiting substances susceptible to metabolism such as oxidation, reduction, hydrolysis and conjugation in vivo. The RET kinase inhibiting substance of the invention also includes compounds that generate an RET kinase inhibiting substance by undergoing metabolism such as oxidation, reduction and hydrolysis in vivo.

The RET kinase inhibiting substance of the invention has activity of inhibiting RET kinase activity (hereinafter, also referred to as “RET kinase-inhibiting activity”). The inhibition capacity of the RET kinase inhibiting substance of the invention is not limited as long as it inhibits kinase activity of RET. Examples of methods for determining the RET kinase-inhibiting activity of the RET kinase inhibiting substance include cell free kinase assay, western blotting, cell growth assay and viability assay. Examples of the cell growth assay include tritium thymidine uptake method, MTT method, XTT method (cell counting kit-8 (Dojindo Laboratories)), AlamarBlue method, Neutral Red method, BrdU method, Ki67 staining and PCNA staining. Examples of the viability assay include TUNNEL staining, Caspase-3 cleavage detection and PARP cleavage detection. These methods may be carried out according to conventional techniques (Blood. 2005, 105, 2941-2948, Molecular Cancer Therapeutics. 2005, 4, 787-798).

Hereinafter, an example of a method for determining RET kinase-inhibiting activity will be described.

The RET kinase-inhibiting activity can be determined by cell free kinase assay.

RET can be prepared by gene-engineering means according to a conventional method. For example, according to the method of Baculovirus Expression System, human recombinant GST fusion protein, human recombinant histidine-tag fusion protein or the like may be expressed in an insect cell (Spodoptera frugiperda 9 (Sf9)). Furthermore, the expressed recombinant protein can be purified by affinity chromatography (e.g., GSH-agarose (Sigma) or Ni-NTH-agarose (Qiagen)). The purity and identification of the protein can be confirmed by SDS-PAGE, silver staining and western blotting using an antibody specific to RET.

The cell free kinase assay can be carried out as follows.

First, to each well of a plate (e.g., 96-well, 384-well, etc.), a mixed solution including 20 ÎĽl of standard reaction solution, 5 ÎĽl of ATP solution, 5 ÎĽl of the test substance, and a mixed solution including 10 ÎĽl of solution containing 50 ng of RET recombinant protein and 10 ÎĽl of solution containing 125 ng of biotinylated Poly(Glu, Tyr)4:1 can be added sequentially.

This kinase reaction solution (50 ÎĽl) may contain 60 mM HEPES-NaOH (pH7.5), 3 mM MgCl2, 3 mM MnCl2, 3 ÎĽM Na-orthovanadate, 1.2 mM DTT, 50 ÎĽg/ml PEG20000 and 1 ÎĽM ATP. In this case, the ATP labeled with a radioactive isotope such as [Îł-32P]-ATP or [Îł-33P]-ATP may be used.

The reaction solution may be incubated for a certain period of time, and then 50 ÎĽl of 2% (v/v) H3PO4 solution may be added to terminate the reaction.

Each well may be subjected to an appropriate washing procedure.

RET kinase-inhibiting activity can be assessed by determining the amount of ATP incorporation. When the ATP labeled with a radioactive isotope is used, the amount of ATP incorporation can be assessed by determining radioactivity captured on the plate with a scintillation counter.

According to this method, the RET kinase-inhibiting activity of the compound can be assessed.

(5) Therapeutic Agent, Pharmaceutical Composition and Therapeutic Method

The therapeutic agent of the invention containing an RET kinase inhibiting substance is an agent for treating at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract. Moreover, the therapeutic agent of the invention containing an RET kinase inhibiting substance is an agent for treating thyroid carcinoma. Preferably, the therapeutic agent of the invention is used for a disease including a cell expressing mutant RET.

The therapeutic agent of the invention may be administered to a living organism, i.e., a mammal (e.g., human, rat, rabbit, sheep, pig, bovine, cat, dog, monkey, etc.) that requires treatment of the disease.

The pharmaceutical composition of the invention contains an RET kinase inhibiting substance for administering to an organism including a cell expressing mutant RET.

The pharmaceutical composition of the invention can be used as a therapeutic agent for treating a disease expressing mutant RET. Examples of diseases expressing mutant RET include multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract.

The pharmaceutical composition of the invention may be administered to a living organism, i.e., a mammal (e.g., human, rat, rabbit, sheep, pig, bovine, cat, dog, monkey, etc.). According to the present invention, said living organism includes a cell expressing mutant RET.

According to the present invention, the therapeutic agent contains an agent for improving prognosis of cancer, an agent for preventing cancer recurrence or the like. The therapeutic agent for treating cancer or tumor contains an antitumor agent, an agent for suppressing cancer metastasis or the like.

The effect of treatment may be verified by observation of an x-ray picture, CT or the like, by histopathological diagnosis of biopsy, or from a disease marker value.

Where a therapeutic agent or a pharmaceutical composition of the invention is used, the given dosage of the RET kinase inhibiting substance differs depending on the degree of the symptom, age, sex, weight and sensitivity difference of the patient, administration mode, administration period, administration interval, nature, prescription and the type of the pharmaceutical formulation, and the type of the active element. Usually, but without limitation, the dosage of the RET kinase inhibiting substance is 0.1-1000 mg/day, preferably 0.5-100 mg/day, more preferably 1-30 mg/day for an adult (weight 60 kg), which may be administered once to three times a day.

Although the therapeutic agent or the pharmaceutical composition containing the RET kinase inhibiting substance of the invention as an active element may be used alone, it is usually mixed with appropriate additives and made into a formulation.

Examples of such additive include excipients, binders, lubricants, disintegrants, colorants, flavoring agents, emulsifiers, surfactants, solubilizing agents, suspending agents, tonicity agents, buffers, antiseptic agents, antioxidant agents, stabilizers, absorption promoters and the like that are generally used for medicine. If required, they may be used in combination. Examples of such additive are as follows.

Excipients: lactose, sucrose, glucose, cornstarch, mannitol, sorbitol, starch, alpha-starch, dextrin, crystalline cellulose, light anhydrous silicic acid, aluminum silicate, calcium silicate, magnesium aluminometasilicate and calcium hydrogen phosphate.

Binders: for example, polyvinyl alcohol, methyl cellulose, ethyl cellulose, gum arabic, tragacanth, gelatin, shellac, hydroxypropyl methylcellulose, hydroxypropylcellulose, carboxymethylcellulose sodium, polyvinylpyrrolidone and macrogol.

Lubricants: magnesium stearate, calcium stearate, sodium stearyl fumarate, talc, polyethyleneglycol and colloid silica.

Disintegrants: crystalline cellulose, agar, gelatin, calcium carbonate, sodium hydrogen carbonate, calcium citrate, dextrin, pectin, low substituted hydroxypropylcellulose, carboxymethylcellulose, carboxymethylcellulose calcium, croscarmellose sodium, carboxymethyl starch and carboxymethyl starch sodium.

Colorants: ferric oxide, yellow ferric oxide, carmine, caramel, beta-carotene, titanium oxide, talc, riboflavin sodium phosphate, yellow aluminum lake and the like that are approved as additives in medicine.

Flavoring agents: cocoa powder, menthol, aromatic powder, peppermint oil, camphor and cinnamon powder.

Emulsifiers or surfactants: stearyl triethanolamine, sodium lauryl sulfate, laurylaminopropionate, lecithin, glycerine monostearate, sucrose fatty acid ester and glycerine fatty acid ester.

Solubilizing agents: polyethyleneglycol, propylene glycol, benzyl benzoate, ethanol, cholesterol, triethanolamine, sodium carbonate, sodium citrate, Polysorbate 80 and nicotine acid amide.

Suspending agents: in addition to the surfactants mentioned above, hydrophilic polymers such as polyvinyl alcohol, polyvinylpyrrolidone, methylcellulose, hydroxymethylcellulose, hydroxyethylcellulose and hydroxypropylcellulose.

Tonicity agents: glucose, sodium chloride, mannitol and sorbitol.

Buffers: buffers made from phosphate, acetate, carbonate and citrate.

Antiseptic agents: methylparaben, propylparaben, chlorobutanol, benzyl alcohol, phenethyl alcohol, dehydroacetic acid and sorbic acid.

Antioxidant agents: hydrosulfate, ascorbic acid and alpha-tocopherol.

Stabilizers: those generally used for medicine.

Absorption promoters: those generally used for medicine.

If required, components such as vitamins and amino acids may be blended.

Examples of formulations include oral formulations such as tablets, dispersant, granule, fine granule, capsule, syrup, lozenge and inhaler; external formulations such as suppository, ointment, eye ointment, poultice strip, eye-drops, nasal drops, eardrops, skin patch and lotion; and injectable formulations.

The oral formulations mentioned above may be formulated by appropriately combining the additives mentioned above. If necessary, surface of these formulations may be coated.

The external formulations mentioned above may be formulated by appropriately combining the additives mentioned above, particularly excipients, binders, flavoring agents, emulsifiers, surfactants, solubilizing agents, suspending agent, tonicity agents, antiseptic agents, antioxidant agents, stabilizers and absorption promoters.

The injectable formulations mentioned above may be formulated by appropriately combining the additives mentioned above, particularly emulsifiers, surfactants, solubilizing agents, suspending agents, tonicity agents, buffers, antiseptic agents, antioxidant agents, stabilizers and absorption promoters. The injectable formulations may be used through means such as infusion, intramuscular injection, subcutaneous injection, intradermal injection and intravenous injection.

The present invention relates to a method for treating at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract, the method including administering an effective amount of an RET kinase inhibiting substance to a patient. The present invention also relates to a method for treating thyroid carcinoma, including administering an effective amount of an RET kinase inhibiting substance to a patient.

The present invention further relates to a method for treating a disease, including administering an effective amount of an RET kinase inhibiting substance to an organism including a cell expressing mutant RET. According to the present invention, said disease is preferably at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract.

According to the therapeutic method of the invention, the route and the method for administering the RET kinase inhibiting substance are not particularly limited and reference may be made to the description of the therapeutic agent or the pharmaceutical composition above.

The present invention includes use of an RET kinase inhibiting substance for producing a therapeutic agent for treating at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract. The present invention also includes use of an RET kinase inhibiting substance for producing a therapeutic agent for treating thyroid carcinoma.

The present invention further includes use of an RET kinase inhibiting substance for producing a pharmaceutical composition containing the RET kinase inhibiting substance for administering to an organism including a cell expressing mutant RET. As to the use according to the invention, the pharmaceutical composition is effective as an agent for treating at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract.

The present invention includes an RET kinase inhibiting substance for a therapeutic agent for treating at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract. In addition, the present invention includes an RET kinase inhibiting substance for a therapeutic agent for treating thyroid carcinoma.

Furthermore, the present invention includes an RET kinase inhibiting substance for a pharmaceutical composition containing the RET kinase inhibiting substance for administering to an organism including a cell expressing mutant RET. According to the present invention, said pharmaceutical composition is useful as a therapeutic agent for treating at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract.

The present invention also provides an RET kinase inhibitor containing the compound represented by General Formula (I), a pharmacologically acceptable salt thereof or a solvate thereof.

The compound represented by General Formula (I) is as mentioned above and preferably 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide.

The present invention further provides an RET kinase inhibitor containing at least one compound selected from

  • 5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrrole-3-carboxylic acid(2-diethylaminoethyl)amide (SU11248),
  • N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N′-(5-methyl-3-isoxazolyl)urea (KRN951) and
  • 4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)propoxy]quinazoline (AZD2171),
    a pharmacologically acceptable salt thereof or a solvate thereof.

The RET kinase-inhibiting activity of the RET kinase inhibitor of the invention can be determined as described above.

The compound may be used either alone or mixed with appropriate additives mentioned above and made into a formulation as the RET kinase inhibitor of the invention.

As to the usage and the dosage of the RET kinase inhibitor of the invention, reference may be made to the description of the therapeutic agent or the pharmaceutical composition above.

The present invention also includes use of at least one compound selected from the compound represented by General Formula (I), SU11248, KRN951 and AZD2171, a pharmacologically acceptable salt thereof or a solvate thereof, for producing an RET kinase inhibitor.

The present invention further includes a method for inhibiting RET kinase with at least one compound selected from the compound represented by General Formula (I), SU11248, KRN951 and AZD2171, a pharmacologically acceptable salt thereof or a solvate thereof. According to the method of the invention, the usage and the dosage of the compound are not particularly limited and reference may be made to the description of the therapeutic agent or the pharmaceutical composition above.

2. Method for Predicting Sensitivity

The present invention provides a method for predicting whether or not a patient is highly sensitive to an RET kinase inhibiting substance of the invention using the presence or the absence of RET mutation in the cell as an indication. Therapeutic effect of a RET kinase inhibiting substance is more prospective for patients highly sensitive to said RET kinase inhibiting substance.

According to the method of the invention, a patient is preferably a patient suffering from at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract.

(1) Step of Determining the Presence or the Absence of RET Mutation in the Cell

In this step, the cell is preferably taken from the patient. The cell may be obtained, for example, by removing it from a patient by a surgical procedure (e.g., biopsy, etc.). Preferably, blood cells are used for genetic-variation-induced diseases such as multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, thyroid carcinoma, papillary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract.

The presence or the absence of RET mutation can be determined according to the method described above.

(2) Step of Predicting Whether or not Patient is Highly Sensitive to RET Kinase Inhibiting Substance

In this step, whether a patient is highly sensitive to an RET kinase inhibiting substance can be predicted preferably using the presence or the absence of RET mutation in the cell determined in (1) as an indication. Specifically, when the cell determined is expressing mutant RET, the patient is judged to be highly sensitive to the RET kinase inhibiting substance.

Another aspect of the invention is a method for analyzing sensitivity of a cell to an RET kinase inhibiting substance using the determination result in (1) as an indication. Specifically, when the cell is expressing mutant RET based on the determination results in (1), this cell is judged to be more sensitive to the RET kinase inhibiting substance as compared to cells not expressing the mutant RET.

Yet another aspect of the invention is a method for selecting a cell or a patient highly sensitive to an RET kinase inhibiting substance using the determination result in (1) as an indication. Specifically, when a cell is expressing mutant RET as determined from the results in (1), this cell or a patient having this cell is judged to be highly sensitive to the RET kinase inhibiting substance. Thus, such cell or such patient can be selected as a cell or a patient highly sensitive to the RET kinase inhibiting substance.

Still yet another aspect of the invention is a method for classifying patients through analysis of sensitivity to an RET kinase inhibiting substance using the determination result in (1) as an indication. Specifically, according to the method of the invention, sensitivity of patients to an RET kinase inhibiting substance is analyzed based on the determination results in (1) as described above, and the patients having the cell of interest can be classified according to this result. For example, patients may be classified into a group including cells expressing mutant RET and a group without such cell. Alternatively, patients may be classified into a group highly sensitive to an RET kinase inhibiting substance and a group of others.

Still yet another aspect of the invention is a method for selecting a patient for administering an RET kinase inhibiting substance, the method including selecting a patient having a cell expressing mutant RET based on the results from the determination in (1). Patients having a cell expressing mutant RET can be a target intended for administering the RET kinase inhibiting substance.

Still yet another aspect of the invention is a method for predicting the therapeutic effect of the RET kinase inhibiting substance on a patient based on the results from the determination in (1). According to the method of the invention, when the cell is expressing mutant RET as determined from the results in (1), the cell is judged to be highly sensitive to the RET kinase inhibiting substance, and thus the therapeutic effect of this RET kinase inhibiting substance is predicted be high on the cell or a patient having this cell.

The present invention also relates to a method for determining the presence or the absence of RET mutation in the cell derived from a patient for predicting the sensitivity level of the patient to the RET kinase inhibiting substance. This determination method is as described in (1) above.

Determination of the presence or the absence of RET mutation enables prediction of the sensitivity level of a patient to the RET kinase inhibiting substance.

In this step, although the RET kinase inhibiting substance is as described above, it is preferably 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof.

The method of the invention can be employed to predict the level of the efficacy of the RET kinase inhibiting substance on a patient before administering the RET kinase inhibiting substance to the patient. Therefore, patients who are expected to be more susceptible to the RET kinase inhibiting substance can be selected for carrying out the treatment of the disease. Thus, the present invention is highly effective in clinical respect.

The present invention provides a test kit for determining the presence or the absence of RET mutation used for the method of the invention. The test kit of the invention contains the reagents mentioned above used for the determination. The test kit of the invention allows prediction of whether or not a patient is highly sensitive to the RET kinase inhibiting substance.

The present invention also relates to use of the test kit for the prediction mentioned above.

Hereinafter, the present invention will be illustrated by way of specific examples, although the invention should not be limited thereto.

EXAMPLE 1

Determination of RET Kinase-Inhibiting Activity of RET Kinase Inhibiting Substance

RET kinase-inhibiting activity of test substances were tested by ProQinase (Freiburg, Germany, GmbH) upon our request. To be more precise, RET kinase-inhibiting activity was determined as follows.

1. Expression and Purification of RET

RET was expressed as human recombinant GST fusion protein (hereinafter, also referred to as “RET recombinant protein”) in an insect cell (Spodoptera frugiperda 9 (Sf9)) according to the method of Baculovirus Expression System. The expressed RET recombinant protein was purified by affinity chromatography using GSH-agarose (Sigma) or Ni-NTH-agarose (Qiagen). The purity and identification of the protein can be confirmed by SDS-PAGE silver staining and western blotting using an antibody specific to RET.

2. Determination of Inhibitory Activity to RET Kinase Activity

First, to each well of streptavidin-coated 96-well FlashPlate (Perkin Elmer/NEM), 20 ÎĽl of standard reaction solution, 5 ÎĽl of ATP solution (diluted with H2O), 5 ÎĽl of the test substance (10% aqueous dimethylsulfoxide solution), and a mixed solution including 10 ÎĽl of solution containing 50 ng of RET recombinant protein and 10 ÎĽl of solution containing 125 ng of biotinylated Poly(Glu, Tyr)4:1 were added sequentially. This kinase reaction solution (50 ÎĽL) contained 60 mM HEPES-NaOH (pH7.5), 3 mM MgCl2, 3 mM MnCl2, 3 ÎĽM Na-orthovanadate, 1.2 mM DTT, 50 ÎĽg/ml PEG20000, and 1 ÎĽM [Îł-33P]-ATP.

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide (methanesulfonate), 6-[2-(methylcarbamoyl)phenylsulfanyl]-3-E-[2-(pyridine-2-yl)ethenyl]indazole (hereinafter, also referred to as “AG013736”), SU11248, KRN951 or AZD2171 was used as the test substance.

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide was produced according to the descriptions of International publication No. 02/32872 pamphlet (WO02/32872) and International publication No. 2005/063713 pamphlet (WO2005/063713).

AG013736 was produced based on the description of International publication No. 01/002369 pamphlet (WO01/002369). SU11248 was produced based on the description of International publication No. 01/060814 pamphlet (WO01/060814). KRN951 was produced based on the description of International publication No. 02/088110 pamphlet (WO02/088110). AZD2171 was produced based on the description of International publication No. 00/47212 pamphlet (WO00/47212).

Next, the reaction solution was incubated at 30° C. for 80 minutes, after which 50 μl of 2% (v/v) H3PO4 solution was added to terminate the reaction.

The 96-well plate was washed and aspirated twice with 200 ÎĽl of 0.9% (w/v) NaCl solution.

The amount of 33Pi incorporation can be assessed by determining the radioactivity on the plate with a microplate scintillation counter (from Microbeta, Wallac).

The manipulation was performed with a BeckmanCoulter/Sagian robotic system.

The concentration of the test substance required for inhibiting RET kinase activity for 50% (IC50) was calculated using specific radioactivity of 33P at varying concentrations (10 points ranging from 10 ÎĽM to 0.0003 ÎĽM) with Prism 3.03 (Windows, Graphpad, San Diego, Calif., USA).

In this case, the value obtained for the case where substrate Poly(Glu, Tyr)4:1 was solely added (without the addition of RET recombinant protein) was assumed 0% while the value obtained for the case where RET recombinant protein and substrate Poly(Glu, Tyr)4:1 were added (without the addition of the test substance) was assumed 100%.

The kinase activity in the presence of the test substance at each concentration was assessed as percentage of the value obtained by subtracting the 0% value from the radioactivity value to the value obtained by subtracting the 0% value from the 100% value. Based on this percentage (%), the concentration of the test substance required to inhibit RET kinase activity for 50% (IC50) was calculated.

As a result, 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide was found to have RET kinase-inhibiting activity (IC50=35 nM). In addition, SU11248, KRN951 and AZD2171 were also found to have RET kinase-inhibiting activity (IC50=64, 92 and 75 nM, respectively). AG013736 had IC50 of 5600 nM. Furthermore, the test substances differed in the level of RET kinase-inhibiting activity.

EXAMPLE 2

Effect of RET Kinase Inhibiting Substance on Ligand-Independent RET Phosphorylation in Human Medullary Thyroid Carcinoma Cell Line (TT)

1. Preparation of Cell Extract

Human medullary thyroid carcinoma cell line (TT, purchased from ATCC) was suspended in RPMI1640 medium containing 15% FBS (purchased from Sigma). TT is a cell expressing RET where cysteine at codon 634 in the wild-type RET amino acid sequence is mutated with tryptophan (Biochemical and Biophysical Research Communications, 207, 1022-1028, 1995). Two mL of this cell suspension per well (4×105 cells/mL) was added to 6-well cell culture plate (purchased from FALCON), and cultured in a 5% CO2 incubator (37° C.) overnight. After cultivation, supernatant was removed from each well and 1.8 mL of RPMI1640 medium containing 15% FBS was added. Then, 0.2 mL of test substance 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide (methanesulfonate) (diluted in RPMI1640 medium containing 15% FBS) dissolved in dimethylsulfoxide was added and cultured in a 5% CO2 incubator (37° C.) for an hour. Supernatant was removed from each well, which was then washed with 400 μL of PBS, and added with 100 μL of solubilizing buffer (50 mM Hepes (pH7.4), 150 mM NaCl, 10% (v/v) glycerol, 1% Triton X-100, 1.5 mM MgCl2, 1 mM EDTA (pH 8.0), 100 mM NaF, 1 mM PMSF, 10 μg/mL Aprotinin, 50 μg/mL Leupeptin, 1 μg/mL Pepstatin A and 1 mM Na3VO4). Cells in this solution were harvested with a scraper and treated at 15,000 rpm and 4° C. for 15 minutes. SDS buffer was added to the supernatant and subjected to treatment at 94° C. for 5 minutes to solubilize the protein, which was then prepared to 20 μg/10 μL as a cell extract.

2. Electrophoresis and Western Blotting

The cell extract (20 ÎĽg/10 ÎĽL) was subjected to electrophoresis on 4-20% gradient polyacrylamide gel (purchased from Daiichi Pure Chemicals), followed by transfer on a PVDF membrane (purchased from Amersham pharmacia biotech) by a conventional technique. Then, the transferred membrane was immunoblotted using anti-RET antibody (anti-RET, purchased from Cell Signaling), anti-phosphorylated RET antibody (anti-phospho RET (Tyr 905), purchased from Cell Signaling), anti-Erk1/2 antibody (anti-Erk1/2, purchased from Cell Signaling) or anti-phosphorylated Erk1/2 antibody (anti-phospho-Erk1/2, purchased from Cell Signaling) as primary antibody, and horse radish peroxidase-labeled anti-rabbit IgG antibody (anti-rabbit IgG, HRP-linked Antibody (purchased from Cell Signaling)) as secondary antibody. The membrane was washed and then treated with Super Signal (purchased from PIERCE) for color development.

RET autophosphorylation activity (%) of each lane was determined assuming the absorbance of the well added with test substance-free cell extract as 100% RET autophosphorylation activity. RET autophosphorylation activity (%) was determined while stepwisely varying the concentration of the test substance to calculate the concentration of the test substance required for inhibiting RET autophosphorylation activity for 50% (IC50).

As a result, 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide inhibited RET phosphorylation in a concentration-dependent manner (IC50=27 nM) (FIG. 1). In addition, 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide was also found to inhibit phosphorylation of one of the downstream molecule of RET, Erk1/2, which is associated with cell growth signal, at a concentration similar to that for RET kinase (FIG. 1).

EXAMPLE 3

Effect of RET Kinase Inhibiting Substance on Cell Growth of Human Medullary Thyroid Carcinoma Cell Line (TT)

Human medullary thyroid carcinoma cell line (TT, purchased from ATCC) was suspended in RPMI1640 medium containing 15% FBS (purchased from Sigma). 0.1 mL per well of this cell suspension (3×104 cells/mL) was added to 96-well cell culture plate (purchased from NUNC), and cultured in a 5% CO2 incubator (37° C.) overnight. After cultivation, 0.1 mL of test substance 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide (methanesulfonate) diluted in RPMI1640 medium containing 15% FBS was added to each well and further cultured in a 5% CO2 incubator (37° C.) for 10 days. After cultivation, 10 μL of Cell Counting Kit-1 (purchased from DOJINDO) was added to each well, treated in 5% CO2 incubator (37° C.) for color development and absorbance of each well was determined with plate reader MTP-500 (Corona Electric) at measurement wavelength of 415 nm and reference wavelength of 660 nm. Percentage (%) of the absorbance of each well with the test substance was determined compared to the absorbance of well without the test substance, based on which concentration of the test substance required for inhibiting cell growth for 50% (IC50) was calculated.

As a result, 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide was found to have inhibitory activity of IC50=78 nM against growth of human medullary thyroid carcinoma cell line (TT).

EXAMPLE 4

Antitumor Effect of RET Kinase Inhibiting Substance in Model for Subcutaneous Transplantation of Human Medullary Thyroid Carcinoma Cell Line (TT)

Human medullary thyroid carcinoma cell line (TT, purchased from ATCC) was cultured at 37° C. in RPMI1640 (containing 15% FBS) in a 5% carbon dioxide incubator to about 80% confluence, and cells were harvested with trypsin-EDTA according to a general method. The cells were suspended in a phosphate buffer to prepare 1×108 cells/mL suspension. 0.1 mL each of the resulting cell suspension was subcutaneously transplanted to a nude mouse at the side of its body (purchased from Charles River).

Once the tumor volume became approximately 100-200 mm3 after transplantation, the test substance 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide (methanesulfonate) was orally administered for 10 mg/kg, 30 mg/kg or 100 mg/kg, once a day, for four weeks. The major and minor axes of tumors were measured with Digimatic caliper (Mitsutoyo), and tumor volumes were calculated according to the following formula.


Tumor Volume(TV)=Major axis of tumor (mm)Ă—(Minor axis of tumor)2 (mm2)/2

As a result, 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide was found to have dose-dependent antitumor effect in the model for subcutaneous transplantation of human medullary thyroid carcinoma cell line (TT) (FIG. 2).

EXAMPLE 5

Effect of RET Kinase Inhibiting Substance on RET Phosphorylation in Model for Subcutaneous Transplantation of Human Medullary Thyroid Carcinoma Cell Line (TT)

Human medullary thyroid carcinoma cell line (TT, purchased from ATCC) was cultured at 37° C. in RPMI1640 (containing 15% FBS) in a 5% carbon dioxide incubator to about 80% confluence, and cells were harvested with trypsin-EDTA according to a general method. The cells were suspended in a phosphate buffer to prepare 1×108 cells/mL suspension. 0.1 mL each of the resulting cell suspension was subcutaneously transplanted to a nude mouse at the side of its body (purchased from Charles River).

Once the tumor volume became approximately 100-200 mm3 after transplantation, the test substance 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide (methanesulfonate) was orally administered for 10 mg/kg, 30 mg/kg or 100 mg/kg. Tumors were resected 2, 8, 12 or 24 hours after administration, to which solubilizing buffer (50 mM Hepes (pH7.4), 150 mM NaCl, 10% (v/v) glycerol, 1% Triton X-100, 1.5 mM MgCl2, 1 mM EDTA (pH 8.0), 100 mM NaF, 1 mM PMSF, 10 μg/mL Aprotinin, 50 μg/mL Leupeptin, 1 μg/mL Pepstatin A, 1 mM Na3VO4), 25 mM β-glycerophosphate, and phosphatase inhibitor cocktail II (SIGMA)) were added and homogenized. Treatment at 15,000 rpm and 4° C. for 15 minutes and addition of SDS buffer to the supernatant were followed by treatment at 94° C. for 5 minutes to solubilize protein to 20 μg/10 μL to prepare cell extract. The cell extract was subjected to electrophoresis and immunoblotting in the same manner as in Example 2.

As a result, 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide was found to have RET autophosphorylation inhibitory activity at the dose found to exert antitumor effect in the model for subcutaneous transplantation of human medullary thyroid carcinoma cell line (TT) (FIG. 3).

From these results, it was shown that the RET kinase inhibiting substance of the invention was expected to be more effective to organisms containing cells expressing mutant RET. The RET kinase inhibiting substance of the invention was also demonstrated to be useful as a therapeutic agent for treating at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract as well as thyroid carcinoma.

REFERENCE EXAMPLE

Hereinafter, a method for producing a formulation of one of the RET kinase inhibiting substances, 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide will be described as a reference example.

(Production of Pharmaceutical Composition)

(1) 1 mg Tablet

24 g of crystal (C) of methanesulfonate of 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide (hereinafter, also referred to as “crystal (C)”, which was produced according to the method described in Example 7 of WO2005/063713) and 192 g of light anhydrous silicic acid (antigelling agent sold under the trade name of AEROSIL (registered trademark) 200, Nippon Aerosil) were mixed with 20 L Super Mixer, and then 1236 g of D-mannitol (excipient, Towa-Kasei), 720 g of crystalline cellulose (excipient sold under the trade name of Avicel PH101, Asahi Kasei) and 72 g of hydroxypropylcellulose (binder sold under the trade name of HPC-L, Nippon Soda) were further added and mixed together. Subsequently, a suitable amount of anhydrous ethanol was added to obtain a granulated body containing crystal (C). This granulated body was dried in a rack dryer (60° C.), and then size-regulated using Power Mill to obtain granules. Together with the granules, 120 g of croscarmellose sodium (disintegrant sold under the trade name of Ac-Di-Sol, FMC International Inc.) and 36 g of sodium stearyl fumarate (lubricant, JRS Pharma LP) were placed and mixed together in a 20 L tumbler mixer, and molded with a tablet machine to obtain tablets with a total mass of 100 mg per tablet. Furthermore, the tablets were coated using aqueous 10% Opadry yellow (OPADRY 03F42069 YELLOW, Colorcon Japan) solution as a coating solution with a tablet coating machine, thereby obtaining coated tablets with a total mass of 105 mg per tablet.

(2) 10 mg Tablet

60 g of crystal (C) and 192 g of light anhydrous silicic acid (antigelling agent sold under the trade name of AEROSIL (registered trademark) 200, Nippon Aerosil) were mixed with 20 L Super Mixer, and then 1200 g of D-mannitol (excipient, Towa-Kasei), 720 g of crystalline cellulose (excipient sold under the trade name of Avicel PH101, Asahi Kasei) and 72 g of hydroxypropylcellulose (binder sold under the trade name of HPC-L, Nippon Soda) were further added and mixed together. Subsequently, a suitable amount of anhydrous ethanol was added to obtain a granulated body containing crystal (C). This granulated body was dried in a rack dryer (60° C.), and then size-regulated using Power Mill to obtain granules. Together with the granules, 120 g of croscarmellose sodium (disintegrant sold under the trade name of Ac-Di-Sol, FMC International Inc.) and 36 g of sodium stearyl fumarate (lubricant, JRS Pharma LP) were placed and mixed together in a 20 L tumbler mixer, and molded with a tablet machine to obtain tablets with a total mass of 400 mg per tablet. Furthermore, the tablets were coated using aqueous 10% Opadry yellow (OPADRY 03F42069 YELLOW, Colorcon Japan) solution as a coating solution with a tablet coating machine, thereby obtaining coated tablets with a total mass of 411 mg per tablet.

(3) 100 mg Tablet

31.4 g of crystal (C) and 4 g of light anhydrous silicic acid (antigelling agent sold under the trade name of AEROSIL (registered trademark) 200, Nippon Aerosil) were mixed with 1 L Super Mixer, and then 40.1 g of anhydrous calcium hydrogen phosphate (excipient, Kyowa Chemical Industry), 10 g of low substituted hydroxypropylcellulose (binder sold under the trade name of L-HPC (LH-21), Shin-Etsu Chemical) and 3 g of hydroxypropylcellulose (binder sold under the trade name of HPC-L, Nippon Soda) were further added and mixed together. Subsequently, a suitable amount of anhydrous ethanol was added to obtain a granulated body containing crystal (C). This granulated body was dried in a rack dryer (60° C.), and then granulated using Power Mill to obtain granules. Together with the granules, 10 g of croscarmellose sodium (disintegrant sold under the trade name of Ac-Di-Sol, FMC International Inc.) and 1.5 g of sodium stearyl fumarate (lubricant, JRS Pharma LP) were mixed and molded with a tablet machine to obtain tablets with a total mass of 400 mg per tablet.

The present invention provides a therapeutic agent and a method containing an RET kinase inhibiting substance for treating at least one disease selected from multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract, use of RET kinase inhibiting substance for producing said therapeutic agent and an RET kinase inhibiting substance for said therapeutic agent.

The present invention also provides a therapeutic agent and a method containing an RET kinase inhibiting substance for treating thyroid carcinoma, use of an RET kinase inhibiting substance for producing said therapeutic agent and an RET kinase inhibiting substance for said therapeutic agent.

Moreover, the present invention provides a pharmaceutical composition containing an RET kinase inhibiting substance for administering to an organism including a cell expressing mutant RET, a method for treating a disease including administration to an organism including a cell expressing mutant RET, use of RET kinase inhibiting substance for producing said pharmaceutical composition and an RET kinase inhibiting substance for said pharmaceutical composition.

The present invention also provides an RET kinase inhibitor.

Furthermore, the present invention provides a method for predicting the effect of an RET kinase inhibiting substance.

More specifically, the effect of an RET kinase inhibiting substance can be predicted using the presence or the absence of RET mutation in the cell as an indication.

Since the method according to the invention enables one to predict the effect of the compound without administering the compound to the patient, it has become possible to select a patient who is expected to be more susceptible to the compound. Thus, contribution to the patient's QOL has become possible.

Sequence Listing Free Text

SEQ ID NOS: 5-20 Primers

Claims

1. A therapeutic agent comprising an RET kinase inhibiting substance for treating at least one disease selected from the group consisting of multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract, wherein said RET kinase inhibiting substance is a compound represented by General Formula (I)

wherein, R1 represents a group represented by Formula —V1—V2—V3 (wherein, V1 represents C1-6 alkylene group that may have a substituent; V2 represents a single bond, an oxygen atom, a sulfur atom, carbonyl group, sulfinyl group, sulfonyl group, group represented by Formula —CONR6—, group represented by Formula —SO2NR6—, group represented by Formula —NR6SO2—, group represented by Formula —NR6CO— or group represented by Formula —NR6— (wherein, R6 represents a hydrogen atom, C1-6 alkyl group that may have a substituent or C3-8 cycloalkyl group that may have a substituent); V3 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent);

R2 represents cyano group, C1-6 alkoxy group that may have a substituent, carboxyl group, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVa11Va12 (wherein, Va11 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent; Va12 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent, 3-10-membered non-aromatic heterocyclic group that may have a substituent, hydroxyl group, C1-6 alkoxy group that may have a substituent or C3-8 cycloalkoxy group that may have a substituent);

Y1 represents a group represented by Formula

(wherein, R7 and R8 each independently represent a hydrogen atom, a halogen atom, cyano group, nitro group, amino group, C1-6 alkyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C1-6 alkoxy group that may have a substituent, C1-6 alkylthio group that may have a substituent, formyl group, C2-7 acyl group that may have a substituent, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVd1Vd2 (wherein, Vd1 and Vd2 each independently represent a hydrogen atom or C1-6 alkyl group that may have a substituent);

W1 and W2 each independently represent a carbon atom or a nitrogen atom that may have a substituent);

R3 and R4 each independently represent a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C2-7 acyl group that may have a substituent or C2-7 alkoxycarbonyl group that may have a substituent; and

R5 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent,

a pharmacologically acceptable salt thereof or a solvate thereof.

2. The therapeutic agent according to claim 1, wherein R1 is C1-6 alkyl group (where, R1 may have at least one substituent selected from the group consisting of 3-10-membered non-aromatic heterocyclic group that may have C1-6 alkyl group, hydroxyl group, C1-6 alkoxy group, amino group, mono-C1-6 alkylamino group and di-C1-6 alkylamino group).

3. The therapeutic agent according to claim 1, wherein R1 is methyl group or group represented by any one of the following Formulae

(wherein, Ra3 represents methyl group; Ra1 represents a hydrogen atom or hydroxyl group; Ra2 represents methoxy group, ethoxy group, 1-pyrrolidinyl group, 1-piperidinyl group, 4-morpholinyl group, dimethylamino group or diethylamino group).

4. The therapeutic agent according to claim 1, wherein R1 is methyl group or 2-methoxyethyl group.

5. The therapeutic agent according to claim 1, wherein R2 represents cyano group or group represented by Formula —CONVa11Va12 (wherein, Va11 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent; Va12 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent, 3-10-membered non-aromatic heterocyclic group that may have a substituent, hydroxyl group, C1-6 alkoxy group that may have a substituent or C3-8 cycloalkoxy group that may have a substituent).

6. The therapeutic agent according to claim 1, wherein R2 is cyano group or group represented by Formula —CONHVa16 (wherein, Va16 represents a hydrogen atom, C1-6 alkyl group, C3-8 cycloalkyl group, C1-6 alkoxy group or C3-8 cycloalkoxy group, where Va16 may have at least one substituent selected from the group consisting of a halogen atom, cyano group, hydroxyl group and C1-6 alkoxy group).

7. The therapeutic agent according to claim 1, wherein R2 is a group represented by Formula —CONHVa17 (wherein, Va17 represents a hydrogen atom, C1-6 alkyl group or C1-6 alkoxy group).

8. The therapeutic agent according to claim 1, wherein R2 is a group represented by Formula —CONHVa18 (wherein, Va18 represents a hydrogen atom, methyl group or methoxy group).

9. The therapeutic agent according to claim 1, wherein Y1 is a group represented by Formula

(wherein, R71 represents a hydrogen atom or a halogen atom).

10. The therapeutic agent according to claim 1, wherein R3 and R4 is a hydrogen atom.

11. The therapeutic agent according to claim 1, wherein R5 is a hydrogen atom, C1-6 alkyl group, C3-8 cycloalkyl group or C6-10 aryl group (where, R5 may have at least one substituent selected from the group consisting of a halogen atom and methanesulfonyl group).

12. The therapeutic agent according to claim 1, wherein R5 is methyl group, ethyl group or cyclopropyl group.

13. The therapeutic agent according to claim 1, wherein the RET kinase inhibiting substance is at least one compound selected from the group consisting of:

N-(4-(6-cyano-7-(2-methoxyethoxy)-4-quinolyl)oxy-2-fluorophenyl)-N′-(4-fluorophenyl)urea;

N-(2-chloro-4-((6-cyano-7-((1-methyl-4-piperidyl)methoxy)-4-quinolyl)oxy)phenyl)-N′-cyclopropylurea;

N-(4-((6-cyano-7-(((2R)-3-(diethylamino)-2-hydroxypropyl)oxy)-4-quinolyl)oxy)phenyl)-N′-(4-fluorophenyl)urea;

N-(4-((6-cyano-7-(((2R)-2-hydroxy-3-(1-pyrrolidino)propyl)oxy)-4-quinolyl)oxy)phenyl)-N′-(4-fluorophenyl)urea;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-methoxyethoxy)-6-quinolinecarboxamide;

N6-cyclopropyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-(2-methoxyethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-(2-fluoroethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-methoxy-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-ethyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-fluoro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-methoxyethoxy)-6-quinolinecarboxamide;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-hydroxyethoxy)-6-quinolinecarboxamide;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-((2S)-2,3-dihydroxypropyl)oxy-6-quinolinecarboxamide;

4-(3-chloro-4-(methylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-methoxy-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-ethoxyethoxy)-6-quinolinecarboxamide;

4-(4-((cyclopropylamino)carbonyl)aminophenoxy)-7-(2-methoxyethoxy)-6-quinolinecarboxamide;

N-(2-fluoro-4-((6-carbamoyl-7-methoxy-4-quinolyl)oxy)phenyl)-N′-cyclopropylurea;

N6-(2-hydroxyethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(1-propylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(cis-2-fluoro-cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-(2-methoxyethoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-(4-morpholino) ethoxy)-6-quinolinecarboxamide;

4-(3-chloro-4-(2-fluoroethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-((2R)tetrahydro-2-furanylmethyl)-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-fluoro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-((2R)-2-hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((2R)-3-diethylamino-2-hydroxypropoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((2R)-3-diethylamino-2-hydroxypropoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((2R)-2-hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((2R)-2-hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((1-methyl-4-piperidyl)methoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((1-methyl-4-piperidyl)methoxy)-6-quinolinecarboxamide;

N-(4-(6-cyano-7-(2-methoxyethoxy)-4-quinolyl)oxy-2-fluorophenyl)-N′-cyclopropylurea;

N-(4-(6-cyano-7-(3-(4-morpholino)propoxy)-4-quinolyl)oxyphenyl)-N′-(3-(methylsulfonyl)phenyl)urea;

4-(4-((cyclopropylamino)carbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-fluoro-4-((2-fluoroethylamino)carbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-(2-ethoxyethyl)-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(4-(3-ethylureido)-3-fluoro-phenoxy)-7-methoxyquinoline-6-carboxylic acid (2-cyanoethyl)amide; and

N-(4-(6-(2-cyanoethyl)carbamoyl-7-methoxy-4-quinolyl)oxy-2-fluorophenyl)-N′-cyclopropylurea,

a pharmacologically acceptable salt thereof or a solvate thereof.

14. The therapeutic agent according to claim 1, wherein the RET kinase inhibiting substance is at least one compound selected from the group consisting of:

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-methoxy-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(methylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide; and

N6-methoxy-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide,

a pharmacologically acceptable salt thereof or a solvate thereof.

15. The therapeutic agent according to claim 1, wherein the RET kinase inhibiting substance is 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof.

16. The therapeutic agent according to claim 1, wherein the RET kinase inhibiting substance is methanesulfonate of 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide.

17. A therapeutic agent comprising an RET kinase inhibiting substance for treating at least one disease selected from the group consisting of multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract, wherein said RET kinase inhibiting substance is at least one compound selected from the group consisting of:

5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrrole-3-carboxylic acid(2-diethylaminoethyl)amide;

N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N′-(5-methyl-3-isoxazolyl)urea; and

4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)propoxy]quinazoline,

a pharmacologically acceptable salt thereof or a solvate thereof.

18. The therapeutic agent according to claim 1, wherein the disease comprises a cell expressing mutant RET.

19. The therapeutic agent according to claim 18, wherein the mutant RET comprises a mutation site where at least one amino acid selected from the group consisting of amino acids at codons 321, 533, 609, 611, 618, 620, 630, 631, 634, 691, 768, 790, 791, 804, 806, 844, 883, 891 and 918 in the amino acid sequence represented by SEQ ID NO: 2 or 4 is substituted with other amino acid.

20. The therapeutic agent according to claim 18, wherein the mutant RET is a polypeptide encoded by RET gene rearranged with at least one gene selected from the group consisting of H4 gene, RIα gene, ELE1 gene, RFG5 gene, hTIF gene, RFG7 gene, ELKS gene, kinectin gene, PCM-1 gene and RFP gene.

21. A therapeutic agent comprising an RET kinase inhibiting substance for treating thyroid carcinoma, wherein said RET kinase inhibiting substance is a compound represented by General Formula (I)

wherein, R1 represents a group represented by Formula —V1—V2—V3 (wherein, V1 represents C1-6 alkylene group that may have a substituent; V2 represents a single bond, an oxygen atom, a sulfur atom, carbonyl group, sulfinyl group, sulfonyl group, group represented by Formula —CONR6—, group represented by Formula —SO2NR6—, group represented by Formula —NR6SO2—, group represented by Formula —NR6CO— or group represented by Formula —NR6— (wherein, R6 represents a hydrogen atom, C1-6 alkyl group that may have a substituent or C3-8 cycloalkyl group that may have a substituent); V3 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent);

R2 represents cyano group, C1-6 alkoxy group that may have a substituent, carboxyl group, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVa11Va12 (wherein, Va11 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent; Va12 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent, 3-10-membered non-aromatic heterocyclic group that may have a substituent, hydroxyl group, C1-6 alkoxy group that may have a substituent or C3-8 cycloalkoxy group that may have a substituent);

Y1 represents a group represented by Formula

(wherein, R7 and R8 each independently represent a hydrogen atom, a halogen atom, cyano group, nitro group, amino group, C1-6 alkyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C1-6 alkoxy group that may have a substituent, C1-6 alkylthio group that may have a substituent, formyl group, C2-7 acyl group that may have a substituent, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVd1Vd2 (wherein, Vd1 and Vd2 each independently represent a hydrogen atom or C1-6 alkyl group that may have a substituent);

W1 and W2 each independently represent a carbon atom or a nitrogen atom that may have a substituent);

R3 and R4 each independently represent a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C2-7 acyl group that may have a substituent or C2-7 alkoxycarbonyl group that may have a substituent; and

R5 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent,

a pharmacologically acceptable salt thereof or a solvate thereof.

22. The therapeutic agent according to claim 21, wherein R1 is C1-6 alkyl group (where, R1 may have at least one substituent selected from the group consisting of 3-10-membered non-aromatic heterocyclic group that may have C1-6 alkyl group, hydroxyl group, C1-6 alkoxy group, amino group, mono-C1-6 alkylamino group and di-C1-6 alkylamino group).

23. The therapeutic agent according to claim 21, wherein R1 is methyl group or group represented by any one of the following Formulae

(wherein, Ra3 represents methyl group; Ra1 represents a hydrogen atom or hydroxyl group; Ra2 represents methoxy group, ethoxy group, 1-pyrrolidinyl group, 1-piperidinyl group, 4-morpholinyl group, dimethylamino group or diethylamino group).

24. The therapeutic agent according to claim 21, wherein R1 is methyl group or 2-methoxyethyl group.

25. The therapeutic agent according to claim 21, wherein R2 represents cyano group or group represented by Formula —CONVa11Va12 (wherein, Va11 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent; Va12 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent, 3-10-membered non-aromatic heterocyclic group that may have a substituent, hydroxyl group, C1-6 alkoxy group that may have a substituent or C3-8 cycloalkoxy group that may have a substituent).

26. The therapeutic agent according to claim 21, wherein R2 is cyano group or group represented by Formula —CONHVa16 (wherein, Va16 represents a hydrogen atom, C1-6 alkyl group, C3-8 cycloalkyl group, C1-6 alkoxy group or C3-8 cycloalkoxy group, where Va16 may have at least one substituent selected from the group consisting of a halogen atom, cyano group, hydroxyl group and C1-6 alkoxy group).

27. The therapeutic agent according to claim 21, wherein R2 is a group represented by Formula —CONHVa17 (wherein, Va17 represents a hydrogen atom, C1-6 alkyl group or C1-6 alkoxy group).

28. The therapeutic agent according to claim 21, wherein R2 is a group represented by Formula —CONHVa18 (wherein, Va18 represents a hydrogen atom, methyl group or methoxy group).

29. The therapeutic agent according to claim 21, wherein Y1 is a group represented by Formula

(wherein, R71 represents a hydrogen atom or a halogen atom).

30. The therapeutic agent according to claim 21, wherein R3 and R4 is a hydrogen atom.

31. The therapeutic agent according to claim 21, wherein R5 is a hydrogen atom, C1-6 alkyl group, C3-8 cycloalkyl group or C6-10 aryl group (where, R5 may have at least one substituent selected from the group consisting of a halogen atom and methanesulfonyl group).

32. The therapeutic agent according to claim 21, wherein R5 is methyl group, ethyl group or cyclopropyl group.

33. The therapeutic agent according to claim 21, wherein the RET kinase inhibiting substance is at least one compound selected from the group consisting of:

N-(4-(6-cyano-7-(2-methoxyethoxy)-4-quinolyl)oxy-2-fluorophenyl)-N′-(4-fluorophenyl)urea;

N-(2-chloro-4-((6-cyano-7-((1-methyl-4-piperidyl)methoxy)-4-quinolyl)oxy)phenyl)-N′-cyclopropylurea;

N-(4-((6-cyano-7-(((2R)-3-(diethylamino)-2-hydroxypropyl)oxy)-4-quinolyl)oxy)phenyl)-N′-(4-fluorophenyl)urea;

N-(4-((6-cyano-7-(((2R)-2-hydroxy-3-(1-pyrrolidino)propyl)oxy)-4-quinolyl)oxy)phenyl)-N′-(4-fluorophenyl)urea;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-methoxyethoxy)-6-quinolinecarboxamide;

N6-cyclopropyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-(2-methoxyethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-(2-fluoroethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-methoxy-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-ethyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-fluoro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-methoxyethoxy)-6-quinolinecarboxamide;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-hydroxyethoxy)-6-quinolinecarboxamide;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-((2S)-2,3-dihydroxypropyl)oxy-6-quinolinecarboxamide;

4-(3-chloro-4-(methylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-methoxy-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-ethoxyethoxy)-6-quinolinecarboxamide;

4-(4-((cyclopropylamino)carbonyl)aminophenoxy)-7-(2-methoxyethoxy)-6-quinolinecarboxamide;

N-(2-fluoro-4-((6-carbamoyl-7-methoxy-4-quinolyl)oxy)phenyl)-N′-cyclopropylurea;

N6-(2-hydroxyethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(1-propylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(cis-2-fluoro-cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-(2-methoxyethoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-(4-morpholino) ethoxy)-6-quinolinecarboxamide;

4-(3-chloro-4-(2-fluoroethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-((2R)tetrahydro-2-furanylmethyl)-4-(3-chloro-4-(((methylamino)carbonyl)amino) phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-fluoro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-((2R)-2-hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((2R)-3-diethylamino-2-hydroxypropoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((2R)-3-diethylamino-2-hydroxypropoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((2R)-2-hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((2R)-2-hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((1-methyl-4-piperidyl)methoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((1-methyl-4-piperidyl)methoxy)-6-quinolinecarboxamide;

N-(4-(6-cyano-7-(2-methoxyethoxy)-4-quinolyl)oxy-2-fluorophenyl)-N′-cyclopropylurea;

N-(4-(6-cyano-7-(3-(4-morpholino)propoxy)-4-quinolyl)oxyphenyl)-N′-(3-(methylsulfonyl)phenyl)urea;

4-(4-((cyclopropylamino)carbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-fluoro-4-((2-fluoroethylamino)carbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-(2-ethoxyethyl)-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(4-(3-ethylureido)-3-fluoro-phenoxy)-7-methoxyquinoline-6-carboxylic acid (2-cyanoethyl)amide; and

N-(4-(6-(2-cyanoethyl)carbamoyl-7-methoxy-4-quinolyl)oxy-2-fluorophenyl)-N′-cyclopropylurea,

a pharmacologically acceptable salt thereof or a solvate thereof.

34. The therapeutic agent according to claim 21, wherein the RET kinase inhibiting substance is at least one compound selected from the group consisting of:

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-methoxy-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(methylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide; and

N6-methoxy-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide,

a pharmacologically acceptable salt thereof or a solvate thereof.

35. The therapeutic agent according to claim 21, wherein the RET kinase inhibiting substance is 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof.

36. The therapeutic agent according to claim 21, wherein the RET kinase inhibiting substance is methanesulfonate of 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide.

37. A therapeutic agent comprising an RET kinase inhibiting substance for treating thyroid carcinoma, wherein said RET kinase inhibiting substance is at least one compound selected from the group consisting of:

5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrrole-3-carboxylic acid(2-diethylaminoethyl)amide;

N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N′-(5-methyl-3-isoxazolyl)urea; and

4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)propoxy]quinazoline,

a pharmacologically acceptable salt thereof or a solvate thereof.

38. The therapeutic agent according to claim 21, wherein the thyroid carcinoma comprises a cell expressing mutant RET.

39. The therapeutic agent according to claim 38, wherein the mutant RET comprises a mutation site where at least one amino acid selected from the group consisting of amino acids at codons 321, 533, 609, 611, 618, 620, 630, 631, 634, 691, 768, 790, 791, 804, 806, 844, 883, 891 and 918 in the amino acid sequence represented by SEQ ID NO: 2 or 4 is substituted with other amino acid.

40. The therapeutic agent according to claim 38, wherein the mutant RET is a polypeptide encoded by RET gene rearranged with at least one gene selected from the group consisting of H4 gene, RIα gene, ELE1 gene, RFG5 gene, hTIF gene, RFG7 gene, ELKS gene, kinectin gene, PCM-1 gene and RFP gene.

41. A pharmaceutical composition comprising an RET kinase inhibiting substance for administering to an organism comprising a cell expressing mutant RET, wherein said RET kinase inhibiting substance is a compound represented by General Formula (I)

wherein, R1 represents a group represented by Formula —V1—V2—V3 (wherein, V1 represents C1-6 alkylene group that may have a substituent; V2 represents a single bond, an oxygen atom, a sulfur atom, carbonyl group, sulfinyl group, sulfonyl group, group represented by Formula —CONR6—, group represented by Formula —SO2NR6—, group represented by Formula —NR6SO2—, group represented by Formula —NR6CO— or group represented by Formula —NR6— (wherein, R6 represents a hydrogen atom, C1-6 alkyl group that may have a substituent or C3-8 cycloalkyl group that may have a substituent); V3 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent);

R2 represents cyano group, C1-6 alkoxy group that may have a substituent, carboxyl group, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVa11Va12 (wherein, Va11 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent; Va12 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent, 3-10-membered non-aromatic heterocyclic group that may have a substituent, hydroxyl group, C1-6 alkoxy group that may have a substituent or C3-8 cycloalkoxy group that may have a substituent);

Y1 represents a group represented by Formula

(wherein, R7 and R8 each independently represent a hydrogen atom, a halogen atom, cyano group, nitro group, amino group, C1-6 alkyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C1-6 alkoxy group that may have a substituent, C1-6 alkylthio group that may have a substituent, formyl group, C2-7 acyl group that may have a substituent, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVd1Vd2 (wherein, Vd1 and Vd2 each independently represent a hydrogen atom or C1-6 alkyl group that may have a substituent);

W1 and W2 each independently represent a carbon atom or a nitrogen atom that may have a substituent);

R3 and R4 each independently represent a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C2-7 acyl group that may have a substituent or C2-7 alkoxycarbonyl group that may have a substituent; and

R5 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent,

a pharmacologically acceptable salt thereof or a solvate thereof.

42. The pharmaceutical composition according to claim 41, wherein R1 is C1-6 alkyl group (where, R1 may have at least one substituent selected from the group consisting of 3-10-membered non-aromatic heterocyclic group that may have C1-6 alkyl group, hydroxyl group, C1-6 alkoxy group, amino group, mono-C1-6 alkylamino group and di-C1-6 alkylamino group).

43. The pharmaceutical composition according to claim 41, wherein R1 is methyl group or group represented by any one of the following Formulae

(wherein, Ra3 represents methyl group; Ra1 represents a hydrogen atom or hydroxyl group; Ra2 represents methoxy group, ethoxy group, 1-pyrrolidinyl group, 1-piperidinyl group, 4-morpholinyl group, dimethylamino group or diethylamino group).

44. The pharmaceutical composition according to claim 41, wherein R1 is methyl group or 2-methoxyethyl group.

45. The pharmaceutical composition according to claim 41, wherein R2 represents cyano group or group represented by Formula —CONVa11Va12 (wherein, Va11 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent; Va12 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent, 3-10-membered non-aromatic heterocyclic group that may have a substituent, hydroxyl group, C1-6 alkoxy group that may have a substituent or C3-8 cycloalkoxy group that may have a substituent).

46. The pharmaceutical composition according to claim 41, wherein R2 is cyano group or group represented by Formula —CONHVa16 (wherein, Va16 represents a hydrogen atom, C1-6 alkyl group, C3-8 cycloalkyl group, C1-6 alkoxy group or C3-8 cycloalkoxy group, where Va16 may have at least one substituent selected from the group consisting of a halogen atom, cyano group, hydroxyl group and C1-6 alkoxy group).

47. The pharmaceutical composition according to claim 41, wherein R2 is a group represented by Formula —CONHVa17 (wherein, Va17 represents a hydrogen atom, C1-6 alkyl group or C1-6 alkoxy group).

48. The pharmaceutical composition according to claim 41, wherein R2 is a group represented by Formula —CONHVa18 (wherein, Va18 represents a hydrogen atom, methyl group or methoxy group).

49. The pharmaceutical composition according to claim 41, wherein Y1 is a group represented by Formula

(wherein, R71 represents a hydrogen atom or a halogen atom).

50. The pharmaceutical composition according to claim 41, wherein R3 and R4 is a hydrogen atom.

51. The pharmaceutical composition according to claim 41, wherein R5 is a hydrogen atom, C1-6 alkyl group, C3-8 cycloalkyl group or C6-10 aryl group (where, R5 may have at least one substituent selected from the group consisting of a halogen atom and methanesulfonyl group).

52. The pharmaceutical composition according to claim 41, wherein R5 is methyl group, ethyl group or cyclopropyl group.

53. The pharmaceutical composition according to claim 41, wherein the RET kinase inhibiting substance is at least one compound selected from the group consisting of:

N-(4-(6-cyano-7-(2-methoxyethoxy)-4-quinolyl)oxy-2-fluorophenyl)-N′-(4-fluorophenyl)urea;

N-(2-chloro-4-((6-cyano-7-((1-methyl-4-piperidyl)methoxy)-4-quinolyl)oxy)phenyl)-N′-cyclopropylurea;

N-(4-((6-cyano-7-(((2R)-3-(diethylamino)-2-hydroxypropyl)oxy)-4-quinolyl)oxy)phenyl)-N′-(4-fluorophenyl)urea;

N-(4-((6-cyano-7-(((2R)-2-hydroxy-3-(1-pyrrolidino)propyl)oxy)-4-quinolyl)oxy)phenyl)-N′-(4-fluorophenyl)urea;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-methoxyethoxy)-6-quinolinecarboxamide;

N6-cyclopropyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-(2-methoxyethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-(2-fluoroethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-methoxy-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-ethyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-fluoro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-methoxyethoxy)-6-quinolinecarboxamide;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-hydroxyethoxy)-6-quinolinecarboxamide;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-((2S)-2,3-dihydroxypropyl)oxy-6-quinolinecarboxamide;

4-(3-chloro-4-(methylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-methoxy-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-ethoxyethoxy)-6-quinolinecarboxamide;

4-(4-((cyclopropylamino)carbonyl)aminophenoxy)-7-(2-methoxyethoxy)-6-quinolinecarboxamide;

N-(2-fluoro-4-((6-carbamoyl-7-methoxy-4-quinolyl)oxy)phenyl)-N′-cyclopropylurea;

N6-(2-hydroxyethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(1-propylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(cis-2-fluoro-cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-(2-methoxyethoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-(4-morpholino) ethoxy)-6-quinolinecarboxamide;

4-(3-chloro-4-(2-fluoroethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-((2R)tetrahydro-2-furanylmethyl)-4-(3-chloro-4-(((methylamino)carbonyl)amino) phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-fluoro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-((2R)-2-hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((2R)-3-diethylamino-2-hydroxypropoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((2R)-3-diethylamino-2-hydroxypropoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((2R)-2-hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((2R)-2-hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((1-methyl-4-piperidyl)methoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((1-methyl-4-piperidyl)methoxy)-6-quinolinecarboxamide;

N-(4-(6-cyano-7-(2-methoxyethoxy)-4-quinolyl)oxy-2-fluorophenyl)-N′-cyclopropylurea;

N-(4-(6-cyano-7-(3-(4-morpholino)propoxy)-4-quinolyl)oxyphenyl)-N′-(3-(methylsulfonyl)phenyl)urea;

4-(4-((cyclopropylamino)carbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-fluoro-4-((2-fluoroethylamino)carbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-(2-ethoxyethyl)-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(4-(3-ethylureido)-3-fluoro-phenoxy)-7-methoxyquinoline-6-carboxylic acid (2-cyanoethyl)amide; and

N-(4-(6-(2-cyanoethyl)carbamoyl-7-methoxy-4-quinolyl)oxy-2-fluorophenyl)-N′-cyclopropylurea,

a pharmacologically acceptable salt thereof or a solvate thereof.

54. The pharmaceutical composition according to claim 41, wherein the RET kinase inhibiting substance is at least one compound selected from the group consisting of:

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-methoxy-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(methylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide; and

N6-methoxy-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide,

a pharmacologically acceptable salt thereof or a solvate thereof.

55. The pharmaceutical composition according to claim 41, wherein the RET kinase inhibiting substance is 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof.

56. The pharmaceutical composition according to claim 41, wherein the RET kinase inhibiting substance is methanesulfonate of 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide.

57. A pharmaceutical composition comprising an RET kinase inhibiting substance for administering to an organism comprising a cell expressing mutant RET, wherein said RET kinase inhibiting substance is at least one compound selected from the group consisting of:

5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrrole-3-carboxylic acid(2-diethylaminoethyl)amide;

N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N′-(5-methyl-3-isoxazolyl)urea; and

4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)propoxy]quinazoline,

a pharmacologically acceptable salt thereof or a solvate thereof.

58. The pharmaceutical composition according to claim 41, wherein the mutant RET comprises a mutation site where at least one amino acid selected from the group consisting of amino acids at codons 321, 533, 609, 611, 618, 620, 630, 631, 634, 691, 768, 790, 791, 804, 806, 844, 883, 891 and 918 in the amino acid sequence represented by SEQ ID NO: 2 or 4 is substituted with other amino acid.

59. The pharmaceutical composition according to claim 41, wherein the mutant RET is a polypeptide encoded by RET gene rearranged with at least one gene selected from the group consisting of H4 gene, RIα gene, ELE1 gene, RFG5 gene, hTIF gene, RFG7 gene, ELKS gene, kinectin gene, PCM-1 gene and RFP gene.

60. The pharmaceutical composition according to claim 41, wherein the organism is a patient suffering from at least one disease selected from the group consisting of multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract.

61. A method for treating at least one disease selected from the group consisting of multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract, the method comprising the step of administering an effective amount of an RET kinase inhibiting substance to a patient, wherein said RET kinase inhibiting substance is a compound represented by General Formula (I)

wherein, R1 represents a group represented by Formula —V1—V2—V3 (wherein, V1 represents C1-6 alkylene group that may have a substituent; V2 represents a single bond, an oxygen atom, a sulfur atom, carbonyl group, sulfinyl group, sulfonyl group, group represented by Formula —CONR6—, group represented by Formula —SO2NR6—, group represented by Formula —NR6SO2—, group represented by Formula —NR6CO— or group represented by Formula —NR6— (wherein, R6 represents a hydrogen atom, C1-6 alkyl group that may have a substituent or C3-8 cycloalkyl group that may have a substituent); V3 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent);

R2 represents cyano group, C1-6 alkoxy group that may have a substituent, carboxyl group, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVa11Va12 (wherein, Va11 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent; Va12 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent, 3-10-membered non-aromatic heterocyclic group that may have a substituent, hydroxyl group, C1-6 alkoxy group that may have a substituent or C3-8 cycloalkoxy group that may have a substituent);

Y1 represents a group represented by Formula

(wherein, R7 and R8 each independently represent a hydrogen atom, a halogen atom, cyano group, nitro group, amino group, C1-6 alkyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C1-6 alkoxy group that may have a substituent, C1-6 alkylthio group that may have a substituent, formyl group, C2-7 acyl group that may have a substituent, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVd1Vd2 (wherein, Vd1 and Vd2 each independently represent a hydrogen atom or C1-6 alkyl group that may have a substituent);

W1 and W2 each independently represent a carbon atom or a nitrogen atom that may have a substituent);

R3 and R4 each independently represent a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C2-7 acyl group that may have a substituent or C2-7 alkoxycarbonyl group that may have a substituent; and

R5 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent,

a pharmacologically acceptable salt thereof or a solvate thereof.

62. A method for treating at least one disease selected from the group consisting of multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract, the method comprising the step of administering an effective amount of an RET kinase inhibiting substance to a patient, wherein said RET kinase inhibiting substance is at least one compound selected from the group consisting of:

5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrrole-3-carboxylic acid(2-diethylaminoethyl)amide;

N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N′-(5-methyl-3-isoxazolyl)urea; and

4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)propoxy]quinazoline,

a pharmacologically acceptable salt thereof or a solvate thereof.

63. A method for treating thyroid carcinoma, comprising the step of administering an effective amount of an RET kinase inhibiting substance to a patient, wherein said RET kinase inhibiting substance is a compound represented by General Formula (I)

wherein, R1 represents a group represented by Formula —V1—V2—V3 (wherein, V1 represents C1-6 alkylene group that may have a substituent; V2 represents a single bond, an oxygen atom, a sulfur atom, carbonyl group, sulfinyl group, sulfonyl group, group represented by Formula —CONR6—, group represented by Formula —SO2NR6—, group represented by Formula —NR6SO2—, group represented by Formula —NR6CO— or group represented by Formula —NR6— (wherein, R6 represents a hydrogen atom, C1-6 alkyl group that may have a substituent or C3-8 cycloalkyl group that may have a substituent); V3 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent);

R2 represents cyano group, C1-6 alkoxy group that may have a substituent, carboxyl group, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVa11Va12 (wherein, Va11 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent; Va12 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent, 3-10-membered non-aromatic heterocyclic group that may have a substituent, hydroxyl group, C1-6 alkoxy group that may have a substituent or C3-8 cycloalkoxy group that may have a substituent);

Y1 represents a group represented by Formula

(wherein, R7 and R8 each independently represent a hydrogen atom, a halogen atom, cyano group, nitro group, amino group, C1-6 alkyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C1-6 alkoxy group that may have a substituent, C1-6 alkylthio group that may have a substituent, formyl group, C2-7 acyl group that may have a substituent, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVd1Vd2 (wherein, Vd1 and Vd2 each independently represent a hydrogen atom or C1-6 alkyl group that may have a substituent);

W1 and W2 each independently represent a carbon atom or a nitrogen atom that may have a substituent);

R3 and R4 each independently represent a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C2-7 acyl group that may have a substituent or C2-7 alkoxycarbonyl group that may have a substituent; and

R5 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent,

a pharmacologically acceptable salt thereof or a solvate thereof.

64. A method for treating thyroid carcinoma, comprising the step of administering an effective amount of an RET kinase inhibiting substance to a patient, wherein said RET kinase inhibiting substance is at least one compound selected from the group consisting of:

5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrrole-3-carboxylic acid(2-diethylaminoethyl)amide;

N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N′-(5-methyl-3-isoxazolyl)urea; and

4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)propoxy]quinazoline,

a pharmacologically acceptable salt thereof or a solvate thereof.

65. A method for treating a disease, comprising the step of administering an effective amount of an RET kinase inhibiting substance to an organism comprising a cell expressing mutant RET, wherein said RET kinase inhibiting substance is a compound represented by General Formula (I)

wherein, R1 represents a group represented by Formula —V1—V2—V3 (wherein, V1 represents C1-6 alkylene group that may have a substituent; V2 represents a single bond, an oxygen atom, a sulfur atom, carbonyl group, sulfinyl group, sulfonyl group, group represented by Formula —CONR6—, group represented by Formula —SO2NR6—, group represented by Formula —NR6SO2—, group represented by Formula —NR6CO— or group represented by Formula —NR6— (wherein, R6 represents a hydrogen atom, C1-6 alkyl group that may have a substituent or C3-8 cycloalkyl group that may have a substituent); V3 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent);

R2 represents cyano group, C1-6 alkoxy group that may have a substituent, carboxyl group, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVa11Va12 (wherein, Va11 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent; Va12 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent, 3-10-membered non-aromatic heterocyclic group that may have a substituent, hydroxyl group, C1-6 alkoxy group that may have a substituent or C3-8 cycloalkoxy group that may have a substituent);

Y1 represents a group represented by Formula

(wherein, R7 and R8 each independently represent a hydrogen atom, a halogen atom, cyano group, nitro group, amino group, C1-6 alkyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C1-6 alkoxy group that may have a substituent, C1-6 alkylthio group that may have a substituent, formyl group, C2-7 acyl group that may have a substituent, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVd1Vd2 (wherein, Vd1 and Vd2 each independently represent a hydrogen atom or C1-6 alkyl group that may have a substituent);

W1 and W2 each independently represent a carbon atom or a nitrogen atom that may have a substituent);

R3 and R4 each independently represent a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C2-7 acyl group that may have a substituent or C2-7 alkoxycarbonyl group that may have a substituent; and

R5 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent,

a pharmacologically acceptable salt thereof or a solvate thereof.

66. A method for treating a disease, comprising the step of administering an effective amount of an RET kinase inhibiting substance to an organism comprising a cell expressing mutant RET, wherein said RET kinase inhibiting substance is at least one compound selected from the group consisting of:

5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrrole-3-carboxylic acid(2-diethylaminoethyl)amide;

N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N′-(5-methyl-3-isoxazolyl)urea; and

4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)propoxy]quinazoline,

a pharmacologically acceptable salt thereof or a solvate thereof.

67-72. (canceled)

73. An RET kinase inhibiting substance for a therapeutic agent for treating at least one disease selected from the group consisting of multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract, wherein said RET kinase inhibiting substance is a compound represented by General Formula (I)

wherein, R1 represents a group represented by Formula —V1—V2—V3 (wherein, V1 represents C1-6 alkylene group that may have a substituent; V2 represents a single bond, an oxygen atom, a sulfur atom, carbonyl group, sulfinyl group, sulfonyl group, group represented by Formula —CONR6—, group represented by Formula —SO2NR6—, group represented by Formula —NR6SO2—, group represented by Formula —NR6CO— or group represented by Formula —NR6— (wherein, R6 represents a hydrogen atom, C1-6 alkyl group that may have a substituent or C3-8 cycloalkyl group that may have a substituent); V3 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent);

R2 represents cyano group, C1-6 alkoxy group that may have a substituent, carboxyl group, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVa11Va12 (wherein, Va11 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent; Va12 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent, 3-10-membered non-aromatic heterocyclic group that may have a substituent, hydroxyl group, C1-6 alkoxy group that may have a substituent or C3-8 cycloalkoxy group that may have a substituent);

Y1 represents a group represented by Formula

(wherein, R7 and R8 each independently represent a hydrogen atom, a halogen atom, cyano group, nitro group, amino group, C1-6 alkyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C1-6 alkoxy group that may have a substituent, C1-6 alkylthio group that may have a substituent, formyl group, C2-7 acyl group that may have a substituent, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVd1Vd2 (wherein, Vd1 and Vd2 each independently represent a hydrogen atom or C1-6 alkyl group that may have a substituent);

W1 and W2 each independently represent a carbon atom or a nitrogen atom that may have a substituent);

R3 and R4 each independently represent a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C2-7 acyl group that may have a substituent or C2-7 alkoxycarbonyl group that may have a substituent; and

R5 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent,

a pharmacologically acceptable salt thereof or a solvate thereof.

74. An RET kinase inhibiting substance for a therapeutic agent for treating at least one disease selected from the group consisting of multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract, wherein said RET kinase inhibiting substance is at least one compound selected from the group consisting of:

5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrrole-3-carboxylic acid(2-diethylaminoethyl)amide;

N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N′-(5-methyl-3-isoxazolyl)urea; and

4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)propoxy]quinazoline,

a pharmacologically acceptable salt thereof or a solvate thereof.

75. An RET kinase inhibiting substance for a therapeutic agent for treating thyroid carcinoma, wherein said RET kinase inhibiting substance is a compound represented by General Formula (I)

wherein, R1 represents a group represented by Formula —V1—V2—V3 (wherein, V1 represents C1-6 alkylene group that may have a substituent; V2 represents a single bond, an oxygen atom, a sulfur atom, carbonyl group, sulfinyl group, sulfonyl group, group represented by Formula —CONR6—, group represented by Formula —SO2NR6—, group represented by Formula —NR6SO2—, group represented by Formula —NR6CO— or group represented by Formula —NR6— (wherein, R6 represents a hydrogen atom, C1-6 alkyl group that may have a substituent or C3-8 cycloalkyl group that may have a substituent); V3 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent);

R2 represents cyano group, C1-6 alkoxy group that may have a substituent, carboxyl group, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVa11Va12 (wherein, Va11 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent; Va12 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent, 3-10-membered non-aromatic heterocyclic group that may have a substituent, hydroxyl group, C1-6 alkoxy group that may have a substituent or C3-8 cycloalkoxy group that may have a substituent);

Y1 represents a group represented by Formula

(wherein, R7 and R8 each independently represent a hydrogen atom, a halogen atom, cyano group, nitro group, amino group, C1-6 alkyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C1-6 alkoxy group that may have a substituent, C1-6 alkylthio group that may have a substituent, formyl group, C2-7 acyl group that may have a substituent, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVd1Vd2 (wherein, Vd1 and Vd2 each independently represent a hydrogen atom or C1-6 alkyl group that may have a substituent);

W1 and W2 each independently represent a carbon atom or a nitrogen atom that may have a substituent);

R3 and R4 each independently represent a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C2-7 acyl group that may have a substituent or C2-7 alkoxycarbonyl group that may have a substituent; and

R5 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent,

a pharmacologically acceptable salt thereof or a solvate thereof.

76. An RET kinase inhibiting substance for a therapeutic agent for treating thyroid carcinoma, wherein said RET kinase inhibiting substance is at least one compound selected from the group consisting of:

5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrrole-3-carboxylic acid(2-diethylaminoethyl)amide;

N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N′-(5-methyl-3-isoxazolyl)urea; and

4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)propoxy]quinazoline,

a pharmacologically acceptable salt thereof or a solvate thereof.

77. An RET kinase inhibiting substance for a pharmaceutical composition comprising the RET kinase inhibiting substance for administering to an organism comprising a cell expressing mutant RET, wherein said RET kinase inhibiting substance is a compound represented by General Formula (I)

wherein, R1 represents a group represented by Formula —V1—V2—V3 (wherein, V1 represents C1-6 alkylene group that may have a substituent; V2 represents a single bond, an oxygen atom, a sulfur atom, carbonyl group, sulfinyl group, sulfonyl group, group represented by Formula —CONR6—, group represented by Formula —SO2NR6—, group represented by Formula —NR6SO2—, group represented by Formula —NR6CO— or group represented by Formula —NR6— (wherein, R6 represents a hydrogen atom, C1-6 alkyl group that may have a substituent or C3-8 cycloalkyl group that may have a substituent); V3 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent);

R2 represents cyano group, C1-6 alkoxy group that may have a substituent, carboxyl group, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVa11Va12 (wherein, Va11 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent; Va12 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent, 3-10-membered non-aromatic heterocyclic group that may have a substituent, hydroxyl group, C1-6 alkoxy group that may have a substituent or C3-8 cycloalkoxy group that may have a substituent);

Y1 represents a group represented by Formula

(wherein, R7 and R8 each independently represent a hydrogen atom, a halogen atom, cyano group, nitro group, amino group, C1-6 alkyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C1-6 alkoxy group that may have a substituent, C1-6 alkylthio group that may have a substituent, formyl group, C2-7 acyl group that may have a substituent, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVd1Vd2 (wherein, Vd1 and Vd2 each independently represent a hydrogen atom or C1-6 alkyl group that may have a substituent);

W1 and W2 each independently represent a carbon atom or a nitrogen atom that may have a substituent);

R3 and R4 each independently represent a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C2-7 acyl group that may have a substituent or C2-7 alkoxycarbonyl group that may have a substituent; and

R5 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent,

a pharmacologically acceptable salt thereof or a solvate thereof.

78. An RET kinase inhibiting substance for a pharmaceutical composition comprising the RET kinase inhibiting substance for administering to an organism comprising a cell expressing mutant RET, wherein said RET kinase inhibiting substance is at least one compound selected from the group consisting of:

5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrrole-3-carboxylic acid(2-diethylaminoethyl)amide;

N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N′-(5-methyl-3-isoxazolyl)urea; and

4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)propoxy]quinazoline,

a pharmacologically acceptable salt thereof or a solvate thereof.

79. An RET kinase inhibitor comprising a compound represented by General Formula (I)

wherein, R1 represents a group represented by Formula —V1—V2—V3 (wherein, V1 represents C1-6 alkylene group that may have a substituent; V2 represents a single bond, an oxygen atom, a sulfur atom, carbonyl group, sulfinyl group, sulfonyl group, group represented by Formula —CONR6—, group represented by Formula —SO2NR6—, group represented by Formula —NR6SO2—, group represented by Formula —NR6CO— or group represented by Formula —NR6— (wherein, R6 represents a hydrogen atom, C1-6 alkyl group that may have a substituent or C3-8 cycloalkyl group that may have a substituent); V3 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent);

R2 represents cyano group, C1-6 alkoxy group that may have a substituent, carboxyl group, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVa11Va12 (wherein, Va11 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent; Va12 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent, 3-10-membered non-aromatic heterocyclic group that may have a substituent, hydroxyl group, C1-6 alkoxy group that may have a substituent or C3-8 cycloalkoxy group that may have a substituent);

Y1 represents a group represented by Formula

(wherein, R7 and R8 each independently represent a hydrogen atom, a halogen atom, cyano group, nitro group, amino group, C1-6 alkyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C1-6 alkoxy group that may have a substituent, C1-6 alkylthio group that may have a substituent, formyl group, C2-7 acyl group that may have a substituent, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVd1Vd2 (wherein, Vd1 and Vd2 each independently represent a hydrogen atom or C1-6 alkyl group that may have a substituent);

W1 and W2 each independently represent a carbon atom or a nitrogen atom that may have a substituent);

R3 and R4 each independently represent a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C2-7 acyl group that may have a substituent or C2-7 alkoxycarbonyl group that may have a substituent; and

R5 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent,

a pharmacologically acceptable salt thereof or a solvate thereof.

80. An RET kinase inhibitor comprising at least one compound selected from the group consisting of:

5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrrole-3-carboxylic acid(2-diethylaminoethyl)amide;

N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N′-(5-methyl-3-isoxazolyl)urea; and

4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)propoxy]quinazoline,

a pharmacologically acceptable salt thereof or a solvate thereof.

81. A method for predicting whether a patient is highly sensitive to an RET kinase inhibiting substance, comprising the step of using the presence or the absence of RET mutation in the cell as an indication, wherein said RET kinase inhibiting substance is a compound represented by General Formula (I)

wherein, R1 represents a group represented by Formula —V1—V2—V3 (wherein, V1 represents C1-6 alkylene group that may have a substituent; V2 represents a single bond, an oxygen atom, a sulfur atom, carbonyl group, sulfinyl group, sulfonyl group, group represented by Formula —CONR6—, group represented by Formula —SO2NR6—, group represented by Formula —NR6SO2—, group represented by Formula —NR6CO— or group represented by Formula —NR6— (wherein, R6 represents a hydrogen atom, C1-6 alkyl group that may have a substituent or C3-8 cycloalkyl group that may have a substituent); V3 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent);

R2 represents cyano group, C1-6 alkoxy group that may have a substituent, carboxyl group, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVa11Va12 (wherein, Va11 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent; Va12 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent, 3-10-membered non-aromatic heterocyclic group that may have a substituent, hydroxyl group, C1-6 alkoxy group that may have a substituent or C3-8 cycloalkoxy group that may have a substituent);

Y1 represents a group represented by Formula

(wherein, R7 and R8 each independently represent a hydrogen atom, a halogen atom, cyano group, nitro group, amino group, C1-6 alkyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C1-6 alkoxy group that may have a substituent, C1-6 alkylthio group that may have a substituent, formyl group, C2-7 acyl group that may have a substituent, C2-7 alkoxycarbonyl group that may have a substituent or group represented by Formula —CONVd1Vd2 (wherein, Vd1 and Vd2 each independently represent a hydrogen atom or C1-6 alkyl group that may have a substituent);

W1 and W2 each independently represent a carbon atom or a nitrogen atom that may have a substituent);

R3 and R4 each independently represent a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C2-7 acyl group that may have a substituent or C2-7 alkoxycarbonyl group that may have a substituent; and

R5 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent,

a pharmacologically acceptable salt thereof or a solvate thereof.

82. The method according to claim 81, wherein R1 is C1-6 alkyl group (where, R1 may have at least one substituent selected from the group consisting of 3-10-membered non-aromatic heterocyclic group that may have C1-6 alkyl group, hydroxyl group, C1-6 alkoxy group, amino group, mono-C1-6 alkylamino group and di-C1-6 alkylamino group).

83. The method according to claim 81, wherein R1 is methyl group or group represented by any one of the following Formulae

(wherein, Ra3 represents methyl group; Ra1 represents a hydrogen atom or hydroxyl group; Ra2 represents methoxy group, ethoxy group, 1-pyrrolidinyl group, 1-piperidinyl group, 4-morpholinyl group, dimethylamino group or diethylamino group).

84. The method according to claim 81, wherein R1 is methyl group or 2-methoxyethyl group.

85. The method according to claim 81, wherein R2 represents cyano group or group represented by Formula —CONVa11Va12 (wherein, Va11 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent or 3-10-membered non-aromatic heterocyclic group that may have a substituent; Va12 represents a hydrogen atom, C1-6 alkyl group that may have a substituent, C2-6 alkenyl group that may have a substituent, C2-6 alkynyl group that may have a substituent, C3-8 cycloalkyl group that may have a substituent, C6-10 aryl group that may have a substituent, 5-10-membered heteroaryl group that may have a substituent, 3-10-membered non-aromatic heterocyclic group that may have a substituent, hydroxyl group, C1-6 alkoxy group that may have a substituent or C3-8 cycloalkoxy group that may have a substituent).

86. The method according to claim 81, wherein R2 is cyano group or group represented by Formula —CONHVa16 (wherein, Va16 represents a hydrogen atom, C1-6 alkyl group, C3-8 cycloalkyl group, C1-6 alkoxy group or C3-8 cycloalkoxy group, where Va16 may have at least one substituent selected from the group consisting of a halogen atom, cyano group, hydroxyl group and C1-6 alkoxy group).

87. The method according to claim 81, wherein R2 is a group represented by Formula —CONHVa17 (wherein, Va17 represents a hydrogen atom, C1-6 alkyl group or C1-6 alkoxy group).

88. The method according to claim 81, wherein R2 is a group represented by Formula —CONHVa18 (wherein, Va18 represents a hydrogen atom, methyl group or methoxy group).

89. The method according to claim 81, wherein Y1 is a group represented by Formula

(wherein, R71 represents a hydrogen atom or a halogen atom).

90. The method according to claim 81, wherein R3 and R4 is a hydrogen atom.

91. The method according to claim 81, wherein R5 is a hydrogen atom, C1-6 alkyl group, C3-8 cycloalkyl group or C6-10 aryl group (where, R5 may have at least one substituent selected from the group consisting of a halogen atom and methanesulfonyl group).

92. The method according to claim 81, wherein R5 is methyl group, ethyl group or cyclopropyl group.

93. The method according to claim 81, wherein the RET kinase inhibiting substance is at least one compound selected from the group consisting of:

N-(4-(6-cyano-7-(2-methoxyethoxy)-4-quinolyl)oxy-2-fluorophenyl)-N′-(4-fluorophenyl)urea;

N-(2-chloro-4-((6-cyano-7-((1-methyl-4-piperidyl)methoxy)-4-quinolyl)oxy)phenyl)-N′-cyclopropylurea;

N-(4-((6-cyano-7-(((2R)-3-(diethylamino)-2-hydroxypropyl)oxy)-4-quinolyl)oxy)phenyl)-N′-(4-fluorophenyl)urea;

N-(4-((6-cyano-7-(((2R)-2-hydroxy-3-(1-pyrrolidino)propyl)oxy)-4-quinolyl)oxy)phenyl)-N′-(4-fluorophenyl)urea;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-methoxyethoxy)-6-quinolinecarboxamide;

N6-cyclopropyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-(2-methoxyethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-(2-fluoroethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-methoxy-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-ethyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-fluoro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-methoxyethoxy)-6-quinolinecarboxamide;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-hydroxyethoxy)-6-quinolinecarboxamide;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-((2S)-2,3-dihydroxypropyl)oxy-6-quinolinecarboxamide;

4-(3-chloro-4-(methylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-methoxy-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-ethoxyethoxy)-6-quinolinecarboxamide;

4-(4-((cyclopropylamino)carbonyl)aminophenoxy)-7-(2-methoxyethoxy)-6-quinolinecarboxamide;

N-(2-fluoro-4-((6-carbamoyl-7-methoxy-4-quinolyl)oxy)phenyl)-N′-cyclopropylurea;

N6-(2-hydroxyethyl)-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(1-propylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(cis-2-fluoro-cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-(2-methoxyethoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-(2-(4-morpholino) ethoxy)-6-quinolinecarboxamide;

4-(3-chloro-4-(2-fluoroethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-((2R)tetrahydro-2-furanylmethyl)-4-(3-chloro-4-(((methylamino)carbonyl)amino) phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-fluoro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-((2R)-2-hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((2R)-3-diethylamino-2-hydroxypropoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((2R)-3-diethylamino-2-hydroxypropoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((2R)-2-hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((2R)-2-hydroxy-3-(1-pyrrolidino)propoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-((1-methyl-4-piperidyl)methoxy)-6-quinolinecarboxamide;

N6-methyl-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-((1-methyl-4-piperidyl)methoxy)-6-quinolinecarboxamide;

N-(4-(6-cyano-7-(2-methoxyethoxy)-4-quinolyl)oxy-2-fluorophenyl)-N′-cyclopropylurea;

N-(4-(6-cyano-7-(3-(4-morpholino)propoxy)-4-quinolyl)oxyphenyl)-N′-(3-(methylsulfonyl)phenyl)urea;

4-(4-((cyclopropylamino)carbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-fluoro-4-((2-fluoroethylamino)carbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-(2-ethoxyethyl)-4-(3-chloro-4-(((methylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(4-(3-ethylureido)-3-fluoro-phenoxy)-7-methoxyquinoline-6-carboxylic acid (2-cyanoethyl)amide; and

N-(4-(6-(2-cyanoethyl)carbamoyl-7-methoxy-4-quinolyl)oxy-2-fluorophenyl)-N′-cyclopropylurea,

a pharmacologically acceptable salt thereof or a solvate thereof.

94. The method according to claim 81, wherein the RET kinase inhibiting substance is at least one compound selected from the group consisting of:

4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(ethylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide;

N6-methoxy-4-(3-chloro-4-(((cyclopropylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide;

4-(3-chloro-4-(methylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide; and

N6-methoxy-4-(3-chloro-4-(((ethylamino)carbonyl)amino)phenoxy)-7-methoxy-6-quinolinecarboxamide,

a pharmacologically acceptable salt thereof or a solvate thereof.

95. The method according to claim 81, wherein the RET kinase inhibiting substance is 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide, a pharmacologically acceptable salt thereof or a solvate thereof.

96. The method according to claim 81, wherein the RET kinase inhibiting substance is methanesulfonate of 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide.

97. A method for predicting whether a patient is highly sensitive to an RET kinase inhibiting substance, comprising the step of using the presence or the absence of RET mutation in the cell as an indication, wherein said RET kinase inhibiting substance is at least one compound selected from the group consisting of:

5-(5-fluoro-2-oxo-1,2-dihydroindole-3-ylidenemethyl)-2,4-dimethyl-1H-pyrrole-3-carboxylic acid(2-diethylaminoethyl)amide;

N-{2-chloro-4-[(6,7-dimethoxy-4-quinolyl)oxy]phenyl}-N′-(5-methyl-3-isoxazolyl)urea; and

4-[(4-fluoro-2-methylindole-5-yl)oxy]-6-methoxy-7-[3-(pyrrolidine-1-yl)propoxy]quinazoline,

a pharmacologically acceptable salt thereof or a solvate thereof.

98. The method according to claim 81, wherein the RET mutation is substitution of at least one amino acid selected from the group consisting of amino acids at codons 321, 533, 609, 611, 618, 620, 630, 631, 634, 691, 768, 790, 791, 804, 806, 844, 883, 891 and 918 in the amino acid sequence represented by SEQ ID NO: 2 or 4 with other amino acid.

99. The method according to claim 81, wherein the RET mutation owes to rearrangement of RET gene and at least one gene selected from the group consisting of H4 gene, RIα gene, ELE1 gene, RFG5 gene, hTIF gene, RFG7 gene, ELKS gene, kinectin gene, PCM-1 gene and RFP gene.

100. The method according to claim 81, wherein the patient is suffering from at least one disease selected from the group consisting of multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract.

101. The method according to claim 81, wherein the prediction comprises the steps of:

determining the presence or the absence of RET mutation in the cell; and

predicting that the patient is highly sensitive to the RET kinase inhibiting substance when mutant RET is expressed in the cell.

102. The method according to claim 101, wherein the determination of the presence or the absence of RET mutation in the cell is carried out by dideoxynucleotide chain termination technique.

103. The method according to claim 101, wherein the determination of the presence or the absence of RET mutation in the cell is carried out by RT-PCR.

104. The method according to claim 101, wherein the determination of the presence or the absence of RET mutation in the cell is carried out by immunochemical technique.

105. The method according to claim 97, wherein the RET mutation is substitution of at least one amino acid selected from the group consisting of amino acids at codons 321, 533, 609, 611, 618, 620, 630, 631, 634, 691, 768, 790, 791, 804, 806, 844, 883, 891 and 918 in the amino acid sequence represented by SEQ ID NO: 2 or 4 with other amino acid.

106. The method according to claim 97, wherein the RET mutation owes to rearrangement of RET gene and at least one gene selected from the group consisting of H4 gene, RIα gene, ELE1 gene, RFG5 gene, hTIF gene, RFG7 gene, ELKS gene, kinectin gene, PCM-1 gene and RFP gene.

107. The method according to claim 97, wherein the patient is suffering from at least one disease selected from the group consisting of multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, familial medullary thyroid carcinoma, thyroid carcinoma, papillary thyroid carcinoma, sporadic medullary thyroid carcinoma, Hirschsprung disease, pheochromocytoma, parathyroid hyperplasia and mucosal neuromas of the gastrointestinal tract.

108. The method according to claim 97, wherein the prediction comprises the steps of:

determining the presence or the absence of RET mutation in the cell; and

predicting that the patient is highly sensitive to the RET kinase inhibiting substance when mutant RET is expressed in the cell.

109. The method according to claim 108, wherein the determination of the presence or the absence of RET mutation in the cell is carried out by dideoxynucleotide chain termination technique.

110. The method according to claim 108, wherein the determination of the presence or the absence of RET mutation in the cell is carried out by RT-PCR.

111. The method according to claim 108, wherein the determination of the presence or the absence of RET mutation in the cell is carried out by immunochemical technique.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: