US20090232824A1
2009-09-17
12/423,855
2009-04-15
The subject invention provides polynucleotide sequences, designated BIVM, and transcriptional/translational products obtained from the polynucleotide sequences of the invention. The subject invention also provides polynucleotide and polypeptide sequences provided by SEQ ID NOs: 1-28. Also provided are methods of detecting the presence of BIVM nucleic acids or polypeptides in samples suspected of containing BIVM genes, BIVM transcriptional products, or BIVM translational products. These methods are also useful for the detection of BIVM orthologs. Other embodiments provide polypeptide and/or nucleic acid vaccines for the induction of an immune response to in an individual. Kits for detecting the presence of BIVM genes, orthologs thereof, BIVM polypeptides, or BIVM transcriptional products are also provided.
Get notified when new applications in this technology area are published.
C07K14/70503 » CPC main
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans; Receptors; Cell surface antigens; Cell surface determinants Immunoglobulin superfamily
A61K39/395 IPC
Medicinal preparations containing antigens or antibodies Antibodies ; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
A61K39/00 IPC
Medicinal preparations containing antigens or antibodies
C07K14/00 IPC
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
C07K16/00 IPC
Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
The application is a continuation of U.S. application Ser. No. 11/415,536, filed May 2, 2006, now allowed, which is a divisional of U.S. application Ser. No. 10/417,476, filed Apr. 16, 2003, now U.S. Pat. No. 7,038,030, which claims priority to U.S. Provisional Application Ser. No. 60/373,146, filed Apr. 16, 2002, the disclosures of which are hereby incorporated by reference in their entireties, including all figures, nucleic acid sequences, amino acid sequences, and tables.
The subject invention was made with government support under a research project supported by the National Institutes of Health Grant No. AI23338. The government has certain rights in this invention.
The Sequence Listing for this application is labeled “Seq-List.txt, was created on Apr. 14, 2009, and is 251 KB. The entire contents of the sequence listing is incorporated herein by reference in its entirety.
Considerable uncertainty remains with regards to the total number of human genes. Initial interpretations of genomic sequences resulted in estimates that placed the numbers of genes in man in the range of 30,000 to 40,000 (Lander, E. S., et al. [2001] “Initial Sequencing and Analysis of the Human Genome,” Nature, 409:860-921; Ventner, J. C., et al. [2001] “The Sequence of the Human Genome,” Science, 291:1304-51). Subsequent re-examination of the sequence data suggests the number of genes in the human genome is likely to be between 65,000 and 75,000 (Wright, F. A., et al. [2001] “A Draft Annotation and Overview of the Human Genome,” Genome Biology 2:1.1-1.39). Predictions of 35,000 to 120,000 genes have been projected on the basis of EST sequences (Ewing, B., et al. [2000] “Analysis of Expressed Sequence Tags Indicates 35,000 Human Genes,” Nature Genet. 25:232-234; Liang, F., et al. [2000], “Gene Index Analysis of the Human Genome Estimates Approximately 120,000 Genes,” Nature Genet. 25:239-240). New genes continue to be recognized through inspection of genomic sequences as well as through a variety of different biochemical, immunological and other directed approaches.
The immunoglobulin superfamily (IgSF) represents a particularly large and extensively diversified family of genes (Barclay, A. N., et al. [1997] The Leucocyte Antigen FactsBook, Academic Press, San Diego). Each IgSF member encodes at least one Ig that consists of ˜100 amino acid residues that are arranged in two β sheets, which are comprised of anti-parallel β strands that are linked by an intrachain disulfide. Although the majority of genes in the IgSF function in the immune response, other IgSF genes are involved with cell-adhesion or growth factor recognition. IgSF domains are the most abundant domain type found in leukocyte membrane proteins.
In the course of an electronic EST database search for novel human genes encoding Ig domains, we identified an anonymous EST (IMAGE 785450; GenBank AA449273) (Hawke, N. A., et al. [1999] “Expanding Our Understanding of Immunoglobulin, T-cell Antigen Receptor, and Novel Immune-Type Receptor Genes: a Subset of the Immunoglobulin Gene Superfamily,” Immunogenetics 50:124-133) and cloned the corresponding full-length cDNA. The predicted structure of the protein encoded by this gene, which is termed BIVM (basic, immunoglobulin-like variable motif-containing), includes short peptide motifs characteristic of an Ig variable (V) region, one of the subtypes of Ig domains. However, it lacks significant sequence identity to any group of proteins heretofore described.
We have determined the sequence of BIVM cDNA in species representative of critical points in phylogeny, examined the intracellular distribution of a recombinant form of BIVM, characterized its expression patterns in various tissues at different times in development, and defined other features of the gene that further emphasize its unique character. In addition, we have identified a BIVM-like gene in the protozoan parasite, Giardia lamblia.
The subject invention provides polynucleotide sequences, designated BIVM, and transcriptional/translational products obtained from the polynucleotide sequences of the invention (SEQ ID Nos:1-28). The subject invention also provides methods of detecting the presence of BIVM nucleic acids, transcriptional products, or polypeptides in samples suspected of containing BIVM genes. These methods are also useful for the detection of BIVM orthologs. Other embodiments provide polypeptide and/or nucleic acid vaccines for the induction of an immune response. Kits for detecting the presence of BIVM genes, orthologs thereof, BIVM polypeptides, or BIVM transcriptional products obtained from the polynucleotide sequences are also provided.
The file of this patent contains at least one drawing executed in color. Copies of this patent with color drawings will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.
Table I. Exon-intron organization of human BIVM. Three alternative splice donors in the 5′ untranslated region are designated A1, A2, and A3. Nucleotide positions are relative to FIG. 1, intron length and splice donor/acceptor sequences are shown. Coding sequence is in upper case.
FIGS. 1A-1C. Human BIVM. The nucleotide sequence (SEQ ID NO: 1) and predicted amino acid translation product (SEQ ID NO: 2) of a human BIVM transcript. Translational start and stop codons are in reverse text. RNA splice junctions are underlined (see Table I). Nucleotides at 5′ ends, defined by analyses of RACE products, are boxed. Nucleotide numbering is on the right; amino acid numbering is on the left. The M1(GX6C), M2 (WFRQ), M3a and M3b (YFC and YHC) motifs are shaded. The Alu sequence in the 3′ untranslated region is in lower case.
FIG. 2. Predicted genomic organization of human BIVM. BIVM consists of nine coding exons (exons 1-9) and two 5′ untranslated region exons (A and B). Alternative splice donor sites are present within exon A (see Table I); transcripts have been identified that include exon A, but not exon B. The CpG island is denoted by a solid bar, the Alu sequence is denoted by a hatched bar, and the location of the sequence-tagged site (STS) marker, WI-5740, is indicated (see also FIG. 1A).
FIGS. 3A-3B. BIVM is well conserved among deuterostomes. ClustalW alignment of the human BIVM peptide sequence (BIVM.Hs; (SEQ ID NO: 2)) with orthologous sequences from mouse (BIVM.Mm; (SEQ ID NO: 27)), chicken (BIVM.Gg; (SEQ ID NO: 8)), Xenopus (XBIVM; (SEQ ID NO: 5)), zebrafish (BIVM.Dr; (SEQ ID NO: 11)), and sea urchin (SpBIVM; (SEQ ID NO: 13)). The sea urchin sequence lacks a stop codon and therefore is predicted to encode a longer polypeptide (indicated by . . . ). The M1, M2, M3a and M3b motifs are indicated. The highly conserved domain within BIVM is indicated with arrowheads. Identical residues are shown in reverse text (black), similarities are shaded (gray). Gaps introduced to maintain/maximize alignment are indicated with (−).
FIG. 4. Syntenic relationship between the human BIVM region and the mouse genome. The relative locations of human BIVM and flanking genes on chromosome 13q32-33; known corresponding chromosomal map positions are indicated for mouse. Transcription direction is indicated with arrows. Approximate distances between genes (if known) are indicated.
FIGS. 5A-5F. Expression of BIVM. RNA blots of BIVM expression from (A) human tissues and cell lines, (B) mouse embryos and somatic tissues, (C) Xenopus embryos and kidney, and (D) sea urchin embryos. Approximately 2 μg of polyA+ RNA/track was analyzed in human and mouse; ˜10 μg of total RNA/track was analyzed in Xenopus and sea urchin. Actin is used as a loading control with human and mouse blots; 18S ribosomal RNA is used as a loading control with Xenopus and sea urchin blots. Real time PCR analysis of BIVM expression in (E), developing zebrafish embryos and adult tissues, and in (F) chicken bursa at various stages of embryonic development. The quantity of BIVM (designated on the left) is relative and normalized (see Methods). Note that the level of zebrafish BIVM expression in the 0 hpf embryo is approximately 10 times the level detected at 6 hpf. Time points in the analysis of bursa are days of embryonic life (e.g. E12) and chicken embryonic fibroblasts (CEFs) were included as a control. Days post coitus=dpc, stage=st., hour post fertilization=hpf, days post fertilization=dpf and intestine=intest.
FIGS. 6A-6J. BIVM localizes to the nucleus and the cytoplasm. (A) Western analysis of whole cell lysates from pIRES2-EGFP (EGFP), pBIVM-N2/EGFP (N2/EGFP) and pBIVM-K1/EGFP (K1/EGFP) transfected Cos-7 cells. Recombinant BIVM is detected with an anti-V5 antibody. EGFP is shown as a transfection and loading control. Note that only a single protein corresponding to the 5′ ATG is generated from the endogenous transcript (pBIVM-N2); protein synthesis is increased by modification of the translational start site (pBIVMK1). Size standards are indicated. (B) Western analysis of nuclear and cytoplasmic fractions from pBIVM-K1/EGFP transfected Cos-7 cells. OCT-1 (Pombo, A., et al. [1998] “Regional and Temporal Specialization in the Nucleus: A Transcriptionally-Active Nuclear Domain Rich in PTF, Oct1 and PIKA Antigens Associated with Specific Chromosomes Early in the Cell Cycle,” EMBO J. 1768) and HSP90 (Perdew, G. H., et al. [1991] “Evidence that the 90-kDa Heatshock Protein (HSP90) Exists in Cytosol in Heteromeric Complexes Containing HSP70 and Three Other Proteins with Mr 63,000, 56,000, and 50,000,” J Biol Chem 6708) are nuclear and cytoplasmic markers, respectively. (C-J) Immunocytochemical localization of BIVM. Cos7 cells transiently transfected with pBIVM-K1 were analyzed by conventional fluorescent microscopy. Recombinant BIVM (green), actin (red), nuclei (blue), and overlayered images are shown. Note that levels of nuclear BIVM vary (compare C to G).
FIGS. 7A-7C. Giardia BIVM-like sequence. (A) The nucleotide sequence (SEQ ID NO: 14) and predicted amino acid translation product (SEQ ID NO: 15) of a Giardia lamblia BIVM-like (BIVML) transcript. Translational start and stop codons are in reverse text. Numbering is as in FIG. 1. Grey shading indicates conserved motifs. A sequence resembling predicted giardial initiator regions is boxed. A classic giardial polyadenylation signal sequence is underlined. (B) Alignment of the predicted BIVML protein (SEQ ID NO: 15) with the C-terminal region of human BIVM (SEQ ID NO: 2). Labeling is as in FIG. 3. (C) RNA blot (10 μg/track) probed for BIVML in vegetative-stage (veg) and 21 hr encysting Giardia. Calmodulin is shown as loading control.
FIG. 8. RT-PCR analysis of extracts from BIVM expressing and non-expressing human cell lines indicated that EP58/MGC5302 was expressed in all cell lines that express BIVM but not in a BIVM non-expressing cell line.
FIG. 9. Potential binding sites contained in the 41 bp region separating the BIVM and EP58/MGC5302 genes revealed sites for cell type specific factors such as the myeloid zinc finger-1 (MZF-1), the hematopoietic-expressed Ikaros-2 (IK2) factor, and the ubiquitously expressed transcription factors NF1, USF, NFκB, and NMYC.
FIG. 10. Detection of bands representing NFκB-specific binding constitutively present in nuclear extracts.
FIG. 11. Binding of the 41 bp intergenic region by NFκB complexes containing c-Rel and RelB factors, which are constitutively present in the nuclear extracts from the BIVM expressing K562 cell line.
FIG. 12. TNF-α activated NFκB increases the expression of BIVM in the BIVM-expressing HeLa cell line (DNS). A cell line devoid of basal BIVM expression, the Raji Burkitt's lymphoma line, is induced to express BIVM by TNF-a.
FIGS. 13A-13C. Flow cytometer analyses of cells stained with propidium iodide.
SEQ ID NO: 1—human BIVM cDNA
SEQ ID NO: 2—human BIVM amino acid sequence
SEQ ID NO: 3—human BIVM gemonic sequence with upstream partial sequence of MGC5302 gene and downstream partial sequence of ERCC5 gene
SEQ ID NO: 4—Xenopus BIVM open reading frame
SEQ ID NO: 5—Xenopus BIVM amino acid sequence
SEQ ID NO: 6—Chicken BIVM open reading frame
SEQ ID NO: 7—Alternatively spliced chicken BIVM open reading frame
SEQ ID NO: 8—Chicken BIVM amino acid sequence
SEQ ID NO: 9—Alternatively splice chicken BIVM amino acid sequence
SEQ ID NO: 10—Zebrafish BIVM open reading frame
SEQ ID NO: 11—Zebrafish BIVM amino acid sequence
SEQ ID NO: 12—Sea urchin BIVM partial coding sequence
SEQ ID NO: 13—Sea urchin BIVM partial amino acid sequence
SEQ ID NO: 14—Giardia BIVM-like open reading frame
SEQ ID NO: 15—Giardia BIVM-like amino acid sequence
SEQ ID NO: 16—Lancelet BIVM partial coding sequence
SEQ ID NO: 17—Lancelet BIVM partial amino acid sequence
SEQ ID NO: 18—Mouse BIVM exon A nucleotide sequence
SEQ ID NO: 19—Mouse BIVM exon B nucleotide sequence
SEQ ID NO: 20—Mouse BIVM exon C nucleotide sequence
SEQ ID NO: 21—Mouse BIVM exon 1 nucleotide sequence
SEQ ID NO: 22—Alternative mouse BIVM 5′ end clone (6359)
SEQ ID NO: 23—Alternative mouse BIVM 5′ end clone (6358)
SEQ ID NO: 24—Alternative mouse BIVM 5′ end clone (6356)
SEQ ID NO: 25—Alternative mouse BIVM 5′ end clone (cDNA)
SEQ ID NO: 26—Mouse BIVM cDNA with clone 6359 5′ end
SEQ ID NO: 27—Mouse BIVM amino acid sequence
SEQ ID NO: 28—Mouse BIVM genomic sequence with upstream partial sequence of KDEL gene
SEQ ID NO: 29—Human BIVM exon A1 splice donor sequence
SEQ ID NO: 30—Human BIVM exon A2 splice donor sequence
SEQ ID NO: 31—Human BIVM exon A3 splice donor sequence
SEQ ID NO: 32—Human BIVM exon B splice acceptor sequence
SEQ ID NO: 33—Human BIVM exon B splice donor sequence
SEQ ID NO: 34—Human BIVM exon 1 splice acceptor sequence
SEQ ID NO: 35—Human BIVM exon 1 splice donor sequence
SEQ ID NO: 36—Human BIVM exon 2 splice acceptor sequence
SEQ ID NO: 37—Human BIVM exon 2 splice donor sequence
SEQ ID NO: 38—Human BIVM exon 3 splice acceptor sequence
SEQ ID NO: 39—Human BIVM exon 3 splice donor sequence
SEQ ID NO: 40—Human BIVM exon 4 splice acceptor sequence
SEQ ID NO: 41—Human BIVM exon 4 splice donor sequence
SEQ ID NO: 42—Human BIVM exon 5 splice acceptor sequence
SEQ ID NO: 43—Human BIVM exon 5 splice donor sequence
SEQ ID NO: 44—Human BIVM exon 6 splice acceptor sequence
SEQ ID NO: 45—Human BIVM exon 6 splice donor sequence
SEQ ID NO: 46—Human BIVM exon 7 splice acceptor sequence
SEQ ID NO: 47—Human BIVM exon 7 splice donor sequence
SEQ ID NO: 48—Human BIVM exon 8 splice acceptor sequence
SEQ ID NO: 49—Human BIVM exon 8 splice donor sequence
SEQ ID NO: 50—Human BIVM exon 9 splice acceptor sequence
SEQ ID NO: 51—HSMAP5 primer
SEQ ID NO: 52—HSMAP6 primer
SEQ ID NO: 53—xfbivmMAPF1 primer
SEQ ID NO: 54—xfbivmMAPR1 primer
SEQ ID NO: 55—M1 amino acid motif
SEQ ID NO: 56—M2 amino acid motif
SEQ ID NO: 57—M3a amino acid motif
SEQ ID NO: 58—M3b amino acid motif
SEQ ID NO: 59—BIVM N-terminus region of homology
SEQ ID NO: 60—BIVM C-terminus region of homology
SEQ ID NO: 61—BIVM amino acid motif 1
SEQ ID NO: 62—BIVM amino acid motif 2
SEQ ID NO: 63—BIVM amino acid motif 3
SEQ ID NO: 64—BIVM amino acid motif 4
SEQ ID NO: 65—BIVM peptide domain (N-terminus of region of interspecific homology)
The subject invention provides isolated and/or purified nucleotide sequences comprising: a) a polynucleotide sequence, or fragment thereof, or a polynucleotide encoding an amino acid sequence, or fragment of said amino acid sequence, of a sequence selected from the group consisting of SEQ ID NOs: 1-64 (or the complements of said polynucleotide sequences or fragments thereof); b) a polynucleotide sequence, or fragment thereof, comprising a sequence having at least about 20% to 99.99% identity to a polynucleotide selected from the group consisting of SEQ ID NOs: 1-28; c) a polynucleotide sequence encoding a polypeptide comprising a sequence selected from the group consisting of SEQ ID NOs: 2, 5, 7, 8, 9, 11, 13, 15, 17, or 27; d) splice variants of SEQ ID NOs: 1-3 or 6-9; or e) a polynucleotide sequence encoding a polypeptide fragment of SEQ ID NOs: 2, 5, 7, 8, 9, 11, 13, 15, 17, or 27, wherein said fragment has substantially the same biological or serologic activity as the native (or intact) polypeptide.
Nucleotide, polynucleotide, or nucleic acid sequence(s) are understood to mean. according to the present invention, either a double-stranded DNA, a single-stranded DNA, or products of transcription of the said DNAs (e.g., RNA molecules). It should also be understood that the present invention does not relate to the genomic nucleotide sequences encoding BIVM in their natural/native environment or natural/native state. The nucleic acid, polynucleotide, or nucleotide sequences of the invention have been isolated, purified (or partially purified), by separation methods including, but not limited to, ion-exchange chromatography, molecular size exclusion chromatography, affinity chromatography, or by genetic engineering methods such as amplification, cloning, or subcloning.
Optionally, the polynucleotide sequences of the instant invention can also contain one or more polynucleotides encoding heterologous polypeptide sequences (e.g., tags that facilitate purification of the polypeptides of the invention (see, for example, U.S. Pat. No. 6,342,362, hereby incorporated by reference in its entirety; Altendorf et al. [1999-WWW, 2000] “Structure and Function of the Fo Complex of the ATP Synthase from Escherichia Coli,” J. of Experimental Biology 203:19-28, The Co. of Biologists, Ltd., G. B.; Baneyx [1999] “Recombinant Protein Expression in Escherichia coli,” Biotechnology 10:411-21, Elsevier Science Ltd.; Eihauer et al. [2001] “The FLAG™ Peptide, a Versatile Fusion Tag for the Purification of Recombinant Proteins,” J. Biochem Biophys Methods 49:455-65; Jones et al. [1995] J. Chromatography 707:3-22; Jones et al. [1995] “Current Trends in Molecular Recognition and Bioseparation,” J. of Chromatography A. 707:3-22, Elsevier Science B. V.; Margolin [2000] “Green Fluorescent Protein as a Reporter for Macromolecular Localization in Bacterial Cells,” Methods 20:62-72, Academic Press; Puig et al. [2001] “The Tandem Affinity Purification (TAP) Method: A General Procedure of Protein Complex Purification,” Methods 24:218-29, Academic Press; Sassenfeld [1990] “Engineering Proteins for Purification,” TibTech 8:88-93; Sheibani [1999] “Prokaryotic Gene Fusion Expression Systems and Their Use in Structural and Functional Studies of Proteins,” Prep. Biochem. & Biotechnol. 29(1):77-90, Marcel Dekker, Inc.; Skerra et al. [1999] “Applications of a Peptide Ligand for Streptavidin: the Strep-tag”, Biomolecular Engineering 16:79-86, Elsevier Science, B. V.; Smith [1998] “Cookbook for Eukaryotic Protein Expression: Yeast, Insect, and Plant Expression Systems,” The Scientist 12(22):20; Smyth et al. [2000] “Eukaryotic Expression and Purification of Recombinant Extracellular Matrix Proteins Carrying the Strep II Tag”, Methods in Molecular Biology, 139:49-57; Unger [1997] “Show Me the Money: Prokaryotic Expression Vectors and Purification Systems,” The Scientist 11(17):20, each of which is hereby incorporated by reference in their entireties), or commercially available tags from vendors such as such as STRATAGENE (La Jolla, Calif.), NOVAGEN (Madison, Wis.), QIAGEN, Inc., (Valencia, Calif.), or InVitrogen (San Diego, Calif.).
| TABLE I |
| Splice variants of BIVM (SEQ ID NOs: 29-50) |
| Seq ID | Intron | |||||
| No. | Exon | Splice Donor | Splice Acceptor | Position | (bp) | |
| 29 | A1 | CGGCCCCAGGgtaac | — | 1-415 | — |
| 30 | A2 | TGTGATCCAGgtccg | — | 1-365 | — |
| 31 | A3 | CAGGCCAGAGgtacc | — | 1-473 | — |
| 33/32 | B | TTTCTGTCAGgtgat | ttccctaaagGAATC | 474-557 | 5785 |
| 35/34 | 1 | CACAAATCAGgtaag | ttcctcttagGAGCT | 558-1157 | 1754 |
| 37/36 | 2 | TCAGACGATGgtgat | tgtattctagGCAAT | 1158-1284 | 8682 |
| 39/38 | 3 | GAGCTGCAAAgtaag | gtgttctcagGTACT | 1285-1380 | 4481 |
| 41/40 | 4 | CACTTATGAGgtatg | tcttttgtagCCTTC | 1381-1485 | 609 |
| 43/42 | 5 | GGAGAAACTGgtagg | ttactttcagGTGGT | 1486-1580 | 216 |
| 45/44 | 6 | AAGCATTCAGgtaag | tttttaatagCTTCA | 1581-1713 | 9405 |
| 49/48 | 7 | AACAAAGAAGgtaag | ttaactatagATGGG | 1714-1800 | 2768 |
| 50 | 8 | — | ttcttctcagGTTGG | 1801-1897 | 4089 |
| 50 | 9 | — | ttcttctcagGTTGG | 1898-3029 | 832 |
Other aspects of the invention provide vectors containing one or more of the polynucleotides of the invention. The vectors can be vaccine, replication, or amplification vectors. In some embodiments of this aspect of the invention, the polynucleotides are operably associated with regulatory elements capable of causing the expression of the polynucleotide sequences. Such vectors include, among others, chromosomal, episomal and virus-derived vectors, e.g., vectors derived from bacterial plasmids, from bacteriophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations of the aforementioned vector sources, such as those derived from plasmid and bacteriophage genetic elements (e.g., cosmids and phagemids).
As indicated above, vectors of this invention can also comprise elements necessary to provide for the expression and/or the secretion of a polypeptide encoded by the nucleotide sequences of the invention in a given host cell. The vector can contain one or more elements selected from the group consisting of a promoter, signals for initiation of translation, signals for termination of translation, and appropriate regions for regulation of transcription. In certain embodiments, the vectors can be stably maintained in the host cell and can, optionally, contain signal sequences directing the secretion of translated protein. Other embodiments provide vectors that are not stable in transformed host cells. Vectors can integrate into the host genome or be autonomously-replicating vectors.
In a specific embodiment, a vector comprises a promoter operably linked to a protein or peptide-encoding nucleic acid sequence, one or more origins of replication, and, optionally, one or more selectable markers (e.g., an antibiotic resistance gene). Non-limiting exemplary vectors for the expression of the polypeptides of the invention include pBr-type vectors, pET-type plasmid vectors (Promega), pBAD plasmid vectors (Invitrogen) or those provided in the examples below. Furthermore, vectors according to the invention are useful for transforming host cells for the cloning or expression of the nucleotide sequences of the invention.
Promoters which may be used to control expression include, but are not limited to, the CMV promoter, the SV40 early promoter region (Bernoist and Chambon [1981] Nature 290:304-310), the promoter contained in the 3′ long terminal repeat of Rous sarcoma virus (Yamamoto, et al. [1980] Cell 22:787-797), the herpes thymidine kinase promoter (Wagner et al. Proc. Natl. Acad. Sci. USA 78:1441-1445), the regulatory sequences of the metallothionein gene (Brinster et al. [1982] Nature 296:39-42); prokaryotic vectors containing promoters such as the β-lactamase promoter (Villa-Kamaroff, et al. [1978] Proc. Natl. Acad. Sci. USA 75:3727-3731), or the tac promoter (DeBoer, et al. [1983] Proc. Natl. Acad. Sci. USA 80:21-25); see also, “Useful Proteins from Recombinant Bacteria” in Scientific American, 1980, 242:74-94; plant expression vectors comprising the nopaline synthetase promoter region (Herrera-Estrella et al. [1983] Nature 303:209-213) or the cauliflower mosaic virus 35S RNA promoter (Gardner, et al. [1981] Nucl. Acids Res. 9:2871), and the promoter of the photosynthetic enzyme ribulose biphosphate carboxylase (Herrera-Estrella et al. [1984] Nature 310:115-120); promoter elements from yeast or fungi such as the Gal 4 promoter, the ADC (alcohol dehydrogenase) promoter, PGK (phosphoglycerol kinase) promoter, and/or the alkaline phosphatase promoter.
The subject invention also provides for “homologous” or “modified” nucleotide sequences. Modified nucleic acid sequences will be understood to mean any nucleotide sequence obtained by mutagenesis according to techniques well known to persons skilled in the art, and exhibiting modifications in relation to the normal sequences. For example, mutations in the regulatory and/or promoter sequences for the expression of a polypeptide that result in a modification of the level of expression of a polypeptide according to the invention provide for a “modified nucleotide sequence”. Likewise, substitutions, deletions, or additions of nucleic acid to the polynucleotides of the invention provide for “homologous” or “modified” nucleotide sequences. In various embodiments, “homologous” or “modified” nucleic acid sequences have substantially the same biological or serological activity as the native (naturally occurring) BIVM polypeptides. A “homologous” or “modified” nucleotide sequence will also be understood to mean a splice variant of the polynucleotides of the instant invention (see Table I) or any nucleotide sequence encoding a “modified polypeptide” as defined below.
A homologous nucleotide sequence, for the purposes of the present invention, encompasses a nucleotide sequence having a percentage identity with the bases of the nucleotide sequences of between at least (or at least about) 20.00% to 99.99% or higher. The aforementioned range of percent identity is to be taken as including, and providing written description and support for, any fractional percentage, in intervals of 0.01%, between 20.00% and 99.99% or higher. These percentages are purely statistical and differences between two nucleic acid sequences can be distributed randomly and over the entire sequence length.
In various embodiments, homologous sequences exhibiting a percentage identity with the bases of the nucleotide sequences of the present invention can have 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identity with the polynucleotide sequences of the instant invention.
Both protein and nucleic acid sequence homologies may be evaluated using any of the variety of sequence comparison algorithms and programs known in the art. Such algorithms and programs include, but are by no means limited to, TBLASTN, BLASTP, FASTA, TFASTA, and CLUSTALW (Pearson and Lipman [1988] Proc. Natl. Acad. Sci. USA 85(8):2444-2448; Altschul et al. [1990] J. Mol. Biol. 215(3):403-410; Thompson et al. [1994] Nucleic Acids Res. 22(2):4673-4680; Higgins et al. [1996] Methods Enzymol. 266:383-402; Altschul et al. [1990] J. Mol. Biol. 215(3):403-410; Altschul et al. [1993] Nature Genetics 3:266-272).
The subject invention also provides nucleotide sequences complementary to any of the polynucleotide sequences disclosed herein. Thus, the invention is understood to include any DNA whose nucleotides are complementary to those of the sequence of the invention, and whose orientation is reversed (e.g., an antisense sequence).
The present invention further provides fragments of the polynucleotide sequences provided herein. Representative fragments of the polynucleotide sequences according to the invention will be understood to mean any nucleotide fragment having at least 8 or 9 successive nucleotides, preferably at least 12 successive nucleotides, and still more preferably at least 15 or at least 20 successive nucleotides of the sequence from which it is derived. In other embodiments, fragments contain from one nucleotide less than the full length polynucleotide sequence to fragments comprising up to, and including 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, or 255 consecutive nucleotides of a particular sequence disclosed herein. Yet other embodiments provide fragments (or detection probes) comprising nucleotides 1446 to 1697 or 1447 to 1698 of FIG. 1 (SEQ ID NO:1). It is to be understood that such fragments refer only to portions of the disclosed polynucleotide sequences that are not listed in a publicly available database or prior art references.
Among these representative fragments, those capable of hybridizing under stringent conditions with a nucleotide sequence according to the invention are preferred. Conditions of high or intermediate stringency are provided infra and are chosen to allow for hybridization between two complementary DNA fragments. Hybridization conditions for a polynucleotide of about 300 bases in size will be adapted by persons skilled in the art for larger- or smaller-sized oligonucleotides, according to methods well known in the art (see, for example, Sambrook et al. [1989]).
The subject invention also provides detection probes (e.g., fragments of the disclosed polynucleotide sequences) for hybridization with a target sequence or an amplicon generated from the target sequence. Such a detection probe will advantageously have as sequence a sequence of at least 9, 12, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides. Alternatively, detection probes can comprise 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, or 255 consecutive nucleotides of the disclosed nucleic acids. The detection probes can also be used as labeled probe or primer in the subject invention. Labeled probes or primers are labeled with a radioactive compound or with another type of label. Alternatively, non-labeled nucleotide sequences may be used directly as probes or primers; however, the sequences are generally labeled with a radioactive element (32P, 35S, 3H, 125I) or with a molecule such as biotin, acetylaminofluorene, digoxigenin, 5-bromo-deoxyuridine, or fluorescein to provide probes that can be used in numerous applications.
The nucleotide sequences according to the invention may also be used in analytical systems, such as DNA chips. DNA chips and their uses are well known in the art and (see for example, U.S. Pat. Nos. 5,561,071; 5,753,439; 6,214,545; Schena et al. [1996] BioEssays 18:427-431; Bianchi et al. [1997] Clin. Diagn. Virol. 8:199-208; each of which is hereby incorporated by reference in their entireties) and/or are provided by commercial vendors such as Affymetrix, Inc. (Santa Clara, Calif.).
Various degrees of stringency of hybridization can be employed. The more severe the conditions, the greater the complementarity that is required for duplex formation. Severity of conditions can be controlled by temperature, probe concentration, probe length, ionic strength, time, and the like. Preferably, hybridization is conducted under moderate to high stringency conditions by techniques well known in the art, as described, for example, in Keller, G. H., M. M. Manak [1987] DNA Probes, Stockton Press, New York, N.Y., pp. 169-170.
By way of example, hybridization of immobilized DNA on Southern blots with 32P-labeled gene-specific probes can be performed by standard methods (Maniatis et al. [1982] Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York). In general, hybridization and subsequent washes can be carried out under moderate to high stringency conditions that allow for detection of target sequences with homology to the exemplified polynucleotide sequence. For double-stranded DNA gene probes, hybridization can be carried out overnight at 20-25° C. below the melting temperature (Tm) of the DNA hybrid in 6×SSPE, 5× Denhardt's solution, 0.1% SDS, 0.1 mg/ml denatured DNA. The melting temperature is described by the following formula (Beltz et al. [1983] Methods of Enzymology, R. Wu, L. Grossman and K. Moldave [eds.] Academic Press, New York 100:266-285).
Tm=81.5° C.+16.6 Log[Na+]+0.41(% G+C)−0.61(% formamide)−600/length of duplex in base pairs.
Washes are typically carried out as follows:
(1) twice at room temperature for 15 minutes in 1×SSPE, 0.1% SDS (low stringency wash);
(2) once at Tm−20° C. for 15 minutes in 0.2×SSPE, 0.1% SDS (moderate stringency wash).
For oligonucleotide probes, hybridization can be carried out overnight at 10-20° C. below the melting temperature (Tm) of the hybrid in 6×SSPE, 5× Denhardt's solution, 0.1% SDS, 0.1 mg/ml denatured DNA. Tm for oligonucleotide probes can be determined by the following formula:
Tm(° C.)=2(number T/A base pairs)+4(number G/C base pairs) (Suggs et al. [1981] ICN-UCLA Symp. Dev. Biol. Using Purified Genes, D. D. Brown [ed.], Academic Press, New York, 23:683-693).
Washes can be carried out as follows:
(1) twice at room temperature for 15 minutes 1×SSPE, 0.1% SDS (low stringency wash;
2) once at the hybridization temperature for 15 minutes in 1×SSPE, 0.1% SDS (moderate stringency wash).
In general, salt and/or temperature can be altered to change stringency. With a labeled DNA fragment >70 or so bases in length, the following conditions can be used:
By way of another non-limiting example, procedures using conditions of high stringency can also be performed as follows: Pre-hybridization of filters containing DNA is carried out for 8 h to overnight at 65° C. in buffer composed of 6×SSC, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 μg/ml denatured salmon sperm DNA. Filters are hybridized for 48 h at 65° C., the preferred hybridization temperature, in pre-hybridization mixture containing 100 μg/ml denatured salmon sperm DNA and 5-20×106 cpm of 32P-labeled probe. Alternatively, the hybridization step can be performed at 65° C. in the presence of SSC buffer, 1×SSC corresponding to 0.15M NaCl and 0.05 M Na citrate. Subsequently, filter washes can be done at 37° C. for 1 h in a solution containing 2×SSC, 0.01% PVP, 0.01% Ficoll, and 0.01% BSA, followed by a wash in 0.1×SSC at 50° C. for 45 min. Alternatively, filter washes can be performed in a solution containing 2×SSC and 0.1% SDS, or 0.5×SSC and 0.1% SDS, or 0.1×SSC and 0.1% SDS at 68° C. for 15 minute intervals. Following the wash steps, the hybridized probes are detectable by autoradiography. Other conditions of high stringency which may be used are well known in the art (see, for example, Sambrook et al. [1989] Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Press, N.Y., pp. 9.47-9.57; and Ausubel et al. [1989] Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, New York, each incorporated herein in its entirety).
A further non-limiting example of procedures using conditions of intermediate stringency are as follows: Filters containing DNA are pre-hybridized, and then hybridized at a temperature of 60° C. in the presence of a 5×SSC buffer and labeled probe. Subsequently, filters washes are performed in a solution containing 2×SSC at 50° C. and the hybridized probes are detectable by autoradiography. Other conditions of intermediate stringency which may be used are well known in the art (see, for example, Sambrook et al. [1989] Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Press, N.Y., pp. 9.47-9.57; and Ausubel et al. [1989] Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, New York, each of which is incorporated herein in its entirety).
Duplex formation and stability depend on substantial complementarity between the two strands of a hybrid and, as noted above, a certain degree of mismatch can be tolerated. Therefore, the probe sequences of the subject invention include mutations (both single and multiple), deletions, insertions of the described sequences, and combinations thereof, wherein said mutations, insertions and deletions permit formation of stable hybrids with the target polynucleotide of interest. Mutations, insertions and deletions can be produced in a given polynucleotide sequence in many ways, and these methods are known to an ordinarily skilled artisan. Other methods may become known in the future.
It is also well known in the art that restriction enzymes can be used to obtain functional fragments of the subject DNA sequences. For example, Bal31 exonuclease can be conveniently used for time-controlled limited digestion of DNA (commonly referred to as “erase-a-base” procedures). See, for example, Maniatis et al. [1982] Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York; Wei et al. [1983] J. Biol. Chem. 258:13006-13512. The nucleic acid sequences of the subject invention can also be used as molecular weight markers in nucleic acid analysis procedures.
The invention also provides host cells transformed by a polynucleotide according to the invention and the production of BIVM (or BIVM ortholog) polypeptides by the transformed host cells. In some embodiments, transformed cells comprise an expression vector containing BIVM, or BIVM ortholog, polynucleotide sequences. Other embodiments provide for host cells transformed with nucleic acids. Yet other embodiments provide transformed cells comprising an expression vector containing fragments of BIVM, or BIVM ortholog, polynucleotide sequences. Transformed host cells according to the invention are cultured under conditions allowing the replication and/or the expression of the nucleotide sequences of the invention. Expressed polypeptides are recovered from culture media and purified, for further use, according to methods known in the art.
The host cell may be chosen from eukaryotic or prokaryotic systems, for example bacterial cells (Gram negative or Gram positive), yeast cells, animal cells, plant cells, and/or insect cells using baculovirus vectors. In some embodiments, the host cell for expression of the polypeptides include, and are not limited to, those taught in U.S. Pat. Nos. 6,319,691; 6,277,375; 5,643,570; 5,565,335; Unger [1997] The Scientist 11(17):20; or Smith [1998] The Scientist 12(22):20, each of which is incorporated by reference in its entirety, including all references cited within each respective patent or reference. Other exemplary, and non-limiting, host cells include Staphylococcus spp., Enterococcus spp., E. coli, and Bacillus subtilis; fungal cells, such as Streptomyces spp., Aspergillus spp., S. cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, Hansela polymorpha, Kluveromyces lactis, and Yarrowia lipolytica; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, 293 and Bowes melanoma cells; and plant cells. A great variety of expression systems can be used to produce the polypeptides of the invention and polynucleotides can be modified according to methods known in the art to provide optimal codon usage for expression in a particular expression system.
Furthermore, a host cell strain may be chosen that modulates the expression of the inserted sequences, modifies the gene product, and/or processes the gene product in the specific fashion. Expression from certain promoters can be elevated in the presence of certain inducers; thus, expression of the genetically engineered polypeptide may be controlled. Furthermore, different host cells have characteristic and specific mechanisms for the translational and post-translational processing and modification (e.g., glycosylation, phosphorylation) of proteins. Appropriate cell lines or host systems can be chosen to ensure the desired modification and processing of the foreign protein expressed. For example, expression in a bacterial system can be used to produce an unglycosylated core protein product whereas expression in yeast will produce a glycosylated product. Expression in mammalian cells can be used to provide “native” glycosylation of a heterologous protein. Furthermore, different vector/host expression systems may effect processing reactions to different extents.
Nucleic acids and/or vectors can be introduced into host cells by well-known methods, such as, calcium phosphate transfection, DEAE-dextran mediated transfection, transfection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction and infection (see, for example, Sambrook et al. [1989] Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).
The subject invention also provides for the expression of a polypeptide, derivative, or a variant (e.g., a splice variant) encoded by a polynucleotide sequence disclosed herein. Alternatively, the invention provides for the expression of a polypeptide fragment obtained from a polypeptide, derivative, or a variant encoded by a polynucleotide fragment derived from the polynucleotide sequences disclosed herein. In either embodiment, the disclosed sequences can be regulated by a second nucleic acid sequence so that the polypeptide or fragment is expressed in a host transformed with a recombinant DNA molecule according to the subject invention. For example, expression of a protein or peptide may be controlled by any promoter/enhancer element known in the art.
The subject invention also provides nucleic acid based methods for the identification of the presence of the BIVM gene, or orthologs thereof, in a sample. These methods can utilize the nucleic acids of the subject invention and are well known to those skilled in the art (see, for example, Sambrook et al. [1989] or Abbaszadega [2001] “Advanced Detection of Viruses and Protozoan Parasites in Water,” Reviews in Biology and Biotechnology, 1(2):21-26). Among the techniques useful in such methods are enzymatic gene amplification (or PCR), Southern blots, Northern blots, or other techniques utilizing nucleic acid hybridization for the identification of polynucleotide sequences in a sample. Thus, the subject invention can provide nucleic acid based methodologies for the identification of G. lamblia in environmental or biological samples and provides sensitive assays for the diagnosis of G. lamblia infections. Alternatively, the nucleic acids can be used to screen individuals for cancers, tumors, or malignancies associated with dysregulation of the BIVM gene or its transcriptional products.
The subject invention also provides polypeptides encoded by nucleotide sequences of the invention. The subject invention also provides fragments of at least 5 amino acids of a polypeptide encoded by the polynucleotides of the instant invention. In some embodiments, the polypeptide fragments are reactive with antibodies found in the serum of an individual infected with G. lamblia.
In the context of the instant invention, the terms polypeptide, peptide and protein are used interchangeably. Likewise, the terms variant and homologous are also used interchangeably. It should be understood that the invention does not relate to the polypeptides in natural form or native environment. Peptides and polypeptides according to the invention have been isolated or obtained by purification from natural sources (or their native environment), chemically synthesized, or obtained from host cells prepared by genetic manipulation (e.g., the polypeptides, or fragments thereof, are recombinantly produced by host cells). Polypeptides according to the instant invention may also contain non-natural amino acids, as will be described below.
“Variant” or “homologous” polypeptides will be understood to designate the polypeptides containing, in relation to the native polypeptide, modifications such as deletion, addition, or substitution of at least one amino acid, truncation, extension, or the addition of chimeric heterologous polypeptides. Optionally, “variant” or “homologous” polypeptides can contain a mutation or post-translational modifications. Among the “variant” or “homologous” polypeptides, those whose amino acid sequence exhibits 20.00% to 99.99% (inclusive) identity to the native polypeptide sequence are preferred. The aforementioned range of percent identity is to be taken as including, and providing written description and support for, any fractional percentage, in intervals of 0.01%, between 50.00% and, up to, including 99.99%. These percentages are purely statistical and differences between two polypeptide sequences can be distributed randomly and over the entire sequence length.
“Variant” or “homologous” polypeptide sequences exhibiting a percentage identity with the polypeptides of the present invention can, alternatively, have 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 91, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identity with the polypeptide sequences of the instant invention. The expression equivalent amino acid is intended here to designate any amino acid capable of being substituted for one of the amino acids in the basic structure without, however, essentially modifying the biological activities of the corresponding peptides and as provided below.
By way of example, amino acid substitutions can be carried out without resulting in a substantial modification of the biological activity of the corresponding modified polypeptides; for example, the replacement of leucine with valine or isoleucine; aspartic acid with glutamic acid; glutamine with asparagine; arginine with lysine; and the reverse substitutions can be performed without substantial modification of the biological activity of the polypeptides.
In other embodiments, homologous polypeptides according to the subject invention also include various splice variants identified within the BIVM coding sequence (see Table I).
The subject invention also provides biologically active fragments of a polypeptide according to the invention and includes those peptides capable of eliciting an immune response. In one embodiment, an immune response directed against G. lamblia is provided. The immune response can provide components (either antibodies or components of the cellular immune response (e.g., B-cells, helper, cytotoxic, and/or suppressor T-cells)) reactive with the biologically active fragment of a polypeptide, the intact, full length, unmodified polypeptide disclosed herein, or both the biologically active fragment of a polypeptide and the intact, full length, unmodified polypeptides disclosed herein. Biologically active fragments according to the invention comprise from five (5) amino acids to one amino acid less than the full length of any polypeptide sequence provided herein. Alternatively, fragments comprising 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, or 255 consecutive amino acids of a disclosed polypeptide sequence are provided herein.
Fragments, as described herein, can be obtained by cleaving the polypeptides of the invention with a proteolytic enzyme (such as trypsin, chymotrypsin, or collagenase) or with a chemical reagent, such as cyanogen bromide (CNBr). Alternatively, polypeptide fragments can be generated in a highly acidic environment, for example at pH 2.5. Such polypeptide fragments may be equally well prepared by chemical synthesis or using hosts transformed with an expression vector containing nucleic acids encoding polypeptide fragments according to the invention. The transformed host cells contain a nucleic acid and are cultured according to well-known methods; thus, the invention allows for the expression of these fragments, under the control of appropriate elements for regulation and/or expression of the polypeptide fragments.
Modified polypeptides according to the invention are understood to designate a polypeptide obtained by variation in the splicing of transcriptional products of the BIVM gene, genetic recombination, or by chemical synthesis as described below. Modified polypeptides contain at least one modification in relation to the normal polypeptide sequence. These modifications can include the addition, substitution, deletion of amino acids contained within the polypeptides of the invention.
In order to extend the life of the polypeptides of the invention, it may be advantageous to use non-natural amino acids, for example in the D form, or alternatively amino acid analogs, such as sulfur-containing forms of amino acids. Alternative means for increasing the life of polypeptides can also be used in the practice of the instant invention. For example, polypeptides of the invention, and fragments thereof, can be recombinantly modified to include elements that increase the plasma, or serum half-life of the polypeptides of the invention. These elements include, and are not limited to, antibody constant regions (see for example, U.S. Pat. No. 5,565,335, hereby incorporated by reference in its entirety, including all references cited therein), or other elements such as those disclosed in U.S. Pat. Nos. 6,319,691; 6,277,375; or 5,643,570, each of which is incorporated by reference in its entirety, including all references cited within each respective patent. Alternatively, the polynucleotides and genes of the instant invention can be recombinantly fused to elements that are useful in the preparation of immunogenic constructs for the purposes of vaccine formulation or elements useful for the isolation of the polypeptides of the invention.
The polypeptides, fragments, and immunogenic fragments of the invention may further contain linkers that facilitate the attachment of the fragments to a carrier molecule for the stimulation of an immune response or diagnostic purposes. The linkers can also be used to attach fragments according to the invention to solid support matrices for use in affinity purification protocols. In this aspect of the invention, the linkers specifically exclude, and are not to be considered anticipated, where the fragment is a subsequence of another peptide, polypeptide, or protein as identified in a search of protein sequence databases as indicated in the preceding paragraph. In other words, the non-identical portions of the other peptide, polypeptide, of protein is not considered to be a “linker” in this aspect of the invention. Non-limiting examples of “linkers” suitable for the practice of the invention include chemical linkers (such as those sold by Pierce, Rockford, Ill.), peptides which allow for the connection of the immunogenic fragment to a carrier molecule (see, for example, linkers disclosed in U.S. Pat. Nos. 6,121,424; 5,843,464; 5,750,352; and 5,990,275, hereby incorporated by reference in their entirety). In various embodiments, the linkers can be up to 50 amino acids in length, up to 40 amino acids in length, up to 30 amino acids in length, up to 20 amino acids in length, up to 10 amino acids in length, or up to 5 amino acids in length.
In other specific embodiments, the polypeptides, peptides, derivatives, or analogs thereof may be expressed as a fusion, or chimeric protein product (comprising the protein, fragment, analog, or derivative joined via a peptide bond to a heterologous protein sequence (e.g., a different protein)). Such a chimeric product can be made by ligating the appropriate nucleic acid sequences encoding the desired amino acid sequences to each other by methods known in the art, in the proper coding frame, and expressing the chimeric product by methods commonly known in the art (see, for example, U.S. Pat. No. 6,342,362, hereby incorporated by reference in its entirety; Altendorf et al. [1999-WWW, 2000] “Structure and Function of the Fo Complex of the ATP Synthase from Escherichia Coli,” J. of Experimental Biology 203:19-28, The Co. of Biologists, Ltd., G. B.; Baneyx [1999] “Recombinant Protein Expression in Escherichia coli,” Biotechnology 10:411-21, Elsevier Science Ltd.; Eihauer et al.
“The FLAG™ Peptide, a Versatile Fusion Tag for the Purification of Recombinant Proteins,” J. Biochem Biophys Methods 49:455-65; Jones et al. [1995] J. Chromatography 707:3-22; Jones et al. [1995] “Current Trends in Molecular Recognition and Bioseparation,” J. Chromatography A. 707:3-22, Elsevier Science B. V.; Margolin [2000] “Green Fluorescent Protein as a Reporter for Macromolecular Localization in Bacterial Cells,” Methods 20:62-72, Academic Press; Puig et al. [2001] “The Tandem Affinity Purification (TAP) Method: A General Procedure of Protein Complex Purification,” Methods 24:218-29, Academic Press; Sassenfeld [1990] “Engineering Proteins for Purification,” TibTech 8:88-93; Sheibani [1999] “Prokaryotic Gene Fusion Expression Systems and Their Use in Structural and Functional Studies of Proteins,” Prep. Biochem. & Biotechnol. 29(1):77-90, Marcel Dekker, Inc.; Skerra et al. [1999] “Applications of a Peptide Ligand for Streptavidin: The Strep-tag”, Biomolecular Engineering 16:79-86, Elsevier Science, B. V.; Smith [1998] “Cookbook for Eukaryotic Protein Expression: Yeast, Insect, and Plant Expression Systems,” The Scientist 12(22):20; Smyth et al. [2000] “Eukaryotic Expression and Purification of Recombinant Extracellular Matrix Proteins Carrying the Strep II Tag”, Methods in Molecular Biology, 139:49-57; Unger [1997] “Show Me the Money: Prokaryotic Expression Vectors and Purification Systems,” The Scientist 11(17):20, each of which is hereby incorporated by reference in their entireties). Alternatively, such a chimeric product may be made by protein synthetic techniques, e.g., by use of a peptide synthesizer.
Another embodiment of the subject invention provides for the use of polypeptides encoded by the polynucleotides of the subject invention for the induction of an immune response or protective immunity in a subject to which the polypeptides are administered. In this aspect of the invention, compositions containing polypeptide are administered to a subject in amounts sufficient to induce an immune response, and/or induce protective immunity. The composition administered to the subject may, optionally, contain an adjuvant and may be delivered to the subject in any manner known in the art for the delivery of immunogen to a subject. Compositions may be formulated in any carriers, including for example, carriers described in E. W. Martin's Remington's Pharmaceutical Science, Mack Publishing Company, Easton, Pa.
The expression of the BIVM gene or BIVM gene product (e.g., DNA, RNA, or polypeptide) is dysregulated in a variety of cancers, tumors, and/or malignancies. Non-limiting examples of such cancers, tumors, and/or malignancies include prostate cancer, breast cancer, melanoma, chronic myelogenous leukemia, cervical cancer, adenocarcinomas, lymphoblastic leukemia, colorectal cancer, and lung carcinoma. Accordingly, the present invention provides a method for screening, or aiding in the diagnosis of, an individual suspected of having a malignancy or cancer. The subject invention provides methods comprising the steps of determining the amount of BIVM in a biological sample obtained from said individual and comparing the measured amount of BIVM to the amount of BIVM found in the normal population. The presence of a significantly increased amount of BIVM is associated with an indication of a malignancy or cancer. BIVM gene product can be detected by well-known methodologies including, and not limited to, Western blots, enzyme linked immunoassays (ELISAs), radioimmunoassays (RIAs), Northern blots, Southern blots, PCR-based assays, or other assays for the quantification of gene product known to the skilled artisan. This information, in conjunction with other information available to the skilled practitioner, assists in making a diagnosis.
The terms “comprising”, “consisting of” and “consisting essentially of” are defined according to their standard meaning and may be substituted for one another throughout the instant application in order to attach the specific meaning associated with each term.
Following examples illustrate procedures for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.
Human BIVM was identified originally as an EST (IMAGE #785450; GenBank AA449273) that encodes the two short motifs WFRQ (motif 2 [M2]) and YFC (motif 3a [M3a]), which correspond to framework region 2 (FR2) and FR3 of an Ig V domain, respectively (Barclay, A. N., et al. [1997] The Leucocyte Antigen FactsBook, Academic Press, San Diego). The W in M2 and C in M3a correspond to W41 and C104 of the IMGT numbering system. Complete sequencing of this EST, overlapping ESTs (IMAGE #2184889, GenBank AI538125; IMAGE 136117, GenBank R33273; IMAGE 1060823, GenBank AA568610; and IMAGE 785450, GenBank AA449273) and RACE strategies were used to resolve the complete mRNA sequence.
Human BIVM mRNA is 3857 nucleotides and encodes a 503 amino acid protein (FIG. 1). No proteins with significant identities (E<0.01) to BIVM have been identified using BLAST analyses. Searches of current motif databases (BLOCKS, PRINTS, Conserved Domain Database, Domain Architecture Retrieval Tool, Simple Modular Architecture Research Tool) also failed to identify any additional significant motifs within the BIVM protein.
In addition to the shared M2 and M3a motifs, a second V domain FR3 motif, YHC (M3b), is located several residues amino terminal of M3a. Furthermore, a putative FR1 motif (M1), encoding the conserved V domain residues G16 and C23 (IMGT amino acid numbering), was identified by visual inspection of BIVM peptide sequences (FIG. 1).
The 42 amino acids between M1 and M2 in BIVM are inconsistent with the sequence relationship in a V region in which the corresponding motifs would be separated by no more than 12 residues. This increased distance between C23 and C104 of M1 and M3a (or M3b), which normally form a disulfide bridge and stabilize the Ig domain architecture, strongly suggests that BIVM is not a member of the IgSF. Since these peptide motifs are extremely short, it could be argued that their presence in BIVM may be a random occurrence. However, it should be emphasized that in the original search of the EST database, only 17 sequences were identified that encode W(Y/F)R(Q/H) and YFC that are correctly spaced and maintain an open reading frame. Of these 17 sequences, 16 were TCR cDNAs (encoding WYRQ) and one was BIVM (encoding WFRQ) (Hawke, N. A., et al. [1999] “Expanding Our Understanding of Immunoglobulin, T-cell Antigen Receptor, and Novel Immune-Type Receptor Genes: a Subset of the Immunoglobulin Gene Superfamily,” Immunogenetics 50:124-133).
GeneBridge 4 radiation hybrid panel mapping (Gyapay, G., et al. [1996] “A Radiation Hybrid Map of the Human Genome,” Hum Mol Genet 5:339-346) localized BIVM on chromosome 13q32-33 (data not shown). Examination of the publicly available Human Genome Project database revealed the exon-intron structure of BIVM. A 5′ truncated BIVM sequence (hypothetical protein FLJ20159) was initially placed on the publicly available human genome map at 13q14-q21. The 5′ untranslated region of BIVM consists of two separate exons (designated exons A and B), followed by the coding region consisting of nine exons; the exon/intron boundaries are indicated in Table I.
Inspection of genomic sequence localizes BIVM between ERCC5 and “hypothetical protein” MGC5302, a human ortholog of the gene encoding the mouse protein Kdel1/EP58 (Kimata, Y., et al. [2000] “Identification of a Novel Mammalian Endoplasmicreticulum-Resident KDEL Protein Using an EST Database Motif Search,” Gene 261:321-327). A CpG island is located in the 5′ untranslated region of BIVM; the 3′ untranslated region contains an Alu sequence (FIGS. 1 and 2). The Alu polyA sequence in the 3′ untranslated region leads to the spurious production of 3′ truncated cDNAs including many that are represented as ESTs.
Multiple 5′ untranslated region splice variants were observed in analysis of 5′ RACE products. Specifically, exon A has at least 3 splice donor sequences and exon B, which has a poor splice acceptor sequence, can be absent from the mature transcript (FIGS. 1 and 2; Table I). In addition, it is likely that multiple transcriptional start sites are present (FIG. 1).
BIVM orthologs were identified in: mouse, chicken, Xenopus and zebrafish in order to address its potential phylogenetic conservation, as well as to define conserved motifs potentially relevant to function. In addition, a partial sequence for a BIVM ortholog was identified in sea urchin. The identity of the human BIVM protein to these orthologs ranges from 35-87% overall and is consistent with the phylogenetic relationships of the species considered (FIG. 3; see below). The C-terminal region of BIVM shares the highest degree of interspecific sequence identity. The N-terminus of this peptide domain is RK(V/C)LD (SEQ ID NO: 65) and the C-terminus is GGNLHC (SEQ ID NO: 60). This region includes all of the V domain motifs, and is 220 amino acids in human (indicated by arrowheads in FIG. 3).
The corresponding domains in mouse, chicken, Xenopus, zebrafish and sea urchin are 97%, 91%, 91%, 87% and 64% identical to the human domain, respectively. In addition, BIVM ESTs have been identified from an ascidian, sea squirt (Halocynthia roretzi) (e.g., GenBank AV385966), and a BIVM cDNA fragment has been isolated from a protochordate (cephalochordate), lancelet (Branchiostoma floridae), using an RT-PCR strategy (Yoder and Litman, GenBank AF411393). Their sequences within this domain are highly conserved.
Human BIVM maps between EP58/MGC5302 and ERCC5 on 13q. The human EP58 EST (that extends most 5′), places the transcriptional start sites of EP58 and BIVM only 41 bp apart. We identified a mouse BIVM genomic clone (from a ë FixII library), which also encodes the 5′ end of Ep58/Kdel1 (FIG. 4). The mapping position of Ep58/Kdel1 and BIVM in mouse has not yet been determined. The tight physical linkage of the EP58 to BIVM (41 bp in human and 224 bp in mouse) is consistent with a shared regulatory control system that functions in opposite directions (FIG. 4). Notably, both Ep58 and BIVM appear to be ubiquitously expressed (FIG. 5) (Kimata, Y., et al. [2000] “Identification of a Novel Mammalian Endoplasmicreticulum-Resident KDEL Protein Using an EST Database Motif Search,” Gene 261:321-327). Finally, zebrafish BIVM has been mapped to linkage group 6 (LG6); however, its linkage relationship to kdel1 is unknown.
The human BIVM transcript is ˜3.8 kb and appears to be expressed ubiquitously; the highest relative levels of expression are in spleen, ovary, small intestine, colon, peripheral leukocytes and liver (FIG. 5A). Additional RNA dot blot analyses indicate expression of BIVM in human testes, ovary, aorta, appendix, trachea, pituitary gland, bladder, uterus, spinal cord, salivary gland, stomach, mammary gland and bone marrow as well as in several fetal tissues (data not shown). Notably, BIVM expression was not detected in fetal spleen, adult thymus and certain cancer cell lines (e.g., promylocytic leukemia, HL-60, and Burkitt's lymphoma Raji) while significant expression was evident in other lines (e.g., HeLa, S3, and colorectal adenocarcinoma, SW480).
The predominant mouse BIVM transcript also is ˜3.8 kb (FIG. 5B), of which ˜3.3 kb have been sequenced. Comparisons of 5′ mouse BIVM RACE products indicate that the 5′ untranslated region undergoes alternative RNA splicing, which, like in the human gene, does not affect the coding sequences. The highest levels of expression of mouse BIVM are in heart, brain, liver and kidney (FIG. 5B).
A major difference between the expression of human and mouse BIVM is observed in the spleen, in which expression is high in the human but appears to be minimal in the mouse. In the developing mouse embryo, BIVM expression is detected at a uniform level after gastrulation (FIG. 5B). An ˜2.1 kb XBIVM cDNA was identified in Xenopus that is consistent with the length of the predominant transcript observed in RNA blotting (FIG. 5C). The broad, diffuse nature of the principal hybridizing band could reflect sequence heterogeneity. The nature of the larger transcript (˜4.4 kb) is unknown. Northern blot analysis of sea urchin RNA detects two SpBIVM transcripts of ˜7.4 and 8 kb (FIG. 5D), which are notably longer than the human and mouse forms. The additional sequence in these transcripts might be a result of additional 5′ or 3′ untranslated regions and/or could reflect polyadenylation effects. Extended 3′ untranslated regions are encountered frequently with sea urchin mRNA.
Real-time PCR was used to analyze BIVM expression levels throughout development in zebrafish (FIG. 5E). As observed in Xenopus and sea urchin, there is a large maternal store of BIVM transcript in the 1-cell embryo (0 hpf in zebrafish) which appears to be quickly lost after the initial cellular division(s). In zebrafish, the level of BIVM expression drops by ˜90% within the first 6 hours of life (midgastrula stage) and is comparatively undetectable by 12 hpf (post-gastrula stage). Although comparable stages of development were not examined in mouse (see above), it is likely that this early embryonic regulation of BIVM expression will be conserved.
We noted BIVM expression in chicken bursa, which serves as the primary site of B lymphocyte differentiation. BIVM expression in chicken bursa decreases slightly between embryonic day 12 and day 14, increases significantly at day 19, and is the highest in the 4 month old chicken bursa, in which levels are 6-fold greater than observed in embryonic fibroblasts (CEFs; FIG. 5F). Expression of BIVM in other tissues in chicken has not been characterized.
The relatively high predicted pI of BIVM (9.1) suggests that it may bind other proteins and/or DNA (or other nucleic acids). The levels of BIVM produced from the native pBIVM-N2 construct and modified pBIVM-K1 construct (see Methods) were compared in whole cells lysates from transiently transfected Cos7 cells. BIVM levels are higher in cells transfected with the modified pBIVM-K1 (FIG. 6A), which was used in all subsequent transfection experiments. It should be noted that the size of this recombinant protein (with C-terminal epitope tags) is ˜61 KDa, whereas the native protein (without post-translational modifications) is predicted to be ˜57 kDa. The observation that a single protein is generated from this transcript argues that translation does not begin at a more 3′ ATG as suggested by the “hypothetical protein” FLJ20159 GenBank entries (which are predicted to encode a ˜27 kDa protein). Western analysis using antibodies that recognize the V5 peptide sequence indicate that the epitope-tagged BIVM is present both in cytoplasmic and nuclear fractions (FIG. 6B). These results were confirmed by direct immunohistochemical localization of BIVM in the cytoplasm and nucleus (FIG. 6C-J). Variation in the relative amounts of BIVM in the nucleus was observed in individual cells. Thus, it is possible that the BIVM protein enters and exits the nucleus in a regulated or cell-cycle-dependent manner.
A tBLASTn search identified a BIVM-like gene (named BIVML) in the genome of the primitive protozoan parasite, Giardia lamblia (McArthur, A. G., et al. [2000] “The Giardia Genome Project Database,” FEMS Microbiol Lett 189:271-273). The 2045 nucleotide BIVML cDNA is predicted to encode a 270 amino acid protein (predicted MW ˜30 kDa; Pi=7.56) with no predicted signal peptide, membrane spanning regions or nuclear localization signal; thus, it is likely to be cytosolic. BIVML contains 17 cysteine residues (6.2%) throughout the protein (FIG. 7A). Known giardial proteins that are secreted to the trophozite surface or the cyst wall are also highly cysteine rich. This sequence is 22-25% identical and 46-49% similar to the carboxyl-terminal region of all deuterostome BIVM peptides described here, correlates directly with the conserved domain described above, and includes the M2 and M3b motifs (FIG. 7B). Northern analysis detects an ˜2.0 kb BIVML transcript as well as a larger transcript of unknown identity in both vegetatively growing and encysting cells (FIG. 7C).
BIVML is unusual in having long untranslated regions consistent with the size of the transcript. The 5′ and 3′ untranslated regions were determined by RACE and are 229 nucleotides and 983 nucleotides, respectively (FIG. 7A), most transcripts of giardial chromosomal genes characterized to date have very short (<20 nucleotides) untranslated regions, although exceptions are being noted.
The identification of a BIVM ortholog in such an early branching eukaryote was unexpected since tBLASTn searches of the currently available S. cerevisiae and Drosophila as well as S. pombe and C. elegans genome databases failed to identify any sequences exhibiting significant identity to BIVM. Furthermore, it has not been possible to identify BIVM-like sequences in the complete genomes of Campylobacter jejuni (Parkhill, J., et al. [2000] “Complete DNA Sequence of a Serogroup A Strain of Neisseria Meningitidis Z2491,” Nature 404:502-506), Mycobacterium leprae (Cole, S. T., et al. [2001] “Massive Gene Decay in the Leprosy Bacillus,” Nature 409:1007-11), Mycobacterium tuberculosis (Cole, S. T., et al. [1998] “Deciphering the Biology of Mycobacterium Tuberculosis from the Complete Genome Sequence,” Nature 393:537-544), or Neisseria menigitidis (Parkhill, J., et al. [2000] “The Genome Sequence of the Food-Borne Pathogen Campylobacter Jejuni Reveals Hypervariable Sequences,” Nature 403:665-668). In DNA hybridization studies, a Giardia BIVML probe failed to cross-hybridize to Trichomonas foetus, Trichomonas vaginalis or Entamoeba histolytica genomic DNA (data not shown).
The identification of a BIVM-like gene in the Giardia genome, but not in other similar proteostome genomes, taken together with the fact that Giardia is parasitic, suggests that BIVML may have been acquired via horizontal gene transfer from a higher eukaryotic host.
The transcriptional start site of the human EP58/MGC5302 sequence (GenBank XM—015844) is only 41 bp from that of BIVM: BIVM and EP58 genes are in a head-to-head orientation, in opposite transcriptional orientation. The mouse EP58/Kdel1 and BIVM genes share the same physical orientation separated by 224 bp. This exceedingly tight physical linkage and close spacing of BIVM and EP58 suggests that common regulatory elements located in or near the intergenic region potentially control the expression of both genes. RT-PCR analysis of extracts from BIVM expressing and non-expressing human cell lines indicated that EP58/MGC5302 was expressed in all cell lines that express BIVM but not in the BIVM non-expressing cell line, Raji (FIG. 8). Based on these results, it is possible that these genes are co-regulated and that the transacting factors associated with the 41 bp intergenic region linking these genes control their expression.
A MatInspector V2.2 search for potential binding sites contained in the 41 bp region separating the BIVM and EP58/MGC5302 genes revealed sites for cell type specific factors such as the myeloid zinc finger-1 (MZF-1), the hematopoietic-expressed Ikaros-2 (IK2) factor, and the ubiquitously expressed transcription factors NF1, USF, NFκB, and NMYC (FIG. 9). Nearly identical sites also were predicted for the mouse 224 bp Bivm-Kdel1 intergenic region. MZF-1 and IK2 are expressed in the K562 human erythroleukemia cell line and IK2 is expressed in the Raji Burkitt's lymphoma cell line. Based on this information, electrophoretic mobility shift assays (EMSAs) were performed to compare protein binding to the 41 bp region in nuclear extracts from BIVM expressing and non-expressing cells (FIG. 10).
MZF-1 and IK2-specific binding would be expected to produce unique bands in the K562 and Raji nuclear extracts that are not observed in nuclear extracts from non-lymphoid cell lines. In addition, an NFκB consensus sequence was used as probe and competitor (Santa Cruz Biotechnology) to detect bands representing NFκB-specific binding that may be constitutively present in the nuclear extracts (FIG. 10). Significant DNA binding activity was observed with the 41 bp BIVM-specific probe in all extracts assayed, producing 1 minor band and two major bands (FIG. 10; Lanes 4-10), one of which was competed by the addition of cold NFκB-specific probe, indicating that NFκB complexes may be present (FIG. 10; Lane 3). One major band was detected with the NFκB consensus probe in the nuclear extracts from BIVM expressing lines (FIG. 10; Lanes 13-17) that was competed by the BIVM-specific probe (FIG. 10; Lane 11). An additional complex also was observed bound to the NFκB-specific probe in the extracts from a BIVM non-expressing line (FIG. 10; Lane 18). Together these results show that the 41 bp BIVM-EP58/MGC5302 intergenic region supports DNA binding activity and that the bound complexes include factors that also bind the NFκB consensus probe. Similar DNA binding activity was observed in the BIVM non-expressing Raji cell line as in the BIVM expressing cells and may result from constitutive nuclear NFκB factors and suggests either that additional flanking regions function in BIVM gene regulation or that protein co-factors or other mechanisms, such as methylation-dependent promoter silencing, could play a role in BIVM expression. The presence of a CpG island 5′ of the BIVM gene, together with the lack of both BIVM and EP581MGC5302 expression in the Raji cell lines, supports the latter hypothesis.
As described above, the 41 bp intergenic region contains putative sites for ubiquitous transacting factors and an NFκB site that appears to be bound by NFκB complexes containing c-Rel and RelB factors, which are constitutively present in the nuclear extracts from the BIVM expressing K562 cell line (FIG. 1). NFκB comprises a large family of transcription factors, most of which are sequestered in the cytoplasm through inhibitor binding. Activation of the cell by various agents, such as the proinflammatory cytokine TNF-a, leads to phosphorylation-induced degradation of the inhibitor and nuclear translocation of additional NFκB transacting factors. Although constitutive factors may drive basal BIVM expression, TNF-α activated NFκB increases the expression of BIVM in the BIVM-expressing HeLa cell line (DNS). Furthermore, a cell line devoid of basal BIVM expression, the Raji Burkitt's lymphoma line, is induced to express BIVM by TNF-a (FIG. 12). The specific TNF-a activated factors associated with the BIVM promoter can be defined using antibody shift assays.
The BIVM encoded protein has a high proportion of lysine and arginine residues and a predicted isoelectric point (pI) of 9.1. The net positive charge under physiological conditions suggests that BIVM may interact with other proteins and/or DNA. Western blot analysis and cytoimmunofluorescence studies utilizing transfected, epitope-tagged BIVM expression constructs revealed that BIVM is present in both cytoplasmic and nuclear fractions. Variation in the relative amounts of nuclear recombinant BIVM was observed in individual cells and may reflect regulated or cell cycle-dependent BIVM nuclear import/export. The Cos7 cells that have been transformed stably with BIVM exhibit a decreased cell doubling time compared to untransformed Cos7 cells, suggesting the potential role for BIVM in cell cycle regulation. Furthermore, preliminary studies of Cos7 BIVM stable transformants stained with a nuclear stain (DAPI) reveal a high proportion of cells containing multiple nuclei compared to untransformed cells. Flow cytometer analyses of these cells stained with propidium iodide indicate that ˜90% of the cells contain tetraploid or greater DNA content, consistent with the presence of multiple nuclei (FIG. 13; Panel 3). This phenomenon was not observed in a G418-resistant, BIVM-revertant cell line, which has lost expression of recombinant BIVM and exhibits both a nuclear morphology and a diploid DNA content similar to that of the untransformed parental line (FIG. 13; Panels 1 & 2).
The high proportion of lysine and arginine residues and the net charge of the protein (pI 9.1) suggest that BIVM may interact with proteins and/or DNA (or other nucleosides). Specifically, protein-protein interactions are being assayed using the BacterioMatch two hybrid system (Stratagene). This system provides a rapid, selective approach to identify BIVM-specific protein interactions in vivo. Mouse Bivm has been utilized initially as we can take advantage of mouse cDNA libraries that are commercially available for this system (Stratagene) and because the results obtained can be used to complement concurrent BIVM knock out mice studies now underway in our laboratory. Although it is possible that BIVM may function differently in human and mouse, the 87% sequence conservation between human and mouse BIVM protein, strong synteny in BIVM flanking genes, and the tight physical linkage observed between the BIVM and EP58 genes, is consistent with functional equivalence.
RNA was isolated with RNAzol B (Teltest, Friendswood, Tex.) or Trizol (Gibco BRL, Rockville, Md.). Mouse genomic DNA (ë FixII) and liver cDNA (ë ZAPII) libraries were screened using standard procedures (Strong, S. J., et al. [1999] “A Novel Multigene Family Encodes Diversified Variable Regions,” Proc Natl Acad Sci USA 96:15080-15085). DNA sequencing and the analysis of DNA sequences were carried out as described previously (Rast, J. P. et al. [1994] “T Cell Receptor Gene Homologs are Present in the Most Primitive Jawed Vertebrates,” Proc. Natl Acad. Sci. USA 91:9248-9252). Alignments were constructed using ClustalW 1.8. Identity relationships were examined using BLAST and ALIGN software. Rapid amplification of cDNA ends (RACE) utilized a standard protocol (Mertineit, C., et al. [1998] “Sex-Specific Exons Control DNA Methyltransferase in Mammalian Germ Cells,” Development 125:889-897) or the GeneRacer kit (Invitrogen, Carlsbad, Calif.). The RNA sources for RACE were: human HeLa cells, mouse liver, chicken bursa, Xenopus laevis liver, zebrafish (Danio rerio) liver, 15 hpf sea urchin (Strongylocentotus purpuratus) embryos, and vegetative-stage Giardia lamblia.
Human BIVM was mapped using HSMAP5 (CCATGCCTCTCTACTACTCACTCCCAACAC) (SEQ ID NO: 51) and HSMAP6 (GGTAAGAAGAACACCATTGTGTTTGAAGGC) (SEQ ID NO: 52) intronic primers (which correspond to sequence between exon 8 and 9) and the GeneBridge 4 radiation hybrid (RH) panel (Gyapay, G., et al. [1996] “A Radiation Hybrid Map of the Human Genome,” Hum Mol Genet 5:339-346) (Research Genetics, Huntsville, Ala.). Zebrafish BIVM (see below) was mapped using the zfBIVMMAPF1 (CAATGCCTAACACTGTGGAAAGTGAAGGCG) (SEQ ID NO: 53) and zfBIVMMAPR1 (GATAACTGTCGAGCTCGGTTGAGCAGGGC) (SEQ ID NO: 54) primers and the T51 RH panel (Glusman, G., et al. [1996] “Sequence Analysis in the Olfactory Receptor Gene Cluster on Human Chromosome 17: Recombinatorial Events Affecting Receptor Diversity,” Genomics 37:147-160) (Research Genetics). Additional gene mapping data were derived from the Human-Mouse Homology Map and the Mouse Genome Informatics Database (Blake, J. A., et al. and Mouse Genome Database Group [2001] “The Mouse Genome Database (MGD): Integration Nexus for the Laboratory Mouse,” Nucleic Acids Res 29:91-94).
Mouse BIVM Partial sequence of the mouse BIVM gene was obtained by screening a mouse genomic library with a human BIVM cDNA probe. A mouse BIVM cDNA was recovered by screening a liver cDNA library with a probe corresponding to mouse exon 6.
Chicken BIVM tBLASTn searches using the human BIVM sequence identified a chicken (Gallus gallus) bursal EST (GenBank AJ399198) encoding an avian ortholog (BIVM). RACE strategies identified a complete open reading frame cDNA. A single RNA-splicing variant, which encodes an additional 23 amino acids, also has been sequenced (GenBank AF411388; data not shown).
Xenopus XBIVM Partial Xenopus laevis XBIVM sequence was identified as an oocyte EST (GenBank BF047666) using tBLASTn searches with the human BIVM sequence. RACE strategies resolved a complete open reading frame cDNA.
Zebrafish BIVM Touchdown PCR (Don, R. H., et al. [1991] “‘Touchdown’ PCR to Circumvent Spurious Priming During Gene Amplification,” Nucleic Acids Res 19:4008) and nested degenerate primers, designed with CODE-HOP software (Rose, T. M., et al. [1998] “Consensus-Degenerate Hybrid Oligonucleotide Primers for Amplification of Distantly Related Sequences,” Nucleic Acids Res 26:1628-35), were used to amplify BIVM cDNA fragments from zebrafish liver. Primers for the primary PCR were designed to amplify the coding sequence between the amino acid motifs GNTTLMWRF and YFCPIGFEA; primers for the nested PCR were designed to amplify the sequence between motifs WFRQINDHF and YRHQNHYFCP. PCR products of the expected size were gel purified, cloned and sequenced. Full-length clones were derived by RACE.
Sea urchin SpBIVM A fragment of the sea urchin SpBIVM cDNA was recovered from 20 hpf embryo cDNA using nested PCR as described for zebrafish. RACE strategies identified a 1,899 nucleotide coding region that corresponds to the complete open reading frame of BIVM from other species; as of yet it has not been possible to identify a stop codon.
Giardia lamblia BIVM-like The Giardia lamblia BIVML sequence was initially identified with a tBLASTn search of the High Throughput Genomic (HTGS) database with the human BIVM sequence. BIVML is encoded in four overlapping genomic clones (clone KJ1556, GenBank #AC049185; clone MJ4898, GenBank AC083097; clone EJ2770, GenBank #AC038625; and clone KI0613, GenBank #AC046875). RACE was used to identify the complete, 2,045 nucleotide cDNA.
The coding region of human BIVM was cloned into pcDNA3.1/V5-His TOPO (Invitrogen) in order to generate pBIVM-N2, which encodes a BIVM-V5 fusion protein (the VS epitope is at the C terminus). A similar construct, pBIVM-K1, was generated in which the translational start sequence was modified in order to increase protein synthesis, as described in Kozak, M. [1996], “Interpreting cDNA Sequences: Some Insights from Studies on Translation,” Mamm. Genome 7:563-574. Both of these constructs were then subcloned into pIRES2-EGFP (Clontech, Palo Alto, Calif.) to create pBIVM-N2/EGFP and pBIVM-K1/EGFP, which produced recombinant BIVM and EGFP from the same plasmid. Cos7 cells (˜60% confluent) were transiently transfected with expression constructs using the GENEJAMMER™ transfection reagent according to manufacturer's instructions (Stratagene, La Jolla, Calif.).
Whole cell lysates were prepared from transfected cells in the presence of 1× Protease Inhibitor Cocktail Set III (Calbiochem, San Diego, Calif.) essentially as recommended by Santa Cruz Biotechnology. Nuclear and cytoplasmic extracts were prepared from transfected cells essentially as described in Yu, C. L., et al. [1995] “Enhanced DNA-Binding Activity of a Stat3-Related Protein in Cells Transformed by the Src Onco Protein,” Science 269:81-83. Protein concentrations were determined using Protein Assay Reagent (Bio-Rad, Hercules, Calif.). Whole cell, nuclear, and cytoplasmic extracts were separated by SDS-polyacrylamide gel electrophoresis (10% polyacrylamide), transferred to Immobilon P filters (Millipore, Bedford, Mass.) and blocked prior to incubation with mouse anti-V5 monoclonal antibody (Invitrogen), anti-OCT1 polyclonal antibody (Santa Cruz) or anti-HSP90 monoclonal antibody (StressGen Biotechnologies Corp, Victoria, BC, Canada). Following incubation with alkaline phosphatase-conjugated secondary antibodies, reactive proteins were detected using Western Blue Stabilizer Substrate (Promega, Madison, Wis.).
Transfected Cos7 cells were fixed for 15 minutes with 3% paraformaldehyde, permeabilized in 1% Triton-X 100, incubated with primary antibodies, washed and incubated with secondary antibodies and 2 μg/ml Hoechst 33258. Primary antibodies included a mouse anti-V5 monoclonal antibody and an anti-actin polyclonal antibody (ICN Pharmaceuticals, Inc., Costa Mesa, Calif.) that were detected with a Cy2-conjugated, anti-mouse antibody (Jackson Immuno Research Laboratories, West Grove, Pa.) and a Cy3-conjugated, anti-rabbit antibody (Sigma, St. Louis, Mo.), respectively.
Multiple Tissue Northern (MTN™) blots (human and mouse) were obtained from Clontech. In addition, 10 μg of Xenopus, sea urchin and Giardia lamblia total RNA were subjected to electrophoresis through 1.2% agarose, 2.2 M formaldehyde gels and transfer to nylon membranes (Zetaprobe™-GT; BioRad). RNA blots were hybridized with radiolabeled probes in Expresshyb™ (Clontech). The Giardia RNA blot was hybridized with single strand-specific probes as described in Knodler, L. A., et al. [1999] “Developmental Gene Regulation in Giardia Lamblia: First Evidence for an Encystation-Specific Promoter and Differential 5′ mRNA Processing,” Mol Microbiol 2:327-340. Blots were stripped and reprobed with actin, 18S rRNA or Calmodulin probes.
Real time PCR analysis detected BIVM expression from chicken bursa and zebrafish embryos and tissues using a GeneAmp 5700 Sequence Detection System (PE Biosystems, Foster City, Calif.) with SYBR Green detection. Each PCR series was done in triplicate. The relative expression levels were determined for each transcript from plasmid standards that were included in each experiment and normalized to the expression of S17 rRNA (chicken bursa) or S26 rRNA (zebrafish) levels.
All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.
It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application.
1. A method of inducing an immune response in an individual comprising administering a composition comprising a carrier and a polypeptide comprising SEQ ID NO: 2 or a biologically active fragment of SEQ ID NO: 2 to an individual in an amount sufficient to induce an immune response.
2. The method according to claim 1, wherein said biologically active fragment comprises at least five consecutive amino acids of SEQ ID NO: 2 fused to a heterologous protein sequence.
3. The method according to claim 1, wherein said biologically active fragment comprises at least ten consecutive amino acids of SEQ ID NO: 2 fused to a heterologous protein sequence.
4. The method according to claim 1, wherein said biologically active fragment comprises at least fifteen consecutive amino acids of SEQ ID NO: 2 fused to a heterologous protein sequence.
5. The method according to claim 1, wherein said composition comprises SEQ ID NO: 2 and a carrier.
6. The method according to claim 1, wherein said biologically active fragment comprises at least twenty consecutive amino acids of SEQ ID NO: 2 fused to a heterologous protein sequence.
7. The method according to claim 1, wherein said biologically active fragment comprises at least twenty-five consecutive amino acids of SEQ ID NO: 2 fused to a heterologous protein sequence.
8. The method according to claim 1, wherein said biologically active fragment comprises at least thirty consecutive amino acids of SEQ ID NO: 2 fused to a heterologous protein sequence.
9. An isolated polypeptide comprising SEQ ID NO: 2 or a biologically active fragment thereof, said biologically active fragment comprising at least five consecutive amino acids of SEQ ID NO: 2 fused to a heterologous protein sequence.
10. The isolated polypeptide according to claim 9, wherein said biologically active fragment comprises at least ten consecutive amino acids of SEQ ID NO: 2 fused to a heterologous protein sequence.
11. The isolated polypeptide according to claim 9, wherein said biologically active fragment comprises at least fifteen consecutive amino acids of SEQ ID NO: 2 fused to a heterologous protein sequence.
12. A composition comprising a carrier and a polypeptide according to claim 9.
13. An isolated antibody that specifically binds to SEQ ID NO: 2.
14. A composition comprising a carrier and an antibody according to claim 13.