Patent application title:

METHODS FOR DETECTING A CYCLOPHILIN B SNP ASSOCIATED WITH HERDA

Publication number:

US20090325182A1

Publication date:
Application number:

12/550,158

Filed date:

2009-08-28

Abstract:

This invention provides compositions and methods for identification of carriers of Hereditary Equine Regional Dermal Asthenia (HERDA) in equine species. In particular, this invention identifies a single nucleotide polymorphorism (SNP) in cyclophlin B that can be used to identify carriers of HERDA and individuals affected by HERDA.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N9/90 »  CPC main

Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes Isomerases (5.)

C12Q1/6883 »  CPC further

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material

C12Q2600/156 »  CPC further

Oligonucleotides characterized by their use Polymorphic or mutational markers

C12Q2600/16 »  CPC further

Oligonucleotides characterized by their use Primer sets for multiplex assays

C12Q2600/172 »  CPC further

Oligonucleotides characterized by their use Haplotypes

C12Q1/68 IPC

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids

C07H21/00 IPC

Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids

C07K2/00 IPC

Peptides of undefined number of amino acids; Derivatives thereof

C12N15/74 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora

C12Y502/01008 »  CPC further

Cis-trans-Isomerases (5.2.1) Peptidylprolyl isomerase (5.2.1.8), i.e. cyclophilin

Description

CROSS-REFERENCES TO RELATED APPLICATIONS

This application is a divisional application of U.S. application Ser. No. 11/787,611, filed Apr. 16, 2007 which claims the benefit of U.S. Provisional Patent Application No. 60/826,038, filed Sep. 18, 2006, the disclosure of which is hereby incorporated by reference in its entirety for all purposes.

STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT

Not applicable.

BACKGROUND OF THE INVENTION

Hereditary equine regional dermal asthenia (HERDA) is an inherited skin disease predominantly found in the American Quarter Horse. The classic phenotype of velvety hyperextensible skin, accompanied with seromas and hematomas particularly along the dorsal aspect, does not normally present until sometime after 6 months of age, often as old as two years when the horse is first being broke to saddle. The inability to treat the disease most commonly results in euthanasia of the affected horse. While there have been relatively few HERDA (historically, also referred to as hyperelastosis cutis) cases reported throughout the past thirty years, an increase in the incidence of HERDA cases being seen by veterinary dermatologists occurred in the late 1990's.

Pedigree analysis suggests an autosomal recessive mode of inheritance, with a common ancestor that can be traced back via both the paternal and maternal lines in all HERDA cases with complete pedigrees. Heritability analysis corroborated those conclusions drawn from pedigree analysis and calculated increased inbreeding coefficient values for HERDA horses relative to a random sampling of American Quarter Horses [Tryon et al., Am J Vet Res., 66(3): p. 437-42 (2005)]. Analysis of sire records of stallions known to produce offspring with HERDA estimated a carrier frequency of 2-6% in the sub-population of mares being bred to those horses.

The HERDA phenotype shares similarities with clinical diagnoses seen in humans and animals, yet specific features of the disease pathology suggest it may have a unique genetic basis. Ehlers-Danlos Syndrome (EDS) is a heterogenic disorder that can take a variety of forms in humans, but a universal characteristic of the condition is fragile hyperextensible skin that can be more easily subject to bruising and tearing [Mao, J. R. and J. Bristow, J Clin Invest, 107(9): p. 1063-9 (2001)]. Many forms of EDS affect skin regardless of the location on the body and do not require a trigger event to display the phenotype. The common thread to the variety of genes in which mutations have been associated with EDS is the fibril collagens. The majority of cases displaying the gross EDS phenotype are caused by defects in the collagen genes themselves (COL1A1, COL3A1, COL5A, COL5A2) or in the enzymes which process (ADAMTS2, PLOD) or interact (TNXB) with collagens.

In contrast, HERDA foals rarely show indications of the disease at birth and areas which develop lesions are non-uniformly distributed over the body. Many cases of HERDA are not identified until the horses begin to train with a saddle, and lesions are most commonly found along the dorsal aspect, coincident with where the saddle would rest. Histological examination of HERDA tissue could not definitively diagnose the disease, although subtle signs of thinned and shortened collagen fibers in the deep dermis suggest a general disorganization in affected individuals [White et al., Vet Dermatol, 15(4): p. 207-17 (2004)]. Collagen 1 and collagen 3 content were indistinguishable between HERDA samples and unaffected controls [White et al., Vet Dermatol, 15(4): p. 207-17 (2004)].

Thus, there is a need in the art for compositions and methods for accurately identifying equines that are HERDA carriers as well as for diagnosing whether an equine is afflicted with HERDA. The present invention meets these and other needs.

BRIEF SUMMARY OF THE INVENTION

The present invention provides compositions and methods for detecting a single nucleotide polymorphism (SNP) associated with hereditary equine regional dermal asthenia (HERDA).

One embodiment of the invention provides methods for detecting a single nucleotide polymorphism (SNP) associated with hereditary equine regional dermal asthenia (HERDA) phenotype in an equine. The methods comprise detecting a nucleic acid sequence comprising position 115 of a nucleic acid encoding cyclophilin B (PPIB) in a biological sample from the equine, wherein the presence of a single copy of a G to A substitution at position 115 of the nucleic acid encoding PPIB indicates that the equine is a carrier for the SNP associated with HERDA and the presence of two copies of a G to A substitution at position 115 of the nucleic acid encoding PPIB indicates that the animal is affected with HERDA. In some embodiments, the equine is a domesticated equine (e.g., of the genus and subgenus Equus). In some embodiments, the nucleic acid is detected by (a) specifically amplifying a nucleic acid sequence comprising position 115 of a polynucleotide encoding PPIB, thereby amplifying nucleic acids comprising the SNP associated with HERDA; and (b) detecting the amplified nucleic acids, thereby detecting the SNP associated with HERDA. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO:2. In some embodiments, the nucleic acid sequence is specifically amplified using primers comprising the sequences set forth in SEQ ID NOS: 4 and 5. In some embodiments, the SNP is detected by sequencing the amplified nucleic acids. In some embodiments, the SNP is detected by contacting the amplified nucleic acids with EarI.

Another embodiment of the invention provides a kit for detecting a SNP associated with HERDA comprising: (a) an isolated polynucleotide comprising position 115 of a polynucleotide encoding PPIB; and (b) primers that specifically amplify the nucleic acid. In some embodiments, the nucleic acid sequence comprises SEQ ID NOS:1, 2, 3 or a complement or subsequence thereof. In some embodiments, the primers comprise the sequences set forth in SEQ ID NOS:4 and 5. In some embodiments, the kit further comprises the restriction enzyme EarI.

Yet another embodiment of the invention comprises an isolated polynucleotide comprising the sequence set forth in SEQ ID NO:2 or a complement or a subsequence thereof. The invention also provides polypeptide encoded by the isolated polynucleotide, expression vectors comprising the polynucleotide operably linked to an expression control sequence, and host cells comprising the expression vectors. The invention further provides an isolated polynucleotide capable of distinguishing between the sequence provided in SEQ ID NO: 2, or a complement thereof and a nucleic acid encoding a wild type PPIB protein.

A further embodiment of the invention provides an isolated nucleic acid sequence comprising a sequence set forth in Tables 1 and 7.

These and other embodiments of the invention are further described by the detailed description that follows.

BRIEF DESCRIPTION OF THE DRAWINGS AND TABLES

FIG. 1 illustrates a comparison of expected heterozygosity values between populations.

FIG. 2 illustrates (A) the pedigree of families used to confirm the location of the HERDA locus; (B) ECA1 analysis confirming the location of the HERDA locus.

FIG. 3 illustrates the establishment of a minimum critical interval (i.e., fine structure mapping) used to identify PPIB*HRD.

FIG. 4 illustrates (A) the genomic region corresponding to SEQ ID NO: 1; (B) the structure of equine PPIB cDNA.

FIG. 5 illustrates (A) the direct sequence of SNP2 in equine cyclophilin B; (B) an assay of SNP2 in equine cyclophilin B.

FIG. 6 illustrates a protein sequence alignment of the first 100 residues of PPIB from a HERDA-affected horse, a normal horse, five mammals and three non-mammalian vertebrates. The two mutations detected in HERDA-affected horses are indicated with an asterisk.

Table 1 sets forth informative SNPs for reducing the critical interval surrounding the HERDA locus.

Table 2 summarizes results from a χ2 test of differences in allele frequencies between a sample of HERDA-affected horses and age-matched unaffected Quarter Horses

Table 3 summarizes results from the PPIB SNP2 genotypes in tested animals.

Table 4 sets forth the primer concentrations and annealing temperatures for the genome scan multiplex reactions described in Example 1 below.

Table 5 primer concentrations and annealing temperatures for the fine structure mapping reactions described in Examples 1 and 3 below.

Table 6 sets forth the top BLAST results for equine microsatellites to human genomic DNA.

Table 7 sets forth sequences for equine PPIB primers.

BRIEF DESCRIPTION OF SEQUENCES

SEQ ID NO: 1 is the wild type genomic sequence containing the equine PPIB locus. Introns are presented in lower case and exons are presented in upper case. Positions +1, +2, and +3 (i.e., encoding the Met start codon) are indicated in bold and underlined, position +17 is indicated in bold, position +115 is indicated in bold; primer sequences that can be used to amplify a subsequence of SEQ ID NO:1 comprising position +115 are underlined.

SEQ ID NO: 2 is the HERDA PPIB cDNA coding sequence. Positions 17 and 115 are indicated in bold.

SEQ ID NO: 3 is the wild type PPIB cDNA coding sequence. Positions 17 and 115 are indicated in bold.

SEQ ID NO: 4 is the sequence of a PCR forward primer used to amplify a region of DNA containing SNP2 (i.e., PPIB*HRD).

SEQ ID NO: 5 is the sequence of a PCR reverse primer used to amplify a region of DNA containing SNP2 (i.e., PPIB*HRD).

DETAILED DESCRIPTION OF THE INVENTION

I. Introduction

The present invention provides compositions and methods for the detection of Hereditary Equine Regional Dermal Asthenia (HERDA) in equine species based on the detection of a single nucleotide polymorphorism (SNP) in the cyclophilin B (PPIB) gene that can be used as a marker to identify HERDA carriers and HERDA-affected individuals. The invention is based on identification of a SNP causatively associated with HERDA, i.e., a G→A substitution at position 115 of the cDNA encoding cyclophilin B (i.e., PPIB) gene.

A unique strategy was used to map the HERDA locus which exploited the dataset available, one which consisted of many HERDA-affected horses but few relatives and only a single complete full-sib family which segregated for the trait. A genome scan to identify areas of homozygosity common to HERDA-affected HERDA horses was carried out with the goal of roughly mapping the disease locus. Microsatellites were used to verify that the HERDA locus could be found on the q arm of ECA1, in close proximity to the marker AHT58. Single nucleotide polymorphisms (SNPs) were discovered in genes predicted to lie within a ˜20 MB interval surrounding AHT58 and allowed the further reduction of the critical interval to ˜2.3 MB, which is predicted to contain 20 known genes based on the comparative genomics of sequenced mammals to date (human, mouse, dog, and cow). These analyses identified, inter alia, a PPIB allele (i.e., PPIB*HRD) comprising a single nucleotide polymorphism (SNP) that is found in perfect association with the HERDA phenotype (i.e., is the causative SNP). The PPIB*HRD SNP is located at position +115 of SEQ ID NO:1 (i.e., a genomic sequence encoding PPIB) and position 115 of SEQ ID NO:2 (i.e., a cDNA sequence encoding PPIB) and is predicted to cause a glycine to arginine missense mutation at position 39 of the encoded polypeptide.

The PPIB*HRD allele can conveniently be used to determine whether a horse exhibiting skin irregularities is HERDA-affected or is a HERDA carrier. For example, when a young horse begins to show skin irregularities, the methods described herein can be used to determine whether or not the horse is HERDA-affected and prevent a potentially unnecessary euthanasia. The methods of the invention can also be used to identify HERDA carriers within the breeding population and minimize the production of HERDA-affected horses.

II. Definitions

Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry and nucleic acid chemistry and hybridization described below are those well known and commonly employed in the art. Standard techniques are used for nucleic acid and peptide synthesis. Generally, enzymatic reactions and purification steps are performed according to the manufacturer's specifications. The techniques and procedures are generally performed according to conventional methods in the art and various general references (see generally, Sambrook et al. MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), which are provided throughout this document. The nomenclature used herein and the laboratory procedures in analytical chemistry, and organic synthetic described below are those well known and commonly employed in the art. Standard techniques, or modifications thereof, are used for chemical syntheses and chemical analyses.

“Equine” as used herein refers to domesticated and wild horses, ponies, burros, and donkeys (e.g., of the Genus Equus, including, for example, Equus Equus caballus, Equus Equus przewalskii, Equus Asinus africanus, Equus Asinus hemionus, Equus Hippotigris burchelli, Equus Hippotigris zebra, and Equus Dolichohippus grevyi). Horses include any known breed of horse, including, for example, American Quarter Horses, Arabians, Palominos, American Paint Horses, American Wild Horses, Appaloosas, Morgans, Mustangs, Australian Stock Horses, Barbs, Miniature Horses, Thoroughbreds, ponies such as Quarter Ponies, Shetland Ponies, Chincoteague Ponies, and Connemara Ponies, and draft horses such as Clydesdales, American Creams, Belgians, Percherons, Shires, and Suffolks.

“PPIB,” “peptidylprolyl isomerase B” and “cyclophilin B” as used herein refers to a member of the peptidyl-prolyl isomerase (PPI) gene family. This family of genes is implicated in protein folding, immune response via its binding of cyclosporine A, and T cell activation. PPIs have been implicated in protein folding of collagens via their cis-trans peptidyl-prolyl isomerase function (see, e.g., Bachinger, J Biol Chem 262: 17144-8 (1987); Smith et al., J. Biol. Chem. 270: 18323-8 (1995); and Steinmann et al., J. Biol. Chem. 266: 1299-303 (1991)). PPIB refers to nucleic acids and polypeptide polymorphic variants (including single nucleotide polymorphisms involving displacement, insertion, or deletion of a single nucleotide that may or may not lead to a change in an encoded polypeptide sequence), alleles, mutants, and interspecies homologs that: (1) have an amino acid sequence that has greater than about 60% amino acid sequence identity, 65%, 70%, 75%, 80%, 85%, 90%, preferably 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or greater amino acid sequence identity, preferably over a region of over a region of at least about 25, 50, 100, 200, 500, 1000, or more amino acids, to an amino acid sequence encoded by a PPIB nucleic acid (for an equine PPIB nucleic acid sequence, see, e.g., SEQ ID NOS: 1, 2, and 3 and Genbank Accession No. EF397503); (2) bind to antibodies, e.g., polyclonal antibodies, raised against an immunogen comprising an amino acid sequence of a PPIB polypeptide (e.g., encoded by SEQ ID NOS: 1, 2, or 3), and conservatively modified variants thereof, (3) specifically hybridize under stringent hybridization conditions to an anti-sense strand corresponding to a nucleic acid sequence encoding a PPIB protein, and conservatively modified variants thereof; (4) have a nucleic acid sequence that has greater than about 95%, preferably greater than about 96%, 97%, 98%, 99%, or higher nucleotide sequence identity, preferably over a region of at least about 25, 50, 100, 200, 500, 1000, or more nucleotides, to a PPIB nucleic acid. PPIB nucleic acids include polynucleotides comprising the PPIB SNP causatively associated with HERDA (i.e., PPIB*HRD) as well as polynucleotides comprising PPIB SNPs not causatively associated with HERDA (e.g., PPIB*1). Positions within the PPIB nucleic acids are counted from the adenosine nucleotide of the ATG start codon. A polynucleotide or polypeptide sequence is typically from a mammal including, but not limited to, domesticated equines and wild equines. The nucleic acids and proteins of the invention include both naturally occurring or recombinant molecules.

The terms “nucleic acid” and “polynucleotide” are used interchangeably herein to refer to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form. The term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs).

Unless otherwise indicated, a particular nucleic acid sequence also encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)). The term nucleic acid is used interchangeably with gene, cDNA, mRNA, oligonucleotide, and polynucleotide.

A nucleic acid “capable of distinguishing” as used herein refers to a polynucleotide(s) that (1) specifically hybridizes under stringent hybridization conditions to an anti-sense strand corresponding to a nucleic acid sequence encoding a PPIB protein, and conservatively modified variants thereof, or (2) has a nucleic acid sequence that has greater than about 80%, 85%, 90%, 95%, preferably greater than about 96%, 97%, 98%, 99%, or higher nucleotide sequence identity, preferably over a region of at least about 25, 50, 100, 200, 500, 1000, or more nucleotides, to a PPIB nucleic acid (e.g., a sequence as set forth in SEQ ID NOS: 1, 2, 3 or complement or a subsequence thereof, including, e.g., a subsequence comprising position 115 of SEQ ID NOS 2 or 3 or position +115 of SEQ ID NO:1).

The phrase “stringent hybridization conditions” refers to conditions under which a probe will hybridize to its target subsequence, typically in a complex mixture of nucleic acid, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Probes, “Overview of principles of hybridization and the strategy of nucleic acid assays” (1993). Generally, stringent conditions are selected to be about 5-10° C. lower than the thermal melting point I for the specific sequence at a defined ionic strength Ph. The Tm is the temperature (under defined ionic strength, Ph, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at Ph 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least two times background, optionally 10 times background hybridization. Exemplary stringent hybridization conditions can be as following: 50% formamide, 5×SSC, and 1% SDS, incubating at 42° C., or, 5×SSC, 1% SDS, incubating at 65° C., with wash in 0.2×SSC, and 0.1% SDS at 65° C.

Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides which they encode are substantially identical. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. In such cases, the nucleic acids typically hybridize under moderately stringent hybridization conditions. Exemplary “moderately stringent hybridization conditions” include a hybridization in a buffer of 40% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 1×SSC at 45° C. A positive hybridization is at least twice background. Those of ordinary skill will readily recognize that alternative hybridization and wash conditions can be utilized to provide conditions of similar stringency.

The terms “isolated,” “purified,” or “biologically pure” refer to material that is substantially or essentially free from components that normally accompany it as found in its native state. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein that is the predominant species present in a preparation is substantially purified. In particular, an isolated PPIB nucleic acid is separated from open reading frames that flank the PPIB gene and encode proteins other than PPIB. The term “purified” denotes that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. Particularly, it means that the nucleic acid or protein is at least 85% pure, more preferably at least 95% pure, and most preferably at least 99% pure.

The term “heterologous” when used with reference to portions of a nucleic acid indicates that the nucleic acid comprises two or more subsequences that are not found in the same relationship to each other in nature. For instance, the nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid, e.g., a promoter from one source and a coding region from another source. Similarly, a heterologous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).

An “expression vector” is a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements that permit transcription of a particular nucleic acid in a host cell. The expression vector can be part of a plasmid, virus, or nucleic acid fragment. Typically, the expression vector includes a nucleic acid to be transcribed operably linked to a promoter.

The terms “polypeptide,” “peptide” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.

The term “amino acid” refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, α-carboxyglutamate, and O-phosphoserine. Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.

Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.

“Conservatively modified variants” applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are “silent variations,” which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid. One of skill will recognize that each codon in a nucleic acid (except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan) can be modified to yield a functionally identical molecule. Accordingly, each silent variation of a nucleic acid which encodes a polypeptide is implicit in each described sequence.

As to amino acid sequences, one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a “conservatively modified variant” where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the invention.

The following eight groups each contain amino acids that are conservative substitutions for one another:

    • 1) Alanine (A), Glycine (G);
    • 2) Aspartic acid (D), Glutamic acid (E);
    • 3) Asparagine (N), Glutamine (Q);
    • 4) Arginine I, Lysine (K);
    • 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V);
    • 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W);
    • 7) Serine (S), Threonine (T); and
    • 8) Cysteine (C), Methionine (M)
    • (see, e.g., Creighton, Proteins (1984)).

The terms “identical” or percent “identity,” in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, or 95% identity over a specified region a region of SEQ ID NOS: 1, 2, or 3 or a polypeptide encoded by SEQ ID NOS: 1, 2, or 3), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. Such sequences are then said to be “substantially identical.” This definition also refers to the compliment of a test sequence. Preferably, the identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.

For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters. For sequence comparison of nucleic acids and proteins to PPIB nucleic acids and proteins, the BLAST and BLAST 2.0 algorithms and the default parameters discussed below are used.

A “comparison window”, as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection (see, e.g., Current Protocols in Molecular Biology (Ausubel et al., eds. 1995 supplement)).

A preferred example of algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., Nuc. Acids Res. 25:3389-3402 (1977) and Altschul et al., J. Mol. Biol. 215:403-410 (1990), respectively. BLAST and BLAST 2.0 are used, with the parameters described herein, to determine percent sequence identity for the nucleic acids and proteins of the invention. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a word length (W) of 11, an expectation (E) of 10, M=5, N=−4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a word length of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)) alignments (B) of 50, expectation (E) of 10, M=5, N=−4, and a comparison of both strands.

The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.

An indication that two nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the antibodies raised against the polypeptide encoded by the second nucleic acid, as described below. Thus, a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions. Another indication that two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions, as described below. Yet another indication that two nucleic acid sequences are substantially identical is that the same primers can be used to amplify the sequence.

The phrase “selectively (or specifically) hybridizes to” refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent hybridization conditions when that sequence is present in a complex mixture (e.g., total cellular or library DNA or RNA).

By “host cell” is meant a cell that contains an expression vector and supports the replication or expression of the expression vector. Host cells may be, for example, prokaryotic cells such as E. coli or eukaryotic cells such as yeast or CHO cells.

III. Nucleic Acids Encoding PPIB

A. General Recombinant DNA Methods

This invention relies on routine techniques in the field of recombinant genetics. Generally, the nomenclature and the laboratory procedures in recombinant DNA technology described below are those well known and commonly employed in the art. Standard techniques are used for cloning, DNA and RNA isolation, amplification and purification. Generally enzymatic reactions involving DNA ligase, DNA polymerase, restriction endonucleases and the like are performed according to the manufacturer's specifications. Basic texts disclosing the general methods of use in this invention include Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd ed. 1989); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); and Current Protocols in Molecular Biology (Ausubel et al., eds., 1994)).

For nucleic acids, sizes are given in either kilobases (kb) or base pairs (bp). These are estimates derived from agarose or acrylamide gel electrophoresis, from sequenced nucleic acids, or from published DNA sequences. For proteins, sizes are given in kilodaltons (kDa) or amino acid residue numbers. Proteins sizes are estimated from gel electrophoresis, from sequenced proteins, from derived amino acid sequences, or from published protein sequences.

Oligonucleotides that are not commercially available can be chemically synthesized according to the solid phase phosphoramidite triester method first described by Beaucage & Caruthers, Tetrahedron Letts. 22:1859-1862 (1981), using an automated synthesizer, as described in Van Devanter et. al., Nucleic Acids Res. 12:6159-6168 (1984). Purification of oligonucleotides is by either native acrylamide gel electrophoresis or by anion-exchange HPLC as described in Pearson & Reanier, J. Chrom. 255:137-149 (1983).

The sequence of the cloned genes and synthetic oligonucleotides can be verified after cloning using, e.g., the chain termination method for sequencing double-stranded templates of Wallace et al., Gene 16:21-26 (1981).

B. Cloning Methods for the Isolation of Nucleotide Sequences Encoding PPIB

In general, the nucleic acid sequences encoding PPIB and related nucleic acid sequence homologues are cloned from cDNA and genomic DNA libraries or isolated using amplification techniques with oligonucleotide primers. For example, PPIB sequences are typically isolated from nucleic acid (genomic or cDNA) libraries by hybridizing with a nucleic acid probe, the sequence of which can be derived from SEQ ID NO: 1, 2, 3, or a complement or a subsequence thereof. PPIB RNA and cDNA can be isolated from any equine.

PPIB polymorphic variants, alleles, and interspecies homologues that are substantially identical to PPIB can be isolated using PPIB nucleic acid probes and oligonucleotides under stringent hybridization conditions, by screening libraries. Alternatively, expression libraries can be used to clone PPIB polymorphic variants, alleles, and interspecies homologues, by detecting expressed homologues immunologically with antisera or purified antibodies made against the core domain of PPIB which also recognize and selectively bind to the PPIB homologue.

To make a cDNA library, PPIB mRNA may be purified from any equine. The mRNA is then made into cDNA using reverse transcriptase, ligated into a recombinant vector, and transfected into a recombinant host for propagation, screening and cloning. Methods for making and screening cDNA libraries are well known (see, e.g., Gubler & Hoffman, Gene 25:263-269 (1983); Sambrook et al., supra; Ausubel et al., supra).

For a genomic library, the DNA is extracted from the tissue and either mechanically sheared or enzymatically digested to yield fragments of about 1-8 kb. The fragments are then separated by gradient centrifugation from undesired sizes and are constructed in bacteriophage lambda vectors. These vectors and phage are packaged in vitro. Recombinant phage are analyzed by plaque hybridization as described in Benton & Davis, Science 196:180-182 (1977). Colony hybridization is carried out as generally described in Grunstein et al., PNAS USA., 72:3961-3965 (1975).

An alternative method of isolating PPIB nucleic acids and their homologues combines the use of synthetic oligonucleotide primers and amplification of an RNA or DNA template (see U.S. Pat. Nos. 4,683,195 and 4,683,202; PCR Protocols: A Guide to Methods and Applications (Innis et al., eds, 1990)). Methods such as polymerase chain reaction (PCR) and ligase chain reaction (LCR) can be used to amplify nucleic acid sequences of PPIB directly from mRNA, from cDNA, from genomic libraries or cDNA libraries. Degenerate oligonucleotides can be designed to amplify PPIB homologues using the sequences provided herein. Restriction endonuclease sites can be incorporated into the primers. Polymerase chain reaction or other in vitro amplification methods may also be useful, for example, to clone nucleic acid sequences that code for proteins to be expressed, to make nucleic acids to use as probes for detecting the presence of PPIB encoding mRNA in physiological samples, for nucleic acid sequencing, or for other purposes. Genes amplified by the PCR reaction can be purified from agarose gels and cloned into an appropriate vector.

Amplification techniques using primers can also be used to amplify and isolate PPIB DNA or RNA. For example, nucleic acids encoding PPIB or fragments thereof may be obtained by amplification of an equine cDNA library or reverse transcribed from an equine RNA using isolated nucleic acid primer pairs having the sequences set forth in Table 7 or SEQ ID NOS: 4 and 5.

These primers can be used, e.g., to amplify either the full length sequence or a probe of one to several hundred nucleotides, which is then used to screen a cDNA library for full-length PPIB.

Gene expression of PPIB can also be analyzed by techniques known in the art, e.g., reverse transcription and amplification of mRNA, isolation of total RNA or poly A+ RNA, northern blotting, dot blotting, in situ hybridization, RNase protection, probing DNA microchip arrays, and the like.

Synthetic oligonucleotides can be used to construct recombinant PPIB genes for use as probes or for expression of protein. This method is performed using a series of overlapping oligonucleotides usually 40-120 bp in length, representing both the sense and non-sense strands of the gene. These DNA fragments are then annealed, ligated and cloned. Alternatively, amplification techniques can be used with precise primers to amplify a specific subsequence of the PPIB gene. The specific subsequence is then ligated into an expression vector. PPIB chimeras can be made, which combine, e.g., a portion of PPIB with a portion of a heterologous PPIB to create a chimeric, functional PPIB.

The gene for PPIB is typically cloned into intermediate vectors before transformation into prokaryotic or eukaryotic cells for replication and/or expression. These intermediate vectors are typically prokaryote vectors, e.g., plasmids, or shuttle vectors. Isolated nucleic acids encoding PPIB proteins comprise a nucleic acid sequence encoding a PPIB protein and subsequences, interspecies homologues, alleles and polymorphic variants thereof. In preferred embodiments, the isolated nucleic acid encoding a PPIB protein is SEQ ID NO: 1, 2, 3 or a complement thereof.

C. Expression of PPIB

To obtain high level expression of a cloned gene, such as those cDNAs encoding PPIB, one typically subclones PPIB into an expression vector that contains a strong promoter to direct transcription, a transcription/translation terminator, and if for a nucleic acid encoding a protein, a ribosome binding site for translational initiation. Suitable bacterial promoters are well known in the art and described, e.g., in Sambrook et al. and Ausubel et al. Bacterial expression systems for expressing the PPIB protein are available in, e.g., E. coli, Bacillus sp., and Salmonella (Palva et al., Gene 22:229-235 (1983); Mosbach et al., Nature 302:543-545 (1983). Kits for such expression systems are commercially available. Eukaryotic expression systems for mammalian cells, yeast, and insect cells are well known in the art and are also commercially available.

The promoter used to direct expression of a heterologous nucleic acid depends on the particular application. The promoter is preferably positioned about the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.

In addition to the promoter, the expression vector typically contains a transcription unit or expression cassette that contains all the additional elements required for the expression of the PPIB encoding nucleic acid in host cells. A typical expression cassette thus contains a promoter operably linked to the nucleic acid sequence encoding PPIB and signals required for efficient polyadenylation of the transcript, ribosome binding sites, and translation termination. Additional elements of the cassette may include enhancers and, if genomic DNA is used as the structural gene, introns with functional splice donor and acceptor sites.

In addition to a promoter sequence, the expression cassette should also contain a transcription termination region downstream of the structural gene to provide for efficient termination. The termination region may be obtained from the same gene as the promoter sequence or may be obtained from different genes.

The particular expression vector used to transport the genetic information into the cell is not particularly critical. Any of the conventional vectors used for expression in eukaryotic or prokaryotic cells may be used. Standard bacterial expression vectors include plasmids such as pBR322 based plasmids, pSKF, pET23D, and fusion expression systems such as GST and LacZ. Epitope tags can also be added to recombinant proteins to provide convenient methods of isolation, e.g., c-myc.

Expression vectors containing regulatory elements from eukaryotic viruses are typically used in eukaryotic expression vectors, e.g., SV40 vectors, papilloma virus vectors, and vectors derived from Epstein-Barr virus. Other exemplary eukaryotic vectors include pMSG, pAV009/A+, pMTO10/A+, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV40 early promoter, SV40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.

Some expression systems have markers that provide gene amplification such as thymidine kinase, hygromycin B phosphotransferase, and dihydrofolate reductase.

The elements that are typically included in expression vectors also include a replicon that functions in E. coli, a gene encoding antibiotic resistance to permit selection of bacteria that harbor recombinant plasmids, and unique restriction sites in nonessential regions of the plasmid to allow insertion of eukaryotic sequences. The particular antibiotic resistance gene chosen is not critical, any of the many resistance genes known in the art are suitable. The prokaryotic sequences are preferably chosen such that they do not interfere with the replication of the DNA in eukaryotic cells, if necessary.

Standard transfection methods are used to produce bacterial, mammalian, yeast or insect cell lines that express large quantities of PPIB protein, which are then purified using standard techniques (see, e.g., Colley et al., J. Biol. Chem. 264:17619-17622 (1989); Guide to Protein Purification, in Methods in Enzymology, vol. 182 (Deutscher, ed., 1990)). Transformation of eukaryotic and prokaryotic cells are performed according to standard techniques (see, e.g., Morrison, J. Bact. 132:349-351 (1977); Clark-Curtiss & Curtiss, Methods in Enzymology 101:347-362 (Wu et al., eds, 1983).

Any of the well known procedures for introducing foreign nucleotide sequences into host cells may be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, liposomes, microinjection, plasma vectors, viral vectors and any of the other well known methods for introducing cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into a host cell (see, e.g., Sambrook et al., supra). It is only necessary that the particular genetic engineering procedure used be capable of successfully introducing at least one gene into the host cell capable of expressing PPIB.

After the expression vector is introduced into the cells, the transfected cells are cultured under conditions favoring expression of PPIB, which is recovered from the culture using standard techniques identified below.

D. Purification of PPIB Protein

Either naturally occurring or recombinant PPIB can be purified for use in functional assays. Naturally occurring PPIB are purified, e.g., from equines and any other source of a PPIB homologue. Recombinant PPIB is purified from any suitable expression system.

PPIB may be purified to substantial purity by standard techniques, including selective precipitation with such substances as ammonium sulfate; column chromatography, immunopurification methods, and others (see, e.g., Scopes, Protein Purification: Principles and Practice (1982); U.S. Pat. No. 4,673,641; Ausubel et al., supra; and Sambrook et al., supra).

A number of procedures can be employed when recombinant PPIB is being purified. For example, proteins having established molecular adhesion properties can be reversible fused to PPIB. With the appropriate ligand, PPIB can be selectively adsorbed to a purification column and then freed from the column in a relatively pure form. The fused protein is then removed by enzymatic activity. Finally PPIB could be purified using immunoaffinity columns.

IV. Determining Whether an Equine is a HERDA Carrier by Detecting PPIB Nucleic Acid Sequences

In one embodiment of the invention, methods of determining whether a particular equine is normal, a HERDA carrier, or HERDA-affected are provided. According to the methods of the invention, the PPIB allele of the equine is analyzed and compared to the PPIB alleles disclosed herein to determine whether the equine is a HERDA carrier. Determination of the presence of absence of a particular PPIB allele is generally performed by analyzing a nucleic acid sample that is obtained from the equine. Often, the nucleic acid sample comprises genomic DNA. It is also possible to analyze RNA samples for the presence of PPIB alleles.

In some embodiments, the PPIB*HRD allele is detected using direct sequencing of an amplified nucleic acid comprising a subsequence of a nucleic acid encoding PPIB (e.g., a nucleic acid comprising position +115 of SEQ ID NO:1 or position 115 of SEQ ID NO:2). Primers can be designed which amplify a nucleic acid comprising position 115 of a PPIB nucleic acid. For example, sequences comprising the PPIB SNP described herein can be amplified using primers comprising the sequences set forth in SEQ ID NOS: 4 and 5. The primers amplify a 250 bp PPIB fragment comprising the PPIB SNP associated with HERDA (i.e., by amplifying a PPIB fragment comprising position +115 of SEQ ID NO:1 or position 115 of SEQ ID NO:2). Once amplified, the sequences can be detected using any method known in the art.

In some embodiments, the PPIB*HRD allele is detected using restriction fragment length polymorphism (RFLP) analysis. For example, sequences comprising the PPIB SNP described herein can be amplified using primers comprising the sequences set forth in SEQ ID NOS: 4 and 5. The primers amplify a 250 bp PPIB fragment comprising the PPIB SNP associated with HERDA (i.e., by amplifying a PPIB fragment comprising position +115 of SEQ ID NO:1 or position 115 of SEQ ID NO:2). Equines carrying wild-type PPIB have an EarI site +34-39 of a genomic PPIB sequence. Equines carrying the PPIB SNP associated with HERDA have an additional EarI site 67 bp from the first EarI site, i.e., at position +111-116 of a genomic PPIB sequence. A PPIB sequence or subsequence comprising is amplified from a biological sample from an equine and the amplification products are digested with a restriction enzyme (i.e., EarI). If the second EarI recognition site is present in the PPIB, the amplification product will be digested in two places. Conversely, if the second EarI recognition site is not present in the PPIB, the amplification products will only be digested in one place. Following digestion, the restriction fragments are then analyzed using any methods known in the art including, for example, gel electrophoresis.

In some embodiments, the PPIB allele is detected using oligonucleotide primers and/or probes (i.e., primers and probes that amplify and detect position 115 of SEQ ID NOS 2 or 3 or position +115 of SEQ ID NO:1). For example, nucleic acids encoding PPIB alleles or fragments thereof may be amplified using isolated nucleic acid primer pairs comprising the sequences set forth in SEQ ID NOS: 4 and 5. Oligonucleotides can be prepared by any suitable method, including chemical synthesis. Oligonucleotides can be synthesized using commercially available reagents and instruments. Alternatively, they can be purchased through commercial sources. Methods of synthesizing oligonucleotides are well known in the art (see, e.g., Narang et al., Meth. Enzymol. 68:90-99, 1979; Brown et al., Meth. Enzymol. 68:109-151, 1979; Beaucage et al., Tetrahedron Lett. 22:1859-1862, 1981; and the solid support method of U.S. Pat. No. 4,458,066).

A. PCR Identification of PPIB Alleles

In some embodiments, PCR is used to amplify nucleic acids encoding PPIB alleles (i.e., wild type PPIB or PPIB alleles comprising PPIB*HRD or PPIB*1). A general overview of the applicable technology can be found in PCR Protocols: A Guide to Methods and Applications (Innis et al. eds. (1990)) and PCR Technology: Principles and Applications for DNA Amplification (Erlich, ed. (1992)). In addition, amplification technology is described in U.S. Pat. Nos. 4,683,195 and 4,683,202.

PCR permits the copying, and resultant amplification of a target nucleic acid, e.g., a nucleic acid encoding PPIB. Briefly, a target nucleic acid, e.g. DNA from a sample from an equine, is combined with a sense and antisense primers, dNTPs, DNA polymerase and other reaction components. (See, Innis et al., supra) The sense primer can anneal to the antisense strand of a DNA sequence of interest. The antisense primer can anneal to the sense strand of the DNA sequence, downstream of the location where the sense primer anneals to the DNA target. In the first round of amplification, the DNA polymerase extends the antisense and sense primers that are annealed to the target nucleic acid. The first strands are synthesized as long strands of indiscriminate length. In the second round of amplification, the antisense and sense primers anneal to the parent target nucleic acid and to the complementary sequences on the long strands. The DNA polymerase then extends the annealed primers to form strands of discrete length that are complementary to each other. The subsequent rounds serve to predominantly amplify the DNA molecules of the discrete length.

B. Detection of Amplified Products

Amplified products can be detected using any means known in the art, including, e.g., restriction fragment length polymorphism (RFLP) analysis; denaturing gel electrophoresis (see, e.g., Erlich, ed., PCR TECHNOLOGY, PRINCIPLES AND APPLICATIONS FOR DNA AMPLIFICATION, W.H. Freeman and Co, New York, 1992, Chapter 7), direct sequencing, and HPLC-based analysis. Suitable sequence methods include e.g., dideoxy sequencing-based methods and Maxam and Gilbert sequence (see, e.g., Sambrook and Russell, supra). Suitable HPLC-based analyses include, e.g., denaturing HPLC (dHPLC) as described in e.g., Premstaller and Oefner, LC-GC Europe 1-9 (July 2002); Bennet et al., BMC Genetics 2:17 (2001); Schrimi et al., Biotechniques 28(4):740 (2000); and Nairz et al., PNAS USA 99(16): 10575-10580 (2002); and ion-pair reversed phase HPLC-electrospray ionization mass spectrometry (ICEMS) as described in e.g., Oberacher et al.; Hum. Mutat. 21(1):86 (2003). Other methods for characterizing single base changes in PPIB alleles include, e.g., single base extensions (see, e.g., Kobayashi et al, Mol. Cell. Probes, 9:175-182, 1995); single-strand conformation polymorphism analysis, as described, e.g., in Orita et al., Proc. Nat. Acad. Sci. 86, 2766-2770 (1989), allele specific oligonucleotide hybridization (ASO) (e.g., Stoneking et al., Am. J. Hum. Genet. 48:70-382, 1991; Saiki et al., Nature 324, 163-166, 1986; EP 235,726; and WO 89/11548); and sequence-specific amplification or primer extension methods as described in, for example, WO 93/22456; U.S. Pat. Nos. 5,137,806; 5,595,890; 5,639,611; and U.S. Pat. No. 4,851,331; 5′-nuclease assays, as described in U.S. Pat. Nos. 5,210,015; 5,487,972; and 5,804,375; and Holland et al., 1988, Proc. Natl. Acad. Sci. USA 88:7276-7280.

Detection techniques for evaluating nucleic acids for the presence of a single base change involve procedures well known in the field of molecular genetics. Further, many of the methods involve amplification of nucleic acids. Ample guidance for performing the methods is provided in the art. Exemplary references include manuals such as PCR Technology: PRINCIPLES AND APPLICATIONS FOR DNA AMPLIFICATION (ed. H. A. Erlich, Freeman Press, NY, N.Y., 1992); PCR PROTOCOLS: A GUIDE TO METHODS AND APPLICATIONS (eds. Innis, et al., Academic Press, San Diego, Calif., 1990); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, Ausubel, 1994-1999, including supplemental updates through April 2004; Sambrook & Russell, Molecular Cloning, A Laboratory Manual (3rd Ed, 2001).

Methods for detecting single base changes well known in the art often entail one of several general protocols: hybridization using sequence-specific oligonucleotides, primer extension, sequence-specific ligation, sequencing, or electrophoretic separation techniques, e.g., singled-stranded conformational polymorphism (SSCP) and heteroduplex analysis. Exemplary assays include 5′ nuclease assays, template-directed dye-terminator incorporation, molecular beacon allele-specific oligonucleotide assays, single-base extension assays, and SNP scoring by real-time pyrophosphate sequences. Analysis of amplified sequences can be performed using various technologies such as microchips, fluorescence polarization assays, and matrix-assisted laser desorption ionization (MALDI) mass spectrometry. In addition to these frequently used methodologies for analysis of nucleic acid samples to detect single base changes, any method known in the art can be used to detect the presence of the PPIB mutations described herein.

Although the methods typically employ PCR steps, other amplification protocols may also be used. Suitable amplification methods include ligase chain reaction (see, e.g., Wu & Wallace, Genomics 4:560-569, 1988); strand displacement assay (see, e.g., Walker et al., Proc. Natl. Acad. Sci. USA 89:392-396, 1992; U.S. Pat. No. 5,455,166); and several transcription-based amplification systems, including the methods described in U.S. Pat. Nos. 5,437,990; 5,409,818; and 5,399,491; the transcription amplification system (TAS) (Kwoh et al., Proc. Natl. Acad. Sci. USA 86:1173-1177, 1989); and self-sustained sequence replication (3SR) (Guatelli et al., Proc. Natl. Acad. Sci. USA 87:1874-1878, 1990; WO 92/08800). Alternatively, methods that amplify the probe to detectable levels can be used, such as Qβ-replicase amplification (Kramer & Lizardi, Nature 339:401-402, 1989; Lomeli et al., Clin. Chem. 35:1826-1831, 1989). A review of known amplification methods is provided, for example, by Abramson and Myers in Current Opinion in Biotechnology 4:41-47, 1993.

V. Kits

PPIB and its homologues are useful tools for more specific and sensitive identification of equines that are normal, HERDA carriers, or HERDA-affected. For example, nucleic acids that specifically hybridize to PPIB nucleic acids, such as PPIB probes and primers (e.g., SEQ ID NOS: 4 and 5), PPIB nucleic acids (e.g. nucleic acids comprising a sequence set forth in SEQ ID NOS: 1, 2, 3 or a complement or subsequence thereof) can be used to identify equines that are HERDA carriers.

The invention also provides kits and solutions for detecting the PPIB SNPs described herein. For example, the invention provides kits that include one or more reaction vessels that have aliquots of some or all of the reaction components of the invention in them. Aliquots can be in liquid or dried form. Reaction vessels can include sample processing cartridges or other vessels that allow for the containment, processing and/or amplification of samples in the same vessel. Such kits allow for ready detection of amplification products of the invention into standard or portable amplification devices. The kits can also include written instructions for the use of the kit to amplify and control for amplification of PPIB nucleic acid.

Kits can include, for instance, amplification reagents comprising primers sufficient to amplify at least one PPIB PPIB SNP (e.g., SEQ ID NOS: 4 and 5) and at least one probe for amplifying and detecting the polynucleotide sequence. In some embodiments, the kits further comprise a restriction enzyme (e.g., Ear I). In addition, the kit can include nucleotides (e.g., A, C, G and T), a DNA polymerase and appropriate buffers, salts and other reagents to facilitate amplification reactions.

EXAMPLES

The following examples are offered to illustrate, but not to limit the claimed invention.

Example 1

Materials and Methods

Samples: Diagnosed cases of HERDA were referred to us at the UC-Davis Veterinary Medical Teaching Hospital (VMTH) beginning in 1998, and case history, pedigrees, and blood samples were collected. Occasionally owners of affected horses would also include blood samples from parents, siblings, or other first degree relatives. American Quarter Horses are regularly seen at the UC-Davis VMTH and blood samples were collected between 2002-2004. Medical records of these control samples were screened to insure no history of a HERDA phenotype and to verify age. With the permission of the American Quarter Horse Association (AQHA), backlogged hair root samples of specific relatives of affected horses were made available from the UC-Davis Veterinary Genetics Laboratory (VGL), which conducts parentage testing for all registered American Quarter Horses. Genomic DNA was isolated from blood samples using the Qiagen Blood Mini-Kit (Qiagen: Valencia, Calif.). Genomic DNA was isolated from the hair root samples by the VGL using published protocols (Locke et al., Anim Genet, 33(5): p. 329-37 (2002)). In total, the dataset consisted of 68 horses diagnosed with HERDA, 76 relatives of affected horses, 1,079 control Quarter Horses, and 55 horses of diverse heritage (e.g., Arabians, Paint Horses, and draft horses).

Microsatellite Genotyping: Fluorescently labeled primers sets for the majority of the microsatellite markers used in the initial scan for homozygosity were obtained with the help of the Dorothy Havermeyer Foundation. Primers for additional published microsatellite markers were obtained from Applied Biosytems (Foster City, Calif.). All microsatellite data was analyzed using an ABI 3100 Genetic Analyzer and STRAND software.

Multiplex reactions for the initial genome scan were based on previous reports (Locke et al., Anim Genet, 33(5): p. 329-37 (2002)]. Data for 27 of the 100 loci screened in the genome scan were generated by the VGL as part of their standard parentage panel and genotyped in three multiplex reactions. Sixty-six additional markers were combined into fourteen multiplex reactions. Amplification of genome scan multiplex reactions were performed in 25 μL total volume containing 1 μL genomic DNA, 1×PCR buffer, 2.5 mM MgCl2, 250 μM dNTPs, 1 unit AmpliTaq Gold (Applied Biosystems) with primer concentrations and annealing temperatures specified in Table 4. The other seven microsatellites were individually amplified and genotyped under the same conditions except for a reduced total volume of 15 μL and 0.5 units AmpliTaq Gold. For fine structure mapping around the HERDA locus, informative markers spanning ECA1 were combined into small multiplex reactions to minimize sample use. Amplification conditions were in 20 μL total volume, 1 μL genomic DNA, 1×PCR Buffer, 1.5 mM MgCl2, 125 μM dNTPs, 0.5 units AmpliTaq Gold with primer concentrations and annealing temperatures specified in Table 5.

Statistics: Allele and genotype frequencies were counted within the control population (n=44) and the affected population (n=38) at 98 autosomal microsatellite loci. For each group, the expected heterozygosity values with standard errors and observed heterozygosity values of each locus were calculated with Arlequin software (Excoffier et al., Evolutionary Bioinformatics Online, (1): p. 47-50 (2005)). A chi-square test of a L×2 contingency table with L−1 degrees of freedom, where L=# of alleles present at a given locus, were conducted to calculate P values testing the null hypothesis that the two population samples have the same allele frequencies. LOD scores were generated using the HOMOZ/MAPMAKER software [Kiruglyak et al., Am J Hum Genet, 56(2): p. 519-27 (1995)].

Establishing a comparative framework: Equine microsatellites were compared with the human genome using BLAST to determine a comparative framework between the two genomes. A minimal standard of homology between the equine and human sequences was set at an alignment score (S)>60 and a sum probability value (E)<3.0 E-06 consistent with previous reports (Farber, C. R. and J. F. Medrano, Anim Genet, 35(1): p. 28-33 (2004)). Subsequently, the region of the human genome identified with BLAST comparisons, plus 5 MB proximal and distal to the region, were compared with other fully and partially mapped mammalian genomes using the UCSC Genome Browser to confirm conservation of synteny across species.

A list of equine candidate genes was generated from the region of synteny from the human genome (Build 35.1). The Horse Genome Project was searched for equine BAC clones which had both ends successfully sequenced and that BLAST within 250 kB of each other on HSA15, surrounding the region of identity by descent (Leeb et al., Genomics 87: 772-776 (2006)). These BAC clones provided additional confidence in the physical relationship between ECA1 and HSA15 and helped to verify our candidate gene list. Equine gene specific markers were optimized with the 5000 rad equine panel (Chowdhary et al., Genome Res, 13(4): p. 742-51 (2003)). Informative gene specific markers were subsequently RH mapped to verify their locations relative to previously RH mapped microsatellites UM004, AHT58, and UM043.

SNP discovery and genotyping: A list of genes predicted to lie within the region of homozygosity identified in the HERDA population was generated based on comparative homology across fully sequenced mammals (human, mouse, and dog). Genes for SNP discovery were selected based on their spacing across the region as well as the availability of mammalian mRNA sequences from the Genbank database. Sequences from all available mammals (most often human, mouse, dog, and cow) were aligned (Vector NTI) and analyzed for regions of high conservation across species. In addition, human and mouse mRNA sequences were subjected to BLAT analysis against their respective compiled genomic sequences to determine intron/exon boundaries and the size of introns. Introns which had conserved sizes between 700 bp and 3 Kb in both human and mouse were targeted to facilitate cloning and sequencing. These features were used to design primers for amplification of specific homologous sequences from the horse genome.

Genomic DNA from an unaffected Quarter Horse and an affected HERDA horse were used to amplify corresponding genomic fragments for each of the genes in Table 1. The HERDA sample used in this phase of SNP discovery was homozygous for 10 microsatellite markers which span 31.6 cM. Fragments which amplified cleanly and were of the approximate expected size were cloned into the TOPO TA Cloning Kit (Invitrogen: Carlsbad, Calif.). Three bacterial clones from both the control and affected horse were sequenced with vector specific primers. Sequences were subjected to BLAST analysis to verify that both ends of cloned exonic sequence were homologous to the genes targeted. All clones were aligned to identify gene-specific intronic SNPs or microsatellites which may segregate within the Quarter Horse population. To genotype SNPs from additional affected horses and unaffected controls, genomic fragments were amplified, purified with the Qiaquik Purification Kit (Qiagen: Valencia, Calif.) and sequenced on an ABI 3100 Genetic Analyzer with one of the gene specific primers used in the original amplification. The polymorphic microsatellite within the intron of SPG21 was genotyped using a fluorescently labeled primer as previously described.

Sequencing of candidate genes: Skin fibroblasts derived from dermal punch biopsies (Animal care protocol #10714) taken from an affected HERDA horse and an age-matched unaffected Quarter Horse were used to generate cDNA libraries (Fast Track 2.0 mRNA Isolation Kit, Invitrogen; Marathon cDNA Amplification Kit, BD Biosciences). 5′ and 3′ RACE reactions were carried out with appropriate reverse and forward primers (Table 7), separated by gel electrophoresis, extracted, and sequenced directly to obtain coding sequence as well as partial 5′UTR and 3′UTR. For PPIB, additional primers were designed to generate sequence of the four predicted introns (Table 7). Equine homologues of human genes from the syntenic region were computationally mined from the equine whole genome sequence trace archives. Discontinuous MegaBLAST was used to design primers that generated maximal equine coding sequence. cDNA products were amplified, cloned, and sequenced to identify additional SNPs between the affected and unaffected cDNA libraries.

Assay for SNP2 (i.e., PPIB*HRD) in PPIB: Primers were designed to amplify a fragment of the cyclophilin B gene which contains an informative SNP from equine gDNA. An unlabeled forward primer (5′CGGTGGATGCTGCGTTTCT) and a fluorescently labeled reverse primer (5′6FAM-GCCCAAGCCAGCCTAGGA) were used to generate a 250 bp fragment under the following conditions: 1 μL genomic DNA, 1×PCR Buffer (Perkin-Elmer), 1.5 mM MgCl2, 125 μM of each dNTP, primer concentrations of 0.2 μM, and 0.5 units Taq Gold in a 20 μL reaction. Samples were denatured for 10 minutes at 94° C., followed by 32 cycles of 20 sec at 94° C., 30 sec at 58° C., and 1 min at 72° C.; followed by 10 min at 72° C. 10 μL of the PCR reaction was subsequently digested in a total volume of 20 μL containing 1×NEB Buffer 1 and 4 units Ear I restriction endonuclease (NEB) for 2.5 hours at 37° C. 1 μL of digested product was combined with 10 μL of a 5% dilution of Gene Scan 400HD[ROX] in Hi-Di Formamide (Applied Biosystems), denatured for 5 minutes at 94° C., cooled for 5 minutes at 4° C., and analyzed on a 3100ABI Genetic Analyzer. A conserved EarI site which cuts 46 bp from the end of the forward primer serves as an internal control to verify that the enzyme is working properly. The SNP detected in the HERDA population introduces a second Ear I site which cuts an additional 67 bp from the conserved Ear I site. All samples tested are run with a water negative control and three positive controls: (1) an affected HERDA sample; (2) the heterozygous sire of (1); and (3) an unaffected homozygous ‘wild-type’ full sibling of (1).

Example 2

Mapping HERDA

The initial populations studied consisted of 38 affected HERDA horses, 44 age-matched unaffected Quarter Horses, and 13 first-degree relatives of affected horses. Of 98 loci evaluated, only 13 had distinguishable expected heterozygosity values, based on the overlapping of their standard error, and an unambiguous decrease of observed heterozygosity in the HERDA population relative to the control population (FIG. 1). The remaining 13 loci were further evaluated for significant differences in allele frequencies using a chi-square test of a contingency table comparing the two populations. Only HMS15 and HMS7, two markers which map ˜18 cM apart on ECA 1, gave significant P values <0.05 (Table 2).

To confirm the location of the HERDA locus, 52 samples consisting of 11 affected and 41 relatives were genotyped at 9 loci on ECA1 (FIG. 2A). The average distance between markers is 16.8 cM and the two markers (HMS15 and HMS7) which were used to initially detect the reduction in heterozygosity within the affected population were replaced by alternative nearby markers for this stage of analysis. A maximum LOD score of 7.4 was generated at marker AHT58 (FIG. 2B). Similar analyses were performed with these samples for a subset of chromosomes which had been analyzed in Table 1 based on early indications of a reduction in heterozygosity. Maximum LOD scores for all loci tested, except those on the distal arm of ECA1, did not approach the minimally significant LOD score of 3.0 typically used in linkage studies.

Example 3

Reduction of the Critical Interval/Fine Structure Mapping

The large number of HERDA samples collected to date (61+7) provides the opportunity to use recombination events which have occurred as the mutant allele has been passed down through the generations to minimize the critical interval that contains the HERDA locus. Initially, 12 microsatellites that have been linkage mapped or RH mapped near the AHT58 marker were used to genotype all HERDA samples. Sixty four (57+7) samples contained a region of homozygosity centered around the AHT58 marker and carry two copies of the 185 allele. Eight (6+2) of these samples were homozygous at all 12 microsatellite markers, a region which spans 31.6 cM, and most likely represent the alleles that were in linkage disequilibrium with the mutation when it arose. The majority of samples contained a large block of homozygosity either proximal or distal to, but always containing the AHT58 microsatellite.

BLAST results of seven of the twelve microsatellites used to refine the area of homozygosity within affected samples established a framework to compare the equine and human genomes (Table 6). UCD440, AHT58, and UM043 showed significant homology to regions of HSA15q22-15q24 (located at approximately 59.9 MB, 62.6 MB, and 71.1 MB respectively), which is consistent with the most recent comparative maps reported (Perrocheau et al., Anim Genet, 37(2): p. 145-55 (2006); Swinburne et al., Genomics, 87(1): p. 1-29 (2006)). The region of HSA15 was screened for genes associated with EDS or related genes which would be logical candidates based on the observed phenotype. Although no EDS-like candidate genes were evident, cartilage intermediate layer protein (CILP) merited further investigation, despite the appearance of lying outside the critical interval. Additional gene-based markers were discovered within the equine homologues of five human genes (ITGA11, CILP, SPG21, USP3, and TLN2) that map within the region of HSA15. SNPs were found within four of the five gene introns while a polymorphic dinucleotide microsatellite was found within an intron of SPG21 (Table 1).

A subset of 18 affected samples which were informative for defining the critical interval with microsatellites and 5 unaffected, unrelated samples were used for evaluating gene-specific markers. Three affected samples heterozygous for the intronic SNP in TLN2, proximal to the HERDA locus, and six affected samples heterozygous for the intronic dinucleotide repeat in SPG21, distal to the HERDA locus, define the smallest identifiable critical interval to date (FIG. 3).

Example 4

Mutation Screen

In other species, the minimal critical interval containing the HERDA locus is part of a larger block of synteny which has been conserved throughout evolution based on comparative analysis of human, chimpanzee, rhesus, dog, mouse, and rat genomes. The region, including TLN2 and SPG21, contains 20 known genes and 6 putative loci in humans. Further investigation into the reported functions and protein associations of these genes led to the sequencing of PPIB, or cyclophilin B (FIGS. 4A and 4B).

Two SNPs (i.e., PPIB*1 and PPIB*HRD) which are predicted to cause missense mutations were found by sequencing PPIB cDNA of a HERDA affected horse and comparing it to the PPIB cDNA sequence of an unaffected control horse (Genbank Accession No. EF397503). All four introns of PPIB were also sequenced and no informative SNP's were found. Additional samples were amplified, purified, and sequenced to determine if either of the two SNPs was commonly found in Quarter Horses. SNP1 or PPIB*1 (A17G), predicted to cause a glutamic acid to glycine change in protein sequence (i.e., p.6E>G) in the putative endoplasmic reticulum (ER) signal sequence, was found in multiple non-affected samples in both the heterozygous and homozygous states, indicating that it is not causative for HERDA. SNP2 or PPIB*HRD (G115A), predicted to cause a glycine to arginine change in protein sequence (i.e., p.39G>R), was homozygous within affected samples; heterozygous among (14 of 18) non-affected relatives initially screened; and not found among the unaffected, unrelated control samples (FIG. 5A).

An assay was developed so that large numbers of samples could be screened to determine the frequency of SNP2 (i.e., PPIB*HRD) (FIG. 5B). All HERDA samples, with the exception of the four genotypically distinct samples flagged as potential misdiagnosed cases were homozygous for the mutation (Table 3). All available samples of relatives of affected horses were analyzed and 76% (58 of 76) are heterozygous. All parents of affected horses that are homozygous for the SNP are heterozygous, consistent with the autosomal recessive nature of the disease. Samples which were related (parent or grandparent) to the four genotypically aberrant affected horses were homozygous for the wild type SNP. Previous pedigree analysis of the families used in establishing a LOD score for the HERDA locus typically display an inbreeding loop which represents the most likely path of the transmission of the mutation. In all cases, the SNP segregated in a predictable fashion consistent with the hypothesis that inbreeding is leading to the union of two mutant alleles which are identical by descent.

A set of 182 unaffected Quarter Horses collected at the VMTH were screened for the mutation. Seven samples were heterozygous and 175 were homozygous for the wild type SNP, suggesting a 3.85% carrier frequency. An additional 897 Quarter Horse samples revealed 866 that are homozygous wild type and 31 that are heterozygous, suggesting a 3.46% carrier frequency. A small sampling of Arabians, draft horses, and a set of horses of unknown lineage were tested and only the wild type SNP was detected.

The HERDA predicted PPIB protein and one of the two equine wild type variants were aligned with five mammalian and three non-mammalian vertebrate (Danio rerio, Xenopus tropicalis, and Gallus gallus) PPIB sequences (FIG. 6). Equine PPIB shared the highest identity (97.7%) with canine PPIB. The six mammalian PPIB sequences were 88% identical. Across sequenced vertebrates, the glycine residue that is mutated in HERDA horses is invariant. The glycine sits in the third position of a completely conserved seven amino acid peptide (37KKGPKVT43) structure that has been strictly maintained throughout vertebrate evolution.

It will be recognized by the skilled artisan that a number of methods known in the art may be used to assay for the SNP of the present invention, including, but not limited to, sequencing, pyrosequencing, allele specific PCR, restriction enzyme digestion, and oligonucleotide hybridization, among others.

Example 5

Linked Marker Test

Of the 57 affected samples initially screened and the 7 samples subsequently screened and identified as homozygous for the “HERDA” SNP2 of PPIB (i.e., PPIB*HRD), all samples are homozygous for the 185 allele at marker AHT58. Fifty-three of the initially screened samples and 3 of the subsequently screened samples (93.7% cumulatively) are homozygous for the 115 allele of UM004, suggesting the marker is farther away from the PPIB SNP2 then AHT58.

To investigate the utility of SNP2, the 38 samples from the control Quarter Horse population which were heterozygous for “HERDA” SNP2 were genotyped at the flanking markers AHT58 and UM004. In all cases, the 185 allele of AHT58 and the 115 allele of UM004 were detected. The HERDA haplotype in conjunction with the above data showed that the three markers were tightly associated.

The mapping of disease genes in the horse have benefited greatly from our understanding of human diseases and their previously discovered genetic bases. In the case of HERDA, a number of phenotypic similarities with the heterogenic disorder Ehlers-Danlos Syndrome did not lead us to a short, well-defined list of candidate genes worth pursuing. Instead, unique features of the HERDA pathology which appear to distinguish it from previously reported conditions suggested that a broader approach must be taken to maximize the chance of mapping the locus. In addition, the unusual structure of horse families and populations introduces difficulties in obtaining well-defined, segregating families for a given trait. A combination of approaches, integrating data from the comparative genomics of mammals, allowed the mapping of the HERDA locus to a relatively small, ˜2.3 MB region of ECA1.

The detection of homozygous polymorphisms in the HERDA population within the minimum critical interval allowed development of a marker for HERDA. Of the 57+7 affected horses which share the characteristic HERDA haplotype, four DNA markers have been determined to be homozygous in all samples: the G→A intronic SNP of USP3; the A→G exonic SNP (+17) predicted to cause a missense mutation in PPIB(PPIB*1); the G→A exonic SNP (+115) predicted to cause a missense mutation of PPIB(PPIB*HRD); and the 185 allele of the AHT58 microsatellite marker. A C→T intronic SNP in TLN2 and an intronic microsatellite in SPG21 serve as markers for establishing the smallest critical interval surrounding the HERDA locus.

Comparative genomics reveals this region of the mammalian genome to have conserved synteny. The equivalent region of the human genome includes 20 known genes and 6 putative genes, including TLN2 and SPG21. No obvious candidate genes consistent with known EDS genes reside within this region. Additional research into the functions of genes within the region led to the sequencing of PPIB based on its cis-trans peptidyl-prolyl isomerase function and a published association with procollagen [Davis et al., J Biol Chem, 264(15): p. 8956-62 (1989); Smith et al., J Biol Chem, 270(31): p. 18323-8 (1995); Steinmann et al., J Biol Chem., 266(2): p. 1299-303 (1991)]. A SNP which would change a conserved glycine residue to an arginine in PPIB was found.

The tight association of the G→A exonic SNP (PPIB*HRD) with the HERDA phenotype makes it a highly informative marker for confirming suspected cases of HERDA and screening unaffected horses for carrier status. All parents of HERDA horses that are homozygous for the SNP are heterozygous. Of 1210 unaffected horses screened, none were found to be homozygous for the G→A exonic SNP (PPIB*HRD). In addition, all 38 control horses found to be heterozygous for the SNP carried alleles at the flanking markers consistent with the HERDA haplotype. This observation agrees well with the hypothesis that the SNP developed only once within the American Quarter Horse, presumably in association with the HERDA locus.

It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

TABLE 1
Base
pairs
Seq from
Gene Primers Tm Size Primer end SNP w/Flanking Sequence
ITGA11 F: ACCTGTCTTCCTGGCGCCC 61 1.7 Kb R  77 Control: CGGTCCCCGCCCTCA
R: CAGCACATGGAAGTTGATCCGA HRDA: CGGTCCCAGCCCTCA
CILP F: TGGTGCCTCAACAGGGAGCAG 60 1.5 Kb R 155 Control: AGACAGGGTTTATGT
R: CACTTGCTCCAGGGAGACCA HRDA: AGACAGGATTTATGT
SPG21 F: VIC-TCATACTCTGACCCCGCTGATC 58 224- N/A Control Allele: 224
R: TTTAATTTTCCTTCCCACTCACG 228 HRDA Allele: 226
USP3 F: AGCTTTCACAGCTGACAGGCATA 60 1.7 Kb F 337 Control: AACACCCACTCATGT
R: TGAGTGACTGAAGGATGGCATTC HRDA: AACACCCGCTCATGT
TLN2 F: CTCGTCAGAAAATCAGTACTTCTC 59 945 bp R 153 Control: GGAGAACCCACAAGC
R: CCAATCCCCACCCCAAGATA HRDA: GGAGAACTCACAAGC

TABLE 2
x2 test of
independence
Locus Chr. d.f. x2 P-Value
ASB41 1 6 6.3992 0.380
HMS15 1 7 27.4681 0.0003
HMS7 1 7 21.4342 0.003
LEX34 5 5 3.2420 0.663
AHT5 8 6 5.3013 0.506
COR69 13 5 8.7535 0.119
COR002 14 4 3.3490 0.501
B-8 15 8 7.9469 0.439
AHT2 15 4 6.2828 0.179
LEX56 16 7 7.0211 0.427
COR32 17 3 3.4948 0.321
LEX36 19 9 4.4039 0.883
A-17 26 8 4.7455 0.785

TABLE 3
Homozygous Homozygous
Sample Wild Type Heterozygous “Mutant” Total
HERDA 4 0 64 68
Relatives 18 58 0 76
Control-QH 175 7 0 182
Control-QH 866 31 0 897
Arabian 18 0 0 18
Draft 9 0 0 9
Unidentified 28 0 0 28
Total 1118 96 64 1278

TABLE 4
MPX Conc Conc
Name Tm (° C.) Marker (μM) MPX Name Tm (° C.) Marker (μM)
MPX-4 58 ASB22 0.1 STR1 55 AHT4 0.2
ASB5 0.04 55 HTG10 0.18
B-8 0.04 55 HTG4 0.1
COR003 0.03 55 LEX3 0.2
COR058 0.05 55 LEX33 1.25
COR070 0.15 60 AHT5 0.13
NVHEQ18 0.04 60 ASB17 0.25
MPX-5A 58 COR069 0.12 60 ASB2 0.3
COR075 0.04 60 ASB23 0.1
I-18 0.05 60 HMS6 0.3
VHL047 0.06 60 HMS7 0.3
MPX-6 58 ASB37 0.04 60 VHL20 0.25
COR002 0.1 STR2 55 AHT2 0.08
COR032 0.04 CA425 0.4
COR096 0.12 CA487 0.07
LEX54 0.12 60 CA437 0.3
NVHEQ79 0.05 EB2E8 0.6
UM010 0.05 HMS15 0.18
ASB39 0.12 HMS5 0.1
MPX-10 58 COR017 0.09 HMS6 0.24
COR031 0.05 HTG3 0.15
COR040 0.12 HTG6 0.1
LEX25 0.02 HTG7 0.06
NVHEQ70 0.03 STR3 55 CA412 0.2
MPX-A 58 UM037 0.1 CA502 0.14
HTG21 0.1 HMS1 0.15
LEX74 0.1 60 ASB9 0.4
LEX37 0.1 HMS2 1
COR082 0.15 MPXvg14-1 58 ASB14 0.04
COR008 0.1 NVHEQ82 0.04
MPX-B 58 LEX22 0.1 A-14 0.06
L15.2 0.1 LEX034 0.08
COR071 0.1 COR007 0.06
LEX23 0.1 MPXvg14- 56 COR089 0.125
TKY28 0.1 56 TKY321 0.05
MPX-L 58 LEX36 0.1 LEX69 0.125
HMS47 0.1 LEX52 0.05
LEX56 0.1 A-17 0.04
COR055 0.16 MPX-R 58 UCDEQ457 0.1
MPX-M 58 ASB1 0.1 LEX071 0.1
COR61 0.1 COR033 0.1
AHT21 0.1 MPX-S 58 L12.2 0.1
COR018 0.1 ASB18 0.1
MPX-Y 58 AHT17 0.04 COR065 0.1
LEX73 0.06 Single Amp 58 AHT19 0.1
COR024 0.06 Single Amp 58 COR016 0.1
COR092 0.1 Single Amp 58 COR038 0.1
Chrom1 58 ASB41 0.12 Single Amp 58 LEX4 0.1
NVHEQ100 0.06 Single Amp 58 LEX38 0.1
ASB8 0.08 Single Amp 58 LEX68 0.1
HMS15 0.08 Single Amp 58 SGCV16 0.1

TABLE 5
MPX Tm Conc MPX Conc
Name (° C.) Marker (μM) Name Tm (° C.) Marker (μM)
Chr1-A 58 HTG12 0.2 Chr1-D 58 LEX49 1
UM043 0.2 1CA25 0.2
TKY295 0.2 Chr1-E 58 UM026 0.2
Chr1-B 58 AHT58 0.2 HMS15 0.2
UM004 0.2 Chr1F 58 AHT21 0.2
Chr1-C 58 TKY342 0.2 ASB8 0.2
UCD440 1 1CA43 0.2

TABLE 6
Maximum Human Chromosome:
Locus (S) (E) Accession MB
1CA25 99.6 6E−18 AC06773.1 HSA15: 75.35-75.49
UM043 73.8 3E−10 AC129980.6 HSA15: 71.03-71.23
HTG12 89.7 5E−15 AC105014.5 HSA15: 66.65-62.77
AHT58 163 4E−37 AC090543.12 HSA15: 62.61-62.77
UM004 141 1E−30 AC011927.11 HSA15: 60.55-60.68
UCD440 266 3e−68 AC009554.14 HSA15: 59.88-60.07
HMS15 91.7 1E−15 AC084759.2 HSA15: 51.91-52.07
TKY410 222 5E−55 AC016044.11 HSA15: 50.82-50.97
UM026 240 2E−60 AC091005.9 HSA15: 36.00-36.15

TABLE 7
Primer Sequence Applicationa
CSNK1G1-B CATTTCCTAGGGCACCATGGAG
PPIB-5UTR-F TCTTCTCCCGGTGGATGCT G, I1
PPIB-211-R GCGAAGAGCACCTTCATGTTCG
PPIB-312-F TTTGACCTGCGAATTGGAGATG G, I2
PPIB-388-R CACTGTTTTTGGAACAGTCTTTCC G, I1
PPIB-477-F AGGGTGGAGACTTCACCCGG G, I3
PPIB-484-R CCACCCTGGATCATGAAGTCCT G, I2
PPIB-575-F GGCTGGGTGAGCATGGCCAA G, I4, R
PPIB-657-R CTAGCCAGGCTGTCTTCACG G, I3
PPIB-748-F CCCTGAAGGATGTGACAA G
PPIB-799-R GGGCTTCTCCACCTCRATCTT G, I4, R
SNX22-F AAACGCCTGCCYAACTGG G
Modified Mar- CGACTCACTATAGGGCTCGAGC R
athon Adapter
aG = genomic DNA amplification; R = RACE cDNA amplification; I# = Intron x amplification

Claims

What is claimed is:

1. A kit for detecting a SNP associated with HERDA comprising:

(a) an isolated polynucleotide comprising position 115 of a polynucleotide encoding PPIB; and

(b) primers that specifically amplify the nucleic acid.

2. The kit of claim 1, wherein the nucleic acid sequence comprises SEQ ID NOS:1, 2, 3 or a complement or subsequence thereof.

3. The kit of claim 1, wherein the primers comprise the sequences set forth in SEQ ID NOS:4 and 5.

4. The kit of claim 1, further comprising the restriction enzyme Ear I.

5. An isolated polynucleotide comprising a sequence at least 95% identical to the sequence set forth in SEQ ID NO:2 or a complement thereof.

6. A polypeptide encoded by the polynucleotide of claim 5.

7. An expression vector comprising a polynucleotide of claim 5, operably linked to an expression control sequence.

8. A host cell comprising an expression vector according to claim 7.

9. The host cell of claim 8, wherein the cell is E. coli.

10. An isolated polynucleotide capable of distinguishing between the sequence provided in SEQ ID NO: 2, or a complement thereof and a nucleic acid encoding a wild type PPIB protein.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: