Patent application title:

DATA PROCESSING, ANALYSIS METHOD OF GENE EXPRESSION DATA TO IDENTIFY ENDOGENOUS REFERENCE GENES

Publication number:

US20100137149A1

Publication date:
Application number:

12/521,498

Filed date:

2007-12-27

Abstract:

Disclosed are a data processing and analysis method of gene expression data for identifying endogenous reference genes and a composition for the quantitative analysis of gene expression, comprising a pair of primers and/or probes useful in the amplification of the identified endogenous reference genes. Introduced with the concepts of “Zero's proportion’ and CV, the me allows different datasets to be integrally analyzed, thereby searching for novel reference genes. By the method, 2,087 genes are first found as housekeeping genes which are expressed in most tissues, and the usefulness thereof in the relative quantification of different target genes is determined by analyzing their expression stability. Out of the 2,087 genes, 13 genes are found to show higher expression stability with lower expression levels across a wide range of samples than traditional reference genes such as GAPDH and ACTB, and therefore are suitable for the normalization of universal genes having relatively low expression levels.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

G16B25/10 »  CPC main

ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression Gene or protein expression profiling; Expression-ratio estimation or normalisation

G16B25/00 »  CPC further

ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression

C12Q2600/166 »  CPC further

Oligonucleotides characterized by their use Oligonucleotides used as internal standards, controls or normalisation probes

C12Q1/6813 »  CPC further

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids Hybridisation assays

C12Q2545/113 »  CPC further

Reactions characterised by their quantitative nature the purpose being quantitative analysis with an external standard/control, i.e. control reaction is separated from the test/target reaction

C12Q1/6851 »  CPC further

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid amplification reactions Quantitative amplification

C12Q2545/101 »  CPC further

Reactions characterised by their quantitative nature the purpose being quantitative analysis with an internal standard/control

C40B40/08 IPC

Libraries , e.g. arrays, mixtures; Libraries containing only organic compounds; Libraries containing nucleotides or polynucleotides, or derivatives thereof Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries

C12Q1/68 IPC

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids

Description

TECHNICAL FIELD

The present invention relates to a data processing and analysis method of gene expression data for identifying endogenous reference genes and a composition for the quantitative analysis of gene expression, comprising a pair of primers and/or probes useful in the amplification of the identified endogenous reference genes. More particularly, the present invention relates to a data processing and analysis method for identifying novel endogenous reference genes using gene expression data from EST, SAGE and microarray datasets with zero's proportion and coefficient of variation, and a composition for the quantitative analysis of gene expression, comprising a pair of primers and/or probes useful in the amplification of the identified endogenous reference genes.

BACKGROUND ART

As many as 50,000-100,000 genes can be found in each human cell, but are selectively used in each cell. Of them, a significant number of genes are involved in basic functions and routine cellular metabolic processes required for the sustenance of the cell. Such genes are called housekeeping genes (hereinafter referred to as “HKG”). In various gene expression analysis methods utilizing the quantification of messenger RNA (hereinafter referred to as “mRNA”) to determine expression levels of specific or multiple genes with the aim of identifying the functions of specific genes, searching for genes directed to specific functions, profiling the gene expression of organisms under specific conditions, and describing other biological purposes, endogenous reference genes mean housekeeping genes useful in the normalization of the mRNA level for the relative quantification of genes of interest. Endogenous reference genes are most widely used to normalize mRNA level for accurate comparison of gene expression between different samples (Vandesompele J et al., Genome Biol 3(7), p. RESEARCH0034, 2002). Endogenous reference genes are usually used in gene expression analysis techniques ranging from conventional reverse transcriptase polymerase chain reaction (hereinafter referred to as “RT-PCR”) to recently developed quantitative real time PCR (hereinafter referred to as “qRT-PCT”), serial analysis of gene expression (hereinafter referred to as “SAGE”) and microarray. Traditional reference genes such as glyceraldehyde-3-phosphate dehydrogenase (hereinafter referred to as “GAPDH”) and β-actin (hereinafter referred to as “ACTB”) have been used without proper validation, assuming that they are expressed at constant levels across different samples, irrespectively cell or tissue type and are not regulated by experimental treatment.

However, it is well known that the expression of traditional reference genes may vary among different tissues and cell types and can be regulated by experimental conditions, including sample treatment, developmental stage and pathological states (Bereta J and Bereta M, Biochem Biophys Res Commun 217(1)363-369, 1995; Tricarico C et al., Anal Biochem 309(2):293-300, 2002; Thellin O et al., J Biotechnol 75(2-3):291-295, 1999; Rubie C et al., Mol Cell Probes 19(2):101-109, 2005; Schmittgen T D and Zakrajsek B A, J Biochem Biophys Methods 46(1-2):69-81, 2000; Zhong H and J Simons W, Biochem Biophys Res Commun 259(3):523-526, 1999; Selvey S et al., Mol Cell Probes 15(5):307-311, 2001; Wu Y Y and L Rees J, Acta Derm Venereol 80(1):2-3, 2000; Lee P D et al., Genome Res 12(2):292-297, 2002; Hamalainen H K et al., Anal Biochem 299(1):63-70, 2001). The use of inappropriate reference genes in the relative quantification of gene expression may result in biased expression profiles. This concern has already been raised by many researchers (Tricarico C et al., Anal Biochem 309(2):293-300 2002; Dheda K et al., Anal Biochem 344(1):141-143, 2005; de Kok J B et al., Lab Invest 85(1):154-159, 2005; Brunner A M et al., BMC Plant Biol 4:14, 2004). Particularly, the selection of proper endogenous reference genes is essential for accurate measurement in qRT-PCR, which is a reliable method for detecting gene expression with high sensitivity and accuracy though accurate normalization, and may not be required in qualitative analysis such as northern blot or conventional RT-PCR (Huggett J et al., Genes Immun 6(4):279-284, 2005).

With the acknowledgement of the importance of the proper validation of traditional reference genes and the identification of more suitable reference genes, a number of studies have been undertaken to select the most suitable genes among commonly used reference genes in specific experimental conditions, or to identify novel genes, which are superior to the traditional genes that are universally used for mRNA quantification. However, most of the previous studies have been focused on the selection (validation) of the most stable genes among commonly used reference genes in specific experimental systems or a given set of limited tissue samples (Goidin D et al., Anal Biochem 295(1):17-21, 2001; Haller F et al., Anal Biochem 335(1):1-9, 2004; Ohl F et al., J Mol Med 83(12):1014-1024, 2005; Radonic A et al., Biochem Biophys Res Commun 313(4):856-862, 2004). Some programs are now available for identifying the most appropriate genes among multiple reference genes using qRT-PCR results (Vandesompele J et al., Genome Biol 3(7), p. RESEARCH0034, 2002; Pfaffl M W et al., Biotechnol Lett 26(6):509-15, 2004; Andersen C L et al., Cancer. Res 64(15):5245-5250, 2004).

In addition, novel endogenous reference genes have been found mostly on the basis of microarray data (Hamalainen H K et al., Anal Biochem 299(1):63-70, 2001; Hoerndli F J et al., Anal Biochem 335(1):30-41, 2004; Czechowski T et al., Plant Physiol 139(1):5-17, 2005; Jin P et al., BMC Genomics, 5(1):55, 2004; Kobayashi M S et al., J. Neurosci Res 76(4):512-518, 2004; Shulzhenko N et al., Biochem Biophys Res Commun 337(1):306-12, 2005). As is well-known, the microarray technique has some problems and limitations (errors) due to the potential for inaccurate cross hybridization between probes and unintended transcripts, the potential for differences in hybridization efficiency between probe sets, and the potential for the incorrect annotation of transcripts (Haverty P M et al., Bioinformatics 20(18):3431-3441, 2004; van Ruissen F et al., BMC Genomics 6:91, 2005). The microarray technique also allows the detection of expression of genes only on the chip, in contrast to expressed sequence tag (hereinafter referred to as “EST”) and SAGE, in which the expression profiles of whole transcripts in samples (cDNA libraries) can be measured (van Ruissen F et al., BMC Genomics 6:91, 2005). The use of gene expression data from different platforms together is expected to complement the limitation of individual platforms. For example, SAGE is far more sensitive than EST for detecting low-abundance transcripts (Sun M et al., BMC Genomics 5(1):1-4, 2004).

Even if an ideal endogenous reference gene does not exist, it is possible to find a more ideal endogenous reference gene applicable to most experimental conditions than traditional reference genes through various, large gene expression data.

Leading to the present invention, intensive and thorough research on accurate comparison of gene expression among different samples, conducted by the present inventors, resulted in the finding that gene expression datasets constructed from microarray data, in addition to EST and SAGE data, are useful in searching for endogenous reference genes, and that novel reference genes identified using the datasets are superior to previously used genes and show more stable expression across a wide range of samples, thus being universally useful for the normalization of gene expression, rather than being limited for use on specific tissue samples or in specific studies.

DISCLOSURE

Technical Problem

Therefore, it is an object of the present invention to provide a method of processing and analyzing gene expression data, with a statistical concept introduced thereinto, to identify endogenous reference genes which are superior to traditional reference genes in terms of expression stability across a wide range of samples, thus being universally useful for the normalization of gene expression, and a composition for the quantitative analysis of gene expression, comprising a pair of primers and/or probes useful in the amplification of the identified endogenous reference genes.

Technical Solution

In order to accomplish the above objects, the present invention provides a method for selecting candidate endogenous reference genes (ERG), comprising: 1) computing expression levels of genes from EST, SAGE and microarray datasets; and 2) identifying genes which are constitutively expressed across a wide range of tissues using the computed gene expression levels of step :L) and zero(0)'s proportions thereof.

Also, the present invention provides a composition for detecting at least one candidate endogenous reference gene selected according to the present invention, comprising a detection reagent applicable to amplification of the candidate endogenous reference gene.

Also, there is provided a method for quantifying an expression level of a gene of interest, comprising: 1) performing real-time PCR to amplify the gene of interest with a pair of primers and/or probes and then performing real-time PCR to amplify the a candidate endogenous reference gene with the composition; and 2) normalizing the expression level of the gene of interest relative to that of the candidate endogenous reference gene.

Furthermore, there is provided a method for selecting guide genes, comprising: measuring the candidate endogenous reference genes selected using the method for coefficient of variation (CV); and ranking the endogenous reference genes in an ascending order of CV.

Also, the present invention provides a composition for detecting at least one guide reference gene identified according to the present invention, comprising a detection reagent applicable to amplification of the guide gene.

There is provided a method for quantifying an expression level of a target gene, comprising: 1) synthesizing cDNA from RNA of a subject; 2) performing real-time PCR to amplify the target gene using a pair of primers and/or probes, with the cDNA serving as a template and then performing real-time PCR to amplify the candidate endogenous reference gene using the composition; and 3) normalizing an expression level of the target gene to that of the candidate endogenous reference gene of step 2).

Moreover, there is provided a method for identifying the amplification of a target gene in genomic DNA, comprising: 1) amplifying the target gene with a pair of primers or probes through real-time PCR, with a genomic DNA of a subject serving as a template and then performing real-time PCR to amplify the candidate endogenous reference gene with the composition; and 2) normalizing an expression level of the target gene to that of the candidate endogenous reference gene.

Advantageous Effects

Introduced with the concepts of ‘Zero's proportion’ and CV, the method of the present invention allows different datasets to be integrally analyzed, thereby searching for novel reference genes. By the method, 2,087 genes were first found as housekeeping genes which are expressed in most tissues, and the usefulness thereof in the relative quantification of different target genes was determined by analyzing their expression stability. Out of the 2,087 genes, 13 genes were found to show higher expression stability with lower expression levels across a wide range of samples than traditional reference genes such as GAPDH and ACTB, and therefore are suitable for the normalization of universal genes having relatively low expression levels.

DESCRIPTION OF DRAWINGS

FIG. 1 is a schematic view showing a process of identifying endogenous reference genes (ERGs). FIG. 2 is a graph showing a functional distribution of candidate ERGs classified according to FunCat (Functional Classification Catalogue):

Numeral: numbers of genes

A: protein fate (folding, modification, destination); B: cellular transport, transport facilitation and transport route; C: transcription; D: cellular communication/signal transduction mechanism; E: cell cycle and DNA processing; F: protein synthesis; G: metabolism; H: energy; I: cell fate; J: interaction with cellular environment; K: interaction with environment(systemic); L: organ differentiation; M: development (systemic); N: protein activity regulation; O: tissue differentiation; P: Biogenesis of cellular components; Q: cell rescue, defense and virulence; and R: cell type differentiation.

FIG. 3 shows correlations of gene expression of 2,087 candidates ERG among four datasets [EST (expressed sequence tag), ShortSAGE, LongSAGE and microarray datasets].

FIG. 4 shows correlations of CV (coefficient of variation %) of 2,087 candidates ERGs among four datasets (EST, ShortSAGE, LongSAGE and microarray datasets).

FIG. 5 is a graph showing the comparison of gene expression between the candidate ERGs, selected according to the present invention, and non-candidate ERGs among each dataset:

Box and Whisker plots: expression distribution expressed as natural log value (1n);

Bottom surface of box: corresponding to 25% of the total expression levels in ascending order; and

Top surface of box: corresponding to 75% of the total expression levels in ascending order.

FIG. 6 shows the comparison of gene expression between the 13 ERGs of the present invention and 13 arbitrarily selected traditional ERGs.

FIG. 7 shows the comparison of CV (%) between the 13 ERGs of the present invention and 13 arbitrarily selected traditional ERGs.

FIG. 8 is a graph showing mRNA level distributions of the novel and traditional ERGs, determined by real-time PCR, in 48 samples including frozen human tissues and cancer cell lines.

FIG. 9 shows mRNA level distributions, expressed as Cp values determined using real-time PCR, of the novel and traditional ERGs in 48 samples (including frozen human tissues and cancer cell lines) and 60 FFPE (formalin-fixed paraffin-embedded) tissues. In the boxes, the middle lines represent median values of Cp, and the bottom and the top surfaces correspond to 25% and 75% of the total Cp values in ascending order, respectively.

BEST MODE

The terms used herein are defined before embodiments of the present invention are described in detail.

The term “candidate reference gene”, as used herein, is intended to refer to a gene, selected using the method of the present invention, which shows a housekeeping gene

(HKG)'s properties of being constitutively expressed across a wide range of tissues.

The term “guide gene”, as used herein, is intended to refer to a gene, selected from among candidate reference genes, which shows as low an expression level and variation in expression level as most transcripts within cells, which is also expressed as “reference gene” or “endogenous reference gene”.

In accordance with an aspect thereof, the present invention provides a method for selecting candidate endogenous reference genes (ERG), comprising:

1) computing expression levels of genes from EST, SAGE and microarray datasets; and

2) identifying genes which are constitutively expressed across a wide range of tissues using the computed gene expression levels of step 1) and zero(0)'s proportions thereof.

Endogenous reference genes (ERG) are most widely used to normalize mRNA levels for an accurate comparison of gene expression between different samples. ERG is usually applied to gene expression analysis, such as RT-PCR (reverse transcriptase polymerase chain reaction), qRT-PCR (quantitative real time PCR), SAGE (serial analysis of gene expression) and microarray. Traditional reference genes, such as glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-actin (ACTB), have been used without proper validation, assuming that they are expressed at constant levels across different samples irrespectively the various origins thereof, and are not regulated according to experimental conditions. However, it is well known that the expression of traditional reference genes may differ from one tissue or cell type to another and can be regulated by experimental conditions, including sample treatment, developmental stage and pathological states.

In order to search for candidate housekeeping genes (HKG) whose expression is maintained on similar levels in most tissues, first, datasets were constructed using EST and SAGE human gene expression data collected from the publicly available CGAP site (The Cancer Genome Project, http://cgap.nci.nih.gov/) and microarray gene expression data obtained from the GeneExpress Oncology Datasuite™ of Gene Logic Inc., based on the Affymetrix Human Genome U133 array set. Although the above-mentioned databases were combined to construct new datasets, it should be noted that availability is not limited to the databases. Using the expression data from the datasets, the expression level of a given gene is determined according to the following Mathematical Formulas 1 and 2. The EST (expressed sequence tag) expression levels and the SAGE expression levels of a gene in a given library can be calculated according to Mathematical Formulas 1 and 2, respectively

 < Mathematical   Formula   1 >  E   T   S   gene   expression =    No   of   E   S   T   of   a   Given   Gene   in   Library Total   No .  of   E   S   T   s   in   Libaray ×  1  , 000 , 000   < Mathematical   Formula   2 >  S   A   G   E   gene   expression = No   of   Tags   of   a   Given   Gene   in   Library Total   No .  of   Tags   in   Libaray × 1 , 000 , 000

In accordance with the present invention, data from the different databases were analyzed to determine their integrity and to identify commonality therebetween. In this regard, the concept of zero (0)'s proportion is introduced to determine the possibility that a given gene might be a housekeeping gene (HKG), which is ubiquitously expressed across most tissues.

 < Mathematical   Formula   3 >  0 '  s   Proportion = No .  of   Tissues   with   No   Expression   of   a   Given   Gene Total   No .  of   Tissues

As expressed by Mathematical Formula 3, zero(0)'s proportion is defined as the ratio of the number of the tissues with no expression of a given gene to the total number of tissues. The lower the 0's proportion is, the higher is the possibility that the given gene might be an HKG. Utilizing the concept of 0's proportion, genes which have low 0's proportions in EST, ShortSAGE, and LongSAGE datasets were sorted. 2,087 genes common to the 3 datasets were selected and categorized as “candidate reference genes” or “candidate ERGs”. The genes which have low 0's proportions refer to genes with 0's proportions less than 0.4 for EST, 0.1 for ShortSAGE, and 0.3 for LongSAGE. The mean gene expression values and CV (%) of the 2,087 candidate reference genes were calculated using another dataset, Affymetrix HG-U133, as well as in EST and SAGE datasets. The expression data of 1,990 UniGene clusters (gene expression data for 5,238 different probe sets, 5317 fragments) corresponding to 2,087 ERGs were obtained.

As a result, a significant correlation of the mean expression values is observed among all of the four datasets (EST (expressed sequence tag), ShortSAGE, LongSAGE and microarray dataset)) (see FIG. 3). Correlation analysis on CV showed lower agreement between datasets than on the mean gene expression levels, although a significant correlation was detected (see FIG. 4).

In addition, the candidate ERGs were compared with non-ERGs with regard to gene expression in each dataset. As we expected, the mean gene expression level of the candidate ERGs was significantly higher than that of non-ERGs in all of the four datasets (p<0.0001) (see FIG. 5).

In accordance with another aspect thereof, the present invention provides a composition for detecting at least one candidate endogenous reference gene selected according to the present invention, comprising a detection reagent applicable to amplification of the candidate endogenous reference gene.

The candidate endogenous reference gene useful in the present invention is one or more genes selected from a group consisting of Accession No. Hs 120(PRDX6), Accession No. Hs 142(SULT1A1), Accession No. Hs 202(BZRP), Accession No. Hs 429(ATP5G3), Accession No. Hs 695(CSTB), Accession No. Hs 808(HNRPF), Accession No. Hs 861(MAPK3), Accession No. Hs 1063(SNRPC), Accession No. Hs 1103(TGFB1), Accession No. Hs 2430(TCFL1), Accession No. Hs 2533(ALDH9A1), Accession No. Hs 2795(LDHA), Accession No. Hs 2853(PCBP1), Accession No. Hs 3100(KARS), Accession No. Hs 3254(MRPL23), Accession No. Hs 3353(G3BP), Accession No. Hs 3416(ADFP), Accession No. Hs 439(STOML2), Accession No. Hs 3530(FUSIP1), Accession No. Hs 3989(PLXNB2), Accession No. Hs 4055(KLF6), Accession No. Hs 4742(GPAA1), Accession No. Hs 4747(DKC1), Accession No. Hs 4766(FAM32A), Accession No. Hs 4859(CCNL1), Accession No. Hs 4997(RBM23), Accession No. Hs 4998(TMOD3), Accession No. Hs 5062(TM4SF8), Accession No. Hs 5086(MGC10433), Accession No. Hs 5120(DNCL1), Accession No. Hs 5158(ILK), Accession No. Hs 5245(FLJ20643), Accession No. Hs 5258(MAGED1), Accession No. Hs 5268(ZDHHC4), Accession No. Hs 5298(ADIPOR1), Accession No. Hs 5308(UBA52), Accession No. Hs 5324(C2orf25), Accession No. Hs 5345(RNPEPL1), Accession No. Hs 5662(GNB2L1), Accession No. Hs 5710(CREG1), Accession No. Hs 5719(CNAP1), Accession No. Hs 5912(FBXO7), Accession No. Hs 5947(RAB8A), Accession No. Hs 6396(JTB), Accession No. Hs 6454(RGS19IP1), Accession No. Hs 6459(GPR172A), Accession No. Hs 6551(ATP6AP1), Accession No. Hs 6891(SFRS6), Accession No. Hs 7101(ANAPC5), Accession No. Hs 7236(NOSIP), Accession No. Hs 7476(ATP6V0B), Accession No. Hs 7527(DKFZP566E144), Accession No. Hs 7744(NDUFV1), Accession No. Hs 7753(CALU), Accession No. Hs 7768(FIBP), Accession No. Hs 7862(PNRC2), Accession No. Hs 7910(RYBP), Accession No. Hs 7917(HIG1), Accession No. Hs 8102(RPS20), Accession No. Hs 8372(UQCR), Accession No. Hs 8737(WDR6), Accession No. Hs 8752(TMEM4), Accession No. Hs 8765(DDX42), Accession No. Hs 8859(CANT1), Accession No. Hs 8867(CYR61), Accession No. Hs 9003(FLJ13868), Accession No. Hs 9015(MGC52000), Accession No. Hs 9043(C14orf120), Accession No. Hs 9234(NIFIE14), Accession No. Hs 9235(NME4), Accession No. Hs 9527(C2orf28), Accession No. Hs 9534(SEC11L1), Accession No. Hs 9573(ABCF1), Accession No. Hs 9589(UBQLN1), Accession No. Hs 9788(NDFIP1), Accession No. Hs 9825(CGI-128), Accession No. Hs 9857(DCXR), Accession No. Hs 10326(COPE), Accession No. Hs 10842(RAN), Accession No. Hs 10848(BMS1L), Accession No. Hs 11125(SPCS1), Accession No. Hs 11184(UBE2R2), Accession No. Hs 11223(IDH1), Accession No. Hs 11355(TMPO), Accession No. Hs 11463(UMP-CMPK), Accession No. Hs 12013(ABCE1), Accession No. Hs 12084(TUFM), Accession No. Hs 12102(SNX3), Accession No. Hs 12107(BC-2), Accession No. Hs 12109(WDR39), Accession No. Hs 12144(KIAA1033), Accession No. Hs 12152(SRPRB), Accession No. Hs 12272(BECN1), Accession No. Hs 12341(ADAR), Accession No. Hs 12457(NUP133), Accession No. Hs 12865(NSFL1C), Accession. No. Hs 13662(MGC5508), Accession No. Hs 14317(NOLA3), Accession No. Hs 14333(FLJ10349), Accession No. Hs 14745(C10orf9), Accession No. Hs 14839(POLR2G), Accession No. Hs 14846(SLC7A1), Accession No. Hs 14894(TGOLN2), Accession No. Hs 15277(C16orf33), Accession No. Hs 15591(COPS6), Accession No. Hs 15738(RAB7), Accession No. Hs 16059(HSPC009), Accession No. Hs 16130(E2-230K), Accession No. Hs 16349(KIAA0431), Accession No. Hs 17118(FLJ11730), Accession No. Hs 17250(MGC4767), Accession No. Hs 17680(FUCA2), Accession No. Hs 17731(FLJ12892), Accession No. Hs 17883(PPM1G), Accession No. Hs 18069(LGMN), Accession No. Hs 18128(C20orf44), Accession No. Hs 18349(MRPL15), Accession No. Hs 19673(MAF1), Accession No. Hs 20013(P29), Accession No. Hs 20107(KNS2), Accession No. Hs 20157(CDK5RAP3), Accession No. Hs 20521(HRMT1L2), Accession No. Hs 20529(LOC127262), Accession No. Hs 20573(IGF1R), Accession No. Hs 20716(TIMM17A), Accession No. Hs 22393(DENR), Accession No. Hs 22543(UBE3A), Accession No. Hs 22546(CYBASC3), Accession No. Hs 22616(KIAA0664), Accession No. Hs 23033(LOC92912), Accession No. Hs 23111(FARSLA), Accession No. Hs 23978(SAFB), Accession No. Hs 24301(POLR2E), Accession No. Hs 24379(TRAPPC1), Accession No. Hs 24601(FBLN1), Accession No. Hs 24950(RGS5), Accession No. Hs 25155(NET1), Accession No. Hs 25450(SLC29A1), Accession No. Hs 25723(MTVR1), Accession No. Hs 26010(PFKP), Accession No. Hs 26023(FOXJ3), Accession No. Hs 26136(MGC14156), Accession No. Hs 26232(MAN2C1), Accession No. Hs 26403(GSTZ1), Accession No. Hs 26518(TM4SF7), Accession No. Hs 27222(NOLA2), Accession No. Hs 28491(SAT), Accession No. Hs 28914(APRT), Accession No. Hs 29203(GBL), Accession No. Hs 29665(CLSTN1), Accession No. Hs 30011(MGC2963), Accession No. Hs 30026(HSPC182), Accession No. Hs 30345(TRAP1), Accession No. Hs 30954(PMVK), Accession No. Hs 31053(CKAP1), Accession No. Hs 31334(C20orf14), Accession No. Hs 31387(DKFZP564J0123), Accession No. Hs 34045(CDCA4), Accession No. Hs 34576(TAX1BP1), Accession No. Hs 34906(BLOC1S2), Accession No. Hs 35052(TEGT), Accession No. Hs 35828(MARK3), Accession No. Hs 36587(PPP1R7), Accession No. Hs 36927(HSPH1), Accession No. Hs 37616(STRA13), Accession No. Hs 37916(DPP7), Accession No. Hs 42806(Cab45), Accession No. Hs 43297(MTPN), Accession No. Hs 47062(POLR2I), Accession No. Hs 50098(NDUFA4), Accession No. Hs 50308(HIP2), Accession No. Hs 50425(TEBP), Accession No. Hs 53066(HSPBP1), Accession No. Hs 54277(FAM50A), Accession No. Hs 54457(CD81), Accession No. Hs 54642(MAT2B), Accession No. Hs 54649(RY1), Accession No. Hs 55682(EIF3S7), Accession No. Hs 55847(MRPL51), Accession No. Hs 58488(CTNNAL1), Accession No. Hs 58992(SMC4L1), Accession No. Hs 59486(HSDL2), Accession No. Hs 61812(PTPN12), Accession No. Hs 65234(DDX27), Accession No. Hs 65238(RNF40), Accession No. Hs 66048(BPY2IP1), Accession No. Hs 66915(C22orf16), Accession No. Hs 68714(SFRS1), Accession No. Hs 9293(HEXB), Accession No. Hs 69554(RNF126), Accession No. Hs 69855(UNR), Accession No. Hs 71465(SQLE), Accession No. Hs 71787(MRPS7), Accession No. Hs 73527(CSNK2B), Accession No. Hs 73722(APEX1), Accession No. Hs 73799(GNAI3), Accession No. Hs 73965(SFRS2), Accession No. Hs 74047(ETFB), Accession No. Hs 74050(FVT1), Accession No. Hs 74137(TMP21), Accession No. Hs 74375(DVL1), Accession No. Hs 74405(YWHAQ), Accession No. Hs 74471(GJA1), Accession No. Hs 74563(OAZ2), Accession No. Hs 74564(SSR2), Accession No. Hs 74576(GDI1), Accession No. Hs 75056(TIMM13), Accession No. Hs 75061(MARCKSL1), Accession No. Hs 75066(TSN), Accession No. Hs 75087(FASTK), Accession No. Hs 75117(ILF2), Accession No. Hs 75133(TFAM), Accession No. Hs 75139(ARFIP2), Accession No. Hs 75189(DAP), Accession No. Hs 75227(NDUFA9), Accession No. Hs 75243(BRD2), Accession No. Hs 75249(ARL6IP), Accession No. Hs 75254(IRF3), Accession No. Hs 75318(TUBA1), Accession No. Hs 75348(PSME1), Accession No. Hs 75438(QDPR), Accession No. Hs 75527(ADSL), Accession No. Hs 75724(COPB2), Accession No. Hs 75798(C20orf111), Accession No. Hs 75841(C12orf8), Accession No. Hs 75890(MBTPS1), Accession No. Hs 75914(RNP24), Accession No. Hs 76111(DAG1), Accession No. Hs 76394(ECHS1), Accession No. Hs 76480(UBL4), Accession No. Hs 76662(ZDHHC16), Accession No. Hs 76686(GPX1), Accession No. Hs 76847(GANAB), Accession No. Hs 77060(PSMB6), Accession No. Hs 77269(GNAI2), Accession No. Hs 77313(CDK10), Accession No. Hs 77422(PLP2), Accession No. Hs 77558(HMGN3), Accession No. Hs 77578(USP9X), Accession No. Hs 77793(CSK), Accession No. Hs 77897(SF3A3), Accession No. Hs 77961(HLA-B), Accession No. Hs 77978(DKFZp761I2123), Accession No. Hs 78466(PSMD8), Accession No. Hs 78601(UROD), Accession No. Hs 78771(PGK1), Accession No. Hs 78880(ILVBL), Accession No. Hs 78888(DBI), Accession No. Hs 78989(ADH5), Accession No. Hs 79064(DHPS), Accession No. Hs 79081(PPP1CC), Accession No. Hs 79088(RCN2), Accession No. Hs 79101(CCNG1), Accession No. Hs 79110(NCL), Accession No. Hs 79322(QARS), Accession No. Hs 79335(SMARCD1), Accession No. Hs 79387(PSMC5), Accession No. Hs 79402(POLR2C), Accession No. Hs 79411(RPA2), Accession No. Hs 79625(C20orf149), Accession No. Hs 80545(RPL37), Accession No. Hs 80919(SYPL), Accession No. Hs 80986(ATP5G1), Accession No. Hs 81328(NFKBIA), Accession No. Hs 81424(SUMO1), Accession No. Hs 81848(RAD21), Accession No. Hs 81964(SEC24C), Accession No. Hs 82201(CSNK2A2), Accession No. Hs 82327(GSS), Accession No. Hs 82719(MGC21416), Accession No. Hs 82793(PSMB3), Accession No. Hs 82887(PPP1R11), Accession No. Hs 82890(DAD1), Accession No. Hs 82916(CCT6A), Accession No. Hs 82927(AMPD2), Accession No. Hs 83190(FASN), Accession No. Hs 83347(AAMP), Accession No. Hs 83383(PRDX4), Accession No. Hs 83734(STX4A), Accession No. Hs 83753(SNRPB), Accession No. Hs 83765(DHFR), Accession No. Hs 83916(NDUFA5), Accession No. Hs 84359(GABARAP), Accession No. Hs 84753(FLJ12442), Accession No. Hs 85155(ZFP36L1), Accession No. Hs 85769(ERBP), Accession No. Hs 85962(DERPC), Accession No. Hs 86131(FADD), Accession No. Hs 87752(MSN), Accession No. Hs 89545(PSMB4), Accession No. Hs 89643(TKT), Accession No. Hs 89649(EPHX1), Accession No. Hs 89781(UBTF), Accession No. Hs 89864(SKIV2L), Accession No. Hs 90061(PGRMC1), Accession No. Hs 90093(HSPA4), Accession No. Hs 90107(ADRM1), Accession No. Hs 90443(NDUFS8), Accession No. Hs 91142(KHSRP), Accession No. Hs 91531(MLLT6), Accession No. Hs 93659(ERP70), Accession No. Hs 93832(LOC54499), Accession No. Hs 95577(CDK4), Accession No. Hs 96530(COX11), Accession No. Hs 96852(FLJ21128), Accession No. Hs 96996(HNRPAO), Accession No. Hs 97616(SH3GL1), Accession No. Hs 97887(RCN1), Accession No. Hs 98751(FUBP3), Accession No. Hs 98791(ACTR1B), Accession No. Hs 102696(MCTS1), Accession No. Hs 102798(PSMA1), Accession No. Hs 103561(ARL6IP4), Accession No. Hs 103834(MGC5576), Accession No. Hs 104839(TIMP2), Accession No. Hs 105547(NPDC1), Accession No. Hs 106185(RALGDS), Accession No. Hs 106876(ATP6VOD1), Accession No. Hs 106909(ANAPC13), Accession No. Hs 107003(CCNB1IP1), Accession No. Hs 107101(FLJ31031), Accession No. Hs 107387(C7orf20), Accession No. Hs 107393(C3orf4), Accession No. Hs 108029(SH3BGRL), Accession No. Hs 108080(CSRP1), Accession No. Hs 108371(E2F4), Accession No. Hs 108408(APH-1A), Accession No. Hs 108957(RPS27L), Accession No. Hs 108969(PTD008), Accession No. Hs 109051(SH3BGRL3), Accession No. Hs 109052(C14orf2), Accession No. Hs 109672(SIAT7F), Accession No. Hs 109798(C6orf48), Accession No. Hs 110695(SF3B5), Accession No. Hs 110849(ESRRA), Accession No. Hs 111286(MRPS11), Accession No. Hs 111577(ITM2C), Accession No. Hs 111801(ARS2), Accession No. Hs 112058(SIVA), Accession No. Hs 112318(TOMM7), Accession No. Hs 112955(NUDT5), Accession No. Hs 114033(SSR1), Accession No. Hs 114286(CD9), Accession No. Hs 114412(TXNL1), Accession No. Hs 115474(RFC3), Accession No. Hs 115792(EXOSC7), Accession No. Hs 116448(GLS), Accession No. Hs 117176(PABPN1), Accession No. Hs 117715(ST5), Accession No. Hs 118110(BST2), Accession No. Hs 118400(FSCN1), Accession No. Hs 118463(PNPLA2), Accession No. Hs 118638(NME1), Accession No. Hs 118722(FUT8), Accession No. Hs 118964(p66alpha), Accession No. Hs 118983(GSDMDC1), Accession No. Hs 19177(ARF3), Accession No. Hs 119192(H2AFZ), Accession No. Hs 119251(UQCRC1), Accession No. Hs 119591(AP2S1), Accession No. Hs 119598(RPL3), Accession No. Hs 120323(DNAPTP6), Accession No. Hs 121088(NUP153), Accession No. Hs 121549(CDIPT), Accession No. Hs 122363(WIPI-2), Accession No. Hs 122523(SND1), Accession No. Hs 124126(ARPC1A), Accession No. Hs 124147(FBXL11), Accession No. Hs 124246(ClOorf119), Accession No. Hs 124366(BBX), Accession No. Hs 125113(CCT8), Accession No. Hs 125867(EVL), Accession No. Hs 125898(GNAS), Accession No. Hs 126497(AEBP2), Accession No. Hs 126774(RAMP), Accession No. Hs 126938(NAPA), Accession No. Hs 127092(DHX38), Accession No. Hs 127249(EAP30), Accession No. Hs 127386(MAMDC2), Accession No. Hs 127764(RAB5C), Accession No. Hs 128065(CTSC), Accession No. Hs 128199(SEPT11), Accession No. Hs 128548(WDR1), Accession No. Hs 129634(CINP), Accession No. Hs 129673(EIF4A1), Accession No. Hs 130031(TRIO), Accession No. Hs 130098(DDX23), Accession No. Hs 130293(CROP), Accession No. Hs 130413(TM9SF2), Accession No. Hs 131226(BNIP3L), Accession No. Hs 132497(PRNPIP), Accession No. Hs 132513 HSD17B12), Accession No. Hs 133892(TPM1), Accession No. Hs 134074(SLC35E1), Accession No. Hs 134688(PSMD13), Accession No. Hs 135406(CEBPZ), Accession No. Hs 136905(UREB1), Accession No. Hs 136947(RALY), Accession No. Hs 137510(NCOR2), Accession No. Hs 138860(ARHGAP1), Accession No. Hs 139896(MAEA), Accession No. Hs 140452(M6PRBP1), Accession No. Hs 142442(HP1-BP74), Accession No. Hs 143187(DDX49), Accession No. Hs 143766(DRPLA), Accession No. Hs 143873(S100A10), Accession No. Hs 144058(EBSP), Accession No. Hs 144468(MGC3234), Accession No. Hs 144835(EEF1G), Accession No. Hs 144868(VTI1B), Accession No. Hs 144941(MUF1), Accession No. Hs 144949(ZNF313), Accession No. Hs 144980(SCAMP4), Accession No. Hs 145049(PLEKHM2), Accession No. Hs 145442(MAP2K1), Accession No. Hs 145575(UBL3), Accession No. Hs 146070(TPM3), Accession No. Hs 146393(HERPUD1), Accession No. Hs 146602(QP-C), Accession No. Hs 146804(SPIN), Accession No. Hs 146806(CUL1), Accession No. Hs 147433(PCNA), Accession No. Hs 148078(RBAF600), Accession No. Hs 148272(CCM2), Accession No. Hs 148330(ARF4), Accession No. Hs 148340(PTPRG), Accession No. Hs 148670(RHOBTB1), Accession No. Hs 149004(FBXO31), Accession No. Hs 149957(RPS6KA1), Accession No. Hs 149983(PEX14), Accession No. Hs 150107(BIRC6), Accession No. Hs 150540(BC002942), Accession No. Hs 150580(SUI1), Accession No. Hs 150837(TXNDC5), Accession No. Hs 151134(OXA1L), Accession No. Hs 151220(KIAA0992), Accession No. Hs 151413(GMFB), Accession No. Hs 151787(U5-116KD), Accession No. Hs 152536(p44S10), Accession No. Hs 153177(RPS28), Accession No. Hs 154023(TXNDC4), Accession No. Hs 154073(SLC35B1), Accession No. Hs 155165(ZFPL1), Accession No. Hs 155218(HNRPUL1), Accession No. Hs 155396(NFE2L2), Accession No. Hs 155829(KIAA0676), Accession No. Hs 156171(PSMC6), Accession No. Hs 156367(RPS29), Accession No. Hs 156667(KIAA1536), Accession No. Hs 157160(MRPS34), Accession No. Hs 157351(PTD004), Accession No. Hs 157379(H2AFV), Accession No. Hs 157394(HAGH), Accession No. Hs 159014(PRPF4B), Accession No. Hs 159118(AMD1), Accession No. Hs 159130(RAF1), Accession No. Hs 159161(ARHGDIA), Accession No. Hs 159699(FBXO21), Accession No. Hs 159799(THRAP2), Accession No. Hs 160958(CDC37), Accession No. Hs 161357(PDHB), Accession No. Hs 162032(HBP1), Accession No. Hs 162233(CHD4), Accession No. Hs 162877(PACSIN2), Accession No. Hs 163645(MOCS2), Accession No. Hs 163776(UBE2J1), Accession No. Hs 163893(PICALM), Accession No. Hs 165195(VAPA), Accession No. Hs 166011(CTNND1), Accession No. Hs 166204(PHF1), Accession No. Hs 166463(HNRPU), Accession No. Hs 166924(SEC13L1), Accession No. Hs 166975(SFRS5), Accession No. Hs 167535(SRP54), Accession No. Hs 168073(TRPC4AP), Accession No. Hs 168799(METTL3), Accession No. Hs 169611(DIABLO), Accession No. Hs 169718(CNN2), Accession No. Hs 170107(UQCRFS1), Accession No. Hs 170131(NFIC), Accession No. Hs 170553(CNOT7), Accession No. Hs 170622(CFL1), Accession No. Hs 171626(SKP1A), Accession No. Hs 172550(PTBP1), Accession No. Hs 172755(BRP44L), Accession No. Hs 172928(COL1A1), Accession No. Hs 173024(NYREN18), Accession No. Hs 173162(NOC4), Accession No. Hs 173381(DPYSL2), Accession No. Hs 173464(FKBP8), Accession No. Hs 173611(NDUFS2), Accession No. Hs 173705(LOC401152), Accession No. Hs 173724(CKB), Accession No. Hs 174050(EDF1), Accession No. Hs 174195(IFITM2), Accession No. Hs 175473(AK1), Accession No. Hs 175955(YT521), Accession No. Hs 177530(ATP5E), Accession No. Hs 177766(PARP1), Accession No. Hs 178551(RPL8), Accession No. Hs 178728(MBD3), Accession No. Hs 179986(FLOT1), Accession No. Hs 180141(CFL2), Accession No. Hs 180312(MRPS16), Accession No. Hs 180414(HSPA8), Accession No. Hs 180877(H3F3B), Accession No. Hs 180903(384D8-2), Accession No. Hs 180909(PRDX1), Accession No. Hs 180933(CXXC1), Accession No. Hs 181046(DUSP3), Accession No. Hs 181112(MED4), Accession No. Hs 181163(HMGN2), Accession No. Hs 181244(HLA-A), Accession No. Hs 181368(PRPF8), Accession No. Hs 181444(TMEM9), Accession No. Hs 182255(NHP2L1), Accession No. Hs 182626(C22orf5), Accession No. Hs 182885(SLC35B2), Accession No. Hs 183684(EIF4G2), Accession No. Hs 183706(ADD1), Accession No. Hs 183800(RANGAP1), Accession No. Hs 183850(DCTD), Accession No. Hs 183994(PPP1CA), Accession No. Hs 184062(C20orf24), Accession No. Hs 184211(PMPCB), Accession No. Hs 184233(HSPA9B), Accession No. Hs 184492(ELAVL1), Accession No. Hs 185172(GNB2), Accession No. Hs 185597(SPG7), Accession No. Hs 187199(MALAT1), Accession No. Hs 187635(RPS15A), Accession No. Hs 187763(BRD4), Accession No. Hs 187866(SDFR1), Accession No. Hs 187946(SLC20A1), Accession No. Hs 188501(PAFAH1B2), Accession No. Hs 188614(PLEKHA5), Accession No. Hs 188879(RBM6), Accession No. Hs 188882(NUDT3), Accession No. Hs 189075(PTK9), Accession No. Hs 189119(CXXC5), Accession. No. Hs 189329(SMURF1), Accession No. Hs 189716(NDUFAB1), Accession No. Hs 189772(CCT2), Accession No. Hs 190028(GSTO1), Accession No. Hs 190086(MRCL3), Accession No. Hs 190334(RAP1A), Accession No. Hs 190384(COPS4), Accession No. Hs 190722(HSPC142), Accession No. Hs 190904(STRN4), Accession No. Hs 191186(TTC17), Accession No. Hs 191346(SEPT7), Accession No. Hs 191518(DHX9), Accession No. Hs 191987(UBE2J2), Accession No. Hs 192316(CDC2L1), Accession No. Hs 192374(TRA1), Accession No. Hs 192425(EIF3S8), Accession No. Hs 193118(RAI17), Accession No. Hs 193163(BIN1), Accession No. Hs 193491(TUBB6), Accession No. Hs 194329(TCEAL4), Accession No. Hs 194718(ZNF265), Accession No. Hs 195464(FLNA), Accession No. Hs 195642(C17orf27), Accession No. Hs 196983(SSFA2), Accession No. Hs 198281(PKM2), Accession No. Hs 199561(RANBP2), Accession No. Hs 199625(HAX1), Accession No. Hs 200063(HDAC7A), Accession No. Hs 200600(SCAMP3), Accession No. Hs 200804(SDCBP), Accession. No. Hs 201253(ch-TOG), Accession No. Hs 201390(WDR45L), Accession No. Hs 201712(GLGL), Accession No. Hs 202011(GK001), Accession No. Hs 202085(VDAC1), Accession No. Hs 202166(HNRPH1), Accession No. Hs 202179(SMN2), Accession No. Hs 203099(KIAA0261), Accession No. Hs 203910(SGTA), Accession No. Hs 204041(AHSA1), Accession No. Hs 204773(MEP50), Accession No. Hs 205163(MRPL3), Accession No. Hs 206500(CTTN), Accession No. Hs 206824(MGC71993), Accession No. Hs 208597(CTBP1), Accession No. Hs 209983(STMN1), Accession No. Hs 210469(ELMO2), Accession No. Hs 210532(KIAA0141), Accession No. Hs 211463(DNM2), Accession No. Hs 211594(PSMC4), Accession No. Hs 211914(NDUFS7), Accession No. Hs 212102(TXNDC7), Accession No. Hs 212395(CIZ1), Accession No. Hs 213061(NUCKS), Accession No. Hs 213470(PSMB7), Accession No. Hs 213541, Accession No. Hs 213666(KIAA0460), Accession No. Hs 213724(SUPT16H), Accession No. Hs 216653(FBXO9), Accession No. Hs 220950(FOXO3A), Accession No. Hs 221847(SLC38A2), Accession No. Hs 222510(DAZAP1), Accession No. Hs 223141(DDX21), Accession No. Hs 224607(SDC1), Accession No. Hs 226007(RDH11), Accession No. Hs 226117(H1F0), Accession No. Hs 226755(YWHAH), Accession No. Hs 227067(ATAD3A), Accession No. Hs 227253(TOMM70A), Accession No. Hs 227777(PTP4A1), Accession No. Hs 229641(PC4), Accession No. Hs 231295(PITPNC1), Accession No. Hs 231616(HSPCO23), Accession No. Hs 232194(KIAA0174), Accession No. Hs 232543(PDCD4), Accession No. Hs 233458(NFYC), Accession No. Hs 233552(CDC2L5), Accession No. Hs 233952(PSMA7), Accession No. Hs 234521(MAPKAPK3), Accession No. Hs 236030(SMARCC2), Accession No. Hs 237536(MGC20781), Accession No. Hs 237971(XTP3TPA), Accession No. Hs 238839(SCYL1), Accession No. Hs 240170(MGC2731), Accession No. Hs 241336(ATPIF1), Accession No. Hs 241543(POLDIP2), Accession No. Hs 241558(ARIH2), Accession No. Hs 241575(GNPTG), Accession No. Hs 241576(DERL1), Accession No. Hs 241579(SERPINH1), Accession No. Hs 242458(SPG21), Accession No. Hs 242947(DGKI), Accession No. Hs 246112(ASCC3L1), Accession No. Hs 246310(ATP5J), Accession No. Hs 246413(CPNE1), Accession No. Hs 246781(FBXO11), Accession No. Hs 247077(RHOA), Accession No. Hs 247186(FBS1), Accession No. Hs 247975(HSPD1), Accession No. Hs 248267(MPST), Accession No. Hs 248941(TAF9), Accession No. Hs 49600(DLGAP4), Accession No. Hs 250009(ARL10C), Accession No. Hs 250429(SUPT6H), Accession No. Hs 250758(PSMC3), Accession No. Hs 250899(HSBP1), Accession No. Hs 250905(LOC51234), Accession No. Hs 251531(PSMA4), Accession No. Hs 252457(MVD), Accession No. Hs 252713(TTC15), Accession No. Hs 252967 DKFZp566C0424), Accession No. Hs 253726(PAPOLA), Accession No. Hs 253903(STOM), Accession No. Hs 254042(BAT1), Accession No. Hs 255015(VPS24), Accession No. Hs 255093(PFKL), Accession No. Hs 255932(XRN2), Accession No. Hs 255935(BTG1), Accession No. Hs 255973(CRI1), Accession No. Hs 256301(MGC13170), Accession No. Hs 256549(NUBP2), Accession No. Hs 257008(PLD3), Accession No. Hs 257341(SAV1), Accession No. Hs 57761(SH3BP5), Accession No. Hs 258551(DNPEP), Accession No. Hs 258563(FEZ2), Accession No. Hs 258798 C10orf86), Accession No. Hs 259461(PALM2-AKAP2), Accession No. Hs 260603(PIP5K2B), Accession No. Hs 262823(FLJ10326), Accession No. Hs 265829(ITGA3), Accession No. Hs 268488(KIAA1185), Accession No. Hs 268530(GPS1), Accession No. Hs 268742(C13orf12), Accession No. Hs 268849(GLO1), Accession No. Hs 268939(MATR3), Accession N Hs 269528(MAK3), Accession No. Hs 269577(PTPRA), Accession No. Hs 269782(GNAQ), Accession No. Hs 269944(MTCH2), Accession No. Hs 270291(ACTN4), Accession No. Hs 270428(SUCLG1), Accession No. Hs 270525(LASS5), Accession No. Hs 270869(ZNF410), Accession No. Hs 271135(ATP5C1), Accession No. Hs 271695(NOB1P), Accession No. Hs 272062(PTPRF), Accession No. Hs 272168(TDE1), Accession No. Hs 272630(ATP6V1D), Accession No. Hs 272927(SEC23A), Accession No. Hs 273077(TMEM14B), Accession No. Hs 274184(TFE3), Accession No. Hs 274772(C15orf15), Accession No. Hs 274873(CARS), Accession No. Hs 275243(S100A6), Accession No. Hs 275775(SEPP1), Accession No. Hs 275865(PCNP), Accession No. Hs 276878(NUP93), Accession No. Hs 277035(MGLL), Accession No. Hs 277517(C11orf2), Accession No. Hs 278186(ARHGEF1), Accession No. Hs 278362(MEA), Accession No. Hs 278426(PDAP1), Accession No. Hs 278429(C9orf78), Accession No. Hs 278500(GNPDA1), Accession No. Hs 278569(SNX17), Accession No. Hs 278573(CD59), Accession No. Hs 278721(SLC39A7), Accession No. Hs 279061(C17orf25), Accession No. Hs 279245(TACC1), Accession No. Hs 279257(PCMT1), Accession No. Hs 279413(POLD1), Accession No. Hs 279529(PX19), Accession No. Hs 279583(DREV1), Accession No. Hs 279623(SEPX1), Accession No. Hs 279640(TPR), Accession No. Hs 279652(MRPL4), Accession No. Hs 279669(TUBG1), Accession No. Hs 279696(SUMF2), Accession No. Hs 279806(DDX5), Accession No. Hs 79836(COMMD9), Accession No. Hs 279920(YWHAB), Accession No. Hs 279929(TMED9), Accession No. Hs 80202(SBF1), Accession No. Hs 280342(PRKAR1A), Accession No. Hs 280378(SNRPB2), Accession No. Hs 282410(CALM1), Accession No. Hs 282700(SPCS2), Accession No. Hs 282901(RNPC2), Accession No. Hs 282998(RBM9), Accession No. Hs 283111(C14orf124), Accession No. Hs 283454(BNIP2), Accession No. Hs 283521(RHEB), Accession No. Hs 283610(APG4B), Accession No. Hs 283652(IDI1), Accession No. Hs 283739(UBQLN4), Accession No. Hs 284208(ANKRD25), Accession No. Hs 284279(HMOX2), Accession No. Hs 284286(MRPS24), Accession No. Hs 284491(PDXK), Accession No. Hs 285354(MAX), Accession No. Hs 285976(LASS2), Accession No. Hs 286221(ARF1), Accession No. Hs 286226(MYO1C), Accession No. Hs 288193(KPNA4), Accession No. Hs 288856(PFDN5), Accession No. Hs 288969(HSCARG), Accession No. Hs 289008(C6orf68), Accession No. Hs 289092(COTL1), Accession No. Hs 289123(DCTN2), Accession No. Hs 289271(CYC1), Accession No. Hs 290243(GBF1), Accession No. Hs 290404(SLC25A3), Accession No. Hs 290758(DDB1), Accession No. Hs 291587(ARID1B), Accession No. Hs 292026(EIF4E2), Accession No. Hs 292063(EIF4B), Accession No. Hs 292078(LARP), Accession No. Hs 292265(ZMYND11), Accession No. Hs 292457, Accession No. Hs 292493(G22P1), Accession No. Hs 292524(CCNH), Accession No. Hs 292579(PTDSS1), Accession No. Hs 293563(FLJ12666), Accession No. Hs 295917(ATP6V1B2), Accession No. Hs 297324(TIMP3), Accession No. Hs 298198(CKLFSF3), Accession No. Hs 298280(ATP5A1), Accession No. Hs 298654(DUSP6), Accession No. Hs 299002(FBL), Accession No. Hs 299055(GDI2), Accession No. Hs 300141(RPL39), Accession No. Hs 300684(RCP9), Accession No. Hs 300772(TPM2), Accession No. Hs 300816 RAB1B), Accession No. Hs 300834(GALNT2), Accession No. Hs 301404(RBM3), Accession No. Hs 301412(Ufc1), Accession No. Hs 302742(MRPS6), Accession No. Hs 302903(UBE2I), Accession No. Hs 303676(G3BP2), Accession No. Hs 304192(DSTN), Accession No. Hs 304682(CST3), Accession No. Hs 306123(MAGEF1), Accession No. Hs 306242(RANBP9), Accession No. Hs 306329(ZA20D3), Accession No. Hs 306425(IBTK), Accession No. Hs 308122(ITPK1), Accession No. Hs 308340(NUP188), Accession No. Hs 308709(GRP58), Accession No. Hs 309090(SFRS7), Accession No. Hs 309231(C6orf153), Accession No. Hs 309641(RNF11), Accession No. Hs 309753(STARD3NL), Accession No. Hs 309849(C14orf159), Accession No. Hs 310542(TOMM40), Accession No. Hs 310645(RAB1A), Accession No. Hs 311072(MRPS35), Accession No. Hs 311346(CMAS), Accession No. Hs 311609(DDX39), Accession No. Hs 311640(RPS27A), Accession No. Hs 312098(ADAM15), Accession No. Hs 313847(TXNDC11), Accession No. Hs 314263(BAZ2A), Accession No. Hs 314359(EIF3S12), Accession No. Hs 315177(IFRD2), Accession No. Hs 315230(GC20), Accession No. Hs 319334(NASP), Accession No. Hs 321391(MGC4549), Accession No. Hs 321541(RAB11A), Accession No. Hs 323363(APG9L1), Accession No. Hs 323489(FLJ20758), Accession No. Hs 324250(NDUFB2), Accession No. Hs 324844(VKORC1), Accession No. Hs 325650(EHD2), Accession No. Hs 326387(MORF4L2), Accession No. Hs 330384(CORO1C), Accession No. Hs 331431(SCC-112), Accession No. Hs 333388(EEF1D), Accession No. Hs 333579(HSPC152), Accession No. Hs 333786(PSMA2), Accession No. Hs 333823(MRPL13), Accession No. Hs 334017(K-ALPHA-1), Accession No. Hs 334479(TRAF7), Accession No. Hs 334534(GNS), Accession No. Hs 334587(RBPMS), Accession No. Hs 334713(BMSC-UbP), Accession No. Hs 334851(LASP1), Accession No. Hs 334868(PPP2R5E), Accession No. Hs 335003(ANKRD11), Accession No. Hs 335057(SEPT2), Accession No. Hs 335163(KIAA1102), Accession No. Hs 335918(FDPS), Accession No. Hs 337295(STIP1), Accession No. Hs 337766(TXNRD1), Accession No. Hs 339278(COPB), Accession No. Hs 339639(COX7A2L), Accession No. Hs 339697(GRINA), Accession No. Hs 343911(E124), Accession No. Hs 345694(KCMF1), Accession No. Hs 346868(EBNA1BP2), Accession No. Hs 348418(DR1), Accession No. Hs 349656(SCARB2), Accession No. Hs 350194(ZMAT2), Accession No. Hs 350229(CASC3), Accession No. Hs 350268(IRF2BP2), Accession No. Hs 350364(C9orf100S), Accession No. Hs 350927(SLC25A6), Accession No. Hs 351099(FLJ10241), Accession No. Hs 351296(LOC51035), Accession No Hs 351316(TM4SF1), Accession No. Hs 351474(PAQR4), Accession No. Hs 351680, Accession No. Hs 351875(COX6C), Accession No. Hs 352341(STCH), Accession No. Hs 352656(GHITM), Accession No. Hs 352768(PSMB1), Accession No. Hs 354056(POR), Accession No. Hs 355141(TNIP1), Accession No. Hs 355606(MGC23909), Accession No. Hs 355643(RNPS1), Accession No. Hs 355708(FLJ20507), Accession No. Hs 355750(MGC5306), Accession No. Hs 355753(DKFZp586M1819), Accession No. Hs 355867(MARS), Accession No. Hs 355927(VDAC2), Accession No. Hs 355934(SFPQ), Accession No. Hs 355983(BZW1), Accession No. Hs 356061(MAP1LC3B), Accession No. Hs 356096(FLJ10350), Accession No. Hs 356190(UBB), Accession No. Hs 356270(SDHD), Accession No. Hs 356285(HMGN1), Accession No. Hs 356331(PPIA), Accession No. Hs 356366(RPS2), Accession No. Hs 356371(RPL28), Accession No. Hs 356377(LOC149603), Accession No. Hs 356467(MGC2747), Accession No. Hs 356501(PHF6), Accession No. Hs 356502(RPLP1), Accession No. Hs 356549(SNRPD3), Accession No. Hs 356630(NUTF2), Accession No. Hs 356647(SNX6), Accession No. Hs 356654(PSMC1), Accession No. Hs 56766( ), Accession No. Hs 356769(MAN2B1), Accession No. Hs 356799, Accession No. Hs 357901(SOX4), Accession No. Hs 362728(SEP15), Accession No. Hs 365116(U2AF1), Accession No. Hs 368084(LRPPRC), Accession No. Hs 368149(CCT7), Accession No. Hs 368157(PYGB), Accession No. Hs 368240(DYRK1A), Accession No. Hs 68264(PPP2R5C), Accession No. Hs 368376(SRPR), Accession No. Hs 368402(LOC51337), Accession No. Hs 368404(EXT2), Accession No. Hs 368525(PDLIM1), Accession No. Hs 368598(LEREPO4), Accession No. Hs 368934(MGC40157), Accession No. Hs 368985(TRIP12), Accession No. Hs 369017(RAB2), Accession No. Hs 369052(SELT), Accession No. Hs 369068(DNCLI2), Accession No. Hs 369125(PSMD14), Accession No. Hs 369285(DKFZP434B168), Accession No. Hs 369356(MLL5), Accession No. Hs 369606(CPSF6), Accession No. Hs 369607(GAK), Accession No. Hs 369614(COPS2), Accession No. Hs 369615(FLJ20551), Accession No. Hs 369761(DAZAP2), Accession No. Hs 369785(MGC2749), Accession No. Hs 369920(RAP1B), Accession No. Hs 370024(SEC31L1), Accession No. Hs 370247(APLP2), Accession No. Hs 370292(BCCIP), Accession No. Hs 370312(FNTA), Accession No. Hs 370408(COMT), Accession No. Hs 370581(CAP1), Accession No. Hs 370770(XPO1), Accession No. Hs 370771(CDKN1A), Accession No. Hs 370895(RPN2), Accession No. Hs 370927(PRO1855), Accession No. Hs 370937(TAPBP), Accession No. Hs 371001(EIF3S9), Accession No. Hs 371416(CARM1), Accession No. Hs 371563(RAB14), Accession No. Hs 371788(DKFZP547E1010), Accession No. Hs 371889(ATP1A1), Accession No. Hs 372003(C9orf10), Accession No. Hs 372050(SMAP-5), Accession No. Hs 372286(CUL3), Accession No. Hs 372331(SPTAN1), Accession No. Hs 372541(KBTBD2), Accession No. Hs 372616(ARL1), Accession No. Hs 372914(NDRG1), Accession No. Hs 373550(TGIF), Accession No. Hs 373741(HM13), Accession No. Hs 373763(HNRPR), Accession No. Hs 373952(CAMTA2), Accession No. Hs 373959(VGLL4), Accession No. Hs 374043(ASXL1), Accession No. Hs 374257(SIAT4A), Accession No. Hs 374378(CKS1B), Accession No. Hs 374477(EWSR1), Accession No. Hs 374503(MORF4L1), Accession No. Hs 374588(RPL17), Accession No. Hs 374596(TPT1), Accession No. Hs 374650(IFITM3), Accession No. Hs 374973(PRPF4), Accession No. Hs 375001(TLN1), Accession No. Hs 375108(CD24), Accession No. Hs 375217(RNF31), Accession No. Hs 376046(BTN3A2), Accession No. Hs 376933(GUK1), Accession No. Hs 377155(LYRIC), Accession No. Hs 378103(RPS5), Accession No. Hs 378532(HBS1L), Accession No. Hs 378808(eIF2A), Accession No. Hs 380403(PCGF4), Accession No. Hs 380774(DDX3X), Accession No. Hs 380953(RPL38), Accession No. Hs 380973(SUMO2), Accession No. Hs 381008(HLA-E), Accession No. Hs 381058(KIAA0146), Accession No. Hs 381072(PPIF), Accession No. Hs 381123(RPL21), Accession No. Hs 381126(RPS14), Accession No. Hs 381189(CBX3), Accession No. Hs 381219, Accession No. Hs 381256(GLTP), Accession No. Hs 382044(MRPS2), Accession No. Hs 382168(NCOA3), Accession No. Hs 385913(ANP32E), Accession No. Hs 385986(UBE2B), Accession No. Hs 386434(ANXA7), Accession No. Hs 386465(CHERP), Accession No. Hs 386939(USP7), Accession No. Hs 387208(FAU), Accession No. Hs 387804(PABPC1), Accession No. Hs 388034(RXRB), Accession No. Hs 388654(ATP6V1G1), Accession No. Hs 388664(RPL11), Accession No. Hs 388739(XRCC5), Accession No. Hs 388927(YY1), Accession No. Hs 388956(C19orf22), Accession No. Hs 389037(MCM3APAS), Accession No. Hs 389107(ATP6V0C), Accession No. Hs 389171(PINK1), Accession No. Hs 389649(DDX48), Accession No. Hs 389734(TCEAL8), Accession No. Hs 389996(CHCHD2), Accession No. Hs 390667(GSTK1), Accession No. Hs 393201(ACTR2), Accession No. Hs 395482(PTK2), Accession No. Hs 396644(PAIP2), Accession No. Hs 396740(NIP30), Accession No. Hs 396783(SLC9A3R1), Accession No. Hs 397609(RPS16), Accession No. Hs 399800(AKAP8L), Accession No. Hs 400295(RPL30), Accession No. Hs 401509(RBM10), Accession No. Hs 401903(COX5A), Accession No. Hs 401929(RPL10), Accession No. Hs 403917(STK24), Accession No. Hs 404056(EIF3S1), Accession No. Hs 404321(GARS), Accession No. Hs 405144(SFRS3), Accession No. Hs 405410(OGT), Accession No. Hs 405514(LOC284058), Accession No. Hs 405590(EIF3S6), Accession No. Hs 405880(MRPS21), Accession No. Hs 405942(LOC339229), Accession No. Hs 406062(NDUFA11), Accession No. Hs 406068(UBE2M), Accession No. Hs 406096(ZA20D2), Accession No. Hs 406277(SF3A1), Accession No. Hs 406300(RPL23), Accession No. Hs 406423(SF3B2), Accession No. Hs 406510(ATP5B), Accession No. Hs 406520(LOC389541), Accession No. Hs 406534(HMG20B), Accession No. Hs 406590(PGR1), Accession No. Hs 406620(RPS10), Accession No. Hs 406683(RPS15), Accession No. Hs 406799(RAB18), Accession No. Hs 406840(SLC35A4), Accession No. Hs 407368(C19orf13), Accession No. Hs 407580(PKP4), Accession No. Hs 407995(MIF), Accession No. Hs 408018(RPL36), Accession No. Hs 408073(RPS6), Accession No. Hs 408236(TXNL5), Accession No. Hs 408257(NDUFS6), Accession No. Hs 408293(KAB), Accession No. Hs 408324(FLJ10769), Accession No. Hs 408428(CHES1), Accession No. Hs 408581(SVIL), Accession No. Hs 408909(GOLPH3), Accession No. Hs 409140(ATP5O), Accession No. Hs 409223(SSR4), Accession No. Hs 409230(AGPAT1), Accession No. Hs 409834(PHPT1), Accession No. Hs 410197(IDH3G), Accession No. Hs 410596(HAN11), Accession No. Hs 410817(RPL13), Accession No. Hs 411480(AUP1), Accession No. Hs 411641(EIF4EBP1), Accession No. Hs 411847(MAPK6), Accession No. Hs 412103(EFHA1), Accession No. Hs 412117(ANXA6), Accession No. Hs 412196(ESRRBL1), Accession No. Hs 412433(AIP), Accession No. Hs 412468(KLHDC3), Accession No. Hs 412842(ClOorf7), Accession No. Hs 413036(WBSCR22), Accession No. Hs 413482(C21orf33), Accession No. Hs 414579(SCOTIN), Accession No. Hs 415342(KIAA1049), Accession No. Hs 416049(TNPO2), Accession No. Hs 416436(TRIM50A), Accession No. Hs 417004(S100A11), Accession No. Hs 417029(DERP6), Accession No. Hs 418123(CTSL), Accession No. Hs 418175(VPS28), Accession No. Hs 418233(MRPL24), Accession No. Hs 418450(MRPL11), Accession No. Hs 418533(BUB3), Accession No. Hs 418668(ATP5D), Accession No. Hs 419640(PARK7), Accession No. Hs 420269(COL6A2), Accession No. Hs 420272(H2AFY), Accession No. Hs 421257(RPL7), Accession No. Hs 421509(CCT4), Accession No. Hs 422113(ZNF511), Accession No. Hs 423935(RDBP), Accession No. Hs 423968(TTC11), Accession No. Hs 424126(SERF2), Accession No. Hs 424908(LSM5), Accession No. Hs 425777(UBE2L6), Accession No. Hs 426296(C10orf104), Accession No. Hs 426359(DKFZp564J157), Accession No. Hs 429052(ITGB1), Accession No. Hs 429353(SEPN1), Accession No. Hs 429581(RTN4), Accession No. Hs 429819(PITPNA), Accession No. Hs 429839(MGC23908), Accession No. Hs 430425(GNB1), Accession No. Hs 430551(IQGAP1), Accession No. Hs 430606(CS), Accession No. Hs 430657(ARF5), Accession No. Hs 430733(CLNS1A), Accession No. Hs 431101(GNG12), Accession No. Hs 431367(C6orf55), Accession No. Hs 431498(FOXP1), Accession No. Hs 431550(MAP4K4), Accession No. Hs 431668(COX6B1), Accession No. Es 431850(MAPK1), Accession No. Hs 431861(PPP5C), Accession No. Hs 431926 NFKB1), Accession No. Hs 432121(PRDX2), Accession No. Hs 432438(EML4), Accession No. Hs 432491(ESD), Accession No. Hs 432690(SLC39A9), Accession No. Hs 432760(CAPZB), Accession No. Hs 432898(RPL4), Accession No. Hs 432976(NR1H2), Accession No. Hs 433154(PLSCR3), Accession No. Hs 433201(CDK2AP1), Accession No. Hs 433222(NPC2), Accession No. Hs 433291(ARD1), Accession No. Hs 433307(BCKDHA), Accession No. Hs 433343(SRRM2), Accession No. Hs 433345, Accession No. Hs 433419(COX411), Accession No. Hs 433512(ACTR3), Accession No. Hs 433529(RPS11), Accession No. Hs 433540(DNAJC8), Accession No. Hs 433573(Bles03), Accession No. Hs 433615(TUBB2), Accession No. Hs 433701(RPL37A), Accession No. Hs 433722(KIAA1967), Accession No. Hs 33732(CLK1), Accession No. Hs 433750(EIF4G1), Accession No. Hs 433759(BANF1), Accession No. Hs 433795(SHC1), Accession No. Hs 433863(PBP), Accession No. Hs 433901(COX8A), Accession No. Hs 433951(GPX4), Accession No. Hs 434102(HMGB1), Accession No. Hs 434207(HARS2), Accession No. Hs 434219(ANKHD1), Accession No. Hs 434401(ZNF638), Accession No. Hs 434937(PPIB), Accession No. Hs 434953(HMGB2), Accession No. Hs 434980(APP), Accession No. Hs 435044(TBC1D22A), Accession No. Hs 435064(KIAA1608), Accession No. Hs 435120(KIF1C), Accession No. Hs 435136(TXN), Accession No. Hs 435166(LBR), Accession No. Hs 435231(ZFR), Accession No. Hs 435255(UBXD1), Accession No. Hs 435326(ACTL6A), Accession No. Hs 435512(PPP3CA), Accession No. Hs 435535(ZNF395), Accession No. Hs 435610(WAC), Accession No. Hs 435741(GCSH), Accession No. Hs 435759(THAP4), Accession No. Hs 435771(API5), Accession No. Hs 435841(TNRC15), Accession No. Hs 435850(LYPLA1), Accession No. Hs 435933(PHF10), Accession No. Hs 435948(ATAD1), Accession No. Hs 435952(CDK5RAP1), Accession No. Hs 435974(MTHFD1), Accession No. Hs 436035(TUBA6), Accession No. Hs 436093(BAT2), Accession No. Hs 436204(ZNF289), Accession No. Hs 436298(EMP1), Accession No. Hs 436405(IDH3B), Accession No. Hs 436437(ALDH2), Accession No. Hs 436446(ARMET), Accession No. Hs 436500(DBNL), Accession No. Hs 436568(CD74), Accession No. Hs 436578(POLR2F), Accession No. Hs 436657(CLU), Accession No. Hs 436687(SET), Accession No. Hs 436803(VBP1), Accession No. Hs 437056(SUPT5H), Accession No. Hs 437060(CYCS), Accession No. Hs 437110(ANXA2), Accession No. Hs 437178(ACADVL), Accession No. Hs 437256(GRINL1A), Accession No. Hs 437277(MGAT4B), Accession No. Hs 437367(GBAS), Accession No. Hs 437388(PIGT), Accession No. Hs 437403(PP), Accession No. Hs 437594(RPLP2), Accession No. Hs 437638(XBP1), Accession No. Hs 437779(Cllorf10), Accession No. Hs 437831(C14orf32), Accession No. Hs 438072(UNC84A), Accession No. Hs 438219(GPS2), Accession No. Hs 438429(RPS19), Accession No. Hs 438678(TALDO1), Accession No. Hs 438720(MCM7), Accession No. Hs 438970(TBL1XR1), Accession No. Hs 438974(CUTL1), Accession No. Hs 439480(RBM5), Accession No. Hs 439481(SUPT4H1), Accession No. Hs 439548(FLJ22875), Accession No. Hs 439552, Accession No. Hs 439815(HBXIP), Accession No. Hs 440382(RFP), Accession No. Hs 440544(CLIC4), Accession No. Hs 440599(DDX1), Accession No. Hs 440604(PSMD7), Accession No. Hs 440899(TTYH3), Accession No. Hs 440932(SEPT9), Accession No. Hs 440960(RAD23A), Accession No. Hs 440961(CAST), Accession No. Hs 441072(POLR2L), Accession No. Hs 441550(C20orf22), Accession No. Hs 442344(IRS2), Accession No. Hs 442798(RNF10), Accession No. Hs 443134(GBA2), Accession No. Hs 443379(PSMD11), Accession No. Hs 443837(NPEPPS), Accession No. Hs 443914(SOD1), Accession No. Hs 444279(DKFZp761C169), Accession No. Hs 444356(GRB2), Accession No. Hs 444468(CTDSP1), Accession No. Hs 444472(SDHC), Accession No. Hs 444569(VMP1), Accession No. Hs 444673(CRR9), Accession No. Hs 444724(AZI2), Accession No. Hs 444818(CGGBP1), Accession No. Hs 444931(CRSP6), Accession No. Hs 444969(C2orf4), Accession No. Hs 444986(METAP2), Accession No. Hs 445081(NS5ATP13TP2), Accession No. Hs 445351(LGALS1), Accession No. Hs 445394(VPS29), Accession No. Hs 445498(SKIIP), Accession No. Hs 445511(RIOK3), Accession No. Hs 445570(CD63), Accession No. Hs 445803(DC2), Accession No. Hs 445893(KHDRBS1), Accession No. Hs 445977(GTF3A), Accession No. Hs 446017(WSB1), Accession No. Hs 446091(WTAP), Accession No. Hs 446123(CAPZA2), Accession No. Hs 446149(LDHB), Accession No. Hs 446260(PSMA6), Accession No. Hs 446336(PXN), Accession No. Hs 446345(FTH1), Accession No. Hs 446414(CD47), Accession No. Hs 446427(OAZ1), Accession No. Hs 446445(YIF1), Accession No. Hs 446450(ITM2B), Accession No. Hs 446574(TMSB10), Accession No. Hs 446588(RPS13), Accession No. Hs 446623(HNRPL), Accession No. Hs 446628(RPS4X), Accession No. Hs 446641(ARAF), Accession No. Hs 446852(EIF3S6IP), Accession No. Hs 447477(ST13), Accession No. Hs 447492(PGAM1), Accession No. Hs 447547(VPS35), Accession No. Hs 48226(RPLP0), Accession No. Hs 448588(NGFRAP1), Accession No. Hs 448646(RPL27A), Accession No. Hs 448879, Accession No. Hs 449114(HNRPC), Accession No. Hs 449171(HNRPK), Accession No. Hs 454534(USF2), Accession No. Hs 454699(IL6ST), Accession No. Hs 456507(PKD1-like), Accession No. Hs 456557(FLJ10597), Accession No. Hs 458320(DC12), Accession No. Hs 458358(TSPYL1), Accession No. Hs 458414(IFITM1), Accession No. Hs 458458(C19orf27), Accession No. Hs 458747(ANP32A), Accession No. Hs 459106(OAZIN), Accession No. Hs 459149(BTBD1), Accession No. Hs 459174(FLJ23790), Accession No. Hs 459211(AKAP13), Accession No. Hs 459596(MPG), Accession No. Hs 459649(CLCN7), Accession No. Hs 459927(PTMA), Accession No. Hs 459940(LITAF), Accession No. Hs 460238(SH3GLB2), Accession No. Hs 460317(ALS4), Accession No. Hs 460336(GGA2), Accession No. Hs 460468(XPO6), Accession No. Hs 460499(ATXN2L), Accession No. Hs 460574(LOC124446), Accession No. Hs 460923(CNOT1), Accession No. Hs 460929(GOT2), Accession No. Hs 460978(APPBP1), Accession No. Hs 461047(G6PD), Accession No. Hs 461131(CYB5-M), Accession No. Hs 461361(CFDP1), Accession No. Hs 461379(GABARAPL2), Accession No. Hs 461722(HSPC176), Accession No. Hs 461777(PCOLN3), Accession No. Hs 461896(CRK), Accession No. Hs 461925(RPA1), Accession No. Hs 462035(UBE2G1), Accession No. Hs 462086(RIP), Accession No. Hs 462306(UBE2S), Accession No. Hs 462316(TTC19), Accession No. Hs 462492(USP22), Accession No. Hs 462550(PIGS), Accession No. Hs 462956(PPARBP), Accession No. Hs 462998(IGFBP4), Accession No. Hs 463010(SMARCE1), Accession No. Hs 463035(FKBP10), Accession No. Hs 463041(RERE), Accession No. Hs 463059(STAT3), Accession No. Hs 463295(CDC27), Accession No. Hs 463506(AKAP1), Accession No. Hs 463702(BCAS3), Accession No. Hs 463797(Clorf33), Accession No. Hs 464071(PGD), Accession No. Hs 464137(ACOX1), Accession No. Hs 464210(SYNGR2), Accession No. Hs 464336(P4HB), Accession No. Hs 464438(AGTRAP), Accession No. Hs 464472(MRLC2), Accession No. Hs 464595(PPP4R1), Accession No. Hs 464652(TNFSF5IP1), Accession No. Hs 464912(P15RS), Accession No. Hs 465224(NARS), Accession No. Hs 465374(EFHD2), Accession No. Hs 465498(TXNL4A), Accession No. Hs 465529(MIDN), Accession No. Hs 465543(BTBD2), Accession No. Hs 465627(MAP2K2), Accession No. Hs 465645(C19orf10), Accession No. Hs 465808(HNRPM), Accession No. Hs 465849(PIN1), Accession No. Hs 465924(SDHB), Accession No. Hs 466044(PKN1), Accession No. Hs 466088(TPM4), Accession No. Hs 466148(NR2F6), Accession No. Hs 466471(GPI), Accession No. Hs 466693(SIRT2), Accession No. Hs 466766(LTBP4), Accession No. Hs 466775(SNRPA), Accession No. Hs 467084(EIF4G3), Accession No. Hs 467097(SNRP70), Accession No. Hs 467192(PPP2R1A), Accession No. Hs 467279(LENG4), Accession No. Hs 467284(RPS9), Accession No. Hs 467408(TRIM28), Accession No. Hs 467637(CDC42), Accession No. Hs 467696(HPCAL1), Accession No. Hs 467701(ODC1), Accession No. Hs 467807(LAPTM4A), Accession No. Hs 467824(PUM2), Accession No. Hs 467960(RAB10), Accession No. Hs 468018(PPP1CB), Accession No. Hs 468415(PIGF), Accession No. Hs 468442(CALM2), Accession No. Hs 468760(AFTIPHILIN), Accession No. Hs 469022(DGUOK), Accession No. Hs 469171(DKFZP564D0478), Accession No. Hs 469331(STARD7), Accession No. Hs 469820(RALB), Accession No. Hs 469863(YWHAZ), Accession No. Hs 469925(FLJ14346), Accession No. Hs 469970(SFRS4), Accession No. Hs 470091(YWHAE), Accession No. Hs 470233(ARL5), Accession No. Hs 470417, Accession No. Hs 470477(PTP4A2), Accession No. Hs 470577(EIF2S2), Accession No. Hs 470588(KPNA6), Accession No. Hs 470943(STAT1), Accession No. Hs 471011(SF3B1), Accession No. Hs 471104(NOP5/NOP58), Accession No. Hs 471207(NDUFS1), Accession No. s 471441(PSMB2), Accession No. Hs 471461(ACSL3), Accession No. Hs 471593(CAB39), Accession No. Hs 471768(MGC4796), Accession No. Hs 471818(M11S1), Accession No. Hs 471851(HDLBP), Accession No. Hs 471873(DTYMK), Accession No. Hs 471933(FKBP1A), Accession No. Hs 471975(C20orf116), Accession No. Hs 472010(PRNP), Accession No. Hs 472024(C20orf30), Accession No. Hs 472031(UBE2D3), Accession No. Hs 472038(CGI-94), Accession No. Hs 472056(SYNCRIP), Accession No. Hs 472119(MKKS), Accession No. Hs 472185(NDUFS5), Accession No. Hs 472213(RRBP1), Accession No. Hs 472330(C20orf3), Accession No. Hs 472475(MACF1), Accession No. Hs 472535(AKIP), Accession No. Hs 472558(SDBCAG84), Accession No. Hs 472651(BLCAP), Accession No. Hs 472737(TOP1), Accession No. Hs 473296(TPD52L2), Accession No. Hs 473583(NSEP1), Accession No. Hs 473648(GART), Accession No. Hs 473721(SLC2A1), Accession No. Hs 473761(RTN3), Accession No. Hs 473788(OTUB1), Accession No. Hs 474005(SUMO3), Accession No. Hs 474010(PTTG1IP), Accession No. Hs 474053(COL6A1), Accession No. Hs 474083(B4GALT2), Accession No. Hs 474213(UFD1L), Accession No. Hs 474584(AKR1A1), Accession No. Hs 474643(HSPC117), Accession No. Hs 474751(MYH9), Accession No. Hs 474833(CSNK1E), Accession No. Hs 474914(RUTBC3), Accession No. Hs 474938(SLC25A17), Accession No. Hs 474949(RBX1), Accession No. Hs 474982(ACO2), Accession No. Hs 475125(ATXN10), Accession No. Hs 475319(LRRFIP2), Accession No. Hs 475382(FLJ22405), Accession No. Hs 475392(LOC55831), Accession No. Hs 475663(RAB5A), Accession No. Hs 475733(TOP2B), Accession No. Hs 475812(SIMP), Accession No. Hs 476018(CTNNB1), Accession No. Hs 476033(TLP19), Accession No. Hs 476179(SMARCC1), Accession No. Hs 476221(IHPK2), Accession No. Hs 76231(IMPDH2), Accession No. Hs 476308(ALAS1), Accession No. Hs 476365(SCP2), Accession No. Hs 476448(FLNB), Accession No. Hs 476706(MRPL37), Accession No. Hs 476930(DKFZP5640123), Accession No. Hs 477157(DULLARD), Accession No. Hs 477789(ATP1B3), Accession No. Hs 477892(GYG), Accession No. Hs 478000(MBNL1), Accession No. Hs 478044(PA2G4), Accession No. Hs 478553(EIF4A2), Accession No. Hs 479208(FBXL5), Accession No. Hs 479264(LAP3), Accession No. Hs 479634(SLC30A9), Accession No. Hs 479693(SFRS11), Accession No. Hs 479728(GAPD), Accession No. Hs 479747(BCAR1), Accession No. Hs 479814(POLR2B), Accession No. Hs 480073(HNRPD), Accession No. Hs 480311(PDLIM5), Accession No. Hs 480465(SCYE1), Accession No. Hs 80653(ANXA5), Accession No. Hs 481571(UQCRH), Accession No. Hs 481720(MYO10), Accession No. Hs 481898(KAT3), Accession No. Hs 482144(RPL26), Accession No. Hs 482363(SLC30A5), Accession No. Hs 482526(TINP1), Accession No. Hs 482868(KIAA0372), Accession No. Hs 483036(PJA2), Accession No. Hs 483067(C5orf13), Accession No. Hs 483305(HINT1), Accession No. Hs 483408(PPP2CA), Accession No. Hs 483454(CNN3), Accession No. Hs 483486(JMJD1B), Accession No. Hs 484138(FBXW11), Accession No. Hs 484188(ATP6V0E), Accession No. 484242(ETEA), Accession No. Hs 484288(DDX41), Accession No. Hs 484363(RNF130), Accession No. Hs 484551(CPM), Accession No. Hs 484813(DEK), Accession No. Hs 485155(RPL35), Accession No. Hs 485195(SORT1), Accession No. Hs 485246(PSMA5), Accession No. Hs 485262(MTCH1), Accession No. Hs 485365(AHCYL1), Accession No. Hs 485616(DST), Accession No. Hs 486542(BCLAF1), Accession No. Hs 487027(VIL2), Accession No. Hs 487054(TCP1), Accession. No. Hs 487635(BZW2), Accession No. Hs 487774(HNRPA2B1), Accession No. Hs 488171(KIAA1068), Accession No. Hs 488181(OGDH), Accession No. Hs 488307(DKFZP564K0822), Accession No. Hs 488478(FLJ10099), Accession No. Hs 488671(BAZ1B), Accession No. Hs 489207(ASNS), Accession No. Hs 489284(ARPC1B), Accession No. Hs 489287(CPSF4), Accession No. Hs 489336(SYAP1), Accession No. Hs 489615(PBEF1), Accession No. Hs 490203(CALD1), Accession No. Hs 490394(SSBP1), Accession No. Hs 490415(ZYX), Accession No. Hs 490745(DNAJB6), Accession No. Hs 490795(CHR2SYT), Accession No. Hs 490874(MTX1), Accession No. Hs 491336(ELP3), Accession No. Hs 491359(LMNA), Accession No. Hs 491440(PPP2CB), Accession No. Hs 491494(CCT3), Accession No. Hs 491597(VDAC3), Accession No. Hs 491695(UBE2V2), Accession No. Hs 491745(TCEA1), Accession No. Hs 491988(TRAM1), Accession No. Hs 492236(WDR42A), Accession No. Hs 492314(LAPTM4B), Accession No. Hs 492445(EDD), Accession No. Hs 492599(EIF3S3), Accession No. Hs 492805(CGI-07), Accession No. Hs 493362(AK3L1), Accession No. Hs 493750(WDR40A), Accession No. Hs 494173(ANXA1), Accession No. Hs 494419(LAMP1), Accession No. Hs 494457(NINJ1), Accession No. Hs 494604(ANP32B), Accession No. Hs 494614(XTP2), Accession No. Hs 494691(PFN1), Accession No. Hs 494700(CDW92), Accession No. Hs 494985(FBXW2), Accession No. Hs 495039(NDUFA8), Accession No. Hs 495349(KIAA0515), Accession No. Hs 495471(PMPCA), Accession No. Hs 495605(CD99), Accession No. Hs 495851(MGC4825), Accession No. Hs 495960(ATP6AP2), Accession No. Hs 496068(PCTK1), Accession No. Hs 496098(DKFZp761A052), Accession No. Hs 496271, Accession No. Hs 496487(ATF4), Accession No. Hs 496646(IL13RA1), Accession No. Hs 496684(LAMP2), Accession No. Hs 497183(IVNS1ABP), Accession No. Hs 497599(WARS), Accession No. Hs 497692(Clorf48), Accession No. Hs 497893(ENAH), Accession No. Hs 498239(FH), Accession No. Hs 498313(ADSS), Accession No. Hs 498317(PNAS-4), Accession No. Hs 498455(KIAA0217), Accession No. Hs 498548(RBM17), Accession No. Hs 498727(DHCR24), Accession No. Hs 499145(YME1L1), Accession No. Hs 499158(GGA1), Accession No. Hs 499594(TIMM23), Accession No. Hs 499833(C10orf74), Accession No. Hs 499891(HNRPH3), Accession No. Hs 499925(VPS26), Accession No. Hs 499960(SARA1), Accession No. Hs 500067(PPP3CB), Accession No. Hs 500101(VCL), Accession No. Hs 500375(ENTPD6), Accession No. Hs 500409(GLUD1), Accession No. Hs 500546(IDE), Accession No. Hs 500674(SMBP), Accession No. Hs 500775(ZNF207), Accession No. Hs 500842(MGEA5), Accession No. Hs 500874(CUEDC2), Accession No. Hs 501012(ADD3), Accession No. Hs 501023(MXI1), Accession No. Hs 501203(TIAL1), Accession No. Hs 501293(BSG), Accession No. Hs 501309(CIRBP), Accession No. Hs 501353(PLEKHJ1), Accession No. Hs 501376(UROS), Accession No. Hs 501420(NCLN), Accession No. Hs 501629(IER2), Accession No. Hs 501684(NAP1L4), Accession No. Hs 501735(STIM1), Accession No. Hs 501853(Cllorfl5), Accession No. Hs 501924(USP47), Accession No. Hs 501991(MLSTD2), Accession No. Hs 502302(CAT), Accession No. Hs 502328(CD44), Accession No. Hs 502461(DGKZ), Accession No. Hs 502528(NDUFS3), Accession No. Hs 502630(Cllorf3l), Accession No. Hs 502659(RHOC), Accession No. Hs 502705(PRP19), Accession No. Hs 502745(FADS2), Accession No. Hs 502769(SLC3A2), Accession No. Hs 502773(MTCBP-1), Accession No. Hs 502823(PRDX5), Accession No. Hs 502829(SF1), Accession No. Hs 502836(ARL2), Accession No. Hs 502842(CAPN1), Accession No. Hs 502872(MAP3K11), Accession No. Hs 502876(RHOB), Accession No. Hs 503093(ZFP36L2), Accession No. Hs 503222(RAB6A), Accession No. Hs 503251(PME-1), Accession No. Hs 503597(HSPC148), Accession No. Hs 503709(PORIMIN), Accession No. Hs 503716(MGC2714), Accession No. Hs 503787(DARS), Accession No. Hs 504237(ITM1), Accession No. Hs 504517(RPS27), Accession No. Hs 504613(PTMS), Accession No. Hs 504620(REA), Accession No. Hs 504687(MYL9), Accession No. Hs 504828(DDX47), Accession No. Hs 504895(STRAP), Accession No. Hs 505033(KRAS2), Accession No. Hs 505059(PSMD4), Accession No. Hs 505625(C12orf10), Accession No. Hs 505652(COPZ1), Accession No. Hs 505676(CIP29), Accession No. Hs 505705(MYL6), Accession No. Hs 505806(PBXIP1), Accession No. Hs 505824(CGI-51), Accession No. Hs 506215(RARS), Accession No. Hs 506325(NUDT4), Accession No. Hs 06759(ATP2A2), Accession No. Hs 506861(DDX54), Accession No. Hs 507074(KIAA0152), Accession No. Hs 507162(FLJ12750), Accession No. Hs 507584(MGC9850), Accession No. Hs 507680(PFAAP5), Accession No. Hs 507910(PGRMC2), Accession No. Hs 507916(TGFB1I4), Accession No. Hs 508010(FNDC3A), Accession No. Hs 508644(FLJ10154), Accession No. Hs 509163(KIAA1181), Accession No. Hs 509226(FKBP3), Accession No. Hs 509264(KLHDC2), Accession No. Hs 509414(KTN1), Accession No. Hs 509622(RGL2), Accession No. Hs 509736(HSPCB), Accession No. Hs 509791(ERH), Accession No. Hs 509909(NUMB), Accession No. Hs 510087(ENSA), Accession No. Hs 510328(DDX24), Accession No. Hs 510402(MCP), Accession No. Hs 511067(FLJ10579), Accession No. Hs 511138(DKFZP564G2022), Accession No. Hs 511149(SNAP23), Accession No. Hs 511425(SRP9), Accession No. Hs 511504(TCF12), Accession No. Hs 511862, Accession No. Hs 511952(CBX6), Accession No. Hs 512005(ARPC3), Accession No. Hs 512465(SURF4), Accession No. Hs 512525(RPS17), Accession No. Hs 512607(MIR16), Accession No. Hs 512640(PRKCSH), Accession No. Hs 512661(KIAA1160), Accession No. Hs 512676, Accession No. Hs 512693(FLJ20859), Accession No. Hs 512756(THAP7), Accession No. Hs 512815(AP3D1), Accession No. Hs 512857(CD151), Accession No. Hs 512867(H63), Accession No. Hs 512908(ARPP-19), Accession No. Hs 513043(C15orf12), Accession No. Hs 513055(REC14), Accession No. Hs 513057(RANBP5), Accession No. Hs 513058(TMED3), Accession No. Hs 513071(MESDC1), Accession No. Hs 513083(RPL9), Accession No. Hs 513141(IDH2), Accession No. Hs 513145(NEUGRIN), Accession No. Hs 513153(FURIN), Accession No. Hs 513230(MRPL28), Accession No. Hs 513242(RHOT2), Accession No. Hs 513261(C16orf34), Accession No. Hs 513266(NDUFB10), Accession No. Hs 513470(NFATC2IP), Accession No. Hs 513488(MVP), Accession No. Hs 513490(ALDOA), Accession No. Hs 513520(BCKDK), Accession No. Hs 513522(FUS), Accession No. Hs 513631(ARL2BP), Accession No. Hs 513856(DPH2L1), Accession No. Hs 513984(FLII), Accession No. Hs 514012(MAP2K3), Accession No. Hs 514036(SDF2), Accession No. Hs 514038(FLOT2), Accession No. Hs 514174(JUP), Accession No. Hs 514196(RPL27), Accession. No. Hs 514211(MGC4251), Accession No. Hs 514216(CGI-69), Accession No. Hs 514220(GRN), Accession No. Hs 514297(FLJ13855), Accession No. Hs 514303(PHB), Accession No. Hs 514435(SF3B3), Accession No. Hs 514489(WBP2), Accession No. Hs 514535(LGALS3BP), Accession No. Hs 514581(ACTG1), Accession No. Hs 514590(HGS), Accession No. Hs 514819(AP2B1), Accession No. Hs 514870(ATP5F1), Accession No. Hs 514920(NDP52), Accession No. Hs 514934(CAPZA1), Accession No. Hs 515003(Cl9orf6), Accession No. Hs 515005(STK11), Accession No. Hs 515018(GNA13), Accession No. Hs 515053(AES), Accession No. Hs 515070(EEF2), Accession No. Hs 515092(CLPP), Accession No. Hs 515155(MGC2803), Accession No. Hs 515162(CALR), Accession No. Hs 515164(GADD45GIP1), Accession No. Hs 515210(DNAJB1), Accession No. Hs 515255(LSM4), Accession No. Hs 515266(RENT1), Accession No. Hs 515271(SFRS14), Accession No. Hs 515329(RPL22), Accession No. Hs 515371(CAPNS1), Accession No. Hs 515406(AKT2), Accession No. Hs 515417(EGLN2), Accession No. Hs 515432(DEDD2), Accession No. Hs 515472(SNRPD2), Accession No. Hs 515475(SYMPK), Accession No. Hs 515487(CALM3), Accession No. Hs 515494(SLC1A5), Accession No. Hs 515500(SAE1), Accession No. Hs 515515(KDELR1), Accession No. Hs 515517(RPL18), Accession No. Hs 515524(NUCB1), Accession No. Hs 515540(PTOV1), Accession No. Hs 515550(LOC284361), Accession No. Hs 515598(PRPF31), Accession No. Hs 515607(PPP1R12C), Accession No. Hs 515642(GPSN2), Accession No. Hs 515785(BLVRB), Accession No. Hs 515846(RUVBL2), Accession No. Hs 515848(HADHB), Accession No. Hs 515890(YPEL5), Accession No. Hs 516075(TIA1), Accession No. Hs 516077(FLJ14668), Accession No. Hs 516087(TEX261), Accession No. Hs 516111(DCTN1), Accession No. Hs 516114(WBP1), Accession No. Hs 516157(MAT2A), Accession No. Hs 516450(FLJ20297), Accession No. Hs 516522(FLJ21919), Accession No. Hs 516539(HNRPA3), Accession No. Hs 516587(UBE2Q), Accession No. Hs 516633(NCKAP1), Accession No. Hs 516711(CHPF), Accession No. Hs 516790(ARHGEF2), Accession No. Hs 516807(STK25), Accession No. Hs 516826(TRIB3), Accession No. Hs 516855(CENPB), Accession No. Hs 517080(SLC35C2), Accession No. Hs 517106(CEBPB), Accession No. Hs 517134(C20orf43), Accession No. Hs 517145(ENO1), Accession No. Hs 517168(TAGLN2), Accession No. Hs 517216(PEA15), Accession No. Hs 517232(PEX19), Accession No. Hs 517240(IFNGR2), Accession No. Hs 517262(SON), Accession No. Hs 517293(F11R), Accession No. Hs 517338(ATP6V1E1), Accession No. Hs 17342(DEDD), Accession No. Hs 517356(COL18A1), Accession No. Hs 517357(DGCR2), Accession No. Hs 517421(PCQAP), Accession No. Hs 517438(ASCC2), Accession No. Hs 517517(EP300), Accession No. Hs 517543(PES1), Accession No. Hs 517582(MCM5), Accession No. Hs 517622(UNC84B), Accession No. Hs 517641(L3MBTL2), Accession No. Hs 517666(DIA1), Accession No. Hs 517731(PP2447), Accession No. Hs 517768(DKFZP564B167), Accession No. Hs 517792(C3orf10), Accession No. Hs 517817(MGC3222), Accession No. Hs 517821, Accession No. Hs 517888(CRTAP), Accession No. Hs 517948(DHX30), Accession No. Hs 517949(MAP4), Accession No. Hs 517969(APEH), Accession No. Hs 517981(TUSC2), Accession No. Hs 518060(ARL6IP5), Accession No. Hs 518123(TFG), Accession No. Hs 518236(SEC61A1), Accession No. Hs 518244(RPN1), Accession No. Hs 518249(ZNF9), Accession No. Hs 518250(COPG), Accession No. Hs 518265(H41), Accession No. Hs 518326(SERP1), Accession No. Hs 518346(SSR3), Accession No. Hs 518374(QSCN6), Accession No. Hs 518424(NDUFB5), Accession No. Hs 518460(AP2M1), Accession No. Hs 518464(PSMD2), Accession No. Hs 518525(GLUL), Accession No. Hs 518551(RPL31), Accession No. Hs 518608(PP784), Accession No. Hs 518609(ARPC5), Accession No. Hs 518750(OCIAD1), Accession No. Hs 18805(HMGA1), Accession No. Hs 518827(CCNI), Accession No. Hs 519276(MAPKAPK2), Accession No. Hs 519304(PELO), Accession No. Hs 519346(ERBB2IP), Accession No. Hs 519347(SFRS12), Accession No. Hs 519520(RPS25), Accession No. Hs 519523(SERPINB6), Accession No. Hs 519557(TMEM14C), Accession No. Hs 519718(TTC1), Accession No. Hs 519756(STK10), Accession No. Hs 519818(MGAT1), Accession No. Hs 519909(MARCKS), Accession No. Hs 519930(C6orf62), Accession No. Hs 520026(VARS2), Accession No. Hs 520028(HSPA1A), Accession No. Hs 520037(NEU1), Accession No. Hs 520070(C6orf82), Accession No. Hs 520140(SRF), Accession No. Hs 520189(ELOVL5), Accession No. Hs 520205(EIF2AK1), Accession No. Hs 520210(KDELR2), Accession No. Hs 520287(C6orf111), Accession No. Hs 520313(CD164), Accession No. Hs 520383(STX7), Accession No. Hs 520421(PERP), Accession No. Hs 520459(GTF2I), Accession No. Hs 520623(C7orf27), Accession No. Hs 520640(ACTB), Accession No. Hs 520740(SCRN1), Accession No. Hs 520794(YKT6), Accession No. Hs 520898(CTSB), Accession No. Hs 520943(WBSCR1), Accession No. Hs 520967(MDH2), Accession No. Hs 520973(HSPB1), Accession No. Hs 520974(YWHAG), Accession No. Hs 521064(ZNF655), Accession No. Hs 521151(FLJ22301), Accession No. Hs 521289(REPIN1), Accession No. Hs 521487(MGC8721), Accession No. Hs 521640(RAD23B), Accession No. Hs 521809(COBRA1), Accession No. Hs 521903(LY6E), Accession No. Hs 521924(SIAHBP1), Accession No. Hs 521969(NDUFB11), Accession No. Hs 521973(WDR13), Accession No. Hs 522074(DSIPI), Accession No. Hs 522110(CREB3), Accession No. Hs 522114(CLTA), Accession No. Hs 522310(NANS), Accession No. Hs 522373(GSN), Accession No. Hs 522394(HSPA5), Accession No. Hs 522463(EEF1A1), Accession No. Hs 522507(FBXW5), Accession No. Hs 522584(TMSB4X), Accession No. Hs 522590(EIF1AX), Accession No. Hs 522632(TIMP1), Accession No. Hs 522665(MAGED2), Accession No. Hs 522675(FLJ12525), Accession No. Hs 522752(PSMD10), Accession No. Hs 522817(BCAP31), Accession No. Hs 522819(IRAK1), Accession No. Hs 522823(EMD), Accession No. Hs 522932(NCOA4), Accession No. Hs 522995(EIF4EBP2), Accession No. Hs 523004(PSAP), Accession No. Hs 523012(DDIT4), Accession No. Hs 523054(SMP1), Accession No. Hs 523131(TRAPPC3), Accession No. Hs 523145(DDOST), Accession No. Hs 523215(NDUFB8), Accession No. Hs 523238(NOLC1), Accession No. Hs 523262(C1orf8), Accession No. Hs 523299(EIF3S10), Accession No. Hs 523302(PRDX3), Accession No. Hs 523560(HSPCA), Accession No. Hs 523680(SSRP1), Accession No. Hs 523789(TncRNA), Accession No. Hs 523829(POLD4), Accession No. Hs 523836(GSTP1), Accession No. Hs 523852(CCND1), Accession No. Hs 523875(INPPL1), Accession No. Hs 524009(AASDHPPT), Accession No. Hs 524081(DPAGT1), Accession No. Hs 524084(RNF26), Accession No. Hs 524161(RSU1), Accession No. Hs 524171(RAD52), Accession No. Hs 524183(FKBP4), Accession No. Hs 524195(ARHGAP21), Accession No. Hs 524214(MLF2), Accession No. Hs 524219(TPI1), Accession No. Hs 524271(PHC2), Accession No. Hs 524367(CBARA1), Accession No. Hs 524395(TUBA3), Accession No. Hs 524464(ATP5G2), Accession No. Hs 524502(RNF41), Accession No. Hs 524530(CTDSP2), Accession No. Hs 524590(RAB21), Accession No. Hs 524599(NAP1L1), Accession No. Hs 524690(PPIE), Accession No. Hs 524788(RAB35), Accession No. Hs 524809(RSN), Accession No. Hs 524899(SAP18), Accession No. Hs 524920(ZFP91), Accession No. Hs 524969(Ufml), Accession No. Hs 525134(FLJ20277), Accession No. Hs 525163(ANKRD10), Accession No. Hs 525232(LRP10), Accession No. Hs 525238(C14orf119), Accession No. Hs 525330(ARF6), Accession No. Hs 525391(FLJ20580), Accession No. Hs 525527(RER1), Accession No. Hs 525626(PACS1L), Accession No. Hs 525899(C6orf49), Accession No. Hs 526464(PML), Accession No. Hs 526521(MDH1), Accession No. Hs 527105(HNRPDL), Accession No. Hs 527193(RPS23), Accession No. Hs 527348(AKAP9), Accession No. Hs 527412(ASAH1), Accession No. Hs 527861(OS-9), Accession No. Hs 527862(PKD1), Accession No. Hs 527980(DUT), Accession No. Hs 528050(HARS), Accession No. Hs 528222(NDUFS4), Accession No. Hs 528300(PITRM1), Accession No. Hs 528305(DDX17), Accession No. Hs 528572(SCAM-1), Accession No. Hs 528668(RPL6), Accession No. Hs 528780(GSPT1), Accession No. Hs 528803(UQCRC2), Accession No. Hs 529059(EIF3S4), Accession No. Hs 529132(SEPW1), Accession No. Hs 529244(NCK2), Accession No. Hs 529280(ANAPC7), Accession No. Hs 529303(ARPC2), Accession No. Hs 529369(AFAP), Accession No. Hs 529400(IFNAR1), Accession No. Hs 529420(UBE2G2), Accession No. Hs 529591(TLOC1), Accession No. Hs 529618(TFRC), Accession No. Hs 529631(RPL35A), Accession No. Hs 529782(VCP), Accession No. Hs 529798(BTF3), Accession No. Hs 529862(CSNK1A1), Accession No. Hs 529890(CANX), Accession No. Hs 529892(SQSTM1), Accession No. Hs 529957(SEC63), Accession No. Hs 530096(EIF3S2), Accession No. Hs 530118(LUC7L2), Accession No. Hs 530291(ANXA11), Accession No. Hs 530314(SSNA1), Accession No. Hs 530331(PDHA1), Accession No. Hs 530381(PIM3), Accession No. Hs 530412(PAI-RBP1), Accession No. Hs 530436(STXBP3), Accession No. Hs 530479(PMF1), Accession No. Hs 530687(RNH), Accession No. Hs 530734(MRPL16), Accession No. Hs 530753(FLJ20625), Accession No. Hs 530823(COPS7A), Accession No. Hs 530862(PRKAG1), Accession No. Hs 531081(LGALS3), Accession No. Hs 531089(PSMA3), Accession No. Hs 531176(SARS), Accession No. Hs 531330(CBWD1), Accession No. Hs 531614(BTBD14B), Accession No. Hs 531752(RANBP3), Accession No. Hs 531856(GAS5), Accession No. Hs 531876(DNCL2A), Accession No. Hs 531879(RAD1), Accession No. Hs 532359(RPL5), Accession No. Hs 532399(KIAA0663), Accession No. Hs 532755(GTL3), Accession No. Hs 532790(NMT1), Accession No. Hs 532793(KPNB1), Accession No. Hs 532803(HN1), Accession No. Hs 532826(MCL1), Accession No. Hs 532853(NDUFB7), Accession No. Hs 533030(HRIHFB2122), Accession No. Hs 533059(TUBB), Accession No. Hs 533122(SFRS10), Accession No. Hs 533136(LRPAP1), Accession No. Hs 533192(TOMM20), Accession No. Hs 533222(HSA9761), Accession No. Hs 533245(DDX46), Accession No. Hs 533282(NONO), Accession No. Hs 533308(PPP2R5D), Accession No. Hs 533317(VIM), Accession No. Hs 533437(TCEB1), Accession No. Hs 533440(WWP1), Accession No. Hs 533474(PPP1R8), Accession No. Hs 533479(LYPLA2), Accession No. Hs 533526(ATRX), Accession No. Hs 533624(H3F3A), Accession No. Hs 533712(RBM4), Accession No. Hs 533732(SRP14), Accession No. Hs 533771(STUB1), Accession No. Hs 533782(KRT8), Accession No. Hs 533977(TXNIP), Accession No. Hs 533985(EXOC7), Accession No. Hs 533986(ZNF258), Accession No. Hs 534125(HLA-C), Accession No. Hs 534168(NDUFA1), Accession No. Hs 534212(SEC22L1), Accession No. Hs 534255(B2M), Accession No. Hs 534307(CCND3), Accession No. Hs 534314(EIF5A), Accession No. Hs 534326(ITGB4BP), Accession No. Hs 534338(PPP4C), Accession No. Hs 534346(RPS7), Accession No. Hs 534350(SMARCB1), Accession No. Hs 534453(GRIM19), Accession No. Hs 534456(ANAPC11), Accession No. Hs 534457(C14orf166), Accession No. Hs 534473(TOMM22), Accession No. Hs 534483(MGC2941), Accession No. Hs 536275(PACS1), Accession No. Hs 541269(NDUFB9), Accession No. Hs 546248(CTSD), Accession No. Hs 546250(DNCl2), Accession No. Hs 546253(FDFT1), Accession No. Hs 546261(HNRPA1), Accession No. Hs 546269(RPL10A), Accession No. Hs 546271(PCBP2), Accession No. Hs 546286(RPS3), Accession No. Hs 546289(RPS12), Accession No. Hs 546290(RPS18), Accession No. Hs 546291(NET-5), Accession No. Hs 546339(SMAP), Accession No. Hs 546356(RPL13A), Accession No. Hs 546394(HSPC016), Accession No. Hs 547759(SSBP3), Accession No. Hs 549178(C9orf86), Accession No. Hs 552590(HTF9C), Accession No. Hs 553496(PGM3), Accession No. Hs 553512(C3F), Accession No. Hs 554767(NUP88), Accession. No. Hs 554776(SREBF1), Accession No. Hs 554894(FLJ12953), Accession No. Hs 554896(MGC11257), Accession No. Hs 555194(FAM36A), Accession No. Hs 555866(C1QBP), Accession No. Hs 555873(HNRPAB), Accession No. Hs 555875(IDH3A), Accession No. Hs 555889(PSMC2), Accession No. Hs 555890(RBBP4), Accession No. Hs 555911(RBM8A), Accession No. Hs 555969(RIC8), Accession No. Hs 555971(PP1201), Accession No. Hs 555973(MRPS25), Accession No. Hs 555994(LONP), Accession No. Hs 556267(FBXL10), Accession No. Hs 556461(NDUFV2), Accession No. Hs 556795(PAICS), Accession No. Hs 557550(NPM1), Accession No. Hs 558296(ACP1), Accession No. Hs 558313(COX6A1), Accession No. Hs 558322(EEF1B2), Accession No. Hs 558325(EIF5), Accession No. Hs 558328(FKBP5), Accession No. Hs 558330(FTL), Accession No. Hs 558338(HSPE1), Accession No. Hs 558345(IK), Accession No. Hs 558354(LAMR1), Accession No. Hs 558360(NDUFB4), Accession No. Hs 558361(NME2), Accession No. Hs 558362(NUMA1), Accession No. Hs 558376(RAC1), Accession No. Hs 558381(RNU65), Accession No. Hs 558382(RPL15), Accession No. Hs 558383(RPL18A), Accession No. Hs 558384(RPL19), Accession No. Hs 558385(RPL23A), Accession No. Hs 558386(RPL34), Accession No. Hs 558388(RPS3A), Accession No. Hs 558389(RPS8), Accession No. Hs 558390(RPS24), Accession No. Hs 558391(RPS26), Accession No. Hs 558396(SCD), Accession No. Hs 558424(CSDA), Accession No. Hs 558426(EIF3S5), Accession No. Hs 558429(G10), Accession No. Hs 558431(RPL14), Accession No. Hs 558442(PDCD6IP), Accession No. Hs 558448(TXNL2), Accession No. Hs 558453(ATP5L), Accession No. Hs 558454(NUDC), Accession No. Hs 558458(COPS8), Accession No. Hs 558473(C18orf10), Accession No. Hs 558499(8D6A), Accession No. Hs 558511(PSARL), Accession No. Hs 558521(C2orf33), Accession No. Hs 558591(ORMDL1), Accession No. Hs 558825(PDE4DIP), Accession No. Hs 558995, Accession No. Hs 567260(CD2BP2), Accession No. Hs 567263(Clorf43), Accession No. Hs 567267(ATP2C1) and Accession No. Hs 567279(HCNGP). According to the present invention, the detection reagent is a pair of primers and/or probes applicable to the amplification of the candidate reference gene.

Suitable for use in the composition of the present invention is a pair of a sense primer and an antisense primer, both ranging in length from 10 to 50 bp, corresponding to a sense or antisense sequence of the selected candidate reference gene, respectively. The sense primer is preferably 12˜30 bp, more preferably 15˜26 bp, and most preferably 17˜22 by in length. This is also true of the antisense primer. However, as long as they are useful in the amplification of the gene, the primers used in the present invention can be any length. The primers may be designed using a well-known primer design program. Additionally, the primers are not limited as to their position on the gene, as long as they can be used in the amplification of the gene.

In contrast to previously reported traditional HKGs, in which genes encoding metabolism and ribosome proteins are contained in high proportions (Eisenberg E & Levanon E Y, Trends Genet 19:362-5, 2003; Hsiao L L et al., Physiol Genomics 7:97-104, 2001), genes encoding proteins involved in protein fate (23%, 308/1318) and cellular transport (21%, 273/1318) are found at a high proportion within the candidate ERGs when they are classified by FunCat (Functional Classification Catalogue, Version 2.0, Ruepp A et al., Nucleic Acids Res 32:5539-45, 2004) (see FIG. 2). Further, analysis on the 2,087 genes shows a high frequency of CpG islands, which is in line with the results of previous reports (Larsen F et, al., Genomics 13:1095-107, 1992; Ponger L et al., Genome Res 11:1854-60, 2001) (see TABLE 1).

Moreover, the genes can be detected using microarray, SAGE (Serial Analysis of Gene Expression) or qRT-PCR (quantitative real time PCR). Out of the genes, the most abundant transcript was found to come from EEF1A1 in EST and LongSAGE, from DGK1 in ShortSAGE, and from RPL10A in HG-U133 microarray (see Table 2).

In addition, the reference genes selected and identified according to the present invention are adopted as candidate reference genes which may be useful in the analysis of the genes of interest through the validation of expression stability.

In accordance with a further aspect thereof, the present invention provides a method for quantifying an expression level of a gene of interest, comprising:

1) performing real-time PCR to amplify the gene of interest with a pair of primers and/or probes and then performing real-time PCR to amplify the candidate endogenous reference gene with the composition; and

2) normalizing the expression level of the gene of interest relative to that of the candidate endogenous reference gene.

In accordance with still a further aspect thereof, the present invention provides a method for selecting guide genes, comprising measuring the selected candidate endogenous reference genes for coefficient of variation (CV) and ranking the endogenous reference genes in an ascending order of CV.

In an embodiment, the guide genes are expressed in most human body tissues. The guide genes can be used to normalize expression levels for relative quantification of gene expression between different samples. The higher the coefficient of variation (CV) is, the more greatly the gene expression varies from one tissue to another.

CVs of the candidate reference genes, selected using the selection method of the present invention, were calculated for each UniGene cluster in the datasets including EST, ShortSAGE, LongSAGE and microarray, and the genes were arranged in ascending order of CV. From the candidate ERG were selected the reference genes which were found to be stably expressed across a wide range of tissues. Out of the 400 genes (corresponding to about 20% of the candidate ERG) which were preferentially ranked in ascending order of CV from each dataset, 13 ERGs common to all four datasets were selected (see FIG. 1 and Table 3). The 13 reference genes are identified as Accession No. Hs 500775(ZNF207), Accession No. Hs 446427(OAZ1), Accession No. Hs 530118(LUC7L2), Accession No. Hs 208597(CTBP1), Accession No. Hs 440382(TRIM27), Accession No. Hs 444279(GPBP1), Accession No. Hs 250009(ARL8B), Accession No. Hs 9589(UBQLN1), Accession No. Hs 253726(PAPOLA), Accession No. Hs 146806(CUL1), Accession No. Hs 533222(DIMT1L), Accession No. Hs 494985(FBXW2) and Accession No. Hs 242458(SPG21).

In other words, the reference genes are genes that show lower expression variations than do the other genes among the 2,087 genes expressed in most tissues. The reference genes identified according to the present invention are expressed in a manner similar to that in which the majority of the intracellular transcripts are expressed at low abundance.

In an aspect of gene expression level and CV, the 13 reference genes identified according to the present invention were compared with 13 traditional reference genes (see Table 4). In all datasets, six of the 13 traditional reference genes showed relatively high mean expression levels, while the other traditional reference genes indicated expression levels similar to or lower than those of the reference genes of the present invention. In terms of both expression level and CV, the traditional reference genes are generally greater than the endogenous reference genes of the present invention (see FIGS. 6 and 7).

In order to validate the suitability of the 13 genes for reference genes, they were examined for gene copy number variation with reference to the Database of Genomic

Variants(//projects.tcag.ca/variation/)(see Table 5). As a result, only OAZ1 and DIMT1L, among the 13 genes of the present invention, were found on chromosome regions known for gene copy variation, whereas many (ACTS, GAPDH, PGK1, B2M, TBP, TFRC, ALAS1) of the traditional reference genes were located in such chromosome regions.

Furthermore, the quantitative real-time RT-PCR (qRT-PCR) analysis (see Table 7) of ERG on human tissue samples and cancer cell lines (see Table 6) indicated that the 13 novel ERGs were expressed in all 48 samples, including frozen human tissues and cancer cell lines (see FIG. 8). The novel 13 ERGs ranged from 19 to 29 in Cp (Crossing Point, the cycle number at which fluorescence crosses the background signal upon qRT-PCR) (see FIG. 9). In addition, using geNorm v3.4 software (Vandesompele J et al., Genome Biol 3:RESEARCH0034, 2002) and NormFinder software (Andersen C L et al., Cancer Res 64:5245-50, 2004), ERGs were analyzed for expression stability according to the following Mathematical Formula 4 in consideration of the efficiency of the PCR performed above (see Table 8). All of the 13 novel ERGs according to the present invention were found to show higher expression stability than were the traditional ERGs as calculated by the geNorm and NormFinder programs (see Table 9). In Table 9, lower expression stability values (M by geNorm, S by NormFinder) mean more stable expression.


Relative Expression=(1+ECpΔCp=Minimum Cp−Sample Cp;


Minimum Cp=lowest Cp value; and


E=PCR Efficiency   <Mathematical Formula 4>

There was no significant correlation between the M values, which were calculated with geNorm (M) and CV in microarray and LongSAGE datasets, but significance was found in EST and ShortSAGE datasets. Likewise, as for the stability values(S), calculated with NormFinder, significant correlation was found in EST, ShortSAGE and LongSAGE, but not in microarray. Both the M and the S values showed highest agreement with CV in ShortSAGE (see Table 10).

These results indicate that the reference genes identified according to the present invention are more stably expressed than are the traditional reference genes.

In consideration of the fact that the majority of intracellular transcripts are expressed in low abundance (Warrington J A et al., Physiol Genomics 2(3):143-147, 2000), traditional reference genes, having high expression levels, may not be suitable for use in normalization. A reference gene with an expression level similar to that of a target gene is recommended, so that the measurement can be done on the same linear scale (Szabo A et al., Genome Biol 5(8):R59, 2004; RocheAppliedScience Technical Note No. LC 15/2005). Therefore, the endogenous reference genes identified according to the present invention are believed to be more suitable and widely used because they show relatively lower expression and lower variability than do the traditional reference genes (Czechowski T et al., Plant Physiol 139(1):5-17, 2005).

In accordance with still another aspect thereof, the present invention provides a composition for detecting at least one of the guide genes identified according to the present invention, comprising a detection reagent applicable to amplification of the guide gene.

In an embodiment of this aspect, the guide genes feature low expression levels, like most low-abundance intracellular transcripts. The guide gene useful in the present invention is one or more genes selected from a group consisting of Accession No. Hs 500775(ZNF207), Accession No. Hs 446427(OAZ1), Accession No. Hs 530118(LUC7L2), Accession No. Hs 208597(CTBP1), Accession No. Hs 440382(TRIM27), Accession No. Hs 444279(GPBP1), Accession No. Hs 250009(ARL8B), Accession No. Hs 9589(UBQLN1), Accession No. Hs 253726(PAPOLA), Accession No. Hs 146806(CUL1), Accession No. Hs 533222(DIMT1L), Accession No. Hs 494985(FBXW2) and Accession No. Hs 242458(SPG21). According to the present invention, the detection reagent is a pair of primers and/or probes applicable to the amplification of the guide gene.

Suitable for use in the composition of the present invention is a pair of a sense primer and an antisense primer, both ranging in length from 10 to 50 by corresponding to sense or antisense sequence of the identified guide genes, respectively. The sense primer is preferably 12˜30 bp, more preferably 15˜26 bp, and most preferably 17˜22 by in length. This is also true of the antisense primer. However, as long as they are useful in the amplification of the gene, any length of primers can be used in the present invention. The primers may be designed using a well-known primer design program. Additionally, the primers are not limited by the position on the gene as long as they can be used in the amplification of the gene.

In addition, the detection method is preferably conducted using microarray, SAGE (Serial Analysis of Gene Expression) or qRT-PCR (quantitative real time PCR).

In accordance with yet a further aspect thereof, the present invention provides a method for quantifying an expression level of a target gene, comprising:

1) synthesizing cDNA from RNA of a subject;

2) performing real-time PCR to amplify the target gene using a pair of primers and/or probes, with the cDNA serving as a template and then performing real-time PCR to amplify the candidate endogenous reference gene using the composition; and

2) normalizing the expression level of the target gene to that of the candidate endogenous reference gene.

In accordance with yet another aspect thereof, the present invention provides a method for identifying the amplification of a target gene in genomic DNA, comprising:

1) amplifying the target gene with a pair of primers or probes through real-time POR, with a genomic DNA of a subject serving as a template and than performing real-time PCR to amplify the candidate endogenous reference gene with the composition; and

2) normalizing the expression level of the target gene to that of the candidate endogenous reference gene.

MODE FOR INVENTION

A better understanding of the present invention may be obtained through the following examples which are set forth to illustrate, but are riot to be construed as the limit of the present invention.

Example 1

Gene Expression Dataset Construction

EST (expressed sequence tag) and SAGE (serial analysis of gene expression) human gene expression data were collected from the publicly available CGAP site (The Cancer Genome Project, http://cgap.nci.nih.gov/). Microarray gene expression data were obtained from the GeneExpress Oncology Datasuite™ of Gene Logic Inc., based on the Affymetrix Human Genome U133 array set.

Out of a total of 8,633 libraries in Hs_LibData.dat (31/Oct/05) file, 77 libraries meeting the requirements: 1) non-normalized and 2) >10,000 sequences, were included in the EST dataset constructed from the CGAP site. EST frequency in each library was obtained from Hs_ExprData.dat (31/Oct/05) file. 29 different tissues, including normal and tumor samples, and 26,117 UniGene clusters were included in these libraries.

SAGE short data for all 280 libraries (Hs_short.frequencies.gz, 05/Dec/06), representing 38,290 UniGene clusters, and SAGE long data (Hs_long.frequencies.gz, 05/Dec/06) for 46 libraries, representing 21,868 UniGene clusters, were used in creating the dataset for SAGE short (ShortSAGE) and long (LongSAGE), respectively. Also, SAGE tags were mapped to UniGene clusters using the files Hs_short.best_gene.gz (05/Dec/06) and Hs_long.best_gene.gz (05/Dec/06). ShortSAGE and LongSAGE contained information on SAGE expression in 28 and 9 different tissues, including normal and tumor samples, respectively.

Affymetrix GeneChips gene expression data from 567 different samples representing 13 different tissues including the brain, the breast, the colon, the esophagus, the kidney, the liver, the lung, the lymph node, the ovary, the pancreas, the prostate, the rectum and the stomach were also analyzed (Table 11). Affymetrix (CA) HG-U133 and 44,760 different probe sets (total 44,928 probe sets) were included in the microarray dataset.

Example 2

Selection of Candidate ERG

Using the datasets constructed in Example 1, expression level was calculated for UniGene clusters so as to search for housekeeping genes which are constitutively expressed in most human tissues.

Gene expression levels of EST dataset for each gene were calculated as the number of ESTs of a gene in a given library, divided by the total number of ESTs in all genes in a given library and then multiplied by 1,000,000, as expressed by Mathematical Formula 1.

Likewise, Gene expression levels of SAGE dataset for each gene were calculated as the number of tags (sum of tag frequency) of a gene in a given library, divided by the total number of tags and then multiplied by 1,000,000, as expressed by Mathematical Formula 2.

 < Mathematical   Formula   1 >  E   T   S   gene   expression =    No   of   E   S   T   of   a   Given   Gene   in   Library Total   No .  of   E   S   T   s   in   Libaray ×  1  , 000 , 000   < Mathematical   Formula   2 >  S   A   G   E   gene   expression = No   of   Tags   of   a   Given   Gene   in   Library Total   No .  of   Tags   in   Libaray × 1 , 000 , 000

Expression levels in Microarray dataset were represented by the signal intensity calculated for each transcript by the analysis algorithm of Affymetrix Microarray Suite 5.0. Mean gene expression was defined as the average of gene expression level of a given gene in all libraries.

HKGs for use in identifying endogenous reference genes, which are expressed in most human tissues, were investigated using EST and SAGE datasets. In order to examine whether a given gene might be an HKG which is constitutively expressed across a wide range of tissues, the proportion of the tissues not expressing the given gene to the total tissues of the EST and SAGE datasets was calculated. If gene expression frequency is found in any one library of multiple libraries corresponding to one tissue, that gene was considered to be expressed in that tissue. For this, the 0's proportion, which is defined as the ratio of the number of the tissues in which a given gene was not expressed to the total number of tissues, was introduced. In the 0's proportion, “0” indicates that the gene is expressed in all tissues, and conversely, “1” means that the gene is not expressed in any tissue.

 < Mathematical   Formula   3 >  0 '  s   Proportion = No .  of   Tissues   with   No   Expression   of   a   Given   Gene Total   No .  of   Tissues

In a study of 101 samples obtained from 47 different human tissues and cell lines, cutoff values for the 0's proportion were determined in each of EST and SAGE datasets so as to include most of the 575 housekeeping genes identified from previous microarray data using the Affymetrix U95A chip (CA), containing 2,600 probes (Eisenberg E and Levanon E Y, Trends Genet, 19(7), 362-365, 2003). Genes with 0's proportion<0.4 for EST (EST, 4,027 UniGene clusters), 0.1 for ShortSAGE (4,758 UniGene clusters) and 0.3 for LongSAGE (4,569 UniGene clusters) were sorted. 2,087 genes common to the three datasets were selected

Out of the 575 genes obtained by U95A, 451(78.43%) in EST, 432(75.13%) in ShortSAGE, and 446(77.57%) in LongSAGE were included in the selected housekeeping genes, respectively. A majority of the 575 HKGs was found to have low 0's proportion in the constructed datasets, EST, ShortSAGE and LongSAGE even though some genes showed the 0's proportion greater than 0.5 unexpectedly. Traditional reference genes like RPLPO, ACTS, PPIA, GAPDH, PGK1, B2M and were TFRC also found in the 2,087 genes.

The mean gene expression value and CV (%) of the housekeeping genes selected from the EST and SAGE datasets were calculated in the microarray dataset (Affymetrix HG-U133, CA). The microarray expression data of 5,238 different probe sets (gene expression data for 5,317 fragments, 1,990 UniGene clusters) corresponding to the selected HKGs were obtained.

UniGene clusters were used to allow respective gene probes to correspond thereto in the datasets. On the chip set HG-U133 were found cases where multiple probe sets, which show various expression intensities, correspond to one gene or UniGene cluster. In such cases, one probe set for one UniGene cluster, showing the lowest CV among several probe sets, was selected.

The 2,087 HKGs obtained above were categorized as “candidate ERGs” or “candidate reference genes” in accordance with the present invention.

Experimental Example 1

Analysis of Candidate ERG

<1-1> Functional Classification of Candidate ERG

Using FunCat (Functional Classification Catalogue, Version 2.0, Ruepp, A., et al. Nucleic Acids Res, 32, 5539-45, 2004), the 2,087 genes obtained above were classified.

Out of the 2,087 candidate ERGs, 1,689 UniGene clusters were associated with GO terms allocated to MIPS (Munich Information Center for Protein Sequences) FunCat (Functional Catalogue). Among the 1,689 UniGene clusters, 1,318 UniGene clusters were functionally classified to be associated with GO terms corresponding to biological processes. These 1,318 genes were identified to be involved in various basic cellular functions. While a high proportion of the previously reported traditional HKGs encode metabolism and ribosome proteins (Eisenberg E & Levanon E Y, Trends Genet 19:362-5, 2003; Hsiao L L et al., Physiol Genomics 7:97-104, 2001), genes encoding proteins involved in protein fate (23%, 308/1318) and cellular transport (21%, 273/1318) are found in large amounts in the candidate ERGs (FIG. 2).

<1-2> Analysis of Candidate ERGs for CpG Island

Sequences upstream of the annotated transcription start site of the ERGs according to the present invention were obtained from the UCSC site (//hgdownload.cse.ucsc.edu/goldenPath/hg18/bigZips/). CpG islands located 1,000, 2,000 and 5,000 by upstream of the transcription start points on the basis of a DNA sequence longer than 500 bp, and having a G+C content of 55% and a

CpG observed/expected ratio of 0.65 (Takai D & Jones PA Proc Natl Acad Sci USA, 99, 3740-5, 2002), were searched for using CpGIE software (Wang, Y & Leung, F C Bioinformatics, 20, 1170-7, 2004).

The Z-test (R program, //www.R-project.org) was applied to assess whether there was a statistical significance of differences in the frequency of genes with CpG island between the candidate ERGs and non-candidate ERGs. P<0.05 was considered to be significant.

In line with the previous reports (Larsen, F., et al., Genomics, 13, 1095-107. 1992; Ponger, L., et al., Genome Res, 11, 1854-60. 42, 2001), most candidate ERGs were found to show high frequencies of CpG islands in upstream sequences (1000 bp; 70%, 2000 bp; 73%, 5000 bp; 76%). In contrast, CpG islands were found at low frequencies in the upstream sequences of non-candidate ERGs (p<0.001, Table 1).

TABLE 1
Comparison of the Proportion of Genes with CpG Islands in
Upstream Sequences of the transcription start site in
Candidate ERG and Non-Candidate ERG
Candidate ERG Non-Candidate ERG
(No. = 2002) (No. = 14848)
Ratios of Ratios of
Genes with Genes with
Upstream No. of CpG No. of CpG p-
Bp Genes Islands Genes Islands values
5000 1516 76% 8036 54% <0.001
2000 1456 73% 7410 50% <0.001
1000 1410 70% 7048 47% <0.001

Experimental Example 2

Correlation Analysis

Correlation analysis was performed using a correlation coefficient, which indicates linear association between two groups, with a significance level of p<0.05. All calculations and scatter plots were produced with the statistical analysis program R-Package (//www.r-project.org).

First, Pearson and Spearman's rank correlation analysis were performed to compare the candidate ERGs selected from the four datasets in terms of gene expression and CV. FIG. 3 is a scatter plot of gene expression for the four datasets of the candidate ERGs. It was observed that there was a significant correlation of expression values between all four datasets. ShortSAGE versus LongSAGE showed the highest Spearman correlation coefficient of 0.853 (p<0.0001) and the lowest Spearman correlation of 0.339 between EST and Microarray (p<0.0001).

Next, the coefficient of variation (CV, %) was computed to investigate the consistency of the expression level of the candidate ERGs across various libraries in each dataset. Pearson and Spearman's rank correlation analyses were performed on the CV thus obtained, indicating that the CV was less similar between datasets (Spearman correlation coefficient<0.5) than was the gene expression level although a significant correlation was still found (p≦0.001) (FIG. 4).

These results may be attributed to the difference in the kind and number of samples between datasets because expression levels may vary depending on the kind and number of the samples.

Experimental Example 3

Comparison Between Candidate ERG and Non-Candidate ERG

A t-test was conducted to examine whether there was a significant difference in mean gene expression between candidate ERG and non-candidate ERG. FIG. 5 shows the distribution of the gene expressions of candidate ERG and non-candidate ERG for each dataset. As was expected, the mean gene expression level of the candidate ERGs was significantly higher than that of non-candidate ERGs in all four datasets (p<0.0001). These results are in line with previous reports (Eisenberg E and Levanon E Y, Trends Genet, 19(7), 362-365, 2003).

Gene expression levels were found to range from 73.83 to 9324.87 in EST, from 28.58 to 4086.25 in ShortSAGE, from 17.47 to 4621.60 in LongSAGE, and from 1.47 to 18598.26 in HG-U133 microarray. A significant number of genes encoding ribosomal proteins showed the highest expression levels in all four datasets. The most abundant transcript was found to come from EEF1A1 in EST and LongSAGE, from DGK1 in ShortSAGE, and from RPL10A in HG-U133 microarray (Table 2)

TABLE 2
A list of 2087 candidate endogenous reference genes
UniGene EST SHORT SAGE
cluster Symbol Gene Names Mean CV 0's P Mean
120 PRDX6 Peroxiredoxin 6 458.61 113.71 0.034 222.30
142 SULT1A1 Sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1248.16 105.30 0.241 177.46
202 TSPO translocator protein 198.55 80.83 0.207 233.57
429 ATP5G3 ATP synthase, H+ transporting, mitochondrial F0 complex, subuni 211.73 76.87 0.103 522.98
c (subunit 9) isoform 3
695 CSTB Cystatin B (stefin B) 138.20 109.45 0.345 151.39
808 HNRPF Heterogeneous nuclear ribonucleoprotein F 340.14 74.87 0.034 137.03
861 MAPK3 Mitogen-activated protein kinase 3 145.68 106.68 0.241 68.60
1063 SNRPC Small nuclear ribonucleoprotein polypepticte C 171.26 77.26 0.276 96.52
1103 TGFB1 Transforming growth factor, beta 1 (Camurati-Engelmann disease) 197.32 110.45 0.345 106.49
2430 VPS72 Vacuolar protein sorting 72 homolog (S. cerevisiae) 117.28 76.90 0.241 41.98
2533 ALDH9A1 Aldehyde dehydrogenase 9 family, member A1 119.81 68.68 0.207 60.36
2795 LDHA Lactate dehydrogenase A 723.58 109.92 0.034 334.22
2853 PCBP1 Poly(rC) binding protein 1 203.55 81.02 0.103 154.67
3100 KARS Lysyl-tRNA synthetase 242.90 76.66 0.138 67.12
3254 MRPL23 Mitochondrial ribosomal protein L23 105.59 58.85 0.379 97.41
3353 G3BP1 GTPase activating protein (SH3 domain) binding protein 1 221.63 105.29 0.138 78.09
3416 ADFP Adipose differentiation-related protein 250.88 167.90 0.241 109.67
3439 STOML2 Stomatin (EPB72)-like 2 303.44 78.37 0.069 70.64
3530 FUSIP1 FUS interacting protein (serine/arginine-rich) 1 188.96 77.05 0.138 79.35
3989 PLXNB2 Plexin B2 365.44 108.04 0.138 98.71
4055 KLF6 Kruppel-like factor 6 258.77 121.39 0.276 257.29
4742 GPAA1 GPAA1P anchor attachment protein 1 homolog (yeast) 334.17 107.33 0.207 107.98
4747 DKC1 Dyskeratosis congenita 1, dyskerin 232.08 109.39 0.138 62.19
4766 FAM32A Family with sequence similarity 32, member A 182.68 72.56 0.138 55.17
4859 CCNL1 Cyclin L1 117.20 67.94 0.379 101.90
4997 RBM23 RHA binding motif protein 23 151.36 66.00 0.345 65.10
4998 TMOD3 Tropomodulin 3 (ubiquitous) 117.77 105.21 0.345 60.81
5062 TSPAN3 Tetraspanin 3 230.30 90.95 0.069 333.07
5086 RBM42 RNA binding motif protein 42 232.32 80.47 0.172 62.72
5120 DYNLL1 Dynein, light chain, LC8-type 1 202.21 103.08 0.103 212.71
5158 ILK Integrin-linked kinase-2 154.41 64.84 0.138 163.14
5245 PIH1D1 PIH1 domain containing 1 300.56 124.75 0.207 64.41
5258 MAGED1 Melanoma antigen family D, 1 605.46 103.33 0.138 122.13
5268 ZDHHC4 Zinc finger, DHHC-type containing 4 105.02 62.27 0.345 71.67
5298 ADIPOR1 Adiponectin receptor 1 175.47 95.76 0.138 78.91
5308 UBA52 Ubiquitin A-52 residue ribosomal protein fusion product 1 482.46 229.44 0.103 354.49
5324 C2orf25 Chromosome 2 open reading frame 25 665.12 222.84 0.138 73.70
5345 RNPEPL1 Arginyl aminopeptidase (aminopeptidase B)-like 1 174.04 85.31 0.310 69.83
5662 GNB2L1 Guanine nucleotide binding protein (G protein), beta polypeptide 2 2888.02 78.73 0.000 632.04
like 1
5710 CREG1 Cellular repressor of E1A-stimulated genes 1 186.09 125.07 0.241 58.67
5719 NCAPD2 Non-SMC condensin I complex, subunit D2 285.44 132.20 0.241 289.65
5912 FBXO7 F-box protein 7 203.36 91.84 0.207 53.23
5947 RAB8A RAB8A, member RAS oncogene family 195.76 70.42 0.138 44.57
6396 JTB Jumping translocation breakpoint 264.77 96.40 0.172 138.04
6454 GIPC1 GIPC PDZ domain containing family, member 1 283.16 100.25 0.069 233.69
6459 GPR172A G protein-coupled receptor 172A 180.95 83.98 0.276 117.70
6551 ATP6AP1 ATPase, H+ transporting, lysosomal accessory protein 1 238.13 103.93 0.207 113.84
6891 SFRS6 Splicing factor, arginine/serine-rich 6 131.50 89.49 0.241 113.93
7101 ANAPC5 Anaphase promoting complex subunit 5 248.20 68.36 0.103 57.03
7236 NOSIP Nitric oxide synthase interacting protein 160.80 86.71 0.310 73.56
7476 ATP6V0B ATPase, H+ transporting, lysosomal 21 kDa, V0 subunit c″ 179.43 84.77 0.241 134.42
7527 REXO2 REX2, RNA exonuclease 2 homolog (S. cerevisiae) 137.24 85.72 0.379 91.89
7744 NDUFV1 NADH dehydrogenase (ubiquinone) flavoprotein 1, 51 kDa 373.45 70.69 0.069 253.95
7753 CALU Calumenin 251.14 83.95 0.069 200.10
7768 FIBP Fibroblast growth factor (acidic) intracellular binding protein 149.44 71.07 0.138 81.86
7862 PNRC2 Proline-rich nuclear receptor coactivator 2 165.82 66.37 0.241 93.55
7910 RYBP RING1 and YY1 binding protein 148.78 147.82 0.310 165.96
7917 HIGD1A HIG1 domain family, member 1A 1039.59 201.55 0.103 249.49
8102 RPS20 Ribosomal protein S20 808.74 200.51 0.000 918.89
8372 UQCR Ubiquinol-cytochrome c reductase, 6.4 kDa subunit 171.69 131.04 0.172 357.79
8737 WDR6 WD repeat domain 6 214.98 113.65 0.172 102.30
8752 TMEM4 Transmembrane protein 4 133.39 83.23 0.345 56.83
8765 DDX42 DEAD (Asp-Glu-Ala-Asp) box polypeptide 42 139.51 72.23 0.310 48.25
8859 CANT1 Calcium activated nucleotidase 1 195.72 80.27 0.310 74.83
8867 CYR61 Cysteine-rich, angiogenic inducer, 61 267.57 79.91 0.379 187.29
9003 C16orf58 Chromosome 16 open reading frame 58 148.64 68.89 0.207 73.69
9015 LOC57255 Hypothetical locus LOC572558 130.09 98.43 0.276 184.94
9043 NGDN Neuroguidin, EIF4E binding protein 117.81 54.04 0.379 56.29
9234 TMEM147 Transmembrane protein 147 129.58 83.82 0.207 68.85
9235 NME4 Protein expressed in non-metastatic cells 4 148.59 103.05 0.379 93.18
9527 C2orf28 Chromosome 2 open reading frame 28 184.04 88.83 0.207 81.51
9534 SEC11A SEC11 homolog A (S. cerevisiae) 146.99 82.65 0.069 98.58
9573 ABCF1 ATP-binding cassette, sub-family F (GCN20), member 1 173.73 124.13 0.276 46.97
9589 UBQLN1 Ubiquilin 1 111.34 60.19 0.310 75.93
9788 NDFIP1 Nedd4 family interacting protein 1 167.04 73.62 0.172 82.06
9825 FAM96B Family with sequence similarity 96, member B 139.95 94.16 0.345 76.79
9857 DCXR Dicarbonyl/L-xylulose reductase 170.77 74.16 0.379 194.06
10326 COPE Coatomer protein complex, subunit epsilon 383.31 95.38 0.103 164.06
10842 RAN RAN, member RAS oncogene family 825.56 82.38 0.000 182.70
10848 BMS1 BMS1 homolog, ribosome assembly protein (yeast) 121.69 60.27 0.345 38.94
11125 SPCS1 Signal peptidase complex subunit 1 homolog (S. cerevisiae) 151.97 92.91 0.276 94.29
11184 UBE2R2 Ubiquitin-conjugating enzyme E2R 2 379.09 474.01 0.172 129.52
11223 IDH1 Isocitrate dehydrogenase 1 (NADP+), soluble 199.04 77.27 0.103 52.37
11355 TMPO Thymopoietin 213.98 130.12 0.172 63.16
11463 CMPK Cytidylate kinase 180.54 86.53 0.172 123.53
12013 ABCE1 ATP-binding cassette, sub-family E (OABP), member 1 179.59 72.05 0.241 47.30
12084 TUFM Tu translation elongation factor, mitochondrial 518.02 95.08 0.207 235.78
12102 SNX3 Sorting nexin 3 280.04 91.18 0.207 131.08
12107 CHMP2A Chromatin modifying protein 2A 108.77 44.44 0.207 76.75
12109 CIAO1 Cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae) 127.53 69.27 0.207 66.06
12144 KIAA1033 KIAA1033 109.38 59.10 0.345 39.29
12152 SRPRB Signal recognition particle receptor, B subunit 197.29 199.04 0.310 64.91
12272 BECN1 Beclin 1 (coiled-coil, myosin-like BCL2 interacting protein) 135.99 56.22 0.310 50.41
12341 ADAR Adenosine deaminase, RNA-specific 272.66 83.29 0.103 99.54
12457 NUP133 Nucleoporin 133 kDa 134.39 100.25 0.310 69.13
12865 NSFL1C NSFL1 (p97) cofactor (p47) 137.86 79.36 0.276 48.09
13662 TMEM109 Transmembrane protein 109 180.15 110.32 0.276 52.31
14317 NOLA3 Nucleolar protein family A, member 3 (H/ACA small nucleolar 205.32 119.91 0.310 169.22
RNPs)
14333 ATPBD1B ATP binding domain 1 family, member B 159.24 82.57 0.379 150.04
14745 CCNY Cyclin Y 133.37 75.66 0.276 86.24
14839 POLR2G Polymerase (RNA) II (DNA directed) polypeptide G 141.30 66.30 0.207 89.01
14846 SLC7A1 Solute carrier family 7 (cationic amino acid transporter, y+ system 139.07 71.59 0.310 60.63
member 1
14894 TGOLN2 Trans-golgi network protein 2 157.54 69.37 0.241 121.24
15277 C16orf33 Chromosome 16 open reading frame 33 120.09 75.30 0.310 84.56
15591 COPS6 COP9 constitutive photomorphogenic homolog subunit 6 217.83 90.78 0.172 83.92
(Arabidopsis)
15738 RAB7A RAB7A, member RAS oncogene family 400.18 95.67 0.069 120.91
16059 CCDC56 Coiled-coil domain containing 56 143.39 86.29 0.345 96.29
16130 UBE2O Ubiquitin-conjugating enzyme E2O 157.52 114.59 0.241 63.36
16349 ASCIZ ATM/ATR-Substrate Chk2-Interacting Zn2+-finger protein 122.72 69.67 0.310 39.01
17118 C1orf149 Chromosome 1 open reading frame 149 139.92 85.35 0.310 67.64
17250 COQ5 Coenzyme Q5 homolog, methyltransferase (S. cerevisiae) 91.88 50.52 0.345 105.68
17680 FUCA2 Fucosidase, alpha-L-2, plasma 157.91 93.28 0.276 55.65
17731 CCDC14 Coiled-coil domain containing 14 84.79 48.78 0.379 64.78
17883 PPM1G Protein phosphatase 1G (formerly 2C), magnesium-dependent, 381.13 94.17 0.103 159.30
gamma isoform
18069 LGMN Legumain 189.38 150.90 0.310 74.08
18128 C20orf44 Chromosome 20 open reading frame 44 120.34 63.49 0.276 50.49
18349 MRPL15 Mitochondrial ribosomal protein L15 126.02 62.29 0.310 42.98
19673 MAF1 MAF1 homolog (S. cerevisiae) 208.66 72.97 0.069 71.97
20013 SYF2 SYF2 homolog, RNA splicing factor (S. cerevisiae) 109.39 47.58 0.310 80.86
20107 KLC1 Kinesin light chain 1 158.65 81.31 0.241 78.88
20157 CDK5RAP3 CDK5 regulatory subunit associated protein 3 186.17 71.88 0.276 79.43
20521 PRMT1 Protein arginine methyltransferase 1 270.96 72.70 0.103 131.53
20529 FAM79A Family with sequence similarity 79, member A 101.33 68.50 0.379 50.65
20573 IGF1R Insulin-like growth factor 1 receptor 133.12 72.84 0.379 106.46
20716 TIMM17A Translocase of inner mitochondrial membrane 17 homolog A 378.20 138.09 0.241 84.45
(yeast)
22393 DENR Density-regulated protein 147.59 60.97 0.138 66.26
22543 UBE3A Ubiquitin protein ligase E3A (human papilloma virus E6-associated 180.41 98.42 0.276 92.47
protein, Angelman syndrome)
22546 CYBASC3 Cytochrome b, ascorbate dependent 3 271.22 114.11 0.276 52.24
22616 KIAA0664 KIAA0664 protein 126.85 69.83 0.276 39.21
23033 UBE2Q2 Ubiquitin-conjugating enzyme E2Q (putative) 2 127.34 80.73 0.379 38.96
23111 FARSA Phenylalanyl-tRNA synthetase, alpha subunit 239.95 79.63 0.241 48.89
23978 SAFB Scaffold attachment factor B 195.91 87.35 0.207 63.83
24301 POLR2E Polymerase (RNA) II (DNA directed) polypeptide E, 25 kDa 345.43 77.04 0.207 85.97
24379 TRAPPC1 Trafficking protein particle complex 1 155.30 123.38 0.172 110.66
24601 FBLN1 Fibulin 1 492.05 242.68 0.345 156.54
24950 RGS5 Regulator of G-protein signalling 5 561.58 225.25 0.345 142.46
25155 NET1 Neuroepithelial cell transforming gene 1 114.28 95.82 0.207 72.57
25450 SLC29A1 Solute carrier family 29 (nucleoside transporters), member 1 201.64 68.32 0.379 64.55
25723 FAM89B Family with sequence similarity 89, member B 140.19 148.04 0.345 67.63
26010 PFKP Phosphofructokinase, platelet 268.83 113.15 0.103 141.32
26023 FOXJ3 Forkhead box J3 73.83 44.60 0.379 59.94
26136 PIGY Phosphatidylinositol glycan anchor biosynthesis, class Y 150.82 96.10 0.345 217.48
26232 MAN2C1 Mannosidase, alpha, class 2C, member 1 117.43 87.14 0.379 35.17
26403 GSTZ1 Glutathione transferase zeta 1 (maleylacetoacetate isomerase) 139.46 92.67 0.345 60.70
26518 TSPAN4 Tetraspanin 4 164.19 75.89 0.310 86.39
27222 NOLA2 Nucleolar protein family A, member 2 (H/ACA small nucleolar 172.83 107.54 0.276 108.00
RNPs)
28491 SAT1 Spermidine/spermine N1-acetyltransferase 1 578.08 192.92 0.276 378.42
28914 APRT Adenine phosphoribosyltransferase 160.48 119.31 0.345 95.10
29203 GBL G protein beta subunit-like 172.86 96.17 0.310 80.31
29665 CLSTN1 Calsyntenin 1 223.34 109.23 0.103 167.80
30011 TMEM93 Transmembrane protein 93 122.56 80.02 0.379 65.81
30026 SSU72 SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae) 122.96 77.31 0.138 99.27
30345 TRAP1 TNF receptor-associated protein 1 433.73 106.66 0.103 96.17
30954 PMVK Phosphomevalonate kinase 168.78 141.42 0.379 53.56
31053 TBCB Tubulin folding cofactor B 267.45 128.93 0.276 115.61
31334 PRPF6 PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae) 278.00 95.93 0.103 96.19
31387 C3orf60 Chromosome 3 open reading frame 60 194.85 96.83 0.276 72.05
34045 CDCA4 Cell division cycle associated 4 142.01 95.48 0.379 33.71
34576 TAX1BP1 Tax1 (human T-cell leukemia virus type I) binding protein 1 166.29 86.39 0.138 127.07
34906 BLOC1S2 Biogenesis of lysosome-related organelles complex-1, subunit 2 110.24 106.36 0.345 62.63
35052 TEGT Testis enhanced gene transcript (BAX inhibitor 1) 601.46 76.56 0.000 357.59
35828 MARK3 MAP/microtubule affinity-regulating kinase 3 181.74 68.97 0.207 74.00
36587 PPP1R7 Protein phosphatase 1, regulatory subunit 7 147.34 89.65 0.207 55.81
36927 HSPH1 Heat shock 105 kDa/110 kDa protein 1 142.61 62.36 0.241 178.86
37616 STRA13 Stimulated by retinoic acid 13 homolog (mouse) 132.28 87.28 0.310 103.87
37916 DPP7 Dipeptidylpeptidase 7 189.05 126.98 0.207 134.29
42806 SDF4 Stromal cell derived factor 4 395.61 110.02 0.138 55.59
43297 MTPN Myotrophin 224.31 82.09 0.172 192.32
47062 POLR2I Polymerase (RNA) II (DNA directed) polypeptide I, 14.5 kDa 136.77 76.60 0.310 77.76
50098 NDUFA4 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9 kDa 444.09 142.87 0.310 773.46
50308 HIP2 Huntingtin interacting protein 2 145.77 68.04 0.207 85.98
50425 PTGES3 Prostaglandin E synthase 3 (cytosolic) 411.83 77.96 0.103 332.11
53066 HSPBP1 Hsp70-interacting protein 202.07 92.49 0.138 68.61
54277 FAM50A Family with sequence similarity 50, member A 145.83 129.34 0.345 100.96
54457 CD81 CD81 antigen (target of antiproliferative antibody 1) 303.19 99.16 0.069 141.89
54642 MAT2B Methionine adenosyltransferase II, beta 133.55 71.29 0.207 61.78
54649 RY1 Putative nucleic acid binding protein RY-1 203.85 97.67 0.241 75.69
55682 EIF3S7 Eukaryotic translation initiation factor 3, subunit 7 zeta, 66/67 kDa 455.77 153.84 0.034 89.94
55847 MRPL51 Mitochondrial ribosomal protein L51 122.64 99.22 0.241 154.55
58488 CTNNAL1 Catenin (cadherin-associated protein), alpha-like 1 126.66 70.42 0.379 68.29
58992 SMC4 Structural maintenance of chromosomes 4 228.66 99.66 0.207 72.95
59486 HSDL2 Hydroxysteroid dehydrogenase like 2 129.48 73.68 0.345 63.64
61812 PTPN12 Protein tyrosine phosphatase, non-receptor type 12 108.62 74.97 0.345 108.97
65234 DDX27 DEAD (Asp-Glu-Ala-Asp) box polypeptide 27 199.19 91.01 0.241 62.30
65238 RNF40 Ring finger protein 40 193.26 81.38 0.172 54.91
66048 MAP1S Microtubule-associated protein 1S 131.74 79.04 0.276 47.23
66915 C22orf16 Chromosome 22 open reading frame 16 135.11 102.77 0.379 60.49
68714 SFRS1 Splicing factor, arginine/serine-rich 1 (splicing factor 2, alternate 249.07 79.18 0.103 98.30
splicing factor)
69293 HEXB Hexosaminidase B (beta polypeptide) 198.57 153.59 0.276 71.52
69554 RNF126 Ring finger protein 126 161.03 83.35 0.241 55.88
69855 UNR Cold shock domain containing E1, RNA-binding 657.29 110.51 0.103 304.45
71465 SQLE Squalene epoxidase 105.27 62.62 0.276 77.51
71787 MRPS7 Mitochondrial ribosomal protein S7 159.90 59.92 0.310 86.87
73527 CSNK2B Casein kinase 2, beta polypeptide 202.65 73.01 0.207 101.19
73722 APEX1 APEX nuclease (multifunctional DNA repair enzyme) 1 339.50 85.30 0.103 230.38
73799 GNAI3 Guanine nucleotide binding protein (G protein), alpha inhibiting 150.46 62.95 0.207 56.56
activity polypeptide 3
73965 SFRS2 Hypothetical protein ET 280.26 73.78 0.000 222.54
74047 ETFB Electron-transfer-flavoprotein, beta polypeptide 168.06 80.53 0.138 68.32
74050 FVT1 Follicular lymphoma variant translocation 1 98.29 70.32 0.379 59.60
74137 TMED10 Transmembrane emp24-like trafficking protein 10 (yeast) 237.09 91.81 0.138 150.00
74375 DVL1 Dishevelled, dsh homolog 1 (Drosophila) 133.54 77.04 0.276 79.92
74405 YWHAQ Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase 413.13 88.00 0.034 420.70
activation protein, theta polypeptide
74471 GJA1 Gap junction protein, alpha 1, 43 kDa (connexin 43) 183.35 62.77 0.379 500.49
74563 OAZ2 Ornithine decarboxylase antizyme 2 193.33 73.23 0.103 86.41
74564 SSR2 Signal sequence receptor, beta (translocon-associated protein 312.91 86.38 0.034 107.44
beta)
74576 GDI1 GDP dissociation inhibitor 1 230.50 117.59 0.138 161.01
75056 TIMM13 Translocase of inner mitochondrial membrane 13 homolog (yeast) 225.25 76.11 0.345 109.02
75061 MARCKSL MARCKS-like 1 449.23 89.23 0.103 136.56
75066 TSN Translin 128.46 75.98 0.345 72.68
75087 FASTK Fas-activated serine/threonine kinase 179.08 68.42 0.345 123.07
75117 ILF2 Interleukin enhancer binding factor 2, 45 kDa 349.26 76.78 0.034 86.61
75133 TFAM Transcription factor A, mitochondrial 111.21 68.59 0.310 47.20
75139 ARFIP2 ADP-ribosylation factor interacting protein 2 (arfaptin 2) 178.80 116.43 0.345 37.76
75189 DAP Death-associated protein 217.73 94.24 0.103 143.76
75227 NDUFA9 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39 290.29 122.15 0.138 97.37
75243 BRD2 Bromodomain containing 2 301.76 102.55 0.069 150.65
75249 ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 269.13 69.42 0.172 141.78
75254 IRF3 Interferon regulatory factor 3 131.45 93.03 0.345 57.56
75318 TUBA4A Tubulin, alpha 4a 346.93 95.88 0.276 72.41
75348 PSME1 Proteasome (prosome, macropain) activator subunit 1 (PA28 196.67 85.95 0.138 139.00
alpha)
75438 QDPR Quinoid dihydropteridine reductase 239.93 101.27 0.345 88.56
75527 ADSL Adenylosuccinate lyase 187.36 79.69 0.000 46.87
75724 COPB2 Coatomer protein complex, subunit beta 2 (beta prime) 169.19 70.94 0.172 144.95
75798 C20orf111 Chromosome 20 open reading frame 111 138.12 60.97 0.379 52.53
75841 ERP29 Endoplasmic reticulum protein 29 170.38 80.11 0.276 109.13
75890 MBTPS1 Membrane-bound transcription factor peptidase, site 1 143.96 76.79 0.241 59.34
75914 TMED2 Transmembrane emp24 domain trafficking protein 2 257.34 78.55 0.103 201.28
76111 DAG1 Dystroglycan 1 (dystrophin-associated glycoprotein 1) 185.89 66.32 0.310 97.04
76394 ECHS1 Enoyl Coenzyme A hydratase, short chain, 1, mitochondrial 296.18 99.29 0.207 101.19
76480 UBL4A Ubiquitin-like 4A 177.47 73.71 0.379 41.09
76662 ZDHHC16 Zinc finger, DHHC-type containing 16 138.92 90.05 0.276 57.18
76686 GPX1 Glutathione peroxidase 1 154.93 84.27 0.276 234.43
76847 GANAB Glucosidase, alpha; neutral AB 371.62 103.22 0.138 252.72
77060 PSMB6 Proteasome (prosome, macropain) subunit, beta type, 6 258.61 103.69 0.172 150.18
77269 GNAI2 Guanine nucleotide binding protein (G protein), alpha inhibiting 454.86 93.08 0.103 370.28
activity polypeptide 2
77313 CDK10 Cyclin-dependent kinase (CDC2-like) 10 98.89 72.87 0.345 69.26
77422 PLP2 Proteolipid protein 2 (colonic epithelium-enriched) 189.36 121.71 0.310 104.42
77558 HMGN3 High mobility group nucleosomal binding domain 3 161.44 94.74 0.207 171.44
77578 USP9X Ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila) 143.39 67.26 0.310 52.03
77793 CSK C-src tyrosine kinase 222.19 95.17 0.310 68.74
77897 SF3A3 Splicing factor 3a, subunit 3, 60 kDa 169.65 127.16 0.276 81.46
77961 HLA-B Major histocompatibility complex, class I, B 851.44 157.10 0.103 105.86
77978 Hypothetical protein DKFZp761I2123 115.47 65.78 0.345 70.16
78466 PSMD8 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 274.96 128.74 0.241 119.08
78601 UROD Uroporphyrinogen decarboxylase 187.65 84.63 0.103 96.65
78771 PGK1 Phosphoglycerate kinase 1 681.19 86.72 0.034 423.67
78880 ILVBL IlvB (bacterial acetolactate synthase)-like 185.37 153.08 0.379 101.11
78888 DBI Diazepam binding inhibitor (GABA receptor modulator, acyl- 220.96 127.35 0.241 166.57
Coenzyme A binding protein)
78989 ADH5 Alcohol dehydrogenase 5 (class III), chi polypeptide 179.39 72.64 0.034 89.94
79064 DHPS Deoxyhypusine synthase 164.95 100.52 0.241 47.03
79081 PPP1CC Protein phosphatase 1, catalytic subunit, gamma isoform 318.25 84.70 0.103 100.43
79088 RCN2 Reticulocalbin 2, EF-hand calcium binding domain 150.90 75.39 0.207 99.10
79101 CCNG1 Cyclin G1 240.04 67.65 0.069 82.44
79110 NCL Nucleolin 293.04 63.35 0.034 210.54
79322 QARS Glutaminyl-tRNA synthetase 402.46 67.92 0.138 149.07
79335 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of 146.36 68.95 0.241 54.24
chromatin, subfamily d, member 1
79387 PSMC5 Proteasome (prosome, macropain) 26S subunit, ATPase, 5 243.74 74.96 0.138 158.29
79402 POLR2C Polymerase (RNA) II (DNA directed) polypeptide C, 33 kDa 146.42 65.99 0.241 62.49
79411 RPA2 Replication protein A2, 32 kDa 179.33 111.72 0.345 81.59
79625 C20orf149 Chromosome 20 open reading frame 149 361.43 94.87 0.310 218.44
80545 RPL37 Ribosomal protein L37 755.77 355.66 0.103 2167.23
80919 SYPL1 Synaptophysin-like 1 215.72 101.08 0.207 132.20
80986 ATP5G1 ATP synthase, H+ transporting, mitochondrial F0 complex, subuni 209.65 91.99 0.276 223.23
c (subunit 9), isoform 1
81328 NFKBIA Nuclear factor of kappa light polypeptide gene enhancer in B-cells 186.76 120.33 0.345 367.44
inhibitor, alpha
81424 SUMO1 SMT3 suppressor of mif two 3 homolog 1 (yeast) 313.72 89.00 0.034 338.47
81848 RAD21 RAD21 homolog (S. pombe) 368.76 164.73 0.103 102.70
81964 SEC24C SEC24 related gene family, member C (S. cerevisiae) 186.43 96.07 0.241 56.08
82201 CSNK2A2 Casein kinase 2, alpha prime polypeptide 123.76 72.38 0.310 77.63
82327 GSS Glutathione synthetase 184.39 77.08 0.138 47.74
82719 YIPF6 Yip1 domain family, member 6 123.85 72.31 0.379 40.25
82793 PSMB3 Proteasome (prosome, macropain) subunit, beta type, 3 158.41 64.83 0.138 168.49
82887 PPP1R11 Protein phosphatase 1, regulatory (inhibitor) subunit 11 190.42 75.63 0.241 36.52
82890 DAD1 Defender against cell death 1 202.51 132.00 0.310 176.07
82916 CCT6A Chaperonin containing TCP1, subunit 6A (zeta 1) 407.59 75.69 0.034 155.89
82927 AMPD2 Adenosine monophosphate deaminase 2 (isoform L) 148.16 149.07 0.345 62.69
83190 FASN Fatty acid synthase 562.35 101.57 0.241 249.20
83347 AAMP Angio-associated, migratory cell protein 224.46 80.95 0.138 75.73
83383 PRDX4 Peroxiredoxin 4 152.24 74.89 0.379 62.85
83734 STX4 Syntaxin 4 117.13 61.41 0.276 65.02
83753 SNRPB Small nuclear ribonucleoprotein polypeptides B and B1 874.09 87.85 0.138 206.87
83765 DHFR Dihydrofolate reductase 111.62 78.02 0.310 60.49
83916 NDUFA5 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13 455.28 149.11 0.207 146.78
84359 GABARAP GABA(A) receptor-associated protein 190.65 77.34 0.138 153.83
84753 NT5DC2 5′-nucleotidase domain containing 2 158.64 96.33 0.310 142.25
85155 ZFP36L1 Zinc finger protein 36, C3H type-like 1 196.81 98.76 0.207 254.51
85769 DNTTIP2 Deoxynucleotidyltransferase, terminal, interacting protein 2 105.55 51.70 0.379 54.58
85962 CTF8 Chromosome transmission fidelity factor 8 homolog (S. cerevisiae) 170.29 139.62 0.276 49.58
86131 FADD Fas (TNFRSF6)-associated via death domain 158.82 101.13 0.172 69.23
87752 MSN Moesin 275.46 95.27 0.103 181.99
89545 PSMB4 Proteasome (prosome, macropain) subunit, beta type, 4 463.81 87.69 0.034 224.28
89643 TKT Transketolase (Wernicke-Korsakoff syndrome) 588.97 97.80 0.103 201.22
89649 EPHX1 Epoxide hydrolase 1, microsomal (xenobiotic) 238.26 88.30 0.345 128.11
89781 UBTF Upstream binding transcription factor, RNA polymerase I 121.71 54.79 0.241 117.56
89864 SKIV2L Superkiller viralicidic activity 2-like (S. cerevisiae) 132.50 66.99 0.379 46.22
90061 PGRMC1 Progesterone receptor membrane component 1 194.16 93.36 0.172 99.80
90093 HSPA4 Heat shock 70 kDa protein 4 149.59 74.25 0.172 62.89
90107 ADRM1 Adhesion regulating molecule 1 246.89 81.18 0.172 107.95
90443 NDUFS8 NADH dehydrogenase (ubiquinone) Fe—S protein 8, 23 kDa 153.66 106.13 0.207 151.21
(NADH-coenzyme Q reductase)
91142 KHSRP KH-type splicing regulatory protein (FUSE binding protein 2) 237.57 80.25 0.241 191.59
91531 MLLT6 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, 163.44 99.71 0.207 48.01
Drosophila); translocated to, 6
93659 PDIA4 Protein disulfide isomerase family A, member 4 221.64 92.23 0.207 119.28
93832 TMCO1 Transmembrane and coiled-coil domains 1 215.75 94.44 0.138 138.95
95577 CDK4 Cyclin-dependent kinase 4 512.67 181.54 0.103 70.34
96530 COX11 COX11 homolog, cytochrome c oxidase assembly protein (yeast) 133.50 61.61 0.241 44.09
96852 EDC3 Enhancer of mRNA decapping 3 homolog (S. cerevisiae) 315.49 327.98 0.345 49.12
96996 HNRPA0 Heterogeneous nuclear ribonucleoprotein A0 203.93 87.67 0.172 175.06
97616 SH3GL1 SH3-domain GRB2-like 1 271.66 106.70 0.069 109.70
97887 RCN1 Reticulocalbin 1, EF-hand calcium binding domain 176.05 78.51 0.207 128.29
98751 FUBP3 Far upstream element (FUSE) binding protein 3 115.91 57.99 0.276 79.69
98791 ACTR1B ARP1 actin-related protein 1 homolog B, centractin beta (yeast) 154.61 74.84 0.276 46.33
102696 MCTS1 Malignant T cell amplified sequence 1 182.20 108.79 0.379 89.54
102798 PSMA1 Proteasome (prosome, macropain) subunit, alpha type, 1 222.80 73.98 0.069 117.56
103561 ARL6IP4 ADP-ribosylation-like factor 6 interacting protein 4 177.34 82.48 0.172 125.24
103834 TMEM106C Transmembrane protein 106C 164.57 88.83 0.138 88.84
104839 TIMP2 TIMP metallopeptidase inhibitor 2 266.07 83.65 0.172 326.45
105547 NPDC1 Neural proliferation, differentiation and control, 1 184.55 89.27 0.345 240.66
106185 RALGDS Ral guanine nucleotide dissociation stimulator 113.28 56.31 0.379 94.40
106876 ATP6V0D1 ATPase, H+ transporting, lysosomal 38 kDa, V0 subunit d isoform 1 157.31 76.54 0.207 90.28
106909 ANAPC13 Anaphase promoting complex subunit 13 409.28 124.92 0.310 82.82
107003 CCNB1IP1 Cyclin B1 interacting protein 1 198.64 135.06 0.207 2470.25
107101 C1orf86 Chromosome 1 open reading frame 86 132.02 90.12 0.310 102.36
107387 C7orf20 Chromosome 7 open reading frame 20 158.14 146.65 0.379 85.47
107393 CLDND1 Claudin domain containing 1 182.62 98.17 0.276 55.41
108029 SH3BGRL SH3 domain binding glutamic acid-rich protein like 217.90 129.37 0.138 173.06
108080 CSRP1 Cysteine and glycine-rich protein 1 226.87 81.65 0.172 326.55
108371 E2F4 E2F transcription factor 4, p107/p130-binding 124.23 53.45 0.207 64.69
108408 APH1A Anterior pharynx defective 1 homolog A (C. elegans) 214.52 73.54 0.276 115.29
108957 RPS27L Ribosomal protein S27-like 214.43 105.97 0.345 197.20
108969 C19orf56 Chromosome 19 open reading frame 56 165.48 98.67 0.207 145.21
109051 SH3BGRL3 SH3 domain binding glutamic acid-rich protein like 3 190.53 95.77 0.207 158.45
109052 C14orf2 Chromosome 14 open reading frame 2 254.93 147.67 0.310 191.48
109672 ST6GALNAC6 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N- 113.89 58.27 0.379 67.37
acetylgalactosaminide alpha-2,6-sialyltransferase 6
109798 C6orf48 Chromosome 6 open reading frame 48 221.40 98.21 0.207 94.17
110695 SF3B5 Splicing factor 3b, subunit 5, 10 kDa 161.11 93.81 0.310 280.95
110849 ESRRA Estrogen-related receptor alpha 243.72 107.89 0.310 78.88
111286 MRPS11 Mitochondrial ribosomal protein S11 118.62 52.84 0.207 53.04
111577 ITM2C Integral membrane protein 2C 293.83 115.98 0.138 172.80
111801 ARS2 ARS2 protein 213.16 99.08 0.276 50.72
112058 SIVA1 SIVA1, apoptosis-inducing factor 161.23 58.99 0.345 75.36
112318 TOMM7 Translocase of outer mitochondrial membrane 7 homolog (yeast) 406.79 253.67 0.276 376.30
112955 NUDT5 Nudix (nucleoside diphosphate linked moiety X)-type motif 5 197.68 94.29 0.276 63.30
114033 SSR1 Signal sequence receptor, alpha (translocon-associated protein 161.00 68.79 0.207 55.66
alpha)
114286 CD9 CD9 antigen (p24) 239.20 130.06 0.172 227.35
114412 TXNL1 Thioredoxin-like 1 117.31 93.59 0.207 120.38
115474 RFC3 Replication factor C (activator 1) 3, 38 kDa 175.70 158.89 0.345 40.56
115792 EXOSC7 Exosome component 7 134.25 74.20 0.207 51.01
116448 GLS Glutaminase 192.13 67.06 0.379 38.83
117176 PABPN1 Poly(A) binding protein, nuclear 1 124.05 80.27 0.276 277.14
117715 ST5 Suppression of tumorigenicity 5 101.33 55.39 0.379 68.40
118110 BST2 Bone marrow stromal cell antigen 2 216.68 84.28 0.241 177.54
118400 FSCN1 Fascin homolog 1, actin-bundling protein (Strongylocentrotus 684.83 91.57 0.241 277.47
purpuratus)
118463 PNPLA2 Patatin-like phospholipase domain containing 2 162.21 88.10 0.345 139.17
118638 NME1 Non-metastatic cells 1, protein (NM23A) expressed in 290.12 103.60 0.172 202.48
118722 FUT8 Fucosyltransferase 8 (alpha (1,6) fucosyltransferase) 118.38 149.55 0.379 65.86
118964 GATAD2A GATA zinc finger domain containing 2A 124.22 85.19 0.310 40.82
118983 GSDMDC1 Gasdermin domain containing 1 184.87 95.75 0.379 147.97
119177 ARF3 ADP-ribosylation factor 3 239.68 76.49 0.138 139.61
119192 H2AFZ H2A histone family, member Z 453.31 159.40 0.103 221.14
119251 UQCRC1 Ubiquinol-cytochrome c reductase core protein I 442.99 74.48 0.103 152.44
119591 AP2S1 Adaptor-related protein complex 2, sigma 1 subunit 177.74 82.21 0.241 121.28
119598 RPL3 Ribosomal protein L3 3807.92 79.61 0.000 1976.38
120323 LOC26010 Viral DNA polymerase-transactivated protein 6 128.35 69.74 0.310 119.93
121088 NUP153 Nucleoporin 153 kDa 123.13 79.84 0.310 76.28
121549 CDIPT CDP-diacylglycerol--inositol 3-phosphatidyltransferase 177.98 81.88 0.241 115.81
(phosphatidylinositol synthase)
122363 WIPI2 WD repeat domain, phosphoinositide interacting 2 186.76 89.61 0.138 78.30
122523 SND1 Staphylococcal nuclease domain containing 1 355.50 74.36 0.034 106.76
124126 ARPC1A Actin related protein ⅔ complex, subunit 1A, 41 kDa 206.46 81.13 0.103 122.85
124147 FBXL11 PRO1880 protein 144.07 78.43 0.207 52.87
124246 C10orf119 Chromosome 10 open reading frame 119 144.50 66.52 0.172 76.17
124366 BBX Bobby sox homolog (Drosophila) 147.83 66.94 0.345 56.68
125113 CCT8 Chaperonin containing TCP1, subunit 8 (theta) 187.53 84.03 0.034 136.62
125867 EVL Enah/Vasp-like 170.08 84.54 0.276 196.70
125898 GNAS GNAS complex locus 669.01 93.40 0.069 471.82
126497 AEBP2 AE binding protein 2 102.85 77.77 0.379 126.95
126774 DTL Denticleless homolog (Drosophila) 160.79 71.32 0.379 58.18
126938 NAPA N-ethylmaleimide-sensitive factor attachment protein, alpha 196.92 84.26 0.069 106.30
127092 DHX38 DEAH (Asp-Glu-Ala-His) box polypeptide 38 168.85 103.87 0.379 51.60
127249 SNF8 SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) 134.67 80.08 0.310 125.84
127386 MAMDC2 MAM domain containing 2 147.47 78.47 0.241 343.27
127764 RAB5C RAB5C, member RAS oncogene family 242.33 112.45 0.276 245.24
128065 CTSC Cathepsin C 238.81 102.05 0.207 76.06
128199 SEPT11 Septin 11 159.83 63.97 0.241 90.00
128548 WDR1 WD repeat domain 1 267.90 69.81 0.069 103.72
129634 CINP Cyclin-dependent kinase 2-interacting protein 104.53 70.89 0.345 34.81
129673 EIF4A1 Eukaryotic translation initiation factor 4A, isoform 1 1492.15 82.19 0.000 380.49
130031 TRIO Triple functional domain (PTPRF interacting) 142.59 75.94 0.310 334.92
130098 DDX23 DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 188.55 94.45 0.172 50.98
130293 CROP Cisplatin resistance-associated overexpressed protein 152.55 84.06 0.207 191.28
130413 TM9SF2 Transmembrane 9 superfamily member 2 210.83 99.09 0.103 49.93
131226 BNIP3L BCL2/adenovirus E1B 19 kDa interacting protein 3-like 192.67 70.38 0.241 50.95
132497 PRNPIP Prion protein interacting protein 168.32 67.74 0.310 103.21
132513 HSD17B12 Hydroxysteroid (17-beta) dehydrogenase 12 137.10 95.65 0.207 48.15
133892 TPM1 Tropomyosin 1 (alpha) 606.98 169.48 0.207 189.30
134074 SLC35E1 Solute carrier family 35, member E1 110.83 70.67 0.345 72.41
134688 PSMD13 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 304.05 104.85 0.207 57.48
135406 CEBPZ CCAAT/enhancer binding protein zeta 126.72 64.41 0.207 51.10
136905 HUWE1 HECT, UBA and WWE domain containing 1 196.13 66.09 0.138 75.28
136947 RALY RNA binding protein, autoantigenic (hnRNP-associated with lethal 339.69 92.28 0.069 169.57
yellow homolog (mouse))
137510 NCOR2 Nuclear receptor co-repressor 2 243.82 126.40 0.207 47.10
138860 ARHGAP1 Rho GTPase activating protein 1 106.56 50.87 0.310 92.98
139896 MAEA Macrophage erythroblast attacher 203.45 84.45 0.276 56.94
140452 M6PRBP1 Mannose-6-phosphate receptor binding protein 1 381.09 119.04 0.138 119.07
142442 HP1BP3 Heterochromatin protein 1, binding protein 3 161.28 66.57 0.207 72.01
143187 DDX49 DEAD (Asp-Glu-Ala-Asp) box polypeptide 49 144.35 67.10 0.241 59.63
143766 ATN1 Atrophin 1 184.56 86.85 0.207 76.29
143873 S100A10 S100 calcium binding protein A10 (annexin II ligand, calpactin I, 255.56 111.88 0.172 675.77
light polypeptide (p11))
144058 NAT9 N-acetyltransferase 9 99.56 67.02 0.345 45.72
144468 CHID1 Chitinase domain containing 1 179.03 105.35 0.241 103.94
144835 EEF1G Eukaryotic translation elongation factor 1 gamma 4056.39 76.55 0.000 1929.11
144868 VTI1B Vesicle transport through interaction with t-SNAREs homolog 1B 103.57 54.85 0.310 47.28
(yeast)
144941 LRRC41 Leucine rich repeat containing 41 152.40 71.74 0.172 45.67
144949 ZNF313 Zinc finger protein 313 145.79 62.78 0.138 63.37
144980 SCAMP4 Secretory carrier membrane protein 4 127.39 96.37 0.345 60.46
145049 PLEKHM2 Pleckstrin homology domain containing, family M (with RUN 205.68 86.88 0.138 45.61
domain) member 2
145442 MAP2K1 Mitogen-activated protein kinase kinase 1 101.59 55.16 0.241 57.21
145575 UBL3 Ubiquitin-like 3 157.68 79.65 0.345 90.10
146070 TPM3 Tropomyosin 3 695.80 102.33 0.000 175.65
146393 HERPUD1 Homocysteine-inducible, endoplasmic reticulum stress-inducible, 226.44 86.29 0.172 101.04
ubiquitin-like domain member 1
146602 UQCRQ Ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5 kDa 193.38 169.43 0.276 312.78
146804 SPIN1 Spindlin 1 127.00 68.69 0.345 46.25
146806 CUL1 Cullin 1 120.27 57.50 0.207 69.33
147433 PCNA Proliferating cell nuclear antigen 258.31 133.96 0.172 92.79
148078 UBR4 Ubiquitin protein ligase E3 component n-recognin 4 144.18 73.44 0.138 81.01
148272 CCM2 Cerebral cavernous malformation 2 199.79 94.01 0.207 76.34
148330 ARF4 ADP-ribosylation factor 4 385.93 105.50 0.138 153.40
148340 PTPRG Protein tyrosine phosphatase, receptor type, G 1592.61 150.52 0.069 252.27
148670 RHOBTB1 Rho-related BTB domain containing 1 116.95 99.14 0.345 47.31
149004 FBXO31 F-box protein 31 141.63 81.88 0.379 71.24
149957 RPS6KA1 Ribosomal protein S6 kinase, 90 kDa, polypeptide 1 146.89 140.85 0.310 62.80
149983 PEX14 Peroxisomal biogenesis factor 14 132.69 140.50 0.241 43.40
150107 BIRC6 Baculoviral IAP repeat-containing 6 (apollon) 149.90 66.77 0.345 78.67
150540 TMEM112B Transmembrane protein 112B 180.63 177.93 0.379 53.76
150580 EIF1 Eukaryotic translation initiation factor 1 458.80 84.42 0.034 865.15
150837 TXNDC5 Thioredoxin domain containing 5 483.23 126.33 0.034 99.46
151134 OXA1L Oxidase (cytochrome c) assembly 1-like 238.54 70.29 0.103 62.00
151220 PALLD Palladin, cytoskeletal associated protein 198.94 75.04 0.345 113.44
151413 GMFB Glia maturation factor beta 190.53 95.31 0.379 113.32
151787 EFTUD2 Elongation factor Tu GTP binding domain containing 2 326.78 81.27 0.069 105.28
152536 PSMD6 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 6 134.14 63.78 0.241 75.62
153177 RPS28 Ribosomal protein S28 437.53 297.35 0.241 1095.00
154023 TXNDC4 Thioredoxin domain containing 4 (endoplasmic reticulum) 133.74 72.55 0.345 51.92
154073 SLC35B1 Solute carrier family 35, member B1 99.61 61.75 0.379 52.53
155165 ZFPL1 Zinc finger protein-like 1 156.23 92.72 0.310 64.84
155218 HNRPUL1 Heterogeneous nuclear ribonucleoprotein U-like 1 474.38 82.52 0.000 175.01
155396 NFE2L2 Nuclear factor (erythroid-derived 2)-like 2 182.54 63.38 0.172 76.81
155829 TBC1D9B TBC1 domain family, member 9B (with GRAM domain) 189.13 67.14 0.241 61.75
156171 PSMC6 Proteasome (prosome, macropain) 26S subunit, ATPase, 6 202.42 86.99 0.172 72.51
156367 RPS29 Ribosomal protein S29 735.43 357.07 0.241 2469.70
156667 CALCOCO Calcium binding and coiled-coil domain 1 150.95 83.49 0.276 48.15
157160 MRPS34 Mitochondrial ribosomal protein S34 163.79 79.67 0.276 94.71
157351 GTPBP9 GTP-binding protein 9 (putative) 256.77 85.59 0.207 86.88
157379 H2AFV H2A histone family, member V 212.94 72.40 0.138 196.03
157394 HAGH Hydroxyacylglutathione hydrolase 110.09 79.63 0.345 58.25
159014 PRPF4B PRP4 pre-mRNA processing factor 4 homolog B (yeast) 101.54 63.09 0.379 87.15
159118 AMD1 Adenosylmethionine decarboxylase 1 179.16 87.63 0.241 87.60
159130 RAF1 V-raf-1 murine leukemia viral oncogene homolog 1 148.50 123.34 0.138 75.30
159161 ARHGDIA Rho GDP dissociation inhibitor (GDI) alpha 781.87 98.28 0.138 124.37
159699 FBXO21 F-box protein 21 112.15 59.46 0.345 78.43
159799 THRAP2 Thyroid hormone receptor associated protein 2 135.37 68.96 0.345 57.41
160958 CDC37 CDC37 cell division cycle 37 homolog (S. cerevisiae) 297.55 114.77 0.069 93.25
161357 PDHB Pyruvate dehydrogenase (lipoamide) beta 188.51 80.70 0.172 57.45
162032 HBP1 HMG-box transcription factor 1 119.42 40.70 0.345 76.14
162233 CHD4 Chromodomain helicase DNA binding protein 4 294.77 95.15 0.207 209.93
162877 PACSIN2 Protein kinase C and casein kinase substrate in neurons 2 181.10 101.47 0.207 88.79
163645 MOCS2 Molybdenum cofactor synthesis 2 123.58 91.10 0.276 59.81
163776 UBE2J1 Ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast) 229.95 250.60 0.310 47.01
163893 PICALM Phosphatidylinositol binding clathrin assembly protein 153.29 84.25 0.310 98.35
165195 VAPA VAMP (vesicle-associated membrane protein)-associated protein 170.73 76.58 0.069 115.35
A, 33 kDa
166011 CTNND1 Catenin (cadherin-associated protein), delta 1 181.39 76.07 0.138 75.94
166204 PHF1 PHD finger protein 1 128.96 77.28 0.345 43.53
166463 HNRPU Heterogeneous nuclear ribonucleoprotein U (scaffold attachment 279.34 89.13 0.034 185.87
factor A)
166924 SEC13 SEC13 homolog (S. cerevisiae) 164.56 70.57 0.207 99.75
166975 SFRS5 Splicing factor, arginine/serine-rich 5 241.85 95.20 0.138 153.47
167535 SRP54 Signal recognition particle 54 kDa 132.08 105.35 0.241 43.01
168073 TRPC4AP Transient receptor potential cation channel, subfamily C, member 174.32 67.74 0.241 95.49
4 associated protein
168799 METTL3 Methyltransferase like 3 133.88 65.22 0.172 71.62
169611 DIABLO Diablo homolog (Drosophila) 167.55 69.66 0.276 41.81
169718 CNN2 Calponin 2 263.90 111.61 0.138 133.00
170107 UQCRFS1 Ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 112.20 75.09 0.241 76.06
170131 NFIC Nuclear factor I/C (CCAAT-binding transcription factor) 128.62 75.64 0.379 73.22
170553 CNOT7 CCR4-NOT transcription complex, subunit 7 119.98 77.62 0.276 62.09
170622 CFL1 Cofilin 1 (non-muscle) 1372.26 96.41 0.034 1717.53
171626 SKP1A S-phase kinase-associated protein 1A (p19A) 457.12 128.78 0.138 403.46
172550 PTBP1 Polypyrimidine tract binding protein 1 554.08 85.76 0.103 138.65
172755 BRP44L Brain protein 44-like 150.10 97.09 0.379 90.49
172928 COL1A1 Collagen, type I, alpha 1 657.85 170.49 0.276 1790.49
173024 NUB1 Negative regulator of ubiquitin-like proteins 1 102.38 55.09 0.276 49.89
173162 COX4NB COX4 neighbor 259.86 100.34 0.310 48.81
173381 DPYSL2 Dihydropyrimidinase-like 2 213.62 76.62 0.310 337.96
173464 FKBP8 FK506 binding protein 8, 38 kDa 446.43 105.38 0.103 241.30
173611 NDUFS2 NADH dehydrogenase (ubiquinone) Fe—S protein 2, 49 kDa 308.98 100.60 0.069 103.79
(NADH-coenzyme Q reductase)
173705 LOC40115 HCV F-transactivated protein 1 155.92 91.92 0.207 105.45
173724 CKB Creatine kinase, brain 395.40 117.54 0.310 500.02
174050 EDF1 Endothelial differentiation-related factor 1 163.11 77.20 0.345 295.84
174195 IFITM2 Interferon induced transmembrane protein 2 (1-8D) 439.92 224.90 0.276 123.33
175473 AK1 Adenylate kinase 1 115.05 96.67 0.345 154.31
175955 YTHDC1 YTH domain containing 1 114.99 56.92 0.310 51.24
177530 ATP5E ATP synthase, H+ transporting, mitochondrial F1 complex, epsilo 343.57 172.81 0.207 738.25
subunit
177766 PARP1 Poly (ADP-ribose) polymerase family, member 1 260.77 114.80 0.103 88.33
178551 RPL8 Ribosomal protein L8 1600.62 93.63 0.034 951.00
178728 MBD3 Methyl-CpG binding domain protein 3 226.33 93.86 0.241 150.69
179986 FLOT1 Flotillin 1 239.64 133.66 0.241 173.68
180141 CFL2 Cofilin 2 (muscle) 236.22 198.55 0.345 58.91
180312 MRPS16 Mitochondrial ribosomal protein S16 148.32 71.61 0.276 43.03
180414 HSPA8 Heat shock 70 kDa protein 8 1204.20 99.10 0.000 543.94
180877 H3F3B H3 histone, family 3B (H3.3B) 701.35 71.33 0.000 322.18
180903 NCAPH2 Non-SMC condensin II complex, subunit H2 273.31 91.43 0.310 66.01
180909 PRDX1 Peroxiredoxin 1 973.56 146.34 0.138 346.95
180933 CXXC1 CXXC finger 1 (PHD domain) 127.97 58.18 0.345 51.48
181046 DUSP3 Dual specificity phosphatase 3 (vaccinia virus phosphatase VH1- 168.09 115.04 0.207 74.49
related)
181112 MED4 Mediator of RNA polymerase II transcription, subunit 4 homolog 208.67 152.66 0.276 52.19
(yeast)
181163 HMGN2 High-mobility group nucleosomal binding domain 2 798.73 84.12 0.000 504.02
181244 HLA-A Major histocompatibility complex, class I, A 874.95 96.35 0.138 945.29
181368 PRPF8 PRP8 pre-mRNA processing factor 8 homolog (yeast) 308.98 76.46 0.138 57.52
181444 TMEM9 Transmembrane protein 9 210.70 80.44 0.172 99.45
182255 NHP2L1 NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) 236.95 69.85 0.069 216.97
182626 C22orf5 Chromosome 22 open reading frame 5 189.45 87.32 0.310 85.24
182885 SLC35B2 Solute carrier family 35, member B2 197.27 131.49 0.241 71.21
183684 EIF4G2 Eukaryotic translation initiation factor 4 gamma, 2 571.05 99.96 0.069 244.19
183706 ADD1 Adducin 1 (alpha) 210.75 70.37 0.138 124.62
183800 RANGAP1 Ran GTPase activating protein 1 330.34 92.47 0.172 82.36
183850 DCTD DCMP deaminase 140.58 59.00 0.345 50.00
183994 PPP1CA Protein phosphatase 1, catalytic subunit, alpha isoform 374.52 71.55 0.103 122.79
184062 C20orf24 Chromosome 20 open reading frame 24 161.95 77.22 0.310 106.44
184211 PMPCB Peptidase (mitochondrial processing) beta 177.15 64.50 0.138 44.05
184233 HSPA9 Heat shock 70 kDa protein 9 (mortalin) 311.24 80.92 0.034 155.04
184492 ELAVL1 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu 130.66 66.07 0.207 61.10
antigen R)
185172 GNB2 Guanine nucleotide binding protein (G protein), beta polypeptide 2 420.89 178.43 0.172 146.97
185597 SPG7 Spastic paraplegia 7, paraplegin (pure and complicated autosomal 167.10 102.17 0.207 85.24
recessive)
187199 MALAT1 Metastasis associated lung adenocarcinoma transcript 1 (non- 3984.95 243.42 0.241 982.17
coding RNA)
187635 RPS15A Chromosome 20 open reading frame 19 705.06 435.58 0.138 584.60
187763 BRD4 Bromodomain containing 4 226.90 138.89 0.241 92.81
187866 NPTN Neuroplastin 120.12 53.64 0.379 127.00
187946 SLC20A1 Solute carrier family 20 (phosphate transporter), member 1 141.36 96.84 0.207 79.95
188501 PAFAH1B2 Platelet-activating factor acetylhydrolase, isoform Ib, beta subunit 149.54 78.69 0.138 75.71
30 kDa
188614 PLEKHA5 Pleckstrin homology domain containing, family A member 5 115.79 66.94 0.379 53.09
188879 RBM6 RNA binding motif protein 6 100.43 54.89 0.379 79.10
188882 NUDT3 Nudix (nucleoside diphosphate linked moiety X)-type motif 3 129.54 63.13 0.276 41.12
189075 TWF1 Twinfilin, actin-binding protein, homolog 1 (Drosophila) 164.98 70.22 0.310 103.18
189119 CXXC5 CXXC finger 5 97.63 45.99 0.345 191.46
189329 SMURF1 SMAD specific E3 ubiquitin protein ligase 1 126.19 77.52 0.379 46.81
189716 NDUFAB1 NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1, 224.85 87.06 0.276 59.73
8 kDa
189772 CCT2 Chaperonin containing TCP1, subunit 2 (beta) 269.61 95.66 0.069 124.53
190028 GSTO1 Glutathione S-transferase omega 1 178.51 92.79 0.241 87.26
190086 MRCL3 Myosin regulatory light chain MRCL3 469.83 322.83 0.172 204.74
190334 RAP1A RAP1A, member of RAS oncogene family 130.79 76.47 0.310 49.76
190384 COPS4 COP9 constitutive photomorphogenic homolog subunit 4 163.76 100.38 0.138 59.12
(Arabidopsis)
190722 C19orf62 Chromosome 19 open reading frame 62 218.33 85.79 0.207 75.54
190904 STRN4 Striatin, calmodulin binding protein 4 183.13 100.67 0.241 74.69
191186 TTC17 Tetratricopeptide repeat domain 17 125.42 63.68 0.310 43.91
191346 SEPT7 Septin 7 318.59 80.82 0.103 196.34
191518 DHX9 DEAH (Asp-Glu-Ala-His) box polypeptide 9 239.90 67.53 0.241 61.56
191987 UBE2J2 Ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast) 125.95 71.90 0.207 35.20
192316 CDC2L1 Cell division cycle 2-like 1 (PITSLRE proteins) 102.48 85.83 0.379 83.41
192374 HSP90B1 Heat shock protein 90 kDa beta (Grp94), member 1 388.12 88.21 0.034 487.07
192425 EIF3S8 Eukaryotic translation initiation factor 3, subunit 8, 110 kDa 1001.22 91.36 0.103 382.10
193118 ZMIZ1 Zinc finger, MIZ-type containing 1 125.42 71.59 0.345 103.91
193163 BIN1 Bridging integrator 1 216.65 88.45 0.241 86.88
193491 TUBB6 Tubulin, beta 6 255.15 94.70 0.241 85.60
194329 TCEAL4 Transcription elongation factor A (SII)-like 4 110.76 60.41 0.207 98.50
194718 ZRANB2 Zinc finger, RAN-binding domain containing 2 170.63 70.34 0.207 60.86
195464 FLNA Filamin A, alpha (actin binding protein 280) 554.90 92.75 0.172 45.29
195642 RNF213 Ring finger protein 213 146.02 74.10 0.379 49.42
196983 SSFA2 Sperm specific antigen 2 238.74 197.56 0.241 41.49
198281 PKM2 Pyruvate kinase, muscle 3044.33 101.80 0.000 562.77
199561 RANBP2 RAN binding protein 2 134.09 59.13 0.379 78.36
199625 HAX1 HCLS1 associated protein X-1 243.58 94.74 0.138 231.23
200063 HDAC7A Histone deacetylase 7A 252.27 159.81 0.241 66.57
200600 SCAMP3 Secretory carrier membrane protein 3 165.58 75.71 0.207 82.26
200804 SDCBP Syndecan binding protein (syntenin) 355.16 73.99 0.172 100.60
201253 CKAP5 Cytoskeleton associated protein 5 157.71 77.53 0.069 51.67
201390 WDR45L WDR45-like 115.15 53.09 0.138 66.73
201712 GLG1 Golgi apparatus protein 1 128.23 88.99 0.310 62.32
202011 CCDC47 Coiled-coil domain containing 47 108.62 67.48 0.172 152.06
202085 VDAC1 Voltage-dependent anion channel 1 179.22 70.07 0.276 154.71
202166 HNRPH1 Heterogeneous nuclear ribonucleoprotein H1 (H) 199.33 74.31 0.069 183.12
202179 SMN2 Survival of motor neuron 1, telomeric 103.17 55.27 0.379 77.19
203099 WAPAL Wings apart-like homolog (Drosophila) 162.13 143.02 0.345 56.63
203910 SGTA Small glutamine-rich tetratricopeptide repeat (TPR)-containing, 213.58 79.65 0.138 124.15
alpha
204041 AHSA1 AHA1, activator of heat shock 90 kDa protein ATPase homolog 1 263.29 112.20 0.207 131.33
(yeast)
204773 WDR77 WD repeat domain 77 185.81 74.28 0.172 65.95
205163 MRPL3 Mitochondrial ribosomal protein L3 176.93 58.08 0.069 129.59
206500 CTTN Cortactin 148.63 96.70 0.310 85.71
206824 MGC71993 Similar to DNA segment, Chr 11, Brigham & Womens 143.54 88.77 0.345 218.52
Genetics 0434 expressed
208597 CTBP1 Hypothetical protein LOC285463 136.74 48.53 0.138 213.99
209983 STMN1 Stathmin 1/oncoprotein 18 619.09 139.81 0.034 198.15
210469 ELMO2 Engulfment and cell motility 2 (ced-12 homolog, C. elegans) 96.39 71.43 0.379 57.31
210532 KIAA0141 KIAA0141 138.36 72.99 0.241 62.91
211463 DNM2 Dynamin 2 195.67 87.32 0.241 81.50
211594 PSMC4 Proteasome (prosome, macropain) 26S subunit, ATPase, 4 469.59 192.26 0.138 67.56
211914 NDUFS7 NADH dehydrogenase (ubiquinone) Fe—S protein 7, 20 kDa 159.44 73.80 0.379 86.83
(NADH-coenzyme Q reductase)
212102 PDIA6 Protein disulfide isomerase family A, member 6 274.17 97.91 0.103 160.42
212395 CIZ1 CDKN1A interacting zinc finger protein 1 272.61 88.59 0.138 50.78
213061 NUCKS1 Nuclear casein kinase and cyclin-dependent kinase substrate 1 304.71 64.96 0.138 231.69
213470 PSMB7 Proteasome (prosome, macropain) subunit, beta type, 7 247.81 65.94 0.034 222.67
213541 LOC55288 Hypothetical LOC552889 136.06 60.14 0.345 67.95
213666 KIAA0460 KIAA0460 96.71 78.04 0.241 68.88
213724 SUPT16H Suppressor of Ty 16 homolog (S. cerevisiae) 149.27 79.71 0.207 52.16
216653 FBXO9 F-box protein 9 92.27 49.72 0.310 50.09
220950 FOXO3 Forkhead box O3 196.88 112.74 0.276 91.70
221847 SLC38A2 Solute carrier family 38, member 2 204.23 78.33 0.207 281.04
222510 DAZAP1 DAZ associated protein 1 126.05 97.18 0.276 67.85
223141 DDX21 DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 255.54 70.08 0.069 103.03
224607 SDC1 Syndecan 1 241.65 87.87 0.276 119.67
226007 RDH11 Retinol dehydrogenase 11 (all-trans and 9-cis) 340.36 135.94 0.172 92.30
226117 H1F0 H1 histone family, member 0 326.85 160.18 0.310 127.49
226755 YWHAH Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase 199.21 161.02 0.207 191.85
activation protein, eta polypeptide
227067 ATAD3A ATPase family, AAA domain containing 3A 254.68 105.30 0.172 57.56
227253 TOMM70A Translocase of outer mitochondrial membrane 70 homolog A 130.67 67.31 0.172 87.82
(yeast)
227777 PTP4A1 Protein tyrosine phosphatase type IVA, member 1 219.08 115.20 0.138 131.83
229641 SUB1 SUB1 homolog (S. cerevisiae) 300.51 103.71 0.138 147.72
231295 PITPNC1 Phosphatidylinositol transfer protein, cytoplasmic 1 171.09 127.31 0.345 63.03
231616 C19orf53 Chromosome 19 open reading frame 53 162.05 104.55 0.345 102.58
232194 KIAA0174 KIAA0174 204.24 73.78 0.138 84.98
232543 PDCD4 Programmed cell death 4 (neoplastic transformation inhibitor) 126.25 61.41 0.310 189.22
233458 NFYC Nuclear transcription factor Y, gamma 92.20 51.11 0.345 89.24
233552 CDC2L5 Cell division cycle 2-like 5 (cholinesterase-related cell division 139.27 109.94 0.379 29.61
controller)
233952 PSMA7 Proteasome (prosome, macropain) subunit, alpha type, 7 358.81 133.21 0.069 431.24
234521 MAPKAPK3 Mitogen-activated protein kinase-activated protein kinase 3 185.75 77.03 0.379 59.41
236030 SMARCC2 SWI/SNF related, matrix associated, actin dependent regulator of 198.07 83.50 0.207 34.66
chromatin, subfamily c, member 2
237536 NT5C3L 5′-nucleotidase, cytosolic III-like 160.67 84.27 0.276 95.40
237971 XTP3TPA XTP3-transactivated protein A 122.34 67.16 0.276 58.94
238839 SCYL1 SCY1-like 1 (S. cerevisiae) 173.16 113.72 0.310 144.41
240170 OBFC2B Oligonucleotide/oligosaccharide-binding fold containing 2B 136.42 69.86 0.345 96.25
241336 ATPIF1 ATPase inhibitory factor 1 227.40 125.29 0.172 224.03
241543 POLDIP2 Polymerase (DNA-directed), delta interacting protein 2 217.98 81.62 0.138 66.91
241558 ARIH2 Ariadne homolog 2 (Drosophila) 178.45 77.54 0.172 65.16
241575 GNPTG N-acetylglucosamine-1-phosphate transferase, gamma subunit 117.17 100.69 0.345 73.29
241576 DERL1 Der1-like domain family, member 1 111.58 87.37 0.310 72.57
241579 SERPINH1 Serpin peptidase inhibitor, clade H (heat shock protein 47), 380.44 115.76 0.172 198.12
member 1, (collagen binding protein 1)
242458 SPG21 Spastic paraplegia 21 (autosomal recessive, Mast syndrome) 120.35 59.44 0.310 76.41
242947 DGKI Diacylglycerol kinase, iota 131.75 120.70 0.379 4086.25
246112 ASCC3L1 Activating signal cointegrator 1 complex subunit 3-like 1 278.46 81.24 0.172 160.68
246310 ATP5J ATP synthase, H+ transporting, mitochondrial F0 complex, subuni 220.45 113.90 0.276 232.33
F6
246413 CPNE1 RNA binding motif protein 12 392.42 88.16 0.069 93.63
246781 FBXO11 F-box protein 11 141.20 92.55 0.379 48.14
247077 RHOA Ras homolog gene family, member A 553.79 77.72 0.034 545.41
247186 FBRS Fibrosin 145.20 107.50 0.379 70.03
247975 HSPD1 Pro-melanin-concentrating hormone-like 1 241.69 85.58 0.207 238.18
248267 MPST Mercaptopyruvate sulfurtransferase 167.67 112.86 0.276 80.10
248941 TAF9 TAF9 RNA polymerase II, TATA box binding protein (TBP)- 148.14 65.92 0.276 54.96
associated factor, 32 kDa
249600 DLGAP4 Discs, large (Drosophila) homolog-associated protein 4 233.49 169.10 0.276 98.90
250009 ARL8B ADP-ribosylation factor-like 8B 132.27 55.79 0.379 134.21
250429 SUPT6H Suppressor of Ty 6 homolog (S. cerevisiae) 162.25 82.76 0.379 44.11
250758 PSMC3 Proteasome (prosome, macropain) 26S subunit, ATPase, 3 391.11 115.64 0.138 111.57
250899 HSBP1 Heat shock factor binding protein 1 214.94 105.83 0.069 141.99
250905 TMEM85 Transmembrane protein 85 156.08 143.74 0.241 77.54
251531 PSMA4 Proteasome (prosome, macropain) subunit, alpha type, 4 739.81 217.34 0.138 172.42
252457 MVD Mevalonate (diphospho) decarboxylase 170.93 117.34 0.379 65.93
252713 TTC15 Tetratricopeptide repeat domain 15 105.62 56.20 0.345 75.68
252967 C1orf144 Chromosome 1 open reading frame 144 240.90 109.65 0.207 105.98
253726 PAPOLA Poly(A) polymerase alpha 216.15 65.36 0.172 118.24
253903 STOM Stomatin 199.17 100.65 0.276 100.22
254042 BAT1 HLA-B associated transcript 1 351.44 89.43 0.069 144.69
255015 VPS24 Vacuolar protein sorting 24 (yeast) 126.82 67.80 0.069 79.90
255093 PFKL Phosphofructokinase, liver 342.69 81.83 0.207 167.85
255932 XRN2 5′-3′ exoribonuclease 2 166.16 57.70 0.069 53.31
255935 BTG1 B-cell translocation gene 1, anti-proliferative 272.14 115.44 0.138 264.18
255973 EID1 EP300 interacting inhibitor of differentiation 1 227.90 86.79 0.138 174.44
256301 C19orf48 Chromosome 19 open reading frame 48 337.67 84.54 0.207 158.37
256549 NUBP2 Nucleotide binding protein 2 (MinD homolog, E. coli) 200.75 98.94 0.241 76.00
257008 PLD3 Phospholipase D family, member 3 349.21 100.00 0.276 203.69
257341 SAV1 Salvador homolog 1 (Drosophila) 91.57 65.55 0.276 34.40
257761 SH3BP5 SH3-domain binding protein 5 (BTK-associated) 170.93 92.54 0.345 70.17
258551 DNPEP Aspartyl aminopeptidase 168.16 84.05 0.138 38.05
258563 FEZ2 Fasciculation and elongation protein zeta 2 (zygin II) 190.19 204.72 0.345 67.33
258798 NSMCE4A Non-SMC element 4 homolog A (S. cerevisiae) 79.52 52.34 0.345 366.69
259461 PALM2- PALM2-AKAP2 protein 171.91 79.41 0.310 128.63
AKAP2
260603 PIP5K2B Phosphatidylinositol-4-phosphate 5-kinase, type II, beta 132.75 67.00 0.276 94.30
262823 IARS2 Isoleucyl-tRNA synthetase 2, mitochondrial 139.24 59.53 0.345 118.15
265829 ITGA3 Integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 404.31 148.83 0.379 109.76
receptor)
268488 LRRC47 Leucine rich repeat containing 47 115.89 116.32 0.379 54.76
268530 GPS1 Radical fringe homolog (Drosophila) 263.51 64.58 0.138 107.13
268742 POMP Proteasome maturation protein 213.22 98.49 0.276 212.21
268849 GLO1 Glyoxalase I 293.88 85.24 0.138 179.31
268939 MATR3 Matrin 3 292.73 68.23 0.034 241.08
269528 NAT13 N-acetyltransferase 13 237.37 198.20 0.172 110.90
269577 PTPRA Protein tyrosine phosphatase, receptor type, A 183.68 82.75 0.207 168.07
269782 GNAQ Guanine nucleotide binding protein (G protein), q polypeptide 174.12 105.06 0.241 52.13
269944 MTCH2 Mitochondrial carrier homolog 2 (C. elegans) 158.42 74.35 0.103 70.20
270291 ACTN4 Actinin, alpha 4 341.13 108.40 0.172 419.64
270428 SUCLG1 Succinate-CoA ligase, GDP-forming, alpha subunit 242.34 241.99 0.241 106.33
270525 LASS5 LAG1 longevity assurance homolog 5 (S. cerevisiae) 111.31 73.14 0.379 57.78
270869 ZNF410 Zinc finger protein 410 135.77 84.28 0.172 53.74
271135 ATP5C1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamm 448.47 176.19 0.172 135.97
polypeptide 1
271695 NOB1 NIN1/RPN12 binding protein 1 homolog (S. cerevisiae) 111.46 73.07 0.310 47.43
272062 PTPRF Protein tyrosine phosphatase, receptor type, F 269.10 88.46 0.310 119.22
272168 SERINC3 Serine incorporator 3 121.11 72.44 0.138 39.75
272630 ATP6V1D ATPase, H+ transporting, lysosomal 34 kDa, V1 subunit D 149.33 85.72 0.207 78.13
272927 SEC23A Sec23 homolog A (S. cerevisiae) 128.24 74.07 0.379 52.45
273077 TMEM14B Transmembrane protein 14B 128.20 70.29 0.345 63.88
274184 TFE3 Transcription factor binding to IGHM enhancer 3 111.31 57.20 0.276 57.28
274772 C15orf15 Chromosome 15 open reading frame 15 1163.64 205.16 0.172 82.77
274873 CARS Cysteinyl-tRNA synthetase 176.72 76.48 0.207 82.54
275243 S100A6 S100 calcium binding protein A6 (calcyclin) 361.59 101.08 0.103 591.93
275775 SEPP1 Selenoprotein P, plasma, 1 543.33 189.21 0.379 121.63
275865 PCNP PEST-containing nuclear protein 315.34 88.79 0.069 83.52
276878 NUP93 Nucleoporin 93 kDa 101.32 60.26 0.241 65.66
277035 MGLL Monoglyceride lipase 399.51 211.97 0.379 116.15
277517 C11orf2 Chromosome 11 open reading frame 2 193.83 84.84 0.241 127.65
278186 ARHGEF1 Rho guanine nucleotide exchange factor (GEF) 1 194.28 91.63 0.345 73.95
278362 MEA1 Male-enhanced antigen 1 152.60 83.00 0.276 98.75
278426 PDAP1 PDGFA associated protein 1 184.93 86.49 0.172 106.94
278429 C9orf78 Chromosome 9 open reading frame 78 109.74 79.17 0.276 63.78
278500 GNPDA1 Glucosamine-6-phosphate deaminase 1 174.64 74.75 0.241 80.44
278569 SNX17 Sorting nexin 17 297.66 66.25 0.069 132.92
278573 CD59 CD59 antigen p18-20 (antigen identified by monoclonal antibodies 336.75 91.21 0.138 154.72
16.3A5, EJ16, EJ30, EL32 and G344)
278721 SLC39A7 Solute carrier family 39 (zinc transporter), member 7 147.65 72.58 0.379 71.42
279061 GLOD4 Glyoxalase domain containing 4 148.90 76.66 0.172 65.97
279245 TACC1 Transforming, acidic coiled-coil containing protein 1 186.16 79.86 0.241 103.52
279257 PCMT1 Protein-L-isoaspartate (D-aspartate) O-methyltransferase 172.73 62.20 0.103 102.09
279413 POLD1 Polymerase (DNA directed), delta 1, catalytic subunit 125 kDa 164.91 99.93 0.276 75.52
279529 PRELID1 PRELI domain containing 1 224.95 77.28 0.172 102.94
279583 METTL9 Methyltransferase like 9 183.44 155.70 0.241 146.63
279623 SEPX1 Selenoprotein X, 1 117.70 54.66 0.345 47.48
279640 TPR Translocated promoter region (to activated MET oncogene) 94.90 66.61 0.310 69.84
279652 MRPL4 Mitochondrial ribosomal protein L4 173.40 73.00 0.276 110.73
279669 TUBG1 Tubulin, gamma 1 169.58 65.01 0.310 72.06
279696 SUMF2 Sulfatase modifying factor 2 149.85 83.02 0.345 127.55
279806 DDX5 RNA-binding protein 45 (RBP45), putative 457.60 87.95 0.103 856.99
279836 COMMD9 COMM domain containing 9 104.98 49.94 0.379 60.58
279920 YWHAB Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase 288.39 87.94 0.034 251.99
activation protein, beta polypeptide
279929 TMED9 Transmembrane emp24 protein transport domain containing 9 291.55 91.04 0.069 202.03
280202 SBF1 SET binding factor 1 382.01 317.21 0.310 36.29
280342 PRKAR1A Protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue 266.02 111.27 0.103 209.46
specific extinguisher 1)
280378 SNRPB2 Small nuclear ribonucleoprotein polypeptide B″ 243.47 100.43 0.310 68.06
282410 CALM1 Calmodulin 1 (phosphorylase kinase, delta) 246.78 67.76 0.103 513.80
282700 SPCS2 Signal peptidase complex subunit 2 homolog (S. cerevisiae) 232.99 84.36 0.207 59.54
282901 RBM39 RNA binding motif protein 39 166.92 85.70 0.138 181.79
282998 RBM9 RNA binding motif protein 9 477.00 221.29 0.103 145.15
283111 C14orf124 Chromosome 14 open reading frame 124 168.06 139.52 0.207 73.74
283454 BNIP2 BCL2/adenovirus E1B 19 kDa interacting protein 2 130.03 68.79 0.310 47.89
283521 RHEB Ras homolog enriched in brain 193.25 113.28 0.310 92.73
283610 ATG4B ATG4 autophagy related 4 homolog B (S. cerevisiae) 180.36 88.44 0.172 49.24
283652 IDI1 Isopentenyl-diphosphate delta isomerase 1 233.34 102.32 0.241 58.55
283739 UBQLN4 Ubiquilin 4 165.35 84.58 0.207 62.49
284208 ANKRD25 Ankyrin repeat domain 25 124.68 85.84 0.379 46.63
284279 HMOX2 Heme oxygenase (decycling) 2 151.53 85.91 0.310 50.68
284286 MRPS24 Mitochondrial ribosomal protein S24 136.83 77.51 0.345 71.40
284491 PDXK Pyridoxal (pyridoxine, vitamin B6) kinase 235.50 93.74 0.138 787.92
285354 MAX MYC associated factor X 109.16 60.60 0.345 64.26
285976 LASS2 LAG1 longevity assurance homolog 2 (S. cerevisiae) 203.17 82.28 0.172 132.14
286221 ARF1 ADP-ribosylation factor 1 704.87 66.67 0.069 199.12
286226 MYO1C Myosin IC 253.69 114.87 0.310 90.05
288193 KPNA4 Karyopherin alpha 4 (importin alpha 3) 144.60 134.58 0.379 59.34
288856 PFDN5 Prefoldin 5 226.65 96.63 0.103 320.21
288969 NMRAL1 NmrA-like family domain containing 1 126.04 77.91 0.379 34.41
289008 NUS1 Nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) 157.63 95.67 0.310 68.14
289092 COTL1 Coactosin-like 1 (Dictyostelium) 315.93 109.13 0.172 167.69
289123 DCTN2 Dynactin 2 (p50) 261.39 105.34 0.069 89.02
289271 CYC1 Cytochrome c-1 345.69 78.79 0.172 242.81
290243 GBF1 Golgi-specific brefeldin A resistance factor 1 241.54 85.11 0.310 632.98
290404 SLC25A3 Solute carrier family 25 (mitochondrial carrier; phosphate carrier), 1579.85 87.93 0.034 45.05
member 3
290758 DDB1 Damage-specific DNA binding protein 1, 127 kDa 452.78 82.29 0.138 190.14
291587 ARID1B AT rich interactive domain 1B (SWI1-like) 135.97 82.06 0.310 73.22
292026 EIF4E2 Eukaryotic translation initiation factor 4E member 2 186.78 88.38 0.138 46.59
292063 EIF4B Hypothetical protein PRO1843 439.43 110.97 0.103 148.75
292078 LARP1 La ribonucleoprotein domain family, member 1 246.82 65.22 0.069 105.37
292265 ZMYND11 Zinc finger, MYND domain containing 11 133.13 109.13 0.207 56.47
292457 SNHG5 Small nucleolar RNA host gene (non-protein coding) 5 400.14 267.50 0.276 289.85
292493 XRCC6 X-ray repair complementing defective repair in Chinese hamster 691.10 100.07 0.034 318.36
cells 6 (Ku autoantigen, 70 kDa)
292524 CCNH Cyclin H 158.48 96.80 0.276 32.70
292579 PTDSS1 Phosphatidylserine synthase 1 195.76 80.55 0.276 67.07
293563 C1orf108 Chromosome 1 open reading frame 108 144.99 87.81 0.172 65.61
295917 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58 kDa, V1 subunit B, 151.09 76.58 0.207 62.97
isoform 2
297324 TIMP3 TIMP metallopeptidase inhibitor 3 (Sorsby fundus dystrophy, 505.19 227.34 0.310 200.02
pseudoinflammatory)
298198 CMTM3 CKLF-like MARVEL transmembrane domain containing 3 127.34 71.77 0.310 95.15
298280 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha 1791.25 357.36 0.000 473.59
subunit, isoform 1, cardiac muscle
298654 DUSP6 Dual specificity phosphatase 6 208.26 87.60 0.310 98.88
299002 FBL Fibrillarin 591.46 179.47 0.138 162.19
299055 GDI2 GDP dissociation inhibitor 2 323.73 77.59 0.069 72.16
300141 RPL39 Ribosomal protein L39 775.36 419.08 0.172 791.80
300684 RCP9 Calcitonin gene-related peptide-receptor component protein 79.62 45.89 0.241 39.78
300772 TPM2 Tropomyosin 2 (beta) 881.72 370.12 0.345 294.55
300816 RAB1B RAB1B, member RAS oncogene family 228.92 96.00 0.172 175.17
300834 GALNT2 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N- 155.76 89.15 0.241 76.65
acetylgalactosaminyltransferase 2 (GalNAc-T2)
301404 RBM3 RNA binding motif (RNP1, RRM) protein 3 325.81 102.69 0.172 117.20
301412 UFC1 Ubiquitin-fold modifier conjugating enzyme 1 142.19 76.03 0.276 155.60
302742 MRPS6 Mitochondrial ribosomal protein S6 184.15 77.33 0.276 99.50
302903 UBE2I Ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) 178.40 82.89 0.172 95.85
303676 G3BP2 Ras-GTPase activating protein SH3 domain-binding protein 2 149.92 66.30 0.241 98.85
304192 DSTN Destrin (actin depolymerizing factor) 223.11 77.62 0.207 79.90
304682 CST3 Cystatin C (amyloid angiopathy and cerebral hemorrhage) 266.47 126.42 0.172 802.25
306123 MAGEF1 Melanoma antigen family F, 1 183.67 83.29 0.379 64.12
306242 RANBP9 RAN binding protein 9 116.92 67.43 0.310 66.12
306329 ZFAND6 Zinc finger, AN1-type domain 6 247.28 99.07 0.276 111.07
306425 IBTK Inhibitor of Bruton agammaglobulinemia tyrosine kinase 104.18 51.87 0.379 71.02
308122 ITPK1 Inositol 1,3,4-triphosphate 5/6 kinase 254.52 81.30 0.276 53.88
308340 NUP188 Nucleoporin 188 kDa 329.72 144.04 0.241 50.55
308709 PDIA3 Protein disulfide isomerase family A, member 3 204.27 87.48 0.069 175.08
309090 SFRS7 Splicing factor, arginine/serine-rich 7, 35 kDa 189.69 89.49 0.172 104.22
309231 C6orf153 Chromosome 6 open reading frame 153 157.44 80.31 0.310 66.08
309641 RNF11 Ring finger protein 11 162.82 68.82 0.172 187.15
309753 STARD3NL STARD3 N-terminal like 119.30 74.99 0.310 95.69
309849 C14orf159 Chromosome 14 open reading frame 159 122.74 74.53 0.379 43.93
310542 TOMM40 Translocase of outer mitochondrial membrane 40 homolog (yeast) 267.48 79.87 0.138 50.95
310645 RAB1A RAB1A, member RAS oncogene family 252.99 84.41 0.241 104.46
311072 MRPS35 Mitochondrial ribosomal protein S35 138.81 64.82 0.345 40.18
311346 CMAS Cytidine monophosphate N-acetylneuraminic acid synthetase 109.31 97.45 0.345 48.58
311609 DDX39 DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 260.02 110.28 0.138 102.82
311640 RPS27A Ribosomal protein S27a 524.64 119.16 0.034 830.70
312098 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 200.26 132.76 0.345 77.56
313847 TXNDC11 Thioredoxin domain containing 11 106.99 71.40 0.345 35.55
314263 BAZ2A Bromodomain adjacent to zinc finger domain, 2A 164.92 91.68 0.241 70.15
314359 EIF3S12 Eukaryotic translation initiation factor 3, subunit 12 248.91 116.13 0.103 350.37
315177 IFRD2 Interferon-related developmental regulator 2 180.25 60.11 0.276 58.92
315230 EIF1B Eukaryotic translation initiation factor 1B 166.77 108.63 0.207 160.77
319334 NASP Nuclear autoantigenic sperm protein (histone-binding) 320.92 87.44 0.103 131.55
321391 ELOF1 Elongation factor 1 homolog (S. cerevisiae) 119.51 68.26 0.345 60.37
321541 RAB11A RAB11A, member RAS oncogene family 193.82 99.65 0.172 123.34
323363 ATG9A ATG9 autophagy related 9 homolog A (S. cerevisiae) 159.62 88.11 0.276 47.64
323489 PTCD3 Pentatricopeptide repeat domain 3 153.29 80.62 0.172 49.53
324250 NDUFB2 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8 kDa 245.74 182.66 0.379 183.95
324844 VKORC1 Vitamin K epoxide reductase complex, subunit 1 151.74 66.24 0.276 138.96
325650 EHD2 EH-domain containing 2 160.03 99.53 0.379 116.94
326387 MORF4L2 Mortality factor 4 like 2 313.02 109.69 0.103 189.57
330384 CORO1C Coronin, actin binding protein, 1C 171.53 69.53 0.103 118.15
331431 SCC-112 SCC-112 protein 242.38 75.28 0.069 64.31
333388 EEF1D Eukaryotic translation elongation factor 1 delta (guanine nucleotide 899.57 105.63 0.000 404.01
exchange protein)
333579 HSPC152 Hypothetical protein HSPC152 209.20 133.84 0.172 163.96
333786 PSMA2 Proteasome (prosome, macropain) subunit, alpha type, 2 207.24 97.57 0.138 197.41
333823 MRPL13 Mitochondrial ribosomal protein L13 113.33 69.75 0.345 44.81
334017 TUBA1B Tubulin, alpha 1b 1834.27 95.82 0.000 1202.13
334479 TRAF7 TNF receptor-associated factor 7 242.13 130.36 0.138 56.99
334534 GNS Glucosamine (N-acetyl)-6-sulfatase (Sanfilippo disease IIID) 129.18 72.76 0.276 73.76
334587 RBPMS RNA binding protein with multiple splicing 136.68 59.93 0.345 76.18
334713 UBL7 Ubiquitin-like 7 (bone marrow stromal cell-derived) 192.75 67.45 0.207 71.93
334851 LASP1 LIM and SH3 protein 1 297.69 80.06 0.034 98.51
334868 PPP2R5E Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform 111.74 78.51 0.345 40.49
335003 ANKRD11 Ankyrin repeat domain 11 152.63 135.85 0.276 85.85
335057 SEPT2 Septin 2 321.01 90.60 0.069 203.38
335163 LIMCH1 LIM and calponin homology domains 1 217.46 84.47 0.379 58.83
335918 FDPS Farnesyl diphosphate synthase (farnesyl pyrophosphate 635.55 104.20 0.034 75.25
synthetase, dimethylallyltranstransferase, geranyltranstransferase
337295 STIP1 Stress-induced-phosphoprotein 1 (Hsp70/Hsp90-organizing 326.55 78.19 0.172 108.95
337766 TXNRD1 Thioredoxin reductase 1 641.30 103.44 0.034 227.03
339278 COPB1 Coatomer protein complex, subunit beta 1 144.35 59.14 0.241 121.58
339639 COX7A2L Cytochrome c oxidase subunit VIIa polypeptide 2 like 222.21 84.81 0.241 200.80
339697 GRINA Glutamate receptor, ionotropic, N-methyl D-asparate-associated 287.06 90.28 0.103 251.13
protein 1 (glutamate binding)
343911 EI24 Etoposide induced 2.4 mRNA 172.38 72.77 0.103 162.16
345694 KCMF1 Potassium channel modulatory factor 1 114.01 57.72 0.345 54.57
346868 EBNA1BP2 EBNA1 binding protein 2 190.81 79.22 0.276 75.67
348418 DR1 Down-regulator of transcription 1, TBP-binding (nagative cofactor 109.41 77.62 0.207 45.01
349656 SCARB2 Scavenger receptor class B, member 2 147.31 89.03 0.241 210.49
350194 ZMAT2 Zinc finger, matrin type 2 115.49 53.42 0.207 37.72
350229 CASC3 Cancer susceptibility candidate 3 124.19 53.21 0.241 114.41
350268 IRF2BP2 Interferon regulatory factor 2 binding protein 2 153.03 81.62 0.276 118.60
350364 FAM120AOS Family with sequence similarity 120A opposite strand 107.30 65.11 0.379 41.56
350927 SLC25A6 Solute carrier family 25 (mitochondrial carrier; adenine nucleotide 952.99 85.55 0.000 444.35
translocator), member 6
351099 FLJ10241 Hypothetical protein FLJ10241 126.93 65.83 0.276 39.55
351296 LOC51035 SAPK substrate protein 1 210.44 71.71 0.172 87.27
351316 TM4SF1 Transmembrane 4 L six family member 1 422.43 110.13 0.276 449.98
351474 PAQR4 Progestin and adipoQ receptor family member IV 212.87 153.70 0.345 84.43
351680 CDNA clone IMAGE: 5302006 133.19 88.88 0.276 120.23
351875 COX6C Cytochrome c oxidase subunit VIc 304.69 180.70 0.310 559.91
352341 STCH Stress 70 protein chaperone, microsome-associated, 60 kDa 121.74 86.32 0.379 58.92
352656 GHITM Growth hormone inducible transmembrane protein 363.92 99.19 0.103 63.14
352768 PSMB1 Proteasome (prosome, macropain) subunit, beta type, 1 292.02 82.24 0.103 177.54
354056 POR P450 (cytochrome) oxidoreductase 227.09 82.79 0.379 74.23
355141 TNIP1 TNFAIP3 interacting protein 1 269.81 97.79 0.241 102.36
355606 TMEM167 Transmembrane protein 167 211.08 149.60 0.276 80.22
355643 RNPS1 RNA binding protein S1, serine-rich domain 423.42 65.75 0.103 105.94
355708 TMEM127 Transmembrane protein 127 77.31 49.24 0.379 45.95
355750 JOSD3 Josephin domain containing 3 117.50 61.17 0.379 147.10
355753 AGPAT6 1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic 150.13 73.56 0.345 47.02
acid acyltransferase, zeta)
355867 MARS Methionine-tRNA synthetase 323.10 233.26 0.069 59.52
355927 VDAC2 Voltage-dependent anion channel 2 242.40 82.56 0.103 141.28
355934 SFPQ Splicing factor proline/glutamine-rich (polypyrimidine tract binding 269.46 133.96 0.138 128.50
protein associated)
355983 BZW1 Basic leucine zipper and W2 domains 1 338.32 108.39 0.103 181.32
356061 MAP1LC3B Microtubule-associated protein 1 light chain 3 beta 126.69 74.25 0.207 166.48
356096 MAP7D1 MAP7 domain containing 1 191.33 92.49 0.207 152.55
356190 UBB Ubiquitin B 742.69 74.99 0.000 716.73
356270 SDHD Succinate dehydrogenase complex, subunit D, integral membrane 977.72 187.08 0.207 47.58
protein
356285 HMGN1 High-mobility group nucleosome binding domain 1 279.36 80.39 0.138 330.79
356331 PPIA Peptidylprolyl isomerase A (cyclophilin A) 1225.70 78.02 0.034 1646.83
356366 RPS2 Ribosomal protein S2 5031.59 91.00 0.000 1894.42
356371 RPL28 Ribosomal protein L28 622.10 176.27 0.034 2001.52
356377 RNF187 Ring finger protein 187 188.84 96.73 0.207 92.73
356467 C19orf42 Chromosome 19 open reading frame 42 148.32 80.69 0.034 76.36
356501 PHF6 PHD finger protein 6 145.65 87.04 0.310 160.28
356502 RPLP1 Ribosomal protein, large, P1 881.03 208.46 0.000 2388.08
356549 SNRPD3 Small nuclear ribonucleoprotein D3 polypeptide 18 kDa 153.63 84.17 0.276 81.89
356630 NUTF2 Nuclear transport factor 2 144.29 83.13 0.103 186.27
356647 SNX6 Sorting nexin 6 134.10 84.57 0.310 94.88
356654 PSMC1 Proteasome (prosome, macropain) 26S subunit, ATPase, 1 154.97 82.94 0.172 80.59
356766 C20orf199 Chromosome 20 open reading frame 199 227.51 154.61 0.310 203.56
356769 MAN2B1 Mannosidase, alpha, class 2B, member 1 166.87 97.57 0.310 102.94
356799 RPL41 Ribosomal protein L41 336.21 165.15 0.345 350.34
357901 SOX4 SRY (sex determining region Y)-box 4 163.64 90.74 0.345 273.44
362728 SEP15 15 kDa selenoprotein 302.87 139.54 0.138 110.63
365116 U2AF1 U2(RNU2) small nuclear RNA auxiliary factor 1 152.30 63.70 0.241 103.78
368084 LRPPRC Leucine-rich PPR-motif containing 180.31 95.65 0.241 70.90
368149 CCT7 Chaperonin containing TCP1, subunit 7(eta) 968.98 94.04 0.069 253.53
368157 PYGB Phosphorylase, glycogen; brain 289.40 94.26 0.241 262.01
368240 DYRK1A Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A 132.39 93.19 0.379 80.76
368264 PPP2R5C Protein phosphatase 2, regulatory subunit B (B56), gamma 235.30 135.72 0.103 78.57
368376 SRPR Signal recognition particle receptor (‘docking protein’) 170.10 91.17 0.138 64.69
368402 C8orf55 Chromosome 8 open reading frame 55 129.24 75.63 0.379 50.69
368404 EXT2 Exostoses (multiple) 2 144.25 80.41 0.345 64.81
368525 PDLIM1 PDZ and LIM domain 1 (elfin) 285.39 113.52 0.241 94.01
368598 ZC3H15 Zinc finger CCCH-type containing 15 153.03 73.26 0.172 63.93
368934 C17orf45 Chromosome 17open reading frame 45 538.27 122.37 0.103 510.24
368985 TRIP12 Thyroid hormone receptor interactor 12 160.59 66.50 0.345 74.13
369017 RAB2A RAB2A, member RAS oncogene family 185.09 87.27 0.172 120.37
369052 SELT Selenoprotein T 368.37 150.53 0.172 114.17
369068 DYNC1LI2 Dynein, cytoplasmic 1, light intermediate chain 2 158.56 97.53 0.138 167.20
369125 PSMD14 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 166.50 83.15 0.103 74.34
369285 INTS7 Integrator complex subunit 7 112.06 98.19 0.379 266.65
369356 MLL5 Myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, 156.73 73.07 0.276 76.27
Drosophila)
369606 CPSF6 Cleavage and polyadenylation specific factor 6, 68 kDa 132.90 65.76 0.207 63.91
369607 GAK Cyclin G associated kinase 139.66 91.16 0.379 72.66
369614 COPS2 COP9 constitutive photomorphogenic homolog subunit 2 138.58 64.46 0.241 36.98
(Arabidopsis)
369615 SLC25A38 Solute carrier family 25, member 38 148.69 73.93 0.345 43.41
369761 DAZAP2 DAZ associated protein 2 432.10 77.51 0.069 187.75
369785 C19orf50 Chromosome 19 open reading frame 50 176.53 91.76 0.207 85.83
369920 RAP1B RAP1B, member of RAS oncogene family 160.45 86.70 0.138 172.27
370024 SEC31A SEC31 homolog A (S. cerevisiae) 162.54 73.78 0.138 159.51
370247 APLP2 Amyloid beta (A4) precursor-like protein 2 331.96 98.29 0.207 295.17
370292 BCCIP BRCA2 and COKN1A interacting protein 116.14 69.62 0.172 54.66
370312 FNTA Farnesyltransferase, CAAX box, alpha 113.75 73.97 0.172 56.14
370408 COMT Catechol-O-methyltransferase 269.48 182.45 0.138 81.80
370581 CAP1 CAP, adenylate cyclase-associated protein 1 (yeast) 429.82 79.15 0.069 202.38
370770 XPO1 Exportin 1 (CRM1 homolog, yeast) 218.71 75.18 0.172 86.09
370771 CDKN1A Cyclin-dependent kinase inhibitor 1A (p21, Cip1) 406.91 129.23 0.207 221.01
370895 RPN2 Ribophorin II 431.77 115.24 0.069 151.28
370927 LRRC59 Leucine rich repeat containing 59 338.69 149.06 0.138 68.76
370937 TAPBP TAP binding protein (tapasin) 159.24 70.81 0.310 115.35
371001 EIF3S9 Eukaryotic translation initiation factor 3, subunit 9 eta, 116 kDa 343.76 63.64 0.103 193.59
371416 CARM1 Coactivator-associated arginine methyltransferase 1 186.54 108.72 0.276 44.92
371563 RAB14 RAB14, member RAS oncogene family 154.08 65.54 0.310 90.16
371788 C1orf77 Chromosome 1 open reading frame 77 121.36 60.36 0.207 40.80
371889 ATP1A1 Hypothetical protein MGC16179 910.43 156.53 0.069 245.88
372003 FAM120A Family with sequence similarity 120A 211.67 121.79 0.241 130.10
372050 YIPF5 Yip1 domain family, member 5 117.56 66.39 0.276 58.15
372286 CUL3 Cullin 3 131.34 66.77 0.207 55.91
372331 SPTAN1 Spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) 187.03 76.74 0.207 141.12
372541 KBTBD2 Kelch repeat and BTB (POZ) domain containing 2 100.18 63.32 0.310 72.26
372616 ARL1 ADP-ribosylation factor-like 1 107.60 50.60 0.345 53.90
372914 NDRG1 N-myc downstream regulated gene 1 214.33 101.47 0.241 84.08
373550 TGIF1 TGFB-induced factor homeobox 1 109.97 67.30 0.379 133.12
373741 HM13 Histocompatibility (minor) 13 280.09 120.85 0.069 144.47
373763 HNRPR Heterogeneous nuclear ribonucleoprotein R 210.83 74.59 0.103 190.45
373952 CAMTA2 Calmodulin binding transcription activator 2 181.38 88.37 0.345 50.38
373959 VGLL4 Vestigial like 4 (Drosophila) 141.11 70.42 0.310 71.58
374043 ASXL1 Additional sex combs like 1 (Drosophila) 130.97 88.31 0.241 116.01
374257 LOC28616 Hypothetical protein LOC286167 151.79 112.19 0.276 73.50
374378 CKS1B CDC28 protein kinase regulatory subunit 1B 179.04 67.28 0.172 113.85
374477 EWSR1 Ewing sarcoma breakpoint region 1 423.33 116.42 0.069 133.82
374503 MORF4L1 Mortality factor 4 like 1 292.45 60.67 0.069 303.22
374588 RPL17 Ribosomal protein L17 907.22 138.52 0.034 1232.67
374596 TPT1 Tumor protein, translationally-controlled 1 987.59 77.14 0.034 3569.27
374650 IFITM3 Interferon induced transmembrane protein 3 (1-8U) 366.99 97.80 0.276 406.62
374973 PRPF4 PRP4 pre-mRNA processing factor 4 homolog (yeast) 103.66 65.33 0.207 44.01
375001 TLN1 Talin 1 392.09 120.61 0.138 109.38
375108 CD24 CD24 antigen (small cell lung carcinoma cluster 4 antigen) 239.14 95.21 0.310 518.62
375217 RNF31 Ring finger protein 31 104.06 73.05 0.379 50.53
376046 BTN3A2 Butyrophilin, subfamily 3, member A2 149.93 123.05 0.310 52.79
376933 GUK1 Guanylate kinase 1 401.68 92.59 0.276 308.91
377155 MTDH Metadherin 214.89 91.52 0.138 132.35
378103 RPS5 Ribosomal protein S5 1006.11 134.01 0.069 568.97
378532 HBS1L HBS1-like (S. cerevisiae) 131.17 80.02 0.241 36.24
378808 EIF2A Eukaryotic translation initiation factor 2A, 65 kDa 197.55 75.77 0.138 71.81
380403 BMI1 BMI1 polycomb ring finger oncogene 103.02 59.56 0.276 49.37
380774 DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 183.86 64.56 0.241 292.30
380953 RPL38 Ribosomal protein L38 472.88 260.03 0.138 1234.08
380973 SUMO2 SMT3 suppressor of mif two 3 homolog 2 (yeast) 634.74 241.40 0.103 516.19
381008 HLA-E Major histocompatibility complex, class I, E 476.57 108.00 0.103 189.44
381058 KIAA0146 KIAA0146 protein 136.13 82.82 0.276 58.75
381072 PPIF Peptidylprolyl isomerase F (cyclophilin F) 236.14 96.10 0.034 101.71
381123 RPL21 Ribosomal protein L21 1087.11 152.34 0.069 2223.30
381126 RPS14 Ribosomal protein S14 312.13 120.35 0.172 890.77
381189 CBX3 Chromobox homolog 3 (HP1 gamma homolog. Drosophila) 352.70 90.90 0.138 202.41
381219 RPL15 Ribosomal protein L15 454.76 118.60 0.034 690.41
381256 GLTP Glycolipid transfer protein 107.14 53.95 0.379 107.25
382044 MRPS2 Mitochondrial ribosomal protein S2 171.06 80.19 0.207 63.91
382168 NCOA3 Nuclear receptor coactivator 3 166.37 135.20 0.345 47.57
385913 ANP32E Acidic (leucine-rich) nuclear phosphoprotein 32 family, member E 183.06 71.26 0.345 98.67
385986 UBE2B Ubiquitin-conjugating enzyme E2B (RAD6 homolog) 135.72 71.52 0.345 133.50
386434 ANXA7 Annexin A7 173.87 70.85 0.138 79.18
386465 CHERP Calcium homeostasis endoplasmic reticulum protein 177.08 80.21 0.345 43.91
386939 USP7 Ubiquitin specific peptidase 7 (herpes virus-associated) 181.20 217.36 0.207 49.17
387208 FAU Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) 336.62 163.47 0.103 653.75
ubiquitously expressed (fox derived); ribosomal protein S30
387804 PABPC1 Poly(A) binding protein, cytoplasmic 1 625.68 87.04 0.000 382.83
388034 RXRB Retinoid X receptor, beta 142.87 89.88 0.310 38.31
388654 ATP6V1G1 ATPase, H+ transporting, lysosomal 13 kDa, V1 subunit G isoform 1 234.65 112.64 0.172 97.60
388664 RPL11 Ribosomal protein L11 672.13 137.34 0.034 1553.26
388739 XRCC5 X-ray repair complementing defective repair in Chinese hamster 346.39 73.79 0.034 162.11
cells 5 (double-strand-break rejoining; Ku autoantigan, 80 kDa)
388927 YY1 YY1 transcription factor 136.53 65.73 0.103 127.70
388956 C19orf22 Chromosome 19 open reading frame 22 133.57 84.00 0.345 55.36
389037 MCM3APAS MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) 152.46 115.81 0.207 70.85
associated protein
389107 ATP6V0C ATPase, H+ transporting, lysosomal 16 kDa, V0 subunit c 237.34 79.84 0.172 238.25
389171 PINK1 PTEN induced putative kinase 1 126.44 98.97 0.207 74.04
389649 EIF4A3 Eukaryotic translation initiation factor 4A, isoform 3 193.85 75.13 0.138 88.57
389734 TCEAL8 Transcription elongation factor A (SII)-like 8 155.08 72.63 0.345 43.98
389996 CHCHD2 Coiled-coil-helix-coiled-coil-helix domain containing 2 373.11 68.47 0.034 337.24
390667 GSTK1 Glutathione S-transferase kappa 1 168.35 104.34 0.241 152.19
393201 ACTR2 ARP2 actin-related protein 2 homolog (yeast) 328.49 139.01 0.172 119.86
395482 PTK2 PTK2 protein tyrosine kinase 2 177.88 103.98 0.207 42.01
396644 PAIP2 Poly(A) binding protein interacting protein 2 198.13 69.25 0.103 96.51
396740 NIP30 NEFA-interacting nuclear protein NIP30 96.64 53.08 0.241 47.28
396783 SLC9A3R1 Solute carrier family 9 (sodium/hydrogen exchanger), member 3 165.70 98.11 0.276 107.54
regulator 1
397609 RPS16 Ribosomal protein S16 1470.38 224.21 0.069 1068.13
399800 AKAP8L A kinase (PRKA) anchor protein 8-like 166.62 90.19 0.310 63.09
400295 RPL30 Ribosomal protein L30 473.07 139.61 0.103 2027.75
401509 RBM10 RNA binding motif protein 10 170.05 75.56 0.172 69.36
401903 COX5A Cytochrome c oxidase subunit Va 149.97 93.76 0.379 296.35
401929 RPL10 Ribosomal protein L10 1521.64 147.31 0.000 2240.90
403917 STK24 Serine/threonine kinase 24 (STE20 homolog, yeast) 150.48 84.52 0.276 83.03
404056 EIF3S1 Eukaryotic translation initiation factor 3, subunit 1 alpha, 35 kDa 140.93 90.80 0.310 62.42
404321 GARS Glycyl-tRNA synthetase 247.29 80.31 0.034 166.21
405144 SFRS3 Splicing factor, arginine/serine-rich 3 526.80 137.87 0.034 293.88
405410 OGT O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N- 153.55 55.45 0.379 87.05
acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)
405514 KIAA1267 KIAA1267 114.08 65.11 0.345 72.89
405590 EIF3S6 Eukaryotic translation initiation factor 3, subunit 6 48 kDa 654.44 113.72 0.069 174.41
405880 MRPS21 Mitochondrial ribosomal protein S21 141.88 82.93 0.276 145.69
405942 CCDC137 Coiled-coil domain containing 137 133.03 86.11 0.241 77.12
406062 NDUFA11 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 11, 14.7 kDa 173.17 93.80 0.345 194.39
406068 UBE2M Ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) 132.46 80.88 0.345 94.66
406096 ZFAND5 Zinc finger, AN1-type domain 5 192.43 93.38 0.345 318.23
406277 SF3A1 Splicing factor 3a, subunit 1, 120 kDa 296.74 89.39 0.276 83.36
406300 RPL23 Ribosomal protein L23 696.30 308.79 0.069 1844.46
406423 SF3B2 Splicing factor 3b, subunit 2, 145 kDa 355.96 73.17 0.069 58.42
406510 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta 1002.07 88.90 0.034 206.51
polypeptide
406520 LOC38954 Similar to CG14977-PA 124.27 87.28 0.276 188.85
406534 HMG20B High-mobility group 20B 281.92 155.98 0.103 66.80
406590 MRFAP1 Mof4 family associated protein 1 256.02 73.95 0.207 195.87
406620 RPS10 Ribosomal protein S10 1185.80 153.87 0.034 437.99
406683 RPS15 Ribosomal protein S15 521.25 123.23 0.069 137.98
406799 RAB18 RAB18, member RAS oncogene family 127.87 57.58 0.310 50.22
406840 SLC35A4 Solute carrier family 35, member A4 186.45 71.30 0.103 42.86
407368 LSM14A LSM14A, SCD6 homolog A (S. cerevisiae) 151.28 68.77 0.207 296.81
407580 PKP4 Plakophilin 4 130.61 101.53 0.207 111.02
407995 MIF Macrophage migration inhibitory factor (glycosylation-inhibiting 520.62 161.06 0.241 820.62
factor)
408018 RPL36 Ribosomal protein L36 426.58 200.20 0.276 1665.77
408073 RPS6 Ribosomal protein S6 1753.93 92.01 0.034 1215.89
408236 TXNL5 Thioredoxin-like 5 137.51 78.57 0.276 189.91
408257 NDUFS6 NADH dehydrogenase (ubiquinone) Fe—S protein 6, 13 kDa 167.98 115.41 0.379 166.96
(NADH-coenzyme Q reductase)
408293 CEP170 Centrosomal protein 170 kDa 95.55 57.63 0.379 56.47
408324 FLJ10769 Hypothetical protein FLJ10769 179.63 110.86 0.345 54.49
408428 FOXN3 Forkhead box N3 171.98 93.85 0.379 87.86
408581 SVIL Supervillin 150.79 78.33 0.276 98.78
408909 GOLPH3 Golgi phosphoprotein 3 (coat-protein) 149.55 90.99 0.207 103.46
409140 ATP5O ATP synthase, H+ transporting, mitochondrial F1 complex, O 238.76 77.50 0.138 187.51
subunit (oligomycin sensitivity conferring protein)
409223 SSR4 Signal sequence receptor, delta (translocon-associated protein 187.19 88.00 0.138 154.53
delta)
409230 AGPAT1 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic 188.83 78.43 0.207 71.39
acid acyltransferase, alpha)
409834 PHPT1 Phosphohistidine phosphatase 1 129.72 80.15 0.379 132.98
410197 IDH3G Isocitrate dehydrogenase 3 (NAD+) gamma 142.89 74.63 0.276 43.88
410596 WDR68 WD repeat domain 68 190.39 78.19 0.069 37.03
410817 RPL13 Ribosomal protein L13 1259.59 96.20 0.034 2237.07
411480 AUP1 Ancient ubiquitous protein 1 197.34 72.07 0.103 130.09
411641 EIF4EBP1 Eukaryotic translation initiation factor 4E binding protein 1 185.54 87.93 0.310 96.89
411847 MAPK6 Mitogen-activated protein kinase 6 143.89 100.65 0.207 67.09
412103 EFHA1 EF-hand domain family, member A1 130.69 68.19 0.276 74.51
412117 ANXA6 Annexin A6 173.96 90.66 0.172 81.81
412196 IFT57 Intraflagellar transport 57 homolog (Chlamydomonas) 109.98 56.91 0.379 49.42
412433 AIP Aryl hydrocarbon receptor interacting protein 157.20 76.87 0.207 95.68
412468 KLHDC3 Kelch domain containing 3 366.49 77.49 0.172 60.90
412842 CDC123 Cell division cycle 123 homolog (S. cerevisiae) 155.00 62.20 0.207 68.47
413036 WBSCR22 Williams Beuren syndrome chromosome region 22 181.29 80.06 0.103 73.81
413482 C21orf33 Chromosome 21 open reading frame 33 220.73 103.88 0.172 72.11
414579 SCOTIN Scotin 344.80 79.60 0.138 89.15
415342 TCF25 Transcription factor 25 (basic helix-loop-helix) 132.99 67.57 0.172 122.55
416049 TNPO2 Transportin 2 (importin 3, karyopherin beta 2b) 121.80 74.72 0.345 77.32
416436 TRIM50 Tripartite motif-containing 50 253.97 118.36 0.138 85.38
417004 S100A11 S100 calcium binding protein A11 (calgizzarin) 282.02 146.47 0.138 317.66
417029 C17orf81 Chromosome 17 open reading frame 81 116.93 60.21 0.379 84.10
418123 CTSLL3 Cathepsin L-like 3 196.99 151.69 0.345 94.78
418175 VPS28 Vacuolar protein sorting 28 (yeast) 137.80 101.08 0.345 126.20
418233 MRPL24 Mitochondrial ribosomal protein L24 111.66 117.93 0.345 91.94
418450 MRPL11 Mitochondrial ribosomal protein L11 169.41 63.02 0.310 53.11
418533 BUB3 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast) 180.32 113.91 0.172 73.29
418668 ATP5D ATP synthase, H+ transporting, mitochondrial F1 complex, delta 142.90 94.88 0.276 249.44
subunit
419640 PARK7 Parkinson disease (autosomal recessive, early onset) 7 255.09 75.95 0.172 80.33
420269 COL6A2 Collagen, type VI, alpha 2 425.15 132.41 0.379 327.11
420272 H2AFY H2A histone family, member Y 236.54 78.85 0.069 156.87
421257 RPL7 Ribosomal protein L7 148.01 111.08 0.138 773.71
421509 CCT4 Chaperonin containing TCP1, subunit 4 (delta) 245.54 69.17 0.138 100.96
422113 ZNF511 Zinc finger protein 511 92.03 40.84 0.379 56.61
423935 RDBP RD RNA binding protein 114.07 56.49 0.241 90.04
423968 F1S1 Fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) 140.14 94.84 0.379 184.40
424126 SERF2 Small EDRK-rich factor 2 421.90 169.35 0.103 442.70
424908 LSM5 LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) 118.18 94.48 0.310 84.59
425777 UBE2L6 Ubiquitin-conjugating enzyme E2L 6 176.08 83.76 0.345 95.06
426296 C10orf104 Chromosome 10 open reading frame 104 193.46 94.72 0.207 104.09
426359 PRR13 proline rich 13 204.04 77.90 0.345 127.55
429052 ITGB1 Integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen 343.25 71.08 0.207 216.47
CD29 includes MDF2, MSK12)
429353 SEPN1 Selenoprotein N, 1 163.54 91.46 0.241 102.88
429581 RTN4 Reticulon 4 587.74 263.68 0.069 320.92
429819 PITPNA Phosphatidylinositol transfer protein, alpha 132.54 66.33 0.241 119.10
429839 BTF3L4 Basic transcription factor 3-like 4 128.62 88.13 0.379 63.92
430425 GNB1 Guanine nucleotide binding protein (G protein), beta polypeptide 1 348.68 72.19 0.069 129.12
430551 IQGAP1 IQ motif containing GTPase activating protein 1 168.69 68.30 0.241 88.02
430606 CS Citrate synthase 377.31 109.46 0.034 147.21
430657 ARF5 ADP-ribosylation factor 5 184.36 99.34 0.310 83.08
430733 CLNS1A Chloride channel, nucleotide-sensitive, 1A 147.58 71.03 0.207 62.07
431101 GNG12 Guanine nucleotide binding protein (G protein), gamma 12 197.95 72.99 0.310 108.86
431367 VTA1 Vps20-associated 1 homolog (S. cerevisiae) 154.26 81.47 0.172 43.97
431498 FOXP1 Forkhead box P1 158.95 84.08 0.345 98.20
431550 MAP4K4 Mitogen-activated protein kinase kinase kinase kinase 4 150.49 75.85 0.241 138.08
431668 COX6B1 Cytochrome c oxidase subunit Vib polypeptide 1 (ubiquitous) 249.30 171.30 0.207 425.55
431850 MAPK1 Mitogen-activated protein kinase 1 147.43 68.90 0.241 66.06
431861 PPP5C Protein phosphatase 5, catalytic subunit 203.35 97.62 0.138 99.20
431926 NFKB1 Nuclear factor of kappa light polypeptide gene enhancer in B-cells 118.70 65.79 0.310 59.70
1 (p105)
432121 PRDX2 Peroxiredoxin 2 328.05 98.46 0.069 287.03
432438 EML4 Echinoderm microtubule associated protein like 4 127.17 67.00 0.345 67.18
432491 ESD Esterase D/formylglutathione hydrolase 181.49 81.57 0.103 68.19
432690 SLC39A9 Solute carrier family 39 (zinc transporter), member 9 123.27 74.29 0.207 62.18
432760 CAPZB Capping protein (actin filament) muscle Z-line, beta 189.76 70.34 0.069 950.43
432898 RPL4 Mitogen-activated protein kinase kinase kinase 13 2173.97 96.68 0.000 1111.01
432976 NR1H2 Nuclear receptor subfamily 1, group H, member 2 190.02 112.04 0.241 79.20
433154 PLSCR3 Phospholipid scramblase 3 118.46 78.13 0.345 42.73
433201 CDK2AP1 CDK2-associated protein 1 137.33 80.77 0.241 153.26
433222 NPC2 Niemann-Pick disease, type C2 218.82 98.64 0.069 149.92
433291 ARD1A ARD1 homolog A, N-acetyltransferase (S. cerevisiae) 119.07 75.05 0.207 64.82
483307 BCKDHA Branched chain keto acid dehydrogenase E1, alpha polypeptide 166.35 84.74 0.379 89.54
(maple syrup urine disease)
433343 SRRM2 Serine/arginine repetitive matrix 2 179.81 99.94 0.103 178.03
433345 Full-length cDNA clone CL0BB014ZH04 of Neuroblastoma of 131.69 72.43 0.241 109.07
Homo sapiens (human)
433419 COX4I1 Cytochrome c oxidase subunit IV isoform 1 291.96 97.81 0.103 402.93
433512 ACTR3 ARP3 actin-related protein 3 homolog (yeast) 202.84 72.82 0.103 95.46
433529 RPS11 Ribosomal protein S11 659.56 130.65 0.069 457.96
433540 DNAJC8 DnaJ (Hsp40) homolog, subfamily C, member 8 164.57 66.59 0.172 102.38
433573 C11orf68 Chromosome 11 open reading frame 68 109.74 74.58 0.379 76.09
433615 TUBB2C Tubulin, beta 2C 1313.99 109.59 0.034 501.20
433701 RPL37A Ribosomal protein L37a 941.22 280.38 0.034 2360.84
433722 KIAA1967 KIAA1967 137.26 57.51 0.345 37.39
433732 CLK1 CDC-like kinase 1 179.68 71.24 0.379 66.75
433750 EIF4G1 Eukaryotic translation initiation factor 4 gamma, 1 509.92 79.20 0.138 129.41
433759 BANF1 Barrier to autointegration factor 1 185.36 115.51 0.103 199.75
433795 SHC1 SHC (Src homology 2 domain containing) transforming protein 1 307.01 110.48 0.103 93.40
433863 PEBP1 Phosphatidylethanolamine binding protein 1 349.44 89.20 0.034 565.16
433901 COX8A Cytochrome c oxidase subunit 8A (ubiquitous) 335.34 202.06 0.207 527.55
433951 GPX4 Glutathione peroxidase 4 (phospholipid hydroperoxidase) 265.60 84.94 0.207 646.53
434102 HMGB1 High-mobility group box 1 638.86 104.01 0.000 439.56
434207 HARS2 Histidyl-tRNA synthetase 2 146.76 94.43 0.276 50.79
434219 ANKHD1 Ankyrin repeat and KH domain containing 1 190.31 76.42 0.103 265.78
434401 ZNF638 Zinc finger protein 638 127.61 80.05 0.276 97.81
434937 PPIB Peptidylprolyl isomerase B (cyclophilin B) 258.12 78.54 0.069 426.54
434953 HMGB2 High-mobility group box 2 275.63 95.40 0.138 90.55
434980 APP Amyloid beta (A4) precursor protein (peptidase nexin-II, Alzheime 228.56 92.10 0.172 645.54
disease)
435044 TBC1D22A TBC1 domain family, member 22A 160.02 137.97 0.310 159.88
435064 DENND1A DENN/MADD domain containing 1A 99.58 55.26 0.379 37.16
435120 KIF1C Kinesin family member 1C 210.09 68.46 0.241 114.26
435136 TXN Thioredoxin 346.61 189.66 0.276 221.38
435166 LBR Lamin B receptor 188.22 185.85 0.310 68.73
435231 ZFR Zinc finger RNA binding protein 158.35 73.83 0.172 48.65
435255 UBXD1 UBX domain containing 1 173.66 118.04 0.241 59.99
435326 ACTL6A Actin-like 6A 152.42 64.63 0.172 41.79
435512 PPP3CA Protein phosphatase 3 (formerly 2B), catalytic subunit, alpha 156.63 85.19 0.345 114.98
isoform (calcineurin A alpha)
435535 ZNF395 Zinc finger protein 395 126.06 79.86 0.310 50.14
435610 WAC WW domain containing adaptor with coiled-coil 197.21 111.45 0.172 100.47
435741 GCSH IQ motif and WD repeats 1 165.11 72.41 0.138 121.99
435759 THAP4 THAP domain containing 4 133.58 83.98 0.379 45.48
435771 API5 Apoptosis inhibitor 5 191.29 106.97 0.276 59.57
435841 TNRC15 Trinucleotide repeat containing 15 115.02 60.28 0.310 37.44
435850 LYPLA1 Lysophospholipase I 278.94 98.93 0.138 132.98
435933 PHF10 Chromosome 6 open reading frame 120 160.27 71.75 0.276 72.80
435948 ATAD1 ATPase family, AAA domain containing 1 119.77 79.07 0.310 46.76
435952 CDK5RAP1 CDK5 regulatory subunit associated protein 1 122.11 83.77 0.310 40.84
435974 MTHFD1 Methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, 193.28 103.81 0.172 55.52
methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate
synthetase
436035 TUBA1C Tubulin, alpha 1c 3419.68 98.12 0.000 275.68
436093 BAT2 HLA-B associated transcript 2 414.35 96.65 0.172 98.56
436204 ZNF289 Zinc finger protein 289, ID1 regulated 187.48 70.10 0.138 33.87
436298 EMP1 Epithelial membrane protein 1 139.81 90.61 0.310 164.61
436405 IDH3B Isocitrate dehydrogenase 3 (NAD+) beta 233.17 64.64 0.172 72.68
436437 ALDH2 Aldehyde dehydrogenase 2 family (mitochondrial) 213.99 91.66 0.207 112.73
436446 ARMET Arginine-rich, mutated in early stage tumors 238.76 107.79 0.379 112.15
436500 DBNL Drebrin-like 322.18 106.61 0.241 68.08
436568 CD74 CD74 antigen (invariant polypeptide of major histocompatibility 3672.46 211.82 0.345 1315.63
complex, class II antigen-associated)
436578 POLR2F Polymerase (RNA) II (DNA directed) polypeptide F 106.90 73.50 0.345 88.14
436657 CLU Clusterin (complement lysis inhibitor, SP-40,40, sulfated 586.91 158.76 0.241 1709.53
glycoprotein 2, testosterone-repressed prostate message 2,
apolipoprotein J)
436687 SET SET translocation (myeloid leukemia-associated) 285.02 84.84 0.034 483.49
436803 VBP1 Von Hippel-Lindau binding protein 1 182.84 93.52 0.207 77.53
437056 SUPT5H Suppressor of Ty 5 homolog (S. cerevisiae) 216.64 117.71 0.207 47.97
437060 CYCS Cytochrome c, somatic 1874.90 252.41 0.207 102.41
437110 ANXA2 Annexin A2 2060.10 130.61 0.034 483.00
437178 ACADVL Acyl-Coenzyme A dehydrogenase, very long chain 288.37 92.69 0.069 176.48
437256 GRINL1A Glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A 151.07 83.14 0.345 42.69
437277 MGAT4B Mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N- 1083.50 147.46 0.103 98.94
acetylglucosaminyltransferase, isoenzyme B
437367 GBAS Glioblastoma amplified sequence 143.22 113.71 0.276 128.35
437388 PIGT Phosphatidylinositol glycan, class T 227.91 106.45 0.103 55.36
437403 PPA1 Pyrophosphatase (inorganic) 1 159.06 72.02 0.138 83.72
437594 RPLP2 Ribosomal protein, large, P2 498.18 148.73 0.034 2903.18
437638 XBP1 X-box binding protein 1 319.21 100.78 0.069 381.08
437779 C11orf10 Chromosome 11 open reading frame 10 241.39 149.44 0.345 178.08
437831 C14orf32 Chromosome 14 open reading frame 32 175.37 74.13 0.241 47.62
438072 UNC84A Unc-84 homolog A (C. elegans) 146.52 82.20 0.345 53.45
438219 GPS2 G protein pathway suppressor 2 172.78 109.64 0.172 71.49
438429 RPS19 Ribosomal protein S19 721.53 169.75 0.103 3026.84
438678 TALDO1 Transaldolase 1 280.29 75.06 0.138 109.07
438720 MCM7 MCM7 minichromosome maintenance deficient 7 (S. cerevisiae) 548.49 107.89 0.138 192.09
438970 TBL1XR1 Transducin (beta)-like 1X-linked receptor 1 185.70 86.87 0.241 73.49
438974 CUTL1 Cut-like 1, CCAAT displacement protein (Drosophila) 159.65 95.91 0.310 59.88
439480 RBM5 RNA binding motif protein 5 145.24 117.34 0.379 56.89
439481 SUPT4H1 Suppressor of Ty 4 homolog 1 (S. cerevisiae) 139.55 62.12 0.207 121.04
439548 FAM96A Family with sequence similarity 96, member A 155.35 85.81 0.241 32.78
439552 MAP2K3 Mitogen-activated protein kinase kinase 3 2617.77 147.47 0.000 97.32
439815 HBXIP Hepatitis B virus x interacting protein 127.08 97.39 0.310 188.94
440382 TRIM27 Tripartite motif-containing 27 155.33 68.54 0.172 80.66
440544 CLIC4 Chloride intracellular channel 4 337.71 121.54 0.103 116.71
440599 DDX1 DEAD (Asp-Glu-Ala-Asp) box polypeptide 1 433.83 283.30 0.103 194.20
440604 PSMD7 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 156.07 77.17 0.138 99.15
(Mov34 homolog)
440899 TTYH3 Tweety homolog 3 (Drosophila) 229.54 97.64 0.172 81.97
440932 SEPT9 Septin 9 361.78 96.86 0.034 158.17
440960 RAD23A RAD23 homolog A (S. cerevisiae) 214.38 69.61 0.207 56.98
440961 CAST Calpastatin 194.31 90.01 0.207 86.43
441072 POLR2L Polymerase (RNA) II (DNA directed) polypeptide L, 7.6 kDa 225.44 138.68 0.379 278.78
441550 ABHD12 Abhydrolase domain containing 12 215.47 106.70 0.241 69.22
442344 IRS2 Insulin receptor substrate 2 134.97 79.52 0.379 117.65
442798 RNF10 Ring finger protein 10 210.73 75.43 0.103 80.34
443134 GBA2 Glucosidase, beta (bile acid) 2 132.85 60.27 0.379 64.55
443379 PSMD11 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 180.98 64.45 0.172 49.98
443837 NPEPPS Aminopeptidase puromycin sensitive 173.54 73.65 0.172 51.38
443914 SOD1 Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 341.06 88.95 0.103 267.67
(adult))
444279 GPBP1 GC-rich promoter binding protein 1 132.98 56.92 0.241 63.11
444356 GRB2 Growth factor receptor-bound protein 2 167.92 61.94 0.172 146.51
444468 CTDSP1 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A 187.59 76.37 0.241 92.85
small phosphatase 1
444472 SDHC Succinate dehydrogenase complex, subunit C, integral membrane 175.42 71.22 0.207 45.51
protein, 15 kDa
444569 TMEM49 Transmembrane protein 49 212.58 83.31 0.241 197.09
444673 CLPTM1L CLPTM1-like 229.08 106.76 0.207 91.56
444724 AZI2 5-azacytidine induced 2 132.28 73.71 0.345 44.74
444818 CGGBP1 CGG triplet repeat binding protein 1 177.53 83.72 0.241 66.90
444931 CRSP6 Cofactor required for Sp1 transcriptional activation, subunit 6, 77 kDa 88.71 48.78 0.379 43.14
444969 MEMO1 Mediator of cell motility 1 96.52 59.19 0.276 59.89
444986 METAP2 Methionyl aminopeptidase 2 169.09 73.08 0.172 54.25
445081 OAF OAF homolog (Drosophila) 113.21 58.71 0.345 57.76
445351 LGALS1 Lectin, galactoside-binding, soluble, 1 (galectin 1) 564.16 197.93 0.241 1304.52
445394 VPS29 Vacuolar protein sorting 29 (yeast) 276.97 108.32 0.138 82.01
445498 SNW1 SNW domain containing 1 143.71 69.55 0.138 43.68
445511 RIOK3 RIO kinase 3 (yeast) 110.92 105.70 0.379 54.46
445570 CD63 CD63 antigen (melanoma 1 antigen) 489.45 199.49 0.034 182.09
445803 DC2 DC2 protein 658.16 215.09 0.138 77.15
445893 KHDRBS1 KH domain containing, RNA binding, signal transduction 227.64 88.75 0.138 189.36
associated 1
445977 GTF3A General transcription factor IIIA 160.66 73.81 0.172 82.05
446017 WSB1 WD repeat and SOCS box-containing 1 239.91 93.71 0.276 231.33
446091 WTAP Wilms tumor 1 associated protein 119.70 95.46 0.379 83.46
446123 CAPZA2 Capping protein (actin filament) muscle Z-line, alpha 2 370.83 95.48 0.138 88.07
446149 LDHB Lactate dehydrogenase B 1544.78 120.53 0.000 250.91
446260 PSMA6 Proteasome (prosome, macropain) subunit, alpha type, 6 224.07 106.72 0.172 227.02
446336 PXN Paxillin 259.56 97.96 0.138 155.02
446345 FTH1 Ferritin, heavy polypeptide 1 2359.77 133.58 0.034 3636.50
446414 CD47 CD47 antigen (Rh-related antigen, integrin-associated signal 165.59 95.67 0.310 83.15
transducer)
446427 OAZ1 Ornithine decarboxylase antizyme 1 673.68 62.71 0.069 576.39
446445 YIF1A Yip1 interacting factor homolog A (S. cerevisiae) 151.87 80.99 0.276 76.17
446450 ITM2B Integral membrane protein 2B 511.62 115.21 0.138 528.00
446574 TMSB10 Thymosin beta 10 524.43 177.08 0.103 1381.46
446588 RPS13 Ribosomal protein S13 183.34 95.13 0.345 603.82
446623 HNRPL Heterogeneous nuclear ribonucleoprotein L 113.61 53.54 0.276 351.95
446628 RPS4X Ribosomal protein S4, X-linked 1285.06 89.84 0.000 2026.83
446641 ARAF V-raf murine sarcoma 3611 viral oncogene homolog 176.49 69.57 0.241 54.08
446852 EIF3S6IP Eukaryotic translation initiation factor 3, subunit 6 interacting 925.97 188.87 0.034 160.77
protein
447477 ST13 Suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 272.29 141.17 0.103 139.88
interacting protein)
447492 PGAM1 Phosphoglycerate mutase 1 (brain) 781.46 84.70 0.034 498.68
447547 VPS35 Hypothetical protein MGC34800 195.14 67.15 0.103 121.44
448226 RPLP0 Ribosomal protein, large, P0 3809.20 75.92 0.000 1108.65
448588 NGFRAP1 Nerve growth factor receptor (TNFRSF16) associated protein 1 218.09 83.14 0.310 364.70
448646 RPL27A Ribosomal protein L27a 766.60 139.37 0.276 3106.03
448879 LOC38834 similar to ribosomal protein L13 471.24 99.11 0.069 126.52
449114 HNRPC Heterogeneous nuclear ribonucleoprotein C (C1/C2) 803.24 90.38 0.034 241.77
449171 HNRPK Heterogeneous nuclear ribonucleoprotein K 403.79 69.90 0.034 266.35
454534 USF2 Upstream transcription factor 2, c-fos interacting 111.98 76.53 0.310 62.62
454699 IL6ST Interleukin 6 signal transducer (gp130, oncostatin M receptor) 266.74 139.73 0.103 48.68
456507 KIAA0319L KIAA0319-like 131.45 85.77 0.241 73.31
456557 C1orf164 chromosome 1 open reading frame 164 143.89 71.60 0.276 116.20
458320 C3orf37 chromosome 3 open reading frame 37 170.49 148.07 0.310 35.84
458358 TSPYL1 Squamous cell carcinoma antigen recognized by T cells 2 101.91 73.81 0.345 127.17
458414 IFITM1 Interferon induced transmembrane protein 1 (9-27) 278.31 223.88 0.345 119.42
458458 FAM108A1 Family with sequence similarity 108, member A1 149.77 96.59 0.276 93.53
458747 ANP32A Acidic (leucine-rich) nuclear phosphoprotein 32 family, member A 197.57 100.71 0.172 46.30
459106 AZIN1 Antizyme inhibitor 1 209.63 95.22 0.207 49.61
459149 BTBD1 BTB (POZ) domain containing 1 136.20 84.67 0.310 54.21
459174 FAM91A1 Family with sequence similarity 91, member A1 133.90 80.72 0.379 82.35
459211 AKAP13 A kinase (PRKA) anchor protein 13 217.52 97.30 0.310 70.77
459596 MPG N-methylpurine-DNA glycosylase 110.09 94.77 0.241 78.83
459649 CLCN7 Chloride channel 7 161.09 107.31 0.207 57.89
459927 PTMA Prothymosin, alpha (gene sequence 28) 1066.55 86.69 0.000 1205.32
459940 LITAF Lipopolysaccharide-induced TNF factor 184.70 98.75 0.069 118.47
460238 SH3GLB2 SH3-domain GRB2-like endophilin B2 146.60 86.41 0.207 54.58
460317 SETX Senataxin 132.56 111.94 0.310 59.22
460336 GGA2 Golgi associated, gamma adaptin ear containing, ARF binding 253.27 171.03 0.241 51.31
protein 2
460468 XPO6 Exportin 6 212.84 80.39 0.172 58.36
460499 ATXN2L Ataxin 2-like 228.25 84.67 0.310 66.95
460574 LOC12444 Hypothetical protein BC017488 125.84 87.37 0.379 74.28
460923 CNOT1 CCR4-NOT transcription complex, subunit 1 173.85 65.75 0.207 67.45
460929 GOT2 Glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate 397.62 79.42 0.103 126.69
aminotransferase 2)
460978 APPBP1 Amyloid beta precursor protein binding protein 1 133.67 64.71 0.241 46.47
461047 G6PD Glucose-6-phosphate dehydrogenase 274.16 130.32 0.207 81.94
461131 CYB5B Cytochrome b5 type B (outer mitochondrial membrane) 192.30 75.56 0.138 76.12
461361 CFDP1 Craniofacial development protein 1 111.79 67.73 0.310 79.79
461379 GABARAPL2 GABA(A) receptor-associated protein-like 2 122.55 63.48 0.345 184.34
461722 TRAPPC2L Trafficking protein particle complex 2-like 97.91 62.09 0.379 78.84
461777 CHMP1A Chromatin modifying protein 1A 171.31 77.92 0.207 77.23
461896 CRK V-crk sarcoma virus CT10 oncogene homolog (avian) 158.10 68.61 0.276 68.65
461925 RPA1 Replication protein A1, 70 kDa 160.13 72.42 0.103 83.76
462035 UBE2G1 Ubiquitin-conjugating enzyme E2G1 (UBC7 homolog, yeast) 149.46 102.82 0.207 72.02
462086 RPAIN RPA interacting protein 129.54 77.35 0.379 70.39
462306 UBE2S Ubiquitin-conjugating enzyme E2S 216.54 74.27 0.310 226.76
462316 TTC19 Hypothetical protein LOC125150 116.49 89.17 0.241 83.84
462492 USP22 Ubiquitin specific peptidase 22 379.95 165.78 0.138 95.69
462550 PIGS Phosphatidylinositol glycan, class S 164.57 97.00 0.345 61.36
462956 PPARBP PPAR binding protein 106.51 76.59 0.379 65.65
462998 IGFBP4 Insulin-like growth factor binding protein 4 345.88 87.71 0.207 238.31
463010 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of 173.85 56.13 0.069 51.34
chromatin, subfamily e, member 1
463035 FKBP10 FK506 binding protein 10, 65 kDa 164.51 91.24 0.310 88.10
463041 RERE Arginine-glutamic acid dipeptide (RE) repeats 200.18 92.99 0.276 112.05
463059 STAT3 Signal transducer and activator of transcription 3 (acute-phase 205.74 114.93 0.207 286.52
response factor)
463295 CDC27 Cell division cycle 27 115.34 79.50 0.310 47.81
463506 AKAP1 A kinase (PRKA) anchor protein 1 124.11 52.64 0.345 401.26
463702 BCAS3 Breast carcinoma amplified sequence 3 98.88 74.57 0.379 44.08
463797 MRTO4 mRNA turnover 4 homolog (S. cerevisiae) 142.20 59.85 0.276 48.55
464071 PGD Phosphogluconate dehydrogenase 338.78 85.70 0.138 159.65
464137 ACOX1 Acyl-Coenzyme A oxidase 1, palmitoyl 103.04 66.74 0.241 64.57
464210 SYNGR2 Synaptogyrin 2 348.69 97.83 0.276 159.36
464336 P4HB Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4- 859.74 89.54 0.069 354.48
hydroxylase), beta polypeptide (protein disulfide isomerase-
associated 1)
464438 AGTRAP Angiotensin II receptor-associated protein 117.55 68.62 0.379 100.58
464472 MRLC2 Myosin regulatory light chain MRLC2 233.35 102.50 0.034 303.55
464595 PPP4R1 Protein phosphatase 4, regulatory subunit 1 181.18 80.16 0.241 61.71
464652 TNFSF5IP1 Tumor necrosis factor superfamily, member 5-induced protein 1 145.59 119.46 0.345 59.73
464912 P15RS Hypothetical protein FLJ10656 142.03 83.19 0.276 65.87
465224 NARS Asparaginyl-tRNA synthetase 220.96 70.84 0.103 91.32
465374 EFHD2 EF-hand domain family, member D2 265.91 113.85 0.241 121.77
465498 TXNL4A Thioredoxin-like 4A 121.61 80.29 0.276 118.06
465529 MIDN Midnolin 139.65 96.07 0.345 77.19
465543 BTBD2 BTB (POZ) domain containing 2 204.49 98.92 0.207 90.71
465627 MAP2K2 Mitogen-activated protein kinase kinase 2 154.59 85.81 0.310 176.08
465645 C19orf10 Chromosome 19 open reading frame 10 204.93 79.48 0.276 122.81
465808 HNRPM Heterogeneous nuclear ribonucleoprotein M 258.95 99.76 0.103 126.89
465849 PIN1 Protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1 121.36 61.35 0.310 157.79
465924 SDHB Succinate dehydrogenase complex, subunit B, iron sulfur (lp) 161.79 65.94 0.241 76.80
466044 PKN1 Protein kinase N1 252.31 87.50 0.276 62.96
466088 TPM4 Tropomyosin 4 139.00 71.29 0.345 150.55
466148 NR2F6 Nuclear receptor subfamily 2, group F, member 6 179.12 94.04 0.379 157.14
466471 GPI Glucose phosphate isomerase 502.15 94.80 0.069 172.27
466693 SIRT2 Sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae) 214.11 113.63 0.379 122.41
466766 LTBP4 Latent transforming growth factor beta binding protein 4 174.46 77.33 0.379 68.26
466775 SNRPA Small nuclear ribonucleoprotein polypeptide A 196.94 63.74 0.138 58.13
467084 EIF4G3 Eukaryotic translation initiation factor 4 gamma, 3 102.77 64.71 0.310 58.39
467097 SNRP70 Small nuclear ribonucleoprotein 70 kDa polypeptide (RNP antigen) 294.48 80.04 0.103 100.15
467192 PPP2R1A Protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65) 475.55 80.67 0.069 102.67
alpha isoform
467279 LENG4 Leukocyte receptor cluster (LRC) member 4 315.24 116.72 0.310 169.43
467284 RPS9 Ribosomal protein S9 986.04 73.58 0.069 638.08
467408 TRIM28 Tripartite motif-containing 28 715.33 79.78 0.138 235.85
467637 CDC42 Cell division cycle 42 (GTP binding protein, 25 kDa) 158.07 97.05 0.138 282.31
467696 HPCAL1 Hippocalcin-like 1 172.64 83.71 0.379 94.69
467701 ODC1 Ornithine decarboxylase 1 351.16 77.30 0.103 112.30
467807 LAPTM4A Lysosomal-associated protein transmembrane 4 alpha 482.50 88.89 0.069 380.71
467824 PUM2 Pumilio homolog 2 (Drosophila) 153.26 86.50 0.207 60.01
467960 RAB10 RAB10, member RAS oncogene family 162.79 57.31 0.103 100.37
468018 PPP1CB Protein phosphatase 1, catalytic subunit, beta isoform 203.84 64.65 0.207 243.47
468415 PIGF Phosphatidylinositol glycan, class F 150.01 71.46 0.241 85.62
468442 CALM2 Calmodulin 2 (phosphorylase kinase, delta) 1841.31 235.41 0.000 448.88
468760 AFTPH Aftiphilin 93.25 61.52 0.310 56.19
469022 DGUOK Deoxyguanosine kinase 116.26 75.71 0.241 55.33
469171 C1orf160 Chromosome 1 open reading frame 160 116.05 66.17 0.172 59.47
469331 STARD7 START domain containing 7 312.84 91.19 0.138 3007.75
469820 RALB V-ral simian leukemia viral oncogene homolog B (ras related; GTF 125.95 59.65 0.379 51.68
binding protein)
469863 YWHAZ Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase 385.89 74.53 0.034 262.56
activation protein, zeta polypeptide
469925 FAM128B Family with sequence similarity 128, member B 157.81 62.74 0.345 481.47
469970 SFRS4 Splicing factor, arginine/serine-rich 4 134.13 54.16 0.310 62.81
470091 YWHAE Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase 330.87 97.70 0.069 590.76
activation protein, epsilon polypeptide
470233 ARL5A ADP-ribosylation factor-like 5A 137.43 81.25 0.345 39.57
470417 PEF1 Penta-EF-hand domain containing 1 144.07 63.57 0.241 62.85
470477 PTP4A2 Protein tyrosine phosphatase type IVA, member 2 163.45 69.99 0.103 138.21
470577 EIF2S2 Eukaryotic translation initiation factor 2, subunit 2 beta, 38 kDa 175.54 98.23 0.379 164.48
470588 KPNA6 Karyopherin alpha 6 (importin alpha 7) 105.07 66.63 0.207 91.23
470943 STAT1 Signal transducer and activator of transcription 1, 91 kDa 204.00 91.39 0.207 99.04
471011 SF3B1 Splicing factor 3b, subunit 1, 155 kDa 171.22 65.74 0.276 54.27
471104 NOP5/NOP58 Nucleolar protein NOP5/NOP58 119.95 77.84 0.207 107.80
471207 NDUFS1 NADH dehydrogenase (ubiquinone) Fe—S protein 1, 75 kDa 152.75 64.26 0.207 53.27
(NADH-coenzyme Q reductase)
471441 PSMB2 Proteasome (prosome, macropain) subunit, beta type, 2 160.02 84.75 0.207 132.08
471461 ACSL3 Acyl-CoA synthetase long-chain family member 3 143.25 48.15 0.207 55.56
471593 CAB39 Calcium binding protein 39 125.47 90.94 0.276 71.62
471768 STK40 Serine/threonine kinase 40 150.57 81.43 0.310 76.01
471818 CAPRIN1 Cell cycle associated protein 1 233.39 93.24 0.069 48.75
471851 HDLBP High density lipoprotein binding protein (vigilin) 770.41 90.63 0.034 284.45
471873 DTYMK Deoxythymidylate kinase (thymidylate kinase) 151.55 81.98 0.276 61.06
471933 FKBP1A FK506 binding protein 1A, 12 kDa 284.05 83.21 0.138 166.80
471975 C20orf116 Chromosome 20 open reading frame 116 168.09 95.60 0.379 46.80
472010 PRNP Prion protein (p27-30) (Creutzfeld-Jakob disease, Gerstmann- 151.22 82.78 0.276 217.32
Strausler-Scheinker syndrome, fatal familial insomnia)
472024 C20orf30 Chromosome 20 open reading frame 30 180.50 82.62 0.138 87.82
472031 UBE2D3 Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) 305.38 72.17 0.069 161.41
472038 UTP11L UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast) 116.49 107.41 0.379 46.16
472056 SYNCRIP Synaptotagmin binding, cytoplasmic RNA interacting protein 198.01 71.24 0.103 97.30
472119 MKKS McKusick-Kaufman syndrome 110.70 82.99 0.276 43.01
472185 NDUFS5 NADH dehydrogenase (ubiquinone) Fe—S protein 5, 15 kDa 317.85 115.06 0.172 175.84
(NADH-coenzyme Q reductase)
472213 RRBP1 Ribosome binding protein 1 homolog 180 kDa (dog) 194.55 81.99 0.276 81.63
472330 C20orf3 Chromosome 20 open reading frame 3 210.62 71.28 0.345 111.23
472475 MACF1 Glycine-rich protein (GRP3S) 170.84 81.77 0.310 117.24
472535 AURKAIP1 Aurora kinase A interacting protein 1 236.28 92.32 0.345 87.41
472558 ERGIC3 ERGIC and golgi 3 273.22 82.09 0.138 150.94
472651 BLCAP Bladder cancer associated protein 174.08 74.85 0.241 69.65
472737 TOP1 Topoisomerase (DNA) I 145.07 71.88 0.310 79.62
473296 TPD52L2 Tumor protein D52-like 2 198.42 74.39 0.172 87.51
473583 YBX1 Y box binding protein 1 706.53 98.38 0.034 340.36
473648 GART Phosphoribosylglycinamide formyltransferase, 159.98 70.49 0.138 51.98
phosphoribosylglycinamide synthetase,
phosphoribosylaminoimidazole synthetase
473721 SLC2A1 Solute carrier family 2 (facilitated glucose transporter), member 1 496.75 142.19 0.345 157.66
473761 RTN3 Reticulon 3 222.45 76.58 0.103 160.89
473788 OTUB1 OTU domain, ubiquitin aldehyde binding 1 235.08 75.48 0.207 93.09
474005 SUMO3 SMT3 suppressor of mif two 3 homolog 3 (yeast) 224.13 104.97 0.138 71.57
474010 PTTG1IP Pituitary tumor-transforming 1 interacting protein 472.39 85.43 0.138 111.37
474053 COL6A1 Collagen, type VI, alpha 1 240.21 60.68 0.345 421.26
474083 B4GALT2 UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 2 118.57 65.47 0.345 74.49
474213 UFD1L Ubiquitin fusion degradation 1 like (yeast) 117.12 72.56 0.276 42.38
474584 AKR1A1 Aldo-keto reductase family 1, member A1 (aldehyde reductase) 216.03 70.29 0.138 94.42
474643 C22orf28 Chromosome 22 open reading frame 28 331.66 109.80 0.138 100.93
474751 MYH9 Myosin, heavy polypeptide 9, non-muscle 426.57 109.52 0.069 127.27
474833 CSNK1E Casein kinase 1, epsilon 193.49 86.78 0.138 68.93
474914 RUTBC3 RUN and TBC1 domain containing 3 190.23 157.68 0.345 74.06
474938 SLC25A17 Solute carrier family 25 (mitochondrial carrier; peroxisomal 113.70 81.93 0.345 33.74
membrane protein, 34 kDa), member 17
474949 RBX1 Ring-box 1 145.55 82.29 0.241 69.87
474982 ACO2 Aconitase 2, mitochondrial 307.04 91.01 0.034 105.23
475125 ATXN10 Ataxin 10 198.54 95.44 0.172 118.31
475319 LRRFIP2 Leucine rich repeat (in FLII) interacting protein 2 104.35 72.12 0.310 69.04
475382 MTMR14 Myotubularin related protein 14 149.47 83.39 0.172 114.62
475392 TMEM111 Transmembrane protein 111 136.12 88.37 0.379 46.89
475663 RAB5A RAB5A, member RAS oncogene family 119.70 91.27 0.241 74.69
475733 TOP2B Topoisomerase (DNA) II beta 180 kDa 180.06 113.03 0.172 121.72
475812 STT3B STT3, subunit of the oligosaccharyltransferase complex, homolog 108.24 76.02 0.310 55.56
B (S. cerevisiae)
476018 CTNNB1 Catenin (cadherin-associated protein), beta 1, 88 kDa 138.21 58.20 0.310 215.94
476033 TXNDC12 Thioredoxin domain containing 12 (endoplasmic reticulum) 146.57 70.89 0.172 52.90
476179 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of 171.16 127.75 0.138 91.06
chromatin, subfamily c, member 1
476221 IHPK2 Inositol hexaphosphate kinase 2 145.26 55.31 0.241 77.62
476231 IMPDH2 IMP (inosine monophosphate) dehydrogenase 2 1006.91 110.38 0.034 120.62
476308 ALAS1 Aminolevulinate, delta-, synthase 1 132.82 82.50 0.345 50.43
476365 SCP2 Sterol carrier protein 2 690.56 180.11 0.276 125.14
476448 FLNB Filamin B, beta (actin binding protein 278) 189.01 103.49 0.310 56.29
476706 MRPL37 Mitochondrial ribosomal protein L37 249.66 66.27 0.172 97.03
476930 CHMP2B Chromatin modifying protein 2B 143.22 100.41 0.310 73.54
477157 DULLARD Dullard homolog (Xenopus laevis) 158.37 96.36 0.103 97.30
477789 ATP1B3 ATPase, Na+/K+ transporting, beta 3 polypeptide 167.45 84.60 0.138 135.93
477892 GYG1 Glycogenin 1 151.92 63.62 0.345 54.22
478000 MBNL1 Muscleblind-like (Drosophila) 304.13 90.08 0.241 61.18
478044 PA2G4 Proliferation-associated 2G4, 38 kDa 460.10 87.56 0.103 157.68
478553 EIF4A2 Eukaryotic translation initiation factor 4A, isoform 2 403.21 91.85 0.069 357.47
479208 FBXL5 F-box and leucine-rich repeat protein 5 140.68 84.67 0.276 55.97
479264 LAP3 Leucine aminopeptidase 3 140.16 84.68 0.241 106.91
479634 SLC30A9 Solute carrier family 30 (zinc transporter), member 9 123.90 63.55 0.379 75.32
479693 SFRS11 Splicing factor, arginine/serine-rich 11 189.39 69.99 0.172 199.97
479728 GAPDH Glyceraldehyde-3-phosphate dehydrogenase 7330.72 80.18 0.000 3167.05
479747 BCAR1 Breast cancer anti-estrogen resistance 1 183.08 85.45 0.310 58.32
479814 POLR2B Polymerase (RNA) II (DNA directed) polypeptide B, 140 kDa 170.30 62.57 0.310 102.92
480073 HNRPD Heterogeneous nuclear ribonucleoprotein D (AU-rich element RN/ 229.02 68.01 0.103 241.33
binding protein 1, 37 kDa)
480311 PDLIM5 PDZ and LIM domain 5 273.24 235.65 0.241 95.21
480465 SCYE1 Small inducible cytokine subfamily E, member 1 (endothelial 107.39 55.27 0.276 55.39
monocyte-activating)
480653 ANXA5 Annexin A5 303.60 104.16 0.069 169.77
481571 UQCRH Similar to Ubiquinol-cytochrome C reductase complex 11 kDa 229.54 102.84 0.138 431.88
protein, mitochondrial precursor (Mitochondrial hinge protein)
(Cytochrome C1, nonheme 11 kDa protein) (Complex III subunit
VIII)
481720 MYO10 Myosin X 140.50 130.53 0.310 91.75
481898 CCBL2 Cysteine conjugate-beta lyase 2 134.41 54.32 0.310 48.63
482144 RPL26 Similar to 60S ribosomal protein L26 447.43 95.30 0.034 699.37
482363 SLC30A5 Solute carrier family 30 (zinc transporter), member 5 78.30 56.98 0.379 57.46
482526 TINP1 TGF beta-inducible nuclear protein 1 121.52 61.06 0.241 173.99
482868 KIAA0372 KIAA0372 126.07 60.99 0.241 71.13
483036 PJA2 Praja 2, RING-H2 motif containing 158.62 65.91 0.276 72.48
483067 C5orf13 Chromosome 5 open reading frame 13 318.12 190.12 0.379 195.11
483305 HINT1 Histidine triad nucleotide binding protein 1 236.40 118.42 0.207 113.38
483408 PPP2CA Protein phosphatase 2 (formerly 2A), catalytic subunit, alpha 230.50 94.12 0.138 105.32
isoform
483454 CNN3 Calponin 3, acidic 211.93 89.89 0.207 399.33
483486 JMJD1B Jumonji domain containing 1B 107.12 52.95 0.310 64.58
484138 FBXW11 F-box and WD-40 domain protein 11 117.64 68.50 0.379 109.27
484188 ATP6V0E1 ATPase, H+ transporting, lysosomal 9 kDa, V0 subunit e1 159.10 68.32 0.138 71.54
484242 UBXD8 UBX domain containing 8 125.98 75.93 0.207 66.51
484288 DDX41 DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 214.13 74.98 0.138 47.70
484363 RNF130 Ring finger protein 130 97.65 67.32 0.138 111.91
484551 CPM Carboxypeptidase M 186.28 78.16 0.310 71.14
484813 DEK DEK oncogene (DNA binding) 260.77 83.22 0.172 114.27
485155 RPL35 Ribosomal protein L35 281.04 111.39 0.172 1995.97
485195 SORT1 Sortilin 1 150.82 80.52 0.345 91.72
485246 PSMA5 Proteasome (prosome, macropain) subunit, alpha type, 5 164.31 83.49 0.207 72.99
485262 MTCH1 Mitochondrial carrier homolog 1 (C. elegans) 364.72 91.85 0.103 222.02
485365 AHCYL1 S-adenosylhomocysteine hydrolase-like 1 182.57 61.85 0.207 87.98
485616 DST Dystonin 144.43 74.83 0.276 159.14
486542 BCLAF1 BCL2-associated transcription factor 1 184.76 58.42 0.207 57.11
487027 VIL2 Villin 2 (ezrin) 228.59 71.02 0.138 203.46
487054 TCP1 T-complex 1 209.76 78.62 0.138 162.70
487635 BZW2 Basic leucine zipper and W2 domains 2 250.31 146.18 0.172 96.11
487774 HNRPA2B1 Heterogeneous nuclear ribonucleoprotein A2/B1 218.53 87.55 0.103 476.18
488171 NUDCD3 NudC domain containing 3 607.73 183.50 0.034 2935.95
488181 OGDH Oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) 245.90 110.90 0.207 93.55
488307 ECOP EGFR-coamplified and overexpressed protein 151.47 75.46 0.345 105.70
488478 C7orf42 Chromosome 7 open reading frame 42 151.66 70.90 0.207 70.53
488671 BAZ1B Bromodomain adjacent to zinc finger domain, 1B 114.54 65.20 0.207 97.87
489207 ASNS Asparagine synthetase 262.06 124.38 0.172 159.98
489284 ARPC1B Actin related protein ⅔ complex, subunit 1B, 41 kDa 555.08 109.32 0.103 249.26
489287 CPSF4 Cleavage and polyadenylation specific factor 4, 30 kDa 171.76 69.89 0.172 88.36
489336 SYAP1 Synapse associated protein 1, SAP47 homolog (Drosophila) 126.10 45.09 0.310 51.70
489615 PBEF1 Pro-B-cell colony enhancing factor 1 211.67 111.85 0.276 110.09
490203 CALD1 Caldesmon 1 242.44 103.25 0.207 84.05
490394 SSBP1 Single-stranded DNA binding protein 1 444.28 309.52 0.241 86.70
490415 ZYX Zyxin 259.67 90.01 0.138 278.36
490745 DNAJB6 DnaJ (Hsp40) homolog, subfamily B, member 6 182.26 74.39 0.103 170.33
490795 FAM62B Family with sequence similarity 62 (C2 domain containing) 256.81 139.32 0.276 67.48
member B
490874 MTX1 Metaxin 1 139.52 83.02 0.310 62.57
491336 ELP3 Elongation protein 3 homolog (S. cerevisiae) 98.38 59.66 0.379 43.04
491359 LMNA Lamin A/C 797.11 108.53 0.138 415.19
491440 PPP2CB Protein phosphatase 2 (formerly 2A), catalytic subunit, beta 146.90 77.42 0.276 218.31
isoform
491494 CCT3 Chaperonin containing TCP1, subunit 3 (gamma) 1152.31 109.73 0.034 207.97
491597 VDAC3 Voltage-dependent anion channel 3 189.10 60.03 0.207 82.40
491695 UBE2V2 Ubiquitin-conjugating enzyme E2 variant 2 1324.03 205.58 0.276 58.78
491745 TCEA1 Transcription elongation factor A (SII), 1 180.17 63.49 0.241 69.36
491988 TRAM1 Translocation associated membrane protein 1 151.74 62.44 0.172 147.67
492236 WDR42A WD repeat domain 42A 135.63 62.96 0.310 61.94
492314 LAPTM4B Lysosomal associated protein transmembrane 4 beta 315.85 98.92 0.138 124.30
492445 UBR5 Ubiquitin protein ligase E3 component n-recognin 5 133.59 70.25 0.345 51.32
492599 EIF3S3 Eukaryotic translation initiation factor 3, subunit 3 gamma, 40 kDa 457.44 91.86 0.069 165.21
492805 NMD3 NMD3 homolog (S. cerevisiae) 154.69 68.25 0.276 64.99
493362 AK3L1 Adenylate kinase 3 138.22 63.01 0.241 49.75
493750 WDR40A WD repeat domain 40A 158.95 64.13 0.345 28.58
494173 ANXA1 Annexin A1 663.71 206.40 0.138 439.06
494419 LAMP1 Lysosomal-associated membrane protein 1 278.30 123.84 0.276 112.59
494457 NINJ1 Ninjurin 1 146.99 120.17 0.379 192.87
494604 ANP32B Acidic (leucine-rich) nuclear phosphoprotein 32 family, member B 297.30 74.71 0.069 142.74
494614 BAT2D1 BAT2 domain containing 1 103.03 72.44 0.310 133.29
494691 PFN1 Profilin 1 582.68 96.95 0.069 1198.54
494700 SLC44A1 Solute carrier family 44, member 1 156.34 79.78 0.379 88.15
494985 FBXW2 F-box and WD-40 domain protein 2 97.45 68.65 0.379 40.27
495039 NDUFA8 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19 100.91 70.67 0.345 82.23
495349 KIAA0515 KIAA0515 213.73 62.92 0.069 129.84
495471 PMPCA Peptidase (mitochondrial processing) alpha 174.09 84.07 0.172 85.88
495605 CD99 CD99 antigen 171.31 62.16 0.138 198.26
495851 APOO Apolipoprotein O 144.33 80.53 0.345 129.92
495960 ATP6AP2 ATPase, H+ transporting, lysosomal accessory protein 2 177.66 91.25 0.276 67.87
496068 PCTK1 PCTAIRE protein kinase 1 177.60 80.15 0.207 56.40
496098 OTUD5 OTU domain containing 5 171.08 119.61 0.207 43.34
496271 ? Full-length cDNA clone CS0DJ002YF04 of T cells (Jurkat cell line) 552.58 198.74 0.172 70.79
Cot 10-normalized of Homo sapiens (human)
496487 ATF4 Activating transcription factor 4 (tax-responsive enhancer element 644.83 92.22 0.069 179.34
B67)
496646 IL13RA1 Interleukin 13 receptor, alpha 1 117.23 77.35 0.310 54.24
496684 LAMP2 Lysosomal-associated membrane protein 2 175.62 85.98 0.241 127.56
497183 IVNS1ABP Influenza virus NS1A binding protein 156.30 56.55 0.241 76.25
497599 WARS Tryptophanyl-tRNA synthetase 328.30 141.43 0.103 158.85
497692 NSL1 NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) 142.41 132.49 0.379 45.74
497893 ENAH Enabled homolog (Drosophila) 133.62 90.22 0.276 73.14
498239 FH Fumarate hydratase 304.63 108.28 0.276 51.25
498313 ADSS Adenylosuccinate synthase 138.41 96.89 0.276 66.59
498317 C1orf121 Chromosome 1 open reading frame 121 139.90 108.25 0.379 67.33
498455 LARP5 La ribonucleoprotein domain family, member 5 142.32 72.97 0.241 56.84
498548 RBM17 RNA binding motif protein 17 119.60 106.34 0.207 84.57
498727 DHCR24 24-dehydrocholesterol reductase 380.21 178.18 0.207 125.92
499145 YME1L1 YME1-like 1 (S. cerevisiae) 218.20 87.96 0.241 85.44
499158 GGA1 Golgi associated, gamma adaptin ear containing, ARF binding 149.92 94.46 0.276 59.38
protein 1
499594 TIMM23 Translocase of inner mitochondrial membrane 23 homolog (yeast) 116.05 77.66 0.241 46.30
499833 REEP3 Receptor accessory protein 3 97.26 86.49 0.345 48.48
499891 HNRPH3 Heterogeneous nuclear ribonucleoprotein H3 (2H9) 152.75 70.91 0.103 103.56
499925 VPS26A Vacuolar protein sorting 26 homolog A (S. pombe) 129.39 63.83 0.172 66.21
499960 SAR1A SAR1 gene homolog A (S. cerevisiae) 122.18 69.10 0.172 87.25
500067 PPP3CB Protein phosphatase 3 (formerly 2B), catalytic subunit, beta 120.27 66.72 0.241 124.28
isoform (calcineurin A beta)
500101 VCL Vinculin 197.78 102.19 0.207 122.06
500375 ENTPD6 Ectonucleoside triphosphate diphosphohydrolase 6 (putative 163.42 84.78 0.276 93.92
function)
500409 GLUD1 Glutamate dehydrogenase 1 161.37 95.54 0.138 228.78
500546 IDE Insulin-degrading enzyme 112.83 68.82 0.310 46.45
500674 TM9SF3 Transmembrane 9 superfamily member 3 215.50 58.43 0.207 132.96
500775 ZNF207 Zinc finger protein 207 233.29 62.27 0.034 165.68
500842 MGEA5 Meningioma expressed antigen 5 (hyaluronidase) 179.67 93.93 0.310 194.92
500874 CUEDC2 CUE domain containing 2 129.96 52.06 0.310 136.22
501012 ADD3 Adducin 3 (gamma) 223.70 119.75 0.310 80.79
501023 MXI1 MAX interactor 1 94.44 62.74 0.345 62.06
501203 TIAL1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 146.01 73.16 0.276 75.46
501293 BSG Basigin (OK blood group) 737.88 112.29 0.103 664.58
501309 CIRBP Cold inducible RNA binding protein 265.44 117.90 0.034 203.81
501353 PLEKHJ1 Pleckstrin homology domain containing, family J member 1 100.87 56.61 0.379 75.27
501376 UROS Uroporphyrinogen III synthase (congenital erythropoietic porphyria) 130.07 71.33 0.241 54.58
501420 NCLN Nicalin homolog (zebrafish) 177.01 86.48 0.241 51.28
501629 IER2 Immediate early response 2 140.79 60.99 0.241 197.55
501684 NAP1L4 Nucleosome assembly protein 1-like 4 166.93 111.13 0.138 77.93
501735 STIM1 Stromal interaction molecule 1 117.62 71.87 0.276 85.58
501853 TMEM9B TMEM9 domain family, member B 110.79 91.41 0.379 55.61
501924 USP47 Ubiquitin specific peptidase 47 132.14 118.32 0.345 43.63
501991 MLSTD2 Male sterility domain containing 2 96.74 62.95 0.379 51.17
502302 CAT Catalase 158.19 107.96 0.345 78.26
502328 CD44 CD44 antigen (homing function and Indian blood group system) 366.11 100.63 0.172 183.18
502461 DGKZ Diacylglycerol kinase, zeta 104 kDa 109.99 96.64 0.310 78.41
502528 NDUFS3 NADH dehydrogenase (ubiquinone) Fe—S protein 3, 30 kDa 119.28 75.88 0.207 151.30
(NADH-coenzyme Q reductase)
502630 C11orf31 Chromosome 11 open reading frame 31 170.27 98.83 0.276 149.13
502659 RHOC Ras homolog gene family, member C 253.62 101.47 0.138 234.42
502705 PRPF19 PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae) 198.31 100.04 0.276 84.60
502745 FADS2 Fatty acid desaturase 2 266.18 116.45 0.276 221.93
502769 SLC3A2 Solute carrier family 3 (activators of dibasic and neutral amino acid 276.24 84.47 0.138 123.67
transport), member 2
502773 ADI1 Acireductone dioxygenase 1 159.84 55.74 0.103 57.70
502823 PRDX5 Peroxiredoxin 5 183.65 76.11 0.241 216.88
502829 SF1 Splicing factor 1 263.86 66.20 0.069 141.67
502836 ARL2 ADP-ribosylation factor-like 2 134.06 114.72 0.310 119.31
502842 CAPN1 Calpain 1, (mu/I) large subunit 287.11 101.89 0.207 88.58
502872 MAP3K11 Mitogen-activated protein kinase kinase kinase 11 128.70 82.13 0.276 72.97
502876 RHOB Ras homolog gene family, member B 165.00 92.57 0.310 283.76
503093 ZFP36L2 Zinc finger protein 36, C3H type-like 2 150.79 67.83 0.207 280.17
503222 RAB6A RAB6A, member RAS oncogene family 152.69 73.96 0.241 119.21
503251 PPME1 Protein phosphatase methylesterase 1 123.71 52.56 0.207 59.51
503597 HSPC148 Hypothetical protein HSPC148 107.89 76.02 0.276 58.03
503709 TMEM123 Transmembrane protein 123 339.10 161.64 0.172 79.34
503716 DCUN1D5 DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae) 167.32 87.13 0.138 54.63
503787 DARS Aspartyl-tRNA synthetase 147.34 55.17 0.138 100.30
504237 STT3A STT3, subunit of the oligosaccharyltransferase complex, homolog 117.19 108.95 0.345 77.26
A (S. cerevisiae)
504517 RPS27 Tetraspanin 9 176.40 121.62 0.379 2547.00
504613 PTMS Parathymosin 175.13 81.37 0.345 308.10
504620 PHB2 Prohibitin 2 506.51 79.86 0.069 136.79
504687 MYL9 Elongation factor Tu family protein 343.66 100.94 0.379 340.49
504828 DDX47 DEAD (Asp-Glu-Ala-Asp) box polypeptide 47 130.63 59.08 0.379 43.21
504895 STRAP Serine/threonine kinase receptor associated protein 221.43 95.09 0.138 122.68
505033 KRAS v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog 115.82 83.04 0.310 57.38
505059 PSMD4 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4 259.00 62.63 0.103 180.27
505625 C12orf10 Chromosome 12 open reading frame 10 105.33 77.88 0.345 80.93
505652 COPZ1 Coatomer protein complex, subunit zeta 1 204.89 87.20 0.000 217.03
505676 CIP29 Cytokine induced protein 29 kDa 184.81 88.39 0.241 118.62
505705 MYL6 Myosin, light polypeptide 6, alkali, smooth muscle and non-muscle 438.52 109.87 0.069 1121.48
505806 PBXIP1 Pre-B-cell leukemia transcription factor interacting protein 1 115.75 83.63 0.310 72.04
505824 SAMM50 Sorting and assembly machinery component 50 homolog (S. cerevisiae) 242.60 117.59 0.172 59.28
506215 RARS Arginyl-tRNA synthetase 192.15 85.96 0.172 103.05
506325 NUDT4 Nudix (nucleoside diphosphate linked moiety X)-type motif 4 121.40 87.04 0.379 161.89
pseudogene 2
506759 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 375.19 241.76 0.241 195.37
506861 DDX54 DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 199.70 104.77 0.241 74.73
507074 KIAA0152 KIAA0152 244.90 89.86 0.069 77.13
507162 VPS37B Vacuolar protein sorting 37 homolog B (S. cerevisiae) 142.45 79.66 0.276 143.42
507584 POLR1D Polymerase (RNA) I polypeptide D, 16 kDa 121.94 73.07 0.241 107.77
507680 PFAAP5 Phosphonoformate immuno-associated protein 5 143.30 68.40 0.345 63.32
507910 PGRMC2 Progesterone receptor membrane component 2 131.09 75.85 0.207 124.83
507916 TSC22D1 TSC22 domain family, member 1 344.52 102.84 0.172 243.46
508010 FNDC3A Fibronectin type III domain containing 3A 264.21 157.30 0.241 110.98
508644 FLJ10154 Hypothetical protein FLJ10154 183.99 75.88 0.310 65.60
509163 ERGIC1 Endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 147.54 71.85 0.103 94.35
509226 FKBP3 FK506 binding protein 3, 25 kDa 146.28 97.77 0.241 140.21
509264 KLHDC2 Kelch domain containing 2 117.21 72.23 0.207 121.90
509414 KTN1 Kinectin 1 (kinesin receptor) 196.92 103.65 0.207 88.75
509622 RGL2 Ral guanine nucleotide dissociation stimulator-like 2 136.36 70.20 0.345 93.28
509736 HSP90AB1 Heat shock protein 90 kDa alpha (cytosolic), class B member 1 2045.82 87.83 0.000 550.72
509791 ERH Enhancer of rudimentary homolog (Drosophila) 148.95 80.20 0.207 256.46
509909 NUMB Numb homolog (Drosophila) 115.97 62.99 0.241 58.22
510087 ENSA Endosulfine alpha 196.15 70.81 0.034 159.53
510328 DDX24 DEAD (Asp-Glu-Ala-Asp) box polypeptide 24 446.38 126.73 0.103 75.63
510402 CD46 CD46 molecule, complement regulatory protein 255.43 87.89 0.276 81.27
511067 FAM82C Family with sequence similarity 82, member C 193.94 125.16 0.345 39.66
511138 TMEM87A Transmembrane protein 87A 153.90 71.25 0.241 82.26
511149 SNAP23 Synaptosomal-associated protein, 23 kDa 159.76 70.15 0.276 51.21
511425 SRP9 Signal recognition particle 9 kDa 1439.84 206.14 0.069 454.09
511504 TCF12 Transcription factor 12 (HTF4, helix-loop-helix transcription factors 175.22 83.75 0.276 69.32
4)
511862 Similar to 60S acidic ribosomal protein P1 182.40 88.27 0.379 84.86
511952 CBX6 Chromobox homolog 6 153.88 81.20 0.276 64.59
512005 ARPC3 Actin related protein ⅔ complex, subunit 3, 21 kDa 175.09 73.61 0.241 119.68
512465 SURF4 Surfeit 4 272.49 79.31 0.069 106.55
512525 RPS17 Ribosomal protein S17 1561.21 128.47 0.069 599.75
512607 MIR16 Membrane interacting protein of RGS16 243.63 112.71 0.207 98.46
512640 PRKCSH Protein kinase C substrate 80K-H 369.95 87.75 0.172 131.74
512661 ISY1 ISY1 splicing factor homolog (S. cerevisiae) 247.17 110.21 0.241 115.05
512676 RPS25 Ribosomal protein S25 200.49 132.68 0.241 286.69
512693 METT11D1 Methyltransferase 11 domain containing 1 119.37 86.98 0.345 29.73
512756 THAP7 THAP domain containing 7 139.40 88.58 0.345 51.73
512815 AP3D1 Adaptor-related protein complex 3, delta 1 subunit 260.40 98.20 0.034 107.57
512857 CD151 CD151 antigen 289.17 93.65 0.207 378.94
512867 CASC4 Cancer susceptibility candidate 4 130.94 70.38 0.207 100.14
512908 ARPP-19 Cyclic AMP phosphoprotein, 19 kD 226.51 76.75 0.207 146.97
513043 IMP3 IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) 135.64 58.16 0.310 47.55
513055 WDR61 WD repeat domain 61 114.60 53.12 0.345 70.68
513057 RANBP5 RAN binding protein 5 280.02 118.69 0.172 101.08
513058 TMED3 Transmembrane emp24 protein transport domain containing 3 180.01 81.33 0.138 114.71
513071 MESDC1 Mesoderm development candidate 1 153.38 113.49 0.276 50.82
513083 RPL9 Ribosomal protein L9 1564.85 164.78 0.034 740.57
513141 IDH2 Isocitrate dehydrogenase 2 (NADP+), mitochondrial 276.13 73.73 0.103 172.64
513145 NGRN Neugrin, neurite outgrowth associated 292.66 85.21 0.034 91.71
513153 FURIN Furin (paired basic amino acid cleaving enzyme) 171.95 95.68 0.379 67.56
513230 MRPL28 Mitochondrial ribosomal protein L28 206.58 141.00 0.241 67.94
513242 RHOT2 Ras homolog gene family, member T2 146.56 66.79 0.345 59.56
513261 HN1L Hematological and neurological expressed 1-like 169.07 73.84 0.138 62.28
513266 NDUFB10 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22 141.77 93.82 0.345 42.16
513470 NFATC2IP Nuclear factor of activated T-cells, cytoplasmic, calcineurin- 123.18 55.34 0.310 30.57
dependent 2 interacting protein
513488 MVP Major vault protein 276.00 95.97 0.276 79.08
513490 ALDOA Aldolase A, fructose-bisphosphate 1575.38 81.23 0.034 916.32
513520 BCKDK Branched chain ketoacid dehydrogenase kinase 181.01 99.21 0.276 51.25
513522 FUS Fusion (involved in t(12; 16) in malignant liposarcoma) 402.21 88.89 0.034 172.34
513631 ARL2BP ADP-ribosylation factor-like 2 binding protein 133.32 76.06 0.379 60.80
513856 DPH1 DPH1 homolog (S. cerevisiae) 153.80 77.15 0.172 162.16
513984 FLII Flightless 1 homolog (Drosophila) 218.66 80.64 0.103 61.58
514012 MAP2K3 Mitogen-activated protein kinase kinase 3 206.91 198.73 0.379 68.18
514036 SDF2 Stromal cell-derived factor 2 139.48 83.16 0.379 49.32
514038 FLOT2 Flotillin 2 205.94 75.37 0.241 103.22
514174 JUP Junction plakoglobin 311.95 175.04 0.310 204.87
514196 RPL27 Ribosomal protein L27 445.53 163.18 0.103 927.28
514211 TMEM101 Transmembrane protein 101 207.70 66.43 0.345 109.02
514216 SLC25A39 Solute carrier family 25, member 39 372.09 78.71 0.103 162.85
514220 GRN Granulin 569.94 118.75 0.103 216.06
514297 UBE2Z Ubiquitin-conjugating enzyme E2Z (putative) 149.22 70.83 0.172 84.41
514303 PHB Prohibitin 337.86 78.21 0.103 142.93
514435 SF3B3 Splicing factor 3b, subunit 3, 130 kDa 245.52 67.98 0.138 44.20
514489 WBP2 WW domain binding protein 2 367.18 97.07 0.138 147.04
514535 LGALS3BP Lectin, galactoside-binding, soluble, 3 binding protein 714.12 134.59 0.172 117.40
514581 ACTG1 Actin, gamma 1 6790.08 96.54 0.000 1374.42
514590 HGS Hepatocyte growth factor-regulated tyrosine kinase substrate 234.48 89.80 0.241 88.17
514819 AP2B1 Adaptor-related protein complex 2, bela 1 subunit 184.47 53.67 0.207 92.79
514870 ATP5F1 ATP synthase, H+ transporting, mitochondrial F0 complex, subuni 441.56 130.47 0.034 84.88
b, isoform 1
514920 CALCOCO Calcium binding and coiled-coil domain 2 151.26 76.62 0.241 46.59
514934 CAPZA1 Capping protein (actin filament) muscle Z-line, alpha 1 232.49 84.07 0.276 101.72
515003 C19orf6 Chromosome 19 open reading frame 6 218.92 96.61 0.172 96.49
515005 STK11 Serine/threonine kinase 11 (Peutz-Jeghers syndrome) 127.27 85.12 0.379 66.15
515018 GNA13 Guanine nucleotide binding protein (G protein), alpha 13 162.22 105.65 0.345 72.69
515053 AES Amino-terminal enhancer of split 314.90 95.73 0.138 258.48
515070 EEF2 Eukaryotic translation elongation factor 2 403.41 101.00 0.034 2097.60
515092 CLPP ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit 173.03 103.29 0.241 50.27
homolog (E. coli)
515155 C19orf43 Chromosome 19 open reading frame 43 161.94 77.42 0.138 117.34
515162 CALR Calreticulin 575.58 88.03 0.034 110.24
515164 GADD45GIP1 Growth arrest and DNA-damage-inducible, gamma interacting 191.12 69.42 0.276 107.72
protein 1
515210 DNAJB1 DnaJ (Hsp40) homolog, subfamily B, member 1 233.68 80.33 0.207 330.45
515255 LSM4 LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) 266.66 105.98 0.276 139.77
515266 UPF1 UPF1 regulator of nonsense transcripts homolog (yeast) 163.88 99.99 0.276 60.23
515271 SFRS14 Splicing factor, arginine/serine-rich 14 124.30 81.86 0.310 47.59
515329 RPL22 Ribosomal protein L22 191.43 75.49 0.138 455.30
515371 CAPNS1 Calpain, small subunit 1 404.46 95.10 0.069 519.15
515406 AKT2 V-akt murine thymoma viral oncogene homolog 2 139.00 124.72 0.345 101.41
515417 EGLN2 Egl nine homolog 2 (C. elegans) 257.04 138.23 0.379 141.94
515432 DEDD2 Death effector domain containing 2 94.65 52.25 0.379 52.49
515472 SNRPD2 Small nuclear ribonucleoprotein D2 polypeptide 16.5 kDa 292.31 154.43 0.207 250.23
515475 SYMPK Symplekin 133.18 53.29 0.241 43.73
515487 CALM3 Calmodulin 3 (phosphorylase kinase, delta) 439.26 95.22 0.069 170.52
515494 SLC1A5 Solute carrier family 1 (neutral amino acid transporter), member 5 448.32 106.79 0.138 90.90
515500 SAE1 SUMO-1 activating enzyme subunit 1 380.21 79.67 0.034 84.41
515515 KDELR1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention 261.62 81.81 0.138 278.16
receptor 1
515517 RPL18 Ribosomal protein L18 743.38 74.48 0.103 361.65
515524 NUCB1 Nucleobindin 1 350.34 117.21 0.103 177.67
515540 PTOV1 Prostate tumor overexpressed gene 1 175.30 98.47 0.172 165.98
515550 LOC284361 Hematopoietic signal peptide-containing 135.48 82.61 0.310 234.71
515598 PRPF31 PRP31 pre-mRNA processing factor 31 homolog (yeast) 368.40 151.24 0.276 57.93
515607 PPP1R12C Protein phosphatase 1, regulatory (inhibitor) subunit 12C 165.22 97.14 0.379 50.41
515642 GPSN2 Glycoprotein, synaptic 2 171.37 74.21 0.345 122.06
515785 BLVRB Biliverdin reductase B (flavin reductase (NADPH)) 143.92 94.30 0.310 182.67
515846 RUVBL2 RuvB-like 2 (E. coli) 354.78 98.40 0.138 97.93
515848 HADHB Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme 213.42 90.90 0.103 98.50
thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta
subunit
515890 YPEL5 Yippee-like 5 (Drosophila) 181.92 82.16 0.276 123.75
516075 TIA1 TIA1 cytotoxic granule-associated RNA binding protein 183.23 80.58 0.310 93.19
516077 FLJ14668 Hypothetical protein FLJ14668 112.96 75.82 0.276 61.98
516087 TEX261 Testis expressed sequence 261 146.81 110.15 0.241 33.17
516111 DCTN1 Dynactin 1 (p150, glued homolog, Drosophila) 261.96 94.41 0.103 64.73
516114 WBP1 WW domain binding protein 1 114.03 56.61 0.310 42.16
516157 MAT2A Methionine adenosyltransferase II, alpha 195.52 68.87 0.172 242.05
516450 SMPD4 Sphingomyelin phosphodiesterase 4, neutral membrane (neutral 248.30 97.54 0.172 118.46
sphingomyelinase-3)
516522 INTS3 Integrator complex subunit 3 142.16 102.91 0.379 59.15
516539 HNRPA3 Heterogeneous nuclear ribonucleoprotein A3 223.52 72.69 0.138 168.69
516587 UBE2Q1 Ubiquitin-conjugating enzyme E2Q (putative) 1 131.58 55.37 0.345 69.25
516633 NCKAP1 NCK-associated protein 1 198.42 62.97 0.241 153.54
516711 CHPF Chondroitin polymerizing factor 213.73 142.81 0.379 128.03
516790 ARHGEF2 Rho/rac guanine nucleotide exchange factor (GEF) 2 133.62 84.47 0.379 59.83
516807 STK25 Serine/threonine kinase 25 (STE20 homolog, yeast) 455.41 109.35 0.138 64.72
516826 TRIB3 Tribbles homolog 3 (Drosophila) 228.24 99.31 0.241 50.84
516855 CENPB Centromere protein B, 80 kDa 202.67 80.52 0.276 82.21
517080 SLC35C2 Solute carrier family 35, member C2 163.93 94.82 0.207 60.57
517106 CEBPB CCAAT/enhancer binding protein (C/EBP), beta 178.82 93.37 0.345 155.23
517134 C20orf43 Chromosome 20 open reading frame 43 247.39 69.92 0.069 79.36
517145 ENO1 Enolase 1, (alpha) 3401.32 102.15 0.000 166.84
517168 TAGLN2 Transgelin 2 626.02 75.92 0.069 595.39
517216 PEA15 Phosphoprotein enriched in astrocytes 15 283.17 82.20 0.172 201.83
517232 PEX19 Peroxisomal biogenesis factor 19 151.27 57.99 0.207 78.36
517240 IFNGR2 Interferon gamma receptor 2 (interferon gamma transducer 1) 158.55 79.26 0.172 79.49
517262 SON SON DNA binding protein 197.08 79.92 0.138 111.91
517293 F11R F11 receptor 215.86 109.54 0.276 1045.83
517338 ATP6V1E1 ATPase, H+ transporting, lysosomal 31 kDa, V1 subunit E isoform 1 197.20 81.17 0.069 122.60
517342 DEDD Death effector domain containing 136.31 62.93 0.276 55.11
517356 COL18A1 Collagen, type XVIII, alpha 1 388.40 175.92 0.345 169.44
517357 DGCR2 DiGeorge syndrome critical region gene 2 214.17 92.03 0.241 88.38
517421 PCQAP PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich- 205.74 178.98 0.241 70.11
associated protein
517438 ASCC2 Activating signal cointegrator 1 complex subunit 2 138.59 89.52 0.138 46.79
517517 EP300 E1A binding protein p300 124.61 92.25 0.379 70.50
517543 PES1 Pescadillo homolog 1, containing BRCT domain (zebrafish) 242.64 124.33 0.276 66.78
517582 MCM5 MCM5 minichromosome maintenance deficient 5, cell division 424.00 105.24 0.172 49.05
cycle 46 (S. cerevisiae)
517622 UNC84B Unc-84 homolog B (C. elegans) 131.34 80.16 0.310 86.59
517641 L3MBTL2 L(3)mbt-like 2 (Drosophila) 116.46 67.43 0.345 35.18
517666 CYB5R3 Cytochrome b5 reductase 3 314.58 161.98 0.138 125.03
517731 TRABD TraB domain containing 180.88 102.41 0.276 83.26
517768 BRP44 Brain protein 44 127.10 104.51 0.345 90.63
517792 C3orf10 Chromosome 3 open reading frame 10 175.04 80.24 0.069 101.16
517817 TMEM43 Transmembrane protein 43 136.66 75.36 0.310 40.01
517821 CDNA clone IMAGE: 5278517 120.53 66.29 0.310 154.05
517888 CRTAP Cartilage associated protein 208.15 77.38 0.207 87.57
517948 DHX30 DEAH (Asp-Glu-Ala-His) box polypeptide 30 209.13 121.04 0.207 70.11
517949 MAP4 Microtubule-associated protein 4 306.69 79.18 0.103 204.68
517969 APEH N-acylaminoacyl-peptide hydrolase 330.37 60.97 0.207 65.68
517981 TUSC2 Tumor suppressor candidate 2 129.92 69.61 0.310 47.18
518060 ARL6IP5 ADP-ribosylation-like factor 6 interacting protein 5 303.59 116.09 0.207 144.14
518123 TFG TRK-fused gene 189.81 59.70 0.138 95.89
518236 SEC61A1 Sec61 alpha 1 subunit (S. cerevisiae) 272.42 82.37 0.138 130.33
518244 RPN1 Ribophorin I 232.54 86.03 0.172 155.16
518249 CNBP CCHC-type zinc finger, nucleic acid binding protein 307.66 69.72 0.034 229.80
518250 COPG Coatomer protein complex, subunit gamma 205.51 104.21 0.276 130.03
518265 CDV3 CDV3 homolog (mouse) 192.56 91.81 0.138 187.87
518326 SERP1 Stress-associated endoplasmic reticulum protein 1 233.71 64.27 0.069 106.11
518346 SSR3 Signal sequence receptor, gamma (translocon-associated protein 133.69 62.65 0.241 92.36
gamma)
518374 QSOX1 Quiescin Q6 sulfhydryl oxidase 1 151.71 84.80 0.310 145.16
518424 NDUFB5 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16 kDa 625.19 180.45 0.276 63.18
518460 AP2M1 Adaptor-related protein complex 2, mu 1 subunit 584.10 76.35 0.069 110.88
518464 PSMD2 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 538.23 93.02 0.103 173.46
518525 GLUL Glutamate-ammonia ligase (glutamine synthetase) 326.37 86.68 0.138 580.48
518551 RPL31 Ribosomal protein L31 883.50 204.46 0.103 1315.12
518608 MRFAP1L1 Morf4 family associated protein 1-like 1 107.24 53.27 0.172 87.02
518609 ARPC5 Actin related protein ⅔ complex, subunit 5, 16 kDa 226.65 65.59 0.172 86.13
518750 OCIAD1 OCIA domain containing 1 121.73 78.62 0.172 557.63
518805 HMGA1 High mobility group AT-hook 1 1583.57 131.69 0.172 519.78
518827 CCNI Cyclin I 495.99 157.57 0.034 378.10
519276 MAPKAPK2 Mitogen-activated protein kinase-activated protein kinase 2 172.89 87.16 0.172 110.38
519304 PELO Pelota homolog (Drosophila) 204.10 151.63 0.310 91.66
519346 ERBB2IP Erbb2 interacting protein 171.05 83.90 0.241 52.83
519347 SFRS12 Splicing factor, arginine/serine-rich 12 99.98 49.97 0.310 53.48
519520 RPS25 Ribosomal protein S25 717.45 181.09 0.034 1253.26
519523 SERPINB6 Serpin peptidase inhibitor, clade B (ovalbumin), member 6 180.64 74.06 0.172 97.35
519557 TMEM14C Transmembrane protein 14C 139.62 70.39 0.276 71.79
519718 TTC1 Tetratricopeptide repeat domain 1 119.41 63.74 0.276 51.02
519756 STK10 Serine/threonine kinase 10 131.85 89.36 0.379 33.36
519818 MGAT1 Mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N- 179.60 85.97 0.138 124.43
acetylglucosaminyltransferase
519909 MARCKS Myristoylated alanine-rich protein kinase C substrate 360.12 219.46 0.310 315.50
519930 C6orf62 Chromosome 6 open reading frame 62 131.39 63.83 0.138 140.39
520026 VARS2 Valyl-tRNA synthetase 317.40 77.78 0.241 122.24
520028 HSPA1A Heat shock 70 kDa protein 1A 267.63 174.20 0.241 697.50
520037 NEU1 Sialidase 1 (lysosomal sialidase) 229.35 119.62 0.310 108.45
520070 CUTA CUtA divalent cation tolerance homolog (E. coli) 154.48 68.26 0.207 234.43
520140 SRF Serum response factor (c-fos serum response element-binding 130.75 59.73 0.379 78.21
transcription factor)
520189 ELOVL5 ELOVL family member 5, elongation of long chain fatty acids 137.81 70.07 0.276 92.84
(FEN1/Elo2, SUR4/Elo3-like, yeast)
520205 EIF2AK1 Eukaryotic translation initiation factor 2-alpha kinase 1 238.20 66.39 0.138 137.26
520210 KDELR2 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention 225.97 94.83 0.138 163.28
receptor 2
520287 C6orf111 Chromosome 6 open reading frame 111 170.77 69.67 0.207 51.33
520313 CD164 CD164 antigen, sialomucin 387.43 78.65 0.172 179.75
520383 STX7 Syntaxin 7 200.61 198.70 0.379 62.05
520421 PERP PERP, TP53 apoptosis effector 278.10 105.31 0.379 142.93
520459 GTF2I General transcription factor II, i 179.36 111.40 0.345 291.72
520623 C7orf27 Chromosome 7 open reading frame 27 107.46 71.73 0.345 33.85
520640 ACTB Actin, beta 4381.34 95.98 0.034 1348.49
520740 SCRN1 Secernin 1 162.41 76.80 0.276 116.36
520794 YKT6 SNARE protein Ykt6 322.61 99.65 0.276 50.36
520898 CTSB Cathepsin B 555.78 100.98 0.034 454.52
520943 EIF4H Eukaryotic translation initiation factor 4H 520.03 71.02 0.069 219.24
520967 MDH2 Malate dehydrogenase 2, NAD (mitochondrial) 368.83 66.26 0.069 186.05
520973 HSPB1 Heat shock 27 kDa protein 1 608.95 126.99 0.138 466.81
520974 YWHAG Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase 171.99 87.92 0.310 260.44
activation protein, gamma polypeptide
521064 ZNF655 Zinc finger protein 655 100.31 68.90 0.379 78.88
521151 ZNF672 Zinc finger protein 672 185.36 113.36 0.310 46.43
521289 REPIN1 Replication initiator 1 220.03 101.31 0.172 86.72
521487 TMEM66 Transmembrane protein 66 276.62 74.21 0.138 363.27
521640 RAD23B RAD23 homolog B (S. cerevisiae) 334.78 294.31 0.241 1470.83
521809 RP13- Cofactor of BRCA1 180.78 84.61 0.172 78.57
122B23.3
521903 LY6E Lymphocyte antigen 6 complex, locus E 425.61 138.70 0.172 224.92
521924 SIAHBP1 Fuse-binding protein-interacting repressor 381.93 82.10 0.103 89.56
521969 NDUFB11 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3 kDa 144.58 114.75 0.379 136.30
521973 WDR13 WD repeat domain 13 177.47 106.14 0.172 49.95
522074 TSC22D3 TSC22 domain family, member 3 194.81 93.94 0.207 98.72
522110 CREB3 CAMP responsive element binding protein 3 153.05 94.31 0.241 42.72
522114 CLTA Clathrin, light polypeptide (Lca) 317.85 88.44 0.103 155.26
522310 NANS N-acetylneuraminic acid synthase (sialic acid synthase) 114.60 62.52 0.310 91.19
522373 GSN Gelsolin (amyloidosis, Finnish type) 434.41 204.85 0.138 323.96
522394 HSPA5 Heat shock 70 kDa protein 5 (glucose-regulated protein, 78 kDa) 367.53 102.24 0.172 784.29
522463 EEF1A1 Eukaryotic translation elongation factor 1 alpha 1 9324.87 148.86 0.000 3936.86
522507 FBXW5 F-box and WD-40 domain protein 5 199.15 90.48 0.276 108.16
522584 TMSB4X Thymosin, beta 4, X-linked 1362.45 161.68 0.172 1985.02
522590 EIF1AX Eukaryotic translation initiation factor 1A, X-linked 136.35 67.99 0.207 125.35
522632 TIMP1 TIMP metallopeptidase inhibitor 1 386.91 180.87 0.241 193.45
522665 MAGED2 Melanoma antigen family D, 2 430.71 110.49 0.138 74.89
522675 LAS1L LAS1-like (S. cerevisiae) 201.59 69.13 0.241 56.35
522752 PSMD10 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 122.91 60.90 0.276 74.90
522817 BCAP31 B-cell receptor-associated protein 31 290.93 84.50 0.172 110.80
522819 IRAK1 Interleukin-1 receptor-associated kinase 1 382.94 97.80 0.138 147.41
522823 EMD Emerin (Emery-Dreifuss muscular dystrophy) 171.35 87.58 0.379 89.83
522932 NCOA4 Nuclear receptor coactivator 4 209.19 70.05 0.138 63.66
522995 EIF4EBP2 Eukaryotic translation initiation factor 4E binding protein 2 176.81 73.83 0.103 72.69
523004 PSAP Prosaposin (variant Gaucher disease and variant metachromatic 1098.27 123.65 0.034 854.93
leukodystrophy)
523012 DDIT4 DNA-damage-inducible transcript 4 415.15 125.10 0.276 174.92
523054 TMEM50A Transmembrane protein 50A 139.64 109.41 0.276 109.08
523131 TRAPPC3 Trafficking protein particle complex 3 139.68 66.61 0.310 61.64
523145 DDOST Dolichyl-diphosphooligosaccharide-protein glycosyltransferase 338.02 90.17 0.103 119.03
523215 NDUFB8 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19 kDa 199.51 106.37 0.172 132.65
523238 NOLC1 Nucleolar and coiled-body phosphoprotein 1 176.02 83.34 0.138 97.37
523262 TMEM59 Transmembrane protein 59 262.49 95.63 0.069 168.88
523299 EIF3S10 Eukaryotic translation initiation factor 3, subunit 10 theta, 150/170 kDa 180.25 76.56 0.172 112.29
523302 PRDX3 Peroxiredoxin 3 948.84 182.31 0.138 83.94
523560 HSP90AA2 Heat shock protein 90 kDa alpha (cytosolic), class A member 2 971.87 81.16 0.000 822.83
523680 SSRP1 Structure specific recognition protein 1 259.94 67.23 0.138 128.11
523789 TncRNA Trophoblast-derived noncoding RNA 290.76 109.38 0.310 400.45
523829 POLD4 Polymerase (DNA-directed), delta 4 192.79 92.64 0.310 73.03
523836 GSTP1 Glutathione S-transferase pi 363.83 79.45 0.103 390.11
523852 CCND1 Cyclin D1 257.94 79.21 0.310 315.81
523875 INPPL1 Inositol polyphosphate phosphatase-like 1 198.48 82.78 0.310 52.62
524009 AASDHPPT Aminoadipate-semialdehyde dehydrogenase-phosphopantetheiny 139.83 74.10 0.345 73.36
transferase
524081 DPAGT1 Dolichyl-phosphate (UDP-N-acetylglucosamine) N- 125.85 78.99 0.345 43.70
acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase
524084 RNF26 Ring finger protein 26 170.50 95.60 0.310 45.76
524161 RSU1 Ras suppressor protein 1 173.91 80.13 0.276 81.94
524171 RAD52 RAD52 homolog (S. cerevisiae) 128.36 73.88 0.345 57.90
524183 FKBP4 FK506 binding protein 4, 59 kDa 345.04 165.12 0.138 195.27
524195 ARHGAP2 Rho GTPase activating protein 21 118.87 87.10 0.379 102.62
524214 MLF2 Myeloid leukemia factor 2 271.91 68.75 0.138 109.61
524219 TPI1 Triosephosphate isomerase 1 1085.58 88.77 0.069 928.11
524271 PHC2 Polyhomeotic-like 2 (Drosophila) 333.79 105.07 0.138 59.03
524367 CBARA1 Calcium binding atopy-related autoantigen 1 133.75 65.29 0.207 95.25
524395 TUBA1A Tubulin, alpha 1a 423.08 127.26 0.241 779.97
524464 ATP5G2 ATP synthase, H+ transporting, mitochondrial F0 complex, subuni 300.01 124.98 0.172 295.35
c (subunit 9), isoform 2
524502 RNF41 Ring finger protein 41 110.38 68.59 0.241 55.12
524530 CTDSP2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A 286.91 136.97 0.103 54.40
small phosphatase 2
524590 RAB21 RAB21, member RAS oncogene family 112.13 48.40 0.379 39.33
524599 NAP1L1 60S ribosomal protein L6 (RPL6A) 559.97 99.14 0.034 179.39
524690 PPIE Peptidylprolyl isomerase E (cyclophilin E) 224.33 109.34 0.207 60.86
524788 RAB35 RAB35, member RAS oncogene family 97.18 65.96 0.379 47.40
524809 CLIP1 CAP-GLY domain containing linker protein 1 121.91 90.76 0.345 71.42
524899 SAP18 Sin3-associated polypeptide, 18 kDa 129.03 72.41 0.172 89.47
524920 ZFP91 Zinc finger protein 91 homolog (mouse) 128.10 83.51 0.207 99.40
524969 UFM1 Ubiquitin-fold modifier 1 172.41 84.47 0.310 85.23
525134 POMGNT1 Protein O-linked mannose beta1,2-N- 161.82 102.74 0.345 77.25
acetylglucosaminyltransferase
525163 ANKRD10 Ankyrin repeat domain 10 156.22 79.59 0.207 92.10
525232 LRP10 Low density lipoprotein receptor-related protein 10 201.98 129.16 0.138 71.88
525238 C14orf119 Chromosome 14 open reading frame 119 141.96 104.26 0.276 130.29
525330 ARF6 ADP-ribosylation factor 6 191.66 134.63 0.103 129.69
525391 C1orf123 Chromosome 1 open reading frame 123 98.24 87.20 0.310 44.15
525527 RER1 RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae) 137.56 72.32 0.310 57.33
525626 PACS2 Phosphofurin acidic cluster sorting protein 2 126.74 98.42 0.345 36.14
525899 C6orf49 Chromosome 6 open reading frame 49 144.67 83.87 0.172 114.56
526464 PML Promyelocytic leukemia 129.51 84.95 0.345 75.33
526521 MDH1 Malate dehydrogenase 1, NAD (soluble) 414.98 150.61 0.103 302.75
527105 HNRPDL Heterogeneous nuclear ribonucleoprotein D-like 215.39 95.16 0.207 425.77
527193 RPS23 Ribosomal protein S23 178.23 128.51 0.207 1153.32
527348 AKAP9 A kinase (PRKA) anchor protein (Yotiao) 9 103.64 60.76 0.310 39.34
527412 ASAH1 N-acylsphingosine amidohydrolase (acid ceramidase) 1 216.47 95.28 0.241 124.23
527861 OS9 Amplified in osteosarcoma 317.55 151.86 0.138 157.27
527862 PKD1 Hypothetical protein LOC339047 142.25 87.72 0.345 135.27
527980 DUT DUTP pyrophosphatase 150.77 79.02 0.207 96.02
528050 HARS Histidyl-tRNA synthetase 171.62 84.32 0.138 39.25
528222 NDUFS4 NADH dehydrogenase (ubiquinone) Fe—S protein 4, 18 kDa 112.10 94.04 0.276 72.79
(NADH-coenzyme Q reductase)
528300 PITRM1 Pitrilysin metallopeptidase 1 122.00 61.07 0.276 46.35
528305 DDX17 DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 298.20 91.95 0.138 235.95
528572 SORBS3 Sorbin and SH3 domain containing 3 187.70 104.57 0.345 62.31
528668 RPL6 Ribosomal protein L6 1037.68 85.03 0.034 572.62
528780 GSPT1 G1 to S phase transition 1 170.88 56.71 0.138 73.97
528803 UQCRC2 Ubiquinol-cytochrome c reductase core protein II 272.39 84.82 0.103 118.93
529059 EIF3S4 Eukaryotic translation initiation factor 3, subunit 4 delta, 44 kDa 311.33 92.44 0.172 112.54
529132 SEPW1 Selenoprotein W, 1 231.08 110.89 0.276 115.82
529244 NCK2 NCK adaptor protein 2 236.70 169.13 0.345 42.17
529280 ANAPC7 Anaphase promoting complex subunit 7 94.04 52.31 0.379 51.63
529303 ARPC2 Actin related protein ⅔ complex, subunit 2, 34 kDa 329.77 127.35 0.034 204.04
529369 AFAP1 Actin filament associated protein 1 101.03 56.96 0.379 54.85
529400 IFNAR1 Interferon (alpha, beta and omega) receptor 1 108.71 56.53 0.310 76.16
529420 UBE2G2 Ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast) 160.64 100.65 0.103 928.90
529591 TLOC1 Translocation protein 1 141.82 65.80 0.172 80.62
529618 TFRC Transferrin receptor (p90, CD71) 212.76 85.52 0.241 89.51
529631 RPL35A Ribosomal protein L35a 453.58 173.13 0.103 891.99
529782 VCP Valosin-containing protein 532.58 85.03 0.034 173.75
529798 BTF3 Basic transcription factor 3 400.11 94.96 0.069 270.43
529862 CSNK1A1 Casein kinase 1, alpha 1 210.72 69.09 0.103 102.92
529890 CANX Calnexin 399.31 129.28 0.069 448.92
529892 SQSTM1 Sequestosome 1 789.12 108.86 0.034 194.96
529957 SEC63 SEC63-like (S. cerevisiae) 120.12 80.80 0.276 70.58
530096 EIF3S2 Eukaryotic translation initiation factor 3, subunit 2 beta, 36 kDa 451.94 86.61 0.034 284.86
530118 LUC7L2 LUC7-like 2 (S. cerevisiae) 132.76 59.55 0.172 74.65
530291 ANXA11 Annexin A11 279.25 86.71 0.069 75.64
530314 SSNA1 Sjogren's syndrome nuclear autoantigen 1 122.20 58.54 0.379 75.26
530331 PDHA1 Pyruvate dehydrogenase (lipoamide) alpha 1 179.99 79.37 0.207 104.89
530381 PIM3 Pim-3 oncogene 114.61 72.86 0.345 42.02
530412 SERBP1 SERPINE1 mRNA binding protein 1 289.56 66.47 0.069 569.26
530436 STXBP3 Syntaxin binding protein 3 113.84 77.40 0.276 71.84
530479 PMF1 Polyamine-modulated factor 1 128.35 73.53 0.241 60.22
530687 RNH1 Ribonuclease/angiogenin inhibitor 1 342.47 102.27 0.172 126.29
530734 MRPL16 Mitochondrial ribosomal protein L16 106.22 67.89 0.345 48.51
530753 C11orf59 Chromosome 11 open reading frame 59 153.75 63.46 0.276 132.79
530823 COPS7A COP9 constitutive photomorphogenic homolog subunit 7A 202.70 132.83 0.138 52.43
(Arabidopsis)
530862 PRKAG1 Protein kinase, AMP-activated, gamma 1 non-catalytic subunit 136.75 73.16 0.241 38.26
531081 LGALS3 Lectin, galactoside-binding, soluble, 3 (galectin 3) 318.01 134.08 0.241 403.19
531089 PSMA3 Proteasome (prosome, macropain) subunit, alpha type, 3 218.40 93.16 0.276 54.35
531176 SARS Seryl-tRNA synthetase 297.55 88.08 0.138 137.35
531330 CBWD1 COBW domain containing 2 123.09 79.22 0.310 125.23
531614 BTBD14B BTB (POZ) domain containing 14B 123.09 63.39 0.310 79.33
531752 RANBP3 RAN binding protein 3 122.49 64.65 0.310 44.32
531856 GAS5 Growth arrest-specific 5 227.80 134.55 0.241 609.96
531876 DYNLRB1 Dynein, light chain, roadblock-type 1 167.51 104.22 0.241 122.79
531879 RAD1 RAD1 homolog (S. pombe) 115.15 74.02 0.379 58.80
532359 RPL5 Ribosomal protein L5 747.39 72.96 0.000 682.59
532399 ZC3H11A Zinc finger CCCH-type containing 11A 139.50 74.48 0.241 64.34
532755 C16orf80 Chromosome 16 open reading frame 80 95.17 63.38 0.207 37.29
532790 NMT1 N-myristoyltransferase 1 165.97 105.96 0.172 94.43
532793 KPNB1 Karyopherin (importin) beta 1 568.94 129.62 0.000 88.10
532803 HN1 Hematological and neurological expressed 1 225.82 90.89 0.103 218.39
532826 MCL1 Myeloid cell leukemia sequence 1 (BCL2-related) 252.48 83.80 0.207 221.93
532853 NDUFB7 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18 kDa 145.80 84.03 0.345 150.66
533030 TRIOBP TRIO and F-actin binding protein 339.95 148.19 0.207 108.55
533059 TUBB Tubulin, beta polypeptide 2476.41 87.07 0.000 423.10
533122 SFRS10 Splicing factor, arginine/serine-rich 10 (transformer 2 homolog, 182.52 60.97 0.034 111.10
Drosophila)
533136 LRPAP1 Low density lipoprotein receptor-related protein associated protein 1 234.76 108.38 0.207 119.75
533192 TOMM20 Translocase of outer mitochondrial membrane 20 homolog (yeast) 208.87 77.43 0.138 133.51
533222 DIMT1L DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) 129.17 69.14 0.379 42.41
533245 DDX46 DEAD (Asp-Glu-Ala-Asp) box polypeptide 46 118.53 50.97 0.345 51.51
533282 NONO Non-POU domain containing, octamer-binding 842.92 104.94 0.034 184.07
533308 PPP2R5D Protein phosphatase 2, regulatory subunit B (B56), delta isoform 223.23 100.62 0.138 47.46
533317 VIM Vimentin 1800.81 137.19 0.069 658.72
533437 TCEB1 Transcription elongation factor B (SIII), polypeptide 1 (15 kDa, 121.08 94.03 0.276 103.33
elongin C)
533440 WWP1 WW domain containing E3 ubiquitin protein ligase 1 146.51 87.93 0.345 60.09
533474 PPP1R8 Protein phosphatase 1, regulatory (inhibitor) subunit 8 95.08 118.26 0.379 50.60
533479 LYPLA2 Lysophospholipase II 223.79 59.26 0.276 107.17
533526 ATRX Alpha thalassemia/mental retardation syndrome X-linked (RAD54 149.83 61.38 0.276 73.22
homolog, S. cerevisiae)
533624 H3F3A H3 histone, family 3A 322.44 81.23 0.103 986.85
533712 RBM4 RNA binding motif protein 4 169.22 66.18 0.138 54.47
533732 SRP14 Signal recognition particle 14 kDa (homologous Alu RNA binding 223.87 85.87 0.172 350.32
protein)
533771 STUB1 STIP1 homology and U-box containing protein 1 238.45 84.03 0.241 74.01
533782 KRT8 Keratin 8 1307.25 94.61 0.379 1096.00
533977 TXNIP Thioredoxin interacting protein 429.73 92.27 0.034 105.46
533985 EXOC7 Exocyst complex component 7 168.92 93.23 0.276 83.81
533986 ZMYM6 Zinc finger, MYM-type 6 99.16 62.99 0.310 42.97
534125 HLA-C Major histocompatibility complex, class I, C 610.10 155.80 0.034 477.32
534168 NDUFA1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5 kDa 261.51 202.07 0.310 304.79
534212 SEC22B SEC22 vesicle trafficking protein homolog B (S. cerevisiae) 107.96 68.79 0.379 57.75
534255 B2M Beta-2-microglobulin 1303.98 172.16 0.000 2594.12
534307 CCND3 Cyclin D3 471.76 356.89 0.207 49.64
534314 EIF5A Eukaryotic translation initiation factor 5A 438.38 88.29 0.207 745.09
534326 ITGB4BP Integrin beta 4 binding protein 360.06 78.91 0.103 132.91
534338 PPP4C Protein phosphatase 4 (formerly X), catalytic subunit 191.52 75.42 0.138 85.04
534346 RPS7 Ribosomal protein S7 572.81 120.27 0.000 458.06
534350 SMARCB1 SWI/SNF related, matrix associated, actin dependent regulator of 210.96 162.57 0.172 56.06
chromatin, subfamily b, member 1
534453 NDUFA13 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13 194.91 119.87 0.138 355.30
534456 ANAPC11 APC11 anaphase promoting complex subunit 11 homolog (yeast) 164.01 99.17 0.172 159.17
534457 C14orf166 Chromosome 14 open reading frame 166 171.37 66.04 0.138 73.01
534473 TOMM22 Translocase of outer mitochondrial membrane 22 homolog (yeast) 144.72 100.10 0.207 64.20
534483 PHF23 PHD finger protein 23 123.34 63.04 0.276 43.74
536275 PACS1 Phosphofurin acidic cluster sorting protein 1 217.82 86.00 0.345 46.64
541269 NDUFB9 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22 kDa 269.72 132.31 0.172 420.59
546248 CTSD Cathepsin D (lysosomal aspartyl peptidase) 660.73 119.52 0.103 104.98
546250 DYNC1I2 Dynein, cytoplasmic 1, intermediate chain 2 154.54 71.13 0.172 166.85
546253 FDFT1 Farnesyl-diphosphate farnesyltransferase 1 249.53 81.90 0.034 124.83
546261 HNRPA1 Heterogeneous nuclear ribonucleoprotein A1 649.46 94.55 0.000 470.61
546269 RPL10A Ribosomal protein L10a 706.14 175.46 0.103 1748.03
546271 PCBP2 Poly(rC) binding protein 2 293.34 87.15 0.103 451.52
546286 RPS3 Ribosomal protein S3 2290.87 95.60 0.000 1021.82
546289 RPS12 Ribosomal protein S12 527.74 281.85 0.103 1459.28
546290 RPS18 Ribosomal protein S18 939.29 233.81 0.069 1853.80
546291 RPS27 Ribosomal protein S27 (metallopanstimulin 1) 725.59 382.56 0.172 55.70
546339 C11orf58 Chromosome 11 open reading frame 58 580.69 190.75 0.138 99.65
546356 RPL13A Ribosomal protein L13a 1352.43 84.32 0.000 3663.74
546394 CCDC72 Coiled-coil domain containing 72 244.28 200.01 0.241 175.77
547759 SSBP3 Single stranded DNA binding protein 3 124.35 57.76 0.310 76.79
549178 C9orf86 Chromosome 9 open reading frame 86 219.13 114.79 0.138 106.75
552590 HTF9C HpaII tiny fragments locus 9C 107.24 77.34 0.276 37.92
553496 PGM3 Phosphoglucomutase 3 103.08 61.39 0.379 48.42
553512 MBOAT5 Membrane bound O-acyltransferase domain containing 5 124.81 75.10 0.310 81.43
554767 NUP88 Nucleoporin 88 kDa 120.01 86.75 0.345 41.31
554776 SREBF1 Sterol regulatory element binding transcription factor 1 171.91 88.02 0.276 65.79
554894 WDR54 WD repeat domain 54 114.62 72.99 0.345 48.56
554896 C7orf50 Chromosome 7 open reading frame 50 193.18 101.69 0.207 156.46
555194 FAM36A Family with sequence similarity 36, member A 120.40 52.67 0.276 115.74
555866 C1QBP Complement component 1, q subcomponent binding protein 312.33 77.95 0.138 179.94
555873 HNRPAB Heterogeneous nuclear ribonucleoprotein A/B 316.21 89.74 0.034 87.52
555875 IDH3A Isocitrate dehydrogenase 3 (NAD+) alpha 143.01 87.51 0.345 43.03
555889 PSMC2 Proteasome (prosome, macropain) 26S subunit, ATPase, 2 219.37 69.24 0.172 67.04
555890 RBBP4 Retinoblastoma binding protein 4 204.72 80.47 0.172 148.13
555911 RBM8A RNA binding motif protein 8A 125.26 75.03 0.172 110.86
555969 RIC8A Resistance to inhibitors of cholinesterase 8 homolog A (C. elegans) 261.31 93.56 0.172 42.50
555971 TMBIM1 Transmembrane BAX inhibitor motif containing 219.28 114.17 0.207 100.55
555973 MRPS25 Mitochondrial ribosomal protein S25 152.15 62.00 0.207 47.22
555994 LONP2 Ion peptidase 2, peroxisomal 135.95 87.69 0.379 37.87
556267 FBXL10 F-box and leucine-rich repeat protein 10 81.84 65.86 0.379 39.65
556461 NDUFV2 NADH dehydrogenase (ubiquinone) flavoprotein 2, 24 kDa 146.86 108.59 0.207 99.23
556795 PAICS Phosphoribosylaminoimidazole carboxylase, 253.76 89.34 0.138 122.76
phosphoribosylaminoimidazole succinocarboxamide synthetase
557550 NPM1 Nucleophosmin (nucleolar phosphoprotein B23, numatrin) 1675.95 168.64 0.000 707.78
558296 ACP1 Acid phosphatase 1, soluble 123.81 58.79 0.172 76.31
558313 COX6A1 Cytochrome c oxidase subunit VIa polypeptide 1 170.58 93.53 0.241 268.12
558322 EEF1B2 Eukaryotic translation elongation factor 1 beta 2 450.71 94.79 0.034 725.93
558325 EIF5 Eukaryotic translation inititation factor 5 232.38 85.09 0.172 121.20
558328 FKBP5 FK506 binding protein 5 117.84 59.52 0.310 88.77
558330 FTL Ferritin, light polypeptide 2521.41 158.72 0.069 1268.35
558338 HSPE1 Heat shock 10 kDa protein 1 (chaperonin 10) 270.37 133.18 0.207 259.73
558345 IK IK cytokine, down-regulator of HLA II 252.13 99.25 0.138 52.12
558354 RPSA Ribosomal protein SA 1322.76 86.38 0.034 2215.71
558360 NDUFB4 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15 kDa 211.99 145.77 0.345 213.80
558361 NME2 Non-metastatic cells 2, protein (NM23B) expressed in 300.76 113.65 0.276 377.22
558362 NUMA1 Nuclear mitotic apparatus protein 1 186.63 72.04 0.207 70.26
558376 RAC1 Ras-related C3 botulinum toxin substrate 1 (rho family, small GTP 310.27 151.23 0.000 423.24
binding protein Rac1)
558381 SNORA65 Small nucleolar RNA, H/ACA box 65 182.13 140.06 0.172 167.44
558382 RPL15 Ribosomal protein L15 675.76 128.40 0.000 247.73
558383 RPL18A Ribosomal protein L18a 705.56 175.27 0.034 1510.30
558384 RPL19 Ribosomal protein L19 526.89 137.15 0.034 913.52
558385 RPL23A Ribosomal protein L23a 699.13 138.42 0.069 591.06
558386 RPL34 Ribosomal protein L34 697.35 378.17 0.069 994.94
558388 RPS3A Ribosomal protein S3A 2474.40 122.86 0.034 1599.66
558389 RPS8 Ribosomal protein S8 962.64 129.92 0.000 1884.53
558390 RPS24 Ribosomal protein S24 612.43 101.36 0.034 1096.04
558391 RPS26 Ribosomal protein S26 165.48 119.11 0.276 1253.30
558396 SCD Stearoyl-CoA desaturase (delta-9-desaturase) 914.63 104.45 0.069 153.06
558424 CSDA Cold shock domain protein A 226.19 107.82 0.103 153.84
558426 EIF3S5 Eukaryotic translation initiation factor 3, subunit 5 epsilon, 47 kDa 303.80 92.52 0.172 111.38
558429 BUD31 BUD31 homolog (S. cerevisiae) 144.18 63.32 0.172 74.41
558431 RPL14 Ribosomal protein L14 572.84 76.90 0.069 374.90
558442 PDCD6IP Programmed cell death 6 interacting protein 197.37 92.14 0.241 62.39
558448 TXNL2 Thioredoxin-like 2 190.19 99.31 0.276 111.05
558453 ATP5L ATP synthase, H+ transporting, mitochondrial F0 complex, subunig 303.51 169.99 0.172 614.08
558454 NUDC Nuclear distribution gene C homolog (A. nidulans) 366.87 118.17 0.207 97.57
558458 COPS8 COP9 constitutive photomorphogenic homolog subunit 8 143.44 86.61 0.207 41.97
(Arabidopsis)
558473 C18orf10 Chromosome 18 open reading frame 10 143.75 80.47 0.172 66.89
558499 CD320 CD320 molecule 188.81 75.95 0.379 45.84
558511 PARL Presenilin associated, rhomboid-like 126.27 91.30 0.276 60.47
558521 C2orf33 Chromosome 2 open reading frame 33 133.19 79.12 0.241 84.37
558591 ORMDL1 ORM1-like 1 (S. cerevisiae) 156.16 85.13 0.345 92.26
558825 PDE4DIP Phosphodiesterase 4D interacting protein (myomegalin) 192.79 111.41 0.241 95.41
558995 C1orf151 Chromosome 1 open reading frame 151 718.64 244.03 0.103 115.01
567260 CD2BP2 CD2 antigen (cytoplasmic tail) binding protein 2 161.65 79.42 0.207 55.10
567263 C1orf43 Chromosome 1 open reading frame 43 337.41 80.70 0.172 106.63
567267 ATP2C1 ATPase, Ca++ transporting, type 2C, member 1 95.02 60.83 0.345 74.61
567279 SAP30BP SAP30 binding protein 178.67 103.35 0.207 55.83
SHORT Genomic Variants on Human
UniGene SAGE LONG SAGE Affymetrix Genome Assembly Build 36
cluster CV 0's P Mean CV 0's P Mean CV Variation Cytogen Locus ID
  120 77.57 0.000 182.28 77.83 0.000 536.31 44.78 CopyNumber 1q25.1 177
  142 78.94 0.036 83.00 75.28 0.000 CopyNumber 16p11.2 2900
  202 113.47 0.000 199.28 96.07 0.111 419.21 51.49
  429 82.18 0.000 551.21 81.48 0.000 865.18 43.60
  695 90.92 0.000 118.87 85.62 0.111 1052.98 100.96 CopyNumber 21q22.3 3455
  808 66.96 0.000 135.76 77.44 0.222 210.67 38.17
  861 107.22 0.000 36.11 50.87 0.222 127.15 87.08 CopyNumber 16p11.2 2903
 1063 67.18 0.036 100.31 75.40 0.222 194.60 33.14
 1103 111.80 0.036 125.52 97.41 0.111 106.24 57.23
 2430 80.01 0.071 47.30 88.89 0.222 218.15 32.90
 2533 77.46 0.071 74.01 77.57 0.111 354.31 47.43
 2795 95.03 0.000 259.59 82.14 0.111 2250.38 43.77
 2853 63.43 0.036 186.93 60.34 0.111 926.32 22.95
 3100 76.40 0.000 61.24 67.08 0.222 517.42 29.81
 3254 78.32 0.036 113.88 73.94 0.111 211.49 31.45 Inversion 11p15.5 2202
 3353 56.37 0.071 216.42 70.65 0.000 881.36 27.96
 3416 131.08 0.036 68.67 112.87 0.222 360.44 151.18 CopyNumber 9p22.1 1912
 3439 80.75 0.036 89.54 93.24 0.111 191.34 38.33
 3530 72.15 0.036 108.31 56.32 0.000 136.00 30.88
 3989 108.38 0.036 134.74 83.01 0.111 427.22 43.37
 4055 135.83 0.000 441.94 118.93 0.111 64.49 38.32
 4742 119.15 0.036 39.71 65.93 0.222 275.64 44.77 CopyNumber 8q24.3 1879
 4747 73.50 0.071 71.07 73.04 0.111 307.46 47.47
 4766 86.86 0.036 72.60 84.36 0.222 262.05 27.51
 4859 103.29 0.071 110.40 111.52 0.000 299.38 40.44
 4997 62.12 0.000 50.72 94.59 0.111 264.44 22.10
 4998 63.22 0.036 28.78 51.61 0.222 229.36 56.84
 5062 101.42 0.000 111.82 81.88 0.111 800.47 52.13 CopyNumber 15q24.3 2811
 5086 72.25 0.036 53.42 73.36 0.222 135.70 28.77
 5120 71.64 0.000 204.68 69.54 0.111 1158.59 29.63
 5158 67.54 0.000 138.55 60.73 0.111 383.95 36.39
 5245 74.90 0.000 80.69 73.69 0.000 219.54 21.60
 5258 84.40 0.071 133.74 77.92 0.111 589.76 55.05
 5268 78.70 0.000 46.25 73.83 0.111 113.40 37.54
 5298 59.08 0.000 58.54 49.70 0.111 296.11 31.82
 5308 83.81 0.000 479.50 73.38 0.000 2422.20 38.02
 5324 64.23 0.000 62.22 66.74 0.111 694.81 25.69
 5345 86.81 0.071 61.41 84.79 0.111 73.49 30.51 CopyNumber 2q37.3 515
 5662 87.26 0.000 651.22 57.10 0.000 2861.36 36.28
 5710 67.53 0.071 34.13 80.74 0.111 452.86 45.78
 5719 94.26 0.000 65.99 56.36 0.000 55.53 45.18 CopyNumber 12p13.31 2368
 5912 65.61 0.000 30.20 60.87 0.111 430.78 30.03
 5947 68.42 0.036 34.91 59.37 0.222 368.59 33.28
 6396 72.90 0.036 94.01 39.56 0.222 869.88 31.02
 6454 77.38 0.000 290.31 91.04 0.000 504.85 40.25 CopyNumber 19p13.12 3223
 6459 121.97 0.036 88.34 85.38 0.111 157.79 41.08 CopyNumber 8q24.3 1880
 6551 102.10 0.000 99.28 83.28 0.000 515.56 45.37
 6891 68.55 0.000 79.36 95.32 0.000 437.26 34.58
 7101 85.77 0.071 81.04 84.26 0.000 183.19 27.20
 7236 91.55 0.000 89.02 123.50 0.111 150.63 53.39 CopyNumber 19q13.33 3277
 7476 85.55 0.000 91.48 67.53 0.000 1250.83 39.30
 7527 92.63 0.036 52.36 54.01 0.222 97.43 36.93
 7744 85.28 0.000 77.42 71.13 0.000 415.46 37.27 CopyNumber 11q13.1-11q13.2 2278
 7753 136.12 0.000 138.00 85.95 0.111 100.65 48.84 CopyNumber 7q32.1 1639
 7768 65.21 0.000 63.80 65.95 0.111 269.17 27.39 CopyNumber 11q13.1 2276
 7862 74.15 0.036 84.67 63.85 0.111
 7910 72.05 0.036 78.63 65.90 0.111 153.70 42.23
 7917 78.00 0.000 135.78 112.82 0.111 661.73 52.63 CopyNumber 3p22.1 572
 8102 83.01 0.000 1410.01 75.01 0.000 4250.06 30.72
 8372 108.88 0.000 146.74 79.82 0.111 788.19 32.34
 8737 68.38 0.036 88.71 85.75 0.111 253.06 44.11
 8752 57.76 0.071 52.10 62.17 0.222 102.13 32.76 CopyNumber 12q13.2 2429
 8765 64.21 0.000 53.71 59.12 0.000 228.43 30.56
 8859 111.07 0.036 53.33 94.17 0.222 234.96 73.37
 8867 137.92 0.000 273.81 95.23 0.111 547.98 79.93
 9003 69.05 0.000 66.15 65.61 0.000 148.11 36.69
 9015 65.95 0.000 180.11 68.32 0.000
 9043 67.83 0.000 38.48 97.33 0.111 162.00 25.78
 9234 79.49 0.071 68.18 62.80 0.111 434.76 37.42
 9235 92.25 0.000 67.77 88.26 0.222 256.46 58.39
 9527 84.48 0.036 51.11 48.09 0.222 538.70 28.49
 9534 72.74 0.000 86.28 73.16 0.222 626.14 29.63
 9573 92.63 0.036 31.79 54.71 0.222 778.41 33.32
 9589 61.30 0.036 71.77 49.75 0.111 919.32 26.81
 9788 88.77 0.071 127.59 72.78 0.000 377.13 38.24
 9825 66.79 0.000 56.23 48.85 0.111 365.07 28.07
 9857 122.60 0.000 232.82 151.99 0.000 463.40 157.98
 10326 73.58 0.000 197.00 75.36 0.000 369.97 68.55
 10842 94.54 0.000 239.28 115.19 0.222 718.72 44.58
 10848 67.53 0.071 31.76 66.74 0.111 104.71 37.33 CopyNumber 10q11.21 2093
 11125 68.78 0.071 93.47 59.46 0.000 817.21 27.49
 11184 59.84 0.036 115.93 46.13 0.000 292.68 27.77 CopyNumber 9p13.3 1937
 11223 88.67 0.071 78.63 87.24 0.222 57.89 55.15
 11355 104.32 0.036 66.99 75.00 0.222 62.56 35.20
 11463 61.89 0.036 113.19 84.50 0.111 429.95 40.75
 12013 64.76 0.036 45.75 69.36 0.222 99.02 32.35
 12084 81.01 0.000 364.40 89.06 0.000 623.07 39.39 CopyNumber 16p11.2 2900
 12102 67.05 0.071 114.17 52.22 0.111 518.73 22.82 CopyNumber 6q21 1407
 12107 72.91 0.036 50.80 59.67 0.111 329.36 29.47
 12109 61.69 0.036 46.73 59.25 0.111 118.79 29.00 CopyNumber 2q11.2 378
 12144 73.94 0.071 41.87 82.28 0.222 162.21 31.04
 12152 79.55 0.036 58.29 64.64 0.222 30.47 58.95
 12272 64.89 0.071 48.28 64.28 0.111 236.82 29.21
 12341 71.85 0.000 80.90 63.60 0.222 646.53 35.91
 12457 60.75 0.036 41.32 44.32 0.222 141.28 35.86
 12865 77.51 0.036 56.10 68.14 0.111 161.87 24.52
 13662 73.45 0.071 42.54 82.56 0.111 286.77 29.53
 14317 85.06 0.000 210.81 76.29 0.111 707.56 30.56 CopyNumber 15q14 2760
 14333 93.92 0.000 49.69 65.95 0.222 52.91 32.36 CopyNumber 1p36.11 49
 14745 67.71 0.036 34.86 68.85 0.222 344.17 44.46
 14839 60.79 0.036 72.24 59.97 0.000 425.45 27.99 CopyNumber 11q12.3 2269
 14846 71.11 0.036 35.42 56.40 0.111 290.22 58.28
 14894 82.05 0.000 60.76 70.36 0.111 126.08 28.41
 15277 127.86 0.000 94.06 82.10 0.111 147.72 37.89 CopyNumber 16p13.3 2866
 15591 67.01 0.000 41.12 58.74 0.111 131.70 28.53 CopyNumber 7q22.1 1598
 15738 72.04 0.000 129.69 48.46 0.111 417.14 23.56
 16059 66.35 0.000 71.91 74.39 0.111 679.76 46.08
 16130 62.56 0.036 43.34 61.70 0.222 18.64 94.29 CopyNumber 17q25.1 3075
 16349 59.57 0.071 31.68 64.66 0.222 148.04 24.93 CopyNumber 16q23.2 2956
 17118 62.14 0.071 46.03 69.29 0.111 213.73 40.31 CopyNumber 1p34.3 58
 17250 79.64 0.071 117.82 78.92 0.111 294.70 33.94
 17680 73.53 0.071 48.01 54.77 0.111 516.93 33.95 CopyNumber 6q24.2 1437
 17731 70.13 0.000 29.51 60.36 0.111 520.71 54.10
 17883 65.60 0.000 135.33 70.28 0.000 114.89 33.02
 18069 90.49 0.036 63.83 85.91 0.111 211.65 49.02
 18128 74.70 0.036 28.66 43.42 0.222 141.00 37.06 CopyNumber 20q11.22 3366
 18349 74.07 0.036 49.61 83.49 0.222 300.87 45.97
 19673 80.92 0.071 95.67 73.57 0.222 562.71 37.51 CopyNumber 8q24.3 1879
 20013 65.84 0.000 62.25 52.78 0.000 173.94 35.93 CopyNumber 1p36.11 48
 20107 96.88 0.036 39.46 139.41 0.222 175.52 41.33 CopyNumber 14q32.33 2746
 20157 77.35 0.036 59.44 87.93 0.222 376.62 32.83
 20521 94.01 0.000 152.96 89.93 0.111 383.24 40.81 CopyNumber 19q13.33 3277
 20529 69.78 0.071 39.76 53.17 0.222 749.10 34.18 CopyNumber 1p36.32 11
 20573 67.85 0.000 81.56 153.79 0.111 23.55 41.49
 20716 71.00 0.036 66.00 55.65 0.222 276.11 36.03 CopyNumber 1q32.1 209
 22393 64.62 0.036 63.67 82.21 0.222 228.15 33.72
 22543 56.69 0.036 63.96 65.55 0.222 34.14 49.75
 22546 71.92 0.036 42.45 98.37 0.222 651.22 63.93 CopyNumber 11q12.2 2266
 22616 75.10 0.071 35.69 58.10 0.222 144.92 52.15 CopyNumber 17p13.3 2978
 23033 58.71 0.071 39.15 53.57 0.222 341.82 43.42
 23111 77.82 0.071 52.47 83.58 0.222 105.11 33.54 CopyNumber 19p13.13 3220
 23978 66.48 0.036 58.25 63.84 0.222 128.24 28.55
 24301 143.33 0.036 116.94 59.98 0.111 286.08 26.26 CopyNumber 19p13.3 3198
 24379 89.22 0.000 90.75 71.03 0.000 479.98 29.85
 24601 136.75 0.000 195.56 129.74 0.222 34.60 49.50 CopyNumber 22q13.31 3508
 24950 186.79 0.071 189.81 135.70 0.222 307.39 104.91
 25155 120.45 0.071 52.76 77.03 0.222 204.80 58.51
 25450 206.58 0.036 103.43 106.19 0.222 124.80 61.30
 25723 98.01 0.036 74.46 92.32 0.111 204.78 31.78
 26010 107.96 0.036 71.92 87.71 0.111 127.90 44.05 CopyNumber 10p15.2-10p15.3 2038
 26023 71.18 0.036 27.14 63.42 0.222 32.41 34.48
 26136 64.61 0.000 126.52 71.60 0.000 1187.97 29.30
 26232 90.53 0.071 26.46 93.62 0.222 122.41 30.42
 26403 79.12 0.036 49.19 87.28 0.222 49.29 121.55
 26518 108.83 0.036 82.68 57.69 0.111 145.35 56.07 CopyNumber 11p15.5 2200
 27222 70.07 0.036 92.82 77.94 0.111 408.36 36.92
 28491 110.80 0.000 366.05 99.16 0.000 1987.13 39.05
 28914 124.19 0.036 75.99 55.29 0.111 172.22 38.11 CopyNumber 16q24.3 2971
 29203 106.14 0.000 45.04 65.31 0.111 60.43 48.50 CopyNumber 16p13.3 2866
 29665 99.16 0.036 72.28 88.66 0.111 350.56 37.72
 30011 81.69 0.071 81.96 82.93 0.222 133.44 28.49 CopyNumber 17p13.3-17p13.2 2981
 30026 86.33 0.000 93.91 62.29 0.111 123.60 30.35 CopyNumber 1p36.33 0003
 30345 88.62 0.000 124.96 92.01 0.222 262.70 34.03
 30954 68.95 0.000 33.38 69.19 0.222 151.11 40.16
 31053 81.65 0.000 122.44 66.60 0.111 341.88 36.28 CopyNumber 19q13.12 3250
 31334 61.03 0.036 78.51 49.15 0.111 134.99 47.91 CopyNumber 20q13.33 3420
 31387 84.87 0.000 46.14 75.32 0.222 173.71 43.22
 34045 74.24 0.071 45.53 64.82 0.111 117.61 48.58
 34576 64.28 0.036 73.10 58.20 0.000 402.96 28.27 CopyNumber 7p15.2 1525
 34906 68.64 0.071 61.99 53.16 0.111 625.46 46.98
 35052 57.78 0.000 362.25 60.57 0.000 855.32 36.18
 35828 62.01 0.000 45.72 60.60 0.222 108.48 23.16 CopyNumber 14q32.33 2744
 36587 71.83 0.000 30.96 65.30 0.222 179.98 30.62
 36927 121.45 0.000 211.50 111.53 0.222 291.25 56.92
 37616 95.13 0.036 111.55 102.44 0.000 164.13 70.51
 37916 76.45 0.036 73.92 86.57 0.000 160.38 37.39 CopyNumber 9q34.3 2030
 42806 98.22 0.071 67.92 66.52 0.222 113.20 27.89 CopyNumber 1p36.33 0002
 43297 62.31 0.036 167.46 70.07 0.000
 47062 81.09 0.000 51.75 59.62 0.111 279.70 38.81 CopyNumber 19q13.12 3250
 50098 97.25 0.000 197.41 66.02 0.111 889.01 34.95
 50308 69.01 0.071 64.21 68.46 0.111 590.61 33.23 CopyNumber 4p14 824
 50425 59.02 0.000 452.95 56.90 0.000 981.84 28.48
 53066 89.79 0.036 84.91 123.45 0.222 86.87 42.17
 54277 70.86 0.036 96.39 65.47 0.222 198.46 29.56
 54457 101.21 0.000 70.72 79.45 0.111 1276.93 35.83
 54642 66.57 0.036 50.30 60.80 0.222 504.88 34.60
 54649 62.12 0.000 39.30 61.93 0.222 114.82 27.65
 55682 77.92 0.000 55.77 52.38 0.111 1742.75 35.36 CopyNumber 22q12.3 3492
 55847 133.75 0.000 127.47 77.36 0.222 1589.77 32.09 CopyNumber 12p13.31 2368
 58488 91.55 0.000 55.35 57.10 0.222 204.60 74.27
 58992 99.33 0.036 54.95 72.92 0.000 19.90 46.40 CopyNumber 19q13.2 3258
 59486 80.61 0.000 36.11 94.51 0.222 125.78 61.69
 61812 62.20 0.036 81.03 52.93 0.222 163.53 35.91
 65234 85.90 0.000 45.56 51.74 0.111 230.78 28.28
 65238 74.65 0.036 76.11 68.06 0.111 138.90 30.03 CopyNumber 16p11.2 2904
 66048 75.95 0.000 37.75 57.98 0.111 62.79 37.57 CopyNumber 19p13.11 3229
 66915 138.86 0.071 97.34 71.78 0.222 1098.67 81.32
 68714 72.45 0.000 52.63 57.22 0.222 320.40 27.38
 69293 98.44 0.071 85.35 81.08 0.000 585.49 38.47
 69554 69.56 0.036 55.49 73.57 0.111 83.68 28.75
 69855 188.78 0.000 305.44 48.54 0.000 727.35 25.99
 71465 105.85 0.071 66.00 78.37 0.222 243.96 77.49
 71787 77.93 0.071 83.49 81.21 0.222 200.16 37.18
 73527 70.51 0.071 124.08 51.87 0.111 583.61 28.44
 73722 85.72 0.000 261.97 71.05 0.000 463.11 27.57
 73799 65.89 0.071 58.08 66.99 0.000 377.98 28.45
 73965 70.12 0.000 283.48 68.03 0.000 235.15 31.88
 74047 87.12 0.071 30.09 43.70 0.222 43.44 43.38
 74050 65.00 0.000 50.61 69.46 0.222 85.49 33.47
 74137 67.80 0.036 162.33 96.54 0.000 765.38 31.85
 74375 80.65 0.000 94.05 93.83 0.222 79.06 34.15 CopyNumber 1p36.33 2
 74405 70.95 0.000 376.04 102.24 0.000 1073.13 29.89 CopyNumber 2p25.1 280
 74471 146.61 0.000 820.91 82.84 0.222 309.99 88.83
 74563 91.47 0.000 161.30 79.91 0.000 220.82 27.96
 74564 86.90 0.071 98.67 73.67 0.222 853.95 35.62
 74576 103.63 0.036 206.54 105.86 0.111 372.42 51.84
 75056 95.92 0.036 196.13 70.63 0.000 175.01 40.98
 75061 134.90 0.036 139.52 106.48 0.222 694.54 68.77
 75066 57.57 0.071 59.08 75.04 0.222 49.39 28.04
 75087 78.42 0.000 102.46 73.16 0.111 222.76 28.01 CopyNumber 7q36.1 1667
 75117 68.05 0.000 108.92 67.92 0.222 298.96 40.82
 75133 90.78 0.036 33.87 52.50 0.222
 75139 77.20 0.071 32.14 56.90 0.111 265.49 32.96
 75189 71.71 0.036 88.49 96.81 0.111 273.22 47.07
 75227 98.77 0.000 103.41 83.59 0.111 330.85 41.09
 75243 86.87 0.000 163.16 69.12 0.000 306.90 30.86 CopyNumber 6p21.32 1316
 75249 79.25 0.036 72.48 58.84 0.111 451.23 40.81 CopyNumber 16p12.3 2889
 75254 85.88 0.036 35.63 92.11 0.222 167.60 35.94 CopyNumber 19q13.33 3277
 75318 107.17 0.071 47.29 77.96 0.222 245.52 63.96
 75348 83.65 0.000 90.61 53.97 0.000 742.51 27.52
 75438 135.05 0.071 104.15 222.79 0.111 241.61 96.64
 75527 75.11 0.036 50.93 81.60 0.222 188.80 30.23
 75724 72.09 0.000 117.37 63.92 0.000 284.42 34.05
 75798 66.34 0.000 46.25 98.54 0.111 132.09 26.63
 75841 67.70 0.036 111.03 66.56 0.222 697.12 38.13
 75890 63.35 0.071 55.70 53.32 0.222 192.57 34.39
 75914 75.69 0.000 149.78 60.21 0.111 998.68 31.35 CopyNumber 12q24.31 2518
 76111 74.32 0.036 91.80 91.74 0.222 349.38 32.91
 76394 97.13 0.071 85.81 54.54 0.111 723.48 75.27 CopyNumber 10q26.3 2199
 76480 72.15 0.071 42.20 50.89 0.222 107.11 31.94
 76662 75.63 0.071 39.52 102.23 0.222 371.15 30.57
 76686 89.86 0.000 260.60 79.93 0.111 786.14 45.48
 76847 66.20 0.000 156.31 84.21 0.111 534.34 30.42 CopyNumber 11q12.3 2268
 77060 84.28 0.000 108.25 74.95 0.111 304.90 32.72 CopyNumber 17p13.2 2984
 77269 77.93 0.000 395.01 92.11 0.000 212.81 53.48 CopyNumber 3p21.31 586
 77313 109.12 0.036 102.72 140.65 0.000 74.75 36.55 CopyNumber 16q24.3 2973
 77422 91.72 0.000 60.73 89.20 0.111 377.17 61.65 Inversion Xp11.23 3552
 77558 84.61 0.000 101.75 71.51 0.111 662.90 46.96
 77578 77.49 0.000 102.87 121.76 0.222 171.09 31.33
 77793 72.60 0.000 34.98 96.71 0.222 170.28 52.53
 77897 69.16 0.071 111.11 71.27 0.000 112.01 24.87
 77961 169.44 0.000 823.99 124.02 0.000 4899.68 43.03 CopyNumber 6p21.33 1313
 77978 75.97 0.000 91.06 68.25 0.111 264.14 34.17
 78466 105.76 0.000 115.24 59.35 0.111 296.95 45.96
 78601 74.95 0.036 60.03 61.28 0.000 209.16 29.30
 78771 85.53 0.000 445.96 90.90 0.000 1179.63 41.05 CopyNumber Xq21.1 3567
 78880 89.08 0.036 41.08 84.35 0.222 167.42 38.32 CopyNumber 19p13.12 3225
 78888 111.41 0.036 130.51 70.31 0.000 1459.58 43.93
 78989 75.96 0.000 94.26 93.28 0.000 363.83 37.58
 79064 65.62 0.071 37.14 60.46 0.222 93.49 36.45
 79081 93.36 0.036 167.72 99.22 0.111 499.05 34.22
 79088 81.96 0.000 99.08 109.91 0.222 156.03 53.20 CopyNumber 15q24.3 2811
 79101 141.29 0.071 153.49 137.97 0.111 444.07 49.53
 79110 86.13 0.036 372.48 77.25 0.000 913.17 31.25
 79322 74.35 0.036 132.17 60.84 0.000 691.01 34.62
 79335 73.95 0.036 64.11 77.17 0.222 67.72 31.29
 79387 62.64 0.000 149.41 65.96 0.111 377.33 28.18
 79402 69.22 0.036 42.24 54.66 0.111 237.05 27.80
 79411 67.91 0.000 66.14 69.85 0.222 231.21 28.82
 79625 136.24 0.000 189.30 141.24 0.222 1792.59 46.21 CopyNumber 20q13.33 3419
 80545 88.80 0.000 3675.93 53.49 0.000 8897.81 33.60
 80919 76.35 0.036 67.97 78.25 0.111 313.08 32.42
 80986 120.32 0.000 219.34 96.44 0.000 231.11 44.42 CopyNumber 17q21.32 3034
 81328 217.63 0.036 729.78 176.26 0.000 845.91 66.53
 81424 60.84 0.000 178.67 63.11 0.222 343.25 25.72
 81848 71.54 0.071 108.12 78.45 0.222 261.11 47.46
 81964 75.88 0.071 37.25 88.70 0.222 173.27 38.81
 82201 64.48 0.071 52.80 63.18 0.222 227.05 31.28
 82327 80.48 0.000 34.79 79.12 0.222 199.40 38.88 CopyNumber 20q11.22 3365
 82719 66.25 0.071 23.77 44.79 0.111 85.74 30.33
 82793 128.02 0.036 83.47 68.72 0.222 611.12 45.54
 82887 77.92 0.071 29.21 62.08 0.222 470.22 22.27
 82890 66.89 0.000 89.92 89.16 0.111 541.67 28.47
 82916 94.85 0.000 244.03 94.29 0.000 218.30 42.67
 82927 105.59 0.036 43.00 75.49 0.222 123.23 36.72
 83190 182.78 0.036 211.86 121.95 0.222 263.79 128.00
 83347 69.02 0.036 71.54 56.24 0.000 154.79 25.38
 83383 84.31 0.036 68.79 80.95 0.111 617.70 83.89
 83734 69.26 0.071 53.32 60.39 0.000 140.82 29.73 CopyNumber 16p11.2 2905
 83753 88.26 0.000 302.30 80.76 0.111 314.59 48.19 CopyNumber 20p13 3302
 83765 85.58 0.071 65.48 111.40 0.222 99.10 47.99 CopyNumber 5q14.1 1155
 83916 87.67 0.000 53.16 106.27 0.222 192.48 51.98
 84359 91.88 0.000 190.01 97.99 0.111 1358.12 25.26
 84753 105.87 0.036 215.33 92.76 0.222 92.58 76.88
 85155 135.45 0.000 398.59 101.28 0.111 463.10 46.79
 85769 68.76 0.036 46.70 56.56 0.111 203.84 26.22
 85962 84.29 0.071 75.97 60.72 0.222 14.60 66.14
 86131 79.74 0.036 38.81 70.54 0.222 91.70 50.98
 87752 96.06 0.000 186.51 80.13 0.111 86.54 36.98
 89545 67.58 0.000 183.77 60.61 0.111 631.69 33.52 CopyNumber 1q21.2- 152
 89643 142.36 0.000 365.70 117.06 0.111 120.47 36.69
 89649 104.25 0.000 82.36 107.95 0.111 606.74 180.62
 89781 68.82 0.000 113.28 69.11 0.111 494.30 21.89 CopyNumber 17q21.31 3026
 89864 114.71 0.071 29.48 76.43 0.222 163.77 23.54 CopyNumber 6p21.32 1314
 90061 83.92 0.036 91.42 74.05 0.222 651.40 42.91
 90093 92.05 0.036 105.16 101.89 0.222 155.51 38.77
 90107 77.30 0.000 83.77 71.73 0.111 271.86 37.65 CopyNumber 20q13.33 3417
 90443 101.63 0.000 70.31 56.02 0.222 263.10 39.12 CopyNumber 11q13.2 2278
 91142 77.58 0.000 202.64 43.73 0.000 163.39 35.82
 91531 96.12 0.071 80.15 95.45 0.111 637.99 34.78
 93659 83.46 0.000 155.28 76.20 0.111 167.42 46.25
 93832 74.43 0.000 74.64 79.56 0.222 186.80 32.78
 95577 87.03 0.071 71.04 85.81 0.222 371.35 99.75
 96530 62.70 0.000 32.79 68.25 0.222 65.51 38.27 CopyNumber 17q22 3042
 96852 64.09 0.071 35.77 59.97 0.111 461.69 19.35
 96996 71.81 0.000 189.55 52.96 0.000 218.21 29.32
 97616 65.77 0.036 108.39 65.74 0.222 102.19 51.76 CopyNumber 19p13.3 3206
 97887 68.13 0.000 92.61 67.37 0.222 239.81 49.52 CopyNumber 11p13 2237
 98751 70.96 0.036 59.19 66.83 0.222 66.72 38.38
 98791 67.83 0.036 28.93 101.87 0.222 224.90 22.28 CopyNumber 2q11.2 379
102696 79.18 0.000 92.68 80.38 0.111 211.23 39.36
102798 87.39 0.000 110.04 53.06 0.111 793.97 25.38
103561 85.04 0.036 55.08 51.00 0.111 262.35 26.56 CopyNumber 12q24.31 2517
103834 80.57 0.036 64.54 76.68 0.222 293.02 59.69
104839 100.99 0.000 225.26 136.95 0.222 87.68 65.32
105547 81.74 0.000 160.68 82.23 0.111 143.20 86.05 CopyNumber 9q34.3 2030
106185 89.36 0.036 64.50 91.88 0.000 183.56 43.28
106876 63.88 0.000 56.12 75.64 0.222 138.98 35.36
106909 79.27 0.036 39.60 58.13 0.222 516.81 27.82
107003 124.40 0.000 813.78 84.52 0.000 197.77 54.64
107101 89.68 0.000 175.98 78.98 0.111 268.93 27.15 CopyNumber 1p36.33 4
107387 70.31 0.000 76.67 74.85 0.000 253.94 39.88
107393 83.93 0.036 59.30 71.63 0.222 267.59 45.01
108029 93.33 0.000 169.75 68.54 0.000 579.34 50.79
108080 130.54 0.000 212.70 124.15 0.111 825.21 73.65
108371 71.05 0.036 43.89 82.98 0.222 479.16 32.37
108408 68.23 0.036 119.79 74.72 0.111 307.87 34.75
108957 105.42 0.000 125.72 97.21 0.000 1244.98 34.19
108969 69.16 0.000 54.94 59.23 0.111 484.04 31.51
109051 126.66 0.036 115.04 127.27 0.222 405.39 56.02
109052 93.26 0.000 149.09 47.63 0.111 1050.08 33.47 CopyNumber 14q32.33 2746
109672 98.84 0.036 29.04 57.79 0.111 108.91 98.07
109798 88.57 0.036 97.36 91.62 0.111 559.23 64.63
110695 89.57 0.000 421.58 103.23 0.000 476.37 28.95
110849 75.22 0.000 67.73 71.02 0.000 181.15 45.21
111286 105.86 0.071 18.21 107.86 0.222 110.28 32.60
111577 146.37 0.071 118.94 80.20 0.111 415.46 141.25
111801 62.24 0.036 45.24 48.41 0.111 283.10 26.11 CopyNumber 7q22.1 1600
112058 86.73 0.000 80.73 66.67 0.111 82.86 34.43
112318 59.33 0.036 328.41 54.43 0.000 CopyNumber 7p15.3 1519
112955 83.18 0.000 68.65 74.54 0.222 175.05 32.35
114033 66.61 0.071 46.31 51.12 0.111 208.35 29.63
114286 105.50 0.000 160.45 104.16 0.111 138.02 46.31
114412 69.57 0.000 89.73 60.94 0.000 565.48 23.70
115474 68.64 0.000 26.75 40.02 0.222 38.04 51.64
115792 86.72 0.000 64.83 84.38 0.111 84.30 30.92 CopyNumber 3p21.31 574
116448 76.33 0.071 42.71 91.17 0.111 92.28 52.71
117176 57.12 0.000 213.98 51.77 0.000 546.64 24.11
117715 73.13 0.036 39.78 89.12 0.222 139.79 48.24 CopyNumber 11p15.4 2212
118110 135.94 0.000 197.86 123.23 0.111 289.38 139.96
118400 143.18 0.036 396.12 82.68 0.222 45.89 81.52 CopyNumber 7p22.1 1487
118463 114.64 0.036 277.75 88.48 0.000 489.97 35.21 CopyNumber 11p15.5 2200
118638 91.73 0.000 150.66 112.93 0.111 502.98 55.85
118722 70.58 0.071 36.51 53.51 0.222 115.71 60.62
118964 81.48 0.071 54.63 51.42 0.111 180.13 35.29
118983 116.33 0.000 216.74 115.85 0.000 112.11 59.33
119177 54.58 0.000 89.84 57.06 0.222 287.10 32.29 CopyNumber 12q13.12 2421
119192 136.52 0.071 366.01 79.98 0.111 746.04 45.80
119251 77.27 0.000 105.57 82.18 0.000 510.26 60.79
119591 132.87 0.000 85.25 60.89 0.111 277.18 26.93 CopyNumber 19q13.32 3268
119598 65.34 0.000 1828.88 55.92 0.000 5605.82 37.33
120323 72.42 0.000 82.14 75.76 0.222 139.72 33.20
121088 71.71 0.036 49.78 72.44 0.111 167.42 38.93 CopyNumber 6p22.3 1297
121549 59.29 0.036 72.38 43.55 0.111 348.76 34.62
122363 70.90 0.071 47.10 52.74 0.222 69.77 30.93
122523 74.89 0.000 118.63 57.28 0.000 262.80 35.66
124126 115.07 0.000 66.49 67.09 0.111 404.01 47.98 CopyNumber 7q22.1 1597
124147 80.00 0.036 49.60 67.28 0.111 88.88 40.69
124246 73.44 0.000 67.23 50.90 0.222 78.00 25.49
124366 64.80 0.036 31.83 72.36 0.222 296.88 27.96 CopyNumber 3q13.12 644
125113 208.71 0.000 207.39 70.50 0.000 130.39 26.17
125867 149.28 0.071 249.31 163.63 0.000 127.51 42.41
125898 68.47 0.000 463.77 95.22 0.000 3114.95 38.76
126497 92.86 0.071 174.55 58.17 0.000 240.18 42.08
126774 85.40 0.071 39.13 64.55 0.222 142.39 51.09
126938 74.59 0.036 93.26 77.82 0.111 106.86 32.06 CopyNumber 19q13.32 3269
127092 112.32 0.071 30.80 75.39 0.222 57.16 37.84 CopyNumber 16q22.3 2939
127249 54.54 0.000 80.21 58.63 0.111 216.47 28.77 CopyNumber 17q21.32 3034
127386 80.59 0.000 307.40 63.02 0.111
127764 63.23 0.036 156.09 58.22 0.000
128065 98.69 0.071 111.69 94.46 0.222 59.95 51.61
128199 77.43 0.000 73.49 95.92 0.222 302.61 35.57
128548 78.55 0.000 160.67 43.75 0.111 510.95 31.27 CopyNumber 4p16.1 773
129634 74.38 0.071 38.63 51.13 0.222 58.68 27.28
129673 76.37 0.000 374.81 65.02 0.111 2050.10 29.97
130031 141.77 0.036 61.66 100.82 0.111 124.88 40.58
130098 68.07 0.036 21.50 58.55 0.222 72.44 30.73
130293 74.37 0.036 143.21 63.05 0.111 394.94 46.49
130413 62.69 0.036 35.34 73.66 0.111 763.95 36.55
131226 77.45 0.036 40.35 61.36 0.222 211.50 44.83
132497 62.00 0.000 89.82 78.68 0.000 67.63 44.78 CopyNumber 1p34.1 66
132513 64.29 0.036 33.27 58.33 0.222 474.25 37.94 CopyNumber 11p11.2 2252
133892 129.65 0.000 246.87 96.64 0.111 1107.22 68.63
134074 100.43 0.071 26.96 119.73 0.222 90.07 25.91
134688 70.25 0.071 68.24 53.74 0.000 72.44 28.26
135406 65.02 0.071 70.87 53.64 0.111 258.58 31.26
136905 88.95 0.071 63.87 56.85 0.111 420.31 25.48
136947 61.39 0.000 83.24 64.45 0.111 164.27 33.47
137510 78.32 0.071 33.03 97.57 0.222 338.93 38.22 CopyNumber 12q24.31 2520
138860 75.60 0.000 63.39 84.41 0.222 104.45 29.18
139896 65.18 0.000 67.60 55.36 0.111 240.43 26.38
140452 115.93 0.000 61.69 109.34 0.222 149.10 37.19
142442 65.85 0.000 96.04 76.63 0.222 900.30 25.31
143187 74.48 0.000 61.96 104.03 0.111 114.98 39.16
143766 70.65 0.036 56.38 78.56 0.222 131.85 31.29
143873 123.17 0.000 265.13 64.14 0.111 1812.20 70.31
144058 67.40 0.071 30.59 57.17 0.222 91.15 33.46
144468 77.62 0.000 72.08 68.21 0.000 369.59 42.51 CopyNumber 11p15.5 2200
144835 59.90 0.000 1239.80 47.18 0.000 4424.16 35.78 CopyNumber 11q12.3 2268
144868 61.94 0.036 46.48 65.44 0.222
144941 99.27 0.036 30.70 62.58 0.222 27.70 47.48
144949 89.85 0.036 51.55 71.38 0.111 139.69 32.40
144980 66.37 0.036 31.70 83.79 0.111 78.74 45.38
145049 79.64 0.036 44.08 75.91 0.222
145442 67.35 0.071 65.14 62.03 0.111 227.44 39.23
145575 224.58 0.036 45.18 76.11 0.222 202.49 59.73
146070 128.18 0.000 178.96 54.77 0.000 93.05 36.84
146393 72.80 0.000 88.78 95.83 0.111 667.21 52.63
146602 102.89 0.000 281.39 83.54 0.000 1415.55 49.65
146804 74.69 0.036 67.23 67.16 0.222 54.96 64.90
146806 65.76 0.036 76.43 55.00 0.111 156.47 27.78
147433 173.87 0.036 100.81 101.76 0.111 185.23 55.89
148078 68.19 0.000 44.30 49.13 0.222 259.39 36.71
148272 78.08 0.000 40.88 58.49 0.222 282.89 43.22
148330 68.24 0.000 195.74 61.44 0.111 882.12 30.42
148340 57.95 0.000 129.05 74.68 0.111 97.73 64.77 CopyNumber 3p14.2 601
148670 89.45 0.036 35.45 93.34 0.222 56.01 87.59
149004 102.91 0.036 30.71 66.15 0.222 CopyNumber 16q24.2 2967
149957 81.12 0.071 47.00 76.13 0.222 125.85 48.66
149983 68.84 0.071 42.84 78.77 0.222 75.44 36.59 CopyNumber 1p36.22 27
150107 116.09 0.071 20.91 61.58 0.222 573.50 21.98 CopyNumber 2p22.3 302
150540 90.93 0.036 48.36 86.76 0.000 183.75 29.74
150580 80.15 0.000 1108.77 70.34 0.000 3122.23 30.91 CopyNumber 17q21.2 3022
150837 124.23 0.036 86.20 120.91 0.222 778.59 48.51
151134 57.73 0.071 45.75 78.70 0.222 289.38 30.06
151220 73.17 0.036 66.67 96.14 0.222 744.16 63.01 CopyNumber 4q32.3 1031
151413 80.50 0.000 79.73 76.85 0.000 300.73 30.47
151787 65.45 0.036 107.49 74.56 0.111 592.77 39.14
152536 151.78 0.036 64.94 62.87 0.111 437.32 51.09
153177 82.65 0.000 1290.76 62.05 0.000
154023 69.11 0.071 35.70 66.65 0.111 83.15 28.46 CopyNumber 9q31.1 1976
154073 75.96 0.036 33.22 53.61 0.222 218.58 39.39
155165 68.65 0.036 52.72 66.13 0.111 79.58 31.11
155218 57.46 0.000 200.28 53.39 0.000 216.50 35.53
155396 76.82 0.071 67.48 97.34 0.222 405.26 42.07
155829 66.32 0.000 59.97 79.36 0.000 238.12 23.08
156171 68.16 0.000 68.13 52.36 0.222 147.78 34.78
156367 87.67 0.000 1712.42 68.63 0.000 4735.69 38.82
156667 92.93 0.036 26.62 69.37 0.222 239.39 35.65
157160 92.71 0.071 89.61 69.92 0.000 100.13 36.59 CopyNumber 16p13.3 2866
157351 66.51 0.036 91.00 77.95 0.000 484.52 37.70
157379 88.98 0.000 245.35 78.54 0.000
157394 115.85 0.036 40.70 64.13 0.111 128.63 71.71 CopyNumber 16p13.3 2866
159014 63.78 0.036 89.22 60.16 0.111 163.73 32.17
159118 93.76 0.000 80.22 75.94 0.222 173.36 116.76
159130 70.14 0.036 83.65 78.95 0.000 257.93 22.84
159161 97.10 0.000 133.32 61.43 0.000 599.74 28.29 CopyNumber 17q25.3 3087
159699 69.52 0.000 37.41 64.94 0.111 210.99 69.05 CopyNumber 12q24.22 2509
159799 64.26 0.036 34.74 59.78 0.111 91.07 36.21 CopyNumber 12q24.21 2506
160958 79.14 0.000 114.90 52.77 0.222 127.25 40.40
161357 64.76 0.000 46.29 76.91 0.000 147.60 39.89
162032 67.26 0.036 70.53 79.73 0.000 255.04 27.58
162233 74.14 0.000 90.72 65.27 0.000 179.64 29.18
162877 69.59 0.036 50.56 52.07 0.000 521.49 49.22
163645 76.60 0.071 24.93 67.74 0.111 84.40 61.57
163776 71.14 0.071 37.56 78.72 0.111 528.53 41.20
163893 57.76 0.000 58.05 59.53 0.000 271.42 33.87
165195 65.00 0.036 108.29 54.09 0.222 943.91 27.36
166011 93.62 0.000 49.61 56.41 0.222 312.99 31.66
166204 68.68 0.071 31.97 87.75 0.000 320.35 36.72
166463 56.02 0.000 192.95 59.71 0.000 787.81 25.31
166924 72.91 0.036 55.96 77.29 0.111 350.25 27.79
166975 84.13 0.000 175.23 59.39 0.111 567.33 40.53
167535 67.25 0.071 31.16 78.48 0.222 189.62 34.78 CopyNumber 14q13.2 2665
168073 57.46 0.000 79.97 43.40 0.000 97.12 34.22 CopyNumber 20q11.22 3365
168799 72.15 0.000 85.51 85.35 0.111 127.53 38.40 CopyNumber 14q11.2 2643
169611 69.54 0.071 37.43 50.49 0.222 285.98 24.97
169718 96.71 0.000 139.45 63.02 0.222 232.68 35.86 CopyNumber 19p13.3 3198
170107 87.41 0.071 47.18 78.34 0.222 1036.03 59.06
170131 67.79 0.036 50.82 86.27 0.111 99.84 47.80 CopyNumber 19p13.3 3203
170553 58.81 0.071 60.80 61.32 0.222 725.07 33.82
170622 78.58 0.000 2283.14 56.69 0.000 9908.08 42.82 CopyNumber 11q13.1 2276
171626 63.32 0.000 241.54 57.86 0.000 1649.53 25.79
172550 105.11 0.000 212.10 66.20 0.111 549.43 25.49
172755 131.11 0.036 69.54 193.88 0.111 31.12 77.04
172928 223.12 0.000 3277.02 184.20 0.222 23.83 59.75
173024 72.45 0.000 18.77 58.78 0.222 607.15 31.58
173162 77.43 0.071 64.12 75.11 0.111 116.53 36.61
173381 129.69 0.036 196.90 150.06 0.222 416.10 84.50
173464 130.72 0.000 144.94 86.56 0.000 106.78 43.86
173611 74.38 0.036 72.63 73.41 0.222 450.20 37.71
173705 71.42 0.036 77.12 54.80 0.111 1003.69 44.66
173724 129.37 0.000 480.96 98.37 0.111 328.75 117.68
174050 81.34 0.000 161.44 58.99 0.111 435.08 32.67 CopyNumber 9q34.3 2030
174195 121.69 0.000 59.79 61.62 0.222 1541.94 54.35
175473 178.89 0.000 74.84 74.19 0.111 39.59 55.77
175955 78.53 0.071 82.37 63.20 0.000 407.41 30.39 CopyNumber 4q13.2 868
4q13.3-4q13.2
177530 105.78 0.000 370.63 61.86 0.000 1399.62 34.95
177766 110.71 0.036 85.86 98.28 0.222 258.95 47.27
178551 80.06 0.000 709.53 80.15 0.000 4043.69 42.24
178728 82.99 0.000 68.39 77.86 0.222 178.39 24.90
179986 66.32 0.000 162.17 96.06 0.000 650.73 31.17 CopyNumber 6p21.33 1312
180141 117.29 0.036 32.50 84.00 0.222 371.27 77.91
180312 89.37 0.036 55.94 83.19 0.222 153.55 46.39
180414 84.33 0.000 849.88 48.98 0.000 1613.00 26.72
180877 77.30 0.000 324.36 71.18 0.000 1202.80 34.96
180903 87.91 0.000 76.16 118.67 0.111 44.42 26.29 CopyNumber 22q13.33 3520
180909 80.07 0.000 371.75 106.26 0.000 1474.92 40.32
180933 80.42 0.071 73.33 92.53 0.111 346.11 27.13
181046 71.47 0.000 52.77 69.61 0.111 76.22 39.96
181112 67.48 0.000 56.45 51.99 0.111 58.24 39.41 CopyNumber 13q14.2 2567
181163 101.97 0.036 209.51 59.97 0.000 1671.22 28.67
181244 84.91 0.000 615.31 92.95 0.000 CopyNumber 6p21.33 1311
181368 73.25 0.036 72.19 59.47 0.222 877.69 37.35
181444 77.92 0.000 93.53 65.83 0.111 428.12 41.92
182255 70.26 0.000 258.19 78.53 0.000 575.25 28.65
182626 59.53 0.036 77.65 60.50 0.111 114.59 33.95
182885 72.14 0.071 79.54 72.22 0.111 658.87 31.09
183684 66.42 0.000 167.12 47.95 0.000 1226.24 19.58
183706 87.65 0.000 71.68 63.07 0.111 129.53 32.44
183800 73.34 0.000 88.07 68.82 0.111 79.80 39.64 CopyNumber 22q13.2 3503
183850 63.02 0.071 42.45 54.66 0.222 201.07 30.38
183994 111.25 0.036 107.82 63.33 0.222 314.08 45.04
184062 80.16 0.000 108.22 79.79 0.111 885.45 50.28
184211 68.32 0.071 35.11 53.79 0.222 316.88 34.51
184233 67.24 0.000 149.88 69.13 0.111 465.50 38.54
184492 63.40 0.071 46.02 72.84 0.222 397.55 26.36 CopyNumber 19p13.2 3210
185172 91.53 0.000 246.66 86.19 0.000 344.82 34.87 CopyNumber 7q22.1 1600
185597 59.04 0.000 83.15 71.88 0.111 139.56 35.15 CopyNumber 16q24.3 2972
187199 115.54 0.000 303.70 76.68 0.000
187635 101.59 0.000 380.46 78.22 0.000 28.66 51.48 CopyNumber 16p12.3 2889
187763 66.27 0.000 76.79 54.16 0.222 500.24 26.46
187866 73.60 0.000 111.79 64.50 0.111 680.00 34.53
187946 84.06 0.000 104.34 48.89 0.222 200.66 75.07
188501 67.55 0.000 55.47 53.26 0.222 45.76 34.94
188614 65.47 0.071 44.10 82.41 0.222 84.46 53.64 CopyNumber 12p12.3 2387
188879 68.81 0.071 103.91 56.06 0.111 141.32 40.35
188882 62.39 0.036 30.53 64.74 0.222 163.76 30.89
189075 84.72 0.000 48.42 71.25 0.222 232.97 38.78
189119 95.87 0.000 83.56 64.37 0.222 64.39 50.46
189329 60.19 0.071 28.86 71.76 0.222 86.40 35.87
189716 84.20 0.000 79.20 72.95 0.111 798.87 31.92
189772 112.18 0.071 233.62 107.40 0.222 546.84 44.02
190028 96.99 0.036 64.26 55.28 0.222 715.65 50.89
190086 108.77 0.000 238.35 55.47 0.111 312.07 29.80
190334 64.40 0.000 45.95 69.08 0.222 275.10 42.89
190384 61.06 0.036 49.81 60.07 0.111 232.13 26.89
190722 69.16 0.000 105.73 67.89 0.000 144.16 53.90
190904 86.92 0.036 32.05 61.63 0.222 95.24 30.61 CopyNumber 19q13.32 3268
191186 70.71 0.071 39.12 55.01 0.222 614.82 24.31
191346 80.55 0.000 98.52 86.95 0.111 757.36 36.32 CopyNumber 7p14.2 1530
191518 87.09 0.071 92.92 81.35 0.222 176.63 30.67
191987 71.55 0.071 50.78 45.94 0.222 307.98 24.32 CopyNumber 1p36.33 2
192316 65.32 0.036 43.60 69.01 0.222 176.27 33.07 CopyNumber 1p36.33 3
192374 78.84 0.000 407.58 81.92 0.000 1068.05 35.28
192425 76.85 0.000 311.90 64.60 0.000 InversionBreak 16p11.2 2900
point
InversionBreak
point
CopyNumber
193118 62.88 0.036 41.98 71.16 0.000 331.29 46.59 CopyNumber 10q22.3 2141
193163 145.45 0.000 64.92 125.23 0.222 62.71 48.89 CopyNumber 2q14.3 408
193491 92.35 0.000 115.38 71.01 0.111 286.47 58.62 CopyNumber 18p11.21 3105
194329 73.07 0.000 93.43 82.64 0.000 315.47 84.07
194718 66.93 0.071 50.97 67.72 0.111 497.18 30.12
195464 98.64 0.036 248.43 76.79 0.000 442.92 71.56 Inversion Xq28 3630
195642 78.70 0.071 39.60 101.58 0.222 88.25 56.73
196983 83.49 0.071 33.94 63.95 0.222 186.36 59.61
198281 108.54 0.000 400.81 102.64 0.111 57.29 51.53
199561 68.25 0.036 72.08 76.53 0.000 89.48 31.20
199625 89.82 0.000 222.28 87.19 0.111 383.94 32.48
200063 131.93 0.071 68.93 74.04 0.111 65.10 51.46
200600 81.79 0.036 59.63 66.67 0.222 239.47 30.41 CopyNumber 1q22 160
200804 109.85 0.000 135.85 90.16 0.000 879.77 36.77 CopyNumber 8q12.1 1762
201253 75.54 0.071 53.03 72.88 0.111 150.04 34.96
201390 61.96 0.036 64.00 58.40 0.111 410.22 35.22
201712 78.85 0.036 29.07 57.59 0.222 96.84 37.35 CopyNumber 16q22.3 2941
202011 64.61 0.000 88.75 53.56 0.111 189.04 35.21
202085 70.60 0.000 180.75 62.87 0.000
202166 57.15 0.000 166.73 45.76 0.111 1023.72 33.49 Inversion 5q35.3 1270
CopyNumber
202179 59.85 0.000 59.18 64.11 0.222 53.16 43.92 CopyNumber 5q13.2 1143
203099 55.11 0.036 50.48 63.52 0.222 113.15 27.96
203910 83.11 0.000 151.92 125.87 0.000 46.20 51.50
204041 74.62 0.036 106.38 86.68 0.111 254.62 59.64
204773 71.71 0.000 60.94 64.50 0.000 135.31 39.98
205163 62.46 0.000 151.99 70.71 0.000 517.07 39.92 CopyNumber 3q22.1 670
206500 81.07 0.036 62.30 49.78 0.222
206824 89.50 0.000 195.81 83.44 0.111 2218.86 36.90
208597 62.01 0.000 112.96 50.60 0.000 481.51 24.72
209983 132.48 0.071 257.96 130.11 0.222 101.23 38.96
210469 70.29 0.036 21.05 72.93 0.222 64.90 43.40
210532 74.09 0.071 82.09 84.33 0.111 61.52 28.17
211463 73.34 0.000 101.29 69.16 0.222 98.91 38.82 CopyNumber 19p13.2 3217
211594 102.99 0.071 73.05 66.89 0.111 104.24 46.28 CopyNumber 19q13.2 3258
211914 107.07 0.036 59.20 53.55 0.111 128.87 42.11 CopyNumber 19p13.3 3198
212102 78.06 0.000 138.13 60.95 0.111 393.98 37.87
212395 62.26 0.071 31.35 67.76 0.222 59.26 42.89
213061 98.05 0.000 327.00 72.73 0.000 1227.71 41.68
213470 67.83 0.000 192.87 68.35 0.111 410.41 31.28
213541 84.63 0.036 85.44 89.94 0.000 429.86 31.21
213666 61.77 0.036 27.18 63.86 0.222 107.77 28.26
213724 81.67 0.071 54.83 74.71 0.111 278.03 30.19
216653 74.68 0.071 33.21 71.69 0.222 343.12 32.18
220950 71.10 0.071 83.15 93.30 0.000 1027.22 35.80
221847 107.96 0.000 214.24 135.53 0.111 687.16 51.69
222510 93.05 0.071 88.95 63.95 0.222 113.62 30.43 CopyNumber 19p13.3 3198
223141 99.93 0.036 131.95 62.74 0.111 1035.61 39.53
224607 152.50 0.036 87.86 158.09 0.222 137.21 45.23
226007 164.81 0.071 47.81 52.32 0.222 40.09 36.30
226117 83.46 0.000 65.79 116.54 0.111 371.84 56.86 CopyNumber 22q13.1 3496
226755 93.25 0.000 194.51 65.63 0.111 278.34 38.95
227067 67.54 0.071 33.57 86.75 0.222 231.33 33.85 CopyNumber 1p36.33 3
227253 81.31 0.036 55.73 71.93 0.111 101.17 28.59
227777 72.56 0.000 81.21 76.44 0.111 415.86 66.71
229641 64.35 0.000 118.72 79.68 0.000 809.47 34.84 CopyNumber 5p13.3 1105
231295 68.62 0.071 21.81 62.84 0.222 87.17 37.84 CopyNumber 17q24.2 3061
231616 83.55 0.036 105.55 56.13 0.000 385.33 37.02 CopyNumber 19p13.13-19p13.12 3221
232194 64.71 0.000 51.79 57.10 0.111 405.35 23.20
232543 132.95 0.036 98.19 105.59 0.222 74.17 72.02
233458 89.76 0.000 44.01 49.80 0.000 127.26 26.28
233552 59.88 0.071 23.54 97.43 0.222 130.13 32.17 CopyNumber 7p14.1 1535
233952 90.17 0.000 319.55 67.24 0.000 101.92 36.48
234521 91.19 0.071 81.43 91.57 0.222 69.82 35.53
236030 71.56 0.036 23.36 61.13 0.222 83.17 36.95 CopyNumber 12q13.2 2429
237536 90.09 0.036 49.15 76.51 0.111 483.90 44.44
237971 91.89 0.036 78.94 95.20 0.222 246.47 64.85
238839 67.07 0.000 145.01 65.51 0.000 190.91 36.76
240170 87.00 0.000 118.73 122.83 0.222 37.21 46.26 CopyNumber 12q13.2 2429
241336 61.07 0.000 155.72 77.04 0.111 721.67 34.47
241543 76.34 0.000 45.73 60.57 0.222 203.39 33.10
241558 64.15 0.000 47.89 63.03 0.222 122.71 28.63
241575 70.86 0.000 45.40 74.01 0.222 432.03 30.80 CopyNumber 16p13.3 2866
241576 71.75 0.000 35.61 63.06 0.222 626.29 37.40
241579 107.31 0.000 207.46 85.28 0.222
242458 57.83 0.036 73.30 49.12 0.000 415.64 29.35
242947 58.36 0.000 3864.18 41.07 0.000 13.84 72.12
246112 67.73 0.000 136.82 57.97 0.111 1178.68 27.77 CopyNumber 2q11.2 378
246310 76.17 0.000 145.70 64.99 0.111 618.59 39.03
246413 81.25 0.036 112.38 61.72 0.111 183.60 54.30
246781 62.94 0.071 41.90 55.75 0.222 10.39 88.93
247077 67.52 0.000 567.58 47.87 0.000 1471.14 26.19 CopyNumber 3p21.31 583
247186 64.96 0.000 37.62 80.54 0.222 77.06 31.82 CopyNumber 16p11.2 2904
247975 105.68 0.000 438.14 91.84 0.000 104.18 46.50
248267 96.06 0.036 85.59 77.62 0.000 267.18 59.58
248941 61.08 0.036 51.35 63.24 0.222 221.26 33.54 CopyNumber 5q13.2 1143
249600 70.96 0.071 67.36 81.11 0.222 73.53 34.15
250009 61.55 0.000 59.19 55.14 0.111 418.28 26.81
250429 69.07 0.071 30.41 44.58 0.222 130.29 29.98
250758 61.91 0.000 91.07 70.47 0.222 135.51 35.81
250899 79.57 0.000 193.37 90.68 0.000 526.51 34.77
250905 66.32 0.000 77.23 58.42 0.111 1248.73 26.47
251531 101.66 0.000 119.04 61.83 0.222 359.88 30.37
252457 76.40 0.000 54.99 74.23 0.000 13.56 94.81 CopyNumber 16q24.2-16q24.3 2970
252713 72.27 0.071 50.47 59.99 0.111 74.87 50.43
252967 64.23 0.000 74.53 57.70 0.111 168.08 23.83
253726 58.02 0.000 89.50 50.88 0.000 451.23 27.68
253903 101.02 0.071 152.14 104.18 0.222 591.87 57.57
254042 67.31 0.000 162.34 45.49 0.000 920.76 27.97 CopyNumber 6p21.33 1313
255015 52.53 0.036 52.05 70.92 0.111 607.92 28.15
255093 61.27 0.000 87.62 65.22 0.111 184.42 34.31
255932 75.20 0.071 63.07 84.50 0.111 246.82 28.40
255935 97.23 0.000 310.78 117.34 0.111 10.29 49.34
255973 77.67 0.000 121.74 58.40 0.111 88.24 45.36
256301 143.00 0.036 131.52 125.09 0.111 193.25 117.05
256549 73.37 0.071 66.78 109.62 0.111 72.47 43.74 CopyNumber 16p13.3 2866
257008 94.53 0.000 239.54 60.00 0.000 206.91 69.09
257341 80.14 0.071 32.10 94.24 0.222
257761 74.40 0.071 57.97 89.39 0.222 90.97 44.23
258551 113.91 0.036 31.42 52.51 0.111 212.75 23.35 CopyNumber 2q35 496
258563 74.13 0.000 51.06 53.28 0.222 270.95 35.45
258798 192.40 0.000 100.67 52.60 0.222 109.62 31.17
259461 79.93 0.036 118.37 49.94 0.000 119.14 28.75
260603 112.19 0.036 28.87 96.98 0.111 114.76 44.19
262823 101.47 0.036 35.90 64.77 0.222 268.43 30.93
265829 134.13 0.036 60.09 147.84 0.222 88.23 82.34
268488 75.37 0.000 22.47 50.04 0.222 260.69 28.22 CopyNumber 1p36.32 12
268530 81.96 0.036 168.88 85.78 0.000 106.18 37.76
268742 79.56 0.000 96.43 68.28 0.111 881.42 37.73
268849 62.43 0.000 127.97 70.40 0.222 666.34 58.26 CopyNumber 6p21.2 1325
268939 88.77 0.000 69.60 63.46 0.111 993.14 26.39
269528 65.55 0.000 77.77 59.98 0.111 321.03 37.48
269577 52.27 0.036 116.39 58.52 0.000 163.78 33.49 CopyNumber 20p13 3304
269782 67.13 0.071 73.22 67.37 0.111 139.08 34.10
269944 60.66 0.000 46.86 64.04 0.222 297.40 32.90 CopyNumber 11p11.2 2254
270291 83.84 0.000 288.23 52.39 0.000 489.18 51.55
270428 69.26 0.036 56.42 53.38 0.000 575.82 78.18
270525 70.97 0.071 49.58 95.80 0.222 482.93 25.81
270869 61.79 0.036 41.81 83.43 0.222 159.67 24.39
271135 68.23 0.036 96.12 59.45 0.000 1364.03 36.20
271695 74.54 0.071 51.23 58.22 0.222 431.22 39.81
272062 90.33 0.071 134.84 67.71 0.222 403.60 48.89
272168 70.53 0.071 24.14 85.55 0.222 235.12 31.23
272630 60.27 0.000 49.35 72.52 0.111 70.37 33.27
272927 66.36 0.000 55.23 67.21 0.111 132.83 49.23
273077 75.82 0.071 65.81 74.94 0.111 284.35 38.35
274184 70.70 0.071 73.81 63.57 0.111 79.41 33.16
274772 65.96 0.000 78.91 69.49 0.000 341.50 37.35
274873 81.69 0.000 64.18 62.49 0.111 401.63 28.94
275243 132.16 0.000 386.53 100.02 0.222 2365.31 75.71
275775 134.20 0.071 141.95 138.41 0.222 1379.68 60.08
275865 62.60 0.071 77.19 60.06 0.111 390.18 35.84
276878 85.73 0.071 75.29 88.57 0.222 41.28 79.67
277035 117.16 0.000 49.43 96.96 0.111 820.49 57.32 CopyNumber 3q21.3 667
277517 74.29 0.000 43.19 64.65 0.222 340.59 48.75
278186 85.24 0.071 64.92 117.05 0.111 125.86 38.10
278362 66.62 0.000 67.90 71.94 0.000 328.98 38.55
278426 62.04 0.000 92.55 57.10 0.111 156.41 42.46 CopyNumber 7q22.1 1597
278429 64.98 0.036 103.18 62.08 0.111 94.29 29.86
278500 68.19 0.036 75.86 73.54 0.222 106.63 48.00
278569 82.25 0.000 200.20 102.95 0.222 107.25 51.36
278573 101.10 0.000 114.44 148.80 0.111 650.32 46.92
278721 83.27 0.036 71.10 71.24 0.222 72.60 42.44
279061 67.08 0.036 44.30 63.18 0.222 197.52 31.29 CopyNumber 17p13.3 2975
279245 76.47 0.000 75.15 85.55 0.111 91.87 45.55
279257 66.80 0.036 93.74 71.44 0.111 194.76 31.27
279413 129.76 0.036 110.16 104.82 0.111 47.09 59.50
279529 81.69 0.036 104.37 66.22 0.222 1363.23 45.45 CopyNumber 5q35.3 1268
279583 71.86 0.036 199.42 57.52 0.000 103.71 39.63 Inversion 16p12.2-16p12.1 2894
CopyNumber
279623 77.55 0.071 41.14 84.94 0.111 251.43 82.76 CopyNumber 16p13.3 2866
279640 65.23 0.036 40.21 83.36 0.222 301.86 23.97
279652 91.16 0.000 56.36 73.29 0.222 122.30 52.34
279669 82.14 0.071 83.17 76.56 0.222 90.40 49.23
279696 83.17 0.036 102.39 93.03 0.000 431.21 44.69
279806 69.81 0.000 647.74 79.09 0.111 1392.91 24.99
279836 58.12 0.000 42.38 77.37 0.222 109.90 38.28 CopyNumber 11p13-11p12 2245
279920 78.76 0.000 209.25 54.55 0.111 1143.94 32.04
279929 81.28 0.000 119.27 50.43 0.111 615.57 32.57
280202 67.43 0.036 34.06 68.28 0.111
280342 64.79 0.000 190.05 68.21 0.111 507.64 35.59
280378 78.00 0.036 59.08 52.49 0.111 324.22 34.79
282410 75.08 0.000 346.66 83.21 0.000 863.13 37.39
282700 59.59 0.071 89.12 64.76 0.111 474.36 29.57
282901 61.28 0.000 161.17 55.92 0.111 586.28 30.27
282998 87.12 0.000 109.61 89.33 0.000 203.95 38.00
283111 77.12 0.000 54.33 58.77 0.111 148.42 37.10
283454 55.19 0.071 33.55 62.22 0.111 72.33 42.83
283521 77.37 0.000 76.39 64.83 0.222 21.40 67.57
283610 59.73 0.071 45.77 73.57 0.111 113.35 30.58
283652 77.33 0.036 55.65 73.75 0.222 173.00 38.91
283739 146.71 0.071 51.69 109.60 0.222 360.93 32.32
284208 78.08 0.071 29.66 65.71 0.111 301.23 63.92
284279 69.22 0.000 39.54 69.82 0.222 123.20 36.70
284286 81.75 0.036 67.66 95.49 0.222 1531.44 35.52 CopyNumber 7p13 1537
284491 136.63 0.000 305.06 99.27 0.000 226.73 38.91 CopyNumber 21q22.3 3455
285354 59.95 0.071 60.82 74.39 0.222 168.00 27.87
285976 94.65 0.000 98.07 53.23 0.111 573.85 77.02
286221 75.65 0.000 248.30 58.65 0.000 3463.94 35.74
286226 101.42 0.036 32.24 72.06 0.222 207.01 28.47
288193 61.78 0.000 45.54 63.87 0.111 349.23 36.00
288856 87.34 0.071 197.77 57.17 0.000 1020.14 40.67
288969 73.68 0.071 31.39 60.73 0.222 278.99 36.61
289008 59.92 0.036 63.72 61.38 0.222 271.56 30.69
289092 116.11 0.036 289.77 159.61 0.111 458.68 76.94 CopyNumber 16q24.1 2960
289123 66.03 0.000 78.85 81.68 0.000 272.21 82.53 CopyNumber 12q13.3 2432
289271 87.86 0.000 314.40 88.75 0.000 394.29 60.90 CopyNumber 8q24.3 1879
290243 125.85 0.000 761.77 103.49 0.000 101.29 27.98
290404 75.80 0.071 40.20 86.49 0.111 1710.99 28.57
290758 67.69 0.000 91.13 56.76 0.222 361.48 36.00 CopyNumber 11q12.2 2266
291587 59.78 0.000 43.57 53.60 0.111 178.10 32.56
292026 69.01 0.036 40.56 58.47 0.222 211.07 26.51
292063 62.83 0.000 145.61 55.21 0.000 49.54 46.81
292078 78.84 0.036 77.92 77.84 0.111 475.13 31.13
292265 64.89 0.071 34.72 84.99 0.222 384.26 31.49 CopyNumber 10p15.3 2033
292457 160.14 0.000 215.82 73.61 0.111 63.85 61.00
292493 70.67 0.000 424.46 81.44 0.000 831.58 26.17
292524 67.18 0.071 25.82 53.79 0.222 195.08 27.33
292579 75.20 0.036 75.85 66.75 0.111 420.33 36.15
293563 104.96 0.036 137.26 82.64 0.111 165.89 47.95
295917 77.96 0.036 56.00 89.69 0.222 319.57 47.66
297324 107.68 0.000 190.59 111.57 0.222 155.47 67.70
298198 79.37 0.000 97.17 92.03 0.111 293.20 59.13
298280 86.67 0.000 235.59 89.33 0.111 1546.16 35.33
298654 101.00 0.071 136.05 94.16 0.111 181.32 68.18
299002 118.98 0.036 211.61 81.78 0.000 590.01 51.94 CopyNumber 19q13.2 3258
299055 67.41 0.071 60.49 51.37 0.000 1136.65 27.04
300141 82.66 0.000 880.44 79.56 0.000
300684 86.52 0.036 19.56 66.08 0.222 55.18 33.61
300772 407.50 0.000 144.07 60.22 0.111 11.36 80.27
300816 68.45 0.000 144.04 91.05 0.222 258.49 31.17
300834 53.83 0.000 46.55 59.38 0.111
301404 84.83 0.036 127.77 69.34 0.000 48.88 37.40
301412 70.03 0.000 161.71 51.02 0.000 573.46 31.44
302742 97.96 0.036 99.87 126.82 0.222 620.43 57.69 CopyNumber 21q22.11 3448
302903 73.32 0.036 155.07 64.76 0.111 503.88 36.57 CopyNumber 16p13.3 2866
303676 78.57 0.036 106.32 83.93 0.222 263.04 37.05
304192 89.25 0.071 87.57 78.41 0.111 1681.62 40.81
304682 146.41 0.000 586.08 115.24 0.000 1233.74 48.30
306123 69.15 0.071 59.10 53.26 0.222 125.75 44.20
306242 71.12 0.000 48.63 99.39 0.222 136.24 37.00
306329 62.26 0.000 60.88 78.67 0.222 316.67 32.67
306425 73.63 0.000 34.17 79.05 0.000 84.65 38.45 CopyNumber 6q14.1 1383
308122 77.12 0.036 78.26 58.86 0.111 226.98 30.91 CopyNumber 14q32.12 2733
308340 93.90 0.071 39.81 69.75 0.222 83.71 47.24
308709 105.53 0.000 111.91 66.83 0.000 310.05 37.58 CopyNumber 15q15.3 2771
309090 85.59 0.071 177.79 69.74 0.111 45.16 35.63
309231 80.54 0.036 63.95 73.06 0.111 580.07 23.13
309641 75.27 0.000 99.07 83.98 0.000 264.53 42.66
309753 69.18 0.000 71.16 72.16 0.111 742.22 44.20 CopyNumber 7p14.1 1534
309849 73.60 0.071 28.98 68.38 0.222 94.62 48.92
310542 92.37 0.071 77.69 87.64 0.222 156.90 38.84
310645 69.28 0.036 100.90 54.85 0.000 1125.09 21.18
311072 86.83 0.036 27.73 57.37 0.222 367.02 38.90
311346 67.53 0.036 44.51 86.22 0.111 53.25 44.95 CopyNumber 12p12.1 2391
311609 70.74 0.000 104.20 81.30 0.000 237.18 48.06 CopyNumber 19p13.12 3223
311640 106.83 0.000 510.33 73.34 0.000 93.77 42.99
312098 97.67 0.071 80.93 101.94 0.111 35.13 77.49
313847 55.80 0.036 26.60 71.34 0.222 299.35 40.72
314263 68.60 0.071 103.11 55.03 0.000 89.94 34.68 CopyNumber 12q13.3 2430
314359 69.38 0.000 355.31 42.03 0.000 154.82 30.01
315177 90.19 0.000 79.21 90.27 0.000 225.39 34.43 CopyNumber 3p21.31 586
315230 75.35 0.000 128.92 93.04 0.222 276.19 37.74
319334 88.71 0.036 167.66 92.28 0.000 64.37 38.27
321391 64.74 0.000 42.64 64.44 0.111 435.65 30.96
321541 59.35 0.036 127.00 41.41 0.111 662.88 41.93 CopyNumber 15q22.31 2793
323363 64.47 0.000 29.43 51.70 0.222
323489 81.42 0.036 73.56 84.83 0.222 152.22 30.03
324250 79.24 0.000 158.34 82.02 0.000 324.22 27.86
324844 83.37 0.000 138.52 92.47 0.111 368.21 49.14
325650 136.52 0.000 82.13 109.38 0.222 108.42 62.31
326387 61.74 0.000 159.12 60.70 0.111 1355.73 29.26
330384 69.44 0.000 68.69 88.89 0.222 263.52 45.28
331431 64.62 0.036 34.89 61.05 0.222 164.96 25.51 CopyNumber 4p14 825
333388 90.31 0.000 248.00 49.98 0.000 56.06 41.65 CopyNumber 8q24.3 1878
333579 73.99 0.000 207.00 86.45 0.000 578.55 32.43
333786 82.77 0.000 297.78 97.96 0.000 88.80 27.84
333823 89.78 0.036 42.96 56.87 0.222 126.65 54.02
334017 82.51 0.000 1496.72 84.82 0.111
334479 72.52 0.036 61.34 57.88 0.222 224.68 33.05 CopyNumber 16p13.3 2866
334534 94.59 0.000 64.42 72.27 0.222 230.52 56.05
334587 98.49 0.036 127.44 77.96 0.222 56.82 48.84
334713 72.87 0.071 69.27 86.41 0.222 158.37 38.36
334851 102.17 0.000 101.40 41.98 0.111 553.93 45.99
334868 56.26 0.071 23.15 52.67 0.222 170.24 29.57
335003 52.84 0.000 53.68 52.65 0.111 280.86 27.96 CopyNumber 16q24.3 2972
335057 68.54 0.000 137.12 58.17 0.000 682.36 27.44
335163 75.40 0.071 45.38 129.15 0.222 69.59 99.48
335918 98.06 0.071 79.89 54.30 0.222 222.21 54.25 CopyNumber 1q22 160
337295 84.21 0.036 137.57 72.92 0.111 116.16 50.84 CopyNumber 11q13.1 2272
337766 68.01 0.000 202.91 74.78 0.000 3513.66 53.34 CopyNumber 12q23.3 2494
339278 66.75 0.000 93.08 54.14 0.111 612.93 27.37
339639 71.56 0.000 59.94 63.25 0.222 530.98 32.89
339697 73.00 0.000 206.27 69.44 0.111 207.55 60.06
343911 79.02 0.000 73.68 85.85 0.111 126.75 36.12
345694 57.05 0.000 44.59 53.30 0.000 118.43 29.68
346868 85.04 0.071 86.46 71.11 0.222 78.76 41.86
348418 65.21 0.036 41.25 56.56 0.111 133.63 28.30
349656 69.11 0.000 122.42 91.03 0.111 65.67 33.86
350194 67.50 0.071 57.18 56.35 0.222 974.29 21.31
350229 97.88 0.000 64.62 89.22 0.111 182.02 57.82
350268 84.85 0.071 121.48 94.64 0.111 854.94 33.25
350364 62.80 0.071 32.70 56.87 0.222 489.36 49.85
350927 60.49 0.000 549.42 42.63 0.000 1242.87 45.82
351099 73.49 0.071 48.32 58.61 0.111 151.95 26.94
351296 70.85 0.000 100.35 47.00 0.111 210.84 29.83 CopyNumber 11q12.3 2268
351316 231.65 0.000 962.00 171.72 0.222 602.84 78.49
351474 98.35 0.000 56.04 104.42 0.111 65.42 73.26
351680 134.97 0.036 51.32 81.83 0.222 1028.80 33.00
351875 195.85 0.000 285.77 81.89 0.000 1982.14 49.61
352341 75.79 0.071 26.39 65.54 0.222 37.24 43.85
352656 71.84 0.036 58.63 44.06 0.111 875.31 43.75
352768 72.88 0.036 106.19 71.31 0.111 881.32 24.35 CopyNumber 6q27 1479
354056 76.13 0.071 56.50 78.63 0.111 126.70 123.02 CopyNumber 7q11.23 1572
355141 91.77 0.000 101.53 69.50 0.111 220.79 44.58
355606 60.91 0.071 76.85 66.68 0.000 574.94 34.63
355643 77.96 0.036 108.17 72.63 0.111 1201.76 27.22 CopyNumber 16p13.3 2866
355708 63.12 0.036 37.30 87.81 0.222 262.34 29.20 CopyNumber 2q11.2 378
355750 71.27 0.000 106.84 50.91 0.000 80.87 40.21
355753 84.23 0.036 38.89 56.95 0.111 336.82 37.01
355867 93.77 0.071 48.09 62.22 0.222 280.34 54.64 CopyNumber 12q13.3 2432
355927 64.41 0.000 147.13 64.66 0.111 941.32 36.63
355934 69.80 0.036 156.14 50.78 0.000 161.58 25.13
355983 66.37 0.000 154.52 67.35 0.222 404.14 34.07
356061 67.49 0.000 116.51 74.14 0.111 218.65 28.55 CopyNumber 16q24.2 2967
356096 70.29 0.000 168.35 68.41 0.111 168.20 43.07
356190 88.54 0.000 478.54 95.96 0.000 3961.19 25.93
356270 65.90 0.036 46.04 72.70 0.222 257.48 42.37
356285 79.82 0.000 329.64 78.06 0.000 799.76 33.14
356331 59.53 0.000 1683.27 56.79 0.000 5223.43 28.46
356366 92.12 0.000 1928.74 63.68 0.000 CopyNumber 16p13.3 2866
356371 75.13 0.000 2350.46 66.23 0.000 112.06 33.10
356377 82.23 0.000 62.50 63.16 0.222 320.21 50.05
356467 66.21 0.000 55.00 59.52 0.000 527.54 28.10
356501 153.63 0.000 51.63 63.33 0.000 250.13 58.63
356502 73.27 0.000 2501.03 44.31 0.000 4303.08 32.44 CopyNumber 15q23 2800
356549 65.60 0.000 84.68 67.51 0.222 294.91 45.11
356630 59.68 0.000 135.65 56.95 0.111 256.98 31.53
356647 75.20 0.000 113.95 64.30 0.000 982.39 31.67 Inversion 14q13.1-14q13.2 2663
356654 68.00 0.036 50.52 58.00 0.111 529.64 18.33
356766 85.27 0.036 207.71 52.85 0.111 3532.27 54.09
356769 148.76 0.071 82.19 77.74 0.111 211.91 50.28
356799 127.42 0.000 82.88 66.53 0.000
357901 181.23 0.036 350.43 80.27 0.111 407.08 74.43
362728 62.46 0.000 117.00 40.93 0.222 292.65 31.92
365116 68.53 0.036 126.74 72.33 0.222 109.68 38.27
368084 67.93 0.036 82.52 74.16 0.111 330.85 36.03
368149 84.73 0.000 319.23 99.32 0.000 306.87 38.36
368157 132.67 0.000 60.76 64.42 0.222 96.04 37.48
368240 63.21 0.036 41.47 63.19 0.222 282.82 29.11
368264 104.35 0.036 82.07 152.01 0.000 93.79 33.59
368376 63.69 0.000 60.30 75.16 0.111 475.42 40.92
368402 86.05 0.036 31.92 91.55 0.111 104.92 68.11 CopyNumber 8q24.3 1876
368404 74.03 0.036 46.42 53.59 0.000 79.74 27.69
368525 121.26 0.000 89.35 75.68 0.222 699.89 47.37
368598 79.84 0.036 50.09 69.21 0.222 212.95 33.37 CopyNumber 2q32.1 464
368934 97.54 0.000 420.24 80.76 0.000 2026.16 62.15
368985 64.59 0.000 54.64 54.70 0.222 245.08 30.39
369017 64.56 0.000 69.11 41.17 0.222 181.79 39.53
369052 64.31 0.000 70.30 47.70 0.000 455.50 36.14
369068 62.84 0.000 90.19 99.10 0.111 210.93 35.73
369125 86.12 0.036 66.79 75.85 0.222 CopyNumber 2q24.2 437
369285 183.68 0.000 62.35 137.25 0.222 34.54 60.02
369356 80.32 0.071 113.07 56.67 0.111 217.18 43.38
369606 78.57 0.071 63.17 66.71 0.111 145.32 32.96
369607 63.47 0.036 49.42 69.10 0.111 289.22 36.24 CopyNumber 4p16.3 758
369614 68.46 0.071 43.68 55.15 0.222 348.84 31.68
369615 89.80 0.071 29.44 70.80 0.222 118.05 30.52
369761 72.58 0.036 199.77 81.21 0.000 1028.59 25.79
369785 70.47 0.000 99.64 68.29 0.000 519.82 35.06
369920 77.09 0.000 168.51 77.20 0.111 505.36 31.36
370024 81.89 0.000 128.78 60.25 0.000 422.20 27.11
370247 75.77 0.000 233.67 70.23 0.000 40.90 41.82 CopyNumber 11q24.3 2355
370292 77.26 0.036 36.54 69.28 0.000 327.17 36.76 CopyNumber 10q26.2 2190
370312 65.22 0.036 69.14 59.74 0.222 173.14 30.85
370408 81.05 0.000 47.84 69.75 0.000 458.21 44.61 CopyNumber 22q11.21 3466
370581 86.13 0.000 191.83 64.65 0.111 579.49 33.71 CopyNumber 1p34.2 60
370770 84.48 0.036 95.64 93.45 0.111 452.54 31.23 CopyNumber 2p15 345
370771 118.09 0.036 242.66 151.31 0.222 251.27 55.14
370895 82.56 0.000 100.06 76.14 0.111 881.82 34.34
370927 121.90 0.036 52.90 64.05 0.222 432.84 47.49
370937 87.18 0.071 124.70 85.67 0.111 561.13 45.91
371001 69.51 0.000 170.33 68.79 0.111 454.07 35.94
371416 78.55 0.036 36.50 64.63 0.111 96.75 35.90 CopyNumber 19p13.2 3217
371563 63.43 0.036 59.64 75.25 0.111 202.76 25.54
371788 59.70 0.000 54.31 56.93 0.222 206.21 29.90
371889 68.61 0.000 325.06 67.81 0.000 936.64 56.60
372003 61.79 0.000 80.84 79.74 0.111 89.46 30.69
372050 66.34 0.071 46.09 73.62 0.222 82.63 32.40
372286 64.63 0.036 30.00 59.49 0.222 354.14 23.10
372331 89.80 0.036 81.60 144.08 0.222 232.33 49.08
372541 65.94 0.071 66.46 82.62 0.111 186.66 25.95
372616 72.02 0.036 35.25 60.41 0.222 143.19 33.51
372914 126.22 0.000 100.73 126.29 0.111 231.60 56.38
373550 88.97 0.036 184.03 68.60 0.222 209.76 48.79
373741 79.81 0.000 77.80 98.88 0.000 412.67 38.36
373763 63.54 0.036 195.53 52.32 0.111
373952 94.13 0.036 30.34 82.86 0.111 96.20 32.08 CopyNumber 17p13.2 2984
373959 63.44 0.000 33.58 71.55 0.000 183.05 41.76
374043 66.27 0.036 34.15 82.28 0.222 106.28 22.55
374257 90.84 0.071 57.56 72.95 0.222 65.71 68.99
374378 119.35 0.036 125.53 97.64 0.111 225.89 60.82
374477 56.99 0.000 105.78 48.32 0.000 246.92 24.70
374503 59.32 0.000 271.15 58.47 0.000 2139.38 28.45
374588 75.34 0.000 683.86 58.24 0.000 413.28 42.63
374596 85.39 0.000 2551.73 61.31 0.000 5206.59 33.30
374650 126.18 0.036 88.32 93.01 0.222 2238.80 53.03
374973 72.70 0.071 33.02 75.69 0.222 110.84 45.58
375001 70.26 0.000 87.30 74.38 0.222 100.50 40.21
375108 143.73 0.071 764.58 129.71 0.222 128.99 45.16
375217 66.70 0.000 45.51 78.12 0.222 38.58 33.48
376046 131.46 0.071 67.73 85.63 0.222 324.83 59.30
376933 85.54 0.000 188.71 94.17 0.111 932.24 43.14
377155 84.44 0.000 52.03 67.04 0.000 165.50 32.72
378103 84.12 0.036 640.07 72.81 0.000 2299.39 45.40 CopyNumber 19q13.43 3293
378532 74.21 0.071 19.77 57.36 0.222 143.45 34.11
378808 80.58 0.071 42.68 76.86 0.222 1023.41 32.72
380403 77.18 0.071 39.70 97.70 0.111 152.35 50.89
380774 69.78 0.036 367.07 72.51 0.000 704.94 28.60
380953 120.40 0.000 1164.30 50.87 0.000 4148.67 36.69 CopyNumber 17q25.1 3072
380973 66.60 0.000 541.31 51.30 0.000 636.85 33.23
381008 113.07 0.000 775.01 80.40 0.000 541.08 39.56
381058 58.41 0.036 40.33 63.46 0.222 25.40 47.69
381072 76.95 0.000 77.98 75.38 0.111 163.52 63.87
381123 73.37 0.000 1876.45 45.25 0.000 8803.79 35.35
381126 143.53 0.000 523.32 77.49 0.000 40.73 27.35 CopyNumber 5q33.1 1236
381189 74.68 0.036 232.19 94.40 0.000 495.84 37.72
381219 98.54 0.000 704.33 65.39 0.000 1933.04 37.91
381256 99.47 0.036 83.41 96.68 0.111 46.96 62.16
382044 92.25 0.036 85.09 76.07 0.111 98.39 41.13
382168 85.81 0.071 40.65 65.81 0.222 47.88 50.87 CopyNumber 20q13.12-20q13.13 3395
385913 75.07 0.071 85.26 93.35 0.222 200.81 51.44
385986 67.61 0.036 72.40 68.58 0.000 238.36 27.33
386434 72.97 0.036 52.83 73.51 0.111 344.41 26.93
386465 67.39 0.071 32.55 77.62 0.111 144.09 43.35
386939 79.30 0.036 38.64 50.55 0.111 171.14 24.98
387208 63.45 0.000 727.99 60.47 0.000 2811.53 37.85
387804 85.40 0.036 481.25 60.76 0.000 2686.84 38.70
388034 67.46 0.071 46.51 81.22 0.222 140.62 25.58
388654 81.47 0.000 93.30 67.09 0.111 637.15 55.44 CopyNumber 9q32 1992
388664 53.99 0.000 1460.59 41.29 0.000 6835.36 34.82
388739 68.80 0.036 122.75 82.72 0.111 520.74 24.62
388927 71.40 0.071 139.68 66.05 0.111 356.99 30.26
388956 85.77 0.036 71.01 94.85 0.111
389037 84.61 0.036 47.66 65.23 0.222 91.25 34.83
389107 94.66 0.036 263.90 108.16 0.000 892.91 48.86 CopyNumber 16p13.3 2866
389171 82.45 0.036 44.74 103.84 0.111 192.72 33.61
389649 125.20 0.036 163.93 82.73 0.000 425.65 32.06 CopyNumber 17q25.3 3084
389734 78.85 0.071 38.68 121.32 0.111 289.67 51.68
389996 180.39 0.000 327.19 82.08 0.000 1922.00 29.42
390667 74.42 0.000 105.64 80.72 0.111 468.47 48.33
393201 67.22 0.071 96.98 68.05 0.111 509.48 35.05
395482 65.92 0.036 44.74 59.27 0.111 102.70 40.91 CopyNumber 8q24.3 1874
396644 69.48 0.036 133.73 60.82 0.111 1142.75 35.09
396740 68.39 0.036 43.05 64.23 0.111 445.56 26.13
396783 118.29 0.036 110.63 82.09 0.111 261.57 76.08
397609 254.69 0.000 633.23 56.50 0.000 13138.69 29.06
399800 66.18 0.036 44.45 64.79 0.111 75.35 36.85
400295 72.44 0.000 2244.41 48.14 0.000 13951.77 33.35
401509 85.63 0.036 115.39 64.94 0.000 118.05 44.04
401903 90.23 0.000 453.74 70.31 0.000 114.88 45.33
401929 68.45 0.000 2446.06 47.57 0.000 4419.77 40.15 Inversion Xq28 3631
403917 63.27 0.071 80.15 43.62 0.222 142.49 52.88
404056 68.09 0.036 52.37 46.66 0.000 187.40 29.97
404321 116.89 0.000 104.40 74.14 0.111 419.99 34.26
405144 69.11 0.000 415.47 73.52 0.000 396.95 31.07
405410 76.64 0.071 78.70 71.34 0.000 433.35 42.84
405514 69.02 0.071 38.09 82.50 0.111 418.51 26.82 CopyNumber 17q21.32-17q21.31 3030
405590 81.80 0.036 169.04 77.14 0.000 245.79 24.62
405880 78.38 0.000 92.99 92.66 0.000 940.03 50.82
405942 83.39 0.071 57.96 72.26 0.000 158.43 35.77
406062 84.43 0.000 131.48 52.80 0.222 1502.27 27.41
406068 75.82 0.036 114.88 92.45 0.111 127.41 44.39
406096 82.28 0.036 155.28 110.89 0.222 111.15 33.70
406277 63.86 0.036 80.15 58.28 0.111 262.74 27.77
406300 110.40 0.000 1789.62 51.80 0.000 3379.42 39.25
406423 82.14 0.036 108.09 55.19 0.222 227.08 30.58
406510 99.80 0.000 362.39 97.60 0.000 1484.49 47.35
406520 68.92 0.000 79.16 46.52 0.000 552.71 43.50 CopyNumber 7q22.1 1598
406534 76.53 0.036 84.44 74.61 0.111 81.66 48.02 CopyNumber 19p13.3 3204
406590 80.43 0.000 116.59 54.77 0.111 3669.45 26.79
406620 105.57 0.000 937.84 74.78 0.000 CopyNumber 6p21.31 1319
406683 397.62 0.036 101.26 87.65 0.111 4567.96 36.31 CopyNumber 19p13.3 3198
406799 62.82 0.036 34.19 47.08 0.222 624.11 32.91
406840 63.67 0.071 35.33 63.00 0.222 417.25 27.92
407368 85.75 0.000 208.80 51.34 0.000 189.03 26.77
407580 55.41 0.071 40.52 91.55 0.111 136.75 49.37
407995 102.74 0.000 792.47 129.50 0.000 1327.53 53.18
408018 73.73 0.000 1638.52 53.51 0.000 1595.26 49.48
408073 101.78 0.000 1040.65 78.37 0.000 5022.25 35.22
408236 178.08 0.036 191.09 140.73 0.111 166.92 28.73
408257 73.75 0.000 176.37 73.95 0.000 346.00 33.39
408293 79.96 0.071 55.21 76.68 0.222
408324 79.03 0.000 70.97 91.67 0.222 261.14 38.52
408428 57.10 0.000 54.54 56.13 0.111
408581 168.89 0.000 47.66 93.70 0.111 22.32 70.59 CopyNumber 10p11.23 2079
408909 55.91 0.000 107.48 55.68 0.000 462.90 38.03 CopyNumber 5p13.3 1105
409140 68.36 0.000 146.00 65.13 0.111 1015.79 34.02
409223 88.98 0.000 109.75 63.00 0.111 1498.41 63.96
409230 77.08 0.000 45.77 60.03 0.222 368.93 29.50 CopyNumber 6p21.32 1314
409834 82.56 0.000 145.39 69.35 0.000 1395.23 31.06 CopyNumber 9q34.3 2030
410197 63.50 0.071 28.39 50.29 0.111 193.36 31.09
410596 66.47 0.071 34.69 51.96 0.111 972.56 29.87
410817 89.11 0.000 967.12 38.98 0.000 4919.57 40.81 CopyNumber 16q24.3 2972
411480 73.79 0.000 66.40 53.89 0.222 180.20 28.59 CopyNumber 2p13.1 356
411641 133.02 0.000 73.09 72.11 0.111 141.55 88.01
411847 71.19 0.036 79.52 59.04 0.000 277.48 39.90
412103 67.52 0.036 35.32 74.96 0.111 239.50 42.79 CopyNumber 13q12.11 2541
412117 79.30 0.036 72.03 73.91 0.111 106.69 32.88
412196 75.22 0.071 30.98 71.64 0.222 199.00 43.49
412433 63.22 0.036 78.22 90.02 0.111 272.65 29.98 CopyNumber 11q13.1-11q13.2 2278
412468 119.89 0.036 65.27 91.38 0.111 141.12 32.72
412842 70.86 0.071 69.10 79.95 0.111 232.58 28.04
413036 70.20 0.071 69.74 59.75 0.111 243.79 34.29
413482 80.49 0.036 49.57 57.15 0.111 337.81 43.89
414579 80.14 0.071 71.27 55.92 0.222
415342 79.01 0.000 111.61 77.60 0.222 459.69 25.69
416049 68.55 0.036 43.93 72.18 0.222 197.48 40.51
416436 70.64 0.000 58.84 53.49 0.000 108.37 40.38 InversionBreak 7q11.23-7q11.22 1569
point
CopyNumber
CopyNumber
417004 136.17 0.000 201.17 72.90 0.222 521.74 63.64
417029 74.72 0.036 99.27 71.29 0.000 200.46 37.83
418123 202.05 0.036 138.03 241.75 0.222 319.38 64.64 CopyNumber 9q21.33-9q22.1 1960
418175 85.40 0.000 67.13 69.58 0.111 354.32 39.90 CopyNumber 8q24.3 1880
418233 101.45 0.000 117.46 123.53 0.000 280.39 36.32
418450 105.88 0.000 56.80 81.39 0.222 159.74 29.02
418533 61.17 0.036 73.40 66.43 0.222 340.85 38.60
418668 90.41 0.000 162.79 95.51 0.111 100.95 36.86 CopyNumber 19p13.3 3198
419640 82.10 0.071 72.52 61.17 0.111 1390.88 23.87
420269 205.21 0.036 412.78 162.70 0.222 70.62 57.13
420272 65.09 0.000 101.26 85.37 0.000 239.55 31.21
421257 83.68 0.000 1327.95 45.08 0.000 5761.57 31.60
421509 88.01 0.036 110.18 89.29 0.000 938.99 34.34
422113 70.57 0.036 55.85 49.24 0.111 252.93 58.42 CopyNumber 10q26.3 2199
423935 65.96 0.000 87.90 52.75 0.222 148.10 43.63 CopyNumber 6p21.32 1314
423968 79.75 0.000 113.92 73.70 0.111 461.34 31.00 CopyNumber 7q22.1 1600
424126 98.54 0.000 300.03 49.27 0.000 154.40 28.34 CopyNumber 15q15.3 2771
424908 81.21 0.000 64.53 78.90 0.111 265.87 44.69
425777 80.47 0.036 77.84 85.16 0.111 366.93 47.98 CopyNumber 11q12.1 2261
426296 64.88 0.071 75.24 62.36 0.111 1457.22 32.65
426359 87.85 0.000 111.22 63.93 0.222 458.50 41.77
429052 92.93 0.000 242.82 57.76 0.222 1214.90 32.34
429353 79.94 0.036 65.42 71.89 0.111 343.74 43.42
429581 114.95 0.000 135.56 64.30 0.222 1000.39 35.21
429819 89.35 0.000 44.35 56.24 0.111 112.40 29.86
429839 70.25 0.036 59.72 96.19 0.000 526.01 27.93 CopyNumber 1p32.3 71
430425 77.22 0.000 63.83 73.92 0.000 645.48 26.65 CopyNumber 1p36.33 3
430551 76.02 0.000 71.02 65.06 0.000 221.97 39.09
430606 54.49 0.000 144.68 41.23 0.111 503.23 31.70
430657 80.31 0.071 49.61 85.30 0.222 278.49 29.31
430733 68.85 0.036 62.86 88.39 0.111 19.58 102.83
431101 80.78 0.036 82.46 93.00 0.111 302.22 42.11
431367 68.42 0.071 40.76 57.01 0.222 317.45 23.88
431498 58.31 0.000 50.68 71.27 0.111 215.07 31.63
431550 68.11 0.000 104.26 94.29 0.222 36.35 49.04 CopyNumber 2q11.2 384
431668 67.73 0.000 220.78 53.03 0.111 783.69 38.20
431850 72.50 0.036 34.04 80.31 0.111 12.95 42.74 CopyNumber 22q11.22-22q11.21 3472
431861 75.28 0.036 122.14 101.94 0.222 73.76 32.92
431926 135.79 0.071 84.76 110.75 0.222 190.15 30.68
432121 83.85 0.000 184.40 74.24 0.111 42.79 41.58 CopyNumber 19p13.13 3220
432438 80.60 0.071 52.75 89.48 0.111 211.51 33.45
432491 76.58 0.036 40.08 63.63 0.222 127.64 31.44
432690 65.69 0.000 31.94 67.02 0.222 611.10 28.10
432760 97.72 0.000 118.99 66.08 0.111 276.03 25.41
432898 79.34 0.000 1010.53 58.63 0.000 4901.72 34.25
432976 72.23 0.000 73.94 60.54 0.222 75.50 28.05
433154 96.48 0.071 34.89 56.17 0.222 376.16 26.85
433201 91.66 0.036 152.71 94.95 0.111 576.21 55.18
433222 103.15 0.036 189.47 72.45 0.000 1186.75 51.60
433291 85.16 0.071 76.18 72.63 0.111 114.48 38.12
483307 77.86 0.071 96.78 92.13 0.000 114.79 35.45
433343 65.49 0.000 184.42 53.88 0.000 291.09 38.55 CopyNumber 16p13.3 2866
433345 120.01 0.000 213.51 71.24 0.000 862.00 56.26
433419 60.89 0.000 500.10 50.66 0.000 1779.46 34.78
433512 84.34 0.071 85.96 81.88 0.222 1236.34 38.08
433529 170.20 0.036 2199.40 54.31 0.000 14172.61 40.90 CopyNumber 19q13.33 3277
433540 69.15 0.000 64.51 73.27 0.000 211.95 23.86
433573 63.03 0.000 57.01 59.43 0.111 123.88 31.69 CopyNumber 11q13.1 2276
433615 92.22 0.000 388.92 80.94 0.111 1034.66 46.90 CopyNumber 9q34.3 2030
433701 71.70 0.000 2139.00 50.10 0.000 7744.18 32.81
433722 74.06 0.036 27.81 59.03 0.222 141.76 60.11 CopyNumber 8p21.3 1710
433732 90.12 0.071 85.09 83.28 0.111 103.47 51.61
433750 73.70 0.000 60.65 76.09 0.222 80.25 36.40 CopyNumber 3q27.1 733
433759 58.35 0.000 139.75 61.48 0.111 411.26 35.14
433795 85.23 0.036 87.81 51.85 0.111 404.06 43.69
433863 66.30 0.000 430.25 65.24 0.000 1139.88 60.50
433901 72.42 0.000 618.72 88.72 0.000 1212.52 34.44
433951 77.15 0.000 631.83 67.81 0.111 627.74 38.31 CopyNumber 19p13.3 3198
434102 72.84 0.000 538.05 84.61 0.000 2487.38 32.06
434207 74.97 0.071 49.39 68.58 0.222 97.26 42.61 CopyNumber 20p11.23 3342
434219 137.02 0.036 51.48 60.93 0.222 80.88 28.08
434401 76.58 0.000 58.22 90.45 0.222 245.63 25.67
434937 79.45 0.000 143.66 68.38 0.111 736.59 35.97
434953 126.26 0.000 167.82 113.49 0.111 50.78 49.08
434980 73.22 0.000 373.57 81.91 0.111 63.94 46.60
435044 119.14 0.036 65.58 58.30 0.222 171.64 27.03 CopyNumber 22q13.31 3512
435064 53.57 0.071 27.55 70.25 0.222 213.71 32.00
435120 91.12 0.036 52.68 89.10 0.222 111.38 57.81
435136 83.96 0.000 172.33 62.24 0.000 53.09 51.23
435166 68.02 0.071 73.27 65.77 0.111 310.78 56.86
435231 128.11 0.071 40.03 61.55 0.000 85.70 26.38 CopyNumber 5p13.3 1105
435255 62.36 0.071 56.26 62.36 0.222 90.51 30.90
435326 74.42 0.071 49.09 59.90 0.222 78.17 52.63 CopyNumber 3q26.33 731
435512 77.87 0.000 34.15 50.88 0.222 190.85 63.23
435535 73.62 0.071 34.83 91.49 0.000 260.08 66.53
435610 69.17 0.000 86.37 78.22 0.111 404.43 20.92
435741 64.08 0.000 87.01 63.94 0.000 98.47 35.51 CopyNumber 16q23.2 2956
435759 74.67 0.071 52.90 67.87 0.222 332.76 29.01 CopyNumber 2q37.3 516
435771 67.86 0.036 56.30 74.26 0.111 90.36 28.25
435841 72.67 0.071 23.60 100.76 0.222 161.24 24.64
435850 84.40 0.036 105.96 99.27 0.111 267.53 47.21 CopyNumber 8q11.23 1756
435933 58.96 0.036 57.82 69.98 0.111 211.82 30.44
435948 62.53 0.036 29.62 71.91 0.222 149.70 30.57
435952 57.02 0.036 28.36 84.91 0.111 104.05 37.95
435974 78.61 0.071 68.25 91.00 0.222 218.66 65.62
436035 91.16 0.000 187.52 75.63 0.000 3174.68 46.99
436093 78.08 0.000 76.39 64.46 0.111 136.65 33.53
436204 64.95 0.036 29.22 78.13 0.222 250.23 22.99
436298 167.91 0.036 265.70 177.92 0.222 42.37 74.64
436405 77.90 0.036 27.67 56.95 0.222 313.71 26.76
436437 94.20 0.036 77.60 93.12 0.222 918.38 80.58
436446 66.68 0.000 99.63 53.06 0.111 309.25 35.80
436500 72.80 0.036 60.68 75.22 0.222 472.17 25.55 CopyNumber 7p13 1537
436568 131.69 0.000 1219.01 117.62 0.111 50.53 68.91
436578 90.18 0.000 113.73 79.39 0.000 140.58 43.95
436657 178.41 0.000 500.52 138.23 0.111 15.83 89.67
436687 75.22 0.000 611.23 84.03 0.000 638.97 31.31
436803 73.05 0.000 85.70 97.89 0.111 316.09 35.27
437056 103.58 0.036 43.41 77.96 0.222 163.82 26.89
437060 74.69 0.000 167.53 67.12 0.000 1114.79 54.47
437110 118.34 0.000 457.69 74.53 0.111
437178 108.35 0.000 118.41 93.36 0.000 491.49 49.15
437256 85.27 0.071 27.23 74.49 0.222 133.85 34.04
437277 113.92 0.036 112.16 68.25 0.222 562.98 51.58 CopyNumber 5q35.3 1271
437367 80.84 0.036 76.15 76.20 0.111 240.02 54.01
437388 92.45 0.071 42.31 57.64 0.222 238.37 40.11
437403 73.99 0.036 83.00 65.86 0.000 913.95 48.77
437594 63.31 0.000 2995.32 44.60 0.000 3402.65 43.18 CopyNumber 11p15.5 2200
437638 230.82 0.000 332.76 161.65 0.000 726.60 84.34
437779 79.94 0.000 162.25 59.57 0.000 1026.73 29.41
437831 69.32 0.071 42.55 70.99 0.222 349.70 25.46
438072 75.82 0.071 37.78 63.33 0.111 226.25 39.89
438219 66.65 0.071 41.29 63.30 0.222 161.95 25.67
438429 82.19 0.000 2234.04 58.24 0.000 4443.85 41.78
438678 95.46 0.000 66.45 74.83 0.111 417.69 43.11 CopyNumber 11p15.5 2200
438720 110.88 0.036 245.01 102.14 0.000 150.74 57.91 CopyNumber 7q22.1 1598
438970 65.73 0.036 35.85 46.43 0.111 1820.04 33.55
438974 65.29 0.036 44.97 79.81 0.111 CopyNumber 7q22.1 1603
439480 63.35 0.036 57.48 70.79 0.111 236.05 33.28
439481 387.86 0.000 88.09 67.88 0.222 169.24 40.86 CopyNumber 17q22 3047
439548 61.68 0.071 37.93 64.75 0.222 1054.07 45.16
439552 95.86 0.071 229.49 79.88 0.111 6558.96 35.24
439815 64.93 0.036 157.75 73.89 0.000 568.16 45.34
440382 63.06 0.000 67.84 45.41 0.111 163.60 26.30
440544 76.58 0.000 183.45 74.43 0.111 120.48 60.51 CopyNumber 1p36.11 46
440599 545.85 0.000 639.75 338.15 0.000 377.40 37.66
440604 69.40 0.000 120.21 77.49 0.222 219.86 29.08 CopyNumber 16q22.3 2941
440899 108.09 0.036 90.62 83.07 0.111 375.62 48.63
440932 67.69 0.000 103.15 59.03 0.111 1062.06 42.62 CopyNumber 17q25.2 3077
440960 72.81 0.071 47.81 52.64 0.111 258.65 30.69 CopyNumber 19p13.13 3220
440961 70.30 0.000 77.69 104.24 0.000 450.65 39.28
441072 127.50 0.000 185.74 85.71 0.000 731.13 33.84 CopyNumber 11p15.5 2200
441550 76.06 0.036 56.52 72.10 0.222 236.69 37.99
442344 88.49 0.071 72.66 94.29 0.000 207.03 63.14 CopyNumber 13q33.3-13q34 2880
442798 54.05 0.036 54.26 57.73 0.222 231.34 26.39
443134 85.46 0.036 64.44 87.35 0.222 198.90 27.17
443379 72.92 0.071 67.86 68.96 0.111 224.78 38.54
443837 77.55 0.071 46.32 62.18 0.222 174.43 34.43 CopyNumber 17q21.32 3031
443914 58.76 0.000 247.64 46.39 0.000 1457.78 49.68
444279 61.65 0.000 80.72 51.79 0.111 746.56 26.60
444356 57.17 0.036 92.25 70.76 0.222 182.95 39.12 CopyNumber 17q25.1 3073
444468 78.70 0.000 67.26 84.13 0.111 310.40 27.53
444472 73.19 0.071 54.83 62.43 0.111 195.91 35.50
444569 110.59 0.000 189.12 138.53 0.000 519.72 46.05
444673 71.14 0.036 92.42 75.43 0.111 67.52 34.65
444724 59.51 0.036 21.27 56.05 0.222 81.02 40.08
444818 72.48 0.071 40.54 62.78 0.111 209.04 23.65
444931 61.84 0.071 30.56 69.88 0.222 113.86 30.06
444969 72.90 0.071 59.68 83.21 0.000 136.35 35.35
444986 81.88 0.071 31.66 59.27 0.222 182.02 33.14
445081 108.71 0.036 70.28 132.55 0.222 544.37 97.39
445351 153.11 0.000 1533.86 144.30 0.111 39.15 60.06 CopyNumber 22q13.1 3496
445394 61.72 0.000 60.05 68.24 0.000 1169.19 31.54
445498 69.47 0.071 37.53 51.18 0.111 126.46 22.30 CopyNumber 14q24.3 2709
445511 100.89 0.071 43.28 70.81 0.222 220.12 43.86
445570 85.23 0.000 287.35 53.42 0.000 2381.68 28.41
445803 90.03 0.000 123.83 68.80 0.111 1202.42 33.85
445893 61.34 0.036 158.23 69.47 0.000 147.47 27.99
445977 66.19 0.036 69.10 64.20 0.111 644.29 43.60
446017 76.51 0.036 155.50 54.07 0.000 397.35 48.34
446091 71.17 0.036 85.02 65.59 0.111 941.23 28.02 CopyNumber 6q25.3 1460
446123 64.84 0.000 57.10 56.16 0.222 166.18 39.16
446149 93.31 0.000 369.45 112.87 0.000 1387.86 59.45 CopyNumber 12p12.1 2390
446260 71.29 0.000 126.46 62.05 0.111 720.78 37.72
446336 118.95 0.000 56.90 54.31 0.111 182.90 31.05
446345 75.64 0.000 2881.93 51.03 0.000
446414 79.62 0.036 56.65 96.50 0.111 83.57 42.55 Inversion 3q13.12 646
446427 55.94 0.000 444.92 41.01 0.000 1860.94 22.07 CopyNumber 19p13.3 3199
446445 117.64 0.000 85.11 64.37 0.111 220.61 30.91
446450 91.72 0.000 785.60 75.69 0.000 1838.91 35.62
446574 101.45 0.000 1048.70 47.73 0.111 4295.62 48.23
446588 74.06 0.000 514.97 50.47 0.000 10114.50 28.56
446623 59.32 0.000 440.12 53.84 0.000 280.15 39.09
446628 69.18 0.000 1715.03 60.31 0.000 4069.97 36.87
446641 74.66 0.000 70.78 78.14 0.000 226.36 28.05
446852 65.91 0.036 169.80 67.64 0.000 1472.64 39.26 CopyNumber 22q13.1 3496
447477 59.67 0.036 112.12 53.27 0.222
447492 70.38 0.000 576.32 85.45 0.111 128.97 28.68
447547 68.05 0.036 63.65 59.13 0.222
448226 91.01 0.000 1605.76 74.12 0.000 1886.46 41.47
448588 89.27 0.000 289.59 98.53 0.222 1421.10 61.15
448646 106.73 0.000 2172.80 57.81 0.000
448879 104.70 0.071 169.47 88.62 0.000
449114 62.43 0.000 277.65 67.95 0.111 25.47 56.84
449171 78.63 0.000 672.77 37.65 0.000 CopyNumber 9q21.32 1957
454534 72.76 0.036 51.63 64.52 0.222 87.97 34.37 CopyNumber 19q13.12 3247
454699 69.32 0.071 522.93 101.80 0.000
456507 68.08 0.036 50.47 65.93 0.222 358.16 38.22
456557 65.44 0.036 88.99 75.61 0.222 120.23 30.51 CopyNumber 1p34.1 66
458320 67.14 0.071 31.00 50.77 0.222 136.02 27.81
458358 94.79 0.071 58.21 86.21 0.222 256.39 41.07
458414 135.42 0.036 193.99 95.48 0.222 1264.21 74.29
458458 96.04 0.000 151.41 91.30 0.000
458747 58.82 0.036 95.42 71.07 0.222 98.53 30.78
459106 67.41 0.036 30.94 43.03 0.222 350.68 35.89
459149 77.24 0.071 63.96 81.98 0.222 208.67 32.53
459174 64.84 0.071 65.88 81.46 0.111 430.22 38.61
459211 74.24 0.071 63.93 96.88 0.111 121.40 39.40 CopyNumber 15q25.3 2828
459596 97.43 0.036 59.17 70.19 0.111 97.92 30.16 CopyNumber 16p13.3 2866
459649 98.22 0.071 74.77 93.41 0.111 141.86 39.47 CopyNumber 16p13.3 2866
459927 87.23 0.000 2248.86 63.06 0.000 1030.19 45.59 CopyNumber 2q37.1 507
459940 87.15 0.000 129.67 70.79 0.222 677.27 59.84
460238 100.06 0.000 31.15 69.28 0.000 250.78 29.94
460317 72.75 0.036 35.75 55.10 0.222 115.06 30.41
460336 67.69 0.071 40.70 46.75 0.000 45.79 44.88
460468 64.03 0.036 56.42 63.75 0.111 230.88 23.36 CopyNumber 16p11.2 2900
460499 92.61 0.071 48.97 54.21 0.000 37.47 53.32 CopyNumber 16p11.2 2900
460574 83.01 0.071 78.45 91.21 0.111 746.92 27.83
460923 71.51 0.036 28.17 61.28 0.222 152.22 22.68 CopyNumber 16q21 2926
460929 96.28 0.071 141.87 83.05 0.111 370.86 56.55 CopyNumber 16q21 2926
460978 73.44 0.036 49.25 81.01 0.222 250.20 31.68
461047 103.47 0.071 67.54 106.04 0.111 70.12 87.63
461131 122.98 0.036 127.62 157.34 0.222 76.67 41.61
461361 78.50 0.036 30.76 40.03 0.222 174.78 41.86 CopyNumber 16q23.1 2944
461379 83.32 0.000 96.52 91.91 0.111 641.27 33.25
461722 71.51 0.000 48.48 53.92 0.111 186.99 29.54 CopyNumber 16q24.3 2971
461777 79.87 0.000 81.52 105.93 0.111
461896 75.47 0.000 126.02 74.34 0.000 134.80 28.05
461925 71.77 0.000 103.12 73.82 0.222 147.49 38.95
462035 62.46 0.000 66.85 67.94 0.111 216.51 26.40 CopyNumber 17p13.2 2983
462086 56.55 0.036 58.35 72.87 0.111 140.21 27.82 Inversion 17p11.2 2999
462306 151.24 0.036 384.89 136.76 0.111 93.89 42.37
462316 52.50 0.036 45.98 51.91 0.000 305.99 31.78
462492 75.74 0.000 101.26 70.86 0.222 889.15 34.30
462550 77.59 0.036 37.84 47.17 0.111 481.28 40.17
462956 121.13 0.071 41.50 83.60 0.111 272.89 75.13
462998 165.03 0.000 412.00 132.76 0.222 318.32 32.43
463010 74.65 0.036 48.26 79.91 0.000 297.90 46.77 CopyNumber 17q21.2 3021
463035 84.60 0.036 88.96 78.41 0.222 29.55 123.40
463041 60.04 0.000 61.76 105.33 0.111 85.41 37.40 CopyNumber 1p36.23 24
463059 99.58 0.000 97.24 64.76 0.000 708.36 33.04
463295 128.90 0.000 22.01 67.66 0.222 89.26 24.02 CopyNumber 17q21.32-17q21.31 3030
463506 144.88 0.036 69.53 99.95 0.000 311.25 41.57 CopyNumber 17q22 3044
463702 182.82 0.071 17.71 63.68 0.222 71.51 32.11
463797 86.43 0.071 35.50 77.38 0.222 60.88 56.60
464071 87.71 0.000 221.39 89.76 0.000 219.07 81.15 CopyNumber 1p36.22 27
464137 80.94 0.036 49.33 90.69 0.000 60.37 44.17
464210 106.68 0.000 141.21 95.75 0.111 537.14 49.17
464336 99.04 0.000 283.74 88.39 0.000 2084.95 55.71 CopyNumber 17q25.3 3087
464438 107.95 0.036 166.40 112.66 0.000 98.95 38.69
464472 95.86 0.000 207.88 42.93 0.000 1126.38 32.54
464595 58.98 0.000 59.05 58.88 0.111 215.87 47.07 CopyNumber 18p11.22 3100
464652 61.77 0.036 54.95 54.53 0.222 517.28 24.42
464912 70.39 0.000 76.41 70.71 0.111 213.12 37.13
465224 72.99 0.036 75.36 57.77 0.222 700.57 30.47
465374 103.77 0.071 157.39 115.14 0.000 330.15 48.22
465498 68.89 0.000 88.16 71.12 0.111 400.88 28.38
465529 122.89 0.036 107.98 78.16 0.111 288.27 45.92 CopyNumber 19p13.3 3198
465543 63.89 0.071 84.61 58.95 0.111 64.19 57.71
465627 70.89 0.000 133.95 67.91 0.000 301.85 37.18 CopyNumber 19p13.3 3205
465645 77.44 0.000 75.74 54.65 0.000 386.74 35.78
465808 66.58 0.000 143.70 66.22 0.111 434.39 30.19
465849 69.39 0.000 91.55 80.10 0.111 44.47 66.21
465924 84.07 0.036 50.18 61.81 0.222 165.00 42.35 CopyNumber 1p36.13 35
466044 72.79 0.036 84.23 68.24 0.111 73.78 52.32 CopyNumber 19p13.12 3223
466088 111.92 0.000 181.29 71.15 0.111 179.65 56.72
466148 84.06 0.000 97.34 76.06 0.111 203.63 72.98
466471 105.82 0.000 168.18 142.62 0.000 626.83 50.67
466693 102.86 0.000 67.60 126.08 0.222 176.70 34.39
466766 118.35 0.036 34.50 83.74 0.222 45.08 45.77
466775 79.83 0.036 68.63 60.69 0.222 244.72 28.23 CopyNumber 19q13.2 3260
467084 54.54 0.036 34.59 66.69 0.222 99.92 38.09 CopyNumber 1p36.12 37
467097 76.10 0.036 128.68 86.64 0.111 397.83 35.85 CopyNumber 19q13.33 3276
467192 73.99 0.000 138.33 71.24 0.111 315.89 28.78
467279 53.14 0.000 77.66 63.14 0.111 125.33 61.82 CopyNumber 19q13.42 3287
467284 110.65 0.036 1280.99 75.58 0.000 CopyNumber 19q13.42 3287
467408 83.16 0.000 325.76 90.96 0.111 393.32 76.72
467637 49.68 0.000 192.26 43.69 0.111 218.92 31.71 CopyNumber 1p36.12 39
467696 92.22 0.000 54.70 92.68 0.111 81.56 46.18
467701 84.27 0.036 80.50 96.79 0.222 611.36 76.96
467807 67.35 0.000 271.07 62.85 0.000 1249.38 26.16
467824 65.40 0.036 37.46 47.95 0.222 425.41 25.22
467960 55.30 0.071 78.25 53.53 0.222 1591.91 35.68
468018 78.99 0.000 181.90 57.84 0.111 221.20 50.86
468415 66.24 0.071 77.48 62.56 0.111 149.98 25.30 CopyNumber 2p21 325
468442 60.35 0.000 431.37 47.50 0.000 3361.97 24.79
468760 79.05 0.036 31.54 72.64 0.111 405.11 28.06
469022 70.82 0.071 71.82 59.11 0.111 223.87 28.02
469171 71.16 0.071 32.92 79.80 0.222 196.57 24.11
469331 87.59 0.000 191.43 51.78 0.111 1314.48 35.64 CopyNumber 2q11.2 378
469820 71.71 0.000 38.70 85.72 0.222 246.69 30.95 CopyNumber 2q14.2 402
469863 57.98 0.000 457.07 59.63 0.000
469925 77.87 0.000 361.73 80.70 0.000 456.73 35.81 CopyNumber 2q14.3-2q21.1 410
469970 76.12 0.000 60.03 58.11 0.000 250.41 21.69
470091 62.78 0.000 636.64 72.45 0.000
470233 104.74 0.071 31.04 74.54 0.111 227.42 28.85
470417 65.73 0.000 36.16 73.00 0.222 240.63 29.90 CopyNumber 1p35.2-1p35.1 53
470477 78.56 0.000 176.13 76.36 0.000 704.61 35.82 CopyNumber 1p35.2-1p35.1 53
470577 112.63 0.000 64.25 63.02 0.000
470588 62.13 0.000 49.83 47.08 0.222 38.39 32.85
470943 79.99 0.036 73.35 126.49 0.222 655.85 58.91
471011 67.05 0.071 67.25 53.93 0.222 121.32 42.55
471104 89.45 0.000 149.19 59.04 0.111 602.32 48.56
471207 63.61 0.071 49.29 54.88 0.222 136.91 52.19
471441 78.02 0.000 176.65 89.29 0.111 498.87 39.72
471461 73.53 0.071 32.43 58.01 0.222 196.76 59.72
471593 53.91 0.071 36.64 49.61 0.222 288.93 31.86
471768 90.76 0.071 70.68 83.24 0.111 111.27 42.60 CopyNumber 1p34.3 57
471818 63.33 0.071 35.69 55.32 0.111 1268.99 34.78
471851 70.38 0.000 115.85 67.87 0.111 499.38 30.04
471873 109.74 0.071 97.75 113.82 0.111 48.62 53.92
471933 63.18 0.000 202.14 53.09 0.000 624.43 29.36
471975 70.45 0.071 36.48 73.24 0.222 242.80 24.13 CopyNumber 20p13 3306
472010 105.00 0.000 67.84 111.58 0.222 155.71 45.29
472024 64.21 0.036 69.70 48.63 0.111 1913.94 28.06
472031 59.04 0.000 211.67 50.43 0.111 CopyNumber 4q24 915
472038 67.26 0.071 32.17 50.19 0.111 123.01 32.36
472056 68.89 0.036 112.97 60.49 0.111
472119 66.76 0.071 31.86 112.28 0.222 139.92 34.83
472185 78.25 0.000 242.12 90.19 0.000 1069.96 32.56
472213 95.80 0.071 41.74 48.04 0.111 48.90 42.31
472330 96.95 0.036 69.76 90.01 0.111 465.49 45.06
472475 69.13 0.000 78.28 70.30 0.000 139.49 37.18
472535 99.64 0.071 77.90 44.78 0.222 199.94 32.50 CopyNumber 1p36.33 2
472558 74.34 0.000 132.04 58.70 0.000 639.31 31.64
472651 79.84 0.000 36.65 74.11 0.222 314.39 34.69
472737 61.99 0.071 43.99 48.64 0.222 363.10 33.74 CopyNumber 20q12 3378
473296 84.70 0.000 63.19 58.70 0.222 168.83 41.41 CopyNumber 20q13.33 3420
473583 80.46 0.000 514.27 77.95 0.000 1676.15 36.77
473648 73.17 0.036 64.60 71.35 0.222 102.03 32.42
473721 128.82 0.000 134.23 123.75 0.111 33.23 53.19
473761 72.57 0.000 132.69 52.87 0.111 657.85 38.65
473788 64.69 0.000 111.64 71.83 0.222 157.28 26.24
474005 61.86 0.000 75.34 61.40 0.111 478.66 29.39
474010 78.81 0.000 59.76 58.87 0.222 891.19 36.45
474053 147.51 0.000 499.17 168.59 0.222 29.70 60.90
474083 72.19 0.036 75.46 78.10 0.111 114.78 33.60
474213 79.94 0.000 36.27 50.63 0.222 196.39 29.08
474584 80.62 0.071 112.70 73.66 0.000 162.31 31.89
474643 74.60 0.000 58.12 75.67 0.222 795.97 39.57 CopyNumber 22q12.3 3485
474751 97.07 0.000 78.94 84.91 0.222 372.66 35.97 CopyNumber 22q12.3 3492
474833 89.25 0.036 58.59 72.73 0.111 237.54 48.09
474914 69.41 0.036 62.09 108.62 0.111 72.32 40.96
474938 60.89 0.036 23.46 63.42 0.222 59.35 36.45
474949 73.51 0.036 92.75 72.43 0.111 309.31 39.95
474982 85.98 0.000 78.19 80.45 0.111 320.54 79.01 CopyNumber 22q13.2 3503
475125 207.12 0.000 64.68 86.52 0.222 119.70 27.01
475319 67.49 0.036 43.01 77.46 0.222 62.08 33.32
475382 139.32 0.036 33.09 54.60 0.222 133.66 23.64
475392 65.47 0.036 34.18 68.93 0.222 258.78 29.27
475663 63.62 0.000 53.92 65.40 0.111 432.72 25.21
475733 81.21 0.036 146.31 89.30 0.222 173.94 39.02
475812 68.94 0.071 52.89 70.48 0.222 1013.17 36.02
476018 69.79 0.000 149.54 73.93 0.000 200.35 60.22
476033 64.70 0.000 34.53 60.01 0.111 864.12 31.66 CopyNumber 1p32.3 71
476179 79.60 0.000 59.30 85.57 0.111 194.12 38.59 CopyNumber 3p21.31 580
476221 67.55 0.000 66.80 51.17 0.222 603.05 35.35
476231 80.66 0.000 113.22 65.22 0.111 228.30 24.27
476308 72.23 0.000 22.50 50.59 0.222 178.95 107.93 CopyNumber 3p21.1 590
476365 67.35 0.036 87.65 77.78 0.111 406.18 49.02 CopyNumber 1p32.3 73
476448 82.54 0.036 26.09 48.03 0.111 273.21 70.63
476706 89.82 0.000 112.58 110.62 0.222 81.22 37.20
476930 58.53 0.000 66.80 47.34 0.111 174.86 28.52
477157 67.07 0.000 152.23 52.84 0.111
477789 79.84 0.000 117.57 72.54 0.222 721.27 53.90
477892 78.36 0.036 57.25 57.97 0.222 310.08 37.49
478000 64.58 0.071 50.48 78.17 0.111 341.67 50.94 CopyNumber 3q25.2 695
478044 91.75 0.000 243.91 67.91 0.000
478553 71.73 0.000 280.28 57.47 0.000 1815.88 27.23 CopyNumber 3q27.3 735
479208 70.67 0.036 49.83 85.49 0.222 273.64 45.06 CopyNumber 4p15.33-4p15.32 780
479264 90.31 0.036 53.68 100.71 0.222 408.08 53.78 CopyNumber 4p15.32 782
479634 68.03 0.036 41.66 53.90 0.000 172.97 40.28 CopyNumber 4p13 831
479693 56.38 0.000 130.06 53.34 0.111 284.38 38.70
479728 83.62 0.000 3178.15 102.50 0.000 4934.56 42.86 CopyNumber 12p13.31 2368
479747 70.99 0.036 64.38 45.15 0.222 7.50 52.67 Inversion 16q23.1 2943
CopyNumber
479814 68.90 0.071 58.18 86.26 0.111 282.68 26.04
480073 71.32 0.036 300.48 64.32 0.000 630.71 24.05
480311 89.15 0.036 59.40 90.37 0.222 67.76 39.38
480465 68.49 0.036 34.96 55.94 0.111 256.72 29.28
480653 90.52 0.000 190.63 63.63 0.222 682.67 41.50
481571 70.58 0.000 535.04 63.11 0.000 1077.46 44.16
481720 79.80 0.036 93.11 81.12 0.222 200.72 60.41
481898 73.18 0.000 50.50 72.53 0.111 147.39 32.08 CopyNumber 1p22.2 109
482144 85.86 0.000 471.96 66.50 0.000
482363 60.86 0.000 36.22 51.54 0.222 233.09 31.51
482526 63.94 0.000 168.03 60.84 0.000 627.83 38.92
482868 62.26 0.000 47.36 57.55 0.111 85.83 30.54
483036 86.03 0.071 34.06 72.88 0.222 186.72 49.93
483067 195.81 0.000 113.05 119.75 0.222 107.96 48.75
483305 77.80 0.000 53.80 57.74 0.222 1552.44 38.45 CopyNumber 5q31.1 1221
483408 59.58 0.000 101.17 58.25 0.222 332.91 23.51
483454 95.38 0.000 276.29 56.43 0.222 240.02 66.66
483486 70.29 0.071 53.21 62.00 0.111 273.51 21.50
484138 135.13 0.071 55.94 56.87 0.222 135.74 33.03 CopyNumber 5q35.1 1257
484188 89.14 0.071 98.14 90.97 0.111 1025.85 27.84 CopyNumber 5q35.2 1260
484242 68.78 0.000 36.97 64.48 0.222 152.49 26.36
484288 72.10 0.000 44.27 51.35 0.222 205.62 31.99
484363 74.19 0.000 128.94 71.40 0.000 135.92 30.55
484551 83.81 0.071 35.00 75.65 0.111
484813 92.28 0.071 140.15 85.01 0.222 357.48 42.75
485155 104.91 0.000 1053.71 62.95 0.000 233.33 38.86
485195 72.46 0.036 32.33 115.62 0.222 98.61 44.74
485246 89.00 0.036 63.99 82.34 0.222 305.16 41.61
485262 65.94 0.000 121.08 68.51 0.111 1132.47 23.10
485365 89.21 0.036 50.62 83.69 0.222 24.30 39.23
485616 118.44 0.036 54.62 126.87 0.222 202.89 41.15
486542 66.70 0.036 40.95 55.22 0.111 532.52 25.97
487027 102.66 0.036 172.51 92.92 0.000 456.64 51.77
487054 83.58 0.000 196.99 81.02 0.111 96.63 33.00 CopyNumber 6q25.3 1460
487635 90.09 0.036 87.13 86.36 0.111 418.48 59.45
487774 69.59 0.000 441.11 76.24 0.000 858.14 28.90
488171 78.74 0.000 1889.50 43.31 0.000 205.88 23.98
488181 66.18 0.000 72.82 72.57 0.111 150.84 51.09
488307 118.69 0.000 40.98 83.43 0.222 116.63 31.66
488478 63.31 0.000 60.31 56.88 0.222 531.39 27.89 CopyNumber 7q11.21-7q11.22 1563
488671 63.52 0.000 66.99 86.38 0.222 146.22 35.88 CopyNumber 7q11.23-7q11.22 1569
489207 229.58 0.036 95.96 93.07 0.000 100.25 84.19 CopyNumber 7q21.3 1596
489284 174.12 0.000 270.09 108.06 0.111 502.47 67.41 CopyNumber 7q22.1 1597
489287 72.56 0.000 89.22 87.25 0.111 137.90 40.47 CopyNumber 7q22.1 1597
489336 73.40 0.036 29.14 50.97 0.222 434.70 40.35
489615 157.53 0.000 87.65 120.96 0.111 238.13 62.54
490203 94.98 0.000 149.77 111.35 0.222 71.14 35.48
490394 80.08 0.036 124.86 65.68 0.000 343.69 34.12
490415 84.59 0.000 165.38 70.44 0.111 321.85 40.17
490745 67.85 0.000 174.03 73.05 0.111 107.47 33.33
490795 84.72 0.036 61.57 91.56 0.222 366.95 44.62
490874 71.64 0.071 51.50 59.92 0.222 199.27 40.49 CopyNumber 1q22 160
491336 79.86 0.071 26.67 61.36 0.222 59.45 31.69
491359 117.62 0.000 444.58 141.63 0.000 144.60 37.95
491440 84.00 0.000 127.99 68.91 0.111 584.73 41.60
491494 76.88 0.000 179.06 70.15 0.111 578.57 38.69
491597 68.90 0.071 78.66 71.01 0.111 47.73 29.91
491695 61.10 0.036 47.66 66.95 0.111 115.13 36.13 CopyNumber 8q11.21 1744
491745 79.23 0.036 91.43 97.21 0.222 517.81 34.02 CopyNumber 8q11.23 1756
491988 80.07 0.036 148.34 53.25 0.000 761.27 37.05
492236 58.47 0.071 53.23 50.26 0.111 378.81 31.38
492314 134.13 0.000 280.47 119.64 0.111 867.01 82.56
492445 79.94 0.071 34.07 68.47 0.222 235.18 33.32
492599 63.87 0.000 104.23 64.07 0.222 1025.28 42.75
492805 98.49 0.071 45.41 54.06 0.222 714.35 33.62
493362 78.53 0.036 36.00 66.40 0.111 1207.36 49.22
493750 62.06 0.036 19.06 55.52 0.222 369.95 32.38
494173 148.42 0.000 295.60 110.96 0.111 876.15 113.53
494419 79.67 0.000 84.24 54.97 0.222 1836.27 27.61
494457 75.88 0.000 131.41 71.03 0.111 140.35 49.81
494604 77.33 0.000 102.64 45.34 0.000 1093.70 32.75
494614 67.07 0.071 131.49 59.76 0.111 271.73 34.09
494691 100.32 0.000 1473.17 85.74 0.000 1356.61 41.82 CopyNumber 17p13.2 2984
494700 111.44 0.036 45.03 71.95 0.222 142.65 50.45 CopyNumber 9q31.1 1982
494985 58.47 0.000 23.54 51.61 0.111 69.32 28.36
495039 77.88 0.000 53.22 87.48 0.111 241.85 32.88
495349 51.38 0.000 73.03 68.57 0.000 128.78 41.86
495471 132.48 0.000 61.04 104.84 0.222 111.31 28.11 CopyNumber 9q34.3 2030
495605 103.21 0.000 259.83 98.52 0.000 1069.64 37.36 CopyNumber Xp22.33 3522
495851 103.41 0.036 155.32 96.68 0.000 133.50 48.69
495960 75.83 0.071 89.70 72.01 0.222 23.52 45.21
496068 80.35 0.036 68.03 85.57 0.222 133.18 34.99
496098 67.73 0.036 47.15 59.31 0.222 174.56 31.62
496271 89.89 0.071 67.91 73.61 0.222
496487 88.77 0.000 227.53 59.84 0.111 1039.79 27.70
496646 74.01 0.071 51.96 94.43 0.222 242.03 33.02
496684 91.16 0.000 90.84 89.82 0.111 116.47 51.77 CopyNumber Xq24 3603
497183 76.76 0.036 93.97 66.65 0.111 259.92 53.23
497599 111.15 0.036 134.22 94.08 0.111 192.73 115.77
497692 81.57 0.036 38.61 69.57 0.222 88.50 26.06 CopyNumber 1q32.3 223
497893 70.25 0.036 80.49 54.75 0.222 85.47 38.00 CopyNumber 1q42.12 234
498239 85.83 0.071 42.11 68.85 0.222 313.30 70.17
498313 73.37 0.071 61.83 57.22 0.222 166.23 33.54
498317 97.53 0.036 34.96 52.65 0.222 241.17 32.40
498455 60.99 0.071 41.69 52.75 0.222 159.22 29.80
498548 65.53 0.036 83.74 56.09 0.111 544.75 28.88
498727 212.50 0.000 375.51 152.25 0.111 393.92 82.64
499145 63.76 0.036 90.25 49.65 0.000 362.61 30.38 CopyNumber 10p12.1 2075
499158 77.10 0.036 36.41 89.25 0.111 487.66 24.83 CopyNumber 22q13.1 3496
499594 68.79 0.000 38.30 61.11 0.111 43.26 67.66 CopyNumber 10q11.23 2097
499833 65.54 0.036 31.78 67.31 0.111 65.25 48.78
499891 64.27 0.036 90.85 48.08 0.000 119.21 32.55
499925 99.08 0.071 47.23 93.94 0.111 425.42 26.54
499960 53.38 0.036 75.36 58.96 0.111 230.51 30.46
500067 91.39 0.000 42.67 83.69 0.222 85.13 38.67
500101 91.91 0.000 122.55 71.82 0.222 523.98 46.28
500375 72.57 0.000 42.54 60.50 0.111 173.31 57.99
500409 90.31 0.000 97.98 79.16 0.222 111.85 38.24 CopyNumber 10q23.2 2151
500546 80.29 0.071 32.37 73.60 0.222 114.50 26.14
500674 61.65 0.036 100.83 54.64 0.111 101.84 40.78
500775 56.77 0.000 154.32 52.88 0.111 358.69 18.38
500842 76.32 0.000 109.14 53.92 0.000 70.07 32.85
500874 92.56 0.000 190.37 116.30 0.000 302.13 30.53
501012 80.92 0.036 59.53 67.35 0.222 56.69 51.38
501023 76.62 0.036 34.17 71.76 0.222 359.89 46.05
501203 60.32 0.036 58.65 70.61 0.000 203.01 29.78
501293 159.72 0.000 331.94 61.09 0.111 257.95 64.96
501309 91.32 0.000 179.56 76.44 0.000 74.58 38.37 CopyNumber 19p13.3 3198
501353 76.11 0.000 85.50 67.94 0.111 165.38 38.49 CopyNumber 19p13.3 3199
501376 74.39 0.000 46.23 52.90 0.222 117.83 30.84 CopyNumber 10q26.2 2190
501420 72.23 0.071 51.43 76.62 0.222 8.49 69.55
501629 193.96 0.071 304.65 100.03 0.000 1073.10 56.96
501684 67.20 0.071 72.15 58.11 0.111 182.45 25.59 CopyNumber 11p15.4 2203
501735 80.80 0.036 48.77 90.13 0.222 66.88 36.29 CopyNumber 11p15.4 2205
501853 66.72 0.036 45.46 83.18 0.111 258.40 27.75 CopyNumber 11p15.4 2212
501924 70.20 0.036 22.66 58.29 0.111 CopyNumber 11p15.3 2216
501991 74.39 0.071 51.32 69.18 0.222 239.62 40.48
502302 104.67 0.036 65.09 114.45 0.111 58.12 61.81
502328 105.65 0.036 192.87 102.65 0.000 277.01 57.86 CopyNumber 11p13 2243
502461 88.29 0.000 63.08 66.07 0.222 92.47 41.06
502528 68.66 0.000 135.26 95.87 0.111 414.87 34.37 CopyNumber 11p11.2 2254
502630 86.54 0.000 188.95 62.55 0.111 974.26 31.28
502659 83.71 0.000 137.92 78.61 0.000 418.65 40.34 CopyNumber 1p13.2-1p13.1 141
502705 75.99 0.000 63.68 62.88 0.222 200.89 34.78
502745 116.28 0.000 165.50 152.75 0.111 33.94 90.81
502769 70.29 0.000 127.45 65.13 0.000 146.88 43.18 CopyNumber 11q12.3 2269
502773 85.33 0.000 36.02 52.79 0.222 382.36 89.13
502823 89.25 0.000 97.58 72.37 0.000 1483.75 48.37
502829 49.99 0.000 140.90 56.82 0.000 377.34 29.68 CopyNumber 11q13.1 2274
502836 80.42 0.000 108.10 81.32 0.222 186.99 39.86
502842 98.83 0.071 91.38 63.44 0.111 262.91 27.81
502872 160.73 0.000 168.69 130.10 0.111 162.72 27.57
502876 121.94 0.036 240.25 126.64 0.111 1110.19 63.79
503093 105.81 0.000 272.03 101.56 0.000 1003.83 41.56
503222 70.44 0.000 78.57 60.15 0.111 436.02 32.33
503251 75.49 0.036 52.37 80.76 0.000 269.32 30.58 CopyNumber 11q13.4 2286
503597 72.02 0.036 44.54 65.19 0.222 993.22 28.63
503709 80.48 0.036 56.09 56.61 0.000 359.18 41.09
503716 74.54 0.036 67.10 57.41 0.111 401.83 39.72 CopyNumber 11q22.3 2327
503787 62.10 0.036 88.32 64.96 0.222 94.48 36.57
504237 84.57 0.071 67.58 73.38 0.111 96.18 41.40
504517 74.64 0.000 2607.18 71.46 0.000
504613 89.25 0.000 223.84 85.33 0.111 62.36 60.07
504620 86.81 0.000 160.25 104.00 0.111 1302.64 32.11
504687 187.11 0.000 417.49 95.88 0.222 784.44 114.26
504828 60.20 0.036 35.05 61.58 0.222 272.03 32.15
504895 88.83 0.000 185.08 83.41 0.000 509.46 28.54
505033 85.57 0.071 37.32 52.34 0.000 231.87 47.13
505059 69.53 0.000 146.67 85.08 0.000 401.54 42.58
505625 85.89 0.036 105.74 98.40 0.111 141.17 35.31
505652 54.99 0.000 128.09 56.80 0.000 337.62 27.67
505676 67.86 0.036 90.76 76.70 0.222 152.86 29.88
505705 81.22 0.000 811.93 36.92 0.000 2225.97 26.97 CopyNumber 12q13.2 2429
505806 90.69 0.036 62.89 118.65 0.222 193.34 42.44
505824 125.62 0.071 46.25 72.86 0.111 171.87 30.26 CopyNumber 22q13.31 3505
506215 79.99 0.000 94.43 66.41 0.000 157.71 28.13
506325 83.72 0.071 84.67 58.55 0.111 347.25 61.58
506759 118.14 0.036 94.62 70.61 0.111 37.81 36.31
506861 78.06 0.000 95.81 90.86 0.000 79.06 33.92
507074 74.70 0.000 83.96 62.86 0.222 432.06 61.29
507162 98.40 0.000 29.80 68.25 0.111 92.08 59.64
507584 68.17 0.000 150.24 63.80 0.000 369.22 38.69
507680 54.78 0.036 49.68 77.53 0.222 203.53 42.58
507910 69.11 0.000 69.36 64.68 0.111 88.32 41.59
507916 97.27 0.036 192.99 102.63 0.000 52.82 43.91
508010 93.45 0.036 32.99 90.85 0.222 166.37 35.28
508644 68.43 0.036 49.21 55.85 0.222 110.99 40.54
509163 93.24 0.036 35.34 54.15 0.222 375.23 41.32
509226 88.83 0.000 236.57 70.64 0.000 179.58 33.62
509264 71.38 0.000 82.07 77.38 0.000 427.67 35.66
509414 89.01 0.036 72.77 69.54 0.000 512.55 27.88
509622 105.94 0.036 112.54 148.47 0.000 237.96 45.40
509736 72.67 0.000 720.87 60.73 0.111 4674.01 38.38
509791 66.04 0.036 289.40 66.68 0.000 2482.97 38.50
509909 66.97 0.036 31.58 63.60 0.222 102.28 29.40
510087 96.58 0.036 144.88 56.65 0.000
510328 60.49 0.000 87.51 60.32 0.111 344.12 27.98
510402 70.87 0.071 74.30 67.71 0.222 332.17 39.17
511067 63.37 0.071 30.52 92.27 0.222 178.77 26.75
511138 72.01 0.071 51.32 77.97 0.111 386.10 50.09 CopyNumber 15q15.1 2768
511149 73.09 0.071 47.43 61.92 0.222 219.59 40.88
511425 66.07 0.000 306.59 64.17 0.000 766.85 32.72
511504 156.60 0.036 118.98 198.75 0.222 93.53 41.90
511862 113.15 0.036 78.27 91.67 0.111
511952 83.56 0.036 45.39 80.23 0.222 280.77 42.92
512005 86.15 0.000 177.05 97.71 0.000
512465 60.22 0.000 101.69 51.11 0.000 1328.32 37.34
512525 140.21 0.000 564.24 59.56 0.111 CopyNumber 15q25.2 2822
512607 74.76 0.000 66.75 86.55 0.111 188.34 40.78
512640 95.97 0.036 87.26 49.87 0.000 353.07 25.39
512661 114.56 0.036 78.95 73.16 0.111 225.56 27.09
512676 89.69 0.036 472.46 56.90 0.000 3826.23 33.98
512693 65.72 0.071 32.21 61.74 0.222 243.81 32.66 CopyNumber 14q11.2 2641
512756 68.12 0.071 36.00 87.05 0.222 82.76 24.22 CopyNumber 22q11.21 3469
512815 57.32 0.000 72.82 58.05 0.222 349.78 23.00 CopyNumber 19p13.3 3199
512857 98.39 0.000 389.64 108.93 0.000 236.30 44.67 CopyNumber 11p15.5 2200
512867 145.32 0.000 57.53 59.42 0.111 756.60 42.54
512908 81.46 0.000 139.12 83.26 0.000 529.32 26.51
513043 79.47 0.036 65.23 53.50 0.222 200.34 26.92
513055 71.45 0.036 46.53 69.38 0.111 428.66 34.03
513057 72.89 0.000 108.87 84.74 0.000 172.47 40.79
513058 89.89 0.000 89.17 120.69 0.111 251.55 55.04
513071 80.98 0.036 61.02 85.52 0.111 416.01 37.15
513083 90.78 0.000 747.03 87.03 0.000 13273.59 32.07
513141 104.92 0.000 106.35 102.92 0.222 68.76 57.99 CopyNumber 15q26.1 2836
513145 72.65 0.000 82.48 62.05 0.111 690.46 36.42 CopyNumber 15q26.1 2836
513153 127.64 0.036 57.82 56.98 0.000 112.68 79.81
513230 68.82 0.036 88.04 62.79 0.111 102.18 30.45 CopyNumber 16p13.3 2866
513242 76.58 0.036 70.14 78.60 0.000 134.47 29.60 CopyNumber 16p13.3 2866
513261 83.40 0.036 100.06 63.05 0.000 66.99 49.34 CopyNumber 16p13.3 2866
513266 88.47 0.000 43.44 51.74 0.222 420.41 37.37 CopyNumber 16p13.3 2866
513470 74.31 0.071 23.98 100.87 0.222 126.44 34.12 CopyNumber 16p11.2 2900
513488 126.33 0.071 80.83 109.04 0.111 135.41 35.18
513490 141.10 0.000 600.22 108.89 0.000 1936.06 50.21 CopyNumber 16p11.2 2903
513520 74.53 0.036 51.84 63.38 0.222 107.26 38.88
513522 86.72 0.000 262.60 56.68 0.000 109.64 38.78
513631 66.09 0.036 43.26 73.49 0.222 231.71 24.36
513856 69.11 0.000 58.26 78.43 0.111 50.56 33.92
513984 103.20 0.036 56.92 80.13 0.111 110.00 28.54 Inversion 17p11.2 2999
514012 104.20 0.000 68.14 88.15 0.222 111.02 33.44
514036 78.04 0.071 40.32 72.95 0.111 150.39 21.29
514038 71.06 0.071 98.33 73.54 0.222 282.81 33.39
514174 127.42 0.036 218.64 117.36 0.111 423.86 101.58
514196 72.49 0.000 707.66 61.15 0.000 8554.76 27.60 CopyNumber 17q21.31 3024
514211 139.51 0.036 50.70 81.92 0.222 182.87 97.71
514216 73.83 0.000 115.83 85.67 0.111 792.84 46.18
514220 104.37 0.000 175.85 118.04 0.222 722.34 44.39
514297 72.66 0.036 77.55 75.65 0.222 353.72 26.50 CopyNumber 17q21.32 3034
514303 86.25 0.000 174.64 95.39 0.222 134.97 51.53 CopyNumber 17q21.33 3035
514435 68.14 0.036 40.72 84.74 0.222 147.89 37.81 CopyNumber 16q22.1 2937
514489 80.99 0.071 44.98 74.04 0.000 217.12 36.85
514535 115.82 0.036 81.79 89.33 0.222 806.22 54.38
514581 87.86 0.000 2385.84 64.09 0.000 12015.94 27.98 CopyNumber 17q25.3 3086
514590 79.57 0.000 82.16 60.88 0.111 270.30 30.55
514819 63.43 0.000 91.91 57.33 0.111 146.77 39.49 CopyNumber 17q12 3015
514870 75.67 0.036 116.52 66.41 0.111 1076.27 31.74
514920 70.87 0.036 42.93 92.05 0.222 305.87 26.30 CopyNumber 17q21.32 3034
514934 64.83 0.000 93.36 57.74 0.222 489.19 36.29 CopyNumber 1p13.2-1p13.1 141
515003 90.52 0.000 73.12 71.02 0.111 244.41 34.43 CopyNumber 19p13.3 3198
515005 84.23 0.036 84.14 115.67 0.111 111.71 28.21 CopyNumber 19p13.3 3198
515018 81.16 0.036 38.38 92.19 0.222 975.69 36.28 CopyNumber 17q24.1 3057
515053 79.56 0.036 327.53 82.45 0.000 130.71 37.38 CopyNumber 19p13.3 3201
515070 61.50 0.000 1309.96 51.55 0.000 2287.41 36.04
515092 92.89 0.071 63.55 123.14 0.222 142.44 34.66
515155 77.95 0.000 107.39 48.32 0.222 1314.81 29.66
515162 99.70 0.000 174.56 65.50 0.111 738.50 33.21 CopyNumber 19p13.13 3220
515164 83.59 0.000 81.45 86.75 0.222 111.33 38.03
515210 159.79 0.000 500.13 127.33 0.111 405.99 51.27
515255 77.20 0.000 150.61 99.16 0.000 275.62 55.00
515266 74.02 0.036 54.18 59.54 0.222 129.69 29.52
515271 69.78 0.071 36.74 77.34 0.111 130.40 32.76
515329 66.72 0.000 534.24 65.17 0.000 3426.69 32.80 CopyNumber 1p36.31 17
515371 70.79 0.000 343.10 48.33 0.111 1005.23 29.71
515406 149.32 0.000 65.79 61.04 0.222 287.02 37.67 CopyNumber 19q13.2 3259
515417 66.12 0.000 107.98 54.42 0.000 153.02 44.34 CopyNumber 19q13.2 3260
515432 97.88 0.036 44.58 59.07 0.111 404.46 33.77
515472 85.54 0.000 277.80 71.92 0.000 1110.26 42.17
515475 68.85 0.071 36.35 61.24 0.222 28.67 48.11
515487 274.74 0.000 142.33 104.31 0.111 173.36 32.28
515494 119.52 0.071 146.78 92.71 0.111 112.41 47.69 CopyNumber 19q13.32 3268
515500 76.81 0.000 102.79 91.08 0.222
515515 49.82 0.000 182.19 48.37 0.000 152.89 38.45 CopyNumber 19q13.32 3273
515517 88.12 0.000 299.84 58.12 0.000 7157.08 36.30
515524 71.77 0.000 80.95 66.53 0.111 391.51 35.24 CopyNumber 19q13.33 3275
515540 75.18 0.000 189.06 82.37 0.111 165.22 50.26 CopyNumber 19q13.33 3278
515550 69.11 0.000 172.43 76.53 0.111 561.99 34.69
515598 74.86 0.071 38.40 66.79 0.111 138.35 27.47
515607 65.02 0.036 55.58 56.62 0.111 158.32 52.15 CopyNumber 19q13.42 3288
515642 65.18 0.000 99.65 61.65 0.000 197.53 45.80
515785 105.76 0.036 219.93 101.68 0.000 214.35 62.17
515846 76.72 0.036 69.80 136.41 0.222 151.33 51.40 CopyNumber 19q13.33 3276
515848 79.47 0.000 50.31 62.08 0.111 672.95 55.07
515890 80.81 0.036 100.90 82.45 0.111 935.79 30.21 CopyNumber 2p23.2-2p23.1 300
516075 80.99 0.036 54.66 76.57 0.222 157.18 35.84
516077 82.82 0.071 56.97 75.78 0.000 146.37 36.19
516087 72.96 0.071 33.52 80.94 0.222 302.28 19.82
516111 89.42 0.000 51.66 89.35 0.222 183.74 28.09 CopyNumber 2p13.1 356
516114 76.16 0.071 48.69 52.22 0.111 215.69 73.89 CopyNumber 2p13.1 356
516157 71.75 0.000 187.71 78.16 0.000 146.38 36.40
516450 82.86 0.000 54.05 65.03 0.222 129.56 29.36 CopyNumber 2q14.3-2q21.1 410
516522 78.65 0.000 43.56 73.85 0.222 158.20 39.84
516539 64.18 0.000 157.83 64.03 0.111 335.66 28.98
516587 75.09 0.036 89.91 71.91 0.111 266.02 25.33
516633 70.34 0.036 119.71 62.46 0.111 38.49 36.65 CopyNumber 2q32.1 456
516711 87.42 0.000 50.69 95.23 0.222 148.16 36.16
516790 76.19 0.071 46.62 74.67 0.222 107.23 36.95
516807 71.31 0.000 60.83 83.48 0.222 86.90 29.56 CopyNumber 2q37.3 516
516826 108.19 0.071 35.66 84.03 0.111 151.54 92.04
516855 76.73 0.000 81.22 90.29 0.111 67.23 34.92
517080 76.28 0.071 23.53 51.42 0.222 79.83 30.97
517106 158.42 0.036 155.61 98.37 0.222 1027.69 57.60
517134 72.40 0.000 77.76 62.28 0.111 210.01 25.80
517145 114.98 0.036 448.32 88.56 0.000 135.06 29.88
517168 83.39 0.000 616.48 87.90 0.000 607.75 49.57
517216 119.03 0.000 135.47 130.41 0.222 76.10 46.15
517232 73.76 0.071 32.93 49.49 0.111 125.67 43.67
517240 62.59 0.036 68.91 63.03 0.111 546.02 33.01
517262 56.95 0.036 106.71 47.20 0.000 453.65 25.51
517293 86.33 0.000 196.11 66.38 0.111 1344.41 51.31
517338 80.24 0.000 77.61 75.20 0.111 340.46 41.14
517342 163.80 0.071 33.97 52.74 0.222 152.42 25.59
517356 140.28 0.000 114.91 84.11 0.222 170.23 74.30
517357 55.86 0.000 28.35 52.86 0.111 107.26 33.50 CopyNumber 22q11.21 3463
517421 80.19 0.000 44.23 77.66 0.222 119.57 29.20 CopyNumber 22q11.21 3467
517438 78.06 0.036 26.64 70.20 0.222 67.48 48.02
517517 71.96 0.036 47.98 48.58 0.222 59.52 37.67
517543 68.12 0.036 74.51 88.10 0.111 83.91 46.35
517582 97.38 0.071 65.71 77.50 0.222 104.81 77.46
517622 74.85 0.000 74.01 87.22 0.222 166.60 36.65
517641 62.07 0.036 22.98 61.04 0.222 296.00 30.89
517666 82.83 0.036 80.25 64.44 0.222 667.96 39.27 CopyNumber 22q13.2 3504
517731 91.26 0.000 65.22 73.35 0.000 220.84 43.41
517768 117.43 0.036 25.76 80.17 0.222 508.84 63.13
517792 64.90 0.000 96.83 54.04 0.000 859.89 24.77
517817 69.75 0.071 33.30 51.38 0.111 305.79 29.77
517821 70.35 0.000 131.04 69.12 0.000 671.35 29.32
517888 77.52 0.036 95.09 58.38 0.222 103.41 36.07
517948 68.83 0.036 63.83 84.82 0.222 141.09 23.16 CopyNumber 3p21.31 580
517949 71.07 0.036 123.55 64.91 0.222 203.81 34.54
517969 81.54 0.036 84.63 88.21 0.222 142.60 39.43
517981 78.80 0.000 22.98 50.79 0.222 103.97 29.66 CopyNumber 3p21.31 586
518060 65.51 0.036 134.03 74.66 0.000 392.29 40.39
518123 62.29 0.036 95.99 66.38 0.111 474.82 27.22
518236 84.23 0.036 80.10 61.00 0.000 319.95 36.04
518244 55.08 0.000 111.32 61.11 0.000 314.23 33.48 CopyNumber 3q21.3 668
518249 60.78 0.000 175.57 66.17 0.111 786.47 28.84
518250 62.86 0.036 67.52 62.70 0.111 145.96 34.99
518265 54.39 0.000 141.98 43.28 0.000 341.22 32.71
518326 63.93 0.036 210.14 56.18 0.000 903.16 40.84
518346 76.42 0.000 96.28 40.13 0.111 1384.11 39.61 CopyNumber 3q25.31 703
518374 194.16 0.000 83.91 105.38 0.111 228.30 73.20 CopyNumber 1q25.2-1q25.3 186
518424 65.39 0.000 65.91 71.07 0.111 472.78 36.48
518460 86.56 0.000 144.56 61.00 0.111 474.56 36.78 CopyNumber 3q27.1 733
518464 78.82 0.000 131.96 60.97 0.222 341.49 43.16 CopyNumber 3q27.1 733
518525 108.66 0.000 559.19 97.79 0.000 1176.03 58.17
518551 87.47 0.000 989.61 83.61 0.000
518608 66.98 0.036 53.34 50.94 0.222 233.50 33.35
518609 135.38 0.000 166.56 130.43 0.111 588.35 32.89
518750 94.60 0.000 288.21 79.65 0.000 1360.79 25.92
518805 142.88 0.000 1068.25 127.25 0.000 249.62 81.08
518827 57.74 0.000 355.52 56.22 0.111 84.24 38.17
519276 93.94 0.000 113.47 81.01 0.000 230.33 36.58 CopyNumber 1q32.1 213
519304 60.54 0.036 36.33 87.42 0.222 114.84 33.78
519346 66.16 0.071 34.53 74.90 0.222 314.36 37.07 CopyNumber 5q12.3 1140
519347 68.95 0.071 34.71 73.49 0.222 207.52 27.55
519520 70.03 0.000 741.35 73.96 0.000
519523 81.66 0.000 55.73 84.24 0.222 3.52 261.11
519557 79.60 0.000 93.24 91.88 0.111 2662.06 27.88
519718 67.90 0.036 45.99 67.49 0.000 115.89 35.44
519756 92.45 0.071 40.69 113.09 0.222 132.53 29.71 CopyNumber 5q35.1 1258
519818 97.23 0.000 59.90 67.91 0.111 188.05 33.00 CopyNumber 5q35.3 1273
519909 101.05 0.000 244.91 76.44 0.222 117.68 50.36
519930 69.33 0.036 121.92 56.23 0.111 110.92 29.41
520026 87.98 0.000 108.58 87.98 0.222 62.19 41.41
520028 222.76 0.000 1404.48 164.02 0.000 1040.72 63.83
520037 63.50 0.071 45.72 74.52 0.222 158.73 56.07
520070 64.71 0.000 185.65 53.29 0.111 672.92 34.49
520140 84.60 0.036 75.11 85.11 0.111 74.72 42.98
520189 97.80 0.036 77.42 57.29 0.222 38.86 41.39
520205 70.26 0.000 81.96 68.26 0.222 596.12 27.17
520210 74.37 0.000 122.94 70.34 0.222 538.81 39.96
520287 65.65 0.071 131.99 67.30 0.111 252.76 37.55
520313 83.70 0.036 103.31 73.66 0.000 842.14 32.44
520383 69.15 0.036 54.79 74.80 0.222 51.28 37.61
520421 121.20 0.071 155.06 87.58 0.111 2195.13 80.88
520459 84.53 0.000 159.85 66.78 0.111 399.69 40.23 InversionBreakpoint 7q11.23 1572
CopyNumber
520623 81.68 0.036 27.31 61.61 0.222 248.55 33.13
520640 91.02 0.000 1961.29 60.59 0.111 5036.63 31.42 CopyNumber 7p22.1 1487
520740 85.41 0.000 97.72 112.58 0.111 187.18 70.60
520794 70.80 0.036 49.78 44.95 0.111 40.24 56.59 CopyNumber 7p13 1537
520898 110.99 0.000 400.82 102.01 0.000 21.23 57.80
520943 59.21 0.000 305.60 62.29 0.000 662.42 26.48
520967 70.34 0.000 252.42 65.79 0.000 120.89 29.85 CopyNumber 7q11.23 1572
520973 130.49 0.000 298.97 145.41 0.111 1152.33 82.08 CopyNumber 7q11.23 1572
520974 80.79 0.036 179.20 74.93 0.111 1930.00 33.13 CopyNumber 7q11.23 1572
521064 70.08 0.071 60.61 80.98 0.111 558.65 43.97
521151 85.62 0.036 47.47 134.19 0.222 127.30 30.14
521289 65.97 0.036 64.57 62.31 0.222 236.18 49.64
521487 69.54 0.000 276.67 67.15 0.000 538.96 41.02
521640 133.20 0.000 85.15 63.55 0.111 298.27 31.34
521809 69.55 0.000 72.24 94.32 0.000 125.31 30.12 CopyNumber 9q34.3 2030
521903 143.71 0.000 176.08 67.76 0.000 27.38 72.01
521924 82.37 0.036 59.55 73.11 0.111 401.23 45.90
521969 86.81 0.000 55.63 96.01 0.000 400.95 33.05
521973 80.96 0.036 39.93 90.53 0.111 142.18 54.69
522074 162.66 0.071 183.70 145.60 0.000 75.36 43.60
522110 63.85 0.071 29.44 57.72 0.222 152.37 38.21
522114 58.16 0.000 93.47 54.91 0.000 909.36 30.72
522310 102.19 0.036 111.23 114.70 0.111 227.49 72.44
522373 177.96 0.000 134.50 163.88 0.111 1015.67 83.01
522394 84.47 0.000 695.64 96.96 0.000 892.36 34.63
522463 71.14 0.000 4621.60 78.17 0.000
522507 66.02 0.036 114.54 64.14 0.000 369.13 29.46 CopyNumber 9q34.3 2030
522584 80.07 0.000 1864.38 65.53 0.000 2817.95 42.35
522590 65.85 0.000 87.04 74.78 0.111 155.78 39.35
522632 157.61 0.000 149.26 117.91 0.111 1399.30 82.97
522665 99.28 0.071 78.39 77.48 0.111 169.43 65.16
522675 68.02 0.071 35.39 56.96 0.222 89.16 49.55
522752 63.85 0.036 65.13 87.37 0.111 226.13 30.00
522817 92.87 0.000 243.72 76.57 0.000 446.45 43.91
522819 75.66 0.000 128.02 77.03 0.000 442.54 53.56
522823 65.96 0.000 55.52 55.51 0.111 80.40 39.08 Inversion Xq28 3631
522932 74.41 0.071 62.12 87.31 0.222 932.94 35.74 CopyNumber 10q11.23 2097
522995 72.57 0.000 92.76 85.46 0.222 155.41 29.78
523004 91.74 0.000 1093.46 104.71 0.000 1020.96 39.57
523012 151.59 0.036 108.27 101.71 0.111 460.74 105.86
523054 58.03 0.000 85.81 56.99 0.111 215.84 28.86 CopyNumber 1p36.11 48
523131 64.37 0.036 54.95 87.13 0.000 176.91 27.06
523145 77.65 0.000 77.46 74.44 0.000 713.08 34.57
523215 72.87 0.000 87.19 71.68 0.111 515.77 29.73 CopyNumber 10q24.31 2164
523238 72.68 0.000 120.04 66.25 0.222 77.37 32.28
523262 70.08 0.036 131.35 69.97 0.000 1073.88 31.10
523299 84.00 0.071 94.08 72.86 0.222 94.93 27.98
523302 73.40 0.036 52.80 58.41 0.111 39.16 33.68
523560 81.28 0.000 971.82 62.39 0.000
523680 83.52 0.000 107.04 96.51 0.111 160.42 34.93
523789 160.56 0.000 399.15 138.88 0.000 126.46 81.17
523829 93.80 0.036 62.35 75.95 0.111 128.33 63.45
523836 118.62 0.000 551.15 91.25 0.000 692.25 64.89 CopyNumber 11q13.1-11q13.2 2278
523852 122.32 0.000 140.78 82.29 0.222 223.69 123.19 CopyNumber 11q13.2-11q13.3 2280
523875 85.23 0.036 67.45 82.01 0.222 138.28 32.54
524009 72.05 0.071 48.51 71.53 0.222 181.41 38.91
524081 79.74 0.036 25.40 66.56 0.222 131.07 30.87
524084 71.59 0.000 52.46 63.40 0.222 310.09 30.43
524161 56.55 0.071 58.04 46.88 0.000 158.34 33.48 CopyNumber 10p13 2062
524171 65.02 0.036 39.20 45.15 0.222
524183 99.77 0.036 250.38 82.32 0.111 259.10 66.52 CopyNumber 12p13.33 2363
524195 77.48 0.036 45.90 110.88 0.222 329.67 54.17
524214 65.06 0.000 93.97 80.62 0.111 429.42 38.04
524219 102.77 0.000 1283.75 138.72 0.000 1413.03 41.62
524271 101.04 0.000 72.07 117.41 0.111 303.87 28.52
524367 97.52 0.000 23.68 69.12 0.222 212.52 34.89
524395 160.71 0.071 629.43 152.46 0.111 691.04 113.98
524464 63.84 0.000 249.77 51.93 0.111 800.60 36.87
524502 63.30 0.036 38.16 53.21 0.222 35.02 67.39 CopyNumber 12q13.2 2429
524530 62.04 0.071 58.64 69.36 0.222 119.54 33.29
524590 62.24 0.071 32.90 59.64 0.222 168.27 24.98 CopyNumber 12q21.1 2454
524599 101.39 0.036 171.63 88.17 0.111 877.45 45.68
524690 157.16 0.071 37.45 91.05 0.222 129.11 25.70 CopyNumber 1p34.2 60
524788 66.86 0.071 46.71 77.38 0.222 152.65 26.13
524809 81.00 0.071 32.60 68.39 0.222 71.44 35.75
524899 64.26 0.000 95.67 74.61 0.222 638.70 30.17
524920 66.48 0.000 61.67 67.69 0.111 789.95 26.29
524969 65.49 0.000 50.51 61.47 0.222 159.56 35.37
525134 62.67 0.036 52.40 77.61 0.222 157.75 32.67
525163 68.79 0.036 118.15 66.40 0.000 209.09 38.04
525232 89.47 0.036 78.60 84.11 0.000 536.96 31.58
525238 93.87 0.000 59.16 67.35 0.111 602.44 37.66
525330 77.23 0.000 183.06 61.77 0.000 381.49 40.05
525391 59.57 0.036 42.13 65.68 0.222 156.20 32.83 CopyNumber 1p32.3 74
525527 71.43 0.071 100.14 58.46 0.111 184.06 29.23 CopyNumber 1p36.33-1p36.32 4
525626 70.54 0.036 28.27 80.56 0.222 93.85 33.60 CopyNumber 14q32.33 2747
525899 90.18 0.000 114.54 61.10 0.222 197.83 28.39
526464 68.99 0.036 26.13 58.80 0.222 142.58 30.88 CopyNumber 15q24.1 2808
526521 96.01 0.000 250.88 101.74 0.000 147.15 33.86
527105 68.10 0.000 371.42 53.26 0.000 445.41 26.61
527193 66.74 0.000 1409.75 60.87 0.000 54.69 37.93
527348 68.02 0.071 31.17 107.14 0.111 156.88 41.93
527412 112.08 0.036 111.78 104.84 0.222 954.00 37.46
527861 75.05 0.000 174.55 93.72 0.000 778.13 44.76
527862 77.71 0.000 121.83 69.64 0.222 CopyNumber 16p13.3 2866
527980 93.19 0.000 140.08 80.91 0.111 72.21 28.28 CopyNumber 15q21.1 2774
528050 86.07 0.071 39.50 93.86 0.222 153.01 24.84
528222 71.25 0.000 56.92 67.43 0.222 297.99 38.18
528300 70.72 0.071 37.21 64.60 0.111 143.10 32.16 CopyNumber 10p15.2-10p15.3 2038
528305 69.32 0.000 323.87 54.84 0.000 1767.97 27.06
528572 107.18 0.036 40.58 69.71 0.222 121.35 39.94 CopyNumber 8p21.3 1710
528668 82.67 0.000 640.96 72.93 0.000
528780 78.91 0.036 95.64 74.72 0.111 545.27 28.60
528803 63.96 0.000 69.19 61.88 0.222 637.49 39.09 Inversion 16p12.2-16p12.1 2894
529059 86.70 0.000 155.84 79.33 0.000 436.61 43.10 CopyNumber 19p13.2 3216
529132 101.86 0.000 206.58 89.23 0.000 607.67 37.45
529244 79.26 0.036 48.81 59.97 0.222 299.18 31.69 CopyNumber 2q12.2 387
529280 59.84 0.036 42.59 87.27 0.222 122.27 29.28
529303 118.67 0.000 324.14 115.14 0.111 857.43 38.03
529369 89.29 0.000 25.26 76.50 0.111 9.01 69.95
529400 76.13 0.000 40.63 114.07 0.111 32.05 45.08
529420 107.73 0.000 106.80 48.77 0.000 56.41 37.58
529591 68.74 0.000 78.81 61.99 0.111 467.29 39.56
529618 87.09 0.036 82.62 91.59 0.111 36.01 56.84 CopyNumber 3q29 753
Inversion
CopyNumber
529631 74.72 0.000 620.31 56.60 0.000 176.79 30.79 CopyNumber 3q29 755
529782 58.53 0.000 130.67 66.49 0.000 146.41 27.77
529798 75.07 0.000 328.92 49.58 0.000 1755.52 30.60
529862 62.81 0.000 117.16 56.20 0.222
529890 63.76 0.000 331.32 41.79 0.000 3988.58 27.20 CopyNumber 5q35.3 1270
529892 108.94 0.036 139.13 107.43 0.222 CopyNumber 5q35.3 1271
529957 57.49 0.036 71.45 52.24 0.000 242.41 35.55
530096 68.28 0.000 137.92 57.16 0.111 422.18 29.43
530118 65.41 0.000 57.21 50.39 0.111 386.79 22.90
530291 94.65 0.000 62.14 78.23 0.000 77.23 37.30
530314 113.91 0.000 72.35 69.84 0.111 135.51 32.51 CopyNumber 9q34.3 2030
530331 79.95 0.071 96.65 72.31 0.111 393.16 48.43
530381 84.23 0.000 44.92 94.49 0.111 740.81 47.85
530412 108.42 0.000 884.31 121.35 0.000 755.69 25.73
530436 68.51 0.036 39.15 65.12 0.000 89.36 36.15
530479 68.09 0.071 50.16 67.87 0.222 130.74 30.76
530687 76.35 0.000 123.16 101.20 0.111 388.74 29.72 CopyNumber 11p15.5 2200
530734 78.25 0.036 43.82 67.00 0.222 203.80 36.73
530753 64.89 0.000 122.19 58.43 0.111 1049.37 27.21
530823 71.41 0.036 34.72 46.24 0.111 219.78 24.63
530862 76.97 0.071 24.06 57.79 0.111 216.03 27.91 CopyNumber 12q13.12 2421
531081 144.33 0.000 188.82 111.97 0.111 1778.83 73.47
531089 64.92 0.000 58.25 72.81 0.222 240.62 40.78
531176 69.91 0.036 192.02 57.22 0.111 407.01 25.65
531330 73.90 0.000 113.07 68.46 0.111 834.17 46.89 CopyNumber 9p24.3 1883
531614 75.55 0.071 84.93 89.38 0.111 260.94 66.65
531752 65.88 0.071 46.35 66.00 0.000 53.66 35.52
531856 113.19 0.000 567.60 102.77 0.000 10.32 101.76
531876 75.41 0.036 87.48 59.71 0.222 539.73 29.29
531879 73.81 0.071 33.40 53.04 0.111 88.51 36.03
532359 71.75 0.000 899.39 67.01 0.000 3112.89 40.25
532399 60.44 0.071 53.30 56.19 0.111 556.41 25.27
532755 59.70 0.071 35.53 57.88 0.222 174.78 35.47
532790 82.55 0.000 83.21 52.24 0.222 153.66 31.53
532793 105.70 0.036 160.69 81.87 0.111 299.76 37.08 CopyNumber 17q21.32 3031
532803 110.79 0.000 194.85 85.55 0.111 251.26 89.23
532826 124.52 0.036 436.04 83.52 0.000 55.92 39.14
532853 75.00 0.000 86.71 66.43 0.111 104.95 47.87
533030 90.84 0.036 91.99 90.93 0.111 235.53 30.97 CopyNumber 22q13.1 3496
533059 100.23 0.000 432.63 104.06 0.111 952.40 34.46 CopyNumber 6p21.33 1312
533122 60.64 0.071 124.04 67.72 0.000 610.09 26.23
533136 71.52 0.000 67.48 58.25 0.111 202.24 47.72 CopyNumber 4p16.2 761
533192 67.13 0.036 119.13 68.06 0.000 390.25 37.80
533222 60.55 0.071 36.87 44.13 0.111 164.72 28.30 CopyNumber 5q12.1 1137
533245 65.70 0.036 46.71 63.31 0.111 179.53 24.31 CopyNumber 5q31.1 1222
533282 56.67 0.000 183.69 77.18 0.000 1100.81 25.29
533308 68.45 0.036 48.77 64.22 0.222 202.26 24.39
533317 143.97 0.000 745.87 104.93 0.111 2393.96 70.88
533437 71.07 0.036 132.40 64.32 0.222
533440 143.68 0.036 45.51 61.68 0.222 235.54 58.67
533474 59.55 0.036 53.89 75.77 0.111 128.82 31.21
533479 69.59 0.036 96.22 76.98 0.111 86.44 31.09
533526 71.06 0.000 49.86 57.89 0.111 218.93 31.26
533624 70.85 0.000 959.57 58.54 0.000 1867.45 27.19
533712 65.23 0.036 55.59 73.88 0.222 259.05 30.12
533732 65.50 0.000 204.31 50.13 0.000 1297.83 21.87
533771 93.54 0.000 50.24 77.32 0.222 1094.17 25.43 CopyNumber 16p13.3 2866
533782 221.65 0.036 544.77 104.33 0.222 29.71 50.29
533977 109.58 0.071 160.18 105.13 0.111 1758.85 51.28 CopyNumber 1q21.1 147
533985 197.67 0.036 55.92 64.84 0.111 188.23 31.85
533986 68.64 0.036 24.58 130.07 0.222 179.95 28.58
534125 142.62 0.000 832.59 105.81 0.111 4813.26 38.31 CopyNumber 6p21.33 1313
534168 75.97 0.036 323.99 55.72 0.000 1011.41 45.93 CopyNumber Xq24 3602
534212 77.33 0.000 43.32 66.35 0.222 99.62 33.06 CopyNumber 1q21.1 147
534255 96.87 0.000 2910.69 103.61 0.000 4736.90 32.54 CopyNumber 15q21.1 2773
534307 90.48 0.036 47.43 99.71 0.111 237.12 58.21
534314 85.64 0.000 902.22 82.80 0.000 123.06 45.02
534326 91.25 0.000 113.47 96.69 0.111 398.89 46.54
534338 66.09 0.036 78.26 71.00 0.222 158.13 58.47 CopyNumber 16p11.2 2903
534346 77.56 0.000 650.12 74.11 0.000
534350 71.06 0.071 29.73 56.39 0.222 141.64 41.82
534453 90.65 0.000 296.51 95.48 0.000 624.74 38.70
534456 130.28 0.000 192.47 72.01 0.000 88.66 32.89 CopyNumber 17q25.3 3087
534457 62.64 0.071 61.53 74.61 0.000 730.32 25.54
534473 63.86 0.071 93.62 63.87 0.222 453.91 46.23
534483 56.84 0.071 41.04 62.68 0.222 271.95 33.02
536275 69.43 0.071 36.99 76.62 0.222 305.46 30.60
541269 79.15 0.000 244.71 86.94 0.000
546248 137.05 0.036 819.47 122.30 0.000 277.15 66.77
546250 75.46 0.000 135.33 72.35 0.000 457.00 31.62
546253 79.22 0.036 154.37 88.05 0.222 80.29 33.55
546261 89.83 0.036 496.55 65.24 0.000 6040.82 27.54
546269 75.45 0.000 1517.81 42.29 0.000 14429.75 31.95
546271 65.78 0.000 386.41 50.39 0.000 1283.29 34.90
546286 89.05 0.000 1172.72 54.31 0.000 4362.29 39.28
546289 108.77 0.000 1051.06 67.54 0.000 4831.90 38.49
546290 94.06 0.000 2012.36 62.38 0.000 6697.93 38.63
546291 84.07 0.000 142.03 61.95 0.000 5073.35 34.62 CopyNumber 12p13.33-12p13.32 2364
546339 64.42 0.000 67.76 55.24 0.111 535.27 24.30
546356 59.11 0.000 4388.69 51.21 0.000 6301.04 40.02 CopyNumber 19q13.33 3277
546394 111.80 0.000 185.13 58.61 0.000
547759 63.46 0.071 48.56 84.67 0.000
549178 82.90 0.000 82.93 55.18 0.111 CopyNumber 9q34.3 2030
552590 70.08 0.036 25.28 65.81 0.222 CopyNumber 22q11.21 3466
553496 72.62 0.071 41.08 79.89 0.222 43.50 72.79
553512 113.45 0.000 44.13 95.01 0.111
554767 64.47 0.071 35.90 65.85 0.222
554776 84.70 0.071 46.58 100.28 0.222 Inversion 17p11.2 2999
554894 87.26 0.071 45.88 73.07 0.222 CopyNumber 2p13.1 356
554896 89.43 0.000 112.49 60.07 0.000 291.19 31.70 CopyNumber 7p22.3 1481
555194 75.14 0.036 108.54 77.43 0.222
555866 100.49 0.000 206.53 89.92 0.000 185.01 47.68
555873 116.51 0.000 174.85 100.43 0.111
555875 78.46 0.036 17.73 91.10 0.222
555889 61.77 0.036 59.41 70.56 0.222
555890 64.41 0.000 151.98 72.68 0.111 CopyNumber 1p35.1 54
555911 83.61 0.000 120.74 64.55 0.000 182.74 32.39 CopyNumber 1q21.1 147
555969 85.57 0.036 27.90 60.28 0.222 187.95 28.62
555971 102.99 0.071 43.43 70.29 0.000
555973 61.02 0.071 25.39 54.32 0.222 365.86 37.66 CopyNumber 3p24.3 538
555994 67.15 0.071 17.47 70.28 0.222 113.88 43.85 CopyNumber 16q12.1 2912
556267 68.11 0.036 37.29 76.22 0.222
556461 109.80 0.000 89.26 94.15 0.111
556795 113.17 0.071 222.20 105.92 0.111
557550 90.20 0.000 781.42 91.24 0.000 2030.99 30.63
558296 65.84 0.000 71.76 64.47 0.222 293.40 20.63 CopyNumber 2p25.3 261
558313 83.46 0.000 103.84 61.28 0.111
558322 81.02 0.000 781.10 60.08 0.000
558325 58.04 0.071 105.00 59.17 0.000
558328 175.31 0.071 41.72 74.68 0.222 724.52 77.69 CopyNumber 6p21.31 1321
558330 119.70 0.000 1306.25 81.82 0.000 CopyNumber 19q13.33 3275
558338 94.69 0.000 392.75 84.14 0.111
558345 68.96 0.036 47.70 48.55 0.222
558354 85.28 0.000 3392.33 80.75 0.000
558360 85.52 0.000 198.33 51.08 0.111
558361 86.68 0.000 276.67 71.79 0.111
558362 74.08 0.036 45.59 64.87 0.222 229.35 49.45
558376 55.75 0.000 528.10 45.88 0.000
558381 127.10 0.000 52.20 90.63 0.000
558382 62.95 0.036 245.75 66.13 0.111
558383 92.57 0.000 850.60 69.48 0.111
558384 70.50 0.000 972.23 66.45 0.000 CopyNumber 17q12 3020
558385 76.67 0.000 522.14 55.82 0.111
558386 70.79 0.000 1008.37 63.71 0.000
558388 76.32 0.000 1561.96 59.50 0.000
558389 86.31 0.000 2526.25 46.00 0.000
558390 76.07 0.000 653.91 60.77 0.000
558391 71.38 0.000 1018.49 62.26 0.000
558396 101.60 0.071 177.30 89.88 0.222 187.47 100.01
558424 92.40 0.000 144.32 74.76 0.000
558426 67.09 0.036 90.90 62.22 0.111
558429 78.14 0.036 73.01 72.78 0.111 CopyNumber 7q22.1 1597
558431 100.68 0.000 155.33 60.37 0.000
558442 68.18 0.000 51.45 69.20 0.000
558448 67.59 0.000 46.04 58.06 0.111
558453 82.84 0.000 530.26 57.92 0.000
558454 75.98 0.000 112.20 87.34 0.111 CopyNumber 1p36.11 49
558458 67.67 0.071 35.79 63.61 0.111
558473 70.64 0.000 40.37 55.42 0.222 104.21 36.46 CopyNumber 18q12.2 3132
558499 78.66 0.071 43.18 52.43 0.222 69.81 63.34 CopyNumber 19p13.2 3210
558511 54.61 0.000 46.40 50.18 0.222
558521 78.28 0.000 61.92 65.33 0.111
558591 68.02 0.071 85.80 56.76 0.111 687.61 32.03
558825 107.55 0.000 42.12 72.58 0.000 CopyNumber 1q21.1 147
558995 53.36 0.000 186.71 64.24 0.111
567260 63.25 0.036 44.20 70.83 0.222 14.03 385.13 CopyNumber 16p11.2 2903
567263 62.05 0.000 93.74 61.88 0.222 27.38 49.92
567267 57.55 0.036 44.12 65.62 0.000 26.18 56.35
567279 65.02 0.036 43.97 59.48 0.111 CopyNumber 17q25.1 3074
Mean: mean gene expression level,
CV: coefficient of variation,
0's P: 0's proportion
indicates data missing or illegible when filed

Example 3

Identification of ERG

Among the candidate ERGs, reference genes were further identified according to the following process. First, CVs were calculated for each UniGene cluster in the datasets including EST, ShortSAGE, LongSAGE and microarray (Affymetrix HG-U133, CA), and genes were preferentially ranked in ascending order of CV. Out of the 400 genes (approx. 20% of the candidate ERG) which were preferentially ranked in ascending order of CV from each dataset, 13 ERGs were found to be common to all four datasets (Table 3). The 13 ERGs were identified as Accession No. Hs 500775(ZNF207), Accession No. Hs 446427(OAZ1), Accession No. Hs 530118(LUC7L2), Accession No. Hs 208597(CTBP1), Accession No. Hs 440382(TRIM27), Accession No. Hs 444279(GPBP1), Accession No. Hs 250009(ARL8B), Accession No. Hs 9589(UBQLN1), Accession No. Hs 253726(PAPOLA), Accession No. Hs 146806(CUL1), Accession No. Hs 533222(DIMT1L), Accession No. Hs 494985(FBXW2) and Accession No. Hs 242458(SPG21).

The gene ontology thereof was determined from a Gene Ontology site (http://www.geneontology.org/).

Most of the identified genes (ZNF207, OAZ1, CTBP1, PAPOLA, and FBXW2) were involved in basic cellular physiological processes, particularly in cellular metabolic processes. TRIM27 and CUL1 are genes responsible for cell proliferation. OAZ1 showed the lowest CV in both ShortSAGE and LongSAGE. CTBP1 and ZNF207 were the most stable genes in CGAP and Microarray, respectively. OAZ1, which is involved in polyamine biosynthesis, showed the highest expression across all four datasets, with relatively low CV in all datasets except for the EST dataset.

Experimental Example 4

Correlation Analysis of Reference Gene Between Datasets

Pearson and Spearman's rank correlation analyses were performed on the ERGs identified according to the present invention in a manner similar to that of Experimental Example 2 to compare the four datasets in terms of gene expression and CV.

Significant correlations between expression values were observed within some of the datasets, whereas no significant correlations of CV between any of the datasets were observed.

Although the Spearman correlation between EST-Microarray (0.374, P=0.206) and ShortSAGE-Microarray (0.511, P=0.076) was not significant, the gene expression of the 13 ERGs showed a significant Pearson correlation (p<0.001). No significant correlation in CV was found between the datasets (P>0.05). With the respective transcripts thereof found in all tissues in both ShortSAGE and LongSAGE, CDC42 and MYL6 were most stably expressed among the ERGs. HBP1 and PSMC1 showed the lowest CV in EST and Microarray.

Experimental Example 5

Comparison Between Novel Reference Gene and Traditional Reference Gene in Gene Expression Datasets

The 13 endogenous reference genes identified according to the present invention were compared with 13 traditional reference genes (Table 4) in terms of gene expression level and CV.

As a result, the six traditional endogenous reference genes, RPLP0, ACTS, PPIA, GAPD, PGK1 and B2M, showed high expression levels, while the other genes, GUSB, HPRT1, TBP, TFRC, ALAS1, H6PD and HMBS, exhibited relatively low expression levels, in all four datasets (FIG. 6). These results are in line with those of the previous report, in which potential endogenous expression genes were analyzed for mRNA level using qRT-PCR (Radonic A et al., Biochem Biophys Res Commun, 313(4), 856-862, 2004). The expression levels of the endogenous reference genes identified according to the present invention were similar to or slightly higher than those of the low-abundance group of the traditional endogenous reference genes.

In addition, all of the endogenous reference genes identified according to the present invention, except for a few, showed lower CV values than traditional reference genes (FIG. 7). In other words, the endogenous reference genes of the present invention are generally low in expression variation across a wide range of tissues, indicating that the identified reference genes according to the present invention are more stably expressed than traditional endogenous reference genes.

TABLE 3
ERGs identified from four datasets
UniGene EST SHORT SAGE LONG SAGE
cluster Symbol Gene Title Mean CV 0's P Mean CV 0's P Mean CV 0's P
Hs.446427 OAZ1 Ornithine 673.68 62.71 0.069 576.39 55.94 0 444.92 41.01 0
decarboxylase
antizyme 1
Hs.9589 UBQLN1 Ubiquitin 1 111.34 60.19 0.31 75.93 61.3 0.036 71.77 49.75 0.111
Hs.444279 GPBP1 GC-rich promoter 132.98 56.92 0.241 63.11 61.63 0 80.72 51.79 0.111
binding protein 1
Hs.208597 CTBP1 C-terminal binding 136.74 48.53 0.138 213.99 62.01 0 112.96 50.6 0
protein 1
Hs.253726 PAPOLA Poly(A) polymerase 216.15 65.36 0.172 118.24 58.02 0 89.5 50.88 0
alpha
Hs.250009 ARL8B ADP-ribosylation 132.27 55.79 0.379 134.21 61.55 0 59.19 55.14 0.111
factor-like 8B
Hs.242458 SPG21 Spastic 120.35 59.44 0.31 76.41 57.83 0.036 73.3 49.12 0
paraplegia 21
(autosomal
recessive,
Mast syndrome)
Hs.530118 LUC7L2 LUC7-like 2 132.76 59.55 0.172 74.65 65.41 0 57.21 50.39 0.111
(S. cerevisiae)
Hs.500775 ZNF207 Zinc finger 233.29 62.27 0.034 165.68 56.77 0 154.32 52.88 0.111
protein 207
Hs.533222 DIMT1L DIM1 129.17 69.14 0.379 42.41 60.55 0.071 36.87 44.13 0.111
dimethyladenosine
transferase 1-
like (S. cerevisiae)
Hs.440382 TRIM27 Tripartite motif 155.33 68.54 0.172 80.66 63.06 0 67.84 45.41 0.111
containing 27
Hs.146806 CUL1 Culin 1 120.27 57.5 0.207 69.33 65.76 0.036 76.43 55 0.111
Hs.494985 FBXW2 F-box and WD-40 97.45 68.65 0.379 40.27 58.47 0 23.54 51.61 0.111
domain protein 2
UniGene Affymetrix Gene Ontology
cluster Mean CV Biological Process Molecular Function
Hs.446427 1860.9 22.07 Polyamine biosynthesis Ornithine decarboxylase
inhibitor activity
Hs.9589 919.32 26.81 Kinase binding
Hs.444279 746.56 26.6
Hs.208597 481.51 24.72 Negative regulation of cell Protein C-terminus
proliferation; Protein binding Transcription
phosphorylation; Viral factor binding
genome replication
Hs.253726 451.23 27.68 mRNA polyadenylation RNA binding
Hs.250009 418.28 26.81 Chromosome segregation α-tubulin binding;
β-tubulin binding; GDP
binding, GTP binding;
GTPase activity
Hs.242458 415.64 29.35 Antigen receptor-mediated CD4 receptor binding
signaling pathway
Hs.530118 386.79 22.9
Hs.500775 358.69 18.38 Regulation of transcription, Transcription factor
DNA-dependent activity, Zinc ion binding
Hs.533222 164.72 28.3
Hs.440382 163.6 26.3 Cell proliferation Metal ion binding
Spermatogenesis Transmembrane receptor
protein tyrosine kinase
activity
Hs.146806 156.47 27.78 Cell cycle arrest; G1/S Protein binding
transition of mitotic cell
cycle. Induction of
apoptosis by intracellular
signals Negative
regulation of cell
proliferation
Hs.494985 69.32 28.36 Proteolysis Protein binding; ubiquitin
conjugating enzyme
activity; ubiquitin-protein
ligase activity
Mean: Mean gene expression level,
CV: Coefficient of variation,
0's P: 0's proportion

TABLE 4
Traditional EGRs used in present invention
UniGene EST SHORT SAGE LONG SAGE Affymetrix
cluster Symbol Gene Title Mean CV 0's P Mean CV 0's P Mean CV 0's P Mean CV
Hs.448226 RPLP0 Ribosomal protein, 3,809.2 75.92 0 1,108.65 91.01 0 1,605.76 74.12 0 1,888.46 41.47
large, P0
Hs.520640 ACTB β-actin 4,381.34 95.98 0.034 1,348.49 91.02 0 1,961.29 60.59 0.111 5,036.63 31.42
Hs.356331 PPIA Peptidylprolyl 1,225.7 78.02 0.034 1,646.83 59.53 0 1,683.27 56.79 0 5,223.43 28.46
isomerase A
(cyclophilin A)
Hs.479728 GAPDH Glyceraldehyde-3- 7,330.72 80.18 0 3,167.05 83.62 0 3,178.15 102.5 0 4,934.56 42.86
phosphate
dehydrogenase
Hs.78771 PGK1 Phosphoglycerate 681.19 86.72 0.034 423.67 85.52 0 445.96 90.9 0 1,179.63 41.05
kinase 1
Hs.534255 B2M β-2-microglobulin 1,303.98 172.16 0 2,594.12 96.87 0 2,910.69 103.61 0 4,736.9 32.54
Hs.255230 GUSB β-Glucuronidase 116.77 89.37 0.414 40.98 67.81 0.107 11.42 89.36 0.556 360.37 49.14
Hs.412707 HPRT1 Hypoxanthine 103.48 63.18 0.345 32.51 63.51 0.107 33.29 49.07 0.222 233.36 40.85
phosphoribosyl-
transferase 1
Hs.1100 TBP TATA box binding 71.46 47.77 0.448 31.94 62.8 0.286 17.58 69.22 0.444 25.44 73.23
protein
Hs.529618 TFRC Transferrin receptor 212.76 85.52 0.241 89.51 87.09 0.036 82.62 91.59 0.111 36.01 56.84
(p90, CD71)
Hs.82609 HMBS Hydroxy- 176.26 105.68 0.172 32.51 76.51 0.214 28.04 42.5 0.444 119.08 33.63
methylbilane
synthase
Hs.463511 H6PD Hexose-6-phosphate 101.9 86.9 0.483 44.65 70.8 0.071 25.33 101.45 0.222 25.4 28.85
dehydrogenase
(glucose-
1-dehydrogenase)
Hs.476308 ALAS1 δ-Aminolevulinate 132.82 82.5 0.345 50.43 72.23 0 22.5 50.59 0.222 178.95 107.93
synthase 1
Mean: Mean gene expression level,
CV: Coefficient of variation,
0's P: 0's proportion

Experimental Example 6

Gene Copy Number Variations of ERGs

The 13 ERGs identified according to the present invention were examined for gene copy number variation with reference to the Database of Genomic Variants (http://projects.tcag.ca/variation/). Only OAZ1 and DIMT1L, among the 13 genes of the present invention, were found in chromosome regions known to exhibit gene copy number variation (Table 5). In contrast, many (ACTB, GAPDH, PGK1, B2M, TBP, TFRC, ALAS1) of the traditional reference genes were located at such genomic loci (Table 5). These results suggest that almost all of the identified reference genes of the present invention, except for the two genes, can be used as guide genes for the measurement of gene amplification because they might be highly unlikely to show variation in gene copy number.

Experimental Example 7

Validation of Reference Gene

<7-1> Validation of Expression Level of ERG by Quantitative RT-PCR (qRT-PCR)

For use in validating the expression stability of the ERGs identified from the datasets, a total of 108 human samples, including 26 frozen human tissues, 60 formalin-fixed, paraffin embedded (FFPE) human tissues, and 22 human cancer cell lines were obtained (Table 6). The 60 FFPE tissues were composed of 10 breast cancer tissues, 8 normal stomach tissues, 9 stomach cancer tissues, 10 normal ovary tissues, 4 ovarian dropsy tissues, 9 borderline ovarian tumors, and 10 ovarian cancer tissues. Total RNA was isolated from these tissues and cell lines. For frozen human tissues and human cancer cell line samples, RNA which met the requirements of A260/2801.80 and rRNA (28S/18S)1.0 was used in qRT-PCR. cDNA was synthesized from the RNA using a standard technique and then diluted in distilled water (1:3 cDNA:DW) before qRT-PCR. PCR primers are summarized, together with the Universal Probe Library (UPL) thereof, in Table 7, below.

For use in this qRT-PCR, traditional ERGs were selected on the basis of the use frequency in previous reports and commercially available kits and the CV calculated from the database of the present invention. The 8 ERGs (B2M, ACTB, GAPDH, HMBS, PPIA, HPRT1, TBP and H6PD) that are most widely used can be found in commercially available kits such as Taqman human endogenous control plate (Applied Biosystems) and HKG selection kit (Roche Applied Science, Ohl F et, al., J Mol Med 83:1014-24, 2005; Roche Applied Science Technical Note No. LC 15/2005; Applied Biosystems, 2001). Each gene was measured at 530 nm using an FAM-conjugate UPL probe (Roche Applied Science) or a custom-made specific probe (TIB MOLBIOL GmbH, Germany). All PCR was performed in a Lightcycler 2.0 (Roche Applied Science, USA) using standard protocols.

PCR efficiency for each gene was measured using a cDNA serial dilution (Pfaffl MW et al., Nucleic Acids Res 29: e45, 2001) of the stomach cancer cell line MKN74 and calculated with Lightcycler software 4.0 (Roche Applied Science, USA). It was found to fall within a range from 90 to 100% (Table 8).

Also, PCR efficiency for each probe in tissue samples was estimated using a LinRegPCR program (Ramakers C et al., Neurosci Lett 339:62-6, 2003). A Cp value is an average of three measurements for each gene. The same genes from different tissue samples were measured under the same PCR conditions so as to minimize experimental variation. Because it was not measured in any of 4 samples, normal lung, liver, breast and kidney tissues, the Cp value of H6PD was omitted from subsequent calculations. For each experiment that was conducted in triplicate, the Cp values were found to have a CV less than 5%.

Expression levels of 20 genes, except for H6PD, across 48 samples, including frozen human tissues and cancer cell lines, are depicted in FIG. 8. The 13 novel ERGs of the present invention were expressed in all 48 samples. 7 traditional ERGs showed a wide expression range (Cp: 13.52˜29.39) whereas H6PD was not found in some tissues. The 13 ERGs ranged in Cp from 18.90 to 28.79 (FIG. 9). Traditional ERGs can be classified into a high-expression group (median <20 cycles) and a low-expression group (median >23 cycles). B2M, PPIA, GAPDH and ACTS are included in the high-expression group and HPRT1, TBP, and HMBS are found in the low-expression group. All of the novel ERGs of the present invention, except for OAZ1, show expression levels between those of the high-expression group and the low-expression group of the traditional ERGs. ZNF2007 had the highest expression level among the ERGs, followed by UBQLN1 and CULL OAZ1 had the lowest expression level.

TABLE 5
Gene copy number variations of traditional ERG and novel ERG
Novel candidate ERGs
Genomic Variation** Traditional ERGs
Gene Genomic Locus Gene Genomic Genomic Variation**
Symbol location* Variation type ID References symbol location* Variation type Locus ID References
ZNF207 17q11.2 RPLP0 12q24.23
OAZ1 19p13.3 Copy number 3199 Wong et ACTB 7p22.1 Copy number 1487 Wong et al (2007)
at (2007)
LUC7L2 7q34 PPIA 7p13
CTBP1 4p16.3 GAPDH 12p13.31 Copy number 2368 Redon et al (2006)
TRIM27 6p22.1 PGK1 Xq21.1 Copy number 3567 Iafrate et al (2004)
GPBP1 5q11.2 B2M 15q21.1 Copy number 2773 Redon et al (2006)
UBQLN1 9q21.33 GUSB 7q11.21
ARL8B 3p26.1 HPRT1 Xq26.2
PAPOLA 14q32.2 TBP 6q27 Copy number 1479 Redon et al (2006)
CUL1 7q36.1 TFRC 3q29 Copy number 753 Iafrate et al (2004)
Copy number Redon et al (2006)
DIMT1L 5q12.1 Copy number 1137 Redon et HMBS 11q23.3
al (2006)
FBXW2 9q33.2 H6PD 1p36.22
SPG21 15q22.31 ALAS1 3p21.2 Copy number 590 Wong et al (2007)
*Genomic location was searched from Ensembl (http://www.ensembl.org/index.html)
**Genomic variations were searched in the Database of Genomic Variants (http://projects.tcag.ca/variation/, Human Genome Assembly Build 36 (hg18)).

<7-2> Validation of ERG Using Expression Stability Based on qRT-PCR Data

Gene expression stability was analyzed using geNorm v3.4 software (Vandesompele J et al., Genome Biol 3:RESEARCH0034, 2002) and NormFinder software (Andersen CL et al., Cancer Res 64:5245-50, 2004). For geNorm and NormFinder analysis, Cp values were converted into relative expression levels in consideration of the PCR efficiencies of genes shown in Table 8 (GeNorm software manual, update on Sep. 6, 2004. //medgen.ugnet.be/˜jvdesomp/genorm/). Relative expression was calculated according to the following Mathematical Formula 4.


Relative Expression=(1+ECpΔCp=Minimum Cp−Sample Cp;


Minimum Cp=lowest Cp value; and


E=PCR Efficiency   <Mathematical Formula 4>

Correlation between the gene expression stability calculated with the geNorm or NormFinder program (M by geNorm, S by NormFinder) and the CV calculated in each dataset was analyzed with R analysis software (//www.R-project.org).

All of the genes were found to have M values (<0.9) lower than the default limit, 1.5, of geNorm, with high expression stability, as analyzed using the geNorm program (Table 9). Lower M values for mean expression stability mean more stable expression. GPBP1 and CUL1 were observed to show the most stable expression. Among the genes analyzed, B2M is the lowest stable expression gene, with the highest M value of 0.888, followed by ACTB (M=0.843), HMBS (M=0.815) and GAPDH (M=0.793) in descending order of expression instability.

When using the NormFinder program, TBP and PAPOLA were ranked as the top two in terms of expression stability (Table 9). Consistent with the geNorm result, B2M, ACTB, GAPDH, HMBS and HPRT1 were found to be less stable in expression level than the novel ERGs of the present invention. Both programs demonstrated that most of the novel ERGs identified according to the present invention show more stable expression levels than do traditional ERGs. Further, when analyzed for gene expression stability using a LinRegPCR program on the basis of the relative expression calculated with PCR efficiency, most novel ERGs were found to maintain higher expression stability than traditional ERGs.

There is no significant correlation between the M values calculated with geNorm and the CV values in Microarray and LongSAGE (p>0.05), whereas significance was found in correlation between M values and CV values in EST (Pearson correlation coefficient: 0.676, p=0.001) and ShortSAGE (Pearson correlation coefficient: 0.659, p=0.002). Likewise, as for the Stability values (S), calculated with NormFinder, significant correlation was found in EST, ShortSAGE and LongSAGE, but not in microarray. Both the M and the S values showed higher agreement with CV in EST and ShortSAGE than in Affymetrix (Table 10).

Furthermore, the 13 novel ERGs were analyzed for expression in 60 FFPE samples using qRT-PCR in order to examine the possibility of applying them to the tissues in which high RNA degradation occurs. All of the genes, except for DIMT1L, were found to be expressed in all 60 samples. Cp was observed to range from 18.85 to 33.02 for traditional ERGs and from 23.33 to 31.38 for the novel ERGs (FIG. 9). Because of the lack of amplification in 5 samples, DIMT1L was omitted from subsequent stability analyses. Despite difference in the type of samples used in the experiments, almost all genes, except for several genes, were observed to be expressed in a pattern similar to that observed in the previous 48 samples. These results indicate that the novel ERGs of the present invention can be applied to gene expression in FFPE samples. geNorm and NormFinder analyses demonstrate that most of the novel ERGs are more stably expressed with lower Cp values in FFPE samples, as well as in the 48 samples, than are traditional ERGs (Table 9).

TABLE 6
Human tissues and cancer cell lines used in Real time-PCR
Tissue or cell Normal (N)/
No. lines Type Tumor (T) Diagnosis Remarks
1 Adrenal gland frozen tissue N Normal
2 Brain frozen tissue N Normal
3 Breast frozen tissue N Normal
4 Colon frozen tissue N Normal Normal tissue adjacent to signet ring
cell carcinoma, ascending colon
5 Esophagus frozen tissue N Normal
6 Kidney frozen tissue N Normal
7 Liver frozen tissue N Normal
8 Lung frozen tissue N Normal
9 Omentum frozen tissue N Normal
10 Ovary frozen tissue N Normal
11 Placenta frozen tissue N Normal
12 Placenta frozen tissue N Normal Immature placenta with focal
intervillous calcifications, normal two
umbilical arteries and one vein, and
no evidence of chorioamnionitis
13 Rectum frozen tissue N Normal
14 Salivary gland frozen tissue N Normal
15 Thyroid gland frozen tissue N Normal
16 Tonsil frozen tissue N Normal
17 Uterus frozen tissue N Normal
18 Vein frozen tissue N Normal
19 Vulva frozen tissue N Normal
20 Brain frozen tissue T Glioblastoma multiforme
21 Breast frozen tissue T Invasive ductal carcinoma, upper
central
22 Transverse colon frozen tissue T Ulcerofungating carcinoma,
transverse colon, Mucinous
adenocarcinoma
23 Lung frozen tissue T Pleomorphic carcinoma
24 Ovary frozen tissue T Transitional cell carcinoma, bilateral
ovaries
25 Rectum frozen tissue T Adenocarcinoma, moderately
differentiated with mucin production
26 Stomach frozen tissue T Advanced gastric carcinoma, Tubular
adenocarcinoma, M/D
27 HL-60 cell lines T Leukemia Blood
28 MDA-MB-231 cell lines T Breast cancer Breast
29 C33A cell lines T Cervical cancer Cervix
30 HeLa cell lines T Cervical cancer
31 HCC-44 cell lines T Lung cancer Lung
32 A549 cell lines T Lung cancer
33 Caov3 cell lines T Ovarian cancer Ovary
34 OV-90 cell lines T Ovarian cancer
35 OVCAR3 cell lines T Ovarian cancer
36 SK-OV3 cell lines T Ovarian cancer
37 SNU119 cell lines T Ovarian cancer
38 SW626 cell lines T Ovarian cancer
39 AGS cell lines T Gastric cancer Stomach
40 Kato III cell lines T Gastric cancer
41 MKN1 cell lines T Gastric cancer
42 MKN74 cell lines T Gastric cancer
43 NCI-N87 cell lines T Gastric cancer
44 SNU5 cell lines T Gastric cancer
45 SNU16 cell lines T Gastric cancer
46 SNU484 cell lines T Gastric cancer
47 SNU601 cell lines T Gastric cancer
48 SNU638 cell lines T Gastric cancer
*Normal tissue adjacent to signet ring cell carcinoma, ascending colon; and
**immature placenta with focal intervillous calcifications; normal two umbilical arteries and one vein, and no evidence of chorioamnionitis.

TABLE 7
Primers and Taqman Probes for Real-Time PCR
Gene UPL Primers Product
Names No. Sense Primers Anti-Sense Primers (bp)
GAPDH 60 SEQ ID NO. 1: SEQ ID NO. 2: 66
agccacatcgctcagaca gcccaatacgaccaaatcc
ACTB 64 SEQ ID NO. 3: SEQ ID NO. 4: 97
ccaaccgcgagaagatga ccagaggcgtacagggatag
B2M 42 SEQ ID NO. 5: SEQ ID NO. 6: 86
ttctggcctggaggctatc tcaggaaatttgactttccattc
PPIA # SEQ ID NO. 7: SEQ ID NO. 8: 326
catctgcactgccaagactg tgcaatccagctaggcatg
ag
HPRT1 73 SEQ ID NO. 9: SEQ ID NO. 10: 102
tgaccttgatttattttgca cgagcaagacgttcagtcct
tacc
HMBS 26 SEQ ID NO. 11: SEQ ID NO. 12: 92
tgtggtgggaaccagctc tgttgaggtttccccgaat
TBP  3 SEQ ID NO. 13: SEQ ID NO. 14: 60
gctggcccatagtgatcttt cttcacacgccaagaaacagt
H6PD 89 SEQ ID NO. 15: SEQ ID NO. 16: 74
tggagatcatcatgaaagag gcgaatgacaccgtactcct
acc
ZNF207 27 SEQ ID NO. 17: SEQ ID NO. 18: 65
ctgtttcctagcacagcaca ggtttgaaatctgtaccaacagg
a
OAZ1 74 SEQ ID NO. 19: SEQ ID NO. 20: 67
caccatgccgctcctaag gagggagaccctggaactct
LUC7L2 85 SEQ ID NO. 21: SEQ ID NO. 22: 60
cgatcacacagcaagaatcc agatcgatgtctgcgatgc
CTBP1 77 SEQ ID NO. 23: SEQ ID NO. 24: 86
actgcgtgaccctgcact gccccttgtctcatctgc
TRIM27  7 SEQ ID NO. 25: SEQ ID NO. 26: 71
caggcacgagctgaactct agctgctcaaactcccaaac
GPBP1  4 SEQ ID NO. 27: SEQ ID NO. 28: 75
tcacttgaggcagaacacag agcacatgtttcatcattttcac
a
UBQLN1 73 SEQ ID NO. 29: SEQ ID NO. 30: 92
gaatcctgaccttgctgcac ttgggagctgttgtctcattt
ARL8B 82 SEQ ID NO. 31: SEQ ID NO. 32: 66
aagcatgtgggagcggtat cgatctgcagcatctatcatgt
PAPOLA 78 SEQ ID NO. 33: SEQ ID NO. 34: 91
gctacgaagaccagtccatt tgttggtcacagatgctgct
g
CUL1 65 SEQ ID NO. 35: SEQ ID NO. 36: 86
gcgaggtcctcactcagc ttctttctcaattagaatgtcaat
gc
DIMT1L 77 SEQ ID NO. 37: SEQ ID NO. 38: 75
tccagtgttgtaaggataga Ccttactagaccatcccattcct
acctaag
FBXW2  3 SEQ ID NO. 39: SEQ ID NO. 40: 111
cggctctgcagacttcact ttgcacttctgcaaaactacct
SPG21 21 SEQ ID NO. 41: SEQ ID NO. 42: 88
gatgtctttttccggcagat cgagatggtcccaataaactg

TABLE 8
PCR Efficiency of Genes
UPL Probe PCR Efficiency PCR Efficiency
Gene Name Nos. (Diluted)* (LinRegPCR)**
GAPDH 60 1.899 1.735 ± 0.048 (137)
ACTB 64 2.038 1.491 ± 0.034 (137)
B2M 42 1.868 1.717 ± 0.068 (140)
PPIA # 1.877 1.773 ± 0.058 (142)
HPRT1 73 1.800 1.771 ± 0.024 (143)
HMBS 26 1.954 1.431 ± 0.031 (143)
TBP 3 1.826 1.447 ± 0.038 (142)
H6PD 89 1.874 1.832 ± 0.026 (64) 
ZNF207 27 1.869 1.648 ± 0.018 (142)
OAZ1 74 2.068 1.498 ± 0.059 (142)
LUC7L2 85 1.829 1.709 ± 0.047 (143)
CTBP1 77 2.064 1.651 ± 0.055 (141)
TRIM27 7 1.908 1.693 ± 0.034 (143)
GPBP1 4 1.844 1.715 ± 0.031 (141)
UBQLN1 73 1.864 1.723 ± 0.027 (143)
ARL8B 82 1.838 1.499 ± 0.074 (139)
PAPOLA 78 1.830 1.509 ± 0.032 (141)
CUL1 65 1.810 1.695 ± 0.027 (139)
DIMT1L 77 1.906 1.655 ± 0.037 (141)
FBXW2 3 1.891 1.638 ± 0.02 (142) 
SPG21 21 1.826 1.636 ± 0.021 (142)
*PCR Efficiency; calculated with Roche Lightcycler software 4.0 using serial diluted cDNA of MKN 74 stomach cancer cell line;
**PCR Efficiency; calculated with LinRegPCR (Ramakers et al., Neurosci Lett 339(1): 62-66, 2003); and,
#: F-ttcttgctggtcttgccatTcctgga-p;
T: TAMRA-labeled;
F: FAM-labeled;
P: phosphate.

TABLE 9
Expression Stability of Novel and Traditional ERGs
Calculated by geNorm and NormFinder based on Real-Time PCR
Data
48 Samples 60 FFPE Samples*
GeNorm NormFinder GeNorm NormFinder
Genes M Genes S Genes M Genes S
GPBP1 0.496 TBP 0.276 GPBP1 0.409 ARL8B 0.233
CUL1 PAPOLA 0.280 PAPOLA LUC7L2 0.235
PAPOLA 0.536 CUL1 0.287 ARL8B 0.437 OAZ1 0.247
TBP 0.548 LUC7L2 0.290 CTBP1 0.454 CTBP1 0.251
LUC7L2 0.565 CTBP1 0.312 LUC7L2 0.483 UBQLN1 0.273
TRIM27 0.585 GPBP1 0.317 SPG21 0.509 SPG21 0.280
FBXW2 0.597 TRIM27 0.317 FBXW2 0.528 FBXW2 0.286
CTBP1 0.608 FBXW2 0.329 OAZ1 0.545 PAPOLA 0.290
UBQLN1 0.623 DIMT1L 0.364 UBQLN1 0.555 TRIM27 0.327
DIMT1L 0.637 PPIA 0.383 TRIM27 0.567 GPBP1 0.345
PPIA 0.661 UBQLN1 0.398 TBP 0.580 HPRT1 0.368
OAZ1 0.682 OAZ1 0.438 CUL1 0.593 CUL1 0.383
ZNF207 0.709 ARL8B 0.494 HPRT1 0.609 TBP 0.402
ARL8B 0.731 SPG21 0.502 ZNF207 0.625 HMBS 0.407
SPG21 0.749 ZNF207 0.502 HMBS 0.641 ZNF207 0.440
HPRT1 0.770 HPRT1 0.516 GAPDH 0.668 PPIA 0.461
GAPDH 0.793 HMBS 0.587 PPIA 0.692 GAPDH 0.527
HMBS 0.815 GAPDH 0.591 B2M 0.715 B2M 0.530
ACTB 0.843 ACTB 0.618 ACTB 0.737 ACTB 0.541
B2M 0.888 B2M 0.815
*DIMT1L was excluded from the analysis.
M: mean expression stability calculated with geNorm program;
S: Stability calculated with NormFinder program.

TABLE 10
Correlation between CV in each dataset and expression stability calculated with
geNorm and NormFinder
EST-M EST-S ShortSAGE-M ShortSAGE-S LongSAGE-M LongSAGE-S Affy-M Affy-S M-S
Pearson 0.676 0.792 0.659 0.75 0.427 0.561 0.039 0.017 0.953
P value 0.001 <0.001 0.002 <0.001 0.061 0.01 0.869 0.944 <0.001
Spearman 0.589 0.605 0.277 0.268 0.092 0.105 0.424 0.357 0.955
P value 0.006 0.005 0.237 0.254 0.701 0.661 0.063 0.123 <0.001
Pearson 0.623 0.626 0.656 0.737 0.481 0.672 0.243 0.335 0.852
P value 0.004 0.004 0.002 <0.001 0.037 0.002 0.317 0.161 <0.001
Spearman 0.663 0.596 0.515 0.502 0.374 0.567 0.521 0.583 0.841
P value 0.002 0.008 0.024 0.03 0.115 0.013 0.022 0.009 <0.001
M: Mean expression stability calculated with geNorm;
S: Stability calculated with NormFinder

TABLE 11
List of 567 Samples Including 13 Tissues in HG-U133 Array
Nos. of
Tissues Categories Morphology Samples
Brain Benign Meningioma 7 23
Malignant Glioblastoma Multiforme 7
Oligodendroglioma 6
Medulloblastoma 3
Breast Normal Normal Tissue 18 74
Malignant Infiltrating Duct Carcionma 36
Infiltrating Duct and Lobular 7
Carcinoma
Infiltrating Lobular Carcinoma 13
Colon Normal Normal Tissue 22 62
Malignant Adenocarcinoma 33
Mucinous Adenocarcinoma 7
Esophagus Normal Normal Tissue 11 17
Malignant Adenocarcinoma 6
Kidney Normal Normal Tissue 26 51
Benign Oncocytoma 5
Malignant Clear Cell Adenocarcinoma 6
Renal Cell Carcinoma 14
Liver Normal Normal Tissue 10 29
Malignant Hepatocellular Carcinoma 19
Lung Normal Normal Tissue 26 58
Malignant Adenocarcinoma 15
Squamous Cell Carcinoma 17
Lymph Normal Normal Tissue 4 23
Node Malignant Hodgkin's Disease 4
Malignant Lymphoma 15
Ovary Normal Normal Tissue 10 50
Malignant Adenocarcinoma 5
Clear Cell Adenocarcinoma 6
Mucinous Cystadenocarcinoma 5
Serous Cystadenocarcinoma 6
Papillary Serous 18
Adenocarcinoma
Pancreas Normal Normal Tissue 13 41
Malignant Adenocarcinoma 28
Prostate Normal Normal Tissue 14 41
Malignant Adenocarcinoma 27
Rectum Normal Normal Tissue 17 38
Malignant Adenocarcinoma 21
Stomach Normal Normal Tissue 17 60
Malignant Adenocarcinoma 37
Signet Ring Cell Carcinoma 6
Total 567

Claims

1. A method for selecting candidate endogenous reference genes (ERG), comprising:

1) computing expression levels of genes from EST, SAGE and microarray datasets; and

2) identifying genes which are constitutively expressed across a wide range of tissues using the computed gene expression levels of step 1) and zero(0)'s proportions thereof.

2. The method according to claim 1, wherein the computing of expression levels of step 1) is conducted according to Mathematical Formulas 1 and 2:

 < Mathematical   Formula   1 >  E   T   S   gene   expression =    No   of   E   S   T   of   a   Given   Gene   in   Library Total   No .  of   E   S   T   s   in   Libaray ×  1  , 000 , 000   < Mathematical   Formula   2 >  S   A   G   E   gene   expression = No   of   Tags   of   a   Given   Gene   in   Library Total   No .  of   Tags   in   Libaray × 1 , 000 , 000

3. The method according to claim 1, wherein the datasets of step 1) comprise mRNA expression level data derived from CGAP EST (Hs_ExprData.dat), SAGE (Hs_short.frequencies.gz and Hs_long.frequencies.gz) and microarray (Affymetrix HG-U133, CA).

4. The method according to claim 1, wherein the 0's proportion of step 2) is determined according to Mathematical Formula 3:

 < Mathematical   Formula   3 >  0 '  s   Proportion = No .  of   Tissues   with   No   Expression   of   a   Given   Gene Total   No .  of   Tissues

5. A composition for detecting at least one candidate endogenous reference gene, selected according to the method of claim 1, comprising a detection reagent capable of hybridizing with the candidate endogenous reference gene.

6. The composition according to claim 5, wherein the candidate endogenous reference is one or more genes selected from a group consisting of Accession No. Hs 120(PRDX6), Accession No. Hs 142(SULT1A1), Accession No. Hs 202(BZRP), Accession No. Hs 429(ATP5G3), Accession No. Hs 695(CSTB), Accession No. Hs 808(HNRPF), Accession No. Hs 861(MAPK3), Accession No. Hs 1063(SNRPC), Accession No. Hs 1103(TGFB1), Accession No. Hs 2430(TCFL1), Accession No. Hs 2533(ALDH9A1), Accession No. Hs 2795(LDHA), Accession No. Hs 2853(PCBP1), Accession No. Hs 3100(KARS), Accession No. Hs 3254(MRPL23), Accession No. Hs 3353(G3BP), Accession No. Hs 3416(ADFP), Accession No. Hs 439(STOML2), Accession No. Hs 3530(FUSIP1), Accession No. Hs 3989(PLXNB2), Accession No. Hs 4055(KLF6), Accession No. Hs 4742(GPAA1), Accession No. Hs 4747(DKC1), Accession No. Hs 4766(FAM32A), Accession No. Hs 4859(CCNL1), Accession No. Hs 4997(RBM23), Accession No. Hs 4998(TMOD3), Accession No. Hs 5062(TM4SF8), Accession No. Hs 5086(MGC10433), Accession No. Hs 5120(DNCL1), Accession No. Hs 5158(ILK), Accession No. Hs 5245(FLJ20643), Accession No. Hs 5258(MAGED1), Accession No. Hs 5268(ZDHHC4), Accession No. Hs 5298(ADIPOR1), Accession No. Hs 5308(UBA52), Accession No. Hs 5324(C2orf25), Accession No. Hs 5345(RNPEPL1), Accession No. Hs 5662(GNB2L1), Accession No. Hs 5710(CREG1), Accession No. Hs 5719(CNAP1), Accession No. Hs 5912(FBXO7), Accession No. Hs 5947(RAB8A), Accession No. Hs 6396(JTB), Accession No. Hs 6454(RGS19IP1), Accession No. Hs 6459(GPR172A), Accession No. Hs 6551(ATP6AP1), Accession No. Hs 6891(SFRS6), Accession No. Hs 7101(ANAPC5), Accession No. Hs 7236(NOSIP), Accession No. Hs 7476(ATP6V0B), Accession No. Hs 7527(DKFZP566E144), Accession No. Hs 7744(NDUFV1), Accession No. Hs 7753(CALU), Accession No. Hs 7768(FIBP), Accession No. Hs 7862(PNRC2), Accession No. Hs 7910(RYBP), Accession No. Hs 7917(HIG1), Accession No. Hs 8102(RPS20), Accession No. Hs 8372(UQCR), Accession No. Hs 8737(WDR6), Accession No. Hs 8752(TMEM4), Accession No. Hs 8765(DDX42), Accession No. Hs 8859(CANT1), Accession No. Hs 8867(CYR61), Accession No. Hs 9003(FLJ13868), Accession No. Hs 9015(MGC52000), Accession No. Hs 9043(C14orf120), Accession No. Hs 9234(NIFIE14), Accession No. Hs 9235(NME4), Accession No. Hs 9527(C2orf28), Accession No. Hs 9534(SEC11L1), Accession No. Hs 9573(ABCF1), Accession No. Hs 9589(UBQLN1), Accession No. Hs 9788(NDFIP1), Accession No. Hs 9825(CGI-128), Accession No. Hs 9857(DCXR), Accession No. Hs 10326(COPE), Accession No. Hs 10842(RAN), Accession No. Hs 10848(BMS1L), Accession No. Hs 11125(SPCS1), Accession No. Hs 11184(UBE2R2), Accession No. Hs 11223(IDH1), Accession No. Hs 11355(TMPO), Accession No. Hs 11463(UMP-CMPK), Accession No. Hs 12013(ABCE1), Accession No. Hs 12084(TUFM), Accession No. Hs 12102(SNX3), Accession No. Hs 12107(BC-2), Accession No. Hs 12109(WDR39), Accession No. Hs 12144(KIAA1033), Accession No. Hs 12152(SRPRB), Accession No. Hs 12272(BECN1), Accession No. Hs 12341(ADAR), Accession No. Hs 12457(NUP133), Accession No. Hs 12865(NSFL1C), Accession No. Hs 13662(MGC5508), Accession No. Hs 14317(NOLA3), Accession No. Hs 14333(FLJ10349), Accession No. Hs 14745(C10orf9), Accession No. Hs 14839(POLR2G), Accession No. Hs 14846(SLC7A1), Accession No. Hs 14894(TGOLN2), Accession No. Hs 15277(C16orf33), Accession No. Hs 15591(COPS6), Accession No. Hs 15738(RAB7), Accession No. Hs 16059(HSPC009), Accession No. Hs 16130(E2-230K), Accession No. Hs 16349(KIAA0431), Accession No. Hs 17118(FLJ11730), Accession No. Hs 17250(MGC4767), Accession No. Hs 17680(FUCA2), Accession No. Hs 17731(FLJ12892), Accession No. Hs 17883(PPM1G), Accession No. Hs 18069(LGMN), Accession No. Hs 18128(C20orf44), Accession No. Hs 18349(MRPL15), Accession No. Hs 19673(MAF1), Accession No. Hs 20013(P29), Accession No. Hs 20107(KNS2), Accession No. Hs 20157(CDK5RAP3), Accession No. Hs 20521(HRMT1L2), Accession No. Hs 20529(LOC127262), Accession No. Hs 20573(IGF1R), Accession No. Hs 20716(TIMM17A), Accession No. Hs 22393(DENR), Accession No. Hs 22543(UBE3A), Accession No. Hs 22546(CYBASC3), Accession No. Hs 22616(KIAA0664), Accession No. Hs 23033(LOC92912), Accession No. Hs 23111(FARSLA), Accession No. Hs 23978(SAFB), Accession No. Hs 24301(POLR2E), Accession No. Hs 24379(TRAPPC1), Accession No. Hs 24601(FBLN1), Accession No. Hs 24950(RGS5), Accession No. Hs 25155(NET1), Accession No. Hs 25450(SLC29A1), Accession No. Hs 25723(MTVR1), Accession No. Hs 26010(PFKP), Accession No. Hs 26023(FOXJ3), Accession No. Hs 26136(MGC14156), Accession No. Hs 26232(MAN2C1), Accession No. Hs 26403(GSTZ1), Accession No. Hs 26518(TM4SF7), Accession No. Hs 27222(NOLA2), Accession No. Hs 28491(SAT), Accession No. Hs 28914(APRT), Accession No. Hs 29203(GBL), Accession No. Hs 29665(CLSTN1), Accession No. Hs 30011(MGC2963), Accession No. Hs 30026(HSPC182), Accession No. Hs 30345(TRAP1), Accession No. Hs 30954(PMVK), Accession No. Hs 31053(CKAP1), Accession No. Hs 31334(C20orf14), Accession No. Hs 31387(DKFZP564J0123), Accession No. Hs 34045(CDCA4), Accession No. Hs 34576(TAX1BP1), Accession No. Hs 34906(BLOC1S2), Accession No. Hs 35052(TEGT), Accession No. Hs 35828(MARK3), Accession No. Hs 36587(PPP1R7), Accession No. Hs 36927(HSPH1), Accession No. Hs 37616(STRA13), Accession No. Hs 37916(DPP7), Accession No. Hs 42806(Cab45), Accession No. Hs 43297(MTPN), Accession No. Hs 47062(POLR2I), Accession No. Hs 50098(NDUFA4), Accession No. Hs 50308(HIP2), Accession No. Hs 50425(TEBP), Accession No. Hs 53066(HSPBP1), Accession No. Hs 54277(FAM50A), Accession No. Hs 54457(CD81), Accession No. Hs 54642(MAT2B), Accession No. Hs 54649(RY1), Accession No. Hs 55682(EIF3S7), Accession No. Hs 55847(MRPL51), Accession No. Hs 58488(CTNNAL1), Accession No. Hs 58992(SMC4L1), Accession No. Hs 59486(HSDL2), Accession No. Hs 61812(PTPN12), Accession No. Hs 65234(DDX27), Accession No. Hs 65238(RNF40), Accession No. Hs 66048(BPY2IP1), Accession No. Hs 66915(C22orf16), Accession No. Hs 68714(SFRS1), Accession No. Hs 9293(HEXB), Accession No. Hs 69554(RNF126), Accession No. Hs 69855(UNR), Accession No. Hs 71465(SQLE), Accession No. Hs 71787(MRPS7), Accession No. Hs 73527(CSNK2B), Accession No. Hs 73722(APEX1), Accession No. Hs 73799(GNAI3), Accession No. Hs 73965(SFRS2), Accession No. Hs 74047(ETFB), Accession No. Hs 74050(FVT1), Accession No. Hs 74137(TMP21), Accession No. Hs 74375(DVL1), Accession No. Hs 74405(YWHAQ), Accession No. Hs 74471(GJA1), Accession No. Hs 74563(OAZ2), Accession No. Hs 74564(SSR2), Accession No. Hs 74576(GDI1), Accession No. Hs 75056(TIMM13), Accession No. Hs 75061(MARCKSL1), Accession No. Hs 75066(TSN), Accession No. Hs 75087(FASTK), Accession No. Hs 75117(ILF2), Accession No. Hs 75133(TFAM), Accession No. Hs 75139(ARFIP2), Accession No. Hs 75189(DAP), Accession No. Hs 75227(NDUFA9), Accession No. Hs 75243(BRD2), Accession No. Hs 75249(ARL6IP), Accession No. Hs 75254(IRF3), Accession No. Hs 75318(TUBA1), Accession No. Hs 75348(PSME1), Accession No. Hs 75438(QDPR), Accession No. Hs 75527(ADSL), Accession No. Hs 75724(COPB2), Accession No. Hs 75798(C20orf111), Accession No. Hs 75841(C12orf8), Accession No. Hs 75890(MBTPS1), Accession No. Hs 75914(RNP24), Accession No. Hs 76111(DAG1), Accession No. Hs 76394(ECHS1), Accession No. Hs 76480(UBL4), Accession No. Hs 76662(ZDHHC16), Accession No. Hs 76686(GPX1), Accession No. Hs 76847(GANAB), Accession No. Hs 77060(PSMB6), Accession No. Hs 77269(GNAI2), Accession No. Hs 77313(CDK10), Accession No. Hs 77422(PLP2), Accession No. Hs 77558(HMGN3), Accession No. Hs 77578(USP9X), Accession No. Hs 77793(CSK), Accession No. Hs 77897(SF3A3), Accession No. Hs 77961(HLA-B), Accession No. Hs 77978(DKFZp761I2123), Accession No. Hs 78466(PSMD8), Accession No. Hs 78601(UROD), Accession No. Hs 78771(PGK1), Accession No. Hs 78880(ILVBL), Accession No. Hs 78888(DB1), Accession No. Hs 78989(ADH5), Accession No. Hs 79064(DHPS), Accession No. Hs 79081(PPP1CC), Accession No. Hs 79088(RCN2), Accession No. Hs 79101(CCNG1), Accession No. Hs 79110(NCL), Accession No. Hs 79322(QARS), Accession No. Hs 79335(SMARCD1), Accession No. Hs 79387(PSMC5), Accession No. Hs 79402(POLR2C), Accession No. Hs 79411(RPA2), Accession No. Hs 79625(C20orf149), Accession No. Hs 80545(RPL37), Accession No. Hs 80919(SYPL), Accession No. Hs 80986(ATP5G1), Accession No. Hs 81328(NFKBIA), Accession No. Hs 81424(SUMO1), Accession No. Hs 81848(RAD21), Accession No. Hs 81964(SEC24C), Accession No. Hs 82201(CSNK2A2), Accession No. Hs 82327(GSS), Accession No. Hs 82719(MGC21416), Accession No. Hs 82793(PSMB3), Accession No. Hs 82887(PPP1R11), Accession No. Hs 82890(DAD1), Accession No. Hs 82916(CCT6A), Accession No. Hs 82927(AMPD2), Accession No. Hs 83190(FASN), Accession No. Hs 83347(AAMP), Accession No. Hs 83383(PRDX4), Accession No. Hs 83734(STX4A), Accession No. Hs 83753(SNRPB), Accession No. Hs 83765(DHFR), Accession No. Hs 83916(NDUFA5), Accession No. Hs 84359(GABARAP), Accession No. Hs 84753(FLJ12442), Accession No. Hs 85155(ZFP36L1), Accession No. Hs 85769(ERBP), Accession No. Hs 85962(DERPC), Accession No. Hs 86131(FADD), Accession No. Hs 87752(MSN), Accession No. Hs 89545(PSMB4), Accession No. Hs 89643(TKT), Accession No. Hs 89649(EPHX1), Accession No. Hs 89781(UBTF), Accession No. Hs 89864(SKIV2L), Accession No. Hs 90061(PGRMC1), Accession No. Hs 90093(HSPA4), Accession No. Hs 90107(ADRM1), Accession No. Hs 90443(NDUFS8), Accession No. Hs 91142(KHSRP), Accession No. Hs 91531(MLLT6), Accession No. Hs 93659(ERP70), Accession No. Hs 93832(LOC54499), Accession No. Hs 95577(CDK4), Accession No. Hs 96530(COX11), Accession No. Hs 96852(FLJ21128), Accession No. Hs 96996(HNRPAO), Accession No. Hs 97616(SH3GL1), Accession No. Hs 97887(RCN1), Accession No. Hs 98751(FUBP3), Accession No. Hs 98791(ACTR1B), Accession No. Hs 102696(MCTS1), Accession No. Hs 102798(PSMA1), Accession No. Hs 103561(ARL6IP4), Accession No. Hs 103834(MGC5576), Accession No. Hs 104839(TIMP2), Accession No. Hs 105547(NPDC1), Accession No. Hs 106185(RALGDS), Accession No. Hs 106876(ATP6V0D1), Accession No. Hs 106909(ANAPC13), Accession No. Hs 107003(CCNB1IP1), Accession No. Hs 107101(FLJ31031), Accession No. Hs 107387(C7orf20), Accession No. Hs 107393(C3orf4), Accession No. Hs 108029(SH3BGRL), Accession No. Hs 108080(CSRP1), Accession No. Hs 108371(E2F4), Accession No. Hs 108408(APH-1A), Accession No. Hs 108957(RPS27L), Accession No. Hs 108969(PTD008), Accession No. Hs 109051(SH3BGRL3), Accession No. Hs 109052(C14orf2), Accession No. Hs 109672(SIAT7F), Accession No. Hs 109798(C6orf48), Accession No. Hs 110695(SF3B5), Accession No. Hs 110849(ESRRA), Accession No. Hs 111286(MRPS11), Accession No. Hs 111577(ITM2C), Accession No. Hs 111801(ARS2), Accession No. Hs 112058(SIVA), Accession No. Hs 112318(TOMM7), Accession No. Hs 112955(NUDT5), Accession No. Hs 114033(SSR1), Accession No. Hs 114286(CD9), Accession No. Hs 114412(TXNL1), Accession No. Hs 115474(RFC3), Accession No. Hs 115792(EXOSC7), Accession No. Hs 116448(GLS), Accession No. Hs 117176(PABPN1), Accession No. Hs 117715(ST5), Accession No. Hs 118110(BST2), Accession No. Hs 118400(FSCN1), Accession No. Hs 118463(PNPLA2), Accession No. Hs 118638(NME1), Accession No. Hs 118722(FUT8), Accession No. Hs 118964(p66alpha), Accession No. Hs 118983(GSDMDC1), Accession No. Hs 19177(ARF3), Accession No. Hs 119192(H2AFZ), Accession No. Hs 119251(UQCRC1), Accession No. Hs 119591(AP2S1), Accession No. Hs 119598(RPL3), Accession No. Hs 120323(DNAPTP6), Accession No. Hs 121088(NUP153), Accession No. Hs 121549(CDIPT), Accession No. Hs 122363(WIPI-2), Accession No. Hs 122523(SND1), Accession No. Hs 124126(ARPC1A), Accession No. Hs 124147(FBXL11), Accession No. Hs 124246(C10orf119), Accession No. Hs 124366(BBX), Accession No. Hs 125113(CCT8), Accession No. Hs 125867(EVL), Accession No. Hs 125898(GNAS), Accession No. Hs 126497(AEBP2), Accession No. Hs 126774(RAMP), Accession No. Hs 126938(NAPA), Accession No. Hs 127092(DHX38), Accession No. Hs 127249(EAP30), Accession No. Hs 127386(MAMDC2), Accession No. Hs 127764(RAB5C), Accession No. Hs 128065(CTSC), Accession No. Hs 128199(SEPT11), Accession No. Hs 128548(WDR1), Accession No. Hs 129634(CINP), Accession No. Hs 129673(EIF4A1), Accession No. Hs 130031(TRIO), Accession No. Hs 130098(DDX23), Accession No. Hs 130293(CROP), Accession No. Hs 130413(TM9SF2), Accession No. Hs 131226(BNIP3L), Accession No. Hs 132497(PRNPIP), Accession No. Hs 132513 HSD17B12), Accession No. Hs 133892(TPM1), Accession No. Hs 134074(SLC35E1), Accession No. Hs 134688(PSMD13), Accession No. Hs 135406(CEBPZ), Accession No. Hs 136905(UREB1), Accession No. Hs 136947(RALY), Accession No. Hs 137510(NCOR2), Accession No. Hs 138860(ARHGAP1), Accession No. Hs 139896(MAEA), Accession No. Hs 140452(M6PRBP1), Accession No. Hs 142442(HP1-BP74), Accession No. Hs 143187(DDX49), Accession No. Hs 143766(DRPLA), Accession No. Hs 143873(S100A10), Accession No. Hs 144058(EBSP), Accession No. Hs 144468(MGC3234), Accession No. Hs 144835(EEF1G), Accession No. Hs 144868(VTI1B), Accession No. Hs 144941(MUF1), Accession No. Hs 144949(ZNF313), Accession No. Hs 144980(SCAMP4), Accession No. Hs 145049(PLEKHM2), Accession No. Hs 145442(MAP2K1), Accession No. Hs 145575(UBL3), Accession No. Hs 146070(TPM3), Accession No. Hs 146393(HERPUD1), Accession No. Hs 146602(QP-C), Accession No. Hs 146804(SPIN), Accession No. Hs 146806(CUL1), Accession No. Hs 147433(PCNA), Accession No. Hs 148078(RBAF600), Accession No. Hs 148272(CCM2), Accession No. Hs 148330(ARF4), Accession No. Hs 148340(PTPRG), Accession No. Hs 148670(RHOBTB1), Accession No. Hs 149004(FBXO31), Accession No. Hs 149957(RPS6KA1), Accession No. Hs 149983(PEX14), Accession No. Hs 150107(BIRC6), Accession No. Hs 150540(BC002942), Accession No. Hs 150580(SUI1), Accession No. Hs 150837(TXNDC5), Accession No. Hs 151134(OXA1L), Accession No. Hs 151220(KIAA0992), Accession No. Hs 151413(GMFB), Accession No. Hs 151787(U5-116KD), Accession No. Hs 152536(p44S10), Accession No. Hs 153177(RPS28), Accession No. Hs 154023(TXNDC4), Accession No. Hs 154073(SLC35B1), Accession No. Hs 155165(ZFPL1), Accession No. Hs 155218(HNRPUL1), Accession No. Hs 155396(NFE2L2), Accession No. Hs 155829(KIAA0676), Accession No. Hs 156171(PSMC6), Accession No. Hs 156367(RPS29), Accession No. Hs 156667(KIAA1536), Accession No. Hs 157160(MRPS34), Accession No. Hs 157351(PTD004), Accession No. Hs 157379(H2AFV), Accession No. Hs 157394(HAGH), Accession No. Hs 159014(PRPF4B), Accession No. Hs 159118(AMD1), Accession No. Hs 159130(RAF1), Accession No. Hs 159161(ARHGDIA), Accession No. Hs 159699(FBXO21), Accession No. Hs 159799(THRAP2), Accession No. Hs 160958(CDC37), Accession No. Hs 161357(PDHB), Accession No. Hs 162032(HBP1), Accession No. Hs 162233(CHD4), Accession No. Hs 162877(PACSIN2), Accession No. Hs 163645(MOCS2), Accession No. Hs 163776(UBE2J1), Accession No. Hs 163893(PICALM), Accession No. Hs 165195(VAPA), Accession No. Hs 166011(CTNND1), Accession No. Hs 166204(PHF1), Accession No. Hs 166463(HNRPU), Accession No. Hs 166924(SEC13L1), Accession No. Hs 166975(SFRS5), Accession No. Hs 167535(SRP54), Accession No. Hs 168073(TRPC4AP), Accession No. Hs 168799(METTL3), Accession No. Hs 169611(DIABLO), Accession No. Hs 169718(CNN2), Accession No. Hs 170107(UQCRFS1), Accession No. Hs 170131(NFIC), Accession No. Hs 170553(CNOT7), Accession No. Hs 170622(CFL1), Accession No. Hs 171626(SKP1A), Accession No. Hs 172550(PTBP1), Accession No. Hs 172755(BRP44L), Accession No. Hs 172928(COL1A1), Accession No. Hs 173024(NYREN18), Accession No. Hs 173162(NOC4), Accession No. Hs 173381(DPYSL2), Accession No. Hs 173464(FKBP8), Accession No. Hs 173611(NDUFS2), Accession No. Hs 173705(LOC401152), Accession No. Hs 173724(CKB), Accession No. Hs 174050(EDF1), Accession No. Hs 174195(IFITM2), Accession No. Hs 175473(AK1), Accession No. Hs 175955(YT521), Accession No. Hs 177530(ATP5E), Accession No. Hs 177766(PARP1), Accession No. Hs 178551(RPL8), Accession No. Hs 178728(MBD3), Accession No. Hs 179986(FLOT1), Accession No. Hs 180141(CFL2), Accession No. Hs 180312(MRPS16), Accession No. Hs 180414(HSPA8), Accession No. Hs 180877(H3F3B), Accession No. Hs 180903(384D8-2), Accession No. Hs 180909(PRDX1), Accession No. Hs 180933(CXXC1), Accession No. Hs 181046(DUSP3), Accession No. Hs 181112(MED4), Accession No. Hs 181163(HMGN2), Accession No. Hs 181244(HLA-A), Accession No. Hs 181368(PRPF8), Accession No. Hs 181444(TMEM9), Accession No. Hs 182255(NHP2L1), Accession No. Hs 182626(C22orf5), Accession No. Hs 182885(SLC35B2), Accession No. Hs 183684(EIF4G2), Accession No. Hs 183706(ADD1), Accession No. Hs 183800(RANGAP1), Accession No. Hs 183850(DCTD), Accession No. Hs 183994(PPP1CA), Accession No. Hs 184062(C20orf24), Accession No. Hs 184211(PMPCB), Accession No. Hs 184233(HSPA9B), Accession No. Hs 184492(ELAVL1), Accession No. Hs 185172(GNB2), Accession No. Hs 185597(SPG7), Accession No. Hs 187199(MALAT1), Accession No. Hs 187635(RPS15A), Accession No. Hs 187763(BRD4), Accession No. Hs 187866(SDFR1), Accession No. Hs 187946(SLC20A1), Accession No. Hs 188501(PAFAH1B2), Accession No. Hs 188614(PLEKHA5), Accession No. Hs 188879(RBM6), Accession No. Hs 188882(NUDT3), Accession No. Hs 189075(PTK9), Accession No. Hs 189119(CXXC5), Accession No. Hs 189329(SMURF1), Accession No. Hs 189716(NDUFAB1), Accession No. Hs 189772(CCT2), Accession No. Hs 190028(GSTO1), Accession No. Hs 190086(MRCL3), Accession No. Hs 190334(RAP1A), Accession No. Hs 190384(COPS4), Accession No. Hs 190722(HSPC142), Accession No. Hs 190904(STRN4), Accession No. Hs 191186(TTC17), Accession No. Hs 191346(SEPT7), Accession No. Hs 191518(DHX9), Accession No. Hs 191987(UBE2J2), Accession No. Hs 192316(CDC2L1), Accession No. Hs 192374(TRA1), Accession No. Hs 192425(EIF3S8), Accession No. Hs 193118(RAI17), Accession No. Hs 193163(BIN1), Accession No. Hs 193491(TUBB6), Accession No. Hs 194329(TCEAL4), Accession No. Hs 194718(ZNF265), Accession No. Hs 195464(FLNA), Accession No. Hs 195642(C17orf27), Accession No. Hs 196983(SSFA2), Accession No. Hs 198281(PKM2), Accession No. Hs 199561(RANBP2), Accession No. Hs 199625(HAX1), Accession No. Hs 200063(HDAC7A), Accession No. Hs 200600(SCAMP3), Accession No. Hs 200804(SDCBP), Accession No. Hs 201253(ch-TOG), Accession No. Hs 201390(WDR45L), Accession No. Hs 201712(GLG1), Accession No. Hs 202011(GK001), Accession No. Hs 202085(VDAC1), Accession No. Hs 202166(HNRPH1), Accession No. Hs 202179(SMN2), Accession No. Hs 203099(KIAA0261), Accession No. Hs 203910(SGTA), Accession No. Hs 204041(AHSA1), Accession No. Hs 204773(MEP50), Accession No. Hs 205163(MRPL3), Accession No. Hs 206500(CTTN), Accession No. Hs 206824(MGC71993), Accession No. Hs 208597(CTBP1), Accession No. Hs 209983(STMN1), Accession No. Hs 210469(ELMO2), Accession No. Hs 210532(KIAA0141), Accession No. Hs 211463(DNM2), Accession No. Hs 211594(PSMC4), Accession No. Hs 211914(NDUFS7), Accession No. Hs 212102(TXNDC7), Accession No. Hs 212395(CIZ1), Accession No. Hs 213061(NUCKS), Accession No. Hs 213470(PSMB7), Accession No. Hs 213541, Accession No. Hs 213666(KIAA0460), Accession No. Hs 213724(SUPT16H), Accession No. Hs 216653(FBXO9), Accession No. Hs 220950(FOXO3A), Accession No. Hs 221847(SLC38A2), Accession No. Hs 222510(DAZAP1), Accession No. Hs 223141(DDX21), Accession No. Hs 224607(SDC1), Accession No. Hs 226007(RDH11), Accession No. Hs 226117(H1F0), Accession No. Hs 226755(YWHAH), Accession No. Hs 227067(ATAD3A), Accession No. Hs 227253(TOMM70A), Accession No. Hs 227777(PTP4A1), Accession No. Hs 229641(PC4), Accession No. Hs 231295(PITPNC1), Accession No. Hs 231616(HSPCO23), Accession No. Hs 232194(KIAA0174), Accession No. Hs 232543(PDCD4), Accession No. Hs 233458(NFYC), Accession No. Hs 233552(CDC2L5), Accession No. Hs 233952(PSMA7), Accession No. Hs 234521(MAPKAPK3), Accession No. Hs 236030(SMARCC2), Accession No. Hs 237536(MGC20781), Accession No. Hs 237971(XTP3TPA), Accession No. Hs 238839(SCYL1), Accession No. Hs 240170(MGC2731), Accession No. Hs 241336(ATPIF1), Accession No. Hs 241543(POLDIP2), Accession No. Hs 241558(ARIH2), Accession No. Hs 241575(GNPTG), Accession No. Hs 241576(DERL1), Accession No. Hs 241579(SERPINH1), Accession No. Hs 242458(SPG21), Accession No. Hs 242947(DGKI), Accession No. Hs 246112(ASCC3L1), Accession No. Hs 246310(ATP5J), Accession No. Hs 246413(CPNE1), Accession No. Hs 246781(FBXO11), Accession No. Hs 247077(RHOA), Accession No. Hs 247186(FBS1), Accession No. Hs 247975(HSPD1), Accession No. Hs 248267(MPST), Accession No. Hs 248941(TAF9), Accession No. Hs 49600(DLGAP4), Accession No. Hs 250009(ARL10C), Accession No. Hs 250429(SUPT6H), Accession No. Hs 250758(PSMC3), Accession No. Hs 250899(HSBP1), Accession No. Hs 250905(LOC51234), Accession No. Hs 251531(PSMA4), Accession No. Hs 252457(MVD), Accession No. Hs 252713(TTC15), Accession No. Hs 252967 DKFZp566C0424), Accession No. Hs 253726(PAPOLA), Accession No. Hs 253903(STOM), Accession No. Hs 254042(BAT1), Accession No. Hs 255015(VPS24), Accession No. Hs 255093(PFKL), Accession No. Hs 255932(XRN2), Accession No. Hs 255935(BTG1), Accession No. Hs 255973(CRI1), Accession No. Hs 256301(MGC13170), Accession No. Hs 256549(NUBP2), Accession No. Hs 257008(PLD3), Accession No. Hs 257341(SAV1), Accession No. Hs 57761(SH3BP5), Accession No. Hs 258551(DNPEP), Accession No. Hs 258563(FEZ2), Accession No. Hs 258798 C10orf86), Accession No. Hs 259461(PALM2-AKAP2), Accession No. Hs 260603(PIP5K2B), Accession No. Hs 262823(FLJ10326), Accession No. Hs 265829(ITGA3), Accession No. Hs 268488(KIAA1185), Accession No. Hs 268530(GPS1), Accession No. Hs 268742(C13orf12), Accession No. Hs 268849(GLO1), Accession No. Hs 268939(MATR3), Accession No. Hs 269528(MAK3), Accession No. Hs 269577(PTPRA), Accession No. Hs 269782(GNAQ), Accession No. Hs 269944(MTCH2), Accession No. Hs 270291(ACTN4), Accession No. Hs 270428(SUCLG1), Accession No. Hs 270525(LASS5), Accession No. Hs 270869(ZNF410), Accession No. Hs 271135(ATP5C1), Accession No. Hs 271695(NOB1P), Accession No. Hs 272062(PTPRF), Accession No. Hs 272168(TDE1), Accession No. Hs 272630(ATP6V1D), Accession No. Hs 272927(SEC23A), Accession No. Hs 273077(TMEM14B), Accession No. Hs 274184(TFE3), Accession No. Hs 274772(C15orf15), Accession No. Hs 274873(CARS), Accession No. Hs 275243(S100A6), Accession No. Hs 275775(SEPP1), Accession No. Hs 275865(PCNP), Accession No. Hs 276878(NUP93), Accession No. Hs 277035(MGLL), Accession No. Hs 277517(C11orf2), Accession No. Hs 278186(ARHGEF1), Accession No. Hs 278362(MEA), Accession No. Hs 278426(PDAP1), Accession No. Hs 278429(C9orf78), Accession No. Hs 278500(GNPDA1), Accession No. Hs 278569(SNX17), Accession No. Hs 278573(CD59), Accession No. Hs 278721(SLC39A7), Accession No. Hs 279061(C17orf25), Accession No. Hs 279245(TACC1), Accession No. Hs 279257(PCMT1), Accession No. Hs 279413(POLD1), Accession No. Hs 279529(PX19), Accession No. Hs 279583(DREV1), Accession No. Hs 279623(SEPX1), Accession No. Hs 279640(TPR), Accession No. Hs 279652(MRPL4), Accession No. Hs 279669(TUBG1), Accession No. Hs 279696(SUMF2), Accession No. Hs 279806(DDX5), Accession No. Hs 79836(COMMD9), Accession No. Hs 279920(YWHAB), Accession No. Hs 279929(TMED9), Accession No. Hs 80202(SBF1), Accession No. Hs 280342(PRKAR1A), Accession No. Hs 280378(SNRPB2), Accession No. Hs 282410(CALM1), Accession No. Hs 282700(SPCS2), Accession No. Hs 282901(RNPC2), Accession No. Hs 282998(RBM9), Accession No. Hs 283111(C14orf124), Accession No. Hs 283454(BNIP2), Accession No. Hs 283521(RHEB), Accession No. Hs 283610(APG4B), Accession No. Hs 283652(IDI1), Accession No. Hs 283739(UBQLN4), Accession No. Hs 284208(ANKRD25), Accession No. Hs 284279(HMOX2), Accession No. Hs 284286(MRPS24), Accession No. Hs 284491(PDXK), Accession No. Hs 285354(MAX), Accession No. Hs 285976(LASS2), Accession No. Hs 286221(ARF1), Accession No. Hs 286226(MYO1C), Accession No. Hs 288193(KPNA4), Accession No. Hs 288856(PFDN5), Accession No. Hs 288969(HSCARG), Accession No. Hs 289008(C6orf68), Accession No. Hs 289092(COTL1), Accession No. Hs 289123(DCTN2), Accession No. Hs 289271(CYC1), Accession No. Hs 290243(GBF1), Accession No. Hs 290404(SLC25A3), Accession No. Hs 290758(DDB1), Accession No. Hs 291587(ARID1B), Accession No. Hs 292026(EIF4E2), Accession No. Hs 292063(EIF4B), Accession No. Hs 292078(LARP), Accession No. Hs 292265(ZMYND11), Accession No. Hs 292457, Accession No. Hs 292493(G22P1), Accession No. Hs 292524(CCNH), Accession No. Hs 292579(PTDSS1), Accession No. Hs 293563(FLJ12666), Accession No. Hs 295917(ATP6V1B2), Accession No. Hs 297324(TIMP3), Accession No. Hs 298198(CKLFSF3), Accession No. Hs 298280(ATP5A1), Accession No. Hs 298654(DUSP6), Accession No. Hs 299002(FBL), Accession No. Hs 299055(GDI2), Accession No. Hs 300141(RPL39), Accession No. Hs 300684(RCP9), Accession No. Hs 300772(TPM2), Accession No. Hs 300816 RAB1B), Accession No. Hs 300834(GALNT2), Accession No. Hs 301404(RBM3), Accession No. Hs 301412(Ufc1), Accession No. Hs 302742(MRPS6), Accession No. Hs 302903(UBE2I), Accession No. Hs 303676(G3BP2), Accession No. Hs 304192(DSTN), Accession No. Hs 304682(CST3), Accession No. Hs 306123(MAGEF1), Accession No. Hs 306242(RANBP9), Accession No. Hs 306329(ZA20D3), Accession No. Hs 306425(IBTK), Accession No. Hs 308122(ITPK1), Accession No. Hs 308340(NUP188), Accession No. Hs 308709(GRP58), Accession No. Hs 309090(SFRS7), Accession No. Hs 309231(C6orf153), Accession No. Hs 309641(RNF11), Accession No. Hs 309753(STARD3NL), Accession No. Hs 309849(C14orf159), Accession No. Hs 310542(TOMM40), Accession No. Hs 310645(RAB1A), Accession No. Hs 311072(MRPS35), Accession No. Hs 311346(CMAS), Accession No. Hs 311609(DDX39), Accession No. Hs 311640(RPS27A), Accession No. Hs 312098(ADAM15), Accession No. Hs 313847(TXNDC11), Accession No. Hs 314263(BAZ2A), Accession No. Hs 314359(EIF3S12), Accession No. Hs 315177(IFRD2), Accession No. Hs 315230(GC20), Accession No. Hs 319334(NASP), Accession No. Hs 321391(MGC4549), Accession No. Hs 321541(RAB11A), Accession No. Hs 323363(APG9L1), Accession No. Hs 323489(FLJ20758), Accession No. Hs 324250(NDUFB2), Accession No. Hs 324844(VKORC1), Accession No. Hs 325650(EHD2), Accession No. Hs 326387(MORF4L2), Accession No. Hs 330384(CORO1C), Accession No. Hs 331431(SCC-112), Accession No. Hs 333388(EEF1D), Accession No. Hs 333579(HSPC152), Accession No. Hs 333786(PSMA2), Accession No. Hs 333823(MRPL13), Accession No. Hs 334017(K-ALPHA-1), Accession No. Hs 334479(TRAF7), Accession No. Hs 334534(GNS), Accession No. Hs 334587(RBPMS), Accession No. Hs 334713(BMSC-UbP), Accession No. Hs 334851(LASP1), Accession No. Hs 334868(PPP2R5E), Accession No. Hs 335003(ANKRD11), Accession No. Hs 335057(SEPT2), Accession No. Hs 335163(KIAA1102), Accession No. Hs 335918(FDPS), Accession No. Hs 337295(STIP1), Accession No. Hs 337766(TXNRD1), Accession No. Hs 339278(COPB), Accession No. Hs 339639(COX7A2L), Accession No. Hs 339697(GRINA), Accession No. Hs 343911(EI24), Accession No. Hs 345694(KCMF1), Accession No. Hs 346868(EBNA1BP2), Accession No. Hs 348418(DR1), Accession No. Hs 349656(SCARB2), Accession No. Hs 350194(ZMAT2), Accession No. Hs 350229(CASC3), Accession No. Hs 350268(IRF2BP2), Accession No. Hs 350364(C9orf10OS), Accession No. Hs 350927(SLC25A6), Accession No. Hs 351099(FLJ10241), Accession No. Hs 351296(LOC51035), Accession No. Hs 351316(TM4SF1), Accession No. Hs 351474(PAQR4), Accession No. Hs 351680, Accession No. Hs 351875(COX6C), Accession No. Hs 352341(STCH), Accession No. Hs 352656(GHITM), Accession No. Hs 352768(PSMB1), Accession No. Hs 354056(POR), Accession No. Hs 355141(TNIP1), Accession No. Hs 355606(MGC23909), Accession No. Hs 355643(RNPS1), Accession No. Hs 355708(FLJ20507), Accession No. Hs 355750(MGC5306), Accession No. Hs 355753(DKFZp586M1819), Accession No. Hs 355867(MARS), Accession No. Hs 355927(VDAC2), Accession No. Hs 355934(SFPQ), Accession No. Hs 355983(BZW1), Accession No. Hs 356061(MAP1LC3B), Accession No. Hs 356096(FLJ10350), Accession No. Hs 356190(UBB), Accession No. Hs 356270(SDHD), Accession No. Hs 356285(HMGN1), Accession No. Hs 356331(PPIA), Accession No. Hs 356366(RPS2), Accession No. Hs 356371(RPL28), Accession No. Hs 356377(LOC149603), Accession No. Hs 356467(MGC2747), Accession No. Hs 356501(PHF6), Accession No. Hs 356502(RPLP1), Accession No. Hs 356549(SNRPD3), Accession No. Hs 356630(NUTF2), Accession No. Hs 356647(SNX6), Accession No. Hs 356654(PSMC1), Accession No. Hs 56766( ), Accession No. Hs 356769(MAN2B1), Accession No. Hs 356799, Accession No. Hs 357901(SOX4), Accession No. Hs 362728(SEP15), Accession No. Hs 365116(U2AF1), Accession No. Hs 368084(LRPPRC), Accession No. Hs 368149(CCT7), Accession No. Hs 368157(PYGB), Accession No. Hs 368240(DYRK1A), Accession No. Hs 68264(PPP2R5C), Accession No. Hs 368376(SRPR), Accession No. Hs 368402(LOC51337), Accession No. Hs 368404(EXT2), Accession No. Hs 368525(PDLIM1), Accession No. Hs 368598(LEREPO4), Accession No. Hs 368934(MGC40157), Accession No. Hs 368985(TRIP12), Accession No. Hs 369017(RAB2), Accession No. Hs 369052(SELT), Accession No. Hs 369068(DNCLI2), Accession No. Hs 369125(PSMD14), Accession No. Hs 369285(DKFZP434B168), Accession No. Hs 369356(MLL5), Accession No. Hs 369606(CPSF6), Accession No. Hs 369607(GAK), Accession No. Hs 369614(COPS2), Accession No. Hs 369615(FLJ20551), Accession No. Hs 369761(DAZAP2), Accession No. Hs 369785(MGC2749), Accession No. Hs 369920(RAP1B), Accession No. Hs 370024(SEC31L1), Accession No. Hs 370247(APLP2), Accession No. Hs 370292(BCCIP), Accession No. Hs 370312(FNTA), Accession No. Hs 370408(COMT), Accession No. Hs 370581(CAP1), Accession No. Hs 370770(XPO1), Accession No. Hs 370771(CDKN1A), Accession No. Hs 370895(RPN2), Accession No. Hs 370927(PRO1855), Accession No. Hs 370937(TAPBP), Accession No. Hs 371001(EIF3S9), Accession No. Hs 371416(CARM1), Accession No. Hs 371563(RAB14), Accession No. Hs 371788(DKFZP547E1010), Accession No. Hs 371889(ATP1A1), Accession No. Hs 372003(C9orf10), Accession No. Hs 372050(SMAP-5), Accession No. Hs 372286(CUL3), Accession No. Hs 372331(SPTAN1), Accession No. Hs 372541(KBTBD2), Accession No. Hs 372616(ARL1), Accession No. Hs 372914(NDRG1), Accession No. Hs 373550(TGIF), Accession No. Hs 373741(HM13), Accession No. Hs 373763(HNRPR), Accession No. Hs 373952(CAMTA2), Accession No. Hs 373959(VGLL4), Accession No. Hs 374043(ASXL1), Accession No. Hs 374257(SIAT4A), Accession No. Hs 374378(CKS1B), Accession No. Hs 374477(EWSR1), Accession No. Hs 374503(MORF4L1), Accession No. Hs 374588(RPL17), Accession No. Hs 374596(TPT1), Accession No. Hs 374650(IFITM3), Accession No. Hs 374973(PRPF4), Accession No. Hs 375001(TLN1), Accession No. Hs 375108(CD24), Accession No. Hs 375217(RNF31), Accession No. Hs 376046(BTN3A2), Accession No. Hs 376933(GUK1), Accession No. Hs 377155(LYRIC), Accession No. Hs 378103(RPS5), Accession No. Hs 378532(HBS1L), Accession No. Hs 378808(eIF2A), Accession No. Hs 380403(PCGF4), Accession No. Hs 380774(DDX3X), Accession No. Hs 380953(RPL38), Accession No. Hs 380973(SUMO2), Accession No. Hs 381008(HLA-E), Accession No. Hs 381058(KIAA0146), Accession No. Hs 381072(PPIF), Accession No. Hs 381123(RPL21), Accession No. Hs 381126(RPS14), Accession No. Hs 381189(CBX3), Accession No. Hs 381219, Accession No. Hs 381256(GLTP), Accession No. Hs 382044(MRPS2), Accession No. Hs 382168(NCOA3), Accession No. Hs 385913(ANP32E), Accession No. Hs 385986(UBE2B), Accession No. Hs 386434(ANXA7), Accession No. Hs 386465(CHERP), Accession No. Hs 386939(USP7), Accession No. Hs 387208(FAU), Accession No. Hs 387804(PABPC1), Accession No. Hs 388034(RXRB), Accession No. Hs 388654(ATP6V1G1), Accession No. Hs 388664(RPL11), Accession No. Hs 388739(XRCC5), Accession No. Hs 388927(YY1), Accession No. Hs 388956(C19orf22), Accession No. Hs 389037(MCM3APAS), Accession No. Hs 389107(ATP6VOC), Accession No. Hs 389171(PINK1), Accession No. Hs 389649(DDX48), Accession No. Hs 389734(TCEAL8), Accession No. Hs 389996(CHCHD2), Accession No. Hs 390667(GSTK1), Accession No. Hs 393201(ACTR2), Accession No. Hs 395482(PTK2), Accession No. Hs 396644(PAIP2), Accession No. Hs 396740(NIP30), Accession No. Hs 396783(SLC9A3R1), Accession No. Hs 397609(RPS16), Accession No. Hs 399800(AKAP8L), Accession No. Hs 400295(RPL30), Accession No. Hs 401509(RBM10), Accession No. Hs 401903(COX5A), Accession No. Hs 401929(RPL10), Accession No. Hs 403917(STK24), Accession No. Hs 404056(EIF3S1), Accession No. Hs 404321(GARS), Accession No. Hs 405144(SFRS3), Accession No. Hs 405410(OGT), Accession No. Hs 405514(LOC284058), Accession No. Hs 405590(EIF3S6), Accession No. Hs 405880(MRPS21), Accession No. Hs 405942(LOC339229), Accession No. Hs 406062(NDUFA11), Accession No. Hs 406068(UBE2M), Accession No. Hs 406096(ZA20D2), Accession No. Hs 406277(SF3A1), Accession No. Hs 406300(RPL23), Accession No. Hs 406423(SF3B2), Accession No. Hs 406510(ATP5B), Accession No. Hs 406520(LOC389541), Accession No. Hs 406534(HMG20B), Accession No. Hs 406590(PGR1), Accession No. Hs 406620(RPS10), Accession No. Hs 406683(RPS15), Accession No. Hs 406799(RAB18), Accession No. Hs 406840(SLC35A4), Accession No. Hs 407368(C19orf13), Accession No. Hs 407580(PKP4), Accession No. Hs 407995(MIF), Accession No. Hs 408018(RPL36), Accession No. Hs 408073(RPS6), Accession No. Hs 408236(TXNL5), Accession No. Hs 408257(NDUFS6), Accession No. Hs 408293(KAB), Accession No. Hs 408324(FLJ10769), Accession No. Hs 408428(CHES1), Accession No. Hs 408581(SVIL), Accession No. Hs 408909(GOLPH3), Accession No. Hs 409140(ATP50), Accession No. Hs 409223(SSR4), Accession No. Hs 409230(AGPAT1), Accession No. Hs 409834(PHPT1), Accession No. Hs 410197(IDH3G), Accession No. Hs 410596(HAN11), Accession No. Hs 410817(RPL13), Accession No. Hs 411480(AUP1), Accession No. Hs 411641(EIF4EBP1), Accession No. Hs 411847(MAPK6), Accession No. Hs 412103(EFHA1), Accession No. Hs 412117(ANXA6), Accession No. Hs 412196(ESRRBL1), Accession No. Hs 412433(AIP), Accession No. Hs 412468(KLHDC3), Accession No. Hs 412842(C10orf7), Accession No. Hs 413036(WBSCR22), Accession No. Hs 413482(C21orf33), Accession No. Hs 414579(SCOTIN), Accession No. Hs 415342(KIAA1049), Accession No. Hs 416049(TNPO2), Accession No. Hs 416436(TRIM50A), Accession No. Hs 417004(S100A11), Accession No. Hs 417029(DERP6), Accession No. Hs 418123(CTSL), Accession No. Hs 418175(VPS28), Accession No. Hs 418233(MRPL24), Accession No. Hs 418450(MRPL11), Accession No. Hs 418533(BUB3), Accession No. Hs 418668(ATP5D), Accession No. Hs 419640(PARK7), Accession No. Hs 420269(COL6A2), Accession No. Hs 420272(H2AFY), Accession No. Hs 421257(RPL7), Accession No. Hs 421509(CCT4), Accession No. Hs 422113(ZNF511), Accession No. Hs 423935(RDBP), Accession No. Hs 423968(TTC11), Accession No. Hs 424126(SERF2), Accession No. Hs 424908(LSM5), Accession No. Hs 425777(UBE2L6), Accession No. Hs 426296(C10orf104), Accession No. Hs 426359(DKFZp564J157), Accession No. Hs 429052(ITGB1), Accession No. Hs 429353(SEPN1), Accession No. Hs 429581(RTN4), Accession No. Hs 429819(PITPNA), Accession No. Hs 429839(MGC23908), Accession No. Hs 430425(GNB1), Accession No. Hs 430551(IQGAP1), Accession No. Hs 430606(CS), Accession No. Hs 430657(ARF5), Accession No. Hs 430733(CLNS1A), Accession No. Hs 431101(GNG12), Accession No. Hs 431367(C6orf55), Accession No. Hs 431498(FOXP1), Accession No. Hs 431550(MAP4K4), Accession No. Hs 431668(COX6B1), Accession No. Hs 431850(MAPK1), Accession No. Hs 431861(PPP5C), Accession No. Hs 431926 NFKB1), Accession No. Hs 432121(PRDX2), Accession No. Hs 432438(EML4), Accession No. Hs 432491(ESD), Accession No. Hs 432690(SLC39A9), Accession No. Hs 432760(CAPZB), Accession No. Hs 432898(RPL4), Accession No. Hs 432976(NR1H2), Accession No. Hs 433154(PLSCR3), Accession No. Hs 433201(CDK2AP1), Accession No. Hs 433222(NPC2), Accession No. Hs 433291(ARD1), Accession No. Hs 433307(BCKDHA), Accession No. Hs 433343(SRRM2), Accession No. Hs 433345, Accession No. Hs 433419(COX4I1), Accession No. Hs 433512(ACTR3), Accession No. Hs 433529(RPS11), Accession No. Hs 433540(DNAJC8), Accession No. Hs 433573(Bles03), Accession No. Hs 433615(TUBB2), Accession No. Hs 433701(RPL37A), Accession No. Hs 433722(KIAA1967), Accession No. Hs 33732(CLK1), Accession No. Hs 433750(EIF4G1), Accession No. Hs 433759(BANF1), Accession No. Hs 433795(SHC1), Accession No. Hs 433863(PBP), Accession No. Hs 433901(COX8A), Accession No. Hs 433951(GPX4), Accession No. Hs 434102(HMGB1), Accession No. Hs 434207(HARS2), Accession No. Hs 434219(ANKHD1), Accession No. Hs 434401(ZNF638), Accession No. Hs 434937(PPIB), Accession No. Hs 434953(HMGB2), Accession No. Hs 434980(APP), Accession No. Hs 435044(TBC1D22A), Accession No. Hs 435064(KIAA1608), Accession No. Hs 435120(KIF1C), Accession No. Hs 435136(TXN), Accession No. Hs 435166(LBR), Accession No. Hs 435231(ZFR), Accession No. Hs 435255(UBXD1), Accession No. Hs 435326(ACTL6A), Accession No. Hs 435512(PPP3CA), Accession No. Hs 435535(ZNF395), Accession No. Hs 435610(WAC), Accession No. Hs 435741(GCSH), Accession No. Hs 435759(THAP4), Accession No. Hs 435771(API5), Accession No. Hs 435841(TNRC15), Accession No. Hs 435850(LYPLA1), Accession No. Hs 435933(PHF10), Accession No. Hs 435948(ATAD1), Accession No. Hs 435952(CDK5RAP1), Accession No. Hs 435974(MTHFD1), Accession No. Hs 436035(TUBA6), Accession No. Hs 436093(BAT2), Accession No. Hs 436204(ZNF289), Accession No. Hs 436298(EMP1), Accession No. Hs 436405(IDH3B), Accession No. Hs 436437(ALDH2), Accession No. Hs 436446(ARMET), Accession No. Hs 436500(DBNL), Accession No. Hs 436568(CD74), Accession No. is 436578(POLR2F), Accession No. Hs 436657(CLU), Accession No. Hs 436687(SET), Accession No. Hs 436803(VBP1), Accession No. Hs 437056(SUPT5H), Accession No. Hs 437060(CYCS), Accession No. Hs 437110(ANXA2), Accession No. Hs 437178(ACADVL), Accession No. Hs 437256(GRINL1A), Accession No. Hs 437277(MGAT4B), Accession No. Hs 437367(GBAS), Accession No. Hs 437388(PIGT), Accession No. Hs 437403(PP), Accession No. Hs 437594(RPLP2), Accession No. Hs 437638(XBP1), Accession No. its 437779(C11orf10), Accession No. Hs 437831(C14orf32), Accession No. Hs 438072(UNC84A), Accession No. Hs 438219(GPS2), Accession No. Hs 438429(RPS19), Accession No. Hs 438678(TALDO1), Accession No. Hs 438720(MCM7), Accession No. Hs 438970(TBL1XR1), Accession No. Hs 438974(CUTL1), Accession No. Hs 439480(RBM5), Accession No. Hs 439481(SUPT4H1), Accession No. Hs 439548(FLJ22875), Accession No. Hs 439552, Accession No. Hs 439815(HBXIP), Accession No. Hs 440382(RFP), Accession No. Hs 440544(CLIC4), Accession No. Hs 440599(DDX1), Accession No. Hs 440604(PSMD7), Accession No. Hs 440899(TTYH3), Accession No. Hs 440932(SEPT9), Accession No. Hs 440960(RAD23A), Accession No. Hs 440961(CAST), Accession No. Hs 441072(POLR2L), Accession No. Hs 441550(C20orf22), Accession No. Hs 442344(IRS2), Accession No. Hs 442798(RNF10), Accession No. Hs 443134(GBA2), Accession No. Hs 443379(PSMD11), Accession No. Hs 443837(NPEPPS), Accession No. Hs 443914(SOD1), Accession No. Hs 444279(DKFZp761C169), Accession No. Hs 444356(GRB2), Accession No. Hs 444468(CTDSP1), Accession No. Hs 444472(SDHC), Accession No. Hs 444569(VMP1), Accession No. Hs 444673(CRR9), Accession No. Hs 444724(AZI2), Accession No. Hs 444818(CGGBP1), Accession No. Hs 444931(CRSP6), Accession No. Hs 444969(C2orf4), Accession No. Hs 444986(METAP2), Accession No. Hs 445081(NS5ATP13TP2), Accession No. Hs 445351(LGALS1), Accession No. Hs 445394(VPS29), Accession No. Hs 445498(SKIIP), Accession No. Hs 445511(RIOK3), Accession No. Hs 445570(CD63), Accession No. Hs 445803(DC2), Accession No. Hs 445893(KHDRBS1), Accession No. Hs 445977(GTF3A), Accession No. Hs 446017(WSB1), Accession No. Hs 446091(WTAP), Accession No. Hs 446123(CAPZA2), Accession No. Hs 446149(LDHB), Accession No. Hs 446260(PSMA6), Accession No. Hs 446336(PXN), Accession No. Hs 446345(FTH1), Accession No. Hs 446414(CD47), Accession No. Hs 446427(OAZ1), Accession No. Hs 446445(YIF1), Accession No. Hs 446450(ITM2B), Accession No. Hs 446574(TMSB10), Accession No. Hs 446588(RPS13), Accession No. Hs 446623(HNRPL), Accession No. Hs 446628(RPS4X), Accession No. Hs 446641(ARAF), Accession No. Hs 446852(EIF3S6IP), Accession No. Hs 447477(ST13), Accession No. Hs 447492(PGAM1), Accession No. Hs 447547(VPS35), Accession No. Hs 48226(RPLP0), Accession No. Hs 448588(NGFRAP1), Accession No. Hs 448646(RPL27A), Accession No. Hs 448879, Accession No. Hs 449114(HNRPC), Accession No. Hs 449171(HNRPK), Accession No. Hs 454534(USF2), Accession No. Hs 454699(IL6ST), Accession No. Hs 456507(PKD1-like), Accession No. Hs 456557(FLJ10597), Accession No. Hs 458320(DC12), Accession No. Hs 458358(TSPYL1), Accession No. Hs 458414(IFITM1), Accession No. Hs 458458(C19orf27), Accession No. Hs 458747(ANP32A), Accession No. Hs 459106(OAZIN), Accession No. Hs 459149(BTBD1), Accession No. Hs 459174(FLJ23790), Accession No. Hs 459211(AKAP13), Accession No. Hs 459596(MPG), Accession No. Hs 459649(CLCN7), Accession No. Hs 459927(PTMA), Accession No. Hs 459940(LITAF), Accession No. Hs 460238(SH3GLB2), Accession No. Hs 460317(ALS4), Accession No. Hs 460336(GGA2), Accession No. Hs 460468(XPO6), Accession No. Hs 460499(ATXN2L), Accession No. Hs 460574(LOC124446), Accession No. Hs 460923(CNOT1), Accession No. Hs 460929(GOT2), Accession No. Hs 460978(APPBP1), Accession No. Hs 461047(G6PD), Accession No. Hs 461131(CYB5-M), Accession No. Hs 461361(CFDP1), Accession No. Hs 461379(GABARAPL2), Accession No. Hs 461722(HSPC176), Accession No. Hs 461777(PCOLN3), Accession No. Hs 461896(CRK), Accession No. Hs 461925(RPA1), Accession No. Hs 462035(UBE2G1), Accession No. Hs 462086(RIP), Accession No. Hs 462306(UBE2S), Accession No. Hs 462316(TTC19), Accession No. Hs 462492(USP22), Accession No. Hs 462550(PIGS), Accession No. Hs 462956(PPARBP), Accession No. Hs 462998(IGFBP4), Accession No. Hs 463010(SMARCE1), Accession No. Hs 463035(FKBP10), Accession No. Hs 463041(RERE), Accession No. Hs 463059(STAT3), Accession No. Hs 463295(CDC27), Accession No. Hs 463506(AKAP1), Accession No. Hs 463702(BCAS3), Accession No. Hs 463797(C1orf33), Accession No. Hs 464071(PGD), Accession No. Hs 464137(ACOX1), Accession No. Hs 464210(SYNGR2), Accession No. Hs 464336(P4HB), Accession No. Hs 464438(AGTRAP), Accession No. Hs 464472(MRLC2), Accession No. Hs 464595(PPP4R1), Accession No. Hs 464652(TNFSF5IP1), Accession No. Hs 464912(P15RS), Accession No. Hs 465224(NARS), Accession No. Hs 465374(EFHD2), Accession No. Hs 465498(TXNL4A), Accession No. Hs 465529(MIDN), Accession No. Hs 465543(BTBD2), Accession No. Hs 465627(MAP2K2), Accession No. Hs 465645(C19orf10), Accession No. Hs 465808(HNRPM), Accession No. Hs 465849(PIN1), Accession No. Hs 465924(SDHB), Accession No. Hs 466044(PKN1), Accession No. Hs 466088(TPM4), Accession No. Hs 466148(NR2F6), Accession No. Hs 466471(GPI), Accession No. Hs 466693(SIRT2), Accession No. Hs 466766(LTBP4), Accession No. Hs 466775(SNRPA), Accession No. Hs 467084(EIF4G3), Accession No. Hs 467097(SNRP70), Accession No. Hs 467192(PPP2R1A), Accession No. Hs 467279(LENG4), Accession No. Hs 467284(RPS9), Accession No. Hs 467408(TRIM28), Accession No. Hs 467637(CDC42), Accession No. Hs 467696(HPCAL1), Accession No. Hs 467701(ODC1), Accession No. Hs 467807(LAPTM4A), Accession No. Hs 467824(PUM2), Accession No. Hs 467960(RAB10), Accession No. Hs 468018(PPP1CB), Accession No. Hs 468415(PIGF), Accession No. Hs 468442(CALM2), Accession No. Hs 468760(AFTIPHILIN), Accession No. Hs 469022(DGUOK), Accession No. Hs 469171(DKFZP564D0478), Accession No. Hs 469331(STARD7), Accession No. Hs 469820(RALB), Accession No. Hs 469863(YWHAZ), Accession No. Hs 469925(FLJ14346), Accession No. Hs 469970(SFRS4), Accession No. Hs 470091(YWHAE), Accession No. Hs 470233(ARL5), Accession No. Hs 470417, Accession No. Hs 470477(PTP4A2), Accession No. Hs 470577(EIF2S2), Accession No. Hs 470588(KPNA6), Accession No. Hs 470943(STAT1), Accession No. Hs 471011(SF3B1), Accession No. Hs 471104(NOP5/NOP58), Accession No. Hs 471207(NDUFS1), Accession No. s 471441(PSMB2), Accession No. Hs 471461(ACSL3), Accession No. Hs 471593(CAB39), Accession No. Hs 471768(MGC4796), Accession No. Hs 471818(M11S1), Accession No. Hs 471851(HDLBP), Accession No. Hs 471873(DTYMK), Accession No. Hs 471933(FKBP1A), Accession No. Hs 471975(C20orf116), Accession No. Hs 472010(PRNP), Accession No. Hs 472024(C20orf30), Accession No. Hs 472031(UBE2D3), Accession No. Hs 472038(CGI-94), Accession No. Hs 472056(SYNCRIP), Accession No. Hs 472119(MKKS), Accession No. Hs 472185(NDUFS5), Accession No. Hs 472213(RRBP1), Accession No. Hs 472330(C20orf3), Accession No. Hs 472475(MACF1), Accession No. Hs 472535(AKIP), Accession No. Hs 472558(SDBCAG84), Accession No. Hs 472651(BLCAP), Accession No. Hs 472737(TOP1), Accession No. Hs 473296(TPD52L2), Accession No. Hs 473583(NSEP1), Accession No. Hs 473648(GART), Accession No. Hs 473721(SLC2A1), Accession No. Hs 473761(RTN3), Accession No. Hs 473788(OTUB1), Accession No. Hs 474005(SUMO3), Accession No. Hs 474010(PTTG1IP), Accession No. Hs 474053(COL6A1), Accession No. Hs 474083(B4GALT2), Accession No. Hs 474213(UFD1L), Accession No. Hs 474584(AKR1A1), Accession No. Hs 474643(HSPC117), Accession No. Hs 474751(MYH9), Accession No. Hs 474833(CSNK1E), Accession No. Hs 474914(RUTBC3), Accession No. Hs 474938(SLC25A17), Accession No. Hs 474949(RBX1), Accession No. Hs 474982(ACO2), Accession No. Hs 475125(ATXN10), Accession No. Hs 475319(LRRFIP2), Accession No. Hs 475382(FLJ22405), Accession No. Hs 475392(LOC55831), Accession No. Hs 475663(RAB5A), Accession No. Hs 475733(TOP2B), Accession No. Hs 475812(SIMP), Accession No. Hs 476018(CTNNB1), Accession No. Hs 476033(TLP19), Accession No. Hs 476179(SMARCC1), Accession No. Hs 476221(IHPK2), Accession No. Hs 76231(IMPDH2), Accession No. Hs 476308(ALAS1), Accession No. Hs 476365(SCP2), Accession No. Hs 476448(FLNB), Accession No. Hs 476706(MRPL37), Accession No. Hs 476930(DKFZP5640123), Accession No. Hs 477157(DULLARD), Accession No. Hs 477789(ATP1B3), Accession No. Hs 477892(GYG), Accession No. Hs 478000(MBNL1), Accession No. Hs 478044(PA2G4), Accession No. Hs 478553(EIF4A2), Accession No. Hs 479208(FBXL5), Accession No. Hs 479264(LAP3), Accession No. Hs 479634(SLC30A9), Accession No. Hs 479693(SFRS11), Accession No. Hs 479728(GAPD), Accession No. Hs 479747(BCAR1), Accession No. Hs 479814(POLR2B), Accession No. Hs 480073(HNRPD), Accession No. Hs 480311(PDLIM5), Accession No. Hs 480465(SCYE1), Accession No. Hs 80653(ANXA5), Accession No. Hs 481571(UQCRH), Accession No. Hs 481720(MYO10), Accession No. Hs 481898(KAT3), Accession No. Hs 482144(RPL26), Accession No. Hs 482363(SLC30A5), Accession No. Hs 482526(TINP1), Accession No. Hs 482868(KIAA0372), Accession No. Hs 483036(PJA2), Accession No. Hs 483067(C5orf13), Accession No. Hs 483305(HINT1), Accession No. Hs 483408(PPP2CA), Accession No. Hs 483454(CNN3), Accession No. Hs 483486(JMJD1B), Accession No. Hs 484138(FBXW11), Accession No. Hs 484188(ATP6V0E), Accession No. 484242(ETEA), Accession No. Hs 484288(DDX41), Accession No. Hs 484363(RNF130), Accession No. Hs 484551(CPM), Accession No. Hs 484813(DEK), Accession No. Hs 485155(RPL35), Accession No. Hs 485195(SORT1), Accession No. Hs 485246(PSMA5), Accession No. Hs 485262(MTCH1), Accession No. Hs 485365(AHCYL1), Accession No. Hs 485616(DST), Accession No. Hs 486542(BCLAF1), Accession No. Hs 487027(VIL2), Accession No. Hs 487054(TCP1), Accession No. Hs 487635(BZW2), Accession No. Hs 487774(HNRPA2B1), Accession No. Hs 488171(KIAA1068), Accession No. Hs 488181(OGDH), Accession No. Hs 488307(DKFZP564K0822), Accession No. Hs 488478(FLJ10099), Accession No. Hs 488671(BAZ1B), Accession No. Hs 489207(ASNS), Accession No. Hs 489284(ARPC1B), Accession. No. Hs 489287(CPSF4), Accession No. Hs 489336(SYAP1), Accession No. Hs 489615(PBEF1), Accession No. Hs 490203(CALD1), Accession No. Hs 490394(SSBP1), Accession No. Hs 490415(ZYX), Accession No. Hs 490745(DNAJB6), Accession No. Hs 490795(CHR2SYT), Accession No. Hs 490874(MTX1), Accession No. Hs 491336(ELP3), Accession No. Hs 491359(LMNA), Accession No. Hs 491440(PPP2CB), Accession No. Hs 491494(CCT3), Accession No. Hs 491597(VDAC3), Accession No. Hs 491695(UBE2V2), Accession No. Hs 491745(TCEA1), Accession No. Hs 491988(TRAM1), Accession No. Hs 492236(WDR42A), Accession No. Hs 492314(LAPTM4B), Accession No. Hs 492445(EDD), Accession No. Hs 492599(EIF3S3), Accession No. Hs 492805(CGI-07), Accession No. Hs 493362(AK3L1), Accession No. Hs 493750(WDR40A), Accession No. Hs 494173(ANXA1), Accession No. Hs 494419(LAMP1), Accession No. Hs 494457(NINJ1), Accession No. Hs 494604(ANP32B), Accession No. Hs 494614(XTP2), Accession No. Hs 494691(PFN1), Accession No. Hs 494700(CDW92), Accession No. Hs 494985(FBXW2), Accession No. Hs 495039(NDUFA8), Accession No. Hs 495349(KIAA0515), Accession No. Hs 495471(PMPCA), Accession No. Hs 495605(CD99), Accession No. Hs 495851(MGC4825), Accession No. Hs 495960(ATP6AP2), Accession No. Hs 496068(PCTK1), Accession No. Hs 496098(DKFZp761A052), Accession No. Hs 496271, Accession No. Hs 496487(ATF4), Accession No. Hs 496646(IL13RA1), Accession No. Hs 496684(LAMP2), Accession No. Hs 497183(IVNS1ABP), Accession No. Hs 497599(WARS), Accession No. Hs 497692(C1orf48), Accession No. Hs 497893(ENAH), Accession No. Hs 498239(FH), Accession No. Hs 498313(ADSS), Accession No. Hs 498317(PNAS-4), Accession No. Hs 498455(KIAA0217), Accession No. Hs 498548(RBM17), Accession No. Hs 498727(DHCR24), Accession No. Hs 499145(YME1L1), Accession No. Hs 499158(GGA1), Accession No. Hs 499594(TIMM23), Accession No. Hs 499833(C10orf74), Accession No. Hs 499891(HNRPH3), Accession No. Hs 499925(VPS26), Accession No. Hs 499960(SARA1), Accession No. Hs 500067(PPP3CB), Accession No. Hs 500101(VCL), Accession No. Hs 500375(ENTPD6), Accession No. Hs 500409(GLUD1), Accession No. Hs 500546(IDE), Accession No. Hs 500674(SMBP), Accession No. Hs 500775(ZNF207), Accession No. Hs 500842(MGEA5), Accession No. Hs 500874(CUEDC2), Accession No. Hs 501012(ADD3), Accession No. Hs 501023(MXI1), Accession No. Hs 501203(TIAL1), Accession No. Hs 501293(BSG), Accession No. Hs 501309(CIRBP), Accession No. Hs 501353(PLEKHJ1), Accession No. Hs 501376(UROS), Accession No. Hs 501420(NCLN), Accession No. Hs 501629(IER2), Accession No. Hs 501684(NAP1L4), Accession No. Hs 501735(STIM1), Accession No. Hs 501853(C11orf15), Accession No. Hs 501924(USP47), Accession No. Hs 501991(MLSTD2), Accession No. Hs 502302(CAT), Accession No. Hs 502328(CD44), Accession No. Hs 502461(DGKZ), Accession No. Hs 502528(NDUFS3), Accession No. Hs 502630(C11orf3l), Accession No. Hs 502659(RHOC), Accession No. Hs 502705(PRP19), Accession No. Hs 502745(FADS2), Accession No. Hs 502769(SLC3A2), Accession No. Hs 502773(MTCBP-1), Accession No. Hs 502823(PRDX5), Accession No. Hs 502829(SF1), Accession No. Hs 502836(ARL2), Accession No. Hs 502842(CAPN1), Accession No. Hs 502872(MAP3K11), Accession No. Hs 502876(RHOB), Accession No. Hs 503093(ZFP36L2), Accession No. Hs 503222(RAB6A), Accession No. Hs 503251(PME-1), Accession No. Hs 503597(HSPC148), Accession No. Hs 503709(PORIMIN), Accession No. Hs 503716(MGC2714), Accession No. Hs 503787(DARS), Accession No. Hs 504237(ITM1), Accession No. Hs 504517(RPS27), Accession No. Hs 504613(PTMS), Accession No. Hs 504620(REA), Accession No. Hs 504687(MYL9), Accession No. Hs 504828(DDX47), Accession No. Hs 504895(STRAP), Accession No. Hs 505033(KRAS2), Accession No. Hs 505059(PSMD4), Accession No. Hs 505625(C12orf10), Accession No. Hs 505652(COPZ1), Accession No. Hs 505676(CIP29), Accession No. Hs 505705(MYL6), Accession No. Hs 505806(PBXIP1), Accession No. Hs 505824(CGI-51), Accession No. Hs 506215(RARS), Accession No. Hs 506325(NUDT4), Accession No. Hs 06759(ATP2A2), Accession No. Hs 506861(DDX54), Accession No. Hs 507074(KIAA0152), Accession No. Hs 507162(FLJ12750), Accession No. Hs 507584(MGC9850), Accession No. Hs 507680(PFAAP5), Accession No. Hs 507910(PGRMC2), Accession No. Hs 507916(TGFB1I4), Accession No. Hs 508010(FNDC3A), Accession No. Hs 508644(FLJ10154), Accession No. Hs 509163(KIAA1181), Accession No. Hs 509226(FKBP3), Accession No. Hs 509264(KLHDC2), Accession No. Hs 509414(KTN1), Accession No. Hs 509622(RGL2), Accession No. Hs 509736(HSPCB), Accession No. Hs 509791(ERH), Accession No. Hs 509909(NUMB), Accession No. Hs 510087(ENSA), Accession No. Hs 510328(DDX24), Accession No. Hs 510402(MCP), Accession No. Hs 511067(FLJ10579), Accession No. Hs 511138(DKFZP564G2022), Accession No. Hs 511149(SNAP23), Accession No. Hs 511425(SRP9), Accession No. Hs 511504(TCF12), Accession No. Hs 511862, Accession No. Hs 511952(CBX6), Accession No. Hs 512005(ARPC3), Accession No. Hs 512465(SURF4), Accession No. Hs 512525(RPS17), Accession No. Hs 512607(MIR16), Accession No. Hs 512640(PRKCSH), Accession No. Hs 512661(KIAA1160), Accession No. Hs 512676, Accession No. Hs 512693(FLJ20859), Accession No. Hs 512756(THAP7), Accession No. Hs 512815(AP3D1), Accession No. Hs 512857(CD151), Accession No. Hs 512867(H63), Accession No. Hs 512908(ARPP-19), Accession No. Hs 513043(C15orf12), Accession No. Hs 513055(REC14), Accession No. Hs 513057(RANBP5), Accession No. Hs 513058(TMED3), Accession No. Hs 513071(MESDC1), Accession No. Hs 513083(RPL9), Accession No. Hs 513141(IDH2), Accession No. Hs 513145(NEUGRIN), Accession No. Hs 513153(FURIN), Accession No. Hs 513230(MRPL28), Accession No. Hs 513242(RHOT2), Accession No. Hs 513261(C16orf34), Accession No. Hs 513266(NDUFB10), Accession No. Hs 513470(NFATC2IP), Accession No. Hs 513488(MVP), Accession No. Hs 513490(ALDOA), Accession No. Hs 513520(BCKDK), Accession No. Hs 513522(FUS), Accession No. Hs 513631(ARL2BP), Accession No. Hs 513856(DPH2L1), Accession No. Hs 513984(FLII), Accession No. Hs 514012(MAP2K3), Accession No. Hs 514036(SDF2), Accession No. Hs 514038(FLOT2), Accession No. Hs 514174(JUP), Accession No. Hs 514196(RPL27), Accession No. Hs 514211(MGC4251), Accession No. Hs 514216(CGI-69), Accession No. Hs 514220(GRN), Accession No. Hs 514297(FLJ13855), Accession No. Hs 514303(PHB), Accession No. Hs 514435(SF3B3), Accession No. Hs 514489(WBP2), Accession No. Hs 514535(LGALS3BP), Accession No. Hs 514581(ACTG1), Accession No. Hs 514590(HGS), Accession No. Hs 514819(AP2B1), Accession No. Hs 514870(ATP5F1), Accession No. Hs 514920(NDP52), Accession No. Hs 514934(CAPZA1), Accession No. Hs 515003(C19orf6), Accession No. Hs 515005(STK11), Accession No. Hs 515018(GNA13), Accession No. Hs 515053(AES), Accession No. Hs 515070(EEF2), Accession No. Hs 515092(CLPP), Accession No. Hs 515155(MGC2803), Accession No. Hs 515162(CALR), Accession No. Hs 515164(GADD45GIP1), Accession No. Hs 515210(DNAJB1), Accession No. Hs 515255(LSM4), Accession No. Hs 515266(RENT1), Accession No. Hs 515271(SFRS14), Accession No. Hs 515329(RPL22), Accession No. Hs 515371(CAPNS1), Accession No. Hs 515406(AKT2), Accession No. Hs 515417(EGLN2), Accession No. Hs 515432(DEDD2), Accession No. Hs 515472(SNRPD2), Accession No. Hs 515475(SYMPK), Accession No. Hs 515487(CALM3), Accession No. Hs 515494(SLC1A5), Accession No. Hs 515500(SAE1), Accession No. Hs 515515(KDELR1), Accession No. Hs 515517(RPL18), Accession No. Hs 515524(NUCB1), Accession No. Hs 515540(PTOV1), Accession No. Hs 515550(LOC284361), Accession No. Hs 515598(PRPF31), Accession No. Hs 515607(PPP1R12C), Accession No. Hs 515642(GPSN2), Accession No. Hs 515785(BLVRB), Accession No. Hs 515846(RUVBL2), Accession No. Hs 515848(HADHB), Accession No. Hs 515890(YPEL5), Accession No. Hs 516075(TIA1), Accession No. Hs 516077(FLJ14668), Accession No. Hs 516087(TEX261), Accession No. Hs 516111(DCTN1), Accession No. Hs 516114(WBP1), Accession No. Hs 516157(MAT2A), Accession No. Hs 516450(FLJ20297), Accession No. Hs 516522(FLJ21919), Accession No. Hs 516539(HNRPA3), Accession No. Hs 516587(UBE2Q), Accession No. Hs 516633(NCKAP1), Accession No. Hs 516711(CHPF), Accession No. Hs 516790(ARHGEF2), Accession No. Hs 516807(STK25), Accession No. Hs 516826(TRIB3), Accession No. Hs 516855(CENPB), Accession No. Hs 517080(SLC35C2), Accession No. Hs 517106(CEBPB), Accession No. Hs 517134(C20orf43), Accession No. Hs 517145(ENO1), Accession No. Hs 517168(TAGLN2), Accession No. Hs 517216(PEA15), Accession No. Hs 517232(PEX19), Accession No. Hs 517240(IFNGR2), Accession No. Hs 517262(SON), Accession No. Hs 517293(F11R), Accession No. Hs 517338(ATP6V1E1), Accession No. Hs 17342(DEDD), Accession No. Hs 517356(COL18A1), Accession No. Hs 517357(DGCR2), Accession No. Hs 517421(PCQAP), Accession No. Hs 517438(ASCC2), Accession No. Hs 517517(EP300), Accession No. Hs 517543(PES1), Accession No. Hs 517582(MCM5), Accession No. Hs 517622(UNC84B), Accession No. Hs 517641(L3MBTL2), Accession No. Hs 517666(DIA1), Accession No. Hs 517731(PP2447), Accession No. Hs 517768(DKFZP564B167), Accession No. Hs 517792(C3orf10), Accession No. Hs 517817(MGC3222), Accession No. Hs 517821, Accession No. Hs 517888(CRTAP), Accession No. Hs 517948(DHX30), Accession No. Hs 517949(MAP4), Accession No. Hs 517969(APEH), Accession No. Hs 517981(TUSC2), Accession No. Hs 518060(ARL6IP5), Accession No. Hs 518123(TFG), Accession No. Hs 518236(SEC61A1), Accession No. Hs 518244(RPN1), Accession No. Hs 518249(ZNF9), Accession No. Hs 518250(COPG), Accession No. Hs 518265(H41), Accession No. Hs 518326(SERP1), Accession No. Hs 518346(SSR3), Accession No. Hs 518374(QSCN6), Accession No. Hs 518424(NDUFB5), Accession No. Hs 518460(AP2M1), Accession No. Hs 518464(PSMD2), Accession No. Hs 518525(GLUL), Accession No. Hs 518551(RPL31), Accession No. Hs 518608(PP784), Accession No. Hs 518609(ARPC5), Accession No. Hs 518750(OCIAD1), Accession No. Hs 18805(HMGA1), Accession No. Hs 518827(CCNI), Accession No. Hs 519276(MAPKAPK2), Accession No. Hs 519304(PELO), Accession No. Hs 519346(ERBB2IP), Accession No. Hs 519347(SFRS12), Accession No. Hs 519520(RPS25), Accession No. Hs 519523(SERPINB6), Accession No. Hs 519557(TMEM14C), Accession No. Hs 519718(TTC1), Accession No. Hs 519756(STK10), Accession No. Hs 519818(MGAT1), Accession No. Hs 519909(MARCKS), Accession No. Hs 519930(C6orf62), Accession No. Hs 520026(VARS2), Accession No. Hs 520028(HSPA1A), Accession No. Hs 520037(NEU1), Accession No. Hs 520070(C6orf82), Accession No. Hs 520140(SRF), Accession No. Hs 520189(ELOVL5), Accession No. Hs 520205(EIF2AK1), Accession No. Hs 520210(KDELR2), Accession No. Hs 520287(C6orf111), Accession No. Hs 520313(CD164), Accession No. Hs 520383(STX7), Accession No. Hs 520421(PERP), Accession No. Hs 520459(GTF2I), Accession No. Hs 520623(C7orf27), Accession No. Hs 520640(ACTB), Accession No. Hs 520740(SCRN1), Accession No. Hs 520794(YKT6), Accession No. Hs 520898(CTSB), Accession No. Hs 520943(WBSCR1), Accession No. Hs 520967(MDH2), Accession No. Hs 520973(HSPB1), Accession No. Hs 520974(YWHAG), Accession No. Hs 521064(ZNF655), Accession No. Hs 521151(FLJ22301), Accession No. Hs 521289(REPIN1), Accession No. Hs 521487(MGC8721), Accession No. Hs 521640(RAD23B), Accession No. Hs 521809(COBRA1), Accession No. Hs 521903(LY6E), Accession No. Hs 521924(SIAHBP1), Accession No. Hs 521969(NDUFB11), Accession No. Hs 521973(WDR13), Accession No. Hs 522074(DSIPI), Accession No. Hs 522110(CREB3), Accession No. Hs 522114(CLTA), Accession No. Hs 522310(NANS), Accession No. Hs 522373(GSN), Accession No. Hs 522394(HSPA5), Accession No. Hs 522463(EEF1A1), Accession No. Hs 522507(FBXW5), Accession No. Hs 522584(TMSB4X), Accession No. Hs 522590(EIF1AX), Accession No. Hs 522632(TIMP1), Accession No. Hs 522665(MAGED2), Accession No. Hs 522675(FLJ12525), Accession No. Hs 522752(PSMD10), Accession No. Hs 522817(BCAP31), Accession No. Hs 522819(IRAK1), Accession No. Hs 522823(EMD), Accession No. Hs 522932(NCOA4), Accession No. Hs 522995(EIF4EBP2), Accession No. Hs 523004(PSAP), Accession No. Hs 523012(DDIT4), Accession No. Hs 523054(SMP1), Accession No. Hs 523131(TRAPPC3), Accession No. Hs 523145(DDOST), Accession No. Hs 523215(NDUFB8), Accession No. Hs 523238(NOLC1), Accession No. Hs 523262(C1orf8), Accession No. Hs 523299(EIF3S10), Accession No. Hs 523302(PRDX3), Accession No. Hs 523560(HSPCA), Accession No. Hs 523680(SSRP1), Accession No. Hs 523789(TncRNA), Accession No. Hs 523829(POLD4), Accession No. Hs 523836(GSTP1), Accession No. Hs 523852(CCND1), Accession No. Hs 523875(INPPL1), Accession No. Hs 524009(AASDHPPT), Accession No. Hs 524081(DPAGT1), Accession No. Hs 524084(RNF26), Accession No. Hs 524161(RSU1), Accession No. Hs 524171(RAD52), Accession No. Hs 524183(FKBP4), Accession No. Hs 524195(ARHGAP21), Accession No. Hs 524214(MLF2), Accession No. Hs 524219(TPI1), Accession No. Hs 524271(PHC2), Accession No. Hs 524367(CBARA1), Accession No. Hs 524395(TUBA3), Accession No. Hs 524464(ATP5G2), Accession No. Hs 524502(RNF41), Accession No. Hs 524530(CTDSP2), Accession No. Hs 524590(RAB21), Accession No. Hs 524599(NAP1L1), Accession No. Hs 524690(PPIE), Accession No. Hs 524788(RAB35), Accession No. Hs 524809(RSN), Accession No. Hs 524899(SAP18), Accession No. Hs 524920(ZFP91), Accession No. Hs 524969(Ufm1), Accession No. Hs 525134(FLJ20277), Accession No. Hs 525163(ANKRD10), Accession No. Hs 525232(LRP10), Accession No. Hs 525238(C14orf119), Accession No. Hs 525330(ARF6), Accession No. Hs 525391(FLJ20580), Accession No. Hs 525527(RER1), Accession No. Hs 525626(PACS1L), Accession No. Hs 525899(C6orf49), Accession No. Hs 526464(PML), Accession No. Hs 526521(MDH1), Accession No. Hs 527105(HNRPDL), Accession No. Hs 527193(RPS23), Accession No. Hs 527348(AKAP9), Accession No. Hs 527412(ASAH1), Accession No. Hs 527861(OS-9), Accession No. Hs 527862(PKD1), Accession No. Hs 527980(DUT), Accession No. Hs 528050(HARS), Accession No. Hs 528222(NDUFS4), Accession No. Hs 528300(PITRM1), Accession No. Hs 528305(DDX17), Accession No. Hs 528572(SCAM-1), Accession No. Hs 528668(RPL6), Accession No. Hs 528780(GSPT1), Accession No. Hs 528803(UQCRC2), Accession No. Hs 529059(EIF3S4), Accession No. Hs 529132(SEPW1), Accession No. Hs 529244(NCK2), Accession No. Hs 529280(ANAPC7), Accession No. Hs 529303(ARPC2), Accession No. Hs 529369(AFAP), Accession No. Hs 529400(IFNAR1), Accession No. Hs 529420(UBE2G2), Accession No. Hs 529591(TLOC1), Accession No. Hs 529618(TFRC), Accession No. Hs 529631(RPL35A), Accession No. Hs 529782(VCP), Accession No. Hs 529798(BTF3), Accession No. Hs 529862(CSNK1A1), Accession No. Hs 529890(CANX), Accession No. Hs 529892(SQSTM1), Accession No. Hs 529957(SEC63), Accession No. Hs 530096(EIF3S2), Accession No. Hs 530118(LUC7L2), Accession No. Hs 530291(ANXA11), Accession No. Hs 530314(SSNA1), Accession No. Hs 530331(PDHA1), Accession No. Hs 530381(PIM3), Accession. No. Hs 530412(PAI-RBP1), Accession No. Hs 530436(STXBP3), Accession No. Hs 530479(PMF1), Accession No. Hs 530687(RNH), Accession No. Hs 530734(MRPL16), Accession No. Hs 530753(FLJ20625), Accession No. Hs 530823(COPS7A), Accession No. Hs 530862(PRKAG1), Accession No. Hs 531081(LGALS3), Accession No. Hs 531089(PSMA3), Accession No. Hs 531176(SARS), Accession No. Hs 531330(CBWD1), Accession No. Hs 531614(BTBD14B), Accession No. Hs 531752(RANBP3), Accession No. Hs 531856(GAS5), Accession No. Hs 531876(DNCL2A), Accession No. Hs 531879(RAD1), Accession No. Hs 532359(RPL5), Accession No. Hs 532399(KIAA0663), Accession No. Hs 532755(GTL3), Accession No. Hs 532790(NMT1), Accession No. Hs 532793(KPNB1), Accession No. Hs 532803(HN1), Accession No. Hs 532826(MCL1), Accession No. Hs 532853(NDUFB7), Accession. No. Hs 533030(HRIHFB2122), Accession No. Hs 533059(TrJBB), Accession No. Hs 533122(SFRS10), Accession No. Hs 533136(LRPAP1), Accession No. Hs 533192(TOMM20), Accession No. Hs 533222(HSA9761), Accession No. Hs 533245(DDX46), Accession No. Hs 533282(NONO), Accession No. Hs 533308(PPP2R5D), Accession No. Hs 533317(VIM), Accession No. Hs 533437(TCEB1), Accession No. Hs 533440(WWP1), Accession No. Hs 533474(PPP1R8), Accession No. Hs 533479(LYPLA2), Accession No. Hs 533526(ATRX), Accession No. Hs 533624(H3F3A), Accession No. Hs 533712(RBM4), Accession No. Hs 533732(SRP14), Accession No. Hs 533771(STUB1), Accession No. Hs 533782(KRT8), Accession No. Hs 533977(TXNIP), Accession No. Hs 533985(EXOC7), Accession No. Hs 533986(ZNF258), Accession No. Hs 534125(HLA-C), Accession No. Hs 534168(NDUFA1), Accession No. Hs 534212(SEC22L1), Accession No. Hs 534255(B2M), Accession No. Hs 534307(CCND3), Accession No. Hs 534314(EIF5A), Accession No. Hs 534326(ITGB4BP), Accession No. Hs 534338(PPP4C), Accession No. Hs 534346(RPS7), Accession No. Hs 534350(SMARCB1), Accession No. Hs 534453(GRIM19), Accession No. Hs 534456(ANAPC11), Accession No. Hs 534457(C14orf166), Accession No. Hs 534473(TOMM22), Accession No. Hs 534483(MGC2941), Accession No. Hs 536275(PACS1), Accession No. Hs 541269(NDUFB9), Accession No. Hs 546248(CTSD), Accession No. Hs 546250(DNCl2), Accession No. Hs 546253(FDFT1), Accession No. Hs 546261(HNRPA1), Accession No. Hs 546269(RPL10A), Accession No. Hs 546271(PCBP2), Accession No. Hs 546286(RPS3), Accession No. Hs 546289(RPS12), Accession No. Hs 546290(RPS18), Accession No. Hs 546291(NET-5), Accession No. Hs 546339(SMAP), Accession No. Hs 546356(RPL13A), Accession No. Hs 546394(HSPC016), Accession No. Hs 547759(SSBP3), Accession No. Hs 549178(C9orf86), Accession No. Hs 552590(HTF9C), Accession No. Hs 553496(PGM3), Accession No. Hs 553512(C3F), Accession No. Hs 554767(NUP88), Accession No. Hs 554776(SREBF1), Accession No. Hs 554894(FLJ12953), Accession No. Hs 554896(MGC11257), Accession No. Hs 555194(FAM36A), Accession No. Hs 555866(C1QBP), Accession No. Hs 555873(HNRPAB), Accession No. Hs 555875(IDH3A), Accession No. Hs 555889(PSMC2), Accession No. Hs 555890(RBBP4), Accession No. Hs 555911(RBM8A), Accession No. Hs 555969(RIC8), Accession No. Hs 555971(PP1201), Accession No. Hs 555973(MRPS25), Accession No. Hs 555994(LONP), Accession No. Hs 556267(FBXL10), Accession No. Hs 556461(NDUFV2), Accession No. Hs 556795(PAICS), Accession No. Hs 557550(NPM1), Accession No. Hs 558296(ACP1), Accession No. Hs 558313(COX6A1), Accession No. Hs 558322(EEF1B2), Accession No. Hs 558325(EIF5), Accession No. Hs 558328(FKBP5), Accession No. Hs 558330(FTL), Accession No. Hs 558338(HSPE1), Accession No. Hs 558345(IK), Accession No. Hs 558354(LAMR1), Accession No. Hs 558360(NDUFB4), Accession No. Hs 558361(NME2), Accession No. Hs 558362(NUMA1), Accession No. Hs 558376(RAC1), Accession No. Hs 558381(RNU65), Accession No. Hs 558382(RPL15), Accession No. Hs 558383(RPL18A), Accession No. Hs 558384(RPL19), Accession No. Hs 558385(RPL23A), Accession No. Hs 558386(RPL34), Accession No. Hs 558388(RPS3A), Accession No. Hs 558389(RPS8), Accession No. Hs 558390(RPS24), Accession No. Hs 558391(RPS26), Accession No. Hs 558396(SCD), Accession No. Hs 558424(CSDA), Accession No. Hs 558426(EIF3S5), Accession No. Hs 558429(G10), Accession No. Hs 558431(RPL14), Accession No. Hs 558442(PDCD6IP), Accession No. Hs 558448(TXNL2), Accession No. Hs 558453(ATP5L), Accession No. Hs 558454(NUDC), Accession No. Hs 558458(COPS8), Accession No. Hs 558473(C18orf10), Accession No. Hs 558499(8D6A), Accession No. Hs 558511(PSARL), Accession No. Hs 558521(C2orf33), Accession No. Hs 558591(ORMDL1), Accession No. Hs 558825(PDE4DIP), Accession No. Hs 558995, Accession No. Hs 567260(CD2BP2), Accession No. Hs 567263(C1orf43), Accession No. Hs 567267(ATP2C1) and Accession No. Hs 567279(HCNGP).

7. The composition according to claim 5, wherein the detection reagent comprises a pair of primers and/or probes applicable to the amplification of the candidate endogenous reference gene.

8. The composition according to claim 7, wherein the pair of primers consists of a sense primer 10˜50 by in length, corresponding to a sense sequence of the gene, and an antisense primer 10˜50 by in length, corresponding to an antisense sequence of the gene.

9. The composition according to claim 8, wherein the sense primer ranges in length from 12 to 30 bp.

10. The composition according to claim 8, wherein the antisense primer ranges in length from 12 to 30 bp.

11. The composition according to claim 5, wherein the detection of the gene is conducted using a microarray technique, a SAGE (Serial Analysis of Gene Expression) technique or a qRT-PCR (quantitative real time PCR) technique.

12. A method for selecting guide genes, comprising:

measuring the candidate endogenous reference genes selected using the method of claim 1 for coefficient of variation (CV); and

ranking the candidate endogenous reference genes in an ascending order of CV.

13. The method according to claim 12, wherein the guide genes are expressed in most human tissues.

14. The method according to claim 12, wherein the guide genes can be used to normalize expression levels for relative quantification of gene expression between different samples.

15. The method according to claim 12, wherein the coefficient of variation (CV) becomes larger as the gene expression increasingly varies from one tissue to another.

16. A composition for detecting at least one of the guide genes identified using the method of claim 12, comprising a detection reagent applicable to amplification of the guide gene.

17. The composition according to claim 16, wherein the guide gene useful in the present invention is one or more genes selected from a group consisting of Accession No. Hs 500775(ZNF207), Accession No. Hs 446427(OAZ1), Accession No. Hs 530118(LUC7L2), Accession No. Hs 208597(CTBP1), Accession No. Hs 440382(TRIM27), Accession No. Hs 444279(GPBP1), Accession No. Hs 250009(ARL8B), Accession No. Hs 9589(UBQLN1), Accession No. Hs 253726(PAPOLA), Accession No. Hs 146806(CUL1), Accession No. Hs 533222(DIMT1L), Accession No. Hs 494985(FBXW2) and Accession No. Hs 242458(SPG21).

18. The composition according to claim 16, wherein the detection reagent comprises a pair of primers and/or probes applicable to the amplification of the guide reference gene.

19. The composition according to claim 16, wherein the guide genes show low expression levels, similar to most low-abundance intracellular transcripts.

20. The composition according to claim 18, wherein the pair of primers consists of a sense primer 10˜50 by in length corresponding to a sense sequence of the gene and an antisense primer 10˜50 by in length corresponding to an antisense sequence of the gene.

21. The composition according to claim 20, wherein the sense primer ranges in length from 12 to 30 bp.

22. The composition according to claim 20, wherein the antisense primer ranges in length from 12 to 30 bp.

23. The composition according to claim 20, wherein the detecting the gene is conducted using a microarray technique, a SAGE (Serial Analysis of Gene Expression) technique or a qRT-PCR (quantitative real time PCR) technique.

24. A method for quantifying an expression level of a target gene, comprising:

1) synthesizing cDNA from RNA of a subject;

2) performing real-time PCR to amplify the target gene using a pair of primers and/or probes with the cDNA serving as a template and then performing real-time PCR to amplify the endogenous reference gene using the composition of claims 5; and

3) normalizing an expression level of the target gene to that of the endogenous reference gene of step 2).

25. A method for quantifying an expression level of a target gene, comprising:

1) synthesizing cDNA from RNA of a subject;

2) performing real-time PCR to amplify the target gene using a pair of primers and/or probes with the cDNA serving as a template and then performing real-time PCR to amplify the endogenous reference gene using the composition of claims 16; and

3) normalizing an expression level of the target gene to that of the endogenous reference gene of step 2).

26. A method for identifying the amplification of a target gene in genomic DNA, comprising:

1) amplifying the target gene with a pair of primers or probes through real-time PCR, with a genomic DNA of a sample serving as a template and then performing real-time PCR to amplify the candidate endogenous reference gene with the composition of claims 5; and

2) normalizing an expression level of the target gene to that of the candidate endogenous reference gene.

27. A method for identifying the amplification of a target gene in genomic DNA, comprising:

1) amplifying the target gene with a pair of primers or probes through real-time PCR, with a genomic DNA of a sample serving as a template and then performing real-time PCR to amplify the candidate endogenous reference gene with the composition of claims 16; and

2) normalizing an expression level of the target gene to that of the candidate endogenous reference gene.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: