US20100184134A1
2010-07-22
12/685,544
2010-01-11
This invention provides for a novel means of incorporating non-native amino acids into preselected positions of a protein using a cell-free synthesis system. The methods involve the use of non-orthogonal, native isoaccepting sense tRNAs that are encoded by the genetic code. Such methods allow for numerous non-native amino acids to be incorporated through the use of sense codons without having to rely upon orthogonal tRNA-synthetase pairs.
Get notified when new applications in this technology area are published.
C07K1/02 » CPC main
General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length in solution
C12P21/02 » CPC further
Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
C12P21/06 IPC
Preparation of peptides or proteins produced by the hydrolysis of a peptide bond, e.g. hydrolysate products
This application claims the benefit under 35 U.S.C. §1.119(e) of U.S. Application Nos. 61/144,083, 61/144,097 and 61/144,030, all filed Jan. 12, 2009, each of which is incorporated by reference in its entirety for all purposes.
NOT APPLICABLE
NOT APPLICABLE
Protein synthesis is a fundamental biological process that underlies the development of polypeptide therapeutics, vaccines, diagnostics, and industrial enzymes. With the advent of recombinant DNA (rDNA) technology, it has become possible to harness the catalytic machinery of the cell to produce a desired protein. This can be achieved within the cellular environment or in vitro using lysates derived from cells.
Because only twenty amino acids are naturally incorporated into proteins, limitations to the production of a desired protein exist. For example, a peptide that is potentially useful as a therapeutic agent may be quickly degraded or otherwise inactivated upon administration to a patient as a result of proteases present within the patient. Likewise, infectious agents such as bacteria or viruses are more likely to develop resistance against peptides that contain only naturally occurring amino acids. This occurs because enzymes that are produced by the bacteria or virus that can inactivate a peptide drug are more likely to inactivate a peptide containing naturally occurring amino acids as opposed to a peptide containing non-native amino acids. Such limitations become even more apparent when compared with small organic molecule synthesis, in which any structural change can be made to influence functional properties of the compound. As a result, proteins containing non-native amino acids are becoming more auspicious for therapeutic uses. Furthermore, peptides containing non-native amino acids are extremely useful for non-therapeutic research purposes, such as uses relevant to the structural and functional probing of proteins, construction of peptide libraries for combinatorial chemistry, and proteomic studies.
Although the twenty naturally occurring amino acids can be modified by post-translational modification, expanding the genetic code to include additional non-native amino acids with novel biological, chemical, or physical properties will increase the utility of the protein containing such novel non-native amino acids. Protein properties may include the size, acidity, nucleophilicity, hydrogen-bonding, or hydrophobicity of the protein.
Different strategies have been utilized to synthesize peptides containing non-native amino acids. Synthetic peptide chemistry has been used routinely for this purpose. See, e.g., Eckert et al., Cell 99:103-15 (1999). However, routine solid-phase peptide synthesis is generally limited to small peptides with less than 100 residues. With the recent development of enzymatic ligation and native chemical ligation of peptide fragments, it is possible to make larger proteins. However, these methods are not easily scaled. See, e.g., Dawson and Kent, Annu Rev. Biochem. 69:923 (2000).
In vivo translation using living cells is widely used for the efficient synthesis and post-translational modification of proteins from a genetically encoded natural or recombinant DNA sequence. However, folding may be inefficient if the protein is expressed in inclusion bodies. Most importantly, such methods are more difficult for the selective incorporation of multiple non-native amino acids, or to control the post-translational modification process.
In vitro, or cell-free, protein synthesis offers several advantages over conventional in vivo protein expression methods. Cell-free systems can direct most, if not all, of the metabolic resources of the cell towards the exclusive production of one protein. Moreover, the lack of a cell wall and membrane components in vitro is advantageous since it allows for control of the synthesis environment. For example, tRNA levels can be changed to reflect the codon usage of genes being expressed. The redox potential, pH, or ionic strength can also be altered with greater flexibility than with in vivo protein synthesis because concerns of cell growth or viability do not exist. Furthermore, direct recovery of purified, properly folded protein products can be easily achieved.
The productivity of cell-free systems has improved over 2-orders of magnitude in recent years, from about 5 μg/ml-hr to about 500 μg/ml-hr. Such improvements have made in vitro protein synthesis a practical technique for laboratory-scale research and provides a platform technology for high-throughput protein expression. It further indicates the feasibility for using cell-free technologies as an alternative means to in vivo large-scale, commercial production of protein pharmaceuticals.
The incorporation of non-native amino acids into proteins remains a challenge with both in vivo and in vitro protein synthesis systems. A major hurdle in this field of endeavor is promoting recognition of an aminoacyl-tRNA synthetase with a non-native amino acid. An aminoacyl-tRNA synthetase is an enzyme that catalyzes the bond of a specific amino acid to its cognate tRNA molecule. In most cases, each naturally occurring amino acid has one specific aminoacyl-tRNA synthetase that will aminoacylate that amino acid to its proper tRNA molecule, which is known as tRNA charging. There exists relatively few aminoacyl-tRNA synthetases considering the fact that the degeneracy of the genetic code allows amino acids to be charged to more than one kind of tRNA molecule. Thus, the success of incorporating non-native amino acids into proteins depends on the recognition of the non-native amino acid by aminoacyl-tRNA synthetases, which in general requires high selectively to insure the fidelity of protein translation. The fidelity of aminoacylation is maintained both at the level of substrate discrimination and proofreading of both non-cognate intermediates and protein products.
One strategy has been to incorporate non-native amino acids into proteins using aminoacyl-tRNA synthetases that cannot discriminate between non-native amino acids that are structurally similar to their natural counterparts due to lack of proofreading mechanisms. Because the proofreading activity of the aminoacyl-tRNA synthetase has been disabled, structural analogs of natural amino acids that have been misactivated may escape the editing functions of the synthetase, and be incorporated into the growing peptide chain as desired. See, e.g., Doring et al., Science 292:501 (2001).
A major limitation of the abovementioned strategy is that all sites corresponding to a particular natural amino acid throughout the protein are replaced. The extent of incorporation of the natural and non-native amino acid may also vary because it is difficult to completely deplete the cognate natural amino acid inside the cell. Another limitation is that these strategies make it difficult to study the mutant protein in living cells because the multi-site incorporation of analogs often results in toxicity. Finally, this method is applicable in general only to close structural analogs of the common amino acids, again because substitutions must be tolerated at all sites in the genome.
More recently, orthogonal tRNAs and corresponding orthogonal aminoacyl-tRNA synthetases that charge the orthogonal tRNA with the desired non-native amino acid has been used as a strategy to overcome previous limitations. An orthogonal tRNA is a tRNA that base pairs with a codon that is not normally associated with an amino acid such as a stop codon or 4 base pair codon, etc. Importantly, orthogonal components do not cross-react with any of the endogenous tRNAs, aminoacyl-tRNA synthetases, amino acids, or codons in the host organism.
A commonly used orthogonal system for the incorporation of non-native amino acids is the amber suppressor orthogonal tRNA. Using this system, a suppressor tRNA is prepared that recognizes the stop codon UAG and is chemically aminoacylated with a non-native amino acid. Conventional site-directed mutagenesis is used to introduce the stop codon TAG at the site of interest in the protein gene. When the aminoacylated suppressor tRNA and the mutant gene are combined in an in vitro transcription/translation system, the non-native amino acid is incorporated in response to the UAG codon which gives a protein containing the non-native amino acid at the specified position. See, e.g., Sayers et al., Nucleic Acids Res. 16:791-802 (1988). Evidence has shown that the desired non-native amino acid is incorporated at the position specified by the UAG codon and that the non-native amino acid is not incorporated at any other site in the protein. See, e.g., Noren et al., Science 244:182-88 (1989); Ellman et al., Science 255: 197-200 (1992). For additional discussion of orthogonal translation systems that incorporate non-native amino acids, and methods for their production and use, see also Wang and Schultz, Chem. Commun. 1:1-11 (2002); Xie and Schultz, Methods 36:227-38 (2005); Xie and Schultz, Curr. Opinion in Chemical Biology 9:548-554 (2005); Wang et al., Annu Rev. Biophys. Biomol. Struct. 35:225-49 (2006); and Xie and Schultz, Nat. Rev. Mol. Cell Biol. 7:775-82 (2006).
However, the incorporation of non-native amino acids using orthogonal components suffers from much lower yields because it relies on inherently inefficient suppressor tRNAs competing with termination factors. In addition, the use of orthogonal components for incorporation of non-native amino acids has been restricted to selective incorporation of only a single non-native amino acid per protein at only one of the three nonsense termination codons (the UAG amber stop codon) because of competition at amino acid sense codons from natural amino acids catalyzed by the tRNA charging and proofreading activities of the twenty different aminoacyl-tRNA synthetases, and because attempts to use a second termination codon (UGA) often fails due to read through by the ribosome. See, e.g., Cload et al., Chem. and Biol. 3:1033-38 (1996).
While some attempts have been made to incorporate non-native amino acids into proteins using tRNAs that recognize sense codons, such attempts have been made using a pure reconstituted in vitro translation system. See Tan et al., Methods 36:279-90 (2005); Forster et al., U.S. Pat. No. 6,977,150. However, such pure reconstituted translation systems require purified translational components, which is impractical outside of the context of research, very expensive, and not shown to be highly efficient.
There exists a need in the art for incorporating non-native amino acids into a growing polypeptide chain, where orthogonal tRNA/aminoacyl-tRNA synthetase pairs can be avoided, where native isoaccepting tRNAs aminoacylated with non-native amino acids recognize sense codons and subsequently incorporate the non-native amino acid into a growing polypeptide chain at a position defined by the sense codon, where numerous non-native amino acids can be incorporated at defined positions, and where a crude cell-free protein synthesis system can be used that avoids the impracticality, expense, and inefficiency of a pure reconstituted in vitro translation system. The invention described herein fulfills these and other needs, as will be apparent upon review of the following disclosure.
This invention discloses a method for introducing non-native amino acids into pre-selected positions of a protein using a cell-free synthesis system comprising the steps of 1) obtaining a nucleic acid template comprising degenerate sense codons, 2) lysing a cell population to yield a cell lysate, 3) aminoacylating a first and second isoaccepting sense tRNA in separate tRNA charging reactions, said first isoaccepting sense tRNA charged with an amino acid and said second isoaccepting sense tRNA charged with a non-native amino acid, 4) adding the first and second isoaccepting sense tRNAs charged with their respective amino acids and the nucleic acid template to the cell lysate and permitting the reaction to generate a protein bearing non-native amino acids in positions corresponding to the second sense codons of the template.
More specifically, this invention is an in vitro method of introducing non-native amino acids into pre-selected positions of a protein using a cell-free synthesis system, the method comprising the steps of:
a) Obtaining a nucleic acid template comprising degenerate sense codons where a first sense codon and a second sense codon correspond to a same native amino acid but differ in their respective nucleotide sequence;
b) Generating a cell lysate;
c) Preventing an endogenous native amino acid from incorporating into a growing polypeptide chain at positions corresponding to the first and second sense codons;
d) Adding a first catalytic aminoacylating agent to a first reaction vessel containing a charging reaction mixture including an amino acid and a first isoaccepting sense tRNA said first isoaccepting sense tRNA recognizing the first sense codon;
e) Aminoacylating the first isoaccepting sense tRNA with the amino acid to yield a tRNA:amino acid charged moiety;
f) Adding a second catalytic aminoacylating agent to a second reaction vessel containing a charging reaction mixture including a non-native amino acid and a second isoaccepting sense tRNA said second isoaccepting sense tRNA recognizing the second sense codon;
g) Aminoacylating the second isoaccepting sense tRNA with the non-native amino acid to yield a tRNA:non-native amino acid charged moiety;
h) Combining the cell lysate with:
i) Permitting the reaction to generate the polypeptide bearing non-native amino acids in those positions corresponding to the second sense codons of the template.
An endogenous native amino acid can be prevented from being incorporated into the desired polypeptide chain at positions corresponding to the first and second sense codons by depleting the native aminoacyl-tRNA synthetase that aminoacylates the endogenous native amino acid.
The endogenous native amino acid can also be prevented from incorporating into a growing polypeptide chain at positions corresponding to the first and second sense codons by inactivating both a native first isoaccepting sense tRNA that recognizes the first sense codon and a native second isoaccepting sense tRNA that recognizes the second sense codon. This may be accomplished by adding an inactivated aminoacyl-tRNA synthetase that selectively binds to the native first and second isoaccepting sense tRNAs, said inactivated synthetase having the ability to outcompete the native aminoacyl-tRNA synthetase. This may also be accomplished by adding anti-sense DNA that selectively binds to the native first and second isoaccepting sense tRNAs. In some embodiments, the first and second isoaccepting sense tRNAs are inactivated by adding a specific tRNA ribonuclease or active fragments thereof that selectively cleave the native first and second isoaccepting sense tRNAs. In some embodiments, the first and second isoaccepting sense tRNAs are inactivated by adding colicin D or an active fragment of colicin D.
The above-described method can be performed wherein one or both of the catalytic aminoacylating agents are aminoacyl-tRNA synthetases. When the catalytic aminoacylating agents are aminoacyl-tRNA synthetases, said aminoacyl-tRNA synthetases are removed from the reaction vessel of the tRNA charging reaction prior to combining the tRNA:amino acid charged moiety and tRNA:non-native amino acid charged moiety with the cell lysate. The catalytic aminoacylating agents can also be ribosomes. The above-described method may use a cell population comprises bacterial cells, preferably E. coli cells. The cell population may be depleted for arginine decarboxylase. The cell population comprise rabbit reticulocytes. The above-described method may also utilize a cell lysate that exhibits active oxidation phosphorylation during protein synthesis.
In a related method of this invention, the cell lysate is depleted of the native aminoacyl-tRNA synthetase by genetically altering the cells prior to lysing where the alteration replaces the gene encoding the native aminoacyl-tRNA synthetase with a gene encoding an aminoacyl-tRNA synthetase fused to a capture moiety. The native aminoacyl-tRNA synthetase tagged with a capture moiety may be heterologous to the host cell population. The above-described method may comprise the step of capturing the native aminoacyl-tRNA synthetase fused to a capture moiety by affinity chromatography. The affinity chromatography method may be immunoaffinity chromatography. The capturing of the native aminoacyl-tRNA synthetase fused to a capture moiety may occur by immunoprecipitation using an antibody that recognizes the capture moiety.
In a related system, this invention is a cell-free synthesis reaction system for introducing non-native amino acids into preselected positions of a protein comprising:
where all three vessels have openings that permit the combining of the two charging mixtures and cell lysate into a single reaction mixture. The above mentioned system may be used with cells derived from a bacterial population, preferably a bacterial population of E. coli cells. The system is optionally practiced using E. coli cells depleted of arginine decarboxylase. The system is further optionally practiced wherein the cell lysate has a functional oxidative phosphorylation system. The system described herein can be used where one or both of the catalytic aminoacylating reagents are either aminoacyl-tRNA synthetase or ribozymes.
The invention further provides a kit for the in vitro synthesis of proteins having non-native amino acids introduced into preselected positions of the protein, the kit comprising:
The above mentioned kit may be used with cells derived from a bacterial population, preferably a bacterial population of E. coli cells. The kit is optionally practiced using E. coli cells depleted of arginine decarboxylase. The kit is further optionally practiced wherein the cell lysate has a functional oxidative phosphorylation system. The kit described herein can be used where one or both of the catalystic aminoacylating reagents are either aminoacyl-tRNA synthetase or ribozymes.
FIG. 1 shows (a) the tRNAGAAPhe HDV ribozyme plasmid DNA template used for in vitro transcription, (b) a fragment of the DNA template detailing the orientation of the T7 promotor, tRNAGAAPhe coding sequence fused to the hepatitis delta virus (HDV) ribozyme sequence, and (c) the resulting E. coli isoaccepting tRNAGAAPhe transcript secondary structure with the anticodon sequence GAA in red, where the subscript denotes the corresponding anticodon sequence.
FIG. 2 shows the process flow diagram illustrating the steps required to generate novel nnAA-tRNAs including (a) in vitro transcription of tRNA-HDV ribozyme DNA template (b) isolation of tRNA 2,3′-cyclic phosphate by size exclusion chromatography, (c) enzymatic hydrolysis of tRNA 2,3′-cyclic phosphate using T4 polynucleotide kinase (PNK) and, (d) aminoacylation of engineered isoaccepting tRNAs with nnAAs catalyzed by engineered amino acid tRNA synthetase (aaRS) enzymes.
FIG. 3 shows TBE/UREA gels for protocols 1-4 used for optimization of in vitro transcription of two different engineered E. coli tRNACUCGlu constructs. Both constructs are mutated at U34C to produce a CUC anticodon; the rightmost construct contains additional noted mutations that should theoretically increase transcription yield.
FIG. 4 shows TBE/UREA gels of in vitro transcription protocols 1-4 for two different engineered tRNAUUGGln constructs from E. coli and H. pylori, respectively.
FIG. 5 shows (a) an illustration of the Hepatitis Delta Virus (HDV) consensus sequence used for generating 3′ homogeneous tRNA. The autocatalytic ribozyme cleaves at the 3′ end of the tRNA leaving a 2′,3′-cyclic phosphate that is subsequently removed before aminoacylation. (b) Size exclusion chromatographic separation of the transcription product illustrating separation of the 73 nucleotide tRNA 2′,3′-cyclic phosphate product from the self-cleaved HDV ribozyme.
FIG. 6 shows the effect of various additives on RNA stability.
FIG. 7 shows the time dependence of the dephosphorylation of tRNA 2′-3′-cyclic phosphate by PNK treatment as measured by (a) separation of reactant and product using acid/urea gel electrophoresis or (b) using a malachite green phosphate release assay.
FIG. 8 shows IMAC purification profiles of (a) E coli GluRS 6XHis and (b) H pylori GluRS2 (ND) enzymes used for charging tRNA with non-native amino acids (nnAA).
FIG. 9 shows (a) the dimeric structure of the homologous T. thermophilus PheRS illustrating the amino acid recognition site containing A294G and the anti-codon recognition site. (b) IMAC purification profile of cell-free produced PheRS(A294G) showing pull-down of the dimeric complex by the 6X His-tagged PheS(A294G) domain.
FIG. 10 shows the purification of several PheRS(A294G, A794X) variants produced by cell-free protein synthesis.
FIG. 11 shows percent Phe aminoacylation analysis of [30-32Phe-tRNAPhe catalyzed by PheRS(A294G) for 30 min. (a) P1 nuclease digestion of (b) Phe-tRNAAAAPhe, Phe-tRNACUAPhe, or Phe-tRNAGAAPhe results in [32P]Phe-AMP that can be separated from free [32P]AMP on PEI cellulose TLC plates and imaged using autoradiography.
FIG. 12 shows percent para-acetyl Phe (pAF) aminoacylation analysis of pAF-tRNAPhe variants catalyzed by PheRS(A294G) under various conditions as measured by autoradiography using a end-labeled [32P]-3′ tRNA.
FIG. 13 shows the time dependence of the formation of (a) pAF-tRNACUAPhe and (b) pAF-tRNAAAAPhe as measured by autoradiography.
FIG. 14 shows that (a) E. coli GluRS can robustly aminoacylate tRNACUCGlu with cognate glutamate as measured using a [32P]-3′ tRNA end-labeling assay under optimized conditions. Mono-fluoroglutamate (F-Glu) AMP is not separated from [32P]-AMP under these chromatographic conditions. (b) H. pylori GluRS2(ND) can aminoacylate H. pylori tRNACUCGlu with Glu and F-Glu, although F-Glu AMP is not separated from AMP under these chromatographic conditions.
FIG. 15 shows (a) the separation of aminoacylated pAF-tRNAGAAPhe from tRNAGAAPhe using hydrophobic interaction chromatography, and (b) the chromatographic mobility of aminoacylated pAF-tRNAGAAPhe, tRNAGAAPhe, and tRNAGAAPhe2′,3′ cyclic phosphate by acid-urea gel electrophoresis.
FIG. 16 shows (a) the separation of aminoacylated pAF-tRNACUAPhe from tRNACUAPhe and (b) pAF-tRNAAAAPhe from tRNAAAAPhe using hydrophobic interaction chromatography.
FIG. 17 shows that (a) Wild type E. coli tRNAGlu and (b) in vitro transcribed E coli tRNACUCGlu can be robustly charged with mono-fluoroglutamate as determined by acid/urea gel electrophoresis.
FIG. 18 shows cell-free synthesis yields of GMCSF as function of the concentration of added lysine, phenylalanine, or glutamic acid to the extract.
FIG. 19 shows (a) a diagram of the species involved in non-native amino acid incorporation into fluorescent turboGFP in the cell-free synthesis reaction, including background recharging of engineered isoaccepting tRNA by endogenous E coli PheRS, (b) the chemical structure of an active-site directed inhibitor of PheRS, 5′-O-[N-(Phenylalanyl) sulfamoyl] adenosine, Phe-SA, and (c) the determination of IC50 for inhibition of the rate of cell-free synthesis of turboGFP as a function of added inhibitors Phe-SA (IC50=0.8 nM) or Glu-SA (IC50=54 nM).
FIG. 20 shows a response surface describing the relationship between added Phe amino acid and [Phe-SA] inhibitor on the rate of turboGFP cell-free synthesis
FIG. 21 shows a schematic diagram illustrating the salient features of dual-charging nnAA incorporation
FIG. 22 illustrates the salient features of the turboGFP Y50TAG amber suppressor protein used to establish incorporation of para-acetyl phenylalanine (pAF) at position 50.
FIG. 23 shows the conditions used to demonstrate dual-charging incorporation of para-acetyl phenylalanine (pAF) into turboGFP Y50TAG.
FIG. 24 illustrates how the removal or inhibition of PheRS from the cell-free extract, while adding exogenously synthesized pAF-tRNACUAPhe and Phe-tRNAGAAPhe, can be used to site-specifically incorporate a nnAA into a protein by engineered ribosomal protein synthesis.
FIG. 25 is a schematic showing a cell-free protein synthesis system as described herein. In this example, the native aminoacyl-tRNA synthetase is depleted following cell lysis. Native aaRS refers to the native aminoacyl-tRNA synthetase. tRNA1 and tRNA2 refer to the first and second isoaccepting sense tRNAs, respectively. NAA depicts a native amino acid, and nnAA depicts a non-native amino acid.
FIG. 26 is a schematic showing an example of the two tRNA charging reactions as described herein. In this example, the aminoacylating reagent is an aminoacyl-tRNA synthetase, the first isoaccepting sense tRNA is charged with the native amino acid, and the second isoaccepting sense tRNA is charged with a non-native amino acid. aaRS refers to an aminoacyl-tRNA synthetase. tRNA1 and tRNA2 refer to the first and second isoaccepting sense tRNAs, respectively. NAA depicts a native amino acid, and nnAA depicts a non-native amino acid.
This invention provides for a novel means of incorporating non-native amino acids into preselected positions of a protein using a cell-free synthesis system. The methods involve the use of non-orthogonal, native isoaccepting sense tRNAs that are encoded by the genetic code. Such methods allow for numerous non-native amino acids to be incorporated through the use of sense codons without having to rely upon orthogonal tRNA-synthetase pairs.
Important to the present invention is the utilization of isoaccepting sense tRNAs to differentially incorporate either native or non-native amino acids into a protein even though such tRNAs are normally charged with the same amino acid in nature. This invention exploits the degeneracy of the genetic code to incorporate non-native amino acids into a growing polypeptide chain based on an mRNA sense codon sequence without compromising the ability to incorporative the native amino acid into the protein. Following cell lysis, a lysate is created that contains all the cellular components required for protein synthesis. A nucleic acid template is then added that has sense codons specifying positions in which the non-native amino acid will be incorporated. The endogenous native amino acid that is coded for by the sense codons must be prevented from being incorporated into the desired protein. Preventing incorporation of the endogenous native amino acid is accomplished either by depleting the native aminoacyl-tRNA synthetase, or by inactivating the isoaccepting tRNA molecules that function to position an amino acid within a growing polypeptide chain based on the mRNA template sequence. The native aminoacyl-tRNA synthetase has the ability to charge both isoaccepting tRNAs. Thus, the native aminoacyl-tRNA synthetase must be depleted from the lysate protein prior to the protein synthesis reaction to prevent uncharged isoaccepting sense tRNA molecules from being charged with the incorrect amino acid while in the lysate, if the invention is practiced by depleting a native aminoacyl-tRNA synthetase.
Each isoaccepting sense tRNA is separately aminoacylated in a tRNA charging reaction. This aspect of the invention is referred to as “dual charging” because each isoaccepting sense tRNA is charged in a separate reaction vessel. Any method that will aminoacylate a tRNA molecule is sufficient regardless of whether an aminoacyl-tRNA synthetase is utilized for the separate charging reaction. For example, either a purified ribozyme or any functional aminoacyl-tRNA synthetase may be used to separately charge each respective isoaccepting sense tRNA molecule. The first isoaccepting sense tRNA is charged with any amino acid, preferably the native amino acid. The second isoaccepting sense tRNA is charged in yet another separate reaction with the desired non-native amino acid. The first isoaccepting sense tRNA and second isoaccepting sense tRNA that have been charged with their respective amino acids are then purified from the charging reaction mixtures, which includes isolation from any aminoacyl-tRNA synthetases that was used in the reaction vessel. The purified isoaccepting sense tRNA molecules are then added to the lysate in which the protein synthesis reaction will occur to generate a desired protein containing both native and non-native amino acids in positions specified by the different sequences recognized by isoaccepting sense tRNAs.
The uses of proteins containing non-native amino acids include desired changes in protein structure and/or function, which would include changing the size, acidity, nucleophilicity, hydrogen bonding, hydrophobicity, or accessibility of protease target sites. Proteins that include an non-native amino acid can have enhanced or even entirely new catalytic or physical properties such as modified toxicity, biodistribution, structural properties, spectroscopic properties, chemical and/or photochemical properties, catalytic ability, serum half-life, and the ability to react with other molecules, either covalently or non-covalently. Proteins that include at least one non-native amino acid are useful for, but not limited to, novel therapeutics, diagnostics, catalytic enzymes, binding proteins, and the study of protein structure and function.
The cell-free non-native amino acid incorporation method of this invention is distinct from the non-native amino acid incorporation methods previously employed in the art. Most notably, this invention uses isoaccepting tRNAs that recognize sense codons, which circumvents the requirement of having to utilize orthogonal tRNAs and orthogonal aminoacyl-tRNA synthetases in order to incorporate non-native amino acids. Using orthogonal tRNAs relies on inherently inefficient suppressor tRNAs. This inefficiency is a result competition at the non-orthogonal sense codons from natural amino acids catalyzed by the tRNA charging and proofreading activities of the twenty different aminoacyl-tRNA synthetases in addition to inherently inefficient suppressor tRNAs competing with termination factors. This results in selective incorporation of only a single non-native amino acid per protein at only one of the three termination codons: the UAG “amber” codon. Additionally, orthogonal protein synthesis systems that utilize amber stop codons to incorporate non-native amino acids often fail to terminate at the second termination codon due to read through by the ribosome. See, e.g., Cloud et al., Chem. and Biol. 3:1033-38 (1996). Although attempts have been made to utilize sense codon recognition for incorporation of non-native amino acids (see e.g. Tan et al., Methods 36:279-90 (2005); Forster et al., U.S. Pat. No. 6,977,150), such pure reconstituted translation systems require purified translational components, which is impractical outside of the context of research, very expensive, and not shown to be highly efficient.
The protein synthesis reaction of this invention is practiced by obtaining a nucleic acid encoding the desired protein as described above, obtaining a cell lysate, preventing the endogenous native amino acid from being incorporated into the desired polypeptide, obtaining two isoaccepting sense tRNAs, one of which has been charged with an amino acid in a tRNA charging reaction in the first reaction vessel, and one of which has been charged with a non-native amino acid in a separate tRNA charging reaction that takes place in the second reaction vessel, and combining the nucleic acid and charged isoaccepting sense tRNAs with the cellular lysate to form a protein synthesis reaction mixture. The amino acid used to charge the first isoaccepting tRNA in the first charging reaction may or may not be a native amino acid, but will not be the endogenous native amino acid produced by the host cell population used to generate the lysate.
The modified protein may also be referred to as the desired protein, selected protein, or target protein. As used herein, the modified protein refers generally to any peptide or protein having more than about 5 amino acids. The modified protein comprises at least one non-native amino acid at a pre-determined site, and may contain multiple non-native amino acids. If present at two or more sites in the polypeptide, the non-native amino acids can be the same or different. Where the non-native amino acids are different, the tRNA codons for each non-native amino acids will also be different.
The modified protein may be homologous to, or may be exogenous, meaning that they are heterologous, i.e., foreign, to the cells from which the cell-free lysate is derived, such as a human protein, viral protein, yeast protein, etc. produced in a bacterial cell-free extract. Modified proteins may include, but are not limited to, molecules such as, e.g., renin, a growth hormone, including human growth hormone; bovine growth hormone; growth hormone releasing factor; parathyroid hormone; thyroid stimulating hormone; lipoproteins; alpha-1-antitrypsin; insulin A-chain; insulin B-chain; proinsulin; follicle stimulating hormone; calcitonin; luteinizing hormone; glucagon; clotting factors such as factor VIIIC, factor IX, tissue factor, and von Willebrands factor; anti-clotting factors such as Protein C; atrial natriuretic factor; lung surfactant; a plasminogen activator, such as urokinase or human urine or tissue-type plasminogen activator (t-PA); bombesin; thrombin; hemopoietic growth factor; tumor necrosis factor-alpha and -beta; enkephalinase; RANTES (regulated on activation normally T-cell expressed and secreted); human macrophage inflammatory protein (MIP-1-alpha); a serum albumin such as human serum albumin; mullerian-inhibiting substance; relaxin A-chain; relaxin B-chain; prorelaxin; mouse gonadotropin-associated peptide; a microbial protein, such as beta-lactamase; DNase; inhibin; activin; vascular endothelial growth factor (VEGF); receptors for hormones or growth factors; integrin; protein A or D; rheumatoid factors; a neurotrophic factor such as bone-derived neurotrophic factor (BDNF), neurotrophin-3,-4, -5, or -6 (NT-3, NT-4, NT-5, or NT-6), or a nerve growth factor such as NGF-(3; platelet-derived growth factor (PDGF); fibroblast growth factor such as aFGF and bFGF; epidermal growth factor (EOF); transforming growth factor (TGF) such as TGF-alpha and TGF-beta, including TGF-(31, TGF-(32, TGF-(33, TGF-(34, or TGF-(35; insulin-like growth factor-I and -II (IGF-I and IGF-II); des(1-3)-IGF-I (brain IGF-I), insulin-like growth factor binding proteins; CD proteins such as CD-3, CD-4, CD-8, and CD-I 9; erythropoietin; osteoinductive factors; immunotoxins; a bone morphogenetic protein (BMP); an interferon such as interferon- alpha, -beta, and -gamma; colony stimulating factors (CSFs), e.g., M-CSF, GM-CSF, and G-CSF; interleukins (ILs), e.g., IL-1 to IL-10; superoxide dismutase; T-cell receptors; surface membrane proteins; decay accelerating factor; viral antigen such as, for example, a portion of the AIDS envelope; transport proteins; homing receptors; addressins; regulatory proteins; antibodies; and fragments of any of the above-listed polypeptides.
“Aminoacylation” or “aminoacylate” refers to the complete process in which a tRNA is “charged” with its correct amino acid that is a result of adding an aminoacyl group to a compound. As it pertains to this invention, a tRNA that undergoes aminoacylation or has been aminoacylated is one that has been charged with an amino acid, and an amino acid that undergoes aminoacylation or has been aminoacylated is one that has been charged to a tRNA molecule.
“Aminoacyl-tRNA synthetase” or “tRNA synthetase” or “synthetase” or “aaRS” or “RS” refers to an enzyme that catalyzes a covalent linkage between an amino acid and a tRNA molecule. This results in a “charged” tRNA molecule, which is a tRNA molecule that has its respective amino acid attached via an ester bond.
“Binding moiety” refers to any substrate or ligand that is part of a molecular association responsible for eliminating a desired aminoacyl-tRNA synthetase from a reaction mixture. Such ligand or substrate moieties may include, but are not limited to, antibodies, affinity supports, matrices, resins, columns, or coated beads.
“Cell-free synthesis system” refers to the in vitro synthesis of polypeptides in a reaction mix comprising biological extracts and/or defined reagents. The reaction mix will comprise a template for production of the macromolecule, e.g. DNA, mRNA, etc.; monomers for the macromolecule to be synthesized, e.g. amino acids, nucleotides, etc.; and co-factors, enzymes and other reagents that are necessary for the synthesis, e.g. ribosomes, uncharged tRNAs, tRNAs charged with unnatural amino acids, polymerases, transcriptional factors, etc.
“Capture moiety” refers to a tag that genetically engineered onto a protein. Such tags may include, but are not limited to a His-tag, GFP-tag, GST-tag, FLAG-tag, etc.
“Catalytic aminoacylating reagent” refers to any enzyme or molecule that has the capability to charge a tRNA molecule. Such aminoacylating reagents may refer to, but are not limited to, aminoacyl-tRNA synthetases or ribozyme columns.
“Charged tRNA” or “aminoacylated tRNA” refers to a tRNA molecule that has an amino acid bound at the amino acid attachment site. During protein synthesis, the amino acid to transferred to the growing polypeptide chain, releasing the tRNA, which is referred to as the “released tRNA.”
“Charging reaction mixture” refers to an in vitro reaction mixture in which an isoaccepting sense tRNA is charged with its respective amino acid. The mixture contains only isoaccepting tRNAs with a specific codon sequence that is to be charged. Methods for charging natural, non-native and/or arbitrary tRNA with natural, non-native and/or arbitrary amino acids are known in the art, and include, but are not limited to, chemical aminoacylation, biological misacylation, acylation by modified aminoacyl tRNA synthetases, ribozyme-based, and protein nucleic acid-mediated methods.
“Degenerate codon” refers to the degeneracy of the genetic code such that one amino acid or translation termination site may be coded for by more than one codon. A codon is a three nucleotide sequence that specifies either an amino acid or translational stop sequence. Degeneracy is a result of all proteins being made up of only 20 amino acids even though 64 possible codons exist.
“DNA” refers to a sequence of two or more covalently bonded, naturally occurring or modified deoxyribonucleotides.
“Gene” refers to a hereditary unit consisting of a sequence of DNA that has a specific chromosomal location. A gene is expressed to produce a protein product.
“Heterologous” as it pertains to this invention refers to an aminoacyl-tRNA synthetase that originates from a species different from the host cell in which it is expressed.
“Isoaccepting sense tRNA” refers to different tRNA species that bind to alternate codons for the same amino acid.
“Lysate” is any cell derived preparation comprising the components required for protein synthesis machinery, wherein such cellular components are capable of expressing a nucleic acid encoding a desired protein where a majority of the biological components are present in concentrations resulting from the lysis of the cells rather than having been reconstituted. A lysate may be further altered such that the lysate is supplemented with additional cellular components, e.g. amino acids, nucleic acids, enzymes, etc. The lysate may also be altered such that additional cellular components are removed following lysis.
“Native amino acid” refers to one or more naturally occurring amino acids encoded by the genetic code. An “endogenous native amino acid” refers to a native amino acid produced by the host cells used to generate the lysate.
“Native aminoacyl-tRNA synthetase” refers to a host cell aminoacyl-tRNA synthetase enzyme that is found in nature. Native aminoacyl-tRNA synthetases may be synthesized and added exogenously to a tRNA reaction vessel as defined by this invention. Native aminoacyl tRNA synthetases include, but are not limited to, a natural aminoacyl tRNA synthetases from one or more of plants, microorganisms, prokaryotes, eukaryotes, protozoa, bacteria, mammals, yeast, E. coli, or humans.
“Native isoaccepting sense tRNA” refers to either a first or second isoaccepting sense tRNA that is produced by the host population of cells used to create the lysate used for the cell-free protein synthesis reaction.
“Non-native amino acids” or “nnAA” refer to amino acids that are not one of the twenty naturally occurring amino acids that are the building blocks for all proteins, but are nonetheless capable of being biologically engineered such that they are incorporated into proteins. Non-native amino acids may include D-peptide enantiomers or any post-translational modifications of one of the twenty naturally occurring amino acids. A wide variety of non-native amino acids can be used in the methods of the invention. The non-native amino acid can be chosen based on desired characteristics of the non-native amino acid, e.g., function of the non-native amino acid, such as modifying protein biological properties including toxicity, biodistribution, or half life, structural properties, spectroscopic properties, chemical and/or photochemical properties, catalytic properties, ability to react with other molecules (either covalently or noncovalently), or the like. Non-native amino acids that can be used in the methods of the invention may include, but are not limited to, an non-native analogue of a tyrosine amino acid; an non-native analog of a glutamine amino acid; an non-native analog of a phenylalanine amino acid; an non-native analog of a serine amino acid; an non-native analog of a threonine amino acid; an alkyl, aryl, acyl, azido, cyano, halo, hydrazine, hydrazide, hydroxyl, alkenyl, alkynl, ether, thiol, sufonly, seleno, ester, thioacid, borate, boronate, phospho, phosphono, phosphine, heterocyclic, enone, imine, aldehyde, hydroxylamine, keto, or amino substituted amino acid, or any combination thereof; an amino acid with a photoactivatable cross-linker; a spin-labeled amino acid; a fluorescent amino acid; an amino acid with a novel functional group; an amino acid that covalently or noncovalently interacts with another molecule; a metal binding amino acid; a metal-containing amino acid; a radioactive amino acid; a photocaged and/or photoisomerizable amino acid; a biotin or biotin-analog containing amino acid; a glycosylated or carbohydrate modified amino acid; a keto containing amino acid; amino acids comprising polyethylene glycol or polyether; a heavy atom substituted amino acid; a chemically cleavable or photocleavable amino acid; an amino acid with an elongated side chain; an amino acid containing a toxic group; a sugar substituted amino acid, e.g., a sugar substituted serine or the like; a carbon-linked sugar-containing amino acid, e.g., a sugar substituted serine or the like; a carbon-linked sugar-containing amino acid; a redox-active amino acid; an α-hydroxy containing acid; an amino thio acid containing amino acid; an α, α disubstituted amino acid; a β-amino acid; a cyclic amino acid other than praline, etc.
“Polypeptide” or “peptide” or “protein” refers to two or more naturally occurring amino acids, joined by one or more peptide bonds.
“Reaction vessel” refers to the containment that is autonomous from the protein synthesis reaction in which the tRNA charging reaction occurs.
“Ribozyme” refers an RNA molecule that is capable of catalyzing a chemical reaction. As it pertains to the current invention, a ribozyme has aminoacylating activity such that it will charge a tRNA molecule independent of an aminoacyl-tRNA synthetase.
“RNA” refers to a sequence of two or more covalently bonded, naturally occurring or modified ribonucleotides.
“Sense codon” refers to a set of three nucleotides in a protein coding sequence that specify an amino acid. As used in this invention, a sense codon does not include a termination signal or stop codon.
“tRNA” or “transfer RNA” refers to a small RNA molecule that transfers a specific amino acid to a growing polypeptide chain at the ribosomal site of protein synthesis during translation. tRNAs contain a three base codon that pairs to the corresponding mRNA codon. As a result of the degeneracy of the genetic code, an amino acid can associate with multiple tRNAs, while each type of tRNA molecule can only associate with one type of amino acid.
“tRNA charging reaction” refers to the reaction in which a synthesized native tRNA is charged with its respective amino acid separate from the protein synthesis reaction, whether said amino acid is natural or non-native.
“tRNA:first amino acid charged moiety” refers generally to an isoaccepting tRNA molecule that has been charged with an amino acid. As it pertains to this invention, “tRNA:first amino acid charged moiety” is used in conjunction, and relative to, a tRNA:non-native amino acid charged moiety.
“tRNA:non-native amino acid charged moiety” refers generally to a tRNA molecule that is an isoaccepting tRNA molecule to the isoaccepting first tRNA molecule, but which has been charged with a non-native amino acid in place of the native amino acid.
“Transforming” a cell or population of cells refers to the alteration of the gene expression of a host cell or cells from which the lysate is derived. As used in this invention, transforming a cell refers to the process in which is cell is altered such that an exogenous nucleic acid sequence is introduced that expresses a recombinant protein.
In order to produce the proteins of this invention, one needs a nucleic acid template. The template for cell-free protein synthesis can be either mRNA or DNA. The template can encode for any particular gene of interest, and may encode a full-length polypeptide or a fragment of any length thereof. Nucleic acids to serve as sequencing templates are optionally derived from a natural source or they can be synthetic or recombinant. For example, DNAs can be recombinant DNAs, e.g., plasmids, viruses or the like. The nature of the invention uses sense codons for the incorporation of non-native amino acids, and circumvents the requirement of orthogonal components as is commonly found in the art. As a result, a preferred embodiment of the invention will use a template that is capable of translating a complete and functional protein regardless of whether non-native amino acids are chosen to be incorporated.
A DNA template that comprises the gene of interest will be operably linked to at least one promoter and to one or more other regulatory sequences including without limitation repressors, activators, transcription and translation enhancers, DNA-binding proteins, etc. Suitable quantities of DNA template for use herein can be produced by amplifying the DNA in well known cloning vectors and hosts, or by polymerase chain reaction (PCR).
A preferred embodiment uses a bacterial lysate. A DNA template be constructed for bacterial expression by operably linking a desired protein-encoding DNA to both a promoter sequence and a bacterial ribosome binding site (Shine-Delgarno sequence). Promoters suitable for use with the DNA template in the cell-free transcription-translation methods of the invention include any DNA sequence capable of promoting transcription in vivo in the bacteria from which the bacterial extract is derived. Preferred are promoters that are capable of efficient initiation of transcription within the host cell. DNA encoding the desired protein and DNA containing the desired promoter and Shine-Dalgarno (SD) sequences can be prepared by a variety of methods known in the art. Alternatively, the desired DNA sequences can be obtained from existing clones or, if none are available, by screening DNA libraries and constructing the desired DNA sequences from the library clones.
RNA templates encoding the protein of interest can be conveniently produced from a recombinant host cell transformed with a vector constructed to express a mRNA with a bacterial ribosome binding site (SD sequence) operably linked to the coding sequence of the desired gene such that the ribosomes in the reaction mixture are capable of binding to and translating such mRNA. Thus, the vector carries any promoter capable of promoting the transcription of DNA in the particular host cell used for RNA template synthesis.
Because it is difficult to extract undegraded RNA from bacteria, higher eukaryotic cell culture is preferred for the production of the RNA template. In principle, any higher eukaryotic cell culture is workable, including both vertebrate and invertebrate cell cultures. The RNA template can be conveniently isolated in a total cellular RNA fraction extracted from the host cell culture. Total cellular RNA can be isolated from the host cell culture by any method known in the art. The desired RNA template can be isolated along with most of the cellular mRNA if the RNA template is designed to contain at its 3′ end a polyadenylation signal recognized by the eukaryotic host cell. Thus, the host cell will produce the RNA template with a polyadenylate (poly(A)) tail. Polyadenylated mRNAs can be separated from the bulk of cellular RNA by affinity chromatography on oligodeoxythymidylate (oligo (dT))-cellulose columns using any methods known in the art. If the size of the mRNA encoding the desired protein is known, the mRNA preparation can be further purified for mRNA molecules of the particular size by agarose gel electrophoresis of the RNA.
Examples of appropriate molecular techniques for generating recombinant nucleic acids, and instructions sufficient to direct persons of skill through many closing exercises are found in Berger and Kimmel, Guide to Molecular Cloning Techniques, Methods in Enzymology (Volume 152 Academic Press, Inc., San Diego, Calif. 1987); PCR Protocols: A Guide to Methods and Applications (Academic Press, San Diego, Calif. 1990). Product information from manufacturers of biological reagents and experimental equipment also provide information useful in known biological methods. Such manufacturers include SIGMA (Saint Louis, Mo.), R&D systems (Minneapolis, Minn.), Pharmacia LKB Biotechnology (Piscataway, N.J.), Clontech Laboratories, Inc. (Palo Alto, Calif.), Aldrich Chemical Company (Milwaukee, Wis.), Invitrogen (San Diego, Calif.), Applied Biosystems (Fosters City, Calif.), as well as many other commercial sources known to one of skill in the art.
The present invention utilizes a cell lysate for in vitro translation of a target protein. For convenience, the organism used as a source for the lysate may be referred to as the source organism or host cell. Host cells may be bacteria, yeast, mammalian or plant cells, or any other type of cell capable of protein synthesis. A lysate comprises components that are capable of translating messenger ribonucleic acid (mRNA) encoding a desired protein, and optionally comprises components that are capable of transcribing DNA encoding a desired protein. Such components include, for example, DNA-directed RNA polymerase (RNA polymerase), any transcription activators that are required for initiation of transcription of DNA encoding the desired protein, transfer ribonucleic acids (tRNAs), aminoacyl-tRNA synthetases, 70S ribosomes, N10-formyltetrahydrofolate, formylmethionine-tRNAfMet synthetase, peptidyl transferase, initiation factors such as IF-1, IF-2, and IF-3, elongation factors such as EF-Tu, EF-Ts, and EF-G, release factors such as RF-1, RF-2, and RF-3, and the like.
An embodiment uses bacterial cells from which a lysate is derived. A bacterial lysate derived from any strain of bacteria can be used in the methods of the invention. The bacterial lysate can be obtained as follows. The bacteria of choice are grown up overnight in any of a number of growth media and under growth conditions that are well known in the art and easily optimized by a practitioner for growth of the particular bacteria. For example, a natural environment for synthesis utilizes cell lysates derived from bacterial cells grown in medium containing glucose and phosphate, where the glucose is present at a concentration of at least about 0.25% (weight/volume), more usually at least about 1%; and usually not more than about 4%, more usually not more than about 2%. An example of such media is 2YTPG medium, however one of skill in the art will appreciate that many culture media can be adapted for this purpose, as there are many published media suitable for the growth of bacteria such as E. coli, using both defined and undefined sources of nutrients. Cells that have been harvested overnight can be lysed by suspending the cell pellet in a suitable cell suspension buffer, and disrupting the suspended cells by sonication, breaking the suspended cells in a French press, continuous flow high pressure homogenization, or any other method known in the art useful for efficient cell lysis. The cell lysate is then centrifuged or filtered to remove large DNA fragments. Methods of bacterial lysate preparation are well known in the art. See, e.g., Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 1989).
Another embodiment uses rabbit reticulocyte cells from which to derive a lysate. Reticulocyte lysate is prepared following the injection of rabbits with phenylhydrazine, which ensures reliable and consistent reticulocyte production in each lot. The reticulocytes are purified to remove contaminating cells which could otherwise alter the translational properties of final lysate. The cells can then be lysed by suspending the cell pellet in a suitable cell suspension buffer, and disrupting the suspended cells by sonication, breaking the suspended cells in a French press, or any other method known in the art useful for efficient cell lysis. After the reticulocytes are lysed, the lysate is treated with micrococcal nuclease and CaCl2 in order to destroy endogenous mRNA and thus reduce background translation. EGTA is further added to chelate the CaCl2 thereby inactivating the nuclease. Hemin may also be added to the reticulocyte lysate because it is a suppressor of an inhibitor of the initiation factor eIF2a. In the absence of hemin, protein synthesis in reticulocyte lysates ceases after a short period of incubation. See e.g., Jackson, R. and Hunt, T., Meth. In Enzymol. (1983). Potassium acetate and magnesium acetate are added at a level recommended for the translation of most mRNA species. For further detail on preparing rabbit reticulocyte lysate, one skilled in the art can refer to, e.g., Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 1989).
An embodiment may use a plant lysate such as wheat germ lysate. Generally, wheat germ lysate is prepared by grinding wheat germ in a lysate buffer, followed by centrifugation to remove cell debris. The supernatant is then separated by chromatography from endogenous amino acids and plant pigments that are inhibitory to translation. The lysate is also treated with micrococcalnuclease to destroy endogenous mRNA, to reduce background translation to a minimum. The lysate contains the cellular components necessary for protein synthesis, such as tRNA, rRNA and initiation, elongation, and termination factors. The lysate is further optimized by the addition of an energy generating system consisting of phosphocreatine kinase and phospocreatine, and magnesium acetate is added at a level recommended for the translation of most mRNA species. For more detail on the preparation of wheat germ lysate, see e.g., Roberts, B. E. and Paterson, B. M. (1973), Proc. Natl. Acad. Sci. U.S.A. Vol. 70, No. 8, pp. 2330-2334), following the modifications described by Anderson, C. W., et al., Meth. Enzymol. (Vol. 101, p. 635; 1983).
Lysates are also commercially available from manufacturers such as Promega Corp.(Madison, Wis.), Stratagene (La Jolla, Calif.), Amersham (Arlington Heights, Ill.) and GIBCO (Grand Island, N.Y.).
The endogenous native amino acids recognized by the isoaccepting tRNAs used in the tRNA charging reactions that are produced by the host cell population must be prevented from being incorporated into the desired polypeptide. This allows the dual nature of the present invention to place native or non-native amino acids not produced by the host cell population into the first and second codon positions, respectively. One skilled in the art can prevent incorporation of an endogenous native amino acid either by depleting native aminoacyl-tRNA synthetases that would function to aminoacylate the native amino acid, or by disrupting the function of the isoaccepting tRNAs.
The native aminoacyl-tRNA synthetase may be depleted from the cell lysate either before lysis of the host cell population, or directly from the lysate following lysis of the host cell population in order to prevent incorporation of an endogenous native amino acid.
In embodiments where the native aminoacyl-tRNA synthetase is depleted from the cell lysate before lysis, the host cell population is altered such that the native aminoacyl-tRNA synthetase is replaced with an aminoacyl-tRNA synthetase fused to a tag referred to as a capture moiety. The native aminoacyl-tRNA synthetase is replaced by transforming said cells with a gene wherein said gene expresses an aminoacyl-tRNA synthetase fused to a capture moiety that is capable of functionally replacing the native aminoacyl-tRNA synthetase. The purpose of replacing the native aminoacyl-tRNA synthetase with a tagged aminoacyl-tRNA synthetase is to provide a simple manner in which the lysate will be cleared of an aminoacyl-tRNA synthetase capable of charging both isoaccepting sense tRNAs while retaining survival of the host cell population in the absence of the native aminoacyl-tRNA synthetase.
When using an aminoacyl-tRNA synthetase fused to a capture moiety to functionally replace the native aminoacyl-tRNA synthetase prior to lysis, one also needs to alter the host cell such that the expression of the native aminoacyl-tRNA synthetase is inhibited. This may be accomplished by any method known in the art including, but not limited to, creating a host cell line that has a deletion for the entire DNA sequence that codes for the synthetase mRNA; deleting a portion of the DNA sequence that codes for the synthetase mRNA such that any resulting synthetase protein is rendered non-functional, where the deleted portion may include an exon, intron, promoter, or enhancer sequence; or introducing any type of exogenous intervening sequence into the coding or regulatory sequence of the endogenous aminoacyl-tRNA synthetase, such as a transposon, that functions to disrupt or completely inhibit the function of the synthetase. Methods of disrupting endogenous gene function are well known in the art, and should not be limited only to these discussed. Such methods are well known in the art, and are common to the practice of molecular biology. For greater detail on such techniques, see e.g., Sambrook et al., Molecular Cloning-A Laboratory Manual, 3rd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 2000).
When using an aminoacyl-tRNA synthetase fused to a capture moiety to functionally replace the native aminoacyl-tRNA synthetase prior to lysis, the aminoacyl-tRNA synthetase fused to a capture moiety itself must be depleted from the lysate following lysis in order to prevent any cross-reactivity that might aminoacylate both isoaccepting sense tRNAs with the same amino acid. The aminoacyl-tRNA synthetase fused to a capture moiety may be depleted from the lysate by any method known in the art that will allow a tagged protein to be removed from a lysate, which may include but is not limited to, affinity chromatography, immunoaffinity chromatography, or immunoprecipitation.
In embodiments where an aminoacyl-tRNA synthetase fused to a capture moiety is depleted from the cell lysate by affinity chromatography, one may utilize a variety of tags known in the art. A common tag e.g., is a Histidine-tag (His-tag), which has an affinity towards nickel or cobalt ions. Here, the tagged aminoacyl-tRNA synthetase to be depleted may be engineered into a recombinant protein that will express the desired synthetase having the His-tag exist as part of the expressed protein. If one immobilizes nickel or cobalt ions on a resin column, an affinity support that specifically binds to histidine-tagged proteins can be created. As it relates to the present invention, the resin immobilized with either the nickel or cobalt ions is the binding moiety. Because the only protein in the lysate that will have a His-tag will be the aminoacyl-tRNA synthetase fused to the His-tag, that synthetase will be the only protein that will bind to the resin, letting all other proteins pass through the column. Such techniques are well known in the art, and His-tag vectors are commercially available from manufacturers such as Qiagen (Valencia, Calif.), Roche Applied Science (Rotkreuz, Switzerland), Biosciences Clontech (Palo Alto, Calif.), Promega (San Luis Obispo, Calif.) and Thermo Scientific (Rockford, Ill.).
Immunoaffinity chromatography may also be used to deplete from the lysate the aminoacyl-tRNA synthetase fused to a capture moiety. Immunoaffinity chromatography is a method of affinity chromatography that is achieved by tagging the aminoacyl-tRNA synthetase with a capture moiety that is recognized by an antibody. The capture moiety may be any tag that is commercially available and recognized by commercially available antibodies. Such tags may include, but are not limited to, Green Fluorescent Protein (GFP) tag, Glutathione-S-transferase (GST) tag, and the FLAG-tag tag. Immunoaffinity chromatography methods are well known in the art. For more detail on either affinity or immunoaffinity chromatography, see, e.g., Affinity Chromatography: Principles & Methods (Pharmacia LKB Biotechnology 1988), and Doonan, Protein Purification Protocols (The Humana Press 1996).
In another embodiment of the present invention, the aminoacyl-tRNA synthetase fused to a capture moiety may be depleted from the lysate by immunoprecipitation. In this embodiment, antibodies are raised against the capture moiety, but such systems often provide for the use of commercial antibodies raised against commercially available recombinant tags. The antibody is then immobilized on a solid-phase substrate binding moiety that may include, but is not limited to, microscopic superparamagnetic or microscopicagarose beads. The beads bind to the substrate of choice, and when added to the cell lysate, the proteins that are targeted by the antibodies are bonded onto the substrate. Alternatively, the antibodies may also be directly added to the lysate and allowed to associate with the targeted aminoacyl-tRNA synthetase to be depleted. Beads coated in Protein A/G are then added to the antibody/aminoacyl-tRNA synthetase mixture, at which time the antibodies and bound synthetase will bind to the Protein A/G beads. The substrate can then be removed from the lysate, for example, via magnetic fields for superparamagnetic substrates or centrifugation for microscopicagarose substrates. Immunoprecipitation methods are well known in the art. See, e.g. E. Harlow, Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 1988).
In some embodiments of the present invention, the native aminoacyl-tRNA synthetase is depleted prior to lysis and functionally replaced by transforming the host cell population with a recombinant aminoacyl-tRNA gene that produces an aminoacyl-tRNA synthetase that is thermally instable. Following cell lysis, heat can be used to denature the thermally instable aminoacyl-tRNA synthetase to prevent unwanted charging of the isoaccepting tRNA molecules within the lysate. Similarly, the host cell population can be replaced with a recombinant aminoacyl-tRNA synthetase gene that expresses an aminoacyl-tRNA synthetase that is unstable under ionic, physical, or chemical conditions.
In embodiments where the native aminoacyl-tRNA synthetase is depleted from the cell lysate following lysis, replacing the aminoacyl-tRNA synthetase with an aminoacyl-tRNA synthetase tagged with a capture moiety is unnecessary. In these embodiments, immunoaffinity chromatography or immunoprecipitation may be used to deplete the endogenous native aminoacyl-tRNA synthetase. This embodiment requires raising antibodies against the native aminoacyl-tRNA synthetase. Once antibodies that sufficiently recognize the native aminoacyl-tRNA synthetase are raised, either immunoaffinity chromatography or immunoprecipitation, as described above, may be used to deplete the lysate of the native aminoacyl-tRNA synthetase.
In other embodiments where the native aminoacyl-tRNA synthetase is depleted following cell lysis, the native aminoacyl-tRNA synthetase may be functionally depleted using an aminoacyl-tRNA synthetase inhibitor that is specific to that synthetase desired to be depleted. Many aminoacyl-tRNA synthetase inhibitors are amino acid analogs that inhibit a specific aminoacyl-tRNA synthetase, although a particular inhibitor may sometimes inhibit aminoacyl-tRNA synthetases associated with more than one amino acid. Aminoacyl-tRNA synthetase specific inhibitors can also be searched in databanks such as BioInfoBank (http://ia.bioinfo.pl/). A person skilled in the art would also readily recognize that a specific inhibitor can be designed, screened, and tested, based on the available structural models of aminoacyl-tRNA synthetases.
Examples of aminoacyl-tRNA synthetase inhibitors include S-trityl-L-cysteine; L-asparaginamide; 4-aza-DL-leucine; DL-serine hydroxamate; proflavine (hemisulfate salt); L-isoleucinol; N-phenylglycine; L-leucinol; L-methioninol; phe-leu-amide; tyramine; L-isoleucinol; 3,4-dehydro-DL-proline; S-carbamyl-L-cysteine; a-methyl-DL-methionine; chloro-L-alanine; cis-hydroxy proline; L-prolinol; L-histidonol; L-tyrprophan hydroxamate; DL-4-thiaisoleucine; DL-amino-.epsilon.-caprolactam; L-aspartic acid amide; DL-β-hydroxynorvaline; cis-4-fluoro-L-proline; trans-4-fluoro-L-carboxylic acid; α-methyl-DL-histidine; N-formyl-L-histidine; L-2-amino-3-sulfamoylpropionic acid; L-aspartic acid-β-hydroxamate; β-cyano-L-alanine; selenocystamine; 4-amino-n-butyric acid amide; DL-5-hydroxylysine; L-lysinhydroxamate; 3-(N-phenylacetyl)amino-2,6-piperidinedione (antineoplaston A10); 4-amino-4 phosphonobutyric acid; ethionamide; 1,2-diamino-3(4-imidazolyl)propane(histidinamine); α-methylhistidine; (S)-2-methylbutylamine; L-O-methylthreonine; DL-armentomycin (2-amino-4,4-dichlorobutyric acid); DL-3-dehydroarmentomycin; DL-3-hydroxyleucine; 5,5,5-trifluoro-DL-leucine; β-(3-aminocyclohexyl)-DL-alanine; DL-p-chloroamphetamine; trans-2,6-diaminohex-4-enoic acid; DL-2,6-diphthalimidocaproic acid methyl ester; DL-5-hydroxylysine; L-lysinhydroxamate; DL-4-oxalysine; DL-4-selenalysine; L-methioninamide; 2-amino-4-methylhex-4-enoic acid; (1S,2S)-2-amino-1-phenyl-1,3-propanediol; N-benzyl-D-amphetamine; N-benzyl-L-phenylalanine; N-benzyl-D-phenylethylamine; 1,3-bis(acetoxy)-2-nitro-1-phenylpropane (fenitropan); 1,2-diamino-3-(2,6-dichlorophenyl)propane; 1,2-diamino-3-hydroxy-5-phenylpentane; 1,2-diamino-3-phenylpropane; N-(2,6-dichlorobenzylidene)-2-phenylethylamine; N-(2,6-dichlorobenzyl)-2-phenylethylamine; N-(4-fluorobenzyl)-L-phenylalanine; DL-2-fluorophenylalanine; 2-hydroxyethyl-2-phenylammonium sulfate; α-and β-methyl-DL-phenylalanine; L-phenylalaninol; L-α-phenylglycine; DL-threo-β-phenylserine; β-2-thienyl-DL-alanine; N-trifluroacetyl-L-phenylalanine cyclohexyl ester; 2-aminomethyl-4-isopropyloxypyrrolidine oxalate; 2-amino-methylpyrrolidine; L-4-thiaproline; N-benzylethanolamine; N-(2,6-dichlorobenzyl)ethanolamine; N-(2,6-dichlorobenzylidene)ethanolamine; DL-β-hydroxyleucine; 1,2-diamino-5-phenyl-3-pentanol; DL-7-azatryptophan; DL-4-and DL-6-flurotryptophan; 5-hydroxytryptamine; L-5-hydroxytryptophan; DL-α-methyltryptamine; α- and β-methyl-DL-tryptophan; tryptamine; DL-2-amino-1-(4-hydroxyphenyl)-1-propanol; DL-3-fluorotyrosine; 3-iodo-L-tyrosine; 3-nitro-L-tyrosine; L-tyrosinol.HCl; L-threo-2-amino-3-chlorobutyric acid; hexafluoro-DL-valine; DL-norvaline; L-4-thialysine; DL-ethionine; N,N′-di-CBZ-L-lysine; DL-3-fluorophenylalanine; DL-4-fluorophenylalanine; and DL-3,4-dihydroxyphenylalanine. These compounds are known in the art.
Whilst the methods listed above for depleting proteins are the most commonly employed in the art, the methods of the present invention should not be limited only to those procedures described above. Any functional means for depleting a native aminoacyl-tRNA synthetase will accord with the methods of incorporating non-native amino acids as claimed in the present invention.
Endogenous native amino acids can further be prevented from incorporation into the desired polypeptide by inactivating native isoaccepting tRNAs. Native isoaccepting tRNAs can be inactivated using either an inactivated aminoacyl-tRNA synthetase variant that that has been engineered to selectively bind to the native first and second isoaccepting sense tRNAs; or by using antisense DNA.
The aminoacyl-tRNA synthetase variants are engineered to lack aminoacylating activity, but nonetheless outcompete the native aminoacyl-tRNA synthetases. Thus, the aminoacyl-tRNA synthetase variants will be able to inactivate specific isoaccepting tRNAs by binding to said isoaccepting tRNAs without aminoacylating its target tRNA.
Engineered tRNA/aminoacyl-tRNA synthetase pairs and promiscuous aminoacyl-tRNA synthetases may be engineered using a variety of methods generally used for protein directed evolution. Various types of mutagenesis may be used to produce novel synthetases. Such types of mutagenesis may include, but are not limited to, site-directed, random point mutagenesis, homologous recombination (DNA shuffling), mutagenesis using uracil containing templates, oligonucleotide-directed mutagenesis, phosphorothioate-modified DNA mutagenesis, mutagenesis using gapped duplex DNA or the like. Additional suitable methods include point mis-match repair, mutagenesis using repair-deficient host strains, restriction-selection and restriction-purification, deletion mutagenesis, mutagenesis by total gene synthesis, double-strand break repair, and the like. The mutants are then screened using a functional assay for desired activity. Mutagenesis, e.g., involving chimeric constructs, can also be used. Specific sites for increasing the affinity of the protein to its cognate tRNA can be identified by examining X-ray crystal structures. Engineering aminoacyl-tRNA synthetases to recognize non-native amino acids has become well known in the art. See, e.g. Liu et al., Proc. Natl. Acad. Sci. 94:10092-7 (1997); Furter, Protein Sci., 7:419 (1998); Zhang et al., Proc. Natl. Acad. Sci. 94:4504-09 (1997); Ohno et al., J. Biochem. 130:417-23 (2001). The reaction conditions in which a tRNA is charged with an amino acid in the tRNA charging reaction is illustrated in the examples provided herein.
Once specific aminoacyl-tRNA synthetase variants for isoaccepting tRNAs are identified, the lysate can be depleted of a specific isoaccepting tRNA by immobilizing the binding molecules on a column and passing the lysate through this column to recover the depleted isoaccepting tRNA lysate.
An embodiment of the present invention uses antisense DNA to inactivate isoaccepting tRNAs to prevent an endogenous native amino acid from incorporating into the desired polypeptide. Here, the antisense DNA recognizes the anticodon sequence of its target tRNA, hence preventing the native isoaccepting tRNA from associating with its mRNA codon sequence.
Inactivating and depleting tRNA molecules is well known in the art. See, e.g., Lindsley and Guarneros, Mol. Microbiology 48:1267-74 (2003); Jackson et al., RNA 7:765-73 (2001); Kanda et al., Biochem. Biophys. Res. Commun. 270:1136-9 (2000); Kanda et al., FEBS Letters 440:273-76 (1998); Kanda et al., Bioorganic & Medicinal Chemistry 8:675-79; Schmidt and Schimmel, PNAS 90:6919-23 (1993).
Specific t-RNA ribonucleases (tRNAses) can be used to inactive specific tRNAs by selectively cleaving specific tRNAs. Examples of specific tRNAses include colicin D, colicin E5, and PrrC. See, e.g., Tomita et al., Proc. Natl. Acad. Sci. 97:8278-83 (2000); Morad et al., J. Biol. Chem. 268:26842-9 (1993); Ogawa et al., 283:2097-2100 (1999); de Zamarozy et al., Mol. Cell 8:159-168 (2001). Active fragments of these specific t-RNA ribonucleases, e.g., C-terminal domain of colicin D or colicin E5, can be used for the present invention. Specific t-RNA ribonucleases can be further engineered to inactivate a subset of their target t-RNAs, or can be altered to inactivate a different tRNA target. When the ribonuclease activity is not longer desired, the tRNAses may be inhibited by an inhibitor, e.g., ImmD protein (see, e.g., de Zamarozy et al.).
The isoaccepting sense tRNAs must be charged in order to incorporate the non-native amino acids into the desire protein. The tRNA charging reaction, as used herein, refers to the in vitro tRNA aminoacylation reaction in which desired isoaccepting sense tRNAs are aminoacylated with their respective amino acid of interest. The tRNA charging reaction comprises the charging reaction mixture, an isoaccepting sense tRNA, and as used in this invention, may include either natural or non-native amino acids.
The present invention is a dual charging system because the isoaccepting sense tRNA is charged with either a native or non-native amino acid in a separate tRNA charging reaction. The present invention requires separate in vitro tRNA charging reactions for each respective isoaccepting sense tRNA, as different types of amino acids are desired to be added to a growing polypeptide chain at the first and second sense codons where only one native amino acid would normally be added.
The separate tRNA charging reaction can be any reaction that aminoacylates a sense tRNA molecule with a desired amino acid separate from the protein synthesis reaction. This reaction can take place in an extract, an artificial reaction mixture, or a combination of both.
Suitable tRNA aminoacylation reaction conditions are well known to those of ordinary skill in the art. Typically, tRNA aminoacylation is carried out in a physiological buffer with a pH value ranging from 6.5 to 8.5, 0.5-10 mM high energy phosphate (such as ATP), 5-200 mM MgCl2, 20-200 mM KCl. Preferably, the reaction is conducted in the presence of a reducing agent (such as 0-10 mM dithiothreitol). Where the aminoacyl-tRNA synthetase is exogenously added, the concentration of the synthetase is typically 1-100 nM. One skilled in the art would readily recognize that these conditions can be varied to optimize tRNA aminoacylation, such as high specificity for the pre-selected amino acids, high yields, and lowest cross-reactivity.
The reaction can be carried out in a temperature ranging from 4 to 40° C., or more preferably 20-37° C. Where the cell lysate is derived from a thermophilic bacteria, the reaction may be carried out in a higher temperature (e.g. 70° C.). Where a thermally unstable aminoacyl-tRNA synthetase is used, the reaction is preferably carried out in a lower temperature (e.g. 4° C.). The reaction temperature may also be varied to optimize tRNA aminoacylation.
In a preferred embodiment of the invention isoaccepting tRNAs are charged by aminoacyl-tRNA synthetases. In this embodiment, a first isoaccepting sense tRNA would be charged with the native amino acid in one tRNA charging reaction. A second isoaccepting tRNA that associates with a different codon sequence, but for the same amino acid as the codon for the first isoaccepting sense tRNA, would be charged with a non-native amino acid in a second tRNA charging reaction. The second tRNA charging reaction would proceed in a separate reaction vessel as the first tRNA charging reaction. Because the first and second tRNA charging reaction occur in separate reactions, the first and second isoaccepting sense tRNAs are not required to be charged using the same aminoacyl-tRNA synthetase.
The tRNA charging reactions can thus utilize either the native aminoacyl-tRNA synthetase specific to the isoaccepting sense tRNAs to be charged, an engineered aminoacyl-tRNA synthetase, or a “promiscuous” aminoacyl tRNA synthetase capable of charging a tRNA molecule with more than one type of amino acid. Promiscuous aminoacyl-tRNA synthetases may either themselves be engineered, or may include endogenously produced aminoacyl-tRNA synthetases that are sometimes found in nature.
The aminoacyl-tRNA synthetase utilized depends on the amino acid to be incorporated. For native amino acids, the charging reaction may use a native, engineered, or promiscuous aminoacyl-tRNA synthetase. For non-native amino acids, the charging reaction typically use either an engineered or promiscuous aminoacyl-tRNA synthetase. For efficiently charging a modified tRNA and/or a non-native amino acid, the aminoacyl-tRNA synthetase can be engineered to aminoacylate the modified tRNA with a non-native amino acid under conditions similar to native reaction conditions. Engineering tRNA/aminoacyl-tRNA synthetase pairs is discussed above. An example of engineered synthetases is Ala294→Gly Phe-RS, with the Ala294→Gly mutation at the active site of the synthetase. In some embodiments, an engineered synthetase allows the aminoacylation of a modified tRNA and/or a non-native amino acid under conditions similar to normal reaction conditions
Alternatively, a modified tRNA and/or a non-native amino acid can be charged under gently-denaturing reaction conditions, e.g., elevated pH, increased MgCl2 concentrations, the addition of detergents, DMSO, or spermidine. An example of such reaction conditions includes:100 mM Hepes pH 8.1, 75 mM MgCl2, 5 mM ATP, 40 mM KCl, 1.4 M DMSO, 0.1% Triton X-100, 10-100 μM tRNAphe, 5-20 mM p-acetyl-phenylalanine, and 1-10 μM Ala294→Gly Phe-RS. In some embodiments, a modified tRNA and/or a non-native amino acid can be charged under the gently-denaturing reaction conditions by a native aminoacyl-tRNA synthetase.
In some systems, the isoaccepting codons are serviced by the same tRNA, with the first codon perfectly matched by the tRNA and the second codon mismatched by wobble base-paring. In these systems, it is possible to have a modified tRNA that favors the second codon, i.e., perfectly matching the second codon.
Therefore, engineered tRNA/aminoacyl-tRNA synthetase pairs useful for the charging reaction further include a system utilizing a modified tRNA derived from a native tRNA. The native tRNA forms Watson-Crick base-pairing with a sense codon encoding a native amino acid, and forms wobble base-pairing with one or more wobble degenerate sense codon(s) encoding the same native amino acid. The modified tRNA according to the present invention comprises a modified anticodon sequence that forms Watson-Crick base-pairing with one of the wobble degenerate sense codon(s).
An aminoacyl-tRNA synthetase aminoacylates the modified tRNA with a non-native amino acid. In some embodiments, the modified tRNA is charged with a non-native amino acid by an engineered aminoacyl-tRNA synthetase. An example of engineered tRNA is an engineered E. coli phenylalanine tRNA in which the anticodon GAA has been modified to an anticodon AAA (see Kwon et al., JACS 125:7512-7513, 2003). An example of engineered aminoacyl-tRNA synthetase is a modified phenylalanine-tRNA synthetase, e.g., a Thr415Gly mutant. An example of non-native amino acids to be charged using the engineered tRNA/aminoacyl-tRNA synthetase pair is L-3-(2-naphthyl)alanine (Nal).
Other examples of engineered tRNAs include an asparagine tRNA in which the anticodon GUU has been modified to an anticodon AUU (GUU→AUU); a GCA→ACA cysteine tRNA; a UUC→CUC glutamine tRNA; a GUG→AUG histidine tRNA; a UUU→CUU lysine tRNA; an CGU→AGU threonine tRNA. Examples of non-native amino acids to be charged further include, e.g., fluro-glutamine and para-acetyl-phenylalanine
Following the aminoacylation of the isoaccepting sense tRNA in the separate charging reaction, the charged isoaccepting sense tRNA must be purified in order to add it to the cell-free protein synthesis reaction. This aspect of the invention requires the charged isoaccepting sense tRNA to be isolated from the aminoacyl-tRNA synthetase used in the tRNA charging reaction to ensure that the synthetases utilized for the charging reaction do not cross react with the tRNAs and/or amino acids in the protein synthesis reaction
Amino-acylated tRNA may be purified from unreacted tRNA and any aminoacyl-tRNA synthetase using elongation factor-Tu (Ef-Tu) from E. coli or T. thermophilis, immobilized on Sepharose 4B (GE Healthcare) see Derwnskus, Fischer, & Sprinzl, Anal. Biochem., 136, 161 (1984). Briefly, the immobilized protein is activated in the presence of GTP, pyruvate kinase, and phosphoenolpyruvate to generate immobilized Ef-Tu-GDP that specifically binds the amino-acylated tRNA. The column is washed in low ionic strength buffer (10 mM KCl; 50 mM HEPES; pH 7.4) and eluted in high salt buffer to yield purified amino-acylated tRNA.
Another embodiment charges an isoaccepting sense tRNA with a non-native amino acid using a ribozyme column that is capable of transferring an aminoacyl group from the 5′-OH of the ribozyme (after being charged by an oligonucleotide donor) to the 3′-OH of the tRNA molecule. Ribozymes currently employed in the art result in the ability to catalyze reactions between a broad spectrum of isoaccepting sense tRNAs and non-native amino acids, which is particularly useful for making isoaccepting sense tRNAs aminoacylated with non-native amino acids when using in vitro translation reactions. Ribozymes currently known in the art further enable efficient affinity purification of the aminoacylated products, examples of suitable substrates including agarose, sepharose, and magnetic beads. Such methods bypass the requirement for aminoacyl-tRNA synthetases in order for proper isoaccepting sense tRNA charging. Isoaccepting tRNAs that are aminoacylated using ribozymes can be accomplished in a variety of ways. One suitable method is to elute the aminoacylated isoaccepting tRNAs for a column with a buffer such as EDTA. See, e.g., Bessho et al., Nature Biotechnology 20:723-28 (2002); Lee et al., Nat. Struct. Biol. 20:1797-806 (2001).
tRNA molecules to be used in the tRNA charging reaction can be synthesized from a synthetic DNA template for any tRNA of choice following amplification by PCR in the presence of appropriate 5′ and 3′ primers. The resulting double-stranded DNA template, containing a T7-promoter sequence, can then be transcribed in vitro using T7 RNA polymerase to produce the tRNA molecule, which is subsequently added to the tRNA charging reaction.
The above described charged isoaccepting sense tRNAs associated with the first and second codons are now combined with the cell lysate along with the nucleic acid template for synthesis of the desired protein having non-native amino acids as preselected positions.
The reaction mixture will further comprise monomers for the macromolecule to be synthesized, e.g. amino acids, nucleotides, etc., and such co-factors, enzymes and other reagents that are necessary for the synthesis, e.g. ribosomes, tRNA, polymerases, transcriptional factors, etc. In addition to the above components such as a cell-free extract, genetic template, and amino acids, materials specifically required for protein synthesis may be added to the reaction. The materials include salts, folinic acid, cyclic AMP, inhibitors for protein or nucleic acid degrading enzymes, inhibitors or regulators of protein synthesis, adjusters of oxidation/reduction potentials, non-denaturing surfactants, buffer components, spermine, spermidine, putrescine, etc. Metabolic inhibitors to undesirable enzymatic activity may be added to the reaction mixture. Alternatively, enzymes or factors that are responsible for undesirable activity may be removed directly from the extract, or the gene encoding the undesirable enzyme may be inactivated or deleted from the chromosome.
The cell-free synthesis reaction may utilize a large scale reactor, small scale reactor, or may be multiplexed to perform a plurality of simultaneous syntheses. Continuous reactions will use a feed mechanism to introduce a flow of reagents, and may isolate the end-product as part of the process. Batch systems are also of interest, where additional reagents may be introduced to prolong the period of time for active synthesis. A reactor may be run in any mode such as batch, extended batch, semi-batch, semi-continuous, fed-batch and continuous, and which will be selected in accordance with the application purpose.
In embodiments wherein a DNA template is used to drive in vitro protein synthesis, the individual components of the protein synthesis reaction mixture may be mixed together in any convenient order. RNA polymerase is added to the reaction mixture to provide enhanced transcription of the DNA template. RNA polymerases suitable for use herein include any RNA polymerase that functions in the bacteria from which the bacterial extract is derived. In embodiments wherein an RNA template is used to drive in vitro protein synthesis, the components of the reaction mixture can be admixed together in any convenient order, but are preferably admixed in an order wherein the RNA template is added last.
The reaction mixture can be incubated at any temperature suitable for the transcription and/or translation reactions. The reaction mixture can be agitated or unagitated during incubation. The use of agitation enhances the speed and efficiency of protein synthesis by keeping the concentrations of reaction components uniform throughout and avoiding the formation of pockets with low rates of synthesis caused by the depletion of one or more key components. The reaction can be allowed to continue while protein synthesis occurs at an acceptable specific or volumetric rate, or until cessation of protein synthesis, as desired. The reaction can be conveniently stopped by incubating the reaction mixture on ice, or rapid dilution with water or an appropriate buffer. The reaction can be maintained as long as desired by continuous feeding of the limiting and non-reusable transcription and translation components.
Various cell-free synthesis reaction systems are well known in the art. See, e.g., Kim, D. M. and Swartz, J. R. Biotechnol. Bioeng. 66:180-8 (1999); Kim, D. M. and Swartz, J. R. Biotechnol. Prog. 16:385-90 (2000); Kim, D. M. and Swartz, J. R. Biotechnol. Bioeng. 74:309-16 (2001); Swartz et al., Methods Mol. Biol. 267:169-82 (2004); Kim, D. M. and Swartz, J. R. Biotechnol. Bioeng. 85:122-29 (2004); Jewett, M. C. and Swartz, J. R., Biotechnol. Bioeng. 86:19-26 (2004); Yin, G. and Swartz, J. R., Biotechnol. Bioeng. 86:188-95 (2004); Jewett, M. C. and Swartz, J. R., Biotechnol. Bioeng. 87:465-72 (2004); Voloshin, A. M. and Swartz, J. R., Biotechnol. Bioeng. 91:516-21 (2005).
Cell-free protein synthesis can exploit the catalytic power of the cellular machinery. Obtaining maximum protein yields in vitro requires adequate substrate supply, e.g. nucleoside triphosphates and amino acids, a homeostatic environment, catalyst stability, and the removal or avoidance of inhibitory byproducts. The optimization of in vitro synthetic reactions benefits from recreating the in vivo state of a rapidly growing organism. In some embodiments of the invention, cell-free synthesis is therefore performed in a reaction where oxidative phosphorylation is activated, i.e. the CYTOMIM™ system. The CYTOMIM™ system is defined by using a reaction condition in the absence of polyethylene glycol with optimized magnesium concentration. The CYTOMIM™ system does not accumulate phosphate, which is known to inhibit protein synthesis, whereas conventional secondary energy sources result in phosphate accumulation.
The concentration of magnesium in the reaction mixture affects the overall synthesis. There is often magnesium present in the cell lysate, which may then be adjusted with additional magnesium to optimize the concentration. The CYTOMIM™ system utilizes a preferred concentration of magnesium at least about 5 mM, usually at least about 10 mM, and preferably at least about 12 mM, and at a concentration of not more than about 20 mM, and usually not more than about 15 mM. Other changes that may enhance synthesis with respect to the CYTOMIM™ system is the removal of HEPES buffer and phosphoenol pyruvate from the reaction mixture. The CYTOMIM™ system is described in U.S. Pat. No. 7,338,789, herein incorporated by reference.
In some embodiments of the invention, cell-free synthesis is performed in a reaction where the redox conditions in the reaction mixture is optimized. This may include adding a redox buffer to the reaction mix in order to maintain the appropriate oxidizing environment for the formation of proper disulfide bonds, e.g. by the inclusion of glutathione at an appropriate ratio of oxidized to reduced forms. The reaction mixture may further be modified to decrease the activity of endogenous molecules that have reducing activity. Preferably such molecules can be chemically inactivated prior to cell-free protein synthesis, e.g. by treatment of the lysate with iodoacetamide (IAM), or other compounds that irreversibly inactivate free sulfhydryl groups. The presence of endogenous enzymes having reducing activity may be further diminished by the use of extracts prepared from genetically modified cells having inactivation mutations in such enzymes, for example thioredoxin reductase, glutathione reductase, etc. Alternatively, such enzymes can be removed by selective removal from the cell lysate during its preparation. Maximizing redox conditions is described in U.S. Pat. Nos. 6,548,276 and 7,041,479, herein incorporated by reference.
In some embodiments of the invention, cell-free synthesis is performed in a reaction where the optimal amino acid concentration is maintained by inhibiting enzymes that act to undesirably metabolize specific amino acids Inhibition of enzymes that catalyze the metabolism of amino acids can be achieved by addition of inhibitory compounds to the reaction mix, modification of the reaction mixture to decrease or eliminate the responsible enzyme activities, or a combination of both. A preferred embodiment eliminates arginine decarboxylase. Other such inhibitory compounds to be eliminated from the protein synthesis reaction mixture may include, but are not limited to, tryptophanase, alanine glutamate transaminase, or pyruvate oxidase. Eliminating enzymatic activity in order to optimize amino acid metabolism during cell-free protein synthesis is described in U.S. Pat. No. 6,994,986, herein incorporated by reference.
Following the in vitro synthesis reaction, synthesized proteins containing non-native amino acids can be purified as in standard in the art. Proteins of the invention can be recovered and purified by methods including, but not limited to, ammonium sulfate or ethanol precipitation, acid or base extraction, column chromatography, affinity column chromatography, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, hydroxylapatite chromatography, lectin chromatography, gel electrophoresis, etc. Newly synthesized proteins containing non-native amino acids must be correctly folded. Proper folding may be accomplished using high performance liquid chromatography (HPLC), affinity chromatography, or other suitable methods where high purity is desired. A variety of purification/protein folding methods are known in the art, e.g., Deutscher, Methods in Enzymology Vol. 182: Guide to Protein Purification (Academic Press, Inc. N.Y. 1990); Bollag et al., Protein Methods, 2nd Edition, (Wiley-Liss, N.Y. 1996).
Following purification, proteins containing non-native amino acids can possess a conformation different from the desired conformations of the relevant polypeptides. In general, it is occasionally desirable to denature and reduce expressed polypeptides and then to cause the polypeptides to re-fold into the preferred conformation. For example, guanidine, urea, DTT, DTE, and/or a chaperone can be added to a translation product of interest.
methods of reducing, denaturing and renaturing proteins are well known to those of skill in the art. See, e.g. Debinski et al., J. Biol. Chem. 268:14065-70 (1993); Buchner et al., Anal. Biochem. 205:263-70 (1992).
The methods of the present invention provide for modified proteins containing non-native amino acids that have biological activity comparable to the native protein. One may determine the specific activity of a protein in a composition by determining the level of activity in a functional assay, quantitating the amount of protein present in a non-functional assay, e.g. immunostaining, ELISA, quantitation on coomasie or silver stained gel, etc., and determining the ratio of biologically active protein to total protein. Generally, the specific activity as thus defined will be at least about 5% that of the native protein, usually at least about 10% that of the native protein, and may be about 25%, about 50%, about 90% or greater. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1989).
Following the in vitro synthesis reaction and subsequent purification, the desired protein containing the non-native amino acids may be optionally used e.g., as assay components, therapeutic reagents, or as immunogens for antibody production.
An embodiment of the current invention provides a cell-free synthesis reaction system. The reaction system comprises a first and second catalytic aminoacylating reagent reaction vessel that comprises a charging mixture of reagents that are able to aminoacylate each respective isoaccepting sense tRNA with its respective corresponding amino acid, such that different isoaccepting sense tRNAs are differentially charged with either a native or non-native amino acid as desired. The reaction system further has a reaction vessel that contains a cell lysate containing a mixture of reagents able to carry out a cell-free protein synthesis, in which the vessels described in the system have openings that permit the combining of the two charging mixtures and cell lysate into a single reaction mixture.
An embodiment of the current invention provides a kit for the in vitro synthesis of proteins having non-native amino acids introduced into preselected positions of the protein. The kit contains the reaction vessels with the appropriate reagents required for aminoacylating the isoaccepting sense tRNAs. The kit further has a reaction vessel that contains a cell lysate containing a mixture of regents able to carry out in vitro synthesis of proteins from a nucleic acids template. One embodiment utilizes aminoacyl-tRNA synthetases as the catalytic aminoacylating reagent. Another embodiment utilizes a ribozyme as the catalytic aminoacylating reagent. One embodiment contains a cell lysate derived from a bacterial population. Another embodiment contains a cell lysate derived from an E. coli population. Another embodiment provides a cell lysate that has a function oxidative phophorylation system.
All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference.
Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.
The following examples are provided by way of illustration only and not by way of limitation. Those of skill will readily recognize a variety of noncritical parameters which could be changed or modified to yield essentially similar results.
Standard methods in molecular biology are described (Maniatis et al. (1982) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Sambrook and Russell (2001) Molecular Cloning, 3yd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Wu (1993) Recombinant DNA, Vol. 217, Academic Press, San Diego, Calif.). Standard methods also appear in Bindereif, Schön, & Westhof (2005) Handbook of RNA Biochemistry, Wiley-VCH, Weinheim, Germany which describes detailed methods for RNA manipulation and analysis.
Methods for protein purification, chromatography, electrophoresis, centrifugation, and crystallization are described (Coligan et al. (2000) Current Protocols in Protein Science, Vol. 1, John Wiley and Sons, Inc., New York). Methods for cell-free synthesis are described in Spirin & Swartz (2008) Cell-free Protein Synthesis, Wiley-VCH, Weinheim, Germany. Methods for incorporation of non-native amino acids into proteins using cell-free synthesis are described in Shimizu et al (2006) FEBS Journal, 273, 4133-4140.
Isoaccepting tRNAs aminoacylated with non-native amino acids can be produced from a designed tRNA-HDV ribozyme template DNA, illustrated by example in FIG. 1, by in vitro transcription, followed by purification by size exclusion chromatography (SEC), enzymatic removal of the 2′,3′-cyclic phosphate, and charging of the tRNA with non-native amino acids (nnAAs) using engineered tRNA synthetase enzymes, as illustrated in FIG. 2. In order to optimize the transcription yield, four different in vitro transcription protocols were tested for the tRNA transcripts illustrated in FIG. 3 and FIG. 4. All four different in vitro transcription protocols gave similar tRNA yields. Transcription optimization was generally carried out for 2-3 h at 37° C. in 50 μL reactions. Reaction conditions were as follows: (1) 40 mM HEPES (pH 7.9), 10 mM DTT, 10 mM MgCl2, 2.5 mM spermidine, 4 U/ml pyrophosphatase, 0.4 U/ml supeRNAse-in (Ambion), 20 mM NaCl, 4 mM NTP, 0.024 mg/ml T7 RNA polymerase, 0.028 mg/ml plasmid DNA template. (2) 80 mM HEPES (pH 7.5), 5 mM DTT, 22 mM MgCl2, 1 mM Spermidine, 0.12 mg/ml Bovine Serum Albumin (BSA), 1 U/ml pyrophosphatase, 0.4 U/ml SupeRNAse-in, 3.75 mM NTPs, 0.024 mg/ml T7 RNA polymerase, 0.028 mg/ml plasmid DNA template (3) 30 mM HEPES (pH 7.9) 10 mM DTT, MgCl2, 2 mM Spermidine, 1 U/ml pyrophosphatase, 0.4 U/ml supeRNAse-in, 4 mM NTPs, 0.024 mg/ml T7 RNA polymerase, 0.028 mg/ml plasmid DNA template. (4) 40 mM HEPES (pH 8.0), 10 mM DTT, 46 mM MgCl2; 2 mM Spermidine, 0.4 U/ml supeRNAse-in, 10 mM NaCl, 3 mM NTP, 0.024 mg/ml T7 RNA polymerase, 0.028 mg/ml plasmid DNA template. In contrast to previous findings (Bindereif, Schon, & Westhof (2005)), we found that templates encoding for Uracil at position 1 or 2 of the tRNA (e.g. constructs 1 and 4) were not seriously defective for transcription by T7 RNA polymerase. As a result, the construct 1 tRNACUCGlu was preferred. The tRNA product produced using Protocol 1 was the most homogenous so this protocol was used for large-scale transcriptions with the exceptions noted below.
To produce large amounts of tRNACUAPhe, tRNAAAAPhe or tRNACUAGlu construct 1, 100 mL transcriptions were set up in certified RNAse free 50 ml conical tubes. For example, large scale reactions for tRNACUAGlu construct 1 contained 0.4 U/μL pyrophosphatase and 0.04 U/μL superRNAse-in were used. Transcription reactions were incubated for 2 hours at 37° C., supplemented with another 0.024 mg/ml T7 RNA polymerase and incubated for 2 more hours at 37° C., then filtered through 0.20 μm PES filters (VWR catalog #87006-062).
Typically, aliquots of 50 mL transcriptions were loaded onto a 2 L Sephacryl S-100 or S-300 size exclusion resin in XK50/100 columns using an AKTA with 50 mM Tris (pH 6.5), 250 mM NaCl, 0.1 mM EDTA to separate tRNA-2,3′ cyclic phosphate from precursor RNA transcripts and cleaved HDV ribozyme RNA (FIG. 5). 25 mL fractions were collected and tRNA peak fractions were determined by TBE/UREA PAGE gel electrophoresis. tRNA-2,3′ cyclic diphosphate was precipitated by adding 1/10 volume 3 M sodium acetate (pH 5.2) and an equal volume of isopropanol, followed by incubation for 30 minutes at −80° C., and pelleting tRNA by centrifugation (20,000×g for 30 min in a FiberLite F-13 rotor). Pellets were washed with 70% ethanol, air dried briefly, then resuspended in 1 mM sodium citrate buffer (pH 6.4).
Production of H. pylori tRNAUUGGln (2 ml) was carried out using Protocol 1. tRNA purification was performed with a 26/60 Sephacryl S-200 size exclusion column (FIGS. 2a and 2b). EDTA was omitted from the sizing column buffer. H. pylori tRNAGln was resuspended in 50 mM Tris (pH 8.5).
In the course of these experiments we found that (1) addition of 0.1 mM EDTA and (2) addition of RNAse inhibitor in the transcription reactions prevents degradation of RNA (compare lanes 1 and 2 of FIG. 6A), due presumably due to significant RNAse contamination in NTPs (Sigma Aldrich catalog #: U6625; G8877, C1506, A7600). As shown in FIG. 6B intact purified tRNAGlu incubated overnight at 37° C. with NTPs was completely degraded (lane 2), however, addition of RNAse inhibitor abrogated this degradation (lane 3). This degradation was unlikely due to simple metal dependent cleavage as addition of EDTA did not affect degradation lane (lane 4). (Incubation with EDTA alone produces no tRNA degradation (lane 5).) Second, we found in that in some cases, tRNA purified without EDTA in the sizing column buffer and without a chelating agent in the resuspension buffer was susceptible to damage/degradation in the presence reducing agents (FIG. 6C; compare lanes 1 and 2), perhaps due to heavy metal contamination of tRNAs as it can be abrogated with the addition of EDTA (lane 3).
T4 polynucleotide kinase (PNK), required for the removal of the 2′-3′ cyclic phosphate from tRNA cleaved by HDV ribozyme (cf. FIGS. 2 & 5), was produced as follows The PNK gene with an N-terminal 6-Histidine tag was gene synthesized (DNA 2.0, Menlo Park., Calif.), and cloned into plasmid pYD317. The plasmid T4PNK_pYD317 was used to transform BL21(DE3) cells. These cells were grown in a Braun 10 L fermenter on autoinduction media (Studier F. W. (2005) Protein Expr. Purif, 41:207-234) for 18 hours to a final OD of 21. Cells were harvested by centrifugation and to obtain 240 g of cell pellet. 40 g of cell pellet were resuspended in 500 ml Buffer A (50 mM Tris (pH 7.8), 300 mM KCl, 10 mM imidazole), lysed by homogenization, was clarified by centrifugation, and loaded onto a 35 mL Ni-IMAC column. The column was washed with 5 column volumes of Buffer A. Buffer A plus 0.5 mM BME, 300 mM imidazole, 0.1 μM ATP, and 10% glycerol (v/v) was used for elution. To prevent aggregation, PNK-containing fractions were immediately diluted 4× with Buffer A containing 20% glycerol. PNK-containing fractions were pooled and buffer exchanged into PNK storage buffer (20 mM Tris (pH 7.6), 100 mM KCl, 0.2 mM EDTA, 2 mM DTT, 50% glycerol) at a final concentration of 1.2 mg/mL.
tRNA-2′,3′-cyclic phosphate (40 μM) was incubated at 37° C. with 50 μg/ml PNK in 50 mM MES (pH 5.5), 10 mM MgCl2, 300 mM NaCl, and 0.1 mM EDTA for 1 hr leaving 2′,3′-OH groups at the 3′ terminus of the tRNA, followed by phenol:chloroform:isoamylalcohol extraction and buffer exchanged using a PD10 (GE health sciences) size exclusion column pre-equilibrated in 0.3 M sodium acetate (pH 5.2) to remove inorganic phosphate and excess phenol. tRNA was precipitated by addition of an equal volume isopropanol, incubation at −80° C. for 30 min, centrifuged for 30 min at 20,000×g, washed with 70% ethanol, centrifuged for 10 min at 20,000×g, air dried and resuspended in 0.1 mM sodium citrate (pH 6.4). tRNA was refolded by heating to 70° C., addition of 10 mM MgCl2, and then slowly cooled to room temperature. tRNA concentration was determined using a NanoDrop 1000 spectrophotometer (Thermo Scientific) with 1A260=40 μg/mL, and confirmed by TBE/urea gel electrophoresis. Yields of ˜2-10 mg of active, chargeable tRNA could be achieved from a 100 mL transcription reaction. H. pylori tRNAGln was prepared similarly using an earlier iteration of this protocol with the following differences: tRNA concentration was 8.6 μM; in PNK reactions, PNK concentration was 0.020 mg/ml, EDTA was omitted, and 1 mM β-mercaptoethanol was added. The tRNA was resuspended in DEPC treated sterile water after purification.
The extent of dephosphorylation was assayed by acid/urea gel electrophoresis and by phosphate release using a Malachite Green phosphate detection assay (R&D Systems, Inc). FIG. 7 shows that dephosphorylated tRNA has a reduced mobility in acid/urea gel electrophoresis (Bindereif, Schon, & Westhof (2005)). Aliquots containing 3 μg of dephosphorylated tRNA were diluted 2-fold in loading buffer (100 mM sodium acetate (pH 5.2), 7 M urea, 1 mg/ml bromophenol blue dye) and loaded on a 6.5% 19:1 acrylamide, 100 mM sodium acetate (pH 5.2), 7 M urea gel (40 cm×34 cm) and electrophoresed overnight at 40 W. Gels were stained using 0.06% methylene Blue, 0.5 M sodium acetate (pH 5.2) for 30 minutes and destained with deionized water. Both assays indicated essentially complete and quantitative dephosphorylation after 1 h.
The separate tRNA aminoacylation (charging) reactions illustrated by the last step in FIG. 2 require the use of an engineered aminoacyl-tRNA synthetase to aminoacylate isoaccepting tRNA molecules. This synthetase can be obtained by expressing a recombinant engineered synthetase as described in the examples below.
E. coli glutamyl-tRNA synthetase (GluRS) was cloned, expressed and purified by IMAC chromatography. The E. coli GluRS expression construct was transformed into BL21(DE3) cells. Colonies were inoculated into 2 ml LB broth supplemented with 100 μg/ml ampicillin (LB-AMP) and grown to saturation at 37° C. This culture was diluted into 100 ml LB-AMP and grown to saturation at 37° C. This entire culture was used to inoculate 10 L of autoinduction media (Studier (2005), Protein Expr Purif.; 41,207-34) supplemented with 100 μg/mlAmpicillin in a Bioflo 3000 fermentor. This culture was grown for 18 hours at 37° C. until it reached an OD of ˜12. Cells were harvested in Sharples centrifuge and frozen at −80° C. 30 g of cell pellet was resuspend in 500 ml of GluRS Lysis Buffer (50 mM sodium phosphate (pH 8.0), 300 mM NaCl, 10 mM imidazole, 10% glycerol) and lysed by passage through an Avestin C55A homogenizer. Lysate was clarified by centrifugation in a JA-17 (Beckman) rotor at 40,000×g for 30 min. The supernatant was passed over a 30 ml Ni2+ Sepharose 6 Fast Flow (GE Healthcare) column equilibrated in GluRS lysis buffer. The column was then washed with 15 column volumes of GluRS Wash Buffer (50 mM sodium phosphate pH 8.0; 300 mM sodium chloride; 20 mM imidazole; 10% glycerol), and eluted with 5 column volumes of GluRS Elution Buffer (50 mM sodium phosphate pH 8.0; 300 mM sodium chloride; 300 mM imidazole; 10% glycerol) as illustrated in FIG. 8a. Peak fractions were pooled, dialyzed twice into 2 L of 2× GluRS Storage Buffer (100 mM HEPES, pH 8.0; 40 mM sodium chloride; 1 mM dithiothreitol (DTT); 0.2 mM EDTA), and diluted 2-fold with 100% glycerol. Recovery was ˜945 mg GluRS from 30 g of cell pellet. Protein was stored at −80° C. for extended periods of time and −20° C. once thawed.
H. pylori GluRS2 (ND) (also termed a non-discriminating (ND) synthetase) was cloned, expressed, and purified by IMAC as follows. The H. pylori GluRS2 (ND) expression construct was transformed into BL21 (DE3) cells and plated on two LB-AMP plates at 37° C. The next morning 10 ml LB was added to the plates and they were then scrapped with a sterile pipet to resuspend all colonies. The resuspension was added to 2 L of LB-AMP and grown at 37° C. In keeping with previous work (Skouloubris, Ribas de Pouplana et al. (2003) Proc Natl Acad Sci USA, 100, 11297-302), to avoid incorporation of glutamate in GluRS2(ND)'s glutamine codons as a result of its own expression, overexpression was induced with 1 mM isopropyl β-D-thiogalactoside at OD600˜0.9 for only 30 min Cells were harvested by centrifugation at 4500 rpm for 30 min in a Sorvall RC-3B centrifuge, and frozen at −80° C. Cell pellet from 2 L of culture was resuspended in 25 ml lysis buffer (20 mM Tris, pH 8.5; 300 mM NaCl; 10% glycerol; 10 mM imidazole) supplemented with 250 μL bacterial protease inhibitor cocktail (Sigma). Cells were lysed by addition of lysozyme (to 1 mg/ml) and passage 10× through a 22 gauge blunt needle. Total lysate was clarified by centrifugation at 35,000×g for 30 min. Lysate was diluted 3× in lysis buffer then bound in batch mode for 10 minutes to 1 ml of IMAC High Performance Sepharose charged with NiSO4 and equilibrated in lysis buffer. The resin was washed with 10 column volumes of lysis buffer supplemented with 0.5 mM DTT, and then eluted 5× with 1 ml GluRS2 (ND) Elution Buffer (Lysis Buffer supplemented with 300 mM imidazole and 0.5 mM DTT) as illustrated in FIG. 8b. Peak fractions were concentrated by Vivaspin 10 kD MWCO ultrafiltration. Preliminary dialysis of concentrated protein into 40 mM HEPES, pH 7.2, 0.2 mM EDTA, 1 mM DTT resulted in GluRS2 (ND) precipitation. Sodium chloride was added to resolubilize and protein was instead dialyzed into GluRS2 (ND) Storage Buffer (20 mM Tris, pH 8.5; 300 mM NaCl; 10% glycerol; 0.5 mM DTT; 0.1 mM EDTA). Protein was stored in small aliquots at −80° C. ˜0.6 mg of GluRS2(ND) was recovered from the purification.
E. coli phenylalanyl-tRNA synthetase (PheRS) is an obligate dimer consisting of two subunits, PheS and PheT, as illustrated in FIG. 9a for the homologous enzyme from T. thermophilis. The mutation A294G was introduced in the E. coli PheS in order to increase the percent charging of non-native para-substituted phenylalanine analogs (Datta, Wang et al. (2002) J Am Chem Soc, 124, 5652-3) using a QuickChange Mutagenesis kit (Stratagene) and overlapping primers The resulting 6XHisPheS(A294G) gene was subcloned into pET21(a) using Nde I to Sal I restriction sites. This plasmid was used to transform BL21(DE3) competent cells. Cells were grown overnight in auto-induction media yielding PheS(A294G) subunit in inclusion bodies. Cells were lysed by homogenization and the inclusion bodies were pelleted by centrifugation, completely resuspended in 6 M guanidine, then diluted with PBS to a final concentration of 2 M guanidine-HCl. The PheT gene was amplified from E. coli genomic DNA using primers containing NdeI and XhoI restriction sites. The PCR fragment was subcloned into pET24(b), and expressed using the identical autoinduction media as PheS(A294G). In contrast to PheS(A294G), the expressed PheT subunit was soluble. Cells were lysed in Ni affinity purification load buffer: 50 mM NaPO4 buffer (pH 7.5), 300 mM NaCl, and 5 mM imidazole. The lysate was clarified, and then PheS(A294G) in 2 M guanidine-HCl was added slowly with stirring. Refolded PheRS was isolated by Ni affinity chromatography followed by size exclusion chromatography using an S100 size exclusion resin.
Alternatively, and more efficiently, PheRS(A294G) and variants in the anticodon recognition site of the PheT domain were produced by cell-free synthesis from independent PheS and PheT genes cloned into pYD317 as summarized in Table 1:
| TABLE 1 | ||
| PheT Variants in FIG. 10 | Corresponding Mutations | |
| PheT MP | R794M R788P | |
| PheT QP | R794Q R791P | |
| PheT AP | R794A A791P | |
| PheT K | R794K | |
| PheT KV | R794K A15V | |
The 3′ terminal adenosine nucleotide of tRNAs was exchanged with α-32P-AMP using E. coli CCA nucleotidyl transferase enzyme as described (Ledoux & Uhlenbeck (2008), Methods, 44, 74-80). Reaction conditions are driven toward removal of the 3′-AMP using excess PPi, and then toward addition of AMP using PPiase. Active tRNA was incubated with CCA enzyme in 50 mM Glycine pH 9.0, 10 mM MgCl2, 0.3 μM α-32P-ATP, 0.05 mM PPi for 5 min at 37° C. 1 μl of 10 μM CTP and 10 U/ml (1 Unit) of inorganic pyrophosphatase (yeast-Sigma) was added, and incubated for 2 min longer, then 1/10th volume of 3 M NaOAc pH 5.2 was added to each aliquot. The resulting 3′-end radiolabeled tRNA was diluted 1:5 with water and refolded prior to use.
Aminoacylation of nnAAs onto tRNAPhe was performed using optimized conditions. The conditions for wild-type tRNAGAAPhe aminoacylation were 50 mM Hepes pH 7.5, 40 mM KCl, 10 mM MgCl2, 5 mM ATP, 8-40 μM tRNAGAAPhe, 10 mM DTT, 10-100 mM amino acid (Phe or para-acetyl Phenylalanine (pAF)), and 1-100 μM PheRS or PheRS A294G. End labeled tRNA reactions are digested with P1 nuclease for 20-60 min at room temperature and 1 μl is spotted on a pre-washed (water) PEI cellulose TLC plate and allowed to air dry. AMP is resolved from aa-AMP in acetic acid/1M NH4Cl/ddH2O (5:10:85) as monitored by autoradiography using a Molecular Dynamics storage phosphor screen with a Storm 840 Phosphoimager (FIGS. 11 and 12). In contrast to the results shown in FIG. 11, Peterson and Uhlenbeck (Peterson and Uhlenbeck (1992) Biochemistry, 31, 10380-9) have shown that under limiting [ tRNACUAPhe], charging by phenylalanine is very inefficient.
The kinetics of tRNACUAPhe and tRNAAAAPhe aminoacylation with pAF were monitored in 50 mM Hepes pH 8.1, 40 mM KCl, 75 mM MgCl2, 5 mM ATP, 0.1% Triton X-100, 1.4 M DMSO, .025 U/μl Inorganic pyrophosphatase, 8-40 μM tRNACUAPhe or tRNAAAAPhe, 10 mM DTT, 10-100 mM pAF, and 1-100 μM PheRS or PheRS(A294G). FIG. 13 shows that pAF is efficiently charged to form pAF-tRNACUAPhe and pAF-tRNAAAAPhe under the conditions of this reaction.
We used high concentrations—18 μM each—of E.coli GluRS and tRNACUCGlu in the charging reactions. Normal charging conditions were: 10 μL reactions, 37° C. incubation for 30 min in 50 mM HEPES, pH 7.5; 10 mM MgCl2; 10 mM DTT; 10 mM ATP; 10 mM glutamic acid, pH 7.5; 10 U/ml pyrophosphatase; and 1 μL of [32P] end labeled tRNACUCGlu Reactions were quenched with 1 μL of 3 M sodium acetate. Encouragingly, with such high concentrations of tRNA and GluRS, we found that mutant tRNACUCGlu could be charged with cognate glutamate to 75% even with normal buffer conditions (FIG. 14a, lane 2). By changing the reaction pH to 8.1 and increasing Mg2+ concentrations to 70 mM charging increased slightly to 77%. Further addition of dimethyl sulfoxide (DMSO) to 2.5 M and Tween-20 to 0.25% resulted in an additional increase to 84% charging (FIG. 14a, lane 4). Fluoro substituted glutamate charging onto wild type tRNAGlu could not be detected under the conditions of this assay (FIG. 14a, lane 5), due to the poor separation of fluoro substituted glutamate-AMP and AMP in the thin layer chromatography (Hartman, Josephson et al. (2007) PLoS ONE, 2, e972).
We also confirmed the activity of the purified H. pylori GluRS2(ND) (1.9 μM) using, H. pylori tRNAGln 3.4 μM, pyrophosphatase 50 U/ml and 0.5 μL of [32P] end labeled H. pylori tRNAGln was included in each reaction. Similarly, no charging of mono-fluoro substituted glutamate was observed using this assay (FIG. 14b)
Non-radiolabledtRNAGAAPhe tRNACUAPhe, and tRNAAAAPhe were aminoacylated in 50 mM Hepes pH 7.5, 40 mM KCl, 10 mM MgCl2, 5 mM ATP, 8-40 μM tRNAGAAPhe, 10 mM DTT, 10-100 mM amino acid (Phe or pAF), and 1-100 μM PheRS or PheRS A294G. The conditions for tRNACUAPhe and tRNAAAAPhe aminoacylation were 50 mM Hepes pH 8.1, 40 mM KCl, 75 mM MgCl2, 5 mM ATP, 0.1% Triton X-100,1.4 M DMSO, 8-40 μM tRNAAAAPhe or tRNACUAPhe, 10 mM DTT, 10-100 mM pAF , and 1-100 μM PheRS or PheRS A294G. Reactions are incubated at 37° C. for 15 min and quenched with 2.5 volumes of 300 mM sodium acetate pH 5.5. The quenched sample was extracted with 25:24:1 phenol:chloroform:isoamyl alcohol pH 5.2 (Ambion), vortexed for 2 min, then centrifuged at 14,000×g for 10-30 min at 4° C. to separate the aqueous (tRNA) and organic phases (protein). The aqueous phase (containing charged tRNA) was removed and added to a pre-equilibrated (300 mM NaOAc) G25 sephadex resin size exclusion column that separates based on the size of the molecule. The eluant was mixed with 2.5 volumes of 100% ethanol and incubated at −80° C. for 15-30 minutes and centrifuged at ˜14,000×g for 30-45 minutes. The pelleted aminoacylated tRNA is stored at −80° C. or resuspended in a slightly acidic buffer for injection into the HPLC and/or use in cell-free synthesis reactions.
Aminoacylation of non-radiolabeled tRNAGAAPhe, tRNACUAPhe, and tRNAAAAPhe monitored by HPLC hydrophobic interaction chromatography (HIC) that resolved the aminoacylated and unaminoacylated moieties of tRNA as shown in FIG. 15 & FIG. 16. The HPLC C5 column was equilibrated in buffer A (50 mM potassium phosphate and 1.5 M ammonium sulfate pH 5.7), then 1-10 μg of pelleted aminoacylated tRNA mixed with 100 μl of 2× buffer A was injected and separated with a gradient from buffer A to buffer B (50 mM potassium phosphate and 5% isopropanol) over 50 minutes. The fraction of aminoacylated tRNA determined by peak area showed good agreement with the fraction determined using [32P]-end labeled tRNA as in FIG. 13 for reactions run under the same conditions.
Alternatively, tRNACACGln charged using E. coli GluRS to aminoacylate with mono-fluoroglutamate or pAF-tRNACACPhe and tRNAGAAPhe (FIG. 15) were separated using acid/urea polyacrylamide 40 cm×34 cm gel electrophoresis. For charging tRNACACGlu reaction conditions were: 12.5 μL reactions, 37° C. incubation for 30 minutes in 50 mM HEPES, pH 8.1; 70 mM MgCl2; 10 mM DTT; 10 mM ATP; 10 mM amino acid, pH 8.1; 16.6 U/ml pyrophosphatase. (To assure absence of RNAse in charging reactions, prior to tRNA addition the buffer was ultrafiltered through a 3000 Dalton molecular weight cut-off membrane (Microsep 3K Omega; Pall lifesciences). Reactions were quenched with 1.25 μL of 3M sodium acetate, diluted 2-fold in loading buffer (100 mM sodium acetate pH 5.2; 7 M urea; 1 mg/ml bromophenol blue dye) and loaded on 6.5% 19:1 acrylamide; 100 mM sodium acetate, pH 5.2; 7 M urea gels and electrophoresed overnight at 40 W. Gels were stained using 0.18% Methylene Blue, 0.5 M sodium acetate, pH 5.2 for 30 minutes and destained with deionized water. Charging of wild type tRNAGlu (Chemical Block, Moscow, Russia) or in vitro transcribed tRNACUCGlu with cognate glutamate or non-native fluoroglutamate could be observed up to 70% (FIG. 17).
Cell-free extracts or lysates were generated to maximize ribosome yield using rapid growth of high cell density fermentations of E. coli strain KGK10 (Knapp, Goerke et al. (2007) Biotechnol Bioeng, 97, 901-8), essentially as described by Liu et al.(Liu, Zawada et al. (2005) Biotechnol Prog, 21, 460-5) DL-dithiothreitol was not added to the cell lysate following homogenization. A modified “run-off procedure” was used to prepare the cell-free extract. Fermentation volume to generate sufficient cell-free extract was typically 2.5× the desired cell-free reaction volume. To inactivate the reducing activity of the cell extract, iodoacetamide (IAM) at various concentrations was added as previously described (Yang, Kanter et al. (2004) Biotechnol Prog, 20, 1689-96). Gene expression was under the control of the T7 promoter. In order to facilitate translation initiation, genes were synthesized (DNA 2.0, Menlo Park, Calif.) with synonymous codons at the 5′ end of the gene with ATG start codon (N-terminal methionine residue) optimized for mRNA instability as measured by mRNA ΔGfold in the −6 to +37 positions (Kudla, Murray et al. (2009) Science, 324, 255-258) and rare codons were replaced.
Cell-free reactions were run at 30° C. containing 8 mM magnesium glutamate, 10 mM ammonium glutamate, 130 mM potassium glutamate, 35 mM sodium pyruvate, 1.2 mM AMP, 0.86 mM each of GMP, UMP, & CMP, 2 mM amino acids (1 mM for tyrosine), 4 mM sodium oxalate, 1 mM putrescine, 1.5 mM spermidine, 15 mM potassium phosphate, 100 nM T7 RNA polymerase, 2-50 nM DNA template(s), 1-10 μM E. coli DsbC, and 24-30% (v/v) IAM-treated cell-free extract. The redox potential was manipulated by the addition of reduced (GSH) and oxidized (GSSG) glutathione to a total concentration of ˜5 mM. The initial redox potential was calculated using the Nernst equation with E0=−205 mV as the standard potential of the GSH/GSSG couple at 30° C. and pH 7 (Wunderlich and Glockshuber (1993) Protein Science, 2, 717-726).
GMCSF was expressed in the cell-free protein synthesis system at 30° C. for 6 hours. FIG. 18 illustrates how the concentration of added amino acids, Lys and Phe, but not Glu, may be manipulated in the cell-free reaction to affect protein synthesis.
The genomic copy of glutamate-tRNA synthetase (gltX) was tagged with a C-terminal FLAG-tag in order to remove the synthetase activity using FLAG-tag affinity chromatography while maintaining the enzyme activity for preparation of the cell-extract prepared from E. coli KGK10. Gene insertion was carried out using Quick &Easy E.coli Gene Deletion Kit (Cat. No. K006) from GENE BRIDGES (Heidelberg, Germany) according to the protocol suggested by the manufacturer. A 708-FLPecmR expression plasmid (A105, GENE BRIDGES) was used to eliminate the selection marker from E. coli chromosome. The DNA insertion cassette was amplified by PCR extension using AccuPrime pfx SuperMix (Invitrogen) according to the protocol suggested by the manufacturer. DNA template was FTR-PGK-gb2-neo-FRT template DNA from Quick &Easy E.coli Gene Deletion Kit. Primers included:
| 5′GCGTATCAACAAAGCGCTGGATTTTATTGCTGAACGCGAAAATCAGCA |
| GGGTGGCGACTACAAAGATGACGATGACAAATAAAATTAACCCTCACTAA |
| AGGGCGG3′ |
| and |
| 5′AGGGATTATCGGATTGTTACAACGCTTAGGGATTCGCGATAGCAAATA |
| ATTAATACGACTCACTATAGGGCTCG3′ |
PCR fragments were purified with QIAGEN DNA purification kit before transforming E. coli KGK10 by electroporation. The DNA fragment including 3′ end and downstream of gltX was amplified from chromosome DNA of KGK10ΔgltX::gltX-Flag using primers 5′GTTCAACACCGACAAGCTGCTGTGGCTG3′ and 5′ GCGGGAAGGGATTATCGGATTGTTACAACGC3′. Flag-tag encoding sequence was confirmed by using a primer, 5′GATTACTGACTGGACCGCTG3′. First, primers were designed for PCR amplification the DNA fragment containing the Flag-tag encoding sequence at 3′end of gltX. The Flag-tag sequence DYKDDDDK was connected to the C-terminus of glutamate-tRNA synthetase through a dipeptide GG. The tag peptide sequence was back translated to DNA sequence, 5′GGGTGGCGACTACAAAGATGACGATGACAAA3′. A stop codon TAA was added just behind the FLAG-tag encoding sequence. The forward primer included a 50 Nt homology sequence that encoded the C-terminus of glutamate—tRNA synthetase (GluRS) at 5′end, the Flag-tag sequence in the middle, and the amplifying sequence AATTAACCCTCACTAAAGGGCGG at the 3′end. The backward primer was designed by connecting the amplifying sequence TAATACGACTCACTATAGGGCTCG to a 50 Nt homology sequence which is located downstream of gltX gene. Second, the linear fragment for FLAG-tag sequence insertion was amplified and transformed into KGK10 to replace a 441 by sequence downstream of gltX. Flag-tag insertion mutants were selected by kanamycin resistance marker which was inserted to the genomic DNA of KGK10. Then, the kanamycin resistance marker for selection was eliminated using 708-FLPecmR expression plasmid . Finally, the FLAG-tag encoding sequence was confirmed by sequencing the PCR fragment which was amplified from the mutant KGK10ΔgltX::gltX-Flag. A DNA sequence, 5′GGGTGGCGACTACAAAGATGACGATGACAAA3′, was attached to the 3′ end of the gltX gene in the KGK10 chromosome. This fragment encodes the amino acid sequence GGDYKDDDDK, two Gly residues and a FLAG-tag. Removal of the FLAG-tagged GluRS protein from the cell-free extract is achieved by passing the extract over anti-FLAG M2 magnetic beads (Sigma cat # M8823) and removing the beads.
FIG. 19 illustrates how the reactivity of added isoaccepting charged nnAA-tRNAs added to the cell-free reaction can be modulated using active site directed inhibitors to limit the background recharging of the added isoaccepting tRNA.
The 5′-O-[N-(aminoacyl)sulfamoyl] adenosine inhibitor Phe-SA (FIG. 19b) was synthesized as follows: to a solution of alcohol (7 g, 17.03 mmol, 1.0 eq) in DMAC (70 mL) at 0° C. was added DIEA (10.62 mL, 59.61 mmol, 4.0 eq) and sulfamoyl chloride (4 eq) and the reaction mixture was stirred at room temperature for 15 h. The reaction mixture was diluted with ethyl acetate (300 mL) and washed with water (4×50 mL). The organic layer was dried over MgSO4, evaporated and purified by column chromatography (DCM to 20% MeOH in DCM) to give the activated sulfamate (4.5 g, 9.18 mmol, 54% yield) To a solution of sulfamate (2.0 g, 4.07 mmole, 1 eq), DCC (0.841 g, 4.07 mmol, 1 eq), DMAP (050 g, 4.07 mmol, 1.0 eq) in DCM (45 mL) was added Boc-Phe-OH (1.1 g, 4.07 mmol, 1 eq) and the reaction mixture was stirred at room temperature for 10 h. The reaction mixture was diluted with ethyl acetate (450 mL), washed with saturated aqueous NaHCO3, water, brine, dried over MgSO4, and evaporated. The crude product was dissolved in MeOH/n-butylamine (30mL/30mL) and stirred at room temperature for 3 h. The solvents were evaporated and the crude product was purified by flash chromatography (EtOAc to 10% MeOH/EtOAc) to give the Phe-SA inhibitor (0.90 g, 1.4 mmol, 35% yield)
The effects of 5′-O-[N-(aminoacyl)sulfamoyl] adenosine inhibitors (Phe-SA and Glu-SA) in cell-free synthesis of a GFP reporter protein, turboGFP are illustrated in FIG. 19c. Cell-free synthesis reactions at 30° C. were monitored by fluorescence (λEx=476 nm and λEm=490 nm). with an adhesive cover (VWR, 9503130) in a Molecular Devices SpectraMaxM5 plate reader for 5 h. Aminoacyl synthetase inhibitors Phe-SA and Glu-SA (Integrated DNA Technologies, Iowa) were serially diluted 3-fold in DEPC-water from stock solutions in TE buffer (Invitrogen, 12090) and transferred to a 96-well V-bottom polypropylene plate (Greiner Bio-One, 651207). The cell-free reaction mix was immediately added to the microplate with inhibitor for a 25 μL final reaction volume. The maximal rate of fluorescence change (V0 (RFU/sec)=no inhibitor, V=in the presence of inhibitor) were determined and the percent relative activity determined as a function of added inhibitor concentration as shown. Importantly, these inhibitors are competitively specific to their respective aminoacyl tRNA synthetases (PheRS and GluRS), as turboGFP fluorescence activity in the presence of 1 nM Phe-SA inhibitor (˜50% activity) can be completely restored with the addition of >10 μM PheRS(A294G) as shown in FIG. 20. Surface response analysis of GFP activity as a function of varying both [Phe-SA] and added L-phenylalanine is consistent with the competitive and specific nature of the Phe-SA inhibition.
FIG. 21 illustrates the features required for efficient dual-charging of isoaccepting tRNAs that requires removal (or inhibition) of a native, endogenous tRNA synthetase, followed by the addition of specific isoaccepting engineered charged tRNAs for efficient incorporation of nnAAs into proteins. Here, the potential recharging of exogenously introduced tRNAs can be overcome if the synthetase(s) responsible for regenerating the aminoacyl-tRNA moiety are removed (cf example 8) or inhibited (cf example 9).
To control and optimize the cell-free synthesis of proteins containing non-native amino acids (nnAAs) we aimed to establish a quantitative framework that describes the kinetics and thermodynamics of individual steps in the overall process (cf FIG. 19a). Such a framework provides insights into the functions and mechanisms of each participant in the process and serves as a foundation for in-depth analyses and optimization of the cell-free incorporation of nnAAs into proteins.
We constructed and analyzed a minimal kinetic model (cf FIG. 19) based on the cell-free synthesis of the green fluorescent protein from Anthropoda, turboGFP (Evdokimov, Pokross et al. (2006) EMBO Rep, 7, 1006-12). An amber (UAG) codon was introduced at position 50 in the protein sequence, yielding plasmid turboGFP Y50TAG (FIG. 22). In the absence of added suppressor tRNA, only the expected 6 kD truncated protein is synthesized from this plasmid.
The kinetics of the cell-free synthesis of fluorescent turboGFP in microtiter plate format were monitored by fluorescence (λEx=476 nm and λEm=510 nm) with an adhesive cover (VWR, 9503130) in a Molecular Devices SpectraMax M5 plate reader for up to 5 h in a volume of 25 μl per well. FIG. 23 shows that the reference pYD317-turboGFP plasmid yields a strong fluorescent signal after 5 h of synthesis. A control reaction containing turboGFP Y50TAG plasmid only yields no fluorescence, consistent with the ca. 6 kD truncated product (cf FIG. 22). The incorporation of para-acetyl phenylalanine at position 50 using the UAG-specific E. coli phenylalanine tRNACUAPhe and tRNAGAAPhe was measured in the presence 12 nM Phe-SA inhibitor, to inhibit the endogenous activity of PheRS (cf. FIG. 19c). No protein was synthesized when uncharged tRNACUAPhe and tRNAGAAPhe were added under these conditions, showing that a) none of the other 19 aaRS can react with these tRNAs (FIG. 24) and b) PheRS is completely inhibited under these conditions. Also, addition of a single charged Phe-tRNAGAAPhe does not result in protein synthesis, showing that this tRNA is specific only for TTC or TTT codons. In contrast, addition of various concentrations of both charged pAF-tRNACUAPhe and Phe-tRNAGAAPhe results in 13-20% of the wild-type fluorescence after 5 h, consistent with significant protein synthesis with incorporation of pAF at position 50. As the [Phe-tRNAGAAPhe] was increased, the total fluorescence increased to up to ˜20% of the positive control expression, suggesting there is an optimal concentration of Phe-tRNAGAAPhe for achieving high nnAA-protein yield. These results suggest that the acylated tRNAs are stable and are effectively delivered to the ribosome (FIG. 24) during the time course of the cell-free reaction.
The present invention requires the use of a nucleic acid template for the cell-free protein synthesis reaction. The following provides an example of generating a template having codon sequences constructed based on placement of non-native amino acids within the desired polypeptide.
An amino acid sequence of human granulocyte macrophage colony stimulating factor (hGMCSF) is obtained from Research Collaboratory for Structural Bioinformatics (RCSB) protein data bank (PDB). A structural DNA gene encoding hGMCSF protein is synthesized de novo (DNA 2.0, Menlo Park, Calif.) such that all, but the second, glutamine amino-acid residues are encoded by the first codon CAA. The second glutamine from the N-terminus of the protein is encoded by the codon CAG. The gene is flanked by the T7 promoter and terminator and is inserted into a plasmid vector containing an E. coli origin of replication and kanamycin resistance gene. The circular plasmid DNA template is prepared by transforming XL1Blue (Stratagene, La Jolla, Calif.) strain of E. coli, growing up the culture at 37° C. overnight and purifying DNA using a purification kit (Qiagen, Valencia, Calif.).
A lysate must be generated that will be useful for expressing proteins containing non-native amino acids. This example demonstrates the generation of a lysate from E. coli that is modified such that a native aminoacyl-tRNA synthetase is expressed with a 6Xhis-tag useful for depleting said synthetase as described in subsequent examples.
E. coli A19ΔendAΔtonAΔspeAΔtnaAΔsdaAΔsdaBΔgshAΔgorTrxBHAmet+ is first modified such that a DNA fragment encoding 6Xhis-tag is appended to the native Gln-RS at the C-terminal end in the E. coli chromosome.
E. coli cells are then grown in a 10 L Braun Biostat C fermentor. The cells are grown on 2YPTG media in batch mode with pH control at pH 7.0. The cells are harvested at 3.2 OD (595) at growth rate of >0.7 per hour. Cells are separated from the media by centrifugation at 6000 g, 4° C. for 25 min and the resulting cell paste is stored at −80° C. The cell paste is thawed at 4° C. in S30 buffer (10mM TRIS-acetate pH 8.2 (Sigma-Aldrich Corp. St. Louis, Mo.), 14 mM magnesium acetate (Sigma-Aldrich), and 60 mM potassium acetate (Sigma-Aldrich)) at a ratio of 1 mL of buffer per 1 g of wet cell paste. Resuspended cells are passed through a high pressure homogenizer (Emulsiflex C-50, Avestin Inc., Ottawa, Ontario, Canada). The pressure drop is set at 20000 psi. The homogenized mixture is then centrifuged at 30000 g, 4° C. for 30 minutes. The procedure is repeated twice and the supernatant is retained both times. The mixture is incubated at 37° C. for 80 min in a rotary shaker. After the incubation, the extract is dialyzed with 10 diavolumes of S30 buffer at 4° C. using tangential flow filtration across 5000 MWCO membrane (Millipore, Billerica, Mass.).
The present invention requires inactivation of an endogenous aminoacyl-tRNA synthetase. The purpose of this inactivation is to prevent uncharged isoaccepting tRNAs that would normally have been charged with a non-native amino acids from being mis-aminoacylated with native amino acids.
Endogenous tRNA synthetase expression can be reduced by inactivating or “knocking out” tRNA synthetase nucleic acid sequence(s) or their promoters using targeted homologous recombination of genomic DNA (e.g., see Smithies et al., Nature 317: 230-234 (1985); Thomas and Capecchi, Cell 51: 503-512 (1987); Zhang et al., Nature Biotech 18:1314-1318 (2000)). For example, a mutant, non-functional tRNA synthetase (or a completely unrelated DNA sequence) flanked by DNA homologous to the endogenous tRNA synthetase (either the coding regions or regulatory regions of seryl tRNA synthetase) can be used, with or without a selectable marker and/or a negative selectable marker, to transform cells that express the endogenous tRNA synthetase. Insertion of the DNA construct, via targeted homologous recombination, results in inactivation of the tRNA synthetase.
Targeted homologous recombination can be used to insert a DNA construct comprising a mutant tagged tRNA synthetase in the cell, as described above. In another embodiment, targeted homologous recombination can be used to insert a DNA construct comprising a nucleic acid that encodes a tRNA synthetase polypeptide variant that differs from that present in the cell.
Alternatively, endogenous tRNA synthetase expression can be reduced by targeting deoxyribonucleotide sequences complementary to the regulatory region of a tRNA synthetase gene (i.e. promoter and/or enhancers) to form triple helical structures that prevent transcription of the tRNA synthetase in target cells.
The endogenous aminoacyl-tRNA synthetase in the E. coli extract above may be deactivated by addition of micromolar concentration of 5¢-O-[N-(Phenyalanylacyl)sulfamoyl] adenosine during the pretreatment with iodoacetamide, prior to addition of the template DNA as described above.
To remove a chromosomally integrated native 6Xhis-tag tRNA synthetase as described in Example 2, a volume of the appropriately engineered S30 extract is incubated with varying volumes of pre-equilibrated Ni-NTA magnetic beads (20 mM Tris-HCl, 0.1 M NaCl at pH 7.5) before use for 30 min at 4° C. After removing the beads with the help of a magnetic separator, the remaining extract is used for protein synthesis.
The separate tRNA charging reactions require the use of an aminoacyl-tRNA synthetase to aminoacylate isoaccepting tRNA molecules. This synthetase can be obtained by expressing a recombinant synthetase as described in this example.
The structural gene for E. coli gln-tRNA synthetase is PCR-amplified from E coli genomic DNA (ATCC #10798D-5) using the forward and reverse primers as shown in Table 2. PCR products are then cloned into pET23b vector (Novagen, Gibbstown, N.J.) after a double digestion with NdeI and HindIII to generate plasmids, pET23b-GlnRSH (histidine-tagged) and pET23b-GlnRS. The resulting plasmids contain Gln-RS sequences with or without 6xhistidine-tag under the control of a T7 promoter for over-expression.
| TABLE 2 |
| Primers used for the construction of each |
| type of expression vector |
| Name | Type | Sequence |
| GlnRSH |
| Forward | 5′-AAAAAACATATGAGTGAGGCAG-3′ | |
| primer | (SEQ ID NO: 1) | |
| Reverse | C- | 5′-AAAAAAAAGCTTCTCGCCTACTTTC-3′ |
| primer | terminal | (SEQ ID NO: 2) |
| His | ||
| tag | ||
| GlnRS | ||
| Forward | Wild | 5′-AAAAAACATATGAGTGAGGCAG-3′ |
| primer | type | (SEQ ID NO: 3) |
| Reverse | 5′-AAAAAAAAGCTTTTACTCGCCTACTTTC-3′ | |
| primer | (SEQ ID NO: 4) | |
| Sequences of the restriction sites are underlined. The stop codon is shown in boldface letters. |
GlnRS overproducer plasmid (pET23b-GlnRSH) is transformed into chemically competent BL-21 cells (Promega; Madison, Wis.) and plated on LB/carbenicillin plates. A single colony is grown overnight in TB/100 ug/mL carbenicillin and then used to inoculate a large culture at 1:50 dilution. The cells are grown in rich media to mid-log phase at 37° C. before induction with 1 mM IPTG for 5 h. All subsequent purification steps are carried out at 4° C. Crude cell extracts are prepared by centrifugation at 5000 g, followed by cell-lysis under high pressure. The extracts are mixed with 5 mL of Ni-NTA resin that has been preequilibrated in lysis buffer. After a 1 h incubation of the protein on ice to allow binding to the resin, this mixture is poured into a 10 mL column. Weakly bound proteins are removed with wash buffer (50 mM potassium phosphate, pH 6.0, 300 mM NaCl, 10 mM β-mercaptoethanol, 10% glycerol) until the A280 of the eluate drops below 0.1. The protein is eluted with a gradient of 0-0.5 M imidazole in wash buffer. Peak fractions identified by activity or SDS-PAGE are pooled together and dialyzed against buffer containing 50 mM potassium phosphate, pH 7.0, 100 mM KCl, and 10 mM β-mercaptoethanol at 4° C. overnight. Protein is then concentrated to a final concentration of 10 mg/mL in 40% glycerol and then stored at −20° C.
Non-native amino acids cannot usually be charged to isoaccepting sense tRNA molecules by naturally occurring aminoacyl-tRNA synthetases. In some instances, “promiscuous” aminoacyl-tRNA synthetases may previously exist that have the capability to charge isoaccepting tRNAs with non-native amino acids. In other instances wherein no aminoacyl-tRNA synthetases exist with such capability, new aminoacyl-tRNA synthetases must be engineered such that the desired non-native amino acid can be charged to a tRNA molecule in the separate tRNA charging reaction.
Active site residues of a thermostable tRNA synthetases known to be involved in substrate recognition are identified using Pymol molecular viewing software. Residues within 5-10 Å of the amino acid side chain are identified. A 2×20 amino acid=400 member ‘library’ of site directed variants corresponding to the indentified residues is constructed as follows. A cassette library of 35-mer oligonucleotides, representing sense or antisense strands coding for the amino acids on each side of the codons are synthesized (Operon, Huntsville, Ala.) with NNK (where N=G,A,T,C and K=G or T nucleoside triphosphates). Using the Quickchange Multisite mutagenesis protocol (Stratagene, La Jolla, Calif.), the pooled oligos are annealed to template DNA, amplified by DNA polymerase, plasmid template is degraded with Dpnl, and the library is transformed and plated. Ninety-six clones are sequenced to confirm the diversity of the library.
High throughput expression of variants as described in Example 5 is conducted in a 96-well format as follows. Plated colonies are transferred by sterile toothpicks to 96-well deep well plates and grown in rich medium to OD600=0.5 followed by induction with 1 mM IPTG and overnight growth. The purification is carried out in 96-well format using Millipore
Multiscreen filtration plates (Millipore Corp.). Cells are harvested & lysed, the lysate diluted with 4× volume of PBS buffer, and 200 μL is loaded onto Ni-chelating sepharose media in the Multiscreen plate. Enzyme elutions are optimized using increasing concentrations of imidazole. The filtrate is filtered by vacuum filtration and high yields of pure recombinant protein are produced.
The enzyme activity of each variant is assayed using radiolabeled non-native amino acids by a discontinuous steady state assay that monitors the formation of [3H]-labeled nnAA-tRNAnnAA at 37° C. in 50 mM Tris-HCl (or Hepes) pH 7.5, 20 mM KCl1, 4 mM DTT, 10 mM MgCl2, 0.2 mg/ml bovine serum albumin, and a range of amino acid, ATP, and tRNA concentrations. The activities are normalized for the enzyme concentration independently determined by fluorescence using a coupled enzyme assay that measures released pyrophosphate.
GalNAc L-Threonine is an example of a non-native amino acid, which is synthesized from commercially available GalNAc L-Threonine (N-Fmoc-O-(2-acetamido-3,4,6-tri-O-acetyl-2-deoxy-α-D-galactopyranosyl)-L-threonine (V-Labs, Inc., Covington, La.). This synthesis occurs by selective deprotection of the Fmoc group with piperidine in dichloromethane to give the free amino acid followed by selective enzymatic hydrolysis of the carbohydrate acetates using lipase WG (The sample is purified using reversed phase HPLC).
The present invention requires the charging of isoaccepting sense tRNAs with either native or non-native amino acids in a charging reaction separate from the protein synthesis reaction.
tRNA Synthetic DNA oligonucleotides (Integrated DNA Technologies, Inc., Coralville, Iowa) are designed such that the sense strand corresponding to the 5′ end of the sequence possesses a 10-bp overlap with the 3′ antisense strand. The oligonucleotides used for construction of the E. coli tRNA2 Gln gene are: 5′-AAT TCCTGCAGTAATACGACTCACTATAGGGGGTATCGCCA AGCGGTAAGGCACCGG-3′ (SEQ ID NO:5); 5′-mTmGGCTGGGGTACGAGATTCGAACCTCGGAATGCCGGAATCAGAATCCGGTG CCTT-3′ (SEQ ID NO:6), where mT and mG represent the 5′-O-methyl nucleotides and the underlined portions represent the overlapped region. Bold type indicates the T7 RNA polymerase promoter. Oligonucleotides are mixed to an equimolar concentration of 4 mM in a reaction solution containing 400 mM dNTPs, 10 mM Tris-HCl, pH 7.5, 10 mM MgSO4, 7.5 mM DTT, and 50 U/mL Klenow fragment polymerase (Promega). The mixture is cycled between 10° C. and 37° C. at 30 s intervals for eight cycles, after which the DNA is precipitated in 65% ethanol/0.3 M sodium acetate, pelleted, and resuspended in 100 mL PMS buffer (5 mM PIPES, pH 7.5/10 mM MgSO4). Transcription is performed in solutions containing 250 mM HEPES-KOH, pH 7+5, 30 mM MgCl2, 2 mM spermidine, 40 mM DTT, 0.1 mg/mL bovine serum albumin, 5 mM dNTPs, 5 mg inorganic pyrophosphatase (Boeringer Mannheim), 50 U RNasin (Amersham), 40 mg/mL T7 RNA polymerase, and 1 mM DNA template from the Klenow extension reaction . The 2-mL reaction mixture is incubated at 37 deg C for 8-10 h, at which time RQ1 RNase-free DNase (Promega) is added to 10 U/mL and the incubation continued for a further 2-3 hr. The reactions are then loaded on a 5-mL DE-52 (Whatman) column preequilibrated with 100 mM HEPES-KOH, pH 7.5, 12 mM MgCl2, and 200 mM NaCl. The column is washed with 30 mL equilibration buffer and the RNA eluted with a solution of 100 mM HEPES-KOH, pH 7.5, 12 mM MgCl2, 600 mM NaCl. Fractions containing tRNA are dialyzed into PMS buffer and refolded by heating to 70° C., followed by slow cooling to room temperature.
GalNAc L-Gln-tRNA2 The formation of charged GalNAc L-Gln-tRNA2 is catalyzed by a recombinant aaRS as follows. A typical reaction mixture contains 50 mM Tris-HCl (or Hepes) pH 7.5, 20 mM KCl, 4 mM DTT, 10 mM MgCl2, 0.2 mg/ml bovine serum albumin, 1-5 nM aaRS, and a range of amino acid, ATP, and tRNA concentrations. The charged tRNA may be purified by immobilized Ef-Tu chromatography as previously described. The recombinant aaRS used for this charging reaction is described in Ran et al., J. Am. Chem. Soc. 126:15654-55 (2004).
The cell-free protein synthesis reaction contains the reagents summarized in Table 3 along with an E. coli lysate generated as described in Example 2 and subsequently depleted of a native aminoacyl-tRNA synthetase as described in Example 3.
| TABLE 3 |
| Summary of Reagents added the Cell- |
| free Protein Expression system |
| Reagent | Concentration | |
| Magnesium Glutamate | 8 | mM | |
| Ammonium Glutamate | 10 | mM | |
| Potassium Glutamate | 130 | mM | |
| AMP | 1.20 | mM | |
| GMP | 0.86 | mM | |
| UMP | 0.86 | mM | |
| CMP | 0.86 | mM | |
| Amino Acids | 2 | mM | |
| GalNAc L-Gln-tRNA2 | 2 | mM | |
| Gln-Gln-tRNA1 | 2 | mM | |
| Pyruvate | 30 | mM | |
| NAD | 3.3 | mM | |
| CoA | 2.7 | mM | |
| Oxalic Acid | 4 | mM | |
| Spermidine | 1.5 | mM | |
| Putrescine | 1 | mM | |
| T7 RNA polymerase | 0.10 | mg/ml | |
| Plasmid | 0.0133 | mg/ml | |
| E. coli DsbC | 75 | ug/ml |
| E. coli extract | 6/25 total reaction volume | |
The extract is pretreated with 100 μM iodoacetamide at 21° C. for 30 min. The plasmid contains the structural gene encoding the target protein and is constructed as explained above. GalNAc L-Gln-tRNA2 is the charged tRNA as described above. Gln-Gln-tRNA1 is the glutamine tRNA recognizing a codon different from that of Gln-tRNA2 charged with native glutamine amino acid. The charging reaction is carried out as described in Example 8 except that native E. coli GlnRS is used to catalyze the charging reaction of Gln-tRNA1. Native GlnRS is produced according to procedure in Example 4. Amino Acids are in an equimolar mixture of all 20 native amino acids except for glutamine (19 amino acids total in the mixture).
The 1 mL of reaction mixture is spread on the bottom of a petri dish (Thermo Fisher Scientific, Rochester, N.Y.) and incubated at 30° C. in a sealed humidified incubator for 4 hours.
1. An in vitro method of introducing non-native amino acids into pre-selected positions of a polypeptide using a cell-free synthesis system, the method comprising the steps of:
a) Obtaining a nucleic acid template comprising degenerate sense codons where a first sense codon and a second sense codon correspond to a same native amino acid but differ in their respective nucleotide sequence;
b) Generating a cell lysate;
c) Preventing an endogenous native amino acid from incorporating into a growing polypeptide chain at positions corresponding to the first and second sense codons;
d) Adding a first catalytic aminoacylating agent to a first reaction vessel containing a charging reaction mixture including an amino acid and a first isoaccepting sense tRNA said first isoaccepting sense tRNA recognizing the first sense codon;
e) Aminoacylating the first isoaccepting sense tRNA with the amino acid to yield a tRNA:amino acid charged moiety;
f) Adding a second catalytic aminoacylating agent to a second reaction vessel containing a charging reaction mixture including a non-native amino acid and a second isoaccepting sense tRNA said second isoaccepting sense tRNA recognizing the second sense codon;
g) Aminoacylating the second isoaccepting sense tRNA with the non-native amino acid to yield a tRNA:non-native amino acid charged moiety;
h) Combining the cell lysate with:
1) the tRNA:amino acid charged moiety;
2) the tRNA:non-native amino acid charged moiety; and,
3) the nucleic acid template comprising the first and second codons under conditions appropriate to generate a polypeptide from the template; and;
i) Permitting the reaction to generate the polypeptide bearing non-native amino acids in those positions corresponding to the second sense codons of the template.
2. The method of claim 1, wherein the endogenous native amino acid is prevented from incorporating into a growing polypeptide chain at positions corresponding to the first and second sense codons by depleting the native aminoacyl-tRNA synthetase that aminoacylates the endogenous native amino acid.
3. The method of claim 1, wherein one or both of the catalytic aminoacylating agents are aminoacyl-tRNA synthetases.
4. The method of claim 3, wherein the aminoacyl-tRNA synthetases are removed from the charging reaction mixture prior to combining the tRNA:amino acid charged moiety and tRNA:non-native amino acid charged moiety with the cell lysate.
5. The method of claim 1, wherein one or both of the catalytic aminoacylating agents are ribozymes.
6. The method of claim 1, wherein the cell population is a population of bacterial cells.
7. The method of claim 6, wherein the bacterial cells are Escherichia coli.
8. The method of claim 7, wherein the cells are depleted for arginine decarboxylase.
9. The method of claim 1, wherein the cell population are rabbit reticulocytes.
10. The method of claim 1, wherein the cell lysate exhibits active oxidation phosphorylation during protein synthesis.
11. The method of claim 2 further comprising the steps of:
a) transforming the cells used to generate the cell lysate with a gene wherein said gene expresses an aminoacyl-tRNA synthetase fused to a capture moiety that is capable of functionally replacing the native aminoacyl-tRNA synthetase;
b) altering said cells to inhibit expression of the native aminoacyl-tRNA synthetase gene; and
c) depleting the cell lysate of the aminoacyl-tRNA synthetase fused to the capture moiety.
12. The method of claim 11 further comprising the step of depleting the aminoacyl-tRNA synthetase fused to a capture moiety by affinity chromatography.
13. The method of claim 12, wherein the affinity chromatography is immunoaffinity chromatography.
14. The method of claim 11, wherein the aminoacyl-tRNA synthetase fused to a capture moiety is heterologous to the cells forming the cell lysate.
15. The method of claim 11, wherein the aminoacyl-tRNA synthetase fused to a capture moiety is depleted by immunoprecipitation using an antibody that recognizes the capture moiety.
16. The method of claim 2 further comprising the steps of:
a) transforming the cells used to generate the cell lysate with a gene wherein said gene expresses an unstable recombinant aminoacyl-tRNA synthetase that is capable of functionally replacing the native aminoacyl-tRNA synthetase;
b) altering said cells to inhibit expression of the native aminoacyl-tRNA synthetase gene; and
c) depleting the cell lysate of the unstable recombinant aminoacyl-tRNA synthetase.
17. The method of claim 16, wherein the recombinant aminoacyl-tRNA synthetase is thermally unstable.
18. The method of claim 2, wherein the cell lysate is depleted of its native aminoacyl-tRNA synthetase by immunoaffinity chromatography.
19. The method of claim 2, wherein the cell lysate is depleted of its native aminoacyl-tRNA synthetase by immunoprecipitation.
20. The method of claim 2, wherein the cell lysate is depleted of its native aminoacyl-tRNA synthetase by introducing an aminoacyl-tRNA synthetase inhibitor specific to the native aminoacyl-tRNA synthetase.
21. An in vitro synthesis reaction system for introducing non-native amino acids into pre-selected positions of a protein comprising:
a) a first catalytic aminoacylating reagent reaction vessel comprising a complete charging mixture of reagents able to aminoacylate a first isoaccepting sense tRNA with its corresponding amino acid to yield a tRNA:amino acid charged moiety;
b) a second catalytic aminoacylating reagent reaction vessel comprising a complete charging mixture of reagents able to aminoacylate a second isoaccepting sense tRNA with a non-native amino acid to yield a tRNA:non-native amino acid charged moiety; and
c) a reaction vessel containing a cell lysate containing a mixture of reagents able to carry out in vitro synthesis of proteins from a nucleic acid template;
where all three vessels have openings that permit the combining of the two charging mixtures and cell lysate into a single reaction mixture.
22. The system of claim 21, wherein the cell lysate is derived from a bacterial population.
23. The system of claim 22, wherein the bacterial population is Escherichia coli.
24. The system of claim 23, wherein the Escherichia coli are depleted for arginine decarboxylase.
25. The system of claim 21, wherein the cell lysate has a functional oxidative phosphorylation system.
26. The system of claim 21, wherein one or both of the catalytic aminoacylating reagents are aminoacyl-tRNA synthetases.
27. The system of claim 21, wherein one or both of the catalytic aminoacylating reagents are ribozymes.
28. A kit for the in vitro synthesis of proteins having non-native amino acids introduced into preselected positions of the protein, the kit comprising:
a) a first catalytic aminoacylating reagent reaction vessel comprising a complete charging mixture of reagents able to aminoacylate a first isoaccepting sense tRNA with its corresponding amino acid to yield a tRNA:amino acid charged moiety;
b) a second catalytic aminoacylating reagent reaction vessel comprising a complete charging mixture of reagents able to aminoacylate a second isoaccepting sense tRNA with a non-native amino acid to yield a tRNA:non-native amino acid charged moiety; and
c) a reaction vessel containing a cell lysate containing a mixture of reagents able to carry out in vitro synthesis of proteins from a nucleic acid template.
29. The kit of claim 28, wherein the cell lysate is derived from a bacterial population.
30. The kit of claim 29, wherein the bacterial population is Escherichia coli.
31. The kit of claim 30, wherein the Escherichia coli are depleted for arginine decarboxylase.
32. The kit of claim 28, wherein one or both of the catalytic aminoacylating reagents are aminoacyl-tRNA synthetases.
33. The kit of claim 28, wherein one or both of the catalytic aminoacylating reagents are ribozymes.
34. The kit of claim 28, wherein the cell lysate has a functional oxidative phosphorylation system.
35. The method of claim 1, wherein the non-native amino acids are selected from the group consisting of glycol modified amino acids, metal-chelating groups, aryl-azide containing amino acids, and ketone containing amino acids.
36. The method of claim 1, wherein the endogenous native amino acid is prevented from incorporating into a growing polypeptide chain at positions corresponding to the first and second sense codons by inactivating both a native first isoaccepting sense tRNA that recognizes the first sense codon and a native second isoaccepting sense tRNA that recognizes the second sense codon.
37. The method of claim 36, wherein the native first and second isoaccepting sense tRNAs are inactivated by adding an inactivated aminoacyl-tRNA synthetase that selectively binds to the native first and second isoaccepting sense tRNAs, said inactivated synthetase having the ability to outcompete the native aminoacyl-tRNA synthetase.
38. The method of claim 36, wherein the native first and second isoaccepting sense tRNAs are inactivated by adding anti-sense DNA that selectively binds to the native first and second isoaccepting sense tRNAs.
39. The method of claim 36, wherein the native first and second isoaccepting sense tRNAs are inactivated by adding a specific tRNA ribonuclease or active fragments thereof that selectively cleave the native first and second isoaccepting sense tRNAs.
40. The method of claim 39, wherein the native first and second isoaccepting sense tRNAs are inactivated by adding colicin D or an active fragment of colicin D.