US20100216138A1
2010-08-26
12/599,953
2008-05-30
The present invention relates to a method for identifying a DNA breakpoint and agents for use therein. More particularly, the present invention provides a method for identifying a gene translocation breakpoint based on the application of a novel multiplex DNA amplification technique. The method of the present invention facilitates not only the identification of the break-point position but, further, enables the isolation of the DNA segment across which the breakpoint occurs. This provides a valuable opportunity to conduct further analysis of the breakpoint region, such as to sequence across this region. The method of the present invention is useful in a range of applications including, but not limited to, providing a routine means to characterise the gene break-point associated with disease onset in a patient and thereby enable the design of patient specific probes and primers for ongoing monitoring of the subject disease condition. In addition to monitoring the progression of a condition characterised by the existence of the breakpoint, there is also enabled assessment of the effectiveness of existing therapeutic drugs and/or new therapeutic drugs and, to the extent that the condition is a neoplasm, prediction of the likelihood of a subject's relapse from a remissive state.
Get notified when new applications in this technology area are published.
C12Q1/6858 » CPC main
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid amplification reactions Allele-specific amplification
C12Q2549/119 » CPC further
Reactions characterised by the features used to influence the efficiency or specificity the purpose being that of reducing false positive or false negative signals using nested primers
C12Q2537/143 » CPC further
Reactions characterised by the reaction format or use of a specific feature the purpose or use of Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
C12Q2525/155 » CPC further
Reactions involving modified oligonucleotides, nucleic acids, or nucleotides; Modifications characterised by incorporating/generating a new priming site
C12Q1/68 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids
The present invention relates to a method for identifying a DNA breakpoint and agents for use therein. More particularly, the present invention provides a method for identifying a gene translocation breakpoint based on the application of a novel multiplex DNA amplification technique. The method of the present invention facilitates not only the identification of the breakpoint position but, further, enables the isolation of the DNA segment across which the breakpoint occurs. This provides a valuable opportunity to conduct further analysis of the breakpoint region, such as to sequence across this region. The method of the present invention is useful in a range of applications including, but not limited to, providing a routine means to characterise the gene breakpoint associated with disease onset in a patient and thereby enable the design of patient specific probes and primers for ongoing monitoring of the subject disease condition. In addition to monitoring the progression of a condition characterised by the existence of the breakpoint, there is also enabled assessment of the effectiveness of existing therapeutic drugs and/or new therapeutic drugs and, to the extent that the condition is a neoplasm, prediction of the likelihood of a subject's relapse from a remissive state.
The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.
Bibliographic details of the publications referred to by author in this specification are collected alphabetically at the end of the description.
Chromosomal translocations bring the previously unlinked segments of the genome together by virtue of the exchange of parts between non-homologous chromosomes. Although some translocations are not associated with a new phenotype, others may result in disease due to the modulation of protein expression or the synthesis of a new fusion protein.
There are two main types of chromosomal translocations which occur, these being reciprocal translocations (also known as non-Robertsonian) and Robertsonian translocations. Further, translocations can be balanced (in an even exchange of material with no genetic information extra or missing) or unbalanced (where the exchange of chromosome material is unequal resulting in extra or missing genes).
Reciprocal (non-Robertsonian) translocations usually result in an exchange of material between non-homologous chromosomes and are found in about 1 in 600 newborns. Such translocations are usually harmless and may be found through prenatal diagnosis. However, carriers of balanced reciprocal translocations exhibit an increased risk of creating gametes with unbalanced chromosome translocations thereby leading to miscarriages or children with abnormalities.
Robertsonian translocations involve two acrocentric chromosomes that fuse near the centromere region with loss of the short arms. The resulting karyotype has only 45 chromosomes since two chromosomes have fused together. Robertsonian translocations have been observed involving all combinations of acrocentric chromosomes. The most common translocation involves chromosomes 13 and 14 and is seen in about 1 in 1300 persons. Like other translocations, carriers of Robertsonian translocations are phenotypically normal, but exhibit a risk of unbalanced gametes which lead to miscarriages or abnormal offspring. For example, carriers of Robertsonian translocations involving chromosome 21 exhibit a higher probability of having a child with Down syndrome.
Diseases which may result from the occurrence of a translocation include:
The shorthand t(A;B)(p1;q2) is used to denote a translocation between chromosome A and chromosome B. The information in the second set of parentheses, when given, gives a precise location within the chromosome for chromosomes A and B respectively—with p indicating the short arm of the chromosome, q indicating the long arm, and the numbers of p and q refers to regions, bands and sub-bands seen when staining the chromosomes under microscope.
As detailed above, chronic myelogenous leukemia is an example of a neoplastic condition which is caused by a chromosomal translocation. However, unlike many neoplastic conditions, its treatment prospects are quite good if it can be effectively diagnosed and monitored.
In virtually all cases of chronic myelogenous leukemia, a specific translocation is seen. This translocation involves the reciprocal fusion of small pieces from the long arms of chromosome 9 and 22. The altered chromosome 22 is known as the Philadelphia chromosome (abbreviated as Ph1). When the breakpoint of the Ph1 chromosome was sequenced, it was found that the translocation creates a fusion gene by bringing together sequences from the c-ABL proto-oncogene and another BCR (breakpoint cluster region). The BCR-ABL fusion gene encodes a phosphoprotein (p210) that functions as a dysregulated protein tyrosine kinase and predisposes the cell to become neoplastic. This hypothesis is supported by finding that expression of p210 results in transformation of a variety of hematopoietic cell lines in vitro and that mice transgenic for the human BCR-ABL gene develop a number of hematologic malignancies. Another well studied example of a translocation generating cancer is seen in Burkitt's lymphoma. In some cases of this B cell tumor, a translocation is seen involving chromosome 8 and one of three other chromosomes (2, 14 or 22). In these cases, a fusion protein is not produced. Rather, the c-myc proto-oncogene on chromosome 8 is brought under transcriptional control of an immunoglobulin gene promoter. In B cells, immunoglobulin promoters are transcriptionally quite active, resulting in over expression of c-myc, which is known from several other systems to exhibit monogenic properties. Accordingly, this translocation results in aberrant high expression of an oncogenic protein.
The classical method of diagnosing chromosomal translocations, such as those observed in chronic myelogenic leukemia, is by karyotyping. For many translocations, however, it is now possible to detect the translocation by PCR, using primers which span the breakpoint. In some cases, the PCR technique can also be used for sensitive detection and monitoring of treatment. Monitoring to determine the effect of treatment has become increasingly important for diseases such as chronic myeloid leukemia and acute promyelocytic leukemia as increasingly effective treatment has been developed. For monitoring in these 2 diseases, the starting material for the PCR is RNA. The translocation breakpoint is within the introns of the respective genes and, as a consequence, RNA splicing removes the sequence of RNA transcribed by introns and results in only one or a very limited number of final mRNA products being produced, despite the very large number of different translocations which are present in the patient population.
However, the use of RNA as the starting material to detect and quantify the translocation by PCR suffers the disadvantage that RNA is a difficult molecule to work with due to its inherent susceptibility to degradation. DNA is a more stable molecule. However, the initial identification and characterisation of the breakpoint in the context of DNA is much more difficult since cluster regions of chromosomal fusion sites often span large introns of several tens of thousands of nucleotides. These sizes are too large for direct coverage by a single PCR reaction. There therefore exists an ongoing need to develop means for routinely conducting breakpoint analyses on DNA samples.
In work leading up to the present invention, a novel multiplex amplification reaction has been developed which enables the localisation and analysis of a breakpoint in a DNA sample. Despite the precise position of the breakpoint being unknown, the method of the present invention nevertheless enables diagnosis of the existence of the breakpoint in a DNA sample and the isolation and analysis of the breakpoint region using a relatively modest and simple multiplex amplification reaction. The design of this amplification reaction results in the advantage that generation of long PCR products is not required. Still further, the optional incorporation of a primer hybridisation tag region at the 5′ end of the amplification primers enables the rapid generation of large copy numbers of the amplicons generated using these primers and therefore facilitates the isolation and analysis of the amplicons.
Throughout this specification and the claims which follow, unless the context requires otherwise, the word “comprise”, and variations such as “comprises” and “comprising”, will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.
As used herein, the term “derived from” shall be taken to indicate that a particular integer or group of integers has originated from the species specified, but has not necessarily been obtained directly from the specified source. Further, as used herein the singular forms of “a”, “and” and “the” include plural referents unless the context clearly dictates otherwise.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
The subject specification contains nucleotide sequence information prepared using the programme PatentIn Version 3.1, presented herein after the bibliography. Each nucleotide sequence is identified in the sequence listing by the numeric indicator <210> followed by the sequence identifier (eg. <210>1, <210>2, etc). The length, type of sequence (DNA, etc) and source organism for each sequence is indicated by information provided in the numeric indicator fields <211>, <212> and <213>, respectively. Nucleotide sequences referred to in the specification are identified by the indicator SEQ ID NO: followed by the sequence identifier (eg. SEQ ID NO:1, SEQ ID NO:2, etc.). The sequence identifier referred to in the specification correlates to the information provided in numeric indicator field <400> in the sequence listing, which is followed by the sequence identifier (eg. <400>1, <400>2, etc). That is SEQ ID NO:1 as detailed in the specification correlates to the sequence indicated as <400>1 in the sequence listing
One aspect the present invention is directed to a method of identifying a gene breakpoint, said method comprising:
contacting a DNA sample with:
FIG. 1 is a schematic representation of the strategy for amplification of the breakpoint region in the first round PCR. The forward primers for gene A and the reverse primers for gene B are preferably used in pools rather than individually. Only primer pairs which closely straddle the breakpoint will produce efficient amplification. The tags and tag primers are not shown. The strategy for the second round PCR is the same although the forward and reverse primers are just internal to their corresponding primers in the first round. In the case of chronic myeloid leukemia, gene A is the BCR gene and gene B is the ABL gene. Primer binding sites are staggered so that the maximum amplicon size does not exceed 1 kilobase.
FIG. 2 is a schematic representation of a protocol for isolation of the BCR-ABL translocation breakpoint in chronic myeloid leukemia.
FIG. 3 is an image of the results of electrophoresis showing amplified material from study of one patient. NFA was the pool of 6 forward BCR primers and NFA13 and NFA14 were 2 pools each containing 12 reverse ABL primers. NFA 13/14 was a pool containing the 24 ABL primers belonging to pools 13 and 14.
FIG. 4 is a representation of the sequences of the breakpoints in 4 patients with chronic myeloid leukemia. The numbers on the left are the Genbank base numbers for the BCR and ABL genes.
FIG. 5 shows the site of the DNA breakpoints in the ABL and BCR genes in the 27 patients with breakpoints isolated and identified. Blue regions in the ABL gene represent the exons 1a, 1b and E2. Red regions in the BCR gene represent exons 13, 14 and 15.
Samples from 29 CML patients have been studied using the invention. In 27 of these patients the breakpoint sequences have been isolated and detailed sequencing information obtained. For one patient it has not been possible to amplify the BCR/ABL breakpoint. For the remaining patient a suspected breakpoint has been amplified. Sequence information shows the BCR gene at the 5′ end and ABL sequence at the 3′ end, however this breakpoint has not been confirmed with primers made specifically for the suspected regions.
FIG. 6 is a comparison of DNA-based and RNA-based quantification of minimal residual disease (MRD) in samples of blood from 16 patients with CML. ND=not detected. Y-axis shows the number of leukemic cells as a proportion of total cells. The DNA-based PCR used patient-specific primers synthesised using knowledge of the breakpoint sequence in the patient being studied, the RNA-based PCR was the conventional approach using reverse transcription followed by PCR using generic primers. Black symbols show MRD detected by both techniques, red symbols show disease detected only by DNA-PCR and blue symbols show disease not detected. DNA-based PCR appears to be approximately 2 orders of magnitude more sensitive than RNA-based PCR.
FIG. 7 is an illustration of the isolation of the PML-RARα breakpoint from a sample from the one patient with acute promyelocytic leukemia
The present invention is predicated, in part, on the determination that gene translocation breakpoints can be routinely and easily identified, via DNA analysis, by sequentially performing two PCR reactions which use multiple primers directed to the genes flanking the breakpoint which are themselves tagged at their 5′ end with a DNA region suitable for use as a primer hybridisation site. The simultaneous use of multiple primers facilitates the performance of a short PCR, rather than the long PCRs which have been performed to date. By sequentially performing a second PCR using primers directed to gene regions internal to those used in the first reaction, amplification of a DNA molecule spanning the breakpoint region can be achieved in a manner which enables the identification and isolation of a smaller amplification product than has been enabled to date in terms of the analysis of genomic DNA. By incorporating unique tag regions which can themselves be targeted by a primer, amplification of the initial amplicon can be rapidly achieved, thereby overcoming any disadvantage associated with the use of a low concentration of starting primer directed to the genes flanking the breakpoint. The method of the present invention therefore provides a simple yet accurate means of identifying and analysing a gene breakpoint using DNA. To this end, it would be appreciated that although the method of the present invention is exemplified by reference to chronic myelogenic leukemia, this method can be applied to any situation in which a gene breakpoint is sought to be identified via a DNA sample.
Accordingly, in one aspect the present invention is directed to a method of identifying a gene breakpoint, said method comprising:
(i) contacting a DNA sample with:
It should be understood that in a preferred embodiment of the present invention, where one primer is used in step (i)(a), it is preferable that two or more primers are used in step (i)(b). The converse applies where one primer is used in step (i)(b). Similarly, in another preferred embodiment, where one primer is used in step (iii)(a), it is preferable that two or more primers are used in step (iii)(b). The converse applies where one primer is used in step (iii)(b). Reference to the “flanking genes” 5′ and 3′ to the breakpoint should be understood as a reference to the genes or gene fragments on either side of the breakpoint. In terms of the 5′ and 3′ nomenclature which is utilised in the context of these genes/gene fragments, this should be understood as a reference to the 5′→3′ orientation of the sense strand of double stranded DNA from which the DNA of interest derives. Accordingly, reference to “the flanking gene 5′ to the breakpoint” should be understood as a reference to the sense strand of double stranded DNA. To this end, any reference to “gene” or “gene fragment” herein, to the extent that it is not specified, is a reference to the sense strand of double stranded DNA. Reference to the forward primer being directed to the antisense strand of the flanking gene 5′ to the breakpoint therefore indicates that the forward primer bears the same DNA sequence as a region of the sense strand 5′ to the breakpoint and therefore will bind to and amplify the antisense strand corresponding to that region.
Reference to “gene” should be understood as a reference to a DNA molecule which codes for a protein product, whether that be a full protein or a protein fragment. In terms of chromosomal DNA, the gene will include both intron and exon regions. However, to the extent that the DNA of interest is cDNA, such as might occur if the DNA of interest is vector DNA, there may not exist intron regions. Such DNA may nevertheless include 5′ or 3′ untranslated regions. Accordingly, reference to “gene” herein should be understood to encompass any form of DNA which codes for a protein or protein fragment including, for example, genomic DNA and cDNA.
Reference to a gene “breakpoint” should be understood as a reference to the point at which a fragment of one gene recombines with another gene or fragment thereof. That is, there has occurred a recombination of two genes such that either one or both genes have become linked at a point within one or both of the genes rather than the beginning or end of one gene being linked to the beginning or end of the other gene. That is, at least one of the subject genes has been cleaved and has recombined with all or part of another gene. The recombination of the two non-homologous gene regions may occur by any method including but not limited to chromosomal gene translocations or in vitro homologous recombinations (such as may occur where a DNA segment is being inserted into a vector or an artificial chromosome or where a vector portion thereof chromosomally integrates in a host cell).
Preferably, the subject gene breakpoint is a chromosomal gene translocation breakpoint. As detailed hereinbefore, chromosomal gene translocations are known to occur and, in some cases, lead to the onset of disease states. Since a gene translocation between two genes will not necessarily result in the breakpoint occurring at precisely the same nucleotide position on the two genes each time the translocation event occurs, it is not possible to assume that the breakpoint position in one patient, such as the Philadelphia chromosome breakpoint in one CML patient, will be the same in another patient. The method of the present invention enables the simple yet accurate determination of a gene breakpoint using DNA.
The present invention therefore preferably provides a method of identifying a chromosomal gene translocation breakpoint, said method comprising:
(i) contacting a genomic DNA sample with:
Reference to “DNA” should be understood as a reference to deoxyribonucleic acid or derivative or analogue thereof. In this regard, it should be understood to encompass all forms of DNA, including cDNA and genomic DNA. The nucleic acid molecules of the present invention may be of any origin including naturally occurring (such as would be derived from a biological sample), recombinantly produced or synthetically produced.
Reference to “derivatives” should be understood to include reference to fragments, homologs or orthologs of said DNA from natural, synthetic or recombinant sources. “Functional derivatives” should be understood as derivatives which exhibit any one or more of the functional activities of DNA. The derivatives of said DNA sequences include fragments having particular regions of the DNA molecule fused to other proteinaceous or non-proteinaceous molecules. “Analogs” contemplated herein include, but are not limited to, modifications to the nucleotide or nucleic acid molecule such as modifications to its chemical makeup or overall conformation. This includes, for example, modification to the manner in which nucleotides or nucleic acid molecules interact with other nucleotides or nucleic acid molecules such as at the level of backbone formation or complementary base pair hybridisation. The biotinylation or other form of labelling of a nucleotide or nucleic acid molecules is an example of a “functional derivative” as herein defined.
As detailed hereinbefore, the method of the present invention is predicated on the use of multiple oligonucleotide primers to facilitate the multiplexed amplification of a DNA sample of interest. In one embodiment of the present invention, the DNA sample of interest is a hybrid gene which comprises a portion of one gene (gene A) which is located 5′ to the translocation breakpoint and a second gene (gene B) which is located 3′ to the translocation breakpoint. In a particular embodiment, gene A is BCR and gene B is ABL. The identification of the existence and nature of a gene translocation breakpoint is achieved by using two or more forward primers directed to gene A and two or more reverse primers directed towards gene B. The primers directed to gene A are designed to hybridise at intervals along gene A and the primers directed to gene B are similarly designed to hybridise at intervals along gene B. In the first round PCR, the primers which will amplify the hybrid gene are the upstream primers which hybridise to that portion of gene A which lies 5′ to the breakpoint and the downstream primers which hybridise to that portion of gene B which lies 3′ to the breakpoint. Furthermore, since small amplicons are amplified more efficiently than larger amplicons, there will occur selection for amplification directed by the primer pair which hybridises closest to the breakpoint. The same principle holds for the second round primers and, since in one embodiment each second round primer corresponds to an individual first-round primer but hybridises internal to it with regard to the breakpoint, there will be further selection for amplification by the pair of the second round primers which bound the breakpoint. Without limiting the present invention in any way, the second round of PCR amplification provides additional specificity for amplification of the breakpoint region. Following the second round PCR, successful amplification of the sequence surrounding the breakpoint will be evident as a band of amplified material on electrophoresis.
Since it is not known precisely where the breakpoint lies, it is possible that one or more of the internal primers may not hybridise to their target region sequence due to this sequence having been effectively spliced out during the translocation event. However, in one embodiment, the forward and reverse primers selected for the first round amplification are directed to amplifying from the 5′ and 3′ end regions, respectively, of the gene fragments flanking the breakpoint. The second round primers are then directed to internal regions of the gene fragments flanking the breakpoint, that is, the regions which are closer to the breakpoint than the regions targeted by the first round primers. Again, it would be appreciated that since the precise location of the breakpoint is not known, one or more of these forward and/or reverse primers may not hybridise to the DNA sample due to their target region sequence having been spliced out. In terms of the second round “internal primers”, it should be understood that this is a reference to a population of primers of which at least one primer, but preferably all the primers, are designed to amplify the subject DNA from a point which, when considered in the context of the translocated gene itself (rather than the antisense strand or the amplification product), is 3′ of the most 3′ of the forward primers used in the first round amplification and 5′ of the most 5′ of the reverse primers used in the first round amplification. By using the approach of a two step amplification using progressively more internally localised primers, amplification of DNA spanning the breakpoint region can be achieved without the requirement to perform long PCRs or to generate very long and cumbersome amplification products.
Reference to a “primer” or an “oligonucleotide primer” should be understood as a reference to any molecule comprising a sequence of nucleotides, or functional derivatives or analogues thereof, the function of which includes hybridisation to a region of a nucleic acid molecule of interest (the DNA of interest also being referred to as a “target DNA”) and the amplification of the DNA sequence 5′ to that region. It should be understood that the primer may comprise non-nucleic acid components. For example, the primer may also comprise a non-nucleic acid tag such as a fluorescent or enzymatic tag or some other non-nucleic acid component which facilitates the use of the molecule as a probe or which otherwise facilitates its detection or immobilisation. The primer may also comprise additional nucleic acid components, such as the oligonucleotide tag which is discussed in more detail hereinafter. In another example, the primer may be a protein nucleic acid which comprises a peptide backbone exhibiting nucleic acid side chains. preferably, said oligonucleotide primer is a DNA primer.
Reference to “forward primer” should be understood as a reference to a primer which amplifies the target DNA in the DNA sample of interest by hybridising to the antisense strand of the target DNA.
Reference to “reverse primer” should be understood as a reference to a primer which amplifies the target DNA in the DNA sample of interest and in the PCR by hybridising to the sense strand of the target DNA.
The design and synthesis of primers suitable for use in the present invention would be well known to those of skill in the art. In one embodiment, the subject primer is 4 to 60 nucleotides in length, in another embodiment 10 to 50 in length, in yet another embodiment 15 to 45 in length, in still another embodiment 20 to 40 in length, in yet another embodiment 25 to 35 in length. In yet still another embodiment, primer is about 26, 27, 28, 29, 30, 31, 32, 33 or 34 nucleotides in length. Without limiting the invention in any way, the primers are designed in one embodiment to have a TM of 65 to 70° C. This enables the PCR to use a high annealing temperature, which minimises non-specific annealing and amplification. Each forward or reverse primer for the second round PCR is designed to hybridise to a sequence which is close, either downstream for the forward primer or upstream for the reverse primer, to the hybridisation sequence for its corresponding forward or reverse first-round primer. Designing the corresponding primers to hybridise to closely adjoining sequences minimises the probability that the translocation breakpoint will involve or occur between the hybridisation sequences. even if this does occur, the sequence surrounding the translation breakpoint can still be amplified by the immediately upstream or downstream, as the case may be, primer pair.
In the exemplified embodiment described herein, primers were chosen so that their binding sites were staggered with the separation between adjacent binding sites being approximately 500 bases. This was done so that the amplified material would have range in size, up to a maximum length of approximately 1 kilobase. This strategy is in contrast to the strategy of “Long PCR” which would require fewer primers and a less complex multiplex PCR reaction. The advantages of the strategy of the present invention are that the standard shorter PCR reaction is more robust and the amplified product can be sequenced immediately rather than requiring another set of PCR reactions to break it up into smaller amplicons which are suitable for sequencing.
In terms of the number of primers which are used in the method of the invention, this can be determined by the person of skill in the art. With regard to the total number of primers, the variables which require consideration are the size of the gene region which is being targeted and the distance between the sequences to which the primers hybridise. In order to amplify PCR fragments which are no larger than about 1 kb, the primers can be designed to hybridise at intervals of approximately 500 bases. With regard to CML, nearly all BCR translocations involve one of two regions, each of approximately 3 kb in length. In this case, 12 outer forward primers and 12 corresponding inner primers may be used. The ABL gene, however, is larger, approximately 140 kb in length, and up to 280 outer reverse primers and 280 inner reverse primers may be used. In one particular embodiment, a combination of 6 forward primers and 24 reverse primers is used and in another embodiment a combination of 6 forward primers and 140 reverse primers. The primer number which is selected to be used will depend on the genes involved in the translocation and thus may vary from translocation to translocation and will involve consideration of the competing issues of the number of PCR reactions which are required to be performed versus the probability of generating non-specific products during a PCR reaction. As would be understood by the person of skill in the art, a large number of primers in each individual PCR reaction decreases the number of PCR reactions but increases the probability of non-specific amplification reactions.
In one embodiment, the method of the present invention is performed using at least three primers, in another embodiment at least four primers. In yet another embodiment said invention is performed using 6-10 primers, 6-15 primers, 6-20 primers, 6-25 primers or 6-30 primers. In still another embodiment there is used 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 primers.
There is therefore preferably provided a method of identifying a gene breakpoint, said method comprising:
(i) contacting a DNA sample with
The primers which are used in the method of the present invention are of a relatively low individual concentration due to the starting primer pool comprising multiple individual primers. This reduces the risk of inducing inhibition of PCR. In order to facilitate a successful amplification result, it is therefore necessary to enable the generation of sufficient amplicons for detection and isolation. In one aspect of the present invention, this can be facilitated by tagging the primers with an oligonucleotide which can be used as a primer hybridisation site. In addition to the primers directed towards genes A and B, each PCR reaction may therefore also contain concentrations of two oligonucleotides which are directed to the tag, as a primer hybridisation site. These oligonucleotide sequences act as primers and enable efficient secondary amplification of the amplicons generated by the initial hybridisation and extension of the primers directed towards genes A and B. In one embodiment, the primer which is directed to the tag exhibits a TM of 65° C.-70° C. in order to minimise non-specific amplification. Thus these primers are directed towards overcoming the potential problem posed by the low concentrations of the primers directed towards A and B. Nevertheless, in some situations it may not be necessary to use one or both tag primers. For example, when there are only six forward primers for the BCR gene each primer may be at a concentration which is sufficient for relatively efficient amplification. Still further, it should be appreciated that the oligonucleotide tags provide an additional use when they are present in the final PCR round, since the tag primers can also be used for sequencing. Accordingly, although the tag is suitable for use as a site for primer hybridisation, it should be understood that the subject tag may also be useful for other purposes, such as a probe binding site in the context of Southern gel analysis or to enable isolation of the primer or the amplicon extended therefrom. To this end, the tag may comprise a non-nucleic acid component, such as a protein molecule or biotin which would enable isolation, for example by affinity chromatography, streptavidin binding or visualisation.
In order to ensure that these tags do not interfere with the extension of the primer, the primers are linked to the oligonucleotide tag at their 5′ end. Reference to “oligonucleotide tag” should therefore be understood as a reference to a nucleotide sequence of less than 50 nucleotides which is linked to the 5′ end of the forward and reverse primers of the present invention. In one embodiment, the tag is 25-30 bases in length. It should also be understood that consistently with the definitions provided in relation to the forward and reverse primers, the oligonucleotide tags herein described may also comprise non-nucleic acid components such as isolation or visualisation tags eg. biotin, enzymatic labels, fluorescent labels and the like. This enables quick and simple isolation or visualisation of the tagged primers or amplicons via non-molecular methods.
That the oligonucleotide tag is “operably linked” to the primer should be understood as a reference to those regions being linked such that the functional objectives of the tagged primer, as detailed hereinbefore, can be achieved. In terms of the means by which these regions are linked and, further, the means by which the subject oligonucleotide primer binds to its target DNA region, these correspond to various types of interactions. In this regard, reference to “interaction” should be understood as a reference to any form of interaction such as hybridisation between complementary nucleotide base pairs or some other form of interaction such as the formation of bonds between any nucleic or non-nucleic acid portion of the primer molecule or tag molecule with any other nucleic acid or non-nucleic acid molecule, such as the target molecule, a visualisation means, an isolation means or the like. This type of interaction may occur via the formation of bonds such as, but not limited to, covalent bonds, hydrogen bonds, van der Wals forces or any other mechanism of interaction. preferably, to the extent that the interaction occurs between the primer and a region of the target DNA, said interaction is hybridisation between complementary nucleotide base pairs. In order to facilitate this interaction, it is preferable that the target DNA is rendered partially or fully single stranded for a time and under conditions sufficient for hybridisation with the primer to occur.
Without limiting the present invention to any one theory or mode of action, the inclusion of an oligonucleotide tag which can itself function as a primer hybridisation site can assist in facilitating the convenient and specific amplification of the amplicon generated by the forward and reverse primers of the present invention. Accordingly, this overcomes somewhat the amplification limitation which is inherent where a relatively low starting concentration of the forward and reverse primers is used. Where the starting concentration of forward and reverse primers is sufficiently high, it may not be necessary to use a tag. Accordingly, in a preferred embodiment, the DNA sample of interest is contacted with both the forward and reverse primers of the present invention and primers directed to the oligonucleotide tags of the forward and reverse primers such that the amplification reaction of step (ii) proceeds in the context of all these primers. It should be understood, however, that although it is preferred that amplification based on both the gene primers and the tag primers is performed simultaneously, the method can be adapted to perform the tag primer based amplification step after the completion of the gene primer based amplification.
The DNA sequence of the tags may be the same or different. With respect to a first round amplification, the tags may be the same if the purpose is to amplify the initial amplification product. However, if one wishes to selectively enrich for amplicons containing the sequence of one of the flanking genes, the primer directed to the tag region of the primer of the gene of interest (eg. gene A) should differ to the primer directed to the tag region of the primer of the other gene (eg. gene B). In another example, in terms of a second or subsequent round of amplification, the tags which are used for sequencing would be required to be different to prevent the simultaneous sequencing of both strands.
The present invention therefore provides a method of identifying a gene translocation breakpoint, said method comprising:
(i) contacting a DNA sample with:
It should be understood that the oligonucleotide primers and tags of the present invention should not be limited to the specific structure exemplified herein (being a linear, single-stranded molecule) but may extend to any suitable structural configuration which achieves the functional objectives detailed herein. For example, it may be desirable that all or part of the oligonucleotide is double stranded, comprises a looped region (such as a hairpin bend) or takes the form of an open circle confirmation, that is, where the nucleotide primer is substantially circular in shape but its terminal regions do not connect.
Facilitating the interaction of the nucleic acid primer with the target DNA may be performed by any suitable method. Those methods will be known to those skilled in the art.
Methods for achieving primer directed amplification are also very well known to those of skill in the art. In a preferred method, said amplification is polymerase chain reaction, NASBA or strand displacement amplification. Most preferably, said amplification is polymerase chain reaction. To this end, in one embodiment of the invention, a 20 minute hybridisation provides good amplification in the first round PCR.
Reference to a “sample” should be understood as a reference to either a biological or a non-biological sample. Examples of non-biological samples includes, for example, the nucleic acid products of synthetically produced nucleic acid populations. Reference to a “biological sample” should be understood as a reference to any sample of biological material derived from an animal, plant or microorganism (including cultures of microorganisms) such as, but not limited to, cellular material, blood, mucus, faeces, urine, tissue biopsy specimens, fluid which has been introduced into the body of an animal and subsequently removed (such as, for example, the saline solution extracted from the lung following lung lavage or the solution retrieved from an enema wash), plant material or plant propagation material such as seeds or flowers or a microorganism colony. The biological sample which is tested according to the method of the present invention may be tested directly or may require some form of treatment prior to testing. For example, a biopsy sample may require homogenisation prior to testing or it may require sectioning for in situ testing. Further, to the extent that the biological sample is not in liquid form, (if such form is required for testing) it may require the addition of a reagent, such as a buffer, to mobilise the sample.
To the extent that the target DNA is present in a biological sample, the biological sample may be directly tested or else all or some of the nucleic acid material present in the biological sample may be isolated prior to testing. It is within the scope of the present invention for the target nucleic acid molecule to be pre-treated prior to testing, for example inactivation of live virus or being run on a gel. It should also be understood that the biological sample may be freshly harvested or it may have been stored (for example by freezing) prior to testing or otherwise treated prior to testing (such as by undergoing culturing).
Reference to “contacting” the sample with the primer should be understood as a reference to facilitating the mixing of the primer with the sample such that interaction (for example, hybridisation) can occur. Means of achieving this objective would be well known to those of skill in the art.
The choice of what type of sample is most suitable for testing in accordance with the method disclosed herein will be dependent on the nature of the situation, such as the nature of the condition being monitored. For example, in a preferred embodiment a neoplastic condition is the subject of analysis. If the neoplastic condition is a lymphoid leukemia, a blood sample, lymph fluid sample or bone marrow aspirate would likely provide a suitable testing sample. Where the neoplastic condition is a lymphoma, a lymph node biopsy or a blood or marrow sample would likely provide a suitable source of tissue for testing. Consideration would also be required as to whether one is monitoring the original source of the neoplastic cells or whether the presence of metastases or other forms of spreading of the neoplasia from the point of origin is to be monitored. In this regard, it may be desirable to harvest and test a number of different samples from any one mammal. Choosing an appropriate sample for any given detection scenario would fall within the skills of the person of ordinary skill in the art.
The term “mammal” to the extent that it is used herein includes humans, primates, livestock animals (e.g. horses, cattle, sheep, pigs, donkeys), laboratory test animals (e.g. mice, rats, rabbits, guinea pigs), companion animals (eg. dogs, cats) and captive wild animals (eg. kangaroos, deer, foxes). preferably, the mammal is a human or a laboratory test animal. Even more preferably the mammal is a human.
As detailed hereinbefore, in one embodiment the method of the present invention is performed as a sequential two step amplification using multiple second round primers each of which is directed to a gene region which is either 3′ (for the forward primers) or 5′ (for the reverse primers) to that which is targeted by the corresponding first round primers. The person of skill in the art would appreciate that in some cases it may not be necessary to conduct a second round amplification. The necessity to perform a second round amplification may also be obviated if a selective or enrichment step as described below is performed. This situation may arise when the sequence around the breakpoint is amplified very efficiently and there is very little non-specific amplification such that a clearly defined band of amplification product is observed on electrophoresis of the product of the first round amplification or if the subsequent selection step is very efficient. In general, however, it is expected that a sequential two step amplification process would be used in order to minimise non-specific amplification and to generate a relatively short amplification product which spans the breakpoint region. In general, it is expected that the amplification product would be less than 1.5 kb, less than 1 kb, less than 0.8 kb or less than 0.5 kb. It should be understood that depending on the size of the genes which have been translocated, the method of the invention may be adapted to incorporate third or fourth round amplification steps in order to further minimise non-specific amplification. This can be an issue owing to the number of primers present in the multiplexed reaction and to the fact that one of the genes participating in the translocation often contains multiple repetitive sequences such as Alu. Nevertheless, it is expected that the need for further rounds of amplification would be unlikely.
Although the method of the present invention has been designed such that the amplification steps can be sequentially performed directly on the amplification product of a previous amplification, this should not be understood as a limitation in terms of whether any additional steps are sought to be incorporated by the skilled person, such as enrichment/selection steps. For example, one may seek to select for the desired amplicons after the first round amplification and to thereafter conduct the second round amplification on their material alone. Methods which one could utilise to select or enrich include:
Without limiting the application of the present invention to any one theory or mode of action, in a classical PCR, the primers and reaction conditions are designed so that primer hybridisation and extension of the forward and reverse primers occur at or close to the maximum efficiency so that the number of amplicons approximately doubles with each cycle resulting in efficient exponential amplification. Bottleneck PCR, however, is predicated on the use of forward and reverse primer sets where the primers of one set have been designed or are otherwise used under conditions wherein they do not hybridise and extend efficiently. Accordingly, although the efficient primer set will amplify normally, the inefficient set will not. As a consequence, when a sequence of interest is amplified, the number of amplicon strands is significantly less than that which would occur in a classical PCR. Efficient amplification only commences once amplicons have been generated which incorporate, at one end, the tag region of the inefficient primer. At this point, the primers directed to the tag regions effect a normal amplification rate. A “bottleneck” is therefore effectively created in terms of the generation of transcripts from the inefficient primer set.
A more severe bottleneck is usefully created where the inefficient primers are directed to commonly repeated sequences, such as an alu sequence. Amplification of unwanted product may result if such binding sites are closely apposed and if the inefficient primers can act as forward primers and reverse primers. However, owing to both primers being inefficient, amplification is initially extremely inefficient and there is a severe bottleneck. Efficient amplification only commences once amplicon strands have been generated which comprise the tag region of the inefficient primer at one end and its complement at the other. After any given number of cycles, the number of such amplicons is, however, substantially less than that which occurs during amplification of the sequence of interest. The amount of unwanted product at the end of the amplification reaction is correspondingly reduced.
Hybridisation and extension of an inefficient primer which has correctly hybridised to the sequence of interest followed in a subsequent cycle by hybridisation and extension of an efficient primer to the previously synthesised amplicon generates a template to which the tag primer can efficiently hybridise and extend. Since such molecules together with their complements provide upstream and downstream binding sites, each for an efficient primer (the tag primer and one member of the efficient set), succeeding cycles of amplification from such templates are both efficient and exponential. The result is that, after an initial lag or “bottleneck”, the overall rate of amplification speeds up in later cycles so that a near doubling of amplicon number with each cycle results. However, the net result is that there is negative selection against amplification of undesired amplicons as compared to amplicons of the sequence of interest, owing to the bottleneck at each end for the former and only at one end for the latter.
Accordingly, if the same number of commencing target sequences is considered and comparison to the amplification produced by classical PCR is made, application of the bottleneck PCR will produce a lesser increase in the number of amplicons of the sequence of interest and an even lesser increase in the number of amplicons of unwanted sequences. Although amplification of both wanted and unwanted products occurs, there is relative enrichment of the sequence of interest relative to the unwanted sequences. There is an inverse relationship between absolute amplification and enrichment since decreasing the efficiency of the inefficient primer set produces increased enrichment at the expense of lesser amplification.
Once the amplification rounds have been completed, the amplicons spanning the breakpoint region can be analysed. In a preferred embodiment, the subject amplicon is isolated by excision of a gel band containing that amplicon and sequenced in order to characterise the breakpoint region. To the extent that a band excised from a gel is to be analysed, it may be necessary to further amplify the DNA contained therein in order to provide sufficient material for sequencing. The oligonucleotide tags hereinbefore described provide a suitable primer hybridisation site to facilitate further amplification of the isolated amplicons.
As detailed hereinbefore, the method of the present invention provides a simple and routine means of identifying and characterising any breakpoint region, such as the nature, accuracy and stability of a site directed insertion of a gene into a chromosome or vector (this being important in the context of gene therapy), but in particular the chromosomal gene translocation breakpoints that are characteristic of many diseases. Examples of such translocations and diseases include, but are not limited to:
In terms of the embodiment of the invention exemplified herein, primers were chosen so that their binding sites were staggered with the separation between adjacent binding sites being approximately 500 bases. This was done so that the amplified material would have range in size, up to a maximum length of approximately 1 kilobase. This strategy may be contrasted to the prior art strategy of “Long PCR” which would require fewer primers and a less complex multiplex PCR reaction. One of the advantages of the strategy of the present invention is that the standard shorter PCR reaction is more robust and the amplified product can be sequenced immediately rather than requiring another set of PCR reactions to break it up into smaller amplicons which are suitable for sequencing.
The present invention therefore preferably provides a method of identifying a chromosomal BCR-ABL translocation breakpoint, said method comprising:
(i) contacting a DNA sample with:
Accordingly, in yet another aspect there is provided a method of monitoring a disease condition in a mammal, which disease condition is characterised by a gene breakpoint, said method comprising screening for the presence of said breakpoint in a biological sample derived from said mammal, which breakpoint has been identified in accordance with the method hereinbefore defined.
Methods of screening for the subject breakpoint would be well known to those skilled in the art and include any suitable probe-based screening technique, such as PCR based methods. By virtue of the identification of the breakpoint region in accordance with the method of the invention, one can design an appropriate probe set to specifically amplify the subject breakpoint.
In one embodiment, said gene breakpoint is a chromosomal gene translocation breakpoint such as:
Still another aspect of the present invention is directed to a DNA primer set, which primer set is designed to amplify and/or otherwise detect a gene breakpoint, which breakpoint has been identified in accordance with the method hereinbefore defined.
The present invention is now described by reference to the following non-limiting examples and figures.
Genomic DNA extracted by Qiagen Flexigene kit
1st Round PCR (50 ng genomic DNA)—all reactions performed in duplicate
Forward primer pool—FA (Contains 7 forward BCR primers BCRF1-BCRF7 each with same 5′ tag sequence (A), Total 50 ng (7.14 ng each)
Reverse primer pool—R3/4 (Pool of 24 oligonucleotide reverse ABL primers, each with same 5′ tag sequence (C), Total 50 ng (2.08 ng each)
Forward and reverse tag sequence primers (A,C) —25 ng of each
1×PCR buffer, 5 mM MgCl2, 0.75 ul dUTP (300 uM each), 0.4 ul Platinum Taq (2 U)
95/4 min
(97° C./1 min, 65° C./20 min, 72° C./1 min)×5
(96° C./30 sec, 65° C./20 min, 72° C./1 min)×5
(92° C./30 sec, 65° C./20 min, 72° C./1 min)×10
2nd Round PCR (1st round reaction diluted 1/200 in sterile water)
Forward primer pool—NFA (Contains 7 forward internal BCR primers BFN1-BFN7 each with same 5′ tag sequence (B), Total 50 ng (7.14 ng each)
Reverse primer pool—RN3/4 (Pool of 24 oligonucleotide reverse internal ABL primers, each with same 5′ tag sequence (D), Total 50 ng (2.08 ng each)
Forward and reverse tags (B,D)—25 ng of each
1×PCR buffer, 5 mM MgCl2, 0.75 ul dUTP (300 uM), 0.4 ul Pt Taq (2 U)
95/4 min
(94° C./30 sec, 65° C./10 min, 72° C./1 min) x10
(94° C./30 sec, 65° C./5 min, 72° C./1 min) x15
1×PCR buffer, 5 mM MgCl2, 0.75 ul dUTP (300 uM), 0.4 ul Pt Taq (2 U)
95/4 min
(94° C./30 sec, 65° C./30 sec, 72° C./30 sec)×35
1×PCR buffer, 5 mM MgCl2, 0.75 ul dUTP (300 uM), 0.4 ul Pt Taq (2 U)
95/4 min
(97° C./1 min, 65° C./30 sec, 72° C./30 sec)×5
(96° C./30 sec, 65° C./30 sec, 72° C./30 sec)×5
(92° C./30 sec, 65° C./30 sec, 72° C./30 sec)×25
Band excised and purified via Qiagen minElute kit
Products sequenced with 5′ BCR specific primer to confirm BCR/ABL breakpoint (Flinders sequencing facility).
Nearly all translocations involve a 3 kb region of the BCR gene and 140 kb region of the ABL gene. Six forward primers used to cover the region of the BCR gene and 282 primers used to cover the region of the ABL gene. Six PCRs are set up, each containing one of the BCR primers, all of the ABL primers, and the common tag primer.
If necessary, a second round of PCR is performed with a nested internal BCR primer and 282 nested internal ABL primers Alternatively, 1-3 rounds of Bottleneck PCR are performed in order to remove non-specific amplified products and reveal the amplified translocation sequence.
The ABL gene is very rich in Alu sequences, and the BCR gene also contains one such sequence. The ABL primers have therefore undergone a selection procedure which sequentially involves, for each ABL primer:
The BCR and ABL primers used in Example 1 are shown in Example 2.
| 1st Rd | ||
| BCRF1-FT0 | cttctccctgacatccgtgg | |
| BCRF2-FT0 (−5) | acacagcatacgctatgcacatgtg | |
| BCRF3-FT0 | gaggttgttcagatgaccacgg | |
| BCRF4-FT1 (−10) | cagctactggagctgtcagaacag | |
| BCRF5-FT0 | tgggcctccctgcatcc | |
| BCRF6-FT0 | tccccctgcaccccacg | |
| 2nd Rd | ||
| BCRF1-FT1 | tgacatccgtggagctgcagatgc | |
| BCRF2-FT1 | acatgtgtccacacacaccccacc | |
| BCRF3-FT1 | accacgggacacctttgaccctgg | |
| BCRF4-FT1 (−4) | ctggagctgtcagaacagtgaagg | |
| BCRF5-FT1 | tccctgcatccctgcatctcctcc | |
| BCRF6-FT1 | cccacgacttctccagcactgagc |
The second round primers were internal to the first round primers and were used either for a second round together with internal ABL primers or for performing Bottleneck PCR in order to eliminate non-specific amplified material and facilitate isolation of the translocation breakpoint.
Various combinations of the forward and reverse primers can be used. In one embodiment, the protocol that was used was to set up 6 PCRs, each containing a different BCR primer and all 282 ABL primers
282 Reverse ABL Primers Used for the First PCR Round and the Tag Sequence which was on the 5′ End of Each Primer
| Tag A | gcaacactgtgacgtactggagg | |
| R1 | gtctatctaaaattcacaaggaatgc | |
| R2 | aggcaaagtaaaatccaagcaccc | |
| R3 | cactcctgcactccagcctgg | |
| R4 | caaccaccaaagtgcttttcctgg | |
| R5 | atatggcatctgtaaatattaccacc | |
| R6 | tgcctcggcctcccaaagtgc | |
| R7 | agccaccacacccagccagg | |
| R8 | aataactgttttctccccccaaaac | |
| R9 | tgttttacaaaaatggggccatacc | |
| R10 | acttaagcaaattctttcataaaaaggg | |
| R11 | ctttcaattgttgtaccaactctcc | |
| R12 | acctcctgcatctctccttttgc | |
| R13 | aaataaagttttgagaaccataagtgg | |
| R14 | caccatcacagctcactgcagc | |
| R15 | aacctctttgagaatcggatagcc | |
| R16 | aaataaagtacatacctccaattttgc | |
| R17 | gacacattcctatgggtttaattcc | |
| R18 | tgtaaaatatggtttcagaagggagg | |
| R19 | gcaggtggataacgaggtcagg | |
| R20 | ccagccaagaatttcaaagattagc | |
| R21 | gaagggagatgacaaagggaacg | |
| R22 | gcagaagaactgcttgaacctgg | |
| R23 | gtggtcccagctactcgagagg | |
| R24 | ccctcagcaaaactaactgaaaagg | |
| R25 | tagaaaccaagatatctagaattccc | |
| R26 | ccacgcccggcggaataaatgc | |
| R27 | acaaaaaaagaggcaaaaactgagag | |
| R28 | ctgggcgcagtggctcatgcc | |
| R29 | tggctgtgaggctgagaactgc | |
| R30 | ctgggcgacagagtgagactcc | |
| R31 | aagtctggctgggcgcagtgg | |
| R32 | aatggacaaaagaggtgaactggc | |
| R33 | gatagagtgaaaacgcacaatggc | |
| R34 | aattaaacagctaggtcaatatgagg | |
| R35 | ggtctccactatcaagggacaag | |
| R36 | aagcagctgttagtcatttccagg | |
| R37 | aggcatcctcagattatggctcc | |
| R38 | cctgagtaacactgagaccctgc | |
| R39 | aacactcaagctgtcaagagacac | |
| R40 | attcaggccaggcgcagtggc | |
| R41 | taaatcgtaaaactgccacaaagc | |
| R42 | cagaggagtaggagaaggaaaagg | |
| R43 | ggtagctatctaccaagtagaatcc | |
| R44 | atcagattggaaaaagtcccaaagc | |
| R45 | ctcctgaaaagcacctactcagc | |
| R46 | ctccttaaacctgaggtactggg | |
| R47 | ttttctcctaatagaccaccattcc | |
| R48 | ctgctgtattaccatcactcatgtc | |
| R49 | ctggccaacatagtgaaaccacg | |
| R50 | atttgaataggggttaaagtatcattg | |
| R51 | cacttcagtggaagttggcatgc | |
| R52 | gtttttcttcgaagtgataaacatacg | |
| R53 | gctccttagtctatgtacctgtgg | |
| R54 | tactctggcatggtaactggtgc | |
| R55 | acaaaggactaggtctgtggagc | |
| R56 | ccaagtttaccaaattaccaaagttacc | |
| R57 | tgagccgatatcacgccactgc | |
| R58 | tcccaataaaggttttggcccagg | |
| R59 | ctgggtagcaaattagggaacagg | |
| R60 | ctggccagaaaagacagttttatcc | |
| R61 | ggttcccaggaagggataacacc | |
| R62 | tcactccaggaggttccatttcc | |
| R63 | aggcttggaaataagcagcagtgg | |
| R64 | attcatacaatggaatactactcagc | |
| R65 | taagtgatcctcccacctcaacc | |
| R66 | tataagaggaagactggggctgg | |
| R67 | tcatacttatgcaggttataggagg | |
| R68 | caagatcacgccactgcactcc | |
| R69 | aaaataaatagctggtgctcaagatc | |
| R70 | caccagcctcattcaacagatgg | |
| R71 | caatgcagcctcaacctcctgg | |
| R72 | gttaggtcaggtgctcatgtctg | |
| R73 | aagtttcaaaaggacatgtacaaaatg | |
| R74 | tcctgaagaggctgcagcttcc | |
| R75 | ctggtgcacattcccaagtgtgc | |
| R76 | catgttggccatgttcttctgagg | |
| R77 | ctcagcctcccgagtagctgg | |
| R78 | aaagacatttaagaggagatgaggc | |
| R79 | tgctgggattacaggcgtgagc | |
| R80 | tgtgacttccatccgcagctcc | |
| R81 | gacacttttgtggagctttcatgg | |
| R82 | catgtgagggggcacgtcttgc | |
| R83 | tcttctctatgagaaaagtggttgc | |
| R84 | tggcaaaatgctatcgagctgcc | |
| R85 | tatgaacacagccggcctcagg | |
| R86 | gaggttgcagtgagctgagatcg | |
| R87 | gtcaagcacccagtccgatacc | |
| R88 | atctgggcttggtggcgcacg | |
| R89 | gttaagcgggtcccacatcagc | |
| R90 | cagccagtttcagtagaaagatgc | |
| R91 | gacccaagcataaggggactagc | |
| R92 | cccaaaaagtttacaagagaaattttc | |
| R93 | cgcctgtagtcccagctactcg | |
| R94 | cgcgtgatgcggaaaagaaatcc | |
| R95 | tctactatgaaccctccttcagac | |
| R96 | gtgctgggattacaggtgtgagc | |
| R97 | ttatccaaatgtcccagggcagg | |
| R98 | ctgccagcactgctcgccagc | |
| R99 | gctactgcaggcagtgccttcc | |
| R100 | catccaagcccaaggtgtcagg | |
| R101 | tgtttgcatgtaatttcaggaagcc | |
| R102 | gatccgtcactgttaacactcagg | |
| R103 | ctcacagtcacaagctcctgagc | |
| R104 | gagatgatgctggggtcacagg | |
| R105 | ttagaagaatgggatcgcaaagg | |
| R106 | cggtattcaaatatgaggtcaggc | |
| R107 | gtaaatcctgctgccagtcttcc | |
| R108 | acagggtcagacagagccttgg | |
| R109 | agttattgatctaactatacaacaagc | |
| R110 | aaagactaggggccggggacg | |
| R111 | ctggtagaaataaagacaacaaagcc | |
| R112 | gtgccaagtaattaaaagtttgaaacc | |
| R113 | ggcttttgaagggagcaccacc | |
| R114 | gaaggataaatacctatgatactttcc | |
| R115 | ggcagggaaatactgtgcttcaag | |
| R116 | gtggtgaaattccacctcagtacc | |
| R117 | tcccaaagtgctgggattacagg | |
| R118 | gaaattagcaaacaatgccaagacg | |
| R119 | taagtattggaccgggaaggagg | |
| R120 | ctatcattttgctcaaagtgtagcc | |
| R121 | atttcacaaactacagaggccagg | |
| R122 | tagacttctgtctctctatgctgc | |
| R123 | tgagtgagctgccatgtgatacc | |
| R124 | acttcacaccagcctgtccacc | |
| R125 | taactcatatcctcagagagaccc | |
| R126 | agaggttcctcgattcccctgc | |
| R127 | gtgtcagcgtcccaacacaaagc | |
| R128 | gaaagtggatgggcaagcattgc | |
| R129 | gtgatcacctcacagctgcagg | |
| R130 | gtttgtttagtcaaggcatttcacc | |
| R131 | cctcagcctccagagtagctgg | |
| R132 | taaaagaaaactcctccttcctgg | |
| R133 | aatgtgctatgtctttaaatccatgg | |
| R134 | agctggcaaatctggtaatataaaag | |
| R135 | gcttgaacctggaaggtggagg | |
| R136 | gcaggcatgctaagaccttcagc | |
| R137 | cagctccatgaataactccacagg | |
| R138 | gcttgaacccaggaggcagagg | |
| R139 | atcgaagatgccactgcaagagg | |
| R140 | ccaaccacacttcaggggatacc | |
| R141 | cacgccagtccactgatactcac | |
| R142 | gggtttcaccatgttggccagg | |
| R143 | cccaacaaaggctctggcctgg | |
| R144 | atgacagcagaggagcttcatcc | |
| R145 | gcaggctacgagtaaaaggatgg | |
| R146 | cgggtaaaatcttgcctccttcc | |
| R147 | aaacttaaaccaatggtggatgtgg | |
| R148 | agagactgaggaactgttccagc | |
| R149 | gaaacggtcttggatcactgatcc | |
| R150 | tgcgcatgatatcttgtttcaggg | |
| R151 | ggcctccgtttaaactgttgtgc | |
| R152 | gaatgctggcccgacacagtgg | |
| R153 | tcttggtatagaaaagccagctgg | |
| R154 | gcaaaagcccaagagcccctgg | |
| R155 | ttctcccaaaatgagccccaagg | |
| R156 | gtggtgacgtaaacaaaaggtacc | |
| R157 | gcaaattccatgtgaatcttattggc | |
| R158 | cctgatctatggaacagtggtgg | |
| R159 | gttacaaacgttgcagtttgcaacg | |
| R160 | gaaccccgtcaacagtgatcacc | |
| R161 | acaggacctcaaggcaaggagc | |
| R162 | catacctaaaatagaaatgtctatccc | |
| R163 | gagttgcatatatgttttataaatccc | |
| R164 | tgagcccacatccataaagttagc | |
| R165 | accgcaacctttgccgcctgg | |
| R166 | taaatattttgtatggagtcaccacc | |
| R167 | aaagccaggagaaaaagttatgagg | |
| R168 | tcccaaagtcccaggattacagg | |
| R169 | tcactatggagcatctccgatgg | |
| R170 | agttccctggaagtctccgagg | |
| R171 | aaaataatcacccagcccacatcc | |
| R172 | acaaaactacagacacagaaagtgg | |
| R173 | tttgggaggctgaggtaggtgg | |
| R174 | aaagacagtgaaacatctataaggg | |
| R175 | cattttgggagaccagggcagg | |
| R176 | gcatgggacagacacaaagcagc | |
| R177 | gaataacaaagagagccggctgg | |
| R178 | taaaccttttattgaaaattgtcaaatgg | |
| R179 | cgcctcagcctcccaaagtgc | |
| R180 | tacattagttttataggtccagtagg | |
| R181 | gaaggtttattcatattaaaatgtgcc | |
| R182 | ctggcttctgtggtttgagttgg | |
| R183 | acagacctacctcctaaggatgg | |
| R184 | gctagcttttgtgtgtaagaatggg | |
| R185 | ggcctactcacacaatagaatacc | |
| R186 | gcaccattgcactccagcctgg | |
| R187 | gaaattaggataaaggttgtcacagc | |
| R188 | cagaagtgttcaaggtgaaactgtc | |
| R189 | ctgaatcatgaaatgttctactctgc | |
| R190 | tgtcaacttgactgggccatacg | |
| R191 | ctcccgtatagttgggattatagg | |
| R192 | gcttggagttccttgaaattcttgg | |
| R193 | cctggtggctccagttttctacc | |
| R194 | aactcctgacctcatgatccacc | |
| R195 | gctgggattacaggcatgagcc | |
| R196 | ttctcctttatccttggtgacattc | |
| R197 | tcccaaagtgctgggattacagg | |
| R198 | gtcataagtcagggaccatctgc | |
| R199 | ctgtttcattgatttccagactggc | |
| R200 | gcaatctcggctcactgcaagc | |
| R201 | gaagaagtgactatatcagatctgg | |
| R202 | ttcaccatgttggccaggctgg | |
| R203 | catcactgaagatgacaactgagc | |
| R204 | gtccagcctgggcgatagagc | |
| R205 | gaggaaagtctttgaagaggaacc | |
| R206 | ggtacactcaccagcagttttgc | |
| R207 | gagcaactggtgtgaatacatatgg | |
| R208 | caatacctggcaccacatacacc | |
| R209 | gggactacaggcatgtgccacc | |
| R210 | cggtggctcacgcgtgtaatcc | |
| R211 | caactgttaaatctctcatggaaacc | |
| R212 | gacaaaggattagaaatgcaccc | |
| R213 | ggaaatgttctaaaactggattgtgg | |
| R214 | aataataatagccaggtgtggtagc | |
| R215 | ctggaacactcacacattgctgg | |
| R216 | ctgggtgacagagcgagactcc | |
| R217 | cccaaatcatccccgtgaaacatgc | |
| R218 | gaccctgcaatcccaacactgg | |
| R219 | ctctcaggccttcaaactacacc | |
| R220 | caggaaagggctcgctcagtgg | |
| R221 | atctgcaaaagcagcagagcagg | |
| R222 | gtacccatgacagacaagttttagg | |
| R223 | cttatcccctactgtctcctttgg | |
| R224 | ggatggtctcgatctcctgacc | |
| R225 | aggttagagaccttcctctaatgc | |
| R226 | agctgggattacaggtgcctgc | |
| R227 | gctgaggcaggttggggctgc | |
| R228 | acatttaacgtctcctaacttctcc | |
| R229 | gtgctgcgattacaggtgtgagc | |
| R230 | tatgacagcagtattatactatcacc | |
| R231 | ctggggaccaaatctgaactgcc | |
| R232 | gtagctattgttatttccaaaagagg | |
| R233 | gcttgggaccccaggacaagg | |
| R234 | cctggccaacatggggaaatcc | |
| R235 | aattgcttgaacctgggaggtgg | |
| R236 | gcctaagacccaaaagctattagc | |
| R237 | catattaaagggccatattcaaattgg | |
| R238 | ggatgtaaccagtgtatatcacagg | |
| R239 | ggaagtttagtccacatcttctagc | |
| R240 | gcacccacaggacaaccacacg | |
| R241 | gggacgcgcctgttaacaaagg | |
| R242 | gggctgggggccacgctcc | |
| R243 | cgcaaaagtgaagccctcctgg | |
| R244 | gaaatcctacttgatctaaagtgagc | |
| R245 | tttgagcaacttggaaaaaataagcg | |
| R246 | ttcccaaaagacaaatagcacttcc | |
| R247 | ccattttgaaaatcacagtgaattcc | |
| R248 | gaaaagaaaaccctgaattcaaaagg | |
| R249 | tgctgaaaagaagcatttaaaagtgg | |
| R250 | ctcttaccagtttcagagctttcc | |
| R251 | ttttcagccaaaaatcaaggacagg | |
| R252 | cttgagcccaggagtttgagacc | |
| R253 | cgcctgtagtaccctctactagg | |
| R254 | ggtaaagaaagaaggatttgaaaacc | |
| R255 | taagagtaatgaggttaaagtttatgc | |
| R256 | catttttattgtcacaggccatttgc | |
| R257 | gccacgccttctcttctgccacc | |
| R258 | tgcctctcctgactgcactgtg | |
| R259 | ccatgctctaccacgcccttgg | |
| R260 | cattcaggctggagtgcggtgg | |
| R261 | cttaaaaattgtctggctaagacattg | |
| R262 | ttgctcttgttgcccgggttgg | |
| R263 | gagcttagaggaaaagtattatttcc | |
| R264 | tggtgctgtgccagacgctgg | |
| R265 | cagatctttttggctattgtcttgg | |
| R266 | gaaggaaagggcctcccactgc | |
| R267 | catgaaaaagcatgctggggagg | |
| R268 | caaacataaaaaagctttaatagaagcc | |
| R269 | tcccaactatgaaaaaatagaagacg | |
| R270 | cacaaattagccgggcatggtgg | |
| R271 | cttcctttactgagtctttctaaagc | |
| R272 | tgtcctttgaaatgtaggtatgtgg | |
| R273 | ggatcttgcaatactgacatctcc | |
| R274 | atttgaaaagaactgaaggatctacc | |
| R275 | gtgagctgagatctcgtctctgc | |
| R276 | tttgtctgaaacagattctaaaagttgg | |
| R277 | gcaggtgcctgtagtcccagc | |
| R278 | gtttgagcttctaaaattcatggattc | |
| R279 | gtggtaggtcaaaccgcaattcc | |
| R280 | accaaatcagacatatcagctttgg | |
| R281 | cacagaacggatcctcaataaagg | |
| R282 | gttaactcctcccttctctttatgg |
| 2nd Round |
| Tag D | gtgttcagagagcttgatttccagg | |
| RN1 | cccacttgatttttcccacatgg | |
| RN2 | atttatttagatgaagtgaatattttcc | |
| RN3 | atttagtttgtttaactgtgagtgc | |
| RN4 | gtacagaagtgcttgatgcatacc | |
| RN5 | aggcagataaaaattctccattagc | |
| RN6 | acaagcacgagccacagcacc | |
| RN7 | cgctcttgttgcccaggctgg | |
| RN8 | cccaaaacagactttctagataacc | |
| RN9 | ttcaaattgctttttttctactcacc | |
| RN10 | gatctgaaaaaagtgacaggttgg | |
| RN11 | cactgaaatttgaaaggaacatatgg | |
| RN12 | tctggtgcagtggcctctagg | |
| RN13 | accataagtggttttacctgatgg | |
| RN14 | cccaggcgcaggtgattctcc | |
| RN15 | ggtggctcacgcctgaaatcc | |
| RN16 | cacagtccacgtgccacaatcc | |
| RN17 | aatcatgttaacacatccctctcc | |
| RN18 | gaagagagtgttgaaaggttaagc | |
| RN19 | cgagaccatactggctaagatgg | |
| RN20 | attagccacacaataaatgttctgg | |
| RN21 | tttgaaaagcgttgcaatatgatgc | |
| RN22 | ggttgcagtgagccgagatcg | |
| RN23 | ggtgggaggactgcctgagc | |
| RN24 | aacagagagaaaaaacacaaattacc | |
| RN25 | gatatctagaattcccaaatacttgg | |
| RN26 | gtgatagaattaaaggaaaaaataaacg | |
| RN27 | attgttccttttctaaatattctacc | |
| RN28 | cagcactttgggaggctgagg | |
| RN29 | cacagaggtttcacagtgctgg | |
| RN30 | aacttctgcttctgtccataatgc | |
| RN31 | gcctgtaatcccagcactttgg | |
| RN32 | gccagtaaacatatgaaaaggtgc | |
| RN33 | aattatgtaaataaagagtgaaaagg | |
| RN34 | cccctacacagaaaaaacaattcc | |
| RN35 | tgagtgtcaaagaaaaatacaattgg | |
| RN36 | atacacagagaaaatgagtccacc | |
| RN37 | aacactccccttctctgtttagc | |
| RN38 | gatattctttgcaacctaggatgc | |
| RN39 | ctctaaaactaatcagcaatgtaacc | |
| RN40 | cacctgtaatcccagcactttgg | |
| RN41 | cgtaaaactgccacaaagcttgtagg | |
| RN42 | gtggcagaggtgcaagcaagc | |
| RN43 | acagaaatgacaaacgcatgtacc | |
| RN44 | acactctcttagctaggctttgg | |
| RN45 | gagcttggaatagggcagttcc | |
| RN46 | ctgggttctttaaacatgtccagg | |
| RN47 | tcaagaaaggacactgcagtggc | |
| RN48 | catgcacacaaactatctcattcc | |
| RN49 | tagccgggcatggtggcacg | |
| RN50 | atcatgctgattgaatttcaaatagc | |
| RN51 | ttggcatgcagggcagtgacc | |
| RN52 | ggtggtgagataataacacctgc | |
| RN53 | ttgctatataataatcatttgtgatcc | |
| RN54 | cggtaactgttactctgggatgg | |
| RN55 | aggctaggttcccttctcttcc | |
| RN56 | gtagtgcctagcacagagaaagc | |
| RN57 | ctagcctgggcaacaagagcg | |
| RN58 | tctctctcctctctgggatcag | |
| RN59 | gtttgaatatttgtatgcagcaagc | |
| RN60 | tagaacaaattctggcttataaaagc | |
| RN61 | ccactctacctttattccttgcc | |
| RN62 | agaccagaatatgcaagcagagg | |
| RN63 | ggacgttttgctggtgtctgcg | |
| RN64 | aaggaacaaactgttgtcacatgc | |
| RN65 | atgtagctgggactacaggtgc | |
| RN66 | ggctcatgcctgtaatcccagc | |
| RN67 | atgaggttttcacacaaaaagatgc | |
| RN68 | tgggcgacagagcaagactcc | |
| RN69 | aaatgtccctaaaagtgatcaacagc | |
| RN70 | cagactcagttttacctcatcagc | |
| RN71 | agtgatctttcctctttaacctcc | |
| RN72 | ccagctattcaggaggccaagg | |
| RN73 | cttaaacattatgacactgtcttgc | |
| RN74 | ccaggtctatgaggccgttcc | |
| RN75 | tccaaagcatccctacattatacc | |
| RN76 | acatacatacatgcagtgactagc | |
| RN77 | tacaggtgccagccaccatgc | |
| RN78 | gcctgtaatcccagcactctgg | |
| RN79 | gacagagtcccactcttgttgc | |
| RN80 | gtgccttccaaagcagtgtagg | |
| RN81 | tatcttactgggtatgtataatgcc | |
| RN82 | caaaggaaatacgtcctaccagg | |
| RN83 | ccttttctcacagacatgcttcc | |
| RN84 | taaacacagtgagcagaatccc | |
| RN85 | ataaagcaaacttctaaaagggtcc | |
| RN86 | accactacactccagcctggg | |
| RN87 | gatacctgggtcagagtaagtgc | |
| RN88 | tgtaatctcagctacttgggagg | |
| RN89 | gtgtcgtcttctcttcctctacg | |
| RN90 | ctggctagtatgaggttggtgc | |
| RN91 | ggactagccacatttcaaccagg | |
| RN92 | gcagtatactgagaatttagtttcc | |
| RN93 | gaggctgaggcaggagaatgg | |
| RN94 | cattgtttgatgaaggtcaacagc | |
| RN95 | cagacaagagtggctacggcag | |
| RN96 | acgcccagccagattattcagg | |
| RN97 | ggaaccagaaagaagtgcaaagg | |
| RN98 | tgagccatcttggaggcaggc | |
| RN99 | caggaccttcctacaaacctcc | |
| RN100 | aacacaacatatctgaccttacgc | |
| RN101 | gccttagaagtccagaggaaagc | |
| RN102 | tgacgtacccagtagaccttcc | |
| RN103 | ctctgcaagcctgggaaacagg | |
| RN104 | gccttgtccccaagtcctaagg | |
| RN105 | gcaaagggactcctggaattcc | |
| RN106 | gctcctgcctgtaatcccagc | |
| RN107 | gaaggaaacagaaaaagcagaggc | |
| RN108 | cttactaccgttcttcttcactgg | |
| RN109 | actattctgtttctttaggtttactgc | |
| RN110 | cggtggctcacacctgtaatcc | |
| RN111 | agccagagttctgtgctctagg | |
| RN112 | taatttgcatttcgtgccgctcc | |
| RN113 | cacttttaatacagatcccaatagg | |
| RN114 | atgtattttttcttttcctgtcaagc | |
| RN115 | aaatgttaacattattctccctaagg | |
| RN116 | catatgcccagatcccgtctcc | |
| RN117 | acaggtgtgagccgctgcacc | |
| RN118 | gccaagacgtttacagttttggc | |
| RN119 | aggaaacttctgaggatgatggg | |
| RN120 | gctttatagggcagtctgaattcc | |
| RN121 | ttagaataaaagttatctcgggagg | |
| RN122 | taatttcttcagctttatccctcag | |
| RN123 | cacatgactaattctctattcattcc | |
| RN124 | aaagacctcaagaaaagagtcacc | |
| RN125 | gacccataaagattatatgcccag | |
| RN126 | aaagtactaatgcagtgtgtcagc | |
| RN127 | gaggttcctcgattcccctgc | |
| RN128 | ggagagcagaggaattcacagg | |
| RN129 | agtaattagaaactgattctaagacg | |
| RN130 | cataccattgccaatccagttcc | |
| RN131 | attacgggtgcctgccactgc | |
| RN132 | cagccaggcagaggagagagg | |
| RN133 | ttttcattccaagtttctgtttggg | |
| RN134 | tttcaaataggaatttggataatccc | |
| RN135 | taagccgagatcacaccactgc | |
| RN136 | ccttcagcgcattatatcttggc | |
| RN137 | ccatctaatccatcttaaattcacc | |
| RN138 | gagtggagactgcgccactgc | |
| RN139 | aatcatgtgccaattaaaccatggc | |
| RN140 | cccagggaccagaccagacc | |
| RN141 | ctcactcaccagtgaaaatcagc | |
| RN142 | ggttgctctcgaactcctgacc | |
| RN143 | gttcccccagctcctttctgc | |
| RN144 | agaaagatgtagaagggtccagc | |
| RN145 | gggaaaaggtgtattatgcaagcg | |
| RN146 | ctctctcagacctaatgcaaaagc | |
| RN147 | aactatacatacagtatttgtattagc | |
| RN148 | aaattaatgcaatccatgatccagg | |
| RN149 | ctttctccactctaagagaaccc | |
| RN150 | ttttggtgtgttcatattggctgc | |
| RN151 | gcttccacaaatgacagacaaagg | |
| RN152 | ggctcatgcttgtaatcccagc | |
| RN153 | catatgaattgttgttcctttgtagg | |
| RN154 | cactggtacaagtccaagagtcc | |
| RN155 | gaccctgtgtctacttcctggg | |
| RN156 | tatttgaactatctcttgaaatgtcc | |
| RN157 | ctgattaaaaagtattacccttggc | |
| RN158 | tttgaaactgcactcaataacttgg | |
| RN159 | agtaatgtgtcatgatccaatggc | |
| RN160 | gaaagcatttcccaatgtctcacc | |
| RN161 | caatggacaaaaggcccaactgc | |
| RN162 | tccagctctggcttttttgttaag | |
| RN163 | acggagtctcactccgtgacc | |
| RN164 | ctatgtcatagtcaagagactttgc | |
| RN165 | gttcaagcgattctcctgtctcg | |
| RN166 | ccacctaatacttaaatacggaagc | |
| RN167 | acaacaaacttaatagtgaagtg | |
| RN168 | ttacaggcgtgagtcaccatgc | |
| RN169 | aacacctccaagaggccaaacg | |
| RN170 | tactattggcaaatttcaattatatgg | |
| RN171 | agcccacatcctaaaattcaataag | |
| RN172 | gaaagtggataagtgtttgtctgg | |
| RN173 | ggccaggcattcaagaccagc | |
| RN174 | agccaacaacaaaaagacacaacc | |
| RN175 | ttgagcccaggagttcaagacc | |
| RN176 | cagactaaagatctcagagagaaac | |
| RN177 | cgcttgtaatcccagcacttgg | |
| RN178 | aaaagtgaaatcagaatttgtttcc | |
| RN179 | caggcgtgagcaactgtgtcc | |
| RN180 | ggtccagtaggatctcgtttgc | |
| RN181 | actttgaaaatgttgttatagctggg | |
| RN182 | ttccctgcatctaagtcttctcc | |
| RN183 | agatatctaccattgaagagtttgc | |
| RN184 | agtcttcacttcactttgttgtcc | |
| RN185 | ccatgcaggtatgaaatataaaagc | |
| RN186 | tgggtgacagagtgagactcc | |
| RN187 | acagcaataccgggttaacatgc | |
| RN188 | tttatgtaaaagatgaatgcgaggc | |
| RN189 | ctactctgctactgggaacagg | |
| RN190 | caaacgttagtctggcaaaatgcg | |
| RN191 | tgcacgctaccacacccagc | |
| RN192 | aattcttggatctgtgtgtttactgc | |
| RN193 | taccagttatcattctctttctgc | |
| RN194 | atccacccacctcggcctcc | |
| RN195 | cactctgcctggcccttaatgg | |
| RN196 | atagtttgtttaatatgccactaagg | |
| RN197 | gcgtgagccaccgcacctgg | |
| RN198 | ctccatcacacaaattttatgtggc | |
| RN199 | agacggagtctcgttctgtcgc | |
| RN200 | tcccaggttcaagccattctcc | |
| RN201 | tattttgagagtctcactctgtcg | |
| RN202 | gtctcgaactcctgacctcagg | |
| RN203 | aaggaggtgaagagtgaactacg | |
| RN204 | gtctcaggttttggacttacttgg | |
| RN205 | tttacagatcttaaatgcattaggac | |
| RN206 | gtacactgaacaaaggagacagg | |
| RN207 | ctggtagtaatgcaaaatagcacc | |
| RN208 | catttaatgtgaaatgaattataagcc | |
| RN209 | gagacagggtttcactatgttgg | |
| RN210 | ccagcactttggaaggctgagg | |
| RN211 | gaaaccaagtatcatggtaaattgc | |
| RN212 | cagtgagggctgctcagttcc | |
| RN213 | gccaggtgcggtggctcacg | |
| RN214 | catgcctgtaatcccagctacc | |
| RN215 | atgtaaatggtacagtcactttagg | |
| RN216 | cccacaatacagagaactcttacc | |
| RN217 | tgaaacatgcagcccagtgtcc | |
| RN218 | tgttttttctcctgccttcaatcc | |
| RN219 | gctttcctgggtctccatctgg | |
| RN220 | gcagccgcttgaaaacaaaacagc | |
| RN221 | gatcacgttacatttgggggtgg | |
| RN222 | taggctgaaaaactaaaatttgttgc | |
| RN223 | ctcctttgggctcctttagtcc | |
| RN224 | gcctcggcctcccaaagtgc | |
| RN225 | aatgcctagagagatttggcagg | |
| RN226 | gagatggggtttcactatgttgg | |
| RN227 | tgtgatcttgccactgcactcc | |
| RN228 | acttctcctccatttgtttcttcg | |
| RN229 | cgtgcccgggctcagttctac | |
| RN230 | ccaaaacaataaaatcacaatttggg | |
| RN231 | ctgaactgccttagagtaaatccg | |
| RN232 | atttctgtatcaggtctgtgttcc | |
| RN233 | ggctgaccccttcactgtttcc | |
| RN234 | caaaaattagccaggcatggtgg | |
| RN235 | gcagtgagcagtgatcgcacc | |
| RN236 | aaagactgtgaactaacttgtttgc | |
| RN237′1 | tgccaagaattacacattattaggc | |
| RN238 | ggccaggatgtcattaactttcc | |
| RN239 | gtaagagctgacgtgtattgtgc | |
| RN240 | cccggtgaggccgcacatcc | |
| RN241 | cctgcgccttaaccccctcc | |
| RN242 | cggcgcctaggggccatcg | |
| RN243 | acttaaggaaacgaacatgacacc | |
| RN244 | gagaccgagtcttgctgtgtcg | |
| RN245 | gtattaattgaagatgatttggaatgc | |
| RN246 | tctttaaaagactatcgctgaggc | |
| RN247 | aaaagagacatcagtagagcatcc | |
| RN248 | gttcatgttttctttgacgtctcc | |
| RN249 | tttcgaaagttcaggctgagtgc | |
| RN250 | gaccctcaaaacaatcctctaagg | |
| RN251 | caaaacacacttagaaacaaactgc | |
| RN252 | gcctgggcgacatagtgagacc | |
| RN253 | ggcaggagaatggcgtgaacc | |
| RN254 | tttgctcgttgcccaggctgg | |
| RN255 | gcaacttaatgtgatagaataatagc | |
| RN256 | cctccccttctgctgccagc | |
| RN257 | ccacaacaatgtaaactcctctgg | |
| RN258 | tactctccctagagttcgttccc | |
| RN259 | gggtccccctttggccattcc | |
| RN260 | gatcttggctcacttcaacctcc | |
| RN261 | aggggaaatatttaaaccttgg | |
| RN262 | aatgcaatggtgcatttacagagg | |
| RN263 | tcattttatctatttctacatggtcc | |
| RN264 | ggaagggaaatgcccatgaacc | |
| RN265 | agtgaacattttctgcagcctcc | |
| RN266 | caacaggacgtcaggcgatcc | |
| RN267 | ccttcaggctgtcctgaaaagg | |
| RN268 | agtctcactccatcgcccagg | |
| RN269 | actgtgaacagtagttaactcagg | |
| RN270 | gcatgcctgtaatccaagctgc | |
| RN271 | gaaacaattctcttttcacacttgc | |
| RN272 | ggctcatgcctgttatcccagc | |
| RN273 | agaagaagcttagtcatatgtttgg | |
| RN274 | cagatgcttgagccaaacaaatgg | |
| RN275 | ctggcagacagagtgagactcc | |
| RN276 | aatgtgtgaatattattcattacaggg | |
| RN277 | gcaggagaattgcttgaacctgg | |
| RN278 | ctttagtcaaattaaaacagtctatcc | |
| RN279 | gatttctatctcctgcaaccacc | |
| RN280 | ttcttgtgtaactactaaaaatctcc | |
| RN281 | aaagggtcttcataaggctaatgg | |
| RN282 | ctcttaaggattatttatatgaagacc |
Amplified patient DNA was electrophoresed on a 2% agarose gel. P is patient DNA, N is the normal DNA and W is the water control. The patient DNA was amplified using multiple RARα primers and a single PML primer
Two patients have been studied and the breakpoint has been isolated and sequenced in both. The primers used are shown in Example 4.
| 1st Rd | ||
| PML F1-FT1 | caggaggagccccagagc | |
| PML F2-FT1 | tcctggggatggttggatgc | |
| PML F3-FT1 | tgaccccacagagtttacacagc | |
| PML F4-FT1 | agtcagggcaggctctgcc | |
| PML F5-FT1 | tattttggccccatccagaaagc | |
| PML F6-FT1 | cacccagagtacagctttgttcc | |
| 2nd Rd | ||
| PML F1-FT2 | gaggagccccagagcctgc | |
| PML F2-FT2 | tggggatggttggatgcttacc | |
| PML F3-FT2 | cccacagagtttacacagcttgc | |
| PML F4-FT2 | caggctctgcccactcacc | |
| PML F5-FT2 | ccatccagaaagcccaaagcc | |
| PML F6-FT2 | ccagagtacagctttgttcctcattc |
The second round primers were internal to the first round primers and were used for performing Bottleneck PCR in order to eliminate non-specific amplified material and facilitate isolation of the translocation breakpoint.
Various combinations of the forward and reverse primers can be used. 2 exemplary protocols were either to set up 6 PCRs, each containing a different PML primer and all 34 RARalpha primers, or to set up 1 PCR which contained all 6 forward and all 34 reverse primers.
34 Reverse RARalpha Reverse Primers Used for the First PCR Round and the Tag Sequence which was on the 5′ End of Each Primer
| Tag R1 | gcagtacaaacaacgcacagcg | |
| RAR1 | ctgccaccctccacagtccc | |
| RAR2 | gccaagaccatgcatgcg | |
| RAR3 | cccagggacaaagagactccc | |
| RAR4 | caggaagcagacagtcttctagttcc | |
| RAR5 | tgcctgtaatcccaacactttgg | |
| RAR6 | tccctctggccaggatggg | |
| RAR7 | atggggaatgggagtaggaagc | |
| RAR8 | cagatcagttctcccctccagc | |
| RAR9 | acaaaaaagaaacatgctcagagagg | |
| RAR10 | tggtggcatgcatctgtagtcc | |
| RAR11 | aggtgctctatagatgttagcatccc | |
| RAR12 | ccaggacaggatggagatctgg | |
| RAR13 | agggaacctgtgcattatccttgc | |
| RAR14 | cagaagtcttgctttaaggaggagg | |
| RAR15 | gggtacgtgaaactcaccaagg | |
| RAR16 | cagagtgtggcaagcaaggg | |
| RAR17 | aacattttaaaggtacaaataacgtggg | |
| RAR18 | tagggagcaacagccattaagc | |
| RAR19 | ggtgcactgtccagctctgg | |
| RAR20 | actctcgctgaactcgcctgg | |
| RAR21 | ctcggtctctggtggtacgc | |
| RAR22 | gcaagaggtccgagctggg | |
| RAR23 | ggaagaagtgaaacaagagatgaagg | |
| RAR24 | cccagagaacaaaccggattagg | |
| RAR25 | cccttcaaccttctccaatctgc | |
| RAR26 | cccatgtccagtggtttaggg | |
| RAR27 | gagattggtgggagacagatgg | |
| RAR28 | cttctcagctcaaagttccagcg | |
| RAR29 | gaatgggagagatgaccagagg | |
| RAR30 | aagggcaagggggtatgtgg | |
| RAR31 | ggaaggaagcatgggaacacc | |
| RAR32 | ccatcaatgctctgtctgtctgg | |
| RAR33 | gtgccgtgactgtgcttgg | |
| RAR34 | acatcccattgacctcatcaagc |
Nearly all translocations involve a 3 kb region of the BCR gene and 140 kb region of the ABL gene. Six forward primers used to cover the region of the BCR gene and 282 primers used to cover the region of the ABL gene. Six PCRs are set up, each containing one of the BCR primers, all of the ABL primers, and the common tag primer.
If necessary, a second round of PCR is performed with a nested internal BCR primer and 282 nested internal ABL primers Alternatively, 1-3 rounds of Bottleneck PCR are performed in order to remove non-specific amplified products and reveal the amplified translocation sequence.
The ABL gene is very rich in Alu sequences, and the BCR gene also contains one such sequence. The ABL primers have therefore undergone a selection procedure which sequentially involves, for each ABL primer:
The BCR and ABL primers used in Example 1 are shown in Example 2.
Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.
| TABLE 1 | |
| Sequence | |
| Identifier | Sequence |
| SEQ ID NO: 001 | gtgggcccccccgtttccgtgtacagggcacctgca |
| gggagggcaggcagctagcctgaaggctgatccccc | |
| cttcctgttagcacttttgatgggactagtggactt | |
| tggttcagaaggaagagctatgcttgttagggcctc | |
| ttgtctcctcccaggagtggacaaggtgggttagga | |
| gcagtttctccctgagtggctgc | |
| SEQ ID NO: 002 | caccacgtctggctaatttttgtatttttagtagag |
| atggggtttcaacatgttagccaggctggtctcgaa | |
| ctcctgacctcaggtgatccacccgcctgggccctc | |
| caaagtgctgggattacaggcaggagccactgtgcc | |
| cggcctgacctcatatttgaataccgagttttagtt | |
| ctggaggagctgcaggttttatgaaaagggaacaca | |
| tttgattcctcagagcagccacaggccagctctctg | |
| aagtaaagtgcacgtgtgcatgtgtgtgcacactca | |
| cacacacgtacacacacattcacaaataactgtgcc | |
| cggcctgacctcatatttgaataccgagttttagtt | |
| ctggaggagctgcagg | |
| SEQ ID NO: 003 | tttgggaggctgaggcaggtggatcgcttgagctca |
| ggagttggagaccagcctgaccaacatggtgaaacc | |
| ctgtgtctactaaaaatacaaagattagccgggcta | |
| ggcagtgggcacctgtaatcacaactgcttgggagg | |
| ctgagggaagagaatcgcttgaacccaggaggcgga | |
| ggttgcagtgagccgagcttgtgccactgcattcca | |
| gcctgggcgacagag | |
| SEQ ID NO: 004 | ggtctcactctgttgaactcctggtggcctcaaggg |
| atcctcctacctcggcctcacaaagtattggaatta | |
| caggtgtgagtcactgcagctggccttcacttatca | |
| ctgtgaggagtaaacagctgcatggtgggcttaatg | |
| ccatctaacacgagtgactccatgttcagacagtag | |
| gatcacaaatgattattatatagcaatgaatggcca | |
| caggtacatagactaaggagccacatccctgct | |
| SEQ ID NO: 005 | cctccagctacctgccagccggcacttttggtcaag |
| ctgttttgcattcactgttgcacatatgctcagtca | |
| cacacacagcatacgctatgcacatgtgtccacaca | |
| caccccacccacatcccacatcaccccgaccccctc | |
| tgctgtccttggaaccttattacacttcgagtcact | |
| ggtttgcctgtattgtgaaaccagctggatcc | |
| SEQ ID NO: 006 | ttatttataacaacattttcagcgtggcaactgcag |
| tttcagaatggtggaattataccagtcagagagaga | |
| tgcaaatgatttaaaataggaagaaagcaggtgtct | |
| ggcccagaggaccagattaagaagaccccatgagag | |
| ttacaatagttagtgaaaatggtgcttctgcaaacc | |
| tcatgtctacagaagctggt | |
| SEQ ID NO: 007 | tgcaccttcataacataatctttctcctgggcccct |
| gtctctggctgcctcataaacgctggtgtttccctc | |
| gtgggcctccctgcatccctgcatctcctcccgggt | |
| cctgtctgtgagcaatacagcgtgacaccctacgct | |
| gccccgtggtcccgggcttgtctctccttgcctccc | |
| tgttacctttctttctatctcttccttgccccg | |
| SEQ ID NO: 008 | gtgagctccgcctcctgtcagatcagtggcggcatt |
| agtttctcataggagcatgaaatctattgtgaacag | |
| tacatgcgatggatccaggttgcgtgctcctagtga | |
| gaatctaatgcctgaggatctctcattgtctcttat | |
| cactcccagataggactgtctagttgcaggaaaaca | |
| agctcagggctcccactgattctacattacagtggg | |
| ttgtataattattatatattacaatgtaataataa | |
| SEQ ID NO: 009 | ggagtctgaggaggggaaggaggcaaggttggctcg |
| gatcccagccagtaagtctgggtgtgg | |
| SEQ ID NO: 010 | cttctccctgacatccgtgg |
| SEQ ID NO: 011 | acacagcatacgctatgcacatgtg |
| SEQ ID NO: 012 | gaggttgttcagatgaccacgg |
| SEQ ID NO: 013 | cagctactggagctgtcagaacag |
| SEQ ID NO: 014 | tgggcctccctgcatcc |
| SEQ ID NO: 015 | tccccctgcaccccacg |
| SEQ ID NO: 016 | tgacatccgtggagctgcagatgc |
| SEQ ID NO: 017 | acatgtgtccacacacaccccacc |
| SEQ ID NO: 018 | accacgggacacctttgaccctgg |
| SEQ ID NO: 019 | ctggagctgtcagaacagtgaagg |
| SEQ ID NO: 020 | tccctgcatccctgcatctcctcc |
| SEQ ID NO: 021 | cccacgacttctccagcactgagc |
| SEQ ID NO: 022 | gcaacactgtgacgtactggagg |
| SEQ ID NO: 023 | gtctatctaaaattcacaaggaatgc |
| SEQ ID NO: 024 | aggcaaagtaaaatccaagcaccc |
| SEQ ID NO: 025 | cactcctgcactccagcctgg |
| SEQ ID NO: 026 | caaccaccaaagtgcttttcctgg |
| SEQ ID NO: 027 | atatggcatctgtaaatattaccacc |
| SEQ ID NO: 028 | tgcctcggcctcccaaagtgc |
| SEQ ID NO: 029 | agccaccacacccagccagg |
| SEQ ID NO: 030 | aataactgttttctccccccaaaac |
| SEQ ID NO: 031 | tgttttacaaaaatggggccatacc |
| SEQ ID NO: 032 | acttaagcaaattctttcataaaaaggg |
| SEQ ID NO: 033 | ctttcaattgttgtaccaactctcc |
| SEQ ID NO: 034 | acctcctgcatctctccttttgc |
| SEQ ID NO: 035 | aaataaagttttgagaaccataagtgg |
| SEQ ID NO: 036 | caccatcacagctcactgcagc |
| SEQ ID NO: 037 | aacctctttgagaatcggatagcc |
| SEQ ID NO: 038 | aaataaagtacatacctccaattttgc |
| SEQ ID NO: 039 | gacacattcctatgggtttaattcc |
| SEQ ID NO: 040 | tgtaaaatatggtttcagaagggagg |
| SEQ ID NO: 041 | gcaggtggataacgaggtcagg |
| SEQ ID NO: 042 | ccagccaagaatttcaaagattagc |
| SEQ ID NO: 043 | gaagggagatgacaaagggaacg |
| SEQ ID NO: 044 | gcagaagaactgcttgaacctgg |
| SEQ ID NO: 045 | gtggtcccagctactcgagagg |
| SEQ ID NO: 046 | ccctcagcaaaactaactgaaaagg |
| SEQ ID NO: 047 | tagaaaccaagatatctagaattccc |
| SEQ ID NO: 048 | ccacgcccggcggaataaatgc |
| SEQ ID NO: 049 | acaaaaaaagaggcaaaaactgagag |
| SEQ ID NO: 050 | ctgggcgcagtggctcatgcc |
| SEQ ID NO: 051 | tggctgtgaggctgagaactgc |
| SEQ ID NO: 052 | ctgggcgacagagtgagactcc |
| SEQ ID NO: 053 | aagtctggctgggcgcagtgg |
| SEQ ID NO: 054 | aatggacaaaagaggtgaactggc |
| SEQ ID NO: 055 | gatagagtgaaaacgcacaatggc |
| SEQ ID NO: 056 | aattaaacagctaggtcaatatgagg |
| SEQ ID NO: 057 | ggtctccactatcaagggacaag |
| SEQ ID NO: 058 | aagcagctgttagtcatttccagg |
| SEQ ID NO: 059 | aggcatcctcagattatggctcc |
| SEQ ID NO: 060 | cctgagtaacactgagaccctgc |
| SEQ ID NO: 061 | aacactcaagctgtcaagagacac |
| SEQ ID NO: 062 | attcaggccaggcgcagtggc |
| SEQ ID NO: 063 | taaatcgtaaaactgccacaaagc |
| SEQ ID NO: 064 | cagaggagtaggagaaggaaaagg |
| SEQ ID NO: 065 | ggtagctatctaccaagtagaatcc |
| SEQ ID NO: 066 | atcagattggaaaaagtcccaaagc |
| SEQ ID NO: 067 | ctcctgaaaagcacctactcagc |
| SEQ ID NO: 068 | ctccttaaacctgaggtactggg |
| SEQ ID NO: 069 | ttttctcctaatagaccaccattcc |
| SEQ ID NO: 070 | ctgctgtattaccatcactcatgtc |
| SEQ ID NO: 071 | ctggccaacatagtgaaaccacg |
| SEQ ID NO: 072 | atttgaataggggttaaagtatcattg |
| SEQ ID NO: 073 | cacttcagtggaagttggcatgc |
| SEQ ID NO: 074 | gtttttcttcgaagtgataaacatacg |
| SEQ ID NO: 075 | gctccttagtctatgtacctgtgg |
| SEQ ID NO: 076 | tactctggcatggtaactggtgc |
| SEQ ID NO: 077 | acaaaggactaggtctgtggagc |
| SEQ ID NO: 078 | ccaagtttaccaaattaccaaagttacc |
| SEQ ID NO: 079 | tgagccgatatcacgccactgc |
| SEQ ID NO: 080 | tcccaataaaggttttggcccagg |
| SEQ ID NO: 081 | ctgggtagcaaattagggaacagg |
| SEQ ID NO: 082 | ctggccagaaaagacagttttatcc |
| SEQ ID NO: 083 | ggttcccaggaagggataacacc |
| SEQ ID NO: 084 | tcactccaggaggttccatttcc |
| SEQ ID NO: 085 | aggcttggaaataagcagcagtgg |
| SEQ ID NO: 086 | attcatacaatggaatactactcagc |
| SEQ ID NO: 087 | taagtgatcctcccacctcaacc |
| SEQ ID NO: 088 | tataagaggaagactggggctgg |
| SEQ ID NO: 089 | tcatacttatgcaggttataggagg |
| SEQ ID NO: 090 | caagatcacgccactgcactcc |
| SEQ ID NO: 091 | aaaataaatagctggtgctcaagatc |
| SEQ ID NO: 092 | caccagcctcattcaacagatgg |
| SEQ ID NO: 093 | caatgcagcctcaacctcctgg |
| SEQ ID NO: 094 | gttaggtcaggtgctcatgtctg |
| SEQ ID NO: 095 | aagtttcaaaaggacatgtacaaaatg |
| SEQ ID NO: 096 | tcctgaagaggctgcagcttcc |
| SEQ ID NO: 097 | ctggtgcacattcccaagtgtgc |
| SEQ ID NO: 098 | catgttggccatgttcttctgagg |
| SEQ ID NO: 099 | ctcagcctcccgagtagctgg |
| SEQ ID NO: 100 | aaagacatttaagaggagatgaggc |
| SEQ ID NO: 101 | tgctgggattacaggcgtgagc |
| SEQ ID NO: 102 | tgtgacttccatccgcagctcc |
| SEQ ID NO: 103 | gacacttttgtggagctttcatgg |
| SEQ ID NO: 104 | catgtgagggggcacgtcttgc |
| SEQ ID NO: 105 | tcttctctatgagaaaagtggttgc |
| SEQ ID NO: 106 | tggcaaaatgctatcgagctgcc |
| SEQ ID NO: 107 | tatgaacacagccggcctcagg |
| SEQ ID NO: 108 | gaggttgcagtgagctgagatcg |
| SEQ ID NO: 109 | gtcaagcacccagtccgatacc |
| SEQ ID NO: 110 | atctgggcttggtggcgcacg |
| SEQ ID NO: 111 | gttaagcgggtcccacatcagc |
| SEQ ID NO: 112 | cagccagtttcagtagaaagatgc |
| SEQ ID NO: 113 | gacccaagcataaggggactagc |
| SEQ ID NO: 114 | cccaaaaagtttacaagagaaattttc |
| SEQ ID NO: 115 | cgcctgtagtcccagctactcg |
| SEQ ID NO: 116 | cgcgtgatgcggaaaagaaatcc |
| SEQ ID NO: 117 | tctactatgaaccctccttcagac |
| SEQ ID NO: 118 | gtgctgggattacaggtgtgagc |
| SEQ ID NO: 119 | ttatccaaatgtcccagggcagg |
| SEQ ID NO: 120 | ctgccagcactgctcgccagc |
| SEQ ID NO: 121 | gctactgcaggcagtgccttcc |
| SEQ ID NO: 122 | catccaagcccaaggtgtcagg |
| SEQ ID NO: 123 | tgtttgcatgtaatttcaggaagcc |
| SEQ ID NO: 124 | gatccgtcactgttaacactcagg |
| SEQ ID NO: 125 | ctcacagtcacaagctcctgagc |
| SEQ ID NO: 126 | gagatgatgctggggtcacagg |
| SEQ ID NO: 127 | ttagaagaatgggatcgcaaagg |
| SEQ ID NO: 128 | cggtattcaaatatgaggtcaggc |
| SEQ ID NO: 129 | gtaaatcctgctgccagtcttcc |
| SEQ ID NO: 130 | acagggtcagacagagccttgg |
| SEQ ID NO: 131 | agttattgatctaactatacaacaagc |
| SEQ ID NO: 132 | aaagactaggggccggggacg |
| SEQ ID NO: 133 | ctggtagaaataaagacaacaaagcc |
| SEQ ID NO: 134 | gtgccaagtaattaaaagtttgaaacc |
| SEQ ID NO: 135 | ggcttttgaagggagcaccacc |
| SEQ ID NO: 136 | gaaggataaatacctatgatactttcc |
| SEQ ID NO: 137 | ggcagggaaatactgtgcttcaag |
| SEQ ID NO: 138 | gtggtgaaattccacctcagtacc |
| SEQ ID NO: 139 | tcccaaagtgctgggattacagg |
| SEQ ID NO: 140 | gaaattagcaaacaatgccaagacg |
| SEQ ID NO: 141 | taagtattggaccgggaaggagg |
| SEQ ID NO: 142 | ctatcattttgctcaaagtgtagcc |
| SEQ ID NO: 143 | atttcacaaactacagaggccagg |
| SEQ ID NO: 144 | tagacttctgtctctctatgctgc |
| SEQ ID NO: 145 | tgagtgagctgccatgtgatacc |
| SEQ ID NO: 146 | acttcacaccagcctgtccacc |
| SEQ ID NO: 147 | taactcatatcctcagagagaccc |
| SEQ ID NO: 148 | agaggttcctcgattcccctgc |
| SEQ ID NO: 149 | gtgtcagcgtcccaacacaaagc |
| SEQ ID NO: 150 | gaaagtggatgggcaagcattgc |
| SEQ ID NO: 151 | gtgatcacctcacagctgcagg |
| SEQ ID NO: 152 | gtttgtttagtcaaggcatttcacc |
| SEQ ID NO: 153 | cctcagcctccagagtagctgg |
| SEQ ID NO: 154 | taaaagaaaactcctccttcctgg |
| SEQ ID NO: 155 | aatgtgctatgtctttaaatccatgg |
| SEQ ID NO: 156 | agctggcaaatctggtaatataaaag |
| SEQ ID NO: 157 | gcttgaacctggaaggtggagg |
| SEQ ID NO: 158 | gcaggcatgctaagaccttcagc |
| SEQ ID NO: 159 | cagctccatgaataactccacagg |
| SEQ ID NO: 160 | gcttgaacccaggaggcagagg |
| SEQ ID NO: 161 | atcgaagatgccactgcaagagg |
| SEQ ID NO: 162 | ccaaccacacttcaggggatacc |
| SEQ ID NO: 163 | cacgccagtccactgatactcac |
| SEQ ID NO: 164 | gggtttcaccatgttggccagg |
| SEQ ID NO: 165 | cccaacaaaggctctggcctgg |
| SEQ ID NO: 166 | atgacagcagaggagcttcatcc |
| SEQ ID NO: 167 | gcaggctacgagtaaaaggatgg |
| SEQ ID NO: 168 | cgggtaaaatcttgcctccttcc |
| SEQ ID NO: 169 | aaacttaaaccaatggtggatgtgg |
| SEQ ID NO: 170 | agagactgaggaactgttccagc |
| SEQ ID NO: 171 | gaaacggtcttggatcactgatcc |
| SEQ ID NO: 172 | tgcgcatgatatcttgtttcaggg |
| SEQ ID NO: 173 | ggcctccgtttaaactgttgtgc |
| SEQ ID NO: 174 | gaatgctggcccgacacagtgg |
| SEQ ID NO: 175 | tcttggtatagaaaagccagctgg |
| SEQ ID NO: 176 | gcaaaagcccaagagcccctgg |
| SEQ ID NO: 177 | ttctcccaaaatgagccccaagg |
| SEQ ID NO: 178 | gtggtgacgtaaacaaaaggtacc |
| SEQ ID NO: 179 | gcaaattccatgtgaatcttattggc |
| SEQ ID NO: 180 | cctgatctatggaacagtggtgg |
| SEQ ID NO: 181 | gttacaaacgttgcagtttgcaacg |
| SEQ ID NO: 182 | gaaccccgtcaacagtgatcacc |
| SEQ ID NO: 183 | acaggacctcaaggcaaggagc |
| SEQ ID NO: 184 | catacctaaaatagaaatgtctatccc |
| SEQ ID NO: 185 | gagttgcatatatgttttataaatccc |
| SEQ ID NO: 186 | tgagcccacatccataaagttagc |
| SEQ ID NO: 187 | accgcaacctttgccgcctgg |
| SEQ ID NO: 188 | taaatattttgtatggagtcaccacc |
| SEQ ID NO: 189 | aaagccaggagaaaaagttatgagg |
| SEQ ID NO: 190 | tcccaaagtcccaggattacagg |
| SEQ ID NO: 191 | tcactatggagcatctccgatgg |
| SEQ ID NO: 192 | agttccctggaagtctccgagg |
| SEQ ID NO: 193 | aaaataatcacccagcccacatcc |
| SEQ ID NO: 194 | acaaaactacagacacagaaagtgg |
| SEQ ID NO: 195 | tttgggaggctgaggtaggtgg |
| SEQ ID NO: 196 | aaagacagtgaaacatctataaggg |
| SEQ ID NO: 197 | cattttgggagaccagggcagg |
| SEQ ID NO: 198 | gcatgggacagacacaaagcagc |
| SEQ ID NO: 199 | gaataacaaagagagccggctgg |
| SEQ ID NO: 200 | taaaccttttattgaaaattgtcaaatgg |
| SEQ ID NO: 201 | cgcctcagcctcccaaagtgc |
| SEQ ID NO: 202 | tacattagttttataggtccagtagg |
| SEQ ID NO: 203 | gaaggtttattcatattaaaatgtgcc |
| SEQ ID NO: 204 | ctggcttctgtggtttgagttgg |
| SEQ ID NO: 205 | acagacctacctcctaaggatgg |
| SEQ ID NO: 206 | gctagcttttgtgtgtaagaatggg |
| SEQ ID NO: 207 | ggcctactcacacaatagaatacc |
| SEQ ID NO: 208 | gcaccattgcactccagcctgg |
| SEQ ID NO: 209 | gaaattaggataaaggttgtcacagc |
| SEQ ID NO: 210 | cagaagtgttcaaggtgaaactgtc |
| SEQ ID NO: 211 | ctgaatcatgaaatgttctactctgc |
| SEQ ID NO: 212 | tgtcaacttgactgggccatacg |
| SEQ ID NO: 213 | ctcccgtatagttgggattatagg |
| SEQ ID NO: 214 | gcttggagttccttgaaattcttgg |
| SEQ ID NO: 215 | cctggtggctccagttttctacc |
| SEQ ID NO: 216 | aactcctgacctcatgatccacc |
| SEQ ID NO: 217 | gctgggattacaggcatgagcc |
| SEQ ID NO: 218 | ttctcctttatccttggtgacattc |
| SEQ ID NO: 219 | tcccaaagtgctgggattacagg |
| SEQ ID NO: 220 | gtcataagtcagggaccatctgc |
| SEQ ID NO: 221 | ctgtttcattgatttccagactggc |
| SEQ ID NO: 222 | gcaatctcggctcactgcaagc |
| SEQ ID NO: 223 | gaagaagtgactatatcagatctgg |
| SEQ ID NO: 224 | ttcaccatgttggccaggctgg |
| SEQ ID NO: 225 | catcactgaagatgacaactgagc |
| SEQ ID NO: 226 | gtccagcctgggcgatagagc |
| SEQ ID NO: 227 | gaggaaagtctttgaagaggaacc |
| SEQ ID NO: 228 | ggtacactcaccagcagttttgc |
| SEQ ID NO: 229 | gagcaactggtgtgaatacatatgg |
| SEQ ID NO: 230 | caatacctggcaccacatacacc |
| SEQ ID NO: 231 | gggactacaggcatgtgccacc |
| SEQ ID NO: 232 | cggtggctcacgcgtgtaatcc |
| SEQ ID NO: 233 | caactgttaaatctctcatggaaacc |
| SEQ ID NO: 234 | gacaaaggattagaaatgcaccc |
| SEQ ID NO: 235 | ggaaatgttctaaaactggattgtgg |
| SEQ ID NO: 236 | aataataatagccaggtgtggtagc |
| SEQ ID NO: 237 | ctggaacactcacacattgctgg |
| SEQ ID NO: 238 | ctgggtgacagagcgagactcc |
| SEQ ID NO: 239 | cccaaatcatccccgtgaaacatgc |
| SEQ ID NO: 240 | gaccctgcaatcccaacactgg |
| SEQ ID NO: 241 | ctctcaggccttcaaactacacc |
| SEQ ID NO: 242 | caggaaagggctcgctcagtgg |
| SEQ ID NO: 243 | atctgcaaaagcagcagagcagg |
| SEQ ID NO: 244 | gtacccatgacagacaagttttagg |
| SEQ ID NO: 245 | cttatcccctactgtctcctttgg |
| SEQ ID NO: 246 | ggatggtctcgatctcctgacc |
| SEQ ID NO: 247 | aggttagagaccttcctctaatgc |
| SEQ ID NO: 248 | agctgggattacaggtgcctgc |
| SEQ ID NO: 249 | gctgaggcaggttggggctgc |
| SEQ ID NO: 250 | acatttaacgtctcctaacttctcc |
| SEQ ID NO: 251 | gtgctgcgattacaggtgtgagc |
| SEQ ID NO: 252 | tatgacagcagtattatactatcacc |
| SEQ ID NO: 253 | ctggggaccaaatctgaactgcc |
| SEQ ID NO: 254 | gtagctattgttatttccaaaagagg |
| SEQ ID NO: 255 | gcttgggaccccaggacaagg |
| SEQ ID NO: 256 | cctggccaacatggggaaatcc |
| SEQ ID NO: 257 | aattgcttgaacctgggaggtgg |
| SEQ ID NO: 258 | gcctaagacccaaaagctattagc |
| SEQ ID NO: 259 | catattaaagggccatattcaaattgg |
| SEQ ID NO: 260 | ggatgtaaccagtgtatatcacagg |
| SEQ ID NO: 261 | ggaagtttagtccacatcttctagc |
| SEQ ID NO: 262 | gcacccacaggacaaccacacg |
| SEQ ID NO: 263 | gggacgcgcctgttaacaaagg |
| SEQ ID NO: 264 | gggctgggggccacgctcc |
| SEQ ID NO: 265 | cgcaaaagtgaagccctcctgg |
| SEQ ID NO: 266 | gaaatcctacttgatctaaagtgagc |
| SEQ ID NO: 267 | tttgagcaacttggaaaaaataagcg |
| SEQ ID NO: 268 | ttcccaaaagacaaatagcacttcc |
| SEQ ID NO: 269 | ccattttgaaaatcacagtgaattcc |
| SEQ ID NO: 270 | gaaaagaaaaccctgaattcaaaagg |
| SEQ ID NO: 271 | tgctgaaaagaagcatttaaaagtgg |
| SEQ ID NO: 272 | ctcttaccagtttcagagctttcc |
| SEQ ID NO: 273 | ttttcagccaaaaatcaaggacagg |
| SEQ ID NO: 274 | cttgagcccaggagtttgagacc |
| SEQ ID NO: 275 | cgcctgtagtaccctctactagg |
| SEQ ID NO: 276 | ggtaaagaaagaaggatttgaaaacc |
| SEQ ID NO: 277 | taagagtaatgaggttaaagtttatgc |
| SEQ ID NO: 278 | catttttattgtcacaggccatttgc |
| SEQ ID NO: 279 | gccacgccttctcttctgccacc |
| SEQ ID NO: 280 | tgcctctcctgactgcactgtg |
| SEQ ID NO: 281 | ccatgctctaccacgcccttgg |
| SEQ ID NO: 282 | cattcaggctggagtgcggtgg |
| SEQ ID NO: 283 | cttaaaaattgtctggctaagacattg |
| SEQ ID NO: 284 | ttgctcttgttgcccgggttgg |
| SEQ ID NO: 285 | gagcttagaggaaaagtattatttcc |
| SEQ ID NO: 286 | tggtgctgtgccagacgctgg |
| SEQ ID NO: 287 | cagatctttttggctattgtcttgg |
| SEQ ID NO: 288 | gaaggaaagggcctcccactgc |
| SEQ ID NO: 289 | catgaaaaagcatgctggggagg |
| SEQ ID NO: 290 | caaacataaaaaagctttaatagaagcc |
| SEQ ID NO: 291 | tcccaactatgaaaaaatagaagacg |
| SEQ ID NO: 292 | cacaaattagccgggcatggtgg |
| SEQ ID NO: 293 | cttcctttactgagtctttctaaagc |
| SEQ ID NO: 294 | tgtcctttgaaatgtaggtatgtgg |
| SEQ ID NO: 295 | ggatcttgcaatactgacatctcc |
| SEQ ID NO: 296 | atttgaaaagaactgaaggatctacc |
| SEQ ID NO: 297 | gtgagctgagatctcgtctctgc |
| SEQ ID NO: 298 | tttgtctgaaacagattctaaaagttgg |
| SEQ ID NO: 299 | gcaggtgcctgtagtcccagc |
| SEQ ID NO: 300 | gtttgagcttctaaaattcatggattc |
| SEQ ID NO: 301 | gtggtaggtcaaaccgcaattcc |
| SEQ ID NO: 302 | accaaatcagacatatcagctttgg |
| SEQ ID NO: 303 | cacagaacggatcctcaataaagg |
| SEQ ID NO: 304 | gttaactcctcccttctctttatgg |
| SEQ ID NO: 305 | gtgttcagagagcttgatttccagg |
| SEQ ID NO: 306 | cccacttgatttttcccacatgg |
| SEQ ID NO: 307 | atttatttagatgaagtgaatattttcc |
| SEQ ID NO: 308 | atttagtttgtttaactgtgagtgc |
| SEQ ID NO: 309 | gtacagaagtgcttgatgcatacc |
| SEQ ID NO: 310 | aggcagataaaaattctccattagc |
| SEQ ID NO: 311 | acaagcacgagccacagcacc |
| SEQ ID NO: 312 | cgctcttgttgcccaggctgg |
| SEQ ID NO: 313 | cccaaaacagactttctagataacc |
| SEQ ID NO: 314 | ttcaaattgctttttttctactcacc |
| SEQ ID NO: 315 | gatctgaaaaaagtgacaggttgg |
| SEQ ID NO: 316 | cactgaaatttgaaaggaacatatgg |
| SEQ ID NO: 317 | tctggtgcagtggcctctagg |
| SEQ ID NO: 318 | accataagtggttttacctgatgg |
| SEQ ID NO: 319 | cccaggcgcaggtgattctcc |
| SEQ ID NO: 320 | ggtggctcacgcctgaaatcc |
| SEQ ID NO: 321 | cacagtccacgtgccacaatcc |
| SEQ ID NO: 322 | aatcatgttaacacatccctctcc |
| SEQ ID NO: 323 | gaagagagtgttgaaaggttaagc |
| SEQ ID NO: 324 | cgagaccatactggctaagatgg |
| SEQ ID NO: 325 | attagccacacaataaatgttctgg |
| SEQ ID NO: 326 | tttgaaaagcgttgcaatatgatgc |
| SEQ ID NO: 327 | ggttgcagtgagccgagatcg |
| SEQ ID NO: 328 | ggtgggaggactgcctgagc |
| SEQ ID NO: 329 | aacagagagaaaaaacacaaattacc |
| SEQ ID NO: 330 | gatatctagaattcccaaatacttgg |
| SEQ ID NO: 331 | gtgatagaattaaaggaaaaaataaacg |
| SEQ ID NO: 332 | attgttccttttctaaatattctacc |
| SEQ ID NO: 333 | cagcactttgggaggctgagg |
| SEQ ID NO: 334 | cacagaggtttcacagtgctgg |
| SEQ ID NO: 335 | aacttctgcttctgtccataatgc |
| SEQ ID NO: 336 | gcctgtaatcccagcactttgg |
| SEQ ID NO: 337 | gccagtaaacatatgaaaaggtgc |
| SEQ ID NO: 338 | aattatgtaaataaagagtgaaaagg |
| SEQ ID NO: 339 | cccctacacagaaaaaacaattcc |
| SEQ ID NO: 340 | tgagtgtcaaagaaaaatacaattgg |
| SEQ ID NO: 341 | atacacagagaaaatgagtccacc |
| SEQ ID NO: 342 | aacactccccttctctgtttagc |
| SEQ ID NO: 343 | gatattctttgcaacctaggatgc |
| SEQ ID NO: 344 | ctctaaaactaatcagcaatgtaacc |
| SEQ ID NO: 345 | cacctgtaatcccagcactttgg |
| SEQ ID NO: 346 | cgtaaaactgccacaaagcttgtagg |
| SEQ ID NO: 347 | gtggcagaggtgcaagcaagc |
| SEQ ID NO: 348 | acagaaatgacaaacgcatgtacc |
| SEQ ID NO: 349 | acactctcttagctaggctttgg |
| SEQ ID NO: 350 | gagcttggaatagggcagttcc |
| SEQ ID NO: 351 | ctgggttctttaaacatgtccagg |
| SEQ ID NO: 352 | tcaagaaaggacactgcagtggc |
| SEQ ID NO: 353 | catgcacacaaactatctcattcc |
| SEQ ID NO: 354 | tagccgggcatggtggcacg |
| SEQ ID NO: 355 | atcatgctgattgaatttcaaatagc |
| SEQ ID NO: 356 | ttggcatgcagggcagtgacc |
| SEQ ID NO: 357 | ggtggtgagataataacacctgc |
| SEQ ID NO: 358 | ttgctatataataatcatttgtgatcc |
| SEQ ID NO: 359 | cggtaactgttactctgggatgg |
| SEQ ID NO: 360 | aggctaggttcccttctcttcc |
| SEQ ID NO: 361 | gtagtgcctagcacagagaaagc |
| SEQ ID NO: 362 | ctagcctgggcaacaagagcg |
| SEQ ID NO: 363 | tctctctcctctctgggatcag |
| SEQ ID NO: 364 | gtttgaatatttgtatgcagcaagc |
| SEQ ID NO: 365 | tagaacaaattctggcttataaaagc |
| SEQ ID NO: 366 | ccactctacctttattccttgcc |
| SEQ ID NO: 367 | agaccagaatatgcaagcagagg |
| SEQ ID NO: 368 | ggacgttttgctggtgtctgcg |
| SEQ ID NO: 369 | aaggaacaaactgttgtcacatgc |
| SEQ ID NO: 370 | atgtagctgggactacaggtgc |
| SEQ ID NO: 371 | ggctcatgcctgtaatcccagc |
| SEQ ID NO: 372 | atgaggttttcacacaaaaagatgc |
| SEQ ID NO: 373 | tgggcgacagagcaagactcc |
| SEQ ID NO: 374 | aaatgtccctaaaagtgatcaacagc |
| SEQ ID NO: 375 | cagactcagttttacctcatcagc |
| SEQ ID NO: 376 | agtgatctttcctctttaacctcc |
| SEQ ID NO: 377 | ccagctattcaggaggccaagg |
| SEQ ID NO: 378 | cttaaacattatgacactgtcttgc |
| SEQ ID NO: 379 | ccaggtctatgaggccgttcc |
| SEQ ID NO: 380 | tccaaagcatccctacattatacc |
| SEQ ID NO: 381 | acatacatacatgcagtgactagc |
| SEQ ID NO: 382 | tacaggtgccagccaccatgc |
| SEQ ID NO: 383 | gcctgtaatcccagcactctgg |
| SEQ ID NO: 384 | gacagagtcccactcttgttgc |
| SEQ ID NO: 385 | gtgccttccaaagcagtgtagg |
| SEQ ID NO: 386 | tatcttactgggtatgtataatgcc |
| SEQ ID NO: 387 | caaaggaaatacgtcctaccagg |
| SEQ ID NO: 388 | ccttttctcacagacatgcttcc |
| SEQ ID NO: 389 | taaacacagtgagcagaatccc |
| SEQ ID NO: 390 | ataaagcaaacttctaaaagggtcc |
| SEQ ID NO: 391 | accactacactccagcctggg |
| SEQ ID NO: 392 | gatacctgggtcagagtaagtgc |
| SEQ ID NO: 393 | tgtaatctcagctacttgggagg |
| SEQ ID NO: 394 | gtgtcgtcttctcttcctctacg |
| SEQ ID NO: 395 | ctggctagtatgaggttggtgc |
| SEQ ID NO: 396 | ggactagccacatttcaaccagg |
| SEQ ID NO: 397 | gcagtatactgagaatttagtttcc |
| SEQ ID NO: 398 | gaggctgaggcaggagaatgg |
| SEQ ID NO: 399 | cattgtttgatgaaggtcaacagc |
| SEQ ID NO: 400 | cagacaagagtggctacggcag |
| SEQ ID NO: 401 | acgcccagccagattattcagg |
| SEQ ID NO: 402 | ggaaccagaaagaagtgcaaagg |
| SEQ ID NO: 403 | tgagccatcttggaggcaggc |
| SEQ ID NO: 404 | caggaccttcctacaaacctcc |
| SEQ ID NO: 405 | aacacaacatatctgaccttacgc |
| SEQ ID NO: 406 | gccttagaagtccagaggaaagc |
| SEQ ID NO: 407 | tgacgtacccagtagaccttcc |
| SEQ ID NO: 408 | ctctgcaagcctgggaaacagg |
| SEQ ID NO: 409 | gccttgtccccaagtcctaagg |
| SEQ ID NO: 410 | gcaaagggactcctggaattcc |
| SEQ ID NO: 411 | gctcctgcctgtaatcccagc |
| SEQ ID NO: 412 | gaaggaaacagaaaaagcagaggc |
| SEQ ID NO: 413 | cttactaccgttcttcttcactgg |
| SEQ ID NO: 414 | actattctgtttctttaggtttactgc |
| SEQ ID NO: 415 | cggtggctcacacctgtaatcc |
| SEQ ID NO: 416 | agccagagttctgtgctctagg |
| SEQ ID NO: 417 | taatttgcatttcgtgccgctcc |
| SEQ ID NO: 418 | cacttttaatacagatcccaatagg |
| SEQ ID NO: 419 | atgtattttttcttttcctgtcaagc |
| SEQ ID NO: 420 | aaatgttaacattattctccctaagg |
| SEQ ID NO: 421 | catatgcccagatcccgtctcc |
| SEQ ID NO: 422 | acaggtgtgagccgctgcacc |
| SEQ ID NO: 423 | gccaagacgtttacagttttggc |
| SEQ ID NO: 424 | aggaaacttctgaggatgatggg |
| SEQ ID NO: 425 | gctttatagggcagtctgaattcc |
| SEQ ID NO: 426 | ttagaataaaagttatctcgggagg |
| SEQ ID NO: 427 | taatttcttcagctttatccctcag |
| SEQ ID NO: 428 | cacatgactaattctctattcattcc |
| SEQ ID NO: 429 | aaagacctcaagaaaagagtcacc |
| SEQ ID NO: 430 | gacccataaagattatatgcccag |
| SEQ ID NO: 431 | aaagtactaatgcagtgtgtcagc |
| SEQ ID NO: 432 | gaggttcctcgattcccctgc |
| SEQ ID NO: 433 | ggagagcagaggaattcacagg |
| SEQ ID NO: 434 | agtaattagaaactgattctaagacg |
| SEQ ID NO: 435 | cataccattgccaatccagttcc |
| SEQ ID NO: 436 | attacgggtgcctgccactgc |
| SEQ ID NO: 437 | cagccaggcagaggagagagg |
| SEQ ID NO: 438 | ttttcattccaagtttctgtttggg |
| SEQ ID NO: 439 | tttcaaataggaatttggataatccc |
| SEQ ID NO: 440 | taagccgagatcacaccactgc |
| SEQ ID NO: 441 | ccttcagcgcattatatcttggc |
| SEQ ID NO: 442 | ccatctaatccatcttaaattcacc |
| SEQ ID NO: 443 | gagtggagactgcgccactgc |
| SEQ ID NO: 444 | aatcatgtgccaattaaaccatggc |
| SEQ ID NO: 445 | cccagggaccagaccagacc |
| SEQ ID NO: 446 | ctcactcaccagtgaaaatcagc |
| SEQ ID NO: 447 | ggttgctctcgaactcctgacc |
| SEQ ID NO: 448 | gttcccccagctcctttctgc |
| SEQ ID NO: 449 | agaaagatgtagaagggtccagc |
| SEQ ID NO: 450 | gggaaaaggtgtattatgcaagcg |
| SEQ ID NO: 451 | ctctctcagacctaatgcaaaagc |
| SEQ ID NO: 452 | aactatacatacagtatttgtattagc |
| SEQ ID NO: 453 | aaattaatgcaatccatgatccagg |
| SEQ ID NO: 454 | ctttctccactctaagagaaccc |
| SEQ ID NO: 455 | ttttggtgtgttcatattggctgc |
| SEQ ID NO: 456 | gcttccacaaatgacagacaaagg |
| SEQ ID NO: 457 | ggctcatgcttgtaatcccagc |
| SEQ ID NO: 458 | catatgaattgttgttcctttgtagg |
| SEQ ID NO: 459 | cactggtacaagtccaagagtcc |
| SEQ ID NO: 460 | gaccctgtgtctacttcctggg |
| SEQ ID NO: 461 | tatttgaactatctcttgaaatgtcc |
| SEQ ID NO: 462 | ctgattaaaaagtattacccttggc |
| SEQ ID NO: 463 | tttgaaactgcactcaataacttgg |
| SEQ ID NO: 464 | agtaatgtgtcatgatccaatggc |
| SEQ ID NO: 465 | gaaagcatttcccaatgtctcacc |
| SEQ ID NO: 466 | caatggacaaaaggcccaactgc |
| SEQ ID NO: 467 | tccagctctggcttttttgttaag |
| SEQ ID NO: 468 | acggagtctcactccgtgacc |
| SEQ ID NO: 469 | ctatgtcatagtcaagagactttgc |
| SEQ ID NO: 470 | gttcaagcgattctcctgtctcg |
| SEQ ID NO: 471 | ccacctaatacttaaatacggaagc |
| SEQ ID NO: 472 | atattcaacaaacttaatagtgaagtg |
| SEQ ID NO: 473 | ttacaggcgtgagtcaccatgc |
| SEQ ID NO: 474 | aacacctccaagaggccaaacg |
| SEQ ID NO: 475 | tactattggcaaatttcaattatatgg |
| SEQ ID NO: 476 | agcccacatcctaaaattcaataag |
| SEQ ID NO: 477 | gaaagtggataagtgtttgtctgg |
| SEQ ID NO: 478 | ggccaggcattcaagaccagc |
| SEQ ID NO: 479 | agccaacaacaaaaagacacaacc |
| SEQ ID NO: 480 | ttgagcccaggagttcaagacc |
| SEQ ID NO: 481 | cagactaaagatctcagagagaaac |
| SEQ ID NO: 482 | cgcttgtaatcccagcacttgg |
| SEQ ID NO: 483 | aaaagtgaaatcagaatttgtttcc |
| SEQ ID NO: 484 | caggcgtgagcaactgtgtcc |
| SEQ ID NO: 485 | ggtccagtaggatctcgtttgc |
| SEQ ID NO: 486 | actttgaaaatgttgttatagctggg |
| SEQ ID NO: 487 | ttccctgcatctaagtcttctcc |
| SEQ ID NO: 488 | agatatctaccattgaagagtttgc |
| SEQ ID NO: 489 | agtcttcacttcactttgttgtcc |
| SEQ ID NO: 490 | ccatgcaggtatgaaatataaaagc |
| SEQ ID NO: 491 | tgggtgacagagtgagactcc |
| SEQ ID NO: 492 | acagcaataccgggttaacatgc |
| SEQ ID NO: 493 | tttatgtaaaagatgaatgcgaggc |
| SEQ ID NO: 494 | ctactctgctactgggaacagg |
| SEQ ID NO: 495 | caaacgttagtctggcaaaatgcg |
| SEQ ID NO: 496 | tgcacgctaccacacccagc |
| SEQ ID NO: 497 | aattcttggatctgtgtgtttactgc |
| SEQ ID NO: 498 | taccagttatcattctctttctgc |
| SEQ ID NO: 499 | atccacccacctcggcctcc |
| SEQ ID NO: 500 | cactctgcctggcccttaatgg |
| SEQ ID NO: 501 | atagtttgtttaatatgccactaagg |
| SEQ ID NO: 502 | gcgtgagccaccgcacctgg |
| SEQ ID NO: 503 | ctccatcacacaaattttatgtggc |
| SEQ ID NO: 504 | agacggagtctcgttctgtcgc |
| SEQ ID NO: 505 | tcccaggttcaagccattctcc |
| SEQ ID NO: 506 | tattttgagagtctcactctgtcg |
| SEQ ID NO: 507 | gtctcgaactcctgacctcagg |
| SEQ ID NO: 508 | aaggaggtgaagagtgaactacg |
| SEQ ID NO: 509 | gtctcaggttttggacttacttgg |
| SEQ ID NO: 510 | tttacagatcttaaatgcattaggac |
| SEQ ID NO: 511 | gtacactgaacaaaggagacagg |
| SEQ ID NO: 512 | ctggtagtaatgcaaaatagcacc |
| SEQ ID NO: 513 | catttaatgtgaaatgaattataagcc |
| SEQ ID NO: 514 | gagacagggtttcactatgttgg |
| SEQ ID NO: 515 | ccagcactttggaaggctgagg |
| SEQ ID NO: 516 | gaaaccaagtatcatggtaaattgc |
| SEQ ID NO: 517 | cagtgagggctgctcagttcc |
| SEQ ID NO: 518 | gccaggtgcggtggctcacg |
| SEQ ID NO: 519 | catgcctgtaatcccagctacc |
| SEQ ID NO: 520 | atgtaaatggtacagtcactttagg |
| SEQ ID NO: 521 | cccacaatacagagaactcttacc |
| SEQ ID NO: 522 | tgaaacatgcagcccagtgtcc |
| SEQ ID NO: 523 | tgttttttctcctgccttcaatcc |
| SEQ ID NO: 524 | gctttcctgggtctccatctgg |
| SEQ ID NO: 525 | gcagccgcttgaaaacaaaacagc |
| SEQ ID NO: 526 | gatcacgttacatttgggggtgg |
| SEQ ID NO: 527 | taggctgaaaaactaaaatttgttgc |
| SEQ ID NO: 528 | ctcctttgggctcctttagtcc |
| SEQ ID NO: 529 | gcctcggcctcccaaagtgc |
| SEQ ID NO: 530 | aatgcctagagagatttggcagg |
| SEQ ID NO: 531 | gagatggggtttcactatgttgg |
| SEQ ID NO: 532 | tgtgatcttgccactgcactcc |
| SEQ ID NO: 533 | acttctcctccatttgtttcttcg |
| SEQ ID NO: 534 | cgtgcccgggctcagttctac |
| SEQ ID NO: 535 | ccaaaacaataaaatcacaatttggg |
| SEQ ID NO: 536 | ctgaactgccttagagtaaatccg |
| SEQ ID NO: 537 | atttctgtatcaggtctgtgttcc |
| SEQ ID NO: 538 | ggctgaccccttcactgtttcc |
| SEQ ID NO: 539 | caaaaattagccaggcatggtgg |
| SEQ ID NO: 540 | gcagtgagcagtgatcgcacc |
| SEQ ID NO: 541 | aaagactgtgaactaacttgtttgc |
| SEQ ID NO: 542 | tgccaagaattacacattattaggc |
| SEQ ID NO: 543 | ggccaggatgtcattaactttcc |
| SEQ ID NO: 544 | gtaagagctgacgtgtattgtgc |
| SEQ ID NO: 545 | cccggtgaggccgcacatcc |
| SEQ ID NO: 546 | cctgcgccttaaccccctcc |
| SEQ ID NO: 547 | cggcgcctaggggccatcg |
| SEQ ID NO: 548 | acttaaggaaacgaacatgacacc |
| SEQ ID NO: 549 | gagaccgagtcttgctgtgtcg |
| SEQ ID NO: 550 | gtattaattgaagatgatttggaatgc |
| SEQ ID NO: 551 | tctttaaaagactatcgctgaggc |
| SEQ ID NO: 552 | aaaagagacatcagtagagcatcc |
| SEQ ID NO: 553 | gttcatgttttctttgacgtctcc |
| SEQ ID NO: 554 | tttcgaaagttcaggctgagtgc |
| SEQ ID NO: 555 | gaccctcaaaacaatcctctaagg |
| SEQ ID NO: 556 | caaaacacacttagaaacaaactgc |
| SEQ ID NO: 557 | gcctgggcgacatagtgagacc |
| SEQ ID NO: 558 | ggcaggagaatggcgtgaacc |
| SEQ ID NO: 559 | tttgctcgttgcccaggctgg |
| SEQ ID NO: 560 | gcaacttaatgtgatagaataatagc |
| SEQ ID NO: 561 | cctccccttctgctgccagc |
| SEQ ID NO: 562 | ccacaacaatgtaaactcctctgg |
| SEQ ID NO: 563 | tactctccctagagttcgttccc |
| SEQ ID NO: 564 | gggtccccctttggccattcc |
| SEQ ID NO: 565 | gatcttggctcacttcaacctcc |
| SEQ ID NO: 566 | aggggaaatatttaaaccttgg |
| SEQ ID NO: 567 | aatgcaatggtgcatttacagagg |
| SEQ ID NO: 568 | tcattttatctatttctacatggtcc |
| SEQ ID NO: 569 | ggaagggaaatgcccatgaacc |
| SEQ ID NO: 570 | agtgaacattttctgcagcctcc |
| SEQ ID NO: 571 | caacaggacgtcaggcgatcc |
| SEQ ID NO: 572 | ccttcaggctgtcctgaaaagg |
| SEQ ID NO: 573 | agtctcactccatcgcccagg |
| SEQ ID NO: 574 | actgtgaacagtagttaactcagg |
| SEQ ID NO: 575 | gcatgcctgtaatccaagctgc |
| SEQ ID NO: 576 | gaaacaattctcttttcacacttgc |
| SEQ ID NO: 577 | ggctcatgcctgttatcccagc |
| SEQ ID NO: 578 | agaagaagcttagtcatatgtttgg |
| SEQ ID NO: 579 | cagatgcttgagccaaacaaatgg |
| SEQ ID NO: 580 | ctggcagacagagtgagactcc |
| SEQ ID NO: 581 | aatgtgtgaatattattcattacaggg |
| SEQ ID NO: 582 | gcaggagaattgcttgaacctgg |
| SEQ ID NO: 583 | ctttagtcaaattaaaacagtctatcc |
| SEQ ID NO: 584 | gatttctatctcctgcaaccacc |
| SEQ ID NO: 585 | ttcttgtgtaactactaaaaatctcc |
| SEQ ID NO: 586 | aaagggtcttcataaggctaatgg |
| SEQ ID NO: 587 | ctcttaaggattatttatatgaagacc |
| SEQ ID NO: 588 | caggaggagccccagagc |
| SEQ ID NO: 589 | tcctggggatggttggatgc |
| SEQ ID NO: 590 | tgaccccacagagtttacacagc |
| SEQ ID NO: 591 | agtcagggcaggctctgcc |
| SEQ ID NO: 592 | tattttggccccatccagaaagc |
| SEQ ID NO: 593 | cacccagagtacagctttgttcc |
| SEQ ID NO: 594 | gaggagccccagagcctgc |
| SEQ ID NO: 595 | tggggatggttggatgcttacc |
| SEQ ID NO: 596 | cccacagagtttacacagcttgc |
| SEQ ID NO: 597 | caggctctgcccactcacc |
| SEQ ID NO: 598 | ccatccagaaagcccaaagcc |
| SEQ ID NO: 599 | ccagagtacagctttgttcctcattc |
| SEQ ID NO: 600 | gcagtacaaacaacgcacagcg |
| SEQ ID NO: 601 | ctgccaccctccacagtccc |
| SEQ ID NO: 602 | gccaagaccatgcatgcg |
| SEQ ID NO: 603 | cccagggacaaagagactccc |
| SEQ ID NO: 604 | caggaagcagacagtcttctagttcc |
| SEQ ID NO: 605 | tgcctgtaatcccaacactttgg |
| SEQ ID NO: 606 | tccctctggccaggatggg |
| SEQ ID NO: 607 | atggggaatgggagtaggaagc |
| SEQ ID NO: 608 | cagatcagttctcccctccagc |
| SEQ ID NO: 609 | acaaaaaagaaacatgctcagagagg |
| SEQ ID NO: 610 | tggtggcatgcatctgtagtcc |
| SEQ ID NO: 611 | aggtgctctatagatgttagcatccc |
| SEQ ID NO: 612 | ccaggacaggatggagatctgg |
| SEQ ID NO: 613 | agggaacctgtgcattatccttgc |
| SEQ ID NO: 614 | cagaagtcttgctttaaggaggagg |
| SEQ ID NO: 615 | gggtacgtgaaactcaccaagg |
| SEQ ID NO: 616 | cagagtgtggcaagcaaggg |
| SEQ ID NO: 617 | aacattttaaaggtacaaataacgtggg |
| SEQ ID NO: 618 | tagggagcaacagccattaagc |
| SEQ ID NO: 619 | ggtgcactgtccagctctgg |
| SEQ ID NO: 620 | actctcgctgaactcgcctgg |
| SEQ ID NO: 621 | ctcggtctctggtggtacgc |
| SEQ ID NO: 622 | gcaagaggtccgagctggg |
| SEQ ID NO: 623 | ggaagaagtgaaacaagagatgaagg |
| SEQ ID NO: 624 | cccagagaacaaaccggattagg |
| SEQ ID NO: 625 | cccttcaaccttctccaatctgc |
| SEQ ID NO: 626 | cccatgtccagtggtttaggg |
| SEQ ID NO: 627 | gagattggtgggagacagatgg |
| SEQ ID NO: 628 | cttctcagctcaaagttccagcg |
| SEQ ID NO: 629 | gaatgggagagatgaccagagg |
| SEQ ID NO: 630 | aagggcaagggggtatgtgg |
| SEQ ID NO: 631 | ggaaggaagcatgggaacacc |
| SEQ ID NO: 632 | ccatcaatgctctgtctgtctgg |
| SEQ ID NO: 633 | gtgccgtgactgtgcttgg |
| SEQ ID NO: 634 | acatcccattgacctcatcaagc |
1. A method of identifying a gene breakpoint, said method comprising:
(i) contacting a DNA sample with:
(a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
(b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
(ii) amplifying the DNA sample of step (i);
(iii) optionally contacting the amplicon generated in step (ii) with:
(a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag; and
(b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag,
wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the other reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i); and
(iv) amplifying the DNA sample of step (iii);
(v) analysing said amplified DNA.
2. (canceled)
3. (canceled)
4. (canceled)
5. (canceled)
6. (canceled)
7. (canceled)
8. (canceled)
9. (canceled)
10. (canceled)
11. (canceled)
12. (canceled)
13. (canceled)
14. (canceled)
15. (canceled)
16. (canceled)
17. (canceled)
18. (canceled)
19. (canceled)
20. (canceled)
21. (canceled)
22. (canceled)
23. (canceled)
24. (canceled)
25. (canceled)
26. (canceled)
27. (canceled)
28. A method of identifying a gene translocation breakpoint, said method comprising:
(i) contacting a DNA sample with:
(a) one or more forward primers directed to a DNA region of the antisense strand of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
(b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ relative to the gene breakpoint, which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags;
(c) a primer directed to the forward primer oligonucleotide tag of step (i)(a); and
(d) a primer directed to the reverse primer oligonucleotide tag of step (i)(b);
(ii) amplifying the DNA sample of step (i);
(iii) optionally contacting the amplicon generated in step (ii) with:
(a) one or more forward primers directed to a DNA region of the flanking gene or fragment thereof located 5′ relative to the gene breakpoint, which primers are directed to DNA regions which are located 3′ to one or more of the forward primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
(b) one or more reverse primers directed to a DNA region of the flanking gene or fragment thereof located 3′ to the gene breakpoint, which primers are directed to DNA regions which are located 5′ to one or more of the reverse primers of step (i) and which primers are optionally operably linked at their 5′ end to an oligonucleotide tag;
(c) a primer directed to the forward primer oligonucleotide tag of step (iii)(a); and
(d) a primer directed to the reverse primer oligonucleotide tag of step (iii)(b);
wherein the oligonucleotide tags of the forward primers are the same relative to the forward primer tags of step (iii)(a) and the oligonucleotide tags of the reverse primers are the same relative to the reverse primer tags of step (iii)(a) but which forward primer oligonucleotide tags are different relative to the reverse primer tags and which forward and reverse primer tags of step (iii) are different relative to the forward and reverse primer tags of step (i);
(iv) amplifying the DNA sample of step (iii); and
(v) analysing said amplified DNA.
29. The method according to claim 1, wherein at least one set of said forward and reverse primers are linked to an oligonucleotide tag.
30. The method according to claim 1, wherein one primer is used in step (i)(a) and two or more primers are used in step (i)(b).
31. The method according to claim 1, wherein one primer is used in step (i)(b) and two or more primers are used in step (i)(a).
32. The method according to claim 1, wherein step (iii) is performed and one primer is used in step (iii)(a) and two or more primers are used in step (πi)(b).
33. The method according to claim 1, wherein step (iii) is performed and one primer is used in step (iii)(b) and two or more primers are used in step (iii)(a).
34. The method according to claim 1, wherein said gene breakpoint is a gene translocation breakpoint or a homologous recombination point.
35. The method according to claim 34, wherein said gene translocation breakpoint is a chromosomal gene translocation breakpoint.
36. The method according to claim 35, wherein said gene translocation breakpoint is selected from the group consisting of:
(i) BCR-ABL translocation,
(ii) PML-RARα translocation,
(iii) t(2;5)(p23;q35) translocation,
(iv) t(8; 14) translocation,
(v) t(9;22)(q34;q11) translocation,
(vi) t(11; 14) translocation,
(vii) t(11;22)(q24;q11.2-12) translocation,
(viii) t(14;18)(q32;q21) translocation,
(ix) t(17;22) translocation,
(x) t(15; 17) translocation,
(xi) t(1; 12)(q21;p 13) translocation,
(xii) t(9; 12)(p24;p 13) translocation,
(xiii) t(X;18)(p1 1.2;q1 1.2) translocation,
(xiv) t(1;1 I)(q42.1;q14.3) translocation, and
(xv) t(1; 19) translocation.
37. The method according to claim 1, wherein 1-30 primers are used in step (i)(a) and 24-400 primers are used in step (i)(b).
38. The method according to claim 37, wherein step (iii) is performed and 1-30 primers are used in step (iii)(a) and 24-400 primers are used in step (iii)(b).
39. The method according to claim 1, wherein only steps (i), (ii) and (v) are performed.
40. The method according to claim 39, wherein steps (iii) and (iv) are additionally performed.
41. The method according to claim 39, wherein said amplified DNA of step (ii) is subjected to a further step of amplification, selection or enrichment.
42. The method according to claim 41, wherein said amplification is bottleneck PCR.
43. The method according to claim 40, wherein said amplified DNA of step (iv) is subjected to a further step of amplification, selection or enrichment.
44. The method according to claim 43, wherein said amplification is bottleneck PCR.
45. The method according to claim 1, wherein said gene breakpoint is a chromosomal BCR-ABL translocation and:
(a) the forward primers of step (i)(a) correspond to SEQ ID NOs:10-15; and
(b) the reverse primers of step (i)(b) correspond to SEQ ID NOs:23-304 and are linked to the oligonucleotide tag defined by SEQ ID NO:22
and wherein if step (iii) is performed then:
(a) the forward primers of step (iii)(a) correspond to SEQ ID NOs: 16-21; and
(b) the reverse primers of step (iii)(b) corresponds to SEQ ID NOs:306-587 and are linked to the oligonucleotide tag defined by SEQ ID NO:305.
46. The method according to claim 1, wherein said gene breakpoint is a chromosomal PML-RARalpha translocation and:
(a) the forward primers of step (i)(a) correspond to SEQ ID NOs:588-593; and
(b) the reverse primers of step (i)(b) correspond to SEQ ID NOs:601-634 and are linked to the oligonucleotide tag defined by SEQ ID NO: 22
and wherein step (ii) is followed by bottleneck PCR which is performed using primers corresponding to SEQ ID NOs: 594-599.
47. A method of monitoring a disease condition in a mammal, which disease condition is characterised by a gene breakpoint, said method comprising screening for the presence of said breakpoint in a biological sample derived from said mammal, which breakpoint has been identified in accordance with the method of claim 1.
48. The method according to claim 47, wherein said condition is:
anaplastic large cell lymphoma,
Burkitt's lymphoma,
CML, ALL,
Mantle cell lymphoma,
Ewing's sarcoma,
follicular lymphoma,
dermatofibrosarcoma protuberans,
acute promyelocy e leukemia,
acute myelogenous leukemia,
Synovial sarcoma,
Schizophrenia; or
acute pre-B cell leukemia.
49. A DNA primer set, which primer set is designed to amplify and/or otherwise detect a gene breakpoint, which breakpoint has been identified in accordance with the method of claim 1.