US20100239612A1
2010-09-23
12/718,931
2010-03-05
The invention relates to a method for inducing protection against the 4 serotypes of dengue fever in a patient, comprising:
Get notified when new applications in this technology area are published.
A61P7/00 » CPC further
Drugs for disorders of the blood or the extracellular fluid
A61P9/02 » CPC further
Drugs for disorders of the cardiovascular system Non-specific cardiovascular stimulants, e.g. drugs for syncope, antihypotensives
A61P17/00 » CPC further
Drugs for dermatological disorders
A61P31/00 » CPC further
Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
A61P31/14 » CPC further
Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics; Antivirals for RNA viruses
A61P43/00 » CPC further
Drugs for specific purposes, not provided for in groups -
A61K2039/5254 » CPC further
Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA; Virus avirulent or attenuated
A61K2039/5256 » CPC further
Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA; Virus expressing foreign proteins
A61K2039/545 » CPC further
Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
A61K2039/70 » CPC further
Medicinal preparations containing antigens or antibodies Multivalent vaccine
C12N2770/24134 » CPC further
ssRNA viruses positive-sense; Details; Flaviviridae; Flavivirus, e.g. yellow fever virus, dengue, JEV Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Y02A50/30 » CPC further
in human health protection, e.g. against extreme weather Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
A61K39/12 » CPC main
Medicinal preparations containing antigens or antibodies Viral antigens
A61P31/12 » CPC further
Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics Antivirals
This application claims priority to provisional application Ser. No. 60/885,077, which was filed on Jan. 16, 2007, and is hereby incorporated by reference in its entirety.
1. Field of the Invention
The invention relates to a method for inducing protection against the 4 serotypes of dengue fever in a patient, comprising:
in which the second administration (b) is made between at least 30 days and not more than 12 months after the first administration (a).
2. Summary of the Related Art
Dengue fevers are caused by four viruses of the flavivirus genus which are of similar serological type but differ from the antigen point of view (GĂźbler et al., 1988, in: Epidemiology of arthropod-borne viral disease. Monath T P M, editor, Boca Raton (Fla.): CRC Press: 223-60; Kautner et al., 1997, J. of Pediatrics, 131: 516-524; Rigau-PĂŠrez et al., 1998, Lancet, 352: 971-977; Vaughn et al., 1997, J. Infect. Dis., 176: 322-30). Infection with a serotype of dengue fever may produce a spectrum of clinical disease from non-specific viral syndrome to severe fatal hemorrhagic disease. The incubation period for dengue fever after a mosquito bite is approximately 4 days (from 3 to 14 days). Dengue fever is characterized by a two-phase fever, headaches, pains in various parts of the body, prostration, eruptions and lymphadenopathy (Kautner et al., 1997, J. of Pediatrics, 131: 516-524; Rigau-PĂŠrez et al., 1998, Lancet, 352: 971-977). The viremic period is of the same as the febrile period (Vaughn et al., 1997, J. Infect. Dis., 176: 322-30). Cure of dengue fever is complete after 7 to 10 days, but prolonged asthenia is normal. Reduced leukocyte and platelet numbers frequently occur.
Hemorrhagic dengue fever is a severe febrile disease characterized by homeostasis abnormalities and an increase in vascular permeability which can lead to hypovolemia and hypotension (dengue fever with shock syndrome), often complicated by severe internal bleeding. The mortality rate for hemorrhagic dengue fever can reach 10% without treatment, but is 1% in most centers with experience of treatment (WHO Technical Guide, 1986. Dengue haemorrhagic fever: diagnosis, treatment and control, p. 1-2. World Health Organization, Geneva, Switzerland).
Routine laboratory diagnosis of dengue fever is based on isolation of the virus and/or the detection of antibodies specific to dengue fever virus.
Dengue is the second most important infectious tropical disease after malaria, more than half of the world's population living in areas where there is a risk of epidemic transmission. There are estimated to be 50-100 million cases of dengue fever every year, 500,000 patients hospitalized for hemorrhagic dengue fever, and 25,000 deaths. Dengue fever is endemic in Asia, the Pacific, Africa, Latin America and the Caribbean. Dengue fever virus infections are endemic in more than 100 tropical countries and hemorrhagic dengue fever has been documented in 60 of these countries (GĂźbler, 2002, TRENDS in Microbiology, 10: 100-103; Monath, 1994, Proc. Natl. Acad. Sci., 91: 2395-2400). A number of well-described factors would appear to be implicated in dengue feverâpopulation growth, unplanned and uncontrolled urbanization, in particular associated with poverty, an increase in air travel, lack of effective mosquito control and deterioration of sanitary and public health infrastructure (GĂźbler, 2002, TRENDS in Microbiology, 10: 100-103). Travellers and expatriates are increasingly being warned about dengue fever (Shirtcliffe et al., 1998, J. Roy. Coll. Phys. Lond., 32: 235-237). Dengue fever has been one of the main causes of febrile diseases among American troops during deployments in tropical areas where dengue fever is endemic (DeFraites et al., 1994, MMWR, 1994, 43: 845-848).
The viruses are maintained within a cycle involving humans and Aedes aegypti, a domestic mosquito which bites during the daytime, and prefers to feed on man. Infection in man is initiated by injection of the virus during the blood meal of an infected Aedes aegypti mosquito. The salivary virus is mainly deposited in the extravascular tissues. The first category of cells to be infected after inoculation are the dentritic cells, which then migrate to the lymphatic ganglia (Wu et al., 2000, Nature Med., 7: 816-820). After initial replication in the skin and lymphatic ganglia, the virus appears in the blood in the course of the acute febrile stage, generally for 3 to 5 days.
Along with the dentritic cells, monocytes and macrophages are among the first targets of dengue fever virus. Protection against homotypic reinfection is complete and probably lasts a lifetime, but cross-protection between the different types of dengue lasts from less than a few weeks to a few months (Sabin, 1952, Am. J. Trop. Med. Hyg., 1: 30-50). As a consequence, an individual may become infected with a different serotype. A second infection due to dengue fever is in theory a risk factor for the development of severe dengue fever. However, hemorrhagic dengue fever is multifactorialâfactors include the strain of virus involved and the age, immune status and genetic predisposition of the patient. Two factors play a major role in the occurrence of hemorrhagic dengue feverârapid viral replication with a high level of viremia (the severity of the disease being associated with the level of viremia; Vaughn et al., 2000, J. Inf. Dis., 181: 2-9) and a major inflammatory response with the release of high levels of inflammatory mediators (Rothman and Ennis, 1999, Virology, 257: 1-6). There is no specific treatment against dengue fever. Treatment for dengue fever is symptomatic, with bed rest, control of the fever and pain through antipyretics and analgesics, and adequate drinking. The treatment of hemorrhagic dengue fever requires balancing of liquid losses, replacement of coagulation factors and the infusion of heparin.
Preventive measures are currently based on control of the vector and personal protection measures which are difficult to apply and are costly. No vaccine against dengue fever has at present been approved. Given that the four serotypes of dengue fever are in circulation in the world and that they have been reported as being involved in cases of hemorrhagic dengue fever, vaccination should ideally confer protection against the four serotypes of dengue fever virus.
When immunizing with a tetravalent vaccine, it may happen that the response is induced predominantly against only one or at most 3 serotypes. There is therefore a need for a method which makes it possible to reduce interference between the different serotypes and makes it possible to induce neutralizing antibodies against the 4 serotypes of dengue fever.
The inventors have found that it is possible to generate an immune response comprising antibodies neutralizing the 4 serotypes when the vaccinal formulation which is intended to induce a response against the 4 serotypes is administered after preliminary immunization with an attenuated living vaccine of only one serotype, the second immunization being made 30 days to 12 months after the first administration.
The inventors have in particular shown that tetravalent DEN-1,2,3,4 immunization after monovalent DEN-2 immunization induces responses against the four serotypes in all the monkeys immunized. Conversely, tetravalent immunization alone only induced a satisfactory response against two out of 4 serotypes, even after a booster.
The immune response generated by the method according to the invention is therefore both quantitatively and qualitatively greater (covers all serotypes).
In accordance with a first object, this invention therefore relates to a method making it possible to induce a neutralizing antibody response against the 4 serotypes of dengue fever in a patient and comprises:
in which the second administration (b) is made at least 30 days and not more than 12 months after the first administration (a).
According to a particular embodiment of the method of immunization according to the invention, the vaccinal virus used in the first administration (a) is selected from the group comprising vaccinal viruses of dengue fever of serotype 1 or 2.
According to another particular embodiment of the method of immunization according to the invention, the said vaccinal virus used in the first administration (a) is selected from the group comprising strains VDV1 and VDV2.
According to another particular embodiment of the method according to the invention, the said vaccinal viruses used in the tetravalent vaccine are Chimerivax⢠DEN-1,2,3 and 4.
According to another particular embodiment of the method according to the invention the quantity of vaccinal viruses of dengue fever of serotypes 1, 2, 3 and 4 lies within a range from 103 to 106 DICC50.
According to another particular embodiment of the method according to the invention, the monovalent vaccine comprises about 104 DICC50 of VDV1 or VDV2 and the tetravalent vaccine comprises about 105 DICC50 of Chimerivax⢠DEN-1,2,3 and 103 DICC50 of Chimerivax⢠DEN-4.
According to another embodiment of the method according to the invention, the second administration (b) is made 30 to 60 days after the first administration (a).
Another object of the present invention is an immunization kit against dengue fever virus comprising a container containing at least (a) a first container containing a monovalent composition or vaccine comprising a vaccinal virus of a first serotype of dengue fever, (b) a second container containing a tetravalent composition or vaccine comprising vaccinal viruses for the 4 serotypes of dengue fever.
According to one embodiment, the kit according to the invention comprises at least:
According to a particular embodiment, the kit according to the invention comprises a monovalent vaccine comprising about 104 DICC50 of VDV1 or VDV2 and a tetravalent vaccine comprising about 105 DICC50 of Chimerivax⢠DEN-1,2,3 and about 103 DICC50 of Chimerivax⢠DEN-4.
This invention therefore also relates to use of dengue fever vaccinal viruses for the manufacture of a monovalent vaccine and a tetravalent vaccine for immunization against dengue fever virus in which the monovalent vaccine comprises a vaccinal virus of a first serotype of dengue fever, the tetravalent vaccine comprises vaccinal viruses of the 4 serotypes of dengue fever and in which the tetravalent vaccine is administered at least 30 days and not more than 12 months after administration of the monovalent vaccine.
The invention will now be described in more detail in the description which follows.
âDengue fever virusesâ or âDENâ are positive single-strand RNA viruses belonging to the Flavivirus genus of the family of flaviviridae. The genome in RNA contains a type I end member at the 5Ⲡextremity but has no poly-A tail at the 3Ⲡextremity. The organization of the genome comprises the following elements: non-coding region (NCR) 5â˛, structural proteins (capsid (C), pre-membrane/membrane (prM/M), envelope (E)) and non-structural proteins (NS1-NS2A-NS2B-NS3-NS4A-NS4B-NS5) and NCR 3â˛. The viral genome RNA is associated with the capsid proteins to form a nucleocapsid. As in the case of flaviviruses, the DEN viral genome codes an uninterrupted coding region which is translated into a single polyprotein.
In the context of this invention, by âvaccinal dengue fever virusâ is meant any viral form of dengue fever virus that is capable of inducing a specific immune response comprising neutralizing antibodies, which preferably includes all viral forms of dengue fever virus which can be used in the context of an immunization program in man against infection by a dengue fever virus. By vaccinal dengue fever viruses are therefore meant inactivated viruses, attenuated viruses, and recombinant proteins such as the envelope protein of dengue fever virus. Numerous examples of these are known in the art.
A vaccinal virus is regarded as being âinactivatedâ if it no longer replicates in permissive cells.
A vaccinal virus is regarded as being âattenuatedâ if after growth at 37° C. or 39° C. in Huh-7, VERO and/or C6/36 liver cells the said vaccinal virus has a maximum titer which is at least 10 times less than maximum titer obtained with the wild parent strain under the same culture conditions and as measured using the same method for determining titer. A vaccinal virus which has diminished growth in at least one of the three cell types identified above is therefore regarded as being âattenuatedâ in the context of this invention.
A vaccinal virus which can be used in man has a positive benefit/risk ratio, the said ratio generally satisfying statutory and regulatory requirements for obtaining a marketing authorization. A vaccinal dengue fever virus used in the context of this invention is preferably a virus which has been attenuated in such a way that it does not induce the disease in man. Advantageously, the said vaccinal virus only results in side effects of at most moderate intensity (i.e., medium to slight, or zero) in the majority of vaccinated individuals, while retaining its ability to induce a neutralizing antibody response.
Dengue fever vaccinal viruses which can be used in the context of this invention may be cited by way of non-limiting examples: inactivated vaccinal viruses, attenuated vaccinal viruses such as the attenuated strains VDV-1, VDV-2, the strains described for example in applications WO02/66621, WO0057904, WO0057908, WO0057909, WO0057910, WO02/0950075 and WO02/102828, or chimeras. Chimeric viruses have the special feature that they have the characteristics of attenuated viruses as defined above. All chimeric viruses expressing the envelope protein of a dengue fever virus and inducing an immune response comprising antibodies neutralizing the serotype from which the envelope protein originates may therefore be used in the context of this invention. Mention may be made by way of non-limiting examples of: the dengue fever Chimerivax⢠such as described for example in patent application WO 98/37911, dengue/dengue fever chimeras such as described for example in patent applications WO9640933 and WO0160847. The vaccinal virus of serotype 1 dengue fever may for example be the vaccinal strain VDV1 or a Chimerivax⢠DEN-1, in particular a YF17D/DEN-1 virus, or again a DEN-1 16007/PDK13 strain. The vaccinal virus for serotype 2 of dengue fever may for example be the vaccinal strain VDV2 or a Chimerivax⢠DEN-2, in particular a YF17D/DEN-2 virus, or again a DEN-2 16681/PDK53 strain. The vaccinal virus of serotype 3 of dengue fever may be a Chimerivax⢠DEN-3, in particular a YF17D/DEN-3 virus. The vaccinal virus of serotype 4 of dengue fever may be a Chimerivax⢠DEN-4, in particular a YF17D/DEN-4 virus. Reference may be made to the applications identified here for precise description of the strains mentioned and the processes for obtaining them.
âVDVâ or âVero dengue vaccineâ designates an attenuated living dengue fever viral strain adapted to Vero cells (i.e. able to reproducibly replicate at significant level in Vero cells) and capable of inducing a specific humoral response, including the induction of neutralizing antibodies, in primates and particularly in man.
âVDV-1â is a strain obtained from a wild DEN-1 16007 strain which has undergone 11 passes through PDK cells (DEN-1 16007/PDK11) and which has subsequently been amplified in Vero cells at 32° C., the RNA of which has been purified and transfected in Vero cells. The VDV-1 strain has 14 additional mutations in comparison with the DEN-1 16007/PDK13 vaccinal strain (13 passes through PDKâPrimary Dog Kidneyâcells). The DEN-1 16007/PDK13 strain, also called âLAV1â, has been described in patent application EP1159968 in the name of Mahidol University and has been filed with the National Microorganisms Cultures Collection (CNCM) under number I-2480. The complete sequence of the VDV-1 strain is given in sequence SEQ ID NO:1. This strain can easily be reproduced from that sequence. A process for preparing and characterizing the VDV-1 strain has been described in the international patent application filed under number WO/2006/134433 in the names of Sanofi-Pasteur and the Center for Disease Control and Prevention.
âVDV-2â is a strain which has been obtained from wild strain DEN-2 16681 which has undergone 50 passes through PDK cells (DEN-2 16681/PDK50), plate purified, the RNA from which has been extracted and purified before being transfected in Vero cells. The VDV-2 strain has subsequently been obtained by plate purification and amplification in Vero cells. The VDV-2 strain has 10 additional mutations in comparison with the DEN-2 16681/PDK53 vaccinal strain (53 passes through PDK cells), including 4 silent mutations. The DEN-2 16681/PDK53 strain, also known as âLAV2â, has been described in patent application EP1159968 in the name of Mahidol University and has been filed with the National Microorganisms Cultures Collection (CNCM) under number 1-2481. The complete sequence of the VDV-2 strain is given in sequence SEQ ID NO:2. The VDV-2 strain can easily be reproduced from that sequence. A process for preparing and characterizing the VDV-2 strain has been described in the international patent application filed under number WO/2006/134443 in the names of Sanofi-Pasteur and the Center for Disease Control and Prevention.
The VDV 1 and 2 strains are prepared by amplification in Vero cells. The viruses produced are harvested and clarified from cell debris by filtration. The DNA is digested by treatment with enzymes. Impurities are eliminated by ultrafiltration. Infectious titers may be increased by a concentration method. After adding a stabilizer, the strains are stored in lyophilized or frozen form before use and then reconstituted when needed.
By âChimeriVax⢠dengueâ or âCYDâ is meant a chimeric yellow fever (YF) virus which comprises the skeleton of a YF virus in which the sequences coding for the pre-membrane and envelope proteins have been replaced by those of a DEN virus. Thus, a chimeric YF virus containing the prM and E sequences of a serotype 1 dengue fever strain (DEN-1) is called âCYD-1 or CYD DEN1â. A chimeric YF containing the prM and E sequences of a DEN-2 strain is referred to as âCYD-2 or CYD DEN2â. A chimeric YF virus containing the prM and E sequences of a DEN-3 strain is referred to as âCYD-3 or CYD DEN3â. A chimeric YF virus containing the prM and E sequences of a DEN-4 strain is referred to as âCYD-4 or CYD DEN4â. The preparation of these dengue ChimeriVax⢠has been described in detail in international patent applications WO 98/37911 and WO 03/101397, to which reference may be made for a precise description of the processes for their preparation. The chimeras described in the examples have been generated by using prM and E sequences from strains DEN 1 PUO359 (TYP1140), DEN2 PUO218, DEN3 PaH881/88 and DEN 4 1228 (TVP 980). Any dengue fever virus strain may be used to construct chimeras in the context of this invention.
Preferably, the chimeric YF virus comprises the skeleton of an attenuated yellow fever strain YF17D (Theiler M. and Smith H. H. (1937) J. Exp. Med., 65, p. 767-786) (viruses YF17D/DEN-1, YF17D/DEN-2, YF17D/DEN-3, YF17D/DEN-4). Examples of YF17D strains which may be used include YF17D204 (YF-VaxÂŽ, Sanofi-Pasteur, Swifwater, Pa., USA; StamarilÂŽ, Sanofi-Pasteur, Marcy lâ˛Etoile, France; ARILVAXâ˘, Chiron, Speke, Liverpool, UK; FLAVIMUNÂŽ, Berna Biotech, Bern, Switzerland; YF17D-204 France (X15067, X15062); YF17D-204,234 US (Rice et al., 1985, Science, 229: 726-733), or again the related strains YF17DD (Genbank access number U17066), YF17D-213 (Genbank access number U17067) and the strains YF17DD described by Galler et al. (1998, Vaccines, 16(9/10): 1024-1028). Any other attenuated yellow fever virus strain which may be used in man may be used to construct chimeras in the context of this invention.
When the term âaboutâ is used in conjunction with an amount it means plus or minus 10% of that amount, e.g., âabout 104â means 104Âą103.
According to a particular embodiment, for each serotype used in the various administrations the vaccinal viruses are present in the vaccine in a quantity from 103 to 105 DICC50.
According to a particular embodiment, vaccinal viruses VDV1 or VDV2 are present in the monovalent vaccine at a level of about 104 DICC50.
According to a particular embodiment, Chimerivax⢠DEN-1,2,3 are present in the tetravalent vaccine at a level of about 105 DICC50 and Chimerivax⢠DEN-4 is present in the tetravalent vaccine at a level of about 103 DICC50.
Each monovalent ChimeriVax⢠dengue fever vaccinal virus (serotypes 1, 2, 3 and 4) has been prepared by amplifying each serotype in Vero cells. More specifically, the four viruses are produced separately in adhering Vero cells in a serum-free medium. The viral harvest, clarified from cell debris by filtration, is then concentrated and purified by ultrafiltration and chromatography to remove the DNA from the host cells. After adding a stabilizing agent, the vaccinal strains are stored in a frozen or lyophilized form before use and then reconstituted as needed. The same process is applied to the four chimeras.
A dose, composition or vaccine is âmonovalentâ when in addition to a pharmaceutically acceptable excipient it contains a vaccinal virus of a single dengue fever serotype. A dose, composition or vaccine is âtetravalentâ when it contains vaccinal viruses of the four serotypes of dengue fever. Multivalent compositions are obtained by simple mixing of monovalent compositions.
By âpatientâ is meant a person (child or adult) who is likely to be infected by dengue fever, in particular a person at risk of infection, such as for example a person traveling in regions where dengue fever is present, or an inhabitant of those regions. The term therefore includes persons who are naĂŻve for dengue fever virus and those who are not naĂŻve.
In a first aspect, this invention therefore relates to a method of immunization against dengue fever virus.
The inventors have in fact shown in particular that the administration of 4 serotypes 30 days to 12 months after the first administration of a monovalent vaccine makes it possible to obtain effective protection against the 4 serotypes. The method according to this invention is therefore of very particular interest in the context of an immunization strategy against dengue fever.
According to this invention, the first immunization may be performed using a monovalent composition or vaccine comprising a vaccinal virus of any of the 4 serotypes of dengue fever, the second administration being performed with all 4 vaccinal serotypes. According to a particular embodiment, a serotype 1 or 2 dengue fever vaccinal virus, preferably serotype 2, is used for the first administration. Preferably, the dengue fever vaccinal virus used in the first administration is an attenuated dengue virus and is not a chimeric virus. According to a particular embodiment, strain VDV1 or VDV2, preferably strain VDV2, is used as the vaccinal virus in the first administration.
Attenuated living vaccinal viruses are used in the second administration, preferably chimeric viruses expressing antigens for the four serotypes of dengue fever virus, in particular Chimerivax⢠DENT, 2, 3 and 4.
According to particular embodiments, this invention therefore includes the following systems:
(a) VDV1 (b) CYD DEN-1,2,3 and 4
(b) VDV2 (b) CYD DEN-1,2,3 and 4.
In the context of this invention, by âvaccinal compositionâ is meant a composition comprising an âimmunoeffective quantityâ of dengue fever vaccinal virus, that is to say a sufficient quantity of dengue fever vaccinal virus to induce a specific immune response comprising neutralizing antibodies, which may be revealed for example by the seroneutralization test as described in Example 1 below. A serum is regarded as being positive for the presence of neutralizing antibodies when the titer of neutralizing antibodies so determined is not less than 1:10 (unity: 1/dilution).
The quantities of vaccinal strain are commonly expressed in terms of viral plaque forming units (PFU) or doses infecting 50% of the tissue culture or again doses infecting 50% of the cell culture (DICC50). For example, compositions according to the invention may contain 10 to 106 DICC50, in particular 103 to 105 DICC50 of dengue fever vaccinal virus of serotypes 1, 2, 3 or 4 for a monovalent or tetravalent composition. Thus, in the compositions or utilizations according to the invention the doses of dengue vaccinal viruses of serotypes 1, 2, 3 and 4 preferably each lie within a range from 10 to 106 DICC50, such as 10, 102, 103, 104, 105 or 106 DICC50, in particular within a range from 103 to 105 DICC50. Vaccinal virus may be used at the same or different doses, which can be adjusted in relation to the nature of the vaccinal virus used and the intensity of the immune response obtained.
According to a particular embodiment of a method according to this invention, the quantities of attenuated live vaccinal virus in monovalent and tetravalent compositions or vaccines are 103 to 105 DICC50. According to a particular embodiment, the monovalent vaccine comprises about 104 DICC50 of VDV1 or VDV2, preferably VDV2. According to a particular embodiment, the tetravalent vaccine comprises 105 DICC50 of Chimerivax⢠DEN-1,2,3 and 4. According to one advantageous embodiment, the tetravalent vaccine comprises about 105 DICC50 of Chimerivax⢠DEN-1, 2 and 3 and about 103 DICC50 of Chimerivax⢠DEN-4.
In the context of this invention, the second administration (b) is performed 30 days and not more than 12 months after administration (a). According to an advantageous embodiment, the second administration is performed 30 days to 60 days after the first administration (a).
The neutralizing antibody response is advantageously durable, that is to say it can be detected in serum up to at least 6 months after the second administration.
Vaccinal viruses are administered in the form of compositions or vaccines which can be prepared by any method known to those skilled in the art. Normally, viruses, generally in lyophilized form, are mixed with a pharmaceutically acceptable excipient such as water or a phosphate-buffered saline solution, wetting agents or stabilizing agents. By âpharmaceutically acceptable excipientâ is meant any solvent, dispersing medium, charge, etc., which does not produce any secondary reaction, for example an allergic reaction, in humans or animals. The excipient is selected on the basis of the pharmaceutical form chosen, the method and the route of administration. Appropriate excipients, and requirements in relation to pharmaceutical formulation, are described in âRemington: The Science & Practice of Pharmacyâ, which represents a reference work in the field.
Preferably, vaccinal compositions are prepared in injectable form, and may take the form of liquid solutions, suspensions or emulsions. The compositions may in particular comprise an aqueous solution buffered in such a way as to maintain a pH between about 6 and 9 (as determined using a pH meter at ambient temperature).
Although it is not necessary to add an adjuvant, the compositions may nevertheless include such a compound, that is to say a substance which increases, stimulates or reinforces the cell or humoral immune response induced by the vaccinal virus administered simultaneously. Those skilled in the art will be able to select an adjuvant which might be appropriate in the context of this invention from the adjuvants conventionally used in the field of vaccines.
The compositions or vaccines according to the invention may be administered by any means conventionally used in vaccination, for example parenterally (in particular intradermally, subcutaneously or intramuscularly), advantageously subcutaneously. Preferably, the compositions or vaccines are injectable compositions administered subcutaneously, advantageously in the region of the left deltoid or right deltoid.
The volume of vaccine composition administered will depend on the method of administration. In the case of subcutaneous injections, the volume is generally between 0.1 and 1.0 ml, preferably about 0.5 ml.
The optimum period for administering all serotypes 1 to 4 is about 1 to 3 months before exposure to dengue fever virus. Vaccinations may be administered as a prophylactic treatment against infection by dengue fever virus in adults and children. Target populations therefore include persons who may be naĂŻve (i.e., not previously immunized) or non-naĂŻve with regard to dengue fever virus.
Booster administrations of dengue fever vaccinal viruses of serotypes 1 to 4 may also be used for example between 6 months and 10 years, for example 6 months, 1 year, 3 years, 5 years or 10 years after administration of the second administration (b) according to the invention. Booster administrations will advantageously be performed using the same compositions or vaccines (i.e., the same vaccinal viruses) and preferably under the same conditions of administration (anatomical sites and methods of administration) as used for the 2nd administration (b).
Interference phenomena may be explained by the dominance of one or more serotypes in relation to others and are therefore independent of the technology used for preparation of the candidate vaccine (from VDV or Chimerivaxâ˘). The method according to this invention can therefore be applied in general to all dengue fever vaccinal viruses.
This invention is therefore also intended to cover use of dengue fever vaccinal viruses for the manufacture of a monovalent vaccine and a tetravalent vaccine for immunization against dengue fever virus in which the monovalent vaccine comprises the vaccinal virus of a first serotype of dengue fever, the tetravalent vaccine comprises vaccinal viruses for 4 serotypes of dengue fever, in which the tetravalent vaccine is administered at least 30 days and not later than 12 months after administration of the monovalent vaccine.
For a description of the vaccines and conditions of use in the context of use according to this invention, reference may be made to the description provided in relation to the method of immunization according to the invention.
According to another aspect, this invention has as its object an immunization kit against the four serotypes of dengue fever virus. The kit according to this invention comprises compositions or vaccines as defined above in relation to the method of immunization proposed. The kit according to the invention therefore comprises a container containing various containers containing the compositions or vaccines and advantageously, and optionally, an explanatory brochure including useful information for administration of the said compositions or vaccines.
According to one embodiment, this invention therefore relates to a kit for immunization against dengue fever virus, a container containing at least (a) a first container containing a monovalent vaccine comprising a vaccinal virus of a first serotype of dengue fever, and (b) a second container containing a tetravalent vaccine comprising vaccinal viruses for the 4 serotypes of dengue fever.
For a description of the vaccines, compositions or dengue fever vaccinal viruses which may be used in the kit according to the invention, reference may be made to the description provided above in relation to the method of immunization according to the invention.
According to a particular embodiment the kit according to the invention comprises at least:
According to a particular embodiment, the kit according to the invention comprises at least one monovalent vaccine comprising about 104 DICC50 of VDV1 or VDV2 and a tetravalent vaccine comprising about 105 DICC50 of Chimerivax⢠DEN-1,2,3 and about 103 DICC50 of Chimerivax⢠DEN-4.
The kits according to the invention may contain a single example or several examples of the containers as described above.
If the vaccines used are in lyophilized form, the kit will advantageously comprise at least one additional container containing the diluent which can be used to reconstitute an injectable dose of vaccine. Any pharmaceutically acceptable diluent may be used for this purpose, conventionally water or a phosphate-buffered aqueous solution.
The invention is illustrated by the following example.
Viremia and immunogenicity were tested in a monkey model. Viremia in particular has been identified as being one of the factors associated with the virulence and severity of the disease in man, and therefore constitutes an important parameter which must be taken into consideration. As for immunogenicity, this is a key parameter in the context of evaluating the protection imparted.
1.1 Materials and methods
Experiments on monkeys were carried out in accordance with European Directives relating to animal experiments. The immunizations were performed on cynomolgus monkeys (Macaca fascicularis) originating from Mauritania. The monkeys were placed in quarantine for six weeks prior to immunization.
The monkeys were immunized subcutaneously with 0.5 ml of vaccine composition in the arm. After mild anesthesia with ketamine (Imalgene, Merial), blood was collected by puncture of the inguinal or saphenal veins. On days 0 and 28 following each immunization, 5 ml of blood were sampled in order to evaluate antibody responses, while between days 2 and 10 1 ml of blood was sampled in order to evaluate viremia. The blood was collected on ice and preserved on ice until the serum was separated off. In order to do this, the blood was centrifuged for 20 minutes at 4° C. and the serum collected was stored at â80° C. until the time of the tests.
Measurement of Viremia
Post-vaccination viremia was monitored by quantitative real time RT-PCT (qRT-PCR). Two sets of primers and probes located in the NS5 gene of the DENT and DEN2 strains were used to quantify the RNA of VDV-1 and VDV-2 respectively. A third set of 2 primers and 1 probe located in the NS5 gene of the YF virus was used to quantify the RNA of CYD. Finally, 4 sets of primers and specific probes for the different CYD serotypes located at the junction of the E (DEN)/NS1 (YF) genes were used to identify the serotype in the samples positive for NS5 YF RNA (see also Table 1). 7 plasmids containing the region targeted by each PCR, under the control of promoter T7, were transcribed in vitro to generate a series of synthetic RNA which were included in each RT-PCT test as an internal reference. The synthetic RNA were determined by spectrophotometry, the quantity of RNA obtained was converted into the number of RNA copies and expressed as GEQ (genome equivalents).
0.140 ml of monkey serum were extracted using the âNucleospin 96 Virusâ˘â RNA extraction kit from Macherey Nagel according to the manufacturer's instructions, and then the purified RNA was eluted with 0.140 ml (0.090 ml, then 0.05 ml) of RNase-free water. In order to avoid repeated freeze/thaw cycles, a first quantification was performed immediately after extraction on 5 Îźl of the said RNA preparation. The remaining volume was frozen at 70° C.
In addition to the components of the âQiagen Qauntitect⢠probesâ RT-PCR quantification kit (Qiagen), the reaction mixtures contained 10 picomoles of each primer, 4 picomoles of each probe and 5 Îźl of RNA in a total volume of 25 Îźl. In the case of the RNA under test, 5 Îźl of the purified preparation were added directly to the reaction mixture without a prior dilution stage. The synthetic RNAs were diluted 1/10 in RNAse-free water, and 7 dilutions containing approximately 10 to 106 GEQ in 5 Îźl were quantified in parallel in order to generate a calibration curve.
The quantification reactions were carried out using the ABIPrism 700⢠equipment from Applied Biosystem, using the following program: 50° C./30 min, 95° C./15 min, followed by 40 cycles of 95° C./15 sec-60° C./60 sec.
The quantification limit for viral RNA in this test is 2.9 to 3.3 log10GEQ/ml (800 to 2000 GEQ/ml; 4 to 10 GEQ/reaction), according to PCR targets (standard deviation: +/â0.3 log10).
The correlation between infectious titer and the quantification of viral RNA was established in parallel with the tests by analyzing 0.140 ml of samples of negative monkey serums (DO) to which a known quantity of infectious particles of the viruses used for immunization (CYD or VDV) had been added. The said control serums were prepared in two dilutions containing approximately 1 PFU and approximately 100 PFU in 5 Îźl (2.3 and 4.3 log10PFU/ml, respectively).
In the tests used in the examples, the correlation between GEQ and PFU is as follows: GEQ/PFU ratio 2.7 log10 (i.e. 1 PFU=500 GEQ) for sera positive for YF or CYDs; GEQ/PFU ratio 2.5 log10 (i.e. 1 PFU=320 GEQ) for sera positive for VDV1 or VDV2.
The quantification limits are <3.3 log10GEQ/ml (i.e. <4 PFU/ml) for YF and CYDs qRT-PCR, and <2.9 log10GEQ/ml (i.e. <2.5 PFU/ml) for VDV1 and VDV2 qRT-PCR.
The primers and probes used are shown in Table 1 below, in which the sense and anti-sense primers and the probe are listed in order for each test.
| TABLE 1 | ||||
| YF | ||||
| YF-NS5 | sense | 5â˛âGCACGGATGTAACAGACTGAAGA (23 bases) | SEQ ID NO: 3 | |
| YF-NS5 | antisense | 5â˛âCCAGGCCGAACCTGTCAT (18 bases) | SEQ ID NO: 4 | |
| YF-NS5 | 5â˛âFam-CGACTGTGTGGTCCGGCCCATC-Tamra (22 bases) | SEQ ID NO: 5 | ||
| CYD1 | ||||
| spe | ||||
| CYD1 | sense | 5â˛âCAT TGC AGT TGG CCT GGT AA (20 b) | SEQ ID NO: 6 | |
| CYD1 | antisense | 5â˛âCTT TGG CAA GAG AGA GCT CAA GT (23 b) | SEQ ID NO: 7 | |
| CYD1 | 5â˛âFam-CCG ATC AAG GAT GCG CCA TCA-Tamra (21 b) | SEQ ID NO: 8 | ||
| CYD2 | ||||
| spe | ||||
| CYD2 | sense | 5â˛âGTG GGA GTC GTG ACG CTG TA (20 b) | SEQ ID NO: 9 | |
| CYD2 | antisense | 5â˛âGTT GAT GGC GCA TCC TTG ATC (21 b) | SEQ ID NO: 10 | |
| CYD2 | 5â˛âFam-TGG GAG TTA TGG TGG GCG CCG-Tamra (21 b) | SEQ ID NO: 11 | ||
| CYD3 | ||||
| spe | ||||
| CYD3 | sense | 5â˛âAAA ACA CTT CCA TGT CAT TTT CAT G (25 b) | SEQ ID NO: 12 | |
| CYD3 | antisense | 5â˛âGTT GAT GGC GCA ACC TTG ATC (21 b) | SEQ ID NO: 13 | |
| CYD3 | 5â˛âFam-TGCGATAGGAATTATCACACTCTATCTGGGAGC-Tamra (33 b) | SEQ ID NO: 14 | ||
| CYD4 | ||||
| spe | ||||
| CYD4 | sense | 5â˛âCTT AGT ATT GTG GAT TGG CAC GAA (24 b) | SEQ ID NO: 15 | |
| CYD4 | antisense | 5â˛âGCG CCA ACT GTG AAA CCT AGA (21 b) | SEQ ID NO: 16 | |
| CYD4 | 5â˛âFam-AGAAACACTTCAATGGCAATACGTGCAT-Tamra (39 b) | SEQ ID NO: 17 | ||
| VDV1 | ||||
| spe | ||||
| VDV1-NS5 | sense | 5â˛âTCG CAA CAG CCT TAA CAG C (19b) | SEQ ID NO: 18 | |
| VDV1-NS5 | antisense | 5â˛âACT ATC TCC CTC CCA TCC TTC (21 b) | SEQ ID NO: 19 | |
| VDV1-NS5 | 5â˛âFam-TTC ACA CCA CTT CCA C-M GB/NFQ (16 b) | SEQ ID NO: 20 | ||
| VDV2 | ||||
| spec | ||||
| VDV2-NS5 | sense | 5â˛âAAT GAC AGA CAC GAC TCC (18 b) | SEQ ID NO: 21 | |
| VDV2-NS5 | antisense | 5â˛âCCC AAA ACC TAC TAT CTT CAA C (22 b) | SEQ ID NO: 22 | |
| VDV2-NS5 | 5â˛âFam-TGG AAG TCG GCA CGT GA-MGB/NFQ (17 b) | SEQ ID NO: 23 | ||
Measurement of Neutralizing Antibodies (Seroneutralization Test) (SN50)
Conventionally, dengue fever antibodies are measured using the PRNT50 test (test of neutralization by reducing the number of PFU to 50%). As this test is cumbersome and consumes much material, we have developed the SN50 test based on a 50% reduction in the number of units measured in the DICC50 test.
In a 96 well plate, 0.120 ml of each decomplemented serum is added to 0.480 ml of diluent (ISCOVE 4% SVF) in each well. Serial dilutions of a factor 6 are performed by transferring 0.150 ml of serum into 0.450 ml of diluent. 450 Οl of viral dilution containing 2.7 log10 DICC50/ml are added to each well so as to obtain 25 DICC50/well. The plate is incubated at 37° C. for 1 hour. 0.1 ml of each dilution is then distributed into 6 wells of a 96 well plate in which VERO cells have been seeded 3 days before the start of the experiment at a density of 8000 cells/well in 0.1 ml of ISCOVE 4% SVF medium. After 6 days incubation at 37° C. in the presence of 5% CO2, the cells are fixed using an ethanol/acetone (70/30) mixture at 4° C. for 15 minutes, and then washed 3 times in PBS and incubated for 1 hour at 37° C. in the presence of 0.05 ml of a 1/2000 dilution of an anti-flavivirus monoclonal antibody (mAb 4G2 obtained from an ATCC H-B112 hybridoma). The plates are then washed twice and incubated for 1 hour at 37° C. in the presence of 0.05 ml of a 1/1000 dilution of an anti-mouse IgG conjugated with alkaline phosphatase. The lysis plaques are revealed by adding 0.05 ml of a stained substrate: BCIP/NBT. The neutralizing antibody titers are calculated using the Karber formula as defined below:
Log10SN50=d+f/N(X+N/2),
in which:
d: represents the dilution providing 100% neutralization (that is 6 negative replicates, i.e. presenting no signs of infection)
f: represents the dilution factor as log10 (e.g. dilution factor of 1:4, f=0.6)
N: represents the number of replicates/dilution (N=6)
X: total number of wells having no sign of infection, with the exception of dilution d.
The limit for viral detection is 10 SN50 (i.e. 1.0 log10SN50).
The viral strains used for neutralization were the strains DENT 1 6007, DEN2 16681, DEN3 16562 or DEN4 1036.
In the case of the controls, the initial viral dilutions were re-titrated.
The correlation between the neutralizing titer measured in the SN50 test and the neutralizing titer measured conventionally in the PRNT50 test is: log10PRNT50=log10SN50+0.2.
1.2 Evaluation of Simultaneous Immunizations
2 groups of 4 monkeys of equivalent age and weight were immunized (see Table 2).
Immunization was performed subcutaneously in the arm using a 23G1 needle, with a quantity of 105 DICC50 for each CYD DEN 1 to 4 serotype for the tetravalent vaccine and a quantity of 104 DICC50 for the monovalent VDV-2.
| TABLE 2 |
| Composition of the groups and immunization protocol |
| Monkeys |
| Immunizations |
| Group | D0 | D56 | |
| Group 1 | Monovalent | Tetravalent | |
| VDV 2 | Dengue | ||
| 1234 | |||
| ChimeriVax | |||
| Group 2 | Tetravalent | Tetravalent | |
| Dengue | Dengue | ||
| 1234 | 1234 | ||
| ChimeriVax | ChimeriVax | ||
The immunogenicity results obtained after one immunization (D0+28) and two immunizations (D56+28) are shown in Table 3.
The viremia results are provided in Table 4.
| TABLE 3 |
| SN50 neutralizing titer (units 1/dil) |
| Monkeys |
| Immunizations | D 0 + 28 | D 56 + 28 |
| ID | D 0 | D 56 | DEN-1 | DEN-2 | DEN-3 | DEN-4 | DEN-1 | DEN-2 | DEN-3 | DEN-4 |
| AM762 | VDV 2 | CYD | 10 | 501 | â | 10 | 63 | 1005 | 63 | 200 |
| AM839 | 1234 | â | 802 | â | â | 80 | 1271 | 63 | 504 | |
| AM905 | 20 | 158 | â | â | 318 | 1010 | 252 | 506 | ||
| AN011 | 13 | 1005 | â | â | 252 | 1271 | 319 | 1010 | ||
| Geometric | 11 | 583 | <10 | <10 | 142 | 1131 | 134 | 477 | ||
| mean | ||||||||||
| AM496 | CYD | CYD | 50 | â | 16 | 32 | 100 | 40 | 80 | 252 |
| AM645 | 1234 | 1234 | â | â | 13 | 31 | 16 | â | â | 63 |
| AM766 | â | â | â | 32 | 20 | â | â | 80 | ||
| AM813 | 25 | â | â | 13 | 63 | 13 | 20 | 63 | ||
| Geometric | 13 | <10 | <10 | 25 | 38 | 11 | 14 | 95 | ||
| mean | ||||||||||
| â: titer < 10 |
| TABLE 4 |
| viremia analyses (units: log 10 GEQ/mL) |
| First immunization |
| Group | Monkey | D 2 | D 3 | D 4 | D 5 | D 6 | D 7 | D 8 | D 9 | D 10 |
| 1 | AM762 | <2.7 | <2.7 | <2.7 | <2.7 | 4.77 | 4.89 | 4.84 | 4.47 | <2.7 |
| initial VDV 2 | AM839 | 5.11 | 4.51 | 4.19 | 4.19 | 4.56 | 3.69 | <2.7 | <2.7 | <2.7 |
| booster CYD 1, 2, 3, 4 | AM905 | <2.7 | <2.7 | <2.7 | <2.7 | 4.16 | 4.31 | 4.16 | 3.50 | 4.14 |
| AN011 | <2.7 | <2.7 | 3.75 | 4.29 | 4.35 | 4.22 | 3.51 | <2.7 | 3.28 | |
| 2 | AM496 | 4.22 | 3.36 | 3.71 | 4.15 | 3.14 | <3.1 | 3.58 | <3.1 | <3.1 |
| initial CYD 1, 2, 3, 4 | AM645 | 4.21 | 3.61 | 2.82 | 3.51 | 3.65 | 3.24 | <3.1 | 3.47 | 3.44 |
| booster CYD 1, 2, 3, 4 | AM766 | 3.97 | 3.06 | 3.38 | 4.19 | 3.80 | 3.73 | <3.1 | <3.1 | <3.1 |
| AM813 | 4.81 | 4.60 | 3.17 | <3.1 | <3.1 | <3.1 | <3.1 | <3.1 | <3.1 | |
| Booster |
| Group | Monkey | D 58 | D 59 | D 60 | D 61 | D 62 | D 63 | D 64 | D 65 | D 66 |
| 1 | AM762 | <3.2 | <3.2 | <3.2 | 3.11 | <3.2 | <3.2 | 3.65 | 3.59 | <3.2 |
| initial VDV 2 | AM839 | 4.98 | 4.86 | 4.43 | 3.79 | <3.2 | <3.2 | <3.2 | <3.2 | <3.2 |
| booster CYD 1, 2, 3, 4 | AM905 | <3.2 | <3.2 | 3.09 | 3.42 | 3.39 | <3.2 | <3.2 | 4.08 | 4.22 |
| AN011 | 3.55 | 3.42 | <3.2 | <3.2 | 3.42 | 3.37 | 4.67 | 5.09 | 4.97 | |
| 2 | AM496 | <3.2 | <3.2 | <3.2 | <3.2 | <3.2 | <3.2 | <3.2 | <3.2 | <3.2 |
| initial CYD 1, 2, 3, 4 | AM645 | <3.2 | <3.2 | <3.2 | <3.2 | <3.2 | <3.2 | <3.2 | <3.2 | <3.2 |
| booster CYD 1, 2, 3, 4 | AM766 | <3.2 | <3.2 | <3.2 | <3.2 | <3.2 | <3.2 | <3.2 | <3.2 | <3.2 |
| AM813 | <3.2 | <3.2 | <3.2 | <3.2 | <3.2 | <3.2 | <3.2 | <3.2 | <3.2 | |
| CYD1 | ||||||||||
| CYD4 | ||||||||||
| VDV2 |
In brief, the results can be summarized as follows:
The examples therefore show that the method of immunization according to this invention improves the immunogenicity of the dengue fever vaccinal viruses without adversely affecting the latter's safety.
All publications recited herein are hereby incorporated by reference in their entirety. To the extent of conflict between a publication and the present specification, the present specification controls.
1-7. (canceled)
8. An immunization kit against dengue fever virus comprising container (a) a first container containing a monovalent vaccine comprising a vaccinal virus of a first serotype of dengue fever, (b) a second container containing a tetravalent vaccine comprising vaccinal viruses for the 4 serotypes of dengue fever.
9. The immunization kit as claimed in claim 8, comprising at least:
(a) a first container containing a monovalent vaccine comprising a VDV1 or VDV2 vaccinal virus,
(b) a second container containing a tetravalent vaccine comprising Chimerivax⢠DEN-1,2,3 and 4.
10. The immunization kit as claimed in claim 9, wherein the monovalent vaccine comprises 104 DICC50 of VDV1 or VDV2 and the tetravalent vaccine comprises about 105 DICC50 of Chimerivax⢠DEN-1,2,3 and about 103 DICC50 of Chimerivax⢠DEN-4.
11. An immunization kit against dengue fever virus comprising container (a) a first container containing a monovalent vaccine comprising a VDV1 or VDV2 vaccinal virus, (b) a second container containing a tetravalent vaccine comprising vaccinal viruses for the 4 serotypes of dengue fever.
12. The immunization kit as claimed in claim 11, comprising at least:
(a) a first container containing a monovalent vaccine comprising a VDV1 or VDV2 vaccinal virus,
(b) a second container containing a tetravalent vaccine comprising Chimerivax⢠DEN-1,2,3 and 4.
13. The immunization kit as claimed in claim 12, wherein the monovalent vaccine comprises 104 DICC50 of VDV1 or VDV2 and the tetravalent vaccine comprises about 105 DICC50 of Chimerivax⢠DEN-1,2,3 and about 103 DICC50 of Chimerivax⢠DEN-4.