US20110039332A1
2011-02-17
12/663,840
2007-11-20
To establish human pluripotent stem cells having properties close to human ES cells comprising the genome of the patient per se that can circumvent immunological rejection of transplanted cells from cells derived from a postnatal human tissue. It was found that human pluripotent stem cells can be induced by introducing three genes of Oct3/4, Sox2 and KIf 4, or three genes of Oct3/4, Sox2 and KIf 4 plus the c-Myc gene or a histone deacetylase (HDAC) inhibitor to undifferentiated stem cells present in various human postnatal tissues in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation.
Get notified when new applications in this technology area are published.
A61P3/10 » CPC main
Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
C12N15/85 » CPC further
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
A61P25/28 » CPC further
Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
C12N5/0696 » CPC further
Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor; Animal cells or tissues; Human cells or tissues; Vertebrate cells Artificially induced pluripotent stem cells, e.g. iPS
C12N2501/602 » CPC further
Active agents used in cell culture processes, e.g. differentation; Transcription factors Sox-2
C12N2501/603 » CPC further
Active agents used in cell culture processes, e.g. differentation; Transcription factors Oct-3/4
C12N2501/604 » CPC further
Active agents used in cell culture processes, e.g. differentation; Transcription factors Klf-4
C12N2501/606 » CPC further
Active agents used in cell culture processes, e.g. differentation; Transcription factors c-Myc
C12N2510/00 » CPC further
Genetically modified cells
C12N2799/027 » CPC further
Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a retrovirus
The present invention relates to human pluripotent stem cells induced from stem cells present in a human postnatal tissue and its inducing method.
With the rapid aging of the society, diseases associated with tissue degeneration and tissue injury are rapidly increasing. Said diseases include cerebral infarction, myocardial infarction and renal failure that develop in an age-dependent manner due to the metabolic syndrome, Alzheimer's disease, Parkinson's disease and osteoporosis that are induced by age-related internal changes of the tissue, and the like. Type I diabetes, multiple sclerosis and rheumatoid arthritis induced by autoimmune diseases as well as burns and spinal injuries induced by wounds are also diseases characterized by tissue degeneration and tissue injury. As methods of treating such diseases resulting from tissue degeneration and injury, various regenerative medical techniques are being developed now.
Regenerative medicine is roughly divided into two methods: the induced regeneration method in which endogenous stem cells in patients are activated with a drug etc., and the cell replacement therapy in which stem cells or somatic cells induced from stem cells or tissues are transplanted. Specifically, in diseases accompanied by chronic inflammation and diseases in elderly individuals, the induced regeneration method does not work well due to reduced function of stem cells from the patient per se, and thus the development of the cell replacement therapy is imperative. In order to treat diseases resulting from tissue degeneration and injury by a cell replacement therapy, a large amount of stem cells or somatic cells induced from stem cells generally need to be prepared as materials for transplantation. For this purpose, stem cells that can differentiate into various tissues and that can self-replicate for a long time are indispensable for the development of a cell replacement therapy.
As stem cells that satisfy these conditions, there have been reported ES cells or EG cells that can be induced from fertilized eggs or primordial germ cells. However, in order to perform the cell replacement therapy safely and efficiently, it is necessary to prepare ES cells or EG cells comprising the genome of the patient per se that can circumvent the immunological rejection of transplanted cells.
As a method of preparing ES cells comprising the genome of the patient per se, a method of nuclear transplantation in which the nucleus of an egg is replaced with that of a somatic cell of the recipient has been investigated in animals such as mice. However, the success rate of nuclear transplantation is still low, and no success has been made in humans. Separately, there is a report on establishment of the iPS (induced pluripotent stem) cells having a property close to that of ES cells by introducing four genes of Oct3/4, Sox2, Klf4 and c-Myc into fibroblasts derived from mouse skin (Cell 126: 1-14, Aug. 25, 2006). However, the rate of iPS induction is low, and it has not been successful in humans.
Thus, it is an object of the present invention to establish human pluripotent stem cells from cells derived from a human postnatal tissue, said stem cells having properties close to that of ES cells and comprising the genome of the patient per se thereby circumventing immunological rejection of transplanted cells.
The present inventors have found that human pluripotent stem cells can be induced by introducing three genes of Oct3/4, Sox2 and Klf4 or three genes of Oct3/4, Sox2 and Klf4 plus the c-Myc gene or a histone deacetylase (HDAC) inhibitor into undifferentiated stem cells present in a human postnatal tissue in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation. Furthermore, we have discovered a method of efficiently inducing human pluripotent stem cells by introducing three genes of Oct3/4, Sox2 and Klf4 or three genes of Oct3/4, Sox2 and Klf4 plus the c-Myc gene or a histone deacetylase inhibitor into undifferentiated stem cells after the undifferentiated stem cells were amplified by a primary culture or a second subculture, or a subculture in a low density and low subculturing in a culture medium comprising a low-concentration serum.
Human postnatal tissues are preferably tissues immediately after birth (various tissues of neonates), umbilical cord tissues (the umbilical cord, cord blood), the amnion, the placenta etc., and more preferably various neonatal tissues and umbilical cord tissues. Post-natal tissues include tissues of various timings during the period from the birth of an individual to its death. The undifferentiated stem cells refer to stem cells in which at least four genes of Nanog, Oct3/4, Sox2 and Tert have not undergone epigenetic modification by heterochromatin formation due to DNA methylation or histone modification, among the primordial cells in the tissue of somatic stem cells established in vitro, such as mesenchymal stem cells (Science, 1999, April 2; 284 (5411): 143-7) and MAPCs (multipotent adult progenitor cells) (Stem Cell Rev. 2005; 1(1): 53-9), and MIAMI (marrow-isolated adult multilineage inducible) cells (J. Cell Sci. 2004 Jun. 15; 117 (Pt 14): 2971-81).
ES cell-like pluripotent stem cells refer to cells having an in vitro long-term self-renewal ability and the pluripotency of differentiating into three germ layers, and said pluripotent stem cells may form teratoma when transplanted into a test animal such as mouse. The present invention is thought to provide a useful technique for the cell replacement therapy for the treatment of diseases resulting from tissue degeneration or injury.
After extensive and intensive investigation on methods of establishing ES cell-like pluripotent stem cells from human postnatal tissues, the present inventors have obtained the following three major findings:
(1) Among the cells derived from human postnatal tissues, cells that can be transformed into ES cell-like pluripotent stem cells by introducing four genes of Oct3/4, Sox2, Klf4 and c-Myc are undifferentiated stem cells in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation;
(2) Undifferentiated stem cells in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation are mostly present in postnatal tissues immediately after birth (various neonatal tissues), cord tissues (the umbilical cord, cord blood), the amnion, the placenta and the like; and
(3) When cultured under a high-concentration serum or subcultured for a long time even under a low serum concentration, undifferentiated stem cells in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation lose its property of being transformed into ES cell-like pluripotent stem cells by the introduction of four genes of Oct3/4, Sox2, Klf4 and c-Myc. By applying said findings, we have completed the present invention that establishes ES cell-like pluripotent stem cells efficiently from human tissue-derived cells.
Since the c-Myc gene has a risk of inducing cancer, we have then investigated its alternatives, and have found that by adding a histone deacetylase inhibitor in stead of the c-Myc gene to undifferentiated stem cells in mice, ES cell-like pluripotent stem cells can be induced from undifferentiated stem cells in which the Tert, Nanog, Oct3/4 and Sox2 genes have not undergone epigenetic inactivation present in postnatal tissues, and thus, it is expected that, in the case of humans as well, by adding a histone deacetylase inhibitor in stead of the c-Myc gene to undifferentiated stem cells in which the Tert, Nanog, Oct3/4 and Sox2 genes have not undergone epigenetic inactivation, they could be transformed into ES cell-like pluripotent stem cells.
Furthermore, it was found, in mice, that transformation into ES cell-like pluripotent stem cells can be effected by introducing only three genes of Oct3/4, Sox2 and Klf4 except the c-Myc gene to undifferentiated stem cells, and thus it is expected in the case of humans as well, by adding three genes of Oct3/4, Sox2 and Klf4 to undifferentiated stem cells in which the Tert, Nanog, Oct3/4 and Sox2 genes have not undergone epigenetic inactivation, transformation into ES cell-like pluripotent stem cells could be effected.
Thus, the present invention provides the following (1) to (35):
(1) A human pluripotent stem cell having an in vitro long-term self-renewal ability and the pluripotency of differentiating into ectoderm, mesoderm and endoderm, that was induced from an undifferentiated stem cell present in a human postnatal tissue in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation.
(2) The human pluripotent stem cell according to the above (1) induced from an undifferentiated stem cell present in a human postnatal tissue, wherein said undifferentiated stem cell present in the human postnatal tissue was subjected to a primary culture or a second subculture, or a subculture in a low serum concentration.
(3) The human pluripotent stem cell according to the above (1) induced by the forced expression of each of three genes of Oct3/4, Sox2 and Klf4 in an undifferentiated stem cell present in a human postnatal tissue, wherein said undifferentiated stem cell present in the human postnatal tissue was subjected to a primary culture or a second subculture or to a subculture in a low serum concentration.
(4) The human pluripotent stem cell according to the above (1) induced by the forced expression of each of four genes of Oct3/4, Sox2, Klf4 and c-Myc in an undifferentiated stem cell present in a human postnatal tissue, wherein said undifferentiated stem cell present in the human postnatal tissue was subjected to a primary culture or a second subculture or to a subculture in a low serum concentration.
(5) The human pluripotent stem cell according to the above (1) induced by combining the forced expression of each of three genes of Oct3/4, Sox2 and Klf4 and a histone deacetylase inhibitor treatment in an undifferentiated stem cell present in a human postnatal tissue, wherein said undifferentiated stem cell present in the human postnatal tissue was subjected to a primary culture or a second subculture or to a subculture in a low serum concentration.
(6) The human pluripotent stem cell according to the above (1) induced by combining the forced expression of each of three genes of Oct3/4, Sox2 and Klf4 and a MS-275 treatment in an undifferentiated stem cell present in a human postnatal tissue, wherein said undifferentiated stem cell present in the human postnatal tissue was subjected to a primary culture or a second subculture or to a subculture in a low serum concentration.
(7) The human pluripotent stem cell according to any one of the above (2) to (6) wherein FGF-2 is further used in the culture of said undifferentiated stem cell.
(8) The human pluripotent stem cell according to any one of the above (2) to (6) wherein PDGF and FGF are further used in the culture of said undifferentiated stem cell.
(9) The human pluripotent stem cell according to any one of the above (2) to (8) wherein the culture of said undifferentiated stem cell is further conducted in a lower density.
(10) The human pluripotent stem cell according to any one of the above (1) to (9) wherein said human pluripotent stem cell is positive for Nanog.
(11) The human pluripotent stem cell according to any one of the above (1) to (10) wherein said human pluripotent stem cell is positive for alkaline phosphatase staining.
(12) The human pluripotent stem cell according to any one of the above (1) to (11) wherein said human pluripotent stem cell is positive for Tert.
(13) The human pluripotent stem cell according to any one of the above (1) to (12) wherein said human pluripotent stem cell comes to have teratoma-forming potential when it is transplanted into a test animal.
(14) The human pluripotent stem cell according to any one of the above (1) to (13) wherein said human postnatal tissue is a tissue immediately after birth.
(15) The human pluripotent stem cell according to any one of the above (1) to (13) wherein said human postnatal tissue is a tissue immediately after birth and is a tissue derived from a neonatal tissue or an umbilical cord tissue.
(16) The human pluripotent stem cell according to any one of the above (1) to (13) wherein said human postnatal tissue is a tissue immediately after birth and is a tissue derived from a neonatal skin or a blood vessel derived from the umbilical cord.
(17) The human pluripotent stem cell according to any one of the above (1) to (16) wherein said human pluripotent stem cell further has an in vitro potential of differentiating into a primordial germ cell.
(18) An undifferentiated stem cell present in a human postnatal tissue, in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation and which can be induced into a human pluripotent stem cell having an in vitro long-term self-renewal ability and the pluripotency of differentiating into ectoderm, mesoderm and endoderm by the forced expression of each of three genes of Oct3/4, Sox2 and Klf4.
(19) An undifferentiated stem cell present in a human postnatal tissue, in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation and which can be induced into a human pluripotent stem cell having an in vitro long-term self-renewal ability and the pluripotency of differentiating into ectoderm, mesoderm and endoderm by the forced expression of each of four genes of Oct3/4, Sox2, Klf4 and c-Myc.
(20) An undifferentiated stem cell present in a human postnatal tissue, in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation and which can be induced into a human pluripotent stem cell having an in vitro long-term self-renewal ability and the pluripotency of differentiating into ectoderm, mesoderm and endoderm by combining the forced expression of each of three genes of Oct3/4, Sox2 and Klf4 and a histone deacetylase inhibitor treatment.
(21) An undifferentiated stem cell present in a human postnatal tissue, in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation and which can be induced into a human pluripotent stem cell having an in vitro long-term self-renewal ability and the pluripotency of differentiating into ectoderm, mesoderm and endoderm by combining the forced expression of each of three genes of Oct3/4, Sox2 and Klf4 and a MS-275 treatment.
(22) The undifferentiated stem cell present in a human postnatal tissue according to any one of the above (18) to (21), wherein said human postnatal tissue is a tissue immediately after birth.
(23) The undifferentiated stem cell present in a human postnatal tissue according to any one of the above (18) to (21), wherein said human postnatal tissue is a tissue immediately after birth and is a tissue derived from a neonatal tissue or an umbilical cord tissue.
(24) The undifferentiated stem cell present in a human postnatal tissue according to any one of the above (18) to (21), wherein said human postnatal tissue is a tissue immediately after birth and is a tissue derived from a neonatal skin or a blood vessel of the umbilical cord.
(25) The undifferentiated stem cell present in a human postnatal tissue according to any one of the above (18) to (24), wherein said human pluripotent stem cell further has an in vitro potential of differentiating into a primordial germ cell.
(26) A method of inducing a human pluripotent stem cell wherein an undifferentiated stem cell present in a human postnatal tissue, in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation, is subjected to a primary culture or a second subculture or to a third or fourth subculture in a low serum concentration at 0 to 5%, and then each of three genes of Oct3/4, Sox2 and Klf4 is subjected to forced expression.
(27) The method of inducing a human pluripotent stem cell according to the above (26), wherein each of four genes comprising each of three genes of Oct3/4, Sox2 and Klf4 plus c-Myc is subjected to forced expression.
(28) The method of inducing a human pluripotent stem cell according to the above (26), wherein the forced expression of each of three genes of Oct3/4, Sox2 and Klf4 is combined with a histone deacetylase inhibitor treatment.
(29) The method of inducing a human pluripotent stem cell according to the above (26), wherein the forced expression of each of three genes of Oct3/4, Sox2 and Klf4 is combined with a MS-275 treatment.
(30) The method of inducing a human pluripotent stem cell according to any one of the above (26) to (29), wherein said undifferentiated stem cell is cultured in the presence of FGF-2.
(31) The method of inducing a human pluripotent stem cell according to any one of the above (26) to (29), wherein said undifferentiated stem cell is cultured in the presence of PDGF and EGF
(32) The method of inducing a human pluripotent stem cell according to any one of the above (26) to (31), wherein said human postnatal tissue is a tissue immediately after birth.
(33) The method of inducing a human pluripotent stem cell according to any one of the above (26) to (31), wherein said human postnatal tissue is a tissue immediately after birth and is a tissue derived from a neonatal tissue or an umbilical cord tissue.
(34) The method of inducing a human pluripotent stem cell according to any one of the above (26) to (31), wherein said human postnatal tissue is a tissue immediately after birth and is a tissue derived from a neonatal skin or a blood vessel of the umbilical cord.
(35) A method of culturing a human pluripotent stem cell according to any one of the above (1) to (17) in a culture medium comprising an inhibitor of Rho associated kinase as an active ingredient.
(36) The human pluripotent stem cell according to anyone of the above (1) to (17) on which cell surface antigens SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, CD9, CD24, and CD90 are expressed.
The undifferentiated stem cells of the present invention present in a human postnatal tissue refer to stem cells that have not undergone epigenetic modification by heterochromatin formation due to DNA methylation or histone modification of at least four genes of Nanog, Oct3/4, Sox2 and Tert among the primordial cells in the tissue of various somatic stem cells established in vitro, such as mesenchymal stem cells, MAPCs and MIAMI cells. When human pluripotent stem cells are induced from undifferentiated stem cells present in a human postnatal tissue, each gene of Tert, Nanog, Oct3/4 and Sox2 is activated (expressed).
Mesenchymal stem cells refer to those cells having the potential of differentiating into mesenchymal cells (bone, cartilage, fat) among the cells (interstitial cells) obtained as nonhematopoietic cells that are adherent to a plastic culture tray when tissues of bone marrow, fat, muscle, skin etc. are cultured in a culture medium containing a high-concentration serum (5% or more). Thus, mesenchymal stem cells are the cells obtained by the above culturing, and thus their properties are different from those of the undifferentiated cells (stem cells in which at least four genes of Nanog, Oct3/4, Sox2 and Tert have not undergone epigenetic modification by heterochromatin formation due to DNA methylation or histone modification, among the primordial cells in the tissue of somatic stem cells established in vitro, such as mesenchymal stem cells, MAPCs and MIAMI cells) immediately after isolation from human postnatal tissues.
However, even under the condition of culturing mesenchymal stem cells, MAPCs and MIAMI cells, a very small number of the undifferentiated cells can be maintained depending on the culture conditions of a small passage number or low-density culturing. As the human postnatal tissues of the present invention, there can be mentioned each tissue at various timings during the period from the birth of an individual to its death (bone marrow fluid, muscle, adipose tissue, peripheral blood, skin, skeletal muscle etc.) and tissues concomitant to birth such as cord tissues (umbilical cord, cord blood), the amnion, the placenta and the like, preferably there can be mentioned tissues (bone marrow fluid, muscle, adipose tissue, peripheral blood, skin, skeletal muscle etc.) immediately after birth such as various neonatal tissues, and more preferably there can be mentioned various neonatal tissues such as neonatal skin and cord tissues (umbilical cord, cord blood) such as tissues derived from cord-derived blood vessels.
Undifferentiated stem cells present in the human postnatal tissues of the present invention can be cultured for a certain period from a primary culture in a culture medium containing or not containing a low concentration serum (preferably 2% or less) and to which cell growth factors (PDGF, EGF, FGF-2 etc.) have been added or not added, and have properties different from those of mesenchymal stem cells that are characterized by a long time culturing in the serum (concentrations exceeding 5%).
As the above cell growth factors, there can be mentioned FGF-2, PDGF, EGF, IGF, insulin, TGFb-1, activin A, noggin, BDNF, NGF, NT-1, NT-2, NT-3 and the like, and the addition of FGF-2 alone or the addition of both PDGF and EGF is preferred. The above FGF-2 stands for basic fibroblast growth factor, PDGF stands for platelet-derived growth factor, EGF stands for epidermal growth factor, IGF stands for insulin-like growth factor, TGF β-1 stands for transforming growth factor β-1, BDNF stands for brain-derived neurotrophic factor, NGF stands for nerve growth factor, NT-1 stands for neurotrophin-1, NT-2 stands for neurotrophin-2, and NT-3 stands for neurotrophin-3.
The above primary culture represents immediately after isolation from a human, the primary culture cells subcultured once represent the second subculture, the primary culture cells subcultured twice represent the third subculture, and the primary culture cells subcultured three times represent the fourth subculture. Culturing for a certain period from the above primary culture generally means from the primary culture to the fourth subculture, preferably from the primary culture to the second subculture.
Human pluripotent stem cells induced from undifferentiated stem cells present in a human postnatal tissue in which the Tert, Nanog, Oct3/4 and Sox2 genes have not undergone epigenetic inactivation represent stem cells that have a long-term self-renewal ability under the condition for culturing human ES cells and an in vitro pluripotency of differentiating into ectoderm, mesoderm and endoderm under the condition for inducing in vitro differentiation of human ES cells, and the above human pluripotent stem cells may further have a potential of differentiating into primordial germ cells under the condition for inducing in vitro differentiation of human ES cells. Also human pluripotent stem cells of the present invention induced from undifferentiated stem cells present in a human postnatal tissue in which the Tert, Nanog, Oct3/4 and Sox2 genes have not undergone epigenetic inactivation may be stem cells that have an ability of forming teratoma when transplanted into a test animal such as mouse.
The low concentration serum encompassed by the present invention is generally serum at a concentration of 5% or less, preferably serum at a concentration of 2% or less, and the low density as used herein is a concentration of about 10% or less.
As the method of alkaline phosphatase staining, the following method may be mentioned. Thus, after removing the culture liquid from each well, the cells are fixed in a 10% formaldehyde solution at room temperature for 2 to 5 minutes, washed with a phosphate buffer etc., a solution of nitroblue tetrazolium chloride/5-bromo-4-chloro-3′-indolyl phosphate p-toluidine salt (hereinafter referred to as the NBT/BCIP solution), a chromogenic substrate of alkaline phosphatase, is added, and reacted at room temperature for 20-30 minutes.
The human pluripotent stem cells were expressed cell surface antigens SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, CD9, CD24, and CD90, and ES cell marker genes Nanog, Oct3/4, TDGF1, Dnmt3b, GABRB3, GDF3, Zfp42, ALP, CD9, and Thy-1. The promoter regions of Nanog and Oct3/4 in the human pluripotent stem cells were demethylated compared to the parental fibroblasts. The human pluripotent stem cells carries at least a single copy of Oct3/4, Sox2, Klf4, and c-Myc transgene. The induced human pluripotent stem cells and the parental cells (undifferentiated stem cell present in a human postnatal tissue) had almost the same SNP genotype each other, and HLA type of the induced human pluripotent stem cell was completely identical to that of the parental cell (undifferentiated stem cell present in a human postnatal tissue).
A histone deacetylase inhibitor and MS-275 and a treatment method using them are as describe later:
The method of forced expression as used herein comprises a method for external expression in which a gene is expressed by introducing it with a vector etc. and a method for internal expression in which internal expression is promoted by the stimulation of a drug etc. Furthermore, forced expression as used herein also encompasses a method in which the genes of Oct3/4, Sox2, Klf4 and c-Myc are extracellularly expressed, and then the proteins produced of Oct3/4, Sox2, Klf4 and c-Myc are introduced directly into the cell using a method for introducing protein. As the method for introducing protein, there can be mentioned in case of a method that employs a commercially available carrier reagent (Chariot, BioPorter, GenomONE), the PTD (protein transduction domain) fusion protein method, the electroporation method, the microinjection method and the like. The external expression method in which each gene of Oct3/4, Sox2, Klf4 and c-Myc is introduced into a vector etc. for forced expression is as follows:
The present invention will now be explained in detail below.
1. A Method of Separating a Cell Fraction that Contains Undifferentiated Stem Cells from Human Postnatal Bone Marrow
As a method of obtaining the undifferentiated stem cells of the present invention present in human postnatal tissue from human bone marrow, the following method may be mentioned.
In order to harvest a bone marrow fluid from human bone marrow, the donor is given a general anesthetic, then placed on a prone position, and from the posterior border of the ilium, a needle called the bone marrow collection needle is stuck directly into the skin to lead the needle through the iliac surface to the bone marrow, and the liquid of the bone marrow is aspirated with a syringe. In order to obtain undifferentiated stem cells from the bone marrow fluid, the mononuclear cell fraction separated by density centrifugation is collected. The collected cell fraction, as crude purified cells containing the undifferentiated stem cells, is cultured according to the method described in 6, and used for the induction of human pluripotent stem cells of the present invention.
2. A Method of Separating a Fraction that Contains Undifferentiated Stem Cells from Human Postnatal Skin
As a method of obtaining the undifferentiated stem cells of the present invention present in human postnatal tissue from human skin, the following method may be mentioned.
From the back of a human knee or the buttock, a skin tissue containing the epidermis and the dermis is harvested. This skin tissue is immersed in 0.6% trypsin (manufactured by Invitrogen)/DMEM (Dulbecco's Modified Eagle's Medium)/F-12 (manufactured by Invitrogen)/1% antibiotics, antimycotics (manufactured by Invitrogen) with the inner side of the skin facing downward, and treated at 37° C. for 30 minutes.
After the skin tissue is turned over to scrub slighly the inner side with tweezers, the skin tissue is finely cut into about 1 mm2 sections using scissors, which are then centrifuged at 1200 rpm and room temperature for 10 minutes. The supernatant is removed, and to the tissue precipitate is added 25 ml of 0.1% trypsin/DMEM/F-12/1% antibiotics, antimycotics, and stirred using a stirrer at 37° C. and 200-300 rpm for 40 minutes. After confirming the tissue precipitate was fully digested, 3 ml fetal bovine serum (FBS) (manufactured by JRH) is added, and filtered sequentially with gauze (Type I manufactured by PIP), a 100 μm nylon filter (manufactured by FALCON) and a 40 μm nylon filter (manufactured by FALCON). After centrifuging at 1200 rpm and room temperature for 10 minutes to remove the supernatant, DMEM/F-12/1% antibiotics, antimycotics is added to wash the precipitate, and then centrifuged at 1200 rpm and room temperature for 10 minutes. The cell faction thus obtained may be cultured according to the method described in 6. below as crude purified cells containing undifferentiated stem cells, and used for the induction of human pluripotent stem cells of the present invention.
3. A Method of Separating a Fraction that Contains Undifferentiated Stem Cells from a Human Postnatal Skeletal Muscle
As a method of obtaining the undifferentiated stem cells of the present invention present in human postnatal tissue from human skeletal muscle, the following method may be mentioned.
After the epidermis and a connective tissue containing muscle such as a lateral head of biceps brachii muscle and a sartorius muscle of the leg is cut and the muscle is excised, it is sutured. The whole muscle obtained is minced with scissors or a scalpel, and then suspended in DMEM (high glucose) containing 0.06% collagenase type IA (manufactured by SIGMA) and 10% FBS, and incubated at 37° C. for 2 hours.
By centrifugation, cells are collected from the minced muscle, and suspended in DMEM (high glucose) containing 10% FBS. After passing the suspension through a microfilter with a pore size of 40 μm and then a microfilter with a pore size of 20 μm, the cell fraction obtained may be cultured according to the method described in 6. below as crude purified cells containing undifferentiated stem cells, and used for the induction of human pluripotent stem cells of the present invention.
4. A Method of Separating a Cell Fraction that Contains Undifferentiated Stem Cells from a Human Postnatal Adipose Tissue
As a method of obtaining the undifferentiated stem cells of the present invention present in human postnatal tissue from human postnatal adipose tissue, the following method may be mentioned.
Cells derived from adipose tissue for use in the present invention may be isolated by various methods known to a person skilled in the art. For example, such a method is described in U.S. Pat. No. 6,153,432, which is incorporated herein in its entirety. A preferred source of adipose tissue is omental adipose tissue. In humans, adipose cells are typically isolated by fat aspiration.
In one method of isolating cells derived from adipose cells, adipose tissue is treated with 0.01% to 0.5%, preferably 0.04% to 0.2%, and most preferably about 0.1% collagenase, 0.01% to 0.5%, preferably 0.04%, and most preferably about 0.2% trypsin and/or 0.5 ng/ml to 10 ng/ml dispase, or an effective amount of hyaluronidase or DNase (DNA digesting enzyme), and about 0.01 to about 2.0 mM, preferably about 0.1 to about 1.0 mM, most preferably 0.53 mM concentration of ethylenediaminetetraacetic acid (EDTA) at 25 to 50° C., preferably 33 to 40° C., and most preferably 37° C. for 10 minutes to 3 hours, preferably 30 minutes to 1 hour, and most preferably 45 minutes.
Cells are passed through nylon or a cheese cloth mesh filter of 20 microns to 800 microns, more preferably 40 microns to 400 microns, and most preferably 70 microns. Then the cells in the culture medium are subjected to differential centrifugation directly or using Ficoll or Percoll or another particle gradient. The cells are centrifuged at 100 to 3000×g, more preferably 200 to 1500×g, most preferably 500×g for 1 minute to 1 hours, more preferably 2 to 15 minutes and most preferably 5 minutes, at 4 to 50° C., preferably 20 to 40° C. and more preferably about 25° C.
The adipose tissue-derived cell fraction thus obtained may be cultured according to the method described in 6. below as crude purified cells containing undifferentiated stem cells, and used for the induction of human pluripotent stem cells of the present invention.
5. A Method of Separating a Cell Fraction that Contains Undifferentiated Stem Cells from a Human Postnatal Peripheral Blood or Human Cord Blood
As a method of obtaining the undifferentiated stem cells of the present invention present in human postnatal tissue from human postnatal peripheral blood or human cord blood, the following method may be mentioned.
First, from the vein or cord blood, about 50 ml to 500 ml of blood is harvested to collect cells, and mononuclear cells are collected by the Ficoll-Hypaque method [Kanof, M. E. and Smith, P. D. 1993 Isolation of whole mononuclear cells from peripheral blood. in Current Protocols in Immunology (J. E. Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevack, and W. Strober, eds.), pp. 7.1.1.-7.1.5, John Wiley & Sons, New York].
Then, about 1×107 to 1×108 human peripheral blood mononuclear cells are suspended in a RPMI 1640 medium (manufactured by Invitrogen) (hereinafter referred to as an essential medium for culturing peripheral blood stem cells) containing 10% fetal bovine serum (manufactured by JRH Biosciences), 100 μg/ml streptomycin and 100 units/ml penicillin (manufactured by Invitrogen), and after washing twice, the cells are recovered. The recovered cells are suspended again in the essential medium for culturing peripheral blood stem cells, which is then plated in a 100 mm plastic culture dish at 1×107 cells/dish, and incubated in a 37° C. incubator under a condition of 8% CO2. After 10 hours, suspended cells are removed and the attached cells are only harvested by pipetting.
The peripheral blood-derived or cord blood-derived adherent cell fraction thus obtained may be cultured according to the method described in 6. below as crude purified cells containing undifferentiated stem cells, and used for the induction of human pluripotent stem cells of the present invention.
Examples of culture media useful in culturing the undifferentiated stem cells of the present invention present in a human postnatal tissue include the ES medium [40% Dulbecco's Modified Eagle's Medium (DMEM), 40% F12 medium, 2 mM L-glutamine, 1% non-essential amino acids, 0.1 mM β-mercaptoethanol (the above are manufactured by SIGMA), 20% Knockout Serum Replacement (manufactured by Invitrogen), 10 μg/ml gentamycin (manufactured by Invitrogen)] (hereinafter referred to as the ES medium), the MAPC medium [60% Dulbecco's Modified Eagle's Medium-low glucose (manufactured by Invitrogen), 40% MCDB 201 (manufactured by Invitrogen), 1×ITS medium supplement (manufactured by SIGMA), 1× linolenic acid albumin (manufactured by SIGMA), 1 nM dexamethasone (manufactured by SIGMA), 10−4 M ascorbic acid (manufactured by SIGMA), 10 μg/ml gentamycin (manufactured by Invitrogen), 2% fetal bovine serum (manufactured by Invitrogen)] (hereinafter referred to as the MAPC medium), the FBM medium (manufactured by Lonza) [MCDB202 modified medium, 2% fetal bovine serum, 5 μg/ml insulin, 50 μg/ml gentamycin, 50 ng/ml amphotericin-B] (hereinafter referred to as the FBM medium), and the like.
As “growth factors, cytokines, hormones” to be added to the above culture medium, there can be mentioned FGF-2, PDGF, EGF, IGF, insulin, TGFb-1, activin A, Noggin, BDNF, NGF, NT-1, NT-2, NT-3 and the like.
In order to induce human pluripotent stem cells of the present invention efficiently form the undifferentiated stem cells of the present invention present in a human postnatal tissue, preferably the cell fraction obtained by the above methods 1. to 5. is cultured in a medium containing the above additives for about 1 to 12 days at a low density of about 103 cells/cm2 to 104 cells/cm2.
7. A Method of Inducing Human Pluripotent Stem Cells from Undifferentiated Stem Cells Present in a Human Postnatal Tissue
In order to induce the human pluripotent stem cells of the present invention from the undifferentiated stem cells of the present invention present in a human postnatal tissue cultured according to the method described in 6., it is necessary to introduce the c-Myc gene or a histone deacetylase inhibitor, in addition to the three genes of Oct3/4, Sox2 and Klf4, to the undifferentiated stem cells of the present invention present in a human postnatal tissue cultured according to the method described in 6.
As virus vectors that can be used for introducing a gene into the undifferentiated stem cells of the present invention present in a human postnatal tissue, there can be mentioned retrovirus vectors (including lentivirus vectors), adenovirus vectors and the like, and preferably adenovirus vectors are used to introduce a mouse-derived cationic amino acid transporter (mCAT) gene, and then a retrovirus vector is used to introduce the Oct3/4, Sox2, Klf4 and c-Myc genes.
As virus vector plasmids, there can be mentioned pMXs, pMXs-IB, pMXs-puro, pMXs-neo (pMXs-IB is a vector carrying the blasticidin-resistant gene in stead of the puromycin-resistant gene of pMXs-puro) [Experimental Hematology, 2003, 31 (11): 1007-14], MFG [Proc. Natl. Acad. Sci. U.S.A. 92, 6733-6737 (1995)], pBabePuro [Nucleic Acids Research 18, 3587-3596 (1990)], LL-CG, CL-CG, CS-CG, CLG [Journal of Virology 72: 8150-8157 (1998)] and the like as the retrovirus system, and pAdexl [Nucleic Acids Res. 23: 3816-3821 (1995)] and the like as the adenovirus system.
As packaging cells, any cells may be used that can supply a lacking protein of a recombinant virus vector plasmid deficient in at least one gene encoding a protein required for virus packaging. For example, there can be used HEK-293 cells derived from human kidney, packaging cells based on a mouse fibroblast NIH3T3, and the like.
As proteins to be supplied by packaging cells, there can be used retrovirus-derived proteins such as gag, pol, and env in the case of retrovirus vectors, HIV-derived proteins such as gag, pol, env, vpr, vpu, vif, tat, rev, and nef in the case of lentivirus vectors, and adenovirus-derived proteins such as E1A and E1B in the case of adenovirus vectors.
By introducing any of the above recombinant virus vector plasmid into the above packaging cells, recombinant virus vectors can be produced. As methods of introducing the above virus vector plasmid into the above packaging cells, various gene introduction methods are known including, but not limited to, the calcium phosphate method [Kokai (Japanese Unexamined Patent Publication) No. 2-227075], the lipofection method [Proc. Natl. Acad. Sci. U.S.A. 84: 7413 (1987)], the electroporation method and the like, and any suitable method may be used from the known gene introduction methods.
As histone acetylase inhibitors, there can be mentioned those described in the following A to E, and among them MS-275 is preferred.
A. Trichostatin A and its analogs, for example: trichostatin A (TSA); and trichostatin C (Koghe et al. 1998, Biochem. Pharmacol. 56: 1359-1364).
B. Peptides, for example: oxamflatin [(2E)-5-[3-[(phenylsulfonyl)aminophenyl]-pent-2-ene-4-inohydroxamic acid (Kim et al., Oncogene 18: 2461-2470 (1999)); Trapoxin A (cyclo-(L-phenylalanyl-L-phenylalanyl-D-pipecolinyl-L-2-amino-8-oxo-9,10-epoxy-decanoyl (Kijima et al., J. Biol. Chem. 268: 22429-22435 (1993)); FR901228, depsipeptide (Nakajima et al., Ex. Cell RES. 241: 126-133 (1998)); FR225497, cyclic tetrapeptide (H. Mori et al., PCT International Patent Publication WO 00/08048 (Feb. 17, 2000)); apicidin, cyclic tetrapeptide [cyclo-(N—O-methyl-L-tryptophanyl-L-isoleucinyl-D-pipecolinyl-L-2-amino-8-oxodecanoyl)] (Darkin-Rattray et al., Proc. Natl. Acad. Sci. U.S.A. 93: 13143-13147 (1996); apicidin Ia, apicidin Ib, apicidin Ic, apicidin IIa, and apicidin IIb (P. Dulski et al., PCT International Patent Publication WO 97/11366); HC-toxin, cyclic tetrapeptide (Bosch et al., Plant Cell 7: 1941-1950 (1995)); WF27082, cyclic tetrapeptide (PCT International Patent Publication WO 98/48825); and chlamydocin (Bosch et al., supra).
C. Hybrid polar compounds (HPC) based on hydroxamic acid, for example: salicyl hydroxamic acid (SBHA) (Andrews et al., International J. Parasitology 30: 761-8 (2000)); suberoylanilide hydroxamic acid (SAHA) (Richon et al., Proc. Natl. Acad. Sci. U.S.A. 95: 3003-7 (1998)); azelaic bishydroxamic acid (ABHA) (Andrews et al., supra); azelaic-1-hydroxamate-9-anilide (AAHA) (Qiu et al., Mol. Biol. Cell 11: 2069-83 (2000)); M-carboxy cinnamic acid bishydroxamide (CBHA) (Ricon et al., supra); 6-(3-chlorophenylureido) carpoic hydroxamic acid, 3-Cl-UCHA) (Richon et al., supra); MW2796 (Andrews et al., supra); and MW2996 (Andrews et al., supra).
D. Short chain fatty acid (SCFA) compounds, for example: sodium butyrate (Cousens et al., J. Biol. Chem. 254: 1716-23 (1979)); isovalerate (McBain et al., Biochem. Pharm. 53: 1357-68 (1997)); valproic acid; valerate (McBain et al., supra); 4-phenyl butyric acid (4-PBA) (Lea and Tulsyan, Anticancer RESearch 15: 879-3 (1995)); phenyl butyric acid (PB) (Wang et al., Cancer RESearch 59: 2766-99 (1999)); propinate (McBain et al., supra); butylamide (Lea and Tulsyan, supra); isobutylamide (Lea and Tulsyan, supra); phenyl acetate (Lea and Tulsyan, supra); 3-bromopropionate (Lea and Tulsyan, supra); tributyrin (Guan et al., Cancer RESearch 60: 749-55 (2000)); arginine butyrate; isobutyl amide; and valproate.
E. Benzamide derivatives, for example: MS-275 [N-(2-aminophenyl)-4-[N-(pyridine-3-yl-methoxycarbonyl)aminomethyl]benzamide] (Saito et al., Proc. Natl. Acad. Sci. U.S.A. 96: 4592-7 (1999)); and a 3′-amino derivative of MS-275 (Saito et al., supra); and CI-994.
A histone deacetylase inhibitor treatment may be carried out, for example, as follows:
The concentration of the histone deacetylase inhibitor used depends on a particular inhibitor, but is preferably 0.001 nM to about 10 mM, and more preferably about 0.01 nM to about 1000 nM. The effective amount or the dosage of a histone deacetylase inhibitor is defined as the amount of the histone deacetylase inhibitor that does not significantly decrease the survival rate of cells, specifically undifferentiated stem cells. Cells are exposed for 1 to 5 days or 1 to 3 days. The exposure period may be less than one day. In a specific embodiment, cells are cultured for about 1 to 5 days, and then exposed to an effective amount of a histone deacetylase inhibitor. However, the histone deacetylase inhibitor may be added at the start of culturing. Within such a time frame, a gene-carrying vehicle such as a vector containing a nucleic acid encoding three genes (Oct3/4, Sox2 and Klf4) is introduced into cultured cells by a known method.
Examples of culture media useful for culturing human pluripotent stem cells induced from undifferentiated stem cells present in a human postnatal tissue of the present invention include, but not limited to, the ES medium, and a culture medium suitable for culturing human ES cells such as MEF-conditioned ES medium (hereinafter referred to as the MEF-conditioned ES medium) which is a supernatant obtained by adding 10 ng/ml FGF-2 to the ES medium and then mouse embryonic fibroblasts (hereinafter referred to as MEF) were added thereto and cultured for 24 hours to obtain the supernatant.
As “growth factors, cytokines, hormones” to be added to the above culture media, there can be mentioned ingredients involved in the growth and maintenance of human ES cells including FGF-2, TGFb-1, activin A, Nanoggin, BDNF, NGF, NT-1, NT-2, NT-3 and the like. The addition of Y-27632 (Calbiochem; water soluble) or Fasudil (HA1077: Calbiochem), an inhibitor of Rho associated kinase (Rho associated coiled coil-containing protein kinase) is also useful for culturing the human pluripotent stem cells of the present invention.
In order to culture and grow human pluripotent stem cells induced from the undifferentiated stem cells of the present invention present in a human postnatal tissue, it is preferred that the cells are subcultured every 5 to 7 days in a culture medium containing the above additives on a MEF-covered plastic culture dish or a matrigel-coated plastic culture dish to 1:3 to 1:6 or plated at 103 cells/cm2 to 3×104 cells/cm2.
In order to store human pluripotent stem cells induced from the undifferentiated stem cells of the present invention present in a human postnatal tissue for a long time, the following method may be mentioned.
After suspending the cells in the Cryopreservation Medium For Primate ES Cells (manufactured by ReproCELL), they are rapidly frozen in liquid nitrogen, and stored in a liquid nitrogen storage vessel for a long time.
10. A Method of Treating Diseases Using Human Pluripotent Stem Cells Induced from Undifferentiated Stem Cells Present in a Human Postnatal Tissue
In order to apply human pluripotent stem cells induced from the undifferentiated stem cells of the present invention present in a human postnatal tissue to treatment of diseases, the following method may be mentioned.
In order to apply human pluripotent stem cells induced from the undifferentiated stem cells of the present invention present in a human postnatal tissue to treatment of diseases caused by degeneration or insufficient functions of various tissues, it is desirable to harvest a tissue from an individual who wishes a future treatment, and to construct a cell bank system for storing stably undifferentiated stem cells present in a human postnatal tissue or the human pluripotent stem cells of the present invention induced from the undifferentiated stem cells.
Since undifferentiated stem cells present in a human postnatal tissue are detected at high rates in young individuals, preferred undifferentiated stem cells for the cell bank are cord blood, the umbilical cord, the placenta, skin obtained from neonates and the like. Even in adults, undifferentiated stem cells for the cell bank may be harvested from the bone marrow, adipose tissue, peripheral blood, skin and the like depending on the physical status of the donor. The undifferentiated stem cells of the present invention obtained from each donor may be stored frozen as they are, or may be transformed into human pluripotent stem cells according to the above-mentioned method of the present invention prior to storing frozen.
The undifferentiated stem cells of the present invention or the human pluripotent stem cells of the present invention thus stored may be used for the treatment of the donor per se or of immunohistologically compatible recipients as well. In treatment, depending on the amount of cell replacement required for the treatment of the subject disease, the human pluripotent stem cells of the present invention must be subcultured according to the method of the above 8. The required number of the human pluripotent stem cells of the present invention obtained by subculturing can be used for the treatment of various diseases by a method described below.
Diseases of the central nervous system using the human pluripotent stem cells of the present invention include Parkinson's disease, Alzheimer's disease, multiple sclerosis, cerebral infarction, spinal injury and the like. For the treatment of Parkinson's disease, a therapeutic method is possible in which human pluripotent stem cells are differentiated into dopamine-acting neurons and then transplanted into the striate body of the patient with Parkinson's disease. Differentiation into dopamine-acting neurons can be effected by coculturing the PA6 cell which is a mouse stromal cell line and the human pluripotent stem cells of the present invention under a serum-free condition. For the treatment of Alzheimer's disease, cerebral infarction and spinal injury, a therapeutic method in which the human pluripotent stem cells of the present invention are induced to differentiate into neural stem cells followed by transplantation into the injured site is effective.
In order to induce differentiation from the human pluripotent stem cells of the present invention to neural stem cells, three methods may be mentioned. In a first method, the human pluripotent stem cells of the present invention are cultured in suspension to form an embryoid body, and the embryoid body obtained is cultured in a serum-free medium containing FGF-2 for use in the culture of neural stem cells. In a second method, the human pluripotent stem cells of the present invention are cocultured with the PA6 cell which is a mouse stromal cell line, and then cultured in a serum-free medium containing FGF-2 for use in the culture of neural stem cells.
In a third method, the human pluripotent stem cells of the present invention are transferred to a serum-free medium containing FGF-2 to directly induce differentiation. In the treatment of multiple sclerosis, treatment can be effected by further inducing the differentiation of neural stem cells induced from the human pluripotent stem cells of the present invention into oligodendrocytes or progenitors of oligodendrocytes, which are then transplanted to the injured site. As a method of inducing oligodendrocytes or progenitors of oligodendrocytes from neural stem cells induced from the human pluripotent stem cells of the present invention, there can be mentioned a method of culturing said neural stem cells in the presence of a fusion protein between a soluble interleukin-6 receptor and interleukin-6.
The human pluripotent stem cells of the present invention can be used for the treatment of hepatic diseases such as hepatitis, cirrhosis and liver failure. In order to treat these diseases, the human pluripotent stem cells of the present invention are preferably differentiated to hepatic cells or hepatic stem cells, and then are transplanted. Hepatic cells or hepatic stem cells may be obtained by culturing the human pluripotent stem cells of the present invention in the presence of activin A for 5 days, and then culturing in the presence of the hepatocyte growth factor (HGF) for about a week to obtain hepatic cell or hepatic stem cells.
The human pluripotent stem cells of the present invention can be used for the treatment of pancreatic diseases such as type I diabetes mellitus. In the case of type I diabetes mellitus, the human pluripotent stem cells of the present invention are preferably differentiated to pancreatic beta cells, and then are transplanted to the pancreas. The human pluripotent stem cells of the present invention can be differentiated to pancreatic beta cells in following six steps of culturing: (1) culturing in the presence of a serum-free medium, activin A and Wnt protein for 1 to 2 days; (2) culturing in the presence of 0.2% FBS and activin A for 1 to 2 days; (3) culturing in the presence of 2% FBS, FGF-10 and KAAD-cyclopamine (keto-N-aminoethylaminocaproyl dihydrocinnamoylcyclopamine) for 2 to 4 days; (4) culturing in the presence of 1% B27 (manufactured by Invitrogen), FGF-10, KAAD-cyclopamine and retinoic acid for 2 to 4 days; (5) culturing in the presence of 1% B27, gamma secretase inhibitor and extendin-4 for 2 to 3 days; (6) culturing in the presence of 1% B27, extendin-4, IGF-1 and HGF for 3 days.
The human pluripotent stem cells of the present invention can be used for the treatment of heart failure associated with ischemic heart diseases. In treating heart failure, the human pluripotent stem cells of the present invention are preferably differentiated into cardiac muscle cells prior to transplanting to the injured site. By adding noggin to the medium from three days before forming an embryoid body, cardiac muscle cells can be obtained from the human pluripotent stem cells of the present invention in about 2 weeks after forming the embryoid body.
The present invention provides for the first time human pluripotent stem cells induced from undifferentiated stem cells present in a human postnatal tissue and having an in vitro long-term self-renewal ability and the pluripotency of differentiating into ectoderm, mesoderm and endoderm, and further said human pluripotent stem cells may have a potential of differentiating into primordial germ cells.
Cells in a tissue that was lost in diseases etc. can be supplied by inducing human pluripotent cells from the undifferentiated stem cells harvested from a patient by using the induction method of the present invention, followed by inducing to differenciate into a necessary cell depending on diseases and then transplanting the cells to the patient. The undifferentiated stem cells of the present invention present in a human postnatal tissue can be used to search drugs that promote the induction from said undifferentiated stem cells to human pluripotent stem cells by using markers such as Tert, Nanog, Sox2, Oct3/4 and alkaline phosphatase that direct the induction to human pluripotent stem cells. Said drugs can be used in stead of gene introduction and can enhance the induction efficiency of human pluripotent stem cells.
FIG. 1: Four genes of Oct3/4, Sox2, Klf4 and c-Myc were introduced into cells established under a low serum condition from mononuclear cells derived from a human adult bone marrow, and RNA was extracted from the colonies obtained, and the amount expressed of the human Nanog and human Tert genes was demonstrated by quantitative PCR. Fibroblasts and mesenchymal stem cells in which the four genes were not introduced were used as the control in the experiment. The amount expressed of the gene was expressed by a relative value in which the amount expressed was normalized by the amount expressed of the human HPRT gene, and by setting as one the amount expressed of the gene in alkaline phosphatase-positive colonies induced from a neonatal skin fibroblast established by example 6. It was confirmed that the expression of Nanog and Tert was significantly high in colonies in which four genes were introduced and which were positive for alkaline phosphatase.
FIG. 2: Four genes of Oct3/4, Sox2, Klf4 and c-Myc were introduced into the primary culture fibroblasts derived from a neonatal skin, RNA was extracted from the colonies obtained, and the amount expressed of the human Nanog and human Tert genes was demonstrated by quantitative PCR. Its parental fibroblasts and mesenchymal stem cells in which four genes were not introduced were used as the control in the experiment. The amount expressed of genes was normalized by the amount expressed of the human HPRT gene, and further was expressed by a relative value by setting as one the amount expressed of the gene in alkaline phosphatase-positive colonies induced from a neonatal skin fibroblast established by example 6. It was confirmed that the expression of Nanog and Tert was significantly high in colonies in which four genes were introduced and which were positive for alkaline phosphatase.
FIG. 3: After three gene introduction and treatment with MS-275 (0.1 or 1.0 μM), a histone deacetylase (HDAC) inhibitor by using cells derived from a mouse bone marrow established under a low serum condition, RNA was extracted from the colonies obtained, and the amount expressed of Nanog was demonstrated by quantitative PCR. From the cells in which three genes were introduced and which were treated with a histone deacetylase inhibitor, alkaline phosphatase-positive cell group (colonies) was formed, and it was confirmed that the expression of Nanog in these colonies was significantly higher than the alkaline phosphatase-negative colonies.
In the figure, W1, W2, W3, W4, W5 and W6 represent the number of each well of the 6-well plate used in Example 12.
FIG. 4: Figure shows the characterization of human iPS clone 1-8. a-e, Morphology of its parental fibroblast (lot. 5F0438) (a), human iPS clone 1-8 cells cultured on MEF feeder cells (b), human iPS clone 1-8 cells in mTeSR1 medium (c), clone 2-4 cells (d), and clone 3-2 cells (e) in mTeSR1 medium. f-g, Growth curve of clone 1-8. Arrows indicate the dates of examinations. Square indicates the period for counting cell numbers to estimate cell proliferation rate. h, Multicolor karyogram image indicates normal karyotype of iPS clone 1-8 derived cell at day 101.
FIG. 5: Figure shows characterization of transcription factor, cell surface antigens and alkaline phosphatase activity in human iPS clone 1-8 cell. a-h, Immunohistochemical staining of human iPS cells (clone 1-8) with Nanog (a), SSEA-3 (b), SSEA-4 (c), TRA-1-60 (d), TRA-1-81 (e), CD9 (f), CD24 (g), Thy-1 (also called CD90) (h). Green fluorescent staining indicates that human iPS clone 1-8 expresses all of these surface antigens. i, Alkaline phosphatase staining indicates that iPS clone 1-8 is alkaline phosphatase positive.
FIG. 6: Figure shows gene expression analysis of human iPS clone 1-8 cells. a, RT-PCR analysis of hES marker gene expression in clone 1-8 and its parental fibroblast (NeoFB). Genes were detected at 30 cycles except for CYP26A1 (35 cycles). b, Silencing of four transgenes in clone 1-8. Crude fibroblasts obtained on 17 days after gene transduction were used as control. “exo” primer sets selectively detected exogenous expression and “total” primer sets included endogenous expression.
FIG. 7: Figure shows global gene expression analysis of human iPS clonel-8 cells. Scatter plots show comparison of global gene expression between human iPS clone-1-8 cells cultured in mTeSR and H14 hES cells with MEFs (GSM151741 from public database GEO)(a), or between clone 1-8 and its parental fibroblasts (b). Symbols of ES cell specific genes were pointed with lines in both scatter plots. Expression intensity was shown in colorimetric order from red (high) to green (low).
FIG. 8: Figure shows global gene expression analysis by gene trees. Cells were clustered in the gene tree based on a set of genes by the International Stem Cell Initiative (except PTF1A because of no array in the chip). Samples were designated 1-8 mTeSR for clone-1-8 cultured in mTeSR, 1-8CM for clone 1-8 cultured in MEF-conditioned medium, 5F0438 for the parental fibroblasts, hES1, hES2, hES3 (GSM194307, GSM194308, GSM194309) for Sheff 4 line cultured on MEF, hES4, hES5 (GSM194313, GSM194314) for Sheff 4 line cultured on matrigel, hES6, hES7 (GSM151739, GSM151741) for H14 line cultured on MEF, Fibroblasts1 for GSM96262, Fibroblasts2 for GSM96263, and Fibroblasts3 for GSM96264, respectively. Expression intensity was shown in colorimetric order from red (high) to green (low).
FIG. 9: Figure shows global gene expression analysis by gene trees. Cells were clustered in the gene tree based on a set of genes correlated with Nanog gene expression in human ES cells (seven GEO data) between the ratio of 0.99 and 1 when compared with fibroblasts (three GEO data). Samples were designated 1-8 mTeSR for clone-1-8 cultured in mTeSR, 1-8CM for clone 1-8 cultured in MEF-conditioned medium, 5F0438 for the parental fibroblasts, hES1, hES2, hES3 (GSM194307, GSM194308, GSM194309) for Sheff 4 line cultured on MEF, hES4, hES5 (GSM194313, GSM194314) for Sheff 4 line cultured on matrigel, hES6, hES7 (GSM151739, GSM151741) for H14 line cultured on MEF, Fibroblasts1 for GSM96262, Fibroblasts2 for GSM96263, and Fibroblasts3 for GSM96264, respectively. Expression intensity was shown in colorimetric order from red (high) to green (low).
FIG. 10: The parts of the Oct3/4 promoter including the distal enhancer (Oct3/4-Z1) and the proximal promoter region (Oct3/4-Z2) and the parts of the Nanog promoter including the proximal promoter region (Nanog-Z1, -Z2) were analyzed for the methylation of CpG (a). Ratio of methylation on CpG shown by circle is indicated by the percentage (b).
FIG. 11: Figure shows teratoma that was derived from human iPS-1-8 mTeSR cells cultured for 94 days. Human iPS-1-8 mTeSR cells were injected into SCID mouse testes and analyzed 56 days after injection. a, HE and alcian blue staining of formaldehyde fixed teratoma tissues. The teratomas contained tissues representative of the three germ layers. ne: neural epitherium, ca: cartilage, et: endodermal tract. b-d, tissues originated from transplant were distinguished from host tissues by HuNu staining. Nestin expressing neural epitherium (b), Collagen II expressing chondrocyte (c), alpha-fetoprotein expressing endodermal tract (d).
FIG. 12: Figure shows teratoma formation. Teratoma 1 (T-1) was derived from human iPS-1-8 mTeSR cells cultured for 94 days. The human iPS-1-8 mTeSR cells were injected into SCID mouse testes and analyzed 56 days after injection. Teratoma 2 (T-2) was derived from human iPS-1-8 mTeSR cells cultured for 102 days. The human iPS-1-8 mTeSR cells were injected into SCID mouse testes and analyzed 48 days after injection. In teratoma-1 (T-1), smooth muscle cells (positive for α-SMA) and secretary epithelium (positive for MUC-1) were observed in addition to three germ layers observed in FIG. 11.
FIG. 13: Figure shows teratoma formation. Teratoma 3 (T3) was derived from human iPS-1-8 mTeSR cells cultured for 114 days. Human iPS-1-8 mTeSR cells were injected into SCID mouse testis and analyzed 42 days after injection. Three germ layers similar to FIGS. 11 and 12 were observed.
T-F1 and F2 figure shows teratoma that were derived from freeze-thawed iPS-1-8 mTeSR cells cultured for 134 days (passage 19). Human iPS-1-8 mTeSR cells were injected into SCID mouse testes and analyzed 46 days (T-F1) and 48 days (T-F2) after injection. Tissues consisting of three germ layers were observed. Melanocytes were also observed in T-F2 experiment. Pluripotency were maintained even via freezing and thawing.
FIG. 14: Figure shows the existence of four transgenes in human iPS clone 1-8. Oct3/4, Sox2, and Klf4 transgenes were detected by Southern blot analysis. Human iPS clone-1-8 was estimated to have approximately ten copies of both Oct3/4 transgenes and Sox2 transgenes, and a single copy of Klf4 transgene. Genomic PCR proved c-Myc transduction. Primer set was designed to include whole second intron. Black arrows indicate the position of transgene. White arrow indicates the position of endogenous c-Myc.
FIG. 15: Figure shows hES maker gene expression profile in ALP positive colonies induced by four genes (Oct4, Sox2, Klf4 and c-Myc). Colonies were stained for alkaline phosphatase at 17 days post 4 genes transduction. All ALP(+) colonies were dissected and determined their hES marker gene expressions. a, the number of colonies expressing Nanog, TDGF1, Dnmt3b, Zfp42, FoxD3, TERT, CYP26A1, and GDF3. b, morphologies of octa-positive colonies. c-d, the number of hES cell marker genes categorized by individual experiments.
FIG. 16-FIG. 22: Figure shows morphologies of four gene (Oct4, Sox2, Klf4 and c-Myc) induced colonies categorized by gene expression profile of ES cell related 8 genes (Nanog, TDGF1, Dnmt3b, Zfp42, FoxD3, TERT, CYP26A1, and GDF3) as well as alkaline phosphatase activity. Circles indicate the picked-up colony.
Undifferentiated stem cells present in a human postnatal tissues are undifferentiated stem cells which are present in human postnatal skin, bone marrow, adipose tissue, skeletal muscle tissue, and peripheral blood, and tissues concomitant to birth such as placenta, umbilical cord and cord blood and in which the Tert, Nanog, Oct3/4 and Sox2 genes have not undergone epigenetic inactivation, and, by using a combination of induced expression of the three genes of Oct3/4, Sox2 and Klf4 and the induced expression of c-Myc or the addition of a histone deacetylase inhibitor, can induce human pluripotent stem cells having a long-term self-renewal ability and the pluripotency of differentiating into ectoderm, mesoderm and endoderm. The above human pluripotent stem cells may further have a potential of differentiating into primordial germ cells.
Undifferentiated stem cells present in a human postnatal tissue can be cultured using a plastic culture dish. When a 2% serum is used, PDGF and EGF or FGF-2 may be added to the culture medium, to which IGF or insulin may further be added. In this case, when a culture medium containing serum is used for a long term culture, properties of undifferentiated stem cells present in a human postnatal tissue may change, and thus it is important to limit the serum concentration to 2% or less and the number of passages to about twice. When a 2% low concentration serum is used, the MAPC medium or the FBM medium, for example, is used as the culture medium. As the culture condition, an incubator at 37° C. and 5% CO2 is used similarly to common culture cells. It is also possible to use low concentration oxygen, for example a 3% oxygen concentration. Culture plates are preferably coated with fibronectin etc.
The human pluripotent stem cells of the present invention induced from undifferentiated stem cells present in a human postnatal tissue may be cultured using a plastic culture dish. In the primary culture, cells after the four genes of Oct3/4, Sox2, Klf4 and c-Myc were introduced therein are cultured in a MEF-conditioned human ES cell medium to which 10 ng/ml bFGF and 10 ng/ml activin A had been added, and the medium is changed every 1 to 2 days. The pluripotent stem cells induced are detached with dispase, collagenase, trypsin or the like, and subcultured. When MEF is used as a supporting layer after the primary culture, the induced human pluripotent stem cells are plated on a MEF-covered plastic culture dish, and cultured in a human ES cell medium supplemented with 10 ng/ml bFGF. When the supporting cells are not used, the induced human pluripotent stem cells are plated on a matrigel-coated plastic culture dish, and cultured in a MEF-conditioned human ES cell medium supplemented with 10 ng/ml bFGF and 10 ng/ml activin A. In either of the culture methods, the medium is changed every 1 to 2 days.
In order to induce the human pluripotent stem cells of the present invention from undifferentiated stem cells present in a human postnatal tissue in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation, the following method may be used. First, an adenovirus vector is constructed carrying cDNA having the sequence of coding region of the mouse-derived cationic amino acid transporter (mCAT) gene (see Example 2, Table 1), which is then introduced into the packaging cell based on the HEK293 cell to prepare a virus solution of the adenovirus vector. The virus solution is added at a multiplicity of infection (m.o.i.: the ratio of the number of virus particles to the number of cells) of 1 to 20 to undifferentiated stem cells present in a human postnatal tissue in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation, and thus undifferentiated stem cells expressing mCAT are prepared.
Then, a retrovirus vector carrying cDNA encoding human Oct3/4, a retrovirus vector carrying cDNA encoding human Sox2, a retrovirus vector carrying cDNA encoding human Klf4, and a retrovirus vector carrying cDNA encoding human c-Myc are constructed (Table 1), and then each of them is introduced into the packaging cell capable of producing an ecotropic recombinant virus constructed based on the HEK293 cell to prepare a virus solution of retrovirus vectors.
To the undifferentiated stem cells in which mCAT has been expressed using an adenovirus vector and in which each of the Tert, Nanog, Oct3/4 and Sox2 genes has not undergone epigenetic inactivation, four types of retrovirus vectors each carrying the four genes (coding regions) of Oct3/4, Sox2, Klf4 and c-Myc, respectively, are added at a m.o.i. of 1 to 200 per virus vector to establish the induction of the human pluripotent stem cells of the present invention.
To the undifferentiated stem cells in which mCAT has been expressed using an adenovirus vector and in which each of the Tert, Nanog, Oct3/4 and Sox2 genes has not undergone epigenetic inactivation, three types of virus vectors each carrying the genes (coding regions) of Oct3/4, Sox2 and Klf4, respectively, at a m.o.i. of 1 to 200 per virus vector, as well as MS-275 at a final concentration of 10 nM to 100 preferably 100 nM to 1 μM, are added to establish the induction of the human pluripotent stem cells of the present invention.
It is preferred that the human pluripotent stem cells of the present invention after being suspended in the Cryopreservation Medium For Primate ES Cells (manufactured by ReproCELL), preferably are rapidly frozen in liquid nitrogen, and stored in a liquid nitrogen storage vessel.
It is preferred that the pluripotent stem cells of the present invention that were stored frozen are rapidly thawed by suspending in a medium that had been warmed to 37° C., removing the medium from the suspension by centrifugation, and then suspending again in a fresh medium to start culturing.
The following explains a method in which, by applying the present invention, siRNA and a compound that inhibit the induction from undifferentiated stem cells present in a human postnatal tissue in which the Tert, Nanog, Oct3/4 and Sox2 genes have not undergone epigenetic inactivation to human pluripotent stem cells are searched using a high throughput screening system.
siRNA represents a double stranded RNA that comprises about 19 base pairs which is part of the sequence of a gene, and that has an effect of inhibiting the translation of the gene to the protein due to RNA interference. When siRNA of a gene is introduced into a cell, only the function carried by the protein can be specifically deleted. Thus, by using a whole genome siRNA library in a specific cell, the state in which the function of only one gene among all the genes was deleted can be observed individually for every gene.
Thus, by using the above siRNA library, it is possible to identify a gene that inhibits the induction from a undifferentiated stem cell present in a human postnatal tissue in which the Tert, Nanog, Oct3/4 and Sox2 genes have not undergone epigenetic inactivation to a human pluripotent stem cell. By developing an inhibitor of the gene using this method, it is possible to induce human pluripotent stem cells from undifferentiated stem cells present in a human postnatal tissue.
As the siRNA library, those in which four siRNA's are synthesized for each gene of a total of about 25,000 human genes, mixed in equal amounts, and dispensed in a 384-well culture plate are used, and subjected to screening (manufactured by Qiagen). Details of it are as follows. Four siRNA's synthesized for each gene are mixed in equal amounts, and 2.5 pmol each is dispensed in each well of a 384-well culture plate. In order to cover all of about 25,000 genes, seventy three 384-well culture plates are needed. To predetermined wells of each plate, 2.5 pmol each of the positive and negative control siRNAs is dispensed in order to determine the introduction efficiency of siRNA into the cell and to correct for efficiency of each plate. The final concentration of siRNA is 50 nM.
After siRNA was prepared, a primary screening is conducted. As methods of detecting the activation of genes that could be an index for differentiation into the pluripotent stem cells of the present invention such as Tert, Nanog, Oct3/4 and Sox2 in the cell to be targeted, there are the promoter reporter assay of the gene of interest [as the reporter gene, EGFP (enhanced green fluorescence protein), luciferase etc.], the immunocytochemical staining method to said gene product, and the like.
For transfection of siRNA to the cell, the lipofection method may be used. To each well of a total of 73 plates in which siRNA has been dispensed, 0.1 μl of LipofectAMINE RNAiMax (manufactured by Invitrogen) in 10 μl of Opti-MEM (manufactured by Invitrogen) is dispensed. Ten minutes later, target cells prepared at 20 to 25 cells/μl in up to 40 μl of the medium are dispended to every well on the 73 plates to introduce siRNA into the cell. The number of cells and the amount of the medium are determined as appropriate depending on the cell used for screening.
In conducting a reporter assay, cells in which a reporter system has been permanently integrated with a retrovirus vector (including lentivirus) or cells 1 to 7 days after infection with an adenovirus vector carrying the reporter system of interest are used for cells such as adult stem cells for which gene introduction by the lipofection method or the calcium phosphate method is difficult. When the reporter system of the present invention is applied to cultured lined cells such as HEK293 cells and Hela cells, the reporter system should be introduced one day in advance or simultaneously with siRNA by a gene introduction method suitable for respective cells.
The entire 73 plates to which transfection reagents and cells have been dispensed are cultured in a culturing equipment maintained at 37° C. and 5% CO2 for 2 to 7 days. The culturing time may vary as appropriate depending on the type of the cell, the gene to be detected, and the like.
As a method of selecting siRNA that promotes the induction from undifferentiated stem cells present in a human postnatal tissue to human pluripotent stem cells, alkaline phosphatase staining can be used. As the alkaline phosphatase staining method, the following method can be mentioned. After removing the culture liquid from each well, cells are fixed in a 10% formaldehyde solution at room temperature for 2 to 5 minutes, washed with a phosphate buffer etc., and a chromogenic substrate of alkaline phosphatase, nitroblue tetrazolium chloride/5-bromo-4-chloro-3′-indolyl phosphatase para-toluidine salt solution (hereinafter referred to as the NBT/BCIP solution) is added and reacted at room temperature for 20 to 30 minutes.
Also when a compound library is used, the method used is conducted similarly to the above screening used for siRNA. The compound in stead of siRNA is spotted in each well, the cell is dispensed and cultured, and similarly determined. The transfection procedure is not necessary.
The retrovirus vector plasmids for the four genes of Oct3/4-pMx, Sox2-pMx, Klf4-pMx and c-Myc-pMx constructed as in Table 1 were introduced into the packaging cell, the Plat-E cell [Experimental Hematology, 2003, 31 (11): 1007-14], using Fugene HD (manufactured by Roche). During 24 to 48 hours after retrovirus vector introduction, the medium was replaced with a medium suitable for the cell to which gene is to be introduced. After culturing the Plat-E cell to which retrovirus vector was introduced for more than 4 hours, the supernatant was recovered and passed through a filter of 45 μm in diameter (manufactured by Millipore). By the above procedure, the retrovirus vector solutions of the four genes (Oct3/4, Sox2, Klf4 and c-Myc) were prepared.
The retrovirus vector plasmids for the three genes of Oct3/4-pMx, Sox2-pMx, Klf4-pMx and c-Myc-pMx were introduced into the packaging cell, the Plat-E cell, using Fugene HD (manufactured by Roche). During 24 to 48 hours after retrovirus vector introduction, the medium was replaced with a medium suitable for the cell to which gene is to be introduced. After culturing the Plat-E cell to which retrovirus vector was introduced for more than 4 hours, the supernatant was recovered and passed through a filter of 45 μm in diameter (manufactured by Millipore). By the above procedure, the retrovirus vector solution of the three genes (Oct3/4, Sox2 and Klf4) were prepared.
According to the present invention, it was necessary to introduce genes including an oncogene (c-Myc) into human cells by retrovirus vector in order to induce pluripotent stem cells. In this case, when a gene is introduced into human cells using an amphotropic retrovirus vector which can infect into human cells, there is a risk of infection to human cells other than the cells of interest. Thus, in preparation for safe experiment, an ecotropic retrovirus vector that infect the rodent cells but not human cells and an adenovirus vector carrying gene encoding its receptor which is mouse-derived cationic amino acid transporter 1 (mCAT1) were combined and used in gene introduction into the human cells.
First, an adenovirus vector carrying cDNA having the sequence of coding region of the mouse-derived cationic amino acid transporter (mCAT1) gene was constructed. Specifically, Adeno-X Expression System 1 kit (manufactured by TakaraBio Clontech) was used. In Adeno-X Expression System 1 kit, based on the experimental method attached to the kit by TakaraBio, the mCAT1 gene was subcloned into the multi-cloning site of a vector called pShuttle.
Subsequently, an expression cassette was excised by the PI-Sce I site and the I-Ceu I site, cleavage sites on both ends of the expression cassette of pShuttle, and a DNA fragment containing the desired gene was inserted in between the PI-Sce I site and the I-Ceu I site in the Adeno-X Viral DNA in the above kit, which was then treated with a restriction enzyme Swa I to remove adenovirus DNA for which integration was unsuccessful. After the plasmid was transformed into an E. coli DH5 strain, whether the desired gene was correctly introduced into adenovirus DNA or not was confirmed by restriction enzyme treatment, PCR etc. The plasmid was prepared in large quantities, and cleaved with the Pac I restriction enzyme. Using the recombinant adenovirus DNA thus obtained, the gene was introduced into the HEK293 cells (MicroBix) plated in six wells using Lipofectamin 2000 (manufactured by Invitrogen), and two weeks later when the cell exhibited a cytopathic effect (CPE), the cells were collected as they are in the medium.
Subsequently, after the cell suspension was subjected to freezing and thawing for three times, the cells were disrupted, and virus particles present in the cells were allowed to release into the liquid. The virus suspension thus prepared was added to one 100 mm plastic culture dish equivalent of HEK293 cells (5×106 cells) to infect the cells, the virus was propagated. Furthermore, after virus was prepared in large quantities using four 150 mm plate equivalent of HEK293 cells, virus was purified using the Adenovirus Purification kit (manufactured by Clontech), and stored frozen at −80° C.
The titer (plaque forming units, PFU) of the mCAT1 adenovirus vector was determined using the Adeno-X Rapid Titer kit. On a 24-well plate, HEK293 low cells were plated at a concentration of 5×104 cells/500 μl per well. Fifty μl of serially diluted (from 10−2 to 10−7) virus vector was mixed with 500 μl of the medium, and then used to infect the cells. After culturing at 5% CO2 and 37° C. for 48 hours, the medium was aspirated off, the cells were dried for 5 minutes, and then using 500 μl of cold 100% methanol the cells were fixed by allowing to stand at −20° C. for 10 minutes. After aspirating off methanol, the wells were washed three times with 500 μl of phosphate buffer containing 1% bovine serum albumin. A mouse anti-Hexon antibody was diluted 1000-fold with phosphate buffer containing 1% bovine serum albumin, and 250 μl each of it was added to wells.
After allowing to stand at 37° C. for 1 hour, the antibody solution was removed, and the wells were washed three times with 500 μl of phosphate buffer containing 1% bovine serum albumin. Horseradish peroxidase-labelled rat anti-mouse immunoglobulin antibody was diluted 500-fold with phosphate buffer containing 1% bovine serum albumin, and 250 μl was added to wells. After allowing to stand at 37° C. for 1 hour, the antibody solution was removed, and washed three times with 500 μl of phosphate buffer containing 1% bovine serum albumin. 250 μl of the DAB (diaminobenzidine) solution (10-fold DAB concentrate was diluted with a stable peroxidase buffer) was added to wells, and was allowed to stand at room temperature for 10 minutes. After aspirating off DAB, 500 μl of phosphate buffer was added. Using a 20× objective lens, the number of brown positive cells in six viewing fields was counted.
Radius of a standard 20× objective lens: 0.5 mm
Area in one viewing field: 7.853×10−3 cm2
Area of a well: 2 cm2
Viewing field of a well: 2 cm2/7.853×103 cm2=254.7 viewing fields
(32/6)×254.7/(0.55×10−5)=2.5×108 ifu (infection unit)/ml
Staining for confirming alkaline phosphatase activity which is a characteristic of pluripotent stem cells was conducted in the following manner. After removing the culture medium, a 10% formalin neutral buffer solution was added to wells, and cells were fixed at room temperature for 5 minutes. After washing with a phosphate buffer etc., a chromogenic substrate of alkaline phosphatase, 1 step NBT/BCIP (manufactured by Pierce) was added and reacted at room temperature for 20 to 30 minutes. Cells having alkaline phosphatase activity were all stained blue violet.
The expression of target gene of each colony including an alkaline phosphatase-positive colonies was determined using quantitative PCR in the following manner. Colonies developed by the induction of pluripotent stem cells were harvested, and RNA was extracted using the Recoverall total nucleic acid isolation kit for FFPE (manufactured by Ambion). After synthesizing cDNA from the extracted RNA, the target gene was amplified using the Taqman Preamp mastermix (manufactured by Applied Biosystems).
As the primers for quantitative PCR, the Taqman gene exprESsion assay (manufactured by Applied Biosystems) was used. The following shows the name of the target gene and the product code of each primer. Human Hprt: Hs99999909_m1, human Nanog: Hs02387400_g1, human Tert: Hs00162669_m1, Mouse Hprt: Mm01545399_m1, mouse Nanog: Ma02019550_s1.
As the positive control for quantitative PCR, cDNA extracted from mesenchymal stem cells established by the following manner was used.
One vial (2.5×107 cells) of human bone marrow-derived mononuclear cells (hBMMNCs (manufactured by Lonza), Lot 060175A: female, 21 years old, black) was thawed in a 37° C. water bath, and suspended in 10 ml of the MSCGM medium (a growth medium for mesenchymal cells) (manufactured by Lonza). In order to remove DMSO in the frozen solution, this was centrifuged at 300 g and 4° C. for seven minutes and the supernatant was removed. The cell mass thus obtained was resuspended in 10 ml of MSCGM medium, and plated on a 100 mm plate at a concentration of 105 cells/cm2 and cultured at 37° C. Seven days later, the medium was changed. At this time, the suspended cells in the old medium were collected by centrifuging at 300 g and 4° C. for five minutes, and were returned to the cells together with the fresh medium. On day 13 when the adherent cells became confluent, the supernatant was removed, non-adherent cells were washed off with a phosphate buffer, and adherent cells were collected by detaching with a 0.05% trypsin-EDTA solution and plated at a concentration of 3000 cells/cm2. RNA was collected from the cells of the third subculture, and cDNA was synthesized.
From human adult bone marrow-derived cells (trade name: Human Bone Marrow-Derived Mononuclear Cell) containing undifferentiated stem cells present in a postnatal human adult bone marrow tissue, the cells were established under the low serum (2%) and the high serum (10%) culture conditions, and were used in the experiment for inducing pluripotent stem cells. Thus, one vial each (2.5×107 cells) of frozen human bone marrow-derived mononuclear cells (hBMMNCs (manufactured by Lonza), Lot 060809B: female, 20 years old, white/and hBMMNCs (manufactured by Lonza), Lot 060470B: female, 20 years old, black) was thawed in a 37° C. water bath, and suspended in 10 ml of the MAPC medium for use in the low serum culture. In order to remove DMSO in the frozen solution, this was centrifuged at 300 g and 4° C. for seven minutes and the supernatant was removed.
The cell mass thus obtained was resuspended, and plated at a concentration of 105 cells/cm2 on a 100 mm plate coated with 10 ng/ml fibronectin. Growth factors [10 ng/ml PDGF-BB (manufactured by Peprotech), 10 ng/ml EGF (manufactured by Peprotech), 10 ng/ml IGF-1 (manufactured by Peprotech)] were added. Three days later, growth factors were only added. Seven days later, the suspended cells and the medium were collected except the adherent cells, and centrifuged at 300 g and 4° C. for five minutes. After the supernatant was removed, the cells were resuspended in a fresh medium. The cell suspension was returned to the original 10 cm dish, and growth factors were added thereto. On day 10 when the adherent cells became confluent, the supernatant was removed, non-adherent cells were washed off with a phosphate buffer, and adherent cells were collected by detaching with a 0.05% trypsin-EDTA solution, and using a cell banker (manufactured by Juji Field), the primary culture was stored frozen.
Using the human bone marrow-derived mononuclear cell of the same lot, the cells were established using a MSCGM medium (manufactured by Lonza) containing 10% FBS under the high serum condition. The Human Bone Marrow-Derived Mononuclear Cells were plated at a concentration of 105 cells/cm2 in a 100 mm plate to which 10 ml of the MSCGM medium had been added, and cultured at 37° C. Seven days later, the suspended cells and the medium were collected except the adherent cells, and centrifuged at 300 g and 4° C. for five minutes, and after the supernatant was removed, the cells were resuspended in a fresh medium. The cell suspension was returned to the original 10 cm dish, and culturing was continued. On day 13 when the adherent cells became confluent, the supernatant was removed, non-adherent cells were washed off with a phosphate buffer. Adherent cells were collected by detaching with a 0.05% trypsin-EDTA solution, and using a cell banker (manufactured by Juji Field), the primary culture was stored frozen.
One vial each of the human bone marrow-derived primary culture cells that were established under the high serum and the low serum conditions and stored frozen was thawed in a 37° C. incubator. Two ml of the medium used for the establishment was added to the cells respectively, and the cells were plated at a concentration of 104 cells/cm2 on a 6-well plastic culture dish of which bottom had been coated with matrigel (manufactured by Becton Dickinson) at a concentration of 20 μg/cm2 and cultured for 14 hours (a second subculture cells). Fourteen hours later, the medium was removed, and the mCAT1 adenovirus vector prepared in Example 2 at an amount equivalent to a m.o.i. of 10 in 500 μl of the Hank's balanced salt solution per well was added, and were infected at room temperature for 30 minutes.
Two ml each of the medium used for establishment was added to each well, and cultured at 37° C. Forty eight hours after the introduction of the mCAT-1 adenovirus vector, the medium of each well was replaced with 2 ml of the retrovirus vector solution (polybrene at a final concentration of 4 μg/ml was added) of four genes (Oct3/4, Sox2, Klf4, c-Myc) which were prepared in Example 1, and cultured at 37° C. for 14 hours. The virus supernatant was removed and replaced with the MEF-conditioned ES medium. Then medium change with the MEF-conditioned ES medium was continued every two days. On examining fourteen days after the introduction of the four genes, one typical colony was found in the low serum condition group of Lot 060809B that exhibits a characteristics of the induced pluripotent stem cells. Said colony was composed of markedly smaller cells than the surrounding cells. In addition to the pluripotent stem cell-like colony, a plurality of colonies were observed in both the low serum group and the high serum group, but they were not stained with alkaline phosphatase.
In order to isolate the pluripotent stem cell-like colonies, the wells were washed with the Hank's balanced salt solution, and then colonies were surrounded by a cloning ring (manufactured by Iwaki) to the bottom of which silicone grease had been applied. One hundred μl of the Detachment Medium For Primate ES Cells (manufactured by ReproCELL) was added in the ring and cultured at 37° C. for 10 to 20 minutes. The cell suspension in the ring containing the detached colony was added to 2 ml of the MEF-conditioned ES medium, and plated in one well of a MEF-coated 24-well plate. After culturing at 37° C. for 8 to 14 hours, the medium was changed, and subsequently medium change was continued every two days, and 8 days later a second subculture was carried out.
The medium was removed, washed with the Hank's balanced salt solution, the Detachment Medium For Primate ES Cells (manufactured by ReproCELL) was added, cultured at 37° C. for 10 minutes, and 2 ml of the medium was added to stop the reaction. The cell suspension was transferred to a centrifuge tube, and centrifuged at 4° C. and 200 g for 5 minutes to remove the supernatant. The cells were resuspended in the MEF-conditioned ES medium, and plated in 4 wells of the MEF-coated 24-well plate. Medium change was continued every 2 days, and seven days after the second subculture, the cells were subjected to alkaline phosphatase staining, and the cloned colony-derived cells were stained blue violet.
Furthermore, by quantitative PCR, it was confirmed that Nanog and Tert were expressed by the colony of alkaline phosphatase activity-positive pluripotent stem cells. When compared to the mesenchymal stem cells established in Example 4, the amount expressed of Nanog was as much as 30-fold higher. The expression of Tert was noted only in said pluripotent stem cells, and not in the mesenchymal stem cells. In the cells that did not form colonies despite the introduction of the four genes, Nanog or Tert was not expressed (FIG. 1).
From the foregoing, when human adult bone marrow-derived cells were used, the pluripotent stem cells were obtained from the low serum culture group but not at all from the high serum culture group (Lot 060809B and Lot 060470B) (Table 2). Also, culturing under the low serum condition was suitable for the maintenance of the undifferentiated cells.
Using cells (trade name: Neonatal Normal Human Skin Fibroblasts, primary culture) derived from a human neonatal tissue, a human tissue immediately after birth, the induction of human pluripotent stem cells from undifferentiated stem cells present in the skin of a human neonate was attempted.
One vial of the frozen Neonatal Normal Human Skin Fibroblasts (primary culture, manufactured by Lonza, Lot 5F0438) was thawed in a 37° C. incubator, and was suspended in the MCDB202 modified medium, a medium containing 2% fetal bovine serum, 5 μg/ml insulin, 50 μg/ml gentamycin, 50 ng/ml amphotericin-B (FBM medium, manufactured by Lonza) to obtain 12 ml of a cell suspension. Two ml each of the cell suspension was plated on a 6-well plastic culture dish of which bottom had been coated with matrigel (manufactured by Becton Dickinson) at a concentration of 20 μg/cm2 (second subculture cells).
Fourteen hours later, the medium was removed, and the mCAT1 adenovirus vector prepared in Example 2 at an amount equivalent to a m.o.i. of 5 in 500 μl of the Hank's balanced salt solution per well was added, and was infected at room temperature for 30 minutes. To each well, 2 ml of the FBM medium was added respectively, and cultured at 37° C. Forty eight hours after the introduction of the mCAT-1 adenovirus vector, the medium of each well was replaced with 2 ml of the retrovirus vector solution (polybrene at a final concentration of 4 μg/ml was added) of the four genes (Oct3/4, Sox2, Klf4 and c-Myc) prepared in Example 1, and cultured at 37° C. for 4 hours.
The virus supernatant was removed and replaced with the MEF-conditioned ES medium. Then medium change with the MEF-conditioned ES medium was continued every two days, and fourteen days after the introduction of the four genes, one well of the 6-well plate was subjected to alkaline phosphatase staining. As a result, six pluripotent stem cell-like alkaline phosphatase-positive colonies were obtained. Alkaline phosphatase-positive colonies were composed of markedly smaller cells than the neonatal normal human skin fibroblasts.
Subsequently, by quantitative PCR, it was confirmed that Nanog and Tert were expressed by the colonies of alkaline phosphatase activity-positive pluripotent stem cells. When compared to the mesenchymal stem cells established under the high serum (10%) culture condition in Example 5, the neonatal normal human skin fibroblasts before the introduction of the four genes did not express Nanog, whereas in the case of the cells after the introduction of the four genes, 9-fold as much in the cells that are not forming colonies and 18-fold as much expression of Nanog in the alkaline phosphatase activity-positive colonies were observed (FIG. 2). On the other hand, the expression of Tert was only noted in the alkaline phosphatase activity-positive colonies. From this, the pluripotent stem cells are defined by the characteristics of alkaline phosphatase activity-positive and Nanog-positive and Tert-positive. Also, the neonatal normal human skin fibroblasts were confirmed to be the cells that have a relatively high efficiency of inducing the pluripotent stem cells and that can express Nanog by the introduction of the four genes.
Colonies of the pluripotent stem cells were isolated in the following manner. On day 17 after gene introduction, six colonies with a characteristic shape were selected from the remaining wells. After washing the wells with the Hank's balanced salt solution, colonies were surrounded by a cloning ring (manufactured by Iwaki) to the bottom of which silicone grease had been applied. One hundred μl of the Detachment Medium For Primate ES Cells (manufactured by ReproCELL) was added in the ring and cultured at 37° C. for 20 minutes. The cell suspension in the ring containing the detached colonies was added to 2 ml of the MEF-conditioned ES medium, and plated in one well of a MEF-coated 24-well plate. After culturing at 37° C. for 14 hours, the medium was changed, and subsequently medium change was continued every two days, and 8 days later a second subculture was carried out. The medium was removed, the cells were washed with the Hank's balanced salt solution, the Detachment Medium For Primate ES Cells was added and cultured at 37° C. for 10 minutes, and 2 ml of the medium was added to stop the reaction.
The cell suspension was transferred to a centrifuge tube, and centrifuged at 4° C. and 200 g for 5 minutes, and the supernatant was removed. The cells were resuspended in the MEF-conditioned ES medium, and plated on four wells of a MEF-coated 24-well plate. Seven days after the second subculture, in a subculturing method described below, the cells were plated on a 60 mm plastic culture dish of which bottom had been coated with matrigel at a concentration of 20 μg/cm2. Further eight days later (37 days after the introduction of the four genes), a third subculture was conducted, and plated on two matrigel-coated 60 mm plastic culture dishes, and part of it was used in alkaline phosphatase staining and RNA extraction. The result confirmed that the cells derived from the cloned colonies are alkaline phosphatase activity-positive and are expressing Nanog and Tert at high rate, thereby endorsing that they are pluripotent stem cells.
The induced pluripotent stem cells were subcultured every 5 to 7 days for maintenance and growth. From the plastic culture dish on which subculturing is to be conducted, the medium was removed, the cells were washed with the Hank's balanced salt solution, dispase or the Detachment Medium For Primate ES Cells was added, and cultured at 37° C. for 5 to 10 minutes. When more than half of the colonies were detached, the ES medium was added to stop the reaction, and the cell suspension was transferred to a centrifuge tube. When colonies precipitated on the bottom of the tube, the supernatant was removed, and the ES medium was added again for suspension. After examining the size of the colonies, any extremely large ones were divided into appropriate sizes by slowly pipetting. Appropriately sized colonies were plated on a matrigel-coated plastic culture dish with a base area of about 3 to 6 times that before subculture. The colony-derived pluripotent stem cells are being grown and maintained now.
As shown in Table 2, the Neonatal Normal Human Skin Fibroblasts in the lot (Lot 5F0474) other than the above lot 5F0438 exhibited a favorable induction of pluripotent stem cells. From comparison to Example 5, cells derived from young individuals or cells of which culturing time is short were thought to be suitable for the induction of the pluripotent stem cells.
From the above results, when cells derived from human neonatal tissue that is a human postnatal tissue containing undifferentiated cells were subjected to a second subculture in a culture medium containing 2% serum, it was possible to induce the pluripotent stem cells.
Then, using human adult tissue-derived cells (trade name: Adult Normal Human Skin Fibroblasts, primary culture) containing undifferentiated stem cells present in a human adult skin, the induction of pluripotent stem cells of the present invention was carried out.
One vial each of the frozen Adult Normal Human Skin Fibroblasts (primary culture, manufactured by Lonza, Lot 6F3535: 28 years old, female, white, Lot 6F4026: 39 year old, female, white) was thawed in a 37° C. incubator, suspended in the FBM medium, and 12 ml of the cell suspension was obtained, respectively. Two ml each of the cell suspensions was plated on a 6-well plastic culture dish of which bottom had been coated with matrigel at a concentration of 20 μg/cm2 (second subculture cells).
Fourteen hours later, the medium was removed, and the mCAT1 adenovirus vector prepared in Example 2 at an amount equivalent to a m.o.i. of 5 in 500 μl of the Hank's balanced salt solution per well was added, and was infected at room temperature for 30 minutes. To each well, 2 ml of the FBM medium was added, and cultured at 37° C. Forty eight hours after the introduction of the mCAT-1 adenovirus vector, the medium of each well was replaced with 2 ml of the retrovirus vector solution (polybrene at a final concentration of 4 μg/ml was added) of the four genes (Oct3/4, Sox2, Klf4 and c-Myc) prepared in Example 1, and cultured at 37° C. for 4 hours. The virus supernatant was removed and replaced with the MEF-conditioned ES medium. Then medium change with the MEF-conditioned ES medium was continued every two days, and thirteen days after the introduction of the four genes, alkaline phosphatase staining was carried out. As a result, two pluripotent stem cell-like alkaline phosphatase-positive colonies per well were obtained from the Lot 6F3535, whereas no alkaline phosphatase-positive colonies were obtained from the Lot 6F4242 (Table 2).
From comparison to Example 6, the neonate-derived cells among the skin fibroblasts had a higher efficiency of inducing the pluripotent stem cells. Also, among the Adult Normal Human Skin Fibroblasts, cells derived from younger donors had a higher transformation efficiency. From the foregoing, it was demonstrated that the efficiency of inducing the pluripotent stem cells decreases in an age-dependent manner.
One vial of frozen Neonatal Normal Human Skin Fibroblasts (primary culture, manufactured by Lonza, Lot 5F0439) was thawed in a 37° C. incubator, suspended in the FBM medium, and plated on two 100 mm plastic culture dishes (a second subculture). After culturing for six days until a 70 to 90% confluence could be obtained, the cells were detached using a 0.025% trypsin-EDTA solution (manufactured by Lonza), centrifuged at 4° C. and 200 g for 5 minutes, and the supernatant was removed. The second subcultured cells collected were stored frozen using the cell banker.
The frozen second subculture cells were thawed in a 37° C. incubator, suspended in 12 ml of the FBM medium, centrifuged at 4° C. and 200 g for 5 minutes, and the supernatant was removed. The cells were suspended, and plated at a concentration of 104 cell/cm2 on a 100 mm plastic culture dish of which bottom had been coated with matrigel at a concentration of 20 μg/cm2 (a third subculture). Fourteen hours later, the medium was removed, and the mCAT1 adenovirus vector prepared in Example 2 at an amount equivalent to a m.o.i. of 5 in 2 ml of the Hank's balanced salt solution was added, and was infected at room temperature for 30 minutes. To each well, 10 ml of the FBM medium was added, and cultured at 37° C.
Forty eight hours after the introduction of the mCAT-1 adenovirus vector, the medium was removed, and replaced with 10 ml of the retrovirus vector solution (polybrene at a final concentration of 4 μg/ml was added) of the four genes (Oct3/4, Sox2, Klf4 and c-Myc) prepared in Example 1, and cultured at 37° C. for 4 hours. The virus supernatant was removed and replaced with the MEF-conditioned ES medium. Then medium change with the MEF-conditioned ES medium was continued every two days, and fourteen days after the introduction of the four genes, alkaline phosphatase staining was carried out. As a result, five pluripotent stem cell-like alkaline phosphatase-positive colonies were obtained. By calculating based on the area of the bottom, this indicates that 0.83 colony per well of the 6-well plate was obtained (Table 2).
From comparison to Example 6, it was demonstrated that the efficiency of inducing the pluripotent stem cells decreases with the prolonged culture period.
Using the cells (trade name: Normal Human Umbilical Vein Endothelial Cells, primary culture) derived from a human umbilical cord, a human tissue immediately after birth, the induction of the human pluripotent stem cells of the present invention from undifferentiated stem cells present in the umbilical cord was attempted.
One vial of the frozen Normal Human Umbilical Vein Endothelial Cells (primary culture, manufactured by Lonza) was thawed in a 37° C. incubator, and suspended in the Endothelial Cell Medium kit-2 manufactured by Lonza (2% serum) (hereinafter referred to as EBM-2) to obtain 12 ml of the cell suspension. About 105/2 ml/well each of the cell suspension was plated to a 6-well plastic culture dish of which bottom had been coated with matrigel at a concentration of 20 μg/cm2 (second subculture). Six hours later, the medium was removed, and the mCAT1 adenovirus vector prepared in Example 2 at an amount equivalent to a m.o.i. of 5 in 500 μl of the Hank's balanced salt solution per well was added, and infected at room temperature for 30 minutes.
2.5 ml each of the EBM-2 medium was added to each well, and cultured at 37° C. Forty eight hours after the introduction of the mCAT-1 adenovirus vector, the medium of each well was replaced with 2 ml each of the retrovirus vector solutions (polybrene at a final concentration of 5 μg/ml was added) of the four genes (Oct3/4, Sox2, Klf4 and c-Myc) prepared in Example 1, and cultured at 37° C. for 4 hours. The virus supernatant was removed and replaced with the MEF-conditioned ES medium. Then medium change with the MEF-conditioned ES medium was continued every two days. Twelve days after the introduction of the four genes, colonies were confirmed.
Thirteen days after the introduction of the four genes, the induced colonies were stained with alkaline phosphatase activity.
From the above results, when cells derived from human umbilical cord that is a human tissue immediately after birth containing undifferentiated cells were subjected to a second subculture in a culture medium containing 2% serum, it was possible to induce the pluripotent stem cells.
As described below, using the cells (trade name: Normal Human Umbilical Artery Smooth Muscle Cells, the third subculture) derived from a human umbilical cord, a human tissue immediately after birth, the induction of the human pluripotent stem cells of the present invention from undifferentiated stem cells present in the umbilical cord was attempted.
One vial of the frozen Normal Human Umbilical Artery Smooth Muscle Cells (the third culture, manufactured by Lonza) was thawed in a 37° C. incubator, and suspended in the Smooth Muscle Cell Medium kit-2 manufactured by Lonza (5% serum) (hereinafter referred to as SmGM-2) to obtain 12 ml of the cell suspension. About 105/2 ml/well each of the cell suspension was plated to a 6-well plastic culture dish (manufactured by Becton Dickinson) of which bottom had been coated with matrigel (manufactured by Becton Dickinson) at a concentration of 20 μg/cm2 (the fourth subculture). One day later, the medium was removed, and the mCAT1 adenovirus vector at an amount equivalent to a m.o.i. of 1.25 to 5 in 500 μl of the Hank's balanced salt solution per well was added, and infected at room temperature for 30 minutes. 2.5 ml each of the SmGM-2 medium was added to each well, and cultured at 37° C.
Forty eight hours after the introduction of the mCAT-1 adenovirus vector, the medium of each well was replaced with 2 ml each of the retrovirus vector solutions (polybrene at a final concentration of 5 μg/ml was added) of the four genes (Oct3/4, Sox2, Klf4 and c-Myc) prepared in Example 1, and cultured at 37° C. for 4 hours. The virus supernatant was removed and replaced with the MEF-conditioned ES medium. Then medium change with the MEF-conditioned ES medium was continued every two days. Thirteen days after the introduction of the four genes, colonies were confirmed. However, the induced colonies were not stained with alkaline phosphatase activity.
From the above results, it was revealed that though the cells derived from human umbilical cord which is a human tissue immediately after birth contains undifferentiated cells present in the umbilical cord, when the cells were subjected to a fourth subculture in a culture medium containing 5% serum, the induction of the pluripotent stem cells was extremely difficult.
Using mouse bone marrow-derived cells, a mouse postnatal tissue, the induction of pluripotent stem cells of the present invention from undifferentiated stem cells present in a mouse postnatal tissue was attempted.
Femurs and tibias were extracted from 4 to 6 week-old mice (c57BL/6N lineage, 4-week-old, female) taking utmost care not to bring in any other tissue. By soaking the collected bone in 70% ethanol for a short period of time, the cells that attached to the outside of the bone were killed to prevent the contamination of cells other than the bone marrow. After ethanol treatment, the bone was immediately transferred to IMDM (Iscove's Modified Dulbecco's Medium) (manufactured by SIGMA) to prevent the effect of the cells inside of the bone marrow. The outside of each bone was wiped with Kimwipe to remove the connective tissue. All of the treated bone was transferred to a mortar having IMDM, and was smashed with a pestle. After washing several times with IMDM, the bone was cut into pieces with scissors. After further washing with IMDM several times, bone fragments were transferred to centrifuge tubes.
After removing IMDM, 10 ml per five mice of IMDM containing 0.2% collagenase I (manufactured by SIGMA) was added, and shaken at 37° C. for 1 hour. After shaking, the suspension was stirred several times using a Pipetman, and then the supernatant was transferred to another tube, to which an equal amount of cold 10% FBS-containing IMDM was added to stop the enzyme reaction. The bone fragments after enzyme treatment were transferred to a mortar containing cold 10% FBS-containing IMDM, and smashed again with a pestle, and after stirring several times, the supernatant was collected. The cell suspension thus collected was filtered by sequentially passing through a Nylon mesh of 70 μm and 40 μm in diameter. The cell suspension was centrifuged at 4° C. and 600 g for 7 minutes, and cells derived from the mouse deep bone marrow were collected.
The cells derived from mouse deep bone marrow were suspended in the MAPC medium, and plated at a concentration of 105 cells/cm2. For plating of cells, a dish previously coated with a phosphate buffer containing 10 ng/ml fibronectin (Becton Dickinson) was used. To the medium, growth factors [10 ng/ml PDGF-BB (manufactured by Peprotech), 10 ng/ml EGF (manufactured by Peprotech), 1000 units/ml LIF (manufactured by Chemicon)] were added at the time of use. Three days after plating, growth factors were only added without changing the medium. Six days later, non-adherent cells were washed off with the phosphate buffer, and adherent cells were collected by detaching with a 0.05% trypsin-EDTA solution (manufactured by Invitrogen), and using a cell banker (manufactured by Juji Field), the cells were stored frozen as the primary culture.
The primary culture cells that had been stored frozen were thawed in a 37° C. water bath, and suspended in 10 ml of the MAPC medium that is a medium containing 2% FBS. In order to remove DMSO in the frozen solution, it was centrifuged at 4° C. and 300 g for 7 minutes, and the supernatant was removed. The cell mass obtained was resuspended, and plated at a concentration of 2.5×103 cells/cm2 on a 12-well plastic plate having the bottom which had been gelatin-coated with 0.1% gelatin/phosphate buffer, and 2 ml each of the MAPC medium was added (the second subculture).
Eight to 14 hours later, the medium was removed, and 2 ml each of the four gene retrovirus vector solution prepared as in Example 1 was added thereto and cultured at 37° C. for 4 to 14 hours. Then the virus solution was removed, and replaced with the mouse ES medium [the ES medium to which a final concentration of 0.3% FBS (manufactured by Invitrogen), 1000 units/ml LIF (manufactured by Chemicon), and 0.1 mM 2-mercaptoethanol were added]. Then medium change with the mouse ES medium was continued every three days, and 5 to 7 days after the introduction of the four genes, said pluripotent stem cells formed colonies comprising mouse ES cell-like small cells. The colonies of the induced pluripotent stem cells were stained blue violet by alkaline phosphatase activity.
From the remaining wells of the 12-well plate, the mouse pluripotent stem cells were subcultured, and subculture was continued to a gelatin-coated 100 mm plate. From the seventh subculture cells, RNA was extracted using the RNeasy mini kit (manufactured by QIAGEN) and cDNA was synthesized. Using the cDNA, quantitative PCR was conducted to confirm the expression of Nanog.
The mouse pluripotent stem cells of the seventh subculture were subcutaneously transplanted to the back of three syngeneic C57BL/6N mice at 3×105 cells/mouse, and 38 days later the teratoma that formed was extracted. Teratoma was formed in all three mice. From the extracted teratoma, slices were prepared, and differentiation potential into three germ layers was analyzed by immunological staining and histological staining (HE stain, alcian blue stain). As a result, MAP2-positive cells (the nervous system) and GFAP-positive cells (the nervous system) as the ectodermic system, skeletal muscle cells (myocytes) and cartilage tissues as the mesodermic system, and intestinal tract tissues as the endodermic system were observed.
In order to maintain and grow the mouse pluripotent stem cells, they were subcultured every 3 to 4 days. The medium was removed from the plastic culture dish in which subculture is carried out, washed with phosphate buffer, a 0.05% trypsin-EDTA solution was added, and cultured at 37° C. for 5 minutes. When the cells detached, the ES medium was added to stop the reaction, and the cell suspension was transferred to a centrifuge tube. By centrifuging at 200 g for 5 minutes, the supernatant was removed, and after suspending the precipitate in the mouse ES medium, the cells were plated in a gelatin-coated plate at a concentration of 104 cells/cm2. The pluripotent stem cells induced from the cells derived from the mouse bone marrow cultured in low serum in the same subculture method could be cultured for a long time.
As described above, pluripotent stem cells were induced from the postnatal mouse bone marrow-derived cells established under the low serum condition.
Using cells derived from mouse bone marrow that is a mouse postnatal tissue, the induction of pluripotent stem cells was carried out with the introduction of three genes and histone deacetylase inhibitor treatment.
The primary culture cells derived from mouse bone marrow containing undifferentiated stem cells that had been stored frozen after preparing in a manner similar to Example 11 were plated at a concentration of 5×103 cells/cm2 on a 24-well plastic plate (manufactured by Becton Dickinson) having the bottom which had been gelatin-coated with a 0.1% gelatin/phosphate buffer, and 2 ml each of the MAPC medium was added.
Eight hours later, the medium was removed, 2 ml each of the three gene (human Oct3/4, Sox2 and Klf4) retrovirus vector solution prepared as in Example 1 were added, and after further adding MS-275, a histone deacetylase inhibitor, at a final concentration of 1 or 0.1 μM, they were cultured at 37° C. for 14 hours. Then after removing the virus solution, 2 ml each of the MAPC medium containing MS-275, a histone deacetylase inhibitor, at a final concentration of 1 or 0.1 μM was added. Three days later, the medium was replaced with the mouse ES medium [a final concentration of 0.3% FBS (manufactured by Invitrogen), 1000 units/ml LIF (manufactured by Chemicon) and 0.1 mM 2-mercaptoethanol were added to the ES medium at the time of use].
Medium change with the mouse ES medium was continued every 2 to 3 days. Twelve days after the introduction of three genes (human Oct3/4, Sox2 and Klf4) retrovirus vector, the cells were subcultured from each well of the 24-well plastic plate to each well of a 6-well plastic plate. A portion of it was also cultured in a 24-well plastic plate. Fifteen days after said three gene introduction and MS-275 treatment, the pluripotent stem cells formed colonies composed of mouse ES cell-like small cells. The colonies of said pluripotent stem cells were stained blue violet by alkaline phosphatase activity.
Then, the amount expressed of the Nanog gene was confirmed by quantitative PCR, and the expression of mouse Nanog of colonies of pluripotent stem cells having alkaline phosphatase activity was confirmed (FIG. 3).
Eighteen days after said three gene introduction and MS-275 treatment, the pluripotent stem cells were subcultured from each well of the 6-well plate to a gelatin-coated 100 mm plate. Subculture was continued similarly.
Twenty nine days after said three gene introduction and MS-275 treatment, the mouse pluripotent stem cells were subcutaneously transplanted to the back of syngeneic C57BL/6N mice at 2×107 cells/mouse, and 34 days later the teratoma that formed was extracted. From the extracted teratoma, slices were prepared, and differentiation potential into three germ layers was analyzed by immunological and histological staining (HE stain, alcian blue stain). As a result, GFAP-positive cells (the nervous system) and keratin producing cells (skin cells) as the ectodermic system, smooth muscle actin-positive cells (smooth muscle cells), bone tissues and cartilage tissues as the mesodermic system, and intestinal tract tissues (endodermal epithelium positive for MUC-1) as the endodermic system were observed.
Then, using cells derived from mouse bone marrow that is a mouse postnatal tissue, the induction of mouse pluripotent stem cells was carried out with the introduction of three genes.
The primary culture cells derived from mouse bone marrow containing undifferentiated stem cells that had been stored frozen after preparing in Example 11 were plated at a concentration of 1×104 cells/cm2 on a 24-well plastic plate (manufactured by Becton Dickinson) having the bottom which had been gelatin-coated with a 0.1% gelatin/phosphate buffer solution, and 2 ml each of the MAPC medium was added.
Two days later, the medium was removed, 2 ml each of the three gene (human Oct3/4, Sox2 and Klf4) retrovirus vector solution prepared as in Example 1 were added, and after culturing at 37° C. for 1 day, the virus solution was removed, and 2 ml each of the MAPC medium was added. Three days later, the medium was replaced with the mouse ES medium [a final concentration of 0.3% FBS (manufactured by Invitrogen), 1000 units/ml LIF (manufactured by Chemicon) and 0.1 mM 2-mercaptoethanol were added to the ES medium at the time of use]. Then medium change with the mouse ES medium was continued every 2 to 3 days. Eleven days after the introduction of three gene (human Oct3/4, Sox2 and Klf4) retrovirus vector, the cells were subcultured from each well of the 24-well plastic plate to each well of a 6-well plastic plate.
Then medium change with the mouse ES medium was continued every 2 to 3 days. Nineteen days after said three gene introduction, the pluripotent stem cells formed colonies composed of mouse ES cell-like small cells. In order to confirm the alkaline phosphatase activity, the medium was removed and then a 10% formalin neutral buffer solution was added to wells, and fixed at room temperature for 5 minutes. After washing with a phosphate buffer etc., the 1 step NBT/BCIP solution (manufactured by Pierce) comprising a chromogenic substrate of alkaline phosphatase was added and reacted at room temperature for 20 to 30 minutes. The colonies of said pluripotent stem cells were stained blue violet by alkaline phosphatase activity.
Then, the amount expressed of the Nanog gene was confirmed by quantitative PCR, and the expression of mouse Nanog of colonies of pluripotent stem cells having alkaline phosphatase activity was confirmed.
Using cells derived from mouse bone marrow that is a mouse postnatal tissue, the induction of pluripotent stem cells was carried out with the introduction of three genes.
The primary culture cells derived from mouse bone marrow containing undifferentiated stem cells that had been stored frozen after preparing in Example 11 were plated at a concentration of 1×104 cells/cm2 on a 6-well plastic plate (manufactured by Becton Dickinson) the bottom of which had been gelatin-coated with a 0.1% gelatin/phosphate buffer solution, and the MAPC medium was added in 2 ml portions.
Two days later, the medium was removed, the three gene (human Oct3/4, Sox2 and Klf4) retrovirus vector solution prepared as in Example 1 were added in 2 ml portions, and after culturing at 37° C. for 1 day, the virus solution was removed, and the MAPC medium was added in 2 ml portions. Three days later, the medium was replaced with the mouse ES medium [a final concentration of 0.3% FBS (manufactured by Invitrogen), 1000 units/ml LIF (manufactured by Chemicon) and 0.1 mM 2-mercaptoethanol were added to the ES medium at the time of use]. Medium change with the mouse ES medium was continued every 2 to 3 days. Nine days after the introduction of three gene (human Oct3/4, Sox2 and Klf4) retrovirus vector, the cells were subcultured from each well of the 6-well plastic plate to each well of a 10 cm plastic dish.
Medium change with the mouse ES medium was continued every 2 to 3 days. Seven days after said three gene introduction, the pluripotent stem cells formed colonies composed of mouse ES cell-like small cells. In order to confirm the alkaline phosphatase activity, the medium was removed and then a 10% formalin neutral buffer solution was added to wells, and fixed at room temperature for 5 minutes. After washing with a phosphate buffer etc., the 1 step NBT/BCIP (manufactured by Pierce), a chromogenic substrate of alkaline phosphatase, was added and reacted at room temperature for 20 to 30 minutes. The colonies of said pluripotent stem cells were stained blue violet by alkaline phosphatase activity.
Then, the amount expressed of the Nanog gene was confirmed by quantitative PCR, and the expression of mouse Nanog of colonies of pluripotent stem cells having alkaline phosphatase activity was confirmed.
Forty nine days after said three gene introduction, the mouse pluripotent stem cells were subcutaneously transplanted on the back of syngeneic C57BL/6N mice at 2×107 cells/mouse, and 13 and 17 days later the teratoma that formed was extracted. Slices were prepared from the extracted teratoma, and differentiation potential into three germ layers was analyzed by immunological and histological staining (HE stain, alcian blue stain). As a result, GFAP-positive cells (the nervous system) and keratin producing cells as the ectodermic system, smooth muscle actin-positive cells (smooth muscle cells), bone tissues and cartilage tissues as the mesodermic system, and intestinal tract tissues (endodermal epithelium positive for MUC-1) as the endodermic system were observed.
Likewise, after said three gene introduction, the mouse pluripotent stem cells which were single-sorted based on GFP and SSEA-1 positive with FACSAria, were subcutaneously transplanted on the back of syngeneic C57BL/6N mice at 2×107 cells/mouse, and 13 and 14 days later the teratoma that formed was extracted. Slices were prepared from the extracted teratoma, and differentiation potential into three germ layers was analyzed by immunological and histological staining (HE stain, alcian blue stain). As a result, neural tube derived cells positive for GFAP, Nestin or Neurofilament as ectodermic system and cartilage tissues as the mesodermic system, and intestinal tract tissues (endodermal epithelium positive for MUC-1 and alpha-fetoprotein) as the endodermic system were observed.
From the above results, pluripotent stem cell were obtained by the forced expression of each of three genes of Oct3/4, Sox2, and Klf4 in undifferentiated stem cell present in a postnatal tissue. The pluripotent stem cells showed an in vitro long-term self-renewal ability, and were expressed ES cell marker, Nanog expression and alkaline phosphatase activity, and the ability of differentiation of tissues derivative from all three germ layers (ectoderm, mesoderm and endoderm).
Human induced pluripotent stem (iPS) cell line generated from neonatal human skin fibroblasts (lot # 5F0438) in Example which was termed iPS-1 was further sub-cloned with cloning cylinder and 0.25% trypsin-EDTA as described in Example 6. Nine sub-clones which were termed human iPS-1-1, 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8 and 1-9 were obtained. One of nine sub clones, termed human iPS-1-8 clone, was successfully expanded on MEF feeder cells in human ES medium supplemented with 0.1 mM 2-mercaptoethanol and 10 ng/ml bFGF or in mTeSR1 defined medium (Stem cell Technologies) on matrigel (Invitrogen)-coated culture dishes. Medium was changed for human iPS-1-8 clone culture everyday and usually treated with 5 to 20 μM of Y-27632 (Calbiochem) to avoid cell apoptosis triggered by the passaging procedures. For the passage to continue the culture, human induced pluripotent stem cells were washed with Hanks's balanced solution, incubated in 0.25% trypsin-EDTA (Gibco) at 37° C. for 3 minutes, and then added the culture medium to terminate the trypsin activity. Human induced pluripotent stem cells were centrifuged at 300×g at room temperature or 4° C. for 5 minutes and the supernatant was removed. Precipitated human induced pluripotent stem cells were re-suspended into culture medium. The pluripotent stem cells were usually split into new culture dishes using 1:4 to 1:6 splits. Human iPS-1-8 clone was frozen using Cell freezing solution for ES cells (Reprocell) according to the manufacture's manual.
Human iPS-1-8 clone was morphologically indistinguishable from typical human ES cell colonies that consist of small, round, and compact cells with defined edges when cultured on mitomycin-C treated mouse embryonic fibroblasts (MEFs) (FIG. 4). Human iPS-1-8 clone actively proliferated in mTeSR1 medium. Human iPS-1-8 clone derived cells cultured in mTeSR1 medium was termed human iPS-1-8 mTeSR cells. Human iPS-1-8 clone was able to be passaged more than 30 times, and cultured for more than half year after four factor infections (FIGS. 4f,g). Human iPS-1-8 mTeSR cells were able to be stored in liquid nitrogen and re-cultured in mTeSR medium in the presence of 5 to 20 μM of Y-27632. Population doubling time of human iPS-1-8 mTeSR cells was approximately 48.5 hours when analyzed between passages 19 to 26 which correspond to days 123 to 148 after four factor infection.
Karyotype analysis of long-term cultured human iPS-1-8 clone (1-8 mTeSR) was performed using giemsa stain and multicolor-FISH analysis. Human iPS cells were pretreated with 0.02 μg/ml colecemid for 2 hours, followed by incubation with 0.075 M KCl for 20 minutes, and then fixed with Carnoy's fixative. For multicolor-FISH analysis, cells were hybridized with the multicolor FISH probe (Cambio) and analyzed under DMRA2 fluorescent microscope (Leica). Human iPS-1-8 mTeSR cells mainly maintained a normal karyotype (46XY) after long-term culture in mTeSR (68%) without any chromosomal translocation or deletion (FIG. 4h, Table 3).
For alkaline phosphatase staining, cells were fixed with 10% formalin neutral buffer solution (Wako) at room temperature for 5 minutes, washed with PBS, and incubated with alkaline phosphatase substrate 1 step NBT/BCIP (Pierce) at room temperature for 20-30 minutes. Cells having alkaline phosphatase activity were stained in blue violet. For immunocytochemistry, cultured cells were fixed with 10% formaldehyde for 10 minutes and blocked with 0.1% gelatin/PBS at room temperature for 1 hour. The cells were incubated overnight at 4° C. with primary antibodies against SSEA-3 (MC-631; Chemicon), SSEA-4 (MC813-70; Chemicon) TRA-1-60 (abcam), TRA-1-81 (abcam), CD9 (M-L13; R&D systems), CD24 (ALB9; abcam), CD90 (5E10; BD bioscience), or Nanog (R&D systems). For Nanog staining, cells were permeabilized with 0.1% Triton X-100/PBS before blocking. The cells were washed with PBS for three times, and then incubated with AlexaFluor 488-conjugated secondary antibodies (Molecular Probes) and Hoechst 33258 at room temperature for 1 hour. After further washing, fluorescence was detected with an Axiovert 200M microscope (Carl Zeiss).
Human iPS-1-8 mTeSR cells were positive for alkaline phosphatase (hereinafter referred to as “ALP”) activity and the glycolipid antigens SSEA-3 and SSEA-4, the keratin sulfate antigens TRA-1-60 and TRA-1-81, and the protein antigens CD9, CD24, Thy-1 (CD90) staining (FIG. 5).
Total RNA was isolated from human iPS-1-8 clone, its parental fibroblasts, and crude fibroblasts obtained on 17 days after gene transduction by using RNeasy (Qiagen). cDNA was synthesized by SuperScript III (Invitrogen). Gene expressions were detected by PCR using Extaq (Takara). Sequences of the primers were described in Table 4.
Human iPS-1-8 clone expressed human ES marker genes Nanog, TERT, Sa114, Zfp42, GDF3, Dnmt3b, TDGF1, GABRB3, and CYP26A1 though the parental fibroblasts expressed none of those marker genes (FIG. 6a). In contrast to crude fibroblasts, human iPS-1-8 clone down-regulated forced expression of four genes (FIG. 6b).
Human iPS cells cultured in both mTeSR on matrigel □1-8 mTeSR□ and MEF-conditioned medium on matrigel (1-8CM) and its parental fibroblasts (5F0438) were analyzed for global gene expression. The microarray study was carried out using the Affymetrix Human Genome U133 Plus 2.0 gene expression arrays (Affymetrix, Santa Clara, Calif.). The GeneChip® Human Genome U133 Plus 2.0 Array provides comprehensive coverage of the transcribed human genome on a single array and analyzes the expression level of over 47,000 transcripts and variants, including 38,500 well-characterized human genes. Briefly, total RNA was extracted from cells with RNAeasy (Qiagen). Biotin-labelled cRNA was reverse transcribed from 1 μg of total RNA according to Affymetrix technical protocols. Fifteen micrograms of cRNA was fragmented and hybridized to a Affymetrix U133 plus 2 GeneChip arrays at 45° C. for 16 hours and then washed and stained using the Affimetrix Fluidics (Affymetrix). The assays were scanned in the Affimetrix GCS3000 scanner, and the image obtained were analyzed using the GCOS software. Data from this experiment and GEO were investigated with the GeneSpring 7.3.1. software.
For scatter plot analyses, human induced pluripotent stem cell clone-1-8, cultured in mTeSR on matrigel (1-8 mTeSR) and its parental fibroblasts (5F0438) were analyzed based on a set of 21,080 genes with present flag call (P<0.04) or marginal flag call (0.04□ P<0.06) for both clone 1-8 and H14 hES line which is data from GEO (GSM151741), were used as a representative of human ES cells for comparison.
For cluster analysis, DNA microarray data for clone-1-8 cultured in mTeSR (1-8 mTeSR), clone 1-8 cultured in MEF-conditioned medium (1-8CM) and its parental fibroblasts (5F0438) were compared with DNA microarray data for Sheff 4 line cultured on MEF (hES1:GSM194307, hES2: GSM194308, hES3: GSM194309), Sheff 4 line cultured on matrigel (hES4: GSM194313, hES5: GSM194314), H14 line cultured on MEF (hES6: GSM151739, hES7: GSM151741), and three fibroblasts (GSM96262 for Fibroblasts1, GSM96263 for Fibroblasts2 and GSM96264 for Fibroblasts3).
The global gene expression profile of the human iPS cell line (clone 1-8) and its parental fibroblasts were analyzed. Cluster analysis using the gene set defined by the International Stem Cell Initiative revealed that the human iPS cell line 1-8 clustered with human ES cell lines but separated from the parental fibroblasts (FIG. 8). Although the pearson correlation coefficient was 0.675 between human ES cell lines sheff4 and H14, the coefficient was 0.835 between human iPS cell line 1-8 and human ES cell line H14 (FIG. 8). This analysis indicate that human iPS cell line 1-8 had a similar gene expression pattern to the human ES cell lines H14. Scatter plot analysis between indicate that the human ES cell marker genes, Nanog, Oct3/4, TDGF1, Dnmt3b, GABRB3, GDF3, Zfp42, ALP, CD9, and Thy-1 showed high correlation between human iPS cell line and human ES cell line H14 (FIG. 7a). In contrast, clonel-8 was different from the parental neonatal fibroblasts (FIG. 7b). This was confirmed by the cluster analysis using the nanog-related genes. Pearson correlation coefficient was 0.908 between human iPS cell line 1-8 and human ES cell line H14 and 0.100 between human iPS cell line 1-8 and its parental fibroblasts (FIG. 9). These analysis reveal that human iPS cell line is indistinguishable from human ES cell line in gene expression.
The promoter regions of Nanog and Oct3/4 were analyzed for methylation of individual CpG sites. Ten nanograms of bisulfite-treated genomic DNA was PCR-amplified with primers containing a T7-promoter and transcripts treated with RNase A. As fragments originating from a methylated CpG sequence contained a G instead of an A-base, they had a 16 Da higher molecular weight than those resulting from the corresponding non-methylated CpG. This mass difference was detected using a MALDI-TOF mass spectrometer (Autoflex, Bruker Daltonics). The spectra produced by the mass spectrometer were analyzed using the EpiTYPER (Sequenom). The percentage methylation of individual CpG sites was calculated using the area under the peak of the signal from the unmethylated and methylated fragments. The percentage methylation of individual CpG sites were calculated using the area under the peak of the signal from the unmethylated and methylated fragments. Table 9 lists up locations and sizes in genome corresponding to amplicon using for methylation analyses. Table 10 lists up the primer sets using for methylation analyses. The Oct3/4 proximal promoter including conserved region 1 (CR1), the Oct3/4 promoter distal enhancer including CR4 and the Nanog proximal promoter including Oct3/4 and Sox2 binding sites were examined (FIG. 10a). As shown in FIG. 10b, cytosine-phosphate-guanosine (CpG) dinucleotides in these regions are demethylated in clone 1-8 derived cells compared to the parental fibroblasts.
Human iPS-1-8 mTeSR cell-suspension (0.5 to 2×106 cells/mouse) was injected into the medulla of left testis of 7 to 8 week old SCID mice (CB17, Oriental Yeast) using a Hamilton syringe. After 6 to 8 weeks, the teratomas were excised under perfusion with PBS followed with 10% buffered formalin, and subjected to the histological analysis. Human iPS-1-8 mTeSR cells gave rise to teratomas 4 to 8 weeks after transplantation into testes of SCID mice.
Teratomas were embedded in the mounting medium, and sectioned at 10 μm on a cryostat. Serial sections were stained with hematoxylin-eosin (HE) to visualize the general morphology. For the detection of cartilage, alcian blue staining was employed or combined with HE.
For immunostaining, sections were treated with Immunoblock (Dainippon-Sumitomo) for 30 minutes to block non-specific binding. Slides were incubated with the following primary antibodies: anti Nestin polyclonal antibody (PRB-570C, COVANCE, 1:300), anti Type II collagen polyclonal antibody (LB-1297, LSL, 1:200), anti Smooth muscle actin polyclonal antibody (RB-9010—R7, LAB VISION, 1:1), anti α-Fetoprotein polyclonal antibody (A0008, DAKO, 1:500), anti MUC-1 polyclonal antibody (RB-9222-P0, LAB VISION, 1:100), and anti Human nuclei monoclonal antibody (HuNu) (MAB1281, CHEMICON, 1:300). For Type II collagen, before the treatment with primary antibody a section was incubated with Hyaluronidase (25 mg/mL) for 30 minutes. Localization of antigens was visualized by using appropriate secondary antibodies (Alexa fluor 594 and 688, Molecular Probes, 1:600). Nuclei were stained with DAPI. Immunostained teratoma sections were analyzed under a fluorescence microscope (Axio Imager Z1, Zeiss).
Teratomas of human iPS-1-8 mTeSR cells contained tissues representative of three germ layers, neuroectoderm, mesoderm, and endoderm. FIG. 11 shows teratoma that was derived from human iPS-1-8 mTeSR cells cultured for 94 days (T1). Human iPS-1-8 mTeSR cells were injected into SCID mouse testes and analyzed 56 days after injection. HE and alcian blue staining of teratoma tissues reveled that teratomas contained neural epitherium (positive for nestin) cartilage (positive for collagen II), endodermal tract (alpha-fetoprotein). Human iPS-1-8 mTeSR cell derived tissues were distinguished from host tissues by HuNu staining. In T1 teratoma, smooth muscle cells (positive for alpha-SMA) and secretary epithelium (positive for MUC-1) were also observed (FIG. 12). Human iPS-1-8 mTeSR cells which were cultured for 102 days and 114 days, were injected into SCID mouse testes and analyzed 48 days and 42 days (T3) after injection, respectively (T2, FIG. 12, T3, FIG. 13). Tissues representative of three germ layers, neuroectoderm, mesoderm and endoderm, were observed. To confirm whether human iPS can be cryopreserved, human iPS-1-8 mTeSR cells were frozen down, stored in liquid nitrogen and recultured. These cells were injected into SCID mouse testes and analyzed 46 days (T-F1) and 48 days (T-F2) after injection. Tissues representative of three germ layers, neuroectoderm, mesoderm and endoderm, were observed. Melanocytes were also observed in the T-F2 teratoma (FIG. 13). Thus, pluripotency was maintained via freezing and thawing.
Both southern blot analysis and genomic PCR analysis indicated human iPS-1-8 clone carried four transgenes. In southern blot analysis cDNA fragments were prepared by restriction enzyme digestion (XhoI for POU5F1, NotI for Sox2, PstI for KIF4) from the corresponding pMX vector plasmids. These fragments were purified as [32P]-labeled probes with agarose gel electrophoresis and a QIAquick gel extraction kit (QIAGEN). Genomic DNA was prepared from the human iPS clone 1-8 and its parental fibroblasts. Five μg of each genomic DNA was digested with KpnI (POU5F1, Sox2, and Klf4). Fragments were separated on a 0.8% agarose gel, blotted onto HybondXL membrane (GE Healthcare), and hybridized with [32P]-labeled probes. Human iPS clone-1-8 was shown to carry approximately ten copies of both Oct3/4 transgenes and Sox2 transgenes, and a single copy of Klf4 transgene (FIG. 14). In genomic PCR analysis, primer set indicated as c-Myc-total in Table 4 was designed so that the amplicon included whole second intron of c-Myc. Thus, amplicon size of the transgene (338 bp) was smaller than amplicon of endogene (1814 bp). Vector plasmid and the parental fibroblast genome, crude cultured fibroblast genome obtained from 17 days culture post infection were used as a control template. The genomic PCR confirmed clone-1-8 cells carries c-Myc transgene (FIG. 14).
SNP genotyping was performed with the use of the GeneChip Human Mapping 500K Array Set (Affymetrix) according to the manufacture's protocol. Human iPS-1-8 mTeSR cells cultured in mTeSR on matrigel, its parental fibroblasts (5F0438), and fibroblast (5F0416) derived from a different donor were analyzed for this assay. The array set includes a StyI and a NspI chip. Two aliquots of 250 ng of DNA each were digested with NspI and StyI, respectively. Each enzyme preparation was hybridized to the corresponding SNP array (262,000 and 238,000 on the NspI and StyI array respectively). The 93% call rate threshold at P=0.33 (dynamic Model algorithm confidence threshold) with the Dynamic Model algorithm138 was used in individual assays.
To confirm whether human iPS-1-8 mTeSR cells were generated from fibroblasts (5F0438), we compared SNP genotyping between human iPS-1-8 mTeSR cells and the employed fibroblasts (Table 5). SNPs of human iPS-1-8 mTeSR cells were consistent to that of parental cells in 464,069 (99.17%) of 467,946 of called SNPs and different from that of parental cells in 3,877 (0.83%) of them. In contrast, SNPs of human iPS-1-8 mTeSR cells were consistent to that of unrelated donor cells (5F0416) only in 284,950 (60.50%) of 470,960 of called SNPs and different from that of the unrelated cells in 186,010 (39.50%) of them. Thus, human iPS-1-8 clone (1-8 mTeSR) and parental cells had almost the same SNP genotype each other, strongly suggesting that both cells were originated from a single donor.
HLA DNA typing was performed by utilizing hybridization of PCR-amplified DNA with sequence specific oligonucleotide probes (SSOP) (Luminex). Assays were performed to determine the HLA-A, HLA-B, HLA-Cw, HLA-DR, HLA-DQ, HLA-DP and Bw loci according to manufacturer's instructions. Human iPS cells are promising materials in cell transplantation therapies, they would overcome immune rejection, because human iPS cells can be directly generated from patients' cells and must be the identical HLA type. To actually prove the HLA issue, we carried out HLA typing of human iPS-1-8 clone (1-8 mTeSR), parental cells (5F0438), and unrelated fibroblasts (5F0416). As expected, HLA type of iPS-1-8 clone was completely identical to that of 5F0438 but not 5F0416 (Table 6).
From the foregoing, human pluripotent stem cell were obtained by the forced expression of each of four genes of Oct3/4, Sox2, Klf4, and c-Myc in undifferentiated stem cell present in a human postnatal tissue. The human pluripotent stem cells showed an in vitro long-term self-renewal ability and the pluripotency of differentiation into ectoderm, mesoderm and endoderm. The human pluripotent stem cells were expressed cell surface antigens SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, CD9, CD24, and CD90, and ES cell marker genes Nanog, Oct3/4, TDGF1, Dnmt3b, GABRB3, GDF3, Zfp42, ALP, CD9, and Thy-1. The promoter regions of Nanog and Oct3/4 in the human pluripotent stem cells were demethylated compared to the parental fibroblasts. The human pluripotent stem cells carries at least a single copy of Oct3/4, Sox2, Klf4, and c-Myc transgene. The induced human pluripotent stem cells and the parental cells (undifferentiated stem cell present in a human postnatal tissue) had almost the same SNP genotype each other, and HLA type of the induced human pluripotent stem cell was completely identical to that of the parental cell (undifferentiated stem cell present in a human postnatal tissue).
Two lots of neonatal fibroblasts (5F0416 and 5F0474) were seeded at 103 cells/cm2 or 104 cells/cm2 into 35 mm diameter wells of 6 well plates and cultured in FBM supplemented with FGM-2 SingleQuots (manufactured by Lonza) before the four genes transduction. Cells were infected with mCAT1-adenovirus vectors at 2×105 ifu/well and then infected with the retroviral vectors carrying four genes as described in Example 6. Eight wells were prepared for this study (2 different lot and 2 different densities in duplicate).
Seventeen days post 4-gene infection, cells were fixed and stained for alkaline phosphatase (ALP) as described in Example 3. In total, 163 ALP positive (+) colonies were observed in four independent experiments. All 163 ALP (+) colonies and 18 ALP-negative (ALP (−)) colonies were dissected, and total RNA from these colonies were extracted using a RecoverAll Total Nucleic Acid Isolation kit (manufactured by Ambion). After the cDNA preparation, genes of interest were amplified using Taqman preamp (manufactured by Applied Biosystems). Real-time quantitative PCR was performed with ABI PRISM 7900HT (manufactured by Applied Biosystems) using PCR primer sets (manufactured by Applied Biosystems, Nanog, Hs02387400_g1, Dnmt3b, Hs00171876_m1, FoxD3, Hs00255287_s1, Zfp42, Hs01938187_s1, TDGF1, Hs02339499_g1, TERT, Hs00162669_m1, GDF3, Hs00220998_m1, CYP26A1, Hs00175627_m1, GAPDH, Hs99999905_m1) to determine gene expression of human ES cell markers in colonies. Eight genes (Nanog, TDGF1, Dnmt3b Zfp42 FoxD3, GDF3, CYP26A1 and TERT genes) which were reported to express in human ES cells were selected as a pluripotent stem cell marker genes. A standard curves was generated for each primer pair. All expression values were normalized against GAPDH.
It is known that mouse ES cells and mouse iPS cells form multilayered/aggregated colonies. Thus we first analyzed the mouse ES cell like aggregated colonies which were induced by ectopic expression of four gene in human fibroblasts (e.g. colony #1-2-F and #1-2-B in FIG. 22). However, these colonies are all ALP (−). Next we analyzed the Nanog gene expression in colonies. Nanog gene expression was observed in 161 out of 163 ALP positive colonies and 16 out of 18 ALP negative colonies. On the other hand expression of TERT and CYP26A1 genes were observed only in 26 and 24 colonies out of 163 ALP positive colonies respectively (FIG. 15a). Genes such as Nanog, TDGF, and Dnmt3b which are well know to be close association with the pluripotent state in human ES cells, and to be strongly downregulated upon their differentiation had higher tendency to be induced by the four gene transduction.
ALP positive colonies can be categorized into 40 groups based on the gene expression pattern of the eight human marker genes (Table 7). When colonies are categorized by the total number of eight marker genes expression, the distribution of colony number followed a normal distribution suggesting the presence of a stochastic process in the colony induction (FIGS. 15c,d). In addition the efficiency of human ES cell marker gene expression in human fibroblasts was affected by the donor difference.
Quantitative gene expression analysis of colonies formed 17 days after infection indicated that the transgenes c-Myc and Oct4 showed high expression in all the analyzed colonies (Table 11). In addition endogenous Nanog expression was very high in most of the ALP positive colonies, including cells lacking expression of one or more of the eight human ES cell marker genes (Table 11). These results indicate that the process of pluripotent stem cell induction from human skin fibroblasts is slower than that described for mouse iPS cell generation. Only 4 out of 163 ALP positive colonies were positive for Nanog, TDGF1, Dnmt3b, Zfp42, FoxD3, GDF3, Cyp26a1 and TERT (octa-positive coloniy). Cells in these octa-positive colonies showed common features: 1) small size with the high nucleus to cytoplasm ratio and 2) formation of small monolayer colonies within the space between fibroblasts (FIG. 15c). These features are consistent to the feature of human ES cells. However, these three features were also observed in some of ALP (+) colonies which lacked one or more ES cell marker expression. In addition, the large colony with these three features lack ALP expression (FIG. 22 colony #7-1-1). ALP (+) colonies with fibroblastic feature (colony #5-1-7, #3-1-214, #3-2-233, #3-1-212, #3-1-215, #5-1-4 in FIGS. 16-22 and Table 7, 11) usually lacked one or more ES cell marker gene expressions.
These results indicate that induced pluripotent stem cells can be isolated from small monolayer colonies comprising small cells with high nucleus to cytoplasm ratio not from fibroblastic colonies, defused colonies or multilayered colonies. Table 8 summarizes all of experiments and results on the ALP positive colony number using human neonatal fibroblasts.
Adenovirus vector plasmids for mCAT1 were transfected into 29310 cells. The mCAT1-adenoviruses were isolated from these cells by three freeze-thaw cycles, purified using Adenovirus purification kit (Clontech) and stored at −80° C. The titer of the vector stocks was determined by Adeno-X rapid titer kit (Clontech).
The replication deficient MMLV derived retrovirus vector pMx was used for the ectopic expression of human Oct3/4, Sox-2, c-Myc and Klf4. Recombinant retroviruses were generated by transfecting vectors to the Plat-E packaging system (Morita et al., 2000) followed by incubation in FBM (Lonza) supplemented with FGM-2 SingleQuots (Lonza). Between 24 and 48 hours after the transfection, supernatant from the Plat-E culture was collected several times at intervals of at least 4 hours and passed through a 0.45 μm filter.
For MEF-conditioned medium (MEF-CM) preparation, human ES medium (DMEM/F12 (Gibco) supplemented with 20% Knockout Serum Replacement (KSR, Invitrogen), 2 mM L-glutamine (Sigma), 1× nonessential amino acids (Sigma), 10 μg/ml gentamycin), 10 ng/ml bFGF was conditioned on mitomycin-C treated MEF (Reprocell) for 20-24 hours, harvested, filtered through a 0.45 μm filter and supplemented with 0.1 mM 2-mercaptoethanol (Sigma) and 10 ng/ml bFGF before use.
Using cells (trade name: Neonatal Normal Human Skin Fibroblasts, primary culture) derived from a human neonatal tissue, a human tissue immediately after birth, the induction of human pluripotent stem cells from undifferentiated stem cells present in the skin of a human neonate was attempted.
Human neonatal dermal fibroblasts (Lonza; lot 5F0416) were cultured in FBM supplemented with FGM-2 SingleQuots. Three days before the 4 gene introduction, fibroblasts were seeded at 103 cells/cm2 into 6 well plates. Eighteen hours later, the cells were mixed with the mCAT1 adenovirus vector solution in 500 μl Hanks' balanced salt solution, and incubated at room temperature for 30 min. The cells were then added to 2 ml of medium and cultured for 48 hrs. Subsequently, the cells were incubated in 2 ml of the retrovirus/polybrene solution (mixture of equal volumes of the retrovirus vector suspension for each of the four genes (Oct3/4, Sox2, Klf4 and c-Myc) prepared in Example 1, supplemented with 5 μg/ml of polybrene) at 37° C. for 4 hrs to overnight. The virus supernatant was replaced with the MEF-conditioned ES medium. Then medium was changed every days.
On day 33 after gene introduction, a colony with a characteristic shape was picked with forceps from a well. The picked colony was transferred into a matigel-coated well in a 24-well plate and maintained in mTeSR defined medium supplemented with 10 μM Y-27632. Fourteen hours later the medium was changed. Medium change was continued every days. At day 54 after the infection a second culture was carried out. At day 67, human iPS-2-4 clone was sub-cloned and designated as human iPS-2-4 sub-clone.
For passaging, medium was removed, and the cells were washed with the Hank's balanced salt solution followed by the treatment with 0.25% trysin-EDTA at 37° C. for 3 minutes. Fresh medium was added to stop the reaction. The cell suspension was centrifuged at 4° C. and 200×g for 5 minutes, and the supernatant was removed. The cells were resuspended in mTeSR defined medium supplemented with 10 μM Y-27632 and plated.
Human iPS-2-4 sub-clone was successfully expanded in mTeSR1 defined medium (Stem cell Technologies) on matrigel (Invitrogen)-coated culture dishes. We termed cells derived from the sub-clone iPS-2-4 and cultured in mTeSR1 medium as human iPS-2-4 mTeSR cells. Medium was changed for human iPS-2-4 mTeSR cell culture everyday and usually treated with Y-27632 (Calbiochem) to avoid cell apoptosis after passaging. For passaging, cells were washed with Hanks's balanced solution, incubated in 0.25% trypsin-EDTA (Gibco) at 37° C. for 3 minutes, and then added the culture medium. Cells were centrifuged at 300×g at room temperature or 4° C. for 5 minutes and the supernatant was removed. The cells were re-suspended into culture medium. Human iPS-2-4 mTeSR cells were morphologically indistinguishable from typical human ES cells and human iPS-1-8 mTeSR cells consisting of small, round, and high nucleus to cytoplasm ratio cells with defined edges.
Fifty nine days post 4-gene infection, a part of cells were fixed and stained for alkaline phosphatase (ALP) as described in Example 3. Colonies consisting of cells were positive for ALP and Total RNA from colonies were extracted using a RecoverAll Total Nucleic Acid Isolation kit (manufactured by Ambion). After the cDNA preparation, genes of interest were amplified using Taqman preamp (manufactured by Applied Biosystems). Real-time quantitative PCR was performed with ABI PRISM 7900HT (manufactured by Applied Biosystems) using PCR primer sets (manufactured by Applied Biosystems, Nanog, Hs02387400_g1, Dnmt3b, Hs00171876_m1, FoxD3, Hs00255287_s1, Zfp42, Hs01938187_s1, TDGF1, Hs02339499_g1, TERT, Hs00162669_m1, GDF3, Hs00220998_m1, CYP26A1, Hs00175627_m1, GAPDH, Hs99999905_m1) to determine gene expression of human ES cell markers in colonies. Conle-2-4 showed ES cell marker gene expressions (Table 12).
From the above results, human pluripotent stem cell were obtained by the forced expression of each of four genes of Oct3/4, Sox2, Klf4, and c-Myc in undifferentiated stem cell present in a human postnatal tissue. The human pluripotent stem cells showed an in vitro long-term self-renewal ability, and were expressed ES cell marker genes Nanog, Oct3/4, TDGF1, Dnmt3b, GABRB3, GDF3, Zfp42, ALP, CD9, and Thy-1.
According to Example 16, human neonatal dermal fibroblasts (Lonza; lot 5F0438) were cultured in FBM supplemented with FGM-2 SingleQuots. Three days before the 4 gene introduction, fibroblasts were seeded at 103 cells/cm2 into 6 well plates. Eighteen hours later, the cells were mixed with the mCAT1 adenovirus vector solution in 500 μl Hanks' balanced salt solution, and incubated at room temperature for 30 min. The cells were then added to 2 ml of medium and cultured for 48 hrs. Subsequently, the cells were incubated in 2 ml of the retrovirus/polybrene solution (mixture of equal volumes of the retrovirus vector suspension for each of the four genes (Oct3/4, Sox2, Klf4 and c-Myc) prepared in Example 1, supplemented with 5 μg/ml of polybrene) at 37° C. for 4 hrs to overnight. The virus supernatant was replaced with the MEF-conditioned ES medium. Then medium was changed every days. On day 21 after gene introduction, a colony with a characteristic shape was directly picked with forceps from one of dishes. The picked colony was transferred into a matigel-coated well in a 24-well plate and maintained in mTeSR defined medium supplemented with 10 μM Y-27632.
Fourteen hours later the medium was changed. Medium change was continued every days. 40 days after the infection, a second subcloning was carried out, and cells were successfully expanded in mTeSR1 defined medium (Stem cell Technologies) on matrigel (Invitrogen)-coated culture dishes. Medium was changed everyday and usually treated with Y-27632 (Calbiochem) to avoid cell apoptosis after passaging. For passaging, cells were washed with Hanks's balanced solution, incubated in 0.25% trypsin-EDTA (Gibco) at 37° C. for 5 minutes, and then added the culture medium. Cells were centrifuged at 300×g at room temperature for 5 minutes and the supernatant was removed. The cells were re-suspended into culture medium.
Cells were morphologically indistinguishable from typical human ES cells, human iPS-1-8 mTeSR cells, and human iPS-2-4 mTeSR cells that consist of small, round, and high nucleus to cytoplasm ratio cells with defined edges. Thus we termed this clone as human iPS-3-2 clone. Human iPS-3-2 clone actively proliferated in mTeSR1 medium. We termed these cells derived from human iPS-3-2 clone which culture in mTeSR1 medium as human iPS-3-2 mTeSR cells.
Forty eight days post 4-gene infection, cells were fixed and stained for alkaline phosphatase (ALP) as described in Example 3. Total RNA from colonies were extracted using a RecoverAll Total Nucleic Acid Isolation kit (manufactured by Ambion). After the cDNA preparation, genes of interest were amplified using Taqman preamp (manufactured by Applied Biosystems). Real-time quantitative PCR was performed with ABI PRISM 7900HT (manufactured by Applied Biosystems) using PCR primer sets (manufactured by Applied Biosystems, Nanog, Hs02387400_g1, Dnmt3b, Hs00171876_m1, FoxD3, Hs00255287_s1, Zfp42, Hs01938187_s1, TDGF1, Hs02339499_g1, TERT, Hs00162669_m1, GDF3, Hs00220998_m1, CYP26A1, Hs00175627_m1, GAPDH, Hs99999905_m1) to determine gene expression of human ES cell markers in colonies. Conle-3-2 showed ES cell marker gene expressions (Table 12).
From the above results, human pluripotent stem cell were obtained by the forced expression of each of four genes of Oct3/4, Sox2, Klf4, and c-Myc in undifferentiated stem cell present in a human postnatal tissue. The human pluripotent stem cells showed an in vitro long-term self-renewal ability, and were expressed ES cell marker genes Nanog, Oct3/4, TDGF1, Dnmt3b, GABRB3, GDF3, Zfp42, ALP, CD9, and Thy-1.
Table 1 shows the name of gene, the NCBI number, the virus vector in which said gene was inserted, insert size, the restriction site at the 5′-end, the restriction site at the 3′-end, the length of the translated region, the length of the 3′-untranslated region, clone ID, and the supplier of the four genes or the three genes and the receptor of mouse ecotropic retrovirus vector (mCAT: mouse-derived cationic amino acid transporter) used in Examples.
| TABLE 1 |
| Construction data |
| Gene- | |||||||||
| Name | inserted | 5′-end | 3′-end | Length of | 3′- | ||||
| of | virus | Insert | restriction | restriction | translated | untranslated | |||
| gene | NCBI No. | vector | size | site | site | region | region | Clone ID | Supplier |
| human | NM_002701 | pMXs-puro | 1411 | EcoRI | Xho1 | 1083 | 274 | 6578897 | Open |
| Oct3/4 | Biosystems | ||||||||
| human | BC013923 | pMXs-neo | 1172 | EcoRI | Xho1 | 954 | 143 | 2823424 | Open |
| Sox2 | Biosystems | ||||||||
| human | BC058901 | pMXs-IB | 1876 | EcoRI | Xho1 | 1365 | 473 | 6012670 | Open |
| c-Myc | Biosystems | ||||||||
| human | BC029923 | pMXs-IB | 1591 | EcoRI | EcoRI | 1413 | 38 | 5111134 | Open |
| Klf4 | Biosystems | ||||||||
| mCAT1 | NM_007513 | Adeno-X | 2032 | BssS1 | BssS1 | 1869 | 132 | A830015N05 | RIKEN |
| FANTOM | |||||||||
| clone | |||||||||
Table 2 summarizes the number of alkaline phosphatase-positive colonies of Examples 4 to 7. For cell type, the number of subculture is attached. The day of four gene introduction is a day when a retrovirus vector was infected. Lot No. is that of Lonza products. Age of donors is based on the donor information of Lonza products. The number of colonies is the number of colonies composed of alkaline phosphatase-positive small cells per 10 cm2.
| TABLE 2 |
| Examples 5 to 8 and 10, Number of alkaline phosphatase (ALP)-positive |
| colonies formed by gene introduction |
| No. of | ||||||
| passages at | ||||||
| Serum | the time of | |||||
| Cell | concentration | gene | Date of gene | Date of ALP | Colony |
| Example | Cell type | Donor age | Lot No. | (%) | introduction | introduction | staining | count* |
| 8 | Neonatal skin fibroblast | Neonate | 5F0439 | 2 | 3 | 2007/3/20 | 2007/4/3 | 0.8 |
| 6 | Neonatal skin fibroblast | Neonate | 5F0438 | 2 | 2 | 2007/4/15 | 2007/4/29 | 6.0 |
| 6 | Neonatal skin fibroblast | Neonate | 5F0438 | 2 | 2 | 2007/5/5 | 2007/5/16 | 6.0 |
| 6 | Neonatal skin fibroblast | Neonate | 5F0474 | 2 | 2 | 2007/5/5 | 2007/5/16 | 4.0 |
| 6 | Neonatal skin fibroblast | Neonate | 5F0438 | 2 | 2 | 2007/5/12 | 2007/5/26 | 7.0 |
| 6 | Neonatal skin fibroblast | Neonate | 5F0474 | 2 | 2 | 2007/5/12 | 2007/5/26 | 9.5 |
| 7 | Adult skin fibroblast | 28 | 6F3535 | 2 | 2 | 2007/5/5 | 2007/5/16 | 2.0 |
| 7 | Adult skin fibroblast | 39 | 6F4026 | 2 | 2 | 2007/5/5 | 2007/5/16 | 0.0 |
| 5 | Adult BM-derived cell (low | 20 | 060470B | 2 | 2 | 2007/3/20 | 2007/4/3 | 0.0 |
| serum) | ||||||||
| 5 | Adult BM-derived cell (low | 20 | 060809B | 2 | 2 | 2007/3/26 | 2007/4/9 | 0.0 |
| serum) | ||||||||
| 5 | Adult BM-derived cell (low | 20 | 060809B | 2 | 2 | 2007/4/15 | 2007/4/29 | 0.2 |
| serum) | ||||||||
| 5 | Adult BM-derived cell (low | 20 | 060809B | 2 | 2 | 2007/5/5 | 2007/5/19 | 0.0 |
| serum) | ||||||||
| 5 | Adult BM-derived mesenchymal | 20 | 060809B | 10 | 2 | 2007/3/20 | 2007/4/3 | 0.0 |
| stem cell (high serum) | ||||||||
| 5 | Adult BM-derived mesenchymal | 20 | 060470B | 10 | 2 | 2007/3/26 | 2007/4/9 | 0.0 |
| stem cell (high serum) | ||||||||
| 10 | Neonatal umbilical cord artery | Neonate | 5F0442 | 5 | 4 | 2007/5/11 | 2007/5/24 | 0.0 |
| smooth muscle cell | ||||||||
| *The number of colonies composed of alkaline phosphatase-positive small cells per 10 cm2. | ||||||||
| “BM” in Table 2 means “Bone Marrow”. |
| TABLE 3 |
| karyotype analysis |
| Chromosome | ||
| no. | Cell no | |
| 44 | 1 | |
| 45 | 22 | |
| 46 | 67 | |
| 47 | 7 | |
| 48 | 1 | |
| 89 | 1 | |
| 136 | 1 | |
| TABLE 4 |
| Primer Sequences for RT-PCR |
| Forward primer sequence | Reverse primer sequence | |
| HPRT | AGTCTGGCTTATATCCAACACTTCG | GACTTTGCTTTCCTTGGTCAGG |
| Nanog | TACCTCAGCCTCCAGCAGAT | TGCGTCACACCATTGCTATT |
| TERT | AGCCAGTCTCACCTTCAACCGC | GGAGTAGCAGAGGGAGGCCG |
| Sall4 | AAACCCCAGCACATCAACTC | GTCATTCCCTGGGTGGTTC |
| Zfp42 | TTGGAGTGCAATGGTGTGAT | TCTGTTCACACAGGCTCCAG |
| GDF3 | GGCGTCCGCGGGAATGTACTTC | TGGCTTAGGGGTGGTCTGGCC |
| Dnmt3b | GCAGCGACCAGTCCTCCGACT | AACGTGGGGAAGGCCTGTGC |
| TDGF1 | ACAGAACCTGCTGCCTGAAT | AGAAATGCCTGAGGAAAGCA |
| GABRB3 | CTTGACAATCGAGTGGCTGA | TCATCCGTGGTGTAGCCATA |
| CYP26A1 | AACCTGCACGACTCCTCGCACA | AGGATGCGCATGGCGATTCG |
| Oct4-total | GAGAAGGAGAAGCTGGAGCA | AATAGAACCCCCAGGGTGAG |
| Oct4-exo | AGTAGACGGCATCGCAGCTTGG | GGAAGCTTAGCCAGGTCCGAGG |
| Sox2-total | CAGGAGAACCCCAAGATGC | GCAGCCGCTTAGCCTCG |
| Sox2-exo | ACACTGCCCCTCTCACACAT | CGGGACTATGGTTGCTGACT |
| Klf4-total | ACCCTGGGTCTTGAGGAAGT | ACGATCGTCTTCCCCTCTTT |
| Klf4-exo | CTCACCCTTACCGAGTCGGCG | GCAGCTGGGGCACCTGAACC |
| c-Myc-total | TCCAGCTTGTACCTGCAGGATCTGA | CCTCCAGCAGAAGGTGATCCAGACT |
| c-Myc-exo | AGTAGACGGCATCGCAGCTTGG | CCTCCAGCAGAAGGTGATCCAGACT |
| TABLE 5 |
| SNP genotyping |
| 500K_Set Number of total | 500,568 | ||
| SNP |
| Number of called SNP |
| human iPS-1-8 | 484,393 | 96.77% | |
| neoFB (5F0438) | 480,249 | 95.94% | |
| neoFB (5F0416) | 485,626 | 97.01% |
| human iPS-1-8 vs. neoFB (5F0438) |
| Called SNP in both samples | 467,946 | ratio | |
| Consistent SNP | 464,069 | 99.17% | |
| different SNP | 3,877 | 0.83% | |
| No called SNP in neither | 32,622 |
| human iPS-1-8 vs. neoFB (5F0416) |
| Called SNP in both samples | 470,960 | ratio | |
| Consistent SNP | 284,950 | 60.50% | |
| different SNP | 186,010 | 39.50% | |
| No called SNP in neither | 29,608 | ||
| TABLE 6 |
| HLA genotyping |
| ID | A allele | B allele | Cw allele | DRB1 allele | DQB1 allele | DPB1 allele |
| 5F0438 | *0101/ | *0206/ | *3801/09 | *3905 | *0602/ | *0702/ | *0802 | *1104/43/ | *0301/ | *0402 | *0402/ | *0501 |
| 5F0416 | *0201/ | — | *1501/ | *5101/ | *0303/ | *0401/ | *0401/33/38 | *0801/26 | *0302/ | *0402 | *0201 | *0301/ |
| 1-8(5F0438) | *0101/ | *0206/ | *3801/09 | *3905 | *0602/ | *0702/ | *0802 | *1104/43/ | *0301/ | *0402 | *0402/ | *0501 |
| ID | HLA-A | HLA-B | HLA-Cw | HLA-DR | HLA-DQ | HLA-DP | Bw |
| 5F0438 | A1 | A2 | B38 | B39 | Cw6 | Cw7 | DR8.2 | DR11 | DQ7 | DQ4 | DP4 | DP5 | 4/6 |
| 5F0416 | A2 | — | B62 | B51 | Cw9 | Cw4 | DR4.1 | DR8.1 | DQ8 | DQ4 | DP2 | DP3 | 4/6 |
| 1-8(5F0438) | A1 | A2 | B38 | B39 | Cw6 | Cw7 | DR8.2 | DR11 | DQ7 | DQ4 | DP4 | DP5 | 4/6 |
| TABLE 7 |
| Gene expression patterns in ALP(+) and ALP(−) colonies |
| No. of | ||||||||||
| Group | gene | No. of | ||||||||
| No. | expressed | Nanog | TDGF1 | Dnmt3b | Zfp42 | FoxD3 | GDF3 | CYP26A1 | TERT | colony |
| Gene expression patterns in ALP(+) colonies |
| 1 | 8 | + | + | + | + | + | + | + | + | 4 |
| 2 | 7 | + | + | + | + | + | + | + | − | 7 |
| 3 | 7 | + | + | + | + | + | + | − | + | 11 |
| 4 | 7 | + | + | + | + | + | − | + | + | 1 |
| 5 | 6 | + | + | + | + | + | + | − | − | 25 |
| 6 | 6 | + | + | + | + | + | − | + | − | 4 |
| 7 | 6 | + | + | + | + | + | − | − | + | 3 |
| 8 | 6 | + | + | + | + | − | + | − | + | 2 |
| 9 | 6 | + | + | + | + | − | + | + | − | 3 |
| 10 | 6 | + | + | + | − | + | + | + | − | 1 |
| 11 | 6 | + | + | + | − | − | + | + | + | 1 |
| 12 | 5 | + | + | + | + | + | − | − | − | 22 |
| 13 | 5 | + | + | + | + | − | + | − | − | 9 |
| 14 | 5 | + | + | + | + | − | − | + | − | 2 |
| 15 | 5 | + | + | + | − | + | + | − | − | 4 |
| 16 | 5 | + | + | + | − | + | − | + | − | 2 |
| 17 | 5 | + | + | + | − | − | + | + | − | 1 |
| 18 | 5 | + | + | − | + | + | + | − | − | 2 |
| 19 | 5 | + | + | − | + | + | − | − | + | 1 |
| 20 | 4 | + | + | + | + | − | − | − | − | 9 |
| 21 | 4 | + | + | + | − | + | − | − | − | 3 |
| 22 | 4 | + | + | + | − | − | + | − | − | 5 |
| 23 | 4 | + | + | − | + | + | − | − | − | 7 |
| 24 | 4 | + | − | + | + | + | − | − | − | 1 |
| 25 | 4 | + | − | + | − | + | + | − | − | 2 |
| 26 | 4 | + | − | − | + | + | + | − | − | 1 |
| 27 | 3 | + | + | + | − | − | − | − | − | 1 |
| 28 | 3 | + | + | − | + | − | − | − | − | 3 |
| 29 | 3 | + | + | − | − | + | − | − | − | 4 |
| 30 | 3 | + | + | − | − | − | − | − | + | 1 |
| 31 | 3 | + | − | + | + | − | − | − | − | 1 |
| 32 | 3 | + | − | + | − | + | − | − | − | 2 |
| 33 | 3 | + | − | + | − | − | + | − | − | 1 |
| 34 | 3 | + | − | − | + | + | − | − | − | 1 |
| 35 | 3 | + | − | − | − | + | + | − | − | 1 |
| 36 | 2 | + | + | − | − | − | − | − | − | 4 |
| 37 | 2 | + | − | + | − | − | − | − | − | 5 |
| 38 | 2 | + | − | − | + | − | − | − | − | 2 |
| 39 | 1 | + | − | − | − | − | − | − | − | 2 |
| 40 | 0 | − | − | − | − | − | − | − | − | 2 |
| Gene expression patterns in ALP(−) colonies |
| 41 | 6 | + | + | + | + | + | − | + | − | 1 |
| 42 | 6 | + | + | − | + | + | + | − | + | 1 |
| 43 | 5 | + | + | + | + | + | − | − | − | 3 |
| 44 | 5 | + | + | − | + | + | − | − | + | 6 |
| 45 | 4 | + | + | + | − | + | − | − | − | 1 |
| 46 | 4 | + | + | − | + | + | − | − | − | 1 |
| 47 | 4 | + | + | + | − | − | − | − | + | 1 |
| 48 | 2 | + | − | − | − | − | − | − | + | 1 |
| 49 | 1 | + | − | − | − | − | − | − | − | 1 |
| 50 | 1 | − | + | − | − | − | − | − | − | 1 |
| 51 | 0 | − | − | − | − | − | − | − | − | 1 |
| TABLE 8 |
| List of experiments |
| experimental conditions | ALP staining |
| date of 4 gene | cell density | number of | |||
| transduction | donor | (cell□/cm2) | date | colony (/10 cm2) | notes |
| 2007/3/20 | 5F0439 | 1 × 104 | 2007/4/3 | 0.8 | |
| 2007/4/15 | 5F0438 | 1 × 104 | 2007/4/29 | 6.0 | iPS clone#1-8 |
| 2007/5/5 | 5F0438 | 1 × 104 | 2007/5/16 | 6.0 | |
| 5F0474 | 1 × 104 | 4.0 | |||
| 2007/5/12 | 5F0438 | 1 × 104 | 2007/5/26 | 7.0 | |
| 5F0474 | 1 × 104 | 9.5 | |||
| 2007/5/26 | 5F0474 | 1 × 104 | 2007/6/9 | 13.3 | |
| 2007/6/8 | 5F0416 | 1 × 103 | 2007/6/22 | 19.0 | |
| 5F0416 | 1 × 104 | 17.5 | |||
| 5F0474 | 1 × 104 | 14.0 | |||
| 2007/7/20 | 5F0416 | 1 × 103 | 2007/8/6 | 3.0 | |
| 5F0416 | 1 × 104 | 9.0 | |||
| 2007/8/10 | 5F0416 | 1 × 103 | 2007/8/27 | 21.0 | ALP(+) colony |
| 5F0416 | 1 × 104 | 21.5 | classification | ||
| 5F0474 | 1 × 103 | 17.0 | |||
| 5F0474 | 1 × 104 | 19.5 | |||
| 2007/8/17 | 5F0416 | 1 × 103 | ND | iPS clone #2-4 | |
| 5F0416 | 1 × 104 | ND | |||
| 5F0474 | 1 × 103 | ND | |||
| 5F0474 | 1 × 104 | ND | |||
| 2007/8/31 | 5F1195 | 1 × 103 | ND | ||
| 2007/9/14 | 5F0438 | 1 × 103 | ND | iPS clone #3-2 | |
| TABLE 9 |
| Promoter regions in methylation analysis |
| amplicon | location in genome corresponding | size of | |
| name | to amplicon | amplicon | |
| Nanog-z1 | chr12: 7832645-7832959 | 315 | |
| Nanog-z2 | chr12: 7832877-7833269 | 393 | |
| Oct3/4-z1 | chr6: 31248581-31249029 | 449 | |
| Oct3/4-z2 | chr6_qbl_hap2: 2388299-2388525 | 227 | |
| TABLE 10 |
| Primer sequences for methylation analyses |
| sequences of primers (capital | |
| names of | for gene-specific sequences, |
| primers | lower case for tag sequences) |
| Nanog-z1-L | aggaagagagGGAATTTAAGGTGTATGTATTTTTTAT |
| TTT | |
| Nanog-z1-R | cagtaatacgactcactatagggagaaggctATAACC |
| CACCCCTATAATCCCAATA | |
| Nanog-z2-L | aggaagagagGTTAGGTTGGTTTTAAATTTTTGAT |
| Nanog-z2-R | cagtaatacgactcactatagggagaaggctTTTATA |
| ATAAAAACTCTATCACCTTAAACC | |
| Oct3/4-z1-L | aggaagagagTAGTAGGGATTTTTTGGATTGGTTT |
| Oct3/4-z1-R | cagtaatacgactcactatagggagaaggctAAAACT |
| TTTCCCCCACTCTTATATTAC | |
| Oct3/4-z2-L | aggaagagagGGTAATAAAGTGAGATTTTGTTTTAA |
| AAA | |
| Oct3/4-z2-R | cagtaatacgactcactatagggagaaggctCCACCC |
| ACTAACCTTAACCTCTAA | |
| TABLE 11 |
| Relative mRNA expression of ES cell markers in ALP positive colonies |
| Nanog | GDF3 | CYP26A1 |
| Group | Sample | ALP | mean | SD | mean | SD | mean | SD | |||
| iPS 1-8 | ALP(+) | 1.0 | 1.0 | 1.0 | |||||||
| 1 | #5-2-32 | ALP(+) | 9.3 | ± | 1.5 | 4.8 | ± | 0.3 | 27.2 | ± | 12.5 |
| 1 | #5-2-49 | ALP(+) | 15.9 | ± | 5.7 | 242.9 | ± | 78.8 | 3.0 | ± | 0.3 |
| 1 | #5-2-51 | ALP(+) | 27.1 | ± | 2.2 | 419.2 | ± | 24.7 | 73.5 | ± | 8.2 |
| 1 | #7-2-37 | ALP(+) | 36.9 | ± | 7.8 | 171.3 | ± | 20.0 | 110.1 | ± | 15.4 |
| 3 | #1-1-5 | ALP(+) | 21.0 | ± | 2.4 | 59.2 | ± | 10.2 | 0.0 | ± | 0.0 |
| 3 | #1-1-11 | ALP(+) | 127.6 | ± | 6.0 | 259.7 | ± | 3.9 | 0.0 | ± | 0.0 |
| 3 | #1-1-19 | ALP(+) | 32.6 | ± | 8.4 | 34.0 | ± | 5.0 | 0.0 | ± | 0.0 |
| 3 | #1-2-28 | ALP(+) | 9.5 | ± | 1.0 | 3.4 | ± | 0.9 | 0.0 | ± | 0.0 |
| 3 | #3-1-218 | ALP(+) | 141.5 | ± | 64.3 | 328.8 | ± | 54.1 | 0.0 | ± | 0.0 |
| 3 | #3-2-226 | ALP(+) | 78.0 | ± | 16.6 | 188.2 | ± | 3.8 | 0.0 | ± | 0.0 |
| 3 | #5-2-41 | ALP(+) | 55.5 | ± | 12.2 | 151.3 | ± | 21.2 | 0.0 | ± | 0.0 |
| 3 | #5-2-44 | ALP(+) | 0.1 | ± | 0.1 | 0.1 | ± | 0.1 | 0.0 | ± | 0.0 |
| 3 | #5-2-46 | ALP(+) | 10.9 | ± | 2.6 | 67.9 | ± | 12.3 | 0.0 | ± | 0.0 |
| 3 | #5-2-50 | ALP(+) | 0.1 | ± | 0.0 | 0.4 | ± | 0.1 | 0.0 | ± | 0.0 |
| 3 | #7-2-26 | ALP(+) | 51.5 | ± | 14.4 | 126.4 | ± | 1.1 | 0.0 | ± | 0.0 |
| 4 | #5-1-2 | ALP(+) | 0.7 | ± | 0.1 | 0.0 | ± | 0.0 | 5.0 | ± | |
| 7 | #3-2-227 | ALP(+) | 14.6 | ± | 1.1 | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 |
| 7 | #5-1-13 | ALP(+) | 20.1 | ± | 5.9 | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 |
| 7 | #7-2-31 | ALP(+) | 1.1 | ± | 0.4 | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 |
| 8 | #3-1-210 | ALP(+) | 103.4 | ± | 11.7 | 195.3 | ± | 17.7 | 0.0 | ± | 0.0 |
| 8 | #3-1-211 | ALP(+) | 50.8 | ± | 3.6 | 291.3 | ± | 43.9 | 0.0 | ± | 0.0 |
| 11 | #1-1-20 | ALP(+) | 50.3 | ± | 14.5 | 34.3 | ± | 3.6 | 10.4 | ± | 2.0 |
| 12 | #5-1-20 | ALP(+) | 9.3 | ± | 0.5 | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 |
| 19 | #3-2-233 | ALP(+) | 126.4 | ± | 65.3 | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 |
| 23 | #5-1-16 | ALP(+) | 3.7 | ± | 1.3 | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 |
| 23 | #5-1-18 | ALP(+) | 1.9 | ± | 0.3 | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 |
| 23 | #7-2-46 | ALP(+) | 17.4 | ± | 5.1 | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 |
| 28 | #3-1-215 | ALP(+) | 2.2 | ± | 0.3 | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 |
| 29 | #3-1-212 | ALP(+) | 1.9 | ± | 0.3 | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 |
| 29 | #5-1-4 | ALP(+) | 1.4 | ± | 0.2 | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 |
| 30 | #3-2-228 | ALP(+) | 5.6 | ± | 2.9 | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 |
| 42 | #305-2-28 | ALP(−) | 0.5 | ± | 0.1 | 0.1 | ± | 0.0 | ± | 0.0 | |
| 44 | #5-1-3 | ALP(−) | 0.8 | ± | 0.2 | 0.0 | ± | 0.0 | 1.6 | ± | 0.3 |
| 44 | #5-1-23 | ALP(−) | 6.9 | ± | 1.1 | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 |
| 44 | #5-1-24 | ALP(−) | 7.2 | ± | 2.0 | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 |
| 44 | #5-2-25 | ALP(−) | 0.2 | ± | 0.1 | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 |
| 44 | #5-2-36 | ALP(−) | 2.5 | ± | 0.5 | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 |
| 44 | #7-2-40 | ALP(−) | 3.4 | ± | 0.9 | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 |
| 47 | #7-1-21 | ALP(−) | 0.2 | ± | 0.1 | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 |
| 48 | #F | ALP(−) | 0.6 | ± | 0.3 | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 |
| 49 | #I | ALP(−) | 2.1 | ± | 0.6 | 0.0 | ± | 0.0 | 226.0 | ± | 17.7 |
| 50 | #B | ALP(−) | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 |
| 51 | #H | ALP(−) | 2.1 | ± | 0.6 | 0.0 | ± | 0.0 | 226.0 | ± | 17.7 |
| TERT | Myc | Oct4 |
| Group | mean | SD | mean | SD | mean | SD | ||||
| 1.0 | 1.0 | 1.0 | ||||||||
| 1 | 0.2 | ± | 0.0 | 1121.1 | ± | 25.3 | 39.3 | ± | 1.5 | |
| 1 | 3.7 | ± | 0.5 | 1106.3 | ± | 51.8 | 770.6 | ± | 9.3 | |
| 1 | 2.5 | ± | 0.1 | 1329.4 | ± | 272.1 | 101.6 | ± | 5.1 | |
| 1 | 6.2 | ± | 1.1 | 566.9 | ± | 22.1 | 30.9 | ± | 2.4 | |
| 3 | 0.12 | ± | 0.09 | 436 | ± | 12 | 25.0 | ± | 1.2 | |
| 3 | 0.6 | ± | 0.3 | 59.2 | ± | 1.2 | 9.1 | ± | 0.1 | |
| 3 | 1.1 | ± | 446.9 | ± | 15.8 | 14.9 | ± | 0.1 | ||
| 3 | 1.6 | ± | 0.1 | 1052.8 | ± | 129.5 | 17.1 | ± | 0.3 | |
| 3 | 7.0 | ± | 0.7 | 9796.2 | ± | 275.5 | 324.2 | ± | 29.8 | |
| 3 | 67.6 | ± | 7.1 | 9714.4 | ± | 15.7 | 258.7 | ± | 13.3 | |
| 3 | 5.2 | ± | 0.1 | 285.3 | ± | 49.6 | 24.8 | ± | 3.2 | |
| 3 | 1.1 | ± | 0.0 | 13065.1 | ± | 769.8 | 241.8 | ± | 0.7 | |
| 3 | 4.4 | ± | 0.8 | 171.5 | ± | 2.3 | 578.7 | ± | 13.4 | |
| 3 | 0.7 | ± | 0.5 | 3176.2 | ± | 751.2 | 233.4 | ± | 17.7 | |
| 3 | 2.5 | ± | 0.3 | 1446.0 | ± | 421.7 | 33.8 | ± | 2.6 | |
| 4 | 0.5 | ± | 0.2 | 6049.2 | ± | 396.9 | 3.8 | ± | 0.3 | |
| 7 | 40.0 | ± | 5.7 | 27086.4 | ± | 3870.8 | 530.6 | ± | 84.1 | |
| 7 | 1.9 | ± | 1.0 | 9125.8 | ± | 883.7 | 7.5 | ± | 0.7 | |
| 7 | 20.6 | ± | 0.6 | 8344.9 | ± | 2054.5 | 6.7 | ± | 0.5 | |
| 8 | 18.1 | ± | 1.8 | 95692.9 | ± | 5109.8 | 2843.9 | ± | 113.9 | |
| 8 | 20.2 | ± | 2.9 | 29701.1 | ± | 4821.3 | 483.1 | ± | 13.9 | |
| 11 | 1.3 | ± | 0.1 | 533.8 | ± | 24.8 | 30.2 | ± | 1.2 | |
| 12 | 0.0 | ± | 0.0 | 16848.2 | ± | 1742.0 | 4.7 | ± | 0.2 | |
| 19 | 28.7 | ± | 4.9 | 23614.4 | ± | 388.9 | 310.9 | ± | 19.2 | |
| 23 | 0.0 | ± | 0.0 | 2927.9 | ± | 412.5 | 130.3 | ± | 10.1 | |
| 23 | 0.0 | ± | 0.0 | 19433.2 | ± | 297.0 | 4.2 | ± | 0.5 | |
| 23 | 0.0 | ± | 0.0 | 1959.8 | ± | 379.9 | 8.5 | ± | 0.7 | |
| 28 | 0.0 | ± | 0.0 | 6065.6 | ± | 704.9 | 3.4 | ± | 0.3 | |
| 29 | 0.0 | ± | 0.0 | 4572.6 | ± | 303.7 | 7.4 | ± | 0.1 | |
| 29 | 0.0 | ± | 0.0 | 53755.3 | ± | 10897.7 | 22.9 | ± | 3.0 | |
| 30 | 807.1 | ± | 13.4 | 25595.8 | ± | 2002.8 | 414.9 | ± | 22.6 | |
| 42 | 0.0 | ± | 0.0 | 5873.2 | ± | 156.2 | 226.3 | ± | 12.9 | |
| 44 | 0.5 | ± | 0.2 | 8698.4 | ± | 492.3 | 58.7 | ± | 2.6 | |
| 44 | 0.7 | ± | 0.1 | 9350.1 | ± | 201.0 | 2.1 | ± | 0.1 | |
| 44 | 7.3 | ± | 1.8 | 26133.6 | ± | 3528.5 | 8.0 | ± | 0.1 | |
| 44 | 0.5 | ± | 0.1 | 5211.8 | ± | 618.7 | 370.7 | ± | 7.8 | |
| 44 | 0.5 | ± | 0.1 | 8971.8 | ± | 110.3 | 266.6 | ± | 21.4 | |
| 44 | 11.8 | ± | 3.4 | 9748.3 | ± | 530.0 | 7.3 | ± | 0.1 | |
| 47 | 14.6 | ± | 1.9 | 7681.0 | ± | 286.9 | 261.0 | ± | 26.0 | |
| 48 | 8.2 | ± | 0.6 | 53887.9 | ± | 1343.2 | 13.3 | ± | 1.2 | |
| 49 | 0.0 | ± | 0.0 | 906.4 | ± | 231.6 | 7.2 | ± | 0.2 | |
| 50 | 0.0 | ± | 0.0 | 4461.3 | ± | 589.3 | 5.2 | ± | 0.4 | |
| 51 | 0.0 | ± | 0.0 | 906.4 | ± | 231.6 | 7.2 | ± | 0.2 | |
| TABLE 12 |
| relative mRNA expression in clone-2-4 and 3-2. |
| #3-2_day48 | #2-4_day59 | #1-8_day82 | #1-8_day94 | |
| Nanog | 4.21 ± 1.11 | 2.88 ± 0.43 | 2.41 | 1.00 ± 0.24 |
| TERT | 1.52 ± 0.50 | 1.94 ± 0.14 | 0.69 | 1.00 ± 0.70 |
| GDF3 | 6.42 ± 0.16 | 6.65 ± 0.05 | 0.92 | 1.00 ± 0.49 |
| CYP26A1 | 72.45 ± 14.92 | 49.12 ± 0.06 | 62.50 | 1.00 ± 0.01 |
| TDGF1 | 2.55 ± 0.10 | 3.53 ± 0.05 | 3.53 | 1.00 ± 0.01 |
| Dnmt3b | 2.66 ± 0.04 | 0.96 ± 0.02 | 0.91 | 1.00 ± 0.01 |
| Foxd3 | 1.16 ± 0.08 | 0.59 ± 0.17 | 1.14 | 1.00 ± 0.18 |
| Zfp42 | 0.98 ± 0.15 | 0.76 ± 0.01 | 2.44 | 1.00 ± 0.02 |
| Myc | 6.14 ± 0.58 | 4.58 ± 0.16 | 3.82 | 1.00 ± 0.05 |
| Oct3/4 | 2.00 ± 0.07 | 1.08 ± 0.01 | 1.33 | 1.00 ± 0.00 |
Cells in a tissue that was lost in diseases etc. can be supplied by inducing human pluripotent cells from the undifferentiated stem cells harvested from a patient by using the induction method of the present invention, followed by inducing to differenciate into a necessary cell depending on diseases and then transplanting the cells to the patient. The undifferentiated stem cells of the present invention present in a human postnatal tissue can be used to search drugs that promote the induction from said undifferentiated stem cells to human pluripotent stem cells by using markers such as Tert, Nanog, Sox2, Oct3/4 and alkaline phosphatase that direct the induction to human pluripotent stem cells. Said drugs can be used in stead of gene introduction and can enhance the induction efficiency of human pluripotent stem cells.
1. A human pluripotent stem cell having an in vitro long-term self-renewal ability and the pluripotency of differentiating into ectoderm, mesoderm and endoderm, that was induced from an undifferentiated stem cell present in a human postnatal tissue in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation.
2. The human pluripotent stem cell according to claim 1 induced from an undifferentiated stem cell present in a human postnatal tissue, wherein said undifferentiated stem cell present in the human postnatal tissue was subjected to a primary culture or a second subculture, or a subculture in a low serum concentration.
3. The human pluripotent stem cell according to claim 1 induced by the forced expression of each of three genes of Oct3/4, Sox2 and Klf4 in an undifferentiated stem cell present in a human postnatal tissue, wherein said undifferentiated stem cell present in the human postnatal tissue was subjected to a primary culture or a second subculture or to a subculture in a low serum concentration.
4. The human pluripotent stem cell according to claim 1 induced by the forced expression of each of four genes of Oct3/4, Sox2, Klf4 and c-Myc in an undifferentiated stem cell present in a human postnatal tissue, wherein said undifferentiated stem cell present in the human postnatal tissue was subjected to a primary culture or a second subculture or to a subculture in a low serum concentration.
5. The human pluripotent stem cell according to claim 1 induced by combining the forced expression of each of three genes of Oct3/4, Sox2 and Klf4 and a histone deacetylase inhibitor treatment in an undifferentiated stem cell present in a human postnatal tissue, wherein said undifferentiated stem cell present in the human postnatal tissue was subjected to a primary culture or a second subculture or to a subculture in a low serum concentration.
6. The human pluripotent stem cell according to claim 1 induced by combining the forced expression of each of three genes of Oct3/4, Sox2 and Klf4 and a MS-275 treatment in an undifferentiated stem cell present in a human postnatal tissue, wherein said undifferentiated stem cell present in the human postnatal tissue was subjected to a primary culture or a second subculture or to a subculture in a low serum concentration.
7. The human pluripotent stem cell according to any one of claims 2 to 6 wherein FGF-2 is further used in the culture of said undifferentiated stem cell.
8. The human pluripotent stem cell according to any one of claims 2 to 6 wherein PDGF and FGF are further used in the culture of said undifferentiated stem cell.
9. The human pluripotent stem cell according to any one of claims 2 to 8 wherein the culture of said undifferentiated stem cell is further conducted in a lower density.
10. The human pluripotent stem cell according to any one of claims 1 to 9 wherein said human pluripotent stem cell is positive for Nanog.
11. The human pluripotent stem cell according to any one of claims 1 to 10 wherein said human pluripotent stem cell is positive for alkaline phosphatase staining.
12. The human pluripotent stem cell according to any one of claims 1 to 11 wherein said human pluripotent stem cell is positive for Tert.
13. The human pluripotent stem cell according to any one of claims 1 to 12 wherein said human pluripotent stem cell comes to have teratoma-forming potential when it is transplanted into a test animal.
14. The human pluripotent stem cell according to any one of claims 1 to 13 wherein said human postnatal tissue is a tissue immediately after birth.
15. The human pluripotent stem cell according to any one of claims 1 to 13 wherein said human postnatal tissue is a tissue immediately after birth and is a tissue derived from a neonatal tissue or an umbilical cord tissue.
16. The human pluripotent stem cell according to any one of claims 1 to 13 wherein said human postnatal tissue is a tissue immediately after birth and is a tissue derived from a neonatal skin or a blood vessel derived from the umbilical cord.
17. The human pluripotent stem cell according to any one of claims 1 to 16 wherein said human pluripotent stem cell further has an in vitro potential of differentiating into a primordial germ cell.
18. An undifferentiated stem cell present in a human postnatal tissue, in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation and which can be induced into a human pluripotent stem cell having an in vitro long-term self-renewal ability and the pluripotency of differentiating into ectoderm, mesoderm and endoderm by the forced expression of each of three genes of Oct3/4, Sox2 and Klf4.
19. An undifferentiated stem cell present in a human postnatal tissue, in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation and which can be induced into a human pluripotent stem cell having an in vitro long-term self-renewal ability and the pluripotency of differentiating into ectoderm, mesoderm and endoderm by the forced expression of each of four genes of Oct3/4, Sox2, Klf4 and c-Myc.
20. An undifferentiated stem cell present in a human postnatal tissue, in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation and which can be induced into a human pluripotent stem cell having an in vitro long-term self-renewal ability and the pluripotency of differentiating into ectoderm, mesoderm and endoderm by combining the forced expression of each of three genes of Oct3/4, Sox2 and Klf4 and a histone deacetylase inhibitor treatment.
21. An undifferentiated stem cell present in a human postnatal tissue, in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation and which can be induced into a human pluripotent stem cell having an in vitro long-term self-renewal ability and the pluripotency of differentiating into ectoderm, mesoderm and endoderm by combining the forced expression of each of three genes of Oct3/4, Sox2 and Klf4 and a MS-275 treatment.
22. The undifferentiated stem cell present in a human postnatal tissue according to any one of claims 18 to 21, wherein said human postnatal tissue is a tissue immediately after birth.
23. The undifferentiated stem cell present in a human postnatal tissue according to any one of claims 18 to 21, wherein said human postnatal tissue is a tissue immediately after birth and is a tissue derived from a neonatal tissue or an umbilical cord tissue.
24. The undifferentiated stem cell present in a human postnatal tissue according to any one of claims 18 to 21, wherein said human postnatal tissue is a tissue immediately after birth and is a tissue derived from a neonatal skin or a blood vessel of the umbilical cord.
25. The undifferentiated stem cell present in a human postnatal tissue according to any one of claims 18 to 24, wherein said human pluripotent stem cell further has an in vitro potential of differentiating into a primordial germ cell.
26. A method of inducing a human pluripotent stem cell wherein an undifferentiated stem cell present in a human postnatal tissue, in which each gene of Tert, Nanog, Oct3/4 and Sox2 has not undergone epigenetic inactivation, is subjected to a primary culture or a second subculture or to a third or fourth subculture in a low serum concentration at 0 to 5%, and then each of three genes of Oct3/4, Sox2 and Klf4 is subjected to forced expression.
27. The method of inducing a human pluripotent stem cell according to claim 26, wherein each of four genes comprising each of three genes of Oct3/4, Sox2 and Klf4 plus c-MYc is subjected to forced expression.
28. The method of inducing a human pluripotent stem cell according to claim 26, wherein the forced expression of each of three genes of Oct3/4, Sox2 and Klf4 is combined with a histone deacetylase inhibitor treatment.
29. The method of inducing a human pluripotent stem cell according to claim 26, wherein the forced expression of each of three genes of Oct3/4, Sox2 and Klf4 is combined with a MS-275 treatment.
30. The method of inducing a human pluripotent stem cell according to any one of claims 26 to 29, wherein said undifferentiated stem cell is cultured in the presence of FGF-2.
31. The method of inducing a human pluripotent stem cell according to any one of claims 26 to 29, wherein said undifferentiated stem cell is cultured in the presence of PDGF and EGF
32. The method of inducing a human pluripotent stem cell according to any one of claims 26 to 31, wherein said human postnatal tissue is a tissue immediately after birth.
33. The method of inducing a human pluripotent stem cell according to any one of claims 26 to 31, wherein said human postnatal tissue is a tissue immediately after birth and is a tissue derived from a neonatal tissue or an umbilical cord tissue.
34. The method of inducing a human pluripotent stem cell according to any one of claims 26 to 31, wherein said human postnatal tissue is a tissue immediately after birth and is a tissue derived from a neonatal skin or a blood vessel of the umbilical cord.
35. A method of culturing a human pluripotent stem cell according to any one of claims 1 to 17 in a culture medium comprising an inhibitor of Rho associated kinase as an active ingredient.
36. The human pluripotent stem cell according to anyone of claims 1 to 17 on which cell surface antigens SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, CD9, CD24, and CD90 are expressed.