Patent application title:

Compositions and Methods for Treatment of Neoplastic Disease

Publication number:

US20110059901A1

Publication date:
Application number:

12/860,699

Filed date:

2010-08-20

Abstract:

The present invention comprises compositions and methods for treating a tumor or neoplastic disease in a host, The methods employ conjugates comprising superantigen polypeptides or nucleic acids with other structures that preferentially bind to tumor cells and are capable of inducing apoptosis. Also provided are superantigen-glycolipid conjugates and vesicles that are loaded onto antigen presenting cells to activate both T cells and NKT cells. Cell-based vaccines comprise tumor cells engineered to express a superantigen along with glycolipids products which, when expressed, render the cells capable of eliciting an effective anti-tumor immune response in a mammal into which these cells are introduced. Included among these compositions are tumor cells, hybrid cells of tumor cells and accessory cells, preferably dendritic cells. Also provided are T cells and NKT cells activated by the above compositions that can be administered for adoptive immunotherapy.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C07K14/31 »  CPC main

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F) from Staphylococcus (G)

A61K39/0011 »  CPC further

Medicinal preparations containing antigens or antibodies; Vertebrate antigens Cancer antigens

A61K48/005 »  CPC further

Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered

C07K14/3156 »  CPC further

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci from Streptococcus pneumoniae (Pneumococcus)

C07K14/70503 »  CPC further

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans; Receptors; Cell surface antigens; Cell surface determinants Immunoglobulin superfamily

C07K14/7156 »  CPC further

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans; Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for interferons [IFN]

A61K2039/5156 »  CPC further

Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA; Animal cells expressing foreign proteins

A61K2039/55544 »  CPC further

Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant; Organic adjuvants Bacterial toxins

C07K2319/33 »  CPC further

Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies

A61K38/16 IPC

Medicinal preparations containing peptides Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof

A61P35/00 »  CPC further

Antineoplastic agents

Description

CROSS REFERENCE TO RELATED APPLICATIONS

The instant application is a Continuation of divisional application Ser. No. 12/145,949, filed on Jun. 25, 2008, which is a divisional of application Ser. No. 10/937,758, filed Sep. 8, 2004 and abandoned, which is a continuation of application Ser. No. 09/650,884, filed on Aug. 30, 2000 and abandoned, which claims priority to provisional application No. 60/151,470, filed on Aug. 30, 1999. All of these applications are incorporated herein in their entirety by reference.

FIELD OF INVENTION

The invention relates generally to immunotherapeutic compositions and methods for treating tumors and cancer. The methods are based on the expression of superantigen (“SAg”) alone or in combination with other molecules in transfected host cells (tumor cells, accessory cells or lymphocytes). Other therapeutic methods are based on administering T cells which are activated by cells engineered to express SAg and other immunostimulatory molecules and structures.

BACKGROUND

Therapy of the neoplastic diseases has largely involved the use of chemotherapeutic agents, radiation, and surgery. However, results with these measures, while beneficial in some tumors, has had only marginal effects in many patients and little or no effect in many others, while demonstrating unacceptable toxicity. Hence, there has been a quest for newer modalities to treat neoplastic diseases.

In 1980, tumoricidal effects were demonstrated in four of five patients with advanced breast cancer treated with autologous plasma that had been perfused over columns in which Staphylococcal Protein A was chemically attached to a solid surface (Terman et al., New Eng. J. Med., 305:1195 (1981)). While the initial observations of tumor killing effects with the immobilized Protein A perfusion system have been confirmed, some have obtained inconsistent results.

The explanation of these inconsistencies appears to be as follows. First, commercial Protein A is an impure preparation, as evident from polyacrylamide gel electrophoresis and radioimmunoassays that detected Staphylococcal enterotoxins in the preparations. Second, various methods of immobilizing Protein A to solid supports have been used, sometimes resulting in loss of biological activity of the perfusion system. Third, the plasma used for perfusion over immobilized Protein A has often been stored and treated in different ways, also resulting in occasional inactivation of the system. Moreover, the substance(s) or factors responsible for the anti-tumor effect of this extremely complex perfusion system have not been previously defined. The system contained an enormous number of biologically active materials, including the Protein A itself, Staphylococcal proteases, nucleases, exotoxins, enterotoxins and leukocidin, as well as the solid support and coating materials. In addition, several anaphylatoxins were generated in plasma after contact with immobilized Protein A. Finally, it was speculated that the biological activity of the system was due to the removal from the plasma by the Protein A of immunosuppressive immune complexes that otherwise inhibit the patient's antitumor immune response.

The Staphylococcal enterotoxins that contaminate the Protein A columns are a family of extracellular products of Staphylococcal aureus that belong to a well recognized group of proteins that have common physical and chemical properties. The enterotoxins produce a number of characteristic effects in humans and animals, such as emesis, hypotension, fever, chills, and shock in primates and enhancement of gram negative endotoxic lethality in rabbits. At least some of these effects are due to the ability of these proteins to act as extremely potent T cell mitogens.

Staphylococcal enterotoxins are representative of a family of molecules known as SAgs which are the most powerful T cell mitogens known. They are capable of activating 5 to 30% or the total T cell population compared to 0.01% for conventional antigens. Moreover, the enterotoxins elicit strong polyclonal proliferation at concentrations 10.sup.3-fold lower than conventional T cell mitogens. The most potent enterotoxin, Staphylococcal enterotoxin A (SEA), has been shown to stimulate DNA synthesis in human T cells at concentrations of as low as 10.sup.-13 to 10.sup.-16M. Enterotoxin-activated T cells produce a variety of cytokines, including IFN, various interleukins and TNF. Enterotoxins stimulate several other cell populations involved in innate and adaptive immunity which also play a major role in anti-tumor immunity, For example, enterotoxins engage the variable region of the TCR chain on exposed face of the pleated sheet and the sides of the MHC class II molecule.

The SAg is capable of augmenting the TH-1 cytokine response by CD4+ cells r while also activating NKT and NK cells. NK cell cytotoxicity is augmented by IFN produced by SAg activated T cells. NKT cells are known to be activated by SAgs, peptides, -galactosylceramides and lipoarabinomannans presented on CD1 receptors. Evidence points to an invariant lectin like recognition unit on the NKT cell chain as a specific ligand for galactosylceramide determinants on tumor cells. SAgs induce tumor killing in vivo when given alone or conjugated to tumor associated antibodies. They are also effective when employed ex vivo to produce tumor sensitized T cells for the adoptive therapy of MCA 205/207 tumors. SAg transfected tumor cells have shown a capacity to reduce metastatic disease in a murine mammary carcinoma model.

In addition to these common biological activities, the Staphylococcal enterotoxins share common physicochemical properties. They are heat stable, trypsin resistant, and soluble in water and salt solutions. Furthermore, the Staphylococcal enterotoxins have similar sedimentation coefficients, diffusion constants, partial specific volumes, isoelectric points, and extinction coefficients. The Staphylococcal enterotoxins have been divided into five serological types designated SEA, Staphylococcal enterotoxin B (SEB), Staphylococcal enterotoxin C (SEC), Staphylococcal enterotoxin D (SED), and Staphylococcal enterotoxin E (SEE), which exhibit striking structural similarities. The enterotoxins are composed of a single polypeptide chain of about 30 kilodaltons (kD). All staphylococcal enterotoxins have a characteristic disulfide loop near the middle of the molecule. SEA is a flat monomer consisting or 233 amino acid residues divided into two domains. Domain I comprises residues 31-116 and domain II of residues 117-233 together with the amino tail 1-30. In addition, the biologically active regions of the proteins are conserved and show a high degree of homology. One region of striking amino acid sequence homology between SEA, SEB, SEC, SED, and SEE is located immediately downstream (toward the carboxy terminus) from the cysteine located at residue 106 in SEA. This region is thought to be responsible for T cell activation. A second homologous region that begins at residue 147 and extends downstream is highly conserved. This region is believed to mediate emetic activity. The region related to emetic activity can be omitted from enterotoxins used as therapeutics.

A sequence analysis of the Staphylococcal enterotoxins with other toxins has revealed SEA, SEB, SEC, SED, Staphylococcal toxic shock-associated toxin (TSST-1 also known as SEF), and the Streptococcal exotoxins share considerable nucleic acid and amino acid sequence homology. The enterotoxins belong to a common generic group of proteins thought to be evolutionarily related.

Enterotoxins bind to MHC Class II molecules and the T cell receptor (“TCR”) in a manner quite distinct from conventional antigens. Enterotoxins engage the variable region of the TCR Vβ chain on an exposed face of the β-pleated sheet and the sides of the MHC Class II molecule, rather than engaging the groove of the Class II molecule like conventional antigens. In contrast to SEB and the SEC, which have only the capacity to bind to the MHC class II alpha chain, SEA, as well as SEE and SED, in a zinc dependent manner, also interacts with the MHC class II β chain. T cell recognition is based on the presence of the Vβ chain and is therefore independent of other TCR components and diversity elements. Single amino acid positions and regions important for SAg-TCR interactions have been defined. These residues are located in the vicinity of the shallow cavity formed between the two domains. The alanine substitution of amino acid residue Asn23 in SEB has demonstrated the importance of this residue in SEB/TCR interaction. This particular residue is conserved among all of the Staphylococcal enterotoxins and may constitute a common anchor position for enterotoxin interaction with TCR Vβ chains. Amino acid residues in positions 60-64 have also been shown to contribute to the TCR interaction as do the cysteine residues forming the intermolecular disulfide bridge of SEA. For SEC2 and SEC3, the key points of interaction in the Vβ chain are located in the CDR1, CDR2 and HRV4 TCR Vβ-3 chain. Hence, multiple and highly variable parts of the Vβ chain contribute to the formation of the enterotoxin binding site on the TCR. Thus far, a single and linear consensus motif in the TCR Vβ displaying a high affinity interaction with particular enterotoxins has not been identified. A significant contribution of the TCR alpha chain in enterotoxin-TCR recognition is acknowledged as well as MHC class II isotypes. This distinctive binding mechanism of enterotoxins which bypasses the highly variable parts of the MHC class II and TCR molecules allows them to activate a high frequency or T cells with massive lymphoproliferation, cytokine induction and cytotoxic T cell generation. These properties are shared by other proteins made by infectious agents. Together, these proteins form a well recognized group known as SAgs.

There are two general classes of SAgs. The first includes minor lymphocyte stimulating (MLS) antigens. The second class of SAgs includes mycoplasmal, viral, and bacterial proteins such as the Staphylococcal enterotoxins, Streptococcal exotoxins. All SAgs have the following properties. T cell activation does not require antigen processing. There is no MHC restriction of responding T cells. SAgs bind to and evoke responses from all T cells expressing Vβ receptors, without requiring other TCR or diversity elements. CD4-CD8-α/β T cells and γ/δ T cells are also capable of responding to SAgs. The SAgs induce a biochemically distinct T cell activation pathway. Thus, SAgs interact with and activate a much larger proportion of T cells than conventional antigens, causing massive lymphoproliferation, cytotoxic T cell generation, and cytokine secretion. A given SAg can activate up to 30% of resting T cells compared to 0.01% for conventional antigens. As highly representative members of this family of SAgs, the enterotoxins share these characteristics.

The present invention features the use of SAgs in association with molecules to produce tumor killing effects. The SAgs are useful in peptide form and may combine with another peptide or nucleic acid to form a conjugate. The effect of the combined molecules is synergistic. These conjugates are useful when administered as a preventative or therapeutic antitumor vaccine in tumor bearing patients. Alternatively, they may be used ex vivo to load an antigen presenting cell as a means of immunizing a T or NKT cell population for use in adoptive therapy of cancer. Examples of such conjugates are complexes between: SAg and glycosylceramide; SAg and apolipoproteins (Lp(a)), SAg and oxyLDL, SAg and verotoxins, SAg and GPI-ceramide (with phytosphingosine backbone), SAg and lipopolysaccharide (LPS), SAg and peptidoglycan, SAg and mannan proteoglycan, SAg and muramic acid, SAg and tumor peptides. Also intended are SAg and Gal conjugates and glycosylated SAgs.

The present invention features the use of SAg in association or conjugated to oxidized low density lipoproteins (oxyLDL) and apolipoproteins (e.g., lipoprotein (a) (Lp(a)). OxyLDL and its byproducts bind to receptors on sinusoidal endothelial cells in the tumor microcirculation where they induce apoptosis, increase levels of tissue factor and activated thrombin, upregulate achesion molecules and produce a prothrombotic state. Lp(a) is densely deposited in tumor microcirculation and as a competitive inhibitor of plasminogen is prothrombotic. Hence, both apolipoproteins and oxyLDL not only home to receptors on the tumor microcirculation but they also induce endothelial cell or macrophage apoptosis as well as a prothrombotic state. These local effects are amplified by the presence of the conjugated superantigen which induce a localized T cell immune and inflammatory response collectively resulting in a potent anti-tumor response.

The present invention also features the use of the SAg in association or conjugated to verotoxins. The latter molecules have the capacity to bind to galactosylceramide receptors on tumor cells and induce apoptosis. Hence, the tumor targeting and apoptosis inducing functions of the verotoxin are coupled with the T cell immune and inflammatory response induced by the SAgs to produce a potent and well localized anti-tumor response.

The present invention features the use of SAgs in association or conjugated to mono or digalactosylceramides. The latter have been isolated from marine sponge Aegelus mauritanius and is expressed in certain bacteria such as Sphingomonas paucimobilis. They have been shown to activate NKT cells and to induce anti-tumor effects in vivo against several types of tumors. The activation of NKT cells in the presence of the mono and digalactosylceramides appears to be IL-12 dependent. The biological activity of the -galactosylceramides is observed in both mono and digalactosylceramide forms and is dependent upon the presence of an anomeric configuration on the terminal galactose. The lengths of the sphingosine base and fatty acyl chains of 23 and 15 respectively also appear to be optimal for production of the anti-tumor effects.

SAgs are known to be the most powerful T cell mitogens known and have been shown to produce anti-tumor effects in several animal models. The -galactosylceramides are known to be potent inducers of NKT cell activation which have been shown to produce an anti-tumor effect in an IL-12 dependent manner. In the present invention SAgs are combined with -galactosylceramides biochemically as conjugates and genetically within a cell which expresses the newly synthesized protein-bound galactosylceramide on the cell surface. The newly synthesized conjugates in native form or expressed in or on the cell produce a synergistic anti-tumor effect due to the activation of T cells and NKT cell populations.

SUMMARY OF THE INVENTION

The present invention comprises a method for treating cancer in a host comprising providing conjugates, fusion proteins or naked nucleic acids of superantigen and additonal molecule(s) which produce an tumoricidal response. The addtional molecule serves the following functions: 1) to target a receptor (digalactosylceramide) expressed on tumor cells in vivo and induce tumor cell apoptosis e.g., SAg-verotoxin conjugates. 2) to target receptors expressed on tumor sinusoidal endothelium, induce apoptosis and a prothrombotic state e.g. SAg-oxyLDL conjugates and SAg-Lp(a) conjugates 3) to activate a dormant population of tumoricidal NKT cells e.g. SAg-digalactosylceramides, SAg-GPI-digalactosylceramide (phytosphingosine) complexes. 4) target receptors for integrins expressed on tumor microvasculature e.g., SAg-RGD conjugates. 5) naked DNA administered intratumorally induces tumor cell expresson in vivo of receptors for ligands which produce apoptosis and inflammation e.g, naked DNA SAg-oxyLDL receptor, SAg-LOX-1 receptor, SAg-SREC receptor.

Compositions which mimic SAgs are used in place of native SAgs for in vivo administration in order to circumvent the problem of naturally occurring SAg-specific antibodies. The SAg mimics are largely comprised of nucleotides or oligonucleotide-peptide chimeric constructs which are specific for tumor cells expressing SAg receptors (via the nucleotide) while retaining their SAg specificity for the TCR (via the peptide). The class II binding site of the SAg may optionally be eliminated or mutated to minimize SAg peptide binding to MHC class II receptors in vivo. The molecule may be composed entirely of nucleotides for which there are no naturally occurring antibodies. In addition, carriers are provided for in vivo transfection of tumors by nucleic acids encoding SAgs or other nucleic acid constructs given in Table I. Phage displayed tumor neovasculature ligands may also carry nucleic acids encoding SAgs or other constructs.

The constructs and method are used to treat any solid tumor such as carcinoma, melanoma and sarcoma or cancer of hemopoietic origin, such as lymphomas and leukemias which may or may not form solid tumors.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art of this invention. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below.

All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Other features and advantages of the invention will be apparent from the following detailed description and from the claims.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention provides methods and materials for treating cancer related to the polypepide or nucleic acid conjugates or fusions comprising SAg with other molecules that synergize or cooperate with SAg in the induction of an anti-tumor response.

As used in this application, T cells are defined as any class of lymphocytes that undergo maturation and differentiation in the thymus. They include, but are not limited to NK cells, NKT cells and/T cells and may be known as cytotoxic, helper or suppressor T cells or they may be defined by the expression or type of CD or TCR present.

SAg-encoding nucleic acid can encode a mutant, variant, and/or modified form of a SAg.

These methods are used to treat any solid tumor such as carcinoma, melanoma, and sarcoma, or cancers of hematopoietic origin such as leukemia and lymphomas.

Provided herein are SAg oligonucleotide and oligonucleotide-peptide compositions capable of targeting and delivering SAgs to tumor sites in vivo without elimination by circulating naturally occurring SAg specific antibodies prevalent in the human cancer patients. Provided also are compositions and methods for delivery of therapeutic nucleic acid constructs to tumor sites in vivo using therapeutic genes carried by erythrocytes from patients with sickle cell anemia which have the unique capability of adhering to sites on tumor neovasculature.

1. Cancer

This invention is used to treat any type of cancer in a host at any stage of the disease. More particularly, the cancer is a solid tumor such as a carcinoma, melanoma, or sarcoma. This invention is used to treat cancers of hemopoietic origin such as leukemia or lymphoma, that involve solid tumors. A host is any animal that develops cancer and has an immune system such as mammals. Thus, humans are considered hosts within the scope of the invention. Since the invention provides SAg-transfected cells as a vaccine, a cancer is one that a host is likely to develop based on family history or other criteria. In this case, the host is one that is susceptible to cancer.

2. Nucleic Acid

The term nucleic acid as used herein encompasses both RNA and DNA, including cDNA, genomic DNA, and synthetic (e.g., chemically synthesized) DNA. The nucleic acid can be double-stranded or single-stranded. Where single-stranded, the nucleic acid can be the sense strand or the antisense strand. The term isolated nucleic acid means that the nucleic acid is not immediately contiguous with both of the sequences with which it is immediately contiguous (one on the 5′ end and one on the 3′ end) in the naturally occurring genome of the organism from which it is derived. For example, an isolated nucleic acid molecule can be, without limitation, a recombinant DNA molecule of any length, provided nucleic acid sequences normally found immediately flanking that recombinant DNA molecule in a naturally occurring genome are removed or absent. Thus, an isolated nucleic acid molecule includes, without limitation, a recombinant DNA that exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other sequences as well as recombinant DNA that is incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, adenovirus, or herpes virus), or into the genomic DNA of a prokaryote or eukaryote. In addition, an isolated nucleic acid can include a recombinant DNA molecule that is part of a hybrid or fusion nucleic acid sequence.

Naked nucleic acid is administered to a host. For example, naked pharmaceutical-grade plasmid DNA are injected into a host intramuscularly such that it is expressed by host cells (U.S. Pat. Nos. 5,589,466; 5,580,599; 5,264,618; 5,459,127; and 5,561,064). In addition, cationic lipids are used to deliver biologically active molecules, such as oligonucleotides to host cells in vivo (U.S. Pat. Nos. 5,264,618, 5,459,127, and 5,561,064).

Our previous patent applications which are hereby incorporated by reference include U.S. patent application Ser. No. 07/416,530, filed Oct. 3, 1989, U.S. patent application Ser. No. 07/466,577, filed Jan. 17, 1990, U.S. patent application Ser. No. 07/891,718, filed Jun. 1, 1992, U.S. patent application Ser. No. 08/025,144, filed Mar. 2, 1993, U.S. patent application Ser. No. 08/189,424, filed Jan. 31, 1994, U.S. patent application Ser. No. 08/491,746, filed Jun. 19, 1995, PCT applications PCT/US91/00342, and PCT/US94/02339. These applications have given comprehensive description of the SAg genes, the creation of high enterotoxin producing mutant strains as well as recombinant methods of production of SAgs. In addition, methods of treating cancer by transfecting tumor cells in vivo and in vitro with SAg nucleotides using well defined recombinant technology have been described in these applications. Subsequently, Dow et al., (J. Clin. Invest. 99: 2616-2624 (1997)) described in vitro and in vivo transfection of eukaryotic cells with SAg DNA which was capable of inducing inflammatory responses in vivo. It is noted that the SAg genes have been cloned and their sequences delineated before 1988 and methods used to transfect cells in vivo or in vitro with nucleic acids encoding polypeptides are also well known in the art.

3. Transfection This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.

4. Constructs

Tumor cells are transfected with various nucleic acids which are designed to increase their immunogenicity and to provide them with capacity to traffic to metastatic sites where they may initiate a potent inflammatory and immune response. Such constructs of this invention can be linear or circular nucleic acids obtained from mammals or bacteria that encode a polypeptide such as a SAg, mutant SAg, erythrogenic toxin. In one embodiment, SAgs as well as SAg receptors are engineered to remain anchored to the surface of transfected cells when the cell is to be used for immunization. Likewise, when a SAg receptor gene is transfected into anergized T cells from cancer patients, it is desirable to express the receptor on the cell surface so that they are readily recognized and activated by exogenous receptor bound SAg. In contrast, when it is desirable to use SAg transfected cells to activate T cells in vivo or ex vivo or to promote trafficking of transfected tumor cells to metastatic sites in vivo, it is suitable for the SAg to be secreted from the transfected cells.

A vector, plasmid, or virus that directs the expression of a polypeptide such as a SAg can include other nucleic acid sequences such as, for example, nucleic acid sequences that encode a signal sequence or an amplifiable gene. Signal sequences are well known in the art and can be selected and operatively linked to a polypeptide encoding sequence such that the signal sequence directs the secretion of the polypeptide from a cell. An amplifiable gene (e.g., the dihydrofolate reductase [DHFR] gene) in an expression vector can allow for selection of host cells containing multiple copies of the transfected nucleic acid.

Standard molecular biology techniques are used to construct, propagate, and express the nucleic acid, nucleic acid constructs, vectors, plasmids, and viruses of the invention ((Sambrook, J. et al., supra; Maniatis et al., Molecular Cloning (1988); and U.S. Pat. No. 5,364,934. For example, prokaryotic cells (e.g., E. coli, Bacillus, Pseudomonas, and other bacteria), yeast, fungal cells, insect cells, plant cells, phage, and higher eukaryotic cells such as Chinese hamster ovary cells, COS cells, and other mammalian cells can be used.

Constructs are used in vivo or ex vivo or in combination as in Example 5-7, 16-23. They are used to immunize a host by direct in vivo administration or they are used ex vivo to activate T cells or NKT cells to become tumor specific effector cells which are employed for adoptive immunotherapy of cancer by methods and models (Examples 7, 16, 19-23).

TABLE I
Therapeutic Constructs and Preferred Conditions Of Use
I. CELLS: Tumor Cells, DCs or DC/Tumor Cell Hybrids (DC/tc)
USE: In vivo and Ex vivo
PURPOSE
A. In Vivo Preventative or Therapeutic Vaccine (Established Tumor)
Accomplish by transfecting or co-transfecting with nucleic acid encoding superantigen plus one or more of
the following:
 1. Superantigens
 2. Enzyme that modifies carbohydrate to induce Gal or GalCer epitope expression
 3. Functional hyaluronidase from microbial or human sources
 4. Staphylococcal or streptococcal erythrogenic toxin
 5. Staphylococcal protein a or a domain thereof
 6. Staphylococcal hemolysin and functional microbial toxins
 7. Functional microbial or human coagulase
 8. Costimulatory protein
 9. Chemoattractants
10. Chemokines
11. Nucleic acids encoding biosynthesis of lipopolysaccharides
12. Nucleic acids encoding biosynthesis of glycosylceramides
13. Nucleic acids encoding biosynthesis of microbial membrane or capsular lipoproteins and
polysaccharides
14. Oncogenes, amplified oncogenes and transcription factors
15. Angiogenic factors and receptors
16. Tumor growth factor receptors
17. Tumor suppressor receptors
18. Cell cycle proteins
19. Heat-shock proteins, ATPases and G proteins
20. Proteins engaged in antigen processing, sorting and intracellular trafficking
21. Inducible nitric oxide synthase (iNOS)
22. apolipoproteins (e,g,. Lp(a)) transfected into tumor cells & sickled erythrocytes used for targeting
tumor microvasculature
23. LDL and oxyLDL receptors (e.g., SCEP receptor) transfected into tumor cells and sickled
erythrocytes & used for targeting to tumor microvasculature
B. Ex Vivo Immunization of T and/or NKT cells to Produce Tumor Specific Effector Cells (for
Adoptive Immunotherapy)*
Accomplish by (i) transfecting or co-transfecting tumor or accessory cells with nucleic acid encoding
the following, or (ii) providing immobilized molecules or receptors that present the following:
 1. Superantigen
 2. Superantigen receptor and transcription factor with bound superantigen
 3. CD1 receptor binding and/or expressing superantigen-glycosyl ceramide complex
 4. CD14 receptor binding or expressing superantigen-lipopolysaccharide or superantigen-
peptidoglycan complex
 5. Mannose receptor binding glycosylated superantigen
 6. Glycophorin receptor
 7. Superantigen-tumor peptide(s) complex on MHC or CD1-bearing APC in soluble or immobilized
form
C. Therapeutic Molecules or Complex Applied to Transfected or Untransfected Tumor cells or
Accessory Cells; or MHC class I, class II, CD1, Superantigen receptor or CD14 receptor:
 1. Superantigen (wherein cell may express Gal)
 2. Glycosylated superantigen
 3. Superantigen complex with
a. glycosyl ceramide
b. lipopolysaccharide
c. peptidoglycan
d. mannan proteoglycan
e. muramic acid
f. tumor peptide
g. glycosylceramides with terminal Gal(α1-4)Gal
e.g. globotriosylceramide and galabiosylceramide
h. Conjugates of SAg-(Gb2 or Gb3 or Gb4)
i. Conjugates of SAg -(Gb2 or Gb3 or Gb4)-CD1
j. GPI anchored conjugates: SAg-GPI-(Gb2 or Gb3 or Gb4)
l. GPI anchored conjugates: SAg-GPI-(Gb2 or Gb3 or Gb4)-CD1
m. Conjugates of SAg polypeptide or nucleic acid with Verotoxin
n. Conjugates of SAg Polypeptide or nucleic acid with Verotoxin A or B
subunit
o. Conjugates of SAg polypeptide or nucleic acid with IFNα receptor
peptides homologous to verotoxin
p. Conjugates of SAg polypeptide or nucleic acid with CD19 peptides
homologous to verotoxin
q. Conjugates of SAg polypeptide or nucleic acid with Arg-Gly-Asp or Asn-
Gly-Arg
r. Conjugates of SAg polypeptide or nucleic acid with LDL, VLDL, HDL
s. Conjugates of SAg polypeptide or nucleic acid with Apolipoproteins (e.g.,
Lp(a), apoB-100, apoB-48, apoE)
t. Conjugates of SAg polypeptide or nucleic acid with oxyLDL,
oxyLDL mimics, (e.g., 7β-hydroperoxycholesterol, 7β-
hydroxycholesterol, 7-ketocholesterol, 5α-6α-epoxycholesterol,
7β-hydroperoxy-choles-5-en-3β-ol, 4-hydroxynonenal (4-HNE), 9-
HODE, 13-HODE and cholesterol-9-HODE)
u. Conjugates of SAg polypeptide or nucleic acid with oxyLDL by
products (e.g. lysolecithin, lysophosphatidylcholine,
malondialdehyde, 4-hydroxynonenal)
v. LDL and oxyLDL receptors (e.g., LDL oxyLDL, acetyl-LDL,
VLDL, LRP, CD36, SREC, LOX-1, macrophage scavenger
receptors) as polypeptide or nucleic acid alone or with SAg
polypeptide or nucleic acid intratumorally
II. CELLS: Specialized Tumor Specific Effector Cells (T and/or NKT Cells)
USE: Adoptive Immunotherapy In Vivo
PURPOSE:
A. CD44 Expression on T cells or NKT
Accomplished by: (i) Superantigen stimulation; and/or (ii) transfection with nucleic acid encoding CD44
and/or (iii) transfection with nucleic acid encoding glycosyltransferase
B. Chimeric TCR with:
Invariant a chain site for binding GalCer and
Vβ chain site for binding superantigen
C. Dual TCR Vβ chains with sites for superantigen binding
D. T cells or NKT cells with overexpressed Vb region specific for a given superantigen
E. T cells or NKT cells with lowered signal transduction threshold
III. MOLECULES: Superantigen mimics
USE: In Vivo Administration
A. Superantigen receptor-binding oligonucleotides
B. Superantigen oligonucleotide-peptide conjugate
Oligonucleotide is specific for superantigen receptor on tumor cells
Peptide has deleted class II binding site and intact TCR binding site
C. Phage displayed integrin ligand on tumor neovasculature - carrier for superantigen-encoding
nucleic acid.
IV. CARRIERS: for nucleic acid encoding superantigen
USE Transfection of Tumors In vivo
A. Sickled erythrocytes that target tumor neovasculature
B. Phage displayed tumor neovascular integrin and superantigen receptor carrying superantigen
nucleic acids
V. CARRIERS: constructed to co-express superantigen conjugates or complexes with:
Glycosylceramide
αGal
Lipopolysaccharides
Peptidoglycans
USE Transfection of Tumor Cells and/or DCs and/or DC/tc's - in vivo or ex vivo.
A. Liposomes
B. Proteosomes

TABLE II
Nucleic Acid Constructs and Cells
Gene or Gene Product Cells transformed Reference or Source
1. SAg Tumor [See text]
(SEQ ID NOS: 1-2)
2. Enterotoxin Tumor [See text]
(SEQ ID NOS 3-12)
3. SAg receptor Tumor [See text]
(SEQ ID NOS 1-2)
4. Enterotoxin receptor Tumor [See text]
(SEQ ID NOS 3-12)
5. CD1 receptor(s) Tumor Martin L H et al., Proc. Natl.
(SEQ ID NO 13-14) Acad. Sci. 83: 9154-9158 (1986)
6. CD14 receptor Tumor Ferrero, E et al., J. Immunol. 145:
(SEQ ID NOS 15-16) 331-336 (1990)
7. CD44 encoding nucleic acids T or NKT Nottenburg, C et al. Proc. Natl.
(SEQ ID NO 17) Acad. Sci. 66: 8521-88525 (1992)
8. Carbohydrate modifying enzymes Tumor, Sheng, Y et al. Int. J. Cancer 73:
(SEQ ID: NO 18) T or NKT 850-858 (1997)
9. TCR Vβ chain Tumor Tillinghast, J P et al., Science 233:
(SEQ NOS 19-20) 879-883 (1986)
10. Staph/Strep hyaluronidase Tumor Hynes W L et al., Infect. Immun., 63:
(SEQ NOS: 21-22) 3015-3020 (1995)
11. Staph/Strep erythrogenic toxin Tumor McShan W M, et al., Adv. Exp. Med.
(SEQ NOS 23-24) Biol. 418: 971-973 (1997)
12. Staphylococcal β-hemolysin Tumor Projan S J et al., Nucleic Acid Res.
(SEQ NOS: 25-26) 3305-3309 (1989)
13. Strep capsular polysaccharide Tumor Lin, W S et al., J. Bacteriol. 176:
(SEQ NOS: 27-28) 7005-7016 (1994)
14. Staph staphylocoagulase Tumor Kaida S. et al., J. Biochemistry 102:
(SEQ NOS 29-30) 1177-1186 (1987)
15. Staph Protein A Tumor Shuttleworth, H L et al., Gene 58:
(SEQ NOS: 31-32) 283-295 (1987)
16. Staph Protein A domain D Tumor Roben, P W et al., J. Immunol. 154:
(SEQ NOS: 33-34) 6347-6445 (1995)
17. Staph Protein A Domain B Tumor Gouda, H et al., Biochemistry, 31:
(SEQ NO: 35) 9665-9672 (1992)
18. Immunostimulatory protein Tumor, Tokunaga, T et al., Microbiol. Immunol. 36:
T or NKT 55-66, (1992)
19. Costimulatory protein Tumor Entage, P C et al., J. Immunol. 160:
2531-2538 (1998)
20. SAg-mimicking nucleic acid T or NKT
21. Glycophorin Tumor Siebert, P D. et al., Proc. Natl.
(SEQ NOS: 36-37) Acad. Sci. USA 83 1665-1669 (1986)
22. Mannose receptor Tumor Kim S J. et al., Genomics 14:
(SEQ ID NOS 38-39) 721-727 (1992)
23. Angiostatin Tumor Cao, Y. et al., J. Clin. Invest 101:
(SEQ ID NO: 40) 1055-1063 (1998)
24. Chemoattractant Tumor Ames, R S. et al., J. Biol. Chem. 271:
(SEQ ID NOS: 41-42) 20231- 20234 (1996)
25. Chemokine Tumor Nagira, M et al., J. Biol. Chem. 272:
(SEQ ID NOS 43-44) 19518- 19524 (1997)
26. Transcription factor Tumor, Schwab M et al., Mol. Cell Biol. 6:
(SEQ ID NO 45) T or NKT 2752-2758 (1986)
27. Transcription factor-binding Tumor,
nucleic acid T or NKT
28. SAg/peptide conjugate Tumor
29. Glyco-SAg Tumor
30. Staph. global regulator gene agr Tumor Balaban, N. et al., Proc. Natl.
(SEQ ID NO: 46-48) Acad. Sci. USA 92: 1619-1623 (1995)
31. Lipid A biosynthetic genes Tumor Schnaitman C A et al., ge lpxA-D
(SEQ ID NOS: 49-56) Microbiological Reviews 57: 655-682 (1993)
32. Mycobacterial mycolic acid Tumor Fernandes N D et al., Gene 170: 95-99
biosynthetic genes (1996); Mathur M et al., J. Biol. Chem.
(SEQ ID NOS: 57-58) 267: 19388-19395 (1992)
33. c-abl oncogene amplified in Tumor Scherle P A et al., Proc. Natl. Acad.
chronic myel. Leukemia Sci. USA 87: 1908 (1990); Heisterkamp
(SEQ ID NOS: 59-60) N et. al., Nature 344: 251-253 (1990)
34. erbB2 (HER2/neu) oncogene Tumor Schechter A L et al., Science 229: 976
(SEQ ID NOS: 61-62) (1985); Bargmann C L Nature 319: 226 (1986);
Hung M C et al., Proc. Natl. Acad Sci. 83:
261 (1986); Yamamoto T et al., Nature 319:
230 (1986)
35. IGF-1 receptor gene Tumor Abbott A M et al., J. Biol. Chem. 267:
(SEQ ID NOS: 63-64) 10759-10763 (1992); Scott J et al.,
Nature 317: 260-262 (1985); Liu J et al.,
Cell 75: 59-63 (1993)
36. VEGF Tumor Tischer E et al., J. Biol. Chem. 266:
(SEQ ID NOS: 65-66) 11947- 11954 (1991)
37. Strep emm-like gene family Tumor Kehoe M A, In: Cell-Wall Associated
Proteins in Gram-Positive Bacteria in
Bacterial Cell Wall, Ghuysen J M et
al., eds, Elsevier, Amsterdam, 1994
38. iNOS Tumor Xie Q W et al., Science 256:
(SEQ ID NOS 67-68) 225-228 (1992)
39. Apolipoproteins (e.g., Lp(a), Tumor [See Text]
apoB-100, apoB-48, apoE)
(SEQ ID NOS: 69-74)
40. LDL & oxyLDL receptors (e.g., Tumor [See Text]
LDL oxyLDL, acetyl-LDL, VLDL,
LRP, CD36, SREC, LOX-1
macrophage scavenger receptors)
SEQ ID NOS: (75-86)
SAg-encoding DNA is used alone or together with DNA encoding other cell surface moieties useful in generating antitumor immunity. Genes or their products are shown in column 1, source information is shown in column 3, preferred cells to be transformed, transfected or transduced with the DNA are shown in column 2. All of references are incorporated by reference in their entirety.

5. Superantigens (SAns)

SAgs are polypeptides that have the ability to stimulate large subsets of T cells. SAgs include Staphylococcal enterotoxins, Streptococcal pyrogenic exotoxins, Mycoplasma antigens, rabies antigens, mycobacteria antigens, EB viral antigens, minor lymphocyte stimulating antigen, mammary tumor virus antigen, heat shock proteins, stress peptides, and the like. Any SAg can be used as described herein, although, Staphylococcal enterotoxins such as SEA, SEB, SEC, and SED and streptococcal pyrogenic exotoxins such as toxic shock-associated toxin (TSST-1 also called SEF) are preferred.

When using enterotoxins, the region related to emetic activity can be omitted to minimize toxicity. In addition, SAgs can be derivatized to minimize toxicity. The level of toxicity may not be a concern when using SAg transfected cells to activate lymphocytes ex vivo since the lymphocytes can be rinsed of SAg polypeptide prior to administration to a host.

The nucleic acid sequences that encode SAgs are known and readily available. For example, Staphylococcal enterotoxin A (SEA), SEB, SEC, SED, SEE, TSST-1, and Streptococcal pyrogenic exotoxin (SPEA) have been cloned and can be expressed in E. coli (Betley M J and J J Mekalonos, J. Bacteriol. 170:34 (1987); Huang I Y et al., J. Biol. Chem., 262:7006 (1987); Betley M et al., Proc. Natl. Acad. Sci. USA, 81:5179 (1984); Gaskill M E and S A Khan, J. Biol. Chem., 263:6276 (1988); Jones C L and S A Khan, J. Bacteriol., 166:29 (1986); Huang I Y and M S Bergdoll, J. Biol. Chem., 245:3518 (1970); Ranelli D M et al., Proc. Nat. Acad. Sci. USA 82:5850 (1985); Bohach G A, Infect Immun., 55:428 (1987); Bohach G A, Mol. Gen. Genet. 209:15 (1987); Couch J L et al., J. Bacteriol. 170:2954 (1988); Kreiswierth B N et al., Nature, 305:709 (1983); Cooney J et al., J. Gen. Microbiol., 134:2179 (1988); Iandolo J J, Annu Rev. Microbiol., 43:375 (1989); and U.S. Pat. No. 5,705,151)). Additional nucleic acid sequences encoding SAgs are described elsewhere (Bohach et al., Crit. Rev. in Microbiology 17:251-272 (1990); (Kotzin, B L et al., Advances Immunology 54: 99-165 (1993)) PCR can be used to isolate SAg-encoding acid. For example, the nucleic acid encoding SEA, SEB, and TSST-1 can be isolated as described elsewhere (Dow et al., J. Clin. Invest. 99:2616-2624 (1997)). Briefly, the following primers can be used to amplify the SAg-encoding nucleic acid:

(SEQ ID NO: 87)
SEA forward:
GGGAATTCCATGGAGAGTCAACCAG,
(SEQ ID NO: 88)
SEA backward:
GCAAGCTTAACTTGTTAATAG;
(SEQ ID NO: 89)
SEB forward:
GGGAATTCCATGG-AGAAAAGCG,
(SEQ ID NO: 90)
SEB backward:
GCGGATCCTCACTTTTTCTTTG;
(SEQ ID NO: 91)
TSST-1 forward:
GGGGTACCCCGAAGGAGGAAAAAAAAATGTCTACAAACGATAATATAAA
G,
(SEQ ID NO: 92)
TSST-1 backward:
TGCTCTAGAGCATTAATTAATTTCTGCTTCTATAGTTTTTAT

The full-length TSST-1 nucleic acid sequence is cloned into a eukaryotic expression vector (pCR3; InVitrogen Corp., San Diego, Calif.), whereas only the sequence corresponding to the mature SEB and SEA (sequences minus the putative bacterial signal sequences) is cloned into pCR3. Removal of the SEB and SEA signal sequences increases the level of expression in transfected cells. The plasmids are grown in Escherichia coli and plasmid DNA extracted by the modified alkaline lysis method and purified on a CsCl gradient.

Nucleic acids encoding mutant or variant SAgs are also considered nucleic acid sequences encoding SAgs within the scope of the invention. For example, a mutant SAg-encoding acid sequence is engineered such that the resulting SAg is devoid of amino acid residues, e.g., histidine, known to produce toxicity. Likewise, SAg-encoding nucleic acid is engineered to contain or lack sequences that facilitate the selective binding of SAgs to certain Vβ regions of the TCR present on T cells or to ganglioside, mannose (or other carbohydrate) receptor, certain regions of MHC class II, and/or enterotoxin receptors present on tumor cells, antigen presenting cells (APCs), and/or lymphocytes.

Nucleic acid sequences that encode a SAg are also fused, in frame, with nucleic acid that encodes another polypeptide. This larger nucleic acid is termed herein a SAg fusion gene and the resulting polypeptide product is a SAg fusion product. Nucleic acid sequences that are fused to SAg-encoding nucleic acid include, without limitation, nucleic acid sequences that encode tumor antigens, costimulatory molecules, adhesion molecules and MHC class II molecules. The superantigen fusion product is secreted by a transfected cell, expressed on the cell surface or it may remain intracellular in nucleic acid or partly processed form.

SAgs are also isolated and purified from their natural source as well as from a heterologous expression system such as E. coli. Likewise, SAg-containing polypeptides (e.g., SAg fusion products) are isolated and purified from a heterologous expression system. In addition, Staphylococcus strains producing high levels of enterotoxin have been identified and are available. For example, exposing enterotoxin-producing Staphylococcus aureus to mutagenic agents such as N-methyl-N-nitro-N-nitrosoguanidine results in a 20 fold increase in enterotoxin production over the amounts produced by the parent wild-type Staphylococcus aureus strain (Freedman M A and Howard M B J. Bacteriol., 106:289(1971)).

6. Glycosylated SAgs and SAgs Conjugated to Glucosylceramides. Lipopolysaccharides, Glycans and Lipoarabinomannans: Presentation on CD1 Receptors for Activation of T or NKT Cells and Differentiation to Tumor Specific Effector Cells.

In a tumor cell or accessory cell, nucleic acid signal sequences are integrated into nucleic acids encoding the SAg molecules in order to route them to the Golgi apparatus and endoplasmic reticulum of tumor cells where they are glycosylated via appropriate glycosyltransferases (precedents from the selective transferases used to produce monogalactosylceramide in the Sphingomonas paucimobilis) to produce a proteoglycan with structural similarity to LPS, lipoteichoic acid, GalCer, a Gal, Streptococcus capsular polysaccharide. This construct is then secreted as an immunogenic “ground substance.” Alternatively, the resulting SAg glycolipid is anchored to the membrane, expressed on the cell surface and routed specifically to CD1 receptors.

SAgs which are glycosylated by the above intracellular processes have improved capacity to bind surface structures such as mannose receptors, ganglioside receptors and CD1 receptors. Generally, the nucleic acids encoding a SAg are modified to include a signal sequence for routing to the Golgi apparatus and a core sequence which initiates glycosylation. It is important that the Vβ TCR binding region is not blocked by the added carbohydrate modifications. For example, an N-linked glycosylation site (in the sequence Asn X Ser/Thr where X is any residue except Pro) is engineered into SAg-encoding acid sequences which do not functionally interfere with TCR binding and activation. The nucleic acid encoding these signal sequences and core binding glycosylation sites of SAgs are fused to nucleic acids encoding SAg and the fusion gene used to transfect tumor cells of a host. In addition, glycosylated forms of SAgs are expressed in a heterologous eukaryotic expression system such as yeast cells or baculovirus-infected insect cells. In gram negative bacteria (such as E. coli), nucleic acids encoding SAgs are fused to nucleic acids encoding LPS's, in gram positive bacteria (such as Staphylococcus or Streptococcus), to nucleic acids encoding capsular polysaccharides and teichoic acids and in mycobacterial species to nucleic acids encoding lipoarabinan.

The gram negative bacterium Sphingomonas paucimobilis produces the monogalactosylceramide. In this bacterium, nucleic acids encoding SAgs (containing serine) are fused to nucleic acids encoding and directing the synthesis of glycosylceramides and monogalactosylceramide in particular. The resulting galactosylceramide-SAgs are powerful T cell stimulants. The same procedure is followed in bacteria which naturally produce LPS's such as E. coli, Salmonella or Klebsiella or for bacteria which naturally produce lipoarabinomannans glycans or polysaccharides containing cell walls such as Mycobacterium and Streptococcus respectively. The SAg-polysaccharide constructs bind to CD1 receptors of antigen presenting cells. They are then capable of activating NKT cells either in vivo or ex vivo to become tumor specific effector cells in response to IL-12. SAgs are also conjugated genetically or biochemically as in Example 5 to LPS's via a natural high affinity binding site for LPS binding protein (LPB). Once bound, the SAg catalyzes the binding of LPS monomers to CD14 and CD1 receptors in a fashion similar to that of LPB. In this way, the conjugates are capable of activating T cells for use in vivo or ex vivo for adoptive immunotherapy while preserving the anti-apoptotic effect of LPS on SAg activated T cells. Examples of their preparation and use in vivo and in vitro are given in Examples 4, 7, 15, 16, 18-23.

In addition, SAgs similarly conjugated to lipoarabinomannans and glycans are integrated into lymphomonocytic cell membranes via glycosylphosphatidylinositol anchors. These SAg-lipoarabinomannan complexes are expressed or secreted by antigen presenting cells or tumor cells. They are also bound to CD1, mannose or class II receptors in which form they are used to activate T or NKT cells. These constructs are administered in vivo or they are used ex vivo to produce tumor specific effector cell populations (T cell or NKT cells) which are employed for adoptive immunotherapy of cancer (Examples 5, 15-16, 18-23).

Mannose receptor expression is upregulated by cytokines. For example, accessory cells including DCs, and tumor cells express mannose receptors on their surfaces after GM-CSF treatment. SAgs are bound to mannose receptors by transfecting cells with nucleic acids encoding SAg which also consist of nucleic acids encoding signal sequences and glycosylation sites which, in the presence of appropriate glycosyltransferases, produce mannosylated SAgs. These preferentially bind to mannose receptors. In addition, glycosylated SAgs bind to amphipathic cell surface gangliosides and glycolipids via hydrophobic interactions. These glycosylated SAgs presented in a form bound to mannose receptors are capable of activating T cells and NKT cell populations. They are used either in vivo by direct administration or ex vivo to produce a tumor specific effector cell population (T cell or NKT cells) for use in adoptive immunotherapy of cancer (Examples 4, 5, 15, 16, 18-23).

7. SAgs Conjugated to Glycosylceramides, Gangliosides and Verotoxins (VT)

Amphipathic gangliosides bound to tumor cell surfaces such as GD1, GD2, GD3, GM1, GM2, GM3, GQ1 and GT1 are capable of binding exogenous SAgs. The binding of a SAg to the surface of a tumor cell creates an immunogen on the tumor cell surface. Tumor cells transfected with nucleic acids encoding glycosyltransferases overexpress gangliosides, producing a greater surface density of ganglioside moieties available to bind exogenous SAgs. Enterotoxins bind to cell surface amphipathic gangliosides and/or glycophorins via their hydrophobic residues while preserving their T cell binding properties. SAgs are also glycosylated intracellularly by addition of a glycosylation site or by chemical conjugation of a carbohydrate moiety using methods well described in the art. In glycosylated or native form, the SAgs bind to surface ganglioside while retaining their T cell activating properties. Overexpression of the hydrophobic regions of the molecule promotes binding to the surface gangliosides (Example 5). Examples from nature of exogenous proteins that bind to cell surface gangliosides include falciparum malarial merozoite which combines with gangliosides associated with the Duffy blood group and induce long standing and durable protection and tetanus toxin which binds to surface gangliosides with highest affinity for the disialyl groups linked to inner galactosyl residues.

Enterotoxin B contains a T cell activating sequence which is chemically cross-linked or polymerized using bifunctional agents such as carbodiimide, glutaraldehyde or formaldehyde by established methods well known in the art. These polymers are then bound to gangliosides expressed on tumor cells such as GD1, GD2, GQ1, GD3 or GM1, GM2, GM3, GT1. In monomeric or polymerized form, SAgs also bind to monogalactosylceramides which are free or bound to CD1 receptors on tumor cells or antigen presenting cells via hydrophobic interactions. The monogalactosylceramide binds to hydrophobic sequences on the SAg which are expressed at multiple sites on the molecule. In one embodiment, the lauroyl group [CH3(CH)10CO] or the group [CH3(CH)13CO] is covalently added to each of the peptide's amino terminus to serve as a of the CD1 receptor. The key SAg peptide sequence such as of SEB (amino acids 225-234) which confers T cell activating properties is tandemly repeated to various lengths prior to lipid conjugation.

Hydrophobic SAg peptides(such as Trp, Tyr, Phe, Leu, and Ile) are screened for binding to glycosylceramides immobilized on CD1 receptors or via adsorption chromatography with immobilized glycosylceramide. The SAg sequences with the greatest affinity for the CD1 receptor are selected for conjugation to the glycosylceramides and LPS's. Alternatively, the SAg sequence is screened for affinity for the CD1 or MHC class II receptor using a peptide phage display library as described in Examples 4. Likewise, pre-formed SAg-glycosylceramide or LPS complexes are also screened for affinity for the CD1 or MHC class II receptor (Example 4). These lipopeptide complexes are then screened for T cell proliferative activity and IL-12 production. The monomeric or polymerized SAg in native or glycosylated form binds to the monoglycosylceramides or gangliosides expressed on CD1 receptors on the tumor cell surface.

Therapeutic Construct: SAg-Glycosylceramide Conjugates

SAgs have an affinity for glycosphingolipids especially those with terminal or subterminal Gal (α1-4)Gal residues. Such residues are expressed on tumor cells as Gal(α1-4)Gal(β1-4)GlcCeramid-e (globotriaosylceramide or Gb3) and Gal(α1-4)GalCeramide (galabiosylceramide or Gb2). Gb3 and Gb2 also known as CD77, Burkitt's lymphoma antigen, and the human blood group pk antigen are the natural receptors for Shiga toxins and VT's . Shiga toxin, a 69-kDa complex of proteins comprised of five β-subunits (7 kDa each) and one α-subunit (30 kDa) has high affinity for the terminal digalactose of Gb3 or Gb2. Methods for their preparation and isolation are described in Example 41. Once bound to the tumor cell, these toxins are internalized and induce apoptosis.

The synthetic pathway for neutral glycosphingolipids in eukaryotic cells is known. Glucosylceramide (GlcCer) is the precursor of lactosylceramide (LacCer), which leads, in order, to Gb3 and globotetraosylceramide (Gb4). Different Golgi enzymes are responsible for addition of monosaccharides from nucleotide-sugar donors in each step of the pathway. Globotriaosylceramide synthase (UDP-galactose: lactosylceramide α1-4-galactosyltransferase) has been purified. In the cytoplasm, the α-subunit of the Shiga toxin or VT is processed by a trypsin-like cleavage. The “activated” 27-kDa α-subunit inactivates 60S ribosomes by depurination of a single nucleotide in 28S rRNA, rendering ribosomes incapable of carrying out peptide elongation.

The present invention provides therapeutically active soluble complexes comprising SAg and glycosphingolipids which have terminal or subterminal Gal(α1-4)Gal residues and Shiga toxin receptors Gb3 and Gb2, (collectively referred to as “GTSG1-4”). These complexes include but are not limited to SAg-GPI-GTSG1-4 complexes, and synthetic and functional derivatives thereof. Such structures appear naturally on surfaces of certain tumor cells such as astrocytoma, Burkitt's lymphoma and ovarian carcinoma. Methods of preparing and isolating glycosylceramides and VTs are given in Example 41.

SAgs also have a demonstrable affinity for galactosylceramides containing Gal(α1-4)Gal residues. Methods of assessing SAg binding to GTSG1-4 are provided given in Example 43. These conjugates are also shed from SAg-transfected tumor cells as binary complexes of SAg-GTSG1-4 or ternary complexes of SAg-GPI-GTSG1-4, in free form, as vesicles or as exosomes (see Sections 38 and Example 38). Methods of isolating and characterizing these shed complexes appear in Section 38 and Example 42. The complexes may also be prepared by chemical or genetic methods (Example 5). SAg-GTSG1-4 or SAg-GPI-GTSG1-4 complexes or exosomes are useful as a preventative vaccine or against established tumor. They are also useful in vivo by direct administration or ex vivo where they are loaded onto antigen presenting cells comprising CD1 or MHC receptors to activate NKT and T cells to produce tumor specific effector T or NKT cells for adoptive therapy of cancer (Examples 5, 7, 14, 15, 16, 18-23, 38).

SAg-VT Conjugates to Induce Tumor Cell Apoptosis

The present invention contemplates the induction of apoptosis in tumor cells expressing Gb2 and Gb3 (or other glycosphingolipids containing terminal Gal(.alpha.1-4)Gal) by using free SAgs, conjugates and fused DNA that comprises SAg, SAg peptide or SAg-encoding DNA fused to intact VT or to VT A or B chains. Preparation of these conjugates and fusion proteins from their corresponding DNA, polypeptides or functional derivatives is provided in Examples 1 and 5. These conjugates induce apoptosis by binding to tumor cell glycosphingolipid receptors having terminal Gal (α1-4)Gal. Methods of assessing tumor cell apoptosis are in Example 44. CD19 or IFN-α peptide sequences and generic carbohydrate recognition domains which bind Gal(α1-4)Gal structures are also useful. CD19, a B-cell restricted differentiation antigen, naturally binds to Gb3 and Gb2 on the cell surface which incudes apoptosis. CD19 has VT-like sequences in the N-terminal extracellular domain (NBRF protein data bank) that have 41%, 34% and 37% sequence identity to VT1, VT2, and VT2e B subunits, respectively. When compared to a consensus VT B sequence, the CD19 sequences show 49% identity. Binding of these peptide sequences to membrane Gal(α1-4)Gal-containing glycolipids facilitates receptor mediated induction of apoptosis.

The IFNα receptor has a 63-kDa extracellular peptide with regions of amino acid identity to domains in the VT B subunit implicated as Gb2/Gb3 binding sites. The preferred targets of the above conjugates on tumor cells are the naturally expressed Shiga toxin receptors Gb3 and Gb2 with a terminal Gal(α1-4)Gal. Astrocytomas and Burkitt's lymphomas are the preferred tumors as they naturally express glycosphingolipid receptors. However, any tumor expressing the appropriate receptor is appropriate. Tumor cells which express either engineered or natural functional derivatives, or mutants of these glycosphingolipid receptors, are also useful. Receptor expression on the target cells is optionally upregulated by cytokines such as IFNy and TNFα. Tumor cell sensitivity to the cytotoxic effects of a VT is enhanced by administration of interleukin-1β before the addition of the conjugates. Tumor cells which do not naturally display Gb3 or Gb2 acquire these structures by transfer from free, soluble structures or liposomes which express the missing glycosphingolipid receptor (Section 38, Example 5). The reconstituted tumor cells bearing the appropriate glycolipid receptors are thus targeted for apoptosis by the above constructs and conjugates.

SAg Nucleic Acid-Verotoxin Conjugate

A preferred construct is the SAg-VT conjugate wherein the SAg is preferably in nucleic acid form (prepared according to Example 3). The VT portion of the complex binds to the tumor cell and initiates apoptosis. The VT also acts as a “vector” for transfer of the SAg nucleic acid into the cell. SAg-VT conjugates bind to the terminal Gal(α1-4)Gal receptors on tumor cell surfaces and are internalized via endocytosis. The SAg nucleic acid is internalized together with the VT. The VT A chain is an RNA N-glycosidase acting on the 60S ribosomal subunit. It induces apoptosis in the tumor cell by removing an adenine base on amino acyl-transfer RNA so that peptide chain elongation is blocked. The resulting apoptotic tumor cells contain the internalized SAg nucleic acid and are then ingested by dendritic cells. The DCs are cross primed to induce an effective anti-tumor response by presenting the tumor associated antigens in the class I pathway to T cells while the SAg nucleic acid expresses SAg polypeptide. These activated DCs or DC/tc hybrids can be prepared by the methods of Examples 28-29. They are used to activate a T or NKT cell population in vivo as a preventative vaccine or by direct administration against established tumor. They are also used ex vivo to produce a population of tumor specific effector cells (T cells or NKT cells) for adoptive therapy of cancer (Examples 5, 7, 14, 15, 16, 18-23, 28-29).

Glycosylation or lipid binding of the enterotoxin does not interfere with T cell binding and activating properties. The SAg is glycosylated by chemical or recombinant techniques described in the Examples 4. The SAg glycoprotein is then further conjugated to gangliosides in the ganglioside synthetic pathway via the presence of key signal peptides on the glyco-SAg (Example 4). The SAg is also rerouted to the LAMP pathway, glycosylated in the Golgi apparatus and the endoplasmic reticulum and then translocated to the membrane class II receptor as a glycosylated ganglioside. Gangliosides are glycosylated to form glycosylceramides by recombinant techniques as described in the Example 4. They are also glycosylated by glycosyltransferases to form homologues which bind to hydrophobic regions of the SAg peptide. The final products namely SAg-glycosylceramides or SAg-LPS's then bind to CD1 receptors and are used to activate T cells or NKT cells. These construct are administered directly vivo or they are useful ex vivo to produce a population of tumor specific effector T cells or NKT cells for adoptive immunotherapy of cancer by protocols given in Examples 7, 15, 16, 18-23.

The present invention contemplates the fusion or coexpression within the same cell of SAg polypeptides with anomeric mono and digalactosylceramides which are expressed within a tumor cell or on the tumor cell surface. These construct could also be effectively expressed on the surface of accessory cells defined in Oxford Dictionary of Biochemistry and Molecular Biology 1997 edition as any one of various types of cell which assist in the immune response cell and includes but is not limited to DCs, fibroblasts, synoviocytes, astrocytes antigen presenting cells, neutrophils, macrophages, basophils, eosinophils, mast cells, keratinocytes and platelets, as well as fusion cells comprising accessory cells and tumor cells.

The anomeric mono and digalactosylceramides have been shown to activate NKT cells and to produce an anti-tumor response in the context of IL-12. The galactosylceramides have several structural requirements in order to produce anti-tumor effects. Mono and digalactosylceramides require an anomeric galactose or glucose as the terminal sugar or inner sugar as for example anomeric 1,6-digalactosylceramide, -anomeric 1,2-digalactosylceramide, anomeric 1,4-digalactosylceramide, a diglycosylceramide wherein the inner sugar is an anomeric galactose or an anomeric glucose and anomeric galactosyl or anomeric glucosyl ceramide. In addition, the 3- and 4-hydoxyl groups on the phytosphingosine portion of the ceramides are preferably unsubstituted, the sphingosine base length is preferably from about 10 to about 13 carbon units and the fatty acyl chain length is preferably in the range of about 12 to about 24 for optimal anti-tumor effectiveness of the molecule.

The expression of anomeric mono- and digalactosylceramides in a cell is achieved by several methods. The first involves the transfection and amplification of nucleic acid encoding the enzymes which synthesize the anomeric 1,4-, the anomeric 1,6- or the anomeric 1,2- mono- and digalactosylceramides such that these glycolipids are overproduced. The genes for these transferase enzymes have been cloned. Transfection of nucleic acid encoding these terminal transferases into the above cells is carried out in vivo by the methods described in Example 1.

A second method for creating cells that overexpress the foregoing glycolipids uses monensin or brefeldin which block additional glycosylation and sialylation of the -galactosylceramides, so that the mono- and digalactosylceramides accumulate in the cell.

A third approach employs cells from patients with Fabry's disease. These cells are genetically deficient in the α-galactosidase so they naturally accumulate α-galactosylceramides.

In a forth technique, an α-galactosidase deficiency is induced in the target cell so that 60 -galactosylceramides accumulate.

In a fifth approach, the -galactosyltransferase is transfected Fabry's disease cells, thereby adding to the usual accumulation due to the catabolic enzyme deficiency. Such cells should have massive accumulations of α-galactosylceramides.

In a sixth approach, the desired mono- or diglycosylceramide expressed on liposome surfaces are transferred to tumor cells lacking these structures by co-culture and employment of fusion techniques given in Example 5.

Nucleic acids encoding SAgs are transfected into the above cells which are overexpressing, overproducing or otherwise accumulating mono and digalactosylceramides. The Golgi apparatus (or Golgi complex) is a major site of synthesis of the foregoing glycolipids. In the present context, the SAg combines with the mono and digalactosylceramides. From the Golgi the SAg-galactosylceramide conjugates or complexes, with the appropriate sorting signals, are dispatched in transport vesicles to other destinations. For a SAg peptide to combine effectively with an -galactosylceramide, the peptide must first have the appropriate sorting signal which directs it to the Golgi and from there, after complexing with the glycolipid, to the cell surface. The trafficking pathway of SAg polypeptide from the ER to the Golgi does not require special signals. SAg polypeptides that enter the ER (and fold and assemble properly) will automatically be transported through the Golgi apparatus to the cell surface unless they carry signals that either detain them in an earlier compartment en route or divert them (via the Golgi apparatus) to lysosomes or secretory vesicles. The SAg-glucosylceramide conjugates are routed from the Golgi to the cell surface after acquiring a structure like a cytoplasmic tail such as phosphoinositol which assures that these molecules will be bound in the cell membrane. The conjugates may also be routed to CD1 or MHC class I receptors, or via, the class II pathway, to MHC class II receptors by associating with invariant chain or LAMP-1 signals.

The mono- and digalactosylceramides are capable of stimulating NKT cells (via an invariant chain) in the presence of IL-12 to produce an anti-tumor response. SAgs are capable of stimulating a T cell-dependent anti-tumor response. The present invention utilizes tumor cells, accessory cells or hybrid cells such as DC/tc, engineered to express SAg-galactosylceramide for anti-tumor therapy. These cells may be administered as a preventative or therapeutic vaccine (Example 29). Alternatively, they may be useful ex vivo to activate an NKT or T cell population for use in adoptive immunotherapy of cancer (Example 29).

8. SAg Targeting to Lysosomes This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
10. SAg Receptors This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
11. Tumor Cells that Express SAgs and the αGal Epitope This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
13. Tumor Cells Expressing SAgs, Glucosylceramides and LPS's and their Receptors This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
14. SAg-Activated Tumor Specific T Cells, NKT Cells or/T Cells Expressing CD44 for Adoptive Immunotherapy This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
15. Tumor Associated Antigens include This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
16. Immunostimulatory Sequences This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
17. Liposomes This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
18. Tumor Cells that Induce Cellulitis This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
19. Tumor cells as mimics of virulent bacteria: transfection with nucleic acid encoding bacterial invasins, virulence factors, and enzymes that degrade extracellular matrix

Invasins

SAg-encoding nucleic acid is fused in frame or cotransfected into tumor cells with nucleic acids encoding bacterial invasins and hyaluronidases. The invasin imparts leukocyte like activity to bacteria is transfected into tumor cells which allows the tumor cells to penetrate tissues. These are exemplified by Yersinia pseudotuberculosis invasin and hyaluronidase (including its various isotypes) and also known as tissue spreading factors. The invasin gene exemplified in Y. pseudotuberculosis encodes a protein located in the outer membrane of the bacterium called invasin (Inv) and the gene is known as inv. The DNA region of the inv gene contains a open reading frame 2964 bases. This protein binds to the host cell surface by means of the C-terminal 192 residue region. Mutation by insertion of a transposon or elimination of the inv gene greatly impairs the ability of the bacterium to penetrate tissues (Schaecter M et al., Genetics of Bacteria edited by Baer G M et al., in Mechanisms of Microbial Disease Williams and Wilkins Baltimore (1993)).

20. Combined Expression of Different Stimulatory Molecules by Co-transfection of Tumor Cells or Fusion of Singly Transfected Cells This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
21. Augmentation of Tumor Cell Immunogenicity by Bacterial Products: Transfection with Genes Encoding Bacterial Antigens or Receptors for Bacterial Products This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
21b. Combining Expression of SAg Nucleic Acids with Nucleic Acids Encoding Enzymes that Drive the Synthesis of Bacterial LPS, Galactosylceramide or Capsular Polysaccharide This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
22. SAg-Ganglioside or SAg-Galactosylceramide Complexes Formed after Transfection of Tumor Cells with DNA Encoding SAgs: Complete Bacterial Antigen System Recognized by CD1 Receptors Capable of Inducing Anti-Tumor Effects This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
23. Nucleic Acids Encoding CD1 Receptors This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
24. DNA Encoding Streptococcal M Proteins and DNA Encoding Protein A or its Fc and VH3 IgG binding Domains Transfected into Tumor Cells Alone or SAg DNA This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
26. Combining SAgs with Enterotoxin Precursors (Cell-bound Dimers and Oligomers) and with Enterotoxin Promoters and Transcriptional Regulatory Genes This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
27. Combining SAg with Oncogenes, Protooncogenes, Amplified Oncogenes, Transcription Factors or Tumor Markers This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
28. Combining SAg with Angiogenic Receptors and Growth Factor Receptors

SAg-encoding nucleic acid is cotransfected or fused in frame to nucleic acid encoding an angiogenic receptor such as VEGF and transfected into tumor cells. SAg nucleic acid is also fused to or cotransfected with nucleic acid encoding other angiogenic receptors such as V integrin, other integrins, cadherins or selectins and introduced into tumor cells or accessory cells. SAg-encoding nucleic acid is also cotransfected into tumor cells or accessory cells with nucleic acids encoding angiogenic proteins such as VEGF. VEGF is produced by tumor cells and stroma, and its expression correlates with the degree of vascularization and grade of malignancy. VEGF receptors, termed KDR andflt, are expressed mainly by the tumor endothelium. Higher levels of VEGF are found in metastatic than in non-metastatic colon cancers (Tischer E et al., J. Biol. Chem. 266: 11947-11954 (1991). VEGF is especially useful here because it is overexpressed in tumor cells at an early stage of tumorigenesis. The promoter of the VEGF gene lacks a TATA box, but has six GC boxes for transcription factor SP-1 binding and also a site for AP-1 and AP-2 binding. The expression of the gene is modulated by several growth factors such as EGF. In some cell types VEGF expression is regulated by IL-1, FGF, PDGF. A common element, mediation of protein kinase C in the regulation of VEGF, has been suggested. VEGF is expressed as a disulfide linked dimer. Long and short forms are generated by alternative splicing and are matrix bound or released, respectively. As a result of its specific effects on endothelial cell migration and proliferation, VEGF is a very potent and specific promoter of angiogenesis. Two well characterized families of angiogenic factors act by binding to tyrosine kinase receptors that have two or three immunoglobulin-like domains, and VEGF binds to two related receptors with seven immunoglobulin-like extracellular domains.

The TRKA oncogene codes for a receptor for nerve growth factor (NGF). The TRKA gene has been found fused to genes that code for proteins that form dimers in cells leading to the synthesis of a constitutively dimerized and active tyrosine kinase. TRKA may have a tumor suppressor function since its expression in neuroblastoma correlated inversely with n-myc gene amplification. Coexpression of mRNA for TRKA and the low affinity NGF receptor in neuroblastoma correlated with a favorable prognosis.

Nucleic acid encoding SAg is fused to nucleic acid encoding the above angiogenic factors or receptors and introduced into tumor cells; alternatively, the two nucleic acids are used to cotransfected tumor cells. These transfectants are prepared as in Example 1. They are useful in vivo as a preventative or therapeutic antitumor vaccine (Examples 15, 16, 18-23). They are also useful ex vivo for inducing tumor specific effector cells for adoptive immunotherapy of cancer (Examples 2-5, 7, 15.16 18-23).

29. Combination of SAg with Cell Cycle Protein This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
30. Combining SAg with Tumor Suppressor Genes, p53 or Developmental Genes This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
31. Combining SAg with Cell Surface Glycoproteins or their Receptors This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
32. Combining SAg with Cytokines and Chemokines

SAg-encoding nucleic acid is fused in frame with nucleic acid encoding a cytokines and chemokines, and the fused nucleic acid is introduced into tumor cells or accessory cells. Alternatively, the two nucleic acids are used to cotransfected these cells. Examples of chemokines and cytokines that are useful herein include RANTES, IL-5, IL-7, IL-12, IL-13, IFN(, TNF(and TNF(. Chemokines are small (typically 6-10 kDa) peptides that have been divided into two classes designated C—C and CXC based on the sequence of the first two cysteine residues. The two families exhibit preferences for different target cell types: C—C chemokines act primarily on macrophages.

Chemokine gene expression is induced by the action of other growth factors and cytokines and are actively expressed in solid tumors showing inflammatory involvement and macrophage or neutrophil invasion. Chemokines of the C—X—C class containing the amino acid sequence motif ELR have demonstrable angiogenic activity which can be inhibited by C—X—C chemokines lacking the ELR motif. Therefore chemokine expression by either tumor cells themselves or elicited from stromal cells by the action tumor-derived growth factors, have the potential to regulate tumor growth by modulation of angiogenesis. G-CSF is a growth factor for granulocyte precursors, and IL-2 is a growth factor for T cells. Nucleic acids encoding SAgs are fused or cotransfected into tumor cells with nucleic acids encoding the above cytokines, chemokines and chemoattractants. The transfectants are prepared as in Example 1. They are useful in vivo as a preventative or therapeutic antitumor vaccine according to Examples 15, 16, 18-23). They are also useful ex vivo for inducing tumor specific effector cells for adoptive immunotherapy of cancer (Examples 2-5, 7, 15, 16 18-23).

33. Combining SAg with Transcription Factors AP-1 and NFκA This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.

34. SAgs Augment the Immunostimulatory Effects of Tumor Associated Peptides, Binary and Ternary Complexes

Bacterial SAg are presented to T cells via the MHC class II molecule by multiple low affinity attachments, resulting in stimulation of the T cell with very low concentrations of antigen. SAgs augment the presentation of antigenic peptides to T cells without sterically interfering with each other's ability to bind and activate the TCR. These augmenting peptides are incorporated into the SAg structure.

SAgs may also bind to binary or ternary complexes of tumor peptide-MHC class I or tumor peptide-MHC class II complexes, either in solution or affixed to a TCR or the surface of an APC. In one embodiment, the SAg is first bound to APCs or T cells followed by addition of complexes between MHC class I or class II and tumor peptide. Alternatively, the SAg may first bind to either cell-bound, soluble or immobilized MHC class I or class II molecules, after which the tumor peptide is added. This trimolecular complex is then presented to the T cell via the TCR.

In another embodiment, SAg is first bound to an APC or to a TCR Vβ chain on an NKT cell. Following this, CD1-glycosylceramide complexes are added and allowed to bind to NKT cell TCR Vβ chain. SAg may be bound to first to CD1-glycosylceramide complexes in soluble form, affixed to CD1+ cells or NKT cells via the TCR. SAgs may be bound to CD1 complexes with glycosylceramide or a glycosphingolipid (with a conserved SAg binding site) in solution or when fixed to CD1+ cells or NKT cells. Alternatively, SAgs are bound to ternary complexes consisting of CD1-glycosylceramide affixed to the NKT cell TCR or bound to CD1-glycosylceramide on APCs, in solution or immobilized, before it has affixed to the NKT TCR. SAg is alternatively bound to binary complexes of (a) CD1-glycosylceramide, (b) CD1-glycosphingolipid, (c) CD14-LPS or (d) MHC-tumor peptide complexes that have either a SAg receptor sequence or a TCR Vβ SAg-binding sequence.

The complexes described above are used in vivo as preventative or therapeutic antitumor vaccines according to Examples 4, 15, 16, 18-23. They are also used ex vivo for inducing tumor specific effector cells that are then taken for adoptive immunotherapy of cancer. (See Examples 2-5, 7, 14, 15, 16 18-23).

35. SAgs Combined with Products of Antigen Processing Pathways This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.

36. SAgs Combined with Signal Transduction Molecules or Heat Shock Proteins (HSPs)

SAg-encoding nucleic acid is fused in frame to (or cotransfected with) a nucleic acid encoding “signal transduction molecules” such as Ras, JAK 1 and STAT-1a and heat shock proteins HSP-60, HSP-70, HSP-90a, HSP-90b, Cox-2 as well as heterotrimeric G proteins and ATPases. The genes for Staphylococcal HSP-70 useful in this invention have been cloned (Ohta, T et al., J. Bacteriology 176: 4779-4783, (1994)). As used herein, SAg polypeptides are ligated to any of above structures at the peptide or nucleic acid level. Preferred proteins for this embodiment are G proteins, ATPases and HSPs. Chemical conjugation is carried out by conventional methods, e.g., use of preferred heterobifunctional crosslinkers. Alternatively, conjugates are produced genetically as fusion proteins by conventional methods. In yet another embodiment, the conjugates are created by permitting natural binding of the components to each other without chemical modification. Any of the foregoing conjugates or fusion proteins may be used when incorporated into vesicles or exosomes secreted from a cell. See Example 36 for methods and protocols.

SAg-encoding nucleic acid is fused in frame (or cotransfected) with nucleic acid encoding a signal transduction protein or HSP. Transfectants are prepared as in Example 1. They are used in vivo as a preventative or therapeutic antitumor vaccine according to Examples 15, 16, 18-23. They are also used ex vivo for inducing tumor specific effector cells for adoptive immunotherapy of cancer (Examples 2-5, 7, 15, 16 18-23). The peptide or polypeptide conjugates are also useful for the same purposes.

37. SAgs with Specialized Sites for C-terminal GPI anchoring, Glycosylation, Sulfation, N-Myristoylation, Phosphorylation, Hydroxylation, N-Methylation, Signal peptide binding, LPS binding, HSP binding, Chemokine binding and Prenylation This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
38. SAgs and SAg Proteomes for Enhanced Immunogenicity, Specificity and Intracellular Trafficking of Soluble or Cell-bound Binary or Ternary Complexes This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
39. Effector T Cells: Methods of Lowering Activation Threshold for Activation by SAg This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
40. SAg Nucleic Acids Fused of Cotransfected into Tumor Cell with Nucleic Acids Encoding Inducible Nitric Oxide Synthase (iNOS) This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
41. DCs, Other Accessory Cells and DC/tc Hybrids Expressing and/or Secreting SAg This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
42. DCs Expressing SAg and Tumor Associated Antigens—Production by Processing of Apoptotic Tumor Cells or Tumor Cell Lysates This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
43. DCs Expressing or Secreting SAg Cotransfected with a Tumor Associated Antigen or “String of Beads” Tumor Antigens This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
44. Naked DNA or RNA Obtained from the Various Cells Described Above That Express and/or Secrete SAg This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
45.Exosomes Derived from (1) SAg-Expressing Tumor Cells (2) SAg Expressing-DCs (3) S/D/t cells or (4) DC/tc Hybrid Cells This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
46. Cell surface Display of Recombinant SAg and Tumor Associated Antigens in Bacteria
47. Introduction of Staphylococcal Collagen Binding Adhesins into DCs, Tumor Cells or S/D/t Cells This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
48. Co-expression of Anti-Tumor Motifs or their Binding Proteins with SAg This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
49. Sags Combined with Low Density Lipoproteins (LDL), Oxidized LDL (oxy LDL) Oxidized LDL Mimics and Apolipoproteins This Section is incorporated in entirety by reference from provisional application No. 60/151,470, filed on Aug. 30, 1999.
50. SAg Combined with Tumor Viruses (Nucleic Acid or Peptide Forms)

SAgs are chemically conjugated to HPV-E6 or 7 human papilloma virus tumor antigens by methods given in Examples 3. Alternatively, the naked nucleotides containing immunostimulatory sequence of the superantigen and the HPV-E6 or E7 are prepared individually or as a fusion nucleotide or protein as in Examples 5, 30, 31. Alternatively, the SAg-HPV fusion gene is transfected into tumor cells as given in Example 1. In this case, the virus serves as the vector for tranfecting the cells with the superantigen nucleic acids. The superantigen-HPV-E6 or E7 conjugates, fusion proteins, naked DNA fusions or tumor cells expressing the superantigens and HPV are used as preventative or therapeutic vaccines under protocols given in Examples 14, 15, 16, 18-23, 30, 31. Further, SAg and HPV-E6 or E7 transfected tumor cells are subjected to irradiation or other apoptosis inducing agents or stimuli after which the apoptotic tumor cell transfectants are presented to dendritic cells ex vivo which ingest the apoptotic tumor cells. In the dendritic cells, the viral antigens and superantigen undergo cross priming to the class I pathway and these dendritic cells are then harvested and administered to the tumor bearing host as given in Examples 26-28. The DNA and RNA from these SAg and HPV-E6 or E7 transfected tumor cells or dendritic cells is extracted and utilized for in vivo therapy as in Examples 30-34. While the HPV-E7 is exemplified herein, the method is applicable to other viruses which are known to be associated or etiopathogenic in the malignant state including but not limited to adenovirus, EB virus, herpesvirus, hepatitis B, cytomegalovirus and Kaposi's sarcoma herpesvirus.

Superantigens Fused to Invasins

Superantigens are fused to nucleic acids encoding invasin molecule or the integrin binding sequences of the invasin molecule. Invasin is a 986 amino acid outer membrane protein that tightly binds at least five different β,-chain integrins prior to uptake in cultured cells (Isberg et al., 1987; Isberg and Leong, 1988, E. Krukonis and R. R. Isberg, unpublished observation). The C-terminal 192 amino acids of the protein contains the integrin binding activity of invasin (Leong et al., 1990) and this region is also sufficient to promote entry when used to coat non-invasive bacteria, such as S. aureus (Rankin et al., 1992). The N-terminal portion of invasin is required for secretion to and proper localization within the bacterial outer membrane (Leong et al, 1990). Integrins are a large family of heterodimeric recepto' that mediate a variety of cell-cell and cell-extracelluh matrix interactions (Hynes et al., 1992). In addition, residues within an 11-amino acid region encompassing residues 903-913 are also critical for cell binding. One of these residues, aspartate 911 (Asp-911), appears to be absolutely essential for binding, as changes at this position result in complete loss of integrin binding.

The Yersinia pseudotuberculosis invasin protein mediates bacterial entry into mammalian cells by binding multiple β-chain integrins. Integrins are a large family of heterodimeric receptors that mediate a variety of cell-cell and cell-extracellar matrix interactions (Hynes et al., 1992). Invasin binding to purified αv5βt integrin is inhibited by Arg-Gly-Asp (RGD)-containing peptides, although invasin contains no RGD sequence. The inv gene has been cloned (Young V B et al., Mol. Microbiol. 4: 1119-1128 (1990)

Fifteen mutations that diminished binding and bacterial entry were isolated after mutagenesis of the entire inv gene. All of the mutations altered residues within the C-terminal 192 amino acids of invasin, previously delineated as the integrin binding domain, and 10 of the mutations fell within an 11 residue region. When this small region is subjected to site-directed mutagenesis, almost half of the 35 mutations generated decreased invasin-mediated entry. D911 within this region is the most critical residue, as even a conservative glutamate substitution abolished bacterial penetration.

The fusion protein consisting of a superantigen (SEs, SPEs or Yersinia and other non SE or SPEA superantigens) fused to an invasin are prepared as in Example 5. They are used for treatment of established and metastatic tumor or as a preventative vaccine as described in Examples 14-16, 18-23.

Examples 1 and 2 below in their entirely are provided in provisional application No. 60/151,470, filed on Aug. 30, 1999 which is incorporated in entirety by reference.

EXAMPLE 1

Preparation of Plasmids for Making DNA Templates for any Gene of Interest and the Process of Transfection

EXAMPLE 2

Cells Transfected with Nucleic Acids Encoding SAgs

EXAMPLE 3

Chemical Conjugation of SAg Nucleic Acids to VTs, Apolipoproteins, HPV Epitopes or Other Polypeptides/Proteins Listed in Tables I and II

The following section describes actual physical conjugates between poly- or oligonucleotides and peptides or proteins. SAg nucleic acid conjugates are prepared by chemical modification of nucleic acids at specific sites within individual nucleotides or within oligonucleotides such that a protein can be bound to a DNA or RNA polymer.

Derivatization may be accomplished through discrete sites on the available bases, sugars, or phosphate groups to create primary amines, sulfhydryls, carboxylates or phenolates. The chemical modification of nucleic acids can encompass several strategies. The initial derivatization may be the addition of a spacer arm to a particular reactive group on the nucleotide structure. Such a spacer typically contains a terminal functional group, such as an amine, that can be used to couple another molecule. The spacer may be used to react with a cross-linking agent, such as a heterobifunctional compound that can facilitate the conjugation of a protein or another molecule to the modified nucleotide.

If enzymatic methods are used to incorporate a small spacer into an oligonucleotide, subsequent chemical conjugation steps still are needed to add the protein moiety. In some cases, if an oligonucleotide contains the appropriate functional group, a protein may be directly coupled using chemical methods. Many of the chemical derivatization methods employed in these strategies involve the use of an activation step that produces a reactive intermediary. The activated species then can be used to couple a molecule containing a nucleophile, typically a primary amine.

A preferred method is to amidate the 5′ PO4 of the oligonucleotide with EDC and then couple cystanmine to the 5′ amidated oligonucleotide. EDC will add an amide to the oligonucleotide to form a phosphoramidate linkage. After the addition of cystamine the disulfide is reduced with an agent such as dithiothreitol (DTT) to produce a free 5′ sulfhydryl. The derivatized oligonucleotide is then coupled to a protein chain (e.g., a verotoxin A or B chain) that has been activated with a heterobifunctional cross-linker such as succinimidyl 4(N-maleimidomethyl)cyclohexane 1-carboxylate (SMCC) which reacts with the amines on the protein which then react with the sulfhydryls on the derivatized oligonucleotide. N-succinimidyl S-actylthioacetate (SATA) is useful for adding a free thiol or sulfhydryl group to a molecule lacking this moiety. With this modification, “protected” sulfhydryl is formed which may be stored indefinitely in this protected state.

When needed, the acetyl group on the protected sulfhydryl is removed to reveal the sulfhydryl for conjugation to another molecule. A heterobifunctional agent such as SMCC or N-Succinimidyl 3-(2-pyridylthio)propionate (SPDP) may be directly added to the amidated oligonucleotide phosphate group to produce a free sulfhydryl unit for reactivity with the protein or peptide.

Chemical Conjugation of Polypeptides/Proteins to SAg DNA via Carbodiimide Reaction with the 5′-Phosphates (Phosphoramidate Formation)

The water-soluble carbodiimide EDC, rapidly reacts with a carboxylate or phosphate to form an active complex able to couple with a primary amine-containing compound. The carbodiimide activates an alkyl phosphate group to a highly reactive phosphodiester intermediate. Diamine spacer molecules or anine-containing peptides then may react with this active species to form a stable phosphoramidate bond. Alternatively, bis-hydrazide compounds may be coupled to DNA using this protocol to yield a terminal hydrazide functional group able to react with aldehyde-containing molecules (Ghosh et. al., 1989). These methods permit specific labeling of SAg DNA only at the 5′ end.

The following protocol describes the modification of SAg DNA or RNA oligonucleotides at their 5′-phosphate ends with a bis-hydrazide compound, such as adipic acid dihydrazide or carbohydrazide. A similar procedure for coupling the diamine compound cystamine is described below.

Protocol

1. Weigh out 1.25 mg of the carbodiimide 1-ethyl-3-(3-dimethylamino-propyl)carbodiimide hydrochloride (EDC) into a microfuge tube.

2. Add 7.5 μl of SAg RNA or DNA that has 5′ phosphate groups. The concentration of the oligonucleotide should be 7.5-15 nmol or a total of about 57-115.5 μg. Also immediately add 5 μl of 0.25 M bis-hydrazide compound dissolved in 0.1 M imidazole, pH 6.

3. Mix (e.g., by vortexing) and centrifuge in a microfuge for 5 min at maximal rpm.

4. Add an additional 20 μl of 0.1 M imidazole, pH 6. Mix and allow to react for 30 mm at room temperature.

5. Purify the hydrazide-labeled oligonucleotide by gel filtration on Sephadex G-25 using 10 mM sodium phosphate, 0.15 M NaCl, 10 mM EDTA, pH 7.2. The oligonucleotide now may be conjugated with an aldehyde-containing molecule.

Sulfhydryl Modification of SAg DNA

Creating a sulfhydryl group on SAg DNA allows conjugation reactions to be done with sulfhydryl-reactive heterobifunctional cross-linkers providing increased control over the derivatization process. Proteins are activated with a cross-linking agent containing an amine-reactive and a sulfhydryl-reactive end, such as SPDP, leaving the sulfhydryl-reactive portion free to couple with the modified DNA molecule. Having a sulfhydryl group on the SAg DNA directs the coupling reaction to discrete sites on the nucleotide strand, thus better preserving hybridization ability in the final conjugate. In addition, heterobifunctional cross-linkers of this type allow two- or three-step conjugation procedures which result in better yield of the desired conjugate than do homobifunctional reagents.

Cystamine Modification of 5′ Phosphate Groups on Superantigen Nucleotides Using EDC

SAg DNA or RNA is modified with cystamine at the 5′ phosphate groups using the carbodiimide reaction described above. In some procedures, the reaction is carried out in a two-step process by first forming a reactive phosphorylimidazolide by EDC conjugation in an imidazole buffer. Next, cystamine is reacted with the activated oligonucleotide, causing the inidazole to be replaced by the amine and creating a phosphoramidate linkage. Reduction of the cystamine-labeled oligonucleotide using a disulfide reducing agent releases 2-mercaptoethylamine and creates a thiol group.

Protocol

1. Weigh out 1.25 mg of the carbodiimide 1-ethyl-3-(3-dimethylamino-propyl)carbodiimide hydrochloride (EDC) into a microfuge tube.

2. Add 7.5 μl of SAg RNA or DNA that has 5′ phosphate groups. The concentration of the oligonucleotide should be 7.5-15 nM or a total of about 57-115.5 .mu.g. Also immediately add 5 μl of 0.25 M cystamine in 0.1 M imidazole, pH 6.

3. Mix (e.g., by vortexing) and centrifuge in a microfuge for 5 min at maximal rpm.

4. Add an additional 20 μl of 0.1 M imidazole, pH 6. Mix and allow to react for 30 mm at room temperature.

5. For reduction of the cystamine disulfides, add 20 μl of 1 M DTT and incubate at room temperature for 15 mm. This will release 2-mercaptoethylamine from the cystamine modification site and create the free sulfhydryl on the 5′ terminus of the oligonucleotide.

6. Purify the SH-labeled oligo by gel filtration on Sephadex G-25 using 10 mM sodium phosphate, 0.15 M NaCl, 10 mM EDTA, pH 7.2. The oligonucleotide now may be used to conjugate with an activated protein containing a sulfhydryl-reactive group.

SPDP Modification of Amines on Superantigen Nucleotides

SAg DNA that has been modified with an amine-terminal spacer arm may be thiolated to contain a sulfhydryl residue. Theoretically, any amine-reactive thiolation reagent may be used to convert an amino group on a SAg DNA molecule into a thiol. A preferred reagent both for cross-linking and for thiolation reactions is the heterobifunctional reagent SPDP. The NHS ester end of SPDP reacts with primary amine groups to produce stable amide bonds. The other end of the cross-linker contains a thiol-reactive pyridyldisulfide group that also can be reduced with DTT to create a free sulfhydryl. The reaction of a 5′-diamine-modified SAg DNA oligonucleotide with SPDP proceeds under mildly alkaline conditions (optimal pH 7-9) yields the pyridyldisulfide-activated intermediate. This derivative can be used to couple directly with sulfhydryl-containing compounds, or it may be converted into a free sulfhydryl for coupling to thiol-reactive compounds. In an alternative approach, 2,2′-dipyridyldisulfide is used to create reactive pyridyldisulfide groups on a reduced 5′-cystamine-labeled SAg oligonucleotide. This derivative then can be used to couple with sulfhydryl-containing molecules, forming a disulfide bond. Reduction of the pyridyldisulfide end after SPDP modification releases the pyridine-2-thione leaving group and generates a terminal-SH group.

Protocol

1. Dissolve the amine-modified SAg oligonucleotide to be thiolated in 250 μl of 50 mM sodium phosphate, pH 7.5.

2. Dissolve SPDP at a concentration of 6.2 mg/ml in DMSO to make a 20 mM stock solution. Alternatively, LC-SPDP may be used and dissolved at a concentration of 8.5 mg/ml in DMSO (also makes a 20 mM solution). If the water-soluble Sulfo-LC-SPDP is used, a stock solution in water may be prepared just prior to addition of an aliquot to the thiolation reaction. In this case, prepare a 10 mM solution of Sulfo-LC-SPDP by dissolving 5.2 mg/ml in water. Since an aqueous solution of the cross-linker will degrade by hydrolysis of the sulfo-NHS ester, it should be used quickly.

3. Add 50 μl of the SPDP (or LC-SPDP) solution to the SAg oligonucleotide solution. Add 100 μl of the Sulfo-LC-SPDP solution, if the water-soluble cross-linker is used. Mix.

4. Allow to react for 1 h at room temperature.

5. Remove excess reagents from the modified SAg oligonucleotide by gel filtration. The modified oligonucleotide now may be used to conjugate with a sulfhydryl-containing molecule, or it may be reduced to create a thiol for conjugation with sulfhydryl-reactive molecules.

6. To release the pyridine-2-thione leaving group and form the free sulfhydryl, add 20 .mu.l of 1M DTT and incubate at room temperature for 15 mm. If present in sufficient quantity, the release of pyridine-2-thione is followed by its characteristic absorbance at 343 nm (ε=8.08×103 M−1 cm−1). For many oligonucleotide modification applications, however, the leaving group will be present in too low a concentration to be detectable.

7. Purify the thiolated oligonucleotide from excess DTT by dialysis or gel filtration using 50 mM sodium phosphate, 1 mM EDTA, pH 7.2. The modified oligonucleotide should be used immediately in a conjugation reaction to prevent sulfhydryl oxidation and formation of disulfide cross-links.

N-succinimidyl S-actylthioacetate (SATA) Modification of Amines on Superantigen DNA Nucleotides

SAg oligonucleotides containing amine groups introduced by enzymatic or chemical means may be modified with SATA to produce protected sulfhydryl derivatives. The NHS (N-hydroxylsuccinimide) ester end of SATA reacts with a primary amine to form a stable amide bond. After modification, the acetyl protecting group can be removed as needed by treatment with hydroxylamine under mildly alkaline conditions. The result is terminal sulfhydryl groups that can be used for subsequent labeling with thiol-reactive probes or activated-protein derivatives.

Protocol

1. Dissolve the amine-modified SAg oligonucleotide to be thiolated in 250 .mu.l of 50 mM sodium phosphate, pH 8.

2. Dissolve SATA in DMF at a concentration of 8 mg/ml.

3. Add 250 μl of the SATA solution to the oligo solution. Mix.

4. React for 3 h at 37° C.

5. Remove excess reagents by gel filtration.

6. To deprotect the thioacetyl group, add 100 μl of 50 mM hydroxylamine hydrochloride, 2.5 mM EDTA, pH 7.5, and react for 2 h.

7. The sulfhydryl-containing oligonucleotide may be used immediately to conjugate with a sulfhydryl-reactive label, or it can be purified from excess hydroxylamine by gel filtration.

Conjugation of a Polypeptide to SAg DNA

As indicated, the DNA molecule must be modified to contain one or more suitable reactive groups, such as nucleophiles like amines or sulfhydryls. The modifications that employ enzymatic or chemical methods can result in random incorporation of modification sites or can be directed exclusively to one end of the DNA molecule, e.g., 5′ phosphate coupling.

Some of the more common procedures for preparing DNA-polypeptide conjugates are given below.

Polypeptide (e.g., VT) Conjugation to Cystamine-Modified SAg DNA Using Amine- and Sulfhydryl-Reactive Heterobifunctional Cross-Linkers

Cystamine groups are added to the 5′ phosphate of SAg DNA as described above. Once a sulfhydryl-modified DNA has been prepared, the following protocol may be used. The protein is activated with SPDP. Reacting the SAg DNA probe in excess allows easy separation of uncoupled SAg oligonucleotide from conjugated molecules.

Protocol

1. Dissolve a 5′-sulfhydryl-modified SAg oligonucleotide in water or 10 mM EDTA at a concentration of 0.05-25 μg/.mu.l. Calculate the total nanomoles of oligonucleotide present based on its molecular weight.

2. Add 0.15M NaCl, 10 mM EDTA, pH 7.2. Add the oligonucleotide solution to the activated protein in a 10-fold molar excess.

3. React at room temperature for 30 mm with gentle mixing.

4. The protein-DNA conjugate is purified away from excess SAg oligonucleotide by dialysis or gel filtration, or through the use of centrifugal concentrators. Centricon-30 concentrators (Amicon) that have a molecular weight cutoff of 30,000 are also used to remove unreacted oligonucleotides. Since the polypeptide molecular weight is approximately 140,000 and the conjugate is even higher, a relatively small DNA oligomer will pass through the membranes of these units while the conjugate will not. To purify the prepared conjugate using Centricon-30s, add 2 ml of the phosphate buffer from step 2 to one concentrator unit, then add the reaction mixture to the buffer and mix. Centrifuge at 1000 g for 15 mm or until the retentate volume is about 50 μl. Add another 2 ml of buffer and centrifuge again until the retentate is 50 μl. Invert the Centricon-30 unit and centrifuge to collect the retentate in the collection tube provided by the manufacturer.

Administration of Peptide-DNA (pDNA), Naked DNA, or Protein or Peptide Conjugates

Naked DNA, pDNA, nucleic acid-peptide or -polypeptide conjugates or genetic fusion products are administered parenterally (for example, iv, ip, im, subcutaneously, intrathecally, intratumoral, rectally, transcutaneously) or orally. Administration may also be by a gene gun using a 1 ml syringe and a 28 gauge needle. The nucleic acid is administered intradermally or intramuscularly in a total volume of 100 μl. A Tyne applicator is used to deliver doses of 1-1000 μg of DNA at 3× weekly intervals. SAg-encoding nucleic acid is injected directly into the tumor. The nucleic acid either contains or does not contain immunostimulatory sequences that induce activation of T cells and skew the response toward production of TH1 cytokines For example, if nucleic acids encoding a tumor associated antigen are used then the nucleic acids are engineered to incorporate ISS sequences in order to fully activate a TH1 response. Likewise, if nucleic acid encoding a tumor associated antigen is cotransfected with nucleic acid encoding a SAg, then one of the nucleic acid constructs is engineered to contain an ISS.

Viral DNA, nucleic acid expression cassettes or plasmids or bacteriophages encoding the constructs given in Table II may be used for in vivo immunization in place of naked DNA. Viruses may also acquire the α-Gal epitope after transfection into tumor cells which contain the α-galactosyltransferase enzyme either naturally or via transfection. The virus must possess the intact N-acetyllactosamine substrate for the galactosyl-transferase in order to express the αGal. The viruses shedding from these cells will express the αGal epitope. The virus also contains peptide sequences for SAg and tumor associated antigen acquired from the tumor cells which were previously transfected with nucleic acids encoding SAg and tumor antigen. The shed virus may also express staphylococcal or streptococcal hyaluronidase and capsular polysaccharide sequences obtained from host tumor cell or accessory cells previously transfected with nucleic acids encoding these genes. The shed virus expressing Gal, SAg, hyaluronidase and capsular polysaccharide is capable of initiating a potent tumoricidal response when administered to hosts with established tumors or when used as a tumor vaccine against potential tumors.

These constructs are also used as vaccines. Further, the nucleic acid construct is pre-processed ex vivo in muscle cells before selective delivery into host tumor tissue. Cationic liposomes or other liposomes or drug carriers well known in the art are used as vehicles to deliver the nucleic acids in vivo.

The transfection process is also carried out ex vivo. Nucleic acids encoding SAgs together with the nucleic acid constructs given in Table II are transfected into tumor cells of all types and antigen presenting cells such as MHC class I and class II as well as APCs expressing CD1 and mannose receptors. These include but are not limited to DCs, immunocytes, monocytes, macrophages, and fibroblasts. SAg is transfected alone or together with one or more of the above constructs given in Table II. The transfected cell expresses/secretes preferentially a SAg plus an immunogenic oncogene product, anti-angiogenesis factor, glycosylceramide, LPS or Gal. The transfectants present their gene products on cell surface receptors such as conventional MHC molecules for SAgs or in the case of the glycosylceramides or LPS on a CD-1 or mannose receptor, an APC. Glycosylated SAgs show preference for presentation on mannose receptors.

EXAMPLE 4

SAgs, Tumor Antigens, Glycosylceramides, LPS's, Binary and Ternary Complexes Applied to MHC Class I, Class II, CD1 or Mannose Receptors

Example 4 in entirety is in provisional application No. 60/151,470, filed on Aug. 30, 1999 incorporated herein in entirety by reference.

EXAMPLE 5

SAg Conjugation to Glycosylceramides Gangliosides LPS's, Glycans, Peptidoglycans Lipoproteins, oxyLDL and Lipoarabinomannans

Selection of the SAg peptide to be used for coupling is governed by several criteria. In practice, a 10-15 residue peptide is selected. For SAgs, the sites chosen for coupling are those presumed not to be vitally involved in T cell binding and activation. In most SAgs, these sites are broadly distributed throughout the molecule. They are available at flexible regions of the protein and on reverse turns or loop structures. C termini are more mobile than the rest of the molecule and frequently exposed on the protein surface. This region is accessible to be coupled to another ligand especially using m-maleimidobenzoyl-N-hydroxysuccinimid-e ester (MBS) via a Cys residue that has been added to the N terminus of the peptide. By coupling the peptide via its N-terminal end, the peptide is exposed in a fashion similar to that found in the native antigen. Additional criteria for selection of the coupling site such as exposed hydrophilic regions, secondary structure, hydropathicity profiles, and probability of helix formation may not be useful. However, care is taken not to disrupt predicted polysaccharide attachment sites, most notably the sequence Asn-X-Ser or Asn-X-Thr, which predicts the presence of Asn-linked polysaccharide moieties. In addition to location of transmembrane regions, Asn-linked glycosylation sites and sites of signal sequence cleavage are all important. After due consideration, the C using 7-15 residues terminus is preferred and is modified to accommodate MBS. This procedure requires a free sulfhydryl group on the synthetic peptide and free amino groups on the ligand. Therefore, to use this method, it is necessary to add a Cys residue to the C or N terminus of the peptide.

Biochemical Conjugation Methods:

SAgs are conjugated to polysaccharide containing structures using several methods well described in the art (Hermanson, G T Bioconjugate Techniques Academic Press, San Diego, Calif. 1996). Two methods are given here one utilizing the isolated complex carbohydrate obtained from the purified ganglioside which is then chemically conjugated to SAg and in another method wherein the ganglioside and SAg are both incorporated into a liposomal membrane. Either method is used to produce complexes which are included within the scope of this invention. However they are by no means exhaustive of all the techniques which could be employed to conjugate human tumor antigens to SAg molecules. Other conjugation strategies may be utilized to produce an immunologically active complex as described by this invention. (See Offord, R E. in Protein Engineering

ed. A R Rees, Oxford, 1992)

Direct Conjugation of Ganglioside, LPS or Peptidoglycan to SAg Molecules

1. Ganglioside or LPS antigens are purified and are then dissolved in aqueous solution at pH 6.0 at a concentration of 1.0 mM/ml

2. Endoglycoceramidase from Rhodococcus (Genzyme) is added to the ganglioside solution to a level of 5 milliunits. The solution is incubated overnight at 37° C. with gentle agitation. The endoglycoceramidase specifically cleaves at the ceramide-polysaccharide bond liberating ceramide and clipping off the complex carbohydrate making up the ganglioside

3. The polysaccharide is isolated by HPLC size exclusion chromatography or by ultrafiltration

4. SAg is dissolved in 1M sodium phosphate, 0.15 M NaCl, pH 7.5, at a concentration of 1 mg/ml. The purified polysaccharide antigen is added to this solution to a concentration of at least 1 mM/ml.

5. In a fume hood, 20 microliters of 5 M sodium cyanoborohydride solution in 1 M NaOH (Aldrich) is added to each ml of the SAg solution.

6. The reaction is mixed gently and incubated at room temperature for 72 hours or 4° C. for 1 week. This reaction reductively aminates the reducing end of the polysaccharide (at the point it was cleaved by the endoglycoceramidase) to the amine groups on the SAg protein creating stable conjugate coupled through a secondary amine linkage. The degree of polysaccharide coupling can be controlled by limiting the time of reaction.

7. Remove unreacted carbohydrate and cyanoborohydride by gel filtration on Sephadex G-25 or by dialysis.

In a second method, SAg-GalCer, SAg-GalCer-CD1, SAg-glycosphingolipid, or SAg-glycosphingolipid-CD1 complexes are produced which have the added benefit of presenting the glycosylceramide in a polyvalent array which is important for high affinity binding to complementary receptors. They retain nearly all of their original structure including most of the ceramide moiety and the entire oligosaccharide chain. The principle of preparation derived from Mahoney, J A et al., Meth. Enzymol 242: 17-27 (1994) is as follows. The fatty acid amide is hydrolyzed from the intact ganglioside converting it to its lyso form which has a unique primary amine at the 2-position of sphingosine. The lysoganglioside is treated with a bifunctional cross-linking reagent, succinimidyl 4(N-maleimidomethyl) cyclohexane 1-carboxylate (SMCC), which forms an amide bond to the 2-position of sphingosine and results in a sulfhydryl-reactive maleimidyl moiety attached through a linker arm, to the original position of the fatty acid amide on the ceramide portion of the ganglioside. The SAg protein is treated with a reagent, N-succinimidyl S-acetylthioacetate (SATA), which converts the lysine e-amino groups to acetylated sulfhydryls. Subsequent treatment with hydroxylamine reveals the desired free sulfhydryls. Treatment of sulfhydryl-derivatized SAg with maleimidyl derivatized ganglioside results in a stable thioester linkage between the ganglioside and the protein. The final product is chromatographically purified and characterized by protein and carbohydrate analysis. The SAg-GalCer or SAg-glycosphingolipid complex is then loaded onto a soluble CD1 receptor.

LPS's and peptidoglycans are conjugated to SAg by methods well described in the art. The most convenient and preferred method to target specifically the polysaccharides on the protein is through mild sodium periodate oxidation. Periodate cleaves adjacent hydroxyl groups in sugar residues to create highly reactive aldehyde functional groups. The generated aldehydes are used to in coupling reactions with amine or hydrazide containing molecules to form covalent linkages. Amines react with formyl groups under reductive amination conditions using a suitable reducing agent such as sodium cyanoborohydride. The result of the reaction is a stable secondary amine linkage. Hydrazides spontaneously react with aldehydes to form hydrazone linkages, although the addition of a reducing agent greatly increases the efficiency of the reaction and the stability of the bond. (See Hermanson, G T. Bioconjugate Techniques, Academic Press, San Diego Calif. 1996).

Genetic Fusion of SAgs to LPS's

N-linked glycosylation occurs exclusively in the ER, where Glc3Man.9GlcNAc2 is added to Asn residues present in the sequence Asn X Ser/Thr (X, any residue except Pro). To produce a glycosylation site on a SAg capable of binding a LPS, recombinant vaccinia virus expressing SAg is produced with Gln149 or Asn149 directed to the ER by appendage of NH2-terminal ER insertion, The SAg is directed to the secretory pathway using signal sequence from IFN. Recombinant vaccinia viruses(rVVs) expressing TAP and SAg nucleoprotein are used. The full length SAg gene modified by standard molecular genetic methods to encode glycosylation sites is inserted into the thymidine kinase locus of vaccinia viruses (VVs) by homologous recombination as described using the pSX11 plasmid to express foreign proteins under the control of the VV p7.5 early/late promoter. SAg nucleoprotein is directed to the secretory pathway using the signal sequence from IFN.quadrature. The SAg coding sequences of all of the rVVs are verified by sequencing PCR-amplified copies of full-length NP genes isolated from the rVV. The resulting SAg-LPS or SAg-lipoprotein complexes are used to immunize a population of T or NKT effector cells for use in the adoptive immunotherapy of cancer (Examples 2, 5, 7 15, 16, 18-23). They may be preloaded onto CD1 or MHC Class I or II receptors on APCs as described below in the course of ex vivo immunization. These complexes may also be used in vivo as a preventative or therapeutic antitumor vaccine as in Example 14, 15, 16, 18-23).

Preparation of Fusion Proteins

Preferred fusion proteins comprise SAgs linked to other proteins or peptides such as VTs or their A and B subunits, IFNα receptors, CD19 peptides or carbohydrate recognition units which are designed to target the SAg to glycosphingolipid receptors on tumor cells or αvβ3 . ligand Arg-Gly-Asp or αvβ5 ligand Asn-Gly-Arg in vivo or in vitro. These fusion proteins induce apoptosis of the tumor cells. The fusion proteins are produced by conventional methods in a variety of cells using a variety of vectors such as phage lambda regulatory sequences. Techniques are well established for producing fusion proteins that include the lacZ protein (β-galactosidase), trpE protein, glutathione-S-transferase, and thioredoxin. Expression in E. coli is most conventional but baculoviral expression systems are also useful. Fusion proteins are produced in bacteria by placing a strong, regulated promoter and an efficient ribosome-binding site upstream of the cloned gene. Exemplified below is a procedure using a representative lacZ vector. However, it should be recognized that other vectors well known in the art would be useful. Plasmids encoding the above proteins are prepared as previously described.

Construction of Expression Plasmids and Detection of Fusion Proteins

1. The appropriate pUR (or pEX or pMR100) vector is ligated in-frame to cDNA fragments to be expressed as fusion partners using the above plasmids to create an in-frame fusion. cDNA encoding the verotoxins may be obtained from Dr. G. Lingwood, University of Toronto; murine p31 Ii are from Dr. R. Germain, National Institutes of Health and J. Miller, University of Chicago.

2. Bacteria of the following strains are transformed: E. coli K12 71/18 or JM103 with pUR vectors, M5219 with pEX vectors or LG90 for pMR100 vectors. The cells are plated on LB medium containing ampicillin (100 μg/ml) and incubated overnight at 37° C. (or 30° C. in the case of the pEX vector). MacConkey lactose indicator plates should be used for pMR100.

3. Individual colonies are tested for the presence of the desired insert by plasmid minipreps.

If most of the colonies can be assumed to contain a cDNA (because directional cloning or a dephosphorylated vector was used in step 1), they can be screened for protein production in parallel (see step 4b). If not, clones that contain a cDNA, as determined by plasmid minipreps, can be screened for protein expression later. cDNA inserts into a pMR100 plasmid can be detected readily as red colonies on the MacConkey lactose indicator plates.

4. Colonies are screened as follows for expression of the fusion protein.

a. Grow small cultures from 5-10 colonies in LB medium containing ampicillin (100 μg/ml). Incubate overnight at 37° C. (or at 30° C. for pEX).

b. Inoculate 5 ml of LB medium containing ampicillin (100 μg/ml) with 50 μl of each overnight culture. Incubate for 2 hours at 37° C. (or at 30° C. for pEX) with aeration. Remove 1 ml of uninduced culture, place it in a microfuge tube, and process as described in steps d and e. If screening for protein production is being done in parallel, prepare plasmid minipreps from 1-ml aliquots of the overnight cultures.

c. Induce each culture as follows: For pUR or pMR100 vectors, add isopropylthio-.quadrature.-D-galactoside (IPTG) to a final concentration of 1 nM and continue incubation at 37° C. with aeration. For pEX vectors, transfer the culture to 40° C. and continue incubating with aeration.

d. At various time points during the incubation (i.e., 1, 2, 3, and 4 hours), transfer 1 ml of each culture to a microfuge tube, and centrifuge at 12,000 g for 1 minute at room temperature in a microfuge. Remove the supernatant by aspiration. The kinetics of induction varies with different proteins, so it is necessary to determine the time at which the maximum amount of product is produced.

e. Resuspend each pellet in 100 μl of 1×SDS gel-loading buffer, heat to 100° C. for 3 minutes, and then centrifuge at 12,000 g for 1 minute at room temperature. Load 15 μl of each suspension on a 6% SDS polyacrylamide gel. Use suspensions of cells containing the vector alone as a control. (For pEX and ORF vectors, also use β-galactosidase as a control.) The fusion protein should appear as a novel band migrating more slowly than the intense β-galactosidase band in the control. It is not uncommon for a protein the size of β-galactosidase to be present along with the fusion protein.

Composition of 1×SDS gel-loading Buffer

50 mM Tris Cl (pH 6.8)

100 mM dithiothreitol (DTT)

2% SDS (electrophoresis grade)

0.1% bromophenol blue

10% glycerol

1.times.SDS gel-loading buffer lacking dithiothreitol can be stored at room temperature. Dithiothreitol should then be added, just before the buffer is used, from a 1 M stock.

Chimeric Enterotoxins

Likewise, hybrid or chimeric SAgs that are non-immunogenic are used to stimulate cells. When these molecules are injected into hosts that have natural antibodies, they are not rapidly eliminated from the circulation. Such chimeric molecules lacking the binding site for natural antibodies preserve the T cell mitogenic and cytokine-inducing properties of the native SAg. A peptide sequence from another SAg to which antibodies do not exist is substituted using genetic or biochemical methods well known in the art. This is particularly useful in the case of enterotoxins such as SEB or SEA to which a large percentage of humans have naturally occurring circulating antibodies. The antibody binding region of these molecules near the C terminal regions is delineated. The substitution of the antibody binding sequences in SEA or SEB for sequences from SEE or SED to which a very small number of humans have circulating antibodies markedly enhances the tumor killing efficacy of the injected chimeric enterotoxins.

A hybrid molecule consisting of a 26 amino acid peptide corresponding to the N-terminal portion of SEA, the loop structure of SEA, a conserved mid-molecular sequence of SEA and SEB, and a C terminal sequence of SEB was synthesized in collaboration with Multi-Peptide Systems, La Jolla, Calif. Peptides were prepared using a variation of Merrifield's original solid phase procedure in conjunction with simultaneous multiple peptide synthesis using t-Boc chemistries. Peptides were cleaved from the resins using simultaneous liquid HF cleavage. The cleared peptides were then extracted with acetic acid and ethyl ether and lyophilized. Reverse phase HPLC analysis and mass spectral analysis revealed a single major peak with the molecular weight corresponding closely to theoretical.

Synthetic SAgs

Amino acid sequences of SEA and SEB known to be involved in the interaction with the TCR and MHC class II molecules are retained. The loop structure of SEA is retained because it is devoid of histidine moieties that are associated with the emetic response. Residues 1-10 of the N-terminal region of SEA are retained because they have MHC class II binding activity. The loop structure of SEA is retained because it and associated disulfide linkages are considered to be important for T lymphocyte mitogenicity, stabilization of the molecule, and resistance to in vivo degradation. A conserved sequence in the central portion of SEA and SEB adjacent to the disulfide loop (amino acids 107-114) was retained. Histidine moieties are deleted from the molecule because of their association with the emetic response.

Synthesis Procedure

The preparation of all peptides was carried out using a variation of Merrifield's original solid phase procedures in conjunction with the method of Simultaneous Multiple Peptide Synthesis using t-Boc chemistries (Merrifield R B I, J. Amer. Chem. Soc. 85:2149-2154 (1963)); Houghten R A, Proc. Natl. Acad. Sci. USA 82:5131-5135 (1985); and Houghten R A et al., Intact. J. Peptide Protein Res. 27:673-678 (1985)).

4-methylbenzhydrylamine (mBHA) and phenylacetamidomethyl (PAM) resins were purchased from Advanced Chemtech (Louisville, Ky.) and Bachem (Torrance, Calif.), respectively. All of the amino acids contained the t-butyloxycarbonyl (t-Boc)-amino protecting group and were purchased from Bachem. The side chain protecting groups included benzyl (threonine, serine and glutamic acid), chlorobenzyloxycarbonyl (lysine), bromobenzyloxycarbonyl (tyrosine), cyclohexyl (aspartic acid), p-toluene sulfonyl (arginine), formyl (tryptophan), methyl benzyl (cysteine), and dinitrophenyl or benzyloxycarbonyl (histidine). Cysteine with the HF stable acetamidomethyl (ACM) protecting group was used, upon request, for internal cysteines. Each lot of amino acid derivative was tested by melting point analysis. Reagent grade methylene chloride (CH2Cl2), isopropanol (IPA), and dimethylformamide (DMF) were obtained from Fisher Scientific (Tustin, Calif.). diisopropylcarbodiimide (DIPCDI) and diisopropylethylamine (DIEA) were purchased from Chem Impex (Wood Dale, Ill.). Trifluoroacetic acid was purchased from Halocarbon (Hackensack, N.J.).

The appropriate resin, mBHA for C-terminal amides and PAM for C-terminal acids, was weighed with a Mettler AE 240 balance (Highstown, N.J.) into separate polypropylene mesh (74 mm) packets which had been pre-sealed on 3 of 4 sides using a TSW TISH-300 Impulse Sealer (San Diego Bag and Supply; San Diego, Calif.). Each packet was also pre-labeled with a reference code using a KOH I NOOR Rapidograph pen with graphite based ink to allow them to be easily identified during resin addition and during the synthesis process. Each packet was then carefully sealed completely to make sure there would be no resin leakage. All the resin containing packets (up to 150) were then placed in a common Nalgene bottle. Enough CH2Cl2 to cover all the packets was then added to the bottle, which was then capped and vigorously shaken for 30 seconds on an Eberbach Shaker (Fisher Scientific; Tustin, Calif.) to wash and swell the resin. The CH2Cl2 solution was then removed. All subsequent steps involved the addition of enough solvent to cover all the packets and vigorous shaking to ensure adequate solvent transfer. The N-t-Boc was removed by acidolysis using a solution of 55% TFA in CH2Cl2 for 30 minutes, leaving the TFA salt of the .alpha.-amino group. The TFA wash solution was then removed. The packets were then washed for 1 min with CH2Cl2 (2.times.), IPA (2.times.) and CH2Cl2 (2.times.) to squeeze out excess TFA and to prepare for neutralization. The TFA salt was neutralized by washing the packets three times with 5% DIEA in CH2Cl2 for two minutes each. This was followed by two washes with CH2Cl2 to remove excess base.

The resin packets were then removed from the common Nalgene bottle and sorted according to computer generated checklists in preparation for coupling. This was double checked to ensure the packets were added to the correct amino acid solution. The packets were then added to bottles containing the appropriate 0.2 M amino acid in CH2Cl2 and/or DMF depending on solubility. These solutions were also prepared using computer generated information. An equal volume of 0.2 M DIPCDI was then added to activate the coupling reaction. The bottles were then shaken for one hour to ensure complete coupling. At completion, the reaction solution was discarded and the packets were washed with DMF for 1 min to remove excess amino acid and the by-product, diisopropylurea. A final CH2Cl2 wash as then used to remove DMF. The packets were then removed from their individual coupling bottles and placed back into the common Nalgene bottle. The peptides were then completed by repeating the same procedure while substituting for the appropriate amino acid at the coupling juncture. The packets were then taken through a final acidolysis along with subsequent CH2Cl2, IPA and CH2Cl2 washes to leave the peptides in the TFA salt form. The packets were then dried in preparation for the next process.

Final side chain deprotection and cleavage of the anchored peptide from the resin was achieved through simultaneous liquid HF cleavage (Houghten R A et al., supra.

Gaseous N2, HF, and argon were acquired from Air Products (San Diego, Calif.). Anisole was purchased from Aldrich Chemical Co. (Milwaukee, Wis.). Acetic acid (HOAc) and ethyl ether were purchased from Fisher Scientific (Tustin, Calif.). Each packet along with a Teflon coated stir bar was placed into an individual reaction vessel of a multi-vessel hydrogen fluoride apparatus (Multiple Peptide Systems; San Diego, Calif.). An amount of anisole equaling 7.5% of the expected volume of HF was then added to act as a carbonium ion scavenger. The reaction tubes were lubricated with vacuum grease at the point where each contacts the apparatus and sealed onto the HF system. The system was then purged with N.sub.2 while cooling the reaction vessels to −70° C. using an acetone/dry ice bath. HF (g) was condensed to the desired level and temperature elevated to −10° C. using ice and water. The reaction was allowed to proceed for 90 minutes with the temperature slowly rising from −10° C. to 0° C. HF was removed using a strong flow of N2 for 90 minutes followed by the use of aspirator vacuum for 60 minutes while maintaining the temperature at 0° C. The reaction vessels were then removed from the apparatus and capped. The residual anisole was removed with two ethyl ether washes. The peptide was then extracted with two 10% HOAc washes. A 50 ml sample of the crude peptide was taken and run on an analytical Beckman 338 Gradient HPLC System (Palo Alto, Calif.) using a Vydac C18 column to profile the initial purity of the compound. The crude peptide was then lyophilized twice on a Virtis Freezemobile 24 Lyophilizer, weighed and stored under argon.

Analytical RP-HPLC was used to determine the homogeneity and approximate elution conditions of the peptides produced. HPLC grade acetonitrile (ACN) was purchased from Fisher Scientific (Tustin, Calif.). HPLC grade TFA was obtained from Pierce Chemicals (Rockford, Ill.). RP-HPLC analysis was carried out on a Beckman 338 Gradient HPLC system (Palo Alto, Calif.) equipped with a BioRad AS-100 autosampler and a Shimadzu CR4A integrator. The column used for all analyses this quarter was a Vydac C-18 column (4.6.×250 mm). The solvent system used was 0.05% aqueous TFA (A) and 0.05% TFA in ACN (B) with a flow rate of 1 ml/min. Absorbance was measured at 215 nm. Most peptides were analyzed using the following special gradient; 5.60% (B) in 28 minutes. Hydrophobic peptides were analyzed using the following special gradient: 5-40% (B) in 9 minutes, 40-90% (B) for 10 additional minutes, 95% (B) for the last 9 minutes.

Analytical data was reviewed. The product peak was identified and marked based upon knowledge of common impurities and the use of predicted HPLC retention times.

Peptides that did not meet normal purity requirements for crude material were purified using preparative RP-HPLC techniques. HPLC grade acetonitrile (CAN) was purchased from Fisher Scientific (Tustin, Calif.). HPLC grade TFA was obtained from Pierce Chemicals (Rockford, Ill.). Purification was carried out on a Waters Delta Prep 3000 with a Preparative Waters Prep Pak Module Radial Compression C18 column (5 cm.times.25 cm, 10-20 m). The solvent system used was 0.05% aqueous TFA (A) and 0.05% TFA in ACN (B). The crude peptides were solubilized in an HOAc/H.sub.20 mixture and injected onto the column with 0.25% to 0.50% ACN per minute linear gradient. The absorbance was measured at 230 nm and 40 ml fractions were collected upon elution with an ISO Fraction Collector (Lincoln, Nebr.). The preparative profile was reviewed and selected fractions were analyzed by analytical RP-HPLC. The analytical data was reviewed and fractions were combined and lyophilized. The lyophilized material was weighed, sampled for a final analytical RP-HPLC analysis and stored under argon in powder form. This process was repeated if the purity level attained was not sufficient. Mass spectral analysis was used to determine the molecular weight of the peptides produced. 95% ethanol was purchased from Fisher Scientific (Tustin, Calif.). HPLC grade TFA was obtained from Pierce Chemicals (Rockford, Ill.). Nitrocellulose matrices (targets) were purchased from Applied Biosystems (Foster City, Calif.).

The samples were solubilized in a 1:1 solution of 95% ethanol and 0.1% TFA (aqueous). The samples were applied to a nitrocellulose matrix (Target). The mass spectra were obtained using an ABI Bio-Ion 20 Mass Spectrometer (Foster City, Calif.). The apparatus makes use of plasma desorption ionization via a Cf252 source. The ionized molecules are then analyzed via time-of flight. An accelerating voltage of 15,000 V is used to accelerate the particles.

The Protocol for Intramolecular Disulfide Bridge:

Dissolve crude peptide (300-500 mg) in 200 ml of deoxygenated water and adjust the pH to 8.5 using NH4OH 28%=Solution A. Note: If the peptide is not very soluble in water, some MeOH can be added.

Dissolve 0.5 g K3Fe(CN)6 in 200 ml of deoxygenated water and adjust the pH to 8.5 using NH4OH 28%=Solution B. Note: 0.5 g K3Fe(CN)6 is an average value for 500 mg of a 10 mer peptide. The excess of K3Fe(CN)6 should be approximately 3.times. It can be adjusted.

Solution A is then dropped slowly into solution B over a 2 hour period. The mixture is then allowed to react, for an additional 1 hour with stirring. The pH is then adjusted to 4.0-4.5 with 10% ACTH. This solution is injected directly into a preparative RP-HPLC. The major peak is then collected. This “pseudo dilution” technique favors the intramolecular disulfide. Therefore, the major peak is the cyclic product.

The chimeric enterotoxin molecule was tested in normal rabbits and rabbits with established VX2 carcinoma. It was administered intravenously and peripherally with adjuvant. The chimeric molecule (1 mg/ml) was diluted initially in 1 ml of sterile H.sub.20. When the solution was clear, 9 ml of normal saline was added. The solution was filtered through a 0.45 m filter and stored in 0.5-1 ml aliquots. Dosage ranged from 2.6-5.0 mg/kg and was described over 3 minutes via the lateral ear vein in a volume of 0.05 ml diluted further in 1.0 ml of 0.15 M NaCl:

The i.v. line was then washed with 3 ml of 0.15M NaCl. In two animals, the temperature rose only 0.3° F. over the ensuing 24 hours and there was no discernible toxicity over the ensuing 14 days of observation. One animal was prescribed a second dose of the chimeric molecule in pluronic acid triblock adjuvant. This was prescribed in a dose of 8.5 mg subcutaneously in each thigh with a total dose 5 mg/kg. The pluronic acid triblock preparation was prepared as follows: 4.23 cc PBS; 0.017 cc Tween; 0.05 cc Squalene; and 0.25 cc Pluronic. The PBS and Tween were mixed first then squalene was added followed by pluronic acid. The total mixture was vortexed for 3-4 minutes. Two ml of above plus 0.34 ml of the chimeric protein (34 mg) plus 1.66 cc PBS were added to the mixture. The mixture was vortexed vigorously for 1-2 minutes. One ml was injected into each thigh (total vol. injected was 0.17 ml or 17 mg protein or 5 mg/kg).

For nearly 5 weeks after injection, no adverse effects were noted. The tumor showed slow, but progressive growth over this period of time. To date, the chimeric enterotoxin molecule appears to be safe in animals and no untoward side effects were demonstrated. The adjuvant used for these studies was the pluronic acid triblock copolymer which has been used to boost the immune response to various antigens in animal models and which is under testing at this point in humans with hepatitis and herpes simplex infections. Other adjuvants including those prepared in water and oil emulsion and aluminum hydroxide to administer various SAgs in vivo to tumor bearing rabbits were also used.

Additionally, enterotoxins such as SEE, SED, SEC, and TSST-1 are used to prepare hybrid molecules containing amino acid sequences and homologous to the enterotoxin family of molecules. To this extent, mammary tumor virus sequences, heat shock proteins, stress peptides, Mycoplasma and mycobacterial antigens, and minor lymphocyte stimulating loci bearing tumoricidal structural homology to the enterotoxin family are useful as anti-tumor agents. Hybrid enterotoxins and other sequences homologous to the native enterotoxins are immobilized or polymerized genetically or biochemically to produce the repeating units and stoichiometry required for (a) binding of accessory cells to T lymphocytes and (b) activation of T lymphocytes.

EXAMPLE 6

Example 6 in entirety is in provisional application No. 60/151,470, filed on Aug. 30, 1999. This application is incorporated herein in entirety by reference.

Targeting SAg Nucleic Acids, Phage Display Systems and Polypeptides to Tumor Sites

Parenterally administered nucleic acid is targeted to a particular cell population as follows. Nucleic acid is attached to a desialylated galactose moiety that targets asialo-orosomucoid receptors in liver cells. Nucleic acid is attached to other ligands such as transferrin and TAP-1 as well as antibodies to surface structures such as the Ley receptor. These ligands and antibodies bind to surface structures and are internalized. Thus, the attached nucleic acid is delivered to a cell of choice.

Examplee 7

General Ex Vivo Immunization Methods to Produce Tumor Specific Effector Cells for Adoptive Immunotherapy of Cancer

Example 7 in entirety is in provisional application No. 60/151,470, filed on Aug. 30, 1999. This application is incorporated herein in entirety by reference.

EXAMPLE 8

Prevention of Anergy in T or NKT Tumor Specific Effector Cells

Example 8 in entirety is in provisional application No. 60/151,470, filed on Aug. 30, 1999. This application is incorporated herein in entirety by reference.

EXAMPLE 9

Reactivation of Anergized Tumor-specific T or NKT Cells by SAg and SAg Receptors

Example 9 in entirety is in provisional application No. 60/151,470, filed on Aug. 30, 1999. This application is incorporated herein in entirety by reference.

EXAMPLE 10

Tumor Specific Effector T or NKT Cells as Lymphoid Organoids

Example 10 in entirety is in provisional application No. 60/151,470, filed on Aug. 30, 1999. This application is incorporated herein in entirety by reference.

EXAMPLE 11

Tumor Specific Effector Cells or Tumor Cells Expressing Protein A, Protein A Domains and/or Angiostatin

Example 11 in entirety is in provisional application No. 60/151,470, filed on Aug. 30, 1999. This application is incorporated herein in entirety by reference.

EXAMPLE 12

SAg Receptor

Example 12 in entirety is in provisional application No. 60/151,470, filed on Aug. 30, 1999. This application is incorporated herein in entirety by reference.

EXAMPLE 13

Avoiding Interference with SAg-Specific Antibodies

Example 13 in entirety is in provisional application No. 60/151,470, filed on Aug. 30, 1999. This application is incorporated herein in entirety by reference.

EXAMPLE 14

Pharmaceutical Compositions and their Manufacture

The pharmaceutical compositions may be in the form of a lyophilized particulate material, a sterile or aseptically produced solution, a tablet, an ampoule, etc. Vehicles such as water (preferably buffered to a physiological pH such as PBS or other inert solid or liquid material may be present. In general, the compositions are prepared by being mixed with or dissolved in, bound to or otherwise combined with one of more water-insoluble or water-soluble aqueous or non aqueous vehicles, if necessary together with suitable additives and adjuvants. It is imperative that the vehicles and conditions shall not adversely affect the activity of the conjugate. Water as such is comprised within the expression vehicles. A suitable therapeutic composition is used in the treatment of cancer of any kind including but not limited to carcinomas, sarcomas, lymphomas, leukemias and comprises a combination of:

(1) a recombinant DNA molecule encoding SAg in combination with, preferably fused with, another recombinant DNA sequence encoding another protein;

(2) a recombinant DNA molecule encoding SAg-in combination with another peptide or polypeptide; or

(3) a recombinant DNA molecule encoding a protein other than a SAg in combination with a SAg peptide or polypeptide.

These compositions that may comprise more than one components are administered together or sequentially and they may be combined (separately or together) with a delivery vehicle, preferably liposomes as disclosed herein. Upon entering its intended or targeted cells, the therapeutic composition leads to the production of SAg and a second protein that may result in (a) apoptosis of the cancer cell and (b) with or without such apoptosis, the activation of effector cells of the immune system, including any or all of the following: cytotoxic T cells, NKT cells, NK cells, T helper cells and macrophages. The present therapeutic compositions are useful for the treatment of cancers, both primary tumors and tumor metastases.

Use of the present therapeutic composition overcomes the disadvantages of traditional treatments for metastatic cancer. For example, compositions of the present invention can target dispersed metastatic cancer cells that cannot be treated using surgery. In addition, administration of such compositions is not accompanied by the harmful side effects of conventional chemotherapy and radiotherapy.

A therapeutic composition also comprises a pharmaceutically acceptable carrier defined as any substance suitable as a vehicle for delivering a nucleic acid molecule (alone or in some combination with a protein) to a suitable in vivo or in vitro site. Preferred carriers are capable of maintaining DNA in a form that is capable of entering the target cell and being expressed by the cell. Preferred carriers include: (1) those that transport, but do not specifically target a nucleic acid molecule to a cell (referred to herein as “non-targeting carriers”); and (2) those that deliver a nucleic acid molecule to a specific site in an animal or a specific cell (“targeting carriers”). Examples of non-targeting carriers are water, phosphate buffered saline (PBS), Ringer's solution, dextrose solution, serum-containing solutions, Hank's balanced salt solution, other aqueous, physiologically balanced solutions, oils, esters and glycols. Aqueous carriers can contain suitable additional substances which enhance chemical stability and isotonicity, such as sodium acetate, sodium chloride, sodium lactate, potassium chloride, calcium chloride, and other substances used to produce phosphate buffer, Tris buffer, and bicarbonate buffer and preservatives, such as thimerosal, m- and o-cresol, formalin and benzyl alcohol.

Preferred substances for aerosol delivery include surfactant substances such as esters or partial esters of fatty acids containing from about 6-22 carbon atoms. Examples are esters of caproic, octanoic. lauric, palmitic, stearic, linoleic, linolenic, olesteric, and oleic acids.

Other carriers can include metal particles (e.g., colloidal gold particles) for use with, for example, a biolistic gun through the skin.

Therapeutic compositions of the present invention can be sterilized by conventional methods and may be lyophilized.

The compositions of the present invention are delivered using a delivery vehicle that can be modified to target a particular site in a subject. Suitable targeting agents include ligands capable of selectively (i.e., specifically) binding to another molecule at a particular site. Examples are antibodies, antigens, receptors and receptor ligands. For example, an antibody specific for an antigen on the surface of a cancer cell can be placed on the outer surface of a liposome delivery vehicle to target the liposome to the cancer cell. By manipulating the chemical formulation of the lipid portion of a liposome preparation, it is possible to modulate its extracellular or intracellular targeting. For example, the charge of the lipid bilayer of a liposome surface can be varied chemically to promote fusion with cells having particular charge characteristics. Preferred liposomes comprise a compound that targets the liposome to a tumor cell, such as a ligand on the outer surface of the liposome that binds a molecule on the tumor cell surface.

Although the DNA constructs of the present invention can be administered in naked form, a liposome is a preferred vehicle for delivery in vivo. A liposome can remain stable in an animal for a sufficient amount of time, at least about 30 minutes, more preferably for at least about 1 hour and even more preferably for at least about 24 hours, to deliver a nucleic acid molecule to a desired site. A liposome of the present invention comprises a lipid composition that can fuse with the plasma membrane of the targeted cell to deliver the encapsulated nucleic acid molecule into a cell. Preferably, the liposomes' transfection efficiency is about 0.5 .mu.g DNA per 16 nmol of liposome delivered to about 10.sup.6 cells, more preferably about 1.0 .mu.g DNA per 16 nmol of liposome delivered to about 10.sup.6 cells, and even more preferably about 2.0 μg DNA per 16 nmol of liposome delivered to about 106 cells.

For use in the present invention, any liposome that is used in art-recognized gene delivery methods is appropriate. Preferred liposomes have a polycationic lipid composition and/or a cholesterol backbone conjugated to polyethylene glycol. Complexing a liposome with nucleic acids for uses described herein is achieved using conventional methods. A suitable concentration of DNA to be added to a liposome preparation a concentration that is effective for delivering a sufficient amount of DNA molecules to a cell so that the cell can produce sufficient SAg and/or a other transduced protein to induce tumoricidal activity or to stimulate or regulate effector cells in a desired manner. Preferably, between about 0.1 μg and 10 .mu.g of DNA is combined with about 8 nmol liposomes; more preferably, between about 0.5 μg and 5 μg of DNA is used even more preferably, about 1.0 μg of DNA is combined with about 8 nmol liposomes.

Another preferred delivery vehicle is a recombinant virus particle, for example, in the form of a vaccine. A recombinant virus vaccine of the present invention includes the DNA encoding the therapeutic composition packaged in a viral coat that allows entrance of the transducing DNA into a cell and its expression. A number of recombinant virus particles can be used, for example, alphaviruses, poxviruses, adenoviruses, herpesviruses, arena virus and retroviruses. Also useful as a delivery vehicle is a “recombinant cell vaccine,” preferably tumor vaccines, in which allogeneic (though histocompatible) or autologous tumor cells are transfected with a DNA preparation encoding the therapeutic proteins or peptides to be expressed. The cells are preferably irradiated and then administered to a patient by any of a number of known injection routes.

The therapeutic compositions that are administered by “tumor cell vaccine,” includes the recombinant molecules without carrier. Treatment with tumor cell vaccines is useful for primary or localized tumors as well as metastases. When used to treat metastatic cancer, which includes prevention of further metastatic disease, as well as, the cure existing metastatic disease.

As used herein, the term “treating” a disease includes alleviating the disease or any of its symptoms and/or preventing the development of a secondary disease resulting from the occurrence of the initial disease.

An “effective treatment protocol” includes a suitable and effective dose of an agent being administered to a subject, given by a suitable route and mode of administration to achieve its intended effect in treating a disease.

Effective doses and modes of administration for a given disease can be determined by conventional methods and include, for example, determining survival rates, side effects (i.e., toxicity) and qualitative or quantitative, objective or subjective, evaluation of disease progression or regression. In particular, the effectiveness of a dose regimen and mode of administration of a therapeutic composition of the present invention to treat cancer can be determined by assessing response rates. A “response rate” is defined as the percentage of treated subjects that responds with either partial or complete remission. Remission can be determined by, for example, measuring tumor size or by microscopic examination of a tissue sample for the presence of cancer cells.

In the treatment of cancer, a suitable single dose can vary depending upon the specific type of cancer and whether the cancer is a primary tumor or a metastatic form. One of skill in the art can test doses of a therapeutic composition suitable for direct injection to determine appropriate single doses for systemic administration, taking into account the usual subject parameters such as size and weight. An effective anti-tumor single dose of a therapeutic recombinant DNA molecule or combination thereof is an amount sufficient amount to result in reduction, and preferably elimination, of the tumor after the DNA molecule or combination has transfected cells at or near the tumor site.

A preferred single dose of SAg-encoding DNA molecule or fusion product thereof is an amount that, when transfected into a target cell population, leads to the production of SAg in an amount, per transfected cell, ranging from about 250 femtograms (fg) to about 1 μg, preferably from about 500 fg to about 500 pg and more preferably from about 1 pg to about 100 pg.

When the SAg-encoding DNA is combined with a second DNA molecule encoding a second protein product, an effective single dose of a the second DNA molecule is an amount that when transfected into a target cell population leads to the production of the second protein product in an amount, per transfected cell, ranging from about 10 fg to about 1 ng, more preferably from about 100 fg to about 750 pg.

An effective cancer-treating single dose of SAg-encoding DNA and a second DNA molecule encoding a second protein when administered to a subject using a non-targeting carrier, is an amount capable of reducing, and preferably eliminating, the primary or metastatic tumor following transfection by the recombinant molecules of cells at or near the tumor site. A preferred single dose of such a therapeutic composition is from about 100 μg to about 4 mg of total recombinant DNA, more preferably from about 200 μg to about 2 mg, most preferably from about 200 μg to about 800 μg of total recombinant molecules. A preferred single dose of liposome-complexed, SAg-encoding DNA, is from about 100 μg of total DNA per 800 nmol of liposome to about 4 mg of total DNA molecules per 32 μM of liposome, more preferably from about 200 μg per 1.6 μmol of liposome to about 3 mg of total recombinant DNA per 24 nmol of liposome, and even more preferably from about 400 μg per 3.2 μmol of liposome to about 2 mg per 16 μM of liposome.

One of skill in the art recognizes that the number of doses required depends upon the extent of disease and the response of an individual to treatment. Thus, according to this invention, an effective number of doses includes any number required to cause regression of primary or metastatic disease.

A preferred treatment protocol comprises monthly administrations of single doses (as described above) for up to about 1 year. An effective number of doses (per individual) of a SAg-encoding DNA molecule and a second DNA molecule encoding a second protein, when administered in a non-targeting carrier or when complexed with liposomes, is from about 1 to about 10 dosings, preferably from about 2 to about 8 dosings, and even more preferably from about 3 to about 5 dosings. Preferably, such dosings are administered about once every 2 weeks until signs of remission appear, followed by about once a month until the disease is gone.

The therapeutic compositions can be administered by any of a variety of modes and routes, including but not limited to, local administration into a site in the subject animal, which site contains abnormal cells to be destroyed. An example is the local injection within the area of a tumor or a lesion. Another example is systemic administration.

Therapeutic compositions that are best delivered by local administration include recombinant DNA molecules

(a) in a non-targeting carrier (e.g., “naked” DNA molecules as taught in Wolff K et al., Science 247:1465-1468 (1990,)); and

(b) complexed to a delivery vehicle.

Suitable delivery vehicles for local administration include liposomes, and may further comprise ligands that target the vehicle to a particular site.

A preferred mode of local administration is by direct injection. Direct injection techniques are particularly useful for injecting the composition into a cellular or tissue mass such as a tumor mass or a granuloma mass that has been induced by a pathogen. Thus, the present recombinant DNA molecule complexed with a delivery vehicle is preferably injected directly into, or locally in the area of, a tumor mass or a single cancer cell.

The present composition may also be administered in or around a surgical wound. For example, a patient undergoes surgery to remove a tumor. Upon removal of the tumor, the therapeutic composition is coated on the surface of tissue inside the wound or injected into areas of tissue inside the wound. Such local administration will treat cancer cells that were not successfully removed by the surgical procedure, as well as prevent recurrence of the primary tumor or development of a secondary tumor in the surgical area.

Therapeutic compositions that are best delivered by systemic administration include recombinant DNA molecules complexed to a tumor binding ligand or a ligand that binds to the tumor vasculature or stroma. Examples are antibodies, antigens, receptor, receptor ligand or a targeted delivery vehicle as disclosed herein. These delivery vehicles may be liposomes into which are incorporated targeting ligands, preferably ligands that targeting the vehicle to the site of tumor cells or another type of lesion. For cancer treatment, ligands that selectively bind to cancer cells, or to cells within the area of a cancer cell, are preferred. Systemic administration is used to treat primary or localized tumors and, in particular, tumor metastases wherein the cancer cells are dispersed. Systemic administration is advantageous when targeting cancer in organs, especially those difficult to reach for direct injection, (e.g., heart, spleen, lung or liver).

Preferred modes and routes of systemic administration include intravenous injection and aerosol, oral and percutaneous (topical) delivery. Intravenous injection methods and aerosol delivery are performed conventionally. Oral delivery is achieved preferably by complexing the therapeutic composition to a carrier capable of withstanding degradation by digestive enzymes in the subject's digestive system. Examples of such carriers, includes plastic capsules or tablets as are known in the art. For topical delivery, the therapeutic composition is mixed with a lipophilic reagent (e.g., DMSO) that can pass into the skin.

The therapeutic compositions and methods of the present invention are intended for animals, preferably mammals and birds, in particular house pets, farm animals and zoo animals as these terms are generally understood. By “farm animals” are intended animals that are eaten or those that produce useful products (e.g., wool-producing sheep). Examples of preferred animal subjects to be treated are dogs, cats, sheep, cattle, horses and pigs. The present compositions and methods are effective in inbred and outbred animal species. Most preferably, the animal is a human.

Another component useful in combination with the therapeutic nucleic acids of this invention is an adjuvant suited for use with a nucleic acid-based vaccine. Examples of adjuvant-containing compositions include

1) SAg-encoding DNA and a second DNA encoding a recombinant protein; or

2) SAg-encoding DNA combined with another peptide or polypeptide; or

3) DNA encoding a second recombinant protein and a SAg peptide or polypeptide.

As indicated above, effective doses of a SAg-encoding DNA combined with a second DNA molecule, or a vaccine nucleic acid molecule are determined conventionally by those skilled in the art. One measure of an effective dose is that produces a sufficient amount of SAg and second protein to stimulate effector cell immunity in a manner that enhances the effectiveness of the vaccine. Adjuvants of the present invention are particularly suited for use in humans because many traditional adjuvants (e.g., Freund's adjuvant and other bacterial cell wall components) are toxic whereas others are relatively ineffective (e.g., aluminum-based salts and calcium-based salts).

EXAMPLE 15

General Procedures for In Vivo and Ex Vivo Sensitization to Produce Tumor Specific Effector Cells for Adoptive Immunotherapy

Example 15 in entirety is in provisional application No. 60/151,470, filed on Aug. 30, 1999. This application is incorporated herein in entirety by reference.

EXAMPLE 16

General Adoptive Immunotherapy Protocol

Example 16 in entirety is in provisional application No. 60/151,470, filed on Aug. 30, 1999. This application is incorporated herein in entirety by reference.

EXAMPLE 17

Preparation and Administration of DNA Liposome Complexes

Example 17 in entirety is in provisional application No. 60/151,470, filed on Aug. 30, 1999. This application is incorporated herein in entirety by reference.

EXAMPLE 18

General Procedures for Administering Constructs in Human Tumor Models and Human Patients

The constructs described herein are tested for therapeutic efficacy in several well established rodent models which are considered to be highly representative as described in “Protocols for Screening Chemical Agents and Natural Products Against Animal Tumors and Other Biological Systems (Third Edition)”, Cancer Chemother. Reports, Part 3, 3: 1-112, which is hereby incorporated by reference in its entirety. Additional tumor models of carcinoma and sarcoma originating from primary sites and prepared as established tumors at primary and/or metastatic sites are utilized to test further the efficacy of the constructs.

EXAMPLE 19

General Procedures for Administering Tumor Cells or Sickled Erythrocytes Transduced with SAgs and SAg-Activated T or NKT Cells in Human Tumor Models and Human Patients

EXAMPLE 20

General Test Evaluation Procedures for Constructs and SAg Activated Effector T or NKT Cells

I. General Test Evaluation Procedures

A. Calculation of Mean Survival Time

Mean survival time is calculated according to the following formula:

Mean   survival   time  ( days ) = S + AS  ( A - 1 ) - ( B + 1 )  NT S  ( A - 1 ) - NT

Definitions:

  • Day: Day on which deaths are no longer considered due to drug toxicity. Example: with treatment starting on Day 1 for survival systems (such as L1210, P388, B16, 3LL, and W256):
  • Day A: Day 6.
  • Day B: Day beyond which control group survivors are considered “no-takes.”
  • Example: with treatment starting on Day 1 for survival systems (such as L1210, P388, and W256), Day B-Day 18. For B16, transplanted AKR, and 3LL survival systems, Day B is to be established.
  • S: If there are “no-takes” in the treated group, S is the sum from Day A through Day B. If there are no “no-takes” in the treated group, S is the sum of daily survivors from Day A onward.
  • S(A-1): Number of survivors at the end of Day (A-1).
    • Example: for 3LE21, S(A-1)=number of survivors on Day 5.
  • NT: Number of “no-takes” according to the criteria given in Protocols 7.300 and 11.103.

B. T/C Computed for all Treated Groups

T/C is the ratio (expressed as a percent) of the mean survival time of the treated group divided by the mean survival time of the control group. Treated group animals surviving beyond Day B, according to the chart below, are eliminated from calculations:

No. of survivors in treated Percent of “no-takes”
group beyond Day B in control group Conclusion
1 Any percent “no-take”
2 <10 drug inhibition
10 “no-takes”
3 <15 drug inhibitions
15 “no-takes”

Positive control compounds are not considered to have “no-takes” regardless of the number of “no-takes” in the control group. Thus, all survivors on Day B are used in the calculation of T/C for the positive control. Surviving animals are evaluated and recorded on the day of evaluation as “cures” or “no-takes.”

Calculation of Median Survival Time

Median Survival Time is defined as the median day of death for a test or control group. If deaths are arranged in chronological order of occurrence (assigning to survivors, on the final day of observation, a “day of death” equal to that day), the median day of death is a day selected so that one half of the animals died earlier and the other half died later or survived. If the total number of animals is odd, the median day of death is the day that the middle animal in the chronological arrangement died. If the total number of animals is even, the median is the arithmetical mean of the two middle values. Median survival time is computed on the basis of the entire population and there are no deletion of early deaths or survivors, with the following exception:

C. Computation of Median Survival Time From Survivors

If the total number of animals including survivors (N) is even, the median survival time (days) (X+Y)/2, where X is the earlier day when the number of survivors is N/2, and Y is the earliest day when the number of survivors (N/2)−1. If N is odd, the median survival time (days) is X.

D. Computation of Median Survival Time From Mortality Distribution

If the total number of animals including survivors (N) is even, the median survival time (days) (X+Y)/2, where X is the earliest day when the cumulative number of deaths is N/2, and Y is the earliest day when the cumulative number of deaths is (N/2)+1. If N is odd, the median survival time (days) is X.

Cures and “No-Takes”: “Cures” and “no-takes” in systems evaluated by median survival time are based upon the day of evaluation. On the day of evaluation any survivor not considered a “no-take” is recorded as a “cure.” Survivors on day of evaluation are recorded as “cures” or “no-takes,” but not eliminated from the calculation of the median survival time.

E. Calculation of Approximate Tumor Weight From Measurement of Tumor Diameters with Vernier Calipers

The use of diameter measurements (with Vernier calipers) for estimating treatment effectiveness on local tumor size permits retention of the animals for lifespan observations. When the tumor is implanted sc, tumor weight is estimated from tumor diameter measurements as follows. The resultant local tumor is considered a prolate ellipsoid with one long axis and two short axes. The two short axes are assumed to be equal. The longest diameter (length) and the shortest diameter (width) are measured with Vernier calipers. Assuming specific gravity is approximately 1.0, and Pi is about 3, the mass (in mg) is calculated by multiplying the length of the tumor by the width squared and dividing the product by two. Thus,

Tumor   weight  ( mg ) = lengh   ( mm ) × ( width  [ mm ] ) 2 2   Or   L × ( W ) 2 2

The reporting of tumor weights calculated in this way is acceptable inasmuch as the assumptions result in as much accuracy as the experimental method warrants.

F. Calculation of Tumor Diameters

The effects of a drug on the local tumor diameter may be reported directly as tumor diameters without conversion to tumor weight. To assess tumor inhibition by comparing the tumor diameters of treated animals with the tumor diameters of control animals, the three diameters of a tumor are averaged (the long axis and the two short axes). A tumor diameter T/C of 75% or less indicates activity and a T/C of 75% is approximately equivalent to a tumor weight T/C of 42%.

G. Calculation of Mean Tumor Weight From Individual Excised Tumors

The mean tumor weight is defined as the sum of the weights of individual excised tumors divided by the number of tumors. This calculation is modified according to the rules listed below regarding “no-takes.” Small tumors weighing 39 mg or less in control mice or 99 mg or less in control rats, are regarded as “no-takes” and eliminated from the computations. In treated groups, such tumors are defined as “no-takes” or as true drug inhibitions according to the following rules:

Percent of Percent of
small tumors in “no-takes” in
treated group control group Action
≦17 Any percent no-take; not used
in calculations
18-39 <10 drug inhibition;
use in calculations
≧10 no-takes; not used
in calculations
≧40 <15 drug inhibition;
use in calculations
≧15 Code all nontoxic
tests “33”

Positive control compounds are not considered to have “no-takes” regardless of the number of “no-takes” in the control group. Thus, the tumor weights of all surviving animals are used in the calculation of T/C for the positive control. T/C are computed for all treated groups having more than 65% survivors. The T/C is the ratio (expressed as a percent) of the mean tumor weight for treated animals divided by the mean tumor weight for control animals. SDs of the mean control tumor weight are computed the factors in a table designed to estimate SD using the estimating factor for SD given the range (difference between highest and lowest observation). Biometrik Tables for Statisticians (Pearson E S, and Hartley H G, eds.) Cambridge Press, vol. 1, table 22, p. 165.

II. Specific Tumor Models

A. Lymphoid Leukemia L1210

Summary: Ascitic fluid from donor mouse is transferred into recipient BDF1 or CDF1 mice. Treatment begins 24 hours after implant. Results are expressed as a percentage of control survival time. Under normal conditions, the inoculum site for primary screening is i.p., the composition being tested is administered i.p., and the parameter is mean survival time. Origin of tumor line: induced in 1948 in spleen and lymph nodes of mice by painting skin with MCA. J Natl Cancer Inst. 13:1328 (1953).

Animals

  • Propagation: DBA/2 mice (or BDF1 or CDF1 for one generation).
  • Testing: BDF1 (C57BL/6×DBA/2) or CDF1 (BALB/c×DBA/2) mice.
  • Weight: Within a 3-g weight range, with a minimum weight of 18 g for males and 17 g for females.
  • Sex: One sex used for all test and control animals in one experiment.
  • Experiment Size: Six animals per test group.
  • Control Groups: Number of animals varies according to number of test groups.

Tumor Transfer

Inject i.p., 0.1 ml of diluted ascitic fluid containing 105 cells.

  • Time of Transfer for Propagation: Day 6 or 7.
  • Time of Transfer for Testing: Day 6 or 7.

Testing Schedule

  • Day 0: Implant tumor. Prepare materials. Run positive control in every odd-numbered experiment. Record survivors daily.
  • Day 1: Weigh and randomize animals. Begin treatment with therapeutic composition. Typically, mice receive 1 ug of the test composition in 0.5 ml saline. Controls receive saline alone. The treatment is given as one dose per week. Any surviving mice are sacrificed after 4 weeks of therapy.
  • Day 5: Weigh animals and record.
  • Day 20: If there are no survivors except those treated with positive control compound, evaluate study.
  • Day 30: Kill all survivors and evaluate experiment.

Quality Control

Acceptable control survival time is 8-10 days. Positive control compound is 5-fluorouracil; single dose is 200 mg/kg/injection, intermittent dose is 60 mg/kg/injection, and chronic dose is 20 mg/kg/injection. Ratio of tumor to control (T/C) lower limit for positive control compound is 135%

Evaluation

Compute mean animal weight on Days 1 and 5, and at the completion of testing compute

T/C for all test groups with >65% survivors on Day 5. A T/C value 85% indicates a toxic test. An initial T/C 125% is considered necessary to demonstrate activity. A reproduced T/C 125% is considered worthy of further study. For confirmed activity a composition should have two multi-dose assays that produce a T/C 25%.

B. Lymphocytic Leukemia P388

Summary: Ascitic fluid from donor mouse is implanted in recipient BDF1 or CDF1 mice.
Treatment begins 24 hours after implant. Results are expressed as a percentage of control survival time. Under normal conditions, the inoculum site for primary screening is ip, the composition being tested is administered ip daily for 9 days, and the parameter is median survival time. Origin of tumor line: induced in 1955 in a DBA/2 mouse by painting with MCA. Scientific Proceedings, Pathologists and Bacteriologists 33:603, 1957.

Animals

  • Propagation: DBA/2 mice (or BDF1 or CDF1 for one generation)
  • Testing: BDF1 (C57BL/6×DBA/2) or CDF1 (BALB/c×DBA/2) mice.
  • Weight: Within a 3-g weight range, with a minimum weight of 18 g for males and 17 g for females.
  • Sex: One sex used for all test and control animals in one experiment.
  • Experiment Size: Six animals per test group.
  • Control Groups: Number of animals varies according to number of test groups.

Tumor Transfer

  • Implant: Inject ip
  • Size of Implant: 0.1 ml diluted ascitic fluid containing 106 cells.
  • Time of Transfer for Propagation: Day 7.
  • Time of Transfer for Testing: Day 6 or 7.

Testing Schedule

  • Day 0: Implant tumor. Prepare materials. Run positive control in every odd-numbered experiment. Record survivors daily.
  • Day 1: Weigh and randomize animals. Begin treatment with therapeutic composition. Typically, mice receive lug of the composition being tested in 0.5 ml saline. Controls receive saline alone. The treatment is given as one dose per week. Any surviving mice are sacrificed after 4 weeks of therapy.
  • Day 5: Weigh animals and record.
  • Day 20: If there are no survivors except those treated with positive control compound, evaluate experiment.
  • Day 30: Kill all survivors and evaluate experiment.

Quality Control

Acceptable median survival time is 9-14 days. Positive control compound is 5-fluorouracil: single dose is 200 mg/kg/injection, intermittent dose is 60 mg/kg/injection, and chronic dose is 20 mg/kg/injection. T/C lower limit for positive control compound is 135% Check control deaths, no takes, etc.

Evaluation

Compute mean animal weight on Days 1 and 5, and at the completion of testing compute T/C for all test groups with >65% survivors on Day 5. A T/C value 85% indicates a toxic test. An initial T/C 125% is considered necessary to demonstrate activity. A reproduced T/C 125% is considered worthy of further study. For confirmed activity a synthetic must have two multi-dose assays (each performed at a different laboratory) that produce a T/C 125%; a natural product must have two different samples that produce a T/C 125% in multi-dose assays.

C. Melanotic Melanoma B16

Summary: Tumor homogenate is implanted ip or sc in BDF1 mice. Treatment begins 24 hours after either ip or sc implant or is delayed until an sc tumor of specified size (usually approximately 400 mg) can be palpated. Results expressed as a percentage of control survival time. The composition being tested is administered ip, and the parameter is mean survival time.

Origin of tumor line: arose spontaneously in 1954 on the skin at the base of the ear in a C57BL/6 mouse. Handbook on Genetically Standardized Jax Mice. Roscoe B. Jackson Memorial Laboratory, Bar Harbor, Me., 1962. See also Ann NY Acad Sci 100, Parts 1 and 2, 1963.

Animals

  • Propagation: C57BL/6 mice.
  • Testing: BDF1 (C57BL/6×DBA/2) mice.
  • Weight: Within a 3-g weight range, with a minimum weight of 18 g for males and 17 g for females.
  • Sex: One sex used for all test and control animals in one experiment.
  • Experiment Size: Ten animals per test group. For control groups, the number of animals varies according to number of test groups.

Tumor Transfer

  • Propagation: Implant fragment sc by trochar or 12-gauge needle or tumor homogenate (see below) every 10-14 days into axillary region with puncture in inguinal region.
  • Testing: Excise sc tumor on Day 10-14.
  • Homogenate: Mix 1 g or tumor with 10 ml of cold balanced salt solution and homogenize, and implant 0.5 ml of this tumor homogenate ip or sc.
  • Fragment: A 25-mg fragment may be implanted sc.

Testing Schedule

  • Day 0: Implant tumor. Prepare materials. Run positive control in every odd-numbered experiment. Record survivors daily.
  • Day 1: Weigh and randomize animals. Begin treatment with therapeutic composition. Typically, mice receive 1 μg of the composition being tested in 0.5 ml saline. Controls receive saline alone. The treatment is given as one dose per week. Any surviving mice are sacrificed 8 weeks of therapy.
  • Day 5: Weigh animals and record.
  • Day 60: Kill all survivors and evaluate experiment.

Quality Control

Acceptable control survival time is 14-22 days. Positive control compound is 5-fluorouracil: single dose is 200 mg/kg/injection, intermittent dose is 60 mg/kg/injection, and chronic dose is 20 mg/kg/injection. T/C lower limit for positive control compound is 135%

Check control deaths, no takes, etc.

Evaluation

Compute mean animal weight on Days 1 and 5, and at the completion of testing compute T/C for all test groups with >65% survivors on Day 5. A T/C value 85% indicates a toxic test. An initial T/C 125% is considered necessary to demonstrate activity. A reproduced T/C 125% is considered worthy of further study. For confirmed activity a therapeutic composition should have two multi-dose assays that produce a T/C 125%.

Metastasis after IV Injection of Tumor Cells

105 B16 melanoma cells in 0.3 ml saline are injected intravenously in C57BL/6 mice. The mice are treated intravenously with 1 g of the composition being tested in 0.5 ml saline. Controls receive saline alone. The treatment is given as one dose per week. Mice sacrificed after 4 weeks of therapy, the lungs are removed and metastases are enumerated.

C. 3LL Lewis Lung Carcinoma

Summary: Tumor may be implanted sc as a 2-4 mm fragment, or im as a 2×106-cell inoculum. Treatment begins 24 hours after implant or is delayed until a tumor of specified size (usually approximately 400 mg) can be palpated. The composition being tested is administered ip daily for 11 days and the results are expressed as a percentage of the control. Origin of tumor line: arose spontaneously in 1951 as carcinoma of the lung in a C57BL/6 mouse. Cancer Res 15:39, 1955. See, also Malave, I. et al., J. Nat'l. Canc. Inst. 62:83-88 (1979).

Animals

  • Propagation: C57BL/6 mice.
  • Testing: BDF1 mice or C3H.
  • Weight: Within a 3-g weight range, with a minimum weight of 18 g for males and 17 g for females.
  • Sex: One sex used for all test and control animals in one experiment.
  • Experiment Size: Six animals per test group for sc implant, or ten for im implant. For control groups, the number of animals varies according to number of test groups.

Tumor Transfer

  • Implant: Inject cells im in hind leg or implant fragment sc in axillary region with puncture in inguinal region.
  • Time of Transfer for Propagation: Days 12-14.
  • Time of Transfer for Testing: Days 12-14.

Testing Schedule

  • Day 0: Implant tumor. Prepare materials. Run positive control in every odd-numbered experiment. Record survivors daily.
  • Day 1: Weigh and randomize animals. Begin treatment with therapeutic composition. Typically, mice receive lug of the composition being tested in 0.5 ml saline. Controls receive saline alone. The treatment is given as one dose per week. Any surviving mice are sacrificed after 4 weeks of therapy.
  • Day 5: Weigh animals and record.
  • Final Day: Kill all survivors and evaluate experiment.

Quality Control

Acceptable im tumor weight on Day 12 is 500-2500 mg. Acceptable im tumor median survival time is 18-28 days. Positive control compound is cyclophosphamide: 20 mg/kg/injection, qd, Days 1-11. Check control deaths, no takes, etc.

Evaluation

Compute mean animal weight when appropriate, and at the completion of testing compute T/C for all test groups. When the parameter is tumor weight, a reproducible T/C 42% is considered necessary to demonstrate activity. When the parameter is survival time, a reproducible T/C 125% is considered necessary to demonstrate activity. For confirmed activity a synthetic must have two multi-dose assays (each performed at a different laboratory); a natural product must have two different samples.

D. 3LL Lewis Lung Carcinoma Metastasis Model

This model has been utilized by a number of investigators. See, for example, Gorelik, E. et al., J. Nat'l. Canc. Inst. 65:1257-1264 (1980); Gorelik, E. et al., Rec. Results Canc. Res. 75:20-28 (1980); Isakov, N. et al., Invasion Metas. 2:12-32 (1982) Talmadge J. E. et al., J. Nat'l. Canc. Inst. 69:975-980 (1982); Hilgard, P. et al., Br. J. Cancer 35:78-86(1977)).

Mice: male C57BL/6 mice, 2-3 months old.
Tumor: The 3LL Lewis Lung Carcinoma was maintained by sc transfers in C57BL/6 mice. Following sc, im or intra-footpad transplantation, this tumor produces metastases, preferentially in the lungs. Single-cell suspensions are prepared from solid tumors by treating minced tumor tissue with a solution of 0.3% trypsin. Cells are washed 3 times with PBS (pH 7.4) and suspended in PBS. Viability of the 3LL cells prepared in this way is generally about 95-99% (by trypan blue dye exclusion). Viable tumor cells (3×104-5×106) suspended in 0.05 ml PBS are injected into the right hind foot pads of C57BL/6 mice. The day of tumor appearance and the diameters of established tumors are measured by caliper every two days.

Typically, mice receive 1 ug of the composition being tested in 0.5 ml saline. Controls receive saline alone. The treatment is given as one or two doses per week.

In experiments involving tumor excision, mice with tumors 8-10 mm in diameter are divided into two groups. In one group, legs with tumors are amputated after ligation above the knee joints. Mice in the second group are left intact as nonamputated tumor-bearing controls. Amputation of a tumor-free leg in a tumor-bearing mouse has no known effect on subsequent metastasis, ruling out possible effects of anesthesia, stress or surgery. Surgery is performed under Nembutal anesthesia (60 mg veterinary Nembutal per kg body weight).

Determination of Metastasis Spread and Growth

Mice are killed 10-14 days after amputation. Lungs are removed and weighed. Lungs are fixed in Bouin's solution and the number of visible metastases is recorded. The diameters of the metastases are also measured using a binocular stereoscope equipped with a micrometer-containing ocular under 8× magnification. On the basis of the recorded diameters, it is possible to calculate the volume of each metastasis. To determine the total volume of metastases per lung, the mean number of visible metastases is multiplied by the mean volume of metastases. To further determine metastatic growth, it is possible to measure incorporation of 125IdUrd into lung cells (Thakur, M. L. et al., J. Lab. Clin. Med. 89:217-228 (1977). Ten days following tumor amputation, 25 μg of FdUrd is inoculated into the peritoneums of tumor-bearing (and, if used, tumor-resected mice. After 30 min, mice are given 1 μCi of 125IdUrd. One day later, lungs and spleens are removed and weighed, and a degree of 125IdUrd incorporation is measured using a gamma counter.

Statistics: Values representing the incidence of metastases and their growth in the lungs of tumor-bearing mice are not normally distributed. Therefore, non-parametric statistics such as the Mann-Whitney U-Test may be used for analysis.
Study of this model by Gorelik et al. (1980, supra) showed that the size of the tumor cell inoculum determined the extent of metastatic growth. The rate of metastasis in the lungs of operated mice was different from primary tumor-bearing mice. Thus in the lungs of mice in which the primary tumor had been induced by inoculation of large doses of 3LL cells (1-5×106) followed by surgical removal, the number of metastases was lower than that in nonoperated tumor-bearing mice, though the volume of metastases was higher than in the nonoperated controls. Using 125IdUrd incorporation as a measure of lung metastasis, no significant differences were found between the lungs of tumor-excised mice and tumor-bearing mice originally inoculated with 1×106 3LL cells. Amputation of tumors produced following inoculation of 1×105 tumor cells dramatically accelerated metastatic growth. These results were in accord with the survival of mice after excision of local tumors. The phenomenon of acceleration of metastatic growth following excision of local tumors had been observed by other investigators. The growth rate and incidence of pulmonary metastasis were highest in mice inoculated with the lowest doses (3×104-1×105 of tumor cells) and characterized also by the longest latency periods before local tumor appearance. Immunosuppression accelerated metastatic growth, though nonimmunologic mechanisms participate in the control exerted by the local tumor on lung metastasis development. These observations have implications for the prognosis of patients who undergo cancer surgery.

E. Walker Carcinosarcoma 256

Summary: Tumor may be implanted sc in the axillary region as a 2-6 mm fragment, im in the thigh as a 0.2-ml inoculum of tumor homogenate containing 106 viable cells, or ip as a 0.1-ml suspension containing 106 viable cells. Treatment of the composition being tested is usually ip. Origin of tumor line: arose spontaneously in 1928 in the region of the mammary gland of a pregnant albino rat. J Natl Cancer Inst 13:1356, 1953.

Animals

  • Propagation: Random-bred albino Sprague-Dawley rats.
  • Testing: Fischer 344 rats or random-bred albino rats.
  • Weight Range: 50-70 g (maximum of 10-g weight range within each experiment).
  • Sex: One sex used for all test and control animals in one experiment.
  • Experiment Size: Six animals per test group. For control groups, the number of animals varies according to number of test groups.

Time of Tumor Transfer

  • Time of Transfer for Propagation: Day 7 for im or ip implant; Days 11-13 for sc implant.
  • Time of Transfer for Testing: Day 7 for im or ip implant; Days 11-13 for sc implant.

Tumor Transfer

Sc fragment implant is by trochar or 12-gauge needle into axillary region with puncture in inguinal area. Im implant is with 0.2 ml of tumor homogenate (containing 106 viable cells) into the thigh. Ip implant is with 0.1 ml of suspension (containing 106 viable cells) into the ip cavity.

Testing Schedule

Prepare and administer compositions under test on days, weigh animals, and evaluate test on the days listed in the following tables.

Test
system Prepare drug Administer Weigh animals Evaluate
5WA16 2 3-6 3 and 7  7
5WA12 0 1-5 1 and 5 10-14
5WA31 0 1-9 1 and 5 30

  • Day 0: Implant tumor. Prepare materials. Run positive control in every odd-numbered experiment. Record survivors daily.
  • Day 1: Weigh and randomize animals.
  • Final Day: Kill all survivors and evaluate experiment.

Quality Control

Acceptable im tumor weight or survival time for the above three test systems:

  • 5WA16: 3-12 g. 5WA12: 3-12 g. 5WA31 or 5WA21: 5-9 days.

Evaluation

Compute mean animal weight when appropriate, and at the completion of testing compute T/C for all test groups. When the parameter is tumor weight, a reproducible T/C 42% is considered necessary to demonstrate activity. When the parameter is survival time, a reproducible T/C 125% is considered necessary to demonstrate activity. For confirmed activity a therapeutic agent must have activity in two multi-dose assays.

F. A20 lymphoma

106 murine A20 lymphoma cells in 0.3 ml saline are injected subcutaneously in Balb/c mice. The mice are treated intravenously with lg of the composition being tested in 0.5 ml saline. Controls receive saline alone. The treatment is given as one dose per week. Tumor growth is monitored daily by physical measurement of tumor size and calculation of total tumor volume. After 4 weeks of therapy the mice are sacrificed.

Treatment Regimens and Results (Constructs)

For determining efficacy in the tumor models described above the general categories of therapeutic constructs used are given below. For all of the classes of conjugates listed below, the SAg component can be prepared as either a DNA encoding SAg or as the SAg polypeptide itself. In either form the SAg DNA or protein may be conjugated to additional molecules, either nucleic acid or polypeptides. Operationally, for therapeutic use in vivo or ex vivo, these conjugates may be prepared by chemical coupling or by recombinant means (whichever is appropriate) and conjugated to a tumor-targeting structure or incorporated into a vehicle (e.g., liposomes) that themselves comprise a tumor targeting structure(s). Again, examples of such targeting structures include, but are not limited to, an antibody, antigen, receptor or receptor ligand. Methods are disclosed in Examples 1, 3, 4, 5, 6, 7, 14, 17, 18, 30-32.

1. SAg Nucleic Acid Constructs including Phage Displays and SAg Transfected Bacterial Cells
2. Glycosylated SAgs
3. Chimeric SAgs
Conjugates having a Superantigen component (polypeptide or nucleic acid)
and a partner that is either a single component or a conjugate of 2 or
more components (protein, carbohydrate, lipid or DNA) as indicated below:
Superantigen
(Protein or DNA) Partner (Single Component or Coniuqate)
 4. DNA coding sequence
 5. Polypeptide
 6. Nucleic acid
 7. Tumor associated Peptide
 8. Tumor Antigen-MHC protein
 9. LPS
10. Lipoarabinomannan
11. Ganglioside
12. Glycosphingolipid
13. Ganglioside-CD1 receptor
14. Glycosphingolipid-CD1 receptor
15. Glycosylceramide (e.g., Gal-Cer)
16. GalCer-CD1 receptor
17. Gal
18. Arg-Gly-Asp or Asn-Gly-Arg
19 iNOS
20. Gb2 or Gb3 or Gb4
21. (Gb2 or Gb3 or Gb4)-CD1 receptor
22. -GPI-(Gb2 or Gb3 or Gb4)
23. -GPI-(Gb2 or Gb3 or Gb4)-CD1 receptor
24. Verotoxin
25. Verotoxin A or B Subunit
26. IFN receptor peptide homologous to VT
27. CD19 peptide homologous to VT
28. LDL, VLDL, HDL, IDL
29. Apolipoproteins (e.g., Lp(a), apoB-100, apoB-48, apoE)
30. OxyLDL, oxyLDL mimics, (e.g., 7β-hydroperoxycholesterol, 7-hydroxycholesterol, 7-
ketocholesterol, 5-6-epoxycholesterol, 7-hydroperoxy-choles-5-en-3β-ol, 4-
hydroxynonenal (4-HNE), 9-HODE, 13-HODE and cholesterol-9-HODE)
31. OxyLDL by products (e.g. lysolecithin, lysophosphatidylcholine, malondialdehyde, 4-
hydroxynonenal)
32. LDL & oxyLDL receptors (e.g., LDL oxyLDL, acetyl-LDL, VLDL, LRP, CD36, SREC,
LOX-1, macrophage scavenger receptors)
33. phytosphingosine, -GPI-phytosphingosine
34. tumor associated lipid antigens
35. glycolipid, proteolipid, glycosphingolipid, sphingolipid with inositolphosphate -containing
head groups, phytoglycolipids, mycoglycolipids, -GPI-sphingosines, -GPI-lipids
36. sphingolipids with inositolphosphate-containing head groups having the general
structure: ceramide-P-myoinositol-X with X referring to polar substituents comprising
ceramide-p-inositol-mannose, inositol-1-P-(6)mannose(a1,2 inositol-1P-(1)ceramide,
(inositol-P)2-ceramide, inositol-P-inositol-P-ceramide, inositol-P-inositol-P-ceramide.
37. tumor associated glycan antigens consisting of peptidoglycans or glycan
phosphotidyinositol (GPI) structures

Vaccine Use

For use as a vaccine, the constructs are administered subcutaneously, intramuscularly intradermally or intraperitoneally in doses ranging from 50 to 500 ng in various vehicles such as Freund's adjuvant, aluminum hydroxide, pluruonic acid triblock and liposomes as described in the art. Doses may be repeated every 10 days. Tumors are implanted after the last dose. A control group does not receive the vaccine.

Use in Established Tumors

For proteins or nucleic acid constructs, treatment consists of injecting animals iv or ip with 50, 500 1000 or 5,000 ng of in 0.1-0.5 ml of normal saline. Unless indicated otherwise above, treatments are given one to three times per week for two to five weeks. Phage displays are administered as 109 transducing units (TU) and irradiated bacterial cells as 105 cells iv into the tail vein one to three times per week for two to five weeks. Exosomes or vesicles, harvested from transfected, transformed or fusion tumor cells or sickled cells are given i.v. into the tail vein in a dose of 0.25-1 g per animal one to three times per week for two to five weeks. The results shown in Table VI are for each composition and dose tested. The results are statistically significant by the Wilcoxon rank sum test.

TABLE VI
Tumor Model Parameter % of Control Response
L1210 Mean survival time >130% 
P388 Mean survival time >130% 
B16 Mean survival time >130% 
B16 metastasis Median number of metastases <70%
3LL Mean survival time >130% 
Mean tumor weight <40%
3LL metastasis Median survival time >130% 
Mean lung weight <60   
Median number of metastases <60%
Median volume of metastases <60%
Medial volume of metastases <60%
Median uptake of IdUrd <60%
Walker carcinoma Median survival time >130% 
Mean tumor weight <40%
A20 Mean survival time >130% 
Mean tumor volume <40%

EXAMPLE 22

Antitumor Effects of Therapeutic Constructs in Human Patients

All patients treated have histologically confirmed malignant disease including carcinomas, sarcomas, melanomas, lymphomas and leukemia and have failed conventional therapy. Patients may be diagnosed as having any stage of metastatic disease involving any organ system. Staging describes both tumor and host, including organ of origin of the tumor, histologic type and histologic grade, extent of tumor size, site of metastases and functional status of the patient. A general classification includes the known ranges of Stage I (localized disease) to Stage 4(widespread metastases). Patient history is obtained and physical examination performed along with conventional tests of cardiovascular and pulmonary function and appropriate radiologic procedures. Histopathology is obtained to verify malignant disease.

EXAMPLE 23

Treatment Procedures

Constructs (or Preparations)

Doses of the constructs are determined as described above using, inter alia, appropriate animal models of tumors. Treatments are given 3×/week for a total of 12 treatments. Patients with stable or regressing disease are treated beyond the 12th treatment. Treatment is given on either an outpatient or inpatient basis as needed.

Patient Evaluation

Assessment of response of the tumor to the therapy is made once per week during therapy and 30 days thereafter. Depending on the response to treatment, side effects, and the health status of the patient, treatment is terminated or prolonged from the standard protocol given above. Tumor response criteria are those established by the International Union Against Cancer and are listed in Table VII.

TABLE VII
RESPONSE DEFINITION
Complete remission (CR) Disappearance of all evidence of
disease
Partial remission (PR) >50% decrease in the product of
the two greatest perpendicular
tumor diameters; no new lesions
Less than partial remission 25-50% decrease in tumor size,
(<PR) stable for at least 1 month
Stable disease <25% reduction in tumor size; no
progression or new lesions
Progression >25% increase in size of any one
measured lesion or appearance of
new lesions despite stabilization
or remission of disease in other
measured sites

The efficacy of the therapy in a population is evaluated using conventional statistical methods including, for example, the Chi Square test or Fisher's exact test. Long-term changes in and short term changes in measurements can be evaluated separately.

Results

One hundred and fifty patients are treated. The results are summarized in Table VIII. Positive tumor responses are observed in 80% of the patients as follows:

TABLE VIII
All Patients
Response No. %
PR 20 66%
<PR 10 33%
Tumor Types Response % of Patients
Breast Adenocarcinoma PR + <PR 80%
Gastrointestinal Carcinoma PR + <PR 75%
Lung Carcinoma PR + <PR 75%
Prostate Carcinoma PR + <PR 75%
Lymphoma/Leukemia PR + <PR 75%
Head and Neck Cancer PR + <PR 75%
Renal and Bladder Cancer PR + <PR 75%
Melanoma PR + <PR 75%

EXAMPLE 22

Antitumor Effects of Therapeutic Constructs and Effector T, NKT Cells or Sickled Erythrocytes in Human Patients

All patients treated have histologically confirmed malignant disease including carcinomas, sarcomas, melanomas, lymphomas and leukemia and have failed conventional therapy. Patients may be diagnosed as having any stage of metastatic disease involving any organ system. Staging describes both tumor and host, including organ of origin of the tumor, histologic type and histologic grade, extent of tumor size, site of metastases and functional status of the patient. A general classification includes the known ranges of Stage I (localized disease) to Stage 4(widespread metastases). Patient history is obtained and physical examination performed along with conventional tests of cardiovascular and pulmonary function and appropriate radiologic procedures. Histopathology is obtained to verify malignant disease

EXAMPLE 23

Example 23 in entirety is provided in provisional application No. 60/151,470, filed on Aug. 30, 1999. This application is incorporated herein in entirety by reference.

Treatment Procedures

Constructs (or Preparations)

Doses of the constructs are determined as described above using, inter alia, appropriate animal models of tumors. Two classes of therapeutic compositions are administered namely SAg proteins or SAg conjugates as described above for animal models.
A treatment consists of injecting the patient with 0.5-500 mg of Construct intravenously in 200 ml of normal saline over a one hour period. Treatments are given 3×/week for a total of 12 treatments. Patients with stable or regressing disease are treated beyond the 12th treatment. Treatment is given on either an outpatient or inpatient basis as needed.

Patient Evaluation

Assessment of response of the tumor to the therapy is made once per week during therapy and 30 days thereafter. Depending on the response to treatment, side effects, and the health status of the patient, treatment is terminated or prolonged from the standard protocol given above. Tumor response criteria are those established by the International Union Against Cancer and are listed in Table VII.

TABLE VII
RESPONSE DEFINITION
Complete remission (CR) Disappearance of all evidence of
disease
Partial remission (PR) >50% decrease in the product of
the two greatest perpendicular
tumor diameters; no new lesions
Less than partial remission 25-50% decrease in tumor size,
(<PR) stable for at least 1 month
Stable disease <25% reduction in tumor size; no
progression or new lesions
Progression >25% increase in size of any one
measured lesion or appearance of
new lesions despite stabilization
or remission of disease in other
measured sites

The efficacy of the therapy in a population is evaluated using conventional statistical methods including, for example, the Chi Square test or Fisher's exact test. Long-term changes in and short term changes in measurements can be evaluated separately.

Results

One hundred and fifty patients are treated. The results are summarized in Table VIII. Positive tumor responses are observed in 80% of the patients as follows:

TABLE VIII
All Patients
Response No. %
PR 20 66%
<PR 10 33%
Tumor Types Response % of Patients
Breast Adenocarcinoma PR + <PR 80%
Gastrointestinal Carcinoma PR + <PR 75%
Lung Carcinoma PR + <PR 75%
Prostate Carcinoma PR + <PR 75%
Lymphoma/Leukemia PR + <PR 75%
Head and Neck Cancer PR + <PR 75%
Renal and Bladder Cancer PR + <PR 75%
Melanoma PR + <PR 75%

Examples 24-47 below are provided in entirety in provisional application No. 60/151,470, filed on Aug. 30, 1999. This application is incorporated herein in entirety by reference.

EXAMPLE 24

Preparation of DCs

EXAMPLE 25

Preparation of DC/Tumor Cells Hybrids (DC/tc)

EXAMPLE 26

Transfection of Hybrid DC/tc's with SAg DNA or RNA in vivo and in vitro

EXAMPLE 27

Preparation of DCs which have Phagocytosed SAg-Transfected Tumor Cell Lysates or Apoptotic Tumor Cells

EXAMPLE 28

Induction of Apoptotic Death and Phagocytosis of Apoptotic Tumor Cells or SAg-Transfected Tumor Cells by DCs

EXAMPLE 29

Treatment of Tumor Bearing Animals with SAg-Transfected or SAg-Expressing DCs

EXAMPLE 30

DNA or RNA from SAg Transfected Tumor Cells, SAg Transfected DCs and SAg Transfected DC/tc Hybrids for In Vivo Vaccination and Transfection of Naive DCs to Produce a DC Expressing SAgs and Tumor Associated Antigens

EXAMPLE 31

DNA Immunization In Vivo

EXAMPLE 32

Pulsing DCs with RNA from SAg Producing Bacteria or S/D/t Cells

EXAMPLE 33

PolyA-Cellular RNA from S/D/t cells or DCs Transfected with SAg

EXAMPLE 34

In Vivo Immunization with RNA derived from “S/D/t cells” or SAg-Transfected Tumor Cells

EXAMPLE 35

Preparation of “String of Beads” Tumor Antigens for Transfection of SAg-Transfected DCs, Other Accessory Cells, or Tumor Cells

EXAMPLE 36

Production of Exosomes from DCs Expressing SAg and Tumor Associated Antigens and Normal Hepatocytes

EXAMPLE 37

Bacterial Constructs for the Expression of SAgs Linked to Galactosylceramides, -Gal Epitope Peptidoglycans, Lipopolysaccharides and β1,3-Glucans

EXAMPLE 38

Gene Transfer for Expression of an Mono or Digalactosylceramide by Transfection with a Cosmid Genomic Library Prepared from a Cell Line in which the Specific Glycosylceramide is Highly Expressed

EXAMPLE 39

Staphylococcal Collagen Binding Adhesin Nucleic Acids Transfected into SAg Transfected Tumor Cells, SAg Transfected DCs or Accessory Cells and S/D/t Cells

EXAMPLE 40

Transfection of Nucleic Acids Encoding SAgs in Combination with Nucleic Acids the Promote Apoptosis Induction

EXAMPLE 41

Preparation and Isolation of Glycosphingolipids and Verotoxins Galabiosylceramide, Globotrioslceramides and Globotetraosylceramide

EXAMPLE 42

Gangliosides Shed from Tumor Cells: Isolation from Tumor Cell Supernatants Collection of Tumor Cell Supernatant

EXAMPLE 43

Assessment of SAg and VT Binding to Glycosphingolipids by TLC Overlay

EXAMPLE 44

Methods of Induction and Assessment of Apoptosis & Inhibition of Protein Synthesi

EXAMPLE 45

Multidrug Resistant Cells: Culture and Preparation

EXAMPLE 46

Incubation of Tumor Cells with Hydroxy Fatty Acids for Selective Synthesis of Galactosphingolipids and Lipid Analysis

EXAMPLE 47

Conjugation of Proteins to Lipoproteins

EXAMPLE 48

Incorporated by reference from PCT/US94/02339 “Tumor Killing Effects of Enterotoxins and Related Compounds,” filed 1 Jun. 1992.

The enterotoxin gene could be used to transfect various accessory cells resulting in enterotoxin expression on the cell surface which may then induce more potent stimulation and proliferation of tumoricidal T lymphocytes. The cotransfection of these accessory cells with adhesion molecules and MHC molecules might further augment the mitogenic activity of T lymphocytes induced by these accessory cells.

Mutant genes of the toxins could be used to transfect various bacteria such as E. Coli resulting in the production of toxin peptides retaining antitumor activity. Such superantigen peptides might have sequences homologous with various naturally occurring viruses such as mammary tumor virus, endogenous proteins such as heat shock proteins, stress proteins and minor lymphocyte stimulating loci, natu rally occurring bacteria such as mycoplasma and mycobacterial species. Amino acid sequences in the native toxin molecules associated with toxicity such as emesis, excessive cytokine induction or humoral antibody production would be deleted. For example, histadine residues of SEB may account for emetic responses of the SEB molecule since carboxymethylation of the SEB molecule selectively blocks histadine moieties resulting in a reduction of the emetic response. Additional mutant genes might be employed to produce peptides which bind selectively to T lymphocytes or class II molecules without stimulating mitogenesis, cytokine or antibody production.

Moreover, enterotoxin genes would be fused with genes from other bioreactive compounds such as cell poisons to produce molecules with capacity to destroy a selective cell population. Such fusion peptides might include enterotoxin sequences fused, for example, with peptides of pseudomonas toxin, diphtheria toxin sequences or antibodies yielding complexes retaining the major structural, biologic features of the native proteins.

19. Bacterial Products Related to Staphylococcal Enterotoxins With Similar Biological Effects

Streptococcal pyrogenic exotoxin (SPE) is produced by many strains of group A streptococci. Three antigenically distinct types (A, B, C) have been described. It is now known that Streptococcal pyrogenic exotoxin or scarlet fever toxin is related to Staphylococcus aureus enterotoxin B. The amino acid sequence of SPE has significant homology with Staphylococcus aureus enterotoxin B but not with other proteins in the Dayhoff library. Table 6 shows the alignment of amino acid sequences of mature SPEA and Staphylococcus aureus enterotoxin B, as reported in Johnson, L. P., LTtalien, J. J. and Schievert, P. M. “Streptococcal pyrogenic exotoxin type A (Scarlet fever toxin) is related to Staphylococcus aureus enterotoxin B,” Mol. Gen. Genet (1986) 203:354-356.

The biological properties of SPE are shared with some Staphylococcal enterotoxins such as lymphocyte mitogenicity, fever induction and enhanced susceptibility to endotoxin shock when given intravenously. SPE activates murine T cells mainly Vβ8.2 in physical association with MHC class II molecules expressed on accessory cells. SPE causes deregulation of the immune response in vitro resulting in delayed (12-16 days) acceleration of humoral and cellular immune activity. This may account for the sustained anti-tumor responses noted with the use of its structural analog, namely enterotoxin B, when administered to rabbits; with the VX-2 carcinoma as demonstrated herein. Moreover, SPE has now been shown to induce a toxic shock like syndrome identical to that associated with various enterotoxins. Given the biological and structural relatedness of these proteins, it would be anticipated that SPE and any other protein, bacterial or otherwise, with homology to enterotoxins would produce tumoricidal effects identical to those of enterotoxins. Indeed, this prediction was borne out by demonstrating complete tumor remissions in the first two of three rabbits bearing large VX-2 carcinomas treated with intravenously administered SPEA.

SEA, SEB, SEC, SED, TSST-1 and the pyrogenic exotoxins have also been shown to share considerable DNA and amino acid homology. The enterotoxins, the pyrogenic exotoxins and TSST-1 therefore appear to be evolutionarily related and all belong to a common generic group of proteins. It should be noted that the two Streptococcal toxins SPEA and C are about as similar to each of the Staphylococcal groups as they are to each other. Exfoliative toxins are of similar size to SEB and SEA with similar modes of action. They share several points of sequence similarity to the Staphylococcal enterotoxins. Overall, there are several stretches at which similarities are apparent throughout the total group comprised of Staphylococcal enterotoxins, Streptococcal pyrogenic exotoxins and Staphylococcal exfoliative toxins. The longest of these, located two-thirds of the way through the proteins, is similar to sequences found at the COOH-terminal end of the human and mouse invariant chain.

The recognition that the biologically active regions of the enterotoxins and SPEA were substantially structurally homologous enables one to predict synthetic polypeptide compounds which will exhibit similar tumoricidal effects. FIG. 2 illustrates the amino acid sequence homology of mature SPEA and Staphylococcus aureus enterotoxin B. The top sequence is the SPEA-derived amino acid sequence. The amino acid sequence of enterotoxin B is on the bottom. Sequences are numbered from the amino acid terminus, with 5 amino acids represented by standard one character designations. (See Tables 5 and 6.) Identities are indicated by: and gaps in the sequences introduced by the alignment algorithm are represented by dashed lines. See Johnson, L. P., L'ltalien, J. J., and Schlievert, P. M., “Streptococcal pyrogenic exotoxin type A (scarlet fever toxins) is related to staphylococcus aureus enterotoxin B,” Mol. Gen. Genet. (1986) 203: 354-356.

Streptococcal pyrogenic exotoxin (SPE) is produced by many strains of group A streptococci. Three antigenically distinct types (A, B, C) have been described. It is now known that Streptococcal pyrogenic exotoxin or scarlet fever toxin is related to Staphylococcus aureus enterotoxin B. The amino acid sequence of SPE has significant homology with Staphylococcus aureus enterotoxin B but not with other proteins in the Dayhoff library. FIG. 2 shows the alignment of amino acid sequences of mature SPEA and Staphylococcus aureus enterotoxin B, as reported in Johnson, L. P., L'ltalien, J. J. and Schievert, P. M. “Streptococcal pyrogenic exotoxin type A (Scarlet fever toxin) is related to Staphylococcus aureus enterotoxin B,” Mol. Gen. Genet(1986) 203:354-356.

One common methodology for evaluating sequence homology and more importantly statistically significant similarities is to use a Monte Carlo analysis using an algorithm written by Lipman and Pearson to obtain a Z value. According to this analysis, a Z value greater than 6 indicates probable significance, and a Z value greater than 10 is considered to be statistically significant. Pearson, W. R., Lipman, D. J., “Improved tools for biological sequence comparison, 1 Proc. Natl. Acad. Sci. USA. April 1988, 85 (8) pages 2444-8; Lipman, D. J., Pearson, W. R., “Rapid and sensitive protein similarity searches,” Science. Mar. 22, 1985, 227 (4693) pages 143525 41.

The known structural homology between the enterotoxins and Streptococcal pyrogenic exotoxin is further supported by the identity of clinical responses. It is known that this exotoxin induces hypotension, fever, chills and septic shock in man. It is hypothesized that this compound activates cytokines, such as interleukin 1, interleukin 2, tumor necrosis factor and interferon, and procoagulant activity which are the prime mediators of the clinical symptomatology.

It could be predicted that peptides of the whole enterotoxin molecule can produce biologically active effects and reliably reproduce the in vivo tumoricidal activity of the whole molecule while eliminating some of the toxic effects noted. The biological properties of SPE are shared with some Staphylococcal enterotoxins such as lymphocyte mitogenicity, fever induction and enhanced susceptibility to endotoxin shock when given intravenously. SPE activates murine T cells mainly Vβ8.2 in physical association with MHC class II molecules expressed on accessory cells. SPE causes deregulation of the immune response in vitro resulting in delayed (12-16 days) acceleration of humoral and cellular immune activity. This may account for the sustained anti-tumor responses noted with the use of its structural analog, namely enterotoxin B, when administered to rabbits with the VX-2 carcinoma as demonstrated herein. Moreover, SPE has now been shown to induce a toxic shock like syndrome identical to that associated with various enterotoxins. Given the biological and structural relatedness of these proteins, it would be anticipated that SPE and any other protein, bacterial or otherwise, with homology to enterotoxins would produce tumoricidal effects identical to those of enterotoxins. Indeed, this prediction was borne out by demonstrating complete tumor remissions in the first two of three rabbits bearing large VX-2 carcinomas treated with intravenously administered SPEA.

An immune functional site on Staphylococcal enterotoxin A has been identified corresponding to residues 1-27 of SEA which is responsible for stimulation of T cell proliferation and induction of interferon-y. This SEA (1-27) sequence corresponds to N-Ser-GIv-Lys-Ser-Glu-Glu-Ile-Asn-GFlu-Lys-Asp-Lev.Arg Lys-Lys-Ser-Glu-Leu-Gln-Gly-Thr-Ala-Lev-Gly-Asn-Lev-Ly and blocks SEA induced T cell proliferation and production of interferon y which was not seen with SEA (28-48) peptide. Thus, a functional site on SEA responsible for modulation of T cell function involves the N-terminal 27 amino acids. These molecules may interact at either the level of TCR or the binding of SEA to class II MHC antigens.] For TSST-1, mitogenic activity was shown to be located on a 14,000 dalton cyanogen bromide generated toxin fragment. Other studies using proteolytic digestion of the TSST-1 with papain demonstrated mitogenic activity in 12,000 dalton fragment occupying 2/3 of TSST-1 molecule toward COOH terminal end of holotoxin. On the other hand, non-specific mitogenicity of rabbit lymphocytes demonstrated by enterotoxins A, B, and Cl was associated with the NH2 terminal ends of the molecules.

Moreover, it would be reasonable to assume that similar or increased tumoricidal effects could be accomplished with biologically active superantigen peptides, intact enterotoxins or superantigens alone or attached to antigen presenting cells (class II MHC, HLA-DR) and incubated ex vivo with a random T cell population or one which may have been pre-enriched for the appropriate Vβ receptor. The activated T cell population with bound enterotoxin might then be reinfused into the host. Similar tumoricidal effects would be anticipated with enterotoxins or biologically active fragments infused into a host who has had an “organoid” (an enriched T lymphocyte organ) implanted on a biocompatible matrix and placed in a site in the host such as the abdominal cavity, adjacent to the liver or subcutaneously.

EXAMPLE 49

Incorporated by reference from U.S. Ser. No. 07/891,718 “Tumor Killing Effects of Enterotoxins and Related Compounds,” filed 1 Jun. 1992 published as WO93/24136, Dec. 9, 1993.

Genetic Aspects of Enterotoxin Production

Proceeding from the seminal work of Cohen &Bayer, U.S. Pat. No. 4,237,224, DNA technology has become useful to provide novel DNA sequences and produce, large amounts of heterologous proteins in transformed cell cultures. In general, the joining of DNA from different organisms relies on the excision of DNA sequences using restriction endonucleases. These enzymes are used to cut donor DNA at very specific locations, resulting in gene fragments which contain the DNA sequences of interest. These DNA fragments usually contain short single-stranded tails at each end, termed “sticky-ends”. These sticky-ended fragments can then be ligated to complementary fragments in expression vehicles which have been prepared, e.g., by digestion with the same restriction endonucleases. Having created an expression vector which contains the structural gene of interest in proper orientation with the control elements, one can use this vector to transform host cells and express the desired gene product;with the cellular machinery available. Once expressed, the gene product is generally recovered by lysing the cell culture, if the product is expressed intracellularly, or recovering the product from the medium if it is secreted by the host cell.

Recombinant DNA technology has been used to express: entirely heterologous gene products, termed direct expression, or the gene product of interest can be expressed as a fusion protein containing some parts of the amino acid sequence of a homologous protein. This fusion protein is generally processed post-translationally to recover the native gene product. Many of the techniques useful in this technology can be found in Maniatis, T., et al. Molecular Cloning; A Laboratory Manual. Cold Spring Harbor Laboratory, New York (1982).

From physical and genetic analysis, the genes for SEA, SEB, SEC, and SEE occupy a chromosomal loci.The structural gene encoding SED in all strains examined is localized, to a large penicillinase-like plasmid.

The enterotoxin A gene has been cloned. SEA was expressed in the E. coli genetic background from a single 2.5 kbp Hind III chromosomal DNA fragment. When sequenced, the DNA was found to contain a single reading frame that generated a protein consistent with the partial sequences of SEA derived by chemical methods. Therefore, it is apparent that the site mapped contained the structural gene for SEA. Betley, M. J., Mekalanos, J. J., J. Bacteriol, 170, 34, 1987; Huang, I. Y., Hughes, J. L., Bergdoll, M. S., Schantz, E. J., J. Biol. Chem., 262, 7006, 1987; Betley, M., Lofdahl, S., Kreiswirth, B. N., Bergdoll, M. S., Novick, R. P. Proc. Natl. Acad., Sci., USA, 81, 5179, 1984. The enterotoxin A gene was found to be at least 18 kilobases in length and was carried on a mobile element. Enterotoxin A production was linked to the presence of a bacteriophage which integrates into the bacterial chromosome. The enterotoxin A gene is located near the phage attachment. The enterotoxin A gene was mapped between the purine and isoleucine-valine markers in 24 Staphylococcus aureus strains. Conversion to the SEA producing phenotype was induced by lysogenization with a temperate phage purified from staphylococcal aureus strain PS42D. Therefore, a bacteriophage vector was found to be responsible for the toxin phenotype in suitable recipients.

The enterotoxin B gene has been cloned and expressed in E. Coli. The DNA of the gene derived from E. Coli has been sequenced and matches the chemically derived sequence with only minor differences. Gaskill, M. E., Khan, S. A., J. Biol. Chem., 263, 6276, 1988; Jones, C. L., Khan, S. A., J. Bacteriol, 166, 29, 1986; Huang, I. Y., Bergdoll, M. S., J. Biol. Chem., 245, 3518, 1970.

The SEC gene has been cloned from the chromosome of Staphylococcus aureus MN Don. The cloned toxin was expressed in E. coli with a molecular weight comparable to that of the toxin from Staphylococcus aureus. The toxin was biologically active as measured by pyrogenicity, enhancement of lethal endotoxic shock and mitogenicity with murine splenocytes. The DNA sequence of the enterotoxin C gene has been developed and a protein sequence derived that compares favorably with the complete chemical sequence reported earlier. Bohach, G. A., Schlievert, P. M., Infect Immun., 55, 428, 1987; Bohach, G. A., Schlievert, P. M. Mol. Gen. Genet. 209, 15, 1987.

The enterotoxin D gene has been found to occur on a 27.6 kbp plasmid. The enterotoxin D gene has been cloned an expressed in E. coli and other Staphylococcal strains. The enterotoxin D gene in staphylococcus aureus is under control of the agar locus like most Staphylococcal extracellular protein genes. The DNA sequence was determined encoding a mature protein with amino acid composition and reaction with antibody to SED confirming its identity to the biochemically purified toxin. Couch, J. L., Saltis, M. T., Betley, M. J., J. Bacteriol. 170, 2954, 1988.

The enterotoxin E gene has been cloned from S. Aureus FR1918 and was expressed in E. coli encoding an extracellular protein of 26,425 daltons. Its identity to SEE was confirmed immunologically and by correspondence of N terminal and C terminal analysis. Kreiswirth, B. N., Lofdahl, S., Betley, M. J., O'Reilly, Schlievert, P. M. Nature, 305, 709, 1983.

TSST-1 gene was not associated with either bacteriophage or plasmid DNA. The gene was cloned on a 10.6 kbp fragment of chromosomal DNA and subsequently on an approximately 1 kbp subclone of the larger fragment. The TSST-1 gene was expressed in E. Coli, and TSST-1 was secreted into the periplasm. The genetic element coding for TSST-1 was found to occupy two loci on the Staphylococcus genome. The loci are indicated by the notation Hi 555; one is at the junction of regions 1 and 2 and is indistinguishable from att012 and closely linked to tyrB. The second is within the trp operon at the junction of regions 17 and 18. Hi555 encodes the tst gene and is a heterologous insertion element that provisionally exhibits some of the characteristics of a transposon. Strains that are Trp″ contain Hi555 at regions 17 and 18 (linked to Trp), while strains that are Trp+ contain Hi555 elsewhere linked to TryB. However, the Trp″ phenotype is not due to insertional inactivation by the unusual element. The sequence and analysis of the tst gene has been described. It codes for a mature protein (TSST-1) of 197 amino acids and a molecular weight of 22,049. Cooney, J., Mulvey, M., Arbuthnott, J. P., Foster, T. J., J. Gen. Microbiol., 134, 2179, 1988.

Streptococcal pyrogenic exotoxin (SPEA) is clearly related to the enterotoxins. It has a cysteine loop of 9 amino acids similar to that of SEA and is also encoded by a converting phage. SPEA shows greater amino acid sequence similarity with SEB than SEA. Immunologic studies show that the proteins and antisera to either enterotoxin are cross reactive. Therefore, genes for all of the enterotoxins have been isolated and transfected into other bacteria to obtain selective production. These genes may be used as sources of accelerated production of these toxins in high producing bacteria employing transfection techniques familiar to one skilled in the art. Iandolo, J. J., Annu. Rev. Microbiol., 43, 375, 1989.

High producing strains of Staphylococcus for selective enterotoxin production have been identified and are available as described in enterotoxin purification section above. Moreover, exposure to mutagenic agents such as N-methyl-N′-nitro-N-nitrosoguanidine of enterotoxin producing Staphylococcus aureus has resulted in a 20 fold increase in enterotoxin production over the amounts produced by the parent Staphylococcus aureus strain. Freedman, M. A., Howard, M. B., J. Bacteriol, 106, 289, 1971.

Additional Documents Incorporated by Reference

This application incorporates by reference the following patents and currently pending patent applications that disclose inventions of the present inventor alone or with co-inventors.

  • 1. Patent application WO91/US342, “Tumor Killing Effects of Enterotoxins and Related Compounds” filed 17 Jan. 1991, and published as WO 91/10680 on 25 Jul. 1991.
  • 2. U.S. Ser. No. 07/891,718 “Tumor Killing Effects of Enterotoxins and Related Compounds,” filed 1 Jun. 1992.
  • 3. U.S. Pat. No. 5,728,388, “Method of Cancer Treatment,” issued Mar. 17, 1998.
  • 4. U.S. Ser. No. 08/491,746, “Method of Cancer Treatment,” filed 19 Jun. 1995.
  • 5. U.S. Ser. No. 08/898,903 “Method of Cancer Treatment,” filed 23 Jul. 1997.
  • 6. U.S. Ser. No. 08/896,933 “Tumor Killing Effects of Enterotoxins and Related Compounds,” filed 18 Jul. 1997.
  • 7. U.S. Ser. No. 60/085,506, “Compositions and Methods for Treatment of Cancer,” filed 5 May 1998.
  • 8. U.S. Ser. No. 60/094,952 “Compositions and Methods for Treatment of Cancer” filed 31 Jul. 1998.
  • 9. U.S. Ser. No. 60/033,172 “Superantigen-Based Methods and Compositions for Treatment of Cancer,” filed 17 Dec. 1996.
  • 10. U.S. Ser. No. 60/044,074 “Superantigne-Based Methods and Compositions for Treatment of Cancer,” filed 17 Apr. 1997.
  • 11. U.S. Ser. No. 09/061,334 “Tumor Cells with Increased Immunogenicity and Uses Thereof,” filed 17 Apr. 1998.

Moreover, all references cited herein are incorporated by reference, whether specifically incorporated or not.

Having now fully described this invention, it will be appreciated by those skilled in the art that the same can be performed within a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation.

While this invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications. This application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth as follows in the scope of the appended claims.

Claims

1. (canceled)

2. (canceled)

3. A method of treating a subject with a carcinoma of the lung or pleura originating from a lung or breast carcinoma comprising administering to said subject intravenously by infusion or injection a tumoricidally effective amount of a composition consisting of:

(i) a biologically active variant, mutant or fragment of a wild type staphylococcal enterotoxin, which variant, mutant or fragment:

(a) has the biological activity of stimulating T cell mitogenesis via a T cell receptor vβ region and

(b) has sequence homology to a native staphylococcal enterotoxin or a streptococcal pyrogenic exotoxin as determined by FASTA or FASTP and Monte Carlo analysis according to the algorithms of W. R. Pearson and D. J. Lipman, wherein a sequence is a homologue if it has a z value greater than 10 when compared to the sequence of said wild type enterotoxin; or

(ii) a biologically active fusion protein having said biological activity and said sequence homology, comprising said enterotoxin mutant, variant or fragment fused to a polypeptide fusion partner.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class: