US20110160072A1
2011-06-30
12/739,559
2008-10-23
The present invention relates generally to a nucleic acid molecule, the RNA and protein expression profiles of which are indicative of the onset, predisposition to the onset and/or progression of a large intestine neoplasm. More particularly, the present invention is directed to a nucleic acid molecule, the expression profiles of which are indicative of the onset and/or progression of a colorectal neoplasm, such as an adenoma or an adenocarcinoma. The expression profiles of the present invention are useful in a range of applications including, but not limited to, those relating to the diagnosis and/or monitoring of colorectal neoplasms, such as colorectal adenomas and adenocarcinomas. Accordingly, in a related aspect the present invention is directed to a method of screening a subject for the onset, predisposition to the onset and/or progression of a large intestine neoplasm by screening for modulation in the expression profile of said nucleic acid molecule markers.
Get notified when new applications in this technology area are published.
C12Q1/6886 » CPC main
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
G01N33/57446 » CPC further
Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing; Immunoassay; Biospecific binding assay; Materials therefor for cancer; Specifically defined cancers of stomach or intestine
C12Q2600/112 » CPC further
Oligonucleotides characterized by their use Disease subtyping, staging or classification
C12Q2600/158 » CPC further
Oligonucleotides characterized by their use Expression markers
C12Q2600/16 » CPC further
Oligonucleotides characterized by their use Primer sets for multiplex assays
G01N2800/06 » CPC further
Detection or diagnosis of diseases Gastro-intestinal diseases
C40B30/04 IPC
Methods of screening libraries by measuring the ability to specifically bind a target molecule, e.g. antibody-antigen binding, receptor-ligand binding
C40B40/08 IPC
Libraries , e.g. arrays, mixtures; Libraries containing only organic compounds; Libraries containing nucleotides or polynucleotides, or derivatives thereof Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries
C07H21/00 IPC
Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
The present invention relates generally to a nucleic acid molecule, the RNA and protein expression profiles of which are indicative of the onset, predisposition to the onset and/or progression of a large intestine neoplasm. More particularly, the present invention is directed to a nucleic acid molecule, the expression profiles of which are indicative of the onset and/or progression of a colorectal neoplasm, such as an adenoma or an adenocarcinoma. The expression profiles of the present invention are useful in a range of applications including, but not limited to, those relating to the diagnosis and/or monitoring of colorectal neoplasms, such as colorectal adenomas and adenocarcinomas.
Accordingly, in a related aspect the present invention is directed to a method of screening a subject for the onset, predisposition to the onset and/or progression of a large intestine neoplasm by screening for modulation in the expression profile of said nucleic acid molecule markers.
Bibliographic details of the publications referred to by author in this specification are collected alphabetically at the end of the description.
The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.
Adenomas are benign tumours, or neoplasms, of epithelial origin which are derived from glandular tissue or exhibit clearly defined glandular structures. Some adenomas show recognisable tissue elements, such as fibrous tissue (fibroadenomas) and epithelial structure, while others, such as bronchial adenomas, produce active compounds that might give rise to clinical syndromes.
Adenomas may progress to become an invasive neoplasm and are then termed adenocarcinomas. Accordingly, adenocarcinomas are defined as malignant epithelial tumours arising from glandular structures, which are constituent parts of many organs of the body. The term adenocarcinoma is also applied to tumours showing a glandular growth pattern. These tumours may be sub-classified according to the substances that they produce, for example mucus secreting and serous adenocarcinomas, or to the microscopic arrangement of their cells into patterns, for example papillary and follicular adenocarcinomas. These carcinomas may be solid or cystic (cystadenocarcinomas). Each organ may produce tumours showing a variety of histological types, for example the ovary may produce both mucinous and cystadenocarcinoma.
Adenomas in different organs behave differently. In general, the overall chance of carcinoma being present within an adenoma (i.e. a focus of cancer having developed within a benign lesion) is approximately 5%. However, this is related to size of an adenoma. For instance, in the large bowel (colon and rectum specifically) occurrence of a cancer within an adenoma is rare in adenomas of less than 1 centimetre. Such a development is estimated at 40 to 50% in adenomas which are greater than 4 centimetres and show certain histopathological change such as villous change, or high grade dysplasia. Adenomas with higher degrees of dysplasia have a higher incidence of carcinoma. In any given colorectal adenoma, the predictors of the presence of cancer now or the future occurrence of cancer in the organ include size (especially greater than 9 mm) degree of change from tubular to villous morphology, presence of high grade dysplasia and the morphological change described as “serrated adenoma”. In any given individual, the additional features of increasing age, familial occurrence of colorectal adenoma or cancer, male gender or multiplicity of adenomas, predict a future increased risk for cancer in the organ—so-called risk factors for cancer. Except for the presence of adenomas and its size, none of these is objectively defined and all those other than number and size are subject to observer error and to confusion as to precise definition of the feature in question. Because such factors can be difficult to assess and define, their value as predictors of current or future risk for cancer is imprecise.
Once a sporadic adenoma has developed, the chance of a new adenoma occurring is approximately 30% within 26 months.
Colorectal adenomas represent a class of adenomas which are exhibiting an increasing incidence, particularly in more affluent countries. The causes of adenoma, and of progression to adenocarcinoma, are still the subject of intensive research. To date it has been speculated that in addition to genetic predisposition, environmental factors (such as diet) play a role in the development of this condition. Most studies indicate that the relevant environmental factors relate to high dietary fat, low fibre, low vegetable intake, smoking, obesity, physical inactivity and high refined carbohydrates.
Colonic adenomas are localised areas of dysplastic epithelium which initially involve just one or several crypts and may not protrude from the surface, but with increased growth in size, usually resulting from an imbalance in proliferation and/or apoptosis, they may protrude. Adenomas can be classified in several ways. One is by their gross appearance and the major descriptors include degrees of protrusion: flat sessile (i.e. protruding but without a distinct stalk) or pedunculated (i.e. having a stalk). Other gross descriptors include actual size in the largest dimension and actual number in the colon/rectum. While small adenomas (less than say 5 or 10 millimetres) exhibit a smooth tan surface, pedunculated and especially larger adenomas tend to have a cobblestone or lobulated red-brown surface. Larger sessile adenomas may exhibit a more delicate villous surface. Another set of descriptors include the histopathological classification; the prime descriptors of clinical value include degree of dysplasia (low or high), whether or not a focus of invasive cancer is present, degree of change from tubular gland formation to villous gland formation (hence classification is tubular, villous or tubulovillous), presence of admixed hyperplastic change and of so-called “serrated” adenomas and its subgroups. Adenomas can be situated at any site in the colon and/or rectum although they tend to be more common in the rectum and distal colon. All of these descriptors, with the exception of number and size, are relatively subjective and subject to interobserver disagreement.
The various descriptive features of adenomas are of value not just to ascertain the neoplastic status of any given adenomas when detected, but also to predict a person's future risk of developing colorectal adenomas or cancer. Those features of an adenoma or number of adenomas in an individual that point to an increased future risk for cancer or recurrence of new adenomas include: size of the largest adenoma (especially 10 mm or larger), degree of villous change (especially at least 25% such change and particularly 100% such change), high grade dysplasia, number (3 or more of any size or histological status) or presence of serrated adenoma features. None except size or number is objective and all are relatively subjective and subject to interobserver disagreement. These predictors of risk for future neoplasia (hence “risk”) are vital in practice because they are used to determine the rate and need for and frequency of future colonoscopic surveillance. More accurate risk classification might thus reduce workload of colonoscopy, make it more cost-effective and reduce the risk of complications from unnecessary procedures.
Adenomas are generally asymptomatic, therefore rendering difficult their diagnosis and treatment at a stage prior to when they might develop invasive characteristics and so became cancer. It is technically impossible to predict the presence or absence of carcinoma based on the gross appearance of adenomas, although larger adenomas are more likely to show a region of malignant change than are smaller adenomas. Sessile adenomas exhibit a higher incidence of malignancy than pedunculated adenomas of the same size. Some adenomas result in blood loss which might be observed or detectable in the stools; while sometimes visible by eye, it is often, when it occurs, microscopic or “occult”. Larger adenomas tend to bleed more than smaller adenomas. However, since blood in the stool, whether overt or occult, can also be indicative of non-adenomatous conditions, the accurate diagnosis of adenoma is rendered difficult without the application of highly invasive procedures such as colonoscopy combined with tissue acquisition by either removal (i.e. polypectomy) or biopsy and subsequent histopathological analysis.
Accordingly, there is an on-going need to elucidate the causes of adenoma and to develop more informative diagnostic protocols or aids to diagnosis that enable one to direct colonoscopy at people more likely to have adenomas. These adenomas may be high risk, advanced or neither of these. Furthermore, it can be difficult after colonoscopy to be certain that all adenomas have been removed, especially in a person who has had multiple adenomas. An accurate screening test may minimise the need to undertake an early second colonoscopy to ensure that the colon has been cleared of neoplasms. Accordingly, the identification of molecular markers for adenomas would provide means for understanding the cause of adenomas and cancer, improving diagnosis of adenomas including development of useful screening tests, elucidating the histological stage of an adenoma, characterising a patient's future risk for colorectal neoplasia on the basis of the molecular state of an adenoma and facilitating treatment of adenomas.
To date, research has focused on the identification of gene mutations which lead to the development of colorectal neoplasms. In work leading up to the present invention, however, it has been determined that changes in expression profiles of genes which may also expressed in healthy individuals are indicative of the development of neoplasms of the large intestine, such as adenomas and adenocarcinomas. More specifically, there has been identified a gene, an increase in the expression of which is indicative of the onset of a large intestine adenoma or adenocarcinoma. Yet more particularly, it has been determined that this gene, which comprises SEQ ID NO:1 and is herein called hCG—1815491, encodes 18 identified exon segments, several of which are expressed in two or more splice variants forms. hCG—1815491 has now been found to transcribe to at least 11 variant RNA transcript forms. It has still further been determined that although the levels of multiple transcribed forms of hCG—1815491 show some level of increase in expression in the context of neoplasia development, hCG—1815491 is, in fact, alternatively spliced in a neoplastic specific manner, thereby enabling a level of diagnostic and prognostic discrimination which is rarely available in the context of a single gene and has been unavailable in terms of the diagnosis of colorectal neoplasias. The findings of the present invention have therefore facilitated the development of a screening method to diagnose the onset, or predisposition thereto, of adenocarcinoma, adenoma and/or the monitoring of conditions characterised by the development of these types of neoplasms.
Throughout this specification and the claims which follow, unless the context requires otherwise, the word “comprise”, and variations such as “comprises” and “comprising”, will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.
As used herein, the term “derived from” shall be taken to indicate that a particular integer or group of integers has originated from the species specified, but has not necessarily been obtained directly from the specified source. Further, as used herein the singular forms of “a”, “and” and “the” include plural referents unless the context clearly dictates otherwise.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
The subject specification contains amino acid and nucleotide sequence information prepared using the programme PatentIn Version 3.4, presented herein after the bibliography. Each amino acid and nucleotide sequence is identified in the sequence listing by the numeric indicator <210> followed by the sequence identifier (eg. <210>1, <210>2, etc). The length, type of sequence (amino acid, DNA, etc.) and source organism for each sequence is indicated by information provided in the numeric indicator fields <211>m<212> and <213>, respectively. Amino acid and nucleotide sequences referred to in the specification are identified by the indicator SEQ ID NO: followed by the sequence identifier (eg. SEQ ID NO:1, SEQ ID NO: 2, etc). The sequence identifier referred to in the specification correlates to the information provided in numeric indicator field <400> in the sequence listing, which is followed by the sequence identifier (eg. <400>1, <400>2, etc). That is SEQ ID NO: 1 as detailed in the specification correlates to the sequence indicated as <400>1 in the sequence listing.
One aspect of the present invention is directed to a method of screening for the onset or predisposition to the onset of a large intestine neoplasm in an individual, said method comprising measuring the level of expression of hCG—1815491 in a biological sample from said individual wherein a higher level of expression of hCG—1815491 or variant thereof relative to control levels is indicative of a neoplastic large intestine cell or a cell predisposed to the onset of a neoplastic state.
The present invention more particularly provides a method of screening for the onset or predisposition to the onset of a large intestine neoplasm in an individual, said method comprising measuring the level of expression of a gene comprising a sequence of nucleotides as set forth in SEQ ID NO:1 or a sequence having at least 90% similarity to SEQ ID NO:1 across the length of the gene, or variant of SEQ ID NO:1, in a biological sample from said individual wherein a higher level of expression of said gene or variant thereof relative to control levels is indicative of a neoplastic large intestine cell or a cell predisposed to the onset of a neoplastic state.
Another aspect of the present invention provides a method of screening for the onset or predisposition to the onset of a large intestine neoplasm in an individual, said method comprising measuring the level of expression of one or more RNA transcripts, which transcripts comprise an RNA sequence characterised by the sequence of one of:
In still another aspect the RNA transcript, the level of expression of which is assessed in accordance with the method of the present invention, is one or more of the transcripts characterised by the sequence of one of:
In yet another aspect said RNA transcript is one or more of the transcripts characterised by the sequence of one of:
In a further aspect there is provided a method of screening for the onset or predisposition to the onset of a large intestine neoplasm in an individual, said method comprising measuring the level of expression of an RNA transcript, which transcript comprises one or more exon segments selected from:
More particularly there is provided a method of screening for the onset or predisposition to the onset of a large intestine neoplasm in an individual, said method comprising measuring the level of expression of an RNA transcript, which transcript comprises one or more exon segments selected from:
Yet more particularly there is provided a method of screening for the onset or predisposition to the onset of a large intestine neoplasm in an individual, said method comprising measuring the level of expression of an RNA transcript selected from:
Still more particularly there is provided a method of screening for the onset or predisposition to the onset of a large intestine neoplasm in an individual, said method comprising measuring the level of expression of an RNA transcript, which transcript is selected from:
In another further aspect, there is therefore provided a method of screening for the onset or predisposition to the onset of a large intestine neoplasm in an individual, said method comprising measuring the level of expression of one or more RNA transcripts, which transcripts comprise an RNA sequence characterised by the sequence of one of:
In yet another aspect said transcripts comprise an RNA sequence characterised by the sequence of one of:
Still another aspect of the present invention provides a diagnostic kit for assaying biological samples comprising an agent for detecting one or more neoplastic marker reagents useful for facilitating the detection by the agent in the first compartment. Further means may also be included, for example, to receive a biological sample. The agent may be any suitable detecting molecule.
FIG. 1. Detection of hCG—1815491 gene expression. The expression from hCG—1815491 in colon tissue specimens from 222 non-diseased controls (black, area designated with an “N”), 42 colitis tissues (red, are designated by an “I”), 29 adenoma (green, area designated by an “A”) and 161 adenocarcinoma (blue, area designated by “Ca”) were measured by hybridization to Affymetrix probeset IDs 238021_s_at (A) and 238022_at (B). The two Affymetrix probeset IDs were included on the commercially available Affymetrix GeneChip HGU133A & HGU13B. Gene expression profiles from RNA extracted from the total of 454 colon tissue specimens were obtained from GeneLogic Inc (Gaithersburg, Md. USA). A quality control analysis was performed to remove arrays not meeting essential quality control measures as defined by the manufacturer. Transcript expression levels were calculated by both Microarray Suite (MAS) 5.0 (Affymetrix) and the Robust Multichip Average (RMA) normalization techniques (Affymetrix. GeneChip expression data analysis fundamentals. Affymetrix, Santa Clara, Calif. USA, 2001; Hubbell et al. Bioinformatics, 18:1585-1592, 2002; Irizarry et al. Nucleic Acid Research, 31, 2003) MAS normalized data was used for performing standard quality control routines and the final data set was normalized with RMA for all subsequent analyses.
FIG. 2. Detection of SEQ ID NO:1 expression in 71 colorectal tissue specimens. The expression of SEQ ID NO:1 in a total of 71 colorectal specimens from 30 non-diseased controls (“normals”), 21 adenoma and 21 adenocarcinoma subjects was measured by end-point PCR using the forward and reverse oligonucleotide primers 5′-TAACTGGAATTCATGTTGGCTGAAATTCATCCCA (SEQ ID NO:89) and 5′-CACGATAAGCTTTTATTATAGTCTATAAACAGGAATACCCAAAACATA TTTAAACC (SEQ ID NO:90). The resulting PCR products were separated by agarose based gel electrophoresis.
FIG. 3. Measurements of SEQ ID NO:1 RNA concentration levels in colorectal tissue specimens. Quantitative Real-Time PCR, using forward and reverse oligonucleotide primers, 5′-TAACTGGAATTCATGTTGG CTGAAATTCATCCCA (SEQ ID NO:91) and 5′-CACGATAAGCTTTTATTATA GTCTATAAACAGGAATACCCAAAACATATTT AAACC (SEQ ID NO:92) was performed on RNA extracted from a total of 71 colorectal specimens from 30 non-diseased controls (white), 21 adenoma (striped) and 21 adenocarcinoma (black) subjects. Relative expression levels were calculated as described in Example 1.
FIG. 4. Schematic representation of predicted RNA variants derived from hCG—1815491. cDNA clones derived from map region 8579310 to 8562303 (SEQ ID NO:1) on human chromosome 16 were used to locate exon sequences. Arrows: Oligo nucleotide primer sets (Table 5) were designed to allow measurement of individual RNA variants by PCR. Oligonucleotide primers covering splice junctions are shown as spanning intron sequences which is not included in the actual oligonucleotide primer sequence. Exon nucleotide sequence and genomic locations are given in FIGS. 22 and 23. The relationship of exon “E” numbering and SEQ ID NO. numbering is further defined in Table 1.
FIG. 5. Example on differential expression of hCG—1815491 RNA variants in colorectal tissue specimens. The expression of the ten predicted RNA transcripts derived from the map region 8579310 to 8562303 on the strand of chromosome 16 was measured by end-point PCR using specific oligonucleotide primer sets (Table 5). DNA sequencing of the resulting PCR amplicons confirmed the products to be derivates of SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30 and SEQ ID NO:31 (Table 5).
FIG. 6. Measurement of SEQ ID NO:21 RNA concentration levels in colorectal tissue specimens. Quantitative Real-Time PCR, using forward oligonucleotide primer, 5′-ACACGGCTTTCCGGAGTAGA (SEQ ID NO:93), and reverse oligonucleotide primer, 5′-AACAGGTTTTACCTCCTTATCTTCAGAA (SEQ ID NO:94), was performed on RNA extracted from a total of 71 colorectal tissue specimens from 30 non-diseased controls (white), 21 adenoma (striped) and 20 adenocarcinoma (black) subjects. SEQ ID NO:21 RNA expression levels are depicted relative to HRPT as explained in Example 1.
FIG. 7. Identification of a novel RNA variant derived from SEQ ID NO:1. End-point PCR, using a forward oligonucleotide primer, 5′-GGCGGAGGAGAGGTG AGC (SEQ ID NO:95), spanning the junction between SEQ ID NO:4 and SEQ ID NO:5 and a reverse oligonucleotide primer, 5′-GCTGACAGCATCCA AATGTATTATG (SEQ ID NO:96), hybridizing to SEQ ID NO:6, was performed on RNA extracted from colorectal tissue specimens from 2 non-diseased controls (Ctrl), 3 adenoma and 3 adenocarcinoma subjects. The resulting PCR products were separated by agarose-based gel electrophoresis and the products observed in the neoplastic tissue samples were sequenced, which confirmed the novel splicing of SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO: 6 (Table 5).
FIG. 8. Measurement of expression of individual target regions in SEQ ID NO:1. The level of RNA hybridization to 13 Affymetrix probesets, Table 3, residing in the map region 8579310 to 8562303 was measured using the Affymetrix GeneChip HuGene Exon 1.0 as recommended by manufacturer. RNA was extracted from colon tissue specimens from 5 non-diseased controls (left bar in boxplots), 5 adenoma (middle bar in boxplots) and 5 adenocarcinoma subjects (right bar in boxplots). The individual boxplots are also given in FIGS. 9-21. The relationship of exon “E” numbering and SEQ ID NO. numbering is further defined in Table 1.
FIG. 9. Measurement of RNA expression on Affymetrix GeneChip HuGene Exon 1.0 probeset ID 3692527 (referred to as Probeset A in FIG. 8) targeting map region 8577230 to 8576913 of SEQ ID NO:1. Expression profiles were obtained from hybridisation analysis of RNA extracted from colon tissue specimens from 5 non-diseased controls, 5 adenoma and 5 adenocarcinoma subjects as further described in Example 1
FIG. 10. Measurement of RNA expression on Affymetrix GeneChip HuGene Exon 1.0 probeset ID 3692526 (referred to as Probeset B in FIG. 8) targeting map region 8576785 to 8576609 of SEQ ID NO:1. Expression profiles were obtained from hybridisation analysis of RNA extracted from colon tissue specimens from 5 non-diseased controls, 5 adenoma and 5 adenocarcinoma subjects as further described in Example 1
FIG. 11. Measurement of RNA expression on Affymetrix GeneChip HuGene Exon 1.0 probeset ID 3692525 (referred to as Probeset C in FIG. 8) targeting map region 8573317 to 8573214 of SEQ ID NO:1. Expression profiles were obtained from hybridisation analysis of RNA extracted from colon tissue specimens from 5 non-diseased controls, 5 adenoma and 5 adenocarcinoma subjects as further described in Example 1.
FIG. 12. Measurement of RNA expression on Affymetrix GeneChip HuGene Exon 1.0 probeset ID 3692524 (referred to as Probeset D in FIG. 8) targeting map region 8571756 to 8571721 of SEQ ID NO:1. Expression profiles were obtained from hybridisation analysis of RNA extracted from colon tissue specimens from 5 non-diseased controls, 5 adenoma and 5 adenocarcinoma subjects as further described in Example 1.
FIG. 13. Measurement of RNA expression on Affymetrix GeneChip HuGene Exon 1.0 probeset ID 3692522 (referred to as Probeset E in FIG. 8) targeting map region 8568480 to 8568447 of SEQ ID NO:1. Expression profiles were obtained from hybridisation analysis of RNA extracted from colon tissue specimens from 5 non-diseased controls, 5 adenoma and 5 adenocarcinoma subjects as further described in Example 1.
FIG. 14. Measurement of RNA expression on Affymetrix GeneChip HuGene Exon 1.0 probeset ID 3692521 (referred to as Probeset F in FIG. 8) targeting map region 8568438 to 8568409 of SEQ ID NO:1. Expression profiles were obtained from hybridisation analysis of RNA extracted from colon tissue specimens from 5 non-diseased controls, 5 adenoma and 5 adenocarcinoma subjects as further described in Example 1.
FIG. 15. Measurement of RNA expression on Affymetrix GeneChip HuGene Exon 1.0 probeset ID 3692504 (referred to as Probeset G in FIG. 8) targeting map region 8566289 to 8566014 of SEQ ID NO:1. Expression profiles were obtained from hybridisation analysis of RNA extracted from colon tissue specimens from 5 non-diseased controls, 5 adenoma and 5 adenocarcinoma subjects as further described in Example 1.
FIG. 16. Measurement of RNA expression on Affymetrix GeneChip HuGene Exon 1.0 probeset ID 3692505 (referred to as Probeset H in FIG. 8) targeting map region 8577467 to 8577374 of SEQ ID NO:1. Expression profiles were obtained from hybridisation analysis of RNA extracted from colon tissue specimens from 5 non-diseased controls, 5 adenoma and 5 adenocarcinoma subjects as further described in Example 1.
FIG. 17. Measurement of RNA expression on Affymetrix GeneChip HuGene Exon 1.0 probeset ID 3692523 (referred to as Probeset I in FIG. 8) targeting map region 8569323 to 8568689 of SEQ ID NO:1. Expression profiles were obtained from hybridisation analysis of RNA extracted from colon tissue specimens from 5 non-diseased controls, 5 adenoma and 5 adenocarcinoma subjects as further described in Example 1.
FIG. 18. Measurement of RNA expression on Affymetrix GeneChip HuGene Exon 1.0 probeset ID 3692520 (referred to as Probeset J in FIG. 8) targeting map region 8568331 to 8567516 of SEQ ID NO:1. Expression profiles were obtained from hybridisation analysis of RNA extracted from colon tissue specimens from 5 non-diseased controls, 5 adenoma and 5 adenocarcinoma subjects as further described in Example 1.
FIG. 19. Measurement of RNA expression on Affymetrix GeneChip HuGene Exon 1.0 probeset ID 3692519 (referred to as Probeset K in FIG. 8) targeting map region 8567301 to 8567162 of SEQ ID NO:1. Expression profiles were obtained from hybridisation analysis of RNA extracted from colon tissue specimens from 5 non-diseased controls, 5 adenoma and 5 adenocarcinoma subjects as further described in Example 1.
FIG. 20. Measurement of RNA expression on Affymetrix GeneChip HuGene Exon 1.0 probeset ID 3692517 (referred to as Probeset L in FIG. 8) targeting map region 8567033 to 8566994 of SEQ ID NO:1. Expression profiles were obtained from hybridisation analysis of RNA extracted from colon tissue specimens from 5 non-diseased controls, 5 adenoma and 5 adenocarcinoma subjects as further described in Example 1.
FIG. 21. Measurement of RNA expression on Affymetrix GeneChip HuGene Exon 1.0 probeset ID 3692518 (referred to as Probeset M in FIG. 8) targeting map region 8567158 to 8567091 of SEQ ID NO:1. Expression profiles were obtained from hybridisation analysis of RNA extracted from colon tissue specimens from 5 non-diseased controls, 5 adenoma and 5 adenocarcinoma subjects as further described in Example 1.
FIG. 22. SEQ ID NO:1 is specified by a 17,008 nucleotide sequence located on the minus strand of human chromosome 16 in the map region 8579310 to 8562303 (+ strand nomenclature) as specified by the NCBI contig ref: NT—010498.15|Hs16—10655, NCBI 36 March 2006 genome. Grey shading indicates location of nucleotide segments, i.e. exons, utilised in the RNA variants further described in FIG. 23.
FIG. 23. SEQ ID NO: 2 to SEQ ID NO: 20 identified to be alternatively spliced to generate the 10 RNA variants depicted in FIG. 4.
FIG. 24. Nucleotide sequences targeted by Affymetrix probeset ID 238021_s_at and probeset ID 238022_at.
The present invention is predicated, in part, on the elucidation of a gene expression profile, specifically that of hCG—1815491, which characterises large intestine cellular populations in terms of their neoplastic state. This finding has now facilitated the development of routine means of screening for the onset or predisposition to the onset of a large intestine neoplasm based on screening for upregulation of the expression of this molecule, relative to control expression levels. To this end, in addition to assessing expression levels of hCG—1815491 relative to normal or non-neoplastic levels, it has been determined that hCG—1815491 is alternatively spliced in a neoplastic specific manner, thereby enabling a high level of discrimination.
In accordance with the present invention, it has been determined that hCG—1815491 is modulated, in terms of differential changes to its levels of expression, depending on whether the cell expressing that gene is neoplastic or not. It should be understood that reference to a gene “expression product” or “expression of a gene” is a reference to either a transcription product (such as primary RNA or mRNA) or a translation product such as protein. This gene and its expression products, whether they be RNA transcripts or encoded proteins, are collectively referred to as the “neoplastic marker”.
Accordingly, one aspect of the present invention is directed to a method of screening for the onset or predisposition to the onset of a large intestine neoplasm in an individual, said method comprising measuring the level of expression of hCG—1815491 in a biological sample from said individual wherein a higher level of expression of hCG—1815491 or variant thereof relative to control levels is indicative of a neoplastic large intestine cell or a cell predisposed to the onset of a neoplastic state.
Reference to “large intestine” should be understood as a reference to a cell derived from one of the six anatomical regions of the large intestine, which regions commence after the terminal region of the ileum, these being:
Reference to “neoplasm” should be understood as a reference to a lesion, tumour or other encapsulated or unencapsulated mass or other form of growth which comprises neoplastic cells. A “neoplastic cell” should be understood as a reference to a cell exhibiting abnormal growth. The term “growth” should be understood in its broadest sense and includes reference to proliferation. In this regard, an example of abnormal cell growth is the uncontrolled proliferation of a cell. Another example is failed apoptosis in a cell, thus prolonging its usual life span. The neoplastic cell may be a benign cell or a malignant cell. In a preferred embodiment, the subject neoplasm is an adenoma or an adenocarcinoma. Without limiting the present invention to any one theory or mode of action, an adenoma is generally a benign tumour of epithelial origin which is either derived from epithelial tissue or exhibits clearly defined epithelial structures. These structures may take on a glandular appearance. It can comprise a malignant cell population within the adenoma, such as occurs with the progression of a benign adenoma to a malignant adenocarcinoma.
Preferably, said neoplastic cell is an adenoma or adenocarcinoma and even more preferably a colorectal adenoma or adenocarcinoma.
Reference to “hCG—1815491” and its transcribed and translated expression products should be understood as a reference to all forms of this gene and to fragments thereof. As would be appreciated by the person of skill in the art, genes are known to exhibit allelic or polymorphic variation between individuals. Accordingly, reference to “hCG—1815491” should be understood to extend to such variants which, in terms of the present diagnostic applications, achieve the same outcome despite the fact that minor genetic variations between the actual nucleic acid sequences may exist between individuals. Reference to “variants” should also be understood to extend to alternative transcriptional forms of hCG—1815491, such as splice variants or variants which otherwise exhibit variation to exon expression and arrangement, such as in terms of multiple exon combinations or alternate 5′- or 3′-ends. The present invention should therefore be understood to extend to all forms of RNA (eg mRNA, primary RNA transcript, miRNA, etc), cDNA and peptide isoforms which arise from alternative splicing or any other mutation, polymorphic or allelic variation. It should also be understood to include reference to any subunit polypeptides such as precursor forms which may be generated, whether existing as a monomer, multimer, fusion protein or other complex.
Without limiting the present invention to any one theory or mode of action, the hCG—1815491 genomic sequence comprises SEQ ID NO:1. The SEQ ID NO:1 nucleic acid molecule has been determined to generate at least 18 alternatively spliced exon segments, as follows:
(i) Exon segment E1 which is defined by SEQ ID NO:2
(ii) Exon segment E2 which is defined by SEQ ID NO:3
(iii) Exon segment E2a which is defined by SEQ ID NO:4
(iv) Exon segment E2b which is defined by SEQ ID NO:5
(v) Exon segment E3 which is defined by SEQ ID NO:6
(vi) Exon segment E3a which is defined by SEQ ID NO:7
(vii) Exon segment E4 which is defined by SEQ ID NO:8
(viii) Exon segment E5 which is defined by SEQ ID NO:9
(ix) Exon segment E5a which is defined by SEQ ID NO:10
(x) Exon segment E5b which is defined by SEQ ID NO:11
(xi) Exon segment E6 which is defined by SEQ ID NO:12
(xii) Exon segment E6a which is defined by SEQ ID NO:13
(xiii) Exon segment E6c which is defined by SEQ ID NO:14
(xiv) Exon segment E6d which is defined by SEQ ID NO:15
(xv) Exon segment E6e which is defined by SEQ ID NO:16
(xvi) Exon segment E7 which is defined by SEQ ID NO:17
(xvii) Exon segment E7a which is defined by SEQ ID NO:18
(xviii) Exon segment UE6/7 which is defined by SEQ ID NO:19
(xix) Exon segment E8 which is defined by SEQ ID NO:20.
SEQ ID NO:1 has at least 8 putative exon segments (SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:17, SEQ ID NO:20) of which several are alternatively spliced. It has been still further determined that from this genomic structure there are transcribed at least 11 different RNA transcripts which each comprise one of the sequences depicted in SEQ ID NOs:21-31, Table 1 and are schematically depicted in FIG. 4. It would be appreciated that the sequences which are depicted in SEQ ID NOs:21-31 take the form of DNA since they have been assembled using SEQ ID NO:1. However, the RNA transcripts which are generated either in vivo or in vitro would be characterised by comprising a corresponding sequence, albeit in RNA form.
Accordingly, in terms of the method of the present invention, screening for the “level of expression” of hCG—1815491 may be achieved in a variety of ways including screening for any of the forms of RNA transcribed from hCG—1815491, cDNA generated therefrom or a protein expression product. Changes to the levels of any of these products is indicative of changes to the expression of the subject gene. Still further, the molecule which is identified and measured may be a whole molecule or a fragment thereof. For example, one is more likely to identify only fragments of RNA or protein molecules in a stool sample although provided that said fragment comprises sufficient sequence to indicate that its origin with the hCG—1815491 gene is more likely than not (such as one or more of the exon segments or exons detailed above), fragmented hCG—1815491 molecules are useful in the context of the method of the present invention. For example, the identification of RNA transcripts corresponding to one or more of the exon segments herein defined, alone or in combination, is a useful means of screening for changes to hCG—1815491 expression.
The present invention therefore more particularly provides a method of screening for the onset or predisposition to the onset of a large intestine neoplasm in an individual, said method comprising measuring the level of expression of a gene comprising a sequence of nucleotides as set forth in SEQ ID NO:1 or a sequence having at least 90% similarity to SEQ ID NO:1 across the length of the gene, or variant of SEQ ID NO:1, in a biological sample from said individual wherein a higher level of expression of said gene or variant thereof relative to control levels is indicative of a neoplastic large intestine cell or a cell predisposed to the onset of a neoplastic state.
Reference to “gene” herein should be understood as a reference to any genomic locus or set of loci which give rise to RNA transcripts from one or more promoters, including transcripts formed by the splicing of two or more exons as hereinbefore described. It would be appreciated that not all RNA transcripts are necessarily translated to a protein expression product.
In one embodiment of the present invention, said hCG—1815491 expression levels are assessed by screening for the levels of expression of one or more of the RNA transcripts which are generated from the SEQ ID NO:1 genomic sequence.
Accordingly, in accordance with this embodiment there is provided a method of screening for the onset or predisposition to the onset of a large intestine neoplasm in an individual, said method comprising measuring the level of expression of one or more RNA transcripts, which transcripts comprise an RNA sequence characterised by the sequence of one of:
Reference to said RNA transcript being “characterised by” the sequence of any one of SEQ ID NOs:21-31 should be understood to mean that the subject RNA transcript comprises a corresponding RNA form of the DNA sequence information which is depicted in SEQ ID NOs:21-31. That is, each of the DNA nucleotides depicted in these sequences should be replaced with the corresponding RNA version of that nucleotide.
Preferably, the RNA transcript, the level of expression of which is assessed in accordance with the method of the present invention, is one or more of the transcripts characterised by the sequence of one of:
Even more preferably, said RNA transcript is one or more of the transcripts characterised by the sequence of one of:
Most preferably, said RNA transcript is characterised by SEQ ID NO:2.
In accordance with these aspects of the present invention, one may screen for the RNA transcript itself or for an expression product translated from said RNA transcript.
It should be understood that one may choose to screen for any one or more of said transcripts in a single sample of interest.
As detailed hereinbefore, hCG—1815491 has been determined to comprise 18 alternatively spliced exon segments which give rise to at least 11 RNA transcripts. It has now been determined that screening for the expression of one or more of the exon segments themselves is indicative of the neoplastic state of the individual in issue. It has still further been determined that the identification of certain combinations of these exons is particularly useful in this regard. To this end, it should be appreciated that the specific exon combinations which are hereinafter discussed may, in some RNA transcripts, have been spliced such that they are joined. In other transcripts, the subject exons may not be joined to one another but may be positioned, relative to one another, either proximally or distally along the transcript.
According to this embodiment there is therefore provided a method of screening for the onset or predisposition to the onset of a large intestine neoplasm in an individual, said method comprising measuring the level of expression of an RNA transcript, which transcript comprises one or more exon segments selected from:
More particularly there is provided a method of screening for the onset or predisposition to the onset of a large intestine neoplasm in an individual, said method comprising measuring the level of expression of an RNA transcript, which transcript comprises one or more exon segments selected from:
Yet more particularly there is provided a method of screening for the onset or predisposition to the onset of a large intestine neoplasm in an individual, said method comprising measuring the level of expression of an RNA transcript selected from:
In a further aspect there is provided a method of screening for the onset or predisposition to the onset of a large intestine neoplasm in an individual, said method comprising measuring the level of expression of an RNA transcript, which transcript comprises one or more exon segments selected from:
Still more particularly there is provided a method of screening for the onset or predisposition to the onset of a large intestine neoplasm in an individual, said method comprising measuring the level of expression of an RNA transcript, which transcript is selected from:
In yet still another aspect, the exon segments of said transcripts are spliced such that they are joined.
With regard to the issue of sequence similarity (also referred to as “identity”), terms used to describe sequence relationships between two or more polynucleotides include “reference sequence”, “comparison window”, “sequence similarity”, “sequence identity”, “percentage of sequence similarity”, “percentage of sequence identity”, “substantially similar” and “substantial identity”. A “reference sequence” is at least 12 but frequently 15 to 18 and often at least 25 or above, such as 30 monomer units in length. Because two polynucleotides may each comprise (1) a sequence (i.e. only a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) a sequence that is divergent between the two polynucleotides, sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a “comparison window” to identify and compare local regions of sequence similarity. A “comparison window” refers to a conceptual segment of typically 12 contiguous residues that is compared to a reference sequence. The comparison window may comprise additions or deletions (i.e. gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, Wis., USA) or by inspection and the best alignment (i.e. resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected. Reference also may be made to the BLAST family of programs as for example disclosed by Altschul et al. (Nucl. Acids Res. 25: 3389, 1997). A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et al. (“Current Protocols in Molecular Biology” John Wiley & Sons Inc, Chapter 15, 1994-1998). A range of other algorithms may be used to compare the nucleotide and amino acid sequences such as but not limited to PILEUP, CLUSTALW, SEQUENCHER or VectorNTI.
The terms “sequence similarity” and “sequence identity” as used herein refers to the extent that sequences are identical or functionally or structurally similar on a nucleotide-by-nucleotide basis over a window of comparison. Thus, a “percentage of sequence identity”, for example, is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g. A, T, C, G, I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. For the purposes of the present invention, “sequence identity” will be understood to mean the “match percentage” calculated by the DNASIS computer program (Version 2.5 for windows; available from Hitachi Software engineering Co., Ltd., South San Francisco, Calif., USA) using standard defaults as used in the reference manual accompanying the software. Similar comments apply in relation to sequence similarity.
As detailed above, and more specifically, nucleic acid sequence identities (homologies) may be evaluated using any of the variety of sequence comparison algorithms and programs known in the art. The extent of sequence identity (homology) may be determined using any computer program and associated parameters, including those described herein, such as BLAST 2.2.2. or FASTA version 3.0t78, with the default parameters. For example, the sequence comparison algorithm is a BLAST version algorithm. In one aspect, for nucleic acid sequence identity analysis, the BLAST nucleotide parameters comprise word size=11, expect=10, filter low complexity with DUST, cost to open gap=5, cost to extend gap=2, penalty for mismatch=−3, reward for match=1, Dropoff (X) for BLAST extensions in bits=20, final X dropoff value for gapped alignment=50, and all other options are set to default.
Exemplary algorithms and programs include, but are not limited to, TBLASTN, BLASTP, FASTA, TFASTA, and CLUSTALW (Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85(8):2444-2448, 1988; Altschul et al., J. Mol. Biol. 215(3):403-410, 1990; Thompson et al., Nucleic Acids Res. 22(2):4673-4680, 1994; Higgins et al., Methods Enzymol. 266:383-402, 1996; Altschul et al., Nature Genetics 3:266-272, 1993). Homology or identity can be measured using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705). Such software matches similar sequences by assigning degrees of homology to various deletions, substitutions and other modifications.
BLAST, BLAST 2.0 and BLAST 2.2.2 algorithms are also used to practice the invention. They are described, e.g., in; Altschul et al. (1990), supra. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold (Altschul et al. (1990) supra). These initial neighbourhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0). Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, M=5, N=−4 and a comparison of both strands. The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873). One measure of similarity provided by BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide sequences would occur by chance.
The subject sequences are defined as exhibiting at least 90% similarity. In one embodiment, said percentage similarity is 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.
It should be understood that the “individual” who is the subject of testing may be any human or non-human mammal. Examples of non-human mammals includes primates, livestock animals (e.g. horses, cattle, sheep, pigs, donkeys), laboratory test animals (e.g. mice, rats, rabbits, guinea pigs), companion animals (e.g. dogs, cats) and captive wild animals (e.g. deer, foxes). Preferably the mammal is a human.
The method of the present invention is predicated on the comparison of the level of hCG—1815491 in a biological sample with the control levels of this marker. The “control level” may be either a “normal level”, which is the level of marker expressed by a corresponding large intestine cell or cellular population which is not neoplastic, or the background level which is detectable in a negative control sample.
The normal (or “non-neoplastic”) level may be determined using tissues derived from the same individual who is the subject of testing. However, it would be appreciated that this may be quite invasive for the individual concerned and it is therefore likely to be more convenient to analyse the test results relative to a standard result which reflects individual or collective results obtained from individuals other than the patient in issue. This latter form of analysis is in fact the preferred method of analysis since it enables the design of kits which require the collection and analysis of a single biological sample, being a test sample of interest. The standard results which provide the normal level may be calculated by any suitable means which would be well known to the person of skill in the art. For example, a population of normal tissues can be assessed in terms of the level of the neoplastic marker of the present invention, thereby providing a standard value or range of values against which all future test samples are analysed. It should also be understood that the normal level may be determined from the subjects of a specific cohort and for use with respect to test samples derived from that cohort. Accordingly, there may be determined a number of standard values or ranges which correspond to cohorts which differ in respect of characteristics such as age, gender, ethnicity or health status. Said “normal level” may be a discrete level or a range of levels. An increase in the expression level of the subject genes relative to normal levels is indicative of the tissue being neoplastic.
Preferably, said control level is a non-neoplastic level.
According to these aspects of the present invention, said large intestine tissue is preferably colorectal tissue.
Still more preferably, said neoplasm is a colorectal adenoma or adenocarcinoma.
In a related aspect, it has been determined that a subpopulation of the hCG—1815491 markers are not only expressed at levels higher than normal levels, their expression pattern is uniquely characterised by the fact that expression levels above that of background control levels are not detectable in non-neoplastic tissue. This determination has therefore enabled the development of qualitative screening systems which are simply designed to detect hCG—1815491 expression relative to a control background level. In accordance with this aspect of the present invention, said “control level” is therefore the “background level”. Preferably, said background level is of the chosen testing methodology.
According to this aspect, there is therefore provided a method of screening for the onset or predisposition to the onset of a large intestine neoplasm in an individual, said method comprising measuring the level of expression of one or more RNA transcripts, which transcripts comprise an RNA sequence characterised by the sequence of one of:
In a most preferred embodiment, said transcripts comprise an RNA sequence characterised by the sequence of one of:
Most preferably, said RNA sequences are characterised by the sequence of either SEQ ID NO:21 or SEQ ID NO:22.
The detection method of the present invention can be performed on any suitable biological sample. To this end, reference to a “biological sample” should be understood as a reference to any sample of biological material derived from an animal such as, but not limited to, cellular material, biological fluids (eg. blood), faeces, tissue biopsy specimens, surgical specimens or fluid which has been introduced into the body of an animal and subsequently removed (such as, for example, the solution retrieved from an enema wash). The biological sample which is tested according to the method of the present invention may be tested directly or may require some form of treatment prior to testing. For example, a biopsy or surgical sample may require homogenisation prior to testing or it may require sectioning for in situ testing of the qualitative expression levels of individual genes. Alternatively, a cell sample may require permeabilisation prior to testing. Further, to the extent that the biological sample is not in liquid form, (if such form is required for testing) it may require the addition of a reagent, such as a buffer, to mobilise the sample.
To the extent that the neoplastic marker gene expression product is present in a biological sample, the biological sample may be directly tested or else all or some of the nucleic acid or protein material present in the biological sample may be isolated prior to testing. To this end, and as hereinbefore described, it would be appreciated that when screening for changes to the level of expression of hCG—1815491 or the specifically recited transcripts, one may screen for the RNA transcripts themselves, cDNA which has been transcribed therefrom or a translated protein product. In yet another example, the sample may be partially purified or otherwise enriched prior to analysis. For example, to the extent that a biological sample comprises a very diverse cell population, it may be desirable to enrich for a sub-population of particular interest. It is within the scope of the present invention for the target cell population or molecules derived therefrom to be pretreated prior to testing, for example, inactivation of live virus or being run on a gel. It should also be understood that the biological sample may be freshly harvested or it may have been stored (for example by freezing) prior to testing or otherwise treated prior to testing (such as by undergoing culturing).
The choice of what type of sample is most suitable for testing in accordance with the method disclosed herein will be dependent on the nature of the situation. Preferably, said sample is a faecal (stool) sample, enema wash, surgical resection, tissue biopsy or blood sample.
As detailed hereinbefore, the present invention is designed to screen for a neoplastic cell or cellular population, which is located in the large intestine. Accordingly, reference to “cell or cellular population” should be understood as a reference to an individual cell or a group of cells. Said group of cells may be a diffuse population of cells, a cell suspension, an encapsulated population of cells or a population of cells which take the form of tissue.
As detailed hereinbefore, reference to “expression” should be understood as a reference to the transcription and/or translation of a nucleic acid molecule. In this regard, the present invention is exemplified with respect to screening for hCG—1815491 expression products taking the form of RNA transcripts (eg primary RNA or mRNA). Reference to “RNA” should be understood to encompass reference to any form of RNA, such as primary RNA or mRNA. Without limiting the present invention in any way, the modulation of gene transcription leading to increased or decreased RNA synthesis will also correlate with the translation of some of these RNA transcripts to produce a protein product. Accordingly, the present invention also extends to detection methodology which is directed to screening for modulated levels or patterns of the neoplastic marker protein products as an indicator of the neoplastic state of a cell or cellular population. Although one method is to screen for RNA transcripts and/or the corresponding protein product, it should be understood that the present invention is not limited in this regard and extends to screening for any other form of neoplastic marker expression product such as, for example, a primary RNA transcript. It is well within the skill of the person of skill in the art to determine the most appropriate screening target for any given situation.
Reference to “nucleic acid molecule” should be understood as a reference to both deoxyribonucleic acid molecules and ribonucleic acid molecules and fragments thereof. The present invention therefore extends to both directly screening for RNA levels in a biological sample or screening for the complementary cDNA which has been reverse-transcribed from an RNA population of interest. It is well within the skill of the person of skill in the art to design methodology directed to screening for either DNA or RNA. As detailed above, the method of the present invention also extends to screening for the protein product translated from the subject RNA.
In terms of screening for the upregulation of hCG—1815491 it would also be well known to the person of skill in the art that changes which are detectable at the DNA level are indicative of changes to gene expression activity and therefore changes to expression product levels. Such changes include but are not limited to, changes to DNA methylation and chromatin proteins associated with the gene. Accordingly, reference herein to “screening the level of expression” and comparison of these “levels of expression” to control “levels of expression” should be understood as a reference to assessing DNA factors which are related to transcription, such as gene/DNA methylation patterns or association with specific chromosomal proteins.
The term “protein” should be understood to encompass peptides, polypeptides and proteins (including protein fragments). The protein may be glycosylated or unglycosylated and/or may contain a range of other molecules fused, linked, bound or otherwise associated to the protein such as amino acids, lipids, carbohydrates or other peptides, polypeptides or proteins. Reference herein to a “protein” includes a protein comprising a sequence of amino acids as well as a protein associated with other molecules such as amino acids, lipids, carbohydrates or other peptides, polypeptides or proteins.
The proteins encoded by hCG—1815491 may be in multimeric form meaning that two or more molecules are associated together. Where the same protein molecules are associated together, the complex is a homomultimer. An example of a homomultimer is a homodimer. Where at least one marker protein is associated with at least one non-marker protein, then the complex is a heteromultimer such as a heterodimer.
Reference to a “fragment” should be understood as a reference to a portion of the subject nucleic acid molecule or protein. As detailed hereinbefore, this is particularly relevant with respect to screening for modulated RNA levels in stool samples since the subject RNA is likely to have been degraded or otherwise fragmented due to the environment of the gut. One may therefore actually be detecting fragments of the subject RNA molecule, which fragments are identified by virtue of the use of a suitably specific probe.
Reference to the “onset” of a neoplasm, such as adenoma or adenocarcinoma, should be understood as a reference to one or more cells of that individual exhibiting dysplasia. In this regard, the adenoma or adenocarcinoma may be well developed in that a mass of dysplastic cells has developed. Alternatively, the adenoma or adenocarcinoma may be at a very early stage in that only relatively few abnormal cell divisions have occurred at the time of diagnosis. The present invention also extends to the assessment of an individual's predisposition to the development of a neoplasm, such as an adenoma or adenocarcinoma. Without limiting the present invention in any way, changed levels of the neoplastic marker may be indicative of that individual's predisposition to developing a neoplasia, such as the future development of an adenoma or adenocarcinoma or another adenoma or adenocarcinoma.
Although the preferred method is to diagnose neoplasia development or predisposition thereto, the detection of converse changes in the levels of said marker may be desired under certain circumstances, for example, to monitor the effectiveness of therapeutic or prophylactic treatment directed to modulating a neoplastic condition, such as adenoma or adenocarcinoma development. For example, where elevated levels of hCG—1815491 indicates that an individual has developed a condition characterised by adenoma or adenocarcinoma development, for example, screening for a decrease in the levels of this marker subsequently to the onset of a therapeutic regime may be utilised to indicate reversal or other form of improvement of the subject individual's condition.
The method of the present invention is therefore useful as a one off test or as an on-going monitor of those individuals thought to be at risk of neoplasia development or as a monitor of the effectiveness of therapeutic or prophylactic treatment regimes directed to inhibiting or otherwise slowing neoplasia development. In these situations, mapping the modulation of hCG—1815491 expression levels in any one or more classes of biological samples is a valuable indicator of the status of an individual or the effectiveness of a therapeutic or prophylactic regime which is currently in use. Accordingly, the method of the present invention should be understood to extend to monitoring for increases or decreases in hCG—1815491 expression levels in an individual relative to their normal level (as hereinbefore defined), or relative to one or more earlier marker expression levels determined from a biological sample of said individual.
Means of testing for the subject expressed neoplasm marker in a biological sample can be achieved by any suitable method, which would be well known to the person of skill in the art, such as but not limited to:
A person of ordinary skill in the art could determine, as a matter of routine procedure, the appropriateness of applying a given method to a particular type of biological sample.
Without limiting the present invention in any way, and as detailed above, gene expression levels can be measured by a variety of methods known in the art. For example, gene transcription or translation products can be measured. Gene transcription products, i.e., RNA, can be measured, for example, by hybridization assays, run-off assays, Northern blots, or other methods known in the art.
Hybridization assays generally involve the use of oligonucleotide probes that hybridize to the single-stranded RNA transcription products. Thus, the oligonucleotide probes are complementary to the transcribed RNA expression product. Typically, a sequence-specific probe can be directed to hybridize to RNA or cDNA. A “nucleic acid probe”, as used herein, can be a DNA probe or an RNA probe that hybridizes to a complementary sequence. One of skill in the art would know how to design such a probe such that sequence specific hybridization will occur. One of skill in the art will further know how to quantify the amount of sequence specific hybridization as a measure of the amount of gene expression for the gene was transcribed to produce the specific RNA.
The hybridization sample is maintained under conditions that are sufficient to allow specific hybridization of the nucleic acid probe to a specific gene expression product. “Specific hybridization”, as used herein, indicates near exact hybridization (e.g., with few if any mismatches). Specific hybridization can be performed under high stringency conditions or moderate stringency conditions. In one embodiment, the hybridization conditions for specific hybridization are high stringency. For example, certain high stringency conditions can be used to distinguish perfectly complementary nucleic acids from those of less complementarity. “High stringency conditions”, “moderate stringency conditions” and “low stringency conditions” for nucleic acid hybridizations are explained on pages 2.10.1-2.10.16 and pages 6.3.1-6.3.6 in Current Protocols in Molecular Biology (Ausubel et al., 1998 supra), the entire teachings of which are incorporated by reference herein). The exact conditions that determine the stringency of hybridization depend not only on ionic strength (e.g., 0.2.times.SSC, 0.1.times.SSC), temperature (e.g., room temperature, 42° C., 68° C.) and the concentration of destabilizing agents such as formamide or denaturing agents such as SDS, but also on factors such as the length of the nucleic acid sequence, base composition, percent mismatch between hybridizing sequences and the frequency of occurrence of subsets of that sequence within other non-identical sequences. Thus, equivalent conditions can be determined by varying one or more of these parameters while maintaining a similar degree of identity or similarity between the two nucleic acid molecules. Typically, conditions are used such that sequences at least about 60%, at least about 70%, at least about 80%, at least about 90% or at least about 95% or more identical to each other remain hybridized to one another. By varying hybridization conditions from a level of stringency at which no hybridization occurs to a level at which hybridization is first observed, conditions that will allow a given sequence to hybridize (e.g., selectively) with the most complementary sequences in the sample can be determined.
Exemplary conditions that describe the determination of wash conditions for moderate or low stringency conditions are described in Kraus, M. and Aaronson, S., 1991. Methods Enzymol., 200:546-556; and in, Ausubel et al. 1998, supra)). Washing is the step in which conditions are usually set so as to determine a minimum level of complementarity of the hybrids. Generally, starting from the lowest temperature at which only homologous hybridization occurs, each ° C. by which the final wash temperature is reduced (holding SSC concentration constant) allows an increase by 1% in the maximum mismatch percentage among the sequences that hybridize. Generally, doubling the concentration of SSC results in an increase in Tm of about 17° C. Using these guidelines, the wash temperature can be determined empirically for high, moderate or low stringency, depending on the level of mismatch sought. For example, a low stringency wash can comprise washing in a solution containing 0.2.times.SSC/0.1% SDS for 10 minutes at room temperature; a moderate stringency wash can comprise washing in a pre-warmed solution (42° C.) solution containing 0.2.times.SSC/0.1% SDS for 15 minutes at 42° C.; and a high stringency wash can comprise washing in pre-warmed (68° C.) solution containing 0.1.times.SSC/0.1% SDS for 15 minutes at 68° C. Furthermore, washes can be performed repeatedly or sequentially to obtain a desired result as known in the art. Equivalent conditions can be determined by varying one or more of the parameters given as an example, as known in the art, while maintaining a similar degree of complementarity between the target nucleic acid molecule and the primer or probe used (e.g., the sequence to be hybridized).
A related aspect of the present invention provides a molecular array, which array comprises a plurality of:
Preferably, said percent identity is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.
Low stringency includes and encompasses from at least about 1% v/v to at least about 15% v/v formamide and from at least about 1M to at least about 2M salt for hybridisation, and at least about 1M to at least about 2M salt for washing conditions. Alternative stringency conditions may be applied where necessary, such as medium stringency, which includes and encompasses from at least about 16% v/v at least about 30% v/v formamide and from at least about 0.5M to at least about 0.9M salt for hybridisation, and at least about 0.5M to at least about 0.9M salt for washing conditions, or high stringency, which includes and encompasses from at least about 31% v/v to at least about 50% v/v formamide and from at least about 0.01M to at least about 0.15M salt for hybridisation, and at least about 0.01M to at least about 0.15M salt for washing conditions. In general, washing is carried out at Tm=69.3+0.41 (G+C) % [19]=−12° C. However, the Tm of a duplex DNA decreases by 1° C. with every increase of 1% in the number of mismatched based pairs (Bonner et al (1973) J. Mol. Biol. 81:123).
Preferably, the subject probes are designed to bind to the nucleic acid or protein to which they are directed with a level of specificity which minimises the incidence of non-specific reactivity. However, it would be appreciated that it may not be possible to eliminate all potential cross-reactivity or non-specific reactivity, this being an inherent limitation of any probe based system.
In terms of the probes which are used to detect the subject proteins, they may take any suitable form including antibodies and aptamers.
A library or array of nucleic acid or protein probes provides rich and highly valuable information. Further, two or more arrays or profiles (information obtained from use of an array) of such sequences are useful tools for comparing a test set of results with a reference, such as another sample or stored calibrator. In using an array, individual probes typically are immobilized at separate locations and allowed to react for binding reactions. Oligonucleotide primers associated with assembled sets of markers are useful for either preparing libraries of sequences or directly detecting markers from other biological samples.
A library (or array, when referring to physically separated nucleic acids corresponding to at least some sequences in a library) of hCG—1815491 markers exhibits highly desirable properties. These properties are associated with specific conditions, and may be characterized as regulatory profiles. A profile, as termed here refers to a set of members that provides diagnostic information of the tissue from which the markers were originally derived. A profile in many instances comprises a series of spots on an array made from deposited sequences.
A molecular array, which array comprises a plurality of:
A characteristic patient profile is generally prepared by use of an array. An array profile may be compared with one or more other array profiles or other reference profiles. The comparative results can provide rich information pertaining to disease states, developmental state, receptiveness to therapy and other information about the patient.
Another aspect of the present invention provides a diagnostic kit for assaying biological samples comprising an agent for detecting one or more neoplastic marker reagents useful for facilitating the detection by the agent in the first compartment. Further means may also be included, for example, to receive a biological sample. The agent may be any suitable detecting molecule.
The present invention is further described by the following non-limiting examples:
RNA extractions were performed using Trizol® reagent (Invitrogen, Carlsbad, Calif., USA) as per manufacturer's instructions. Each sample was homogenised in 300 μL of Trizol reagent using a modified dremel drill and sterilised disposable pestles. Additional 200 μL of Trizol reagent was added to the homogenate and samples were incubated at RT for 10 minutes. 100 μL of chloroform was then added, samples were shaken vortexed for 15 seconds, and incubated at RT for 3 further minutes. The aqueous phase containing target RNA was obtained by centrifugation at 12,000 rpm for 15 min, 40° C. RNA was then precipitated by incubating samples at RT for 10 min with 250 μL of isopropanol. Purified RNA precipitate was collected by centrifugation at 12,000 rpm for 10 minutes, 40° C. and supernatants were discarded. Pellets were then washed with 1 mL 75% ethanol, followed by vortexing and centrifugation at 7,500 g for 8 min, 40° C. Finally, pellets were air-dried for 5 min and resuspended in 80 μL of RNase free water. To improve subsequent solubility samples were incubated at 55° C. for 10 min. RNA was quantified by measuring the optical density at A260/280 nm. RNA quality was assessed by electrophoresis on a 1.2% agarose formaldehyde gel.
Gene Chips were processed using the standard Affymetrix protocol developed for the HU Gene ST 1.0 array described in [Affymetrix, 2007]. Briefly: First cycle dsDNA was synthesized from 100 ng of total RNA extract using random hexamer primers tagged with T7 promoter sequence and SuperScript II (Invitrogen, Carlsbad Calif.) and then DNA Polymerase I. Anti-sense cRNA was then synthesized using T7 polymerase and combined with SuperScript II, dUTP (+dNTP), and random hexamers to synthesize sense strand cDNA incorporating uracil. A combination of uracil DNA glycosylase (UDG) and apurinic/apyrimidinic endonuclease 1 (APE 1) were used to fragment the DNA product.
Next, the DNA was biotin labelled by terminal deoxynucleotidyl transferase (TdT) with the Affymetrix proprietary DNA Labeling Reagent covalently linked to biotin. Hybridization to the Custom Chip CG AGPa520460F was carried out at 45° C. for 16-18 hours. Finally, the chips were washed, stained and scanned as above. All GeneChips analyzed in our lab were stained with streptavidin phycoerytherin and washed with a solution containing biotinylated anti-streptavidin antibodies using the Affymetrix Fluidics Station 450. Finally, the stained and washed microarrays were scanned with the Affymetrix Scanner 3000.
qRT-PCR
Quantitative real time polymerase chain reaction was used to confirm particular gene expression discoveries using Applied Biosystems pre-designed and optimized TaqMan gene expression assays. The resulting expression levels were quantified as a ratio to three genes (HPRT, TBP and GAPDH) with literature reported low variance expression levels. Final results were reported using the Δ-cycle threshold method. Prior to Real-time PCR analysis 100 ng of total RNA was subject to linear amplification using the QIAGEN QuantiTect Whole Transcriptome amplification kit (QIAGEN, Country) according to the manufacturer's instructions. 2 μl of the amplified, diluted (1:50) cDNA was then analysed in a 25 μl reaction volume by RT-PCR using TaqMan universal master mix (Applied Biosystems, USA) in an ABI prism 7700 sequence detector (Manufacturer, Country) following manufacturer's protocols.
Prior to end-point PCR analysis 2 ug of total RNA was subject to linear amplification a high capacity cDNA reverse transcription kit available from Applied Biosystems. 5 μl of the amplified, diluted (1:2) cDNA was then analysied in a 25 μl reaction volume by PCR using a PCR Master Mix (Promega) according to manufacturer's recommendation. 2.5 μl of the amplified products were analysed on 2% agarose E-gel (Invitrogen) along with a 100-base pair DNA Ladder Marker.
We have explored the nucleotide structure and expression levels of transcripts related to hCG—1815491 based on the identification of diagnostic utility of Affymetrix probesets 238021_s_at and 238022_at from our gene chip analysis.
The gene hCG—1815491 is currently represented in NCBI as a single RefSeq sequence, XM—93911. The RefSeq sequence of hCG—1815491 is based on 89 GenBank accessions from 83 cDNA clones. Prior to March 2006, these clones were predicted to represent two overlapping genes, LOC388279 and LOC650242 (the latter also known as hCG—1815491). In March 2006, the human genome database was filtered against clone rearrangements, co-aligned with the genome and clustered in a minimal non-redundant way. As a result, LOC388272 and LOC650242 were merged into one gene named hCG—1815491 (earlier references to hCG—1815491 are: LOC388279, hCG—1815491, LOC650242, XM—944116, AF275804, XM—373688).
We have determined that SEQ ID NO:1, which is defined by the genomic coordinates 8579310 to 8562303 on human chromosome 16 as defined by the NCBI contig reference NT 010498.15|Hs16—10655, NCBI 36 March 2006 genome encompasses hCG—1815491. We have aligned the 10 predicted RNA variants derived from this gene with the genomic nucleotide sequence residing in the map region 8579310 to 8562303. This alignment analysis revealed the existence of at least 6 exons, of which several are alternatively spliced. The identified 6 exons are in contrast to the just 4 exons specified in the NCBI hCG—1815491 RefSeq XM—93911. We have used the identified and expanded exon-intron structure of hCG—1815491 to design specific oligonucleotide primers, which allowed us to measure the expression of RNA variants generated from SEQ ID NO:1 by using PCR-based methodology.
We have conclusively demonstrated the utility of SEQ ID NO:1 to diagnose neoplasia. In particular, we have identified that SEQ ID NO:1 can be used to diagnose adenomas, benign neoplastic lesions that can lead to colorectal adenocarcinoma. We have also demonstrated that SEQ ID NO:1 can be used to diagnose colorectal cancer itself. We hence claim this molecule for broad clinical utility.
In addition, we have conclusively demonstrated neoplastic-specific expression of some of the RNA variants derived from SEQ ID NO:1. Neoplastic-specific splicing of hCG—1815491 has not previously been reported. In particular, RNA variant SEQ ID NO:21 is by far the most pronounced differentially expressed variant of SEQ ID NO:1, and SEQ ID NO:21 appears to be sensitive and specific for colorectal benign pre-cancerous adenomas as well as colorectal carcinoma. Hence we claim diagnostic utility of SEQ ID NO:21 for detection of colorectal neoplasia.
Lastly, we have identified a novel RNA variant, SEQ ID NO:23, derived from alternative splicing of SEQ ID NO:1. This RNA variant is the result of an unprecedented splicing of map regions 8577328-8576605 and 8573324-8573212. We use this example to claim diagnostic utility of any combinations of nucleotide segments derived from SEQ ID NO:1.
Diagnostic Utility of Oligonucleotide Probesets Directed against hCG—1815491 Using Affymetrix Microarray Genechips
The gene expression of human hCG—1815491 was measured by determining the hybridization of RNA extracted from clinical specimens to Affymetrix oligonucleotide probesets, designated 238021_s_at and 238022_at, FIG. 1. The clinical specimens included a total of 454 colorectal tissues derived from 161 adenocarcinoma, 29 adenoma, 42 colitis and 222 non-diseased subjects
We conclude that transcripts derived from the human gene hCG-1815491 have diagnostic utility for identification of colorectal neoplasia.
End-point PCR, using the oligonucleotide sequence primers, 5′-TAACTGGAATTCATGTTGGCTGAAATTCATCCCA (located in SEQ ID NO:6) and 5′-CACGATAAGCTTTTATTATAGTCTATAAACAGGAATACCCAAAACATA TTTAAACC (located in SEQ ID NO:18), was performed to measure the RNA expression level from map region 8573246 to 88567197 within SEQ ID NO:1 in a total of 71 colorectal tissue specimens: 30 non-diseased controls, 21 adenoma tissues and 20 adenocarcinoma tissues, FIG. 2. End-point PCR demonstrated the appearance of four major products that were present in essentially all adenoma and adenocarcinoma colon tissue specimens. Most colon tissue samples from non-disease control specimens produced none or a limited subset of the PCR products. The multiple PCR bands included an approximately 284 base pair product that is the predicted size from the RefSeq NCBI hCG—1815491 entry as well as other bands presumed to arise from alternative splicing.
We conclude that SEQ ID NO:1 that contains map region 8573246 to 88567197 has diagnostic utility as means for detection of colorectal neoplasia.
Quantitative real-time PCR, using the same oligonucleotide sequence primers as described in Example 2,5′-TAACTGG AATTCATGTTGGCTGAAATTCATCCCA and 5′-CACGATAAGCTTTTATTATAGTCTATAAACAGGAATACCCAAAACATA TTTAAACC, was performed to measure the RNA concentration level of SEQ ID NO:1 transcripts derived from map region 8573246 to 88567197 in a total of 71 colorectal tissue specimens: 30 non-diseased controls, 21 adenoma tissues and 20 adenocarcinoma tissues, FIG. 3. The figure shows that most normal tissues expressed low or non-detectable levels of transcripts by contrast to adenoma and adenocarcinoma tissues nearly expressed moderate to high levels of transcripts from SEQ ID NO:1.
We conclude that SEQ ID NO:1 that contains map region 8573246 to 88567197 has diagnostic utility as means as detection of colorectal neoplasia.
Diagnostic Utility of RNA Transcript Variants from SEQ ID NO:1
cDNA clones from NCBI/Aceview (Table 4) were used to gather information regarding predicted RNA transcripts derived from hCG—1815491, FIG. 4 & TABLE 1. None of the reported clones were derived from normal or neoplastic colon tissues.
Oligonucleotide sequence primer sets were generated to each of the predicted 10 hCG—1815491 RNA variants (Table 5) and end-point PCR using these primer sets was performed to measure the existence of the ten [10] hCG—1815491 transcript variants in a total of 72 colorectal tissue specimens from 30 non-disease, 21 adenoma and 21 adenocarcinoma subjects.
The differential expression of the 10 predicted RNA transcripts, as determined using transcript specific primers, is exemplified in FIG. 5 and Table 2. Differential expression as measured by end-point PCR was observed for several of the 10 RNA variants (TABLE 2) e.g. SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:27 and in particular SEQ ID NO:21 was the best one.
We conclude that predicted RNA variants derived from SEQ ID NO:1 exist and they are generated through alternative usage of nucleotide segments in SEQ ID NO:1. We conclude that the presence of several of the RNA variants and specific splicing events, such as represented in SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:27 but in particular SEQ ID NO:21, have diagnostic utility for detection of colorectal neoplasia.
Diagnostic Utility of RNA Transcript Variants from SEQ ID NO:1, by Measuring Concentration Levels
Quantitative Real-Time PCR, was performed to measure the concentration level of RNA variants derived from map region 8579310 to 8562303 on the minus strand of human chromosome 16 in a total of 72 colorectal tissue specimens from 30 non-disease controls, 21 adenoma and 21 adenocarcinoma subjects. Quantitative differences were observed for several of the transcripts, and an example of the quantitative expression profile of SEQ ID NO:21 is given in FIG. 6.
We conclude that measurement of the RNA concentrations of SEQ ID NO:25, SEQ ID NO:30, SEQ ID NO:24 but in particular SEQ ID NO:21 has diagnostic utility for detection of colorectal neoplasia.
We hypothesized that the gene contained within SEQ ID NO:1 contained 6 or more exons that were alternatively spliced in multiple combinations in human colorectal tissue. Alignment of the nucleotide sequences of the predicted mRNA variants derived from hCG—1815491 illustrated that the first 184 nucleotides of RNA SEQ ID NO:25, map region 8577328-8576881 in SEQ ID NO:1, and the first 274 nucleotides of RNA SEQ ID NO:21, map region 8576878-8576605 in SEQ ID NO:1, were in fact flanking each other. End-point PCR, using a forward primer spanning the splice junction of SEQ ID NO:4 and SEQ ID NO:5, 5′-GGCGGAGGAGAGGTGAGC, with a reverse primer 5′-GCTGACAGCATCCA AATGTATTATG hybridizing to SEQ ID NO:6 was performed to demonstrate a novel RNA variant derived from alternative splicing of map region 8576892-8576605 with 8573324-8573280, FIG. 7. The novel RNA variant, named SEQ ID NO:23, appeared up-regulated in colorectal tissue specimens from 3 adenoma and 3 adenocarcinoma subjects but not in 2 non-disease controls, FIG. 7.
Review of all publicly available data indicates that a nucleotide sequence corresponding the SEQ ID NO:23 has never before been identified. We conclude that SEQ ID NO:23 represents a novel RNA variant derived from SEQ ID NO:1. While new sequence data is common with respect to the human genome project, we have identified that this transcript designated SEQ ID NO:23 is a splice variant diagnostic of colorectal neoplasia.
Diagnostic Utility of Individual Exons of hCG—1815491
Gene expression across the chromosomal map region 8579310 to 8562303 on chromosome 16 was measured by determining the hybridization of RNA extracted from clinical specimens to the Affymetrix oligonucleotide probesets specified in TABLE 3. The observed differential expression of the probesets specified in Table 3 from 5 non-disease subjects, 5 adenoma and 5 adenocarcinoma subjects are summarized in FIG. 8. Details of the differential expression across the 13 probesets are provided in FIG. 9-21. We note that expression was not measured across all predicted exons from SEQ ID NO:1, as the available probesets on the Affymetrix GeneChip HuGene Exon 1.0 only targeted a subset of the predicted exons in SEQ ID NO:1.
We conclude that the map region 8577414 to 8566289 has diagnostic utility for identification of colorectal neoplasia. In particular, Affymetrix probesets 3692525 (SEQ ID NO:6), 3692524 (SEQ ID NO:9), 3692519 (SEQ ID NO:18), 3692520 (SEQ ID NO:17), 3692523 and 3692522 (SEQ ID NO:15), and 3692521 (SEQ ID NO:13) can be used to diagnose adenomas, benign neoplastic lesions that can lead to colorectal adenocarcinoma. We also conclude that these probesets can be used to diagnose colorectal cancer itself.
Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.
| TABLE 1 |
| LIST OF MOLECULE SEQUENCES |
| Genomic Map | |||
| SEQUENCE | Region-Human | ||
| ID | FIG. 23 | Nucleotide sequence | Chromosome 16 |
| SEQ ID | SEE FIG. 2 | 8579310- | |
| NO: 1 | 8562303 | ||
| SEQ ID | E2b-E3- | gagcccccgcccgggccaggccctctggccgcgccgtccgcccctctagt | 8576878- |
| NO: 21 | E5a-E6- | cgtgtcccctcgtgggccgaacggacgcggcggtgccccgcgcccgacca | 8576605 |
| E7a | gacgtcccgtgggctagggcctgggcctcgggccgcgtcggcgccggtcg | 8573324- | |
| agcctctccgggtgtcggggttcggggcgggcgcgcgtgggcgtggctcc | 8573212 | ||
| tctgtccacgcctgttcccttcgtcgccgcggctctcgtccgggacacgg | 8571761- | ||
| ctttccggagtagagcccttggaggtgttaagtgtgatgcttccataata | 8571696 | ||
| catttggatgctgtcagctaagttcacttctgaactaaggggttcctcca | 8568521- | ||
| aatgttggctgaaattcatcccaaggctggtctgcaaagtctgcaattca | 8568409 | ||
| taatggagctactgtactggctattggaaggaggagattctgaagataag | 8567320- | ||
| gaggtaaaacctgtttagaaattaaaaatgagttacgatttaaagaaaat | 8566974 | ||
| tcagatgactcattgtgagtgctagttctcttgtaggatgccactggaaa | |||
| tgttgaaatgaaaaatattcagccgttggtctttgaaatttcctgtgatg | |||
| tgtttcaatctagatgcaaagaacatggaaaaatcaaagtgctcgagtgg | |||
| tttaaatatgttttgggtattcctgtttatagactataatacttttccaa | |||
| ttaaaatcctcagttgtcacgcagaagaaggttaagctgtatttgattgc | |||
| cagttttactgaaaatgcttagtattttacagtatcaccaaatatatttt | |||
| gtttagccaaggtataggaaaaataaaataaattgtataggttgactttt | |||
| ttctaaaatgtctttattggattgaatgaatgtttatacctgaaaaaaaa | |||
| aggttcaaaaaaa | |||
| SEQ ID | E2b-E3- | Gagcccccgcccgggccaggccctctggccgcgccgtccgcccctctagt | 8576878- |
| NO: 22 | E5a-E6c- | cgtgtcccctcgtgggccgaacggacgcggcggtgccccgcgcccgacca | 8576605 |
| E7a | gacgtcccgtgggctagggcctgggcctcgggccgcgtcggcgccggtcg | 8573324- | |
| agcctctccgggtgtcggggttcggggcgggcgcgcgtgggcgtggctcc | 8573212 | ||
| tctgtccacgcctgttcccttcgtcgccgcggctctcgtccgggacacgg | 8571761- | ||
| ctttccggagtagagcccttggaggtgttaagtgtgatgcttccataata | 8571696 | ||
| catttggatgctgtcagctaagttcacttctgaactaaggggttcctcca | 8568449- | ||
| aatgttggctgaaattcatcccaaggctggtctgcaaagtctgcaattca | 8568409 | ||
| taatggagctactgtactggctattggaaggaggagattctgaagataag | 8567320- | ||
| gagttctcttgtaggatgccactggaaatgttgaaatgaaaaatattcag | 8566974 | ||
| ccgttggtctttgaaatttcctgtgatgtgtttcaatctagatgcaaaga | |||
| acatggaaaaatcaaagtgctcgagtggtttaaatatgttttgggtattc | |||
| ctgtttatagactataatacttttccaattaaaatcctcagttgtcacgc | |||
| agaagaaggttaagctgtatttgattgccagttttactgaaaatgcttag | |||
| tattttacagtatcaccaaatatattttgtttagccaaggtataggaaaa | |||
| ataaaataaattgtataggttgacttttttctaaaatgtctttattggat | |||
| tgaatgaatgtttatacctgaaaaaaaaaggttcaaaaaaa | |||
| SEQ ID | E2a-E2b- | tctcggcgccagaggggcggggaggggcggggtctcgatcgcgctattgt | 8577328- |
| NO: 23 | E3 | catggagacgggaagctggctgcagcggcggcggggaccgtggggccgag | 8576605 |
| gtggctgccagccggccaatgtctaagcgaggcggagcggcccaggcggc | 8573324- | ||
| ccgagcctgggggagcgcgcagccggccagtggcggcctcgccggcggcc | 8573212 | ||
| tcttcccgggctcgcagtaggcccgagtcgtcgccgggagctcctgggag | |||
| cagcgtccccgccctgctcccctcgctcccgcctcttgcggccccacggc | |||
| ccctcagcgcccgcccccggctccgcccgccgcagccgcagcccctggcg | |||
| ctaacggtcggtaacggcccgcgcgcgccgcccgccgggggctcgcgcca | |||
| gccacgagggagcgtccgcggcccgcgcgcccgcgcggcggaggagaggt | |||
| gagcccccgcccgggccaggccctctggccgcgccgtccgcccctctagt | |||
| cgtgtcccctcgtgggccgaacggacgcggcggtgccccgcgcccgacca | |||
| gacgtcccgtgggctagggcctgggcctcgggccgcgtcggcgccggtcg | |||
| agcctctccgggtgtcggggttcggggcgggcgcgcgtgggcgtggctcc | |||
| tctgtccacgcctgttcccttcgtcgccgcggctctcgtccgggacacgg | |||
| ctttccggagtagagcccttggaggtgttaagtgtgatgcttccataata | |||
| catttggatgctgtcagctaagttcacttctgaactaaggggttcctcca | |||
| aatgttggctgaaattcatcccaaggctggtctgcaa | |||
| SEQ ID | E5b-E6- | catgctttttgagaagtgtatcatctaggaagaaaatcaaatggagtatt | 8571889- |
| NO: 24 | E7a | ggtaattaaattgtaattccatgaaggaaggaagtggtgcaaaagatgaa | 8571696 |
| gctaactattcctgtttttctttttaagagtctgcaattcataatggagc | 8568521- | ||
| tactgtactggctattggaaggaggagattctgaagataaggaggtaaaa | 8568409 | ||
| cctgtttagaaattaaaaatgagttacgatttaaagaaaattcagatgac | 8567320- | ||
| tcattgtgagtgctagttctcttgtaggatgccactggaaatgttgaaat | 8566974 | ||
| gaaaaatattcagccgttggtctttgaaatttcctgtgatgtgtttcaat | |||
| ctagatgcaaagaacatggaaaaatcaaagtgctcgagtggtttaaatat | |||
| gttttgggtattcctgtttatagactataatacttttccaattaaaatcc | |||
| tcagttgtcacgcagaagaaggttaagctgtatttgattgccagttttac | |||
| tgaaaatgcttagtattttacagtatcaccaaatatattttgtttagcca | |||
| aggtataggaaaaataaaataaattgtataggttgacttttttctaaaat | |||
| gtctttattggattgaatgaatgtttatacctgaaaaaaaaaggttcaaa | |||
| aaaa | |||
| SEQ ID | E2a-E3a | tctcggcgccagaggggcggggaggggcggggtctcgatcgcgctattgt | 8577328- |
| NO: 25 | catggagacgggaagctggctgcagcggcggcggggaccgtggggccgag | 8576881 | |
| gtggctgccagccggccaatgtctaagcgaggcggagcggcccaggcggc | 8573324- | ||
| ccgagcctgggggagcgcgcagccggccagtggcggcctcgccggcggcc | 8573041 | ||
| tcttcccgggctcgcagtaggcccgagtcgtcgccgggagctcctgggag | |||
| cagcgtccccgccctgctcccctcgctcccgcctcttgcggccccacggc | |||
| ccctcagcgcccgcccccggctccgcccgccgcagccgcagcccctggcg | |||
| ctaacggtcggtaacggcccgcgcgcgccgcccgccgggggctcgcgcca | |||
| gccacgagggagcgtccgcggcccgcgcgcccgcgcggcggaggagaggt | |||
| gttaagtgtgatgcttccataatacatttggatgctgtcagctaagttca | |||
| cttctgaactaaggggttcctccaaatgttggctgaaattcatcccaagg | |||
| ctggtctgcaagtgagtgtctgcacacagtttgcttgtatgtggagtcga | |||
| tccaaaatagcatcaatgttggttttaccaaagtatttattattgataat | |||
| agaggctaagtacaaaatgtagagaatgtcagctacttgaggcctttgat | |||
| tattaaaaattttattaatgcattaaacaaga | |||
| SEQ ID | E3-E5a- | gtgttaagtgtgatgcttccataatacatttggatgctgtcagctaagtt | 8573324- |
| NO: 26 | E6a-E7a | cacttctgaactaaggggttcctccaaatgttggctgaaattcatcccaa | 8573212 |
| ggctggtctgcaaagtctgcaattcataatggagctactgtactggctat | 8571761- | ||
| tggaaggaggagattctgaagataaggaggatgccactggaaatgttgaa | 8571696 | ||
| atgaaaaatattcagccgttggtctttgaaatttcctgtgatgtgtttca | 8568438- | ||
| atctagatgcaaagaacatggaaaaatcaaagtgctcgagtggtttaaat | 8568409 | ||
| atgttttgggtattcctgtttatagactataatacttttccaattaaaat | 8567320- | ||
| cctcagttgtcacgcagaagaaggttaagctgtatttgattgccagtttt | 8566974 | ||
| actgaaaatgcttagtattttacagtatcaccaaatatattttgtttagc | |||
| caaggtataggaaaaataaaataaattgtataggttgacttttttctaaa | |||
| atgtctttattggattgaatgaatgtttatacctgaaaaaaaaaggttca | |||
| aaaaaa | |||
| SEQ ID | E2a-E3- | tctcggcgccagaggggcggggaggggcggggtctcgatcgcgctattgt | 8577328- |
| NO: 27 | E4-E5a- | catggagacgggaagctggctgcagcggcggcggggaccgtggggccgag | 8576881 |
| E6-E7a | gtggctgccagccggccaatgtctaagcgaggcggagcggcccaggcggc | 8573324- | |
| ccgagcctgggggagcgcgcagccggccagtggcggcctcgccggcggcc | 8573212 | ||
| tcttcccgggctcgcagtaggcccgagtcgtcgccgggagctcctgggag | 8572798- | ||
| cagcgtccccgccctgctcccctcgctcccgcctcttgcggccccacggc | 8572712 | ||
| ccctcagcgcccgcccccggctccgcccgccgcagccgcagcccctggcg | 8571761- | ||
| ctaacggtcggtaacggcccgcgcgcgccgcccgccgggggctcgcgcca | 8571696 | ||
| gccacgagggagcgtccgcggcccgcgcgcccgcgcggcggaggagaggt | 8568521- | ||
| gttaagtgtgatgcttccataatacatttggatgctgtcagctaagttca | 8568409 | ||
| cttctgaactaaggggttcctccaaatgttggctgaaattcatcccaagg | 8567320- | ||
| ctggtctgcattacctatttcttttaagaataaatttagtgggaatatca | 8566974 | ||
| gttccagtcatgggtaccaaacttttttagtgacagagtacacacagagt | |||
| ctgcaattcataatggagctactgtactggctattggaaggaggagattc | |||
| tgaagataaggaggtaaaacctgtttagaaattaaaaatgagttacgatt | |||
| taaagaaaattcagatgactcattgtgagtgctagttctcttgtaggatg | |||
| ccactggaaatgttgaaatgaaaaatattcagccgttggtctttgaaatt | |||
| tcctgtgatgtgtttcaatctagatgcaaagaacatggaaaaatcaaagt | |||
| gctcgagtggtttaaatatgttttgggtattcctgtttatagactataat | |||
| acttttccaattaaaatcctcagttgtcacgcagaagaaggttaagctgt | |||
| atttgattgccagttttactgaaaatgcttagtattttacagtatcacca | |||
| aatatattttgtttagccaaggtataggaaaaataaaataaattgtatag | |||
| gttgacttttttctaaaatgtctttattggattgaatgaatgtttatacc | |||
| tgaaaaaaaaaggttcaaaaaaa | |||
| SEQ ID | E6e | tgataagcaacatccaaatattttgaccctgcttttagtggtttttttca | 8569201- |
| NO: 28 | aatcttattttgagtcttacttttagtcatagaatagctactgatttgat | 8566974 | |
| unspliced | gcggtctttaactgacttaatatttttacaatttcaatatattttgcatt | ||
| ggaatctccagtaatgaatattaaaatatatgtacaatcatttgtagatg | |||
| atatcaattatattaagacatttcagatgggctattgtagtatttaatgt | |||
| gccgtattttatggtagaataattctcagtctctggacatcaagattgct | |||
| ttcagtgggaatgaagattaatttacttcagtcctgattttttaggcatc | |||
| aatgcatgttttcatttttgtcagacttttaccctcttttaatgtaattc | |||
| tcaacttcttatggatttacttcccaatacataaaatccttcaaaacaag | |||
| aatgataataatttttatactttttataaaaataaatttatttttagtcc | |||
| atcaaggtgtctgaagattttatgcctaggtatctccatatctaacttga | |||
| taaggaaaataggataaacaatgctggtaatagcaggaaagtaagtattt | |||
| gaataagatgtcaaactgatatttcatgtgaacctaactcattttatggt | |||
| aactaataattatcttatttaaatcaataggtaaaacctgtttagaaatt | |||
| aaaaatgagttacgatttaaagaaaattcagatgactcattgtgagtgct | |||
| agttctcttgtaggatgccactggaaatgttgaaatgaaaaatgtaagta | |||
| tatcttttggtggaaaaaaggatagtctctaggacacaaaattactgttt | |||
| tatttttttctcaggagtttgcctaagggtgtgacagatgatctctgtca | |||
| cttgtcttagttgtgtcctgcaataaactggatgctttataaaatactag | |||
| acctgtgatttcgtatgctgtaatatttcatttctccatcacccctccaa | |||
| attatttcttagtttggagtaaaataataaatgtattatagtcaacatct | |||
| cttgacccctctttagtttcagctaaactaagcatgtgtgtttgtgtgtt | |||
| cattttatagttcatgtgtagaactatgtgaattaaatttaagaaacatg | |||
| taaagtagaggaaatagttttctggagaaatttttcctttttggatatta | |||
| tgcccttttccattgcttttctctgcttgaaagcaaaaaaaagtacccta | |||
| cccctgttctcctttagggaaaaactattcctataaagtatttttaaatc | |||
| gtgcaagtcattgcctagggttagctaaaacatttctttttaaaaaggag | |||
| aaaatgccctggctttaacattttcttgtatttgtatctattaagataaa | |||
| cagtttactttgatacagtacataccaatctacttaattttttttccagg | |||
| attccttttactatgtttggtctgaccttttatgataacttaatatggga | |||
| acaaattagcatataattctattttccatgtgacctcaaccagttgcaga | |||
| attgtaccactactttagggggggcaatttgacagtttatgtagactata | |||
| gcattaattgttcccaaatgttcagtgcatcctggctaatgtgttattga | |||
| aggtgttttcacgtaagcagttagaggaagcacttcacccctattactaa | |||
| gttattaaaatgcctcctaaaggtagcattttaaattagtatacataatt | |||
| gattagtaatttgtcttctcccaagcataaaacagcatagcagagttaag | |||
| tgtgaccagtgaagtataagatattagggattgatggtgacaatgatcat | |||
| agcaactaaatggattttttttttcttttagattcagccgttggtctttg | |||
| aaatttcctgtgatgtgtttcaatctagatgcaaagaacatggaaaaatc | |||
| aaagtgctcgagtggtttaaatatgttttgggtattcctgtttatagact | |||
| ataatacttttccaattaaaatcctcagttgtcacgcagaagaaggttaa | |||
| gctgtatttgattgccagttttactgaaaatgcttagtattttacagtat | |||
| caccaaatatattttgtttagccaaggtataggaaaaataaaataaattg | |||
| tataggttgacttttttctaaaatgtctttattggattgaatgaatgttt | |||
| atacctgaaaaaaaaaggttcaaaaaaat | |||
| SEQ ID | E6d-E7a | tttaatagaaggaaaatataaatttaatatctgggcaattgagaccttta | 8570158- |
| NO: 29 | aacttactttaaaagtatgatcttgatgtatatgatactgttttgtcttt | 8568409 | |
| gctatattaacagaattagaggggtgttctgcaattcaaataccttatat | 8567320- | ||
| attccaaattttattctctataatggacttttaaaataaaaggtatatgt | 8566974 | ||
| gcttcaagagggcaaaatttgaatcatgagctaatttgctaagcatcaga | |||
| ttatagaaaagcatccttgattaatttggaactgtgaaagggggcgggta | |||
| aaactgttttctgcagaaatttactagtgcagcaaccatttaaattaaat | |||
| gtttgttaacataatagtgatggcattttctcctccccctccttgtggtt | |||
| ttgtccaactagatgttacagtggcagttgcactgactgttaagtgttta | |||
| aatgatgacaccattatgtgaagtgattttgaaatgagagattccagcca | |||
| agaattacatctgctcccatctccttcaaatcatactctctggcagtaca | |||
| gattatgattgatttgtttgtgacagattgcaggaaacagtcattgattt | |||
| ttcaatattttaccttaaaattatttacagttgtaaccatggggaggtat | |||
| tttcatgggctgtcagcccctgaaagactaggataatattccctgctctc | |||
| tgacaagacaaattacctgtaatgagtgcagtagctgaagggtatacttt | |||
| tattttaaaatatgtcaataaccccagtgactaaacgaatattgatttag | |||
| cataatgaagcctgagtaacgtgaaaatgagctttttcaaggggcatggt | |||
| aaagtctttctttttagctggttgtaagaagcttttgattcttttcagcc | |||
| agctggtaggaatatagaattttataagcaaaccatcaggaatgatagtg | |||
| ttgtttctgataagcaacatccaaatattttgaccctgcttttagtggtt | |||
| tttttcaaatcttattttgagtcttacttttagtcatagaatagctactg | |||
| atttgatgcggtctttaactgacttaatatttttacaatttcaatatatt | |||
| ttgcattggaatctccagtaatgaatattaaaatatatgtacaatcattt | |||
| gtagatgatatcaattatattaagacatttcagatgggctattgtagtat | |||
| ttaatgtgccgtattttatggtagaataattctcagtctctggacatcaa | |||
| gattgctttcagtgggaatgaagattaatttacttcagtcctgatttttt | |||
| aggcatcaatgcatgttttcatttttgtcagacttttaccctcttttaat | |||
| gtaattctcaacttcttatggatttacttcccaatacataaaatccttca | |||
| aaacaagaatgataataatttttatactttttataaaaataaatttattt | |||
| ttagtccatcaaggtgtctgaagattttatgcctaggtatctccatatct | |||
| aacttgataaggaaaataggataaacaatgctggtaatagcaggaaagta | |||
| agtatttgaataagatgtcaaactgatatttcatgtgaacctaactcatt | |||
| ttatggtaactaataattatcttatttaaatcaataggtaaaacctgttt | |||
| agaaattaaaaatgagttacgatttaaagaaaattcagatgactcattgt | |||
| gagtgctagttctcttgtaggatgccactggaaatgttgaaatgaaaaat | |||
| attcagccgttggtctttgaaatttcctgtgatgtgtttcaatctagatg | |||
| caaagaacatggaaaaatcaaagtgctcgagtggtttaaatatgttttgg | |||
| gtattcctgtttatagactataatacttttccaattaaaatcctcagttg | |||
| tcacgcagaagaaggttaagctgtatttgattgccagttttactgaaaat | |||
| gcttagtattttacagtatcaccaaatatattttgtttagccaaggtata | |||
| ggaaaaataaaataaattgtataggttgacttttttctaaaatgtcttta | |||
| ttggattgaatgaatgtttatacctgaaaaaaaaaggttcaaaaaaa | |||
| SEQ ID | E2a-E3- | tctcggcgccagaggggcggggaggggcggggtctcgatcgcgctattgt | 8577328- |
| NO: 30 | E5-E7 | catggagacgggaagctggctgcagcggcggcggggaccgtggggccgag | 8576881 |
| gtggctgccagccggccaatgtctaagcgaggcggagcggcccaggcggc | 8573324- | ||
| ccgagcctgggggagcgcgcagccggccagtggcggcctcgccggcggcc | 8573212 | ||
| tcttcccgggctcgcagtaggcccgagtcgtcgccgggagctcctgggag | 8571761- | ||
| cagcgtccccgccctgctcccctcgctcccgcctcttgcggccccacggc | 8571392 | ||
| ccctcagcgcccgcccccggctccgcccgccgcagccgcagcccctggcg | 8567576- | ||
| ctaacggtcggtaacggcccgcgcgcgccgcccgccgggggctcgcgcca | 8566974 | ||
| gccacgagggagcgtccgcggcccgcgcgcccgcgcggcggaggagaggt | |||
| gttaagtgtgatgcttccataatacatttggatgctgtcagctaagttca | |||
| cttctgaactaaggggttcctccaaatgttggctgaaattcatcccaagg | |||
| ctggtctgcaaagtctgcaattcataatggagctactgtactggctattg | |||
| gaaggaggagattctgaagataaggaggtaatattatctcttttaaaaga | |||
| atactttcctctgtaatcctgaatctttattacatgtaagaactttgtgc | |||
| agtagacagcaatttctttgaatttggtatatggaaacaattttattttc | |||
| ctctgctaagtttttgagcctgcctcttctagtgccatggactgcattgg | |||
| tagagctgagaaatatcatttagccatactcagcacccttaaaatagctt | |||
| ctttctgagaattagatctgtgaaggtgtcctgcacagttcttgtagatg | |||
| tcattttagtttgtggttgacgtgcatgcattgcatcctggctaatgtgt | |||
| tattgaaggtgttttcacgtaagcagttagaggaagcacttcacccctat | |||
| tactaagttattaaaatgcctcctaaaggtagcattttaaattagtatac | |||
| ataattgattagtaatttgtcttctcccaagcataaaacagcatagcaga | |||
| gttaagtgtgaccagtgaagtataagatattagggattgatggtgacaat | |||
| gatcatagcaactaaatggattttttttttcttttagattcagccgttgg | |||
| tctttgaaatttcctgtgatgtgtttcaatctagatgcaaagaacatgga | |||
| aaaatcaaagtgctcgagtggtttaaatatgttttgggtattcctgttta | |||
| tagactataatacttttccaattaaaatcctcagttgtcacgcagaagaa | |||
| ggttaagctgtatttgattgccagttttactgaaaatgcttagtatttta | |||
| cagtatcaccaaatatattttgtttagccaaggtataggaaaaataaaat | |||
| aaattgtataggttgacttttttctaaaatgtctttattggattgaatga | |||
| atgtttatacctgaaaaaaaaaggttcaaaaaaa | |||
| SEQ ID | E2a-E3- | tctcggcgccagaggggcggggaggggcggggtctcgatcgcgctattgt | 8577328- |
| NO: 31 | E5a-E6- | catggagacgggaagctggctgcagcggcggcggggaccgtggggccgag | 8576881 |
| E7a | gtggctgccagccggccaatgtctaagcgaggcggagcggcccaggcggc | 8573324- | |
| ccgagcctgggggagcgcgcagccggccagtggcggcctcgccggcggcc | 8573212 | ||
| tcttcccgggctcgcagtaggcccgagtcgtcgccgggagctcctgggag | 8571761- | ||
| cagcgtccccgccctgctcccctcgctcccgcctcttgcggccccacggc | 8571696 | ||
| ccctcagcgcccgcccccggctccgcccgccgcagccgcagcccctggcg | 8568521- | ||
| ctaacggtcggtaacggcccgcgcgcgccgcccgccgggggctcgcgcca | 8568409 | ||
| gccacgagggagcgtccgcggcccgcgcgcccgcgcggcggaggagaggt | 8567320- | ||
| gttaagtgtgatgcttccataatacatttggatgctgtcagctaagttca | 8566974 | ||
| cttctgaactaaggggttcctccaaatgttggctgaaattcatcccaagg | |||
| ctggtctgcaaagtctgcaattcataatggagctactgtactggctattg | |||
| gaaggaggagattctgaagataaggaggtaaaacctgtttagaaattaaa | |||
| aatgagttacgatttaaagaaaattcagatgactcattgtgagtgctagt | |||
| tctcttgtaggatgccactggaaatgttgaaatgaaaaatattcagccgt | |||
| tggtctttgaaatttcctgtgatgtgtttcaatctagatgcaaagaacat | |||
| ggaaaaatcaaagtgctcgagtggtttaaatatgttttgggtattcctgt | |||
| ttatagactataatacttttccaattaaaatcctcagttgtcacgcagaa | |||
| gaaggttaagctgtatttgattgccagttttactgaaaatgcttagtatt | |||
| ttacagtatcaccaaatatattttgtttagccaaggtataggaaaaataa | |||
| aataaattgtataggttgacttttttctaaaatgtctttattggattgaa | |||
| tgaatgtttatacctgaaaaaaaaaggttcaaaaaaa | |||
| TABLE 2 |
| SUMMARY OF END-POINT PCR BASED MEASUREMENT OF PREDICTED |
| RNA VARIANTS DERIVED FROM SEQ ID NO: 1 |
| Non-diseased Controls | Adenoma | Adenocarcinoma | |
| SEQ ID NO: 21 | 3 positive out of 30 | 19 positive out of 21 | 20 positive out of 21 |
| SEQ ID NO: 23 | 0 positive out of 2 | 3 positive out of 3 | 3 positive out of 3 |
| SEQ ID NO: 24 | 1 positive out of 30 | 15 positive out of 21 | 5 positive out of 21 |
| SEQ ID NO: 27 | 1 positive out of 30 | 11 positive out of 21 | 11 positive out of 21 |
| SEQ ID NO: 22 | 1 positive out of 30 | 6 positive out of 21 | 8 positive out of 21 |
| SEQ ID NO: 29 | 8 positive out of 30 | 18 positive out of 21 | 20 positive out of 21 |
| SEQ ID NO: 28 | 12 positive out of 30 | 18 positive out of 21 | 18 positive out of 21 |
| SEQ ID NO: 30 | 16 positive out of 30 | 20 positive out of 21 | 21 positive out of 21 |
| SEQ ID NO: 31 | 16 positive out of 30 | 21 positive out of 21 | 21 positive out of 21 |
| SEQ ID NO: 25 | 19 positive out of 30 | 20 positive out of 21 | 21 positive out of 21 |
| SEQ ID NO: 26 | 19 positive out of 30 | 20 positive out of 21 | 21 positive out of 21 |
| TABLE 3 |
| AFFYMETRIX HuGene Exon 1.0 PROBESETS TARGETING NUCLEOTIDE |
| SEQUENCES IN SEQ ID NO: 1 |
| PROBESET | ||
| SEQ ID NO: 79 | ID | TARGET SEQUENCE |
| SEQ ID NO: 76 | 3692517 | taaaatgtctttattggattgaatgaatgtttatacctga |
| SEQ ID NO: 77 | 3692518 | aggttaagctgtatttgattgccagttttactgaaaatgcttagtattttacagtatc |
| accaaatata | ||
| SEQ ID NO: 78 | 3692519 | aaatttcctgtgatgtgtttcaatctagatgcaaagaacatggaaaaatcaaagtgct |
| cgagtggtttaaatatgttttgggtattcctgtttatagactataatacttttccaat | ||
| taaaatcctcagttgtcacgcaga | ||
| SEQ ID NO: 79 | 3692520 | gcctaagggtgtgacagatgatctctgtcacttgtcttagttgtgtcctgcaataaac |
| tggatgctttataaaatactagacctgtgatttcgtatgctgtaatatttcatttctc | ||
| catcacccctccaaattatttcttagtttggagtaaaataataaatgtattatagtca | ||
| acatctcttgacccctctttagtttcagctaaactaagcatgtgtgtttgtgtgttca | ||
| ttttatagttcatgtgtagaactatgtgaattaaatttaagaaacatgtaaagtagag | ||
| gaaatagttttctggagaaatttttcctttttggatattatgcccttttccattgctt | ||
| ttctctgcttgaaagcaaaaaaaagtaccctacccctgttctcctttagggaaaaact | ||
| attcctataaagtatttttaaatcgtgcaagtcattgcctagggttagctaaaacatt | ||
| tctttttaaaaaggagaaaatgccctggctttaacattttcttgtatttgtatctatt | ||
| aagataaacagtttactttgatacagtacataccaatctacttaattttttttccagg | ||
| attccttttactatgtttggtctgaccttttatgataacttaatatgggaacaaatta | ||
| gcatataattctattttccatgtgacctcaaccagttgcagaattgtaccactacttt | ||
| agggggggcaatttgacagtttatgtagactatagcattaattgttcccaaatgttca | ||
| gtgcatcctggctaatgtgttattgaaggtgttttcacgtaagcagttagaggaagca | ||
| cttc | ||
| SEQ ID NO: 80 | 3692521 | gatgccactggaaatgttgaaatgaaaaat |
| SEQ ID NO: 81 | 3692522 | gaaaattcagatgactcattgtgagtgctagttc |
| SEQ ID NO: 82 | 3692523 | ttcaaggggcatggtaaagtctttctttttagctggttgtaagaagcttttgattctt |
| ttcagccagctggtaggaatatagaattttataagcaaaccatcaggaatgatagtgt | ||
| tgtttctgataagcaacatccaaatattttgaccctgcttttagtggtttttttcaaa | ||
| tcttattttgagtcttacttttagtcatagaatagctactgatttgatgcggtcttta | ||
| actgacttaatatttttacaatttcaatatattttgcattggaatctccagtaatgaa | ||
| tattaaaatatatgtacaatcatttgtagatgatatcaattatattaagacatttcag | ||
| atgggctattgtagtatttaatgtgccgtattttatggtagaataattctcagtctct | ||
| ggacatcaagattgctttcagtgggaatgaagattaatttacttcagtcctgattttt | ||
| taggcatcaatgcatgttttcatttttgtcagacttttaccctcttttaatgtaattc | ||
| tcaacttcttatggatttacttcccaatacataaaatccttcaaaacaagaatgataa | ||
| taatttttatactttttataaaaataaatttatttttagtccatcaaggtgtctg | ||
| SEQ ID NO: 83 | 3692524 | gcaattcataatggagctactgtactggctattgga |
| SEQ ID NO: 84 | 3692525 | gtgtgatgcttccataatacatttggatgctgtcagctaagttcacttctgaactaag |
| gggttcctccaaatgttggctgaaattcatcccaaggctggtctgc | ||
| SEQ ID NO: 85 | 3692526 | ccgaccagacgtcccgtgggctagggcctgggcctcgggccgcgtcggcgccggtcga |
| gcctctccgggtgtcggggttcggggcgggcgcgcgtgggcgtggctcctctgtccac | ||
| gcctgttcccttcgtcgccgcggctctcgtccgggacacggctttccggagtagagcc | ||
| ctt | ||
| SEQ ID NO: 86 | 3692527 | aggtggctgccagccggccaatgtctaagcgaggcggagcggcccaggcggcccgagc |
| ctgggggagcgcgcagccggccagtggcggcctcgccggcggcctcttcccgggctcg | ||
| cagtaggcccgagtcgtcgccgggagctcctgggagcagcgtccccgccctgctcccc | ||
| tcgctcccgcctcttgcggccccacggcccctcagcgcccgcccccggctccgcccgc | ||
| cgcagccgcagcccctggcgctaacggtcggtaacggcccgcgcgcgccgcccgccgg | ||
| gggctcgcgccagccacgagggagcgtc | ||
| SEQ ID NO: 87 | 3692505 | ggcctgagcggttcagactacattctccgagagcccctgggtccgcccagcccagtgc |
| ctgacacctccttcacctatgattgggcgctggcct | ||
| SEQ ID NO: 88 | 3692504 | gtatagcacagcatcacaacctggatactgacattgatgcagtcaagacagagaacat |
| ttatatcatgaggaggatccctcattaccgccctttgatatccacccctacttccaga | ||
| ccatctcactcctcccttaaccctggcaaccactagcatgttctccatttctataaat | ||
| ttgcctttataggaatgttatataattgcaattaaagtgtgtaaccttttggggtttg | ||
| actcacccggcatcattttctggagattcagcttatatgtgtca | ||
| TABLE 4 |
| hCG_1815491 cDNA clones |
| DB455235 | DB347418 | BU590179 | AI827680 | |
| BQ638202 | AA581577 | AI004404 | BX096724 | |
| BM920423 | AW173121 | DB222387 | W38547 | |
| CN278390 | BF436749 | BM151589 | CN278219 | |
| LOC388279 | BU737152 | DB349477 | AA928654 | |
| XM_373688 | CA313804 | BF692451 | AI985612 | |
| AI245732 | H89247 | BI561324 | BQ011371 | |
| AW023444 | BE246152 | DB452125 | AI804090 | |
| BM696001 | BI497216 | BU165627 | AI342725 | |
| BU729242 | DB145524 | BU165662 | AW975944 | |
| LOC650242 | DB143311 | BU569024 | AA746740 | |
| XM_644116 | DA828150 | BF672570 | BU689926 | |
| DB446128 | CN289138 | BU160166 | BG193316 | |
| DB175550 | CN292893 | AW117234 | AA625672 | |
| BM698708 | CV372409 | DB517664 | AI214681 | |
| BI768666 | BF912258 | CB854553 | DW420944 | |
| CD356299 | BE000458 | AI923595 | N90090 | |
| CN288533 | CD000458 | AA825162 | CV575277 | |
| CN275915 | AI903846 | BU180741 | BU625145 | |
| CA436924 | BM150430 | BG720116 | DB520645 | |
| BF679396 | DB372595 | BE504515 | AV725613 | |
| CB217500 | AA829347 | AF275804 | ||
| BQ002970 | AI242819 | AI204177 | ||
| AA844729 | AA954994 | BM974647 | ||
| TABLE 5 |
| OLIGONUCLEOTIDE PRIMERS |
| Genomic | ||
| map regions | ||
| Primer | (start of | |
| nucleotide sequence | primer) | Amplicon sequence confirmation |
| 5′- TAACTGGAATTCATGTTGGC TGAAATTCATCCCA | 8573248=> | MULTIPLE AMPLICONS GENERATED. |
| 5′- CACGATAAGCTTTTATTATA GTCTATAAACAGGA ATACCCAAAACATATTTAA ACC | <=88567198 | |
| 5′- ACACGGCTTTCCGGAGTAGA 5′- AACAGGTTTTACCTCCTTAT CTTCAGAA | 8576635=> <=8571695// 8568521- 8568509 | |
| 5′- ACACGGCTTTCCGGAGTAGA 5′- GGCATCCTACAAGAGAACT CCTTATC | 8576635=> <=8571695// 8568449- 8568433 | |
| 5′- GGCGGAGGAGAGGTGAGC 5′-GCTGACAGCATCCA AATGTATTATG | 8576892=> <=8573280 | |
| 5′- TTTTTGAGAAGTGTATCATC TAGGAAGAA 5′- ACATATTTAAACCACTCGA GCACTTTG | 8571884- 8571856 <=8567253- 8567226 | |
| 5′- CAGCCACGAGGGAGCGT 5′- GGATCGACTCCACATACAA GCA | 8576931=> <=8573192- 8573170 | |
| 5′- ATGTTGGCTGAAATTCATCC CA 5′- TTCCAGTGGCATCCTCCTTA TC | 8573247=> <=8571696// 8568437- 8568425 | |
| 5′- ATGTTGGCTGAAATTCATCC CA 5′- TCTGTGTGTACTCTGTCACT AAAAAAGTTT | 8573247=> <=8572712 | |
| 5′- TAAGATATTAGGGATTGAT GGTGACAA 5′- ACATATTTAAACCACTCGA GCACTTTG | 8567385=> <=8567226 | |
| 5′- TGCCTAGGTATCTCCATATC TAACTTGA 5′- ACATATTTAAACCACTCGA GCACTTTG | 8568679=> <=8567226 | |
| 5′- ATGTTGGCTGAAATTCATCC CA 5′- TGCTGAGTATGGCTAAATG ATATTTCTC | 8573247=> <=8571488 | |
| 5′-CAGCCACGAGGGAGCGT 5′- AACAGGTTTTACCTCCTTAT CTTCAGAA | 8568679=> <=8571695// 8568521- 8568510 | |
1. A method of screening for the onset or predisposition to the onset of a large intestine neoplasm, or monitoring the progress of a neoplasm, in an individual, said method comprising: (i) measuring the level of expression of hCG—1815491 in a biological sample from said individual wherein a higher level of expression of hCG—1815491 or variant thereof relative to control levels is indicative of a neoplastic large intestine cell or a cell predisposed to the onset of a neoplastic state; or (ii) measuring the level of expression of a gene comprising a sequence of nucleotides as set forth in SEQ ID NO:1 or a sequence having at least 90% similarity to SEQ ID NO:1 across the length of the gene, or variant of SEQ ID NO:1, in a biological sample from said individual wherein a higher level of expression of said gene or variant thereof relative to control levels is indicative of a neoplastic large intestine cell or a cell predisposed to the onset of a neoplastic state.
2. (canceled)
3. The method according to claim 1 said method comprising measuring the level of expression of one or more mRNA transcripts, which transcripts comprise an RNA sequence selected from:
(i) an RNA sequence characterized by the sequence of one of:
SEQ ID NO:21, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:21;
SEQ ID NO:22, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:22;
SEQ ID NO:23, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:23;
SEQ ID NO:24, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:24;
SEQ ID NO:25, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:25;
SEQ ID NO:26, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:26;
SEQ ID NO:27, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:27;
SEQ ID NO:28, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:28;
SEQ ID NO:29, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:29;
SEQ ID NO:30, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:30; or
SEQ ID NO:31, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:31
(ii) an RNA sequence characterized by the sequence of one of:
SEQ ID NO:21, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:21;
SEQ ID NO:24, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:24;
SEQ ID NO:27, or a sequence having at least 90% similarity length of the sequence, or variant of SEQ ID NO:27;
SEQ ID NO:22, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:22;
SEQ ID NO:23, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:23;
SEQ ID NO:30, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:30;
SEQ ID NO:31, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:31;
SEQ ID NO:25, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:25.
(iii) an RNA sequence characterized by the sequence of one of:
SEQ ID NO:21, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:21;
SEQ ID NO:24, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:24;
SEQ ID NO:27, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:27;
SEQ ID NO:22, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:22.
4. (canceled)
5. (canceled)
6. A method of screening for the onset or predisposition to the onset of a large intestine neoplasm in an individual, said method comprising measuring the level of expression of an RNA transcript, which transcript comprises one or more exon segments selected from:
(i) an exon segment defined by SEQ ID NO:2, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:2;
(ii) an exon segment defined by SEQ ID NO:3, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:3
(iii) an exon segment defined by SEQ ID NO:4, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:4;
(iv) an exon segment defined by SEQ ID NO:5, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:5;
(v) an exon segment defined by SEQ ID NO:6, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:6;
(vi) an exon segment defined by SEQ ID NO:7, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:7;
(vii) an exon segment defined by SEQ ID NO:8, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:8;
(viii) an exon segment defined by SEQ ID NO:9, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:9;
(ix) an exon segment defined by SEQ ID NO:10, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:10;
(x) an exon segment defined by SEQ ID NO:11, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:11;
(xi) an exon segment defined by SEQ ID NO:12, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:12
(xii) an exon segment defined by SEQ ID NO:13, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:13
(xiii) an exon segment defined by SEQ ID NO:14, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:14
(xiv) an exon segment defined by SEQ ID NO:15, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:15
(xv) an exon segment defined by SEQ ID NO:16, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:16
(xvi) an exon segment defined by SEQ ID NO:17, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:17
(xvii) an exon segment defined by SEQ ID NO:18, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:18
(xviii) an exon segment defined by SEQ ID NO:19, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:19; or
(xix) an exon segment defined by SEQ ID NO:20, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:20
in a biological sample from said individual wherein a higher level of said RNA transcript or variant thereof relative to control levels is indicative of a neoplastic large intestine cell or a cell predisposed to the onset of a neoplastic state.
7. The method according to claim 6 wherein said transcript comprises one or more exon segments selected from:
(i) an exon segment defined by SEQ ID NO:3, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:3
(ii) an exon segment defined by SEQ ID NO:4, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:4;
(iii) an exon segment defined by SEQ ID NO:5, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:5;
(iv) an exon segment defined by SEQ ID NO:6, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:6;
(v) an exon segment defined by SEQ ID NO:7, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:7;
(vi) an exon segment defined by SEQ ID NO:8, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:8;
(vii) an exon segment defined by SEQ ID NO:9, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:9; or
(viii) an exon segment defined by SEQ ID NO:10, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:10;
(ix) an exon segment defined by SEQ ID NO:11, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:11;
(x) an exon segment defined by SEQ ID NO:12, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:12;
(xi) an exon segment defined by SEQ ID NO:13, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:13;
(xii) an exon segment defined by SEQ ID NO:14, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:14;
(xiii) an exon segment defined by SEQ ID NO:15, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:15;
(xiv) an exon segment defined by SEQ ID NO:18, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:18;
(xv) an exon segment defined by SEQ ID NO:19, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:19
8. The method according to claim 7 wherein said transcript is selected from:
(i) an RNA transcript which comprises each of the exon segments defined by SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:10 and SEQ ID NO:12, or a sequence having at least 90% similarity across the length of these sequences, or variants of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:10 and SEQ ID NO:12;
(ii) an RNA transcript which comprises each of the exon segments defined by SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:10 and SEQ ID NO:14, or a sequence having at least 90% similarity across the length of these sequences, or variants of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:10 and SEQ ID NO:14;
(iii) an RNA transcript which comprises each of the exon segments defined by SEQ ID NO:3 and SEQ ID NO:6, or a sequence having at least 90% similarity across the length of these sequences, or variants of SEQ ID NO:3 and SEQ ID NO:6;
(iv) an RNA transcript which comprises each of the exon segments defined by SEQ ID NO:11, SEQ ID NO:12 and SEQ ID NO:18, or a sequence having at least 90% similarity across the length of these sequences, or variants of SEQ ID NO:11, SEQ ID NO:12 and SEQ ID NO:18;
(v) an RNA transcript which comprises each of the exon segments defined by SEQ ID NO:4 and SEQ ID NO:7, or a sequence having at least 90% similarity across the length of these sequences, or variants of SEQ ID NO:4 and SEQ ID NO:7;
(vi) an RNA transcript which comprises each of the exon segments defined by SEQ ID NO:6, SEQ ID NO:10 and SEQ ID NO:13, or a sequence having at least 90% similarity across the length of these sequences, or variants of SEQ ID NO:6, SEQ ID NO:10 and SEQ ID NO:13;
(vii) an RNA transcript which comprises each of the exon segments defined by SEQ ID NO:6 and SEQ ID NO:8, or a sequence having at least 90% similarity across the length of these sequences, or variants of SEQ ID NO:6 and SEQ ID NO:8;
(viii) an RNA transcript which comprises each of the exon segments defined by SEQ ID NO:19 and SEQ ID NO:18, or a sequence having at least 90% similarity across the length of these sequences, or variants of SEQ ID NO:19 and SEQ ID NO:18;
(ix) an RNA transcript which comprises each of the exon segments defined by SEQ ID NO:15 and SEQ ID NO:18, or a sequence having at least 90% similarity across the length of these sequences, or variants of SEQ ID NO:15 and SEQ ID NO:18;
(x) an RNA transcript which comprises each of the exon segments defined by SEQ ID NO:6 and SEQ ID NO:9, or a sequence having at least 90% similarity across the length of these sequences, or variants of SEQ ID NO:6 and SEQ ID NO:9; or
(xi) an RNA transcript which comprises each of the exon segments defined by SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:10 and SEQ ID NO:12, or a sequence having at least 90% similarity across the length of these sequences, or variants of SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:10 and SEQ ID NO:12.
9. The method according to claim 6 wherein said transcript comprises one or more exon segments selected from:
(i) an exon segment defined by SEQ ID NO:5, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:5;
(ii) an exon segment defined by SEQ ID NO:6, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:6;
(iii) an exon segment defined by SEQ ID NO:8, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:8;
(iv) an exon segment defined by SEQ ID NO:10, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:10;
(v) an exon segment defined by SEQ ID NO:11, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:11;
(vi) an exon segment defined by SEQ ID NO: 12, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:12;
(vii) an exon segment defined by SEQ ID NO:14, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:14; or
(viii) an exon segment defined by SEQ ID NO:18, or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:18.
10. The method according to claim 7 wherein said transcript is selected from:
(i) an RNA transcript which comprises each of the exon segments defined by SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:10 and SEQ ID NO:12, or a sequence having at least 90% similarity across the length of these sequences, or variants of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:10 and SEQ ID NO:12;
(ii) an RNA transcript which comprises each of the exon segments defined by SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:10 and SEQ ID NO:14, or a sequence having at least 90% similarity across the length of these sequences, or variants of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:10 and SEQ ID NO:14;
(iii) an RNA transcript which comprises each of the exon segments defined by SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:18 and SEQ ID NO:24, or a sequence having at least 90% similarity across the length of these sequences, or variants of SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:18 and SEQ ID NO:24; or
(iv) an RNA transcript which comprises each of the exon segments defined by SEQ ID NO:6 and SEQ ID NO:8, or a sequence having at least 90% similarity across the length of these sequences, or variants of SEQ ID NO:6 and SEQ ID NO:8.
11. The method according to claims 1 or 6 wherein the exon segments of said transcripts are spliced such that they are joined.
12. A method of screening for the onset or predisposition to the onset of a large intestine neoplasm in an individual, said method comprising measuring the level of expression of one or more RNA transcripts, which transcripts comprise an RNA sequence characterised by the sequence of one of:
(i) SEQ ID NO:21 or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:21;
(ii) SEQ ID NO:24 or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:24;
(iii) SEQ ID NO:25 or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:25;
(iv) SEQ ID NO:26 or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:26;
(v) SEQ ID NO:27 or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:27;
(vi) SEQ ID NO:29 or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:29;
(vii) SEQ ID NO:30 or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:30; or
(viii) SEQ ID NO:31 or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:31;
in a biological sample from said individual wherein a higher level of expression of the genes or transcripts of group (i) and/or group (ii) relative to background levels is indicative of a neoplastic cell or a cell predisposed to the onset of a neoplastic state.
13. The method according to claim 12 wherein said transcripts comprise an RNA sequence characterised by the sequence of one of:
(i) SEQ ID NO:21 or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:21;
(ii) SEQ ID NO:22 or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:22;
(iii) SEQ ID NO:23 or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:23;
(iv) SEQ ID NO:24 or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:24; or
(v) SEQ ID NO:27 or a sequence having at least 90% similarity across the length of the sequence, or variant of SEQ ID NO:27;
in a biological sample from said individual wherein a higher level of expression of the genes or transcripts of group (i) and/or group (ii) relative to background levels is indicative of a neoplastic cell or a cell predisposed to the onset of a neoplastic state.
14. The method according to claim 13 wherein said RNA sequences are characterised by the sequence of either SEQ ID NO:21 or SEQ ID NO:22.
15. The method according to any one of claims 1, 6 or 12 wherein said level of expression is mRNA expression.
16. The method according to any one of claims 1, 6 or 12 wherein said at least 90% similarity is 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.
17. The method according to any one of claims 1, 6 or 12 wherein said level of expression is assessed by analysing RNA expression or protein expression.
18. (canceled)
19. The method according to any one of claims 1, 6 or 12 wherein said control level is a non-neoplastic level.
20. The method according to any one of claims 1, 6 or 12 wherein said neoplastic cell is an adenoma or adenocarcinoma.
21. The method according to claim 20 wherein said cell is a colorectal cell.
22. The method according to any one of claims 1, 6 or 12 wherein said individual is a human.
23. A molecular array, which array comprises:
(i) nucleic acid molecules comprising a nucleotide sequence corresponding to any one or more of the hCG—1815491 sequences described in claims 1 or 6 or a sequence exhibiting at least 90% identity thereto or a functional derivative, fragment, variant or homologue of said nucleic acid molecule; or
(ii) nucleic acid molecules comprising a nucleotide sequence capable of hybridising to any one or more of the sequences of (i) under medium stringency conditions or a functional derivative, fragment, variant or homologue of said nucleic acid molecule; or
(iii) nucleic acid probes or oligonucleotides comprising a nucleotide sequence capable of hybridising to any one or more of the sequences of (i) under medium stringency conditions or a functional derivative, fragment, variant or homologue of said nucleic acid molecule; or
(iv) probes capable of binding to any one or more of the proteins encoded by the nucleic acid molecules of (i) or a derivative, fragment or homologue thereof
wherein the level of expression of said marker genes of (i) or proteins of (iv) is indicative of the neoplastic state of a cell or cellular subpopulation derived from the large intestine.
24. A diagnostic kit for assaying biological samples comprising an agent for detecting one or more neoplastic markers as defined in claim 1 or 6 and reagents useful for facilitating the detection of said agent.