Patent application title:

CONJUGATIVE PLASMIDS AND METHODS OF USE THEREOF

Publication number:

US20110171734A1

Publication date:
Application number:

12/905,592

Filed date:

2010-10-15

Abstract:

The present invention provides novel C. botulinum conjugatively transmissible plasmids and methods of use thereof. Specifically, described herein are novel, conjugatively transmissible clostridial plasmids which are capable of being transferred among and between clostridial species. The novel plasmids of the present invention therefore permits the delivery of heterologous clostridial genes into a clostridial host, such as C. botulinum, and the expression of genes of interest in that host, including clostridial toxins and the nontoxigenic components of the toxin complex, toxin fragments, or antigenic portions thereof, in a way both that ensures abundant expression and facilitates purification. Furthermore, toxins with altered structures, chimeric, hybrid toxins, and other toxin derivatives valuable in medicine could be synthesized in this system.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N15/74 »  CPC main

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora

C12N15/63 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of U.S. Provisional Application No. 61/252,029, filed Oct. 15, 2009, the entirety of which is incorporated by reference herein for all purposes.

STATEMENT REGARDING FEDERALLY-SPONSORED RESEARCH OR DEVELOPMENT

The invention was made with government support under Grant Nos. AI-057153 and AI-065359 awarded by the National Institutes of Health. The government has certain rights in the invention.

FIELD OF THE INVENTION

This invention is directed to the conjugal transfer of BoNT-encoding plasmids and their derivatives in Clostridium botulinum and discloses technology related to that disclosed in International Patent Application Serial No. WO 2009/006281 filed Jun. 27, 2008, which is hereby incorporated herein by reference for all purposes.

BACKGROUND OF THE INVENTION

Bacteria of the genus Clostridium are gram positive and include many pathogenic species responsible for significant mortality and morbidity in both humans and animals. For instance, Clostridium tetani is a common soil dwelling organism which produces a neurotoxin responsible for the disease tetanus. Clostridium perfringens is a common cause of gas gangrene and food poisoning. Clostridium difficile is a common cause of gastroenteritis and pseudomembraneous colitis, particularly among elderly hospital patients who have had their intestinal flora depopulated by treatment with antibiotics.

Clostridium botulinum is an anaerobic, gram-positive, spore-forming organism that produces the extraordinarily lethal botulinum neurotoxins (BoNTs), a distinctive neurotoxin of extraordinary potency and the cause of botulism, which can cause severe neuroparalytic illness in humans and animals. BoNT is the etiologic agent of botulism, a paralytic disease resulting from the inhibition of neurotransmitter release at the neuromuscular junction. There are several forms of botulism, and infant and foodborne represent the majority of botulism cases reported in the U.S. Despite the unsavory reputation of BoNTs as a deadly poison and as a potential bioterrorism agent, their use in treatment for numerous hyperactive muscle disorders has been widely demonstrated.

Because of their extreme toxicity, the neurotoxins produced by Clostridium botulinum have been the subject of extensive study. Botulinum neurotoxins (BoNT) are classified into seven serotypes, referred to as serotypes A through G, on the basis of their immunological properties. Multiple subtype neurotoxins have been and continue to be discovered especially among serotypes A, B, E and F (Arndt et al. 2006; Carter et al. 2009; Dover et al. 2009; Hill et al. 2007; Smith et al. 2005). In many cases, the amino acid sequences of the toxins have been deduced and compared. See, for example, Minton, “Molecular Genetics of Clostridial Neurotoxins,” in Clostridial Neurotoxins, C. Montecucco (Ed.) Springer-Verlag, Berlin (1995).

Clostridium strains producing BoNTs are broadly characterized into four groups based on metabolic, physiological and genetic properties (Hatheway 1990). Group I contains proteolytic strains of serotypes A, B and F. Group II contains nonproteolytic strains of serotypes B, E and F. Unlike proteolytic strains, nonproteolytic strains lack the ability to digest meat and milk proteins and rely on exogenous proteins for the proteolytic nicking of the neurotoxin into its active di-chain form (Lynt et al. 1982). Group III includes strains of serotypes C and D and Group IV includes strains of C. botulinum serotype G, also referred to as Clostridium argentinense.

The genes encoding BoNT serotypes C, D and G have long been established to be associated with extrachromosomal elements (Sakaguchi et al. 2005; Zhou et al. 1995). Specifically, the BoNT/C1 and BoNT/D clusters are carried on bacteriophages, and in C. botulinum serotype G, the neurotoxin gene, bont/G, was shown to reside on a large plasmid of ca. 114 kb. However, genes encoding serotypes A, B, E and F were believed to be located on the chromosome. Recently, strains of serotype A, proteolytic and nonproteolytic strains of serotype B, and dual neurotoxin producing Ba, Ab and Bf strains have been shown to harbor neurotoxin genes on very large plasmids (Marshall et al. 2007; Smith et al. 2007; Franciosa et al. 2009). Interestingly, in dual neurotoxin-producing strains of Ba, Ab and Bf subtypes analyzed thus far, it appears that both neurotoxin genes are usually located on the same plasmid. Plasmids identified in proteolytic strains of C. botulinum range in size from approximately 150 to 270 kb and several plasmids found in serotypes A and B and dual neurotoxin producing Ba and Bf strains have been shown to be highly conserved, yet they carry different neurotoxin subtype genes. BoNT-encoding plasmids seem to be more prevalent among strains of serotype B than other serotypes. Unlike the large plasmids observed in proteolytic serotype B strains, plasmids found in nonproteolytic B strains are consistently smaller (approximately 48 kb) and share no homology with plasmids of proteolytic C. botulinum strains

Interest in BoNTs has accelerated due to its potential as pharmaceutical agent for the treatment of segmental movement disorders, spasticity, pain syndromes, and various other neural disorders. In addition, the potential for the use of BoNTs in bioterrorism has been noted and, as a result, government agencies are actively investigating countermeasures against them.

In use, BoNT specifically and tightly binds to cholinergic neurons. BoNT is found natively both in bacterial cultures and in contaminated foods as a progenitor toxin complex in which the neurotoxin is associated with nontoxic components including nontoxic nonhemagglutinin (NTNH), hemagglutinin (HA) proteins, RNA, and other uncharacterized protein components. The neurotoxin component of the toxin complex is a 150 kDa protein comprising a heavy (HC) and a light (LC) chain. The LC contains the catalytic domain that cleaves nerve proteins essential for neurotransmission. Specifically, upon endocytosis and internalization into the nerve terminal, the light chain of the toxin acts to block or slow the exocytotic release of neurotransmitters, particularly acetylcholine. Selective injection of botulinum toxin into neuromuscular regions produces a local weakening of proximal muscles and relief from excessive involuntary muscle contractions. In addition to directly affecting cholinergic neurotransmission, BoNT also exerts other poorly understood effects including altering activity of autonomic ganglia.

Upon endocytosis and internalization into the nerve terminal, the light chain of the toxin acts to block or slow the exocytotic release of neurotransmitters, particularly acetylcholine. Accordingly, the ability of BoNT to specifically target peripheral nerves and its long duration of action make it a very attractive potential therapeutic tool. Complications and drawbacks of botulinum toxin therapy include immunological resistance in some patients and diffusion and resulting apoptosis of neighboring muscles. These side effects can be avoided by proper expression, purification and preparation of the toxin or toxin chains or fragments for pharmaceutical use (Schantz et al. 1992).

BoNT-encoding plasmids carrying neurotoxin genes have been identified in numerous proteolytic and nonproteolytic strains of C. botulinum serotypes A and B and in bivalent subtypes Bf and Ab (Marshall et al. 2007; Smith et al. 2007; Franciosa et al. 2008). Although plasmids among proteolytic strains of C. botulinum are quite large and tend to vary in size, plasmids found in nonproteolytic C. botulinum strains are much smaller and are consistently observed to be approximately 48 kb.

Two main strategies have been utilized to obtain clostridial neurotoxins, individual chains of the toxins, or non-toxigenic components of the toxin complex. The first strategy is to isolate the desired protein itself from cultures of the toxigenic C. botulinum strain, and then biochemically separating the chains. However, separating the chains of the purified toxins, or toxin domains, or toxin fragments is technically challenging, laborious, the yields are low. The clinical use of purified botulinum toxin fragments is thus complicated by the need for extreme purity since even minute amounts of any contaminating active toxin can be non-specific and potentially dangerous. Biochemical preparations of toxin chains or fragments are always contaminated with low levels of active neurotoxin.

The second strategy is to recombinantly produce the toxin or toxin fragments in native or heterologous hosts. Unfortunately, the expression of clostridial genes in most heterologous hosts has been found to be inefficient. Available information on clostridial gene expression in E. coli in particular, and also other heterologous hosts, indicates that the expression of clostridial genes in these hosts occurs at very low levels and is relatively inefficient, and necessary post-translational modifications such as proteolytic activation and molecular folding to not occur. Furthermore, expression of clostridial proteins in heterologous hosts may result in production of degraded product and/or produced as insoluble matter. Expression of clostridial genes in clostridial species is, as might be expected, more efficient and the resulting proteins are less prone to structural or sequence errors and undergo proper posttranslational modifications.

Handling of and culturing of these bacteria is difficult since not only are they highly toxic, the organisms are obligate anaerobes which die if exposed to oxygen. Therefore, the clostridia must be handled under specialized conditions. These technical difficulties reduce efficiency of approaches that can be used for gene transfer in other bacteria such as electroporation, transformation and transduction. For instance, currently used clostridial shuttle vectors are constructed using replication genes from small (less than 10 kb) cryptic clostridial plasmids such as pIP404 (C. perfringens), pCD6 (C. difficile, pCB102 (C. butyricum), pBP1 (C. botulinum) or from small plasmids (2.4-25.5 kb) isolated from E. faecalis (pAMβ1), B. subtilis (pIM13) (Davis et al. 2005; Heap et al. 2009). Besides the replication genes functional in clostridia, these vectors also contain an antibiotic resistance gene functional in both clostridia and E. coli, and these plasmids can be transferred to clostridial strains by electroporation. For instance, vectors that additionally contain E. coli oriT sequences can be introduced into clostridial strains by conjugation from a suitable E. coli donor strain, but there are technical difficulties as described below.

In general, these vectors can be transferred to clostridial strains and are maintained in these strains in the presence of the antibiotic that is encoded from the plasmid vector. Transfer efficiency of these vectors varies and is strain dependent. However, these plasmids are not designed to maintain large gene inserts, e.g. larger than approximately 4 kb. Therefore, they cannot be used for transfer of gene clusters such as botulinum neurotoxin clusters that are 12-16 kb. However, botulinum neurotoxins are naturally produced as protein complexes consisting of a neurotoxin associated with several nontoxigenic components. The complex protects the neurotoxin in the host cell as well as in the human/animal gut. In order to increase the yield and production of high quality botulinum neurotoxins, vectors that can transfer large gene clusters are necessary.

Accordingly, the study and the production of clostridial toxin genes as well as other clostridial genes organized in gene clusters would be greatly facilitated by a plasmid providing the conjugal transfer of BoNT-encoding plasmids in other Clostridium species, thereby providing a plasmid and method for the widespread distribution of BoNT-encoding plasmids in other Clostridium species, especially Clostridium species that do not naturally produce these gene products.

SUMMARY OF THE INVENTION

The invention provides a novel conjugative transfer plasmid comprising: an origin of replication effective in Clostridium species; a protein coding sequence for a gene of interest operably joined to a promoter effective in Clostridium species; and an origin of conjugative transfer capable of modulating the conjugative transfer of the plasmid into a recipient Clostridium species, wherein the gene of interest is expressed in the recipient Clostridium species.

In one embodiment, the gene of interest is a botulinum neurotoxin gene for expressing clostridial toxins, toxin fragments, or antigenic portions thereof. The gene of interest may be from the same Clostridium species as the recipient Clostridium species or from a different Clostridium species.

In one embodiment, the plasmid may be selected from any donor Clostridium species. For instance, the plasmid may be found on C. botulinum strains selected from the group consisting of serotypes A, B, C, D, E, F or G. Alternatively, the plasmid may be from C. botulinum strains selected from the group consisting of Ba, Ab, Bf, Af or A(B). The plasmid may be from the same Clostridium species as the recipient Clostridium species or from a different Clostridium species. In one embodiment, the plasmid is selected from the group consisting of pBotCDC-A3, pCLJ, pCLL, pBot81E-1133 and pCLD.

In one embodiment, the promoter effective in Clostridium species is NTNH-BoNT promoter from C. botulinum.

In one embodiment, the recipient Clostridium species is toxic or nontoxic, such as LNT01 or Hall A-Hyper. The recipient Clostridium species may also be proteolytic or nonproteolytic.

In one embodiment, the conjugative transfer plasmid further comprises an antibiotic resistant gene that confers resistance to the recipient Clostridium species to erythromycin, kanamycin, ampicillin, tetracycline, chloramphenicol, spectinomycin, gentamycin, zeomycin or streptomycin. In one embodiment, the conjugative transfer plasmid further comprises an antibiotic resistant gene for conferring resistance to the recipient Clostridium species to erythromycin, tetracycline, chloramphenicol or thiamphenicol.

In an alternate embodiment, the present invention provides a novel conjugative transfer plasmid comprising a BoNT-encoding plasmid containing an origin of replication effective in Clostridium species, the BoNT encoded by the plasmid operably joined to a promoter effective in the Clostridium species; and an origin of conjugative transfer capable of modulating the conjugative transfer of the BoNT-encoding plasmid into a recipient Clostridium species, wherein the BoNT encoded by the plasmid is expressed in the recipient Clostridium species.

In one embodiment, the BoNT-encoding plasmid may be selected from any donor Clostridium species. For instance, the BoNT-encoding plasmid may be selected from C. botulinum serotypes A, B, C, D, E, F or G. Alternatively, the plasmid may be selected from C. botulinum strains Ba, Ab, Bf, Af or A(B). The BoNT-encoding plasmid may be from the same Clostridium species as the recipient Clostridium species or from a different Clostridium species. In one embodiment, BoNT-encoding plasmid is selected from the group consisting of pBotCDC-A3, pCLJ, pCLL, pBot81E-1133 and pCLD.

In one embodiment, the BoNT encoded by the plasmid is a botulinum neurotoxin gene for expressing clostridial toxins, toxin fragments, or antigenic portions thereof. The BoNT encoded by the plasmid may be from the same Clostridium species as the recipient Clostridium species or from a different Clostridium species.

In one embodiment, the BoNT-encoding plasmid further comprises an antibiotic resistant gene confers resistance to the recipient Clostridium species to erythromycin, tetracycline, chloramphenicol, and others known to be encoded from a plasmid. Where the recipient Clostridium species is C. botulinum, the antibiotic resistant gene confers resistance to the recipient Clostridium species to erythromycin, tetracycline, chloramphenicol or thiamphenicol.

In an alternate embodiment, the present invention provides a novel method of conjugatively transferring a gene of interest into a recipient Clostridium species. The method comprises conjugatively transferring a plasmid comprising an origin of replication effective in Clostridium species, a protein coding sequence for a gene of interest operably joined to a promoter effective in Clostridium species, and an origin of conjugative transfer capable of modulating the conjugative transfer of the plasmid into the recipient Clostridium species, wherein the gene of interest encoded by the plasmid is expressed in the recipient Clostridium species.

In one embodiment, the gene of interest is a botulinum neurotoxin gene for expressing clostridial toxins, toxin fragments, or antigenic portions thereof. The gene of interest may be from the same Clostridium species as the recipient Clostridium species or from a different Clostridium species.

While multiple embodiments are disclosed, still other embodiments of the present invention will become apparent to those skilled in the art from the following detailed description. As will be apparent, the invention is capable of modifications in various obvious aspects, all without departing from the spirit and scope of the present invention. Accordingly, the detailed descriptions are to be regarded as illustrative in nature and not restrictive.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1. Confirmation of tagging C. botulinum BoNT-encoded plasmids pBotCDC-A3-Erm (strain CDC-A3), pCLJ-Erm (strain 657Ba) and pCLL-Erm (strain Eklund 17B) by PCR analysis. PCR products of wild-type C. botulinum strains CDC-A3 (Lane 1), 657Ba (Lane 4) and Eklund 17B (Lane 7) and two erythromycin resistant, thiamphenicol sensitive clones of each of CDC-A3 (Lanes 2 and 3), 657Ba (Lanes 5 and 6) and Eklund 17B (Lanes 8 and 9) strains; 1 kb Plus ladder (Invitrogen) (Lane M).

FIG. 2. Confirmation of tagging C. botulinum BoNT-encoding plasmids pBotCDC-A3-Erm (strain CDC-A3), pCLJ-Erm (strain 657Ba) and pCLL-Erm (strain Eklund 17B) by PFGE and Southern hybridization analysis. (B) Ethidium bromide stained PFGE of nondigested DNA samples from C. botulinum strains: wild type CDC-A3 (Lane 1), CDC-A3580s1 (Lane 2), wild type 657Ba (Lane 3), 657Ba-CT4 (Lane 4), wild type Eklund 17B (Lane 5) and Eklund17B-CT11 (Lane 6); Lambda PFG Marker (Lane M), (New England Biolabs). The position of BoNT-encoding plasmids is indicated with arrows. (A) Southern hybridization with the bont/A3 probe (Lanes 1 and 2); the bont/bvB probe (Lanes 3 and 4) and the bont/npB probe (Lanes 5 and 6); (C) Southern hybridization with the ermB probe. PFGE conditions: 6V/cm, 12° C., 1-20 s pulse time, 24 h.

FIG. 3. Confirmation of plasmid transfer from C. botulinum strains CDC-A3580s1, 657BaCT4-2 and Eklund 17BCT11-1 to strain LNT01. Pulsed-field gel electrophoresis of (A) SmaI digested DNA of C. botulinum strains LNT01 (Lane 1 ), CDC-A3580s1 (Lanes 2-4) and LNT01 transconjugants (pCLK-Erm) (Lanes 5-8), (B) XhoI digested DNA of C. botulinum strains LNT01 (Lane 1), 657BaCT4-3 (Lane 2) and LNT01 transconjugants (pCLJ-Erm) (Lanes 3-4), and (C) NarI digested DNA of C. botulinum strains LNT01 (Lane 1), Eklund 17BCT11-1 (Lane 2) and LNT01 transconjugants (pCLL-Erm) (Lanes 3-6), Lambda PFG Marker (Lane M), New England Biolabs. PFGE conditions for gels (A) and (B): 6V/cm, 12° C., 1-26 s pulse time, 24 h, and (C): 6V/cm, 12° C., 1-5s, 24 h.

FIG. 4. Confirmation of plasmid pBotCDC-A3-Erm transfer from C. botulinum strain CDC-A3580s1 to strain LNT01 by PFGE and Southern hybridization analysis. (A) Ethidium bromide stained PFGE of C. botulinum DNA samples: (A) SmaI digested DNA of C. botulinum strain LNT01 (Lanes 1 and 7), CDC-A3 wild type (Lanes 2 and 8), CDC-A3580s1 (Lanes 3 and 9), and LNT01 transconjugants (pBotCDC-A3-Erm) (Lanes 4-6 and 10-12); (B) nondigested DNA samples (Lanes 1-6); SmaI-digested DNA samples (Lanes 7-12). Lambda PFG Marker (Lane M), New England Biolabs. The position of the pBotCDC-A3 plasmid is indicated with an arrow. Southern hybridization with: (C) the ermB probe, and (D) the bont/A3 probe. PFGE conditions: 6V/cm, 12° C., 1-26 s pulse time, 24 h.

FIG. 5. Confirmation of plasmid pCLJ-Erm transfer from C. botulinum strain 657BaCT4 to strain LNT01. (A) Ethidium bromide stained PFGE of C. botulinum strains: (A) LNT01 (Lanes 1 and 7), wild type strain 657Ba (Lanes 2 and 8); 657BaCT4 (Lanes 3 and 9) and transconjugants (pCLJ-Erm) (Lanes 4-6 and 10-12); (B) nondigested DNA samples (Lanes 1-6); XhoI digested DNA samples (Lanes 7-12). Lambda PFG Marker (Lane M), New England Biolabs. The position of the pCLJ plasmid is indicated with an arrow. Southern hybridization with: (B) the ermB probe and (C) the bont/bvB probe. PFGE conditions: 6V/cm, 12° C., 1-26 s pulse time, 24 h.

FIG. 6. Confirmation of plasmid pCLL-Erm transfer from C. botulinum strain Eklund 17BCT11 to strain LNT01. (A-B) Ethidium bromide stained PFGE of C. botulinum strains: LNT01 (Lanes 1 and 7), wild type strain Eklund 17B (Lanes 2 and 8); Eklund 17BCT11 (Lanes 3 and 9) and LNT01 transconjugants (pCLL-Erm) (Lanes 4-6 and Lanes 10-12). (A) nondigested DNA samples (Lanes 1-6); NarI digested DNA samples (Lanes 7-12). Lambda PFG Marker (Lane M), New England Biolabs. The position of the pCLL plasmid is indicated with an arrow. Southern hybridization with: (C) the ermB probe, and (D) the bont/npB probe. PFGE conditions: 6V/cm, 12° C., 1-20 s pulse time, 24 h.

FIG. 7. Confirmation of plasmid pCLK-Erm and pCLJ-Erm transfer to C. botulinum Hall A-hyper-Tn916 mutant strain. (A) Ethidium bromide stained PFGE of C. botulinum strains: wild type Hall A-hyper (Lane 1), Hall A-hyper/Tn916 mutant (Lane 2); Hall A-hyper/Tn916/pBotCDCA3-Erm (Lane 3); CDC-A3 plasmid-cured (Lane 4); wild type CDC-A3 (Lane 5). (D) Ethidium bromide stained PFGE of C. botulinum strains: wild type Hall A-hyper (Lane 6), Hall A-hyper/Tn916 mutant (Lane 7); Hall A-hyper/Tn916/pCLJ-Erm (Lanes 8 and 9); 657Ba-CT4 (Lane 10); wild type Hall A-hyper (Lane 11). Nondigested DNA and SmaI digests were loaded on the gels as indicated below the lanes. Lambda PFG Marker (Lane M), New England Biolabs. The position of the pBotCDC-A3 and pCLJ plasmids is indicated with arrows. Southern hybridization with: (B and E) the ermB probe; and (C and F) the tet probe. PFGE conditions: 6V/cm, 12° C., 1-26 s pulse time, 24 h.

FIG. 8. Plasmid alignment of (A) pCP13 (C. perfringens strain 13) and (B) pCLL (C. botulinum strain Eklund 17B). The alignment has two panels, one for each complete plasmid: pCP13 [top position] and pCLL [bottom position]. The top portions of the panels are composed of colored segments corresponding to the boundaries of locally collinear blocks (LCBs) with lines connecting the homologous blocks in each plasmid. LCBs below a plasmid's centerline are in the reverse complement orientation relative to the reference plasmid (pCP13). The lower portion of the panels represent the predicted open reading frames (ORFs) for the corresponding segments of double stranded DNA with ORFs on top representing top strand and below (bottom strand).

FIG. 9. Plasmid alignment of (A) pCLL (SEQ ID NO: 3; C. botulinum strain Eklund 17B); (B) pCW3 (SEQ ID NO: 27; C. perfringens strain CW92); (C) contig 1108490430999 (SEQ ID NO:29); (D) contig 1108490430283 (SEQ ID NO: 30; C. perfringens type D strain JGS1721) and (E) pCP8533etx (SEQ ID NO: 28; C. perfringens type B strain NCTC8533B4D). The alignment has five panels, one for each plasmid. The top portions of the panels are composed of segments corresponding to the boundaries of locally collinear blocks (LCBs) with lines connecting the homologous blocks in each plasmid. LCBs below a plasmid's center line are in the reverse complement orientation relative to the reference plasmid (pCLL).

FIG. 10. PFGE and Southern hybridization analysis of C. botulinum serotype A, B, Af and F strains. (A) PFGE of nondigested DNA; (B) Southern hybridizations with bont/A and (C) bont/F gene probes. Lanes: (M) Lambda PFGE ladder, (New England Biolabs), (1) ATCC 3502, (2) 5328A, (3) KyotoF, (4) Loch Maree, (5) 657Ba, (6) 14842, (7) Af84, (8) Langeland F, (9) 4852; (W) well position, (SCD) sheared chromosomal DNA.

FIG. 11. PFGE and Southern hybridization analysis of C. botulinum serotype B, Bf and F strains; (A) PFGE of nondigested DNA; (B) Southern hybridizations with bont/B and (C) bont/F gene probes. Lanes: (M) Lambda PFGE ladder (New England Biolabs), (1) OkraB, (2) 10068, (3) 17B, (4) 14842, (5) 657Ba, (6) 81E-1133, (7) 3281(32419), (8) 3281(32419), (9) Langeland F, (10) 4852.

FIG. 12. Plasmid alignment of the highly homologous virulence plasmids of proteolytic C. botulinum strains (A) Loch Maree (pCLK); (B)675 Ba (pCLJ): (C) Bf 81E-1133 (pBot81E-1133); and (D) Okra B (pCLD).

FIG. 13. PFGE and Southern hybridization analysis of C. botulinum strain Bf 81E-1133. (A) PFGE of nondigested and digested DNA; (B) Southern hybridizations with bont/B and (C) bont/F gene probes. Lanes: (M) Lambda PFGE ladder, (New England Biolabs), (1) Nondigested DNA; Digests with (2) AatII, (3) ApaI, (4) BglI, (5) EagI, (6) MluI, (7) NaeI, (8) NarI, (9) NruI, (10) PvuI, (11) RsnII, (12) SalI, (13) SacII, (14) SbfI, (15) SfiI, (16) SmaI, (17) XhoI.

FIG. 14. Plasmid alignment of (A) pCLK (Loch Maree) (SEQ ID NO: 1); (B) pCLJ (657) (SEQ ID NO: 2); (C) contigs 18 and 23 (Bf 81E-1133) (SEQ ID NOs: 68 and 69 respectively); and (D) pCLD (Okra) (SEQ ID NO: 4) in backbone view. Portions of LCBs in mauve color represent regions of DNA conserved in all four plasmids. Homologous regions conserved between two plasmids are as follows: pCLK and pCLJ, pCLK and pBot81E-1133, pCLK and pCLD, pCLJ and pCLD, or pBot81E-1133 and pCLD. Homologous regions conserved between three plasmids are as follows: pCLK, pCLJ, and pBot81E-1133; pCLJ, pBot81E-1133, and pCLD; pCLK, pBot81E-1133, and pCLD; pCLK, pCLJ and pCLD. Regions of LCBs without color represent regions unique to each plasmid.

FIG. 15. Plasmid alignments magnified for the LCB containing the A toxin cluster of (A) pCLJ (SEQ ID NO: 2) (657); (B) contigs 18 & 23 (SEQ ID NOs: 68 and 69 respectively) (Bf 81E-1133); and (C) pCLK (SEQ ID NO: 1) (Loch Maree). The LCB containing the B toxin clusters of (D) pCLJ (657); (E) contigs 18 & 23 (Bf81E-1133); and (F) pCLD (SEQ ID NO: 4) (Okra).

FIG. 16. Plasmid alignment in backbone view magnified for the LCB containing the A toxin cluster of pCLJ (SEQ ID NO: 2) (657), contigs 18 & 23 (SEQ ID NOs: 68 and 69 respectively) (Bf81E-1133), and pCLK (SEQ ID NO: 1) (Loch Maree). Portions of LCBs in gray represent regions of DNA conserved in all three plasmids. Homologous regions conserved between two plasmids are as follows: pCLJ and pBot81E-1133, pCLJ and pCLK, or pBot81E-1133 and pCLK.

FIG. 17. (A) Schematic presentation of wild type and mutated botulinum neurotoxin genes. ClosTron insertion site is shown with a vertical arrow an (*). (B) ClosTron vector pMTL007C-E2 containing the re-targeted group II intron utilized in site specific gene inactivation. (C) Plasmids pCLK-Erm and pCLK-Erm.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides novel conjugatively transferable plasmids and methods of use thereof.

I. IN GENERAL

In the specification and in the claims, the terms “including” and “comprising” are open-ended terms and should be interpreted to mean “including, but not limited to . . . . ” These terms encompass the more restrictive terms “consisting essentially of and “consisting of.”

As used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural reference unless the context clearly dictates otherwise. As well, the terms “a” (or “an”), “one or more” and “at least one” can be used interchangeably herein. It is also to be noted that the terms “comprising”, “including”, “characterized by” and “having” can be used interchangeably.

Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications and patents specifically mentioned herein are incorporated by reference in their entirety for all purposes including describing and disclosing the chemicals, instruments, statistical analyses and methodologies which are reported in the publications which might be used in connection with the invention. All references cited in this specification are to be taken as indicative of the level of skill in the art. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.

II. THE INVENTION

The present invention provides novel conjugatively transferable plasmids and methods of use thereof.

A. Conjugatively Transferrable Plasmids and Methods of Synthesis Thereof.

The present invention provides novel C. botulinum conjugatively transmissible plasmids and methods of use thereof. By “conjugative transfer” we mean the horizontal transmission of genetic information from one bacterium to another (both uni- and multi-directionally). The genetic material transferred may be a plasmid or it may be part of a chromosome. Bacterial cells possessing a conjugative plasmid generally contain a surface structure (the sex pilus) that is involved in the coupling of donor and recipient cells, and the transfer of the genetic information. Conjugation involves contact between cells, and the transfer of genetic traits can be mediated by many plasmids. Among all natural transfer mechanisms, conjugation is the most efficient. For example, the F plasmid of E. coli, the pCF10 plasmid of E. faecalis and the pXO16 plasmid of B. thuringiensis are able to sustain conjugative transfer in liquid medium and exhibit transfer efficiencies of close to 100%. Thus, the conjugative process permits the very efficient delivery of plasmid DNA into a recipient bacterium.

Specifically, in one embodiment, the present invention provides novel, conjugatively transmissible plasmids and their derivatives capable of encoding a gene of interest, wherein the plasmid is capable of being transferred among and between clostridial species, thereby providing for the efficient delivery of the genes of interest into a clostridial host and the expression of said genes of interest in that host. More specifically, in one embodiment, the invention provides novel BoNT-encoding plasmids and their derivatives for conjugal transfer of these plasmid from donor C. botulinum strains into recipient Clostridium species, and used for expression of gene(s) of interest in the recipient Clostridium species. The novel conjugative plasmid derivatives may be comprised of replication and conjugal transfer functions derived from native conjugative plasmids found in various strains of C. botulinum, that can efficiently replicate in Clostridium species; are capable of modulating the conjugative transfer of the plasmids into recipient Clostridium species; and stably maintain large DNA inserts such as genes and/or gene clusters. The protein coding sequence for a gene or gene clusters of interest are operably joined to a promoter effective in Clostridium species; wherein the gene(s) of interest is(are) expressed in the recipient Clostridium species.

By “plasmid” we mean an extra-chromosomal DNA molecule separate from the chromosomal DNA. Plasmids are generally dispensable DNA molecules that are stably maintained in bacterial populations. Plasmids replicate extra-chromosomally inside the bacterium and can transfer their DNA from one cell to another by a variety of mechanisms. DNA sequences controlling extra chromosomal replication (ori) and transfer (tra) are distinct from one another; i.e., a replication sequence generally does not control plasmid transfer, or vice-versa. Replication and transfer are both complex molecular processes that make use of both plasmid- and host-encoded functions. In many cases, a plasmid is circular and double-stranded. Plasmids usually occur naturally in bacteria, but are sometimes found in eukaryotic organisms. Plasmid size varies from 1 to over 1,000 kilobase pairs (kbp). The number of identical plasmids within a single cell can range anywhere from one to even thousands under some circumstances.

The typical conjugative plasmid carries its own origin of replication (oriV) as well as an origin of transfer (oriT). It also typically includes a tra and a trb locus. When conjugation is initiated, an enzyme creates a “nick” in one plasmid DNA strand at the oriT. The enzyme may work alone or in a complex of over a dozen proteins. The transferred, or T-strand, is unwound from the plasmid and transferred into the recipient bacterium in a 5′-terminus to 3′-terminus direction. The remaining strand is replicated, either independent of conjugative action (vegetative replication, beginning at the oriV) or in concert with conjugative replication. Conjugation functions are usually plasmid encoded, but some conjugation genes can be found on the chromosome and can exhibit their activity of plasmid transfer in trans. Numerous conjugative plasmids (and transposons) are known, which can transfer associated genes within one species (narrow host range) or between many species (broad host range). Conjugation can occur between genera as widely diverse as anaerobes and aerobes.

In one embodiment, plasmids can be used from any donor Clostridium species. The conjugatively transferable plasmid of the present invention can be selected from any proteolytic or nonproteolytic donor Clostridium species. For instance, in one embodiment, the conjugatively transferable plasmid of the present invention may be selected from any Clostridium species. In one embodiment the plasmid is selected from C. botulinum serotypes A, B, C, D, E, F or G, or dual neurotoxin producing Clostridium strains Ba, Ab, Bf, Af and A(B). The bivalent A(B) strains contain both the BoNT/A and BoNT/B neurotoxin genes; however only BoNT/A is produced, as the BoNT/B neurotoxin gene in this strain contains a premature stop codon and thus is not expressed. In one embodiment, the plasmid pCLL (approximately 48 kb) from the nonproteolytic C. botulinum serotype B, strain Eklund 17B was used. In other embodiments, the plasmid may be selected from the group consisting of pBotCDC-A3, pCLJ, pBot81E-1133 and pCLD.

For instance, in on embodiment, conjugative C. botulinum plasmids pBotCDC-A3 (proteolytic subtype A3 strain CDC-A3, also referred to in the art as pCLK (SEQ ID NO: 1; GenBank Acc. #CP000963)), pCLJ (SEQ ID NO: 2; GenBank Acc #CP001081) and pCLL (SEQ ID NO: 3; GenBank Acc #CP001057) (tagged with antibiotic resistance markers for tracking purposes) were conjugatively transferred into other proteolytic C. botulinum strains, therefore these plasmids or their derivatives may be used for expression of any native or modified botulinum neurotoxin, its chains or subfragments or as a complex with its nontoxigenic protein components in any suitable recipient Clostridium species. The native toxin gene clusters of the plasmid may be replaced with any gene of interest (including other serotype or subtype native or modified botulinum neurotoxin gene clusters) for expression in the recipient Clostridium species.

By “gene of interest” we mean any heterologous or homologous gene capable of being expressed in the recipient Clostridium species. By “heterologous” we mean a nucleic acid or protein which is not native to Clostridium species. In one embodiment, the gene of interest may include those responsible for expressing clostridial toxins, toxin fragments, or antigenic portions thereof as well as other genes of interest known to one of skill in the art. For instance, the neurotoxin genes encoded on the plasmids pCLK (SEQ ID NO: 1) and pCLJ (SEQ ID NO: 2) are produced in very low quantities in their native hosts, C. botulinum strains CDC-A3 and 657Ba, respectively. Since these native BoNT-encoding plasmids pCLK (SEQ ID NO: 1) and pCLJ (SEQ ID NO: 2) are conjugative they may be transferred to a strain of C. botulinum that is capable of producing high quantities of neurotoxin, such as the Hall A-hyper strain. The “gene of interest” may also include fragments of the neurotoxin genes as well as other genes within the neurotoxin gene cluster that encode proteins that are and are not part of the botulinum progenitor toxin complex. By “gene of interest”, we also mean any gene that is encoded by the genomes of proteolytic or nonproteolytic C. botulinum strain or any clostridial species that produces BoNTs including C. baratii and C. butyricum. Specifically, in one embodiment, the “gene of interest” may be selected from the group consisting of the C. botulinum serotypes A, B, C, D, E, F or G, C. botulinum strains Ba, Ab, Bf, Af or A(B), BoNT/A3 subtype gene, bont/A3 (pBotCDCA3), the bivalent BoNT/B gene, bont/bvB (pCLJ), and the nonproteolytic BoNT/B gene bont/npB (pCLL).

By “proteolytic” we mean C. botulinum strains which do not grow and produce toxin at temperatures below 10° C. By “nonproteolytic” we mean C. botulinum strains which can grow and produce toxin at 3.0° C.

The conjugatively transferable plasmid of the present invention is transferred into a recipient Clostridium species for expression of the gene of interest in the recipient Clostridium species. By “recipient Clostridium species” we mean a toxic or nontoxic Clostridium species which may be the same or different species as the Clostridium species of the plasmid or of the gene or interest. In one embodiment, the plasmid may be from the same Clostridium species as the recipient Clostridium species, although in other embodiments the plasmid may be from a different Clostridium species than the recipient Clostridium species. For instance, in one embodiment, transfer of plasmids from nonproteolytic C. botulinum to proteolytic C. botulinum may occur. In alternate embodiments, plasmids from proteolytic strains may be transferred to nonproteolytic strains Clostridium species.

By “toxic Clostridum species” we mean a Clostridium species which produces BoNT and carries their native BoNT gene on a chromosome. For instance, in one embodiment, the toxic recipient Clostridium species may include a C. botulinum strain Hall A-hyper which contains a BoNT/A1 neurotoxin gene. Plasmid transfer to this strain may also occur by contacting a BoNT encoding plasmid from a donor strain of the present invention with the recipient Clostridium species (i.e., Hall A-hyper) and allowing conjugation to take place, thereby yielding a toxic, recipient strain of Hall A-hyper capable of expressing the recombinant BoNT encoded by the conjugatively transferable plasmid.

By “nontoxic Clostridium species” we mean a Clostridium species which no longer produce their native BoNT because they no longer carry the BoNT gene or the BoNT gene is inactive. For instance, in one embodiment the nontoxic recipient Clostridium species is LNT01. C. botulinum strain LNT01 is a nontoxigenic, tetracycline resistant transposon Tn916 mutant of the parent C. botulinum subtype Al strain 62A (subtype A1) that has lost a genome region containing the entire BoNT gene cluster (Johnson et al. 1997). However, other nontoxic recipient strains that may be used in the invention include any nontoxigenic C. botulinum strain. For instance, Clostridium strains that carry their BoNT genes on extrachromosomal plasmids or bacteriophages can be cured from these elements by several standard genetic techniques known to one of skill in the art. For instance, C. botulinum strain CDC-A3, which typically carries a 267 kb BoNT/A3 encoded plasmid, can be cured of its plasmid, resulting in a plasmid-less strain of CDC-A3 (CDC-A3TC5/Tn916) that is thus nontoxic. Other proteolytic C. botulinum strains may be constructed in this manner. Nonproteolytic C. botulinum strains could also be constructed in a similar fashion.

In one embodiment, the conjugatively transmissible plasmid of the present invention comprises a BoNT-encoding plasmid containing an origin of replication from the native BoNT-encoding plasmids that are effective in Clostridium species; and an origin of conjugative transfer from the native BoNT-encoding plasmids capable of modulating the conjugative transfer of the plasmid from a donor Clostridium species into a recipient Clostridium species, wherein the BoNT encoded by the plasmid is expressed in the recipient Clostridium species after transfer by the plasmid. In another embodiment, the conjugatively transmissible plasmid of the present invention comprises a BoNT-encoding plasmid containing an origin of replication from the native BoNT-encoding plasmids that are effective in Clostridium species; and an origin of conjugative transfer from the native BoNT-encoding plasmids capable of modulating the conjugative transfer of the plasmid from a donor Clostridium species into a recipient Clostridium species, wherein the BoNT encoded by the plasmid is expressed in the recipient Clostridium species after transfer by the plasmid.

By “BoNT-encoding plasmid” we mean a plasmid encoding proteolytic or nonproteolytic Clostridium neurotoxin genes for expressing clostridial toxins, toxin fragments, or antigenic portions thereof. In one embodiment, the BoNT-encoding plasmid is selected from the group consisting of pBotCDC-A3 (proteolytic subtype A3 strain CDC-A3, also referred to in the art as pCLK (SEQ ID NO: 1; GenBank Acc. #CP000963)), pCLJ (proteolytic subtype A4/bivalent B strain 657Ba; GenBank Acc. #CP001081), pBot81E-1133, pCLD (SEQ ID NO:4; GenBank Acc. #CP000964) and pCLL (nonproteolytic serotype B strain Eklund 17B; GenBank Acc. #CP001057).

By “origin of replication” we mean an origin of replication that is functional in a broad range of prokaryotic host cells (i.e., a normal or non-conditional origin of replication such as the ColEl origin and its derivatives). In one embodiment the origin of replication is effective in Clostridium species and may be derived from native BoNT-encoding plasmids.

By “operably joined to a promoter effective in Clostridium species” we mean a segment of DNA that comprises sequences capable of providing both promoter and enhancer functions (i.e., the functions provided by a promoter element and an enhancer element. The availability of a Clostridium promoter such as is known to the art (see U.S. Pat. No. 5,955,368 to Johnson et al.) makes it possible to incorporate gene of interest into an existing plasmid wherein the resultant plasmid is transferred directly into the recipient Clostridium species by conjugative transfer, where the gene will be expressed and the cells of the recipient Clostridium species will produce protein. For example, the long terminal repeats of retroviruses contain both promoter and enhancer functions. The enhancer/promoter may be “endogenous” or “exogenous” or “heterologous.” An “endogenous” enhancer/promoter is one which is naturally linked with a given gene in the genome. An “exogenous” or “heterologous” enhancer/promoter is one which is placed in juxtaposition to a gene by means of genetic manipulation (i.e., molecular biological techniques) such that transcription of that gene is directed by the linked enhancer/promoter. In one embodiment, the promoter is the native NTNH-BoNT promoter from C. botulinum. However, other promoter regions besides the native promoters controlling expression of the toxin and its associated proteins could be potentially introduced in the gene clusters during construction of recombinant genes. Currently, promoters such as those of the ferredoxin or thiolase genes from other clostridial species are used for gene expression in clostridia (Heap et al. 2009).

By “origin of conjugative transfer” we mean a short sequence (typically up to 500 bp) of DNA that is necessary for transfer of the plasmid from a bacterial host to recipient during bacterial conjugation. The oriT is cis-acting—it is found on the same plasmid that is being transferred, and is transferred along with the plasmid. The origin of transfer consists of three functionally-defined domains: a nicking domain, a transfer domain, and a termination domain and facilitates the transfer of plasmids across clostridial species.

By “plasmid derivative” we mean components of the novel conjugative plasmids of the present invention, including but not limited to the origin of replication, which may also be utilized in the construction of C. botulinum-specific shuttle vectors useful in the cloning and expression of clostridial toxins, including BoNTs and their protein complexes. For instance, any other C. botulinum gene of interest may be cloned into these newly constructed C. botulinum specific shuttle vectors. New conjugative expression vectors can be created using the replication and conjugal transfer systems from these native plasmids. This would allow one to reduce the size of these plasmids to facilitate their manipulation. The vectors currently used in our laboratory are derivatives of pJIR1457 and pJIR1456 (Bradshaw et al. 1998; U.S. Pat. No. 5,955,368), pMTL9361 (Pier et al. 2008) and modular clostridial vectors of pMTL80000 series (Heap et al, 2009). These vectors have been useful for the expression and purification of recombinant neurotoxins in a nontoxigenic strain LNT01 or other nontoxigenic C. botulinum host strains. Such host strains can be generated by curing the wild type strains from their BoNT-encoded plasmids or by insertionally inactivating or deleting their native BoNT genes located on the chromosome.

Accordingly, the present invention provides the first demonstration of the conjugative transfer of BoNT-encoding plasmids wherein the plasmid is from a toxic Clostridium species (i.e., an A3 subtype strain, an A4/bivalent B subtype strain and a nonproteolytic serotype B strain) and is effectively transferred to a non-toxic recipient Clostridium species (i.e., a subtype A1 strain) and the BoNT encoded by the plasmid is expressed in the recipient Clostridium species. Taken together, this invention provides for the efficient expression of specific genes of interest in Clostridium species. For instance, where the gene of interest is a specific Clostridium toxin, the novel plasmid and method of the present invention allows one of skill in the art to make any number of clostridial toxins, toxin fragments, or antigenic portions thereof in a clostridial host in a way that ensures abundant expression of the toxin and facilitates purification of said toxin. Furthermore, toxins with altered structures, chimeric toxins, and other toxin derivatives valuable in medicine could be synthesized in this system. Methods for conjugative transfer of the novel plasmids are described in the examples below.

B. Methods of Use.

The present invention also provides for the conjugative transfer of a gene of interest in a recipient Clostridium species. The method comprises conjugatively transferring a plasmid comprising an origin of replication effective in Clostridium species, a protein coding sequence for a gene of interest operably joined to a promoter effective in Clostridium species, and an origin of conjugative transfer capable of modulating the conjugative transfer of the plasmid into the recipient Clostridium species, wherein the gene of interest encoded by the plasmid is expressed in the recipient Clostridium species.

Methods of using the novel plasmid of the present invention, such as for the manufacture of therapeutic toxins or for the improved expression of pure or designer toxins or toxin fragments, are also envisioned and would be known to one of skill in the art.

III. EXAMPLES

The following examples are, of course, offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and the following examples and fall within the scope of the appended claims.

Materials and Methods

Bacterial Strains. Proteolytic C. botulinum strains CDC-A3 (BoNT subtype A3), 657Ba (subtype A4/bivalent B), LNT01 (nontoxigenic, subtype A1), Hall A-hyper (subtype A1) and nonproteolytic C. botulinum serotype B strain Eklund 17B were obtained from the Johnson laboratory culture collection. C. botulinum strain CDC-A3 was originally obtained from the Centers for Disease Control and Prevention (CDC) (Atlanta, Ga.). MLST and PFGE analyses indicated it was genetically identical to subtype A3 strain Loch Maree (Jacobson et al. 2008). C. botulinum strain 657Ba was isolated from a case of infant botulism in 1976 (Hatheway et al. 1981). C. botulinum strain Eklund 17B was isolated from marine sediments off the coast of Washington (Eklund et al. 1967). C. botulinum strain LNT01 is a nontoxigenic Tn916 mutant of the parent strain 62A (subtype A1) (Lin et al. 1991; Johnson et al. 1997). Hall A-hyper is a well characterized subtype A1 strain, which produces high quantities of BoNT/A1 (Brashaw et al. 2004). Escherichia coli strains DH10B and CA434 were used for cloning, maintenance and conjugal transfer of the retargeted ClosTron vectors. All C. botulinum strains were maintained as frozen stocks at −80° C. in TPGY broth (50 g/liter trypticase peptone, 5 g/liter Bacto peptone, 4 g/liter D-glucose, 20 g/liter yeast extract, 1 g/liter cysteine—HCl, pH 7.4) containing 20% glycerol. Bacterial strains were subsequently cultured anaerobically in TPGY.

Mating experiments. Mating experiments were conducted on nonselective TYG (30 g/liter Bacto Tryptone, 20 g/liter yeast extract, 1 g/liter sodium thioglycollate) (4% agar) media and then spread plated onto selective TYG (1.5% agar) plates supplemented with the appropriate antibiotics. Antibiotics were used at the following concentrations: cycloserine (250 μg/ml), sulfamethoxazole (76 μg/ml), thiamphenicol (15 μg/ml), tetracycline (10 μg/ml), erythromycin (2.5 μg/ml), chloramphenicol (25 μg/ml in agar plates and 12.5 mg/ml in broth). All bacterial media components and chemicals were purchased from Becton Dickinson Microbiology Systems, Sparks, Md. and Sigma-Aldrich, St. Louis, Mo.

Plasmid tagging using ClosTron. To ascertain transfer of BoNT-encoding plasmids from the donor to the recipient strain, the plasmids were tagged with an erythromycin resistance gene using the ClosTron mutagenesis system. The ClosTron mutagenesis system (Heap et al. 2004; Heap et al. 2010) was used to insertionally inactivate bont/A3, bont/bvB and bont/npB of plasmids pBotCDC-A3 (strain CDC-A3), pCLJ (strain 657Ba) and pCLL (strain Eklund 17B), respectively. The computer algorithm available through the Targetron (group II intron) Design Site was used to design the PCR primers listed in Table 1 for intron re-targeting of the selected genes bont/A3, bont/bvB and bont/npB. Primers 580|581s-IBS (SEQ ID NO: 5), 580|581s-EBS1d (SEQ ID NO:6), 381|382s-IBS (SEQ ID NO:8), 381|382s-EBS1d (SEQ ID NO:9), 420|421s-IBS (SEQ ID NO:11), 420|421s-EBS1d (SEQ ID NO:12) and EBS Universal (SEQ ID NO:14) (Table 1) were purchased from Sigma-Aldrich (St. Louis, Mo.).

TABLE 1
Oligonucleotide Primers.
Oligonucleotide
Primer Sequence (5′-3′)
580|581s-IBS AAAAAAGCTTATAATTATCCTTACAGATCTTACAT
(SEQ ID NO: 5) GTGCGCCCAGATAGGGTG
580|581s-EBS1d CAGATTGTACAAATGTGGTGATAACAGATAAGTCT
(SEQ ID NO: 6) TACATTTTAACTTACCTTTCTTTGT
580|581s-EBS2 TGAACGCAAGTTTCTAATTTCGGTTATCTGTCGAT
(SEQ ID NO: 7) AGAGGAAAGTGTCT
381|382s-IBS AAAAAAGCTTATAATTATCCTTAGTTCCCCTCGAA
(SEQ ID NO: 8) GTGCGCCCAGATAGGGTG
381|382s-EBS1d CAGATTGTACAAATGTGGTGATAACAGATAAGTCC
(SEQ ID NO: 9) TCGAAGATAACTTACCTTTCTTTGT
381|382s-EBS2 TGAACGCAAGTTTCTAATTTCGATTGGAACTCGAT
(SEQ ID NO: 10) AGAGGAAAGTGTCT
420|421S-IBS AAAAAAGCTTATAATTATCCTTAACTGTCAATAAA
(SEQ ID NO: 11) GTGCGCCCAGATAGGGTG
420|421S-EBS1d CAGATTGTACAAATGTGGTGATAACAGATAAGTCA
(SEQ ID NO: 12) ATAAATTTAACTTACCTTTCTTTGT
420|421S-EBS2 TGAACGCAAGTTTCTAATTTCGATTACAGTTCGAT
(SEQ ID NO: 13) AGAGGAAAGTGTCT
EBS Universal CGAAATTAGAAACTTGCGTTCAGTAAAC
(SEQ ID NO: 14)
A3KMCT1 GAGATCCTGTAAATGGTGTTGATATTGC
(SEQ ID NO: 15)
A3KMCT2 GGTATTATCCCTCTTACACATAGCAGC
(SEQ ID NO: 16)
BVBFCT4 CAAACAATGATCAAGTTATTTAATAG
(SEQ ID NO: 17)
BVBRCT4 TCATTTAAAACTGGCCCAGG
(SEQ ID NO: 18)
NPBFCT11 CAAATCAAAACCATTGGGTGAAAAG
(SEQ ID NO: 19)
NPBRCT11 CTGGACAAAATTTCATTTGCATTATACCCC
(SEQ ID NO: 20)
AnyBF CAGGAGAAGTGGAGCGAAAAAAAG
(SEQ ID NO: 21)
AnyBR TGGTAAGGAATCACTAAAATAAGAAGC
(SEQ ID NO: 22)
Erm-F CCGATACCGTTTACGAAATTGGAACAGG
(SEQ ID NO: 23)
Erm-R TTATTTCCTCCCGTTAAATAATAGATAACT
(SEQ ID NO: 24)
pMTL007-R1 AGGGTATCCCCAGTTAGTGTTAAGTCTTGG
(SEQ ID NO: 25)

A two-step PCR reaction was used to generate the 350 by re-targeted intron. The first step included two separate PCR reactions: one containing the IBS and EBS universal primers and the other containing the EBS2 and EBS1d primers. The intron PCR template supplied in the Targetron Gene Knockout System kit (Sigma-Aldrich, St. Louis, Mo.) was used as the DNA template. Five microliters of each PCR product obtained in the first PCR reactions were combined and used as the template in a second PCR reaction containing the IBS and EBS1d primers. PCR reactions were performed using the GeneAmp High Fidelity PCR system (Applied Biosystems, Foster City, Calif.) under the following conditions: initial hold at 94° C. for 30 s; followed by 20 cycles of 15 s of denaturation at 94° C., 30 s of primer annealing at 55° C., and 30 s of extension at 72° C. and then a final 7 min step at 72° C. The resulting PCR products of 350 by representing the retargeted intron were purified by gel extraction (Qiagen) and cloned into the vector pMTL007C-E2 (Heap et al. 2010) using restriction endonucleases HindIII and BsrGI by standard cloning techniques (Sambrook 2001).

Transformants containing modified ClosTron vectors were selected from E. coli strain DH10B based on chloramphenicol resistance, and plasmid DNA was isolated using a plasmid minipreparation kit (Fermentas Inc., Glen Burnie, Md.). Plasmids were analyzed by restriction analysis with HindIII and BsrGI, and the correct sequence of the intron was verified by sequencing using the primer pMTL007-R1 (SEQ ID NO: 25) (Table 1). The sequencing primer was purchased from Integrated DNA Technologies, Inc. (Coralville, Iowa). Sequencing reactions were performed using an ABI PRISM BigDye Cycle Sequencing Ready Reaction kit (Applied Biosystems, Foster City, Calif.) then purified according to manufacturer's instructions, and analyzed at the University of Wisconsin Biotechnology Center. The nucleotide sequences were aligned and analyzed with sequence analysis software VectorNTI (Invitrogen, Carlsbad, Calif.).

Plasmid DNA from one of the clones containing the correct intron sequence for targeting each BoNT gene was named pMTL007C-E2:Cbo:bont/A-580s (bont/A3), pMTL007CE2: Cbo:bont/bvB-381s (bont/bvB), and pMTL007C-E2:Cbo:bont/npB-420s (bont/npB) and was transformed into the E. coli conjugation donor strain CA434. Plasmids pMTL007C-E2:Cbo:bont/A-580s, pMTL007CE2: Cbo:bont/bvB-381s, and pMTL007C-E2:Cbo:bont/npB-420s were transferred to C. botulinum strains CDC-A3, 657Ba and Eklund 17B, respectively, by conjugation from E. coli donor strain CA434 as previously described (Heap et al. 2007).

After mating, the bacterial mixture was scraped off of the mating plates, resuspended in 1× PBS (phosphate buffered saline), serially diluted and spread plated onto TYG agar supplemented with cycloserine, sulfamethoxazole (selection of C. botulinum) and thiamphenicol (selection for the vectors). Thiamphenicol resistant colonies were purified by restreaking onto fresh TYG agar supplemented with thiamphenicol. Individual colonies were re-suspended in 1× PBS, serially diluted and plated onto TYG agar containing erythromycin to select for the presence of the spliced Erm-RAM indicating intron integration.

Erythromycin resistant colonies were re-streaked onto fresh TYG agar containing erythromycin. Erythromycin resistant clones were replica plated onto TYG containing thiamphenicol to verify plasmid loss by a thiamphenicol sensitive phenotype. Chromosomal DNA was isolated from randomly selected erythromycin resistant, thiamphenicol sensitive clones as well as from wild type C. botulinum strains using the ChargeSwitch gDNA kit (Invitrogen, Carlsbad, Calif.) following the manufacturer's instructions.

Screening of the clones was performed by PCR using the gene specific primers A3KMCT1 (SEQ ID NO: 15), A3KMCT2 (SEQ ID NO: 16) (bont/A3), BVBFCT4 (SEQ ID NO: 17), BVBRCT4 (SEQ ID NO: 18) (bont/bvB), and NPBFCT11 (SEQ ID NO: 19), NPBRCT11 (SEQ ID NO: 20) (bont/npB) (Table 1) designed to anneal to regions flanking the site of intron integration. PCR was performed with AmpliTaq High Fidelity DNA polymerase, buffer and dNTPs (Applied Biosystems, Foster City, Calif.) using a GeneAmp PCR System 9700 (Applied Biosystems) according to manufacturer's instructions. PCR primers were purchased from Integrated DNA Technologies, Inc. (Coralville, Iowa). PCR products were visualized on 1% Trisacetate-EDTA gels, stained with ethidium bromide and photographed using a Gel Imaging System (BioRad, Hercules, Calif.) with UV transillumination. PCR products were purified using a PCR purification kit (Qiagen, Valencia, Calif.) according to manufacturer's instructions.

The nucleotide sequences of the PCR fragments generated from the wild type and the transconjugant clones were determined using the same primers as for the amplification of the DNA fragments (Table 1). The nucleotide sequences were analyzed as described above.

Tn916 Mutagenesis. C. botulinum strain Hall A-hyper was chosen for Tn916 mutagenesis to generate tetracycline-resistant strains. The genome sequence of Hall A-hyper is known (GenBank Acc: CP000727). This strain does not contain any plasmids. Tn916 mutant clones of Hall A-hyper were generated using the methods for Tn916 mutagenesis (Lin et al. 1991). This strain containing a tetracycline resistance marker was used as an alternative recipient in the bacterial mating experiments with donors CDC-A3 and 657Ba.

Mating experiments. Donor and recipient strains were inoculated into TPGY broth from frozen stocks and incubated anaerobically overnight. The strains were subcultured into TPGY containing 2.5 μg/ml erythromycin (donors) and 10 μg/ml tetracycline (recipients). The donors and recipients were passed again in TPGY broth supplemented with antibiotics and incubated anaerobically for 12 h. Each strain was serially diluted to approximately 104 to 105 CFU/ml in TPGY broth and incubated until an OD600 nm of 0.6 to 0.8. Matings between donors and recipients were performed on solid nonselective 4% TYG agar. Three different donor to recipient ratios (5:1, 1:1 and 1:5) were tested. Aliquots of 1 ml or 200 μl of donor (D) and recipient (R) cells were centrifuged at 3,000×g for 5 min and resuspended in 200 μl of recipient or donor cells, respectively, and spread plated onto 4% TYG agar. The mating plates were incubated right side up for 12 h at 37° C. or 30° C., depending on the optimal growth temperature of the donor cells. Separate plates spread plated with 200 μl of donor and recipient cells were also included as controls. Sensitivity of plasmid transfer to DNaseI was tested by treating 1 μl of donor cells with DNaseI (100 μg/ml) in a buffer containing 20 mM Tris-HCl, pH 7.5, 1 mM MgCl2 and 1 mM MgSO4 for 37° C. for 60 minutes (Neve et al. 1984). On the nonselective agar plate 25 ml of DNaseI (10 mg/ml) and 50 μl of 50 mM MgSO4 were added, spread evenly and the plates were incubated at room temperature for 60 minutes. Donor cells incubated for 60 min with DNaseI, were spun down at 3,000×g for 5 min. The supernatant was discarded and the cell pellet was re-suspended in 200 μl of the recipient strain. DNaseI (100 μg/ml) and 1 mM MgSO4 were added to the cell mixture and the cells were spread plated onto the TYG agar supplemented with DNaseI and MgSO4. The plates were incubated at 37° C. for 12 h.

Mating experiments were also performed by separating the donor and recipient cells with a 0.45 μm nitrocellulose membrane to determine if cell-to-cell contact is required for plasmid transfer. In these experiments 200 μl of the donor cell suspensions were spotted in the middle of the plate and spread slightly, and plates incubated until all moisture was absorbed. Then nitrocellulose membrane was placed on top of the donor cells, the plates incubated until the membrane completely adhered to the agar, followed by spreading the recipient cells in the middle of the membrane. The mating plates were incubated right side up for 12 hours at 37° C. or 30° C. The recipient cells were then scraped off the surface of the membrane using cell scrapers, the cells were resuspended in the PBS and plated on selective plates.

To assess the possible involvement of bacteriophages in plasmid transfer, donor cell cultures were passed through a 0.45 μm filter (Millipore) and mixed 1:1 with the recipient cell culture (Blaiotta et al. 2000). CaCl2 (1 mM) was added and the mixture was incubated for 12 h at 37° C.

Following matings, the controls and mating mixtures were scraped off of the TYG agar plates and re-suspended in 3 ml of sterile 1×PBS, serially diluted and plated in duplicate on TYG agar supplemented with tetracycline and erythromycin for selection of the transconjugants. Serial dilutions were also spread plated onto TYG supplemented with tetracycline for enumeration of recipients and transconjugants and TYG containing erythromycin for enumeration of donors and transconjugants. The plates were incubated anaerobically for three days at 30° C. or 37° C. The plasmid transfer frequency was calculated as the number of transconjugants per number of donor cells in matings in which the number of donors was greater than the number of recipients. Transfer frequencies were calculated as the number of transconjugants per number of recipient cells when the recipient counts were greater than the donor cell counts.

Colonies resistant to both tetracycline and erythromycin were re-streaked for isolation onto fresh TYG agar supplemented with tetracycline and erythromycin and kept for further analysis.

Pulsed-field gel electrophoresis. Confirmation of plasmid transfer was performed by pulsed-field gel electrophoresis (PFGE) of nondigested and digested DNA of the transconjugant, donor and recipient strains. C. botulinum strains were inoculated into 10 ml of TPGY and incubated anaerobically at 37° C. (proteolytic strains) or 30° C. (nonproteolytic strains) to an optical density at 600 nm (OD600) of 0.6. One milliliter of formaldehyde (Fisher Scientific, Hampton, N.H.) was added, and the cultures were placed on ice for 15 to 30 minutes to inhibit nuclease activity. PFGE plugs were prepared (Johnson et al. 2005).

To increase the visualization of plasmids, pBotCDC-A3-Erm, pCLJ-Erm and pCLL-Erm in the LNT01 transconjugant clones, restriction digests of PFGE plugs were performed using restriction endonucleases chosen to linearize each plasmid. The nucleotide sequences of each plasmid were analyzed using VectorNTI version 10.3 (Invitrogen, Carlsbad, Calif.) and a rare cutting restriction enzyme that cleaves the plasmid once was selected. Restriction enzymes SmaI, XhoI and NarI (New England Biolabs) were selected to digest the PFGE plugs of LNT01 transconjugants to assess the presence of plasmids pBotCDC-A3-Erm, pCLJ-Erm and pCLLErm, respectively. Restriction digests of the PFGE plugs were performed according to the manufacturer's instructions (New England Biolabs). Two sets of nondigested and digested DNA samples were loaded on the same gel and DNA samples were separated by PFGE in a clamped homogenous electric field system (CHEF-DRII; Bio-Rad, Hercules Calif.). After the DNA was transferred onto the nylon membrane, the filter was cut in half, and each portion contained one set of undigested and digested DNA samples. One membrane was hybridized with a neurotoxin gene specific probe, while the other with an erythromycin gene probe.

Southern Hybridizations. Primers for generation of hybridization probes for ermB (ErmF and ErmR; SEQ ID NOs: 23 and 24 respectively); bont/A3 (A3KMCT1 and A3KMCT2; SEQ ID NOs: 15 and 16 respectively); bont/bvB and bont/npB (AnyB-F and AnyB-R) are listed in Table 1. These gene probes were generated by PCR amplification with an AmpliTaq High Fidelity DNA polymerase, buffer and dNTPs (Applied Biosystems, Foster City, Calif.) using a GeneAmp PCR System 9700 (Applied Biosystems) according to the manufacturer's instructions. The PCR products were purified from agarose gels using the Qiagen gel extraction kit (Qiagen, Valencia, Calif.), and were radioactively labeled with [α-32P] ATP using the Megaprime DNA labeling system (GE Healthcare Bio-Sciences, Piscataway, N.J.).

The DNA samples separated by PFGE were transferred to a positively charged nylon membrane (Immobilon-NY+, Millipore, Bedford, Mass.) overnight by downward capillary transfer in 0.4 M NaOH, 1.5 M NaCl. The membranes were neutralized in 2 M Tris-HCl, pH 7.0 for 15 minutes, rinsed with 2×SSC (3M NaCl, 0.3M sodium citrate) and fixed at 80° C. for 30 minutes under vacuum.

Hybridizations were performed at 42° C. for 16 h in a solution containing 5× Denhardt's Solution, 6×SSPE, 50% formamide, 0.1% SDS, 100 μg/ml herring sperm DNA (Promega, Madison, Wis.) and 32P-labeled probes at approximately 2×106 cpm/ml. All hybridization solutions and buffers were prepared according to standard protocols (Sambrook et al. 2001). After hybridizations the membranes were washed twice with 2×SSPE, 0.1% SDS for 5 min each at room temperature and twice with 0.1×SSPE, 0.1% SDS for 30 min each at 42° C. Autoradiography of the membranes was performed for 6-24 h at −70° C. using Kodak BioMax MS film with a BioMax intensifying screen (Eastman Kodak, Rochester, N.Y.).

Plasmid Alignments. Plasmid sequence alignments were performed to determine the relatedness of the plasmid pCLL (SEQ ID NO: 3) [Acc. No. CP001057] in C. botulinum strain Eklund 17B to plasmids, pCP13 (SEQ ID NO: 26) [Acc. No. AP003515] of C. perfringens strain 13, pCW3 (SEQ ID NO: 27) [Acc No. DQ366035] of C. perfringens strain CW92, pCP8533etx (SEQ ID NO: 28) [Acc. No. AB444205] of C. perfringens strain NCTC8533B4D, and two contigs, gcontig1108490430999 (SEQ ID NO: 29) [Acc. No. AB0001000010.1] and gcontig1108490430283 (SEQ ID NO: 30) [Acc. No AB0001000017] of C. perfringens type D strain JGS 1721. Plasmid sequence files with annotations were obtained from NCBI. Plasmid alignments were conducted using progressive alignment option of Mauve 2.3.1 (Darling et al. 2004) with the default settings. Plasmid alignments were generated using the Mauve alignment viewer, which illustrates locally collinear blocks (LCBs) as regions without rearrangements in the homologous backbone sequence. LCBs below a plasmid's center line represent the reverse complement orientation relative to the reference genome (pCP13, FIG. 8; pCLL, FIG. 9). Sequence similarity plots are displayed in the LCBs, and the height of the sequence identity plot reflects the average column entropy for the region of the respective alignment. The NCBI blastp tool was used to compare the amino acid sequences of the pCLL ORFs with ORFs in C. perfringens strains.

Plasmid tagging using ClosTron. The neurotoxin genes, bont/A3 of plasmid pBotCDC-A3 (strain CDC-A3), bont/bvB of plasmid pCLJ (657Ba), and bont/npB of plasmid pCLL (strain Eklund 17B) were insertionally inactivated using the ClosTron mutagenesis system (Heap et al. 2007; Heap et al. 2010). The potential intron target sites within each neurotoxin gene were identified using the computer algorithm at the group II intron (TargeTron) design site provided by Sigma-Aldrich (St. Louis, Mo.). The target sites chosen for bont/A3, bont/bvB and bont/npB were between nucleotides 580 and 581, 381 and 382, and 420 and 421 on the sense strands, respectively. Each re-targeted intron was amplified by PCR and cloned into the ClosTron vector pMTL007C-E2 between restriction sites HindIII and BsrGI (Heap et al. 2010) resulting in constructs, pMTL007C-E2:Cbo:bont/A-580s, pMTL007CE2: Cbo:bont/bvB-381s, and pMTL007C-E2:Cbo:bont/npB-420s. The constructs were transferred to their respective wild-type strains CDC-A3, 657Ba and Eklund 17B by conjugation from the E. coli donor strain CA434.

Following matings, the cells were plated onto agar containing thiamphenicol to select for C. botulinum clones harboring the ClosTron vector. Thiamphenicol-resistant transconjugants of C. botulinum containing the ClosTron vector were then plated onto agar supplemented with erythromycin for selection of intron integrants, since the erythromycin resistance gene is restored upon integration of the group II intron (Heap et al. 2007; Heap et al. 2010). Next, erythromycin-resistant clones were screened for the loss of the intron vector by replica plating, then erythromycin-resistant and thiamphenicol-sensitive clones were selected and further analyzed by PCR to determine whether the intron had integrated into its desired target site. The gene specific PCR primers (Table 1) were designed to anneal to regions flanking the insertion site for each neurotoxin gene in order to amplify the entire insertion element.

Insertion of the re-targeted introns into either the bont/A3, bont/bvB or bont/npB genes was confirmed by PCR analysis (FIG. 1). PCR amplification of the DNA from the wild type CDCA3 strain using the bont/A3 gene specific primers A3KMCT1 (SEQ ID NO:15) and A3KMCT2 (SEQ ID NO: 16) produced a PCR product of 1,264 by (FIG. 1, Lane 1), whereas a DNA fragment of 3,044 by was observed in the CDCA3 transconjugant clones analyzed (FIG. 1, Lanes 2 and 3), indicating integration of the intron element (approximately 1.8 kb) into the target gene. Similarly, amplification of the 657Ba and Eklund 17B transconjugant clones (FIG. 1, Lanes 5 and 6, and Lanes 8 and 9, respectively) using bont/bvB and bont/npB gene specific primers yielded expected PCR products that exhibited an approximately 1.8 kb increase in size compared to the PCR fragments generated from the wild type 657Ba (FIG. 1, Lane 4) and Eklund 17B (FIG. 1, Lane 7). These results confirmed that the re-targeted introns containing the erythromycin resistance determinant ermB were inserted into the bont/bvB and bont/npb (FIG. 1). Furthermore, the PCR fragments amplified from the tagged BoNT-encoding plasmids were sequenced and it was confirmed that the introns had inserted correctly into the chosen target sites within the neurotoxin genes in all three plasmids.

To verify that the plasmids were tagged, pulsed-field gel electrophoresis (PFGE) of nondigested DNA samples from the wild type strains CDC-A3, 657Ba and Eklund 17B, and the clones carrying the tagged plasmids pBotCDC-A3-Erm, pCLJ-Erm and pCLL-Erm, was performed followed by Southern hybridization analyses using probes specific to ermB and the respective neurotoxin genes. Hybridization signals were observed with the plasmid bands in all strains using the neurotoxin gene probes (FIG. 2). Hybridization of the ermB probe was detected with the tagged plasmid clones but not with the wild type strains, indicating that the plasmids were successfully tagged with the ErmB-RAM. The resultant strains with their tagged plasmids CDC-A3580s1 (pBotCDC-A3-Erm), 657BaCT4 (pCLJ-Erm) and Eklund 17BCT11 (pCLL-Erm) were used as the donors in the mating experiments.

Plasmid transfer was confirmed by pulsed-field gel electrophoresis of digested DNA of transconjugant and wild type C. botulinum strains. C. botulinum strains were inoculated into 10 ml of TPGY and incubated anaerobically at 37° C. (proteolytic strains) or 30° C. (nonproteolytic strains) to an optical density at 600 nm (OD600) of 0.6. One milliliter of formaldehyde (Fisher Scientific) was added and the cultures were placed on ice for 15 to 30 minutes to inhibit nuclease activity and PFGE plugs were prepared (Johnson et al. 2005).

To increase the visualization of virulence plasmids, pCLK-Erm, pCLJ-Erm, and pCLL-Erm in the LNT01 transconjugant clones restriction digests of PFGE plugs were performed using restriction endonucleases chosen to linearize each plasmid. The nucleotide sequences of each plasmid were analyzed using VectorNTI version 10.3 (Invitrogen, Carlsbad, Calif.) and a rare cutting restriction enzyme that cleaves the plasmid once was selected. Restriction enzymes SmaI and XhoI (New England Biolabs), were selected to digest the PFGE plugs of LNT01 transconjugants to assess the presence of plasmids pCLK-Erm and pCLJ-Erm, respectively. Plasmid pCLL is quite smaller (approximately 48 kb) than pCLK and pCLJ, and finding an enzyme that only linearizes the plasmid without over digestion of the chromosome was challenging. Based on the nucleotide sequence of pCLL, the restriction enzyme NarI was chosen. Restriction digests of the PFGE plugs was performed according to the manufacturer's instructions (New England Biolabs). The digested DNA samples were separated by PFGE in a clamped homogenous electric field system (CHEF-DRII; Bio-Rad, Hercules Calif.).

PFGE plugs were prepared for several LNT01 transconjugants that were obtained from each mating experiment to confirm the transfer of each virulence plasmid to the recipient C. botulinum strain LNT01. The PFGE plugs were digested with restriction enzymes designed to linearize each plasmid so that it could be easily visualized in the ethidium bromide stained gel. PFGE analysis of the LNT01 transconjugants from all three separate matings is shown in FIG. 1. Each bacterial strain exhibits a unique restriction banding pattern when digested with a particular restriction enzyme. Digestion of PFGE plugs of LNT01, CDC-A3580s1, 657BaCT4-2 and Eklund 17BCT11-1 all exhibit unique restriction banding patterns when digested with SmaI, XhoI or NarI (FIG. 3). The restriction banding pattern of wild type LNT01 when digested with SmaI was identical to that of the transconjugants except that the banding pattern of all transconjugant clones contained an approximately 270 kb DNA band corresponding to the presence of pCLK-Erm (FIG. 3A). The presence of pCLJ-Erm was revealed as a approximately 270 kb DNA band in the transconjugant LNT01 clones, which exhibited restriction banding patterns that were otherwise identical to LNT01 (FIG. 3B). To separate the DNA fragments in the approximately 48 kb range, the gel loaded with the DNA samples of wild-type LNT01, Eklund 17BCT11-1 and the LNT01 transconjugant clones being analyzed for the presence of pCLL-Erm, was electrophoresed with a pulse-time of 1-5 s. Under these conditions the presence of pCLL-Erm migrating to a position in the gel corresponding to its approximate linear size of approximately 48 kb in the DNA samples of the LNT01 transconjugant clones was clearly observed. This analysis confirmed the transfer of plasmid pCLL-Erm from a nonproteolytic C. botulinum serotype B strain to a proteolytic C. botulinum nontoxigenic Tn916 mutant subtype A1 strain LNT01.

Mating experiments. Separate mixed plate matings between each donor strain, CDCA3580s1 (pBotCDC-A3-Erm), 657BaCT4 (pCLJ-Erm), and Eklund 17BCT11 (pCLL-Erm) and recipient strains LNT01 and Hall A-hyper/Tn916 mutant were performed inside an anaerobic chamber on solid 4% agar TYG media for 12 h. Initially, strain LNT01 was used as the recipient to determine if plasmids pBotCDC-A3-Erm, pCLJ-Erm, and pCLL-Erm could be transferred to a recipient C. botulinum strain. Several mating experiments were performed to optimize the mating conditions to establish the transfer frequencies. Since similar transfer frequencies were observed when matings were performed for 12 or 24 h (data not shown); all subsequent bacterial mating experiments were incubated for 12 h. The mating pairs between proteolytic strains were performed at their optimal growth temperature of 37° C. Matings of the nonproteolytic serotype B donor strain Eklund 17BCT11 and the recipient strain LNT01 were performed at 30° C., which is the optimal growth temperature for nonproteolytic C. botulinum strains, since higher transfer frequencies were observed at this temperature (data not shown). Three different donor to recipient ratios (5:1, 1:1 and 1:5) were tested, the donor:recipient (D:R) ratio of 1:1 yielded the highest transfer frequencies. After the mating conditions were established in LNT01 the same experimental parameters were used to evaluate the transfer frequencies of C. botulinum plasmids into C. botulinum strain Hall A-hyper/Tn916 mutant.

Transconjugants were selected by plating the mating mixtures onto TYG agar supplemented with erythromycin (selection of Erm-plasmid) and tetracycline (selection of recipient strain LNT01 or Hall A-hyper/Tn916. To determine the number of donors and recipients the mating mixtures were also plated onto TYG containing either erythromycin (donors) or tetracycline (recipients). The number of donor cells and recipients varied with respect to the mating pairs (Table 2). The transfer frequency was calculated as the number of transconjugants per recipient or donor depending on which strain had the highest CFU/ml.

The transfer frequency values are displayed in Table 2. Overall, the plasmid transfer frequencies were lower than those reported for plasmids found in strains of C. perfringens (Hughes et al. 2007; Rood et al. 1978; Brynestad et al. 2001). The conjugation frequencies for pBotCDC-A3-Erm and of pCLJ-Erm increased markedly when Hall A-hyper/Tn916 was used as the recipient. Similar conjugation frequencies of plasmid pCLL from the nonproteolytic strain Eklund 17B were observed when either strain LNT01 or Hall A-hyper/Tn916 was used as recipient (Table 2). In one embodiment, D:R ratios of 1:1, 5:1 and 1:5 were tested to determine the optimum ratio for plasmid transfer. A slight increase in the conjugation frequency was observed when a ratio of 1:1 was used over the ratio of 5:1. When a D:R ratio of 1:5 was used a significant decrease in the number of transconjugants was observed. An approximately 4-log reduction in the number of CFU/ml of donors CDC-A3580s1 and 657BaCT4-2 was observed during matings with LNT01.

TABLE 2
Transfer of C. botulinum BoNT-encoding plasmids
to recipient strains LNT01 and Hall A-hyper/Tn916.
Recipient Recipient (Hall
Donor Plasmid (LNTO1) A-hyper/Tn916)
CDC A3580 pBotCDC A3 1.5 × 10−8 ± 1.8 × 10−6 ±
Erm 1.2 × 10−8a 9.4 × 10−7b
657Ba-CT4 pCLJ-Erm 1.4 × 10−6 ± 1.7 × 10−5 ±
1.1 × 10−6a 1.2 × 10−5a
Eklund pCLL-Erm 1.5 × 10−7 ± 4.5 × 10−7 ±
17BCT11 1.4 × 10−7a 2.8 × 10−7a
Transfer frequencies were calculated as the number of tranconjugants per arecipient or bdonor and are reported as the averages of at least three replicate experiments.

Pre-incubation of the donor cells with DNaseI, by combined addition of DNaseI to the agar medium and to the mating mixtures did not inhibit plasmid transfer, and the transfer frequencies were similar to that of matings in which DNaseI was not added. Furthermore, no transductants were obtained in matings performed with the filtered culture supernatants of each donor strain and the whole cell culture of the recipient strain LNT01. Importantly, no transconjugants were obtained when matings were performed in which the donors and recipients were separated by a 0.45 μm nitrocellulose membrane.

Confirmation of BoNT-encoding plasmid transfer. PFGE was performed using nondigested samples and samples digested with restriction enzymes designed to linearize each BoNTencoding plasmid. PFGE analysis of digested samples allowed us to use the unique restriction banding patterns of the strains as a genetic screen to visually determine whether the plasmids were transferred to the recipient strains. PFGE analyses of the recipient LNT01, donor strains and LNT01 transconjugants from three separate matings are shown in FIGS. 4-6. LNT01 (recipient), wild type and plasmid-tagged donor strains, and three clones of each transconjugants all exhibited unique restriction banding patterns when digested with SmaI, XhoI or NarI. PFGE followed by Southern hybridization analyses using the ermB probe (intron probe) and the appropriate neurotoxin gene probes showed that the tagged plasmids were transferred to the recipient strains (FIGS. 4-6).

Transfer of pBotCDC-A3-Erm from CDC-A3 (donor) to LNT01 (recipient) is shown in FIG. 4. When PFGE is performed on nondigested C. botulinum DNA samples most of the DNA remains trapped in the wells because large circular DNA molecules that are nicked or enzymatically relaxed fail to enter the gel matrix (Beverley 1988). Linear forms of plasmids are able to migrate through the gel to a position which corresponds to their linear size relative to a reference marker (Beverley 1988). In addition, a small portion of sheared chromosomal DNA migrating a short distance from the well position is frequently observed in PFGE analysis of nondigested clostridial DNA (Marshall et al. 2007). The DNA restriction banding pattern of the wild type strain LNT01 (FIG. 4, lane 7A) digested with SmaI was identical to that of the transconjugants (FIG. 4, lanes 10-12A), except that the banding pattern of all transconjugants clones contained an additional band of approximately 270 kb. This band corresponds by size to the plasmid, pCDC-A3-Erm in the donor strain (FIG. 4A, lanes 2, 3 and 8, 9). This approximately 270 kb band was observed in digested (FIG. 4, lanes 10-12) and nondigested (FIG. 4, lanes 4-6) samples of the transconjugants hybridized with both bont/A3 (FIG. 4C, lanes 4-6, 10-12) and ermB probes (FIG. 4B, lanes 4-6, 10-12). These results confirmed the transfer of the tagged plasmid containing the intron interrupted bont/A3 gene. The same plasmid band in the donor strains hybridized with the bont/A3 probe (FIG. 4C, lanes 2, 3, 8, 9), but only the tagged donor hybridized with the ermB probe (FIG. 4B, lanes 3 and 9). No hybridization signals were detected with either probe in the recipient strain LNT01. PFGE of digested samples of the transconjugant and donor strains (FIG. 4A, lanes 8-12) showed an increase in the intensity of the approximately 270 kb band in the ethidium bromide stained gel as well as produced stronger hybridization signals with the neurotoxin gene (FIG. 4C, lanes 8-12) and ermB (FIG. 4B, lanes 9-12) probes, while the hybridization signals at the well positions decreased. This indicated that the plasmid was linearized by the restriction enzyme and migrated into the gel.

Similarly, transfer of the approximately 270 kb plasmid, pCLJ-Erm, from the donor strain 657BaCT4 to LNT01 (FIG. 5), and the approximately 48 kb plasmid, pCLL from Eklund 17BCT11 to LNT01 was confirmed (FIG. 6). Furthermore, transfer of plasmids pBotCDC-A3-Erm, and pCLJ-Erm to Hall A-hyper/Tn916 was also confirmed by PFGE and Southern hybridization analyses (FIG. 7).

Plasmid Alignments. The genome alignment tool Mauve (Darling et al. 2004) was used to generate global alignments of C. botulinum plasmid pCLL (SEQ ID NO:3) (strain Eklund 17B) and C. perfringens plasmid pCP13 (SEQ ID NO: 26) (strain 13). Alignment of plasmids pCLL and pCP13 (FIG. 8) revealed 16 locally collinear blocks (LCBs) A3 probe (FIG. 8C: lanes 2, 3, 8, 9), with at least some portion of them found in pCP13. The LCB shown (FIG. 8) encompassed a region of 110RFs which exhibited the highest degree of sequence homology with similar ORFs found on plasmid pCP13. The Mauve program was also used to generate global alignments of pCLL and C. perfringens plasmids pCW3 (SEQ ID NO: 27), pCP8533etx (SEQ ID NO: 28), and two contigs of C. perfringens type D strain JGS1721 (gcontig1108490430283 [SEQ ID NO: 30] and gcontig1108490430999 [SEQ ID NO: 29]). The alignments revealed several locally collinear blocks (LCBs) with at least some portion of them found in the C. perfringens plasmids (FIG. 9). Two neighboring LCBs shown were of particular interest because they shared homology with the conjugative C. perfringens plasmids. The region that contained the tcp locus common to C. perfringens conjugative plasmids is represented by the LCB (FIG. 9). The corresponding LCB observed in pCLL shares some sequence homology with this region as indicated in FIG. 9, however this region is truncated. The LCB of plasmid pCLL contains a gene that encodes for a putative type IV secretion system protein VirD4 (pCLL 0005). Comparison of homologous ORFs of pCLL and C. perfringens plasmids is presented in Table 3.

TABLE 3
Comparison of predicted ORFs of pCLL with plasmids of C. perfringens.
Funciton of closest C.
Putative Function of perfringens relative of gene Size Coding Sequence
pCLL Locus pCLL gene product product, strain and/or identity (aa) position
pCLL_0004 Hypothetical protein Hypothetical protein, C. 78 717-953
perfringens pCP13, PCP53, and
conserved hypothetical, C.
perfringens E str. JGS1987,
CPC_A0335, 53/78 (67%)
pCLL_0005 VirD4 component TraG/TraD family, C. perfringens 739 1017-3236
D str. JGS1721, CJD_A0258,
383/747 (51%)
pCLL_0006 Hypothetical protein Putative membrane protein, C. 711 3241-5376
perfringens C str. JGS1495,
CPC_A0332, 162/353 (45%),
hypothetical protein C. perfringens
pCP13, PCP50, 162/353 (45%)
pCLL_0007 Hypothetical protein Hypothetical protein, C. 91 5377-5652
perfringens pCP13, PCP49, 47/87
(54%)
pCLL_0008 Hypothetical protein Hypothetical protein, C. 138 5764-6402
perfringens pCP13, PCP48, 66/124
(53%)
pCLL_0009 Hypothetical protein Conserved hypothetical, C. 637 6458-8371
perfringens C str. JGS1495,
CPC_A0328, 406/627 (64%)
pCLL_0010 Hypothetical protein Hypothetical protein, C. 167 8373-9053
perfringens pCP13, PCP45, 55/161
(34%)
pCLL_0011 Probable cell wall- Probable cell wall-binding protein, 389  9114-10283
binding protein C. perfringens E str. JGS1987,
AC3_A0050, 224/370 (60%),
TcpG, C. perfringens C str.
JGS1495, CPC_A0146, 83/134
(61%)
pCLL_0012 Hypothetical protein Conserved hypothetical protein, C. 270 10302-11114
perfringens D str. JGS1721,
CJD_1944, 106/267 (39%)
pCLL_0013 Hypothetical protein Conserved hypothetical protein, C. 91 11397-11672
perfringens C str. JGS1495,
CPC_A0323, 42/82 (51%)
pCLL_0014 Hypothetical protein Conserved hypothetical protein, C. 136 11678-12088
perfringens D str. JGS1721,
CJD_A0233, 48/123 (39%)
pCLL_0015 Hypothetical protein Conserved hypothetical protein, C. 379 12102-13241
perfringens C str. JGS1495,
CPC_A0321, 200/377 (53%)
pCLL_0016 Hypothetical protein Conserved hypothetical protein, C. 365 13267-14388
perfringens D str. JGS1721,
CJD_A0227, 55/116 (47%)
pCLL_0017 Conserved Hypothetical protein, C. 171 14453-14968
hypothetical protein perfringens str. 13 pCP13, PCP34,
31/74 (41%)
pCLL_0040 Resolvase/recombinase Resolvase/Recombinase, C. 210 33462-34094
perfringens D str. JGS 1721,
CJD_1891,78/210 (37%)
pCLL_0042 Site-specific DNA-invertase, C. perfringens CPE 181 34265-34810
recombinase resolvase str. F4969, AC5_A0225, 80/191
family (41%)
pCLL_0045 Replication protein Replication protein, C. perfringens 446 35980-37320
B str. ATCC 3626, AC1_A0161,
164/388 (42%)
pCLL_0047 Putative ATPase Putative ATPase, C. perfringens E 297 38545-39438
str. JGS1987, AC3_0198, 145/302
(48%)
pCLL_0048 Hypothetical protein Hypothetical protein, C. 119 37431-39790
perfringens E str. JGS1987,
AC3_0197, 21/41 (51%)
pCLL_0051 Putative LexA LexA represser, C. perfringens B 235 40570-41277
represser str. ATCC 3626, AC1_A0290,
34/78 (43%)
pCLL_0053 Hypothetical protein Conserved hypothetical protein, C. 120 41747-42109
perfringens B str. ATCC 3626
AC1_A0334, 33/105 (31%)
pCLL_0056 Cell wall binding Cell wall binding repeat domain 152 42953-47533
repeat domain protein protein, C. perfringens D str.
JGS1721, CJD_0682, 83/183
(45%)

The numbering for the coding sequence position starts at position 1. There are total of 56 ORFs in the pCLL plasmid, but only those that showed homology with C. perfringens ORFs are listed in Table 3. Any protein sequences for these ORFs are available from GenBank (http://www.ncbi.nlm.nih.gov.ezproxy/nuccore/CP001057).

Results. The present invention provides BoNT-encoding plasmids capable of conjugatively transferring genetic information of interest among other Clostridium species (where the plasmid is from the same Clostridium species, as well as where the plasmid is from different Clostridium species). Mating experiments were conducted between Clostridium species harboring a BoNT-encoding plasmid and a nontoxigenic C. botulinum strain LNT01 as the recipient. Plasmids from C. botulinum strains CDC-A3 and 657Ba, plasmids pBotCDC-A3 (267 kb) and pCLJ (270 kb), respectively, were selected to represent proteolytic Clostridium species. Plasmid pCLL (48 kb) from C. botulinum serotype B, strain Eklund 17B was selected as a representative of nonproteolytic Clostridium species. The recipient strain LNT01 was selected because it is nontoxigenic, and it contains a tetracycline resistance marker due to presence of the transposon Tn916 on the genome.

To ascertain transfer of the plasmids from the donor Clostridium species to the recipient Clostridium species, the plasmids were tagged with an antibiotic resistant gene, wherein the antibiotic resistant gene confers resistance to antibiotics selected from the group consisting of erythromycin, tetracycline, chloramphenicol or thiamphenicol. While any antibiotic resistant gene may be used, the present examples used the erythromycin resistance gene via the ClosTron mutagenesis system. The antibiotic resistance gene inserted on the plasmids is required only to track the plasmid transfer from the donor Clostridium species to the recipient Clostridium species, and is not required for plasmid maintenance in the recipient Clostridium species. The example above demonstrates that positive selection of transconjugants was facilitated by the presence of the tetracycline resistance determinant in combination with erythromycin resistance provided by the tagged plasmids.

Discussion. Early studies attempting to demonstrate plasmid-associated BoNT genes were unsuccessful, except for discovery of the plasmid-borne BoNT/G gene (Zhou et al. 1995). The recent finding of plasmids in C. botulinum serotypes A and B housing BoNT/A, BoNT/B or both BoNT/A and BoNT/B genes (Marshall et al. 2007; Smith et al. 2007) prompted surveys of serotype B strains (Franciosa et al. 2009; Umeda et al. 2009) and dual neurotoxin C. botulinum strains producing subtypes Bf, Af and Ab BoNTs (Marshall 2009; Franciosa et al. 2009). These studies have invigorated interest in the field of plasmid biology in C. botulinum. The present invention demonstrates that plasmids encoding BoNTs can be transferred to other Clostridium species.

Specifically, the present invention therefore provides BoNT-encoding plasmids (such as pBotCDC-A3 and pCLJ from two proteolytic Clostridium species), and pCLL from a nonproteolytic Clostridium species, to other proteolytic Clostridium species, providing a novel conjugatively transferable plasmid capable of transferring BoNT-encoding plasmids to other recipient Clostridium species. Transductants were not obtained when the recipient cells were incubated with filtered donor culture supernatants, demonstrating that bacteriophages were not involved in BoNT gene transfer. Furthermore, since BoNT gene transfer was not inhibited by the addition of DNaseI, and no transconjugants were obtained during matings in which the donor and recipient cells were separated by a 0.45 μm filter, cell-to-cell contact is required for the transfer of these plasmids (demonstrating that plasmid transfer across Clostridium species is likely due to conjugation or a conjugation-like mechanism rather than by transformation).

Previously, C. perfringens was the only Clostridium described to harbor plasmids capable of intraspecies conjugative transfer (Hughes et al. 2007; Rood et al. 1978; Byrnestad et al. 2001; Rood et al. 2004; Bannam et al. 2006). Here, conjugative transfer of plasmid pCLL from the nonproteolytic C. botulinum serotype B strain Eklund 17B to a proteolytic C. botulinum strain supports interspecies transfer since proteolytic and nonproteolytic groups have long been considered to comprise different Clostridium species based on different genomic, genotypic and phenotypic characteristics (Carter et al. 2009; Peck et al. 2009).

Intraspecies conjugal transfer of plasmids in C. perfringens has been reported to be a highly efficient process with conjugation frequencies of 10−1 to 10−2 transconjugants per donor (Hughes et al. 2007; Rood et al. 1978; Byrnestad et al. 2001). Conversely, the conjugation frequencies for the C. botulinum plasmids tested in this study were much lower ranging from 10−5 to 10−8 (Table 2). C. botulinum strain LNT01 was initially selected as a recipient, since it is nontoxigenic and contained the tetracycline resistance marker for positive selection of transconjugants. Although each of the plasmids was successfully transferred to LNT01, we observed a decrease in the number of donor cells during matings. For example, an approximately 4-log reduction in the number of CFU/ml of donors CDC-A3580s1 and 657BaCT4-2 was observed during matings with LNT01. A possible explanation may be that strain LNT01 produces a bacteriocin (unpublished data) that could inhibit the growth or kill the donor cells. C. perfringens strain F4969 was also reported to produce a bacteriocin which interfered with the transfer of plasmid pMRS4969 from this strain to the recipient C. perfringens strain because the bacteriocin greatly inhibited or killed the recipient cells (Byrnestad et al. 2001).

Interestingly, only a 1-2 log reduction of donor (CFU/ml) was observed when the nonproteolytic C. botulinum strain Eklund 17BCT11 was used as the donor. To further investigate if a plasmid-endoded bacteriocin affected transfer efficiencies, another C. botulinum strain (Hall A-hyper/Tn916) that does not contain any plasmids nor a plasmid encoded-bacteriocin similar to those identified in C. botulinum strains ATCC 3502 (Acc. No. AM412318) (Sebaihia et al. 2007) and 213B (Dineen et al. 2000), was tested as a recipient. The plasmid transfer frequency of pCLJ and pBotCDC-A3 into Hall A-hyper/Tn916 increased by at least a log compared to that of LNT01 as a recipient while the transfer frequency of pCLL from the nonproteolytic strain Eklund 17B was similar when both recipients were tested (Table 2).

C. botulinum strain CDC-A3 is identical to strain LochMaree based on MLST (Jacobson et al. 2008) and PFGE analyses (Marshall 2009), and it is highly likely that the plasmids are identical in both strains. The nucleotide sequences of pCLK (SEQ ID NO: 1) (strain Loch Maree, A3), pCLJ (SEQ ID NO: 2) (strain 657Ba, A4) and pCLL (SEQ ID NO: 3) (strain 17B) genome sequences have been deposited in GenBank (Hughes et al. 2007). Although plasmids pCLK and pCLJ share significant sequence homology, the sequence of plasmid pCLL is unrelated to pCLJ and pCLK (Marshall 2009; Hill et al. 2009). Detailed sequence analysis of the botulinum gene clusters of plasmids pCLK and pCLJ have been performed, but little emphasis has been given to the functions of other plasmid genes (Smith et al. 2007). Most of the ORFs of these plasmids are described as putatively encoding hypothetical or conserved hypothetical proteins. The mechanism for plasmid replication is unknown, because gene homologues involved in typical rolling-circle or theta replication have not been identified on these plasmids (Smith et al. 2007). Similarly, the mechanism of plasmid transfer is also unknown, but genes homologous in plasmids pCLK and pCLJ that may be involved in plasmid transfer are suggested by the genome annotations. For example, TraK analogs (CLK_A0294; CLJ_A0213) and TraG/D (CLK_A0293; CLJ_A0212) flanked by hypothetical ORFs, as well as genes that encode for putative type II and type IV secretion system proteins, such as pili, have been described.

Plasmid pCLL of nonproteolytic C. botulinum serotype B strain Eklund 17B is approximately 48 kb in size and contains 56 putative ORFs. As mentioned above, pCLL does not exhibit homology with sequenced plasmids in proteolytic C. botulinum strains. Therefore, homology searches of pCLL were performed with genome sequences of other clostridial species. Initially, a nucleotide sequence alignment of pCLL with pCP13 of C. perfringens strain 13 was performed using Mauve. Surprisingly, this analysis identified regions of homology between pCLL and pCP13, which are graphically displayed as colored locally collinear blocks (LCBs) (FIG. 8). More detailed BLAST analyses revealed eleven ORFs within the gold-colored LCB (CLL0004 to CLL0017) with a range of identity from 34 to 67% with ORFs of plasmid pCP13 (Table 3). Considering that pCP13 is not a conjugative plasmid, further sequence analyses were performed between pCLL and completed sequences of conjugative C. perfringens plasmids and draft genome sequences of several C. perfringens strains.

Interestingly, two conjugative C. perfringens plasmids pCW3 (SEQ ID NO: 27) and pCP8533etx (SEQ ID NO: 28) as well as two contigs representing potential plasmids in a type D strain were identified by the Mauve program to contain regions homologous to pCLL (SEQ ID NO:3) (FIG. 9). The Mauve program revealed two LCBs, which represented regions of pCLL homologous to the C. perfringens nucleotide sequences. The LCB encompassed the tcp (Transfer of Clostridium Plasmids) locus common to conjugative C. perfringens plasmids (Bannam et al. 2006). Although plasmid pCLL does not seem to contain the entire tcp locus, it does carry genes that encode for proteins that exhibit 61% (CLL0011) identity to TcpG (CPC13 A0146 of C. perfringens C strain JGS 1495) (Bannam et al. 2006). The ORF pCLL0005 (a putative VirD4 homolog) in the LCB showed 51% identity to CJD_A0258 (a putative VirD4 component) of C. perfringens type D strain JGS 1721. Further BLAST analyses revealed that C. perfringens type D strain JGS 1721 contained several ORFs with identities ranging from 37%-51% with ORFs of pCLL (Table 3). C. perfringens type D strains carry several plasmids ranging in size from approximately 48 to 110 kb. These strains produce both alpha-toxin (plc gene) and epsilon-toxin (etx gene). The epsilon toxin is ranked third in potency following BoNTs and tetanus neurotoxin (Smedley et al. 2005). C. perfringens type D strains that produce alpha-toxin and epsilontoxins, but not the enterotoxin (cpe gene) or the beta 2 toxin (cpb2 gene) have been reported to carry the etx gene on a plasmid of 48 kb (Sayeed et al. 2007). The etx plasmid in C. perfringens type D strain JGS 1721 also contains the tcp locus (Sayeed et al. 2007). The draft genome sequence of C. perfringens strain JGS 1721 consists of 221 contigs. The pCLL ORFs shared homology with 16 and 8 ORFs within two of these contigs, gcontig1108490430999 (SEQ ID NO: 29) and gcontig1108490430283 (SEQ ID NO:30), respectively. Interestingly, gcontig1108490430283 carries the genes that encode for etx and the tcp locus.

Overall, homology searches revealed that BoNT-encoding plasmid pCLL of the nonproteolytic C. botulinum strain exhibited some degree of homology with both conjugative and nonconjugative plasmids in C. perfringens. The presence of BoNT genes on conjugative plasmids in both proteolytic and nonproteolytic strains of C. botulinum is highly significant and could facilitate the dissemination of neurotoxin genes to other species of clostridia. It is conceivable that BoNT-encoding plasmids were involved in the transfer of BoNT/E and BoNT/F genes to C. butyricum and C. baratii.

In summary, the present invention provides for the first time the novel conjugative transfer of proteolytic and nonproteolytic C. botulinum plasmids encoding BoNT genes to other proteolytic C. botulinum strains. Since BoNT is the most potent toxin known, BoNT gene transfer to other bacteria could lead to the generation of new pathogens of high impact, such as emergence of new BoNT-forming clostridia with resistant phenotypes, and strains with higher spore heat resistance than C. botulinum. The finding that pCLL of the nonproteolytic C. botulinum serotype B strain contains gene regions that are homologous with plasmids in C. perfringens is intriguing and illustrates the potential transfer of plasmids to other clostridial species.

Identification of Botulinum Neurotoxin Genes on a Plasmid in C. Botulinum Bf Strains.

Bacterial strains. The C. botulinum strains were obtained from the Johnson laboratory culture library and are listed in Table 4.

TABLE 4
BoNT genes on plasmids in C. botulinum strains.
Neurotoxin gene Virulence plasmid
Strain Serotype Location Name Size (kb) Source or referencea
81E-1133 B Plasmid pBot81E-1133 ~190 This study
F Plasmid pBot81E-1133 ~190 This study
3281(324 B Plasmid pBot3281 ~260 This study
19)
F Plasmid pBot3281 ~260 This study
84 A2 Chromosome This study
F Chromosome This study
ATCC 3502 A1 Chromosome Sebaihia
5328A A1 Chromosome Mars. Raphael
KyotoF A2 Chromosome Mars. &Smit
Loch A3 Plasmid pCLK 266,785 Mars&SMit
Maree
657Ba A4 Plasmid pCLJ 270,346 Mars. &Smit
B Plasmid pCLJ 270,346 Mars and Smith
OkraB B Plasmid pCLD 148,780 Smith et al.
14842 B Plasmid pBot14842 ~260 This study
10068 B Plasmid pBot10068 ~48 This study
17B B Plasmid pCLL 47,642 GenBank (CP001056)
Alask E E Chromosome GenBank (CP001078)
Langeland F F Chromosome GenBank (CP000728)
4852 F Chromosome This study
aSource or reference for determination of plasmid or chromosomally encoded neurotoxin genes

BoNT Strain Af 84 is a soil sample isolate from the Mendoza province in Argentina (Gimenez 1978), and strains Bf 81E-1133 and Bf 3281(32419) were isolated from separate cases of infant botulism in New Mexico, USA (Hatheway 1987). C. botulinum strains representing four BoNT/A subtypes (A1-A4) and proteolytic and nonproteolytic serotypes B and F were included in the PFGE and Southern blot analyses for comparison with the Bf and Af subtype strains. All strains were maintained as frozen stocks at −80° C. in TPGY broth (50 g/liter trypticase peptone, 5 g/liter Bacto peptone, 4 g/liter D-glucose, 20 g/liter yeast extract, 1 g/liter cysteine—HCl, pH 7.4) supplemented with 40% glycerol. Bacterial strains were subsequently cultured anaerobically in TPGY broth sparged with nitrogen gas prior to autoclaving.

The prevalence of virulence plasmids appears to be highest among proteolytic and nonproteolytic serotype B strains (Franciosa et al. 2009). In agreement with other reports, plasmids of nonproteolytic serotype B strains are significantly smaller than the virulence plasmids found in proteolytic serotype B and bivalent strains analyzed (FIG. 10A). Plasmids of approximately 48 kb were consistently observed in several nonproteolytic serotype B strains (FIG. 10A; unpublished data), whereas the plasmids in bivalent and proteolytic B strains ranged in size from approximately 148 kb to 270 kb (FIG. 10A). Whole genome sequencing of the nonproteolytic serotype B strain 17 B has been completed (GenBank Acc. No. CP001056) and the presence of virulence plasmid pCLL (47.6 kb) has been confirmed in this study and by other researchers (Franciosa et al. 2009). The new virulence plasmid, pBot10068 identified in the nonproteolytic serotype B strain 10068, was similar in size (approximately 48 kb) to plasmid pCLL (FIG. 10). No other plasmids of nonproteolytic serotype B strains have been sequenced, but it is likely that they are highly homologous, since virulence plasmids of consistent size (approximately 48 kb) are common among nonproteolytic serotype B strains (unpublished data; Franciosa et al. 2009).

Attempts to align pCLL (SEQ ID NO: 3) (17B) with pCLD (SEQ ID NO: 4) (Okra B) using the MAUVE software were not successful, indicating that the plasmids are not sufficiently related. The only homologous regions identified between these two plasmids using the comparison tools at the Pathema-Clostridium website were the type B neurotoxin gene clusters. The physiological and metabolic properties of proteolytic and nonproteolytic C. botulinum strains vary. Thus, it is not surprising that these strains carry plasmids that differ significantly in size as well as in gene content. The relatedness of plasmids found in nonproteolytic C. botulinum strains to the plasmids in other toxigenic clostridia remains to be determined.

Pulsed-field gel electrophoresis. Bacterial strains were inoculated into 10 ml of TPGY and incubated anaerobically at 37° C. to an optical density at 600 nm (0D600) of 0.6. Formaldehyde was added to inhibit nuclease activity, and the PFGE plugs were prepared as described (Johnson et al. 2005). Restriction digests of PFGE plugs were performed using restriction endonucleases AatII, ApaI, BglI, EagI, NaeI, NarI, NnuI, PvuII, RsnII, SacII, SalI, SbfI, SfiI, SmaI and XhoI, (New England Biolabs) according to the manufacturer's instructions. Digested and nondigested DNA samples were separated by PFGE in a clamped homogenous electric field system (CHEF-DRII; Bio-Rad, Hercules Calif.) under the following conditions: pulse time 1-30 seconds, 6 V/cm, at 14° C. for 24 h.

Hybridization probes. Regions of the light chain (LC) of the BoNT/A, BoNT/B and BoNT/F genes were amplified by PCR using the primers listed in Table 5 to generate DNA fragments for hybridization probes.

TABLE 5
Oligonucleotide primers used in PCR and sequencing reactions.
Amplicon 
length Primer
Gene (bp) name Primer sequence (5′-3′)
Primers used to generate hybridization probes
bont/A 268 bontAF6a GCTACTAATGCATCACAGGCAGGCG
(SEQ ID NO: 31)
bontAR6a CCCATGAGCAACCCAAAGTCC
(SEQ ID NO: 32)
bont/B 592 bontBF1a TTTGCATCAAGGGAAGGCTTCG
(SEQ ID NO: 33)
bontBR1a AGGAATCACTAAAATAAGAA
(SEQ ID NO: 34)
bont/F 1317 CLP10F AGAGAGCTCATGCCAGTTGTAATAAATAG
(SEQ ID NO: 35)
CLP10R AGAAGATCTCTTTGTACCTTTTCTAGGAA
(SEQ ID NO: 36)
Primers used for sequencing of the neurotoxin genes
bont/A2 CLP2R AGAAGACTCTTATTGTATCCTTCATCTA
(SEQ ID NO: 37)
CLP3F AGAGGATCCGCATTAAATGATTTATGTATCAA
(SEQ ID NO: 38) AG
CLP3R AGACTGCAGCAGTGAACTTTCTCCCCATC
(SEQ ID NO: 39)
HC/A2a CTGTATTTGGTACTTTTGCA
(SEQ ID NO: 40)
HC/A2b CGATAGAGTATATTATGATTCAATA
(SEQ ID NO: 41)
HC/A2c GGTAGCGTAGTGACTACAAA
(SEQ ID NO: 42)
12243F GGATGATATGTAATAATGATATGTC
(SEQ ID NO: 43)
12804F GGACCCTCAGCTGATATTATACAG
(SEQ ID NO: 44)
13328R TCCAGATGTATCTTCAGATAGGAG
(SEQ ID NO: 45)
13940R ATTAGGCATAGGCTCTAATTGGCC
(SEQ ID NO: 46)
14681R AGCGCTATTTATAGACTCATTAAG
(SEQ ID NO: 47)
15418R TTAGTTAGTCTATTATTAGTGATAG
(SEQ ID NO: 48)
16337R ATACATAGCAATACTCATATTAG
(SEQ ID NO: 49)
bont/F FNTNHF GGATGATATGTAATAATGAAAGCAAC
(SEQ ID NO: 50)
CLP10F AGAGAGCTCATGCCAGTTGTAATAAATAG
(SEQ ID NO: 35) 
CLP10R AGAAGATCTCTTTGTACCTTTTCTAGGAA
(SEQ ID NO: 36)
LC/Fa CAGAGATTGACTTAGCAAAT
(SEQ ID NO: 51) 
F711R CCGTATAATCCATGCAGTGCATGTATC
(SEQ ID NO: 52)
F750F AGCAAGCACCTCTTATGATAGCCG
(SEQ ID NO: 53)
F1702R CGATTCTTCTGATAATCGTGTATC
(SEQ ID NO: 54)
CLP11F AGAGGATCCGCGCCACCGCGACTATGCATTAG
(SEQ ID NO: 55) AGTA
CLP11R AGACTGCAGGTTTTCTTGCCATCCATGCT
(SEQ ID NO: 56)
HC/Fa AATATAGGTAATGAGGTACAAA
(SEQ ID NO: 57)
HC/Fb ATTAAATGATTTAGTGACTAGTACT
(SEQ ID NO: 58)
HC/Fc AATGGAAATTTAATAGATGAA
(SEQ ID NO: 59)
F2106F GTTGGATAGTATCAAATTGGCTTAC
(SEQ ID NO: 60)
F2729F ATAGTGGTAAGCTTAGTGAAGTT
(SEQ ID NO: 61)
F2826R GGAATCCTTACCCAGAAACTAATAC
(SEQ ID NO: 62)
F3198R CCAACATATCTTGTATCATTACAACC
(SEQ ID NO: 63)
F3245F GTGATGAGCCAGATCCAAGTATC
(SEQ ID NO: 64)
F3260F AGTGATGAGCCAGATCCAAGTATC
(SEQ ID NO: 65)
F3506F GGCGATCTGGCATACATTAATGTAG
(SEQ ID NO: 66)
KM425R CTGGTACATATGTTAATGATAGCCATTCC
(SEQ ID NO: 67)
aReferenced in Marshall et al. 2007

PCR primers were purchased from Integrated DNA Technologies, Inc. (Coralville, Iowa), and PCR reactions were performed using the GeneAmp High Fidelity PCR system (Applied Biosystems, Foster City, Calif.). PCR conditions were optimized for each primer pair utilized. Total genomic DNA was isolated from C. botulinum strains Loch Maree, 657Ba, Bf 81E-1133 and Af 84 using the ChargeSwitch gDNA Mini Bacteria kit (Invitrogen, Carlsbad, Calif.) according to the manufacturer's instructions, and used as templates in PCR. The PCR products were purified from agarose gels using the Qiagen gel extraction kit (Qiagen, Valencia, Calif.), and were radioactively labeled with [α-32P]ATP using the Megaprime DNA labeling system (GE Healthcare Bio-Sciences, Piscataway, N.J.).

Southern hybridizations. The DNA samples separated by PFGE were transferred to a positively charged nylon membrane (Immobilon-NY+, Millipore, Bedford, Mass.) overnight by downward capillary transfer in 0.4 M NaOH, 1.5 M NaCl. The membranes were neutralized in 2 M Tris-HCl, pH 7.0 for 15 minutes, rinsed with 2×SSC (3M NaCl, 0.3M sodium citrate) and fixed at 80° C. for 30 minutes under vacuum. Hybridizations were performed at 42° C. for 16 h in a solution containing 5×Denhardt's Solution, 6×SSC, 50% formamide, 0.1% SDS, 100 g/ml herring sperm DNA (Promega, Madison, Wis.) and 32P-labeled probes at 2×106 cpm/ml. All hybridization solutions and buffers were prepared according to standard protocols (Sambrook and Russell, 2001). After hybridizations, the membranes were washed twice for 5 min, at room temperature with 2×SSC, 0.1% SDS and twice for 15 min each at 42° C. Autoradiography of the membranes was performed for 16-18 h at −70° C. using Kodak BioMax MS film with a BioMax intensifying screen (Eastman Kodak, Rochester, N.Y.).

Plasmids carrying neurotoxin genes have been identified in numerous C. botulinum strains of serotypes A and B, and in bivalent subtypes Ba and Ab (Marshall et al., 2007; Smith et al., 2007; Franciosa et al., 2009). Here pulsed-field gel electrophoresis (PFGE) and Southern hybridization analysis identified four new virulence plasmids, one in the proteolytic serotype B strain 14842 (pBot14842; approximately 260 kb), one in the nonproteolytic serotype B strain 10068 (pBot10068; approximately 48 kb), and two bivalent Bf subtype strains Bf 3281 (pBot3281; approximately 260 kb) and Bf 81E-1133 (pBot81E-1133; approximately 190 kb). The plasmids identified in the Bf subtype strains differ significantly in size and harbor genes encoding for BoNT/bvB and BoNT/bvF. The presence of two neurotoxin genes on the same plasmid is a phenomenon which has been described for the megaplasmid pCLJ found in strain 657Ba (Marshall et al. 2007; Smith et al. 2007) and for plasmids recently identified in three bivalent Ab strains (Franciosa et al. 2009). The identification of two additional virulence plasmids each harboring different neurotoxin subtype genes supports the hypothesis that plasmids serve as vehicles for the transfer of these genes to other C. botulinum strains and are responsible for the generation of dual neurotoxin producing strains.

Results. Both BoNT/A4 and BoNT/bvB genes were found to be located on the same plasmid in the bivalent C. botulinum strain 657Ba. PFGE is a genetic typing method that has been used as an epidemiological tool to assess the genetic diversity of a variety of bacterial pathogens. PFGE was utilized as a method to identify large plasmids in nondigested DNA samples of Bf subtype strains Bf 81E-1133 and Bf 3281(32419) and the Af subtype strain 84. Strains representing four serotype A subtypes (A1-A4), and proteolytic and nonproteolytic serotypes B and F were included in the analysis for comparison with the Bf and Af subtype strains (FIGS. 10-11). For example, the proteolytic and nonproteolytic serotype B strains Okra B and 17B and the bivalent strain 657Ba were included in this analysis as positive controls because they contain the virulence plasmids pCLD, pCLL and pCLJ, respectively (Smith et al. 2007; Marshall et al. 2007; Franciosa et al. 2009). To determine whether the neurotoxin genes are located on plasmids observed in the PFGE gels, Southern blot analyses were performed using probes designed to hybridize to all subtypes of BoNT/A, BoNT/B and BoNT/F genes.

In all PFGEs of nondigested DNA samples a significant portion of the DNA remained in the wells representing intact chromosomal DNA (FIGS. 10A and 11A). Beneath the well position was a band of sheared chromosomal DNA, characteristic of C. botulinum strains due to their high nuclease activity. Faint bands of DNA were observed beneath the sheared chromosomal DNA that represented linear plasmid DNA molecules.

The subtype A3 (Loch Maree) and A4 (657Ba) strains were included as positive controls and their plasmids pCLK (267 kb) and pCLJ (270 kb) were observed in the ethidium bromide stained gel beneath the prominent band corresponding to sheared chromosomal DNA (FIG. 11A). As expected hybridization signals with the BoNT/A gene probe occurred with the plasmids in the A3 (Loch Maree) and A4 (657Ba) subtype strains (FIG. 11B). Nucleotide bands similar in size to pCLK (Loch Maree) and pCLJ (657Ba) were observed for both serotype B strain 14842 and strain Af 84 (FIG. 11A). The proteolytic serotype B strain 14842 was included in the PFGE analysis of Af 84 as a negative control and as expected hybridization signals were not detected with either BoNT/A or BoNT/F gene probes (FIGS. 11B, C). Hybridization with type A and F neurotoxin gene probes produced signals that were observed only at the well position and at the level of sheared chromosomal DNA in strain Af 84 indicating that both type A and F neurotoxin genes are located on the chromosome in this strain (FIGS. 11B, C).

Plasmids were observed in the PFGE of nondigested DNA of proteolytic and nonproteolytic serotype B strains and bivalent Bf strains Bf 81E-1133 and Bf 3281(32419) (FIG. 10A). A new virulence plasmid was identified in the nonproteolytic serotype B strain 10068 that was similar in size (approximately 48 kb) to pCLL of strain 17B. PFGE analysis of nondigested DNA of several other nonproteolytic strains revealed that all carried similarly sized plasmids (approximately 48 kb) (data not shown). Conversely, plasmids among proteolytic serotype B strains were found to be much larger; ranging in size from approximately 150 kb to 270 kb. Plasmid DNA molecules of varying sizes were observed in the bivalent Bf strains Bf 81E-1133 and Bf 3281(32419) (FIG. 10A).

Hybridization of the BoNT/B gene probe was observed with the 270 kb plasmid, pCLJ (657Ba), the 148 kb plasmid pCLD (Okra B), and the ˜48 kb plasmid pCLL (17B), as expected. Hybridization with the BoNT/B gene probe was also detected with two newly identified plasmids, one in the nonproteolytic B strain 10068 (pBot10068), and one in the proteolytic B strain 14842 (pBot14842) (FIG. 10B).

Interestingly, both BoNT/B and BoNT/F gene probes produced strong hybridization signals with the approximately 260 kb DNA band in C. botulinum strain Bf 3281(32419) (FIG. 10B, C), indicating that both neurotoxin genes in this strain are encoded on the same plasmid. The same neurotoxin gene probes produced weak hybridization signals with the 190 kb DNA band in C. botulinum strain Bf 81E-1133, suggesting that the BoNT/B and BoNT/F genes may reside on a plasmid in this strain. However, strong hybridization signals were also detected at the well position and at the level of sheared chromosomal DNA (FIGS. 10B, C), which could indicate chromosomal BoNT gene location. Thus, in order to accurately determine the location of the neurotoxin genes in this strain, chromosomal DNA was digested with 16 different rare cutting restriction enzymes. Based on the nucleotide sequences of pCLK (SEQ ID NO: 1) (Loch Maree) and pCLJ (SEQ ID NO: 2) (657Ba) restriction enzymes were chosen based on their potential to linearize the plasmid in strain Bf 81E-1133, cleave it more than once, or not at all. The digested DNA was separated by PFGE (FIG. 11A), and Southern hybridizations of the PFGE gel was performed using probes specific to BoNT/B (FIG. 11B) and BoNT/F (FIG. 11C) genes.

Several of the restriction enzymes chosen did not cleave the plasmid at all since the hybridization signals detected were similar to those observed with nondigested DNA samples (FIGS. 11B, C). Six restriction enzymes resulted in an increase in the hybridization signals with both BoNT/B and BoNT/F gene probes with the approximately 190 kb DNA band, while hybridization signals at the well positions decreased (FIG. 11B, C). This clearly demonstrates that the BoNT/B and BoNT/F neurotoxin genes are located on the same plasmid of approximately 190 kb in C. botulinum strain Bf 81E-1133 (FIG. 11).

Unlike the Bf subtype strains, the BoNT/A2 and BoNT/F genes were determined to be located on the chromosome in C. botulinum strain Af 84, despite the presence of a large (approximately 240 kb) plasmid in this strain (FIG. 10A).

DNA sequencing and analysis. The nucleotide sequences were determined for the BoNT/A and BoNT/F genes in C. botulinum strain Af 84 using the oligonucleotide primers listed in Table 4 to establish the subtype of each neurotoxin. Sets of overlapping PCR fragments were generated for both BoNT/A and BoNT/F genes. The nucleotide sequences were determined on both strands of the PCR fragments derived from two separate PCR experiments. Sequencing reactions were performed using the ABI PRISM BigDye Cycle Sequencing reaction kit (Applied Biosystems), and the sequences were determined using an Applied Biosystems 3730x1 automated DNA sequencing instrument at the University of Wisconsin-Madison, Biotechnology Center. The nucleotide sequences were aligned and analyzed with sequence alignment software Vector NTI version 10.3 (Invitrogen, Carlsbad, Calif.).

Sequence analysis of the BoNT/A gene of strain Af 84 confirmed that it is a BoNT/A2 subtype gene, as previously reported (Hill et al. 2007). Furthermore, strain Af 84 is genetically related to other C. botulinum subtype A2 strains KyotoF and FRI-H1A2 (Hill et al. 2007). The gene encoding NTNH has been reported as chimeric in several proteolytic C. botulinum strains and was suggested to be a hot spot for recombination (Hutson et al. 1996; East et al. 1996; Jovita et al. 1998; Smith et al. 2007). Santos-Buelga et al. 1998 characterized the BoNT/bvB and BoNT/bvF gene clusters of strain Bf 3281(32419) and showed that although the BoNT/F neurotoxin gene was more similar to the nonproteolytic BoNT/F of strain 202F, the NTNH of the BoNT/bvF cluster shared a higher degree of sequence identity to the NTNH of proteolytic strains Langeland F and KyotoF (subtype A2).

Plasmid alignments. Plasmid sequence alignments were performed to determine the relatedness of the plasmid in strain Bf 81E-1133 to known plasmids in other proteolytic C. botulinum strains. Plasmid sequence files with annotations were obtained from NCBI for plasmids pCLK (strain Loch Maree) and pCLD (strain Okra B) and the draft sequence of pCLJ (strain 657Ba) was generously provided by Theresa Smith (USAMRIID). For strain Bf 81E-1133, contigs 18 (SEQ ID NO: 68; containing the BoNT/bvB gene) and 23 (SEQ ID NO: 69; containing the BoNT/bvF gene) were obtained from NCBI ABDP01000018 and ABDP01000023, respectively. Plasmid alignments were conducted using the progressive alignment option of Mauve 2.2.0 (Darling et al. 2004) with the default settings (FIG. 12). Figures were generated using the Mauve alignment viewer, which illustrates locally collinear blocks (LCBs) as regions without rearrangements in the homologous backbone sequence. LCBs below a plasmid's center line represent the reverse complement orientation relative to the reference genome (pCLK for alignments shown in FIGS. 13-14, pCLJ for alignments shown in FIG. 15). Sequence similarity plots are displayed in the LCBs, and the height of the sequence identity plot reflects the average column entropy for the region of the respective alignment (Darling et al. 2004).

Results. The genome alignment tool Mauve was used to generate global alignments of three C. botulinum plasmids pCLK (Loch Maree), pCLJ (657Ba) and pCLD (Okra B) with two contigs from the draft genome of C. botulinum strain Bf 81E-1133. A total of 71 contigs (4,217,949 bp) representing the draft genome for strain Bf 81E-1133 were ordered using Mauve with either the chromosome of C. botulinum strain Okra B or strain Langeland F as the reference genome to sift out contigs comprised of prospective plasmid regions. Contigs 18 and 23 were identified as potential plasmid regions, based on the lack of alignment to whole genomes of strains Okra B and Langeland F (data not shown). Contig 18 (SEQ ID NO: 68) contained the BoNT/B gene, and contig 23 (SEQ ID NO: 69) contained the BoNT/F gene. Alignment of plasmids pCLK (SEQ ID NO: 1), pCLD (SEQ ID NO: 4), and pCLJ (SEQ ID NO:2) with Bf81E-1133 contigs 18 and 23 (FIG. 13) revealed eight locally collinear blocks (LCBs) with at least some portion of them found in pCLK (SEQ ID NO: 1), pCLJ (SEQ ID NO:2), and pCLD (SEQ ID NO: 4). The LCB containing the BoNT/A gene cluster for pCLK, pCLJ, and the BoNT/F gene cluster for contigs 18 and 23 also identified a region in pCLD that contained a small degree of sequence similarity although this plasmid lacks either BoNT/A or BoNT/F toxin gene clusters. In backbone view, the alignment of plasmids pCLK, pCLD, and pCLJ with Bf 81E-1133 contigs 18 and 23, identified regions conserved in only two out of four of the plasmid files, and also regions conserved in three out of four of the plasmid files (FIG. 14).

For BoNT gene cluster analysis, alignments were generated using pCLJ, pCLK, and Bf 81E-1133 contig 23 for BoNT/A and BoNT/bvF gene clusters (FIG. 15A), or pCLJ, pCLD, and Bf contig 18 for the BoNT/B cluster (FIG. 15B). The LCB containing the BoNT/bvF cluster in Bf 81E-1133 (contig 23) and the BoNT/A3 cluster in pCLK is in the reverse complement orientation relative to the BoNT/A4 cluster in pCLJ. The alignment viewer was magnified to observe the similarity of the ORFs in both toxin gene cluster types, and revealed that the greatest amount of sequence variation occurred primarily between the neurotoxin genes rather than the other ORFs in the toxin gene clusters. When viewed in the backbone view (FIG. 16), islands were identified that were unique to either Bf 81E-1133 (contigs 18 and 23) and pCLJ or Bf 81E-1133 (contigs 18 and 23) and pCLK, but none of these correspond to regions contained in the ORFs of the toxin cluster. Analysis of the BoNT/B gene cluster revealed a conserved sequence with high sequence identity for the entire LCB that contains the ORFs for the B toxin cluster (FIG. 15B).

Surprisingly, a region of the BoNT/F NTNH of strain Bf 81E-1133 spanning 277 amino acid residues was found to be homologous to the corresponding region of the NTNH of Alaska E (Table 6).

TABLE 6
Amino acid identities of regions of the BoNT/F
NTNH of C. botulinum strain Bf 81E-1133.
% Identity of amino acid residues of NTNH
Strain 1-294 295-572 573-1131 1132-1168
657Baa 99.0 76.0 91.0 63.8
Loch Mareeb 88.8 76.0 96.8 72.2
Alaska Ec 83.3 89.9 80.8 52.8
Langeland Fd 90.8 80.5 92.1 88.0
202 Fe 72.7 72.0 86.0 88.0
aNTNH of BoNT/A4 cluster
bNTNH of BoNT/A3 cluster
cNTNH of BoNT/E cluster
dNTNH of proteolytic BoNT/F cluster
eNTNH of nonproteolytic BoNT/F cluster

The BoNT/E gene cluster is located on the chromosome in strain Alaska E (Acc: CP0001078), but isolates of C. butyricum producing type E neurotoxin have been associated with four cases of infant botulism (Aureli et al. 1986; McCroskey et al. 1986) suggesting the lateral transfer of the neurotoxin gene. Hauser et al. 1992 suggested the type E neurotoxin gene was located on a plasmid in two C. butyricum isolates, however other researchers have reported the toxin gene being chromosomally encoded in toxigenic strains of C. butyricum (Zhou et al. 1993; Wang et al. 2000). The acquisition of the BoNT/E gene by toxigenic isolates of C. butyricum is presently unknown.

Sequence Analysis of the BoNT/bvF NTNH of strain Bf 81E-1133. Pairwise comparisons of the amino acid sequences of the nontoxic nonhemagglutinin (NTNH) of the BoNT/bvF cluster of strain Bf 81E-1133 with the NTNH of several strains of serotype A, strains of proteolytic and nonproteolytic serotypes B and F and the nonproteolytic serotype E strain Alaska E were performed using the AlignX (ClustalW) module of Vector NTI version 10.3 (Invitrogen, Carlsbad, Calif.).

The BoNT/A gene of C. botulinum strain Af 84 has been reported as an A2 subtype (Hill et al. 2007). However, the nucleotide sequences of BoNT/A and BoNT/F have not been determined. Thus, nucleotide sequencing of the BoNT/A and BoNT/F genes of strain Af 84 was conducted to establish each neurotoxin subtype. The BoNT/A gene exhibited 100% identity to BoNT/A2 of C. botulinum subtype A2 strain KyotoF at the nucleotide and amino acid level (data not shown) and was confirmed to be a subtype A2. The results of the sequence comparisons of the BoNT/F gene of C. botulinum strain Af 84 and the four known BoNT/F subtypes are presented in Table 7.

TABLE 7
Nucleotide and amino acid identities of BoNT/F among strains
representative of the four serotype F subtypes.
% Identity (Nucleotide/amino acid)
Neurotoxin C. baratii
Strain subtype 202 F Af 84 Bf 81E-1133 Bf 3281 43756
Langeland F pFa 94/88 96/92 92/84 92/84 83/74
202 F npFb 94/87 96/90 96/90 81/70
Af 84 pFa 92/84 92/84 82/72
Bf 81E-1133 bvFc 100/100 80/69
Bf 3281 bvFc 80/69
C. baratii F (baratii)
43756
aproteolytic F
bnonproteolytic F
cbivalent F

Although C. botulinum strain Af 84 is a bivalent strain, the BoNT/F amino acid sequence differed by 16% from the BoNT/bvF of bivalent strains Bf 3281(32419) and Bf 81E-1133, and it showed the highest level of identity (96/92%) at the nucleotide and amino acid level with the BoNT/pF of proteolytic C. botulinum strain Langeland F. Because the toxin differed from the other BoNT/F subtypes by more than 2.6% (Arndt et al., 2006; Smith et al., 2005), it was classified as a new neurotoxin subtype named BoNT/F5.

The amino acid sequences of the BoNT/F subtypes vary more than the subtypes of the other neurotoxin serotypes, ranging from 10-32% identity (Smith et al. 2005). Even though new subtypes are defined by their amino acid sequences differing by 2.6% (Arndt et al. 2006; Smith et al. 2005), the amino acid sequence of BoNT/F of strain Af 84 differs from the other BoNT/F subtypes by at least 8% and thus represents a new subtype BoNT/F5. Despite strain Af 84 being a bivalent strain, BoNT/F5 shared higher homology with the BoNT/pF subtype of C. botulinum strain Langeland F rather than the BoNT/bvF subtype of bivalent Bf subtype strains (Table 7). The BoNT/pF gene is located on the chromosome in strain Langeland F (Accession number: CP000728), but toxigenic strains of C. baratii have been found to produce BoNT/F (McCroskey et al. 1991; Gimenez et al. 1992; Hall et al. 1985; Harvey et al. 2002). The mechanism of BoNT/F gene cluster transfer to strains of C. baratii is unknown at this time, but virulence plasmids carrying the BoNT/F gene cluster may be involved.

Since the BoNT/A3, BoNT/A4 and BoNT/bvF toxin gene clusters exhibit identical gene content and organization, it is unclear whether the entire neurotoxin gene cluster or a region of the cluster is being exchanged between the highly homologous plasmids pCLJ (657Ba), pCLK (Loch Maree) and pBot81E-1133 (Bf 81E-1133). The gene encoding NTNH was targeted for analysis since it has been reported as being chimeric in several proteolytic strains and is suggested to be a hot spot for recombination (Hutson et al. 1996; East et al. 1996; Jovita et al. 1998; Smith et al. 2007). Pairwise comparisons of the amino acid sequence of NTNH of the BoNT/bvF cluster in Bf 81E-1133 with the NTNH of several strains of serotype A, proteolytic and nonproteolytic strains of serotypes B and F, and to serotype E strain Alaska E revealed that it was highly chimeric (data not shown). Four different regions of the BoNT/bvF NTNH of strain Bf 81E-1133 were identified that exhibit a high level of homology to the corresponding NTNH region of five different strains (Table 7). The amino terminal region of NTNH comprising amino acid residues 1-294 exhibited a 99% identity with the corresponding region of NTNH of the BoNT/A4 cluster of strain 657Ba (Table 7). However, the next region comprising 277 amino acid residues (295-572) shared the highest level of homology (89.9%) with the corresponding region of NTNH in the nonproteolytic C. botulinum serotype E strain Alaska E. The largest region of NTNH (residues 573-1131) was most identical (96.8%) to the similar region of NTNH of the BoNT/A3 cluster of strain Loch Maree. The C-terminal 36 residues showed the same level of identity (88.0%) with the corresponding residues of both the NTNH of the proteolytic strain Langeland F and that of the nonproteolytic strain 202F.

Results. Sequence analysis of the BoNT/B and BoNT/F genes of strain Bf 81E-1133 revealed that these genes were identical to the BoNT/bvB and BoNT/bvF of strain Bf 3281(32419) and to the BoNT/bvB of strain 657Ba (Table 6). Identical subtype BoNT genes on highly homologous plasmids in these strains provides strong evidence that plasmids are the likely vehicles for BoNT gene transfer. The location of the BoNT/bvB and BoNT/bvF gene clusters on plasmid, pBot81E-1133 (Bf 81E-1133) was analyzed in relation to the BoNT/bvB and BoNT/pB gene clusters on plasmids pCLJ (657Ba) and pCLD (Okra B), as well as to the BoNT/A3 and BoNT/A4 gene clusters on plasmids pCLK (Loch Maree) and pCLJ (657Ba) to provide insight as to how highly homologous plasmids carry genes encoding neurotoxins of distinct serotypes. The BoNT/bvB gene cluster of pBot81E-1133 is in the same position on the plasmid as the BoNT/bvB and BoNT/pB gene clusters of pCLJ (657Ba) and pCLD (Okra B) (FIG. 15B). Alignment of plasmids pBot81E-1133 (Bf 81E-1133), pCLK (Loch Maree) and pCLJ (657Ba) shows that the BoNT/bvF cluster of strain Bf 81E-1133 is in the same orientation and position as the BoNT/A3 cluster of pCLK and is in opposite orientation to the BoNT/A4 cluster of pCLJ (FIG. 15A). Smith et al. 2007 reported that the BoNT/A4 gene cluster of pCLJ was in opposite orientation to the BoNT/A3 cluster of pCLK, indicating recombination of the entire gene cluster.

Pairwise comparisons of the amino acid sequence of the NTNH of the BoNT/bvF cluster in Bf 81E-1133 with the NTNH of several strains of serotype A, proteolytic and nonproteolytic strains of serotypes B and F, and with serotype E strain Alaska E was performed and revealed four distinct regions (Table 7). The highly chimeric nature of the BoNT/bvF NTNH of strains Bf 81E-1133 and 3281(32419) suggest that the neurotoxin gene and the 3′ end of NTNH may be the region of the cluster that is being interchanged between C. botulinum virulence plasmids. For example, a region containing a portion of the NTNH gene and the BoNT/bvF gene of pBot81E-1133 may replace a similar region in the BoNT/A4 (pCLJ) or BoNT/A3 (pCLK) gene clusters generating a BoNT/F encoding plasmid.

Nucleotide sequence accession numbers. The nucleotide sequences of the BoNT/A2 (SEQ ID NO: 70) and BoNT/F5 (SEQ ID NO:71) genes of strain Af 84 presented in this paper were submitted to GenBank and were assigned the Accession Nos. FJ968749 (BoNT/A2 gene) and FJ968748 (BoNT/F5 gene).

It should be noted that the above description, attached figures and their descriptions are intended to be illustrative and not limiting of this invention. Many themes and variations of this invention will be suggested to one skilled in this and, in light of the disclosure. All such themes and variations are within the contemplation hereof. For instance, while this invention has been described in conjunction with the various exemplary embodiments outlined above, various alternatives, modifications, variations, improvements, and/or substantial equivalents, whether known or that rare or may be presently unforeseen, may become apparent to those having at least ordinary skill in the art. Various changes may be made without departing from the spirit and scope of the invention. Therefore, the invention is intended to embrace all known or later-developed alternatives, modifications, variations, improvements, and/or substantial equivalents of these exemplary embodiments.

REFERENCES

  • Arndt et al. 2006. J. Mol. Biol. 362(4):733-742.
  • Aureli et al. 1986. J. Infect. Dis. 154:207-211.
  • Bannan et al. 2007. J. Bacteriol. 188:4942-4951.
  • Bannam et al. 2006. J Bacterio1.188: 4942-4951.
  • Beverley. 1988. Nucleic Acids Res 16: 925-939.
  • Blaiotta et al. 2000. Lett Appl Microbiol 31:343-348.
  • Bradshaw et al. 2004. Anaerobe 10: 321-333.
  • Brynestad et al. 2001. Infect. Immun. 69:3483-3487.
  • Carter et al. 2009. BMG Genomics
  • Darling et al. 2004. Genome Res. 14:1394-1403.
  • Dineen et al. 2000. Appl Environ Microbiol 66: 5480-5483.
  • Dover et al. 2009. J. Clin. Microbiol.
  • East et al. 1996. Int. J. Syst. Bacteriol. 46(4):1105-1112.
  • Eklund et al. 1988. Appl. Environ. Microbiol. 54:1405-1408.
  • Eklund et al. 1967. J. Bacteriol. 93:1461-1462.
  • Franciosa et al. 2004. Appl. Environ. Microbiol. 70:7192-7199.
  • Franciosa et al. 2009. PLoS ONE 4(3): e4829. doi:10.1371/journal.pone.0004829.
  • Gimenez et al. 1978. Zbl. Bakt. Hyg. 240:215-220.
  • Gimenez et al. 1983. Rev. Argent. Microbiol. 15:51-55.
  • Gimenez et al. 1992. Infect. Immun. 60(2):518-522.
  • Hall et al. 1985. J. Clin. Microbiol. 21(4):654-655.
  • Harvey et al. 2002. J. Clin. Microbiol. 40(6):2260-2262.
  • Hatheway. 1990. Clin. Microbiol. Rev. 3:66-98.
  • Hatheway et al.1987. J. Clin. Microbiol. 25:2334-2338.
  • Hatheway et al. 1981. J Clin. Microbiol 14: 607-611.
  • Hause et al. 1992. FEMS Microbiol. Lett. 99:251-256.
  • Heap et al. 2010. J. Microbiol. Methods 80:49-55.
  • Heap et al. 2009. J Microbiol. Methods 78:79-85.
  • Heap et al. 2004. J Microbiol. Methods 70: 452-464.
  • Hill et al. 2007. J. Bacteriol. 189:818-832.
  • Hill et al. 2009. BMC Biol 7: 66.
  • Hutson et al. 1996. J. Biol. Chem. 271:10786-10792.
  • Hughes et al. 2007. J. Bacteriol. 189:7531-7538.
  • Jacobson et al. 2008. Microbiology. 154:2408-2415.
  • Johnson et al. 2005. J. Clin. Microbiol. 43(6):2602-2607.
  • Johnson et al. 1997. Clin. Infect. Dis. 25(Supp12):5168-170.
  • Jovita et al.1998. Curr. Microbiol. 36:226-231.
  • Lin et al. 1991. Appl Environ Microbiol 57: 2946-2950.
  • Lynt et al. 1982. J. Food Prot. 45:466-474.
  • Marshall et al. 2007. Biochem. Biophys. Res. Comm. 361:49-54.
  • McCroskey et al. 1986. J. Clin. Microbiol. 23:201-202.
  • McCroskey et al. 1991. J. Clin. Microbiol. 29(11):2618-2620.
  • Neve et al. 1984. J Bacteriol. 157: 833-838.
  • Parsons et al. 2007. J. Bacteriol. 189:7782-7790.
  • Peck et al. 2009. Adv. Microb. Physiol. 55: 183-320.
  • Raphael et al. 2008. Appl. Environ. Microbiol. 74:4390-4397.
  • Rood et al. 1978. Plasmid 1: 563-570.
  • Rood. 2004. Virulence Plasmids of Spore-Forming Bacteria. In: Funnell B E, Phillips J G, eds. Plasmid Biology. Washington D.C.: ASM Press. pp 413-422.
  • Sakaguchi et al. 2005. Proc. Natl. Acad. Sci. 102(48):17472-17477.
  • Sambrook et al. 2001. Molecular Cloning—A laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  • Santos-Buelga et al. 1998. Curr. Microbiol. 37:312-318.
  • Sayeed et al. 2007. Infect Immun 75: 2391-2398.
  • Schantz et al. 1992. Microbiol. Rev. 56:80-99.
  • Scott et al. 1978. FEMS Microbiol. Lett. 4:55-58.
  • Sebaihia et al. 2007. Genome Res. 17:1082-1092.
  • Smedley et al. 2005. Rev Physiol Biochemi Pharm 152:183-204.
  • Smith et al. 2005. Infect. Immun. 73(9):5450-5457.
  • Smith et al. 2007. PLoS ONE 2:e1271. doi:10.1371/journal.pone0001271
  • Strom et al. 1984. Appl. Environ. Microbiol. 48:956-963.
  • Umeda et al. 2009. J Clin Microbiol 47: 2720-2728.
  • Wang et al. 2000. Appl. Environ. Microbiol. 66(11):4992-4997.
  • Zhou et al. 1993. Appl. Environ. Microbiol. 59(11):3825-3831.
  • Zhou et al. 1995. Infect. Immun. 63:2087-2091.

Claims

We claim:

1. A conjugative transfer plasmid comprising:

an origin of replication effective in Clostridium species;

a protein coding sequence for a gene of interest operably joined to a promoter effective in Clostridium species; and

an origin of conjugative transfer capable of modulating the conjugative transfer of the plasmid into a recipient Clostridium species, wherein the gene of interest is expressed in the recipient Clostridium species.

2. The conjugative transfer plasmid of claim 1 wherein the gene of interest is at least one gene for expressing clostridial toxins, toxin fragments, or antigenic portions thereof.

3. The conjugative transfer plasmid of claim 1 wherein the plasmid is selected from C. botulinum serotypes A, B, C, D, E, F or G.

4. The conjugative transfer plasmid of claim 1 wherein the plasmid is selected from C. botulinum strains Ba, Ab, Bf, Af or A(B).

5. The conjugative transfer plasmid of claim 1 wherein the plasmid is selected from the same Clostridium species as the recipient Clostridium species.

6. The conjugative transfer plasmid of claim 1 wherein the plasmid is selected from a different Clostridium species as the recipient Clostridium species.

7. The conjugative transfer plasmid of claim 1 wherein the plasmid is selected from the group consisting of pBotCDC-A3 (SEQ ID NO: 1), pCLJ (SEQ ID NO: 2), pCLL (SEQ ID NO: 3), pBot81E-1133 and pCLD(SEQ IS NO: 4).

8. The conjugative transfer plasmid of claim 1 wherein the promoter effective in Clostridium species is the NTNH promoter from Clostridium botulinum.

9. The conjugative transfer plasmid of claim 1 wherein the recipient Clostridium species is toxic or nontoxic.

10. The conjugative transfer plasmid of claim 1 wherein the recipient Clostridium species is proteolytic or nonproteolytic.

11. The conjugative transfer plasmid of claim 1 wherein the recipient Clostridium species is LNT01 or Hall A-Hyper.

12. The conjugative transfer plasmid of claim 1 further comprising an antibiotic resistant gene for conferring resistance to erythromycin, kanamycin, tetracycline, chloramphenicol, thiamphenicol, spectinomycin or streptomycin.

13. A conjugative transfer plasmid comprising:

a BoNT-encoding plasmid having an origin of replication effective in Clostridium species, the BoNT encoded by the plasmid operably joined to a promoter effective in the Clostridium species; and

an origin of conjugative transfer capable of modulating the conjugative transfer of the BoNT-encoding plasmid into a recipient Clostridium species,

wherein the BoNT encoded by the plasmid is expressed in the recipient Clostridium species.

14. The conjugative transfer plasmid of claim 13 wherein the BoNT-encoding plasmid is selected from the group consisting of pBotCDC-A3 (SEQ ID NO: 1), pCLJ (SEQ ID NO: 2), pCLL (SEQ ID NO: 3), pBot81E-1133 and pCLD(SEQ IS NO: 4).

15. The conjugative transfer plasmid of claim 13 wherein the BoNT encoded by the plasmid is at least one C. botulinum neurotoxin gene for expressing C. botulinum toxins, toxin fragments, or antigenic portions thereof.

16. The conjugative transfer plasmid of claim 13 wherein the BoNT-encoding plasmid is from the same Clostridium species as the recipient Clostridium species.

17. The conjugative transfer plasmid of claim 13 wherein the BoNT-encoding plasmid is from a different Clostridium species as the recipient Clostridium species.

18. The conjugative transfer plasmid of claim 13 further comprising an antibiotic resistant gene for conferring resistance to erythromycin, tetracycline, chloramphenicol or thiamphenicol.

19. A method of conjugatively transferring a gene of interest into a recipient Clostridium species, the method comprising conjugatively transferring a plasmid comprising an origin of replication effective in Clostridium species, a protein coding sequence for a gene of interest operably joined to a promoter effective in Clostridium species, and an origin of conjugative transfer capable of modulating the conjugative transfer of the plasmid into the recipient Clostridium species, wherein the gene of interest encoded by the plasmid is expressed in the recipient Clostridium species.

20. The method of claim 19 wherein the gene of interest is at least one gene for expressing clostridial toxins, toxin fragments, or antigenic portions thereof.

21. The method of claim 19 wherein the plasmid is selected from the group consisting of pBotCDC-A3 (SEQ ID NO: 1), pCLJ (SEQ ID NO: 2), pCLL (SEQ ID NO: 3), pBot81E-1133 and pCLD(SEQ IS NO: 4).

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: