Description
RELATED APPLICATIONS
This application claims priority to New Zealand Application Nos. 540249, filed May 20, 2005 and 541842, filed Aug. 15, 2005, both of which are incorporated by reference in their entireties.
FIELD OF THE INVENTION
The present invention is concerned with methods for the assessment of diseases that result from the combined or interactive effects of two or more genetic variants, and in particular for diagnosing risk of developing such diseases in subjects using an analysis of genetic polymorphisms.
BACKGROUND OF THE INVENTION
Diseases that result from the combined or interactive effects of two or more genetic variants, with or without environmental factors, are called complex diseases and include cancer, coronary artery disease, diabetes, stroke, and chronic obstructive pulmonary disease (COPD). Although combining non-genetic risk factors to determine a risk level of outcome has been in applied to coronary artery disease, (by combining individual factors such as blood pressure, gender, fasting cholesterol, and smoking status), there are no such methods in combining the effects of multiple genetic factors with non-genetic factors. There is a growing realization that the complex diseases, for which examples are given above, may result from the combined effects of common genetic variants or polymorphisms rather than mutations which are rare (believed to be present in less than 1% of the general population). Moreover, these relatively common polymorphisms can confer either susceptibility and/or protective effects on the development of these diseases. In addition, the likelihood that these polymorphisms are actually expressed (termed penetrance) as a disease or clinical manifestation requires a quantum of environmental exposure before such a genetic tendency can be clinically detected.
SUMMARY OF THE INVENTION
Recent studies have identified a number of genetic variants or polymorphisms that confer susceptibility to protection from COPD, occupational COPD (OCOPD), and lung cancer. The biological basis of just how these polymorphisms interact or combine to determine risk remains unclear.
Surprisingly, it has now been found that an assessment approach which determines a subject's net score following the balancing of the number of polymorphisms associated with protection from a disease against the number of polymorphisms associated with susceptibility to that disease present in the subject is indicative of that subject's risk quotient. Furthermore, it has presently been determined that this approach is widely applicable, on a disease-by-disease basis.
It is broadly to this approach to risk assessment that the present invention is directed.
Accordingly, in a first aspect, the present invention provides a method of assessing a subject's risk of developing a disease which includes:
-
- analysing a biological sample from said subject for the presence or absence of protective polymorphisms and for the presence or absence of susceptibility polymorphisms, wherein said protective and susceptibility polymorphisms are associated with said disease;
- assigning a positive score for each protective polymorphism and a negative score for each susceptibility polymorphism or vice versa;
- calculating a net score for said subject, said net score representing the balance between the combined value of the protective polymorphisms and the combined value of the susceptibility polymorphisms present in the subject sample;
- wherein a net protective score is predictive of a reduced risk of developing said disease and a net susceptibility score is predictive of an increased risk of developing said disease.
The value assigned to each protective polymorphism can be the same or can be different. The value assigned to each susceptibility polymorphism can be the same or can be different, with either each protective polymorphism having a negative value and each susceptibility polymorphism having a positive value, or vice versa. When the disease is a lung disease, the protective polymorphisms analysed can be selected from one or more of the group consisting of: +760GG or +760CG within the gene encoding superoxide dismutase 3 (SOD3); −1296TT within the promoter of the gene encoding tissue inhibitor of metalloproteinase 3 (TIMP3); CC (homozygous P allele) within codon 10 of the gene encoding transforming growth factor beta (TGFβ); 2G2G within the promoter of the gene encoding metalloproteinase 1 (MMP1); or one or more polymorphisms in linkage disequilibrium with one or more of these polymorphisms.
Linkage disequilibrium is a phenomenon in genetics whereby two or more mutations or polymorphisms are in such close genetic proximity that they are co-inherited. This means that in genotyping, detection of one polymorphism as present implies the presence of the other. (Reich, D. E. et al. Linkage disequilibrium in the human genome. Nature 411:199-204 (2001), herein incorporated by reference in its entirety).
Preferably, all polymorphisms of the group are analysed.
Preferably, the susceptibility polymorphisms analysed are selected from one or more of the group consisting of: −82AA within the promoter of the gene encoding human macrophage elastase (MMP12); −1562CT or −1562TT within the promoter of the gene encoding metalloproteinase 9 (MMP9); 1237AG or 1237AA (Tt or tt allele genotypes) within the 3′ region of the gene encoding a1-antitrypsin (a1AT); or one or more polymorphisms in linkage disequilibrium with one or more of these polymorphisms.
Preferably, all polymorphisms of the group are analysed.
In one embodiment each protective polymorphism is assigned a value of −1 and each susceptibility polymorphism is assigned a value of +1.
In another embodiment each protective polymorphism is assigned a value of +1 and each susceptibility polymorphism is assigned a value of −1.
When the disease is COPD, the protective polymorphisms analysed can be selected from one or more of the group consisting of: −765 CC or CG in the promoter of the gene encoding cyclooxygenase 2 (COX2); Arg 130 Gln AA in the gene encoding Interleukin-13 (IL-13); Asp 298 Glu TT in the gene encoding nitric oxide synthase 3 (NOS3); Lys 420 Thr AA or AC in the gene encoding vitamin binding protein (VDBP); Glu 416 Asp TT or TG in the gene encoding VDBP; Ile 105 Val AA in the gene encoding glutathione S-transferase (GSTP1); MS in the gene encoding a 1-antitrypsin (a 1 AT); the +489 GG geneotype in the gene encoding Tissue Necrosis factor a (TNFa); the −308 GG geneotype in the gene encoding TNFa; the C89Y AA or AG geneotype in the gene encodoing SMAD3; the 161 GG genotype in the gene encodoing Mannose binding lectin 2 (MBL2); the −1903 AA genotype in the gene encoding Chymase 1 (CMA1); the Arg 197 Gln AA genotype in the gene encoding N-Acetyl transferase 2 (NAT2); the His 139 Arg GG genotype in the gene encoding Microsomal epoxide hydrolase (MEH); the −366 AA or AG genotype in the gene encoding 5 Lipo-oxygenase (ALOX5); the HOM T2437C TT genotype in the gene encoding Heat Shock Protein 70 (HSP 70); the exon 1 + 49 CT or TT genotype in the gene encoding Elafin; the Gln 27 Glu GG genotype in the gene encoding 132 Adrenergic receptor (ADBR); the −1607 1G1G or 1G2G genotype in the promoter of the gene encoding Matrix Metalloproteinase 1 (MMP1); or one or more polymorphisms in linkage disequilibrium with one or more of these polymorphisms. Preferably, all polymorphisms of the group are analysed.
Preferably, the susceptibility polymorphisms analysed are selected from one or more of the group consisting of: Arg 16 Gly GG in the gene encoding β2-adrenoreceptor (ADRB2); 105 AA in the gene encoding Interleukin-18 (IL-18); −133 CC in the promoter of the gene encoding IL-18; −675 5G5G in the promoter of the gene encoding plasminogen activator inhibitor 1 (PAI-1); −1055 TT in the promoter of the gene encoding IL-13; 874 TT in the gene encoding interferon gamma (IFN?); the +489 AA or AG genotype in the gene encoding TNFa; the −308 AA or AG genotype in the gene encoding TNFa; the C89Y GG genotype in the gene encoding SMAD3; the E469K GG genotype in the gene encoding Intracellular Adhesion molecule 1 (ICAM1); the Gly 881 Arg GC or CC genotype in the gene encoding Caspase (NOD2); the −511 GG genotype in the gene encoding IL1B; the Tyr 113 His TT genotype in the gene encoding MEH; the −366 GG genotype in the gene encoding ALOX5; the HOM T2437C CC or CT genotype in the gene encoding HSP 70; the +13924 AA genotype in the gene encoding Chloride Channel Calcium-activated 1 (CLCA1); the −159 CC genotype in the gene encoding Monocyte differentiation antigen CD-14 (CD-14); or one or more polymorphisms in linkage disequilibrium with one or more of these polymorphisms.
Preferably, all polymorphisms of the group are analysed.
In one embodiment each protective polymorphism is assigned a value of −1 and each susceptibility polymorphism is assigned a value of +1.
In one embodiment each protective polymorphism is assigned a value of +1 and each susceptibility polymorphism is assigned a value of −1.
When the disease is OCOPD, the protective polymorphisms analysed can be selected from one or more of the group consisting of: −765 CC or CG in the promoter of the gene encoding COX2; −251 AA In the promoter of the gene encoding interleukin-8 (IL-8); Lys 420 Thr AA in the gene encoding VDBP; Glu 416 Asp TT or TG in the gene encoding VDBP; exon 3 T/C RR in the gene encoding microsomal epoxide hydrolase (MEH); Arg 312 Gln AG or GG in the gene encoding SOD3; MS or SS in the gene encoding a1AT; Asp 299 Gly AG or GG in the gene encoding toll-like receptor 4 (TLR4); Gln 27 Glu CC in the gene encoding ADRB2; −518 AA in the gene encoding IL-11; Asp 298 Glu TT in the gene encoding NOS3; or one or more polymorphisms in linkage disequilibrium with one or more of these polymorphisms.
Preferably, all polymorphisms of the group are analysed.
Preferably, the susceptibility polymorphisms analysed are selected from one or more of the group consisting of: −765 GG in the promoter of the gene encoding COX2; 105 AA in the gene encoding IL-18; −133 CC in the promoter of the gene encoding IL-18; −675 5G5G in the promoter of the gene encoding PAI-1; Lys 420 Thr CC in the gene encoding VDBP; Glu 416 Asp GG in the gene encoding VDBP; Ile 105 Val GG in the gene encoding GSTP1; Arg 312 Gln AA in the gene encoding SOD3; −1055 TT in the promoter of the gene encoding IL-13; 3′ 1237 Tt or tt in the gene encoding a 1AT; −1607 2G2G in the promoter of the gene encoding MMP1; or one or more polymorphisms in linkage disequilibrium with one or more of these polymorphisms.
Preferably, all polymorphisms of the group are analysed.
In one embodiment each protective polymorphism is assigned a value of −1 and each susceptibility polymorphism is assigned a value of +1.
In one embodiment each protective polymorphism is assigned a value of +1 and each susceptibility polymorphism is assigned a value of −1.
When the disease is lung cancer, the protective polymorphisms analysed can be selected from one or more of the group consisting of: the Asp 298 Glu TT genotype in the gene encoding NOS3; the Arg 312 Gln CG or GG genotype in the gene encoding SOD3; the Asn 357 Ser AG or GG genotype in the gene encoding MMP12; the 105 AC or CC genotype in the gene encoding IL-18; the −133 CG or GG genotype in the gene encoding IL-18; the −765 CC or CG genotype in the promoter of the gene encoding COX2; the −221 TT genotype in the gene encoding Mucin 5AC (MUC5AC); the intron 1 C/T TT genotype in the gene encoding Arginase 1 (Arg1); the Leu252Val GG genotype in the gene encoding Insulin-like growth factor II receptor (IGF2R); the −1082 GG genotype in the gene encoding Interleukin 10 (IL-10); the −251 AA genotype in the gene encoding Interleukin 8 (IL-8); the Arg 399 Gln AA genotype in the X-ray repair complementing defective in Chinese hamster 1 (XRCC1) gene; the A870G GG genotype in the gene encoding cyclin D (CCND1); the −751 GG genotype in the promoter of the xeroderma pigmentosum complementation group D (XPD) gene; the Ile 462 Val AG or GG genotype in the gene encoding cytochrome P450 1A1 (CYP1A1); the Ser 326 Cys GG genotype in the gene encoding 8-Oxoguanine DNA glycolase (OGG1); the Phe 257 Ser CC genotype in the gene encoding REV1; or one or more polymorphisms in linkage disequilibrium with any one or more of these polymorphisms.
Preferably, all polymorphisms of the group are analysed.
Preferably, the susceptibility polymorphisms analysed are selected from one or more of the group consisting of: the −786 TT genotype in the promoter of the gene encoding NOS3; the Ala 15 Thr GG genotype in the gene encoding anti-chymotrypsin (ACT); the 105 AA genotype in the gene encoding IL-18; the −133 CC genotype in the promoter of the gene encoding IL-18; the 874 AA genotype in the gene encoding IFN?; the −765 GG genotype in the promoter of the gene encoding COX2; the −447 CC or GC genotype in the gene encoding Connective tissue growth factor (CTGF); and the +161 AA or AG genotype in the gene encoding MBL2; −511 GG genotype in the gene encoding IL-1B; the A-670G AA genotype in the gene encoding FAS (Apo-1/CD95); the Arg 197 Gln GG genotype in the gene encoding N-acetyltransferase 2 (NAT2); the Ile462 Val AA genotype in the gene encoding CYP1A1; the 1019 G/C Pst I CC or CG genotype in the gene encoding cytochrome P450 2E1 (CYP2E1); the C/T Rsa I TT or TC genotype in the gene encoding CYP2E1; the GSTM null genotype in the gene encoding GSTM; the −1607 2G/2G genotype in the promoter of the gene encoding MMP1; the Gln 185 Glu CC genotype in the gene encoding Nibrin (NBS1); the Asp 148 Glu GG genotype in the gene encoding Apex nuclease (APE1); or one or more polymorphisms in linkage disequilibrium with any one or more of these polymorphisms.
Preferably, all polymorphisms of the group are analysed.
In one embodiment each protective polymorphism is assigned a value of −1 and each susceptibility polymorphism is assigned a value of +1.
In one embodiment each protective polymorphism is assigned a value of +1 and each susceptibility polymorphism is assigned a value of −1.
In various embodiments the subject is or has been a smoker.
Preferably, the methods of the invention are performed in conjunction with an analysis of one or more risk factors, including one or more epidemiological risk factors, associated with the risk of developing a lung disease including COPD, emphysema, OCOPD, and lung cancer. Such epidemiological risk factors include but are not limited to smoking or exposure to tobacco smoke, age, sex, and familial history.
In another aspect, the invention provides a method of determining a subject's risk of developing a disease, said method comprising
-
- obtaining the result of one or more analyses of a sample from said subject to determine the presence or absence of protective polymorphisms and the presence or absence of susceptibility polymorphisms, and wherein said protective and susceptibility polymorphisms are associated with said disease;
- assigning a positive score for each protective polymorphism and a negative score for each susceptibility polymorphism or vice versa;
- calculating a net score for said subject, said net score representing the balance between the combined value of the protective polymorphisms and the combined value of the susceptibility polymorphisms present in the subject sample;
- wherein a net protective score is predictive of a reduced risk of developing said disease and a net susceptibility score is predictive of an increased risk of developing said disease.
In a further aspect the present invention provides a method for assessing the risk of a subject developing a disease which includes
-
- determining a net score for said subject in accordance with the methods of the invention described above, in combination with a score based on the presence or absence of one or more epidemiological risk factors,
- wherein a net protective score is predictive of a reduced risk of developing said disease and a net susceptibility score is predictive of an increased predisposition and/or susceptibility to said disease.
In another aspect, the present invention provides a kit for assessing a subject's risk of developing a disease, said kit comprising a means of analysing a sample from said subject for the presence or absence of one or more protective polymorphisms and one or more susceptibility polymorphisms as described herein.
In yet a further aspect, the present invention provides a method of prophylactic or therapeutic intervention in relation to a subject having a net susceptibility score for a disease as determined by a method as defined above which includes the steps of communicating to said subject said net susceptibility score, and advising on changes to the subject's lifestyle that could reduce the risk of developing said disease.
In still a further aspect, the present invention provides a method of treatment of a subject to decrease to the risk of developing a disease through alteration of the net score for said subject as determined by a method as defined above, wherein said method of treatment includes reversing, genotypically or phenotypically, the presence and/or functional effect of one or more susceptibility polymorphisms associated with said disease; and/or replicating and/or mimicking, genotypically or phenotypically, the presence and/or functional effect of one or more protective polymorphisms associated with said disease.
BRIEF DESCRIPTION OF FIGURES
FIG. 1: depicts a graph showing combined frequencies of the presence or absence of selected protective genotypes in the COPD subjects and in resistant smokers.
FIG. 2: depicts a graph showing net scores for protective and susceptibility polymorphisms in COPD subjects.
FIG. 3: depicts a graph showing net scores for protective and susceptibility polymorphisms in OCOPD subjects.
FIG. 4: depicts a graph showing net scores for protective and susceptibility polymorphisms in subjects with lung cancer.
FIG. 5: depicts a graph showing net scores for protective and susceptibility polymorphisms in subjects with lung cancer.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
There is a need for a method for assessing a subject's risk of developing a disease using genetic (and optionally non-genetic) risk factors. In some embodiments, it is an object of the present invention to go some way towards meeting this need and/or to provide the public with a useful choice.
The present invention is directed to methods for the assessment of the genetic risk quotient of a particular subject with respect to a particular disease. The methods rely upon the recognition that for many (if not all) diseases there exist genetic polymorphisms which fall into two categories—namely those indicative of a reduced risk of developing a particular disease (which can be termed “protective polymorphisms” or “protective SNPs”) and those indicative of an increased risk of developing a particular disease (which can be termed “susceptibility polymorphisms” or “susceptibility SNPs”).
As used herein, the phrase “risk of developing [a] disease” means the likelihood that a subject to whom the risk applies will develop the disease, and includes predisposition to, and potential onset of the disease. Accordingly, the phrase “increased risk of developing [a] disease” means that a subject having such an increased risk possesses an hereditary inclination or tendency to develop the disease. This does not mean that such a person will actually develop the disease at any time, merely that he or she has a greater likelihood of developing the disease compared to the general population of individuals that either does not possess a polymorphism associated with increased disease risk, or does possess a polymorphism associated with decreased disease risk. Subjects with an increased risk of developing the disease include those with a predisposition to the disease, for example in the case of COPD, a tendency or prediliction regardless of their lung function at the time of assessment, for example, a subject who is genetically inclined to COPD but who has normal lung function, those at potential risk, for example in the case of COPD, subjects with a tendency to mildly reduced lung function who are likely to go on to suffer COPD if they keep smoking, and subjects with potential onset of the disease, for example in the case of COPD, subjects who have a tendency to poor lung function on spirometry etc., consistent with COPD at the time of assessment.
Similarly, the phrase “decreased risk of developing [a] disease” means that a subject having such a decreased risk possesses an hereditary disinclination or reduced tendency to develop the disease. This does not mean that such a person will not develop the disease at any time, merely that he or she has a decreased likelihood of developing the disease compared to the general population of individuals that either does possess one or more polymorphisms associated with increased disease risk, or does not possess a polymorphism associated with decreased disease risk.
It will be understood that in the context of the present invention the term “polymorphism” means the occurrence together in the same population at a rate greater than that attributable to random mutation (usually greater than 1%) of two or more alternate forms (such as alleles or genetic markers) of a chromosomal locus that differ in nucleotide sequence or have variable numbers of repeated nucleotide units. See www.ornl.gov/sci/techresources/Human_Genome/publicat/97pr/09gloss.html#p. Accordingly, the term “polymorphisms” is used herein contemplates genetic variations, including single nucleotide substitutions, insertions and deletions of nucleotides, repetitive sequences (such as microsatellites), and the total or partial absence of genes (eg. null mutations). As used herein, the term “polymorphisms” also includes genotypes and haplotypes. A genotype is the genetic composition at a specific locus or set of loci. A haplotype is a set of closely linked genetic markers present on one chromosome which are not easily separable by recombination, tend to be inherited together, and can be in linkage disequilibrium. A haplotype can be identified by patterns of polymorphisms such as SNPs. Similarly, the term “single nucleotide polymorphism” or “SNP” in the context of the present invention includes single base nucleotide substitutions and short deletion and insertion polymorphisms. It will further be understood that the term “disease” is used herein in its widest possible sense, and includes conditions which can be considered disorders and/or illnesses which have a genetic basis or to which the genetic makeup of the subject contributes.
Using case-control studies, the frequencies of several genetic variants (polymorphisms) of candidate genes have been compared in disease sufferers, for example, in chronic obstructive pulmonary disease (COPD) sufferers, in occupational chronic obstructive pulmonary disease (OCOPD) sufferers, and in lung cancer sufferers, and in control subjects not suffering from the relevant disease, for example smokers without lung cancer and with normal lung function. The majority of these candidate genes have confirmed (or likely) functional effects on gene expression or protein function.
In various specific embodiments, the frequencies of polymorphisms between blood donor controls, resistant subjects and those with COPD, the frequencies of polymorphisms between blood donor controls, resistant subjects and those with OCOPD, and the frequencies of polymorphisms between blood donor controls, resistant subjects and those with lung cancer, have been compared. This has resulted in both protective and susceptibility polymorphisms being identified for each disease.
The surprising finding relevant to this invention is that a combined analysis of protective and susceptibility polymorphisms discriminatory for a given disease yields a result that is indicative of that subject's risk quotient for that disease. This approach is widely applicable, on a disease-by-disease basis.
The present invention identifies methods of assessing the risk of a subject developing a disease which includes determining in said subject the presence or absence of protective and susceptibility polymorphisms associated with said disease. A net score for said subject is derived, said score representing the balance between the combined value of the protective polymorphisms present in said subject and the combined value of the susceptibility polymorphisms present in said subject. A net protective score is predictive of a reduced risk of developing said disease, and a net susceptibility score is predictive of an increased risk of developing said disease.
Within each category (protective polymorphisms, susceptibility polymorphisms, respectively) the polymorphisms can each be assigned the same value. For example, in the analyses presented in the Examples herein, each protective polymorphism associated with a given disease is assigned a value of +1, and each susceptibility polymorphism is assigned a value of −1. Alternatively, polymorphisms discriminatory for a disease within the same category can each be assigned a different value to reflect their discriminatory value for said disease. For example, a polymorphism highly discriminatory of risk of developing a disease can be assigned a high weighting, for example a polymorphism with a high Odd's ratio can be considered highly discriminatory of disease, and can be assigned a high weighting.
Accordingly, in a first aspect, the present invention provides a method of assessing a subject's risk of developing a disease which includes:
analysing a biological sample from said subject for the presence or absence of protective polymorphisms and for the presence or absence of susceptibility polymorphisms, wherein said protective and susceptibility polymorphisms are associated with said disease;
assigning a positive score for each protective polymorphism and a negative score for each susceptibility polymorphism or vice versa;
calculating a net score for said subject, said net score representing the balance between the combined value of the protective polymorphisms and the combined value of the susceptibility polymorphisms present in the subject sample;
wherein a net protective score is predictive of a reduced risk of developing said disease and a net susceptibility score is predictive of an increased risk of developing said disease.
The subject sample can have already been analysed for the presence or absence of one or more protective or susceptibility polymorphisms, and the method includes the steps of
-
- assigning a positive score for each protective polymorphism and a negative score for each susceptibility polymorphism or vice versa;
- calculating a net score for said subject, said net score representing the balance between the combined value of the protective polymorphisms and the combined value of the susceptibility polymorphisms present in the subject sample;
- wherein a net protective score is predictive of a reduced risk of developing said disease and a net susceptibility score is predictive of an increased risk of developing said disease.
In one embodiment described herein in Example 1, 17 susceptibility genetic polymorphisms and 19 protective genetic polymorphisms identified as discriminatory for COPD were analysed using methods of the invention. These analyses can be used to determine the risk quotient of any subject for COPD, and in particular to identify subjects at greater risk of developing lung cancer.
In another embodiment described herein in Example 2, 11 susceptibility genetic polymorphisms and 11 protective genetic polymorphisms identified as discriminatory for OCOPD are analysed using methods of the invention. These analyses can be used to determine the risk quotient of any subject for OCOPD, and in particular to identify subjects at greater risk of developing OCOPD.
In a further embodiment described herein in Example 3, 19 susceptibility genetic polymorphisms and 17 protective genetic polymorphisms identified as discriminatory for lung cancer are analysed using methods of the invention. These analyses can be used to determine the risk quotient of any subject for lung cancer, and in particular to identify subjects at greater risk of developing lung cancer.
Susceptibility and protective polymorphisms can readily be identified for other diseases using approaches similar to those described in the Examples, as well as in PCT International Application No. PCT/NZ02/00106 (published as WO 02/099134 and herein incorporated by reference in its entirety) via which four susceptibility and three protective polymorphisms discriminatory for lung disease were identified.
The one or more polymorphisms can be detected directly or by detection of one or more polymorphisms which are in linkage disequilibrium with said one or more polymorphisms. As discussed above, linkage disequilibrium is a phenomenon in genetics whereby two or more mutations or polymorphisms are in such close genetic proximity that they are co-inherited. This means that in genotyping, detection of one polymorphism as present implies the presence of the other. (Reich D E et al; Linkage disequilibrium in the human genome, Nature 2001, 411:199-204.)
Examples of polymorphisms reported to be in linkage disequilibrium are presented herein, and include the Interleukin-18 −133 C/G and 105 A/C polymorphisms, and the Vitamin D binding protein Glu 416 Asp and Lys 420 Thr polymorphisms, as shown below.
|
|
|
|
|
LD |
|
|
|
rs |
Alleles |
between |
Phenotype |
| Gene |
SNPs |
numbers |
in LD |
alleles |
in COPD |
|
| Interleukin- |
IL18 −133 |
rs360721 |
C allele |
Strong LD |
CC |
| 18 |
C/G |
|
|
|
susceptible |
|
IL18 105 |
rs549908 |
A allele |
|
AA |
|
A/C |
|
|
|
susceptible |
| Vitamin D |
VDBP |
rs4588 |
A allele |
Strong LD |
AA/AC |
| binding |
Lys 420 |
|
|
|
protective |
| protein |
Thr |
|
VDBP |
rs7041 |
T allele |
|
TT/TG |
|
Glu 416 |
|
|
|
protective |
|
Asp |
|
It will be apparent that polymorphsisms in linkage disequilibrium with one or more other polymorphism associated with increased or decreased risk of developing COPD, emphysema, or both COPD and emphysema will also provide utility as biomarkers for risk of developing COPD, emphysema, or both COPD and emphysema. The data presented herein shows that the frequency for SNPs in linkage disequilibrium is very similar. Accordingly, these genetically linked SNPs can be utilized in combined polymorphism analyses to derive a level of risk comparable to that calculated from the original SNP.
It will therefore be apparent that one or more polymorphisms in linkage disequilibrium with the polymorphisms specified herein can be identified, for example, using public data bases. Examples of such polymorphisms reported to be in linkage disequilibrium with the polymorphisms specified herein are presented herein in Table 21.
The methods of the invention are primarily reliant on genetic information such as that derived from methods suitable to the detection and identification of single nucleotide polymorphisms (SNPs) associated with the specific disease for which a risk assessment is desired. In some embodiments, a SNP is a single base change or point mutation resulting in genetic variation between individuals. SNPs occur in the human genome approximately once every 100 to 300 bases, and can occur in coding or non-coding regions. Due to the redundancy of the genetic code, a SNP in the coding region may or may not change the amino acid sequence of a protein product. A SNP in a non-coding region can, for example, alter gene expression by, for example, modifying control regions such as promoters, transcription factor binding sites, processing sites, ribosomal binding sites, and affect gene transcription, processing, and translation.
SNPs can facilitate large-scale association genetics studies, and there has recently been great interest in SNP discovery and detection. SNPs show great promise as markers for a number of phenotypic traits (including latent traits), such as for example, disease propensity and severity, wellness propensity, and drug responsiveness including, for example, susceptibility to adverse drug reactions. Knowledge of the association of a particular SNP with a phenotypic trait, coupled with the knowledge of whether an individual has said particular SNP, can enable the targeting of diagnostic, preventative and therapeutic applications to allow better disease management, to enhance understanding of disease states and to ultimately facilitate the discovery of more effective treatments, such as personalised treatment regimens.
Indeed, a number of databases have been constructed of known SNPs, and for some such SNPs, the biological effect associated with a SNP. For example, the NCBI SNP database “dbSNP” is incorporated into NCBI's Entrez system and can be queried using the same approach as the other Entrez databases such as PubMed and GenBank. This database has records for over 1.5 million SNPs mapped onto the human genome sequence. Each dbSNP entry includes the sequence context of the polymorphism (i.e., the surrounding sequence), the occurrence frequency of the polymorphism (by population or individual), and the experimental method(s), protocols, and conditions used to assay the variation, and can include information associating a SNP with a particular phenotypic trait.
At least in part because of the potential impact on health and wellness, there has been and continues to be a great deal of effort to develop methods that reliably and rapidly identify SNPs. This is no trivial task, at least in part because of the complexity of human genomic DNA, with a haploid genome of 3×109 base pairs, and the associated sensitivity and discriminatory requirements.
Genotyping approaches to detect SNPs well-known in the art include DNA sequencing, methods that require allele specific hybridization of primers or probes, allele specific incorporation of nucleotides to primers bound close to or adjacent to the polymorphisms (often referred to as “single base extension”, or “minisequencing”), allele-specific ligation (joining) of oligonucleotides (ligation chain reaction or ligation padlock probes), allele-specific cleavage of oligonucleotides or PCR products by restriction enzymes (restriction fragment length polymorphisms analysis or RFLP) or chemical or other agents, resolution of allele-dependent differences in electrophoretic or chromatographic mobilities, by structure specific enzymes including invasive structure specific enzymes, or mass spectrometry. Analysis of amino acid variation is also possible where the SNP lies in a coding region and results in an amino acid change.
DNA sequencing allows the direct determination and identification of SNPs. The benefits in specificity and accuracy are generally outweighed for screening purposes by the difficulties inherent in whole genome, or even targeted subgenome, sequencing.
Mini-sequencing involves allowing a primer to hybridize to the DNA sequence adjacent to the SNP site on the test sample under investigation. The primer is extended by one nucleotide using all four differentially tagged fluorescent dideoxynucleotides (A,C,G, or T), and a DNA polymerase. Only one of the four nucleotides (homozygous case) or two of the four nucleotides (heterozygous case) is incorporated. The base that is incorporated is complementary to the nucleotide at the SNP position.
A number of methods currently used for SNP detection involve site-specific and/or allele-specific hybridisation (Matsuzaki, H. et al. Genome Res. 14:414-425 (2004); Matsuzaki, H. et al. Nat. Methods 1:109-111 (2004); Sethi, A. A. et al. Clin. Chem. 50(2):443-446 (2004), each of the foregoing which is herein incorporated by reference in its entirety). These methods are largely reliant on the discriminatory binding of oligonucleotides to target sequences containing the SNP of interest. The techniques of Affymetrix (Santa Clara, Calif.) and Nanogen Inc. (San Diego, Calif.) are particularly well-known, and utilize the fact that DNA duplexes containing single base mismatches are much less stable than duplexes that are perfectly base-paired. The presence of a matched duplex is detected by fluorescence.
The majority of methods to detect or identify SNPs by site-specific hybridisation require target amplification by methods such as PCR to increase sensitivity and specificity (see, for example U.S. Pat. No. 5,679,524, PCT publication WO 98/59066, PCT publication WO 95/12607, each of the foregoing which is herein incorporated by reference in its entirety). US Application 20050059030 (incorporated herein in its entirety) describes a method for detecting a single nucleotide polymorphism in total human DNA without prior amplification or complexity reduction to selectively enrich for the target sequence, and without the aid of any enzymatic reaction. The method utilises a single-step hybridization involving two hybridization events: hybridization of a first portion of the target sequence to a capture probe, and hybridization of a second portion of said target sequence to a detection probe. Both hybridization events happen in the same reaction, and the order in which hybridisation occurs is not critical.
US Application 20050042608 (herein incorporated by reference in its entirety) describes a modification of the method of electrochemical detection of nucleic acid hybridization of Thorp et al. (U.S. Pat. No. 5,871,918, herein incorporated by reference in its entirety). Briefly, capture probes are designed, each of which has a different SNP base and a sequence of probe bases on each side of the SNP base. The probe bases are complementary to the corresponding target sequence adjacent to the SNP site. Each capture probe is immobilized on a different electrode having a non-conductive outer layer on a conductive working surface of a substrate. The extent of hybridization between each capture probe and the nucleic acid target is detected by detecting the oxidation-reduction reaction at each electrode, utilizing a transition metal complex. These differences in the oxidation rates at the different electrodes are used to determine whether the selected nucleic acid target has a single nucleotide polymorphism at the selected SNP site.
The technique of Lynx Therapeutics (Hayward, Calif.) using MEGATYPE™ technology can genotype very large numbers of SNPs simultaneously from small or large pools of genomic material. This technology uses fluorescently labeled probes and compares the collected genomes of two populations, enabling detection and recovery of DNA fragments spanning SNPs that distinguish the two populations, without requiring prior SNP mapping or knowledge.
A number of other methods for detecting and identifying SNPs exist. These include the use of mass spectrometry, for example, to measure probes that hybridize to the SNP (Ross, P. L. et al. Discrimination of single-nucleotide polymorphisms in human DNA using peptide nucleic acid probes detected by MALDI-TOF mass spectrometry. Anal. Chem. 69, 4197-4202 (1997), herein incorporated by reference in its entirety). This technique varies in how rapidly it can be performed, from a few samples per day to a high throughput of 40,000 SNPs per day, using mass code tags. A preferred example is the use of mass spectrometric determination of a nucleic acid sequence which includes the polymorphisms of the invention, for example, which includes the promoter of the COX2 gene or a complementary sequence. Such mass spectrometric methods are known to those skilled in the art, and the genotyping methods of the invention are amenable to adaptation for the mass spectrometric detection of the polymorphisms of the invention, for example, the COX2 promoter polymorphisms of the invention.
SNPs can also be determined by ligation-bit analysis. This analysis requires two primers that hybridize to a target with a one nucleotide gap between the primers. Each of the four nucleotides is added to a separate reaction mixture containing DNA polymerase, ligase, target DNA and the primers. The polymerase adds a nucleotide to the 3′ end of the first primer that is complementary to the SNP, and the ligase then ligates the two adjacent primers together. Upon heating of the sample, if ligation has occurred, the now larger primer will remain hybridized and a signal, for example, fluorescence, can be detected. A further discussion of these methods can be found in U.S. Pat. Nos. 5,919,626; 5,945,283; 5,242,794; and 5,952,174 (each of the foregoing which is herein incorporated by reference in its entirety).
U.S. Pat. No. 6,821,733 (herein incorporated by reference in its entirety) describes methods to detect differences in the sequence of two nucleic acid molecules that includes the steps of: contacting two nucleic acids under conditions that allow the formation of a four-way complex and branch migration; contacting the four-way complex with a tracer molecule and a detection molecule under conditions in which the detection molecule is capable of binding the tracer molecule or the four-way complex; and determining binding of the tracer molecule to the detection molecule before and after exposure to the four-way complex. Competition of the four-way complex with the tracer molecule for binding to the detection molecule indicates a difference between the two nucleic acids.
Protein- and proteomics-based approaches are also suitable for polymorphism detection and analysis. Polymorphisms which result in or are associated with variation in expressed proteins can be detected directly by analysing said proteins. This typically requires separation of the various proteins within a sample, by, for example, gel electrophoresis or HPLC, and identification of said proteins or peptides derived therefrom, for example by NMR or protein sequencing such as chemical sequencing or more prevalently mass spectrometry. Proteomic methodologies are well known in the art, and have great potential for automation. For example, integrated systems, such as the ProteomIQ™ system from Proteome Systems, provide high throughput platforms for proteome analysis combining sample preparation, protein separation, image acquisition and analysis, protein processing, mass spectrometry and bioinformatics technologies.
The majority of proteomic methods of protein identification utilise mass spectrometry, including ion trap mass spectrometry, liquid chromatography (LC) and LC/MSn mass spectrometry, gas chromatography (GC) mass spectroscopy, Fourier transform-ion cyclotron resonance-mass spectrometer (FT-MS), MALDI-TOF mass spectrometry, and ESI mass spectrometry, and their derivatives. Mass spectrometric methods are also useful in the determination of post-translational modification of proteins, such as phosphorylation or glycosylation, and thus have utility in determining polymorphisms that result in or are associated with variation in post-translational modifications of proteins.
Associated technologies are also well known, and include, for example, protein processing devices such as the “Chemical Inkjet Printer” comprising piezoelectric printing technology that allows in situ enzymatic or chemical digestion of protein samples electroblotted from 2-D PAGE gels to membranes by jetting the enzyme or chemical directly onto the selected protein spots (Sloane, A. J. et al. High throughput peptide mass fingerprinting and protein macroarray analysis using chemical printing strategies. Mol Cell Proteomics 1(7):490-9 (2002), herein incorporated by reference in its entirety). After in-situ digestion and incubation of the proteins, the membrane can be placed directly into the mass spectrometer for peptide analysis.
A large number of methods reliant on the conformational variability of nucleic acids have been developed to detect SNPs.
For example, Single Strand Conformational Polymorphism (SSCP, Orita et al., PNAS 86:2766-2770 (1989), herein incorporated by reference in its entirety) is a method reliant on the ability of single-stranded nucleic acids to form secondary structure in solution under certain conditions. The secondary structure depends on the base composition and can be altered by a single nucleotide substitution, causing differences in electrophoretic mobility under nondenaturing conditions. The various polymorphs are typically detected by autoradiography when radioactively labelled, by silver staining of bands, by hybridisation with detectably labelled probe fragments or the use of fluorescent PCR primers which are subsequently detected, for example by an automated DNA sequencer.
Modifications of SSCP are well known in the art, and include the use of differing gel running conditions, such as for example differing temperature, or the addition of additives, and different gel matrices. Other variations on SSCP are well known to the skilled artisan, including, RNA-SSCP (Gasparini, P. et al. Scanning the first part of the neurofibromatosis type 1 gene by RNA-SSCP: identification of three novel mutations and of two new polymorphisms. Hum Genet. 97(4):492-5 (1996), herein incorporated by reference in its entirety), restriction endonuclease fingerprinting-SSCP (Liu, Q. et al. Restriction endonuclease fingerprinting (REF): a sensitive method for screening mutations in long, contiguous segments of DNA. Biotechniques 18(3):470-7 (1995), herein incorporated by reference in its entirety), dideoxy fingerprinting (a hybrid between dideoxy sequencing and SSCP) (Sarkar, G. et al. Dideoxy fingerprinting (ddF): a rapid and efficient screen for the presence of mutations. Genomics 13:441-443 (1992), herein incorporated by reference in its entirety), bi-directional dideoxy fingerprinting (in which the dideoxy termination reaction is performed simultaneously with two opposing primers) (Liu, Q. et al. Bi-directional dideoxy fingerprinting (Bi-ddF): a rapid method for quantitative detection of mutations in genomic regions of 300-600 bp. Hum Mol. Genet. 5(1):107-14 (1996), herein incorporated by reference in its entirety), and Fluorescent PCR-SSCP (in which PCR products are internally labelled with multiple fluorescent dyes, can be digested with restriction enzymes, followed by SSCP, and analysed on an automated DNA sequencer able to detect the fluorescent dyes) (Makino, R. et al. F-SSCP: fluorescence-based polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP) analysis. PCR Methods Appl. 2(1):10-13 (1992), herein incorporated by reference in its entirety).
Other methods which utilise the varying mobility of different nucleic acid structures include Denaturing Gradient Gel Electrophoresis (DGGE) (Cariello, N. F. et al. Resolution of a missense mutant in human genomic DNA by denaturing gradient gel electrophoresis and direct sequencing using in vitro DNA amplification: HPRT Munich. Am J Hum Genet. 42(5):726-34 (1988), herein incorporated by reference in its entirety), Temperature Gradient Gel Electrophoresis (TGGE) (Riesner, D. et al. Temperature-gradient gel electrophoresis for the detection of polymorphic DNA and for quantitative polymerase chain reaction. Electrophoresis. 13:632-6 (1992), herein incorporated by reference in its entirety), and Heteroduplex Analysis (HET) (Keen, J. et al. Rapid detection of single base mismatches as heteroduplexes on Hydrolink gels. Trends Genet. 7(1):5 (1991), herein, incorporated by reference in its entirety). Here, variation in the dissociation of double stranded DNA (for example, due to base-pair mismatches) results in a change in electrophoretic mobility. These mobility shifts are used to detect nucleotide variations.
Denaturing High Pressure Liquid Chromatography (HPLC) is yet a further method utilised to detect SNPs, using HPLC methods well-known in the art as an alternative to the separation methods described above (such as gel electophoresis) to detect, for example, homoduplexes and heteroduplexes which elute from the HPLC column at different rates, thereby enabling detection of mismatch nucleotides and thus SNPs (Giordano, M. et al. Identification by denaturing high-performance liquid chromatography of numerous polymorphisms in a candidate region for multiple sclerosis susceptibility. Genomics 56(3):247-53 (1999), herein incorporated by reference in its entirety).
Yet further methods to detect SNPs rely on the differing susceptibility of single stranded and double stranded nucleic acids to cleavage by various agents, including chemical cleavage agents and nucleolytic enzymes. For example, cleavage of mismatches within RNA:DNA heteroduplexes by RNase A, of heteroduplexes by, for example bacteriophage T4 endonuclease YII or T7 endonuclease I, of the 5′ end of the hairpin loops at the junction between single stranded and double stranded DNA by cleavase I, and the modification of mispaired nucleotides within heteroduplexes by chemical agents commonly used in Maxam-Gilbert sequencing chemistry, are all well known in the art.
Further examples include the Protein Translation Test (PTT), used to resolve stop codons generated by variations which lead to a premature termination of translation and to protein products of reduced size, and the use of mismatch binding proteins (Moore, W. et al. Mutation detection in the breast cancer gene BRCA1 using the protein truncation test. Mol. Biotechnol. 14(2):89-97 (2000), herein incorporated by reference in its entirety). Variations are detected by binding of, for example, the MutS protein, a component of Escherichia coli DNA mismatch repair system, or the human hMSH2 and GTBP proteins, to double stranded DNA heteroduplexes containing mismatched bases. DNA duplexes are then incubated with the mismatch binding protein, and variations are detected by mobility shift assay. For example, a simple assay is based on the fact that the binding of the mismatch binding protein to the heteroduplex protects the heteroduplex from exonuclease degradation.
Those skilled in the art will know that a particular SNP, particularly when it occurs in a regulatory region of a gene such as a promoter, can be associated with altered expression of a gene. Altered expression of a gene can also result when the SNP is located in the coding region of a protein-encoding gene, for example where the SNP is associated with codons of varying usage and thus with tRNAs of differing abundance. Such altered expression can be determined by methods well known in the art, and can thereby be employed to detect such SNPs. Similarly, where a SNP occurs in the coding region of a gene and results in a non-synonomous amino acid substitution, such substitution can result in a change in the function of the gene product. Similarly, in cases where the gene product is an RNA, such SNPs can result in a change of function in the RNA gene product. Any such change in function, for example as assessed in an activity or functionality assay, can be employed to detect such SNPs.
The above methods of detecting and identifying SNPs are amenable to use in the methods of the invention.
In practicing the present invention to assess the risk a particular subject faces with respect to a particular disease, that subject will be assessed to determine the presence or absence of polymorphisms (preferably SNPs) which are either associated with protection from the disease or susceptibility to the disease.
In order to detect and identify SNPs in accordance with the invention, a sample containing material to be tested is obtained from the subject. The sample can be any sample potentially containing the target SNPs (or target polypeptides, as the case may be) and obtained from any bodily fluid (blood, urine, saliva, etc) biopsies or other tissue preparations.
DNA or RNA can be isolated from the sample according to any of a number of methods well known in the art. For example, methods of purification of nucleic acids are described in Tijssen; Laboratory Techniques in Biochemistry and Molecular Biology Hybridization with nucleic acid probes Part 1: Theory and Nucleic acid preparation, Elsevier, New York, N.Y. 1993, as well as in Maniatis, T., Fritsch, E. F. and Sambrook, J., Molecular Cloning Manual 1989 (each of the foregoing which is herein incorporated by reference in its entirety).
Upon detection of the presence or absence of the polymorphisms tested for, the critical step is to determine a net susceptibility score for the subject. This score will represent the balance between the combined value of the protective polymorphisms present and the total value of the susceptibility polymorphisms present, with a net protective score (i.e., a greater weight of protective polymorphisms present than susceptibility polymorphisms) being predictive of a reduced risk of developing the disease in question. The reverse is true where there is a net susceptibility score. To calculate where the balance lies, the individual polymorphisms are assigned a value. In the simplest embodiment, each polymorphisms within a category (i.e. protective or susceptibility) is assigned an equal value, with each protective polymorphism being −1 and each susceptibility polymorphism being +1 (or vice versa). It is however contemplated that the values assigned to individual polymorphisms within a category can differ, with some polymorphisms being assigned a value that reflects their predictive or discriminatory value. For example, one particularly strong protective polymorphism can have a value of −2, whereas another more weakly protective polymorphism can have a value of −0.75.
The net score, and the associated predictive outcome in terms of the risk of the subject developing a particular disease, can be represented in a number of ways. One example is as a graph as more particularly exemplified herein.
Another example is a simple numerical score (eg +2 to represent a subject with a net susceptibility score or −2 to represent a subject with a net protective score). In each case, the result is communicated to the subject with an explanation of what that result means to that subject. Preferably, advice on ways the subject can change their lifestyle so as to reduce the risk of developing the disease is also communicated to the subject.
It will be appreciated that the methods of the invention can be performed in conjunction with an analysis of other risk factors known to be associated with a disease, such as COPD, emphysema, OCOPD, or lung cancer. Such risk factors include epidemiological risk factors associated with an increased risk of developing the disease. Such risk factors include, but are not limited to smoking and/or exposure to tobacco smoke, age, sex and familial history. These risk factors can be used to augment an analysis of one or more polymorphisms as herein described when assessing a subject's risk of developing a disease such as COPD, emphysema, OCOPD, or lung cancer.
The predictive methods of the invention allow a number of therapeutic interventions and/or treatment regimens to be assessed for suitability and implemented for a given subject, depending upon the disease and the overall risk quotient. The simplest of these can be the provision to a subject with a net susceptibility score of motivation to implement a lifestyle change, for example, in the case of OCOPD, to reduce exposure to aero-pollutants, for example, by an occupational change or by the use of safety equipment in the work place. Similarly where the subject is a current smoker, the methods of the invention can provide motivation to quit smoking. In this latter case, a ‘quit smoking’ program can be followed, which can include the use of anti-smoking medicaments (such as nicotine patches and the like) as well as anti-addiction medicaments.
Other therapeutic interventions can involve altering the balance between protective and susceptibility polymorphisms towards a protective state (such as by neutralizing or reversing a susceptibility polymorphism). The manner of therapeutic intervention or treatment will be predicated by the nature of the polymorphism(s) and the biological effect of said polymorphism(s). For example, where a susceptibility polymorphism is associated with a change in the expression of a gene, intervention or treatment is preferably directed to the restoration of normal expression of said gene, by, for example, administration of an agent capable of modulating the expression of said gene. Where a polymorphism, such as a SNP allele or genotype, is associated with decreased expression of a gene, therapy can involve administration of an agent capable of increasing the expression of said gene, and conversely, where a polymorphism is associated with increased expression of a gene, therapy can involve administration of an agent capable of decreasing the expression of said gene. Methods useful for the modulation of gene expression are well known in the art. For example, in situations were a polymorphism is associated with upregulated expression of a gene, therapy utilising, for example, RNAi or antisense methodologies can be implemented to decrease the abundance of mRNA and so decrease the expression of said gene. Alternatively, therapy can involve methods directed to, for example, modulating the activity of the product of said gene, thereby compensating for the abnormal expression of said gene.
Where a susceptibility polymorphism is associated with decreased gene product function or decreased levels of expression of a gene product, therapeutic intervention or treatment can involve augmenting or replacing of said function, or supplementing the amount of gene product within the subject for example, by administration of said gene product or a functional analogue thereof. For example, where a polymorphism is associated with decreased enzyme function, therapy can involve administration of active enzyme or an enzyme analogue to the subject. Similarly, where a polymorphism is associated with increased gene product function, therapeutic intervention or treatment can involve reduction of said function, for example, by administration of an inhibitor of said gene product or an agent capable of decreasing the level of said gene product in the subject. For example, where a polymorphism is associated with increased enzyme function, therapy can involve administration of an enzyme inhibitor to the subject.
Likewise, when a protective polymorphism is associated with upregulation of a particular gene or expression of an enzyme or other protein, therapies can be directed to mimic such upregulation or expression in an individual lacking the resistive genotype, and/or delivery of such enzyme or other protein to such individual Further, when a protective polymorphism is associated with downregulation of a particular gene, or with diminished or eliminated expression of an enzyme or other protein, desirable therapies can be directed to mimicking such conditions in an individual that lacks the protective genotype.
EXAMPLES
The invention will now be described in more detail, with reference to non-limiting examples.
Example 1
Case Association Study—COPD Methods
Subject Recruitment
Subjects of European descent who had smoked a minimum of fifteen pack years and diagnosed by a physician with chronic obstructive pulmonary disease (COPD) were recruited. Subjects met the following criteria: were over 50 years old and had developed symptoms of breathlessness after 40 years of age, had a Forced expiratory volume in one second (FEV1) as a percentage of predicted <70% and a FEV1/FVC ratio (Forced expiratory volume in one second/Forced vital capacity) of <79% (measured using American Thoracic Society criteria). Two hundred and ninety-four subjects were recruited, of these 58% were male, the mean FEV1/FVC (±95% confidence limits) was 51% (49-53), mean FEV1 as a percentage of predicted was 43 (41-45). Mean age, cigarettes per day and pack year history was 65 yrs (64-66), 24 cigarettes/day (22-25) and 50 pack years (41-55) respectively. Two hundred and seventeen European subjects who had smoked a minimum of twenty pack years and who had never suffered breathlessness and had not been diagnosed with an obstructive lung disease in the past, in particular childhood asthma or chronic obstructive lung disease, were also studied. This control group was recruited through clubs for the elderly and consisted of 63% male, the mean FEV1/FVC (95% CI) was 82% (81-83), mean FEV1 as a percentage of predicted was 96 (95-97). Mean age, cigarettes per day and pack year history was 59 yrs (57-61), 24 cigarettes/day (22-26) and 42 pack years (39-45) respectively. Using a PCR based method [1, incorporated herein in its entirety by reference], all subjects were genotyped for the α1-antitrypsin mutations (S and Z alleles) and those with the ZZ allele were excluded. The COPD and resistant smoker cohorts were matched for subjects with the MZ genotype (5% in each cohort). 190 European blood donors (smoking status unknown) were recruited consecutively through local blood donor services. Sixty-three percent were men and their mean age was 50 years. On regression analysis, the age difference and pack years difference observed between COPD sufferers and resistant smokers was found not to determine FEV or COPD.
This study shows that polymorphisms found in greater frequency in COPD patients compared to controls (and/or resistant smokers) can reflect an increased susceptibility to the development of impaired lung function and COPD. Similarly, polymorphisms found in greater frequency in resistant smokers compared to susceptible smokers (COPD patients and/or controls) can reflect a protective role.
Summary of Characteristics for the COPD, Resistant Smoker and Healthy Blood Donors
|
| Parameter |
COPD |
Resistant smokers |
|
| Median (IQR) |
N = 294 |
N = 217 |
Differences |
|
| % male |
58% |
63% |
ns |
| Age (yrs) |
65 (64-66) |
59 (57-61) |
P < 0.05 |
| Pack years |
50 (46-53) |
42 (39-45) |
P < 0.05 |
| Cigarettes/day |
24 (22-25) |
24 (22-26) |
ns |
| FEV1 (L) |
1.6 (0.7-2.5) |
2.9 (2.8-3.0) |
P < 0.05 |
| FEV1 % predict |
43 (41-45) |
96% (95-97) |
P < 0.05 |
| FEV1/FVC |
51 (49-53) |
82 (81-83) |
P < 0.05 |
|
Means and 95% confidence limits
Cyclo-oxygenase 2 (COX2) −765 G/C Promoter Polymorphism and a1-antitrypsin Genotyping
Genomic DNA was extracted from whole blood samples [2, herein incorporated by reference in its entirety]. The Cyclo-oxygenase 2 −765 polymorphism was determined by minor modifications of a previously published method [3, herein incorporated by reference in its entirety]. The PCR reaction was carried out in a total volume of 25 ul and contained 20 ng genomic DNA, 500 pmol forward and reverse primers, 0.2 mM dNTPs, 10 mM Tris-HCL (pH 8.4), 150 mM KCl, 1.0 mM MgCl2 and 1 unit of polymerase (Life Technologies). Cycling times were incubations for 3 min at 95° C. followed by 33 cycles of 50 s at 94° C., 60 s at 66° C. and 60 s at 72° C. A final elongation of 10 min at 72° C. then followed. 4 ul of PCR products were visualised by ultraviolet trans-illumination of a 3% agarose gel stained with ethidium bromide. An aliquot of 3 ul of amplification product was digested for 1 hr with 4 units of AciI (Roche Diagnostics, New Zealand) at 37° C. Digested products were separated on a 2.5% agarose gel run for 2.0 hours at 80 mV with TBE buffer. The products were visualised against a 123 bp ladder using ultraviolet transillumination after ethidium bromide staining. Using a PCR based method referenced above [1, herein incorporated by reference in its entirety], all COPD and resistant smoker subjects were genotyped for the α1-antitrypsin S and Z alleles.
Other Polymorphism Genotyping
Genomic DNA was extracted from whole blood samples [2]. Purified genomic DNA was aliquoted (10 ng/ul concentration) into 96 well plates and genotyped on a Sequenom™ system (Sequenom™ Autoflex Mass Spectrometer and Samsung 24 pin nanodispenser) using the following sequences, amplification conditions and methods.
The following conditions were used for the PCR multiplex reaction: final concentrations were for 10× Buffer 15 mM MgCl2 1.25×, 25 mM MgCl2 1.625 mM, dNTP mix 25 mM 500 uM, primers 4 uM 100 nM, Taq polymerase (Qiagen hot start) 0.15 U/reaction, Genomic DNA 10 ng/ul. Cycling times were 95° C. for 15 mM, (5° C. for 15 s, 56° C. 30 s, 72° C. 30 s for 45 cycles with a prolonged extension time of 3 min to finish. Shrimp alkaline phosphotase (SAP) treatment was used (2 ul to 5 ul per PCR reaction) incubated at 35° C. for 30 min and extension reaction (add 2 ul to 7 ul after SAP treatment) with the following volumes per reaction of: water, 0.76 ul; hME 10× termination buffer, 0.2 ul; hME primer (10 uM), 1 ul; MassEXTEND enzyme, 0.04 ul.
Sequenom Conditions for the Polymorphisms Genotyping—1
|
| SNP_ID |
TERM |
WELL |
2nd-PCRP |
1st-PCRP |
|
|
| Vitamin |
ACT |
W1 |
ACGTTGGATGGCTTGTTAACCAGCTTTGCC |
ACGTTGGATGTTTTTCAGACTGGCAGAGCG [SEQ. ID. NO. 2] |
|
| DBP-420 |
|
|
[SEQ. ID. NO. 1] |
| |
| Vitamin |
ACT |
W1 |
ACGTTGGATGTTTTTCAGACTGGCAGAGCG |
ACGTTGGATGGCTTGTTAACCAGCTTTGCC [SEQ. ID. NO. 4] |
| DBP-416 |
|
|
[SEQ. ID. NO. 3] |
| |
| IL13 C- |
ACT |
W2 |
ACGTTGGATGCATGTCGCCTTTTCCTGCTC |
ACGTTGGATGCAACACCCAACAGGCAAATG [SEQ. ID. NO. 6] |
| 1055T |
|
|
[SEQ. ID. NO. 5] |
| |
| GSTP1- |
ACT |
W2 |
ACGTTGGATGTGGTGGACATGGTGAATGAC |
ACGTTGGATGTGGTGCAGATGCTCACATAG [SEQ. ID. NO. 8] |
| 105 |
|
|
[SEQ. ID. NO. 7] |
| |
| PAI1 G- |
ACT |
W2 |
ACGTTGGATGCACAGAGAGAGTCTGGACAC |
ACGTTGGATGCTCTTGGTCTTTCCCTCATC [SEQ. ID. NO. 10] |
| 675G |
|
|
[SEQ. ID. NO. 9] |
| |
| NOS3- |
ACT |
W3 |
ACGTTGGATGACAGCTCTGCATTCAGCACG |
ACGTTGGATGAGTCAATCCCTTTGGTGCTC [SEQ. ID. NO. 12] |
| 298 |
|
|
[SEQ. ID. NO. 11] |
| |
| IL13- |
ACT |
W3 |
ACGTTGGATGGTTTTCCAGCTTGCATGTCC |
ACGTTGGATGCAATAGTCAGGTCCTGTCTC [SEQ. ID. NO. 14] |
| Arg130Gln |
|
|
[SEQ. ID. NO. 13] |
| |
| ADRB2- |
ACT |
W3 |
ACGTTGGATGGAACGGCAGCGCCTTCTTG |
ACGTTGGATGACTTGGCAATGGCTGTGATG [SEQ. ID. NO. 16] |
| Arg16Gly |
|
|
[SEQ. ID. NO. 15] |
| |
| IFNG- |
CGT |
W5 |
ACGTTGGATGCAGACATTCACAATTGATTT |
ACGTTGGATGGATAGTTCCAAACATGTGCG [SEQ. ID. NO. 18] |
| A874T |
|
|
[SEQ. ID. NO. 17] |
| |
| IL18-C- |
ACT |
W6 |
ACGTTGGATGGGGTATTCATAAGCTGAAAC |
ACGTTGGATGCCTTCAAGTTCAGTGGTCAG [SEQ. ID. NO. 20] |
| 133G |
|
|
[SEQ. ID. NO. 19] |
| |
| IL18- |
ACT |
W8 |
ACGTTGGATGGGTCAATGAAGAGAACTTGG |
ACGTTGGATGAATGTTTATTGTAGAAAACC [SEQ. ID. NO. 22] |
| A105C |
|
|
[SEQ. ID. NO. 21] |
|
Sequenom Conditions for the Polymorphisms Genotyping—2
|
| SNP_ID |
AMP_LEN |
UP_CONF |
MP_CONF |
Tm(NN) |
PcGC |
PWARN |
UEP_DIR |
|
|
| Vitamin DBP - 420 |
99 |
99.7 |
99.7 |
46.2 |
53.3 |
ML |
R |
| Vitamin DBP - 416 |
99 |
99.7 |
99.7 |
45.5 |
33.3 |
M |
F |
| IL13 C-1055T |
112 |
97.5 |
80 |
48.2 |
60 |
L |
R |
| GSTP1 - 105 |
107 |
99.4 |
80 |
49.9 |
52.9 |
|
F |
| PAI1 G-675G |
109 |
97.9 |
80 |
59.3 |
66.7 |
g |
F |
| NOS3 -298 |
186 |
98.1 |
65 |
61.2 |
63.2 |
|
F |
| IL13-Arg130Gln |
171 |
99.3 |
65 |
55.1 |
47.6 |
|
F |
| ADRB2- Arg16Gly |
187 |
88.2 |
65 |
65.1 |
58.3 |
|
F |
| IFNG - A874T |
112 |
75.3 |
81.2 |
45.6 |
27.3 |
|
F |
| IL18- C-133G |
112 |
93.5 |
74.3 |
41.8 |
46.7 |
L |
F |
| IL18- A105C |
121 |
67.2 |
74.3 |
48.9 |
40 |
|
R |
|
Sequenom Conditions for the Polymorphisms Genotyping—3
|
| SNP_ID |
UEP_MASS |
UEP_SEQ |
EXT1_CALL |
EXT1_MASS |
|
|
| Vitamin DBP - 420 |
4518.9 |
AGCTTTGCCAGTTCC [SEQ. ID. NO. 23] |
A |
4807.1 |
|
| |
| Vitamin DBP - 416 |
5524.6 |
AAAAGCAAAATTGCCTGA [SEQ. ID. NO. 24] |
T |
5812.8 |
| |
| IL13 C-1055T |
4405.9 |
TCCTGCTCTTCCCTC [SEQ. ID. NO. 25] |
T |
4703.1 |
| |
| GSTP1 - 105 |
5099.3 |
ACCTCCGCTGCAAATAC [SEQ. ID. NO. 26] |
A |
5396.5 |
| |
| PAI1 G-675G |
5620.6 |
GAGTCTGGACACGTGGGG [SEQ. ID. NO. 27] |
DEL |
5917.9 |
| |
| NOS3 -298 |
5813.8 |
TGCTGCAGGCCCCAGATGA [SEQ. ID. NO. 28] |
T |
6102 |
| |
| IL13-Arg130Gln |
6470.2 |
AGAAACTTTTTCGCGAGGGAC [SEQ. ID. NO. 29] |
A |
6767.4 |
| |
| ADRB2- Arg16Gly |
7264.7 |
AGCGCCTTCTTGCTGGCACCCAAT [SEQ. ID. NO. 30] |
A |
7561.9 |
| |
| IFNG - A874T |
6639.4 |
TCTTACAACACAAAATCAAATC [SEQ. ID. NO. 31] |
T |
6927.6 |
| |
| IL18- C-133G |
4592 |
AGCTGAAACTTCTGG [SEQ. ID. NO. 32] |
C |
4865.2 |
| |
| IL18- A105C |
6085 |
TCAAGCTTGCCAAAGTAATC [SEQ. ID. NO. 33] |
A |
6373.2 |
|
Sequenom Conditions for the Polymorphisms Genotyping—4
|
| SNP_ID |
EXT1_SEQ |
EXT2_CALL |
EXT2_MASS |
EXT2_SEQ |
1stPAUSE |
|
|
| Vitamin |
AGCTTTGCCAGTTCCT [SEQ. ID. NO. 34] |
C |
5136.4 |
AGCTTTGCCAGTTCCGT |
4848.2 |
|
| DBP - 420 |
|
|
|
[SEQ. ID. NO. 35] |
| |
| Vitamin |
AAAAGCAAAATTGCCTGAT [SEQ. ID. NO. 36] |
G |
6456.2 |
AAAAGCAAAATTGCCTGAGGC |
5853.9 |
| DBP-416 |
|
|
|
[SEQ. ID. NO. 37] |
| |
| IL13 C- |
TCCTGCTCTTCCCTCA [SEQ. ID. NO. 38] |
C |
5023.3 |
TCCTGCTCTTCCCTCGT |
4735.1 |
| 1055T |
|
|
|
[SEQ. ID. NO. 39] |
| |
| GSTP1- |
ACCTCCGCTGCAAATACA [SEQ. ID. NO. 40] |
G |
5716.7 |
ACCTCCGCTGCAAATACGT |
5428.5 |
| 105 |
|
|
|
[SEQ. ID. NO. 41] |
| |
| PAI1 G- |
GAGTCTGGACACGTGGGGA [SEQ. ID. NO. 42] |
G |
6247.1 |
GAGTCTGGACACGTGGGGGA |
5949.9 |
| 675G |
|
|
|
[SEQ. ID. NO. 43] |
| |
| NOS3- |
TGCTGCAGGCCCCAGATGAT [SEQ. ID. NO. |
G |
6416.2 |
TGCTGCAGGCCCCAGATGAGC |
6143 |
| 298 |
44] |
|
|
[SEQ. ID. NO. 45] |
| |
| IL13- |
AGAAACTTTTTCGCGAGGGACA |
G |
7416.8 |
AGAAACTTTTTCGCGAGGGACGGT |
6799.4 |
| Arg130Gln |
[SEQ. ID. NO. 46] |
|
|
[SEQ. ID. NO. 47] |
| |
| ADRB2- |
AGCGCCTTCTTGCTGGCACCCAATA |
G |
8220.3 |
AGCGCCTTCTTGCTGGCACCCAATGGA |
7593.9 |
| Arg16Gly |
[SEQ. ID. NO. 48] |
|
|
[SEQ. ID. NO. 49] |
| |
| IFNG- |
TCTTACAACACAAAATCAAATCT |
A |
7225.8 |
TCTTACAACACAAAATCAAATCAC |
6952.6 |
| A874T |
[SEQ. ID. NO. 50] |
|
|
[SEQ. ID. NO. 51] |
| |
| IL18- C- |
AGCTGAAACTTCTGGC [SEQ. ID. NO. 52] |
G |
5218.4 |
AGCTGAAACTTCTGGGA |
4921.2 |
| 133G |
|
|
|
[SEQ. ID. NO. 53] |
| |
| IL18- |
TCAAGCTTGCCAAAGTAATCT |
C |
7040.6 |
TCAAGCTTGCCAAAGTAATCGGA |
6414.2 |
| A105C |
[SEQ. ID. NO. 54] |
|
|
[SEQ. ID. NO. 55] |
|
Sequenom Conditions for the Polymorphisms Genotyping—5
| Lipoxygenase5- |
ACGTTGGATGGAAGTCAGAGATGATGGCAG |
ACGTTGGATGATGAATCCTGGACCCAAGAC |
|
| 366G/A |
[SEQ. ID. NO. 56] |
[SEQ. ID. NO. 57] |
| |
| TNFalpha+489G/A |
ACGTTGGATGGAAAGATGTGCGCTGATAGG |
ACGTTGGATGGCCACATCTCTTTCTGCATC |
|
[SEQ. ID. NO. 58] |
[SEQ. ID. NO. 59] |
| |
| SMAD3C89Y |
ACGTTGGATGTTGCAGGTGTCCCATCGGAA [SEQ. ID. NO. 60] |
ACGTTGGATGTAGCTCGTGGTGGCTGTGCA |
|
|
[SEQ. ID. NO. 61] |
| |
| CaspaseGly881ArgG/C |
ACGTTGGATGGTGATCACCCAAGGCTTCAG [SEQ. ID. NO. 62] |
ACGTTGGATGGTCTGTTGACTCTTTTGGCC |
|
|
[SEQ. ID. NO. 63] |
| |
| MBL2+161G/A |
ACGTTGGATGGTAGCTCTCCAGGCATCAAC [SEQ. ID. NO. 64] |
ACGTTGGATGGTACCTGGTTCCCCCTTTTC |
|
|
[SEQ. ID. NO. 65] |
| |
| HSP70-HOM2437T/C |
ACGTTGGATGTGATCTTGTTCACCTTGCCG [SEQ. ID. NO. 66] |
ACGTTGGATGAGATCGAGGTGACGTTTGAC |
|
|
[SEQ. ID. NO. 67] |
| |
| CD14-159C/T |
ACGTTGGATGAGACACAGAACCCTAGATGC [SEQ. ID. NO. 68] |
ACGTTGGATGGCAATGAAGGATGTTTCAGG |
|
|
[SEQ. ID. NO. 69] |
| |
| Chymase1-1903G/A |
ACGTTGGATGTAAGACAGCTCCACAGCATC [SEQ. ID. NO. 70] |
ACGTTGGATGTTCCATTTCCTCACCCTCAG |
|
|
[SEQ. ID. NO. 71] |
| |
| TNFalpha-308G/A |
ACGTTGGATGGATTTGTGTGTAGGACCCTG [SEQ. ID. NO. 72] |
ACGTTGGATGGGTCCCCAAAAGAAATGGAG |
|
|
[SEQ. ID. NO. 73] |
| |
| CLCA1+13924T/A |
ACGTTGGATGGGATTGGAGAACAAACTCAC [SEQ. ID. NO. 74] |
ACGTTGGATGGGCAGCTGTTACACCAAAAG |
|
|
[SEQ. ID. NO. 75] |
| |
| MEHTyr113HisT/C |
ACGTTGGATGCTGGCGTTTTGCAAACATAC [SEQ. ID. NO. 76] |
ACGTTGGATGTTGACTGGAAGAAGCAGGTG |
|
|
[SEQ. ID. NO. 77] |
| |
| NAT2Arg197GlnG/A |
ACGTTGGATGCCTGCCAAAGAAGAAACACC [SEQ. ID. NO. 78] |
ACGTTGGATGACGTCTGCAGGTATGTATTC |
|
|
[SEQ. ID. NO. 79] |
| |
| MEHHis139ArgG/A |
ACGTTGGATGACTTCATCCACGTGAAGCCC [SEQ. ID. NO. 80] |
ACGTTGGATGAAACTCGTAGAAAGAGCCGG |
|
|
[SEQ. ID. NO. 81] |
| |
| IL-1B-511A/G |
ACGTTGGATGATTTTCTCCTCAGAGGCTCC [SEQ. ID. NO. 82] |
ACGTTGGATGTGTCTGTATTGAGGGTGTGG |
|
|
[SEQ. ID. NO. 83] |
| |
| ADRB2Gln27GluC/G |
ACGTTGGATGTTGCTGGCACCCAATGGAAG [SEQ. ID. NO. 84] |
ACGTTGGATGATGAGAGACATGACGATGCC |
|
|
[SEQ. ID. NO. 85] |
| |
| ICAM1E469KA/G |
ACGTTGGATGACTCACAGAGCACATTCACG [SEQ. ID. NO. 86] |
ACGTTGGATGTGTCACTCGAGATCTTGAGG |
|
|
[SEQ. ID. NO. 87] |
|
Sequenom Conditions for the Polymorphisms Genotyping—6
|
| SNP_ID |
AMP_LEN |
UP_CONF |
MP_CONF |
Tm(NN) |
PcGC |
UEP_DIR |
|
|
| Lipoxygenase5-366G/A |
104 |
99.6 |
73.4 |
59 |
70.6 |
F |
| TNFalpha + 489G/A |
96 |
99.6 |
73.4 |
45.5 |
38.9 |
F |
| SMAD3C89Y |
107 |
87.3 |
71.7 |
45.7 |
47.1 |
F |
| CaspaseGly881ArgG/C |
111 |
97.2 |
81 |
52.9 |
58.8 |
R |
| MBL2 + 161G/A |
99 |
96.8 |
81 |
50.3 |
52.9 |
F |
| HSP70-HOM2437T/C |
107 |
99.3 |
81 |
62.2 |
65 |
R |
| CD14-159C/T |
92 |
98 |
76.7 |
53.3 |
50 |
F |
| Chymase1-1903G/A |
105 |
99.6 |
76.7 |
53.6 |
39.1 |
R |
| TNFalpha-308G/A |
100 |
99.7 |
81.6 |
59.9 |
70.6 |
R |
| CLCA1 + 13924T/A |
101 |
98 |
98 |
45.3 |
36.8 |
R |
| MEHTyr113HisT/C |
103 |
97.7 |
82.2 |
48.7 |
42.1 |
R |
| NAT2Arg197GlnG/A |
115 |
97.4 |
70 |
48.5 |
36.4 |
F |
| MEHHis139ArgG/A |
115 |
96.7 |
77.8 |
66 |
82.4 |
F |
| IL-1B-511A/G |
111 |
99.2 |
83 |
46 |
47.1 |
R |
| ADRB2Gln27GluC/G |
118 |
96.6 |
80 |
52.2 |
66.7 |
F |
| ICAM1E469KA/G |
115 |
98.8 |
95.8 |
51.5 |
52.9 |
R |
|
Sequenom Conditions for the Polymorphisms Genotyping—7
|
| SNP_ID |
UEP_MASS |
UEP_SEQ |
EXT1_CALL |
EXT1_MASS |
|
|
| Lipoxygenase5-366G/A |
5209.4 |
GTGCCTGTGCTGGGCTC [SEQ. ID. NO. 88] |
A |
5506.6 |
|
| |
| TNFalpha+489G/A |
5638.7 |
GGATGGAGAGAAAAAAAC [SEQ. ID. NO. 89] |
A |
5935.9 |
| |
| SMAD3C89Y |
5056.3 |
CCCTCATGTCATCTACT [SEQ. ID. NO. 90] |
A |
5353.5 |
| |
| CaspaseGly881ArgG/C |
5097.3 |
GTCACCCACTCTGTTGC [SEQ. ID. NO. 91] |
G |
5370.5 |
| |
| MBL2+161G/A |
5299.5 |
CAAAGATGGGCGTGATG [SEQ. ID. NO. 92] |
A |
5596.7 |
| |
| HSP70-HOM2437T/C |
6026.9 |
CCTTGCCGGTGCTCTTGTCC [SEQ. ID. NO. 93] |
T |
6324.1 |
| |
| CD14-159C/T |
6068 |
CAGAATCCTTCCTGTTACGG [SEQ. ID. NO. 94] |
C |
6341.1 |
| |
| Chymase1-1903G/A |
6973.6 |
TCCACCAAGACTTAAGTTTTGCT [SEQ. ID. NO. 95] |
G |
7246.7 |
| |
| TNFalpha-308G/A |
5156.4 |
GAGGCTGAACCCCGTCC [SEQ. ID. NO. 96] |
G |
5429.5 |
| |
| CLCA1+13924T/A |
5759.8 |
CTTTTTCATAGAGTCCTGT [SEQ. ID. NO. 97] |
A |
6048 |
| |
| MEHTyr113HisT/C |
5913.9 |
TTAGTCTTGAAGTGAGGGT [SEQ. ID. NO. 98] |
T |
6211.1 |
| |
| NAT2Arg197GlnG/A |
6635.3 |
TACTTATTTACGCTTGAACCTC [SEQ. ID. NO. 99] |
A |
6932.5 |
| |
| MEHHis139ArgG/A |
5117.3 |
CCAGCTGCCCGCAGGCC [SEQ. ID. NO. 100] |
A |
5414.5 |
| |
| IL-1B-511A/G |
5203.4 |
AATTGACAGAGAGCTCC [SEQ. ID. NO. 101] |
G |
5476.6 |
| |
| ADRB2Gln27GluC/G |
4547 |
CACGACGTCACGCAG [SEQ. ID. NO. 102] |
C |
4820.2 |
| |
| ICAM1E469KA/G |
5090.3 |
CACATTCACGGTCACCT [SEQ. ID. NO. 103] |
G |
5363.5 |
|
Sequenom Conditions for the Polymorphisms Genotyping—8
|
|
|
EXT2 |
EXT2 |
|
1st |
| SNP_ID |
EXT1_SEQ |
CALL |
MASS |
EXT2_SEQ |
PAUSE |
|
|
| Lipoxygenase5- |
GTGCCTGTGCTGGGCTCA |
G |
5826.8 |
GTGCCTGTGCTGGGCTCGT [SEQ. ID. NO. 105] |
5538.6 |
|
| 366G/A |
[SEQ. ID. NO. 104] |
| |
| TNFalpha+489G/A |
GGATGGAGAGAAAAAAACA |
G |
6256.1 |
GGATGGAGAGAAAAAAACGT [SEQ. ID. NO. 107] |
5967.9 |
|
[SEQ. ID. NO. 106] |
| |
| SMAD3C89Y |
CCCTCATGTCATCTACTA |
G |
5658.7 |
CCCTCATGTCATCTACTGC [SEQ. ID. NO. 109] |
5385.5 |
|
[SEQ. ID. NO. 108] |
| |
| CaspaseGly881ArgG/C |
GTCACCCACTCTGTTGCC |
C |
5699.7 |
GTCACCCACTCTGTTGCGC [SEQ. ID. NO. 111] |
5426.5 |
|
[SEQ. ID. NO. 110] |
| |
| MBL2+161G/A |
CAAAGATGGGCGTGATGA |
G |
5901.9 |
CAAAGATGGGCGTGATGGC [SEQ. ID. NO. 113] |
5628.7 |
|
[SEQ. ID. NO. 112] |
| |
| HSP70-HOM2437T/C |
CCTTGCCGGTGCTCTTGTCCA |
C |
6644.3 |
CCTTGCCGGTGCTCTTGTCCGT |
6356.1 |
|
[SEQ. ID. NO. 114] |
|
|
[SEQ. ID. NO. 115] |
| |
| CD14-159C/T |
CAGAATCCTTCCTGTTACGGC |
T |
6645.3 |
CAGAATCCTTCCTGTTACGGTC [SEQ. ID. NO. 117] |
6372.2 |
|
[SEQ. ID. NO. 116] |
| |
| Chymase1-1903G/A |
TCCACCAAGACTTAAGTTTTGCTC |
A |
7550.9 |
TCCACCAAGACTTAAGTTTTGCTTC |
7277.8 |
|
[SEQ. ID. NO. 118] |
|
|
[SEQ. ID. NO. 119] |
| |
| TNFalpha-308G/A |
GAGGCTGAACCCCGTCCC |
A |
5733.7 |
GAGGCTGAACCCCGTCCTC [SEQ. ID. NO. 121] |
5460.6 |
|
[SEQ. ID. NO. 120] |
| |
| CLCA1+13924T/A |
CTTTTTCATAGAGTCCTGTT |
T |
6659.4 |
CTTTTTCATAGAGTCCTGTAAC [SEQ. ID. NO. 123] |
6073 |
|
[SEQ. ID. NO. 122] |
| |
| MEHTyr113HisT/C |
TTAGTCTTGAAGTGAGGGTA |
C |
6531.3 |
TTAGTCTTGAAGTGAGGGTGT [SEQ. ID. NO. 125] |
6243.1 |
|
[SEQ. ID. NO. 124] |
| |
| NAT2Arg197GlnG/A |
TACTTATTTACGCTTGAACCTCA |
G |
7261.8 |
TACTTATTTACGCTTGAACCTCGA |
6964.5 |
|
[SEQ. ID. NO. 126] |
|
|
[SEQ. ID. NO. 127] |
| |
| MEHHis139ArgG/A |
CCAGCTGCCCGCAGGCCA |
G |
5734.7 |
CCAGCTGCCCGCAGGCCGT [SEQ. ID. NO. 129] |
5446.5 |
|
[SEQ. ID. NO. 128] |
| |
| IL-1B-511A/G |
AATTGACAGAGAGCTCCC |
A |
5820.8 |
AATTGACAGAGAGCTCCTG [SEQ. ID. NO. 131] |
5507.6 |
|
[SEQ. ID. NO. 130] |
| |
| ADRB2Gln27GluC/G |
CACGACGTCACGCAGC |
G |
5173.4 |
CACGACGTCACGCAGGA [SEQ. ID. NO. 133] |
4876.2 |
|
[SEQ. ID. NO. 132] |
| |
| ICAM1E469KA/G |
CACATTCACGGTCACCTC |
A |
5707.7 |
CACATTCACGGTCACCTTG [SEQ. ID. NO. 135] |
5394.5 |
|
[SEQ. ID. NO. 134] |
|
Results
Frequencies of individual polymorphisms are as follows:
| TABLE 1 |
|
| Polymorphism allele and genotype frequencies in the COPD patients and resistant smokers. |
|
| Cyclo-oxygenase 2 −765 G/C |
| Frequency |
C |
G |
CC |
CG |
GG |
|
| Controls n = 94 (%) |
27 (14%) |
161 (86%) |
3 (3%) |
21 (22%) |
70 (75%) |
| COPD n = 202 (%) |
59 (15%) |
345 (85%) |
6 (3%) |
47 (23%) |
149 (74%) |
| Resistant n = 172 (%) |
852 (25%) |
259 (75%) |
141 (8%) |
57 (33%) |
101 (59%) |
|
| Beta2-adrenoreceptor Arg 16 Gly |
| Frequency |
A |
G |
AA |
AG |
GG |
|
| Controls n = 182 (%) |
152 (42%) |
212 (58%) |
26 (14%) |
100 (55%) |
56 (31%) |
| COPD n = 236 (%) |
164 (34%) |
308 (66%) |
34 (14%) |
96 (41%) |
1063 (45%) |
| Resistant n = 190 (%) |
135 (36%) |
245 (64%) |
34 (18%) |
67 (35%) |
894 (47%) |
|
| Frequency |
C |
A |
CC |
AC |
AA |
|
| Controls n = 184 (%) |
118 (32%) |
250 (68%) |
22 (12%) |
74 (40%) |
88 (48%) |
| COPD n = 240 (%) |
122 (25%) |
3776 (75%) |
21 (9%) |
80 (33%) |
1395, 7 (58%) |
| Resistant n = 196 (%) |
113 (29%) |
277 (71%) |
16 (8%) |
81 (41%) |
99 (50%) |
|
| Frequency |
G |
C |
GG |
GC |
CC |
|
| Controls n = 187 (%) |
120 (32%) |
254 (68%) |
23 (12%) |
74 (40%) |
90 (48%) |
| COPD n = 238 |
123 (26%) |
3539 (74%) |
21 (9%) |
81 (34%) |
1368 (57%) |
| Resistant n = 195 (%) |
113 (29%) |
277 (71%) |
16 (8%) |
81 (42%) |
98 (50%) |
|
| Plasminogen activator inhibitor 1 −675 4G/5G |
| Frequency |
5G |
4G |
5G5G |
5G4G |
4G4G |
|
| Controls n = 186 (%) |
158 (42%) |
214 (58%) |
31 (17%) |
96 (52%) |
59 (32%) |
| COPD n = 237 (%) |
21912 (46%) |
255 (54%) |
5410,11 (23%) |
111 (47%) |
72 (30%) |
| Resistant n = 194 (%) |
152 (39%) |
236 (61%) |
31 (16%) |
90 (46%) |
7310,11 (38%) |
|
| Nitric oxide synthase 3 Asp 298 Glu (T/G) |
| Frequency |
T |
G |
TT |
TG |
GG |
|
| Controls n = 183 (%) |
108 (30%) |
258 (70%) |
13 (7%) |
82 (45%) |
88 (48%) |
| COPD n = 238 (%) |
159 (42%) |
317 (58%) |
25 (10%) |
109 (47%) |
104 (43%) |
| Resistant n = 194 (%) |
136 (35%) |
252 (65%) |
2813 (15%) |
80 (41%) |
86 (44%) |
|
| Vitamin D Binding Protein Lys 420 Thr (A/C) |
| Frequency |
A |
C |
AA |
AC |
CC |
|
| Controls n = 189 (%) |
113 (30%) |
265 (70%) |
17 (9%) |
79 (42%) |
93 (49%) |
| COPD n = 250 (%) |
147 (29%) |
353 (71%) |
24 (10%) |
99 (40%) |
127 (50%) |
| Resistant n = 195 (%) |
14015 (36%) |
250 (64%) |
2514 (13%) |
9014 (46%) |
80 (41%) |
|
| Vitamin D Binding Protein Glu 416 Asp (T/G) |
| Frequency |
T |
G |
TT |
TG |
GG |
|
| Controls n = 188 (%) |
162 (43%) |
214 (57%) |
35 (19%) |
92 (49%) |
61 (32%) |
| COPD n = 240 (%) |
230 (48%) |
250 (52%) |
57 (24%) |
116 (48%) |
67 (28%) |
| Resistant n = 197 (%) |
19317 (49%) |
201 (51%) |
4316 (22%) |
10716 (54%) |
47 (24%) |
|
| Glutathione S Transferase P1 Ile 105 Val (A/G) |
| Frequency |
A |
G |
AA |
AG |
GG |
|
| Controls n = 185 (%) |
232 (63%) |
138 (37%) |
70 (38%) |
92 (50%) |
23 (12%) |
| COPD n = 238 (%) |
310 (65%) |
166 (35%) |
96 (40%) |
118 (50%) |
24 (10%) |
| Resistant n = 194 (%) |
26919 (69%) |
119 (31%) |
9118 (47%) |
87 (45%) |
16 (8%) |
| Frequency |
A |
T |
AA |
AT |
TT |
|
| Controls n = 186 (%) |
183 (49%) |
189 (51%) |
37 (20%) |
109 (58%) |
40 (22%) |
| COPD n = 235 (%) |
244 (52%) |
226 (48%) |
6420 (27%) |
116 (49%) |
55 (24%) |
| Resistant n = 193 (%) |
208 (54%) |
178 (46%) |
51 (27%) |
106 (55%) |
36 (18%) |
|
| Interleukin-13 Arg 130 Gln (G/A) |
| Frequency |
A |
G |
AA |
AG |
GG |
|
| Controls n = 184 (%) |
67 (18%) |
301 (82%) |
3 (2%) |
61 (33%) |
120 (65%) |
| COPD n = 237 (%) |
86 (18%) |
388 (82%) |
8 (3%) |
70 (30%) |
159 (67%) |
| Resistant n = 194 (%) |
74 (19%) |
314 (81%) |
921 (5%) |
56 (28%) |
129 (67%) |
|
| Frequency |
T |
C |
TT |
TC |
CC |
|
| Controls n = 182 (%) |
65 (18%) |
299 (82%) |
5 (3%) |
55 (30%) |
122 (67%) |
| COPD n = 234 (%) |
94 (20%) |
374 (80%) |
822 (4%) |
78 (33%) |
148 (63%) |
| Resistant n = 192 (%) |
72 (19%) |
312 (81%) |
2 (1%) |
68 (35%) |
122 (64%) |
|
| Frequency |
M |
S |
MM |
MS |
SS |
|
| COPD n = 202 (%) |
391 (97%) |
13 (3%) |
189 (94%) |
13 (6%) |
0 (0%) |
| Resistant n = 189 (%) |
350 (93%) |
28 (7%) |
162 (85%) |
2623 (14%) |
123 (1%) |
|
| *number of chromosomes (2n)Genotype |
-
- 1. Genotype. CC/CG vs GG for resistant vs COPD, Odds ratio (OR)=1.98, 95% confidence limits 1.3-3.1, χ2 (Yates corrected)=8.82, p=0.003, CC/CG=protective for COPD
- 2. Allele. C vs G for resistant vs COPD, Odds ratio (OR)=1.92, 95% confidence limits 1.3-2.8, χ2 (Yates corrected)=11.56, p<0.001, C=protective for COPD
- 3. Genotype. GG vs AG/AA for COPD vs controls, Odds ratio (OR)=1.83, 95% confidence limits 1.2-2.8, χ2 (Yates corrected)=8.1, p=0.004, GG=susceptible to COPD (depending on the presence of other snps)
- 4. Genotype. GG vs AG/AA for resistant vs controls, Odds ratio (OR)=1.98, 95% confidence limits 1.3-3.1, χ2 (Yates corrected)=9.43, p=0.002 GG=resistance (depending on the presence of other snps)
- 5. Genotype. AA vs AC/CC for COPD vs controls, Odds ratio (OR)=1.50, 95% confidence limits 1.0-2.3, χ2 (Yates uncorrected)=4.26, p=0.04, AA=susceptible to COPD
- 6. Allele. A vs C for COPD vs control, Odds ratio (OR)=1.46, 95% confidence limits 1.1-2.0, χ2 (Yates corrected)=5.76, p=0.02
- 7. Genotype. AA vs AC/CC for COPD vs resistant, Odds ratio (OR)=1.35, 95% confidence limits 0.9-2.0, χ2 (Yates uncorrected)=2.39, p=0.12 (trend),
- 8. Genotype. CC vs CG/GG for COPD vs controls, Odds ratio (OR)=1.44, 95% confidence limits 1.0-2.2, χ2 (Yates corrected)=3.4, p=0.06, CC=susceptible to COPD
- 9. Allele. C vs G for COPD vs control, Odds ratio (OR)=1.36, 95% confidence limits 1.0-1.9, χ2 (Yates corrected)=53.7, p=0.05, C=susceptible to COPD
- 10. Genotype. 5G5G vs rest for COPD vs resistant, Odds ratio (OR)=1.55, 95% confidence limits 0.9-2.6, χ2 (Yates uncorrected)=3.12, p=0.08, 5G5G=susceptible to COPD
- 11. Genotype. 5G5G vs rest for COPD vs control, Odds ratio (OR)=1.48, 95% confidence limits 0.9-2.5, χ2 (Yates uncorrected)=2.43, p=0.12, 5G5G=susceptible to COPD
- 12. Allele. 5G vs 4G for COPD vs resistant, Odds ratio (OR)=1.33, 95% confidence limits 1.0-1.8, χ2 (Yates corrected)=4.02, p=0.05, 5G=susceptible to COPD
- 13. Genotype. TT vs TG/GG for resistant vs controls, Odds ratio (OR)=2.2, 95% confidence limits 1.0-4.7, χ2 (Yates corrected)=4.49, p=0.03, TT genotype=protective for COPD
- 14. Genotype. AA/AC vs CC for resistant vs COPD, Odds ratio (OR)=1.39, 95% confidence limits 0.9-2.1, χ2 (Yates uncorrected)=2.59, p=0.10, AA/AC genotype=protective for COPD
- 15. Allele. A vs C for resistant vs COPD, Odds ratio (OR)=1.34, 95% confidence limits 1.0-1.8, χ2 (Yates corrected)=3.94, p=0.05, A allele=protective for COPD
- 16. Genotype. TT/TG vs GG for resistant vs controls, Odds ratio (OR)=1.53, 95% confidence limits 1.0-2.5, χ2 (Yates uncorrected)=3.52, p=0.06, TT/TG genotype=protective for COPD
- 17. Allele. T vs G for resistant vs control, Odds ratio (OR)=1.27, 95% confidence limits 1.0-1.7, χ2 (Yates corrected)=2.69, p=0.1, T allele=protective for COPD
- 18. Genotype. AA vs AG/GG for resistant vs controls, Odds ratio (OR)=1.45, 95% confidence limits 0.9-2.2, χ2 (Yates uncorrected)=3.19, p=0.07, AA genotype=protective for COPD
- 19. Allele. A vs G for resistant vs control, Odds ratio (OR)=1.34, 95% confidence limits 1.0-1.8, χ2 (Yates uncorrected)=3.71, p=0.05, A allele=protective for COPD
- 20. Genotype. AA vs AT/TT for COPD vs controls, Odds ratio (OR)=1.51, 95% confidence limits 0.9-2.5, χ2 (Yates uncorrected)=3.07, p=0.08, AA genotype=susceptible to COPD
- 21. Genotype. AA vs AG/GG for resistant vs controls, Odds ratio (OR)=2.94, 95% confidence limits 0.7-14.0, χ2 (Yates uncorrected)=2.78, p=0.09, AA genotype=protective for COPD
- 22. Genotype. TT vs TC/CC for COPD vs resistant, Odds ratio (OR)=6.03, 95% confidence limits 1.1-42, χ2 (Yates corrected)=4.9, p=0.03, TT=susceptible to COPD
- 23. Genotype. MS/SS vs MM for Resistant vs COPD, Odds ratio (OR)=2.42, 95% confidence limits 1.2-5.1, χ2 (Yates corrected)=5.7, p=0.01, S=protective for COPD
Tissue Necrosis Factor α +489 G/A Polymorphism Allele and Genotype Frequency in the COPD Patients and Resistant Smokers.
| Frequency |
A |
G |
AA |
AG |
GG |
|
| COPD |
54 (11%) |
430 (89%) |
5 (2%) |
44 (18%) |
193 (80%) |
| n = 242 (%) |
| Resistant |
27 (7%) |
347 (93%) |
1 (1%) |
25 (13%) |
161 (86%) |
| n = 187 (%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. AA/AG vs GG for COPD vs resistant, Odds ratio (OR)=1.57, 95% confidence limits 0.9-2.7, χ2 (Yates corrected)=2.52, p=0.11,
- AA/AG=susceptible (GG=protective)
- 2. Allele. A vs G for COPD vs resistant, Odds ratio (OR)=1.61, 95% confidence limits 1.0-2.7, χ2 (Yates corrected)=3.38, p=0.07,
Tissue Necrosis Factor α −308 G/A Polymorphism Allele and Genotype Frequency in the COPD Patients and Resistant Smokers.
| Frequency |
A |
G |
AA |
AG |
GG |
|
| COPD |
90 (19%) |
394 (81%) |
6 (2%) |
78 (32%) |
158 (65%) |
| n = 242 (%) |
| Resistant |
58 (15%) |
322 (85%) |
3 (2%) |
52 (27%) |
135 (71%) |
| n = 190 (%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. GG vs AG/AA for COPD vs resistant, Odds ratio (OR)=0.77, 95% confidence limits 0.5-1.2, χ2 (Yates uncorrected)=1.62, p=0.20,
- GG=protective (AA/AG=susceptible) trend
- 2. Allele. A vs G for COPD vs resistant, Odds ratio (OR)=1.3, 95% confidence limits 0.9-1.9, χ2 (Yates uncorrected)=1.7, p=0.20,
SMAD3 C89Y Polymorphism Allele and Genotype Frequency in the COPD Patients and Resistant Smokers.
| Frequency |
A |
G |
AA |
AG |
GG |
|
| COPD n = 250 (%) |
2 (1%) |
498 (99%) |
0 (0%) |
2 (1%) |
248 (99%) |
| Resistant n = 196 |
6 (2%) |
386 (98%) |
0 (0%) |
6 (3%) |
190 (97%) |
| (%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. AA/AG vs GG for COPD vs resistant, Odds ratio (OR)=0.26, 95% confidence limits 0.04-1.4, χ2 (Yates uncorrected)=3.19, p=0.07,
- AA/AG=protective (GG susceptible)
Intracellular Adhesion Molecule 1 (ICAM1) A/G E469K (rs5498) Polymorphism Allele and Genotype Frequency in COPD Patients and Resistant Smokers.
| Frequency |
A |
G |
AA |
AG |
GG |
|
| COPD |
259 (54%) |
225 (46%) |
73 (30%) |
113 (47%) |
56 (23%) |
| n = 242 (%) |
| Resistant |
217 (60%) |
147 (40%) |
64 (35%) |
89 (49%) |
29 (16%) |
| n = 182 (%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. GG vs AG/GG for COPD vs resistant, Odds ratio (OR)=1.60, 95% confidence limits 0.9-2.7, χ2 (Yates corrected)=3.37, p=0.07,
- 2. Allele. G vs A for COPD vs resistant, Odds ratio (OR)=1.3, 95% confidence limits 1.0-1.7, χ2 (Yates corrected)=2.90, p=0.09
Caspase (NOD2) Gly881Arg Polymorphism Allele and Genotype Frequencies in the COPD Patients and Resistant Smokers.
| Frequency |
G |
C |
GG |
GC |
CC |
|
| COPD n = 247 |
486 (98%) |
8 (2%) |
239 (97%) |
8 (3%) |
0 (0%) |
| Resistant n = 195 |
388 (99.5%) |
2 0.5%) |
193 (99%) |
2 (1%) |
0 (0%) |
| (%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. CC/CG vs GG for COPD vs resistant, Odds ratio (OR)=3.2, 95% confidence limits 0.6-22, χ2 (Yates uncorrected)=2.41, p=0.11 (1-tailed),
- GC/CC=susceptibility (trend)
Mannose Binding Lectin 2(MBL2) +161 G/A Polymorphism Allele and Genotype Frequencies in the COPD Patients and Resistant Smokers.
| Frequency |
A |
G |
AA |
AG |
GG |
|
| COPD n = 218 |
110 (25%) |
326 (75%) |
6 (3%) |
98 (45%) |
114 (52%) |
| (%) |
|
|
| Resistant |
66 (18%) |
300 (82%) |
6 (3%) |
54 (30%) |
123 (67%) |
| n = 183 (%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. GG vs rest for COPD vs resistant, Odds ratio (OR)=0.53, 95% confidence limits 0.4-0.80, χ2 (Yates uncorrected)=8.55, p=0.003,
Chymase 1 (CMA1)-1903 G/A Promoter Polymorphism Allele and Genotype Frequencies in the COPD Patients and Resistant Smokers.
| Frequency |
A |
G |
AA |
AG |
GG |
|
| COPD |
259 (54%) |
219 (46%) |
67 (28%) |
125 (52%) |
47 (20%) |
| n = 239 (%) |
| Resistant |
209 (58%) |
153 (42%) |
63 (35%) |
83 (46%) |
35 (19%) |
| n = 181 (%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. AA vs AG/GG for COPD vs resistant, Odds ratio (OR)=0.73, 95% confidence limits 0.5-1.1, χ2 (Yates corrected)=1.91, p=0.17,
- AA genotype=protective trend
N-Acetyltransferase 2 Arg 197 Gln G/A Polymorphism Allele and Genotype Frequencies in COPD and Resistant Smokers.
| Frequency |
A |
G |
AA |
AG |
GG |
|
| COPD |
136 (28%) |
358 (72%) |
14 (6%) |
108 (44%) |
125 (50%) |
| n = 247 (%) |
| Resistant |
125 (32%) |
267 (68%) |
21 (11%) |
83 (42%) |
92 (47%) |
| n = 196 (%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. AA vs AG/GG for COPD vs resistant, Odds ratio (OR)=0.50, 95% confidence limits 0.2-1.0, χ2 (Yates uncorrected)=3.82, p=0.05,
Interleukin 1B (IL-1B) −511 A/G Polymorphism Allele and Genotype Frequencies in COPD and Resistant Smokers.
| Frequency |
A |
G |
AA |
AG |
GG |
|
| COPD |
160 (32%) |
336 (68%) |
31 (13%) |
98 (40%) |
119 (48%) |
| n = 248 (%) |
|
|
| Resistant |
142 (36%) |
248 (64%) |
27 (14%) |
88 (45%) |
80 (41%) |
| n = 195 (%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. GG vs AA/AG for COPD vs resistant, Odds ratio (OR)=1.3, 95% confidence limits 0.9-2.0, χ2 (Yates corrected)=1.86, p=0.17,
- GG genotype=susceptible trend
Microsomal Epoxide Hydrolase (MEH) Tyr 113 His T/C (Exon 3) Polymorphism Allele and Genotype Frequency in COPD and Resistant Smokers.
| Frequency |
C |
T |
CC |
CT |
TT |
|
| COPD |
137 (28%) |
361 (72%) |
18 (7%) |
101 (41%) |
130 (52%) |
| n = 249 (%) |
|
|
| Resistant |
130 (34%) |
258 (66%) |
19 (10%) |
92 (47%) |
83 (43%) |
| n = 194 (%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. TT vs CT/CC for COPD vs resistant, Odds ratio (OR)=1.5, 95% confidence limits 1.0-2.2, χ2 (Yates corrected)=3.51, p=0.06,
Microsomal Epoxide Hydrolase (MEH) His 139 Arg A/G (Exon 4) Polymorphism Allele and Genotype Frequency in COPD and Resistant Smokers.
| Frequency |
A |
G |
AA |
AG |
GG |
|
| COPD n = 238 |
372 (78%) |
104 (22%) |
148 (62%) |
76 (32%) |
14 (6%) |
| (%) |
| Resistant |
277 (77%) |
81 (23%) |
114 (64%) |
49 (27%) |
16 (9%) |
| n = 179 (%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. GG vs AA/AG for COPD vs resistant, Odds ratio (OR)=0.64, 95% confidence limits 0.3-1.4, χ2 (Yates uncorrected)=1.43, p=0.23,
- GG genotype=protective (trend)
Lipo-Oxygenase −366 G/A Polymorphism Allele and Genotype Frequencies in the COPD Patients and Resistant Smokers.
| Frequency |
A |
G |
AA |
AG |
GG |
|
| COPD n = 247 |
21 (4%) |
473 (96%) |
1 (0.5%) |
19 (7.5%) |
227 (92%) |
| (%) |
|
|
| Resistant |
25 (7%) |
359 (93%) |
0 (0%) |
25 (13%) |
167 (87%) |
| n = 192 (%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. AA/AG vs GG for COPD vs resistant, Odds ratio (OR)=0.60, 95% confidence limits 0.3-1.1, χ2 (Yates corrected)=2.34, p=0.12,
- AA/AG genotype=protective (GG susceptible) trend
Heat Shock Protein 70 (HSP 70) HOM T2437C Polymorphism Allele and Genotype Frequencies in the COPD Patients and Resistant Smokers.
| Frequency |
C |
T |
CC |
CT |
TT |
|
| COPD n = 199 (%) |
127 |
271 |
5 (3%) |
117 (59%) |
77 (39%) |
|
(32%) |
(68%) |
| Resistant n = 166 |
78 |
254 |
4 (2%) |
70 (42%) |
92 (56%) |
| (%) |
(23%) |
(77%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. CC/CT vs TT for COPD vs resistant, Odds ratio (OR)=2.0, 95% confidence limits 1.3-3.1, χ2 (Yates uncorrected)=9.52, p=0.002,
- CC/CT genotype=susceptible (TT=protective)
Chloride Channel Calcium-Activated 1 (CLCA1) +13924 T/A Polymorphism Allele and Genotype Frequencies in the COPD Patients and Resistant Smokers.
| Frequency |
A |
T |
AA |
AT |
TT |
|
| COPD n = 224 |
282 |
166 |
84 (38%) |
114 (51%) |
26 (12%) |
| (%) |
(63%) |
(37%) |
| Resistant n = 158 |
178 |
138 |
42 (27%) |
94 (59%) |
22 (14%) |
| (%) |
(56%) |
(44%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. AA vs AT/TT for COPD vs resistant, Odds ratio (OR)=1.7, 95% confidence limits 1.0-2.7, χ2 (Yates corrected)=4.51, p=0.03,
Monocyte Differentiation Antigen CD-14 −159 Promoter Polymorphism Allele and Genotype Frequencies in the COPD Patients and Resistant Smokers.
| Frequency |
C |
T |
CC |
CT |
TT |
|
| COPD n = 240 |
268 |
212 |
77 (32%) |
114 (48%) |
49 (20%) |
| (%) |
(56%) |
(44%) |
| Resistant n = 180 |
182 |
178 |
46 (25%) |
90 (50%) |
44 (24%) |
| (%) |
(51%) |
(49%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype CC vs CT/TT for COPD vs Resistant, Odds ratio (OR)=1.4, 95% confidence limits 0.9-2.2, χ2 (Yates uncorrected)=2.12, p=0.15,
Elafin +49 C/T Polymorphism Allele and Genotype Frequencies in the COPD Patients, Resistant Smokers and Controls.
| Frequency |
C |
T |
CC |
CT |
TT |
|
| COPD n = 144 (%) |
247 |
41 |
105 (73%) |
37 (26%) |
2 (1%) |
|
(86%) |
(14%) |
| Resistant n = 75 |
121 |
29 |
49 (65%) |
23 (31%) |
3 (4%) |
| (%) |
(81%) |
(19%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. CT/TT vs CC for COPD vs resistant, Odds ratio (OR)=0.70, 95%
- confidence limits=0.4-1.3, χ2 (Yates uncorrected)=1.36, p=0.24,
- CT/TT genotype=protective (trend only)
- 2. Allele: T vs C for COPD vs resistant, Odds ratio (OR)=0.69, 95% confidence limits=0.4-1.2, χ2 (Yates uncorrected)=1.91, p=0.17,
- T genotype=protective (trend only)
Beta2-Adrenoreceptor Gln 27 Glu Polymorphism Allele and Genotype Frequency in the COPD Patients, Resistant Smokers and Controls.
| Frequency |
C |
G |
CC |
CG |
GG |
|
| Controls |
204 |
168 |
57 (31%) |
89 (48%) |
39 (21%) |
| n = 185 (%) |
(55%) |
(45%) |
| COPD n = 238 |
268 |
208 |
67 (28%) |
134 (56%) |
37 (16%) |
| (%) |
(56%) |
(44%) |
| Resistant |
220 |
170 |
64 (33%) |
92 (47%) |
39 (20%) |
| n = 195 (%) |
(56%) |
(44%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. GG vs CG/CC for COPD vs resistant, Odds ratio (OR)=0.74, 95% confidence limits=0.4-1.2, χ2 (Yates uncorrected)=1.47, p=0.23,
- 2. Genotype. GG vs CG/CC for COPD vs controls, Odds ratio (OR)=0.69, 95% confidence limits=0.4-1.2, χ2 (Yates uncorrected)=2.16, p=0.14,
Maxtrix Metalloproteinase 1 (MMP1) −1607 1G/2G Polymorphism Allele and Genotype Frequencies in COPD Patients, Resistant Smokers and Controls.
| Frequency |
1G |
2G |
1G1G |
1G2G |
2G2G |
|
| Controls n = 174 |
214 |
134 |
68 (39%) |
78 (45%) |
28 (16%) |
| (%) |
(61%) |
(39%) |
| COPD n = 217 |
182 |
252 |
47 (22%) |
88 (41%) |
82 (38%) |
| (%) |
(42%) |
(58%) |
| Resistant n = 187 |
186 |
188 |
46 (25%) |
94 (50%) |
47 (25%) |
| (%) |
(50%) |
(50%) |
|
| *number of chromosomes (2n) |
- 1. Genotype. 1G1G vs rest for COPD vs controls, Odds ratio (OR)=0.43, 95% confidence limits 0.3-0.7, ?2 (Yates uncorrected)=13.3, p=0.0003
- 2. Allele. 1G vs 2G for COPD vs controls, Odds ration (OR)=0.45, 95% confidence limits 0.3-0.6, ?2 (Yates corrected)=28.8, p<0.0001,
- 3. Genotype. 1G1G/1G2G vs rest for COPD vs resistant smokers, Odds ratio (OR)=0.55, 95% confidence limits 0.4-0.9, ?2 (Yates uncorrected)=6.83, p=0.009
- 1G1G/162G genotypes=protective
- 4. Allele. 1G vs 2G for COPD vs resistant smokers, Odds ratio (OR)=0.73, 95% confidence limits 0.6-1.0, ?2 (Yates corrected)=4.61, p=0.03,
- 5. Genotype. 2G2G vs 1G1G/1G2G for COPD vs controls, Odds ratio (OR)=3.17, 95% confidence limits 1.9-5.3, ?2 (Yates uncorrected)=21.4, p<0.0001
- 2G2G genotype=susceptible
- 6. Allele. 2G vs 1G for COPD vs controls, Odds ratio (OR)=2.2, 95% confidence limits 1.6-3.0, ?2 (Yates corrected)=28.8, p<0.00001,
- 7. Genotype. 2G2G vs 1G1G/1G2G for COPD vs resistant, Odds ratio (OR)=1.81, 95% confidence limits 1.2-2.9, ?2 (Yates uncorrected)=6.83, p=0.009
- 2G2G genotype=susceptible
- 8. Allele. 2G vs 1G for COPD vs resistant, Odds ratio (OR)=1.4, 95% confidence limits 1.0-1.8, ?2 (Yates corrected)=4.61, p=0.0.03,
Table 2 below provides a summary of the protective and susceptibility polymorphisms determined for COPD.
| TABLE 2 |
|
| Summary of protective and susceptibility polymorphisms for COPD |
| Gene |
Polymorphism |
Role |
|
| Cyclo-oxygenase 2 (COX2) |
COX2 −765 G/C |
CC/CG protective |
| β2-adrenoreceptor (ADBR) |
ADBR Arg16Gly |
GG susceptible |
| Interleukin-18 (IL18) |
IL18 −133 C/G |
CC susceptible |
| Interleukin-18 (IL18) |
IL18 105 A/C |
AA susceptible |
| Plasminogen activator inhibitor 1 (PAI-1) |
PAI-1 −675 4G/5G |
5G5G susceptible |
| Nitric Oxide synthase 3 (NOS3) |
NOS3 298 Asp/Glu |
TT protective |
| Vitamin D Binding Protein (VDBP) |
VDBP Lys 420 Thr |
AA/AC protective |
| Vitamin D Binding Protein (VDBP) |
VDBP Glu 416 Asp |
TT/TG protective |
| Glutathione S Transferase (GSTP-1) |
GSTP1 Ile105Val |
AA protective |
| Interferon ? (IFN-?) |
IFN-? 874 A/T |
AA susceptible |
| Interleukin-13 (IL13) |
IL13 Arg 130 Gln |
AA protective |
| Interleukin-13 (IL13) |
Il13 −1055C/T |
TT susceptible |
| a1-antitrypsin (a1-AT) |
a1-AT S allele |
MS protective |
| Tissue Necrosis Factor α TNFa |
TNFa +489 G/A |
AA/AG |
|
|
susceptible |
|
|
GG protective |
| Tissue Necrosis Factor α TNFa |
TNFa −308 G/A |
GG protective |
|
|
AA/AG |
|
|
susceptible |
| SMAD3 |
SMAD3 C89Y AG |
AA/AG protective |
|
|
GG susceptible |
| Intracellular adhesion molecule 1 |
ICAM1 E469K |
GG susceptible |
| (ICAM1) |
A/G |
| Caspase (NOD2) |
NOD2 Gly 881Arg |
GC/CC susceptible |
|
G/C |
| Mannose binding lectin 2 (MBL2) |
MBL2 161 G/A |
GG protective |
| Chymase 1 (CMA1) |
CMA1 −1903 G/A |
AA protective |
| N-Acetyl transferase 2 (NAT2) |
NAT2 Arg 197 Gln |
AA protective |
|
G/A |
| Interleukin 1B (IL1B) |
(IL1B) −511 A/G |
GG susceptible |
| Microsomal epoxide hydrolase (MEH) |
MEH Tyr 113 His |
TT susceptible |
|
T/C |
| Microsomal epoxide hydrolase (MEH) |
MEH His 139 Arg |
GG protective |
|
G/A |
| 5 Lipo-oxygenase (ALOX5) |
ALOX5 −366 G/A |
AA/AG protective |
|
|
GG susceptible |
| Heat Shock Protein 70 (HSP 70) |
HSP 70 HOM |
CC/CT susceptible |
|
T2437C |
TT protective |
| Chloride Channel Calcium-activated 1 |
CLCA1 +13924 |
AA susceptible |
| (CLCA1) |
T/A |
| Monocyte differentiation antigen CD-14 |
CD-14 −159 C/T |
CC susceptible |
| Elafin |
Elafin Exon 1 +49 |
CT/TT protective |
|
C/T |
| B2-adrenergic receptor (ADBR) |
ADBR Gln 27 Glu |
GG protective |
|
C/G |
| Matrix metalloproteinase 1 (MMP1) |
MMP1 −1607 |
1G1G/1G2G |
|
1G/2G |
protective |
|
The combined frequencies of the presence or absence of the selected protective genotypes COX2 (−765) CC/CG, β2 adreno-receptor AA, Interleukin-13 AA, Nitic Oxide Synthase 3 TT, and Vitamin D Binding Protein AA observed in the COPD subjects and in resistant smokers is presented below in Table 3.
| TABLE 3 |
|
| Combined frequencies of the presence or absence of selected protective |
| genotypes in COPD subjects and in resistant smokers. |
|
|
|
Number of protective |
|
|
polymorphisms |
| Cohorts |
0 |
1 |
=2 |
Total |
|
| COPD |
136 (54%) |
100 (40%) |
16 (7%) |
252 |
| Resistant smokers |
79 (40%) |
83 (42%) |
34 (17%) |
196 |
| % of smokers with COPD |
136/215 |
100/183 |
16/50 |
|
(63%) |
(55%) |
(32%) |
|
| Comparison |
Odd's ratio |
95% CI |
?2 |
P value |
|
| 0 vs 1 vs 2+, Resist vs COPD |
— |
— |
16.43 |
0.0003 |
| 2+ vs 0-1, Resist vs COPD |
3.1 |
1.6-6.1 |
12.36 |
0.0004 |
| 1+ vs 0, Resist vs COPD |
1.74 |
1.2-2.6 |
7.71 |
0.006 |
|
The combined frequencies of the presence or absence of the selected susceptibility genotypes Interleukin-18 105 AA, PAI-1 −675 5G5G, Interleukin-13 −1055 TT, and Interferon-? −874 AA observed in the COPD subjects and in resistant smokers is presented below in Table 4.
| TABLE 4 |
|
| Combined frequencies of the presence or absence of selected |
| susceptibility genotypes in the COPD subjects and in resistant smokers. |
|
|
|
Number of protective |
|
|
polymorphisms |
| Cohorts |
0 |
1 |
=2 |
Total |
|
| COPD |
66 (26%) |
113 (45%) |
73 (29%) |
252 |
| Resistant smokers |
69 (35%) |
92 (47%) |
35 (18%) |
196 |
| % of smokers with |
66/135 |
113/205 |
73/108 |
| COPD |
(49%) |
(55%) |
(68%) |
|
| Comparison |
Odd's ratio |
95% CI |
?2 |
P value |
|
| 0 vs 1 vs 2+, COPD vs Resist |
— |
— |
8.72 |
0.01 |
| 2+ vs 0-1, COPD vs Resist |
1.9 |
1.2-3.0 |
6.84 |
0.009 |
| 1+ vs 0, COPD vs Resist |
1.5 |
1.0-3.5 |
3.84 |
0.05 |
|
The combined frequencies of the presence or absence of the protective genotypes COX2 (−765) CC/CG, Interleukin-13 AA, Nitic Oxide Synthase 3 TT, Vitamin D Binding Protein AA/AC, GSTP1 AA, and a1-antitypsin MS/SS, observed in the COPD subjects and in resistant smokers is presented below in Table 5 and in FIG. 1.
| TABLE 5 |
|
| Combined frequencies of the presence or absence of selected protective |
| genotypes in the COPD subjects and in resistant smokers. |
|
|
|
Number of protective |
|
|
polymorphisms |
| Cohorts |
0 |
1 |
=2 |
Total |
|
| COPD |
51 (19%) |
64 (24%) |
150 (57%) |
265 |
| Resistant smokers |
16 (8%) |
56 (27%) |
133 (65%) |
205 |
| % of smokers with COPD |
51/76 |
64/120 |
150/283 |
|
(76%) |
(53%) |
(53%) |
|
| Comparison |
Odd's ratio |
95% CI |
?2 |
P value |
|
| 0 vs 1 vs 2+, Resist vs COPD |
— |
— |
12.14 |
0.0005 |
| 1+ vs 0, Resist vs COPD |
2.82 |
1.5-5.3 |
11.46 |
0.0004 |
|
Protective polymorphisms were assigned a score of +1 while susceptibility polymorphisms were assigned a score of −1. For each subject, a net score was then calculated according to the presence of susceptibility and protective genotypes. This produced a linear spread of values. When assessed as a range between −3 to +3, a linear relationship as depicted in FIG. 2 was observed. This analysis indicates that for subjects with a net score of −2 or less, there was a 70% or greater risk of having COPD. In contrast, for subjects with a net score of 2+ or greater the risk was approximately 40% (see FIG. 2).
In an analysis in which the value of a given polymorphism was weighted based on the Odd's ratio for that polymorphism (generated by comparing its frequency between resistant and COPD subjects), a linear relationship was again observed. This analysis allowed for the distinction of smokers at high or low risk of having COPD.
I. Example 2
Case Association Study—OCOPD Methods
Subject Recruitment
Subjects of European decent who had been exposed to chronic smoking (minimum 15 pack years) and aero-pollutants in the work place (noxious dusts or fumes) were identified from respiratory clinics. After spirometric testing those with occupational chronic obstructive pulmonary disease (OCOPD) with forced expiratory volume in one second (FEV1) as a percentage of predicted <70% and a FEV1/FVC ratio (Forced expiratory volume in one second/Forced vital capacity) of <79% (measured using American Thoracic Society criteria) were recruited. One hundred and thirty-nine subjects were recruited, of these 70% were male, the mean FEV1/FVC (±Standard Deviation) was 54% (SD 15), mean FEV1 as a percentage of predicted was 46 (SD 19). Mean age, cigarettes per day, and pack year history was 62 yrs (SD 9), 25 cigarettes/day (SD 16) and 53 pack years (SD 31), respectively. One hundred and twelve European subjects who had smoked a minimum of fifteen pack years and similarly been exposed in the work place to potentially noxious dusts or fumes were also studied. This control group was recruited through community studies of lung function and were 81% male; the mean FEV1/FVC (SD) was 81% (SD 8), and mean FEV1 as a percentage of predicted was 96 (SD 10). Mean age, cigarettes per day and pack year history was 58 yrs (SD 11), 26 cigarettes/day (SD 14) and 45 pack years (SD 28), respectively. Using a PCR based method [1], all subjects were genotyped for the α1-antitrypsin mutations (M, S and Z alleles) and those with the ZZ allele were excluded. The OCOPD and resistant smoker cohorts were matched for subjects with the MZ genotype (6% in each cohort). They were also matched for age started smoking (mean 16 yr) and aged stopped smoking (mid fifties). 190 European blood donors (smoking and occupational exposure status unknown) were recruited consecutively through local blood donor services. Sixty-three percent were men and their mean age was 50 years. On regression analysis, the age difference and pack years difference observed between OCOPD sufferers and resistant smokers was found not to determine FEV or OCOPD.
Summary of Characteristics for the OCOPD and Exposed Resistant Smoker Cohorts.
|
| Parameter |
OCOPD |
Exposed resistant |
|
| Mean (SD) |
(N = 139) |
smokers (N = 112) |
Differences |
|
| % male |
70% |
81% |
P < 0.05 |
| Age (yrs) |
62 (9) |
58 (11) |
ns |
| Pack years |
53 (31) |
45 (28) |
P < 0.05 |
| Cigarettes/day |
25 (16) |
26 (14) |
ns |
| FEV1 (L) |
1.3 (0.7) |
3.0 (0.7) |
P < 0.05 |
| FEV1 % predict |
46 (19) |
96% (10) |
P < 0.05 |
| FEV1/FVC |
54 (15) |
81 (8) |
P < 0.05 |
|
Means and 1SD
Cyclooxygenase 2 (COX2) −765 G/C Promoter Polymorphism and a1-Antitrypsin Genotyping
Genomic DNA was extracted from whole blood samples [2]. The COX2 −765 polymorphism was determined by minor modifications of a previously published method [3]. The PCR reaction was carried out in a total volume of 25 ul and contained 20 ng genomic DNA, 500 pmol forward and reverse primers, 0.2 mM dNTPs, 10 mM Tris-HCL (pH 8.4), 150 mM KCl, 1.0 mM MgCl2 and 1 unit of Taq polymerase (Life Technologies). Cycling times were incubations for 3 min at 95° C. followed by 33 cycles of 50 s at 94° C., 60 s at 66° C. and 60 s at 72° C. A final elongation of 10 min at 72° C. then followed. 4 ul of PCR products were visualised by ultraviolet trans-illumination of a 6% agarose gel stained with ethidium bromide. An aliquot of 3 ul of amplification product was digested for 1 hr with 4 units of AciI (Roche Diagnostics, New Zealand) at 37° C. Digested products were separated on a 2.5% agarose gel run for 2.0 hrs at 80 mV with TBE buffer and visualised using ultraviolet transillumination after ethidium bromide staining against a 123 bp ladder. Using a PCR based method discussed above [3], all smoking subjects were genotyped for the α1-antitrypsin M, S and Z alleles.
Genotyping of the Superoxide Dismutase 3 Arg 312 Gln Polymorphism
Genomic DNA was extracted using standard phenol and chloroform methods. Cohorts of patients and controls were configured in to 96-well PCR format containing strategic negative controls. The assay primers, PCR conditions and RFLP assays details have been previously described [4, herein incorporated by reference in its entirety]. Genotyping was done using minor modifications of the above protocol optimised for laboratory conditions. The PCR reactions were amplified in MJ Research thermocyclers in a total volume of 25 μl and contained 80 ng genomic DNA, 10 pmol forward and reverse primers, 0.1 mM dNTPs, 10 mM Tris-HCL (pH 8.4), 150 mM KCl, 1.0 mM MgCl2 and 0.5 unit of Taq polymerase (Qiagen). Aliquots of amplification product were digested for 4 hrs with 5 U of the relevant restriction enzymes (Roche Diagnostics, New Zealand) at designated temperatures and conditions. Digested products were separated on 8% polyacrylamide gels (49:1, Sigma). The products were visualised by ultraviolet transillumination following ethidium bromide staining and migration compared against a 1 Kb plus ladder standard (Invitrogen). Genotypes were recorded in data spreadsheets and statistical analysis performed.
Genotyping of the Microsomal Epoxide Hydrolase Exon 3 TC Polymorphism
Genomic DNA was extracted using standard phenol and chloroform methods. Cohorts of patients and controls were configured in to 96-well PCR format containing strategic negative controls. The assay primers, PCR conditions and RFLP assays details have been previously described [5, herein incorporated by reference in its entirety]. Genotyping was done using minor modifications of the above protocol optimised for laboratory conditions. The PCR reactions were amplified in MJ Research thermocyclers in a total volume of 25 μl and contained 80 ng genomic DNA, 100 ng forward and reverse primers, 0.2 mM dNTPs, 10 mM Tris-HCL (pH 8.4), 150 mM KCl, 1.5 mM MgCl2 and 1.0 unit of Taq polymerase (Qiagen). Cycling conditions consisted of 94° C. 60 s, 56° C. 20 s, 72° C. 20 s for 38 cycles with an extended last extension of 3 min. Aliquots of amplification product were digested for 4 hrs with 5 U of the relevant restriction enzymes Eco RV (Roche Diagnostics, New Zealand) at designated temperature conditions. Digested products were separated on 8% polyacrylamide gels (49:1, Sigma). The products were visualised by ultraviolet transillumination following ethidium bromide staining and migration compared against a 1 Kb plus ladder standard (Invitrogen). Genotypes were recorded in data spreadsheets and statistical analysis performed.
Genotyping of the 3′ 1237 G/A (T/T) Polymorphism of the a1-Antitrypsin Gene
Genomic DNA was extracted using standard phenol and chloroform methods. Cohorts of patients and controls were configured in to 96-well PCR format containing strategic negative controls. The assay primers, PCR conditions and RFLP assays details have been previously described [Sandford A J et al., [6], each of which is herein incorporated by reference in its entirety]. Genotyping was done using minor modifications of the above protocol optimised for laboratory conditions The PCR reactions were amplified in MJ Research thermocyclers in a total volume of 25 μl and contained 80 ng genomic DNA, 100 ng forward and reverse primers, 0.2 mM dNTPs, 10 mM Tris-HCL (pH 8.4), 150 mM KCl, 1.5 mM MgCl2 and 1.0 unit of Taq polymerase (Qiagen). Forward and reverse prime sequences were 5′-CTACCAGGAATGGCCTTGTCC-3′ [SEQ.ID.NO.136] and 5′-CTCTCAGGTCTGGTGTCATCC-3′ [SEQ.ID.NO.137]. Cycling conditions consisted of 94 C 60 s, 56 C 20 s, 72 C 20 s for 38 cycles with an extended last extension of 3 min. Aliquots of amplification product were digested for 4 hrs with 2 Units of the restriction enzymes Taq 1 (Roche Diagnostics, New Zealand) at designated temperature conditions. Digested products were separated on 3% agarose. The products were visualised by ultraviolet transillumination following ethidium bromide staining and migration compared against a 1 Kb plus ladder standard (Invitrogen). Genotypes were recorded in data spreadsheets and statistical analysis performed.
Genotyping of the Asp 299 Gly Polymorphism of the Toll-Like Receptor 4 Gene
Genomic DNA was extracted using standard phenol and chloroform methods. Cohorts of patients and controls were configured in to 96-well PCR format containing strategic negative controls. The assay primers, PCR conditions and RFLP assays details have been previously described [6]. Genotyping was done using minor modifications of the above protocol optimised for laboratory conditions The PCR reactions were amplified in MJ Research thermocyclers in a total volume of 25 μl and contained 80 ng genomic DNA, 100 ng forward and reverse primers, 0.2 mM dNTPs, 10 mM Tris-HCL (pH 8.4), 150 mM KCl, 1.5 mM MgCl2 and 1.0 unit of Taq polymerase (Qiagen). Forward and reverse prime sequences were 5′-GATTAGCATACTTAGACTACTACCTCCATG-3′ [SEQ.ID.NO.138] and 5′-GATCAACTTCTGAAAAAGCATTCCCAC-3′ [SEQ.ID.NO.139]. Cycling conditions consisted of 94° C. 30 s, 55° C. 30 s, 72° C. 30 s for 30 cycles with an extended last extension of 3 min. Aliquots of amplification product were digested for 4 hrs with 2 U of the restriction enzyme Nco I (Roche Diagnostics, New Zealand) at designated temperature conditions. Digested products were separated on 3% agarose gel. The products were visualised by ultraviolet transillumination following ethidium bromide staining and migration compared against a 1 Kb plus ladder standard (Invitrogen). Genotypes were recorded in data spreadsheets and statistical analysis performed.
Genotyping of the −1607 1G2G Polymorphism of the Matrix Metalloproteinase 1 Gene
Genomic DNA was extracted using standard phenol and chloroform methods. Cohorts of patients and controls were configured in to 96-well PCR format containing strategic negative controls. The assay primers, PCR conditions and RFLP assays details have been previously described [Dunleavey L, et al]. Genotyping was done using minor modifications of the above protocol optimised for laboratory conditions The PCR reactions were amplified in MJ Research thermocyclers in a total volume of 25 μl and contained 80 ng genomic DNA, 100 ng forward and reverse primers, 200 mM dNTPs, 20 mM Tris-HCL (pH 8.4), 50 mM KCl, 1.5 mM MgCl2 and 1.0 unit of Taq polymerase (Qiagen). Forward and reverse prime sequences were 3′ TCGTGAGAATGTCTTCCCATT-3′ [SEQ.ID.NO.140] and 5′-TCTTGGATTGATTTGAGATAAGTGAAATC-3′ [SEQ.ID.NO.141]. Cycling conditions consisted of 94 C 60 s, 55 C 30 s, 72 C 30 s for 35 cycles with an extended last extension of 3 min. Aliquots of amplification product were digested for 4 hrs with 6 Units of the restriction enzymes XmnI (Roche Diagnostics, New Zealand) at designated temperature conditions. Digested products were separated on 6% polyacrylamide gel. The products were visualised by ultraviolet transillumination following ethidium bromide staining and migration compared against a 1 Kb plus ladder standard (Invitrogen). Genotypes were recorded in data spreadsheets and statistical analysis performed.
Other Polymorphism Genotyping
Genomic DNA was extracted from whole blood samples [4]. Purified genomic DNA was aliquoted (10 ng/ul concentration) into 96 well plates and genotyped on a Sequenom™ system (Sequenom™ Autoflex Mass Spectrometer and Samsung 24 pin nanodispenser) using the sequences, amplification conditions and methods described below.
The following conditions were used for the PCR multiplex reaction: final concentrations were for 10× Buffer 15 mM MgCl2 1.25×, 25 mM MgCl2 1.625 mM, dNTP mix 25 mM 500 uM, primers 4 uM 100 nM, Taq polymerase (Quiagen hot start) 0.15 u/reaction, Genomic DNA 10 ng/ul. Cycling times were 95° C. for 15 min, (5° C. for 15 s, 56° C. 30 s, 72° C. 30 s for 45 cycles with a prolonged extension time of 3 min to finish. We used shrimp alkaline phosphotase (SAP) treatment (2 ul to 5 ul PCR reaction) incubated at 35° C. for 30 min and extension reaction (add 2 ul to 7 ul after SAP treatment) with the following volumes per reaction of water 0.76 ul, hME 10× termination buffer 0.2 ul, hME primer (10 uM) 1 ul, MassEXTEND enzyme 0.04 ul.
Sequenom Conditions for the Polymorphisms Genotyping—1
|
| SNP_ID |
TERM |
WELL |
2nd-PCRP |
1st-PCRP |
|
|
| VDBP - 420 |
ACT |
W1 |
ACGTTGGATGGCTTGTTAACCAGCTT |
ACGTTGGATGTTTTTCAGACTGGCAG |
|
|
|
|
TGCC [SEQ. ID. NO. 142] |
AGCG [SEQ. ID. NO. 143] |
| |
| VDBP - 416 |
ACT |
W1 |
ACGTTGGATGTTTTTCAGACTGGCAG |
ACGTTGGATGGCTTGTTAACCAGCTTT |
|
|
|
AGCG [SEQ. ID. NO. 144] |
GCC [SEQ. ID. NO. 145] |
| |
| ADRB2- |
ACT |
W2 |
ACGTTGGATGTTGCTGGCACCCAATG |
ACGTTGGATGATGAGAGACATGACGA |
| Gln27Glu |
|
|
GAAG [SEQ. ID. NO. 146] |
TGCC [SEQ. ID. NO. 147] |
| |
| GSTP1 -105 |
ACT |
W2 |
ACGTTGGATGTGGTGGACATGGTGAA |
ACGTTGGATGTGGTGCAGATGCTCAC |
|
|
|
TGAC [SEQ. ID. NO. 148] |
ATAG [SEQ. ID. NO. 149] |
| |
| PAI1 G-675G |
ACT |
W2 |
ACGTTGGATGCACAGAGAGAGTCTGG |
ACGTTGGATGCTCTTGGTCTTTCCCTC |
|
|
|
ACAC [SEQ. ID. NO. 150] |
ATC |
|
|
|
|
[SEQ. ID. NO. 151] |
| |
| IL-11 G518A |
ACT |
W3 |
ACGTTGGATGCCTCTGATCCTCTTTGC |
ACGTTGGATGAAGAGGGAGTGGAAG |
|
|
|
TTC [SEQ. ID. NO. 152] |
GGAAG [SEQ. ID. NO. 153] |
| |
| NOS3 - 298 |
ACT |
W3 |
ACGTTGGATGACAGCTCTGCATTCAG |
ACGTTGGATGAGTCAATCCCTTTGGT |
|
|
|
CACG [SEQ. ID. NO. 154] |
GCTC [SEQ. ID. NO. 155] |
| |
| IL-8 A-251T |
CGT |
W5 |
ACGTTGGATGACTGAAGCTCCACAAT |
ACGTTGGATGGCCACTCTAGTACTAT |
|
|
|
TTGG [SEQ. ID. NO. 156] |
ATCTG [SEQ. ID. NO. 157] |
| |
| IL-18 C-133G |
ACT |
W6 |
ACGTTGGATGGGGTATTCATAAGCTG |
ACGTTGGATGCCTTCAAGTTCAGTGG |
|
|
|
AAAC [SEQ. ID. NO. 158] |
TCAG [SEQ. ID. NO. 159] |
| |
| IL-18 A105C |
ACT |
W8 |
ACGTTGGATGGGTCAATGAAGAGAA |
ACGTTGGATGAATGTTTATTGTAGAA |
|
|
|
CTTGG [SEQ. ID. NO. 160] |
AACC [SEQ. ID. NO. 161] |
|
Sequenom Conditions for the Polymorphisms Genotyping—2
|
| SNP_ID |
AMP_LEN |
UP_CONF |
MP_CONF |
Tm(NN) |
PcGC |
PWARN |
UEP_DIR |
|
|
| VDBP - 420 |
99 |
99.7 |
99.7 |
46.2 |
53.3 |
ML |
R |
| VDBP - 416 |
99 |
99.7 |
99.7 |
45.5 |
33.3 |
M |
F |
| ADRB2-Gln27Glu |
118 |
96.6 |
80 |
52.2 |
66.7 |
L |
F |
| GSTP1 -105 |
107 |
99.4 |
80 |
49.9 |
52.9 |
|
F |
| PAI1 G-675G |
109 |
97.9 |
80 |
59.3 |
66.7 |
g |
F |
| IL-11 G518A |
169 |
97.5 |
65 |
52.9 |
52.6 |
s |
F |
| NOS3 - 298 |
186 |
98.1 |
65 |
61.2 |
63.2 |
|
F |
| IL-8 A-251T |
119 |
92.6 |
81.2 |
45.9 |
28.6 |
|
R |
| IL-18 C-133G |
112 |
93.5 |
74.3 |
41.8 |
46.7 |
L |
F |
| IL-18 A105C |
121 |
67.2 |
74.3 |
48.9 |
40 |
|
R |
|
Sequenom Conditions for the Polymorphisms Genotyping—3
|
| SNP_ID |
UEP_MASS |
UEP_SEQ |
EXT1_CALL |
EXT1_MASS |
|
|
| VDBP - 420 |
4518.9 |
AGCTTTGCCAGTTCC[SEQ. ID. NO. 162] |
A |
4807.1 |
|
| |
| VDBP - 416 |
5524.6 |
AAAAGCAAAATTGCCTGA[SEQ. ID. NO. |
T |
5812.8 |
|
|
163] |
| |
| ADRB2- |
4547 |
CACGACGTCACGCAG[SEQ. ID. NO. 164] |
C |
4820.2 |
| Gln27Glu |
| |
| GSTP1 -105 |
5099.3 |
ACCTCCGCTGCAAATAC[SEQ. ID. NO. 165] |
A |
5396.5 |
| |
| PAI1 G-675G |
5620.6 |
GAGTCTGGACACGTGGGG[SEQ. ID. NO. |
DEL |
5917.9 |
|
|
166] |
| |
| IL-11 G518A |
5705.7 |
TCCATCTCTGTGGATCTCC[SEQ. ID. NO. |
A |
6002.9 |
|
|
167] |
| |
| NOS3 - 298 |
5813.8 |
TGCTGCAGGCCCCAGATGA[SEQ. ID. NO. |
T |
6102 |
|
|
168] |
| |
| IL-8 A-251T |
6428.2 |
CACAATTTGGTGAATTATCAA[SEQ. ID. |
A |
6716.4 |
|
|
NO. 169] |
| |
| IL-18 C-133G |
4592 |
AGCTGAAACTTCTGG[SEQ. ID. NO. 170] |
C |
4865.2 |
| |
| IL-18 A105C |
6085 |
TCAAGCTTGCCAAAGTAATC[SEQ. ID. |
A |
6373.2 |
|
|
NO. 171] |
|
Sequenom Conditions for the Polymorphisms Genotyping—4
|
| SNP_ID |
EXT1_SEQ |
EXT2_CALL |
EXT2_MASS |
EXT2_SEQ |
1stPAUSE |
|
|
| VDBP - 420 |
AGCTTTGCCAGTTCCT |
C |
5136.4 |
AGCTTTGCCAGTTCCGT |
4848.2 |
|
|
[SEQ. ID. NO. 172] |
|
|
[SEQ. ID. NO. 173] |
| |
| VDBP - 416 |
AAAAGCAAAATTGCCTGA |
G |
6456.2 |
AAAAGCAAAATTGCCTGAG |
5853.9 |
|
T [SEQ. ID. NO. 174] |
|
|
GC [SEQ. ID. NO. 175] |
| |
| ADRB2- |
CACGACGTCACGCAGC |
G |
5173.4 |
CACGACGTCACGCAGGA |
4876.2 |
| Gln27Glu |
[SEQ. ID. NO. 176] |
|
|
[SEQ. ID. NO. 177] |
| |
| GSTP1 -105 |
ACCTCCGCTGCAAATACA |
G |
5716.7 |
ACCTCCGCTGCAAATACGT |
5428.5 |
|
[SEQ. ID. NO. 178] |
|
|
[SEQ. ID. NO. 179] |
| |
| PAI1 G-675G |
GAGTCTGGACACGTGGGG |
G |
6247.1 |
GAGTCTGGACACGTGGGGG |
5949.9 |
|
A [SEQ. ID. NO. 180] |
|
|
A [SEQ. ID. NO. 181] |
| |
| IL-11 G518A |
TCCATCTCTGTGGATCTCC |
G |
6323.1 |
TCCATCTCTGTGGATCTCC |
6034.9 |
|
A [SEQ. ID. NO. 182] |
|
|
GT [SEQ. ID. NO. 183] |
| |
| NOS3 - 298 |
TGCTGCAGGCCCCAGATG |
G |
6416.2 |
TGCTGCAGGCCCCAGATGA |
6143 |
|
AT [SEQ. ID. NO. 184] |
|
|
GC [SEQ. ID. NO. 185] |
| |
| IL-8 A-251T |
CACAATTTGGTGAATTAT |
T |
7029.6 |
CACAATTTGGTGAATTATC |
6741.4 |
|
CAAT [SEQ. ID. NO. 186] |
|
|
AAAT [SEQ. ID. NO. 187] |
| |
| IL-18 C-133G |
AGCTGAAACTTCTGGC |
G |
5218.4 |
AGCTGAAACTTCTGGGA |
4921.2 |
|
[SEQ. ID. NO. 188] |
|
|
[SEQ. ID. NO. 189] |
| |
| IL-18 A105C |
TCAAGCTTGCCAAAGTAA |
C |
7040.6 |
TCAAGCTTGCCAAAGTAAT |
6414.2 |
|
TCT [SEQ. ID. NO. 190] |
|
|
CGGA[SEQ. ID. NO. 191] |
|
Results
Frequencies of individual polymorphisms are as follows:
| TABLE 6 |
|
| Polymorphism allele and genotype frequency in the OCOPD patients, |
| exposed resistant smokers and controls. |
|
| Cyclo-oxygenase 2 −765 G/C |
| Frequency |
C |
G |
CC |
CG |
GG |
|
| Controls n = 95 (%) |
27 (14%) |
161 (86%) |
3 (3%) |
21 (22%) |
70 (75%) |
| OCOPD n = 82 (%) |
22 (13%) |
1424 (87%) |
2 (2%) |
18 (22%) |
623 (76%) |
| Resistant n = 87 (%) |
422 (24%) |
132 (76%) |
61 (7%) |
301 (34%) |
51 (59%) |
|
| Glutathione S Transferase P1 Ile 105 Val (A/G) |
| Frequency |
A |
G |
AA |
AG |
GG |
|
| Controls n = 186 (%) |
234 (63%) |
138 (37%) |
71 (38%) |
92 (50%) |
23 (12%) |
| OCOPD n = 123 (%) |
159 (65%) |
87 (36%) |
52 (42%) |
55 (45%) |
165 (13%) |
| Resistant n = 98 (%) |
136 (69%) |
60 (31%) |
44 (45%) |
48 (49%) |
6 (6%) |
|
| Frequency |
C |
A |
CC |
AC |
AA |
|
| Controls n = 185 (%) |
119 (32%) |
251 (68%) |
22 (12%) |
75 (40%) |
88 (48%) |
| OCOPD n = 122 (%) |
62 (25%) |
182 (75%) |
12 (10%) |
38 (31%) |
726,7 (59%) |
| Resistant n = 98 (%) |
60 (31%) |
136 (69%) |
6 (6%) |
48 (49%) |
44 (45%) |
|
| Frequency |
G |
C |
GG |
GC |
CC |
|
| Controls n = 188 (%) |
121 (32%) |
255 (68%) |
23 (12%) |
75 (40%) |
90 (48%) |
| OCOPD n = 122 |
62 (25%) |
182 (75%) |
12 (10%) |
38 (31%) |
728,9 (59%) |
| Resistant n = 97 (%) |
60 (31%) |
134 (69%) |
6 (6%) |
48 (50%) |
43 (44%) |
|
| Frequency |
A |
T |
AA |
AT |
TT |
|
| Controls n = 188 (%) |
175 (47%) |
201 (53%) |
39 (21%) |
97 (52%) |
52 (28%) |
| OCOPD n = 116 |
101 (44%) |
131 (56%) |
21 (18%) |
59 (51%) |
36 (31%) |
| Resistant n = 93 (%) |
9411 (50%) |
92 (49%) |
2610 (28%) |
42 (45%) |
25 (27%) |
|
| Vitamin D Binding Protein Lys 420 Thr (A/C) |
| Frequency |
A |
C |
AA |
AC |
CC |
|
| Controls n = 189 (%) |
113 (30%) |
265 (70%) |
17 (9%) |
79 (42%) |
93 (49%) |
| OCOPD n = 122 (%) |
62 (25%) |
182 (75%) |
5 (4%) |
52 (43%) |
6514 (53%) |
| Resistant n = 99 (%) |
7313 (37%) |
125 (63%) |
1212 (12%) |
49 (50%) |
38 (38%) |
|
| Vitamin D Binding Protein Glu 416 Asp (T/G) |
| Frequency |
T |
G |
TT |
TG |
GG |
|
| Controls n = 189 (%) |
163 (43%) |
215 (57%) |
35 (19%) |
93 (49%) |
61 (32%) |
| OCOPD n = 122 (%) |
109 (45%) |
135 (55%) |
25 (21%) |
59 (48%) |
3817 (31%) |
| Resistant n = 99 (%) |
10316 (52%) |
95 (48%) |
2315 (23%) |
5715 (58%) |
19 (19%) |
|
| Microsomal epxoide hydrolase R/r Exon 3 T/C |
| Frequency |
r |
R |
rr |
Rr |
RR |
|
| Controls n = 184 (%) |
228 (62%) |
140 (38%) |
77 (42%) |
74 (40%) |
33 (18%) |
| OCOPD n = 98 (%) |
144 (74%) |
52 (26%) |
55 (56%) |
34 (35%) |
9 (9%) |
| Resistant n = 102 (%) |
135 (66%) |
69 (34%) |
52 (51%) |
31 (30%) |
1918 (19%) |
|
| Super oxide dismutase 3 Arg 312 Gln |
| Frequency |
A |
G |
AA |
AG |
GG |
|
| Controls n = 190 (%) |
371 (98%) |
9 (2%) |
183 (96%) |
5 (3%) |
2 (1%) |
| OCOPD n = 100 (%) |
19920 (99%) |
1 (1%) |
99 (99%) |
1 (1%) |
0 (0%) |
| Resistant n = 102 (%) |
193 (95%) |
1120 (5%) |
92 (90%) |
919 (9%) |
119 (1%) |
|
| Frequency |
M |
S |
MM |
MS |
SS |
|
| OCOPD n = 88 (%) |
171 (97%) |
5 (3%) |
83 (94%) |
5 (6%) |
0 (0%) |
| Resistant n = 94 (%) |
175 (93%) |
1322 (7%) |
81 (86%) |
1321 (14%) |
0 (0%) |
|
| Toll-like receptor 4 Asp 299 Gly A/G |
| Frequency |
A |
G |
AA |
AG |
GG |
|
| OCOPD n = 60 (%) |
117 (98%) |
1 (2%) |
58 (98%) |
1 (2%) |
0 (0%) |
| Resistant n = 34 (%) |
65 (96%) |
3 (4%) |
31 (91%) |
323 (9%) |
0 (0%) |
|
| Beta2-adrenoreceptor Gln 27 Glu |
| Frequency |
C |
G |
CC |
CG |
GG |
|
| Controls n = 186 (%) |
204 (55%) |
168 (45%) |
57 (31%) |
90 (48%) |
39 (21%) |
| OCOPD n = 122 (%) |
129 (53%) |
115 (47%) |
32 (26%) |
65 (53%) |
25 (21%) |
| Resistant n = 99 (%) |
117 (59%) |
81 (41%) |
3824 (38%) |
41 (41%) |
20 (20%) |
|
| Interleukin 11 (IL-11) −518 G/A |
| Frequency |
A |
G |
AA |
AG |
GG |
|
| OCOPD n = 119 (%) |
110 (46%) |
128 (54%) |
22 (19%) |
66 (55%) |
31 (26%) |
| Resistant n = 98 (%) |
103 (53%) |
93 (47%) |
2625 (27%) |
51 (52%) |
21 (21%) |
|
| Frequency |
T |
C |
TT |
TC |
CC |
|
| Controls n = 182 (%) |
65 (18%) |
299 (82%) |
5 (3%) |
55 (30%) |
122 (67%) |
| OCOPD n = 121 (%) |
53 (22%) |
189 (78%) |
526 (4%) |
43 (36%) |
73 (60%) |
| Resistant n = 97 (%) |
31 (16%) |
163 (84%) |
1 (1%) |
29 (30%) |
67 (69%) |
|
| Plasminogen activator inhibitor 1 −675 4G/5G |
| Frequency |
5G |
4G |
5G5G |
5G4G |
4G4G |
|
| Controls n = 186 (%) |
158 (42%) |
214 (58%) |
31 (17%) |
96 (52%) |
59 (32%) |
| OCOPD n = 122 (%) |
11528 (47%) |
129 (53%) |
2927 (24%) |
57 (47%) |
36 (30%) |
| Resistant n = 98 (%) |
76 (39%) |
120 (61%) |
14 (14%) |
48 (49%) |
36 (37%) |
|
| Nitric oxide synthase 3 Asp 298 Glu (T/G) |
| Frequency |
T |
G |
TT |
TG |
GG |
|
| Controls n = 183 (%) |
108 (30%) |
258 (70%) |
13 (7%) |
82 (45%) |
88 (48%) |
| OCOPD n = 120 (%) |
71 (30%) |
169 (70%) |
10 (8%) |
51 (43%) |
59 (49%) |
| Resistant n = 99 (%) |
71 (36%) |
127 (64%) |
1529,30 (15%) |
41 (41%) |
43 (43%) |
|
| a1-antitrypsin 3′ 1237 G/A (T/t) |
| Frequency |
T |
t |
TT |
Tt |
tt |
|
| Controls n = 178 (%) |
345 (97%) |
11 (3%) |
167 (94%) |
11 (6%) |
0 (0%) |
| COPD n = 61 (%) |
109 (89%) |
13 (11%)32 |
50 (82%) |
9 (15%)31 |
2 (3%)31 |
| Resistant n = 35 (%) |
67 (96%) |
3 (4%) |
32 (91%) |
3 (9%) |
0 (0%) |
|
| Matrix metalloproteinase 1 −1607 1G/2G |
| Frequency |
1G |
2G |
1G1G |
1G2G |
2G2G |
|
| Controls n = 174 (%) |
214 (61%) |
134 (39%) |
68 (39%) |
78 (45%) |
28 (16%) |
| COPD n = 93 (%) |
90 (48%) |
96 (52%)34 |
24 (26%) |
42 (45%) |
27 (29%)33 |
| Resistant n = 94 (%) |
99 (53%) |
89 (47%) |
25 (27%) |
49 (52%) |
20(21%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. CC/CG vs GG for resistant vs OCOPD, Odds ratio (OR)=2.2, 95% confidence limits=1.1-4.8, χ2 (Yates corrected)=4.76, P=1.03, CC/CG=protective
- 2. Allele. C vs G for resistant vs OCOPD, Odds ratio (OR)=2.1, 95% confidence limits 1.1-3.8, χ2 (Yates corrected)=5.65, p=0.02. C=protective
- 3. Genotype. GG vs CG/CC for OCOPD vs resistant, Odds ratio (OR)=0.5, 95% confidence limits=0.2-0.9, χ2 (Yates corrected)=4.76, P=0.03. GG=susceptible
- 4. Allele. G vs C for OCOPD vs resistant, Odds ratio (OR)=0.5, 95% confidence limits 0.3-0.9, χ2 (Yates corrected)=5.65, p=0.02. G=susceptible
- 5. Genotype. GG vs AG/AA for OCOPD vs resistant, Odds ratio (OR)=2.3, 95% confidence limits=0.8-6.9, χ2 (Yates uncorrected)=2.88, p=0.09. GG genotype=susceptible
- 6. Genotype. AA vs AC/CC for OCOPD vs resistant, Odds ratio (OR)=1.8, 95% confidence limits=1.0-3.1, χ2 (Yates corrected)=3.8, p=0.05. AA=susceptibility
- 7. Genotype. AA vs AC/CC for OCOPD vs controls, Odds ratio (OR)=1.6, 95% confidence limits 1.0-2.6, χ2 (Yates uncorrected)=3.86, p=0.05. AA=susceptibility
- 8. Genotype. CC vs CG/GG for OCOPD vs controls, Odds ratio (OR)=1.6, 95% confidence limits=1.0-2.6, χ2 (Yates uncorrected)=3.68, p=0.05. CC=susceptibility
- 9. Genotype. CC vs CG/GG for OCOPD vs resistant, Odds ratio (OR)=1.8, 95% confidence limits 1.0-3.2, χ2 (Yates corrected)=4.10, p=0.04. CC=susceptibility
- 10. Genotype. AA vs AT/TT for OCOPD vs resistant, Odds ratio (OR)=1.8, 95% confidence limits=0.9-3.6, χ2 (Yates uncorrected)=2.88, p=0.09. AA=protective
- 11. Allele. A vs T for OCOPD vs resistant, Odds ratio (OR)=1.3, 95% confidence limits=0.9-2.0, χ2 (Yates uncorrected)=2.3, p=0.15. A=protective
- 12. Genotype. AA vs AC/CC for resistant vs OCOPD, Odds ratio (OR)=3.2, 95% confidence limits=1.0-11.0, χ2 (Yates corrected)=3.89, p=0.05. AA genotype=protective
- 13. Allele. A vs C for resistant vs OCOPD, Odds ratio (OR)=1.7, 95% confidence limits 1.1-2.6, χ2 (Yates corrected)=6.24, p=0.01. A allele=protective
- 14. Genotype. CC vs AC/AA for OCOPD vs resistant, Odds ratio (OR)=1.8, 95% confidence limits=1.0-3.3, χ2 (Yates corrected)=4.29, p=0.04. CC genotype=susceptibility
- 15. Genotype. TT/TG vs GG for resistant vs OCOPD, Odds ratio (OR)=1.9, 95% confidence limits=1.0-38, χ2 (Yates uncorrected)=4.08, p=0.04. TT/TG genotype=protective
- 16. Allele. T vs G for resistant vs OCOPD, Odds ratio (OR)=1.3, 95% confidence limits 0.9-2.0, χ2 (Yates uncorrected)=2.36, p=0.12. A allele=protective
- 17. Genotype. GG vs TT/TG for OCOPD vs resistant, Odds ratio (OR)=0.5, 95% confidence limits=0.3-1.0, χ2 (Yates uncorrected)=4.1, p=0.04. GG genotype=susceptible
- 18. Genotype. RR vs Rr/rr for resistant vs OCOPD, Odds ratio (OR)=2.3, 95% confidence limits=0.9-5.8, χ2 (Yates uncorrected)=3.7, p=0.05, RR genotype=protective
- 19. Genotype. AG/GG vs AA for resistant vs OCOPD, Odds ratio (OR)=10.8, 95% confidence limits=1.4-229, χ2 (Yates corrected)=5.99 p=0.01. AG/GG genotype=protective, AA susceptible
- 20. Allele. G vs A for resistant vs OCOPD, Odds ratio (OR)=11.3, 95% confidence limits 1.5-237, χ2 (Yates corrected)=6.77, p=0.001. G allele=protective, A susceptible
- 21. Genotype. MS vs MM for Resistant vs OCOPD, Odds ratio (OR)=2.7, 95% confidence limits 0.8-9.0, χ2 (Yates uncorrected)=3.4, p=0.07.
- 22. Allele: S vs M allele for resistant vs OCOPD, Odds ratio (OR)=2.5, 95% confidence limits 0.8-8.4, χ2 (Yates uncorrected)=3.24, p=0.07.
- 23. Genotype AG vs AA in resistant vs OCOPD, Odd's Ratio (OR)=5.61, 95% confidence limits 0.5-146, χ2 (Yates uncorrected)=2.66, p=0.10. AG=protective
- 24. Genotype. CC vs CG/GG for resistant vs OOCOPD, Odds ratio (OR)=1.75, 95% confidence limits=1.0-3.2, χ2 (Yates uncorrected)=3.73, p=0.05. CC=protective
- 25. Genotype: AA vs AG/GG for resistant vs OCOPD, Odd's Ratio (OR)=1.6, 95% confidence limits 0.8-32, χ2 (Yates uncorrected)=2.02, p=0.16. AA=protective
- 26. Genotype. TT vs TC/CC for OCOPD vs resistant, Odds ratio (OR)=6.03, 95% confidence limits 1.1-42, χ2 (Yates corrected)=4.9, p=0.03. TT=susceptible
- 27. Genotype. 5G5G vs rest for OCOPD vs resistant, Odds ratio (OR)=1.9, 95% confidence limits 0.9-4.0, χ2 (Yates uncorrected)=3.11, p=0.08. 5G5G=susceptible
- 28. Allele. 50 vs 4G for OCOPD vs resistant, Odds ratio (OR)=1.4, 95% confidence limits 0.9-2.1, χ2 (Yates corrected)=3.1, p=0.08. 5G=susceptible
- 29. Genotype. TT vs TG/GG for resistant vs controls, Odds ratio (OR)=2.3, 95% confidence limits 1.0-5.5, χ2 (Yates corrected)=3.80, p=0.05. TT genotype=protective
- 30. Genotype. TT vs TG/GG for resistant vs OCOPD, Odds ratio (OR)=1.9, 95% confidence limits 0.8-5.0, χ2 (Yates uncorrected)=2.49, p=0.11. TT genotype=protective
- 31. Genotype: Tt/tt vs TT for COPD vs controls, Odd's Ratio (OR)=3.34, 95% confidence limits 1.3-8.9, χ2 (Yates corrected)=6.28, p=0.01. Tt/tt susceptible to OCOPD
- 32. Allele: t vs T for COPD vs controls, Odd's Ratio (OR)=2.5, 95% confidence limits 1.0-6.3, χ2 (Yates corrected)=4.1, p=0.04. t=susceptible to OCOPD
- 33. Genotype. 2G2G vs 1G1G/1G2G for COPD vs controls, Odds ratio (OR)=2.1, 95% confidence limits 1.1-4.1, χ2 (Yates corrected)=5.44, p=0.02. 2G2G genotype=susceptible for OCOPD
- 34. Allele. 2G vs 1G for COPD vs controls, Odds ratio (OR)=1.7, 95% confidence limits 1.2-2.5, χ2 (Yates corrected)=7.97, p=0.005. 2G=susceptible for OCOPD
Table 7 below provides a summary of the protective and susceptibility polymorphisms determined for OCOPD.
| TABLE 7 |
|
| Summary of protective and susceptibility polymorphisms for OCOPD |
| Gene |
Polymorphism |
Role |
|
| Cyclo-oxygenase (Cox) 2 |
Cox 2 −765 G/C |
CC/CG protective |
|
|
GG susceptible |
| β2-adrenoreceptor (ADRB2) |
ADRB2 Gln 27Glu |
CC protective |
| Interleukin-18 (IL-18) |
IL-18 −133 C/G |
CC susceptible |
| Interleukin-18 (IL-18) |
IL-18 105 A/C |
AA susceptible |
| Plasminogen activator |
PAI-1 −675 4G/5G |
5G5G |
| inhibitor 1 (PAI-1) |
|
susceptible |
| Nitric Oxide synthase 3 (NOS3) |
NOS3 298 Asp/Glu |
TT protective |
| Vitamin D Binding Protein |
VDBR Lys 420 Thr |
AA protective |
| (VDBR) |
|
CC susceptible |
| Vitamin D Binding Protein |
VDBP Glu 416 Asp |
TT/TG protective |
| (VDBR) |
|
GG susceptible |
| Glutathione S Transferase |
GSTP1 Ile105Val |
GG susceptible |
| (GSTP1) |
| Superoxide dismutase 3 (SOD3) |
SOD3 Arg 312 Gln |
AG/GG |
|
|
protective |
|
|
AA susceptible |
| a1-antitrypsin (a1AT) |
a1AT 3′ 1237 G/A |
Tt/tt susceptible |
|
(T/t) |
| a1-antitrypsin (a1AT) |
a1AT S allele |
MS protective |
| Toll-like receptor 4 (TLR4) |
TLR4 Asp 299 Gly |
AG/GG |
|
A/G |
protective |
| Interleukin-8 (IL-8) |
IL-8 −251 A/T |
AA protective |
| Interleukin 11 (IL-11) |
IL-11 −518 G/A |
AA protective |
| Microsomal epoxide |
MEH Exon 3 T/C |
RR protective |
| hydrolase (MEH) |
(r/R) |
| Interleukin 13 (IL-13) |
IL-13 −1055 C/T |
TT susceptible |
| Matrix Metalloproteinase 1 |
MMP1 −1607 |
2G2G susceptible |
| (MMP1) |
1G/2G |
|
The combined frequencies of the presence or absence of the selected protective genotypes COX2 −765 CC/CG, NOS3 298 TT, a 1AT MS/SS, SOD3 AG/GG, MEH Exon 3 RR, and VDBP 420 AA observed in the OCOPD subjects and in resistant smokers is presented below in Table 8.
| TABLE 8 |
|
| Combined frequencies of the presence or absence of protective genotypes |
| in OCOPD subjects and in resistant smokers. |
|
|
|
Number of protective polymorphisms |
|
| Cohorts |
0 |
1 |
=2 |
Total |
|
| OCOPD |
34 (27%) |
51 (41%) |
39 (32%) |
124 |
| Resistant |
20 (19%) |
31 (30%) |
53 (51%) |
104 |
| smokers |
| % of |
34/54 (63%) |
51/82 (62%) |
39/92 (42%) |
| smokers with |
| OCOPD |
|
| Comparison |
Odd's ratio |
95% CI |
?2 |
P value |
|
| 0 vs 1 · vs 2+, Resist vs OCOPD |
— |
— |
16.2 |
0.003 |
| 2+ vs 0-1, Resist vs OCOPD |
2.3 |
1.3-4.0 |
8.15 |
0.004 |
| 0 vs 2+, OCOPD vs Resist |
2.3 |
1.1-4.9 |
4.97 |
0.03 |
|
The combined frequencies of the presence or absence of the selected susceptibility genotypes MMP1−1607 2G2G, GSTP1 105 GG, PAI-1-675 5G5G, IL-13 −1055 TT, and VDBP 416 GG, observed in the OCOPD subjects and in resistant smokers is presented below in Table 9.
| TABLE 9 |
|
| Combined frequencies of the presence or absence of selected susceptibility |
| genotypes in OCOPD subjects and in resistant smokers. |
|
|
|
Number of protective polymorphisms |
|
| Cohorts |
0 |
1 |
=2 |
Total |
|
| OCOPD |
45 (36%) |
55 (44%) |
24 (20%) |
124 |
| Resistant |
55 (54%) |
37 (37%) |
9 (9%) |
101 |
| smokers |
| % of |
45/100 (45%) |
55/92 (60%) |
24/33 (73%) |
| smokers with |
| OCOPD |
|
| Comparison |
Odd's ratio |
95% CI |
?2 |
P value |
|
| 0 vs 1 vs 2+, OCOPD vs Resist |
— |
— |
9.1 |
0.01 |
| 2+ vs 0-1, OCOPD vs Resist |
2.5 |
1.0-6.0 |
4.05 |
0.04 |
| 0+ vs 1-2+, Resist vs OCOPD |
2.1 |
1.2-3.7 |
6.72 |
0.01 |
|
Protective polymorphisms were assigned a score of +1 while susceptibility polymorphisms were assigned a score of −1. For each subject, a net score was then calculated according to the presence of susceptibility and protective genotypes. This produced a linear spread of values, as shown in Table 10. When assessed as a range between −2 to +3, a linear relationship as depicted in FIG. 3 was observed. This analysis indicates that for subjects with a net score of −1 or less, there was an approximately 70% or greater risk of having OCOPD. In contrast, for subjects with a net score of 2+ or greater, the risk was approximately 25% (see FIG. 3). As a point of clarification, it is noted that FIG. 3 depicts the sum of the protective and susceptibility polymorphisms combined, rather than simply the sum of the protective polymorphisms in one graph and the sum of the susceptibility polymorphisms in another graph. Thus, the SNP score can be negative if there are only susceptibility polymorphisms, positive, if there are only protective polymorphisms, or either positive or negative, depending upon the relative numbers of protective to susceptibility polymorphisms.
| TABLE 10 |
|
| Combined presence or absence of protective |
| and susceptibility polymorphisms |
|
Score combining protective and |
|
susceptibility polymorphisms |
| OCOPD n = 124 |
8 |
28 |
33 |
39 |
11 |
5 |
| Resistant n = 101 |
2 |
11 |
23 |
27 |
23 |
15 |
| % OCOPD |
80% |
72% |
59% |
59% |
32% |
25% |
|
II. Example 3
Case Association Study—Lung Cancer
Methods
Subject Recruitment
Subjects of European decent who had smoked a minimum of fifteen pack years and diagnosed with lung cancer were recruited. Subjects met the following criteria: diagnosed with lung cancer based on radiological and histological grounds, including primary lung cancers with histological types of small cell lung cancer, squamous cell lung cancer, adenocarinoma of the lung, non-small cell cancer (where histological markers can not distinguish the subtype) and broncho-alveolar carcinoma. Subjects can be of any age and at any stage of treatment after the diagnosis had been confirmed. One hundred and nine subjects were recruited, of these 58% were male, the mean FEV1/FVC (±95% confidence limits) was 51% (49-53), mean FEV1 as a percentage of predicted was 43 (41-45). Mean age, cigarettes per day and pack year history was 65 yrs (64-66), 24 cigarettes/day (22-25) and 50 pack years (41-55) respectively. Two hundred and seventeen European subjects who had smoked a minimum of twenty pack years and who had never suffered breathlessness and had not been diagnosed with an obstructive lung disease or lung cancer in the past were also studied. This control group was recruited through clubs for the elderly and consisted of 63% male, the mean FEV1/FVC (95% CI) was 82% (81-83), mean FEV1 as a percentage of predicted was 96 (95-97). Mean age, cigarettes per day and pack year history was 59 yrs (57-61), 24 cigarettes/day (22-26) and 42 pack years (39-45) respectively. Using a PCR based method [1], all subjects were genotyped for the α1-antitrypsin mutations (S and Z alleles) and those with the ZZ allele were excluded. 190 European blood donors (smoking status unknown) were recruited consecutively through local blood donor services. Sixty-three percent were men and their mean age was 50 years. On regression analysis, the age difference and pack years difference observed between lung cancer sufferers and resistant smokers was found not to determine FEV or lung cancer.
This study shows that polymorphisms found in greater frequency in lung cancer patients compared to resistant smokers can reflect an increased susceptibility to the development of lung cancer. Similarly, polymorphisms found in greater frequency in resistant smokers compared to lung cancer can reflect a protective role.
Summary of Characteristics.
|
| Parameter |
Lung Cancer |
Resistant smokers |
|
| Median (IQR) |
N = 109 |
N = 200 |
Differences |
|
| % male |
52% |
64% |
ns |
| Age (yrs) |
68 (11) |
60 (12) |
P < 0.05 |
| Pack years |
40 (31) |
43 (25) |
P < 0.05 |
| Cigarettes/day |
18 (11) |
24 (12) |
ns |
| FEV1 (L) |
1.7 (0.6) |
2.8 (0.7) |
P < 0.05 |
| FEV1 % predict |
67 (22) |
96% (10) |
P < 0.05 |
| FEV1/FVC |
59 (14) |
82 (8) |
P < 0.05 |
|
Means and 95% confidence limits
Glutathione S-Transferase Null Polymorphisms Genotyping
Genomic DNA was extracted using standard phenol and chloroform methods. Cohorts of patients and controls were configured in to 96-well PCR format containing strategic negative controls. The assay primers, PCR conditions and RFLP assays details have been previously described [7, herein incorporated by reference in its entirety]. Genotyping was done using minor modifications of the above protocol optimised for our own laboratory conditions The PCR reactions were amplified in MJ Research thermocyclers in a total volume of 25 μl and contained 80 ng genomic DNA, 100 ng forward and reverse primers, 200 mM dNTPs, 20 mM Tris-HCL (pH 8.4), 50 mM KCl, 2.5 mM MgCl2 and 1.0 unit of Taq polymerase (Qiagen). Forward, internal (GSTM4) and reverse prime sequences were 5′ CTGCCCTACTTGATTGATGG-3′ [SEQ.ID.NO.192], 5′ ATCTTCTCCTCTTCTGTCTC-3′ [SEQ.ID.NO.193] and 5′-TTCTGGATTGTAGCAGATCA-3′ [SEQ.ID.NO.194]. Cycling conditions consisted of 94 C 60 s, 59 C 30 s, 72 C 30 s for 35 cycles with an extended last extension of 3 min. Digested products were separated on 3% agarose gel. The products were visualised by ultraviolet transillumination following ethidium bromide staining and migration compared against a 1 Kb plus ladder standard (Invitrogen). Genotypes were recorded in data spreadsheets and statistical analysis performed.
Cyclooxygenase 2 Polymorphisms Genotyping
Genomic DNA was extracted from whole blood samples (Maniatis, T., Fritsch, E. F. and Sambrook, J., Molecular Cloning Manual. 1989). The Cyclo-oxygenase 2 −765 polymorphism was determined by minor modifications of a previously published method (Papafili A, et al., 2002, incorporated in its entirety herein by reference)). The PCR reaction was carried out in a total volume of 25 ul and contained 20 ng genomic DNA, 500 pmol forward and reverse primers, 0.2 mM dNTPs, 10 mM Tris-HCL (pH 8.4), 150 mM KCl, 1.0 mM MgCl2 and 1 unit of polymerase (Life Technologies). Cycling times were incubations for 3 min at 95° C. followed by 33 cycles of 50 s at 94° C., 60 s at 66° C. and 60 s at 72° C. A final elongation of 10 min at 72° C. then followed. 4 ul of PCR products were visualised by ultraviolet trans-illumination of a 3% agarose gel stained with ethidium bromide. An aliquot of 3 ul of amplification product was digested for 1 hr with 4 units of AciI (Roche Diagnostics, New Zealand) at 37° C. Digested products were separated on a 2.5% agarose gel run for 2.0 hours at 80 mV with TBE buffer. The products were visualised against a 123 bp ladder using ultraviolet transillumination after ethidium bromide staining.
Matrix Metalloproteinase 1 −1607 1G/2G Polymorphisms Genotyping
Genomic DNA was extracted using standard phenol and chloroform methods. Cohorts of patients and controls were configured in to 96-well PCR format containing strategic negative controls. The assay primers, PCR conditions and RFLP assays details have been previously described (Dunleavey, L. et al. Rapid genotype analysis of the matrix metalloproteinase-1 gene 1G/2G polymorphism that is associated with risk of cancer. Matrix Biol. 19(2):175-7 (2000), herein incorporated by reference in its entirety). Genotyping was done using minor modifications of the above protocol optimised for our own laboratory conditions The PCR reactions were amplified in MJ Research thermocyclers in a total volume of 25 μl and contained 80 ng genomic DNA, 100 ng forward and reverse primers, 200 mM dNTPs, 20 mM Tris-HCL (pH 8.4), 50 mM KCl, 1.5 mM MgCl2 and 1.0 unit of Taq polymerase (Qiagen). Forward and reverse prime sequences were 3′ TCGTGAGAATGTCTTCCCATT-3′ [SEQ.ID.NO.195] and 5′-TCTTGGATTGATTTGAGATAAGTGAAATC-3′[SEQ.ID.NO.196]. Cycling conditions consisted of 94 C 60 s, 55 C 30 s, 72 C 30 s for 35 cycles with an extended last extension of 3 min Aliquots of amplification product were digested for 4 hrs with 6 Units of the restriction enzymes XmnI (Roche Diagnostics, New Zealand) at designated temperature conditions. Digested products were separated on 6% polyacrylamide gel. The products were visualised by ultraviolet transillumination following ethidium bromide staining and migration compared against a 1 Kb plus ladder standard (Invitrogen). Genotypes were recorded in data spreadsheets and statistical analysis performed.
Polymorphism Genotyping Using the Sequenom Autoflex Mass Spectrometer
Genomic DNA was extracted from whole blood samples [2]. Purified genomic DNA was aliquoted (10 ng/ul concentration) into 96 well plates and genotyped on a Sequenom™ system (Sequenom™ Autoflex Mass Spectrometer and Samsung 24 pin nanodispenser) using the following sequences, amplification conditions and methods. The following conditions were used for the PCR multiplex reaction: final concentrations were for 10× Buffer 15 mM MgCl2 1.25×, 25 mM MgCl2 1.625 mM, dNTP mix 25 mM 500 uM, primers 4 uM 100 nM, Taq polymerase (Quiagen hot start) 0.15 U/reaction, Genomic DNA 10 ng/ul. Cycling times were 95° C. for 15 min, (5° C. for 15 s, 56° C. 30 s, 72° C. 30 s for 45 cycles with a prolonged extension time of 3 min to finish. We used shrimp alkaline phosphotase (SAP) treatment (2 ul to 5 ul per PCR reaction) incubated at 35° C. for 30 min and extension reaction (add 2 ul to 7 ul after SAP treatment) with the following volumes per reaction of: water, 0.76 ul; hME 10× termination buffer, 0.2 ul; hME primer (10 uM), 1 ul; MassEXTEND enzyme, 0.04 ul.
Sequenom Conditions for the Polymorphisms Genotyping—1
|
| TERM |
SNP_ID |
2nd-PCRP |
1st-PCRP |
|
|
| ACT |
CYP2E1_1019G/CPst1 |
ACGTTGGATGAAACCAGAGGGAAGCAAAGG |
ACGTTGGATGTCATTGGTTGTGCTGCACCT |
|
|
|
[SEQ. ID. NO. 197] |
[SEQ. ID. NO. 198] |
| |
| ACT |
XPD-751 G/T |
ACGTTGGATGCACCAGGAACCGTTTATGGC |
ACGTTGGATGAGCAGCTAGAATCAGAGGAG |
|
|
[SEQ. ID. NO. 199] |
[SEQ. ID. NO. 200] |
| |
| ACT |
IL-18 105 A/C |
ACGTTGGATGGTCAATGAAGAGAACTTGGTC |
ACGTTGGATGAATGTTTATTGTAGAAAACC |
|
|
[SEQ. ID. NO. 201] |
[SEQ. ID. NO. 202] |
| |
| ACT |
IL-18-133 G/C |
ACGTTGGATGGGGTATTCATAAGCTGAAAC |
ACGTTGGATGCCTTCAAGTTCAGTGGTCAG |
|
|
[SEQ. ID. NO. 203] |
[SEQ. ID. NO. 204] |
| |
| ACT |
CYP 1A1 Ile462Val |
ACGTTGGATGGTGATTATCTTTGGCATGGG |
ACGTTGGATGGGATAGCCAGGAAGAGAAAG |
|
|
[SEQ. ID. NO. 205] |
[SEQ. ID. NO. 206] |
| |
| ACT |
MMP12 Asn 357 Ser A/G |
ACGTTGGATGCCCTATTTCTTTGTCTTCAC |
ACGTTGGATGCTTGGGATAATTTGGCTCTG |
|
|
[SEQ. ID. NO. 207] |
[SEQ. ID. NO. 208] |
| |
| ACT |
OGG1 Ser 326 Cys G/C |
ACGTTGGATGGGAACCCTTTCTGCGCTTTG |
ACGTTGGATGCCTACAGGTGCTGTTCAGTG |
|
|
[SEQ. ID. NO. 209] |
[SEQ. ID. NO. 210] |
| |
| ACT |
NAT2 Arg 197 Gln A/G |
ACGTTGGATGCCTGCCAAAGAAGAAACACC |
ACGTTGGATGACGTCTGCAGGTATGTATTC |
|
|
[SEQ. ID. NO. 211] |
[SEQ. ID. NO. 212] |
| |
| ACT |
CYP2E1_C/T Rsa1 |
ACGTTGGATGGTTCTTAATTCATAGGTTGC |
ACGTTGGATGCTTCATTTCTCATCATATTTTC |
|
|
[SEQ. ID. NO. 213] |
[SEQ. ID. NO. 214] |
| |
| ACG |
CCND1 A870G |
ACGTTGGATGTAGGTGTCTCCCCCTGTAAG |
ACGTTGGATGTCCTCTCCAGAGTGATCAAG |
|
|
[SEQ. ID. NO. 215] |
[SEQ. ID. NO. 216] |
| |
| ACG |
ILB1-511 A/G |
ACGTTGGATGATTTTCTCCTCAGAGGCTCC |
ACGTTGGATGTGTCTGTATTGAGGGTGTGG |
|
|
[SEQ. ID. NO. 217] |
[SEQ. ID. NO. 218] |
| |
| ACG |
FAS_A-670G |
ACGTTGGATGTTGTGGCTGCAACATGAGAG |
ACGTTGGATGCTATGGCGCAACATCTGTAC |
|
|
[SEQ. ID. NO. 219] |
[SEQ. ID. NO. 220] |
| |
| ACG |
NOS3-786 T/C |
ACGTTGGATGACTGTAGTTTCCCTAGTCCC |
ACGTTGGATGAGTCAGCAGAGAGACTAGGG |
|
|
[SEQ. ID. NO. 221] |
[SEQ. ID. NO. 222] |
| |
| ACT |
ACT_Ala15Thr |
ACGTTGGATGGAGTTGAGAATGGAGAGAATG |
ACGTTGGATGTCAAGTGGGCTGTTAGGGTG |
|
|
[SEQ. ID. NO. 223] |
[SEQ. ID. NO. 224] |
| |
| ACT |
SOD3 Arg 312 Gln |
ACGTTGGATGTGCTGCGTGGTGGGCGTGTG |
ACGTTGGATGGGCCTTGCACTCGCTCTCG |
|
|
[SEQ. ID. NO. 225] |
[SEQ. ID. NO. 226] |
| |
| ACT |
NOS3 Asp 298 Glu |
ACGTTGGATGAAACGGTCGCTTCGACGTGC |
ACGTTGGATGACCTCAAGGACCAGCTCGG |
|
|
[SEQ. ID. NO. 227] |
[SEQ. ID. NO. 228] |
| |
| CGT |
IL-8-251 A/T |
ACGTTGGATGACTGAAGCTCCACAATTTGG |
ACGTTGGATGGCCACTCTAGTACTATATCTG |
|
|
[SEQ. ID. NO. 229] |
[SEQ. ID. NO. 230] |
| |
| CGT |
IFN gamma 874 A/T |
ACGTTGGATGCAGACATTCACAATTGATTT |
ACGTTGGATGGATAGTTCCAAACATGTGCG |
|
|
[SEQ. ID. NO. 231] |
[SEQ. ID. NO. 232] |
| |
| ACT |
XRCC1 Arg 399 Gln G/A |
ACGTTGGATGTAAGGAGTGGGTGCTGGACT |
ACGTTGGATGAGGATAAGGAGCAGGGTTGG |
|
|
[SEQ. ID. NO. 233] |
[SEQ. ID. NO. 234] |
|
Sequenom Conditions for the Polymorphisms Genotyping—2
|
| SNP_ID |
AMP_LEN |
UP_CONF |
MP_CONF |
Tm(NN) |
PcGC |
PWARN |
UEP_DIR |
UEP_MASS |
|
|
| CYP2E1_1019G/CPst 1 |
119 |
95.2 |
71.3 |
46.7 |
47.1 |
|
F |
5256.4 |
| XPD -751 G/T |
113 |
97.6 |
71.3 |
49.8 |
47.4 |
|
F |
5689.7 |
| IL-18 105 A/C |
120 |
65.6 |
71.3 |
49.8 |
36.4 |
|
R |
6702.4 |
| IL-18 -133 G/C |
112 |
93.5 |
81.3 |
47.1 |
42.1 |
|
F |
5811.8 |
| CYP 1A1 Ile462Val |
102 |
98.2 |
81.3 |
55.6 |
55 |
|
F |
6222.1 |
| MMP12 Asn 357 Ser A/G |
95 |
92.6 |
81.3 |
48 |
30.4 |
|
F |
7070.6 |
| OGG1 Ser 326 Cys G/C |
99 |
96.5 |
82.2 |
58.9 |
70.6 |
|
R |
5227.4 |
| NAT2 Arg 197 Gln A/G |
115 |
97.4 |
70 |
48.5 |
36.4 |
|
F |
6635.3 |
| CYP2E1_C/T Rsa1 |
105 |
62.8 |
77.8 |
46.4 |
26.1 |
|
R |
7018.6 |
| CCND1 A870G |
106 |
98.1 |
83 |
45.8 |
47.1 |
|
R |
5034.3 |
| ILB1 -511 A/G |
111 |
99.2 |
83 |
46 |
47.1 |
|
R |
5203.4 |
| FAS_A-670G |
103 |
99.2 |
83 |
54.4 |
50 |
|
R |
6166 |
| NOS3 -786 T/C |
114 |
97.5 |
83 |
61.8 |
61.9 |
|
F |
6358.1 |
| ACT_Ala15Thr |
118 |
93.4 |
68.2 |
45.2 |
47.1 |
|
F |
5136.4 |
| SOD3 Arg 312 Gln |
119 |
63.2 |
68.2 |
55.5 |
57.9 |
|
F |
5855.8 |
| NOS3 Asp 298 Glu |
113 |
82.2 |
68.2 |
65.4 |
66.7 |
|
F |
6432.2 |
| IL-8 -251 A/T |
119 |
92.6 |
75.8 |
45.9 |
28.6 |
|
R |
6428.2 |
| IFN gamma 874 A/T |
112 |
75.3 |
75.8 |
46.4 |
26.1 |
|
F |
6943.6 |
| XRCC1 Arg 399 Gln G/A |
109 |
93.6 |
93.6 |
66.8 |
82.4 |
|
F |
5099.3 |
|
Sequenom Conditions for the Polymorphisms Genotyping—3
|
|
|
EXT1 |
EXT1 |
|
EXT2 |
| SNP_ID |
UEP_SEQ |
CALL |
MASS |
EXT1_SEQ |
CALL |
|
|
| CYP2E1_1019G/CPst1 |
TTCTTGGTTCAGGAGAG |
C |
5529.6 |
TTCTTGGTTCAGGAGAGC |
G |
|
|
[SEQ. ID. NO. 235] |
|
|
[SEQ. ID. NO. 236] |
| |
| XPD-751 G/T |
GCAATCTGCTCTATCCTCT |
T |
5977.9 |
GCAATCTGCTCTATCCTCTT |
G |
|
[SEQ. ID. NO. 237] |
|
|
[SEQ. ID. NO. 238] |
| |
| IL-18 105 A/C |
ATTCAAGCTTGCCAAAGTAATC |
A |
6990.6 |
ATTCAAGCTTGCCAAAGTAAT |
C |
|
[SEQ. ID. NO. 239] |
|
|
CT [SEQ. ID. NO. 240] |
| |
| IL-18 -133 G/C |
CATAAGCTGAAACTTCTGG |
C |
6085 |
CATAAGCTGAAACTTCTGGC |
G |
|
[SEQ. ID. NO. 241] |
|
|
[SEQ. ID. NO. 242] |
| |
| CYP 1A1 Ile462Val |
GGAAGTGTATCGGTGAGACC |
A |
6519.3 |
GGAAGTGTATCGGTGAGACC |
G |
|
[SEQ. ID. NO. 243] |
|
|
A [SEQ. ID. NO. 244] |
| |
| MMP12 Asn 357 Ser |
TGACAAATACTGGTTAATTAGCA |
A |
7367.8 |
TGACAAATACTGGTTAATTAG |
G |
| A/G |
[SEQ. ID. NO. 245] |
|
|
CAA [SEQ. ID. NO. 246] |
| |
| OGG1 Ser 326 Cys |
GCTCCTGAGCATGGCGG |
G |
5500.6 |
GCTCCTGAGCATGGCGGC |
C |
| G/C |
[SEQ. ID. NO. 247] |
|
|
[SEQ. ID. NO. 248] |
| |
| NAT2 Arg 197 Gln |
TACTTATTTACGCTTGAACCTC |
A |
6932.5 |
TACTTATTTACGCTTGAACCT |
G |
| A/G |
[SEQ. ID. NO. 249] |
|
|
CA [SEQ. ID. NO. 250] |
| |
| CYP2E1_C/T Rsa1 |
CTTAATTCATAGGTTGCAATTTT |
T |
7315.8 |
CTTAATTCATAGGTTGCAATT |
C |
|
[SEQ. ID. NO. 251] |
|
|
TTA [SEQ. ID. NO. 252] |
| |
| CCND1 A870G |
ACATCACCCTCACTTAC[SEQ. ID. |
G |
5307.5 |
ACATCACCCTCACTTACC |
A |
|
NO. 253] |
|
|
[SEQ. ID. NO. 254] |
| |
| ILB1 -511 A/G |
AATTGACAGAGAGCTCC |
G |
5476.6 |
AATTGACAGAGAGCTCCC |
A |
|
[SEQ. ID. NO. 255] |
|
|
[SEQ. ID. NO. 256] |
| |
| FAS_A-670G |
ATGAGAGGCTCACAGACGTT |
G |
6439.2 |
ATGAGAGGCTCACAGACGTT |
A |
|
[SEQ. ID. NO. 257] |
|
|
C [SEQ. ID. NO. 258] |
| |
| NOS3-786 T/C |
GGCATCAAGCTCTTCCCTGGC |
C |
6631.3 |
GGCATCAAGCTCTTCCCTGG |
T |
|
[SEQ. ID. NO. 259] |
|
|
CC [SEQ. ID. NO. 260] |
| |
| ACT_Ala15Thr |
GAATGTTACCTCTCCTG[SEQ. ID. |
A |
5433.6 |
GAATGTTACCTCTCCTGA |
G |
|
NO. 261] |
|
|
[SEQ. ID. NO. 262] |
| |
| SOD3 Arg 312 Gln |
GCACTCAGAGCGCAAGAAG |
C |
6129 |
GCACTCAGAGCGCAAGAAGC |
G |
|
[SEQ. ID. NO. 263] |
|
|
[SEQ. ID. NO. 264] |
| |
| NOS3 Asp 298 Glu |
GCTGCTGCAGGCCCCAGATGA |
T |
6720.4 |
GCTGCTGCAGGCCCCAGATG |
G |
|
[SEQ. ID. NO. 265] |
|
|
AT [SEQ. ID. NO. 266] |
| |
| IL-8 -251 A/T |
CACAATTTGGTGAATTATCAA |
A |
6716.4 |
CACAATTTGGTGAATTATCAA |
T |
|
[SEQ. ID. NO. 267] |
|
|
T [SEQ. ID. NO. 268] |
| |
| IFN gamma 874 A/T |
TTCTTACAACACAAAATCAAATC |
T |
7231.8 |
TTCTTACAACACAAAATCAAA |
A |
|
[SEQ. ID. NO. 269] |
|
|
TCT [SEQ. ID. NO. 270] |
| |
| XRCC1 Arg 399 Gln |
TCGGCGGCTGCCCTCCC |
A |
5396.5 |
TCGGCGGCTGCCCTCCCA |
G |
| G/A |
[SEQ. ID. NO. 271] |
|
|
[SEQ. ID. NO. 272] |
|
Sequenom Conditions for the Polymorphisms Genotyping—4
|
| SNP_ID |
EXT2_MASS |
EXT2_SEQ |
1stPAUSE |
|
|
| CYP2E1_1019G/CPst1 |
5873.8 |
TTCTTGGTTCAGGAGAGGT[SEQ. ID. NO. 273] |
5585.6 |
|
| |
| XPD -751 G/T |
6292.1 |
GCAATCTGCTCTATCCTCTGC[SEQ. ID. NO. 274] |
6018.9 |
| |
| IL-18 105 A/C |
7658 |
ATTCAAGCTTGCCAAAGTAATCGGA[SEQ. ID. |
7031.6 |
|
|
NO. 275] |
| |
| IL-18 -133 G/C |
6438.2 |
CATAAGCTGAAACTTCTGGGA[SEQ. ID. NO. |
6141 |
|
|
276] |
| |
| CYP 1A1 Ile462Val |
6839.5 |
GGAAGTGTATCGGTGAGACCGT[SEQ. ID. NO. |
6551.3 |
|
|
277] |
| |
| MMP12 Asn 357 Ser A/G |
7688 |
TGACAAATACTGGTTAATTAGCAGT[SEQ. ID. |
7399.8 |
|
|
NO. 278] |
| |
| OGG1 Ser 326 Cys G/C |
5853.8 |
GCTCCTGAGCATGGCGGGA[SEQ. ID. NO. 279] |
5556.6 |
| |
| NAT2 Arg 197 Gln A/G |
7261.8 |
TACTTATTTACGCTTGAACCTCGA[SEQ. ID. |
6964.5 |
|
|
NO. 280] |
| |
| CYP2E1_C/T Rsa1 |
7636 |
CTTAATTCATAGGTTGCAATTTTGT[SEQ. ID. |
7347.8 |
|
|
NO. 281] |
| |
| CCND1 A870G |
5651.7 |
ACATCACCCTCACTTACTG[SEQ. ID. NO. 282] |
5338.5 |
| |
| ILB1 -511 A/G |
5820.8 |
AATTGACAGAGAGCTCCTG[SEQ. ID. NO. 283] |
5507.6 |
| |
| FAS_A-670G |
6743.4 |
ATGAGAGGCTCACAGACGTTTC[SEQ. ID. NO. |
6470.2 |
|
|
284] |
| |
| NOS3-786 T/C |
6975.5 |
GGCATCAAGCTCTTCCCTGGCTG[SEQ. ID. |
6662.3 |
|
|
NO. 285] |
| |
| ACT_Ala15Thr |
5738.7 |
GAATGTTACCTCTCCTGGC[SEQ. ID. NO. 286] |
5465.6 |
| |
| SOD3 Arg 312 Gln |
7116.6 |
GCACTCAGAGCGCAAGAAGGGGC[SEQ. ID. |
6185 |
|
|
NO. 287] |
| |
| NOS3 Asp 298 Glu |
7034.6 |
GCTGCTGCAGGCCCCAGATGAGC[SEQ. ID. |
6761.4 |
|
|
NO. 288] |
| |
| IL-8 -251 A/T |
7029.6 |
CACAATTTGGTGAATTATCAAAT[SEQ. ID. NO. |
6741.4 |
|
|
289] |
| |
| IFN gamma 874 A/T |
7530 |
TTCTTACAACACAAAATCAAATCAC[SEQ. ID. |
7256.8 |
|
|
NO. 290] |
| |
| XRCC1 Arg 399 Gln G/A |
6054.9 |
TCGGCGGCTGCCCTCCCGGA[SEQ. ID. NO. |
5428.5 |
|
|
291] |
|
Sequenom Conditions for the Polymorphisms Genotyping—5
|
| TERM |
SNP_ID |
2nd-PCRP |
1st-PCRP |
|
|
| ACT |
CTGF-447G/C |
ACGTTGGATGAGGTAGCTGAAGAG |
ACGTTGGATGGCCTATAGCCTCTAA |
|
|
|
GCAAAC [SEQ. ID. NO. 292] |
AACGC [SEQ. ID. NO. 293] |
| |
| ACT |
NBS1 Gln185Glu |
ACGTTGGATGCTTTCAATTTGTGGA |
ACGTTGGATGTGTGCACTCATTTGT |
|
G/C |
GGCTG [SEQ. ID. NO. 294] |
GGACG [SEQ. ID. NO. 295] |
| |
| ACT |
MBL2 161 G/A |
ACGTTGGATGGTAGCTCTCCAGGCA |
ACGTTGGATGGTACCTGGTTCCCCC |
|
|
TCAAC [SEQ. ID. NO. 296] |
TTTTC [SEQ. ID. NO. 297] |
| |
| ACT |
IGF2R Leu252Val |
ACGTTGGATGACACCAGGCGTTTGA |
ACGTTGGATGAAAAACGCCAACAGC |
|
C/G |
TGTTG [SEQ. ID. NO. 298] |
ATCGG [SEQ. ID. NO. 299] |
| |
| ACT |
MUC5AC -221 C/T |
ACGTTGGATGAGGCGGAGATGGGT |
ACGTTGGATGAGTCTAGGGTGGGG |
|
|
GTGTC [SEQ. ID. NO. 300] |
TATGTG [SEQ. ID. NO. 301] |
| |
| ACT |
Arg1 intron1 C/T |
ACGTTGGATGATGTGTGGATTCACA |
ACGTTGGATGGGGTTGGCAACTCTA |
|
|
GCTCG [SEQ. ID. NO. 302] |
AAAGG [SEQ. ID. NO. 303] |
| |
| ACT |
REV1 Phe257Ser |
ACGTTGGATGCTCTGAAATCAGTGC |
ACGTTGGATGATGGTCAACAGTGTT |
|
C/T |
TGCTC [SEQ. ID. NO. 304] |
GCCAG [SEQ. ID. NO. 305] |
| |
| ACT |
Apex1 Asp148Glu |
ACGTTGGATGCACCTCTTGATTGCT |
ACGTTGGATGACCCGGCCTTCCTGA |
|
G/T |
TTCCC [SEQ. ID. NO. 306] |
TCATG [SEQ. ID. NO. 307] |
| |
| ACG |
IL-10 -1082 A/G |
ACGTTGGATGATTCCATGGAGGCTG |
ACGTTGGATGGACAACACTACTAAG |
|
|
GATAG [SEQ. ID. NO. 308] |
GCTTC [SEQ. ID. NO. 309] |
|
Sequenom Conditions for the Polymorphisms Genotyping—6
|
| SNP_ID |
AMP_LEN |
UP_CONF |
MP_CONF |
Tm(NN) |
PcGC |
PWARN |
UEP_DIR |
UEP_MASS |
|
|
| CTGF-447G/C |
119 |
98.2 |
65 |
52 |
52.9 |
|
R |
5090.3 |
| NBS1 Gln185Glu G/C |
118 |
97 |
65 |
51 |
52.9 |
|
R |
5192.4 |
| MBL2 161 G/A |
99 |
96.8 |
65 |
50.3 |
52.9 |
|
F |
5299.5 |
| IGF2R Leu252Val C/G |
114 |
98.5 |
67.8 |
68.6 |
82.4 |
|
F |
5206.4 |
| MUC5AC -221 C/T |
119 |
81.8 |
67.8 |
56.9 |
64.7 |
g |
R |
5273.4 |
| Arg1 intron1 C/T |
102 |
99.6 |
67.8 |
53.3 |
52.6 |
|
R |
5932.9 |
| REV1 Phe257Ser C/T |
105 |
99.6 |
67.8 |
57.5 |
55 |
|
R |
6003.9 |
| Apex1 Asp148Glu G/T |
114 |
92.9 |
67.8 |
46.8 |
35 |
|
F |
6113 |
| IL-10 -1082 A/G |
107 |
98 |
68.8 |
51.2 |
58.8 |
|
R |
4977.2 |
|
Sequenom Conditions for the Polymorphisms Genotyping—7
|
| SNP_ID |
UEP_SEQ |
EXT1_CALL |
EXT1_MASS |
EXT1_SEQ |
|
|
| CTGF-447G/C |
AAAAGGTTTCTCCCCCC |
G |
5363.5 |
AAAAGGTTTCTCCCCCCC |
|
|
[SEQ. ID. NO. 310] |
|
|
[SEQ. ID. NO. 311] |
| |
| NBS1 Gln185Glu |
AGGCTGCTTCTTGGACT |
G |
5465.6 |
AGGCTGCTTCTTGGACTC |
| G/C |
[SEQ. ID. NO. 312] |
|
|
[SEQ. ID. NO. 313] |
| |
| MBL2 161 G/A |
CAAAGATGGGCGTGATG |
A |
5596.7 |
CAAAGATGGGCGTGATGA |
|
[SEQ. ID. NO. 314] |
|
|
[SEQ. ID. NO. 315] |
| |
| IGF2R Leu252Val |
GCCAGCCCCGGGACGGA |
C |
5479.6 |
GCCAGCCCCGGGACGGA |
| C/G |
[SEQ. ID. NO. 316] |
|
|
C [SEQ. ID. NO. 317] |
| |
| MUC5AC -221 |
ATGGGTGTGTCTGCCGG |
T |
5570.6 |
ATGGGTGTGTCTGCCGGA |
| C/T |
[SEQ. ID. NO. 318] |
|
|
[SEQ. ID. NO. 319] |
| |
| Arg1 intron1 C/T |
GGCTGTAAGGAAATCTGGG |
T |
6230.1 |
GGCTGTAAGGAAATCTGG |
|
[SEQ. ID. NO. 320] |
|
|
GA [SEQ. ID. NO. 321] |
| |
| REV1 Phe257Ser |
CCTTATCCTCCTCCTGGGAA |
T |
6301.1 |
CCTTATCCTCCTCCTGGG |
| C/T |
[SEQ. ID. NO. 322] |
|
|
AAA [SEQ. ID. NO. 323] |
| |
| Apex1 Asp148Glu |
TGTTTCATTTCTATAGGCGA |
T |
6401.2 |
TGTTTCATTTCTATAGGCG |
| G/T |
[SEQ. ID. NO. 324] |
|
|
AT [SEQ. ID. NO. 325] |
| |
| IL-10 -1082 A/G |
CCTATCCCTACTTCCCC |
G |
5250.4 |
CCTATCCCTACTTCCCCC |
|
[SEQ. ID. NO. 326] |
|
|
[SEQ. ID. NO. 327] |
|
Sequenom conditions for the polymorphisms Genotyping—8
|
| SNP_ID |
EXT2_CALL |
EXT2_MASS |
EXT2_SEQ |
1stPAUSE |
|
|
| CTGF-447G/C |
C |
5716.7 |
AAAAGGTTTCTCCCCCCGA |
5419.5 |
|
|
|
|
[SEQ. ID. NO. 328] |
| |
| NBS1 Gln185Glu |
C |
5818.8 |
AGGCTGCTTCTTGGACTGA |
5521.6 |
| G/C |
|
|
[SEQ. ID. NO. 329] |
| |
| MBL2 161 G/A |
G |
5901.9 |
CAAAGATGGGCGTGATGGC |
5628.7 |
|
|
|
[SEQ. ID. NO. 330] |
| |
| IGF2R Leu252Val |
G |
5823.8 |
GCCAGCCCCGGGACGGAGT |
5535.6 |
| C/G |
|
|
[SEQ. ID. NO. 331] |
| |
| MUC5AC -221 C/T |
C |
5890.8 |
ATGGGTGTGTCTGCCGGGT |
5602.6 |
|
|
|
[SEQ. ID. NO. 332] |
| |
| Arg1 intron1 C/T |
C |
6879.5 |
GGCTGTAAGGAAATCTGGGGGT |
6262.1 |
|
|
|
[SEQ. ID. NO. 333] |
| |
| REV1 Phe257Ser |
C |
6630.3 |
CCTTATCCTCCTCCTGGGAAGA |
6333.1 |
| C/T |
|
|
[SEQ. ID. NO. 334] |
| |
| Apex1 Asp148Glu |
G |
7068.6 |
TGTTTCATTTCTATAGGCGAGGA |
6442.2 |
| G/T |
|
|
[SEQ. ID. NO. 335] |
| |
| IL-10 -1082 A/G |
A |
5858.8 |
CCTATCCCTACTTCCCCTTC |
5281.4 |
|
|
|
[SEQ. ID. NO. 336] |
|
Results
Frequencies of individual polymorphisms are as follows:
| TABLE 11 |
|
| Polymorphism allele and genotype frequencies in the Lung cancer |
| patients, resistant smokers and controls. |
|
| Nitric oxide synthase 3 Asp 298 Glu (T/G) |
| Controls n = 183 (%) |
108 |
(30%) |
258 |
(70%) |
13 |
(7%) |
82 |
(45%) |
88 |
(48%) |
| Lung Cancer n = 107 (%) |
71 |
(33%) |
143 |
(67%) |
9 |
(8%) |
53 |
(50%) |
45 |
(42%) |
| Resistant n = 198 (%) |
135 |
(34%) |
261 |
(66%) |
281.2 |
(14%) |
79 |
(40%) |
91 |
(46%) |
|
| Nitric oxide synthase 3 −786 T/C |
| Controls n = 183 (%) |
|
|
|
|
|
|
|
|
|
|
| Lung Cancer n = 107 (%) |
82 |
(38%) |
132 |
(62%) |
16 |
(15%) |
50 |
(47%) |
413 |
(38%) |
| Resistant n = 198 (%) |
166 |
(42%) |
228 |
(58%) |
31 |
(16%) |
104 |
(53%) |
62 |
(31%) |
|
| Super oxide dismutase 3 Arg 312 Gln C/G |
| Controls n = 190 (%) |
371 |
(98%) |
9 |
(2%) |
183 |
(96%) |
5 |
(3%) |
2 |
(1%) |
| Lung Cancer n = 104 (%) |
208 |
(100%) |
0 |
(0%) |
104 |
(100%) |
0 |
(0%) |
0 |
(0%) |
| Resistant n = 182 (%) |
390 |
(98%) |
10 |
(3%) |
191 |
(95%) |
84 |
(4%) |
14 |
(1%) |
|
| Controls n = 190 (%) |
|
|
|
|
|
|
|
|
|
|
| Lung Cancer n = 103 (%) |
68 |
(33%) |
138 |
(67%) |
4 |
(4%) |
60 |
(58%) |
39 |
(38%) |
| Resistant n = 193 (%) |
132 |
(34%) |
254 |
(66%) |
185 |
(9%) |
96 |
(50%) |
79 |
(41%) |
|
| Controls n = 188 (%) |
175 |
(47%) |
201 |
(53%) |
39 |
(21%) |
97 |
(52%) |
52 |
(28%) |
| Lung Cancer n = 90 |
68 |
(38%) |
112 |
(62%) |
6 |
(7%) |
56 |
(52%) |
28 |
(31%) |
| Resistant n = 199 (%) |
1927 |
(48%) |
206 |
(52%) |
456 |
(23%) |
102 |
(51%) |
52 |
(26%) |
|
| Anti-chymotrypsin Ala −15 Thr |
| Lung Cancer n = 108 |
99 |
(46%) |
1179 |
(54%) |
24 |
(22%) |
51 |
(47%) |
338 |
(31%) |
| Resistant n = 196 (%) |
207 |
(53%) |
185 |
(47%) |
52 |
(27%) |
103 |
(53%) |
41 |
(21%) |
| Lung Cancer n = 107 |
109 |
(51%) |
105 |
(49%) |
2511 |
(23%) |
59 |
(55%) |
23 |
(21%) |
| Resistant n = 199 (%) |
188 |
(47%) |
210 |
(53%) |
45 |
(23%) |
98 |
(49%) |
5610 |
(28%) |
| Lung Cancer n = 107 |
64 |
(30%) |
150 |
(70%) |
12 |
(11%) |
40 |
(37%) |
5512 |
(51%) |
| Resistant n = 198 (%) |
143 |
(36%) |
253 |
(64%) |
23 |
(12%) |
97 |
(49%) |
78 |
(39%) |
| FAS (Apo-1/CD 95) A −670 G |
| Lung Cancer n = 106 |
12114 |
(57%) |
91 |
(43%) |
3213 |
(30%) |
57 |
(54%) |
17 |
(16%) |
| Resistant n = 198 (%) |
202 |
(51%) |
194 |
(49%) |
45 |
(23%) |
112 |
(57%) |
41 |
(21%) |
|
| Lung Cancer n = 108 |
72 |
(33%) |
144 |
(66%) |
11 |
(10%) |
50 |
(46%) |
47 |
(44%) |
| Resistant n = 197 (%) |
147 |
(37%) |
247 |
(63%) |
3115 |
(16%) |
85 |
(43%) |
81 |
(41%) |
|
| Cytochrome P450 1A1 Ile 462 Val G/A |
| Lung Cancer n = 109 |
5 |
(2%) |
213 |
(98%) |
0 |
(0%) |
5 |
(5%) |
10416 |
(95%) |
| Resistant n = 199 (%) |
20 |
(5%) |
378 |
(95%) |
1316 |
(1%) |
1816 |
(9%) |
1802 |
(90%) |
| Lung Cancer n = 109 |
8 |
(4%) |
210 |
(96%) |
1 |
(1%) |
6 |
(5%) |
102 |
(94%) |
| Resistant n = 199 (%) |
21 |
(5%) |
377 |
(95%) |
017 |
(0%) |
2117 |
(11%) |
178 |
(89%) |
|
| 8-oxoguanine DNA glycosylase Ser 326 Cys C/G |
| Lung Cancer n = 109 |
40 |
(18%) |
178 |
(82%) |
2 |
(2%) |
36 |
(33%) |
71 |
(65%) |
| Resistant n = 199 (%) |
100 |
(25%) |
298 |
(75%) |
1418 |
(7%) |
72 |
(36%) |
113 |
(57%) |
|
| N-Acetyltransferase 2 Arg 197 Gln G/A |
| Lung Cancer n = 106 |
55 |
(26%) |
157 |
(74%) |
9 |
(8%) |
37 |
(35%) |
6019 |
(57%) |
| Resistant n = 195 (%) |
122 |
(31%) |
268 |
(69%) |
17 |
(9%) |
88 |
(45%) |
90 |
(46%) |
|
| Cytochrome P450 2E1 1019 G/C Pst1 |
| Lung Cancer n = 109 |
10 |
(5%) |
208 |
(95%) |
0 |
(0%) |
1020 |
(9%) |
99 |
(91%) |
| Resistant n = 197 (%) |
11 |
(3%) |
383 |
(97%) |
0 |
(0%) |
11 |
(6%) |
186 |
(94%) |
|
| Cytochrome P450 2E1 C/T Rsa I |
| Lung Cancer n = 108 |
11 |
(5%) |
205 |
(95%) |
0 |
(0%) |
1121 |
(10%) |
97 |
(90%) |
| Resistant n = 198 (%) |
11 |
(3%) |
385 |
(97%) |
0 |
(0%) |
11 |
(6%) |
187 |
(94%) |
|
| Lung Cancer n = 107 |
50 |
(23%) |
164 |
(77%) |
8 |
(8%) |
34 |
(33%) |
6522 |
(61%) |
| Resistant n = 200 (%) |
116 |
(29%) |
284 |
(71%) |
1722 |
(9%) |
8222 |
(41%) |
101 |
(50%) |
|
| Lung Cancer n = 109 |
52 |
(24%) |
166 |
(76%) |
8 |
(7%) |
36 |
(33%) |
6523 |
(60%) |
| Resistant n = 198 (%) |
117 |
(30%) |
279 |
(70%) |
1723 |
(9%) |
8323 |
(42%) |
98 |
(49%) |
|
| Glutathione S-Transferase M null |
|
Controls n = 178 |
75 |
(42%) |
103 |
(58%) |
|
Lung Cancer n = 107 |
6724 |
(58%) |
48 |
(42%) |
|
Resistant n = 182 |
100 |
(55%) |
82 |
(45%) |
|
|
| Controls n = 186 (%) |
183 |
(49%) |
189 |
(51%) |
37 |
(20%) |
109 |
(58%) |
40 |
(22%) |
| Lung cancer n = 106 (%) |
116 |
(55%) |
96 |
(45%) |
3425,26 |
(32%) |
48 |
(45%) |
24 |
(23%) |
| Resistant n = 196 (%) |
209 |
(53%) |
183 |
(47%) |
50 |
(26%) |
109 |
(56%) |
37 |
(19%) |
|
| Controls n = 95 (%) |
27 |
(14%) |
161 |
(86%) |
3 |
(3%) |
21 |
(22%) |
70 |
(75%) |
| Lung Cancer n = 109 (%) |
34 |
(16%) |
184 |
(84%)30 |
5 |
(5%27) |
24 |
(22%)27 |
80 |
(73%)29 |
| Resistant n = 158 (%) |
75 |
(24%)28 |
241 |
(76%) |
11 |
(7%) |
53 |
(34%) |
94 |
(59%) |
|
| Matrix metalloproteinase 1 −1607 1G/2G |
| Frequency |
1G |
2G |
1G1G |
1G2G |
2G2G |
|
| Controls n = 174 |
214 |
(61%) |
134 |
(39%) |
68 |
(39%) |
78 |
(45%) |
28 |
(16%) |
| (%) |
| Lung Cancer n = 67 |
58 |
(43%) |
76 |
(57%)32 |
13 |
(19%) |
32 |
(48%) |
22 |
(33%)31 |
| (%) |
| Resistant n = 171 |
167 |
(49%) |
175 |
(51%) |
41 |
(24%) |
85 |
(50%) |
45 |
(26%) |
| (%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. TT vs TG/GG for resistant vs lung cancer, Odds ratio (OR)=1.8, 95% confidence limits 0.8-4.3, χ2 (Yates uncorrected)=2.14, p=0.14, TT genotype=protective
- 2. Genotype. TT vs TG/GG for resistant vs controls, Odds ratio (OR)=2.2, 95% confidence limits 1.0-4.6, χ2 (Yates corrected)=4.2, p=0.04, TT genotype=protective
- 3. Genotype. TT vs CC/CT for Lung cancer vs resistant, Odds ratio (OR)=1.4, 95% confidence limits 0.8-2.3, χ2 (Yates uncorrected)=1.45, p=0.23, TT genotype=susceptible
- 4. Genotype CG/GG vs CC for resistant vs lung cancer, Yates uncorrected=3.38, P=0.07 and Fisher's Two tailed test, P=0.03. CG/GG=protective
- 5. Genotype. AA vs AG/GG for resistant vs lung cancer, Odds ratio (OR)=2.6, 95% confidence limits 0.8-9.2, χ2 (Yates uncorrected)=2.89, p=0.09. AA genotype=protective
- 6. Genotype. AA vs AT/TT for resistant vs lung cancer, Odds ratio (OR)=4.1, 95% confidence limits=1.6=11.2, χ2 (Yates corrected)=9.8, p=0.002, AA=protective
- 7. Allele. A vs T for resistant smokers vs lung cancer, Odds ratio (OR)=1.5, 95% confidence limits 1.0-2.2, χ2 (Yates corrected)=5.07, p=0.02, A=protective
- 8. Genotype. GG vs AA/AG for Lung cancer vs resistant, Odds ratio (OR)=1.7, 95% confidence limits=0.9-2.9, χ2 (Yates uncorrected)=3.51, p=0.06, GG=susceptible
- 9. Allele. G vs A for lung cancer vs resistant smokers, Odds ratio (OR)=1.3, 95% confidence limits 0.9-1.9, χ2 (Yates uncorrected)=2.71, p=0.10,
- 10. Genotype. GG vs AG/AA for Resistant vs lung cancer, Odds ratio (OR)=1.4, 95% confidence limits=0.8-2.6, χ2 (Yates uncorrected)=1.6, p=0.20, GG=protective
- 11. Genotype. AG/AA vs GG for Lung cancer vs resistant, Odds ratio (OR)=1.4, 95% confidence limits=0.8-2.6, χ2 (Yates uncorrected)=1.6, p=0.20, AA=susceptible
- 12. Genotype. GG vs AA/AG for Lung cancer vs resistant, Odds ratio (OR)=1.6, 95% confidence limits=1-2.7, χ2 (Yates uncorrected)=4.07, p=0.04, GG=susceptible
- 13. Genotype. AA vs AG/GG for Lung cancer vs resistant, Odds ratio (OR)=1.5, 95% confidence limits=0.8-2.6, χ2 (Yates uncorrected)=2.03, p=0.15, AA=susceptible
- 14. Allele. A vs G for Lung cancer vs resistant, Odds ratio (OR)=1.3, 95% confidence limits 0.9-1.8, χ2 (Yates uncorrected)=2.04, p=0.15, A=susceptible
- 15. Genotype. GG vs TG/TT for Resistant vs lung cancer, Odds ratio (OR)=1.7, 95% confidence limits=0.8-3.7, χ2 (Yates uncorrected)=1.81, p=0.18, GG=protective
- 16. Genotype. AG/GG vs AA for Resistant vs lung cancer, Odds ratio (OR)=2.2, 95% confidence limits=0.7-6.9, χ2 (Yates uncorrected)=2.41, p=0.12, GG/AG=protective, AA=susceptible
- 17. Genotype. GG/AG vs AA for Resistant vs COPD, Odds ratio (OR)=1.7, 95% confidence limits=0.7-4.6, χ2 (Yates uncorrected)=1.45, p=0.23, GG/AG=protective
- 18. Genotype. GG vs CG/CC for Resistant vs lung cancer, Odds ratio (OR)=4.0, 95% confidence limits=0.9-26.3, χ2 (Yates uncorrected)=3.87, p=0.05, GG=protective
- 19. Genotype. GG vs AG/AA for Lung cancer vs resistant, Odds ratio (OR)=1.5, 95% confidence limits=0.9-2.5, χ2 (Yates uncorrected)=3.0, p=0.08, GG=susceptible
- 20. Genotype. CG vs GG for Lung cancer and resistant, Odds ratio (OR)=1.7, 95% confidence limits=0.7-4.5, χ2 (Yates uncorrected)=1.42, p=0.23, CG=susceptible
- 21. Genotype. TC vs CC for Lung cancer and resistant, Odds ratio (OR)=1.9, 95% confidence limits=0.8-5.0, χ2 (Yates uncorrected)=2.24, p=0.13, TC=susceptible
- 22. Genotype. AA vs AC/CC for Lung cancer and resistant, Odds ratio (OR)=1.6, 95% confidence limits=1.0-2.6, χ2 (Yates uncorrected)=3.51, p=0.06, AA=susceptible, AC/CC protective
- 23. Genotype. CC vs CG/GG for Lung cancer and resistant, Odds ratio (OR)=1.5, 95% confidence limits=0.9-2.5, χ2 (Yates uncorrected)=2.90, p=0.09, CC=susceptible, CG/GG protective
- 24. Genotype. Null vs wild for Lung cancer and controls, Odds ratio (OR)=1.92, 95% confidence limits=1.2-3.2, χ2 (Yates corrected)=6.64, p=0.01, Null=susceptible
- 25. Genotype. AA vs AT/TT for lung cancer vs resistant, Odds ratio (OR)=1.4, 95% confidence limits 0.8-2.4, χ2 (Yates uncorrected)=1.48, p=0.22, AA genotype=susceptible
- 26. Genotype. AA vs AT/TT for lung cancer vs controls, Odds ratio (OR)=1.9, 95% confidence limits 1.1-3.4, χ2 (Yates corrected)=5.45, p=0.02, AA genotype=susceptible to lung cancer
- 27. Genotype. CC/CG vs GG for Lung cancer vs resistant, Odds ratio (OR)=0.53, 95% confidence limits=0.3-0.9, χ2 (Yates corrected)=4.9, P=0.03 CC/CG=protective
- 28. Allele. C vs G for Lung cancer vs resistant, Odds ratio (OR)=0.59, 95% confidence limits 0.4-0.9, χ2 (Yates corrected)=4.8, p=0.03, C=protective
- 29. Genotype. GG vs CG/CC for Lung cancer vs resistant, Odds ratio (OR)=1.88, 95% confidence limits=1.1-3.3, χ2 (Yates corrected)=4.9, P=0.03 GG=susceptible (when compared against resistant smokers but not controls)
- 30. Allele. G vs C for Lung cancer vs resistant, Odds ratio (OR)=1.7, 95% confidence limits 1.1-2.7, χ2 (Yates corrected)=4.8, p=0.03, G=susceptible (when compared against resistant smokers but not controls)
- 31. Genotype. 2G2G vs 1G1G/1G2G for Lung cancer vs controls, Odds ratio (OR)=2.55, 95% confidence limits 1.3-5.1, χ2 (Yates corrected)=7.3, p=0.007 2G2G genotype=susceptible
- 32. Allele. 2G vs 1G for Lung cancer vs controls, Odds ratio (OR)=2.1, 95% confidence limits 1.4-3.2, χ2 (Yates corrected)=12.3, p=0.0004, 2G=susceptible
Connective Tissue Growth Factor (CTGF) −447 G/C Polymorphism Allele and Genotype Frequencies in the Lung Cancer and Resistant Smokers.
| Frequency |
G |
C |
GG |
GC |
CC |
|
| Lung cancer n = 109 |
201 |
17 |
92 |
17 |
0 |
| (%) |
(92%) |
(8%) |
(84%) |
(16%) |
(0%) |
| Resistant n = 200 |
379 |
21 |
179 |
21 |
0 |
| (%) |
(95%) |
(5%) |
(90%) |
(10%) |
(0%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. GC/CC vs GG for lung cancer vs resistant, Odds ratio (OR)=1.6, 95% confidence limits 0.8-3.3, χ2 (Yates uncorrected)=1.70, p=0.19, GC/CC genotype=susceptibility (trend)
Mucin 5AC (Muc5AC)-221 C/T Polymorphism Allele and Genotype Frequencies in the Lung Cancer and Resistant Smokers.
| Frequency |
C |
T |
CC |
CT |
TT |
|
| Lung cancer n = 109 |
177 |
41 |
73 |
31 |
5 |
| (%) |
(81%) |
(19%) |
(67%) |
(28%) |
(5%) |
| Resistant n = 195 |
296 |
94 |
119 |
58 |
18 |
| (%) |
(76%) |
(24%) |
(61%) |
(30%) |
(9%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. TT vs CC/CT for lung cancer vs resistant, Odds ratio (OR)=0.47, 95% confidence limits 0.2-1.4, χ2 (Yates uncorrected)=2.16, p=0.14, TT genotype=protective (trend)
Mannose Binding Lectin (MBL2) 161 G/A Polymorphism Allele and Genotype Frequencies in the Lung Cancer and Resistant Smokers.
| Frequency |
G |
A |
GG |
AG |
AA |
|
| Lung cancer n = 105 |
173 |
37 |
71 |
31 |
3 |
| (%) |
(82%) |
(18%) |
(67%) |
(30%) |
(3%) |
| Resistant n = 197 |
338 |
56 |
147 |
44 |
6 |
| (%) |
(86%) |
(14%) |
(75%) |
(22%) |
(3%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. AG/AA vs GG for lung cancer vs resistant, Odds ratio (OR)=1.4, 95% confidence limits 0.8-2.4, χ2 (Yates uncorrected)=1.67, p=0.20, AG/AA genotype=susceptibility (trend)
Nibrin (NBS1) Gln185Glu G/C Polymorphism Allele and Genotype Frequencies in the Lung Cancer and Resistant Smokers.
| Frequency |
G |
C |
GG |
GC |
CC |
|
| Lung cancer n = 109 |
150 |
68 |
54 |
42 |
13 |
| (%) |
(69%) |
(31%) |
(50%) |
(39%) |
(12%) |
| Resistant n = 199 |
295 |
103 |
107 |
81 |
11 |
| (%) |
(74%) |
(26%) |
(54%) |
(41%) |
(6%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. CC vs CG/GG for lung cancer vs resistant, Odds ratio (OR)=2.3, 95% confidence limits 0.9-5.8, χ2 (Yates uncorrected)=4.01, p=0.05, CC genotype=susceptibility
Arginase 1 (Arg1) Intron 1 C/T Polymorphism Allele and Genotype Frequencies in the Lung Cancer and Resistant Smokers.
| Frequency |
C |
T |
CC |
CT |
TT |
|
| Lung cancer n = 105 |
137 |
73 |
45 |
47 |
13 |
| (%) |
(65%) |
(35%) |
(43%) |
(45%) |
(12%) |
| Resistant n = 180 |
203 |
157 |
65 |
73 |
42 |
| (%) |
(56%) |
(44%) |
(36%) |
(41%) |
(23%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. TT vs CC/CT for lung cancer vs resistant, Odds ratio (OR)=0.46, 95% confidence limits 0.2-0.95, χ2 (Yates uncorrected)=5.11, p=0.02, TT genotype=protective
- 2. Allele. T vs C for lung cancer vs resistant, Odds ratio (OR)=0.69, 95% confidence limits 0.5-1.0, χ2 (Yates corrected)=3.96, p=0.05, T allele=protective
REV1 Phe257Ser C/T Polymorphism Allele and Genotype Frequencies in the Lung Cancer and Resistant Smokers.
| Frequency |
C |
T |
CC |
CT |
TT |
|
| Lung cancer n = 109 |
129 |
89 |
39 |
51 |
19 |
| (%) |
(59%) |
(41%) |
(36%) |
(47%) |
(17%) |
| Resistant n = 192 |
242 |
142 |
83 |
76 |
33 |
| (%) |
(63%) |
(37%) |
(43%) |
(40%) |
(17%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. CC vs CT/TT for lung cancer vs resistant, Odds ratio (OR)=0.73, 95% confidence limits 0.4-1.2, χ2 (Yates uncorrected)=1.6, p=0.20, CC genotype=protective (trend)
Insulin-Like Growth Factor II Receptor (IGF2R) Leu252Val C/G Polymorphism Allele and Genotype Frequencies in the Lung Cancer and Resistant Smokers.
| Frequency |
C |
G |
CC |
CG |
GG |
|
| Lung cancer n = 109 |
190 |
28 |
82 |
26 |
1 |
| (%) |
(87%) |
(13%) |
(75%) |
(24%) |
(1%) |
| Resistant n = 198 |
342 |
54 |
150 |
42 |
6 |
| (%) |
(86%) |
(14%) |
(76%) |
(21%) |
(3%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. GG vs CC/CG for lung cancer vs resistant, Odds ratio (OR)=0.30, 95% confidence limits 0.01-2.5, χ2 (Yates uncorrected)=1.41, p=0.22 (1-tailed t-test), GG genotype=protective (trend)
Apex Nuclease (APE1) Asp148Glu T/G Polymorphism Allele and Genotype Frequencies in the Lung Cancer and Resistant Smokers.
| Frequency |
T |
G |
TT |
TG |
GG |
|
| Lung cancer n = 109 |
124 |
94 |
39 |
46 |
24 |
| (%) |
(57%) |
(43%) |
(36%) |
(42%) |
(22%) |
| Resistant n = 192 |
229 |
155 |
69 |
91 |
32 |
| (%) |
(60%) |
(40%) |
(36%) |
(47%) |
(17%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. GG vs TT/TG for lung cancer vs resistant, Odds ratio (OR)=1.4, 95% confidence limits 0.8-2.7, χ2 (Yates uncorrected)=1.3, p=0.25, GG genotype=susceptibility (trend)
Interleukin 10 (IL-10)-1082 A/G polymorphism allele and genotype frequencies in the lung cancer and resistant smokers.
| Frequency |
G |
C |
GG |
GC |
CC |
|
| Lung cancer n = 98 |
91 |
105 |
16 |
59 |
23 |
| (%) |
(46%) |
(54%) |
(16%) |
(60%) |
(24%) |
| Resistant n = 196 |
174 |
218 |
40 |
94 |
62 |
| (%) |
(44%) |
(56%) |
(20%) |
(48%) |
(32%) |
|
| *number of chromosomes (2n) |
-
- 1. Genotype. GG vs GC/CC for lung cancer vs resistant, Odds ratio (OR)=0.66, 95% confidence limits 0.4-1.2, χ2 (Yates uncorrected)=2.12, p=0.15, GG genotype=protective (trend)
Table 12 below provides a summary of the protective and susceptibility polymorphisms determined for lung cancer.
| TABLE 12 |
|
| Summary of protective and susceptibility polymorphisms in Lung Cancer |
| patients relative to resistant smokers (with normal lung function) |
| Gene |
Polymorphism |
Role |
|
| Nitric Oxide synthase 3 (NOS3) |
NOS3 Asp 298 Glu |
TT protective |
| Nitric Oxide synthase 3 (NOS3) |
NOS3 −786 T/C |
TT susceptible |
| Superoxide dismutase 3 (SOD3) |
SOD3 Arg 312 Gln |
CG/GG protective |
| XRCC1 |
XRCC1 Arg 399 Gln G/A |
AA protective |
| Interleukin-8 (IL-8) |
IL-8 −251 A/T |
AA protective |
| Anti-chymotrypsin (ACT) |
ACT Ala 15 Thr |
GG susceptible |
| Cyclin D (CCND1) |
CCND1 A870G |
GG protective |
|
|
AA susceptible |
| Interleukin 1B (IL-1B) |
IL-1B −511 A/G |
GG susceptible |
| FAS (Apo-1/CD95) |
FAS A-670G |
AA susceptible |
| XPD |
XPD −751 G/T |
GG protective |
| CYP 1A1 |
CYP 1A1 Ile 462 Val |
GG/AG protective |
|
A/G |
AA susceptible |
| Matrix metalloproteinase 12 |
MMP12 Asn 357 Ser |
GG/AG protective |
| (MMP12) |
A/G |
| 8-Oxoguanine DNA glycolase |
OGG1 Ser 326 Cys G/C |
GG protective |
| (OGG1) |
| N-acetyltransferase 2 (NAT2) |
NAT2 Arg 197 Gln A/G |
GG susceptible |
| CYP2E1 |
CYP2E1 1019 G/C Pst I |
CC/CG |
|
|
susceptible |
| CYP2E1 |
CYP2E1 C/T Rsa I |
TT/TC |
|
|
susceptible |
| Interleukin-18 (IL-18) |
IL-18 105 A/C |
AC/CC protective |
|
|
AA susceptible |
| Interleukin-18 (IL-18) |
IL-18 −133 G/C |
CG/GG protective |
|
|
CC susceptible |
| Glutathione S-transferase M |
GSTM null |
Null susceptible |
| Interferon gamma (IFN?) |
IFN? 874 A/T |
AA susceptible |
| Cyclo-oxygenase 2 (COX2) |
COX2 −765 G/C |
CC/CG protective |
|
|
GG susceptible |
| Matrix metalloproteinase 1 (MMP1) |
MMP −1607 1G/2G |
2G2G susceptible |
| Connective tissue growth factor |
CTGF −447 G/C |
GC/CC |
| (CTGF) |
|
susceptible |
| Mucin 5AC (MUC5AC) |
MUC5AC −221 C/T |
TT protective |
| Mannose binding lectin 2 (MBL2) |
MBL2 +161 G/A |
AG/AA |
|
|
susceptible |
| Nibrin (NBS1) |
NBS1 Gln185Glu G/C |
CC susceptible |
| Arginase 1 (Arg1) |
Arg1 intron 1 C/T |
TT protective |
| REV1 |
REV1 Phe257Ser C/T |
CC protective |
| Insulin-like growth factor II receptor |
IGF2R Leu252Val C/G |
GG protective |
| (IGF2R) |
| Apex nuclease (Apex or APE1)) |
Apex Asp148Glu G/T |
GG susceptible |
| Interleukin 10 (IL-10) |
IL-10 −1082 A/G |
GG protective |
|
The combined frequencies of the presence or absence of the selected protective genotypes CYP1A1 GG/AG, OGG1 GG, CCND1 GG, NOS3 298 TT, IL-8 AA, and XRCC1 AA observed in the subjects with lung cancer and in resistant smokers is presented below in Table 13.
| TABLE 13 |
|
| Combined frequencies of the presence or absence of selected protective |
| genotypes in subjects with lung cancer and in resistant smokers. |
|
|
|
Number of protective |
|
|
polymorphisms |
| Cohorts |
0 |
1 |
=2 |
Total |
|
| Lung Cancer |
66 (61%) |
37 (34%) |
6 (6%) |
109 |
| Resistant smokers |
71 (36%) |
86 (43%) |
42 (21%) |
199 |
| % of smokers with Lung |
66/137 |
37/123 |
6/42 |
| cancer |
(48%) |
(30%) |
(14%) |
|
| Comparison |
Odd's ratio |
95% CI |
?2 |
P value |
|
| 0 vs 1 vs 2+, Resist vs Lung |
— |
— |
22.3 |
<0.0001 |
| cancer |
| 2+ vs 0-1, Resist vs Lung cancer |
4.6 |
1.8-12.5 |
11.87 |
0.0005 |
| 0 vs 2+, Lung cancer vs Resist |
2.8 |
1.7-4.6 |
16.7 |
<0.0001 |
|
The combined frequencies of the presence or absence of the selected susceptibility genotypes CYP2E1 1019 CC/CG, FAS AA, IL-1B GG, and ACT 15 GG, observed in the subjects with lung cancer and in resistant smokers is presented below in Table 14.
| TABLE 14 |
|
| Combined frequencies of the presence or absence of selected susceptibility |
| genotypes in subjects with lung cancer and in resistant smokers. |
|
|
|
Number of susceptibility |
|
|
polymorphisms |
| Cohorts |
0 |
1 |
=2 |
Total |
|
| Lung Cancer |
21 (19%) |
52 (48%) |
35 (33%) |
108 |
| Resistant smokers |
71 (36%) |
85 (43%) |
42 (21%) |
198 |
| % of smokers with |
21/92 |
52/137 |
35/77 |
| COPD |
(23%) |
(38%) |
(45%) |
|
| Comparison |
Odd's ratio |
95% CI |
?2 |
P value |
|
| 0 vs 1 vs 2+, |
— |
— |
10.2 |
0.006 |
| Lung cancer vs Resist |
| 2+ vs 0-1, Lung cancer vs Resist |
1.8 |
1.0-3.1 |
4.1 |
0.04 |
| 0+ vs 1-2+, Resist vs COPD |
2.3 |
1.3-4.2 |
8.2 |
0.004 |
|
The combined frequencies of the presence or absence of the selected protective genotypes CYP1A1 GG/AG, OGG1 GG, CCND1 GG, NOS3 298 TT, SOD3 CG/GG, XPD GG, MMP12 GG/AG, and XRCC1 AA observed in the subjects with lung cancer and in resistant smokers is presented below in Table 15.
| TABLE 15 |
|
| Combined frequencies of the presence or absence of selected protective |
| genotypes in subjects with lung cancer and in resistant smokers. |
|
|
|
Number of protective |
|
|
polymorphisms n = 8 |
| Cohorts |
0 |
1 |
=2 |
Total |
|
| Lung Cancer |
54 (50%) |
50 (46%) |
5 (4%) |
109 |
| Resistant smokers |
67 (34%) |
83 (42%) |
50 (25%) |
199 |
| % of smokers with Lung |
54/121 |
50/133 |
5/55 |
| cancer |
(45%) |
(38%) |
(9%) |
|
| Comparison |
Odd's ratio |
95% CI |
?2 |
P value |
|
| 0 vs 1 vs 2+, Resist vs Lung |
— |
— |
21.5 |
<0.0001 |
| cancer |
| 2+ vs 0-1, Resist vs Lung cancer |
6.9 |
2.5-20.5 |
18.7 |
<0.0001 |
| 0 vs 2+, Lung cancer vs Resist |
2.0 |
1.2-3.2 |
6.96 |
0.008 |
|
The combined frequencies of the presence or absence of the selected susceptibility genotypes CYP2E1 1019 CC/CG, FAS AA, IL-1B GG, ACT 15 GG, NAT2 GG, IL-18 105 AA, and IFN? AA, observed in the subjects with lung cancer and in resistant smokers is presented below in Table 16.
| TABLE 16 |
|
| Combined frequencies of the presence or absence of selected susceptibility |
| genotypes in subjects with lung cancer and in resistant smokers. |
|
|
|
Number of susceptibility |
|
|
polymorphisms n = 7 |
| Cohorts |
1 |
2 |
=3 |
Total |
|
| Lung Cancer |
16 (15%) |
35 (32%) |
58 (53%) |
109 |
| Resistant smokers |
65 (33%) |
66 (33%) |
69 (34%) |
200 |
| % of smokers with |
16/81 |
35/101 |
58/127 |
| COPD |
(20%) |
(35%) |
(46%) |
|
| Comparison |
Odd's ratio |
95% CI |
?2 |
P value |
|
| 0 vs 1 vs 2+, Lung cancer |
— |
— |
14.6 |
0.0007 |
| vs Resist |
| 3+ vs 1-2, Lung cancer vs Resist |
2.2 |
1.3-5.6 |
9.4 |
0.002 |
| 1 vs 2-3+, Resist vs COPD |
2.8 |
1.5-5.4 |
10.7 |
0.001 |
|
The combined frequencies of the presence or absence of the selected protective genotypes CYP1A1 GG/AG, OGG1 GG, CCND1 GG, NOS3 298 TT, IL-8 AA, XRCC1 AA, and Cox 2 −765 CC/CG, observed in the subjects with lung cancer and in resistant smokers is presented below in Table 17.
| TABLE 17 |
|
| Combined frequencies of the presence or absence of protective genotypes |
| in the exposed smoking subjects (Lung cancer subjects and resistant |
| smokers). |
|
|
|
Number of protective |
|
|
genotypes |
| Cohorts |
0 |
1 |
=2 |
Total |
|
| Lung Cancer |
45 (40%) |
50 (43%) |
19 (17%) |
114 |
| Resistant smokers |
47 (23%) |
79 (40%) |
74 (37%) |
200 |
| % of smokers with Lung |
45/92 |
50/129 |
19/93 |
| cancer |
(49%) |
(39%) |
(20%) |
|
| Comparison |
Odd's ratio |
95% CI |
?2 |
P value |
|
| 0 vs 1 vs 2+, Resist vs Lung |
— |
— |
16.8 |
0.0002 |
| cancer |
| 2+ vs 0-1, Resist vs Lung cancer |
2.94 |
1.6-5.4 |
13.44 |
0.0002 |
| 0 vs 2+, Lung cancer vs Resist |
2.12 |
1.3-3.6 |
8.2 |
0.004 |
|
The combined frequencies of the presence or absence of the selected susceptibility genotypes CYP2E1 1019 CC/CG, FAS AA, IL-B1 GG, ACT 15 GG, and MMP1 2G2G, observed in the subjects with lung cancer and in resistant smokers is presented below in Table 18.
| TABLE 18 |
|
| Combined frequencies of the presence or absence of susceptibility |
| genotypes in the exposed smoking subjects (Lung cancer subjects and |
| resistant smokers). |
|
|
|
Number of susceptibility |
|
|
genotypes |
| Cohorts |
0-1 |
2-3 |
4-6 |
Total |
|
| Lung Cancer |
13 (12%) |
66 (61%) |
30 (28%) |
109 |
| Resistant smokers |
54 (27%) |
113 (56%) |
33 (17%) |
200 |
| % of smokers with |
13/67 |
66/179 |
30/63 |
| COPD |
(19%) |
(37%) |
(48%) |
|
| Comparison |
Odd's ratio |
95% CI |
?2 |
P value |
|
| 0-1 vs 2-3 vs 4-6, |
— |
— |
11.8 |
0.003 |
| Lung cancer vs Resist |
| 4-6 vs rest, Lung cancer vs |
1.9 |
1.0-3.5 |
4.6 |
0.03 |
| Resist |
| 0-1 vs rest, Resist vs COPD |
2.7 |
1.4-5.6 |
8.6 |
0.003 |
|
Protective polymorphisms were assigned a score of −1 while susceptibility polymorphisms were assigned a score of +1. For each subject, a net score was then calculated according to the presence of susceptibility and protective genotypes. This produced a linear spread of values, as shown in Table 14. When assessed as a range between −2 to +4, a linear relationship as depicted in FIG. 4 was observed. This analysis indicates that for subjects with a net score of −2 or less, there was a minimal risk of having lung cancer. For subjects with a net score of −1, there was an approximately one in ten risk of having lung cancer. In contrast, for subjects with a net score of 4+ or greater, the risk was markedly increased to over 70% (see Table 19 and FIG. 4). It is noted that for FIG. 4, unlike the data presented in FIG. 3, the protective polymorphisms are assigned a negative value while the susceptibility polymorphisms are assigned a positive value. The precise value or sign given to each one is not critical, as long as it is consistent between the types of polymorphisms.
| TABLE 19 |
|
| Combined presence or absence of protective and susceptibility polymorphisms |
|
Score combining protective (−1) and susceptibility (+1) polymorphisms |
| Lung cancer |
0 (0%) |
2 (2%) |
10 (9%) |
21 (19%) |
38 (35%) |
23 (21%) |
15 (14%) |
| N = 109 (%) |
| Resistant smokers |
6 (3%) |
21 (11%) |
39 (20%) |
51 (26%) |
52 (26%) |
25 (13%) |
6 (3%) |
| N = 200 (%) |
| % Lung cancer |
0% |
9% |
20% |
29% |
42% |
48% |
71% |
|
A further combined analysis was performed using a greater number of polymorphisms. Again, this produced a linear spread of values (Table 20). When assessed as a range between −3 to +5, a linear relationship as depicted in FIG. 5 was observed. This analysis indicates that for subjects with a net score of −2 or less, there was a minimal risk of having lung cancer. In contrast, for subjects with a net score of 5+ or greater, the risk was markedly increased to 80% (see Table 20 and FIG. 5).
| TABLE 20 |
|
| Combined presence or absence of protective and susceptibility polymorphisms |
|
SNP score for Lung cancer according to the presence of |
|
protective(−1) and susceptibility (+1) genotypes for all smokers |
| Cohorts |
<−3 |
−2 |
−1 |
0 |
1 |
2 |
3 |
4 |
5+ |
|
| Lung cancer |
0 (0%) |
1 (1%) |
3 (3%) |
10 (9%) |
25 (23%) |
32 (29%) |
20 (18%) |
14 (13%) |
4 (4%) |
| N = 109 |
| Resistant smokers |
3 (2%) |
12 (6%) |
16 (8%) |
34 (17%) |
58 29%) |
48 (24%) |
21 (11%) |
7 (4%) |
1 (0.5%) |
| N = 200 |
| % Lung cancer |
0% |
7% |
16% |
23% |
30% |
40% |
49% |
67% |
80% |
|
DISCUSSION
The methods of the invention allow the determination of risk of disease to be assessed. For example, a simple scoring system in which each polymorphism in a category (i.e. protective or susceptibility) is assigned the same value allows the combined effects of all potentially relevant polymorphisms to be factored into the analysis. In other embodiments, the methods of the invention utilize a scoring system with adjustment (weighting) for the magnitude of the effect of each individual polymorphism, and again allow all polymorphisms to be simultaneously analyzed.
In other embodiments, analyses can utilise path analysis and/or Monte-Carlo analysis where the non-genetic and genetic factors can be analyzed.
Similar results were observed in comparing the presence or absence of susceptibility and resistant polymorphisms in smokers with OCOPD, and in smokers with lung cancer and resistant smokers.
The benefit of a net susceptibility score, having been determined for a subject is that it provides the opportunity for early prophylactic and/or therapeutic intervention. Such intervention can be as simple as communicating the net susceptibility score to the subject together with an explanation of the implications of that score. This alone can cause a lifestyle or occupational change, with the resultant beneficial effect for the subject.
Other, more direct approaches to prophylaxis or therapy can also be followed. These can include pharmaceutical or other medicaments being administered directed at favourably altering the net score of the subject together with other such approaches as discussed herein.
Table 21 below presents representative examples of polymorphisms in linkage disequilibrium with the polymorphisms specified herein. Examples of such polymorphisms can be located using public databases, such as that available online at world wide web dot hapmap dot org. Specified polymorphisms are indicated in the columns marked SNP NAME. Unique identifiers are indicated in the columns marked RS NUMBER.
| TABLE 21 |
|
| Polymorphisms reported to be in linkage disequilibrium (unless stated) with examples of specified |
| polymorphism. |
| SNP NAME |
RS NUMBER |
SNP NAME |
RS NUMBER |
SNP NAME |
RS NUMBER |
|
|
COX2 SNPs |
|
rs6684912 |
|
rs5277 |
|
rs7527769 |
|
rs2745559 |
|
rs2066823 |
|
rs7550380 |
|
rs12042763 |
|
rs4648263 |
|
rs2206594 |
|
rs4648250 |
|
rs4987012 |
|
rs6687495 |
|
rs4648251 |
|
rs20428 |
|
rs6681231 |
|
rs2223626 |
|
rs20429 |
|
rs13376484 |
|
rs689462 |
|
rs4648264 |
|
rs12064238 |
|
rs4648253 |
|
rs4648265 |
|
rs10911911 |
|
rs689465 |
|
rs4648266 |
|
rs12743673 |
|
rs12027712 |
|
rs4648267 |
|
rs10911910 |
|
rs689466 |
|
rs11567824 |
|
rs12743516 |
|
rs2745558 |
|
rs4648268 |
|
rs10911909 |
|
rs3918304 |
|
rs4648269 |
|
rs1119066 |
|
rs20415 |
|
rs4648270 |
|
rs1119065 |
|
rs20416 |
|
rs12759220 |
|
rs1119064 |
|
rs4648254 |
|
rs20430 |
|
rs10798053 |
|
rs11567815 |
|
rs4648271 |
|
rs12409744 |
−765G > C |
rs20417 |
|
rs11567825 |
|
rs10911908 |
|
rs4648256 |
|
rs4648273 |
|
rs10911907 |
|
rs20419 |
|
rs16825748 |
|
rs7416022 |
|
rs2734779 |
|
rs4648274 |
|
rs2745561 |
|
rs20420 |
|
rs16825745 |
|
rs10911906 |
|
rs20422 |
|
rs20432 |
|
rs2734776 |
|
rs20423 |
|
rs20433 |
|
rs2734777 |
|
rs5270 |
|
rs3218622 |
|
rs12084433 |
|
rs20424 |
|
rs2066826 |
|
rs2734778 |
|
rs5271 |
|
rs5278 |
|
rs2745560 |
|
rs4648257 |
|
rs4648276 |
|
rs2223627 |
|
rs11567819 |
|
rs20434 |
|
rs2383517 |
|
rs3134591 |
|
rs3218623 |
|
rs4295848 |
|
rs3134592 |
|
rs3218624 |
|
rs4428839 |
|
rs20426 |
|
rs5279 |
|
rs4609389 |
|
rs4648258 |
|
rs4648278 |
|
rs4428838 |
|
rs11567820 |
|
rs13306034 |
|
rs12131210 |
|
rs2745557 |
|
rs2853803 |
|
rs2179555 |
|
rs11567821 |
|
rs4648279 |
|
rs2143417 |
|
rs4648259 |
|
rs4648281 |
|
rs2143416 |
|
rs4648260 |
|
rs4648282 |
|
rs11583191 |
|
rs4648261 |
|
rs11567826 |
|
rs2383516 |
|
rs4648262 |
|
rs4648283 |
|
rs2383515 |
|
rs11567822 |
|
rs4648284 |
|
rs10911905 |
|
rs11567823 |
|
rs4648285 |
|
rs10911904 |
|
rs2066824 |
|
rs11567827 |
|
|
|
rs20427 |
|
rs4648286 |
|
rs4648287 |
|
rs1042719 |
|
rs5744244 |
|
rs5272 |
|
rs3729944 |
|
rs360722 |
|
rs4648288 |
|
rs3730182 |
|
rs5023207 |
|
rs5273 |
|
rs1042720 |
|
rs5744246 |
|
rs5274 |
|
rs6879202 |
|
rs5744247 |
|
rs3218625 |
|
rs3777124 |
−133 C/G |
rs360721 |
|
rs4648289 |
|
rs1803051 |
|
rs4988359 |
|
rs4648290 |
|
rs8192451 |
|
rs12721559 |
|
rs1051896 |
|
rs4987255 |
|
rs5744248 |
|
rs5275 |
|
rs3177007 |
|
rs5744249 |
|
1ADRB SNPs |
|
rs1126871 |
|
rs5744250 |
|
rs2082382 |
|
rs6885272 |
|
rs5744251 |
|
rs2082394 |
|
rs6889528 |
|
rs100000356 |
|
rs2082395 |
|
rs4521458 |
|
rs1834481 |
|
rs9325119 |
|
rs10463409 |
|
rs17215057 |
|
rs9325120 |
|
rs7702861 |
|
rs5744253 |
|
rs12189018 |
|
IL-18 SNPs |
|
rs5744254 |
|
rs11168066 |
|
rs187238 |
|
rs5744255 |
|
rs11959615 |
|
rs5744228 |
|
rs5744256 |
|
rs11958940 |
|
rs360718 |
|
rs5744257 |
|
rs4705270 |
|
rs360717 |
|
rs360720 |
|
rs10079142 |
|
rs5744229 |
|
rs5744258 |
|
rs9325121 |
|
rs100000353 |
|
rs5744259 |
|
rs11746634 |
|
rs5744231 |
|
rs5744260 |
|
rs11168067 |
|
rs5744232 |
|
rs5744261 |
|
rs9325122 |
|
rs7106524 |
105 A/C |
rs549908 |
|
rs11957351 |
|
rs189667 |
|
PAI-1 SNPs |
|
rs11948371 |
|
rs12290658 |
|
rs6465787 |
|
rs11960649 |
|
rs12271175 |
|
rs7788533 |
|
rs1432622 |
|
rs11606049 |
|
rs6975620 |
|
rs1432623 |
|
rs360716 |
|
rs6956010 |
|
rs11168068 |
|
rs360715 |
|
rs12534508 |
|
rs17778257 |
|
rs360714 |
|
rs4729664 |
|
rs2400706 |
|
rs2043055 |
|
rs2527316 |
|
rs2895795 |
|
rs5744233 |
|
rs2854235 |
|
rs2400707 |
|
rs795467 |
|
rs10228765 |
|
rs2053044 |
|
rs12270240 |
|
rs2854225 |
|
rs17108803 |
|
rs100000354 |
|
rs2854226 |
|
rs12654778 |
|
rs4937113 |
|
rs2227707 |
|
rs11168070 |
|
rs100000355 |
|
rs2227631 |
|
rs11959427 |
|
rs360723 |
−675 4G/5G |
No rs |
|
rs1042711 |
|
rs5744237 |
|
NOS3 SNPs |
|
rs1801704 |
|
rs5744238 |
|
rs2373962 |
| Arg16Gly |
rs1042713 |
|
rs5744239 |
|
rs2373961 |
|
rs1042714 |
|
rs7932965 |
|
rs6951150 |
|
rs1042717 |
|
rs11214103 |
|
rs13238512 |
|
rs1800888 |
|
rs5744241 |
|
rs10247107 |
|
rs1042718 |
|
rs5744242 |
|
rs10276930 |
|
rs3729943 |
|
rs5744243 |
|
rs10277237 |
|
rs12703107 |
|
rs9282804 |
|
rs2282679 |
|
rs6946340 |
Asp298Glu |
rs1799983 |
|
rs2282680 |
|
rs6946091 |
|
VDBP SNPs |
|
rs705117 |
|
rs6946415 |
|
rs222035 |
|
rs2070741 |
|
rs10952296 |
|
rs222036 |
|
rs2070742 |
|
rs13309715 |
|
rs16846943 |
|
rs6821541 |
|
rs10952297 |
|
rs7668653 |
|
rs222048 |
|
rs7784943 |
|
rs1491720 |
|
rs432031 |
|
rs11771443 |
|
rs16845007 |
|
rs432035 |
|
rs2243310 |
|
rs17830803 |
|
rs222049 |
|
rs1800783 |
Glu416Asp |
rs7041 |
|
rs222050 |
|
rs3918155 |
Lys420Thr |
rs4588 |
|
rs12510584 |
|
rs3918156 |
|
rs3737553 |
|
rs17467825 |
|
rs2566519 |
|
rs9016 |
|
GSTP1 SNPs |
|
rs3918157 |
|
rs1352846 |
|
rs656652 |
|
rs3918158 |
|
rs222039 |
|
rs625978 |
|
rs3918159 |
|
rs3775154 |
|
rs6591251 |
|
rs2566516 |
|
rs222040 |
|
rs12278098 |
|
rs3918225 |
|
rs843005 |
|
rs612020 |
|
rs3918160 |
|
rs222041 |
|
rs12284337 |
|
rs1800779 |
|
rs7672977 |
|
rs12574108 |
|
rs2243311 |
|
rs705121 |
|
rs6591252 |
|
rs3918161 |
|
rs11723621 |
|
rs597717 |
|
rs10952298 |
|
rs2298850 |
|
rs688489 |
|
rs2070744 |
|
rs705120 |
|
rs597297 |
|
rs3918226 |
|
rs2298851 |
|
rs6591253 |
|
rs3918162 |
|
rs844806 |
|
rs6591254 |
|
rs3918163 |
|
rs1491709 |
|
rs7927381 |
|
rs3918164 |
|
rs705119 |
|
rs7940813 |
|
rs3918165 |
|
rs6845925 |
|
rs593055 |
|
rs1800781 |
|
rs12640255 |
|
rs7927657 |
|
rs13310854 |
|
rs12644050 |
|
rs614080 |
|
rs13310763 |
|
rs6845869 |
|
rs7941395 |
|
rs2853797 |
|
rs12640179 |
|
rs7941648 |
|
rs13311166 |
|
rs222042 |
|
rs7945035 |
|
rs13310774 |
|
rs3187319 |
|
rs2370141 |
|
rs2853798 |
|
rs222043 |
|
rs2370142 |
|
rs11974098 |
|
rs842999 |
|
rs7949394 |
|
rs3918166 |
|
rs222044 |
|
rs7949587 |
|
rs3730001 |
|
rs222045 |
|
rs6591255 |
|
rs3918167 |
|
rs16846912 |
|
rs8191430 |
|
rs3918168 |
|
rs222046 |
|
rs6591256 |
|
rs3918169 |
|
rs705118 |
|
rs8191431 |
|
rs3918170 |
|
rs222047 |
|
rs8191432 |
|
rs3793342 |
|
rs13142062 |
|
rs7109914 |
|
rs3793341 |
|
rs843000 |
|
rs4147580 |
|
rs1549758 |
|
rs3755967 |
|
rs8191436 |
|
rs1007311 |
|
rs1491710 |
|
rs8191437 |
|
rs9282803 |
|
rs2282678 |
|
rs17593068 |
|
rs8191438 |
|
rs2069718 |
|
rs7145047 |
|
rs8191439 |
|
rs3087272 |
|
rs7141735 |
|
rs8191440 |
|
rs2069719 |
|
rs11558264 |
|
rs8191441 |
|
rs9282708 |
|
rs6647 |
|
rs1079719 |
|
rs2069720 |
|
rs8350 |
|
rs1871041 |
|
rs1042274 |
|
rs2230075 |
|
rs4147581 |
|
rs2069721 |
|
rs1049800 |
|
rs8191444 |
|
rs2069734 |
S allele |
rs17580 |
|
rs8191445 |
|
rs2069722 |
|
rs2854258 |
|
rs2370143 |
|
rs2234687 |
|
rs2753937 |
|
rs8191446 |
|
rs7957366 |
|
rs2749547 |
|
rs3891249 |
|
rs2069723 |
|
rs1243162 |
|
rs8191447 |
|
rs2069724 |
|
rs2753938 |
|
rs12796085 |
|
rs2069725 |
|
rs2070709 |
|
rs8191448 |
|
rs4394909 |
|
rs17090719 |
|
rs762803 |
|
rs2069726 |
|
rs11846959 |
|
rs8191449 |
|
rs2069727 |
|
rs1802962 |
| Ile105Val |
rs947894 |
|
IL-13 SNPs |
|
rs2749521 |
|
rs4986948 |
−1055 C/T |
rs1800925 |
|
rs2753939 |
|
rs675554 |
|
rs11575055 |
|
rs1802959 |
|
rs749174 |
|
rs2069755 |
|
rs1802961 |
|
rs8191450 |
|
rs2069741 |
|
rs1050469 |
|
rs743679 |
|
rs2069742 |
Z allele |
no rs |
|
rs1799811 |
|
rs2069743 |
|
rs1050520 |
|
rs11553890 |
|
rs2069756 |
|
rs12077 |
|
rs4986949 |
|
rs3212142 |
|
rs12233 |
|
rs8191451 |
|
rs2066960 |
|
rs13170 |
|
rs1871042 |
|
rs1295687 |
|
rs1303 |
|
rs11553892 |
|
rs3212145 |
|
rs1802960 |
|
rs4891 |
|
rs2069744 |
|
rs1243163 |
|
rs6413486 |
|
rs2069745 |
|
rs2073333 |
|
rs5031031 |
|
rs2069746 |
|
rs1243164 |
|
rs947895 |
|
rs2069747 |
|
rs7144409 |
|
IFN-SNPs |
|
rs2069748 |
|
rs7142803 |
|
rs2069707 |
|
rs1295686 |
|
rs1243165 |
|
rs3814242 |
Arg130Gln |
rs20541 |
|
rs1051052 |
|
rs2069709 |
|
rs2069749 |
|
rs1243166 |
|
rs2069710 |
|
rs1295685 |
|
rs11628917 |
|
rs2069711 |
|
rs848 |
|
rs11832 |
|
rs2069712 |
|
rs2069750 |
|
rs9944155 |
| 874 A/T |
rs2430561 |
|
rs847 |
1237 G/A |
rs11568814 |
|
rs2069713 |
|
a1-antitrypsin |
|
rs877081 |
|
|
|
SNPs |
|
rs1861494 |
|
rs709932 |
|
rs877082 |
|
rs2234685 |
|
rs11558261 |
|
rs877083 |
|
rs1861493 |
|
rs20546 |
|
rs877084 |
|
rs2069714 |
|
rs11558263 |
|
rs875989 |
|
rs2069715 |
|
F1028580 |
|
rs9944117 |
|
rs2069716 |
|
rs7145770 |
|
rs1884546 |
|
rs2069717 |
|
rs2239652 |
|
rs1884547 |
|
rs1885065 |
|
rs2735442 |
|
rs8046608 |
|
rs1884548 |
|
rs2569693 |
|
rs5743264 |
|
rs1243167 |
|
rs281439 |
|
rs5743266 |
|
rs17751614 |
|
rs281440 |
|
rs2076752 |
|
rs1884549 |
|
rs2569694 |
|
rs5743267 |
|
rs1243168 |
|
rs11575073 |
|
rs8061316 |
|
rs17090693 |
|
rs2569695 |
|
rs8061636 |
|
rs17824597 |
|
rs2075741 |
|
rs16948754 |
|
TNFa SNPs |
|
rs11575074 |
|
rs7206340 |
|
rs1799964 |
|
rs2569696 |
|
rs2076753 |
|
rs1800630 |
|
rs2735439 |
|
rs2067085 |
|
rs1799724 |
|
rs2569697 |
|
rs16948755 |
| +489 G/A |
rs1800610 |
|
rs2075742 |
|
rs2111235 |
|
rs3093662 |
|
rs2569698 |
|
rs2111234 |
|
rs3093664 |
|
rs11669397 |
|
rs7190413 |
| −308 G/A |
rs1800629 (1) |
|
rs901886 |
|
rs7206582 |
|
SMAD3 SNPs |
|
rs885742 |
|
rs8045009 |
| C89Y |
C89Y no rs (2) |
|
rs2569699 |
|
rs6500328 |
|
ICAM1 |
|
rs1056538 |
|
rs7500036 |
|
rs1799969 |
|
rs11549918 |
|
rs8057341 |
|
rs5493 |
|
rs2569700 |
|
rs12918060 |
|
rs5030381 |
|
rs2228615 |
|
rs7204911 |
|
rs5494 |
|
rs2569701 |
|
rs7500826 |
|
rs3093033 |
|
rs2569702 |
|
rs4785449 |
|
rs5495 |
|
rs2735440 |
|
rs12922299 |
|
rs1801714 |
|
rs2569703 |
|
rs11649521 |
|
rs13306429 |
|
rs10418913 |
|
rs13339578 |
|
rs2071441 |
|
rs1056536 |
|
rs17221417 |
|
rs5496 |
|
rs2569704 |
|
rs13331327 |
|
rs5497 |
|
rs11673661 |
|
rs11642482 |
|
rs13306430 |
|
rs2569705 |
|
rs11642646 |
| E469K |
rs5498 |
|
rs10402760 |
|
rs17312836 |
|
rs5030400 |
|
rs2569706 |
|
rs5743268 |
|
rs2071440 |
|
rs2569707 |
|
rs5743269 |
|
rs5499 |
|
rs2735441 |
|
rs5743270 |
|
rs3093032 |
|
rs2436545 |
|
rs12925051 |
|
rs1057981 |
|
rs2436546 |
|
rs12929565 |
|
rs5500 |
|
rs2916060 |
|
rs13380733 |
|
rs5501 |
|
rs2916059 |
|
rs13380741 |
|
rs5030383 |
|
rs2916058 |
|
rs11647841 |
|
rs281436 |
|
rs2569708 |
|
rs10451131 |
|
rs923366 |
|
rs12972990 |
|
rs2066842 |
|
rs281437 |
|
rs735747 |
|
rs5743271 |
|
rs3093030 |
|
rs885743 |
|
rs7498256 |
|
rs5030384 |
|
NOD2 SNPs |
|
rs5743272 |
|
rs5030385 |
|
rs4785224 |
|
rs5743273 |
|
rs3810159 |
|
rs5743261 |
|
rs2076754 |
|
rs281438 |
|
rs5743262 |
|
rs2066843 |
|
rs3093029 |
|
rs5743263 |
|
rs1078327 |
|
rs5743274 |
|
rs11645386 |
|
rs1031101 |
|
rs1861759 |
|
rs7187857 |
|
rs10824795 |
|
rs5743275 |
|
rs8061960 |
|
rs10824794 |
|
rs5743276 |
|
rs5743294 |
|
rs920725 |
|
rs2066844 |
|
rs2357791 |
|
rs7916582 |
|
rs5743277 |
|
rs7359452 |
|
rs920724 |
|
rs5743278 |
|
rs7203344 |
|
rs16933335 |
|
rs6413461 |
|
rs5743295 |
|
rs11003125 |
|
rs3813758 |
|
rs5743296 |
|
rs7100749 |
|
rs5743279 |
|
rs3135499 |
|
rs11003124 |
|
rs5743280 |
|
rs5743297 |
|
rs7084554 |
|
rs5743281 |
|
rs5743298 |
|
rs7096206 |
|
rs4785225 |
|
rs5743299 |
|
rs11003123 |
|
rs16948773 |
|
rs3135500 |
|
rs11575988 |
|
rs9931711 |
|
rs5743300 |
|
rs11575989 |
|
rs17313265 |
|
rs8056611 |
|
rs7095891 |
|
rs11646168 |
|
rs2357792 |
|
rs4647963 |
|
rs9925315 |
|
rs12600253 |
|
rs8179079 |
|
rs5743284 |
|
rs12598306 |
|
rs5030737 |
|
rs5743285 |
|
rs7205423 |
161 G/A |
rs1800450 |
|
rs751271 |
|
rs718226 |
|
rs1800451 |
|
rs748855 |
|
MBL2 SNPs |
|
rs12246310 |
|
rs1861758 |
|
rs7899547 |
|
rs12255312 |
|
rs13332952 |
|
rs10824797 |
|
rs11003122 |
|
rs7198979 |
|
rs11003131 |
|
rs1982267 |
|
rs1861757 |
|
rs930506 |
|
rs1982266 |
|
rs7203691 |
|
rs930505 |
|
rs4935047 |
|
rs5743286 |
|
rs11003130 |
|
rs4935046 |
|
rs5743287 |
|
rs2384044 |
|
rs10824793 |
|
rs10521209 |
|
rs2384045 |
|
rs1838066 |
| Gly881Arg |
rs2066845 |
|
rs5027257 |
|
rs1838065 |
|
rs5743289 |
|
rs2384046 |
|
rs930509 |
|
rs8063130 |
|
rs12263867 |
|
rs930508 |
|
rs2076756 |
|
rs11003129 |
|
rs930507 |
|
rs12920425 |
|
rs12221393 |
|
CMA1 SNPs |
|
rs12920040 |
|
rs2165811 |
|
rs1956920 |
|
rs12920558 |
|
rs12782244 |
|
rs1956921 |
|
rs12919099 |
|
rs11003128 |
−1903 G/A |
rs1800875 |
|
rs12920721 |
|
rs17664818 |
|
rs1800876 |
|
rs2076755 |
|
rs7475766 |
|
rs3759635 |
|
rs5743290 |
|
rs10824796 |
|
rs1956922 |
|
rs5743291 |
|
rs16933417 |
|
rs1956923 |
|
rs11642651 |
|
rs2165810 |
|
NAT2 SNPs |
|
rs1861756 |
|
rs11003127 |
|
rs11780272 |
|
rs749910 |
|
rs3925313 |
|
rs2101857 |
|
rs4990643 |
|
rs7094151 |
|
rs13363820 |
|
rs1077861 |
|
rs7071882 |
|
rs6984200 |
|
rs5743292 |
|
rs12264958 |
|
rs13277605 |
|
rs9921146 |
|
rs11003126 |
|
rs9987109 |
|
rs7820330 |
|
rs7596849 |
−366 G/A |
rs9550373 |
|
rs7460995 |
|
rs4848306 |
|
rs11542984 |
|
rs2087852 |
|
rs3087257 |
|
rs4769055 |
|
rs2101684 |
|
rs7556811 |
|
rs17074937 |
|
rs7011792 |
|
rs7556903 |
|
rs9671065 |
|
rs1390358 |
|
rs6743438 |
|
rs9579645 |
|
rs923796 |
|
rs6743427 |
|
rs9579646 |
|
rs4546703 |
|
rs6761336 |
|
rs4075131 |
|
rs4634684 |
|
rs6761335 |
|
rs4075132 |
|
rs2410556 |
|
rs6743338 |
|
rs9315043 |
|
rs11996129 |
|
rs6761245 |
|
rs9315044 |
|
rs4621844 |
|
rs6761237 |
|
rs4597169 |
|
rs11785247 |
|
rs6743330 |
|
rs9578037 |
|
rs1115783 |
|
rs6743326 |
|
rs9578196 |
|
rs1115784 |
|
rs6743322 |
|
rs4293222 |
|
rs1961456 |
|
rs6761220 |
|
rs10507391 |
|
rs1112005 |
|
rs6761218 |
|
rs12429692 |
|
rs11782802 |
|
rs5021469 |
|
rs4769871 |
|
rs973874 |
|
rs6710598 |
|
rs4769872 |
|
rs1495744 |
|
rs1143623 |
|
rs4769873 |
|
rs7832071 |
|
rs1143624 |
|
rs12430051 |
|
rs1805158 |
|
rs2708920 |
|
rs9315045 |
|
rs1801279 |
|
rs1143625 |
|
rs9670278 |
|
rs1041983 |
|
rs2853545 |
|
rs4503649 |
|
rs1801280 |
|
rs2708921 |
|
rs9508832 |
|
rs4986996 |
|
rs1143626 |
|
rs9670460 |
|
rs12720065 |
|
rs3087258 |
|
rs3885907 |
|
rs4986997 |
C-511T |
rs16944 |
|
rs3922435 |
|
rs1799929 |
|
rs3917346 |
|
rs9551957 |
| Arg197Gln |
rs1799930 |
|
rs4986962 |
|
rs12018461 |
|
rs1208 |
|
rs1143627 |
|
rs9551958 |
|
rs1799931 |
|
MEH SNPs |
|
rs10467440 |
|
rs2552 |
Tyr113His |
rs1051740 (2) |
|
rs12017304 |
|
rs4646247 |
His139Arg |
rs2234922 (2) |
|
rs9551959 |
|
rs971473 |
|
ALOX5AP SNPs |
|
rs11617473 |
|
rs721398 |
|
rs4076128 |
|
rs11147438 |
|
IL-1B SNPs |
|
rs9508830 |
|
rs10162089 |
|
rs10169916 |
|
rs4073259 |
|
rs9551960 |
|
rs13009179 |
|
rs4073260 |
|
rs9285075 |
|
rs4849127 |
|
rs11616333 |
|
rs12431114 |
|
rs4849126 |
|
rs4073261 |
|
rs4254165 |
|
rs7558108 |
|
rs4075474 |
|
rs4360791 |
|
rs13032029 |
|
rs4075473 |
|
rs17612031 |
|
rs13013349 |
|
rs9670115 |
|
rs3803277 |
|
rs12623093 |
|
rs9315042 |
|
rs3803278 |
|
rs3087255 |
|
rs3809376 |
|
rs12429469 |
|
rs3087256 |
|
rs12877064 |
|
rs17612099 |
|
rs6721954 |
|
rs9508831 |
|
rs9550576 |
|
rs12621220 |
|
rs9670503 |
|
rs4356336 |
|
rs4584668 |
|
rs2075800 |
|
rs2734714 |
|
rs4238137 |
|
CLCA1 SNPs |
|
rs6661730 |
|
rs17612127 |
|
rs2791519 |
|
rs2753377 |
|
rs4147063 |
|
rs2791518 |
|
rs2753378 |
|
rs4147064 |
|
rs5744302 |
|
rs2145412 |
|
rs4147062 |
|
rs1321697 |
|
rs2180762 |
|
rs9315046 |
|
rs2753338 |
|
rs1005569 |
|
rs9506352 |
|
rs2791517 |
|
rs5744325 |
|
rs9670531 |
|
rs5744303 |
|
rs5744326 |
|
rs9671182 |
|
rs2734706 |
|
rs1985554 |
|
rs9315047 |
|
rs2753345 |
|
rs1985555 |
|
rs17690694 |
|
rs2753347 |
|
rs100000102 |
|
rs9652070 |
|
rs2753348 |
|
rs100000103 |
|
rs17074966 |
|
rs2753349 |
|
rs1969719 |
|
rs4387455 |
|
rs5744304 |
|
rs2390102 |
|
rs4254166 |
|
rs5744305 |
|
rs5744329 |
|
rs4075692 |
|
rs1358826 |
|
rs1407142 |
|
rs17690748 |
|
rs2753359 |
|
rs2753384 |
|
rs9671124 |
|
rs5744306 |
|
rs2753385 |
|
rs9671125 |
|
rs2734711 |
|
rs5744330 |
|
rs9741436 |
|
rs5744307 |
|
rs5744331 |
|
rs9578197 |
|
rs2734712 |
|
rs926064 |
|
rs4769056 |
|
rs2753361 |
|
rs926065 |
|
rs11147439 |
|
rs2753364 |
|
rs926066 |
|
rs12721459 |
|
rs1555389 |
|
rs926067 |
|
rs4769874 |
|
rs2753365 |
|
rs2753386 |
|
HSP70 HOM SNPs |
|
rs100000100 |
|
rs2180764 |
|
rs1043618 |
|
rs100000101 |
|
rs2734689 |
|
rs11576009 |
|
rs5744310 |
|
rs5744332 |
|
rs11557922 |
|
rs5744311 |
|
rs5744333 |
|
rs11576010 |
|
rs5744312 |
|
rs11161837 |
|
rs1008438 |
|
rs4656114 |
|
rs5744335 |
|
rs11576011 |
|
rs5744313 |
|
rs2038485 |
|
rs4713489 |
|
rs2753367 |
|
rs3765989 |
|
rs16867582 |
|
rs4656115 |
|
rs2734690 |
|
rs12526722 |
|
rs2734713 |
|
rs5744336 |
|
rs6933097 |
|
rs5744314 |
|
rs2734691 |
|
rs12213612 |
|
rs5744315 |
|
rs2734692 |
|
rs481825 |
|
rs5744316 |
|
rs5744337 |
|
rs7757853 |
|
rs5744317 |
|
rs5744338 |
|
rs7757496 |
|
rs5744318 |
|
rs2734694 |
|
rs9469057 |
|
rs926063 |
|
rs5744339 |
|
rs12182397 |
|
rs5744319 |
|
rs100000104 |
|
rs16867580 |
|
rs5744320 |
|
rs2791515 |
|
rs2075799 |
|
rs5744321 |
|
rs4656116 |
|
rs482145 |
|
rs5744322 |
|
rs5744342 |
|
rs2227957 |
|
rs5744323 |
|
rs5744343 |
| T2437C |
rs2227956 |
|
rs5744324 |
|
rs2180761 |
|
rs2227955 |
|
rs2791516 |
|
rs5744344 |
|
rs5744345 |
|
rs5744443 |
|
rs6032038 |
|
rs1358825 |
|
rs5744444 |
|
rs6032039 |
|
rs2145410 |
|
rs3138074 |
|
rs2267863 |
|
rs2734695 |
|
rs13166911 |
|
rs6124692 |
|
rs5744346 |
|
rs2563310 |
+49 C/T |
No rs |
|
rs5744347 |
|
rs2569193 |
|
rs17333103 |
|
rs100000105 |
|
rs2569192 |
|
rs17333180 |
|
rs5744349 |
|
rs5744446 |
|
rs1983649 |
|
rs4655913 |
|
rs5744447 |
|
rs16989785 |
|
rs1321696 |
|
rs5744448 |
|
rs17424356 |
|
rs5744352 |
|
rs3138076 |
|
rs6017500 |
|
rs11583355 |
|
rs12519656 |
|
rs6032040 |
|
rs100000106 |
|
rs5744449 |
|
rs6017501 |
|
rs1321695 |
|
rs2915863 |
|
rs2664581 |
| +13924 T/A |
rs1321694 |
|
rs3138078 |
|
rs17424474 |
|
rs2791514 |
|
rs6875483 |
|
rs17333381 |
|
rs2734696 |
|
rs2569191 |
|
rs1053826 |
|
rs5744354 |
|
rs5744451 |
|
rs2664533 |
|
rs2791513 |
|
rs5744452 |
|
rs1053831 |
|
rs2753332 |
|
rs100000098 |
|
rs2664520 |
|
rs2791512 |
|
rs17118968 |
|
rs2267864 |
|
rs2791511 |
|
rs5744455 |
|
rs13038355 |
|
rs2734697 |
−159 C/T |
rs2569190 |
|
rs13043296 |
|
CD14 SNPs |
|
rs2569189 |
|
rs13039213 |
|
rs6877461 |
|
rs2563303 |
|
rs6104049 |
|
rs3822356 |
|
rs3138079 |
|
rs13043503 |
|
rs6877437 |
|
rs2228049 |
|
rs6104050 |
|
rs12153256 |
|
rs13763 |
|
rs17424578 |
|
rs11554680 |
|
rs11556179 |
|
rs17424613 |
|
rs12109040 |
|
rs4914 |
|
rs6017502 |
|
rs12517200 |
|
Elafin SNPs |
|
rs6094101 |
|
rs5744430 |
|
rs2868237 |
|
rs6130778 |
|
rs5744431 |
|
rs4632412 |
|
rs6130779 |
|
rs100000092 |
|
rs7347427 |
|
rs6104051 |
|
rs5744433 |
|
rs6032032 |
|
rs6104052 |
|
rs100000093 |
|
rs10854230 |
|
ADBR2 SNPs |
|
rs4912717 |
|
rs7347426 |
|
rs2082382 |
|
rs100000094 |
|
rs8183548 |
|
rs2082394 |
|
rs100000095 |
|
rs6104047 |
|
rs2082395 |
|
rs100000096 |
|
rs6513967 |
|
rs9325119 |
|
rs6864930 |
|
rs13038813 |
|
rs9325120 |
|
rs100000097 |
|
rs8118673 |
|
rs12189018 |
|
rs6864583 |
|
rs7346463 |
|
rs11168066 |
|
rs6864580 |
|
rs7362841 |
|
rs11959615 |
|
rs6889418 |
|
rs13042694 |
|
rs11958940 |
|
rs6889416 |
|
rs13038342 |
|
rs4705270 |
|
rs5744440 |
|
rs7363327 |
|
rs10079142 |
|
rs5744441 |
|
rs6073668 |
|
rs9325121 |
|
rs5744442 |
|
rs13044826 |
|
rs11746634 |
|
rs11168067 |
|
rs1800468 |
|
rs542603 |
|
rs9325122 |
|
rs4987025 |
|
rs574939 |
|
rs11957351 |
|
rs1800469 |
|
rs573764 |
|
rs11948371 |
|
rs11466314 |
|
rs7102189 |
|
rs11960649 |
|
rs12977628 |
|
rs575727 |
|
rs1432622 |
|
rs12977601 |
|
rs552306 |
|
rs1432623 |
|
rs12985978 |
|
rs634607 |
|
rs11168068 |
|
rs11466315 |
|
rs12286876 |
|
rs17778257 |
|
rs11551223 |
|
rs12285331 |
|
rs2400706 |
|
rs11551226 |
|
rs519806 |
|
rs2895795 |
|
rs11466316 |
|
rs12283571 |
|
rs2400707 |
|
rs13306706 |
|
rs2839969 |
|
rs2053044 |
|
rs13306707 |
|
rs2000609 |
|
rs17108803 |
|
rs13306708 |
|
rs7125865 |
|
rs12654778 |
|
rs9282871 |
|
rs570662 |
|
rs11168070 |
Leu10Pro |
rs1982073 |
|
rs11225427 |
|
rs11959427 |
|
rs1800471 |
|
rs484915 |
|
rs1042711 |
|
rs13447341 |
|
rs470307 |
|
rs1801704 |
|
rs11466318 |
|
rs2408490 |
|
rs1042713 |
|
rs12976890 |
|
rs12279710 |
| Gln27Glu |
rs1042714 |
|
rs12978333 |
|
rs685265 |
|
rs1042717 |
|
rs10420084 |
|
rs7107224 |
|
rs1800888 |
|
rs10418010 |
|
rs1155764 |
|
rs1042718 |
|
rs12983775 |
|
rs534191 |
|
SOD3 SNPs |
|
rs12462166 |
|
rs509332 |
| Arg213Gly |
rs1799895 (2) |
|
rs2241715 |
|
rs12283759 |
|
TGFB1 SNPs |
|
rs9749548 |
|
rs2105581 |
|
rs1529717 |
|
rs7258445 |
|
rs470206 |
|
rs1046909 |
|
rs11466320 |
|
rs533621 |
|
rs2241712 |
|
rs11466321 |
−1607 G/GG |
rs1799750 |
|
rs2241713 |
|
rs8108052 |
|
rs470211 |
|
rs2241714 |
|
rs6508976 |
|
rs470146 |
|
rs11673525 |
|
rs8108632 |
|
rs2075847 |
|
rs2873369 |
|
rs11466324 |
|
rs473509 |
|
rs11083617 |
|
rs2241716 |
|
rs498186 |
|
rs11083616 |
|
rs2241717 |
|
GSTM1 |
|
|
|
|
|
polymorphism |
|
rs4803458 |
|
rs2288873 |
Null |
Null allele No rs (2) |
|
rs11670143 |
|
rs12973435 |
|
MMP9 SNPs |
|
rs1982072 |
|
rs2014015 |
|
rs11696804 |
|
rs11668109 |
|
rs1989457 |
|
rs6104416 |
|
rs13345981 |
|
rs10406816 |
|
rs3933239 |
|
rs11666933 |
|
rs8102918 |
|
rs3933240 |
|
rs11466310 |
|
rs4803455 |
|
rs6094237 |
|
rs11466311 |
|
MMP1 SNPs |
|
rs11697325 |
|
rs2317130 |
|
rs529381 |
|
rs6130988 |
|
rs4803457 |
|
rs1144396 |
|
rs6073983 |
|
rs3087453 |
|
rs504875 |
|
rs6130989 |
|
rs1800820 |
|
rs526215 |
|
rs6130990 |
|
rs1054797 |
|
rs12280880 |
|
rs10211842 |
|
rs6073984 |
|
rs8125587 |
|
TIMP3 SNPs |
|
rs6073985 |
|
rs3918253 |
|
rs5754289 |
|
rs8121146 |
|
rs2274755 |
|
rs5754290 |
|
rs6032620 |
|
rs2664538 |
|
rs9606994 |
|
rs11698788 |
|
rs3918254 |
|
rs7285034 |
|
rs6032621 |
|
rs6130993 |
|
rs13433582 |
|
rs6065912 |
|
rs3918255 |
|
rs1962223 |
|
rs6104417 |
|
rs2236416 |
|
rs8137129 |
|
rs3848720 |
|
rs6130994 |
|
rs1807471 |
|
rs13040272 |
|
rs3918256 |
|
rs7290885 |
|
rs6104418 |
|
rs3918281 |
|
rs5749511 |
|
rs3848721 |
|
rs3787268 |
|
rs11703366 |
|
rs3848722 |
|
rs3918257 |
|
rs4990774 |
|
rs6104419 |
|
rs6017725 |
−1296 T/C |
rs9619311 |
|
rs4810482 |
|
rs6032623 |
|
rs2234921 |
|
rs3761157 |
|
rs3918258 |
|
rs2234920 |
|
rs3761158 |
|
rs2250889 |
|
rs16991235 |
|
rs3761159 |
|
rs3918259 |
|
rs4638893 |
|
rs8113877 |
|
rs3918260 |
|
rs12169569 |
|
rs6065913 |
|
rs13969 |
|
rs5998639 |
|
rs6104420 |
|
rs6104427 |
|
rs7284166 |
|
rs6104421 |
|
rs6104428 |
|
rs5749512 |
|
rs3918240 |
|
rs2274756 |
|
rs6104422 |
|
rs6017726 |
|
rs3918278 |
|
rs3918261 |
|
rs3918241 |
|
rs6032624 |
| −1562 C/T |
rs3918242 |
|
rs3918262 |
|
rs3918243 |
|
rs3918263 |
|
rs3918279 |
|
rs3918264 |
|
rs3918280 |
|
rs6130995 |
|
rs4578914 |
|
rs6130996 |
|
rs6017724 |
|
rs3918265 |
|
rs3918244 |
|
rs3918266 |
|
rs3918245 |
|
rs3918267 |
|
rs6130992 |
|
rs6073987 |
|
rs3918247 |
|
rs6073988 |
|
rs3918248 |
|
rs3918282 |
|
rs3918249 |
|
rs1802909 |
|
rs6104423 |
|
rs13925 |
|
rs6104424 |
|
rs20544 |
|
rs6104425 |
|
rs1056628 |
|
rs6104426 |
|
rs1802908 |
|
rs3918250 |
|
rs2664517 |
|
rs1805089 |
|
rs9509 |
|
rs3918251 |
|
rs3918268 |
|
rs13040572 |
|
rs3918269 |
|
rs13040580 |
|
rs3918270 |
|
rs3918252 |
|
MMP12 SNPs |
|
rs8125581 |
−82 A/G |
rs2276109 (2) |
|
| (1 = no other SNPs reported to be in LD, 2 = no other SNPS reported to be in LD) |
INDUSTRIAL APPLICATION
The present invention is directed to methods for assessing a subject's risk of developing a disease. The methods include the analysis of polymorphisms herein shown to be associated with increased or decreased risk of developing a disease, or the analysis of results obtained from such an analysis, and the determination of a net risk score. Methods of treating subjects at risk of developing a disease herein described are also provided. Additional information regarding the above material, or subparts thereof, can be found in U.S. patent application Ser. No. 10/479,525, filed Jun. 16, 2004; and PCT Application No. PCT/NZ02/00106, filed Jun. 5, 2002, which further designates New Zealand Application No. 512169, filed Jun. 5, 2001; New Zealand Application No. 513016, filed Jul. 17, 2001, and New Zealand Application No. 514275, filed Sep. 18, 2001, all of which are incorporated by reference in their entireties. Additional information can also be found in PCT application Nos. ______ and ______, filed May 10, 2006, entitled “Methods and Compositions for Assessment of Pulmonary Function and Disorders” and “Methods of Analysis of Polymorphisms and Uses Thereof” respectively, having Agent Reference Nos. 542813JBM and 542814JBM respectively, both of which are incorporated in their entireties by reference. PCT Application Agent Reference No. 542813JBM claims priority to: NZ application No. 539934, filed May 10, 2005; NZ application No. 541935, filed Aug. 19, 2005; and JP application No. 2005-360523, filed Dec. 14, 2005, all of which are incorporated by reference in their entireties. PCT Application Agent Reference No. 542814JBM claims priority to: NZ application No. 540249, filed May 20, 2005; and NZ application No. 541842, filed Aug. 15, 2005, all of which are incorporated in their entireties by reference. Additional information can also be found in U.S. Pat. No. ______, filed concurrently with the instant application, entitled “Methods and Compositions for Assessment of Pulmonary Function and Disorders”, attorney docket No; SGENZ.013AUS, incorporated by reference in its entirety.
PUBLICATIONS
- 1. Sandford A J, et al., 1999. Z and S mutations of the α1-antitrypsin gene and the risk of chronic obstructive pulmonary disease. Am J Respir Cell Mol. Biol. 20; 287-291.
- 2. Maniatis, T., Fritsch, E. F. and Sambrook, J., Molecular Cloning Manual. 1989.
- 3. Papafili A, et al., 2002. Common promoter variant in cyclooxygenase-2 represses gene expression. Arterioscler Thromb Vasc Biol. 20; 1631-1635.
- 4. Ukkola, O., Erkkilä, P. H., Savolainen, M. J. & Kesäniemi, Y. A. 2001. Lack of association between polymorphisms of catalase, copper zinc superoxide dismutase (SOD), extracellular SOD and endothelial nitric oxide synthase genes and macroangiopathy in patients with type 2 diabetes mellitus. J Int Med 249; 451-459.
- 5. Smith C A D & Harrison D J, 1997. Association between polymorphism in gene for microsomal epoxide hydrolase and susceptibility to emphysema. Lancet. 350; 630-633.
- 6. Lorenz E, et al., 2001. Determination of the TLR4 genotype using allele-specific PRC. Biotechniques. 31; 22-24.
- 7. Cantlay A M, Smith C A, Wallace W A, Yap P L, Lamb D, Harrison D J. Heterogeneous expression and polymorphic genotype of glutathione S-transferases in human lung. Thorax. 1994, 49(10):1010-4.
All patents, publications, scientific articles, and other documents and materials referenced or mentioned herein are indicative of the levels of skill of those skilled in the art to which the invention pertains, and each such referenced document and material is hereby incorporated by reference to the same extent as if it had been incorporated by reference in its entirety individually or set forth herein in its entirety. Any and all materials and information from any such patents, publications, scientific articles, web sites, electronically available information, and other referenced materials or documents can be physically incorporated into this specification.
The specific methods and compositions described herein are representative of various embodiments or preferred embodiments and are exemplary only and not intended as limitations on the scope of the invention. Other objects, aspects, examples and embodiments will occur to those skilled in the art upon consideration of this specification, and are encompassed within the spirit of the invention as defined by the scope of the claims. It will be readily apparent to one skilled in the art that varying substitutions and modifications can be made to the invention disclosed herein without departing from the scope and spirit of the invention. The invention illustratively described herein suitably can be practiced in the absence of any element or elements, or limitation or limitations, which is not specifically disclosed herein as essential. Thus, for example, in each instance herein, in embodiments or examples of the present invention, any of the terms “comprising”, “consisting essentially of”, and “consisting of” can be replaced with either of the other two terms in the specification, thus indicating additional examples, having different scope, of various alternative embodiments of the invention. Also, the terms “comprising”, “including”, containing”, etc. are to be read expansively and without limitation. The methods and processes illustratively described herein suitably can be practiced in differing orders of steps, and that they are not necessarily restricted to the orders of steps indicated herein or in the claims. It is also that as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to “a host cell” includes a plurality (for example, a culture or population) of such host cells, and so forth. Under no circumstances may the patent be interpreted to be limited to the specific examples or embodiments or methods specifically disclosed herein. Under no circumstances may the patent be interpreted to be limited by any statement made by any Examiner or any other official or employee of the Patent and Trademark Office unless such statement is specifically and without qualification or reservation expressly adopted in a responsive writing by the Applicant.
The terms and expressions that have been employed are used as terms of description and not of limitation, and there is no intent in the use of such terms and expressions to exclude any equivalent of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention as claimed. Thus, it will be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed can be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended indicative claims.
The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
Other embodiments are within the following indicative claims. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.