US20110236891A1
2011-09-29
13/046,066
2011-03-11
The invention teaches a novel reagent formulation for the efficient preparation of a nucleic acid template from cells for high throughput real-time PCR analysis. The reagent permits rapid cell lysis and template preparation without the need for template purification and isolation. The reagent therefore dramatically improves throughput of real-time PCR analysis while at the same time permitting the rapid and sensitive real-time Catacleave PCR detection of a single molecule of nucleic acid template in as little as about 35 cycles of PCR amplification.
Get notified when new applications in this technology area are published.
C12Q1/689 » CPC main
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Y02A50/30 » CPC further
in human health protection, e.g. against extreme weather Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Y02P20/582 » CPC further
Technologies relating to chemical industry; Improvements relating to the production of bulk chemicals Recycling of unreacted starting or intermediate materials
Y02P20/582 » CPC further
Technologies relating to chemical industry; Improvements relating to the production of bulk chemicals Recycling of unreacted starting or intermediate materials
C12Q1/68 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids
This application claims priority from U.S. Provisional Patent Application No. 61/312,873, filed on Mar. 11, 2010, the content of which is hereby incorporated by reference in its entirety.
The disclosure describes a buffer and methods of template nucleic acid preparation for highly efficient real-time PCR analysis. In an embodiment, the buffer is suitable for lysis of cells containing a target nucleic acid.
The implementation of high throughput PCR screening has revolutionized modern biology and medicine. Diagnostics, environmental monitoring, blood testing and genotyping are but a few of the fields of research that are impacted by this remarkable analytical tool. Together with the emergence of bioinformatics, scientists are now able to analyze large amounts of genetic information in record time. Nevertheless, the conversion of traditional PCR analysis to a high throughput format necessarily requires that the PCR process be streamlined for efficiency as much as possible whilst preserving the advantages of traditional analytical PCR. This challenge is particularly evident when attempting to detect target DNA sequences extracted from living organisms, such as prokaryotic pathogens, where the need for increased throughput requires that cell lysis and PCR amplification occur in the same reaction buffer without compromising the sensitivity of PCR detection.
The present invention is based on a novel lysis reagent formulation for the efficient preparation of a nucleic acid template from cells for high throughput real-time PCR analysis. The formulation of the reagent permits rapid cell lysis and template preparation without the need for template purification and isolation. The reagent therefore dramatically improves throughput of real-time PCR analysis while at the same time preserving the sensitivity of detection.
Accordingly, the present invention provides novel methods for the preparation of template nucleic acids using a lysis reagent that permits the rapid and sensitive real-time PCR detection of a single molecule of nucleic acid template in as little as 30 cycles of PCR amplification.
In one aspect, the invention teaches a method of preparing a nucleic acid template for real-time PCR amplification. Cells are lysed in a lysis reagent comprising a buffer with a pH of about 6 to about 9, a zwitterionic detergent at a concentration of about 0.125% to about 2%, an azide at a concentration of about 0.3 to about 2.5 mg/ml, and a protease. After incubating the resulting cell lysate at about 55° C. for about 15 minutes to produce a substantially protein-free cell lysate, the protease is inactivated at about 95° C. for about 10 minutes. The substantially protein-free cell lysate provides a template for real-time PCR amplification reaction in a mixture comprising a pair of amplification primers that can anneal to a target DNA sequence in the cell lysate, a probe comprising a detectable label, DNA and RNA nucleic acid sequences that are substantially complimentary to a region of the target DNA, an amplifying polymerase activity, an amplification buffer, and an RNase H activity. After amplification of the target DNA between the first and second amplification primers, the RNA sequences within the probe can form a RNA:DNA heteroduplex with the complimentary DNA sequences in the target DNA.
The RNase H activity can be a hot start (i.e., activates only after exposure to very high temperatures). RNase H activity or the activity of a thermostable RNase H or both.
In another aspect, the invention relates to a method of preparing a nucleic acid template for real-time PCR amplification. Cells are lysed in a lysis reagent comprising a buffer with a pH of about 6 to about 9, a zwitterionic detergent at a concentration of about 0.125% to about 2%, an azide at a concentration of about 0.3 to about 2.5 mg/ml. After incubating the resulting cell lysate at about 55° C. for about 15 minutes, the cell lysate provides a template for real-time PCR amplification reaction in a mixture comprising a pair of amplification primers that can anneal to a target DNA sequence in the cell lysate, a probe comprising a detectable label and DNA and RNA nucleic acid sequences that are substantially complimentary to a region of the target DNA, an amplifying polymerase activity, an amplification buffer, and an RNase H activity. After amplification of the target DNA between the first and second amplification primers, the RNA sequences within the probe can form a RNA:DNA heteroduplex with the complimentary DNA sequences in the target DNA.
The addition of the cell lysate permits the real-time PCR detection of a single target DNA molecule in the cell lysate that requires less than 40 PCR amplification cycles, less than 35 PCR amplification cycles or less than 30 PCR amplification cycles.
In certain embodiments, the amplification reaction mixture can include a reverse transcriptase activity. The probe can be fluorescently labeled. The fluorescent label can be a FRET pair.
In another embodiment the substantially protein-free cell lysate is diluted 5 to 15 fold by the amplification reaction mixture.
The cells can be gram positive bacterial cells such as Listeria or gram negative cells such as E. coli or Salmonella.
The buffer can be an acetate or phosphate based buffer, 3-(N-morpholino)propane sulphonic acid (MOPS), N-(2-hydroxyethyl)piperazine-Nâ˛-(2-ethane sulphonic acid) (HEPES) or 2-amino-2-hydroxymethyl-1,3-propanediol buffer (Tris).
The zwitterionic detergent can be 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS).
The protease can be proteinase K.
In another embodiment, the invention discloses a lysis reagent comprising a buffer with a pH of about 6 to about 8, a zwitterionic detergent at a concentration of about 0.125% to about 2%, and an azide at a concentration of about 0.3 to about 2.5 mg/ml, wherein the presence of about a 5-15 fold dilution of the reagent together with the amplification reaction mixture does not inhibit the amplifying polymerase and RNase H enzymatic activities.
The lysis reagent can contain a buffer having an acetate or phosphate based buffer, 3-(N-morpholino)propane sulphonic acid (MOPS), N-(2-hydroxyethyl)piperazine-Nâ˛-(2-ethane sulphonic acid) (HEPES), or 2-amino-2-hydroxymethyl-1,3-propanediol buffer (Tris).
The zwitterionic detergent can be 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS).
In yet another embodiment, the lysis reagent comprises a buffer with a pH of about 6 to about 8, a zwitterionic detergent at a concentration of about 0.125% to about 2%, and an azide at a concentration of about 0.3 to about 2.5 mg/ml, and a protease, wherein, after inactivation of the protease, the presence of about a 5-15 fold dilution of the reagent together with the amplification reaction mixture does not inhibit the amplifying polymerase and RNase H enzymatic activities.
The buffer can include an acetate based buffer, 3-(N-morpholino)propane sulphonic acid (MOPS), N-(2-hydroxyethyl)piperazine-Nâ˛-(2-ethane sulphonic acid) (HEPES), or 2-amino-2-hydroxymethyl-1,3-propanediol buffer.
The zwitterionic detergent can be 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate.
The previously described embodiments have many advantages, including the ability to perform cell lysis and real-time PCR without the need for template purification and dilution. The detection method is fast, accurate, sensitive and suitable for high throughput applications.
FIG. 1 is a schematic representation of CataCleave probe technology.
FIG. 2 is a schematic representation of real-time CataCleave probe detection of PCR amplification products.
FIG. 3A is the output of a real-time PCR reaction using CataCleave probe to detect Salmonella DNA in the presence of different lysis reagents (CZ1-7 & 0.125X TZ).
FIG. 3B is the output of a real-time PCR reaction using CataCleave probe to detect Listeria DNA in the presence of different concentrations of lysis reagent.
FIG. 4 is the output of a real-time PCR reaction using CataCleave probe to detect target DNA sequences in a Listeria cell lysate obtained using different concentrations of lysis reagent.
FIG. 5 is the output of a real-time PCR reaction using CataCleave probe to detect low concentrations of Listeria cells using a preferred lysis solution.
The practice of the embodiments described herein employs, unless otherwise indicated, conventional molecular biological techniques within the skill of the art. Such techniques are well known to the skilled worker, and are explained fully in the literature. See, e.g., Ausubel, et al., ed., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY, N.Y. (1987-2008), including all supplements; Sambrook, et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor, N.Y. (1989).
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art. The specification also provides definitions of terms to help interpret the disclosure and claims of this application. In the event a definition is not consistent with definitions elsewhere, the definition set forth in this application will control.
As used herein, the term âcellsâ can refer to prokaryotic or eukaryotic cells.
In one embodiment, the term âcellsâ can refer to microorganisms such as bacteria including, but not limited to gram positive bacteria, gram negative bacteria, acid-fast bacteria and the like. In certain embodiments, the âcellsâ to be tested may be collected using swab sampling of surfaces. In other embodiments, the âcellsâ can refer to pathogenic organisms.
As used herein, gram positive bacteria include, but are not limited to, Actinomedurae, Actinomyces israelii, Bacillus anthracis, Bacillus cereus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Clostridium tetani, Corynebacterium, Enterococcus faecalis, Listeria monocytogenes, Nocardia, Propionibacterium acnes, Staphylococcus aureus, Staphylococcus epiderm, Streptococcus mutans, Streptococcus pneumoniae and the like.
As used herein, gram negative bacteria including, but are not limited to, Afipia fielis, Bacteriodes, Bartonella bacilliformis, Bortadella pertussis, Borrelia burgdorferi, Borrelia recurrentis, Brucella, Calymmatobacterium granulomatis, Campylobacter, Escherichia coli, Francisella tularensis, Gardnerella vaginalis, Haemophilius aegyptius, Haemophilius ducreyi, Haemophilius influenziae, Heliobacter pylori, Legionella pneumophila, Leptospira interrogans, Neisseria meningitidia, Porphyromonas gingivalis, Providencia sturti, Pseudomonas aeruginosa, Salmonella enteridis, Salmonella typhi, Serratia marcescens, Shigella boydii, Streptobacillus moniliformis, Streptococcus pyogenes, Treponema pallidum, Vibrio cholerae, Yersinia enterocolitica, Yersinia pestis and the like.
As used herein, acid-fast bacteria include, but are not limited to, Myobacterium avium, Myobacterium leprae, Myobacterium tuberculosis and the like.
In other embodiments, the âcellsâ can refer to other bacteria not falling into the other three categories including, but are not limited to, Bartonella henselae, Chlamydia psittaci, Chlamydia trachomatis, Coxiella burnetii, Mycoplasma pneumoniae, Rickettsia akari, Rickettsia prowazekii, Rickettsia rickettsii, Rickettsia tsutsugamushi, Rickettsia typhi, Ureaplasma urealyticum, Diplococcus pneumoniae, Ehrlichia chafensis, Enterococcus faecium, Meningococci and the like.
In yet other embodiment, the term âcellsâ can refer to fungi including, but are not limited to, Aspergilli, Candidae, Candida albicans, Coccidioides immitis, Cryptococci, and combinations thereof.
In another embodiment, the term âcellsâ can refer to parasitic microbes including, but are not limited to, Balantidium coli, Cryptosporidium parvum, Cyclospora cayatanensis, Encephalitozoa, Entamoeba histolytica, Enterocytozoon bieneusi, Giardia lamblia, Leishmaniae, Plasmodii, Toxoplasma gondii, Trypanosomae, trapezoidal amoeba and the like.
In another embodiment, the term âcellsâ can refer to parasites including worms (e.g., helminthes), particularly parasitic worms including, but not limited to, Nematoda (roundworms, e.g., whipworms, hookworms, pinworms, ascarids, filarids and the like), Cestoda (e.g., tapeworms) and the like.
As used herein, âzwitterionic detergentâ refers to detergents exhibiting zwitterionic character (e.g., does not possess a net charge, lacks conductivity and electrophoretic mobility, does not bind ion-exchange resins, breaks protein-protein interactions), including, but not limited to, CHAPS, CHAPSO and betaine derivatives, e.g. preferably sulfobetaines sold under the brand names ZwittergentÂŽ (Calbiochem, San Diego, Calif.) and AnzergentÂŽ Anatrace, Inc.; Maumee, Ohio).
Examplary zwitterionic detergents for use in practicing the invention include those sold under the brand names ZwittergentÂŽ and AnzergentÂŽ having the chemical names of: n-Tetradecyl-N, N-dimethyl-3-ammonio-1-propanesulfonate, n-octyl-N,N-dimethyl-3-amraonio-1-propanesulfonate, n-decyl-N,N-dimethyl-3-ammonio-1-propanesulfonate, and n-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate.
Exemplary detergents of the present invention can be purchased under the brand names, for example, of: Anzergent 3-14, Analytical Grade; Anzergent 3-8, Analytical Grade; Anzergent 3-10, Analytical Grade; Anzergent 3-12, Analytical Grade, respectively or zwittergent 3-8, zwittergent 3-10, zwittergent 3-12 and zwittergent 3-14, CHAPS, CHAPSO, ApolO and Apol2.
In one embodiment, the zwitterionic detergent is CHAPS (CAS Number: 75621-03-3; available from SIGMA-ALDRICH product no. C3023-1G), an abbreviation for 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (described in further detail in U.S. Pat. No. 4,372,888) having the structure:
In a further embodiment, CHAPS is present at a concentration of about 0.125% to about 2% weight/volume (w/v) of the total composition. In a further embodiment, CHAPS is present at a concentration of about 0.25% to about 1% w/v of the total composition. In yet another embodiment, CHAPS is present at a concentration of about 0.4% to about 0.7% w/v of the total composition.
In another embodiment, the zwitterionic detergent is CHAPSO (CAS Number: 82473-24-3; available from FLUKA, Product number 26675), an abbreviation for 3-[(3-cholamidopropyl)dimethylammonio]-2-hydroxy-1-propanesulfonate and having the structure:
In a further embodiment, CHAPSO is present at a concentration of about 0.125% to about 2% w/v of the total composition. In a further embodiment, CHAPSO is present at a concentration of about 0.25% to about 1% w/v of the total composition. In yet another embodiment, CHAPSO is present at a concentration of about 0.4% to about 0.7% w/v of the total composition.
As used herein, the term âbufferâ refers to a composition that can effectively maintain the pH value between 6 and 9, with a pKa at 25° C. of about 6 to about 9. The buffer described herein is generally a physiologically compatible buffer that is compatible with the function of enzyme activities and enables biological macromolecules to retain their normal physiological and biochemical functions.
Examples of buffers include, but are not limited to, HEPES ((4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), MOPS (3-(N-morpholino)-propanesulfonic acid), N-tris(hydroxymethyl)methylglycine acid (Tricine), tris(hydroxymethyl)methylamine acid (Tris), piperazine-N,Nâ˛-bis(2-ethanesulfonic acid) (PIPES) and acetate or phosphate containing buffers (K2HPO4, KH2PO4, Na2HPO4, NaH2PO4) and the like.
The term âazideâ as used herein is represented by the formula âN3. In one embodiment, the azide is sodium azide NaN3 (CAS number 26628-22-8; available from SIGMA-ALDRICH Product number: S2002-25G) that acts as a general bacterioside.
The term âprotease,â as used herein, is an enzyme that hydrolyses peptide bonds (has protease activity). Proteases are also called, e.g., peptidases, proteinases, peptide hydrolases, or proteolytic enzymes. The proteases for use according to the invention can be of the endo-type that act internally in polypeptide chains (endopeptidases). In one embodiment, the protease can be the serine protease, proteinase K (EC 3.4.21.64; available from Roche Applied Sciences, recombinant proteinase K 50 U/ml (from Pichia pastoris) Cat. No. 03 115 887 001).
Proteinase K is used to digest protein and remove contamination from preparations of nucleic acid. Addition of proteinase K to nucleic acid preparations rapidly inactivates nucleases that might otherwise degrade the DNA or RNA during purification. It is highly-suited to this application since the enzyme is active in the presence of chemicals that denature proteins and it can be inactivated at temperatures of about 95° C. for about 10 minutes.
In one embodiment, lysis of gram positive and gram negative bacteria, such as Listeria, Salmonella, and E. Coli requires the lysis reagent include proteinase K (1 mg/ml). Protein in the cell lysate is digested by proteinase K for 15 minutes at 55° C. followed by inactivation of the proteinase K at 95° C. for 10 minutes. After cooling, the substantially protein free lysate is compatible with high efficiency PCR amplification.
In addition to or in lieu of proteinase K, the lysis reagent can comprise a serine protease such as trypsin, chymotrypsin, elastase, subtilisin, streptogrisin, thermitase, aqualysin, plasmin, cucumisin, or carboxypeptidase A, D, C, or Y. In addition to a serine protease, the lysis solution can comprise a cysteine protease such as papain, calpain, or clostripain; an acid protease such as pepsin, chymosin, or cathepsin; or a metalloprotease such as pronase, thermolysin, collagenase, dispase, an aminopeptidase or carboxypeptidase A, B, E/H, M, T, or U. Proteinase K is stable over a wide pH range (pH 4.0-10.0) and is stable in buffers with zwitterionic detergents.
The term âlysateâ as used herein, refers to a liquid phase with lysed cell debris and nucleic acids.
As used herein, the term âsubstantially protein freeâ refers to a lysate where most proteins are inactivated by proteolytic cleavage by a protease. Protease may include proteinase K. Addition of proteinase K during cell lysis rapidly inactivates nucleases that might otherwise degrade the target nucelic acids. The âsubstantially protein freeâ lysate may be or may not be subjected to a treatment to remove inactivated proteins.
As used herein, the phrase âdoes not inhibit said amplifying polymerase and RNase H enzymatic activitiesâ means the presence of the lysis reagent decreases the amplifying polymerase and RNase H enzymatic activities by 0% or by less than about 1% or by less than about 2% or by less than about 5% or by less than about 10% or by less than about 25% as compared to the amplifying polymerase and RNase H enzymatic activities in the absence of the lysis reagent.
As used herein, the term ânucleic acidâ refers to an oligonucleotide or polynucleotide, wherein said oligonucleotide or polynucleotide may be modified or may comprise modified bases. Oligonucleotides are single-stranded polymers of nucleotides comprising from 2 to 60 nucleotides. Polynucleotides are polymers of nucleotides comprising two or more nucleotides. Polynucleotides may be either double-stranded DNAs, including annealed oligonucleotides wherein the second strand is an oligonucleotide with the reverse complement sequence of the first oligonucleotide, single-stranded nucleic acid polymers comprising deoxythymidine, single-stranded RNAs, double stranded RNAs or RNA/DNA heteroduplexes. Nucleic acids include, but are not limited to, genomic DNA, cDNA, hnRNA, snRNA, mRNA, rRNA, tRNA, fragmented nucleic acid, nucleic acid obtained from subcellular organelles such as mitochondria or chloroplasts, and nucleic acid obtained from microorganisms or DNA or RNA viruses that may be present on or in a biological sample. Nucleic acids may be composed of a single type of sugar moiety, e.g., as in the case of RNA and DNA, or mixtures of different sugar moieties, e.g., as in the case of RNA/DNA chimeras.
As used herein, the term âlabelâ or âdetectable labelâ can refer to any chemical moiety attached to a nucleotide, nucleotide polymer, or nucleic acid binding factor, wherein the attachment may be covalent or non-covalent. Preferably, the label is detectable and renders said nucleotide or nucleotide polymer detectable to the practitioner of the invention. Detectable labels include luminescent molecules, chemiluminescent molecules, fluorochromes, fluorescent quenching agents, colored molecules, radioisotopes or scintillants. Detectable labels also include any useful linker molecule (such as biotin, avidin, streptavidin, HRP (horseradish peroxidase), protein A, protein G, antibodies or fragments thereof, Grb2, polyhistidine, Ni2+, FLAG tags, myc tags), heavy metals, enzymes (examples include alkaline phosphatase, peroxidase and luciferase), electron donors/acceptors, acridinium esters, dyes and calorimetric substrates. It is also envisioned that a change in mass may be considered a detectable label, as is the case of surface plasmon resonance detection. The skilled artisan would readily recognize useful detectable labels that are not mentioned above, which may be employed in the operation of the present invention.
Solely, for illustrative purposes, the method of using the lysis reagent for nucleic acid template preparation is disclosed below in the context of CataCleave PCR or RT-PCR detection of the bacterial pathogen, Salmonella. CataCleave PCR will be explained hereinafter.
As used herein, the term âtargetâ nucleic acid sequence refers to a nucleic acid sequence or structure to be detected or characterized. Exemplary target nucleic acid sequences include, but are not limited to, genomic DNA or genomic RNA. In one embodiment, a âtargetâ nucleic acid sequence can serve as a template for amplification in a PCR reaction or reverse transcription PCR reaction. In one embodiment, the âtargetâ nucleic acid sequence can refer to a nucleic acid sequence present in the nucleic acid of an organism or a sequence complementary thereto, which is not present in the nucleic acids of other species.
In one embodiment, a Salmonella nucleic acid sequence targeted for DNA amplification is first selected from Salmonella nucleic sequences known in the art. As used herein, the term âSalmonella target sequenceâ refers to a DNA or RNA sequence comprising the nucleic acid sequence of a bacterium of the genus Salmonella. It includes but is not limited to, species S. enterica and S. bongori that include, but are not limited to, the subspecies: enterica (I), salamae (II), arizonae (IIIa), diarizonae (IIIb), houtenae (IV), and indica (VI). Exemplary serogroups and serovars of the subspecies Salmonella enterica can be found in the U.S. Pat. No. 7,659,381, which is incorporated herein by reference in its entirety.
Exemplary Salmonella nucleic acid sequences that may be targeted for amplification according to the present invention are taught by the following publications: Liu W Q et al., âSalmonella paratyphi C: genetic divergence from Salmonella choleraesuis and pathogenic convergence with Salmonella typhiâ, PLoS One, 2009; 4(2):e4510; Thomson N R et al., âComparative genome analysis of Salmonella enteritidis PT4 and Salmonella gallinarum 287/91 provides insights into evolutionary and host adaptation pathways,â Genome Res, October 2008; 18(10):1624-37; Encheva V et al., âProteome analysis of serovars typhimurium and Pullorum of Salmonella enterica subspecies I.â, BMC Microbiol, Jul. 18, 2005; 5:42; McClelland M et al., âComparison of genome degradation in Paratyphi A and Typhi, human-restricted serovars of Salmonella enterica that cause typhoidâ, Nat Genet, December 2004; 36(12):1268-74; Chiu C H et al., âSalmonella enterica serotype Choleraesuis: epidemiology, pathogenesis, clinical disease, and treatment,â Clin Microbiol Rev, April 2004; 17(2):311-22; Deng W et al., âComparative genomics of Salmonella enterica serovar Typhi strains Ty2 and CT18,â J Bacteriol, April 2003; 185(7):2330-7; Parkhill J et al., âComplete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18.â, Nature, Oct. 25, 2001; 413(6858):848-52; McClelland M et al., âComplete genome sequence of Salmonella enterica serovar typhimurium LT2,â Nature, Oct. 25, 2001; 413(6858):852-6, of which contents are incorporated herein by reference. An exemplary nucleotide sequence of the complete 4857432 by genome of Salmonella enterica subsp. enterica serovar typhimurium str. LT2 is available under Genbank Accession No. NCâ003197.
In one embodiment, the amplification probe, having the sequence of SEQ ID NO: 3, anneals to the target Salmonella invA nucleic acid sequence.
In another embodiment, the target nucleic acid sequence is a region found within the Salmonella-specific invA gene nucleic acid sequence having the following DNA sequence:
| SEQâIDâNO:â4,âSalmonellaâentericaâInvAâgeneâ(GenBankââ | |
| AccessionâNo.:âU43272.1): | |
| AACAGTGCTCGTTTACGACCTGAATTACTGATTCTGGTACTAATGGTGATGATCATTTCT | |
| ATGTTCGTCATTCCATTACCTACCTATCTGGTTGATTTCCTGATCGCACTGAATATCGTA | |
| CTGGCGATATTGGTGTTTATGGGGTCGTTCTACATTGACAGAATCCTCAGTTTTTCAACG | |
| TTTCCTGCGGTACTGTTAATTACCACGCTCTTTCGTCTGGCATTATCGATCAGTACCAGC | |
| CGTCTTATCTTGATTGAAGCCGATGCCGGTGAAATTATCGCCACGTTCGGGCAATTCGTT | |
| ATTGGCGATAGCCTGGCGGTGGGTTTTGTTGTCTTCTCTATTGTCACCGTGGTCCAGTTT | |
| ATCGTTATTACCAAAGGTTCAGAACGCGTCGCGGAAGTCGCGGCCCGATTTTCTCTGGAT | |
| GGTATGCCCGGTAAACAGATGAGTATTGATGCCGATTTGAAGGCCGGTATTATTGATGCG | |
| GATGCTGCGCGCGAACGGCGAAGCGTACTGGAAAGGGAAAGCCAGCTTTACGGTTCCTTT | |
| GACGGTGCGATGAAGTTTATCAAAGGTGACGCTATTGCCGGCATCATTATTATCTTTGTG | |
| AACTTTATTGGCGGTATTTCGGTGGGGATGACCCGCCATGGTATGGATTTGTCCTCCGCT | |
| CTGTCTACTTATACCATGCTGACCATTGGTGATGGTCTTGTCGCCCAGATCCCCGCATTG | |
| TTGATTGCGATTAGTGCCGGTTTTATCGTGACTCGCGTAAATGGCGATAGCGATAATATG | |
| GGGCGGAATATCATGACGCAGCTGTTGAACAACCCATTTGTATTGGTTGTTACGGCTATT | |
| TTGACCATTTCAATGGGAACTCTGCCGGGATTCCCGCTGCCGGTATTTGTTATTTTATCG | |
| GTGGTTTTAAGCGTACTCTTCTATTTTAAATTCCGTGAAGCAAAACGTAGCGCCGCCAAA | |
| CCTAAAACCAGCAAAGGCGAGCAGCCGCTTAGTATTGAGGAAAAAGAAGGGTCGTCGTTG | |
| GGACTGATTGGCGATCTCGATAAAGTCTCTACAGAGACCGTACCGTTGATATTACTTGTG | |
| CCGAAGAGCCGGCGTGAAGATCTGGAAAAAGCTCAACTTGCGGAGCGTCTACGTAGTCAG | |
| TTCTTTATTGATTATGGCGTGCGCCTGCCGGAAGTATTGTTACGCGATGGCGAGGGCCTG | |
| GACGATAACAGCATCGTATTGTTGATTAATGAGATCCGTGTTGAACAATTTACGGTCTAT | |
| TTTGATTTGATGCGAGTGGTAAATTATTCCGATGAAGTCGTGTCCTTTGGTATTAATCCA | |
| ACAATCCATCAGCAAGGTAGCAGTCAGTATTTCTGGGTAACGCATGAAGAGGGGGAGAAA | |
| CTCCGGGAGCTTGGCTATGTGTTGCGGAACGCGCTTGATGAGCTTTACCACTGTCTGGCG | |
| GTGACCGTGGCGCGCAACGTCAATGAATATTTCGGTATTCAGGAAACAAAACATATGCTG | |
| GACCAACTGGAAGCGAAATTTCCTGATTTACTTAAAGAAGTGCTCAGACATGCCACGGTA | |
| CAACGTATATCTGAAGTTTTGCAGCGTTTATTAAGCGAACGTGTTTCCGTGCGTAATATG | |
| AAATTAATTATGGAAGCGCTCGCATTGTGGGCGCCAAGAGAAAAAGATGTCATTAACCTT | |
| GTAGAGCATATTCGTGGAGCAATGGCGCGTTATATTTGTCATAAATTCGCCAATGGCGGC | |
| GAATTACGAGCAGTAATGGTATCTGCTGAAGTTGAGGATGTTATTCGCAAAGGGATCCGT | |
| CAGACCTCTGGCAGTACCTTCCTCAGCCTTGACCCGGAAGCCTCCGCTAATTTGATGGAT | |
| CTCATTACACTTAAGTTGGATGATTTATTGATTGCACATAAAGATCTTGTCCTCCTTACG | |
| TCTGTCGATGTCCGTCGATTTATTAAGAAA |
As used herein, the term âprimerâ or âamplification primerâ refers to an oligonucleotide that acts as a point of initiation of DNA synthesis in a PCR reaction. A primer is usually about 15 to about 35 nucleotides in length and hybridizes to a region complementary to the target sequence. Oligonucleotides may be synthesized and prepared by any suitable methods (such as chemical synthesis), which are known in the art. Oligonucleotides may also be conveniently obtained through commercial sources.
A person of ordinary skill in the art would easily optimize and identify primers. A number of computer programs (e.g., Primer-Express) are readily available to design optimal primer/probe sets. It will be apparent to one of ordinary skill in the art that the primers and probes based on the nucleic acid information provided (or publicly available with accession numbers) can be prepared accordingly.
In one embodiment, the pair of amplification primers (i.e., forward primer and reverse primer) can be the pair of primers of SEQ ID NOs: 1 and 2.
| 5â˛-TCGâTCAâTTCâCATâTACâCTAâCC | (SEQâIDâNO:â1) |
| 5ⲠTACâTGAâTCGâATAâATGâCCAâGACâGAA | (SEQâIDâNO:â2) |
A âprimer dimerâ is a potential by-product in PCR that consists of primer molecules that have partially hybridized to each other because of strings of complementary bases in the primers. As a result, the DNA polymerase amplifies the primer dimer, leading to competition for PCR reagents, thus potentially inhibiting amplification of the DNA sequence targeted for PCR amplification. In real-time PCR, primer dimers may interfere with accurate quantification by reducing sensitivity.
Primer sequences for the detection of Salmonella are screened for the formation of primer-dimer. PCR reactions are performed using pairs of forward and reverse primers in the presence of SYBR Green I. The fluorescence emission intensity of this dye increases when it becomes intercalated into duplex DNA and therefore can serve as a non-specific probe in nucleic acid amplification reactions. The reactions are performed in a suitable reaction buffer described containing 800 nM of forward and reverse primer, thermostable DNA polymerase, and SYBR Green I. The resulting increase in SYBR Green I fluorescence emission can be detected in real-time using a suitable instrument, such as the Applied Biosystems 7500 Fast Real-Time PCR System or the Biorad CFX96 real-time PCR thermocycler. Primer-dimer formation leads to a characteristic sigmoidal shaped emission profile similar to that seen in the presence of primer-specific template DNA. The terms âannealingâ and âhybridizationâ are used interchangeably and mean the base-pairing interaction of one nucleic acid with another nucleic acid that results in formation of a duplex, triplex, or other higher-ordered structure. In certain embodiments, the primary interaction is base specific, e.g., A/T and G/C, by Watson/Crick and Hoogsteen-type hydrogen bonding. In certain embodiments, base-stacking and hydrophobic interactions may also contribute to duplex stability.
As used herein, the term âsubstantially complementaryâ refers to two nucleic acid strands that are sufficiently complimentary in sequence to anneal and form a stable duplex. The complementarity does not need to be perfect; there may be any number of base pair mismatches, for example, between the two nucleic acids. However, if the number of mismatches is so great that no hybridization can occur under even the least stringent hybridization conditions, the sequence is not a substantially complementary sequence. When two sequences are referred to as âsubstantially complementaryâ herein, it means that the sequences are sufficiently complementary to each other to hybridize under the selected reaction conditions such as stringent hybridization condition. The relationship of nucleic acid complementarity and stringency of hybridization sufficient to achieve specificity is well known in the art. Two substantially complementary strands can be, for example, perfectly complementary or can contain from 1 to many mismatches so long as the hybridization conditions are sufficient to allow, for example discrimination between a pairing sequence and a non-pairing sequence. Accordingly, âsubstantially complementaryâ sequences can refer to sequences with base-pair complementarity of 100, 95, 90, 80, 75, 70, 60, 50 percent or less, or any number in between, in a double-stranded region.
A person of skill in the art will know how to design PCR primers flanking a Salmonella genomic sequence of interest. Synthesized oligos are typically between 20 and 26 base pairs in length with a melting temperature, TM of around 55 degrees.
An exemplary protocol for detecting a target Salmonella sequence may include the steps of providing a food sample or surface wipe, mixing the sample or wipe with a growth medium and incubating to increase the number or population of Salmonella (âenrichmentâ), disintegrating Salmonella cells (âlysisâ), and subjecting the obtained lysate to amplification and detection of target Salmonella sequence. Food samples may include, but are not limited to, fish such as salmon, dairy products such as milk, and eggs, poultry, fruit juices, meats such as ground pork, pork, ground beef, or beef, vegetables such as spinach or alfalfa sprouts, or processed nuts such as peanut butter.
The limit of detection (LOD) for food contaminants is described in terms of the number of colony forming units (CFU) that can be detected in either 25 grams of solid or 25 mL of liquid food or on a surface of defined area. By definition, a colony-forming unit is a measure of viable bacterial numbers. Unlike indirect microscopic counts where all cells, dead and living, are counted, CFU measures viable cells. One CFU (usually one bacterial cell) will grow to form a single colony on an agar plate under permissive conditions. The United States Food Testing Inspection Service defines the minimum LOD as 1 CFU/25 grams of solid food or 25 mL of liquid food or 1 CFU/surface area.
In practice, it is impossible to reproducibly inoculate a food sample or surface with a single CFU and insure that the bacterium survives the enrichment process. This problem is overcome by inoculating the sample at either one or several target levels and analyzing the results using a statistical estimate of the contamination called the Most Probable Number (MPN). As an example, a Salmonella culture can be grown to a specific cell density by measuring the absorbance in a spectrophotometer. Ten-fold serial dilutions of the target are plated on agar media and the numbers of viable bacteria are counted. This data is used to construct a standard curve that relates CFU/volume plated to cell density. For the MPN to be meaningful, test samples at several inoculum levels are analyzed. After enrichment and extraction a small volume of sample is removed for real-time analysis. The ultimate goal is to achieve a fractional recovery of between 25% and 75% (i.e. between 25% and 75% of the samples test positive in the assay using reverse transcriptase-PCR employing a CataCleave probe, which will be explained below). The reason for choosing these fractional recovery percentages is that they convert to MPN values of between 0.3 CFU and 1.375 CFU for 25 gram samples of solid food, 25 mL samples of liquid food, or a defined area for surfaces. These MPN values are chosen because they bracket the required LOD of 1 CFU/sample. With practice, it is possible to estimate the volume of diluted inoculum (based on the standard curve) to achieve these fractional recoveries.
The reagent for lysing cells can comprise a buffer with a pH of about 6 to about 9, a zwitterionic detergent at a concentration of about 0.125% to about 2%, and an azide at a concentration of about 0.3 to about 2.5 mg/ml. For the lysis of gram negative bacteria, such as Salmonella or E.coli, the lysis reagent may optionally include a protease such as proteinase K. Proteases such as proteinase K are however required for the preparation of PCR template nucleic acid from gram positive bacteria.
In one embodiment, the 1à lysis reagent is prepared that contains 12.5 mM Tris acetate or Tris-HCl or HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (pH=7-8), 0.25% (w/v) CHAPS, 0.3125 mg/ml sodium azide. 45 Οl 1à lysis agent is then added to 5 Οl enrichment sample and incubated at 55° C. for 15 minutes.
For the lysis of gram negative bacteria, proteinase K to 1 mg/ml may be added to the lysis reagent. After incubation at 55° C. for 15 minutes, the proteinase K is inactivated at 95° C. for 10 minutes to produce a substantially protein free lysate that is compatible with high efficiency PCR or reverse transcription PCR analysis.
Once the primers are selected and the cell free lysate containing the target nucleic acid is prepared (see Examples), nucleic acid amplification can be accomplished by a variety of methods, including the polymerase chain reaction (PCR), nucleic acid sequence based amplification (NASBA), ligase chain reaction (LCR), and rolling circle amplification (RCA). The polymerase chain reaction (PCR) is the method most commonly used to amplify specific target DNA sequences.
âPolymerase chain reaction,â or âPCR,â generally refers to a method for amplification of a desired nucleotide sequence in vitro. The procedure is described in detail in U.S. Pat. Nos. 4,683,202, 4,683,195, 4,800,159, and 4,965,188, the contents of which are hereby incorporated herein in their entirety. Generally, the PCR process consists of introducing a molar excess of two or more extendable oligonucleotide primers to a reaction mixture comprising the desired target sequence(s), where the primers are complementary to opposite strands of the double stranded target sequence. The reaction mixture is subjected to a program of thermal cycling in the presence of a DNA polymerase, resulting in the amplification of the desired target sequence flanked by the DNA primers.
In one aspect, Salmonella-specific primers which can be used in the embodiments may have a DNA sequence of SEQ ID NOs.: 1-2.
A probe which can be used in the embodiments of the instant application (sometimes referred to as a âCataCleave probeâ) may have the following sequences:
5â˛-/FAM/CGATCAGrGrArArATCAACCAG/IABFQ) (SEQ ID NO: 3) to be used with the primer pair of SEQ ID NOs: 1 and 2 (wherein, lowercase ârâ denotes RNA bases (i.e. rG is riboguanosine).
As used herein, the term âPCR fragmentâ or âampliconâ refers to a polynucleotide molecule (or collectively the plurality of molecules) produced following the amplification of a particular target nucleic acid. An PCR fragment is typically, but not exclusively, a DNA PCR fragment. An PCR fragment can be single-stranded or double-stranded, or in a mixture thereof in any concentration ratio. A PCR fragment can be about 100 to about 500 nucleotides or more in length.
An amplification âbufferâ is a compound added to an amplification reaction which modifies the stability, activity, and/or longevity of one or more components of the amplification reaction by regulating the amplification reaction. The buffering agents of the invention are compatible with PCR amplification and RNase H cleavage activity. Examples of buffers include, but are not limited to, HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), MOPS (3-(N-morpholino)-propanesulfonic acid), and acetate or phosphate containing buffers and the like. In addition, PCR buffers may generally contain up to about 70 mM KCl and about 1.5 mM or higher MgCl2, to about 50-200 ÎźM each of dATP, dCTP, dGTP and dTTP. The buffers of the invention may contain additives to optimize efficient reverse transcriptase-PCR or PCR reactions.
An additive is a compound added to a composition which modifies the stability, activity, and/or longevity of one or more components of the composition. In certain embodiments, the composition is an amplification reaction composition. In certain embodiments, an additive inactivates contaminant enzymes, stabilizes protein folding, and/or decreases aggregation. Exemplary additives that may be included in an amplification reaction include, but are not limited to, betaine, formamide, KCl, CaCl2, MgOAc, MgCl2, NaCl, NH4OAc, NaI, Na(CO3)2, LiCl, MnOAc, NMP, trehalose, demiethylsulfoxide (âDMSOâ), glycerol, ethylene glycol, dithiothreitol (âDTTâ), pyrophosphatase (including, but not limited to Thermoplasma acidophilum inorganic pyrophosphatase (âTAPâ)), bovine serum albumin (âBSAâ), propylene glycol, glycinamide, CHES, Percoll, aurintricarboxylic acid, Tween 20, Tween 21, Tween 40, Tween 60, Tween 85, Brij 30, NP-40, Triton X-100, CHAPS, CHAPSO, Mackernium, LDAO (N-dodecyl-N,N-dimethylamine-N-oxide), Zwittergent 3-10, Xwittergent 3-14, Xwittergent SB 3-16, Empigen, NDSB-20, T4G32, E. Coli SSB, RecA, nicking endonucleases, 7-deazaG, dUTP, anionic detergents, cationic detergents, non-ionic detergents, zwittergent, sterol, osmolytes, cations, and any other chemical, protein, or cofactor that may alter the efficiency of amplification. In certain embodiments, two or more additives are included in an amplification reaction. Additives may be optionally added to improve selectivity of primer annealing provided the additives do not interfere with the activity of RNase H.
As used herein, an âamplifying polymerase activityâ or âamplifying activityâ refers to the enzymatic activity associated with nucleic acid amplification such as the activity associated with thermostable DNA polymerases.
As used herein, the term âthermostable,â as applied to an enzyme, refers to an enzyme that retains its biological activity at elevated temperatures (e. g., at 55° C. or higher), or retains its biological activity following repeated cycles of heating and cooling. Thermostable polynucleotide polymerases find particular use in PCR amplification reactions.
As used herein, a âthermostable polymeraseâ is an enzyme that is relatively stable to heat and eliminates the need to add enzyme prior to each PCR cycle. Non-limiting examples of thermostable polymerases may include polymerases isolated from the thermophilic bacteria Thermus aquaticus (Taq polymerase), Thermus thermophilus (Tth polymerase), Thermococcus litoralis (Tli or VENT polymerase), Pyrococcus furiosus (Pfu or DEEPVENT polymerase), Pyrococcus woosii (Pwo polymerase) and other Pyrococcus species, Bacillus stearothermophilus (Bst polymerase), Sulfolobus acidocaldarius (Sac polymerase), Thermoplasma acidophilum (Tac polymerase), Thermus rubber (Tru polymerase), Thermus brockianus (DYNAZYME polymerase), Thermotoga neapolitana (Tne polymerase), Thermotoga maritime (Tma) and other species of the Thermotoga genus (Tsp polymerase), and Methanobacterium thermoautotrophicum (Mth polymerase). The PCR reaction may contain more than one thermostable polymerase enzyme with complementary properties leading to more efficient amplification of target sequences. For example, a nucleotide polymerase with high processivity (the ability to copy large nucleotide segments) may be complemented with another nucleotide polymerase with proofreading capabilities (the ability to correct mistakes during elongation of target nucleic acid sequence), thus creating a PCR reaction that can copy a long target sequence with high fidelity. The thermostable polymerase may be used in its wild type form. Alternatively, the polymerase may be modified to contain a fragment of the enzyme or to contain a mutation that provides beneficial properties to facilitate the PCR reaction. In one embodiment, the thermostable polymerase may be Taq polymerase. Many variants of Taq polymerase with enhanced properties are known and include AmpliTaq, AmpliTaq Stoffel fragment, SuperTaq, SuperTaq plus, LA Taq, LApro Taq, and EX Taq.
One of the most widely used techniques to study gene expression exploits first-strand cDNA for mRNA sequence(s) as template for amplification by the PCR. This method, often referred to as RT-PCR or reverse transcriptase-PCR, exploits the high sensitivity and specificity of the PCR process and is widely used for detection and quantification of RNA.
As used herein, âreverse transcriptase activityâ refers to the activity associated with RNA-dependent DNA polymerases that catalyze the synthesis of a complementary DNA strand or cDNA from a single stranded RNA template.
The reverse transcriptase-PCR procedure, carried out as either an end-point or real-time assay, involves two separate molecular syntheses: (i) the synthesis of cDNA from an RNA template; and (ii) the replication of the newly synthesized cDNA through PCR amplification. To attempt to address the technical problems often associated with reverse transcriptase-PCR, a number of protocols have been developed taking into account the three basic steps of the procedure: (a) the denaturation of RNA and the hybridization of reverse primer; (b) the synthesis of cDNA; and (c) PCR amplification. In the so called âuncoupledâ reverse transcriptase-PCR procedure (e.g., two step reverse transcriptase-PCR), reverse transcription is performed as an independent step using the optimal buffer condition for reverse transcriptase activity. Following cDNA synthesis, the reaction is diluted to decrease MgCl2, and deoxyribonucleoside triphosphate (dNTP) concentrations to conditions optimal for Taq DNA Polymerase activity, and PCR is carried out according to standard conditions (see U.S. Pat. Nos. 4,683,195 and 4,683,202). By contrast, âcoupledâ reverse transcriptase PCR methods use a common buffer for reverse transcriptase and Taq DNA Polymerase activities. In one version, the annealing of reverse primer is a separate step preceding the addition of enzymes, which are then added to the single reaction vessel. In another version, the reverse transcriptase activity is a component of the thermostable Tth DNA polymerase. Annealing and cDNA synthesis are performed in the presence of Mn2+ then PCR is carried out in the presence of Mg2+ after the removal of Mn2+ by a chelating agent. Finally, the âcontinuousâ method (e.g., one step reverse transcriptase-PCR) integrates the three reverse transcriptase-PCR steps into a single continuous reaction that avoids the opening of the reaction tube for component or enzyme addition. Continuous reverse transcriptase-PCR has been described as a single enzyme system using the reverse transcriptase activity of thermostable Taq DNA Polymerase and Tth polymerase and as a two enzyme system using AMV reverse transcriptase and Taq DNA Polymerase wherein the initial 65° C. An RNA denaturation step can be omitted.
The first step in real-time reverse-transcription PCR is to generate the complementary DNA strand using one of the template specific DNA primers. In traditional PCR reactions this product is denatured, the second template specific primer binds to the cDNA, and is extended to form duplex DNA. This product is amplified in subsequent rounds of temperature cycling. To maintain the highest sensitivity it is important that the RNA not be degraded prior to synthesis of cDNA. The presence of RNase H in the reaction buffer will cause unwanted degradation of the RNA:DNA hybrid formed in the first step of the process because it can serve as a substrate for the enzyme. There are two major methods to combat this issue. One is to physically separate the RNase H from the rest of the reverse-transcription reaction using a barrier such as wax that will melt during the initial high temperature DNA denaturation step. A second method is to modify the RNase H such that it is inactive at the reverse-transcription temperature, typically 45-55° C. Several methods are known in the art, including reaction of RNase H with an antibody, or reversible chemical modification. For example, a hot start RNase H activity as used herein can be an RNase H with a reversible chemical modification produced after reaction of the RNase H with cis-aconitic anhydride under alkaline conditions. When the modified enzyme is used in a reaction with a Tris based buffer and the temperature is raised to 95° C. the pH of the solution drops and RNase H activity is restored. This method allows for the inclusion of RNase H in the reaction mixture prior to the initiation of reverse transcription.
Additional examples of RNase H enzymes and hot start RNase H enzymes that can be employed in the invention are described in U.S. Patent Application No. 2009/0325169 to Walder et al.
One step reverse transcriptase-PCR provides several advantages over uncoupled reverse transcriptase-PCR. One step reverse transcriptase-PCR requires less handling of the reaction mixture reagents and nucleic acid products than uncoupled reverse transcriptase-PCR (e.g., opening of the reaction tube for component or enzyme addition in between the two reaction steps), and is therefore less labor intensive, reducing the required number of person hours. One step reverse transcriptase-PCR also requires less sample, and reduces the risk of contamination. The sensitivity and specificity of one-step reverse transcriptase-PCR has proven well suited for studying expression levels of one to several genes in a given sample or the detection of pathogen RNA. Typically, this procedure has been limited to use of gene-specific primers to initiate cDNA synthesis.
The ability to measure the kinetics of a PCR reaction by real-time detection in combination with these reverse transcriptase-PCR techniques has enabled accurate and precise determination of RNA copy number with high sensitivity. This has become possible by detecting the reverse transcriptase-PCR product through fluorescence monitoring and measurement of PCR product during the amplification process by fluorescent dual-labeled hybridization probe technologies, such as the 5Ⲡfluorogenic nuclease assay (âTaq-Manâ) or endonuclease assay (âCataCleaveâ), discussed below.
Post-amplification amplicon detection has been developed to monitor amplification during the PCR process. These methods typically employ fluorescently labeled probes that bind to the newly synthesized DNA or dyes whose fluorescence emission is increased when intercalated into double stranded DNA.
The probes are generally designed so that donor emission is quenched in the absence of target by fluorescence resonance energy transfer (FRET) between two chromophores. The donor chromophore, in its excited state, may transfer energy to an acceptor chromophore when the pair is in close proximity. This transfer is always non-radiative and occurs through dipole-dipole coupling. Any process that sufficiently increases the distance between the chromophores will decrease FRET efficiency such that the donor chromophore emission can be detected radiatively. Common donor chromophores include FAM, TAMRA, VIC, JOE, Cy3, Cy5, and Texas Red. Acceptor chromophores are chosen so that their excitation spectra overlap with the emission spectrum of the donor. An example of such a pair is FAM-TAMRA. There are also non fluorescent acceptors that will quench a wide range of donors. Other examples of appropriate donor-acceptor FRET pairs will be known to those skilled in the art.
Common examples of FRET probes that can be used for real-time detection of PCR include molecular beacons, TaqMan probes (e.g., U.S. Pat. Nos. 5,210,015 and 5,487,972), and CataCleave probes (e.g., U.S. Pat. No. 5,763,181). The molecular beacon is a single stranded oligonucleotide designed so that in the unbound state the probe forms a secondary structure where the donor and acceptor chromophores are in close proximity and donor emission is reduced. At the proper reaction temperature, the beacon unfolds and specifically binds to the amplicon. Once unfolded the distance between the donor and acceptor chromophores increases such that FRET is reversed and donor emission can be monitored using specialized instrumentation. TaqMan and CataCleave technologies differ from the molecular beacon in that the FRET probes employed are cleaved such that the donor and acceptor chromophores become sufficiently separated to reverse FRET.
TaqMan technology employs a single stranded oligonucleotide probe that is labeled at the 5Ⲡend with a donor chromophore and at the 3Ⲡend with an acceptor chromophore. The DNA polymerase used for amplification must contain a 5â˛â3Ⲡexonuclease activity. The TaqMan probe binds to one strand of the amplicon at the same time that the primer binds. As the DNA polymerase extends the primer the polymerase will eventually encounter the bound TaqMan probe. At this time the exonuclease activity of the polymerase will sequentially degrade the TaqMan probe starting at the 5Ⲡend. As the probe is digested the mononucleotides comprising the probe are released into the reaction buffer. The donor diffuses away from the acceptor and FRET is reversed. Emission from the donor is monitored to identify probe cleavage. Because of the way TaqMan works a specific amplicon can be detected only once for every cycle of PCR. Extension of the primer through the TaqMan target site generates a double stranded product that prevents further binding of TaqMan probes until the amplicon is denatured in the next PCR cycle.
U.S. Pat. No. 5,763,181, the content of which is incorporated herein by reference, describes another real-time detection method (referred to as âCataCleaveâ). CataCleave technology differs from TaqMan in that cleavage of the probe is accomplished by a second enzyme that does not have polymerase activity. The CataCleave probe has a sequence within the molecule which is a target of an endonuclease, such as, for example a restriction enzyme or RNase. In one example, the CataCleave probe has a chimeric structure where the 5Ⲡand 3Ⲡends of the probe are constructed of DNA and the cleavage site contains RNA. The DNA sequence portions of the probe are labeled with a FRET pair either at the ends or internally. The PCR reaction includes an RNase H enzyme that will specifically cleave the RNA sequence portion of a RNA-DNA duplex. After cleavage, the two halves of the probe dissociate from the target amplicon at the reaction temperature and diffuse into the reaction buffer. As the donor and acceptors separate FRET is reversed in the same way as the TaqMan probe and donor emission can be monitored. Cleavage and dissociation regenerates a site for further CataCleave binding. In this way it is possible for a single amplicon to serve as a target or multiple rounds of probe cleavage until the primer is extended through the CataCleave probe binding site.
The term âprobeâ as used herein refers to a polynucleotide that comprises a specific portion designed to hybridize in a sequence-specific manner with a complementary region of a specific nucleic acid sequence, e.g., a target nucleic acid sequence. In one embodiment, the oligonucleotide probe is in the range of 15-60 nucleotides in length. More preferably, the oligonucleotide probe is in the range of 18-30 nucleotides in length. The precise sequence and length of an oligonucleotide probe of the invention depends in part on the nature of the target polynucleotide to which it binds. The binding location and length may be varied to achieve appropriate annealing and melting properties for a particular embodiment. Guidance for making such design choices can be found in many of the references describing Taq-man assays or CataCleave, described in U.S. Pat. Nos. 5,763,181, 6,787,304, and 7,112,422, the contents of which contents are incorporated herein by reference in their entirety.
As used herein, the term âlabelâ or âdetectable labelâ may refer to any label which can be detected by optical or chemical means. For example, in one embodiment, the label or detectable label of a CataCleave probe may comprise a fluorochrome compound that is attached to the probe by covalent or non-covalent means.
As used herein, the term âfluorochromeâ refers to a fluorescent compound that emits light upon excitation by light of a shorter wavelength than the light that is emitted. The term âfluorescent donorâ or âfluorescence donorâ refers to a fluorochrome that emits light that is measured in the assays described in the present invention. More specifically, a fluorescent donor provides light that is absorbed by a fluorescence acceptor. The term âfluorescent acceptorâ or âfluorescence acceptorâ refers to either a second fluorochrome or a quenching molecule that absorbs energy emitted from the fluorescence donor. The second fluorochrome absorbs the energy that is emitted from the fluorescence donor and emits light of longer wavelength than the light emitted by the fluorescence donor. The quenching molecule absorbs energy emitted by the fluorescence donor.
Any luminescent molecule, preferably a fluorochrome and/or fluorescent quencher may be used in the practice of this invention, including, for example, Alexa Fluor 350, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, 7-diethylaminocoumarin-3-carboxylic acid, fluorescein, Oregon Green 488, Oregon Green 514, tetramethylrhodamine, rhodamine X, Texas Red dye, QSY 7, QSY33, Dabcyl, BODIPY FL, BODIPY 630/650, BODIPY 6501665, BODIPY TMR-X, BODIPY TR-X, dialkylaminocoumarin, Cy5.5, Cy5, Cy3.5, Cy3, DTPA(Eu3+)-AMCA and TTHA(Eu3+)AMCA.
In one embodiment, the 3Ⲡterminal nucleotide of the oligonucleotide probe is blocked or rendered incapable of extension by a nucleic acid polymerase. Such blocking is conveniently carried out by the attachment of a reporter or quencher molecule to the terminal 3Ⲡposition of the probe.
In one embodiment, reporter molecules are fluorescent organic dyes derivatized for attachment to the terminal 3Ⲡor terminal 5Ⲡends of the probe via a linking moiety. Preferably, quencher molecules are also organic dyes, which may or may not be fluorescent, depending on the embodiment of the invention. For example, in a preferred embodiment of the invention, the quencher molecule is non-fluorescent. Generally whether the quencher molecule is fluorescent or simply releases the transferred energy from the reporter by non-radiative decay, the absorption band of the quencher should substantially overlap the fluorescent emission band of the reporter molecule. Non-fluorescent quencher molecules that absorb energy from excited reporter molecules, but which do not release the energy radiatively, are referred to in the application as chromogenic molecules.
Exemplary reporter-quencher pairs may be selected from xanthene dyes, including fluoresceins, and rhodamine dyes. Many suitable forms of these compounds are widely available commercially with substituents on their phenyl moieties which can be used as the site for bonding or as the bonding functionality for attachment to an oligonucleotide. Another group of fluorescent compounds are the naphthylamines, having an amino group in the alpha or beta position. Included among such naphthylamino compounds are 1-dimethylaminonaphthyl-5-sulfonate, 1-anilino-8-naphthalene sulfonate and 2-p-touidinyl6-naphthalene sulfonate. Other dyes include 3-phenyl-7-isocyanatocoumarin, acridines, such as 9-isothiocyanatoacridine and acridine orange; N-(p-(2-benzoxazolyl)phenyl)maleimide; benzoxadiazoles, stilbenes, pyrenes, and the like.
In one embodiment, reporter and quencher molecules are selected from fluorescein and non-fluorescent quencher dyes.
There are many linking moieties and methodologies for attaching reporter or quencher molecules to the 5Ⲡor 3Ⲡtermini of oligonucleotides, as exemplified by the following references: Eckstein, editor, Oligonucleotides and Analogues: A Practical Approach (IRL Press, Oxford, 1991); Zuckerman et al., Nucleic Acids Research, 15: 5305-5321 (1987) (3Ⲡthiol group on oligonucleotide); Sharma et al., Nucleic Acids Research, 19: 3019 (1991) (3Ⲡsulfhydryl); Giusti et al., PCR Methods and Applications, 2: 223-227 (1993) and Fung et al., U.S. Pat. No. 4,757,141 (5Ⲡphosphoamino group via Aminolink. II available from Applied Biosystems, Foster City, Calif.) Stabinsky, U.S. Pat. No. 4,739,044 (3Ⲡaminoalkylphosphoryl group); Agrawal et al., Tetrahedron Letters, 31: 1543-1546 (1990) (attachment via phosphoramidate linkages); Sproat et al., Nucleic Acids Research, 15: 4837 (1987) (5Ⲡmercapto group); Nelson et al., Nucleic Acids Research, 17: 7187-7194 (1989) (3Ⲡamino group); and the like.
Rhodamine and non-fluorescent quencher dyes are also conveniently attached to the 3Ⲡend of an oligonucleotide at the beginning of solid phase synthesis, e.g., Woo et al., U.S. Pat. No. 5,231,191; and Hobbs, Jr., U.S. Pat. No. 4,997,928.
In one embodiment of the invention, the oligonucleotide probe can be attached to a solid support. Different probes may be attached to the solid support and may be used to simultaneously detect different target sequences in a sample. Reporter molecules having different fluorescence wavelengths can be used on the different probes, thus enabling hybridization to the different probes to be separately detected.
Examples of preferred types of solid supports for immobilization of the oligonucleotide probe include polystyrene, avidin coated polystyrene beads cellulose, nylon, acrylamide gel and activated dextran, controlled pore glass (CPG), glass plates and highly cross-linked polystyrene. These solid supports are preferred for hybridization and diagnostic studies because of their chemical stability, ease of functionalization and well defined surface area. Solid supports such as controlled pore glass (500 âŤ, 1000 âŤ) and non-swelling high cross-linked polystyrene (1000 âŤ) are particularly preferred in view of their compatibility with oligonucleotide synthesis.
The oligonucleotide probe may be attached to the solid support in a variety of manners. For example, the probe may be attached to the solid support by attachment of the 3Ⲡor 5Ⲡterminal nucleotide of the probe to the solid support. However, the probe may be attached to the solid support by a linker which serves to distance the probe from the solid support. The linker is most preferably at least 30 atoms in length, more preferably at least 50 atoms in length.
Hybridization of a probe immobilized to a solid support generally requires that the probe be separated from the solid support by at least 30 atoms, more-preferably at least 50 atoms. In order to achieve this separation, the linker generally includes a spacer positioned between the linker and the 3Ⲡnucleoside. For oligonucleotide synthesis, the linker arm is usually attached to the 3â˛-OH of the 3Ⲡnucleoside by an ester linkage which can be cleaved with basic reagents to free the oligonucleotide from the solid support.
A wide variety of linkers are known in the art which may be used to attach the oligonucleotide probe to the solid support. The linker may be formed of any compound which does not significantly interfere with the hybridization of the target sequence to the probe attached to the solid support. The linker may be formed of a homopolymeric oligonucleotide which can be readily added on to the linker by automated synthesis. Alternatively, polymers such as functionalized polyethylene glycol can be used as the linker. Such polymers are preferred over homopolymeric oligonucleotides because they do not significantly interfere with the hybridization of probe to the target oligonucleotide. Polyethylene glycol is particularly preferred because it is commercially available, soluble in both organic and aqueous media, easy to functionalize, and is completely stable under oligonucleotide synthesis and post-synthesis conditions.
The linkages between the solid support, the linker and the probe are preferably not cleaved during removal of base protecting groups under basic conditions at high temperature. Examples of preferred linkages include carbamate and amide linkages. Immobilization of a probe is well known in the art and one skilled in the art may determine the immobilization conditions.
According to one embodiment of the method, the hybridization probe is immobilized on a solid support. The oligonucleotide probe is contacted with a sample of nucleic acids under conditions favorable for hybridization. The fluorescence signal of the reporter molecule is measured before and after being contacted with the sample. Since the reporter molecule on the probe exhibits a greater fluorescence signal when hybridized to a target sequence, an increase in the fluorescence signal after the probe is contacted with the sample indicates the hybridization of the probe to target sequences in the sample. In an unhybridized state, the fluorescent label is quenched by the quencher. On hybridization to the target, the fluorescent label is separated from the quencher resulting in fluorescence.
Immobilization of the hybridization probe to the solid support also enables the target sequence hybridized to the probe to be readily isolated from the sample. In later steps, the isolated target sequence may be separated from the solid support and processed (e.g., purified, amplified) according to methods well known in the art depending on the particular needs of the researcher.
The labeled oligonucleotide probe may be used as a probe for the real-time detection of Salmonella target nucleic acid sequence in a sample.
A CataCleave oligonucleotide probe is first synthesized with DNA and RNA sequences that are complimentary to sequences found within a PCR amplicon comprising a selected Salmonella target sequence. In one embodiment, the probe is labeled with a FRET pair, for example, a fluorescein molecule at one end of the probe and a non-fluorescent quencher molecule at the other end. Hence, upon hybridization of the probe with the PCR amplicon, a RNA:DNA heteroduplex forms that can be cleaved by an RNase H activity.
RNase H hydrolyzes RNA in RNA-DNA hybrids. This enzyme was first identified in calf thymus but has subsequently been described in a variety of organisms. RNase H activity appears to be ubiquitous in eukaryotes and bacteria. Although RNase Hs constitute a family of proteins of varying molecular weight and nucleolytic activity, substrate requirements appear to be similar for the various isotypes. For example, most RNase H's studied to date function as endonucleases and requiring divalent cations (e.g., Mg2+, Mn2+) to produce cleavage products with 5Ⲡphosphate and 3Ⲡhydroxyl termini.
RNase HI from E.coli is the best-characterized member of the RNase H family. In addition to RNase HI, a second E.coli RNase H, RNase HII has been cloned and characterized (Itaya, M., Proc. Natl. Acad. Sci. USA, 1990, 87, 8587-8591). It is comprised of 213 amino acids while RNase HI is 155 amino acids long. E. coli RNase HIM displays only 17% homology with E.coli RNase HI. An RNase H cloned from S. typhimurium differed from E.coli RNase HI in only 11 positions and was 155 amino acids in length (Itaya, M. and Kondo K., Nucleic Acids Res., 1991, 19, 4443-4449).
Proteins that display RNase H activity have also been cloned and purified from a number of viruses, other bacteria and yeast (Wintersberger, U. Pharmac. Ther., 1990, 48, 259-280). In many cases, proteins with RNase H activity appear to be fusion proteins in which RNase H is fused to the amino or carboxy end of another enzyme, often a DNA or RNA polymerase. The RNase H domain has been consistently found to be highly homologous to E.coli RNase HI, but because the other domains vary substantially, the molecular weights and other characteristics of the fusion proteins vary widely.
In higher eukaryotes two classes of RNase H have been defined based on differences in molecular weight, effects of divalent cations, sensitivity to sulfhydryl agents and immunological cross-reactivity (Busen et al., Eur. J. Biochem., 1977, 74, 203-208). RNase HI enzymes are reported to have molecular weights in the 68-90 kDa range, be activated by either Mn2+ or Mg2+ and be insensitive to sulfhydryl agents. In contrast, RNase H II enzymes have been reported to have molecular weights ranging from 31-45 kDa, to require Mg2+ to be highly sensitive to sulfhydryl agents and to be inhibited by Mn2+ (Busen, W., and Hausen, P., Eur. J. Biochem., 1975, 52, 179-190; Kane, C. M., Biochemistry, 1988, 27, 3187-3196; Busen, W., J. Biol. Chem., 1982, 257, 7106-7108.).
An enzyme with RNase HII characteristics has been purified to near homogeneity from human placenta (Frank et al., Nucleic Acids Res., 1994, 22, 5247-5254). This protein is reported to have a molecular weight of approximately 33 kDa and be active in a pH range of 6.5-10, with a pH optimum of 8.5-9. The enzyme is reported to require Mg2+ and be inhibited by Mn2+ and n-ethyl maleimide. The products of cleavage reactions have 3Ⲡhydroxyl and 5Ⲡphosphate termini.
According to an embodiment, real-time nucleic acid amplification is performed on a target polynucleotide in the presence of a thermostable nucleic acid polymerase, an RNase H activity, a pair of PCR amplification primers capable of hybridizing to the Salmonella target polynucleotide, and the labeled CataCleave oligonucleotide probe. During the real-time PCR reaction, cleavage of the probe by RNase H leads to the separation of the fluorescent donor from the fluorescent quencher and results in the real-time increase in fluorescence of the probe corresponding to the real-time detection of Salmonella target DNA sequences in the sample.
In certain embodiments, the real-time nucleic acid amplification permits the real-time detection of a single target DNA molecule in less than about 40 PCR amplification cycles.
The disclosure herein also provides for a kit format which comprises a package unit having one or more reagents for the real-time detection of Salmonella target nucleic acid sequences in a sample. The kit may also contain one or more of the following items: buffers, instructions, and positive or negative controls. Kits may include containers of reagents mixed together in suitable proportions for performing the methods described herein. Reagent containers preferably contain reagents in unit quantities that obviate measuring steps when performing the subject methods.
The kit may contain a lysis reagent comprising a buffer with a pH of about 6 to about 9, a zwitterionic detergent at a concentration of about 0.125% to about 2%, and an azide at a concentration of about 0.3 to about 2.5 mg/ml. For the lysis of gram positive bacteria, the kit may include a protease, for example, 100 mg of lyophilized proteinase K and an aliquot of a buffer solution for the reconstitution of the proteinase K solution. In one embodiment, the 1Ă lysis reagent contains 12.5 mM Tris acetate (pH 8.0) or Tris-HCl (pH 8.0) or HEPES (pH=7.8), 0.25% (w/v) CHAPS, and 0.3125 mg/ml sodium azide.
Kits may also contain reagents for real-time PCR including, but not limited to, a thermostable polymerase, thermostable RNase H, primers selected to amplify a Samonella nucleic acid target sequence and a labeled CataCleave oligonucleotide probe that anneals to the real-time PCR product and allow for the detection of Salmonella target nucleic acid sequences according to the methodology described herein. Kits may comprise reagents for the detection of two or more Salmonella target nucleic acid sequences. Kit reagents may also include reagents for RT-PCR analysis where applicable.
In certain embodiments, the amplification primer pair has the sequence of SEQ ID NOs 1 and 2.
In other embodiments, the CataCleave oligonucleotide probe has the sequence of SEQ ID NO: 3.
The present invention will now be illustrated by the following examples, which are not to be considered limiting in any way.
5 ΟL of ground beef enrichment (spiked with Salmonella) are diluted into 42.5 ΟL of lysis buffer containing 2.5 Οl proteinase K (20.1 mg/ml). The samples are incubated at 55° C. for 15 minutes and then heated to 95° C. for 10 minutes prior to cooling. 2 Οl of lysate is then added to each PCR-CataCleave reaction.
Eight Lysis Buffers were Tested:
1. CZ1: 1% CHAPS, 1 mg/mL sodium azide, 20 mM HEPES-KOH (pH 8)
2. CZ2: 2% CHAPS, 1 mg/mL sodium azide, 20 mM HEPES-KOH (pH 8)
3. CZ3: 0.5% CHAPS, 1 mg/mL sodium azide, 20 mM HEPES-KOH (pH 8)
4. CZ4: 1% CHAPS, 0.5 mg/mL sodium azide, 20 mM HEPES-KOH (pH 8)
5. CZ5: 1% CHAPS, 2.5 mg/mL sodium azide 20 mM HEPES-KOH (pH 8)
6. CZ6: 1% CHAPS, 1 mg/mL sodium azide, 20 mM HEPES-KOH (pH 8)
7. CZ7: 1% CHAPS, 1 mg/mL sodium azide, 100 mM HEPES-KOH (pH 8)
8. 0.125 TZ (1Ă TZ: 2% Triton-X, 5 mg/ml sodium azide, 0.2 M Tris pH=8)
Each reaction mix contained amplification buffer (32 mM HEPES ((4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid)-KOH, pH 7.8, 100 mM potassium acetate, 4 mM magnesium acetate, 0.11% bovine serum albumin, 1% dimethylsulfoxide), 800 nM Salmonella-Forward primer (SEQ ID NO. 1), 800 nM Salmonella-Reverse primer (SEQ ID NO. 2), 200 nM Salmonella CataCleave probe (SEQ ID NO. 3), dUTP/NTP mix (80 ÎźM dGTP, dCTP, dATP and 160 ÎźM dUTP), 2.5 Units Thermus aquaticus DNA polymerase, 1 Unit Pyrococcus furiosis RNase HII, and 0.1 Unit Uracil-N-Glycosylase and lysate.
| Component | Îźl/25 Îźl rxn | |
| 10X ICAN Buffer | 2.5 | |
| 1 | ||
| 1 | ||
| 1 | ||
| Fermentas dN/UTP (2/4 mM) | 1 | |
| 0.5 | ||
| 0.1 | ||
| RNaseH II (undiluted) | 0.2 | |
| Lysate | 2 | |
| Water | 15.70 | |
The Salmonella Forward and Reverse primers amplify a 180 base pair fragment contained within the Salmonella invasion gene (invA).
The sequences of the primers and probes were as follows:
| Salmonella-Forwardâprimer: | |
| (SEQâIDâNO:â1) | |
| 5â˛-TCGTCATTCCATTACCTACC | |
| Salmonella-Reverseâprimer: | |
| (SEQâIDâNO:â2) | |
| 5â˛-TACTGATCGATAATGCCAGACGAA | |
| SalmonellaâCataCleaveâProbe: | |
| (SEQâIDâNO:â3) | |
| 5â˛-/FAM/CGATCAGrGrArArATCAACCAG/IABFQ), |
Abbreviations: FAM: 6-Carboxyfluorescein; IABHQ: Iowa Black Hole Quencher for short wavelength emission from Integrated DNA Technologies (Coralville, Iowa).
The reaction were run on a Roche Lightcycler 480 using the following cycling protocol: 37° C. for 10 minutes; 95° C. for 10 minutes; then 50 cycles of amplification; 95° C. for 15 seconds, 60° C. for 20 seconds.
FAM emission was monitored during the 60° C. step.
| Cp values |
| Lysis | Sample | Sample | Sample | Sample | Std. | |
| solution | 1 | 2 | 3 | 4 | Average | Dev. |
| CZ1 | 22.75 | 24.68 | 27.59 | 24.31 | 24.83 | 2.02 |
| CZ2 | 24.84 | 22.5â | 22.65 | 22.44 | 23.11 | 1.16 |
| CZ3 | 21.7â | 21.32 | 21.59 | 21.24 | 21.46 | 0.22 |
| CZ4 | 21.78 | 21.25 | 22.21 | 21.63 | 21.72 | 0.40 |
| CZ5 | 20:99 | 20.78 | 22.74 | 20.46 | 21.24 | 1.02 |
| CZ6 | 22.5â | 2219 | 21.64 | 20.87 | 21 80 | 0.71 |
| CZ7 | 22.33 | 21.3â | 21.38 | 23.47 | 22.12 | 1.01 |
| 0.125 TZ | 24.69 | 24.13 | 22.89 | 23.53 | 23.81 | 0.77 |
The raw data from the CataCleave-PCR reactions are depicted as an output graph in FIG. 3A. The data show CZ5 with a composition of CZ5: 1% CHAPS, 2.5 mg/mL sodium azide 20 mM HEPES-KOH (pH 8) was the best lysate reagent for Salmonella.
A control CataCleave PCR was first tested on purified target DNA resuspended in following lysis reagent concentrations:
Five microliters of ground beef enrichment (spiked with Listeria) was first added to 42.5 Οl of lysis agent and 2.5 Οl proteinase K (20 mg/ml) and incubated at 55° C. for 15 minutes. After inactivation at 95° C. for 10 minutes, 2 Οl of the lysate was added to each reaction mix containing 1à ICAN amplification buffer (32 mM HEPES-KOH, pH 7.8; 4 mM magnesium acetate; 1% DMSO; and, 0.11% BSA), 400 nM LmonC3-Forward primer (SEQ ID NO. 5), 400 nM LmonC3-Reverse primer (SEQ ID NO. 6), 200 nM CataCleave probe (SEQ ID NO. 7), dUTP/NTP mix (80 ΟM dGTP, dCTP, dATP and 160 ΟM dUTP), 2.5 Units Thermus aquaticus DNA polymerase, 1 Unit Pyrococcus furiosis RNase HII, and 0.1 unit uracil-N-glycosylase (UNG).
| Component | Îźl/25 Îźl rxn | |
| 10X ICAN Buffer | 2.5 | |
| Forward primer (20 | 1 | |
| 1 | ||
| 1 | ||
| Fermentas dN/UTP (2/4 | 1 | |
| Taq polymerase (5 | 0.5 | |
| 0.1 | ||
| RNaseH II (undiluted) | 0.2 | |
| lysate | 2 | |
| Water | 15.70 | |
| LmonâC3F: | |
| (SEQâIDâNO.:â5) | |
| ACGAGTAACGGGACAAATGC | |
| LmonâC3R: | |
| (SEQâIDâNO.:â6) | |
| TCCCTAATCTATCCGCCTGA | |
| LmonâCCâC3B: | |
| (SEQâIDâNO.:â7) | |
| 5â˛-/FAM/-CGAATGTAArCAGACACGGTCTCA/IABFQ/, |
The reactions were run on a Roche Lightcycler 480 using the following cycling protocol: 37° C. for 10 minutes; 95° C. for 10 minutes; then 50 cycles of amplification; 95° C. for 15 seconds, 60° C. for 20 seconds. FAM emission was monitored during the 60° C. step.
| Cp values |
| Lysis | Sample | Sample | Sample | Standard | ||
| Number | Solution | 1 | 2 | 3 | Average | Dev. |
| 1 | 1x ZAC | 19.57 | 19.67 | 19.58 | 19.61 | 0.06 |
| 2 | 0.5x ZAC | 19.58 | 19.53 | 19.57 | 19.56 | 0.03 |
| 3 | 0.25x ZAC | 20.52 | 20.3 | 20.5 | 20.44 | 0.12 |
| 4 | 0.125x ZAC | 20.87 | 20.83 | 20.81 | 20.84 | 0.03 |
| 5 | 0.125x TZ | 20.38 | 20.33 | 20.37 | 20.36 | 0.03 |
The raw data from the CataCleave-PCR reactions are depicted as an output graph in FIG. 3B. The results show that the lysis reagent does not inhibit the PCR CataCleave reaction.
5 ΟL of ground beef enrichment (spiked with Listeria) were diluted into 42.5 ΟL of lysis agent containing 2.5 Οl proteinase K (20.1 mg/ml). The samples are incubated at 55° C. for 15 minutes and then heated to 95° C. for 10 minutes and then cooled.
17.7 Îźl of lysate was then added to each reaction mix containing amplification buffer 1Ă ICAN buffer, 400 nM LmonC3-forward primer (SEQ ID NO. 5), 400 nM LmonC3-reverse primer (SEQ ID NO. 6), 200 nM CataCleave probe (SEQ ID NO. 7), dUTP/NTP mix (80 ÎźM dGTP, dCTP, dATP and 160 ÎźM dUTP), 2.5 units Thermus aquaticus DNA polymerase, 1 unit Pyrococcus furiosis RNase HII, and 0.1 unit uracil-N-glycosylase (UNG).
| Component | Îźl/25 Îźl rxn | |
| 10X ICAN Buffer | 2.5 | |
| Forward primer | 1 | |
| Reverse primer (20 | 1 | |
| 1 | ||
| Fermentas dN/UTP | 1 | |
| Taq polymerase (5 | 0.5 | |
| 0.1 | ||
| RNaseH II | 0.2 | |
| lysate | 17.7 | |
| Cp values |
| Column | Lysis Solution | Sample 1 | Sample 2 | Average | |
| 1 | 1x | ZAC | NONE | NONE | NONE |
| 2 | 0.5x | ZAC. | NONE | NONE | NONE |
| 3 | 0.425x | ZAC | 28.96 | 28.76 | 28.86 |
| 4 | 0.125x | ZAC | 20.35 | 20.29 | 20.32 |
| 5 | 0.125x | TZ | 20.82 | 20.69 | 20.76 |
The raw data from the CataCleave-PCR reactions are depicted as an output graph in FIG. 4.
The lysis reagent 0.125Ă ZAC is shown to be optimal for the combined lysis and PCR CataCleave assay for the detection of the invA Listeria gene. The results also show that the 0.125Ă ZAC lysis reagent is superior to 0.125Ă TZ lysis agent (A. Abolmaaty, C. Vu, J. Oliver and R. E. Levin. 2000. Microbio. 101:181-189).
An overnight culture of L. monocytogenes cells were diluted and lysed in 0.125Ă ZAC with 1 mg/ml proteinase K, and 2 Îźl of the resulting lysate was added to each reaction mix containing 1Ă ICAN amplification buffer, 400 nM LmonC3-forward primer (SEQ ID NO. 5), 400 nM LmonC3-reverse primer (SEQ ID NO. 6), 200 nM CataCleave probe (SEQ ID NO. 7), dUTP/NTP mix (80 ÎźM dGTP, dCTP, dATP and 160 ÎźM dUTP), 2.5 units Thermus aquaticus DNA polymerase, 1 unit Pyrococcus furiosis RNase HII, and 0.1 unit uracil-N-glycosylase (UNG).
The raw data from the CataCleave-PCR reactions are depicted as an output graph in FIG. 5.
The results shown in FIG. 5 demonstrate that the assay was able to detect 1 cfu, or one genomic copy of L. monocytogenes.
Any patent, patent application, publication, or other disclosure material identified in the specification is hereby incorporated by reference herein in its entirety. Any material, or portion thereof, that is said to be incorporated by reference herein, but which conflicts with existing definitions, statements, or other disclosure material set forth herein is only incorporated to the extent that no conflict arises between that incorporated material and the present disclosure material.
1. A method of preparing a nucleic acid template for real-time PCR amplification, comprising the steps of:
lysing cells in a lysis reagent comprising:
a buffer with a pH of about 6 to about 9;
a zwitterionic detergent at a concentration of about 0.125% to about 2%,
an azide at a concentration of about 0.3 to about 2.5 mg/ml, and
a protease,
incubating the resulting cell lysate at about 55° C. for about 15 minutes to produce a substantially protein-free cell lysate,
inactivating said protease at about 95° C. for about 10 minutes,
adding said protein-free cell lysate directly to a real-time PCR amplification reaction mixture comprising:
a pair of amplification primers that can anneal to a target DNA in said cell lysate;
a probe comprising a detectable label and DNA and RNA nucleic acid sequences that are substantially complimentary to a region of the target DNA;
an amplifying polymerase activity,
an amplification buffer, and
an RNase H activity,
wherein, after amplification of the target DNA between the first and second amplification primers, the RNA sequences within the probe can form a RNA:DNA heteroduplex with the complimentary DNA sequences in said target DNA.
2. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 1, wherein the addition of said cell lysate permits the real-time PCR detection of a single target DNA molecule in said cell lysate.
3. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 1, wherein the real-time PCR detection of a single target DNA molecule requires less than about 50 PCR amplification cycles.
4. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 1, wherein said amplification reaction mixture further comprises a reverse transcriptase activity.
5. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 1, wherein the probe is labeled with a FRET pair.
6. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 1, wherein said protein-free cell lysate is diluted 5-15 fold by said amplification reaction mixture.
7. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 1, wherein said cells are gram-positive and gram-negative bacterial cells.
8. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 7, wherein said gram positive bacterial cells are Listeria.
9. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 1, wherein the buffer comprises an acetate or phosphate buffer, Tris, 3-(N-morpholino)propane sulphonic acid, N-(2-hydroxyethyl)piperazine-Nâ˛-(2-ethane sulphonic acid) or 2-amino-2-hydroxymethyl-1,3-propanediol buffer.
10. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 1, wherein the zwitterionic detergent is 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate.
11. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 1, wherein the protease is proteinase K.
12. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 1, wherein the amplifying activity comprises a thermostable amplifying activity.
13. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 1, wherein the RNase H activity comprises a thermostable RNase H activity.
14. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 1, wherein the RNase H activity is a host start RNase H activity.
15. A method of preparing a nucleic acid template for real-time PCR amplification, comprising the steps of:
lysing cells in a lysis reagent comprising:
a buffer with a pH of about 6 to about 9;
a zwitterionic detergent at a concentration of about 0.125% to about 2%, and
an azide at a concentration of about 0.3 to about 2.5 mg/ml,
incubating the cell lysate at about 55° C. for about 15 minutes,
adding said cell lysate directly to an amplification reaction mixture comprising:
a pair of amplification primers that can anneal to a target DNA in said cell lysate;
a probe comprising a detectable label and DNA and RNA nucleic acid sequences that are substantially complimentary to a region of the target DNA;
an amplifying polymerase activity,
an amplification buffer, and
an RNase H activity,
wherein, after amplification of the target DNA between the first and second amplification primers, the RNA sequences within the probe can form a RNA:DNA heteroduplex with the complimentary DNA sequences in said target DNA.
16. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 15, wherein said amplification reaction mixture further comprises a reverse transcriptase activity.
17. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 15, wherein the probe is labeled with a FRET pair.
18. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 15, wherein said cell lysate is diluted less than 5-15 fold by said amplification reaction mixture.
19. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 15, wherein the addition of said cell lysate permits the real-time PCR detection of a single target DNA molecule in said cell lysate.
20. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 15, wherein the real-time PCR detection of a single target DNA molecule in said cell lysate in less than about 50 PCR amplification cycles.
21. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 15, wherein said cells are gram negative bacterial cells.
22. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 21, wherein said gram negative cells are Salmonella or E. coli.
23. The method of preparing nucleic acids for real-time PCR amplification according to claim 15, wherein the buffer comprises an acetate or phosphate buffer, Tris, 3-(N-morpholino)propane sulphonic acid, N-(2-hydroxyethyl)piperazine-Nâ˛-(2-ethane sulphonic acid), or 2-amino-2-hydroxymethyl-1,3-propanediol buffer.
24. The method of preparing nucleic acids for real-time PCR amplification according to claim 15, wherein the zwitterionic detergent is 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate.
25. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 15, wherein the amplifying activity comprises a thermostable amplifying activity.
26. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 15, wherein the RNase H activity comprises a thermostable RNase H activity.
27. The method of preparing a nucleic acid template for real-time PCR amplification according to claim 15, wherein the RNase H activity is a host hot-start RNase H activity.
28. A lysis reagent having:
a buffer with a pH of about 6 to about 9;
a zwitterionic detergent at a concentration of about 0.125% to about 2%, and
an azide at a concentration of about 0.3 to about 2.5 mg/ml,
wherein addition of about a two fold dilution of said reagent directly to an amplification reaction mixture comprising:
a pair of amplification primers that can anneal to a target DNA in said cell lysate;
a probe comprising a detectable label and DNA and RNA nucleic acid sequences that are substantially complimentary to a region of the target DNA;
an amplifying polymerase activity,
an amplification buffer, and
an RNase H activity,
does not inhibit said amplifying polymerase and RNase H enzymatic activities.
29. The lysis reagent of claim 28, wherein the buffer comprises an acetate or phosphate buffer, Tris, 3-(N-morpholino)propane sulphonic acid, N-(2-hydroxyethyl)piperazine-Nâ˛-(2-ethane sulphonic acid), or 2-amino-2-hydroxymethyl-1,3-propanediol buffer.
30. The lysis reagent of claim 28, wherein the zwitterionic detergent is 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate.
31. The lysis reagent of claim 28, wherein the amplification buffer further comprises a reverse transcriptase activity.
32. The lysis reagent of claim 28, wherein the amplifying activity comprises a thermostable amplifying activity.
33. The lysis reagent of claim 28, wherein the RNase H activity comprises a thermostable RNase H activity.
34. The lysis reagent of claim 28, wherein the RNase H activity is a hot start RNase H activity.
35. A lysis reagent having:
a buffer with a pH of about 6 to about 9;
a zwitterionic detergent at a concentration of about 0.125% to about 2%, and
an azide at a concentration of about 0.3 to about 2.5 mg/ml, and
a protease,
wherein, after inactivation of said protease, addition of about a two fold dilution of said reagent directly to an amplification reaction mixture comprising:
a pair of amplification primers that can anneal to a target DNA in said cell lysate;
a probe comprising a detectable label and DNA and RNA nucleic acid sequences that are substantially complimentary to a region of the target DNA;
an amplifying polymerase activity,
an amplification buffer, and
an RNase H activity,
does not inhibit said amplifying polymerase and RNase H enzymatic activities.
36. The lysis reagent of claim 35, wherein the buffer comprises an acetate or phosphate buffer, Tris, 3-(N-morpholino)propane sulphonic acid, N-(2-hydroxyethyl)piperazine-Nâ˛-(2-ethane sulphonic acid), or 2-amino-2-hydroxymethyl-1,3-propanediol buffer.
37. The lysis reagent of claim 35, wherein the zwitterionic detergent is 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate.
38. The lysis reagent of claim 35, wherein the amplification buffer further comprises a reverse transcriptase activity.
39. The lysis reagent of claim 35, wherein the amplifying activity comprises a thermostable amplifying activity.
40. The lysis reagent of claim 35, wherein the RNase H activity comprises a thermostable RNase H activity.
41. The lysis reagent of claim 35, wherein the RNase H activity is a hot start RNase H activity.