US20110236941A1
2011-09-29
13/049,263
2011-03-16
A novel genetically modified microorganisms capable of using CO to produce 1-butanol and/or a precursor thereof, novel methyltransferases and nucleic acids encoding same, methods for producing genetically modified microorganisms using said novel methyltransferases, and methods of producing 1-butanol and/or a precursor thereof by microbial fermentation.
Get notified when new applications in this technology area are published.
C12N15/74 » CPC main
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
C12N1/205 » CPC further
Microorganisms, e.g. protozoa; Compositions thereof ; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor; Bacteria; Culture media therefor Bacterial isolates
C12N9/0006 » CPC further
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
C12N9/0008 » CPC further
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
C12R2001/145 » CPC further
Microorganisms ; Processes using microorganisms; Bacteria or Actinomycetales ; using bacteria or Actinomycetales Clostridium
Y02E50/10 » CPC further
Technologies for the production of fuel of non-fossil origin Biofuels, e.g. bio-diesel
Y02E50/10 » CPC further
Technologies for the production of fuel of non-fossil origin Biofuels, e.g. bio-diesel
Y02P20/52 » CPC further
Technologies relating to chemical industry; Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
Y02P20/52 » CPC further
Technologies relating to chemical industry; Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
C12P7/16 » CPC further
Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic Butanols
C12P1/04 IPC
Preparation of compounds or compositions, not provided for in groups - , by using microorganisms or enzymes by using bacteria
The present disclosure relates to methods for the production of biofuels by microbial fermentation and genetically modified micro-organisms suitable for use in such methods.
Butanol is an important bulk chemical with a wide range of industrial uses that has worldwide production of 4.5-5.5 million tonnes per annum. It is used as a precursor for the production of acrylate and methacrylate esters (used in coatings, plastics, textiles, adhesives, etc), glycol ethers (coatings, electronics) and butyl acetate (paints, ink, coatings, synthetic fruit flavoring) as well as butylamines (production of pesticides and pharmaceuticals) and amine resins. It also has direct use as a solvent (in ink, dyes, etc), an extractant (for the production of drugs and natural substances such as alkaloids, antibiotics, hormones, and vitamins), and in deicing fluids, cosmetics and chromatography.
Butanol also has potential as a second generation biofuel, and in this context is referred to as Biobutanol (Köpke & Dürre, 2010). It has similar properties to gasoline and superior properties to ethanol. Specifically, it has increased mileage due to higher energy density, it can be mixed with gasoline in any concentration (while ethanol can only be blended up to 85%) and is not hygroscopic or corrosive.
Biofuels for transportation are attractive replacements for gasoline and are rapidly penetrating fuel markets as low concentration blends. Biofuels, derived from natural plant sources, are more environmentally sustainable than those derived from fossil resources (such as gasoline), their use allowing a reduction in the levels of so-called fossil carbon dioxide (CO2) gas that is released into the atmosphere as a result of fuel combustion. In addition, biofuels can be produced locally in many geographies, and can act to reduce dependence on imported fossil energy resources.
The vast majority of biofuels are produced via traditional yeast-based fermentation processes that use crop derived carbohydrates as the main carbon source and are known as first generation biofuels. However, these crops are required for food and many crops also require high agricultural inputs in the form of fertilizers. These limitations mean that first generation biofuels are considered unsustainable and the greenhouse gas reductions that can be achieved are limited. The aim of second generation biofuels is the sustainable use of non-food parts of current crops or other industrial waste to reduce greenhouse gas emissions and reduce dependency on fossil fuels.
Recent 1-butanol production has been mainly by oxo synthesis (Weiβermel & Arpe, 2003). Petrochemicals including crude oil are cracked to form propylene which is used during oxo synthesis. However the synthesis process requires use of non-renewable resources as well as suffering from being expensive and non-specific in the products formed.
Butanol can also be produced through biological production methods, the most common being the Acetone-Butanol-Ethanol (ABE) fermentation which has been used industrially since 1913 (Köpke & Dürre, 2010). This method has the unwanted by-product of acetone which is usually produced at about half the volume of butanol which therefore substantially reduces the yield. Additionally, this method of fermentation is limited by the toxicity of butanol to the micro-organism which results in growth being almost completely inhibited at such low butanol concentrations as 1.5% (Köpke and Dürre 2010). Furthermore ABE fermentation uses sugar from corn, starch, cassaya and sugar cane as a feedstock. This results in the undesirable use of arable land to produce fuel rather than food. It can also exacerbate problems related to deforestation and desertification.
Only a few organisms are known to naturally produce butanol and none of these produce butanol at a high yield from abundant sources (such as carbon monoxide —CO). Two organisms known to naturally produce butanol from CO are Butyribacterium methylotrophicum (which synthesises only traces of butanol (Heiskanen et al, 2007)), and Clostridium carboxidivorans (which produces low yields of 1-butanol as a by-product to the main fermentation products ethanol and acetate (Liou et al, 2005)).
A number of organisms have been genetically modified to produce 1-butanol including E. coli, Bacillus subtilis, Saccharomyces cerevisiae, Pseudomonas putida, or Lactobacillus brevis. However all of these organisms still rely on sugar as feedstock (Köpke & Dürre, 2010). Despite over 250 Clostridium species being known, only a few are genetically accessible. There is no natural competence (uptake of extracellular DNA from the cell's environment) known in Clostridia and electrotransformation or conjugation are the only methods available for transformation. These issues present significant difficulties in effectively transforming Clostridia species. Most Clostridia have one or more restriction/methylation systems to protect against foreign and phage DNA which means that transformation is particularly difficult and unpredictable.
It is an object of the invention to overcome one or more disadvantages of the prior art, or to at least provide the public with a useful alternative to known technologies.
In accordance with the invention, it has been discovered that a genetically modified microorganism is capable of using CO to produce 1-butanol or a precursor thereof as the main fermentation product.
In a first aspect, the invention provides an acetogenic recombinant microorganism which produces 1-butanol and/or a precursor thereof as the main fermentation product.
In a related aspect, the invention provides an acetogenic recombinant microorganism which is capable of producing 1-butanol and/or a precursor thereof by fermentation from a substrate comprising CO at a concentration of greater than approximately 1 mM or 0.075 g/l per litre of fermentation broth.
Preferably, the microorganism comprises exogenous nucleic acids adapted to express one or more enzymes in the butanol biosynthesis pathway.
In one embodiment, the one or more enzymes are chosen from the group consisting of: Thiolase 3-hydroxybutyryl-CoA dehydrogenase, Crotonase/crotonyl-CoA hydratase, Butyryl-CoA dehydrogenase, Electron Transfer Flavoprotein A, and Electron Transfer Flavoprotein B
Preferably, the microorganism comprises one or more exogenous nucleic acids encoding one or more of the enzymes.
Preferably, the one or more nucleic acids encoding the one or more enzymes is chosen from the nucleic acids SEQ ID NO. 1 to SEQ ID NO. 6 or functionally equivalent variants thereof.
Preferably, the microorganism comprises one or more exogenous nucleic acids encoding each of Thiolase, 3-hydroxybutyryl-CoA dehydrogenase, Crotonase, Butyryl-CoA dehydrogenase, Electron Transfer Flavoprotein A and Electron Transfer Flavoprotein B.
Preferably, the microorganism comprises a plasmid encoding one or more of, or preferably each of, Thiolase, 3-hydroxybutyryl-CoA dehydrogenase, Crotonase, Butyryl-CoA dehydrogenase, Electron Transfer Flavoprotein A and Electron Transfer Flavoprotein B.
In one embodiment, the microorganism comprises one or more exogenous nucleic acids encoding each of the enzymes thiolase 3-hydroxybutyryl-CoA dehydrogenase, crotonase/crotonyl-CoA hydratase and butyryl-CoA dehydrogenase.
Preferably, the microorganism further comprises an exogenous phosphotransacetylase/acetate kinase promoter. Preferably, the promoter corresponds to SEQ_ID No. 7 or a functionally equivalent variant thereof.
Preferably, the promoter is contained on a construct encoding one or more of the enzymes referred to herein before.
In one embodiment, the microorganism comprises exogenous nucleic acids adapted to express one or more of the enzymes chosen from the group consisting of: Phosphotransbutyrylase; butyrate kinase; ferredoxin dependent aldehyde oxidoreductase; butyraldehyde dehydrogenase; butanol dehydrogenase; a bifunctional butyraldehyde dehydrogenase and butanol dehydrogenase.
In one embodiment, the microorganism comprises exogenous nucleic acids adapted to express one or more of butyraldehyde dehydrogenase, butanol dehydrogenase and a bifunctional butyraldehyde dehydrogenase/butanol dehydrogenase. Preferably, the microorganism comprises one or more exogenous nucleic acids encoding one or more of butyraldehyde dehydrogenase, butanol dehydrogenase and a bifunctional butyraldehyde dehydrogenase/butanol dehydrogenase.
In one embodiment, the microorganism comprises exogenous nucleic acids adapted to express one or more of Phosphotransbutyrylase, butyrate kinase, ferredoxin dependent aldehyde oxidoreductase, and butanol dehydrogenase. Preferably, the microorganism comprises one or more exogenous nucleic acids encoding one or more of Phosphotransbutyrylase, butyrate kinase, ferredoxin dependent aldehyde oxidoreductase, and butanol dehydrogenase. In particular embodiments, the microorganism comprises exogenous nucleic acids adapted to express each of Phosphotransbutyrylase, butyrate kinase, ferredoxin dependent aldehyde oxidoreductase, and butanol dehydrogenase.
In one embodiment, the one or more nucleic acids encoding the one or more enzymes is chosen from the nucleic acids outlined in tables 7 to 10 herein after and functionally equivalent variants thereof.
In one embodiment, the microorganism comprises one or more nucleic acid adapted to express at least two of the enzymes in the butanol biosynthesis pathway, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, or at least 12 of the enzymes. Preferably, the microorganism is selected from the group of acetogenic bacteria. In certain embodiments the microorganism is selected from the group comprising Clostridium autoethanogenum, Clostridium ljungdahlii Clostridium ragsdalei, Clostridium carboxidivorans, Clostridium drakei, Clostridium scatalogenes, Clostridium aceticum, Clostridium formicoaceticum, Butyribacterium limosum, Acetobacterium woodii, Blautia producta, Eubacterium limosum, Moorella thermoacetica, Moorella thermautotrophica, Oxobacter pfennigii, and Thermoanaerobacter kiuvi.
Preferably, the microorganism is Clostridium autoethanogenum DSM23693.
In one embodiment, the recombinant microorganism of the invention has the defining characteristics of the microorganism deposited at the DSMZ (Deutsche Sammlung für Mikroorganismen and Zellkulturen GmbH, Braunschweig, Germany) under the accession number DSM24138.
In a second aspect, the invention provides a recombinant methyltransferase gene according to nucleotide SEQ_ID NO 27 or a functionally equivalent variant thereof.
In a third aspect, the invention provides a methyltransferase according to SEQ_ID NO 28 or a functionally equivalent amino acid variant thereof.
In a related aspect the invention provides a recombinant microorganism comprising a methyltransferase gene according to the second aspect. The methyltransferase gene may be present on a nucleic acid construct or integrated into the genome of the microorganism.
In a fourth aspect, the invention provides a nucleic acid comprising SEQ_ID No 1 to 6, or functionally equivalent variants thereof, in any order.
Preferably, the nucleic acid comprises SEQ_ID No 1 to 6 in the order shown in FIG. 2.
Preferably, the nucleic acid further comprises a phosphotransacetylase/acetate kinase promoter. Preferably, the promoter corresponds to SEQ_ID No. 7 or a functionally equivalent variant thereof.
In a fifth aspect, the invention provides an expression construct comprising one or more nucleic acid sequences wherein the construct, when expressed in an acetogenic microorganism, results in 1-butanol and/or a precursor thereof being produced as the main fermentation product.
Preferably, the one or more nucleic acid sequences encode one or more enzymes that are part of the 1-butanol biosynthesis pathway.
Preferably, the nucleic acids are selected from nucleic acids encoding thiolase, 3-hydroxybutyryl-CoA dehydrogenase, crotonase, butyryl-CoA dehydrogenase, electron transfer flavoprotein A and/or electron transfer flavoprotein B.
Preferably, the one or more nucleic acid sequences are selected from SEQ_ID NO. 1 to SEQ_ID NO. 6 or functionally equivalent variants thereof.
In one embodiment, the nucleic acids are further selected from nucleic acids encoding Phosphotransbutyrylase, butyrate kinase, ferredoxin dependent aldehyde oxidoreductase, butyraldehyde dehydrogenase, butanol dehydrogenase, and a bifunctional butyraldehyde dehydrogenase/butanol dehydrogenase.
In one embodiment, the nucleic acids are selected from the group of nucleic acids outlined in tables 7 to 10 herein after and functionally equivalent variants thereof.
In one embodiment, the expression construct encodes at least 2 enzymes in the butanol biosynthesis pathway, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 or at least 12 of the enzymes.
Preferably, the expression construct further comprises a phosphotransacetylase/acetate kinase operon promoter. In another embodiment, the expression construct comprises another highly active promoter such as the promoter of the pyruvate:ferredoxin oxidoreductase (SEQ_ID No. 48), the Wood-Ljungdahl gene cluster (SEQ_ID No 47), Rnf operon (SEQ_ID No 49) or the ATP synthase operon (SEQ_ID No 50). Preferably, the phosphotransacetylase/acetate kinase operon promoter corresponds to SEQ_ID No. 7 or a functionally equivalent variant thereof.
In a sixth aspect, the invention provides a methylation construct comprising a methyltransferase gene as described herein.
In a seventh aspect, the invention provides a composition comprising the expression construct of the fifth aspect and the methylation construct of the sixth aspect.
Preferably, the composition is able to produce a recombinant microorganism which produces 1-butanol and/or a precursor thereof as the main fermentation product.
In an eighth aspect, the invention provides a method of producing a recombinant microorganism comprising:
In one embodiment, expression of the methyltransferase gene in step b. is constitutive. In another embodiment, expression of the methyltransferase gene in step b. is induced.
In one embodiment, both the methylation construct and the expression construct are isolated in step C. In another embodiment, the expression construct is isolated in step C.
In one embodiment, only the expression construct is introduced into the destination microorganism. In another embodiment, both the expression construct and the methylation construct are introduced into the destination microorganism.
Preferably, the expression construct is as defined in the fifth aspect.
Preferably, the recombinant microorganism produces 1-butanol and/or a precursor thereof as the main fermentation product.
In a related aspect, the invention provides a method of producing a recombinant microorganism comprising:
Preferably, the expression construct is as defined in the fifth aspect.
Preferably, the recombinant microorganism produces 1-butanol and/or a precursor thereof as the main fermentation product.
Preferably, the methyltransferase is produced by expressing a methyltransferase gene, preferably according to SEQ_ID No 27 or a functionally equivalent variant thereof, in a microorganism and isolating the methyltransferase enzyme.
In a further related aspect, the invention provides a method of producing a recombinant microorganism comprising:
Preferably, the expression construct is as defined in the fifth aspect.
Preferably, the recombinant microorganism produces 1-butanol and/or a precursor thereof as the main fermentation product.
In a further related aspect, the invention provides a method of producing a recombinant microorganism comprising:
Preferably, the methyltransferase is encoded by a methyltransferase gene as defined in the second aspect or a methyltransferase as defined in the third aspect.
Preferably, the recombinant microorganism produces 1-butanol and/or a precursor thereof as the main fermentation product.
In a ninth aspect, the invention provides a method of producing a recombinant microorganism comprising:
In one embodiment, expression of the methyltransferase gene in step b. is constitutive. In another embodiment, expression of the methyltransferase gene in step b. is induced.
In one embodiment, both the methylation construct and the expression construct are isolated in step C. In another embodiment, the expression construct is isolated in step C.
In one embodiment, only the expression construct is introduced into the destination microorganism. In another embodiment, both the expression construct and the methylation construct are introduced into the destination microorganism.
Preferably, the recombinant microorganism produces 1-butanol and/or a precursor thereof as the main fermentation product.
In a tenth aspect, the invention provides a method of producing a recombinant microorganism that produces 1-butanol or a precursor thereof as the main fermentation product comprising:
In one embodiment, expression of the methyltransferase gene in step b. is constitutive. In another embodiment, expression of the methyltransferase gene in step b. is induced.
In one embodiment, both the methylation construct and the expression construct are isolated in step C. In another embodiment, the expression construct is isolated in step C.
In one embodiment, only the expression construct is introduced into the destination microorganism. In another embodiment, both the expression construct and the methylation construct are introduced into the destination microorganism.
Preferably, the expression construct is as defined in the fifth aspect.
Preferably, the methylation construct is as defined in the sixth aspect.
In an eleventh aspect, the invention provides a method of production of 1-butanol and/or a precursor thereof by microbial fermentation comprising fermenting a substrate using a recombinant microorganism.
Preferably, 1-butanol and/or a precursor thereof is the main fermentation product.
Preferably, the recombinant microorganism is as described in any one of the eighth to the tenth aspects.
Preferably, 1-butanol and/or a precursor thereof is produced in a yield of from approximately 0.075 grams per litre of fermentation broth (g/l) to approximately 20 g/l. In one embodiment, the yield is from approximately 0.15 g/l to approximately 1.54 g11. In other embodiments, the yield is approximately 10 g/l, approximately 5 g/l, or approximately 2 g/l. Preferably, the yield of 1-butanol is up to the limit at which butanol becomes toxic to the surrounding media.
Preferably, the substrate comprises CO. Preferably, the substrate is a gaseous substrate comprising CO. In one embodiment, the substrate comprises an industrial waste gas. In certain embodiments, the gas is steel mill waste gas or syngas.
In one embodiment, the substrate will typically contain a major proportion of CO, such as at least about 20% to about 100% CO by volume, from 20% to 70% CO by volume, from 30% to 60% CO by volume, and from 40% to 55% CO by volume. In particular embodiments, the substrate comprises about 25%, or about 30%, or about 35%, or about 40%, or about 45%, or about 50% CO, or about 55% CO, or about 60% CO by volume.
While it is not necessary for the substrate to contain any hydrogen, the presence of H2 should not be detrimental to product formation in accordance with methods of the invention. In particular embodiments, the presence of hydrogen results in an improved overall efficiency of alcohol production. For example, in particular embodiments, the substrate may comprise an approx 2:1, or 1:1, or 1:2 ratio of H2:CO. In one embodiment the substrate comprises about 30% or less H2 by volume, 20% or less H2 by volume, about 15% or less H2 by volume or about 10% or less H2 by volume. In other embodiments, the substrate stream comprises low concentrations of H2, for example, less than 5%, or less than 4%, or less than 3%, or less than 2%, or less than 1%, or is substantially hydrogen free. The substrate may also contain some CO2 for example, such as about 1% to about 80% CO2 by volume, or 1% to about 30% CO2 by volume.
Preferably, the precursor produced by the method of any of the preceding aspects is converted to 1-butanol in the presence of phosphotransbutyrylase, butyrate kinase, ferredoxin dependent aldehyde oxidoreductase, and butanol dehydrogenase.
Preferably, the microorganism produces phosphotransbutyrylase, butyrate kinase, ferredoxin dependent aldehyde oxidoreductase, and butanol dehydrogenase both before and after introduction of an exogenous nucleic acid.
Preferably, the precursor produced by the method of any of the preceding aspects is converted to 1-butanol in the presence of butyraldehyde dehydrogenase, butanol dehydrogenase and/or a bifunctional butyraldehyde dehydrogenase/butanol dehydrogenase.
Preferably, the microorganism produces butyraldehyde dehydrogenase, butanol dehydrogenase and/or a bifunctional butyraldehyde dehyrogenase/butanol deydrogenase before and after introduction of an exogenous nucleic acid.
In a twelfth aspect, the invention provides 1-butanol or a precursor thereof when produced by the method of the eleventh aspect.
In a thirteenth aspect, the invention provides a shuttle microorganism comprising a methylation construct as defined herein.
Preferably, the shuttle microorganism further comprises an expression construct as defined herein.
Preferably, the shuttle microorganism is E. coli or Bacillus subtillis.
Preferably, the methylation construct of any of the previous aspects comprises a lac promoter and the methyltransferase gene and is induced by Isopropyl-β-D-thio-galactoside (IPTG). Expression of the methyltransferase could also be controlled by other inducible promoter systems such as ara, tet, or T7.
In a fourteenth aspect, the invention provides a nucleic acid having a sequence chosen from the group consisting of SEQ_ID NOs 8 to 13.
In a fifteenth aspect, the invention provides a nucleic acid having a sequence chosen from the group consisting of SEQ_ID NOs 16 to 23.
In a sixteenth aspect, the invention provides a nucleic acid comprising at least the nucleic acid sequence of SEQ ID No. 7 or a functionally equivalent variant thereof, a nucleic acid construct or vector comprising same, and microorganisms comprising said nucleic acid or nucleic acid construct or vector.
In a seventeenth aspect, the invention provides a nucleic acid which encodes a methyltransferase according to SEQ_ID No 28.
In an eighteenth aspect, the invention provides a nucleic acid comprising a nucleic acid encoding a polypeptide having the amino acid sequence of a polypeptide chosen from the group listed in tables 7 to 10 herein after and functionally equivalent variants of any one or more thereof.
In a nineteenth aspect, the invention provides a nucleic acid comprising a nucleic acid chosen from the group listed in tables 7 to 10 herein after and functionally equivalent variants of any one or more thereof.
In a twentieth aspect, the invention provides constructs and microorganisms comprising a nucleic acid of the eighteenth or nineteenth aspects of the invention.
In a twenty first aspect, the invention provides a nucleic acid having a sequence chosen from the group consisting of SEQ_ID NOs 32 to 38 and 123 to 135.
In a twenty second aspect, the invention provides a polypeptide comprising the amino acid sequence of a polypeptide chosen from the group listed in tables 7 to 10 herein after and functionally equivalent variants of any one or more thereof.
The invention may also be said broadly to consist in the parts, elements and features referred to or indicated in the specification of the application, individually or collectively, in any or all combinations of two or more of said parts, elements or features, and where specific integers are mentioned herein which have known equivalents in the art to which the invention relates, such known equivalents are deemed to be incorporated herein as if individually set forth.
These and other aspects of the present invention, which should be considered in all its novel aspects, will become apparent from the following description, which is given by way of example only, with reference to the accompanying figures, in which:
FIG. 1 shows the butanol biosynthesis pathway from CO.
FIG. 2 shows an exemplary expression plasmid encoding genes involved in 1-butanol biosynthesis.
FIG. 3 shows sequencing results of pMTL85245-thlA-crt-hbd which demonstrate that the 1-butanol biosynthesis genes found on the expression plasmid were free of mutations.
FIGS. 4a, 4b and 4c show a nucleotide alignment of the C. autoethanogenum (CAU), C. ljungdahlii (CLJ), C. ragsdalei (CRA) and the designed methyltransferase (DMT) genes.
FIG. 4d shows an amino acid alignment of the methyltransferases from C. autoethanogenum (CAU1+2), C. ljungdahlii (CLJ), C. ragsdalei (CRA1+2) and the designed methyltransferase (DMT).
FIG. 5 shows an exemplary methylation plasmid of the invention
FIG. 6 shows an agarose gel electrophoresis image of isolated plasmid DNA. Lane 1, 6, 11, 16, 21 and 26 show 100 by Plus DNA Ladder. Lane 2-5 shows PCR with original methylated plasmid mix as template in the following order: ermB, ColE1, thlA, crt. Lane 7-10, 12-15, 17-20, 22-25 and 27-30 show PCR with isolated plasmids from 4 different clones as template, each in the following order ermB, ColE1, thlA, crt. Lane 32-35 shows plasmid prep from 4 different clones. Lane 36 shows plasmid prep from original C. autoethanogenum DSM23693.
FIG. 7 shows HPLC results showing 1-butanol production with C. autoethanogenum harboring butanol plasmid pMTL85245-thlA-crt-hbd.
FIG. 8 shows an analysis of expression of over 200 genes during a typical fermentation with Clostridium autoethanogenum at standard conditions using real-time PCR to identify appropriate promoter regions for the expression of heterologous genes.
FIG. 9 shows the sequence for SEQ_ID No 1, 2 and 3.
FIG. 10 shows the sequence for SEQ_ID No 4, 5 and 6.
FIG. 11 shows the sequence for promoter regions encoded by SEQ_ID No 7, 47, 48, 49 and 50.
FIG. 12 shows the sequence for SEQ_ID No 14
FIG. 13 shows the sequence for SEQ_ID No 15
FIG. 14 shows the sequence for SEQ_ID No 24 and 25
FIG. 15 shows the sequence for SEQ_ID No 26
FIG. 16 shows the sequence for SEQ_ID No 27
FIG. 17 shows the sequence for SEQ_ID No 28
FIG. 18 shows the sequence for SEQ_ID No 29
FIG. 19 shows the 16s rRNA gene of C. autoethanogenum (Y18178, GI:7271109)
FIGS. 20 and 21 show the sequence for SEQ_ID No 31
FIG. 22 shows Seq. ID 39: Nucleotide acid sequence of bifunctional butanol/butyraldehyde dehydrogenase of C. autoethanogenum
FIG. 23 shows Seq. ID 40: Nucleotide acid sequence of bifunctional butanol/butyraldehyde dehydrogenase of C. autoethanogenum
FIG. 24 shows Seq. ID 41: Nucleotide acid sequence of butyraldehyde dehydrogenase of C. autoethanogenum; and, Seq. ID 42: Amino acid sequence of butyraldehyde dehydrogenase of C. autoethanogenum
FIG. 25 shows Seq. ID 43: Nucleotide acid sequence of butyraldehyde dehydrogenase of C. autoethanogenum; and, Seq. ID 44: Amino acid sequence of butyraldehyde dehydrogenase of C. autoethanogenum
FIG. 26 shows Seq. ID 45: Nucleotide acid sequence of butyraldehyde dehydrogenase of C. autoethanogenum
FIG. 27 shows Seq. ID 46: Amino acid sequence of butyraldehyde dehydrogenase of C. autoethanogenum; and, Seq. ID 119: Nucleotide acid sequence of butanol dehydrogenase of C. autoethanogenum
FIG. 28 shows Seq. ID 120: Amino acid sequence of butanol dehydrogenase of C. autoethanogenum; and Seq. ID 121: Nucleotide acid sequence of butanol dehydrogenase of C. autoethanogenum.
FIG. 29 shows Seq. ID 122: Amino acid sequence of butanol dehydrogenase of C. autoethanogenum; and, Seq. ID 51: Nucleotide acid sequence of butanol dehydrogenase of C. autoethanogenum.
FIG. 30 shows Seq. ID 52: Amino acid sequence of butanol dehydrogenase of C. autoethanogenum; and, Seq. ID 53: Nucleotide acid sequence of butanol dehydrogenase of C. autoethanogenum
FIG. 31 shows Seq. ID 54: Amino acid sequence of butanol dehydrogenase of C. autoethanogenum; and, Seq. ID 55: Nucleotide acid sequence of butanol dehydrogenase of C. autoethanogenum
FIG. 32 shows Seq. ID 56: Amino acid sequence of butanol dehydrogenase of C. autoethanogenum; and, Seq. ID 57: Nucleotide acid sequence of butanol dehydrogenase of C. autoethanogenum.
FIG. 33 shows Seq. ID 58: Amino acid sequence of butanol dehydrogenase of C. autoethanogenum; and Seq. ID 59: Nucleotide sequence of phosphate acetyl/butyryl transferase from C. autoethanogenum; and Seq. ID 60: Amino acid sequence of phosphate acetyl/butyryl transferase from C. autoethanogenum.
FIG. 34 shows Seq. ID 61: Nucleotide sequence of acetate/butyrate kinase from C. autoethanogenum; and Seq. ID 62: Amino acid sequence of acetate/butyrate kinase from C. autoethanogenum.
FIG. 35 shows Seq. ID 63: Nucleotide sequence of aldehyde:ferredoxin oxidoreductase from C. autoethanogenum; and Seq. ID 64: Amino acid sequence of aldehyde:ferredoxin oxidoreductase from C. autoethanogenum.
FIG. 36 shows Seq. ID 65: Nucleotide sequence of aldehyde:ferredoxin oxidoreductase from C. autoethanogenum; and Seq. ID 66: Amino acid sequence of aldehyde:ferredoxin oxidoreductase from C. autoethanogenum.
FIG. 37 shows Seq. ID 67: Nucleotide acid sequence of bifunctional butanol/butyraldehyde dehydrogenase of C. ljungdahlii
FIG. 38 shows Seq. ID 68: Amino acid sequence of bifunctional butanol/butyraldehyde dehydrogenase of C. ljungdahlii
FIG. 39 shows Seq. ID 69: Nucleotide acid sequence of bifunctional butanol/butyraldehyde dehydrogenase of C. ljungdahlii
FIG. 40 shows Seq. ID 70: Amino acid sequence of bifunctional butanol/butyraldehyde dehydrogenase of C. ljungdahlii; and Seq. ID 71: Nucleotide acid sequence of butyraldehyde dehydrogenase of C. ljungdahlii.
FIG. 41 shows Seq. ID 72: Amino acid sequence of butyraldehyde dehydrogenase of C. ljungdahlii; and Seq. ID 73: Nucleotide acid sequence of butyraldehyde dehydrogenase of C. ljungdahlii; and Seq. ID 74: Amino acid sequence of butyraldehyde dehydrogenase of C. ljungdahlii.
FIG. 42 shows Seq. ID 75: Nucleotide acid sequence of butanol dehydrogenase of C. ljungdahlii; and Seq. ID 76: Amino acid sequence of butanol dehydrogenase of C. ljungdahlii; and Seq. ID 77: Nucleotide acid sequence of butanol dehydrogenase of C. ljungdahlii.
FIG. 43 shows Seq. ID 78: Amino acid sequence of butanol dehydrogenase of C. ljungdahlii; and Seq. ID 79: Nucleotide acid sequence of butanol dehydrogenase of C. ljungdahlii; and Seq. ID 80: Amino acid sequence of butanol dehydrogenase of C. ljungdahlii.
FIG. 44 shows Seq. ID 81: Nucleotide acid sequence of butanol dehydrogenase of C. ljungdahlii; and Seq. ID 82: Amino acid sequence of butanol dehydrogenase of C. ljungdahlii; and Seq. ID 83: Nucleotide acid sequence of butanol dehydrogenase of C. ljungdahlii.
FIG. 45 shows Seq. ID 84: Amino acid sequence of butanol dehydrogenase of C. ljungdahlii; and Seq. ID 85: Nucleotide sequence of phosphate acetyl/butyryl transferase from C. ljungdahlii; and Seq. ID 86: Amino acid sequence of phosphate acetyl/butyryl transferase from C. ljungdahlii; and Seq. ID 87: Nucleotide sequence of acetate/butyrate kinase from C. ljungdahlii.
FIG. 46 shows Seq. ID 88: Amino acid sequence of acetate/butyrate kinase from C. ljungdahlii; and Seq. ID 89: Nucleotide sequence of aldehyde:ferredoxin oxidoreductase from C. ljungdahlii; and Seq. ID 90: Amino acid sequence of aldehyde:ferredoxin oxidoreductase from C. ljungdahlii.
FIG. 47 shows Seq. ID 91: Nucleotide sequence of aldehyde:ferredoxin oxidoreductase from C. ljungdahlii; and Seq. ID 92: Amino acid sequence of aldehyde:ferredoxin oxidoreductase from C. ljungdahlii.
FIG. 48 shows Seq. ID 93: Nucleotide Acid sequence of bifunctional butanol/butyraldehyde dehydrogenase from C. ragsdalei
FIG. 49 shows Seq. ID 94: Amino Acid sequence of bifunctional butanol/butyraldehyde dehydrogenase from C. ragsdalei
FIG. 50 shows Seq. ID 95: Nucleotide Acid sequence of bifunctional butanol/butyraldehyde dehydrogenase from C. ragsdalei.
FIG. 51 shows Seq. ID 96: Amino Acid sequence of bifunctional butanol/butyraldehyde dehydrogenase from C. ragsdalei; and Seq. ID 97: Nucleotide Acid sequence of butyraldehyde dehydrogenase from C. ragsdalei.
FIG. 52 shows Seq. ID 98: Amino Acid sequence of butyraldehyde dehydrogenase from C. ragsdalei; Seq. ID 99: Nucleotide Acid sequence of butyraldehyde dehydrogenase from C. ragsdalei; and Seq. ID 100: Amino Acid sequence of butyraldehyde dehydrogenase from C. ragsdalei.
FIG. 53 shows Seq. ID 101: Nucleotide Acid sequence of butanol dehydrogenase from C. ragsdalei; and Seq. ID 102: Amino Acid sequence of butanol dehydrogenase from C. ragsdalei; and Seq. ID 103: Nucleotide Acid sequence of butanol dehydrogenase from C. ragsdalei.
FIG. 54 shows Seq. ID 104: Amino Acid sequence of butanol dehydrogenase from C. ragsdalei; and Seq. ID 105: Nucleotide Acid sequence of butanol dehydrogenase from C. ragsdalei; and Seq. ID 106: Amino Acid sequence of butanol dehydrogenase from C. ragsdalei:
FIG. 55 shows Seq. ID 107: Nucleotide Acid sequence of butanol dehydrogenase from C. ragsdalei; and Seq. ID 108: Amino Acid sequence of butanol dehydrogenase from C. ragsdalei; and Seq. ID 109: Nucleotide Acid sequence of butanol dehydrogenase from C. ragsdalei.
FIG. 56 shows Seq. ID 110: Amino Acid sequence of butanol dehydrogenase from C. ragsdalei; and Seq. ID 111: Nucleotide sequence of phosphate acetyl/butyryl transferase from C. ragsdalei; and Seq. ID 112: Amino acid sequence of phosphate acetyl/butyryl transferase from C. ragsdalei; and Seq. ID 113: Nucleotide sequence of acetate/butyrate kinase from C. ragsdalei.
FIG. 57 shows Seq. ID 114: Amino acid sequence of acetate/butyrate kinase from C. ragsdalei; and Seq. ID 115: Nucleotide sequence of aldehyde:ferredoxin oxidoreductase from C. ragsdalei; and Seq. ID 116: Amino acid sequence of aldehyde:ferredoxin oxidoreductase from C. ragsdalei.
FIG. 58 shows Seq. ID 117: Nucleotide sequence of aldehyde:ferredoxin oxidoreductase from C. ragsdalei; and Seq. ID 118: Amino acid sequence of aldehyde:ferredoxin oxidoreductase from C. ragsdalei.
The following is a description of the present invention, including preferred embodiments thereof, given in general terms. The invention is further elucidated from the disclosure given under the heading “Examples” herein below, which provides experimental data supporting the invention, specific examples of various aspects of the invention, and means of performing the invention.
Among others, the closely related microorganisms C. autoethanogenum, C. ljungdahlii, and C. ragsdalei are known to be useful for production of ethanol as biofuel from carbon monoxide. In order to produce 1-butanol as a biofuel from a gaseous substrate, a universal transformation system for these organisms has been developed and production of 1-butanol as the main fermentation product from CO has been demonstrated.
The inventors have found that when particular genes encoding proteins in the 1-butanol biosynthesis pathway (FIG. 1) were introduced into acetogenic microorganisms, such microorganisms were able to use a gaseous substrate to produce 1-butanol or a precursor thereof as the main fermentation product. Although some unmodified microorganisms are known to produce 1-butanol, the yield of 1-butanol from CO produced by such unmodified microorganisms is very low. As a result, their utility for production of biofuels from gaseous substrates is extremely limited due to their low efficiency and a subsequent lack of commercial viability. Clostridium autoethanogenum naturally produces ethanol, acetate, 2,3-butandiol and lactic acid but is not known to produce 1-butanol.
As shown in FIG. 1, the Wood-Ljungdahl pathway converts CO to acetyl-CoA. This compound may be further converted to 1-butanol in acetogenic microorganisms by the action of the enzymes thiolase, 3-hydroxybutyryl-CoA dehydrogenase, crotonase/crotonyl-CoA hydratase, butyryl-CoA dehydrogenase, butyraldehyde dehydrogenase and butanol dehydrogenase. In a particular embodiment of the invention, the microorganism expresses the first four enzymes which may be encoded by the nucleic acid SEQ_ID Nos 1 to 4 or functionally equivalent variants thereof. The present invention provides a microorganism that facilitates the conversion of acetyl-CoA to 1-butanol by the action of enzymes encoded by recombinant nucleic acids as well as naturally occurring enzymes. The invention also provides for the use of microorganisms expressing other recombinant nucleic acid sequences which encode enzymes at other stages in the Wood-Ljungdahl or butanol biosynthesis pathways. The inventors have also identified a number of novel enzymes and nucleic acids.
Since there is no natural competence (uptake of extracellular DNA from the cell's environment) known in Clostridia and electrotransformation or conjugation are the only methods available for transformation. These issues present significant difficulties in effectively transforming Clostridium species. Additionally, the restriction/methylation systems found in Clostridia protect against foreign and phage DNA and result in their genetic transformation being particularly troublesome. Transformation of several Clostridium strains (C. acetobutylicum ATCC824, C. cellulolyticum ATCC35319, C. botulinum ATCC25765, and C. difficile CD3 and CD6) was shown to be only possible if DNA is methylated in vivo in E. coli or methylated in vitro in a specific pattern prior to transformation (Mermelstein et al, 1993; Herbert et al, 2003; Jennert et al, 2000; Davis et al, 2000). However, the determination of the correct methylation pattern is often not possible due to unspecific exonucleases, etc. Additionally, many Clostridium species also possess restriction systems which digest DNA that is methylated at a specific (“wrong”) position.
The abovementioned major hurdles have been overcome by the inventors in developing the recombinant microorganisms of the present invention. A novel methylation system comprising a novel methyltransferase gene was developed to circumvent the naturally occurring restriction barriers present in native acetogenic microorganisms. Accordingly, the methylation method and methyltransferase gene of the present invention may be applied to a number of compatible microorganisms that have restriction barriers preventing effective introduction and expression of desirable recombinant nucleic acids in microorganisms.
As referred to herein, “precursors of 1-butanol” include butyryl CoA, butyryl-phosphate, butyrate, and butyraldehyde.
As referred to herein, a “fermentation broth” is a culture medium comprising at least a nutrient media and bacterial cells.
As referred to herein, a “shuttle microorganism” is a microorganism in which a methyltransferase enzyme is expressed and is distinct from the destination microorganism.
As referred to herein, a “destination microorganism” is a microorganism in which the genes included on the expression construct are expressed and is distinct from the shuttle microorganism.
As referred to herein, the term “main fermentation product” is intended to mean the one fermentation product which is produced in the highest concentration and/or yield.
The terms “increasing the efficiency”, “increased efficiency” and the like, when used in relation to a fermentation process, include, but are not limited to, increasing one or more of the rate of growth of microorganisms catalysing the fermentation, the volume of desired product (such as alcohols) produced per volume of substrate (such as sugar) consumed, the rate of production or level of production of the desired product, and the relative proportion of the desired product produced compared with other by-products of the fermentation.
The phrase “substrate comprising carbon monoxide” and like terms should be understood to include any substrate in which carbon monoxide is available to one or more strains of bacteria for growth and/or fermentation, for example.
The phrase “gaseous substrate comprising carbon monoxide” and like phrases and terms includes any gas which contains a level of carbon monoxide. In certain embodiments the substrate contains at least about 20% to about 100% CO by volume, from 20% to 70% CO by volume, from 30% to 60% CO by volume, and from 40% to 55% CO by volume. In particular embodiments, the substrate comprises about 25%, or about 30%, or about 35%, or about 40%, or about 45%, or about 50% CO, or about 55% CO, or about 60% CO by volume.
While it is not necessary for the substrate to contain any hydrogen, the presence of H2 should not be detrimental to product formation in accordance with methods of the invention. In particular embodiments, the presence of hydrogen results in an improved overall efficiency of alcohol production. For example, in particular embodiments, the substrate may comprise an approx 2:1, or 1:1, or 1:2 ratio of H2:CO. In one embodiment the substrate comprises about 30% or less H2 by volume, 20% or less H2 by volume, about 15% or less H2 by volume or about 10% or less H2 by volume. In other embodiments, the substrate stream comprises low concentrations of H2, for example, less than 5%, or less than 4%, or less than 3%, or less than 2%, or less than 1%, or is substantially hydrogen free. The substrate may also contain some CO2 for example, such as about 1% to about 80% CO2 by volume, or 1% to about 30% CO2 by volume. In one embodiment the substrate comprises less than or equal to about 20% CO2 by volume. In particular embodiments the substrate comprises less than or equal to about 15% CO2 by volume, less than or equal to about 10% CO2 by volume, less than or equal to about 5% CO2 by volume or substantially no CO2.
In the description which follows, embodiments of the invention are described in terms of delivering and fermenting a “gaseous substrate containing CO”. However, it should be appreciated that the gaseous substrate may be provided in alternative forms. For example, the gaseous substrate containing CO may be provided dissolved in a liquid. Essentially, a liquid is saturated with a carbon monoxide containing gas and then that liquid is added to the bioreactor. This may be achieved using standard methodology. By way of example, a microbubble dispersion generator (Hensirisak et. al. Scale-up of microbubble dispersion generator for aerobic fermentation; Applied Biochemistry and Biotechnology Volume 101, Number 3/October, 2002) could be used. By way of further example, the gaseous substrate containing CO may be adsorbed onto a solid support. Such alternative methods are encompassed by use of the term “substrate containing CO” and the like.
In particular embodiments of the invention, the CO-containing gaseous substrate is an industrial off or waste gas. “Industrial waste or off gases” should be taken broadly to include any gases comprising CO produced by an industrial process and include gases produced as a result of ferrous metal products manufacturing, non-ferrous products manufacturing, petroleum refining processes, gasification of coal, gasification of biomass, electric power production, carbon black production, and coke manufacturing. Further examples may be provided elsewhere herein.
Unless the context requires otherwise, the phrases “fermenting”, “fermentation process” or “fermentation reaction” and the like, as used herein, are intended to encompass both the growth phase and product biosynthesis phase of the process. As will be described further herein, in some embodiments the bioreactor may comprise a first growth reactor and a second fermentation reactor. As such, the addition of metals or compositions to a fermentation reaction should be understood to include addition to either or both of these reactors.
The term “bioreactor” includes a fermentation device consisting of one or more vessels and/or towers or piping arrangement, which includes the Continuous Stirred Tank Reactor (CSTR), Immobilized Cell Reactor (ICR), Trickle Bed Reactor (TBR), Bubble Column, Gas Lift Fermenter, Static Mixer, or other vessel or other device suitable for gas-liquid contact. As is described herein after, in some embodiments the bioreactor may comprise a first growth reactor and a second fermentation reactor. As such, when referring to the addition of substrate to the bioreactor or fermentation reaction it should be understood to include addition to either or both of these reactors where appropriate.
“Exogenous nucleic acids” are nucleic acids which originate outside of the microorganism to which they are introduced. Exogenous nucleic acids may be derived from any appropriate source, including, but not limited to, the microorganism to which they are to be introduced, strains or species of microorganisms which differ from the organism to which they are to be introduced, or they may be artificially or recombinantly created. In one embodiment, the exogenous nucleic acids represent nucleic acid sequences naturally present within the microorganism to which they are to be introduced, and they are introduced to increase expression of or over-express a particular gene (for example, by increasing the copy number of the sequence (for example a gene)). In another embodiment, the exogenous nucleic acids represent nucleic acid sequences not naturally present within the microorganism to which they are to be introduced and allow for the expression of a product not naturally present within the microorganism or increased expression of a gene native to the microorganism (for example in the case of introduction of a regulatory element such as a promoter). The exogenous nucleic acid may be adapted to integrate into the genome of the microorganism to which it is to be introduced or to remain in an extra-chromosomal state.
It should be appreciated that the invention may be practised using nucleic acids whose sequence varies from the sequences specifically exemplified herein provided they perform substantially the same function. For nucleic acid sequences that encode a protein or peptide this means that the encoded protein or peptide has substantially the same function. For nucleic acid sequences that represent promoter sequences, the variant sequence will have the ability to promote expression of one or more genes. Such nucleic acids may be referred to herein as “functionally equivalent variants”. By way of example, functionally equivalent variants of a nucleic acid include allelic variants, fragments of a gene, genes which include mutations (deletion, insertion, nucleotide substitutions and the like) and/or polymorphisms and the like. Homologous genes from other bacteria capable of butyric acid or butanol fermentation may also be considered as examples of functionally equivalent variants of the sequences specifically exemplified herein. These include homologous genes in species such as Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium tetani, Clostridium pasteurianum, Clostridium kluyveri, Clostridium cellulovorans, Clostridium perfringens, Clostridium botulinum, Clostridium butyricum strain DSM10702, Clostridium tyrobutyricum strain ATCC 25755, Anaerococcus prevotii DSM 20548, Thermoanaerobacter tengcongensis, Brachyspira pilosicoli, Bacillus megaterium, Streptococcus pyogenes and Clostridium saccharoperbutylacetonicum details of which are publicly available on websites such as Genbank or NCBI. The phrase “functionally equivalent variants” should also be taken to include nucleic acids whose sequence varies as a result of codon optimisation for a particular organism. “Functionally equivalent variants” of a nucleic acid herein will preferably have at least approximately 70%, preferably approximately 80%, more preferably approximately 85%, preferably approximately 90%, preferably approximately 95% or greater nucleic acid sequence identity with the nucleic acid identified. In a particular embodiment, the functionally equivalent variant of the thiolase gene as defined herein may be the atoAB gene in E. coli (NC—000913.2; atoA=GeneID: 946719; atoB=GeneID: 946727). Functionally equivalent variants of the eftAB gene as defined herein may be found in Tsai and Saier (1995).
It should also be appreciated that the invention may be practised using polypeptides whose sequence varies from the amino acid sequences specifically exemplified herein. These variants may be referred to herein as “functionally equivalent variants”. A functionally equivalent variant of a protein or a peptide includes those proteins or peptides that share at least 40%, preferably 50%, preferably 60%, preferably 70%, preferably 75%, preferably 80%, preferably 85%, preferably 90%, preferably 95% or greater amino acid identity with the protein or peptide identified and has substantially the same function as the peptide or protein of interest. Such variants include within their scope fragments of a protein or peptide wherein the fragment comprises a truncated form of the polypeptide wherein deletions may be from Ito 5, to 10, to 15, to 20, to 25 amino acids, and may extend from residue 1 through 25 at either terminus of the polypeptide, and wherein deletions may be of any length within the region; or may be at an internal location. Functionally equivalent variants of the specific polypeptides herein should also be taken to include polypeptides expressed by homologous genes in other species of bacteria, for example as exemplified in the previous paragraph.
“Substantially the same function” as used herein is intended to mean that the nucleic acid or polypeptide is able to perform the function of the nucleic acid or polypeptide of which it is a variant. For example, a variant of an enzyme of the invention will be able to catalyse the same reaction as that enzyme. However, it should not be taken to mean that the variant has the same level of activity as the polypeptide or nucleic acid of which it is a variant.
One may assess whether a functionally equivalent variant has substantially the same function as the nucleic acid or polypeptide of which it is a variant using any number of known methods. However, by way of example, the methods outlined in Inui et al (2008) may be used to assess enzyme activity.
“Over-express”, “over expression” and like terms and phrases when used in relation to the invention should be taken broadly to include any increase in expression of one or more protein as compared to the expression level of the protein of a parental microorganism under the same conditions. It should not be taken to mean that the protein is expressed at any particular level.
A “parental microorganism” is a microorganism used to generate a recombinant microorganism of the invention. The parental microorganism may be one that occurs in nature (ie a wild type microorganism) or one that has been previously modified but which does not express or over-express one or more of the enzymes the subject of the present invention. Accordingly, the recombinant microorganisms of the invention have been modified to express or over-express one or more enzymes that were not expressed or over-expressed in the parental microorganism.
The terms nucleic acid “constructs” or “vectors” and like terms should be taken broadly to include any nucleic acid (including DNA and RNA) suitable for use as a vehicle to transfer genetic material into a cell. The terms should be taken to include plasmids, viruses (including bacteriophage), cosmids and artificial chromosomes. Constructs or vectors may include one or more regulatory elements, an origin of replication, a multicloning site and/or a selectable marker, among other elements, sites and markers. In one particular embodiment, the constructs or vectors are adapted to allow expression of one or more genes encoded by the construct or vector. Nucleic acid constructs or vectors include naked nucleic acids as well as nucleic acids formulated with one or more agents to facilitate delivery to a cell (for example, liposome-conjugated nucleic acid, an organism in which the nucleic acid is contained).
It should be appreciated that nucleic acids of the invention may be in any appropriate form, including RNA, DNA, or cDNA, including double-stranded and single-stranded nucleic acids.
In one aspect the invention provides genetically modified microorganisms capable of using CO to produce 1-butanol and/or a precursor thereof as the main fermentation product. The microorganism is preferably an acetogenic recombinant microorganism which produces 1-butanol and/or a precursor thereof as the main fermentation product. In one particular embodiment, the acetogenic recombinant microorganism is capable of producing 1-butanol or a precursor thereof by fermentation from a substrate comprising CO at a concentration of greater than approximately 1 mM or 0.075 g/l of butanol per litre of fermentation broth.
In one particular embodiment, the microorganism comprises one or more exogenous nucleic acid adapted to express or over-express one or more enzymes in the butanol biosynthesis pathway. In one embodiment, the microorganism is adapted to express one or more enzyme in the butanol biosynthesis pathway which is not naturally present in the parental microorganism from which it is derived, or to over-express one or more enzyme in the butanol biosynthesis pathway which are naturally present in the parental microorganism.
The microorganism may be adapted to express or over-express the one or more enzymes by any number of recombinant methods including, for example, increasing expression of native genes within the microorganism (for example, by introducing a stronger or constitutive promoter to drive expression of a gene), increasing the copy number of a gene encoding a particular enzyme by introducing exogenous nucleic acids encoding and adapted to express the enzyme, introducing an exogenous nucleic acid encoding and adapted to express an enzyme not naturally present within the parental microorganism.
In certain embodiments, the parental microorganism may be transformed to provide a combination of increased or over-expression of one or more genes native to the parental microorganism and introduction of one or more genes not native to the parental microorganism.
Preferably, the microorganism comprises one or more exogenous nucleic acids encoding one or more of the enzymes chosen from the group consisting: Thiolase; 3-hydroxybutyryl-CoA dehydrogenase; Crotonase/crotonyl-CoA hydratase; Butyryl-CoA dehydrogenase; Electron Transfer Flavoprotein A; and, Electron Transfer Flavoprotein B. In one embodiment, the one or more nucleic acids encoding the one or more enzymes is chosen from the nucleic acids SEQ ID NO. 1 to SEQ ID NO. 6 or functionally equivalent variants thereof.
In one embodiment the recombinant microorganism is adapted to express one or more of the genes which encode the enzymes thiolase (IUBMB enzyme nomenclature EC:2.3.1.9) (thlA), 3-hydroxybutyryl-CoA dehydrogenase (EC:1.1.1.157) (hbd), crotonase/crotonyl-CoA hydratase (EC:1.1.1.157) (crt or cch) and/or butyryl-CoA dehydrogenase (EC4.2.1.55) (bcd). In one embodiment, the microorganism is adapted to express all of these enzymes. In a further embodiment, the genes correspond to one or more of the nucleic acid sequences selected from SEQ_ID Nos 1 to 4 or functionally equivalent variants thereof. The recombinant microorganism of the invention may also contain two electron transferring proteins. In one embodiment, the electron transferring proteins are electron transferring flavoproteins (EC1.3.99.2) (etfAB) encoded by SEQ_ID Nos 5 and 6, or functionally equivalent variants thereof. The use of these electron-transferring flavoproteins enhances the efficiency of the microorganism in producing 1-butanol. The flavoproteins provide a stable complex that is required for the activity of Bcd.
In one particular embodiment, the microorganism comprises one or more exogenous nucleic acids encoding each of Thiolase, 3-hydroxybutyryl-CoA dehydrogenase, Crotonase, Butyryl-CoA dehydrogenase, Electron Transfer Flavoprotein A and Electron Transfer Flavoprotein B.
In one embodiment, the microorganism comprises a plasmid encoding one or more of, or preferably each of, Thiolase, 3-hydroxybutyryl-CoA dehydrogenase, Crotonase, Butyryl-CoA dehydrogenase, Electron Transfer Flavoprotein A and Electron Transfer Flavoprotein B.
In one embodiment, the microorganism alternatively or further comprises exogenous nucleic acids adapted to express one or more of the enzymes chosen from the group consisting of: Phosphotransbutyrylase; butyrate kinase; ferredoxin dependent aldehyde oxidoreductase (or in other words aledhyde:ferredoxin oxidoreductase); butyraldehyde dehydrogenase; butanol dehydrogenase; a bifunctional butyraldehyde dehydrogenase/butanol dehydrogenase.
In one embodiment, the microorganism comprises exogenous nucleic acids adapted to express one or more of butyraldehyde dehydrogenase, butanol dehydrogenase and a bifunctional butyraldehyde dehydrogenase/butanol dehydrogenase. Preferably, the microorganism comprises one or more exogenous nucleic acids encoding one or more of butyraldehyde dehydrogenase, butanol dehydrogenase and a bifunctional butyraldehyde dehydrogenase/butanol dehydrogenase.
In one embodiment, the microorganism comprises exogenous nucleic acids adapted to express one or more of Phosphotransbutyrylase, butyrate kinase, ferredoxin dependent aldehyde oxidoreductase, and butanol dehydrogenase. Preferably, the microorganism comprises one or more exogenous nucleic acids encoding one or more of Phosphotransbutyrylase, butyrate kinase, ferredoxin dependent aldehyde oxidoreductase, and butanol dehydrogenase. In particular embodiments, the microorganism comprises exogenous nucleic acids adapted to express each of Phosphotransbutyrylase, butyrate kinase, ferredoxin dependent aldehyde oxidoreductase, and butanol dehydrogenase.
In one embodiment, the microorganism comprises one or more nucleic acid adapted to express at least two of the enzymes in the 1-butanol biosynthesis pathway, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, or at least 12 of the enzymes.
In one embodiment, the microorganism further comprises an exogenous phosphotransacetylase/acetate kinase promoter, although other promoters may be used. Preferably, the promoter corresponds to SEQ_ID No. 7 or a functionally equivalent variant thereof. Preferably, the promoter is contained on a construct encoding one or more of the enzymes referred to herein before.
Preferably, the parental microorganism is selected from the group of acetogenic bacteria. In certain embodiments the microorganism is selected from the group comprising Clostridium autoethanogenum, Clostridium ljungdahlii Clostridium ragsdalei, Clostridium carboxidivorans, Clostridium drakei, Clostridium scatalogenes, Clostridium aceticum, Clostridium formicoaceticum, Butyribacterium limosum, Acetobacterium woodii, Blautia producta, Eubacterium limosum, Moorella thermoacetica, Moorella thermautotrophica, Oxobacter pfennigii, and Thermoanaerobacter kiuvi.
In one particular embodiment, the parental microorganism is selected from the cluster of ethanologenic, acetogenic Clostridia comprising the species C. autoethanogenum, C. ljungdahlii, and C. ragsdalei and related isolates. These include but are not limited to strains C. autoethanogenum JAI-1T (DSM10061) [Abrini J, Naveau H, Nyns E-J: Clostridium autoethanogenum, sp. nov., an anaerobic bacterium that produces ethanol from carbon monoxide. Arch Microbiol 1994, 4: 345-351], C. autoethanogenum LBS1560 (DSM19630) [Simpson S D, Forster R L, Tran P T, Rowe M J, Warner I L: Novel bacteria and methods thereof. International patent 2009, WO/2009/064200], C. autoethanogenum LB S1561 (DSM23693), C. ljungdahlii PETCT (DSM13528=ATCC 55383) [Tanner R S, Miller L M, Yang D: Clostridium ljungdahlii sp. nov., an Acetogenic Species in Clostridial rRNA Homology Group I. Int J Syst Bacteriol 1993, 43: 232-236], C. ljungdahlii ERI-2 (ATCC 55380) [Gaddy J L: Clostridium stain which produces acetic acid from waste gases. 1997, U.S. Pat. No. 5,593,886], C. ljungdahlii C-01 (ATCC 55988) [Gaddy J L, Clausen E C, Ko C-W: Microbial process for the preparation of acetic acid as well as solvent for its extraction from the fermentation broth. 2002, U.S. Pat. No. 6,368,819], C. ljungdahlii O-52 (ATCC 55989) [Gaddy J L, Clausen E C, Ko C-W: Microbial process for the preparation of acetic acid as well as solvent for its extraction from the fermentation broth. 2002, U.S. Pat. No. 6,368,819], C. ragsdalei P11T (ATCC BAA-622) [Huhnke R L, Lewis R S, Tanner R S: Isolation and Characterization of novel Clostridial Species. International patent 2008, WO 2008/028055], related isolates such as “C. coskatii” [Zahn J A, Saxena J, Do Y, Patel M, Fishein S, Datta R, Tobey R: Clostridium coskatii, sp. nov., an Anaerobic Bacterium that Produces Ethanol from Synthesis Gas. Poster SIM Annual Meeting and Exhibition, San Francisco, 2010], or mutated strains such as C. ljungdahlii OTA-1 (Tirado-Acevedo O. Production of Bioethanol from Synthesis Gas Using Clostridium ljungdahlii. PhD thesis, North Carolina State University, 2010). These strains form a subcluster within the Clostridial rRNA cluster I, and their 16S rRNA gene is more than 99% identical with a similar low GC content of around 30%. However, DNA-DNA reassociation and DNA fingerprinting experiments showed that these strains belong to distinct species [Huhnke R L, Lewis R S, Tanner R S: Isolation and Characterization of novel Clostridial Species. International patent 2008, WO 2008/028055].
All species of this cluster have a similar morphology and size (logarithmic growing cells are between 0.5-0.7×3-5 are mesophilic (optimal growth temperature between 30-37° C.) and strictly anaerobe [Tanner R S, Miller L M, Yang D: Clostridium ljungdahlii sp. nov., an Acetogenic Species in Clostridial rRNA Homology Group I. Int J Syst Bacteriol 1993, 43: 232-236; Abrini J, Naveau H, Nyns E-J: Clostridium autoethanogenum, sp. nov., an anaerobic bacterium that produces ethanol from carbon monoxide. Arch Microbiol 1994, 4: 345-351; Huhnke R L, Lewis R S, Tanner R S: Isolation and Characterization of novel Clostridial Species. International patent 2008, WO 2008/028055]. Moreover, they all share the same major phylogenetic traits, such as same pH range (pH 4-7.5, with an optimal initial pH of 5.5-6), strong autotrophic growth on CO containing gases with similar growth rates, and a similar metabolic profile with ethanol and acetic acid as main fermentation end product, and small amounts of 2,3-butanediol and lactic acid formed under certain conditions. [Tanner R S, Miller L M, Yang D: Clostridium ljungdahlii sp. nov., an Acetogenic Species in Clostridial rRNA Homology Group I. Int J Syst Bacteriol 1993, 43: 232-236; Abrini J, Naveau H, Nyns E-J: Clostridium autoethanogenum, sp. nov., an anaerobic bacterium that produces ethanol from carbon monoxide. Arch Microbiol 1994, 4: 345-351; Huhnke R L, Lewis R S, Tanner R S: Isolation and Characterization of novel Clostridial Species. International patent 2008, WO 2008/028055]. Indole production was observed with all three species as well. However, the species differentiate in substrate utilization of various sugars (e.g. rhamnose, arabinose), acids (e.g. gluconate, citrate), amino acids (e.g. arginine, histidine), or other substrates (e.g. betaine, butanol). Moreover some of the species were found to be auxotroph to certain vitamins (e.g. thiamine, biotin) while others were not.
In one embodiment, the microorganism produces phosphotransbutyrylase, butyrate kinase, ferredoxin dependent aldehyde oxidoreductase, and butanol dehydrogenase both before and after introduction of an exogenous nucleic acid.
In one embodiment, the microorganism produces butyraldehyde dehydrogenase and/or butanol dehydrogenase both before and after introduction of an exogenous nucleic acid.
In one particular embodiment, the microorganism is Clostridium autoethanogenum DSM23693.
In one embodiment, the recombinant microorganism of the invention has the defining characteristics of the microorganism deposited at the DSMZ (Deutsche Sammlung für Mikroorganismen and Zellkulturen GmbH, Braunschweig, Germany) under the accession number DSM24138.
The one or more exogenous nucleic acids may be delivered to a parental microorganism as naked nucleic acids or may be formulated with one or more agents to facilitate the tranformation process (for example, liposome-conjugated nucleic acid, an organism in which the nucleic acid is contained). The one or more nucleic acids may be DNA, RNA, or combinations thereof, as is appropriate.
The microorganisms of the invention may be prepared from a parental microorganism and one or more exogenous nucleic acids using any number of techniques known in the art for producing recombinant microorganisms. By way of example only, transformation (including transduction or transfection) may be achieved by electroporation, conjugation, or chemical and natural competence. Suitable transformation techniques are described for example in Sambrook et al, 1989.
In certain embodiments, due to the restriction systems which are active in the microorganism to be transformed, it is necessary to methylate the nucleic acid to be introduced into the microorganism. This can be done using a variety of techniques, including those described below, and further exemplified in the Examples section herein after.
In another aspect, the invention provides a method of producing a recombinant microorganism comprising the following steps:
a. introduction into a shuttle microorganism of (i) an expression construct and (ii) a methylation construct comprising a methyltransferase gene;
b. expression of the methyltransferase gene;
c. isolation of one or more constructs from the shuttle microorganism; and,
d. introduction of the one or more constructs into a destination microorganism;
wherein the expression construct comprises one or more genes encoding enzymes to be expressed in the destination organism.
In one embodiment, the methyltransferase gene of step B is expressed constitutively. In another embodiment, expression of the methyltransferase gene of step B is induced.
The shuttle microorganism is a microorganism, preferably a restriction negative microorganism, that facilitates the methylation of the nucleic acid sequences that make up the expression construct. In a particular embodiment, the shuttle microorganism is a restriction negative E. coli or Bacillus subtillis.
Once the expression construct and the methylation construct are introduced into the shuttle microorganism, the methyltransferase gene present on the methylation construct is expressed. In one embodiment, where expression must be induced, induction may be by any suitable promoter system although in one particular embodiment of the invention, the methylation construct comprises an inducible lac promoter (preferably encoded by SEQ_ID NO 28) and is induced by addition of lactose or an analogue thereof, more preferably isopropyl-β-D-thio-galactoside (IPTG). Other suitable promoters include the ara, tet, or T7 system. In an alternative embodiment of the invention, the methylation construct promoter is a constitutive promoter.
In one embodiment the expression construct promoter is a constitutive promoter that is preferably highly active under appropriate fermentation conditions. However, an inducible promoter could be used. In preferred embodiments, the expression construct promoter is selected from the group comprising phosphotransacetylase/acetate kinase operon promoter, pyruvate:ferredoxin oxidoreductase (SEQ_ID No. 48), the Wood-Ljungdahl gene cluster (SEQ_ID No 47), Rnf operon (SEQ_ID No 49) or the ATP synthase operon ((SEQ_ID No 50). Preferably, the phosphotransacetylase/acetate kinase operon promoter corresponds to SEQ_ID No. 7 or a functionally equivalent variant thereof FIG. 8 shows that expression of genes operably linked to these promoters have a high level of expression in Clostridium autoethanogenum under standard conditions.
In a particular embodiment, the methylation construct has an origin of replication specific to the identity of the shuttle microorganism so that any genes present on the methylation construct are expressed in the shuttle microorganism. Preferably, the expression construct has an origin of replication specific to the identity of the destination microorganism so that any genes present on the expression construct are expressed in the destination microorganism.
Expression of the methyltransferase enzyme results in methylation of the genes present on the expression construct. The expression construct may then be isolated from the shuttle microorganism according to any one of a number of known methods. By way of example only, the methodology described in the Examples section described hereinafter may be used to isolate the expression construct.
In one particular embodiment, both constructs are concurrently isolated. The expression construct may be introduced into the destination microorganism using any number of known methods. However, by way of example, the methodology described in the Examples section hereinafter may be used. Since the expression construct is methylated, the nucleic acid sequences present on the expression construct are able to be incorporated into the destination microorganism and successfully expressed.
In a further embodiment, the invention provides a method of producing a recombinant microorganism comprising:
It is envisaged that a methyltransferase gene of the invention, preferably according to SEQ_ID No 27 or a functionally equivalent variant thereof, may be introduced into a shuttle microorganism and over-expressed. The resulting methyltransferase enzyme may be collected using known methods and used in vitro to methylate an expression construct, preferably, the expression construct is as defined in the fifth aspect. The expression construct may then be introduced into the destination microorganism for expression. Preferably, the recombinant microorganism produces 1-butanol and/or a precursor thereof as the main fermentation product.
In a further embodiment, the invention provides a method of producing a recombinant microorganism comprising:
Standard methods are used for the introduction of a methyltransferase gene, preferably according to SEQ_ID No 27, into the genome of the shuttle microorganism. The methyltransferase may be constitutively expressed by the microorganism and result in the production of a methyltransferase enzyme, preferably according to SEQ_ID No 28 or a functionally equivalent variant thereof. An expression construct is methylated, isolated and introduced into the destination microorganism which preferably, produces 1-butanol and/or a precursor thereof as the main fermentation product.
The invention also includes microorganisms comprising a recombinant methyltransferase gene or methylation construct as herein described.
The present invention also provides a hybrid methyltransferase gene (SEQ_ID NO 28) developed following analysis of methyltransferase nucleic acid sequences and restriction barrier systems from C. autoethanogenum, C. ljungdahlii, and C. ragsdalei.
The methyltransferase gene is expressed in a shuttle microorganism which results in the production of a methyltransferase enzyme which methylates the sequence of the expression construct. The methyltransferase gene may be present on a construct or integrated into the genome of the shuttle microorganism. The hybrid methyltransferase gene is codon optimised for E. coli and may be incorporated into a methylation construct (FIG. 5). The methyltransferase gene may be codon optimised for use in another species of microorganism where appropriate, for example Bacillus subtillus. Methods for codon optimisation are standard and would be known to one of skill in the art (Carbone et al, 2003). Also incorporated within the scope of the invention are methyltransferase genes that have at least 70%, preferably 75%, preferably 80%, preferably 85%, preferably 90%, preferably 95% or greater nucleic acid sequence identity to SEQ_ID NO 28 and express a polypeptide which is able to methylate DNA.
It will be appreciated by one of skill in the art that the methylation method and methyltransferase gene will have utility across a range of microorganisms. In one embodiment, the destination microorganism is selected from the group comprising Clostridium autoethanogenum, Clostridium ljungdahlii and Clostridium ragsdalei, Clostridium carboxidivorans, Clostridium drakei, Clostridium scatalogenes, Clostridium aceticum, Clostridium formicoaceticum, Butyribacterium limosum, Acetobacterium woodii, Blautia producta, Eubacterium limosum, Moorella thermoacetica, Moorella thermautotrophica, Oxobacter pfennigii, and Thermoanaerobacter kiuvi. In one particular embodiment, the destination microorganism is selected from the group consisting Clostridium autoethanogenum, Clostridium ljungdahlii and Clostridium ragsdalei. In one particular embodiment the destination microorganism is Clostridium autoethanogenum DSM23693.
The invention also provides various nucleic acids or nucleic acid constructs as outlined in aspects 4, 5, 14, 15, 16, 18, 19 and 21 of the invention herein before described.
In another embodiment of the invention, there is an expression construct comprising one or more nucleic acids encoding one or more enzymes chosen from Thiolase, 3-hydroxybutyryl-CoA dehydrogenase, Crotonase, Butyryl-CoA dehydrogenase and an electron transfer protein or a functionally equivalent variant thereof. Preferably, the electron transfer protein is Electron Transfer Flavoprotein A or Electron Transfer Flavoprotein B. In a particular embodiment, both Electron Transfer Flavoprotein A and Electron Transfer Flavoprotein B are included on the expression construct.
Exemplary sequence information for each gene and equivalent enzyme is provided on GenBank as detailed in Table 1 herein after. Skilled persons will readily appreciate alternative genes and enzymes which may be used. In one embodiment, the enzymes are encoded by the nucleic acid SEQ_ID No 1 to 6 which may be present in any order on the construct or in the order shown in FIG. 2. SEQ_ID Nos 8 to 13 and SEQ_ID Nos 16 to 23 are novel sequences used to clone and sequence the genes referred to in the immediately preceding paragraph.
In order to obtain 1-butanol from a precursor the activity of one or more of butyraldehyde dehydrogenase (EC1.2.1.10), alcohol dehydrogenase (EC 1.1.1.1), phosphotransbutyrylase (EC 2.3.1.19), butyrate kinase (EC 2.7.2.7), aldehyde:ferredoxin oxidoreductase (EC1.2.7.5) and alcohol dehydrogenase (EC 1.1.1.1) may be required. The alcohol dehydrogenase of the invention is a butanol dehydrogenase. In certain embodiments, butyraldehyde dehydrogenase (EC1.2.1.10) and alcohol dehydrogenase (EC 1.1.1.1), or phosphotransbutyrylase (EC 2.3.1.19), butyrate kinase (EC 2.7.2.7), aldehyde:ferredoxin oxidoreductase (EC1.2.7.5) and alcohol dehydrogenase (EC 1.1.1.1), or a combination of both sets of enzymes is required. In one embodiment, the butyraldehyde dehydrogenase and butanol dehydrogenase activity is supplied by a bifunctional butyraldehyde dehydrogenase/butanol dehydrogenase. These various enzymes are shown in the butanol biosynthesis pathway depicted in FIG. 1. In some microorganisms butyraldehyde dehydrogenase, butanol dehydrogenase, phosphotransbutyrylase, butyrate kinase, and/or aldehyde:ferredoxin oxidoreductase are naturally expressed by the microorganism and therefore catalyse the conversion of butyryl-CoA to 1-butanol.
Accordingly, in one embodiment, the expression construct comprises nucleic acids encoding one or more of phosphotransbutyrylase, butyrate kinase, ferredoxin dependent aldehyde oxidoreductase, butyraldehyde dehydrogenase, butanol dehydrogenase, and a bifunctional butyraldehyde dehydrogenase/butanol dehydrogenase in addition to or in the alternative to one or more of Thiolase, 3-hydroxybutyryl-CoA dehydrogenase, Crotonase, Butyryl-CoA dehydrogenase and an electron transfer protein.
Examples of appropriate enzymes and amino acid and nucleic acid sequence information include, but are not limited to: butyraldehyde dehydrogenase, such as Ald from C. beijerinckii (ABR35947, GI:149905114), C. saccharobutylicum (CAQ57983, GI:189310620), or Clostridium saccharoperbutylacetonium (AAP42563, GI:31075383); butanol dehydrogenase, such as BdhB from C. acetobutylicum (NP—349891, GI:15896542); bifunctional butyraldehyde/butanol dehydrogenase enzyme, such as AdhE1 from C. acetobutylicum (NP—149325, GI:15004865) or AdhE2 from C. acetobutylicum (NP—149199, GI:15004739), C. beijerinckii. YP—001307449, GI:150015195); a phosphotransbutyrylase such as Ptb from C. acetobutylicum (NP—348368); butyrate kinase such as Buk from C. acetobutylicum (AAK81015.1); aldehyde:ferredoxin oxidoreductase AOR from C. acetobutylicum (NP—348637). Persons of ordinary skill in the art to which the invention relates may readily appreciate alternative examples of appropriate enzymes of use in the invention. The inventors have also identified a number of novel enzymes and genes which may be used in the invention, the details of which are provided herein after in the Examples section (in particular see tables 7 to 10). The invention also encompasses functionally equivalent variants of these enzymes and genes and their use in methods of the invention.
The inclusion of one or more of these genes may help avoid co-production of butyrate completely, increasing the efficiency of 1-butanol production. The invention also provides recombinant microorganisms comprising one or more nucleic acids adapted to express or increase expression of one or more of these enzymes.
In one embodiment, the nucleic acid(s) encode an enzyme chosen from the group of enzymes listed in tables 7 to 10 herein after and functional equivalents of any one or more thereof. In a particular embodiment, the nucleic acids are chosen from the group of nucleic acids listed in tables 7 to 10 herein after and functional equivalents of any one or more thereof.
In one embodiment, the expression construct encodes at least 2 enzymes in the butanol biosynthesis pathway, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 or at least 12 of the enzymes.
Preferably, the expression construct further comprises a suitable promoter as hereinbefore described. In one embodiment the promoter is a phosphotransacetylase/acetate kinase promoter. Preferably, the promoter corresponds to SEQ_ID No. 7 or a functionally equivalent variant thereof.
In a preferred embodiment, the expression construct comprises a nucleic acid encoding all of said enzymes. It will be appreciated by one of skill in the art that the expression construct may comprise nucleic acids encoding alternative electron transferring proteins.
The genes to be expressed in the recombinant microorganism may be assembled in the expression construct under the control of any appropriate promoter. In a particular embodiment, the promoter allows for substantially constitutive expression of the genes under its control. In a particular embodiment, the promoter is a phosphotransacetylase/acetate kinase (SEQ_ID NO 7) promoter. Other promoters which may find use in the invention include those from C. autoethanogenum (or C. ljungdahlii). The inventors have also identified a number of other promoters that are operably linked to genes that were highly expressed under typical fermentation conditions in Clostridium autoethanogenum (FIG. 8). Analysis of expression of over 200 genes during typical fermentation conditions using real-time PCR identified a number of appropriate promoters. These include pyruvate:ferredoxin oxidoreductase (SEQ_ID No. 48), the Wood-Ljungdahl gene cluster (SEQ_ID No 47), Rnf operon (SEQ_ID No 49) and the ATP synthase operon (SEQ_ID No 50). It will be appreciated by those of skill in the art that other promoters which can direct expression, preferably a high level of expression under appropriate fermentation conditions, would be effective as alternatives to the presently preferred embodiments.
In one embodiment, the invention comprises a construct, recombinant microorganism or a nucleic acid sequence comprising nucleic acid SEQ_ID NOs 1 to 6 in the order shown in FIG. 2. However, it will be appreciated by one of skill in the art that the invention may still have the desired utility when the nucleic acid sequences are presented in any order and with one or more of the sequences absent.
In another embodiment, the invention comprises a nucleic acid comprising the promoter sequence represented by Seq ID No. 7, or a functionally equivalent variant thereof, construct comprising said promoter and recombinant microorganisms comprising same.
It will be appreciated that an expression construct of the present invention may contain any number of regulatory elements in addition to the promoter as well as additional genes suitable for expression of further proteins if desired. In one embodiment the construct includes one promoter. In another embodiment, the construct includes two or more promoters. In one particular embodiment, the construct includes one promoter for with each gene to be expressed. In one embodiment, the construct includes one or more ribosomal binding sites, preferably a ribosomal binding site for each gene to be expressed.
It will be appreciated by those of skill in the art that the nucleic acid sequences and construct sequences defined herein may contain standard linker nucleotides such as those required for ribosome binding sites and/or restriction sites. Such linker sequences should not be interpreted as being required and do not provide a limitation on the sequences defined.
When the expression construct of the invention is expressed in an acetogenic microorganism, the microorganism produces 1-butanol or a precursor thereof as the main fermentation product. It is envisaged that other genes which encode enzymes catalyzing different steps of the Wood-Ljungdahl or butanol biosynthesis pathways may also be incorporated in the expression construct in order to produce 1-butanol as the main fermentation product.
It is envisaged that the expression construct and the methylation construct as defined above may be combined to provide a composition of matter. Such a composition has particular utility in circumventing restriction barrier mechanisms in a wide variety of microorganisms but in a preferred embodiment, the recombinant microorganism produced by use of the composition produces 1-butanol or a precursor thereof as the main fermentation product.
Nucleic acids and nucleic acid constructs, including expression constructs of the invention, may be constructed using any number of techniques standard in the art. For example, chemical synthesis or recombinant techniques may be used. Such techniques are described, for example, in Sambrook et al (1989). Further exemplary techniques are described in the Examples section herein after. Essentially, the individual genes and regulatory elements will be operably linked to one another such that the genes can be expressed to form the desired proteins. Suitable vectors for use in the invention will be appreciated by those of ordinary skill in the art. However, by way of example, the following vectors may be suitable: pMTL80000 shuttle vectors, pIMP1, pJIR750 and the plasmids exemplified in the Examples section herein after.
To the extent that the invention provides novel nucleic acids and nucleic acid vectors, it also provides nucleic acids which are capable of hybridising to at least a portion of a nucleic acid herein described, a nucleic acid complementary to any one thereof, or a functionally equivalent variant of any one thereof. Such nucleic acids will preferably hybridise to such nucleic acids, a nucleic acid complementary to any one thereof, or a functionally equivalent variant of any one thereof, under stringent hybridisation conditions. “Stringent hybridisation conditions” means that the nucleic acid is capable of hybridising to a target template under standard hybridisation conditions such as those described in Sambrook et al (1989). It will be appreciated that the minimal size of such nucleic acids is a size which is capable of forming a stable hybrid between a given nucleic acid and the complementary sequence to which it is designed to hybridise. Accordingly, the size is dependent on the nucleic acid composition and percent homology between the nucleic acid and its complementary sequence, as well as the hybridisation conditions which are utilised (for example, temperature and salt concentrations). In one embodiment, the nucleic acid is at least 10 nucleotides in length, at least 15 nucleotides in length, at least, 20 nucleotides in length, at least 25 nucleotides in length, or at least 30 nucleotides in length.
It should be appreciated that nucleic acids of the invention may be in any appropriate form, including RNA, DNA, or cDNA, including double-stranded and single-stranded nucleic acids.
The invention also provides host organisms, particularly microorganisms, and including viruses, bacteria, and yeast, comprising any one or more of the nucleic acids described herein.
The invention provides a method of production of 1-butanol and/or a precursor thereof by microbial fermentation comprising fermenting a gaseous substrate comprising CO using a recombinant microorganism. In certain embodiments, 1-butanol or a precursor thereof is co-produced with another fermentation product (for example, ethanol). In one embodiment, the 1-butanol or a precursor thereof is the main fermentation product. In one, embodiment, the recombinant microorganism is as herein before described.
In one embodiment, 1-butanol and/or a precursor thereof is produced in a yield of from approximately 0.075 grams per litre of fermentation broth (g/l) to approximately 20 g/l. In one embodiment, the yield is from approximately 0.15 g/l to approximately 1.54 g11. In other embodiments, the yield is approximately 10 g/l, approximately 5 g/l, or approximately 2 g/l. Preferably, the yield of 1-butanol is up to the limit at which butanol becomes toxic to the bacteria.
Preferably, the fermentation comprises the steps of anaerobically fermenting a substrate in a bioreactor to produce 1-butanol and/or a precursor thereof using recombinant microorganisms as described herein.
Where the precursor of 1-butanol is referred to herein it is envisaged that it may be optionally converted to 1-butanol in the presence of butyraldehyde dehydrogenase, butanol dehydrogenase, a bifunctional butyraldehyde dehydrogenase/butanol dehydrogenase, phosphotransbutyrylase, butyrate kinase, and/or ferredoxin dependent aldehyde oxidoreductase. Preferably, the microorganism produces one or more of these enzymes both before and after introduction of a recombinant nucleic acid.
In an embodiment of the invention, the gaseous substrate fermented by the microorganism is a gaseous substrate containing CO. The gaseous substrate may be a CO-containing waste gas obtained as a by-product of an industrial process, or from some other source such as from automobile exhaust fumes. In certain embodiments, the industrial process is selected from the group consisting of ferrous metal products manufacturing, such as a steel mill, non-ferrous products manufacturing, petroleum refining processes, gasification of coal, electric power production, carbon black production, ammonia production, methanol production and coke manufacturing. In these embodiments, the CO-containing gas may be captured from the industrial process before it is emitted into the atmosphere, using any convenient method. The CO may be a component of syngas (gas comprising carbon monoxide and hydrogen). The CO produced from industrial processes is normally flared off to produce CO2 and therefore the invention has particular utility in reducing CO2 greenhouse gas emissions and producing butanol for use as a biofuel. Depending on the composition of the gaseous CO-containing substrate, it may also be desirable to treat it to remove any undesired impurities, such as dust particles before introducing it to the fermentation. For example, the gaseous substrate may be filtered or scrubbed using known methods.
It will be appreciated that for growth of the bacteria and CO-to-lbutanol fermentation to occur, in addition to the CO-containing substrate gas, a suitable liquid nutrient medium will need to be fed to the bioreactor. A nutrient medium will contain vitamins and minerals sufficient to permit growth of the micro-organism used. Anaerobic media suitable for fermentation to produce butanol using CO are known in the art. For example, suitable media are described Biebel (2001). In one embodiment of the invention the media is as described in the Examples section herein after.
The fermentation should desirably be carried out under appropriate conditions for the CO-to-butanol fermentation to occur. Reaction conditions that should be considered include pressure, temperature, gas flow rate, liquid flow rate, media pH, media redox potential, agitation rate (if using a continuous stirred tank reactor), inoculum level, maximum gas substrate concentrations to ensure that CO in the liquid phase does not become limiting, and maximum product concentrations to avoid product inhibition.
In addition, it is often desirable to increase the CO concentration of a substrate stream (or CO partial pressure in a gaseous substrate) and thus increase the efficiency of fermentation reactions where CO is a substrate. Operating at increased pressures allows a significant increase in the rate of CO transfer from the gas phase to the liquid phase where it can be taken up by the micro-organism as a carbon source for the production of butanol. This in turn means that the retention time (defined as the liquid volume in the bioreactor divided by the input gas flow rate) can be reduced when bioreactors are maintained at elevated pressure rather than atmospheric pressure. The optimum reaction conditions will depend partly on the particular micro-organism of the invention used. However, in general, it is preferred that the fermentation be performed at pressure higher than ambient pressure. Also, since a given CO-to-butanol conversion rate is in part a function of the substrate retention time, and achieving a desired retention time in turn dictates the required volume of a bioreactor, the use of pressurized systems can greatly reduce the volume of the bioreactor required, and consequently the capital cost of the fermentation equipment. According to examples given in U.S. Pat. No. 5,593,886, reactor volume can be reduced in linear proportion to increases in reactor operating pressure, i.e. bioreactors operated at 10 atmospheres of pressure need only be one tenth the volume of those operated at 1 atmosphere of pressure.
The benefits of conducting a gas-to-ethanol fermentation at elevated pressures has been described elsewhere. For example, WO 02/08438 describes gas-to-ethanol fermentations performed under pressures of 30 psig and 75 psig, giving ethanol productivities of 150 g/l/day and 369 g/l/day respectively. However, example fermentations performed using similar media and input gas compositions at atmospheric pressure were found to produce between 10 and 20 times less ethanol per litre per day.
The composition of gas streams used to feed a fermentation reaction can have a significant impact on the efficiency and/or costs of that reaction. For example, O2 may reduce the efficiency of an anaerobic fermentation process. Processing of unwanted or unnecessary gases in stages of a fermentation process before or after fermentation can increase the burden on such stages (e.g. where the gas stream is compressed before entering a bioreactor, unnecessary energy may be used to compress gases that are not needed in the fermentation). Accordingly, it may be desirable to treat substrate streams, particularly substrate streams derived from industrial sources, to remove unwanted components and increase the concentration of desirable components.
In certain embodiments a culture of a bacterium of the invention is maintained in an aqueous culture medium. Preferably the aqueous culture medium is a minimal anaerobic microbial growth medium. Suitable media are known in the art and described for example in U.S. Pat. Nos. 5,173,429 and 5,593,886 and WO 02/08438, and as described in the Examples section herein after.
Butanol, or a mixed alcohol stream containing butanol and one or more other alcohols, may be recovered from the fermentation broth by methods known in the art, such as fractional distillation or evaporation, pervaporation, and extractive fermentation, including for example, liquid-liquid extraction. By-products such as acids including butyrate may also be recovered from the fermentation broth using methods known in the art. For example, an adsorption system involving an activated charcoal filter or electrodialysis may be used. Alternatively, continuous gas stripping may also be used.
In certain preferred embodiments of the invention, butanol and by-products are recovered from the fermentation broth by continuously removing a portion of the broth from the bioreactor, separating microbial cells from the broth (conveniently by filtration), and recovering butanol and optionally acid from the broth. Alcohols may conveniently be recovered for example by distillation, and acids may be recovered for example by adsorption on activated charcoal. The separated microbial cells are preferably returned to the fermentation bioreactor. The cell free permeate remaining after the alcohol(s) and acid(s) have been removed is also preferably returned to the fermentation bioreactor. Additional nutrients (such as B vitamins) may be added to the cell free permeate to replenish the nutrient medium before it is returned to the bioreactor.
Also, if the pH of the broth was adjusted as described above to enhance adsorption of acetic acid to the activated charcoal, the pH should be re-adjusted to a similar pH to that of the broth in the fermentation bioreactor, before being returned to the bioreactor.
In one embodiment of the invention, butanol is recovered from the fermentation reaction using extractive fermentation procedures in which butanol is recovered into an oil phase in the reactor. Skilled persons would readily appreciate techniques for achieving this
The invention will now be described in more detail with reference to the following non-limiting examples.
Genetic modifications were carried out using a plasmid containing a synthetic operon consisting of a strong, native C. autoethanogenum promoter controlling a thiolase, 3-hydroxybutyryl-CoA dehydrogenase, crotonase, butyryl-CoA dehydrogenase, and 2 electron transferring flavoproteins genes from C. acetobutylicum (FIG. 1-2). This plasmid was methylated in vivo using a novel methyltransferase and then transformed into C. autoethanogenum DSM23693. Production of 1-butanol as the main fermentation product was shown on different industrial gas streams (steel mill waste gas, syngas).
Standard Recombinant DNA and molecular cloning techniques were used in this invention and are described by Sambrook et al, 1989 and Ausubel et al, 1987. DNA sequences of butanol biosynthetic genes of Clostridium acetobutylicum ATCC824 used were obtained from NCBI (Table 1). The phosphotransacetylase/acetate kinase operon promoter of C. autoethanogenum DSM10061 were sequenced and used for expression of target genes (Table 1). RT-PCR experiments showed that this promoter is constitutively expressed at a high level (FIG. 8).
| TABLE 1 |
| Sources of 1-butanol pathway genes |
| SEQ_ID | ||
| Gene/Promoter | GenBank Citation | NO. |
| Thiolase (thlA) | NC_003030 Clostridium acetobutylicum ATCC 824, | 1 |
| complete genome; GI: 15896127; GeneID: 1119056 | ||
| 3-hydroxybutyryl-CoA dehydrogenase | NC_003030 Clostridium acetobutylicum ATCC 824, | 2 |
| (hbd) | complete genome; GI: 15895965; GeneID: 1118891 | |
| Crotonase (crt) | NC_003030 Clostridium acetobutylicum ATCC 824, | 3 |
| complete genome; GI: 15895969; GeneID: 1118895 | ||
| butyryl-CoA dehydrogenase (bcd) | NC_003030 Clostridium acetobutylicum ATCC 824, | 4 |
| complete genome; GI: 15895968; GeneID: 1118894 | ||
| Electron Transfer Flavoprotein A | NC_003030 Clostridium acetobutylicum ATCC 824, | 5 |
| (etfA) | complete genome; GI: 15895966; GeneID: 1118892 | |
| Electron Transfer Flavoprotein B | NC_003030 Clostridium acetobutylicum ATCC 824, | 6 |
| (etfB) | complete genome; GI: 15895967; GeneID: 1118893 | |
| phosphotransacetylase/acetate | Clostridium autoethanogenum DSM10061 | 7 |
| kinase promoter (Ppta-ack) | ||
Genomic DNA from Clostridium acetobutylicum ATCC824 and Clostridum autoethanogenum DSM10061 was isolated using a modified method by Bertram and Dürre (1989). A 100-ml overnight culture was harvested (6,000×g, 15 min, 4° C.), washed with potassium phosphate buffer (10 mM, pH 7.5) and suspended in 1.9 ml STE buffer (50 mM Tris-HCl, 1 mM EDTA, 200 mM sucrose; pH 8.0). 300 μl lysozyme (400,000 U) were added and the mixture was incubated at 37° C. for 30 min, followed by addition of 280 μl of a 10% (w/v) SDS solution and another incubation for 10 min. RNA was digested at room temperature by addition of 240 μl of an EDTA solution (0.5 M, pH 8), 20 μl Tris-HCl (1 M, pH 7.5), and 10 μl RNase A (Fermentas). Then, 100 μl Proteinase K (0.5 U) were added and proteolysis took place for 1-3 h at 37° C. Finally, 600 μl of sodium perchlorate (5 M) were added, followed by a phenol-chloroform extraction and an isopropanol precipitation. DNA quantity and quality was inspected spectrophotometrically.
Butanol biosynthesis genes and the phosphotransacetylase/acetate kinase promoter were amplified by PCR with oligonucleotides in table 2 using iProof High Fidelity DNA Polymerase (Bio-Rad Laboratories) and the following program: initial denaturation at 98° C. for 30 seconds, followed by 32 cycles of denaturation (98° C. for 10 seconds), annealing (50-62° C. for 30-120 seconds) and elongation (72° C. for 45 seconds), before a final extension step (72° C. for 10 minutes).
| TABLE 2 |
| Oligonucleotides for cloning |
| Oligonucleotide | SEQ_ID | ||
| Target | Name | DNA Sequence (5′ to 3′) | NO. |
| Ppta-ack | Ppta-ack-NotI-F | GAGCGGCCGCAATATGATATTTATGTCC | 8 |
| Ppta-ack | Ppta-ack-NdeI-R | TTCCATATGTTTCATGTTCATTTCCTCC | 9 |
| ThlA | ThlA-Cac-NdeI-F | GTTCATATGAAAGAAGTTGTAATAGC | 10 |
| ThlA | ThlA-Cac-EcoRI-R | CAAGAATTCCTAGCACTTTTCTAGC | 11 |
| crt-bcd-etfB- | Crt-Cac-KpnI-F | AAGGTACCTTAGGAGGATTAGTCATGG | 12 |
| etfA-hbd operon | |||
| crt-bcd-etfB- | Crt-hbd-Cac- | GAGGATCCGGATTCTTGTAAACTTATTTTG | 13 |
| etfA-hbd operon | BamHI-R | ||
The amplified 498 by promoter region of the phosphotransacetylase/acetate kinase operon (Ppta-ack) was cloned into the E. coli—Clostridium shuttle vector pMTL 85141 (Seq. ID 14; FJ797651.1; Nigel Minton, University of Nottingham; Heap et al., 2009) using NotI and NdeI restriction sites and strain DH5α-T1R (Invitrogen). The created plasmid pMTL85145 and the 1,194 by PCR product of the thiolase gene were both cut with NdeI and EcoRI. A ligation was transformed into E. coli XL1-Blue MRF′ Kan (Stratagene) resulting in plasmid pMTL85145-thlA. Subsequently, the amplified 4,764 by PCR fragment of the crt-bcd-etfB-etfA-hbd operon from C. acetobutylicum ATCC 824 was cloned into this vector using KpnI and BamHI and E. coli ABLE K (Stratagene), creating plasmid pMTL85145-thlA-crt-hbd. Finally, the antibiotic resistance cassette was changed from chloramphenicol to clarithromycin. Therefore, an ermB cassette was released from vector pMTL82254 (Seq. ID 15; FJ797646.1; Nigel Minton, University of Nottingham; Heap et al., 2009) using restriction enzymes Pmel and FseI and exchanged with the catP cassette of plasmid pMTL85145-thlA-crt-hbd. The insert of the resulting expression plasmid pMTL85245-thlA-crt-hbd (SEQ_ID No. 31 was completely sequenced using oligonucleotides given in table 3 and results confirmed that the butanol biosynthesis genes were free of mutations (FIG. 3).
| TABLE 3 |
| Oligonucleotides for sequencing |
| Oligonucleotide | SEQ_ID | |
| Name | DNA Sequence (5′ to 3′) | NO. |
| seq-ThlA-hbd- | CAGAGGATGTTAATGAAGTC | 16 |
| 3562-4162 | ||
| seq-ThlA-hbd- | GCATCAGGATTAAATGACTG | 17 |
| 4163-4763 | ||
| seq-ThlA-hbd- | ATAGCGAAGTACTTG | 18 |
| 4764-5364 | ||
| seq-ThlA-hbd- | GATGCAATGACAGCTTTC | 19 |
| 5365-5965 | ||
| seq-ThlA-hbd- | GGAACAAAAGGTATATCAGC | 20 |
| 5966-6566 | ||
| seq-ThlA-hbd- | CGGAGCATTTGATAAAGAA | 21 |
| 7168-7768 | ||
| seq-ThlA-hbd- | GCTGATTGTACATCACTTGA | 22 |
| 7769-8369 | ||
| seq-ThlA-hbd- | CCAGAATTAATAGCTCAAGT | 23 |
| 8370-8870 | ||
A hybrid methyltransferase gene fused to an inducible lac promoter was designed (Seq. ID 28), by alignment of methyltransferase genes from C. autoethanogenum (SEQ_ID No. 24), C. ljungdahlii (SEQ_ID No. 25), and C. ragsdalei (SEQ_ID No. 26) (FIGS. 4a, 4b and 4c). Expression of the methyltransferase gene resulted in production of a methyltransferase enzyme according to SEQ_ID No. 28. Methyltransferase amino acid sequence alignment data is shown in FIG. 4d. The hybrid methyltransferase gene (SEQ_ID No. 27) was chemically synthesized and cloned into vector pGS20 (Seq. ID 29; ATG:biosynthetics GmbH, Merzhausen, Germany) using EcoRI (FIG. 5). The resulting methylation plasmid pGS20-methyltransferase was double transformed with the expression plasmid pMTL85245-thlA-crt-hbd into the restriction negative E. coli XL1-Blue MRF′ Kan (Stratagene). In vivo methylation was induced by addition of 1 mM IPTG, and methylated plasmids were isolated using the PureLink™ HiPure Plasmid Maxiprep Kit (Invitrogen). The resulting methylated plasmid composition was used for transformation of C. autoethanogenum DSM23693.
During the complete transformation experiment, C. autoethanogenum DSM23693 was grown in PETC media (Tab. 4) with 10 g/l fructose and 30 psi steel mill waste gas (collected from New Zealand Steel site in Glenbrook, NZ; composition: 44% CO, 32% N2, 22% CO2, 2% H2) as carbon source at 37° C. using standard anaerobic techniques described by Hungate (1969) and Wolfe (1971).
| TABLE 4 |
| PETC media (ATCC media 1754; |
| http://www.atcc.org/Attachments/2940.pdf) |
| Media component | Concentration per 1.0 L of media |
| NH4Cl | 1 | g |
| KCl | 0.1 | g |
| MgSO4•7H2O | 0.2 | g |
| NaCl | 0.8 | g |
| KH2PO4 | 0.1 | g |
| CaCl2 | 0.02 | g |
| Trace metal solution | 10 | ml |
| Wolfe's vitamin solution | 10 | ml |
| Yeast Extract | 1 | g |
| Resazurin (2 g/L stock) | 0.5 | ml |
| NaHCO3 | 2 | g |
| Reducing agent | 0.006-0.008% (v/v) |
| Distilled water | Up to 1 L, pH 5.5 (adjusted with HCl) |
| Wolfe's vitamin solution | per L of Stock |
| Biotin | 2 | mg |
| Folic acid | 2 | mg |
| Pyridoxine hydrochloride | 10 | mg |
| Thiamine•HCl | 5 | mg |
| Riboflavin | 5 | mg |
| Nicotinic acid | 5 | mg |
| Calcium D-(+)-pantothenate | 5 | mg |
| Vitamin B12 | 0.1 | mg |
| p-Aminobenzoic acid | 5 | mg |
| Thioctic acid | 5 | mg |
| Distilled water | To 1 | L |
| Trace metal solution | per L of stock |
| Nitrilotriacetic Acid | 2 | g |
| MnSO4•H2O | 1 | g |
| Fe (SO4)2(NH4)2•6H2O | 0.8 | g |
| CoCl2•6H2O | 0.2 | g |
| ZnSO4•7H2O | 0.2 | mg |
| CuCl2•2H2O | 0.02 | g |
| NaMoO4•2H2O | 0.02 | g |
| Na2SeO3 | 0.02 | g |
| NiCl2•6H2O | 0.02 | g |
| Na2WO4•2H2O | 0.02 | g |
| Distilled water | To 1 | L |
| Reducing agent stock | per 100 mL of stock |
| NaOH | 0.9 | g |
| Cystein•HCl | 4 | g |
| Na2S | 4 | g |
| Distilled water | To 100 | mL |
To make competent cells, a 50 ml culture of C. autoethanogenum DSM23693 was subcultured to fresh media for 3 consecutive days. These cells were used to inoculate 50 ml PETC media containing 40 mM DL-threonine at an OD600nm of 0.05. When the culture reached an OD600nm of 0.4, the cells were transferred into an anaerobic chamber and harvested at 4,700×g and 4° C. The culture was twice washed with ice-cold electroporation buffer (270 mM sucrose, 1 mM MgCl2, 7 mM sodium phosphate, pH 7.4) and finally suspended in a volume of 600 μl fresh electroporation buffer. This mixture was transferred into a pre-cooled electroporation cuvette with a 0.4 cm electrode gap containing 1 μg of the methylated plasmid mix and immediately pulsed using the Gene pulser Xcell electroporation system (Bio-Rad) with the following settings: 2.5 kV, 600 μl, and 25 μF. Time constants of 3.7-4.0 ms were achieved. The culture was transferred into 5 ml fresh media. Regeneration of the cells was monitored at a wavelength of 600 nm using a Spectronic Helios Epsilon Spectrophotometer (Thermo) equipped with a tube holder. After an initial drop in biomass, the cells start growing again. Once the biomass has doubled from that point, the cells were harvested, suspended in 200 μl fresh media and plated on selective PETC plates (containing 1.2% Bacto™ Agar (BD)) with 4 μg/μl Clarithromycin. After 4-5 days of inoculation with 30 psi steel mill gas at 37° C., 15-80 colonies per plate were clearly visible.
The colonies were used to inoculate 2 ml PETC media containing 4 μg/μl Clarithromycin. When growth occurred, the culture was upscaled into 5 ml and later 50 ml PETC media containing 4 μg/μ1 Clarithromycin and 30 psi steel mill gas as sole carbon source.
To verify the DNA transfer, a plasmid mini prep was performed from 10 ml culture volume using the QIAprep Spin Miniprep Kit (Qiagen). Due to Clostridial exonuclease activity (Burchhardt and Dürre, 1990), the isolated plasmid DNA from 4 analyzed clones were partly degraded and only resulted in a smear on an agarose gel, while a plasmid isolation from the original C. autoethanogenum DSM23693 strain didn't result in a signal at all (FIG. 6). However, the quality of the isolated plasmid DNA was sufficient to run a control PCR using 4 sets of primers, covering all relevant different regions of the plasmid (Table 5). The PCR was performed with illustra PuReTaq Ready-To-Go™ PCR Beads (GE Healthcare) using a standard conditions (95° C. for 5 min; 32 cycles of 95° C. for 30 s, 50° C. for 30 s, and 72° C. for 1 min; 72° C. for 10 min). PCR of all 4 analyzed transformants resulted in the same signals as with the original methylated plasmid mix as template (FIG. 6). As a further control, 1 μl of each of the partly degraded isolated plasmids were re-transformed in E. coli XL1-Blue MRF′ Kan (Stratagene), from where the plasmids could be isolated cleanly and verified by restriction digests.
To confirm the identity of the 4 clones, genomic DNA was isolated (see above) from 40 ml of each culture and a PCR was performed against the 16s rRNA gene (Tab. 5; Weisberg et al., 1991) using illustra PuReTaq Ready-To-Go™ PCR Beads (GE Healthcare) and standard conditions (95° C. for 5 min; 32 cycles of 95° C. for 30 s, 50° C. for 30 s, and 72° C. for 1 min; 72° C. for 10 min). The respective PCR products were purified and sequenced. Sequences of all clones showed at least 99.9% identity against the 16s rRNA gene of C. autoethanogenum (Seq. ID 30; Y18178, GI:7271109).
A respective strain was deposited at DSMZ (Deutsche Sammlung für Mikroorganismen and Zellkulturen GmbH, Braunschweig, Germany) under the accession number DSM24138 on 26 Oct. 2010.
| TABLE 5 |
| Oligonucleotides for PCR confirmation of plasmid and species |
| Oligonucleotide | Seq ID | ||
| Target region | Name | DNA Sequence (5′ to 3′) | No. |
| 16s rRNA gene | fD1 | CCGAATTCGTCGACAACAGAGTTTGATCCTGGC | 135 |
| TCAG | |||
| 16s rRNA gene | rP2 | CCGGGATCCAAGCTTACGGCTACCTTGTTACGA | 32 |
| CTT | |||
| Antibiotic resistance | ermB-F | TTTGTAATTAAGAAGGAG | 33 |
| cassette (ermB) | |||
| Antibiotic resistance | ermB-R | GTAGAATCCTTCTTCAAC | 34 |
| cassette (ermB) | |||
| Insert 1 (thlA) | ThlA-Cac-NdeI-F | GTTCATATGAAAGAAGTTGTAATAGC | 10 |
| Insert 1 (thlA) | ThlA-Cac-EcoRI-R | CAAGAATTCCTAGCACTTTTCTAGC | 11 |
| Insert 2 (crt-bcd- | Crt-conserved-F | GCTGGAGCAGATAT | 35 |
| etfAB-hbd) | |||
| Insert 2 (crt-bcd- | Crt-conserved-R | GCTGTCATTCCTTC | 36 |
| etfAB-hbd) | |||
| Replication origin | ColE1-F | CGTCAGACCCCGTAGAAA | 37 |
| (ColE1) | |||
| Replication origin | ColE1-R | CTCTCCTGTTCCGACCCT | 38 |
| (ColE1) | |||
To demonstrate 1-butanol production from CO as sole energy and carbon source, PETC media without yeast extract and fructose were prepared and inoculated with the novel C. autoethanogenum strain harboring butanol plasmid pMTL85245-thlA-crt-hbd. Bottles were pressurized with 30 psi of a CO containing gas stream from two industrial sources, steel mill waste gas (collected from New Zealand Steel site in Glenbrook, NZ; composition: 44% CO, 32% N2, 22% CO2, 2% H2) and syngas (Range Fuels Inc., Broomfield, Colo.; composition: 29% CO, 45% H2, 13% CH4, 12% CO2, 1% N2). 1-Butanol production could be demonstrated on both gas mixes over several subculturing periods and co-production of butyrate was observed as well.
Analysis of metabolites were performed by HPLC using an Agilent 1100 Series HPLC system equipped with a RID operated at 35° C. (Refractive Index Detector) and an Alltech IOA-2000 Organic acid column (150×6.5 mm, particle size 5 μm) kept at 60° C. Slightly acidified water was used (0.005 M H2SO4) as mobile phase with a flow rate of 0.7 ml/min. To remove proteins and other cell residues, 400 μl samples were mixed with 100 μl of a 2% (w/v) 5-Sulfosalicylic acid and centrifuged at 14,000×g for 3 min to separate precipitated residues. 10 μl of the supernatant were then injected into the HPLC for analyses.
The highest 1-butanol production measured in two cultures was 1.54 g/l (25.66 mM) with 1-butanol as main fermentation end product (Table 6, FIG. 7). The production of the other metabolites was reduced compared to the original strain C. autoethanogenum DSM23693, which only produces ethanol, acetate, and 2,3-butandiol. Although the carbon flux was shifted towards 1-butanol production, the amount of total carbon incorporated into metabolic end products remain almost the same (Table 6). The slight increase of 20% is likely to be the result of an extra reducing equivalents offload by producing 1-butanol and butyrate compared to ethanol and respectively acetate. The production of 2,3-butandiol which usually acts as electron sink, is completely diminished.
| TABLE 6 |
| Metabolite production and carbon balance of C. autoethanogenum harboring butanol |
| plasmid pMTL85245-thlA-crt-hbd compared to C. autoethanogenum DSM23693 |
| Original | C. autoethanogenum | |
| C. autoethanogenum | DSM23693 + | |
| DSM23693 | pMTL85245-thlA-crt-bcd |
| M | P | Carbon | Product | Product | Carbon | Product | Product | Carbon | |
| Product | [g/mol] | [g/cm3] | atoms | [g/l] | [mmol/l] | [mmol/l] | [g/l] | [mmol/l] | [mmol/l] |
| Ethanol | 46.08 | 0.789 | 2 | 1.02 | 28.06 | 56.11 | 0.37 | 10.18 | 20.35 |
| Acetate | 60.05 | 1.049 | 2 | 1.87 | 29.69 | 59.37 | 0.30 | 4.76 | 9.52 |
| 2,3-butandiol | 90.12 | 0.987 | 4 | 0.18 | 2.02 | 8.09 | 0 | 0 | 0 |
| 1-butanol | 74.12 | 0.810 | 4 | 0 | 0 | 0 | 1.54 | 25.66 | 102.63 |
| Butyrate | 88.11 | 0.960 | 4 | 0 | 0 | 0 | 0.31 | 3.67 | 14.67 |
| Total | 123.58 | 147.17 | |||||||
The expression plasmid only contains the genes necessary for production of butyryl-CoA from acetyl-CoA. Butyryl-CoA can then be converted directly to butanol by action of a butyraldehyde dehydrogenase and butanol dehydrogenase (FIG. 1). A second possibility is that butyryl-CoA is converted to butyrate via a phosphotransbutyrylase and butyrate kinase (FIG. 1), in which case ATP is gained via substrate level phosphorylation (SLP). Since operation of the Wood-Ljungdahl pathway requires ATP, acetogenic cells rely on ATP from SLP, which is also reflected in the fact that every acetogenic bacteria known produces acetate (Drake et al., 2006). However, the recombinant cell can now also generate ATP via SLP also by producing butyrate. Butyrate can then be further reduced to butyraldehyde via a aldehyde:ferredoxinoxidoreductase (AOR) (FIG. 1). This reaction could be driven by reduced ferredoxin, provided by oxidation of CO via the carbon monoxide dehydrogenase (CO+Fdred->CO2+Fdox), the initial step in the Wood-Ljungdahl pathway. Butyraldehyde can then be converted to butanol via a butanol dehydrogenase (FIG. 1). Conversion of externally added butyrate to butanol by a culture of C. autoethanogenum has been demonstrated (WO2009/113878).
Respective genes/enzymes with butyraldehyde dehydrogenase, butanol dehydrogenase, phophotransbutyrylase, butyrate kinase, and aldehyde:ferredoxin oxidoreductase activity have been identified by the inventors in C. autoethanogenum, C. ljungdahlii, and C. ragsdalei (Tab. 7-10). Potential genes and enzymes were predicted by comparison with characterized genes and enzymes using BLAST (Altschul et al, 1990), COG (Tatusov et al, 2003), and TIGRFAM (Haft et al, 2002) databases. Motif scans were performed against PROSITE (Hulo et al., 2008) Pfam (Finn et al., 2010) databases. Genomes of C. autoethanogenum, C. ljungdahlii, and C. ragsdalei contain several genes encoding enzymes with alcohol and aldehyde dehydrogenase activity. As indicated in tables 7 to 10, some of these were found to have high homology of over 70% to characterized butyraldehyde and butanol dehydrogenases from C. acetobutylicum, C. beijerinckii, or C. saccharobutylicum, while others have at least in some 40% identity to these enzymes. All three genomes encode exactly one enzyme with Phosphate acetyl/butyryl transferase activity and one with Acetate/butyrate kinase activity. C. autoethanogenum, C. ljungdahlii, and C. ragsdalei each possess 2 aldehyde:ferredoxin oxidoreductase genes.
| TABLE 7 |
| Genes of C. autoethanogenum potentially conferring butyraldehyde and butanol dehydrogenase activity |
| Sequence | Description | Identity (protein) to characterized enzymes |
| Seq. ID 39-40 | Bifunctional butanol/ | bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. beijerinckii NCIMB |
| butyraldehyde dehydrogenase | 8052 (Identities = 644/861 (75%), Positives = 748/861 (87%), e-value = 0.0) | |
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (Identities = 594/858 (70%), Positives = 730/858 (86%), e-value = 0.0) | ||
| Seq. ID 41-42 | Butyraldehyde dehydrogenase | bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. beijerinckii NCIMB |
| 8052 (Identities = 367/504 (73%), Positives = 437/504 (87%), e-value = 0.0) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (354/504 (71%), Positives = 440/504 (88%), e-value = 0.0) | ||
| Seq. ID 43-44 | Butyraldehyde dehydrogenase | bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum |
| ATCC824 (Identities = 173/352 (50%), Positives = 236/352 (68%), e-value = 1e−91) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. beijerinckii NCIMB | ||
| 8052 (Identities = 160/374 (43%), Positives = 234/374 (63%), e-value = 5e−87) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE1 from C. acetobutylicum | ||
| ATCC824 (Identities = 158/366 (44%), Positives = 235/366 (65%), e-value = 5e−82) | ||
| butyraldehyde dehydrogenase Ald from C. beijerinckii NCIMB8052 | ||
| (Identities = 110/354 (32%), Positives = 184/354 (52%), e-value = 9e−44) | ||
| butyraldehyde dehydrogenase from C. saccharoperbutylacetonicum | ||
| (111/354 (32%), Positives = 182/354 (52%), e-value = 2e−44) | ||
| Seq. ID 45-46 | Butyraldehyde dehydrogenase | bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. beijerinckii NCIMB |
| 8052 (Identities = 188/477 (40%), Positives = 270/477 (57%), e-value = 9e−84) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (Identities = 164/428 (39%), Positives = 256/428 (60%), e-value = 1e−79) | ||
| Seq. ID 119-120 | Butanol dehydrogenase | NADPH-dependet butanol dehydrogenase from C. saccharobutylicum |
| (Identities = 285/388 (74%), Positives = 334/388 (87%), e-value = 7e−177) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (Identities = 163/396 (42%), Positives = 237/396 (60%), e-value = 4e−80) | ||
| Seq. ID 121-122 | Butanol dehydrogenase | NADPH-dependet butanol dehydrogenase from C. saccharobutylicum |
| (Identities = 271/388 (70%), Positives = 328/388 (85%), e-value = 3e−168) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (Identities = 169/403 (42%), Positives = 240/403 (60%), e-value = 3e−83) | ||
| Seq. ID 51-52 | Butanol dehydrogenase | bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. beijerinckii NCIMB |
| 8052 (246/315 (79%), Positives = 287/315 (92%), e-value = 1e−153) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (208/312 (67%), Positives = 260/312 (84%), e-value = 4e−128) | ||
| Seq. ID 53-54 | Butanol dehydrogenase | NADPH-dependet butanol dehydrogenase from C. saccharobutylicum |
| (Identities = 264/388 (69%), Positives = 326/388 (85%), e-value = 5e−163) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. beijerinckii | ||
| NCIMB8052 (Identities = 169/410 (42%), Positives = 246/410 (60%), e-value = | ||
| 5e−82) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (Identities = 162/402 (41%), Positives = 240/402 (60%), e-value = 2e−78) | ||
| Seq. ID 55-56 | Butanol dehydrogenase | NADH-dependent butanol dehydrogenase BdhA from C. acetobutylicum |
| ATCC824 (Identities = 161/388 (42%), Positives = 243/388 (63%), e-value = 7e−92) | ||
| NADH-dependent butanol dehydrogenase BdhB from C. acetobutylicum | ||
| ATCC824 (Identities = 155/389 (40%), Positives = 242/389 (63%), e-value = 4e−85) | ||
| Seq. ID 57-58 | Butanol dehydrogenase | NADPH-dependet butanol dehydrogenase AdhE2 from C. saccharobutylicum |
| (Identities = 156/385 (41%), Positives = 236/385 (62%), e-value = 1e−72) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (Identities = 154/412 (38%), Positives = 233/412 (57%), e-value = 8e−70) | ||
| Seq. ID 59-60 | Phosphate acetyl/butyryl | phosphate butyryltransferase from C. acetobutylicum ATCC 824 (Identities = |
| transferase | 85/338 (26%), Positives = 146/338 (44%), e-value = 2e−12) | |
| Seq ID 61-62 | Acetate/butyrate kinase | butyrate kinase from C. acetobutylicum ATCC 824 (Identities = 49/175 (28%), |
| Positives = 78/175 (45%), e-value 5e−08) | ||
| Seq ID 63-64 | Aldehyde: ferredoxin | aldehyde: ferredoxin oxidoreductase from C. acetobutylicum ATCC 824 |
| oxidoreductase | (Identities = 183/618 (30%), Positives = 311/618 (51%), e-value = 6e−72) | |
| Seq ID 65-66 | Aldehyde: ferredoxin | aldehyde: ferredoxin oxidoreductase from C. acetobutylicum ATCC 824 |
| oxidoreductase | (Identities = 191/633 (31%), Positives = 308/633 (49%), e-value = 2e−70) | |
| TABLE 8 |
| Genes of C. ljungdahlii potentially conferring butyraldehyde and butanol dehydrogenase activity |
| Sequence | Description | Identity to characterized enzymes |
| Seq. ID 67-68 | Bifunctional butanol/ | bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. beijerinckii NCIMB |
| butyraldehyde dehydrogenase | 8052 (Identities = 644/862 (75%), Positives = 751/862 (88%), e-value = 0.0) | |
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (Identities = 592/858 (69%), Positives = 729/858 (85%), e-value = 0.0) | ||
| Seq. ID 69-70 | Bifunctional butanol/ | bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. beijerinckii NCIMB |
| butyraldehyde dehydrogenase | 8052 (Identities = 636/860 (74%), Positives = 752/860 (88%), e-value = 0.0) | |
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (Identities = 585/858 (69%), Positives = 733/858 (86%), e-value = 0.0) | ||
| Seq. ID 71-72 | Butyraldehyde dehydrogenase | bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum |
| ATCC824 (Identities = 209/429 (49%), Positives = 286/429 (67%), e-value = 4e−111) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. beijerinckii NCIMB | ||
| 8052 (Identities = 196/467 (42%), Positives = 286/467 (62%), e-value = 1e−102) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE1 from C. acetobutylicum | ||
| ATCC824 (Identities = 193/443 (44%), Positives = 283/443 (64%), e-value = 7e−100) | ||
| butyraldehyde dehydrogenase Ald from C. beijerinckii NCIMB8052 | ||
| (Identities = 125/409 (31%), Positives = 206/409 (51%), e-value = 3e−49) | ||
| butyraldehyde dehydrogenase from C. saccharoperbutylacetonicum | ||
| (124/409 (31%), Positives = 204/409 (50%), e-value = 2e−48) | ||
| Seq. ID 73-74 | Butyraldehyde dehydrogenase | bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. beijerinckii NCIMB |
| 8052 (Identities = 188/477 (40%), Positives = 270/477 (57%), e-value = 9e−84) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (Identities = 164/428 (39%), Positives = 256/428 (60%), e-value = 1e−79) | ||
| Seq. ID 75-76 | Butanol dehydrogenase | NADPH-dependet butanol dehydrogenase from C. saccharobutylicum |
| (Identities = 285/388 (74%), Positives = 335/388 (87%), e-value = 9e−177) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (Identities = 164/396 (42%), Positives = 238/396 (61%), e-value = 1e−80) | ||
| Seq. ID 77-78 | Butanol dehydrogenase | NADPH-dependet butanol dehydrogenase from C. saccharobutylicum |
| (Identities = 281/388 (73%), Positives = 327/388 (85%), e-value = 2e−173) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (Identities = 169/403 (42%), Positives = 240/403 (60%), e-value = 3e−83) | ||
| Seq. ID 79-80 | Butanol dehydrogenase | NADPH-dependet butanol dehydrogenase from C. saccharobutylicum |
| (Identities = 264/388 (69%), Positives = 326/388 (85%), e-value = 5e−163) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. beijerinckii | ||
| NCIMB8052 (Identities = 169/410 (42%), Positives = 246/410 (60%), e-value = | ||
| 4e−82) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (Identities = 162/402 (41%), Positives = 240/402 (60%), e-value = 2e−78) | ||
| Seq. ID 81-82 | Butanol dehydrogenase | NADH-dependent butanol dehydrogenase BdhA from C. acetobutylicum |
| ATCC824 (Identities = 161/388 (42%), Positives = 243/388 (63%), e-value = 7e−92) | ||
| NADH-dependent butanol dehydrogenase BdhB from C. acetobutylicum | ||
| ATCC824 (Identities = 155/389 (40%), Positives = 242/389 (63%), e-value = 4e−85) | ||
| Seq. ID 83-84 | Butanol dehydrogenase | NADPH-dependet butanol dehydrogenase from C. saccharobutylicum |
| (Identities = 150/389 (39%), Positives = 233/389 (60%), e-value = 7e−73) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (Identities = 154/412 (38%), Positives = 233/412 (57%), e-value = 8e−70) | ||
| Seq. ID 85-86 | Phosphate acetyl/butyryl | phosphate butyryltransferase from C. acetobutylicum ATCC 824 (91/340 (27%), |
| transferase | Positives = 156/340 (46%), e-value = 1e−16) | |
| Seq ID 87-88 | Acetate/butyrate kinase | butyrate kinase from C. acetobutylicum ATCC 824 (49/162 (31%), Positives = |
| 77/162 (48%), e-value 5e−08) | ||
| Seq ID 89-90 | Aldehyde: ferredoxin | aldehyde: ferredoxin oxidoreductase from C. acetobutylicum ATCC 824 (188/631 |
| oxidoreductase | (30%), Positives = 318/631 (51%), e-value = 3e−11) | |
| Seq ID 91-92 | Aldehyde: ferredoxin | aldehyde: ferredoxin oxidoreductase from C. acetobutylicum ATCC 824 |
| oxidoreductase | (Identities = 191/633 (31%), Positives = 308/633 (49%), e-value = 2e−70) | |
| TABLE 10 |
| Genes of C. ragsdalei potentially conferring butyraldehyde and butanol dehydrogenase activity |
| Sequence | Description | Identity to characterized enzymes |
| Seq. ID 93-94 | Bifunctional butanol/ | bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. beijerinckii NCIMB |
| butyraldehyde dehydrogenase | 8052 (Identities = 645/861 (75%), Positives = 751/861 (88%), e-value = 0.0) | |
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (Identities = 591/858 (69%), Positives = 731/858 (86%), e-value = 0.0) | ||
| Seq. ID 95-96 | Bifunctional butanol/ | bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. beijerinckii NCIMB |
| butyraldehyde dehydrogenase | 8052 (Identities = 639/860 (75%), Positives = 752/860 (88%), e-value = 0.0) | |
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (Identities = 591/858 (69%), Positives = 735/858 (86%), e-value = 0.0) | ||
| Seq. ID 97-98 | Butyraldehyde dehydrogenase | bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum |
| ATCC824 (Identities = 214/457 (47%), Positives = 294/457 (65%), e-value = 5e−111) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. beijerinckii NCIMB | ||
| 8052 (Identities = 200/457 (44%), Positives = 283/457 (62%), e-value = 1e−103) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE1 from C. acetobutylicum | ||
| ATCC824 (Identities = 198/457 (44%), Positives = 289/457 (64%), e-value = 4e−101) | ||
| butyraldehyde dehydrogenase Ald from C. beijerinckii NCIMB8052 | ||
| (Identities = 125/409 (31%), Positives = 206/409 (51%), e-value = 3e−49) | ||
| butyraldehyde dehydrogenase from C. saccharoperbutylacetonicum | ||
| (Identities = 123/409 (31%), Positives = 205/409 (51%), e-value = 1e−48) | ||
| Seq. ID 99-100 | Butyraldehyde dehydrogenase | bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. beijerinckii NCIMB |
| 8052 (Identities = 188/477 (40%), Positives = 270/477 (57%), e-value = 9e−84) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (Identities = 164/428 (39%), Positives = 256/428 (60%), e-value = 1e−79) | ||
| Seq. ID 101-102 | Butanol dehydrogenase | NADPH-dependet butanol dehydrogenase from C. saccharobutylicum |
| (Identities = 285/388 (74%), Positives = 335/388 (87%), e-value = 9e−177) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (Identities = 164/396 (42%), Positives = 238/396 (61%), e-value = 1e−80) | ||
| Seq. ID 103-104 | Butanol dehydrogenase | NADPH-dependet butanol dehydrogenase from C. saccharobutylicum |
| (Identities = 281/388 (73%), Positives = 327/388 (85%), e-value = 2e−173) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (Identities = 169/403 (42%), Positives = 240/403 (60%), e-value = 3e−83) | ||
| Seq. ID 105-106 | Butanol dehydrogenase | NADPH-dependet butanol dehydrogenase from C. saccharobutylicum |
| (Identities = 264/388 (69%), Positives = 326/388 (85%), e-value = 5e−163) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. beijerinckii | ||
| NCIMB8052 (Identities = 169/410 (42%), Positives = 246/410 (60%), e-value = | ||
| 4e−82) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (Identities = 162/402 (41%), Positives = 240/402 (60%), e-value = 2e−78) | ||
| Seq. ID 107-108 | Butanol dehydrogenase | NADH-dependent butanol dehydrogenase BdhA from C. acetobutylicum |
| ATCC824 (Identities = 162/388 (42%), Positives = 243/388 (63%), e-value = 3e−92) | ||
| NADH-dependent butanol dehydrogenase BdhB from C. acetobutylicum | ||
| ATCC824 (Identities = 155/389 (40%), Positives = 242/389 (63%), e-value = 6e−85) | ||
| Seq. ID 109-110 | Butanol dehydrogenase | NADPH-dependet butanol dehydrogenase from C. saccharobutylicum |
| (Identities = 147/389 (38%), Positives = 227/389 (59%), e-value = 3e−71) | ||
| bifunctional aldehyde/alcohol dehydrogenase AdhE2 from C. acetobutylicum | ||
| ATCC824 (Identities = 155/412 (38%), Positives = 233/412 (57%), e-value = 2e−70) | ||
| Seq. ID 111-112 | Phosphate acetyl/butyryl | phosphate butyryltransferase from C. acetobutylicum ATCC 824 87/325 (27%), |
| transferase | Positives = 148/325 (46%), e-value = 2e−16) | |
| Seq ID 113-114 | Acetate/butyrate kinase | butyrate kinase from C. acetobutylicum ATCC 824 (Identities = 49/162 (31%), |
| Positives = 77/162 (48%), e-value 4e−11) | ||
| Seq ID 115-116 | Aldehyde: ferredoxin | aldehyde: ferredoxin oxidoreductase from C. acetobutylicum ATCC 824 |
| oxidoreductase | (Identities = 187/633 (30%), Positives = 319/633 (51%), e-value = 3e−74) | |
| Seq ID 117-118 | Aldehyde: ferredoxin | aldehyde: ferredoxin oxidoreductase from C. acetobutylicum ATCC 824 |
| oxidoreductase | (Identities = 187/633 (30%), Positives = 302/633 (48%), e-value = 1e−69) | |
Successful expression of introduced Thiolase, 3-hydroxybutyryl-CoA dehydrogenase, Crotonase, Butyryl-CoA dehydrogenase, Electron Transfer Flavoprotein A and Electron Transfer Flavoprotein B were confirmed by RT-PCR studies.
A 50-ml culture of C. autoethanogenum harboring butanol plasmid pMTL85245-thlA-crt-hbd grown in a serum bottle with 30 psi steel mill gas as substrate was harvested by centrifugation (6,000×g, 5 min, 4° C.). RNA was isolated by suspending the cell pellet in 100 μL of lysozyme solution (50,000 U lysozyme, 0.5 μL 10% SDS, 10 mM Tris-HCl, 0.1 mM EDTA; pH 8). After 5 min, 350 μL of lysis buffer (containing 10 μL of 2-mercaptoethanol) was added. The cell suspension was mechanistically disrupted by passing five times through an 18-21 gauge needle. RNA was then isolated using PureLink™ RNA Mini Kit (Invitrogen) and eluted in 100 μL of RNase-free water. The RNA was checked via PCR and gel electrophoresis and quantified spectrophotometrically, and treated with DNase I (Roche) if necessary. Quality and integrity of RNA was checked using a BioAnalyzer (Agilent Technologies). The reverse transcription step was carried out using SuperScript III Reverse Transcriptase Kit (Invitrogen). RT-PCR reactions were performed in MyiQ Single Colour Real-Time PCR Detection System (Bio-Rad Labratories) in a reaction volume of 15 μL with 25 ng of cDNA template, 67 nM of each primer (Tab. 11), and 1× iQ SYBR Green Supermix (Bio-Rad Labratories, Hercules, Calif. 94547, USA). Guanylate kinase and formate tetrahydrofolate ligase were used as housekeeping gene and non-template controls were included. The reaction conditions were 95° C. for 3 min, followed by 40 cycles of 95° C. for 15 s, 55° C. for 15 s and 72° C. for 30 s. A melting-curve analysis was performed immediately after completion of the RT PCR (38 cycles of 58° C. to 95° C. at 1° C./s), for detection of primer dimerisation or other artifacts of amplification. mRNA from housekeeping and all target genes were successfully detected.
| TABLE 11 |
| Oligonucleotides for RT-PCR |
| Oligonu- | |||
| cleotide | SEQ_ID | ||
| Target | Name | DNA Sequence (5′ to 3′) | NO. |
| Guanylate kinase | GnK-F | TCAGGACCTTCTGGAACTGG | 131 |
| GnK-R | ACCTCCCCTTTTCTTGGAGA | 132 | |
| Formate | FoT4L-F | CAGGTTTCGGTGCTGACCTA | 133 |
| tetrahydrofolate | FoT4L-R | AACTCCGCCGTTGTATTTCA | 134 |
| ligase | |||
| Thiolase | thlA-RT-F | TTGATGAAATGATCACTGACGGATT | 123 |
| thlA-RT-R | GAAATGTTCCATCTCTCAGCTATGT | 124 | |
| 3-hydroxybutyryl- | hdb-RT-F | CATCACTTTCAATAACAGAAGTGGC | 125 |
| CoA dehydrogenase | hbd-RT-R | TACCTCTACAAGCTTCATAACAGGA | 126 |
| Butyryl-CoA | bcd-RT-F | AAAATGGGTCAGTATGGTATGATGG | 127 |
| dehydrogenase | bcd-RT-R | TGTAGTACCGCAAACCTTTGATAAT | 128 |
| Electron Transfer | etfA-RT-F | CAAGTTTACTTGGTGGAACAATAGC | 129 |
| Flavoprotein A | etfA-RT-R | GAGTTGGTCTTACAGTTTTACCAGT | 130 |
The invention has been described herein, with reference to certain preferred embodiments, in order to enable the reader to practice the invention without undue experimentation. However, a person having ordinary skill in the art will readily recognise that many of the components and parameters may be varied or modified to a certain extent or substituted for known equivalents without departing from the scope of the invention. It should be appreciated that such modifications and equivalents are herein incorporated as if individually set forth. Titles, headings, or the like are provided to enhance the reader's comprehension of this document, and should not be read as limiting the scope of the present invention.
The entire disclosures of all applications, patents and publications, cited above and below, if any, are hereby incorporated by reference. However, the reference to any applications, patents and publications in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that they constitute valid prior art or form part of the common general knowledge in any country in the world.
Throughout this specification and any claims which follow, unless the context requires otherwise, the words “comprise”, “comprising” and the like, are to be construed in an inclusive sense as opposed to an exclusive sense, that is to say, in the sense of “including, but not limited to”.
1.-65. (canceled)
66. An acetogenic recombinant microorganism which one or a combination of produces 1-butanol and a precursor thereof as the main fermentation product.
67. An acetogenic recombinant microorganism as claimed in claim 66, wherein the microorganism is capable of producing one or both 1-butanol and a precursor thereof by fermentation from a substrate comprising CO at a concentration of greater than approximately 1 mM or 0.075 grams per liter of fermentation broth.
68. An acetogenic recombinant microorganism as claimed in claim 66, wherein the microorganism further comprises exogenous nucleic acids adapted to express one or more enzymes in the butanol biosynthesis pathway.
69. An acetogenic recombinant microorganism as claimed in claim 68, wherein the microorganism further comprises one or more exogenous nucleic acids adapted to express one or more of enzymes chosen from the group consisting of:
Thiolase
3-hydroxybutyryl-CoA dehydrogenase
Crotonase/crotonyl-CoA hydratase
Butyryl-CoA dehydrogenase
Electron transport flavoprotein
Phosphotransbutyrylase;
butyrate kinase;
ferredoxin dependent aldehyde oxidoreductase;
butyraldehyde dehydrogenase;
butanol dehydrogenase; and,
a bifunctional butyraldehyde dehydrogenase/butanol dehydrogenase.
70. An acetogenic recombinant microorganism as claimed in claim 69, wherein the microorganism comprises one or more exogenous nucleic acids encoding each of Thiolase, 3-hydroxybutyryl-CoA dehydrogenase, Crotonase, and Butyryl-CoA dehydrogenase.
71. An acetogenic recombinant microorganism as claimed in claim 70, wherein the microorganism further comprises one or more exogenous nucleic acids encoding at least one electron transport flavoprotein chosen from the group consisting of Electron Transfer Flavoprotein A and Electron Transfer Flavoprotein B.
72. An acetogenic recombinant microorganism as claimed in claim 70, wherein the microorganism further comprises one or more exogenous nucleic acids encoding one or more of butyraldehyde dehydrogenase, butanol dehydrogenase and a bifunctional butyraldehyde dehydrogenase/butanol dehydrogenase.
73. An acetogenic recombinant microorganism as claimed in claim 70, wherein the microorganism further comprises one or more exogenous nucleic acids encoding one or more of Phosphotransbutyrylase, butyrate kinase, ferredoxin dependent aldehyde oxidoreductase and butanol dehydrogenase.
74. An acetogenic recombinant microorganism as claimed in claim 66, wherein the microorganism is selected from the group comprising Clostridium autoethanogenum, Clostridium ljungdahlii Clostridium ragsdalei, Clostridium carboxidivorans, Clostridium drakei, Clostridium scatalogenes, Clostridium aceticum, Clostridium formicoaceticum, Butyribacterium limosum, Acetobacterium woodii, Blautia producta, Eubacterium limosum, Moorella thermoacetica, Moorella thermautotrophica, Oxobacter pfennigii, and Thermoanaerobacter kiuvi.
75. An acetogenic recombinant microorganism as claimed in claim 74, wherein the microorganism is Clostridium autoethanogenum DSM23693.
76. A method for the production of one or both of 1-butanol and a precursor thereof by microbial fermentation comprising fermenting a substrate using a recombinant microorganism as claimed in claim 66.
77. A method as claimed in claim 76, wherein one or both of 1-butanol and a precursor thereof is the main fermentation product.
78. A method as claimed in claim 76, wherein at least one or both 1-butanol and a precursor thereof is produced in a yield of from approximately 0.075 grams per liter of fermentation broth to approximately 20 grams per liter.
79. A method as claimed in claim 78, wherein the yield is from approximately 0.15 grams per liter to approximately 1.54 grams per liter.
80. A method as claimed in claim 78, wherein the yield is approximately 10 grams per liter, approximately 5 grams per liter, or approximately 2 grams per liter.
81. A method as claimed in claim 78, wherein the yield of 1-butanol is up to the limit at which butanol becomes toxic.
82. A method as claimed in claim 76, wherein the substrate comprises CO.
83. A method as claimed in claim 82, wherein the substrate comprises at least about 20% to about 100% CO by volume.
84. A recombinant microorganism having the defining characteristics of the microorganism deposited at the DSMZ under the accession number DSM24138.
85. (canceled)
86. The method of claim 76, wherein the substrate comprises an industrial waste gas.