Patent application title:

METHOD FOR THE DETECTION AND CHARACTERIZATION OF A TOXINOGENIC CLOSTRIDIUM DIFFICILE STRAIN

Publication number:

US20120028819A1

Publication date:
Application number:

13/262,844

Filed date:

2010-03-31

Abstract:

The invention relates to a method for the detection and characterization of a toxinogenic Clostridium difficile strain in a sample, wherein the following steps are performed, (i) a sample is provided for, (ii) in a multiplex PCR assay, (iii) the sample is analyzed with respect to the presence or absence of the cytotoxin tcdB gene, (iv) the sample is analyzed with respect to the presence or absence of one or more of the following deletions in the tcdC gene: (a) an 18 bp deletion in SEQ ID NO. 1 from nucleotide 330 to nucleotide 347, (b) a 36 bp deletion in SEQ ID NO. 1 from nucleotide (301) to nucleotide (336), (c) a 39 bp deletion in SEQ ID NO. 1 from nucleotide (341) to nucleotide (370), (d) a 54 bp deletion in SEQ ID NO. 1 from nucleotide (313) to nucleotide (366) and (e) a single nucleotide deletion at position 117 of SEQ ID NO. 1. The invention also relates to respective kits and primers and probes.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12Q1/689 »  CPC main

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria

C12Q2600/156 »  CPC further

Oligonucleotides characterized by their use Polymorphic or mutational markers

C40B30/00 IPC

Methods of screening libraries

C40B40/06 IPC

Libraries , e.g. arrays, mixtures; Libraries containing only organic compounds Libraries containing nucleotides or polynucleotides, or derivatives thereof

C40B60/12 IPC

Apparatus specially adapted for use in combinatorial chemistry or with libraries for screening libraries

Description

FIELD OF THE INVENTION

The present invention is in the field of biology and chemistry. In particular, the invention is in the field of molecular biology. More particular, the invention is in the field of detection of nucleic acids and real-time PCR. Most particularly the invention relates to the detection and characterization of a toxinogenic Clostridium difficile strain.

BACKGROUND OF THE INVENTION

Clostridium difficile is a species of Gram-positive bacteria of the genus Clostridium. Clostridia are anaerobic, spore-forming rods (bacillus). C. difficile is the most serious cause of antibiotic-associated diarrhea (AAD) and can lead to pseudomembranous colitis, a severe infection of the colon, often resulting from eradication of the normal gut flora by antibiotics. The C. difficile bacteria, which naturally reside in the body, become overgrown: The overgrowth is harmful because the bacterium releases toxins that can cause bloating, constipation, and diarrhea with abdominal pain, which may become severe. Latent symptoms often mimic some flu-like symptoms. Discontinuation of causative antibiotic treatment is often curative.

C. difficile infections can range in severity from asymptomatic to severe and life-threatening, especially among the elderly. People most often get infected in hospitals, nursing homes, or institutions, although C. difficile infection in the community, outpatient setting is increasing. The rate of C. difficile acquisition is estimated to be 13% in patients with hospital stays of up to 2 weeks, and 50% in those with hospital stays longer than 4 weeks. Frequency and severity of C. difficile colitis remains high and seems to be associated with increased death rates. Early intervention and aggressive management are key factors to recovery.

The emergence of a new, highly toxic strain of C. difficile, resistant to fluoroquinolone antibiotics, such as Cipro (ciprofloxacin) and Levaquin (levofloxacin), said to be causing geographically dispersed outbreaks in North America was reported in 2005 (Dial S, Delaney J, Barkun A, Suissa S (2005). “Use of gastric acid-suppressive agents and the risk of community-acquired Clostridium difficile-associated disease”. JAMA 294 (23): 2989-95. doi:10.1001/jama.294.23.2989).

On Jun. 4, 2003, two outbreaks of a highly virulent strain of this bacterium were reported in Montreal, Quebec and Calgary, Alberta, in Canada. Sources put the death count as low as 36 and as high as 89, with approximately 1,400 cases in 2003 and within the first few months of 2004. C. difficile infections continued to be a problem in the Quebec health care system in late 2004. As of March 2005, it had spread into the Toronto, Ontario area, hospitalizing 10 people.

A similar outbreak took place at Stoke Mandeville Hospital in the United Kingdom between 2003 and 2005.

It has been suggested that both the Canadian and English outbreaks were related to the seemingly more virulent Strain NAP1/BI/027 of the bacterium. This strain, also known as Quebec strain, has also been implicated in an epidemic at two Dutch hospitals (Harderwijk and Amersfoort, both 2005). A theory for explaining the increased virulence of 027 is that it is a hyperproducer of both toxins A and B, and that certain antibiotics may actually stimulate the bacteria to hyperproduce.

As one analyzes the pool of patients with the spores, many that are asymptomatic will pass the organism to individuals that are immunocompromised and, hence, susceptible to increasing rates of diarrhea and poor outcome. It seems notable that the clusters described above represent a challenge to epidemiologists trying to understand how the illness spreads via the convergence of information technology with clinical surveillance.

On Oct. 1, 2006, C. difficile was said to have killed at least 49 people at hospitals in Leicester, England over eight months, according to a National Health Service investigation.

On Oct. 27, 2006, 9 deaths were attributed to the bacterium in Quebec, Canada.

On Feb. 27, 2007, a new outbreak was identified at Trillium Health Centre in Mississauga, Ontario, where 14 people were diagnosed with the bacteria. The bacteria were of the same strain as the one in Quebec. Officials have not been able to determine whether C. difficile was responsible for deaths of four patients over the prior two months.

In October 2007, Maidstone and Tunbridge Wells NHS Trust was heavily criticized by the Healthcare Commission regarding its handling of a major outbreak of C. difficile in its hospitals in Kent from April 2004 to September 2006. In its report, the Commission estimated that about 90 patients “definitely or probably” died as a result of the infection (Healthcare Commission press release: Healthcare watchdog finds significant failings in infection control at Maidstone and Tunbridge Wells NHS Trust, 11 Oct. 2007 and Daily Telegraph, Health Secretary intervenes in superbug row, 11 Oct. 2007).

Thus, there is a need for a method for the detection and characterization of a toxinogenic Clostridium difficile strain in a sample.

SUMMARY OF THE INVENTION

The inventors have found a pioneering method for the detection and characterization of a toxinogenic Clostridium difficile strain in a sample. The advantage is that multiple diagnostic questions may be addressed in one single method. This method now allows designation of a sample as comprising a hypervirulant Clostridium difficile strain. Further, it allows scoring of a sample as a non NAP1/BI/027 strain. Also the sample may be scored as NAP1/BI/027 strain. It may be also scored as ribotype 078 strain, or scored as 017 strain. Hence, in a single assay all of the above designations may be done.

The invention relates to a method for the detection and characterization of a toxinogenic Clostridium difficile strain in a sample, wherein the following steps are performed, (a) a sample is provided for, (b) in a multiplex PCR assay, (c) the sample is analyzed with respect to the presence or absence of the cytotoxin tcdB gene, (d) the sample is analyzed with respect to the presence or absence of one or more of the following deletions in the tcdC gene: (a) an 18 bp deletion in SEQ ID NO. 1 from nucleotide 330 to nucleotide 347, (b) a 36 bp deletion in SEQ ID NO. 1 from nucleotide 301 to nucleotide 336, (c) 39 bp deletion in SEQ ID NO. 1 from nucleotide 341 to nucleotide 370, (d) 54 bp deletion in SEQ ID NO. 1 from nucleotide 313 to nucleotide 366 and (e) a single nucleotide deletion at position 117 of SEQ ID NO. 1.

The invention also relates to a kit for performing the methods of the invention, comprising primers and or probes for amplifying and/or detecting (i) the cytotoxin tcdB gene, (ii) the 1.8 kb deletion in the tcdA gene, (iii) an 18 bp deletion in SEQ ID NO. 1 from nucleotide 330 to nucleotide 347 of the tcdC gene, (iv) a 39 bp deletion in SEQ ID NO. 1 from nucleotide 341 to nucleotide 370 of the tcdC gene, (v) a single nucleotide deletion at position 117 of SEQ ID NO. 1 and primers and/or probes for (vi) the detection of the binary toxin cdtA/B gene.

“Polymerase chain reaction” or “PCR” means a reaction for the in vitro amplification of specific DNA sequences by the simultaneous primer extension of complementary strands of DNA. In other words, PCR is a reaction for making multiple copies or replicates of a target nucleic acid flanked by primer binding sites, such reaction comprising one or more repetitions of the following steps: (i) denaturing the target nucleic acid, (ii) annealing primers to the primer binding sites, and (iii) extending the primers by a nucleic acid polymerase in the presence of nucleoside triphosphates. Usually, the reaction is cycled through different temperatures optimized for each step in a thermal cycler instrument. Particular temperatures, durations at each step, and rates of change between steps depend on many factors well-known to those of ordinary skill in the art, e.g. exemplified by the references: McPherson et al, editors, PCR: A Practical Approach and PCR2: A Practical Approach (IRL Press, Oxford, 1991 and 1995, respectively). For example, in a conventional

PCR using Taq DNA polymerase, a double stranded target nucleic acid may be denatured at a temperature >90° C., primers annealed at a temperature in the range 50-75° C., and primers extended at a temperature in the range 72-78° C.

The term “PCR” encompasses derivative forms of the reaction, including but not limited to, real-time PCR, nested PCR, quantitative PCR, multiplexed PCR, and the like.

Reaction volumes range from a few hundred nanoliters, e.g. 200 nl, to a few hundred microlitres. Herein, preferred volumes are 10-50 microliter more preferably about 25 microliters per reaction chamber.

“Real-time PCR” means a PCR for which the amount of reaction product, i.e. amplicon, is monitored as the reaction proceeds. There are many forms of real-time PCR that differ mainly in the detection chemistries used for monitoring the reaction product, e.g. Gelfand et aI, U.S. Pat. No. 5,210,015 (“taqman”); Wittwer et al, U.S. Pat. Nos. 6,174,670 and 6,569,627 (intercalating dyes); Tyagi et al, U.S. Pat. No. 5,925,517 (molecular beacons). Detection chemistries for real-time PCR are reviewed in Mackay et aI, Nucleic Acids Research, 30: 1292-1305 (2002). In real time PCR a two temperature stage reaction may also be used in which the polymerisation temperature equals the annealing temperature, even for typical hybridization probes like Scorpion primers or Pleiades probes.

“Multiplexed PCR” means a PCR wherein multiple target sequences (or a single target sequence and one or more reference sequences) are simultaneously carried out in the same reaction mixture, e.g. Bernard et al, Anal. Biochem., 273: 221-228 (1999) (two-color real-time PCR). Usually, distinct sets of primers are employed for each sequence being amplified. Typically, the number of target sequences in a multiplex PCR is in the range of from 2 to 10, or from 2 to 8, or more typically, from 3 to 6. The preferred number is 2-6 for the present invention.

“Quantitative PCR” means a PCR designed to measure the abundance of one or more specific target sequences in a sample or specimen. Quantitative PCR includes both absolute quantitation and relative quantitation of such target sequences. Quantitative measurements are made using one or more reference sequences that may be assayed separately or together with a target sequence. The reference sequence may be endogenous or exogenous to a sample or specimen, and in the latter case, may comprise one or more competitor templates. Typical endogenous reference sequences include segments of transcripts of the following genes: pactin, GAPDH, microglobulin, ribosomal RNA, and the like. Techniques for quantitative PCR are well-known to those of ordinary skill in the art, as exemplified in the following references: ‘Freeman et aI., Biotechniques, 26: 112-126 15 (1999); Becker-Andre et aI, Nucleic Acids Research, 17: 9437-9447 (1989); Zimmerman et aI, Biotechniques, 21: 268-279 (1996); Diviacco et aI, Gene, 122: 3013-3020 (1992); BeckerAndre et aI, Nucleic Acids Research, 17: 9437-9446 (1989); and the like.

“Primer” means an oligonucleotide, either natural or synthetic that is capable, upon forming a duplex with a polynucleotide template, of acting as a point of initiation of nucleic acid synthesis and being extended from its 3′ end along the template so that an extended duplex is formed. Extension of a primer is usually carried out with a nucleic acid polymerase, such as a DNA or RNA polymerase. The sequence of nucleotides added in the extension process is determined by the sequence of the template polynucleotide. Usually primers are extended by a DNA polymerase. Primers usually have a length in the range of from 14 to 40 nucleotides, or in the range of from 18 to 36 nucleotides. Primers are employed in a variety of nucleic amplification reactions, for example, linear amplification reactions using a single primer, or polymerase chain reactions, employing two or more primers. Guidance for selecting the lengths and sequences of primers for particular applications is well known to those of ordinary skill in the art, as evidenced by the following references: Dieffenbach, editor, PCR Primer: A Laboratory Manual, 2nd Edition (Cold Spring Harbor Press, New York, 2003).

“Sample” means a quantity of material from a biological, environmental, medical, or patient source in which detection or measurement of target nucleic acids is sought. On the one hand it is meant to include a specimen or culture (e.g., microbiological cultures). On the other hand, it is meant to include both biological and environmental samples. A sample may include a specimen of synthetic origin. Biological samples may be animal, including human, fluid, solid (e.g., stool) or tissue, as well as liquid and solid food and feed products and ingredients such as dairy items, vegetables, meat and meat by-products, and waste. Biological samples may include materials taken from a patient including, but not limited to cultures, blood, saliva, cerebral spinal fluid, pleural fluid, semen, needle aspirates, and the like. Biological samples may be obtained from all of the various families of domestic animals, as well as feral or wild animals, including, but not limited to, such animals as ungulates, bear, fish, rodents, etc. Environmental samples include environmental material such as surface matter, soil, water and industrial samples, as well as samples obtained from food and dairy processing instruments, apparatus, equipment, utensils, disposable and non-disposable items. These examples are not to be construed as limiting the sample types applicable to the present invention. The terms “sample” and “specimen” are used interchangeably.

Preferred amplification products are depicted in the following table:

TABLE 1
SEQ C. difficile
ID NO target name target length (bp) target sequence
2 tcdB (amplicon 1) 120 CATTAGATGAAACTATAGACTTACTTCCTACATTATC
TGAAGGATTACCTATAATTGCAACTATTATAGATGGT
GTAAGTTTAGGTGCAGCAATCAAAGAGCTAAGTGAAA
CGAGTGACC
3 tcdB (amplicon 2) 140 TTTTGCCCCAGCTAATACACTTGATGAAAACCTAGAA
GGAGAAGCAATTGATTTTACTGGAAAATTAATTATTG
ACGAAAATATTTATTATTTTGATGATAATTATAGAGG
AGCTGTAGAATGGAAAGAATTAGATGGTG
4 tcdC_nt117 140 TGAAAGAAAAGGAAGCTCTAAGAAAATAATTAAATTC
TTTAAGAGCACAAAGGATATTGCTCTACTGGCATTTA
TTTTGGTGTGTTTTTTGGCAATATATCCTCACCAGCT
TGTTCTGAAGACCATGAGGAGGTCATTTC
5 tcdC deletions 18 bp, 200; same target CAAAATGAAAGACGACGAAAAGAAAGCTATTGAAGCT
36 bp, 39 bp and 54 bp region for all GAAAATCAACGTAAAGCTGAAGAAGCTAAAAAAGCTG
AAGAAGCTAAAAAGGCTGAAGAACAACGCAAAAAAGA
AGAAGAGGAGAAGAAAGGATATGATACTGGTATTACT
TATGACCAATTAGCTAGAACACCTGATGATTATAGTA
CAAAAGGTAAATTTG
6 binary toxin 200 GTTGATGTCTGATTGGGAAGACGAAGATTTGGATACA
GATAATGATAATATACCAGATTCATATGAACGAAATG
GATATACTATTAAGGACTTAATTGCAGTTAAGTGGGA
AGATAGTTTTGCAGAACAAGGCTATAAGAAATATGTA
TCAAATTATTTAGAGTCAAATACTGCTGGAGATCCAT
ATACAGATTATGAAA
7 tcdA deletion(s) 540 TTTATCAAAGTAAATTCTTAACTTTGAATGGCAAAAA
ATATTATTTTGATAATGACTCAAAAGCAGTTACTGGA
TGGCAAACCATTGATGGTAAAAAATATTACTTTAAT
CTTAACACTGCTGAAGCAGCTACTGGATGGCAAACTA
TTGATGGTAAAAAATATTACTTTAATACTAACACTTC
CATAGCTTCAACTGGTTATACAATTATTAATGGTAAA
CATTTTTATTTTAATACTGATGGTATTATGCAGATAG
GAGTGTTTAAAGGACCTAATGGATTTGAATACTTTG
CACCTGCTAATACGGATGCTAACAATATAGAAGGTCA
AGCTATACGTTATCAAAATAGATTCCTATATTTACAT
GACAATATATATTACTTTGGTAATAATTCAAAAGCAG
TTACTGGATGGCAAACTATTAATGGTAATGTATATTA
CTTTATGCCTGATACTGCTATGGCTGCAGCTGGTGGA
CTTTTCGAGATTGATGGTGTTATATATTTCTTTGGTG
TTGATGGAGTAAAAGCCCCTGGGA
8 tcdC 18-bp amplicon 145 GAAGCTGAAAATCAACGTAAAGCTGAAGAAGCTAAAA
AGGCTGAAGAACAACGTAAAAAAGAAGAAGAAGAGA
AGAAAGGATATGATACTGGTATTACTTATGACCAATT
AGCTAGAACACCTGATGATTATAAGTACAAAAAGG
9 tcdC 36-bp amplicon 138 AGAAAGCTATTGAAGCTGAAGAAGCTAAGAAAGCTGA
AGAACAACGTAAAAAAGAAGAAGAAGAGAAGAAAGGA
TATGATACTGGTATTACTTATGACCAATTAGCTAGAA
CATCTGATGATTATAAGTACAAAAAGG
10 tcdC 39-bp amplicon 95 AGCTAAAAAGGCTGAAGAAGAGAAGAAAGGATATGAT
ACTGGTATTACTTATGACCAATTAGCTAGAACATCTG
ATGATTATAAGTACAAAAAGG
11 tcdC 54-bp amplicon 110 TGAAGCTGAAAATCAACGTAAAAAAGAAGAAGAGGAG
AAGAAAGGATATGATACTGGTATTACTTATGACCAAT
TAGCTAGAACATCTGATGATTATAAGTACAAAAAGG
1 full wt tcdC sequence 699 ATGTTTTCTAAAAAAAATGATGGTAACGAATTTAGTA
(strain 630 ACCESSION ATGAAGGAAAAGGAAGCTCTAAGAAAATAATTAAATT
AM180355 REGION: CTTTAAGAGCACAAAGGGTATTGCTCTACTGGCATTT
804310 . . . 805008) ATTTTAGGCGTGTTTTTTGGCAATATATCCTCACCAG
CTTGTTCTGAAGACCATGAGGAGGTCATTTCTAACCA
AACATCAGTTATAGATTCTCAAAAAACAGAAATAGAA
ACTTTAAATAGCAAATTGTCTGATGCTGAACCATGGT
TCAAAATGAAAGACGACGAAAAGAAAGCTATTGAAGC
TGAAAATCAACGTAAAGCTGAAGAAGCTAAAAAAGCT
GAAGAAGCTAAAAAGGCTGAAGAACAACGCAAAAAAG
AAGAAGAGGAGAAGAAAGGATATGATACTGGTATTAC
TTATGACCAATTAGCTAGAACACCTGATGATTATAAG
TACAAAAAGGTAAAATTTGAAGGTAAGGTTATTCAAG
TTATTGAAGATGGTGATGAGGTGCAAATAAGATTAGC
TGTGTCTGGAAATTATGATAAGGTTGTACTATGTAGT
TATAAAAAATCAATAACTCCTTCAAGAGTATTAGAGG
ATGATTACATAACTATAAGAGGTATAAGTGCTGGAAC
TATAACTTATGAATCAACTATGGGTGGAAATATAACT
ATACCAGGGATAGCTGTAGAGAAAATTAATTAA
12 full ribotype 027 tcdC 680 ATGTTTTCTAAAAAAAATGAGGGTAACGAATTTAGTA
sequence (incl nt117 ATGAAAGAAAAGGAAGCTCTAAGAAAATAATTAAATT
and 18-bp deletion) CTTTAAGAGCACAAAGGATATTGCTCTACTGGCATTT
ACCESSION DQ861412 ATTTTGGTGTGTTTTTTGGCAATATATCCTCACCAGC
TTGTTCTGAAGACCATGAGGAGGTCATTTCTAATCAA
ACATCAGTTATAGATTCTCAAAAAACAGAAATAGAAA
CTTTAAATAGCAAATTGTCTGATGCTGAACCATGGTT
CAAAATGAAAGACGACGAAAAGAAAGCTATTGAAGCT
GAAAATCAACGTAAAGCTGAAGAAGCTAAAAAGGCTG
AAGAACAACGTAAAAAAGAAGAAGAAGAGAAGAAAGG
ATATGATACTGGTATTACTTATGACCAATTAGCTAGA
ACACCTGATGATTATAAGTACAAAAAGGTAAAATTTG
AAGGTAAGGTTATTCAAGTTATTGAAGATGGTGATGA
GGTGCAAATAAGATTAGCTGTGTCTGGAAATTATGAT
AAGGTCGTACTATGTAGTTATAAAAAATCAATAACTC
CTTCAAGAGTGTTAGAGGATGATTACATAACTATAAG
AGGTATAAGTGCTGGAACTATAACTTATGAATCAACT
ATGGGTGGAAAAATAACCATACCAGGGATAGCTGTAG
AGAAAATTAATTAA
13 full tcdC sequence of 663 ATGTTTTCTAAAAAAAATGAGGGTAACGAATTTAGTA
36-bp deletion variant ATGAAGGAAAAGGAAGCTCTAAGAAAATAATTAAATT
(ACCESSION DQ861424) CTTTAAGAGCACAAAGGATATTGCTCTACTGGCATTT
ATTTTTGGTGTGTTTTTTGGCAATATATCCTCACCAG
CTTGTTCTGAAGACCATGAGGAGGTCATTTCTAATCA
AACATAAGTTATAGATTCTCAAAAAACAGAAATAGAA
ACTTTAAATAGCAAATTGTCTGATGCTGAACCATGGT
TCAAAATGAAAGATGACGAAAAGAAAGCTATTGAAGC
TGAAGAAGCTAAGAAAGCTGAAGAACAACGTAAAAAA
GAAGAAGAAGAGAAGAAAGGATATGATACTGGTATTA
CTTATGACCAATTAGCTAGAACATCTGATGATTATAA
GTACAAAAAGGTAAAATTTGAAGGTAAGGTTATTCAA
GTTATTGAAGATGGTGATGAGGTGCAAATAAGATTAG
CTGTGTCTGGAAATTATGATGAGGTCGTACTATGTAG
TTATAAAAAATCAATAACTCCTTCAAGAGTGTTAGAG
GATGATTACATAACTATAAGAGGTATAAGTGCTGGAA
CTATAACTTATGAATCAACTATGGGTGGAAAAATAAC
TATACCAGGAATAGCTGTAGAGAAAATAAATTAA
14 full tcdC sequence of 660 ATGTTTTCTAAAAAAAATGAGGGTAACGAATTTAGTA
39-bp deletion variant ATGAAGGAAAAGGAATCTCTAAGAAAATAATTAAATT
(ACCESSION EF470292) CTTTAAGAGCACAAAGGGTATTGCTCTACTGGCATTT
ATTTTTGGTGTGTTTTTTGGCAATATATCCTCACCAG
CTTGTTCTGAAGACCATGAGGAGGTCATTTCTAATTA
AACATCAGTTATAGATTCTCAAAAAACAGAAATAGAA
ACTTTAAATAGCAAATTGTCTGATGCTGAACCATGGT
TCAAAATGAAAGACGACGAAAAGAAAGCTATTGAAGC
TGAAAATCAACGTAAAGCTGAAGAAGCTAAAAAGGCT
GAAGAAGAGAAGAAAGGATATGATACTGGTATTACTT
ATGACCAATTAGCTAGAACATCTGATGATTATAAGTA
CAAAAAGGTAAAATTTGAAGGTAAGGTTATTCAAGTT
ATTGAAGATGGTGATGAGGTGCAAATAAGATTCGCTG
GTCTGGAAATTATGATAAGGTTGTACTATGTAGTTAA
AAAAAATCAATAACTCCTTCAAGAGTGTTAGAGGATG
ATTACATAACTATAAGAGGTATAAGTGCTGGAACTAT
AACTTATGAATCAACTATGGGTGGAAACATAACTATA
CCAGGAATAGCTGTAGAGAAAATTAATTAA
15 full tcdC sequence of 645 ATGTTTTCTAAAAAAAATGATGGTAACGAATTTAGTA
54-bp deletion variant ATGAAGGAAAAGGAAGCTCTAAGAAAATAATTAAATT
(not in public database) CTTTAAGAGCACAAAGGGTATTGCTCTACTGGCATTT
ATTTTAGGCGTGTTTTTTGGCAATATATCCTCACCAG
CTTGTTCTGAAGACCATGAGGAGGTCATTTCTAACCA
AACATCAGTTATAGATTCTCAAAAAACAGAAATAGAA
ACTTTAAATAGCAAATTGTCTGATGCTGAACCATGGT
TCAAAATGAAAGACGACGAAAAGAAAGCTATTGAAGC
TGAAAATCAACGTAAAAAAGAAGAAGAGGAGAAGAAA
GGATATGATACTGGTATTACTTATGACCAATTAGCTA
GAACATCTGATGATTATAAGTACAAAAAGGTAAAATT
TGAAGGTAAGGTTATTCAAGTTATTGAAGATGGTGAT
GAGGTGCAAATAAGATTAGCTGTGTCTGGAAATTATG
ATAAGGTTGTACTATGTAGTTATAAAAAATCAATAAC
TCCTTCAAGAGTATTAGAGGATGATTACATAACTATA
AGAGGTATAAGTGCTGGAACTATAACTTATGAATCAA
CTATGGGTGGAAATATAACTATACCAGGGATAGCTGT
AGAGAAAATTAATTAA
2 SEQ ID NO. 2 is the preferred tcdB amplicon.
3 SEQ ID NO. 3 is a further preferred tcdB amplicon.
4 SEQ ID NO. 4 discloses the tcdC nt117 deletion.
5 SEQ ID NO. 5 discloses the tcdC deletions 18 bp, 36 bp, 39 bp and 54 bp.
6 SEQ ID NO. 6 discloses the binary toxin.
7 SEQ ID NO. 6 discloses the tcdA deletion(s).
8 SEQ ID NO. 8 is the preferred tcdC 18-bp amplicon.
9 SEQ ID NO. 9 is the preferred tcdC 36-bp.
10 SEQ ID NO. 10 is the preferred tcdC 39-bp amplicon
11 SEQ ID NO. 11 is the preferred tcdC 54-bp amplicon
1 SEQ ID NO. 1 is the full length wt tcdC sequence (strain 630 ACCESSION AM180355
REGION: 804310 . . . 805008)
12 SEQ ID NO. 12 is full length ribotype 027 tcdC sequence (incl nt117 and 18-bp
deletion) ACCESSION DQ861412
13 SEQ ID NO. 13 is the full length tcdC sequence of 36-bp deletion variant
(ACCESSION DQ861424)
14 SEQ ID NO. 14 is the full length tcdC sequence of 39-bp deletion variant
(ACCESSION EF470292)
15 SEQ ID NO. 15 is the full length tcdC sequence of 54-bp deletion variant.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows the preferred targets according to the present invention.

FIG. 2 shows a possible cartridge set-up according to the invention.

DETAILED DESCRIPTION OF EMBODIMENTS

The invention relates to a method for the detection and characterization of a toxinogenic Clostridium difficile strain in a sample, wherein the following steps are performed, (a) a sample is provided for, (b) in a multiplex PCR assay, (c) the sample is analyzed with respect to the presence or absence of the cytotoxin tcdB gene, (d) the sample is analyzed with respect to the presence or absence of one or more of the following deletions in the tcdC gene: (a) an 18 bp deletion in SEQ ID NO. 1 from nucleotide 330 to nucleotide 347, (b) a 36 bp deletion in SEQ ID NO. 1 from nucleotide 301 to nucleotide 336, (c) 39 bp deletion in SEQ ID NO. 1 from nucleotide 341 to nucleotide 370, (d) 54 bp deletion in SEQ ID NO. 1 from nucleotide 313 to nucleotide 366 and (e) a single nucleotide deletion at position 117 of SEQ ID NO. 1.

Optionally, the sample is additionally analyzed with respect to the presence or absence of the enterotoxin tcdA gene 1.8 kb deletion.

Preferably, the sample is additionally analyzed with respect to the presence or absence of the binary toxin cdtA and/or cdtB.

In one embodiment of the method according to the invention the sample is analyzed with respect to, (i) the presence or absence of all of following the deletions, (a) a 18 bp deletion in SEQ ID NO. 1 from nucleotide 330 to nucleotide 347, (b) a 39 bp deletion in SEQ ID NO. 1 from nucleotide 341 to nucleotide 370 and (c) a single nucleotide deletion at position 117 of SEQ ID NO. 1, (ii) the sample is analyzed with respect to the presence or absence of the cytotoxin tcdB gene, (iii) the sample is analyzed with respect to the presence or absence of the 1.8 kb tcdA deletion and (iv) the sample is analyzed with respect to the presence or absence of the cdtA/B binary toxin gene.

Preferably in the method according to the invention (a) if the tcdB gene sequence is present, the tcdA deletion is absent, neither the single nucleotide deletion at position 117 of SEQ ID NO. 1 is present, nor the 18 bp deletion is present, nor the 39 bp deletion is present, then the sample is scored as toxinogenic Clostridium difficile, (b) if the tcdB gene sequence is present, the tcdA deletion is absent, the single nucleotide deletion at position 117 of SEQ ID NO. 1 is present, the 18 bp deletion is present, the cdtA/B binary toxin gene is present, then the sample is scored as a ribotype 027 Clostridium difficile strain, (c) if the tcdB gene sequence is present, the tcdA deletion is present, neither the single nucleotide deletion at position 117 of SEQ ID NO. 1 is present, nor the 18 bp deletion is present, nor the 39 bp deletion in SEQ ID NO. 1 from nucleotide 341 to nucleotide 370 is present, the cdtA/B binary toxin gene is absent, then the sample is scored as a ribotype 017 Clostridium difficile strain and (d) if the tcdB gene sequence is present, the tcdA deletion is absent, the 39 bp deletion in SEQ ID NO. 1 from nucleotide 341 to nucleotide 370 is present, the cdtA/B binary toxin gene is present, then the sample is scored as a ribotype 078 Clostridium difficile strain.

Optionally and additionally the following further targets may be analyzed. These are targets associated with hypervirulence, such as but not limited to tcdCΔ36bp, tcdCΔ54bp. The strains carrying the 36-bp, 39-bp or 54-bp deletions all have additional specific mutations upstream in the tcdC gene that result in a truncated and non-functional

TcdC protein which is preferably part of the assay.

Specific variations in the 3′ part of the tcdB gene have been reported relative to non-NAP1/BI/027 strains which are preferably in the assay.

Preferably the amplification products in the multiplex PCR assay are between 60 and 200 bp in size.

In one embodiment, the multiplex amplification reaction is done in a closed system in the presence of fluorescent indicators in the reaction mixture(s), the fluorescent indicators being capable of generating an optical signal related to a presence and/or quantity of each amplicon in the amplification reaction and monitoring the optical signal of the fluorescent indicators in the amplification reaction

In the method according to the invention the closed system gives an optical output for the user, indicating the scoring assignment outlined above.

Preferably, the multiplex PCR amplification is quantitative real-time PCR. The real-time PCR (also designated herein as quantitative PCR or quantitative real-time PCR (qPCR)) is a method to simultaneously amplify and quantify nucleic acids using a polymerase chain reaction (PCR). Quantitative real-time reverse transcription PCR (RT-qPCR) is a quantitative real-time PCR method further comprising a reverse transcription of RNA into DNA, e.g. mRNA into cDNA. In qPCR methods, the amplified nucleic acid is quantified as it accumulates. Typically, fluorescent dyes that intercalate with double-stranded DNA (e.g. ethidiumbromide or SYBR® Green I) or modified nucleic acid probes (“reporter probes”) that fluoresce when hybridized with a complementary nucleic acid (e.g. the accumulating DNA) are used for quantification in qPCR based methods. Particularly, fluorogenic primers, hybridization probes (e.g. LightCycler probes (Roche)), hydrolysis probes (e.g. TaqMan probes (Roche)), or hairpin probes, such as molecular beacons, Scorpion primers (DxS), Sunrise primers (Oncor), LUX primers (Invitrogen), Amplifluor primers (Intergen) or the like can be used as reporter probes. In accordance with the present invention, fluorogenic primers or probes may for example be primers or probes to which fluorescence dyes have been attached, e.g. covalently attached. Such fluorescence dyes may for example be FAM (5-or 6-carboxyfluorescein), VIC, NED, Fluorescein, FITC, IRD-700/800, CY3, CY5, CY3.5, CY5.5, HEX, TET, TAMRA, JOE, ROX, BODIPY TMR, Oregon Green, Rhodamine Green, Rhodamine Red, Texas Red, Yakima Yellow, Alexa Fluor, PET Biosearch Blue™, Marina Blue®, Bothell Blue®, CAL Fluor® Gold, CAL Fluor® Red 610, Quasar™ 670, LightCycler Red640®, Quasar™ 705, LightCycler Red705® and the like. Particular reporter probes may additionally comprise fluorescence quenchers.

For the embodiments of the present invention selective primers can be used in quantitative real-time multiplex PCR.

A “primer” herein refers to an oligonucleotide comprising a sequence that is complementary to a nucleic acid to be transcribed (“template”). During replication polymerases attach nucleotides to the 3′ end of the primer complementary to the respective nucleotides of the template.

In particular embodiments of the invention the polymerase used for quantitative real-time PCR is a polymerase from a thermophile organism or a thermostable polymerase or is selected from the group consisting of Thermus thermophilus (Tth) DNA polymerase, Thermus acquaticus (Taq) DNA polymerase, Thermotoga maritima (Tma) DNA polymerase, Thermococcus litoralis (Tli) DNA polymerase, Pyrococcus furiosus (Pfu) DNA polymerase, Pyrococcus woesei (Pwo) DNA polymerase, Pyrococcus kodakaraensis KOD DNA polymerase, Thermus filiformis (Tfi) DNA polymerase, Sulfolobus solfataricus Dpo4 DNA polymerase, Thermus pacificus (Tpac) DNA polymerase, Thermus eggertssonii (Teg) DNA polymerase, Thermus brockianus (Tbr) and Thermus flavus (Tfl) DNA polymerase.

Particularly, the fluorescently labelled probes are labelled with a dye selected from the group consisting of FAM, VIC, NED, Fluorescein, FITC, IRD-700/800, CY3, CY5, CY3.5, CY5.5, HEX, TET, TAMRA, JOE, ROX, BODIPY TMR, Oregon Green, Rhodamine Green, Rhodamine Red, Texas Red, Yakima Yellow, Alexa Fluor and PET.

In particular, the hybridization probe is a LightCycler probe (Roche) or the hydrolysis probe is a TaqMan probe (Roche). In other embodiments the hairpin probe is selected from the group consisting of molecular beacon, Scorpion primer, Sunrise primer, LUX primer and Amplifluor primer. The TaqMan probes are preferred.

The invention relates to a closed system amplification cartridge comprising one or more channels or chambers comprising primers and/or probes for amplifying and/or detecting (i) the cytotoxin tcdB gene, (ii) the 1.8 kb deletion in the tcdA gene, (iii) an 18 bp deletion in SEQ ID NO. 1 from nucleotide 330 to nucleotide 347 of the tcdC gene, (iv) a 39 bp deletion in SEQ ID NO. 1 from nucleotide 341 to nucleotide 370 of the tcdC gene, (v) a single nucleotide deletion at position 117 of SEQ ID NO. 1 and primers and/or probes for the detection of the binary toxin cdtA/B gene.

The invention also relates to a kit for performing the methods of the invention, comprising primers and or probes for amplifying and/or detecting (i) the cytotoxin tcdB gene, (ii) the 1.8 kb deletion in the tcdA gene, (iii) an 18 bp deletion in SEQ ID NO. 1 from nucleotide 330 to nucleotide 347 of the tcdC gene, (iv) a 39 bp deletion in SEQ ID NO. 1 from nucleotide 341 to nucleotide 370 of the tcdC gene, (v) a single nucleotide deletion at position 117 of SEQ ID NO. 1 and primers and/or probes for (vi) the detection of the binary toxin cdtA/B gene.

In preferred embodiments of the invention, the kit additionally comprises enzymes such as a polymerase a buffer and other ingredients.

In one embodiment the method may take place in a cartridge which is designed for performing sample preparation and real-time multiplex PCR. These are systems, methods, and apparatus for closed multi-stage nucleic acid amplification reactions wherein a portion of a prior-stage reaction mixture serves as the sample for the next stage reaction. The invention provides a method as outlined above for controlling the amplification comprising the step of (i) amplifying said multiplex reaction in the presence of a fluorescent indicator in a reaction mixture, the fluorescent indicator being capable of generating an optical signal related to a quantity of an amplicon in the amplification reaction; (ii) monitoring the optical signal of the fluorescent indicator in the amplification reaction.

The invention also relates to a closed system amplification cartridge comprising one or more channels or chambers comprising primers and or probes for amplifying and/or detecting (i) the cytotoxin tcdB gene, (ii) the tcdC gene, (iii) an 18 bp deletion in SEQ ID NO. 1 from nucleotide 330 to nucleotide 347, (iv) a 36 bp deletion in SEQ ID NO. 1 from nucleotide 301 to nucleotide 336, (v) a 39 bp deletion in SEQ ID NO. 1 from nucleotide 341 to nucleotide 370, (vi) a 54 bp deletion in SEQ ID NO. 1 from nucleotide 313 to nucleotide 366, (vii) a single nucleotide deletion at position 117 of SEQ ID NO. 1. Such a closed system is disclosed for example in WO 2006/047777. The cartridge may additionally comprise one or more chambers for sample preparation, e.g. cell lysis and/or nucleic acid extraction. Preferably the PCR chambers comprise a optically transparent surface, such as glass, crystal or plastic that allows for online detection of the amplification product.

Once the DNA has been isolated in the cartridge it is resolubilized in the mastermix, which is stored in lyophilized form inside the cartridge. Homogenizing the eluate in the mastermix solution then takes place. Filling the at least 3 to 5 PCR chambers (or a subset if the application so requires), such that no air is entrapped in the chambers is performed in the cartridge. Less than 5 chambers may be required by the amplification, here a cartridge variant may be used. The required elution volume can be adapted via the assay protocol. Closing the chambers during amplification, so that no amplicons may escape into the environment, and no air is allowed into the chambers is performed. Temperature-cycling the chambers is done. The cycling is synchronized between all chambers, with individual temperature set points. Fluorescence detection in up to 6 wavelengths is then done. Detection may be triggered at any moment in the cycle. Calculation of Ct values, initial concentrations and final test results, from the measurement data and, possibly, additional calibration data is performed. A test result is generated based on the Ct values for the targets of the invention.

The cartridge performs the PCR in a device. A specimen container or also cartridge herein arrives at the console, and the user enters the identifier (e.g. barcode, identifier on a paper order form, etc.) associated to the order. The console retrieves the associated order from the local console database. Next the user scans the RFID tag of the cartridge. The cartridge is checked on its validity (e.g. cartridge type corresponds with test type, expiration date, etc.). In case the cartridge is valid it is associated with the order in the console database. The console main service requests an available slot of an instrument. The instrument control subsystem returns an available slot after applying load-balancing. After notifying the user to insert the cartridge, the user inserts the cartridge in the suggested slot. The instrument control subsystem is notified that a cartridge was inserted and the console main service checks whether the cartridge is associated with the order. In case the cartridge is associated with the order, the recipe database is accessed to retrieve the recipe matching the test type in the order. After retrieving the recipe, the instrument control subsystem is ordered to upload the recipe and start the test for the slot where the cartridge was inserted. After completion of the test, the test result is received by the instrument control subsystem and the following steps will be performed:

The test result will be passed to the test result engine. The test result engine will store the result in the console database. Next the result will be send to the external IS via the external IS data exchange subsystem. And the user gets informed that the test is completed. The user gets an optical and/or acoustical output concerning the score.

As drawn in FIG. 2, the cartridge is divided into 6 modules. The modules are explained in detail in the following paragraphs. A module within the cartridge is defined for its functionality. All functionality of the cartridge is integrated as much as possible and realized with a minimal number of parts. The total process flow is as follows: The operator fills the lysis chamber manually with the sample and closes the input lid. The cartridge is placed on the tray of the slot and with the tray loaded into the slot. When loaded into the slot, the process starts with liquefying and lysing the sample. This is all done with the help of, e.g. HiFU energy in the lysis chamber. Different reagents are added after each other to the sample so that the final result can be flushed through the extraction membrane. All this steps are done in one chamber to be able to handle also high viscose samples like stool (feces). Also only one interface and HiFU source is needed for all the processes. The transport of reagents to the chamber is done by the fluid transport module. Within this module the reagents are stored for the shelf life, are taken out of the reservoirs and transported to the lysis chamber. The module also transports the treated sample from the lysis chamber through the extraction membrane to the waste. In the same way the washing lysis module, fluid transport module, extraction module, waste handling module, PCR module, manual sample input, covering reagents are handled, taken from the reservoir and transported through the membrane to the waste. By centralizing the fluid actuation and handling, the number of interfaces and the number of components within the cartridge for this support function are minimized. The previous mentioned extraction membrane is embodied within the extraction module. This module ensures a good flow through the membrane and a good heat transfer to the membrane. This heat is needed for the ethanol removal and elution of the DNA. The waste handling module is used to direct all fluids, except the eluate, to the waste this is done by the same type of valve as used in the fluid handling module. This is done to minimize the different techniques used within the cartridge for the same functionality. The second function of this module is to suck the elute buffer through the extraction membrane. The actuation is done by this module to minimize the risk of contamination of the eluate. This risk would be higher when the fluid transport module also was used for this function. Before the eluate is transported to the PCR chamber, first the mastermix must be added and the DNA content must be homogenized over the total volume. This is also done within this module. Finally the fluid is transported to the PCR chamber. The actuation is done with the same actuator as used earlier for the elute transport through the extraction membrane. Pressure driven fluid transport is chosen also for this transport function. Next to that the functionality for pressure driven fluid transport is already within the cartridge. The PCR chambers, placed within the PCR module, must be filled without air. To ensure this a de-aeration membrane is placed within the supply channel to remove mixing-bubbles going to the PCR chamber. The PCR chambers are made so that the geometry of the chamber limits the volume. This makes sure that the chambers are filled with the same volume even when the chambers are filled from one supply channel. The chambers are placed parallel within the fluidic structure to prevent any cross talk of primers and or probes that are specific per chamber. There is also a post-filling de-aeration filter.

Samples or specimens containing target polynucleotides (Clostridum difficile) may come from a wide variety of sources for use with the present invention, including cell cultures, animal or human tissues, patient biopsies, environmental samples, or the like. Samples are prepared for assays of the invention using conventional techniques, which typically depend on the source from which a sample or specimen is taken. Samples or specimens are collected so as to minimize the chance of contamination of the sample or specimen by external elements, or the environment by the sample or specimen if it contains hazardous components. Generally, this is carried out by introducing a sample for analysis, e.g., tissue, blood, saliva, etc., directly into a sample collection chamber within a fluidly closed system. Typically, the prevention of cross-contamination of the sample may be accomplished by directly injecting the sample into the sample collection chamber through a optionally sealable opening, e.g., an injection valve, or a septum. Generally, sealable valves are preferred to reduce any potential threat of leakage during or after sample injection. In addition to the foregoing, the sample collection portion of the device/cartridge may also include reagents and/or treatments for neutralization of infectious agents, stabilization of the specimen or sample, pH adjustments, and the like. Stabilization and pH adjustment treatments may include, e.g. introduction of heparin to prevent clotting of blood samples, addition of buffering agents, addition of protease, preservatives and the like. Such reagents may generally be stored within the sample collection chamber of the device/cartridge or may be stored within a separately accessible chamber, wherein the reagents may be added to or mixed with the sample upon introduction of the sample into the device. These reagents may be incorporated within the device in either liquid or lyophilized form, depending upon the nature and stability of the particular reagent used.

Herein the preferred sample is human or animal feces.

Prior to carrying out amplification reactions on a sample, it will often be desirable to perform one or more sample preparation operations upon the sample. Typically, these sample preparation operations will include such manipulations as extraction of intracellular material, e.g., nucleic acids from whole samples and the like. One or more of these various operations may be readily incorporated into the fluidly closed systems contemplated by the present invention.

For those embodiments where whole cells or other tissue samples are being analyzed, it will typically be necessary to extract the nucleic acids from the cells, feces, blood or other bodily fluids prior to continuing with the various sample preparation operations. Accordingly, following sample collection, nucleic acids may be liberated from the collected cells, into a crude extract, followed by additional treatments to prepare the sample for subsequent operations, e.g., denaturation of contaminating (DNA binding) proteins, purification, filtration, desalting, and the like. Liberation of nucleic acids from the sample cells, and denaturation of DNA binding proteins may generally be performed by chemical, physical, or electrolytic lysis methods. For example, chemical methods generally employ lysing agents to disrupt the cells and extract the nucleic acids from the cells, followed by treatment of the extract with chaotropic salts such as guanidinium isothiocyanate or urea to denature any contaminating and potentially interfering proteins. Generally, where chemical extraction and/or denaturation methods are used, the appropriate reagents may be incorporated within a sample preparation chamber, a separate accessible chamber, or may be externally introduced.

Physical methods may be used to extract the nucleic acids and denature DNA binding proteins. U.S. Pat. No. 5,304,481 discusses the use of physical protrusions within microchannels or sharp edged particles within a chamber or channel to pierce cell membranes and extract their contents. Combinations of such structures with piezoelectric elements for agitation can provide suitable shear forces for lysis. Such elements are described in greater detail with respect to nucleic acid fragmentation, below. More traditional methods of cell extraction may also be used, e.g., employing a channel with restricted cross-sectional dimension which causes cell lysis. Alternatively, cell extraction and denaturing of contaminating proteins may be carried out by applying an alternating electrical current to the sample. More specifically, the sample of cells is flowed through a microtubular array while an alternating electric current is applied across the fluid flow. A variety of other methods may be utilized within the device of the present invention to perform cell lysis/extraction, including, e.g., subjecting cells to ultrasonic agitation, or forcing cells through small apertures, thereby subjecting the cells to high shear stress resulting in rupture.

Following extraction, it will often be desirable to separate the nucleic acids from other elements of the crude extract, e.g., denatured proteins, cell membrane particles, salts, and the like. Removal of particulate matter is generally accomplished by filtration, flocculation or the like. A variety of filter types may be readily incorporated into the device. Further, where chemical denaturing methods are used, it may be desirable to desalt the sample prior to proceeding to the next step. Desalting of the sample, and isolation of the nucleic acid may generally be carried out in a single step, e.g., by binding the nucleic acids to a solid phase and washing away the contaminating salts or performing gel filtration chromatography on the sample, passing salts through dialysis membranes, and the like. Suitable solid supports for nucleic acid binding include, e.g., diatomaceous earth, silica (i.e., glass wool), or the like. Suitable gel exclusion media, also well known in the art, may also be readily incorporated into the device/cartridge of the present invention, and is commercially available from, e.g., Pharmacia and Sigma Chemical. The isolation and/or gel filtration/desalting may be carried out in an additional chamber, or alternatively, the particular chromatographic media may be incorporated in a channel or fluid passage leading to a subsequent reaction chamber. Alternatively, the interior surfaces of one or more fluid passages or chambers may themselves be derivatized to provide functional groups appropriate for the desired purification, e.g., charged groups, affinity binding groups and the like. Alternatively, desalting methods may generally take advantage of the high electrophoretic mobility and negative charge of DNA compared to other elements. Electrophoretic methods may also be utilized in the purification of nucleic acids from other cell contaminants and debris. In one example, a separation channel or chamber of the device is fluidly connected to two separate “field” channels or chambers having electrodes, e.g., platinum electrodes, disposed therein. The two field channels are separated from the separation channel using an appropriate barrier or “capture membrane” which allows for passage of current without allowing passage of nucleic acids or other large molecules. The barrier generally serves two basic functions: first, the barrier acts to retain the nucleic acids which migrate toward the positive electrode within the separation chamber; and second, the barriers prevent the adverse effects associated with electrolysis at the electrode from entering into the reaction chamber (e.g., acting as a salt junction). Such barriers may include dialysis membranes, dense gels, PEI filters, or other suitable materials. Upon application of an appropriate electric field, the nucleic acids present in the sample will migrate toward the positive electrode and become trapped on the capture membrane. Sample impurities remaining free of the membrane are then washed from the chamber by applying an appropriate fluid flow. Upon reversal of the voltage, the nucleic acids are released from the membrane in a substantially purer form. The field channels may be disposed on the same or opposite sides or ends of a separation chamber or channel, and may be used in conjunction with mixing elements described herein, to ensure maximal efficiency of operation. Further, coarse filters may also be overlaid on the barriers to avoid any fouling of the barriers by particulate matter, proteins or nucleic acids, thereby permitting repeated use. In a similar aspect, the high electrophoretic mobility of nucleic acids with their negative charges, may be utilized to separate nucleic acids from contaminants by utilizing a short column of a gel or other appropriate matrix or gel which will slow or retard the flow of other contaminants while allowing the faster nucleic acids to pass.

In a preferred embodiment the probes and/or primers are distributed in the channels or chambers as follows: A specific mix of primers and probes is stably stored as dried material in each individual PCR chamber. With the filling of the PCR chamber with the premixed template/PCR reactionmix the stored primers/probes form a homogeneous solution with concentrations optimal for their designated reactions.

Claims

1. Method for the detection and characterization of a toxinogenic Clostridium difficile strain in a sample, wherein the following steps are performed,

a. a sample is provided for;

b. in a multiplex PCR assay,

i the sample is analyzed with respect to the presence or absence of the cytotoxin tcdB gene;

ii the sample is analyzed with respect to the presence or absence of one or more of the following deletions in the tcdC gene,

a) an 18 bp deletion in SEQ ID NO. 1 from nucleotide 330 to nucleotide 347;

b) a 36 bp deletion in SEQ ID NO. 1 from nucleotide 301 to nucleotide 336;

c) a 39 bp deletion in SEQ ID NO. 1 from nucleotide 341 to nucleotide 370;

d) a 54 bp deletion in SEQ ID NO. 1 from nucleotide 313 to nucleotide 366;

e) a single nucleotide deletion at position 117 of SEQ ID NO. 1

2. Method according to claim 1, wherein the sample is additionally analyzed with respect to the presence or absence of the enterotoxin tcdA gene 1.8 kb deletion.

3. Method according to claim 1, wherein the sample is additionally analyzed with respect to the presence or absence of the binary toxin cdtA and/or cdtB.

4. Method according to claim 1, wherein the sample is analyzed with respect to,

a. the presence or absence of all of the following deletions:

b. a 18 bp deletion in SEQ ID NO. 1 from nucleotide 330 to nucleotide 347, a 39 bp deletion in SEQ ID NO. 1 from nucleotide 341 to nucleotide 370,

c. a single nucleotide deletion at position 117 of SEQ ID NO. 1,

d. the presence or absence of the cytotoxin tcdB gene,

e. the presence or absence of the 1.8 kb tcdA deletion and

f. the presence or absence of the cdtA/B binary toxin gene.

5. Method according to claim 1, wherein

a. if the tcdB gene sequence is present, the tcdA deletion is absent, neither the single nucleotide deletion at position 117 of SEQ ID NO. 1 is present, nor the 18 bp deletion is present, nor the 39 bp deletion is present, then the sample is scored as toxinogenic Clostridium difficile,

b. if the tcdB gene sequence is present, the tcdA deletion is absent, the single nucleotide deletion at position 117 of SEQ ID NO. 1 is present, the 18 bp deletion is present, and the cdtA/B binary toxin gene is present, then the sample is scored as a ribotype 027 Clostridium difficile strain,

c. if the tcdB gene sequence is present, the tcdA deletion is present, neither the single nucleotide deletion at position 117 of SEQ ID NO. 1 is present, nor the 18 bp deletion is present, nor the 39 bp deletion in SEQ ID NO. 1 from nucleotide 341 to nucleotide 370 is present, and the cdtA/B binary toxin gene is absent, then the sample is scored as a ribotype 017 Clostridium difficile strain and

d. if the tcdB gene sequence is present, the tcdA deletion is absent, the 39 bp deletion in SEQ ID NO. 1 from nucleotide 341 to nucleotide 370 is present, and the cdtA/B binary toxin gene is present, then the sample is scored as a ribotype 078 Clostridium difficile strain.

6. Method according to claim 1, wherein the multiplex amplification reaction is done in a closed system in the presence of fluorescent indicators in the reaction mixture(s), the fluorescent indicators being capable of generating an optical signal related to a presence and/or quantity of each amplicon in the amplification reaction and monitoring the optical signal of the fluorescent indicators in the amplification reaction.

7. Method according to claim 6, wherein the closed system gives an optical output for the user.

8. Method according to claim 1, wherein the amplification products in the multiplex PCR assay are between 60 and 200 bp in size.

9. Method according to claim 1, wherein the multiplex PCR amplification is quantitative real-time PCR.

10. Method according to claim 1, wherein the sample is human or animal feces.

11. Closed system amplification cartridge comprising one or more channels or chambers comprising primers and/or probes for amplifying and/or detecting (i) the cytotoxin tcdB gene, (ii) the 1.8 kb deletion in the tcdA gene, (iii) an 18 bp deletion in SEQ ID NO. 1 from nucleotide 330 to nucleotide 347 of the tcdC gene, (iv) a 39 bp deletion in SEQ ID NO. 1 from nucleotide 341 to nucleotide 370 of the tcdC gene, (v) a single nucleotide deletion at position 117 of SEQ ID NO. 1 and primers and/or probes for the detection of the binary toxin cdtA/B gene.

12. Kit for performing the method according to claim 11, comprising primers and or probes for amplifying and/or detecting (i) the cytotoxin tcdB gene, (ii) the 1.8 kb deletion in the tcdA gene, (iii) an 18 bp deletion in SEQ ID NO. 1 from nucleotide 330 to nucleotide 347 of the tcdC gene, (iv) a 39 bp deletion in SEQ ID NO. 1 from nucleotide 341 to nucleotide 370 of the tcdC gene, (v) a single nucleotide deletion at position 117 of SEQ ID NO. 1 and primers and/or probes for (vi) the detection of the binary toxin cdtA/B gene.

Resources

Images & Drawings included:

Sources:

Recent applications in this class:

Recent applications for this Assignee: