Patent application title:

COMPOSITION AND METHOD FOR CANCER TREATMENT

Publication number:

US20120039885A1

Publication date:
Application number:

13/151,635

Filed date:

2011-06-02

Abstract:

Anti-CEACAM6 antibodies and antibody fragments, nucleic acids encoding them, methods of their manufacture, and methods to treat cancer using these compounds are provided.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

G01N33/57473 »  CPC main

Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing; Immunoassay; Biospecific binding assay; Materials therefor for cancer involving carcinoembryonic antigen, i.e. CEA

A61P43/00 »  CPC further

Drugs for specific purposes, not provided for in groups -

C07K16/2803 »  CPC further

Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily

A61K2039/505 »  CPC further

Medicinal preparations containing antigens or antibodies comprising antibodies

C07K2317/24 »  CPC further

Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered

C07K2317/56 »  CPC further

Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL

C07K2317/565 »  CPC further

Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL Complementarity determining region [CDR]

C07K2317/622 »  CPC further

Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components Single chain antibody (scFv)

G01N2333/70596 »  CPC further

Assays involving biological materials from specific organisms or of a specific nature from animals; from humans; Assays involving receptors, cell surface antigens or cell surface determinants Molecules with a "CD"-designation not provided for elsewhere in

A61K39/395 IPC

Medicinal preparations containing antigens or antibodies Antibodies ; Immunoglobulins; Immune serum, e.g. antilymphocytic serum

A61P35/00 »  CPC further

Antineoplastic agents

Description

This application claims priority to U.S. provisional application Ser. No. 60/557,258, filed on Mar. 27, 2004, and incorporated herein by reference.

BACKGROUND OF THE INVENTION

1. Field of the Invention

The invention relates to anti-CEACAM6 antibodies and antibody fragments, nucleic acids encoding them, methods of their manufacture, and methods to treat cancer using these compounds.

2. Description of the Background

CEACAM6, carcinoembryonic antigen cell adhesion molecule 6 or CD66, is related to carcinoembryonic antigen (CEA) and both are members of the immunoglobulin superfamily of proteins. CEACAM6 is a cell surface oncogene which is composed of immunoglobulin-like (Ig-like) domains capable of homophilic and heterophilic interactions (Beauchemin N, et. al., Exp Cell Res. 252(2): 243-9, 1999; Kuroki, et. al. J Leukoc Biol. 70(4): 543-50, 2001). It is a 320 amino acid long cell surface GPI-linked glycoprotein comprised of 3 Ig-like C2 domains with a short C-terminal cytoplasmic tail. The expression profile of CEACAM6 in normal human tissues show moderate expression in a variety of epithelial tissue and myeloid cells. However, deregulated cell surface expression of CEA and CEACAM6 is observed in approximately 50% human cancers (25). An immunohistochemical study of human tissue expression of CEACAM6 showed intense staining on proliferating cells of hyperplastic polyps and adenomas when compared to normal colorectal mucosa (26). These observations represent some of the earliest molecular events in colonic epithelial cells that lead to colorectal cancer. However, deregulated cell surface expression of CEACAM6 is observed in ˜50% of human cancers, including colorectal and pancreatic cancer. Further, it has been demonstrated that de-regulated over-expression of CEACAM6 inhibits differentiation and apoptosis of cells when deprived of their anchorage to the extracellular matrix (ECM) (Ordoñez, et. al, Cancer Research, 60, 3419-3424, 2000), a process known as anoikis, which accompanies malignant transformation and strongly implicates CEACAM6 as an oncogene.

The utilization of therapeutic monoclonal antibodies (unconjugate or conjugated) for the treatment of human diseases including solid and hematological malignancies is well validated and established. Particularly useful for therapeutic applications are chimeric or humanized monoclonal antibodies due to their reduced immunological side effects. The efficacy and potency of this approach has been validated for Non-Hodgkin's Lymphoma (targeting CD20 antigen with rituximab) and breast cancer (targeting Her-2/Neu with Herceptin) with complete responses observed in patients with advanced stage disease.

Thus, there is an urgent need for novel therapies that specifically target up-regulated oncogenes such as CEACAM6.

SUMMARY OF THE INVENTION

The present invention provides high affinity antibodies and antibody fragments to CEACAM6. As used herein, the term antibody refers to a full length, complete antibody molecule as recognized in the art. The term fragment in the context of the present application refers to a portion of an antibody that retains the capability to bind to CEACAM6 with high affinity and specificity. Antibody fragments can be defined based on how many domains are included and/or excluded from the original full domain structure. Hence fragment can mean Variable heavy (VH) or Variable light (VL) or Single chain Fv (VH-VL) or Fab (VL-CL-VH-CH1) or Fab2 (VL-CL-VH-CH1)2 or any of the above linked to novel small molecules, PEG or other protein domain(s) or labeling agents (fluorescent dye). A preferred example of such a fragment is a single chain antibody variable region fragment (ScFv). The term as used herein antibody generally refers to complete antibody molecules or fragments, unless there is a statement to the contrary.

These antibodies are preferably humanized or chimeric or ScFv (murine or humanized) antibodies or fragments. The antibodies and fragments of this invention are further provided as a pharmaceutical preparation for therapeutic use. The invention further provides recombinant DNA molecules encoding humanized CEACAM6 antibodies and expression systems for producing or manufacturing the antibodies recombinantly.

The anti-CEACAM6 antibodies of this invention are useful for treating conditions in which CEACAM6 is over-expressed, such as cancer. The antibodies act through a specific high affinity interaction at the cell surface to induce apoptosis and cell kill by antibody dependent cellular cytotoxicity (ADCC) and complement dependent cytotoxicity (CDC). In one embodiment, the applicant has developed humanized monoclonal antibodies, targeting CEACAM6. The applicant demonstrates the efficacy and potency of high affinity anti-CEACAM6 antibodies in cell killing assays described herein. As a further embodiment, applicant has utilized a structure based design algorithm for developing humanized antibodies that have been expressed in E. coli.

This invention provides a therapeutic method of administering an effective amount of anti-CEACAM6 antibodies to a patient that suffers from a disease in which CEACAM6 is overexpressed, such as cancer, particularly cancer of epithelial or myeloid origin. Cancers in which CEACAM6 is overexpressed include gastrointestinal cancers, including colorectal, pancreatic, stomach and others; lung cancer, breast cancer, leukemias, including acute myeloid leukemias; female reproductive cancers such as cervical, uterine and ovarian cancers; other epithelial cancers such as brain, prostate, liver and kidney tumors. Applicant has discovered that the known murine anti-CEACAM6 monoclonal antibody, 13.1, promotes pancreatic cancer cell apoptosis in tissue culture and may be used for therapeutic indications.

Thus, the present invention provides a method of treating cancer, comprising administering an effective amount of an anti-CEACAM6 antibody or antibody fragment to a patient in need thereof.

In one embodiment, the antibody or antibody fragment is humanized.

In another embodiment, the antibody or antibody fragment is chimeric.

In another embodiment, the antibody or antibody fragment is an ScFv.

In another embodiment, the ScFv is murine or humanized.

In another embodiment of the invention, the cancer is of epithelial or myeloid origin.

In one embodiment, the cancer is at least one selected from the group consisting of gastrointestinal cancer, lung cancer, breast cancer, leukemias, cervical cancer, uterine cancer, ovarian cancers, brain cancer, prostate cancer, liver cancer and kidney cancer.

In yet another embodiment, the cancer may be colorectal cancer, pancreatic cancer, stomach cancer and acute myeloid leukemia.

In another embodiment, the patient is a human or a non-human animal.

In another embodiment, the antibody or antibody fragment is administered parenterally, intraperitoneally intravenously or subcutaneous, orally, nasally, via inhalation or rectally.

In another embodiment, the antibody or antibody fragment is administered intravenously at a dosage of from 5 mg/m2 to 2000 mg/m2.

The present invention also provides a method of inducing apoptosis in cells expressing CEACAM6, comprising contacting the cells with an effective amount of an anti-CEACAM6 antibody or antibody fragment. Preferred embodiments are as described above. In another embodiment, the cells are cancer cells.

The present invention also provides a humanized murine anti-CEACAM6 antibody or antibody fragment. In a preferred embodiment, the antibody or antibody fragment contains the CDRs of monoclonal antibody 13.1. In another embodiment, the antibody or antibody fragment is modified with PEG.

The present invention also provides an anti-CEACAM6 ScFv. In a preferred embodiment, the ScFv contains the CDRs of monoclonal antibody 13.1. In another embodiment, the ScFv is modified with PEG.

The present invention also provides a fragment of an anti-CEACAM6 antibody which has high affinity for CEACAM6. In a preferred embodiment, the fragment contains the CDRs of monoclonal antibody 13.1. In another embodiment, the fragment is modified with PEG.

The present invention also provides a conjugate in which the antibody or fragment described above is conjugated to at least one other moiety.

The present invention also provides a pharmaceutical composition, comprising the antibody or fragment as discussed above and at least one pharmaceutical excipient.

In one embodiment of the invention, the excipient is one or more of water, pH buffers, wetting agents, salts, reducing agents, sugars, glycerol, glycol, oils, preservatives and antimicrobials.

The present invention also provides an antibody or fragment as described above.

The present invention also provides a method of producing the antibody or fragment as described above, comprising transforming a host cell with a nucleic acid which encodes the antibody or antibody fragment and isolating the antibody or antibody fragment from the host cell.

The present invention also provides a method of diagnosing over-expression of CEACAM6, comprising:

contacting a sample from a subject with an anti-CEACAM6 antibody or antibody fragment;

determining whether a complex formed between the antibody or antibody fragment and CEACAM6; and

correlating the formation of the complex with over-expression of CEACAM6 in the subject, or

correlating the absence of the complex with no over-expression of CEACAM6 in the subject.

The present invention also provides a method of diagnosing cancer or hematological malignancy involving over-expression of CEACAM6, comprising:

contacting a sample from a subject with an anti-CEACAM6 antibody or antibody fragment;

determining whether a complex formed between the antibody or antibody fragment and CEACAM6; and

correlating the formation of the complex with the presence of a cancer or hematological malignancy involving over-expression of CEACAM6 in the subject, or

correlating the absence of the complex with the absence of a cancer or hematological malignancy involving over-expression of CEACAM6 in the subject.

In one embodiment, the antibody or antibody fragment is a monoclonal antibody.

In another embodiment, the antibody or antibody fragment is a murine antibody or a humanized antibody.

In another embodiment, the subject is human.

In another embodiment, the sample is a biopsy sample.

In another embodiment, the antibody or antibody fragment is humanized.

In another embodiment, the antibody or antibody fragment is chimeric.

In another embodiment, the antibody or antibody fragment is an ScFv.

In another embodiment, of the invention the ScFv is murine or humanized.

BRIEF DESCRIPTION OF THE DRAWINGS

The invention will be better understood from a reading of the following detailed description taken in conjunction with the drawings in which like reference designators are used to designate like elements, and in which:

FIG. 1 is a Western blot showing the expression of CEACAM6 in 11 human pancreatic cancer cell lines, lanes from left to right are M: marker, 1: Capan-2, 2: CFPAC-1, 3: Panc-1, 4: ASPC-1, 5: MiaPaCa, 6: CaPan-1, 7: BXPC-3, 8: Hs766T, 9: su.86.86, 10: Mutj, 11: HPAF-2. The band at 45 kDa is an actin control;

FIG. 2 shows immunohistochemical staining of four representative pancreatic adenocarcinoma patient biopsy samples;

FIG. 3 is a graph showing the percent survival of two different pancreatic cancer cell lines in the presence of anti-CEACAM-6 monoclonal antibody;

FIG. 4 is a chart showing the structure based sequence alignment of the murine anti-CEACAM6 VH and VL chains with the VH and VL of 1 MCP (SEQ ID NO: 23 and 24);

FIG. 5 shows the homology model of mouse anti-CEACAM6 VH and VL SCFV chain built on the structural coordinates of 1MCP and containing a gly-ser linker (ggggsggggscggggs) (SEQ ID NO: 25) with a cysteine residue to attach other moieties, such as drugs;

FIG. 6 is a chart showing the humanization of the VL chain of murine anti-CEACAM6. An asterisk denotes a position at which all query sequences have the exact same amino acid (called sequence identity). Two dots denote a position in the sequence at which all analyzed sequences have amino acids that are chemically similar (i.e. all acidic or all non-polar; called sequence conservation). One dot denotes a weaker chemical similarity (weaker sequence conservation). No annotation denotes that no chemical similarity exists;

FIG. 7 is a chart showing the humanization of the VH chain of murine anti-CEACAM6 (SEQ ID NO: 26 and 27). An asterisk denotes a position at which all query sequences have the exact same amino acid (called sequence identity). Two dots denote a position in the sequence at which all analyzed sequences have amino acids that are chemically similar (i.e. all acidic or all non-polar; called sequence conservation). One dot denotes a weaker chemical similarity (weaker sequence conservation). No annotation denotes that no chemical similarity exists;

FIG. 8 shows Western blots for the murine ScFv and humanized ScFv version 8.

FIG. 9 demonstrates that the bacterially expressed mouse ScFv and humanized ScFv version 8 are active antibody fragments against CEACAM6 expressing pancreatic cancer cell lines. The data presented in the panels shows that the murine ScFv (yellow) and humanized ScFv (version 8) antibody fragments to CEACAM6 is efficient at cell killing in 5 different pancreatic cancer cell lines expressing CEACAM6. IC50 values range from 0.07-4.0 μg/mL depending on the cell line.

FIG. 10 shows that the murine ScFv antibody fragment given daily intraperitoneally is effective in reducing the tumor volume by 50-70% compared to the saline treated animals.

FIG. 11 is a Western blot analysis of cleaved human caspase-2 of HPAF-2 pancreatic cancer cells treated with anti-CEACAM6 Mab (1 μg/mL) (A). 0 hr and 6 hr (B). 0 hr, 24 hr, 48 hr and 72 hr. Cleaved caspase-2 migrates at ˜34 kDa.

DETAILED DESCRIPTION OF THE INVENTION

Applicants have discovered that the CEACAM6 protein is a target for inducing apoptosis in cells over expressing CEACAM6 to cause cell death. Apoptosis is induced by treating such cells with antibodies that induce ADCC and CDC.

The humanized antibodies of the invention include intact immunoglobulin molecules, comprising 2 full-length heavy chains and 2 full-length light chains, for example, IgG, IgA, IgM, IgE, and IgD, and subsequences that induce apoptosis in cells overexpressing CEACAM6. Particular subsequences include, for example, single chain, such as ScFv, Fab, Fab′ or (Fab) 2 fragment.

It was discovered that CEACAM6 overexpression in certain cells, such as cancerous cells, provides a therapeutic target. The recognition and binding of this target by high affinity antibodies leads to apoptosis or programmed cell death of the errant cells. Monoclonal antibodies which bind CEACAM6 and lead to apoptosis may be made by methods known in the art, such as first described by Kohler and Millstein (Kohler et al., 1975, Nature, 265:495-497.1, incorporated herein by reference). Humanized and chimeric antibodies may be made in various methods once the critical selection criteria are determined.

Humanization (also called Reshaping or Complementarity Determining Region—CDR grating) is now a well-established technique for reducing the immunogenicity of monoclonal antibodies (Mab) from xenogeneic sources (commonly rodent) and for improving their activation of the human immune system. Although the mechanics of producing the engineered Mab using the techniques of molecular biology are relatively straightforward, simple grafting of the rodent CDRs into human frameworks does not always reconstitute the binding affinity and specificity of the original Mab. In order to humanize an antibody, the design is now the critical step in reproducing the function of the original molecule. This design includes various choices or selection criteria: the extents of the CDRs, the human frameworks to use and the substitution of residues from the rodent Mab into the human framework regions (backmutations). The positions of these backmutations have been identified principally by sequence/structural analysis or by analysis of a homology model of the variable regions' three-dimensional structure. Phage libraries can be used to vary the amino acids at chosen positions. Similarly, many approaches have been used to choose the most appropriate human frameworks in which to graft the rodent CDRs. One method may use a limited subset of well-characterized human Mabs (often where the structure is available), irrespective of the sequence identity to the rodent Mab (called the fixed-frameworks approach). One may use variable regions with high amino acid sequence identity to the rodent variable regions (homology matching or best-fit); others use consensus or germline sequences while still other methods select fragments of the framework sequences within each light or heavy chain variable region from several different human Mabs. Other approaches to humanization replace the surface rodent residues with the most common residues found in human Mabs (‘resurfacing’ or ‘veneering’).

One structure based method used to make humanized ScFv antibodies of this invention, providing the selection criteria is outlined below:

1 Sequence VL and VH regions (mouse anti-CEACAM6 Mab)
2 PSI-BLAST Search to identify Xtal structure of a mouse Mab with
high sequence similarity to the VL and VH of anti-CEACAM Mab
3 Alignment of VL and VH 1MCP with VL and VH of
anti-CEACAM6 (Clustal W)
4 Molecular modeling of CEACAM6 Mab VL and VH on 1 MCP
(ICM 3.1, Sybyl 6.9)
5 Linking VL C-terminus to VH N-terminus
6 Identify a Human Acceptor for VL and VH (Human Anti-P53,
163.15)
7 Synthesize VL and VH with Gly-Ser containing or other Linker
8 Express DNA sequence and Purify antibodies

In one embodiment, the humanized and/or chimeric antibodies of the invention comprise the CDRs, or consensus CDRs, of monoclonal antibody 13-1. The complete sequence of monoclonal antibody 13-1 is provided below:

Mouse monoclonal antibody 13-1 light chain (SEQ ID NO: 1):
NIVLTQSPAS LAVSLGQRAT ISCRASKSVS ASGYIYMHWY QQKPGQPPKL
LISLASNLESGVPARFSGSG SGTDFTLNIH PVEEEDVATY YCQHSRELPL
TFGAGTKLEL KRADAAPTVSIFPPSSEQLT SGGASVVCFL NNFYPKDINV
KWKIDGSERQ NGVLNSWTDQ DSKDSTYSMSSTLTLTKDEY ERHNSYTCEA
THKTSTSPIV KSFNRNEC
Mouse monoclonal antibody 13-1 heavy chain (SEQ ID NO: 2):
EVQXVETGGG LVRPGNSLKL SCLTSGFTFS NYRMHWLRQP PGKRLEWIAV
ITVKSDNYGAKYAESVRGRF TISRDDSKSS VYLQMNRLRE EDTATYYCCR
TPWVYAMDCW GQGTSVIVSSAKTTPPSVYP LAPGSAAQTN SMVTLGCLVK
GYFPEPVTVT WNSGSLSSGV HTFPAVLQSDLYTLSSSVTV PSSTWPSETV
TCNVAHPASS TKVDKKIVPR DCGCKPCICT VPEVSSVFIFPPKPKDVLTI
TLTPKVTCVV VDISKDDPEV QFSWFVDDVE VHTAQTQPRE
EQFNSTFRSVSELPIMHQDW LNGKEFKCRV NSAAFPAPIE KTISKTKGRP
KAPQVYTIPP PKEQMAKDKVSLTCMITDFF PEDITVEWQW NGQPAENYKN
TQPIMDTDGS YFVYSKLNVQ KSNWEAGNTFTCSVLHEGLH NHHTEKSLSH SPGK

See Akashi, S., Kato, K., Torizawa, T., Dohmae, N., Yamaguchi, H., Kamachi, M., Harada, A., Imanaka, T., Shimada, I. and Takio, K. Structural characterization of mouse monoclonal antibody 13-1 against a porphyrin derivative: identification of a disulfide bond in CDR-H3 of Mab 13-1. Biochem. Biophys. Res. Commun. 240 (3), 566-572 (1997), incorporated herein by reference.

Once the DNA sequence of the antibody molecule is obtained, it may be operably linked to promoters in suitable vectors for expression in a variety of hosts. Such vector-host systems are readily available from companies such as Promega or Invitrogen.

Useful cells for expression of the antibody encoding vectors to make protein are bacteria, such as E. coli, eukaryotic systems such as yeast or insect cells using a baculovirus system, or mammalian cells, such as CHO cells.

The murine and humanized antibody fragments may also be produced in COS cells, CHO cells, Multiple Myeloma cells and baculovirus using well established existing methods.

A wide variety of linker sequences may be used to link VL and VH, however incorporating amino acids with active groups such as sulfhydryl, such as cysteine, carboxyl, such as aspartic acid or glutamic acid, amines, such as lysine or arginine are useful for forming conjugates with other drugs, cytotoxic or detecting agents.

Useful ‘high affinity’ antibodies to CEACAM6 made by the methods described in this invention may be tested for cell killing activity or cytoxicity in assays known in the art. One such assay is embodied by the method described in the example entitled Cellular Cytotoxicity Assay in the Examples provided herein. The method described herein also allows one to determine a qualitative concentration of antibodies to effect cell kill and thus be useful for treating cancer. Cancers for which anti-CEACAM6 antibodies may be useful include gastrointestinal cancers, including colorectal, pancreatic, stomach and others; lung cancer, breast cancer, leukemias, including acute myeloid leukemias; female reproductive cancers such as cervical, uterine and ovarian cancers; other epithelial cancers such as brain, prostate, liver and kidney tumors. Applicant has discovered that the known murine anti-CEACAM6 monoclonal antibody, 13.1, promotes pancreatic cancer cell apoptosis in tissue culture and may be used for such therapeutic indications.

The subject to be treated may be a human or a non-human animal. Preferably, the animal is a mammal. Examples of animals include dogs, cats, livestock and monkeys (e.g. Cyanomolgus).

“High affinity” as used to describe the antibodies of the present invention means anti-CEACAM6 antibodies which are capable of causing apoptosis of CEACAM6 bearing cells as determined by cytotoxic assays described and demonstrated in this application.

Monoclonal antibodies, particularly chimeric and humanized, obtained in this invention are useful for therapeutic indications. Such antibodies leading to cell death have IC50 concentrations of 10 ng/ml-100 μg/ml, preferably 100 ng/ml-50 μg/ml and most preferably 1 μg/ml-20 μg/ml. Monoclonal anti-CEACAM6 antibodies, including humanized or chimeric, of the invention, particularly ScFv antibody fragments may have binding affinities of 10−10-10−7 M, preferably 10−9-10−8M.

DNA microarray in combination with correlative RT-PCR, Northern and western blotting (these techniques being known to those of skill in the art) may be used to demonstrate over-expression of the tumor antigen CEACAM6 on human cancer cell lines to determine those tumors that may benefit from antibody therapy described herein. Those tumor tissues or cells over-expressing CEACAM6 two-fold or more compared to the same normal tissue or cells, preferably 5-fold or more, or most preferably 10-fold or more are most preferred for treatment with the anti-CEACAM6 antibodies. Further, immunohistochemical analysis of human cancer tissue utilizing an antibody targeting CEACAM6 can be used to determine overexpression, that is, increased expression in comparison to normal tissue.

The antibodies of the present invention may be given as a sole therapeutic agent or may be used in combination therapies. Other agents for combination therapy include Gemcitabine, 5-fluorouracil, irinotecan, cisplatin, oxaliplatin, EGF receptor monoclonal and VEGF monoclonal antibodies, hormonal therapy in prostate or reproductive cancer, doxorubicin, idarubicin, Am-C, Mylotarg, carboplatin, taxotere, tyrosine kinase inhibitors (PDGFR, c-Kit, EGFR etc), as a conjugated antibody with radioactive ions (Iodine, Yttrium, etc); as a conjugated antibody with various toxins (Diphtheria, Psedomonas, others); as an antibody conjugated with any chemotherapy agent such as taxotere, doxorubicin or any of those recited above; as a conjugated antibody with protein kinase inhibitors and other signal transduction inhibitors/activators. Other conjugates may be made that are useful in detection or diagnostic indications, such as fluorescent or radioactive labels, biotin-avidin or streptavidin, reagents for conducting ELISA assays, MR agents such as Gadolinium, chelating moieties for chelating MR agents. Such diagnostic agents are known in the art and are useful for diagnosing disease, particularly cancer. Detection agents may be useful for research reagents as a detectable tag using optical means, such as fluorescent labeling, or radioactive labels.

The antibodies of the present invention may be prepared for pharmaceutical administration by methods and excipients generally known in the art (Remington's Pharmaceutical Sciences, E. W. Martin). Excipients may include water, pH buffers, such as citrate or phosphate buffers, ‘wetting agents’ such as Tweens or other detergents, salts such as sodium chloride, reducing agents such as thiols, sugars, such as dextrose, lactose, sucrose and the like, glycerol, glycol, oils, preservatives, antimicrobials, etc. The antibodies may be formulated in specialized delivery vehicles such as liposomes. The preparation may be prepared as a liquid, powder, solid or in gel form for administration. Administration may be via parenteral routes, such as intravenous, intraperitoneally or subcutaneous, oral, nasal, inhalation, rectally via suppositories or other known routes of administering drugs. Modifications of the anti-CEACAM6 antibody may be made to improve pharmacologic efficacy, such as PEGylation.

Dosages and administration schedules are readily determined by those skilled in the pharmacology. The antibodies of the invention may be administered intravenously from 5 mg/m2 to 2000 mg/m2, preferably 50 mg/m2 to 1000 mg/m2, most preferably 100 mg/m2 to 500 mg/m2.

The present invention also provides a method of diagnosing over-expression of CEACAM6, comprising:

contacting a sample from a subject with an anti-CEACAM6 antibody or antibody fragment;

determining whether a complex formed between the antibody or antibody fragment and CEACAM6; and

correlating the formation of the complex with over-expression of CEACAM6 in the subject, or

correlating the absence of the complex with no over-expression of CEACAM6 in the subject.

The present invention also provides a method of diagnosing cancer or hematological malignancy involving over-expression of CEACAM6, comprising:

contacting a sample from a subject with an anti-CEACAM6 antibody or antibody fragment;

determining whether a complex formed between the antibody or antibody fragment and CEACAM6; and

correlating the formation of the complex with the presence of a cancer or hematological malignancy involving over-expression of CEACAM6 in the subject, or

correlating the absence of the complex with the absence of a cancer or hematological malignancy involving over-expression of CEACAM6 in the subject.

Each of these methods is dependent on the formation of a detectable complex between the anti-CEACAM6 antibody or antibody fragment and CEACAM6, if it is present in the sample. If the complex forms in a detectable amount, the assay is positive. If the complex does not form in a detectable amount, the result is negative. Thus, these methods are similar to other well-known antibody assays which are widely used in medical diagnostics. The antibody can be fluorescently labeled for enhanced detection. Another method to detect CEACAM6 in a tumor would be to sequence the DNA of CEACAM6 after RT-PCR. This method successfully identifies the CEACAM6 message and any new mutations the tumor may have acquired during its evolution. This method has been utilized for EGFR mutations in non small cell lung cancer and BCR-Abl mutations in chronic myeloid leukemia. In a particularly preferred embodiment, the sample is a biopsy sample obtained using well-known clinical procedures. Examples of biopsy samples those obtained either by ultra sound guided endoscopy, CT guided biopsy of the tumor (Liver metastasis) or at surgery. The tissue is generally processed and embedded in paraffin or snap frozen for isolating RNA or DNA.

With respect to the amino acid and nucleic acid sequences described herein, the present invention also includes embodiments in which the amino acid or nucleic acid has at least 70%, 75%, preferably 80%, 85%, more preferably at least 90%, 95%, 97%, 98% or 99% identity or homology to the specific sequences described herein (see the Examples below). These nucleic acids will hybridize under stringent conditions to the complement of the nucleic acid sequences described herein. The terms “stringent conditions” or “stringent hybridization conditions” includes reference to conditions under which a polynucleotide will hybridize to its target sequence, to a detectably greater degree than other sequences (e.g., at least 2-fold over background). Stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides), for example, high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 0.1×SSC at 60 to 65° C. (see Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes, Part I, Chapter 2 “Overview of principles of hybridization and the strategy of nucleic acid probe assays”, Elsevier, N.Y. (1993); and Current Protocols in Molecular Biology, Chapter 2, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995)), all incorporated herein by reference. Amino acid and polynucleotide identity, homology and/or similarity can be determined using the ClustalW algorithm, MEGALIGN*, Lasergene, Wis.).

EXAMPLES

The following Examples are provided to illustrate specific embodiments of the invention, and are not limiting in any way.

CEACAM6 Expression in Human Pancreatic Cancer Cell Lines

Three gene array-profiling studies on pancreatic cancer cell lines (11, 12, 13) and human pancreatic cancer biopsy samples (14, 15) have clearly shown that a number of genes are highly over-expressed. Of the highly over-expressed genes from these three studies, CEACAM6 had a 25-fold increase compared to normal pancreatic cells and was the number 1 expressed hit in one study (11).

DNA microarray in combination with correlative RT-PCR, Northern and western blotting are used to demonstrate over-expression of the tumor antigen CEACAM6 on several human pancreatic cancer cell lines. Further, immunchistochemical analysis utilizing a murine monoclonal antibody (Mab 13-1) targeting CEACAM6 on pancreatic cancer cell lines and pancreatic cancer patient biopsy specimens (25 of 30) have confirmed increased expression in comparison to normal pancreatic tissue.

Western Blotting

In this study, eleven human pancreatic cancer cell lines (Capan-2, CFPAC-1, Pane-1, ASPC-1, MiaPaCa-2, CaPan-1, BXPC-3, Hs766T, Su.86.86, Mutj and HPAF-2) were grown in tissue culture to confluence. Each of the cell lines were spun down, lysed in lysis buffer, run on SDS-PAGE, transferred to nitrocellulose and probed with the murine monoclonal antibody to CEACAM6 (13.1) and anti-actin antibody (control).

FIG. 1 shows a Western blot demonstrating the expression of CEACAM6 in eleven (11) human pancreatic cancer cell lines. The data of FIG. 1 includes the following cell lines: M-Marker, 1: Capan-2, 2: CFPAC-1, 3: Pane-1, 4: ASPC-1, 5: MiaPaCa-2, 6: CaPan-1, 7: BXPC-3, 8: Hs766T, 9: Su.86.86, 10: Mutj, 11: HPAF-2. The band at 45 kDa is the actin control.

FIG. 1 shows that five (5) of the cell lines have a high level of expression of CEACAM6, namely cell lines CFPAC-1, ASPC-1, CaPan-1, BXPC-3 and HPAF-2. Two of those cell lines, namely lines Hs766T and Su.86.86, are low expressers, all migrating at a Mr 75 kDa due to glycosylation.

Human Cancer Tissue Array

Thirty human pancreatic cancer patient biopsy samples were either deparaffinized and microwaved for antigen retrieval, or if fixed frozen, the above step was omitted. Both types of section were acetone fixed and stained with aNCA monoclonal antibody (13.1) and processed using a mixture of anti-Ms and anti-Rb immunoglobulins. After rinsing slides were incubated with Avidin-HRP reagent, rinsed and incubated in DAB. The slides were counter stained in hematoxylin. Of the 30 patient samples tested, 25 showed intense cell surface staining of neoplastic pancreatic duct cells. The surrounding normal tissue were not stained clearly delineating tumor cells from normal pancreas cells.

FIG. 2 shows resulting immunohistochemical staining of four representative pancreatic adenocarcinoma patient biopsy samples with the murine anti-CEACAM6 monoclonal antibody. The intense dark brown staining of the malignant duct surface epithelium is evident.

Cellular Cytotoxicity Assay

To demonstrate that an anti-CEACAM-6 monoclonal antibody can mediate pancreatic cancer cell killing, Applicant has employed an in vitro cytotoxicity assay. This assay utilizes the CellTiter 96 Non-Radioactive Cell Proliferation Assay (Promega Corp., Madison, Wis.). MiaPaCa and HPAF-2 pancreatic cancer cells were plated in 0.1 mL medium on day 0 in 96-well microtiter plates (Falcon, #3072). On day 1, 10 μL, of serial dilutions of the commercially available anti-CEACAM-6 agent were added in replicates of 4 to the plates. After incubation for 4 days at 37° C. in a humidified incubator, 20 μL of a 20:1 mixture of [3-(4,5-dimethyl-2-yl)-5-(3 carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt; MTS], 2 mg/ml, and an electron coupling reagent, phenazine methosulfate (PMS, 0.92 mg/ml in DPBS), was added to each well and incubated for 4 hours at 37° C. Absorbance was measured using Model 7520 microplate reader (Cambridge Technology, Inc.) at 490 nm.

FIG. 3 shows the percentage of survival of control calculated from the absorbance corrected for background absorbance. The surviving fraction of cells was determined by dividing the mean absorbance values of the monoclonal antibody by the mean absorbance values of the control. For the two pancreatic cancer cell lines evaluated, the mouse anti-CEACAM6 monoclonal antibody (13-1) promoted pancreatic cancer cell apoptosis with an IC50=1-10 μg/ml. This is most likely due to inhibition of anoikis, a surveillance mechanism that prevents dysplasia and preserves normal tissue architecture. As those skilled in the art will appreciate, FIG. 3 shows that the anti-CEACAM-6 monoclonal antibody is efficient at cell killing in two different pancreatic cancer cell lines at a concentration of 1-10 mg/ml.

Humanization by Design

The mouse anti-CEACAM6 monoclonal antibody VL and VH region sequences were characterized by mass spectroscopic peptide mapping. The VL and VH sequences were identical to that in the NCBI protein sequence database. A PSI-BLAST search was used to identify a crystal structure of a mouse monoclonal antibody with the highest sequence similarity to the VL and VH of anti-CEACAM6 monoclonal antibody (13-1). The design cycle is shown in Table 1.

TABLE 1
Humanization By Structure-Based Design
1 Sequence VL and VH regions (mouse anti-CEACAM6 Mab)
2 PSI-BLAST Search to identify Xtal structure of a mouse Mab with
high sequence similarity to the VL and VH of anti-CEACAM Mab
3 Alignment of VL and VH 1 MCP with VL and VH of
anti-CEACAM6 (Clustal W)
4 Molecular modeling of CEACAM6 Mab VL and VH on 1 MCP
(ICM 3.1, Sybyl 6.9)
5 Linking VL C-terminus to VH N-terminus
6 Identify a Human Acceptor for VL and VH (Human Anti-P53,
163.15)
7 Synthesize VL and VH with Gly-Ser Linker
8 Express in and Purify from E. Coli

Applicant identified the crystal structure of 1MCP, a mouse monoclonal antibody against phosphorylcholine, as the best structure for molecular modeling and extracted from the protein database. Referring to FIG. 4, sequence alignments of VL and VH domains of 1 MCP were performed with the VL and VH of anti-CEACAM6 using the program Clustal W. Molecular modeling of the anti-CEACAM6 monoclonal antibody VL and VH were performed using the crystal structure of 1 MCP on an Octane Silicon Graphics workstation using the program ICM (Internal Coordinate Mechanism) and refined in Sybyl 6.9 (Tripos).

A glycine-serine linker was constructed linking the VL C-terminus to VH N-terminus (distance=33° A) with a cysteine residue in the following order (GS GSGS (cys) GSGSG). Referring to FIG. 5, the cysteine residue was introduced into the linker as it is a potential site for producing a drug-conjugated molecule.

The mouse CEACAM6 homology model and sequence was used to identify the best human acceptor for the VL and VH domains. The design was based on searching through the Kabat database (32) using the program fasta (33) with analysis of the modeled structure utilizing the program QUANTA (Accelrys, latest release 2000). Care was taken to conserve the canonical forms and residues at the interface between the light and heavy chains.

FIG. 6 shows Applicant's humanization of the VL chain of murine anti-CEACAM6. Sequences in grey comprise the complementarity determining regions (CDR 1, 2 and 3) which are identical to the acceptor human sequence. Residues in positions 1 and 53 in the framework regions will be mutated, as these are observed in humans and pack well against the CDRs. Referring now to FIG. 6, Applicant's light chain design was based on human sequence 163.15 (kabat database id 047292) (34). The first three residues of this sequence look like nonsense (possibly a result of the primer sequence), therefore, Applicant changed them to the most common residues found in human sequences (namely DIV). Applicant's first embodiment comprised a straight graft of the CEACAM6 CDRs into the human frameworks. In a second embodiment, Applicant changed the human Tyr at position 49 to the S found in the CEACAM6 light chain.

From the model, Ser49 is the most prominent framework residue in the binding site and binding affinity will be evaluated by mutation. The model shows that it might interact with M100a in the heavy chain CDR-H3. It also can interact with nearby CDR residues in the light chain. The N-terminus is occasionally important in binding antigen, hence Applicant's third embodiment changes the human Asp at position 1 to the Asn found in the CEACAM6 light chain. From the model, this Asn interacts with Pro95 in CDR-L3 and Lys27 in CDR-L1 and may also interact with Glu61 in CDR-H2. Applicant's third embodiment only has two backmutations.

FIG. 7 shows Applicant's humanization of the VH chain of murine anti-CEACAM6. Sequences in grey are the complementarity determining regions (CDR 1, 2 and 3) which are identical to the acceptor human sequence. Residues in positions 24, 37, 48 and 99 in the framework regions will be mutated as these are observed in humans and pack well against the CDRs.

For the heavy chain, Applicant searched the Kabat database (32) without success. Therefore, Applicant searched the NCBI non-redundant database. Once again, searching was done with fasta (33) with analysis of the modeled structure using the program QUANTA (Accelrys, latest release 2000). Care was taken to conserve the canonical forms and residues at the interface between the light and heavy chains. The heavy chain design was based on human sequence AAC51024 (NCBI accession 1791061) (35). It is notable that all three CDRs are the same length as murine CEACAM6.

These results demonstrate that the CDR-H3 loop might take the same conformation since sequence length is a better indicator of conformation than sequence composition. One embodiment of Applicant's composition comprises a straight graft of the CEACAM6 CDRs into these human frameworks. A second embodiment changes the human Ala at position 24 to the Thr found in the CEACAM6 heavy chain and similarly Val at position 48 to Ile.

Thr24 is a canonical residue for CDR-H1 and possibly interacts with Phe 27 and 29. Ile48 is a common back mutation in humanization experiments and from the model appears to support the conformation of CDR-H2. A third embodiment mutates the unusual Cys at position 93 to Ala and Val at position 37 to leucine. Leu37 is a residue at the light/heavy interface and will be kept murine. Cys93 in the model appears to be interacting with Tyr99. Cys93 may form a disulphide bridge with Cys102 in CDR-H3 (36), although this is appears unlikely from the model. Alternatively, Cys93 may comprise a metal binding site.

Gene Synthesis, Bacterial Expression and Protein Purification

Referring now to Table 2, below, Applicant utilized a gene synthesis approach to construct the murine ScFv and nine versions of VL-Glycine-Serine Linker-VH constructs of the humanized anti-CEACAM6 ScFv.

TABLE 2
Humanized ScFv Gene variables
Light
Chain Heavy Chain
1 53 24 37 48 99
Position 1 D Y A V V A
Variable 2 D Y T V I A
3 D Y T L I C
4 D S A V V A
5 D S T V I C
6 D S T L I C
7 N S A V V A
8 N S T V I C
9 N S T L I C

All ten constructs have been cloned into a pET19b N-terminally positioned histidine tagged vector. DNA sequencing has confirmed the authenticity of these constructs. Two of these constructs (murine ScFv and V.8 humanized ScFv) have been expressed in BL21 (DE3) PlysS competent bacteria with good protein expression and purified to >85% purity. The details of experimental procedure are described below. FIG. 8 shows the results of bacterial expression and purification on a Nickel affinity column of the murine ScFv and humanized ScFv version 6. The western blots were probed with an anti-histidine antibody (Qiagen). Expression time points are 0, 2 and 4 hours.

Bacterial Expression

Applicant has prepared the murine ScFv and 9 humanized ScFv variants as described above. These constructs were cloned into the pET19b vector as NcoI-BamHI containing inserts which contain a 5′ coding sequence for a hexa-histidine tag. DNA sequencing of all the constructs has shown authenticity of the inserts with the presence of an in-frame hexa-histidine tag placed N-terminal to the start site. Two of the ScFv's (murine ScFv and humanized ScFv V.8) have been successfully expressed in E. coli. The expressed recombinant proteins have been purified to ˜85% purity using a Ni2+ affinity chromatography column.

The DNA has been isolated from bacteria using the Qiagen Mini and Maxi preparation kits (Qiagen, CA). The sequence information, as DNA and amino acid sequences, is provided below:

Mouse ScFv (SEQ ID NO: 3)
CcatgGAAGTGCAGCTGGTGGAAACCGGCGGCGGCCTGGTGCGTCCGGGCAACAGCCTGAAA
CTGAGCTGCCTGACCAGCGGCTTTACCTTTAGCAACTATCGTATGCATTGGCTGCGTCAGCC
GCCGGGCAAACGTCTGGAATGGATTGCGGTGATTACCGTGAAAAGCGATAACTATGGCGCGA
AATATGCGGAAAGCGTGCGTGGCCGTTTTACCATTAGCCGTGATGATAGCAAAAGCAGCGTG
TATCTGCAGATGAACCGTCTGCGTGAAGAAGATACCGCGACCTATTATTGCTGCCGTACCCC
GTGGGTGTATGCGATGGATTGCTGGGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCTGCGGCG
GCGGCGGCAGCAACATTGTGCTGACCCAGAGCCCGGCGAGCCTGGCGGTGAGCCTGGGCCAG
CGTGCGACCATTAGCTGCCGTGCGAGCAAAAGCGTGAGCGCGAGCGGCTATATTTATATGCA
TTGGTATCAGCAGAAACCGGGCCAGCCGCCGAAACTGCTGATTAGCCTGGCGAGCAACCTGG
AAAGCGGCGTGCCGGCGCGTTTTAGCGGCAGCGGCAGCGGCACCGATTTTACCCTGAACATT
CATCCGGTGGAAGAAGAAGATGTGGCGACCTATTATTGCCAGCATAGCCGTGAACTGCCGCT
GACCTTTGGCGCGGGCACCAAACTGGAACTGCATCATCATCATCATCATTAAggatcc
SEQ ID NO: 4
M E V Q L V E T G G G L V R P G N S L K L S C L T S G F T F S
N Y R M H W L R Q P P G K R L E W I A V I T V K S D N Y G A K
Y A E S V R G R F T I S R D D S K S S V Y L Q M N R L R E E D
T A T Y Y C C R T P W V Y A M D C W G G G G S G G G G S C G G
G G S N I V L T Q S P A S L A V S L G Q R A T I S C R A S K S
V S A S G Y I Y M H W Y Q Q K P G Q P P K L L I S L A S N L E
S G V P A R F S G S G S G T D F T L N I H P V E E E D V A T Y
Y C Q H S R E L P L T F G A G T K L E L H H H H H H Stop G S
Humanized ScFv Version 1 (SEQ ID NO: 5)
CcatgGAAGTGCAGCTGGTGGAAAGCGGCGGCGGCCTGGTGCAGCCGGGCGGCAGCCTGCGT
CTGAGCTGCGCGGCGAGCGGCTTTACCTTTAGCAACTATCGTATGCATTGGGTGCGTCAGGC
GCCGGGCAAAGGCCTGGAATGGGTGGGCGTGATTACCGTGAAAAGCGATAACTATGGCGCGA
AATATGCGGAAAGCGTGCGTGGCCGTTTTACCATTAGCCGTGATGATAGCAAAAACAGCCTG
TATCTGCAGATGAACAGCCTGAAAACCGAAGATACCGCGGTGTATTATTGCGCGCGTACCCC
GTGGGTGTATGCGATGGATTGCTGGGGCCAGGGCACCCTGGTGACCGTGAGCAGCGGCGGCG
GCggaAGCGGCggtGGCGGCAGCTGCGGCGGCGGCGGCAGCGACATTGTGCTGACCCAGAGC
CCGGATAGCCTGGCGGTGAGCCTGGGCGAACGTGCGACCATTAACTGCCGTGCGAGCAAAAG
CGTGAGCGCGAGCGGCTATATTTATATGCATTGGTATCAGCAGAAACCGGGCCAGCCGCCGA
AACTGCTGATTTATCTGGCGAGCAACCTGGAAAGCGGCGTGCCGGATCGTTTTAGCGGCAGC
GGCAGCGGCACCGATTTTACCCTGACCATTAGCAGCCTGCAGGCGGAAGATGTGGCGGTGTA
TTATTGCCAGCATAGCCGTGAACTGCCGCTGACCTTTGGCGGCGGCACCAAAGTGGAAATTA
AACATCATCATCATCATCATTAAggatcc
SEQ ID NO: 6
M E V Q L V E S G G G L V Q P G G S L R L S C A A S G F T F S
N Y R M H W V R Q A P G K G L E W V G V I T V K S D N Y G A K
Y A E S V R G R F T I S R D D S K N S L Y L Q M N S L K T E D
T A V Y Y C A R T P W V Y A M D C W G Q G T L V T V S S G G G 
G S G G G G S C G G G G S D I V L T Q S P D S L A V S L G E R
A T I N C R A S K S V S A S G Y I Y M H W Y Q Q K P G Q P P K
L L I Y L A S N L E S G V P D R F S G S G S G T D F T L T I S
S L Q A E D V A V Y Y C Q H S R E L P L T F G G G T K V E I K
H H H H H H Stop G
Humanized ScFv Version 2 (SEQ ID NO: 7)
CcatgGAAGTGCAGCTGGTGGAAAGCGGCGGCGGCCTGGTGCAGCCGGGCGGCAGCCTGCGT
CTGAGCTGCGCGACCAGCGGCTTTACCTTTAGCAACTATCGTATGCATTGGGTGCGTCAGGC
GCCGGGCAAAGGCCTGGAATGGATTGGCGTGATTACCGTGAAAAGCGATAACTATGGCGCGA
AATATGCGGAAAGCGTGCGTGGCCGTTTTACCATTAGCCGTGATGATAGCAAAAACAGCCTG
TATCTGCAGATGAACAGCCTGAAAACCGAAGATACCGCGGTGTATTATTGCGCGCGTACCCC
GTGGGTGTATGCGATGGATTGCTGGGGCCAGGGCACCCTGGTGACCGTGAGCAGCGGCGGCG
GCggaAGCGGCggtGGCGGCAGCTGCGGCGGCGGCGGCAGCGACATTGTGCTGACCCAGAGC
CCGGATAGCCTGGCGGTGAGCCTGGGCGAACGTGCGACCATTAACTGCCGTGCGAGCAAAAG
CGTGAGCGCGAGCGGCTATATTTATATGCATTGGTATCAGCAGAAACCGGGCCAGCCGCCGA
AACTGCTGATTTATCTGGCGAGCAACCTGGAAAGCGGCGTGCCGGATCGTTTTAGCGGCAGC
GGCAGCGGCACCGATTTTACCCTGACCATTAGCAGCCTGCAGGCGGAAGATGTGGCGGTGTA
TTATTGCCAGCATAGCCGTGAACTGCCGCTGACCTTTGGCGGCGGCACCAAAGTGGAAATTA
AACATCATCATCATCATCATTAAggatcc
SEQ ID NO: 8
M E V Q L V E S G G G L V Q P G G S L R L S C A T S G F T F S
N Y R M H W V R Q A P G K G L E W I G V I T V K S D N Y G A K
Y A E S V R G R F T I S R D D S K N S L Y L Q M N S L K T E D
T A V Y Y C A R T P W V Y A M D C W G Q G T L V T V S S G G G
G S G G G G S C G G G G S D I V L T Q S P D S L A V S L G E R
A T I N C R A S K S V S A S G Y I Y M H W Y Q Q K P G Q P P K
L L I Y L A S N L E S G V P D R F S G S G S G T D F T L T I S
S L Q A E D V A V Y Y C Q H S R E L P L T F G G G T K V E I K
H H H H H H Stop G S
Humanized ScFv Version 3 (SEQ ID NO: 9)
CcatgGAAGTGCAGCTGGTGGAAAGCGGCGGCGGCCTGGTGCAGCCGGGCGGCAGCCTGCGT
CTGAGCTGCGCGACCAGCGGCTTTACCTTTAGCAACTATCGTATGCATTGGCTGCGTCAGGC
GCCGGGCAAAGGCCTGGAATGGATTGGCGTGATTACCGTGAAAAGCGATAACTATGGCGCGA
AATATGCGGAAAGCGTGCGTGGCCGTTTTACCATTAGCCGTGATGATAGCAAAAACAGCCTG
TATCTGCAGATGAACAGCCTGAAAACCGAAGATACCGCGGTGTATTATTGCTGCCGTACCCC
GTGGGTGTATGCGATGGATTGCTGGGGCCAGGGCACCCTGGTGACCGTGAGCAGCGGCGGCG
GCggaAGCGGCggtGGCGGCAGCTGCGGCGGCGGCGGCAGCGACATTGTGCTGACCCAGAGC
CCGGATAGCCTGGCGGTGAGCCTGGGCGAACGTGCGACCATTAACTGCCGTGCGAGCAAAAG
CGTGAGCGCGAGCGGCTATATTTATATGCATTGGTATCAGCAGAAACCGGGCCAGCCGCCGA
AACTGCTGATTTATCTGGCGAGCAACCTGGAAAGCGGCGTGCCGGATCGTTTTAGCGGCAGC
GGCAGCGGCACCGATTTTACCCTGACCATTAGCAGCCTGCAGGCGGAAGATGTGGCGGTGTA
TTATTGCCAGCATAGCCGTGAACTGCCGCTGACCTTTGGCGGCGGCACCAAAGTGGAAATTA
AACATCATCATCATCATCATTAAggatcc
SEQ ID NO: 10
M E V Q L V E S G G G L V Q P G G S L R L S C A T S G F T F S
N Y R M H W L R Q A P G K G L E W I G V I T V K S D N Y G A K
Y A E S V R G R F T I S R D D S K N S L Y L Q M N S L K T E D
T A V Y Y C C R T P W V Y A M D C W G Q G T L V T V S S G G G
G S G G G G S C G G G G S D I V L T Q S P D S L A V S L G E R
A T I N C R A S K S V S A S G Y I Y M H W Y Q Q K P G Q P P K
L L I Y L A S N L E S G V P D R F S G S G S G T D F T L T I S
S L Q A E D V A V Y Y C Q H S R E L P L T F G G G T K V E I K
H H H H H H Stop G S
Humanized ScFv Version 4 (SEQ ID NO: 11)
CcatgGAAGTGCAGCTGGTGGAAAGCGGCGGCGGCCTGGTGCAGCCGGGCGGCAGCCTGCGT
CTGAGCTGCGCGGCGAGCGGCTTTACCTTTAGCAACTATCGTATGCATTGGGTGCGTCAGGC
GCCGGGCAAAGGCCTGGAATGGGTGGGCGTGATTACCGTGAAAAGCGATAACTATGGCGCGA
AATATGCGGAAAGCGTGCGTGGCCGTTTTACCATTAGCCGTGATGATAGCAAAAACAGCCTG
TATCTGCAGATGAACAGCCTGAAAACCGAAGATACCGCGGTGTATTATTGCGCGCGTACCCC
GTGGGTGTATGCGATGGATTGCTGGGGCCAGGGCACCCTGGTGACCGTGAGCAGCGGCGGCG
GCggaAGCGGCggtGGCGGCAGCTGCGGCGGCGGCGGCAGCGACATTGTGCTGACCCAGAGC
CCGGATAGCCTGGCGGTGAGCCTGGGCGAACGTGCGACCATTAACTGCCGTGCGAGCAAAAG
CGTGAGCGCGAGCGGCTATATTTATATGCATTGGTATCAGCAGAAACCGGGCCAGCCGCCGA
AACTGCTGATTAGCCTGGCGAGCAACCTGGAAAGCGGCGTGCCGGATCGTTTTAGCGGCAGC
GGCAGCGGCACCGATTTTACCCTGACCATTAGCAGCCTGCAGGCGGAAGATGTGGCGGTGTA
TTATTGCCAGCATAGCCGTGAACTGCCGCTGACCTTTGGCGGCGGCACCAAAGTGGAAATTA
AACATCATCATCATCATCATTAAggatcc
SEQ ID NO: 12
M E V Q L V E S G G G L V Q P G G S L R L S C A A S G F T F S
N Y R M H W V R Q A P G K G L E W V G V I T V K S D N Y G A K
Y A E S V R G R F T I S R D D S K N S L Y L Q M N S L K T E D
T A V Y Y C A R T P W V Y A M D C W G Q G T L V T V S S G G G
G S G G G G S C G G G G S D I V L T Q S P D S L A V S L G E R
A T I N C R A S K S V S A S G Y I Y M H W Y Q Q K P G Q P P K
L L I S L A S N L E S G V P D R F S G S G S G T D F T L T I S
S L Q A E D V A V Y Y C Q H S R E L P L T F G G G T K V E I K
H H H H H H Stop G S
Humanized ScFv Version 5 (SEQ ID NO: 13)
CcatgGAAGTGCAGCTGGTGGAAAGCGGCGGCGGCCTGGTGCAGCCGGGCGGCAGCCTGCGT
CTGAGCTGCGCGACCAGCGGCTTTACCTTTAGCAACTATCGTATGCATTGGGTGCGTCAGGC
GCCGGGCAAAGGCCTGGAATGGATTGGCGTGATTACCGTGAAAAGCGATAACTATGGCGCGA
AATATGCGGAAAGCGTGCGTGGCCGTTTTACCATTAGCCGTGATGATAGCAAAAACAGCCTG
TATCTGCAGATGAACAGCCTGAAAACCGAAGATACCGCGGTGTATTATTGCGCGCGTACCCC
GTGGGTGTATGCGATGGATTGCTGGGGCCAGGGCACCCTGGTGACCGTGAGCAGCGGCGGCG
GCggaAGCGGCggtGGCGGCAGCTGCGGCGGCGGCGGCAGCGACATTGTGCTGACCCAGAGC
CCGGATAGCCTGGCGGTGAGCCTGGGCGAACGTGCGACCATTAACTGCCGTGCGAGCAAAAG
CGTGAGCGCGAGCGGCTATATTTATATGCATTGGTATCAGCAGAAACCGGGCCAGCCGCCGA
AACTGCTGATTAGCCTGGCGAGCAACCTGGAAAGCGGCGTGCCGGATCGTTTTAGCGGCAGC
GGCAGCGGCACCGATTTTACCCTGACCATTAGCAGCCTGCAGGCGGAAGATGTGGCGGTGTA
TTATTGCCAGCATAGCCGTGAACTGCCGCTGACCTTTGGCGGCGGCACCAAAGTGGAAATTA
AACATCATCATCATCATCATTAAggatcc
SEQ ID NO: 14
M E V Q L V E S G G G L V Q P G G S L R L S C A T S G F T F S
N Y R M H W V R Q A P G K G L E W I G V I T V K S D N Y G A K
Y A E S V R G R F T I S R D D S K N S L Y L Q M N S L K T E D
T A V Y Y C A R T P W V Y A M D C W G Q G T L V T V S S G G G
G S G G G G S C G G G G S D I V L T Q S P D S L A V S L G E R
A T I N C R A S K S V S A S G Y I Y M H W Y Q Q K P G Q P P K
L L I S L A S N L E S G V P D R F S G S G S G T D F T L T I S
S L Q A E D V A V Y Y C Q H S R E L P L T F G G G T K V E I K
H H H H H H Stop G S
Humanized ScFv Version 6 (SEQ ID NO: 15)
CcatgGAAGTGCAGCTGGTGGAAAGCGGCGGCGGCCTGGTGCAGCCGGGCGGCAGCCTGCGT
CTGAGCTGCGCGACCAGCGGCTTTACCTTTAGCAACTATCGTATGCATTGGCTGCGTCAGGC
GCCGGGCAAAGGCCTGGAATGGATTGGCGTGATTACCGTGAAAAGCGATAACTATGGCGCGA
AATATGCGGAAAGCGTGCGTGGCCGTTTTACCATTAGCCGTGATGATAGCAAAAACAGCCTG
TATCTGCAGATGAACAGCCTGAAAACCGAAGATACCGCGGTGTATTATTGCTGCCGTACCCC
GTGGGTGTATGCGATGGATTGCTGGGGCCAGGGCACCCTGGTGACCGTGAGCAGCGGCGGCG
GCggaAGCGGCggtGGCGGCAGCTGCGGCGGCGGCGGCAGCGACATTGTGCTGACCCAGAGC
CCGGATAGCCTGGCGGTGAGCCTGGGCGAACGTGCGACCATTAACTGCCGTGCGAGCAAAAG
CGTGAGCGCGAGCGGCTATATTTATATGCATTGGTATCAGCAGAAACCGGGCCAGCCGCCGA
AACTGCTGATTAGCCTGGCGAGCAACCTGGAAAGCGGCGTGCCGGATCGTTTTAGCGGCAGC
GGCAGCGGCACCGATTTTACCCTGACCATTAGCAGCCTGCAGGCGGAAGATGTGGCGGTGTA
TTATTGCCAGCATAGCCGTGAACTGCCGCTGACCTTTGGCGGCGGCACCAAAGTGGAAATTA
AACATCATCATCATCATCATTAAggatcc
SEQ ID NO: 16
M E V Q L V E S G G G L V Q P G G S L R L S C A T S G F T F S
N Y R M H W L R Q A P G K G L E W I G V I T V K S D N Y G A K
Y A E S V R G R F T I S R D D S K N S L Y L Q M N S L K T E D
T A V Y Y C C R T P W V Y A M D C W G Q G T L V T V S S G G G
G S G G G G S C G G G G S D I V L T Q S P D S L A V S L G E R
A T I N C R A S K S V S A S G Y I Y M H W Y Q Q K P G Q P P K
L L I S L A S N L E S G V P D R F S G S G S G T D F T L T I S
S L Q A E D V A V Y Y C Q H S R E L P L T F G G G T K V E I K
H H H H H H Stop G S
Humanized ScFv Version 7 (SEQ ID NO: 17)
CcatgGAAGTGCAGCTGGTGGAAAGCGGCGGCGGCCTGGTGCAGCCGGGCGGCAGCCTGCGT
CTGAGCTGCGCGGCGAGCGGCTTTACCTTTAGCAACTATCGTATGCATTGGGTGCGTCAGGC
GCCGGGCAAAGGCCTGGAATGGGTGGGCGTGATTACCGTGAAAAGCGATAACTATGGCGCGA
AATATGCGGAAAGCGTGCGTGGCCGTTTTACCATTAGCCGTGATGATAGCAAAAACAGCCTG
TATCTGCAGATGAACAGCCTGAAAACCGAAGATACCGCGGTGTATTATTGCGCGCGTACCCC
GTGGGTGTATGCGATGGATTGCTGGGGCCAGGGCACCCTGGTGACCGTGAGCAGCGGCGGCG
GCggaAGCGGCggtGGCGGCAGCTGCGGCGGCGGCGGCAGCAACATTGTGCTGACCCAGAGC
CCGGATAGCCTGGCGGTGAGCCTGGGCGAACGTGCGACCATTAACTGCCGTGCGAGCAAAAG
CGTGAGCGCGAGCGGCTATATTTATATGCATTGGTATCAGCAGAAACCGGGCCAGCCGCCGA
AACTGCTGATTAGCCTGGCGAGCAACCTGGAAAGCGGCGTGCCGGATCGTTTTAGCGGCAGC
GGCAGCGGCACCGATTTTACCCTGACCATTAGCAGCCTGCAGGCGGAAGATGTGGCGGTGTA
TTATTGCCAGCATAGCCGTGAACTGCCGCTGACCTTTGGCGGCGGCACCAAAGTGGAAATTA
AACATCATCATCATCATCATTAAggatcc
SEQ ID NO: 18
M E V Q L V E S G G G L V Q P G G S L R L S C A A S G F T F S
N Y R M H W V R Q A P G K G L E W V G V I T V K S D N Y G A K
Y A E S V R G R F T I S R D D S K N S L Y L Q M N S L K T E D
T A V Y Y C A R T P W V Y A M D C W G Q G T L V T V S S G G G
G S G G G G S C G G G G S N I V L T Q S P D S L A V S L G E R
A T I N C R A S K S V S A S G Y I Y M H W Y Q Q K P G Q P P K
L L I S L A S N L E S G V P D R E S G S G S G T D F T L T I S
S L Q A E D V A V Y Y C Q H S R E L P L T F G G G T K V E I K
H H H H H H Stop G S
Humanized ScFv Version 8 (SEQ ID NO: 19)
CcatgGAAGTGCAGCTGGTGGAAAGCGGCGGCGGCCTGGTGCAGCCGGGCGGCAGCCTGCGT
CTGAGCTGCGCGACCAGCGGCTTTACCTTTAGCAACTATCGTATGCATTGGGTGCGTCAGGC
GCCGGGCAAAGGCCTGGAATGGATTGGCGTGATTACCGTGAAAAGCGATAACTATGGCGCGA
AATATGCGGAAAGCGTGCGTGGCCGTTTTACCATTAGCCGTGATGATAGCAAAAACAGCCTG
TATCTGCAGATGAACAGCCTGAAAACCGAAGATACCGCGGTGTATTATTGCGCGCGTACCCC
GTGGGTGTATGCGATGGATTGCTGGGGCCAGGGCACCCTGGTGACCGTGAGCAGCGGCGGCG
GCggaAGCGGCggtGGCGGCAGCTGCGGCGGCGGCGGCAGCAACATTGTGCTGACCCAGAGC
CCGGATAGCCTGGCGGTGAGCCTGGGCGAACGTGCGACCATTAACTGCCGTGCGAGCAAAAG
CGTGAGCGCGAGCGGCTATATTTATATGCATTGGTATCAGCAGAAACCGGGCCAGCCGCCGA
AACTGCTGATTAGCCTGGCGAGCAACCTGGAAAGCGGCGTGCCGGATCGTTTTAGCGGCAGC
GGCAGCGGCACCGATTTTACCCTGACCATTAGCAGCCTGCAGGCGGAAGATGTGGCGGTGTA
TTATTGCCAGCATAGCCGTGAACTGCCGCTGACCTTTGGCGGCGGCACCAAAGTGGAAATTA
AACATCATCATCATCATCATTAAggatcc
SEQ ID NO: 20
M E V Q L V E S G G G L V Q P G G S L R L S C A T S G F T F S
N Y R M H W V R Q A P G K G L E W I G V I T V K S D N Y G A K
Y A E S V R G R F T I S R D D S K N S L Y L Q M N S L K T E D
T A V Y Y C A R T P W V Y A M D C W G Q G T L V T V S S G G G
G S G G G G S C G G G G S N I V L T Q S P D S L A V S L G E R
A T I N C R A S K S V S A S G Y I Y M H W Y Q Q K P G Q P P K
L L I S L A S N L E S G V P D R F S G S G S G T D F T L T I S
S L Q A E D V A V Y Y C Q H S R E L P L T F G G G T K V E I K
H H H H H H Stop G S
Humanized ScFv Version 9 (SEQ ID NO: 21)
CcatgGAAGTGCAGCTGGTGGAAAGCGGCGGCGGCCTGGTGCAGCCGGGCGGCAGCCTGCGT
CTGAGCTGCGCGACCAGCGGCTTTACCTTTAGCAACTATCGTATGCATTGGCTGCGTCAGGC
GCCGGGCAAAGGCCTGGAATGGATTGGCGTGATTACCGTGAAAAGCGATAACTATGGCGCGA
AATATGCGGAAAGCGTGCGTGGCCGTTTTACCATTAGCCGTGATGATAGCAAAAACAGCCTG
TATCTGCAGATGAACAGCCTGAAAACCGAAGATACCGCGGTGTATTATTGCTGCCGTACCCC
GTGGGTGTATGCGATGGATTGCTGGGGCCAGGGCACCCTGGTGACCGTGAGCAGCGGCGGCG
GCggaAGCGGCggtGGCGGCAGCTGCGGCGGCGGCGGCAGCAACATTGTGCTGACCCAGAGC
CCGGATAGCCTGGCGGTGAGCCTGGGCGAACGTGCGACCATTAACTGCCGTGCGAGCAAAAG
CGTGAGCGCGAGCGGCTATATTTATATGCATTGGTATCAGCAGAAACCGGGCCAGCCGCCGA
AACTGCTGATTAGCCTGGCGAGCAACCTGGAAAGCGGCGTGCCGGATCGTTTTAGCGGCAGC
GGCAGCGGCACCGATTTTACCCTGACCATTAGCAGCCTGCAGGCGGAAGATGTGGCGGTGTA
TTATTGCCAGCATAGCCGTGAACTGCCGCTGACCTTTGGCGGCGGCACCAAAGTGGAAATTA
AACATCATCATCATCATCATTAAggatcc
SEQ ID NO: 22
M E V Q L V E S G G G L V Q P G G S L R L S C A T S G F T F S
N Y R M H W L R Q A P G K G L E W I G V I T V K S D N Y G A K
Y A E S V R G R F T I S R D D S K N S L Y L Q M N S L K T E D
T A V Y Y C C R T P W V Y A M D C W G Q G T L V T V S S G G G
G S G G G G S C G G G G S N I V L T Q S P D S L A V S L G E R
A T I N C R A S K S V S A S G Y I Y M H W Y Q Q K P G Q P P K
L L I S L A S N L E S G V P D R F S G S G S G T D F T L T I S
S L Q A E D V A V Y Y C Q H S R E L P L T F G G G T K V E I K
H H H H H H Stop G S

Recombinant Protein Expression

Table 3 summarizes the steps of Applicant's method for recombinant protein expression.

TABLE 3
1 Transform competent E. coli BL21(DE3)PLysS cells (Invitrogen)
with recombinant ScFv pET19b vector. Plate on LB agar ampicillin
plates and grow overnight at 37° C.
2 Select a single colony and inoculate 20m1 of LB broth containing
100 μg/ml ampicillin and grow with vigorous shaking at 37° C.
overnight.
3 Inoculate a 1 liter culture (LB, 100 μg/ml) 1:50 with non-induced
overnight culture. Grow at 37° C. with vigorous shaking until an
OD600 of 0.6 is reached.
4 Take 1 ml sample prior to induction.
5 Induce expression by adding IPTG to a final concentration of
300 μM.
6 Incubate the culture for 4 hours at 37° C. Collect a second
1 ml sample.
7 Harvest cells by centrifugation at 4000 × g for 20 minutes.
8 Store pellet at −20° C. overnight or process immediately.

Purification of Histidine Tagged Protein under Denaturing Conditions

Thaw the cell pellet for 15 minutes on ice and resuspend in buffer (PBS, 8M urea, pH 8.0) at 5 ml per gram wet weight. Stir cells for 30-60 minutes at room temperature, then centrifuge lysate at 10,000×g for 20 minutes at room temperature and collect supernatant. Purification of histidine tagged proteins using Ni-NTA superflow (Qiagen) under denaturing conditions includes equilibration of the column with 5 column volumes of buffer 1 (100 mM NaH2PO4, 10 mM Tris-HCl, 8M urea, pH 8.0), apply lysate to column with a flow rate of 1 ml/min and wash with buffer 1 until the A280 is below 0.01 and then wash with buffer 2 (100 mM NaH2PO4, 10 mM Tris-HCl, 8M urea, pH 6.3) until the A280 is below 0.01. Finally the protein is eluted with buffer 3 (100 mM NaH2PO4, 10 mM Tris-HCl, 8M urea, pH 4.5).

Protein Refolding

Eluted protein is maintained at a low protein concentration (10-50 μg/ml). Four volumes of refolding buffer (20 mM Tris, 025 mM NaCl, 0.5% NP-40, 0.4 mM PMSF, 2 mM GSH, 0.2 mM GSSG, 100 mM EDTA, pH 7.8) are used to refolded at 4° C. for 24 hours. The refolded samples are dialyzed against 20 mM Tris-HCl, 120 mM NaCl, 5% Glycerol, pH 7.4) at 4° C. for 24 hours. Insoluble aggregates are removed by centrifugation. The samples are concentrated by lyophilization or by using an Amicon concentrator.

Protein Purification

The AKTA Prime (Amersham Bioscience) liquid chromatography protein purification system is used to further purify the recombinant proteins to >95% using, ion-exchange, hydrophobic and gel filtration columns sequentially. Since antibody fragments vary widely in surface composition and isoelectric points, there can be no generic purification schemes. A new procedure is designed for these antibody fragments. The protein purity can be analyzed using SDS-PAGE and silver staining.

As those skilled in the art will appreciate, it is desirable to produce a protein in the native state. The only case when alternative expression methods can become necessary is if native expression does not yield sufficient material for structure-function studies. Applicant has found that the murine ScFv and version 8 of the humanized ScFv are found in inclusion bodies. The recombinant protein was purified from these inclusion bodies and refolded to the native state. Fully functional molecules can then be obtained by further column purification steps (AKTA Prime, FPLC system) and assessed for activity by binding studies.

In certain embodiments, Applicant's method provides high level protein expression for the remaining 8 constructs based on the pET19b vector. In other embodiments, Applicant's method employs other vectors such as pET15 or 25 (Novagen) or pPROEX-Hta (Invitrogen) or pQE (Qiagen) or pGex-GST (Invitrogen).

In certain embodiments, bacterial expression provides functional molecules. In other embodiments, a baculovirus expression system is utilized. These embodiments include using the pFastBac vector (Invitrogen) or the pQE-TriSystem (Qiagen). The latter vector can be used for parallel protein expression using a single construct in E. coli, insect and mammalian cells. Generally, recombinant baculovirus can be generated by co-transfection of the shuttle vector and linearized baculovirus genomic DNA into insect cells such as Sf9 and Sf21 cells. Optimized protocols for co-transfection, virus amplification and plaque assay for virus titer determination will be obtained from the protocols of the different suppliers.

In yet other embodiments, Applicant uses the pQE-Tri-system (Qiagen) for expression in mammalian cells. This vector can be introduced into cells by traditional transfection techniques such as calcium phosphate, lipofection or electroporation. Protein expression is followed by western blotting with an anti-histidine antibody (Qiagen).

As those skilled in the art will appreciate, refolding of proteins can be a challenge, with many different techniques being available. In certain embodiments, Applicant uses a eukaryotic system as described above. Applicant has successfully refolded the murine and version 8 of the humanized ScFv with good solubility and functionality. Applicant's constructs can be evaluated for binding affinity utilizing the recombinant human CEACAM6 antigen, which has been cloned as a GST-tagged construct into the pGex vector (Invitrogen). DNA sequencing has confirmed the authenticity of the insert. As described above for the antibody fragments, human CEACAM6 antigen can be expressed in bacteria or baculovirus and purified to >95% purity using GST affinity chromatography in combination with AKTA Prime gel filtration chromatography.

Plates are coated overnight at 4° C. with an anti-histidine tagged antibody or anti-GST antibody in PBS/BSA. After washing the wells 4 times with PBS-Tween, purified histidine tagged ScFv or GST tagged CEACAM6 is added and incubated at room temperature for 2 hours. After washing in PBS-Tween 4 times CEACAM6 or ScFv is added, incubated for 1-2 hours at room temperature, washed and probed with an anti-GST antibody or anti-histidine antibody respectively. Secondary antibody is added in PBS/BSA and incubated at room temperature for 45 minutes. After washing 4 times in PBS-Tween, substrate solution (TMB) is added and color development is monitored in a microplate reader. These data are compared and contrasted to the original murine anti-CEACAM6 monoclonal antibody (murine IgG1 13.1).

The BIACore technology has become the standard method for measuring the affinity of antigen-antibody interactions and provides a tool to compare binding kinetics of a recombinant antibody fragment produced in bacteria with that of the parental monoclonal antibody. Applicant has discovered that the kinetic constants determined for the engineered monovalent antibody fragments are comparable to those obtained for the parental monovalent antibody fragments produced proteolytic cleavage from the parental monoclonal antibodies (35).

In real-time biomolecular interaction analysis (BIA), the antibody (ScFv or IgGI) is immobilized on a sensor chip surface, while a solution containing the antigen (CEACAM6) flows continuously over the surface or vice versa. Transport of the sample to the sensor surface is controlled with a microfluidics cartridge. A buffer solution is pumped at a constant flow rate over the sensor surface. A pulse of sample is injected and association of the analyte to the ligand is observed as an increase in the response expressed as resonance units (RU), followed as a function of time and presented as a sensorgram. From this data the association rate constant can be calculated. At the end of the injection, the sample is replaced by a continuous flow of buffer. The decrease in the response reflects the dissociation of the analyte from the ligand surface, and the data collected can be used to calculate the dissociation rate constant for the interaction.

In order to demonstrate that an anti-CEACAM6 monoclonal antibody can mediate pancreatic cancer cell killing Applicant has employed an in vitro cytotoxicity assay. This utilizes the CellTiter 96 Non-Radioactive Cell Proliferation Assay (Promega Corp., Madison, Wis.). Pancreatic cancer cell lines expressing CEACAM6 (CFPAC-1, ASPC-1, Capan-1, BXPC-3 and HPAF-2) are plated in 0.1 mL medium on day 0 in 96-well micro-titer plates (Falcon, #3072). On day 1, 10 μL of serial dilutions of the commercially available anti-CEACAM-6 Mab, the murine ScFv and nine versions of the humanized ScFv products will be added in replicates of 4 to the plates.

After incubation for 4 days at 37° C. in a humidified incubator, 20 μL, of a 20:1 mixture of [3-(4,5-dimethyl-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt; MTS], 2 mg/ml, and an electron coupling reagent, phenazine methosulfate (PMS, 0.92 mg/ml in DPBS), are added to each well and incubated for 4 hours at 37° C. Absorbance is measured using Model 7520 microplate reader (Cambridge Technology, Inc.) at 490 nm. Data are expressed as the percentage of survival of control calculated from the absorbance corrected for background absorbance. The surviving fraction of cells will be determined by dividing the mean absorbance values of the monoclonal antibody by the mean absorbance values of the control.

As discussed above, we have bacterially expressed the original murine ScFv and humanized ScFv version 8, and we have now evaluated the efficacy of these antibody fragments in 5 different pancreatic cancer cell lines in culture. FIG. 9 demonstrates that the bacterially expressed mouse ScFv and humanized ScFv version 8 are active antibody fragments against CEACAM6 expressing pancreatic cancer cell lines.

Therapeutic Efficacy of the Mouse ScFv in a Mouse Model of Pancreatic Cancer

BXPC-3 pancreatic cancer cell line over-expressing CEACAM6 was utilized for this study. The mice were male athymic nude and were innoculated with 10 million cells in the flank region. Tumors were grown to a mean volume of 50 mm3. There were 8 mice in the control and 8 mice in the treated groups. Treatment was initiated at day 28 after innoculation with recombinant mouse ScFv at 5 mg/kg or 10 mg/kg given intraperitoneally daily for 2 weeks. Tumor volumes were measured weekly. All animals maintained their weights in both groups. The data demonstrate that there was a 50-70% reduction in tumor volume with treatment compared to the untreated animals (FIG. 10).

Treatment of HPAF-2 Cells with anti-CEACAM6 Mab Promotes Apoptosis

In order to ascertain the mechanism(s) of anti-CEACAM6 monoclonal antibody (Mab) mediated apoptosis, a gene expression profile (GEP) study was performed utilizing the human affymetrix U133A oligonucleotide gene array consisting of ˜22,000 probes. HPAF-2 pancreatic cancer cells were treated with 1 μg/mL anti-CEACAM6 Mab for 6 and 24 hours. The control was untreated HPAP-2 cells. Total RNA was extracted utilizing the RNeasy Mini Kit (Qiagen, CA) according to the manufacturer's instructions. The amount of total RNA isolated from the cells was quantified using spectrophotometric OD260 measurements with yields ≧25 μg/sample. 5 μg of mRNA was used to generate first-strand cDNA by using a T7-linked oligo (dT) primer. After second-strand synthesis, in vitro transcription (Ambion) was performed with biotinylated UTP and CTP (Enzo Diagnostics), resulting in 40- to 80-fold linear amplification of RNA. 40 μg of biotinylated RNA was fragmented to 50- to 150-nt size before overnight hybridization at 45° C. to HG-U133A 2.0 Affymetrix array (Santa Clara, Calif.). Each gene on this chip is represented by 10 to 20 oligonucleotides, termed a ‘probe set’. The intensity of hybridization of labeled mRNA to these sets reflects the level of expression of a particular gene. After washing, arrays were stained with streptavidin—phycoerythrin (Molecular Probes) and scanned on a Hewlett-Packard scanner. Intensity for each feature of the array was captured by using GENECHIP SOFTWARE (Affymetrix, Calif.), and a single raw expression level for each gene was derived from the 10-20 probe pairs representing each gene by using a trimmed mean algorithm. Intensity values were scaled such that overall intensity for each chip of the same type was equivalent. The mean (±SD) difference between the scaling factors of all GeneChips was 0.75±0.15. The ratio of GAPDH 3′ to 5′ (1.02±0.10) indicated a high overall quality of the samples. Well measured genes were defined genes that had a ratio of signal intensity to background noise of greater than 2 in more than 80% of the samples hybridized. Mab treated was compared to the control sample and lists of ‘robust increasers’ or ‘robust decreasers’ were generated utilizing the Affymetrix Data Analysis Program (Affymetrix MAS 5.0). Fundamentals' guide was used to import these lists into GeneSpring (version 5.0) and obtain the intersection of robust increasers or decreasers respectively. Gene expression profiles were further classified according genes involved in promoting and evading apoptosis and self-sufficiency in growth signals including oncogenes and insensitivities to growth inhibitory signals.

The results indicated that several apoptotic proteins were robustly up-regulated at 6 hours and 24 hours respectively. The apoptotic protein that was markedly over-expressed at 6 hours was caspase-2 (˜10-fold) compared to untreated HPAF-2 cells. However, at 24 hours caspase-2 levels had decreased to ˜4-fold compared to untreated HPAF-2 cells. This result was confirmed with a western blot analysis after treating HPAF-2 cells with anti-CEACAM6 Mab at 1 μg/mL for 6, 24, 48 and 72 hours with a rabbit polyclonal antibody to active caspase-2 (Abeam Inc, MA) which migrates at 34 kDa (FIG. 11). There appears to be a basal level of caspase-2 in untreated cells (also observed in the gene expression profile analysis) and at 6 hours after treatment with anti-CEACAM6 Mab the level of caspase-2 increases and remains elevated for 48 hours. However, as cells undergo apoptosis the level decreases to below basal level. It has been difficult to assign caspase-2 to the effector or initiator caspase groups. It bears sequence homology to initiators (caspase-9 and CED-3), but its cleavage specificity is closer to the effectors (caspase-3 and -7). It has been observed that cell death occurring during the metaphase/anaphase transition is characterized by the activation of caspase-2 (which can be activated in response to DNA damage) and/or mitochondrial membrane permeabilization with the release of cell death effectors such as apoptosis-inducing factor and the caspase-9 and -3 activator cytochrome c (28). Although the mode of activation of caspase-2 is yet to be determined caspase-2 plays critical and singular roles in the control of programmed cell death.

Diagnostic and Prognostic Marker

The anti-CEACAM6 monoclonal antibody has not been developed as a diagnostic and/or prognostic marker. An immunohistochemical analysis on tissue microarrays from 243 colorectal patient biopsies prior to adjuvant chemotherapy from a randomized controlled clinical trial demonstrated that CEACAM6 over-expression independently predicted for poor overall survival in comparison to CEA or CEACAM1. In this tissue array CEACAM6 over-expression was present 55% of patients (Jantscheff P, Terracciano L, Lowy A. et al. Expression of CEACAM6 in resectable colorectal cancer: a factor of independent prognostic significance. J. Clin. Oncol. 2003, 21(19): 3638-46), validating it as a clinical marker and a potential therapeutic target in colorectal cancer. We also analyzed 30 patients with pancreatic cancer and found >75% to have CEACAM6 present on their tumors. Therefore the mouse or the humanized monoclonal antibody and/or the antibody fragments (ScFv) will be useful as a diagnostic and prognostic marker in any cancer or hematological malignancy that over-expresses (by greater than 2-fold compared to normal counterparts) CEACAM6.

While the preferred embodiments of the present invention have been illustrated in detail, it should be apparent that modifications and adaptations to those embodiments may occur to one skilled in the art without departing from the scope of the present invention.

Obviously, numerous modifications and variations of the present invention are possible in light of the above teachings. It is therefore to be understood that within the scope of the appended claims, the invention may be practiced otherwise than as specifically described herein

REFERENCES

  • 1. Von Hoff, D D, Mahadevan, D, Bearss, D J. New Developments in the Treatment of Patients with Pancreatic Cancer. Clinical Oncology Updates, 2001, 4: 1-15.
  • 2. Lynch H T, Smyrk T, Kern S E, Hruban R H, Lightdale C J, Lemon S J, Lynch J F, Fusaro L R, Fusaro R M, Ghadirian P. Familial pancreatic cancer. Semin Oncol. 1996, 23(2):251-75.
  • 3. Jaffee E M, Hruban R H, Canto M, Kern S E. Focus on pancreas cancer. Cancer Cell. 2002, 2(1):25-8.
  • 4. Bardeesy N, DePinho R A. Pancreatic cancer biology and genetics. Nat Rev Cancer, 2002, 2(12):897-909.
  • 5. Cubilla A L, Fitzgerald P J. Morphological patterns of primary nonendocrine human pancreas carcinoma. Cancer Res. 1975, 35(8):2234-48.
  • 6. Klein W M, Hruban R H, Klein-Szanto A J, Wilentz R E. Direct correlation between proliferative activity and dysplasia in pancreatic intraepithelial neoplasia (PanIN): additional evidence for a recently proposed model of progression. Mod Pathol. 2002, 15(4):441-7.
  • 7. Solcia, E, Capela, C, Kloppel, G. Tumors of the Pancreas (Ed. Rosai J.) (Armed Forces Institute of Pathology, Washington D.C., 1995).
  • 8. Iacobuzio-Donahue C A, Ryu B, Hruban R H, Kern S E. Exploring the host desmoplastic response to pancreatic carcinoma: gene expression of stromal and neoplastic cells at the site of primary invasion. Am J Pathol. 2002, 160(1):91=9.
  • 9. Lohr M, Schmidt C, Ringel J, Kluth M, Muller P, Nizze H, Jesnowski R. Transforming growth factor-beta1 induces desmoplasia in an experimental model of human pancreatic carcinoma. Cancer Res. 2001, 61(2):550-5.
  • 10. Holloway S, Davis M, Jaber R, Fleming J. A Clinically Relevant Model of Human Pancreatic Adenocarcinoma Identifies Patterns of Metastasis Associated with Alterations of the TGF-beta/Smad4 Signaling Pathway. Int J Gastrointest Cancer. 2003, 33(1):61-70.
  • 11. Han H, Bearss D J, Browne L W, Calaluce R, Nagle R B, Von Hoff D D. Identification of differentially expressed genes in pancreatic cancer cells using cDNA microarray. Cancer Res. 2002, 62(10):2890-6.
  • 12. Gardner-Thorpe J, Ito H, Ashley S W, Whang E E. Differential display of expressed genes in pancreatic cancer cells. Biochem Biophys Res Commun. 2002, 293(1):391-5.
  • 13. Friess H, Ding J, Kleeff J, Fenkell L, Rosinski J A, Guweidhi A, Reidhaar-Olson J F, Korc M, Hammer J, Buehler M W. Micro array-based identification of differentially expressed growth- and metastasis-associated genes in pancreatic cancer. Cell Mol Life Sci. 2003, 60(6):1180-99.
  • 14. Ryu B, Jones J, Blades N J, Parmigiani G, Hollingsworth M A, Hruban R H, Kern S E. Relationships and differentially expressed genes among pancreatic cancers examined by large-scale serial analysis of gene expression. Cancer Res. 2002, 62(3):819-26.
  • 15. Iacobuzio-Donahue C A, Maitra A, Olsen M, Lowe A W, van Heek N T, Rosty C, Walter K, Sato N, Parker A, Ashfaq R, Jaffee E, Ryu B, Jones J, Eshleman J R, Yeo C J, Cameron J L, Kern S E, Hruban R H, Brown P O, Goggins M. Exploration of global gene expression patterns in pancreatic adenocarcinoma using cDNA microarrays. Am J Pathol. 2003, 162(4):1151-62.
  • 16. Smit V T, Boot A J, Sinits A M, Fleuren G J, Cornelisse C J, Bos J L. KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas. Nucleic Acids Res. 1988, 16(16):7773-82.
  • 17. Griffin C A, Hruban R H, Morsberger L A, Ellingham T, Long P P, Jaffee E M, Hauda K M, Bohlander S K, Yeo C J. Consistent chromosome abnormalities in adenocarcinoma of the pancreas. Cancer Res. 1995, 55(11):2394-9.
  • 18. Aoki K, Yoshida N, Matsumoto H, Ide T, Sugimura M, Terada A. Suppression of Ki-ras p21 levels leading to growth inhibition of pancreatic cancer cell lines with Ki-ras mutation but not those without Ki-ras mutation. Mol. Carcinog. 1997, 20: 251-258.
  • 19. Ikeda N, Nakajima Y, Sho M, Adachi M, Huang C L; Iki K, Kanehiro H, Hisanaga M, Nakano H; Miyake M. The association of K-ras gene mutation and vascular endothelial growth factor gene expression in pancreatic carcinoma. Cancer. 2001, 92(3):488-99.
  • 20. Wagner M, et al. A murine tumor progression model for pancreatic cancer recapitulating the genetic alterations of the human disease. Genes Dev. 2001, 15:286-293.
  • 21. Sotillo R. et al. Wide spread tumors in knock-in mice carrying a CDK4 protein insensitive to INK4 inhibitors. EMBO J. 2001, 20:6637-6647.
  • 22. Lersch C, et al. Randomized phase II study of SCH66366 and gemcitabine in the treatment of metastatic adenocarcinoma of the pancreas. Proc. Am. Soc. Clin. Oncol. 2001, Abstract 608.
  • 23. Beauchemin N, Draber P, Dveksler G, Gold P, Gray-Owen S, Grunert F, Hammarstrom S, Holmes K V, Karlsson A, Kuroki M, Lin S H, Lucka L, Najjar S M, Neumaier M, Obrink B, Shively J E, Skubitz K M, Stanners C P, Thomas P, Thompson J A, Virji M, von Kleist S, Wagener C, Watt S, Zimmermann W. Redefined nomenclature for members of the carcinoembryonic antigen family. Exp Cell Res. 1999, 252(2):243-9.
  • 24. Kuroki M, Abe H, Imakiirei T, Liao S, Uchida H, Yamauchi Y, Oikawa S, Kuroki M. Identification and comparison of residues critical for cell-adhesion activities of two neutrophil CD66 antigens, CEACAM6 and CEACAM8. J Leukoc Biol. 2001, 70(4):543-50.
  • 25. Chevinsky A H. CEA in tumors of other than colorectal origin. Semin Surg Oncol. 1991, 7(3):162-6.
  • 26. Scholzel S, Zimmermann W, Schwarzkopf G, Grunert F, Rogaczewski B, Thompson J. Carcinoembryonic antigen family members CEACAM6 and CEACAM7 are differentially expressed in normal tissues and oppositely deregulated in hyperplastic colorectal polyps and early adenomas. Am J Pathol. 2000, 156(2):595-605.
  • 27. Ordonez C, Screaton R A, Ilantzis C, Stanners C P. Human carcinoembryonic antigen functions as a general inhibitor of anoikis. Cancer Res. 2000, 60(13):3419-24.
  • 28. Sippel C J, Fallon R J, Perlmutter D H. Bile acid efflux mediated by the rat liver canalicular bile acid transport/ecto-ATPase protein requires serine 503 phosphorylation and is regulated by tyrosine 488 phosphorylation. J Biol. Chem. 1994, 269(30):19539-45.
  • 29. Bnimmer J, Neumaier M, Gopfert C, Wagener C. Association of pp 60c-src with biliary glycoprotein (CD66a), an adhesion molecule of the carcinoembryonic antigen family downregulated in colorectal carcinomas. Oncogene. 1995, 11(8):1649-55.
  • 30. Beauchemin N, Kunath T, Robitaille J, Chow B, Turbide C, Daniels E, Veillette A. Association of biliary glycoprotein with protein tyrosine phosphatase SHP-1 in malignant colon epithelial cells. Oncogene. 1997, 14(7):783-90.
  • 31. Satow Y, Cohen G H, Padlan E A, Davies D R. Phosphocholine binding immunoglobulin Fab McPC603. An X-ray diffraction study at 2.7 A. J Mol Biol. 1986, 190(4):593-604.
  • 32. Johnson G, Wu T T. Kabat Database and its applications: future directions. Nucleic Acids Res. 2001, 29(1):205-6.
  • 33. Pearson W R. Flexible sequence similarity searching with the FASTA3 program package. Methods Mol. Biol. 2000; 132:185-219.
  • 34. Coomber D W, Hawkins N J, Clark M A, Ward R L. Generation of anti-p53 Fab fragments from individuals with colorectal cancer using phage display. J. Immunol. 1999, 163(4):2276-83.
  • 35. Glas A M, Nottenburg C, Milner E C. Analysis of rearranged immunoglobulin heavy chain variable region genes obtained from a bone marrow transplant (BMT) recipient. Clin Exp Immunol. 1997, 107(2):372-80.
  • 36. Akashi S, Kato K, Torizawa T, Dohmae N, Yamaguchi H, Kamachi M, Harada A, Imanaka T, Shimada I, Takio K. Structural characterization of mouse monoclonal antibody 13-1 against a porphyrin derivative: Identification of a disulfide bond in CDR-H3 of Mab 13-1. Biochem Biophys Res Commun. 1997, 240(3):566-72.
  • 37. Pluckthun A, Krebber A, Krebber C, Horn, U, Knupfer U, Wenderoth R, Nieba L, Proba K, and Riesenberg D. Producing antibodies in Escherichia coli: from PCR to fermentation. In: Antibody Engineering, McCafferty J, Hoogenboom R, and Chiswell D J, Eds. (IRL Press, Oxford; 1996, 203-252).
  • 38. Alfthan K. Surface plasmon resonance biosensors as a tool in antibody engineering. Biosens Bioelectron. 1998, 13(6):653-63.
  • 39. Issaq H J, Veenstra T D, Conrads T P, Felschow D. The SELDI-TOF MS approach to proteomics: protein profiling and biomarker identification. Biochem Biophys Res Commun. 2002, 292(3):587-92.
  • 40. Bruns C J, Harbison M T, Davis D W, Portera C A, Tsan R, McConkey D J, Evans D B, Abbruzzese J L, Hicklin D J, Radinsky R. Epidermal growth factor receptor blockade with C225 plus gemcitabine results in regression of human pancreatic carcinoma growing orthotopically in nude mice by antiangiogenic mechanisms. Clin Cancer Res. 2000; 6(5):1936-48.
  • 41. Kaufmann M, Lindner P, Honegger A, Blank K, Tschopp M, Capitani G, Pluckthun A, Grutter M G. Crystal structure of the anti-His tag antibody 3D5 single-chain fragment complexed to its antigen. J Mol. Biol. 2002, 318(1):135-47.
  • 42. Islam S A, Carvin D, Sternberg M J, Blundell T L. HAD, a data bank of heavy-atom binding sites in protein crystals: a resource for use in multiple isomorphous replacement and anomalous scattering. Acta Crystallogr D Biol Crystallogr. 1998, 54(Pt 6 Pt 1):1199-206.
  • 43. Hallborn J, Carlsson R. Automated screening procedure for high-throughput generation of antibody fragments. Biotechniques. 2002, Suppl:30-7.

Claims

1-54. (canceled)

55. A method of treating brain cancer, prostate cancer, liver cancer, and/or kidney cancer, comprising administering an effective amount of an anti-CEACAM6 antibody or antibody fragment thereof comprising all six of the CDRs of monoclonal antibody 13.1 to a patient with brain cancer, prostate cancer, liver cancer, and/or kidney cancer, wherein the antibody or antibody fragment induces apoptosis in cancer cells.

56. The method of claim 55, wherein the antibody or antibody fragment thereof induces apoptosis against cancer cells in the Cellular Cytotoxicity Assay described herein.

57. The method of claim 55, which is a method of treating brain cancer.

58. The method of claim 55, which is a method of treating prostate cancer.

59. The method of claim 55, which is a method of treating liver cancer.

60. The method of claim 55, which is a method of treating lung cancer.

61. The method of claim 55, wherein the antibody or antibody fragment thereof is humanized.

62. The method of claim 55, wherein the antibody or antibody fragment thereof is chimeric.

63. The method of claim 55, wherein said antibody or antibody fragment thereof is an antibody fragment, and the antibody fragment is an ScFv.

64. The method of claim 63, wherein the ScFv is murine or humanized.

65. The method of claim 55, wherein the patient is a human or a non-human animal.

66. The method of claim 55, wherein the patient is a human.

67. The method of claim 66, wherein the antibody or antibody fragment thereof is administered parenterally, intraperitoneally, intravenously, subcutaneously, orally, nasally, via inhalation or rectally.

68. The method of claim 55, wherein the antibody or antibody fragment thereof is administered intravenously at a dosage of from 5 mg/m2 to 2000 mg/m2.

69. The method of claim 55, wherein the antibody or antibody fragment thereof is monoclonal antibody 13.1.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: