US20120115746A1
2012-05-10
13/311,492
2011-12-05
Compositions and methods for diagnosing and treating CVH and CVH-associated disorders are disclosed. Genes differentially expressed in CVH tissues relative to normal tissues are identified. The genes and the gene products (i.e., the polynucleotides transcribed from and polypeptides encoded by the genes) can be used as markers of CVH. The genes and the gene products can also be used to screen agents that modulate the gene expression or the activities of the gene products.
Get notified when new applications in this technology area are published.
G01N33/6893 » CPC main
Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
G01N2800/065 » CPC further
Detection or diagnosis of diseases; Gastro-intestinal diseases Bowel diseases, e.g. Crohn, ulcerative colitis, IBS
C40B30/04 IPC
Methods of screening libraries by measuring the ability to specifically bind a target molecule, e.g. antibody-antigen binding, receptor-ligand binding
C12Q1/68 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids
G01N33/566 IPC
Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing; Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
C07K14/435 IPC
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
C07H21/04 IPC
Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
This application claims priority from U.S. Provisional Application Ser. No. 60/496,716 filed Aug. 21, 2003. The entirety of that provisional application is incorporated herein by reference.
The present invention relates generally to the diagnosis and treatment of disorders associated with chromic visceral hypersensitivity (CVH), and in particular irritable bowel syndrome (IBS). The invention also relates to genes associated with CVH, polynucleotides transcribed from these genes and polypeptides encoded by these genes. Such polynucleotides and polypeptides can be used for the diagnosis and treatment of CVH.
Irritable Bowel Syndrome (IBS) is a functional bowel disorder of unknown etiology. A functional disorder refers to a disorder or disease where the primary abnormality is an altered physiological function, rather than an identifiable structural or biochemical cause. IBS is characterized by a group of symptoms including intermittent abdominal pain and discomfort and alterations in bowel habits, such as loose or more frequent bowel movements, diarrhea, and/or constipation that occur in the absence of detectable ongoing organic disease.
IBS affects approximately 10-20% of the general population. It is the most common disease diagnosed by gastroenterologists and one of the most common disorders seen by primary care physicians. IBS is understood as a multi-faceted disorder. In people with IBS, symptoms result from what appears to be a disturbance in the interaction between the gut or intestines, the brain, and the autonomic nervous system that alters regulation of bowel motility (motor function) or sensory function.
Human studies demonstrate that IBS is associated with a state of chronic visceral hypersensitivity (CVH) suggesting that processing of visceral sensory information is altered. However, little is known about how the afferent nervous system is changed in this syndrome. A hallmark of TBS is increased visceral hypersensitivity, but the molecular changes underlying the development and maintenance of chronic visceral hypersensitivity in IBS are not known. Current medical treatments for IBS primarily target peripheral symptoms rather than the underlying causes, and therapeutic gains from drug treatments are usually modest and the placebo responses are high (Mertz et al., Gastroenterology, 109:40-52, 1995). Defining the underlying neurological and molecular defects is therefore important to the design of more successful therapeutic strategies. Moreover, there is a need in the art for improved methods for screening, diagnosing, and treating MS and other CVH-related disorders.
CNI-1493 is a MAPK and TNF inhibitor with anti-inflammatory and possible analgesic actions. CNI-1493 inhibits signal transduction pathways by preventing phosphorylation of p38 MAP kinase and JNK, and inhibits production of the proinflammatory cytokines such as TNF-alpha, IL-1, MIP-1 alpha, and MIP-1 beta. In animal models, CNI-1493 has shown protective activity against a wide variety of conditions, ranging from stroke to inflammatory bowel disease. However, CNI-1493 has never been tested for its anti-nociceptive activity in the absence of inflammation. Recently, an animal model of chronic visceral hypersensitivity was created using mechanical and chemical irritation of the colon of neonatal rats (Al-Chaer et al., Gastroenterology, 119:1276-1285, 2000). The animal model provides an ideal platform for studying IBS, validating the neurogenic components of functional abdominal pain, and testing agents that may reduce visceral hypersensitivity.
One aspect of the present invention relates to the treatment for disorders associated with CVH using guanylhydrazone. In one embodiment, the present invention provides a treatment for IBS using CNI1493.
Another aspect of the present invention relates to CVH-related genes (CVHGs) and the gene products, which include the polynucleotides transcribed from the CVHGs (CHVPNs) and the polypeptides encoded by the CVHGs (CHVPPs).
In one embodiment, the present invention provides methods for diagnosing and monitoring CVH and CVH-related disorders by comparing the expression levels of one or more CVHGs at the nucleotide or protein level in biological samples from a subject to control samples.
In another embodiment, the present invention provides pharmaceutical compositions for the treatment of CVH and CVH-related disorders. The pharmaceutical compositions comprise a pharmaceutically acceptable carrier and at least one of the following: (1) a CVHG product; (2) an agent that modulates an activity of a CVHG product; and (3) an agent that modulates the expression of a CVHG.
In another embodiment, the present invention provides methods for treating CVH and CVH-related disorders in a patient with the pharmaceutical compositions described above. The patient may be afflicted with CVH, in which case the methods provide treatment for the disease. The patient may also be considered at risk for CVH, in which case the methods provide prevention for disease development.
In another embodiment, the present invention provides methods for screening anti-CVH agents based on the agents' interaction with CVHPPs, or the agents' effect on the activity or expression of CVHPPs.
In another embodiment, the present invention provides biochips for diagnosing CVH and CHH-related disorders, and for screening agents that inhibit CVH. The biochips comprise at least one of the following (1) a CVHPP or its variant, (2) a portion of a CVHPP or its variant (3) a CVHPN or its variant, and (4) a portion of a CVHPN or its variant.
In another embodiment, the present invention provides a kit for diagnosing CVH and CVH-related disorders. The kit comprises at least one of the following (1) polynucleotide probe that specifically hybridizes to a CVHPN, and (2) an antibody capable of specific binding to a CVHPP.
FIG. 1. Increased sensitivity to CRD in adult rats treated with acetic acid on P10 (n=8). Data was analyzed by two-way repeated measures ANOVA with distention pressure as the repeated factor and P10 treatment as a between group factor. There was a significant effect of P10 treatment (F 1, 12.98) p<0.003, of distention pressure (F 7, 89.9) p<0.001, and there was a significant interaction between distention pressure and P10 treatment (F 7, 4.04) p<0.001. Means were compared with a Tukey test. Significant differences between acetic acid treated and controls were found at distention pressures of 30 (p=0.004), 40 (p<0.001), 50 (p<0.001), 60 (p=0.001) and 70 (p=0.035) mm Hg.
FIG. 2. Effect of CNI-1493 on the response of sensitized rats to graded CRD (n=8). Data was analyzed by two-way repeated measures ANOVA with distention pressure as the repeated factor and drug treatment as a between group factor. There was a significant effect of CNI1493 treatment (F 1, 16.96) p=0.001, of distention pressure (F 7, 28.55) p<0.001, but there was no significant interaction between distention pressure and CNI1493 treatment (F 7, 1.94) p=0.071. Means were compared with a Tukey test. Significant differences between CNI-1493 treated and controls were found at distention pressures of 20 (P=0.001), 30 (p=0.003), 40 (p<0.001), 50 (p=0.001), 60 (p<0.001) and 70 (p=0.015) and 80 (p=0.007) mm Hg.
FIG. 3. Colon histology and MPO activity. H&E stained colon sections from control, vehicle (A); control, cni-1493 (B); sensitized, vehicle (C); and sensitized, CNI1493 (D). Histogram showing MPO activity in colons (E).
The preferred embodiments of the invention are described below. Unless specifically noted, it is intended that the words and phrases in the specification and claims be given the ordinary and accustomed meaning to those of ordinary skill in the applicable art or arts. If any other meaning is intended, the specification will specifically state that a special meaning is being applied to a word or phrase.
It is further intended that the inventions not be limited only to the specific structure, material or acts that are described in the preferred embodiments, but in addition, include any and all structures, materials or acts that perform the claimed function, along with any and all known or later-developed equivalent structures, materials or acts for performing the claimed function.
Further examples exist throughout the disclosure, and it is not applicant's intention to exclude from the scope of his invention the use of structures, materials, methods, or acts that are not expressly identified in the specification, but nonetheless are capable of performing a claimed function.
The present invention is generally directed to compositions and methods for the diagnosis, treatment, and prevention of CVH and CVH-related disorders; and to the identification of novel therapeutic agents for CVH and CVH-related disorders. The present invention is based on the finding that guanylhydrazone is capable of ameliorating CVH in a rat model of IBS and the discovery of transcribed polynucleotides that are differentially expressed in the colon tissue of rats with chemically induced CVH relative to control animals.
To facilitate an understanding of the present invention, a number of terms and phrases are defined below:
As used herein, the terms âa differentially expressed geneâ refer to a gene that meets all of the following criteria during an Affymetrix microarray analysis: (1) the average expression of the gene shows a fold change of two or greater compared with controls and (2) significant changes in gene expression were detected by analyzing signal intensity values by two-way ANOVA with 99% confidence. The differentially expressed genes identified in the colon tissue samples of CVH and CNI1493-treated rats are designated as CVH-related genes (CVHGs). CVHGs generally refer to the genes listed in Tables 3-8.
As used herein, the terms âCVH-related polynucleotide (CVHPN)â and âCVHG polynucleotideâ are used interchangeably. The terms include a transcribed polynucleotide (e.g., DNA, cDNA or mRNA) that comprises one of the CVHG sequences or a portion thereof.
As used herein, the terms âCVH-related polypeptide (CVHPP)â and âCVHG proteinâ are used interchangeably. The terms include polypeptides encoded by an CVHG, an CVHPN, or a portion of an CVHG or CVHPN.
As used herein, a âCVHG productâ includes a nucleic acid sequence and an amino acid sequence (e.g., a polynucleotide or polypeptide) generated when an CVHG is transcribed and/or translated. Specifically, CVHG products include CVHPNs and CVHPPs.
As used herein, a âvariant of a polynucleotideâ includes a polynucleotide that differs from the original polynucleotide by one or more substitutions, additions, deletions and/or insertions such that the activity of the encoded polypeptide is not substantially changed (e.g., the activity may be diminished or enhanced, by less than 50%, and preferably less than 20%) relative to the polypeptide encoded by the original polynucleotide.
A variant of a polynucleotide also includes polynucleotides that are capable of hybridizing under reduced stringency conditions, more preferably stringent conditions, and most preferably highly stringent conditions to the original polynucleotide (or a complementary sequence). Examples of conditions of different stringency are listed in Table 2.
It will be appreciated by those of ordinary skill in the art that, as a result of the degeneracy of the genetic code, there are many nucleotide sequences that encode a polypeptide as described herein. Some of these polynucleotides bear minimal homology to the nucleotide sequence of any native gene. Nonetheless, polynucleotides that vary due to differences in codon usage are specifically contemplated by the present invention.
As used herein, a âvariant of a polypeptideâ is a polypeptide that differs from a native polypeptide in one or more substitutions, deletions, additions and/or insertions, such that the bioactivity or immunogenicity of the native polypeptide is not substantially diminished. In other words, the bioactivity of a variant polypeptide or the ability of a variant polypeptide to react with antigen-specific antisera may be enhanced or diminished by less than 50%, and preferably less than 20%, relative to the native polypeptide. Variant polypeptides include those in which one or more portions, such as an N-terminal leader sequence or transmembrane domain, have been removed. Other preferred variants include variants in which a small portion (e.g., 1-30 amino acids, preferably 5-15 amino acids) has been removed from the N- and/or C-terminal of the mature protein.
Modifications and changes can be made in the structure of a polypeptide of the present invention and still obtain a molecule having biological activity and/or immunogenic properties. Because it is the interactive capacity and nature of a polypeptide that defines that polypeptide's biological activity, certain amino acid sequence substitutions can be made in a polypeptide sequence (or, of course, its underlying DNA coding sequence) and nevertheless obtain a polypeptide with like properties.
In making such changes, the hydropathic index of amino acids can be considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a polypeptide is generally understood in the art. It is believed that the relative hydropathic character of the amino acid residue determines the secondary and tertiary structure of the resultant polypeptide, which in turn defines the interaction of the polypeptide with other molecules, such as enzymes, substrates, receptors, antibodies, antigens, and the like. It is known in the art that an amino acid can be substituted by another amino acid having a similar hydropathic index and still obtain a functionally equivalent polypeptide. In such changes, the substitution of amino acids whose hydropathic indices are within +/â2 is preferred, those that are within +/â1 are particularly preferred, and those within +/â0.5 are even more particularly preferred.
Substitution of like amino acids can also be made on the basis of hydrophilicity, particularly where the biological functional equivalent polypeptide or polypeptide fragment, is intended for use in immunological embodiments. U.S. Pat. No. 4,554,101, incorporated hereinafter by reference, states that the greatest local average hydrophilicity of a polypeptide, as governed by the hydrophilicity of its adjacent amino acids, correlates with its immunogenicity and antigenicity, i.e. with a biological property of the polypeptide.
As detailed in U.S. Pat. No. 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0±1); glutamate (+3.0±1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); proline (â0.5±1); threonine (â0.4); alanine (â0.5); histidine (â0.5); cysteine (â1.0); methionine (â1.3); valine (â1.5); leucine (â1.8); isoleucine (â1.8); tyrosine (â2.3); phenylalanine (â2.5); tryptophan (â3.4). It is understood that an amino acid can be substituted for another having a similar hydrophilicity value and still obtain a biologically equivalent, and in particular, an immunologically equivalent polypeptide. In such changes, the substitution of amino acids whose hydrophilicity values are within ±2 is preferred, those that are within ±1 are particularly preferred, and those within ±0.5 are even more particularly preferred.
As outlined above, amino acid substitutions are generally therefore based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions which take various of the foregoing characteristics into consideration are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine (See Table 1, below). The present invention thus contemplates functional or biological equivalents of an CVHPP as set forth above.
| TABLE 1 |
| Amino Acid Substitutions |
| Exemplary Residue | ||
| Original Residue | Substitution | |
| Ala | Gly; Ser | |
| Arg | Lys | |
| Asn | Gln; His | |
| Asp | Glu | |
| Cys | Ser | |
| Gln | Asn | |
| Glu | Asp | |
| Gly | Ala | |
| His | Asn; Gln | |
| Ile | Leu; Val | |
| Leu | Ile; Val | |
| Lys | Arg | |
| Met | Leu; Tyr | |
| Ser | Thr | |
| Thr | Ser | |
| Trp | Tyr | |
| Tyr | Trp; Phe | |
| Val | Ile; Leu | |
A variant may also, or alternatively, contain nonconservative changes. In a preferred embodiment, variant polypeptides differ from a native sequence by substitution, deletion or addition of five amino acids or fewer. Variants may also (or alternatively) be modified by, for example, the deletion or addition of amino acids that have minimal influence on the immunogenicity, secondary structure, tertiary structure, and hydropathic nature of the polypeptide.
Polypeptide variants preferably exhibit at least about 70%, more preferably at least about 90% and most preferably at least about 95% sequence homology to the original polypeptide.
A polypeptide variant also includes a polypeptide that is modified from the original polypeptide by either natural processes, such as post-translational processing, or by chemical modification techniques which are well known in the art. Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications. Polypeptides may be branched, for example, as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched, and branched cyclic polypeptides may result from post-translation natural processes or may be made by synthetic methods. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a fluorophore or a chromophore, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination.
As used herein, a âbiologically active portionâ of a CVHPP includes a fragment of a CVHPP comprising amino acid sequences sufficiently homologous to or derived from the amino acid sequence of the CVHPP, which includes fewer amino acids than the full length CVHPP, and exhibits at least one activity of the CVHPP. Typically, a biologically active portion of a CVHPP comprises a domain or motif with at least one activity of the CVHPP. A biologically active portion of a CVHPP can be a polypeptide which is, for example, 10, 25, 50, 100, 200 or more amino acids in length. Biologically active portions of a CVHPP can be used as targets for developing agents which modulate a CVHPP-mediated activity.
As used herein, an âimmunogenic portion,â an âantigen,â an âimmunogen,â or an âepitopeâ of a CVHPP includes a fragment of a CVHPP comprising an amino acid sequence sufficiently homologous to, or derived from, the amino acid sequence of the CVHPP, which includes fewer amino acids than the full length CVHPP and can be used to induce an anti-CVHPP humoral and/or cellular immune response.
As used herein, the term âmodulationâ includes, in its various grammatical forms (e.g., âmodulatedâ, âmodulationâ, âmodulatingâ, etc.), up-regulation, induction, stimulation, potentiation, and/or relief of inhibition, as well as inhibition and/or down-regulation or suppression.
As used herein, the term âcontrol sequencesâ or âregulatory sequencesâ refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism. The term âcontrol/regulatory sequenceâ is intended to include promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Control/regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cells and those which direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences).
A nucleic acid sequence is âoperably linkedâ to another nucleic acid sequence when the former is placed into a functional relationship with the latter. For example, a DNA for a presequence or secretory leader peptide is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, âoperably linkedâ means that the DNA sequences being linked are contiguous and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice.
As used herein, the âstringencyâ of a hybridization reaction refers to the difficulty with which any two nucleic acid molecules will hybridize to one another. The present invention also includes polynucleotides capable of hybridizing under reduced stringency conditions, more preferably stringent conditions, and most preferably highly stringent conditions, to polynucleotides described herein. Examples of stringency conditions are shown in Table 2 below: highly stringent conditions are those that are at least as stringent as, for example, conditions A-F; stringent conditions are at least as stringent as, for example, conditions G-L; and reduced stringency conditions are at least as stringent as, for example, conditions M-R.
| TABLE 2 |
| Stringency Condition |
| Poly- | ||||
| Stringency | nucleotide | Hybrid | Hybridization | Wash Temp. |
| Condition | Hybrid | Length (bp)1 | Temperature and BufferH | and BufferH |
| A | DNA:DNA | >50 | 65° C.; 1xSSC -or- | 65° C.; |
| 42° C.; 1xSSC, 50% formamide | 0.3xSSC | |||
| B | DNA:DNA | <50 | TB*; 1xSSC | TB*; 1xSSC |
| C | DNA:RNA | >50 | 67° C.; 1xSSC -or- | 67° C.; |
| 45° C.; 1xSSC, 50% formamide | 0.3xSSC | |||
| D | DNA:RNA | <50 | TD*; 1xSSC | TD*; 1xSSC |
| E | RNA:RNA | >50 | 70° C.; 1xSSC -or- | 70° C.; |
| 50° C.; 1xSSC, 50% formamide | 0.3xSSC | |||
| F | RNA:RNA | <50 | TF*; 1xSSC | TF*; 1xSSC |
| G | DNA:DNA | >50 | 65° C.; 4xSSC -or- | 65° C.; |
| 42° C.; 4xSSC, 50% formamide | 1xSSC | |||
| H | DNA:DNA | <50 | TH*; 4xSSC | TH*; |
| 4xSSC | ||||
| I | DNA:RNA | >50 | 67° C.; 4xSSC -or- | 67° C.; |
| 45° C.; 4xSSC, 50% formamide | 1xSSC | |||
| J | DNA:RNA | <50 | TJ*; 4xSSC | TJ*; 4xSSC |
| K | RNA:RNA | >50 | 70° C.; 4xSSC -or- | 67° C.; |
| 50° C.; 4xSSC, 50% formamide | 1xSSC | |||
| L | RNA:RNA | <50 | TL*; 2xSSC | TL*; 2xSSC |
| M | DNA:DNA | >50 | 50° C.; 4xSSC -or- | 50° C.; |
| 40° C.; 6xSSC, 50% formamide | 2xSSC | |||
| N | DNA:DNA | <50 | TN*; 6xSSC | TN*; 6xSSC |
| O | DNA:RNA | >50 | 55° C.; 4xSSC -or- | 55° C.; |
| 42° C.; 6xSSC, 50% formamide | 2xSSC | |||
| P | DNA:RNA | <50 | TP*; 6xSSC | TP*; 6xSSC |
| Q | RNA:RNA | >50 | 60° C.; 4xSSC -or- | 60° C.; |
| 45° C.; 6xSSC, 50% formamide | 2xSSC | |||
| R | RNA:RNA | <50 | TR*; 4xSSC | TR*; 4xSSC |
| 1The hybrid length is that anticipated for the hybridized region(s) of the hybridizing polynucleotides. When hybridizing a polynucleotide to a target polynucleotide of unknown sequence, the hybrid length is assumed to be that of the hybridizing polynucleotide. When polynucleotides of known sequence are hybridized, the hybrid length can be determined by aligning the sequences of the polynucleotides and identifying the region or regions of optimal sequence complementarity. | ||||
| HSSPE (1xSSPE is 0.15M NaCl, 10 mM NaH2PO4, and 1.25 mM EDTA, pH 7.4) can be substituted for SSC (1xSSC is 0.15M NaCl and 15 mM sodium citrate) in the hybridization and wash buffers; washes are performed for 15 minutes after hybridization is complete. | ||||
| TB* â TR*: The hybridization temperature for hybrids anticipated to be less than 50 base pairs in length should be 5-10° C. less than the melting temperature (Tm) of the hybrid, where Tm is determined according to the following equations. | ||||
| For hybrids less than 18 base pairs in length, Tm(° C.) = 2(# of A + T bases) + 4(# of G + C bases). | ||||
| For hybrids between 18 and 49 base pairs in length, Tm(° C.) = 81.5 + 16.6(log10Na+) + 0.41(% G+C) â (600/N), where N is the number of bases in the hybrid, and Na+ is the concentration of sodium ions in the hybridization buffer (Na+ for 1xSSC = 0.165M). |
As used herein, the terms âimmunospecific bindingâ and âspecifically bind toâ refer to antibodies that bind to an antigen with a binding affinity or 105 Moles taken either from pre-CVH or from a subject who has not suffered CVH, or from a cell, tissue or sample that is not affected by CVH. Control samples of the present invention are taken from normal samples.
As used herein, the term âexpression patternâ includes expression of a group of genes at RNA or protein level, the quantity or activity of each member of which is correlated with the incidence or risk of incidence of CVH and CVH associated diseases. An expression pattern comprises expression level of 2 or more CVHGs. An expression pattern may also comprise expression level of 2-5, 5-15, 15-35, 35-50, or more than 50 CVHGs.
As used herein, the terms âtreating,â âtreatment,â and âtherapyâ refer to curative therapy, prophylactic therapy, and preventative therapy.
Various aspects of the invention are described in further detail in the following subsections. The subsections below describe in more detail the present invention. The use of subsections is not meant to limit the invention; subsections may apply to any aspect of the invention.
One aspect of the present invention relates to a method for treating CVH and CVH-related disorders with compositions comprising a guanylhydrazone compound. In one embodiment, the CVH-related disorder is IBS and the guanylhydrazone compound is CNI1493.
Another aspect of the present invention relates to CVH-related genes. Briefly, new born rats were sensitized by infusion of acetic acid into the colon at P10. Control rats received saline. At eight weeks, the animals were divided into four groups: control+vehicle; control+CNI1493; sensitized+vehicle; and sensitized+CNI1493. Colon samples were obtained after CNI1493 treatment (5 mg/kg for four days, the vehicle group received vehicle only). Gene expression patterns in the colon tissue samples and S1 dorsal root ganglia (S1 DRG) were analyzed using Affymetrix rat genome 230A chips (Affymetrix, Santa Clara, Calif.). Single array analysis for each chip was performed by Affymetrix Microarray Suite (MAS) software to produce a detection call, present, absent or marginal and a signal intensity value for each gene that is a relative measure of abundance of the transcript. For comparison of signal intensity values between chips, all chips will be scaled to an average intensity of 500. Genes called âAbsentâ across all chips and genes without a Fold-change â§2.0 in at least one of the pairwise comparisons of chips from different treatment groups are excluded. The probe sets with absolute call âAbsentâ across all chips and Fold-change <2.0 in all of the possible pairwise comparisons, are filtered out. ANOVA was then performed on the filtered data set. Significant changes in gene expression were detected by analyzing signal intensity values by two-way ANOVA with 99% confidence limits. The differentially regulated genes were subjected to cluster analysis to identify genes associated with sensitization and treatment.
Tables 3 and 4 provides a list of the genes that are differentially expressed in the colon and S1 DRG, respectively, of the sensitized animals, i.e., animals suffering from CVH. Tables 5 and 6 provide a list of the genes that are differentially expressed in the colon and S1 DRG, respectively, in CNI1493-treated animals. Since CNI1493 treatment ameliorates CVH in the sensitized animals, genes differentially regulated by CNI1493 may also be related to the etiology of CVH. Accordingly, genes listed in Tables 3-6 are designated as CVH-related genes (CVHGs).
| TABLE 3 |
| Genes differentially expressed in sensitized colon |
| No. | Acce. No. | Symbol | CTRL-VHL | CTRL-CNI | IBS-VHL | IBS-CNI |
| 73 | NM_021769 | Sult-n | 1.00 | 0.85 | 2.98 | 1.85 |
| 57 | NM_022531 | Des | 1.00 | 1.03 | 2.55 | 1.31 |
| 14 | BF389682 | zzN/A | 1.00 | 1.53 | 2.49 | 2.04 |
| 16 | BF419200 | Cebpd | 1.00 | 1.03 | 2.44 | 2.28 |
| 26 | BI296437 | zzN/A | 1.00 | 1.14 | 2.43 | 1.21 |
| 25 | NM_013002 | Pcp4 | 1.00 | 0.88 | 2.29 | 1.14 |
| 55 | NM_013122 | Igfbp2 | 1.00 | 0.75 | 2.19 | 0.94 |
| 74 | NM_024400 | Adamts1 | 1.00 | 0.90 | 2.11 | 1.14 |
| 65 | AI229029 | Tubb3 | 1.00 | 0.93 | 2.05 | 1.53 |
| 43 | BI282702 | Acta2 | 1.00 | 0.95 | 2.03 | 0.99 |
| 44 | BF399310 | zzN/A | 1.00 | 0.64 | 2.01 | 0.78 |
| 64 | NM_031970 | Hspb1 | 1.00 | 1.14 | 1.90 | 1.40 |
| 12 | ILGFBP4 | BC019836 | 1.00 | 1.41 | 1.88 | 2.00 |
| 58 | BF290193 | zzN/A | 1.00 | 0.65 | 1.84 | 0.90 |
| 36 | AA012755 | 1.00 | 0.72 | 1.83 | 0.79 | |
| 45 | AI103600 | zzN/A | 1.00 | 0.57 | 1.81 | 0.58 |
| 63 | AA851939 | Fxyd6 | 1.00 | 0.95 | 1.81 | 1.26 |
| 56 | AA799832 | zzN/A | 1.00 | 0.78 | 1.80 | 0.95 |
| 50 | NM_019904 | Lgals1 | 1.00 | 0.74 | 1.79 | 0.96 |
| 37 | NM_017148 | Csrp1 | 1.00 | 0.63 | 1.72 | 0.71 |
| 35 | BI283060 | zzN/A | 1.00 | 0.63 | 1.71 | 0.69 |
| 39 | AA800892 | zzN/A | 1.00 | 0.57 | 1.71 | 0.68 |
| 29 | BG373779 | LOC308709 | 1.00 | 0.48 | 1.68 | 0.59 |
| 2 | BI285494 | Ifitm31 | 1.00 | 3.86 | 1.66 | 4.90 |
| 47 | NM_053770 | Argbp2 | 1.00 | 0.79 | 1.66 | 0.77 |
| 34 | NM_012893 | Actg2 | 1.00 | 0.48 | 1.66 | 0.56 |
| 46 | NM_130403 | Ppp1r14a | 1.00 | 0.91 | 1.65 | 0.99 |
| 15 | BG663107 | zzN/A | 1.00 | 1.06 | 1.65 | 1.23 |
| 30 | D29960 | Loc192245 | 1.00 | 0.51 | 1.64 | 0.54 |
| 48 | BM386598 | zzN/A | 1.00 | 0.90 | 1.60 | 0.95 |
| 71 | AA818342 | zzN/A | 1.00 | 0.88 | 1.58 | 1.25 |
| 5 | AW523747 | Amigo2 | 1.00 | 0.88 | 1.57 | 2.10 |
| 40 | AA817802 | zzN/A | 1.00 | 0.55 | 1.57 | 0.69 |
| 75 | BE112887 | zzN/A | 1.00 | 1.06 | 1.55 | 1.05 |
| 33 | M23764 | Tpm1 | 1.00 | 0.60 | 1.54 | 0.68 |
| 59 | AW522471 | Exo70 | 1.00 | 0.65 | 1.54 | 1.00 |
| 8 | EST | 1.00 | 0.93 | 1.52 | 2.14 | |
| 31 | AI044427 | zzN/A | 1.00 | 0.59 | 1.52 | 0.69 |
| 41 | BI279044 | zzN/A | 1.00 | 0.49 | 1.51 | 0.52 |
| 9 | EST | 1.00 | 1.48 | 1.51 | 2.10 | |
| 28 | BI291848 | zzN/A | 1.00 | 0.62 | 1.51 | 0.81 |
| 24 | AI411809 | zzN/A | 1.00 | 0.89 | 1.51 | 1.06 |
| 67 | NM_053440 | Stmn2 | 1.00 | 0.79 | 1.49 | 1.06 |
| 54 | BI285456 | zzN/A | 1.00 | 0.83 | 1.49 | 1.06 |
| 32 | NM_031549 | Tagln | 1.00 | 0.54 | 1.47 | 0.64 |
| 38 | AI177055 | zzN/A | 1.00 | 0.79 | 1.47 | 0.82 |
| 52 | BI279661 | Wfdc1 | 1.00 | 0.66 | 1.46 | 0.94 |
| 20 | AI229240 | zzN/A | 1.00 | 0.68 | 1.46 | 1.69 |
| 1 | BI285346 | Ppp4r1 | 1.00 | 1.34 | 1.46 | 1.51 |
| 53 | NM_134449 | Prkcdbp | 1.00 | 0.87 | 1.45 | 1.01 |
| 49 | BF555956 | zzN/A | 1.00 | 0.85 | 1.45 | 0.91 |
| 42 | X16262 | Myh11 | 1.00 | 0.54 | 1.44 | 0.60 |
| 51 | BG666999 | Slc25a4 | 1.00 | 0.79 | 1.44 | 0.94 |
| 70 | AI177366 | Itgb1 | 1.00 | 1.00 | 1.42 | 1.24 |
| 61 | AA686007 | Parva | 1.00 | 0.80 | 1.41 | 0.99 |
| 68 | BM389644 | zzN/A | 1.00 | 0.88 | 1.41 | 1.07 |
| 18 | BG378721 | zzN/A | 1.00 | 0.95 | 1.40 | 1.21 |
| 60 | AA893484 | Fn1 | 1.00 | 0.51 | 1.40 | 0.88 |
| 27 | NM_019304 | Dgkb | 1.00 | 0.67 | 1.31 | 0.86 |
| 7 | EST | 1.00 | 1.09 | 1.31 | 1.51 | |
| 19 | NM_017131 | Casq2 | 1.00 | 0.71 | 1.30 | 1.19 |
| 6 | U06434 | Scya4 | 1.00 | 1.18 | 1.30 | 1.76 |
| 10 | AB043636 | Kcnj8 | 1.00 | 1.22 | 1.29 | 1.65 |
| 11 | EST | 1.00 | 0.82 | 1.29 | 1.55 | |
| 66 | AF081582 | Evt1 | 1.00 | 0.85 | 1.29 | 1.03 |
| 3 | NM_024145 | Fgr | 1.00 | 1.03 | 1.26 | 1.70 |
| 72 | BI296312 | zzN/A | 1.00 | 0.80 | 1.26 | 1.04 |
| 13 | AA859496 | Gch | 1.00 | 0.93 | 1.24 | 1.34 |
| 22 | BF394235 | zzN/A | 1.00 | 0.55 | 1.23 | 0.99 |
| 69 | BF551377 | zzN/A | 1.00 | 0.81 | 1.21 | 0.99 |
| 62 | AI179984 | Dmrs91 | 1.00 | 0.49 | 1.21 | 0.70 |
| 21 | NM_133605 | Camk2g | 1.00 | 0.77 | 1.18 | 1.01 |
| 17 | U27518 | LOC286989 | 1.00 | 0.50 | 1.11 | 1.19 |
| 4 | NM_022688 | Porf1 | 1.00 | 0.80 | 1.08 | 1.42 |
| 23 | AW254190 | 1.00 | 0.66 | 1.05 | 1.03 | |
| 87 | BM386844 | zzN/A | 1.00 | 1.40 | 1.00 | 0.84 |
| 94 | BF390024 | Ncor1 | 1.00 | 1.34 | 0.93 | 0.89 |
| 92 | BE098713 | zzN/A | 1.00 | 1.11 | 0.87 | 0.82 |
| 86 | BF404414 | zzN/A | 1.00 | 1.19 | 0.85 | 0.80 |
| 82 | AA945828 | zzN/A | 1.00 | 1.54 | 0.84 | 1.07 |
| 88 | AA849756 | zzN/A | 1.00 | 0.86 | 0.84 | 0.66 |
| 83 | BM392373 | Ceacam1 | 1.00 | 1.38 | 0.82 | 0.87 |
| 78 | BM385170 | zzN/A | 1.00 | 1.30 | 0.81 | 1.11 |
| 77 | BF411331 | zzN/A | 1.00 | 1.22 | 0.80 | 1.04 |
| 104 | AI177513 | zzN/A | 1.00 | 0.90 | 0.80 | 0.70 |
| 107 | AA964600 | zzN/A | 1.00 | 0.83 | 0.79 | 0.68 |
| 85 | BI295141 | zzN/A | 1.00 | 1.07 | 0.78 | 0.82 |
| 108 | AI227627 | Cd9 | 1.00 | 0.74 | 0.77 | 0.61 |
| 90 | NM_031762 | Cdkn1b | 1.00 | 1.02 | 0.74 | 0.45 |
| 89 | AI180286 | zzN/A | 1.00 | 0.90 | 0.74 | 0.70 |
| 91 | AI105205 | Ctl1 | 1.00 | 0.93 | 0.73 | 0.57 |
| 103 | BG380281 | zzN/A | 1.00 | 0.72 | 0.72 | 0.64 |
| 101 | BI301490 | zzN/A | 1.00 | 0.68 | 0.69 | 0.66 |
| 113 | BM384203 | zzN/A | 1.00 | 0.90 | 0.69 | 0.66 |
| 114 | BG373555 | zzN/A | 1.00 | 0.98 | 0.68 | 0.74 |
| 105 | BI288816 | zzN/A | 1.00 | 0.65 | 0.68 | 0.48 |
| 109 | AA894262 | zzN/A | 1.00 | 1.07 | 0.68 | 0.59 |
| 106 | AI228548 | zzN/A | 1.00 | 0.62 | 0.67 | 0.30 |
| 76 | AW433971 | Mvk | 1.00 | 1.12 | 0.67 | 0.98 |
| 80 | AA800750 | zzN/A | 1.00 | 1.13 | 0.65 | 0.92 |
| 84 | AI171229 | zzN/A | 1.00 | 1.23 | 0.65 | 0.78 |
| 112 | AI407835 | Add3 | 1.00 | 0.74 | 0.65 | 0.65 |
| 97 | NM_023989 | LOC78973 | 1.00 | 0.84 | 0.65 | 0.70 |
| 81 | AA893602 | zzN/A | 1.00 | 1.13 | 0.65 | 0.93 |
| 98 | AA943165 | zzN/A | 1.00 | 0.71 | 0.64 | 0.52 |
| 93 | NM_031347 | Ppargc1 | 1.00 | 1.17 | 0.62 | 0.52 |
| 79 | BE102350 | zzN/A | 1.00 | 1.64 | 0.61 | 1.18 |
| 110 | AI408598 | zzN/A | 1.00 | 0.85 | 0.61 | 0.53 |
| 111 | AI175820 | zzN/A | 1.00 | 0.64 | 0.61 | 0.57 |
| 99 | AI179665 | 1.00 | 0.77 | 0.59 | 0.64 | |
| 100 | BI296591 | zzN/A | 1.00 | 0.53 | 0.54 | 0.55 |
| 102 | AF189724 | Cxcl12 | 1.00 | 0.73 | 0.50 | 0.61 |
| 96 | BF417032 | zzN/A | 1.00 | 0.87 | 0.49 | 0.57 |
| 95 | M58040 | Tfrc | 1.00 | 0.63 | 0.45 | 0.42 |
| TABLE 4 |
| Genes differentially expressed in sensitized S1 DRG |
| No. | Identifier | Acce. No. | CTRL-VHL | CTRL-CNI | IBS-VHL | IBS-CNI |
| 11 | 1376554_at | BE121079 | 1 | 1.74 | 2.23 | 2.01 |
| 23 | 1369233_at | AF196965 | 1 | 1.45 | 2.09 | 1.71 |
| 4 | 1374620_at | BM392373 | 1 | 1.43 | 1.87 | 2.41 |
| 6 | 1390403_at | BE108405 | 1 | 1.39 | 1.83 | 1.86 |
| 8 | 1379272_at | AA963084 | 1 | 1.08 | 1.83 | 1.70 |
| 24 | 1369157_at | NM_017229 | 1 | 1.05 | 1.78 | 1.09 |
| 19 | 1382915_at | AI237079 | 1 | 1.26 | 1.76 | 1.38 |
| 25 | 1374802_at | AI010721 | 1 | 0.90 | 1.72 | 0.96 |
| 5 | 1389222_at | BI282847 | 1 | 1.30 | 1.69 | 1.66 |
| 22 | 1368379_at | NM_054001 | 1 | 1.31 | 1.68 | 1.66 |
| 7 | 1368678_at | X67108 | 1 | 1.38 | 1.66 | 1.72 |
| 10 | 1386218_at | AI639301 | 1 | 1.35 | 1.65 | 1.58 |
| 26 | 1370301_at | U65656 | 1 | 1.17 | 1.64 | 1.02 |
| 17 | 1389099_at | AI600184 | 1 | 1.50 | 1.64 | 1.50 |
| 18 | 1383159_at | AW434445 | 1 | 1.40 | 1.64 | 1.58 |
| 13 | 1384217_at | BI276341 | 1 | 1.24 | 1.59 | 1.67 |
| 21 | 1389713_at | AI602851 | 1 | 1.17 | 1.58 | 1.45 |
| 12 | 1372620_at | AI008642 | 1 | 1.32 | 1.57 | 1.94 |
| 78 | 1385386_at | BI302745 | 1 | 0.79 | 0.09 | 0.31 |
| 28 | 1387658_at | U93849 | 1 | 1.60 | 0.43 | 0.82 |
| 47 | 1368703_at | NM_053326 | 1 | 0.65 | 0.44 | 0.70 |
| 62 | 1377606_at | AI500913 | 1 | 0.49 | 0.44 | 0.36 |
| 50 | 1375606_at | AI235906 | 1 | 0.75 | 0.46 | 0.43 |
| 49 | 1369255_at | NM_013123 | 1 | 0.80 | 0.46 | 0.58 |
| 40 | 1386999_at | BG380730 | 1 | 0.78 | 0.47 | 0.68 |
| 42 | 1388589_at | BG381046 | 1 | 0.74 | 0.47 | 0.61 |
| 41 | 1370666_at | AF201839 | 1 | 0.66 | 0.49 | 0.44 |
| 52 | 1389864_at | BF405086 | 1 | 0.69 | 0.50 | 0.58 |
| 72 | 1374283_at | BF419505 | 1 | 0.82 | 0.51 | 0.59 |
| 34 | 1375469_at | BE111847 | 1 | 0.67 | 0.52 | 0.67 |
| 38 | 1374002_at | AI045904 | 1 | 0.71 | 0.55 | 0.79 |
| 65 | 1394114_at | AA799434 | 1 | 0.67 | 0.56 | 0.63 |
| 67 | 1388101_at | AF389425 | 1 | 0.73 | 0.56 | 0.71 |
| 57 | 1368279_at | NM_053718 | 1 | 0.78 | 0.56 | 0.39 |
| 45 | 1376350_at | BF396151 | 1 | 0.90 | 0.57 | 0.75 |
| 74 | 1376122_at | BF401577 | 1 | 0.77 | 0.57 | 0.44 |
| 36 | 1369036_at | NM_019309 | 1 | 0.72 | 0.58 | 0.65 |
| 66 | 1367814_at | M14137 | 1 | 0.67 | 0.59 | 0.67 |
| 71 | 1372177_at | AI180033 | 1 | 0.63 | 0.60 | 0.61 |
| 70 | 1373981_at | BI299720 | 1 | 0.62 | 0.60 | 0.55 |
| 35 | 1383468_at | BM958512 | 1 | 0.66 | 0.62 | 0.67 |
| 46 | 1376931_at | BG380736 | 1 | 0.73 | 0.62 | 0.75 |
| 75 | 1371281_at | M37568 | 1 | 0.97 | 0.63 | 0.39 |
| 44 | 1387818_at | NM_053736 | 1 | 0.87 | 0.63 | 0.75 |
| 51 | 1369048_at | NM_017289 | 1 | 0.71 | 0.64 | 0.56 |
| 37 | 1374084_at | BE119993 | 1 | 0.68 | 0.64 | 0.59 |
| 30 | 1387327_at | NM_133318 | 1 | 1.25 | 0.65 | 0.66 |
| 39 | 1373031_at | BI275757 | 1 | 0.83 | 0.65 | 0.77 |
| 32 | 1375448_at | BM391628 | 1 | 0.90 | 0.65 | 0.74 |
| 88 | 1369884_at | NM_022182 | 1 | 0.90 | 0.66 | 0.54 |
| 59 | 1375294_at | BF415950 | 1 | 0.75 | 0.66 | 0.42 |
| 90 | 1387404_at | NM_078620 | 1 | 1.02 | 0.66 | 0.50 |
| 69 | 1386907_at | NM_012949 | 1 | 0.75 | 0.67 | 0.67 |
| 63 | 1392500_at | AA957990 | 1 | 0.59 | 0.67 | 0.58 |
| 68 | 1369000_at | NM_021589 | 1 | 0.75 | 0.67 | 0.67 |
| TABLE 5 |
| Genes differentially expressed in CNI1493-treated colon |
| No. | Identifier | Acce. No. | Description |
| 1 | 1370531_at | U69550 | phospholipase D gene 1 |
| 2 | 1369708_at | NM_031017 | cAMP response element binding protein 1 |
| 3 | 1368889_at | NM_023101 | SNARE Vti1a-beta protein |
| 4 | 1387046_at | NM_053792 | selective LIM binding factor |
| 5 | 1371192_at | BF566236 | neurofibromatosis 2 |
| 6 | 1369195_at | NM_013068 | Fatty acid binding protein 2 |
| 7 | 1398540_at | BM386789 | Rattus norvegicus transcribed sequences |
| 8 | 1375464_at | BI290815 | Rattus norvegicus transcribed sequences |
| 9 | 1387119_at | AW433971 | mevalonate kinase |
| 10 | 1374034_at | BG379410 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein sp: P49589 (H. sapiens) | |||
| SYC_HUMAN CYSTEINYL-TRNA SYNTHETASE | |||
| (CYSTEINE--TRNA LIGASE) (CYSRS) | |||
| 11 | 1392633_at | AI045724 | Rattus norvegicus transcribed sequences |
| 12 | 1371027_at | BF556820 | Cas-Br-M (murine) ectropic retroviral transforming |
| sequence b | |||
| 13 | 1376708_at | BM385170 | Rattus norvegicus transcribed sequences |
| 14 | 1387220_at | NM_019323 | mast cell protease 9 |
| 15 | 1377034_at | BF411331 | âRattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_109591.1 (H. sapiens) serine | |||
| (or cysteine) proteinase inhibitor, clade B (ovalbumin), | |||
| member 1; protease inhibitor 2 (anti-elastase), | |||
| monocyte/neutrophil; protease inhibitor | |||
| 16 | 1374324_at | AA945828 | Rattus norvegicus transcribed sequences |
| 17 | 1370510_a_at | AB012600 | aryl hydrocarbon receptor nuclear translocator-like |
| 18 | 1387130_at | NM_133315 | âsolute carrier family 39 (iron-regulated transporter), |
| member 1â | |||
| 19 | 1390562_s_at | BE102350 | Rattus norvegicus transcribed sequences |
| 20 | 1390960_at | AA893602 | Rattus norvegicus transcribed sequences |
| 21 | 1371925_at | AA893621 | Rattus norvegicus clone C201 intestinal epithelium |
| proliferating cell-associated mRNA sequence | |||
| 22 | 1370693_a_at | M18630 | cyclic nucleotide phosphodiesterase 1 |
| 23 | 1377036_at | BE102350 | Rattus norvegicus transcribed sequences |
| 24 | 1392794_at | AA893579 | Rattus norvegicus transcribed sequences |
| 25 | 1388694_at | AI233121 | MHC class I RT1.O type 149 processed pseudogene |
| 26 | 1388754_at | AI176839 | Rattus norvegicus transcribed sequences |
| 27 | 1368233_at | NM_031042 | âgeneral transcription factor IIF, polypeptide 2 (30 kD |
| subunit)â | |||
| 28 | 1368679_a_at | L14782 | lyn protein non-receptor kinase |
| 29 | 1372177_at | AI180033 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_004522.1 (H. sapiens) | |||
| molybdenum cofactor synthesis 2 [Homo sapiens] | |||
| 30 | 1372868_at | BF284295 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein sp: O14657 (H. sapiens) | |||
| TO1B_HUMAN Torsin B precursor | |||
| 31 | 1380472_at | AI639486 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_003860.1 (H. sapiens) | |||
| carboxylesterase 2; intestinal carboxylesterase; liver | |||
| carboxylesterase-2 [Homo sapiens] | |||
| 32 | 1387994_at | U89280 | oxidative 17 beta hydroxysteroid dehydrogenase type 6 |
| 33 | 1390531_at | BE098021 | Rattus norvegicus transcribed sequences |
| 34 | 1388055_at | U39207 | cytochrome P450 4F5 |
| 35 | 1368379_at | NM_054001 | âCD36 antigen (collagen type I receptor, thrombospondin |
| receptor)-like 2â | |||
| 36 | 1368101_at | NM_012518 | calmodulin 3 |
| 37 | 1389302_at | BI289482 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein pir: S30833 (S. cerevisiae) S30833 | |||
| hypothetical protein YEL044w - yeast (Saccharomyces | |||
| cerevisiae) | |||
| 38 | 1389378_at | AI599324 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein pir: A42973 (H. sapiens) A42973 | |||
| serum protein MSE55 - human | |||
| 39 | 1387444_at | NM_133592 | brain-enriched membrane-associated protein tyrosine |
| BEM-2 | |||
| 40 | 1374284_at | AI227769 | Rattus norvegicus transcribed sequences |
| 41 | 1371239_s_at | AF053361 | âtropomyosin 3, gammaâ |
| 42 | 1387596_at | NM_053897 | âProteinase-activated receptor-2, G protein-coupled |
| receptor 11â | |||
| 43 | 1389873_at | BI282953 | apoptosis-associated speck-like protein containing a |
| CARD | |||
| 44 | 1369773_at | NM_017105 | Bone morphogenetic protein 3 |
| 45 | 1374119_at | BI279615 | âRattus norvegicus transcribed sequence with strong |
| similarity to protein ref: NP_004424.1 (H. sapiens) E74- | |||
| like factor 3 (ets domain transcription factor, epithelial- | |||
| specific); E74-like factor 3 (ets domain transcription | |||
| factor); ets domain transcription | |||
| 46 | 1368128_at | NM_031598 | âphospholipase A2, group IIA (platelets, synovial fluid)â |
| 47 | 1368270_at | NM_012907 | Apolipoprotein B editing protein |
| 48 | 1367960_at | NM_019186 | ADP-ribos lation-like 4 |
| 49 | 1367942_at | NM_019144 | acid phosphatase 5 |
| 50 | 1392694_at | AW526101 | Rattus norvegicus transcribed sequences |
| 51 | 1374452_at | BF399743 | phosphodiesterase 9A |
| 52 | 1368727_at | NM_053929 | âsolute carrier family 7 (cationic amino acid transporter, |
| y+ system), member 9â | |||
| 53 | 1376625_at | BI296015 | Rattus norvegicus transcribed sequences |
| 54 | 1367768_at | NM_031655 | latexin |
| 55 | 1369193_at | AF474979 | cyclin dependent kinase inhibitor 2B |
| 56 | 1382714_at | AA875186 | Rattus norvegicus transcribed sequences |
| 57 | 1376359_at | BG375355 | âRattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_113645.1 (H. sapiens) | |||
| membrane-spanning 4-domains, subfamily A, member 8B | |||
| [Homo sapiens]â | |||
| 58 | 1372064_at | BI296385 | Rattus norvegicus CDK104 mRNA |
| 59 | 1388396_at | BI275932 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein sp: O00506 (H. sapiens) | |||
| ST25_HUMAN Serine/threonine protein kinase 25 | |||
| (Sterile 20/oxidant stress-response kinase 1) | |||
| (Ste20/oxidant stress response kinase-1) (SOK-1) (Ste20- | |||
| like kinase) | |||
| 60 | 1384191_at | BF387765 | Rattus norvegicus transcribed sequences |
| 61 | 1372255_at | BF283284 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein sp: P54136 (H. sapiens) | |||
| SYR_HUMAN ARGINYL-TRNA SYNTHETASE | |||
| (ARGININE--TRNA LIGASE) (ARGRS) | |||
| 62 | 1369262_at | NM_022277 | caspase-8 |
| 63 | 1376117_at | BI289103 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_079533.1 (H. sapiens) NG22 | |||
| protein; choline transporter-like protein 4 [Homo sapiens] | |||
| 64 | 1380262_at | AA893436 | Rattus norvegicus transcribed sequences |
| 65 | 1370113_at | NM_023987 | inhibitor of apoptosis protein 1 |
| 66 | 1368437_at | NM_019174 | carbonic anhydrase 4 |
| 67 | 1390455_at | AI013474 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein sp: P08910 (H. sapiens) | |||
| HPS1 HUMAN Protein PHPS1-2 | |||
| 68 | 1378658_at | BI292185 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_036260.1 (H. sapiens) | |||
| calcium activated chloride channel 4 [Homo sapiens] | |||
| 69 | 1376976_at | AI009823 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_002995.1 (H. sapiens) | |||
| secreted and transmembrane 1 precursor; K12 protein | |||
| perecursor; type 1a transmembrane protein [Homo sapiens] | |||
| 70 | 1370706_a_at | U39943 | cytochrome P450 monooxygenase |
| 71 | 1372997_at | AI105243 | Rattus norvegicus transcribed sequences |
| 72 | 1369183_at | NM_019231 | mitogen activated protein kinase 13 |
| 73 | 1386917_at | NM_012744 | Pyruvate carboxylase |
| 74 | 1390678_at | AA955527 | Rattus norvegicus transcribed sequences |
| 75 | 1398847_at | BG376935 | diphosphoinositol polyphosphate phosphohydolase type |
| II | |||
| 76 | 1368073_at | NM_012591 | Interferon regulatory factor 1 |
| 77 | 1371394_x_at | BG664827 | âRattus norvegicus endogenous retrovirus mRNA, partial |
| sequenceâ | |||
| 78 | 1370422_at | AF036537 | homocysteine respondent protein HCYP2 |
| 79 | 1375230_at | AA800192 | âRattus norvegicus endogenous retrovirus mRNA, partial |
| sequenceâ | |||
| 80 | 1368007_at | NM_022849 | deleted in malignant brain tumors 1 |
| 81 | 1372671_at | BI284293 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein ref: NP_060809.1 (H. sapiens) | |||
| hypothetical protein FLJ11149 [Homo sapiens] | |||
| 82 | 1368219_at | NM_017137 | chloride channel 2 |
| 83 | 1367760_at | D13341 | mitogen activated protein kinase kinase 1 |
| 84 | 1388006_at | U89744 | putative cell surface antigen |
| 85 | 1367925_at | NM_022715 | major vault protein |
| 86 | 1390128_at | BF557618 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein ref: NP_065145.1 (H. sapiens) | |||
| CHMP1.5 protein [Homo sapiens] | |||
| 87 | 1388745_at | AI228417 | âRattus norvegicus transcribed sequence with strong |
| similarity to protein pdb: 1BGM (E. coli) O Chain O, | |||
| Beta-Galactosidase (Chains I-P)â | |||
| 88 | 1369940_at | NM_031811 | transaldolase 1 |
| 89 | 1370400_at | L23128 | âRattus norvegicus MHC class I mRNA, complete cdsâ |
| 90 | 1371970_at | AA799328 | Rattus norvegicus transcribed sequences |
| 91 | 1386933_at | NM_134418 | secretory (zymogen) granule membrane glycoprotein |
| GP2 | |||
| 92 | 1369100_at | NM_134375 | angiotensin/vasopressin receptor |
| 93 | 1372619_at | AI172185 | âRattus norvegicus Aa2-277 mRNA, complete cdsâ |
| 94 | 1380129_at | AA818937 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein sp: P10266 (H. sapiens) | |||
| POL1_HUMAN Endogenous retrovirus HERV-K10 | |||
| putative pol polyprotein [Includes: Reverse transcriptase; | |||
| Endonuclease] | |||
| 95 | 1371078_at | AI500830 | RT1 class Ib gene |
| 96 | 1367586_at | NM_017025 | lactate dehydrogenase A |
| 97 | 1374033_at | BG373505 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: I38135 (H. sapiens) I38135 | |||
| multicatalytic endopeptidase complex (EC 3.4.99.46) beta | |||
| chain MECL-1 - human | |||
| 98 | 1373913_at | BF282271 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein pir: T50626 (H. sapiens) T50626 | |||
| hypothetical protein DKFZp762K1914.1 - human | |||
| (fragment) | |||
| 99 | 1372665_at | AI230228 | âRattus norvegicus phosphoserine aminotransferase |
| mRNA, complete cdsâ | |||
| 100 | 1376056_at | BF291214 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_116178.1 (H. sapiens) | |||
| hypothetical protein FLJ14464 [Homo sapiens] | |||
| 101 | 1368066_at | NM_053812 | BCL2-antagonist/killer 1 |
| 102 | 1374838_at | BI293504 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein sp: Q13342 (H. sapiens) | |||
| LY10_HUMAN LYSP100 protein (Lymphoid-restricted | |||
| homolog of Sp100) (Nuclear autoantigen Sp-140) | |||
| (Speckled 140 kDa) (Nuclear body protein Sp140) | |||
| 103 | 1372816_at | BE107319 | Rattus norvegicus transcribed sequences |
| 104 | 1388236_x_at | M24026 | RT1 class Ib gene |
| 105 | 1371210_s_at | AJ276126 | RT1 class Ib gene |
| 106 | 1390325_at | BI289418 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_083693.1 (M. musculus) | |||
| RIKEN cDNA 9030605E16 [Mus musculus] | |||
| 107 | 1369279_at | NM_130819 | retinol dehydrogenase homolog |
| 108 | 1390021_at | BM391206 | histone 2b |
| 109 | 1368317_at | NM_019157 | aquaporin 7 |
| 110 | 1387100_at | NM_031703 | aquaporin 3 |
| 111 | 1368975_at | NM_013127 | CD38 antigen |
| 112 | 1386908_at | NM_022278 | glutaredoxin 1 (thioltransferase) |
| 113 | 1369427_at | NM_022617 | macrophage expressed gene 1 |
| 114 | 1369110_x_at | NM_012645 | RT1 class Ib gene |
| 115 | 1369957_at | NM_019341 | regulator of G-protein signaling 5 |
| 116 | 1398985_at | AI716480 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_004277.1 (H. sapiens) GTP | |||
| binding protein 1 [Homo sapiens] | |||
| 117 | 1368413_at | NM_022935 | Amiloride binding protein 1 |
| 118 | 1370960_at | BE104060 | insulin-like growth factor-binding protein 5 |
| 119 | 1368505_at | NM_017214 | regulator of G-protein signaling 4 |
| 120 | 1373386_at | AI179953 | Rattus norvegicus transcribed sequences |
| 121 | 1387348_at | BE113270 | insulin-like growth factor-binding protein 5 |
| 122 | 1370638_at | AF069525 | ankyrin 3 (G) |
| 123 | 1377112_at | AA859352 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_001776.1 (H. sapiens) | |||
| cytidine deaminase [Homo sapiens] | |||
| 124 | 1389611_at | AA849857 | Very low density lipoprotein receptor |
| 125 | 1369098_at | NM_013155 | Very low density lipoprotein receptor |
| 126 | 1368294_at | NM_053907 | deoxyribonuclease I-like 3 |
| 127 | 1368342_at | NM_031544 | Adenosine monophosphate deaminase 3 |
| 128 | 1368965_at | NM_030834 | monocarboxylate transporter |
| 129 | 1392819_at | AW921478 | âRattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_071744.1 (H. sapiens) CD20- | |||
| like precusor; membrane-spanning 4-domains, subfamily | |||
| A, member 6 [Homo sapiens]â | |||
| 130 | 1367774_at | NM_031509 | âglutathione S-transferase, alpha 1â |
| 131 | 1387687_at | NM_133542 | âimmunoglobulin superfamily, member 6â |
| 132 | 1369173_at | NM_032060 | complement component 3a receptor 1 |
| 133 | 1372013_at | BG380285 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_006426.1 (H. sapiens) | |||
| interferon induced transmembrane protein 2 (1-8D); | |||
| interferon-inducible [Homo sapiens] | |||
| 134 | 1373025_at | AI411618 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: C1HUQC (H. sapiens) C1HUQC | |||
| complement subcomponent C1q chain C precursor - | |||
| human | |||
| 135 | 1376652_at | BF418957 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: C1HUQA (H. sapiens) C1HUQA | |||
| complement subcomponent C1q chain A precursor - | |||
| human | |||
| 136 | 1368420_at | NM_012532 | ceruloplasmin |
| 137 | 1373932_at | BE098739 | Rattus norvegicus transcribed sequences |
| 138 | 1387893_at | D88250 | âcomplement component 1, s subcomponentâ |
| 139 | 1388557_at | BF284922 | Rattus norvegicus transcribed sequences |
| 140 | 1374730_at | AI102519 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_003323.1 (H. sapiens) TYRO | |||
| protein tyrosine kinase binding protein; polycystic | |||
| lipomembranous osteodysplasia with sclerosing | |||
| leukoencephalopathy [Homo sapiens] | |||
| 141 | 1368000_at | NM_016994 | Complement component 3 |
| 142 | 1368558_s_at | NM_017196 | allograft inflammatory factor 1 |
| 143 | 1373523_at | AI011757 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein sp: P08637 (H. sapiens) | |||
| FC3A_HUMAN Low affinity immunoglobulin gamma | |||
| FC region receptor III-A precursor (IGG FC receptor III- | |||
| 2) (FC-gamma RIII-alpha) (FC-gamma RIIIA) (FCRIIIA) | |||
| (FC-gamm | |||
| 144 | 1387011_at | NM_130741 | lipocalin 2 |
| 145 | 1370885_at | AA849399 | cathepsin Y |
| 146 | 1389470_at | AI639117 | Complement component 2 |
| 147 | 1368430_at | AF154349 | âprotease, cysteine, 1 (legumain)â |
| 148 | 1375010_at | AI177761 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_001242.1 (H. sapiens) CD68 | |||
| antigen; Macrophage antigen CD68 (microsialin) [Homo | |||
| sapiens] | |||
| 149 | 1389006_at | AI170394 | Rattus norvegicus transcribed sequences |
| 150 | 1373575_at | BE111722 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: A35241 (H. sapiens) A35241 IgE | |||
| Fc receptor gamma chain precursor - human | |||
| 151 | 1390510_at | BI294706 | âRattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_071744.1 (H. sapiens) CD20- | |||
| like precusor; membrane-spanning 4-domains, subfamily | |||
| A, member 6 [Homo sapiens]â | |||
| 152 | 1376390_at | BF395317 | âRattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_071744.1 (H. sapiens) CD20- | |||
| like precusor; membrane-spanning 4-domains, subfamily | |||
| A, member 6 [Homo sapiens]â | |||
| 153 | 1368187_at | NM_133298 | glycoprotein (transmembrane) nmb |
| 154 | 1389553_at | BF393825 | âRattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_057268.1 (H. sapiens) C-type | |||
| (calcium dependent, carbohydrate-recognition domain) | |||
| lectin, superfamily member 6; dendritic cell | |||
| immunoreceptor; C-type lectin [Homo sapiens]â | |||
| 155 | 1367568_a_at | NM_012862 | matrix Gla protein |
| 156 | 1370628_at | M34097 | granzyme B |
| 157 | 1379604_at | BF284937 | âRattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_085146.1 (H. sapiens) | |||
| apolipoprotein L, 4 [Homo sapiens]â | |||
| 158 | 1368464_at | NM_022393 | macrophage galactose N-acetyl-galactosamine specific |
| lectin | |||
| 159 | 1379766_at | AI500952 | Rattus norvegicus transcribed sequences |
| 160 | 1370516_at | AB026665 | peptide/histidine transporter PHT2 |
| 161 | 1373071_at | AI103101 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein pir: T00702 (H. sapiens) T00702 | |||
| hypothetical protein F25965 1 - human (fragment) | |||
| 162 | 1393224_at | AW529774 | Rattus norvegicus transcribed sequences |
| 163 | 1390312_at | BG670441 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_060124.1 (H. sapiens) | |||
| hypothetical protein FLJ20073 [Homo sapiens] | |||
| 164 | 1377412_at | AI146237 | Rattus norvegicus transcribed sequences |
| 165 | 1399125_at | BI275516 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein sp: P49441 (H. sapiens) | |||
| INPP_HUMAN Inositol polyphosphate 1-phosphatase | |||
| (IPPase) (IPP) | |||
| 166 | 1386986_at | NM_053340 | opioid growth factor receptor |
| 167 | 1374731_at | BI275929 | âRattus norvegicus transcribed sequence with moderate |
| similarity to protein pdb: 1LBG (E. coli) B Chain B, | |||
| Lactose Operon Repressor Bound To 21-Base Pair | |||
| Symmetric Operator Dna, Alpha Carbons Onlyâ | |||
| 168 | 1388880_at | BI278962 | Lysosomal associated membrane protein 1 (120 kDa) |
| 169 | 1376075_at | BM385544 | Rattus norvegicus transcribed sequences |
| 170 | 1369559_a_at | NM_019195 | integrin-associated protein |
| 171 | 1376972_at | AI407028 | âsolute carrier family 39 (iron-regulated transporter), |
| member 1â | |||
| 172 | 1388776_at | AI169176 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_057563.1 (H. sapiens) | |||
| hypothetical protein LOC51246 [Homo sapiens] | |||
| 173 | 1376029_at | BI295991 | Rattus norvegicus transcribed sequences |
| 174 | 1388164_at | AF029241 | âRat MHC class I RT1.C/E mRNA, 3âČ endâ |
| 175 | 1389734_x_at | BI282965 | RT1 class Ib gene |
| 176 | 1370429_at | L40362 | RT1 class Ib gene |
| 177 | 1388900_at | BG381414 | Rattus norvegicus transcribed sequences |
| 178 | 1375955_at | BI289415 | Rattus norvegicus transcribed sequences |
| 179 | 1389011_at | BG374333 | Rattus norvegicus transcribed sequences |
| 180 | 1389387_at | BF561377 | hydroxyindole-O-methyltransferase |
| 181 | 1387206_at | NM_031740 | âUDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, |
| polypeptide 6â | |||
| 182 | 1388071_x_at | M24024 | RT1 class Ib gene |
| 183 | 1398925_at | BI274664 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_060818.1 (H. sapiens) | |||
| hypothetical protein FLJ11171 [Homo sapiens] | |||
| 184 | 1368224_at | NM_031531 | Serine protease inhibitor |
| 185 | 1374718_at | AA945915 | Rattus norvegicus transcribed sequences |
| 186 | 1394340_at | BF523172 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein sp: P49441 (H. sapiens) | |||
| INPP_HUMAN Inositol polyphosphate 1-phosphatase | |||
| (IPPase) (IPP) | |||
| 187 | 1376022_at | BI292196 | Rattus norvegicus transcribed sequences |
| 188 | 1368732_at | NM_032056 | âtransporter 2, ATP-binding cassette, sub-family B |
| (MDR/TAP)â | |||
| 189 | 1367710_at | NM_017257 | âprotease (prosome, macropain) 28 subunit, betaâ |
| 190 | 1367786_at | NM_080767 | âproteasome (prosome, macropain) subunit, beta type, 8 |
| (low molecular mass polypeptide 7)â | |||
| 191 | 1389170_at | BF283754 | Rattus norvegicus transcribed sequences |
| 192 | 1375853_at | BF284358 | Rattus norvegicus transcribed sequences |
| 193 | 1373757_at | AW529298 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_006691.1 (H. sapiens) | |||
| FLN29 gene product [Homo sapiens] | |||
| 194 | 1388149_at | X57523 | âtransporter 1, ATP-binding cassette, sub-family B |
| (MDR/TAP)â | |||
| 195 | 1372604_at | BI289459 | âRattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_055164.1 (H. sapiens) | |||
| apolipoprotein L, 3; TNF-inducible protein CG12-1 | |||
| [Homo sapiens]â | |||
| 196 | 1387027_a_at | U72741 | âLectin, galactose binding, soluble 9 (Galectin-9)â |
| 197 | 1372034_at | BF284106 | Rattus norvegicus transcribed sequences |
| 198 | 1370186_at | AI599350 | âproteosome (prosome, macropain) subunit, beta type 9 |
| (large multifunctional protease 2)â | |||
| 199 | 1388212_a_at | AJ243974 | âRat MHC class I RT1.C/E mRNA, 3âČ endâ |
| 200 | 1388213_a_at | AJ243973 | âRat MHC class I RT1.C/E mRNA, 3âČ endâ |
| 201 | 1371123_x_at | AJ243973 | âRat MHC class I RT1.C/E mRNA, 3âČ endâ |
| 202 | 1371152_a_at | Z18877 | 25 oligoadenylate synthetase |
| 203 | 1372930_at | AI411381 | âRattus norvegicus cDNA, clone: aC10, differentially |
| expressed in pylorusâ | |||
| 204 | 1388791_at | BI275911 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: T14738 (H. sapiens) T14738 | |||
| hypothetical protein DKFZp564A2416.1 - human | |||
| (fragment) | |||
| 205 | 1369716_s_at | NM_012976 | âLectin, galactose binding, soluble 5 (Galectin-5)â |
| 206 | 1376496_at | AI717736 | âRattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_112092.1 (H. sapiens) | |||
| apolipoprotein L, 2 [Homo sapiens]â | |||
| 207 | 1374337_at | AI408954 | âRattus norvegicus transcribed sequence with moderate |
| similarity to protein pdb: 1LBG (E. coli) B Chain B, | |||
| Lactose Operon Repressor Bound To 21-Base Pair | |||
| Symmetric Operator Dna, Alpha Carbons Onlyâ | |||
| 208 | 1387242_at | NM_019335 | âProtein kinase, interferon-inducible double stranded |
| RNA dependentâ | |||
| 209 | 1376144_at | AA819679 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_113646.1 (H. sapiens) B | |||
| aggressive lymphoma gene [Homo sapiens] | |||
| 210 | 1368835_at | AW434718 | signal transducer and activator of transcription 1 |
| 211 | 1387946_at | AF065438 | peptidylprolyl isomerase C-associated protein |
| 212 | 1383564_at | BF411036 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_004022.1 (H. sapiens) | |||
| interferon regulatory factor 7 isoform d [Homo sapiens] | |||
| 213 | 1389034_at | BI295179 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein sp: Q9UMW8 (H. sapiens) | |||
| UBPI_HUMAN Ubiquitin carboxyl-terminal hydrolase | |||
| 18 (Ubiquitin thiolesterase 18) (Ubiquitin-specific | |||
| processing protease 18) (Deubiquitinating enzyme 18) | |||
| (Ubiqui | |||
| 214 | 1388347_at | AI233210 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein sp: Q16553 (H. sapiens) | |||
| LY6E_HUMAN Lymphocyte antigen Ly-6E precursor | |||
| (Retinoic acid-induced gene E protein) (RIG-E) (Thymic | |||
| shared antigen-1) (TSA-1) (Stem cell antigen 2) (SCA-2) | |||
| 215 | 1376845_at | AA819034 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_114425.1 (H. sapiens) | |||
| TLH29 protein precursor [Homo sapiens] | |||
| 216 | 1376693_at | AA998964 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_060124.1 (H. sapiens) | |||
| hypothetical protein FLJ20073 [Homo sapiens] | |||
| 217 | 1387770_at | NM_130743 | âinterferon, alpha-inducible protein 27-likeâ |
| 218 | 1376920_at | BF408536 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_060124.1 (H. sapiens) | |||
| hypothetical protein FLJ20073 [Homo sapiens] | |||
| 219 | 1387354_at | NM_032612 | signal transducer and activator of transcription 1 |
| 220 | 1373037_at | BI279216 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_004214.1 (H. sapiens) | |||
| ubiquitin-conjugating enzyme E2L 6 [Homo sapiens] | |||
| 221 | 1387995_a_at | BI285494 | interferon induced transmembrane protein 3-like |
| 222 | 1377497_at | BF419319 | âRattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: I60307 (E. coli) I60307 beta- | |||
| galactosidase, alpha peptide - Escherichia coliâ | |||
| 223 | 1368227_at | NM_031664 | âsolute carrier family 28, member 2â |
| 224 | 1390507_at | BI296097 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_002192.2 (H. sapiens) | |||
| interferon stimulated gene (20 kD) [Homo sapiens] | |||
| 225 | 1371440_at | AW916647 | Prostaglandin F receptor |
| 226 | 1369590_a_at | NM_024134 | DNA-damage inducible transcript 3 |
| 227 | 1369202_at | NM_017028 | myxovirus (influenza virus) resistance 2 |
| 228 | 1374627_at | BF283727 | Rattus norvegicus transcribed sequences |
| 229 | 1374551_at | BM388891 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein pir: JC5262 (H. sapiens) JC5262 | |||
| leucine zipper protein IFP35 - human | |||
| 230 | 1387134_at | NM_053687 | schlafen 4 |
| 231 | 1373514_at | AA899109 | Rattus norvegicus transcribed sequences |
| 232 | 1372585_at | BM388445 | Rattus norvegicus transcribed sequences |
| 233 | 1369031_at | NM_053374 | interferon gamma inducing factor binding protein |
| 234 | 1371070_at | AJ302054 | tumor stroma and activated macrophage protein DLM-1 |
| 235 | 1367595_s_at | NM_012512 | Beta-2-microglobulin |
| 236 | 1367663_at | NM_017264 | âprotease (prosome, macropain) 28 subunit, alphaâ |
| 237 | 1390042_at | AI071166 | Rattus norvegicus transcribed sequences |
| 238 | 1369186_at | D85899 | caspase 1 |
| 239 | 1389571_at | BG666368 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein sp: P52630 (H. sapiens) | |||
| STA2_HUMAN Signal transducer and activator of | |||
| transcription 2 (p113) | |||
| 240 | 1370913_at | AI409634 | Best5 protein |
| 241 | 1387969_at | U22520 | chemokine (C-X-C motif) ligand 10 |
| 242 | 1376908_at | AW531805 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein sp: O14879 (H. sapiens) | |||
| IFT4_HUMAN Interferon-induced protein with | |||
| tetratricopeptide repeats 4 (IFIT-4) (Interferon-induced | |||
| 60 kDa protein) (IFI-60K) (ISG-60) (CIG49) (Retinoic | |||
| acid-ind | |||
| 243 | 1369973_at | NM_017154 | xanthine dehydrogenase |
| 244 | 1368332_at | NM_133624 | âguanylate binding protein 2, interferon-inducibleâ |
| 245 | 1372254_at | AW915763 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein sp: P05155 (H. sapiens) IC1_HUMAN | |||
| Plasma protease C1 inhibitor precursor (C1 Inh) (C1Inh) | |||
| 246 | 1373197_at | AI578263 | Rattus norvegicus transcribed sequences |
| 247 | 1370892_at | BI285347 | complement component 4a |
| 248 | 1372757_at | BM386875 | signal transducer and activator of transcription 1 |
| 249 | 1376151_a_at | AI407953 | Rattus norvegicus transcribed sequences |
| 250 | 1387283_at | NM_134350 | myxovirus (influenza virus) resistance 2 |
| 251 | 1371015_at | X52711 | myxovirus (influenza virus) resistance |
| 252 | 1373992_at | AI408440 | âRattus norvegicus cDNA, clone: aD9, differentially |
| expressed in pylorusâ | |||
| 253 | 1390738_at | BM385476 | Rattus norvegicus mRNA for DAMP-1 protein |
| 254 | 1388056_at | AF068268 | 2âČ5âČ oligoadenylate synthetase-2 |
| 255 | 1389365_at | AI228291 | Rattus norvegicus transcribed sequences |
| 256 | 1369726_at | NM_033098 | TAP binding protein |
| 257 | 1370172_at | AA892254 | superoxide dismutase 2 |
| 258 | 1386893_at | NM_017113 | granulin |
| 259 | 1375796_at | BI300770 | âRattus norvegicus Ac2-233 mRNA, complete cdsâ |
| 260 | 1389014_at | BI297612 | pre-B-cell colony-enhancing factor |
| 261 | 1371209_at | AJ243338 | RT1 class Ib gene |
| 262 | 1388255_x_at | AJ243338 | RT1 class Ib gene |
| 263 | 1373406_at | BM384991 | Rattus norvegicus transcribed sequences |
| 264 | 1375006_at | BE121050 | Rattus norvegicus transcribed sequences |
| 265 | 1387897_at | L16532 | cyclic nucleotide phosphodiesterase 1 |
| 266 | 1369456_at | NM_017250 | 5-hydroxytryptamine (serotonin) receptor 2B |
| 267 | 1374141_at | BG372419 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein ref: NP_071387.1 (H. sapiens) | |||
| chromosome 20 open reading frame 67 [Homo sapiens] | |||
| 268 | 1374678_at | BE109578 | Rattus norvegicus transcribed sequences |
| 269 | 1372968_at | BM385950 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein pir: S37032 (R. norvegicus) S37032 | |||
| gene LL5 protein - rat | |||
| 270 | 1371832_at | AW526333 | Rattus norvegicus transcribed sequences |
| 271 | 1390117_at | BG372455 | Rattus norvegicus transcribed sequences |
| 272 | 1369381_a_at | D50306 | âsolute carrier family 15 (oligopeptide transporter), |
| member 1â | |||
| 273 | 1388103_at | AF361355 | voltage-dependent calcium channel gamma subunit-like |
| protein | |||
| 274 | 1386943_at | NM_022533 | plasmolipin |
| 275 | 1373060_at | AI406281 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein pir: T12468 (H. sapiens) T12468 | |||
| hypothetical protein DKFZp564O123.1 - human | |||
| 276 | 1375911_at | AI171772 | âRattus norvegicus hypothetical protein LK44 mRNA, |
| complete cdsâ | |||
| 277 | 1370071_at | NM_130399 | Adenosine deaminase |
| 278 | 1368762_at | NM_053299 | ubiquitin D |
| 279 | 1369712_at | NM_031735 | serine/threonine kinase 3 |
| 280 | 1368419_at | AF202115 | ceruloplasmin |
| 281 | 1369029_at | NM_057194 | phospholipid scramblase 1 |
| 282 | 1369888_at | NM_012707 | glucagon |
| 283 | 1398879_at | BE329031 | arrestin-E |
| 284 | 1369942_at | NM_031675 | actinin alpha 4 |
| 285 | 1370807_at | AF411216 | vacuole Membrane Protein 1 |
| 286 | 1377124_at | AA964824 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein pir: S48059 (H. sapiens) S48059 | |||
| metal-regulatory transcription factor - human | |||
| 287 | 1390221_at | BM385216 | Rattus norvegicus transcribed sequences |
| 288 | 1390604_s_at | BM387863 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_055103.1 (H. sapiens) | |||
| integrin beta 3 binding protein (beta3-endonexin); beta 3 | |||
| endonexin [Homo sapiens] | |||
| 289 | 1398916_at | AI104388 | heat shock 27 kDa protein 1 |
| 290 | 1374600_at | BM986536 | germinal histone H4 gene |
| 291 | 1370307_at | M64780 | Agrin |
| 292 | 1371888_at | AA892843 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_078816.1 (H. sapiens) | |||
| hypothetical protein FLJ20917 [Homo sapiens] | |||
| 293 | 1373603_at | BG673166 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: T45061 (H. sapiens) T45061 | |||
| hypothetical protein c316G12.2 [imported]- human | |||
| 294 | 1388408_at | AA800199 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein pir: T34520 (H. sapiens) T34520 | |||
| hypothetical protein DKFZp564J157.1 - human | |||
| (fragment) | |||
| 295 | 1368471_at | NM_013118 | guanylate cyclase activator 2A |
| 296 | 1374401_at | AI549249 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein sp: O60749 (H. sapiens) | |||
| SNX2_HUMAN Sorting nexin 2 | |||
| 297 | 1371267_at | M64795 | zzN/A |
| 298 | 1370832_at | U06434 | small inducible cytokine A4 |
| 299 | 1383241_at | BI292425 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein sp: P00736 (H. sapiens) | |||
| C1R_HUMAN Complement C1r component precursor | |||
| 300 | 1387922_at | AF109674 | late gestation lung protein 1 |
| 301 | 1376447_at | AI706850 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein sp: P10163 (H. sapiens) | |||
| PRB4_HUMAN Salivary proline-rich protein PO | |||
| precursor (Allele S) | |||
| 302 | 1367740_at | M14400 | âcreatine kinase, brainâ |
| 303 | 1387036_at | NM_024360 | hairy and enhancer of split 1 (Drosophila) |
| 304 | 1370360_at | AF146738 | testis specific protein |
| 305 | 1389111_at | BF396316 | Rattus norvegicus transcribed sequences |
| 306 | 1374454_at | BM388557 | Rattus norvegicus transcribed sequences |
| 307 | 1367764_at | NM_012923 | Cyclin G1 |
| 308 | 1368038_at | AF260258 | synaptojanin 2 binding protein |
| 309 | 1372635_at | BF282163 | Rattus norvegicus transcribed sequences |
| 310 | 1373571_at | AI170276 | Rattus norvegicus transcribed sequences |
| 311 | 1375872_at | AI144944 | Rattus norvegicus transcribed sequences |
| 312 | 1383767_at | AW524430 | Rattus norvegicus transcribed sequences |
| 313 | 1376325_at | BM388975 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein pir: S52863 (H. sapiens) S52863 | |||
| DNA-binding protein R kappa B - human | |||
| 314 | 1388485_at | BG380414 | Rattus norvegicus transcribed sequences |
| 315 | 1368782_at | NM_019348 | somatostatin receptor 2 |
| 316 | 1375867_at | AW524493 | Rattus norvegicus transcribed sequences |
| 317 | 1375138_at | AA893169 | Tissue inhibitor of metalloproteinase 3 |
| 318 | 1390112_at | BF284634 | âRattus norvegicus transcribed sequence with strong |
| similarity to protein ref: NP_004096.2 (H. sapiens) EGF- | |||
| containing fibulin-like extracellular matrix protein 1 | |||
| precursor, isoform a precursor; fibrillin-like [Homo | |||
| sapiens]â | |||
| 319 | 1372935_at | AI598550 | Rattus norvegicus transcribed sequences |
| 320 | 1368322_at | NM_012880 | superoxide dismutase 3 |
| 321 | 1372104_at | BF289002 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_003106.1 (H. sapiens) UDP- | |||
| N-acteylglucosamine pyrophosphorylase 1; AgX; sperm | |||
| associated antigen 2; UDP-N-acteylglucosamine | |||
| pyrophosphorylase 1; Sperm associated antigen 2 [Hom | |||
| 322 | 1367687_a_at | M25719 | Peptidylglycine alpha-amidating monooxygenase |
| 323 | 1372455_at | AI410264 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein sp: O95859 (H. sapiens) | |||
| TNE2_HUMAN Tetraspan NET-2 | |||
| 324 | 1372940_at | BM389329 | Rattus norvegicus transcribed sequences |
| 325 | 1367631_at | NM_022266 | connective tissue growth factor |
| 326 | 1376344_at | AI010267 | Rattus norvegicus transcribed sequences |
| 327 | 1370408_at | AF313411 | putative small membrane protein NID67 |
| 328 | 1390283_at | BI274636 | Rattus norvegicus transcribed sequences |
| 329 | 1372327_at | BF552877 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein ref: NP_057216.1 (H. sapiens) myelin | |||
| gene expression factor 2 [Homo sapiens] | |||
| 330 | 1376175_at | BF283433 | Rattus norvegicus transcribed sequences |
| 331 | 1373966_at | BF406242 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: T43490 (H. sapiens) T43490 | |||
| hypothetical protein DKFZp434A139.1 - human | |||
| (fragments) | |||
| 332 | 1376749_at | AA945955 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: B35272 (H. sapiens) B35272 | |||
| osteoinductive factor - human | |||
| 333 | 1367604_at | NM_022501 | cysteine-rich protein 2 |
| 334 | 1398345_at | BM389225 | angiopoietin-like 2 |
| 335 | 1389836_a_at | AI599265 | Tissue inhibitor of metalloproteinase 3 |
| 336 | 1389256_at | BG381256 | Rattus norvegicus transcribed sequences |
| 337 | 1371500_at | BG375362 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_003564.1 (H. sapiens) latent | |||
| transforming growth factor beta binding protein 4 [Homo | |||
| sapiens] | |||
| 338 | 1371629_at | AI105444 | âRattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: I60307 (E. coli) I60307 beta- | |||
| galactosidase, alpha peptide - Escherichia coliâ | |||
| 339 | 1387707_at | NM_017102 | âsolute carrier family 2, member 2â |
| 340 | 1387505_at | NM_013145 | âGuanine nucleotide binding protein, alpha inhibiting 1â |
| 341 | 1388890_at | BM390316 | Rattus norvegicus transcribed sequences |
| 342 | 1373506_at | AA944568 | Rattus norvegicus transcribed sequences |
| 343 | 1369415_at | NM_053328 | âbasic helix-loop-helix domain containing, class B2â |
| 344 | 1372264_at | BI277460 | âRattus norvegicus transcribed sequence with strong |
| similarity to protein sp: P35558 (H. sapiens) | |||
| PPCC_HUMAN Phosphoenolpyruvate carboxykinase, | |||
| cytosolic [GTP] (Phosphoenolpyruvate carboxylase) | |||
| (PEPCK-C)â | |||
| 345 | 1374105_at | H31665 | Rattus norvegicus transcribed sequences |
| 346 | 1387156_at | NM_024391 | 17-beta hydroxysteroid dehydrogenase type 2 |
| 347 | 1376569_at | BM385790 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein sp: Q9Y5W3 (H. sapiens) | |||
| KLF2_HUMAN Kruppel-like factor 2 (Lung kruppel-like | |||
| factor) | |||
| 348 | 1387028_a_at | M86708 | âInhibitor of DNA binding 1, helix-loop-helix protein |
| (splice variation)â | |||
| 349 | 1376661_at | AI556122 | Rattus norvegicus transcribed sequences |
| 350 | 1377287_at | AA957673 | Rattus norvegicus transcribed sequences |
| 351 | 1375910_at | AA874943 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: T46465 (H. sapiens) T46465 | |||
| hypothetical protein DKFZp434A0530.1 - human | |||
| 352 | 1388447_at | AA800701 | Rattus norvegicus transcribed sequences |
| 353 | 1370912_at | BI278231 | R. norvegicus hsp70.2 mRNA for heat shock protein 70 |
| 354 | 1368883_at | NM_030868 | NOV protein |
| 355 | 1388945_at | BM385779 | âRattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: I60307 (E. coli) I60307 beta- | |||
| galactosidase, alpha peptide - Escherichia coliâ | |||
| 356 | 1389514_at | AI711152 | Rattus norvegicus transcribed sequences |
| 357 | 1377086_at | AI233530 | Rattus norvegicus transcribed sequences |
| 358 | 1373947_at | BI278545 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein pir: A47220 (H. sapiens) A47220 | |||
| dermatopontin precursor - human | |||
| 359 | 1374171_at | AI170507 | âATP-binding cassette, sub-family C (CFTR/MRP), |
| member 9â | |||
| 360 | 1372490_at | BF283759 | Rattus norvegicus transcribed sequences |
| 361 | 1390257_at | BG376956 | Rattus norvegicus transcribed sequences |
| 362 | 1369651_at | NM_012673 | Thymus cell surface antigen |
| 363 | 1388866_at | AA799392 | âRattus norvegicus transcribed sequence with moderate |
| similarity to protein pdb: 1LBG (E. coli) B Chain B, | |||
| Lactose Operon Repressor Bound To 21-Base Pair | |||
| Symmetric Operator Dna, Alpha Carbons Onlyâ | |||
| 364 | 1368303_at | NM_031678 | period homolog 2 |
| 365 | 1370399_at | M29853 | âcytochrome P450, subfamily 4B, polypeptide 1â |
| 366 | 1385606_at | BF559626 | Rattus norvegicus transcribed sequences |
| 367 | 1376170_at | BI290821 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: S46657 (H. sapiens) S46657 | |||
| collagen alpha 1(XIV) chain - human (fragments) | |||
| 368 | 1376832_at | AA800763 | Rattus norvegicus transcribed sequences |
| 369 | 1376049_at | AA925805 | Rattus norvegicus transcribed sequences |
| 370 | 1398365_at | AI171466 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein ref: NP_057048.1 (H. sapiens) CGI- | |||
| 38 protein [Homo sapiens] | |||
| 371 | 1372847_at | AW524458 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein ref: NP_064571.1 (H. sapiens) DC11 | |||
| protein [Homo sapiens] | |||
| 372 | 1372872_at | BI291271 | Rattus norvegicus transcribed sequences |
| 373 | 1376177_at | AI179609 | Rattus norvegicus transcribed sequences |
| 374 | 1387039_at | NM_030828 | glypican 1 |
| 375 | 1372208_at | AA942959 | âprotein phosphatase 1, regulatory (inhibitor) subunit |
| 1Bâ | |||
| 376 | 1376933_at | AI170377 | Rattus norvegicus transcribed sequences |
| 377 | 1388034_at | AB070355 | kinesin family member 1B |
| 378 | 1371794_at | BM391449 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: T14273 (M. musculus) T14273 | |||
| zinc finger protein 106 - mouse | |||
| 379 | 1393464_at | BM383378 | Rattus norvegicus transcribed sequences |
| 380 | 1389007_at | AI231799 | Rattus norvegicus transcribed sequences |
| 381 | 1371508_at | AI412098 | âprotein tyrosine phosphatase type IVA, member 2â |
| 382 | 1374694_at | BF284602 | Rattus norvegicus transcribed sequences |
| 383 | 1374558_at | AI010316 | Rattus norvegicus transcribed sequences |
| 384 | 1399028_at | AI171954 | Rattus norvegicus transcribed sequences |
| 385 | 1368550_at | NM_022858 | HNF-3/forkhead homolog-1 |
| 386 | 1370211_at | BE106940 | neurogranin |
| 387 | 1387090_a_at | NM_024135 | LIM motif-containing protein kinase 2 |
| 388 | 1370072_at | NM_012608 | membrane metallo endopeptidase |
| 389 | 1371703_at | AI407114 | Complement component 3 |
| 390 | 1390319_at | BG378301 | Rattus norvegicus transcribed sequence |
| 391 | 1387008_at | NM_022948 | tricarboxylate carrier-like protein |
| 392 | 1389561_at | BE110624 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein ref: NP_079740.1 (M. musculus) | |||
| RIKEN cDNA 1810021J13 [Mus musculus] | |||
| 393 | 1376023_at | BM386555 | Rattus norvegicus transcribed sequences |
| 394 | 1386979_at | NM_133395 | developmentally regulated protein TPO1 |
| 395 | 1368163_at | J02997 | Dipeptidyl peptidase 4 |
| 396 | 1374935_at | AI412099 | âRattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: I60307 (E. coli) I60307 beta- | |||
| galactosidase, alpha peptide - Escherichia coliâ | |||
| 397 | 1387084_at | NM_012789 | Dipeptidyl peptidase 4 |
| 398 | 1369770_at | NM_012719 | somatostatin receptor 1 |
| 399 | 1389601_at | BI293610 | âRattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: I60307 (E. coli) I60307 beta- | |||
| galactosidase, alpha peptide - Escherichia coliâ | |||
| 400 | 1368295_at | NM_080786 | âsolute carrier family 21 (organic anion transporter), |
| member 9â | |||
| 401 | 1376242_at | BF402365 | Rattus norvegicus transcribed sequences |
| 402 | 1387059_at | NM_019362 | âserine threonine kinase 39 (STE20/SPS1 homolog, |
| yeast)â | |||
| 403 | 1389310_at | BF400694 | Rattus norvegicus transcribed sequences |
| 404 | 1387169_at | NM_053400 | âtransducin-like enhancer of split 3, homolog of |
| Drosophilaâ | |||
| 405 | 1387023_at | NM_031154 | âglutathione S-transferase, mu type 3 (Yb3)â |
| 406 | 1398430_at | AW524711 | Rattus norvegicus transcribed sequences |
| 407 | 1369249_at | NM_053714 | progressive ankylosis |
| 408 | 1387913_at | U48220 | cytochrome P450 2D18 |
| 409 | 1370320_at | AY083160 | MAWD binding protein |
| 410 | 1376047_at | BI285321 | Rattus norvegicus transcribed sequences |
| 411 | 1387315_at | NM_012878 | âsurfactant, pulmonary-associated protein Dâ |
| 412 | 1387239_a_at | AB008803 | âpeptidyl arginine deiminase, type 4â |
| 413 | 1371477_at | BG380735 | Rattus norvegicus transcribed sequences |
| 414 | 1386974_at | NM_134397 | LL5 protein |
| 415 | 1370930_at | BF417285 | kinesin 1C |
| 416 | 1371689_at | BE107334 | eukaryotic translation elongation factor 1 alpha 1 |
| 417 | 1389040_at | AI170825 | Rattus norvegicus transcribed sequences |
| 418 | 1390710_x_at | AA850618 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein ref: NP_003096.1 (H. sapiens) | |||
| sortilin-related receptor containing LDLR class A repeats | |||
| preproprotein; sorting protein-related receptor containing | |||
| LDLR class A repeats; low-density li | |||
| 419 | 1367700_at | NM_080698 | fibromodulin |
| 420 | 1388317_at | BE110655 | Rattus norvegicus transcribed sequences |
| 421 | 1387184_at | NM_024355 | axin 2 |
| 422 | 1390399_at | BE102391 | Rattus norvegicus transcribed sequences |
| 423 | 1375590_at | AA894335 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: T00368 (H. sapiens) T00368 | |||
| hypothetical protein KIAA0663 - human | |||
| 424 | 1387901_at | L19180 | âprotein tyrosine phosphatase, receptor type, Dâ |
| 425 | 1388768_at | BI285601 | Rattus norvegicus transcribed sequences |
| 426 | 1373434_at | AA944179 | Rattus norvegicus transcribed sequences |
| 427 | 1376784_at | BI274481 | Rattus norvegicus transcribed sequences |
| 428 | 1390311_at | AW528602 | Rattus norvegicus transcribed sequences |
| 429 | 1389150_at | AW524559 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_076933.1 (H. sapiens) | |||
| hypothetical protein MGC3265 [Homo sapiens] | |||
| 430 | 1372728_at | BE103745 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein sp: Q99523 (H. sapiens) | |||
| SORT_HUMAN Sortilin precursor (Glycoprotein 95) | |||
| (Gp95) (Neurotensin receptor 3) (NT3) (100 kDa NT | |||
| receptor) | |||
| 431 | 1377325_a_at | AW531278 | Rattus norvegicus transcribed sequences |
| 432 | 1389288_at | BI279838 | âRattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_002479.1 (H. sapiens) | |||
| NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, | |||
| 2 (8 kD, B8) [Homo sapiens]â | |||
| 433 | 1375951_at | AA818521 | thrombomodulin |
| 434 | 1367880_at | NM_012974 | Laminin chain beta 2 |
| 435 | 1399109_at | BI281673 | Rattus norvegicus transcribed sequences |
| 436 | 1369926_at | NM_022525 | glutathione peroxidase 3 |
| 437 | 1388145_at | BM390128 | Tenascin X |
| 438 | 1398973_at | BI296499 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein sp: Q9HD45 (H. sapiens) | |||
| T9S3_HUMAN Transmembrane 9 superfamily protein | |||
| member 3 precursor (SM-11044 binding protein) (EP70- | |||
| P-iso) | |||
| 439 | 1398990_at | BI281754 | Rattus norvegicus transcribed sequences |
| 440 | 1371245_a_at | BI287300 | hemoglobin beta chain complex |
| 441 | 1392890_at | BG663460 | Rattus norvegicus transcribed sequences |
| 442 | 1371102_x_at | X05080 | hemoglobin beta chain complex |
| 443 | 1370240_x_at | AI179404 | âhemoglobin, alpha 1â |
| 444 | 1367553_x_at | NM_033234 | hemoglobin beta chain complex |
| 445 | 1370239_at | AI179404 | âhemoglobin, alpha 1â |
| 446 | 1388608_x_at | AI577319 | âhemoglobin, alpha 1â |
| 447 | 1388848_at | AA891760 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_071934.1 (H. sapiens) | |||
| hypothetical protein FLJ22056 [Homo sapiens] | |||
| 448 | 1389186_at | AA944175 | âRattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: I60307 (E. coli) I60307 beta- | |||
| galactosidase, alpha peptide - Escherichia coliâ | |||
| 449 | 1371972_at | BM388888 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: T00371 (H. sapiens) T00371 | |||
| hypothetical protein KIAA0668 - human (fragment) | |||
| 450 | 1372640_at | BI277758 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_076223.1 (M. musculus) | |||
| RIKEN cDNA 1200009H11 [Mus musculus] | |||
| 451 | 1373162_at | AI600085 | âRattus norvegicus NYGGF3 mRNA, partial cdsâ |
| 452 | 1387310_at | NM_134462 | putative secretory pathway Ca-ATPase SPCA2 |
| 453 | 1388698_at | AI407838 | extracellular matrix protein 1 |
| 454 | 1376105_at | AI599143 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: S46657 (H. sapiens) S46657 | |||
| collagen alpha 1(XIV) chain - human (fragments) | |||
| 455 | 1373674_at | BI283094 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein sp: Q13361 (H. sapiens) | |||
| MGP2_HUMAN Microfibril-associated glycoprotein 2 | |||
| precursor (MAGP-2) (MP25) | |||
| 456 | 1373952_at | AI409841 | Rattus norvegicus transcribed sequences |
| 457 | 1387625_at | NM_013104 | zzN/A |
| 458 | 1374674_at | AW528792 | Rattus norvegicus transcribed sequences |
| 459 | 1375844_at | AI406370 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein ref: NP_067013.1 (H. sapiens) | |||
| polypyrimidine tract binding protein 2; neural | |||
| polypyrimidine tract binding protein; PTB-like protein | |||
| [Homo sapiens] | |||
| 460 | 1368407_at | NM_022605 | heparanase |
| 461 | 1377076_at | AI716131 | Rattus norvegicus transcribed sequences |
| 462 | 1375412_at | AI101331 | Rattus norvegicus transcribed sequences |
| 463 | 1376398_at | BF417784 | Rattus norvegicus transcribed sequences |
| 464 | 1399054_at | BG375798 | Rattus norvegicus transcribed sequences |
| 465 | 1374126_at | BG374261 | Rattus norvegicus transcribed sequences |
| 466 | 1368099_at | NM_053722 | CLIP-associating protein 2 |
| 467 | 1387182_at | NM_057201 | G protein-coupled receptor 37 (endothelin receptor type |
| B-like) | |||
| 468 | 1372814_at | BF283084 | Rattus norvegicus transcribed sequences |
| 469 | 1376115_at | AA964244 | Rattus norvegicus transcribed sequences |
| 470 | 1369373_at | NM_053429 | fibroblast growth factor receptor 3 |
| 471 | 1376781_at | BI286116 | Rattus norvegicus transcribed sequences |
| 472 | 1369638_at | NM_012947 | Eukaryotic elongation factor 2 kinase |
| 473 | 1389003_at | BI282008 | Rattus norvegicus transcribed sequences |
| 474 | 1376089_at | BI294974 | Low density lipoprotein receptor |
| 475 | 1367932_at | NM_017268 | 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 |
| 476 | 1387809_at | NM_053703 | mitogen-activated protein kinase kinase 6 |
| 477 | 1375549_at | AI407719 | Rattus norvegicus transcribed sequences |
| 478 | 1370209_at | BE101336 | Kruppel-like factor 9 |
| 479 | 1389311_at | AW915161 | Rattus norvegicus transcribed sequences |
| 480 | 1390164_at | BE099850 | Rattus norvegicus transcribed sequences |
| 481 | 1376989_at | BE099568 | Rattus norvegicus transcribed sequences |
| 482 | 1368656_at | NM_053856 | secretogranin III |
| 483 | 1373415_at | AI407050 | Rattus norvegicus transcribed sequences |
| 484 | 1374819_at | AI599945 | Rattus norvegicus transcribed sequences |
| 485 | 1367594_at | NM_017087 | biglycan |
| 486 | 1372624_at | BF551377 | Rattus norvegicus transcribed sequences |
| 487 | 1376425_at | BF420705 | âtransforming growth factor, beta 2â |
| 488 | 1389138_at | AA945574 | Rattus norvegicus transcribed sequences |
| 489 | 1367940_at | NM_053352 | chemokine orphan receptor 1 |
| 490 | 1371747_at | AI406304 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_077275.1 (H. sapiens) | |||
| chromosome 20 open reading frame 149 [Homo sapiens] | |||
| 491 | 1372978_at | BI291218 | Rattus norvegicus transcribed sequences |
| 492 | 1387812_at | NM_012999 | Subtilisin - like endoprotease |
| 493 | 1389794_at | AI044984 | Rattus norvegicus transcribed sequences |
| 494 | 1388384_at | AI407618 | Rattus norvegicus transcribed sequences |
| 495 | 1374557_at | BF394235 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein ref: NP_079187.1 (H. sapiens) | |||
| hypothetical protein FLJ23091 [Homo sapiens] | |||
| 496 | 1370579_at | U53513 | âglycine-, glutamate-, thienylcyclohexylpiperidine- |
| binding proteinâ | |||
| 497 | 1367918_at | NM_031066 | protein kinase C-binding protein Zeta1 |
| 498 | 1368930_at | NM_023021 | intermediate conductance calcium-activated potassium |
| channel | |||
| 499 | 1387654_at | NM_023092 | unconventional myosin Myr2 I heavy chain |
| 500 | 1367759_at | NM_012578 | Histone H1-0 |
| 501 | 1386957_at | NM_053622 | nuclear pore membrane glycoprotein 121 kD |
| 502 | 1388709_at | BF284695 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein pir: A35804 (H. sapiens) A35804 | |||
| nucleolin - human | |||
| 503 | 1384371_at | AW921429 | zzN/A |
| 504 | 1371940_at | AW920000 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein sp: Q9UPN3 (H. sapiens) | |||
| ACF7_HUMAN Actin cross-linking family protein 7 | |||
| (Macrophin) (Trabeculin-alpha) (620 kDa actin-binding | |||
| protein) (ABP620) | |||
| 505 | 1370131_at | NM_031556 | caveolin |
| 506 | 1372825_at | BI290551 | Rattus norvegicus transcribed sequences |
| 507 | 1367989_at | NM_012751 | âsolute carrier family 2, member 4â |
| 508 | 1376724_at | AI170671 | Rattus norvegicus transcribed sequences |
| 509 | 1372967_at | BI280323 | Rattus norvegicus transcribed sequences |
| 510 | 1370291_at | AF002281 | actinin alpha 2 associated LIM protein |
| 511 | 1377281_at | BM388545 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_065099.1 (H. sapiens) | |||
| retinitis pigmentosa GTPase regulator interacting protein | |||
| 1; RPGR-interacting protein [Homo sapiens] | |||
| 512 | 1367930_at | NM_017195 | growth associated protein 43 |
| 513 | 1367628_at | NM_019904 | âlectin, galactose binding, soluble 1â |
| 514 | 1388112_at | BG666999 | solute carrier family 25 (mitochondrial adenine nucleotide |
| translocator) member 4 | |||
| 515 | 1387873_at | BI279661 | wap four-disulfide core domain 1 |
| 516 | 1389194_at | AI406491 | Rattus norvegicus transcribed sequences |
| 517 | 1388928_at | BF399310 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein ref: NP_068733.1 (H. sapiens) cofilin | |||
| 2 (muscle) [Homo sapiens] | |||
| 518 | 1370857_at | BI282702 | smooth muscle alpha-actin |
| 519 | 1387018_at | NM_053770 | Arg/Abl-interacting protein ArgBP2 |
| 520 | 1398327_at | BM386598 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein pir: S69890 (H. sapiens) S69890 | |||
| mitogen inducible gene mig-2 - human | |||
| 521 | 1389189_at | BF555956 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein sp: Q9Z1P2 (R. norvegicus) | |||
| AAC1_RAT Alpha-actinin 1 (Alpha-actinin cytoskeletal | |||
| isoform) (Non-muscle alpha-actinin 1) (F-actin cross | |||
| linking protein) | |||
| 522 | 1371361_at | BI278826 | tensin |
| 523 | 1375349_at | BI295776 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein pir: T17257 (H. sapiens) T17257 | |||
| hypothetical protein DKFZp586P1422.1 - human | |||
| 524 | 1376572_a_at | AI045848 | âRattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_068506.1 (H. sapiens) | |||
| supervillin, isoform 2; membrane-associated F-actin | |||
| binding protein p205; archvillin [Homo sapiens]â | |||
| 525 | 1367813_at | NM_130403 | âprotein phosphatase 1, regulatory (inhibitor) subunit |
| 14aâ | |||
| 526 | 1367648_at | NM_013122 | Insulin-like growth factor binding protein 2 |
| 527 | 1374969_at | AA799832 | Rattus norvegicus transcribed sequences |
| 528 | 1371954_at | BF290193 | Rattus norvegicus transcribed sequences |
| 529 | 1370347_at | AF095585 | enigma (LIM domain protein) |
| 530 | 1388483_at | BI296011 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein ref: NP_068733.1 (H. sapiens) cofilin | |||
| 2 (muscle) [Homo sapiens] | |||
| 531 | 1375890_at | BI296994 | Rattus norvegicus transcribed sequences |
| 532 | 1368724_a_at | NM_019131 | âtropomyosin 1, alphaâ |
| 533 | 1370288_a_at | AF372216 | âtropomyosin 1, alphaâ |
| 534 | 1367785_at | NM_031747 | Calponin 1 |
| 535 | 1388422_at | BI275904 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: JC2324 (H. sapiens) JC2324 LIM | |||
| protein - human | |||
| 536 | 1368988_at | AW520914 | calsequestrin 2 |
| 537 | 1370585_a_at | X04440 | âprotein kinase C, beta 1â |
| 538 | 1389187_at | BI286421 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_115950.1 (H. sapiens) EVG1 | |||
| protein [Homo sapiens] | |||
| 539 | 1389050_at | AI170797 | Rattus norvegicus transcribed sequences |
| 540 | 1372658_at | BG373779 | desmuslin |
| 541 | 1387898_at | D29960 | heat shock 20-kDa protein |
| 542 | 1373915_at | AI044427 | âRattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: B49364 (H. sapiens) B49364 | |||
| protein kinase (EC 2.7.1.37), myotonic dystrophy- | |||
| associated - humanâ | |||
| 543 | 1367570_at | NM_031549 | Transgelin (Smooth muscle 22 protein) |
| 544 | 1370287_a_at | M23764 | âtropomyosin 1, alphaâ |
| 545 | 1386869_at | NM_012893 | âactin, gamma 2â |
| 546 | 1388842_at | BG380385 | Rattus norvegicus transcribed sequences |
| 547 | 1371382_at | BI283060 | âRattus norvegicus transcribed sequence with strong |
| similarity to protein pir: A37098 (H. sapiens) A37098 | |||
| gelation factor ABP-280, long form - humanâ | |||
| 548 | 1372219_at | AA012755 | âRattus norvegicus transcribed sequence with strong |
| similarity to protein sp: P06468 (H. sapiens) | |||
| TPM2_HUMAN Tropomyosin beta chain, fibroblast and | |||
| epithelial muscle-type (Tropomyosin 2, fibroblast and | |||
| epithelial muscle-type) (TM36) (TME1) (TM1)â | |||
| 549 | 1370057_at | NM_017148 | cysteine rich protein 1 |
| 550 | 1371541_at | AI177055 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_444278.1 (H. sapiens) | |||
| mitochondrial ribosomal protein L53 [Homo sapiens] | |||
| 551 | 1388496_at | AI103600 | âRattus norvegicus transcribed sequence with strong |
| similarity to protein ref: NP_001449.1 (H. sapiens) | |||
| gamma filamin; filamin C, gamma (actin-binding protein- | |||
| 280); filamin 2; actin-binding protein 280 [Homo | |||
| sapiens]â | |||
| 552 | 1370896_a_at | X16262 | myosin heavy chain 11 |
| 553 | 1372015_at | AI008689 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein sp: O75410 (H. sapiens) | |||
| TAC1_HUMAN Transforming acidic coiled-coil- | |||
| containing protein 1 | |||
| 554 | 1372296_at | AA800892 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein sp: P55822 (H. sapiens) | |||
| SH3B_HUMAN SH3 domain-binding glutamic acid-rich | |||
| protein (SH3BGR protein) (21-glutamic acid-rich | |||
| protein) (21-GARP) | |||
| 555 | 1388451_at | AA817802 | Rattus norvegicus transcribed sequences |
| 556 | 1388298_at | BI279044 | âRattus norvegicus transcribed sequence with strong |
| similarity to protein pir: A32031 (H. sapiens) A32031 | |||
| myosin regulatory light chain, smooth muscle - humanâ | |||
| 557 | 1371677_at | BE113200 | Rattus norvegicus transcribed sequences |
| 558 | 1367691_at | NM_134449 | PKC-delta binding protein |
| 559 | 1372159_at | BI285456 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein ref: NP_067541.1 (M. musculus) | |||
| junctophilin 2 [Mus musculus] | |||
| 560 | 1371331_at | BG665037 | Rattus norvegicus transcribed sequences |
| 561 | 1370234_at | AA893484 | Fibronectin 1 |
| 562 | 1372111_at | BI285449 | caveolin |
| 563 | 1399065_at | BM389543 | Rattus norvegicus transcribed sequences |
| 564 | 1371855_at | BM390254 | Rattus norvegicus transcribed sequences |
| 565 | 1389394_at | AI411809 | Rattus norvegicus transcribed sequences |
| 566 | 1368145_at | NM_013002 | Neuron specific protein PEP-19 (Purkinje cell protein 4) |
| 567 | 1371566_at | BI296437 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_116264.1 (H. sapiens) | |||
| hypothetical protein MGC15482 [Homo sapiens] | |||
| 568 | 1368105_at | AI228231 | Tspan-2 protein |
| 569 | 1372625_at | AA851663 | Rattus norvegicus transcribed sequences |
| 570 | 1372537_at | BI289642 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein sp: O00423 (H. sapiens) | |||
| EML1_HUMAN Echinoderm microtubule-associated | |||
| protein-like 1 (EMAP-1) (HuEMAP-1) | |||
| 571 | 1390430_at | BF284190 | ânuclear receptor subfamily 1, group D, member 2â |
| 572 | 1371969_at | BI291848 | Rattus norvegicus transcribed sequences |
| 573 | 1386860_at | NM_012811 | milk fat globule-EGF factor 8 protein |
| 574 | 1371588_at | AA686007 | âparvin, alphaâ |
| 575 | 1387224_at | NM_019304 | âdiacylglycerol kinase, betaâ |
| 576 | 1374237_at | BI286025 | âRattus norvegicus transcribed sequence with strong |
| similarity to protein sp: P29536 (H. sapiens) | |||
| LMD1_HUMAN Leiomodin 1 (Leiomodin, muscle form) | |||
| (64 kDa autoantigen D1) (64 kDa autoantigen 1D) (64 kDa | |||
| autoantigen 1D3) (Thyroid-associated | |||
| ophthalmopathy aut | |||
| 577 | 1373911_at | BM389026 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein pir: S36110 (H. sapiens) S36110 | |||
| osteoblast-specific factor 2 - human | |||
| 578 | 1371732_at | BI285485 | Rattus norvegicus transcribed sequences |
| 579 | 1371700_at | AI177059 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein sp: P55083 (H. sapiens) | |||
| MFA4_HUMAN Microfibril-associated glycoprotein 4 | |||
| 580 | 1376099_at | AW254017 | âcollagen, type V, alpha 1â |
| 581 | 1388935_at | AI231814 | Rattus norvegicus transcribed sequences |
| 582 | 1379936_at | AA875132 | Rattus norvegicus transcribed sequences |
| 583 | 1372342_at | AI176583 | Rattus norvegicus transcribed sequences |
| 584 | 1398370_at | AW522471 | rexo70 |
| 585 | 1369652_at | AI145313 | Thymus cell surface antigen |
| 586 | 1376640_at | BF285466 | Rattus norvegicus transcribed sequences |
| 587 | 1369955_at | NM_134452 | âcollagen, type V, alpha 1â |
| 588 | 1373858_at | BE109064 | âRattus norvegicus transcribed sequence with moderate |
| similarity to protein pdb: 1LBG (E. coli) B Chain B, | |||
| Lactose Operon Repressor Bound To 21-Base Pair | |||
| Symmetric Operator Dna, Alpha Carbons Onlyâ | |||
| 589 | 1387854_at | BI282748 | âprocollagen, type I, alpha 2â |
| 590 | 1386862_at | NM_013132 | annexin 5 |
| 591 | 1388116_at | BI285575 | âcollagen, type 1, alpha 1â |
| 592 | 1370959_at | BI275716 | âcollagen, type III, alpha 1â |
| 593 | 1370155_at | BM388837 | âprocollagen, type I, alpha 2â |
| 594 | 1388569_at | AI179984 | alpha-2 antiplasmin |
| 595 | 1373032_at | AW251450 | fracture callus protein MUSTANG |
| 596 | 1376265_at | AI411542 | Rattus norvegicus transcribed sequences |
| 597 | 1389367_at | AI409747 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein ref: NP_055390.1 (H. sapiens) | |||
| schwannomin interacting protein 1 [Homo sapiens] | |||
| 598 | 1373957_at | BF281544 | Reelin |
| 599 | 1370927_at | BE108345 | âprocollagen, type XII, alpha 1â |
| 600 | 1372305_at | AA893634 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_057513.1 (H. sapiens) | |||
| COPZ2 for nonclathrin coat protein zeta-COP [Homo | |||
| sapiens] | |||
| 601 | 1383822_at | AI029990 | âRattus norvegicus transcribed sequence with weak |
| similarity to protein ref: NP_001705.1 (H. sapiens) | |||
| Bicaudal D homolog 1 (Drosophila); Bicaudal-D, | |||
| Drosophila, homolog of, 1; Bicaudal D (Drosophila) | |||
| homolog 1 [Homo sapiens]â | |||
| 602 | 1374774_at | BF552241 | Rattus norvegicus transcribed sequences |
| 603 | 1388312_at | BI274487 | tissue inhibitor of metalloproteinase 2 |
| 604 | 1376662_at | BF390141 | Rattus norvegicus transcribed sequences |
| 605 | 1374971_at | AA818954 | Rattus norvegicus transcribed sequences |
| 606 | 1389066_at | BI274408 | Rattus norvegicus transcribed sequences |
| 607 | 1373102_at | BI282750 | Rattus norvegicus transcribed sequences |
| 608 | 1388738_at | AI411227 | Rattus norvegicus transcribed sequences |
| 609 | 1368842_at | BG377130 | Rattus norvegicus transcribed sequences |
| 610 | 1390444_at | AI044433 | Rattus norvegicus transcribed sequences |
| 611 | 1377087_at | AA963029 | Rattus norvegicus transcribed sequences |
| 612 | 1387042_at | NM_012828 | âcalcium channel, voltage-dependent, beta 3 subunitâ |
| 613 | 1369974_at | NM_012663 | vesicle-associated membrane protein 2 |
| 614 | 1374870_at | BF286402 | Rattus norvegicus transcribed sequences |
| 615 | 1374087_at | AI411088 | Rattus norvegicus transcribed sequences |
| 616 | 1374117_at | BI279562 | brain-specific angiogenesis inhibitor 1-associated protein 2 |
| 617 | 1390016_at | BF415854 | Rattus norvegicus transcribed sequences |
| 618 | 1390341_at | BF396709 | Rattus norvegicus transcribed sequences |
| 619 | 1374709_at | AI406795 | Rattus norvegicus transcribed sequences |
| 620 | 1374726_at | AI411941 | Rattus norvegicus transcribed sequences |
| 621 | 1389511_s_at | BF403383 | synaptogyrin 1 |
| 622 | 1390489_at | BE108860 | Rattus norvegicus transcribed sequences |
| 623 | 1388598_at | BI281230 | Rattus norvegicus transcribed sequences |
| 624 | 1370375_at | J05499 | liver mitochondrial glutaminase |
| 625 | 1388821_at | AI010430 | Rattus norvegicus transcribed sequences |
| 626 | 1368276_at | NM_012664 | Synaptophysin |
| 627 | 1375862_at | BM384701 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein sp: P07202 (H. sapiens) | |||
| PERT_HUMAN Thyroid peroxidase precursor (TPO) | |||
| 628 | 1377136_at | AW254190 | Rattus norvegicus transcribed sequences |
| 629 | 1392887_at | AI575082 | Rattus norvegicus transcribed sequences |
| 630 | 1389157_at | BI275583 | Rattus norvegicus transcribed sequences |
| 631 | 1377013_at | AI639108 | Rattus norvegicus transcribed sequences |
| 632 | 1371389_at | AI170668 | Rattus norvegicus transcribed sequences |
| 633 | 1370969_at | BE107303 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein sp: P03845 (E. coli) YPA1_ECOLI | |||
| HYPOTHETICAL PROTEIN 1 | |||
| 634 | 1373438_at | BE329352 | Rattus norvegicus transcribed sequence with weak |
| similarity to protein pir: RGECDW (E. coli) RGECDW | |||
| transcription activator of D-serine dehydratase - | |||
| Escherichia coli | |||
| 635 | 1388456_at | AI228548 | âRattus norvegicus transcribed sequence with strong |
| similarity to protein sp: P23297 (H. sapiens) | |||
| S10A_HUMAN S-100 protein, alpha chain (S100 | |||
| calcium-binding protein A1)â | |||
| 636 | 1373427_at | BI288816 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein ref: NP_067067.1 (H. sapiens) Rag D | |||
| protein; hypothetical GTP-binding protein | |||
| DKFZp761H171 [Homo sapiens] | |||
| 637 | 1368085_at | NM_133595 | GTP cyclohydrolase I feedback regulatory protein |
| 638 | 1369103_at | NM_012755 | Fyn proto-oncogene |
| 639 | 1389456_at | BI296591 | Rattus norvegicus transcribed sequences |
| 640 | 1370904_at | BI301490 | R. norvegicus mRNA for RT1.Ma |
| 641 | 1371499_at | AI227627 | CD9 antigen (p24) |
| 642 | 1371362_at | BI285402 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein sp: Q92841 (H. sapiens) | |||
| DD17_HUMAN Probable RNA-dependent helicase p72 | |||
| (DEAD-box protein p72) (DEAD-box protein 17) | |||
| 643 | 1388920_at | AI230985 | bone morphogenetic protein 6 |
| 644 | 1368851_at | NM_012555 | v-ets erythroblastosis virus E26 oncogene homolog 1 |
| (avian) | |||
| 645 | 1373343_at | AI175820 | Rattus norvegicus transcribed sequences |
| 646 | 1374888_at | AI317837 | Rattus norvegicus transcribed sequences |
| 647 | 1376453_at | BF419074 | Rattus norvegicus transcribed sequences |
| 648 | 1376062_at | BG375315 | syndecan 1 |
| 649 | 1371046_at | AW920849 | âRattus norvegicus beta II spectrin-short isoform mRNA, |
| partial cdsâ | |||
| 650 | 1368080_at | NM_054008 | Rgc32 protein |
| 651 | 1371931_at | BI274753 | general transcription factor II I |
| 652 | 1388463_at | AW252660 | Rattus norvegicus transcribed sequence with moderate |
| similarity to protein ref: NP_057010.1 (H. sapiens) | |||
| putative secreted protein; similar to putative secreted | |||
| protein (H. sapiens) [Homo sapiens] | |||
| 653 | 1388639_at | BF284148 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein ref: NP_060149.1 (H. sapiens) | |||
| hypothetical protein FLJ20128 [Homo sapiens] | |||
| 654 | 1379685_at | AI502753 | CTD-binding SR-like protein rA4 |
| 655 | 1389967_at | AA892386 | âRattus norvegicus ADP-ribosylation-like factor 6- |
| interacting protein mRNA, complete cdsâ | |||
| 656 | 1368941_at | NM_032076 | prostaglandin E receptor 4 (subtype EP4) |
| 657 | 1390457_at | BM385762 | Rattus norvegicus transcribed sequences |
| 658 | 1390458_at | BG666849 | Rattus norvegicus transcribed sequences |
| 659 | 1375254_at | BE103444 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein pir: JC5023 (H. sapiens) JC5023 | |||
| CMP-sialic acid transporter - human | |||
| 660 | 1375530_at | BG374612 | Rattus norvegicus transcribed sequence with strong |
| similarity to protein ref: NP_062298.1 (M. musculus) | |||
| glucosamine-phosphate N-acetyltransferase 1; | |||
| glucosamine-6-phosphate acetyltransferase; glucosamine- | |||
| phosphate N-acetyltransferase [Mus musculus] | |||
| TABLE 6 |
| Genes differentially expressed in CNI1493-treated S1 DRG |
| No. | Identifier | Acce. No. | CTRL-VHL | CTRL-CNI | IBS-VHL | IBS-CNI | Description |
| 52 | 1373932_at | BE098739 | 1.00 | 4.46 | 1.91 | 6.75 | ESTs |
| 48 | 1370913_at | AI409634 | 1.00 | 1.70 | 0.98 | 3.44 | Best5 protein |
| 15 | 1369202_at | NM_017028 | 1.00 | 2.20 | 0.35 | 3.04 | myxovirus (influenza virus) |
| resistance 2 | |||||||
| 62 | 1371152_a_at | Z18877 | 1.00 | 1.49 | 0.48 | 2.48 | 25 oligoadenylate synthetase |
| 53 | 1367850_at | NM_053843 | 1.00 | 1.66 | 1.01 | 2.32 | âFc receptor, IgG, low affinity |
| IIIâ | |||||||
| 54 | 1389006_at | AI170394 | 1.00 | 1.53 | 1.03 | 2.28 | ESTs |
| 58 | 1383564_at | BF411036 | 1.00 | 1.34 | 0.52 | 2.26 | âESTs, Highly similar to |
| IRF7 MOUSE Interferon | |||||||
| regulatory factor 7 (IRF-7) | |||||||
| [M. musculus]â | |||||||
| 67 | 1389034_at | BI295179 | 1.00 | 1.49 | 0.59 | 2.24 | âESTs, Moderately similar to |
| UBPI_MOUSE Ubiquitin | |||||||
| carboxyl-terminal hydrolase | |||||||
| 18 (Ubiquitin thiolesterase 18) | |||||||
| (Ubiquitin-specific processing | |||||||
| protease 18) (Deubiquitinating | |||||||
| enzyme 18) (43 kDa ubiquitin- | |||||||
| specific protease) | |||||||
| [M. musculus]â | |||||||
| 35 | 1386166_at | AA892881 | 1.00 | 1.59 | 1.43 | 2.18 | EST |
| 69 | 1388164_at | AF029241 | 1.00 | 1.52 | 0.97 | 2.09 | âRattus norvegicus partial |
| mRNA for BM1k MHC class | |||||||
| Ib antigen, strain SHRâ | |||||||
| 65 | 1370892_at | BI285347 | 1.00 | 1.66 | 0.69 | 2.05 | Complement component 4 |
| 73 | 1369186_at | D85899 | 1.00 | 1.78 | 1.10 | 2.05 | caspase 1 |
| 56 | 1372691_at | BI292558 | 1.00 | 1.34 | 0.94 | 2.02 | âESTs, Highly similar to |
| A57501 uridine phosphorylase | |||||||
| (EC 2.4.2.3) I - mouse | |||||||
| [M. musculus]â | |||||||
| 70 | 1371015_at | X52711 | 1.00 | 1.40 | 0.81 | 1.98 | âMyxovirus (influenza) |
| resistance, homolog of murine | |||||||
| Mx (also interferon-inducible | |||||||
| protein IFI78)â | |||||||
| 74 | 1376151_a_at | AI407953 | 1.00 | 1.51 | 0.92 | 1.95 | ESTs |
| 51 | 1374730_at | AI102519 | 1.00 | 1.42 | 1.11 | 1.91 | âESTs, Highly similar to |
| TYRO protein tyrosine kinase | |||||||
| binding protein; killer cell | |||||||
| activating receptor associated | |||||||
| protein [Mus musculus] | |||||||
| [M. musculus]â | |||||||
| 30 | 1390730_at | BM383911 | 1.00 | 1.69 | 1.33 | 1.86 | ESTs |
| 36 | 1375346_at | BI290002 | 1.00 | 1.62 | 1.43 | 1.82 | âESTs, Weakly similar to |
| hypothetical protein FLJ20010 | |||||||
| [Homo sapiens] [H. sapiens]â | |||||||
| 72 | 1390738_at | BM385476 | 1.00 | 1.66 | 1.20 | 1.74 | ESTs |
| 47 | 1370186_at | AI599350 | 1.00 | 1.32 | 1.05 | 1.74 | âproteosome (prosome, |
| macropain) subunit, beta type | |||||||
| 9 (large multifunctional | |||||||
| protease 2)â | |||||||
| 80 | 1389553_at | BF393825 | 1.00 | 1.16 | 0.85 | 1.73 | âESTs, Weakly similar to |
| RIKEN cDNA 1810046124 | |||||||
| [Mus musculus] [M. musculus]â | |||||||
| 77 | 1372930_at | AI411381 | 1.00 | 1.14 | 0.76 | 1.72 | âESTs, Weakly similar to |
| DEAF-1 related | |||||||
| transcriptional regulator | |||||||
| (NUDR) [Rattus norvegicus] | |||||||
| [R. norvegicus]â | |||||||
| 59 | 1367786_at | NM_080767 | 1.00 | 1.23 | 0.73 | 1.66 | âproteasome (prosome, |
| macropain) subunit, beta type, | |||||||
| 8 (low molecular mass | |||||||
| polypeptide 7)â | |||||||
| 49 | 1388071_x_at | M24024 | 1.00 | 1.28 | 1.05 | 1.66 | RT1 class Ib gene |
| 44 | 1380030_at | AW523520 | 1.00 | 1.49 | 0.96 | 1.65 | âESTs, Highly similar to |
| RIKEN cDNA 3110024A21 | |||||||
| [Mus musculus] [M. musculus]â | |||||||
| 57 | 1390510_at | BI294706 | 1.00 | 1.21 | 0.83 | 1.65 | âESTs, Weakly similar to |
| RIKEN cDNA 1810027D10 | |||||||
| [Mus musculus] [M. musculus]â | |||||||
| 42 | 1374944_at | BI275829 | 1.00 | 1.26 | 0.65 | 1.65 | âESTs, Moderately similar to |
| hypothetical protein LOC51058 | |||||||
| [Homo sapiens] [H. sapiens]â | |||||||
| 23 | 1384446_at | BF402271 | 1.00 | 1.72 | 1.51 | 1.62 | ESTs |
| 34 | 1375988_at | AW914928 | 1.00 | 1.39 | 1.38 | 1.62 | ESTs |
| 27 | 1373403_at | AI230625 | 1.00 | 1.59 | 1.11 | 1.61 | ESTs |
| 66 | 1387995_a_at | BI285494 | 1.00 | 1.40 | 0.84 | 1.60 | interferon-inducible protein |
| variant 10 | |||||||
| 39 | 1387969_at | U22520 | 1.00 | 1.52 | 1.06 | 1.59 | âsmall inducible cytokine B |
| subfamily (Cys-X-Cys), | |||||||
| member 10â | |||||||
| 32 | 1384167_at | AW522260 | 1.00 | 1.70 | 1.38 | 1.59 | ESTs |
| 37 | 1387566_at | NM_133551 | 1.00 | 1.42 | 1.25 | 1.59 | âphospholipase A2, group |
| IVA (cytosolic, calcium- | |||||||
| dependent)â | |||||||
| 55 | 1372516_at | AI317842 | 1.00 | 1.24 | 1.06 | 1.58 | âESTs, Weakly similar to |
| S62328 kinesin-like DNA | |||||||
| binding protein KID - human | |||||||
| [H. sapiens]â | |||||||
| 43 | 1374277_at | BI289615 | 1.00 | 1.44 | 1.01 | 1.56 | ESTs |
| 28 | 1376264_at | AW526697 | 1.00 | 1.56 | 1.51 | 1.56 | ESTs |
| 33 | 1388872_at | BI290053 | 1.00 | 1.25 | 1.19 | 1.56 | isopentenyl-diphosphate delta |
| isomerase | |||||||
| 14 | 1390312_at | BG670441 | 1.00 | 1.45 | 0.77 | 1.55 | âESTs, Weakly similar to |
| hypothetical protein FLJ20073 | |||||||
| [Homo sapiens] [H. sapiens]â | |||||||
| 64 | 1388149_at | X57523 | 1.00 | 1.15 | 0.72 | 1.52 | âTransporter 1, ABC (ATP |
| binding cassette)â | |||||||
| 71 | 1389571_at | BG666368 | 1.00 | 1.20 | 0.95 | 1.52 | âESTs, Weakly similar to |
| signal transducer and activator | |||||||
| of transcription 1 | |||||||
| [Rattus norvegicus] | |||||||
| [R. norvegicus]â | |||||||
| 68 | 1368835_at | AW434718 | 1.00 | 1.33 | 0.87 | 1.51 | signal transducer and activator |
| of transcription 1 | |||||||
| 60 | 1388347_at | AI233210 | 1.00 | 1.11 | 0.93 | 1.51 | âESTs, Moderately similar to |
| I49013 thymic shared antigen- | |||||||
| 1 - mouse [M. musculus]â | |||||||
| 12 | 1376693_at | AA998964 | 1.00 | 1.27 | 0.60 | 1.49 | âESTs, Moderately similar to |
| hypothetical protein FLJ20073 | |||||||
| [Homo sapiens] [H. sapiens]â | |||||||
| 50 | 1373043_at | BI275923 | 1.00 | 1.36 | 1.16 | 1.49 | âESTs, Highly similar to |
| stromal cell-derived factor 2- | |||||||
| like 1 [Mus musculus] | |||||||
| [M. musculus]â | |||||||
| 24 | 1374465_at | AI237098 | 1.00 | 1.48 | 1.04 | 1.49 | âESTs, Highly similar to |
| ubiquitously expressed | |||||||
| transcript [Mus musculus] | |||||||
| [M. musculus]â | |||||||
| 63 | 1373025_at | AI411618 | 1.00 | 1.15 | 0.61 | 1.47 | âESTs, Weakly similar to |
| S49158 complement protein | |||||||
| C1q beta chain precursor - rat | |||||||
| [R. norvegicus]â | |||||||
| 25 | 1369962_at | NM_031014 | 1.00 | 1.58 | 1.36 | 1.47 | 5-aminoimidazole-4- |
| carboxamide ribonucleotide | |||||||
| formyltransferase/IMP | |||||||
| 19 | 1377117_at | BF387780 | 1.00 | 1.88 | 0.94 | 1.45 | ESTs |
| 16 | 1388754_at | AI176839 | 1.00 | 1.49 | 0.88 | 1.45 | ESTs |
| 46 | 1376056_at | BF291214 | 1.00 | 1.33 | 1.07 | 1.43 | âESTs, Moderately similar to |
| hypothetical protein FLJ14464 | |||||||
| [Homo sapiens] [H. sapiens]â | |||||||
| 29 | 1399056_at | AI716436 | 1.00 | 1.57 | 1.21 | 1.43 | âESTs, Moderately similar to |
| candidate tumor suppressor | |||||||
| protein [Homo sapiens] | |||||||
| [H. sapiens]â | |||||||
| 3 | 1376751_at | AI044250 | 1.00 | 1.74 | 1.16 | 1.41 | âESTs, Highly similar to |
| ST19_MOUSE | |||||||
| Serine/threonine-protein | |||||||
| kinase 19 (RP1 protein) | |||||||
| [M. musculus]â | |||||||
| 11 | 1367846_at | NM_012618 | 1.00 | 1.59 | 0.95 | 1.41 | S100 calcium-binding protein |
| A4 | |||||||
| 45 | 1373504_at | BF287967 | 1.00 | 1.32 | 0.96 | 1.40 | âESTs, Weakly similar to |
| JE0204 testicular protein Tpx- | |||||||
| 1 - rat [R. norvegicus]â | |||||||
| 22 | 1372043_at | BI282363 | 1.00 | 1.52 | 1.16 | 1.37 | âESTs, Moderately similar to |
| ribosomal protein P0-like | |||||||
| protein; 60S acidic ribosomal | |||||||
| protein PO [Homo sapiens] | |||||||
| [H. sapiens]â | |||||||
| 38 | 1370214_at | AI175539 | 1.00 | 1.18 | 0.84 | 1.34 | Parvalbumin (calcium binding |
| protein) | |||||||
| 9 | 1390655_at | BF420653 | 1.00 | 1.47 | 0.54 | 1.34 | âESTs, Highly similar to |
| T14155 zinc finger protein | |||||||
| Peg3 - mouse [M. musculus]â | |||||||
| 26 | 1375669_at | BI285619 | 1.00 | 1.39 | 1.03 | 1.32 | âESTs, Weakly similar to |
| FK506 binding protein 2 (13 | |||||||
| kDa) [Rattus norvegicus] | |||||||
| [R. norvegicus]â | |||||||
| 21 | 1398884_at | BM384924 | 1.00 | 1.71 | 1.10 | 1.32 | âESTs, Highly similar to |
| prefoldin 5; EIG-1; c-myc | |||||||
| binding protein MM-1; DNA | |||||||
| segment, Chr 15, ERATO Doi | |||||||
| 697, expressed [Mus musculus] | |||||||
| [M. musculus]â | |||||||
| 1 | 1368465_at | NM_012892 | 1.00 | 1.66 | 1.12 | 1.30 | amiloride-sensitive cation |
| channel 1 | |||||||
| 20 | 1371381_at | AI007981 | 1.00 | 1.46 | 0.99 | 1.29 | âESTs, Moderately similar to |
| UCRX_HUMAN Ubiquinol- | |||||||
| cytochrome C reductase | |||||||
| complex 7.2 kDa protein | |||||||
| (Cytochrome C1, nonheme 7 | |||||||
| kDa protein) (Complex III | |||||||
| subunit X) (7.2 kDa | |||||||
| cytochrome c1-associated | |||||||
| protein subunit) (HSPC119) | |||||||
| [H. sapiens]â | |||||||
| 4 | 1372815_at | BG673028 | 1.00 | 1.70 | 1.02 | 1.29 | âESTs, Highly similar to |
| MGN_HUMAN Mago nashi | |||||||
| protein homolog | |||||||
| [M. musculus]â | |||||||
| 41 | 1388628_at | BI284430 | 1.00 | 1.30 | 0.84 | 1.29 | âESTs, Weakly similar to |
| PSD7_MOUSE 26S | |||||||
| proteasome non-ATPase | |||||||
| regulatory subunit 7 (26S | |||||||
| proteasome regulatory subunit | |||||||
| S12) (Proteasome subunit | |||||||
| p40) (Mov34 protein) | |||||||
| [M. musculus]â | |||||||
| 61 | 1373037_at | BI279216 | 1.00 | 1.07 | 0.74 | 1.26 | âESTs, Weakly similar to |
| ubiquitin-conjugating enzyme | |||||||
| E2D 2 [Rattus norvegicus] | |||||||
| [R. norvegicus]â | |||||||
| 2 | 1374950_at | BF400611 | 1.00 | 1.52 | 0.89 | 1.23 | ESTs |
| 10 | 1386425_at | H33472 | 1.00 | 1.27 | 0.73 | 1.23 | EST |
| 31 | 1390065_at | BE096685 | 1.00 | 1.53 | 0.86 | 1.22 | ESTs |
| 17 | 1390389_at | BM385936 | 1.00 | 1.21 | 0.87 | 1.20 | ESTs |
| 7 | 1369970_at | NM_031827 | 1.00 | 1.45 | 0.89 | 1.18 | vesicle-associated membrane |
| protein 8 (endobrevin) | |||||||
| 13 | 1390562_s_at | BE102350 | 1.00 | 1.09 | 0.68 | 1.15 | ESTs |
| 8 | 1390147_at | AI549079 | 1.00 | 1.26 | 0.75 | 1.12 | âESTs, Highly similar to |
| T17232 hypothetical protein | |||||||
| DKFZp434I116.1 - human | |||||||
| (fragment) [H. sapiens]â | |||||||
| 95 | 1369157_at | NM_017229 | 1.00 | 1.05 | 1.77 | 1.09 | phosphodiesterase 3B |
| 78 | 1387242_at | NM_019335 | 1.00 | 0.96 | 2.62 | 0.95 | âProtein kinase, interferon- |
| inducible double stranded | |||||||
| RNA dependentâ | |||||||
| 79 | 1377225_at | BF400628 | 1.00 | 0.76 | 3.47 | 0.85 | ESTs |
| 18 | 1372137_at | BI279854 | 1.00 | 1.13 | 0.73 | 1.03 | âESTs, Highly similar to |
| GC5L_MOUSE GCN5-LIKE | |||||||
| PROTEIN 1 [M. musculus]â | |||||||
| 75 | 1393280_at | AA874924 | 1.00 | 1.18 | 0.28 | 1.09 | âESTs, Moderately similar to |
| lymphocyte antigen 86 | |||||||
| [Mus musculus] [M. musculus]â | |||||||
| 76 | 1372604_at | BI289459 | 1.00 | 1.55 | 0.08 | 1.29 | âESTs, Weakly similar to |
| apolipoprotein L, 3; TNF- | |||||||
| inducible protein CG12-1 | |||||||
| [Homo sapiens] [H. sapiens]â | |||||||
| 102 | 1374802_at | AI010721 | 1.00 | 0.90 | 1.72 | 0.96 | âESTs, Moderately similar to |
| hypothetical protein FLJ20424 | |||||||
| [Homo sapiens] [H. sapiens]â | |||||||
| 40 | 1371171_at | M10094 | 1.00 | 0.76 | 6.16 | 0.89 | RT1 class Ib gene |
| 88 | 1371725_at | BM392410 | 1.00 | 0.56 | 1.01 | 0.95 | ESTs |
| 5 | 1368316_at | NM_019158 | 1.00 | 1.22 | 0.71 | 0.91 | aquaporin 8 |
| 89 | 1375084_at | BF419780 | 1.00 | 0.64 | 1.12 | 0.90 | ESTs |
| 85 | 1398272_at | NM_022860 | 1.00 | 0.66 | 0.99 | 0.90 | beta-4N- |
| acetylgalactosaminyltransferase | |||||||
| 81 | 1374721_at | AI178647 | 1.00 | 0.74 | 1.15 | 0.89 | ESTs |
| 90 | 1374398_at | AI178787 | 1.00 | 0.68 | 1.10 | 0.86 | âESTs, Highly similar to |
| suppressor of Ty 6 homolog | |||||||
| (S. cerevisiae) | |||||||
| [Mus musculus] [M. musculus]â | |||||||
| 91 | 1369999_a_at | NM_053601 | 1.00 | 0.68 | 0.95 | 0.84 | neuronatin |
| 6 | 1387658_at | U93849 | 1.00 | 1.61 | 0.43 | 0.83 | Eukaryotic elongation factor 2 |
| kinase | |||||||
| 129 | 1387349_at | NM_013028 | 1.00 | 0.56 | 0.76 | 0.81 | Short stature homeobox 2 |
| 94 | 1390347_at | AW535909 | 1.00 | 0.72 | 1.02 | 0.80 | ESTs |
| 100 | 1376944_at | AI407163 | 1.00 | 0.94 | 1.34 | 0.79 | ESTs |
| 96 | 1369052_at | NM_133323 | 1.00 | 0.90 | 1.29 | 0.79 | zinc finger protein 111 |
| 84 | 1376410_at | BI291814 | 1.00 | 0.66 | 0.93 | 0.76 | ESTs |
| 118 | 1389193_at | BM388083 | 1.00 | 0.60 | 0.83 | 0.76 | ESTs |
| 99 | 1376537_at | AW435010 | 1.00 | 0.81 | 1.06 | 0.75 | ESTs |
| 136 | 1374655_at | BG378095 | 1.00 | 0.57 | 0.90 | 0.75 | ESTs |
| 97 | 1375983_at | AI234287 | 1.00 | 0.77 | 1.21 | 0.74 | ESTs |
| 92 | 1392890_at | BG663460 | 1.00 | 0.59 | 1.24 | 0.74 | ESTs |
| 135 | 1369061_at | NM_053906 | 1.00 | 0.25 | 0.81 | 0.74 | glutathione reductase |
| 101 | 1376610_a_at | BE109163 | 1.00 | 0.77 | 1.60 | 0.74 | âESTs, Weakly similar to |
| G02540 nucleobindin - human | |||||||
| [H. sapiens]â | |||||||
| 103 | 1377823_at | AW531363 | 1.00 | 1.04 | 1.60 | 0.74 | ESTs |
| 82 | 1388116_at | BI285575 | 1.00 | 0.56 | 1.13 | 0.73 | âcollagen, type 1, alpha 1â |
| 121 | 1377070_at | BE098910 | 1.00 | 0.59 | 0.72 | 0.73 | âESTs, Moderately similar to |
| S3B2_HUMAN Splicing | |||||||
| factor 3B subunit 2 | |||||||
| (Spliceosome associated | |||||||
| protein 145) (SAP 145) | |||||||
| (SF3b150) (Pre-mRNA | |||||||
| splicing factor SF3b 145 kDa | |||||||
| subunit) [H. sapiens]â | |||||||
| 131 | 1369958_at | NM_022542 | 1.00 | 0.59 | 0.77 | 0.72 | rhoB gene |
| 130 | 1376288_at | AI408455 | 1.00 | 0.64 | 0.78 | 0.71 | ESTs |
| 132 | 1391078_at | BM391856 | 1.00 | 0.56 | 0.66 | 0.71 | âESTs, Moderately similar to |
| A56284 differentiation- | |||||||
| specific element binding | |||||||
| protein - mouse | |||||||
| [M. musculus]â | |||||||
| 113 | 1374593_at | AA799421 | 1.00 | 0.66 | 0.74 | 0.70 | âESTs, Highly similar to |
| KPCE_RAT PROTEIN | |||||||
| KINASE C, EPSILON TYPE | |||||||
| (NPKC-EPSILON) | |||||||
| [R. norvegicus]â | |||||||
| 112 | 1372158_at | BI295768 | 1.00 | 0.66 | 0.79 | 0.70 | LRP16 protein |
| 83 | 1370969_at | BE107303 | 1.00 | 0.58 | 1.05 | 0.69 | homeo box A5 |
| 93 | 1370583_s_at | AY082609 | 1.00 | 0.73 | 0.98 | 0.69 | P-glycoprotein/multidrug |
| resistance 1 | |||||||
| 98 | 1370139_a_at | AB051214 | 1.00 | 0.87 | 1.16 | 0.68 | zzN/A |
| 87 | 1389919_at | BI296756 | 1.00 | 0.60 | 0.97 | 0.67 | âESTs, Weakly similar to |
| actopaxin [Rattus norvegicus] | |||||||
| [R. norvegicus]â | |||||||
| 117 | 1368242_at | NM_013186 | 1.00 | 0.60 | 0.72 | 0.66 | âPotassium voltage gated |
| channel, Shab-related | |||||||
| subfamily, member 1â | |||||||
| 106 | 1379747_at | AA866443 | 1.00 | 0.83 | 0.97 | 0.66 | ESTs |
| 141 | 1390626_at | BF398788 | 1.00 | 0.66 | 1.04 | 0.66 | ESTs |
| 133 | 1369113_at | NM_019282 | 1.00 | 0.59 | 0.87 | 0.65 | âcysteine knot superfamily 1, |
| BMP antagonist 1â | |||||||
| 137 | 1376320_at | BF393051 | 1.00 | 0.75 | 1.08 | 0.65 | ESTs |
| 86 | 1387588_at | NM_138890 | 1.00 | 0.47 | 1.13 | 0.65 | zzN/A |
| 148 | 1399138_at | BG672805 | 1.00 | 0.71 | 0.87 | 0.65 | ESTs |
| 105 | 1398311_a_at | AF313464 | 1.00 | 0.92 | 1.13 | 0.64 | kinase D-interacting substance |
| of 220 kDa | |||||||
| 115 | 1375538_at | AI230737 | 1.00 | 0.66 | 0.82 | 0.63 | ESTs |
| 140 | 1376204_at | AW531412 | 1.00 | 0.71 | 0.94 | 0.63 | ESTs |
| 111 | 1390538_at | BF414192 | 1.00 | 0.64 | 0.80 | 0.63 | ESTs |
| 151 | 1374909_at | BI296626 | 1.00 | 0.69 | 0.90 | 0.62 | âESTs, Weakly similar to |
| Gasz [Rattus norvegicus] | |||||||
| [R. norvegicus]â | |||||||
| 146 | 1368769_at | NM_031760 | 1.00 | 0.82 | 1.01 | 0.62 | âATP-binding cassette, |
| subfamily B (MDR/TAP), | |||||||
| member 11â | |||||||
| 107 | 1387929_at | AB020504 | 1.00 | 0.76 | 0.82 | 0.61 | PMF32 protein |
| 149 | 1376464_at | BE102505 | 1.00 | 0.79 | 0.79 | 0.60 | ESTs |
| 110 | 1375705_at | AI103622 | 1.00 | 0.60 | 0.73 | 0.59 | Guanine nucleotide-binding |
| protein beta 1 | |||||||
| 128 | 1374084_at | BE119993 | 1.00 | 0.68 | 0.64 | 0.59 | ESTs |
| 123 | 1390722_at | AW531272 | 1.00 | 0.60 | 0.70 | 0.59 | ESTs |
| 122 | 1373008_x_at | BF386649 | 1.00 | 0.44 | 0.57 | 0.58 | reticulon 4 receptor |
| 139 | 1376939_at | BI284907 | 1.00 | 0.67 | 0.85 | 0.58 | ESTs |
| 119 | 1369059_at | NM_053705 | 1.00 | 0.55 | 0.78 | 0.58 | âtransient receptor potential- |
| related protein, ChaKâ | |||||||
| 126 | 1392500_at | AA957990 | 1.00 | 0.59 | 0.67 | 0.58 | ESTs |
| 152 | 1369048_at | NM_017289 | 1.00 | 0.71 | 0.64 | 0.56 | âgamma-aminobutyric acid A |
| receptor, deltaâ | |||||||
| 124 | 1375508_at | BE095963 | 1.00 | 0.50 | 0.61 | 0.56 | âESTs, Highly similar to |
| KIF2_MOUSE KINESIN- | |||||||
| LIKE PROTEIN KIF2 | |||||||
| [M. musculus]â | |||||||
| 142 | 1368429_at | NM_133615 | 1.00 | 0.60 | 0.81 | 0.56 | âTAF9-like RNA polymerase |
| II, TATA box binding protein | |||||||
| (TBP)-associated factor, 31 kDâ | |||||||
| 144 | 1373981_at | BI299720 | 1.00 | 0.62 | 0.60 | 0.55 | ESTs |
| 114 | 1369285_at | NM_031082 | 1.00 | 0.74 | 0.76 | 0.55 | geranylgeranyltransferase type |
| I (GGTase-I) | |||||||
| 108 | 1372804_at | AI175555 | 1.00 | 0.80 | 0.87 | 0.54 | âESTs, Highly similar to |
| hypothetical brain protein | |||||||
| similar to X96994 BR-1 | |||||||
| protein (Helix pomatia) | |||||||
| [Mus musculus] [M. musculus]â | |||||||
| 134 | 1386299_at | AI639471 | 1.00 | 0.50 | 0.86 | 0.53 | EST |
| 138 | 1377362_at | BF390409 | 1.00 | 0.43 | 0.81 | 0.51 | ESTs |
| 125 | 1387131_at | AF193015 | 1.00 | 0.44 | 0.55 | 0.50 | âserine (or cysteine) |
| proteinase inhibitor, clade I | |||||||
| (neuroserpin), member 1â | |||||||
| 147 | 1373778_at | BE349670 | 1.00 | 0.83 | 0.92 | 0.46 | ESTs |
| 145 | 1377030_at | BF390550 | 1.00 | 0.59 | 0.82 | 0.45 | ESTs |
| 143 | 1389436_at | AI236615 | 1.00 | 0.75 | 0.77 | 0.45 | ESTs |
| 116 | 1386181_at | AI639056 | 1.00 | 0.51 | 0.85 | 0.44 | EST |
| 150 | 1371042_at | BG664160 | 1.00 | 0.63 | 0.70 | 0.42 | mitogen-activated protein |
| kinase kinase kinase kinase 3 | |||||||
| 109 | 1387453_at | NM_024489 | 1.00 | 0.49 | 0.83 | 0.39 | zinc finger protein RIN ZF |
| 127 | 1390368_at | AI716535 | 1.00 | 0.40 | 0.46 | 0.34 | ESTs |
| 104 | 1372640_at | BI277758 | 1.00 | 0.85 | 1.80 | 0.33 | ESTs |
| 120 | 1369054_at | NM_133518 | 1.00 | 0.48 | 0.60 | 0.25 | rabphilin 3A |
The human homologs of some of the rat CVHGs are provided in Table 7.
| TABLE 7 |
| Human homologs of rat CVHGs |
| Nucleotide | Amino acid | ||
| Gene | Locus ID | sequence | sequence |
| desmin | 1674 | SEQ ID NO: 1 | SEQ ID NO: 34 |
| PEP-19 | 5121 | SEQ ID NO: 2 | SEQ ID NO: 35 |
| IGFBP2 | 3485 | SEQ ID NO: 3 | SEQ ID NO: 36 |
| ADAMTS1 | 9510 | SEQ ID NO: 4 | SEQ ID NO: 37 |
| ARGBP2 | 8470 | SEQ ID NO: 5 | SEQ ID NO: 38 |
| stathmin-like 2 | 11075 | SEQ ID NO: 6 | SEQ ID NO: 39 |
| myxovirus resistance 2 | 4600 | SEQ ID NO: 7 | SEQ ID NO: 40 |
| IRF7 | 3665 | SEQ ID NO: 8 | SEQ ID NO: 41 |
| GBP2 | 2634 | SEQ ID NO: 9 | SEQ ID NO: 42 |
| SLC28a2 | 9153 | SEQ ID NO: 10 | SEQ ID NO: 43 |
| BDNF | 627 | SEQ ID NO: 11 | SEQ ID NO: 44 |
| phosphodiesterase 3B | 5140 | SEQ ID NO: 12 | SEQ ID NO: 45 |
| TREK2 | 54207 | SEQ ID NO: 13 | SEQ ID NO: 46 |
| trkA | 4914 | SEQ ID NO: 14 | SEQ ID NO: 47 |
| IL1R1 | 3554 | SEQ ID NO: 15 | SEQ ID NO: 48 |
| EEF2k | 29904 | SEQ ID NO: 16 | SEQ ID NO: 49 |
| actin, gamma 2 | 72 | SEQ ID NO: 17 | SEQ ID NO: 50 |
| myosin heavy chain 11 | 4629 | SEQ ID NO: 18 | SEQ ID NO: 51 |
| MRCL3 | 10627 | SEQ ID NO: 19 | SEQ ID NO: 52 |
| MRLC2 | 103910 | SEQ ID NO: 20 | SEQ ID NO: 53 |
| Rho family GTPase 1 | 27289 | SEQ ID NO: 21 | SEQ ID NO: 54 |
| HSPB1 | 3315 | SEQ ID NO: 22 | SEQ ID NO: 55 |
| RIPK4 | 54101 | SEQ ID NO: 23 | SEQ ID NO: 56 |
| type I protein | 80316 | SEQ ID NO: 24 | SEQ ID NO: 57 |
| phosphatase inhibitor | |||
| transgelin | 6876 | SEQ ID NO: 25 | SEQ ID NO: 58 |
| beta 1 integrin | 3688 | SEQ ID NO: 26 | SEQ ID NO: 59 |
| Desmuslin | 23336 | SEQ ID NO: 27 | SEQ ID NO: 60 |
| C/EBP delta | 1052 | SEQ ID NO: 28 | SEQ ID NO: 61 |
| FBXL22 | 283807 | SEQ ID NO: 29 | SEQ ID NO: 62 |
| AF427491 | SEQ ID NO: 30 | SEQ ID NO: 63 | |
| cig5 | 91543 | SEQ ID NO: 31 | SEQ ID NO: 64 |
| SAMD9 | 54809 | SEQ ID NO: 32 | SEQ ID NO: 65 |
| IFI27 | 3429 | SEQ ID NO: 33 | SEQ ID NO: 66 |
In general, Table 3 and Table 5 provide CVHGs that are differentially expressed at in the CVH colon relative to controls. These genes may be a component in the disease mechanism and can be used as markers for diagnosing and monitoring CVH and CVH-related disorders. The CVHGs of Tables 3 and 5, as well as the corresponding CVHG products (CVHPN and CVHPP) may become novel therapeutic targets for the treatment and prevention of CVH and CVH-related disorders. Furthermore, the CVHG products themselves may be used for the treatment of CVH.
Accordingly, the present invention pertains to the use of the CVHGs listed in Tables 3 and 5, the transcribed polynucleotides (CVHPNs), and the encoded polypeptides (CVHPPs) as markers for CVH and CVH-related disorders. Moreover, the use of expression profiles of these genes can indicate the presence of or a risk of CVH and CVH-related disorders. These markers are further useful to correlate differences in levels of expression with a poor or favorable prognosis of CVH and CVH-related disorders. In particular, the present invention is directed to the use of CVHGs and panels of CVHGs set forth in Tables 3 and 5 or homologs thereof. For example, panels of the CVHGs can be conveniently arrayed on solid supports, i.e., biochips, such as the GeneChipÂź, for use in kits. The CVHGs can be used to assess the efficacy of a treatment or therapy of CVH and CVH-related disorders, or as a target for a treatment or therapeutic agent. The CVHGs can also be used to produce antibodies specific to CVHG products, and to construct gene therapy vectors that inhibit the development of CVH and CVH-related disorders. Therefore, without limitation as to mechanism, the invention is based in part on the principle that modulation of the expression of the CVHGs of the invention may ameliorate CVH and CVH-related disorders when they are expressed at levels similar or substantially similar to normal (non-diseased) tissue.
In one aspect, the invention provides CVHGs whose level of expression, which signifies their quantity or activity, is correlated with the presence of CVH and CVH-related disorders. In certain preferred embodiments, the invention is performed by detecting the presence of an CVHPN or a CVHPP.
In another aspect of the invention, the expression levels of the CVHGs are determined in a particular subject sample for which either diagnosis or prognosis information is desired. The level of expression of a number of CVHGs simultaneously provides an expression profile, which is essentially a âfingerprintâ of the presence or activity of an CVHG or plurality of CVHGs that is unique to the state of the cell. In certain embodiments, comparison of relative levels of expression is indicative of the severity of CVH and CVH-related disorders, and as such permits for diagnostic and prognostic analysis. Moreover, by comparing relative expression profiles of CVHGs from tissue samples taken at different points in time, e.g., pre- and post-therapy and/or at different time points within a course of therapy, information regarding which genes are important in each of these stages is obtained. The identification of genes that are abnormally expressed in CVH versus normal tissue, as well as differentially expressed genes during CVH development, allows the use of this invention in a number of ways. For example, comparison of expression profiles of CVHGs at different stages of the disease progression provides a method for long-term prognosis. In another example mentioned above, the efficacy of a particular treatment regime may be evaluated, including whether a particular drug will act to improve the long-term prognosis in a particular patient.
Similarly, CVHGs listed in Tables 4, 6 and 7 can also be used as targets of CVH treatment and as markers to monitor the efficacy of CVH treatment. The gene products from CVHGs of Tables 4, 6 and 7 may also be used in the treatment of CVH and CVH-related disorders.
The discovery of these differential expression patterns for individual or panels of CVHGs allows for screening test compounds with the goal of modulating a particular expression pattern. For example, screening can be done for compounds that will convert an expression profile for a poor prognosis to one for a better prognosis. In certain embodiments, this may be done by making biochips comprising sets of the significant CVHGs, which can then be used in these screens. These methods can also be done on the protein level; that is, protein expression levels of the CVHGs can be evaluated for diagnostic and prognostic purposes or to screen test compounds. For example, in relation to these embodiments, significant CVHGs may comprise CVHGs which are determined to have modulated activity or expression in response to a therapy regime. Alternatively, the modulation of the activity or expression of a CVHG may be correlated with the diagnosis or prognosis of CVH and CVH-related disorders.
In addition, the CVHGs listed in Tables 3-8 can be administered for gene therapy purposes, including the administration of antisense nucleic acids and RNAi. The CVHG products (including CVHPPs and CVHPNs) and modulator of CVHG products (such as anti-CVHPP antibodies) can also be administered as therapeutic drugs.
For example, the CVHG desmin has significantly increased expression in CVH tissue samples, relative to control tissue samples. The presence of increased mRNA for this gene (or any other CVHGs set forth in Tables 3 and 5), and increased levels of the protein products of this gene (or any other CVHGs set forth in Tables 3 and 5) serve as markers for CVH. Accordingly, amelioration of CVH can be achieved by modulating up-regulated CVH markers, such as desmin, to normal levels.
In another embodiment of the invention, a product of CVHG, either in the form of a polynucleotide or a polypeptide, can be used as a therapeutic compound of the invention. In yet other embodiments, a modulator of CVHG expression or the activity of an CVHG product may be used as a therapeutic compound of the invention, or may be used in combination with one or more other therapeutic compositions of the invention. Formulation of such compounds into pharmaceutical compositions is described in subsections below. Administration of such a therapeutic may suppress bioactivity of CVHG product, and therefore may be used to ameliorate CVH.
The CVHG products (CVHPNs and CVHPPs) of the invention may be isolated from any tissue or cell of a subject. It will be apparent to one skilled in the art that bodily fluids, such as blood or feces, may also serve as sources from which the CVHG product of the invention may be assessed. A biological sample of the invention is obtained as a blood sample, a urine or feces sample, a colon biopsy sample. A biological sample may comprise biological components such as blood plasma, serum, erythrocytes, leukocytes, blood platelets, lymphocytes, macrophages, fibroblast cells, mast cells, fat cells, neuronal cells, epithelial cells and the like. The tissue samples containing one or more of the CVHG product themselves may be useful in the methods of the invention, and one skilled in the art will be cognizant of the methods by which such samples may be conveniently obtained, stored and/or preserved.
One aspect of the invention pertains to isolated polynucleotides. Another aspect of the invention pertains to isolated polynucleotide fragments sufficient for use as hybridization probes to identify a CVHPN in a sample, as well as nucleotide fragments for use as PCR probes/primers of the amplification or mutation of the nucleic acid molecules which encode the CVHPP of the invention.
A CVHPN molecule of the present invention, e.g., a polynucleotide molecule having the nucleotide sequence of one of the CVHGs listed in Tables 3-8, or homologs thereof, or a portion thereof, can be isolated using standard molecular biology techniques and the sequence information provided herein, as well as sequence information known in the art. Using all or a portion of the polynucleotide sequence of one of the CVHGs listed Tables 3-8 (or a homolog thereof) as a hybridization probe, a CVHG of the invention or a CVHPN of the invention can be isolated using standard hybridization and cloning techniques.
A CVHPN of the invention can be amplified using cDNA, mRNA or alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. The polynucleotide so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis. Furthermore, oligonucleotides corresponding to CVHG nucleotide sequences of the invention can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.
Alternatively, there are numerous amplification techniques for obtaining a full length coding sequence from a partial cDNA sequence. Within such techniques, amplification is generally performed via PCR. Any of a variety of commercially available kits may be used to perform the amplification step. Primers may be designed using, for example, software well known in the art. Primers are preferably 22-30 nucleotides in length, have a GC content of at least 50% and anneal to the target sequence at temperatures of about 68° C. to 72° C. The amplified region may be sequenced as described above, and overlapping sequences assembled into a contiguous sequence.
One such amplification technique is inverse PCR, which uses restriction enzymes to generate a fragment in the known region of the gene. The fragment is then circularized by intramolecular ligation and used as a template for PCR with divergent primers derived from the known region. Within an alternative approach, sequences adjacent to a partial sequence may be retrieved by amplification with a primer to a linker sequence and a primer specific to a known region. The amplified sequences are typically subjected to a second round of amplification with the same linker primer and a second primer specific to the known region. A variation on this procedure, which employs two primers that initiate extension in opposite directions from the known sequence, is described in WO 96/38591.
Another such technique is known as ârapid amplification of cDNA endsâ or RACE. This technique involves the use of an internal primer and an external primer, which hybridizes to a polyA region or vector sequence, to identify sequences that are 5âČ and 3âČ of a known sequence. Additional techniques include capture PCR (Lagerstrom et al., PCR Methods Applic. 1:11-19, 1991) and walking PCR (Parker et al., Nucl. Acids. Res. 19:3055-60, 1991). Other methods employing amplification may also be employed to obtain a full length cDNA sequence.
In certain instances, it is possible to obtain a full length cDNA sequence by analysis of sequences provided in an expressed sequence tag (EST) database, such as that available from GenBank. Searches for overlapping ESTs may generally be performed using well known programs (e.g., NCBI BLAST searches), and such ESTs may be used to generate a contiguous full length sequence. Full length DNA sequences may also be obtained by analysis of genomic fragments.
In another preferred embodiment, an isolated polynucleotide molecule of the invention comprises a polynucleotide molecule which is a complement of the nucleotide sequence of a CVHG listed in Tables 3-8, or homolog thereof, a CVHPN of the invention, or a portion of any of these nucleotide sequences. A polynucleotide molecule which is complementary to such a nucleotide sequence is one which is sufficiently complementary to the nucleotide sequence such that it can hybridize to the nucleotide sequence, thereby forming a stable duplex.
The polynucleotide molecule of the invention, moreover, can comprise only a portion of the polynucleotide sequence of a CVHG, for example, a fragment which can be used as a probe or primer. The probe/primer typically comprises a substantially purified oligonucleotide. The oligonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 7 or 15, preferably about 25, more preferably about 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 400 or more consecutive nucleotides of a CVHG or a CVHPN of the invention.
Probes based on the nucleotide sequence of anCVHG or anCVHPN of the invention can be used to detect transcripts or genomic sequences corresponding to the CVHG or CVHPN of the invention. In preferred embodiments, the probe comprises a label group attached thereto, e.g., the label group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor. Such probes can be used as a part of a diagnostic kit for identifying cells or tissue which misexpress (e.g., over- or under-express) a CVHG, or which have greater or fewer copies of an CVHG. For example, a level of a CVHG product in a sample of cells from a subject may be determined, or the presence of mutations or deletions of a CVHG of the invention may be assessed.
The invention further encompasses polynucleotide molecules that differ from the polynucleotide sequences of the CVHGs listed in Tables 3-8 but encode the same proteins as those encoded by the genes shown in Tables 3-8 due to degeneracy of the genetic code.
The invention also specifically encompasses homologs of the CVHGs listed in Tables 3-8 of other species. Gene homologs are well understood in the art and are available using databases or search engines such as the Pubmed-Entrez database.
The invention also encompasses polynucleotide molecules which are structurally different from the molecules described above (i.e., which have a slight altered sequence), but which have substantially the same properties as the molecules above (e.g., encoded amino acid sequences, or which are changed only in non-essential amino acid residues). Such molecules include allelic variants, and are described in greater detail in subsections herein.
In addition to the nucleotide sequences of the CVHGs listed in Tables 3-8, it will be appreciated by those skilled in the art that DNA sequence polymorphisms that lead to changes in the amino acid sequences of the proteins encoded by the CVHGs listed in Tables 3-8 may exist within a population (e.g., the human population). Such genetic polymorphism in the CVHGs listed in Tables 3-8 may exist among individuals within a population due to natural allelic variation. An allele is one of a group of genes which occur alternatively at a given genetic locus. In addition it will be appreciated that DNA polymorphisms that affect RNA expression levels can also exist that may affect the overall expression level of that gene (e.g., by affecting regulation or degradation). As used herein, the phrase âallelic variantâ includes a nucleotide sequence which occurs at a given locus or to a polypeptide encoded by the nucleotide sequence.
Polynucleotide molecules corresponding to natural allelic variants and homologs of the CVHGs can be isolated based on their homology to the CVHGs listed in Tables 3-8, using the cDNAs disclosed herein, or a portion thereof, as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions. Polynucleotide molecules corresponding to natural allelic variants and homologs of the CVHGs of the invention can further be isolated by mapping to the same chromosome or locus as the CVHGs of the invention.
In another embodiment, an isolated polynucleotide molecule of the invention is at least 15, 20, 25, 30, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000 or more nucleotides in length and hybridizes under stringent conditions to a polynucleotide molecule corresponding to a nucleotide sequence of an CVHG of the invention. Preferably, the isolated polynucleotide molecule of the invention hybridizes under stringent conditions to the sequence of one of the CVHGs set forth in Tables 3-8, or corresponds to a naturally-occurring polynucleotide molecule.
In addition to naturally-occurring allelic variants of the CVHG of the invention that may exist in the population, the skilled artisan will further appreciate that changes can be introduced by mutation into the nucleotide sequences of the CVHGs of the invention, thereby leading to changes in the amino acid sequence of the encoded proteins, without altering the functional activity of these proteins. For example, nucleotide substitutions leading to amino acid substitutions at ânon-essentialâ amino acid residues can be made. A ânon-essentialâ amino acid residue is a residue that can be altered from the wild-type sequence of a protein without altering the biological activity, whereas an âessentialâ amino acid residue is required for biological activity. For example, amino acid residues that are conserved among allelic variants or homologs of a gene (e.g., among homologs of a gene from different species) are predicted to be particularly unamenable to alteration.
In yet other aspects of the invention, polynucleotides of a CVHG may comprise one or more mutations. An isolated polynucleotide molecule encoding a protein with a mutation in a CVHPP of the invention can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of the gene encoding the CVHPP, such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Such techniques are well known in the art. Mutations can be introduced into the CVHG of the invention by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted non-essential amino acid residues. Alternatively, mutations can be introduced randomly along all or part of a coding sequence of a CVHG of the invention, such as by saturation mutagenesis, and the resultant mutants can be screened for biological activity to identify mutants that retain activity. Following mutagenesis, the encoded protein can be expressed recombinantly and the activity of the protein can be determined.
A polynucleotide may be further modified to increase stability in vivo. Possible modifications include, but are not limited to, the addition of flanking sequences at the 5âČ and/or 3âČ ends; the use of phosphorothioate or 2 O-methyl rather than phosphodiesterase linkages in the backbone; and/or the inclusion of nontraditional bases such as inosine, queosine and wybutosine, as well as acetyl- methyl-, thio- and other modified forms of adenine, cytidine, guanine, thymine and uridine.
Another aspect of the invention pertains to isolated polynucleotide molecules, which are antisense to the CVHGs of the invention. An âantisenseâ polynucleotide comprises a nucleotide sequence which is complementary to a âsenseâ polynucleotide encoding a protein, e.g., complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence. Accordingly, an antisense polynucleotide can hydrogen bond to a sense polynucleotide. The antisense polynucleotide can be complementary to an entire coding strand of a gene of the invention or to only a portion thereof. In one embodiment, an antisense polynucleotide molecule is antisense to a âcoding regionâ of the coding strand of a nucleotide sequence of the invention. The term âcoding regionâ includes the region of the nucleotide sequence comprising codons which are translated into amino acids. In another embodiment, the antisense polynucleotide molecule is antisense to a ânoncoding regionâ of the coding strand of a nucleotide sequence of the invention.
Antisense polynucleotides of the invention can be designed according to the rules of Watson and Crick base pairing. The antisense polynucleotide molecule can be complementary to the entire coding region of an mRNA corresponding to a gene of the invention, but more preferably is an oligonucleotide which is antisense to only a portion of the coding or noncoding region. An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length. An antisense polynucleotide of the invention can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, an antisense polynucleotide can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense polynucleotides, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used. Examples of modified nucleotides which can be used to generate the antisense polynucleotide include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5âČ-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenosine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the antisense polynucleotide can be produced biologically using an expression vector into which a polynucleotide has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted polynucleotide will be of an antisense orientation to a target polynucleotide of interest, described further in the following subsection).
The antisense polynucleotide molecules of the invention are typically administered to a subject or generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding a CVHPP of the invention to thereby inhibit expression of the protein, e.g., by inhibiting transcription and/or translation. The hybridization can be by conventional nucleotide complementarity to form a stable duplex or, for example, in the cases of an antisense polynucleotide molecule which binds to DNA duplexes, through specific interactions in the major groove of the double helix. An example of a route of administration of antisense polynucleotide molecules of the invention include direct injection at a tissue site. Alternatively, antisense polynucleotide molecules can be modified to target selected cells and then administered systemically. For example, for systemic administration, antisense molecules can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface, e.g., by linking the antisense polynucleotide molecules to peptides or antibodies which bind to cell surface receptors or antigens. The antisense polynucleotide molecules can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of the antisense molecules, vector constructs comprising the antisense polynucleotide molecules are preferably placed under the control of a strong promoter.
In yet another embodiment, the antisense polynucleotide molecule of the invention is an α-anomeric polynucleotide molecule. An α-anomeric polynucleotide molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual ÎČ-units, the strands run parallel to each other. The antisense polynucleotide molecule can also comprise a 2âČ-o-methylribonucleotide or a chimeric RNA-DNA analogue.
In still another embodiment, an antisense polynucleotide of the invention is a ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded polynucleotide, such as an mRNA, to which they have a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes) can be used to catalytically cleave mRNA transcripts of the CVHGs of the invention to thereby inhibit translation of the mRNA. A ribozyme having specificity for a CVHPN can be designed based upon the nucleotide sequence of the CVHPN. For example, a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a CVHG mRNA. Alternatively, mRNA transcribed from a CVHG can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. Alternatively, expression of a CVHG of the invention can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the CVHG (e.g., the promoter and/or enhancers) to form triple helical structures that prevent transcription of the gene in target cells.
Expression of the CVHGs of the invention can also be inhibited using RNA interference (âRNAiâ). This is a technique for post-transcriptional gene silencing (âPTGSâ), in which target gene activity is specifically abolished with cognate double-stranded RNA (âdsRNAâ). RNAi resembles in many aspects PTGS in plants and has been detected in many invertebrates including the trypanosome, hydra, planaria, nematode and fruit fly (Drosophila melanogaster). It may be involved in the modulation of transposable element mobilization and antiviral state formation. RNAi technology is disclosed, for example, in U.S. Pat. No. 5,919,619 and PCT Publication Nos. WO99/14346 and WO01/29058. Basically, dsRNA of about 21 nucleotides, homologous to the target gene, is introduced into the cell and a sequence specific reduction in gene activity is observed.
In yet another embodiment, the polynucleotide molecules of the present invention can be modified at the base moiety, sugar moiety or phosphate backbone to improve the stability, hybridization, or solubility of the molecule. For example, the deoxyribose phosphate backbone of the polynucleotide molecules can be modified to generate peptide polynucleotides. As used herein, the terms âpeptide polynucleotidesâ or âPNAsâ refer to polynucleotide mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols.
PNAs can be used in therapeutic and diagnostic applications. For example, PNAs can be used as antisense agents for sequence-specific modulation of CVHG expression by, for example, inducing transcription or translation arrest or inhibiting replication. PNAs of the polynucleotide molecules of the invention can be used in the analysis of single base pair mutations in a gene, (e.g., by PNA-directed PCR clamping). They may also serve as artificial restriction enzymes when used in combination with other enzymes (e.g., S1 nucleases) or as probes or primers for DNA sequencing or hybridization.
In another embodiment, PNAs can be modified, (e.g., to enhance their stability or cellular uptake), by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art. For example, PNA-DNA chimeras of the polynucleotide molecules of the invention can be generated which may combine the advantageous properties of PNA and DNA. Such chimeras allow DNA recognition enzymes, (e.g., DNA polymerases), to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity. PNA-DNA chimeras can be linked using linkers of appropriate lengths selected in terms of base stacking, number of bonds between the nucleobases, and orientation. The synthesis of PNA-DNA chimeras can be performed. For example, a DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry. Modified nucleoside analogs, such as 5âČ-(4-methoxytrityl)amino-5âČ-deoxy-thymidine phosphoramidite, can be used as a spacer between the PNA and the 5âČ end of DNA. PNA monomers are then coupled in a stepwise manner to produce a chimeric molecule with a 5âČ PNA segment and a 3âČ DNA segment. Alternatively, chimeric molecules can be synthesized with a 5âČ DNA segment and a 3âČ PNA segment.
In other embodiments, the oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane or the blood-kidney barrier (see, e.g. PCT Publication No. W089/10134). In addition, oligonucleotides can be modified with hybridization-triggered cleavage agents or intercalating agents. To this end, the oligonucleotide may be conjugated to another molecule (e.g., a peptide, hybridization triggered cross-linking agent, transport agent, or hybridization-triggered cleavage agent). Finally, the oligonucleotide may be detectably labeled, either such that the label is detected by the addition of another reagent (e.g., a substrate for an enzymatic label), or is detectable immediately upon hybridization of the nucleotide (e.g., a radioactive label or a fluorescent label).
Several aspects of the invention pertain to isolated CVHPPs, and biologically active portions thereof, as well as polypeptide fragments suitable for use as immunogens to raise anti-CVHPP antibodies. In one embodiment, native CVHPPs can be isolated from cells or tissue sources by an appropriate purification scheme using standard protein purification techniques. Standard purification methods include electrophoretic, molecular, immunological and chromatographic techniques, including ion exchange, hydrophobic, affinity, and reverse-phase HPLC chromatography, and chromatofocusing. For example, a CVHPP may be purified using a standard anti-CVHPP antibody column. Ultrafiltration and diafiltration techniques, in conjunction with protein concentration, are also useful. The degree of purification necessary will vary depending on the use of the CVHPP. In some instances no purification will be necessary.
In another embodiment, CVHPPs or mutated CVHPPs are produced by recombinant DNA techniques. Alternative to recombinant expression, a CVHPP or mutated CVHPP can be synthesized chemically using standard peptide synthesis techniques.
The invention also provides variants of CVHPPs. The variant of a CVHPP is substantially homologous to the native CVHPP encoded by an CVHG listed in Table 4, and retains the functional activity of the native CVHPP, yet differs in amino acid sequence due to natural allelic variation or mutagenesis, as described in detail above. Accordingly, in another embodiment, the variant of a CVHPP is a protein which comprises an amino acid sequence at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more homologous to the amino acid sequence of the original CVHPP.
In a non-limiting example, as used herein, proteins are referred to as âhomologsâ and âhomologousâ where a first protein region and a second protein region are compared in terms of identity. To determine the percent identity of two amino acid sequences or of two polynucleotide sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or polynucleotide sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In a preferred embodiment, the length of a reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and even more preferably at least 70%, 80%, or 90% of the length of the reference sequence. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleotide âidentityâ is equivalent to amino acid or nucleotide âhomologyâ). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In a preferred embodiment, the percent identity between two amino acid sequences is determined using the Needleman and Wunsch (J. Mol. Biol. 48:444-453, 1970) algorithm which has been incorporated into the GAP program in the GCG software package, using either a Blossom 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. In yet another preferred embodiment, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package, using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6.
The polynucleotide and protein sequences of the present invention can further be used as a âquery sequenceâ to perform a search against public databases to, for example, identify other family members or related sequences. Such searches can be performed using BLAST programs available at the BLAST website maintained by the National Center of biotechnology Information (NCBI), National Library of Medicine, Washington D.C. USA.
The invention also provides chimeric or fusion CVHPPs. Within a fusion CVHPP the polypeptide can correspond to all or a portion of a CVHPP. In a preferred embodiment, a fusion CVHPP comprises at least one biologically active portion of a CVHPP. Within the fusion protein, the term âoperatively linkedâ is intended to indicate that the CVHPP-related polypeptide and the non-CVHPP-related polypeptide are fused in-frame to each other. The non-CVHPP-related polypeptide can be fused to the N-terminus or C-terminus of the CVHPP-related polypeptide.
A peptide linker sequence may be employed to separate the CVHPP-related polypeptide from non-CVHPP-related polypeptide components by a distance sufficient to ensure that each polypeptide folds into its secondary and tertiary structures. Such a peptide linker sequence is incorporated into the fusion protein using standard techniques well known in the art. Suitable peptide linker sequences may be chosen based on the following factors: (1) their ability to adopt a flexible extended conformation; (2) their inability to adopt a secondary structure that could interact with functional epitopes on the CVHPP-related polypeptide and non-CVHPP-related polypeptide; and (3) the lack of hydrophobic or charged residues that might react with the polypeptide functional epitopes. Preferred peptide linker sequences contain gly, asn and ser residues. Other near neutral amino acids, such as thr and ala may also be used in the linker sequence. Amino acid sequences which may be used as linkers are well known in the art. The linker sequence may generally be from 1 to about 50 amino acids in length. Linker sequences are not required when the CVHPP-related polypeptide and non-CVHPP-related polypeptide have non-essential N-terminal amino acid regions that can be used to separate the functional domains and prevent steric interference.
For example, in one embodiment, the fusion protein is a glutathione S-transferase (GST)-CVHPP fusion protein in which the CVHPP sequences are fused to the C-terminus of the GST sequences. Such fusion proteins can facilitate the purification of recombinant CVHPPs.
The CVHPP-fusion proteins of the invention can be incorporated into pharmaceutical compositions and administered to a subject in vivo, as described herein. The CVHPP-fusion proteins can be used to affect the bioavailability of a CVHPP substrate. CVHPP-fusion proteins may be useful therapeutically for the treatment of, or prevention of, damages caused by, for example, (i) aberrant modification or mutation of a CVHG; (ii) mis-regulation of a CVHG; and (iii) aberrant post-translational modification of a CVHPP.
Moreover, the CVHPP-fusion proteins of the invention can be used as immunogens to produce anti-CVHPP antibodies in a subject, to purify CVHPP ligands, and to identify molecules which inhibit the interaction of a CVHPP with a CVHPP substrate in screening assays.
Preferably, a CVHPP-chimeric or fusion protein of the invention is produced by standard recombinant DNA techniques. For example, DNA fragments coding for the different polypeptide sequences are ligated together in-frame in accordance with conventional techniques. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence. Moreover, many expression vectors are commercially available that already encode a fusion moiety (e.g., a GST polypeptide). A CVHPP-encoding polynucleotide can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the CVHPP.
A signal sequence can be used to facilitate secretion and isolation of the secreted protein or other proteins of interest. Signal sequences are typically characterized by a core of hydrophobic amino acids which are generally cleaved from the mature protein during secretion in one or more cleavage events. Such signal peptides contain processing sites that allow cleavage of the signal sequence from the mature proteins as they pass through the secretory pathway. Thus, the invention pertains to the described polypeptides having a signal sequence, as well as to polypeptides from which the signal sequence has been proteolytically cleaved (i.e., the cleavage products). In one embodiment, a polynucleotide sequence encoding a signal sequence can be operably linked in an expression vector to a protein of interest, such as a protein which is ordinarily not secreted or is otherwise difficult to isolate. The signal sequence directs secretion of the protein, such as from a eukaryotic host into which the expression vector is transformed, and the signal sequence is subsequently or concurrently cleaved. The protein can then be readily purified from the extracellular medium by art recognized methods. Alternatively, the signal sequence can be linked to the protein of interest using a sequence which facilitates purification, such as with a GST domain.
The present invention also pertains to variants of the CVHPPs of the invention which function as either agonists or as antagonists to the CVHPPs. In one embodiment, antagonists or agonists of CVHPPs are used as therapeutic agents. For example, antagonists of an up-regulated CVHG that can decrease the activity or expression of such a gene and therefore ameliorate CVH in a subject wherein the CVHG is abnormally increased in level or activity. In this embodiment, treatment of such a subject may comprise administering an antagonist wherein the antagonist provides decreased activity or expression of the targeted CVHG.
In certain embodiments, an agonist of the CVHPPs can retain substantially the same, or a subset, of the biological activities of the naturally occurring form of a CVHPP or may enhance an activity of a CVHPP. In certain embodiments, an antagonist of a CVHPP can inhibit one or more of the activities of the naturally occurring form of the CVHPP by, for example, competitively modulating an activity of a CVHPP. Thus, specific biological effects can be elicited by treatment with a variant of limited function. In one embodiment, treatment of a subject with a variant having a subset of the biological activities of the naturally occurring forth of the protein has fewer side effects in a subject relative to treatment with the naturally occurring form of the CVHPP.
Mutants of a CVHPP which function as either CVHPP agonists or as CVHPP antagonists can be identified by screening combinatorial libraries of mutants, e.g., truncation mutants, of a CVHPP for CVHPP agonist or antagonist activity. In certain embodiments, such mutants may be used, for example, as a therapeutic protein of the invention. A diverse library of CVHPP mutants can be produced by, for example, enzymatically ligating a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential CVHPP sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g., for phage display) containing the set of CVHPP sequences therein. There are a variety of methods which can be used to produce libraries of potential CVHPP variants from a degenerate oligonucleotide sequence. Chemical synthesis of a degenerate gene sequence can be performed in an automatic DNA synthesizer, and the synthetic gene is then ligated into an appropriate expression vector. Use of a degenerate set of genes allows for the provision, in one mixture, of all of the sequences encoding the desired set of potential CVHPP sequences. Methods for synthesizing degenerate oligonucleotides are known in the art.
In addition, libraries of fragments of a protein coding sequence corresponding to a CVHPP of the invention can be used to generate a diverse or heterogenous population of CVHPP fragments for screening and subsequent selection of variants of a CVHPP. In one embodiment, a library of coding sequence fragments can be generated by treating a double-stranded PCR fragment of a CVHPP coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double-stranded DNA, renaturing the DNA to form double-stranded DNA which can include sense/antisense pairs from different nicked products, removing single-stranded portions from reformed duplexes by treatment with S1 nuclease, and ligating the resulting fragment library into an expression vector. By this method, an expression library can be derived which encodes N-terminal, C-terminal and internal fragments of various sizes of the CVHPP.
Several techniques are known in the art for screening gene products of combinatorial libraries made by point mutations or truncation, and for screening cDNA libraries for gene products having a selected property. The most widely used techniques, which are amenable to high-throughput analysis, for screening large gene libraries typically include cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates isolation of the vector encoding the gene whose product was detected. Recursive ensemble mutagenesis (REM), a technique which enhances the frequency of functional mutants in the libraries, can be used in combination with the screening assays to identify CVHPP variants (Delgrave et al. Protein Engineering 6:327-331, 1993).
Portions of a CVHPP or variants of a CVHPP having less than about 100 amino acids, and generally less than about 50 amino acids, may also be generated by synthetic means, using techniques well known to those of ordinary skill in the art. For example, such polypeptides may be synthesized using any of the commercially available solid-phase techniques, such as the Merrifield solid-phase synthesis method, where amino acids are sequentially added to a growing amino acid chain. Equipment for automated synthesis of polypeptides is commercially available from suppliers such as Perkin Elmer/Applied BioSystems Division (Foster City, Calif.), and may be operated according to the manufacturer's instructions.
Methods and compositions for screening for protein inhibitors or activators are known in the art (see U.S. Pat. Nos. 4,980,281, 5,266,464, 5,688,635, and 5,877,007, which are incorporated herein by reference).
It is contemplated in the present invention that CVHPPs are cleaved into fragments for use in further structural or functional analysis, or in the generation of reagents such as CVHPP and CVHPP-specific antibodies. This can be accomplished by treating purified or unpurified polypeptide with a proteolytic enzyme (i.e., a proteinase) including, but not limited to, serine proteinases (e.g., chymotrypsin, trypsin, plasmin, elastase, thrombin, substilin) metal proteinases (e.g., carboxypeptidase A, carboxypeptidase B, leucine aminopeptidase, thermolysin, collagenase), thiol proteinases (e.g., papain, bromelain, Streptococcal proteinase, clostripain) and/or acid proteinases (e.g., pepsin, gastricsin, trypsinogen). Polypeptide fragments are also generated using chemical means such as treatment of the polypeptide with cyanogen bromide (CNBr), 2-nitro-5-thiocyanobenzoic acid, isobenzoic acid, BNPA-skatole, hydroxylamine or a dilute acid solution. Recombinant techniques are also used to produce specific fragments of a CVHPP.
In addition, the invention also contemplates that compounds sterically similar to a particular CVHPP may be formulated to mimic the key portions of the peptide structure, called peptidomimetics or peptide mimetics. Mimetics are peptide-containing molecules which mimic elements of polypeptide secondary structure. See, for example, U.S. Pat. No. 5,817,879 (incorporated by reference hereinafter in its entirety). The underlying rationale behind the use of peptide mimetics is that the peptide backbone of polypeptides exists chiefly to orient amino acid side chains in such a way as to facilitate molecular interactions, such as those of receptor and ligand. Recently, peptide and glycoprotein mimetic antigens have been described which elicit protective antibody to Neisseria meningitidis serogroup B, thereby demonstrating the utility of mimetic applications (Moe et al., Int. Rev. Immunol. 20:201-20, 2001; Berezin et al., J Mol Neurosci. 22:33-39, 2004). Successful applications of the peptide mimetic concept have thus far focused on mimetics of ÎČ-turns within polypeptides. Likely ÎČ-turn structures within a CVHPP can be predicted by computer-based algorithms. For example, U.S. Pat. No. 5,933,819, incorporated by reference hereinafter in its entirety, describes a neural network based method and system for identifying relative peptide binding motifs from limited experimental data. In particular, an artificial neural network (ANN) is trained with peptides with known sequence and function (i.e., binding strength) identified from a phage display library. The ANN is then challenged with unknown peptides, and predicts relative binding motifs. Analysis of the unknown peptides validate the predictive capability of the ANN. Once the component amino acids of the turn are determined, mimetics can be constructed to achieve a similar spatial orientation of the essential elements of the amino acid side chains, as discussed in U.S. Pat. No. 6,420,119 and U.S. Pat. No. 5,817,879, and in Kyte and Doolittle, J. Mol. Biol., 157:105-132, 1982; Moe and Granoff, Int. Rev. Immunol., 20(2):201-20, 2001; Granoff et al., J. Immunol., 167(11):6487-96, 2001 (each incorporated by reference hereinafter in its entirety).
In another aspect, the invention includes antibodies that are specific to CVHPPs of the invention or their variants. Preferably the antibodies are monoclonal, and most preferably, the antibodies are humanized, as per the description of antibodies described below.
An isolated CVHPP, or a portion or fragment thereof, can be used as an immunogen to generate antibodies that bind the CVHPP using standard techniques for polyclonal and monoclonal antibody preparation. A full-length CVHPP can be used or, alternatively, the invention provides antigenic peptide fragments of the CVHPP for use as immunogens. The antigenic peptide of a CVHPP comprises at least 8 amino acid residues of an amino acid sequence encoded by an CVHG set forth in Tables 3-8 or an homolog thereof, and encompasses an epitope of a CVHPP such that an antibody raised against the peptide forms a specific immune complex with the CVHPP. Preferably, the antigenic peptide comprises at least 8 amino acid residues, more preferably at least 12 amino acid residues, even more preferably at least 16 amino acid residues, and most preferably at least 20 amino acid residues.
Immunogenic portions (epitopes) may generally be identified using well known techniques. Such techniques include screening polypeptides for the ability to react with antigen-specific antibodies, antisera and/or T-cell lines or clones. As used herein, antisera and antibodies are âantigen-specificâ if they bind to an antigen with a binding affinity equal to, or greater than 105 Mâ1. Such antisera and antibodies may be prepared as described herein, and using well known techniques. An epitope of a CVHPP is a portion that reacts with such antisera and/or T-cells at a level that is not substantially less than the reactivity of the full length polypeptide (e.g., in an ELISA and/or T-cell reactivity assay). Such epitopes may react within such assays at a level that is similar to or greater than the reactivity of the full length polypeptide. Such screens may generally be performed using methods well known to those of ordinary skill in the art. For example, a polypeptide may be immobilized on a solid support and contacted with patient sera to allow binding of antibodies within the sera to the immobilized polypeptide. Unbound sera may then be removed and bound antibodies detected using, for example, 125I-labeled Protein A.
Preferred epitopes encompassed by the antigenic peptide are regions of the CVHPP that are located on the surface of the protein, e.g., hydrophilic regions, as well as regions with high antigenicity.
A CVHPP immunogen typically is used to prepare antibodies by immunizing a suitable subject, (e.g., rabbit, goat, mouse or other mammal) with the immunogen. An appropriate immunogenic preparation can contain, for example, recombinantly expressed CVHPP or a chemically synthesized CVHPP. The preparation can further include an adjuvant, such as Freund's complete or incomplete adjuvant, or a similar immunostimulatory agent. Immunization of a suitable subject with an immunogenic CVHPP preparation induces a polyclonal anti-CVHPP antibody response. Techniques for preparing, isolating and using antibodies are well known in the art.
Accordingly, another aspect of the invention pertains to monoclonal or polyclonal anti-CVHPP antibodies and immunologically active portions of the antibody molecules, including F(ab) and F(abâČ)2 fragments which can be generated by treating the antibody with an enzyme such as pepsin.
Polyclonal anti-CVHPP antibodies can be prepared as described above by immunizing a suitable subject with a CVHPP. The anti-CVHPP antibody titer in the immunized subject can be monitored over time by standard techniques, such as with an enzyme linked immunosorbent assay (ELISA) using immobilized CVHPP. If desired, the antibody molecules directed against CVHPPs can be isolated from the subject (e.g., from the blood) and further purified by well known techniques, such as protein A chromatography, to obtain the IgG fraction. At an appropriate time after immunization, e.g., when the anti-CVHPP antibody titers are highest, antibody-producing cells can be obtained from the subject and used to prepare monoclonal antibodies by standard techniques, such as the hybridoma technique, human B cell hybridoma technique, the EBV-hybridoma technique, or trioma techniques. The technology for producing monoclonal antibody hybridomas is well known. Briefly, an immortal cell line (typically a myeloma) is fused to lymphocytes (typically splenocytes) from a mammal immunized with a CVHPP immunogen as described above, and the culture supernatants of the resulting hybridoma cells are screened to identify a hybridoma producing a monoclonal antibody that binds to a CVHPP of the invention.
Any of the many well known protocols used for fusing lymphocytes and immortalized cell lines can be applied for the purpose of generating an anti-CVHPP monoclonal antibody. Moreover, the ordinarily skilled worker will appreciate that there are many variations of such methods which also would be useful. Typically, the immortal cell line (e.g., a myeloma cell line) is derived from the same mammalian species as the lymphocytes. For example, murine hybridomas can be made by fusing lymphocytes from a mouse immunized with an immunogenic preparation of the present invention with an immortalized mouse cell line. Preferred immortal cell lines are mouse myeloma cell lines that are sensitive to culture medium containing hypoxanthine, aminopterin and thymidine (âHAT mediumâ). Any of a number of myeloma cell lines can be used as a fusion partner according to standard techniques, e.g., the P3-NS1/1-Ag4-1, P3-x63-Ag8.653 or Sp210-Ag14 myeloma lines. These myeloma lines are available from ATCC. Typically, HAT-sensitive mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol (âPEGâ). Hybridoma cells resulting from the fusion are then selected using HAT medium, which kills unfused and unproductively fused myeloma cells (unfused splenocytes die after several days because they are not transformed). Hybridoma cells producing a monoclonal antibody of the invention are detected by screening the hybridoma culture supernatants for antibodies that bind to a CVHPP, e.g., using a standard ELISA assay.
Alternative to preparing monoclonal antibody-secreting hybridomas, a monoclonal anti-CVHPP antibody can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e.g., an antibody phase display library) with CVHPP to thereby isolate immunoglobulin library members that bind to a CVHPP. Kits for generating and screening phage display libraries are commercially available.
The anti-CVHPP antibodies also include âSingle-chain Fvâ or âscFvâ antibody fragments. The scFv fragments comprise the VH and VL domains of antibody, wherein these domains are present in a single polypeptide chain. Generally, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains which enables the scFv to form the desired structure for antigen binding.
Additionally, recombinant anti-CVHPP antibodies, such as chimeric and humanized monoclonal antibodies, comprising both human and non-human portions, which can be made using standard recombinant DNA techniques, are within the scope of the invention. Such chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art.
Humanized antibodies are particularly desirable for therapeutic treatment of human subjects. Humanized forms of non-human (e.g., murine) antibodies are chimeric molecules of immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, FabâČ, F(abâČ)2 or other antigen-binding subsequences of antibodies), which contain minimal sequence derived from non-human immunoglobulin. Humanized antibodies include human immunoglobulins (recipient antibody) in which residues forming a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity. In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the constant regions being those of a human immunoglobulin consensus sequence. The humanized antibody will preferably also comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.
Such humanized antibodies can be produced using transgenic mice which are incapable of expressing endogenous immunoglobulin heavy and light chain genes, but which can express human heavy and light chain genes. The transgenic mice are immunized in the normal fashion with a selected antigen, e.g., all or a portion of a polypeptide corresponding to a CVHPP of the invention. Monoclonal antibodies directed against the antigen can be obtained using conventional hybridoma technology. The human immunoglobulin transgenes harbored by the transgenic mice rearrange during B cell differentiation, and subsequently undergo class switching and somatic mutation. Thus, using such a technique, it is possible to produce therapeutically useful IgG, IgA and IgE antibodies.
Humanized antibodies which recognize a selected epitope can be generated using a technique referred to as âguided selection.â In this approach a selected non-human monoclonal antibody, e.g., a murine antibody, is used to guide the selection of a humanized antibody recognizing the same epitope.
In a preferred embodiment, the antibodies to CVHPP are capable of reducing or eliminating the biological function of CVHPP, as is described below. That is, the addition of anti-CVHPP antibodies (either polyclonal or preferably monoclonal) to CVHPP (or cells containing CVHPP) may reduce or eliminate the CVHPP activity. Generally, at least a 25% decrease in activity is preferred, with at least about 50% being particularly preferred and about a 95-100% decrease being especially preferred.
An anti-CVHPP antibody can be used to isolate a CVHPP of the invention by standard techniques, such as affinity chromatography or immunoprecipitation. An anti-CVHPP antibody can facilitate the purification of natural CVHPPs from cells and of recombinantly produced CVHPPs expressed in host cells. Moreover, an anti-CVHPP antibody can be used to detect a CVHPP (e.g., in a cellular lysate or cell supernatant on the cell surface) in order to evaluate the abundance and pattern of expression of the CVHPP. Anti-CVHPP antibodies can be used diagnostically to monitor protein levels in tissue as part of a clinical testing procedure, for example, to determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling (i.e., physically linking) the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin; and examples of suitable radioactive materials include 125I, 131I, 35S or 3H.
Anti-CVHPP antibodies of the invention are also useful for targeting a therapeutic to a cell or tissue comprising the antigen of the anti-CVHPP antibody. For example, a therapeutic, such as a small molecule, can be linked to the anti-CVHPP antibody in order to target the therapeutic to the cell or tissue comprising the CVHPP antigen. The method is particularly useful in connection with CVHPPs which are surface markers.
A therapeutic agent may be coupled (e.g., covalently bonded) to a suitable monoclonal antibody either directly or indirectly (e.g., via a linker group). A direct reaction between an agent and an antibody is possible when each possesses a substituent capable of reacting with the other. For example, a nucleophilic group, such as an amino or sulfhydryl group, on one may be capable of reacting with a carbonyl-containing group, such as an anhydride or an acid halide, or with an alkyl group containing a good leaving group (e.g., a halide) on the other.
Alternatively, it may be desirable to couple a therapeutic agent and an antibody via a linker group. A linker group can function as a spacer to distance an antibody from an agent in order to avoid interference with binding capabilities. A linker group can also serve to increase the chemical reactivity of a substituent on an agent or an antibody, and thus increase the coupling efficiency. An increase in chemical reactivity may also facilitate the use of agents, or functional groups on agents, which otherwise would not be possible.
It will be evident to those skilled in the art that a variety of bifunctional or polyfunctional reagents, both homo- and hetero-functional, may be employed as the linker group. Coupling may be effected, for example, through amino groups, carboxyl groups, sulfhydryl groups or oxidized carbohydrate residues. There are numerous references describing such methodology, e.g., U.S. Pat. No. 4,671,958, to Rodwell et al.
Where a therapeutic agent is more potent when free from the antibody portion of the immunoconjugates of the present invention, it may be desirable to use a linker group which is cleavable during or upon internalization into a cell. A number of different cleavable linker groups have been described. The mechanisms for the intracellular release of an agent from these linker groups include cleavage by reduction of a disulfide bond (e.g., U.S. Pat. No. 4,489,710, to Spitler), by irradiation of a photolabile bond (e.g., U.S. Pat. No. 4,625,014, to Senter et al.), by hydrolysis of derivatized amino acid side chains (e.g., U.S. Pat. No. 4,638,045, to Kohn et al.), by serum complement-mediated hydrolysis (e.g., U.S. Pat. No. 4,671,958, to Rodwell et al.), and acid-catalyzed hydrolysis (e.g., U.S. Pat. No. 4,569,789, to Blattler et al.).
It may be desirable to couple more than one agent to an antibody. In one embodiment, multiple molecules of an agent are coupled to one antibody molecule. In another embodiment, more than one type of agent may be coupled to one antibody. Regardless of the particular embodiment, immunoconjugates with more than one agent may be prepared in a variety of ways. For example, more than one agent may be coupled directly to an antibody molecule. Alternatively, linkers that provide multiple sites for attachment can be used.
As is well known in the art, a given polypeptide or polynucleotide may vary in its immunogenicity. It is often necessary therefore to couple the immunogen (e.g., a polypeptide or polynucleotide) of the present invention with a carrier. Exemplary and preferred carriers are CRM197, E coli (LT) toxin, V. cholera (CT) toxin, keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin can also be used as carriers.
Where a CVHPP (or a fragment thereof) and a carrier protein are conjugated (i.e., covalently associated), conjugation may be any chemical method, process or genetic technique commonly used in the art. For example, a CVHPP (or a fragment thereof) and a carrier protein, may be conjugated by techniques, including, but not limited to: (1) direct coupling via protein functional groups (e.g., thiol-thiol linkage, amine-carboxyl linkage, amine-aldehyde linkage; enzyme direct coupling); (2) homobifunctional coupling of amines (e.g., using bis-aldehydes); (3) homobifunctional coupling of thiols (e.g., using bis-maleimides); (4) homobifunctional coupling via photoactivated reagents (5) heterobifunctional coupling of amines to thiols (e.g., using maleimides); (6) heterobifunctional coupling via photoactivated reagents (e.g., the ÎČ-carbonyldiazo family); (7) introducing amine-reactive groups into a poly- or oligosaccharide via cyanogen bromide activation or carboxymethylation; (8) introducing thiol-reactive groups into a poly- or oligosaccharide via a heterobifunctional compound such as maleimido-hydrazide; (9) protein-lipid conjugation via introducing a hydrophobic group into the protein and (10) protein-lipid conjugation via incorporating a reactive group into the lipid. Also, contemplated are heterobifunctional ânon-covalent couplingâ techniques such the Biotin-Avidin interaction. For a comprehensive review of conjugation techniques, see Aslam and Dent (Aslam and Dent, âBioconjugation: Protein Coupling Techniques for the Biomedical Sciences,â Macmillan Reference Ltd., London, England, 1998), incorporated hereinafter by reference in its entirety.
In a specific embodiment, antibodies to a CVHPP may be used to eliminate the CVHPP in vivo by activating the complement system or mediating antibody-dependent cellular cytotoxicity (ADCC), or cause uptake of the antibody coated cells by the receptor-mediated endocytosis (RE) system.
Another aspect of the invention pertains to vectors containing a polynucleotide encoding a CVHPP, a variant of a CVHPP, or a portion thereof. One type of vector is a âplasmid,â which includes a circular double-stranded DNA loop into which additional DNA segments can be ligated. In the present specification, âplasmidâ and âvectorâ can be used interchangeably as the plasmid is the most commonly used form of vector. Vectors also include expression vectors and gene delivery vectors.
The expression vectors of the invention comprise a polynucleotide encoding a CVHPP or a portion thereof in a form suitable for expression of the polynucleotide in a host cell, which means that the expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, and operatively linked to the polynucleotide sequence to be expressed. It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, and the like. The expression vectors of the invention can be introduced into host cells to thereby produce proteins or peptides, such as CVHPPs, mutant forms of CVHPPs, CVHPP-fusion proteins, and the like.
The expression vectors of the invention can be designed for expression of CVHPPs in prokaryotic or eukaryotic cells. For example, CVHPPs can be expressed in bacterial cells such as E. coli, insect cells (using baculovirus expression vectors), yeast cells or mammalian cells. Alternatively, the expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
The expression of proteins in prokaryotes is most often carried out in E. coli with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, usually to the amino terminus of the recombinant protein. Such fusion vectors typically serve three purposes: 1) to increase expression of the recombinant protein; 2) to increase the solubility of the recombinant protein; and 3) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein. Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase. Typical fusion expression vectors include pGEX (Pharmacia, Piscataway, N.J.), pMAL (New England Biolabs, Beverly, Mass.) and pRITS (Pharmacia, Piscataway, N.J.) which fuse glutathione S transferase (GST), maltose E binding protein, and protein A, respectively, to the target recombinant protein.
Purified fusion proteins can be utilized in CVHPP activity assays, (e.g., direct assays or competitive assays described in detail below), or to generate antibodies specific for CVHPPs.
One strategy to maximize recombinant protein expression in E. coli is to express the protein in a host bacteria with an impaired capacity to proteolytically cleave the recombinant protein. Another strategy is to alter the polynucleotide sequence of the polynucleotide to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in E. coli. Such alteration of polynucleotide sequences of the invention can be carried out by standard DNA synthesis techniques.
In another embodiment, the CVHPP expression vector is a yeast expression vector. Examples of vectors for expression in yeast S. cerevisiae include pYepSec1, pMFa, pJRY88, pYES2 and picZ (Invitrogen Corp, San Diego, Calif.).
Alternatively, CVHPPs of the invention can be expressed in insect cells using baculovirus expression vectors. Baculovirus vectors available for expression of proteins in cultured insect cells (e.g., Sf9 cells) include the pAc series and the pVL series.
In yet another embodiment, a polynucleotide of the invention is expressed in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 and pMT2PC. When used in mammalian cells, the expression vector's control functions are often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus 2 and 5, cytomegalovirus and Simian Virus 40. Target gene expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-lac fusion promoter. Target gene expression from the pET 11d vector relies on transcription from a T7 gn10-lac fusion promoter mediated by a coexpressed viral RNA polymerase (T7 gn1). This viral polymerase is supplied by host strains BL21 (DE3) or HSLE174(DE3) from a resident prophage harboring a T7 gn1 gene under the transcriptional control of the lacUV 5 promoter.
In another embodiment, the mammalian expression vector is capable of directing expression of the polynucleotide preferentially in a particular cell type (e.g., tissue-specific regulatory elements are used to express the polynucleotide). Tissue-specific regulatory elements are known in the art and may include epithelial cell-specific promoters. Other non-limiting examples of suitable tissue-specific promoters include the liver-specific promoter (e.g., albumin promoter), lymphoid-specific promoters, promoters of T cell receptors and immunoglobulins, neuron-specific promoters (e.g., the neurofilament promoter), pancreas-specific promoters (e.g., insulin promoter), and mammary gland-specific promoters (e.g., milk whey promoter). Developmentally-regulated promoters (e.g., the α-fetoprotein promoter) are also encompassed.
The invention provides a recombinant expression vector comprising a polynucleotide encoding a CVHPP cloned into the expression vector in an antisense orientation. That is, the DNA molecule is operatively linked to a regulatory sequence in a manner which allows for expression (by transcription of the DNA molecule) of an RNA molecule which is antisense to mRNA corresponding to a CVHG of the invention. Regulatory sequences operatively linked to a polynucleotide cloned in the antisense orientation can be chosen which direct the continuous expression of the antisense RNA molecule in a variety of cell types, for instance, viral promoters and/or enhancers, or regulatory sequences can be chosen which direct constitutive, tissue specific or cell type specific expression of antisense RNA. The antisense expression vector can be in the form of a recombinant plasmid, phagemid or attenuated virus in which antisense polynucleotides are produced under the control of a high efficiency regulatory region, the activity of which can be determined by the cell type into which the vector is introduced.
The invention further provides gene delivery vehicles for delivery of polynucleotides to cells, tissues, or a mammal for expression. For example, a polynucleotide sequence of the invention can be administered either locally or systemically in a gene delivery vehicle. These constructs can utilize viral or non-viral vector approaches in in vivo or ex vivo modality. Expression of the coding sequence can be induced using endogenous mammalian or heterologous promoters. Expression of the coding sequence in vivo can be either constituted or regulated. The invention includes gene delivery vehicles capable of expressing the contemplated polynucleotides. The gene delivery vehicle is preferably a viral vector and, more preferably, a retroviral, lentiviral, adenoviral, adeno-associated viral (AAV), herpes viral, or alphavirus vector. The viral vector can also be an astrovirus, coronavirus, orthomyxovirus, papovavirus, paramyxovirus, parvovirus, picornavirus, poxvirus, togavirus viral vector.
The delivery of gene therapy constructs of this invention into cells is not limited to the above mentioned viral vectors. Other delivery methods and media may be employed such as, for example, nucleic acid expression vectors, polycationic condensed DNA linked or unlinked to killed adenovirus alone, ligand linked DNA, liposomes, eukaryotic cell delivery vehicles cells, deposition of photopolymerized hydrogel materials, handheld gene transfer particle gun, ionizing radiation, nucleic charge neutralization or fusion with cell membranes. Particle mediated gene transfer may be employed. Briefly, DNA sequence can be inserted into conventional vectors that contain conventional control sequences for high level expression, and then be incubated with synthetic gene transfer molecules such as polymeric DNA-binding cations like polylysine, protamine, and albumin, linked to cell targeting ligands such as asialoorosomucoid, insulin, galactose, lactose or transferrin. Naked DNA may also be employed. Uptake efficiency of naked DNA may be improved using biodegradable latex beads. The method may be improved further by treatment of the beads to increase hydrophobicity and thereby facilitate disruption of the endosome and release of the DNA into the cytoplasm.
Another aspect of the invention pertains to the expression of CVHPPs using a regulatable expression system. Systems to regulate expression of therapeutic genes have been developed and incorporated into the current viral and nonviral gene delivery vectors. These systems are briefly described below:
Tet-on/off system. The Tet-system is based on two regulatory elements derived from the tetracycline-resistance operon of the E. coli Tn10 transposon: the tet repressor protein (TetR) and the Tet operator DNA sequence (tetO) to which TetR binds. The system consists of two components, a âregulatorâ and a âreporterâ plasmid. The âregulatorâ plasmid encodes a hybrid protein containing a mutated Tet repressor (rtetR) fused to the VP16 activation domain of herpes simplex virus. The âreporterâ plasmid contains a tet-responsive element (TRE), which controls the âreporterâ gene of choice. The rtetR-VP16 fusion protein can only bind to the TRE, therefore activates the transcription of the âreporterâ gene, in the presence of tetracycline. The system has been incorporated into a number of viral vectors including retrovirus, adenovirus and AAV.
Ecdysone system. The ecdysone system is based on the molting induction system found in Drosophila, but modified for inducible expression in mammalian cells. The system uses an analog of the drosophila steroid hormone ecdysone, muristerone A, to activate expression of the gene of interest via a heterodimeric nuclear receptor. Expression levels have been reported to exceed 200-fold over basal levels with no effect on mammalian cell physiology.
Progesterone system. The progesterone receptor is normally stimulated to bind to a specific DNA sequence and to activate transcription through an interaction with its hormone ligand. Conversely, the progesterone antagonist mifepristone (RU486) is able to block hormone-induced nuclear transport and subsequent DNA binding. A mutant form of the progesterone receptor that can be stimulated to bind through an interaction with RU486 has been generated. To generate a specific, regulatable transcription factor, the RU486-binding domain of the progesterone receptor has been fused to the DNA-binding domain of the yeast transcription factor GAL4 and the transactivation domain of the HSV protein VP16. The chimeric factor is inactive in the absence of RU486. The addition of hormone, however, induces a conformational change in the chimeric protein, and this change allows binding to a GAL4-binding site and the activation of transcription from promoters containing the GAL4-binding site.
Rapamycin system. Immunosuppressive agents, such as FK506 and rapamycin, act by binding to specific cellular proteins and facilitating their dimerization. For example, the binding of rapamycin to FK506-binding protein (FKBP) results in its heterodimerization with another rapamycin binding protein FRAP, which can be reversed by removal of the drug. The ability to bring two proteins together by addition of a drug potentiates the regulation of a number of biological processes, including transcription. A chimeric DNA-binding domain has been fused to the FKBP, which enables binding of the fusion protein to a specific DNA-binding sequence. A transcriptional activation domain also has been fused to FRAP. When these two fusion proteins are co-expressed in the same cell, a fully functional transcription factor can be formed by heterodimerization mediated by addition of rapamycin. The dimerized chimeric transcription factor can then bind to a synthetic promoter sequence containing copies of the synthetic DNA-binding sequence. This system has been successfully integrated into adenoviral and AAV vectors. Long term regulatable gene expression has been achieved in both mice and baboons.
Within certain aspects, CVHPP, CVHPN, CVHPP-specific T cell, CVHPP-presenting APC, CVHG-containing vectors, including but are not limited to expression vectors and gene delivery vectors, may be utilized as vaccines for CVH. Vaccines may comprise one or more such compounds/cells and an immunostimulant. An immunostimulant may be any substance that enhances or potentiates an immune response (antibody and/or cell-mediated) to an exogenous antigen. Examples of immunostimulants include adjuvants, biodegradable microspheres (e.g., polylactic galactide) and liposomes (into which the compound is incorporated). Vaccines within the scope of the present invention may also contain other compounds, which may be biologically active or inactive. For example, one or more immunogenic portions of other antigens may be present, either incorporated into a fusion polypeptide or as a separate compound, within the composition of vaccine.
A vaccine may contain DNA encoding one or more CVHPP or portion of CVHPP, such that the polypeptide is generated in situ. As noted above, the DNA may be present within any of a variety of delivery systems known to those of ordinary skill in the art, including nucleic acid expression vectors, gene delivery vectors, and bacteria expression systems. Numerous gene delivery techniques are well known in the art. Appropriate nucleic acid expression systems contain the necessary DNA sequences for expression in the patient (such as a suitable promoter and terminating signal). Bacterial delivery systems involve the administration of a bacterium (such as Bacillus-Calmette-Guerrin) that expresses an immunogenic portion of the polypeptide on its cell surface or secretes such an epitope. In a preferred embodiment, the DNA may be introduced using a viral expression system (e.g., vaccinia or other pox virus, retrovirus, or adenovirus), which may involve the use of a non-pathogenic (defective), replication competent virus. Techniques for incorporating DNA into such expression systems are well known to those of ordinary skill in the art. The DNA may also be ânaked,â as described, for example, in Ulmer et al., Science 259:1745-1749, 1993 and reviewed by Cohen, Science 259:1691-1692, 1993. The uptake of naked DNA may be increased by coating the DNA onto biodegradable beads, which are efficiently transported into the cells. It will be apparent that a vaccine may comprise both a polynucleotide and a polypeptide component. Such vaccines may provide for an enhanced immune response.
It will be apparent that a vaccine may contain pharmaceutically acceptable salts of the polynucleotides and polypeptides provided herein. Such salts may be prepared from pharmaceutically acceptable non-toxic bases, including organic bases (e.g., salts of primary, secondary and tertiary amines and basic amino acids) and inorganic bases (e.g., sodium, potassium, lithium, ammonium, calcium and magnesium salts).
Any of a variety of immunostimulants may be employed in the vaccines of this invention. For example, an adjuvant may be included. As defined previously, an âadjuvantâ is a substance that serves to enhance the immunogenicity of an antigen. Thus, adjuvants are often given to boost the immune response and are well known to the skilled artisan. Examples of adjuvants contemplated in the present invention include, but are not limited to, aluminum salts (alum) such as aluminum phosphate and aluminum hydroxide, Mycobacterium tuberculosis, Bordetella pertussis, bacterial lipopolysaccharides, aminoalkyl glucosamine phosphate compounds (AGP), or derivatives or analogs thereof, which are available from Corixa (Hamilton, Mont.), and which are described in U.S. Pat. No. 6,113,918; one such AGP is 2-[(R)-3-Tetradecanoyloxytetradecanoylamino]ethyl 2-Deoxy-4-O-phosphono-3-Oâ[(R)-3-tetradecanoyoxytetradecanoyl]-2-[(R)-3-tetradecanoyoxytetradecanoylamino]-b-D-glucopyranoside, which is also known as 529 (formerly known as RC529), which is formulated as an aqueous form or as a stable emulsion, MPLâą (3-O-deacylated monophosphoryl lipid A) (Corixa) described in U.S. Pat. No. 4,912,094, synthetic polynucleotides such as oligonucleotides containing a CpG motif (U.S. Pat. No. 6,207,646), polypeptides, saponins such as Quil A or STIMULONâą QS-21 (Antigenics, Framingham, Mass.), described in U.S. Pat. No. 5,057,540, a pertussis toxin (PT), or an E. coli heat-labile toxin (LT), particularly LT-K63, LT-R72, CT-S109, PT-K9/G129; see, e.g., International Patent Publication Nos. WO 93/13302 and WO 92/19265, cholera toxin (either in a wild-type or mutant form, e.g., wherein the glutamic acid at amino acid position 29 is replaced by another amino acid, preferably a histidine, in accordance with published International Patent Application number WO 00/18434). Various cytokines and lymphokines are suitable for use as adjuvants. One such adjuvant is granulocyte-macrophage colony stimulating factor (GM-CSF), which has a nucleotide sequence as described in U.S. Pat. No. 5,078,996. A plasmid containing GM-CSF cDNA has been transformed into E. coli and has been deposited with the American Type Culture Collection (ATCC), 1081 University Boulevard, Manassas, Va. 20110-2209, under Accession Number 39900. The cytokine IL-12 is another adjuvant which is described in U.S. Pat. No. 5,723,127. Other cytokines or lymphokines have been shown to have immune modulating activity, including, but not limited to, the interleukins 1-alpha, 1-beta, 2, 4, 5, 6, 7, 8, 10, 13, 14, 15, 16, 17 and 18, the interferons-alpha, beta and gamma, granulocyte colony stimulating factor, and the tumor necrosis factors alpha and beta, and are suitable for use as adjuvants.
Any vaccine provided herein may be prepared using well known methods that result in a combination of antigen, immune response enhancer and a suitable carrier or excipient. The compositions described herein may be administered as part of a sustained release formulation (i.e., a formulation such as a capsule, sponge or gel (composed of polysaccharides, for example) that effects a slow release of compound following administration). Such formulations may generally be prepared using well known technology and administered by, for example, oral, rectal or subcutaneous implantation, or by implantation at the desired target site. Sustained-release formulations may contain a polypeptide, polynucleotide or antibody dispersed in a carrier matrix and/or contained within a reservoir surrounded by a rate controlling membrane.
Carriers for use within such formulations are biocompatible, and may also be biodegradable; preferably the formulation provides a relatively constant level of active component release. Such carriers include microparticles of poly(lactide-co-glycolide), as well as polyacrylate, latex, starch, cellulose and dextran. Other delayed-release carriers include supramolecular biovectors, which comprise a non-liquid hydrophilic core (e.g., a cross-linked polysaccharide or oligosaccharide) and, optionally, an external layer comprising an amphiphilic compound, such as a phospholipid (see e.g., U.S. Pat. No. 5,151,254 and PCT applications WO 94/20078, WO/94/23701 and WO 96/06638). The amount of active compound contained within a sustained release formulation depends upon the site of implantation, the rate and expected duration of release and the nature of the condition to be treated or prevented.
Any of a variety of delivery vehicles may be employed within vaccines to facilitate production of an antigen-specific immune response that targets cancer cells. Delivery vehicles include antigen presenting cells (APCs), such as dendritic cells, macrophages, B cells, monocytes and other cells that may be engineered to be efficient APCs. Such cells may, but need not, be genetically modified to increase the capacity for presenting the antigen, to improve activation and/or maintenance of the T cell response, to have anti-CVH effects per se and/or to be immunologically compatible with the receiver (i.e., matched HLA haplotype). APCs may generally be isolated from any of a variety of biological fluids and organs, and may be autologous, allogeneic, syngeneic or xenogenic cells.
Certain preferred embodiments of the present invention use dendritic cells or progenitors thereof as APCs. Dendritic cells are highly potent APCs and have been shown to be effective as a physiological adjuvant for eliciting prophylactic or therapeutic anti-CVH immunity. In general, dendritic cells may be identified based on their typical shape (stellate in situ, with marked cytoplasmic processes (dendrites) visible in vitro), their ability to take up, process and present antigens with high efficiency and their ability to activate naive T cell responses. Dendritic cells may, of course, be engineered to express specific cell-surface receptors or ligands that are not commonly found on dendritic cells in vivo, and such modified dendritic cells are contemplated by the present invention. As an alternative to dendritic cells, secreted vesicles antigen-loaded dendritic cells (called exosomes) may be used within a vaccine (see Zitvogel et al., Nature Med. 4:594-600, 1998).
Dendritic cells and progenitors may be obtained from peripheral blood, bone marrow, lymph nodes, spleen, skin, umbilical cord blood or any other suitable tissue or fluid. For example, dendritic cells may be differentiated ex vivo by adding a combination of cytokines such as GM-CSF, IL-4, IL-13 and/or TNFα to cultures of monocytes harvested from peripheral blood. Alternatively, CD34 positive cells harvested from peripheral blood, umbilical cord blood or bone marrow may be differentiated into dendritic cells by adding to the culture medium combinations of GM-CSF, IL-3, TNFα, CD40 ligand, LPS, flt3 ligand and/or other compound(s) that induce differentiation, maturation and proliferation of dendritic cells.
Dendritic cells are conveniently categorized as âimmatureâ and âmatureâ cells, which allows a simple way to discriminate between two well characterized phenotypes. However, this nomenclature should not be construed to exclude all possible intermediate stages of differentiation. Immature dendritic cells are characterized as APC with a high capacity for antigen uptake and processing, which correlates with the high expression of Fcy receptor and mannose receptor. The mature phenotype is typically characterized by a lower expression of these markers, but a high expression of cell surface molecules responsible for T cell activation such as class I and class II MHC, adhesion molecules (e.g., CD54 and CD11) and costimulatory molecules (e.g., CD40, CD80, CD86 and 4-1BB).
APCs may generally be transfected with a polynucleotide encoding a CVHPP (or portion or other variant thereof) such that the CVHPP, or an immunogenic portion thereof, is expressed on the cell surface. Such transfection may take place ex vivo, and a composition or vaccine comprising such transfected cells may then be used for therapeutic purposes, as described herein. Alternatively, a gene delivery vehicle that targets a dendritic or other antigen presenting cell may be administered to a patient, resulting in transfection that occurs in vivo. In vivo and ex vivo transfection of dendritic cells, for example, may generally be performed using any methods known in the art, such as those described in WO 97/24447, or the gene gun approach described by Mahvi et al., Immunology and cell Biology 75:456-460, 1997. Antigen loading of dendritic cells may be achieved by incubating dendritic cells or progenitor cells with the CVHPP, DNA (naked or within a plasmid vector) or RNA; or with antigen-expressing recombinant bacterium or viruses (e.g., vaccinia, fowlpox, adenovirus or lentivirus vectors). Prior to loading, the polypeptide may be covalently conjugated to an immunological partner that provides T cell help (e.g., a carrier molecule). Alternatively, a dendritic cell may be pulsed with a non-conjugated immunological partner, separately or in the presence of the polypeptide.
Vaccines may be presented in unit-dose or multi-dose containers, such as sealed ampoules or vials. Such containers are preferably hermetically sealed to preserve sterility of the formulation until use. In general, formulations may be stored as suspensions, solutions or emulsions in oily or aqueous vehicles. Alternatively, a vaccine may be stored in a freeze-dried condition requiring only the addition of a sterile liquid carrier immediately prior to use.
As discussed earlier, expression level of CVHGs may be used as a marker for CVH and CVH-related disorders. Detection and measurement of the relative amount of a CVHG product (polynucleotide or polypeptide) of the invention can be by any method known in the art. Typical methodologies for detection of a transcribed polynucleotide include RNA extraction from a cell or tissue sample, followed by hybridization of a labeled probe (i.e., a complementary polynucleotide molecule) specific for the target RNA to the extracted RNA and detection of the probe (i.e., Northern blotting).
Typical methodologies for peptide detection include protein extraction from a cell or tissue sample, followed by binding of an antibody specific for the target protein to the protein sample, and detection of the antibody. For example, detection of desmin may be accomplished using polyclonal antibody anti-desmin. Antibodies are generally detected by the use of a labeled secondary antibody. The label can be a radioisotope, a fluorescent compound, an enzyme, an enzyme co-factor, or ligand. Such methods are well understood in the art.
In certain embodiments, the CVHGs themselves (i.e., the DNA or cDNA) may serve as markers for CVH. For example, an increase of genomic copies of a CVHG, such as by duplication of the gene, may also be correlated with CVH and CVH-associated disorders.
Detection of specific polynucleotide molecules may also be assessed by gel electrophoresis, column chromatography, or direct sequencing, quantitative PCR (in the case of polynucleotide molecules), RT-PCR, or nested-PCR among many other techniques well known to those skilled in the art.
Detection of the presence or number of copies of all or a part of an CVHG of the invention may be performed using any method known in the art. Typically, it is convenient to assess the presence and/or quantity of a DNA or cDNA by Southern analysis, in which total DNA from a cell or tissue sample is extracted and hybridized with a labeled probe (i.e., a complementary DNA molecules). The probe is then detected and quantified. The label group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor. Other useful methods of DNA detection and/or quantification include direct sequencing, gel electrophoresis, column chromatography, and quantitative PCR, as is known by one skilled in the art.
In certain embodiments, CVHPPs may serve as markers for CVH. Detection of specific polypeptide molecules may be assessed by gel electrophoresis, Western blot, column chromatography, or direct sequencing, among many other techniques well known to those skilled in the art.
The expression level of each CVHG may be considered individually, although it is within the scope of the invention to provide combinations of two or more CVHGs for use in the methods and compositions of the invention to increase the confidence of the analysis. In another aspect, the invention provides panels of the CVHGs of the invention. A panel of CVHGs comprises two or more CVHGs. A panel may also comprise 2-5, 5-15, 15-35, 35-50, or more than 50 CVHGs. In a preferred embodiment, these panels of CVHGs are selected such that the CVHGs within any one panel share certain features. For example, the CVHGs of a first panel may all relate to myelination in a CVH sample. Alternatively, CVHGs of a second panel may each exhibit differential regulation as compared to a first panel. Similarly, different panels of CVHGs may be composed of CVHGs representing different stages of CVH. Panels of the CVHGs of the invention may be made by independently selecting CVHGs from Tables 3-8, and may further be provided on biochips, as discussed below.
The invention also provides methods (also referred to herein as âscreening assaysâ) for identifying modulators, i.e., candidate or test compounds or agents comprising therapeutic moieties (e.g., peptides, peptidomimetics, peptoids, polynucleotides, small molecules or other drugs) which (a) bind to a CVHPP, or (b) have a modulatory (e.g., stimulatory or inhibitory) effect on the activity of a CVHPP or, more specifically, (c) have a modulatory effect on the interactions of the CVHPP with one or more of its natural substrates (e.g., peptide, protein, hormone, co-factor, or polynucleotide), or (d) have a modulatory effect on the expression of the CVHPPs. Such assays typically comprise a reaction between the CVHPP and one or more assay components. The other components may be either the test compound itself, or a combination of the test compound and a binding partner of the CVHPP.
To screen for compounds which interfere with binding of two proteins e.g., a CVHPP and its binding partner, a Scintillation Proximity Assay can used. In this assay, the CVHPP is labeled with an isotope such as 125I. The binding partner is labeled with a scintillant, which emits light when proximal to radioactive decay (i.e., when the CVHPP is bound to its binding partner). A reduction in light emission will indicate that a compound has interfered with the binding of the two proteins.
Alternatively a Fluorescence Energy Transfer (FRET) assay could be used. In a FRET assay of the invention, a fluorescence energy donor is comprised on one protein (e.g., a CVHPP) and a fluorescence energy acceptor is comprised on a second protein (e.g., a binding partner of the CVHPP). If the absorption spectrum of the acceptor molecule overlaps with the emission spectrum of the donor fluorophore, the fluorescent light emitted by the donor is absorbed by the acceptor. The donor molecule can be a fluorescent residue on the protein (e.g., intrinsic fluorescence such as a tryptophan or tyrosine residue), or a fluorophore which is covalently conjugated to the protein (e.g., fluorescein isothiocyanate, FITC). An appropriate donor molecule is then selected with the above acceptor/donor spectral requirements in mind.
Thus, in this example, a CVHPP is labeled with a fluorescent molecule (i.e., a donor fluorophore) and its binding partner is labeled with a quenching molecule (i.e., an acceptor). When the CVHPP and its binding partner are bound, fluorescence emission will be quenched or reduced relative the CVHPP alone. Similarly, a compound which can dissociate the interaction of the CVHPP-partner complex, will result in an increase in fluorescence emission, which indicates the compound has interfered with the binding of the CVHPP to its binding partner.
Another assay to detect binding or dissociation of two proteins is fluorescence polarization or anisotropy. In this assay, the investigated protein (e.g., a CVHPP) is labeled with a fluorophore with an appropriate fluorescence lifetime. The protein sample is then excited with vertically polarized light. The value of anisotropy is then calculated by determining the intensity of the horizontally and vertically polarized emission light. Next, the labeled protein (CVHPP) is mixed with a CVHPP binding partner and the anisotropy measured again. Because fluorescence anisotropy intensity is related to the rotational freedom of the labeled protein, the more rapidly a protein rotates in solution, the smaller the anisotropy value. Thus, if the labeled CVHPP is part of a complex (e.g., CVHPP-partner), the CVHPP rotates more slowly in solution (relative to free, unbound CVHPP) and the anisotropy intensity increases. Subsequently, a compound which can dissociate the interaction of the CVHPP-partner complex, will result in a decrease in anisotropy (i.e., the labeled CVHPP rotates more rapidly), which indicates the compound has interfered with the binding of CVHPP to its binding partner.
A more traditional assay would involve labeling the CVHPP binding partner with an isotope such as 125I, incubating with the CVHPP, then immunoprecipitating of the CVHPP. Compounds that increase the free CVHPP will decrease the precipitated counts. To avoid using radioactivity, the CVHPP binding partner could be labeled with an enzyme-conjugated antibody instead.
Alternatively, the CVHPP binding partner could be immobilized on the surface of an assay plate and the CVHPP could be labeled with a radioactive tag. A rise in the number of counts would identify compounds that had interfered with binding of the CVHPP and its binding partner.
Evaluation of binding interactions may further be performed using Biacore technology, wherein the CVHPP or its binding partner is bound to a micro chip, either directly by chemical modification or tethered via antibody-epitope association (e.g., antibody to the CVHPP), antibody directed to an epitope tag (e.g., His tagged) or fusion protein (e.g., GST). A second protein or proteins is/are then applied via flow over the âchipâ and the change in signal is detected. Finally, test compounds are applied via flow over the âchipâ and the change in signal is detected.
Once a series of potential compounds has been identified for a combination of CVHPP, CVHPP binding partner and ALS, a bioassay can be used to select the most promising candidates. For example, a cellular assay that measures cell proliferation in presence of the CVHPP and the CVHPP binding partner was described above. This assay could be modified to test the effectiveness of small molecules that interfere with binding of a CVHPP and its binding partner in enhancing cellular proliferation. An increase in cell proliferation would correlate with a compound's potency.
The test compounds of the present invention are generally either small molecules or biomolecules. Small molecules include, but are not limited to, inorganic molecules and small organic molecules. Biomolecules include, but are not limited to, naturally-occurring and synthetic compounds that have a bioactivity in mammals, such as lipids, steroids, polypeptides, polysaccharides, and polynucleotides. In one preferred embodiment, the test compound is a small molecule. In another preferred embodiment, the test compound is a biomolecule. One skilled in the art will appreciate that the nature of the test compound may vary depending on the nature of the CVHPP. For example, if the CVHPP is an orphan receptor having an unknown ligand, the test compound may be any of a number of biomolecules which may act as cognate ligand, including but not limited to, cytokines, lipid-derived mediators, small biogenic amines, hormones, neuropeptides, or proteases.
The test compounds of the present invention may be obtained from any available source, including systematic libraries of natural and/or synthetic compounds. Test compounds may also be obtained by any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; peptoid libraries (libraries of molecules having the functionalities of peptides, but with a novel, non-peptide backbone which are resistant to enzymatic degradation but which nevertheless remain bioactive); spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the âone-bead one-compoundâ library method; and synthetic library methods using affinity chromatography selection. The biological library and peptoid library approaches are limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds. As used herein, the term âbinding partnerâ refers to a molecule which serves as either a substrate for a CVHPP, or alternatively, as a ligand having binding affinity to the CVHPP.
The invention provides methods of screening test compounds for inhibitors of CVHPP. The method of screening comprises obtaining samples from subjects diagnosed with or suspected of having CVH, contacting each separate aliquot of the samples with one of a plurality of test compounds, and comparing expression of one or more CVHGs in each of the aliquots to determine whether any of the test compounds provides a substantially altered level of expression or activity of an CVHG relative to samples with other test compounds or relative to an untreated sample or control sample. In addition, methods of screening may be devised by combining a test compound with a protein and thereby determining the effect of the test compound on the protein.
In addition, the invention is further directed to a method of screening for test compounds capable of modulating with the binding of a CVHPP and a binding partner, by combining the test compound, CVHPP, and binding partner together and determining whether binding of the binding partner and CVHPP occurs. The test compound may be either small molecules or a bioactive agent. As discussed below, test compounds may be provided from a variety of libraries well known in the art.
Modulators of CVHG expression, activity or binding ability are useful as therapeutic compositions of the invention. Such modulators (e.g., antagonists or agonists) may be formulated as pharmaceutical compositions, as described herein below. Such modulators may also be used in the methods of the invention, for example, to diagnose, treat, or prognose CVH.
The invention provides methods of conducting high-throughput screening for test compounds capable of inhibiting activity or expression of a CVHPP of the present invention. In one embodiment, the method of high-throughput screening involves combining test compounds and the CVHPP and detecting the effect of the test compound on the CVHPP.
A variety of high-throughput functional assays well-known in the art may be used in combination to screen and/or study the reactivity of different types of activating test compounds. Since the coupling system is often difficult to predict, a number of assays may need to be configured to detect a wide range of coupling mechanisms. A variety of fluorescence-based techniques are well-known in the art and are capable of high-throughput and ultra high throughput screening for activity, including but not limited to BRETÂź or FRETÂź (both by Packard Instrument Co., Meriden, Conn.). The ability to screen a large volume and a variety of test compounds with great sensitivity permits analysis of the therapeutic targets of the invention to further provide potential inhibitors of CVH. For example, where the CVHG encodes an orphan receptor with an unidentified ligand, high-throughput assays may be utilized to identify the ligand, and to further identify test compounds which prevent binding of the receptor to the ligand. The BIACOREÂź system may also be manipulated to detect binding of test compounds with individual components of the therapeutic target, to detect binding to either the encoded protein or to the ligand.
By combining test compounds with CVHPPs of the invention and determining the binding activity between them, diagnostic analysis can be performed to elucidate the coupling systems. Generic assays using cytosensor microphysiometer may also be used to measure metabolic activation, while changes in calcium mobilization can be detected by using the fluorescence-based techniques such as FLIPRÂź (Molecular Devices Corp, Sunnyvale, Calif.). In addition, the presence of apoptotic cells may be determined by TUNEL assay, which utilizes flow cytometry to detect free 3-OH termini resulting from cleavage of genomic DNA during apoptosis. As mentioned above, a variety of functional assays well-known in the art may be used in combination to screen and/or study the reactivity of different types of activating test compounds. Preferably, the high-throughput screening assay of the present invention utilizes label-free plasmon resonance technology as provided by BIACOREÂź systems (Biacore International AB, Uppsala, Sweden). Plasmon free resonance occurs when surface plasmon waves are excited at a metal/liquid interface. By reflecting directed light from the surface as a result of contact with a sample, the surface plasmon resonance causes a change in the refractive index at the surface layer. The refractive index change for a given change of mass concentration at the surface layer is similar for many bioactive agents (including proteins, peptides, lipids and polynucleotides), and since the BIACOREÂź sensor surface can be functionalized to bind a variety of these bioactive agents, detection of a wide selection of test compounds can thus be accomplished.
Therefore, the invention provides for high-throughput screening of test compounds for the ability to inhibit activity of a protein encoded by the CVHGs listed in Table 4, by combining the test compounds and the protein in high-throughput assays such as BIACOREÂź, or in fluorescence-based assays such as BRETÂź. In addition, high-throughput assays may be utilized to identify specific factors which bind to the encoded proteins, or alternatively, to identify test compounds which prevent binding of the receptor to the binding partner. In the case of orphan receptors, the binding partner may be the natural ligand for the receptor. Moreover, the high-throughput screening assays may be modified to determine whether test compounds can bind to either the encoded protein or to the binding partner (e.g., substrate or ligand) which binds to the protein.
The present invention pertains to the field of predictive medicine in which diagnostic assays, prognostic assays, pharmacogenetics and monitoring clinical trials are used for prognostic (predictive) purpose to thereby treat an individual prophylactically. Accordingly, one aspect of the present invention relates to diagnostic assays for determining CVHG expression and/or activity, in the context of a biological sample (e.g., blood, urine, feces, serum, cells, tissue) to thereby determine whether an individual is at risk for developing CVH associated with altered CVHG expression or activity. The invention also provides for prognostic (or predictive) assays for determining whether an individual is at risk of developing CVH associated with aberrant CVHG expression or activity.
For example, the number of copies of an CVHG can be assayed in a biological sample. Such assays can be used for prognostic or predictive purposes to thereby prophylactically treat an individual prior to the onset of CVH associated with aberrant CVHG protein, polynucleotide expression or activity.
Another aspect of the invention pertains to monitoring the influence of agents (e.g., drugs, compounds) on the expression or activity of CVHGs in clinical trials.
An exemplary method for detecting the presence or absence of a CVHPP or CVHPN in a biological sample involves contacting a biological sample with a compound or an agent capable of detecting the CVHPP or CVHPN (e.g., mRNA, genomic DNA). A preferred agent for detecting mRNA or genomic DNA corresponding to an CVHG or CVHPP of the invention is a labeled polynucleotide probe capable of hybridizing to a mRNA or genomic DNA of the invention. In a most preferred embodiment, the polynucleotides to be screened are arranged on a GeneChipÂź. Suitable probes for use in the diagnostic assays of the invention are described herein. A preferred agent for detecting a CVHPP of the invention is an antibody which specifically recognizes the CVHPP.
The diagnostic assays may also be used to quantify the amount of expression or activity of a CVHG in a biological sample. Such quantification is useful, for example, to determine the progression or severity of CVH and CVH-related disorders. Such quantification is also useful, for example, to determine the severity of CVH following treatment.
In the field of diagnostic assays, the invention also provides methods for determining the severity of CVH by isolating a sample from a subject (e.g., a colon biopsy), and detecting the presence, quantity and/or activity of one or more CVHG products in the sample relative to a second sample from a normal sample or control sample. In one embodiment, the expression levels of CVHGs in the two samples are compared, and a modulation in one or more CVHGs in the test sample indicates CVH. In other embodiments the modulation of 2, 3, 4 or more CVHGs indicates a severe case of CVH.
In another aspect, the invention provides CVHG products whose quantity or activity is correlated with the severity of CVH. The subsequent level of expression may further be compared to different expression profiles of various stages of the disease to confirm whether the subject has a matching profile. In yet another aspect, the invention provides CVHGs whose quantity or activity is correlated with a risk in a subject for developing CVH.
A preferred agent for detecting a CVHPP is an antibody capable of binding to the CVHPP, preferably an antibody with a detectable label. Antibodies can be polyclonal or more preferably, monoclonal. An intact antibody, or a fragment thereof (e.g., Fab or F(abâČ)2) can be used. The term âlabeled,â with regard to the probe or antibody, is intended to encompass direct labeling of the probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, as well as indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such that it can be detected with fluorescently labeled streptavidin. The term âbiological sampleâ is intended to include tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject. That is, the detection method of the invention can be used to detect CVHG mRNA, protein or genomic DNA in a biological sample in vitro as well as in vivo. For example, in vitro techniques for detection of CVHG mRNA include Northern hybridizations and in situ hybridizations. In vitro techniques for detection of CVHPP include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations and immunofluorescence. In vitro techniques for detection of CVHG genomic DNA include Southern hybridizations. Furthermore, in vivo techniques for detection of CVHPP include introducing into a subject a labeled anti-CVHPP antibody. For example, the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.
In one embodiment, the biological sample contains protein molecules from the test subject. Alternatively, the biological sample can contain mRNA molecules from the test subject or genomic DNA molecules from the test subject. A preferred biological sample is a tissue or serum sample isolated by conventional means from a subject, e.g., a biopsy or blood draw.
The diagnostic method described herein can be utilized to identify subjects having or at risk of developing CVH associated with aberrant CVHG expression or activity.
The assays described herein, such as the preceding or following assays, can be utilized to identify a subject having CVH associated with an aberrant level of CVHG activity or expression. Alternatively, the prognostic assays can be utilized to identify a subject at risk for developing CVH associated with aberrant levels of CVHG protein activity or polynucleotide expression. Thus, the present invention provides a method for identifying CVH associated with aberrant CVHG expression or activity in which a test sample is obtained from a subject and CVHPP or CVHPN (e.g., mRNA or genomic DNA) is detected, wherein the presence of CVHPP or CVHPN is diagnostic or prognostic for a subject having or at risk of developing CVH with aberrant CVHG expression or activity.
Furthermore, the prognostic assays described herein can be used to determine whether a subject can be administered an agent (e.g., an agonist, antagonist, peptidomimetic, protein, peptide, polynucleotide, small molecule, or other drug candidate) to treat or prevent CVH associated with aberrant CVHG expression or activity, such as, for example, a cytokine. For example, such methods can be used to determine whether a subject can be effectively treated with an agent to inhibit CVH. Thus, the present invention provides methods for determining whether a subject can be effectively treated with an agent for CVH associated with aberrant CVHG expression or activity.
Prognostic assays can be devised to determine whether a subject undergoing treatment for CVH has a poor outlook for disease progression. In a preferred embodiment, prognosis can be determined shortly after diagnosis, i.e., within a few days. By establishing expression profiles of different stages of CVHGs, from onset to later stages, an expression pattern may emerge to correlate a particular expression profile to increased likelihood of a poor prognosis. The prognosis may then be used to devise a more aggressive treatment program and enhance the likelihood of success.
The methods of the invention can also be used to detect genetic alterations in a CVHG, thereby determining if a subject with the altered gene is at risk for damage characterized by aberrant regulation in CVHG expression or activity. In preferred embodiments, the methods include detecting, in a sample of cells from the subject, the presence or absence of a genetic alteration characterized by at least one alteration affecting the integrity of a CVHG, or the aberrant expression of the CVHG. For example, such genetic alterations can be detected by ascertaining the existence of at least one of the following: 1) deletion of one or more nucleotides from a CVHG; 2) addition of one or more nucleotides to a CVHG; 3) substitution of one or more nucleotides of a CVHG, 4) a chromosomal rearrangement of a CVHG; 5) alteration in the level of a messenger RNA transcript of a CVHG, 6) aberrant modification of a CVHG, such as of the methylation pattern of the genomic DNA, 7) the presence of a non-wild type splicing pattern of a messenger RNA transcript of a CVHG, 8) non-wild type level of a CVHPP, 9) allelic loss of a CVHG, and 10) inappropriate post-translational modification of a CVHPP. As described herein, there are a large number of assays known in the art, which can be used for detecting alterations in a CVHG or a CVHG product. A preferred biological sample is a blood sample isolated by conventional means from a subject.
In certain embodiments, detection of the alteration involves the use of a probe/primer in a polymerase chain reaction (PCR), such as anchor PCR or RACE PCR, or, alternatively, in a ligation chain reaction (LCR), the latter of which can be particularly useful for detecting point mutations in the CVHG. This method can include the steps of collecting a sample of cells from a subject, isolating a polynucleotide sample (e.g., genomic, mRNA or both) from the cells of the sample, contacting the polynucleotide sample with one or more primers which specifically hybridize to a CVHG under conditions such that hybridization and amplification of the CVHG (if present) occurs, and detecting the presence or absence of an amplification product, or detecting the size of the amplification product and comparing the length to a control sample. It is understood that PCR and/or LCR may be desirable to be used as a preliminary amplification step in conjunction with any of the techniques used for detecting mutations described herein.
Alternative amplification methods include: self-sustained sequence replication, transcriptional amplification system, Q-Beta Replicase, or any other polynucleotide amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of polynucleotide molecules if such molecules are present in very low numbers.
In an alternative embodiment, mutations in an CVHG from a sample cell can be identified by alterations in restriction enzyme cleavage patterns. For example, sample and control DNA is isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis and compared. Differences in fragment length sizes between sample and control DNA indicate mutations in the sample DNA. Moreover, sequence specific ribozymes (see, for example, U.S. Pat. No. 5,498,531) can be used to score for the presence of specific mutations by development or loss of a ribozyme cleavage site.
In other embodiments, genetic mutations in a CVHG can be identified by hybridizing sample and control polynucleotides, e.g., DNA or RNA, to high density arrays containing hundreds or thousands of oligonucleotides probes. For example, genetic mutations in a CVHG can be identified in two dimensional arrays containing light generated DNA probes. Briefly, a first hybridization array of probes can be used to scan through long stretches of DNA in a sample and control to identify base changes between the sequences by making linear arrays of sequential overlapping probes. This step allows the identification of point mutations. This step is followed by a second hybridization array that allows the characterization of specific mutations by using smaller, specialized probe arrays complementary to all variants or mutations detected. Each mutation array is composed of parallel probe sets, one complementary to the wild-type gene and the other complementary to the mutant gene.
In yet another embodiment, any of a variety of sequencing reactions known in the art can be used to directly sequence the CVHG and detect mutations by comparing the sequence of the sample CVHG with the corresponding wild-type (control) sequence. It is also contemplated that any of a variety of automated sequencing procedures can be utilized when performing the diagnostic assays, including sequencing by mass spectrometry.
Other methods for detecting mutations in a CVHG include methods in which protection from cleavage agents is used to detect mismatched bases in RNA/RNA or RNA/DNA heteroduplexes. In general, the art technique of âmismatch cleavageâ starts by providing heteroduplexes by hybridizing (labeled) RNA or DNA containing the wild-type CVHG sequence with potentially mutant RNA or DNA obtained from a tissue sample. The double-stranded duplexes are treated with an agent which cleaves single-stranded regions of the duplex, which will exist due to basepair mismatches between the control and sample strands. For instance, RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated with S1 nuclease to enzymatically digest the mismatched regions. In other embodiments, either DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and with piperidine in order to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then separated by size on denaturing polyacrylamide gels to determine the site of mutation. In a preferred embodiment, the control DNA or RNA can be labeled for detection.
In still another embodiment, the mismatch cleavage reaction employs one or more proteins that recognize mismatched base pairs in double-stranded DNA (so called âDNA mismatch repairâ enzymes) in defined systems for detecting and mapping point mutations in CVHG cDNAs obtained from samples of cells. For example, the mutY enzyme of E. coli cleaves A at G/A mismatches and the thymidine DNA glycosylase from HeLa cells cleaves T at G/T mismatches. According to an exemplary embodiment, a probe based on an CVHG sequence, e.g., a wild-type CVHG sequence, is hybridized to cDNA or other DNA product from a test cell(s). The duplex is treated with a DNA mismatch repair enzyme, and the cleavage products, if any, can be detected from electrophoresis protocols or the like. See, for example, U.S. Pat. No. 5,459,039.
In other embodiments, alterations in electrophoretic mobility will be used to identify mutations in CVHGs. For example, single-strand conformation polymorphism (SSCP) may be used to detect differences in electrophoretic mobility between mutant and wild type polynucleotides. Single-stranded DNA fragments of sample and control CVHG polynucleotides will be denatured and allowed to renature. The secondary structure of single-stranded polynucleotides varies according to sequence. The resulting alteration in electrophoretic mobility enables the detection of even a single base change. The DNA fragments may be labeled or detected with labeled probes. The sensitivity of the assay may be enhanced by using RNA (rather than DNA) in which the secondary structure is more sensitive to a change in sequence. In a preferred embodiment, the subject method utilizes heteroduplex analysis to separate double-stranded heteroduplex molecules on the basis of changes in electrophoretic mobility (Keen et al. Trends Genet. 7:5, 1991).
In yet another embodiment the movement of mutant or wild-type fragments in polyacrylamide gels containing a gradient of denaturant is assayed using denaturing gradient gel electrophoresis (DGGE). When DGGE is used as the method of analysis, DNA will be modified to insure that it does not completely denature, for example, by adding a GC clamp of approximately 40 bp of high-melting GC-rich DNA by PCR. In a further embodiment, a temperature gradient is used in place of a denaturing gradient to identify differences in the mobility of control and sample DNA (Rosenbaum and Reissner Biophys Chem 265:12753, 1987).
Examples of other techniques for detecting point mutations include, but are not limited to, selective oligonucleotide hybridization, selective amplification, and selective primer extension. For example, oligonucleotide primers may be prepared in which the known mutation is placed centrally and then hybridized to target DNA under conditions which permit hybridization only if a perfect match is found (Saiki et al. Proc. Natl. Acad. Sci. USA 86:6230, 1989). Such allele specific oligonucleotides are hybridized to PCR amplified target or a number of different mutations when the oligonucleotides are attached to the hybridizing membrane and hybridized with labeled target DNA.
Alternatively, allele specific amplification technology which depends on selective PCR amplification may be used in conjunction with the instant invention. Oligonucleotides used as primers for specific amplification may carry the mutation of interest in the center of the molecule (so that amplification depends on differential hybridization) or at the extreme 3âČ end of one primer where, under appropriate conditions, mismatch can prevent or reduce polymerase extension. In addition, it may be desirable to introduce a novel restriction site in the region of the mutation to create cleavage-based detection. It is anticipated that, in certain embodiments, amplification may also be performed using Taq ligase for amplification. In such cases, ligation will occur only if there is a perfect match at the 3âČ end of the 5âČ sequence, thus making it possible to detect the presence of a known mutation at a specific site by looking for the presence or absence of amplification.
The methods described herein may be performed, for example, by utilizing prepackaged diagnostic kits comprising at least one probe polynucleotide or antibody reagent described herein, which may be conveniently used, e.g., in clinical settings to diagnose subjects exhibiting symptoms or family history of a disease or illness involving a CVHG.
Furthermore, any cell type or tissue in which a CVHG is expressed may be utilized in the prognostic or diagnostic assays described herein.
Monitoring the influence of agents (e.g., drugs, small molecules, proteins, nucleotides) on the expression or activity of a CVHPP can be applied not only in basic drug screening, but also in clinical trials. For example, the effectiveness of an agent determined by a screening assay, as described herein to decrease CVHG expression or activity, can be monitored in clinical trials of subjects exhibiting increased CVHG expression or activity. In such clinical trials, the expression or activity of an CVHG can be used as a âread-outâ of the phenotype of a particular tissue.
For example, and not by way of limitation, CVHGs that are modulated in tissues by treatment with an agent can be identified. Thus, to study the effect of agents on the CVHPP in a clinical trial, cells can be isolated and RNA prepared and analyzed for the levels of expression of an CVHG. The levels of gene expression or a gene expression pattern can be quantified by Northern blot analysis, RT-PCR or GeneChipÂź as described herein, or alternatively by measuring the amount of protein produced, by one of the methods as described herein, or by measuring the levels of activity of CVHPP. In this way, the gene expression pattern can serve as a read-out, indicative of the physiological response of the cells to the agent. Accordingly, this response state may be determined before treatment and at various points during treatment of the individual with the agent.
In a preferred embodiment, the present invention provides a method for monitoring the effectiveness of treatment of a subject with an agent (e.g., an agonist, antagonist, peptidomimetic, protein, peptide, polynucleotide, small molecule, or other drug candidate identified by the screening assays described herein) including the steps of (i) obtaining a pre-administration sample from a subject prior to administration of the agent; (ii) detecting the level of expression of a CVHG protein or mRNA in the pre-administration sample; (iii) obtaining one or more post-administration samples from the subject; (iv) detecting the level of expression or activity of the CVHG protein or mRNA in the post-administration samples; (v) comparing the level of expression or activity of the CVHG protein or mRNA in the pre-administration sample with the CVHG protein or mRNA the post administration sample or samples; and (vi) altering the administration of the agent to the subject accordingly. According to such an embodiment, CVHG expression or activity may be used as an indicator of the effectiveness of an agent, even in the absence of an observable phenotypic response.
The present invention provides for both prophylactic and therapeutic methods of treating a subject at risk for, susceptible to or diagnosed with CVH. With regard to both prophylactic and therapeutic methods of treatment, such treatments may be specifically tailored or modified, based on knowledge obtained from the field of pharmacogenomics. âPharmacogenomics,â as used herein, includes the application of genomics technologies such as gene sequencing, statistical genetics, and gene expression analysis to drugs in clinical development and on the market. More specifically, the term refers the study of how a subject's genes determine his or her response to a drug (e.g., a subject's âdrug response phenotypeâ or âdrug response genotypeâ). Thus, another aspect of the invention provides methods for tailoring an individual's prophylactic or therapeutic treatment with either the CVHPP molecules of the present invention or CVHPP modulators (e.g., agonists or antagonists) according to that individual's drug response. Pharmacogenomics allows a clinician or physician to target prophylactic or therapeutic treatments to subjects who will most benefit from the treatment and to avoid treatment of subjects who will experience toxic drug-related side effects.
In one aspect, the invention provides a method for preventing in a subject CVH associated with aberrant CVHG expression or activity, by administering to the subject anCVHG product or an agent which modulates CVHG protein expression or activity.
Subjects at risk for CVH which is caused or contributed to by aberrant CVHG expression or activity can be identified by, for example, any or a combination of diagnostic or prognostic assays as described herein.
Administration of a prophylactic agent can occur prior to the manifestation of symptoms characteristic of the differential CVHG protein expression, such that CVH is prevented or, alternatively, delayed in its progression. Depending on the type of CVHG aberrancy (e.g., typically a modulation outside the normal standard deviation), for example, a CVHG product, CVHG agonist or antagonist agent can be used for treating the subject. The appropriate agent can be determined based on screening assays described herein.
Another aspect of the invention pertains to methods of modulating CVHG protein expression or activity for therapeutic purposes. Accordingly, in an exemplary embodiment, the modulatory method of the invention involves contacting a cell with an agent that modulates one or more of the activities of a CVHG product activity associated with the cell. An agent that modulates CVHG product activity can be an agent as described herein, such as a polynucleotide (e.g., an antisense molecule) or a polypeptide (e.g., a dominant-negative mutant of a CVHPP), a naturally-occurring target molecule of a CVHPP (e.g., a CVHPP substrate), an anti-CVHPP antibody, a CVHG modulator (e.g., agonist or antagonist), a peptidomimetic of a CVHG protein agonist or antagonist, or other small molecules.
The invention further provides methods of modulating a level of expression of a CVHG of the invention, comprising administration to a subject having CVH, a variety of compositions which correspond to the CVHGs of Tables 3-8, including proteins or antisense oligonucleotides. The protein may be provided by further providing a vector comprising a polynucleotide encoding the protein to the cells. Alternatively, the expression levels of the CVHGs of the invention may be modulated by providing an antibody, a plurality of antibodies or an antibody conjugated to a therapeutic moiety. Treatment with the antibody may further be localized to the tissue comprising CVH. In another aspect, the invention provides methods for localizing a therapeutic moiety to CVH tissue or cells comprising exposing the tissue or cells to an antibody which is specific to a protein encoded by the CVHGs of the invention. This method may therefore provide a means to inhibit expression of a specific gene corresponding to a CVHG listed in Tables 3-8.
The invention also provides methods of assessing the efficacy of a test compound or therapy for inhibiting CVH in a subject. These methods involve isolating samples from a subject suffering from CVH, who is undergoing treatment or therapy, and detecting the presence, quantity, and/or activity of one or more CVHGs of the invention in the first sample relative to a second sample. Where the efficacy of a test compound is determined, the first and second samples are preferably sub-portions of a single sample taken from the subject, wherein the first portion is exposed to the test compound and the second portion is not. In one aspect of this embodiment, the CVHG is expressed at a substantially decreased level in the first sample, relative to the second. Most preferably, the level of expression in the first sample approximates (i.e., is less than the standard deviation for normal samples) the level of expression in a third control sample, taken from a control sample of normal tissue. This result suggests that the test compound inhibits the expression of the CVHG in the sample. In another aspect of this embodiment, the CVHG is expressed at a substantially increased level in the first sample, relative to the second. Most preferably, the level of expression in the first sample approximates (i.e., is less than the standard deviation for normal samples) the level of expression in a third control sample, taken from a control sample of normal tissue. This result suggests that the test compound augments the expression of the CVHG in the sample.
Where the efficacy of a therapy is being assessed, the first sample obtained from the subject is preferably obtained prior to provision of at least a portion of the therapy, whereas the second sample is obtained following provision of the portion of the therapy. The levels of CVHG product in the samples are compared, preferably against a third control sample as well, and correlated with the presence, or risk of presence, of CVH. Most preferably, the level of CVHG product in the second sample approximates the level of expression of a third control sample. In the present invention, a substantially decreased level of expression of a CVHG indicates that the therapy is efficacious for treating CVH.
The CVHG protein and polynucleotide molecules of the present invention, as well as agents, inhibitors or modulators which have a stimulatory or inhibitory effect on CVHG expression or activity as identified by a screening assay described herein, can be administered to individuals to treat (prophylactically or therapeutically) CVH associated with aberrant CVHG activity.
In conjunction with such treatment, pharmacogenomics (i.e., the study of the relationship between an individual's genotype and that individual's response to a foreign compound or drug) may be considered. Differences in metabolism of therapeutics can lead to severe toxicity or therapeutic failure by altering the relation between dose and blood concentration of the pharmacologically active drug. Thus, a physician or clinician may consider applying knowledge obtained in relevant pharmacogenomics studies in determining whether to administer a CVHG product (polynucleotide or polypeptide) or CVHG modulator as well as tailoring the dosage and/or therapeutic regimen of treatment with a CVHG product or CVHG modulator.
Pharmacogenomics deals with clinically significant hereditary variations in the response to drugs due to altered drug disposition and abnormal action in affected persons. In general, two types of pharmacogenetic conditions can be differentiated. Genetic conditions transmitted as a single factor altering the way drugs act on the body (altered drug action) or genetic conditions transmitted as single factors altering the way the body acts on drugs (altered drug metabolism). These pharmacogenetic conditions can occur either as rare genetic defects or as naturally-occurring polymorphisms. For example, glucose-6-phosphate dehydrogenase deficiency (G6PD) is a common inherited enzymopathy in which the main clinical complication is hemolysis after ingestion of oxidant drugs (anti-malarials, sulfonamides, analgesics, nitrofurans) and consumption of fava beans.
One pharmacogenomics approach to identifying genes that predict drug response, known as âa genome-wide association,â relies primarily on a high-resolution map of the human genome consisting of already known gene-related sites (e.g., a âbi-allelicâ gene marker map which consists of 60,000-100,000 polymorphic or variable sites on the human genome, each of which has two variants). Such a high-resolution genetic map can be compared to a map of the genome of each of a statistically substantial number of subjects taking part in a Phase II/III drug trial to identify genes associated with a particular observed drug response or side effect. Alternatively, such a high resolution map can be generated from a combination of some ten-million known single nucleotide polymorphisms (SNPs) in the human genome. As used herein, an âSNPâ is a common alteration that occurs in a single nucleotide base in a stretch of DNA. For example, an SNP may occur once per every 1,000 bases of DNA. An SNP may be involved in a disease process. However, the vast majority of SNPs may not be disease associated. Given a genetic map based on the occurrence of such SNPs, individuals can be grouped into genetic categories depending on a particular pattern of SNPs in their individual genome. In such a manner, treatment regimens can be tailored to groups of genetically similar individuals, taking into account traits that may be common among such genetically similar individuals. Thus, mapping of the CVHGs of the invention to SNP maps of CVH patients may allow easier identification of these genes according to the genetic methods described herein.
Alternatively, a method termed the âcandidate gene approach,â can be utilized to identify genes that predict drug response. According to this method, if a gene that encodes a drug target is known (e.g., a CVHG of the present invention), all common variants of that gene can be fairly easily identified in the population and it can be determined if having one version of the gene versus another is associated with a particular drug response.
As an illustrative embodiment, the activity of drug metabolizing enzymes is a major determinant of both the intensity and duration of drug action. The discovery of genetic polymorphisms of drug metabolizing enzymes (e.g., N-acetyltransferase 2 (NAT 2) and cytochrome P450 enzymes CYP2D6 and CYPZC19) has provided an explanation as to why some subjects do not obtain the expected drug effects or show exaggerated drug response and serious toxicity after taking the standard and safe dose of a drug. These polymorphisms are expressed in two phenotypes in the population, the extensive metabolizer and poor metabolizer. The prevalence of poor metabolizer phenotypes is different among different populations. For example, the gene coding for CYP2D6 is highly polymorphic and several mutations have been identified in poor metabolizers, which all lead to the absence of functional CYP2D6. Poor metabolizers of CYP2D6 and CYP2C19 quite frequently experience exaggerated drug response and side effects when they receive standard doses. If a metabolite is the active therapeutic moiety, poor metabolizers show no therapeutic response, as demonstrated for the analgesic effect of codeine mediated by its CYP2D6-formed metabolite morphine. The other extreme are the so called ultra-rapid metabolizers who do not respond to standard doses. Recently, the molecular basis of ultra-rapid metabolism has been identified to be due to CYP2D6 gene amplification.
Alternatively, a method termed the âgene expression profilingâ can be utilized to identify genes that predict drug response. For example, the gene expression of an animal dosed with a drug (e.g., CVHG expression in response to a CVHG modulator of the present invention) can give an indication whether gene pathways related to toxicity have been turned on.
Information generated from more than one of the above pharmacogenomics approaches can be used to determine appropriate dosage and treatment regimens for prophylactic or therapeutic treatment an individual. This knowledge, when applied to dosing or drug selection, can avoid adverse reactions or therapeutic failure and thus enhance therapeutic or prophylactic efficiency when treating a subject with a CVHG product or CVHG modulator, such as a modulator identified by one of the exemplary screening assays described herein.
The invention is further directed to pharmaceutical compositions comprising the test compound, or bioactive agent, or an CVHG modulator (i.e., agonist or antagonist), which may further include a CVHG product, and can be formulated as described herein. Alternatively, these compositions may include an antibody which specifically binds to a CVHG protein of the invention and/or an antisense polynucleotide molecule which is complementary to a CVHG polynucleotide of the invention and can be formulated as described herein.
One or more of the CVHGs of the invention, fragments of CVHGs, CVHG products, fragments of CVHG products, CVHG modulators, or anti-CVHPP antibodies of the invention can be incorporated into pharmaceutical compositions suitable for administration.
As used herein the language âpharmaceutically acceptable carrierâ is intended to include any and all solvents, solubilizers, fillers, stabilizers, binders, absorbents, bases, buffering agents, lubricants, controlled release vehicles, diluents, emulsifying agents, humectants, lubricants, dispersion media, coatings, antibacterial or antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well-known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary agents can also be incorporated into the compositions.
The invention includes methods for preparing pharmaceutical compositions for modulating the expression or activity of a polypeptide or polynucleotide corresponding to a CVHG of the invention. Such methods comprise formulating a pharmaceutically acceptable carrier with an agent which modulates expression or activity of a CVHG. Such compositions can further include additional active agents. Thus, the invention further includes methods for preparing a pharmaceutical composition by formulating a pharmaceutically acceptable carrier with an agent which modulates expression or activity of a CVHG and one or more additional bioactive agents.
A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), intraperitoneal, transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine; propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfate; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor ELâą (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the injectable composition should be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the requited particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
Sterile injectable solutions can be prepared by incorporating the active compound (e.g., a fragment of a CVHPP or an anti-CVHPP antibody) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose; a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Stertes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
For administration by inhalation, the compounds are delivered in the form of an aerosol spray from a pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the bioactive compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
The compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
In one embodiment, the therapeutic moieties, which may contain a bioactive compound, are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from e.g. Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art.
It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form, as used herein, includes physically discrete units suited as unitary dosages for the subject to be treated; each unit contains a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.
Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds which exhibit large therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that includes the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.
The CVHGs of the invention can be inserted into gene delivery vectors and used as gene therapy vectors. Gene therapy vectors can be delivered to a subject by, for example, intravenous administration, intraportal administration, intrabiliary administration, intra-arterial administration, direct injection into the liver parenchyma, by intramuscular injection, by inhalation, by perfusion, or by stereotactic injection. The pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can include one or more cells which produce the gene delivery system.
The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.
The invention also encompasses kits for detecting the presence of a CVHG product in a biological sample, the kit comprising reagents for assessing expression of the CVHGs of the invention. Preferably, the reagents may be an antibody or fragment thereof, wherein the antibody or fragment thereof specifically binds with a protein corresponding to a CVHG from Table 4. For example, antibodies of interest may be prepared by methods known in the art. Optionally, the kits may comprise a polynucleotide probe wherein the probe specifically binds with a transcribed polynucleotide corresponding to a CVHG selected from the group consisting of the CVHGs listed in Tables 3-8. The kits may also include an array of CVHGs arranged on a biochip, such as, for example, a GeneChipÂź. The kit may contain means for determining the amount of the CVHG protein or mRNA in the sample; and means for comparing the amount of the CVHG protein or mRNA in the sample with a control or standard. The compound or agent can be packaged in a suitable container. The kit can further comprise instructions for using the kit to detect CVHG protein or polynucleotide
The invention further provides kits for assessing the suitability of each of a plurality of compounds for inhibiting CVH in a subject. Such kits include a plurality of compounds to be tested, and a reagent (i.e., antibody specific to corresponding proteins, or a probe or primer specific to corresponding polynucleotides) for assessing expression of a CVHG listed in Tables 3-8.
The invention also includes an array comprising a panel of CVHGs of the present invention. The array can be used to assay expression of one or more genes in the array.
It will be appreciated by one skilled in the art that the panels of CVHGs of the invention may conveniently be provided on solid supports, such as a biochip. For example, polynucleotides may be coupled to an array (e.g., a biochip using GeneChipÂź for hybridization analysis), to a resin (e.g., a resin which can be packed into a column for column chromatography), or a matrix (e.g., a nitrocellulose matrix for Northern blot analysis). The immobilization of molecules complementary to the CVHG(s), either covalently or noncovalently, permits a discrete analysis of the presence or activity of each CVHG in a sample. In an array, for example, polynucleotides complementary to each member of a panel of CVHGs may individually be attached to different, known locations on the array. The array may be hybridized with, for example, polynucleotides extracted from a blood or colon sample from a subject. The hybridization of polynucleotides from the sample with the array at any location on the array can be detected, and thus the presence or quantity of the CVHG and CVHG transcripts in the sample can be ascertained. In a preferred embodiment, an array based on a biochip is employed. Similarly, Western analyses may be performed on immobilized antibodies specific for CVHPPs hybridized to a protein sample from a subject.
It will also be apparent to one skilled in the art that the entire CVHG product (protein or polynucleotide) molecule need not be conjugated to the biochip support; a portion of the CVHG product or sufficient length for detection purposes (i.e., for hybridization), for example a portion of the CVHG product which is 7, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 100 or more nucleotides or amino acids in length may be sufficient for detection purposes.
In one embodiment, the array can be used to assay gene expression in a tissue to ascertain tissue specificity of genes in the array. In this manner, a large number of genes can be simultaneously assayed for expression. This allows an expression profile to be developed showing a battery of genes specifically expressed in one or more tissues at a given point in time. In one embodiment the invention provides a kit comprising a brochure which comprises at least 5, more preferably 10, more preferably or more CVHGs, and the same CVHGs in computer readable form.
In addition to such qualitative determination, the invention allows the quantitation of gene expression in the biochip. Thus, not only tissue specificity, but also the level of expression of a battery of CVHGs in the tissue is ascertainable. Thus, CVHGs can be grouped on the basis of their tissue expression per se and level of expression in that tissue. As used herein, a ânormal level of expressionâ refers to the level of expression of a gene provided in a control sample, typically the control is taken from either a non-diseased animal or from a subject who has not suffered from CVH. The determination of normal levels of expression is useful, for example, in ascertaining the relationship of gene expression between or among tissues. Thus, one tissue or cell type can be perturbed and the effect on gene expression in a second tissue or cell type can be determined. In this context, the effect of one cell type on another cell type in response to a biological stimulus can be determined. Such a determination is useful, for example, to know the effect of cell-cell interaction at the level of gene expression. If an agent is administered therapeutically to treat one cell type but has an undesirable effect on another cell type, the invention provides an assay to determine the molecular basis of the undesirable effect and thus provides the opportunity to co-administer a counteracting agent or otherwise treat the undesired effect. Similarly, even within a single cell type, undesirable biological effects can be determined at the molecular level. Thus, the effects of an agent on expression of other than the target gene can be ascertained and counteracted.
In another embodiment, the arrays can be used to monitor the time course of expression of one or more genes in the array. This can occur in various biological contexts, as disclosed herein, for example development and differentiation, disease progression, in vitro processes, such as cellular transformation and activation.
The array is also useful for ascertaining the effect of the expression of a gene on the expression of other genes in the same cell or in different cells. This provides, for example, for a selection of alternate molecular targets for therapeutic intervention if the ultimate or downstream target cannot be regulated.
Importantly, the invention provides arrays useful for ascertaining differential expression patterns of one or more genes identified in diseased tissue versus non-diseased tissue. This provides a battery of genes that serve as a molecular target for diagnosis or therapeutic intervention. In particular, biochips can be made comprising arrays not only of the CVHGs listed in Tables 3-8, but of CVHGs specific to subjects suffering from specific manifestations or stages of the disease.
In general, the probes are attached to the biochip in a wide variety of ways, as will be appreciated by those in the art. As described herein, the nucleic acids can either be synthesized first, with subsequent attachment to the biochip, or can be directly synthesized on the biochip.
The biochip comprises a suitable solid substrate. By âsubstrateâ or âsolid supportâ or other grammatical equivalents herein is meant any material that can be modified to contain discrete individual sites appropriate for the attachment or association of the nucleic acid probes and is amenable to at least one detection method. As will be appreciated by those in the art, the number of possible substrates are very large, and include, but are not limited to, glass and modified or functionalized glass, plastics (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, TeflonJ, etc.), polysaccharides, nylon or nitrocellulose, resins, silica or silica-based materials including silicon and modified silicon, carbon, metals, inorganic glasses, plastics, etc.
Generally the substrate is planar, although as will be appreciated by those in the art, other configurations of substrates may be used as well. For example, the probes may be placed on the inside surface of a tube, for flow-through sample analysis to minimize sample volume. Similarly, the substrate may be flexible, such as a flexible foam, including closed cell foams made of particular plastics.
In a preferred embodiment, the surface of the biochip and the probe may be derivatized with chemical functional groups for subsequent attachment of the two. Thus, for example, the biochip is derivatized with a chemical functional group including, but not limited to, amino groups, carboxy groups, oxo groups and thiol groups, with amino groups being particularly preferred. Using these functional groups, the probes can be attached using functional groups on the probes. For example, nucleic acids containing amino groups can be attached to surfaces comprising amino groups. Linkers, such as homo- or hetero-bifunctional linkers, may also be used.
In an embodiment, the oligonucleotides are synthesized as is known in the art, and then attached to the surface of the solid support. As will be appreciated by those skilled in the art, either the 5âČ or 3âČ terminus may be attached to the solid support, or attachment may be via an internal nucleoside.
In an additional embodiment, the immobilization to the solid support may be very strong, yet non-covalent. For example, biotinylated oligonucleotides can be made, which bind to surfaces covalently coated with streptavidin, resulting in attachment.
Alternatively, the oligonucleotides may be synthesized on the surface, as is known in the art. For example, photoactivation techniques utilizing photopolymerization compounds and techniques are used. In a preferred embodiment, the nucleic acids can be synthesized in situ, using well known photolithographic techniques.
Modifications to the above-described compositions and methods of the invention, according to standard techniques, will be readily apparent to one skilled in the art and are meant to be encompassed by the invention. This invention is further illustrated by the following examples which should not be construed as limiting. The contents of all references, patents and published patent applications cited throughout this application, as well as the Figures and Tables are incorporated herein by reference.
New born rats were sensitized by infusion of 0.2 mls of 0.5% acetic acid into the colon at P10, control animals received saline.
At eight weeks of age, rats in four treatment groups: control+vehicle (n=3), control+cni-1493 (n=3), sensitized+vehicle (n=8), sensitized+cni-1493 (n=8) were tested after administration of drug (dissolved in 2.5% mannitol, injected i.p. at 5 mg/kg for four days) for sensitivity to colorectal distention (CRD). Vehicle injected animals received 2.5% mannitol in water.
For electromyographic (EMG) measurements of visceromotor responses, under anesthesia (Nembutal, 50 mg/kg i.p.), two electrodes were implanted in the abdominal wall muscles and externalized behind the head. Rats were allowed a one week recovery time from this surgery. Under mild sedation (Brevital, 5 ml of 1% ip), a 7 cm flexible balloon constructed from a surgical glove finger attached to tygon tubing was inserted into the descending colon and rectum via the anus and held in place by taping the tubing to the tail. Rats were housed in small Lucite cubicles (20Ă8Ă8 cm) and were allowed to adapt for one hour. CRD was performed by rapidly inflating the balloon to constant pressure. Pressure was measured using a sphygmomanometer connected to a pressure transducer. Rats were given graded CRD (20, 40, 60, 80 mm Hg) applied for 20 seconds every 4 minutes.
The behavioral measurements consisted of visual observation of the abdominal withdrawal reflex (AWR) by blinded observers and the assignment of an AWR score:
0, no response;
1, brief head movement followed by immobility;
2, contraction of abdominal muscles;
3, lifting of abdomen;
4, body arching and lifting of pelvic structures.
Descending colons were placed in 10% buffered formalin and portions were frozen for myeloperoxidase (MPO) assays. Haematoxilin & Eosin stained paraffin sections will be scored for inflammation by a pathologist.
Colons and S1 dorsal root ganglia were snap frozen in liquid nitrogen. Colon tissue RNA and S1 dorsal root ganglia RNA was prepared using RNAzol.
An in vitro transcription reaction was performed using 500 ng cDNA which contained a T7 RNA polymerase promoter incorporated during RNA amplification. The cRNA or Target RNAs produced during this in vitro transcription reaction were labeled with biotin. Biotin-labeled Target RNAs were fragmented to a mean size of 200 bases to facilitate their hybridization to probe sequences on the Gene Chip (Affymetrix) array. Each Target RNA sample was initially hybridized to a test array. This array contains a set of probes representing genes that are commonly expressed in the majority of cells (example Rat: actin, GAPDH, hexokinase, 5S rRNA, and B1/B2 repetitive elements). Test arrays confirmed the successful labeling of the target RNAs and prevented the use of degraded or non-representative target RNA samples. Success and consistency of RNA amplification between samples were also confirmed with these test arrays.
Hybridization of Gene Chip (Affymetrix) arrays was performed at 45° C. for 16 hours in 0.1 M MES pH6.6, 1 M sodium chloride, 0.02 M EDTA and 0.01% Tween 20. Four prokaryotic genes (bio B, bio C and bio D from the E. coli biotin synthesis pathway and the cre recombinase gene from P1 bacteriophage) were added to the hybridization cocktail as internal controls. These control RNAs were used to normalize expression levels between experiments. Because the control RNAs were added at varying copy number (Bio B, 1.5 pM; Bio C, 5 pM; Bio D, 25 pM and cre, 100 pM) they were also used in estimating relative abundance of RNA transcripts in the sample. Arrays were washed using both non-stringent (1 M NaCl, 25° C.) and stringent (1 M NaCl, 50° C.) conditions prior to staining with phycoerythrin streptavidin (10 ug/ml final). Gene Chip arrays were scanned using a Gene Array Scanner (Hewlett Packard) and analyzed using the Affymetric Gene Chip Analysis Suite 5.0 software.
Gene expression profiles were produced from Affymetrix rat genome 230A chips.
Single array analysis for each chip was performed by Affymetrix Microarray Suite (MAS) software to produce a detection call, present, absent or marginal and a signal intensity value for each gene that is a relative measure of abundance of the transcript. For comparison of signal intensity values between chips, all chips were scaled to an average intensity of 500. Genes called âAbsentâ across all chips and genes without a |Fold change|â§2.0 in at least one of the pairwise comparisons of chips from different treatment groups were excluded. The probe sets with absolute call âAbsentâ across all chips and |Fold change|<2.0 in all of the possible pairwise comparisons were filtered out. These filters were applied as the first level filters to reduce the noise from the dataset. ANOVA was performed on the filtered dataset. Significant changes in gene expression were detected by analyzing signal intensity values by two-way ANOVA with 99% confidence limits. Genes were subjected to cluster analysis to identify genes associated with sensitization and treatment.
Primer or primer/probe sets were designed using Primer Express software (Applied Biosystems, Foster City, Calif.) such that the amplimer spanned an intron/exon boundary where possible. Where ESTs were homologous to known genes, the sequence of the known gene was used. RT-PCR was performed using Applied Biosystems reagents and kits: Taqman Reverse Transcription Reagents N8080234 and Taqman PCR Core Reagents N8080228. PCR was performed on a GeneAmp 5700 Sequence Detection System (Applied Biosystems). Machine default PCR program was used: 2 min at 50° C., 10 min at 95° C., 45 cycles: 95° C. 15 sec, 60° C. 1 min. Fold change was calculated using delta Ct and/or relative standard curve procedures using GAPDH or b-actin as normalizers for colon genes and PGP9.5 for DRG. Data is expressed as fold change relative to control, vehicle treated values.
| DesminâNM_022531 | |
| Forwardâprimerâ(FP) | |
| GTGGAGCGTGACAACCTGATAG | |
| Reverseâprimerâ(RP) | |
| TGCGCTCTAGGTCAATTCGA | |
| CEBP/deltaâNM_013154âMar.â3,â2004âSYBRâgreen | |
| FP | |
| CCGCCCGAATTGCTACAGT | |
| RP | |
| AGTCTGTCGGAAAAGTCTTTTCTACAA | |
| ESTâhomologousâtoâF-boxâproteins | |
| FP | |
| CCGTGTGCAAGTGTGTAGCAT | |
| RP | |
| GCCGCAGCCCGAAAG | |
| PEP19 | |
| FP | |
| GCTGGAGCAACCAATGGAAA | |
| RP | |
| TCTGTCTCTGGTGCATCCATGT | |
| Probe | |
| TCTâTCTâTGGâACCâTTCâTTâCTGâCCCâATCâATT |
| FPâ1001-1022 | |
| CAACCTCAAACAGTGCAAGATG | |
| RPâ1182-1163 | |
| TGGTTTACTGCACCCTTTGG | |
| MetalloproteinaseâADAMTS-1 | |
| FP | |
| AGGGACCGGAAGTTACTTCCA | |
| RP | |
| CAGGTGTGGGAGCCACATAA | |
| Tubulin,âbetaâ3 | |
| FP | |
| GGGCCTTTGGACACCTATTCA | |
| RP | |
| GCCCTTTGGCCCAGTTGT | |
| PROBE | |
| CâACCâACTâCTGâACCâGAAâGATâAAAâGTTâGTCâAGG | |
| ArgalbâNM_053770âFeb.â19,â2004 | |
| FP | |
| GAATCCCCACAGCCATTAGAAC | |
| RP | |
| GCGAGTTGTACAGACCTGCATT | |
| Probe | |
| ACAâTGTâCTGâTGTâCCTâCATâCCGâGCTâTGT | |
| Stathmin-likeâ2â(scgn10) | |
| FP | |
| TCGGAAGCTCCACGAACTCT | |
| RP | |
| CTCGCTCGTGCTCCCTCTT |
Myeloperoxidase (MPO) assays were performed as described (Bhatia et al., Proc Natl Acad Sci USA 95:4760-4756, 1998). Frozen colon was homogenized in 20 mM phosphate buffer pH 7.4 and centrifuged at 10,000Ăg for 10 minutes at 4° C. Pellet was resuspended in 50 mM phosphate buffer, pH 6.0 containing 0.5% hexadecyltrimethylammonium bromide. Samples were subjected to one cycle of freeze thawing, were incubated at 60° C. for 2 hrs and centrifuged at 10,000Ăg for 5 min at 4° C. Change in absorbance at 655 nM was measured in reaction mix containing 1.6 mM TMB (Sigma) and 0.3 mM H2O2 on a Beckman DU-64 spectrophotometer. Activity was normalized to protein as measured in the extracts. Protein was measured by the BCA method (Pierce, Rockford, Ill.). Activity was expressed as the change in absorbance/min/mg protein.
Previous studies showed that either mechanical irritation or treatment with mustard oil of the colons of young rats between P7 and P12 produced chronic visceral hyperalgesia (ref). To determine whether treatment of the colon of young rats with acetic acid would produce visceral hyperalgesia in adults, the colon of P10 rats was infused with 0.5% acetic acid; control littermates received saline. Rats were tested at 8 weeks of age for sensitivity to CRD and colons were examined for histopathological evidence of inflammation. Adult rats treated with acetic acid on P10 exhibited increased sensitivity to CRD compared to controls (FIG. 1). Data was analyzed by two-way repeated measures ANOVA with distention pressure as the repeated factor and P10 treatment as a between group factor. There was a significant effect of P10 treatment (F 1, 12.98) p<0.003, of distention pressure (F 7, 89.9) p<0.001, and there was a significant interaction between distention pressure and P10 treatment (F 7, 4.04) p<0.001. Means were compared with a Tukey test. Significant differences between AA treated and controls were found at distention pressures of 30 (p=0.004), 40 (p<0.001), 50 (p<0.001), 60 (p=0.001) and 70 (p=0.035) mm Hg. Chemical treatment of colon of P10 rats produces chronic visceral hypersensitivity.
Rats were treated for 4 days with CNI1493 and sensitivity to CRD was measured after treatment. Sensitivity to CRD was significantly reduced by drug treatment F(1, 5.46) p=0.05 (FIG. 2) but was unchanged in vehicle treated rats. Data was analyzed by two-way repeated measures ANOVA with distention pressure as the repeated factor and drug treatment as a between group factor. There was a significant effect of CNI1493 treatment (F 1, 16.96) p=0.001, of distention pressure (F 7, 28.55) p<0.001, but there was no significant interaction between distention pressure and CNI-1493 treatment (F 7, 1.94) p=0.071. Means were compared with a Tukey test. Significant differences between CNI-1493 treated and controls were found at distention pressures of 20 (P=0.001), 30 (p=0.003), 40 (p<0.001), 50 (p=0.001), 60 (p<0.001) and 70 (p=0.015) and 80 (p=0.007) mm Hg.
To determine whether P10 colon irritation produced chronic inflammation, H&E stained colon sections were examined for signs of inflammation and MPO activity in colon extracts was examined. No differences in appearance of the sections were noted between treatment groups and no overt signs of inflammation were observed. Mucosal architecture was normal, there was no cellular infiltrate, and there was no depletion of goblet cells. No differences were observed in colon histopathology (FIG. 3A-3D). There was a significant increase in MPO activity in the sensitized rats compared to controls (FIG. 3E). CNI-1493 treatment significantly lowered MPO activity in sensitized rats. These findings suggest that there was a low grade inflammation or increased lymphocytes present in sensitized rats.
To determine the long term effects of P10 colon irritation and of subsequent CNI1493 treatment on gene expression in the colon, gene expression profiles of rat colons from each treatment group derived from Affymetrix rat genome 230A chips were subjected to cluster analysis to identify genes associated with sensitization and treatment. The analysis revealed that 114 genes were differentially expressed in sensitized/CVH colon (Table 3), 76 genes were differentially expressed in sensitized/CVH S1 DRG (Table 4), 660 genes were differentially expressed in CNI1493-treated colon (Table 5), and 137 genes were differentially expressed in CNI1493-treated S1 DRG (Table 6). Since CNI1493 treatment ameliorates CVH in the sensitized animals, genes differentially regulated by CNI1493 may also be related to the etiology of CVH. Accordingly, genes listed in Tables 3-8 are designated as CVH-related genes (CVHGs). Expression levels of a subset of genes from each group were confirmed by quantitative RT-PCR (Table 8).
| TABLE 8 |
| Comparison of chip results with RT-PCR |
| Gene |
| sen + | sen + | |||
| sen + | veh | sen + | CNI | |
| veh | RT- | CNI | RT- | |
| Chip | PCR | Chip | PCR | |
| desmin | 2.6 | 1.7 | 1.3 | 0.8 |
| CCAAT/enhancerbinding | 2.4 | 2.2 | 2.3 | 1.6 |
| (C/EBP) delta | ||||
| EST similar to F-box proteins | 2.4 | 1.9 | 1.2 | 0.6 |
| neuron specific protein PEP-19 | 2.3 | 2.1 | 1.1 | 1.1 |
| Insulin-like growth factor binding | 2.2 | 2.6 | 0.9 | 0.7 |
| protein 2 | ||||
| ADAMTS1 | 2.1 | 2.0 | 1.1 | 0.8 |
| tubulin, beta 3 | 2.1 | 2.9 | 1.5 | 1.3 |
| ArgBP2 | 1.7 | 2.9 | 0.8 | 1.8 |
| scgn10 | 1.5 | 1.3 | 1.1 | 0.4 |
| BDNF | 1.7 | 1.9 | 1.7 | 2.1 |
| phosphodiesterase 3B | 1.8 | 1.6 | 1.1 | 1.2 |
| Trek2 | 2.1 | 1.5 | 1.7 | 0.9 |
| TrkA precursor | 0.7 | 0.8 | 0.7 | 0.7 |
| interleukin 1 receptor, type 1 | 0.5 | 1.1 | 0.6 | 0.8 |
| elongation factor 2 kinase | 0.4 | 1.6 | 0.8 | 1.5 |
1. A method for detecting CVH in a subject, said method comprising:
(a) contacting a biological sample with an agent that specifically binds to a polypeptide encoded by a gene listed in Tables 3-8 or a homolog thereof;
(b) determining a level of binding of the agent to the polypeptide;
(c) comparing the level of binding of the agent in the biological sample to a level of binding of the agent in a normal control sample; and
(d) producing a diagnosis based on a result from step (c).
2. The method of claim 1, wherein said polypeptide comprises an amino acid sequence recited in any one of SEQ ID NOS:34-66.
3. The method of claim 1, wherein the agent is an antibody directed against the polypeptide.
4. A method for detecting CVH in a subject, said method comprising the steps of:
(a) determining a level of a transcribed polynucleotide in a biological sample obtained from the subject, wherein the transcribed polynucleotide is transcribed from a gene listed in Tables 3-8 or homolog thereof;
(b) comparing the level of the transcribed polynucleotide in the biological sample to a normal level of the transcribed polynucleotide; and
(c) producing a diagnosis based on a result from step (b).
5. The method of claim 4, wherein said transcribed polynucleotide comprises a nucleic acid sequence recited in any one of SEQ ID NOS:1-33, or a complement of any of the foregoing nucleic acid sequences.
6. The method of claim 4, wherein the transcribed polynucleotide is an mRNA.
7. A method for detecting CVH in a subject, said method comprising the steps of:
(a) determining an expression pattern of polypeptides in a biological sample, said polypeptides are encoded by the genes listed in Tables 3-8 or homologs thereof;
(b) comparing the expression pattern of polypeptides obtained in (a) to a normal expression pattern of polypeptides; and
(c) producing a diagnosis based on a result from step (b).
8. The method of claim 7, wherein the polypeptides comprise polypeptide sequences recited in SEQ ID NOS:34-66.
9. The method of claim 7, wherein the expression pattern of polypeptides in the biological sample is determined using antibodies directed against the polypeptides.
10. The method of claim 7, wherein the expression pattern of polypeptides is determined by measuring expression levels of at least three polypeptides.
11. A method for detecting CVH in a subject, said method comprising the steps of:
(a) determining an expression pattern of mRNAs in a biological sample, said mRNAs are transcribed from the genes listed in Tables 3-8 or homologs thereof;
(b) comparing the expression pattern of mRNAs obtained in (a) to a normal expression pattern of mRNAs; and
(c) producing a diagnosis based on a result from step (b).
12. The method of claim 11, wherein said mRNAs comprise polynucleotide sequences recited in SEQ ID NOS:1-33.
13. The method of claim 11, wherein the expression pattern of mRNAs is determined by measuring expression levels of at least three mRNAs.
14.-27. (canceled)
24. A biochip comprising at least one of:
(a) a polynucleotide comprising a sequence that hybridizes to a gene listed in Tables 3-8 or a homolog thereof;
(b) a polypeptide comprising at least a portion of a sequence encoded by a gene listed in Tables 3-8.
25. The biochip of claim 24, wherein said polynucleotide comprises a sequence that hybridizes to any one of SEQ ID NOS: 1-33, and wherein said polypeptide comprising any one of SEQ ID NOS:34-66.
26. A diagnostic kit for CVH, said kit comprising at least one of:
a polynucleotide probe, wherein the probe specifically binds to a polynucleotide transcribed from a gene listed in Tables 3-8 or a homolog thereof; and an antibody capable of immunospecific binding to a polypeptide encoded by a gene listed in tables 3-8.
27. The diagnostic kit of claim 26, wherein the probe specifically binds to a transcribed polynucleotide comprising any one of SEQ ID NOS:1-33.
28. The diagnostic kit of claim 26, wherein the antibody specifically binds to a polypeptide comprising any one of SEQ ID NOS:34-66.
29.-31. (canceled)