US20120167255A1
2012-06-28
13/406,375
2012-02-27
Isolated nucleic acid fragments and recombinant constructs comprising such fragments for altering embryo/endosperm size during seed development are disclosed along with a method of controlling embryo/endosperm size during seed development in plants.
Get notified when new applications in this technology area are published.
C12N15/8261 » CPC main
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs); Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
C12N9/0077 » CPC further
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14) with a reduced iron-sulfur protein as one donor (1.14.15)
Y02A40/146 » CPC further
Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture Genetically Modified [GMO] plants, e.g. transgenic plants
C12N15/82 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
C12N5/10 IPC
Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor Cells modified by introduction of foreign genetic material
A01H5/00 IPC
Products
A01H5/00 IPC
Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
A01H5/10 IPC
Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy Seeds
C12N15/63 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
This application is a continuation-in-part of U.S. patent application Ser. No. 10/163,198, filed Jun. 5, 2002, the entire contents of which are hereby incorporated by reference, which claims the benefit of U.S. Provisional Application No. 60/295,921, filed Jun. 5, 2001, the entire contents of which are hereby incorporated by reference, and U.S. Provisional Application No. 60/334,317, filed Nov. 28, 2001, the entire contents of which are hereby incorporated by reference.
The present invention is in the field of plant breeding and genetics and, in particular, relates to recombinant constructs useful for altering embryo/endosperm size during seed development.
Elucidation of how the size of a developing embryo is genetically regulated is important because the final volume of endosperm as a storage organ of starch and proteins is affected by embryo size in cereal crops. Researchers have found that embryo size-related genes contribute to the regulation of endosperm development. Investigation of these genes is important for agriculture because cereal endosperms are the staple diet in many countries. Also, it is important for agriculture because embryos of various crop grains are the source of many valuable nutrients including oil.
The giant embryo (ge) mutation was first described by Satoh and Omura (1981) Jap. J. Breed. 31:316-326. The giant embryo mutant is a potentially useful character for quality improvement in cereals because increased embryo size will result in increased embryo oil and nutrient traits that are desirable for human consumption. Also, the enlargement of embryos would result in increased embryo-related enzymatic activities, which are often important features in the processing of grains. The mutation was genetically mapped to chromosome 7 (Iwata and Omura (1984) Japan. J. Genet. 59: 199-204; Satoh and Iwata (1990) Japan. J. Breed. 40 (Suppl. 2): 268-269), with additional ge alleles also localized to chromosome 7 (Koh et al. (1996) Theor. Appl. Genet. 93:257-261). The ge mutations were analyzed at the morphologic and genetic level by Hong et al. (1994) Development 122:2051-2058. This publication linked the GE gene as being required for proper endosperm development. Since both endosperm and embryo size are affected by the mutation, GE appears to control coordinated proliferation of the endosperm and embryo during development. Beside the morphological change of embryo and endosperm in ge, it was also shown that the ge seed accumulates more oil compared to the wild type (Matsuo et al. (1987) Japan. J. Breed. 37: 185-191; Okuno (1997) In âScience of the Rice Plantâ Vol. III, Matsuo et al. eds., Food and agriculture policy research center, Tokyo, Japan, pp 433-435).
It has been found that loss-of-function of the GE gene leads to an enlargement of embryonic tissue at the expense of endosperm tissue. This developmental change may be useful in increasing the amount of embryo-specific metabolites such as oil in seed-bearing plants. Despite the extensive genetic and morphological characterization of the GE gene there has been no molecular analysis of the nucleic acid encoding this protein. Indeed, the identity of the protein encoded by GE has not been reported. A better understanding of the GE gene, and the protein it encodes, will be required for a complete understanding of the process controlling embryo size in rice.
This invention concerns an isolated nucleotide fragment comprising a nucleic acid sequence selected from the group consisting of:
(a) a nucleic acid sequence encoding a cytochrome P450 polypeptide associated with controlling embryo/endosperm size during seed development having an amino acid identity of at least 61% based on the Clustal method of alignment when compared to a second polypeptide selected from the group consisting of SEQ ID NO:2, 7, 11, 19, 27, or 33; or
(b) a nucleic acid sequence encoding a cytochrome P450 polypeptide associated with controlling embryo/endosperm size during seed development having an amino acid identity of at least 65% based on the Clustal method of alignment when compared to a third polypeptide selected from the group consisting of SEQ ID NO:15, 17, 31, 93, 95, 97, or 99; or
(c) a nucleic acid sequence encoding a cytochrome P450 polypeptide associated with controlling embryo/endosperm size during seed development having an amino acid identity of at least 70% based on the Clustal method of alignment when compared to a fourth polypeptide selected from the group consisting of SEQ ID NO:9, 13, 23, 29, 35, or 41; or
(d) a nucleic acid sequence encoding a cytochrome P450 polypeptide associated with controlling embryo/endosperm size during seed development having an amino acid identity of at least 77% based on the Clustal method of alignment when compared to a second polypeptide selected from the group consisting of SEQ ID NO:21, 25, 37, or 39.
Also of interest is the complement of such isolated nucleotide fragment.
In a second embodiment, this invention concerns such isolated nucleotide sequence or its complement which comprises at least one motif corresponding substantially to any of the amino acid sequences set forth in SEQ ID NOs:2, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 93, 95, 97, or 99 wherein said motif is a conserved subsequence. Examples of such motifs, among others that can be identified, are shown in SEQ ID NOs:80-91. Also of interest is the use of such fragment or a part thereof in antisense inhibition or co-suppression of cytochrome P450 activity in a transformed plant.
In a third embodiment this invention concerns such isolated nucleotide fragment of Claim 1 complement thereof wherein the fragment or a part thereof is useful in antisense inhibition or co-suppression of cytochrome P450 activity in a transformed plant.
In a fourth embodiment this invention concerns an isolated nucleotide sequence fragment comprising a nucleic acid sequence encoding a first polypeptide associated with controlling embryo/endosperm size during seed development wherein said polypeptide has an amino acid identity of at least 50%, 55%, 60%, 61%, 65%, 70%, 75%, 77%, 80%, 85%, 90%, 95%, or 100% based on the Clustal method of alignment when compared to a second polypeptide selected from the group consisting of SEQ ID NO:2, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 42, 43, 44, 45, 46, 47, 93, 95, 97, or 99. Also of interest is the complement of such sequence.
In a fifth embodiment, this invention concerns this isolated nucleotide sequence of or its complement which comprises at least one motif corresponding substantially to any of the amino acid sequences set forth in SEQ ID NOs:2, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 42, 43, 44, 45, 46, 47, 93, 95, 97, or 99, wherein said motif is a conserved subsequence. Any of these fragments or complements or part of either can be useful in antisense inhibition or co-suppression of cytochrome P450 activity in a transformed plant.
In a sixth embodiment, this invention concerns an isolated nucleic acid fragment comprising a promoter wherein said promoter consists essentially of the nucleotide sequence set forth in SEQ ID NOs:3, 4, 104, or 105, or said promoter consists essentially of a fragment or subfragment that is substantially similar and functionally equivalent to the nucleotide sequence set forth in SEQ ID NOs:3, 4, 104, or 105.
In a seventh embodiment, this invention concerns chimeric constructs comprising any of the foregoing nucleic acid fragment or complement thereof or part of either operably linked to at least one regulatory sequence. Also, of interest are plants comprising such chimeric constructs in their genome, plant tissue or cells obtained from such plants, seeds obtained from these plants and oil obtained from such seeds.
In an eighth embodiment, this invention concerns a method of controlling embryo/endosperm size during seed development in plants which comprises:
(a) transforming a plant with a chimeric construct of the invention;
(b) growing the transformed plant under conditions suitable for the expression of the chimeric construct; and
(c) selecting those transformed plants which produce seeds having an altered embryo/endosperm size.
In a ninth embodiment, this invention concerns a method to isolate nucleic acid fragments encoding polypeptides associated with controlling embryo/endosperm size during seed development which comprises:
(a) comparing SEQ ID NOs:2, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 42, 43, 44, 45, 46, 47, 93, 95, 97, or 99, with other polypeptide sequences associated with controlling embryo/endosperm size during seed development;
(b) identifying the conserved sequences(s) or 4 or more amino acids obtained in step (a);
(c) making region-specific nucleotide probe(s) or oligomer(s) based on the conserved sequences identified in step (b); and
(d) using the nucleotide probe(s) or oligomer(s) of step (c) to isolate sequences associated with controlling embryo/endosperm size during seed development by sequence dependent protocols.
In a tenth embodiment, this invention also concerns a method of mapping genetic variations related to controlling embryo/endosperm size during seed development and/or altering oil phenotypes in plants comprising:
(a) crossing two plant varieties; and
(b) evaluating genetic variations with respect to:
In an eleventh embodiment, this invention concerns a method of molecular breeding to obtain altered embryo/endosperm size during seed development and/or altered oil phenotypes in plants comprising:
(a) crossing two plant varieties; and
(b) evaluating genetic variations with respect to:
The invention can be more fully understood from the following detailed description and the accompanying drawings and Sequence Listing which form a part of this application.
FIG. 1 shows an alignment of the sequence of the GE gene and ge mutant alleles. The allelic mutations resulting in a giant embryo phenotype are noted by a â*â on the complementary strand. Each mutation is labeled and the base change is shown (the corresponding complementary base changes on the coding strand are noted below) and the resulting amino acid change is noted parenthetically (i.e. wild-type->mutant). The ge-1 mutant had a mutation that alters the G at nucleotide 1482 to an A, changing the corresponding Trp residue to a premature translational stop (UGG codon to UGA). In ge-2, the G at nucleotide 1451 was altered to A, again changing the encoded Trp to a premature translational stop (UAG). In ge-3 and ge-9, the C at nucleotide 1177 was altered to T, changing a Pro residue, which is highly conserved among cytochrome P450 proteins, into Ser. In ge-4, the C at nucleotide 1388 was altered to G, changing a Pro residue into Ala. In ge-5, the C at nucleotide 28 was altered to T, causing a premature translational stop (UAA). In ge-6, the A at nucleotide 1067 was altered to C, causing the change of Gln, which is conserved among the CYP78 group, into Pro. In ge-8, we found two mutations: the T at nucleotide 559 was altered to C, causing the change of Ser to Pro, and the C at nucleotide 1328 was altered to T, causing the change of Pro to Leu. One 91 nucleotide-long intron was found between nucleotides 972 and 973.
FIG. 2 shows an alignment of the rice GE (SEQ ID NO:2), barley GE-homolog (SEQ ID NO:93), maize GE1-homolog (SEQ ID NO:95), maize GE2-homolog (SEQ ID NO:97), maize GE3-homolog (SEQ ID NO:99), lily GE-homolog (SEQ ID NO:41), orchid gi 1173624 (SEQ ID NO:43), Arabidopsis gi 1235138 (SEQ ID NO:42), Arabidopsis gi 8920576 (SEQ ID NO:47), columbine GE-homolog (SEQ ID NO:35), soybean GE-homolog (SEQ ID NO:23), Arabidopsis gi 11249511 (SEQ ID NO:44), soybean gi 5921926 (SEQ ID NO:45), soybean GE-homolog (SEQ ID NO:25), soybean GE-homolog (SEQ ID NO:21), and Arabidopsis gi 3831440 (SEQ ID NO:46). The boxed residues are predicted helical regions identified by the Bioscout DSC program (King and Sternberg (1996) Protein Sci 5:2298-2310). Other boxed elements include âSRSâ or substrate-recognition-sites which are hypervariable sequences in the cytochrome P450 structure, âPPPâ clusters of prolines often Pro-Pro-Gly-Pro in cytochrome P450s, âF-G loopâ which is the substrate access channel (part of the conserved sequence motif of SEQ ID NO:83), the conserved âGXDTâ the proton transfer groove involved in heme interaction and enzyme catalysis (part of the conserved sequence motif of SEQ ID NO:85), âEXXRâ the K-helix motif conserved in all cytochrome P450s necessary for heme stabilization and core structure stability (part of conserved sequence motif of SEQ ID NO:88), and âFXXGXRXCXGâ the conserved heme binding site with the cysteine that contacts the heme (part of the conserved sequence motif of SEQ ID NO:90).
FIG. 3 shows GE ectopic expression leads to a reduced embryo and enlarged endosperm phenotype in maize.
FIG. 4A-B shows the oil content analysis of segregating Ubi::GE seeds. F1 kernels of a Ubi::GE backcrossed to wild type were analyzed for seed oil content (3797701). The transgenic construct segregated in a 1:1 fashion. FIG. 4B shows the percent oil distribution of a control transgenic line that does not affect embryo/endosperm size.
FIG. 5 A-C shows A) wild type (T65) seed, B) ge-3 mutant seed in T65 background, and C) ge-3 mutant with the complementing EcoRI 5.1 kb fragment.
FIG. 6 shows seed expressing GE 5 Kbp HYG in age background (2-15), seed expressing GE 5 Kbp HYG in a wild-typeT65 background (3-23), and wild type seed (T65).
FIG. 7 shows GE ectopic expression leads to enlarged seed in rice
FIG. 8A-D shows GE ectopic expression leads to enlarged flowers and seed in Arabidopsis. A and C show a wild type flower and seed, respectively; and B and D show a 35S::GE expressing flower and seed.
FIG. 9A-F shows GE ectopic expression in soybean under 35S promoter.
A: HygR Control event (SRS 163-3-1-1); B: Jack wild-type seed;
C: An event with small seed (SRS 103-3-1-3; D: Jack wild-type seed;
E: An event with large seed (SRS 162-9-1); F: Jack wild-type seed.
Table 1 lists the polypeptides that are described herein, the designation of the genomic or cDNA clones that comprise the nucleic acid fragments encoding polypeptides representing all or a substantial portion of these polypeptides, and the corresponding identifier (SEQ ID NO:) as used in the attached Sequence Listing. The sequence descriptions and Sequence Listing attached hereto comply with the rules governing nucleotide and/or amino acid sequence disclosures in patent applications as set forth in 37 C.F.R. §1.821-1.825.
| TABLE 1 |
| Genes Encoding Enzymes Associated With Altering |
| Embryo/Endosperm Size During Seed Development |
| SEQ ID NO: |
| Cytochrome P450 | (Nucleo- | (Amino | |
| Enzymes | Clone Designation | tide) | Acid) |
| Rice (Oryza sativa) | bac4d1g.pk001.l12.f | 1 | 2 |
| Rice (Oryza sativa) | bac1i1g.pk001.d18 | 3 | |
| Rice (Oryza sativa) | bac4d1g.pk001.o6 | 4 | |
| Rice (Oryza sativa) | bac4d1g.pk001.k21 | 5 | |
| Rice (Oryza sativa) | rca1c.pk007.n11:fis | 6 | 7 |
| Rice (Oryza sativa) | rls2.pk0022.b12:fis | 8 | 9 |
| Rice (Oryza sativa) | rr1.pk0044.e7 | 10 | 11 |
| Maize (Zea mays) | cbn10.pk0034.f8:fis | 12 | 13 |
| Maize (Zea mays) | p0037.crwbn23r | 14 | 15 |
| Maize (Zea mays) | p0121.cfrmn62r:fis | 16 | 17 |
| Maize (Zea mays) | contig of: | 18 | 19 |
| p0014.ctusi51r | |||
| p0014.ctutw92r:fis | |||
| p0022.cglnh53r | |||
| p0122.ckama19r | |||
| p9998.cmrne01rb | |||
| Soybean (Glycine max) | sdp2c.pk042.p12:fis | 20 | 21 |
| Soybean (Glycine max) | contig of: se1.20e06 | 22 | 23 |
| se4.pk0009.e9 | |||
| Soybean (Glycine max) | sfl1.pk0010.a2:fis | 24 | 25 |
| Soybean (Glycine max) | src3c.pk009.k13 | 26 | 27 |
| Sunflower (Helianthus sp.) | hso1c.pk003.n10 | 28 | 29 |
| Sunflower (Helianthus sp.) | hss1c.pk004.b24 | 30 | 31 |
| Wheat (Triticum aestivum) | contig of: | 32 | 33 |
| wdk2c.pk013.c20 | |||
| wre1n.pk0056.b6 | |||
| Columbine (Aquilegia | eav1c.pk006.n4:fis | 34 | 35 |
| vulgaris) | |||
| Grape (Vitis sp.) | veb1c.pk001.k11:fis | 36 | 37 |
| Guayule (Parthenium | epb3c.pk005.d14 | 38 | 39 |
| argentatum Grey) | |||
| Lily (Astroemeria | eae1s.pk003.b24:fis | 40 | 41 |
| caryophylla) | |||
| Barley (Hordeum vulgare) | bdl1c.pk003.h16 | 92 | 93 |
| Maize (Zea mays) | p0037.crwbn23r:fis | 94 | 95 |
| Maize (Zea mays) | cbn10.pk0034.f8.f | 96 | 97 |
| Maize (Zea mays) | cpls1s.pk001.m19 | 98 | 99 |
SEQ ID NO:1 and 2 represent the wild-type open-reading-frame (ORF) DNA sequence and the translated amino acid sequence, respectively, for the rice cytochrome P450 gene, which is responsible for the giant embryo phenotype when mutated. SEQ ID NO:3 represents 17 kb of genomic DNA sequence containing the GE ORF (nucleotides 8301 to 9969) which is interrupted by a 91 nucleotide intron (9273 to 9363). SEQ ID NO:4 represents the 8300 nucleotides upstream of the GE ORF that contains the promoter for the gene and the 5Ⲡuntranslated (UTR) portion of the GE mRNA. SEQ ID NO:5 represents the 7224 nucleotides downstream of the GE ORF that contains the 3â˛-UTR and polyadenylation sequences for the gene. There were no other genes, besides GE, detected by BLAST homology that were contained within this 17 kb region of the rice genome. SEQ ID NOs:80-91 are conserved sequence motifs that are useful in identifying cytochrome P450 genes that are functional homologs of GE. SEQ ID NOs:104 and 105 are upstream promoter sequences for maize homologs zmGE1 and zmGE2, respectively (see Example 13 for more detail). The remaining sequences are PCR primers, adaptors, mutagenesis primers, promoter sequences, terminator sequences, or plasmid vector sequences that were used in making the recombinant DNA/chimeric constructs used in the examples described herein.
The Sequence Listing contains the one letter code for nucleotide sequence characters and the three letter codes for amino acids as defined in conformity with the IUPAC-IUBMB standards described in Nucleic Acids Res. 13:3021-3030 (1985) and in the Biochemical J. 219 (No. 2):345-373 (1984) which are herein incorporated by reference. The symbols and format used for nucleotide and amino acid sequence data comply with the rules set forth in 37 C.F.R. §1.822.
As used herein, an âisolated nucleic acid fragmentâ is a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases. An isolated nucleic acid fragment in the form of a polymer of DNA may be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA. Nucleotides (usually found in their 5â˛-monophosphate form) are referred to by their single letter designation as follows: âAâ for adenylate or deoxyadenylate (for RNA or DNA, respectively), âCâ for cytidylate or deoxycytidylate, âGâ for guanylate or deoxyguanylate, âUâ for uridylate, âTâ for deoxythymidylate, âRâ for purines (A or G), âYâ for pyrimidines (C or T), âKâ for G or T, âHâ for A or C or T, âIâ for inosine, and âNâ for any nucleotide.
The terms âsubfragment that is functionally equivalentâ and âfunctionally equivalent subfragmentâ are used interchangeably herein. These terms refer to a portion or subsequence of an isolated nucleic acid fragment in which the ability to alter gene expression or produce a certain phenotype is retained whether or not the fragment or subfragment encodes an active enzyme. For example, the fragment or subfragment can be used in the design of chimeric constructs to produce the desired phenotype in a transformed plant. Chimeric constructs can be designed for use in co-suppression or antisense by linking a nucleic acid fragment or subfragment thereof, whether or not it encodes an active enzyme, in the appropriate orientation relative to a plant promoter sequence.
The terms âhomologyâ, âhomologousâ, âsubstantially similarâ and âcorresponding substantiallyâ are used interchangeably herein. They refer to nucleic acid fragments wherein changes in one or more nucleotide bases does not affect the ability of the nucleic acid fragment to mediate gene expression or produce a certain phenotype. These terms also refer to modifications of the nucleic acid fragments of the instant invention such as deletion or insertion of one or more nucleotides that do not substantially alter the functional properties of the resulting nucleic acid fragment relative to the initial, unmodified fragment. It is therefore understood, as those skilled in the art will appreciate, that the invention encompasses more than the specific exemplary sequences.
Moreover, the skilled artisan recognizes that substantially similar nucleic acid sequences encompassed by this invention are also defined by their ability to hybridize, under moderately stringent conditions (for example, 1ĂSSC, 0.1% SDS, 60° C.) with the sequences exemplified herein, or to any portion of the nucleotide sequences reported herein and which are functionally equivalent to the gene or the promoter of the invention. Stringency conditions can be adjusted to screen for moderately similar fragments, such as homologous sequences from distantly related organisms, to highly similar fragments, such as genes that duplicate functional enzymes from closely related organisms. Post-hybridization washes determine stringency conditions. One set of preferred conditions involves a series of washes starting with 6ĂSSC, 0.5% SDS at room temperature for 15 min, then repeated with 2ĂSSC, 0.5% SDS at 45° C. for 30 min, and then repeated twice with 0.2ĂSSC, 0.5% SDS at 50° C. for 30 min. A more preferred set of stringent conditions involves the use of higher temperatures in which the washes are identical to those above except for the temperature of the final two 30 min washes in 0.2ĂSSC, 0.5% SDS was increased to 60° C. Another preferred set of highly stringent conditions involves the use of two final washes in 0.1ĂSSC, 0.1% SDS at 65° C.
With respect to the degree of substantial similarity between the target (endogenous) mRNA and the RNA region in the construct having homology to the target mRNA, such sequences should be at least 25 nucleotides in length, preferably at least 50 nucleotides in length, more preferably at least 100 nucleotides in length, again more preferably at least 200 nucleotides in length, and most preferably at least 300 nucleotides in length; and should be at least 80% identical, preferably at least 85% identical, more preferably at least 90% identical, and most preferably at least 95% identical.
Sequence alignments and percent similarity calculations may be determined using a variety of comparison methods designed to detect homologous sequences including, but not limited to, the Megalign program of the LASARGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). Multiple alignment of the sequences are performed using the Clustal method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments and calculation of percent identity of protein sequences using the Clustal method are KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5. For nucleic acids these parameters are KTUPLE=2, GAP PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4.
âGeneâ refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences preceding (5Ⲡnon-coding sequences) and following (3Ⲡnon-coding sequences) the coding sequence. âNative geneâ refers to a gene as found in nature with its own regulatory sequences. âChimeric constructâ refers to a combination of nucleic acid fragments that are not normally found together in nature. Accordingly, a chimeric construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that normally found in nature. A âforeignâ gene refers to a gene not normally found in the host organism, but that is introduced into the host organism by gene transfer. Foreign genes can comprise native genes inserted into a non-native organism, or chimeric constructs. A âtransgeneâ is a gene that has been introduced into the genome by a transformation procedure.
âCoding sequenceâ refers to a DNA sequence that codes for a specific amino acid sequence. âRegulatory sequencesâ refer to nucleotide sequences located upstream (5Ⲡnon-coding sequences), within, or downstream (3Ⲡnon-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences.
âPromoterâ refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. The promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. Accordingly, an âenhancerâ is a DNA sequence which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter. Promoter sequences can also be located within the transcribed portions of genes, and/or downstream of the transcribed sequences. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of an isolated nucleic acid fragment in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. Promoters which cause an isolated nucleic acid fragment to be expressed in most cell types at most times are commonly referred to as âconstitutive promotersâ. New promoters of various types useful in plant cells are constantly being discovered; numerous examples may be found in the compilation by Okamuro and Goldberg, (1989) Biochemistry of Plants 15:1-82. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of some variation may have identical promoter activity.
Specific examples of promoters that may be useful in expressing the nucleic acid fragments of the invention include, but are not limited to, the GE promoter disclosed in this application (SEQ ID NO:4), oleosin promoter (PCT Publication WO99/65479, published on Dec. 12, 1999), maize 27 kD zein promoter (Ueda et al (1994) Mol Cell Bio 14:4350-4359), ubiquitin promoter (Christensen et al (1992) Plant Mol Biol 18:675-680), SAM synthetase promoter (PCT Publication WO00/37662, published on Jun. 29, 2000), or CaMV 35S (Odell et al (1985) Nature 313:810-812).
An âintronâ is an intervening sequence in a gene that does not encode a portion of the protein sequence. Thus, such sequences are transcribed into RNA but are then excised and are not translated. The term is also used for the excised RNA sequences. An âexonâ is a portion of the sequence of a gene that is transcribed and is found in the mature messenger RNA derived from the gene, but is not necessarily a part of the sequence that encodes the final gene product.
The âtranslation leader sequenceâ refers to a DNA sequence located between the promoter sequence of a gene and the coding sequence. The translation leader sequence is present in the fully processed mRNA upstream of the translation start sequence. The translation leader sequence may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency. Examples of translation leader sequences have been described (Turner, R. and Foster, G. D. (1995) Molecular Biotechnology 3:225).
The â3Ⲡnon-coding sequencesâ refer to DNA sequences located downstream of a coding sequence and include polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression. The polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3Ⲡend of the mRNA precursor. The use of different 3Ⲡnon-coding sequences is exemplified by Ingelbrecht et al., (1989) Plant Cell 1:671-680.
âRNA transcriptâ refers to the product resulting from RNA polymerase-catalyzed transcription of a DNA sequence. When the RNA transcript is a perfect complementary copy of the DNA sequence, it is referred to as the primary transcript or it may be a RNA sequence derived from post-transcriptional processing of the primary transcript and is referred to as the mature RNA. âMessenger RNA (mRNA)â refers to the RNA that is without introns and that can be translated into protein by the cell. âcDNAâ refers to a DNA that is complementary to and synthesized from a mRNA template using the enzyme reverse transcriptase. The cDNA can be single-stranded or converted into the double-stranded form using the Klenow fragment of DNA polymerase I. âSenseâ RNA refers to RNA transcript that includes the mRNA and can be translated into protein within a cell or in vitro. âAntisense RNAâ refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA and that blocks the expression of a target isolated nucleic acid fragment (U.S. Pat. No. 5,107,065). The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5Ⲡnon-coding sequence, 3Ⲡnon-coding sequence, introns, or the coding sequence. âFunctional RNAâ refers to antisense RNA, ribozyme RNA, or other RNA that may not be translated but yet has an effect on cellular processes. The terms âcomplementâ and âreverse complementâ are used interchangeably herein with respect to mRNA transcripts, and are meant to define the antisense RNA of the message.
The term âendogenous RNAâ refers to any RNA which is encoded by any nucleic acid sequence present in the genome of the host prior to transformation with the recombinant construct of the present invention, whether naturally-occurring or non-naturally occurring, i.e., introduced by recombinant means, mutagenesis, etc.
The term ânon-naturally occurringâ means artificial, not consistent with what is normally found in nature.
The term âoperably linkedâ refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is regulated by the other. For example, a promoter is operably linked with a coding sequence when it is capable of regulating the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in a sense or antisense orientation. In another example, the complementary RNA regions of the invention can be operably linked, either directly or indirectly, 5Ⲡto the target mRNA, or 3Ⲡto the target mRNA, or within the target mRNA, or a first complementary region is 5Ⲡand its complement is 3Ⲡto the target mRNA.
The term âexpressionâ, as used herein, refers to the production of a functional end-product. Expression of an isolated nucleic acid fragment involves transcription of the isolated nucleic acid fragment and translation of the mRNA into a precursor or mature protein. âAntisense inhibitionâ refers to the production of antisense RNA transcripts capable of suppressing the expression of the target protein. âCo-suppressionâ refers to the production of sense RNA transcripts capable of suppressing the expression of identical or substantially similar foreign or endogenous genes (U.S. Pat. No. 5,231,020).
âMatureâ protein refers to a post-translationally processed polypeptide; i.e., one from which any pre- or propeptides present in the primary translation product have been removed. âPrecursorâ protein refers to the primary product of translation of mRNA; i.e., with pre- and propeptides still present. Pre- and propeptides may be but are not limited to intracellular localization signals.
âStable transformationâ refers to the transfer of a nucleic acid fragment into a genome of a host organism, including both nuclear and organellar genomes, resulting in genetically stable inheritance. In contrast, âtransient transformationâ refers to the transfer of a nucleic acid fragment into the nucleus, or DNA-containing organelle, of a host organism resulting in gene expression without integration or stable inheritance. Host organisms containing the transformed nucleic acid fragments are referred to as âtransgenicâ organisms. The preferred method of cell transformation of rice, corn and other monocots is the use of particle-accelerated or âgene gunâ transformation technology (Klein et al., (1987) Nature (London) 327:70-73; U.S. Pat. No. 4,945,050), or an Agrobacterium-mediated method using an appropriate Ti plasmid containing the transgene (Ishida Y. et al., 1996, Nature Biotech. 14:745-750). The term âtransformationâ as used herein refers to both stable transformation and transient transformation.
Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter âSambrookâ).
The term ârecombinantâ refers to an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated segments of nucleic acids by genetic engineering techniques.
âPCRâ or âPolymerase Chain Reactionâ is a technique for the synthesis of large quantities of specific DNA segments, consists of a series of repetitive cycles (Perkin Elmer Cetus Instruments, Norwalk, Conn.). Typically, the double stranded DNA is heat denatured, the two primers complementary to the 3Ⲡboundaries of the target segment are annealed at low temperature and then extended at an intermediate temperature. One set of these three consecutive steps is referred to as a cycle.
Polymerase chain reaction (âPCRâ) is a powerful technique used to amplify DNA millions of fold, by repeated replication of a template, in a short period of time. (Mullis et al, Cold Spring Harbor Symp. Quant. Biol. 51:263-273 (1986); Erlich et al, European Patent Application 50,424; European Patent Application 84,796; European Patent Application 258,017, European Patent Application 237,362; Mullis, European Patent Application 201,184, Mullis et al U.S. Pat. No. 4,683,202; Erlich, U.S. Pat. No. 4,582,788; and Saiki et al, U.S. Pat. No. 4,683,194). The process utilizes sets of specific in vitro synthesized oligonucleotides to prime DNA synthesis. The design of the primers is dependent upon the sequences of DNA that are desired to be analyzed. The technique is carried out through many cycles (usually 20-50) of melting the template at high temperature, allowing the primers to anneal to complementary sequences within the template and then replicating the template with DNA polymerase.
The products of PCR reactions are analyzed by separation in agarose gels followed by ethidium bromide staining and visualization with UV transillumination. Alternatively, radioactive dNTPs can be added to the PCR in order to incorporate label into the products. In this case the products of PCR are visualized by exposure of the gel to x-ray film. The added advantage of radiolabeling PCR products is that the levels of individual amplification products can be quantitated.
The terms ârecombinant constructâ, âexpression constructâ and ârecombinant expression constructâ are used interchangeably herein. These terms refer to a functional unit of genetic material that can be inserted into the genome of a cell using standard methodology well known to one skilled in the art. Such construct may be itself or may be used in conjunction with a vector. If a vector is used then the choice of vector is dependent upon the method that will be used to transform host plants as is well known to those skilled in the art. For example, a plasmid vector can be used. The skilled artisan is well aware of the genetic elements that must be present on the vector in order to successfully transform, select and propagate host cells comprising any of the isolated nucleic acid fragments of the invention. The skilled artisan will also recognize that different independent transformation events will result in different levels and patterns of expression (Jones et al., (1985) EMBO J. 4:2411-2418; De Almeida et al., (1989) Mol. Gen. Genetics 218:78-86), and thus that multiple events must be screened in order to obtain lines displaying the desired expression level and pattern. Such screening may be accomplished by Southern analysis of DNA, Northern analysis of mRNA expression, Western analysis of protein expression, or phenotypic analysis.
Co-suppression constructs in plants previously have been designed by focusing on overexpression of a nucleic acid sequence having homology to an endogenous mRNA, in the sense orientation, which results in the reduction of all RNA having homology to the overexpressed sequence (see Vaucheret et al. (1998) Plant J 16:651-659; and Gura (2000) Nature 404:804-808). The overall efficiency of this phenomenon is low, and the extent of the RNA reduction is widely variable. Recent work has described the use of âhairpinâ structures that incorporate all, or part, of an mRNA encoding sequence in a complementary orientation that results in a potential âstem-loopâ structure for the expressed RNA (PCT Publication WO 99/53050 published on Oct. 21, 1999). This increases the frequency of co-suppression in the recovered transgenic plants. Another variation describes the use of plant viral sequences to direct the suppression, or âsilencingâ, of proximal mRNA encoding sequences (PCT Publication WO 98/36083 published on Aug. 20, 1998). Both of these co-suppressing phenomena have not been elucidated mechanistically, although recent genetic evidence has begun to unravel this complex situation (Elmayan et al. (1998) Plant Cell 10:1747-1757).
Plant cytochrome P450 enzymes are NADPH-dependent monooxygenases that are responsible for the oxidative metabolism of a variety of compounds in plants. The cytochrome P450s contain iron-sulfur ligands, termed haem-thiolate complexes, that are responsible for a distinctive absorption spectrum with a maximum at 450 nm in the presence of carbon monoxide. In animal systems P450 enzymes are responsible for detoxification pathways in the liver, inactivation and activation of certain carcinogenic compounds, and drug and hormone metabolism. In plants, the cytochrome P450 family is responsible for, but not limited to, herbicide metabolism, secondary metabolism, and wounding responses.
Surprisingly, it has been found that a single mutation of a cytochrome P450 gene in rice can lead to an alteration of embryo/endosperm size during seed development. This gene is named Giant Embryo (GE). Inhibition of the function of the gene leads to enlargement of embryonic tissue at the expense of part of the endosperm tissue. Thus, the GE gene and protein product can regulate proliferation both negatively and positively depending on the tissue. Enlargement of the embryo will result in seeds with high content of valuable components such as oils. A search of GenBank with the rice GE sequence uncovers a number of genes from plants that appear to be homologous.
âGiant embryo-like cytochrome P450â polypeptides would encompass those enzymes from other plants that share sequence and/or functional similarity to the rice GE polypeptide. It is believed that such a polypeptide would comprise a subset of the cytochrome P450 family, and that alteration in the expression of this member would affect embryo-size.
âMotifsâ or âsubsequencesâ refer to short regions of conserved sequences of nucleic acids or amino acids that comprise part of a longer sequence. For example, it is expected that such conserved subsequences (for example SEQ ID NOs:80-91) would be important for function, and could be used to identify new homologues of GE-like cytochrome P450s in plants. It is expected that some or all of the elements may be found in a GE-homologue. Also, it is expected that one or two of the conserved amino acids in any given motif may differ in a true GE-homologue.
Thus, in one aspect, this invention concerns an isolated nucleotide fragment comprising a nucleic acid sequence selected from the group consisting of:
(a) a nucleic acid sequence encoding a cytochrome P450 polypeptide associated with controlling embryo/endosperm size during seed development having an amino acid identity of at least 61% based on the Clustal method of alignment when compared to a second polypeptide selected from the group consisting of SEQ ID NO:2, 7, 11, 19, 27, or 33; or
(b) a nucleic acid sequence encoding a cytochrome P450 polypeptide associated with controlling embryo/endosperm size during seed development having an amino acid identity of at least 65% based on the Clustal method of alignment when compared to a third polypeptide selected from the group consisting of SEQ ID NOs:15, 17, 31, 93, 95, 97, or 99; or
(c) a nucleic acid sequence encoding a cytochrome P450 polypeptide associated with controlling embryo/endosperm size during seed development having an amino acid identity of at least 70% based on the Clustal method of alignment when compared to a third polypeptide selected from the group consisting of SEQ ID NOs:9, 13, 23, 29, 35, or 41; or
(d) a nucleic acid sequence encoding a cytochrome P450 polypeptide associated with controlling embryo/endosperm size during seed development having an amino acid identity of at least 77% based on the Clustal method of alignment when compared to a second polypeptide selected from the group consisting of SEQ ID NOs:21, 25, 37, or 39.
It is well understood by one skilled in the art that many levels of sequence identity are useful in identifying related polypeptide sequences. Useful examples of percent identities are 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or any integer percentage from 55% to 100%.
Also, of interest is the complement of this isolated nucleotide fragment.
The isolated nucleotide sequence or its complement can also comprise at least one, two, three, four, five, six, seven, eight, nine, ten, or eleven motif(s) corresponding substantially to any of the amino acid sequences set forth in SEQ ID NOs:80-91 wherein said motif is a conserved subsequence. In another aspect, this isolated nucleotide fragment or its complement (whether they comprise the aforementioned motif or not) or a part of the fragment or its complement can be used in antisense inhibition or co-suppression of cytochrome P450 activity in a transformed plant. It is appreciated that further embodiments would include at least one, two, three, four, five, six, seven, eight, nine, ten, or eleven motif(s) corresponding substantially to any of the amino acid sequences set forth in SEQ ID NOs:80-91 being used to identify cytochrome P450 polypeptides associated with controlling embryo/endosperm size during seed development.
Protocols for antisense inhibition or co-suppression are well known to those skilled in the art and are described above.
In still a further aspect, this invention concerns an isolated nucleic acid fragment comprising a promoter wherein said promoter consists essentially of the nucleotide sequence set forth in SEQ ID NOs:3, 4, 104, or 105, or said promoter consists essentially of a fragment or subfragment that is substantially similar and functionally equivalent to the nucleotide sequence set forth in SEQ ID NOs:3, 4, 104, or 105.
Also of interest are chimeric constructs comprising any of the above-identified isolated nucleic acid fragments or complements thereof or parts of such fragments or complements operably linked to at least one regulatory sequence.
Plants, plant tissue or plant cells comprising such chimeric constructs in their genome are also within the scope of this invention. Transformation methods are well known to those skilled in the art and are described above. Any plant, dicot or monocot can be transformed with such chimeric constructs.
Examples of monocots include, but are not limited to, corn, wheat, rice, sorghum, millet, barley, palm, lily, Alstroemeria, rye, and oat. Examples of dicots include, but are not limited to, soybean, rape, sunflower, canola, grape, guayule, columbine, cotton, tobacco, peas, beans, flax, safflower, alfalfa.
Plant tissue includes differentiated and undifferentiated tissues or plants, including but not limited to, roots, stems, shoots, leaves, pollen, seeds, tumor tissue, and various forms of cells and culture such as single cells, protoplasm, embryos, and callus tissue. The plant tissue may in plant or in organ, tissue or cell culture.
Also within the scope of this invention are seeds obtained from such plants and oil obtained from these seeds.
In another aspect, this invention concerns a method of controlling embryo/endosperm size during seed development in plants which comprises:
(a) transforming a plant with a chimeric construct of the invention;
(b) growing the transformed plant under conditions suitable for the expression of the chimeric construct; and
(c) selecting those transformed plants which produce seeds having an altered embryo/endosperm size.
The regeneration, development, and cultivation of plants from single plant protoplast transformants or from various transformed explants is well known in the art (Weissbach and Weissbach, In: Methods for Plant Molecular Biology, (Eds.), Academic Press, Inc. San Diego, Calif., (1988)). This regeneration and growth process typically includes the steps of selection of transformed cells, culturing those individualized cells through the usual stages of embryonic development through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil.
The development or regeneration of plants containing the foreign, exogenous isolated nucleic acid fragment that encodes a protein of interest is well known in the art. Preferably, the regenerated plants are self-pollinated to provide homozygous transgenic plants. Otherwise, pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines. Conversely, pollen from plants of these important lines is used to pollinate regenerated plants. A transgenic plant of the present invention containing a desired polypeptide is cultivated using methods well known to one skilled in the art.
There are a variety of methods for the regeneration of plants from plant tissue.
The particular method of regeneration will depend on the starting plant tissue and the particular plant species to be regenerated.
Methods for transforming dicots, primarily by use of Agrobacterium tumefaciens, and obtaining transgenic plants have been published for cotton (U.S. Pat. No. 5,004,863, U.S. Pat. No. 5,159,135, U.S. Pat. No. 5,518,908); soybean (U.S. Pat. No. 5,569,834, U.S. Pat. No. 5,416,011, McCabe et. al., Bio/Technology 6:923 (1988), Christou et al., Plant Physiol. 87:671-674 (1988)); Brassica (U.S. Pat. No. 5,463,174); peanut (Cheng et al., Plant Cell Rep. 15:653-657 (1996), McKently et al., Plant Cell Rep. 14:699-703 (1995)); papaya; and pea (Grant et al., Plant Cell Rep. 15:254-258, (1995)).
Transformation of monocotyledons using electroporation, particle bombardment, and Agrobacterium have also been reported. Transformation and plant regeneration have been achieved in asparagus (Bytebier et al., Proc. Natl. Acad. Sci. (USA) 84:5354, (1987)); barley (Wan and Lemaux, Plant Physiol 104:37 (1994)); Zea mays (Rhodes et al., Science 240:204 (1988), Gordon-Kamm et al., Plant Cell 2:603-618 (1990), Fromm et al., Bio/Technology 8:833 (1990), Koziel et al., Bio/Technology 11: 194, (1993), Armstrong et al., Crop Science 35:550-557 (1995)); oat (Somers et al., Bio/Technology 10: 15 89 (1992)); orchard grass (Horn et al., Plant Cell Rep. 7:469 (1988)); rice (Toriyama et al., TheorAppl. Genet. 205:34, (1986); Part et al., Plant Mol. Biol. 32:1135-1148, (1996); Abedinia et al., Aust. J. Plant Physiol. 24:133-141 (1997); Zhang and Wu, Theor. Appl. Genet. 76:835 (1988); Zhang et al. Plant Cell Rep. 7:379, (1988); Battraw and Hall, Plant Sci. 86:191-202 (1992); Christou et al., Bio/Technology 9:957 (1991)); rye (De la Pena et al., Nature 325:274 (1987)); sugarcane (Bower and Birch, Plant J. 2:409 (1992)); tall fescue (Wang et al., Bio/Technology 10:691 (1992)), and wheat (Vasil et al., Bio/Technology 10:667 (1992); U.S. Pat. No. 5,631,152).
Assays for gene expression based on the transient expression of cloned nucleic acid constructs have been developed by introducing the nucleic acid molecules into plant cells by polyethylene glycol treatment, electroporation, or particle bombardment (Marcotte et al., Nature 335:454-457 (1988); Marcotte et al., Plant Cell 1:523-532 (1989); McCarty et al., Cell 66:895-905 (1991); Hattori et al., Genes Dev. 6:609-618 (1992); Goff et al., EMBO J. 9:2517-2522 (1990)).
Transient expression systems may be used to functionally dissect isolated nucleic acid fragment constructs (see generally, Maliga et al., Methods in Plant Molecular Biology, Cold Spring Harbor Press (1995)). It is understood that any of the nucleic acid molecules of the present invention can be introduced into a plant cell in a permanent or transient manner in combination with other genetic elements such as vectors, promoters, enhancers etc.
In addition to the above discussed procedures, practitioners are familiar with the standard resource materials which describe specific conditions and procedures for the construction, manipulation and isolation of macromolecules (e.g., DNA molecules, plasmids, etc.), generation of recombinant organisms and the screening and isolating of clones, (see for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (1989); Maliga et al., Methods in Plant Molecular Biology, Cold Spring Harbor Press (1995); Birren et al., Genome Analysis: Detecting Genes, 1, Cold Spring Harbor, N.Y. (1998); Birren et al., Genome Analysis: Analyzing DNA, 2, Cold Spring Harbor, N.Y. (1998); Plant Molecular Biology: A Laboratory Manual, eds. Clark, Springer, New York (1997)).
In a still further aspect this invention concerns a method to isolate nucleic acid fragments encoding polypeptides associated with controlling embryo/endosperm size during seed development which comprises:
(a) comparing SEQ ID NOs:2, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 42, 43, 44, 45, 46, 47, 93, 95, 97, or 99, with other polypeptide sequences associated with controlling embryo/endosperm size during seed development;
(b) identifying the conserved sequences(s) or 4 or more amino acids obtained in step (a);
(c) making region-specific nucleotide probe(s) or oligomer(s) based on the conserved sequences identified in step (b); and
(d) using the nucleotide probe(s) or oligomer(s) of step (c) to isolate sequences associated with controlling embryo/endosperm size during seed development by sequence dependent protocols.
Examples of conserved sequence elements that would be useful in identifying other plant sequences associated with controlling embryo/endosperm size during seed development can be found in the group comprising, but not limited to, the nucleotides encoding the polypeptides of SEQ ID NO:80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, or 91.
In another aspect, this invention also concerns a method of mapping genetic variations related to controlling embryo/endosperm size during seed development and/or altering oil phenotypes in plants comprising:
(a) crossing two plant varieties; and
(b) evaluating genetic variations with respect to:
In another embodiment, this invention concerns a method of molecular breeding to obtain altered embryo/endosperm size during seed development and/or altered oil phenotypes in plants comprising:
(a) crossing two plant varieties; and
(b) evaluating genetic variations with respect to:
The terms âmapping genetic variationâ or âmapping genetic variabilityâ are used interchangeably and define the process of identifying changes in DNA sequence, whether from natural or induced causes, within a genetic region that differentiates between different plant lines, cultivars, varieties, families, or species. The genetic variability at a particular locus (gene) due to even minor base changes can alter the pattern of restriction enzyme digestion fragments that can be generated. Pathogenic alterations to the genotype can be due to deletions or insertions within the gene being analyzed or even single nucleotide substitutions that can create or delete a restriction enzyme recognition site. RFLP analysis takes advantage of this and utilizes Southern blotting with a probe corresponding to the isolated nucleic acid fragment of interest.
Thus, if a polymorphism (i.e., a commonly occurring variation in a gene or segment of DNA; also, the existence of several forms of a gene (alleles) in the same species) creates or destroys a restriction endonuclease cleavage site, or if it results in the loss or insertion of DNA (e.g., a variable nucleotide tandem repeat (VNTR) polymorphism), it will alter the size or profile of the DNA fragments that are generated by digestion with that restriction endonuclease. As such, individuals that possess a variant sequence can be distinguished from those having the original sequence by restriction fragment analysis. Polymorphisms that can be identified in this manner are termed ârestriction fragment length polymorphisms: (âRFLPsâ). RFLPs have been widely used in human and plant genetic analyses (Glassberg, UK Patent Application 2135774; Skolnick et al, Cytogen. Cell Genet. 32:58-67 (1982); Botstein et al, Ann. J. Hum. Genet. 32:314-331 (1980); Fischer et al (PCT Application WO 90/13668; Uhlen, PCT Application WO 90/11369).
A central attribute of âsingle nucleotide polymorphismsâ or âSNPsâ is that the site of the polymorphism is at a single nucleotide. SNPs have certain reported advantages over RFLPs or VNTRs. First, SNPs are more stable than other classes of polymorphisms. Their spontaneous mutation rate is approximately 10â9 (Kornberg, DNA Replication, W.H. Freeman & Co., San Francisco, 1980), approximately, 1,000 times less frequent than VNTRs (U.S. Pat. No. 5,679,524). Second, SNPs occur at greater frequency, and with greater uniformity than RFLPs and VNTRs. As SNPs result from sequence variation, new polymorphisms can be identified by sequencing random genomic or cDNA molecules. SNPs can also result from deletions, point mutations and insertions. Any single base alteration, whatever the cause, can be a SNP. The greater frequency of SNPs means that they can be more readily identified than the other classes of polymorphisms.
SNPs can be characterized using any of a variety of methods. Such methods include the direct or indirect sequencing of the site, the use of restriction enzymes where the respective alleles of the site create or destroy a restriction site, the use of allele-specific hybridization probes, the use of antibodies that are specific for the proteins encoded by the different alleles of the polymorphism or by other biochemical interpretation. SNPs can be sequenced by a number of methods. Two basic methods may be used for DNA sequencing, the chain termination method of Sanger et al, Proc. Natl. Acad. Sci. (U.S.A.) 74:5463-5467 (1977), and the chemical degradation method of Maxam and Gilbert, Proc. Natl. Acad. Sci. (U.S.A.) 74: 560-564 (1977).
Furthermore, single point mutations can be detected by modified PCR techniques such as the ligase chain reaction (âLCRâ) and PCR-single strand conformational polymorphisms (âPCR-SSCPâ) analysis. The PCR technique can also be used to identify the level of expression of genes in extremely small samples of material, e.g., tissues or cells from a body. The technique is termed reverse transcription-PCR (âRT-PCRâ).
The term âmolecular breedingâ defines the process of tracking molecular markers during the breeding process. It is common for the molecular markers to be linked to phenotypic traits that are desirable. By following the segregation of the molecular marker or genetic trait, instead of scoring for a phenotype, the breeding process can be accelerated by growing fewer plants and eliminating assaying or visual inspection for phenotypic variation. The molecular markers useful in this process include, but are not limited to, any marker useful in identifying mapable genetic variations previously mentioned, as well as any closely linked genes that display synteny across plant species. The term âsyntenyâ refers to the conservation of gene placement/order on chromosomes between different organisms. This means that two or more genetic loci, that may or may not be closely linked, are found on the same chromosome among different species. Another term for synteny is âgenome colinearityâ.
The present invention is further defined in the following Examples, in which parts and percentages are by weight and degrees are Celsius, unless otherwise stated. It should be understood that these Examples, while indicating preferred embodiments of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims.
The disclosure of each reference set forth herein is incorporated herein by reference in its entirety.
cDNA libraries representing mRNAs from various rice, columbine, grape, guayule, Peruvian lily, corn, soybean, sunflower, and wheat tissues were prepared as described below. The characteristics of the libraries are described below in Table 2.
| TABLE 2 |
| Genomic and cDNA Libraries from Rice, Columbine, Grape, Guayule, |
| Peruvian lily, Corn, Soybean, Sunflower, and Wheat |
| Library | Tissue | Clone |
| bac1i1g | The BAC clone, 1I, is derived from the Texas A&M | bac1i1g.pk001.d18 |
| library. The insert is 100 kb long. This BAC clone | ||
| covers the Giant Embryo region. The average | ||
| insertion length of this library is 1-2 kb. | ||
| bac4d1g | The BAC clone, 4D, is derived from the Texas A&M | bac4d1g.pk001.o6 |
| library. The insert is 80 kb long. This BAC clone | bac4d1g.pk001.k21 | |
| covers part of the Giant Embryo region. The | bac4d1g.pk001.l12.f | |
| average insertion length of this library is 1-2 kb. | ||
| bac1i1g | The BAC clone 1I is derived from the Texas A&M | bac1i1g.pk001.p23 |
| library. The insert is 100 kb long. This BAC clone | ||
| covers the Giant Embryo region. The average | ||
| insertion length of this library is 1-2 kb. | ||
| Bacm | Maize BAC fingerprinting | bacm.pk015.d18.f |
| bacm.pk019.j23 | ||
| bdl1c | Barley (Hordeum vulgaris) leaf tissues infected with | bdl1c.pk003.h16 |
| M grisea (6043) for 48 hours | ||
| eav1c | Columbine (Aquilegia vulgaris) developing seeds | eav1c.pk006.n4:fis |
| (looking for delta 5 desaturase genes) | ||
| veb1c | Grape (Vitis sp.) early berries | veb1c.pk001.k11:fis |
| epb3c | Guayule (Parthenium argentatum, 11591) stem | epb3c.pk005.d14 |
| bark harvested at Dec. 28, 1993- high activity for rubber | ||
| biosynthesis | ||
| eae1s | Alstroemeria cayophylla emerging leaf from mature | eae1s.pk003.b24:fis |
| stem | ||
| cbn10 | Corn Developing Kernel (Embryo and Endosperm); | cbn10.pk0034.f8:fis |
| 10 Days After Pollination | ||
| cpe1c | Corn (Zea mays L.) pooled BMS treated with | cpe1c.pk011.m11 |
| chemicals related to phosphatase | ||
| cpf1c | Corn (Zea mays L.) pooled BMS treated with | cpf1c.pk001.c2 |
| chemicals related to protein synthesis | ||
| cpj1c | Corn (Zea mays L.) pooled BMS treated with | cpj1c.pk002.d2 |
| chemicals related to membrane ionic force | ||
| cpls1s | Maize, leaf sheath, pulvinus region. Identify genes | cpls1s.pk001.m19 |
| that are expressed in the pulvinus region of the leaf | ||
| sheath | ||
| p0022 | Green leaves treated with JA 24 hr before collection | p0022.cglnh53rb |
| [JA] = 1 mg/ml in 0.02% Tween 20 middle ž of | ||
| the 3rd leaf blade and mid rib only (normalized | ||
| P0012) | ||
| p0037 | corn Root Worm infested V5 roots | p0037.crwbn23r |
| p0083 | 7 DAP whole kernels | p0083.cldaq05r |
| p0083.cldaq05ra | ||
| p0121 | shank tissue collected from ears 5DAP, Screened 1 | p0121.cfrmn62r:fis |
| p9998 | Clone confirmations that did not match expected | p9998.cmrne01rb |
| clone | ||
| rca1c | Rice Nipponbare Callus. | rca1c.pk007.n11:fis |
| rls2 | Rice Leaf 15 Days After Germination, 2 Hours After | rls2.pk0022.b12:fis |
| Infection of Strain Magnaporthe grisea 4360-R-67 | ||
| (AVR2-YAMO); Susceptible | ||
| rr1 | Rice Root of Two Week Old Developing Seedling | rr1.pk0044.e7 |
| sdp2c | Soybean (Glycine max L.) developing pods 6-7 mm | sdp2c.pk042.p12:fis |
| se4 | Soybean Embryo, 19 Days After Flowering | se4.pk0009.e9 |
| sfl1 | Soybean Immature Flower | sfl1.pk0010.a2:fis |
| src3c | Soybean 8 Day Old Root Infected With Cyst | src3c.pk009.k13 |
| Nematode | ||
| hso1c | oxalate oxidase-transgenic sunflower plants | hso1c.pk003.n10 |
| hss1c | Sclerotinia infected sunflower plants, purpose | hss1c.pk004.b24 |
| isolation of full length Sclerotinia induced cDNAs | ||
| wdk2c | Wheat Developing Kernel, 7 Days After Anthesis. | wdk2c.pk013.c20 |
cDNA libraries may be prepared by any one of many methods available. For example, the cDNAs may be introduced into plasmid vectors by first preparing the cDNA libraries in Uni-ZAP⢠XR vectors according to the manufacturer's protocol (Stratagene Cloning Systems, La Jolla, Calif.). The Uni-ZAP⢠XR libraries are converted into plasmid libraries according to the protocol provided by Stratagene. Upon conversion, cDNA inserts will be contained in the plasmid vector pBluescript. In addition, the cDNAs may be introduced directly into precut Bluescript II SK(+) vectors (Stratagene) using T4 DNA ligase (New England Biolabs), followed by transfection into DH10B cells according to the manufacturer's protocol (GIBCO BRL Products). Once the cDNA inserts are in plasmid vectors, plasmid DNAs are prepared from randomly picked bacterial colonies containing recombinant pBluescript plasmids, or the insert cDNA sequences are amplified via polymerase chain reaction using primers specific for vector sequences flanking the inserted cDNA sequences. Amplified insert DNAs or plasmid DNAs are sequenced in dye-primer sequencing reactions to generate partial cDNA sequences (expressed sequence tags or âESTsâ; see Adams et al., (1991) Science 252:1651-1656). The resulting ESTs are analyzed using a Perkin Elmer Model 377 fluorescent sequencer.
Full-insert sequence (FIS) data is generated utilizing a modified transposition protocol. Clones identified for FIS are recovered from archived glycerol stocks as single colonies, and plasmid DNAs are isolated via alkaline lysis. Isolated DNA templates are reacted with vector primed M13 forward and reverse oligonucleotides in a PCR-based sequencing reaction and loaded onto automated sequencers. Confirmation of clone identification is performed by sequence alignment to the original EST sequence from which the FIS request is made.
Confirmed templates are transposed via the Primer Island transposition kit (PE Applied Biosystems, Foster City, Calif.) which is based upon the Saccharomyces cerevisiae Ty1 transposable element (Devine and Boeke (1994) Nucleic Acids Res. 22:3765-3772). The in vitro transposition system places unique binding sites randomly throughout a population of large DNA molecules. The transposed DNA is then used to transform DH10B electro-competent cells (Gibco BRL/Life Technologies, Rockville, Md.) via electroporation. The transposable element contains an additional selectable marker (named DHFR; Fling and Richards (1983) Nucleic Acids Res. 11:5147-5158), allowing for dual selection on agar plates of only those subclones containing the integrated transposon. Multiple subclones are randomly selected from each transposition reaction, plasmid DNAs are prepared via alkaline lysis, and templates are sequenced (ABI Prism dye-terminator ReadyReaction mix) outward from the transposition event site, utilizing unique primers specific to the binding sites within the transposon.
Sequence data is collected (ABI Prism Collections) and assembled using Phred/Phrap (P. Green, University of Washington, Seattle). Phred/Phrap is a public domain software program which re-reads the ABI sequence data, re-calls the bases, assigns quality values, and writes the base calls and quality values into editable output files. The Phrap sequence assembly program uses these quality values to increase the accuracy of the assembled sequence contigs. Assemblies are viewed by the Consed sequence editor (D. Gordon, University of Washington, Seattle).
Clones for cDNAs encoding GE-like cytochrome P450 proteins were identified by conducting BLAST searches. (Basic Local Alignment Search Tool; Altschul et al. (1993) J. Mol. Biol. 215:403-410) searches for similarity to sequences contained in the BLAST ânrâ database (comprising all non-redundant GenBank CDS translations, sequences derived from the 3-dimensional structure Brookhaven Protein Data Bank, the last major release of the SWISS-PROT protein sequence database, EMBL, and DDBJ databases). The cDNA sequences obtained in Example 1 were analyzed for similarity to all publicly available DNA sequences contained in the ânrâ database using the BLASTN algorithm provided by the National Center for Biotechnology Information (NCBI). The DNA sequences were translated in all reading frames and compared for similarity to all publicly available protein sequences contained in the ânrâ database using the BLASTX algorithm (Gish and States (1993) Nat. Genet. 3:266-272) provided by the NCBI. For convenience, the P-value (probability) of observing a match of a cDNA sequence to a sequence contained in the searched databases merely by chance as calculated by BLAST are reported herein as âpLogâ values, which represent the negative of the logarithm of the reported P-value. Accordingly, the greater the pLog value, the greater the likelihood that the cDNA sequence and the BLAST âhitâ represent homologous proteins.
ESTs submitted for analysis are compared to the genbank database as described above. ESTs that contain sequences more 5- or 3-prime can be found by using the BLASTn algorithm (Altschul et al (1997) Nucleic Acids Res. 25:3389-3402.) against the Du Pont proprietary database comparing nucleotide sequences that share common or overlapping regions of sequence homology. Where common or overlapping sequences exist between two or more nucleic acid fragments, the sequences can be assembled into a single contiguous nucleotide sequence, thus extending the original fragment in either the 5 or 3 prime direction. Once the most 5-prime EST is identified, its complete sequence can be determined by Full Insert Sequencing as described in Example 1. Homologous genes belonging to different species can be found by comparing the amino acid sequence of a known gene (from either a proprietary source or a public database) against an EST database using the tBLASTn algorithm. The tBLASTn algorithm searches an amino acid query against a nucleotide database that is translated in all 6 reading frames. This search allows for differences in nucleotide codon usage between different species, and for codon degeneracy.
The BLASTX search using the EST sequences from clones listed in Table 3 revealed similarity of the polypeptides encoded by the cDNAs to cytochrome P450 proteins from Arabidopsis [Arabidopsis thaliana] (NCBI General Identifier Nos. gi, [SEQ ID NO:42] which is identical to gi 12325138 and gi 15221132; and gi 11249511, [SEQ ID NO:44]; and gi 3831440, [SEQ ID NO:46]; and gi 8920576, [SEQ ID NO:47]), and a cytochrome P450 protein from orchid [Phalaenopsis sp. SM9108] (NCBI General Identifier No. gi 1173624, [SEQ ID NO:43]), and a cytochrome P450 protein from soybean [Glycine max] (NCBI General Identifier No. gi 5921926, [SEQ ID NO:45]). Shown in Table 3 are the BLAST results for individual ESTs (âESTâ), the sequences of the entire cDNA inserts comprising the indicated cDNA clones (âFISâ), the sequences of contigs assembled from two or more ESTs (âContigâ), sequences of contigs assembled from an FIS and one or more ESTs (âContig*â), or sequences encoding an entire protein derived from an FIS, a contig, or an FIS and PCR (âCGSâ):
| TABLE 3 |
| BLAST Results for Sequences Encoding the Rice Giant Embryo |
| Cytochrome P450 and Polypeptides Homologous To GE |
| BLAST pLog Score |
| Clone | Status | 7109461 | 1173624 | 11249511 | 5921926 | 3831440 | 8920576 |
| bac4d1g.pk001.l12.fis | CGS | 155.0 | |||||
| rca1c.pk007.n11:fis | FIS | 24.0 | |||||
| rls2.pk0022.b12:fis | FIS | 78.3 | |||||
| rr1.pk0044.e7 | EST | 3.5 | |||||
| cbn10.pk0034.f8:fis | FIS | 114.0 | |||||
| p0037.crwbn23r | EST | 63.2 | |||||
| p0121.cfrmn62r:fis | FIS | 156.0 | |||||
| Contig of: | CON | 126.0 | |||||
| p0014.ctusi51r | |||||||
| p0014.ctutw92r:fis | |||||||
| p0022.cglnh53r | |||||||
| p0122.ckama19r | |||||||
| p9998.cmrne01rb | |||||||
| sdp2c.pk042.p12:fis | FIS | 180.0 | |||||
| Contig of: | CON | 180.0 | |||||
| se1.20e06 | |||||||
| se4.pk0009.e9 | |||||||
| sfl1.pk0010.a2:fis | FIS | 180.0 | |||||
| src3c.pk009.k13 | EST | 32.5 | |||||
| hso1c.pk003.n10 | EST | 58.1 | |||||
| hss1c.pk004.b24 | EST | 42.0 | |||||
| contig of: | CON | 27.7 | |||||
| wdk2c.pk013.c20 | |||||||
| wre1n.pk0056.b6 | |||||||
| eav1c.pk006.n4:fis | FIS | 180.0 | |||||
| veb1c.pk001.k11:fis | FIS | 92.4 | |||||
| epb3c.pk005.d14 | EST | 60.7 | |||||
| eae1s.pk003.b24:fis | FIS | 176.0 | |||||
| bdl1c.pk003.h16 | CGS | 154.0 | |||||
| p0037.crwbn23r:fis | GCS | 155.0 | |||||
| cbn10.pk0034.f8.f | CGS | 160.0 | |||||
| cpls1s.pk001.m19 | CGS | 152.0 | |||||
The data in Table 4 represents a calculation of the percent identity of the amino acid sequences set forth in SEQ ID NOs:2, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, and 41, and the cytochrome P450 proteins from Arabidopsis [Arabidopsis thaliana] (NCBI General Identifier Nos. gi 7109461, [SEQ ID NO:42] which is identical to gi 12325138 and gi 15221132; and gi 11249511, [SEQ ID NO:44]; and gi 3831440, [SEQ ID NO:46]; and gi 8920576, [SEQ ID NO:47]), and a cytochrome P450 protein from orchid [Phalaenopsis sp. SM9108] (NCBI General Identifier No. gi 1173624, [SEQ ID NO:43]), and a cytochrome P450 protein from soybean [Glycine max] (NCBI General Identifier No. gi 5921926, [SEQ ID NO:45]).
| TABLE 4 |
| Percent Identity of Amino Acid Sequences Deduced From the Nucleotide |
| Sequences of cDNA Clones Encoding Rice Giant Embryo |
| Cytochrome P450 and Polypeptides Homologous To GE |
| Percent Identity to |
| SEQ ID NO. | 7109461 | 1173624 | 11249511 | 5921926 | 3831440 | 8920576 |
| 2 | 49.1 | 59.6 | ||||
| 7 | 59.0 | |||||
| 9 | 65.9 | |||||
| 11 | 47.6 | |||||
| 13 | 67.0 | |||||
| 15 | 63.3 | |||||
| 17 | 62.0 | |||||
| 19 | 53.2 | 52.2% | ||||
| 21 | 71.1 | |||||
| 23 | 67.1 | |||||
| 25 | 72.7 | |||||
| 27 | 53.4 | |||||
| 29 | 68.1 | 68.8 | ||||
| 31 | 63.2 | |||||
| 33 | 60.0 | |||||
| 35 | 62.7 | 68.8 | ||||
| 37 | 73.6 | 75.0 | ||||
| 39 | 74.0 | |||||
| 41 | 67.1 | |||||
| 93 | 49.6 | 61.3 | ||||
| 95 | 47.5 | 61.7 | ||||
| 97 | 63.8 | |||||
| 99 | 61.3 | |||||
Sequence alignments and percent identity calculations were performed using the Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). Multiple alignment of the sequences was performed using the Clustal method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments using the Clustal method were KTUPLE 1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5. Sequence alignments and BLAST scores and probabilities indicate that the nucleic acid fragments comprising the instant cDNA clones encode a substantial portion of a plant cytochrome P450 protein that shares homology with the rice protein that gives rise to the giant embryo phenotype when mutated.
A chimeric construct comprising a plant cDNA encoding the instant polypeptides in sense orientation with respect to promoter from the maize 27 kD zein, ubiquitin, or CaMV 35S, gene that is located 5Ⲡto the cDNA fragment can be constructed. The 3Ⲡfragment from the 10 kD zein gene [Kirihara et al. (1988) Gene 71:359-370] can be placed 3Ⲡto the cDNA fragment. Such constructs are used to overexpress or cosuppress the gene(s) homologous to GE. It is realized that one skilled in the art could employ different promoters and/or 3â˛-end sequences to achieve comparable expression results. The construct with the CaMV 35S promoter is made as follows: the transcription termination element is released from the clone, In2-1 A, by BglII and Asp718 digestion. The fragment is ligated to SphI and Asp718 restriction sites of pML141 [PCT Application No. WO 00/08162, published Feb. 17, 2000], which carries the 35S promoter, using the linker (GATCCATG) to connect BglII and SphI ends. The DNA containing the GE ORF is amplified through PCR by using a primer set (5â˛-AGAATTCTTCCCATGGCGCTCTCCTCCAT-3â˛, SEQ ID NO:48; and 5â˛-AGAATTCTAGGCCCTAGCCACGGCCTTG-3â˛, SEQ ID NO:49) and the cDNA as a template. The fragment is then digested with EcoRI and inserted to the EcoRI site of the vector between the 35S promoter and the transcription terminator. The appropriate orientation of the insert is confirmed by sequencing.
The construct with the ubiquitin promoter is made as follows: the transcription termination element is released from the clone, In2-1 A, by BclI and KpnI digestion. The fragment is ligated to BamHI and NotI restriction sites of SK-ubi (BbsI), which carries the ubiquitin promoter (maize Ubi-1 promoter, Christensen and Quail (1996) Transgenic Res. 5: 213-218), using the linker (GGCCGTAC) to connect NotI and KpnI ends. The DNA containing the GE ORF is amplified through PCR by using a primer set (5â˛-AGGTCTCCCATGGCGCTCTCCTCCAT-3â˛, SEQ ID NO:50; and 5â˛-ATCATGATCTAGGCCCTAGCCACGGCCTTG-3â˛, SEQ ID NO:51) and the cDNA as a template. The fragment is then digested with BspHI and BsaI and inserted into the BbsI site between the ubiquitin promoter and the transcription terminator.
Plasmid pML103 has been deposited under the terms of the Budapest Treaty at ATCC (American Type Culture Collection, 10801 University Blvd., Manassas, Va. 20110-2209), and bears accession number ATCC 97366. The DNA segment from pML103 contains a 1.05 kb SalI-NcoI promoter fragment of the maize 27 kD zein gene [Prat et al. (1987) Gene 52:51-49; Gallardo et al. (1988) PlantSci. 54:211-2811] and a 0.96 kb SmaI-SalI fragment from the 3Ⲡend of the maize 10 kD zein gene in the vector pGem9Zf(+) (Promega). Vector and insert DNA can be ligated at 15° C. overnight, essentially as described (Maniatis). The ligated DNA may then be used to transform E. coli XL1-Blue (Epicurian Coli XL-1 Blueâ˘; Stratagene). Bacterial transformants can be screened by restriction enzyme digestion of plasmid DNA and limited nucleotide sequence analysis using the dideoxy chain termination method (Sequenase⢠DNA Sequencing Kit; U.S. Biochemical). The resulting plasmid construct would comprise a chimeric construct encoding, in the 5Ⲡto 3Ⲡdirection, the maize 27 kD zein promoter, a cDNA fragment encoding the instant polypeptides, and the 10 kD zein 3Ⲡregion.
The chimeric construct described above can then be introduced into corn cells by the following procedure. Immature corn embryos can be dissected from developing caryopses derived from crosses of the inbred corn lines H99 and LH132. The embryos are isolated 10 to 11 days after pollination when they are 1.0 to 1.5 mm long. The embryos are then placed with the axis-side facing down and in contact with agarose-solidified N6 medium (Chu et al. (1975) Sci. Sin. Peking 18:659-668). The embryos are kept in the dark at 27° C. Friable embryogenic callus consisting of undifferentiated masses of cells with somatic proembryoids and embryoids borne on suspensor structures proliferates from the scutellum of these immature embryos. The embryogenic callus isolated from the primary explant can be cultured on N6 medium and sub-cultured on this medium every 2 to 3 weeks.
The plasmid, p35S/Ac (obtained from Dr. Peter Eckes, Hoechst Ag, Frankfurt, Germany) may be used in transformation experiments in order to provide for a selectable marker. This plasmid contains the Pat gene (see European Patent Publication 0 242 236) which encodes phosphinothricin acetyl transferase (PAT). The enzyme PAT confers resistance to herbicidal glutamine synthetase inhibitors such as phosphinothricin. The pat gene in p35S/Ac is under the control of the 35S promoter from Cauliflower Mosaic Virus (Odell et al. (1985) Nature 313:810-812) and the 3Ⲡregion of the nopaline synthase gene from the T-DNA of the Ti plasmid of Agrobacterium tumefaciens.
The particle bombardment method (Klein et al. (1987) Nature 327:70-73) may be used to transfer genes to the callus culture cells. According to this method, gold particles (1 Οm in diameter) are coated with DNA using the following technique. Ten Οg of plasmid DNAs are added to 50 ΟL of a suspension of gold particles (60 mg per mL). Calcium chloride (50 ΟL of a 2.5 M solution) and spermidine free base (20 ΟL of a 1.0 M solution) are added to the particles. The suspension is vortexed during the addition of these solutions. After 10 minutes, the tubes are briefly centrifuged (5 sec at 15,000 rpm) and the supernatant removed. The particles are resuspended in 200 ΟL of absolute ethanol, centrifuged again and the supernatant removed. The ethanol rinse is performed again and the particles resuspended in a final volume of 30 ΟL of ethanol. An aliquot (5 ΟL) of the DNA-coated gold particles can be placed in the center of a Kapton⢠flying disc (Bio-Rad Labs). The particles are then accelerated into the corn tissue with a Biolistic⢠PDS-1000/He (Bio-Rad Instruments, Hercules Calif.), using a helium pressure of 1000 psi, a gap distance of 0.5 cm and a flying distance of 1.0 cm.
For bombardment, the embryogenic tissue is placed on filter paper over agarose-solidified N6 medium. The tissue is arranged as a thin lawn and covered a circular area of about 5 cm in diameter. The petri dish containing the tissue can be placed in the chamber of the PDS-1000/He approximately 8 cm from the stopping screen. The air in the chamber is then evacuated to a vacuum of 28 inches of Hg. The macrocarrier is accelerated with a helium shock wave using a rupture membrane that bursts when the He pressure in the shock tube reaches 1000 psi.
Seven days after bombardment the tissue can be transferred to N6 medium that contains bialophos (5 mg per liter) and lacks casein or proline. The tissue continues to grow slowly on this medium. After an additional 2 weeks the tissue can be transferred to fresh N6 medium containing bialophos. After 6 weeks, areas of about 1 cm in diameter of actively growing callus can be identified on some of the plates containing the bialophos-supplemented medium. These calli may continue to grow when sub-cultured on the selective medium.
Plants can be regenerated from the transgenic callus by first transferring clusters of tissue to N6 medium supplemented with 0.2 mg per liter of 2,4-D. After two weeks the tissue can be transferred to regeneration medium (Fromm et al. (1990) Bio/Technology 8:833-839).
The 35S promoter of CaMV can be used to over-express and co-suppress the genes homologous to GE in dicot cells. For GE overexpression, the vector KS50 can be used to fuse the GE ORF to the 35S promoter. The GE ORF is amplified by PCR using the primer set with the NotI site at the 3Ⲡend, AGCGGCCGCTTCCCATGGCGCTCTCCT, SEQ ID NO:52, and AGCGGCCGCTCAGGCCCTAGCCACGGC, SEQ ID NO:53. The amplified DNA fragment is digested with NotI and ligated into the NotI site of KS50. The correct orientation of the insert is determined by sequencing. KS50 (7,453 bp) is a derivative of pKS18HH (U.S. Pat. No. 5,846,784) which contains a T7 promoter/T7 terminator controlling the expression of a hygromycin phosphotransferase (HPT) gene, as well as a 35S promoter/NOS terminator controlling the expression of a second HPT gene. KS50 has an insert at the Sal I site consisting of a 35S promoter (960 bp)/NOS terminator (700 bp) cassette taken from pAW28, with a NotI cloning site between the promoter and terminator.
Soybean embryos may then be transformed with the expression vector comprising sequences encoding the instant polypeptides. To induce somatic embryos, cotyledons, 3-5 mm in length dissected from surface sterilized, immature seeds of the soybean cultivar A2872, can be cultured in the light or dark at 26° C. on an appropriate agar medium for 6-10 weeks. Somatic embryos which produce secondary embryos are then excised and placed into a suitable liquid medium. After repeated selection for clusters of somatic embryos which multiplied as early, globular staged embryos, the suspensions are maintained as described below.
Soybean embryogenic suspension cultures can be maintained in 35 mL liquid media on a rotary shaker, 150 rpm, at 26° C. with florescent lights on a 16:8 hour day/night schedule. Cultures are subcultured every two weeks by inoculating approximately 35 mg of tissue into 35 mL of liquid medium.
Soybean embryogenic suspension cultures may then be transformed by the method of particle gun bombardment (Klein et al. (1987) Nature (London) 327:70-73, U.S. Pat. No. 4,945,050). A DuPont Biolistic⢠PDS1000/HE instrument (helium retrofit) can be used for these transformations.
A selectable marker gene which can be used to facilitate soybean transformation is a chimeric construct composed of the 35S promoter from Cauliflower Mosaic Virus (Odell et al. (1985) Nature 313:810-812), the hygromycin phosphotransferase gene from plasmid pJR225 (from E. coli; Gritz et al. (1983) Gene 25:179-188) and the 3Ⲡregion of the nopaline synthase gene from the T-DNA of the Ti plasmid of Agrobacterium tumefaciens. The seed expression cassette comprising the phaseolin 5Ⲡregion, the fragment encoding the instant polypeptides and the phaseolin 3Ⲡregion can be isolated as a restriction fragment. This fragment can then be inserted into a unique restriction site of the vector carrying the marker g ene.
To 50 ÎźL of a 60 mg/mL 1 Îźm gold particle suspension is added (in order): 5 ÎźL DNA (1 Îźg/ÎźL), 20 ÎźL spermidine (0.1 M), and 50 ÎźL CaCl2 (2.5 M). The particle preparation is then agitated for three minutes, spun in a microfuge for 10 seconds and the supernatant removed. The DNA-coated particles are then washed once in 400 ÎźL 70% ethanol and resuspended in 40 ÎźL of anhydrous ethanol. The DNA/particle suspension can be sonicated three times for one second each. Five ÎźL of the DNA-coated gold particles are then loaded on each macro carrier disk.
Approximately 300-400 mg of a two-week-old suspension culture is placed in an empty 60Ă15 mm petri dish and the residual liquid removed from the tissue with a pipette. For each transformation experiment, approximately 5-10 plates of tissue are normally bombarded. Membrane rupture pressure is set at 1100 psi and the chamber is evacuated to a vacuum of 28 inches mercury. The tissue is placed approximately 3.5 inches away from the retaining screen and bombarded three times. Following bombardment, the tissue can be divided in half and placed back into liquid and cultured as described above.
Five to seven days post bombardment, the liquid media may be exchanged with fresh media, and eleven to twelve days post bombardment with fresh media containing 50 mg/mL hygromycin. This selective media can be refreshed weekly. Seven to eight weeks post bombardment, green, transformed tissue may be observed growing from untransformed, necrotic embryogenic clusters. Isolated green tissue is removed and inoculated into individual flasks to generate new, clonally propagated, transformed embryogenic suspension cultures. Each new line may be treated as an independent transformation event. These suspensions can then be subcultured and maintained as clusters of immature embryos or regenerated into whole plants by maturation and germination of individual somatic embryos.
The ge locus was mapped to the region around 85 cM on chromosome 7 using microsatellite and RFLP markers (Koh et al. (1996) Theor. Appl. Genet. 93:257-261). Although numerous RFLP markers and YAC contigs have been mapped to rice chromosomes (Harushima et al. (1998) Genetics 148:479-494; http://rgp.dna.affrc.go.jp), the ge region was located in a 5 cM-long region where no physical markers were found so far. In order to map the ge locus, we made two mapping populations. The ge-3 (Japonica rice cv. Taichung 65) and ge-5 (Japonica rice cv. Kinmaze) homozygous mutant plants were chosen as female parents and Indica rice cultivar Kasalath as a male parent. The resulted F1 plants were selfed to obtain the F2 population. The ge F2 progeny (homozygous for ge) was selected from the F2 population.
To obtain F2 plants that carry recombinations near the ge locus, PCR-based DNA markers were developed. Several known RFLP markers were selected based on their map positions published by the Rice Genome Project Group (RGP) (Harushima et al. (1998) Genetics 148:479-494). The RFLP markers, R1245, R2677 and B2F2, were chosen for the distal markers and the markers, S1848 and C847, were chosen for the proximal markers. Primers were designed to amplify the genomic DNA corresponding to these markers, whose sequences were available from Genbank. For B2F2, which is a barley EST clone, rice homologues were obtained from the DuPont EST database as well as RGP EST database. The primers were designed based on the corresponding rice EST sequence.
A PCR reaction was carried out with 2 pmole primers of two dominant marker sets together, which were specific to the Kasalath sequence of C847 and B2F2. Young leaf tissues obtained from germinated ge F2 plants on N6 medium plates containing 0.3% gelrite were subjected to direct PCR reactions as described in Klimyuk et al. (1993) Plant J. 3:493-494 with modification of extending the sample boiling time to four minutes at the neutralization step. One 30 ul PCR reaction contained 2 ul 2.5 mM dNTPs, 2 ul 25 mM MgCl2, 2 ul DNA extracted from leaf, 0.3 ul Amplitaq gold (Perkin Elmer) and 3 ul PCR buffer. The thermal cycle condition was 95° C. 10 min, 94° C. 30 sec, 56° C. 30 sec, 72° C. 30 sec, 72° C. 5 min repeating step 2 to 4 40 times. Amplification of Kasalath DNA was examined on 2.5 or 3% agarose gels.
By amplifying the marker regions from the parental Japonica and Indica cultivars, several single nucleotide polymorphisms (SNPs) were found. To develop a dominant PCR-based DNA marker from the distal side, one SNP found in C847 was chosen. At this SNP the Japonica sequence had an A residue, whereas the Indica sequence had T. The primer (5â˛GTTTCATAATGAAATTGACTCTTTTTCAGTAA3â˛; SEQ ID NO:54) was designed in a way that the Indica-specific base was complementary to its 3Ⲡend. Using this and the other primer (5â˛GCAAATAATTATTTCTATATACAGGACAGGC3â˛; SEQ ID NO:55) as a set, the corresponding DNA could be amplified only from the Indica. For the proximal side, the B2F2 rice homologue was chosen, which carried a SNP between Japonica (A) and Indica cultivars (T). The designed primer (5â˛TAGCTTTAGAGTACATTTCTTAGATACGGCA3â˛; SEQ ID NO:56) was complementary to the Indica sequence at its 3Ⲡend. In combination with another primer (5â˛TTACTTTGAGCGTGCCAAGCAGTATAATTTCT3â˛; SEQ ID NO:57), DNA was amplified only from Indica but not from Japonica.
By using these Indica-specific primer pairs, 1290 ge homozygous F2 were screened, and 33 recombinants in total were obtained, 15 from the proximal and 18 from the distal ge region.
To obtain the closest physical marker which could serve as a starting point of the chromosome walk toward GE, DNA was isolated from the ends of three YAC clones, Y1931, Y4052 and Y4566. These clones were previously mapped to the region relatively close to the ge locus by RGP. Using a PCR-based method, we recovered and sequenced the both ends of Y4052 and Y1931 and left end of Y4566 (see Methods and Materials). By using primer sets specific to each isolated end, the orientation and overlaps of these YAC clones were analyzed and it was established that the Y4052 left end is the far-most end of the contig of Y4052 and Y4566. To determine which end of Y4052 is close to the ge locus, RFLP was developed for each end. The segregation analysis of ten recombinants from the distal region showed that the Y4052 left end was closer to ge than the right end, leaving 3 and 9 recombination breakpoints, respectively.
Total DNA from yeast YAC strains was extracted. 100 ng DNA was digested by AluI, HaelII and RsaI, and ligated with the vectorette adaptor (5â˛AAGGAGAGGACGCTGTCTGTCGAAGGTAAGGAACGGACGAGAGAAGGG3â˛; SEQ ID NO:58; and 5â˛CTCTCCCTTCTCGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTCTCCTT3â˛; SEQ ID NO:59). 10 ng of ligated DNA was used as PCR template to amplify YAC ends. One PCR reaction contained 20 pmole of the primer specific to the left YAC arm (5â˛CACCCGTTCTCGGAGCACTGTCCGACCGC3â˛; SEQ ID NO:60; or the primer specific to the right arm (5â˛ATATAGGCGCCAGCAACCGCACCTGTGGCG3â˛; SEQ ID NO:61) with 1.6 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl (pH9.0), 0.01% gelatin and 2.5 mM dNTPs. The cycle condition was 95° C. 10 min, 92° C. 1 min, 60° C. 1 min, 72° C. 1 min. After completing 10 cycles of step 2 through 4, the vectorette specific primer was (5â˛CGAATCGTAACCGTTCGTACGAGAATCGCT3â˛; SEQ ID NO:62) was added to the reaction and further amplified in the condition of 92° C. 1 min, 60° C. 1 min and 72° C. 3 min for 30 cycles. The PCR products were separated on agarose gels and amplified DNA was extracted for the second PCR amplification. The second PCR was carried out with the presence of 16 pmole the primer specific to the vectorette unit and 30 pmole the nested primer specific to the YAC left end (5â˛CTGAACCATCTTGGAAGGAC3â˛; SEQ ID NO:63) or the primer specific to the right end (5â˛ACTTGCAAGTCTGGGAAGTG3â˛; SEQ ID NO:64). The cycling condition was 95° C. 10 min, 94° C. 1 min, 58° C. 1 min, 72° C. 1 min, repeating step 2 to step 4 20 times. The recovered ends were cloned into pGEM-T Easy (Promega) and sequenced. The primers derived from the end sequences were used for analyzing the overlapped structure of the YAC contig. Also, these DNA fragments were used to find RFLP to map them with respect to the ge locus.
Based on these results, we initiated a chromosome walk from the Y4052 left end. Two Texas A&M BAC libraries made from the genomic DNA of Taquiq (TQ Indica rice) and Lemont (LM Japonica rice) were used to screen corresponding clones by DNA blot hybridization. Two BAC clones were recovered, TQ1-19L and TQ22-7E, using the Y4052 left end as a probe. The ends of BAC clones were recovered by TAIL PCR and the recovered DNA fragments were cloned into pGEM-T Easy for sequencing (see Materials Methods). Using these sequences, BAC end-specific primer sets were designed and the orientation of these BAC clones in the contig was determined. The data of the PCR analysis showed that the right end (the SP6 side) of TQ1-19L was the new closest end to ge, not present in TQ22-7E and the YAC clones.
The right end of TQ1-19L was used for the second screening of overlapping BAC clones. Three BACs were obtained, LM10-22N, LM10-11O and LM15-7P. The process of recovering BAC ends and mapping per PCR was repeated. For the third screen, the left end was used (the T7 side) of LM15-7P and LM3-6B was obtained. For the fourth screen, the left end of LM3-6B was used and LM20-4D, LM17-3H were obtained. The left end of LM20-4D was mapped to the end of the contig. For the fifth screen, this end was not used as a probe to obtain overlapping BAC clones because of the presence of a repetitive sequence. To obtain an appropriate DNA probe from LM20-4D, the BAC clone was digested by restriction enzyme HindIII and subcloned into pUC18. By DNA blot analysis, one 1.6 kb-long fragment was found not present on the other overlapping clone, LM3-6B, indicating that the fragment was localized toward the end the BAC contig. The 1.6 kb HindIII fragment was used as a probe for the fifth screen and TQ18-11 and LM2-15J were isolated as the overlapping clones. In the sixth screening, the left end of TQ18-11 was used as a probe and two BAC clones, LM4-12E and LM15-20J, were isolated.
The blots of two Texas A&M BAC libraries made from Taquiq, Indica rice; and Lemont, Japonica rice were hybridized with DNA probes using standard DNA hybridization conditions (Sambrook et al. (1989) âMolecular Cloningâ Cold Spring Harbor Laboratory Press, New York). The ends of BAC clones, which were made using the pBeloBAC11 vector, were recovered by TAIL PCR. A typical TAIL PCR reaction was carried out in 20 ul, containing a BAC vector specific primer (4 pmole) and arbitrary degenerated (AD) primers (50 pmole) with 0.2 ul expand hi fidelity Taq polymerase (Roche). Six nested primers specific to the BAC vector were designed:
| BACL1; | ATTCAGGCTGCGCAACTGTTG | SEQâIDâNO:â65 | |
| BACL2; | CTGCAAGGCGATTAAGTTGG | SEQâIDâNO:â66 | |
| BACL3; | GGGTTTTCCCAGTCACGAC | SEQâIDâNO:â67 | |
| BACR1; | TGAGTTAGCTCACTCATTAGGGAC | SEQâIDâNO:â68 | |
| BACR2; | GCTTCCGGCTCGTATGTTGTG | SEQâIDâNO:â69 | |
| BACR3; | GACCATGATTACGCCAAGC | SEQâIDâNO:â70 |
| AD1; | TGWGNAGWANCASAGA | SEQâIDâNO:â71 | |
| AD2; | AGWGNAGWANCAWAGG | SEQâIDâNO:â72 | |
| AD3; | CAWCGICNGAIASGAA | SEQâIDâNO:â73 | |
| AD4; | TCSTICGNACITWGGA | SEQâIDâNO:â74 | |
| AD5; | NGTCGASWGANAWGAA | SEQâIDâNO:â75 | |
| AD6; | GTNCGASWCANAWGTT | SEQâIDâNO:â76 | |
| AD7; | WGTGNAGWANCANAGA | SEQâIDâNO:â77 |
The condition of the first-round PCR was as described by Liu and Whittier 1995, and Liu et al. 1995 with modification of the annealing temperatures changing to 65° C. for the first 5 cycles and 61° C. for the last 15 cycles. In the second PCR, we used 1 ul 1/30 diluted 1st PCR product as a template. The 20 ul reaction contained 8 pmole 2nd BAC vector specific primer, 25 pmole AD primer, and 0.2 ul expand hi fidelity Taq polymerase. The condition of thermal cycle was as described by Liu and Whittier 1995, and Liu et al. 1995 with modification of the annealing temperatures changing to 60° C. for the first two cycles.
3rd PCR was carried out with a normal PCR thermal cycle steps. The reaction contained the 3rd BAC vector specific primer and AD primers. PCR product was cloned into pGEM-T easy vector (Promega) and their DNA sequence was determined by conventional sequencing methods.
Several DNA fragments isolated from these BAC clones that showed polymorphisms between the Japonica and Indica cultivars were used to map recombination break points of the isolated recombinants. As a result, the 1.6 kb HindIII fragment LM20-4D gave three recombination break points, whereas a 950 bp HindIII fragment of TQ18-11 gave no break point among the fifteen distal recombinants. Since the same fragment of TQ18-11 gave one break point among the proximal recombinants, the ge locus was mapped between two makers, 1.6 kb HindIII of LM20-4D and 950 bp HindIII of TQ18-11, i.e. on the two BAC clones, LM20-4D and TQ18-11.
In order to identify the GE gene that was mapped to the region comprising two BAC clones, LM20-4D and TQ18-11, the whole genomic insert of these BAC clones was sequenced. For the purpose, BAC DNA was nebulized using high-pressure nitrogen gas as described in Roe et al. 1996 (Roe et al. (1996) âDNA isolation and Sequencingâ John Wiley and Sons, New York). DNA fragments with the length of 1-2 kb were recovered from agarose gels and cloned into pUC18. 686 clones derived from LM20-4D were randomly isolated and sequenced. Likewise, 700 clones derived from TQ1I-18 were isolated and sequenced. Twelve groups of contiguous sequences were obtained from LM20-4D and 16 from TQ1I-18. Most gaps were filled by PCR and also by obtaining other subclones derived from HindIII or EcoRI fragments of LM20 4D and LM4-12E. This resulted in the construction of a 90 kb-long continuous sequence between two DNA markers, 1.6 kb HindIII LM20-4D and 950 bp HindIII TQ18-1I.
Within the 90 kb sequence, more than ten regions showing certain similarities to genes filed in Genbank as well as in our EST database were identified. Judging from the number of recombinants at the end of the region and the location of these ORFs, one ORF encoding a protein similar to CYP78 proteins, a subfamily of P450 proteins, was found to be a candidate for the GE gene. To confirm the correlation between GE and the P450 gene, the genomic region from mutants and wild type were amplified by PCR. Comparing these sequences, mutations of nine different alleles were identified, all of which were found in the ORF of the P450 gene; three nonsense and six mis-sense mutations were found (see FIG. 1). These data confirm that this rice cytochrome P450 gene is the GE gene, and that mutations within this gene can result in a GE phenotype.
There are a number of P450 genes from GenBank shown to be homologous to GE. Some of them are also expressed in ovules or shoot meristems (Nadeau et al. (1996) Plant Cell 8:213-239; Zondlo and Irish (1999) Plant J. 19:259-268). However, the function of these genes remains largely unknown. In one case, an Arabidopsis gene homologous to GE was overexpressed and the resulting fruit, or pericarp, became enlarged while forming few, if any, seeds or embryos (Ito and Meyerowitz (2000) Plant Cell 12:1541-1550). However, the disruption of this Arabidopsis gene caused no phenotype. It is believed that the characterization, in the present invention, of the rice cytochrome P450 gene as âgiant embryoâ represents the first example of a plant gene directly controlling embryo size.
Cloning the cDNA Encoding Cytochrome P450 Protein Associated with the Giant Embryo Phenotype
Total RNA was extracted from developing rice seeds harvested 2-5 days after pollination, using a TRIazolÂŽ Reagent obtained from Life Technologies Inc., Rockville, Md., 20849 (GIBCO-BRL) which contains phenol and guanidine thiocyanate. Poly A mRNA was purified from total RNA with mRNA Purification kits obtained from Amersham Pharmacia Biotech Inc., Piscataway, N.J., 08855, which consists of oligo (dT)-cellulose spin columns. To make the cDNA library, 5.5 ug of polyA RNA was used for cDNA synthesis kits obtained from Stratagene, La Jolla, Calif., 92037. SuperscriptÂŽ reverse transcriptase obtained from Life Technologies Inc., Rockville, Md., 20849 (GIBCO-BRL) was substituted for the MMLV reverse transcriptase in the first step. BRL cDNA Size Fraction Columns (GIBCO-BRL) were used to fractionate the cDNA by size, fraction 1 to 13 were precipitated, resuspended and ligated with 1 ug of the Uni-ZAP XR vector. After two days of ligation it was packaged in Gigapack III GoldÂŽ packaging extract obtained from Stratagene, La Jolla, Calif., 92037. The unamplified library titer was approximately 780,000 plaques per ml. The entire amount was used for amplification purposes and the procedure produced 150 mls of an amplified cDNA library with a titer of 5.5Ă108 pfu/ml.
Screening for the GE cDNA followed standard protocols well known to those skilled in the art (Ausubel et al. 1993, âCurrent Protocols in Molecular Biologyâ John Wiley & Sons, USA, or Sambrook et al. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press). Briefly, 1.5Ă106 phage clones were plated, then transferred to nylon membranes, which were then subjected to hybridization with radioactively labeled GE probe. More than five positives were detected per 50,000 plaques. Approximately 125 positives were isolated and examined for their identity as GE cDNAs through PCR with GE-specific primers. One primer specific to the 5Ⲡend of the isolated nucleic acid fragment (GGGAAGCGTTCGCGAAGTGAG, SEQ ID NO:78) and the other specific to the cloning vector next to the 5Ⲡend of the cDNA insert (AGCGGATAACAATTTCACACAGG, SEQ ID NO:79). Six of the longest cDNA clones that gave positive results from the PCR reaction were isolated and sequenced. All six clones have nearly the same length, the longest cDNA being 28 nucleotides upstream of the ATG start codon predicted from the genomic sequence.
The genetic confirmation that the rice cytochrome P450 isolated nucleic acid fragment encoded the polypeptide responsible for the giant embryo phenotype was accomplished by transforming ge mutants with the isolated cytochrome P450 cloned sequence. This experiment confirmed that the cytochrome P450 is the GE gene, and that the genomic region used in the transformation contained the complete set of regulatory elements necessary for normal GE expression. The genomic DNA used for the transformation covered 1.7 kb upstream of the coding region, the coding region of GE, and 1.6 kb downstream of the coding region.
GE homologs from other crop species can also be tested in this system by obtaining full-gene sequences, and complementing the rice GE mutant.
In order to confirm possible tissue-specific expression of the GE gene, the presence of the GE transcript in various tissues was analyzed by RNA blot analysis and in situ hybridization (see Example 11).
One method for transforming DNA into cells of higher plants that is available to those skilled in the art is high-velocity ballistic bombardment using metal particles coated with the nucleic acid constructs of interest (see Klein et al. Nature (1987) (London) 327:70-73, and see U.S. Pat. No. 4,945,050). A Biolistic PDS-1000/He (BioRAD Laboratories, Hercules, Calif.) was used for these complementation experiments (see Example 4 for further details). The particle bombardment technique was used to transform the ge mutant with a 5.1 kb EcoRI fragment from wild type (nucleotides 6604-11735 of SEQ ID NO:3) that includes 1.7 kb upstream of the GE coding region, the GE coding region plus intron, and 1.6 kb downstream of the GE coding region.
The bacterial hygromycin B phosphotransferase (Hpt II) gene from Streptomyces hygroscopicus that confers resistance to the antibiotic hygromycin was used as the selectable marker for the rice transformation. In the vector, pML18, the Hpt II gene was engineered with the 35S promoter from Cauliflower Mosaic Virus and the termination and polyadenylation signals from the octopine synthase gene of Agrobacterium tumefaciens. pML18 was described in WO 97/47731, which was published on Dec. 18, 1997, the disclosure of which is hereby incorporated by reference.
Embryogenic callus cultures derived from the scutellum of germinating rice seeds serve as source material for transformation experiments. This material was generated by germinating sterile rice seeds on a callus initiation media (MS salts, Nitsch and Nitsch vitamins, 1.0 mg/l 2,4-D and 10 ΟM AgNO3) in the dark at 27-28° C. Embryogenic callus proliferating from the scutellum of the embryos was then transferred to CM media (N6 salts, Nitsch and Nitsch vitamins, 1 mg/l 2,4-D, Chu et al., 1985, Sci. Sinica 18: 659-668). Callus cultures were maintained on CM by routine sub-culture at two week intervals and used for transformation within 10 weeks of initiation.
Callus was prepared for transformation by subculturing 0.5-1.0 mm pieces approximately 1 mm apart, arranged in a circular area of about 4 cm in diameter, in the center of a circle of Whatman #541 paper placed on CM media. The plates with callus were incubated in the dark at 27-28° C. for 3-5 days. Prior to bombardment, the filters with callus were transferred to CM supplemented with 0.25 M mannitol and 0.25 M sorbitol for 3 hr in the dark. The petri dish lids were then left ajar for 20-45 minutes in a sterile hood to allow moisture on tissue to dissipate.
Each genomic DNA fragment was co-precipitated with pML18 containing the selectable marker for rice transformation onto the surface of gold particles. To accomplish this, a total of 10 Îźg of DNA at a 2:1 ratio of trait:selectable marker DNAs were added to 50 Îźl aliquot of gold particles that were resuspended at a concentration of 60 mg mlâ1. Calcium chloride (50 Îźl of a 2.5 M solution) and spermidine (20 Îźl of a 0.1 M solution) were then added to the gold-DNA suspension as the tube was vortexed for 3 min. The gold particles were centrifuged in a microfuge for 1 sec and the supernatant removed. The gold particles were then washed twice with 1 ml of absolute ethanol and then resuspended in 50 Îźl of absolute ethanol and sonicated (bath sonicator) for one second to disperse the gold particles. The gold suspension was incubated at â70° C. for five minutes and sonicated (bath sonicator) if needed to disperse the particles. Six Îźl of the DNA-coated gold particles were then loaded onto mylar macrocarrier disks and the ethanol was allowed to evaporate.
At the end of the drying period, a petri dish containing the tissue was placed in the chamber of the PDS-1000/He. The air in the chamber was then evacuated to a vacuum of 28-29 inches Hg. The macrocarrier was accelerated with a helium shock wave using a rupture membrane that bursts when the He pressure in the shock tube reaches 1080-1100 psi. The tissue was placed approximately 8 cm from the stopping screen and the callus was bombarded two times. Two to four plates of tissue were bombarded in this way with the DNA-coated gold particles. Following bombardment, the callus tissue was transferred to CM media without supplemental sorbitol or mannitol.
Within 3-5 days after bombardment the callus tissue was transferred to SM media (CM medium containing 50 mg/l hygromycin). To accomplish this, callus tissue was transferred from plates to sterile 50 ml conical tubes and weighed. Molten top-agar at 40° C. was added using 2.5 ml of top agar/100 mg of callus. Callus clumps were broken into fragments of less than 2 mm diameter by repeated dispensing through a 10 ml pipet. Three ml aliquots of the callus suspension were plated onto fresh SM media and the plates were incubated in the dark for 4 weeks at 27-28° C. After 4 weeks, transgenic callus events were identified, transferred to fresh SM plates and grown for an additional 2 weeks in the dark at 27-28° C.
Growing callus was transferred to RM1 media (MS salts, Nitsch and Nitsch vitamins, 2% sucrose, 3% sorbitol, 0.4% gelrite+50 ppm hyg B) for 2 weeks in the dark at 25° C. After 2 weeks the callus was transferred to RM2 media (MS salts, Nitsch and Nitsch vitamins, 3% sucrose, 0.4% gelrite+50 ppm hyg B) and placed under cool white light (Ë40 ÎźEmâ2sâ1) with a 12 hr photoperiod at 25° C. and 30-40% humidity. After 2-4 weeks in the light, callus began to organize, and form shoots. Shoots were removed from surrounding callus/media and gently transferred to RM3 media (½ĂMS salts, Nitsch and Nitsch vitamins, 1% sucrose+50 ppm hygromycin B) in phytatrays (Sigma Chemical Co., St. Louis, Mo.) and incubation was continued using the same conditions as described in the previous step.
Plants were transferred from RM3 to 4âł pots containing Metro mix 350 after 2-3 weeks, when sufficient root and shoot growth had occurred. The seed obtained from the transgenic plants was examined for genetic complementation of the ge mutation with the wild-type genomic DNA containing the GE gene. The mutant GE line transformed with the 5.1 kb EcoRI fragment containing the wild-type GE isolated nucleic acid fragment yielded rice grains with normal embryos.
This result confirms that the 5.1 kb EcoRI fragment containing the cytochrome P450 coding region is sufficient to complement the ge mutant phenotype. Furthermore, all regulatory elements necessary for âwild-typeâ expression of the gene are apparently present within the 5.1 kb EcoRI fragment, since this region completely complements the ge mutation.
The 5.1 kb EcoRI genomic fragment described in Example 10 was sufficient to complement the ge mutation. This demonstrated that the promoter, required for the proper GE expression, was encoded in this genomic region. Two corn homologs of the rice GE are described in Example 13. The 2 kb upstream sequences from both of these genes, zmGE1 and zmGE2, are shown in SEQ ID NOs:104 and 105, respectively. It is believed that the regulatory elements necessary for normal maize GE expression are contained within SEQ ID NO:104 or 105 and the coding regions for zmGE1 and zmGE2.
In order to investigate the expression pattern necessary for GE function, the accumulation of GE RNA in tissues was analyzed by means of in situ hybridization. To obtain detailed data of weak GE expression, a radioactive method following the protocol of Sakai et al. (1995) Nature 378:199-203) was employed. Plant materials were fix and embedded in paraplast according to Jackson, D. P. (1991) In Situ Hybridization in Plants. In: âMolecular Plant Pathology: A Practical Approachâ, (Bowles, D. J., Gurr, S. J. and McPhereson, M. eds), Oxford University Press. The sections were prepared in 8-Îźm thickness using a rotary microtome. To detect GE-specific sense RNA, the region containing the 3â˛UTR was amplified by PCR and cloned into pGEM-T (Promega). The primers used to amplify the region for the probe were GE3â˛RVQ: TCGTGTGCAAGGCCGTGGCTA (SEQ ID NO:106) and GE3â˛LVC: GCACGATCCATTTAGCACACCAG (SEQ ID NO:107). The amplified sequence was from nucleotide 9941 to 10300 of SEQ ID NO:3.
The antisense RNA probe to detect sense GE RNA was synthesized by linearizing the clone by digesting with SpeI and transcribing with T7 RNA polymerase. The sense RNA for control was synthesized by linearizing the clone by digesting with NcoI and transcribing with SP6 RNA polymerase.
After three weeks of exposure on NBT2 Kodak autoradiography emulsion film, the result was analyzed through dark field microscopy using a compound microscope (Nikon, Eclipse E800). GE RNA accumulation was detected in the developing embryo as well as endosperm tissues. The earliest expression detected was at two day after pollination. GE expression detected in embryos was restricted to the apical region at the globular stage and to the epidermal layer of scutellum facing to the endosperm tissue at coleopilar and late stages. In the developing endosperm before the cellular stage, GE RNA was detected in the entire region with some concentration in the area close to the embryonic tissue. Later, the GE expression pattern shifted, with more expression seen in the area facing the embryo. Furthermore, GE expression was also detected in very young leaf tissues.
In order to identify the gene, a barley genomic library (Stratagene, Catalogue No. 946104) was screened by hybridizing a DNA probe made from the entire GE isolated nucleic acid fragment at 65° C. and washing at a medium stringency (5ĂSSPE, 0.5% SDS at 65° C. followed by 1ĂSSPE, 0.5ĂSDS, 65° C.). Five positively hybridizing lambda clones were isolated. Mapping of these clones via restriction enzyme digestion confirmed that all five were overlapping clones from the same genomic region. The DNA fragment that contained the region homologous to rice GE was further subcloned and sequenced.
The deduced coding sequence and the deduced translation product of the barley GE homolog are shown in SEQ ID NO:92 and 93, respectively. The barley GE homolog has a high degree of conservation to the rice GE protein (72.9% identity based on the Clustal method of alignment). Furthermore, the 91 nucleotide intron found in the rice GE gene is conserved in its placement within the barley gene (between nucleotides 991 and 992 of SEQ ID NO:92, the barley intron is 125 nucleotides). This conservation of intron placement is also found in zmGE1, zmGE2, and zmGE3 (see Example 13).
Maize GE homologs were identified by analysis of EST clones with strong homologies to GE (see EXAMPLE 3). Two genes represented by ESTs, cbn10.pk0034.f8, maize GE2 (zmGE2, SEQ ID NO:96 for the nucleotide coding sequence, and SEQ ID NO:97 for the putative translation product) and p0121.cformn62r, maize GE1 (zmGE1, SEQ ID NO:94 for the nucleotide coding sequence, and SEQ ID NO:95 for the putative translation product), were shown to be the most homologous genes in the maize genome by the cross-hybridization analysis. A third clone cpls1s.pk001.m19 (zmGE3, SEQ ID NO:98 for the nucleotide coding sequence, and SEQ ID NO:99 for the putative translation product) has also been identified by analyzing BAC genomic clones (see below). There is a single intron contained within each of the three maize genes, and its placement is conserved with respect to the rice and barley genes discussed in Example 12. The intron for zmGE1 is 122 nucleotides and is found between nucleotides 1143 and 1144 of SEQ ID NO:94, the intron for zmGE2 is 193 nucleotides and is found between nucleotides 942 and 943 of SEQ ID NO:96, and the size of the intron for zmGE3 has not yet been determined, although it is considerably larger than the other four.
For the cross-hybridization analysis, as described below, maize DNA was digested with several different restriction enzymes and separated on 0.7% agarose gel. DNA was transferred to a nylon membrane filter, HyBond N (Amersham), and hybridized at 50° C. with the 32P-labeled probe made from the whole coding region of the rice GE gene. After washing the filter at 1ĂSSPE, 0.5% SDS at 65° C., it was exposed on the Phospho Imager screen (Molecular Dynamics) and signals were detected by using Phospho Imager scanner (Molecular Dynamics). The signals were detected from more than one band, indicating the possibility that there was more than one maize genes very homologous to rice GE.
To identify the homologous genes in the maize genome, the maize genomic library (Stratagene, Catalog No. 946102) was screened at the medium stringency condition starting at 2ĂSSPE, 0.5% SDS, 50° C. and then at 1ĂSSPE, 0.5% SDS 65° C., and obtained nine lambda clones that gave distinct positive signals. PCR analysis showed these clones were shown to have sequences specific to either cbn10.pk0034.f8 or p0121.cformn62r, proving that these EST clones encoded the corn genes most homologous to rice GE.
In order to obtain further information on the structure of these genes represented by two EST clones, maize genomic BAC clones were screened. The clone, p0121.cformn62r, hybridized to BAC clones that belonged to one contig. The clone, cbn10.pk0034.f8, hybridized to BAC clones that derived from two distinct contigs. One BAC clone from each contig was chosen and subclones for sequencing were made of whole BAC inserts. These BACs were BAC b94d.b2 for p0121.cformn62r (zmGE1) and BACs b153c.j17 and b37c.f1 for cbn10.pk0034.f8 contigs (zmGE2). The sequence of each BAC revealed the genomic structure of maize GE homologs. The BAC b37c.f1 contained ORF nearly identical but distinct sequence to the gene represented by cbn10.pk0034.f8 and BAC b153c.j17. The third corn homolog was named zmGE3.
Synteny analysis, or the conservation of gene placement on chromosomes between different organisms, is known to be a useful tool for identifying homologous genes or genomic regions from one species by comparison to a known genomic region from another closely related species. For instance, GeneA from corn is known to possess a unique activity but is related to a large multigene family. Chromosomal analysis of GeneA shows that it is closely linked to GeneB. If one wanted to find the homolog of GeneA in rice (GeneA-r), it is likely that the member of the GeneA-r family will be closely linked to GeneB-r. Rice and maize are known to exhibit conservation of chromosomal structures, i.e. gene orders, to a large extent (Ahn and Tanksley PNAS (1993) 90:7980-7984). In order to make use of such synteny relationships to identify homologs among closely related species, the genomic sequence of the three BACs described in EXAMPLE 13 were compared to the 100 kb-long, rice GE genomic sequence described in EXAMPLE 1. The analysis revealed ORFs in BAC b94d.b2, showing a similarity to a hydrolase, a gene closely linked to the rice GE (the rice hydrolase gene is shown in SEQ ID NO:100 and 101, nucleotide and polypeptide, respectively; and the maize hydrolase is shown in SEQ ID NO:102 and 103). Therefore, zmGE1 is closely linked to a hydrolase gene, just like the rice GE gene. This demonstrated that rice genes closely linked to GE could be used as tags to isolate GE homologs from plant species that have conserved chromosomal structures by using synteny.
Cytochrome P450 proteins comprise a superfamily of genes with a variety of functions (Werck-Reichhart and Feyereisen (2000) Genome Biology 1:reviews 3003.1-3003.9). FIG. 2 shows an alignment of the rice GE (SEQ ID NO:2), barley GE-homolog (SEQ ID NO:93), maize GE1-homolog (SEQ ID NO:95), maize GE2-homolog (SEQ ID NO:97), maize GE3-homolog (SEQ ID NO:99), lily GE-homolog (SEQ ID NO:41), orchid gi 1173624 (SEQ ID NO:43), Arabidopsis gi 1235138 (SEQ ID NO:42), Arabidopsis gi 8920576 (SEQ ID NO:47), columbine GE-homolog (SEQ ID NO:35), soybean GE-homolog (SEQ ID NO:23), Arabidopsis gi 11249511 (SEQ ID NO:44), soybean gi 5921926 (SEQ ID NO:45), soybean GE-homolog (SEQ ID NO:25), soybean GE-homolog (SEQ ID NO:21), and Arabidopsis gi 3831440 (SEQ ID NO:46). The boxed residues are predicted helical regions identified by the Bioscout DSC program (King and Sternberg (1996) Protein Sci 5:2298-2310). Other boxed elements include âSRSâ or substrate-recognition-sites which are hypervariable sequences in the cytochrome P450 structure, âPPPâ clusters of prolines often Pro-Pro-Gly-Pro in cytochrome P450s, âF-G loopâ which is the substrate access channel (part of the conserved sequence motif of SEQ ID NO:83), the conserved âGXDTâ the proton transfer groove involved in heme interaction and enzyme catalysis (part of the conserved sequence motif of SEQ ID NO:85), âEXXRâ the K-helix motif conserved in all cytochrome P450s necessary for heme stabilization and core structure stability (part of conserved sequence motif of SEQ ID NO:88), and âFXXGXRXCXGâ the conserved heme binding site with the cysteine that contacts the heme (part of the conserved sequence motif of SEQ ID NO:90). The alignment of the sequences and comparison to related cytochrome P450 sequences provides a useful method for identifying motifs that are unique to GE-like cytochrome P450s. Many of the conserved sequence motifs found in SEQ ID NOs:80-91 are found at the edge of helical domains, or in SRS regions.
High oil corn cultivars and rice giant embryo mutants share extensive similarities in their phenotypes. GE homologs were mapped to investigate the possible correlation between maize GE homologs and loci controlling high oil traits. Mapping was performed by finding polymorphic nucleotide sequences (SNPs) in the 3â˛UTR region. Gene specific primers were made to PCR amplify the gene from the genomic DNA of the mapping parents. The following primers were used for the amplification: 90F: AATTAACCCTCACTAAAGGGCACCTGCTCTTCCACCAC (SEQ ID NO:108) and 91R: GTAATACGACTCACTATAGGGCGACTGCCCATTTCGTAGC (SEQ ID NO:109). The PCR products were directly sequenced by dye terminator chemistry, and the sequences were then aligned and analyzed for polymorphisms.
For the isolated nucleic acid fragment represented by zmGE1 (p0121.cformn62r), a polymorphism between the mapping parents G61/G39 was found at consensus position 73 with the nucleotide T in G61, but G in G39.
The location of polymorphisms are shown below (S corresponds to C or G, and K corresponds to G or T):
| (SEQâIDâNO:â110) |
| CACCTGCTCTTCCACCACGCCATGGGCTTCGCGCCCTCSGGAGACGCGCA |
| CTGGCGCGGGCTCCGCCGCCTCKCCGCCAACCACCTGTTCGGCCCGCGCC |
| GCGTGGCGGGTGCCGCGCACCACCGCGCCTCCATCGGCGAGGCCATGGTC |
| GCCGACGTCGCCGCTGCCATGGCGCGCCACGGCGAGGTCCCTCTCAAGCG |
| CGTGCTGCATGTCGCGTCTCTCAACCACGTCATGGCCACCGTGTTTGGCA |
| AGCGCTACGACATGGGCAGCCGAGAGGGCGCCCTTCTGGACGAGATGGTG |
| GCCGAGGGCTACGACCTCCTGGGCACGTTCAACTGGGCTGATCAAC. |
A sequencing primer close to the polymorphism was made in order to genotype 94 individuals in the mapping population by Pyrosequencing⢠(Uppsala, Sweden; Rickert et al. (2002) BioTechniques 32:592-603). The sequencing primer, PY90R, was GGGCCGAACAGGTGGTTG (complementary sequence of positions 77-95 in SEQ ID NO:110, underlined above). The heritage score were then used to place the gene onto a core maize genetic map using MAPMAKER⢠or JOINMAPâ˘. Clone p0121.cformn62r was mapped onto the bottom of Chromosome 7, in the vicinity of the marker bnl8.39 in bin 7.04.
This map position was overlapped with one of the quantitative trait loci (QTL) that were associated with high seed oil.
The materials for QTL mapping were developed by crossing two lines, 49.007 and H31. 49.007 was a high oil inbred lined (about 20% kernel oil) developed from the ASKC28 population (Wang, S M. Lin Y H and Huang A H C, 1984. Plant Phys., 76:837). H31 is a public line derived from the Illinois Low Oil (ILO) population that has very low kernel oil content (about 1%) (Quackenbush F W, Firch J G, Brunson A M and House L R. 1963. Cereal Chem. 40:250). From this cross, 180 F2:3 families were developed through two selfing generations. The F3 grain from individual F2 plants was evaluated for germ weight and other oil-related traits. One hundred kernels were shelled from the middle of each ear, dried to Ë5% moisture (40 C for 4 d), weighed and oil content determined by NMR. Twenty germs were dissected from a random subsample of the 100 kernels to determine germ weight. Twenty seedlings of each F3 family were grown in greenhouse and the leaves of the seedlings were bulked on individual family basis. The leaf samples were lyophilized, ground into powder and used for DNA extraction. Genomic DNA was extracted by mini-CTAB method in a 96-well format. SSR markers were used in this mapping study. All genotypes were detected using ABI PRISM systems, which include the use of fluorescent end-label primers, gel electrophoresis on ABI377 DNA sequencer, peak detection and allele identification on GeneScan⢠and Genotyper⢠software. A total of 89 polymorphic SSRs were used in mapping analysis. The linkage map was assembled by MAPMAKER and confirmed by MAPMANAGER. QTL analysis was carried out on mean value of each trait through composite interval mapping. QTL Cartographer was used to perform the analysis.
Important parameters used in the analysis were:
Mapping function: Kosambi
QTL mapping method: Composite interval mapping
Significance threshold: LOD=2.5
Significance test for linear regression and backward stepwise linear regression: ĂĄ=0.05
There appeared to be a QTL for the germ weight trait of high oil seed on chromosome 7. The putative QTL is in the region where EST p0121.cfrn62r (zmGE1) was mapped.
In order to investigate a possible correlation between GE homologs and high oil traits, the expression pattern of zmGE2 was analyzed.
The expression study was conducted by comparing MPSS (Massively Parallel Signature Sequencing) data (Brenner et al. 2000. Nature Biotechnology 18:630-634; Brenner et al. (2000) Proc Natl Acad Sci USA 97:1665-1670), obtained from various corn tissues of different lines. MPSS data enabled a survey of expression levels in terms of looking at the abundance of particular cDNA clones among 1,000,000 clones for each library. The relative abundance of a particular tagged sequence, which is unique to a single cDNA, correlates with the relative level of accumulation of the corresponding RNA in that tissue. The expression of the GE homolog zmGE2 was detected, in all cultivars tested, by the presence of a specific tag sequence, GATCGATGGAACTGAGT (SEQ ID NO:111), in cDNAs from embryo tissues isolated 15 days after pollination. In corn cultivars with normal oil accumulation in seeds, zmGE2 was expressed with a frequency of 238/1,000,000 (238 parts-per-million or ppm) for the wild-type cultivar B73, and 263 ppm for the wild-type ASK cycle 0. In contrast, the expression of zmGE2 in high oil corn lines was reduced by more than 50%. In the high oil line, QX47, zmGE2 was expressed with a significantly lower frequency of 89 ppm. In another high oil line, ASK 28 cycles, the expression level was 113 ppm. A third high oil cultivar, IHO, gave an accumulation rate of 78 ppm. The reduction of expression is especially significant between ASK 0 (normal) and 28 cycles (high oil) because the two lines are derived from the same genetic background.
These data showed that one of the corn GE homologs, zmGE2, was substantially down-regulated in its expression in developing embryos of high oil lines. The result of the expression study confirmed that this GE homolog has a negative correlation with the high oil trait in corn seed. This is consistent with the rice result where mutations in GE genes result in enlarged embryos and high-oil phenotypes.
For GE over expression, the GE ORF (nucleotides 8301-9969 of SEQ ID
NO:3) was amplified from the 5.1 kb EcoRI fragment described in Example 10, which complemented ge mutations. The 5.1 kb EcoRI fragment served as the template from which the GE ORF was amplified using primers GE-ORF1 and GE-ORF2 GE-ORF1 5â˛-ACACCAGGTGCTCGAGAATTCGGTCTCCCATGGCGCTCTCCTCCATGGC-3Ⲡ(SEQ ID NO: 112) GE-ORF2 5â˛-GCCGACGGAGAGCGACATCA-3Ⲡ(SEQ ID NO:113)
The amplified PCR fragment was digested with DnaIII and ligated with DraIII-digested EcoRI 5 kb. The entire GE coding region was PCR amplified out of this construct with a 5Ⲡprimer called âConstruct 5â˛â and âConstruct 3â˛â Construct 5Ⲡ5â˛-CACCAGGTGCTCGAGAATTCGGTCTCCCATG-3Ⲡ(SEQ ID NO:114) Construct 3Ⲡ5â˛-TTCATGGGAGACCTCGAGCTGCAGTCAGGCCCTAGCCACGGCCTTGC-3Ⲡ(SEQ ID NO:115).
âConstruct 5â˛â primer contained DraIII, XhoI, EcoRI and BsaI restrictions sites. âConstruct 3â˛â primer contains a BsaI, XhoI and PstI restriction sites. The PCR fragment was digested with BsaI and was then ligated to a maize ubiquitin promoter along with 2-1A terminator to form UBI::GE:2-1A. (SEQ ID NO:116 and SEQ ID NO:117, respectively) UBI::GE:2-1A was then cloned into the binary vector PHP18422 (SEQ ID NO:118), which was subsequently transformed into Agrobacterium ABA4404.
The maize plant having genotype Hi-II was used for transformation in this study [Armstrong, C. L., et al. (1991) Maize Genet. Coop. Newslett. 65:92-93]. Hi-II transformation and plant regeneration were carried out according to the procedure described in Zhao et al. [Zhao, Z., et al. (2002) Mol. Breed. 8: 323-333]. The pollen from the resultant T0 plants was used to pollinate ears of wild-type plants. T1 seed from the cross was analyzed for embryo and endosperm size.
T1 seed without the transgene produced wild-type seed with normal embryos (see FIG. 3, top two kernels) and T1 seed over-expressing the transgene produced seed with significantly smaller embryos and enlarged endosperm filling the embryo cavity (see FIG. 3, lower two kernels). The oil content of the embryos was determined according to the method described in Applicants' Assignee's U.S. patent application Ser. No. 10/183,687 filed Jun. 27, 2002 (having Attorney Docket No. BB-1458), the contents of which are hereby incorporated by reference. The analysis of oil content in the embryo revealed that the reduced embryo phenotype of transgenic seeds correlated with reduced oil content (see FIG. 4).
Thus, ectopic expression of a rice GE in maize results in altered embryo and endosperm size. The altered embryo size also leads to a reduced oil phenotype in the transgenic maize.
Further analysis of GE function was accomplished through the creation of two constructs, GE3XMyc Hyg and ATG* GE 5 Kbp Hyg.
The first construct, GE3XMyc Hyg, incorporates three c-Myc epitope sequences into the GE coding sequence. This construct is useful for determining the expression pattern of GE in plant tissues.
An approximately 420 bp DNA fragment was amplified from the 3â˛-end of the GE ORF contained in the 5.1 Kb EcoRI plasmid (in Example 10) to make the construct GE 1XMyc.
A set of primers was used to amplify the 3â˛-end of the GE ORF from the AscI site up to the termination codon and a c-Myc epitope was put in-frame to the 3â˛-end of GE. The primer sequences are:
GE AscI F: 5â˛-GCCCGCTCCTGTCGTGGGCGCGCCTCGCCGTG-3Ⲡ(SEQ ID NO:119, corresponding to nucleotides 9575-9606 of SEQ ID NO:3)
GEMycR: 5â˛-GGCGCGCCCTACTCGAGGTCCTCCTCCGAGATGAGCTTCTGCTCGGCCCTAG CCACGGCCTTGCACACGA-3Ⲡ(SEQ ID NO:120, first 44 nucleotides are the complement of the c-Myc epitope, the remaining 26 nucleotides are complementary to the region 9941-9966 of SEQ ID NO:3)
The amplified DNA fragment incorporated a single c-Myc epitope fused to the 3Ⲡend of GE ORF and was cloned into pGEM-T-easy vector to create GE1 XMyc pGEM-T (Promega Corporation). The sequence of the new AscI fragment with 1xMyc is shown in SEQ ID NO:121, where the 1xMyc sequence is found between nucleotides 377 and 406.
The following two oligonucleotides were used to make two additional repeats of c-Myc epitope tags to create GE3XMyc pGEM-T.
| cmyc2XGD: |
| (SEQâIDâNO:â122) |
| 5â˛- |
| CTCGAGCAGAAGCTCATCTCGGAGGAGGACCTCGGCGAGCAGAAGCTCAT |
| CTCGGAGGAGGACCTCGAG-3Ⲡ|
| cmyc2XDC: |
| (SEQâIDâNO:â123) |
| 5â˛- |
| CTCGAGGTCCTCCTCCGAGATGAGCTTCTGCTCGCCGAGGTCCTCCTCCG |
| AGATGAGCTTCTGCTCGAG-3Ⲡ|
Oligonucleotides cmyc2XGD and cmyc2XDC were annealed and digested with XhoI and cloned into the XhoI site of GE1XMyc pGEM-T to create the GE3XMyc pGEM-T plasmid. GE 3XMyc pGEM-T and GE EcoRI 5.1 Kb plasmid from Example 10 were digested with AscI and the 416 bp fragment from GE3X Myc pGEM-T was extracted from gel and cloned into GE EcoRI 5 Kb vector to create GE EcoRI 3X myc.
A HygR selection marker was added as follows: GE EcoRI 3X myc vector was digested with endonuclease PstI and BamHI. In order to make compartible ends, the adaptor sequence Pst BsphI: 5â˛-CATGTGCA-3Ⲡ(SEQ ID NO:124) was ligated to the PstI site to produce an end compatible to the BsphI site. Vector pML18 (described in Example 10) was digested with restriction endonuclease BspHI and BamHI to obtain a 4.3 Kbp DNA fragment containing CaMV35S PRO:HYG which was then subsequently ligated into the BamHI and BspHI sites of GE EcoRI 3X Myc to form the GE3X cMyc Hyg construct.
The second construct, ATG* GE 5 kbp HYG, was made, as described below, in order to investigate the translation initiation site of GE.
The GE ORF possessed an in-frame ATG sequence that was present about 62 nucleotides upstream of the 5Ⲡend of the longest GE cDNA identified. This in-frame ATG sequence was removed by in vitro mutagenesis from the construct to determine whether this ATG had any effect on GE expression/function.
Parenthetically, it was observed that GE ORF shared sequence identity with other CYP78 proteins. Based on this, it was unlikely that the GE ORF might encode a polypeptide that would be about 30 amino acids longer due to the presence of this in-frame ATG sequence.
The determination as to whether this ATG had any effect on GE expression involved mutagenesis to change the ATG codon to a TTG codon. It was found, as is discussed below, that the mutagenized ATG was not required for GE function. The determination was made as follows:
Specifically, in vitro mutagenesis was performed on the 5.1 kb EcoRI genomic fragment (described in Example 10) containing all cis elements and the GE gene.
The following primer was designed to change ATG to TTG: GE_ATG-TTG-1: 5â˛-GAGTGGCAAATTGGTCTATTTAAA-3Ⲡ(SEQ ID NO:125)
The resulting ATG* GE 5 Kbp plasmid was digested with endonuclease PstI and BamHI. Similar to GE3X cMyc Hyg as mentioned above, the ATG-mutagenized 5 kb EcoRI clone was digested with PstI and BamHI and the same linker PstBsphI was ligated to the PstI end.
Vector pML18 (described in Example 10) was digested with restriction endonuclease BspHI and BamHI to obtain a 4.3-kb DNA fragment containing CaMV35S PRO:HYG which was then ligated into BamHI and BspHI sites of the 5 kb EcoRI clone to form the construct, ATG* GE 5-kb HYG.
These two constructs, GE3X cMyc Hyg and ATG* GE 5 Kbp HYG, were transformed into rice homozygous for the ge-2 mutation. The rice transformation procedure was described in Example 10 except that 2 Îźg of each construct was used for the biolistic based transformation.
Seeds were obtained from 7 independent transformants of GE3X cMyc Hyg. 4 of 7 transformants segregated wild-type size embryo, suggesting the transgenic GE protein fused with c-Myc epitope was functional to complement the ge mutation (see FIG. 5 for an example of the complemented ge3-1 seed phenotype, this is representative of the complementation results obtained in this example).
Furthermore, 2 out of 7 transformants produced intermediate sized embryos with the seeds with that were significantly larger than normal wild-type seed due to an alteration in embryo and endosperm size (see FIG. 6). The phenotype of these two transformants was different than the ge-2 mutants. The embryo/endosperm ratio was closer to wild-type although the larger embryo size resulted in an overall increase in seed size when compared to either wild-type or ge2-1 mutant rice seed.
Transformations with ATG*GE5 Kbp HYG yielded 4 transgenic plants, where 3 out of 4 plants produced seed showing segregation of seeds with wild-type embryo, indicating that the mutagenized ATG was not required for GE function. An additional 11 transformants of ATG* GE 5 Kbp Hyg in a wild-type background were recovered. 8 of the 11 transformants produced the large seed phenotype similar to that found with the GE3X cMyc Hyg construct (see FIG. 7).
In order to correlate this large seed phenotype with GE ectopic expression, expression of GE in young panicle was examined using RT-PCR. Specifically, GE expression was examined in young panicles of 5 wild-type and 10 large seed siblings derived from two independent lines, 1001-3-2 and 1001-3-4 with ATG* GE 5 Kbp Hyg. Clear ectopic GE expression was detected in young panicle of large seed plants (5.5Âą0.2 mm in length and 3.1Âą0.1 mm in width), where no GE expression was observed in transgenic plants with wild-type seeds (5.0Âą0.2 mm in length and 2.8Âą0.1 mm in width). These results showed that GE ectopic expression enhances seed size, enlarging both embryo and endosperm size.
GE was expressed in Arabidopsis under the 35 S CaMV promoter in order to examine efficacy of GE for seed size enhancement in other species. The GE gene was amplified from the complementing 5 kb EcoRI genomic fragment using primers that carried XhoI restriction sites directly upstream of the initiation codon and downstream of the stop codon.
| XhoIORF5Ⲡ| |
| (SEQâIDâNO:â126) | |
| 5â˛-AACTCGAGATGGCGCTCTCCTCCATGGC-3Ⲡ| |
| and | |
| XhoIORF3Ⲡ| |
| (SEQâIDâNO:â127) | |
| 5â˛-AACTCGAGTCAGGCCCTAGCCACGGCC-3Ⲡ|
The correct PCR fragment was digested with XhoI and fused to a 35S promoter in the binary vector pBE851 (Aukerman, M., and Sakai, H. (2003) Plant Cell 15:2730-2741). The resulting clone was transformed into Agrobacterium and subsequently into wild-type Arabidopsis Columbia ecotype, following standard procedures (Clough, S. J., and Bent, A. F. (1998) Plant Journal 16:735-743).
T1 transgenic plants were selected with Basta herbicide. All transgenic plants (>30 individual events) produced enlarged flowers. On average, petals and sepals were 1.5-2 times larger than wild type (see FIG. 8). Upon fertilization with the wild-type pollen or pollen from their own, they produced enlarged seed (see FIG. 8). The transgenic seeds were twice as large as the wild type in volume. A cross section of the transgenic seed revealed that the enlargement was associated with an enlarged embryo.
In order to examine whether or not any Arabidopsis GE homologs have a similar function, two Arabidopsis CYP78 genes closest to rice GE from the genomic DNA (CYP78A10 and CYP78A5) were amplified. CYP78A10 (=At1g74110, accession number NMâ106071) has 54% sequence identity with GE at the amino acid residue level, and CYP78A5 (=At1g13710, accession#NMâ101240) has 52% identity with GE. These two genes were fused to 35S promoter of pBE851 (Aukerman, M. and Sakai, H. (2003) Plant Cell 15: 2730-2741) to make the 35S::CYP constructs.
The resulting constructs were transformed into wild-type Arabidopsis plants following standard procedures. More than 30 independent T1 lines were produced for each construct. However, none of them showed a phenotype with large flowers and seeds.
In order to test the efficacy of GE in soybean, the 35S::GE construct described above was transformed into Jack cultures using the biolistic method essentially as described in Example 5. The construct was previously introduced into Arabidopsis and led to the large flower and seed phenotype.
35S::GE was co-transformed with pKS59 (SEQ ID NO:128), which carried the HPT selection marker. 11 events with 35S::GE and two events with a control that did not contain 35S::GE were recovered. A total of 30 lines from 11 events were grown to maturation and set T1 seeds. Three lines produced seeds with reduced size and one line with enlarged seeds (see FIG. 9).
Based on experience with soybean transformation, transgenic lines with small seed size had been occasionally observed with several different constructs. However, lines with enlarged seeds had not been reported in the past, indicating the significance of this particular transgenic event. This large seed phenotype in soybean was in accordance with the result obtained in Arabidopsis, where 35S::GE gave an enlarged seed phenotype (see EXAMPLE 20.) In the both cases, the enlargement of the embryo apparently resulted from over-expression of the GE gene.
1. An isolated nucleotide fragment comprising a nucleic acid sequence SEQ ID NO:2, encoding a cytochrome P450 polypeptide associated with controlling embryo/endosperm size during seed development having an amino acid identity of at least 65% based on the Clustal method of alignment when compared to SEQ ID NO: 97, or the complement thereof.
2. The isolated nucleotide fragment of claim 1, wherein the polypeptide it encodes comprises a motif corresponding to the amino acid sequence set forth in SEQ ID NO:88 wherein said motif is a conserved subsequence.
3. The isolated nucleotide fragment of claim 1 or 2 wherein said fragment or part thereof is useful in antisense inhibition or co-suppression of a cytochrome P450 polypeptide associated with controlling embryo/endosperm size during seed development in a transformed plant.
4. An isolated nucleic acid fragment comprising a promoter wherein said promoter consists essentially of the nucleotide sequence set forth in SEQ ID NOs:3, 4, 104, or 105, or said promoter consists essentially of a fragment or subfragment that is substantially similar and functionally equivalent to the nucleotide sequence set forth in SEQ ID NOs:3, 4, 104, or 105.
5. A chimeric construct comprising the isolated nucleotide fragment of claim 1 or 2 operably linked to at least one regulatory sequence.
6. A chimeric construct comprising the isolated nucleic acid fragment of claim 3 operably linked to at least one regulatory sequence.
7. The chimeric construct of claim 5 wherein said isolated nucleic acid fragment is operably linked to the promoter of claim 4.
8. The chimeric construct of claim 6 wherein said isolated nucleic acid fragment is operably linked to the promoter of claim 4.
9. A plant comprising in its genome the chimeric construct of claim 5.
10. A plant comprising in its genome the chimeric construct of claim 6.
11. A plant comprising in its genome the chimeric construct of claim 7.
12. A plant comprising in its genome the chimeric construct of claim 8.
13. Seeds obtained from the plant of claim 9.
14. Seeds obtained from the plant of claim 10.
15. Seeds obtained from the plant of claim 11.
16. Seeds obtained from the plant of claim 12.
17. Oil obtained from the seeds of claim 13.
18. Oil obtained from the seeds of claim 14.
19. Oil obtained from the seeds of claims 15.
20. Oil obtained from the seeds of claim 16.
21. The plant of claim 9 wherein said plant is selected from the group consisting of rice, corn, sorghum, millet, rye, soybean, canola, wheat, barley, oat, beans, and nuts.
22. The plant of claim 10 wherein said plant is selected from the group consisting of rice, corn, sorghum, millet, rye, soybean, canola, wheat, barley, oat, beans, and nuts.
23. The plant of claim 11 wherein said plant is selected from the group consisting of rice, corn, sorghum, millet, rye, soybean, canola, wheat, barley, oat, beans, and nuts.
24. The plant of claim 12 wherein said plant is selected from the group consisting of rice, corn, sorghum, millet, rye, soybean, canola, wheat, barley, oat, beans, and nuts.
25. Transformed plant tissue or plant cells comprising the chimeric construct of claim 5.
26. Transformed plant tissue or plant cells conprising the chimeric construct of claim 6.
27. Transformed plant tissue or plant cells comprising the chimeric construct of claim 7.
28. Transformed plant tissue or plant cells comprising the chimeric construct of claim 8.
29. The plant tissue or plant cells of claim 25 wherein the plant is selected from the group consisting of rice, corn, sorghum, millet, rye, soybean, canola, wheat, barley, oat, beans, and nuts.
30. The plant tissue or plant cells of claim 26 wherein the plant is selected from the group consisting of rice, corn, sorghum, millet, rye, soybean, canola, wheat, barley, oat, beans, and nuts.
31. The plant tissue or plant cells of claim 27 wherein the plant is selected from the group consisting of rice, corn, sorghum, millet, rye, soybean, canola, wheat, barley, oat, beans, and nuts.
32. The plant tissue or plant cells of claim 28 wherein the plant is selected from the group consisting of rice, corn, sorghum, millet, rye, soybean, canola, wheat, barley, oat, beans, and nuts.
33. A method of controlling embryo/endosperm size during seed development in plants which comprises:
(a) transforming a plant with the chimeric construct of claim 5;
(b) growing the transformed plant under conditions suitable for the expression of the chimeric construct; and
(c) selecting those transformed plants which produce seeds having an altered embryo/endosperm size.
34. A method of controlling embryo/endosperm size during seed development in plants which comprises:
(a) transforming a plant with the chimeric construct of claim 6;
(b) growing the transformed plant under conditions suitable for the expression of the chimeric construct; and
(c) selecting those transformed plants which produce seeds having an altered embryo/endosperm size.
35. A method of controlling embryo/endosperm size during seed development in plants which comprises:
(a) transforming a plant with the chimeric construct of claim 7;
(b) growing the transformed plant under conditions suitable for the expression of the chimeric construct; and
(c) selecting those transformed plants which produce seeds having an altered embryo/endosperm size.
36. A method of controlling embryo/endosperm size during seed development in plants which comprises:
(a) transforming a plant with the chimeric construct of claim 8;
(b) growing the transformed plant under conditions suitable for the expression of the chimeric construct; and
(c) selecting those transformed plants which produce seeds having an altered embryo/endosperm size.
37. A method to isolate nucleic acid fragments encoding polypeptides associated with controlling embryo/endosperm size during seed development which comprises:
(a) comparing SEQ ID NOs:2, 7, 9,11, 13.15,17,19. 21, 23, 25, 27, 29, 31, 33, 35, 37, 39,41,42, 43, 44, 45, 46, 47, 93, 95, 97, or 99 with other polypeptide sequences associated with controlling embryo/endosperm size during seed development;
(b) identifying the conserved sequences(s) or 4 or more amino acids obtained in step (a);
(c) making region-specific nucleotide probe(s) or oligomer(s) based on the conserved sequences identified in step (b); and
(d) using the nucleotide probe(s) or oligomer(s) of step (c) to isolate sequences associated with controlling embryo/endosperm size during seed development by sequence dependent protocols.
38. A method of mapping genetic variations related to controlling embryo/endosperm size and/or altering oil phenotype in plants comprising:
(a) crossing two plant varieties; and
(b) evaluating genetic variations with respect to
(i) a nucleic acid sequence selected from the group consisting of SEQ ID NO:1, 3, 4, 5, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 92, 94, 96, 98, 100, 102, 104or 105; or
(ii) a nucleic acid sequence encoding a polypeptide selected from the group consisting of SEQ ID NO:2, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 42, 43, 44, 45, 46, 47, 80-91, 93, 95, 9in progeny plants resulting from the cross of step (a) wherein the evaluation is made using a method selected from the group consisting of: RFLP analysis, SNP analysis, and PCR-based analysis.
39. A method of molecular breeding to control embryo/endosperm size and/or altering oil phenotype in plants comprising:
(a) crossing two plant varieties; and
(b) evaluating genetic variations with respect to
(i) a nucleic acid sequence selected from the group consisting of SEQ ID NO:1, 3, 4, 5, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28. 30, 32, 34, 36, 38, 40, 92, 94, 96, 98, 100, 102, 104, or 105; or
(ii) a nucleic acid sequence encoding a polypeptide selected from the group consisting of SEQ ID NO:2, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 42, 43, 44, 45, 46, 47, 80-91, 93, 95, 97, or 99; in progeny plants resulting from the cross of step (a) wherein the evaluation is made using a method selected from the group consisting of: RFLP analysis, SNP analysis, and PCR-based analysis.