Patent application title:

T CELL PROTEINS AND NUCLEOTIDES ENCODING THE SAME

Publication number:

US20120178184A1

Publication date:
Application number:

13/433,444

Filed date:

2012-03-29

Abstract:

The present invention relates to mouse and human J12 polynucleotides, polypeptide and anti J12 antibody molecules. The J12 is a cytokine that is preferentially expressed in Th2 cells. The polypeptides and/or antibodies described herein can be used in methods for detection and treatment of certain autoimmune and inflammatory diseases including asthma.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12Q1/6883 »  CPC main

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material

A61P37/02 »  CPC further

Drugs for immunological or allergic disorders Immunomodulators

C07K14/52 »  CPC further

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans Cytokines; Lymphokines; Interferons

C12Q2600/158 »  CPC further

Oligonucleotides characterized by their use Expression markers

G01N2500/02 »  CPC further

Screening for compounds of potential therapeutic value Screening involving studying the effect of compounds C on the interaction between interacting molecules A and B (e.g. A = enzyme and B = substrate for A, or A = receptor and B = ligand for the receptor)

G01N33/566 IPC

Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing; Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds

C07K16/18 IPC

Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans

C07K14/435 IPC

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans

Description

RELATED APPLICATIONS

This application is a divisional of U.S. patent application Ser. No. 11/262,688 filed Oct. 31, 2005 and claims the benefit of U.S. Provisional Application No. 60/624,605 filed Nov. 3, 2004 the contents of which are incorporated herein in their entirety.

FIELD OF THE INVENTION

The invention relates to the field of inflammatory and autoimmune diseases and in particular to a protein designated J12 that is preferentially expressed in Th2 cells.

BACKGROUND INFORMATION

Proteins such as cytokines produced by T helper 1 (Th1) and T helper 2 cells (Th2) cells are thought to play critical roles in autoimmune and inflammatory diseases and it is thought that these diseases can be treated using methods to alter the activities of these proteins. Consequently, genes that are expressed in (Th1) and (Th2) cells are of interest.

Naïve CD4+ T cells can differentiate to Th1 and Th2 cells. Th1 cells are characterized for their production of IFN-γ but not IL-4 while Th2 cells produce IL-4 but not IFN-γ. IFN-γ and IL-4 are two major cytokines involved in autoimmunity and inflammation. After the engagement of TCR-peptide-MHC class II complex, naïve CD4+ T cells expend and develop to Th1 cells when IL-12 but not IL-4 is present; cells develop to Th2 cells when the environment has IL-4 but not IL-12.

CD4+ Th1 play critical roles in cell-mediated immune response while Th2 cells are involve in humoral immunity. However, over activation of CD4+ Th1 and Th2 cells may induce autoimmune and inflammatory diseases. For example, Th2, and also Th1, responses are involved in asthma. Th1 or Th2 responses might be the cause of different type of IBD and myocarditis. Type I diabetes and arthritis may be caused by Th1 response. In order to inhibit the Th1 or Th2 response, it is necessary to discover Th1 or Th2-specific genes which may be involved in their proliferation, differentiation and/or or cytokine production.

The cytokines and surface molecules of Th1/Th2 are involved in the autoimmune and inflammatory diseases. IFNγ, TNFα and IL-2 are mainly produced by Th1 cells, while IL-4, IL-5 and IL-13 are mainly produced by Th2 cells. IFNγ, TNFα and IL-2 all play important roles in the Th1-mediated diseases, such as IBD, MS, EAE, diabetes and arthritis. IL-4 is thought to play a role in asthma. Meanwhile, B7s and B7 receptors play critical roles in the stimulation or inhibition of T cell activation. B7.1 (CD80) and B7.2 (CD86) expressed on antigen presenting cells could stimulate either CD28 or CTLA-4 (CD152) expressed on T cells. Once B7-CD28 ligation occurs, T cells receive positive signals and the cells will be activated with the combination of TCR signals. However, when B7 stimulates CTLA-4, the T cell activation will be inhibited by the CTLA-4 signal. Programmed death receptor 1 (PD-1) is another inhibitory surface molecule. PD-1 deficient mice developed autoimmunity. Finally, a new inhibitory receptor called B and T lymphocyte attenuator (BTLA), initially discovered by Jianfei Yang and Ken Murphy, was recently published in Nature Immunology (2003) 4: 670-679. Increased EAE susceptibility in BTLA-deficient mice was found.

BRIEF SUMMARY OF THE INVENTION

The present invention is based on the discovery of novel mouse and human DNA sequences designated herein as J12 and variants and fragments thereof that are differentially expressed in CD4+ Th2 cells. The nucleic acid and polypeptides sequences described herein can be used in the diagnosis, characterization and or treatment of autoimmune and inflammatory disease diseases. present invention also provides polypeptides and fragments thereof that are encoded by said cDNA sequences. The present invention also provides for antibodies directed to the J12 polypeptides and to expression vectors comprised of J12 DNA sequences and cultured cells that contain the J12 expression vectors.

One embodiment of the invention is a polypeptide comprised of SEQ ID NO: 2 which is the mouse J12 protein sequence. Other embodiments of the invention are the polypeptides of SEQ ID. No's 6-8 which correspond to the polypeptides of three human J12 variants designated Var1, Var2 and Var3.

The invention also encompasses derivatives of the J12 polypeptides. A preferred derivative will have at least 90% polynucleotide identity to the polynucleotide encoding the polypeptides consisting of amino acid sequence of SEQ ID NO's 2 and 6-8. The polynucleotide variants described above can encode polypeptides which contains at least one functional or structural characteristic of J12.

It will be appreciated by those skilled in the art that a multitude of polynucleotide sequences encoding mouse and human J12 sequence, some bearing minimal homology to the polynucleotide sequences of any known and naturally occurring gene may be produced due to the degeneracy of the genetic code. Thus, the present invention also contemplates variations of polynucleotide sequence that could be made by selecting combinations based on alternative codon choices. These combinations are made in accordance with the standard triplet genetic code as applied to the polynucleotide sequence of naturally mouse and human J12.

The invention also encompasses production of DNA sequences which encode human and mouse J12 and J12 derivatives, or fragments thereof, entirely by chemical synthesis. Synthetic sequences may be inserted into expression vectors and host cell systems using reagents that are well known in the art. Moreover synthetic chemistry may be used to introduce mutations into a sequence encoding J12 or any fragment thereof.

Also encompassed by the invention are polynucleotide sequences that are capable of hybridizing to the claimed polynucleotide sequences, and, in particular, to those shown in SEQ ID NO: 1, (mouse J12 cDNA), and SEQ ID. No's 3-5 (human J12 variants) as well as fragments thereof under various conditions of stringency. (See, e.g., Wahl, G. M. and S. L. Berger (1987) Methods Enzymol. 152:399-407; and Kimmel, A. R. (1987) Methods Enzymol. 152:507-511).

Also encompassed by the invention are isolated nucleic acid sequence comprising a sequence at least 80% identical to Var1 and Var3 (SEQ ID No. 3 and SEQ ID No. 5). More preferably the invention encompasses isolated nucleic acid sequences comprising a sequence at least 95% identical to Var1 and Var3.

J12 encoding nucleotide sequences possessing non-naturally occurring codons may also be used. For example, codons preferred by a prokaryotic host can be used to increase protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.

The nucleotide sequences of the present invention can be altered using methods generally known in the art in order to alter J12 encoding sequences by cloning, processing, and/or expression of the gene product. Recombinant DNA techniques and synthetic oligonucleotides may be used to alter the nucleotide sequences.

In another embodiment of the invention, the polynucleotides encoding J12, or derivatives thereof, may be used for therapeutic purposes. In one aspect, the complement of the polynucleotide encoding J12 may be used in situations in which it would be desirable to block the transcription of the mRNA. In particular, cells may be transformed with sequences complementary to polynucleotides encoding J12. Thus, complementary molecules or fragments may be used to modulate J12 activity. Such technology is now well known in the art, and sense or antisense, or siRNA, RNA interference oligonucleotides or larger fragments can be designed from various locations along the coding or control regions of sequences encoding J12. RNA interference oligos and anti-sense oligos could be designed using the sequence of J12 splice variant to specifically inhibit the function of the J12 isoform. RNA interference is a process employing sequence-specific post-transcriptional gene silencing or gene knockdown by providing a double-stranded RNA (dsRNA) that is homologous in sequence to the targeted gene. Small interfering RNAs (siRNAs) can be synthesized in vitro or generated by ribonuclease III cleavage from longer dsRNA and are the mediators of sequence-specific mRNA degradation. SiRNA can be designed according to the technique described by Tuschl, described as follows. Elbashir, S M et al, Nature, 2001, 411, 494-498.

The protein encoded by this novel J12 variant could be selected for use in protein therapeutics. For example, monoclonal antibodies against J12 splice variant polypeptides can be produced. Methods for producing monoclonal antibodies against isolated proteins and their administration to cells are known in the art. Am J Gastroenterol. 2002, 97:2962-72. Monoclonal antibodies directed against the J12 splice variant polypeptides of the invention can be administered to cells to inhibit the function of the protein, and therefore to treat autoimmune, inflammatory and other related diseases.

It is also contemplated that the J12 splice variant of the present invention can be used in screening assays and ultra high throughput assays to identify small molecule inhibitors of the J12 splice variant polypeptides. Small molecule inhibitors could block the binding of this J12 variant to its cell surface receptor. Small molecule inhibitors can be used to block cytokine-receptor interactions. The mechanism could be through occupying protein-protein interacting site on J12, or cause conformation changes of J12

In another embodiment of the invention, natural, modified, or recombinant nucleic acid sequences encoding J12 may be ligated to a heterologous sequence to encode a fusion protein. For example peptide libraries can be screened for inhibitors of J12 activity. It may also be useful to encode a chimeric J12 protein that can be recognized by antibodies that are commercially available. Fusion proteins may also be made to contain cleavage sites between the J12 encoding sequence and other heterologous protein sequence, so that J12 may be cleaved and purified away from the heterologous moiety.

The present invention provides for isolated nucleic acids comprising sequences that encode mouse J12 polypeptides and human J12 variants taught herein.

The present invention also provides isolated nucleic acids comprising sequences that hybridize under highly stringent conditions to hybridization probes of the J12 mouse and human J12 variant sequences.

The present invention also provides isolated nucleic acids comprising sequences having at least 80% identity to the mouse J12 and human J12 variants taught herein.

The present invention also provides isolated nucleic acids comprising sequences that encodes polypeptides comprising the amino acid sequence of mouse and human J12 variants as taught herein that are at least 8 residues in length.

The present invention also provides purified immunogenic polypeptides, the amino acid sequence of which comprises at least ten consecutive residues of mouse and human J12 sequences as taught herein.

Another embodiment of the invention relates to a method of identifying a compound that inhibits the binding of J12 to its natural binding partner, the method comprising,

    • a) providing a J12 polypeptide comprising selected from SED ID No. 2, 6-8 or a combination thereof
    • b) contacting the polypeptide with its natural binding partner and a test compound
    • c) determining whether binding of the binding partner to the polypeptide is decreases in the presence of the test compound, a decrease in said binding being an indication that the test compound inhibits the binding of J12 to its binding partner.

It is contemplated that a recombinant receptor of J12 could used to inhibit J12 binding to its natural receptor.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows an alignment of mouse J12 cDNA sequence (SEQ ID No. 1) with EST AK005939 (SEQ ID No. 23).

FIG. 2A shows the mouse J12 protein sequence (SEQ ID No. 2) and cleavage site. FIG. 2B shows the mouse J12 gene structure (SEQ ID No. 1) vs. AK005939 (SEQ ID No. 23).

FIG. 2C shows the mouse J12 gene genomic structure (SEQ ID No. 1).

FIG. 3 shows J12 mRNA is specifically induced in mouse Th2 cells by anti-CD3 stimulation.

FIG. 4 shows Taqman PCR analysis of J12 mRNA expression in mouse Th2 cell stimulated by anti-CD3.

FIG. 5 shows mouse J12 mRNA expression in normal tissues.

FIG. 6A shows the Human J12 variant 1 protein sequence (SEQ ID No. 6).

FIG. 6B shows the Human J12 variant 2 protein sequence (SEQ ID No. 7).

FIG. 6C shows the Human J12 variant 3 protein sequence (SEQ ID No. 8).

FIG. 7a-b shows Human J12 splicing variant gene structure (SEQ ID Nos. 3-5).

FIG. 8 shows SMART sequence analysis of human J12 var1 (SEQ ID No. 6), human J12 var2 (SEQ ID No. 7) and human J12 var3 (SEQ ID No. 8) protein sequences.

FIG. 9 shows an alignment of the EST AK005939 (SEQ ID No. 23) and human J12variant 1 (SEQ ID No. 3), human J12 variant 2 (SEQ ID No. 4) and human J12 variant 3 (SEQ ID No. 5) DNA.

FIG. 10 shows Taqman PCR analysis of J12 mRNA expression in human Th2 cells stimulated with anti CD3/CD28 stimulation.

FIG. 11 shows the expression of J12 in selected normal human tissues.

FIG. 12 shows the alignment of the human J12, Var1, Var2 partial protein sequences against rat IL4 (SEQ ID No. 24), mouse IL4 (SEQ ID No. 25), mesau IL4 (SEQ ID No. 26), merun IL4 (SEQ ID No. 27), certo IL4 (SEQ ID No. 28), horse IL4 (SEQ ID No. 29), mouse IL13 (SEQ ID No. 30), JU0139 (SEQ ID No. 31) and HSNC30 1 (SEQ ID No. 32).

FIG. 13 shows the alignment of mouse J12 (SEQ ID No. 1) vs AY509149 (IL31) (SEQ ID No. 33) cDNA sequences.

FIG. 14 shows human J12 var1 (Human J12-1) (SEQ ID No. 6) vs AY499343 (IL31) (SEQ ID No. 34) amino acid sequences.

FIG. 15 shows human J12 var2 (Human J12-2) (SEQ ID No. 7) vs AY499343 (IL31) (SEQ ID No. 34) amino acid sequences.

FIG. 16 shows human J12 var3 (Human J12-2) (SEQ ID No. 8) vs AY499343 (IL31) (SEQ ID No. 34) amino acid sequences.

BRIEF DESCRIPTION OF THE SEQUENCES

SEQ ID No. 1 is the mouse J12 cDNA sequence

SEQ ID No. 2 is the mouse J12 protein sequence

SEQ ID No. 3 is human J12 variant 1 DNA full length

SEQ ID No. 4 is human J12 variant 2 DNA full length

SEQ ID No. 5 is humanJl2 variant 3 DNA full length

SEQ ID No. 6 is human J12 variant 1 protein

SEQ ID No.7 is human J12 variant 2 protein

SEQ ID No. 8 is human J12 variant 3 protein

SEQ ID No. 9 is J12 PCR forward primer

SEQ ID No. 10 is J12 PCR reverse primer

SEQ ID No. 11 is TaqMan® FAM-MGB probe:

SEQ ID No. 12 is human J12 forward TaqMan primer

SEQ ID No. 13 is human J12 reverse Taqman primer

SEQ ID No. 14 is Human J12 TaqMan® FAM-MGB probe

SEQ ID No. 15 is mouse J12 cDNA

SEQ ID No. 16 is human J12 Var3 DNA fragment

SEQ ID No. 17 is human J12 Var3 DNA fragment

SEQ ID No. 18 is human J12 Var1 DNA fragment

SEQ ID No. 19 is human J12var2 DNA fragment

SEQ ID No. 20 is mouse J12 ′3 cDNA

SEQ ID No. 21 is human J12 polypeptide 1-125 of var1

SEQ ID No. 22 is human J12 Var3 polypeptide 1-111 or var3

SEQ ID. No. 23 is the mouse EST AK005939 cDNA sequence

SEQ ID. No. 24 is the rat IL4 amino acid sequence

SEQ ID. No. 25 is the mouse IL4 amino acid sequence

SEQ ID. No. 26 is the mesau IL4 amino acid sequence

SEQ ID. No. 27 is the merun IL4 amino acid sequence

SEQ ID. No. 28 is the certo IL4 amino acid sequence

SEQ ID. No. 29 is the horse IL4 amino acid sequence

SEQ ID. No. 30 is the mouse IL13 amino acid sequence

SEQ ID. No. 31 is the JU0139 amino acid sequence

SEQ ID. No. 32 is the HSNC30 1 amino acid sequence

SEQ ID. No. 33 is the mouse AY509149 (IL31) cDNA sequence

SEQ ID. No. 34 is the human AY499343 (IL31) amino acid sequence

DETAILED DESCRIPTION OF THE INVENTION

Definitions

Unless defined otherwise, the scientific and technological terms and nomenclature used herein have the same meaning as commonly understood by a person of ordinary skill in the art to which this invention pertains.

In accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques well known in the art and are described by Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) (hereinafter “Maniatis”); and by Silhavy, T. J., Bennan, M. L. and Enquist, L. W., Experiments with Gene Fusions, Cold Spring Harbor Laboratory Cold Press Spring Harbor, N.Y. (1984); and by Ausubel, F. M. et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-Interscience (1987). “Nucleic Acid Hybridization” [B. D. Hames & S. J. Higgins eds. (1985)]; “Transcription and Translation” [B. D. Hames & S. J. Higgins eds. (1984)]; “Animal Cell Culture” [R. I. Freshney, ed. (1986)]; “Immobilized Cells and Enzymes” [IRL Press, (1986)]; B. Perbal, “A Practical Guide To Molecular Cloning” (1984) and Current Protocols in Molecular Biology, John Wiley and Sons, July, 2002. Therefore, if appearing herein, the following terms shall have the definitions set out below.

The use of the singular forms of the terms “a”, “an,” and “the” include plural reference unless the context clearly indicates otherwise.

Nucleotide sequences are presented herein by single strand, in the 5′ to 3′ direction, from left to right, using the one letter nucleotide symbols as commonly used in the art and in accordance with the recommendations of the IUPAC-IUB Biochemical Nomenclature Commission (Biochemistry, 1972, 11:1726-1732).

As used herein the term “polypeptide” is used interchangeably with amino acid residue sequences or protein and refers to polymers of amino acids of any length. These terms also include proteins that are post-translationally modified through reactions that include, but are not limited to, glycosylation, acetylation, phosphorylation or protein processing. Modifications and changes, for example fusions to other proteins, amino acid sequence substitutions, deletions or insertions, can be made in the structure of a polypeptide while the molecule maintains its biological functional activity. For example, certain amino acid sequence substitutions can be made in a polypeptide or its underlying nucleic acid coding sequence and a protein can be obtained with like properties.

As used herein, the term “cDNA” in the context of this invention refers to deoxyribonucleic acids produced by reverse transcription and typically second-strand synthesis of mRNA or other RNA produced by a gene. If double-stranded, a cDNA molecule has both a coding or sense and a non-coding or antisense strand.

The terms “fragment” of the present invention refer herein to proteins or nucleic acid molecules which can be isolated/purified, synthesized chemically or produced through recombinant DNA technology. All these methods are well known in the art. As exemplified herein below, the nucleotide sequences and polypeptides used in the present invention can be modified, for example by in vitro mutagenesis.

As used herein the term “encoding” refers to the inherent property of specific sequences of nucleotides in a nucleic acid, to serve as templates for synthesis of other molecules having a defined sequence of nucleotides (i.e. rRNA, tRNA, other RNA molecules) or amino acids and the biological properties resulting therefrom. Thus a gene encodes a protein, if transcription and translation of mRNA produced by that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and non-coding strand, used as the template for the transcription, of a gene or cDNA can be referred to as encoding the protein or other product of that gene or cDNA. A nucleic acid that encodes a protein includes any nucleic acids that have different nucleotide sequences but encode the same amino acid sequence of the protein due to the degeneracy of the genetic code. Nucleic acids and nucleotide sequences that encode proteins may include introns.

The terminology “expression vector” defines a vector or vehicle as described above but designed to enable the expression of an inserted sequence following transformation into a host. The cloned gene (inserted sequence) is usually placed under the operation of control element sequences such as promoter sequences. Such expression control sequences will vary depending on whether the vector is designed to express the operably linked gene in a prokaryotic or eukaryotic host or both (shuttle vectors) and can additionally contain transcriptional elements such as enhancer elements, termination sequences, tissue-specificity elements, and/or translational initiation and termination sites.

The terms “vectors” or “DNA construct” are commonly known in the art and refer to any genetic element, including, but not limited to, plasmid DNA, phage DNA, viral DNA and the like which can incorporate the oligonucleotide sequences, or sequences of the present invention and serve as a DNA vehicle into which DNA of the present invention can be cloned. Numerous types of vectors exist and are well known in the art.

As used herein the term “polynucleotide” of the present invention also includes those polynucleotides capable of hybridizing, under stringent hybridization conditions, to sequences herein or the complement thereof. The term “stringent hybridization conditions” is used as generally understood in the art. For example the term can mean an overnight incubation at 42° C. in a solution comprising 50% formamide, 5 ×. SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5×. Denhardt's solution, 10% dextran sulfate, and 20 .mg/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1×SSC at about 60° C. The exact conditions required for “high stringency” may vary depending on the nature of the nucleic acid samples (i.e. DNA:DNA or DNA:RNA).

Also contemplated are nucleic acid molecules that hybridize to the polynucleotides of the present invention at lower stringency hybridization conditions. Changes in the stringency of hybridization and signal detection are primarily accomplished through the manipulation of formamide concentration (lower percentages of formamide result in lowered stringency); salt conditions, or temperature. For example, lower stringency conditions include an overnight incubation at 37 ° C. in a solution comprising 6X SSPE (20×SSPE=3M NaCl; 0.2M NaH2PO4; 0.02M EDTA, pH 7.4), 0.5% SDS, 30% formamide, 100 mu.g/ml salmon sperm blocking DNA; followed by washes at 50° C. with 1×SSPE, 0.1% SDS. In addition, to achieve even lower stringency, washes performed following stringent hybridization can be done at higher salt concentrations (e.g. 5×SSC).

As used herein, the term “host” is meant to include not only prokaryotes but also eukaryotes such as yeast, plant and animal cells. A recombinant DNA molecule or gene which encodes a protein of the present invention can be used to transform a host using any of the techniques commonly known to those of ordinary skill in the art. Prokaryotic hosts may include E. coli, S. tymphimurium, Serratia marcescens and Bacillus subtilis. Eukaryotic hosts include yeasts such as Pichia pastoris, mammalian cells and insect cells.

The terms “amino acid” or “amino acid sequence,” as used herein, refer to an oligopeptide, peptide, polypeptide, or protein sequence, or a fragment of any of these, and to naturally occurring or synthetic molecules. In this context, “fragments”, “immunogenic fragments”, or “antigenic fragments” refer to arrangements of J12 splice variant which are preferably about 5 to about 15 amino acids in length. Where “amino acid sequence” is recited herein to refer to an amino acid sequence of a naturally occurring protein molecule, “amino acid sequence” and like terms are not meant to limit the amino acid sequence to the complete native amino acid sequence associated with the recited protein molecule.

The term “antigenic determinant,” as used herein, refers to that fragment of a molecule (i.e., an epitope) that makes contact with a particular antibody. When a protein or a fragment of a protein is used to immunize a host animal, numerous regions of the protein may induce the production of antibodies which bind specifically to antigenic determinants (given regions or three-dimensional structures on the protein). An antigenic determinant may compete with the intact antigen (i.e., the immunogen used to elicit the immune response) for binding to an antibody.

The terms “complementary” or “complementarity,” as used herein, refer to the natural binding of polynucleotides under permissive salt and temperature conditions by base pairing.

The term “homology or identity,” as used herein, refers to a degree of complementarity. There may be partial homology or complete homology. A partially complementary sequence that at least partially inhibits an identical sequence from hybridizing to a target nucleic acid is referred to as “substantially homologous.” The inhibition of hybridization of the completely complementary sequence to the target sequence may be examined using a hybridization assay under conditions of reduced stringency.

The term “ortholog” refers to a polypeptide obtained from one species that corresponds to the functional counterpart of a polypeptide from another species.

The phrases “percent identity” or “ % identity” refer to the percentage of sequence similarity found in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, e.g., by using the MEGALIGN program (Lasergene software package, DNASTAR. Inc., Madison Wis.). The MEGALIGN program can create alignments between two or more sequences according to different methods, e.g., the clustal method. (Higgins, D. G. and P. M. Sharp (1988) Gene 73:237-244). Percent identity between nucleic acid sequences can also be calculated by the clustal method, or by other methods known in the art, such as the Jotun Hein method. (See, e.g., Hein, J. (1990) Methods in Enzymology 183:626-645.) Identity between sequences can also be determined by other methods known in the art, e.g., by varying hybridization conditions.

The tem “hybridization,” as the term is used herein, refers to any process by which a strand of nucleic acid binds with a complementary strand through base pairing.

The conditions may be varied by adding or removing various blocking reagents. Blocking reagents can include Denhardt's reagent, heparin, BLOTTO, denatured salmon sperm DNA, and commercially available product. The inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility.

The polynucleotide of the present invention can be composed of any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. A polynucleotide may also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons. “Modified” bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus, “polynucleotide” embraces chemically, enzymatically, or metabolically modified forms.

The term “isolated nucleic acid” as used herein refers to a nucleic acid molecule, RNA or DNA that has been removed from its environment.

The tem “degenerate DNA” as used herein refers to a sequence that includes one or more degenerate codons that contain different triplets of nucleotides but encode the same amino acid residue.

The term “stringent conditions as used herein is meant overnight incubation at 42° C. in a solution comprising: 50% formamide, 5×SSC (1.times.SSC=150 mM NaCl 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5× Denhardt's solution, 10% dextran sulfate, and 20 mu.g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1×.SSC at about 65° C. or equivalent conditions.

The term “operably linked” as used herein refers to DNA segments that function together for their intended purpose.

The term “tissue” as used herein refers to one or more cells, extracts and fractions thereof.

The term “cell” as used herein refers to cells in any form, including but not limited to, cells retained in tissue, cell clusters and individually isolated cells.

The term “gene transcription” as used herein refers to a process whereby one strand of a DNA molecule is used as a template for synthesis of a complementary RNA by RNA polymerase.

The term “gene expression” as used herein refers to the process whereby information encoded in a particular gene is decoded into a particular protein. The level of gene expression as the term is used herein can be can be determined by measuring the level of mRNA in a cell.

The term “DNA” as used herein refers to polynucleotide molecules, segments or sequences and is used herein to refer to a chain of nucleotides, each containing the sugar deoxyribose and one of the four adenine (A), guanine (G) thymine (T) or cytosine (C).

The term “RNA” as used herein refers to polynucleotide molecules, segments or sequences and is used herein to refer to a chain of nucleotides each containing the sugar ribose and one of the four adenine (A), guanine (G) uracil (U) or cytosine (C).

The term “oligo” as used herein means a short sequence of DNA or DNA derivative typically 8 to 35 nucleotides in length. The exact size of the molecule will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. An oligonucleotide can be derived synthetically, by cloning or by amplification. The term “derivative” is intended to include any of the above described variants when comprising additional chemical moiety not normally a part of these molecules. These chemical moieties can have varying purposes including, improving a molecule's solubility, absorption, biological half life, decreasing toxicity and eliminating or decreasing undesirable side effects.

The term “autoimmune and inflammatory disease” as used herein means diseases that are associated with autoimmune and inflammatory conditions such as inflammatory and autoimmune conditions such as osteoarthritis, reperfusion injury, asthma, multiple sclerosis, Guillain-Barre syndrome, Crohn's disease, ulcerative colitis, psoriasis, graft versus host disease, systemic lupus erythematosus, rheumatoid arthritis, Alzheimer's disease, toxic shock syndrome, insulin-dependent diabetes mellitis, acute and chronic pain as well as symptoms of inflammation and cardiovascular disease, stroke, myocardial infarction alone or following thrombolytic therapy, thermal injury, adult respiratory distress syndrome (ARDS), multiple organ injury secondary to trauma, acute glomerulonephritis, dermatoses with acute inflammatory components, acute purulent meningitis or other central nervous system disorders, Grave's disease, myasthenia gravis, scleroderma and atopic dermatitis.

The term “cell line” refers to cells capable of stable growth in vitro for multiple generations.

The term “target” refers to any gene perturbed in a disease state, developmental stage or drug treatment. Frequently a target refers to a drug development target that is capable of being altered by an agent or compound. Such drug development targets are suitable for screening candidate compounds used in direct binding assays.

The term “DNA Microarray” as used herein refers collectively to a technique(s) used to measure and analyze the expression of a large number of genes simultaneously and as described in Microarray analysis Schena, Mark Wiley-Liss, 2003 incorporated herein by reference. The term can refer to DNA microarrays which contain microscopic spots of about 1 kb DNA sequences representing thousands of genes bound to the surface of glass microscopic slides. The term can also refer to oligonucleotide arrays (DNA chips) or high density nucleotide probes which contain synthetic oligonucleotides representing thousands of gene sequences synthesized on the surface of small areas of a glass slide.

EXAMPLES

Identification of J12 EST Using Microarray Analysis

The present invention relates to J12 and variants which were initially identified with microarray analysis a technique used in the art used to study the expression level of thousands of genes at the same time. Microarray analysis of Th1 and Th2 stimulated cells was used to identify differentially expressed genes between Th1 and Th2 cells. The analysis was performed with the Affymetrix Genechip system on RNA samples obtained from spleen cells derived from DO11 TCR transgenic mice. These spleen cells were stimulated with OVA and different antibodies and recombinant proteins in order to promote the differentiation of the cells into Th1 and Th2 cells. The Th1 or Th2 cells were then stimulated with anti-CD3 antibodies for 2 hours and then total RNA was prepared for microarray analysis. Preparation of the RNA samples and hybridization with the gene chip apparatus was performed according to the methods specified herein using techniques suggested by Affymetrix. The data obtained from the microarray analysis of the RNA samples was analyzed revealing that EST AK005939 (SEQ ID No. 23) exhibited Th2 specific expression. We conducted further analysis on the EST.

Identification of the Full Length J12 Mouse cDNA Sequence

Using the procedure that follows the full length cDNA corresponding to the EST was obtained. The full length mouse cDNA corresponding to the EST and IMAGE clones relating to AK005939 (SEQ ID No. 23) were obtained from the American Type culture collection and further purified and sequenced. One of Image clones corresponded to the full-length of J12.

Description of the Mouse J12 cDNA

The mouse cDNA corresponding to the EST AK005939 (SEQ ID No. 23) is shown in SEQ ID. NO. 1, however there is a 221 by fragment inserted between T237 and G238 of EST AK005939 (SEQ ID No. 23). FIG. 1 shows an alignment of EST AK005939 (SEQ ID No. 23) and the mouse J12 sequence (SEQ ID No. 1). SEQ ID. No 15 is a fragment of the cDNA that does not align with EST AK005939 (SEQ ID No. 23). The mouse J12 cDNA (SEQ ID No. 1) is predicted to encode a 163 amino acid protein having a signal peptide with the cleavage site between Gly30 and Ala31 SEQ ID. NO. 2. See FIG. 2A and 2B. The mouse J12 gene Genomic structure (SEQ ID No. 1) compared with AK005939 (SEQ ID No. 23) was shown in FIG. 2C.

The J12 mRNA is specifically induced in mouse Th2 cells by anti-CD3 stimulation. (FIG. 3) Th1 and Th2 cells were stimulated with anti-CD3 antibodies for 2 hours before cells were harvested for total RNA extraction. Biotin-labeled cRNAs were in vitro transcribed from double strand cDNA synthesized from total RNA. The cRNAs were used to probe the Affymetrix M430 Chip A and B. After normalization, we discovered that EST AK005939 (SEQ ID No. 23), which contain part of J12 sequence (SEQ ID No. 2), is specifically expressed in Th2 cells. See FIG. 2. The results of Taqman PCR confirmed that J12 mRNA is specifically induced in mouse Th2 cell by anti-CD3 stimulation. See FIG. 4.

Expression of mouse J12 cDNA in normal tissues is shown in FIG. 5. J12 is expressed predominantly in Th2 cells. J12 was also expressed at a lower level in Testes. J12 expression was at undetectable levels in the other tissues tested including brain, heart, liver, lung, and spleen.

Human J12 cDNA Variants and the Proteins They Encode for.

Having established the mouse J12 sequence (SEQ ID No. 1) it was of further interest to find the human ortholog of J12. The further interest is looking for human ortholog of mouse J12. A Blast search conducted against NCBI non-redundant database using protein sequence derived from AK005939 (SEQ ID No. 23) revealed no significant hits other than itself. The blast search conducted using mouse J12 protein sequence (SEQ ID No. 2) against the human genome showed a single hit on human chromosome 12 with statistically significant similarity. The blast hit is located on the reverse complement strand of a human gene named MGC35140. This suggests that there may be a human J12 gene missed by the current model prediction due to the overlapping with gene MGC35140 at the genomic sequence level. The GenScan prediction using a segment of genomic sequence covering the targeted region clearly indicated a new human gene encoding a longer protein sequence than the ORF derived from AK005939 (SEQ ID No. 23). It also contains a predicted signal peptide. This in turn suggested that AK005939 (SEQ ID No. 23) may not be a complete ORF or there might be other splicing variants in mouse genome which can be secreted. The GenScan prediction using a longer mouse genome fragment supported this idea and a gene model with longer ORF with signal peptide is predicted. Based on predicted human J12 we cloned the human J12 using the RACE method.

Three variants of the human J12 clone were found. These variants are designated as human J12 var1 (SEQ ID. No. 3), human J12 var2 (SEQ ID No. 4) and human J12 var3 (SEQ ID No. 5). The predicted amino acid sequence for these variants are shown in SEQ ID No's 6-8 respectively. FIG. 6a-c shows the predicted protein sequences of the human J12 variants 1-3 respectively (SEQ ID Nos. 6-8). Human J12 var1 (SEQ ID No. 3) encodes for a 275 amino acid polypeptide. Human J12 var2 (SEQ ID No. 4) encodes for a 164 amino acid polypeptide having a signal peptide cleavage site between amino acids residues 23 and 24. Human J12 var3 (SEQ ID No. 5) encodes for a 164 amino acid polypeptide. FIG. 7 shows an alignment of the coding regions and the cloned sequences for the three human J12 variants (SEQ ID Nos. 3-5). FIG. 8 shows the SMART sequence analysis of human J12 variant 1 (SEQ ID No. 6), variant 2 (SEQ ID No. 7) and variant 3 (SEQ ID No. 8) protein sequences. FIG. 9 shows an alignment of the three human J12 variants (SEQ ID Nos. 3-5) and the EST AK005939 (SEQ ID No. 23). SEQ ID No. 16 is 3′ a base fragment of J12 Var3 that does not align with EST AK005939 (SEQ ID No. 23). SEQ ID. No. 17 is a 3′ base fragment of J12 Var1 that does not align with EST AK005939 (SEQ ID No. 23). SEQ ID No. 18 corresponds to 3′ bases of J12 Var1. SEQ ID. No. 19 corresponds to 3′ bases of human J12 Var2.

We confirmed that J12 is specifically expressed in human Th2 cells using Taqman PCR. See FIG. 10. Human naïve CD4+ T cells were purified from PBMC and the cells were differentiated into Th1 and Th2 cells for 2 weeks. Cells were then stimulated with anti-CD3 or anti-CD3 and anti-CD28 for 4 hours before total RNA was extracted. RT-TaqMan PCR was performed. The unstimulated (None) cells do not express J12 while J12 was highly induced in Th1 cells stimulated with anti-CD3 or anti-CD3/anti-CD28. CD28 signaling does not play an important role in J12 expression since there is no different expression of J12 between anti-CD3 and anti-CD3/anti-cD28 stimulation.

J12 is expressed in selected normal human tissues is shown in FIG. 11. J12 is expressed predominantly in testes cells. It is also expressed in adrenal gland, small intestine, and skeletal muscle. J12 was expressed at lower level in brain (cerebellum), lung and placenta. J12 was expressed at very low levels in heart, brain, kidney spleen, thymus colon and bone marrow.

Homology to IL-4 and IL-13

A homology search of the human J12 sequences revealed that is a novel gene bearing homology to several human cytokines such as IL-4 and IL-13. FIG. 8 shows an alignment of human J12 variant 1, variant 2 and variant 3 partial protein sequences against the human IL-4 and IL-13 sequences.

Homology to IL-31

IL31 (Genbank accession number for the nucleic acid is AY499343) (SEQ ID No. 34) is a T cell derived cytokine disclosed in Nature Immunology, Jul. 4, 2004 and in United States Patent application No. 20030224487, published Dec. 3, 2003. FIG. 13 shows an alignment of the mouse J12 sequence (SEQ ID No. 1) to the published coding sequence for IL-31 based on from United States Patent application No. 20030224487. The sequences are identical in the coding regions except for the insertion of GGG at positions 987-999 of the Mouse J12 sequence (SEQ ID No. 1). The bases are not located in AY509149 (SEQ ID No. 33). Also, the Mouse J12 (SEQ ID No. 1) has a longer 3′ and 5′ UTR relative to IL-31. SEQ ID. No. 20 is mouse J12 bases 1-427. FIG. 14 shows the human J12 VAR1 (SEQ ID No. 6) aligned to the protein sequence for IL31 (AY499343) (SEQ ID No. 34). The human J12 VAR 2 has 125 additional amino acid residues at the C terminal end of the polypeptide. SEQ ID. No. 21. FIG. 15 shows human J12 var2 (Human J12-2) (SEQ ID No. 7) vs AY499343 (IL31) (SEQ ID No. 34) amino acid sequences and that the sequences are identical. FIG. 16 shows human J12 var3 (Human J12-3) (SEQ ID No. 8) vs AY499343 (IL31) (SEQ ID No. 34) amino acid sequences. Human J12 var1 has 111 more amino acids than human AY499343 (IL31) (SEQ ID No. 34). SEQ ID. No. 22.

The first 350 bases of SEQ ID. No. 3 do not match the IL-31 sequence (SEQ ID No. 34). The first 597 bases of SEQ ID No. 5 do not match the IL-31 sequence (SEQ ID No. 34).

Functions of J12

J12 is differentially expressed in activated Th2 cells and therefore serves as a marker for Th2 stimulated cells that are associated with diseases such as Asthma. There are several possible functions for the J12 protein including the possible involvement in Th1 and Th2 cytokine production, such as interferon γ, IL2, TNFα, IL4, IL5, IL10 and IL13, and in T cell homeostasis (proliferation and apoptosis). As a secreted or cell-surface protein J12 could also function as pro-inflammatory mediators (adhesion, chemotaxis, growth factor) for other cell types.

Methods of Making Antibodies to J12

Polycolonal or monoclonal antibodies against J12 could be used to perform Western blot, immunoprecipitation, immunohistochemistry and FACS analysis. Methods for making polyclonal and monoclonal antibodies against polypeptides are known in the art and are described in Current Protocols in Immunology, 2004 by John Wiley & Sons, Inc. the contents of which is incorporated herein Importantly, they could be used to neutralize J12 activity in vitro and in vivo if they are neutralizing antibodies. The neutralizing antibodies could be used to treat several diseases such as autoimmune and inflammatory diseases.

Human and mouse J12 short peptides and whole protein will be used to immunize animals to produce antibodies. Short peptides will be chemically synthesized and conjugated to KLH. The conjugated J12-KLH will be mixed in CFA (Complete Freund's adjuvant). The J12-KLH-CFA mix will be intradermally injected into rabbits for polycolonal antibody production. The rabbits will be boosted with J12-KLH mixed with IFA (Incomplete Freud's adjuvant) every 4 weeks. The antibody titer in the blood will be detected by ELISA. Once high titers of J12 antibody detected, the animals will be sacrificed and the J12 antibodies in the blood will be purified by affinity purification. Whole J12 recombinant proteins will also used to immunize the animals. J12 protein will mixed with CFA as described and the same procedure will be performed as above.

For the generation of monoclonal antibodies, rats or mice will be immunized with J12 peptide-KLH or J12 protein. Recombinant humanized J12 monoclonal antibodies will be finally used to treat human diseases.

Methods of RNA Isolation

Methods of RNA isolation are well known in the art and the RNA isolation method used should depend on the source of the cells. See Maniatis et al, Molecular Cloning: A laboratory Manual, Third Edition (2001) (Cold Spring Harbor Press, Cold Spring Harbor, N.Y). The preferred method of RNA isolation is the Qiagen RNA purification kit. (Qiagen, Valencia, Calif.).

Steps should be taken to avoid degradation of the RNA prior to analysis. Typically, RNA is isolated from cells soon after the cells have been collected for analysis. Cells that have been collected should be stored under conditions that limit the degradation of RNA known to those skilled in the art. Likewise, after RNA has been isolated from the cell samples the RNA should be stored under conditions that reduce RNA degradation. For example, RNA should be stored on dry ice or under −70° C. conditions under RNAse free conditions. DEPC water should be used in buffers and solutions. Conditions should also be maintained such that additional RNA synthesis is terminated when the cells are collected. In this way RNA expression will be representative of the types and levels of RNA expression at the time of collection.

Isolated RNA from the cells is used to synthesize double stranded DNA in a reverse transcriptase reaction that can be performed according to methods known to those skilled in the art. The preferred reverse transcriptase is the Superscript reverse transcriptase (Superscript Choice™, Invitrogen Carlsbad, Calif.). It is used according the manufacturers instructions. Approximately 5 to 15 μg total RNA from each time points are used to measure in reverse transcriptase reactions. The amount of RNA used varies depending on the number of genes tested and the method used to detect gene expression.

The cDNA is used as a template for the synthesis of labeled cRNA with a plasmid or vector. The cRNA can be labeled with fluorescence or with other methods commonly used in the art such as for labeling nucleic acids. The cRNA is most preferably labeled with biotin. The cRNA is then fragmented using an alkaline base method commonly used in the art.

Preferred Embodiment of the Invention

The following examples are provided to illustrate the invention, but not to limit its scope. Other variants of the invention will be readily apparent to one of ordinary skill in the art. The contents of all references, patents and published patent applications cited throughout this application, as well as the figures and sequence listing are hereby incorporated by reference.

Preparation of the Cells and RNA Samples

D011.10 transgenic spleen cells were cultured in Iscove's DME medium plus10% FCS, L-Glutamine (2 mM), NEAA (0.1 mM), Na Pyruvate (1 mM) and 2-mercaptoethonol (0.05 mM) in the presence of recombinant IL2 (2 ng/ml, eBioscience) at a concentration of 5×105/ml. Cells were stimulated with the TCR specific antigen OVA (Ovalbumin, 500 μg/ml). For Th1 differentiation, the culture were added with recombinant IL-12 (5 ng/ml, CALBIOCHEM) and anti-IL4 (11B11) (2 μg/ml, eBioscience). For Th2 differentiation, recombinant IL-4 (10 ng/ml, CALBIOCHEM) and anti-IL-12 (1 μg/ml, Cell Sciences) were added into the culture. At day 7 cells were differentiated into Th1 and Th2 cells. The cells were then harvested, washed, counted and resuspended in the culture medium without 1L2 at a concentration of 2×106/ml. Cells were stimulated with plate bound anti-CD3 antibody (10 μg/ml) for 4 hours before harvesting for total RNA extraction. Some cells were restimulated with OVA and irradiated BALB/c splenic cells (2000 rad) for another 7 day. Cells were then harvested and restimulated with anti-CD3 for 4 hours before harvesting for total RNA extraction.

RNA was isolated using the RNeasy total RNA isolation kit from Qiagen and a reverse transcription reaction was run on 1 μg of RNA using the RT kit supplied by Applied Biosystems (Foster City, Calif.) in the following manner. Each reaction contained 1× RT buffer, 5.5 mM MgCl2, 500 μM of each dNTP, 2.5 μM of Random Hexamers, 0.4 U/μl of RNase inhibitor, and 1.25 U/μl of MultiScribe Reverse Transcriptase. RT reactions were carried out at 25° C. for 10 min, 48° C. for 40 min and 95° C. for 5 min

Microarray Analysis of RNA Samples

TaqMan real-time PCR was performed in a MicroAmp Optical 96-Well Reaction Plate to (Applied Biosystems). Each well contained 4 μl of each RT product, 1× TaqMan master mix (Applied Biosystem or Eurogentec), primers (forward and reverse), and TaqMan FAM MGB probe in a total volume of 25 μl. Amplification conditions were 2 min at 50° C. (for AmpErase UNG incubation to remove any uracil incorporated into the cDNA), 10 min at 95° C. (for AmpliTaq™ Gold activation), and then run for 40 cycles at 95° C. for 15 seconds, 60° C. for 1 min. All reactions were performed in the ABI Prism 7700 Sequence Detection System for the test samples, standards, and no template controls. They were run in duplicates using the Sequence Detector V 1.6 program. The Rn and Ct were averaged from the values obtained in each reaction. A standard curve was constructed by plotting the Ct vs. the known copy numbers of the template in the standard. According to the standard curve, the copy numbers for all unknown samples were obtained automatically. To determine the copy numbers of the target transcript, a mouse or human genomic DNA (Clontech, Palo Alto, Calif.) was used to generate a standard curve. The copy numbers of genomic DNA template were calculated according to the molecular weight of human diploid genome [3×109 bp=3×109×660 (M.W.)=2×1012 a and then 1 μg/μl genomic DNA was converted into 2.4×106 copy numbers based upon the Avogadro's number (1 mol=6.022×1023 molecules). The genomic DNA was diluted every ten-fold at a range of 5×105 to 5×100 copy numbers. Each sample was run in duplicates, and the Rn (the ratio of the amount of reporter dye emission to the quenching dye emission) and threshold cycle (Ct) values were averaged from each reaction. The copy numbers were then normalized to GAPDH to minimize variability in the results due to differences in the RT efficiency and RNA integrity among tests.

Th1 cells expressed a high level of IFN-γ and low levels of IL-4 when cells were stimulated with anti-CD3, while Th2 cells expressed higher level of IL-4 and low IFN-γ after stimulation with anti-CD3.

Finally, the The cRNA was prepared according to standard protocols provided by the Affymetrix. The cRNA was hybridized onto the murine and murine M430 chip B.

The TaqMan mix of IFNγ and IL-4 was purchased from Applied Biosystems. The J12 TaqMan primers and probe are described as follows:

1) Mouse J12 TaqMan Primers

SEQ ID No. 9
AK005939-F: GGATGTCAGCAGACGAATCAATAC
SEQ ID No. 10
AK005939-R: TTGACTTTCTCCAGATGTGCTATGA

2) Mouse J12 TaqMan® FAM-MGB Probe:

SEQ ID No. 11
AK005939-447T CAGCCTGGACCGGGAAGCATTAACC

3) Human J12 TaqMan Primers:

SEQ ID No. 12
H-J12-19F: GTGCTCGTGTCCCAGAATTACAC;
SEQ ID No. 13
H-J12-R: TGTCTAGCTGTCTGATTGTCTTGAGATA

4) Human J12 TaqMan® FAM-MGB Probe:

SEQ ID No 14
H-J12-Probe: TCCACAGCCCAGCCATCCGG.

Claims

1-4. (canceled)

5. A purified polypeptide, the amino acid sequence of which comprises a sequence at least 90% identical to SEQ ID No. 8.

6. A method of identifying a compound that inhibits the binding of J12 to its natural binding partner, the method comprising,

a) providing a J12 polypeptide comprising SEQ ID No. 8;

b) contacting the polypeptide with its natural binding partner and a test compound

c) determining whether binding of the binding partner to the polypeptide is decreases in the presence of the test compound, a decrease in said binding being an indication that the test compound inhibits the binding of J12 to its binding partner.

7. An antibody against a polypeptide selected from the list consisting of human J12 var1, human J12 var2 or human J12 var3.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: