US20120178644A1
2012-07-12
13/347,555
2012-01-10
The present invention concerns prognostic markers associated with EGFR positive cancer. In particular, the invention concerns prognostic methods based on the molecular characterization of gene expression in paraffin-embedded, fixed tissue samples of EGFR-expressing cancer, which allow a physician to predict whether a patient is likely to respond well to treatment with an EGFR inhibitor.
Get notified when new applications in this technology area are published.
C12Q1/6886 » CPC main
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
C12Q2600/106 » CPC further
Oligonucleotides characterized by their use Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
C12Q2600/158 » CPC further
Oligonucleotides characterized by their use Expression markers
C12Q2600/16 » CPC further
Oligonucleotides characterized by their use Primer sets for multiplex assays
C40B30/04 IPC
Methods of screening libraries by measuring the ability to specifically bind a target molecule, e.g. antibody-antigen binding, receptor-ligand binding
C12Q1/68 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids
This application claims priority under 35 U.S.C. §119(e) to provisional application Ser. No. 60/427,090 filed on Nov. 15, 2002, the entire disclosure of which is hereby expressly incorporated by reference.
1. Field of the Invention
The present invention concerns gene expression profiling of tissue samples obtained from EGFR-positive cancer. More specifically, the invention provides diagnostic, prognostic and predictive methods based on the molecular characterization of gene expression in paraffin-embedded, fixed tissue samples of EGFR-expressing cancer, which allow a physician to predict whether a patient is likely to respond well to treatment with an EGFR inhibitor. In addition, the present invention provides treatment methods based on such findings.
2. Description of the Related Art
Oncologists have a number of treatment options available to them, including different combinations of chemotherapeutic drugs that are characterized as âstandard of care,â and a number of drugs that do not carry a label claim for particular cancer, but for which there is evidence of efficacy in that cancer. Best likelihood of good treatment outcome requires that patients be assigned to optimal available cancer treatment, and that this assignment be made as quickly as possible following diagnosis.
Currently, diagnostic tests used in clinical practice are single analyte, and therefore do not capture the potential value, of knowing relationships between dozens of different markers. Moreover, diagnostic tests are frequently not quantitative, relying on immunohistochemistry. This method often yields different results in different laboratories, in part because the reagents are not standardized, and in part because the interpretations are subjective and cannot be easily quantified. RNA-based tests have not often been used because of the problem of RNA degradation over time and the fact that it is difficult to obtain fresh tissue samples from patients for analysis. Fixed paraffin-embedded tissue is more readily available and methods have been established to detect RNA in fixed tissue. However, these methods typically do not allow for the study of large numbers of genes (DNA or RNA) from small amounts of material. Thus, traditionally fixed tissue has been rarely used other than for immunohistochemistry detection of proteins.
Recently, several groups have published studies concerning the classification of various cancer types by microarray gene expression analysis (see, e.g. Golub et al., Science 286:531-537 (1999); Bhattacharjae et al., Proc. Natl. Acad. Sci. USA 98:13790-13795 (2001); Chen-Hsiang et al., Bioinformatics 17 (Suppl. 1):S316-S322 (2001); Ramaswamy et al., Proc. Natl. Acad. Sci. USA 98:15149-15154 (2001)). Certain classifications of human breast cancers based on gene expression patterns have also been reported (Martin et al., Cancer Res. 60:2232-2238 (2000); West et al., Proc. Natl. Acad. Sci. USA 98:11462-11467 (2001); Sorlie et al., Proc. Natl. Acad. Sci. USA 98:10869-10874 (2001); Yan et al., Cancer Res. 61:8375-8380 (2001)). However, these studies mostly focus on improving and refining the already established classification of various types of cancer, including breast cancer, and generally do not link the findings to treatment strategies in order to improve the clinical outcome of cancer therapy.
Although modern molecular biology and biochemistry have revealed more than 100 genes whose activities influence the behavior of tumor cells, state of their differentiation, and their sensitivity or resistance to certain therapeutic drugs, with a few exceptions, the status of these genes has not been exploited for the purpose of routinely making clinical decisions about drug treatments. One notable exception is the use of estrogen receptor (ER) protein expression in breast carcinomas to select patients to treatment with anti-estrogen drugs, such as tamoxifen. Another exceptional example is the use of ErbB2 (Her2) protein expression in breast carcinomas to select patients with the Her2 antagonist drug HerceptinÂŽ (Genentech, Inc., South San Francisco, Calif.).
Despite recent advances, the challenge of cancer treatment remains to target specific treatment regimens to pathogenically distinct tumor types, and ultimately personalize tumor treatment in order to optimize outcome. Hence, a need exists for tests that simultaneously provide predictive information about patient responses to the variety of treatment options.
The present invention is based on findings of Phase II clinical studies of gene expression in tissue samples obtained from EGFR-expressing head and neck cancer or colon cancer of human patients who responded well or did not respond to (showed resistance to) treatment with EGFR inhibitors.
Based upon such findings, in one aspect the present invention concerns a method for predicting the likelihood that a patient diagnosed with an EGFR-expressing cancer will respond to treatment with an EGFR inhibitor, comprising determining the expression level of one or more prognostic RNA transcripts or their products in a sample comprising EGFR-expressing cancer cells obtained from the patient, wherein the prognostic transcript is the transcript of one or more genes selected from the group consisting of: Bak; Bclx; BRAF; BRK; Cad17; CCND3; CD105; CD44s; CD82; CD9; CGA; CTSL; EGFRd27; ErbB3; EREG; GPC3; GUS; HGF; ID1; IGFBP3; ITGB3; ITGB3; p27; P53; PTPD1; RB1; RPLPO; STK15; SURV; TERC; TGFBR2; TIMP2; TITF1; XIAP; YB-1; A-Catenin; AKT1; AKT2; APC; Bax; B-Catenin; BTC; CA9; CCNA2; CCNE1; CCNE2; CD134; CD44E; CD44v3; CD44v6; CD68; CDC25B; CEACAM6; Chk2; cMet; COX2; cripto; DCR3; DIABLO; DPYD; DR5; EDN1 endothelin; EGFR; EIF4E; ERBB4; ERK1; fas; FRP1; GRO1; HB-EGF; HER2; IGF1R; IRS1; ITGA3; KRT17; LAMC2; MTA1; NMYC; P14ARF; PAI1; PDGFA; PDGFB; PGK1; PLAUR; PPARG; RANBP2; RASSF1; RIZ1; SPRY2; Src; TFRC; TP53BP1; UPA; and VEGFC, wherein (a) the patient is unlikely to benefit from treatment with an EGFR inhibitor if the normalized levels of any of the following genes A-Catenin; AKT1; AKT2; APC; Bax; B-Catenin; BTC; CA9; CCNA2; CCNE1; CCNE2; CD134; CD44E; CD44v3; CD44v6; CD68; CDC25B; CEACAM6; Chk2; cMet; COX2; cripto; DCR3; DIABLO; DPYD; DR5; EDN1 endothelin; EGFR; EIF4E; ERBB4; ERK1; fas; FRP1; GRO1; HB-EGF; HER2; IGF1R; IRS1; ITGA3; KRT17; LAMC2; MTA1; NMYC; P14ARF; PAIL; PDGFA; PDGFB; PGK1; PLAUR; PPARG; RANBP2; RASSF1; RIZ1; SPRY2; Src; TFRC; TP53BP1; upa; VEGFC, or their products are elevated above defined expression thresholds, and (b) the patient is likely to benefit from treatment with an EGFR inhibitor if the normalized levels of any of the following genes Bak; Bclx; BRAF; BRK; Cad17; CCND3; CD105; CD44s; CD82; CD9; CGA; CTSL; EGFRd27; ErbB3; EREG; GPC3; GUS; HGF; ID1; IGFBP3; ITGB3; ITGB3; p27; P53; PTPD1; RB1; RPLPO; STK15; SURV; TERC; TGFBR2; TIMP2; TITF1; XIAP; and YB-1, or their products are elevated above defined expression thresholds.
In another aspect, the present invention concerns a prognostic method comprising
(a) subjecting a sample comprising EGFR-expressing cancer cells obtained from a patient to quantitative analysis of the expression level of at least one gene selected from the group consisting of CD44v3; CD44v6; DR5; GRO1; KRT17; and LAMC2 gene or their products, and
(b) identifying the patient as likely to show resistance to treatment with an EGFR-inhibitor if the expression levels of such gene or genes, or their products, are elevated above a defined threshold. In a particular embodiment, the gene is LAMC2.
In yet another aspect, the invention concerns a method for predicting the likelihood that a patient diagnosed with an EGFR-expressing head or neck cancer will respond to treatment with an EGFR inhibitor, comprising determining the expression level of one or more prognostic RNA transcripts or their products in a sample comprising EGFR-expressing cancer cells obtained from such patient, wherein the prognostic transcript is the transcript of one or more genes selected from the group consisting of: CD44s; CD82; CGA; CTSL; EGFRd27; IGFBP3; p27; P53; RB1; TIMP2; YB-1; A-Catenin; AKT1; AKT2; APC; Bax; B-Catenin; BTC; CCNA2; CCNE1; CCNE2; CD105; CD44v3; CD44v6; CD68; CEACAM6; Chk2; cMet; COX2; cripto; DCR3; DIABLO; DPYD; DR5; EDN1 endothelin; EGFR; EIF4E; ERBB4; ERK1; fas; FRP1; GRO1; HB-EGF; HER2; IGF1R; IRS1; ITGA3; KRT17; LAMC2; MTA1; NMYC; PAIL; PDGFA; PGK1; PTPD1; RANBP2; SPRY2; TP53BP1; and VEGFC, wherein (a) normalized expression of one or more of A-Catenin; AKT1; AKT2; APC; Bax; B-Catenin; BTC; CCNA2; CCNE1; CCNE2; CD105; CD44v3; CD44v6; CD68; CEACAM6; Chk2; cMet; COX2; cripto; DCR3; DIABLO; DPYD; DR5; EDN1 endothelin; EGFR; EIF4E; ERBB4; ERK1; fas; FRP1; GR01; HB-EGF; HER2; IGF1R; IRS1; ITGA3; KRT17; LAMC2; MTA1; NMYC; PAIL; PDGFA; PGK1; PTPD1; RANBP2; SPRY2; TP53BP1; VEGFC, or the corresponding gene product, above determined expression thresholds indicates that the patient is likely to show resistance to treatment with an EGFR inhibitor, and (b) normalized expression of one or more of CD44s; CD82; CGA; CTSL; EGFRd27; IGFBP3; p27; P53; RB1; TIMP2; YB-1, or the corresponding gene product, above defined expression thresholds indicates that the patient is likely to respond well to treatment with an EGFR inhibitor.
In a further aspect, the invention concerns a method for predicting the likelihood that a patient diagnosed with an EGFR-expressing colon cancer will respond to treatment with an EGFR inhibitor, comprising determining the expression level of one or more prognostic RNA transcripts or their products in a sample comprising EGFR-expressing cancer cells obtained from the patient, wherein the prognostic transcript is the transcript of one or more genes selected from the group consisting of Bak; Bclx; BRAF; BRK; Cad17; CCND3; CCNE1; CCNE2; CD105; CD9; COX2; DIABLO; ErbB3; EREG; FRP1; GPC3; GUS; HER2; HGF; ID1; ITGB3; PTPD1; RPLPO; STK15; SURV; TERC; TGFBR2; TITF1; XIAP; CA9; CD134; CD44E; CD44v3; CD44v6; CDC25B; CGA; DR5; GR01; KRT17; LAMC2; P14ARF; PDGFB; PLAUR; PPARG; RASSF1; RIZ1; Src; TFRC; and UPA, wherein (a) elevated expression of one or more of CA9; CD134; CD44E; CD44v3; CD44v6; CDC25B; CGA; DR5; GRO1; KRT17; LAMC2; P14ARF; PDGFB; PLAUR; PPARG; RASSF1; RIZ1; Src; TFRC; and UPA, or the corresponding gene product, above defined expression thresholds indicates that the patient is likely to show resistance to treatment with an EGFR inhibitor, and normalized expression of one or more of Bak; Bclx; BRAF; BRK; Cad17; CCND3; CCNE1; CCNE2; CD105; CD9; COX2; DIABLO; ErbB3; EREG; FRP1; GPC3; GUS; HER2; HGF; ID1; ITGB3; PTPD1; RPLPO; STK15; SURV; TERC; TGFBR2; TITF1; XIAP, or the corresponding gene product, above certain expression thresholds indicates that the patient is likely to respond well to treatment with an EGFR inhibitor.
In another aspect, the invention concerns a method comprising treating a patient diagnosed with an EGFR-expressing cancer and determined to have elevated normalized levels of one or more of the RNA transcripts of Bak; Bclx; BRAF; BRK; Cad17; CCND3; CD105; CD44s; CD82; CD9; CGA; CTSL; EGFRd27; ErbB3; EREG; GPC3; GUS; HGF; ID1; IGFBP3; ITGB3; ITGB3; p27; P53; PTPD1; RB1; RPLPO; STK15; SURV; TERC; TGFBR2; TEMP2; TITF1; XIAP; YB-1; A-Catenin; AKT1; AKT2; APC; Bax; B-Catenin; BTC; CA9; CCNA2; CCNE1; CCNE2; CD134; CD44E; CD44v3; CD44v6; CD68; CDC25B; CEACAM6; Chk2; cMet; COX2; cripto; DCR3; DIABLO; DPYD; DR5; EDN1 endothelin; EGFR; EIF4E; ERBB4; ERK1; fas; FRP1; GRO1; HB-EGF; HER2; IGF1R; IRS1; ITGA3; KRT17; LAMC2; MTA1; NMYC; P14ARF; PAI1; PDGFA; PDGFB; PGK1; PLAUR; PPARG; RANBP2; RASSF1; RIZ1; SPRY2; Src; TFRC; TP53BP1; UPA; and VEGFC genes, or the corresponding gene products in the cancer, with an effective amount of an EGFR-inhibitor, wherein elevated RNA transcript level is defined by a defined expression threshold.
In yet another aspect, the invention concerns a method comprising treating a patient diagnosed with an EGFR-expressing head or neck cancer and determined to have elevated normalized expression of one or more of the RNA transcripts of CD44s; CD82; CGA; CTSL; EGFRd27; IGFBP3; p27; P53; RB1; TIMP2; YB-1; A-Catenin; AKT1; AKT2; APC; Bax; B-Catenin; BTC; CCNA2; CCNE1; CCNE2; CD105; CD44v3; CD44v6; CD68; CEACAM6; Chk2; cMet; COX2; cripto; DCR3; DIABLO; DPYD; DR5; EDN1 endothelin; EGFR; EIF4E; ERBB4; ERK1; fas; FRP1; GRO1; HB-EGF; HER2; IGF1R; IRS1; ITGA3; KRT17; LAMC2; MTA1; NMYC; PAI1; PDGFA; PGK1; PTPD1; RANBP2; SPRY2; TP53BP1; VEGFC genes, or the corresponding gene products in said cancer, with an effective amount of an EGFR-inhibitor, wherein elevated normalized RNA transcript level is defined by a defined expression threshold.
In a further aspect, the invention concerns a method comprising treating a patient diagnosed with an EGFR-expressing colon cancer and determined to have elevated normalized expression of one or more of the RNA transcripts of Bak; Bclx; BRAF; BRK; Cad17; CCND3; CCNE1; CCNE2; CD105; CD9; COX2; DIABLO; ErbB3; EREG; FRP1; GPC3; GUS; HER2; HGF; ID1; ITGB3; PTPD1; RPLPO; STK15; SURV; TERC; TGFBR2; TITF1; XIAP; CA9; CD134; CD44E; CD44v3; CD44v6; CDC25B; CGA; DR5; GR01; KRT17; LAMC2; P14ARF; PDGFB; PLAUR; PPARG; RASSF1; RIZ1; Src; TFRC; UPA genes, or the corresponding gene products in such cancer, with an effective amount of an EGFR-inhibitor, wherein elevated normalized RNA transcript level is defined by a defined expression threshold.
The invention further concerns an array comprising (a) polynucleotides hybridizing to the following genes: Bak; Bclx; BRAF; BRK; Cad17; CCND3; CD105; CD44s; CD82; CD9; CGA; CTSL; EGFRd27; ErbB3; EREG; GPC3; GUS; HGF; ID1; IGFBP3; ITGB3; ITGB3; p27; P53; PTPD1; RB1; RPLPO; STK15; SURV; TERC; TGFBR2; TIMP2; TITF1; XIAP; YB-1; A-Catenin; AKT1; AKT2; APC; Bax; B-Catenin; BTC; CA9; CCNA2; CCNE1; CCNE2; CD134; CD44E; CD44v3; CD44v6; CD68; CDC25B; CEACAM6; Chk2; cMet; COX2; cripto; DCR3; DIABLO; DPYD; DR5; EDN1 endothelin; EGFR; EIF4E; ERBB4; ERK1; fas; FRP1; GRO1; HB-EGF; HERZ; IGF1R; IRS1; ITGA3; KRT17; LAMC2; MTA1; NMYC; P14ARF; PAI1; PDGFA; PDGFB; PGK1; PLAUR; PPARG; RANBP2; RASSF1; RIZ1; SPRY2; Src; TFRC; TP53BP1; UPA; VEGFC; or (b) an array comprising polynucleotides hybridizing to the following genes: CD44v3; CD44v6; DR5; GRO1; KRT17; and LAMC2, immobilized on a solid surface; or (c) an array comprising polynucleotides hybridizing to the following genes: CD44s; CD82; CGA; CTSL; EGFRd27; IGFBP3; p27; P53; RB1; TIMP2; YB-1; A-Catenin; AKT1; AKT2; APC; Bax; B-Catenin; BTC; CCNA2; CCNE1; CCNE2; CD105; CD44v3; CD44v6; CD68; CEACAM6; Chk2; cMet; COX2; cripto; DCR3; DIABLO; DPYD; DR5; EDN1 endothelin; EGFR; EIF4E; ERBB4; ERK1; fas; FRP1; GRO1; HB-EGF; HER2; IGF1R; IRS1; ITGA3; KRT17; LAMC2; MTA1; NMYC; PAI1; PDGFA; PGK1; PTPD1; RANBP2; SPRY2; TP53BP1; and VEGFC, immobilized on a solid surface, or (d) an array comprising polynucleotides hybridizing to the following genes: Bak; Bclx; BRAF; BRK; Cad17; CCND3; CCNE1; CCNE2; CD105; CD9; COX2; DIABLO; ErbB3; EREG; FRP1; GPC3; GUS; HER2; HGF; ID1; ITGB3; PTPD1; RPLPO; STK15; SURV; TERC; TGFBR2; TITF1; XIAP; CA9; CD134; CD44E; CD44v3; CD44v6; CDC25B; CGA; DR5; GRO1; KRT17; LAMC2; P14ARF; PDGFB; PLAUR; PPARG; RASSF1; RIZ1; Src; TFRC; and UPA, immobilized on a solid surface.
In a further aspect, the invention concerns a method in which RNA is isolated from a fixed, paraffin-embedded tissue specimen by a procedure comprising:
(a) incubating a section of the fixed, paraffin-embedded tissue specimen at a temperature of about 56° C. to 70° C. in a lysis buffer, in the presence of a protease, without prior dewaxing, to form a lysis solution;
(b) cooling the lysis solution to a temperature where the wax solidifies; and
(c) isolating the nucleic acid from the lysis solution.
In a different aspect, the invention concerns a kit comprising one or more of (1) extraction buffer/reagents and protocol; (2) reverse transcription buffer/reagents and protocol; and (3) qPCR buffer/reagents and protocol suitable for performing the gene expression analysis methods of the invention.
In a further aspect, the invention concerns a method for measuring levels of mRNA products of genes listed in Tables 5A and 5B by quantitative RT-PCR (qRT-PCR) reaction, by using an amplicon listed in Tables 5A and 5B and a corresponding primer-probe set listed in Tables 6A-6F.
FIG. 1 is a chart illustrating the overall workflow of the process of the invention for measurement of gene expression. In the Figure, FPET stands for âfixed paraffin-embedded tissue,â and âRT-PCRâ stands for âreverse transcriptase PCR.â RNA concentration is determined by using the commercial RiboGreen⢠RNA Quantitation Reagent and Protocol.
FIG. 2 is a flow chart showing the steps of an RNA extraction method according to the invention alongside a flow chart of a representative commercial method.
Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, N.Y. 1994), and March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 4th ed., John Wiley & Sons (New York, N.Y. 1992), provide one skilled in the art with a general guide to many of the terms used in the present application.
One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the methods and materials described. For purposes of the present invention, the following terms are defined below.
The term âmicro arrayâ refers to an ordered arrangement of hybridizable array elements, preferably polynucleotide probes, on a substrate.
The term âpolynucleotide,â when used in singular or plural, generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. Thus, for instance, polynucleotides as defined herein include, without limitation, single- and double-stranded DNA, DNA including single- and double-stranded regions, single- and double-stranded RNA, and RNA including single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or include single- and double-stranded regions. In addition, the term âpolynucleotideâ as used herein refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The strands in such regions may be from the same molecule or from different molecules. The regions may include all of one or more of the molecules, but more typically involve only a region of some of the molecules. One of the molecules of a triple-helical region often is an oligonucleotide. The term âpolynucleotideâ specifically includes cDNAs. The term includes DNAs (including cDNAs) and RNAs that contain one or more modified bases. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are âpolynucleotidesâ as that term is intended herein. Moreover, DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritiated bases, are included within the term âpolynucleotidesâ as defined herein. In general, the term âpolynucleotideâ embraces all chemically, enzymatically and/or metabolically modified forms of unmodified polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including simple and complex cells.
The term âoligonucleotideâ refers to a relatively short polynucleotide, including, without limitation, single-stranded deoxyribonucleotides, single- or double-stranded ribonucleotides, RNA:DNA hybrids and double-stranded DNAs. Oligonucleotides, such as single-stranded DNA probe oligonucleotides, are often synthesized by chemical methods, for example using automated oligonucleotide synthesizers that are commercially available. However, oligonucleotides can be made by a variety of other methods, including in vitro recombinant DNA-mediated techniques and by expression of DNAs in cells and organisms.
The terms âdifferentially expressed gene,â âdifferential gene expressionâ and their synonyms, which are used interchangeably, refer to a gene whose expression is activated to a higher or lower level in a subject suffering from a disease, specifically cancer, such as breast cancer, relative to its expression in a normal or control subject. The terms also include genes whose expression is activated to a higher or lower level at different stages of the same disease. It is also understood that a differentially expressed gene may be either activated or inhibited at the nucleic acid level or protein level, or may be subject to alternative splicing to result in a different polypeptide product. Such differences may be evidenced by a change in mRNA levels, surface expression, secretion or other partitioning of a polypeptide, for example. Differential gene expression may include a comparison of expression between two or more genes or their gene products, or a comparison of the ratios of the expression between two or more genes or their gene products, or even a comparison of two differently processed products of the same gene, which differ between normal subjects and subjects suffering from a disease, specifically cancer, or between various stages of the same disease. Differential expression includes both quantitative, as well as qualitative, differences in the temporal or cellular expression pattern in a gene or its expression products among, for example, normal and diseased cells, or among cells which have undergone different disease events or disease stages. For the purpose of this invention, âdifferential gene expressionâ is considered to be present when there is at least an about two-fold, preferably at least about four-fold, more preferably at least about six-fold, most preferably at least about ten-fold difference between the expression of a given gene in normal and diseased subjects, or in various stages of disease development in a diseased subject.
The term ânormalizedâ with regard to a gene transcript or a gene expression product refers to the level of the transcript or gene expression product relative to the mean levels of transcripts/products of a set of reference genes, wherein the reference genes are either selected based on their minimal variation across, patients, tissues or treatments (âhousekeeping genesâ), or the reference genes are the totality of tested genes. In the latter case, which is commonly referred to as âglobal normalizationâ, it is important that the total number of tested genes be relatively large, preferably greater than 50. Specifically, the term ânormalizedâ with respect to an RNA transcript refers to the transcript level relative to the mean of transcript levels of a set of reference genes. More specifically, the mean level of an RNA transcript as measured by TaqManÂŽ RT-PCR refers to the Ct value minus the mean Ct values of a set of reference gene transcripts.
The terms âexpression threshold,â and âdefined expression thresholdâ are used interchangeably and refer to the level of a gene or gene product in question above which the gene or gene product serves as a predictive marker for patient response or resistance to a drug, in the present case an EGFR inhibitor drug. The threshold is defined experimentally from clinical studies such as those described in examples 1 and 2, below. The expression threshold can be selected either for maximum sensitivity (for example, to detect all responders to a drug), or for maximum selectivity (for example to detect only responders to a drug), or for minimum error.
The phrase âgene amplificationâ refers to a process by which multiple copies of a gene or gene fragment are formed in a particular cell or cell line. The duplicated region (a stretch of amplified DNA) is often referred to as âamplicon.â Usually, the amount of the messenger RNA (mRNA) produced, i.e., the level of gene expression, also increases in the proportion of the number of copies made of the particular gene expressed.
The term âdiagnosisâ is used herein to refer to the identification of a molecular or pathological state, disease or condition, such as the identification of a molecular subtype of head and neck cancer, colon cancer, or other type of cancer. The term âprognosisâ is used herein to refer to the prediction of the likelihood of cancer-attributable death or progression, including recurrence, metastatic spread, and drug resistance, of a neoplastic disease, such as breast cancer, or head and neck cancer. The term âpredictionâ is used herein to refer to the likelihood that a patient will respond either favorably or unfavorably to a drug or set of drugs, and also the extent of those responses, or that a patient will survive, following surgical removal or the primary tumor and/or chemotherapy for a certain period of time without cancer recurrence. The predictive methods of the present invention can be used clinically to make treatment decisions by choosing the most appropriate treatment modalities for any particular patient. The predictive methods of the present invention are valuable tools in predicting if a patient is likely to respond favorably to a treatment regimen, such as surgical intervention, chemotherapy with a given drug or drug combination, and/or radiation therapy, or whether long-term survival of the patient, following surgery and/or termination of chemotherapy or other treatment modalities is likely.
The term âlong-termâ survival is used herein to refer to survival for at least 5 years, more preferably for at least 8 years, most preferably for at least 10 years following surgery or other treatment.
The term âincreased resistanceâ to a particular drug or treatment option, when used in accordance with the present invention, means decreased response to a standard dose of the drug or to a standard treatment protocol.
The term âdecreased sensitivityâ to a particular drug or treatment option, when used in accordance with the present invention, means decreased response to a standard dose of the drug or to a standard treatment protocol, where decreased response can be compensated for (at least partially) by increasing the dose of drug, or the intensity of treatment.
âPatient responseâ can be assessed using any endpoint indicating a benefit to the patient, including, without limitation, (1) inhibition, to some extent, of tumor growth, including slowing down and complete growth arrest; (2) reduction in the number of tumor cells; (3) reduction in tumor size; (4) inhibition (i.e., reduction, slowing down or complete stopping) of tumor cell infiltration into adjacent peripheral organs and/or tissues; (5) inhibition (i.e. reduction, slowing down or complete stopping) of metastasis; (6) enhancement of anti-tumor immune response, which may, but does not have to, result in the regression or rejection of the tumor; (7) relief, to some extent, of one or more symptoms associated with the tumor; (8) increase in the length of survival following treatment; and/or (9) decreased mortality at a given point of time following treatment.
The term âtreatmentâ refers to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) the targeted pathologic condition or disorder. Those in need of treatment include those already with the disorder as well as those prone to have the disorder or those in whom the disorder is to be prevented. In tumor (e.g., cancer) treatment, a therapeutic agent may directly decrease the pathology of tumor cells, or render the tumor cells more susceptible to treatment by other therapeutic agents, e.g., radiation and/or chemotherapy.
The term âtumor,â as used herein, refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues.
The terms âcancerâ and âcancerousâ refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include but are not limited to, breast cancer, colon cancer, lung cancer, prostate cancer, hepatocellular cancer, gastric cancer, pancreatic cancer, cervical cancer, ovarian cancer, liver cancer, bladder cancer, cancer of the urinary tract, thyroid cancer, renal cancer, carcinoma, melanoma, head and neck cancer, and brain cancer.
The âpathologyâ of cancer includes all phenomena that compromise the well-being of the patient. This includes, without limitation, abnormal or uncontrollable cell growth, metastasis, interference with the normal functioning of neighboring cells, release of cytokines or other secretory products at abnormal levels, suppression or aggravation of inflammatory or immunological response, neoplasia, premalignancy, malignancy, invasion of surrounding or distant tissues or organs, such as lymph nodes, etc.
The term âEGFR inhibitorâ as used herein refers to a molecule having the ability to inhibit a biological function of a native epidermal growth factor receptor (EGFR). Accordingly, the term âinhibitorâ is defined in the context of the biological role of EGFR. While preferred inhibitors herein specifically interact with (e.g. bind to) an EGFR, molecules that inhibit an EGFR biological activity by interacting with other members of the EGFR signal transduction pathway are also specifically included within this definition. A preferred EGFR biological activity inhibited by an EGFR inhibitor is associated with the development, growth, or spread of a tumor.
The term âhousekeeping geneâ refers to a group of genes that codes for proteins whose activities are essential for the maintenance of cell function. These genes are typically similarly expressed in all cell types. Housekeeping genes include, without limitation, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), Cyp1, albumin, actins, e.g. β-actin, tubulins, cyclophilin, hypoxantine phsophoribosyltransferase (HRPT), L32. 28S, and 18S.
The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, and biochemistry, which are within the skill of the art. Such techniques are explained fully in the literature, such as, âMolecular Cloning: A Laboratory Manualâ, 2nd edition (Sambrook et al., 1989); âOligonucleotide Synthesisâ (M. J. Gait, ed., 1984); âAnimal Cell Cultureâ (R. I. Freshney, ed., 1987); âMethods in Enzymologyâ (Academic Press, Inc.); âHandbook of Experimental Immunologyâ, 4th edition (D. M. Weir & C. C. Blackwell, eds., Blackwell Science Inc., 1987); âGene Transfer Vectors for Mammalian Cellsâ (J. M. Miller & M. P. Calos, eds., 1987); âCurrent Protocols in Molecular Biologyâ (F. M. Ausubel et al., eds., 1987); and âPCR: The Polymerase Chain Reactionâ, (Mullis et al., eds., 1994).
1. Gene Expression Profiling
In general, methods of gene expression profiling can be divided into two large groups: methods based on hybridization analysis of polynucleotides, and methods based on sequencing of polynucleotides. The most commonly used methods known in the art for the quantification of mRNA expression in a sample include northern blotting and in situ hybridization (Parker & Barnes, Methods in Molecular Biology 106:247-283 (1999)); RNAse protection assays (Hod, Biotechniques 13:852-854 (1992)); and reverse transcription polymerase chain reaction (RT-PCR) (Weis et al., Trends in Genetics 8:263-264 (1992)). Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. Representative methods for sequencing-based gene expression analysis include Serial Analysis of Gene Expression (SAGE), and gene expression analysis by massively parallel signature sequencing (MPSS).
2. Reverse Transcriptase PCR (RT-PCR)
Of the techniques listed above, the most sensitive and most flexible quantitative method is RT-PCR, which can be used to compare mRNA levels in different sample populations, in normal and tumor tissues, with or without drug treatment, to characterize patterns of gene expression, to discriminate between closely related mRNAs, and to analyze RNA structure.
The first step is the isolation of mRNA from a target sample. The starting material is typically total RNA isolated from human tumors or tumor cell lines, and corresponding normal tissues or cell lines, respectively. Thus RNA can be isolated from a variety of primary tumors, including breast, lung, colon, prostate, brain, liver, kidney, pancreas, spleen, thymus, testis, ovary, uterus, head and neck, etc., tumor, or tumor cell lines, with pooled DNA from healthy donors. If the source of mRNA is a primary tumor, mRNA can be extracted, for example, from frozen or archived paraffin-embedded and fixed (e.g. formalin-fixed) tissue samples.
General methods for mRNA extraction are well known in the art and are disclosed in standard textbooks of molecular biology, including Ausubel et al., Current Protocols of Molecular Biology, John Wiley and Sons (1997). Methods for RNA extraction from paraffin embedded tissues are disclosed, for example, in Rupp and Locker, Lab Invest. 56:A67 (1987), and De Andres et al., BioTechniques 18:42044 (1995). In particular, RNA isolation can be performed using purification kit, buffer set and protease from commercial manufacturers, such as Qiagen, according to the manufacturer's instructions. For example, total RNA from cells in culture can be isolated using Qiagen RNeasy mini-columns. Other commercially available RNA isolation kits include MasterPure⢠Complete DNA and RNA Purification Kit (EPICENTREŽ, Madison, Wis.); and Paraffin Block RNA Isolation Kit (Ambion, Inc.). Total RNA from tissue samples can be isolated using RNA Stat-60 (Tel-Test). RNA prepared from tumor can be isolated, for example, by cesium chloride density gradient centrifugation.
As RNA cannot serve as a template for PCR, the first step in gene expression profiling by RT-PCR is the reverse transcription of the RNA template into cDNA, followed by its exponential amplification in a PCR reaction. The two most commonly used reverse transcriptases are avilo myeloblastosis virus reverse transcriptase (AMV-RT) and Moloney murine leukemia virus reverse transcriptase (MMLV-RT). The reverse transcription step is typically primed using specific primers, random hexamers, or oligo-dT primers, depending on the circumstances and the goal of expression profiling. For example, extracted RNA can be reverse-transcribed using a GeneAmp RNA PCR kit (Perkin Elmer, Calif., USA), following the manufacturer's instructions. The derived cDNA can then be used as a template in the subsequent PCR reaction.
Although the PCR step can use a variety of thermostable DNA-dependent DNA polymerases, it typically employs the Taq DNA polymerase, which has a 5â˛-3Ⲡnuclease activity but lacks a 3â˛-5Ⲡproofreading endonuclease activity. Thus, TaqManÂŽ PCR typically utilizes the 5â˛-nuclease activity of Taq or Tth polymerase to hydrolyze a hybridization probe bound to its target amplicon, but any enzyme with equivalent 5Ⲡnuclease activity can be used. Two oligonucleotide primers are used to generate an amplicon typical of a PCR reaction. A third oligonucleotide, or probe, is designed to detect nucleotide sequence located between the two PCR primers. The probe is non-extendible by Taq DNA polymerase enzyme, and is labeled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe. During the amplification reaction, the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner. The resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fluorophore. One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data.
TaqManÂŽ RT-PCR can be performed using commercially available equipment, such as, for example, ABI PRISM 7700⢠Sequence Detection System⢠(Perkin-Elmer-Applied Biosystems, Foster City, Calif., USA), or Lightcycler (Roche Molecular Biochemicals, Mannheim, Germany). In a preferred embodiment, the 5Ⲡnuclease procedure is run on a real-time quantitative PCR device such as the ABI PRISM 7700⢠Sequence Detection Systemâ˘. The system consists of a thermocycler, laser, charge-coupled device (CCD), camera and computer. The system amplifies samples in a 96-well format on a thermocycler. During amplification, laser-induced fluorescent signal is collected in real-time through fiber optics cables for all 96 wells, and detected at the CCD. The system includes software for running the instrument and for analyzing the data.
5â˛-Nuclease assay data are initially expressed as Ct, or the threshold cycle. As discussed above, fluorescence values are recorded during every cycle and represent the amount of product amplified to that point in the amplification reaction. The point when the fluorescent signal is first recorded as statistically significant is the threshold cycle (Ct).
To minimize errors and the effect of sample-to-sample variation, RT-PCR is usually performed using an internal standard. The ideal internal standard is expressed at a constant level among different tissues, and is unaffected by the experimental treatment. RNAs most frequently used to normalize patterns of gene expression are mRNAs for the housekeeping genes glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) and 13-actin.
A more recent variation of the RT-PCR technique is the real time quantitative PCR, which measures PCR product accumulation through a dual-labeled fluorigenic probe (i.e., TaqManÂŽ probe). Real time PCR is compatible both with quantitative competitive PCR, where internal competitor for each target sequence is used for normalization, and with quantitative comparative PCR using a normalization gene contained within the sample, or a housekeeping gene for RT-PCR. For further details see, e.g. Held et al., Genome Research 6:986-994 (1996).
According to one aspect of the present invention, PCR primers and probes are designed based upon intron sequences present in the gene to be amplified. In this embodiment, the first step in the primer/probe design is the delineation of intron sequences within the genes. This can be done by publicly available software, such as the DNA BLAT software developed by Kent, W. J., Genome Res. 12(4):656-64 (2002), or by the BLAST software including its variations. Subsequent steps follow well established methods of PCR primer and probe design.
In order to avoid non-specific signals, it is important to mask repetitive sequences within the introns when designing the primers and probes. This can be easily accomplished by using the Repeat Masker program available on-line through the Baylor College of Medicine, which screens DNA sequences against a library of repetitive elements and returns a query sequence in which the repetitive elements are masked. The masked intron sequences can then be used to design primer and probe sequences using any commercially or otherwise publicly available primer/probe design packages, such as Primer Express (Applied Biosystems); MGB assay-by-design (Applied Biosystems); Primer3 (Steve Rozen and Helen J. Skaletsky (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, N.J., pp 365-386)
The most important factors considered in PCR primer design include primer length, melting temperature (Tm), and G/C content, specificity, complementary primer sequences, and 3â˛-end sequence. In general, optimal PCR primers are generally 17-30 bases in length, and contain about 20-80%, such as, for example, about 50-60% G+C bases. Tm's between 50 and 80° C., e.g. about 50 to 70° C. are typically preferred.
For further guidelines for PCR primer and probe design see, e.g. Dieffenbach, C. W. et al., âGeneral Concepts for PCR Primer Designâ in: PCR Primer, A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1995, pp. 133-155; Innis and Gelfand, âOptimization of PCRsâ in: PCR Protocols, A Guide to Methods and Applications, CRC Press, London, 1994, pp. 5-11; and Plasterer, T. N. Primerselect: Primer and probe design. Methods Mol. Biol. 70:520-527 (1997), the entire disclosures of which are hereby expressly incorporated by reference.
3. Microarrays
Differential gene expression can also be identified, or confirmed using the microarray technique. Thus, the expression profile of breast cancer-associated genes can be measured in either fresh or paraffin-embedded tumor tissue, using microarray technology. In this method, polynucleotide sequences of interest (including cDNAs and oligonucleotides) are plated, or arrayed, on a microchip substrate. The arrayed sequences are then hybridized with specific DNA probes from cells or tissues of interest. Just as in the RT-PCR method, the source of mRNA typically is total RNA isolated from human tumors or tumor cell lines, and corresponding normal tissues or cell lines. Thus RNA can be isolated from a variety of primary tumors or tumor cell lines. If the source of mRNA is a primary tumor, mRNA can be extracted, for example, from frozen or archived paraffin-embedded and fixed (e.g. formalin-fixed) tissue samples, which are routinely prepared and preserved in everyday clinical practice.
In a specific embodiment of the microarray technique, PCR amplified inserts of cDNA clones are applied to a substrate in a dense array. Preferably at least 10,000 nucleotide sequences are applied to the substrate. The microarrayed genes, immobilized on the microchip at 10,000 elements each, are suitable for hybridization under stringent conditions. Fluorescently labeled cDNA probes may be generated through incorporation of fluorescent nucleotides by reverse transcription of RNA extracted from tissues of interest. Labeled cDNA probes applied to the chip hybridize with specificity to each spot of DNA on the array. After stringent washing to remove non-specifically bound probes, the chip is scanned by confocal laser microscopy or by another detection method, such as a CCD camera. Quantitation of hybridization of each arrayed element allows for assessment of corresponding mRNA abundance. With dual color fluorescence, separately labeled cDNA probes generated from two sources of RNA are hybridized pairwise to the array. The relative abundance of the transcripts from the two sources corresponding to each specified gene is thus determined simultaneously. The miniaturized scale of the hybridization affords a convenient and rapid evaluation of the expression pattern for large numbers of genes. Such methods have been shown to have the sensitivity required to detect rare transcripts, which are expressed at a few copies per cell, and to reproducibly detect at least approximately two-fold differences in the expression levels (Schena et al., Proc. Natl. Acad. Sci. USA 93(2):106-149 (1996)). Microarray analysis can be performed by commercially available equipment, following manufacturer's protocols, such as by using the Affymetrix GenChip technology, or Incyte's microarray technology.
The development of microarray methods for large-scale analysis of gene expression makes it possible to search systematically for molecular markers of cancer classification and outcome prediction in a variety of tumor types.
4. Serial Analysis of Gene Expression (SAGE)
Serial analysis of gene expression (SAGE) is a method that allows the simultaneous and quantitative analysis of a large number of gene transcripts, without the need of providing an individual hybridization probe for each transcript. First, a short sequence tag (about 10-14 bp) is generated that contains sufficient information to uniquely identify a transcript, provided that the tag is obtained from a unique position within each transcript. Then, many transcripts are linked together to form long serial molecules, that can be sequenced, revealing the identity of the multiple tags simultaneously. The expression pattern of any population of transcripts can be quantitatively evaluated by determining the abundance of individual tags, and identifying the gene corresponding to each tag. For more details see, e.g. Velculescu et al., Science 270:484-487 (1995); and Velculescu et al., Cell 88:243-51 (1997).
5. MassARRAY Technology
The MassARRAY (Sequenom, San Diego, Calif.) technology is an automated, high-throughput method of gene expression analysis using mass spectrometry (MS) for detection. According to this method, following the isolation of RNA, reverse transcription and PCR amplification, the cDNAs are subjected to primer extension. The cDNA-derived primer extension products are purified, and dipensed on a chip array that is pre-loaded with the components needed for MALTI-TOF MS sample preparation. The various cDNAs present in the reaction are quantitated by analyzing the peak areas in the mass spectrum obtained.
6. Gene Expression Analysis by Massively Parallel Signature Sequencing (MPSS
This method, described by Brenner et al. Nature Biotechnology 18:630-634 (2000), is a sequencing approach that combines non-gel-based signature sequencing with in vitro cloning of millions of templates on separate 5 Îźm diameter microbeads. First, a microbead library of DNA templates is constructed by in vitro cloning. This is followed by the assembly of a planar array of the template-containing microbeads in a flow cell at a high density (typically greater than 3Ă106 microbeads/cm2). The free ends of the cloned templates on each microbead are analyzed simultaneously, using a fluorescence-based signature sequencing method that does not require DNA fragment separation. This method has been shown to simultaneously and accurately provide, in a single operation, hundreds of thousands of gene signature sequences from a yeast cDNA library.
7. Immunohistochemistry
Immunohistochemistry methods are also suitable for detecting the expression levels of the prognostic markers of the present invention. Thus, antibodies or antisera, preferably polyclonal antisera, and most preferably monoclonal antibodies specific for each marker are used to detect expression. The antibodies can be detected by direct labeling of the antibodies themselves, for example, with radioactive labels, fluorescent labels, hapten labels such as, biotin, or an enzyme such as horse radish peroxidase or alkaline phosphatase. Alternatively, unlabeled primary antibody is used in conjunction with a labeled secondary antibody, comprising antisera, polyclonal antisera or a monoclonal antibody specific for the primary antibody. Immunohistochemistry protocols and kits are well known in the art and are commercially available.
8. Proteomics
The term âproteomeâ is defined as the totality of the proteins present in a sample (e.g. tissue, organism, or cell culture) at a certain point of time. Proteomics includes, among other things, study of the global changes of protein expression in a sample (also referred to as âexpression proteomicsâ). Proteomics typically includes the following steps: (1) separation of individual proteins in a sample by 2-D gel electrophoresis (2-D PAGE); (2) identification of the individual proteins recovered from the gel, e.g. my mass spectrometry or N-terminal sequencing, and (3) analysis of the data using bioinformatics. Proteomics methods are valuable supplements to other methods of gene expression profiling, and can be used, alone or in combination with other methods, to detect the products of the prognostic markers of the present invention.
9. Improved Method for Isolation of Nucleic Acid from Archived Tissue Specimens
In the first step of the method of the invention, total RNA is extracted from the source material of interest, including fixed, paraffin-embedded tissue specimens, and purified sufficiently to act as a substrate in an enzyme assay. While extration of total RNA can be performed by any method known in the art, in a particular embodiment, the invention relies on an improved method for the isolation of nucleic acid from archived, e.g. fixed, paraffin-embedded tissue specimens (FPET).
Measured levels of mRNA species are useful for defining the physiological or pathological status of cells and tissues. RT-PCR (which is discussed above) is one of the most sensitive, reproducible and quantitative methods for this âgene expression profilingâ. Paraffin-embedded, formalin-fixed tissue is the most widely available material for such studies. Several laboratories have demonstrated that it is possible to successfully use fixed-paraffin-embedded tissue (FPET) as a source of RNA for RT-PCR (Stanta et al., Biotechniques 11:304-308 (1991); Stanta et al., Methods Mol. Biol. 86:23-26 (1998); Jackson et al., Lancet 1:1391 (1989); Jackson et al., J. Clin. Pathol. 43:499-504 (1999); Finke et al., Biotechniques 14:448-453 (1993); Goldsworthy et al., Mol. Carcinog. 25:86-91 (1999); Stanta and Bonin, Biotechniques 24:271-276 (1998); Godfrey et al., J. Mol. Diagnostics 2:84 (2000); Specht et al. J. Mol. Med. 78:B27 (2000); Specht et al., Am. J. Pathol. 158:419-429 (2001)). This allows gene expression profiling to be carried out on the most commonly available source of human biopsy specimens, and therefore potentially to create new valuable diagnostic and therapeutic information.
The most widely used protocols utilize hazardous organic solvents, such as xylene, or octane (Finke et al., supra) to dewax the tissue in the paraffin blocks before nucleic acid (RNA and/or DNA) extraction. Obligatory organic solvent removal (e.g. with ethanol) and rehydration steps follow, which necessitate multiple manipulations, and addition of substantial total time to the protocol, which can take up to several days. Commercial kits and protocols for RNA extraction from FPET [MasterPure⢠Complete DNA and RNA Purification Kit (EPICENTREŽ, Madison, Wis.); Paraffin Block RNA Isolation Kit (Ambion, Inc.) and RNeasy⢠Mini kit (Qiagen, Chatsworth, Calif.)] use xylene for deparaffinization, in procedures which typically require multiple centrifugations and ethanol buffer changes, and incubations following incubation with xylene.
The method that can be used in the present invention provides an improved nucleic acid extraction protocol that produces nucleic acid, in particular RNA, sufficiently intact for gene expression measurements. The key step in this improved nucleic acid extraction protocol is the performance of dewaxing without the use of any organic solvent, thereby eliminating the need for multiple manipulations associated with the removal of the organic solvent, and substantially reducing the total time to the protocol. According to the improved method, wax, e.g. paraffin is removed from wax-embedded tissue samples by incubation at 65-75° C. in a lysis buffer that solubilizes the tissue and hydrolyzes the protein, following by cooling to solidify the wax.
FIG. 2 shows a flow chart of the improved RNA extraction protocol used herein in comparison with a representative commercial method, using xylene to remove wax. The times required for individual steps in the processes and for the overall processes are shown in the chart. As shown, the commercial process requires approximately 50% more time than the improved process used in performing the methods of the invention.
The lysis buffer can be any buffer known for cell lysis. It is, however, preferred that oligo-dT-based methods of selectively purifying polyadenylated mRNA not be used to isolate RNA for the present invention, since the bulk of the mRNA molecules are expected to be fragmented and therefore will not have an intact polyadenylated tail, and will not be recovered or available for subsequent analytical assays. Otherwise, any number of standard nucleic acid purification schemes can be used. These include chaotrope and organic solvent extractions, extraction using glass beads or filters, salting out and precipitation based methods, or any of the purification methods known in the art to recover total RNA or total nucleic acids from a biological source.
Lysis buffers are commercially available, such as, for example, from Qiagen, EpiCentre, or Ambion. A preferred group of lysis buffers typically contains urea, and Proteinase K or other protease. Proteinase K is very useful in the isolation of high quality, undamaged DNA or RNA, since most mammalian DNases and RNases are rapidly inactivated by this enzyme, especially in the presence of 0.5-1% sodium dodecyl sulfate (SDS). This is particularly important in the case of RNA, which is more susceptible to degradation than DNA. While DNases require metal ions for activity, and can therefore be easily inactivated by chelating agents, such as EDTA, there is no similar co-factor requirement for RNases.
Cooling and resultant solidification of the wax permits easy separation of the wax from the total nucleic acid, which can be conveniently precipitated, e.g. by isopropanol. Further processing depends on the intended purpose. If the proposed method of RNA analysis is subject to bias by contaminating DNA in an extract, the RNA extract can be further treated, e.g. by DNase, post purification to specifically remove DNA while preserving RNA. For example, if the goal is to isolate high quality RNA for subsequent RT-PCR amplification, nucleic acid precipitation is followed by the removal of DNA, usually by DNase treatment. However, DNA can be removed at various stages of nucleic acid isolation, by DNase or other techniques well known in the art.
While the advantages of the improved nucleic acid extraction discussed above are most apparent for the isolation of RNA from archived, paraffin embedded tissue samples, the wax removal step of the present invention, which does not involve the use of an organic solvent, can also be included in any conventional protocol for the extraction of total nucleic acid (RNA and DNA) or DNA only.
By using heat followed by cooling to remove paraffin, the improved process saves valuable processing time, and eliminates a series of manipulations, thereby potentially increasing the yield of nucleic acid.
10. 5â˛-multiplexed Gene Specific Priming of Reverse Transcription
RT-PCR requires reverse transcription of the test RNA population as a first step. The most commonly used primer for reverse transcription is oligo-dT, which works well when RNA is intact. However, this primer will not be effective when RNA is highly fragmented as is the case in FPE tissues.
The present invention includes the use of gene specific primers, which are roughly 20 bases in length with a Tm optimum between about 58° C. and 60° C. These primers will also serve as the reverse primers that drive PCR DNA amplification.
An alternative approach is based on the use of random hexamers as primers for cDNA synthesis. However, we have experimentally demonstrated that the method of using a multiplicity of gene-specific primers is superior over the known approach using random hexamers.
11. Normalization Strategy
An important aspect of the present invention is to use the measured expression of certain genes by EGFR-expressing cancer tissue to provide information about the patient's likely response to treatment with an EGFR-inhibitor. For this purpose it is necessary to correct for (normalize away) both differences in the amount of RNA assayed and variability in the quality of the RNA used. Therefore, the assay typically measures and incorporates the expression of certain normalizing genes, including well known housekeeping genes, such as GAPDH and Cyp1. Alternatively or in addition, normalization can be based on the mean or median signal (Ct in the case of RT-PCR) of all of the assayed genes or a large subset thereof (global normalization approach). On a gene-by-gene basis, measured normalized amount of a patient tumor mRNA is compared to the amount found in a reference set of cancer tissue of the same type (e.g. head and neck cancer, colon cancer, etc.). The number (N) of cancer tissues in this reference set should be sufficiently high to ensure that different reference sets (as a whole) behave essentially the same way. If this condition is met, the identity of the individual cancer tissues present in a particular set will have no significant impact on the relative amounts of the genes assayed. Usually, the cancer tissue reference set consists of at least about 30, preferably at least about 40 different FPE cancer tissue specimens. Unless noted otherwise, normalized expression levels for each mRNA/tested tumor/patient will be expressed as a percentage of the expression level measured in the reference set. More specifically, the reference set of a sufficiently high number (e.g. 40) of tumors yields a distribution of normalized levels of each mRNA species. The level measured in a particular tumor sample to be analyzed falls at some percentile within this range, which can be determined by methods well known in the art. Below, unless noted otherwise, reference to expression levels of a gene assume normalized expression relative to the reference set although this is not always explicitly stated.
12. EGFR Inhibitors
The epidermal growth factor receptor (EGFR) family (which includes EGFR, erb-B2, erb-B3, and erb-B4) is a family of growth factor receptors that are frequently activated in epithelial malignancies. Thus, the epidermal growth factor receptor (EGFR) is known to be active in several tumor types, including, for example, ovarian cancer, pancreatic cancer, non-small cell lung cancer, breast cancer, colon cancer and head and neck cancer. Several EGFR inhibitors, such as ZD1839 (also known as gefitinib or Iressa); and OSI774 (Erlotinib, Tarcevaâ˘), are promising drug candidates for the treatment of EGFR-expressing cancer.
Iressa, a small synthetic quinazoline, competitively inhibits the ATP binding site of EGFR, a growth-promoting receptor tyrosine kinase, and has been in Phase III clinical trials for the treatment of non-small-cell lung carcinoma. Another EGFR inhibitor, [agr]cyano-[bgr]methyl-N-[(trifluoromethoxy)phenyl]-propenamide (LFM-A12), has been shown to inhibit the proliferation and invasiveness of EGFR positive human breast cancer cells.
Cetuximab is a monoclonal antibody that blocks the EGFR and EGFR-dependent cell growth. It is currently being tested in phase III clinical trials.
Tarceva⢠has shown promising indications of anti-cancer activity in patients with advanced ovarian cancer, and non-small cell lung and head and neck carcinomas.
The present invention provides valuable tools to predict whether an EGFR-positive tumor is likely to respond to treatment with an EGFR-inhibitor.
Recent publications further confirm the involvement of EGFR in gastrointestinal (e.g. colon) cancer, and associate its expression with poor survival. See, e.g. Khorana et al., Proc. Am. Soc. Clin. Oncol 22:317 (2003).
While the listed examples of EGFR inhibitors a small organic molecules, the findings of the present invention are equally applicable to other EGFR inhibitors, including, without limitation, anti-EGFR antibodies, antisense molecules, small peptides, etc.
Further details of the invention will be apparent from the following non-limiting Examples.
A gene expression study was designed and conducted with the primary goal to molecularly characterize gene expression in paraffin-embedded, fixed tissue samples of head and neck cancer patients who responded or did not respond to treatment with an EGFR inhibitor. The results are based on the use of five different EGFR inhibitor drugs.
Study Design
Molecular assays were performed on paraffin-embedded, formalin-fixed head and neck tumor tissues obtained from 14 individual patients diagnosed with head and neck cancer. Patients were included in the study only if histopathologic assessment, performed as described in the Materials and Methods section, indicated adequate amounts of tumor tissue.
Each representative tumor block was characterized by standard histopathology for diagnosis, semi-quantitative assessment of amount of tumor, and tumor grade. A total of 6 sections (10 microns in thickness each) were prepared and placed in two Costar Brand Microcentrifuge Tubes (Polypropylene, 1.7 mL tubes, clear; 3 sections in each tube). If the tumor constituted less than 30% of the total specimen area, the sample may have been crudely dissected by the pathologist, using gross microdissection, putting the tumor tissue directly into the Costar tube.
If more than one tumor block was obtained as part of the surgical procedure, all tumor blocks were subjected to the same characterization, as described above, and the block most representative of the pathology was used for analysis.
mRNA was extracted and purified from fixed, paraffin-embedded tissue samples, and prepared for gene expression analysis as described above.
Molecular assays of quantitative gene expression were performed by RT-PCR, using the ABI PRISM 7900⢠Sequence Detection System⢠(Perkin-Elmer-Applied Biosystems, Foster City, Calif., USA). ABI PRISM 7900⢠consists of a thermocycler, laser, charge-coupled device (CCD), camera and computer. The system amplifies samples in a 384-well format on a thermocycler. During amplification, laser-induced fluorescent signal is collected in real-time through fiber optics cables for all 384 wells, and detected at the CCD. The system includes software for running the instrument and for analyzing the data.
Tumor tissue was analyzed for 185 cancer-related genes and 7 reference genes. The threshold cycle (CT) values for each patient were normalized based on the mean of all genes for that particular patient. Clinical outcome data were available for all patients.
Outcomes were classified as either response or no response. The results were analyzed in two different ways using two different criteria for response: partial response, or clinical benefit. The latter criterion combines partial or complete response with stable disease (minimum 3 months). In this study, there were no complete responses, four cases of partial response and two cases of disease stabilization.
We evaluated the relationship between gene expression and partial response by logistic regression and have identified the following genes as significant (p<0.15), as indicated in the attached Table 1. The logistic model provides a means of predicting the probability (Pr) of a subject as being either a partial responder or not. The following equation defined the expression threshold for response.
Pr î˘ ( Response ) = 1 1 + ď Intercept + SlopexReferenceNormalizedCT and Pr î˘ ( No î˘ î˘ Response ) = 1 - Pr î˘ ( Response )
In Table 1, the term ânegativeâ indicates that greater expression of the gene decreased likelihood of response to treatment with EGFR inhibitor, and âpositiveâ indicates that increased expression of the gene increased likelihood of response to EGFR inhibitor. Results from analysis of head and neck cancer patient data using clinical benefit criteria are shown in Table 2.
Overall increased expression of the following genes correlated with resistance of head and neck cancer to EGFR inhibitor treatment: A-Catenin; AKT1; AKT2; APC; Bax; B-Catenin; BTC; CCNA2; CCNE1; CCNE2; CD105; CD44v3; CD44v6; CD68; CEACAM6; Chk2; cMet; COX2; cripto; DCR3; DIABLO; DPYD; DR5; EDN1 endothelin; EGFR; ELF4E; ERBB4; ERK1; fas; FRP1; GRO1; HB-EGF; HER2; IGF1R; IRS1; ITGA3; KRT17; LAMC2; MTA1; NMYC; PAI1; PDGFA; PGK1; PTPD1; RANBP2; SPRY2; TP53BP1; and VEGFC; and increased expression of the following genes correlated with response of head and neck cancer to EGFR inhibitor treatment: CD44s; CD82; CGA; CTSL; EGFRd27; IGFBP3; p27; P53; RB1; TIMP2; and YB-1.
In a study analogous to the study of head and neck cancer patients described in Example 1, gene expression markers were sought that correlate with increased or decreased likelihood of colon cancer response to EGFR inhibitors. Sample preparation and handling and gene expression and data analysis were performed as in Example 1.
Twenty-three colon adenocarcinoma patients in all were studied, using a 192 gene assay. 188 of the 192 genes were expressed above the limit of detection. Both pathological and clinical responses were evaluated. Following treatment with EGFR inhibitor, three patients were determined to have had a partial response, five to have stable disease and fifteen to have progressive disease.
Table 3 shows the results obtained using the partial response criterion.
Results from analysis of colon cancer patient data using clinical benefit criteria are shown in Table 4.
Overall, increased expression of the following genes correlated with resistance of colon cancer to EGFR inhibitor treatment: CA9; CD134; CD44E; CD44v3; CD44v6; CDC25B; CGA; DR5; GRO1; KRT17; LAMC2; P14ARF; PDGFB; PLAUR; PPARG; RASSF1; RIZ1; Src; TFRC; and UPA, and increased expression of the following genes correlated with sensitivity of colon cancer to EGFR inhibitor treatment: CD44s; CD82; CGA; CTSL; EGFRd27; IGFBP3; p27; P53; RB1; TIMP2; and YB-1.
Finally, it is noteworthy that increased expression of the following genes correlated with resistance to EGFR inhibitor treatment in both head and neck and colon cancer: CD44v3; CD44v6; DR5; GRO1; KRT17; LAMC2.
In similar experiments, the elevated expression of LAMC2, B-Catenin, Bax, GRO1, Fas, or ITGA3 in EGFR-positive head and neck cancer was determined to be an indication that the patient is not likely to respond well to treatment with an EGFR inhibitor. On the other hand, elevated expression of YB-1, PTEN, CTSL, P53, STAT3, ITGB3, IGFBP3, RPLPO or p27 in EGFR-positive head and neck cancer was found to be an indication that the patient is likely to respond to EGFR inhibitor treatment.
In another set of similar experiments, elevated expression of the following genes in EGFR-expressing colon cancer correlated with positive response to treatment: BAK; BCL2; BRAF; BRK; CCND3; CD9; ER2; ERBB4; EREG; ERK1; FRP1. Elevated expression of the following genes in EGFR-expressing colon cancer correlated with resistance to treatment: APN; CA9; CCND1; CDC25B; CD134; LAMC2; PDGFB; CD44v6; CYP1; DR5; GAPDH; IGFBP2; PLAUR; RASSF1; UPA.
All references cited throughout the specification are hereby expressly incorporated by reference.
Although the present invention is illustrated with reference to certain embodiments, it is not so limited. Modifications and variations are possible without diverting from the spirit of the invention. All such modifications and variations, which will be apparent to those skilled in the art, are specifically within the scope of the present invention. While the specific examples disclosed herein concern head and neck cancer and colon cancer, the methods of the present invention are generally applicable and can be extended to all EGFR-expressing cancers, and such general methods are specifically intended to be within the scope herein.
| TABLE 1 |
| Partial Response Genes for Head and Neck Study |
| Logistic Discriminat | Likelihood | |||
| Gene | Function | Ratio Test |
| Name | Response | Intercept | Slope | R2 | P Value |
| cMet | Negative | 26.5168713 | 4.57143179 | 0.6662 | 0.0011 |
| LAMC2 | Negative | 5.29706425 | 1.28137295 | 0.6155 | 0.0017 |
| ITGA3 | Negative | 22.6008544 | 3.17707499 | 0.5063 | 0.0044 |
| CD44v6 | Negative | 6.92255059 | 4.3069909 | 0.492 | 0.005 |
| B-Catenin | Negative | 7.85913706 | 2.52965454 | 0.4805 | 0.0055 |
| PDGFA | Negative | 6.0016358 | 1.10386463 | 0.4318 | 0.0085 |
| GRO1 | Negative | 8.37646635 | 1.74815793 | 0.4146 | 0.0099 |
| ERK1 | Negative | 6.14712633 | 1.64819007 | 0.4024 | 0.0111 |
| CD44v3 | Negative | 5.95094528 | 3.36594473 | 0.3451 | 0.0186 |
| Bax | Negative | 5.34006632 | 1.19383253 | 0.3361 | 0.0202 |
| CGA | Positive | â78.121148 | â10.503757 | 0.3266 | 0.0221 |
| fas | Negative | 7.27491015 | 1.38464586 | 0.3251 | 0.0224 |
| IGFBP3 | Positive | â2.1529531 | â2.7937517 | 0.3097 | 0.0258 |
| MTA1 | Negative | 6.07167277 | 1.23786874 | 0.3072 | 0.0264 |
| YB-1 | Positive | 1.73598983 | â4.0859174 | 0.2814 | 0.0336 |
| DR5 | Negative | 9.0550349 | 1.46349944 | 0.2703 | 0.0373 |
| APC | Negative | 5.775003 | 1.88324269 | 0.2512 | 0.0447 |
| ERBB4 | Negative | 11.9466285 | 1.58606697 | 0.2357 | 0.0518 |
| CD68 | Negative | 3.60605487 | 1.0645631 | 0.2319 | 0.0537 |
| cripto | Negative | 19.5004373 | 2.64909385 | 0.2251 | 0.0574 |
| P53 | Positive | â4.1976158 | â1.5541169 | 0.2208 | 0.0598 |
| VEGFC | Negative | 6.33634489 | 0.90613473 | 0.2208 | 0.0598 |
| A-Catenin | Negative | 4.41215235 | 1.7591194 | 0.2199 | 0.0603 |
| COX2 | Negative | 8.00968996 | 1.27597736 | 0.202 | 0.0718 |
| CD82 | Positive | â1.8999985 | â1.171157 | 0.1946 | 0.0772 |
| PAI1 | Negative | 2.94777884 | 0.97480364 | 0.1944 | 0.0774 |
| AKT2 | Negative | 2.45598587 | 1.64608189 | 0.1889 | 0.0817 |
| HER2 | Negative | 4.25059223 | 0.97748483 | 0.1845 | 6.0853 |
| DIABLO | Negative | 17.035069 | 2.93939741 | 0.1809 | 0.0884 |
| p27 | Positive | â1.9798519 | â1.9041142 | 0.1792 | 0.09 |
| RANBP2 | Negative | 2.85994976 | 0.41878666 | 0.1757 | 0.0931 |
| EIF4E | Negative | 2.91202768 | 0.56099402 | 0.1722 | 0.0965 |
| EDN1 endothelin | Negative | 6.06858911 | 0.87185553 | 0.1688 | 0.0998 |
| IGF1R | Negative | 6.14387144 | 1.68865744 | 0.1674 | 0.1012 |
| AKT1 | Negative | 5.02676228 | 1.50585593 | 0.1659 | 0.1028 |
| CCNA2 | Negative | 3.95684559 | 0.63089954 | 0.184 | 0.1033 |
| HB-EGF | Negative | 5.1019713 | 0.70368632 | 0.1627 | 0.1061 |
| TIMP2 | Positive | 2.58975885 | â1.0832648 | 0.1625 | 0.1064 |
| EGFRd27 | Positive | â38.789016 | â5.2513587 | 0.1607 | 0.1083 |
| Chk2 | Negative | 6.8797175 | 1.21671205 | 0.1581 | 0.1112 |
| IRS1 | Negative | 12.0545078 | 1.59632708 | 0.1578 | 0.1115 |
| FRP1 | Negative | 3.38233862 | 0.49053452 | 0.1569 | 0.1126 |
| CCNE2 | Negative | 5.78828731 | 1.11609099 | 0.1566 | 0.1129 |
| SPRY2 | Negative | 4.68447069 | 0.86747803 | 0.1552 | 0.1145 |
| KRT17 | Negative | 0.34280253 | 0.412313 | 0.151 | 0.1195 |
| DPYD | Negative | 2.78071456 | 0.78918833 | 0.1504 | 0.1202 |
| CD105 | Negative | 3.13613733 | 0.51406689 | 0.1391 | 0.1351 |
| TP53BP1 | Negative | 3.18676588 | 0.58622276 | 0.1361 | 0.1395 |
| PTPD1 | Negative | 5.85217342 | 1.08545385 | 0.1357 | 0.1401 |
| CTSL | Positive | â2.2283797 | â1.4833372 | 0.1354 | 0.1405 |
| TABLE 2 |
| Clinical Benefit Genes for Head and Neck Study |
| Logistic Discriminat | Likelihood | |||
| Gene | Function | Ratio Test |
| Name | Response | Intercept | Slope | R2 | P Value |
| cMet.2 | Negative | 23.583252 | 4.4082875 | 0.6444 | 0.0007 |
| GRO1.2 | Negative | 10.10717 | 2.46904056 | 0.5388 | 0.0019 |
| A-Catenin.2 | Negative | 5.13298651 | 2.60834812 | 0.3628 | 0.0107 |
| AKT1.3 | Negative | 7.7652606 | 2.83068092 | 0.3044 | 0.0194 |
| DCR3.3 | Negative | 10.2957141 | 1.85012996 | 0.293 | 0.0219 |
| B-Catenin.3 | Negative | 4.21267279 | 1.5417788 | 0.2791 | 0.0252 |
| EDN1 endothelin.1 | Negative | 6.83022814 | 1.14550062 | 0.2758 | 0.0261 |
| CCNE1.1 | Negative | 7.43731399 | 1.21270723 | 0.2661 | 0.0289 |
| LAMC2.2 | Negative | 1.79659862 | 0.56623898 | 0.2498 | 0.0342 |
| CD44v6.1 | Negative | 2.55050577 | 1.87838162 | 0.2071 | 0.0539 |
| DIABLO.1 | Negative | 16.5051841 | 2.99910512 | 0.2066 | 0.0542 |
| CD44v3.2 | Negative | 3.02492619 | 2.05469571 | 0.2002 | 0.058 |
| NMYC.2 | Negative | 23.2010327 | 3.20767305 | 0.1955 | 0.061 |
| CD82.3 | Positive | â2.7521937 | â1.1692268 | 0.188 | 0.0662 |
| RANBP2.3 | Negative | 2.02076788 | 0.42173233 | 0.1807 | 0.0718 |
| RB1.1 | Positive | â5.7352964 | â1.7540651 | 0.1761 | 0.0754 |
| HER2.3 | Negative | 3.87564158 | 1.11486016 | 0.1732 | 0.0779 |
| MTA1.1 | Negative | 3.9020256 | 0.92255645 | 0.1628 | 0.0874 |
| CGA.3 | Positive | â41.909839 | â5.5686182 | 0.1619 | 0.0883 |
| CEACAM6.1 | Negative | 1.66596967 | 0.59307792 | 0.1602 | 0.0899 |
| PTPD1.2 | Negative | 5.51242763 | 1.18616068 | 0.1601 | 0.0901 |
| ERK1.3 | Negative | 2.4144706 | 0.72072834 | 0.154 | 0.0964 |
| Bax.1 | Negative | 2.91338256 | 0.76334619 | 0.152 | 0.0987 |
| STMY3.3 | Positive | â0.9946728 | â0.6053981 | 0.1483 | 0.1028 |
| COX2.1 | Negative | 5.79279616 | 1.0312018 | 0.1478 | 0.1034 |
| EIF4E.1 | Negative | 2.08005397 | 0.55985052 | 0.1468 | 0.1045 |
| YB-1.2 | Positive | 0.45158771 | â2.2935538 | 0.1426 | 0.1096 |
| fas.1 | Negative | 4.05538424 | 0.8686042 | 0.1397 | 0.1134 |
| PDGFA.3 | Negative | 2.43388275 | 0.53168307 | 0.1371 | 0.1168 |
| FRP1.3 | Negative | 2.17320245 | 0.41529609 | 0.137 | 0.1169 |
| PGK1.1 | Negative | 1.86416703 | 1.92395917 | 0.1338 | 0.1212 |
| AKT2.3 | Negative | 1.45131206 | 1.43341036 | 0.1281 | 0.1294 |
| BTC.3 | Negative | 12.1153734 | 1.67411928 | 0.1281 | 0.1294 |
| APC.4 | Negative | 2.50791938 | 0.92506412 | 0.128 | 0.1296 |
| CCNE2.2 | Negative | 3.98727145 | 0.89372321 | 0.1267 | 0.1315 |
| OPN, osteopontin.3 | Positive | â0.522697 | â0.5069258 | 0.1225 | 0.1382 |
| ITGA3.2 | Negative | 2.23381763 | 0.3800099 | 0.1203 | 0.1417 |
| KRT17.2 | Negative | â0.4861169 | 0.43917211 | 0.1184 | 0.1449 |
| CD44s.1 | Positive | â0.9768133 | â0.8896223 | 0.118 | 0.1456 |
| EGFR.2 | Negative | 0.43258354 | 0.46719029 | 0.1162 | 0.1487 |
| TABLE 3 |
| Partial Response Genes for Colon Study |
| Logistic Discriminat | Likelihood | |||
| Gene | Function | Ratio Test |
| Name | Response | Intercept | Slope | R2 | P Value |
| Bclx_2 | Positive | 2.04896151 | â2.1025144 | 0.172 | 0.0801 |
| BRAF_2 | Positive | â2.5305788 | â3.0987684 | 0.2532 | 0.0337 |
| BRK_2 | Positive | â2.6096501 | â1.577388 | 0.2998 | 0.0209 |
| CA9_3 | Negative | 2.65287578 | 0.83720397 | 0.2758 | 0.0267 |
| Cad17_1 | Positive | â0.0419396 | â1.8773242 | 0.2096 | 0.0533 |
| CCND3_1 | Positive | â1.014844 | â5.1111617 | 0.348 | 0.0128 |
| CCNE1_1 | Positive | â6.5821701 | â0.8939912 | 0.1914 | 0.0648 |
| CCNE2_2 | Positive | 26.1675642 | â1.0709109 | 0.1707 | 0.0812 |
| CD105_1 | Positive | 5.85359096 | â1.2349006 | 0.1302 | 0.1278 |
| CD134_2 | Negative | â5.9286576 | 1.51119518 | 0.1212 | 0.1418 |
| CD44v3_2 | Negative | â1.8184898 | 1.12771829 | 0.2064 | 0.0552 |
| CDC25B_1 | Negative | 10.4351019 | 1.59196005 | 0.2455 | 0.0365 |
| DR5_2 | Negative | â1.7399226 | 1.60177588 | 0.1759 | 0.0767 |
| ErbB3_1 | Positive | 3.65681435 | â0.760436 | 0.1222 | 0.1401 |
| EREG_1 | Positive | â2.3409861 | â1.1217612 | 0.2542 | 0.0333 |
| GPC3_1 | Positive | 4.03889935 | â1.9097648 | 0.3752 | 0.0097 |
| GRO1.2 | Negative | 2.77545378 | 0.74734483 | 0.124 | 0.1359 |
| GUS_1 | Positive | 8.29578416 | â1.9015759 | 0.2105 | 0.0529 |
| HGF_4 | Positive | 5.10609383 | â1.1947949 | 0.2361 | 0.0403 |
| ID1_1 | Positive | 10.6703203 | â1.654146 | 0.216 | 0.0498 |
| ITGB3_1 | Positive | 0.79232612 | â0.827508 | 0.3321 | 0.015 |
| KRT17_2 | Negative | 5.93738146 | 0.93514633 | 0.2133 | 0.0513 |
| LAMC2_2 | Negative | â0.3325052 | 1.41542034 | 0.2475 | 0.0357 |
| P14ARF_1 | Negative | 4.36456658 | 4.10859002 | 0.2946 | 0.022 |
| PDGFB_3 | Negative | â4.7055966 | 1.96517114 | 0.3299 | 0.0154 |
| PLAUR_3 | Negative | 7.51817646 | 0.6862142 | 0.1534 | 0.0983 |
| PTPD1_2 | Positive | â11.659761 | â1.2559081 | 0.1247 | 0.1362 |
| RASSF1_3 | Negative | 6.60631474 | 0.9862129 | 0.1708 | 0.0811 |
| RIZ1_2 | Negative | 2.83817546 | 0.86281199 | 0.1255 | 0.1349 |
| Src_2 | Negative | 4.91364145 | 1.96089745 | 0.1324 | 0.1247 |
| TFRC_3 | Negative | â4.0754666 | 3.03617052 | 0.19 | 0.0658 |
| TITF1_1 | Positive | â1.8849815 | â2.1890987 | 0.1349 | 0.1211 |
| upa_3 | Negative | 4.1059421 | 1.14053848 | 0.1491 | 0.1032 |
| XIAP_1 | Positive | â16.296951 | â2.9502191 | 0.2661 | 0.0295 |
| TABLE 4 |
| Clinical Benefit Genes for Colon Study |
| Logistic Discriminat | Likelihood | |||
| Gene | Function | Ratio Test |
| Name | Response | Intercept | Slope | R2 | P Value |
| Bak | Positive | â1.347937 | â0.993212 | 0.1189 | 0.0602 |
| BRK | Positive | â3.237705 | â1.1479379 | 0.2567 | 0.0057 |
| CD134 | Negative | 9.9358537 | 1.68440149 | 0.1927 | 0.0167 |
| CD44E | Negative | 3.188991 | 0.59091622 | 0.0958 | 0.0916 |
| CD44v6 | Negative | 5.7352464 | 1.77571293 | 0.2685 | 0.0047 |
| CDC25B | Negative | 2.0664209 | 0.67140598 | 0.0783 | 0.1272 |
| CGA | Negative | 2.7903424 | 0.43834476 | 0.1035 | 0.0794 |
| COX2 | Positive | â1.262804 | â0.4741852 | 0.0733 | 0.1398 |
| DIABLO | Positive | â2.514199 | â1.0753148 | 0.1028 | 0.0805 |
| FRP1 | Positive | â0.401936 | â0.3555899 | 0.0937 | 0.0952 |
| GPC3 | Positive | â7.875276 | â1.7437079 | 0.3085 | 0.0025 |
| HER2 | Positive | 0.1228609 | â0.5549133 | 0.073 | 0.1408 |
| ITGB3 | Positive | â1.593092 | â0.5249778 | 0.1352 | 0.045 |
| PPARG | Negative | 8.6479233 | 1.36115361 | 0.1049 | 0.0774 |
| PTPD1 | Positive | â3.203607 | â1.2049773 | 0.1356 | 0.0447 |
| RPLPO | Positive | 3.5110353 | â1.030518 | 0.0752 | 0.135 |
| STK15 | Positive | â0.664989 | â0.5936475 | 0.0873 | 0.1072 |
| SURV | Positive | â1.409619 | â0.6214924 | 0.074 | 0.1381 |
| TERC | Positive | 1.7755749 | â0.5180083 | 0.1073 | 0.0742 |
| TGFBR2 | Positive | 1.5172396 | â0.9288498 | 0.0934 | 0.0957 |
| TABLESâ5A-5B | |||
| Seq.â | |||
| Gene | Accessin | Sequence | ID |
| A-Catenin | NM_00190 | CGTTCCGATCCTCTATACTGCATCCCAGGCATGCCTACAGCACCCTGATGTCGCAGCCTATAAGGCCAACA | 1 |
| GGGACCT | |||
| AKT1 | NM_00516 | CGCTTCTATGGCGCTGAGATTGTGTCAGCCCTGGACTACCTGCACTCGGAGAAGAACGTGGTGTACCGGGA | 2 |
| AKT2 | NM_00162 | TCCTGCCACCCTTCAAACCTCAGGTCACGTCCGAGGTCGACACAAGGTACTTCGATGATGAATTTACCGCC | 3 |
| APC | NM_00003 | GGACAGCAGGAATGTGTTTCTCCATACAGGTCACGGGGAGCCAATGGTTCAGAAACAAATCGAGTGGGT | 4 |
| B-Catenin | NM_00190 | GGCTCTTGTGCGTACTGTCCTTCGGGCTGGTGACAGGGAAGACATCACTGAGCCTGCCATCTGTGCTCTTC | 5 |
| GTCATCTGA | |||
| Bak | NM_00118 | CCATTCCCACCATTCTACCTGAGGCCAGGACGTCTGGGGTGTGGGGATTGGTGGGTCTATGTTCCC | 6 |
| Bax | NM_0432 | CCGCCGTGGACACAGACTCCCCCCGAGAGGTCTTTTTCCGAGTGGCAGCTGACATGTTTTCTGACGGCAA | 7 |
| Bclx | NM_00119 | CTTTTGTGGAACTCTATGGGAACAATGCAGCAGCCGAGAGCCGAAAGGGCCAGGAACGCTTCAACCGCTG | 8 |
| BRAF | NM_00433 | CCTTCCGACCAGCAGATGAAGATCATCGAAATCAATTTGGGCAACGAGACCGATCCTCATCAGCTCCCAAT | 9 |
| GTGCATATAAA | |||
| BRK | NM_00597 | GTGCAGGAAAGGTTCACAAATGTGGAGTGTCTGCGTCCAATACACGCGTGTGCTCCTCTCCTTACTCCATG | 10 |
| GTGTGTGC | |||
| BTC | NM_00172 | AGGGAGATGCCGCTTCGTGGTGGCCGAGCAGACGCCCTCCTGTGTCTGTGATGAAGGCTACATTGGAGCAA | 11 |
| GGTGTGAGAG | |||
| CA9 | NM_00121 | ATCCTAGCCCTGGTTTTTGGCCTCCTTTTTGCTGTCACCAGCGTCGCGTTCCTTGTGCAGATGAGAAGGCA | 12 |
| G | |||
| Cad17 | NM_00406 | GAAGGCCAAGAACCGAGTCAAATTATATTCCAGTTTAAGGCCAATCCTCCTGCTGTGACTTTTGAACTAAC | 13 |
| TGGGGA | |||
| CCNA2 | NM_00123 | CCATACCTCAAGTATTTGCCATCAGTTATTGCTGGAGCTGCCTTTCATTTAGCACTCTACACAGTCACGGG | 14 |
| ACAAAGCT | |||
| CCND3 | NM_00176 | CCTCTGTGCTACAGATTATACCTTTGCCATGTACCCGCCATCCATGATCGCCACGGGCAGCATTGGGGCTG | 15 |
| CAGTG | |||
| CCNE1 | NM_00123 | AAAGAAGATGATGACCGGGTTTACCCAAACTCAACGTGCAAGCCTCGGATTATTGCACCATCCAGAGGCTC | 16 |
| CCNE2 | NM_05774 | ATGCTGTGGCTCCTTCCTAACTGGGGCTTTCTTGACATGTAGGTTGCTTGGTAATAACCTTTTTGTATATC | 17 |
| ACAATTTGGGT | |||
| CD105 | NM_00011 | GCAGGTGTCAGCAAGTATGATCAGCAATGAGGCGGTGGTCAATATCCTGTCGAGCTCATCACCACAGCGGA | 18 |
| AAAA | |||
| CD134 | NM_00332 | GCCCAGTGCGGAGAACAGGTCCAGCTTGATTCTCGTCTCTGCACTTAAGCTGTTCTCCAGGTGCGTGTGAT | 19 |
| T | |||
| CD44E | X55150 | ATCACCGACAGCACAGACAGAATCCCTGCTACCAATATGGACTCCAGTCATAGTACAACGCTTCAGCCTAC | 20 |
| TGCAAATCCAAACACAGGT | |||
| CD44s | M59040 | GACGAAGACAGTCCCTGGATCACCGACAGCACAGACAGAATCCCTGCTACCAGAGACCAAGACACATTCCA | 21 |
| CCCCAGT | |||
| CD44v3 | AJ251595 | CACACAAAACAGAACCAGGACTGGACCCAGTGGAACCCAAGCCATTCAAATCCGGAAGTGCTACTTCAG | 22 |
| CD44v6 | AJ251595 | CTCATACCAGCCATCCAATGCAAGGAAGGACAACACCAAGCCCAGAGGACAGTTCCTGGACTGATTTCTTC | 23 |
| AACCCAA | |||
| CD68 | NM_00125 | TGGTTCCCAGCCCTGTGTCCACCTCCAAGCCCAGATTCAGATTCGAGTCATGTACACAACCCAGGGTGGAG | 24 |
| GAG | |||
| CD82 | NM_00223 | GTGCAGGCTCAGGTGAAGTGCTGCGGCTGGGTCAGCTTCTACAACTGGACAGACAACGCTGAGCTCATGAA | 25 |
| TCGCCCTGAGGTC | |||
| CD9 | NM_00176 | GGGCGTGGAACAGTTTATCTCAGACATCTGaCCCAAGAAGGACGTACTCGAAACCTTCACCGTG | 26 |
| CDC25B | NM_02187 | AAACGAGCAGTTTGCCATCAGACGCTTCCAGTCTATGCCGGTGAGGCTGCTGGGCCACAGCCCCGTGCTTC | 27 |
| GGAACATCACCAAC | |||
| CEACAM6 | NM_00248 | CACAGCCTCACTTCTAACCTTCTGGAACCCACCCACCACTGCCAAGCTCACTATTGAATCCACGCCATTCA | 28 |
| A | |||
| CGA | NM_00127 | CTGAAGGAGCTCCAAGACCTCGCTCTCCAAGGCGCCAAGGAGAGGGCACATCAGCAGAAGAAACACAGCGG | 29 |
| TTTTG | |||
| Chk2 | NM_00719 | ATGTGGAACCCCCACCTACTTGGCGCCTGAAGTTCTTGTTTCTGTTGGGACTGCTGGGTATAACCGTGCTG | 30 |
| TGGACTG | |||
| cMet | NM_00024 | GACATTTCCAGTCCTGCAGTCAATGCCTCTCTGCCCCACCCTTTGTTCAGTOTGGCTGGTGCCACGACAAA | 31 |
| TGTGTGCGATCGGAG | |||
| COX2 | NM_00096 | TCTGCAGAGTTGGAAGCACTCTATGGTGACATCGATGCTGTGGAGCTGTATCCTGCCCTTCTGGTAGAAAA | 32 |
| GCCTCGGC | |||
| criptoâ | NM_00321 | GGGTCTGTGCCCCATGACACCTGGCTGCCCAAGAAGTGTTCCCTGTGTAAATGCTGGCACGGTCA | 33 |
| CTSL | NM_00191 | GGGAGGCTTATCTCACTGAGTGAGCAGAATCTGGTAGACTGCTCTGGGCCTCAAGGCAATGAAGGCTGCAA | 34 |
| TGG | |||
| DCR3 | NM_01643 | GACCAAGGTCCTGGAATGTCTGCAGCAGAAGGTGAATGGCATCCTGGAGAGCCCTACGGGTACAGGGAAGA | 35 |
| C | |||
| DIABLO | NM_01988 | CACAATGGCGGCTCTGAAGAGTTGGCTGTCGCGCAGCGTAACTTCATTCTTCAGGTACAGACAGTGTTTGT | 36 |
| GT | |||
| DPYD | NMâ00011 | AGGACGCAAGGAGGGTTTGTCACTGGCAGACTCGAGACTGTAGGCACTGCCATGGCCCCTGTGCTCAGTAA | 37 |
| GGACTCGGCGGACATC | |||
| DR5 | NM_00384 | CTCTGAGACAGTGCTTCGATGACTTTGCAGACTTGGTGCCCTTTGACTCCTGGGAGCCGCTCATGAGGAAG | 38 |
| TTGGGCCTCATGG | |||
| EDN1âend | NM_00195 | TGCCACCTGGACATCATTTGGGTCAACACTCCCGAGCACGTTGTTCCGTATGGACTTGGAAGCCCTAGGTC | 39 |
| CA | |||
| EGFR | NM_00522 | TGTCGATGGACTTCCAGAACCACCTGGGCAGCTGCCAAAAGTGTGATCCAAGCTGTCCCAAT | 40 |
| EGFRd27 | EGFRd27 | GAGTCGGGCTCTGGAGGAAAAGAAAGGTAATTATGTGGTGACAGATCACGGCTCGTGCGTCCGAGCCTGTG | 41 |
| G | |||
| EIF4E | NM_00196 | GATCTAAGATGGCGACTGTCGAACCGGAAACCACCCCTACTCCTAATCCCCCGACTACAGAAGAGGAGAAA | 42 |
| ACGGAATCTAA | |||
| ErbB3 | NM_00198 | CGGTTATGTCATGCCAGATACACACCTCAAAGGTACTCCCTCCTCCCGGGAAGGCACCCTTTCTTCAGTGG | 43 |
| GTCTCAGTTC | |||
| ERBB4 | NM_00523 | TGGCTCTTAATCAGTTTCGTTACCTGCCTCTGGAGAATTTACGCATTATTCGTGGGACAAAACTTTATGAG | 44 |
| GATCGATATGCCTTG | |||
| EREG | NM_00143 | ATAACAAAGTGTAGCTCTGACATGAATGGCTATTGTTTGCATGGACAGTGCATCTATCTGGTGGACATGAG | 45 |
| TCAAAACTACTGCAGGTGTG | |||
| ERK1 | Z11-696 | ACGGATCACAGTGGAGGAAGCGCTGGCTCACCCCTACCTGGAGCAGTACTATGACCCGACGGATGAG | 46 |
| fas | NM_00004 | GGATTGCTCAACAACCATGCTGGGCATCTGGACCCTCCTACCTCTGGTTCTTACGTCTGTTGCTAGATTAT | 47 |
| CGTCCAAAAGTGTTAATGCC | |||
| FRP1 | NM_00301 | TTGGTACCTGTGGGTTAGCATCAAGTTCTCCCCAGGGTAGAATTCAATCAGAGCTCCAGTTTGCATTTGGA | 48 |
| TGTG | |||
| GPC3 | NM00448 | TGATGCGCCTGGAAACAGTCAGCAGGCAACTCCGAAGGACAACGAGATAAGCACCTTTCACAACCTCG | 49 |
| GRO1 | NM_0151 | CGAAAAGATGCTGAACAGTGACAAATCCAACTGACCAGAAGGGAGGAGGAAGCTCACTGGTGGCTGTTCCT | 50 |
| GA | |||
| GUS | NM_00018 | CCCACTCAGTAGCCAAGTCACAATGTTTGGAAAACAGCCCGTTTACTTGAGCAAGACTGATACCACCTGCG | 51 |
| TG | |||
| HB-EGF | NM_00194 | GACTCCTTCGTCCCCAGTTGCCGTCTAGGATTGGGCCTCCCATAATTGCTTTGCCAAAATACCAGAGCCTT | 52 |
| CAAGTGCCA | |||
| HER2 | NM_00444 | CGGTGTGAGAAGTGCAGCAAGCCCTGTGCCCGAGTGTGCTATGGTCTGGGCATGGAGCACTTGCGAGAGG | 53 |
| HGF | M29-145 | CCGAAATCCAGATGATGATGCTCATGGACCCTGGTGCTACACGGGAAATCCACTCATTCCTTGGG | 54 |
| ID1 | NM_00216 | AGAACCGCAAGGTGAGCAAGGTGGAGATTCTCCAGCACGTCATCGACTACATCAGGGACCTTCAGTTGGA | 55 |
| IGF1R | NM_00087 | GCATGGTAGCCGAAGATTTCACAGTCAAAATCGGAGATTTTGGTATGACGCGAGATATCTATGAGACAGAC | 56 |
| TATTACCGGAAA | |||
| IGFBP3 | NM_0059 | ACGCACCGGGTGTCTGATCCCAAGTTCCACCCCCTCCATTCAAAGATAATCATCATCAAGAAAGGGCA | 57 |
| IRS1 | NM_00554 | CCACAGCTCACCTTCTGTCAGGTGTCCATCCCAGCTCCAGCCAGCTCCCAGAGAGGAAGAGACTGGCACTG | 58 |
| AGG | |||
| ITGA3 | NM_00220 | CCATGATCCTCACTCTGCTGGTGGACTATACACTCCAGACCTCGCTTAGCATGGTAAATCACCGGCTACAA | 59 |
| AGCTTC | |||
| ITGB3 | NM_00021 | ACCGGGAGCCCTACATGACCGAAAATACCTGCAACCGTTACTGCCGTGACGAGATTGAGTCAGTGAAAGAG | 60 |
| CTTAAGG | |||
| KRT17 | NM_60042 | CGAGGATTGGTTCTTCAGCAAGACAGAGGAACTGAACCGCGAGGTGGCCACCAACAGTGAGCTGGTGCAGA | 61 |
| GT | |||
| LAMC2 | NM_00556 | ACTCAAGCGGAAATTGAAGCAGATAGGTCTTATCAGCACAGTCTCCGCCTCCTGGATTCAGTGTCTCGGCT | 62 |
| TCAGGGAGT | |||
| MTA1 | NM_00468 | CCGCCCTGACCTGAAGAGAAACGCGCTCCTTGGCGGACACTGGGGGAGGAGAGGAAGAAGCGCGGCTAACT | 63 |
| TATTCC | |||
| NMYC | NM_00537 | TGAGCGTCGCAGAAACCACAACATCCTGGAGCGCCAGCGCCGCAACGACCTTCGoTCCAGCTTTCTCACGC | 64 |
| TCAGGGA | |||
| p14ARF | NM_00007 | GCGGAAGGTCCCTCAGACATCCCCGATTGAAAGAACCAGAGAGGCTCTGAGAAAOCTCGGGAAACTTAGA | 65 |
| p27 | NM_00406 | CGGTGGACCACGAAGAGTTAACCCGGGACTTGGAGAAGCACTGCAGAGACATGGAAGAGGCGAGCC | 66 |
| P53 | NM_00054 | CTTTGAACCCTTGCTTGCAATAGGTGTGCGTCAGAAGCACCCAGGACTTCCATTTGCTTTGTCCCGGG | 67 |
| PAI1 | NM_00060 | CCGCAACGTGGTTTTCTCACCCTATGGGGTGGCCTCGGTGTTGGCCATGCTCCAGCTGACAACAGGAGGAG | 68 |
| AAACCCAGCA | |||
| PDGFA | NM_00260 | TTGTTGGTGTGCCCTGGTGCCGTGGTGGCGGTCACTCCCTCTGCTGCCAGTGTTTGGACAGAACCCA | 69 |
| PDGFB | NM_00260 | ACTGAAGGAGACCCTTGGAGCCTAGGGGCATCGGCAGGAGAGTGTGTGGGCAGGGTTATTTA | 70 |
| PGK1 | NM_00029 | AGAGCCAGTTGCTGTAGAACTCAAATCTCTGCTGGGCAAGGATGTTCTGTTCTTGAAGGACTGTGTAGGCC | 71 |
| CAG | |||
| PLAUR | NM_00265 | CCCATGGATGCTCCTCTGAAGAGACTTTCCTCATTGACTGCCGAGGCCCCATGAATCAATGTCTGGTAGCC | 72 |
| ACCGG | |||
| PPARG | NM_00503 | TGACTTTATGGAGCCCAAGTTTGAGTTTGCTGTGAAGTTCAATGCACTGGAATTAGATGACAGCGACTTGG | 73 |
| C | |||
| PTPD1 | NM_0703 | CGCTTGCCTAACTCATACTTTCCCGTTGACACTTGATCCACGCAGCGTGGCACTGGGACGTAAGTGGCGCA | 74 |
| GTCTGAATGG | |||
| RANBP2 | NM_00626 | TCCTTCAGCTTTCACACTGGGCTCAGAAATGAAGTTGCATGACTCTTCTGGAAGTCAGGTGGGAACAGGAT | 75 |
| TT | |||
| RASSF1 | NM_00718 | AGTGGGAGACACCTGACCTTTCTCAAGCTGAGATTGAGCAGAAGATCAAGGAGTACAATGCCCAGATCA | 76 |
| RB1 | NM_00032 | CGAAGCCCTTACAAGTTTCCTAGTTCACCCTTACGGATTCCTGGAGGGAACATCTATATTTCACCCCTGAA | 77 |
| GAGTCC | |||
| RIZ1 | NM_01223 | CCAGACGAGCGATTAGAAGCGGCAGCTTGTGAGGTGAATGATTTGGGGGAAGAGGAGGAGGAGGAAGAGGA | 78 |
| GGA | |||
| RPLPO | NM_00100 | CCATTCTATCATCAACGGGTACAAACGAGTCCTGGCCTTGTCTGTGGAGACGGATTACACCTTCCCACTTG | 79 |
| CTGA | |||
| SPRY2 | NM_00584 | TGTGGCAAGTGCAAATGTAAGGAGTGCACCTACCCAAGGCCTCTGCCATCAGACTGGATCTGCGAC | 80 |
| Src | NM_00438 | CCTGAACATGAAGGAGCTGAAGCTGCTGCAGACCATCGGGAAGGGGGAGTTCGGAGACGTGATG | 81 |
| STK15 | NM_00360 | CATCTTCCAGGAGGACCACTCTCTGTGGCACCCTGGACTACCTGCCCCCTGAAATGATTGAAGGTCGGA | 82 |
| SURV | NM_00116 | TGTTTTGATTCCCGGGCTTACCAGGTGAGAAGTGAGGGAGGAAGAAGGCAGTGTCCCTTTTGCTAGAGCTG | 83 |
| ACAGCTTTG | |||
| TERC | U86-046 | AAGAGGAACGGAGCGAGTCCCCGCGCGCGGCGCGATTCCCTGAGCTGTGGGACGTGCACCCAGGACTCGGC | 84 |
| TCACACAT | |||
| TFRC | NM_00323 | GCCAACTGCTTTCATTTGTGAGGGATCTGAACCAATACAGAGCAGACATAAAGGAAATGGGCCTGAGT | 85 |
| TGFBR2 | NM_00324 | AACACCAATGGGTTCCATCTTTCTGGGCTCCTGATTGCTCAAGCACAGTTTGGCCTGATGAAGAGG | 86 |
| TIMP2 | NM_00325 | TCACCCTCTGTGACTTCATCGTGCCCTGGGACACCCTGAGCACCACCCAGAAGAAGAGCCTGAACCACA | 87 |
| TITF1 | NM_00331 | CGACTCCGTTCTCAGTGTCTGACATCTTGAGTCCCCTGGAGGAAAGCTACAAGAAAGTGGGCATGGAGGG | 88 |
| TP53BP1 | NM_00565 | TGCTGTTGCTGAGTCTGTTGCCAGTCCCCAGAAGACCATGTCTGTGTTGAGCTGTATCTGTGAAGCCAGGC | 89 |
| AAG | |||
| upa | NM_00265 | GTGGATGTGCCCTGAAGGACAAGCCAGGCGTCTACACGAGAGTCTCACACTTCTTACCCTGGATCCGCAG | 90 |
| VEGFC | NM_00542 | CCTCAGCAAGACGTTATTTGAAATTACAGTGCCTCTCTCTCAAGGCCCCAAACCAGTAACAATCAGTTTTG | 90 |
| CCAATCACACTT | |||
| XIAP | NM_00116 | GCAGTTGGAAGACACAGGAAAGTATCCCCAAATTGCAGATTTATCAACGGCTTTTATCTTGAAAATAGTGC | 92 |
| CACGCA | |||
| YB-1 | NM_00455 | AGACTGTGGAGTFTGATGTTGTTGAAGGAGAAAAGGGTGCGGAGGCAGCAAATGTTACAGGTCCTGGTGGT | 93 |
| GTTCC | |||
| TABLESâ6A-6F | |||||
| Gene | Accession | Name | Sequence | Length | SeqâID. |
| A-Catenin | NM_001903 | S2138/A-Cate.f2 | CGTTCCGATCCTCTATACTGCAT | 23 | 94 |
| A-Catenin | NM_001903 | S2139/A-Cate.r2 | AGGTCCCTGTTGGCCTTATAGG | 22 | 95 |
| A-Catenin | NM_001903 | S4725/A-Cate.p2 | ATGCCTACAGCACCCTGATGTCGCA | 25 | 96 |
| AKT1 | NM_005163 | S0010/AKT1.f3 | CGCTTCTATGGCGCTGAGAT | 20 | 97 |
| AKT1 | NM_005163 | S0012/AKT1.r3 | TCCCGGTACACCACGTTCTT | 20 | 98 |
| AKT1 | NM_005163 | S4776/AKT1.p3 | CAGCCCTGGACTACCTGCACTCGG | 24 | 99 |
| AKT2 | NM_001626 | S0828/AKT2.f3 | TCCTGCCACCCTTCAAACC | 19 | 100 |
| AKT2 | NM_001626 | S0829/AKT2.r3 | GGCGGTAAATTCATCATCGAA | 21 | 101 |
| AKT2 | NM_001626 | S4727/AKT2.p3 | CAGGTCACGTCCGAGGTCGACACA | 24 | 102 |
| APC | NM_000038 | S0022/APC.f4 | GGACAGCAGGAATGTGTTTC | 20 | 103 |
| APC | NM_000038 | S0024/APC.r4 | ACCCACTCGATTTGTTTCTG | 20 | 104 |
| APC | NM_000038 | S4888/APC.p4 | CATTGGCTCCCCGTGACCTGTA | 22 | 105 |
| B-Catenin | NM_001904 | S2150/B-Cate.f3 | GGCTCTTGTGCGTACTGTCCTT | 22 | 106 |
| B-Catenin | NM_001904 | S2151/B-Cate.r3 | TCAGATGACGAAGAGCACAGATG | 23 | 107 |
| B-Catenin | NM_001904 | S5046/B-Cate.p3 | AGGCTCAGTGATGTCTTCCCTGTCACCAG | 29 | 108 |
| Bak | NM_001188 | S0037/Bak.f2 | CCATTCCCACCATTCTACCT | 20 | 109 |
| Bak | NM_001188 | S0039/Bak.r2 | GGGAACATAGACCCACCAAT | 20 | 110 |
| Bak | NM_001188 | S4724/Bak.p2 | ACACCCCAGACGTCCTGGCCT | 21 | 111 |
| Bax | NM_004324 | S0040/Bax.fl | CCGCCGTGGACACAGACT | 18 | 112 |
| Bax | NM_004324 | S0042/Bax.r1 | TTGCCGTCAGAAAACATGTCA | 21 | 113 |
| Bax | NM_004324 | S4897/Bax.p1 | TGCCACTCGGAAAAAGACCTCTCGG | 25 | 114 |
| Bclx | NM_001191 | S0046/Bc1x.f2 | CTTTTGTGGAACTCTATGGGAACA | 24 | 115 |
| Bclx | NM_001191 | S0048/Bc1x.r2 | CAGCGGTTGAAGCGTTCCT | 19 | 116 |
| Bclx | NM_001191 | S4898/Bc1x.p2 | TTCGGCTCTCGGCTGCTGCA | 20 | 117 |
| BRAF | NM_004333 | S3027/BRAF.f2 | CCTTCCGACCAGCAGATGAA | 20 | 118 |
| BRAF | NM_004333 | S3028/BRAF.r2 | TTTATATGCACATTGGGAGCTGAT | 24 | 119 |
| BRAF | NM_004333 | S4818/BRAF.p2 | CAATTTGGGCAACGAGACCGATCCT | 25 | 120 |
| BRK | NM_005975 | S0678/BRK.f2 | GTGCAGGAAAGGTTCACAAA | 20 | 121 |
| BRK | NM_005975 | S0679/BRK.r2 | GCACACACGATGGAGTAAGG | 20 | 122 |
| BRK | NM_005975 | S4789/BRK.p2 | AGTGTCTGCGTCCAATACACGCGT | 24 | 123 |
| BTC | NM_001729 | S1216/BTC.f3 | AGGGAGATGCCGCTTCGT | 18 | 124 |
| BTC | NM_001729 | S1217/BTC.r3 | CTCTCACACCTTGCTCCAATGTA | 23 | 125 |
| BTC | NM_001729 | S4844/BTC.p3 | CCTTCATCACAGACACAGGAGGGCG | 25 | 126 |
| CA9 | NM_001216 | S1398/CA9.f3 | ATCCTAGCCCTGGTTTTTGG | 20 | 127 |
| CA9 | NM_001216 | S1399/CA9.r3 | CTGCCTTCTCATCTGCACAA | 20 | 128 |
| CA9 | NM_001216 | S4938/CA9.p3 | TTTGCTGTCACCAGCGTCGC | 20 | 129 |
| Cad17 | NM_004063 | S2186/Cad17.f1 | GAAGGCCAAGAACCGAGTCA | 20 | 130 |
| Cad17 | NM_004063 | S2187/Cad17.r1 | TCCCCAGTTAGTTCAAAAGTCACA | 24 | 131 |
| Cad17 | NM_004063 | S5038/Cad17.p1 | TTATATTCCAGTTTAAGGCCAATCCTC | 27 | 132 |
| CCNA2 | NM_001237 | S3039/CCNA2.f1 | CCATACCTCAAGTATTTGCCATCAG | 25 | 133 |
| CCNA2 | NM_001237 | S3040/CCNA2s1 | AGCTTTGTCCCGTGACTGTGTA | 22 | 134 |
| CCNA2 | NM_001237 | S4820/CCNA2.p1 | ATTGCTGGAGCTGCCTTTCATTTAGCACT | 29 | 135 |
| CCND3 | NM_001760 | S2799/CCND3.f1 | CCTCTGTGCTACAGATTATACCTTTGC | 27 | 136 |
| CCND3 | NM_001760 | S2800/CCND3.r1 | CACTGCAGCCCCAATGCT | 18 | 137 |
| CCND3 | NM_001760 | S4966/CCND3.p1 | TACCCGCCATCCATGATCGCCA | 22 | 138 |
| CCNE1 | NM_001238 | S1446/CCNE1.f1 | AAAGAAGATGATGACCGGGTTTAC | 24 | 139 |
| CCNE1 | NM_001238 | S1447/CCNE1.r1 | GAGCCTCTGGATGGTGCAAT | 20 | 140 |
| CCNE1 | NM_001238 | S4944/CCNE1.p1 | CAAACTCAACGTGCAAGCCTCGGA | 24 | 141 |
| CCNE2 | NM_057749 | S1458/CCNE2.f2 | ATGCTGTGGCTCCTTCCTAACT | 22 | 142 |
| CCNE2 | NM_057749 | S1459/CCNE2.r2 | ACCCAAATTGTGATATACAAAAAGGTT | 27 | 143 |
| CCNE2 | NM_057749 | S4945/CCNE2.p2 | TACCAAGCAACCTACATGTCAAGAAAGCCC | 30 | 144 |
| CD105 | NM_000118 | S1410/CD105.f1 | GCAGGTGTCAGCAAGTATGATCAG | 24 | 145 |
| CD105 | NM_000118 | S1411/CD105.r1 | TTTTTCCGCTGTGGTGATGA | 20 | 146 |
| CD105 | NM_000118 | S4940/CD105.p1 | CGACAGGATATTGACCACCGCCTCATT | 27 | 147 |
| CD134 | NM_003327 | S3138/CD134.f2 | GCCCAGTGCGGAGAACAG | 18 | 148 |
| CD134 | NM_003327 | S3139/CD134.r2 | AATCACACGCACCTGGAGAAC | 21 | 149 |
| CD134 | NM_003327â | S3241/CD134.p2 | CCAGCTTGATTCTCGTCTCTGCACTTAAGC | 30 | 150 |
| CD44E | X55150 | S3267/CD44E.f1 | ATCACCGACAGCACAGACA | 19 | 151 |
| CD44E | X55150 | S3268/CD44E.r1 | ACCTGTGTTTGGATTTGCAG | 20 | 152 |
| CD44E | X55150 | S4767/CD44E.p1 | CCCTGCTACCAATATGGACTCCAGTCA | 27 | 153 |
| CD44s | M59040 | S3102/CD44s.f1 | GACGAAGACAGTCCCTGGAT | 20 | 154 |
| CD44s | M59040 | S3103/CD44s.r1 | ACTGGGGTGGAATGTGTCTT | 20 | 155 |
| CD44s | M59040 | S4826/CD44s.p1 | CACCGACAGCACAGACAGAATCCC | 24 | 156 |
| CD44v3 | AJ251595v3 | S2997/CD44v3.f2 | CACACAAAACAGAACCAGGACT | 22 | 157 |
| CD44v3 | AJ251595v3 | S2998/CD44v3.r2 | CTGAAGTAGCACTTCCGGATT | 21 | 157 |
| CD44v3 | AJ251595v3 | S4814/CD44v3.p2 | ACCCAGTGGAACCCAAGCCATTC | 23 | 159 |
| CD44v6 | AJ251595v6 | S3003/CD44v6.f1 | CTCATACCAGCCATCCAATG | 20 | 160 |
| CD44v6 | AJ251595v6 | S3004/CD44v6.r1 | TTGGGTTGAAGAAATCAGTCC | 21 | 161 |
| CD44v6 | AJ251595v6 | S4815/CD44v6.p1 | CACCAAGCCCAGAGGACAGTTCCT | 24 | 162 |
| CD68 | NM_001251 | S0067/CD68.f2 | TGGTTCCCAGCCCTGTGT | 18 | 163 |
| CD68 | NM_001251 | S0069/CD68.r2 | CTCCTCCACCCTGGGTTGT | 19 | 164 |
| CD68 | NM_001251 | S4734/CD68.p2 | CTCCAAGCCCAGATTCAGATTCGAGTCA | 28 | 165 |
| CD82 | NM_002231 | S0684/CD82.f3 | GTGCAGGCTCAGGTGAAGTG | 20 | 166 |
| CD82 | NM_002231 | S0685/CD82.r3 | GACCTCAGGGCGATTCATGA | 20 | 167 |
| CD82 | NM_002231 | S4790/CD82.p3 | TCAGCTTCTACAACTGGACAGACAACGCTG | 30 | 168 |
| CD9 | NM_001769 | S0686/CD9.f1 | GGGCGTGGAACAGTTTATCT | 20 | 168 |
| CD9 | NM_001769 | S0687/CD9.r1 | CACGGTGAAGGTTTCGAGT | 19 | 170 |
| CD9 | NM_001769 | S4792/CD9.p1 | AGACATCTGCCCCAAGAAGGACGT | 24 | 171 |
| CDC25B | NM_021874 | S1160/CDC25B.f1 | AAACGAGCAGTTTGCCATCAG | 21 | 172 |
| CDC25B | NM_021874 | 51161/CDC25B.r1 | GTTGGTGATGTTCCGAAGCA | 20 | 176 |
| CDC25B | NM_021874 | S4842/CDC25B.p1 | CCTCACCGGCATAGACTGGAAGCG | 24 | 174 |
| CEACAM6 | NM_002483 | S3197/CEACAM.f1 | CACAGCCTCACTTCTAACCTTCTG | 24 | 175 |
| CEACAM6 | NM_002483 | S3198/CEACAM.r1 | TTGAATGGCGTGGATTCAATAG | 22 | 176 |
| CEACAM6 | NM_002483 | S3261/CEACAM.p1 | ACCCACCCACCACTGCCAAGCTC | 23 | 177 |
| CGA | NM_001275 | S3221/CGA.f3 | CTGAAGGAGCTCCAAGACCT | 20 | 178 |
| CGA | NM_001275 | S3222/CGA.r3 | CAAAACCGCTGTGTTTCTTC | 20 | 179 |
| CGA | NM_001275 | S3254/CGA.p3 | TGCTGATGTGCCCTCTCCTTGG | 22 | 180 |
| Chk2 | NM_007194 | S1434/Chk2.f3 | ATGTGGAACCCCCACCTACTT | 21 | 181 |
| Chk2 | NM_007194 | S1435/Chk2.r3 | CAGTCCACAGCACGGTTATACC | 22 | 182 |
| Chk2 | NM_007194 | S4942/Chk2.p3 | AGTCCCAACAGAAACAAGAACTTCAGGCG | 29 | 183 |
| cMet | NM_000245 | S0082/cMet.f2 | GACATTTCCAGTCCTGCAGTCA | 22 | 184 |
| cMet | NM_000245 | S0084/cMet.r2 | CTCCGATCGCACACATTTGT | 20 | 185 |
| cMet | NM_000245 | S4993/cMet.p2 | TGCCTCTCTGCCCCACCCTTTGT | 23 | 186 |
| COX2 | NM_000963 | S0088/COX2.f1 | TCTGCAGAGTTGGAAGCACTCTA | 23 | 187 |
| COX2 | NM_000963 | S0090/COX2.r1 | GCCGAGGCTTTTCTACCAGAA | 21 | 188 |
| COX2 | NM_000963 | S4995/COX2.p1 | CAGGATACAGCTCCACAGCATCGATGTC | 28 | 189 |
| cripto | NM_003212 | S3117/cripto.f1â | GGGTCTGTGCCCCATGAC | 18 | 190 |
| cripto | NM_003212 | S3118/cripto.r1â | TGACCGTGCCAGCATTTACA | 20 | 191 |
| cripto | NM_003212 | S3237/cripto.p1â | CCTGGCTGCCCAAGAAGTGTTCCCT | 25 | 192 |
| CTSL | NM_001912 | S1303/CTSL.f2 | GGGAGGCTTATCTCACTGAGTGA | 23 | 193 |
| CTSL | NM_001912 | S1304/CTSL.r2 | CCATTGCAGCCTTCATTGC | 19 | 194 |
| CTSL | NM_001912 | S4899/CTSL.p2 | TTGAGGCCCAGAGCAGTCTACCAGATTCT | 29 | 195 |
| DCR3 | NM_016434 | S1786/DCR3.f3 | GACCAAGGTCCTGGAATGTC | 20 | 196 |
| DCR3 | NM_016434 | 51787/DCR3.r3 | GTCTTCCCTGTACCCGTAGG | 20 | 197 |
| DCR3 | NM_016434 | S4982/DCR3.p3 | CAGGATGCCATTCACCTTCTGCTG | 24 | 198 |
| DIABLO | NM_019887 | S0808/DIABLO.f1 | CACAATGGCGGCTCTGAAG | 19 | 199 |
| DIABLO | NM_019887 | S0809/DIABLO.r1 | ACACAAACACTGTCTGTACCTGAAGA | 26 | 200 |
| DIABLO | NM_019887 | S4813/DIABLO.p1 | AAGTTACGCTGCGCGACAGCCAA | 23 | 201 |
| DPYD | NM_000110 | S0100/DPYD.f2 | AGGACGCAAGGAGGGTTTG | 19 | 202 |
| DPYD | NM_000110 | S0102/DPYD.r2 | GATGTCCGCCGAGTCCTTACT | 21 | 203 |
| DPYD | NM_000110 | S4998/DPYD.p2 | CAGTGCCTACAGTCTCGAGTCTGCCAGTG | 29 | 204 |
| DR5 | NM_003842 | S2551/DR5.f2 | CTCTGAGACAGTGCTTCGATGACT | 24 | 205 |
| DR5 | NM_003842 | S2552/DR5.r2 | CCATGAGGCCCAACTTCCT | 19 | 206 |
| DR5 | NM_003842 | S4979/DR5.p2 | CAGACTTGGTGCCCTTTGACTCC | 23 | 207 |
| EDN1 | NM_001955 | S0774/EDN1âe.f1 | TGCCACCTGGACATCATTTG | 20 | 208 |
| endothelin | |||||
| EDN1 | NM_001955 | S0775/EDN1âe.r1 | TGGACCTAGGGCTTCCAAGTC | 21 | 209 |
| endothelin | |||||
| EDN1 | NM_001955 | S4806/EDN1âe.p1 | CACTCCCGAGCACGTTGTTCCGT | 23 | 210 |
| endothelin | |||||
| EGâFR | NM_005228 | S0103/EGFR.f2 | TGTCGATGGACTTCCAGAAC | 20 | 211 |
| EGFR | NM_005228 | S0105/EGFR.r2â | ATTGGGACAGCTTGGATCA | 19 | 212 |
| EGFR | NM_005228 | S4999/EGFR.p2 | CACCTGGGCAGCTGCCAA | 18 | 213 |
| EGFRd27 | EGFRd27 | S2484/EGFRd2.f2â | GAGTCGGGCTCTGGAGGAAAAG | 22 | 214 |
| EGFRd27 | EGFRd27 | S2485/EGFRd2.r2â | CCACAGGCTCGGACGCAC | 18 | 215 |
| EGFRd27 | EGFRd27 | S4935/EGFRd2.p2 | AGCCGTGATCTGTCACCACATAATTACC | 28 | 216 |
| EIF4E | NM_001968 | S0106/EIF4E.f1 | GATCTAAGATGGCGACTGTCGAA | 23 | 217 |
| EIF4E | NM_001968â | S0108/EIF4E.r1 | TTAGATTCCGTTTTCTCCTCTTCTG | 25 | 218 |
| EIF4E | NM_001968 | S5000/EIF4E.p1 | ACCACCCCTACTCCTAATCCCCCGACT | 27 | 219 |
| ErbB3 | NM_001982 | S0112/ErbB3.f1 | CGGTTATGTCATGCCAGATACAC | 23 | 220 |
| ErbâB3 | NM_001982 | S0114/ErbB3.r1 | GAACTGAGACCCACTGAAGAAAGG | 24 | 221 |
| ErbâB3 | NM_001982 | S5002/ErbB3.p1 | CCTCAAAGGTACTCCCTCCTCCCGG | 25 | 222 |
| ERBB4 | NM_005235 | S1231/ERBB4.f3 | TGGCTCTTAATCAGTTTCGTTACCT | 25 | 223 |
| ERBB4 | NM_005235 | S1232/ERBB4.r3 | CAAGGCATATCGATCCTCATAAAGT | 25 | 224 |
| ERBB4 | NM_005235 | S4891/ERBB4.p3 | TGTCCCACGAATAATGCGTAAATTCTCCAG | 30 | 225 |
| EREG | NM_001432 | S0670/EREG.f1 | ATAACAAAGTGTAGCTCTGACATGAATG | 28 | 226 |
| EREG | NM_001432 | S0671/EREG.r1 | CACACCTGCAGTAGTTTTGACTCA | 24 | 227 |
| EREG | NM001432 | S4772/EREG.p1 | TTGTTTGCATGGACAGTGCATCTATCTGGT | 30 | 228 |
| ERK1 | Z11696 | S1560/ERK1.f3 | ACGGATCACAGTGGAGGAAG | 20 | 229 |
| ERK1 | Z11696 | S1561/ERK1.r3 | CTCATCCGTCGGGTCATAGT | 20 | 230 |
| ERK1 | Z11696 | S4882/ERK1.p3 | CGCTGGCTCACCCCTACCTG | 20 | 231 |
| fas | NM_000043 | S0118/fas.f1 | GGATTGCTCAACAACCATGCT | 21 | 232 |
| fas | NM_000043 | S0120/fas.r1 | GGCATTAACACTTTTGGACGATAA | 24 | 233 |
| fas | NM_000043 | S5003/fas.p1 | TCTGGACCCTCCTACCTCTGGTTCTTACGT | 30 | 234 |
| FRP1 | NM_003012 | S1804/FRP1.f3 | TTGGTACCTGTGGGTTAGCA | 20 | 235 |
| FRP1 | NM_003012 | S1805/FRP1.r3 | CACATCCAAATGCAAACTGG | 20 | 236 |
| FRP1 | NM_003012 | S4983/FRP1.p3 | TCCCCAGGGTAGAATTCAATCAGAGC | 26 | 237 |
| GPC3 | NM_004484 | S1835/GPC3.f1 | TGATGCGCCTGGAAACAGT | 19 | 238 |
| GPC3 | NM_004484 | S1836/GPC3.r1 | CGAGGTTGTGAAAGGTGCTTATC | 23 | 239 |
| GPC3 | NM_004484 | S5036/GPC3.p1 | AGCAGGCAACTCCGAAGGACAACG | 24 | 240 |
| GRO1 | NM_001511 | S0133/GRO1.f2 | CGAAAAGATGCTGAACAGTGACA | 23 | 241 |
| GRO1 | NM_001511 | S0135/GRO1.r2 | TCAGGAACAGCCACCAGTGA | 20 | 242 |
| GRO1 | NM_001511 | S5006/GRO1.p2 | CTTCCTCCTCCCTTCTGGTCAGTTGGAT | 28 | 243 |
| GUS | NM_000181 | S0139/GUS.f1 | CCCACTCAGTAGCCAAGTCA | 20 | 244 |
| GUS | NM_000181 | S0141/GUS.r1 | CACGCAGGTGGTATCAGTCT | 20 | 245 |
| GUS | NM_000181 | S4740/GUS.p1 | TCAAGTAAACGGGCTGTTTTCCAAACA | 27 | 246 |
| HB-EGF | NM_001945 | S0662/HB-EGF.f1 | GACTCCTTCGTCCCCAGTTG | 20 | 247 |
| HB-EGF | NM_001945 | S0663/HB-EGF.r1 | TGGCACTTGAAGGCTCTGGTA | 21 | 248 |
| HB-EGF | NM_001945 | S4787/HB-EGF.p1 | TTGGGCCTCCCATAATTGCTTTGCC | 25 | 249 |
| HER2 | NM_004448 | S0142/HER2.f3 | CGGTGTGAGAAGTGCAGCAA | 20 | 250 |
| HER2 | NM_004448 | S0144/HER2.r3 | CCTCTCGCAAGTGCTCCAT | 19 | 251 |
| HER2 | NM_004448 | S4729/HER2.p3 | CCAGACCATAGCACACTCGGGCAC | 24 | 242 |
| HGF | M29145 | S1327/HGF.f4 | CCGAAATCCAGATGATGATG | 20 | 253 |
| HGF | M29145 | S1328/HGF.r4 | CCCAAGGAATGAGTGGATTT | 20 | 254 |
| HGF | M29145 | S4901/HGF.p4 | CTCATGGACCCTGGTGCTACACG | 23 | 255 |
| ID1 | NM_002165 | S0820/ID1.f1 | AGAACCGCAAGGTGAGCAA | 19 | 256 |
| ID1 | NM_002165 | S0821/ID1.r1 | TCCAACTGAAGGTCCCTGATG | 21 | 257 |
| ID1 | NM_002165 | S4832/ID1.p1 | TGGAGATTCTCCAGCACGTCATCGAC | 26 | 258 |
| IGF1R | NM_000875 | S1249/IGF1R.f3 | GCATGGTAGCCGAAGATTTCA | 21 | 259 |
| IGF1R | NM_000875 | S1250/IGF1R.r3 | TTTCCGGTAATAGTCTGTCTCATAGATATC | 30 | 260 |
| IGF1R | NM_000875 | S4895/IGF1R.p3 | CGCGTCATACCAAAATCTCCGATTTTGA | 28 | 261 |
| IGFBP3 | NM_000598 | S0157/IGFBP3.f3 | ACGCACCGGGTGTCTGA | 17 | 262 |
| IGFBP3 | NM_000598 | S0159/IGFBP3.r3 | TGCCCTTTCTTGATGATGATTATC | 24 | 263 |
| IGFBP3 | NM_000598 | S5011/IGFBP3.p3 | CCCAAGTTCCACCCCCTCCATTCA | 24 | 264 |
| IRS1 | NM_005544 | S1943/IRS1.f3 | CCACAGCTCACCTTCTGTCA | 20 | 265 |
| IRS1 | NM_005544 | S1944/IRS1.r3 | CCTCAGTGCCAGTCTCTTCC | 20 | 266 |
| IRS1 | NM_005544 | S5050/IRS1.p3 | TCCATCCCAGCTCCAGCCAG | 20 | 267 |
| ITGA3 | NM_002204 | S2347/ITGA3.f2 | CCATGATCCTCACTCTGCTG | 20 | 268 |
| ITGA3 | NM_002204 | S2348/ITGA3.r2 | GAAGCTTTGTAGCCGGTGAT | 20 | 269 |
| ITGA3 | NM_002204 | S4852/ITGA3.p2 | CACTCCAGACCTCGCTTAGCATGG | 24 | 270 |
| ITGB3 | NM_000212 | S3126/ITGB3.f1 | ACCGGGAGCCCTACATGAC | 19 | 271 |
| ITGB3 | NM_000212 | S3127/ITGB3.r1 | CCTTAAGCTCTTTCACTGACTCAATCT | 27 | 272 |
| ITGB3 | NM_000212 | S3243/ITGB3.p1 | AAATACCTGCAACCGTTACTGCCGTGAC | 28 | 273 |
| KRT17 | NM_000422 | S0172/KRT17.f2 | CGAGGATTGGTT.CTTCAGCAA | 21 | 274 |
| KRT17 | NM_000422 | S0174/KRT17.r2 | ACTCTGCACCAGCTCACTGTTG | 22 | 275 |
| KRT17 | NM_000422 | S5013/KRT17.p2 | CACCTCGCGGTTCAGTTCCTCTGT | 24 | 276 |
| LAMC2 | NM_005562 | S2826/LAMC2.f2 | ACTCAAGCGGAAATTGAAGCA | 21 | 277 |
| LAMC2 | NM_005562 | S2827/LAMC2.r2 | ACTCCCTGAAGCCGAGACACT | 21 | 278 |
| LAMC2 | NM_005562 | S4969/LAMC2.p2 | AGGTCTTATCAGCACAGTCTCCGCCTCC | 28 | 278 |
| MTA1 | NM_004689 | S2369/MTA1.f1 | CCGCCCTCACCTGAAGAGA | 19 | 280 |
| MTA1 | NM_004689 | S2370/MTA1.r1 | GGAATAAGTTAGCCGCGCTTCT | 22 | 281 |
| MTA1 | NM_004689 | S4855/MTA1.p1 | CCCAGTGTCCGCCAAGGAGCG | 21 | 282 |
| NMYC | NM_005378 | S2884/NMYC.f2 | TGAGCGTCGCAGAAACCA | 18 | 283 |
| NMYC | NM_005378 | S2885/NMYC.r2 | TCCCTGAGCGTGAGAAAGCT | 20 | 284 |
| NMYC | NM_005378 | S4976/NMYC.p2 | CCAGCGCCGCAACGACCTTC | 20 | 285 |
| p14ARF | NM_000077 | S0199/p14ARF.f3 | GCGGAAGGTCCCTCAGACA | 19 | 286 |
| p14ARF | NM_000077 | S0201/p14ARF.r3 | TCTAAGTTTCCCGAGGTTTCTCA | 23 | 287 |
| p14ARF | NM_000077 | S5068/p14ARF.p3 | CCCCGATTGAAAGAACCAGAGAGGCT | 26 | 288 |
| p27 | NM_004064 | S0205/p27.f3 | CGGTGGACCACGAAGAGTTAA | 21 | 289 |
| p27 | NM_004064 | S0207/p27.r3 | GGCTCGCCTCTTCCATGTC | 19 | 290 |
| p27 | NM_004064 | S4750/p27.p3 | CCGGGACTTGGAGAAGCACTGCA | 23 | 291 |
| P53 | NM_000546 | S0208/P53.f2 | CTTTGAACCCTTGCTTGCAA | 20 | 292 |
| P53 | NM_000546 | S0210/P53.r2 | CCCGGGACAAAGCAAATG | 18 | 293 |
| P53 | NM_000546 | S5065/P53.p2 | AAGTCCTGGGTGCTTCTGACGCACA | 25 | 294 |
| PAI1 | NM_000602 | S0211/PAI1.f3 | CCGCAACGTGGTTTTCTCA | 19 | 295 |
| PAI1 | NM_000602 | S0213/PAI1.r3 | TGCTGGGTTTCTCCTCCTGTT | 21 | 296 |
| PAI1 | NM_000602 | S5066/PAI1.p3 | CTCGGTGTTGGCCATGCTCCAG | 22 | 297 |
| PDGFA | NM_002607 | S0214/PDGFA.f3 | TTGTTGGTGTGCCCTGGTG | 19 | 298 |
| PDGFA | NM_002607 | S0216/PDGFA.r3 | TGGGTTCTGTCCAAACACTGG | 21 | 299 |
| PDGFA | NM_002607 | S5067/PDGFA.p3 | TGGTGGCGGTCACTCCCTCTGC | 22 | 300 |
| PDGFB | NM_002608 | S0217/PDGFB.f3 | ACTGAAGGAGACCCTTGGAG | 20 | 301 |
| PDGFB | NM_002608 | S0219/PDGFB.r3 | TAAATAACCCTGCCCACACA | 20 | 302 |
| PDGFB | NM_002608 | S5014/PDGFB.p3 | TCTCCTGCCGATGCCCCTAGG | 21 | 303 |
| PGK1 | NM_000291 | S0232/PGK1.f1 | AGAGCCAGTTGCTGTAGAACTCAA | 24 | 304 |
| PGK1 | NM_000291 | S0234/PGK1.r1 | CTGGGCCTACACAGTCCTTCA | 21 | 305 |
| PGK1 | NM_000291 | S5022/PGK1.p1 | TCTCTGCTGGGCAAGGATGTTCTGTTC | 27 | 306 |
| PLAUR | NM_002659 | S1976/PLAUR.f3 | CCCATGGATGCTCCTCTGAA | 20 | 307 |
| PLAUR | NM_002659 | S1977/PLAUR.r3 | CCGGTGGCTACCAGACATTG | 20 | 308 |
| PLAUR | NM_002659 | S5054/PLAUR.p3 | CATTGACTGCCGAGGCCCCATG | 22 | 309 |
| PPARG | NM_005037 | S3090/PPARG.f3 | TGACTTTATGGAGCCCAAGTT | 21 | 310 |
| PPARG | NM_005037 | S3091/PPARG.r3 | GCCAAGTCGCTGTCATCTAA | 20 | 311 |
| PPARG | NM_005037 | S4824/PPARG.p3 | TTCCAGTGCATTGAACTTCACAGCA | 25 | 312 |
| PTPD1 | NM_007039 | S3069/PTPD1.f2 | CGCTTGCCTAACTCATACTTTCC | 23 | 313 |
| PTPD1 | NM_007039 | S3070/PTPD1.r2 | CCATTCAGACTGCGCCACTT | 20 | 314 |
| PTPD1 | NM_007039 | S4822/PTPD1.p2 | TCCACGCAGCGTGGCACTG | 19 | 315 |
| RANBP2 | NM_006267 | S3081/RANBP2.f3 | TCCTTCAGCTTTCACACTGG | 20 | 316 |
| RANBP2 | NM_006267 | S3082/RANBP2.r3 | AAATCCTGTTCCCACCTGAC | 20 | 317 |
| RANBP2 | NM_006267 | S4823/RANBP2.p3 | TCCAGAAGAGTCATGCAACTTCATTTCTG | 29 | 318 |
| RASSF1 | NM_007182 | S2393/RASSF1.f3 | AGTGGGAGACACCTGACCTT | 20 | 319 |
| RASSF1 | NM_007182 | S2394/RASSF1.s3 | TGATCTGGGCATTGTACTCC | 20 | 320 |
| RASSF1 | NM_007182 | S4909/RASSFl.p3 | TTGATCTTCTGCTCAATCTCAGCTTGAGA | 29 | 321 |
| RB1 | NM_000321 | S2700/RB1.f1 | CGAAGCCCTTACAAGTTTCC | 20 | 322 |
| RB1 | NM_000321 | S2701/RB1.r1 | GGACTCTTCAGGGGTGAAAT | 20 | 323 |
| RB1 | NM_000321 | S4765/RB1.p1 | CCCTTACGGATTCCTGGAGGGAAC | 24 | 324 |
| RIZ1 | NM_012231 | S1320/RIZ1.f2 | CCAGACGAGCGATTAGAAGC | 20 | 325 |
| RIZ1 | NM_012231 | S1321/RIZ1.r2 | TCCTCCTCTTCCTCCTCCTC | 20 | 326 |
| RIZ1 | NM_012231 | S4761/RIZ1.p2 | TGTGAGGTGAATGATTTGGGGâGA | 23 | 327 |
| RPLPO | NM_001002 | S0256/RPLPO.f2 | CCATTCTATCATCAACGGGTACAA | 24 | 328 |
| RPLPO | NM_001002 | S0258/RPLPO.r2 | TCAGCAAGTGGGAAGGTGTAATC | 23 | 329 |
| RPLPO | NM_001002 | S4744/RPLPO.p2 | TCTCCACAGACAAGGCCAGGACTCG | 25 | 330 |
| SPRY2 | NM_005842 | S2985/SPRY2.f2 | TGTGGCAAGTGCAAATGTAA | 20 | 331 |
| SPRY2 | NM_005842 | S2986/SPRY2.r2 | GTCGCAGATCCAGTCTGATG | 20 | 332 |
| SPRY2 | NM_005842 | S4811/SPRY2.p2 | CAGAGGCCTTGGGTAGGTGCACTC | 24 | 333 |
| Src | NM_004383 | S1820/Src.f2 | CCTGAACATGAAGGAGCTGA | 20 | 334 |
| Src | NM_004383 | S1821/Src.r2 | CATCACGTCTCCGAACTCC | 19 | 335 |
| Src | NM_004383 | S5034/Src.p2 | TCCCGATGGTCTGCAGCAGCT | 21 | 336 |
| STK15 | NM_003600 | S0794/STK15.f2 | CATCTTCCAGGAGGACCACT | 20 | 337 |
| STK15 | NM_003600 | S0795/STK15.r2 | TCCGACCTTCAATCATTTCA | 20 | 338 |
| STK15 | NM_003600 | S4745/STK15.p2 | CTCTGTGGCACCCTGGACTACCTG | 24 | 339 |
| SURV | NM_001168 | S0259/SURV.f2 | TGTTTTGATTCCCGGGCTTA | 20 | 340 |
| SURV | NM_001168 | S0261/SURV.r2 | CAAAGCTGTCAGCTCTAGCAAAAG | 24 | 341 |
| SURV | NM_001168 | S4747/SURV.p2 | TGCCTTCTTCCTCCCTCACTTCTCACCT | 28 | 342 |
| TERC | U86046 | S2709/TERC.f2 | AAGAGGAACGGAGCGAGTC | 19 | 343 |
| TERC | U86046 | S2710/TERC.r2 | ATGTGTGAGCCGAGTCCTG | 19 | 344 |
| TERC | U86046 | S4958/TERC.p2 | CACGTCCCACAGCTCAGGGAATC | 23 | 345 |
| TFRC | NM_003234 | S1352/TFRC.f3 | GCCAACTGCTTTCATTTGTG | 20 | 346 |
| TFRC | NM_003234 | S1353/TFRC.r3 | ACTCAGGCCCATTTCCTTTA | 20 | 347 |
| TFRC | NM_003234 | S4748/TFRC.p3 | AGGGATCTGAACCAATACAGAGCAGACA | 28 | 348 |
| TGFBR2 | NM_003242 | S2422/TGFBâR213 | AACACCAATGGGTTCCATCT | 20 | 349 |
| TGFBR2 | NM_003242 | S2423/TGFBR2.r3 | CCTCTTCATCAGGCCAAACT | 20 | 350 |
| TGFBR2 | NM_003242 | S4913/TGFBR2.p3 | TTCTGGGCTCCTGATTGCTCAAGC | 24 | 351 |
| TIMP2 | NM_003255 | S1680/TIMP2.f1 | TCACCCTCTGTGACTTCATCGT | 22 | 352 |
| TIMP2 | NM_003255 | S1681/TIMP2.r1 | TGTGGTTCAGGCTCTTCTTCTG | 22 | 353 |
| TIMP2 | NM_003255 | S4916/TIMP2.p1 | CCCTGGGACACCCTGAGCACCA | 22 | 354 |
| TITF1 | NM_003317 | S2224/TITF1.f1 | CGACTCCGTTCTCAGTGTCTGA | 22 | 355 |
| TITF1 | NM_003317 | S2225/TITF1.r1 | CCCTCCATGCCCACTTTCT | 19 | 356 |
| TITF1 | NM_003317 | S4829/TITF1.p1 | ATCTTGAGTCCCCTGGAGGAAAGC | 24 | 357 |
| TP53BP1 | NM_005657 | S1747/TP53BP.f2 | TGCTGTTGCTGAGTCTGTTG | 20 | 358 |
| TP53BP1 | NM_005657 | S1748/TP53BP.r2 | CTTGCCTGGCTTCACAGATA | 20 | 359 |
| TP53BP1 | NM_005657 | S4924/TP53BP.p2 | CCAGTCCCCAGAAGACCATGTCTG | 24 | 360 |
| upa | NM_002658 | S0283/upa.f3 | GTGGATGTGCCCTGAAGGA | 19 | 361 |
| upa | NM_002658 | S0285/upa.r3 | CTGCGGATCCAGGGTAAGAA | 20 | 362 |
| upa | NM_002658 | S4769/upa.p3 | AAGCCAGGCGTCTACACGAGAGTCTCAC | 28 | 363 |
| VEGFC | NM_005429 | S2251/VEGFC.f1 | CCTCAGCAAGACGTTATTTGAAATT | 25 | 364 |
| VEGFC | NM_005429 | S2252/VEGFC.r1 | AAGTGTGATTGGCAAAACTGATTG | 24 | 365 |
| VEGFC | NM_005429 | S4758/VEGFC.p1 | CCTCTCTCTCAAGGCCCCAAACCAGT | 26 | 366 |
| XIAP | NM_001167 | S0289/XIAP.f1 | GCAGTTGGAAGACACAGGAAAGT | 23 | 367 |
| XIAP | NM_001167 | S0291/XIAP.r1 | TGCGTGGCACTATTTTCAAGA | 21 | 368 |
| XIAP | NM_001167 | S4752/XIAP.p1 | TCCCCAAATTGCAGATTTATCAACGGC | 27 | 369 |
| YB-1 | NM_004559 | S1194/YB-1.f2 | AGACTGTGGAGTTTGATGTTGTTGA | 25 | 370 |
| YB-1 | NM_004559 | S1195/YB-1.r2 | GGAACACCACCAGGACCTGTAA | 22 | 371 |
| YB-1 | NM_004559 | S4843/YB-1.p2 | TTGCTGCCTCCGCACCCTTTTCT | 23 | 372 |
1-55. (canceled)
56. A method for predicting the likelihood that a human colon cancer patient will exhibit a clinically beneficial patient response to treatment with an EGFR inhibitor, the method comprising:
a) assaying a normalized level of an RNA transcript in a sample comprising EGFR-expressing colon cancer cells obtained from said patient, wherein the RNA transcript is the transcript of KRT17;
b) analyzing the normalized level of the KRT17 RNA transcript; and
c) predicting the likelihood of response of the patient to treatment with the EGFR inhibitor, wherein an increased normalized level of the KRT17 RNA transcript correlates with a decreased likelihood of response to treatment with the EGFR inhibitor.
57. The method of claim 56, wherein said sample is a tissue sample.
58. The method of claim 57, wherein the tissue sample is fixed, paraffin-embedded, fresh, or frozen.
59. The method of claim 57, wherein the tissue sample is derived from fine needle, core, or other types of biopsy.
60. The method of claim 56, wherein the EGFR inhibitor is an anti-EGFR monoclonal antibody.
61. The method of claim 60, wherein the anti-EGFR monoclonal antibody is cetuximab.
62. The method of claim 56, wherein the EGFR inhibitor is a small molecule tyrosine-kinase inhibitor.
63. The method of claim 62, wherein the small molecule tyrosine kinase inhibitor is gefitinib or erlotinib.
64. The method of claim 56, further comprising the step of preparing a report comprising a prediction of the likelihood that the patient will respond to treatment with the EGFR inhibitor.
65. The method of claim 56, wherein the normalized level of the KRT17 RNA transcript is determined using reverse transcription polymerase chain reaction (RT-PCR).
66. The method of claim 56, wherein the normalized level of the KRT17 RNA transcript is determined using an array comprising polynucleotides hybridizing to a KRT17 gene immobilized on a solid surface.
67. The method of claim 56, wherein RNA is isolated from colon cancer cells present in a fixed, paraffin-embedded tissue by a procedure comprising:
(a) incubating one or more sections of said fixed, paraffin-embedded tissue at a temperature of about 56° C. to 70° C. in a lysis buffer, in the presence of a protease, without prior dewaxing, to form a lysis solution;
(b) cooling the lysis solution to a temperature where the paraffin solidifies, thereby generating a cooled lysis solution; and
(c) isolating the RNA from said cooled lysis solution.