US20120233717A1
2012-09-13
13/122,399
2010-06-24
US 8,742,085 B2
2014-06-03
WO; PCT/CN2010/000943; 20100624
WO; WO2011/085528; 20110721
Quang Nguyen
Knobbe, Martens, Olson & Bear, LLP
2030-06-24
A method for preparing a transgenic animal of simultaneous multiple-gene expression is provided. Additionally, a method for preparing a transgenic embryo, which introduces both phytase gene and human myxovirus resistant gene A into a target embryo, to obtain a transgenic embryo is provided. The transgenic animal of simultaneous multiple-gene expression can be achieved by transplanting the transgenic embryo into the body of a female target animal. A significant advantage of the foregoing methods, among many others, exists in that the simultaneous expression of multiple genes can be achieved in one transgenosis, which provides a convenient mean for the preparation of combined-gene transferred animals etc.
Get notified when new applications in this technology area are published.
C12N9/16 » CPC main
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Hydrolases (3) acting on ester bonds (3.1)
A01K67/0275 » CPC further
Rearing or breeding animals, not otherwise provided for; New breeds of animals; New breeds of vertebrates Genetically modified vertebrates, e.g. transgenic
C07K14/435 » CPC further
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
A01K2217/052 » CPC further
Genetically modified animals; Animals comprising random inserted nucleic acids (transgenic) inducing gain of function
A01K2227/108 » CPC further
Animals characterised by species; Mammal Swine
A01K2267/02 » CPC further
Animals characterised by purpose Animal zootechnically ameliorated
C12N5/10 IPC
Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor Cells modified by introduction of foreign genetic material
A01K67/027 IPC
Rearing or breeding animals, not otherwise provided for; New breeds of animals New breeds of vertebrates
C07H21/04 IPC
Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
C12N15/00 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
The present invention relates to the field of biotechnology, especially relates to a method for preparing a transgenic animal of simultaneous multiple-gene expression.
In the research of traditional preparation of transgenic animals, the research is usually achieved by means of eukaryotic expression vectors. After a target gene fragment is linked downstream of a eukaryotic promoter and is integrated into a cellular genome by molecular biological means, the expression of the exogenous gene can be directed. The method is broadly used in the research of genetic expression and function. Traditional transgenic methods only integrate one target gene per transgenosis, and thereby prepare a transgenic animal expressing one gene. In case that the preparation of a transgenic animal of multiple genes is concerned, it needs to prepare corresponding transgenic animals of single gene separately, and then prepare the progenies of multiple transgenic animals by the method of mating between transgenic animals and the like. Such method for preparing polygenic animals takes time and work, and costs much.
The object of the present invention is to provide a method for preparing a transgenic embryo.
In the method for preparing a transgenic embryo provided in the invention, both of phytase gene and human myxovirus resistant gene A are introduced into a target embryo to obtain a transgenic embryo.
The nucleotide sequence of aforementioned phytase gene is presented as positions 1360-2658 from 5′-terminal of SEQ ID NO. 1 in the Sequence Listing. The nucleotide sequence of aforementioned human myxovirus resistant gene A is presented as positions 3803-5791 from 5′-terminal of SEQ ID NO. 1 in the Sequence Listing.
Specifically, aforementioned phytase gene and human myxovirus resistant gene A can be introduced into the embryo by a DNA fragment with nucleotide to sequence presented as SEQ ID NO. 1 in the Sequence Listing.
Aforementioned embryo is an embryo in pronuclear stage.
Aforementioned embryo is an embryo of any animal except human, which may specifically be an embryo of pig, cattle, sheep, cat, dog, rabbit or murine.
Another purpose of the present invention exists in provision of a method for cultivating a transgenic animal.
In the method for cultivating a transgenic animal provided in the present invention, the transgenic embryo prepared by the aforementioned method for preparing a transgenic embryo is transplanted into the body of a female target animal to obtain a transgenic animal capable of expressing multiple genes simultaneously.
Aforementioned target animal can be any animal except human, which may specifically be a pig, cattle, sheep, cat, dog, rabbit or murine.
FIG. 1: The gel electrophoresis image of amplified appA.
FIG. 2: The profile of plasmid pcDNA-appA.
FIG. 3: The gel electrophoresis image of amplified MxA.
FIG. 4: The profile of plasmid pcDNA-MxA.
FIG. 5: The profile of plasmid pcDNA-appA-MxA.
FIG. 6: The quantitative detection for the expression of appA and MxA in embryo after the microinjection of AMP gene.
FIG. 7: The PCR detection for the exogenous gene of AMP transgenic pigs.
FIG. 8: The SOUTHERN BLOT detection for the exogenous gene of AMP transgenic pigs.
FIG. 9: The quantitative detection for the expression of appA and MxA.
Hereinafter, the present invention will be further described in combination with specific examples. However, the present invention is not limited to the following examples.
In the following examples, conventional methods are used, unless indicated otherwise.
(1) Preparation of Eukaryotic Expression Vector pcDNA-appA
Using Escherichia coli DH5α (commercially available from Beijing TransGen Biotech Co. Ltd., Catalog No. CD201) as template, the fragments of phytase gene (appA) are amplified with the primers for appA amplification listed in Table 1. The reaction system is 50 μL, which contains 5 μL of 10× Buffer, 8 μL of 2.5 mM dNTP, 1 μL of 20 μM primer appA-L1, 1 μL of 20 μM primer appA-R1 (see Table 1 for the sequences of the primers), 0.5 μL of 5 U/μL high-fidelity Tag polymerase, and 2 μl of Escherichia coli DH5α as template, added up to 50 μL with ultra-pure water (the high-fidelity enzyme is commercially available from Takara Biotechnology (Dalian) Co. Ltd., Catalog No. DR010A). The procedure of PCR amplification: 98 for 10 s and 68° C. for 2 min, 30 cycles. The PCR amplified products are detected with 1% agarose gel electrophoresis (as shown in FIG. 1).
The PCR products are recovered and purified using QIAGEN agarose gel kit (see the kit for the operating steps), and the products purified are cut by two enzymes of HindIII and EcoR I. Meanwhile, pcDNA3.1(+) vectors (commercially available from Invitrogen Corporation) are cut by two enzymes of HindIII and EcoR I. The PCR amplified products and cleaved vectors are linked (the ligase is commercially available from Promega Corporation, Catalog No. M1804). The competent Escherichia coli DH5α (commercially available from Beijing TransGen Biotech Co., Ltd., Catalog No. CD201) is transformed according to the operating steps required by the manufacture. The DH5α liquid is coated onto an agarose gel plate, and cultivated at 37° C. in an incubator overnight. A single colony is picked and inoculated into a liquid LB medium for culture, and part of the DH5α liquid is sent to Invitrogen Beijing Office for sequencing. The vectors in which appA (the nucleotide sequence is presented as positions 1360-2658 from 5′-terminal of SEQ ID NO. 1 in the Sequence Listing) is demonstrated to be contained by sequencing results are selected, and the plasmids are extracted for use. The plasmid demonstrated to be correct by sequencing is named as plasmid pcDNA-appA (the profile of the plasmid is shown in FIG. 2).
(2) Preparation of Eukaryotic Expression Vector pcDNA-MxA
Using human cDNA (obtained from the extraction of total RNA from the human blood ex vivo, and reverse transcription) as template, the fragments of human myxovirus resistant gene A (M×A) are amplified with the primers for MxA amplification listed in Table 1. The reaction system is 50 μL, containing 5 μL of 10× Buffer, 8 μL of 2.5 mM dNTP, 1 μL of 20 μM primer Mx-L1, 1 μL of 20 μM primer Mx-R1 (see Table 1 for the sequences), 0.5 μL of 5 U/μL high-fidelity Tag polymerase, and 100 ng of human cDNA as template, added up to 50 μL with ultra-pure water (the high-fidelity enzyme is commercially available from Takara Biotechnology (Dalian) Co. Ltd., Catalog No. DR010A). The procedure of PCR amplification: 98° C. for 10 s and 68° C. for 2 min, 30 cycles. The PCR amplified products are detected with 1% agarose gel electrophoresis (FIG. 3).
The PCR products are recovered and purified using QIAGEN agarose gel kit (see the kit for the operating steps), and the products purified are cut by two enzymes of HindIII and EcoR I. Meanwhile, pcDNA3.1(+) vectors (commercially available from Invitrogen Corporation) are cut by two enzymes of HindIII and EcoR I. The PCR amplified products and cleaved vectors are linked (the ligase is commercially available from Promega Corporation, Catalog No. M1804). The competent Escherichia coli DH5α (commercially available from Beijing TransGen Biotech Co., Ltd., Catalog No. CD201) is transformed according to the operating steps required by the manufacture. The DH5α liquid is coated onto an agarose gel plate, and cultivated at 37° C. in an incubator overnight. A single colony is picked and inoculated into a liquid LB medium for culture, and part of the DH5α liquid is sent to Invitrogen Beijing Office for sequencing. The vectors in which MxA fragment (the nucleotide sequence is presented as positions 3803-5791 from 5′-terminal of SEQ ID NO. 1 in the Sequence Listing) is demonstrated to be contained by sequencing results are selected, and the plasmids are extracted for use. The plasmid demonstrated to be correct by sequencing is named as plasmid pcDNA-MxA (the profile of the plasmid is shown in FIG. 4).
Using aforementioned pcDNA-appA (the profile of the plasmid is shown as in FIG. 2) as template, the corresponding components as listed in Table 1 are amplified with the primers listed in Table 1. 5 μL of 10× Buffer, 8 μL of 2.5 mM dNTP, 1 μL of 20 μM primer CMV-appA-L1, 1 μL of 20 μM primer CMVappA-R1 (see Table 1 for the sequences), 0.5 μL of 5 U/μL high-fidelity Tag polymerase, and 100 ng of plasmid pcDNA-appA, are added up to 50 μL with ultra-pure water (the high-fidelity enzyme is commercially available from Takara Biotechnology (Dalian) Co. Ltd., Catalog No. DR010A). The procedure of PCR amplification: 98° C. for 10 s and 68° C. for 3 min, 30 cycles. The PCR amplified products are detected with 1% agarose gel electrophoresis. Part of the PCR products are sequenced (Invitrogen Corporation), demonstrating that fragment CMV-appA-BGH pA (the nucleotide sequence is presented as positions 618-2977 from 5′-terminal of SEQ ID NO. 1 in the Sequence Listing) is obtained from amplification. The fragment CMV-appA-BGH pA is comprised of promoter CMV, appA and terminator BGH concatenated in turn; with promoter CMV (the nucleotide sequence is presented as positions 671-1358 from 5′-terminal of SEQ ID NO. 1 in the Sequence Listing), appA (the nucleotide sequence is presented as positions 1360-2658 from 5′-terminal of SEQ ID NO. 1 in the Sequence Listing) and terminator BGH (the nucleotide sequence is presented as positions 2735-2959 from 5′-terminal of SEQ ID NO. 1 in the Sequence Listing).
Aforementioned PCR products of CMV-appA-BGH pA fragment are recovered and purified with QIAGEN agarose gel kit (see the kit for the operating steps), and the products purified are cut by Mlu I enzyme. Meanwhile, plasmid pcDNA-MxA is cut with single enzyme of Mlu I. The PCR amplified products and cleaved vectors are linked (the ligase is commercially available from Promega Corporation, Catalog No. M1804). The competent Escherichia coli DH5α (commercially available from Beijing TransGen Biotech Co., Ltd., Catalog No. CD201) is transformed according to the operating steps required by the manufacture. The DH5α liquid is coated onto an agarose gel plate, and cultivated at 37° C. in an incubator overnight.
A single colony is picked and inoculated into a liquid LB medium for culture. PCR is used to detect fragment CMV-appA-BGH pA in inserted fragment for DH5α liquid (the amplification system is the same as above part of the amplification of fragment CMV-appA-BGH pA (the primers are seen in Table 1), wherein the template is changed to be 2 μL of DH5α liquid). As a result, there presents corresponding amplified band of fragment CMV-appA-BGH pA. Parts of the DH5α liquid of both samples described above are sent to Invitrogen Beijing Office for sequencing. The result shows that the recombinant expression vectors containing fragment CMV-appA-BGH pA and expression cassette MxA are obtained. Such vector is named as pcDNA-appA-MxA, abbreviated to AMP. The profile of plasmid of AMP is shown as FIG. 5.
The sequencing shows that AMP has the nucleotide sequence of SEQ ID NO. 1 in the Sequence Listing, which sequence contains expression cassettes of appA and MxA.
Wherein, expression cassette appA is comprised of promoter CMV (the nucleotide sequence is presented as positions 671-1358 from 5′-terminal of SEQ ID NO. 1 in the Sequence Listing), appA (the nucleotide sequence is presented as positions 1360-2658 from 5′-terminal of SEQ ID NO. 1 in the Sequence Listing) and terminator BGH (the nucleotide sequence is presented as positions 2735-2959 from 5′-terminal of SEQ ID NO. 1 in the Sequence Listing) concatenated in turn; expression cassette MxA is comprised of promoter CMV (the nucleotide sequence is presented as positions 3114-3802 from 5′-terminal of SEQ ID NO. 1 in the Sequence Listing), MxA (the nucleotide sequence is presented as positions 3803-5791 from 5′-terminal of SEQ ID NO. 1 in the Sequence Listing) and terminator BGH (the nucleotide sequence is presented as positions 5868-6092 from 5′-terminal of SEQ ID NO. 1 in the Sequence Listing) concatenated in turn.
1. The pcDNA-appA-MxA obtained from Step I is cut by two enzymes of ScaI (commercially available from Fermentas Corporation, Catalog No. ER0431) and SmaI (commercially available from Fermentas Corporation, Catalog No. ER0661). Then, agarose gel electrophoresis is used to recover the band of 6.9 Kb size, which is diluted to 5 ng/μl. The sequencing shows that the nucleotide sequence of the band of 6.9 Kb is presented as of SEQ ID NO. 1 in the Sequence Listing.
The linearized fragment of 6.9 Kb described above is injected into a porcine embryo in pronuclear stage using microinjection method to obtain the transgenic embryo, and cultivated in NCSU 23 medium (commercially available from Millipore Corporation, Catalog No. MR-182-D) to 8 cell stage.
Genomic DNA of part of the embryos is taken as template directly, and according to the operating instruction of ProtoScript M-MuLV Taq RT-PCR Kit (commercially available from NEB Corporation, Catalog No. E6400S) (the primers are the primers for quantitative PCR detection of appA and MxA as listed in Table 1), appA (the primers are appA-RTL1 and appA-RTR1 in Table 1) and MxA (the primers are hMx1-RTL1 and hMx1-RTR1 in Table 1) in embryos are directly detected. The reaction system of PCR is 50 μL, which contains 5 μL of 10× Buffer, 8 μL of 2.5 mM dNTP, 1 μL of 20 μM upstream primer, 1 μL of 20 μM downstream primer, 0.5 μL of 5 U/μL high-fidelity Tag polymerase, added up to 50 μL with ultra-pure water. The genomic DNA of small pigs obtained are used as template to be detected. The procedure of PCR amplification: 95° C. for 5 min; 94° C. for 20 s, annealing temperature of 56° C. and 72° C. for 1 min, 30 cycles, and finally extension at 72° C. for 5 min. The PCR amplified products are detected with 1.0% agarose gel electrophoresis, screening out the embryos in which genes appA and MxA may be amplified, respectively. The result shows that, among the 24 embryos detected, Nos. 13 and 17 of the embryos are detected to have the capacity of simultaneous expression of appA gene and MxA gene (FIG. 6).
The transgenic embryos prepared by the method of Example 1 are developed to 8 cell stage in vitro, and transplanted into the uterine horns of estrus synchronized sow through vaginal cervix in vitro. After cultivation, 38 transgenic pigs are obtained.
Using the primers for appA and MxA quantitative detection (see Table 1), the integration of corresponding genes in the genomic DNA of transgenic pigs and the integration condition of the exogenous genes in above transgenic pigs are detected.
The PCR reaction system and amplification system are the same as those of detection of the transgenic embryo in Step II of Example 1, screening out the pigs in which genes appA and MxA can be amplified respectively (FIG. 7) (in the figure, +: positive control, with plasmid pcDNA-appA-Mx as template; −: negative control, with DNA of normal pigs as template; 1-23: amplified bands of different transgenic porcine progenies).
As can be seen from upper part of FIG. 7, among the pigs of Nos. 1-23, the genomic DNA from the pigs of Nos. 3, 6, 11, 17, 20 and 22 may be amplified to obtain the band of about 355 bp, which is consistent with the expected appA amplification band. As can be seen from the lower part of FIG. 7, among the pigs of Nos. 1-23, the genomic DNA of pigs of Nos. 3, 6, 11, 17, 20 and 22 may be amplified to obtain the band of 325 bp, which is consistent with the expected MxA amplification band. The sequencing for amplified products indicates that the nucleotide sequences of the amplified fragments are all correct.
Using the primers for quantitative PCR detection of appA and MxA in Table 1 as primers respectively, the system is loaded according to the operating instruction of the kit. PCR processing procedure is as follows: 95° C. for 5 min, 94° C. for 45 s, 56° C. for 1 min and 72° C. for 1 min, 30 cycles, and subsequent extension at 72° C. for 10 min (the probe labeling kit is commercially available from Innogen-cn Corporation, Catalog No. DDLK-010), to obtain two PCR products.
The southern hybridization detection is performed using the aforementioned two PCR products as probe respectively. Before the hybridization, the PCR products are denatured at 95° C. for 5 minutes and then immediately placed into ice water for 10 minutes for use. The DNAs of the porcine auricular tissues of the transgenic pigs numbered as Nos. 3, 6, 11. 17, 20 and 22 as identified in Step 1 are extracted in large amount, and the genomes are cut by two enzymes of Hind III and Not I and the cleaved products of the genomes are concentrated to 300 ng/μl. The cleaved fragments are separated by 1% agarose gel electrophoresis, with the loading amount of 50 μL per well. Then DNAs are denatured in situ, and subsequently transferred onto a nylon film charged positively. According to the operating instruction of the kit, pre-hybridization, hybridization and X-ray film exposure for detecting hybridization signals (commercially available from Innogen-cn Corporation, Catalog No. DIGD-210) are performed. The result of detection (FIG. 8) shows that genes appA and MxA are integrated into the transgenic pigs numbered as Nos. 3, 6, 11, 17, 20 and 22 in southern hybridization detection.
100 μL of blood is collected from the porcine auricular veins of the transgenic pigs numbered as Nos. 3, 6, 11. 17, 20 and 22 screened out in Step II, from which the total RNA of each group of cells is extracted according to the operating instruction of Tiangen Blood Total RNA Extraction Kit (Catalog No. DP433). The total RNA extracted is reverse transcribed to cDNA according to TOYOBO Reverse Transcription Kit (Catalog No. FSK-100).
Using aforementioned cDNAs as template respectively, the semi-quantitative PCR detection of appA and MxA is conducted with the primers for quantitative PCR detection of appA and MxA in Table 1, wherein porcine GAPDH gene is used as internal reference (see Table 1 for the primers). The reaction system of PCR is 50 μL, which contains 5 μL of 10× Buffer, 8 μL of 2.5 mM dNTP, 1 μL of 20 μM upstream primer, 1 μL of 20 μM downstream primer (the primers used to amplify appA, MxA and porcine GAPDH are seen in Table 1, respectively), 0.5 μL of 5 U/μL high-fidelity Tag polymerase and 100 ng of template, added up to 50 μL with ultra-pure water.
The procedure of PCR amplification: 95° C. for 5 min; 94° C. for 20 s, annealing temperature of 56° C. and 72° C. for 1 min, and finally extension at 72° C. for 5 min, 23 cycles for amplification of internal reference GAPDH and 32 cycles for amplification of other templates.
The PCR amplified products are detected using 1.2% agarose gel electrophoresis (FIG. 9). The semi-quantitative result shows that the expression of MxA and appA can be found in both pigs of Nos. 3 and 20, indicating that both of genes MxA and appA can be simultaneously expressed in the corresponding transgenic pigs.
| TABLE 1 |
| Primers used for amplifying vector components in the present invention |
| Cleavage site | ||||
| Name of amplified | Primer | Product | introduced at | |
| fragment | symbol | Primer sequence | length | 5′-terminal |
| Fragment of | appA-L1 | CGCAAGCTTATGAAAGCGATC | 1299 | HindIII |
| Phytase (appA) | TTAATCCCA | (underlined) | ||
| appA-R1 | CACGAATTCTTACAAACTGCA | EcoRI | ||
| CGCCGGTATG | (underlined) | |||
| MxA fragment | Mx-L1 | AGCAAGCTTATGGTTGTTTCC | 1989 | HindIII |
| GAAGTGG | (underlined) | |||
| Mx-R1 | TATGAATTCCTAACCGGGGAA | EcoR I | ||
| CTGGGCA | ||||
| CMV-appA-B | CMVappA-L1 | ATCTGCTTAGGGTTAGGCGTT | 2358 | |
| GH pA fragment | TTGC | |||
| CMVappA-R1 | ataACGCGTTTCTTTCCGCCTC | MluI | ||
| AGAAGCC | (underlined) | |||
| quantitative PCR | appA-RTL1 | CGTGAGAAACAGGACGAAAG | 355 | — |
| detection of appA | appA-RTR1 | GCCGAGATTTGCCAGATTAG | — | |
| quantitative PCR | hMx1-RTL1 | GCATCCCACCCTCTATTAC | 325 | — |
| detection of Mx1 | hMx1-RTR1 | CCTTGCCTCTCCACTTATC | — | |
| quantitative | mGAPDH-L1 | TACACAGCCACTCAGAAGAC | 249 | — |
| PCR detection | mGAPDH-R1 | TTTCACAGCCTCCGTGATAG | — | |
| of Pig GAPDH | ||||
| as internal | ||||
| reference | ||||
The present invention prepares transgenic pig containing two genes (phytase gene (appA) and human myxovirus resistant gene A (MxA)) by using eukaryotic expression vector of spcDNA-appA-MxA expressing simultaneously phytase gene and human myxovirus resistant gene while construction, and using microinjection method. With the capacity of detection of transgenic pig and integration of two genes simultaneously, the significant advantage of the vector of the invention exists in that the simultaneous expression of multiple genes can be achieved in one transgenosis, which provides a convenient mean for the preparation of combined-gene transferred animals.
1. A method for preparing a transgenic embryo comprising:
introducing a nucleotide fragment comprising both phytase gene and human myxovirus resistant gene A into a target embryo to obtain a transgenic embryo.
2. A method according to claim 1, wherein the nucleotide sequence of the phytase gene comprises a sequence of positions 1360-2658 from 5′-terminal of SEQ ID NO. 1 in the Sequence Listing; and the nucleotide sequence of the human myxovirus resistant gene A comprises a sequence of positions 3803-5791 from 5′-terminal of SEQ ID NO. 1 in the Sequence Listing.
3. The method according to claim 2, wherein the phytase gene and the human myxovirus resistant gene A are introduced into the embryo by a DNA fragment with nucleotide sequence presented as SEQ ID NO. 1 in the Sequence Listing.
4. The method according to claim 1, wherein the embryo is an embryo in pronuclear stage.
5. The method according to claim 1, wherein the embryo is an embryo of a pig, cattle, sheep, cat, dog, rabbit or murine.
6. A method for cultivating a transgenic animal comprising:
transplanting the transgenic embryo prepared by the method of claim 1 into the body of a female target animal to obtain a transgenic animal capable of simultaneous multiple-gene expression.
7. The method according to claim 6, wherein the target animal is a pig, cattle, sheep, cat, dog, rabbit or murine.