US20120282614A1
2012-11-08
13/553,320
2012-07-19
The invention provides methods, nucleic acids and kits for detecting metastasis of colon cell proliferative disorders. The invention discloses genomic sequences the methylation patterns of which have utility for the improved detection of metastasis of colon cell proliferative disorders, thereby enabling the improved diagnosis and treatment of patients.
Get notified when new applications in this technology area are published.
C12Q1/6886 » CPC main
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
C12Q2600/112 » CPC further
Oligonucleotides characterized by their use Disease subtyping, staging or classification
C12Q2600/154 » CPC further
Oligonucleotides characterized by their use Methylation markers
C12Q2600/156 » CPC further
Oligonucleotides characterized by their use Polymorphic or mutational markers
C12Q2600/16 » CPC further
Oligonucleotides characterized by their use Primer sets for multiplex assays
C12Q1/68 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids
C07H21/04 IPC
Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
This application is a divisional application of U.S. application Ser. No. 13/091,455, filed Apr. 21, 2011, now pending, which is a divisional application of U.S. application Ser. No. 11/630,620 filed Dec. 7, 2007, now pending; which is a 35 USC §371 National Stage application of International Application No. PCT/US05/22391 filed Jun. 23, 2005; which claims the benefit under 35 USC §119(e) to U.S. Application Ser. No. 60/582,675 filed Jun. 23, 2004, now expired. The disclosure of each of the prior applications is considered part of and is incorporated by reference in the disclosure of this application.
1. Field of the Invention
Aspects of this invention relate to cancer and cancer progression and metastasis, and more particularly to colon cancer progression and metastasis and to novel methods and compositions for detection of colon cancer and progression and metastasis thereof.
2. Background Information
Colorectal cancer is one of the leading causes of cancer-related death throughout the world, it has a high 5-year mortality rate and 50% of the cases are advanced at the time of diagnosis. Advanced colon cancer is often accompanied by metastasis to peritoneum, lymph nodes or other organs. In recent years, a number of genetic and epigenetic alterations including allelic losses on specific chromosomal arms, mutations of oncogenes, tumor suppressor genes and mismatch repair genes, microsatellite instability in coding repeat sequences of target genes and methylation defects in gene promoters have been described in the tumorigenesis of colorectal cancers and a stepwise model of colorectal carcinogenesis has been proposed. However, the molecular mechanisms underlying the progression and the formation of metastasis of colon cancer are still largely unknown.
The adenomatous polyposis coli (APC) tumor suppressor gene, isolated and mapped to chromosomal band 5q21 (3,4), encodes a large 300 kDa protein with multiple cellular functions and interactions, including signal transduction in the Wnt-signalling pathway, mediation of intercellular adhesion, stabilization of the cytoskeleton and possibly regulation of the cell cycle and apoptosis. Germ-line mutations of the APC gene are associated with hereditary familial adenomatous polyposis (FAP), while somatic mutations in APC occur in Ë80% of sporadic colorectal tumors and appear very early in colorectal tumor progression.
Mutation is the most common and primary cause of APC inactivation in colorectal tumors.
DNA methylation is a powerful mechanism for the suppression of gene activity. This frequent epigenetic change in cancer involves aberrantly hypermethylated CpG islands in gene promoters, with loss of transcription of these genes.
A significant proportion of tumor-related genes, including well-characterized tumor suppressor genes (p16I, p15, p14, p73), DNA repair genes (hMLH1), and genes related to metastasis and invasion (CDH1, TIMP3, and DAPK) have been demonstrated to be silenced by methylation in a variety of cancers. Recently, hypermethylation of the APC promoter has also been described in a subset of colorectal adenomas and carcinomas and is considered to be an early step in the process of colorectal cancer pathogenesis.
Although genetic and epigenetic changes of the APC gene have been linked to the early development of colorectal cancer in previous studies, its role in colon cancer metastasis is still largely unknown. Blaker et al. compared the loss of heterozygosity (LOH) pattern of 5q in 15 cases of primary colorectal cancer and the corresponding metastatic liver tumours, and found that the LOH patterns of 5q in the primary and the metastatic tumours were identical in eight cases (Blaker, H., Graf, M., Rieker, R. J., Otto, H. F., Comparison of losses of heterozygosity and replication errors in primary colorectal carcinomas and corresponding liver metastases. J. Pathol., 188,258-262, 1999.). In a recent study, Zauber et al. reported that in their series of 42 colorectal cancers LOH at the APC locus was identical for 39 paired carcinomas and synchronous metastases (Zauber, P., Sabbath-Solitare, M., Marotta, S. P., Bishop, D. T., Molecular changes in the Ki-ras and APC genes in primary colorectal carcinoma and synchronous metastases compared with the findings in accompanying adenomas. Mol. Pathol., 56,137-140, 2003). These studies indicate that genetic changes of the APC gene in metastases are consistent with the primary colorectal cancer. However, epigenetic changes of the APC gene in colorectal cancer metastasis have not been explored yet.
The APC gene has two promoter regions, 1A and 1B; promoter 1A is most commonly active. Hypermethylation of the 1A promoter region of APC has previously been reported in some colorectal adenomas and carcinomas, but not in adjacent normal colonic mucosa. APC 1A promoter methylation has also been found in a number of other human gastrointestinal tumors, including oesophageal, gastric, pancreatic and hepatic cancers.
Bisulfate Modification of DNA is an Art-Recognized Tool Used to Assess CpG Methylation Status.
5-methylcytosine is the most frequent covalent base modification in the DNA of eukaryotic cells. It plays a role, for example, in the regulation of the transcription, in genetic imprinting, and in tumorigenesis. Therefore, the identification of 5-methylcytosine as a component of genetic information is of considerable interest. However, 5-methylcytosine positions cannot be identified by sequencing, because 5-methylcytosine has the same base pairing behavior as cytosine. Moreover, the epigenetic information carried by 5-methylcytosine is completely lost during, e.g., PCR amplification.
The most frequently used method for analyzing DNA for the presence of 5-methylcytosine is based upon the specific reaction of bisulfite with cytosine whereby, upon subsequent alkaline hydrolysis, cytosine is converted to uracil which corresponds to thymine in its base pairing behavior. Significantly, however, 5-methylcytosine remains unmodified under these conditions. Consequently, the original DNA is converted in such a manner that methylcytosine, which originally could not be distinguished from cytosine by its hybridization behavior, can now be detected as the only remaining cytosine using standard, art-recognized molecular biological techniques, for example, by amplification and hybridization, or by sequencing. All of these techniques are based on differential base pairing properties, which can now be fully exploited.
The prior art, in terms of sensitivity, is defined by a method comprising enclosing the DNA to be analyzed in an agarose matrix, thereby preventing the diffusion and renaturation of the DNA (bisulfite only reacts with single-stranded DNA), and replacing all precipitation and purification steps with fast dialysis (Olek A, et al., A modified and improved method for bisulfite based cytosine methylation analysis, Nucleic Acids Res. 24:5064-6, 1996). It is thus possible to analyze individual cells for methylation status, illustrating the utility and sensitivity of the method. An overview of art-recognized methods for detecting 5-methylcytosine is provided by Rein, T., et al., Nucleic Acids Res., 26:2255, 1998.
The bisulfite technique, barring few exceptions (e.g., Zeschnigk M, et al., Eur J Hum Genet. 5:94-98, 1997), is currently only used in research. In all instances, short, specific fragments of a known gene are amplified subsequent to a bisulfite treatment, and either completely sequenced (Olek & Walter, Nat Genet. 1997 17:275-6, 1997), subjected to one or more primer extension reactions (Gonzalgo & Jones, Nucleic Acids Res., 25:2529-31, 1997; WO 95/00669; U.S. Pat. No. 6,251,594) to analyze individual cytosine positions, or treated by enzymatic digestion (Xiong & Laird, Nucleic Acids Res., 25:2532-4, 1997). Detection by hybridization has also been described in the art (Olek et al., WO 99/28498). Additionally, use of the bisulfite technique for methylation detection with respect to individual genes has been described (Grigg & Clark, Bioessays, 16:431-6, 1994; Zeschnigk M, et al., Hum Mol Genet., 6:387-95, 1997; Feil R, et al., Nucleic Acids Res., 22:695-, 1994; Martin V, et al., Gene, 157:261-4, 1995; WO 9746705 and WO 9515373).
Bisulfite Methylation Assay Procedures.
Various methylation assay procedures are known in the art, and can be used in conjunction with the present invention. These assays allow for determination of the methylation state of one or a plurality of CpG dinucleotides (e.g., CpG islands) within a DNA sequence. Such assays involve, among other techniques, DNA sequencing of bisulfite-treated DNA, PCR (for sequence-specific amplification), Southern blot analysis, and use of methylation-sensitive restriction enzymes.
For example, genomic sequencing has been simplified for analysis of DNA methylation patterns and 5-methylcytosine distribution by using bisulfite treatment (Frommer et al., Proc. Natl. Acad. Sci. USA 89:1827-1831, 1992). Additionally, restriction enzyme digestion of PCR products amplified from bisulfite-converted DNA is used, e.g., the method described by Sadri & Hornsby (Nucl. Acids Res. 24:5058-5059, 1996), or COBRA (Combined Bisulfite Restriction Analysis) (Xiong & Laird, Nucleic Acids Res. 25:2532-2534, 1997).
COBRA.
COBRA⢠analysis is a quantitative methylation assay useful for determining DNA methylation levels at specific gene loci in small amounts of genomic DNA (Xiong & Laird, Nucleic Acids Res. 25:2532-2534, 1997). Briefly, restriction enzyme digestion is used to reveal methylation-dependent sequence differences in PCR products of sodium bisulfite-treated DNA. Methylation-dependent sequence differences are first introduced into the genomic DNA by standard bisulfite treatment according to the procedure described by Frommer et al. (Proc. Natl. Acad. Sci. USA 89:1827-1831, 1992). PCR amplification of the bisulfite converted DNA is then performed using primers specific for the interested CpG islands, followed by restriction endonuclease digestion, gel electrophoresis, and detection using specific, labeled hybridization probes. Methylation levels in the original DNA sample are represented by the relative amounts of digested and undigested PCR product in a linearly quantitative fashion across a wide spectrum of DNA methylation levels. In addition, this technique can be reliably applied to DNA obtained from microdissected paraffin-embedded tissue samples.
Other assays used in the art include âMethyLightâ˘â (a fluorescence-based real-time PCR technique) (Eads et al., Cancer Res. 59:2302-2306, 1999), Ms-SNuPE⢠(Methylation-sensitive Single Nucleotide Primer Extension) reactions (Gonzalgo & Jones, Nucleic Acids Res. 25:2529-2531, 1997), methylation-specific PCR (âMSPâ; Herman et al., Proc. Natl. Acad. Sci. USA 93:9821-9826, 1996; U.S. Pat. No. 5,786,146), and methylated CpG island amplification (âMCAâ; Toyota et al., Cancer Res. 59:2307-12, 1999). These may be used alone or in combination with other of these methods.
MethyLight.
Methylight⢠is a novel high-throughput methylation assay that utilizes fluorescence-based real-time PCR technology that requires no further manipulation after the PCR step. It is a highly sensitive assay, capable of detecting methylated alleles in the presence of a 10,000-fold excess of unmethylated alleles, and can very accurately determine the relative prevalence of a particular pattern of DNA methylation.
The MethyLight⢠assay utilizes fluorescence-based real-time PCR (TaqManÂŽ) technology that requires no further manipulations after the PCR step (Eads et al., Cancer Res. 59:2302-2306, 1999). Briefly, the MethyLight⢠process begins with a mixed sample of genomic DNA that is converted, in a sodium bisulfite reaction, to a mixed pool of methylation-dependent sequence differences according to standard procedures (the bisulfite process converts unmethylated cytosine residues to uracil). Fluorescence-based PCR is then performed either in an âunbiasedâ (with primers that do not overlap known CpG methylation sites) PCR reaction, or in a âbiasedâ (with PCR primers that overlap known CpG dinucleotides) reaction. Sequence discrimination can occur either at the level of the amplification process or at the level of the fluorescence detection process, or both.
The MethyLight⢠assay may be used as a quantitative test for methylation patterns in the genomic DNA sample, wherein sequence discrimination occurs at the level of probe hybridization. In this quantitative version, the PCR reaction provides for unbiased amplification in the presence of a fluorescent probe that overlaps a particular putative methylation site. An unbiased control for the amount of input DNA is provided by a reaction in which neither the primers, nor the probe overlie any CpG dinucleotides. Alternatively, a qualitative test for genomic methylation is achieved by probing of the biased PCR pool with either control oligonucleotides that do not âcoverâ known methylation sites (a fluorescence-based version of the âMSPâ technique), or with oligonucleotides covering potential methylation sites.
The MethyLight⢠process can by used with a âTaqManÂŽâ probe in the amplification process. For example, double-stranded genomic DNA is treated with sodium bisulfite and subjected to one of two sets of PCR reactions using TaqManÂŽ probes; e.g., with either biased primers and TaqManÂŽ probe, or unbiased primers and TaqManÂŽ probe. The TaqManÂŽ probe is dual-labeled with fluorescent âreporterâ and âquencherâ molecules, and is designed to be specific for a relatively high GC content region so that it melts out at about 10° C. higher temperature in the PCR cycle than the forward or reverse primers. This allows the TaqManÂŽ probe to remain fully hybridized during the PCR annealing/extension step. As the Taq polymerase enzymatically synthesizes a new strand during PCR, it will eventually reach the annealed TaqManÂŽ probe. The Taq polymerase 5Ⲡto 3Ⲡendonuclease activity will then displace the TaqManÂŽ probe by digesting it to release the fluorescent reporter molecule for quantitative detection of its now unquenched signal using a real-time fluorescent detection system.
Alternatively the Methylight⢠process can be used with âLightcyclerâ˘â probes. A LightCycler⢠probe is a pair of single-stranded fluorescent-labeled oligonucleotides. The first oligonucleotide probe is labeled at its 3Ⲡend with a donor fluorophore dye and the second is labeled at its 5Ⲡend with an acceptor fluorophore dyes. The free 3Ⲡhydroxyl group of the second probe is blocked with a phosphate group to prevent polymerase mediated extension. During the annealing step of real-time quantitative PCR, the PCR primers and the LightCycler⢠probes hybridize to their specific target regions causing the donor dye to come into close proximity to the acceptor dye. When the donor dye is excited by light, energy is transferred by Fluorescence Resonance Energy Transfer (FRET) from the donor to the acceptor dye. The energy transfer causes the acceptor dye to emit fluorescence wherein the increase of measured fluorescence signal is directly proportional to the amount of target DNA.
Typical reagents (e.g., as might be found in a typical MethyLightâ˘-based kit) for MethyLight⢠analysis may include, but are not limited to: PCR primers for specific gene (or methylation-altered DNA sequence or CpG island); TaqManÂŽ and/or LightCycler⢠probes; optimized PCR buffers and deoxynucleotides; and Taq polymerase.
Ms-SNuPE.
The Ms-SNuPE⢠technique is a quantitative method for assessing methylation differences at specific CpG sites based on bisulfite treatment of DNA, followed by single-nucleotide primer extension (Gonzalgo & Jones, Nucleic Acids Res. 25:2529-2531, 1997). Briefly, genomic DNA is reacted with sodium bisulfite to convert unmethylated cytosine to uracil while leaving 5-methylcytosine unchanged. Amplification of the desired target sequence is then performed using PCR primers specific for bisulfite-converted DNA, and the resulting product is isolated and used as a template for methylation analysis at the CpG site(s) of interest. Small amounts of DNA can be analyzed (e.g., microdissected pathology sections), and it avoids utilization of restriction enzymes for determining the methylation status at CpG sites.
Typical reagents (e.g., as might be found in a typical Ms-SNuPEâ˘-based kit) for Ms-SNuPE⢠analysis may include, but are not limited to: PCR primers for specific gene (or methylation-altered DNA sequence or CpG island); optimized PCR buffers and deoxynucleotides; gel extraction kit; positive control primers; Ms-SNuPE⢠primers for specific gene; reaction buffer (for the Ms-SNuPE⢠reaction); and radioactive nucleotides. Additionally, bisulfite conversion reagents may include: DNA denaturation buffer; sulfonation buffer; DNA recovery regents or kit (e.g., precipitation, ultrafiltration, affinity column); desulfonation buffer; and DNA recovery components.
MSP.
MSP (methylation-specific PCR) allows for assessing the methylation status of virtually any group of CpG sites within a CpG island, independent of the use of methylation-sensitive restriction enzymes (Herman et al. Proc. Natl. Acad. Sci. USA 93:9821-9826, 1996; U.S. Pat. No. 5,786,146). Briefly, DNA is modified by sodium bisulfite converting all unmethylated, but not methylated cytosines to uracil, and subsequently amplified with primers specific for methylated versus unmethylated DNA. This technique has been described in U.S. Pat. No. 6,265,171 to Herman. The use of methylation status specific primers for the amplification of bisulfite treated DNA allows the differentiation between methylated and unmethylated nucleic acids. MSP primers pairs contain at least one primer which hybridizes to a bisulfite treated CpG dinucleotide. Therefore, the sequence of said primers comprises at least one CpG dinucleotide. MSP primers specific for non-methylated DNA contain a âTâ at the 3Ⲡposition of the C position in the CpG. MSP requires only small quantities of DNA, is sensitive to 0.1% methylated alleles of a given CpG island locus, and can be performed on DNA extracted from paraffin-embedded samples. Typical reagents (e.g., as might be found in a typical MSP-based kit) for MSP analysis may include, but are not limited to: methylated and unmethylated PCR primers for specific gene (or methylation-altered DNA sequence or CpG island), optimized PCR buffers and deoxynucleotides, and specific probes.
Treatment of metastatic colon cancer currently has a low success rate. Although a number of patients with isolated metastases to the liver have undergone surgical removal of liver metastases and been reported to experience long-term cancer-free survival, the majority of patients with isolated liver metastases ultimately fail treatment because the cancer recurs locally in the liver and/or elsewhere in the body. Therefore, in order to improve the results achieved with surgical removal of the liver metastases, therapy must be directed at controlling both cancer recurrence in the liver and elsewhere in the body. Administration of systemic chemotherapy has the potential to eradicate cancer cells remaining in the body following surgical removal of the liver metastases, and direct infusion of chemotherapy into the liver via the hepatic artery has the potential to destroy remaining cancer cells in the liver.
Pronounced Need in the Art.
Therefore, in view of the incidence of colon cancer metastasis and the low success rate of treatment thereof there is a need for identifying patients who would benefit from systemic adjuvant treatment. Additionally, there is a pronounced need in the art for the development of molecular markers that could be used to provide sensitive, accurate and non-invasive methods (as opposed to, e.g., biopsy) for the diagnosis, prognosis and treatment of colon cell proliferative disorders.
FIGS. 1A, 1B, 2 and 3 relate to Example 1.
FIGS. 1A and 1B show status of promoter methylation of the APC gene as assessed by Methylight assay. PMR: percentage methylated reference. FIG. 1A: APC promoter methylation in 39 primary colorectal cancers and 14 matched normal colon mucosa. FIG. 1B: APC promoter methylation in 39 primary colorectal cancers and 24 liver metastasis.
FIG. 2 shows APC protein expression in 5 matched non-neoplastic colon mucosa and primary colon cancer (N1T1-N5T5), 2 matched primary colon cancer and liver metastases (T6M6 and T7M7) using Western blot analysis. N, non-neoplastic mucosa; T, primary colon cancer; M, liver metastasis. Two isoforms of the APC protein (300 and 200 kDa, respectively) were observed. APC was expressed in all 5 matched non-neoplastic colon and cancerous tissues and 1 matched colon cancer and liver metastasis. In general the expression level of APC was decreased in colon cancer when compared with the corresponding non-neoplastic mucosa. In one matched colon cancer and liver metastasis the expression of APC protein was completely absent. No significant difference among the tissues with APC promoter methylation (T2, T5) versus cases without APC methylation (T1, T3, T4, T6M6 and T7M7) was observed. P, positive control.
FIG. 3 shows immunohistochemical expression of APC in colon and tumor tissue. The distribution and expression pattern of APC in colon cancer was investigated by immunohistochemistry. Non-tumorous epithelium, tumor, lymph node and liver metastases were stained with anti-APC antibodies. APC was found in the cytoplasm. In the majority of the patients studied, the intensity of immunostaining and the number of immunoreactive cells was decreased in tumorous epithelium (B) when compared with the corresponding non-tumorous epithelium (A). Hematoxylin counterstain; Original magnification: x400.
For the purposes of the following invention the terms âsensitivityâ and âspecificityâ refer to values calculated by reference to a sample set according to that described in the examples contained herein.
The term âObserved/Expected Ratioâ (âO/E Ratioâ) refers to the frequency of CpG dinucleotides within a particular DNA sequence, and corresponds to the [number of CpG sites/(number of C basesĂnumber of G bases)]Ăband length for each fragment.
The term âCpG islandâ refers to a contiguous region of genomic DNA that satisfies the criteria of (1) having a frequency of CpG dinucleotides corresponding to an âObserved/Expected Ratioâ>0.6, and (2) having a âGC Contentâ>0.5. CpG islands are typically, but not always, between about 0.2 to about 1 kb in length.
The term âmethylation stateâ or âmethylation statusâ refers to the presence or absence of 5-methylcytosine (â5-mCytâ) at one or a plurality of CpG dinucleotides within a DNA sequence. Methylation states at one or more particular palindromic CpG methylation sites (each having two CpG CpG dinucleotide sequences) within a DNA sequence include âunmethylated,â âfully-methylatedâ and âhemi-methylated.â
The term âhemi-methylationâ or âhemimethylationâ refers to the methylation state of a double stranded DNA comprising on each strand CpG methylation site, where only the CpGs of one strand are methylated.
The term âhypermethylationâ refers to the average methylation state corresponding to an increased presence of 5-mCyt at one or a plurality of CpG dinucleotides within a DNA sequence of a test DNA sample, relative to the amount of 5-mCyt found at corresponding CpG dinucleotides within a normal control DNA sample.
The term âhypomethylationâ refers to the average methylation state corresponding to a decreased presence of 5-mCyt at one or a plurality of CpG dinucleotides within a DNA sequence of a test DNA sample, relative to the amount of 5-mCyt found at corresponding CpG dinucleotides within a normal control DNA sample.
The term âmicroarrayâ refers broadly to both âDNA microarrays,â and âDNA chip(s),â as recognized in the art, encompasses all art-recognized solid supports, and encompasses all methods for affixing nucleic acid molecules thereto or synthesis of nucleic acids thereon.
âGenetic parametersâ are mutations and polymorphisms of genes and sequences further required for their regulation. To be designated as mutations are, in particular, insertions, deletions, point mutations, inversions and polymorphisms and, particularly preferred, SNPs (single nucleotide polymorphisms).
âEpigenetic parametersâ are, in particular, cytosine methylations. Further epigenetic parameters include, for example, the acetylation of histones which, however, cannot be directly analyzed using the described method but which, in turn, correlate with the DNA methylation.
The term âbisulfite reagentâ refers to a reagent comprising bisulfite, disulfite, hydrogen sulfite or combinations thereof, useful as disclosed herein to distinguish between methylated and unmethylated CpG dinucleotide sequences.
The term âmethylation assayâ refers to any assay for determining the methylation state of one or more CpG dinucleotide sequences within a sequence of DNA.
The term âMS AP-PCRâ (Methylation-Sensitive Arbitrarily-Primed Polymerase Chain Reaction) refers to the art-recognized technology that allows for a global scan of the genome using CG-rich primers to focus on the regions most likely to contain CpG dinucleotides, and described by Gonzalgo et al., Cancer Research 57:594-599, 1997.
The term âMethyLightÂŽâ refers to the art-recognized fluorescence-based real-time PCR technique described by Eads et al., Cancer Res. 59:2302-2306, 1999.
The term âHeavyMethylâ˘â assay, in the embodiment thereof implemented herein, refers to a HeavyMethyl MethylightÂŽ assay, which is a variation of the MethylightÂŽ assay, wherein the MethylightÂŽ assay is combined with methylation specific blocking probes covering CpG positions between the amplification primers.
The term MsSNuPE⢠(Methylation-sensitive Single Nucleotide Primer Extension) refers to the art-recognized assay described by Gonzalgo & Jones, Nucleic Acids Res. 25:2529-2531, 1997.
The term âMSPâ (Methylation-specific PCR) refers to the art-recognized methylation assay described by Herman et al. Proc. Natl. Acad. Sci. USA 93:9821-9826, 1996, and by U.S. Pat. No. 5,786,146.
The term COBRA⢠(Combined Bisulfite Restriction Analysis) refers to the art-recognized methylation assay described by Xiong & Laird, Nucleic Acids Res. 25:2532-2534, 1997.
The term âMCAâ (Methylated CpG Island Amplification) refers to the methylation assay described by Toyota et al., Cancer Res. 59:2307-12, 1999, and in WO 00/26401A1.
The term âhybridizationâ is to be understood as a bond of an oligonucleotide to a complementary sequence along the lines of the Watson-Crick base pairings in the sample DNA, forming a duplex structure.
âStringent hybridization conditions,â as defined herein, involve hybridizing at 68° C. in 5ĂSSC/5ĂDenhardt's solution/1.0% SDS, and washing in 0.2ĂSSC/0.1% SDS at room temperature, or involve the art-recognized equivalent thereof (e.g., conditions in which a hybridization is carried out at 60° C. in 2.5ĂSSC buffer, followed by several washing steps at 37° C. in a low buffer concentration, and remains stable). Moderately stringent conditions, as defined herein, involve including washing in 3ĂSSC at 42° C., or the art-recognized equivalent thereof. The parameters of salt concentration and temperature can be varied to achieve the optimal level of identity between the probe and the target nucleic acid. Guidance regarding such conditions is available in the art, for example, by Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, N.Y.; and Ausubel et al. (eds.), 1995, Current Protocols in Molecular Biology, (John Wiley & Sons, N.Y.) at Unit 2.10.
The term âprimaryâ when used in reference to cancer or other cell proliferative disorder shall be taken to mean the first to develop.
The term âmetastasisâ as used herein shall be taken to mean the transfer of a disease-producing agent (such as bacteria, cancer or other cell proliferative disorder cells) from an original site of disease to another part of the body with development of a similar lesion in the new location.
Despite intensive efforts to improve treatment of colon cell proliferative disorders, most cases are diagnosed in an advanced stage with regional or distant metastasis which are associated with poor survival. The herein described invention discloses genetic methylation markers that have novel utility for detection of metastasis of colon cell proliferative disorders or determining likelihood of development thereof, and in further embodiments provides sensitive assay methods for the improved prognostic analysis of said disorders. The invention is particularly preferred for the detection of metastasis of colon carcinoma located in the liver or determining the likelihood of development thereof.
The invention presents improvements over the state of the art in that it provides a means for the detection and/or prediction of metastasis of colon cell proliferative disorders, most particularly colon carcinoma by analysis of the methylation patterns of at least one or a plurality of genes and/or their regulatory sequences. In one embodiment the gene is APC and/or its regulatory sequences. The invention is particularly preferred for the detection of metastasis of colon carcinoma located in the liver or likelihood of metastasis of colon carcinoma. Furthermore, APC methylation can be used as a marker to confirm that liver metastasis of unknown origin is from colon cancer primary and also to distinguish between liver cancer originating from a metastasis from a liver heptocellular carcinoma.
In a further preferred embodiment the methylation of the gene APC and/or its regulatory sequences and one or more genes of a panel of genes consisting of TPEF, p16/INK4A and ALX4, and/or their regulatory sequences is determined and therefrom a prognosis concerning likelihood of progression to metastases is determined. Said embodiments having a combined utility for the detection and prognosis of colon carcinoma.
In one aspect, the present invention provides for the use of the bisulfite technique, in combination with one or more methylation assays, for determination of the methylation status of CpG dinucleotide sequences of at least one of the genes taken from the group consisting ALX4, TPEF, p16/INK4A, APC and/or their regulatory sequences. It is most preferred that said gene is APC. According to the present invention, determination of the methylation status of CpG dinucleotide sequences within the gene APC has prognostic utility.
Although hypermethylation is commonly known in a wide variety of cancers, it has not been widely investigated as a prognostic marker and hypermethylation of genes in metastasis from colon carcinoma is not known in the art. Although hypermethylation of the gene APC is known in colon cancer, a person skilled in the art would not necessarily be led to investigate its use as a prognostic marker. There is nothing in the art to indicate that the gene APC is capable of distinguishing between primary and metastasized tumors or suchlike. Furthermore, hypermethylation of a gene is widely accepted as a modulating factor in gene expression (and thereby protein levels) wherein gene transcription is hindered by methylation thereby leading to decreased levels of expression. As can be seen from the examples that follow, protein levels of the gene APC are not significantly different between colon tissue, colon carcinoma and colon carcinoma metastasis. Therefore a person skilled in the art would not as a matter of course be lead to investigate the use of methylation analysis as a prognostic marker (i.e., one capable of differentiating between primary colon carcinoma and colon carcinoma metastasis) on the basis of its hypermethylation in colon carcinoma.
Particular embodiments of the present invention provide a novel application of the analysis of methylation levels and/or patterns of the gene APC and/or its regulatory sequences that enable a precise prognosis of the likelihood of metastasis and thereby enable the improved treatment and thus overall prognosis of colon cell proliferative disorders. The invention is particularly preferred for the detection of metastasis of colon carcinoma located in the liver. The disclosed method thereby enables the physician and patient to make better and more informed treatment decisions.
In particular aspects, the present invention provides improved means for the prognosis of metastasis of colorectal cell proliferative disorders. This aim is achieved by the analysis of the CpG methylation status of at least one or a plurality of genes and/or their regulatory regions. In one embodiment the CpG methylation status of the gene APC and/or its regulatory sequences is analysed. The invention is particularly preferred for the detection of metastasis of colon carcinoma located in the liver.
In a further aspect the aim of the invention is achieved by the methylation analysis of said gene, APC and/or its regulatory sequences and one or more genes selected from the group consisting ALX4, TPEF, p16/INK4A, APC and/or their regulatory sequences. Said group of genes consisting ALX4, TPEF, p16/INK4A, APC and/or their regulatory sequences having heretofore unknown utility in the detection of colon carcinoma. Therefore said analysis is particularly suited to a combined diagnostic and prognostic colon cell proliferative disorder test.
The present invention is further based upon the analysis of methylation levels within said gene, APC and/or its regulatory sequences and one or more genes selected from the group consisting ALX4, TPEF and p16/INK4A and/or their regulatory sequences said group of genes being further preferred markers for the detection of colon cancer.
Accordingly, the invention also disclose the genomic sequences of said genes in SEQ ID NOS:1 to SEQ ID NO:4, according to TABLE 2. Additional embodiments provide modified variants of SEQ ID NOS:1 to SEQ ID NO:4, as well as oligonucleotides and/or PNA-oligomers for analysis of cytosine methylation patterns within SEQ ID NOS:1 to SEQ ID NO:4. Said modified variants of SEQ ID NO: 1 to 4, namely SEQ ID NO: 5 to 20 (as shown in Table 2) providing the sequences of said genomic nucleic acids subsequent to a treatment suitable for the conversion of all unmethylated cytosine positions to uracil (e.g., bisulfite treatment).
According to the present invention aberrant methylation patterns are associated with the development of metastasis in colon cell proliferative disorders. In particular hypermethylation of the gene APC and/or its regulatory sequences is correlated with metastasis of colon cell proliferative disorders. The invention is particularly preferred for the detection of metastasis of colon carcinoma located in the liver. Methylation analysis of this gene is herein shown to have the surprising effect of being a prognostic marker. Furthermore this prognostic marker is improved by a combined analysis of the gene APC and one or more genes selected from the group consisting of TPEF, p16/INK4A, APC said analysis having a further utility as a diagnostic marker.
The present invention discloses the analysis of methylation within said genes and/or their regulatory sequences in the form of a panel enabling the combined detection and prediction of metastasis and thereby treatment and overall prognosis of colon cell proliferative disorders.
Aberrant methylation of the genes TPEF, p16/INK4A, caveolin-2, DAPK and TIMP3 have to date been associated with the development of colorectal cell proliferative disorders. The present invention provides specific combinations of these genes with the gene APC which were determined to be particularly useful as diagnostic and prognostic markers of colorectal cell proliferative disorders. Accordingly, it is further preferred that the methylation of the gene APC and/or its regulatory sequences and at least one or more of the genes selected from the group consisting ALX4, TPEF and p16 and/or their regulatory sequences are analysed.
An objective of the invention comprises analysis of the methylation state of one or more CpG dinucleotides within SEQ ID NO:1. In a further embodiment the methylation status of at least one CpG position of SEQ ID NO:1 and at least one CpG position taken from the group of sequences consisting of SEQ ID NOS:1 to SEQ ID NO:4 and sequences complementary thereto are analysed.
It is further preferred that the methylation status of at least one CpG position of SEQ ID NO:1 and at least one CpG position taken from the group of sequences consisting of SEQ ID NOS:2-4 are analysed.
The disclosed invention further provides treated nucleic acids, derived from genomic SEQ ID NOS:1 to SEQ ID NO:4, wherein the treatment is suitable to convert at least one unmethylated cytosine base of the genomic DNA sequence to uracil or another base that is detectably dissimilar to cytosine in terms of hybridization. The genomic sequences in question may comprise one, or more, consecutive or random methylated CpG positions. Said treatment preferably comprises use of a reagent selected from the group consisting of bisulfite, hydrogen sulfite, disulfite, and combinations thereof. Nucleic acids treated accordingly are herein also referred to as âmodifiedâ nucleic acids.
In a preferred embodiment of the invention, the objective comprises analysis of at least one modified nucleic acid comprising a sequence of at least 16 contiguous nucleotide bases in length of a sequence selected from the group consisting of SEQ ID NO:5, 6, 13 and 14, wherein said sequence comprises at least one CpG, TpA or CpA dinucleotide and sequences complementary thereto. It is also preferred that at least one modified nucleic acid comprising a sequence of at least 16 contiguous nucleotide bases in length of a sequence selected from the group consisting of SEQ ID NO:5 to SEQ ID NO:20 are analysed in addition to at least 16 contiguous nucleotide bases in length of a sequence selected from the group consisting of SEQ ID NO:5, 6, 13 and 14, wherein said sequence comprises at least one CpG, TpA or CpA dinucleotide and sequences complementary thereto.
The analysed nucleic acids may comprise at least 16, 20, 25, 30 or 35 nucleotides in length of SEQ ID NO: 5 to 20.
The sequences of SEQ ID NOS:5 to SEQ ID NO:20 provide modified versions of the nucleic acid according to SEQ ID NOS:1 to SEQ ID NO:4, wherein the modification of each genomic sequence results in the synthesis of a nucleic acid having a sequence that is unique and distinct from said genomic sequence as follows. For each sense strand genomic DNA, e.g., SEQ ID NO:1, four converted versions are disclosed. A first version wherein âCâ is converted to âTâ but âCpGâ remains âCpGâ (i.e., corresponds to case where, for the genomic sequence, all âCâ residues of CpG dinucleotide sequences are methylated and are thus not converted); a second version discloses the complement of the disclosed genomic DNA sequence (i.e., antisense strand), wherein âCâ is converted to âTâ but âCpGâ remains âCpGâ (i.e., corresponds to case where, for all âCâ residues of CpG dinucleotide sequences are methylated and are thus not converted). The âupmethylatedâ converted sequences of SEQ ID NO:1 to SEQ ID NO: 4 correspond to SEQ ID NO:5 to SEQ ID NO:12 (see TABLE 2). A third chemically converted version of each genomic sequences is provided, wherein âCâ is converted to âTâ or all âCâ residues, including those of âCpGâ dinucleotide sequences (i.e., corresponds to case where, for the genomic sequences, all âCâ residues of CpG dinucleotide sequences are unmethylated); a final chemically converted version of each sequence, discloses the complement of the disclosed genomic DNA sequence (i.e., antisense strand), wherein âCâ is converted to âTâ for all âCâ residues, including those of âCpGâ dinucleotide sequences (i.e., corresponds to case where, for the complement (antisense strand) of each genomic sequence, all âCâ residues of CpG dinucleotide sequences are unmethylated). The âdownmethylatedâ converted sequences of SEQ ID NO: 1 to SEQ ID NO: 4 correspond to SEQ ID NO:13 to SEQ ID NO:20.
Particularly useful as a prognostic marker of colon cell proliferative disorders are the non-naturally occurring sequences according to SEQ ID Nos:5, 6, 14 and 15 which correspond to methylation specific converted sequences of part of the gene APC (SEQ ID NO:1).
In an alternative preferred embodiment, such analysis comprises the use of an oligonucleotide or oligomer for detecting the cytosine methylation state within genomic or treated (chemically modified) DNA, according to and particularly preferred SEQ ID NO:1, but also SEQ ID NOS: 2 to SEQ ID NO:4. Said oligonucleotide or oligomer comprising a nucleic acid sequence having a length of at least nine (9) nucleotides which hybridizes, under moderately stringent or stringent conditions (as defined herein above), to a pretreated nucleic acid sequence according to SEQ ID NOS:5 to SEQ ID NO:20 and/or sequences complementary thereto, or to a genomic sequence according to SEQ ID NOS:1 to SEQ ID NO:4 and/or sequences complementary thereto.
Preferably said oligomers comprise at least one T nucleotide wherein the corresponding base position within genomic (i.e., untreated) DNA is a C, said genomic equivalent of SEQ ID NO: 2 to SEQ ID NO: 4 as provided in the sequence listing (see Table 2).
Thus, the present invention includes nucleic acid molecules (e.g., oligonucleotides and peptide nucleic acid (PNA) molecules (PNA-oligomers)) that hybridize under moderately stringent and/or stringent hybridization conditions to all or a portion of the sequences SEQ ID NOS: 1 to SEQ ID NO: 20, or to the complements thereof. The hybridizing portion of the hybridizing nucleic acids is typically at least 9, 15, 20, 25, 30 or 35 nucleotides in length. However, longer molecules have inventive utility, and are thus within the scope of the present invention.
Preferably, the hybridizing portion of the inventive hybridizing nucleic acids is at least 95%, or at least 98%, or 100% identical to the sequence, or to a portion thereof of SEQ ID NOS:1 to SEQ ID NO:20, or to the complements thereof.
Hybridizing nucleic acids of the type described herein can be used, for example, as a primer (e.g., a PCR primer), or a diagnostic and/or prognostic probe or primer. Preferably, hybridization of the oligonucleotide probe to a nucleic acid sample is performed under stringent conditions and the probe is 100% identical to the target sequence. Nucleic acid duplex or hybrid stability is expressed as the melting temperature or Tm, which is the temperature at which a probe dissociates from a target DNA. This melting temperature is used to define the required stringency conditions.
For target sequences that are related and substantially identical to the corresponding sequence of SEQ ID NOS:1 to SEQ ID NO:4 (such as allelic variants and SNPs), rather than identical, it is useful to first establish the lowest temperature at which only homologous hybridization occurs with a particular concentration of salt (e.g., SSC or SSPE). Then, assuming that 1% mismatching results in a 1° C. decrease in the Tm, the temperature of the final wash in the hybridization reaction is reduced accordingly (for example, if sequences having >95% identity with the probe are sought, the final wash temperature is decreased by 5° C.). In practice, the change in Tm can be between 0.5° C. and 1.5° C. per 1% mismatch.
Examples of inventive oligonucleotides of length X (in nucleotides), as indicated by polynucleotide positions with reference to, e.g., SEQ ID NO:1, include those corresponding to sets (sense and antisense sets) of consecutively overlapping oligonucleotides of length X, where the oligonucleotides within each consecutively overlapping set (corresponding to a given X value) are defined as the finite set of Z oligonucleotides from nucleotide positions:
n to (n+(Xâ1));
where n=1, 2, 3, . . . (Yâ(Xâ1));
where Y equals the length (nucleotides or base pairs);
where X equals the common length (in nucleotides) of each oligonucleotide in the set (e.g., X=20 for a set of consecutively overlapping 20-mers); and where the number (Z) of consecutively overlapping oligomers of length X for a given sequence of length Y is equal to Yâ(Xâ1).
Preferably, the set is limited to those oligomers that comprise at least one CpG, TpG or CpA dinucleotide.
Examples of inventive 20-mer oligonucleotides within a sequence of length 2470 base pairs include the following set of 2470 oligomers (and the antisense set complementary thereto), indicated by polynucleotide positions 1-20, 2-21, 3-22, 4-23, 5-24 to 2451-2470.
Preferably, the set is limited to those oligomers that comprise at least one CpG, TpG or CpA dinucleotide.
The present invention encompasses, for each of SEQ ID NOS:1 to SEQ ID NO:20 (sense and antisense), multiple consecutively overlapping sets of oligonucleotides or modified oligonucleotides of length X, where, e.g., X=9, 10, 17, 20, 22, 23, 25, 27, 30 or 35 nucleotides.
The oligonucleotides or oligomers according to the present invention constitute effective tools useful to ascertain genetic and epigenetic parameters of the genomic sequence corresponding to SEQ ID NOS:1 to SEQ ID NO:4. Preferred sets of such oligonucleotides or modified oligonucleotides of length X are those consecutively overlapping sets of oligomers corresponding to SEQ ID NOS:1 to SEQ ID NO:20 (and to the complements thereof). Preferably, said oligomers comprise at least one CpG, TpG or CpA dinucleotide.
Particularly preferred oligonucleotides or oligomers according to the present invention are those in which the cytosine of the CpG dinucleotide (or of the corresponding converted TpG or CpA dinucleotide) sequences is within the middle third of the oligonucleotide; that is, where the oligonucleotide is, for example, 13 bases in length, the CpG, TpG or CpA dinucleotide is positioned within the fifth to ninth nucleotide from the 5â˛-end.
The oligonucleotides of the invention can also be modified by chemically linking the oligonucleotide to one or more moieties or conjugates to enhance the activity, stability or prognosis of the oligonucleotide. Such moieties or conjugates include chromophores, fluorophors, lipids such as cholesterol, cholic acid, thioether, aliphatic chains, phospholipids, polyamines, polyethylene glycol (PEG), palmityl moieties, and others as disclosed in, for example, U.S. Pat. Nos. 5,514,758, 5,565,552, 5,567,810, 5,574,142, 5,585,481, 5,587,371, 5,597,696 and 5,958,773. The probes may also exist in the form of a PNA (peptide nucleic acid) which has particularly preferred pairing properties. Thus, the oligonucleotide may include other appended groups such as peptides, and may include hybridization-triggered cleavage agents (Krol et al., BioTechniques 6:958-976, 1988) or intercalating agents (Zon, Pharm. Res. 5:539-549, 1988). To this end, the oligonucleotide may be conjugated to another molecule, e.g., a chromophore, fluorophor, peptide, hybridization-triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
The oligonucleotide may also comprise at least one art-recognized modified sugar and/or base moiety, or may comprise a modified backbone or non-natural internucleoside linkage.
The oligonucleotides or oligomers according to particular embodiments of the present invention are typically used in âsets,â which contain at least one oligomer for analysis of each of the CpG dinucleotides of the genomic sequences to be analysed, in a preferred embodiment SEQ ID NOS:1 to SEQ ID NO:4 and sequences complementary thereto, or to the corresponding CpG, TpG or CpA dinucleotide within a sequence of the pretreated nucleic acids according to SEQ ID NOS:5 to SEQ ID NO:20 and sequences complementary thereto. In a further preferred embodiment the set comprises contain at least one oligomer for analysis of each of the CpG dinucleotides of genomic sequence SEQ ID NO:1 and sequences complementary thereto, or to the corresponding CpG, TpG or CpA dinucleotide within a sequence of the pretreated nucleic acids according to SEQ ID NOS: 5, 6, 13 and 14.
However, it is anticipated that for economic or other factors it may be preferable to analyze a limited selection of the CpG dinucleotides within said sequences, and the content of the set of oligonucleotides is altered accordingly.
Therefore, in particular embodiments, the present invention provides a set of at least two (2) (oligonucleotides and/or PNA-oligomers) useful for detecting the cytosine methylation state in pretreated genomic DNA of the gene APC and/or its regulatory sequences (SEQ ID NO:1) or in pretreated genomic DNA thereof (SEQ ID NOS: 5, 6, 13 and 14).
In further embodiments, the present invention provides a set of at least two (2) (oligonucleotides and/or PNA-oligomers) useful for detecting the cytosine methylation state in pretreated genomic DNA of the gene APC and/or its regulatory sequences (SEQ ID NO:1) or in pretreated genomic DNA thereof (SEQ ID NOS: 5, 6, 13 & 14) and pretreated genomic DNA of at least two genes selected from ALX4, TPEF and p16 (SEQ ID NOS:7 to SEQ ID NO:12 and SEQ ID NOS:15 to SEQ ID NO:20), or in genomic DNA (SEQ ID NOS:2 to SEQ ID NO:4 and sequences complementary thereto).
In further embodiments, the present invention provides a set of at least two (2) (oligonucleotides and/or PNA-oligomers) useful for detecting the cytosine methylation state in pretreated genomic DNA of the gene APC and/or its regulatory sequences (SEQ ID NO:1) or in pretreated genomic DNA thereof (SEQ ID NOS:5, 6, 13 & 14) and pretreated genomic DNA of at least two genes selected from ALX4, TPEF, p16, (SEQ ID NOS:7 to SEQ ID NO:12, SEQ ID NOS:15 to SEQ ID NO:20), or in genomic DNA (SEQ ID NOS:2 to SEQ ID NO:4 and sequences complementary thereto).
In preferred embodiments, at least one, and more preferably all members of the set of oligonucleotides is bound to a solid phase.
In further embodiments, the present invention provides a set of at least two (2) oligonucleotides that are used as âprimerâ oligonucleotides for amplifying DNA sequences. Most preferably said primer oligonucleotides hybridise to at least one of SEQ ID NOS: 1, 5, 6, 13 and 14. In a further embodiment said set of primers further comprise oligonucleotides which hybridise to at least one of the group consisting SEQ ID NOS:2 to SEQ ID NO:20 and sequences complementary thereto, or segments thereof.
It is anticipated that the oligonucleotides may constitute all or part of an âarrayâ or âDNA chipâ (i.e., an arrangement of different oligonucleotides and/or PNA-oligomers bound to a solid phase). Such an array of different oligonucleotide- and/or PNA-oligomer sequences can be characterized, for example, in that it is arranged on the solid phase in the form of a rectangular or hexagonal lattice. The solid-phase surface may be composed of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver, or gold. Nitrocellulose as well as plastics such as nylon, which can exist in the form of pellets or also as resin matrices, may also be used. An overview of the Prior Art in oligomer array manufacturing can be gathered from a special edition of Nature Genetics (Nature Genetics Supplement, Volume 21, January 1999, and from the literature cited therein). Fluorescently labeled probes are often used for the scanning of immobilized DNA arrays. The simple attachment of Cy3 and Cy5 dyes to the 5â˛-OH of the specific probe are particularly suitable for fluorescence labels. The prognosis of the fluorescence of the hybridized probes may be carried out, for example, via a confocal microscope. Cy3 and Cy5 dyes, besides many others, are commercially available.
It is particularly preferred that the oligomers according to the invention are utilised for the prognosis of colorectal carcinoma.
The present invention further provides a method for ascertaining the CpG methylation state of selected CpG positions within the genes ALX4, TPEF, p16, APC, and/or their regulatory sequences within a subject and determining therefrom upon the presence of metastasis of colon cell proliferative disorders or determining likelihood of development thereof.
It is particularly preferred that the methylation state of at least one CpG position of the gene APC and or its regulatory sequences is analysed. In a further embodiment of the method it is preferred that the methylation status of at least one CpG position of the gene APC and/or its regulatory sequences and at least one CpG position of one or more of the genes of the group consisting TPEF, p16, ALX4 and/or their regulatory sequences are analysed.
Accordingly, it is preferred that the methylation state of at least one CpG position of the genomic sequence SEQ ID NO:1 is analysed. In a further embodiment of the method it is preferred that the methylation state of at least one CpG position of the genomic sequence SEQ ID NO:1 and at least one CpG position of one or more of the group consisting the genomic sequences SEQ ID NOS: 2-4 are analysed.
Said method comprising contacting a nucleic acid comprising the appropriate gene(s) and/or their regulatory sequences, most preferably SEQ ID NO:1 or SEQ ID NO:1 and one or more of SEQ ID NOS:2 to SEQ ID NO:4 in a biological sample obtained from said subject with at least one reagent or a series of reagents, wherein said reagent or series of reagents, distinguishes between methylated and non-methylated CpG dinucleotides within the target nucleic acid.
It is preferred that the methylation state of at least one CpG position of the genomic sequence SEQ ID NO:1 is analysed.
In a further embodiment of the method it is preferred that the methylation status of at least one CpG position of the genomic sequence SEQ ID NO:1 and one or more of the group consisting the genomic sequences SEQ ID NOS: 2-4 are analysed.
Said method comprising contacting a nucleic acid comprising the appropriate gene(s) and/or their regulatory sequences or SEQ ID NO:1 or SEQ ID NO:1 and one or more of SEQ ID NOS:2 to SEQ ID NO:4 in a biological sample obtained from said subject with at least one reagent or a series of reagents, wherein said reagent or series of reagents, distinguishes between methylated and non-methylated CpG dinucleotides within the target nucleic acid.
Preferably, said method comprises the following steps: In the first step, a sample of the tissue to be analysed is obtained. The source may be any suitable source, such as colon cell lines, histological slides, biopsies, tissue embedded in paraffin and all possible combinations thereof. Genomic DNA is then isolated from said biological sample, this may be by any means standard in the art, including the use of commercially available kits. Briefly, wherein the DNA of interest is encapsulated in by a cellular membrane the biological sample must be disrupted and lysed by enzymatic, chemical or mechanical means. The DNA solution may then be cleared of proteins and other contaminants e.g., by digestion with proteinase K. The genomic DNA is then recovered from the solution. This may be carried out by means of a variety of methods including salting out, organic extraction or binding of the DNA to a solid phase support. The choice of method will be affected by several factors including time, expense and required quantity of DNA.
Once the nucleic acids have been extracted, the genomic double stranded DNA is used in the analysis.
In the second step of the method, the genomic DNA sample is treated in such a manner that cytosine bases which are unmethylated at the 5â˛-position are converted to uracil, thymine, or another base which is dissimilar to cytosine in terms of hybridization behavior. This will be understood as âpretreatmentâ herein.
The above described pretreatment of genomic DNA is preferably carried out with bisulfite (hydrogen sulfite, disulfite) and subsequent alkaline hydrolysis which results in a conversion of non-methylated cytosine nucleobases to uracil or to another base which is detectably dissimilar to cytosine in terms of base pairing behavior. If bisulfite solution is used for the reaction, then an addition takes place at the non-methylated cytosine bases. Moreover, a denaturating reagent or solvent as well as a radical interceptor must be present. A subsequent alkaline hydrolysis then gives rise to the conversion of non-methylated cytosine nucleobases to uracil. The converted DNA is then used for the detection of methylated cytosines.
It is particularly preferred that the genomic DNA of SEQ ID NO: 1 to 4 is thereby converted to the equivalent sequence selected from the group consisting SEQ ID NO: 5 SEQ ID NO: 20. Particularly preferred according to the present invention is the analysis of at least one CpG position of an amplificate of said sequences amplifiable by the use of corresponding primers of Table 1 or hybridizing to the oligonucleotides of Table 1.
In the third step of the method, fragments of the pretreated DNA are amplified, using sets of primer oligonucleotides according to the present invention, and an amplification enzyme. The amplification of several DNA segments can be carried out simultaneously in one and the same reaction vessel. Said amplification may be carried out as a âsingleplexâ reaction wherein only a single amplification is carried out, or as a âmultiplexâ reaction wherein the amplification of a plurality of sequences is carried out simultaneously. Because of statistical and practical considerations, wherein said amplification is a multiplex reaction preferably more than five different fragments having a length of 75-2000 base pairs are amplified. Typically, the amplification is carried out using a polymerase chain reaction (PCR). The set of primer oligonucleotides includes at least two oligonucleotides whose sequences are each reverse complementary, identical, or hybridize under stringent or highly stringent conditions to an at least 16-base-pair long segment of the base sequences. Most preferably this sequence is one of SEQ ID NOS: 5, 6, 13 and 14. In a further embodiment said set further comprises at least one or more pairs of oligonucleotides whose sequences are each reverse complementary, identical, or hybridize under stringent or highly stringent conditions to an at least 16-base-pair long segment of the base sequences of one or more of SEQ ID NOS:7 to SEQ ID NO:12 and SEQ ID NOS:15 to SEQ ID NO:20 and sequences complementary thereto.
In an alternate embodiment of the method, the methylation status of at least one CpG position within the previously specified nucleic acid sequences may be detected by use of methylation-specific primer oligonucleotides. Most preferably this sequence comprises SEQ ID NO:1, and in a further embodiment SEQ ID NO:1 and one or more of SEQ ID NOS:2 to SEQ ID NO:4. This technique (MSP) has been described in U.S. Pat. No. 6,265,171 to Herman. The use of methylation status specific primers for the amplification of bisulfite treated DNA allows the differentiation between methylated and unmethylated nucleic acids. MSP primers pairs contain at least one primer which hybridizes to a bisulfite treated CpG dinucleotide. Therefore, the sequence of said primers comprises at least one CpG dinucleotide. MSP primers specific for non-methylated DNA contain a âTâ at the 3Ⲡposition of the C position in the CpG. Preferably, therefore, the base sequence of said primers is required to comprise a sequence having a length of at least 9 nucleotides which hybridizes to a pretreated nucleic acid sequence according to SEQ ID NOS: 5, 6, 13 and 14. In a further embodiment a set of MSP primers are used wherein said set comprises at least one pair of primers having a length of at least 9 nucleotides which hybridizes to a pretreated nucleic acid sequence according to SEQ ID NOS: 5, 6, 13 and 14 and furthermore at least one pair of SEQ ID NOS:7 to SEQ ID NO:20 and sequences complementary thereto, wherein the base sequence of said oligomers comprises at least one CpG dinucleotide.
A further preferred embodiment of the method comprises the use of blocker oligonucleotides. The use of such blocker oligonucleotides has been described by Yu et al., BioTechniques 23:714-720, 1997. Blocking probe oligonucleotides are hybridized to the bisulfite treated nucleic acid concurrently with the PCR primers. PCR amplification of the nucleic acid is terminated at the 5Ⲡposition of the blocking probe, such that amplification of a nucleic acid is suppressed where the complementary sequence to the blocking probe is present. The probes may be designed to hybridize to the bisulfite treated nucleic acid in a methylation status specific manner. For example, for prognosis of methylated nucleic acids within a population of unmethylated nucleic acids, suppression of the amplification of nucleic acids which are unmethylated at the position in question would be carried out by the use of blocking probes comprising a âCpAâ or âTpAâ at the position in question, as opposed to a âCpGâ if the suppression of amplification of methylated nucleic acids is desired.
For PCR methods using blocker oligonucleotides, efficient disruption of polymerase-mediated amplification requires that blocker oligonucleotides not be elongated by the polymerase. Preferably, this is achieved through the use of blockers that are 3â˛-deoxyoligonucleotides, or oligonucleotides derivitized at the 3Ⲡposition with other than a âfreeâ hydroxyl group. For example, 3â˛-O-acetyl oligonucleotides are representative of a preferred class of blocker molecule.
Additionally, polymerase-mediated decomposition of the blocker oligonucleotides should be precluded. Preferably, such preclusion comprises either use of a polymerase lacking 5â˛-3Ⲡexonuclease activity, or use of modified blocker oligonucleotides having, for example, thioate bridges at the 5â˛-terminii thereof that render the blocker molecule nuclease-resistant. Particular applications may not require such 5Ⲡmodifications of the blocker. For example, if the blocker- and primer-binding sites overlap, thereby precluding binding of the primer (e.g., with excess blocker), degradation of the blocker oligonucleotide will be substantially precluded. This is because the polymerase will not extend the primer toward, and through (in the 5â˛-3Ⲡdirection) the blockerâa process that normally results in degradation of the hybridized blocker oligonucleotide.
A particularly preferred blocker/PCR embodiment, for purposes of the present invention and as implemented herein, comprises the use of peptide nucleic acid (PNA) oligomers as blocking oligonucleotides. Such PNA blocker oligomers are ideally suited, because they are neither decomposed nor extended by the polymerase.
Preferably, therefore, the base sequence of said blocking oligonucleotides is required to comprise a sequence having a length of at least 9 nucleotides which hybridizes to a pretreated nucleic acid sequence according to one of SEQ ID NO: 5, 6, 13 & 14 and sequences complementary thereto, wherein the base sequence of said oligonucleotides comprises at least one CpG, TpG or CpA dinucleotide.
In a further embodiment it is preferred that said blocking oligonucleotides includes at least two oligonucleotides wherein at least one oligonucleotide comprises a sequence having a length of at least 9 nucleotides which hybridizes to a pretreated nucleic acid sequence according to one of SEQ ID NOS:5, 6, 13 and 14, and further at least one oligonucleotide comprises a sequence having a length of at least 9 nucleotides which hybridizes to a pretreated nucleic acid sequence according to one of SEQ ID NOS:7-20.
The fragments obtained by means of the amplification can carry a directly or indirectly detectable label. Preferred are labels in the form of fluorescence labels, radionuclides, or detachable molecule fragments having a typical mass which can be detected in a mass spectrometer. Where said labels are mass labels, it is preferred that the labeled amplificates have a single positive or negative net charge, allowing for better detectability in the mass spectrometer. The prognosis may be carried out and visualized by means of, e.g., matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
Matrix Assisted Laser Desorption/Ionization Mass Spectrometry (MALDI-TOF) is a very efficient development for the analysis of biomolecules (Karas & Hillenkamp, Anal Chem., 60:2299-301, 1988). An analyte is embedded in a light-absorbing matrix. The matrix is evaporated by a short laser pulse thus transporting the analyte molecule into the vapour phase in an unfragmented manner. The analyte is ionized by collisions with matrix molecules. An applied voltage accelerates the ions into a field-free flight tube. Due to their different masses, the ions are accelerated at different rates. Smaller ions reach the detector sooner than bigger ones. MALDI-TOF spectrometry is well suited to the analysis of peptides and proteins. The analysis of nucleic acids is somewhat more difficult (Gut & Beck, Current Innovations and Future Trends, 1:147-57, 1995). The sensitivity with respect to nucleic acid analysis is approximately 100-times less than for peptides, and decreases disproportionally with increasing fragment size. Moreover, for nucleic acids having a multiply negatively charged backbone, the ionization process via the matrix is considerably less efficient. In MALDI-TOF spectrometry, the selection of the matrix plays an eminently important role. For desorption of peptides, several very efficient matrixes have been found which produce a very fine crystallisation. There are now several responsive matrixes for DNA, however, the difference in sensitivity between peptides and nucleic acids has not been reduced. This difference in sensitivity can be reduced, however, by chemically modifying the DNA in such a manner that it becomes more similar to a peptide. For example, phosphorothioate nucleic acids, in which the usual phosphates of the backbone are substituted with thiophosphates, can be converted into a charge-neutral DNA using simple alkylation chemistry (Gut & Beck, Nucleic Acids Res. 23: 1367-73, 1995). The coupling of a charge tag to this modified DNA results in an increase in MALDI-TOF sensitivity to the same level as that found for peptides. A further advantage of charge tagging is the increased stability of the analysis against impurities, which makes the prognosis of unmodified substrates considerably more difficult.
In the fourth step of the method, the amplificates obtained during the third step of the method are analysed in order to ascertain the methylation status of the CpG dinucleotides prior to the treatment.
In embodiments where the amplificates were obtained by means of MSP amplification, the presence or absence of an amplificate is in itself indicative of the methylation state of the CpG positions covered by the primer, according to the base sequences of said primer.
Amplificates obtained by means of both standard and methylation specific PCR may be further analyzed by means of hybridization-based methods such as, but not limited to, array technology and probe based technologies as well as by means of techniques such as sequencing and template directed extension.
In one embodiment of the method, the amplificates synthesised in step three are subsequently hybridized to an array or a set of oligonucleotides and/or PNA probes. In this context, the hybridization takes place in the following manner: the set of probes used during the hybridization is preferably composed of at least 2 oligonucleotides or PNA-oligomers; in the process, the amplificates serve as probes which hybridize to oligonucleotides previously bonded to a solid phase; the non-hybridized fragments are subsequently removed; said oligonucleotides contain at least one base sequence having a length of at least 9 nucleotides which is reverse complementary or identical to a segment of the base sequences specified in the present Sequence Listing; and the segment comprises at least one CpG, TpG or CpA dinucleotide.
In a preferred embodiment, said dinucleotide is present in the central third of the oligomer. For example, wherein the oligomer comprises one CpG dinucleotide, said dinucleotide is preferably the fifth to ninth nucleotide from the 5â˛-end of a 13-mer. One oligonucleotide exists for the analysis of at least one CpG dinucleotide within the sequence according to SEQ ID NO: 1 and in a further embodiment said set further comprises one oligonucleotide for the analysis of at least one CpG dinucleotide within the sequence according to contains to SEQ ID NOS:2-4, and the equivalent positions within SEQ ID NOS:5 to SEQ ID NO: 12 & SEQ ID NOS:15 to SEQ ID NO:20. Said oligonucleotides may also be present in the form of peptide nucleic acids. The non-hybridized amplificates are then removed. The hybridized amplificates are then detected. In this context, it is preferred that labels attached to the amplificates are identifiable at each position of the solid phase at which an oligonucleotide sequence is located.
In yet a further embodiment of the method, the genomic methylation status of the CpG positions may be ascertained by means of oligonucleotide probes that are hybridised to the bisulfite treated DNA concurrently with the PCR amplification primers (wherein said primers may either be methylation specific or standard).
A particularly preferred embodiment of this method is the use of fluorescence-based Real Time Quantitative PCR (Heid et al., Genome Res. 6:986-994, 1996; also see U.S. Pat. No. 6,331,393) employing a dual-labeled fluorescent oligonucleotide probe (TaqMan⢠PCR, using an ABI Prism 7700 Sequence Prognosis System, Perkin Elmer Applied Biosystems, Foster City, Calif.). The TaqMan⢠PCR reaction employs the use of a nonextendible interrogating oligonucleotide, called a TaqMan⢠probe, which, in preferred embodiments, is designed to hybridize to a GpC-rich sequence located between the forward and reverse amplification primers. The TaqMan⢠probe further comprises a fluorescent âreporter moietyâ and a âquencher moietyâ covalently bound to linker moieties (e.g., phosphoramidites) attached to the nucleotides of the TaqMan⢠oligonucleotide. For analysis of methylation within nucleic acids subsequent to bisulfite treatment, it is required that the probe be methylation specific, as described in U.S. Pat. No. 6,331,393, (hereby incorporated by reference in its entirety) also known as the Methylight⢠assay. Variations on the TaqMan⢠prognosis methodology that are also suitable for use with the described invention include the use of dual-probe technology (Lightcyclerâ˘) or fluorescent amplification primers (Sunrise⢠technology). Both these techniques may be adapted in a manner suitable for use with bisulfite treated DNA, and moreover for methylation analysis within CpG dinucleotides.
A further suitable method for the use of probe oligonucleotides for the assessment of methylation by analysis of bisulfite treated nucleic acids. In a further preferred embodiment of the method, the fourth step of the method comprises the use of template-directed oligonucleotide extension, such as MS-SNuPE⢠as described by Gonzalgo & Jones, Nucleic Acids Res. 25:2529-2531, 1997.
In yet a further embodiment of the method, the fourth step of the method comprises sequencing and subsequent sequence analysis of the amplificate generated in the third step of the method (Sanger F., et al., Proc Natl Acad Sci USA 74:5463-5467, 1977).
Best mode: In the most preferred embodiment of the method the nucleic acid according to SEQ ID NO:1 is isolated and treated according to the first three steps of the method outlined above, namely:
Wherein the subsequent amplification of d) is carried out by means of methylation specific primers, as described above, said methylation specific primers comprise a sequence having a length of at least 9 nucleotides which hybridizes to a pretreated nucleic acid sequence according to one of SEQ ID NOS: 5, 6, 13 and 14 and sequences complementary thereto, wherein the base sequence of said oligomers comprises at least one CpG dinucleotide.
It is also preferred that said set of MSP primer oligonucleotides further includes at least two oligonucleotides whose sequences comprise a sequence having a length of at least 9 nucleotides which hybridizes to a pretreated nucleic acid sequence according to one or more of SEQ ID NOS:7-20.
Step e) of the method, namely the analysis of the specific amplificates indicative of the methylation status of one or more CpG positions according to SEQ ID NO:1, and in further embodiments of one or more CpG positions according to SEQ ID NOS:2-4 is carried out by means of real-time prognosis methods as described above.
In an alternative most preferred embodiment of the method the subsequent amplification of d) is carried out in the presence of blocking oligonucleotides, as described above. Said blocking oligonucleotides comprising a sequence having a length of at least 9 nucleotides which hybridizes to a pretreated nucleic acid sequence according to one of SEQ ID NOS: 5, 6, 13 and 14 and sequences complementary thereto.
In a further embodiment it is preferred that said set of blocking oligonucleotides includes at least one oligonucleotides sequence having a length of at least 9 nucleotides which hybridizes to a pretreated nucleic acid sequence according to one of SEQ ID NOS: 5, 6, 13 and 14 and sequences complementary thereto and furthermore at least one oligonucleotides sequence having a length of at least 9 nucleotides which hybridizes to a pretreated nucleic acid sequence according to one of SEQ ID NOS:7-20.
Step e) of the method, namely the prognosis of the specific amplificates indicative of the methylation status of one or more CpG positions according to SEQ ID NOS:1 to SEQ ID NO:4 is carried out by means of real-time prognosis methods as described above.
Additional embodiments of the invention provide a method for the analysis of the methylation status of genomic DNA according to the invention (SEQ ID NO:1, and in further embodiments SEQ ID NOS:2 to SEQ ID NO:4, and complements thereof) without the need for pretreatment.
It is preferred that the methylation of at least one CpG dinucleotide of SEQ ID NO:1 is analysed. In a further embodiment the methylation status of at least one CpG dinucleotide of SEQ ID NO:1 and one or more sequences selected from the group consisting SEQ ID NOS:2-4 are analysed.
In the first step of such additional embodiments, the genomic DNA sample is isolated from tissue or cellular sources. Preferably, such sources include colon cell lines, histological slides or tissue embedded in paraffin. In the second step, the genomic DNA is extracted. This may be by any means standard in the art, including the use of commercially available kits. Briefly, wherein the DNA of interest is encapsulated in by a cellular membrane the biological sample must be disrupted and lysed by enzymatic, chemical or mechanical means. The DNA solution may then be cleared of proteins and other contaminants e.g., by digestion with proteinase K. The genomic DNA is then recovered from the solution. This may be carried out by means of a variety of methods including salting out, organic extraction or binding of the DNA to a solid phase support. The choice of method will be affected by several factors including time, expense and required quantity of DNA.
In a preferred embodiment, the DNA may be cleaved prior to the treatment, and this may be by any means standard in the state of the art, in particular with methylation-sensitive restriction endonucleases.
In the third step, the DNA is then digested with one or more methylation sensitive restriction enzymes. The digestion is carried out such that hydrolysis of the DNA at the restriction site is informative of the methylation status of a specific CpG dinucleotide.
In the fourth step, which is optional but a preferred embodiment, the restriction fragments are amplified. This is preferably carried out using a polymerase chain reaction, and said amplificates may carry suitable detectable labels as discussed above, namely fluorophore labels, radionuclides and mass labels.
In the fifth step the amplificates are detected. The prognosis may be by any means standard in the art, for example, but not limited to, gel electrophoresis analysis, hybridization analysis, incorporation of detectable tags within the PCR products, DNA array analysis, MALDI or ESI analysis.
In the final step the of the method the presence or absence of colon cell proliferative disorder is deduced based upon the methylation state of at least one CpG dinucleotide sequence of the analysed genes. Most preferably the presence or absence of colon cell proliferative disorder is deduced based upon the methylation state of at least one CpG dinucleotide sequence of SEQ ID NO 1 or an average, or a value reflecting an average methylation state of a plurality of CpG dinucleotide sequences of SEQ ID NO 1. In a further embodiment the presence or absence of colon cell proliferative disorder is deduced based upon the methylation state of at least one CpG dinucleotide sequence of SEQ ID NO 1 and at least one sequences selected from SEQ ID NOS:2-4 or an average, or a value reflecting an average methylation state of a plurality of CpG dinucleotide sequences of SEQ ID NO 1 and at least one sequences selected from SEQ ID NOS:2-4.
Prognostic Assays for colon cell proliferative disorders: The present invention enables prognosis of events which are disadvantageous to patients or individuals with colon cancer by analysis of aberrant genomic methylation patterns. Most preferably such a prognosis is based on important genetic and/or epigenetic parameters within the gene APC and/or its regulatory sequences, including that according to SEQ ID NO: 1 alone or in combination with at least one sequence selected from the group consisting SEQ ID NOS:2 to 4 may be used as markers. Said parameters obtained by means of the present invention may be compared to another set of genetic and/or epigenetic parameters, the differences serving as the basis for a diagnosis and/or prognosis of events which are disadvantageous to patients or individuals.
Specifically, the present invention provides for diagnostic cancer assays based on measurement of differential methylation of one or more CpG dinucleotide sequences of genomic sequences. In a preferred embodiment said sequence being SEQ ID NO:1 alone or in combination with at least one sequence selected from the group consisting SEQ ID NOS:2 to 4, or of subregions thereof that comprise such a CpG dinucleotide sequence. Typically, such assays involve obtaining a tissue sample from a test tissue, performing an assay to measure the methylation status of at least one of one or more CpG dinucleotide sequences of SEQ ID NO:1 alone or in combination with at least one sequence selected from the group consisting SEQ ID NOS:2 to 4 and derived from the tissue sample, relative to a control sample, or a known standard and making a diagnosis or prognosis based thereon.
In particular preferred embodiments, inventive oligomers are used to assess the CpG dinucleotide methylation status, such as those based on SEQ ID NO:1 alone or in combination with at least one sequence selected from the group consisting SEQ ID NOS:2 to 4 and, as well as in kits based thereon and useful for the diagnosis and/or prognosis of colon cell proliferative disorders.
Kits: Moreover, an additional aspect of the present invention is a kit comprising, for example: a bisulfate-containing reagent; a set of primer oligonucleotides containing at least two oligonucleotides whose sequences in each case correspond, are complementary, or hybridize under stringent or highly stringent conditions to a 16-base long segment of the sequences SEQ ID NOS: 1, 5, 6, 7, 13 and 14 alone or in combination with at least one sequence selected from the group consisting SEQ ID NOS:2 to 4, 7 to 20; oligonucleotides and/or PNA-oligomers; as well as instructions for carrying out and evaluating the described method.
In a further preferred embodiment, said kit may further comprise standard reagents for performing a CpG position-specific methylation analysis, wherein said analysis comprises one or more of the following techniques: MS-SNuPEâ˘, MSP, MethyLightÂŽ, HeavyMethylâ˘, COBRAâ˘, and nucleic acid sequencing. However, a kit along the lines of the present invention can also contain only part of the aforementioned components.
Typical reagents (e.g., as might be found in a typical COBRA-based kit) for COBRA analysis may include, but are not limited to: PCR primers for specific gene (or methylation-altered DNA sequence or CpG island); restriction enzyme and appropriate buffer; gene-hybridization oligo; control hybridization oligo; kinase labeling kit for oligo probe; and radioactive nucleotides. Additionally, bisulfate conversion reagents may include: DNA denaturation buffer; sulfonation buffer; DNA recovery reagents or kits (e.g., precipitation, ultrafiltration, affinity column); desulfonation buffer; and DNA recovery components.
Typical reagents (e.g., as might be found in a typical MethyLightÂŽ-based kit) for MethyLightÂŽ analysis may include, but are not limited to: PCR primers for specific gene (or methylation-altered DNA sequence or CpG island); TaqManÂŽ probes; optimized PCR buffers and deoxynucleotides; and Taq polymerase.
Typical reagents (e.g., as might be found in a typical Ms-SNuPE-based kit) for Ms-SNuPE⢠analysis may include, but are not limited to: PCR primers for specific gene (or methylation-altered DNA sequence or CpG island); optimized PCR buffers and deoxynucleotides; gel extraction kit; positive control primers; Ms-SNuPE⢠primers for specific gene; reaction buffer (for the Ms-SNuPE⢠reaction); and radioactive nucleotides. Additionally, bisulfite conversion reagents may include: DNA denaturation buffer; sulfonation buffer; DNA recovery regents or kit (e.g., precipitation, ultrafiltration, affinity column); desulfonation buffer; and DNA recovery components.
Typical reagents (e.g., as might be found in a typical MSP-based kit) for MSP analysis may include, but are not limited to: methylated and unmethylated PCR primers for specific gene (or methylation-altered DNA sequence or CpG island), optimized PCR buffers and deoxynucleotides, and specific probes.
The described invention further provides a composition of matter useful for determining the presence of metastasis of colon cell proliferative disorders or determining likelihood of development thereof. Said composition comprising at least one nucleic acid 18 base pairs in length of a segment of the nucleic acid sequence disclosed Table 1, and one or more substances taken from the group comprising: magnesium chloride, dNTP, taq polymerase, bovine serum albumen. It is preferred that said composition of matter comprises a buffer solution appropriate for the stabilization of said nucleic acid in an aqueous solution and enabling polymerase based reactions within said solution. Suitable buffers are known in the art and commercially available.
It is particularly preferred that the composition of matter comprises one of the following groups of nucleic acids SEQ ID NO: 21-23; SEQ ID NO:24-26; SEQ ID NO:27-29; SEQ ID NO:30-32; SEQ ID NO:33-35; SEQ ID NO:36-38; SEQ ID NO:39-41; SEQ ID NO:42-44. Particularly preferred is a composition of matter comprising SEQ ID NO:36-38.
While the present invention has been described with specificity in accordance with certain of its preferred embodiments, the following example serves only to illustrate the invention and is not intended to limit the invention within the principles and scope of the broadest interpretations and equivalent configurations thereof.
Metastatic lesions were obtained from 24 patients (13 male, 11 female, median age 64.5 yrs, range 41-79) with colorectal cancer that developed liver metastasis after prior successful colon cancer resection. In 2 patients the primary colon cancer and a single liver metastasis were resected at the same time. Primary colon cancer tissue was obtained by surgical resection from 39 patients (26 male, 13 female; median age of 74 years, range 40-93 years) with sporadic colorectal cancer. In 14 of these patients corresponding non-cancer colon tissue was also obtained from a tumor-free location which was at least 2 cm distant from the tumor and which was confirmed to be without any tumor cell infiltration by histology. Immediately after surgery, tissue samples were put in liquid nitrogen and stored at â80° C. until use. Formalin fixed tissues were processed as previously described and sections were stained with hematoxylin and eosin (H&E) for histological evaluation. Tumor stages were assessed using the TNM-system.
DNA extraction: Genomic DNA of all samples was extracted from the tissues using the proteinase K digestion method.
Western blot Analysis: Sixteen patients were selected for the analysis from the non-tumorous colon, colon cancer and liver metastases were lysed in a buffer containing 1 mM EDTA, 50 mM β-glycerophosphate, 2 mM sodium orthovanadate, 1% Triton-100, 10% glycerol, 1 mM DTT and protease inhibitors (10 mg/ml benzamidine, 2 mg/ml antipain, and 1 mg/ml leupeptin). The protein concentration of the supernatants was determined by the BCA assay (Bio-rad). Twenty Οg protein of each sample was adjusted to Laemmli buffer composition [2% SDS, 10% glycerol, 62.5 mM Tris-HCl (pH 6.8), 100 mM DTT, and 0.1% bromphenol blue], denatured by heating at 95° C. for 5 min, and subsequently separated on 5% polyacrycamide gels by SDS-gel electrophoresis. After separation, proteins were transferred onto immuno-Blot polyvinylidene difluoride (PVDF) membrane (Bio-rad). The membrane was blocked in 5% non-fat milk in 1% TBST for 1 h at room temperature, and then incubated with 1:200 anti-APC(C-20) antibody (Santa Cruz Biotechology, Santa Cruz, Calif.) overnight at 4° C. Membranes were then washed three times in Tris-bufferd saline/0.1% Tween 20, incubated for 2 h with peroxidase-labeled anti-rabbit IgG (1:2500, KPL) diluted in blocking solution. Membrane-bound secondary antibodies were detected by an enhanced chemiluminescence method following the instructions of the manufacturer (ECL plus western blotting detection reagents, Amersham Biosciences).
In the Western blot analysis, two isoforms of the APC protein (300 and 200 kDa, respectively) were observed while no truncated APC proteins was detected. In general, the level of both APC isoforms was decreased in 10 primary cancer tissues when compared with the corresponding normal colon tissues. However, APC protein levels were similar in 2 liver metastases and increased in 2 liver metastases when compared with the corresponding normal colon tissues. In one matched primary colon cancer and liver metastasis tissues the expression of APC protein was completely absent, while in one case APC protein levels were higher in the liver metastasis than in corresponding primary colon cancer. Furthermore, when we compared the APC protein levels in tumor tissues with the presence of APC promoter methylation, we observed no significant difference among the tissues with methylation of the APC promoter versus cases without methylation (Table 1, FIG. 2).
Immunohistochemistry: The distribution and expression pattern of APC protein in 12 out of these 16 patients selected for western blot analysis were also investigated by immunohistochemistry. Tissue samples used for immunohistochemistry analysis had been obtained after surgery, fixed in 10% neutralized formalin and embedded in paraffin. Deparaffinized sections were stained using H&E. For immunostaining of paraffin-embedded sections, the slides were deparaffinized and rehydrated in a graded alcohol series. Immunostaining was performed with the anti-APC(C-20) antibody (Santa Cruz, Calif.) directed against human APC (dilution 1:20). Incubation with the primary antibody was performed in a moist chamber at 37° C. for 1 hour. Polyvalent anti-rabbit IgG (30 min, room temperature; Immunotech, Marseilles, France) served as a secondary antibody. Slides were washed between steps with Tris-buffered saline. Immunoreactions were visualized via a streptavidin-biotin complex, using the Vectastain ABC alkaline phosphatase kit (distributed by CAMON, Wiesbaden, Germany). Neufuchsin (Sigma-Aldrich, Steinheim, Germany) served as chromogen. The specimens were counter-stained with hematoxylin. Primary antibodies were omitted for negative controls. Evaluation of the slides was performed by an experienced pathologist who was blinded to the results of the methylation analysis (see below). Immunostaining was graded semiquantitatively as negative, weak, moderate, or strong corresponding to positive staining of 0%, <10%, 10-50%, or more than 50% of the total cells.
Results.
APC was found in the cytoplasm of each of the samples obtained from non-tumorous mucosal epithelium, tumorous epithelium of the primary tumor site, lymph node metastases and liver metastases. The intensity of immunostaining and the number of immunoreactive cells was decreased in tumorous epithelium of 5 patients, when compared with the corresponding non-tumorous epithelium. The expression of APC was similar in tumorous and non-tumorous epithelium of 3 patients, as well as in the primary tumor and lymph node metastases of 4 patients.
MethyLight Analysis of APC Gene: Methylation analysis of genomic DNA of all samples was analyzed by the MethyLight⢠technique after bisulfite conversion as previously reported by Eads et al. (Eads, C. A., Danenberg, K. D., Kawakami, K., Saltz, L. B., Blake, C., Shibata, D., Danenberg, P. V., Laird, P. W. (2000) MethyLight: a high-throughput assay to measure DNA methylation. Nucleic Acids Res., 28, E32).
Briefly, two locus-specific PCR primers flank an oligonucleotide probe with a 5Ⲡfluorescent reporter dye (6FAM) and a 3Ⲡquencher dye (BHQ-1). For this analysis primers and probes are specifically designed to bind to bisulfite-converted DNA, which generally span 7 to 10 CpG dinucleotides. The gene of interest is then amplified and normalized to a reference set (β-actin). The specificity of the reactions for methylated DNA is confirmed using unmethylated human sperm DNA and CpGenome Universal Methylated DNA (Chemicon Inc.). TaqMan PCR reactions are performed in parallel with primers specific for the bisulfite-converted methylated sequence for a particular locus and with the ACTB reference primers. The ratio between the values is calculated in these two TaqMan analyses. The extent of methylation at a specific locus is determined by the following formula: [(gene/actb)sample:(gene/actb)SssI-treated genomic DNA]*100. A cut off value of 4% gave the best discrimination between normal and cancerous samples, as previously reported. Therefore, samples with â§4% fully methylated molecules were termed methylated, whereas samples with <4% were considered unmethylated. The primer and probe sequences for APC promoter analysis (GeneBank accession number U02509) are: forward primer (5â˛-3â˛): GAA CCA AAA CGC TCC CCA T SEQ ID NO: 36; reverse primer (5â˛-3â˛): TTA TAT GTC GGT TAC GTG CGT TTA TAT SEQ ID NO: 37; probe sequence (5â˛-3â˛): 6FAM-CCC GTC GAA AAC CCG CCG ATT A-BHQ1 SEQ ID NO: 38 (as listed in Table 1).
Statistical Analysis: The PMR (percentage of methylated reference) values of the Methylight⢠assays were dichotomized for statistical purposes as previously reported by Eads et al. The frequency of APC promoter methylation in primary and metastatic colon cancers was compared by Fisher's exact test. All tests were two-sided, and a p-value of <0.05 was considered statistically significant.
Results.
Using the Methylight assay, the promoter 1A methylation status of the APC gene in 39 primary colon cancers and 14 corresponding samples from non-neoplastic colon mucosa was assessed. Seven cancers exhibited a PMR >4% (7/39) APC promoter methylation was not observed in any of the 14 non neoplastic colon samples (FIG. 1A). The frequency of APC promoter methylation in 24 liver metastatases was then assessed and compared with the frequency thereof in the 39 primary colon cancers. In this series, primary colon cancer and liver metastases were obtained from the same patients in two cases, while the remaining 22 liver metastasis and 37 primary colon cancer samples were obtained from separate patient populations. The analysis showed a higher frequency of APC promoter methylation in metastatic colon cancer (10/24) compared with primary colon cancer (7/39) (p=0.047), although in the two matched primary colon cancer and metastatic tissues, no APC promoter methylation was observed in both the primary cancer and liver metastasis (FIG. 1B).
Using the Methylight assay, APC promoter 1A methylation was observed in 7 of 39 (17.95%) primary colorectal cancers and in none of the matched non-neoplastic colon mucosa samples. Furthermore, a significantly higher frequency (41.67%) of APC promoter methylation in liver metastases of colorectal cancers was observed.
Although the majority of the primary cancers and the liver metastases in this study were from different patients, the fact that APC promoter was more frequently methylated in the liver metastases of colon cancer still indicates that the epigenetic change of the APC gene plays a role in the progression of colorectal cancer. There are two possibilities for the contribution of APC promoter methylation to the metastasis of colorectal cancer; one possibility is that methylation of APC gene promoter occurs early in colorectal cancer and increases during disease progression. Moreover, our results also indicate the other possibility that methylation of the APC gene promoter may occur de novo in the metastatic cancer cells even in the absence of methylation in the primary cancer cells.
Furthermore, APC protein expression in a subset of primary and metastatic colorectal cancer samples was analysed. By Western blot analysis, two isoforms of the APC protein (300 and 200 kDa, respectively) were observed in all non-neoplastic colon mucosa samples, primary tumors and liver metastases. The 300 kDa isoform is the conventional form of the APC protein encoded by exons 1-15 and is critical for the differentiation of intestinal epithelial cells; while the 200 kDa isoform is an alternative splice-form of APC without exon 1 that has been shown to be enriched in non-dividing, terminally-differentiated cells and may contribute to suppression of proliferation (27, 28). In general, the levels of both APC isoforms was decreased in primary cancer tissues when compared with corresponding non-neoplastic mucosa, but APC levels in colon cancer metastases were similar or even increased compared with corresponding non-neoplastic mucosa or primary cancers. The APC protein distribution pattern in non-neoplastic mucosa, colon cancer and liver metastases was also confirmed by immunohistochemistry. Thus, although the APC promoter was more frequently methylated in the liver metastases of colon cancer, there was no significant association between APC promoter methylation and APC protein expression in metastases. From these results it is possible to infer that metastatic cancer cells seem to harbour a heterogenous epigenetic background, in which only few cells exhibit APC promoter methylation. As the Methylight⢠assay detected APC promoter methylation more frequently in metastases compared to primary cancers, this result indicates the presence of methylation independent of the number of cancer cells exhibiting APC methylation. In contrast, APC protein expression was determined in a tissue homogenate including cells with and without APC methylation. Therefore, despite the fact that APC methylation may be detected in these cancer cells, other cancer cells may retain APC expression due to a normal APC gene. Apart from that, even in cells with APC promoter methylation, only one allele may be affected, which may still allow the expression of the unmodified allele.
In summary, it is demonstrated that APC promoter methylation is a frequent epigenetic alteration in colorectal cancer metastases. However, the levels of the APC protein may remain unchanged indicating that metastatic cancer cells seem to either harbour a heterogenous epigenetic background, in which only few cells exhibit APC promoter methylation and others retain APC expression, or that the unaltered second allele still allows sufficient APC expression.
In a further analysis the methylation status of known colon cancer associated marker genes TPEF, p16, TIMP3, DAPK and Caveolin 2 and a novel methylation marker ALX4 were analysed in normal, colon and colon metastasis using the MethyLight⢠assay as described above, with primers and probes according to Table 1. See Table 3 for results of methylation Methylight⢠assays and Table 4 for comparisons of methylation, Western Blot and Immunohistological APC analyses.
| TABLEâ1 |
| ListâofâprimersâandâprobesâusedâforâMethylightâanalysis |
| Gene | forwardâprimerâ(5â˛-3â˛) | reverseâprimerâ(5â˛-3â˛) | probeâsequenceâ(5â˛-3â˛) |
| ALX4 | CGCGGTTTCGATTTTAATGC | ACTCCGACTTAACCCGACGAT | 6FAM- |
| SEQâIDâNO:â21 | SEQâIDâNO:â22 | CGACGAAATTCCTAAC | |
| GCAACCGCTTAA-BHQ1 | |||
| SEQâIDâNO:â23 | |||
| Caveolinâ2 | TTTCGGATGGGAACGGTGTA | CTCCCACCGCCGTTACC | 6FAM- |
| SEQâIDâNO:â24 | SEQâIDâNO:â25 | CCCGTCCTAACCGTCC | |
| GCCCT-BHQ1 | |||
| SEQâIDâNO:â26 | |||
| DAPK | TCGTCGTCGTTTCGGTTAGTT | CCCTCCGAAACGCTATCGA | 6FAM- |
| SEQâIDâNO:â27 | SEQâIDâNO:â28 | CGACCATAAACGCCAA | |
| CGCCG-BHQ1 | |||
| SEQâIDâNO:â29 | |||
| TPEF | TTTTTTTTTCGGACGTCGTTG | CCTCTACATACGCCGCGAAT | 6FAM- |
| SEQâIDâNO:â30 | SEQâIDâNO:â31 | AATTACCGAAAACATC | |
| GACCGA-BHQ1 | |||
| SEQâIDâNO:â32 | |||
| p16/INK4A | TGGAATTTTCGGTTGATTGGTT | AACAACGTCCGCACCTCCT | 6FAM- |
| SEQâIDâNO:â33 | SEQâIDâNO:â34 | ACCCGACCCCGAACCG | |
| CG-BHQ1 | |||
| SEQâIDâNO:â35 | |||
| APC | GAACCAAAACGCTCCCCAT | TTATATGTCGGTTACG | 6FAM- |
| SEQâIDâNO:â36 | TGCGTTTATAT | CCCGTCGAAAACCCGC | |
| SEQâIDâNO:â37 | CGATTA-BHQ1 | ||
| SEQâIDâNO:â38 | |||
| TIMP3 | GCGTCGGAGGTTAAGGTTGTT | CTCTCCAAAATTACCGTACGCG | 6FAM- |
| SEQâIDâNO:â39 | SEQâIDâNO:â40 | AACTCGCTCGCCCGCC | |
| GAA-BHQ1 | |||
| SEQâIDâNO:â41 | |||
| Caveolin | TTTCGGATGGGAACGGTGTA | CTCCCACCGCCGTTACC | 6FAM- |
| SEQâIDâNO:â42 | SEQâIDâNO:â43 | CCCGTCCTAACCGTCC | |
| GCCCT-BHQ1 | |||
| SEQâIDâNO:â44 | |||
| TABLE 2 |
| Genes and sequences according to the invention |
| Genomic | Methylated treated | Unmethylated treated | |
| Gene name | SEQ ID NO | SEQ ID NOs: | SEQ ID NOs: |
| APC | 1 | 5 & 6 | 13 & 14 |
| ALX4 | 2 | 7 & 8 | 15 & 16 |
| TPEF | 3 | â9 & 10 | 17 & 18 |
| p16 | 4 | 11 & 12 | 19 & 20 |
| DAPK | 45 | 48 & 49 | 54 & 55 |
| TIMP3 | 46 | 50 & 51 | 56 & 57 |
| Caveolin 2 | 47 | 52 & 53 | 58 & 59 |
| TABLE 3 |
| Summary of results from analysis of gene methylation |
| in primary cancer and metastasis |
| Gene | Normal (n = 21) | Tumor (n = 47) | Metastasis (n = 24) |
| ALX4 | 0/21 | 30/47 | 16/24â |
| TPEF | 1/21 | 36/47 | 19/24â |
| p16 | 0/21 | 15/47 | 6/24 |
| APC | 0/21 | 10/47 | 10/24â |
| TIMP3 | 1/21 | 11/47 | 2/24 |
| DAPK | 0/21 | â1/47 | 0/24 |
| Caveolin 2 | 0/21 | â5/47 | 1/24 |
| TABLE 4 |
| Expression of APC protein in colon cancer: patient |
| characteristics and molecular changes |
| Methylation | Western blot | Immunohistochemistry |
| No | Age | Sex | T | M | N | T | M | N | T | M |
| 1 | 61 | M | + | ++ | + | +++ | +++ | +++a | ||
| 2 | 51 | F | + | ++ | + | +++ | + | +a | ||
| 3 | 66 | F | â | ++ | + | ND | +++ | +++a | ||
| 4 | 63 | M | + | ++ | + | +++ | +++ | ND | ||
| 5 | 62 | F | + | ++ | + | +++ | +++ | ND | ||
| 6 | 55 | M | â | ++ | + | ND | ND | ND | ||
| 7 | 59 | M | â | ++ | ++ | ND | ND | ND | ||
| 8 | 64 | M | â | ++ | + | +++ | +++ | ND | ||
| 9 | 49 | M | â | ++ | + | +++ | ++ | +a | ||
| 10 | 77 | F | â | ++ | + | +++ | ++ | ND | ||
| 11 | 52 | F | + | ++ | ++ | +++ | ++ | ND | ||
| 12 | 70 | M | + | + | ++ | ND | ND | ++b | ||
| 13 | 79 | F | â | + | ++ | ND | ND | +b | ||
| 14 | 65 | M | â | ++ | ++ | ND | ND | +++b | ||
| 15 | 43 | F | â | â | â | ND | ND | ND | ||
| 16 | 74 | F | â | + | ++ | ND | ND | ND | ||
| Legend: M, male; F, female; N, normal colon; T, colon cancer; M, metastasis; | ||||||||||
| aLymph node metastasis; | ||||||||||
| bliver metastasis; ND, not determined; +, positive; â, negative. Immunohistochemical analysis: â, negative; +, <10% expression; ++, 10-50% expression; +++, >50% expression. |
1. An isolated nucleic acid molecule for the detection of metastasis of colon cell proliferative disorders comprising a sequence at least 18 bases in length selected from the group consisting of SEQ ID NOS: 9, 10, 17, and 18.
2. An isolated oligomer for the detection of metastasis of colon cell proliferative disorders, wherein the oligomer comprising at least one base sequence having a length of at least 10 nucleotides which hybridizes to or is identical to one of the nucleic acid sequences selected from the group consisting of SEQ ID NOS: 9, 10, 17, and 18.
3. A kit comprising a bisulfite reagent and at least one oligomer comprising at least one base sequence having a length of at least 10 nucleotides which hybridizes to or is identical to a nucleic acid sequences selected from the group consisting of SEQ ID NO: 9, 10, 17, and 18.
4. The oligomer of claim 2, wherein the oligomer is an oligonucleotide or peptide nucleic acid (PNA)-oligomer.