US20120288864A1
2012-11-15
13/557,590
2012-07-25
The invention relates to the detection of Salmonella by nucleic acid amplification. The invention provides primer and probe oligonucleotides that can be used in multiplex to detect Salmonella in real-time amplification. The oligonucleotides of the invention detect all group I serovars, and have an increased Salmonella detection range: they enable to cover the seven Salmonella groups. They also have an increased sensitivity, without loss in specificity.
Get notified when new applications in this technology area are published.
C12Q1/689 » CPC main
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
C12Q2600/16 » CPC further
Oligonucleotides characterized by their use Primer sets for multiplex assays
Y02A50/30 » CPC further
in human health protection, e.g. against extreme weather Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
C12Q1/68 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids
The invention relates to the detection of the bacteria of the genus Salmonella. The invention provides oligonucleotides that enable the detection of Salmonella by nucleic acid hybridization, notably by nucleic acid amplification, more particularly, by PCR, advantageously by multiplex amplification (e.g., multiplex PCR), very advantageously, by real-time multiplex amplification (e.g., real-time multiplex PCR).
Salmonella is a genus of bacteria that are causative of severe infections, notably of food or beverage toxi-infections, leading to bacterial enteric illness in both humans and animals, more particularly to salmonellosis, which include gastro-enteritis, as well as typhoid and para-typhoid fevers.
S. enterica subsp. enterica serovar Typhi and some S. enterica subsp. enterica serovar Paratyphi strains are the causative agents of typhoid fever.
There are currently more than 2,500 Salmonella serovars. Millions of human cases are reported worldwide every year, and the diseases result in thousands of deaths.
In recent years, problems related to Salmonella have increased significantly, both in terms of incidence and severity of cases of human salmonellosis.
Prior art method for the detection of Salmonella in food products comprises microbiology methods, which are described in European Standard ISO EN 6579:2002. Such food testing methods comprise lengthy culture steps, namely:
Other methods have been developed, which uses molecular biology, more particularly nucleic acid hybridization.
Illustrative of such methods are the method described in EP 0 721 989 B1 in the names of INSTITUT PASTEUR and INSERM (U.S. Pat. No. 5,824,795; U.S. Pat. No. 6,080,545), wherein oligonucleotides are disclosed to be useful as primers and probes. More particularly, oligonucleotides lag3 and lag6 are disclosed, wherein lag6 can be used as a primer within a primer pair formed with another oligonucleotide, namely lag5, and wherein lag3 can be used as a revealing probe.
The present application relates to an improved set of primers and probe, and to an improved method of Salmonella detection, which do not have the drawbacks of prior art techniques, and which further show unexpected effects and advantages.
The present application notably provides a set of primers and a probe, which can be used in multiplex in the same tube in real-time amplification, and which thereby enables to cover seven Salmonella groups in a single-tube operation. The set of primers and probe of the invention has the further advantage of having an increased sensitivity, without any loss in specificity.
The invention relates to the detection of the bacteria of the genus Salmonella. The invention provides oligonucleotides that enable the detection of Salmonella by nucleic acid hybridization, notably by nucleic acid amplification, more particularly, by PCR, advantageously by multiplex amplification (e.g., multiplex PCR), very advantageously, by real-time multiplex amplification (e.g., real-time multiplex PCR).
The oligonucleotides of the invention have the special advantage of enabling to perform real-time multiplex amplification with increased sensitivity, and wider Salmonella detection range, without loss in specificity.
The oligonucleotides of the invention notably enable to cover the seven Salmonella groups (groups I, II, IIIa, IIIb, IV, V, VI) in real-time multiplex PCR. They further enable to cover all group I serovars.
The detection sensitivity reaches a previously-unattained detection threshold (accurate sensitivity at dilutions of 10â7 or 10â8 for most strains), without loss in specificity.
Illustrative results are shown in the âExamplesâ section below, that show that the oligonucleotides of the invention have a wide Salmonella inclusivity and a sharp sensitivity, even when they are used in real-time multiplex amplification.
FIGS. 1-6 illustrate the curves that are obtained by submitting the nucleic acids of a reference Salmonella strain to real-time PCR using an oligonucleotide set of the invention (multiplex of primers and probe(s)).
For each strain, three oligonucleotide sets are compared:
FIG. 1: S. enterica subsp. salamae (group II) strain CIP 82.29;
FIG. 2: S. enterica subsp. arizonae (group IIIa) strain CIP 82.30;
FIG. 3: S. enterica subsp. diarizonae (group IIIb) strain CIP 82.31;
FIG. 4: S. enterica subsp. houtanae (group IV) strain CIP 82.32;
FIG. 5: S. bongori (group V) strain CIP 82.33;
FIG. 6: S. enterica subsp. indica (group VI) strain CIP 102501.
In the present application, the Salmonella nomenclature is that of Le Minor and Popoff, 1987 (Le Minor L and Popoff M Y, âRequest for an opinion. Designation of Salmonella enterica sp. nov., nom. rev., as the type and only species of the genus Salmonellaâ, Int. J. Syst. Bacteriol. 1987; 37: 465-468).
The genus Salmonella is divided into two species, S. enterica and S. bongori. S. enterica is divided into six groups (groups I, II, IIIa, IIIb, IV, and VI). S. bongori contains one group (group V); see table 1 below.
| TABLE 1 | ||
| Accession number of | ||
| Name | the reference strains | Group |
| S. enterica subsp. enterica | CIP 60.62 | I |
| (serovar Typhimurium) | ||
| S. enterica subsp. salamae | CIP 82.29 | II |
| S. enterica subsp. arizonae | CIP 82.30 | IIIa |
| S. enterica subsp. diarizonae | CIP 82.31 | IIIb |
| S. enterica subsp. houtanae | CIP 82.32 | IV |
| S. bongori | CIP 82.33 | V |
| S. enterica subsp. indica | CIP 102501 | VI |
Each of these strains is available from the C.N.C.M. (Collection Nationale de Cultures de Microorganismes; Institut Pasteur; 25, rue du Docteur Roux; F-75724 Paris Cedex 15; France). The CIP number is the C.N.C.M. strain deposit number.
A detailed description of the nomenclature and taxonomy of the genus Salmonella, as well as alternative strain sources (ATCC, DSM, etc.), can further be found in Tindall et al. 2005 (International Journal of Systemic and Evolutionary Microbiology, 2005, 55: 521-524), and Popoff et al, 2000 (Supplement 1998 (no. 42) to the Kauffmann-White scheme Res. Microbiol. 2000; 151: 63-65).
In the present application, reference is made to the following SEQ ID oligonucleotides:
| TABLEâ2 | |||
| SEQâIDâNO: | |||
| lag3-2 | CACGCAGGAAATAACAGGACTT | Salmonellaâ(forward)âprimer | 1 |
| (claimâsub-setâD) | |||
| lag3-2C | CAAGCATGAAATAACAGGGCTT | Salmonellaâ(forward)âprimer | 2 |
| (claimâsub-setâA) | |||
| lag6-2 | GGGCAACCAGCACTAAC | Salmonellaâ(reverse)âprimer | 3 |
| (claimâsub-setâC) | |||
| lag6-2C1 | GAGCAACCAGTACTAATGG | Salmonellaâ(reverse)âprimer | 4 |
| (claimâsub-setâB) | |||
| MBSal1spe | TGTCAGAATAGTGAGCGTGCCTTAC | Salmonellaâprobe | 5 |
| MBSal1 | cgcgacTGTCAGAATAGTGAGCGTGCCTTACgtcgcg | Salmonellaâprobeâwithâone | 6 |
| beaconâarmâatâeachâend | |||
| CaptModâspe | AATAGTGAGCGTGCCTTACCGACG | Salmonellaâprobe | 7 |
| CaptMod | cgcagcAATAGTGAGCGTGCCTTACCGACGgctgcg | Salmonellaâprobeâwithâone | 8 |
| beaconâarmâatâeachâend | |||
The invention relates to a set of oligonucleotides, more particularly to this set, for use as a primer set, still more particularly for use as a primer set in the amplification of at least one nucleic acid from a Salmonella bacterium, advantageously, for use as a primer set that enables to cover the seven Salmonella groups in a single-tube experiment.
Indeed, said oligonucleotides are especially adapted to be used in multiplex in the same tube to amplify at least one nucleic acid from the nucleic acid material of Salmonella strains belonging to groups I, II, IIIa, IIIb, IV, V and VI. They can be used in multiplex in the same tube, without loss of specificity. Advantageously, when they are used in multiplex, the sensitivity of the amplification reaction is increased.
They also enable to amplify all group I serovars, and notably the following S. enterica subsp. enterica serovars: S. Typhimurium, S. Typhi, S. Paratyphi, S. Virchow, S. Hadar, S. Enteritidis, S. Anatum, S. Senftenberg, S. Cerro, S. Poona, S. Grumpensis, S. Dalhem, S. Kentucky, S. Lomita, S. Kirkee, S. Bredeney, S. Carrau, S. Aberdeen, S. Tenessee.
Said set comprises at least three oligonucleotides selected from:
Said set of oligonucleotides may comprise at least four oligonucleotides selected from:
Preferably, said conservative fragment or variant of sub-set A has retained the capacity of amplifying at least one nucleic acid from the nucleic acid material of at least one Salmonella strain of each the seven Salmonella groups (groups I, II, IIIa, IIIb, IV, V, VI), preferably of each of the seven following Salmonella strains (=Salmonella reference strains):
Preferably, said conservative fragment or variant of sub-set B has retained the capacity of amplifying at least one nucleic acid from the nucleic acid material of at least one Salmonella strain of each the seven Salmonella groups (groups I, II, IIIa, IIIb, IV, V, VI), preferably of each of the seven following Salmonella strains (=Salmonella reference strains):
Preferably, said conservative fragment or variant of sub-set C has retained the capacity of amplifying at least one nucleic acid from the nucleic acid material of at least one Salmonella strain of each the seven Salmonella groups (groups I, II, IIIa, IIIb, IV, V, VI), preferably of each of the seven following Salmonella strains (=Salmonella reference strains):
Preferably, said conservative fragment or variant of sub-set D has retained the capacity of amplifying at least one nucleic acid from the nucleic acid material of at least one Salmonella strain of each the seven Salmonella groups (groups I, II, IIIa, IIIb, IV, V, VI), preferably of each of the seven following Salmonella strains (=Salmonella reference strains):
S. enterica subsp. indica strain CIP 102501 (group VI),
when said conservative fragment or variant is used in multiplex with the oligonucleotides of SEQ ID NO: 2, 4 and 3.
The sequence identity percentage of said conservative variant preferably is of at least 88%, more preferably of at least 91%, even more preferably of at least 93%, most preferably of at least 96%.
The skilled person can use any means that he/she finds appropriate to assess whether a given fragment or variant is conservative, i.e., whether it has retained the capacity of amplifying at least one nucleic acid from the nucleic acid material of each of said seven Salmonella strains, when used in multiplex with said other oligonucleotides.
For example, said fragment or variant is placed in multiplex in the same tube with said other oligonucleotides, together with the nucleic acid material of one of said seven Salmonella reference strains, under conditions that are favorable to said fragment or variant and said other oligonucleotides for them to act as amplification primers, to amplify at least one nucleic acid from said nucleic acid material. The same test shall be repeated with each of the six other Salmonella reference strains. The goal of these seven tests is to determine whether said fragment or variant can still function as an amplification primer when placed in the presence of said other oligonucleotides, and whether the resulting set still is a multiplex primer set that covers said seven reference Salmonella strains. If so, the candidate fragment or variant is a conservative fragment or variant.
To implement such tests, any experimental conditions that the skilled person may find appropriate can be used. Such experimental conditions notably include standard PCR experimental conditions, such as experimental conditions comprising:
Other experimental conditions are also described in example 1 below (real-time multiplex PCR).
Any means that the skilled person may find appropriate to detect whether amplification has occurred or not can be used. For example, said variant or fragment and said other oligonucleotides may be labeled by a detectable marker (e.g., radioactive label, fluorescent label, etc.). Preferably, one or several probes can be used to detect the presence of an amplicon. Said probe(s) can be directly or indirectly labeled, to enable an easy detection thereof. For example, a probe can bear a label (e.g., a fluorescent label) at one of its ends, either directly or indirectly (e.g., beacon probe). A preferred probe is the probe of SEQ ID NO: 6, or the sequence that is fully complementary thereto, over the entire length of said sequence of SEQ ID NO: 6. In example 1 below, experimental conditions are described which make use of the probe of SEQ ID NO: 6 in beacon format (FAM label).
Hence, as illustrated in example 1, an illustrative method to determine whether a candidate conservative variant or fragment has retained the capacity of amplifying at least one nucleic acid from the nucleic acid material of each of said seven Salmonella strains, when used in multiplex with said three other oligonucleotides, is a real-time multiplex PCR, which is performed for each of said seven Salmonella strains as follows:
If said candidate conservative variant or fragment can be considered to have retained said capacity of amplification, the four primers hybridize to a nucleic acid for each of said seven Salmonella strains, thereby enabling the elongation of the targeted sequence for each of said seven Salmonella strains. This hybridization and elongation result in the production of an amplicon, to which the real-time probe of SEQ ID NO: 6 anneals. The probe of SEQ ID NO: 6 being a beacon probe, a fluorescence signal is emitted in real-time through its FAM label. Hence, said candidate conservative variant or fragment can be considered to have retained said capacity of amplification, when a fluorescence signal can be detected for each of said seven Salmonella strains, and preferably when a Ct value can be measured for each of said seven Salmonella strains.
Preferably, said conservative fragment or variant consists of at least 14 nucleotides, more preferably of at least 15 nucleotides, even more preferably of at least 16 nucleotides.
Said conservative fragment consists of at most the total number of the parent oligonucleotide minus 1.
Preferably, said conservative variant is of at most 26 nucleotides, more preferably of at most 25 nucleotides, even more preferably of at most 24 nucleotides.
Preferably, said conservative variant consists of 14 to 26 nucleotides, more preferably of 15 to 25 nucleotides, even more preferably of 16 to 24 nucleotides.
Preferably, said conservative variant is a variant by substitution and/or deletion, more preferably by substitution or deletion, most preferably by substitution.
Preferably, said conservative variant is a variant of the reference oligonucleotide of the sub-set to which it belongs, i.e., a variant of SEQ ID NO: 2 for sub-set A, SEQ ID NO: 4 for sub-set B, SEQ ID NO: 3 for sub-set C, SEQ ID NO: 1 for sub-set D.
Preferably, said conservative variant is of the same length as the parent oligonucleotide or fragment (e.g., 22 nucleotides when SEQ ID NO: 1 or 2 is the parent oligonucleotide; 17 nucleotides when SEQ ID NO: 3 is the parent oligonucleotide; 19 nucleotides when SEQ ID NO: 4 is the parent oligonucleotide).
Based on a sequence identity of at least 85%, the number of oligonucleotide variation(s) can be e.g., of:
Said set may consist of three or four oligonucleotides.
Preferably, said set comprises:
The invention also relates to sets of oligonucleotides, which comprises at least two oligonucleotides selected from the above-mentioned set of at least three, or of at least four oligonucleotides.
In a set of at least two oligonucleotides:
In another set of at least two oligonucleotides:
Said sets may consist of two oligonucleotides, more particularly of a pair of forward and reverse primers (see table 2 above).
In each of the sets of at least two oligonucleotides:
A preferred set of at least two oligonucleotides comprises:
Another preferred set of at least two oligonucleotides comprises:
The application also relates to each of the oligonucleotides that are herein described, individually as a product, more particularly as a product that is notably useful as primer and/or probe.
The invention more particularly relates to an oligonucleotide, which is selected from the above-mentioned set of at least four oligonucleotides (see §1 above).
The application thus relates to an oligonucleotide of sub-set A, preferably to the oligonucleotide of SEQ ID NO: 2. Such an oligonucleotide is notably useful as a primer or a probe, preferably as a primer.
The application also relates to an oligonucleotide of sub-set B, preferably to the oligonucleotide of SEQ ID NO: 4. Such an oligonucleotide is notably useful as a primer or a probe, preferably as a primer.
4. Oligonucleotides, which are Notably Useful as Probes, More Particularly as Real-Time Probes:
The application also relates to an oligonucleotide, which is:
Preferably, said oligonucleotide is the oligonucleotide of SEQ ID NO: 5, or the complementary oligonucleotide thereof.
Such an oligonucleotide is notably useful as a probe.
Such an oligonucleotide is especially adapted to be used in real-time amplification with the above-mentioned set of at least three, or of at least four, oligonucleotides, to detect Salmonella strains of groups I, II, IIIa, IIIb, IV, V and VI.
Highly stringent conditions or very highly stringent conditions are as intended by the person of average skill in the art.
Illustrative conditions of highly stringent conditions comprise:
hybridization to filter-bound DNA in 5ĂSSC, 2% sodium dodecyl sulfate (SDS), 100 micrograms/mL single stranded DNA at 55-65° C. for 8 hours, and washing in 0.2ĂSSC and 0.2% SDS at 60-65° C. for thirty minutes.
Illustrative conditions of very highly stringent conditions comprise:
hybridization to filter-bound DNA in 5ĂSSC, 2% sodium dodecyl sulfate (SDS), 100 micrograms 1 mL single stranded DNA at 55-65° C. for 8 hours, and washing in 0.1ĂSSC and 0.1% SDS at 60-65° C. for thirty minutes.
Illustrative of such conditions are also the PCR conditions described in example 1 below.
Preferably, said conservative variant has a sequence identity of at least 85% with said oligonucleotide of i, or ii., or with a fragment of iii., over the entire length of said oligonucleotide or fragment.
Said conservative fragment consists of at most the total number of the parent oligonucleotide minus 1.
Preferably, said conservative fragment or variant is of at least 20 nucleotides, preferably of at least 21 nucleotides, more preferably of at least 22 nucleotides.
Preferably, said conservative variant is of at most 29 nucleotides, preferably of at most 28 nucleotides, more preferably of at most 27 nucleotides.
Preferably, said conservative variant consists of 20 to 29 nucleotides, more preferably of 21 to 28 nucleotides, even more preferably of 22 to 27 nucleotides.
Preferably, said conservative variant is a variant by substitution and/or deletion, preferably by substitution or deletion, more preferably by substitution.
Preferably, said conservative variant has the same length as the parent oligonucleotide or fragment.
Based on a sequence identity of at least 85%, the number of oligonucleotide variation(s) can be e.g., of 1 to 4, with respect to SEQ ID NO: 5.
When used as a probe, such an oligonucleotide has the special advantage of enabling to detect Salmonella strains of groups I, II, IIIa, IIIb, IV, V and VI. It further enables to detect all group I serovars, and notably the following S. enterica subsp. enterica serovars: S. Typhimurium, S. Typhi, S. Paratyphi, S. Virchow, S. Hadar, S. Enteritidis, S. Anatum, S. Senftenberg, S. Cerro, S. Poona, S. Grumpensis, S. Dalhem, S. Kentucky, S. Lomita, S. Kirkee, S. Bredeney, S. Carrau, S. Aberdeen, S. Tenessee.
When said oligonucleotide is used as a probe, it may be linked to at least one detection label, and/or at least one nucleotide arm that is unrelated to Salmonella and that is intended to carry a quencher or a reporter (e.g., a fluorophore), such as at least one beacon arm. In such a structure, said oligonucleotide is the hybridizing or âspecificâ portion, whilst the remaining elements have a function in the detection of the hybridized nucleic acid.
For example, when the oligonucleotide of SEQ ID NO: 5 is linked to beacon arms at its 5âČ and 3âČ ends, it may have the sequence of SEQ ID NO: 6, or the complementary oligonucleotide thereof, the sequence of which is fully complementary to the oligonucleotide of SEQ ID NO: 6, over the entire length of said oligonucleotide of SEQ ID NO: 6. Said beacon arm-linked of SEQ ID NO:6 or the complementary sequence thereof, may advantageously bear a reporter (e.g., a fluorophore) at one of its end, and a quencher at the other end.
Various formats (types) of probes, including Taqmanâą probes (hydrolysis probes), molecular beacons TM (beacon probes or molecular beacon probes), and Scorpionâą probes are known in the art.
It may e.g., be linked to at least one beacon arm, or to at least one Scorpionâą arm, preferably at least one of such arms in 5âČ and/or 3âČ, most preferably two of such arms, in 5âČ and in 3âČ, respectively.
One of preferred formats is the beacon format.
The structure of molecular beacons is as follows. A short nucleotide sequence (so-called beacon arm) which is unrelated to the target sequence is thus covalently linked to both ends of the probe.
The overall sequence of this arm is not related to Salmonella, which does not exclude the situation where one or two of the nucleotide(s) that are comprised within this arm may hybridize to complementary nucleotide(s) located on the Salmonella nucleic acid strand.
A short unrelated arm is thus linked in 5âČ of the probe, and is labelled with a fluorescent moiety (i.e. fluorescent dye or fluorescent marker). Another but still unrelated arm is linked to the 3âČ end of probe and is labelled with a fluorescence quenching moiety. Thus, molecular beacons have a fluorophore and a quencher at opposite ends. The 5âČ short arm is totally complementary to the one in 3âČ so that they can anneal together, and thus can assume a hairpin structure when unhybridized to the target in solution. In this hairpin conformation, the quencher and the fluorescent dye are close enough to each other to allow efficient quenching of the fluorophore. However, when the probe encounters a target molecule, annealing is favoured with respect to the hairpin conformation when values of beacon arm Tm and probe Tm are suitably chosen (theoretically: probe Tm>beacon arm Tm>primer Tm, wherein Tm is the melting temperature of interest). The fluorophore and quencher move away from each other and the fluorophore can then fluoresce when illuminated by suitable light excitation. As PCR proceeds, amplification product accumulates, and the amount of fluorescence at any given cycle depends on the amount of amplification product present at that time. (See e.g., Sanjay Tyagi and Fred Russell Kramer, Nature Biotechnology 1996, volume 14, pages 303-308; Nature Biotechnology 1998, volume 16, pages 49-53).
(Remark: It is also possible to link the fluorophore at the 3âČ end, while attaching the quencher at the 5âČ end).
Schematically, said probe can have the following formulae (molecular beacon format):
5âČ Fluorophore-(arm1)-probe-(arm2)-Quencher 3âČ
5âČ Quencher-(arm1)-probe-(arm2)-Fluorophore 3âČ
wherein arm1 and arm2 can be any short nucleotide sequences, e.g. in the range of 3-10 nucleotides, preferably 5, 6, 7 nucleotides, allowing for the hairpin structure formation under suitable stringency conditions, i.e. arm1 and arm2 are totally complementary to anneal under the desired stringency conditions (standard PCR stringency conditions include, for example, an annealing temperature of 55 to 65° C. and an Mg concentration of 2 to 7 mM). However, arm1 and arm2 are unrelated to the target sequence of the probe, i.e., the hairpin conformation resulting from the annealing between arm1 and arm2 is essentially the only possible secondary structure for the probe when unhybridized. The skilled person would know how to choose such arms for a given probe.
By fluorophore, it is herein understood any fluorescent marker/dye known in the art. Examples of such suitable fluorescent markers include Fam, Hex, Tet, Joe, Rox, Tamra, Max, Edans, Cy dyes such as CyS, Fluorescein, Coumarin, Eosine, Rhodamine, Bodipy, Alexa, Cascade Blue, Yakima Yellow, Lucifer Yellow and Texas Red (all of them are Trade-Marks), the family of ATTO dyes.
By quencher, we herein understand any quencher known in the art. Examples of such quenchers include Dabcyl, Dark Quencher, Eclipse Dark Quencher, ElleQuencher, Tamra, BHQ and QSY (all of them are Trade-Marks).
The skilled person would know which combinations of dye/quencher are suitable when designing a probe.
5. Set of oligonucleotides, which comprises at least one of said oligonucleotides, Which are Notably Useful as Probes:
The application relates to a set of oligonucleotides, which comprises at least one of the above-mentioned oligonucleotides, which are notably useful as probes (see §4 above), i.e., a set of oligonucleotides, which comprises at least one oligonucleotide, which is:
Preferably, said at least one oligonucleotide is:
In addition to said at least one oligonucleotide, said set may further comprise at least one other oligonucleotide, which is intended as a probe, such as the probe of SEQ ID NO: 7 or of SEQ ID NO: 8.
Said at least one oligonucleotide, the sequence of which is of SEQ ID NO: 5 or of SEQ ID NO: 6 or the complementary sequences thereof, can be considered as enabling to detect any bacterium, which is of the genus Salmonella. In addition to such an oligonucleotide, at least one other oligonucleotide, which is specific of one or several strain(s) and/or serovar(s) and/or subspecies and/or species, can be used, preferably in multiplex with said at least one genus-specific oligonucleotide.
The resulting set of oligonucleotides advantageously enables to determine whether the tested sample contains a Salmonella bacterium, and also to determine which strain(s), serovar(s), subspecies and/or species is present in said sample. Such a determination is especially useful for diagnostic applications. For example, at least one other oligonucleotide, which is specific of the serovar(s) Typhi and/or Paratyphi, can be used; such an oligonucleotide set is especially useful to determine whether a bacterium of the genus Salmonella is present in the tested sample, and whether these Salmonella bacteria does or not comprise bacteria that are causative of typhoid fever or paratyphoid fever.
In addition to said at least one oligonucleotide, said set may further comprise at least one other oligonucleotide, which is intended as a primer, such as at least one oligonucleotide selected from one of the above-mentioned sets of at least four oligonucleotides (see §1 above). In addition to said at least one oligonucleotide, said set may further thus comprise at least one other oligonucleotide, which is selected from the oligonucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4.
Advantageously, in addition to said at least one oligonucleotide, said set further comprises at least one of the above-mentioned individual oligonucleotides (see §3 above).
Advantageously, in addition to said at least one oligonucleotide, said set further comprises at least one of the above-mentioned sets of at least two oligonucleotides (see §2 above).
Very advantageously, in addition to said at least one oligonucleotide, said set further comprises at least one of the above-mentioned sets of at least four oligonucleotides (see §1 above).
Preferably, said set comprises:
More preferably, said set comprises:
Said set is notably useful as a set of primers and probe(s), wherein, e.g., the oligonucleotide of SEQ ID NO: 5 or the complementary oligonucleotide thereof can be used as a probe, whereas the oligonucleotides of SEQ ID NO: 2, 4, 3 and 1 can be used as primers (more particularly as multiplex primers).
Advantageously, said set is useful as a real-time amplification oligonucleotide set (see the examples below).
The application also relates to an amplification mix, and to a kit, wherein said amplification mix or kit comprises:
Said amplification mix or kit may further comprise at least one element among the following elements:
In the kit according to the invention, the oligonucleotides (primers, probes) can be either kept separately, or partially mixed, or totally mixed.
Said oligonucleotides can be provided under dry form, or solubilized in a suitable solvent, as judged by the skilled person. Suitable solvents include TE, PCR-grade water, and the like.
In a preferred embodiment, the kit according to the invention can also contain further reagents suitable for a PCR step.
Such reagents are known to those skilled in the art, and include water, like nuclease-free water, RNase free water, DNAse-free water, PCR-grade water; salts, like magnesium, potassium; buffers such as Tris; enzymes, including polymerases, such as Taq, Vent, Pfu (all of them Trade-Marks), activable polymerase, and the like; nucleotides like deoxynucleotides, dideoxunucleotides, dNTPs, dATP, dTTP, dCTP, dGTP, dUTP; other reagents, like DTT and/or RNase inhibitors; and polynucleotides like polyT, polydT, and other oligonucleotides, e.g., primers.
In another preferred embodiment, the kit according to the invention comprises PCR controls. Such controls are known in the art, and include qualitative controls, positive controls, negative controls, internal controls, quantitative controls, internal quantitative controls, as well as calibration ranges. The internal control for said PCR step can be a template which is unrelated to the target template in the PCR step. Such controls also may comprise control primers and/or control probes. For example, in the case of HPV detection, it is possible to use as an internal control, a polynucleotide chosen within a gene whose presence is excluded in a sample originating from a human body (for example, from a plant gene), and whose size and GC content is equivalent to those from the target sequence.
Such a kit is notably useful for the detection of Salmonella.
More particularly, such a kit is useful for the detection of Salmonella in a product intended for human and/or animal consumption, and/or in a biological sample originating from a human or animal.
Advantageously, said kit is useful to check the safety of a food and/or beverage product, or of a product that is used in the manufacture of a food and/or beverage product.
Advantageously, said kit is a kit for the diagnosis of salmonellosis, more particularly of typhoid and/or paratyphoid fever.
The application also relates to any amplicon, which is obtainable from a Salmonella strain belonging to group I, II, IIIa, IIIb, IV, V or VI, by amplification with a set of at least four oligonucleotides of any one of claims 1-3.
Said strain may e.g., be one of the above-mentioned seven reference strains. It preferably is a strain that naturally-occurs on a product intended for human and/or animal consumption, or a strain that naturally-occurs in a human or animal infected by Salmonella, such as e.g., a salmonellosis patient (including typhoid fever).
The application also relates to any amplification composition, which comprises at least one of such amplicons.
The application also relates to a process for the detection of Salmonella in a sample.
The process of the invention comprises:
Preferably, said four oligonucleotides are:
Unless the Salmonella content of the sample is highly diluted, a negative detection will be indicative of the fact that no Salmonella is present in said sample.
Said sample can be a sample of any material that is susceptible of, or suspected of, containing at last one Salmonella bacterium.
Such material notably comprises food, beverage, intended for animal or human consumption.
Illustrative food or beverage notably comprises milk, and milk-derived product, such as yoghourt, fermented milk, cheese.
Illustrative food or beverage also comprises other food or beverage of animal origin, such as delicatessen, meat, poultry, eggs, as well as green vegetables (which may have been contaminated from manure).
The material to be analyzed can be a biological sample collected from a patient or an animal, suspected of being infected by Salmonella. Such biological samples notably include gastro-enteric samples, such as feces, or blood, serum, plasma.
A swab soaked with human stool can be inoculated to selenite-cystine broth, overnight at 37° C. Then incubated broth can be used for Salmonella detection in multiplex PCR.
If this material is solid (e.g., in foods), it can be grinded, pounded or otherwise broken, and/or homogenized, to facilitate access to the nucleic acids that may be contained herein. ISO standards are available, which describe methods of preparing a product to a bacterial analysis. For milk products, the ISO standard is ISO 8261.
The goal is to make nucleic acids that may be contained in the material accessible to primers for them to anneal thereof, thereby allowing elongation of the annealed nucleic acid.
Before implementation of the amplification method, the material to be analyzed can be pre-treated to enrich the material in Salmonella cells to facilitate their detection. Accordingly, such a pre-enrichment step is usually performed when the Salmonella contamination is very low.
Such a pre-treatment step can e.g., be the standard pre-enrichment step that is described in Standard ISO 6579:2002, i.e., by placing 25 grams of said material in 225 mL of buffered peptone water (pH 7.0±0.2 at 25° C. after sterilization), and incubating it at 37±1° C. for 18±2 hours.
When the material contains a relatively high amount of cocoa (e.g., at least 20%), it is recommended to add 50 g/L of casein or 100 g/L of powder skimmed milk in aid buffered peptone water, and especially when the material is likely to be contaminated by Gram-positive microorganisms, to add 0.018 g/l of brilliant green after 2 hours of incubation. Especially for PCR applications, a re-growing step in buffer peptone water can be added to avoid PCR inhibition.
It is also recommended to take care that the pH does not decrease below 4.5 during said pre-enrichment.
At the end of the pre-enrichment step, the medium is centrifuged, to recover the pellet.
Preferably, the pellet is submitted to nucleic acid extraction, e.g., to DNA extraction, to recover the nucleic acid extract of the pre-enriched medium. Any nucleic acid extraction means that the skilled person may find appropriate can be used, such as the âInstaGen Matrixâ product that is available from Bio-Rad (Bio-Rad, Hercules, U.S.A.; product reference 732-6030).
The method of the invention may comprise such a pre-enrichment step, in accordance with said ISO standard, whereby the amplification step is then performed on a sample of the pre-enriched medium that is obtained from said pre-enrichment step, or a nucleic acid extract thereof.
The oligonucleotides of the invention have nevertheless the special advantage of enabling to avoid this pre-enrichment step. Indeed, the invention provides oligonucleotides that are so sensitive in amplifying and detecting Salmonella that such a pre-enrichment step may, in many circumstances, be unnecessary. Under such circumstances, the amplification step is directly performed on a sample of said material (or on a dilution thereof or on a liquid homogenizate thereof), without any pre-enrichment step, preferably on a nucleic acid extract thereof.
Hence, in accordance with an advantageous embodiment of the invention, said sample or said homogenized sample does not need to be incubated in buffered peptone water for 18±2 hours.
Preferably, said amplicon detection is performed by using at least one of the oligonucleotides described in §4, as a probe. Such a probe will anneal to said amplicon, if said amplicon is present in the test tube.
Advantageously, said probe is
Advantageously, such a probe is such a wide Salmonella coverage, that said amplicon detection does not require to use any other probe (see examples below: the beacon probe of SQ ID NO: 6âwhose hybridizing portion is the oligonucleotide of SEQ ID NO: 5âdetects the seven Salmonella reference strains; the probe of SEQ ID NO: 7 or 8 can be used with it, but would be redundant).
Preferably, the process of the invention is a real-time amplification process. Indeed, every single oligonucleotide that is described in the present application has been designed and built to enable an implementation in a multiplex of primers, preferably in a multiplex of primers and probe for real-time amplification.
Said Salmonella detection process can be easily used in routine in a clinical environment, such as a hospital, and will be very useful for the diagnosis of salmonellosis.
The application also relates to a process for checking the safety of products that are intended for human and/or animal consumption, more particularly the safety of a food and/or beverage product, or of a product that is used in the manufacture of a food and/or beverage product.
Such a process comprises submitting said product to be analyzed, or a sample thereof, to the Salmonella detection process of the invention. A positive detection will be indicative of the fact that it is not recommended to use said product for human and/or animal consumption.
The term âcomprisingâ, which is synonymous with âincludingâ or âcontainingâ, is open-ended, and does not exclude additional, unrecited element(s), ingredient(s) or method step(s), whereas the term âconsisting ofâ is a closed term, which excludes any additional element, step, or ingredient which is not explicitly recited. The term âessentially consisting ofâ is a partially open term, which does not exclude additional, unrecited element(s), step(s), or ingredient(s), as long as these additional element(s), step(s) or ingredient(s) do not materially affect the basic and novel properties of the invention.
The term âcomprisingâ (or âcomprise(s)â) hence includes the term âconsisting ofâ (âconsist(s) ofâ), as well as the term âessentially consisting ofâ (âessentially consist(s) ofâ). Accordingly, the term âcomprisingâ (or âcomprise(s)â) is, in the present application, meant as more particularly encompassing the term âconsisting ofâ (âconsist(s) ofâ), and the term âessentially consisting ofâ (âessentially consist(s) ofâ).
Each of the relevant disclosures of all references cited herein is specifically incorporated by reference. The following examples are offered by way of illustration, and not by way of limitation.
This example compares the Salmonella detection range (=inclusivity), and the sensitivity of different real-time PCR oligonucleotide sets.
A panel of reference Salmonella strains covering groups II, IIIa, IIIb, IV, VI, were assayed by real-time PCR, using four different sets of oligonucleotides:
Real-time PCR oligonucleotide sets 2, 3 and 4 are oligonucleotide sets of the invention, whereas real-time PCR oligonucleotide set 1 is not a set of the invention.
Reference Salmonella strains covering groups II to VI are:
| TABLE 3 | ||
| Strain (group) | CIP no | |
| S. enterica subsp. salamae (II) | CIP 82.29 | |
| S. enterica subsp. arizonae (IIIa) | CIP 82.30 | |
| S. enterica subsp. diarizonae (IIIb) | CIP 82.31 | |
| S. enterica subsp. houtanae (IV) | CIP 82.32 | |
| S. bongori (V) | CIP 82.33 | |
| S. enterica subsp. indica (VI) | CIP 102501 | |
Each of these strains is available from the C.N.C.M. (Collection Nationale de Cultures de Microorganismes; Institut Pasteur; 25, rue du Docteur Roux; F-75724 Paris Cedex 15; France). The CIP number is the C.N.C.M. strain deposit number.
Each reference strain has been grown on 10 mL of Tryptone Soy Broth (TSB, Bio-Rad, ref. 355-3454) for 16 h at 37° C. (at least 1.108 cfu/mL at the end of the culture). Each tube was inoculated with a colony picked with a 10 ΌL culture loop.
1 mL of each culture was centrifuged at 10,000 g for 5 minutes in 1.5 mL Eppendorf tubes. The supernatants were discarded. 200 ΌL of the InstaGen matrix (available from Bio-Rad, Hercules, U.S.A.; product reference 732-6030) were added to the bacterial pellet. A vortex step was done to homogenise the solution. The tubes were then incubated for 10 minutes at 95° C.
5 ÎŒL of the extracted DNA is used in PCR.
Final reaction volume: 50 ÎŒL (45 ÎŒL of reaction mix+5 ÎŒL of DNA extract)
Novataq Hot-Start DNA polymerase: 1 U/PCR
Novataq Hot-Start DNA polymerase buffer: 1Ă
MgCl2 Novagen: 6 mM
dNTP (A,C,G,T) (from Roche): 100 ÎŒM each
Primers: 300 nM each
Probe(s) (FAM label): 300 nM each
Amplification and detection were achieved by real-time PCR using an iCycler iQ (Bio-Rad).
The detection of each of the Salmonella strains was monitored by real-time PCR.
Salmonella reference strains were recovered after cell culture as described above. Each of the Salmonella reference strains was then diluted at 10â5, 10â6, 10â7 and 10â8 in buffered peptone water (Buffered Peptone Water, Bio-Rad, ref. 355-4179).
DNA was thereafter extracted using the above-mentioned DNA extraction kit, and submitted to real-time PCR with each of said oligonucleotide sets, as described above.
The real-time PCR curves obtained with each of the six reference strains are shown in FIGS. 1-6.
The results were also qualified:
âââ, when the Salmonella strain was not detected;
â+â, when Salmonella was detected, but with a low level of fluorescence signal and a given Cycle Threshold (Ct) value (SET 1 and SET 2 results).
â++â, when Salmonella was detected with a correct level of fluorescence signal and a better Cycle Threshold (Ct) value (SET 3 and SET 4 results compared to the SET 1 and SET 2 results).
Representative results are shown in table 4 below:
| TABLE 4 | |
| Primers: |
| lag3-2/lag6-2 | ||
| SEQ ID NO: | lag3-2/lag6-2/lag3-2C/lag6-2C1 | |
| 1 and 3 | SEQ ID NO: 1, 2, 3 and 4 |
| Probe(s): |
| CaptMod + | ||||
| CaptMod | CaptMod | MBSal1 | MBSal1 | |
| SEQ ID | SEQ ID | SEQ ID | SEQ ID | |
| NO: 8 | NO: 8 | NO: 6 | NO: 8 and 6 |
| SET no: |
| SET 1 | SET 2 | SET 3 | SET 4 | ||
| (not of the | (of the | (of the | (of the | ||
| Strain (group) | invention) | invention) | invention) | invention) | |
| S. enterica subsp. salamae (II) | CIP 82.29 | + | + | ++ | ++ |
| S. enterica subsp. arizonae (IIIa) | CIP 82.30 | â | â | ++ | ++ |
| S. enterica subsp. diarizonae (IIIb) | CIP 82.31 | + | + | ++ | ++ |
| S. enterica subsp. houtanae (IV) | CIP 82.32 | â | â | ++ | ++ |
| S. bongori (V) | CIP 82.33 | â | + | ++ | ++ |
| S. enterica subsp. indica (VI) | CIP 102501 | + | + | ++ | ++ |
Both FIGS. 1-6 and table 4 demonstrate that:
Oligonucleotide set 1 enables to detect only 3 of the 6 Salmonella strains.
Oligonucleotide set 2 enables to detect 4 of the 6 Salmonella strains: when compared to set 1, the results of oligonucleotide set 2 show that using the primers of SEQ ID NO: 2 and 4, in addition to primers SEQ ID NO: 1 and 3, improves the Salmonella detection range, compared to using primers SEQ ID NO: 1 and 3 only.
Oligonucleotide set 3 enables to detect all the strains (6/6): when compared to set 2, the results of set 3 show that using the probe of SEQ ID NO: 6 drastically improves the detection range, compared to using the probe of SEQ ID NO: 8.
The performances of oligonucleotide set 4 are equivalent to the ones of oligonucleotide set 3; using the probe of SEQ ID NO: 8, in addition to the probe of SEQ ID NO: 6, does not improve the detection range, but does not alter it.
Sets 2, 3 and 4 have a better detection range than set 1.
The best results are obtained using set 3 or set 4.
The sensitivity of set 1 was compared to the one of set 3, by assaying each of these two sets on a dilution range of each of said six reference Salmonella strains.
Representative results are reported in Table 5:
| TABLE 5 | |
| Strain |
| S. salamae CIP 82.29 (group II) | S. arizonae CIP 82.30 (group IIIa) | S. diarizonae CIP 82.31 (group IIIb) |
| Ct with | Ct with | cfu/ | cfu/ | Ct with | Ct with | cfu/ | Ct with | cfu/ | cfu/ | |||
| Dilution | Set 1 | Set 3 | mL | PCR | Set 1 | Set 3 | mL | cfu/PCR | Ct with Set 1 | Set 3 | mL | PCR |
| 10â5 | 31.3 | 29.42 | 9700 | 250 | N/A | 29.83 | 56000 | 1400 | N/A | 38.45 | 23300 | 689 |
| 32 | 30.93 | N/A | 29.95 | N/A | 39.58 | |||||||
| 31.1 | 29.37 | N/A | 29.67 | N/A | 41.28 | |||||||
| 10â6 | 34.8 | 32.70 | 970 | 25 | N/A | 32.44 | 5600 | 140 | N/A | 43.98 | 2330 | 68.9 |
| 33.3 | 33.13 | N/A | 32.43 | N/A | 43.63 | |||||||
| 33.5 | 32.50 | N/A | 32.02 | N/A | N/A | |||||||
| 10â7 | 38.4 | 35.57 | 97 | 2.5 | N/A | 34.71 | 560 | 14 | N/A | N/A | 233 | 6.9 |
| 36 | 35.33 | N/A | 35.53 | N/A | N/A | |||||||
| 38.9 | 35.91 | N/A | 35.33 | N/A | N/A | |||||||
| 10â8 | 41.2 | 38.89 | 9.7 | 0.25 | N/A | 37.82 | 56 | 1.4 | N/A | N/A | 23.3 | 0.7 |
| 41.9 | 37.78 | N/A | 39.48 | N/A | N/A | |||||||
| 43.6 | N/A | N/A | 37.60 | N/A | N/A | |||||||
| Strain |
| S. houtanae CIP 82.32 (group IV) | S. bongori CIP 82.33 (group V) | S. indica CIP 102501 (group VI) |
| Ct with | Ct with | cfu/ | cfu/ | Ct with | Ct with | Ct with | cfu/ | cfu/ | ||||
| Dilution | Set 1 | Set 3 | mL | PCR | Set 1 | Set 3 | cfu/PCR | Ct with Set 1 | Set 3 | mL | PCR | |
| 10â5 | N/A | 32.71 | 24700 | 603 | N/A | 31.41 | 25700 | 892 | N/A | 29.13 | 20300 | 545 |
| N/A | 33.35 | N/A | 32.44 | N/A | 28.66 | |||||||
| N/A | 32.56 | N/A | 31.42 | N/A | 28.74 | |||||||
| 10â6 | N/A | 35.33 | 2470 | 60.3 | N/A | 34.06 | 2570 | 89.2 | N/A | 32.10 | 2030 | 54.5 |
| N/A | 34.97 | N/A | 34.89 | N/A | 32.21 | |||||||
| N/A | 35.13 | N/A | 34.52 | N/A | 32.14 | |||||||
| 10â7 | N/A | 38.33 | 247 | 6.0 | N/A | 36.90 | 257 | 8.9 | N/A | 35.47 | 203 | 5.4 |
| N/A | 37.85 | N/A | 37.31 | N/A | 35.65 | |||||||
| N/A | 37.29 | N/A | 37.00 | N/A | 35.45 | |||||||
| 10â8 | N/A | 44.25 | 24.7 | 0.6 | N/A | 39.85 | 25.7 | 0.9 | N/A | 42.10 | 20.3 | 0.5 |
| N/A | 41.49 | N/A | 43.21 | N/A | 40.57 | |||||||
| N/A | 40.20 | N/A | 42.01 | N/A | N/A | |||||||
| In table 5 above: | ||||||||||||
| N/A means NOT DETECTED, | ||||||||||||
| cfu/mL means the number of Salmonella cfu per mL, as measured by cell count on cell culture; | ||||||||||||
| cfu/PCR means the theoretical number of Salmonella cfu placed in each PCR tube. |
At a dilution of 10â5, oligonucleotide set 1 does not detect S. diarizonae CIP 82.31 or S. indica CIP 102501 anymore, whereas oligonucleotide set 3 detects them at 10â5 and 10â7, respectively.
Down to a dilution of 10â7, oligonucleotide set 3 gives better CT values on S. salamae than set 1. At 10â8, set 3 gives two CT values that are better than the ones obtained with set 1.
On S. arizonae and S. bongori, set 3 gives accurate CT values, even at a dilution of 10â8, whereas set 1 does not detect these strains at all.
The overall results demonstrate that set 3 is much more sensitive than set 1.
Set 3 further has a very wide group 1 coverage; it detects all Salmonella group I serovars, and notably the following S. enterica subsp. enterica serovars: S. Typhimurium, S. Typhi, S. Paratyphi, S. Virchow, S. Hadar, S. Enteritidis, S. Anatum, S. Senftenberg, S. Cerro, S. Poona, S. Grumpensis, S. Dalhem, S. Kentucky, S. Lomita, S. Kirkee, S. Bredeney, S. Carrau, S. Aberdeen, S. Tenessee.
Sets 2, 3 and 4, which are oligonucleotide sets of the invention, have a wider Salmonella detection range than set I.
Set 3, as well as set 4, cover the six Salmonella reference strains, whereas set 1 covers only three of the six strains.
Set 3 is also much more sensitive than set 1; on average, the gain in sensitivity is of about 2 Log.
Ten samples of milk or fermented milk, which were susceptible of being naturally-contaminated by Salmonella, were collected for comparative analysis.
Each milk or fermented milk sample was treated as follows:
25 grams of milk sample were incubated with buffered peptone water at 37° C. for 20 hours. One milliliter of incubated medium was centrifuged to remove the supernatant. The pellet was submitted to DNA extraction with 200 ΌL of lysis buffer using the InstaGen matrix (Bio-Rad, Hercules, U.S.A.), as above-described in example 1.
Five microliters of extract were used for each Salmonella analysis.
Each of the ten extracts was analyzed:
Real-time PCR were performed as described in example 1, using set 1 or set 3.
Results of the cell culture assays are presence (+) or absence (â) of Salmonella.
PCR results are illustrated by the measured Ct values.
Illustrative results are as follows:
| TABLE 6 | ||
| FAM Ct |
| Sample no | set 1 | set 3 | Cell culture | |
| 1 | N/A | N/A | â | |
| 2 | N/A | N/A | â | |
| 3 | 39.33 | 32.83 | + | |
| 4 | N/A | 38.58 | + | |
| 5 | 47.44 | 38.07 | + | |
| 6 | N/A | N/A | â | |
| 7 | N/A | N/A | â | |
| 8 | N/A | N/A | â | |
| 9 | 19.28 | 21.25 | + | |
| 10 | 38.65 | 33.02 | + | |
| N/A means not detected. |
Samples no 1, 2, 6, 7 and 8 are Salmonella-negative in cell culture, as well as by PCR analysis.
Sample no 4 is Salmonella-positive in cell culture. Analysis of this sample by PCR using set 1 of oligonucleotides gives a false negative result. Such a false negative result is not obtained using set 3 of the invention.
Using Set 1, samples no 5 and no 10 appear to be only weakly positive samples, whereas the cell culture analysis demonstrates that these samples clearly are Salmonella-positive. Compared to set 1, oligonucleotide set 3 of the invention highly improves the detection of these two samples.
Oligonucleotide set 3 enables to detect Salmonella serovars that may not be detected using oligonucleotide set 1.
Oligonucleotide set 3 avoids false negative results that are obtained by using set 1.
Table 7 below presents 58 strains that were tested with oligonucleotide SET 3 (see examples 1 and 2) for exclusivity study. DNA was extracted from a pure culture of each strain (in the appropriate culture conditions) with InstaGen Matrix, as described in examples 1 and 2. SET3 does not detect any of these strains.
| TABLE 7 | ||
| Strain | Deposit no | |
| Shigella sonei | ATCC 25931 | |
| Aeromonas hydrophila | CIP 76.14 | |
| Aeromonas hydrophila | CIP 76.15 | |
| Aeromonas hydrophila | CIP 107500 | |
| Bacillus cereus | ATCC 11778 | |
| Bacillus sphaericus | DSMZ 28 | |
| Bacillus subtilis | ATCC 6633 | |
| Brochothrix campestris | DSMZ 4712 | |
| Brochothrix | DSMZ 20171 | |
| thermosphacta | ||
| Candida albicans | ATCC10231 | |
| Citrobacter freundii | ATCC 8090 | |
| Citrobacter freundii | ATCC 8090 | |
| Corynebacterium bovis | DSMZ 20582 | |
| E. coli | ATCC 25922 | |
| E. coli | ATCC 8739 | |
| E. coli No44 | CIP 105243 | |
| E. coli No46 | CIP 105245 | |
| Enterobacter aerogenes | ATCC 13048 | |
| Enterobacter cloacae | ATCC 23355 | |
| Enterococcus durans | ATCC 19432 | |
| Enterococcus faecium | CIP 54.32 | |
| Erysipelothrix | DSMZ 5055 | |
| rhusiopathiae | ||
| Escherichia coli | DSMZ 30083 | |
| Hafnia alvei | CIP 57.31 | |
| Klebsiella pneumoniae | ATCC 13883 | |
| Kurtia sibirica | DSMZ 4747 | |
| Kurtia gibsonii | DSMZ 20636 | |
| Lactobacillus fermentum | ATCC 9338 | |
| Lactobacillus plantarum | ATCC 8014 | |
| Listeria grayi | CLIP 73019 | |
| Listeria innocua | CLIP 74915 | |
| Listeria ivanovii | CLIP 12229 | |
| Listeria ivanovii | CLIP 74914 | |
| Listeria mono 1/2a | CLIP 74902 | |
| Legionella hackeliae | ATCC 35999 | |
| Legionella wadworthi | ATCC 33877 | |
| Listeria mono 1/2b | CLIP 74903 | |
| Listeria mono 3a | CLIP 74905 | |
| Listeria mono 4a | CLIP 74908 | |
| Listeria mono 4b | ATCC 19115 | |
| Listeria seeligeri | CLIP 3021 | |
| Listeria welshimeri | CLIP 73020 | |
| MyroĂŻdes adoratus | CIP 105170 | |
| MyroĂŻdes adoratus | CIP 103105 | |
| Proteus mirabilis | ATCC 25933 | |
| Proteus hauseri | ATCC 13315 | |
| Pseudomonas aeruginosa | ATCC 25619 | |
| Pseudomonas aeruginosa | ATCC 27853 | |
| Serratia marcescens | ATCC 8100 | |
| Serratia marcescens No20 | CIP 103235 | |
| Serratia marcescens No21 | CIP 53.86 | |
| Serratia marcescens VNo22 | CIP 53100 | |
| Shigella flexneri | ATCC 12022 | |
| Staphylococcus aureus | ATCC 25923 | |
| Staphylococcus aureus | ATCC 44555 | |
| Staphylococcus aureus | ATCC 53840 | |
| Staphylococcus aureus | ATCC 6538 | |
| Staphylococcus epidermidis | ATCC 14990 | |
Oligonucleotide set 3 has an excellent specificity.
1.-57. (canceled)
58. A set of polynucleotides, which comprises the polynucleotides that are obtainable by nucleic acid amplification from at least one Salmonella strain by means of the primers of SEQ ID NO: 4, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 1, wherein, for each one of said polynucleotides that are obtainable by said nucleic acid amplification:
the 5âČ end of a polynucleotide is at least 85% identical to SEQ ID NO: 1 or 2, and
the 3âČ end of the complementary sequence of the same polynucleotide is at least 85% identical to SEQ ID NO: 3 or 4,
or
the 3âČ end of a polynucleotide is at least 85% identical to SEQ ID NO: 3 or 4, and
the 5âČ end of the complementary sequence of the same polynucleotide is at least 85% identical to SEQ ID NO: 1 or 2.
59. The set of claim 58, wherein said at least one Salmonella strain is at least one Salmonella enterica strain.
60. The set of claim 58, wherein said at least one Salmonella strain is at least one of the following strains:
i) at least one S. enterica ssp. enterica strain,
ii) at least one S. enterica ssp. salamae strain,
iii) at least one S. enterica ssp. arizonae strain,
iv) at least one S. enterica ssp. diarizonae strain,
v) at least one S. enterica ssp. houtanae strain, and
vi) at least one S. enterica ssp. indica strain.
61. The set of claim 58, wherein said at least one Salmonella strain is at least one Salmonella bongori strain.
62. The set of claim 58, wherein at least one of said polynucleotides hybridizes to at least one of
i) the sequence of SEQ ID NO: 5 and
ii) the sequence that is complementary to SEQ ID NO: 5,
under stringent conditions, wherein said stringent conditions are:
binding said at least one polynucleotide on a filter,
contacting said filter-bound polynucleotide with said sequence of SEQ ID NO: 5 or said sequence complementary to SEQ ID NO: 5, at 100 micrograms/mL in 5ĂSSC, 2% Sodium Dodecyl Sulfate (SDS), at 55-65° C. for 8 hours,
washing in 0.2ĂSSC and 0.2% SDS at 60-65° C. for thirty minutes.
63. The set of claim 58, wherein at least one of said polynucleotides hybridizes to at least one of
i) the sequence of SEQ ID NO: 6 and
ii) the sequence that is complementary to SEQ ID NO: 6,
under stringent conditions, wherein said stringent conditions are submitting an amplification reaction mix to cycles of nucleic acid amplification as follows:
cycle 1: Ă1;
cycle 2: Ă50:
15 seconds at 95° C.;
30 seconds at 58° C.;
30 seconds at 72° C.,
wherein said amplification reaction mix is:
5 ÎŒL of DNA extract of said at least one S. enterica or S. bongori strain,
Taq polymerase: 1 U,
polymerase buffer: 1Ă,
MgCl2: 6 mM,
dNTP: 100 mM each,
said primers of SEQ ID NOs: 1-4: 300 nM each,
said sequence of SEQ ID NO: 6 or said sequence that is complementary to SEQ ID NO: 6, with a FAM label: 300 nM,
in a final volume of 50 ÎŒL
64. The set of claim 58, wherein at least one of said polynucleotides comprises at least one of the following sequences:
i) the sequence of SEQ ID NO: 5,
ii) the sequence, which is complementary to SEQ ID NO: 5,
iii) a sequence of 20 to 29 nucleotides, which is at least 85% identical to SEQ ID NO: 5, and
iv) the sequence, which is complementary to said sequence of 20 to 29 nucleotides that is at least 85% identical to SEQ ID NO: 5.
65. A composition, which comprises the set of claim 58.
66. A composition, which comprises the set of claim 58 and at least one DNA polymerase.
67. A composition, which comprises the set of claim 58 and the oligonucleotides of SEQ ID NO: 4, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 1.