US20120301479A1
2012-11-29
13/478,165
2012-05-23
The present invention provides vectors that contain and express in vivo or in vitro one or more Hendra virus polypeptides or antigens that elicit an immune response in animal or human against Hendra virus and Nipah virus, compositions comprising said vectors and/or Hendra virus polypeptides, methods of vaccination against Hendra virus and Nipah virus, and kits for use with such methods and compositions.
Get notified when new applications in this technology area are published.
A61K39/155 » CPC main
Medicinal preparations containing antigens or antibodies; Viral antigens Paramyxoviridae, e.g. parainfluenza virus
A61K39/12 » CPC further
Medicinal preparations containing antigens or antibodies Viral antigens
C07K14/005 » CPC further
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
C12N7/00 » CPC further
Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
A61K2039/505 » CPC further
Medicinal preparations containing antigens or antibodies comprising antibodies
A61K2039/5254 » CPC further
Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA; Virus avirulent or attenuated
A61K2039/5256 » CPC further
Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA; Virus expressing foreign proteins
A61K2039/53 » CPC further
Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA DNA (RNA) vaccination
A61K2039/545 » CPC further
Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
A61K2039/70 » CPC further
Medicinal preparations containing antigens or antibodies Multivalent vaccine
C12N2710/24043 » CPC further
dsDNA viruses; Details; Poxviridae; Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
C12N2760/18222 » CPC further
ssRNA viruses negative-sense; Details; Paramyxoviridae; Henipavirus, e.g. hendra virus New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
C12N2760/18234 » CPC further
ssRNA viruses negative-sense; Details; Paramyxoviridae; Henipavirus, e.g. hendra virus Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
C12N2799/023 » CPC further
Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a poxvirus
A61K31/7088 IPC
Medicinal preparations containing organic active ingredients; Carbohydrates; Sugars; Derivatives thereof Compounds having three or more nucleosides or nucleotides
C12N15/863 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for animal cells; Viral vectors Poxviral vectors, e.g. entomopoxvirus
C12N15/85 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
This application claims benefit of U.S. provisional application Ser. No. 61/491,037 filed May 27, 2011.
The present invention relates to formulations for combating Hendra virus and Nipah virus in animals. Specifically, the present invention provides vectors that contain and express in vivo or in vitro Hendra virus F and G antigens that elicit an immune response in animals and human against Hendra virus and Nipah virus, including compositions comprising said vectors, methods of vaccination against Hendra virus and Nipah virus, and kits for use with such methods and compositions. The present invention also provides vectors that contain and express in vivo or in vitro Hendra F or G protein that elicit an immune response in animals against Hendra virus and Nipah, and compositions comprising said vectors.
Hendra virus is the source of a recently emerging disease in animals and human. Hendra virus was first recognized in September 1994 after an outbreak of respiratory illness among twenty horses and two humans in Hendra, Queensland, Australia (Selvey L A, et al., Med J Australia 1995, 162:642-5). Thirteen horses and one human died. In 1995, a second unrelated outbreak was identified that had occurred in August 1994 in Mackay, Queensland, in which two horses died and one human became infected (Hooper P T, et al., Australian Vet J 1996; 74:244-5; Rogers R J, et al., Australia Vet J 1996; 74:243-4). Four of the seven people who contracted the virus from infected horses have died since the disease first emerged in 1994. The fatality rate has been reported at more than 70% in horses and 50% in humans.
Nipah virus is a member of the Paramyxoviridae family and is related to the Hendra virus (formerly called equine morbillivirus). The Nipah virus was initially isolated in 1999 upon examining samples from an outbreak of encephalitis and respiratory illness among adult men in Malaysia and Singapore (see, e.g., Chua et al., Lancet. 1999, 354 (9186):1257-9 and Paton et al., Lancet. 1999 Oct. 9; 354(9186):1253-6). The host for Nipah virus is still unknown, but flying foxes (bats of the Pteropus genus) are suspected to be the natural host. Infection with Nipah virus in humans has been associated with an encephalitis characterized by fever and drowsiness and more serious central nerve system disease, such as coma, seizures and inability to maintain breathing (see, e.g., Lee et al., Ann Neurol. 1999 September; 46(3):428-32). Illness with Nipah virus begins with 3-14 days of fever and headache, followed by drowsiness and disorientation characterized by mental confusion. These signs and symptoms can progress to coma within 24-48 hours. Some patients have had a respiratory illness during the early part of their infections. Serious nerve disease with Nipah virus encephalitis has been marked by some sequelae, such as persistent convulsions and personality changes. During the Nipah virus disease outbreak in 1998-1999, about 40% of the patients with serious nerve disease who entered hospitals died from the illness (see, e.g., Lam & Chua, Clin Infect Dis. 2002 May 1; 34 Suppl 2:S48-51).
Hendra virus, like the majority of other paramyxoviruses, possess two surface glycoproteins, a fusion protein (F) and an attachment protein (G), that are involved in promotion of fusion between the viral membrane and the membrane of the target host cell. Hendra and Nipah viruses require both their attachment and fusion proteins to initiate membrane fusion (Bossart et al., J Virol. 2002; 76:11186-98). Various studies were conducted to understand the functions of the G and F proteins in virus infection. A soluble G glycoprotein of Hendra virus was constructed and showed the capability to bind to Hedra virus and Nipah virus infection-permissive cells (Bossart et al., J Virol. 2005; 79:6690-6702). Monoclonal antibodies specific for the Nipah virus fusion protein were shown to neutralize Hedra virus in vitro and protected hamsters from Hendra virus (Guillaume et al., Virology 2009; 387:459-465). A recombinant soluble Hendra G protein in CpG adjuvant was evaluated in a cat model (McEachern et al., Vaccine 2008; 26:3842-3852).
Currently there is no licensed Hendra vaccine. Therefore, there is a general need for a Hendra vaccine for the protection against Hendra virus and Nipah virus infection, prevention of the disease in animals and human and prevention of spreading of the virus to uninfected animals or human.
The invention provides a solution for optimizing the immunological and efficacious effect of Hendra virus vaccine while retaining high safety for the vaccinated animals.
An object of this invention can be any one or all of providing recombinant vectors or viruses as well as methods for making such viruses, and providing compositions and/or vaccines as well as methods for treatment and prophylaxis of infection by Hendra virus or Nipah virus.
The invention provides a recombinant vector, such as a recombinant virus, that contains and expresses at least one exogenous nucleic acid molecule and, the at least one exogenous nucleic acid molecule may comprise a nucleic acid molecule encoding an immunogen or epitope of interest from Hendra virus, such as F or G or a combination thereof.
The invention further provides compositions or vaccines comprising such an expression vector or the expression product(s) of such an expression vector. The compositions or vaccines may comprise two or more such expression vectors or the expression product(s) of such expression vectors. The invention further relates to a vaccine or composition which may comprise one or more aforementioned recombinant or expression vector a pharmaceutically or veterinarily acceptable carrier, excipient, adjuvant, or vehicle, and additionally one or more antigens. The additional antigen(s) may be Nipah virus antigen(s).
The invention further provides methods for inducing an immunological (or immunogenic) or protective response against Hendra virus or Nipah virus, as well as methods for preventing or treating the disease state(s) caused by Hendra virus or Nipah virus, comprising administering the expression vector or an expression product of the expression vector, or a composition comprising the expression vector, or a composition comprising an expression product of the expression vector.
The invention relates to expression products from the virus as well as antibodies generated from the expression products or the expression thereof in vivo and uses for such products and antibodies, e.g., in diagnostic applications. The invention also relates to a method of hyperimmunizing horses to induce polyclonal antibodies for serotherapy in animals and humans comprising at least one administration of the composition or vector of the present invention.
These and other embodiments are disclosed or are obvious from and encompassed by, the following Detailed Description.
The following detailed description, given by way of example, but not intended to limit the invention solely to the specific embodiments described, may best be understood in conjunction with the accompanying drawings, in which:
FIG. 1 is the table showing the SEQ ID NO assigned to the respective DNA and Protein sequences.
FIG. 2 depicts the plasmid maps of p362-Hendra G and p362-Hendra F.
FIG. 3 shows the vCP3004 (Hendra G) Southern Blot result.
FIG. 4 shows the vCP3004 (Hendra G) Western Blot result.
FIG. 5 shows the vCP3005 (Hendra F) Southern Blot result.
FIG. 6 shows the vCP3005 (Hendra F) Western Blot result.
FIG. 7 depicts the fusion assay of vCP3004, vCP3005, and vCP3004+vCP3005.
FIGS. 8A-8C show the ELISA binding and blocking assays and SNT against Hendra.
FIGS. 9A-9C show the ELISA binding and blocking assays and SNT against Nipah.
FIG. 10A-10B show the VN serology data of horses vaccinated with vCP3004+vCP3005 against Hendra and Nipah.
FIG. 11 shows DNA and protein sequences.
FIG. 12 shows the protein and DNA sequence alignment and sequence identity percentages
Compositions comprising one or more expression vector(s) comprising one or more polynucleotide(s) encoding one or more Hendra virus antigen(s), polypeptide(s) and fragments and variants thereof that elicit an immunogenic response in an animal or human are provided. The expression vector comprising the polynucleotide encoding Hendra virus antigen(s) or polypeptide(s) or fragments or variants may be formulated into vaccines or pharmaceutical compositions and used to elicit or stimulate a protective response in an animal or human. In one embodiment the Hendra virus antigen or polypeptide is a Hendra virus fusion protein (F), a Hendra virus attachment protein (G), or active fragment or variant thereof.
It is recognized that the polypeptides of the invention may be full length polypeptides or active fragments or variants thereof. By “active fragments” or “active variants” is intended that the fragments or variants retain the antigenic nature of the polypeptide. Thus, the present invention encompasses any Hendra virus polypeptide, antigen, epitope or immunogen that elicits an immunogenic response in an animal. The Hendra virus polypeptide, antigen, epitope or immunogen may be any Hendra virus polypeptide, antigen, epitope or immunogen, such as, but not limited to, a protein, peptide or fragment or variant thereof, that elicits, induces or stimulates a response in an animal.
A particular Hendra virus polypeptide of interest is Hendra virus fusion protein (F) and Hendra virus attachment protein (G). It is further recognized that precursors of any of these antigens can be used. The antigenic polypeptides of the invention are capable of protecting against Hendra virus. That is, they are capable of stimulating an immune response in an animal or human.
The term “antigen” or “immunogen” means a substance that induces a specific immune response in a host animal. The antigen may comprise a whole organism, killed, attenuated or live; a subunit or portion of an organism; a recombinant vector containing an insert with immunogenic properties; a piece or fragment of DNA capable of inducing an immune response upon presentation to a host animal; a polypeptide, an epitope, a hapten, or any combination thereof. Alternately, the immunogen or antigen may comprise a toxin or antitoxin.
The terms “protein”, “peptide”, “polypeptide” and “polypeptide fragment” are used interchangeably herein to refer to polymers of amino acid residues of any length. The polymer can be linear or branched, it may comprise modified amino acids or amino acid analogs, and it may be interrupted by chemical moieties other than amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling or bioactive component.
The term “Hendra virus polypeptide or antigen” refers to any antigen or polypeptide identified in any Hendra virus strain. The antigen or polypeptide may be native to the particular Hendra virus strain. The antigen or polypeptide may be optimized from its native form. Hendra virus polypeptide or antigen include, for example, fusion protein (F), attachment protein (G), and Nucleocapsid (N) protein.
The term “immunogenic or antigenic polypeptide” as used herein includes polypeptides that are immunologically active in the sense that once administered to the host, it is able to evoke an immune response of the humoral and/or cellular type directed against the protein. Preferably the protein fragment is such that it has substantially the same immunological activity as the total protein. Thus, a protein fragment according to the invention comprises or consists essentially of or consists of at least one epitope or antigenic determinant. An “immunogenic” protein or polypeptide, as used herein, includes the full-length sequence of the protein, analogs thereof, or immunogenic fragments thereof. By “immunogenic fragment” is meant a fragment of a protein which includes one or more epitopes and thus elicits the immunological response described above. Such fragments can be identified using any number of epitope mapping techniques well known in the art. See, e.g., Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66 (Glenn E. Morris, Ed., 1996). For example, linear epitopes may be determined by e.g., concurrently synthesizing large numbers of peptides on solid supports, the peptides corresponding to portions of the protein molecule, and reacting the peptides with antibodies while the peptides are still attached to the supports. Such techniques are known in the art and described in, e.g., U.S. Pat. No. 4,708,871; Geysen et al., 1984; Geysen et al., 1986. Similarly, conformational epitopes are readily identified by determining spatial conformation of amino acids such as by, e.g., x-ray crystallography and 2-dimensional nuclear magnetic resonance. See, e.g., Epitope Mapping Protocols, supra.
As discussed herein, the invention encompasses active fragments and variants of the antigenic polypeptide. Thus, the term “immunogenic or antigenic polypeptide” further contemplates deletions, additions and substitutions to the sequence, so long as the polypeptide functions to produce an immunological response as defined herein. The term “conservative variation” denotes the replacement of an amino acid residue by another biologically similar residue, or the replacement of a nucleotide in a nucleic acid sequence such that the encoded amino acid residue does not change or is another biologically similar residue. In this regard, particularly preferred substitutions will generally be conservative in nature, i.e., those substitutions that take place within a family of amino acids. For example, amino acids are generally divided into four families: (1) acidic—aspartate and glutamate; (2) basic—lysine, arginine, histidine; (3) non-polar—alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar—glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. Examples of conservative variations include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another hydrophobic residue, or the substitution of one polar residue for another polar residue, such as the substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine, and the like; or a similar conservative replacement of an amino acid with a structurally related amino acid that will not have a major effect on the biological activity. Proteins having substantially the same amino acid sequence as the reference molecule but possessing minor amino acid substitutions that do not substantially affect the immunogenicity of the protein are, therefore, within the definition of the reference polypeptide. All of the polypeptides produced by these modifications are included herein. The term “conservative variation” also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid provided that antibodies raised to the substituted polypeptide also immunoreact with the unsubstituted polypeptide.
The term “epitope” refers to the site on an antigen or hapten to which specific B cells and/or T cells respond. The term is also used interchangeably with “antigenic determinant” or “antigenic determinant site”. Antibodies that recognize the same epitope can be identified in a simple immunoassay showing the ability of one antibody to block the binding of another antibody to a target antigen.
An “immunological response” to a composition or vaccine is the development in the host of a cellular and/or antibody-mediated immune response to a composition or vaccine of interest. Usually, an “immunological response” includes but is not limited to one or more of the following effects: the production of antibodies, B cells, helper T cells, and/or cytotoxic T cells, directed specifically to an antigen or antigens included in the composition or vaccine of interest. Preferably, the host will display either a therapeutic or protective immunological response such that resistance to new infection will be enhanced and/or the clinical severity of the disease reduced. Such protection will be demonstrated by either a reduction or lack of symptoms normally displayed by an infected host, a quicker recovery time and/or a lowered viral titer in the infected host.
By “animal” is intended mammals, birds, and the like. Animal or host as used herein includes mammals and human. The animal may be selected from the group consisting of equine (e.g., horse), canine (e.g., dogs, wolves, foxes, coyotes, jackals), feline (e.g., lions, tigers, domestic cats, wild cats, other big cats, and other felines including cheetahs and lynx), ovine (e.g., sheep), bovine (e.g., cattle), porcine (e.g., pig), avian (e.g., chicken, duck, goose, turkey, quail, pheasant, parrot, finches, hawk, crow, ostrich, emu and cassowary), primate (e.g., prosimian, tarsier, monkey, gibbon, ape), ferrets, seals, and fish. The term “animal” also includes an individual animal in all stages of development, including embryonic and fetal stages.
Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The singular terms “a”, “an”, and “the” include plural referents unless context clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless the context clearly indicate otherwise.
It is noted that in this disclosure and particularly in the claims and/or paragraphs, terms such as “comprises”, “comprised”, “comprising” and the like can have the meaning attributed to it in U.S. patent law; e.g., they can mean “includes”, “included”, “including”, and the like; and that terms such as “consisting essentially of” and “consists essentially of” have the meaning ascribed to them in U.S. patent law, e.g., they allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention.
The present invention relates to a Hendra virus recombinant vaccine or composition which may comprise at least one recombinant or expression vector comprising one or more polynucleotide(s) encoding one or more Hendra virus polypeptide, antigen, epitope or immunogen. The vaccine or composition may further comprise a pharmaceutically or veterinarily acceptable carrier, excipient, adjuvant, or vehicle. The Hendra virus polypeptide, antigen, epitope or immunogen may be any Hendra virus polypeptide, antigen, epitope or immunogen, such as, but not limited to, a protein, peptide or fragment thereof, that elicits, induces or stimulates a response in an animal.
In another embodiment, the pharmaceutically or veterinarily acceptable carrier, excipient, adjuvant, or vehicle may be a water-in-oil emulsion. In yet another embodiment, the water-in-oil emulsion may be a water/oil/water (W/O/W) triple emulsion. In yet another embodiment, the pharmaceutically or veterinarily acceptable carrier, excipient, adjuvant, or vehicle may be an oil-in-water emulsion. In another embodiment, the pharmaceutically or veterinarily acceptable carriers, excipients, adjuvants, or vehicles may be polymers of acrylic or methacrylic acid, maleic anhydride and alkenyl derivative polymers.
In an embodiment, the Hendra virus polypeptide, antigen or fragment or variant thereof may be a Hendra virus F polypeptide or fragment or variant thereof. In an aspect of this embodiment, the Hendra virus F polypeptide or fragment or variant thereof is a recombinant polypeptide produced by a Hendra virus F gene. In another aspect of this embodiment, the Hendra virus F gene has at least 70% identity to the sequence as set forth in SEQ ID NO: 4 or 5. In another aspect of this embodiment, the Hendra virus F polypeptide or fragment or variant thereof has at least 80% identity to the sequence as set forth in SEQ ID NO: 6.
In another embodiment, the Hendra virus polypeptide, antigen or fragment or variant thereof may be a Hendra virus G polypeptide or fragment or variant thereof. In an aspect of this embodiment, the Hendra virus G polypeptide or fragment or variant thereof is a recombinant polypeptide produced by a Hendra virus G gene. In another aspect of this embodiment, the Hendra virus G gene has at least 70% identity to the sequence as set forth in SEQ ID NO: 1 or 2. In another aspect of this embodiment, the Hendra virus G polypeptide or fragment or variant thereof has at least 80% identity to the sequence as set forth in SEQ ID NO: 3.
Synthetic antigens are also included within the definition, for example, polyepitopes, flanking epitopes, and other recombinant or synthetically derived antigens. Immunogenic fragments, for purposes of the present invention, will usually include at least about 3 amino acids, at least about 5 amino acids, at least about 10-15 amino acids, or about 15-25 amino acids or more amino acids, of the molecule. There is no critical upper limit to the length of the fragment, which could comprise nearly the full-length of the protein sequence, or even a fusion protein comprising at least one epitope of the protein.
Accordingly, a minimum structure of a polynucleotide expressing an epitope is that it comprises or consists essentially of or consists of nucleotides encoding an epitope or antigenic determinant of a Hendra virus polypeptide. A polynucleotide encoding a fragment of a Hendra virus polypeptide may comprise or consist essentially of or consist of a minimum of 15 nucleotides, about 30-45 nucleotides, about 45-75, or at least 75, 87 or 150 consecutive or contiguous nucleotides of the sequence encoding the polypeptide. Epitope determination procedures, such as, generating overlapping peptide libraries (Hemmer et al., 1998), Pepscan (Geysen et al., 1984; Geysen et al., 1985; Van der Zee R. et al., 1989; Geysen, 1990; Multipin® Peptide Synthesis Kits de Chiron) and algorithms (De Groot et al., 1999; PCT/US2004/022605) can be used in the practice of the invention.
The term “nucleic acid” and “polynucleotide” refers to RNA or DNA that is linear or branched, single or double stranded, or a hybrid thereof. The term also encompasses RNA/DNA hybrids. The following are non-limiting examples of polynucleotides: a gene or gene fragment, exons, introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars and linking groups such as fluororibose and thiolate, and nucleotide branches. The sequence of nucleotides may be further modified after polymerization, such as by conjugation, with a labeling component. Other types of modifications included in this definition are caps, substitution of one or more of the naturally occurring nucleotides with an analog, and introduction of means for attaching the polynucleotide to proteins, metal ions, labeling components, other polynucleotides or solid support. The polynucleotides can be obtained by chemical synthesis or derived from a microorganism.
The term “gene” is used broadly to refer to any segment of polynucleotide associated with a biological function. Thus, genes include introns and exons as in genomic sequence, or just the coding sequences as in cDNAs and/or the regulatory sequences required for their expression. For example, gene also refers to a nucleic acid fragment that expresses mRNA or functional RNA, or encodes a specific protein, and which includes regulatory sequences.
An “isolated” biological component (such as a nucleic acid or protein or organelle) refers to a component that has been substantially separated or purified away from other biological components in the cell of the organism in which the component naturally occurs, for instance, other chromosomal and extra-chromosomal DNA and RNA, proteins, and organelles. Nucleic acids and proteins that have been “isolated” include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant technology as well as chemical synthesis.
The term “purified” as used herein does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a partially purified polypeptide preparation is one in which the polypeptide is more enriched than the polypeptide is in its natural environment. That is the polypeptide is separated from cellular components. By “substantially purified” is intended that at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98%, or more of the cellular components or materials have been removed. Likewise, a polypeptide may be partially purified. By “partially purified” is intended that less than 60% of the cellular components or material is removed. The same applies to polynucleotides. The polypeptides disclosed herein can be purified by any of the means known in the art.
Moreover, homologs of Hendra virus F or G polypeptides are intended to be within the scope of the present invention. As used herein, the term “homologs” includes orthologs, analogs and paralogs. The term “anologs” refers to two polynucleotides or polypeptides that have the same or similar function, but that have evolved separately in unrelated organisms. The term “orthologs” refers to two polynucleotides or polypeptides from different species, but that have evolved from a common ancestral gene by speciation. Normally, orthologs encode polypeptides having the same or similar functions. The term “paralogs” refers to two polynucleotides or polypeptides that are related by duplication within a genome. Paralogs usually have different functions, but these functions may be related. For example, analogs, orthologs, and paralogs of a wild-type Hendra virus polypeptide can differ from the wild-type Hendra virus polypeptide by post-translational modifications, by amino acid sequence differences, or by both. In particular, homologs of the invention will generally exhibit at least 80-85%, 85-90%, 90-95%, or 95%, 96%, 97%, 98% , 99% sequence identity, with all or part of the wild-type Hendra virus polypeptide or polynucleotide sequences, and will exhibit a similar function.
In one embodiment, the present invention provides an expression vector comprising one or more polynucleotides encoding one or more polypeptides having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to a polypeptide having a sequence as set forth in SEQ ID NO: 3 or 6. In another embodiment, the present invention provides fragments and variants of the Hendra virus F or G polypeptides identified above (SEQ ID NO: 3, 6) which may readily be prepared by one of skill in the art using well-known molecular biology techniques. Variants are homologous polypeptides having amino acid sequences at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequences as set forth in SEQ ID NO: 3 or 6.
Variants include allelic variants. The term “allelic variant” refers to a polynucleotide or a polypeptide containing polymorphisms that lead to changes in the amino acid sequences of a protein and that exist within a natural population (e.g., a virus species or variety). Such natural allelic variations can typically result in 1-5% variance in a polynucleotide or a polypeptide. Allelic variants can be identified by sequencing the nucleic acid sequence of interest in a number of different species, which can be readily carried out by using hybridization probes to identify the same genetic locus in those species. Any and all such nucleic acid variations and resulting amino acid polymorphisms or variations that are the result of natural allelic variation and that do not alter the functional activity of gene of interest, are intended to be within the scope of the invention.
As used herein, the term “derivative” or “variant” refers to a polypeptide, or a nucleic acid encoding a polypeptide, that has one or more conservative amino acid variations or other minor modifications such that (1) the corresponding polypeptide has substantially equivalent function when compared to the wild type polypeptide or (2) an antibody raised against the polypeptide is immunoreactive with the wild-type polypeptide. These variants or derivatives include polypeptides having minor modifications of the Hendra virus polypeptide primary amino acid sequences that may result in peptides which have substantially equivalent activity as compared to the unmodified counterpart polypeptide. Such modifications may be deliberate, as by site-directed mutagenesis, or may be spontaneous. The term “variant” further contemplates deletions, additions and substitutions to the sequence, so long as the polypeptide functions to produce an immunological response as defined herein.
An immunogenic fragment of a Hendra virus polypeptide includes at least 8, 10, 13, 14, 15, or 20 consecutive amino acids, at least 21 amino acids, at least 23 amino acids, at least 25 amino acids, or at least 30 amino acids of a Hendra virus polypeptide having a sequence as set forth in SEQ ID NO: 3, 6, or variants thereof.
In another aspect, the present invention provides an expression vector comprising a polynucleotide encoding a Hendra virus F polypeptide, such as a polynucleotide encoding a polypeptide having a sequence as set forth in SEQ ID NO: 6. In yet another aspect, the present invention provides an expression vector comprising a polynucleotide encoding a polypeptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to a polypeptide having a sequence as set forth in SEQ ID NO: 6, or a conservative variant, an allelic variant, a homolog or an immunogenic fragment comprising at least eight or at east ten consecutive amino acids of one of these polypeptides, or a combination of these polypeptides.
In yet another aspect, the present invention provides an expression vector comprising a polynucleotide encoding a Hendra virus G polypeptide, such as a polynucleotide encoding a polypeptide having a sequence as set forth in SEQ ID NO: 3. In yet another aspect, the present invention provides an expression vector comprising a polynucleotide encoding a polypeptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to a polypeptide having a sequence as set forth in SEQ ID NO: 3, or a conservative variant, an allelic variant, a homolog or an immunogenic fragment comprising at least eight or at east ten consecutive amino acids of one of these polypeptides, or a combination of these polypeptides.
In yet another aspect, the present invention provides an expression vector comprising two polynucleotides encoding a Hendra virus F polypeptide, such as a polynucleotide encoding a polypeptide having a sequence as set forth in SEQ ID NO: 6 and a Hendra virus G polypeptide, such as a polynucleotide encoding a polypeptide having a sequence as set forth in SEQ ID NO: 3.
In one embodiment the polynucleotide of the present invention includes a polynucleotide having a nucleotide sequence as set forth in SEQ ID NO: 1, 2, 4, 5, or a variant thereof. In another embodiment, the polynucleotide of the present invention includes a polynucleotide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 95%, 96%, 97%, 98% or 99% sequence identity to one of a polynucleotide having a sequence as set forth in SEQ ID NO: 1, 2, 4, 5, or a variant thereof.
The polynucleotides of the disclosure include sequences that are degenerate as a result of the genetic code, e.g., optimized codon usage for a specific host. As used herein, “optimized” refers to a polynucleotide that is genetically engineered to increase its expression in a given species. To provide optimized polynucleotides coding for Hendra virus polypeptides, the DNA sequence of the Hendra virus gene can be modified to 1) comprise codons preferred by highly expressed genes in a particular species; 2) comprise an A+T or G+C content in nucleotide base composition to that substantially found in said species; 3) form an initiation sequence of said species; or 4) eliminate sequences that cause destabilization, inappropriate polyadenylation, degradation and termination of RNA, or that form secondary structure hairpins or RNA splice sites. Increased expression of Hendra virus protein in said species can be achieved by utilizing the distribution frequency of codon usage in eukaryotes and prokaryotes, or in a particular species. The term “frequency of preferred codon usage” refers to the preference exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid. There are 20 natural amino acids, most of which are specified by more than one codon. Therefore, all degenerate nucleotide sequences are included in the disclosure as long as the amino acid sequence of the Hendra virus polypeptide encoded by the nucleotide sequence is functionally unchanged.
The sequence identity between two amino acid sequences may be established by the NCBI (National Center for Biotechnology Information) pairwise blast and the blosum62 matrix, using the standard parameters (see, e.g., the BLAST or BLASTX algorithm available on the “National Center for Biotechnology Information” (NCBI, Bethesda, Md., USA) server, as well as in Altschul et al.).
The “identity” with respect to sequences can refer to the number of positions with identical nucleotides or amino acids divided by the number of nucleotides or amino acids in the shorter of the two sequences wherein alignment of the two sequences can be determined in accordance with the Wilbur and Lipman algorithm (Wilbur and Lipman), for instance, using a window size of 20 nucleotides, a word length of 4 nucleotides, and a gap penalty of 4, and computer-assisted analysis and interpretation of the sequence data including alignment can be conveniently performed using commercially available programs (e.g., Intelligenetics™ Suite, Intelligenetics Inc. CA). When RNA sequences are said to be similar, or have a degree of sequence identity or homology with DNA sequences, thymidine (T) in the DNA sequence is considered equal to uracil (U) in the RNA sequence. Thus, RNA sequences are within the scope of the invention and can be derived from DNA sequences, by thymidine (T) in the DNA sequence being considered equal to uracil (U) in RNA sequences.
The sequence identity or sequence similarity of two amino acid sequences, or the sequence identity between two nucleotide sequences can be determined using Vector NTI software package (Invitrogen, 1600 Faraday Ave., Carlsbad, Calif.).
The following documents provide algorithms for comparing the relative identity or homology of sequences, and additionally or alternatively with respect to the foregoing, the teachings in these references can be used for determining percent homology or identity: Needleman S B and Wunsch C D; Smith T F and Waterman M S; Smith T F, Waterman M S and Sadler J R; Feng D F and Dolittle R F; Higgins D G and Sharp P M; Thompson J D, Higgins D G and Gibson T J; and, Devereux J, Haeberlie P and Smithies O. And, without undue experimentation, the skilled artisan can consult with many other programs or references for determining percent homology.
Hybridization reactions can be performed under conditions of different stringency. Conditions that increase stringency of a hybridization reaction are well known. See for example, “Molecular Cloning: A Laboratory Manual”, second edition (Sambrook et al., 1989).
The invention encompasses the Hendra virus polynucleotide(s) contained in a vector molecule or an expression vector and operably linked to a promoter element and optionally to an enhancer.
The present invention further encompasses a vaccine or composition which may comprise one or more aforementioned recombinant vector comprising one or more polynucleotides encoding one or more Hendra virus polypeptides or antigens, a pharmaceutically or veterinarily acceptable carrier, excipient, adjuvant, or vehicle. The present invention further relates to a vaccine or composition which may comprise one or more aforementioned recombinant or expression vector and additionally one or more antigens. The additional antigen(s) may be Nipah virus antigen(s). The antigen may comprise a whole organism, killed, attenuated or live; a subunit or portion of an organism; a recombinant vector containing an insert with immunogenic properties; a piece or fragment of DNA capable of inducing an immune response upon presentation to a host animal; a polypeptide, an epitope, a hapten, or any combination thereof.
A “vector” refers to a recombinant DNA or RNA plasmid or virus that comprises a heterologous polynucleotide to be delivered to a target cell, either in vitro or in vivo. The heterologous polynucleotide may comprise a sequence of interest for purposes of prevention or therapy, and may optionally be in the form of an expression cassette. As used herein, a vector needs not be capable of replication in the ultimate target cell or subject. The term includes cloning vectors and viral vectors.
The term “recombinant” means a polynucleotide with semisynthetic, or synthetic origin which either does not occur in nature or is linked to another polynucleotide in an arrangement not found in nature.
“Heterologous” means derived from a genetically distinct entity from the rest of the entity to which it is being compared. For example, a polynucleotide may be placed by genetic engineering techniques into a plasmid or vector derived from a different source, and is a heterologous polynucleotide. A promoter removed from its native coding sequence and operatively linked to a coding sequence other than the native sequence is a heterologous promoter.
The polynucleotides of the invention may comprise additional sequences, such as additional encoding sequences within the same transcription unit, controlling elements such as promoters, ribosome binding sites, 5′UTR, 3′UTR, transcription terminators, polyadenylation sites, additional transcription units under control of the same or a different promoter, sequences that permit cloning, expression, homologous recombination, and transformation of a host cell, and any such construct as may be desirable to provide embodiments of this invention.
Elements for the expression of a Hendra virus polypeptide, antigen, epitope or immunogen are present in an inventive vector. In minimum manner, this comprises an initiation codon (ATG), a stop codon and a promoter, and optionally also a polyadenylation sequence for certain vectors such as plasmid and certain viral vectors, e.g., viral vectors other than poxviruses. When the polynucleotide encodes a polypeptide fragment, e.g. a Hendra virus polypeptide, in the vector, an ATG is placed at 5′ of the reading frame and a stop codon is placed at 3′. Other elements for controlling expression may be present, such as enhancer sequences, stabilizing sequences, such as intron and signal sequences permitting the secretion of the protein.
The present invention also relates to compositions or vaccines comprising vectors.
The composition or vaccine can comprise one or more vectors, e.g., expression vectors, such as in vivo expression vectors, comprising and expressing one or more Hendra virus polypeptides, antigens, epitopes or immunogens. In one embodiment, the vector contains and expresses one or more polynucleotides that comprise one or more polynucleotides coding for and/or expressing one or more Hendra virus antigen, polypeptide, epitope or immunogen, in a pharmaceutically or veterinarily acceptable carrier, excipient, adjuvant, or vehicle.
According to another embodiment, the vector or vectors in the composition or vaccine comprise, or consist essentially of, or consist of polynucleotide(s) encoding one or more proteins or fragment(s) of a Hendra virus polypeptide, antigen, epitope or immunogen. In another embodiment, the composition or vaccine comprises one, two, or more vectors comprising polynucleotides encoding and expressing, advantageously in vivo, a Hendra virus polypeptide, antigen, fusion protein or an epitope thereof. The invention is also directed at mixtures of vectors that comprise polynucleotides encoding and expressing different Hendra virus polypeptides, antigens, epitopes, fusion protein, or immunogens, e.g., a Hendra virus F and/or G polypeptide, antigen, epitope or immunogen from pathogens causing disease in different species such as, but not limited to, humans, horses, pigs, cows or cattle, dogs, and cats.
In the present invention a recombinant viral vector is used to express one or more coding sequences or fragments thereof encoding one or more Hendra virus polypeptide or fragment or variant thereof. Specifically, the viral vector can express one or more Hendra virus sequences, more specifically one or more Hendra virus genes or fragments thereof that encode Hendra virus F or G polypeptides. Viral vector contemplated herein includes, but not limited to, poxvirus [e.g., vaccinia virus or attenuated vaccinia virus, avipox virus or attenuated avipox virus (e.g., canarypox, fowlpox, dovepox, pigeonpox, quailpox, ALVAC, TROVAC; see e.g., U.S. Pat. No. 5,505,941, U.S. Pat. No. 5,494,8070), raccoonpox virus, swinepox virus, etc.], adenovirus (e.g., human adenovirus, canine adenovirus), herpesvirus (e.g. canine herpesvirus, feline herpesvirus, bovine herpesvirus, swine herpesvirus, equine herpesvirus), baculovirus, retrovirus, etc. In another embodiment, the avipox expression vector may be a canarypox vector, such as, ALVAC. In yet another embodiment, the avipox expression vector may be a fowlpox vector, such as, TROVAC. The Hendra virus polypeptide, antigen, epitope or immunogen may be a Hendra virus F or G protein. The one or more polynucleotides encoding Hendra virus F polypeptide, or Hendra virus G polypeptide, or both F and G proteins are inserted under the control of a specific poxvirus promoter, e.g., the vaccinia promoter 7.5 kDa (Cochran et al., 1985), the vaccinia promoter I3L (Riviere et al., 1992), the vaccinia promoter HA (Shida, 1986), the cowpox promoter ATI (Funahashi et al., 1988), the vaccinia promoter H6 (Taylor et al., 1988b; Guo et al., 1989; Perkus et al., 1989), inter alia.
According to a yet further embodiment of the invention, the expression vector is a plasmid vector, in particular an in vivo expression vector. In a specific, non-limiting example, the pVR1020 or 1012 plasmid (VICAL Inc.; Luke et al., 1997; Hartikka et al., 1996, see, e.g., U.S. Pat. Nos. 5,846,946 and 6,451,769) can be utilized as a vector for the insertion of a polynucleotide sequence. The pVR1020 plasmid is derived from pVR1012 and contains the human tPA signal sequence. In one embodiment the human tPA signal comprises from amino acid M(1) to amino acid S(23) of GenBank accession number HUMTPA14. In another specific, non-limiting example, the plasmid utilized as a vector for the insertion of a polynucleotide sequence can contain the signal peptide sequence of equine IGF1 from amino acid M(24) to amino acid A(48) of GenBank accession number U28070. Additional information on DNA plasmids which may be consulted or employed in the practice are found, for example, in U.S. Pat. Nos. 6,852,705; 6,818,628; 6,586,412; 6,576,243; 6,558,674; 6,464,984; 6,451,770; 6,376,473 and 6,221,362.
The term plasmid covers any DNA transcription unit comprising a polynucleotide according to the invention and the elements necessary for its in vivo expression in a cell or cells of the desired host or target; and, in this regard, it is noted that a supercoiled or non-supercoiled, circular plasmid, as well as a linear form, are intended to be within the scope of the invention.
Each plasmid comprises or contains or consists essentially of, in addition to the polynucleotide(s) encoding the Hendra virus polypeptide(s), antigen(s), epitopes or immunogens, optionally fused with a heterologous peptide sequence, variant, analog or fragment, operably linked to a promoter or under the control of a promoter or dependent upon a promoter. In general, it is advantageous to employ a strong promoter functional in eukaryotic cells. The strong promoter may be, but not limited to, the immediate early cytomegalovirus promoter (CMV-IE) of human or murine origin, or optionally having another origin such as the rat or guinea pig.
In more general terms, the promoter has either a viral, or a cellular origin. A strong viral promoter other than CMV-IE that may be usefully employed in the practice of the invention is the early/late promoter of the SV40 virus or the LTR promoter of the Rous sarcoma virus. A strong cellular promoter that may be usefully employed in the practice of the invention is the promoter of a gene of the cytoskeleton, such as e.g. the desmin promoter (Kwissa et al., 2000), or the actin promoter (Miyazaki et al., 1989).
As to the polyadenylation signal (polyA) for the plasmids and viral vectors other than poxviruses, use can be made of the poly(A) signal of the bovine growth hormone (bGH) gene (see U.S. Pat. No. 5,122,458), or the poly(A) signal of the rabbit β-globin gene or the poly(A) signal of the SV40 virus.
A “host cell” denotes a prokaryotic or eukaryotic cell that has been genetically altered, or is capable of being genetically altered by administration of an exogenous polynucleotide, such as a recombinant plasmid or vector. When referring to genetically altered cells, the term refers both to the originally altered cell and to the progeny thereof.
The present invention includes the following method embodiments. In an embodiment, a method of vaccinating an animal comprising administering composition comprising a vector comprising one or more polynucleotides encoding one or more Hendra virus polypeptides or fragments or variants thereof and a pharmaceutical or veterinarily acceptable carrier, excipient, vehicle, or adjuvant to an animal and human is disclosed. In one aspect of this embodiment, the animal is an equine, a canine, a feline, or a porcine.
In yet another embodiment, a method of vaccinating an animal comprising a composition comprising one or more vectors comprising one or more polynucleotides encoding one or more Hendra virus polypeptides and optionally a pharmaceutical or veterinarily acceptable carrier, excipient, vehicle, or adjuvant and optionally one or more compositions comprising additional antigens is disclosed.
In one embodiment of the invention, a prime-boost regimen can be employed, which is comprised of at least one primary administration and at least one booster administration using at least one common polypeptide, antigen, epitope or immunogen. The administration may comprise one, two, or more vaccines or compositions comprising same or different antigens. Typically the immunological composition(s) or vaccine(s) used in primary administration is different in nature from those used as a booster. However, it is noted that the same composition(s) can be used as the primary administration and the booster administration. This administration protocol is called “prime-boost”.
A prime-boost regimen comprises at least one prime-administration and at least one boost administration using at least one common polypeptide and/or variants or fragments thereof. The prime-administration may comprise one or more administrations. Similarly, the boost administration may comprise one or more administrations. The prime-administration may comprise one or more antigens and the boost administration may comprise one or more antigens.
In one aspect of the prime-boost protocol or regime of the invention, a prime-boost protocol may comprise the administration of a composition comprising a recombinant viral vector that contains and expresses one or more Hendra virus polypeptides, antigens and/or variants or fragments thereof in vivo followed by the administration of one or more recombinant Hendra virus polypeptides or antigens, or an inactivated viral composition or vaccine comprising the Hendra virus polypeptides or antigens, or a DNA plasmid-based composition or vaccine expressing one or more Hendra virus polypeptides or antigens. Likewise, a prime-boost protocol may comprise the administration of a composition comprising one or more recombinant Hendra virus antigens, or an inactivated viral composition or vaccine comprising the Hendra virus polypeptides or antigens, or a DNA plasmid-based composition or vaccine expressing the Hendra virus polypeptide or antigen followed by the administration of a recombinant viral vector that contains and expresses one or more Hendra virus polypeptides or antigens and/or variants or fragments thereof in vivo. It is further noted that both the primary and the secondary administrations may comprise the recombinant viral vector that contains and expresses one or more Hendra virus polypeptides of the invention. Thus, the recombinant Hendra viral vector of the invention may be administered in any order with one or more recombinant Hendra virus antigens, an inactivated viral composition or vaccine comprising the Hendra virus antigens, or a DNA plasmid-based composition or vaccine expressing one or more Hendra virus antigens, or alternatively may be used alone as both the primary and secondary compositions.
The dose volume of compositions for target species that are mammals, e.g., the dose volume of dog compositions, based on viral vectors, e.g., non-poxvirus-viral-vector-based compositions, is generally between about 0.1 to about 2.0 ml, between about 0.1 to about 1.0 ml, and between about 0.5 ml to about 1.0 ml.
The efficacy of the vaccines may be tested about 2 to 4 weeks after the last immunization by challenging animals, such as horses, cats, dogs, pigs, or experimental laboratory animals (such as ferrets and guinea pigs) with a virulent strain of Hendra virus strain. Both homologous and heterologous strains are used for challenge to test the efficacy of the vaccine. The animal may be challenged by spray, intra-nasally, intra-ocularly, intra-tracheally, and/or orally. The challenge viral may be about 105-8 EID50 in a volume depending upon the route of administration. For example, if the administration is by spray, a virus suspension is aerosolized to generate about 1 to 100 μm droplets, if the administration is intra-nasal, intra-tracheal or oral, the volume of the challenge virus is about 0.5 ml, 1-2 ml, and 5-10 ml, respectively. Animals may be observed daily for 14 days following challenge for clinical signs, for example, dehydration and fever. In addition, the groups of animals may be euthanized and evaluated for pathological findings of pulmonary and pleural hemorrhage, tracheitis, bronchitis, bronchiolitis, bronchopneumonia and internal organs. Orophayngeal swabs may be collected from all animals post challenge for virus isolation. The presence or absence of viral antigens in respiratory tissues may be evaluated by quantitative real time reverse transcriptase polymerase chain reaction (qRT-PCR). Blood samples may be collected before and post-challenge and may be analyzed for the presence of Hendra virus-specific antibody.
The various administrations are preferably carried out 1 to 6 weeks apart. Preferred time interval is 3 to 5 weeks, and optimally 4 weeks. According to one embodiment, a six-month booster interval or an annual booster interval is also envisioned. The animals, for examples horses, may be at least four months of age at the time of the first administration.
It should be understood by one of skill in the art that the disclosure herein is provided by way of example and the present invention is not limited thereto. From the disclosure herein and the knowledge in the art, the skilled artisan can determine the number of administrations, the administration route, and the doses to be used for each injection protocol, without any undue experimentation.
The present invention contemplates at least one administration to an animal of an efficient amount of the therapeutic composition made according to the invention. The animal may be male, female, pregnant female and newborn. This administration may be via various routes including, but not limited to, intramuscular (IM), intradermal (ID) or subcutaneous (SC) injection or via intranasal or oral administration. The therapeutic composition according to the invention can also be administered by a needleless apparatus (as, for example with a Pigjet, Dermojet, Biojector, Avijet (Merial, GA, USA), Vet et or Vitajet apparatus (Bioject, Oregon, USA)). Another approach to administering plasmid compositions is to use electroporation (see, e.g. Tollefsen et al., 2002; Tollefsen et al., 2003; Babiuk et al., 2002; PCT Application No. WO99/01158). In another embodiment, the therapeutic composition is delivered to the animal by gene gun or gold particle bombardment.
The recombinant composition or vaccine can be administered to an animal or infected or transfected into cells in an amount of about 1.0 log 10 TCID50 (or CCID50) to about 20.0 log 10 TCID50 (or CCID50), about 1.0 log 10 TCID50 (or CCID50) to about 15.0 log 10 TCID50 (or CCID50), about 2.0 log 10 TCID50 (or CCID50) to about 10.0 log 10 TCID50 (or CCID50), or about 4.0 log 10 TCID50 (or CCID50) to about 8.0 log 10 TCID50 (or CCID50).
In one embodiment, the invention provides for the administration of a therapeutically effective amount of a formulation for the delivery and expression of a Hendra virus antigen or epitope in a target cell. Determination of the therapeutically effective amount is routine experimentation for one of ordinary skill in the art. In one embodiment, the formulation comprises an expression vector comprising a polynucleotide that expresses one or more Hendra virus antigens or epitopes and a pharmaceutically or veterinarily acceptable carrier, vehicle, adjuvant, or excipient.
The pharmaceutically or veterinarily acceptable carriers or vehicles or excipients or adjuvants are well known to the one skilled in the art. For example, a pharmaceutically or veterinarily acceptable carrier or vehicle or excipient or adjuvant can be a 0.9% NaCl (e.g., saline) solution or a phosphate buffer. Other pharmaceutically or veterinarily acceptable carrier or vehicle or excipient or adjuvant that can be used for methods of this invention include, but are not limited to, poly-(L-glutamate) or polyvinylpyrrolidone. The pharmaceutically or veterinarily acceptable carrier or vehicle or excipient or adjuvant may be any compound or combination of compounds facilitating the administration of the vector (or protein expressed from an inventive vector in vitro) and the transfection or infection and/or improves preservation of the vector or protein in a host. Doses and dose volumes are herein discussed in the general description and can also be determined by the skilled artisan from this disclosure read in conjunction with the knowledge in the art, without any undue experimentation.
The cationic lipids containing a quaternary ammonium salt which are advantageously but not exclusively suitable for plasmids, are those having the following formula:
in which R1 is a saturated or unsaturated straight-chain aliphatic radical having 12 to 18 carbon atoms, R2 is another aliphatic radical containing 2 or 3 carbon atoms and X is an amine or hydroxyl group, e.g. the DMRIE. In another embodiment the cationic lipid can be associated with a neutral lipid, e.g. the DOPE.
Among these cationic lipids, preference is given to DMRIE (N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propane ammonium; WO96/34109), advantageously associated with a neutral lipid, advantageously DOPE (dioleoyl-phosphatidyl-ethanol amine; Behr, 1994), to form DMRIE-DOPE.
When DOPE is present, the DMRIE:DOPE molar ratio is advantageously about 95:about 5 to about 5:about 95, more advantageously about 1:about 1, e.g., 1:1.
In another embodiment, pharmaceutically or veterinarily acceptable carrier, excipient, vehicle or adjuvant may be a water-in-oil emulsion. Examples of suitable water-in-oil emulsions include oil-based water-in-oil vaccinal emulsions which are stable and fluid at 4° C. containing: from 6 to 50 v/v % of an antigen-containing aqueous phase, preferably from 12 to 25 v/v %, from 50 to 94 v/v % of an oil phase containing in total or in part a non-metabolizable oil (e.g., mineral oil such as paraffin oil) and/or metabolizable oil (e.g., vegetable oil, or fatty acid, polyol or alcohol esters), from 0.2 to 20 p/v % of surfactants, preferably from 3 to 8 p/v %, the latter being in total or in part, or in a mixture either polyglycerol esters, said polyglycerol esters being preferably polyglycerol (poly)ricinoleates, or polyoxyethylene ricin oils or else hydrogenated polyoxyethylene ricin oils. Examples of surfactants that may be used in a water-in-oil emulsion include ethoxylated sorbitan esters (e.g., polyoxyethylene (20) sorbitan monooleate (TWEEN 80®), available from AppliChem, Inc., Cheshire, Conn.) and sorbitan esters (e.g., sorbitan monooleate (SPAN 80®), available from Sigma Aldrich, St. Louis, Mo.). In addition, with respect to a water-in-oil emulsion, see also U.S. Pat. No. 6,919,084. In some embodiments, the antigen-containing aqueous phase comprises a saline solution comprising one or more buffering agents. An example of a suitable buffering solution is phosphate buffered saline. In one embodiment, the water-in-oil emulsion may be a water/oil/water (W/O/W) triple emulsion (U.S. Pat. No. 6,358,500). Examples of other suitable emulsions are described in U.S. Pat. No. 7,371,395.
The immunological compositions and vaccines according to the invention may comprise or consist essentially of one or more pharmaceutically or veterinarily acceptable carriers, excipients, vehicles or adjuvants. Suitable adjuvants for use in the practice of the present invention are (1) polymers of acrylic or methacrylic acid, maleic anhydride and alkenyl derivative polymers, (2) immunostimulating sequences (ISS), such as oligodeoxyribonucleotide sequences having one or more non-methylated CpG units (Klinman et al., 1996; WO98/16247), (3) an oil in water emulsion, such as the SPT emulsion described on page 147 of “Vaccine Design, The Subunit and Adjuvant Approach” published by M. Powell, M. Newman, Plenum Press 1995, and the emulsion MF59 described on page 183 of the same work, (4) cation lipids containing a quaternary ammonium salt, e.g., DDA (5) cytokines, (6) aluminum hydroxide or aluminum phosphate, (7) saponin or (8) other adjuvants discussed in any document cited and incorporated by reference into the instant application, or (9) any combinations or mixtures thereof.
The oil in water emulsion (3), which is especially appropriate for viral vectors, can be based on: light liquid paraffin oil (European pharmacopoeia type), isoprenoid oil such as squalane, squalene, oil resulting from the oligomerization of alkenes, e.g. isobutene or decene, esters of acids or alcohols having a straight-chain alkyl group, such as vegetable oils, ethyl oleate, propylene glycol, di(caprylate/caprate), glycerol tri(caprylate/caprate) and propylene glycol dioleate, or esters of branched, fatty alcohols or acids, especially isostearic acid esters.
The oil is used in combination with emulsifiers to form an emulsion. The emulsifiers may be nonionic surfactants, such as: esters of on the one hand sorbitan, mannide (e.g. anhydromannitol oleate), glycerol, polyglycerol or propylene glycol and on the other hand oleic, isostearic, ricinoleic or hydroxystearic acids, said esters being optionally ethoxylated, or polyoxypropylene-polyoxyethylene copolymer blocks, such as Pluronic, e.g., L121.
Among the type (1) adjuvant polymers, preference is given to polymers of crosslinked acrylic or methacrylic acid, especially crosslinked by polyalkenyl ethers of sugars or polyalcohols. These compounds are known under the name carbomer (Pharmeuropa, vol. 8, no. 2, June 1996). One skilled in the art can also refer to U.S. Pat. No. 2,909,462, which provides such acrylic polymers crosslinked by a polyhydroxyl compound having at least three hydroxyl groups, preferably no more than eight such groups, the hydrogen atoms of at least three hydroxyl groups being replaced by unsaturated, aliphatic radicals having at least two carbon atoms. The preferred radicals are those containing 2 to 4 carbon atoms, e.g. vinyls, allyls and other ethylenically unsaturated groups. The unsaturated radicals can also contain other substituents, such as methyl. Products sold under the name Carbopol (BF Goodrich, Ohio, USA) are especially suitable. They are crosslinked by allyl saccharose or by allyl pentaerythritol. Among them, reference is made to Carbopol 974P, 934P and 971P.
As to the maleic anhydride-alkenyl derivative copolymers, preference is given to EMA (Monsanto), which are straight-chain or crosslinked ethylene-maleic anhydride copolymers and they are, for example, crosslinked by divinyl ether.
With regard to structure, the acrylic or methacrylic acid polymers and EMA are preferably formed by basic units having the following formula:
in which:
For EMA, x=0 and y=2 and for carbomers x=y=1.
These polymers are soluble in water or physiological salt solution (20 g/l NaCl) and the pH can be adjusted to 7.3 to 7.4, e.g., by soda (NaOH), to provide the adjuvant solution in which the expression vector(s) can be incorporated. The polymer concentration in the final immunological or vaccine composition can range between about 0.01 to about 1.5% w/v, about 0.05 to about 1% w/v, and about 0.1 to about 0.4% w/v.
The cytokine or cytokines (5) can be in protein form in the immunological or vaccine composition, or can be co-expressed in the host with the immunogen or immunogens or epitope(s) thereof. Preference is given to the co-expression of the cytokine or cytokines, either by the same vector as that expressing the immunogen or immunogens or epitope(s) thereof, or by a separate vector thereof.
The invention comprehends preparing such combination compositions; for instance by admixing the active components, advantageously together and with an adjuvant, carrier, cytokine, and/or diluent.
Cytokines that may be used in the present invention include, but are not limited to, granulocyte colony stimulating factor (G-CSF), granulocyte/macrophage colony stimulating factor (GM-CSF), interferon α (IFNα), interferon β (IFNβ), interferon γ, (IFNγ), interleukin-1α (IL-1α), interleukin-1β (IL-1β), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-8 (IL-8), interleukin-9 (IL-9), interleukin-10 (IL-10), interleukin-11 (IL-11), interleukin-12 (IL-12), tumor necrosis factor α (TNFα), tumor necrosis factor β (TNFβ), OX40L, and transforming growth factor β (TGFβ). It is understood that cytokines can be co-administered and/or sequentially administered with the immunological or vaccine composition of the present invention. Thus, for instance, the vaccine of the instant invention can also contain an exogenous nucleic acid molecule that expresses in vivo a suitable cytokine, e.g., a cytokine matched to this host to be vaccinated or in which an immunological response is to be elicited (for instance, a canine cytokine for preparations to be administered to canine).
The invention will now be further described by way of the following non-limiting examples.
Without further elaboration, it is believed that one skilled in the art can, using the preceding descriptions, practice the present invention to its fullest extent. The following detailed examples are to be construed as merely illustrative, and not limitations of the preceding disclosure in any way whatsoever. Those skilled in the art will promptly recognize appropriate variations from the procedures both as to reactants and as to reaction conditions and techniques.
Construction of DNA inserts, plasmids and recombinant viral or plant vectors was carried out using the standard molecular biology techniques described by J. Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989).
The synthetic Hendra virus G polypeptide (SEQ ID NO:2) optimized for expression in Equus caballus was cloned into pUC57 (GenScript Corporation, New Jersey, USA) vector. The EcoRV/KpnI fragment containing Hendra virus G fragment from the pUC57 vector was cloned into pCXL-148-2 (Merial Limited proprietary material) containing vaccinia H6 promoter resulting in plasmid p362-Hendra G (see FIG. 2 plasmid map).
The synthetic Hendra virus G polynucleotide (SEQ ID NO:5) optimized for expression in Equus caballus was cloned into pUC57 vector. The EcoRV/KpnI fragment containing Hendra virus G fragment from the pUC57 vector was cloned into pCXL-148-2 (Merial Limited proprietary material) containing vaccinia H6 promoter resulting in plasmid p362-Hendra F (see FIG. 2 plasmid map).
A. Generation of vCP3004
The IVR (in vitro recombinant) was performed by transfection of Primary chicken embryo fibroblast (1°CEF) cells with NotI linearized donor plasmid p362-Hendra G. The transfected cells were subsequently infected with parental ALVAC as rescue virus at MOI (multiplicity of infection) of 10. After 24 hours, the transfected/infected cells were harvested, sonicated and used for recombinant virus screening. Recombinant plaques were screened based on the plaque lift hybridization method using Hendra G-specific probe which was labeled with horse radish peroxidase according to the manufacturer's protocol (GE Healthcare, Cat #RPN3001). After four sequential rounds of plaque purification, the recombinants designated as vCP3004.1.1.1.1. and vCP3004.5.3.2.2 were generated and confirmed by hybridization as 100% positive for the Hendra G insert and 100% negative for the C5 ORF.
Genomic DNA from vCP3004.1.1.1.1 was extracted and digested with BamHI, HindIII and PstI, separated by agarose electrophoresis and then transferred to nylon membrane. Southern blot was performed by probing with a Hendra G probe. The primers used to generate the Hendra G probe are:
| HenG.1F | |
| (SEQ ID NO: 13) | |
| GGCTCTGACCGACAAAATCG | |
| HenG.1R | |
| (SEQ ID NO: 14) | |
| GAACTGCAGGATGATGTCCC |
Specific 704 bp and 903 bp of BamHI digest bands, 12293 bp of HindIII digest band, 614 bp, 309 bp, and 94 bp of PstI digest bands were observed at the expected sizes, indicating the correct insertion of Hendra G into the C5 locus (see FIG. 3).
Primary CEF cells were infected with vCP3004.1.1.1.1 at MOI of 10 and incubated at 37° C. for 24 hours. The cells and culture supernatant were then harvested. Sample proteins were separated on a 10% SDS-PAGE gel, transferred to PVDF membrane. A serum raised in guinea pig reacted strongly with the G protein at an apparent molecular size of approximately 70 kDa. The result is shown in FIG. 4.
A more detailed analysis of the P3 stock genomic DNA was performed by PCR amplification and sequence analysis of the flanking arms of the C5 locus and the Hendra G insert. Primers C5R.1F and C5L.2R located at the end of the arms of the C5 locus in the donor plasmid were used to amplify the entire C5R-Hendra G insert-C5L fragment.
| C5R.1F | |
| (SEQ ID NO: 15) | |
| ATTCTATCGGAAGATAGGATACCAG | |
| C5L.2R | |
| (SEQ ID NO: 16) | |
| GGAGATACCTTTAGATATGGATCTG |
The results showed that the sequences of the Hendra G insert and the C5 left and right arms around the G insert in vCP3004.1.1.1.1 were correct.
A. Generation of vCP3005
The IVR (in vitro recombinant) was performed by transfection of Primary chicken embryo fibroblast (1°CEF) cells with NotI linearized donor plasmid p362-Hendra F. The transfected cells were subsequently infected with parental ALVAC as rescue virus at MOI (multiplicity of infection) of 10. After 24 hours, the transfected/infected cells were harvested, sonicated and used for recombinant virus screening. Recombinant plaques were screened based on the plaque lift hybridization method using Hendra F-specific probe which was labelled with horse radish peroxidase according to the manufacturer's protocol (GE Healthcare, Cat #RPN3001). After four sequential rounds of plaque purification, the recombinants designated as vCP3005.3.4.1 and vCP3005.5.3.2 were generated and confirmed by hybridization as 100% positive for the Hendra F insert and 100% negative for the C5 ORF.
Genomic DNA from vCP3005.3.4.1 was extracted and digested with BamHI, HindIII and PstI, separated by agarose electrophoresis and then transferred to nylon membrane. Southern blot was performed by probing with a Hendra F probe. The primers used to generate the Hendra F probe are:
| HenF.1F | |
| (SEQ ID NO: 17) | |
| CCATCGAACTGTATAACAAT | |
| HenF.1R | |
| (SEQ ID NO: 18) | |
| GGAGATGATGATGTTGCCCA |
Specific 704 bp and 903 bp of BamHI digest bands, 12293 bp of HindII band, 614 bp, 309 bp and 94 bp of PstI digest bands were observed at the expected sizes, indicating the correct insertion of Hendra F into the C5 locus (see FIG. 5).
Primary CEF cells were infected with vCP3005.3.4.1 at MOI of 10 and incubated at 37° C. for 24 hours. The cells and culture supernatant were then harvested. Sample proteins were separated on a 10% SDS-PAGE gel, transferred to PVDF membrane. When a serum raised in guinea pig was used in the Western blot, a faint band corresponding to uncleaved F0 protein at approximately 60 kDa was recognized. The result is shown in FIG. 6.
A more detailed analysis of the P3 stock genomic DNA was performed by PCR amplification and sequence analysis of the flanking arms of the C5 locus and the Hendra F insert. Primers C5R.1F (SEQ ID NO:15) and C5L.2R (SEQ ID NO:16) located at the end of the arms of the C5 locus in the donor plasmid were used to amplify the entire C5R-Hendra F inset-C5L fragment.
Simultaneous co-infection of HEK293 cells with the ALVAC-Hendra G (vCP3004) and ALVAC-Hendra F (vCP3005) at an MOI of 10+10 resulted in syncytium formation, while single infections either ALVAC-Hendra F (vCP3005) or ALVAC-Hendra G (vCP3004) recombinant virus at MOI of 20 did not result in syncytium formation, demonstrating the functionality of both proteins (see FIG. 7).
The Canarypox vectors (ALVAC) containing polynucleotides (SEQ ID NO:19 and 21) encoding Nipah F protein (SEQ ID NO:20) and Nipah G protein (SEQ ID NO:22) were constructed as described in US patent application US 2007/0031455.
In this study, two groups of horses were vaccinated IM with the mixture of vCP-Hendra G vector (vCP3004) and vCP-Nipah F vector (ALVAC vector containing Nipah F) on D0 and D28. Group 1 received the vector mixture in Carbomer at 5.8 log 10 TCID50/dose. Group 2 received the vector mixture in Carbomer at 6.8 log 10 TCID50/dose. Sera were titrated for antibodies against Hendra G and F proteins and Nipah G and F proteins in serum neutralization titre (SNT) test. Sera were also tested in ELISA blocking and binding assays using antibodies against Hendra G protein and Nipah G protein respectively.
FIGS. 8A-C show the ELISA binding assay and blocking assay using antibodies against Hendra G protein, and SNT test against Hendra G and F proteins. FIGS. 9A-C show the binding assay and blocking assay using antibodies against Nipah G protein, and SNT test against Nipah G and F proteins.
The results showed that vaccination of horses with vCP-Hendra G vector and vCP-Nipah F vector induced anti-Hendra and anti-Nipah responses even as late as D70.
Vaccinations of horses and canaries using vCP3004 (ALVAC-Hendra G)+vCP3005 (ALVAC-Hendra F), vCP3004 (ALVAC-Hendra G) alone and vCP3005 (ALVAC-Hendra F) alone were done on Day 0, Day 28 and D183. Blood, urine, nasal/oral/rectal and ocular swabs were collected and tested for spread/shed evaluation. The vCP3004 (ALVAC-Hendra G)+vCP3005 (ALVAC-Hendra F) experiment design is shown in Table 1 below.
| TABLE 1 |
| vCP3004 (ALVAC-Hendra G) + vCP3005 (ALVAC-Hendra F) vaccination and clinical |
| test in horses |
| Target antigen | ||||||
| titre (after | Serum | Clinical | Biodiffusibility | |||
| Group | Vaccine | dilution) | vaccination | collection | exam | sampling |
| 1 | Recombinant | 5.5log10CCID50/ | D0, D28 | D0, D14, | D0, | Not |
| (n = 4) | canarypox | dose | and D183 | D28, D71, | D0 + 4/6 h, | performed |
| 2 | expressing | 6.9log10CCID50/ | 1 ml | D85, D99, | D1 to D3, | D0, |
| (n = 4) | Hendra F | dose | IM route | D127, | D28, | D0 + 4/6 h, |
| (vCP3005) | D155, | D28 + 4/6 h, | D1, D2, D3, | |||
| and G | D183, | D29 to D31 | D7, D14 | |||
| (vCP3004) | D197, | |||||
| in Carbopol | D204, | |||||
| D211 | ||||||
The clinical result showed that vaccinations are safe for both groups. There is no difference between groups 1 and 2. Biodiffusibility data showed that no virus was detected in any samples.
FIG. 10A shows the virus neutralization (VN) test against Hendra. Both groups showed above the theoretical protection threshold (64 titre) from D70 onward up to D155. After the third injection on D183, both groups showed clear booster effect.
FIG. 10B shows the VN test against Nipah. The results showed good cross reactivity against Nipah. Most horses showed above the protection threshold (60 titre) after the third injection on D183, and some horses showed some protection even after the second injection on D28.
The vCP3004 (ALVAC-Hendra G) experiment design is shown in Table 2 below.
| TABLE 2 |
| vCP3004 (ALVAC-Hendra G) vaccination and |
| clinical test in canaries |
| Inoculation on D0 by | Euthanasia and | ||
| Group | transcutaneous route | Clinical exam | Sampling* |
| A | A1 | vCP3004 50 μl | D0, | 8 birds on D8 |
| (n = 16) | (7.0log10CCID50/dose) | D0 + 3h/5h, | 8 birds on D16 | |
| A2 | PBS + 50% glycerin | D1, D3, D6, D8, | D16 | |
| (n = 4) | (inoculated with | D10, D13, D15, | ||
| placebo and | D16 | |||
| remained in | ||||
| contact with canaries | ||||
| in A1) | ||||
| B | B1 | CPpp** 50 μl | 8 birds on D8 | |
| (n = 16) | (7.0log10CCID50/dose) | 8 birds on D16 | ||
| B2 | PBS + 50% glycerin | D16 | ||
| (n = 4) | (inoculated with | |||
| placebo and | ||||
| remained in | ||||
| contact with canaries | ||||
| in B1) | ||||
| *Sampling: skin at the injection site for histology and virus isolation brain, lung, spleen, liver, kidney pooled for virus isolation | ||||
| **CPpp: inactivated canarypox virus as a control. |
No clinical signs were reported in any one of the four groups. There is no difference in histology between the vaccinated groups.
On D8, virus was detected on the skin of all canaries vaccinated with CPpp (ranging from 2.79 to 6.65 log10 CCID50/ml) and all but one canaries vaccinated with vCP3004 (ranging from 3.22 to 6.80 log10 CCID50/m1). On D16, no virus was detected in any vaccinated groups.
Sampling of the pool of organs showed that no virus was detected in any canaries in the two inoculated groups and the two contact groups on D8 and D16.
The results demonstrated the safety and the absence of spreading of vCP3004 administered at high titre by transcutaneous route to the canary. The absence of reactions and virus isolation in the sentinel canaries confirmed the absence of spread of vCP3004 in this species.
The vCP3005 (ALVAC-Hendra F) experiment design is shown in Table 3 below.
| TABLE 3 |
| vCP3005 (ALVAC-Hendra F) vaccination and |
| clinical test design in canaries |
| Inoculation on D0 by | Euthanasia and | ||
| Group | transcutaneous route | Clinical exam | Sampling |
| A | A1 | vCP3005 50 μl | D0, | 8 birds on D8 |
| (n = 16) | (7.0log10CCID50/dose) | D0 + 3h/5h, | 8 birds on D16 | |
| A2 | PBS + 50% glycerin | D1, D3, D6, D8, | D16 | |
| (n = 4) | (inoculated with | D10, D13, D15, | ||
| placebo and | D16 | |||
| remained in | ||||
| contact with | ||||
| canaries in A1) | ||||
| B | B1 | CPpp 50 μl | 8 birds on D8 | |
| (n = 16) | (7.0log10CCID50/dose) | 8 birds on D16 | ||
| B2 | PBS + 50% glycerin | D16 | ||
| (n = 4) | (inoculated with | |||
| placebo and | ||||
| remained in | ||||
| contact with | ||||
| canaries in B1) | ||||
The result showed that there was no clinical sign for any vaccinated group. On D8 and D16, after the first passage, no virus could be isolated from the organ samples in both inoculated groups and contact animals. This study demonstrated the safety and the absence of spreading of vCP3005 administered at high titre by transcutaneous route to the canary. The absence of reactions and virus isolation in the sentinel canaries confirmed the absence of spread of vCP3005 in this species.
Having thus described in detail preferred embodiments of the present invention, it is to be understood that the invention defined by the above paragraphs is not to be limited to particular details set forth in the above description as many apparent variations thereof are possible without departing from the spirit or scope of the present invention.
All documents cited or referenced in the application cited documents, and all documents cited or referenced herein (“herein cited documents”), and all documents cited or referenced in herein cited documents, together with any manufacturer's instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the invention.
1. A composition comprising one or more expression vectors, wherein the vector comprises a polynucleotide encoding one or more polypeptide selected from the group consisting of a Hendra virus G polypeptide, a variant or fragment of the Hendra virus G polypeptide, a Hendra virus F polypeptide, a variant or fragment of the Hendra virus F polypeptide, and a mixture thereof.
2. The composition of claim 1, wherein the vector comprises a first polynucleotide encoding a Hendra virus G polypeptide and a second polynucleotide encoding a Hendra virus F polypeptide.
3. The composition of claim 1, wherein the composition comprises a first expression vector comprising a polynucleotide encoding a Hendra virus G polypeptide and a second expression vector comprising a polynucleotide encoding a Hendra virus F polypeptide.
4. The composition of claim 1 further comprising one or more additional antigens.
5. The composition of claim 4, wherein the additional antigens are Nipah antigens.
6. The composition of claim 2, wherein the first polynucleotide encodes a Hendra virus G polypeptide having at least 80% sequence identity to the sequence as set forth in SEQ ID NO: 3, and wherein the second polynucleotide encodes a Hendra virus F polypeptide having at least 80% sequence identity to the sequence as set forth in SEQ ID NO: 6.
7. The composition of claim 1, wherein the polynucleotide encodes a Hendra virus G polypeptide having at least 80% sequence identity to the sequence as set forth in SEQ ID NO:3.
8. The composition of claim 1, wherein the polynucleotide encodes a Hendra virus F polypeptide having at least 80% sequence identity to the sequence as set forth in SEQ ID NO:6.
9. The composition of claim 1, wherein the polynucleotide has at least 70% sequence identity to the sequence as set forth in SEQ ID NO:1, 2, 4, or 5.
10. The composition of claim 1, wherein the vector is a poxvirus.
11. The composition of claim 1, wherein the composition further comprises a pharmaceutically or veterinary acceptable vehicle, adjuvant, diluent or excipient.
12. A vector comprising one or more polynucleotide encoding one or more polypeptide selected from the group consisting of a Hendra virus G polypeptide, a variant or fragment of the Hendra virus G, a Hendra virus F polypeptide, a variant or fragment of the Hendra virus F polypeptide, and a mixture thereof.
13. The vector of claim 12, wherein the polynucleotide encodes a Hendra virus G polypeptide having at least 80% sequence identity to the sequence as set forth in SEQ ID NO:3.
14. The vector of claim 12, wherein the polynucleotide encodes a Hendra virus F polypeptide having at least 80% sequence identity to the sequence as set forth in SEQ ID NO:6.
15. The vector of claim 12, wherein the vector comprises a first polynucleotide encoding a Hendra virus G polypeptide and a second polynucleotide encoding a Hendra virus F polypeptide.
16. The vector of claim 15, wherein the first polynucleotide encodes a Hendra virus G polypeptide having at least 80% sequence identity to the sequence as set forth in SEQ ID NO: 3, and wherein the second polynucleotide encodes a Hendra virus F polypeptide having at least 80% sequence identity to the sequence as set forth in SEQ ID NO: 6.
17. The vector of claim 12, wherein the polynucleotide is operably linked to a promoter.
18. The vector of claim 12, wherein the vector is a poxvirus.
19. A method of vaccinating an animal comprising at least one administration of the composition of claim 1 or vector of claim 12.
20. The method of claim 19, wherein the method comprises a prime-boost administration regime.
21. A method for inducing an immunogenic or protective response against Hendra virus or Nipah virus comprising at least one administration of the composition of claim 1 or vector of claim 12.
22. A method of hyperimmunizing horses to induce polyclonal antibodies for serotherapy in animals and humans comprising at least one administration of the composition of claim 1 or vector of claim 12.