Patent application title:

METHODS FOR AFFINITY MATURATION-BASED ANTIBODY OPTIMIZATION

Publication number:

US20120316071A1

Publication date:
Application number:

13/508,353

Filed date:

2010-11-04

Abstract:

Provided herein is a rational method of affinity maturation to evolve the activity of an antibody or portion thereof based on the structure/affinity or activity relationship of an antibody. The resulting affinity matured antibodies exhibit improved or optimized binding affinity for a target antigen.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

G01N33/6845 »  CPC main

Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids; General methods of protein analysis not limited to specific proteins or families of proteins Methods of identifying protein-protein interactions in protein mixtures

A61P31/04 »  CPC further

Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics Antibacterial agents

A61P31/12 »  CPC further

Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics Antivirals

A61P35/00 »  CPC further

Antineoplastic agents

C07K16/00 »  CPC further

Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies

C07K16/28 »  CPC further

Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants

C07K16/2863 »  CPC further

Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators

C07K16/32 »  CPC further

Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes

C12N15/1058 »  CPC further

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Processes for the isolation, preparation or purification of DNA or RNA; Isolating an individual clone by screening libraries Directional evolution of libraries, e.g. evolution of libraries is achieved by mutagenesis and screening or selection of mixed population of organisms

C07K2317/33 »  CPC further

Immunoglobulins specific features characterized by aspects of specificity or valency Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity

C07K2317/34 »  CPC further

Immunoglobulins specific features characterized by aspects of specificity or valency Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues

C07K2317/55 »  CPC further

Immunoglobulins specific features characterized by immunoglobulin fragments Fab or Fab'

C07K2317/56 »  CPC further

Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL

C07K2317/76 »  CPC further

Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen Antagonist effect on antigen, e.g. neutralization or inhibition of binding

C07K2317/92 »  CPC further

Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value

C40B10/00 IPC

Directed molecular evolution of macromolecules, e.g. RNA, DNA or proteins

C40B30/04 »  CPC further

Methods of screening libraries by measuring the ability to specifically bind a target molecule, e.g. antibody-antigen binding, receptor-ligand binding

Description

RELATED APPLICATIONS

Benefit of priority is claimed to U.S. Provisional Application Ser. No. 61/280,618, entitled “Methods for Affinity Maturation-Based Antibody Optimization,” filed Nov. 4, 2009, and to U.S. Provisional Application Ser. No. 61/395,670, entitled “Methods for Affinity Maturation-Based Antibody Optimization, Antibody Conversion and Antibodies,” filed May 13, 2010. Where permitted, the subject matter of the above-noted applications are incorporated by reference in its entirety.

This application also is related to International PCT Application No. PCT/US2009/063299, entitled “Combinatorial Antibody Libraries and Uses Thereof,” filed Nov. 4, 2009, which claims priority to U.S. Provisional Application No. 61/198,764 filed Nov. 7, 2008 and to U.S. Provisional Application No. 61/211,204 filed Mar. 25, 2009, each entitled “Combinatorial Antibody Libraries and Uses Thereof.” This application also is related to International PCT Application No. PCT/US09/63303, entitled Anti-DLL4 Antibodies and Uses Thereof, which also claims priority to each of U.S. Provisional Application Nos. 61/198,764 and 61/211,204.

The subject matter of each of the above-noted applications is incorporated by reference in its entirety.

INCORPORATION BY REFERENCE OF SEQUENCE LISTING PROVIDED ON COMPACT DISCS

An electronic version of the Sequence Listing is filed herewith, the contents of which are incorporated by reference in their entirety. The electronic file is 2.66 megabytes in size, and titled 702seqPC1.txt.

FIELD OF THE INVENTION

Provided herein is a rational method of affinity maturation to evolve the activity of an antibody or portion thereof based on the structure/affinity or activity relationship of an antibody. The resulting affinity matured antibodies exhibit improved or optimized binding affinity for a target antigen.

BACKGROUND

Numerous therapeutic and diagnostic monoclonal antibodies (MAbs) are used in the clinical setting to treat and diagnose human diseases, for example, cancer and autoimmune diseases. For example, exemplary therapeutic antibodies include Rituxan (Rituximab), Herceptin (Trastuzumab), Avastin (Bevacizumab) and Remicade (Infliximab). In designing antibody therapeutics, it is desirable to create antibodies, for example, antibodies that modulate a functional activity of a target, and/or improved antibodies such as antibodies with higher specificity and/or affinity and/or and antibodies that are more bioavailable, or stable or soluble in particular cellular or tissue environments. It is among the objects herein to provide methods for optimizing and improving the binding affiniites of antibodies and for selecting antibodies with desired affinities.

SUMMARY

Provided herein are methods of affinity maturation of antibodies or fragments thereof based on structure/activity relationship (SAR). The methods result in the optimization of antibodies to have increased and improved activity (e.g. binding specificity or affinity) for a target antigen compared to the starting antibody that is affinity matured.

Provided herein is a method of affinity maturation of a first antibody or portion thereof for a target antigen. In the method, a related antibody or portion thereof is identified that exhibits a reduced activity for the target antigen than the corresponding form of a first antibody, whereby the related antibody or portion thereof contains a related variable heavy chain or a related variable light chain that is either 1) one in which the corresponding variable heavy chain or variable light chain of the related antibody exhibits at least 75% amino acid sequence identity to the variable heavy chain or variable light chain of the first antibody but does not exhibit 100% sequence identity therewith; or 2) one in which at least one of the VH, DH and JH germline segments of the nucleic acid molecule encoding the variable heavy chain of the related antibody is identical to one of the VH, DH and JH germline segments of the nucleic acid molecule encoding the variable heavy chain of the first antibody and/or at least one of the Vκ and Jκ or at least one of the Vλ and Jλ germline segments of the nucleic acid molecule encoding the variable light chain is identical to one of the Vκ and Jκ or Vλ and Jλ germline segments of the nucleic acid molecule encoding the variable light chain of the first antibody. Further, in the method, the amino acid sequence of the variable heavy chain or variable light chain of the first antibody is compared to the amino acid sequence of the corresponding related variable heavy chain or variable light chain of the related antibody. Following comparison, a target region within the variable heavy chain or variable light chain of a first antibody is identified, whereby a target region is a region in the first antibody that exhibits at least one amino acid difference compared to the same region in the related antibody. After identifying a target region, a plurality of modified antibodies are produced each containing a variable heavy chain and a variable light chain, or a portion thereof, where at least one of the variable heavy chain or variable light chain is modified in its target region by replacement of a single amino acid residue, such that the target region in each of the plurality of antibodies contains replacement of an amino acid to a different amino acid compared to the first antibody. The resulting plurality of mutated antibodies are screened for an activity to the target antigen. Modified antibodies that exhibit increased activity for the target antigen compared to the first antibody. In one example of the method, the plurality of modified antibodies are produced by producing a plurality of nucleic acid molecules that encode modified forms of a variable heavy chain or a variable light chain of the first antibody, wherein the nucleic acid molecules contain one codon encoding an amino acid in the target region that encodes a different amino acid from the unmodified variable heavy or variable light chain, such that each nucleic acid molecule of the plurality encodes a variable heavy chain or variable light chain that is modified in its target region by replacement of a single amino acid residue.

In the method provided herein, the target region in the first antibody exhibits 1, 2, 3, 4, 5, 6 7, 8, 9 or 10 amino acid differences compared to the corresponding region in the related antibody. Further, in the method, the first antibody can be compared to 1, 2, 3, 4, or 5 related antibodies. In the method herein, the target region is selected from among a CDR1, CDR2, CDR3, FR1, FR2, FR3 and FR4. For example, the target region is a CDR1, CDR2 or CDR3.

In the method provided herein, an activity that is assessed can be binding, signal transduction, differentiation, alteration of gene expression, cellular proliferation, apoptosis, chemotaxis, cytotoxicity, cancer cell invasion, endothelial cell proliferation or tube formation. In one example, the activity is binding and binding is assessed by an immunoassay, whole cell panning or surface plasmon resonance (SPR). For example, binding can be assessed by immunoassay such as by a radioimmunoassay, enzyme linked immunosorbent assay (ELISA) or electrochemiluminescence assay. In particular, binding is assessed using an electrochemiluminescence assay such as meso scale discovery (MSD).

In the method herein, the first antibody that is affinity matured binds to the target antigen with a binding affinity that is at or about 10−4 M, 10−5 M, 10−6 M, 10−7 M, 10−8 M, or lower, when the antibody is in a Fab form.

In one example, the affinity maturation method provided herein involves comparison to a related antibody or portion thereof that exhibits 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less activity than the corresponding form of the first antibody. For example, the related antibody can exhibit the same or similar level of activity to the target antigen compared to a negative control. In another example, the related antibody exhibits a binding affinity that is less than the binding affinity of the first antibody, whereby the binding affinity is at or about 10−4 M, 10−5 M, 10−6 M, 10−7 M, 10−8 M or lower in its Fab form.

In one example of the method provided herein, a target region is identified within the variable heavy chain of the first antibody, and the method is performed therefrom. In another example of a method provided herein, a target region is identified within the variable light chain of the first antibody, the method is performed therefrom. In a further example of the method herein, a target region is identified within the variable heavy chain of the first antibody and steps the method is performed therefrom; and separately and independently a target region is identified within the variable light chain of the first antibody, and the method is performed therefrom.

In one aspect of the method herein, a related antibody that contains the related corresponding variable heavy chain is different than a related antibody that contains the related corresponding variable light chain. In another aspect of the method herein, a related antibody that contains the related corresponding variable heavy chain is the same as a related antibody that contains the related corresponding variable light chain.

In one example of the method herein, the variable heavy chain or variable light chain of the first antibody exhibits 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the corresponding related variable heavy chain or variable light chain of the related antibody. In particular, the variable heavy chain or variable light chain of the first antibody exhibits at least 95% sequence identity with the corresponding related variable heavy chain or variable light chain of the related antibody.

In another example, the related antibody contains a related variable heavy chain or variable light chain that is one in which at least one of the VH, DH and JH germline segments of the nucleic acid molecule encoding the variable heavy chain of the first antibody is identical to one of the VH, DH and JH germline segments of the nucleic acid molecule encoding the variable heavy chain of the related antibody; and/or at least one of the Vκ and Jκ or at least one of the Vλ and Jλ germline segments of the nucleic acid molecule encoding the variable light chain of the first antibody is identical to one of the Vκ and Jκ or Vλ and Jλ, germline segments of the nucleic acid molecule encoding the variable light chain of the related antibody. For example, the related antibody contains a related variable heavy chain or variable light that is one in which at least one of the VH, DH and VH germline segments of the nucleic acid molecule encoding the variable heavy chain of the first antibody is from the same gene family as one of the VH, DH and JH germline segments of the nucleic acid molecule encoding the variable heavy chain of the related antibody; and/or at least one of the Vκ and Jκ or at least one of the Vλ and Jλ germline segments of the nucleic acid molecule encoding the variable light chain of the first antibody is from the same gene family as one of the Vκ and Jκ or Vλ and Jλ germline segments of the nucleic acid molecule encoding the variable light chain of the related antibody. In such examples, the variable heavy chain or variable light chain of the first antibody exhibits 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the corresponding related variable heavy chain or variable light chain of the related antibody.

In the method herein, the first antibody is identified by screening a combinatorial antibody library, where the combinatorial antibody library is produced by combining a VH, a DH and a JH human germline segment or portion thereof in frame to generate a sequence of a nucleic acid molecule encoding a VH chain or a portion thereof; and combining a Vκ and a Jκ human germline segment or portion thereof, or a Vλ and a Jλ germline segment or portion thereof in frame to generate a sequence of a nucleic acid molecule encoding a VL chain or a portion thereof. In the steps of combining, each of the portions of the VH, DH, JH, Vκ, Jκ, Vλ or Jλ are sufficient to produce an antibody or portion thereof containing a VH or VL or portion thereof that forms a sufficient antigen binding site. The steps of combining are repeated a plurality of times to generate sequences of a plurality of different nucleic acid molecules. The nucleic acid molecules are synthesized to produce two libraries. The first library contains nucleic acid molecules encoding a VH chain or a portion thereof; and the second library contains nucleic acid molecules encoding a VL chain or a portion thereof. The nucleic acid molecules from the first and second library are introduced into a cell, which is repeated a plurality of times to produce a library of cells, wherein each cell contains nucleic acid molecules encoding a different combination of VH and VL from every other cell in the library of cells. Finally, in the method of generating a combinatorial library, the cells are grown to express the antibodies or portions thereof in each cell, thereby producing a plurality of antibodies or portion thereof, wherein each antibody or portion thereof in the library comprises a different combination of a VH and a VL chain or a sufficient portion thereof to form an antigen binding site from all other antibodies or portions thereof in the library. To identify a first antibody, the library is screened by contacting an antibody or portion thereof in the library with a target protein, assessing binding of the antibody or portion thereof with the target protein and/or whether the antibody or portion thereof modulates a functional activity of the target protein; and identifying an antibody or portion thereof that exhibits an activity for the target protein, wherein the identified antibody or portion thereof is a first antibody. Similarly, a related antibody also can be identified by screening such a combinatorial antibody library for the target antigen to identify a related antibody that exhibits reduced activity for the target antigen compared to the first antibody.

The combinatorial library that is screened can be an addressable library. In an addressable library, the synthesized nucleic acid sequences are individually addressed, thereby generating a first addressed nucleic acid library and a second addressed nucleic acid library. The cells also are addressed such that each locus contains a cell that contains nucleic acid molecules encoding a different combination of a VH and a VL from every other cell in the addressed library of cells. Finally, the plurality of antibodies or portions thereof are addressed, such that the antibodies or portions thereof at each locus in the library are the same antibody and are different from those at each and every other locus; and the identity of the antibody or portion thereof is known by its address. The addressable library can be arranged in a spatial array, wherein each individual locus of the array corresponds to a different antibody member. The spatial array can be a multiwell plate. In another example, the antibodies in the addressable library can be attached to a solid support that is a filter, chip, slide, bead or cellulose, and the different antibody members are immobilized to the surface thereof.

In the affinity maturation method herein, the target antigen is a polypeptide, carbohydrate, lipid, nucleic acid or a small molecule. The target antigen can expressed on the surface of a virus, bacteria, tumor or other cell, or is a recombinant protein or peptide. In one example, the target antigen is a protein that is a target for therapeutic intervention. For example, the target antigen is involved in cell proliferation and differentiation, cell migration, apoptosis or angiogenesis. Exemplary of target antigens include, but are not limited to, a VEGFR-1, VEGFR-2, VEGFR-3 (vascular endothelial growth factor receptors 1, 2, and 3), a epidermal growth factor receptor (EGFR), ErbB-2, ErbB-3, IGF-R1, C-Met (also known as hepatocyte growth factor receptor; HGFR), DLL4, DDR1 (discoidin domain receptor), KIT (receptor for c-kit), FGFR1, FGFR2, FGFR4 (fibroblast growth factor receptors 1, 2, and 4), RON (recepteur d'origine nantais; also known as macrophage stimulating 1 receptor), TEK (endothelial-specific receptor tyrosine kinase), TIE (tyrosine kinase with immunoglobulin and epidermal growth factor homology domains receptor), CSF1R (colony stimulating factor 1 receptor), PDGFRB (platelet-derived growth factor receptor B), EPHA1, EPHA2, EPHB1 (erythropoietin-producing hepatocellular receptor A1, A2 and B1), TNF-R1, TNF-R2, HVEM, LT-βR, CD20, CD3, CD25, NOTCH, G-CSF-R, GM-CSF-R, EPO-R., a cadherin, an integrin, CD52, CD44, VEGF-A, VEGF-B, VEGF-C, VEGF-D, PIGF, EGF, HGF, TNF-α, LIGHT, BTLA, lymphotoxin (LT), IgE, G-CSF, GM-CSF and EPO.

In the affinity maturation method provided herein, a subset of the amino acid residues in the target region are modified by amino acid replacement. In one example, only the amino acid residues that differ between the first antibody and related antibody in the target region are modified by amino acid replacement. In another example, only the amino acid residues that are the same between the first antibody and the related antibody in the target region are modified by amino acid replacement. In some instances in the method provided herein, all of the amino acids residues in the target region are modified by amino acid replacement. For amino acid that is modified, the amino acid replacement can be to all 19 other amino acid residues, or a restricted subset thereof.

In the method provided herein, that antibody is mutated by PCR mutagenesis, cassette mutagenesis, site-directed mutagenesis, random point mutagenesis, mutagenesis using uracil containing templates, oligonucleotide-directed mutagenesis, phosphorothioate-modified DNA mutagenesis, mutagenesis using gapped duplex DNA, point mismatch repair, mutagenesis using repair-deficient host strains, restriction-selection and restriction-purification, deletion mutagenesis, mutagenesis by total gene synthesis, and double-strand break repair. The antibody can be mutated by NNK, NNS, NNN, NNY or NNR mutagenesis.

In one aspect of the method, scanning mutagenesis of the target region is performed to further elucidate amino acid residues to mutagenenize. In such a method, scanning mutagenesis is performed on the first antibody by producing a plurality of modified antibodies comprising a variable heavy chain and a variable light chain, or a portion thereof, where at least one of the variable heavy chain or variable light chain is one that is modified by replacement of a single amino acid residue with another amino acid residue in the target region, whereby each of the plurality of antibodies contains replacement of an amino acid in the target region compared to the first antibody. Each of the plurality of modified antibodies are screened for an activity to the target antigen. A second antibody is selected from among the modified antibodies that exhibits retained or increased activity for the target antigen compared to the first antibody not containing the amino acid replacement, whereby the second antibody is used in place of the first antibody in the affinity maturation method herein above. In such an example, the plurality of modified antibodies can be produced by producing a plurality of nucleic acid molecules that encode modified forms of a variable heavy chain or a variable light chain of the first antibody containing the target region, wherein the nucleic acid molecules contain one codon that encodes an amino acid in the target region compared to the corresponding codon of the unmodified variable heavy or variable light chain that does not encode the neutral amino acid, whereby each nucleic acid molecule of the plurality encodes a variable heavy chain or variable light chain that is modified by replacement of a single amino acid residue to a neutral amino acid residue in the target region.

Further, in a method where scanning mutagenesis is performed on a target region, a second antibody can be selected that exhibits an activity that is at least or about 75%, 80%, 85%, 90%, 95%, 100%, 105%, 110%, 115%, 120%, 130%, 140%, 150%, 200% or more of the activity of the corresponding form of the first antibody. After selecting the antibody that exhibits retained or increased activity, the amino acid residue position that is modified in the second antibody to contain a scanned acid compared to the first antibody not containing the amino acid replacement can be determined.

In examples of the affinity maturation method herein where scanning mutagenesis is employed, the scanned amino acid can be alanine, threonine, proline or glycine. For example, the scanned amino acid is alanine. The scanned amino acid also can be a non-natural amino acid.

Further, when performing scanning mutagenesis in the methods herein, a subset of the amino acid residues in the target region are modified by amino acid replacement to a scanned amino acid. In one example, only the amino acid residues that differ between the first antibody and related antibody in the target region are modified by amino acid replacement to a scanned amino acid. In another example, only the amino acid residues that are the same between the first antibody and the related antibody in the target region are modified by amino acid replacement to a scanned amino acid. In an additional example, all of the amino acids in the target region are modified by amino acid replacement to a neutral amino acid.

In the affinity maturation methods herein, the selected modified antibody exhibits 2-fold, 5-fold, 10-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700-fold, 800-fold, 900-fold, 1000-fold, 2000-fold, 3000-fold, 4000-fold, 5000-fold, 10000-fold or more improved activity for the target antigen compared to the first antibody. For example, the modified antibody exhibits a binding affinity that is greater than the binding affinity of the first antibody and is or is about 1×10−9 M, 2×10−9 M, 3×10−9 M, 4×10−9 M, 5×10−9 M, 6×10−9 M, 7×10−9 M, 8×10−9 M, 9×10−9 M, 1×1010 M, 2×10−10 M, 3×10−10 M, 4×10−10 M, 5×10−10 M, 6×10−10 M, 7×10−10 M, 8×10−10 M, 9×10−10M or less.

In the methods herein, the amino acid modifications that are altered in the modified antibody compared to the first antibody not containing the amino acid replacements can be determined. Further, the method of affinity maturation provided herein can be repeated iteratively where a modified antibody is selected and is used as the first for subsequent affinity maturation thereof. In addition, in the methods herein, one or more amino acid replacements in the target region of one or more variable heavy chains or one or more variable light chains of selected modified antibodies are combined to generate a further modified antibody, whereby the further modified antibodies are screened for an activity to the target antigen to identify a further modified antibody that exhibits an increased activity for the target antigen compared to the first antibody and to the selected modified antibodies.

In the affinity maturation methods herein, the method can be performed on the variable heavy chain of the first antibody and first modified antibodies selected each containing an amino acid replacement in the target region. Then, independent and separately, the method can be performed on the variable light chain of the first antibody and a second modified antibodies each containing an amino acid replacement in the target region can be selected. The variable heavy chain of a first modified antibody can be combined with the variable light chain of a second modified antibody to generate a plurality of different third modified antibodies each comprising an amino acid replacement in the target region of the variable heavy chain and variable light chain. Such third antibodies can be screened for an activity to the target antigen, and further modified antibodies that exhibit an increased activity for the target antigen compared to the first and second modified antibodies can be selected.

Further, in any of the methods herein, other regions of the antibody can be optimized. For example, after selecting a modified antibody, another different region within the variable heavy chain or variable light chain of the first modified antibody can be selected for further mutagenesis. In such an example, a plurality of nucleic acid molecules that encode modified forms of the variable heavy chain or variable light chain of the first modified antibody can be produced, wherein the nucleic acid molecules contain one codon encoding an amino acid in the selected region that encodes a different amino acid from the first modified variable heavy or variable light chain, whereby each nucleic acid molecule of the plurality encodes a variable heavy chain or variable light chain that is modified in the selected region by replacement of a single amino acid residue. A plurality of further modified antibodies then are produced each containg a variable heavy chain and a variable light chain, or a portion thereof, wherein at least one of the variable heavy chain or variable light chain is modified, whereby the selected region in each of the plurality of antibodies contains replacement of an amino acid to a different amino acid compared to the first modified antibody. The further modified antibodies are screen for activity for the target antigen those further modified antibodies that exhibit increased activity for the target antigen compared to the first modified antibody are selected. In such examples, the different region that is modified can be a CDR1, CDR2, CDR3, FR1, FR2, FR3 or FR4.

In any of the affinity maturation methods herein, any of the antibodoes can include an antibody or portion thereof. Such antibodies can be a Fab, Fab′, F(ab′)2, single-chain Fv (scFv), Fv, dsFv, diabody, Fd and Fd′ fragments, Fab fragments, Fd fragments, scFv fragments, and scFab fragments.

Provided herein is a method of affinity maturation based on scanning mutagenesis. In the method, scanning mutagenesis of a first antibody is performed by producing a plurality of nucleic acid molecules that encode modified forms of a variable heavy chain or a variable light chain of a first antibody, wherein the nucleic acid molecules contain one codon that encodes another amino acid compared to the corresponding codon of the unmodified variable heavy or variable light chain that does not encode the other amino acid, whereby each nucleic acid molecule of the plurality encodes a variable heavy chain or variable light chain that is modified by replacement of a single amino acid residue to another amino acid such that every position across the full-length of the encoded variable heavy or light chain is replaced or every position in a selected region of the encoded variable heavy or variable light chain is replaced, whereby each replacement is to the same amino acid residue. A plurality of modified antibodies are then produced each containing a variable heavy chain and a variable light chain, or a portion thereof, whereby each of the plurality of antibodies contains replacement of an amino acid position with another amino acid compared to the first antibody. The plurality of modified antibodies are screened for an activity to the target antigen. A second antibody is selected from among the modified antibodies that exhibits retained or increased activity for the target antigen compared to the first antibody not containing the amino acid replacement. Further mutagenesis of the second antibody is performed by producing a plurality of nucleic acid molecules that encode modified forms of a variable heavy chain or a variable light chain of the second antibody, wherein the nucleic acid molecules contain one codon encoding an amino acid at the scanned amino acid position that encodes a different amino acid than the scanned amino acid in the second antibody, whereby each nucleic acid molecule of the plurality encodes a variable heavy chain or variable light chain that is modified at the scanned amino acid position by a single amino acid residue. A plurality of further modified antibodies are produced each containing a variable heavy chain and a variable light chain, or a portion thereof whereby the scanned amino acid position contains replacement to a different amino acid compared to the second antibody. The further modified antibodies are screened for an activity to the target antigen. From among the further modified antibodies, a third antibody is selected that exhibits increased activity for the target antigen compared to the first antibody or compared to the second antibody.

In one example of the scanning affinity maturation method provided herein, every position in a region of the encoded variable heavy or variable light chain is replaced. The selected region can be a complementary determining region in the variable heavy chain or variable light chain selected that is a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3.

In the method herein, a second antibody containing a scanning mutation is selected that exhibits retained or increased binding compared to the first antibody. Generally, the second antibody that is selected exhibits an activity that is at least or about 75%, 80%, 85%, 90%, 95%, 100%, 105%, 110%, 115%, 120%, 130%, 140%, 150%, 200% or more of the activity of the corresponding form of the first antibody.

In the affinity maturation method provided herein, the amino acid residue position that is modified in the second antibody to contain a scanned amino acid compared to the first antibody not containing the amino acid replacement can be determined.

In the scanning methods of affinity maturation provided herein, the scanning amino acid residue can be an alaninie, threonine, proline and glycine. For example, the amino acid is an alanine. In other examples, the scanning amino acid is a non-natural amino acid. In the methods herein, each of the plurality of nucleic acid molecules encodes a variable heavy chain or variable light chain that is modified by replacement of a single amino acid residue to the same scanned amino acid. In the method, the scanned amino acid position is modified by amino acid replacement to all other amino acid residues, or to a restricted subset thereof.

In the scanning methods of affinity maturation provided herein, once a second antibody is selected, further modification of the antibody is effected. In the method, modification does not include amino acid replacement to the scanned amino acid or to the original amino acid at that position in the first antibody. The further modification of the second antibody can be effected by a method that is PCR mutagenesis, cassette mutagenesis, site-directed mutagenesis, random point mutagenesis, mutagenesis using uracil containing templates, oligonucleotide-directed mutagenesis, phosphorothioate-modified DNA mutagenesis, mutagenesis using gapped duplex DNA, point mismatch repair, mutagenesis using repair-deficient host strains, restriction-selection and restriction-purification, deletion mutagenesis, mutagenesis by total gene synthesis, and double-strand break repair. In one example, further mutations are made by NNK, NNS, NNN, NNY or NNR mutagenesis.

In the scanning methods of affinity maturation provided herein, the activity that is assessed is binding, signal transduction, differentiation, alteration of gene expression, cellular proliferation, apoptosis, chemotaxis, cytotoxicity, cancer cell invasion, endothelial cell proliferation and tube formation. For example, where the activity is binding, binding is assessed by immunoassay, whole cell panning and surface plasmon resonance (SPR). The immunoassay can be a radioimmunoassay, enzyme linked immunosorbent assay (ELISA) or electrochemiluminescence assay. For example, the electrochemiluminescence assay can be meso scale discovery (MSD).

In the scanning methods of affinity maturation provided herein, the target antigen is a polypeptide, carbohydrate, lipid, nucleic acid or a small molecule. The target antigen can be expressed on the surface of a virus, bacteria, tumor or other cell, or is a recombinant protein or peptide. The target antigen can a protein that is a target for therapeutic intervention. For example, the target antigen is involved in cell proliferation and differentiation, cell migration, apoptosis or angiogenesis. Exemplary target antigen include a VEGFR-1, VEGFR-2, VEGFR-3 (vascular endothelial growth factor receptors 1, 2, and 3), a epidermal growth factor receptor (EGFR), ErbB-2, ErbB-3, IGF-R1, C-Met (also known as hepatocyte growth factor receptor; HGFR), DLL4, DDR1 (discoidin domain receptor), KIT (receptor for c-kit), FGFR1, FGFR2, FGFR4 (fibroblast growth factor receptors 1, 2, and 4), RON (recepteur d'origine nantais; also known as macrophage stimulating 1 receptor), TEK (endothelial-specific receptor tyrosine kinase), TIE (tyrosine kinase with immunoglobulin and epidermal growth factor homology domains receptor), CSF1R (colony stimulating factor 1 receptor), PDGFRB (platelet-derived growth factor receptor B), EPHA1, EPHA2, EPHB1 (erythropoietin-producing hepatocellular receptor A1, A2 and B1), TNF-R1, TNF-R2, HVEM, LT-βR, CD20, CD3, CD25, NOTCH, G-CSF-R, GM-CSF-R, EPO-R., a cadherin, an integrin, CD52, CD44, VEGF-A, VEGF-B, VEGF-C, VEGF-D, PIGF, EGF, HGF, TNF-α, LIGHT, BTLA, lymphotoxin (LT), IgE, G-CSF, GM-CSF and EPO.

In the scanning methods herein, the third antibody exhibits 2-fold, 5-fold, 10-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700-fold, 800-fold, 900-fold, 1000-fold, 2000-fold, 3000-fold, 4000-fold, 5000-fold, 10000-fold or more improved activity for the target antigen compared to the first antibody or the second antibody. For example, where the first antibody binds to the target antigen with a binding affinity that is at or about 10−4 M, 10−5 M, 10−6 M, 10−7 M, 10−8 M, or lower, when the antibody is in a Fab form, the further optimized antibodies, such as the selected third antibody, are those that are optimized to have an improved binding affinity compared to the first antibody. For example, the third antibody exhibits a binding affinity that is greater than the binding affinity of the first antibody and is or is about 1×10−9 M, 2×10−9 M, 3×10−9 M, 4×10−9 M, 5×10−9 M, 6×10−9 M, 7×10−9 M, 8×10−9 M, 9×10−9 M, 1×10−10 M, 2×10−10 M, 3×10−10 M, 4×10−10 M, 5×10−10 M, 6×10−10 M, 7×10−10 M, 8×10−10 M, 9×10−10 M or less.

In one aspect of the method, scanning mutagenesis is performed within the variable heavy chain of the first antibody, and the method performed therefrom. In another aspect, scanning mutagenesis is performed within the variable light chain of the first antibody, and steps of the method are performed therefrom. In an additional aspect of the method, scanning mutagenesis is performed within the variable heavy chain of the first antibody and steps of the method performed therefrom; and separately and independently scanning mutagenesis is performed within the variable light chain of the first antibody, and steps of the method are performed therefrom.

In the method herein, further optimization can be achieved. The method can include determining the amino acid modifications that are altered in the third antibody compared to the first antibody not containing the amino acid replacements. Combination mutants can be generated. Also provided in the method herein, is a method that is repeated iteratively, wherein the third antibody identified in that is selected and used as the first antibody for subsequent maturation thereof, whereby the amino acid residue that is modified is not further modified in subsequent iterations of the method. In another example of optimization, one or more amino acid replacement in one or more variable heavy chains or one or more variable light chains of selected third antibodies are combined to generate a further modified antibody, whereby the further modified antibodies are screened for an activity to the target antigen to identify a further modified antibody that exhibits an increased activity for the target antigen compared to the first antibody, second antibody and to the selected third antibodies. For example, the steps of the method can be performed on the variable heavy chain of the first antibody and third antibodies selected each containing an amino acid replacement in the variable heavy chain compared to the corresponding variable heavy chain of the first antibody. Independently and separately, the steps of the method are performed on the variable light chain of the first antibody and different third modified antibodies are selected each containing an amino replacement in the variable light chain compared to the corresponding variable light chain of the first antibody. The variable heavy chain of a third antibody can be combined with the variable light chain of a different third antibody to generate a plurality of different further modified antibodies each containing an amino acid replacement of the variable heavy chain and variable light chain compared to the corresponding variable heavy chain and variable light chain of the first antibody. The further modified antibodies can be screened for activity (e.g. binding) to the target antigen; and those fourth antibodies that exhibit an increased activity for the target antigen compared to the first antibody, second antibody, and third antibodies are selected.

In another example, after selecting a third antibody another different region within the variable heavy chain or variable light chain of the third antibody is selected for further mutagenesis. In such a method, a plurality of nucleic acid molecules are produced that encode modified forms of the variable heavy chain or variable light chain of the third antibody, wherein the nucleic acids molecules contain one codon encoding an amino acid in the selected region that encodes a different amino acid from the first modified variable heavy or variable light chain, whereby each nucleic acid molecule of the plurality encodes a variable heavy chain or variable light chain that is modified in the selected region by replacement of a single amino acid residue. Then, a plurality of further modified antibodies are produced each containing a variable heavy chain and a variable light chain, or a portion thereof, whereby the selected region in each of the plurality of antibodies contains replacement of an amino acid to a different amino acid compared to the third antibody. The further modified antibodies are screened for an activity (e.g. binding) to the target antigen and those further modified antibodies that exhibit increased activity for the target antigen compared to the third antibody are selected. In such an example, the different region that is subject to further mutagenesis can be a CDR1, CDR2, CDR3, FR1, FR2, FR3 and FR4.

In any of the methods herein, the antibody can be an antibody or fragment thereof containing a variable heavy chain and a variable light chain, or a portion thereof. For example, the antibody can be a full-length antibody or a fragment thereof that is a Fab, Fab′, F(ab′)2, single-chain Fv (scFv), Fv, dsFv, diabody, Fd and Fd′ fragments, Fab fragments, Fd fragments, scFv fragments, and scFab fragments.

Also provided herein is a method of antibody conversion, whereby, following mutageneis of a first or reference antibody having a known activity, an antibody is selected that exhibits an activity that is changed or inverted compared to the activity of the first or reference antibody for the same target antigen. In one example of the method, an activity of an antibody is converted from an antagonist to an activator. In the method, a first antibody or fragment thereof that is an antagonist antibody is selected, whereby the antibody inhibits a functional activity associated with its target antigen. A plurality of modified antibodies is produced each containing a variable heavy chain and a variable light chain, or a portion thereof sufficient to bind antigen, where at least one of the variable heavy chain or variable light chain is modified such that it contains at least one amino acid modification compared to the first antibody. For example, amino acid modification is replacement of at least a single amino acid residue, such that each of the plurality of antibodies contains replacement of an amino acid(s) to a different amino acid(s) compared to the first antibody. In one example of the method, the plurality of modified antibodies are produced by producing a plurality of nucleic acid molecules that encode modified forms of a variable heavy chain or a variable light chain of the first antibody, wherein the nucleic acid molecules contain at least one codon that encodes a different amino acid from the unmodified variable heavy or variable light chain, such that each nucleic acid molecule of the plurality encodes a variable heavy chain or variable light chain that is modified by replacement of a single amino acid residue. Following mutagenesis, the plurality of modified antibodies are each screened for an activity to the target antigen. Antibodies are selected or identified that result in an increase in a functional activity associated with the target antigen compared to activity in the presence of the first antibody, thereby converting the first antibody to an activator.

In some examples of the method of converting an antagonist antibody to an activator, before the antibodies are screened for a functional activity the plurality of antibodies are each assessed for binding affinity for the target antigen. Antibodies that exhibit a binding affinity that is greater then the corresponding form of the first antibody for the target antigen are identified or selected. Then, that subset of antibodies are further screened for a functional activity to identify or select those that have a converted activator activity.

In another example of the method of antibody conversion, an activity of an antibody is converted from an activator to an antagonist. In the method, a first antibody or fragment thereof that is an activator antibody is selected, whereby the antibody increases a functional activity associated with its target antigen. A plurality of modified antibodies is produced each containing a variable heavy chain and a variable light chain, or a portion thereof sufficient to bind antigen, where at least one of the variable heavy chain or variable light chain is modified such that it contains at least one amino acid modification compared to the first antibody. For example, amino acid modification is replacement of at least a single amino acid residue, such that each of the plurality of antibodies contains replacement of an amino acid(s) to a different amino acid(s) compared to the first antibody. In one example of the method, the plurality of modified antibodies are produced by producing a plurality of nucleic acid molecules that encode modified forms of a variable heavy chain or a variable light chain of the first antibody, wherein the nucleic acid molecules contain at least one codon that encodes a different amino acid from the unmodified variable heavy or variable light chain, such that each nucleic acid molecule of the plurality encodes a variable heavy chain or variable light chain that is modified by replacement of a single amino acid residue. Following mutagenesis, the plurality of modified antibodies are each screened for an activity to the target antigen. Antibodies are selected or identified that result in a decrease in a functional activity associated with the target antigen compared to activity in the presence of the first antibody, thereby converting the first antibody to an antagonist.

In some examples of the method of converting an activator antibody to an antagonist, before the antibodies are screened for a functional activity the plurality of antibodies are each assessed for binding affinity for the target antigen. Antibodies that exhibit a binding affinity that is lower then the corresponding form of the first antibody for the target antigen are identified or selected. Then, that subset of antibodies are further screened for a functional activity to identify or select those that have a converted antagonist activity.

In each of the conversion methods above, the target antigen is a VEGFR-1, VEGFR-2, VEGFR-3 (vascular endothelial growth factor receptors 1, 2, and 3), a epidermal growth factor receptor (EGFR), ErbB-2, ErbB-b3, IGF-R1, C-Met (also known as hepatocyte growth factor receptor; HGFR), DLL4, DDR1 (discoidin domain receptor), KIT (receptor for c-kit), FGFR1, FGFR2, FGFR4 (fibroblast growth factor receptors 1, 2, and 4), RON (recepteur d'origine nantais; also known as macrophage stimulating 1 receptor), TEK (endothelial-specific receptor tyrosine kinase), TIE (tyrosine kinase with immunoglobulin and epidermal growth factor homology domains receptor), CSF1R (colony stimulating factor 1 receptor), PDGFRB (platelet-derived growth factor receptor B), EPHA1, EPHA2, EPHB1 (erythropoietin-producing hepatocellular receptor A1, A2 and B1), TNF-R1, TNF-R2, HVEM, LT-βR, CD20, CD3, CD25, NOTCH, G-CSF-R, GM-CSF-R or EPO-R.

Provided herein is an anti-DLL4 antibody multimer that has a binding affinity for DLL4 that is 10−8 M or lower binding affinity as measured by surface plasmon resonance (SPR) as a monomeric Ig fragment and that is an activator of DLL4 activity. For example, the binding affinity is between 10−6 M to 10−8 M. The antibody multimer can be, for example, a full-length antibody, a F(ab′)2 or a scFv dimer. In some examples, that antibody multimer is a full-length antibody that contains a constant region from a constant region of IgG1, IgG2, IgG3, IgA or IgM. For example, the constant region is an IgG1 constant region, or modified form thereof.

In one example, the antibody multimer contains a heavy chain CDR1 (CDRH1) set forth in SEQ ID NO:2908, a heavy chain CDR2 (CDRH2) set forth in SEQ ID NO:2909, a heavy chain CDR3 (CDRH3) set forth in SEQ ID NO: 2910, a light chain CDR1 (CDRL1) set forth in SEQ ID NO:2911, a light chain CDR2 (CDRL2) set forth in SEQ ID NO:2912, and a light chain CDR3 (CDRL3) set forth in SEQ ID NO:2913; or contains a sequences of amino acids that exhibits at least 70% sequence identity to any of SEQ ID NOS: 2908-2913, whereby the antibody binds to DLL4 and is an activator of DLL4 activity. For example, the antibody multimer contains a heavy chain having a variable region set forth in SEQ ID NO: 88 and a light chain comprising a variable region set forth in SEQ ID NO:107.

In another example, the antibody multimer contains a heavy chain CDR1 (CDRH1) set forth in SEQ ID NO:2914, a heavy chain CDR2 (CDRH2) set forth in SEQ ID NO:2915, a heavy chain CDR3 (CDRH3) set forth in SEQ ID NO: 2916, a light chain CDR1 (CDRL1) set forth in SEQ ID NO:2917, a light chain CDR2 (CDRL2) set forth in SEQ ID NO:2918, and a light chain CDR3 (CDRL3) set forth in SEQ ID NO:2919; or contains a sequences of amino acids that exhibits at least 70% sequence identity to any of SEQ ID NOS: 2914-2919, whereby the antibody binds to DLL4 and is an activator of DLL4 activity. For example, the antibody multimer contains a heavy chain having a variable region set forth in SEQ ID NO: 89 and a light chain comprising a variable region set forth in SEQ ID NO:108.

In examples of antibody multimers provided herein, the heavy chain can contain an IgG1 constant region (e.g. set forth in SEQ ID NO: 2922) a light chain constant region, lambda or kappa (e.g. set forth in SEQ ID NO: 2923 or 2924).

Provided herein is a method of treating aberrant angiogenesis associated with an angiogenic disease or condition by administering any of the antibody multimers provided herein to a subject, whereby the activity of a DLL4 receptor is increased. For example, the DLL4 receptor is Notch-1 or Notch-4. The angiogenic disease or condition can be a cancer, diabetic retinopathies and other diabetic complications, inflammatory diseases, endometriosis and age-related macular degeneration.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1: FIG. 1 is a flow chart that illustrates the method of structure-affinity/activity relationship (SAR) based affinity maturation.

FIG. 2: Amino acid alignments of “Hit” Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6-IGKJ1*01. FIG. 2A shows the alignment of the variable heavy chain of “Hit” Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKE*01 (SEQ ID NOS:88 and 107) with the variable heavy chain of “non-Hit” Fab VH1-46_IGHD6-13*01_IGHJ4*01 & L6_IGKJ1*01 (SEQ ID NOS:93 and 107). FIG. 2B shows the alignment of the variable light chain of “Hit” Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 (SEQ ID NOS:88 and 107) with the variable light chains of “non-Hit” Fabs VH1-46_IGHD6-6*01_IGHJ1*01 & A27_IGKJ1*01 (SEQ ID NOS:8 and 110), VH1-46_IGHD6-6*01_IGHJ1*01 & L25_IGKJ1*01 (SEQ ID NOS:88 and 120) and VH1-46_IGHD6-6*01_IGHJ1*01 & L2_IGKJ1*01 (SEQ ID NOS:88 and 112). The regions of variation are highlighted in grey. The amino acid sequence of the “Hit” Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 is shown in bold.

FIG. 3: Amino acid alignment of the variable heavy chain of “Hit” Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01. FIG. 3 shows the alignment of the variable heavy chain of “Hit” Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01 (SEQ ID NOS:89 and 108) with the variable heavy chain of “non-Hit” Fab VH5-51_IGHD6-25*01_IGHJ4*01 & V3-4_IGLJ1*01 (SEQ ID NOS:106 and 108). The regions of variation are highlighted in grey. The amino acid sequence of the “Hit” Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01 is shown in bold.

FIG. 4: Amino acid alignments of germline swapped variable heavy chains. FIG. 4A shows the alignment of the variable heavy chain of “Hit” Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 (SEQ ID NOS:88 and 107) with the variable heavy chains of J segment germline swapped Fabs VH1-46_IGHD6-6*01_IGHJ2*01 & L6_IGKJ1*01 (SEQ ID NOS:585 and 107), VH1-46_IGHD6-6*01_IGHJ4*01 & L6_IGKJ1*01 (SEQ ID NOS:586 and 107) and VH1-46_IGHD6-6*01_IGHJ5*01 & L6_IGKJ1*01 (SEQ ID NOS:587 and 107). FIG. 4B shows the alignment of the variable heavy chain of “Hit” Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01 (SEQ ID NOS:89 and 108) with the variable heavy chains of J segment germline swapped Fabs VH5-51_IGHD5-18*01>3_IGHJ1*01 & V3-4_IGLJ1*01 (SEQ ID NOS:588 and 108), VH5-51_IGHD5-18*01>3_IGHJ3*01 & V3-4_IGLJ4*01 (SEQ ID NOS:589 and 108) and VH5-51_IGHD5-18*01>3_IGHJ5*01 & V3-4_IGLJ4*01 (SEQ ID NOS:590 and 108). FIG. 4C shows the alignment of the variable heavy chain of “Hit” Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01 (SEQ ED NOS:89 and 108) with the variable heavy chains of D segment germline swapped Fabs VH5-51_IGHD5-12*01_IGHJ4*01 & V3-4_IGLJ1*01 (SEQ ID NOS:591 and 108) and VH5-51_IGHD5-24*01_IGHJ4*01 & V3-4_IGLJ1*01 (SEQ ID NOS:592 and 108). The regions of variation are highlighted in grey. The amino acid sequence of the “Hit” Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 is shown in bold.

FIG. 5: Amino acid alignment of the variable heavy chain of “Hit” Fab VH3-23_IGHD2-21*01>3_IGHJ6*01 & V2-13_IGLJ2*01. FIG. 5 shows the alignment of the variable heavy chain of “Hit” Fab VH3-23_IGHD2-21*01>3_IGHJ6*01 & V2-13_IGLJ2*01 (SEQ ID NOS:1729 and 594) with the variable heavy chains of related “Hit” Fabs VH3-23_IGHD2-2*01>3_IGHJ6*01 & V2-13_IGLJ2*01 (SEQ ID NOS:1723 and 594), VH3-23_IGHD2-8*01>3_IGHJ6*01 & V2-13_IGLJ2*01 (SEQ ID NOS:1725 and 594) and VH3-23_IGHD2-15*01>3_IGHJ6*01 & V2-13_IGLJ2*01 (SEQ ID NOS:1727 and 594). The regions of variation are highlighted in grey. The amino acid sequence of the “Hit” Fab VH3-23_IGHD2-21*01>3_IGHJ6*01 & V2-13_IGLJ2*01 is shown in bold.

DETAILED DESCRIPTION

Outline

A. Definitions

B. Overview of Methods

    • 1. Antibody Polypeptides
      • a. Antibody Structure and Function
      • b. Antibody Sequence and Specificity
    • 2. Methods of Identifying Antibodies
    • 3. Existing Methods of Optimizing Antibodies

C. Method for Affinity Maturation of Antibodies

    • 1. Comparison of Structure and Activity
      • a. Selection of a First Antibody for Affinity Maturation
        • i. Immunization and Hybridoma Screening
        • ii. Screening Assays for Identification of a “Hit”
          • 1) Display Libraries
          • 2) Phage Display Libraries
          • 3) Addressable Libraries
      • b. Identification of a Related Antibody
      • c. Comparison of the amino acid sequences of the First Antibody and Related Antibodies
      • d. Mutagenesis of an Identified Region
    • 2. SAR by Scanning Mutagenesis
    • 3. Further Optimization
      • a. Complementarity Determining Regions
      • b. Framework Regions
      • c. Germline Swapping

D. Method of Antibody Conversion

    • 1. Choosing the Starting or Reference Antibody
    • 2. Mutagenesis
    • 3. Selecting for a Converted Antibody
      • a. Binding
      • b. Functional Activity

E. Assays

    • 1. Binding Assays
    • 2. Functional Activity
      • a. Differentiation
      • b. Alteration of Gene Expression
      • c. Cytotoxicity Assay
    • 3. In Vivo Assays

F. Methods of Production of Antibodies

    • 1. Vectors
    • 2. Cells and Expression System
      • a. Prokaryotic Expression
      • b. Yeast
      • c. Insects
      • d. Mammalian cells
      • e. Plants
    • 3. Purification

G. Anti-DLL4 Activator/Modulator Antibodies and Uses Thereof

    • 1. DLL4
      • a. Structure
      • b. Expression
      • c. Function
    • 2. Activator/Modulator Anti-DLL4 Multimer Antibodies
      • Exemplary Antibodies
    • 3. Modifications
      • a. Modifications to Reduce Immunogenicity
      • b. Glycosylation
      • c. Fc Modifications
      • d. PEGylation
    • 4. Compositions, Formulations, Administration and Articles of Manufacture/Kits
      • a. Compositions and Formulations
      • b. Articles of Manufacture and Kits
    • 5. Methods of Treatment and Uses
      • Combination Therapy

H. Examples

A. DEFINITIONS

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the invention(s) belong. All patents, patent applications, published applications and publications, Genbank sequences, databases, websites and other published materials referred to throughout the entire disclosure herein, unless noted otherwise, are incorporated by reference in their entirety. In the event that there are a plurality of definitions for terms herein, those in this section prevail. Where reference is made to a URL or other such identifier or address, it understood that such identifiers can change and particular information on the internet can come and go, but equivalent information can be found by searching the internet. Reference thereto evidences the availability and public dissemination of such information.

As used herein, an antibody refers to immunoglobulins and immunoglobulin portions, whether natural or partially or wholly synthetic, such as recombinantly, produced, including any portion thereof containing at least a portion of the variable region of the immunoglobulin molecule that is sufficient to form an antigen binding site. Hence, an antibody or portion thereof includes any protein having a binding domain that is homologous or substantially homologous to an immunoglobulin antigen binding site. For example, an antibody refers to an antibody that contains two heavy chains (which can be denoted H and H′) and two light chains (which can be denoted L and L′), where each heavy chain can be a full-length immunoglobulin heavy chain or a portion thereof sufficient to form an antigen binding site (e.g. heavy chains include, but are not limited to, VH, chains VH-CH1 chains and VH-CH1-CH2-CH3 chains), and each light chain can be a full-length light chain or a portion thereof sufficient to form an antigen binding site (e.g. light chains include, but are not limited to, VL chains and VL-CL chains). Each heavy chain (H and H′) pairs with one light chain (L and L′, respectively). Typically, antibodies minimally include all or at least a portion of the variable heavy (VH) chain and/or the variable light (VL) chain. The antibody also can include all or a portion of the constant region.

For purposes herein, the term antibody includes full-length antibodies and portions thereof including antibody fragments, such as, but not limited to, Fab, Fab′, F(ab′)2, single-chain Fvs (scFv), Fv, dsFv, diabody, Fd and Fd′ fragments Fab fragments, Fd fragments and scFv fragments. Other known fragments include, but are not limited to, scFab fragments (Hust et al., BMC Biotechnology (2007), 7:14). Antibodies include members of any immunoglobulin class, including IgG, IgM, IgA, IgD and IgE.

As used herein, a full-length antibody is an antibody having two full-length heavy chains (e.g. VH-CH1-CH2-CH3 or VH-CH1-CH2-CH3-CH4) and two full-length light chains (VL-CL) and hinge regions, such as human antibodies produced by antibody secreting B cells and antibodies with the same domains that are produced synthetically.

As used herein, antibody fragment or antibody portion with reference to a “portion thereof” or “fragment thereof” of an antibody refers to any portion of a full-length antibody that is less than full length but contains at least a portion of the variable region of the antibody sufficient to form an antigen binding site (e.g. one or more CDRs) and thus retains the a binding specificity and/or an activity of the full-length antibody; antibody fragments include antibody derivatives produced by enzymatic treatment of full-length antibodies, as well as synthetically, e.g. recombinantly produced derivatives. Examples of antibody fragments include, but are not limited to, Fab, Fab′, F(ab′)2, single-chain Fvs (scFv), Fv, dsFv, diabody, Fd and Fd′ fragments (see, for example, Methods in Molecular Biology, Vol 207: Recombinant Antibodies for Cancer Therapy Methods and Protocols (2003); Chapter 1; p 3-25, Kipriyanov). The fragment can include multiple chains linked together, such as by disulfide bridges and/or by peptide linkers. An antibody fragment generally contains at least about 50 amino acids and typically at least 200 amino acids.

Hence, reference to an “antibody or portion thereof that is sufficient to form an antigen binding site” means that the antibody or portion thereof contains at least 1 or 2, typically 3, 4, 5 or all 6 CDRs of the VH and VL sufficient to retain at least a portion of the binding specificity of the corresponding full-length antibody containing all 6 CDRs. Generally, a sufficient antigen binding site at least requires CDR3 of the heavy chain (CDRH3). It typically further requires the CDR3 of the light chain (CDRL3). As described herein, one of skill in the art knows and can identify the CDRs based on kabat or Chothia numbering (see e.g., Kabat, E. A. et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242, and Chothia, C. et al. (1987) J. Mol. Biol. 196:901-917). For example, based on Kabat numbering, CDR-L1 corresponds to residues L24-L34; CDR-L2 corresponds to residues L50-L56; CDR-L3 corresponds to residues L89-L97; CDR-H1 corresponds to residues H31-H35, 35a or 35b depending on the length; CDR-H2 corresponds to residues H50-H65; and CDR-H3 corresponds to residues H95-H102.

As used herein, “antigen-binding site” refers to the interface formed by one or more complementary determining regions (CDRs; also called hypervariable region). Each antigen binding site contains three CDRs from the heavy chain variable region and three CDRs from the light chain variable region. An antibody molecule typically has two antigen combining sites, each containing portions of a heavy chain variable region and portions of a light chain variable region. The antigen combining sites can contain other portions of the variable region domains in addition to the CDRs.

As used herein, an Fv antibody fragment is composed of one variable heavy domain (VH) and one variable light (VL) domain linked by noncovalent interactions.

As used herein, a dsFv refers to an Fv with an engineered intermolecular disulfide bond, which stabilizes the VH-VL pair.

As used herein, an Fd fragment is a fragment of an antibody containing a variable domain (VH) and one constant region domain (CH1) of an antibody heavy chain.

As used herein, “Fab fragment” is an antibody fragment that contains the portion of the full-length antibody that results from digestion of a full-length immunoglobulin with papain, or a fragment having the same structure that is produced synthetically, e.g. recombinantly. A Fab fragment contains a light chain (containing a VL and CL portion) and another chain containing a variable domain of a heavy chain (VH) and one constant region domain portion of the heavy chain (CH1); it can be recombinantly produced.

As used herein, a F(ab′)2 fragment is an antibody fragment that results from digestion of an immunoglobulin with pepsin at pH 4.0-4.5, or a synthetically, e.g. recombinantly, produced antibody having the same structure. The F(ab′)2 fragment contains two Fab fragments but where each heavy chain portion contains an additional few amino acids, including cysteine residues that form disulfide linkages joining the two fragments; it can be recombinantly produced.

A Fab′ fragment is a fragment containing one half (one heavy chain and one light chain) of the F(ab′)2 fragment.

As used herein, an Fd′ fragment is a fragment of an antibody containing one heavy chain portion of a F(ab′)2 fragment.

As used herein, an Fv′ fragment is a fragment containing only the VH and VL domains of an antibody molecule.

As used herein, a scFv fragment refers to an antibody fragment that contains a variable light chain (VL) and variable heavy chain (VH), covalently connected by a polypeptide linker in any order. The linker is of a length such that the two variable domains are bridged without substantial interference. Exemplary linkers are (Gly-Ser)n residues with some Glu or Lys residues dispersed throughout to increase solubility.

As used herein, diabodies are dimeric scFv; diabodies typically have shorter peptide linkers than scFvs, and they preferentially dimerize.

As used herein, hsFv refers to antibody fragments in which the constant domains normally present in a Fab fragment have been substituted with a heterodimeric coiled-coil domain (see, e.g., Arndt et al. (2001) J Mol Biol. 7:312:221-228).

As used herein, an “antibody multimer” refers to an antibody containing at least two or more antigen-binding sites. Antibody multimers include dimers, trimer, tetramers pentamers, and higher ordered oligomers. Formation of an antibody as a multimer can be achieved based on the knowledge of one of skill in the art. For example, multimeric forms include antibody oligomers that form via a multimerization domain that coordinates or facilitates the intereaction of at least two polypeptides or a covalent bond.

As used herein, a multimerization domain refers to a sequence of amino acids that promotes stable interaction of a polypeptide molecule with one or more additional polypeptide molecules, each containing a complementary multimerization domain, which can be the same or a different multimerization domain to form a stable multimer with the first domain. Generally, a polypeptide is joined directly or indirectly to the multimerization domain. Exemplary multimerization domains include the immunoglobulin sequences or portions thereof, leucine zippers, hydrophobic regions, hydrophilic regions, and compatible protein-protein interaction domains. The multimerization domain, for example, can be an immunoglobulin constant region or domain, such as, for example, the constant domain or portions thereof from IgG, including IgG1, IgG2, IgG3 or IgG4 subtypes, IgA, IgE, IgD and IgM and modified forms thereof.

As used herein, a “monospecific” is an antibody that contains two or more antigen-binding sites, where each antigen-binding site immunospecifically binds to the same epitope.

As used herein, a “multispecific” antibody is an antibody that contains two or more antigen-binding sites, where at least two of the antigen-binding sites immunospecifically bind to different epitopes.

As used herein, a “bispecific” antibody is a multispecific antibody that contains two or more antigen-binding sites and can immunospecifically bind to two different epitopes. A “trispecific” antibody is a multispecific antibody that contains three or more antigen-binding sites and can immunospecifically bind to three different epitopes, a “tetraspecific” antibody is a multispecific antibody that contains four or more antigen-binding sites and can immunospecifically bind to four different epitopes, and so on.

As used herein, reference to a “monomeric Ig fragment” refers to an antibody portion that contains only one antigen-binding site. For example, a monomeric Ig fragment includes, for example, a Fab, Fv or a scFv.

As used herein, a polypeptide domain is a part of a polypeptide (a sequence of three or more, generally 5 or 7 or more amino acids) that is a structurally and/or functionally distinguishable or definable. Exemplary of a polypeptide domain is a part of the polypeptide that can form an independently folded structure within a polypeptide made up of one or more structural motifs (e.g. combinations of alpha helices and/or beta strands connected by loop regions) and/or that is recognized by a particular functional activity, such as enzymatic activity or antigen binding. A polypeptide can have one, typically more than one, distinct domains. For example, the polypeptide can have one or more structural domains and one or more functional domains. A single polypeptide domain can be distinguished based on structure and function. A domain can encompass a contiguous linear sequence of amino acids. Alternatively, a domain can encompass a plurality of non-contiguous amino acid portions, which are non-contiguous along the linear sequence of amino acids of the polypeptide. Typically, a polypeptide contains a plurality of domains. For example, each heavy chain and each light chain of an antibody molecule contains a plurality of immunoglobulin (Ig) domains, each about 110 amino acids in length.

As used herein, an Ig domain is a domain, recognized as such by those in the art, that is distinguished by a structure, called the Immunoglobulin (Ig) fold, which contains two beta-pleated sheets, each containing anti-parallel beta strands of amino acids connected by loops. The two beta sheets in the Ig fold are sandwiched together by hydrophobic interactions and a conserved intra-chain disulfide bond. Individual immunoglobulin domains within an antibody chain further can be distinguished based on function. For example, a light chain contains one variable region domain (VL) and one constant region domain (CL), while a heavy chain contains one variable region domain (VH) and three or four constant region domains (CH). Each VL, CL, VH, and CH domain is an example of an immunoglobulin domain.

As used herein, a “variable domain” with reference to an antibody is a specific Ig domain of an antibody heavy or light chain that contains a sequence of amino acids that varies among different antibodies. Each light chain and each heavy chain has one variable region domain (VL, and, VH). The variable domains provide antigen specificity, and thus are responsible for antigen recognition. Each variable region contains CDRs that are part of the antigen binding site domain and framework regions (FRs).

As used herein, reference to a variable heavy (VH) chain or a variable light (VL) chain (also termed VH domain or VL domain) refers to the polypeptide chains that make up the variable domain of an antibody.

As used herein, a “region” of an antibody refers to a domain of an antibody or a portion of a domain is associated with a particular function or structure. In an antibody, regions of an antibody include the complementarity-determining region, the framework region, and/or the constant region. Generally, for purposes herein, a region of an antibody is a complementarity determining region CDR1, CDR2 and/or CDR3 of the variable light chain or variable heavy chain (CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3), or is a framework region FR1, FR2 or FR3 of the variable light chain or variable heavy chain.

As used herein, “hypervariable region,” “HV,” “complementarity-determining region” and “CDR” and “antibody CDR” are used interchangeably to refer to one of a plurality of portions within each variable region that together form an antigen binding site of an antibody. Each variable region domain contains three CDRs, named CDR1, CDR2, and CDR3. The three CDRs are non-contiguous along the linear amino acid sequence, but are proximate in the folded polypeptide. The CDRs are located within the loops that join the parallel strands of the beta sheets of the variable domain.

As used herein, framework regions (FRs) are the regions within the antibody variable region domains that are located within the beta sheets; the FR regions are comparatively more conserved, in terms of their amino acid sequences, than the hypervariable regions.

As used herein, a constant region domain is a domain in an antibody heavy or light chain that contains a sequence of amino acids that is comparatively more conserved among antibodies than the variable region domain. Each light chain has a single light chain constant region (CL) domain and each heavy chain contains one or more heavy chain constant region (CH) domains, which include, CH1, CH2, CH3 and CH4. Full-length IgA, IgD and IgG isotypes contain CH1, CH2 CH3 and a hinge region, while IgE and IgM contain CH1, CH2 CH3 and CH4. CH1 and CL domains extend the Fab arm of the antibody molecule, thus contributing to the interaction with antigen and rotation of the antibody arms. Antibody constant regions can serve effector functions, such as, but not limited to, clearance of antigens, pathogens and toxins to which the antibody specifically binds, e.g. through interactions with various cells, biomolecules and tissues.

As used herein, humanized antibodies refer to antibodies that are modified to include “human” sequences of amino acids so that administration to a human does not provoke an immune response. Methods for preparation of such antibodies are known. For example, the antibody in which the amino acid composition of the non-variable regions can be based on human antibodies. Computer programs have been designed to identify such regions.

As used herein, “antibody conversion” refers to a process in which the functionl activity of an antibody or fragment thereof for a target antigen or substrate is changed, typically by mutation of one or more amino acid residues, to have an inverse functional activity of the starting or reference antibody. For example, if the starting or reference antibody exhibits antagonist activity for a target antigen, antibody coversion changes the antibody to an agonist or activator/modulator activity. In another example, if the starting or reference antibody exhibits activator/modulator activity for a target antigen, antibody conversion changes the antibody to an antagonist activity.

As used herein, “affinity maturation” refers to a process in which an antibody is evolved from a reference antibody (also referred to herein as a template or parent antibody), typically by mutation of one or more amino acid residues, to have increased activity for a target antigen than a corresponding form of the reference antibody has for the same target antigen. Hence, the evolved antibody is optimized compared to the reference or template antibody.

As used herein, reference to an affinity matured antibody refers to an antibody that has an increased activity for a target antigen relative to a reference antibody. For example, the affinity matured antibody exhibits increased binding to the target antigen compared to the reference or parent antibody. Typically, the affinity matured antibody binds to the same epitope as the reference antibody.

As used herein, an optimized antibody refers to an antibody, or portion thereof, that has an increased activity for a target protein or antigen compared to a reference antibody, for example, improved binding affinity for a target protein and/or an improved functional activity. Typically, the antibody is optimized by virtue of one or more amino acid modifications (amino acid deletion, replacement or insertion) compared to a parent antibody not containing the one or more amino acid modifications. Generally, an activity, for example binding affinity, is increased by at or about 1.5-fold to 1000-fold, generally at least or about 2-fold to 100-fold, for example at or about 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700-fold, 800-fold, 900-fold, 1000-fold or more compared to an activity of the parent antibody (e.g. germline antibody Hit not containing the modification(s)).

As used herein, “structure affinity/activity relationship” (SAR) refers to the relationship between structure (e.g. sequence) and function of a molecule, whereby the activity of an antibody can be correlated to it sequence. Thus, knowledge of the SAR elucidates a region of a sequence, including particular amino acid residues, that contribute to the activity of an antibody. Methods of determining SAR are described herein.

As used herein, activity towards a target protein or target antigen refers to binding specificity or binding affinity and/or modulation of a functional activity of a target protein, or other measurements that reflects the activity of an antibody or portion thereof towards a target protein. Activity of an antibody can be measured using a binding or affinity based assay, such as an ELISA, electrochemiluminescence assay (e.g. Meso Scale Discovery), or surface plasmon resonance, or can measured using a cell based assay as described herein.

As used herein, “functional activity” refer to activities of a polypeptide (e.g. target protein) or portion thereof associated with a full-length (complete) protein. Functional activities include, but are not limited to, biological activity, catalytic or enzymatic activity, antigenicity (ability to bind to or compete with a polypeptide for binding to an anti-polypeptide antibody), immunogenicity, ability to form multimers, the ability to specifically bind to a receptor or ligand for the polypeptide and signaling and downstream effector functions. For purposes herein, modulation (i.e. activation or inhibition) of a functional activity of a polypeptide by an antibody or portion thereof herein means that a functional activity of the polypeptide is changed or altered in the presence of the antibody compared to the absence of the antibody or portion thereof.

As used herein, binding activity refer to characteristics of a molecule, e.g. a polypeptide, relating to whether or not, and how, it binds one or more binding partners. Binding activities include ability to bind the binding partner(s), the affinity with which it binds to the binding partner (e.g. high affinity), the avidity with which it binds to the binding partner, the strength of the bond with the binding partner and specificity for binding with the binding partner.

As used herein, “affinity” or “binding affinity” refers to the strength with which an antibody molecule or portion thereof binds to an epitope on a target protein or antigen. Affinity is often measured by equilibrium association constant (KA) or equilibrium dissociation constant (KD). Low-affinity antibody-antigen interaction is weak, and the molecules tend to dissociate rapidly, while high affinity antibody-antigen binding is strong and the molecules remain bound for a longer amount of time. Generally, affinity of an antibody to a target protein is with an equilibrium association constant (KA) of greater than or equal to about 106M−1, greater than or equal to about 107M−1, greater than or equal to about 108M−1, or greater than or equal to about 109M−1, 1010M−1, 1011M−1 or 1012M−1. Antibodies also can be characterized by an equilibrium dissociation constant (KD) 10−4 M, 10−6 M to 10−7 M, or 10−8 M, 10−10M, 10−11M or 10−12M or lower dissociation constant. It is understood that a lower dissociation constant means that the antibody is characterized by a higher binding affinity. Generally, antibodies having a nanomolar or sub-nanomolar dissociaton constant are deemed to be high affinity antibodies. Such affinities can be readily determined using conventional techniques, such as by equilibrium dialysis; by using the BIAcore 2000 instrument, using general procedures outlined by the manufacturer; by radioimmunoassay using radiolabeled target antigen; or by another method known to the skilled artisan. The affinity data can be analyzed, for example, by the method of Scatchard et al., Ann N.Y. Acad. ScL, 51:660 (1949).

As used herein, “specifically bind” or “immunospecifically bind” with respect to an antibody or antigen-binding fragment thereof are used interchangeably herein and refer to the ability of the antibody or antigen-binding fragment to form one or more noncovalent bonds with a cognate antigen, by noncovalent interactions between the antibody combining site(s) of the antibody and the antigen (e.g. human DLL4). Typically, an antibody that immunospecifically binds (or that specifically binds) to an antigen is one that binds to the antigen with an affinity constant Ka of about or 1×107M−1 or 1×108M−1 or greater (or a dissociation constant (Kd) of 1×10−7M or 1×10−8M or less). Affinity constants can be determined by standard kinetic methodology for antibody reactions, for example, immunoassays, surface plasmon resonance (SPR) (Rich and Myszka (2000) Curr. Opin. Biotechnol 11:54; Englebienne (1998) Analyst. 123:1599), isothermal titration calorimetry (ITC) or other kinetic interaction assays known in the art (see, e.g., Paul, ed., Fundamental Immunology, 2nd ed., Raven Press, New York, pages 332-336 (1989); see also U.S. Pat. No. 7,229,619 for a description of exemplary SPR and ITC methods for calculating the binding affinity of anti-RSV antibodies). Instrumentation and methods for real time detection and monitoring of binding rates are known and are commercially available (e.g., BiaCore 2000, Biacore AB, Upsala, Sweden and GE Healthcare Life Sciences; Malmqvist (2000) Biochem. Soc. Trans. 27:335).

As used herein, the term “bind selectively” or “selectively binds,” in reference to a polypeptide or an antibody provided herein, means that the polypeptide or antibody binds with a selected epitope without substantially binding to another epitope. Typically, an antibody or fragment thereof that selectively binds to a selected epitope specifically binds to the epitope, such as with an affinity constant Ka of about or 1×107M−1 or 1×108M−1 or greater.

As used herein, “epitope” refers to the localized region on the surface of an antigen or protein that is recognized by an antibody. Peptide epitopes include those that are continuous epitopes or discontinuous epitopes. An epitope is generally determined by the three dimensional structure of a protein as opposed to the linear amino acid sequence.

As used herein, “binds to the same epitope” with reference to two or more antibodies means that the antibodies compete for binding to an antigen and bind to the same, overlapping or encompassing continuous or discontinuous segments of amino acids. Those of skill in the art understand that the phrase “binds to the same epitope” does not necessarily mean that the antibodies bind to exactly the same amino acids. The precise amino acids to which the antibodies bind can differ. For example, a first antibody can bind to a segment of amino acids that is completely encompassed by the segment of amino acids bound by a second antibody. In another example, a first antibody binds one or more segments of amino acids that significantly overlap the one or more segments bound by the second antibody. For the purposes herein, such antibodies are considered to “bind to the same epitope.”

Antibody competition assays can be used to determine whether an antibody “binds to the same epitope” as another antibody. Such assays are well known on the art. Typically, competition of 70% or more, such as 70%, 71%, 72%, 73%, 74%, 75%, 80%, 85%, 90%, 95% or more, of an antibody known to interact with the epitope by a second antibody under conditions in which the second antibody is in excess and the first saturates all sites, is indicative that the antibodies “bind to the same epitope.” To assess the level of competition between two antibodies, for example, radioimmunoassays or assays using other labels for the antibodies, can be used. For example, a DLL4 antigen can be incubated with a saturating amount of a first anti-DLL4 antibody or antigen-binding fragment thereof conjugated to a labeled compound (e.g., 3H, 125I, biotin, or rubidium) in the presence the same amount of a second unlabeled anti-DLL4 antibody. The amount of labeled antibody that is bound to the antigen in the presence of the unlabeled blocking antibody is then assessed and compared to binding in the absence of the unlabeled blocking antibody. Competition is determined by the percentage change in binding signals in the presence of the unlabeled blocking antibody compared to the absence of the blocking antibody. Thus, if there is a 70% inhibition of binding of the labeled antibody in the presence of the blocking antibody compared to binding in the absence of the blocking antibody, then there is competition between the two antibodies of 70%. Thus, reference to competition between a first and second antibody of 70% or more, such as 70%, 71%, 72%, 73%, 74%, 75%, 80%, 85%, 90%, 95% or more, means that the first antibody inhibits binding of the second antibody (or vice versa) to the antigen by 70%, 71%, 72%, 73%, 74%, 75%, 80%, 85%, 90%, 95% or more (compared to binding of the antigen by the second antibody in the absence of the first antibody). Thus, inhibition of binding of a first antibody to an antigen by a second antibody of 70%, 71%, 72%, 73%, 74%, 75%, 80%, 85%, 90%, 95% or more indicates that the two antibodies bind to the same epitope.

As used herein, the term “surface plasmon resonance” refers to an optical phenomenon that allows for the analysis of real-time interactions by detection of alterations in protein concentrations within a biosensor matrix, for example, using the BiaCore system (GE Healthcare Life Sciences).

As used herein, a “bispecific” antibody is a multispecific antibody that contains two or more antigen-binding sites and can immunospecifically bind to two different epitopes. A “trispecific” antibody is a multispecific antibody that contains three or more antigen-binding sites and can immunospecifically bind to three different epitopes, a “tetraspecific” antibody is a multispecific antibody that contains four or more antigen-binding sites and can immunospecifically bind to four different epitopes, and so on.

As used herein, “epitope mapping” is the process of identification of the molecular determinants for antibody-antigen recognition.

As used herein, a “target protein” or “target antigen” refers to candidate proteins or peptides that are specifically recognized by an antibody or portion thereof and/or whose activity is modulated by an antibody or protion thereof. A target protein includes any peptide or protein that contains an epitope for antibody recognition. Target proteins include proteins involved in the etiology of a disease or disorder by virtue of expression or activity. Exemplary target proteins are described herein.

As used herein, a “Hit” refers to an antibody or portion thereof generated, identified, recognized or selected as having an activity for a target antigen. For example, a “Hit” can be identified in a screening assay. Generally, a “Hit” is identified based on its binding activity or affinity for the target antigen. For purposes herein, a “Hit” is generally recognized to be an antibody or portion thereof that has a binding affinity for a target antigen that is at least about or is 10−5 M, 10−6 M, 10−7 M, 10−8 M, or lower. For purposes herein, a Hit typically is a first antibody or a reference or parent antibody that is further optimized using affinity maturation methods herein. Thus, the terms “Hit”, first antibody, reference antibody or parent antibody are used interchangeably herein.

As used herein, a “modified antibody” refers to an antibody, or portion thereof, that contains one or more amino acid modifications compared to a parent or reference antibody. An amino acid modification includes an amino acid deletion, replacement (or substitution), or addition. A modified antibody can contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acid modifications. Typically, an amino acid modification is an amino acid replacement. Generally, the amino acid modifications are present in a region or target region of an antibody, but also can be present in other regions of the antibody or portion thereof.

As used herein, a “related antibody” is an antibody that exhibits structural and functional similarity to a corresponding form of a reference antibody (e.g. a Hit antibody or first antibody), but that does not exhibit the same activity or structure (e.g. sequence) as the reference antibody. For example, a related antibody is one that exhibits sequence simiarlity but is not identical to the reference antibody, and exhibits reduced activity or less activity than the activity of a reference antibody towards a target protein or antigen, such as reduced binding affinity. For purposes herein, an antibody is a related antibody if 1) it exhibits sequence similarity to a reference antibody such that it contains a variable heavy chain and/or a variable light chain that exhibits at least 75% amino acid sequence identity to the corresponding variable heavy chain or variable light chain of the first antibody, where the related antibody (variable heavy chain and variable light chain) does not exhibit 100% sequence identity to the reference antibody; and 2) it exhibits reduced activity compared to a corresponding form of the reference antibody. The sequence similiarity or sequence identity can be In another example, an antibody is a related antibody if 1) it exhibits sequence similarity to a reference antibody such that at least one of the VH, DH and JH germline segments of the nucleic acid molecule encoding the variable heavy chain of the related antibody is identical to one of the VH, DH and JH germline segments of the nucleic acid molecule encoding the variable heavy chain of the first antibody and/or at least one of the Vκ and Jκ or at least one of the Vλ and Jλ germline segments of the nucleic acid molecule encoding the variable light chain is identical to one of the Vκ and Jκ or Vλ and Jλ germline segments of the nucleic acid molecule encoding the variable light chain of the first antibody; and 2) it exhibits reduced activity compared to a corresponding form of the reference antibody.

As used herein “reduced activity” or “less activity” for a target antigen means that an antibody, or portion thereof, exhibits an activity towards a target antigen (e.g. binding or other functional activity) that is not as high or of the same degree as the activity of a reference antibody for the same target antigen. It is understood that in comparing an activity to a reference antibody, the activity is compared to the corresponding form of the antibody using the same assay to assess activity under the same or similar conditions. Hence, the requisite level of activity between and among two or more antibodies is compared under similar parameters or conditions. For purposes herein, an antibody that has a “reduced activity” or “less activity” for a target antigen generally exhibits 80% or lower the activity towards a target antigen as a reference antibody, such as 5% to 80% of the activity, for example, at or about 80%, 75%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or lower the activity towards a target antigen as a reference antibody.

As used herein, a “related variable heavy chain” or a “related variable light chain” is one that exhibits sequence identity to the corresponding variable heavy chain and/or variable light chain of a reference antibody, but that is not identical (e.g. does not exhibit 100% sequence identity) to the corresponding variable heavy chain and/or variable light chain of a reference antibody. Generally, a related variable heavy chain or a variable light chain is one that exhibits at least 60% sequence identity to the corresponding chain of the reference antibody, generally at least 75% sequence identity. For example, a related variable heavy chain or a variable light chain is one that exhibits 60% to 99% sequence identity, for example, at or about 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the corresponding chain of the reference antibody. For example, a related antibody includes an antibody in which at least one of the VH, DH and JH germline segments of the nucleic acid molecule encoding the variable heavy chain of the related antibody is identical to one of the VH, DH and JH germline segments of the nucleic acid molecule encoding the variable heavy chain of the first antibody and/or at least one of the Vκ and Jκ or at least one of the Vλ and Jλ germline segments of the nucleic acid molecule encoding the variable light chain is identical to one of the Vκ and Jκ or Vλ and Jλ germline segments of the nucleic acid molecule encoding the variable light chain of the first antibody. Generally, a related variable heavy chain and/or variable light chain of an antibody exhibits at least 75% amino acid sequence identity to the corresponding variable heavy chain or variable light of a reference antibody.

As used herein, a form of an antibody refers to a particular structure of an antibody. Antibodies herein include full length antibodies and portions thereof, such as, for example, a Fab fragment or other antibody fragment. Thus, a Fab is a particular form of an antibody.

As used herein, reference to a “corresponding form” of an antibody means that when comparing a property or activity of two antibodies, the property is compared using the same form of the antibody. For example, if its stated that an antibody has less activity compared to the activity of the corresponding form of a first antibody, that means that a particular form, such as a Fab of that antibody, has less activity compared to the Fab form of the first antibody.

As used herein, “sequence diversity” or “sequence similarity” refers to a representation of nucleic acid sequence similarity and is determined using sequence alignments, diversity scores, and/or sequence clustering. Any two sequences can be aligned by laying the sequences side-by-side and analyzing differences within nucleotides at every position along the length of the sequences. Sequence alignment can be assessed in silico using Basic Local Alignment Search Tool (BLAST), an NCBI tool for comparing nucleic acid and/or protein sequences. The use of BLAST for sequence alignment is well known to one of skill in the art. The Blast search algorithm compares two sequences and calculates the statistical significance of each match (a Blast score). Sequences that are most similar to each other will have a high Blast score, whereas sequences that are most varied will have a low Blast score.

As used herein, Basic Local Alignment Search Tool (BLAST) is a search algorithm developed by Altschul et al. (1990) to separately search protein or DNA databases, for example, based on sequence identity. For example, blastn is a program that compares a nucleotide query sequence against a nucleotide sequence database (e.g. GenBank). BlastP is a program that compares an amino acid query sequence against a protein sequence database.

As used herein, a “target region” refers to a region of a variable heavy chain or variable light chain of an antibody (e.g. a Hit antibody) or portion thereof that exhibits at least one amino acid differences compared to the corresponding region of related antibody or antibodies. Thus, a target region includes one or more of a CDR1, CDR2, CDR3, FR1, FR2, FR3 or FR4 of the variable heavy chain or variable light chain of a an antibody that contains at least one amino acid difference compared to the corresponding region of a related antibody. Generally, a target region is a region of an antibody that is associated with the structure/activity relationship (SAR) of the antibody. Thus, for purposes of practice of the method herein, a target region is one that is targeted for further mutagenesis. As described herein, it is within the level of one of skill in the art to identify such regions and to determine if amino acid differences exist. One of skill in the art knows and can identify a region in an antibody, for example a CDR or FR, based on Kabat or Chothia numbering (see e.g., Kabat, E. A. et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242, and Chothia, C. et al. (1987) J. Mol. Biol. 196:901-917).

As used herein, “saturation mutagenesis” refers to the process of systematically generating a plurality of mutants by replacing at least one amino acid residue of a protein sequence to all or a subset of the remaining amino acid residues or to effect replacement of a number of amino acid residues (within or across the full length of the protein or within or across a region of a protein) each to all or a subset of the remaining amino acid residues. Saturation mutagenesis can be full or partial.

As used herein, “full saturation mutagenesis” refers to the process of systematically generating a plurality of mutants by replacing an amino acid residue in a protein sequence with the other 19 other naturally-occurring amino acids. A single amino acid residue in a protein sequence can be subject to mutagenesis. Alternatively, all or a subset of amino acid residues across the full length sequence of a protein or a region of the protein sequence (e.g. target region) can be subjected to full saturation mutagenesis.

As used herein, “partial saturation mutagenesis” refers to the process of systematically generating a plurality of mutant sequences by replacing an amino acid residue in a protein sequence to a subset of the other 19 other naturally-occurring amino acids. A single amino acid residue in a protein sequence can be subject to mutagenesis. Alternatively, all or a subset of amino acid residues across the full length sequence of a protein or a region of the protein sequence (e.g. target region) can be subjected to partial saturation mutagenesis.

As used herein, “scanning mutagenesis” refers to the process of systematically replacing all or a subset of amino acids in a protein or in a region of a protein (e.g. target region) with a selected amino acid, typically alanine, glycine or serine, as long as each residue is replaced with the same residue. Typically, the replacing amino acid is an alanine.

As used herein, reference to an antibody that is an “Up mutant” or an antibody that “exhibits retained or increased activity”, refers to an antibody subjected to scanning mutagenesis whose activity when containing a single amino acid mutation to a scanned amino acid is retained or increased compared to the parent antibody not contained the scanned amino acid mutation. The antibody that retains an activity to a target antigen can exhibit some increase or decrease in binding, but generally exhibits the same binding as the first antibody not containing the scanned mutation, for example, exhibits at least 75% of the binding activity, such as 75% to 120% of the binding, for example, 75%, 80%, 85%, 90%, 95%, 100%, 105%, 110% or 115% of the binding. An antibody that exhibits increased activity to a target antigen generally exhibits greater than 115% of the activity, such as greater than 115%, 120%, 130%, 140%, 150%, 200% or more activity than the first antibody not containing the mutation.

As used herein “iterative” with respect to performing the steps of the method means that the method is repeated a plurality of times, such as 2, 3, 4, 5 or more times, until a modified “Hit” is identified whose activity is optimized or improved compared to prior iterations.

As used herein, an “intermediate” with reference to an antibody or portion thereof refers to an antibody that is derived from or evolved from a reference antibody, template or parent antibody, for example, by the process of affinity maturation, but that is itself further evolved. For example, once a modified Hit is selected in the affinity maturation method herein, it can itself be used as a template in order to further evolve or optimize the antibody. Hence, the modified Hit is an intermediate antibody in order to identify or select a further modified Hit.

As used herein, an “antibody library” refers to a collection of antibody members or portions thereof, for example, 2 or more, typically 5 or more, and typically 10 or more, such as, for example, at or about 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 1000, 104, 105, 106, 107, 108, 109, 1010, 1011, 1012, 1013, 1014 or more of such molecules. In some examples, the members of the collection are analogous to each other in that members within a collection are varied compared to a target or template antibody. An antibody library, however, encompasses a collection of any antibody members, or portions thereof. Thus, it is not necessary that each member within the collection is varied compared to a template member. Generally, collections contain different members (i.e. based on sequence), although in some cases collections of antibodies can contain some members that are the same. Typically, collections contain at least 104 or about 104,105 or about 105, 106 or about 106, at least 108 or about 108, at least 109 or about 109, at least 1010 or about 1010, or more different antibody members. Thus, the collections typically have a diversity of at least 104 or about 104,105 or about 105, 106 or about 106, at least 108 or about 108, at least 109 or about 109, at least 1010 or about 1010, at least 1011 or about 1011, at least 1012 or about 1012, at least 1013 or about 1013, at least 1014 or about 1014, or more. Thus, an antibody library having a diversity of 107 means that it contains 107 different members.

As used herein, “diversity” with respect to members in a collection or library refers to the number of unique members in a collection. Hence, diversity refers to the number of different amino acid sequences or nucleic acid sequences, respectively, among the analogous polypeptide members of that collection. For example, a collection of polynucleotides having a diversity of 104 contains 104 different nucleic acid sequences among the analogous polynucleotide members. In one example, the provided collections of polynucleotides and/or polypeptides have diversities of at least at or about 102, 103, 104, 105, 106, 107, 108, 109, 1010 or more.

As used herein, “a diversity ratio” refers to a ratio of the number of different members in the library over the number of total members of the library. Thus, a library with a larger diversity ratio than another library contains more different members per total members, and thus more diversity per total members. The provided libraries include libraries having high diversity ratios, such as diversity ratios approaching 1, such as, for example, at or about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 0.91, 0.92, 0.93, 0.94, 0.95. 0.96, 0.97, 0.98, or 0.99.

As used herein, “combinatorial library” refers to collections of compounds formed by reacting different combinations of interchangeable chemical “building blocks” to produce a collection of compounds based on permutations of the building blocks. For an antibody combinatorial library, the building blocks are the component V, D and J regions (or modified forms thereof) from which antibodies are formed. For purposes herein, the terms “library” or “collection” are used interchangeably.

As used herein, a combinatorial antibody library is a collection of antibodies (or portions thereof, such as Fabs), where the antibodies are encoded by nucleic acid molecules produced by the combination of V, D and J gene segments, particularly human V, D and J germline segments. The combinatorial libraries herein typically contain at least 50 different antibody (or antibody portions or fragment) members, typically at least or about 50 to 1010 or more different members, generally at least or about 102 to 106 or more different members, for example, at least or about 50, 100, 500, 103, 1×103, 2×103, 3×103, 4×103, 5×103, 6×103, 7×103, 8×103, 9×103, 1×104, 2×104, 3×104, 4×104, 5×104, 6×104, 7×104, 8×104, 9×104, 1×105, 2×105, 3×105, 4×105, 5×105, 6×105, 7×105, 8×105, 9×105, 106, 107, 108, 109, 1010, or more different members. The resulting libraries or collections of antibodies or portions thereof, can be screened for binding to a target protein or modulation of a functional activity.

As used herein, a human combinatorial antibody library is a collection of antibodies or portions thereof, whereby each member contains a VL and VH chains or a sufficient portion thereof to form an antigen binding site encoded by nucleic acid containing human germline segments produced as described in U.S. Provisional Application Nos. 61/198,764 and 61/211,204, incorporated by reference herein.

As used herein, a locus in a library refers to a location or position, that can contain a member or members of library. The position does not have to be a physical position. For example, if the collection is provided as an array on a solid support, the support contains loci that can or do present members of the array.

As used herein, an address refers to a unique identifier for each locus in a collection whereby an addressed member (e.g. an antibody) can be identified. An addressed moiety is one that can be identified by virtue of its locus or location. Addressing can be effected by position on a surface, such as a well of a microplate. For example, an address for a protein in a microwell plate that is F9 means that the protein is located in row F, column 9 of the microwell plate. Addressing also can be effected by other identifiers, such as a tag encoded with a bar code or other symbology, a chemical tag, an electronic, such RF tag, a color-coded tag or other such identifier.

As used herein, an array refers to a collection of elements, such as antibodies, containing three or more members.

As used herein, a “spatial array” is an array where members are separated or occupy a distinct space in an array. Hence, spatial arrays are a type of addressable array. Examples of spatial arrays include microtiter plates where each well of a plate is an address in the array. Spacial arrays include any arrangement wherein a plurality of different molecules, e.g, polypeptides, are held, presented, positioned, situated, or supported. Arrays can include microtiter plates, such as 48-well, 96-well, 144-well, 192-well, 240-well, 288-well, 336-well, 384-well, 432-well, 480-well, 576-well, 672-well, 768-well, 864-well, 960-well, 1056-well, 1152-well, 1248-well, 1344-well, 1440-well, or 1536-well plates, tubes, slides, chips, flasks, or any other suitable laboratory apparatus. Furthermore, arrays can also include a plurality of sub-arrays. A plurality of sub-arrays encompasses an array where more than one arrangement is used to position the polypeptides. For example, multiple 96-well plates can constitute a plurality of sub-arrays and a single array.

As used herein, an addressable library is a collection of molecules such as nucleic acid molecules or protein agents, such as antibodies, in which each member of the collection is identifiable by virtue of its address.

As used herein, an addressable array is one in which the members of the array are identifiable by their address, the position in a spatial array, such as a well of a microtiter plate, or on a solid phase support, or by virtue of an identifiable or detectable label, such as by color, fluorescence, electronic signal (i.e. RF, microwave or other frequency that does not substantially alter the interaction of the molecules of interest), bar code or other symbology, chemical or other such label. Hence, in general the members of the array are located at identifiable loci on the surface of a solid phase or directly or indirectly linked to or otherwise associated with the identifiable label, such as affixed to a microsphere or other particulate support (herein referred to as beads) and suspended in solution or spread out on a surface.

As used herein, “an addressable antibody library” or “an addressable combinatorial antibody library” refers to a collection of antibodies in which member antibodies are identifiable and all antibodies with the same identifier, such as position in a spatial array or on a solid support, or a chemical or RF tag, bind to the same antigen, and generally are substantially the same in amino acid sequence. For purposes herein, reference to an “addressable arrayed combinatorial antibody library” means that the antibody members are addressed in an array.

As used herein, a support (also referred to as a matrix support, a matrix, an insoluble support or solid support) refers to any solid or semisolid or insoluble support to which a molecule of interest, typically a biological molecule, organic molecule or biospecific ligand is linked or contacted. Such materials include any materials that are used as affinity matrices or supports for chemical and biological molecule syntheses and analyses, such as, but are not limited to: polystyrene, polycarbonate, polypropylene, nylon, glass, dextran, chitin, sand, pumice, agarose, polysaccharides, dendrimers, buckyballs, polyacrylamide, silicon, rubber, and other materials used as supports for solid phase syntheses, affinity separations and purifications, hybridization reactions, immunoassays and other such applications. The matrix herein can be particulate or can be in the form of a continuous surface, such as a microtiter dish or well, a glass slide, a silicon chip, a nitrocellulose sheet, nylon mesh, or other such materials. When particulate, typically the particles have at least one dimension in the 5-10 mm range or smaller. Such particles, referred collectively herein as “beads”, are often, but not necessarily, spherical. Such reference, however, does not constrain the geometry of the matrix, which can be any shape, including random shapes, needles, fibers, and elongated. Roughly spherical “beads”, particularly microspheres that can be used in the liquid phase, also are contemplated. The “beads” can include additional components, such as magnetic or paramagnetic particles (see, e.g., Dynabeads® (Dynal, Oslo, Norway)) for separation using magnets, as long as the additional components do not interfere with the methods and analyses herein.

As used herein, matrix or support particles refers to matrix materials that are in the form of discrete particles. The particles have any shape and dimensions, but typically have at least one dimension that is 100 mm or less, 50 mm or less, 10 mm or less, 1 mm or less, 100 μm or less, 50 μm or less and typically have a size that is 100 mm3 or less, 50 mm3 or less, 10 mm3 or less, and 1 mm3 or less, 100 μm3 or less and can be on the order of cubic microns. Such particles are collectively called “beads.”

As used herein, germline gene segments refer to immunoglobulin (Ig) variable (V), diversity (D) and junction (J) or constant (C) genes from the germline that encode immunoglobulin heavy or light (kappa and lambda) chains. There are multiple V, D, J and C gene segments in the germline, but gene rearrangement results in only one segment of each occurring in each functional rearranged gene. For example, a functionally rearranged heavy chain contains one V, one D and one J and a functionally rearranged light chain gene contains one V and one J. Hence, these gene segments are carried in the germ cells but cannot be transcribed and translated into heavy and light chains until they are arranged into functional genes. During B-cell differentiation in the bone marrow, these gene segments are randomly shuffled by a dynamic genetic system capable of generating more than 1010 specificities.

For purposes herein, heavy chain germline segments are designated as VH, DH and JH, and compilation thereof results in a nucleic acid encoding a VH chain. Light chain germline segments are designated as VL or JL, and include kappa and lambda light chains (Vκ and Jκ; Vλ and Jλ) and compilation thereof results in a nucleic acid encoding a VL chain. It is understood that a light chain is either a kappa or lambda light chain, but does not include a kappa/lambda combination by virtue of compilation of a Vκ and Jκ.

Reference to a variable germline segment herein refers to V, D and J groups, subgroups, genes or alleles thereof. Gene segment sequences are accessible from known database (e.g., National Center for Biotechnology Information (NCBI), the international ImMunoGeneTics information System® (IMGT), the Kabat database and the Tomlinson's VBase database (Lefranc (2003) Nucleic Acids Res., 31:307-310; Martin et al., Bioinformatics Tools for Antibody Engineering in Handbook of Therapeutic Antibodies, Wiley-VCH (2007), pp. 104-107).

As used herein, a “group” with reference to a germline segment refers to a core coding region from an immunoglobulin, i.e. a variable (V) gene, diversity (D) gene, joining (J) gene or constant (C) gene encoding a heavy or light chain. Exemplary of germline segment groups include VH, DH, JH, Vκ, Jκ, Vλ and Jλ.

As used herein, a “subgroup” with reference to a germline segment refers to a set of sequences that are defined by nucleotide sequence similarity or identity. Generally, a subgroup is a set of genes that belong to the same group [V, D, J or C], in a given species, and that share at least 75% identity at the nucleotide level. Subgroups are classified based on IMGT nomenclature (imgt.cines.fr; see e.g., Lefranc et al. (2008) Briefings in Bioinformatics, 9:263-275). Generally, a subgroup represent a multigene family.

As used herein, an allele of a gene refer to germline sequences that have sequence polymorphism due to one or more nucleotide differences in the coding region compared to a reference gene sequence (e.g. substitutions, insertions or deletions). Thus, IG sequences that belong to the same subgroup can be highly similar in their coding sequence, but nonetheless exhibit high polymorphism. Subgroup alleles are classified based on IMGT nomenclature with an asterisk (*) followed by a two figure number.

As used herein, a “family” with reference to a germline segment refers to sets of germline segment sequences that are defined by amino acid sequence similarity or identity. Generally, a germline family includes all alleles of a gene.

As used herein, inverted sequence with reference to nucleotides of a germline segment means that the gene segment has a sequence of nucleotides that is the reverse complement of a reference sequence of nucleotides.

As used herein, “compilation,” “compile,” “combine,” “combination,” “rearrange,” “rearrangement,” or other similar terms or grammatical variations thereof refers to the process by which germline segments are ordered or assembled into nucleic acid sequences representing genes. For example, in the combinatorial method, variable heavy chain germline segments are assembled such that the VH segment is 5′ to the DH segment which is 5′ to the JH segment, thereby resulting in a nucleic acid sequence encoding a VH chain. Variable light chain germline segments are assembled such that the VL segment is 5′ to the JL segment, thereby resulting in a nucleic acid sequence encoding a VL chain. A constant gene segment or segments also can be assembled onto the 3′ end of a nucleic acid encoding a VH or VL chain.

As used herein, “linked,” or “linkage” or other grammatical variations thereof with reference to germline segments refers to the joining of germline segments. Linkage can be direct or indirect. Germline segments can be linked directly without additional nucleotides between segments, or additional nucleotides can be added to render the entire segment in-frame, or nucleotides can be deleted to render the resulting segment in-frame. In the method of generating a combinatorial antibody library, it is understood that the choice of linker nucleotides is made such that the resulting nucleic acid molecule is in-frame and encodes a functional and productive antibody.

As used herein, “in-frame” or “linked in-frame” with reference to linkage of human germline segments means that there are insertions and/or deletions in the nucleotide germline segments at the joined junctions to render the resulting nucleic acid molecule in-frame with the 5′ start codon (ATG), thereby producing a “productive” or functional full-length polypeptide. The choice of nucleotides inserted or deleted from germline segments, particularly at joints joining various VD, DJ and VJ segments, is in accord with the rules provided in the method herein for V(D)J joint generation described in detail in U.S. Provisional Application Nos. 61/198,764 and 61/211,204. For example, germline segments are assembled such that the VH segment is 5′ to the DH segment which is 5′ to the JH segment. At the junction joining the VH and the DH and at the junction joining the DH and JH segments, nucleotides can be inserted or deleted from the individual VH, DH or JH segments, such that the resulting nucleic acid molecule containing the joined VDJ segments are in-frame with the 5′ start codon (ATG).

As used herein, a “functional antibody” or “productive antibody” with reference to a nucleic acid encoding an antibody or portion thereof refers to an antibody or portion thereof, such as Fab, that is encoded by the nucleic acid molecule produced by the combinatorial method. In a functional or productive antibody, the V(D)J germline segments are compiled (i.e. rearranged) such that the encoded antibody or portion thereof is not truncated and/or the amino acid sequence is not out of frame. This means that the nucleic acid molecule does not contain internal stop codons that result in the protein translation machinery terminating protein assembly prematurely.

As used herein, corresponding with reference to corresponding residues, for example “amino acid residues corresponding to”, refers to residues compared among or between two polypeptides that are related sequences (e.g. allelic variants, genes of the same family, species variants). One of skill in the art can readily identify residues that correspond between or among polypeptides. For example, by aligning two sequences, one of skill in the art can identify corresponding residues, using conserved and identical amino acids as guides. One of skill in the art can manually align a sequence or can use any of the numerous alignment programs available (for example, BLAST). Hence, an amino acid residues or positions that correspond to each other are those residues that are determined to correspond to one another based on sequence and/or structural alignments with a specified reference polypeptide.

As used herein, “screening” refers to identification or selection of an antibody or portion thereof from a plurality of antibodies, such as a collection or library of antibodies and/or portions thereof, based on determination of the activity or property of an antibody or portion thereof. Screening can be performed in any of a variety of ways, including, for example, by assays assessing direct binding (e.g. binding affinity) of the antibody to a target protein or by functional assays assessing modulation of an activity of a target protein.

As used herein the term assessing is intended to include quantitative and qualitative determination in the sense of obtaining an absolute value for the binding of an antibody or portion thereof with a target protein and/or modulation of an activity of a target protein by an antibody or portion thereof, and also of obtaining an index, ratio, percentage, visual or other value indicative of the level of the binding or activity. Assessment can be direct or indirect. For example, binding can be determined by directly labeling of an antibody or portion thereof with a detectable label and/or by using a secondary antibody that itself is labeled. In addition, functional activities can be determined using any of a variety of assays known to one of skill in the art, for example, proliferation, cytotoxicity and others as described herein, and comparing the activity of the target protein in the presence versus the absence of an antibody or portion thereof.

As used herein, “modulate” or “modulation” and other various grammatical forms thereof with reference to the effect of an antibody or portion thereof on the functional activity of a target protein refers to increased activity such as induction or potentiation of activity, as well as inhibition of one or more activities of the target protein. Hence, modulation can include an increase in the activity (i.e., up-regulation or agonist activity) a decrease in activity (i.e., down-regulation or inhibition) or any other alteration in an activity (such as a change in periodicity, frequency, duration, kinetics or other parameter). Modulation can be context dependent and typically modulation is compared to a designated state, for example, the wildtype protein, the protein in a constitutive state, or the protein as expressed in a designated cell type or condition. The functional activity of a target protein by an antibody or portion thereof can be modulated by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more compared to the activity of the target protein in the abasence of the antibody or portion thereof.

As used herein, Delta-like 4 (DLL4) refers to a protein that is a ligand for Notch receptors 1 and 4. DLL4 includes any DLL4 polypeptide, including but not limited to, a recombinantly produced polypeptide, a sythentically produced polypeptide, a native DLL4 polypeptide, and a DLL4 polypeptide extracted from cells or tissues, including endothelial cells. DLL4 also includes related polypeptides from different species including, but not limited to animals of human and non-human origin. Human DLL4 includes DLL4, allelic variant isoforms, synthetic molecules from nucleic acids, protein isolated from human tissue and cells, and modified forms thereof. An exemplary DLL4 includes human DLL4 having a sequence of amino acids set forth in SEQ ID NO:2904 and encoded by a sequence of nucleotides set forth in SEQ ID NO:2905. For purposes herein, reference to DLL4 is typically with reference to human DLL4, unless stated otherwise.

As used herein, an “activator”, such as an “agonist” or “activator/modulator,” refers to an antibody or portion thereof that modulates signal transduction or other functional activity of a receptor by potentiating, inducing or otherwise enhancing the signal transduction activity or other functional activity of a receptor. An activator, such as an agonists or activator/modulator, can modulate or increase signal transduction or other functional activity when used alone or can alter signal transduction or other functional activity in the presence of the natural ligand of the receptor or other receptor stimulator to enhance signaling by the receptor compared to the ligand alone. An activator includes an agonist or activator/modulator.

As used herein, an “agonist” refers to an antibody or portion thereof that mimics the activity of an endogenous ligand, and can replace the endogenous ligand.

As used herein, a “modulator/activator” refers to an antibody or portion thereof that binds an allosteric site of a target substrate and alters, such as increases, the activation of a receptor by its ligand.

As used herein, an “allosteric site” is a site on the target substrate that is not the site conferring ligand/receptor interaction, but that when bound by an antibody or a portion thereof alters the activity of the target substrate.

As used herein, “antagonist” refers to an antibody or portion thereof that modulates signal transduction or other functional activity of a receptor by blocking or decreasing the signal transduction activity or other functional activity of a receptor.

As used herein, off-rate (koff) is the rate at which an antibody dissociates from its antigen.

As used herein, on-rate (kon) is the rate at which an antibody binds antigen.

As used herein, “half-life” (t1/2) or “dissociation half-life” refers to the time in which half of the initially present protein-ligand or substrate-antibody complexes have disassociated. It is designated as Ln(2)/koff.

As used herein, reference to an “antibody or portion thereof that is sufficient to form an antigen binding site” means that the antibody or portion thereof contains at least 1 or 2, typically 3, 4, 5 or all 6 CDRs of the VH and VL sufficient to retain at least a portion of the binding specificity of the corresponding full-length antibody containing all 6 CDRs. Generally, a sufficient antigen binding site at least requires CDR3 of the heavy chain (CDRH3). It typically further requires the CDR3 of the light chain (CDRL3). As described herein, one of skill in the art knows and can identify the CDRs based on Kabat or Chothia numbering (see e.g., Kabat, E. A. et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242, and Chothia, C. et al. (1987) J. Mol. Biol. 196:901-917). For example, based on Kabat numbering, CDR-L1 corresponds to residues L24-L34; CDR-L2 corresponds to residues L50-L56; CDR-L3 corresponds to residues L89-L97; CDR-H1 corresponds to residues H31-H35, 35a or 35b depending on the length; CDR-H2 corresponds to residues H50-H65; and CDR-H3 corresponds to residues H95-H102.

As used herein, a label is a detectable marker that can be attached or linked directly or indirectly to a molecule or associated therewith. The detection method can be any method known in the art.

As used herein, a human protein is one encoded by a nucleic acid molecule, such as DNA, present in the genome of a human, including all allelic variants and conservative variations thereof. A variant or modification of a protein is a human protein if the modification is based on the wildtype or prominent sequence of a human protein.

As used herein, “naturally occurring amino acids” refer to the 20 L-amino acids that occur in polypeptides. The residues are those 20 α-amino acids found in nature which are incorporated into protein by the specific recognition of the charged tRNA molecule with its cognate mRNA codon in humans.

As used herein, non-naturally occurring amino acids refer to amino acids that are not genetically encoded. For example, a non-natural amino acid is an organic compound that has a structure similar to a natural amino acid but has been modified structurally to mimic the structure and reactivity of a natural amino acid. Non-naturally occurring amino acids thus include, for example, amino acids or analogs of amino acids other than the 20 naturally-occurring amino acids and include, but are not limited to, the D-isostereomers of amino acids. Exemplary non-natural amino acids are known to those of skill in the art.

As used herein, nucleic acids include DNA, RNA and analogs thereof, including peptide nucleic acids (PNA) and mixtures thereof. Nucleic acids can be single or double-stranded. When referring to probes or primers, which are optionally labeled, such as with a detectable label, such as a fluorescent or radiolabel, single-stranded molecules are contemplated. Such molecules are typically of a length such that their target is statistically unique or of low copy number (typically less than 5, generally less than 3) for probing or priming a library. Generally a probe or primer contains at least 14, 16 or 30 contiguous nucleotides of sequence complementary to or identical to a gene of interest. Probes and primers can be 10, 20, 30, 50, 100 or more nucleic acids long.

As used herein, a peptide refers to a polypeptide that is from 2 to 40 amino acids in length.

As used herein, the amino acids which occur in the various sequences of amino acids provided herein are identified according to their known, three-letter or one-letter abbreviations (Table 1). The nucleotides which occur in the various nucleic acid fragments are designated with the standard single-letter designations used routinely in the art.

As used herein, an “amino acid” is an organic compound containing an amino group and a carboxylic acid group. A polypeptide contains two or more amino acids. For purposes herein, amino acids include the twenty naturally-occurring amino acids, non-natural amino acids and amino acid analogs (i.e., amino acids wherein the α-carbon has a side chain).

As used herein, “amino acid residue” refers to an amino acid formed upon chemical digestion (hydrolysis) of a polypeptide at its peptide linkages. The amino acid residues described herein are presumed to be in the “L” isomeric form. Residues in the “D” isomeric form, which are so designated, can be substituted for any L-amino acid residue as long as the desired functional property is retained by the polypeptide. NH2 refers to the free amino group present at the amino terminus of a polypeptide. COOH refers to the free carboxy group present at the carboxyl terminus of a polypeptide. In keeping with standard polypeptide nomenclature described in J. Biol. Chem., 243: 3557-3559 (1968), and adopted 37 C.F.R. §§1.821-1.822, abbreviations for amino acid residues are shown in Table 1:

TABLE 1
Table of Correspondence
SYMBOL
1-Letter 3-Letter AMINO ACID
Y Tyr Tyrosine
G Gly Glycine
F Phe Phenylalanine
M Met Methionine
A Ala Alanine
S Ser Serine
I Ile Isoleucine
L Leu Leucine
T Thr Threonine
V Val Valine
P Pro Proline
K Lys Lysine
H His Histidine
Q Gln Glutamine
E Glu Glutamic acid
Z Glx Glu and/or Gln
W Trp Tryptophan
R Arg Arginine
D Asp Aspartic acid
N Asn Asparagine
B Asx Asn and/or Asp
C Cys Cysteine
X Xaa Unknown or other

It should be noted that all amino acid residue sequences represented herein by formulae have a left to right orientation in the conventional direction of amino-terminus to carboxyl-terminus. In addition, the phrase “amino acid residue” is broadly defined to include the amino acids listed in the Table of Correspondence (Table 1) and modified and unusual amino acids, such as those referred to in 37 C.F.R. §§1.821-1.822, and incorporated herein by reference. Furthermore, it should be noted that a dash at the beginning or end of an amino acid residue sequence indicates a peptide bond to a further sequence of one or more amino acid residues, to an amino-terminal group such as NH2 or to a carboxyl-terminal group such as COOH. The abbreviations for any protective groups, amino acids and other compounds, are, unless indicated otherwise, in accord with their common usage, recognized abbreviations, or the IUPAC-IUB Commission on Biochemical Nomenclature (see, (1972) Biochem. 11:1726). Each naturally occurring L-amino acid is identified by the standard three letter code (or single letter code) or the standard three letter code (or single letter code) with the prefix “L-”; the prefix “D-” indicates that the stereoisomeric form of the amino acid is D.

As used herein, an isokinetic mixture is one in which the molar ratios of amino acids has been adjusted based on their reported reaction rates (see, e.g., Ostresh et al., (1994) Biopolymers 34:1681).

As used herein, modification is in reference to modification of a sequence of amino acids of a polypeptide or a sequence of nucleotides in a nucleic acid molecule and includes deletions, insertions, and replacements of amino acids and nucleotides, respectively. Methods of modifying a polypeptide are routine to those of skill in the art, such as by using recombinant DNA methodologies.

As used herein, suitable conservative substitutions of amino acids are known to those of skill in this art and can be made generally without altering the biological activity of the resulting molecule. Those of skill in this art recognize that, in general, single amino acid substitutions in non-essential regions of a polypeptide do not substantially alter biological activity (see, e.g., Watson et al. Molecular Biology of the Gene, 4th Edition, 1987, The Benjamin/Cummings Pub. co., p. 224). Such substitutions can be made in accordance with those set forth in TABLE 2 as follows:

TABLE 2
Original Exemplary conservative
residue substitution
Ala (A) Gly; Ser
Arg (R) Lys
Asn (N) Gln; His
Cys (C) Ser
Gln (Q) Asn
Glu (E) Asp
Gly (G) Ala; Pro
His (H) Asn; Gln
Ile (I) Leu; Val
Leu (L) Ile; Val
Lys (K) Arg; Gln; Glu
Met (M) Leu; Tyr; Ile
Phe (F) Met; Leu; Tyr
Ser (S) Thr
Thr (T) Ser
Trp (W) Tyr
Tyr (Y) Trp; Phe
Val (V) Ile; Leu

Other substitutions also are permissible and can be determined empirically or in accord with known conservative substitutions.

As used herein, a DNA construct is a single or double stranded, linear or circular DNA molecule that contains segments of DNA combined and juxtaposed in a manner not found in nature. DNA constructs exist as a result of human manipulation, and include clones and other copies of manipulated molecules.

As used herein, a DNA segment is a portion of a larger DNA molecule having specified attributes. For example, a DNA segment encoding a specified polypeptide is a portion of a longer DNA molecule, such as a plasmid or plasmid fragment, which, when read from the 5′ to 3′ direction, encodes the sequence of amino acids of the specified polypeptide.

As used herein, the term “nucleic acid” refers to single-stranded and/or double-stranded polynucleotides such as deoxyribonucleic acid (DNA), and ribonucleic acid (RNA) as well as analogs or derivatives of either RNA or DNA. Also included in the term “nucleic acid” are analogs of nucleic acids such as peptide nucleic acid (PNA), phosphorothioate DNA, and other such analogs and derivatives or combinations thereof. Nucleic acid can refer to polynucleotides such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The term also includes, as equivalents, derivatives, variants and analogs of either RNA or DNA made from nucleotide analogs, single (sense or antisense) and double-stranded polynucleotides. Deoxyribonucleotides include deoxyadenosine, deoxycytidine, deoxyguanosine and deoxythymidine. For RNA, the uracil base is uridine.

As used herein, “nucleic acid molecule encoding” refers to a nucleic acid molecule which directs the expression of a specific protein or peptide. The nucleic acid sequences include both the DNA strand sequence that is transcribed into RNA and the RNA sequence that is translated into protein or peptide. The nucleic acid molecule includes both the full length nucleic acid sequences as well as non-full length sequences derived from the full length mature polypeptide, such as for example a full length polypeptide lacking a precursor sequence. For purposes herein, a nucleic acid sequence also includes the degenerate codons of the native sequence or sequences which can be introduced to provide codon preference in a specific host.

As used herein, the term “polynucleotide” refers to an oligomer or polymer containing at least two linked nucleotides or nucleotide derivatives, including a deoxyribonucleic acid (DNA), a ribonucleic acid (RNA), and a DNA or RNA derivative containing, for example, a nucleotide analog or a “backbone” bond other than a phosphodiester bond, for example, a phosphotriester bond, a phosphoramidate bond, a phosphorothioate bond, a thioester bond, or a peptide bond (peptide nucleic acid). The term “oligonucleotide” also is used herein essentially synonymously with “polynucleotide,” although those in the art recognize that oligonucleotides, for example, PCR primers, generally are less than about fifty to one hundred nucleotides in length.

Polynucleotides can include nucleotide analogs, including, for example, mass modified nucleotides, which allow for mass differentiation of polynucleotides; nucleotides containing a detectable label such as a fluorescent, radioactive, luminescent or chemiluminescent label, which allow for detection of a polynucleotide; or nucleotides containing a reactive group such as biotin or a thiol group, which facilitates immobilization of a polynucleotide to a solid support. A polynucleotide also can contain one or more backbone bonds that are selectively cleavable, for example, chemically, enzymatically or photolytically. For example, a polynucleotide can include one or more deoxyribonucleotides, followed by one or more ribonucleotides, which can be followed by one or more deoxyribonucleotides, such a sequence being cleavable at the ribonucleotide sequence by base hydrolysis. A polynucleotide also can contain one or more bonds that are relatively resistant to cleavage, for example, a chimeric oligonucleotide primer, which can include nucleotides linked by peptide nucleic acid bonds and at least one nucleotide at the 3′ end, which is linked by a phosphodiester bond or other suitable bond, and is capable of being extended by a polymerase. Peptide nucleic acid sequences can be prepared using well-known methods (see, for example, Weiler et al. Nucleic acids Res. 25: 2792-2799 (1997)).

As used herein, “similarity” between two proteins or nucleic acids refers to the relatedness between the sequence of amino acids of the proteins or the nucleotide sequences of the nucleic acids. Similarity can be based on the degree of identity and/or homology of sequences of residues and the residues contained therein. Methods for assessing the degree of similarity between proteins or nucleic acids are known to those of skill in the art. For example, in one method of assessing sequence similarity, two amino acid or nucleotide sequences are aligned in a manner that yields a maximal level of identity between the sequences. “Identity” refers to the extent to which the amino acid or nucleotide sequences are invariant. Alignment of amino acid sequences, and to some extent nucleotide sequences, also can take into account conservative differences and/or frequent substitutions in amino acids (or nucleotides). Conservative differences are those that preserve the physico-chemical properties of the residues involved. Alignments can be global (alignment of the compared sequences over the entire length of the sequences and including all residues) or local (the alignment of a portion of the sequences that includes only the most similar region or regions).

“Identity” per se has an art-recognized meaning and can be calculated using published techniques. (See, e.g.: Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). While there exists a number of methods to measure identity between two polynucleotide or polypeptides, the term “identity” is well known to skilled artisans (Carillo, H. & Lipton, D., SIAM J Applied Math 48:1073 (1988)).

As used herein, homologous (with respect to nucleic acid and/or amino acid sequences) means about greater than or equal to 25% sequence homology, typically greater than or equal to 25%, 40%, 50%, 60%, 70%, 80%, 85%, 90% or 95% sequence homology; the precise percentage can be specified if necessary. For purposes herein the terms “homology” and “identity” are often used interchangeably, unless otherwise indicated. In general, for determination of the percentage homology or identity, sequences are aligned so that the highest order match is obtained (see, e.g.: Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; Carillo et al. (1988) SIAM J Applied Math 48:1073). By sequence homology, the number of conserved amino acids is determined by standard alignment algorithms programs, and can be used with default gap penalties established by each supplier. Substantially homologous nucleic acid molecules hybridize typically at moderate stringency or at high stringency all along the length of the nucleic acid of interest. Also contemplated are nucleic acid molecules that contain degenerate codons in place of codons in the hybridizing nucleic acid molecule.

Whether any two molecules have nucleotide sequences or amino acid sequences that are at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% “identical” or “homologous” can be determined using known computer algorithms such as the “FASTA” program, using for example, the default parameters as in Pearson et al. (1988) Proc. Natl. Acad. Sci. USA 85:2444 (other programs include the GCG program package (Devereux, J., et al., Nucleic Acids Research 12(I):387 (1984)), BLASTP, BLASTN, FASTA (Atschul, S. F., et al., J Molec Biol 215:403 (1990)); Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and Carillo et al. (1988) SIAM J Applied Math 48:1073). For example, the BLAST function of the National Center for Biotechnology Information database can be used to determine identity. Other commercially or publicly available programs include, DNAStar “MegAlign” program (Madison, Wis.) and the University of Wisconsin Genetics Computer Group (UWG) “Gap” program (Madison Wis.). Percent homology or identity of proteins and/or nucleic acid molecules can be determined, for example, by comparing sequence information using a GAP computer program (e.g., Needleman et al. (1970) J. Mol. Biol. 48:443, as revised by Smith and Waterman ((1981) Adv. Appl. Math. 2:482). Briefly, the GAP program defines similarity as the number of aligned symbols (i.e., nucleotides or amino acids), which are similar, divided by the total number of symbols in the shorter of the two sequences. Default parameters for the GAP program can include: (1) a unary comparison matrix (containing a value of 1 for identities and 0 for non-identities) and the weighted comparison matrix of Gribskov et al. (1986) Nucl. Acids Res. 14:6745, as described by Schwartz and Dayhoff, eds., ATLAS OF PROTEIN SEQUENCE AND STRUCTURE, National Biomedical Research Foundation, pp. 353-358 (1979); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap; and (3) no penalty for end gaps.

Therefore, as used herein, the term “identity” or “homology” represents a comparison between a test and a reference polypeptide or polynucleotide. As used herein, the term at least “90% identical to” refers to percent identities from 90 to 99.99 relative to the reference nucleic acid or amino acid sequence of the polypeptide. Identity at a level of 90% or more is indicative of the fact that, assuming for exemplification purposes a test and reference polypeptide length of 100 amino acids are compared. No more than 10% (i.e., 10 out of 100) of the amino acids in the test polypeptide differs from that of the reference polypeptide. Similar comparisons can be made between test and reference polynucleotides. Such differences can be represented as point mutations randomly distributed over the entire length of a polypeptide or they can be clustered in one or more locations of varying length up to the maximum allowable, e.g. 10/100 amino acid difference (approximately 90% identity). Differences are defined as nucleic acid or amino acid substitutions, insertions or deletions. At the level of homologies or identities above about 85-90%, the result should be independent of the program and gap parameters set; such high levels of identity can be assessed readily, often by manual alignment without relying on software.

As used herein, an aligned sequence refers to the use of homology (similarity and/or identity) to align corresponding positions in a sequence of nucleotides or amino acids. Typically, two or more sequences that are related by 50% or more identity are aligned. An aligned set of sequences refers to 2 or more sequences that are aligned at corresponding positions and can include aligning sequences derived from RNAs, such as ESTs and other cDNAs, aligned with genomic DNA sequence.

As used herein, “primer” refers to a nucleic acid molecule that can act as a point of initiation of template-directed DNA synthesis under appropriate conditions (e.g., in the presence of four different nucleoside triphosphates and a polymerization agent, such as DNA polymerase, RNA polymerase or reverse transcriptase) in an appropriate buffer and at a suitable temperature. It will be appreciated that a certain nucleic acid molecules can serve as a “probe” and as a “primer.” A primer, however, has a 3′ hydroxyl group for extension. A primer can be used in a variety of methods, including, for example, polymerase chain reaction (PCR), reverse-transcriptase (RT)-PCR, RNA PCR, LCR, multiplex PCR, panhandle PCR, capture PCR, expression PCR, 3′ and 5′ RACE, in situ PCR, ligation-mediated PCR and other amplification protocols.

As used herein, “primer pair” refers to a set of primers that includes a 5′ (upstream) primer that hybridizes with the 5′ end of a sequence to be amplified (e.g. by PCR) and a 3′ (downstream) primer that hybridizes with the complement of the 3′ end of the sequence to be amplified.

As used herein, “specifically hybridizes” refers to annealing, by complementary base-pairing, of a nucleic acid molecule (e.g. an oligonucleotide) to a target nucleic acid molecule. Those of skill in the art are familiar with in vitro and in vivo parameters that affect specific hybridization, such as length and composition of the particular molecule. Parameters particularly relevant to in vitro hybridization further include annealing and washing temperature, buffer composition and salt concentration. Exemplary washing conditions for removing non-specifically bound nucleic acid molecules at high stringency are 0.1×SSPE, 0.1% SDS, 65° C., and at medium stringency are 0.2×SSPE, 0.1% SDS, 50° C. Equivalent stringency conditions are known in the art. The skilled person can readily adjust these parameters to achieve specific hybridization of a nucleic acid molecule to a target nucleic acid molecule appropriate for a particular application.

As used herein, substantially identical to a product means sufficiently similar so that the property of interest is sufficiently unchanged so that the substantially identical product can be used in place of the product.

As used herein, it also is understood that the terms “substantially identical” or “similar” varies with the context as understood by those skilled in the relevant art.

As used herein, an allelic variant or allelic variation references any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and can result in phenotypic polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or can encode polypeptides having altered amino acid sequence. The term “allelic variant” also is used herein to denote a protein encoded by an allelic variant of a gene. Typically the reference form of the gene encodes a wildtype form and/or predominant form of a polypeptide from a population or single reference member of a species. Typically, allelic variants, which include variants between and among species typically have at least 80%, 90% or greater amino acid identity with a wildtype and/or predominant form from the same species; the degree of identity depends upon the gene and whether comparison is interspecies or intraspecies. Generally, intraspecies allelic variants have at least about 80%, 85%, 90% or 95% identity or greater with a wildtype and/or predominant form, including 96%, 97%, 98%, 99% or greater identity with a wildtype and/or predominant form of a polypeptide. Reference to an allelic variant herein generally refers to variations n proteins among members of the same species.

As used herein, “allele,” which is used interchangeably herein with “allelic variant” refers to alternative forms of a gene or portions thereof. Alleles occupy the same locus or position on homologous chromosomes. When a subject has two identical alleles of a gene, the subject is said to be homozygous for that gene or allele. When a subject has two different alleles of a gene, the subject is said to be heterozygous for the gene. Alleles of a specific gene can differ from each other in a single nucleotide or several nucleotides, and can include substitutions, deletions and insertions of nucleotides. An allele of a gene also can be a form of a gene containing a mutation.

As used herein, species variants refer to variants in polypeptides among different species, including different mammalian species, such as mouse and human.

As used herein, a splice variant refers to a variant produced by differential processing of a primary transcript of genomic DNA that results in more than one type of mRNA.

As used herein, the term promoter means a portion of a gene containing DNA sequences that provide for the binding of RNA polymerase and initiation of transcription. Promoter sequences are commonly, but not always, found in the 5′ non-coding region of genes.

As used herein, isolated or purified polypeptide or protein or biologically-active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue from which the protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized. Preparations can be determined to be substantially free if they appear free of readily detectable impurities as determined by standard methods of analysis, such as thin layer chromatography (TLC), gel electrophoresis and high performance liquid chromatography (HPLC), used by those of skill in the art to assess such purity, or sufficiently pure such that further purification does not detectably alter the physical and chemical properties, such as enzymatic and biological activities, of the substance. Methods for purification of the compounds to produce substantially chemically pure compounds are known to those of skill in the art. A substantially chemically pure compound, however, can be a mixture of stereoisomers. In such instances, further purification might increase the specific activity of the compound.

The term substantially free of cellular material includes preparations of proteins in which the protein is separated from cellular components of the cells from which it is isolated or recombinantly-produced. In one embodiment, the term substantially free of cellular material includes preparations of protease proteins having less that about 30% (by dry weight) of non-protease proteins (also referred to herein as a contaminating protein), generally less than about 20% of non-protease proteins or 10% of non-protease proteins or less that about 5% of non-protease proteins. When the protease protein or active portion thereof is recombinantly produced, it also is substantially free of culture medium, i.e., culture medium represents less than about or at 20%, 10% or 5% of the volume of the protease protein preparation.

As used herein, the term substantially free of chemical precursors or other chemicals includes preparations of protease proteins in which the protein is separated from chemical precursors or other chemicals that are involved in the synthesis of the protein. The term includes preparations of protease proteins having less than about 30% (by dry weight) 20%, 10%, 5% or less of chemical precursors or non-protease chemicals or components.

As used herein, synthetic, with reference to, for example, a synthetic nucleic acid molecule or a synthetic gene or a synthetic peptide refers to a nucleic acid molecule or polypeptide molecule that is produced by recombinant methods and/or by chemical synthesis methods.

As used herein, production by recombinant means by using recombinant DNA methods means the use of the well known methods of molecular biology for expressing proteins encoded by cloned DNA.

As used herein, vector (or plasmid) refers to discrete elements that are used to introduce a heterologous nucleic acid into cells for either expression or replication thereof. The vectors typically remain episomal, but can be designed to effect integration of a gene or portion thereof into a chromosome of the genome. Also contemplated are vectors that are artificial chromosomes, such as yeast artificial chromosomes and mammalian artificial chromosomes. Selection and use of such vehicles are well known to those of skill in the art.

As used herein, an expression vector includes vectors capable of expressing DNA that is operatively linked with regulatory sequences, such as promoter regions, that are capable of effecting expression of such DNA fragments. Such additional segments can include promoter and terminator sequences, and optionally can include one or more origins of replication, one or more selectable markers, an enhancer, a polyadenylation signal, and the like. Expression vectors are generally derived from plasmid or viral DNA, or can contain elements of both. Thus, an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, a phage, recombinant virus or other vector that, upon introduction into an appropriate host cell, results in expression of the cloned DNA. Appropriate expression vectors are well known to those of skill in the art and include those that are replicable in eukaryotic cells and/or prokaryotic cells and those that remain episomal or those which integrate into the host cell genome.

As used herein, vector also includes “virus vectors” or “viral vectors.” Viral vectors are engineered viruses that are operatively linked to exogenous genes to transfer (as vehicles or shuttles) the exogenous genes into cells.

As used herein, operably or operatively linked when referring to DNA segments means that the segments are arranged so that they function in concert for their intended purposes, e.g., transcription initiates in the promoter and proceeds through the coding segment to the terminator.

As used herein, biological sample refers to any sample obtained from a living or viral source and includes any cell type or tissue of a subject from which nucleic acid or protein or other macromolecule can be obtained. Biological samples include, but are not limited to, body fluids, such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine and sweat, tissue and organ samples from animals and plants. Also included are soil and water samples and other environmental samples, viruses, bacteria, fungi, algae, protozoa and components thereof. Hence bacterial and viral and other contamination of food products and environments can be assessed. The methods herein are practiced using biological samples and in some embodiments, such as for profiling, also can be used for testing any sample.

As used herein, macromolecule refers to any molecule having a molecular weight from the hundreds up to the millions. Macromolecules include peptides, proteins, nucleotides, nucleic acids, and other such molecules that are generally synthesized by biological organisms, but can be prepared synthetically or using recombinant molecular biology methods.

As used herein, a composition refers to any mixture. It can be a solution, a suspension, liquid, powder, a paste, aqueous, non-aqueous or any combination thereof.

As used herein, a combination refers to any association between or among two or more items. The combination can be two or more separate items, such as two compositions or two collections, can be a mixture thereof, such as a single mixture of the two or more items, or any variation thereof.

As used herein, kit refers to a packaged combination, optionally including instructions and/or reagents for their use.

As used herein, a pharmaceutical effect or therapeutic effect refers to an effect observed upon administration of an agent intended for treatment of a disease or disorder or for amelioration of the symptoms thereof.

As used herein, “disease or disorder” refers to a pathological condition in an organism resulting from cause or condition including, but not limited to, infections, acquired conditions, genetic conditions, and characterized by identifiable symptoms. Diseases and disorders of interest herein are those involving a specific target protein including those mediated by a target protein and those in which a target protein plays a role in the etiology or pathology. Exemplary target proteins and associated diseases and disorders are described elsewhere herein.

As used herein, angiogenic diseases (or angiogenesis-related diseases) are diseases in which the balance of angiogenesis is altered or the timing thereof is altered. Angiogenic diseases include those in which an alteration of angiogenesis, such as undesirable vascularization, occurs. Such diseases include, but are not limited to cell proliferative disorders, including cancers, diabetic retinopathies and other diabetic complications, inflammatory diseases, endometriosis, age-related macular degeneration and other diseases in which excessive vascularization is part of the disease process, including those known in the art or noted elsewhere herein.

As used herein, “treating” a subject with a disease or condition means that the subject's symptoms are partially or totally alleviated, or remain static following treatment.

Hence treatment encompasses prophylaxis, therapy and/or cure. Prophylaxis refers to prevention of a potential disease and/or a prevention of worsening of symptoms or progression of a disease. Treatment also encompasses any pharmaceutical use of a modified interferon and compositions provided herein.

As used herein, a therapeutic agent, therapeutic regimen, radioprotectant, or chemotherapeutic mean conventional drugs and drug therapies, including vaccines, which are known to those skilled in the art. Radiotherapeutic agents are well known in the art.

As used herein, treatment means any manner in which the symptoms of a condition, disorder or disease or other indication, are ameliorated or otherwise beneficially altered.

As used herein therapeutic effect means an effect resulting from treatment of a subject that alters, typically improves or ameliorates the symptoms of a disease or condition or that cures a disease or condition. A therapeutically effective amount refers to the amount of a composition, molecule or compound which results in a therapeutic effect following administration to a subject.

As used herein, the term “subject” refers to an animal, including a mammal, such as a human being.

As used herein, a patient refers to a human subject.

As used herein, amelioration of the symptoms of a particular disease or disorder by a treatment, such as by administration of a pharmaceutical composition or other therapeutic, refers to any lessening, whether permanent or temporary, lasting or transient, of the symptoms that can be attributed to or associated with administration of the composition or therapeutic.

As used herein, prevention or prophylaxis refers to methods in which the risk of developing disease or condition is reduced.

As used herein, an effective amount is the quantity of a therapeutic agent necessary for preventing, curing, ameliorating, arresting or partially arresting a symptom of a disease or disorder.

As used herein, administration refers to any method in which an antibody or protion thereof is contacted with its target protein. Administration can be effected in vivo or ex vivo or in vitro. For example, for ex vivo administration a body fluid, such as blood, is removed from a subject and contacted outside the body with the antibody or portion thereof. For in vivo administration, the antibody or portion thereof can be introduced into the body, such as by local, topical, systemic and/or other route of introduction. In vitro administration encompasses methods, such as cell culture methods.

As used herein, unit dose form refers to physically discrete units suitable for human and animal subjects and packaged individually as is known in the art.

As used herein, a single dosage formulation refers to a formulation for direct administration.

As used herein, an “article of manufacture” is a product that is made and sold. As used throughout this application, the term is intended to encompass compiled germline antibodies or antibodies obtained therefrom contained in articles of packaging.

As used herein, fluid refers to any composition that can flow. Fluids thus encompass compositions that are in the form of semi-solids, pastes, solutions, aqueous mixtures, gels, lotions, creams and other such compositions.

As used herein, animal includes any animal, such as, but are not limited to primates including humans, gorillas and monkeys; rodents, such as mice and rats; fowl, such as chickens; ruminants, such as goats, cows, deer, sheep; mammals, such as pigs and other animals. Non-human animals exclude humans as the contemplated animal. The germline segments, and resulting antibodies, provided herein are from any source, animal, plant, prokaryotic and fungal. Most germline segments, and resulting antibodies, are of animal origin, including mammalian origin.

As used herein, a control refers to a sample that is substantially identical to the test sample, except that it is not treated with a test parameter, or, if it is a sample plasma sample, it can be from a normal volunteer not affected with the condition of interest. A control also can be an internal control.

As used herein, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to compound, comprising “an extracellular domain” includes compounds with one or a plurality of extracellular domains.

As used herein, ranges and amounts can be expressed as “about” a particular value or range. About also includes the exact amount. Hence “about 5 bases” means “about 5 bases” and also “5 bases.”

As used herein, “optional” or “optionally” means that the subsequently described event or circumstance does or does not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not. For example, an optionally substituted group means that the group is unsubstituted or is substituted.

As used herein, the abbreviations for any protective groups, amino acids and other compounds, are, unless indicated otherwise, in accord with their common usage, recognized abbreviations, or the IUPAC-IUB Commission on Biochemical Nomenclature (see, (1972) Biochem. 11:1726).

B. OVERVIEW OF METHODS

Provided herein are methods of selecting antibodies with desired affinities and activities. The methods include affinity maturation and antibody conversion methods. The methods can be used to engineer antibodies to thereby identify or select antibodies that are antagonist antibodies, partial antagonist antibodies, agonist antibodies and/or activator/modulator antibodies. The ability to “tune” a particular pathway as opposed to completely inhibiting it would be an advantage for protein therapeutics. For example, pharmacologically, the ability to turn a pathway “on” or “off” by a high affinity interaction, might be less desirable than modulation of a pathway through “rheostat” based therapeutics. In other examples, an antibody with a high affinity is desired.

The resulting affinity-based or activity-based antibodies generated by practice of the methods can be used for any application or purpose as desired, including for example, in a variety of in vitro and in vivo applications by virtue of their specificity for one or more target proteins. Because of their diversity, specificity and effector functions, antibodies are attractive candidates for protein-based therapeutics. Accordingly, the methods provided herein for generating antibodies with desired affinities, specificities and/or activities permits their use as therapeutic antibodies. For example, the antibodies can be used in methods of treatment and other uses for treating a disease or disorder which is associated with expression or activation of a particular target protein, for which the antibody can modulate.

1. Antibody Polypeptides

In the methods provided herein, mutagenesis is typically performed on the variable region of the antibody. Accordingly, the parent antibody selected for affinity conversion or affinity maturation using the methods provided herein typically minimally include all or a portion of a variable heavy chain (VH) and/or a variable light (VL) chain so long as the antibody contains a sufficient antibody binding site. It is understood, however, that any antibody used or obtained by practice of the methods can be generated to include all or a portion of the constant heavy chain (e.g. one or more CH domains such as CH1, CH2, CH3 and CH4 and/or a constant light chain (CL)). Hence, the antibodies subjected to affinity conversion or affinity maturation herein include those that are full-length antibodies, and also include fragments or portions thereof including, for example, Fab, Fab′, F(ab′)2, single-chain Fvs (scFv), Fv, dsFv, diabody, Fd and Fd′ fragments, Fab fragments, scFv fragments, and scFab fragments. For example, antibodies affinity converted or affinity matured herein include Fabs.

A skilled artisan understands the structure, sequence and function of antibodies. A general description of the structure, sequence and function of antibodies is provided below.

a. Antibody Structure and Function

Antibodies are produced naturally by B cells in membrane-bound and secreted forms. In addition to naturally produced antibodies, antibodies also include synthetically, i.e. recombinantly, produced antibodies, such as antibody fragments. Antibodies specifically recognize and bind antigen epitopes through cognate interactions. Antibody binding to cognate antigens can initiate multiple effector functions, which cause neutralization and clearance of toxins, pathogens and other infectious agents. Diversity in antibody specificity arises naturally due to recombination events during B cell development. Through these events, various combinations of multiple antibody V, D and J gene segments, which encode variable regions of antibody molecules, are joined with constant region genes to generate a natural antibody repertoire with large numbers of diverse antibodies. A human antibody repertoire contains more than 1010 different antigen specificities and thus theoretically can specifically recognize any foreign antigen.

A full-length antibody contains four polypeptide chains, two identical heavy (H) chains (each usually containing about 440 amino acids) and two identical light (L) chains (each containing about 220 amino acids). The light chains exist in two distinct forms called kappa (κ) and lambda (λ). Each chain is organized into a series of domains organized as immunoglobulin (Ig) domains, including variable (V) and constant (C) region domains. Light chains have two domains, corresponding to the C region (CL) and the V region (VL). Heavy chains have four domains, the V region (VH) and three or four domains in the C region (CH1, CH2, CH3 and CH4), and, in some cases, hinge region. The four chains (two heavy and two light) are held together by a combination of covalent (disulfide) and non-covalent bonds.

Antibodies include those that are full-lengths and those that are fragments thereof, namely Fab, Fab′, F(ab′)2, single-chain Fvs (scFv), Fv, dsFv, diabody, Fd and Fd′ fragments. The fragments include those that are in single-chain or dimeric form. The Fv fragment, which contains only the VH and VL domain, is the smallest immunoglobulin fragment that retains the whole antigen-binding site (see, for example, Methods in Molecular Biology, Vol 207: Recombinant Antibodies for Cancer Therapy Methods and Protocols (2003); Chapter 1; p 3-25, Kipriyanov). Stabilization of Fv are achieved by direct linkage of the VH and VL chains, such as for example, by linkage with peptides (to generate single-chain Fvs (scFv)), disulfide bridges or knob-into-hole mutations. Fab fragments, in contrast, are stable because of the presence of the CH1 and CL domains that hold together the variable chains. Fd antibodies, which contain only the VH domain, lack a complete antigen-binding site and can be insoluble.

In folded antibody polypeptides, binding specificity is conferred by antigen binding site domains, which contain portions of heavy and/or light chain variable region domains. Other domains on the antibody molecule serve effector functions by participating in events such as signal transduction and interaction with other cells, polypeptides and biomolecules. These effector functions cause neutralization and/or clearance of the infecting agent recognized by the antibody.

b. Antibody Sequence and Specificity

The variable region of the heavy and light chains are encoded by multiple germline gene segments separated by non-coding regions, or introns, and often are present on different chromosomes. During B cell differentiation germline DNA is rearranged whereby one and one JH gene segment of the heavy chain locus are recombined, which is followed by the joining of one VH gene segment forming a rearranged VDJ gene that encodes a VH chain. The rearrangement occurs only on a single heavy chain allele by the process of allelic exclusion. Allelic exclusion is regulated by in-frame or “productive” recombination of the VDJ segments, which occurs in only about one-third of VDJ recombinations of the variable heavy chain. When such productive recombination events first occur in a cell, this results in production of a μ90 heavy chain that gets expressed on the surface of a pre-B cell and transmits a signal to shut off further heavy chain recombination, thereby preventing expression of the allelic heavy chain locus. The surface-expressed μ heavy chain also acts to activate the kappa (κ) locus for rearrangement. The lambda (λ) locus is only activated for rearrangement if the κ recombination is unproductive on both loci. The light chain rearrangement events are similar to heavy chain, except that only the VL and JL segments are recombined. Before primary transcription of each, the corresponding constant chain gene is added. Subsequent transcription and RNA splicing leads to mRNA that is translated into an intact light chain or heavy chain.

The variable regions of antibodies confer antigen binding and specificity due to recombination events of individual germline V, D and J segments, whereby the resulting recombined nucleic acid sequences encoding the variable region domains differ among antibodies and confer antigen-specificity to a particular antibody. The variation, however, is limited to three complementarity determining regions (CDR1, CDR2, and CDR3) found within the N-terminal domain of the heavy (H) and (L) chain variable regions. The CDRs are interspersed with regions that are more conserved, termed “framework regions” (FR). The extent of the framework region and CDRs has been precisely defined (see e.g., Kabat, E. A. et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242, and Chothia, C. et al. (1987) J. Mol. Biol. 196:901-917). Each VH and VL is typically composed of three CDRs and four FRs arranged from the amino terminus to carboxy terminus in the following order: FR1 CDR1, FR2, CDR2, FR3, CDR3 and FR4. Sequence variability among VL and VH domains is generally limited to the CDRs, which are the regions that form the antigen binding site. For example, for the heavy chain, generally, VH genes encode the N-terminal three framework regions, the first two complete CDRs and the first part of the third CDR; the DH gene encodes the central portion of the third CDR, and the JH gene encodes the last part of the third CDR and the fourth framework region. For the light chain, the VL genes encode the first CDR and second CDR. The third CDR (CDRL3) is formed by the joining of the VL and JL gene segments. Hence, CDRs 1 and 2 are exclusively encoded by germline V gene segment sequences. The VH and VL chain CDR3s form the center of the Ag-binding site, while CDRs 1 and 2 form the outside boundaries; the FRs support the scaffold by orienting the H and L CDRs. On average, an antigen binding site typically requires that at least four of the CDRs make contact with the antigen's epitope, with CDR3 of both the heavy and light chain being the most variable and contributing the most specificity to antigen binding (see e.g., Janis Kuby, Immunology, Third Edition, New York, W.H. Freeman and Company, 1998, pp. 115-118). CDRH3, which includes all of the D gene segment, is the most diverse component of the Ab-binding site, and typically plays a critical role in defining the specificity of the Ab. In addition to sequence variation, there is variation in the length of the CDRs between the heavy and light chains

The constant regions, on the other hand, are encoded by sequences that are more conserved among antibodies. These domains confer functional properties to antibodies, for example, the ability to interact with cells of the immune system and serum proteins in order to cause clearance of infectious agents. Different classes of antibodies, for example IgM, IgD, IgG, IgE and IgA, have different constant regions, allowing them to serve distinct effector functions.

These natural recombination events of V, D, and J, can provide nearly 2×107 different antibodies with both high affinity and specificity. Additional diversity is introduced by nucleotide insertions and deletions in the joining segments and also by somatic hypermutation of V regions. The result is that there are approximately 1010 antibodies present in an individual with differing antigen specificities.

2. Methods of Identifying Antibodies

Antibodies can be identified that have a binding specificity and/or activity against a target protein or antigen by any method known to one of skill in the art. For example, antibodies can be generated against a target antigen by conventional immunization methods resulting in the generation of hybridoma cells secreting the antibody (see e.g. Kohler et al. (1975) Nature, 256:495; Goding, Monoclonal Antibodies: Principles and Practice, pp. 59-103 (Macademic Press, 1986), Kozbor, J. Immunol., (1984) 133:3001; Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc., New York, 1987). In another method, antibodies specific for a target antigen are identified by screening antibody libraries for the desired binding or activity. Antibody libraries can be provided as “one-pot” libraries containing a diverse population of antibody members, for example, as display libraries such as phage display libraries. In such libraries, the identity of each member of the library is typically unknown preceding sequencing of a positive clone with a desired binding activity.

In other examples, antibody libraries include addressable combinatorial antibody libraries as described in U.S. Provisional Application Nos. 61/198,764 and 61/211,204, and published International PCT Appl. No. WO2010054007, incorporated by reference herein. In the addressable libaries, the nucleic acid molecules encoding each VH chain and/or VL chain are individually synthesized, using standard DNA synthesis techniques, in an addressable format, whereby the identity of the nucleic acid sequence of each VH chain and/or VL chain in each locus is known. VH chains and VL chains are then paired, also in an addressable format, such that the identity of each member of the library is known based on its locus or “address”. The addressable combinatorial antibody libraries can be screened for binding or activity against a target protein to identify antibodies or portions thereof that bind to a target protein and/or modulate an activity of a target protein. By virtue of the fact that these libraries are arrayed, the identity of each individual member in the collection is known during screening, thereby allowing facile comparison of “Hit” antibody.

3. Existing Methods of Optimizing Antibodies

Typically, the antibodies generated and/or identified by any of the above methods are of moderate affinity (e.g. Kd−1 of about 106 to 107 M−1). As discussed herein, existing methods of antibody discovery and engineering seek high-affinity antagonist antibodies. Thus, methods of affinity maturation to optimize and improve the binding affinity are employed to further optimize the antibody. An affinity matured antibody generally is one that contains one or more amino acid alterations that result in improvement of an activity, such as antigen binding affinity. Known method for affinity maturing and antibody include, for example, generating and screening antibody libraries using the previously identified antibody as a template by introducing mutations at random in vitro by using error-prone PCR (Zhou et al., Nucleic Acids Research (1991) 19(21):6052; and US2004/0110294); randomly mutating one or more CDRs or FRs (see e.g., WO 96/07754; Barbas et al. (1994) Proc. Natl. Acad. Sci., 91:3809-3813; Cumbers et al. (2002) Nat. Biotechnol., 20:1129-1134; Hawkins et al. (1992) J. Mol. Biol., 226:889-896; Jackson et al., (1995) J. Immunol., 154:3310-3319; Wu et al. (1998) Proc. Natl. Acad. Sci., 95: 6037-6042; McCall et al. (1999) Molecular Immunology, 36:433-445); oligonucleotide directed mutagenesis (Rosok et al., The Journal of Immunology, (1998) 160:2353-2359); codon cassette mutagenesis (Kegler-Ebo et al., Nucleic Acids Research, (1994) 22(9):1593-1599); degenerate primer PCR, including two-step PCR and overlap PCR (U.S. Pat. Nos. 5,545,142, 6,248,516, and 7,189,841; Higuchi et al., Nucleic Acids Research (1988); 16(15):7351-7367; and Dubreuil et al., The Journal of Biological Chemistry (2005) 280(26):24880-24887); domain shuffling by recombining the VH or VL domains selected by phage display with repertoires of naturally occurring V domain variants obtained from unimmunized donors and screening for higher affinity in several rounds of chain reshuffling as described in Marks et al., Biotechnology, 10: 779-783 (1992).

Each of the available approaches for optimizing antibodies has limitations. First, the approaches fail to recognize that antibodies with low affinity are candidate therapeutics acting as agonists, partial agonist/antagonists or activator/modulators. Where generating a high affinity antibody is desired, for example to generate an antagonist antibody, the existing affinity maturation approaches also are limited. For example, many available approaches carry the risk of introducing unwanted mutations (e.g. mutations at undesired positions) and/or biases against selection of particular mutants. Limitations in library size and completeness exist, since it is unfeasible to generate all possible combinations of mutants. Additionally, competition must be avoided to prevent abundant low-affinity variants from excluding rarer high-affinity variants. In addition, many of the affinity matured antibodies are produced either by VH and VL domain shuffling or by random mutagenesis of CDR and/or framework residues. These methods, however, require some type of displayed selection because of the vast number of clones to be evaluated. Finally, very high affinity antibodies are difficult to isolate by panning, since the elution conditions required to break a very strong antibody-antigen interaction are generally harsh enough (e.g., low pH, high salt) to denature the phage particle sufficiently to render it non-infective.

The methods provided herein overcome some or all of these limitations.

C. METHOD FOR AFFINITY MATURATION OF ANTIBODIES

Provided herein is a rational method for affinity maturation of an antibody to improve its activity towards a target antigen based on the structure/activity relationship (SAR) of the antibody that is being affinity matured. The SAR can be used to identify a region or regions or particular amino acid residues in the antibody that are important for its activity (e.g. binding to a target antigen). For example, in the method, knowledge of the structure (e.g. sequence) of a “Hit” or parent antibody to be affinity matured is correlated to an activity (e.g. binding) for a target antigen. Such knowledge can be used to elucidate the region and/or amino acid residues that are involved in the activity toward the target antigen. The region(s) or amino acid residues are targeted for further mutagenesis. Thus, the SAR information provides guidance for further optimization by providing rational identification of region(s) of the antibody polypeptides to be mutagenized. The resulting mutant antibodies can be screened to identify those antibodies that are optimized compared to the starting or reference antibody.

In the methods provided herein, affinity maturation of a “Hit” or parent antibody is based on its structure-affinity/activity-relationship. Thus, the method is a rational and targeted mutagenesis approach with much smaller libraries guided by SARs to identify regions and residues that modulate activity.

The SAR of an antibody can be determined by various approaches. For example, SAR can be determined by comparing the sequence of an antibody that has a desired activity for a target antigen to a related antibody that has reduced activity for the same target antigen to identify those amino acid residues that differ between the antibodies. The region of the antibody that exhibits amino acid differences is identified as a structure that is important in the activity of the antibody, and is targeted for further mutagenesis.

In particular, the SAR can be quickly elucidated using a spatially addressed combinatorial antibody library as described in U.S. Provisional Application No. 61/198,764 and U.S. Provisional Application No. 61/211,204; and in published International PCT Appl. No. WO2010054007. In the spatially addressed format, activities and binding affinities can be correlated to structure (e.g. sequence) coincident with a screening assay, since the sequences of addressed members are known a priori. In the spatially addressed format, the binding affinities of the hit versus nearby non-hit antibody can be compared in sequence space because their sequence identities are known a priori. Comparisons of sequence can be made between “Hits” and related antibodies that have less activity or no activity in the same assay. Such comparisons can reveal SARs and identify important regions or amino acid residues involved in the activity of the antibody. For example, such comparisons can reveal SARs of important CDRs and potentially important residues within the CDRs for binding the target. SAR also can be determined using other methods that identify regions of an antibody or amino acid residues therein that contribute to the activity of an antibody. For example, mutagenesis methods, for example, scanning mutagenesis, can be used to determine SAR.

The rational approach described herein facilitates identifying SARs that aid in the optimization of preliminary hits, mimicking the approach used in small molecule medicinal chemistry. This has advantages over existing methods of affinity maturation. Currently many of the in vitro affinity matured antibodies are produced either by VH and VL domain shuffling or by random mutagenesis of CDR and/or framework residues. Many of these methods, however, require some type of displayed selection because of the vast number of clones to be evaluated. In the method herein, a more rational and targeted mutagenesis approach is employed, using much smaller libraries guided by SARs and scanning mutagenesis to identify regions and residues that modulate affinity. True SARs can be identified because active hits can be compared with related, but less active or inactive antibodies present in the library. In addition, the methods herein can be practiced to avoid generating simultaneous mutations to circumvent exponential expansion of the library size. For example, for a given CDR or target region, one the best substitution is identified in each of the mutated positions, the mutations can be combined in a new antibody in order to generate further improvement in activity. In one example, binding affinity is increased. The increase in affinity, measured as a decrease in Kd, can be achieved through either an increase in association rate (kon), a reduction in dissociation rate (koff), or both.

In one aspect of the method, residues to mutagenize in the “Hit” antibody are identified by comparison of the amino acid sequence of the variable heavy or light chain of the “Hit” antibody with a respective variable heavy or light chain of a related antibody that exhibits reduced activity for the target antigen compared to the Hit antibody that is being affinity matured. In some examples, the related antibody is a non-Hit antibody that exhibits significantly less activity towards the target antigen than the Hit antibody, such as less than 80% of the activity, generally less than 50% of the activity, for example 5% to 50% of the activity, such as 50%, 40%, 30%, 20%, 10%, 5% or less the activity. For example, a no-Hit antibody can be one that exhibits no detectable activity or shows only negligible activity towards the target antigen. In practicing the method, a requisite level of relatedness between the “Hit” and a related antibody is required in order to permit rational analysis of the contributing regions to activity. This structure-affinity/activity relationship analysis between the “Hit” antibody and related antibodies reveals target regions of the antibody polypeptide that are important for activity.

In another aspect of the method provided herein, scanning mutagenesis can be used to reveal more explicit information about the structure/activity relationship of an antibody. In such a method, scanning mutagenesis is generally employed to identify residues to further mutate. Hence, scanning mutagenesis can be employed as the means to determine SAR. Alternatively or optionally, scanning mutagenesis can be used to in combination with the comparison method above. In such an example, once a target region is identified that is involved with an activity, scanning mutagenesis is used to further elucidate the role of individual amino acid residues in an activity in order to rationally select amino acid residues for mutagenesis. As discussed in detail below, in the scanning mutagenesis method herein only those scanned mutant residues that do not negatively impact the activity of the antibody (e.g. either preserve or increase an activity to the target antigen) are subjected to further mutagenesis by further mutating the scanned residue individually to other amino acids.

Once the SAR is determined, a target region containing residues important for activity are revealed in the variable heavy chain and/or variable light chain of an antibody. Once a target region is identified for either the variable heavy chain or light chain, mutagenesis of amino acid residues within the region is employed and mutants are screened for an activity towards the target antigen. In the methods herein, the mutagenized antibodies can be individually generated, such as by DNA synthesis or by recombinant DNA techniques, expressed, and assayed for their activity for a target antigen. By individually mutating each antibody, for example using cassette mutagenesis, simultaneous mutations can be avoided to avoid exponential expansion of the library. In addition, unwanted mutations can be avoided. In other examples, if desired, mutations can be effected by other mutagenesis approaches, for example by using various doping strategies, and the identity of the mutant identified upon screening and sequencing. Affinity maturation can be performed separately and independently on the variable heavy chain and variable light chain of a reference Hit antibody. The resulting affinity matured variable heavy and light chains can then be paired for further optimization of the antibody.

The affinity maturation method provided herein can be performed iteratively to further optimize binding affinity. For example, further optimization can be performed by mutagenesis and iterative screening of additional regions of the antibody polypeptide. At each step of the method, the affinity matured antibody can be tested for an activity (e.g. binding) to the target antigen. Antibodies are identified that have improved activity for the target antigen compared to the parent antibody or any intermediate antibody therefrom. Also, once the best substitutions in a region of an antibody are identified for improving an activity towards a target antigen, they can be combined to create a new antibody to further improve and optimize the antibodies activity. Such combination mutants can provide an additive improvement. Accordingly, the method of affinity maturation herein permits a rational optimization of antibody binding affinity

1. Comparision of Structure and Activity

Provided herein is a method of affinity maturation based on the SAR of a Hit antibody by comparison of its structure and activity to a related antibody. In practicing the method, the amino acid sequence of the heavy chain and/or light chain of a “Hit” antibody is compared to the corresponding sequence of a related antibody that exhibits reduced or less activity for the target antigen compared to the “Hit” antibody. As discussed below, for purposes of practice of the method herein, the related antibody is sufficiently related in sequence to the “Hit” antibody in order to limit regions of the primary sequences that exhibit amino acid differences between the “Hit” and related antibody when compared (e.g. by sequence alignment). Thus, the method permits identification of a region of the “Hit” antibody that is involved in an activity to the target antigen. For example, alignment of the primary sequence (e.g. variable heavy chain and/or variable light chain) of the “Hit” and related antibody can identify one or more regions where amino acid differences exist between the “Hit” and the related antibody. The region(s) can be one or more of CDR1, CDR2 or CDR3 and/or can be amino acid residues within the framework regions of the antibody (e.g. FR1, FR2, FR3 or FR4). A region of the antibody that exhibits at least one amino acid difference compared to the corresponding region in the related antibody is a target region targeted for further mutagenesis.

In the method, mutagenesis to any other amino acid or to a subset of amino acids is performed on amino acid residues within the identified target region. For example, some or up to all amino acid residues of the selected region in the heavy chain and/or light chain of the “Hit” antibody are mutated, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acid residues. Each amino acid residue selected for mutagenesis can be mutated to all 19 other amino acid residues, or to a restricted subset thereof. The resulting mutant antibodies are screened for activity to the target antigen as compared to the starting “Hit” antibody. As discussed below, in some examples, prior to mutagenesis of individual amino acid residues, scanning-mutagenesis of all or select amino acid residues within the target region can be used to identify particular residues for mutagenesis. The subset of identifed residues are then subjected to mutagenesis to improve or optimize an activity towards the target antigen.

Typically, the method is performed on the variable heavy chain and/or variable light chain of the antibody. Typically, affinity maturation is separately performed for one or both of the heavy and/or light chain(s) of the “Hit” antibody independently of the other. The heavy and light chains can be affinity matured independently such as sequentially in any order. Alternatively, the heavy and light chain are subjected to affinity maturation in parallel. Mutant DNA molecules encoding the variable heavy chain and/or variable light chain are designed, generated by mutagenesis and cloned. In some examples, the modified variable heavy and light chains can be synthetically generated or generated by other recombinant means. Various combinations of heavy and light chains can be paired to generate libraries of variant antibodies. The resulting antibodies or fragments thereof are tested for an activity to the target antigen. Antibodies exhibiting an optimized or improved binding affinity as compared to the starting “Hit” antibody are selected.

Iterative screening can be performed to further optimize an activity to the target antigen. For example, mutations that increase an activity to the target antigen within a variable heavy or light chain can be combined, thereby creating an antibody that has an improved activity as compared to the starting “Hit” antibody and/or intermediate single mutant antibodies. Also, pairing of an affinity matured heavy chain with an affinity matured light chain can further optimize and improve the activity of resulting antibodies produced by practice of the method. Further, mutagenesis, e.g. scanning mutagenesis or full or partial saturation mutagenesis, of amino acid residues in one or more additional regions of the variable heavy or light chain can be performed to identify further mutations that further optimize an activity to the target antigen.

At any step in the method, the affinity matured antibodies can be further evaluated for activity. Any activity can be assessed, such as any exemplified in Section E herein. In one example, binding is assessed. Any method known to one of skill in the art can be used to measure the binding or binding affinity of an antibody. In one example, binding affinity is determined using surface Plasmon resonance (SPR). In another example, binding affinity is determined by dose response using ELISA. The resulting antibodies also can be tested for a functional activity as discussed elsewhere herein.

The resulting affinity matured antibodies are selected to have improved and/or optimized activity towards a target antigen compared to the parent “Hit” antibody. By practice of the method, the activity of an antibody for a target antigen can be improved at least 1.5-fold, generally at least 2-fold, for example at least 2-fold to 10000-fold, such as at least 2-fold, 5-fold, 10-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700-fold, 800-fold, 900-fold, 1000-fold, 2000-fold, 3000-fold, 4000-fold, 5000-fold, 10000-fold or more. For example, the affinity matured antibodies generated by practice of the method can have a binding affinity for a target antigen that is improved, for example, that is or is about 1 1×10−9 M to 1×10−11M, generally 5×10−9 M to 5×1010 M, such as at or about 1×10−9 M, 2×10−9 M, 3×10−9 M, 4×10−9 M, 5×10−9 M, 6×10−9 M, 7×10−9 M, 8×10−9 M, 9×10−9 M, 1×10−10 M, 2×1010 M, 3×10−10 M, 4×10−10 M, 5×10−10 M, 6×10−10 M, 7×10−10 M, 8×10−10 M, 9×10−10 M or less.

A summary of the steps of the method is set forth in FIG. 1. A detailed description of each step of the method is provided below. It is understood that the steps of the affinity maturation method provided herein are the same whether the method is performed on the variable heavy chain or variable light chain sequence of an antibody. Hence, for purposes herein, the description below applies to practice of the method on either one or both of the heavy and light chain sequences, unless explicitly stated otherwise. As discussed elsewhere herein, typically, affinity maturation is performed for one or both of the heavy and/or light chain(s) of the antibody independently of the other. If desired, an affinity matured heavy chain can be paired with an affinity matured light chain to further optimize or improve activity of the antibody.

a. Selection of a First Antibody for Affinity Maturation

The antibody chosen to be affinity matured is any antibody that is known in the art or identified as having an activity for a target antigen or antigens. For example, the antibody can be a “Hit” antibody, such as one identified in a screening assay. Generally, the antibody is an antibody that exhibits an activity for a target antigen such that it not ideal for use as a therapeutic because its affinity is not sufficiently high or such that improvement of its activity is achievable or desirable. For example, an antibody chosen for affinity maturation typically has a binding affinity for the target antigen that is at or about 10−5 M to 10−8 M, for example that is at or about 10−5 M, 10−6 M, M, 10−8 M, or lower. Generally, an antibody selected for affinity maturation specifically binds to the target antigen. Assays to assess activity of an antibody for a target antigen are known in the art. Exemplary assays are provided in Section E.

Thus, the first antibody is an antibody that is known to have an activity to a target antigen. The target antigen can be a polypeptide, carbohydrate, lipid, nucleic acid or a small molecule (e.g. neurotransmitter). The antibody can exhibit activity for the antigen expressed on the surface of a virus, bacterial, tumor or other cell, or exhibits an activity (e.g. binding) for the purified antigen. Typically, the target antigen is a purified protein or peptide, including, for example, a recombinant protein.

Generally, the target antigen is a protein that is a target for a therapeutic intervention. Exemplary target antigens include, but are not limited to, targets involved in cell proliferation and differentiation, cell migration, apoptosis and angiogenesis. Such targets include, but are not limited to, growth factors, cytokines, lymphocytic antigens, other cellular activators and receptors thereof. Exemplary of such targets include, membrane bound receptors, such as cell surface receptors, including, but are not limited to, a VEGFR-1, VEGFR-2, VEGFR-3 (vascular endothelial growth factor receptors 1, 2, and 3), a epidermal growth factor receptor (EGFR), ErbB-2, ErbB-b3, IGF-R1, C-Met (also known as hepatocyte growth factor receptor; HGFR), DLL4, DDR1 (discoidin domain receptor), KIT (receptor for c-kit), FGFR1, FGFR2, FGFR4 (fibroblast growth factor receptors 1, 2, and 4), RON (recepteur d'origine nantais; also known as macrophage stimulating 1 receptor), TEK (endothelial-specific receptor tyrosine kinase), TIE (tyrosine kinase with immunoglobulin and epidermal growth factor homology domains receptor), CSF1R (colony stimulating factor 1 receptor), PDGFRB (platelet-derived growth factor receptor B), EPHA1, EPHA2, EPHB1 (erythropoietin-producing hepatocellular receptor A1, A2 and B1), TNF-R1, TNF-R2, HVEM, LT-βR, CD20, CD3, CD25, NOTCH, G-CSF-R, GM-CSF-R and EPO-R. Other targets include membrane-bound proteins such as selected from among a cadherin, integrin, CD52 or CD44. Exemplary ligands that can be targets of the screening methods herein, include, but are not limited to, VEGF-A, VEGF-B, VEGF-C, VEGF-D, PIGF, EGF, HGF, TNF-α, LIGHT, BTLA, lymphotoxin (LT), IgE, G-CSF, GM-CSF and EPO. In some examples, the “Hit” antibody can bind to one or more antigens. For example, as exemplified in Example 1, “Hit” antibodies have been identified that binds to only one target antigen, e.g., DLL4, or that bind to two or more different target antigens, e.g., P-cadherin and erythropoietin (EPO).

In practicing the method provided herein, typically only the variable heavy chain and/or variable light chain of the antibody is affinity matured. Thus, the antibody that is chosen typically contains a variable heavy chain and a variable light chain, or portion thereof sufficient to form an antigen binding site. It is understood, however, that the antibody also can include all or a portion of the constant heavy chain (e.g. one or more CH domains, such as CH1, CH2, CH3 and CH4, and/or a constant light chain (CL)). Hence, the antibody can include those that are full-length antibodies, and also include fragments or portions thereof including, for example, Fab, Fab′, F(ab′)2, single-chain Fvs (scFv), Fv, dsFv, diabody, Fd and Fd′ fragments, Fab fragments, scFv fragments, and scFab fragments. For example, affinity maturation of antibodies exemplified in the examples herein are Fabs. It is understood that once the antibody is affinity matured as provided herein, the resulting antibody can be produced as a full-length antibody or a fragment thereof, such as a Fab, Fab′, F(ab′)2, single-chain Fvs (scFv), Fv, dsFv, diabody, Fd and Fd′ fragments, Fab fragments, scFv fragments, and scFab fragments. Further, the constant region of any isotype can be used in the generation of full or partial antibody fragments, including IgG, IgM, IgA, IgD and IgE constant regions. Such constant regions can be obtained from any human or animal species. It is understood that activities and binding affinities can differ depending on the structure of an antibody. For example, generally a bivalent antibody, for example a bivalent F(ab′)2 fragment or full-length IgG, has a better binding affinity then a monovalent Fab antibody. As a result, where a Fab has a specified binding affinity for a particular target, it is excepted that the binding affinity is even greater for a full-length IgG that is bivalent. Thus, comparison of binding affinities between a first antibody and an affinity matured antibody are typically made between antibodies that have the same structure, e.g. Fab compared to Fab.

An antibody for affinity maturation can include an existing antibody known to one of skill in the art. In other examples, an antibody is generated or identified empirically depending on a desired target. For example, an antibody can be generated using conventional immunization and hybridoma screening methods. In other examples, an antibody is identified by any of a variety of screening methods known to one of skill in the art.

i. Immunization and Hybridoma Screening

Antibodies specific for a target antigen can be made using the hybridoma method first described by Kohler et al. (1975) Nature, 256:495, or made by recombinant DNA methods (U.S. Pat. No. 4,816,567).

In the hybridoma method, a mouse or other appropriate host animal, such as a hamster, is immunized to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the protein used for immunization. Antibodies to a target antigen can be raised in animals by multiple subcutaneous (sc) or intraperitoneal (ip) injections of protein antigen and an adjuvant. Two weeks later, animals are boosted. 7 to 14 days later animals are bled and the serum is assayed for antibody titer specific for the target antigen. Animals are boosted until titers plateau.

Alternatively, lymphocytes can be immunized in vitro. Lymphocytes then are fused with myeloma cells using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell (Goding, Monoclonal Antibodies: Principles and Practice, pp. 59-103 (Academic Press, 1986)).

The hybridoma cells that are prepared are seeded and grown in a suitable culture medium that contains one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells. For example, if the parental myeloma cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine (HAT medium), which substances prevent the growth of HGPRT-deficient cells.

Myeloma cells include those that fuse efficiently, support stable high-level production of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. Among myeloma cell lines are murine myeloma lines, such as those derived from MOPC-21 and MPC-11 mouse tumors available from the Salk Institute Cell Distribution Center, San Diego, Calif., USA, and SP-2 or X63-Ag8-653 cells available from the American Type Culture Collection (ATCC), Rockville, Md., USA. Human myeloma and mouse-human heterocyeloma cells lines also have been described for the production of human monoclonal antibodies (Kozbor, (1984) J. Immunol., 133:3001; and Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc., New York, 1987)).

Culture medium in which hybridoma cells are growing is assayed for production of monoclonal antibodies directed against the target antigen. The binding specificity of monoclonal antibodies produced by hybridoma cells can be determined by any method known to one of skill in the art (e.g. as described in Section E.1), for example, by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoadsorbent assay (ELISA). The binding affinity also can be determined, for example, using Scatchard analysis.

After hybridoma cells are identified that produce antibodies of the desired specificity, affinity, and/or activity, the clones can be subcloned by limiting dilution procedures and grown by standard methods (Goding, Monoclonal Antibodies: Principles and Practice, pp. 59-103 (Academic Press, 1986)). Suitable culture media for this purpose include, for example, D-MEM or RPMI-1640 medium. In addition, the hybridoma cells can be grown in vivo as ascites tumors in an animal.

The monoclonal antibodies secreted by the subclones are suitably separated from the culture medium, ascites fluid, or serum by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.

DNA-encoding the hybridoma-derived monoclonal antibody can be readily isolated and sequenced using conventional procedures. For example, sequencing can be effected using oligonucleotide primers designed to specifically amplify the heavy and light chain coding regions of interest from the hybridoma. Once isolated, the DNA can be placed into expression vectors, which are then transfected into host cells such as E. coli cells, simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein to obtain the synthesis of the desired monoclonal antibodies in the recombinant host cells.

ii. Screening Assays for Identification of a “Hit”

Antibodies that are affinity matured by the method herein can be identified by using combinatorial libraries to screen for synthetic antibody clones with the desired activity or activities. Antibodies with a desired activity can be selected as “Hits.” Such “Hit” antibodies can be further affinity matured to optimize the activity.

1) Display Libraries

Typical of screening methods are high throughput screening of antibody libraries. For example, antibody libraries are screened using a display technique, such that there is a physical link between the individual molecules of the library (phenotype) and the genetic information encoding them (genotype). These methods include, but are not limited to, cell display, including bacterial display, yeast display and mammalian display, phage display (Smith, G. P. (1985) Science 228:1315-1317), mRNA display, ribosome display and DNA display. Using display techniques, the identity of each of the individual antibodies is unknown prior to screening, but the phenotype-genotype link allows for facile identification of selected antibodies. Prior to practice of the method herein, the sequence of a “Hit” antibody is determined.

Typically, in the libraries, nucleic acids encoding antibody gene fragments are obtained from immune cells harvested from humans or animals. If a library biased in favor of an antigen-specific antibody is desired, the subject is immunized with the target antigen to generate an antibody response, and spleen cells and/or circulating B cells or other peripheral blood lymphocytes (PBLs) are recovered for library construction. Additional enrichment for antigen-specific antibody reactive cell populations can be obtained using a suitable screening procedure to isolate B cells expressing antigen-specific membrane bound antibody, e.g. by cell separation with antigen affinity chromatography or adsorption of cells to fluorochrome-labeled antigen followed by fluorescence-activated cell sorting (FACs).

Alternatively, the use of spleen cells and/or B cells or other PBLs from an unimmunized donor provides a better representation of the possible antibody repertoire, and also permits the construction of an antibody library using any animal (human or non-human) species in which the target antigen is not antigenic. For libraries incorporating in vitro antibody gene construction, stem cells are harvested from the subject to provide nucleic acids encoding unrearranged antibody gene segments. The immune cells of interest can be obtained from a variety of animal species, such as human, mouse, rat, lagomorpha, lupine, canine, feline, porcine, bovine, equine, and avian species.

Nucleic acid encoding antibody variable gene segments (including VH and VL segments) can be recovered from the cells of interest and amplified. In the case of rearranged VH and VL gene libraries, the desired DNA can be obtained by isolating genomic DNA or mRNA from lymphocytes followed by polymerase chain reaction (PCR) with primers matching the 5′ and 3′ ends of rearranged VH and VL genes as described in Orlandi et al., (1989) Proc. Natl. Acad. Sci. (USA), 86:3833-3837, thereby making diverse V gene repertoires for expression. The V genes can be amplified from cDNA and genomic DNA, with back primers at the 5′ end of the exon encoding the mature V-domain and forward primers based within the J-segment as described in Orlandi et al., (1989) and in Ward et al., (1989) Nature, 341:544-546. For amplifying from cDNA, however, back primers can also be based in the leader exon as described in Jones et al., (1991) Biotechnology, 9:88-89, and forward primers within the constant region as described in Sastry et al., (1989) Proc. Natl. Acad. Sci. (USA), 86:5728-5732. To maximize complementarity, degeneracy can be incorporated in the primers as described in Orlandi et al. (1989) or Sastry et al. (1989). The library diversity can be maximized by using PCR primers targeted to each V-gene family in order to amplify all available VH and VL arrangements present in the immune cell nucleic acid sample, e.g. as described in the method of Marks et al., (1991) J. Mol. Biol., 222:581-597, or as described in the method of Orum et al., (1993) Nucleic Acids Res., 21:4491-4498. For cloning of the amplified DNA into expression vectors, rare restriction sites can be introduced within the PCR primer as a tag at one end as described in Orlandi et al. (1989), or by further PCR amplification with a tagged primer as described in Clackson et al., (1991) Nature, 352:624-628.

In another example of generating an antibody library, repertoires of synthetically rearranged V genes can be derived in vitro from V gene segments. Most of the human VH-gene segments have been cloned and sequenced (see e.g. Tomlinson et al., (1992) J. Mol. Biol., 227:776-798), and mapped (see e.g. Matsuda et al., (1993) Nature Genet., 3:988-94). These segments can be used to generate diverse VH gene repertoires with PCR primers encoding H3 loops of diverse sequence and length as described in Hoogenboom and Winter (1992) J. Mol. Biol., 227:381-388. VH repertoires also can be made with all of the sequence diversity focused in a long H3 loop of a single length as described in Barbas et al., (1992) Proc. Natl. Acad. Sci. USA, 89:4457-4461. Human Vκ and Vλ segments have been cloned and sequenced (see e.g. Williams and Winter (1993) Eur. J. Immunol., 23:1456-1461) and can be used to make synthetic light chain repertoires. Synthetic V gene repertoires, based on a range of VH and VL folds, and L3 and H3 lengths, encode antibodies of considerable structural diversity. Following amplification of V-gene encoding DNAs, germline V-gene segments can be rearranged in vitro according to the methods of Hoogenboom and Winter (1992) J. Mol. Biol., 227:381-388.

Repertoires of antibody fragments can be constructed by combining VH and VL gene repertoires together in several ways. Each repertoire can be created in different vectors, and the vectors recombined in vitro (see e.g. Hogrefe et al., (1993) Gene, 128:119-126), or in vivo by combinatorial infection, for example, using the lox P system (Waterhouse et al., (1993) Nucl. Acids Res., 21:2265-2266). The in vivo recombination approach exploits the two-chain nature of Fab fragments to overcome the limit on library size imposed by E. coli transformation efficiency. Alternatively, the repertoires can be cloned sequentially into the same vector (see e.g. Barbas et al., (1991) Proc. Natl. Acad. Sci. USA, 88:7978-7982), or assembled together by PCR and then cloned (see e.g. Clackson et al., (1991) Nature, 352:624-628). PCR assembly can also be used to join VH and VL DNAs with DNA encoding a flexible peptide spacer to form single chain Fv (scFv) repertoires. In another technique, “in cell PCR assembly” can be used to combine VH and VL genes within lymphocytes by PCR and then clone repertoires of linked genes (see e.g. Embleton (1992) Nucl. Acids Res., 20:3831-3837).

In typical display libraries, the repertoire of VH and VL chains are constructed as one-pot libraries, such that the sequence of each member of the library is not known. Accordingly, sequencing is required following identification of a “Hit” antibody in order to obtain any knowledge of the SAR relationship as required for practice of the method herein. Thus, as above for hybridoma-generated antibodies, DNA-encoding antibody clones identified from a display library can be readily isolated and sequenced using conventional procedures. For example, sequencing can be effected using oligonucleotide primers designed to specifically amplify the heavy and light chain coding regions of interest from a DNA template, e.g. phage DNA template.

Exemplary of such antibody libraries that can be used for screening are those described in any of the following: European Patent Application Nos. EP0368684 and EP89311731; International Published Patent Application Nos. WO92/001047, WO 02/38756, WO 97/08320, WO 2005/023993, WO 07/137,616 and WO 2007/054816; U.S. Pat. No. 6,593,081 and U.S. Pat. No. 6,989,250; United States Published Patent Application Nos. US 2002/0102613, US 2003/153038, US 2003/0022240, US 2005/0119455, US 2005/0079574 and US 2006/0234302; and Orlandi et al. (1989) Proc Natl. Acad. Sci. U.S.A., 86:3833-3837; Ward et al. (1989) Nature, 341:544-546; Huse et al. (1989) Science, 246:1275-1281; Burton et al. (1991) Proc. Natl. Acad. Sci., U.S.A., 88:10134-10137; Marks et al. (1991) J Mol Biol, 222:581-591; Hoogenboom et al. (1991) J Mol Biol, 227:381-388; Nissim et al. (1994) EMBO J, 13:692-698; Barbas et al. (1992) Proc. Natl. Acad. Sci., U.S.A., 89:4457-4461; Akamatsu et al. (1993) J. Immunol., 151:4651-1659; Griffiths et al. (1994) EMBO J, 13:3245-3260; Fellouse (2004) PNAS, 101:12467-12472; Persson et al. (2006) J. Mol. Biol. 357:607-620; Knappik et al. (2000) J. Mol. Biol. 296:57-86; Rothe et al. (2008) J. Mol. Biol. 376:1182-1200; Mondon et al. (2008) Frontiers in Bioscience, 13:1117-1129; and Behar, I. (2007) Expert Opin. Biol. Ther., 7:763-779.

2) Phage Display Libraries

For example, natural or synthetic antibodies are selected by screening phage libraries containing phage that display various fragments of antibody variable region (Fv) fused to phage coat protein. Variable domains can be displayed functionally on phage, either as single-chain Fv (scFv) fragments, in which VH and VL are covalently linked through a short, flexible peptide, or as Fab fragments, in which they are each fused to a constant domain and interact non-covalently, as described in Winter et al., (1994) Ann. Rev. Immunol., 12:433-455. Such phage libraries are panned by affinity chromatography against the desired antigen. Clones expressing Fv fragments capable of binding to the desired antigen are bound to the antigen and thus separated from the non-binding clones in the library. The binding clones are then eluted from the antigen, and can be further enriched by additional cycles of antigen binding/elution. Any antibody can be obtained by designing a suitable antigen screening procedure to select for the phage clone of interest followed by construction of a full length antibody clone using the Fv sequences from the phage clone of interest and suitable constant region (Fe) sequences described in Kabat et al., Sequences of Proteins of Immunological Interest, Fifth Edition, NIH Publication 91-3242, Bethesda Md. (1991), vols. 1-3.

Repertoires of VH and VL genes can be separately cloned by polymerase chain reaction (PCR) and recombined randomly in phage libraries, which can then be searched for antigen-binding clones as described in Winter et al., Ann. Rev. Immunol., 12: 433-455 (1994). Libraries from immunized sources provide high-affinity antibodies to the immunogen without the requirement of constructing hybridomas. Alternatively, the naive repertoire can be cloned to provide a single source of human antibodies to a wide range of non-self and also self antigens without any immunization as described by Griffiths et al., EMBO J. 12: 725-734 (1993). Finally, naive libraries can also be made synthetically by cloning the unrearranged V-gene segments from stem cells, and using PCR primers containing random sequence to encode the highly variable CDR3 regions and to accomplish rearrangement in vitro as described by Hoogenboom and Winter, J. Mol. Biol., 227: 381-388 (1992).

VH and VL repertoires are cloned separately, one into a phagemid and the other into a phage vector. The two libraries are then combined by phage infection of phagemid-containing bacteria so that each cell contains a different combination and the library size is limited only by the number of cells present (about 1012 clones). Both vectors contain in vivo recombination signals so that the VH and VL genes are recombined onto a single replicon and are co-packaged into phage virions. The libraries can provide a large number of diverse antibodies of good affinity (Kd-1 of about 10−8 M).

Filamentous phage is used to display antibody fragments by fusion to a coat protein, for example, the minor coat protein pIII. The antibody fragments can be displayed as single chain Fv fragments, in which VH and VL domains are connected on the same polypeptide chain by a flexible polypeptide spacer, e.g. as described by Marks et al., J. Mol. Biol., 222: 581-597 (1991), or as Fab fragments, in which one chain is fused to pIII and the other is secreted into the bacterial host cell periplasm where assembly of a Fab-coat protein structure which becomes displayed on the phage surface by displacing some of the wild type coat proteins, e.g. as described in Hoogenboom et al., Nucl. Acids Res., 19: 4133-4137 (1991).

3) Addressable Libraries

Another method of identifying antibodies, or fragments thereof, that have a desired specificity and/or activity for a target protein includes addressable combinatorial antibody libraries as described in U.S. Provisional Application Nos. 61/198,764 and 61/211,204, and in International published PCT Appl. No. WO2010054007, incorporated by reference herein. These include, for example, spatially addressed combinatorial antibody libraries. An advantage of addressable combinatorial libraries compared to display libraries is that each loci represents a different library member whose identity is known by virtue of its address. In such libraries, each individual member of the library is individually generated, and thus the sequence of each member is known. Display of the members of the library can be achieved on any desired format, which permits screening the members not only for binding but also for function. The “Hits” can be quickly identified, including by sequence, coincident with the screening results. Sequencing is not required to obtain structural information about an identified antibody since the sequence of an identified “Hit” is known a priori. Accordingly, affinity maturation of a “Hit” antibody can be performed immediately after screening and identification of a “Hit” antibody.

Addressable combinatorial antibody libraries contain antibodies with variable heavy chain and variable light chains composed of recombined human germline segments. Antibody combinatorial diversity in the library exists from recombination of individual V, D and J segments that make up the variable heavy chains and of individual V (Vκ or Vλ) and J (Jκ or Jλ) segments that make up the variable light chains. Additional combinatorial diversity derives from the pairing of different variable heavy chains and variable light chains

The nucleic acid molecules encoding each VH chain and/or VL chain are individually synthesized, using standard DNA synthesis techniques, in an addressable format, whereby the identity of the nucleic acid sequence of each VH chain and/or VL chain in each locus is known. VH chains and VL chains are then paired, also in an addressable format, such that the identity of each member of the library is known based on its locus or “address”. The addressable combinatorial antibody libraries can be screened for binding or activity against a target protein to identify antibodies or portions thereof that bind to a target protein and/or modulate an activity of a target protein. By virtue of the fact that these libaries are arrayed, the identity of each individual member in the collection is known during screening, thereby allowing facile comparison of “Hit” and related “non-Hit” antibodies.

U.S. Provisional Appl. Nos. 61/198,764 and 61/211,204, and published International PCT Appl. No. WO2010054007, incorporated by reference herein, provide a method of generating a combinatorial antibody library where the identity of every antibody is known at the time of screening by virtue of the combinatorial generation of antibody members. In the combinatorial addressable libraries, variable heavy (VH) and variable light (VL) chain members of the libraries are generated, recombinantly or synthetically by DNA synthesis, from known germline antibody sequences or modified sequences thereof. Antibody combinatorial diversity in the library exists from recombination of individual V, D and J segments that make up the variable heavy chains and of individual V (Vκ or Vλ) and J (Jκ or Jλ) segments that make up the variable light chains. Additional combinatorial diversity derives from the pairing of different variable heavy chains and variable light chains.

Each VL chain of the antibodies in the library is encoded by a nucleic acid molecule that contains a Vκ and a Jκ human germline segment or degenerate codons thereof, or a Vλ and a Jλ human germline segment or degenerate codons thereof, whereby the segments are linked in-frame. The germline segments are joined such that the VL segment is 5′ of the JL segment. Each VH chain of the antibodies in the library is encoded by a nucleic acid molecule that contains a VH, DH and a JH germline segment, whereby the segments are linked in-frame. The germline segments are joined such that the VH segment is 5′ of the DH segment, which is 5′ of the JH segment.

The recombination is effected so that each gene segment is in-frame, such that resulting recombined nucleic acid molecules encodes a functional VH or VL polypeptide. For example, recombined segments are joined such that the recombined full length nucleic acid is in frame with the 5′ start codon (ATG), thereby allowing expression of a full length polypeptide. Any combination of a V(D)J can be made, and junctions modified accordingly in order to generate a compiled V(D)J sequence that is in-frame, while preserving reading frames of each segment. The choice of junction modification is a function of the combination of V(D)J that will be joined, and the proper reading frame of each gene segment. In some examples, the nucleic acid molecule encoding a VH chain and/or a VL chain are further modified to remove stop codons and/or restriction enzyme sites so that the resulting encoded polypeptide is in-frame and functional.

A nucleic acid that encodes a variable heavy chain or a variable light chain is generated as follows. In the first step, individual germline segments (VH, DH and JH for a heavy chain or Vκ and a Jκ, or Vλ and Jλ for a light chain) are selected for recombination. The germline segments can be human germline segments, or dgenerate sequences thereof, or alternatively the germline segments can be modified. For example, the DH segment of a variable heavy chain can be translated in any open reading frame, or alternatively, the DH segment can be the reverse complement of a DH germline segment. Once selected, the germline segments are joined such that the recombined full length nucleic acid is in frame with the 5′ start codon (ATG), thereby allowing expression of a full length polypeptide. Any combination of a V(D)J can be made, and junctions modified accordingly in order to generate a compiled V(D)J sequence that is in-frame, while preserving reading frames of each segment. The V segment is always reading frame 1. The reading frame of the J segment is selected so the correct amino acids are encoded. The D segment can be in any reading frame, but typically, the reading frame is chosen such that the resulting amino acids are predominately hydrophobic. As necessary, nucleic acid modifications are made at the junctions between the gene segments such that each segment is in the desired reading frame. For example, at the V-D junction, one or more nucleotides can be deleted from the 5′ end of the D, one or more nucleotides can be deleted from the 3′ end of the V or one or more nucleotides can be inserted between the V and D (e.g. a nucleotide can be added to the 3′ end of the V). Once the junctions are formed, the sequence is modified to remove any stop codons by substitution of nucleotides, such that stop codon TAA is replaced by codon TAT; stop codon TAG is replaced by codon TAT, and stop codon TGA is replaced by codon TCA. Finally, the nucleic acid can be further modified to, for example, remove unwanted restriction sites, splicing donor or acceptor sites, or other nucleotide sequences potentially detrimental to efficient translation. Modifications of the nucleic acid sequences include replacements or substitutions, insertions, or deletions of nucleotides, or any combination thereof.

The nucleic acid molecules encoding each VH chain and/or VL chain are individually synthesized, using standard DNA synthesis techniques, in an addressable format, whereby the identity of the nucleic acid sequence of each VH chain and/or VL chain in each locus is known.

VH chains and VL chains are then paired, also in an addressable format, such that the identity of each member of the library is known based on its locus or “address”. For example, resulting members of the library are produced by co-expression of nucleic acid molecules encoding the recombined variable region genes together, such that when expressed, a combinatorial antibody member is generated minimally containing a VH and VL chain, or portions thereof. In some examples of the methods, the nucleic acid molecule encoding the VH and VL chain can be expressed as a single nucleic acid molecule, whereby the genes encoding the heavy and light chain are joined by a linker. In another example of the methods, the nucleic acid molecules encoding the VH and VL chain can be separately provided for expression together. Thus, upon expression from the recombined nucleic acid molecules, each different member of the library represents a germline encoded antibody, whereby diversity is achieved by combinatorial diversity of V(D)J segments and pairing diversity of heavy and light chains.

The antibodies within the combinatorial addressable germline antibody libraries contain all or a portion of the variable heavy chain (VH) and variable light chain (VL), as long as the resulting antibody is sufficient to form an antigen binding site. Typically, the combinatorial addressable germline antibodies are Fabs. Exemplary nucleic acids encoding variable heavy chains and light chains are set forth in Table 3 below. A library of antibodies can be generated upon co-expression of a nucleic acid molecule encoding the VH chain and a nucleic acid encoding the VL chain to generate a combinatorial library containing a plurality of different members. An exemplary paired nucleic acid library is set forth in Table 4 below, where each row sets forth a different loci of the library. The combinatorial addressable antibody library can be screened to identify a “Hit” antibody against any target antigen. Related non-Hit antibodies that do not bind the target antigen also can be readily identified, since the identity by sequence structure of each “Hit” or “non-Hit” are immediately known coincident with the binding results.

TABLE 3
Exemplary Variable Heavy Chains and Light Chains
SEQ
Number Name ID NO.
Heavy Chain
1 gnl|Fabrus|VH1-18_IGHD1-26*01_IGHJ2*01 1828
2 gnl|Fabrus|VH1-18_IGHD2-21*01_IGHJ2*01 1829
3 gnl|Fabrus|VH1-18_IGHD3-16*01_IGHJ6*01 1830
4 gnl|Fabrus|VH1-18_IGHD3-22*01_IGHJ4*01 1831
5 gnl|Fabrus|VH1-18_IGHD4-23*01_IGHJ1*01 1832
6 gnl|Fabrus|VH1-18_IGHD5-12*01_IGHJ4*01 1833
7 gnl|Fabrus|VH1-18_IGHD6-6*01_IGHJ1*01 1834
8 gnl|Fabrus|VH1-2_IGHD1-1*01_IGHJ3*01 1835
9 gnl|Fabrus|VH1-24_IGHD1-7*01_IGHJ4*01 1836
10 gnl|Fabrus|VH1-24_IGHD2-15*01_IGHJ2*01 1837
11 gnl|Fabrus|VH1-24_IGHD3-10*01_IGHJ4*01 1838
12 gnl|Fabrus|VH1-24_IGHD3-16*01_IGHJ4*01 1839
13 gnl|Fabrus|VH1-24_IGHD4-23*01_IGHJ2*01 1840
14 gnl|Fabrus|VH1-24_IGHD5-12*01_IGHJ4*01 1841
15 gnl|Fabrus|VH1-24_IGHD5-18*01_IGHJ6*01 1842
16 gnl|Fabrus|VH1-24_IGHD6-19*01_IGHJ4*01 1843
17 gnl|Fabrus|VH1-3_IGHD2-15*01_IGHJ2*01 1844
18 gnl|Fabrus|VH1-3_IGHD2-2*01_IGHJ5*01 1845
19 gnl|Fabrus|VH1-3_IGHD3-9*01_IGHJ6*01 1846
20 gnl|Fabrus|VH1-3_IGHD4-23*01_IGHJ4*01 101
21 gnl|Fabrus|VH1-3_IGHD5-18*01_IGHJ4*01 1847
22 gnl|Fabrus|VH1-3_IGHD6-6*01_IGHJ1*01 1848
23 gnl|Fabrus|VH1-3_IGHD7-27*01_IGHJ4*01 1849
24 gnl|Fabrus|VH1-45_IGHD1-26*01_IGHJ4*01 1850
25 gnl|Fabrus|VH1-45_IGHD2-15*01_IGHJ6*01 1851
26 gnl|Fabrus|VH1-45_IGHD2-8*01_IGHJ3*01 1852
27 gnl|Fabrus|VH1-45_IGHD3-10*01_IGHJ4*01 1853
28 gnl|Fabrus|VH1-45_IGHD3-16*01_IGHJ2*01 1854
29 gnl|Fabrus|VH1-45_IGHD4-23*01_IGHJ4*01 1855
30 gnl|Fabrus|VH1-45_IGHD5-24*01_IGHJ4*01 1856
31 gnl|Fabrus|VH1-45_IGHD6-19*01_IGHJ4*01 1857
32 gnl|Fabrus|VH1-45_IGHD7-27*01_IGHJ6*01 1858
33 gnl|Fabrus|VH1-46_IGHD1-26*01_IGHJ4*01 1859
34 gnl|Fabrus|VH1-46_IGHD2-15*01_IGHJ2*01 99
35 gnl|Fabrus|VH1-46_IGHD3-10*01_IGHJ4*01 92
36 gnl|Fabrus|VH1-46_IGHD4-17*01_IGHJ4*01 1860
37 gnl|Fabrus|VH1-46_IGHD5-18*01_IGHJ4*01 1861
38 gnl|Fabrus|VH1-46_IGHD6-13*01_IGHJ4*01 93
39 gnl|Fabrus|VH1-46_IGHD6-6*01_IGHJ1*01 88
40 gnl|Fabrus|VH1-46_IGHD7-27*01_IGHJ2*01 97
41 gnl|Fabrus|VH1-58_IGHD1-26*01_IGHJ4*01 1862
42 gnl|Fabrus|VH1-58_IGHD2-15*01_IGHJ2*01 1863
43 gnl|Fabrus|VH1-58_IGHD3-10*01_IGHJ6*01 1864
44 gnl|Fabrus|VH1-58_IGHD4-17*01_IGHJ4*01 1865
45 gnl|Fabrus|VH1-58_IGHD5-18*01_IGHJ4*01 1866
46 gnl|Fabrus|VH1-58_IGHD6-6*01_IGHJ1*01 1867
47 gnl|Fabrus|VH1-58_IGHD7-27*01_IGHJ5*01 1868
48 gnl|Fabrus|VH1-69_IGHD1-1*01_IGHJ6*01 98
49 gnl|Fabrus|VH1-69_IGHD1-14*01_IGHJ4*01 1869
50 gnl|Fabrus|VH1-69_IGHD2-2*01_IGHJ4*01 1870
51 gnl|Fabrus|VH1-69_IGHD2-8*01_IGHJ6*01 1871
52 gnl|Fabrus|VH1-69_IGHD3-16*01_IGHJ4*01 1872
53 gnl|Fabrus|VH1-69_IGHD3-3*01_IGHJ4*01 1873
54 gnl|Fabrus|VH1-69_IGHD3-9*01_IGHJ6*01 1874
55 gnl|Fabrus|VH1-69_IGHD4-17*01_IGHJ4*01 1875
56 gnl|Fabrus|VH1-69_IGHD5-12*01_IGHJ4*01 1876
57 gnl|Fabrus|VH1-69_IGHD5-24*01_IGHJ6*01 1877
58 gnl|Fabrus|VH1-69_IGHD6-19*01_IGHJ4*01 1878
59 gnl|Fabrus|VH1-69_IGHD6-6*01_IGHJ1*01 1879
60 gnl|Fabrus|VH1-69_IGHD7-27*01_IGHJ4*01 1880
61 gnl|Fabrus|VH1-8_IGHD1-26*01_IGHJ4*01 1881
62 gnl|Fabrus|VH1-8_IGHD2-15*01_IGHJ6*01 1882
63 gnl|Fabrus|VH1-8_IGHD2-2*01_IGHJ6*01 102
64 gnl|Fabrus|VH1-8_IGHD3-10*01_IGHJ4*01 1883
65 gnl|Fabrus|VH1-8_IGHD4-17*01_IGHJ4*01 1884
66 gnl|Fabrus|VH1-8_IGHD5-5*01_IGHJ4*01 1885
67 gnl|Fabrus|VH1-8_IGHD7-27*01_IGHJ4*01 1886
68 gnl|Fabrus|VH2-26_IGHD1-20*01_IGHJ4*01 1887
69 gnl|Fabrus|VH2-26_IGHD2-15*01_IGHJ2*01 1888
70 gnl|Fabrus|VH2-26_IGHD2-2*01_IGHJ4*01 1889
71 gnl|Fabrus|VH2-26_IGHD3-10*01_IGHJ4*01 1890
72 gnl|Fabrus|VH2-26_IGHD3-9*01_IGHJ6*01 1891
73 gnl|Fabrus|VH2-26_IGHD4-11*01_IGHJ4*01 1892
74 gnl|Fabrus|VH2-26_IGHD5-12*01_IGHJ4*01 1893
75 gnl|Fabrus|VH2-26_IGHD5-18*01_IGHJ4*01 1894
76 gnl|Fabrus|VH2-26_IGHD6-13*01_IGHJ4*01 1895
77 gnl|Fabrus|VH2-26_IGHD7-27*01_IGHJ4*01 1896
78 gnl|Fabrus|VH2-26_IGHD7-27*01_IGHJ4*01 1897
79 gnl|Fabrus|VH2-5_IGHD1-1*01_IGHJ5*01 1898
80 gnl|Fabrus|VH2-5_IGHD2-15*01_IGHJ6*01 1899
81 gnl|Fabrus|VH2-5_IGHD3-16*01_IGHJ4*01 1900
82 gnl|Fabrus|VH2-5_IGHD3-9*01_IGHJ6*01 1901
83 gnl|Fabrus|VH2-5_IGHD5-12*01_IGHJ4*01 1902
84 gnl|Fabrus|VH2-5_IGHD6-13*01_IGHJ4*01 1903
85 gnl|Fabrus|VH2-5_IGHD7-27*01_IGHJ2*01 96
86 gnl|Fabrus|VH2-70_IGHD1-1*01_IGHJ2*01 1904
87 gnl|Fabrus|VH2-70_IGHD2-15*01_IGHJ2*01 1905
88 gnl|Fabrus|VH2-70_IGHD3-22*01_IGHJ4*01 1906
89 gnl|Fabrus|VH2-70_IGHD3-9*01_IGHJ6*01 1907
90 gnl|Fabrus|VH2-70_IGHD5-12*01_IGHJ4*01 1908
91 gnl|Fabrus|VH2-70_IGHD7-27*01_IGHJ2*01 1909
92 gnl|Fabrus|VH3-11_IGHD1-26*01_IGHJ4*01 1910
93 gnl|Fabrus|VH3-11_IGHD2-2*01_IGHJ6*01 1911
94 gnl|Fabrus|VH3-11_IGHD3-16*01_IGHJ4*01 1912
95 gnl|Fabrus|VH3-11_IGHD3-9*01_IGHJ6*01 1913
96 gnl|Fabrus|VH3-11_IGHD4-23*01_IGHJ5*01 1914
97 gnl|Fabrus|VH3-11_IGHD5-18*01_IGHJ4*01 1915
98 gnl|Fabrus|VH3-11_IGHD6-19*01_IGHJ6*01 1916
99 gnl|Fabrus|VH3-11_IGHD6-6*01_IGHJ1*01 1917
100 gnl|Fabrus|VH3-11_IGHD7-27*01_IGHJ4*01 1918
101 gnl|Fabrus|VH3-13_IGHD1-26*01_IGHJ4*01 1919
102 gnl|Fabrus|VH3-13_IGHD2-8*01_IGHJ5*01 1920
103 gnl|Fabrus|VH3-13_IGHD3-3*01_IGHJ1*01 1921
104 gnl|Fabrus|VH3-13_IGHD3-9*01_IGHJ6*01 1922
105 gnl|Fabrus|VH3-13_IGHD4-23*01_IGHJ5*01 1923
106 gnl|Fabrus|VH3-13_IGHD5-5*01_IGHJ4*01 1924
107 gnl|Fabrus|VH3-13_IGHD6-6*01_IGHJ1*01 1925
108 gnl|Fabrus|VH3-13_IGHD7-27*01_IGHJ5*01 1926
109 gnl|Fabrus|VH3-15_IGHD1-26*01_IGHJ4*01 1927
110 gnl|Fabrus|VH3-15_IGHD2-15*01_IGHJ2*01 1928
111 gnl|Fabrus|VH3-15_IGHD2-15*01_IGHJ6*01 1929
112 gnl|Fabrus|VH3-15_IGHD3-10*01_IGHJ4*01 1930
113 gnl|Fabrus|VH3-15_IGHD3-9*01_IGHJ2*01 1931
114 gnl|Fabrus|VH3-15_IGHD5-12*01_IGHJ4*01 1932
115 gnl|Fabrus|VH3-15_IGHD6-6*01_IGHJ1*01 1933
116 gnl|Fabrus|VH3-16_IGHD1-1*01_IGHJ1*01 1934
117 gnl|Fabrus|VH3-16_IGHD1-7*01_IGHJ6*01 1935
118 gnl|Fabrus|VH3-16_IGHD2-15*01_IGHJ2*01 1936
119 gnl|Fabrus|VH3-16_IGHD2-2*01_IGHJ2*01 1937
120 gnl|Fabrus|VH3-16_IGHD3-10*01_IGHJ4*01 1938
121 gnl|Fabrus|VH3-16_IGHD4-4*01_IGHJ2*01 1939
122 gnl|Fabrus|VH3-16_IGHD5-24*01_IGHJ4*01 1940
123 gnl|Fabrus|VH3-16_IGHD6-13*01_IGHJ4*01 1941
124 gnl|Fabrus|VH3-16_IGHD7-27*01_IGHJ2*01 1942
125 gnl|Fabrus|VH3-20_IGHD1-14*01_IGHJ4*01 1943
126 gnl|Fabrus|VH3-20_IGHD2-15*01_IGHJ2*01 1944
127 gnl|Fabrus|VH3-20_IGHD2-8*01_IGHJ4*01 1945
128 gnl|Fabrus|VH3-20_IGHD3-10*01_IGHJ4*01 1946
129 gnl|Fabrus|VH3-20_IGHD3-9*01_IGHJ6*01 1947
130 gnl|Fabrus|VH3-20_IGHD4-23*01_IGHJ4*01 1948
131 gnl|Fabrus|VH3-20_IGHD5-12*01_IGHJ4*01 1949
132 gnl|Fabrus|VH3-20_IGHD6-13*01_IGHJ4*01 1950
133 gnl|Fabrus|VH3-20_IGHD7-27*01_IGHJ2*01 1951
134 gnl|Fabrus|VH3-21_IGHD1-26*01_IGHJ4*01 1952
135 gnl|Fabrus|VH3-21_IGHD2-2*01_IGHJ5*01 1953
136 gnl|Fabrus|VH3-21_IGHD3-22*01_IGHJ4*01 1954
137 gnl|Fabrus|VH3-21_IGHD4-23*01_IGHJ5*01 1955
138 gnl|Fabrus|VH3-21_IGHD5-24*01_IGHJ5*01 1956
139 gnl|Fabrus|VH3-21_IGHD6-19*01_IGHJ1*01 1957
140 gnl|Fabrus|VH3-21_IGHD7-27*01_IGHJ4*01 1958
141 gnl|Fabrus|VH3-23_IGHD1-1*01_IGHJ1*01 1959
142 gnl|Fabrus|VH3-23_IGHD1-1*01_IGHJ4*01 1960
143 gnl|Fabrus|VH3-23_IGHD1-20*01_IGHJ3*01 1961
144 gnl|Fabrus|VH3-23_IGHD1-26*01_IGHJ4*01 1962
145 gnl|Fabrus|VH3-23_IGHD2-15*01_IGHJ4*01 1963
146 gnl|Fabrus|VH3-23_IGHD2-21*01_IGHJ1*01 1964
147 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 1965
148 gnl|Fabrus|VH3-23_IGHD3-16*01_IGHJ4*01 1966
149 gnl|Fabrus|VH3-23_IGHD3-22*01_IGHJ4*01 1967
150 gnl|Fabrus|VH3-23_IGHD3-3*01_IGHJ5*01 1968
151 gnl|Fabrus|VH3-23_IGHD4-11*01_IGHJ4*01 1969
152 gnl|Fabrus|VH3-23_IGHD4-23*01_IGHJ2*01 1970
153 gnl|Fabrus|VH3-23_IGHD5-12*01_IGHJ4*01 1971
154 gnl|Fabrus|VH3-23_IGHD5-24*01_IGHJ1*01 1972
155 gnl|Fabrus|VH3-23_IGHD5-5*01_IGHJ4*01 1973
156 gnl|Fabrus|VH3-23_IGHD6-13*01_IGHJ4*01 1974
157 gnl|Fabrus|VH3-23_IGHD6-25*01_IGHJ2*01 1975
158 gnl|Fabrus|VH3-23_IGHD6-6*01_IGHJ1*01 1976
159 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ4*01 1977
160 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ6*01 1978
161 gnl|Fabrus|VH3-30_IGHD1-1*01_IGHJ6*01 1979
162 gnl|Fabrus|VH3-30_IGHD1-26*01_IGHJ1*01 1980
163 gnl|Fabrus|VH3-30_IGHD1-26*01_IGHJ4*01 1981
164 gnl|Fabrus|VH3-30_IGHD2-15*01_IGHJ2*01 1982
165 gnl|Fabrus|VH3-30_IGHD2-2*01_IGHJ6*01 1983
166 gnl|Fabrus|VH3-30_IGHD3-10*01_IGHJ1*01 1984
167 gnl|Fabrus|VH3-30_IGHD3-16*01_IGHJ6*01 1985
168 gnl|Fabrus|VH3-30_IGHD4-17*01_IGHJ4*01 1986
169 gnl|Fabrus|VH3-30_IGHD5-12*01_IGHJ4*01 1987
170 gnl|Fabrus|VH3-30_IGHD5-18*01_IGHJ1*01 1988
171 gnl|Fabrus|VH3-30_IGHD6-13*01_IGHJ4*01 1989
172 gnl|Fabrus|VH3-30_IGHD6-6*01_IGHJ1*01 1990
173 gnl|Fabrus|VH3-35_IGHD1-1*01_IGHJ2*01 1991
174 gnl|Fabrus|VH3-35_IGHD1-20*01_IGHJ6*01 1992
175 gnl|Fabrus|VH3-35_IGHD2-15*01_IGHJ2*01 1993
176 gnl|Fabrus|VH3-35_IGHD2-21*01_IGHJ6*01 1994
177 gnl|Fabrus|VH3-35_IGHD3-10*01_IGHJ4*01 1995
178 gnl|Fabrus|VH3-35_IGHD3-9*01_IGHJ6*01 1996
179 gnl|Fabrus|VH3-35_IGHD5-12*01_IGHJ4*01 1997
180 gnl|Fabrus|VH3-35_IGHD6-13*01_IGHJ4*01 1998
181 gnl|Fabrus|VH3-35_IGHD7-27*01_IGHJ1*01 1999
182 gnl|Fabrus|VH3-38_IGHD1-14*01_IGHJ5*01 2000
183 gnl|Fabrus|VH3-38_IGHD1-20*01_IGHJ6*01 2001
184 gnl|Fabrus|VH3-38_IGHD2-15*01_IGHJ6*01 2002
185 gnl|Fabrus|VH3-38_IGHD2-2*01_IGHJ1*01 2003
186 gnl|Fabrus|VH3-38_IGHD3-10*01_IGHJ4*01 2004
187 gnl|Fabrus|VH3-38_IGHD3-16*01_IGHJ1*01 2005
188 gnl|Fabrus|VH3-38_IGHD4-17*01_IGHJ2*01 2006
189 gnl|Fabrus|VH3-38_IGHD5-24*01_IGHJ3*01 2007
190 gnl|Fabrus|VH3-38_IGHD6-6*01_IGHJ1*01 2008
191 gnl|Fabrus|VH3-38_IGHD7-27*01_IGHJ6*01 2009
192 gnl|Fabrus|VH3-43_IGHD1-26*01_IGHJ5*01 2010
193 gnl|Fabrus|VH3-43_IGHD1-7*01_IGHJ6*01 2011
194 gnl|Fabrus|VH3-43_IGHD2-2*01_IGHJ3*01 2012
195 gnl|Fabrus|VH3-43_IGHD2-21*01_IGHJ6*01 2013
196 gnl|Fabrus|VH3-43_IGHD3-16*01_IGHJ6*01 2014
197 gnl|Fabrus|VH3-43_IGHD3-22*01_IGHJ4*01 2015
198 gnl|Fabrus|VH3-43_IGHD4-23*01_IGHJ3*01 2016
199 gnl|Fabrus|VH3-43_IGHD5-18*01_IGHJ5*01 2017
200 gnl|Fabrus|VH3-43_IGHD6-13*01_IGHJ4*01 2018
201 gnl|Fabrus|VH3-43_IGHD7-27*01_IGHJ1*01 2019
202 gnl|Fabrus|VH3-48_IGHD6-6*01_IGHJ1*01 2020
203 gnl|Fabrus|VH3-49_IGHD1-26*01_IGHJ4*01 2021
204 gnl|Fabrus|VH3-49_IGHD1-7*01_IGHJ6*01 2022
205 gnl|Fabrus|VH3-49_IGHD2-2*01_IGHJ6*01 2023
206 gnl|Fabrus|VH3-49_IGHD2-8*01_IGHJ4*01 2024
207 gnl|Fabrus|VH3-49_IGHD3-22*01_IGHJ4*01 2025
208 gnl|Fabrus|VH3-49_IGHD3-9*01_IGHJ6*01 2026
209 gnl|Fabrus|VH3-49_IGHD5-18*01_IGHJ4*01 2027
210 gnl|Fabrus|VH3-49_IGHD6-13*01_IGHJ4*01 2028
211 gnl|Fabrus|VH3-49_IGHD7-27*01_IGHJ1*01 2029
212 gnl|Fabrus|VH3-53_IGHD1-14*01_IGHJ6*01 2030
213 gnl|Fabrus|VH3-53_IGHD1-7*01_IGHJ1*01 2031
214 gnl|Fabrus|VH3-53_IGHD2-2*01_IGHJ2*01 2032
215 gnl|Fabrus|VH3-53_IGHD3-22*01_IGHJ3*01 2033
216 gnl|Fabrus|VH3-53_IGHD4-23*01_IGHJ1*01 2034
217 gnl|Fabrus|VH3-53_IGHD5-5*01_IGHJ4*01 2035
218 gnl|Fabrus|VH3-53_IGHD6-13*01_IGHJ3*01 2036
219 gnl|Fabrus|VH3-53_IGHD7-27*01_IGHJ4*01 2037
220 gnl|Fabrus|VH3-64_IGHD1-26*01_IGHJ4*01 2038
221 gnl|Fabrus|VH3-64_IGHD1-7*01_IGHJ6*01 2039
222 gnl|Fabrus|VH3-64_IGHD2-2*01_IGHJ5*01 2040
223 gnl|Fabrus|VH3-64_IGHD3-3*01_IGHJ4*01 2041
224 gnl|Fabrus|VH3-64_IGHD4-17*01_IGHJ4*01 2042
225 gnl|Fabrus|VH3-64_IGHD5-12*01_IGHJ4*01 2043
226 gnl|Fabrus|VH3-64_IGHD6-19*01_IGHJ1*01 2044
227 gnl|Fabrus|VH3-64_IGHD7-27*01_IGHJ4*01 2045
228 gnl|Fabrus|VH3-66_IGHD6-6*01_IGHJ1*01 2046
229 gnl|Fabrus|VH3-7_IGHD1-20*01_IGHJ3*01 2047
230 gnl|Fabrus|VH3-7_IGHD1-7*01_IGHJ6*01 2048
231 gnl|Fabrus|VH3-7_IGHD2-21*01_IGHJ5*01 2049
232 gnl|Fabrus|VH3-7_IGHD2-8*01_IGHJ6*01 2050
233 gnl|Fabrus|VH3-7_IGHD3-22*01_IGHJ3*01 2051
234 gnl|Fabrus|VH3-7_IGHD3-9*01_IGHJ6*01 2052
235 gnl|Fabrus|VH3-7_IGHD4-17*01_IGHJ4*01 2053
236 gnl|Fabrus|VH3-7_IGHD5-12*01_IGHJ4*01 2054
237 gnl|Fabrus|VH3-7_IGHD5-24*01_IGHJ4*01 2055
238 gnl|Fabrus|VH3-7_IGHD6-19*01_IGHJ6*01 2056
239 gnl|Fabrus|VH3-7_IGHD6-6*01_IGHJ1*01 2057
240 gnl|Fabrus|VH3-7_IGHD7-27*01_IGHJ2*01 2058
241 gnl|Fabrus|VH3-72_IGHD1-1*01_IGHJ4*01 2059
242 gnl|Fabrus|VH3-72_IGHD2-15*01_IGHJ1*01 2060
243 gnl|Fabrus|VH3-72_IGHD3-22*01_IGHJ4*01 2061
244 gnl|Fabrus|VH3-72_IGHD3-9*01_IGHJ6*01 2062
245 gnl|Fabrus|VH3-72_IGHD4-23*01_IGHJ2*01 2063
246 gnl|Fabrus|VH3-72_IGHD5-18*01_IGHJ4*01 2064
247 gnl|Fabrus|VH3-72_IGHD5-24*01_IGHJ6*01 2065
248 gnl|Fabrus|VH3-72_IGHD6-6*01_IGHJ1*01 2066
249 gnl|Fabrus|VH3-72_IGHD7-27*01_IGHJ2*01 2067
250 gnl|Fabrus|VH3-73_IGHD1-1*01_IGHJ5*01 2068
251 gnl|Fabrus|VH3-73_IGHD2-8*01_IGHJ2*01 2069
252 gnl|Fabrus|VH3-73_IGHD3-22*01_IGHJ4*01 2070
253 gnl|Fabrus|VH3-73_IGHD3-9*01_IGHJ6*01 2071
254 gnl|Fabrus|VH3-73_IGHD4-11*01_IGHJ6*01 2072
255 gnl|Fabrus|VH3-73_IGHD4-23*01_IGHJ5*01 2073
256 gnl|Fabrus|VH3-73_IGHD5-12*01_IGHJ4*01 2074
257 gnl|Fabrus|VH3-73_IGHD6-19*01_IGHJ1*01 2075
258 gnl|Fabrus|VH3-73_IGHD7-27*01_IGHJ5*01 2076
259 gnl|Fabrus|VH3-74_IGHD1-1*01_IGHJ6*01 2077
260 gnl|Fabrus|VH3-74_IGHD1-26*01_IGHJ4*01 2078
261 gnl|Fabrus|VH3-74_IGHD2-2*01_IGHJ5*01 2079
262 gnl|Fabrus|VH3-74_IGHD3-22*01_IGHJ5*01 2080
263 gnl|Fabrus|VH3-74_IGHD4-17*01_IGHJ1*01 2081
264 gnl|Fabrus|VH3-74_IGHD5-12*01_IGHJ4*01 2082
265 gnl|Fabrus|VH3-74_IGHD6-6*01_IGHJ1*01 2083
266 gnl|Fabrus|VH3-74_IGHD7-27*01_IGHJ4*01 2084
267 gnl|Fabrus|VH3-9_IGHD1-1*01_IGHJ6*01 2085
268 gnl|Fabrus|VH3-9_IGHD1-7*01_IGHJ5*01 2086
269 gnl|Fabrus|VH3-9_IGHD2-2*01_IGHJ4*01 2087
270 gnl|Fabrus|VH3-9_IGHD3-16*01_IGHJ6*01 2088
271 gnl|Fabrus|VH3-9_IGHD3-22*01_IGHJ4*01 2089
272 gnl|Fabrus|VH3-9_IGHD4-11*01_IGHJ4*01 2090
273 gnl|Fabrus|VH3-9_IGHD5-24*01_IGHJ1*01 2091
274 gnl|Fabrus|VH3-9_IGHD6-13*01_IGHJ4*01 2092
275 gnl|Fabrus|VH3-9_IGHD6-25*01_IGHJ6*01 2093
276 gnl|Fabrus|VH3-9_IGHD7-27*01_IGHJ2*01 2094
277 gnl|Fabrus|VH4-28_IGHD1-20*01_IGHJ1*01 2095
278 gnl|Fabrus|VH4-28_IGHD1-7*01_IGHJ6*01 2096
279 gnl|Fabrus|VH4-28_IGHD2-15*01_IGHJ6*01 2097
280 gnl|Fabrus|VH4-28_IGHD3-16*01_IGHJ2*01 2098
281 gnl|Fabrus|VH4-28_IGHD3-9*01_IGHJ6*01 2099
282 gnl|Fabrus|VH4-28_IGHD4-4*01_IGHJ4*01 2100
283 gnl|Fabrus|VH4-28_IGHD5-5*01_IGHJ1*01 2101
284 gnl|Fabrus|VH4-28_IGHD6-13*01_IGHJ4*01 2102
285 gnl|Fabrus|VH4-28_IGHD7-27*01_IGHJ1*01 94
286 gnl|Fabrus|VH4-31_IGHD1-26*01_IGHJ2*01 91
287 gnl|Fabrus|VH4-31_IGHD2-15*01_IGHJ2*01 103
288 gnl|Fabrus|VH4-31_IGHD2-2*01_IGHJ6*01 2103
289 gnl|Fabrus|VH4-31_IGHD3-10*01_IGHJ4*01 2104
290 gnl|Fabrus|VH4-31_IGHD3-9*01_IGHJ6*01 2105
291 gnl|Fabrus|VH4-31_IGHD4-17*01_IGHJ5*01 2106
292 gnl|Fabrus|VH4-31_IGHD5-12*01_IGHJ4*01 2107
293 gnl|Fabrus|VH4-31_IGHD6-13*01_IGHJ4*01 2108
294 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 2109
295 gnl|Fabrus|VH4-31_IGHD7-27*01_IGHJ5*01 95
296 gnl|Fabrus|VH4-34_IGHD1-7*01_IGHJ4*01 2110
297 gnl|Fabrus|VH4-34_IGHD2-2*01_IGHJ4*01 2111
298 gnl|Fabrus|VH4-34_IGHD3-16*01_IGHJ4*01 2112
299 gnl|Fabrus|VH4-34_IGHD3-22*01_IGHJ6*01 2113
300 gnl|Fabrus|VH4-34_IGHD4-17*01_IGHJ4*01 2114
301 gnl|Fabrus|VH4-34_IGHD5-12*01_IGHJ4*01 2115
302 gnl|Fabrus|VH4-34_IGHD6-13*01_IGHJ4*01 2116
303 gnl|Fabrus|VH4-34_IGHD6-25*01_IGHJ6*01 2117
304 gnl|Fabrus|VH4-34_IGHD6-6*01_IGHJ6*01 2118
305 gnl|Fabrus|VH4-34_IGHD7-27*01_IGHJ4*01 100
306 gnl|Fabrus|VH4-39_IGHD1-14*01_IGHJ1*01 2119
307 gnl|Fabrus|VH4-39_IGHD1-20*01_IGHJ6*01 2120
308 gnl|Fabrus|VH4-39_IGHD2-21*01_IGHJ3*01 2121
309 gnl|Fabrus|VH4-39_IGHD3-10*01_IGHJ4*01 2122
310 gnl|Fabrus|VH4-39_IGHD3-16*01_IGHJ2*01 2123
311 gnl|Fabrus|VH4-39_IGHD3-9*01_IGHJ6*01 2124
312 gnl|Fabrus|VH4-39_IGHD4-23*01_IGHJ2*01 2125
313 gnl|Fabrus|VH4-39_IGHD5-12*01_IGHJ4*01 2126
314 gnl|Fabrus|VH4-39_IGHD6-6*01_IGHJ1*01 2127
315 gnl|Fabrus|VH4-4_IGHD1-20*01_IGHJ3*01 2128
316 gnl|Fabrus|VH4-4_IGHD2-8*01_IGHJ4*01 2129
317 gnl|Fabrus|VH4-4_IGHD3-22*01_IGHJ2*01 2130
318 gnl|Fabrus|VH4-4_IGHD4-23*01_IGHJ4*01 2131
319 gnl|Fabrus|VH4-4_IGHD5-12*01_IGHJ5*01 2132
320 gnl|Fabrus|VH4-4_IGHD6-6*01_IGHJ4*01 2133
321 gnl|Fabrus|VH4-4_IGHD7-27*01_IGHJ6*01 2134
322 gnl|Fabrus|VH4-59_IGHD6-25*01_IGHJ3*01 2135
323 gnl|Fabrus|VH5-51_IGHD1-14*01_IGHJ4*01 2136
324 gnl|Fabrus|VH5-51_IGHD1-26*01_IGHJ6*01 2137
325 gnl|Fabrus|VH5-51_IGHD2-8*01_IGHJ4*01 2138
326 gnl|Fabrus|VH5-51_IGHD3-10*01_IGHJ6*01 2139
327 gnl|Fabrus|VH5-51_IGHD3-3*01_IGHJ4*01 2140
328 gnl|Fabrus|VH5-51_IGHD4-17*01_IGHJ4*01 2141
329 gnl|Fabrus|VH5-51_IGHD5-18*01>3_IGHJ4*01 89
330 gnl|Fabrus|VH5-51_IGHD5-18*01>1_IGHJ4*01 2142
331 gnl|Fabrus|VH5-51_IGHD6-25*01_IGHJ4*01 106
332 gnl|Fabrus|VH5-51_IGHD7-27*01_IGHJ4*01 2143
333 gnl|Fabrus|VH6-1_IGHD1-1*01_IGHJ4*01 2144
334 gnl|Fabrus|VH6-1_IGHD1-20*01_IGHJ6*01 2145
335 gnl|Fabrus|VH6-1_IGHD2-15*01_IGHJ4*01 2146
336 gnl|Fabrus|VH6-1_IGHD2-21*01_IGHJ6*01 2147
337 gnl|Fabrus|VH6-1_IGHD3-16*01_IGHJ5*01 2148
338 gnl|Fabrus|VH6-1_IGHD3-3*01_IGHJ4*01 90
339 gnl|Fabrus|VH6-1_IGHD4-11*01_IGHJ6*01 2149
340 gnl|Fabrus|VH6-1_IGHD4-23*01_IGHJ4*01 2150
341 gnl|Fabrus|VH6-1_IGHD5-5*01_IGHJ4*01 2151
342 gnl|Fabrus|VH6-1_IGHD6-13*01_IGHJ4*01 2152
343 gnl|Fabrus|VH6-1_IGHD6-25*01_IGHJ6*01 2153
344 gnl|Fabrus|VH6-1_IGHD7-27*01_IGHJ4*01 2154
345 gnl|Fabrus|VH7-81_IGHD1-14*01_IGHJ4*01 2155
346 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ2*01 2156
347 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ6*01 2157
348 gnl|Fabrus|VH7-81_IGHD3-16*01_IGHJ6*01 2158
349 gnl|Fabrus|VH7-81_IGHD4-23*01_IGHJ1*01 2159
350 gnl|Fabrus|VH7-81_IGHD5-12*01_IGHJ6*01 2160
351 gnl|Fabrus|VH7-81_IGHD6-25*01_IGHJ4*01 2161
352 gnl|Fabrus|VH7-81_IGHD7-27*01_IGHJ4*01 2162
353 gi|Fabrus|VH3-23_IGHD1-1*01>1_IGHJ1*01 2211
355 gi|Fabrus|VH3-23_IGHD1-1*01>2_IGHJ1*01 2212
356 gi|Fabrus|VH3-23_IGHD1-1*01>3_IGHJ1*01 2213
357 gi|Fabrus|VH3-23_IGHD1-7*01>1_IGHJ1*01 2214
358 gi|Fabrus|VH3-23_IGHD1-7*01>3_IGHJ1*01 2215
359 gi|Fabrus|VH3-23_IGHD1-14*01>1_IGHJ1*01 2216
360 gi|Fabrus|VH3-23_IGHD1-14*01>3_IGHJ1*01 2217
361 gi|Fabrus|VH3-23_IGHD1-20*01>1_IGHJ1*01 2218
362 gi|Fabrus|VH3-23_IGHD1-20*01>3_IGHJ1*01 2219
363 gi|Fabrus|VH3-23_IGHD1-26*01>1_IGHJ1*01 2220
364 gi|Fabrus|VH3-23_IGHD1-26*01>3_IGHJ1*01 2221
365 gi|Fabrus|VH3-23_IGHD2-2*01>2_IGHJ1*01 2222
366 gi|Fabrus|VH3-23_IGHD2-2*01>3_IGHJ1*01 2223
367 gi|Fabrus|VH3-23_IGHD2-8*01>2_IGHJ1*01 2224
368 gi|Fabrus|VH3-23_IGHD2-8*01>3_IGHJ1*01 2225
369 gi|Fabrus|VH3-23_IGHD2-15*01>2_IGHJ1*01 2226
370 gi|Fabrus|VH3-23_IGHD2-15*01>3_IGHJ1*01 2227
371 gi|Fabrus|VH3-23_IGHD2-21*01>2_IGHJ1*01 2228
372 gi|Fabrus|VH3-23_IGHD2-21*01>3_IGHJ1*01 2229
373 gi|Fabrus|VH3-23_IGHD3-3*01>1_IGHJ1*01 2230
374 gi|Fabrus|VH3-23_IGHD3-3*01>2_IGHJ1*01 2231
375 gi|Fabrus|VH3-23_IGHD3-3*01>3_IGHJ1*01 2232
376 gi|Fabrus|VH3-23_IGHD3-9*01>2_IGHJ1*01 2233
377 gi|Fabrus|VH3-23_IGHD3-10*01>2_IGHJ1*01 2234
378 gi|Fabrus|VH3-23_IGHD3-10*01>3_IGHJ1*01 2235
379 gi|Fabrus|VH3-23_IGHD3-16*01>2_IGHJ1*01 2236
380 gi|Fabrus|VH3-23_IGHD3-16*01>3_IGHJ1*01 2237
381 gi|Fabrus|VH3-23_IGHD3-22*01>2_IGHJ1*01 2238
382 gi|Fabrus|VH3-23_IGHD3-22*01>3_IGHJ1*01 2239
383 gi|Fabrus|VH3-23_IGHD4-4*01(1)>2_IGHJ1*01 2240
384 gi|Fabrus|VH3-23_IGHD4-4*01(1)>3_IGHJ1*01 2241
385 gi|Fabrus|VH3-23_IGHD4-11*01(1)>2_IGHJ1*01 2242
386 gi|Fabrus|VH3-23_IGHD4-11*01(1)>3_IGHJ1*01 2243
387 gi|Fabrus|VH3-23_IGHD4-17*01>2_IGHJ1*01 2244
388 gi|Fabrus|VH3-23_IGHD4-17*01>3_IGHJ1*01 2245
389 gi|Fabrus|VH3-23_IGHD4-23*01>2_IGHJ1*01 2246
390 gi|Fabrus|VH3-23_IGHD4-23*01>3_IGHJ1*01 2247
391 gi|Fabrus|VH3-23_IGHD5-5*01(2)>1_IGHJ1*01 2248
392 gi|Fabrus|VH3-23_IGHD5-5*01(2)>2_IGHJ1*01 2249
393 gi|Fabrus|VH3-23_IGHD5-5*01(2)>3_IGHJ1*01 2250
394 gi|Fabrus|VH3-23_IGHD5-12*01>1_IGHJ1*01 2251
395 gi|Fabrus|VH3-23_IGHD5-12*01>3_IGHJ1*01 2252
396 gi|Fabrus|VH3-23_IGHD5-18*01(2)>1_IGHJ1*01 2253
397 gi|Fabrus|VH3-23_IGHD5-18*01(2)>2_IGHJ1*01 2254
398 gi|Fabrus|VH3-23_IGHD5-18*01(2)>3_IGHJ1*01 2255
399 gi|Fabrus|VH3-23_IGHD5-24*01>1_IGHJ1*01 2256
400 gi|Fabrus|VH3-23_IGHD5-24*01>3_IGHJ1*01 2257
401 gi|Fabrus|VH3-23_IGHD6-6*01>1_IGHJ1*01 2258
402 gi|Fabrus|VH3-23_IGHD6-6*01>2_IGHJ1*01 2259
403 gi|Fabrus|VH3-23_IGHD6-13*01>1_IGHJ1*01 2260
404 gi|Fabrus|VH3-23_IGHD6-13*01>2_IGHJ1*01 2261
405 gi|Fabrus|VH3-23_IGHD6-19*01>1_IGHJ1*01 2262
406 gi|Fabrus|VH3-23_IGHD6-19*01>2_IGHJ1*01 2263
407 gi|Fabrus|VH3-23_IGHD6-25*01>1_IGHJ1*01 2264
408 gi|Fabrus|VH3-23_IGHD6-25*01>2_IGHJ1*01 2265
409 gi|Fabrus|VH3-23_IGHD7-27*01>1_IGHJ1*01 2266
410 gi|Fabrus|VH3-23_IGHD7-27*01>3_IGHJ1*01 2267
411 gi|Fabrus|VH3-23_IGHD1-1*01>1′_IGHJ1*01 2268
412 gi|Fabrus|VH3-23_IGHD1-1*01>2′_IGHJ1*01 2269
413 gi|Fabrus|VH3-23_IGHD1-1*01>3′_IGHJ1*01 2270
414 gi|Fabrus|VH3-23_IGHD1-7*01>1′_IGHJ1*01 2271
415 gi|Fabrus|VH3-23_IGHD1-7*01>3′_IGHJ1*01 2272
416 gi|Fabrus|VH3-23_IGHD1-14*01>1′_IGHJ1*01 2273
417 gi|Fabrus|VH3-23_IGHD1-14*01>2′_IGHJ1*01 2274
418 gi|Fabrus|VH3-23_IGHD1-14*01>3′_IGHJ1*01 2275
419 gi|Fabrus|VH3-23_IGHD1-20*01>1′_IGHJ1*01 2276
420 gi|Fabrus|VH3-23_IGHD1-20*01>2′_IGHJ1*01 2277
421 gi|Fabrus|VH3-23_IGHD1-20*01>3′_IGHJ1*01 2278
422 gi|Fabrus|VH3-23_IGHD1-26*01>1′_IGHJ1*01 2279
423 gi|Fabrus|VH3-23_IGHD1-26*01>3′_IGHJ1*01 2280
424 gi|Fabrus|VH3-23_IGHD2-2*01>1′_IGHJ1*01 2281
425 gi|Fabrus|VH3-23_IGHD2-2*01>3′_IGHJ1*01 2282
426 gi|Fabrus|VH3-23_IGHD2-8*01>1′_IGHJ1*01 2283
427 gi|Fabrus|VH3-23_IGHD2-15*01>1′_IGHJ1*01 2284
428 gi|Fabrus|VH3-23_IGHD2-15*01>3′_IGHJ1*01 2285
429 gi|Fabrus|VH3-23_IGHD2-21*01>1′_IGHJ1*01 2286
430 gi|Fabrus|VH3-23_IGHD2-21*01>3′_IGHJ1*01 2287
431 gi|Fabrus|VH3-23_IGHD3-3*01>1′_IGHJ1*01 2288
432 gi|Fabrus|VH3-23_IGHD3-3*01>3′_IGHJ1*01 2289
433 gi|Fabrus|VH3-23_IGHD3-9*01>1′_IGHJ1*01 2290
434 gi|Fabrus|VH3-23_IGHD3-9*01>3′_IGHJ1*01 2291
435 gi|Fabrus|VH3-23_IGHD3-10*01>1′_IGHJ1*01 2292
436 gi|Fabrus|VH3-23_IGHD3-10*01>3′_IGHJ1*01 2293
437 gi|Fabrus|VH3-23_IGHD3-16*01>1′_IGHJ1*01 2294
438 gi|Fabrus|VH3-23_IGHD3-16*01>3′_IGHJ1*01 2295
439 gi|Fabrus|VH3-23_IGHD3-22*01>1′_IGHJ1*01 2296
440 gi|Fabrus|VH3-23_IGHD4-4*01(1)>1′_IGHJ1*01 2297
441 gi|Fabrus|VH3-23_IGHD4-4*01(1)>3′_IGHJ1*01 2298
442 gi|Fabrus|VH3-23_IGHD4-11*01(1)>1′_IGHJ1*01 2299
443 gi|Fabrus|VH3-23_IGHD4-11*01(1)>3′_IGHJ1*01 2300
444 gi|Fabrus|VH3-23_IGHD4-17*01>1′_IGHJ1*01 2301
445 gi|Fabrus|VH3-23_IGHD4-17*01>3′_IGHJ1*01 2302
446 gi|Fabrus|VH3-23_IGHD4-23*01>1′_IGHJ1*01 2303
447 gi|Fabrus|VH3-23_IGHD4-23*01>3′_IGHJ1*01 2304
448 gi|Fabrus|VH3-23_IGHD5-5*01(2)>1′_IGHJ1*01 2305
449 gi|Fabrus|VH3-23_IGHD5-5*01(2)>3′_IGHJ1*01 2306
450 gi|Fabrus|VH3-23_IGHD5-12*01>1′_IGHJ1*01 2307
451 gi|Fabrus|VH3-23_IGHD5-12*01>3′_IGHJ1*01 2308
452 gi|Fabrus|VH3-23_IGHD5-18*01(2)>1′_IGHJ1*01 2309
453 gi|Fabrus|VH3-23_IGHD5-18*01(2)>3′_IGHJ1*01 2310
454 gi|Fabrus|VH3-23_IGHD5-24*01>1′_IGHJ1*01 2311
455 gi|Fabrus|VH3-23_IGHD5-24*01>3′_IGHJ1*01 2312
456 gi|Fabrus|VH3-23_IGHD6-6*01>1′_IGHJ1*01 2313
457 gi|Fabrus|VH3-23_IGHD6-6*01>2′_IGHJ1*01 2314
458 gi|Fabrus|VH3-23_IGHD6-6*01>3′_IGHJ1*01 2315
459 gi|Fabrus|VH3-23_IGHD6-13*01>1′_IGHJ1*01 2316
460 gi|Fabrus|VH3-23_IGHD6-13*01>2′_IGHJ1*01 2317
461 gi|Fabrus|VH3-23_IGHD6-13*01>3′_IGHJ1*01 2318
462 gi|Fabrus|VH3-23_IGHD6-19*01>1′_IGHJ1*01 2319
463 gi|Fabrus|VH3-23_IGHD6-19*01>2′_IGHJ1*01 2320
464 gi|Fabrus|VH3-23_IGHD6-19*01>3′_IGHJ1*01 2321
465 gi|Fabrus|VH3-23_IGHD6-25*01>1′_IGHJ1*01 2322
466 gi|Fabrus|VH3-23_IGHD6-25*01>3′_IGHJ1*01 2323
467 gi|Fabrus|VH3-23_IGHD7-27*01>1′_IGHJ1*01 2324
468 gi|Fabrus|VH3-23_IGHD7-27*01>2′_IGHJ1*01 2325
469 gi|Fabrus|VH3-23_IGHD1-1*01>1_IGHJ2*01 2326
470 gi|Fabrus|VH3-23_IGHD1-1*01>2_IGHJ2*01 2327
471 gi|Fabrus|VH3-23_IGHD1-1*01>3_IGHJ2*01 2328
472 gi|Fabrus|VH3-23_IGHD1-7*01>1_IGHJ2*01 2329
473 gi|Fabrus|VH3-23_IGHD1-7*01>3_IGHJ2*01 2330
474 gi|Fabrus|VH3-23_IGHD1-14*01>1_IGHJ2*01 2331
475 gi|Fabrus|VH3-23_IGHD1-14*01>3_IGHJ2*01 2332
476 gi|Fabrus|VH3-23_IGHD1-20*01>1_IGHJ2*01 2333
477 gi|Fabrus|VH3-23_IGHD1-20*01>3_IGHJ2*01 2334
478 gi|Fabrus|VH3-23_IGHD1-26*01>1_IGHJ2*01 2335
479 gi|Fabrus|VH3-23_IGHD1-26*01>3_IGHJ2*01 2336
480 gi|Fabrus|VH3-23_IGHD2-2*01>2_IGHJ2*01 2337
481 gi|Fabrus|VH3-23_IGHD2-2*01>3_IGHJ2*01 2338
482 gi|Fabrus|VH3-23_IGHD2-8*01>2_IGHJ2*01 2339
483 gi|Fabrus|VH3-23_IGHD2-8*01>3_IGHJ2*01 2340
484 gi|Fabrus|VH3-23_IGHD2-15*01>2_IGHJ2*01 2341
485 gi|Fabrus|VH3-23_IGHD2-15*01>3_IGHJ2*01 2342
486 gi|Fabrus|VH3-23_IGHD2-21*01>2_IGHJ2*01 2343
487 gi|Fabrus|VH3-23_IGHD2-21*01>3_IGHJ2*01 2344
488 gi|Fabrus|VH3-23_IGHD3-3*01>1_IGHJ2*01 2345
489 gi|Fabrus|VH3-23_IGHD3-3*01>2_IGHJ2*01 2346
490 gi|Fabrus|VH3-23_IGHD3-3*01>3_IGHJ2*01 2347
491 gi|Fabrus|VH3-23_IGHD3-9*01>2_IGHJ2*01 2348
492 gi|Fabrus|VH3-23_IGHD3-10*01>2_IGHJ2*01 2349
493 gi|Fabrus|VH3-23_IGHD3-10*01>3_IGHJ2*01 2350
494 gi|Fabrus|VH3-23_IGHD3-16*01>2_IGHJ2*01 2351
495 gi|Fabrus|VH3-23_IGHD3-16*01>3_IGHJ2*01 2352
496 gi|Fabrus|VH3-23_IGHD3-22*01>2_IGHJ2*01 2353
497 gi|Fabrus|VH3-23_IGHD3-22*01>3_IGHJ2*01 2354
498 gi|Fabrus|VH3-23_IGHD4-4*01(1)>2_IGHJ2*01 2355
499 gi|Fabrus|VH3-23_IGHD4-4*01(1)>3_IGHJ2*01 2356
500 gi|Fabrus|VH3-23_IGHD4-11*01(1)>2_IGHJ2*01 2357
501 gi|Fabrus|VH3-23_IGHD4-11*01(1)>3_IGHJ2*01 2358
502 gi|Fabrus|VH3-23_IGHD4-17*01>2_IGHJ2*01 2359
503 gi|Fabrus|VH3-23_IGHD4-17*01>3_IGHJ2*01 2360
504 gi|Fabrus|VH3-23_IGHD4-23*01>2_IGHJ2*01 2361
505 gi|Fabrus|VH3-23_IGHD4-23*01>3_IGHJ2*01 2362
506 gi|Fabrus|VH3-23_IGHD5-5*01(2)>1_IGHJ2*01 2363
507 gi|Fabrus|VH3-23_IGHD5-5*01(2)>2_IGHJ2*01 2364
508 gi|Fabrus|VH3-23_IGHD5-5*01(2)>3_IGHJ2*01 2365
509 gi|Fabrus|VH3-23_IGHD5-12*01>1_IGHJ2*01 2366
510 gi|Fabrus|VH3-23_IGHD5-12*01>3_IGHJ2*01 2367
511 gi|Fabrus|VH3-23_IGHD5-18*01(2)>1_IGHJ2*01 2368
512 gi|Fabrus|VH3-23_IGHD5-18*01(2)>2_IGHJ2*01 2369
513 gi|Fabrus|VH3-23_IGHD5-18*01(2)>3_IGHJ2*01 2370
514 gi|Fabrus|VH3-23_IGHD5-24*01>1_IGHJ2*01 2371
515 gi|Fabrus|VH3-23_IGHD5-24*01>3_IGHJ2*01 2372
516 gi|Fabrus|VH3-23_IGHD6-6*01>1_IGHJ2*01 2373
517 gi|Fabrus|VH3-23_IGHD6-6*01>2_IGHJ2*01 2374
518 gi|Fabrus|VH3-23_IGHD6-13*01>1_IGHJ2*01 2375
519 gi|Fabrus|VH3-23_IGHD6-13*01>2_IGHJ2*01 2376
520 gi|Fabrus|VH3-23_IGHD6-19*01>1_IGHJ2*01 2377
521 gi|Fabrus|VH3-23_IGHD6-19*01>2_IGHJ2*01 2378
522 gi|Fabrus|VH3-23_IGHD6-25*01>1_IGHJ2*01 2379
523 gi|Fabrus|VH3-23_IGHD6-25*01>2_IGHJ2*01 2380
524 gi|Fabrus|VH3-23_IGHD7-27*01>1_IGHJ2*01 2381
525 gi|Fabrus|VH3-23_IGHD7-27*01>3_IGHJ2*01 2382
526 gi|Fabrus|VH3-23_IGHD1-1*01>1′_IGHJ2*01 2383
527 gi|Fabrus|VH3-23_IGHD1-1*01>2′_IGHJ2*01 2384
528 gi|Fabrus|VH3-23_IGHD1-1*01>3′_IGHJ2*01 2385
529 gi|Fabrus|VH3-23_IGHD1-7*01>1′_IGHJ2*01 2386
530 gi|Fabrus|VH3-23_IGHD1-7*01>3′_IGHJ2*01 2387
531 gi|Fabrus|VH3-23_IGHD1-14*01>1′_IGHJ2*01 2388
532 gi|Fabrus|VH3-23_IGHD1-14*01>2′_IGHJ2*01 2389
533 gi|Fabrus|VH3-23_IGHD1-14*01>3′_IGHJ2*01 2390
534 gi|Fabrus|VH3-23_IGHD1-20*01>1′_IGHJ2*01 2391
535 gi|Fabrus|VH3-23_IGHD1-20*01>2′_IGHJ2*01 2392
536 gi|Fabrus|VH3-23_IGHD1-20*01>3′_IGHJ2*01 2393
537 gi|Fabrus|VH3-23_IGHD1-26*01>1′_IGHJ2*01 2394
538 gi|Fabrus|VH3-23_IGHD1-26*01>3′_IGHJ2*01 2395
539 gi|Fabrus|VH3-23_IGHD2-2*01>1′_IGHJ2*01 2396
540 gi|Fabrus|VH3-23_IGHD2-2*01>3′_IGHJ2*01 2397
541 gi|Fabrus|VH3-23_IGHD2-8*01>1′_IGHJ2*01 2398
542 gi|Fabrus|VH3-23_IGHD2-15*01>1′_IGHJ2*01 2399
543 gi|Fabrus|VH3-23_IGHD2-15*01>3′_IGHJ2*01 2400
544 gi|Fabrus|VH3-23_IGHD2-21*01>1′_IGHJ2*01 2401
545 gi|Fabrus|VH3-23_IGHD2-21*01>3′_IGHJ2*01 2402
546 gi|Fabrus|VH3-23_IGHD3-3*01>1′_IGHJ2*01 2403
547 gi|Fabrus|VH3-23_IGHD3-3*01>3′_IGHJ2*01 2404
548 gi|Fabrus|VH3-23_IGHD3-9*01>1′_IGHJ2*01 2405
549 gi|Fabrus|VH3-23_IGHD3-9*01>3′_IGHJ2*01 2406
550 gi|Fabrus|VH3-23_IGHD3-10*01>1′_IGHJ2*01 2407
551 gi|Fabrus|VH3-23_IGHD3-10*01>3′_IGHJ2*01 2408
552 gi|Fabrus|VH3-23_IGHD3-16*01>1′_IGHJ2*01 2409
553 gi|Fabrus|VH3-23_IGHD3-16*01>3′_IGHJ2*01 2410
554 gi|Fabrus|VH3-23_IGHD3-22*01>1′_IGHJ2*01 2411
555 gi|Fabrus|VH3-23_IGHD4-4*01(1)>1′_IGHJ2*01 2412
556 gi|Fabrus|VH3-23_IGHD4-4*01(1)>3′_IGHJ2*01 2413
557 gi|Fabrus|VH3-23_IGHD4-11*01(1)>1′_IGHJ2*01 2414
558 gi|Fabrus|VH3-23_IGHD4-11*01(1)>3′_IGHJ2*01 2415
559 gi|Fabrus|VH3-23_IGHD4-17*01>1′_IGHJ2*01 2416
560 gi|Fabrus|VH3-23_IGHD4-17*01>3′_IGHJ2*01 2417
561 gi|Fabrus|VH3-23_IGHD4-23*01>1′_IGHJ2*01 2418
562 gi|Fabrus|VH3-23_IGHD4-23*01>3′_IGHJ2*01 2419
563 gi|Fabrus|VH3-23_IGHD5-5*01(2)>1′_IGHJ2*01 2420
564 gi|Fabrus|VH3-23_IGHD5-5*01(2)>3′_IGHJ2*01 2421
565 gi|Fabrus|VH3-23_IGHD5-12*01>1′_IGHJ2*01 2422
566 gi|Fabrus|VH3-23_IGHD5-12*01>3′_IGHJ2*01 2423
567 gi|Fabrus|VH3-23_IGHD5-18*01(2)>1′_IGHJ2*01 2424
568 gi|Fabrus|VH3-23_IGHD5-18*01(2)>3′_IGHJ2*01 2425
569 gi|Fabrus|VH3-23_IGHD5-24*01>1′_IGHJ2*01 2426
570 gi|Fabrus|VH3-23_IGHD5-24*01>3′_IGHJ2*01 2427
571 gi|Fabrus|VH3-23_IGHD6-6*01>1′_IGHJ2*01 2428
572 gi|Fabrus|VH3-23_IGHD6-6*01>2′_IGHJ2*01 2429
573 gi|Fabrus|VH3-23_IGHD6-6*01>3′_IGHJ2*01 2430
574 gi|Fabrus|VH3-23_IGHD6-13*01>1′_IGHJ2*01 2431
575 gi|Fabrus|VH3-23_IGHD6-13*01>2′_IGHJ2*01 2432
576 gi|Fabrus|VH3-23_IGHD6-13*01>3′_IGHJ2*01 2433
577 gi|Fabrus|VH3-23_IGHD6-19*01>1′_IGHJ2*01 2434
578 gi|Fabrus|VH3-23_IGHD6-19*01>2′_IGHJ2*01 2435
579 gi|Fabrus|VH3-23_IGHD6-19*01>3′_IGHJ2*01 2436
580 gi|Fabrus|VH3-23_IGHD6-25*01>1′_IGHJ2*01 2437
581 gi|Fabrus|VH3-23_IGHD6-25*01>3′_IGHJ2*01 2438
582 gi|Fabrus|VH3-23_IGHD7-27*01>1′_IGHJ2*01 2439
583 gi|Fabrus|VH3-23_IGHD7-27*01>2′_IGHJ2*01 2440
584 gi|Fabrus|VH3-23_IGHD1-1*01>1_IGHJ3*01 2441
585 gi|Fabrus|VH3-23_IGHD1-1*01>2_IGHJ3*01 2442
586 gi|Fabrus|VH3-23_IGHD1-1*01>3_IGHJ3*01 2443
587 gi|Fabrus|VH3-23_IGHD1-7*01>1_IGHJ3*01 2444
588 gi|Fabrus|VH3-23_IGHD1-7*01>3_IGHJ3*01 2445
589 gi|Fabrus|VH3-23_IGHD1-14*01>1_IGHJ3*01 2446
590 gi|Fabrus|VH3-23_IGHD1-14*01>3_IGHJ3*01 2447
591 gi|Fabrus|VH3-23_IGHD1-20*01>1_IGHJ3*01 2448
592 gi|Fabrus|VH3-23_IGHD1-20*01>3_IGHJ3*01 2449
593 gi|Fabrus|VH3-23_IGHD1-26*01>1_IGHJ3*01 2450
594 gi|Fabrus|VH3-23_IGHD1-26*01>3_IGHJ3*01 2451
595 gi|Fabrus|VH3-23_IGHD2-2*01>2_IGHJ3*01 2452
596 gi|Fabrus|VH3-23_IGHD2-2*01>3_IGHJ3*01 2453
597 gi|Fabrus|VH3-23_IGHD2-8*01>2_IGHJ3*01 2454
598 gi|Fabrus|VH3-23_IGHD2-8*01>3_IGHJ3*01 2455
599 gi|Fabrus|VH3-23_IGHD2-15*01>2_IGHJ3*01 2456
600 gi|Fabrus|VH3-23_IGHD2-15*01>3_IGHJ3*01 2457
601 gi|Fabrus|VH3-23_IGHD2-21*01>2_IGHJ3*01 2458
602 gi|Fabrus|VH3-23_IGHD2-21*01>3_IGHJ3*01 2459
603 gi|Fabrus|VH3-23_IGHD3-3*01>1_IGHJ3*01 2460
604 gi|Fabrus|VH3-23_IGHD3-3*01>2_IGHJ3*01 2461
605 gi|Fabrus|VH3-23_IGHD3-3*01>3_IGHJ3*01 2462
606 gi|Fabrus|VH3-23_IGHD3-9*01>2_IGHJ3*01 2463
607 gi|Fabrus|VH3-23_IGHD3-10*01>2_IGHJ3*01 2464
608 gi|Fabrus|VH3-23_IGHD3-10*01>3_IGHJ3*01 2465
609 gi|Fabrus|VH3-23_IGHD3-16*01>2_IGHJ3*01 2466
610 gi|Fabrus|VH3-23_IGHD3-16*01>3_IGHJ3*01 2467
611 gi|Fabrus|VH3-23_IGHD3-22*01>2_IGHJ3*01 2468
612 gi|Fabrus|VH3-23_IGHD3-22*01>3_IGHJ3*01 2469
613 gi|Fabrus|VH3-23_IGHD4-4*01(1)>2_IGHJ3*01 2470
614 gi|Fabrus|VH3-23_IGHD4-4*01(1)>3_IGHJ3*01 2471
615 gi|Fabrus|VH3-23_IGHD4-11*01(1)>2_IGHJ3*01 2472
616 gi|Fabrus|VH3-23_IGHD4-11*01(1)>3_IGHJ3*01 2473
617 gi|Fabrus|VH3-23_IGHD4-17*01>2_IGHJ3*01 2474
618 gi|Fabrus|VH3-23_IGHD4-17*01>3_IGHJ3*01 2475
619 gi|Fabrus|VH3-23_IGHD4-23*01>2_IGHJ3*01 2476
620 gi|Fabrus|VH3-23_IGHD4-23*01>3_IGHJ3*01 2477
621 gi|Fabrus|VH3-23_IGHD5-5*01(2)>1_IGHJ3*01 2478
622 gi|Fabrus|VH3-23_IGHD5-5*01(2)>2_IGHJ3*01 2479
623 gi|Fabrus|VH3-23_IGHD5-5*01(2)>3_IGHJ3*01 2480
624 gi|Fabrus|VH3-23_IGHD5-12*01>1_IGHJ3*01 2481
625 gi|Fabrus|VH3-23_IGHD5-12*01>3_IGHJ3*01 2482
626 gi|Fabrus|VH3-23_IGHD5-18*01(2)>1_IGHJ3*01 2483
627 gi|Fabrus|VH3-23_IGHD5-18*01(2)>2_IGHJ3*01 2484
628 gi|Fabrus|VH3-23_IGHD5-18*01(2)>3_IGHJ3*01 2485
629 gi|Fabrus|VH3-23_IGHD5-24*01>1_IGHJ3*01 2486
630 gi|Fabrus|VH3-23_IGHD5-24*01>3_IGHJ3*01 2487
631 gi|Fabrus|VH3-23_IGHD6-6*01>1_IGHJ3*01 2488
632 gi|Fabrus|VH3-23_IGHD6-6*01>2_IGHJ3*01 2489
633 gi|Fabrus|VH3-23_IGHD6-13*01>1_IGHJ3*01 2490
634 gi|Fabrus|VH3-23_IGHD6-13*01>2_IGHJ3*01 2491
635 gi|Fabrus|VH3-23_IGHD6-19*01>1_IGHJ3*01 2492
636 gi|Fabrus|VH3-23_IGHD6-19*01>2_IGHJ3*01 2493
637 gi|Fabrus|VH3-23_IGHD6-25*01>1_IGHJ3*01 2494
638 gi|Fabrus|VH3-23_IGHD6-25*01>2_IGHJ3*01 2495
639 gi|Fabrus|VH3-23_IGHD7-27*01>1_IGHJ3*01 2496
640 gi|Fabrus|VH3-23_IGHD7-27*01>3_IGHJ3*01 2497
641 gi|Fabrus|VH3-23_IGHD1-1*01>1′_IGHJ3*01 2498
642 gi|Fabrus|VH3-23_IGHD1-1*01>2′_IGHJ3*01 2499
643 gi|Fabrus|VH3-23_IGHD1-1*01>3′_IGHJ3*01 2500
644 gi|Fabrus|VH3-23_IGHD1-7*01>1′_IGHJ3*01 2501
645 gi|Fabrus|VH3-23_IGHD1-7*01>3′_IGHJ3*01 2502
646 gi|Fabrus|VH3-23_IGHD1-14*01>1′_IGHJ3*01 2503
647 gi|Fabrus|VH3-23_IGHD1-14*01>2′_IGHJ3*01 2504
648 gi|Fabrus|VH3-23_IGHD1-14*01>3′_IGHJ3*01 2505
649 gi|Fabrus|VH3-23_IGHD1-20*01>1′_IGHJ3*01 2506
650 gi|Fabrus|VH3-23_IGHD1-20*01>2′_IGHJ3*01 2507
651 gi|Fabrus|VH3-23_IGHD1-20*01>3′_IGHJ3*01 2508
652 gi|Fabrus|VH3-23_IGHD1-26*01>1′_IGHJ3*01 2509
653 gi|Fabrus|VH3-23_IGHD1-26*01>3′_IGHJ3*01 2510
654 gi|Fabrus|VH3-23_IGHD2-2*01>1′_IGHJ3*01 2511
655 gi|Fabrus|VH3-23_IGHD2-2*01>3′_IGHJ3*01 2512
656 gi|Fabrus|VH3-23_IGHD2-8*01>1′_IGHJ3*01 2513
657 gi|Fabrus|VH3-23_IGHD2-15*01>1′_IGHJ3*01 2514
658 gi|Fabrus|VH3-23_IGHD2-15*01>3′_IGHJ3*01 2515
659 gi|Fabrus|VH3-23_IGHD2-21*01>1′_IGHJ3*01 2516
660 gi|Fabrus|VH3-23_IGHD2-21*01>3′_IGHJ3*01 2517
661 gi|Fabrus|VH3-23_IGHD3-3*01>1′_IGHJ3*01 2518
662 gi|Fabrus|VH3-23_IGHD3-3*01>3′_IGHJ3*01 2519
663 gi|Fabrus|VH3-23_IGHD3-9*01>1′_IGHJ3*01 2520
664 gi|Fabrus|VH3-23_IGHD3-9*01>3′_IGHJ3*01 2521
665 gi|Fabrus|VH3-23_IGHD3-10*01>1′_IGHJ3*01 105
666 gi|Fabrus|VH3-23_IGHD3-10*01>3′_IGHJ3*01 2522
667 gi|Fabrus|VH3-23_IGHD3-16*01>1′_IGHJ3*01 2523
668 gi|Fabrus|VH3-23_IGHD3-16*01>3′_IGHJ3*01 2524
669 gi|Fabrus|VH3-23_IGHD3-22*01>1′_IGHJ3*01 2525
670 gi|Fabrus|VH3-23_IGHD4-4*01(1)>1′_IGHJ3*01 2526
671 gi|Fabrus|VH3-23_IGHD4-4*01(1)>3′_IGHJ3*01 2527
672 gi|Fabrus|VH3-23_IGHD4-11*01(1)>1′_IGHJ3*01 2528
673 gi|Fabrus|VH3-23_IGHD4-11*01(1)>3′_IGHJ3*01 2529
674 gi|Fabrus|VH3-23_IGHD4-17*01>1′_IGHJ3*01 2530
675 gi|Fabrus|VH3-23_IGHD4-17*01>3′_IGHJ3*01 2531
676 gi|Fabrus|VH3-23_IGHD4-23*01>1′_IGHJ3*01 2532
677 gi|Fabrus|VH3-23_IGHD4-23*01>3′_IGHJ3*01 2533
678 gi|Fabrus|VH3-23_IGHD5-5*01(2)>1′_IGHJ3*01 2534
679 gi|Fabrus|VH3-23_IGHD5-5*01(2)>3′_IGHJ3*01 2535
680 gi|Fabrus|VH3-23_IGHD5-12*01>1′_IGHJ3*01 2536
681 gi|Fabrus|VH3-23_IGHD5-12*01>3′_IGHJ3*01 2537
682 gi|Fabrus|VH3-23_IGHD5-18*01(2)>1′_IGHJ3*01 2538
683 gi|Fabrus|VH3-23_IGHD5-18*01(2)>3′_IGHJ3*01 2539
684 gi|Fabrus|VH3-23_IGHD5-24*01>1′_IGHJ3*01 2540
685 gi|Fabrus|VH3-23_IGHD5-24*01>3′_IGHJ3*01 2541
686 gi|Fabrus|VH3-23_IGHD6-6*01>1′_IGHJ3*01 2542
687 gi|Fabrus|VH3-23_IGHD6-6*01>2′_IGHJ3*01 2543
688 gi|Fabrus|VH3-23_IGHD6-6*01>3′_IGHJ3*01 2544
689 gi|Fabrus|VH3-23_IGHD6-13*01>1′_IGHJ3*01 2545
690 gi|Fabrus|VH3-23_IGHD6-13*01>2′_IGHJ3*01 2546
691 gi|Fabrus|VH3-23_IGHD6-13*01>3′_IGHJ3*01 2547
692 gi|Fabrus|VH3-23_IGHD6-19*01>1′_IGHJ3*01 2548
693 gi|Fabrus|VH3-23_IGHD6-19*01>2′_IGHJ3*01 2549
694 gi|Fabrus|VH3-23_IGHD6-19*01>3′_IGHJ3*01 2550
695 gi|Fabrus|VH3-23_IGHD6-25*01>1′_IGHJ3*01 2551
696 gi|Fabrus|VH3-23_IGHD6-25*01>3′_IGHJ3*01 2552
697 gi|Fabrus|VH3-23_IGHD7-27*01>1′_IGHJ3*01 2553
698 gi|Fabrus|VH3-23_IGHD7-27*01>2′_IGHJ3*01 2554
699 gi|Fabrus|VH3-23_IGHD1-1*01>1_IGHJ4*01 2555
700 gi|Fabrus|VH3-23_IGHD1-1*01>2_IGHJ4*01 2556
701 gi|Fabrus|VH3-23_IGHD1-1*01>3_IGHJ4*01 2557
702 gi|Fabrus|VH3-23_IGHD1-7*01>1_IGHJ4*01 2558
703 gi|Fabrus|VH3-23_IGHD1-7*01>3_IGHJ4*01 2559
704 gi|Fabrus|VH3-23_IGHD1-14*01>1_IGHJ4*01 2560
705 gi|Fabrus|VH3-23_IGHD1-14*01>3_IGHJ4*01 2561
706 gi|Fabrus|VH3-23_IGHD1-20*01>1_IGHJ4*01 2562
707 gi|Fabrus|VH3-23_IGHD1-20*01>3_IGHJ4*01 2563
708 gi|Fabrus|VH3-23_IGHD1-26*01>1_IGHJ4*01 2564
709 gi|Fabrus|VH3-23_IGHD1-26*01>3_IGHJ4*01 2565
710 gi|Fabrus|VH3-23_IGHD2-2*01>2_IGHJ4*01 2566
711 gi|Fabrus|VH3-23_IGHD2-2*01>3_IGHJ4*01 2567
712 gi|Fabrus|VH3-23_IGHD2-8*01>2_IGHJ4*01 2568
713 gi|Fabrus|VH3-23_IGHD2-8*01>3_IGHJ4*01 2569
714 gi|Fabrus|VH3-23_IGHD2-15*01>2_IGHJ4*01 2570
715 gi|Fabrus|VH3-23_IGHD2-15*01>3_IGHJ4*01 2571
716 gi|Fabrus|VH3-23_IGHD2-21*01>2_IGHJ4*01 2572
717 gi|Fabrus|VH3-23_IGHD2-21*01>3_IGHJ4*01 2573
718 gi|Fabrus|VH3-23_IGHD3-3*01>1_IGHJ4*01 2574
719 gi|Fabrus|VH3-23_IGHD3-3*01>2_IGHJ4*01 2575
720 gi|Fabrus|VH3-23_IGHD3-3*01>3_IGHJ4*01 2576
721 gi|Fabrus|VH3-23_IGHD3-9*01>2_IGHJ4*01 2577
722 gi|Fabrus|VH3-23_IGHD3-10*01>2_IGHJ4*01 2578
723 gi|Fabrus|VH3-23_IGHD3-10*01>3_IGHJ4*01 2579
724 gi|Fabrus|VH3-23_IGHD3-16*01>2_IGHJ4*01 2580
725 gi|Fabrus|VH3-23_IGHD3-16*01>3_IGHJ4*01 2581
726 gi|Fabrus|VH3-23_IGHD3-22*01>2_IGHJ4*01 2582
727 gi|Fabrus|VH3-23_IGHD3-22*01>3_IGHJ4*01 2583
728 gi|Fabrus|VH3-23_IGHD4-4*01(1)>2_IGHJ4*01 2584
729 gi|Fabrus|VH3-23_IGHD4-4*01(1)>3_IGHJ4*01 2585
730 gi|Fabrus|VH3-23_IGHD4-11*01(1)>2_IGHJ4*01 2586
731 gi|Fabrus|VH3-23_IGHD4-11*01(1)>3_IGHJ4*01 2587
732 gi|Fabrus|VH3-23_IGHD4-17*01>2_IGHJ4*01 2588
733 gi|Fabrus|VH3-23_IGHD4-17*01>3_IGHJ4*01 2589
734 gi|Fabrus|VH3-23_IGHD4-23*01>2_IGHJ4*01 2590
735 gi|Fabrus|VH3-23_IGHD4-23*01>3_IGHJ4*01 2591
736 gi|Fabrus|VH3-23_IGHD5-5*01(2)>1_IGHJ4*01 2592
737 gi|Fabrus|VH3-23_IGHD5-5*01(2)>2_IGHJ4*01 2593
738 gi|Fabrus|VH3-23_IGHD5-5*01(2)>3_IGHJ4*01 2594
739 gi|Fabrus|VH3-23_IGHD5-12*01>1_IGHJ4*01 2595
740 gi|Fabrus|VH3-23_IGHD5-12*01>3_IGHJ4*01 2596
741 gi|Fabrus|VH3-23_IGHD5-18*01(2)>1_IGHJ4*01 2597
742 gi|Fabrus|VH3-23_IGHD5-18*01(2)>2_IGHJ4*01 2598
743 gi|Fabrus|VH3-23_IGHD5-18*01(2)>3_IGHJ4*01 2599
744 gi|Fabrus|VH3-23_IGHD5-24*01>1_IGHJ4*01 2600
745 gi|Fabrus|VH3-23_IGHD5-24*01>3_IGHJ4*01 2601
746 gi|Fabrus|VH3-23_IGHD6-6*01>1_IGHJ4*01 2602
747 gi|Fabrus|VH3-23_IGHD6-6*01>2_IGHJ4*01 2603
748 gi|Fabrus|VH3-23_IGHD6-13*01>1_IGHJ4*01 2604
749 gi|Fabrus|VH3-23_IGHD6-13*01>2_IGHJ4*01 2605
750 gi|Fabrus|VH3-23_IGHD6-19*01>1_IGHJ4*01 2606
751 gi|Fabrus|VH3-23_IGHD6-19*01>2_IGHJ4*01 2607
752 gi|Fabrus|VH3-23_IGHD6-25*01>1_IGHJ4*01 2608
753 gi|Fabrus|VH3-23_IGHD6-25*01>2_IGHJ4*01 2609
754 gi|Fabrus|VH3-23_IGHD7-27*01>1_IGHJ4*01 2610
755 gi|Fabrus|VH3-23_IGHD7-27*01>3_IGHJ4*01 2611
756 gi|Fabrus|VH3-23_IGHD1-1*01>1′_IGHJ4*01 2612
757 gi|Fabrus|VH3-23_IGHD1-1*01>2′_IGHJ4*01 2613
758 gi|Fabrus|VH3-23_IGHD1-1*01>3′_IGHJ4*01 2614
759 gi|Fabrus|VH3-23_IGHD1-7*01>1′_IGHJ4*01 2615
760 gi|Fabrus|VH3-23_IGHD1-7*01>3′_IGHJ4*01 2616
761 gi|Fabrus|VH3-23_IGHD1-14*01>1′_IGHJ4*01 2617
762 gi|Fabrus|VH3-23_IGHD1-14*01>2′_IGHJ4*01 2618
763 gi|Fabrus|VH3-23_IGHD1-14*01>3′_IGHJ4*01 2619
764 gi|Fabrus|VH3-23_IGHD1-20*01>1′_IGHJ4*01 2620
765 gi|Fabrus|VH3-23_IGHD1-20*01>2′_IGHJ4*01 2621
766 gi|Fabrus|VH3-23_IGHD1-20*01>3′_IGHJ4*01 2622
767 gi|Fabrus|VH3-23_IGHD1-26*01>1′_IGHJ4*01 2623
768 gi|Fabrus|VH3-23_IGHD1-26*01>3′_IGHJ4*01 2624
769 gi|Fabrus|VH3-23_IGHD2-2*01>1′_IGHJ4*01 2625
770 gi|Fabrus|VH3-23_IGHD2-2*01>3′_IGHJ4*01 2626
771 gi|Fabrus|VH3-23_IGHD2-8*01>1′_IGHJ4*01 2627
772 gi|Fabrus|VH3-23_IGHD2-15*01>1′_IGHJ4*01 2628
773 gi|Fabrus|VH3-23_IGHD2-15*01>3′_IGHJ4*01 2629
774 gi|Fabrus|VH3-23_IGHD2-21*01>1′_IGHJ4*01 2630
775 gi|Fabrus|VH3-23_IGHD2-21*01>3′_IGHJ4*01 2631
776 gi|Fabrus|VH3-23_IGHD3-3*01>1′_IGHJ4*01 2632
777 gi|Fabrus|VH3-23_IGHD3-3*01>3′_IGHJ4*01 2633
778 gi|Fabrus|VH3-23_IGHD3-9*01>1′_IGHJ4*01 2634
779 gi|Fabrus|VH3-23_IGHD3-9*01>3′_IGHJ4*01 2635
780 gi|Fabrus|VH3-23_IGHD3-10*01>1′_IGHJ4*01 2636
781 gi|Fabrus|VH3-23_IGHD3-10*01>3′_IGHJ4*01 2637
782 gi|Fabrus|VH3-23_IGHD3-16*01>1′_IGHJ4*01 2638
783 gi|Fabrus|VH3-23_IGHD3-16*01>3′_IGHJ4*01 2639
784 gi|Fabrus|VH3-23_IGHD3-22*01>1′_IGHJ4*01 2640
785 gi|Fabrus|VH3-23_IGHD4-4*01(1)>1′_IGHJ4*01 2641
786 gi|Fabrus|VH3-23_IGHD4-4*01(1)>3′_IGHJ4*01 2642
787 gi|Fabrus|VH3-23_IGHD4-11*01(1)>1′_IGHJ4*01 2643
788 gi|Fabrus|VH3-23_IGHD4-11*01(1)>3′_IGHJ4*01 2644
789 gi|Fabrus|VH3-23_IGHD4-17*01>1′_IGHJ4*01 2645
790 gi|Fabrus|VH3-23_IGHD4-17*01>3′_IGHJ4*01 2646
791 gi|Fabrus|VH3-23_IGHD4-23*01>1′_IGHJ4*01 2647
792 gi|Fabrus|VH3-23_IGHD4-23*01>3′_IGHJ4*01 2648
793 gi|Fabrus|VH3-23_IGHD5-5*01(2)>1′_IGHJ4*01 2649
794 gi|Fabrus|VH3-23_IGHD5-5*01(2)>3′_IGHJ4*01 2650
795 gi|Fabrus|VH3-23_IGHD5-12*01>1′_IGHJ4*01 2651
796 gi|Fabrus|VH3-23_IGHD5-12*01>3′_IGHJ4*01 2652
797 gi|Fabrus|VH3-23_IGHD5-18*01(2)>1′_IGHJ4*01 2653
798 gi|Fabrus|VH3-23_IGHD5-18*01(2)>3′_IGHJ4*01 2654
799 gi|Fabrus|VH3-23_IGHD5-24*01>1′_IGHJ4*01 2655
800 gi|Fabrus|VH3-23_IGHD5-24*01>3′_IGHJ4*01 2656
801 gi|Fabrus|VH3-23_IGHD6-6*01>1′_IGHJ4*01 2657
802 gi|Fabrus|VH3-23_IGHD6-6*01>2′_IGHJ4*01 2658
803 gi|Fabrus|VH3-23_IGHD6-6*01>3′_IGHJ4*01 2659
804 gi|Fabrus|VH3-23_IGHD6-13*01>1′_IGHJ4*01 2660
805 gi|Fabrus|VH3-23_IGHD6-13*01>2′_IGHJ4*01 2661
806 gi|Fabrus|VH3-23_IGHD6-13*01>3′_IGHJ4*01 2662
807 gi|Fabrus|VH3-23_IGHD6-19*01>1′_IGHJ4*01 2663
808 gi|Fabrus|VH3-23_IGHD6-19*01>2′_IGHJ4*01 2664
809 gi|Fabrus|VH3-23_IGHD6-19*01>3′_IGHJ4*01 2665
810 gi|Fabrus|VH3-23_IGHD6-25*01>1′_IGHJ4*01 2666
811 gi|Fabrus|VH3-23_IGHD6-25*01>3′_IGHJ4*01 2667
812 gi|Fabrus|VH3-23_IGHD7-27*01>1′_IGHJ4*01 2668
813 gi|Fabrus|VH3-23_IGHD7-27*01>2′_IGHJ4*01 2669
814 gi|Fabrus|VH3-23_IGHD1-1*01>1_IGHJ5*01 2670
815 gi|Fabrus|VH3-23_IGHD1-1*01>2_IGHJ5*01 2671
816 gi|Fabrus|VH3-23_IGHD1-1*01>3_IGHJ5*01 2672
817 gi|Fabrus|VH3-23_IGHD1-7*01>1_IGHJ5*01 2673
818 gi|Fabrus|VH3-23_IGHD1-7*01>3_IGHJ5*01 2674
819 gi|Fabrus|VH3-23_IGHD1-14*01>1_IGHJ5*01 2675
820 gi|Fabrus|VH3-23_IGHD1-14*01>3_IGHJ5*01 2676
821 gi|Fabrus|VH3-23_IGHD1-20*01>1_IGHJ5*01 2677
822 gi|Fabrus|VH3-23_IGHD1-20*01>3_IGHJ5*01 2678
823 gi|Fabrus|VH3-23_IGHD1-26*01>1_IGHJ5*01 2679
824 gi|Fabrus|VH3-23_IGHD1-26*01>3_IGHJ5*01 2680
825 gi|Fabrus|VH3-23_IGHD2-2*01>2_IGHJ5*01 2681
826 gi|Fabrus|VH3-23_IGHD2-2*01>3_IGHJ5*01 2682
827 gi|Fabrus|VH3-23_IGHD2-8*01>2_IGHJ5*01 2683
828 gi|Fabrus|VH3-23_IGHD2-8*01>3_IGHJ5*01 2684
829 gi|Fabrus|VH3-23_IGHD2-15*01>2_IGHJ5*01 2685
830 gi|Fabrus|VH3-23_IGHD2-15*01>3_IGHJ5*01 2686
831 gi|Fabrus|VH3-23_IGHD2-21*01>2_IGHJ5*01 2687
832 gi|Fabrus|VH3-23_IGHD2-21*01>3_IGHJ5*01 2688
833 gi|Fabrus|VH3-23_IGHD3-3*01>1_IGHJ5*01 2689
834 gi|Fabrus|VH3-23_IGHD3-3*01>2_IGHJ5*01 2690
835 gi|Fabrus|VH3-23_IGHD3-3*01>3_IGHJ5*01 2691
836 gi|Fabrus|VH3-23_IGHD3-9*01>2_IGHJ5*01 2692
837 gi|Fabrus|VH3-23_IGHD3-10*01>2_IGHJ5*01 2693
838 gi|Fabrus|VH3-23_IGHD3-10*01>3_IGHJ5*01 2694
839 gi|Fabrus|VH3-23_IGHD3-16*01>2_IGHJ5*01 2695
840 gi|Fabrus|VH3-23_IGHD3-16*01>3_IGHJ5*01 2696
841 gi|Fabrus|VH3-23_IGHD3-22*01>2_IGHJ5*01 2697
842 gi|Fabrus|VH3-23_IGHD3-22*01>3_IGHJ5*01 2698
843 gi|Fabrus|VH3-23_IGHD4-4*01(1)>2_IGHJ5*01 2699
844 gi|Fabrus|VH3-23_IGHD4-4*01(1)>3_IGHJ5*01 2700
845 gi|Fabrus|VH3-23_IGHD4-11*01(1)>2_IGHJ5*01 2701
846 gi|Fabrus|VH3-23_IGHD4-11*01(1)>3_IGHJ5*01 2702
847 gi|Fabrus|VH3-23_IGHD4-17*01>2_IGHJ5*01 2703
848 gi|Fabrus|VH3-23_IGHD4-17*01>3_IGHJ5*01 2704
849 gi|Fabrus|VH3-23_IGHD4-23*01>2_IGHJ5*01 2705
850 gi|Fabrus|VH3-23_IGHD4-23*01>3_IGHJ5*01 2706
851 gi|Fabrus|VH3-23_IGHD5-5*01(2)>1_IGHJ5*01 2707
852 gi|Fabrus|VH3-23_IGHD5-5*01(2)>2_IGHJ5*01 2708
853 gi|Fabrus|VH3-23_IGHD5-5*01(2)>3_IGHJ5*01 2709
854 gi|Fabrus|VH3-23_IGHD5-12*01>1_IGHJ5*01 2710
855 gi|Fabrus|VH3-23_IGHD5-12*01>3_IGHJ5*01 2711
856 gi|Fabrus|VH3-23_IGHD5-18*01(2)>1_IGHJ5*01 2712
857 gi|Fabrus|VH3-23_IGHD5-18*01(2)>2_IGHJ5*01 2713
858 gi|Fabrus|VH3-23_IGHD5-18*01(2)>3_IGHJ5*01 2714
859 gi|Fabrus|VH3-23_IGHD5-24*01>1_IGHJ5*01 2715
860 gi|Fabrus|VH3-23_IGHD5-24*01>3_IGHJ5*01 2716
861 gi|Fabrus|VH3-23_IGHD6-6*01>1_IGHJ5*01 2717
862 gi|Fabrus|VH3-23_IGHD6-6*01>2_IGHJ5*01 2718
863 gi|Fabrus|VH3-23_IGHD6-13*01>1_IGHJ5*01 2719
864 gi|Fabrus|VH3-23_IGHD6-13*01>2_IGHJ5*01 2720
865 gi|Fabrus|VH3-23_IGHD6-19*01>1_IGHJ5*01 2721
866 gi|Fabrus|VH3-23_IGHD6-19*01>2_IGHJ5*01 2722
867 gi|Fabrus|VH3-23_IGHD6-25*01>1_IGHJ5*01 2723
868 gi|Fabrus|VH3-23_IGHD6-25*01>2_IGHJ5*01 2724
869 gi|Fabrus|VH3-23_IGHD7-27*01>1_IGHJ5*01 2725
870 gi|Fabrus|VH3-23_IGHD7-27*01>3_IGHJ5*01 2726
871 gi|Fabrus|VH3-23_IGHD1-1*01>1′_IGHJ5*01 2727
872 gi|Fabrus|VH3-23_IGHD1-1*01>2′_IGHJ5*01 2728
873 gi|Fabrus|VH3-23_IGHD1-1*01>3′_IGHJ5*01 2729
874 gi|Fabrus|VH3-23_IGHD1-7*01>1′_IGHJ5*01 2730
875 gi|Fabrus|VH3-23_IGHD1-7*01>3′_IGHJ5*01 2731
876 gi|Fabrus|VH3-23_IGHD1-14*01>1′_IGHJ5*01 2732
877 gi|Fabrus|VH3-23_IGHD1-14*01>2′_IGHJ5*01 2733
878 gi|Fabrus|VH3-23_IGHD1-14*01>3′_IGHJ5*01 2734
879 gi|Fabrus|VH3-23_IGHD1-20*01>1′_IGHJ5*01 2735
880 gi|Fabrus|VH3-23_IGHD1-20*01>2′_IGHJ5*01 2736
881 gi|Fabrus|VH3-23_IGHD1-20*01>3′_IGHJ5*01 2737
882 gi|Fabrus|VH3-23_IGHD1-26*01>1′_IGHJ5*01 2738
883 gi|Fabrus|VH3-23_IGHD1-26*01>3′_IGHJ5*01 2739
884 gi|Fabrus|VH3-23_IGHD2-2*01>1′_IGHJ5*01 2740
885 gi|Fabrus|VH3-23_IGHD2-2*01>3′_IGHJ5*01 2741
886 gi|Fabrus|VH3-23_IGHD2-8*01>1′_IGHJ5*01 2742
887 gi|Fabrus|VH3-23_IGHD2-15*01>1′_IGHJ5*01 2743
888 gi|Fabrus|VH3-23_IGHD2-15*01>3′_IGHJ5*01 2744
889 gi|Fabrus|VH3-23_IGHD2-21*01>1′_IGHJ5*01 2745
890 gi|Fabrus|VH3-23_IGHD2-21*01>3′_IGHJ5*01 2746
891 gi|Fabrus|VH3-23_IGHD3-3*01>1′_IGHJ5*01 2747
892 gi|Fabrus|VH3-23_IGHD3-3*01>3′_IGHJ5*01 2748
893 gi|Fabrus|VH3-23_IGHD3-9*01>1′_IGHJ5*01 2749
894 gi|Fabrus|VH3-23_IGHD3-9*01>3′_IGHJ5*01 2750
895 gi|Fabrus|VH3-23_IGHD3-10*01>1′_IGHJ5*01 2751
896 gi|Fabrus|VH3-23_IGHD3-10*01>3′_IGHJ5*01 2752
897 gi|Fabrus|VH3-23_IGHD3-16*01>1′_IGHJ5*01 2753
898 gi|Fabrus|VH3-23_IGHD3-16*01>3′_IGHJ5*01 2754
899 gi|Fabrus|VH3-23_IGHD3-22*01>1′_IGHJ5*01 2755
900 gi|Fabrus|VH3-23_IGHD4-4*01(1)>1′_IGHJ5*01 2756
901 gi|Fabrus|VH3-23_IGHD4-4*01(1)>3′_IGHJ5*01 2757
902 gi|Fabrus|VH3-23_IGHD4-11*01(1)>1′_IGHJ5*01 2758
903 gi|Fabrus|VH3-23_IGHD4-11*01(1)>3′_IGHJ5*01 2759
904 gi|Fabrus|VH3-23_IGHD4-17*01>1′_IGHJ5*01 2760
905 gi|Fabrus|VH3-23_IGHD4-17*01>3′_IGHJ5*01 2761
906 gi|Fabrus|VH3-23_IGHD4-23*01>1′_IGHJ5*01 2762
907 gi|Fabrus|VH3-23_IGHD4-23*01>3′_IGHJ5*01 2763
908 gi|Fabrus|VH3-23_IGHD5-5*01(2)>1′_IGHJ5*01 2764
909 gi|Fabrus|VH3-23_IGHD5-5*01(2)>3′_IGHJ5*01 2765
910 gi|Fabrus|VH3-23_IGHD5-12*01>1′_IGHJ5*01 2766
911 gi|Fabrus|VH3-23_IGHD5-12*01>3′_IGHJ5*01 2767
912 gi|Fabrus|VH3-23_IGHD5-18*01(2)>1′_IGHJ5*01 2768
913 gi|Fabrus|VH3-23_IGHD5-18*01(2)>3′_IGHJ5*01 2769
914 gi|Fabrus|VH3-23_IGHD5-24*01>1′_IGHJ5*01 2770
915 gi|Fabrus|VH3-23_IGHD5-24*01>3′_IGHJ5*01 2771
916 gi|Fabrus|VH3-23_IGHD6-6*01>1′_IGHJ5*01 2772
917 gi|Fabrus|VH3-23_IGHD6-6*01>2′_IGHJ5*01 2773
918 gi|Fabrus|VH3-23_IGHD6-6*01>3′_IGHJ5*01 2774
919 gi|Fabrus|VH3-23_IGHD6-13*01>1′_IGHJ5*01 2775
920 gi|Fabrus|VH3-23_IGHD6-13*01>2′_IGHJ5*01 2776
921 gi|Fabrus|VH3-23_IGHD6-13*01>3′_IGHJ5*01 2777
922 gi|Fabrus|VH3-23_IGHD6-19*01>1′_IGHJ5*01 2778
923 gi|Fabrus|VH3-23_IGHD6-19*01>2′_IGHJ5*01 2779
924 gi|Fabrus|VH3-23_IGHD6-19*01>3′_IGHJ5*01 2780
925 gi|Fabrus|VH3-23_IGHD6-25*01>1′_IGHJ5*01 2781
926 gi|Fabrus|VH3-23_IGHD6-25*01>3′_IGHJ5*01 2782
927 gi|Fabrus|VH3-23_IGHD7-27*01>1′_IGHJ5*01 2783
928 gi|Fabrus|VH3-23_IGHD7-27*01>2′_IGHJ5*01 2784
929 gi|Fabrus|VH3-23_IGHD1-1*01>1_IGHJ6*01 2785
930 gi|Fabrus|VH3-23_IGHD1-1*01>2_IGHJ6*01 2786
931 gi|Fabrus|VH3-23_IGHD1-1*01>3_IGHJ6*01 2787
932 gi|Fabrus|VH3-23_IGHD1-7*01>1_IGHJ6*01 2788
933 gi|Fabrus|VH3-23_IGHD1-7*01>3_IGHJ6*01 2789
934 gi|Fabrus|VH3-23_IGHD1-14*01>1_IGHJ6*01 2790
935 gi|Fabrus|VH3-23_IGHD1-14*01>3_IGHJ6*01 2791
936 gi|Fabrus|VH3-23_IGHD1-20*01>1_IGHJ6*01 2792
937 gi|Fabrus|VH3-23_IGHD1-20*01>3_IGHJ6*01 2793
938 gi|Fabrus|VH3-23_IGHD1-26*01>1_IGHJ6*01 2794
939 gi|Fabrus|VH3-23_IGHD1-26*01>3_IGHJ6*01 2795
940 gi|Fabrus|VH3-23_IGHD2-2*01>2_IGHJ6*01 2796
941 gi|Fabrus|VH3-23_IGHD2-2*01>3_IGHJ6*01 2797
942 gi|Fabrus|VH3-23_IGHD2-8*01>2_IGHJ6*01 2798
943 gi|Fabrus|VH3-23_IGHD2-8*01>3_IGHJ6*01 2799
944 gi|Fabrus|VH3-23_IGHD2-15*01>2_IGHJ6*01 2800
945 gi|Fabrus|VH3-23_IGHD2-15*01>3_IGHJ6*01 2801
946 gi|Fabrus|VH3-23_IGHD2-21*01>2_IGHJ6*01 2802
947 gi|Fabrus|VH3-23_IGHD2-21*01>3_IGHJ6*01 2803
948 gi|Fabrus|VH3-23_IGHD3-3*01>1_IGHJ6*01 2804
949 gi|Fabrus|VH3-23_IGHD3-3*01>2_IGHJ6*01 2805
950 gi|Fabrus|VH3-23_IGHD3-3*01>3_IGHJ6*01 2806
951 gi|Fabrus|VH3-23_IGHD3-9*01>2_IGHJ6*01 2807
952 gi|Fabrus|VH3-23_IGHD3-10*01>2_IGHJ6*01 2808
953 gi|Fabrus|VH3-23_IGHD3-10*01>3_IGHJ6*01 104
954 gi|Fabrus|VH3-23_IGHD3-16*01>2_IGHJ6*01 2809
955 gi|Fabrus|VH3-23_IGHD3-16*01>3_IGHJ6*01 2810
956 gi|Fabrus|VH3-23_IGHD3-22*01>2_IGHJ6*01 2811
957 gi|Fabrus|VH3-23_IGHD3-22*01>3_IGHJ6*01 2812
958 gi|Fabrus|VH3-23_IGHD4-4*01(1)>2_IGHJ6*01 2813
959 gi|Fabrus|VH3-23_IGHD4-4*01(1)>3_IGHJ6*01 2814
960 gi|Fabrus|VH3-23_IGHD4-11*01(1)>2_IGHJ6*01 2815
961 gi|Fabrus|VH3-23_IGHD4-11*01(1)>3_IGHJ6*01 2816
962 gi|Fabrus|VH3-23_IGHD4-17*01>2_IGHJ6*01 2817
963 gi|Fabrus|VH3-23_IGHD4-17*01>3_IGHJ6*01 2818
964 gi|Fabrus|VH3-23_IGHD4-23*01>2_IGHJ6*01 2819
965 gi|Fabrus|VH3-23_IGHD4-23*01>3_IGHJ6*01 2820
966 gi|Fabrus|VH3-23_IGHD5-5*01(2)>1_IGHJ6*01 2821
967 gi|Fabrus|VH3-23_IGHD5-5*01(2)>2_IGHJ6*01 2822
968 gi|Fabrus|VH3-23_IGHD5-5*01(2)>3_IGHJ6*01 2823
969 gi|Fabrus|VH3-23_IGHD5-12*01>1_IGHJ6*01 2824
970 gi|Fabrus|VH3-23_IGHD5-12*01>3_IGHJ6*01 2825
971 gi|Fabrus|VH3-23_IGHD5-18*01(2)>1_IGHJ6*01 2826
972 gi|Fabrus|VH3-23_IGHD5-18*01(2)>2_IGHJ6*01 2827
973 gi|Fabrus|VH3-23_IGHD5-18*01(2)>3_IGHJ6*01 2828
974 gi|Fabrus|VH3-23_IGHD5-24*01>1_IGHJ6*01 2829
975 gi|Fabrus|VH3-23_IGHD5-24*01>3_IGHJ6*01 2830
976 gi|Fabrus|VH3-23_IGHD6-6*01>1_IGHJ6*01 2831
977 gi|Fabrus|VH3-23_IGHD6-6*01>2_IGHJ6*01 2832
978 gi|Fabrus|VH3-23_IGHD6-13*01>1_IGHJ6*01 2833
979 gi|Fabrus|VH3-23_IGHD6-13*01>2_IGHJ6*01 2834
980 gi|Fabrus|VH3-23_IGHD6-19*01>1_IGHJ6*01 2835
981 gi|Fabrus|VH3-23_IGHD6-19*01>2_IGHJ6*01 2836
982 gi|Fabrus|VH3-23_IGHD6-25*01>1_IGHJ6*01 2837
983 gi|Fabrus|VH3-23_IGHD6-25*01>2_IGHJ6*01 2838
984 gi|Fabrus|VH3-23_IGHD7-27*01>1_IGHJ6*01 2839
985 gi|Fabrus|VH3-23_IGHD7-27*01>3_IGHJ6*01 2840
986 gi|Fabrus|VH3-23_IGHD1-1*01>1′_IGHJ6*01 2841
987 gi|Fabrus|VH3-23_IGHD1-1*01>2′_IGHJ6*01 2842
988 gi|Fabrus|VH3-23_IGHD1-1*01>3′_IGHJ6*01 2843
989 gi|Fabrus|VH3-23_IGHD1-7*01>1′_IGHJ6*01 2844
990 gi|Fabrus|VH3-23_IGHD1-7*01>3′_IGHJ6*01 2845
991 gi|Fabrus|VH3-23_IGHD1-14*01>1′_IGHJ6*01 2846
992 gi|Fabrus|VH3-23_IGHD1-14*01>2′_IGHJ6*01 2847
993 gi|Fabrus|VH3-23_IGHD1-14*01>3′_IGHJ6*01 2848
994 gi|Fabrus|VH3-23_IGHD1-20*01>1′_IGHJ6*01 2849
995 gi|Fabrus|VH3-23_IGHD1-20*01>2′_IGHJ6*01 2850
996 gi|Fabrus|VH3-23_IGHD1-20*01>3′_IGHJ6*01 2851
997 gi|Fabrus|VH3-23_IGHD1-26*01>1′_IGHJ6*01 2852
998 gi|Fabrus|VH3-23_IGHD1-26*01>3′_IGHJ6*01 2853
999 gi|Fabrus|VH3-23_IGHD2-2*01>1′_IGHJ6*01 2854
1000 gi|Fabrus|VH3-23_IGHD2-2*01>3′_IGHJ6*01 2855
1001 gi|Fabrus|VH3-23_IGHD2-8*01>1′_IGHJ6*01 2856
1002 gi|Fabrus|VH3-23_IGHD2-15*01>1′_IGHJ6*01 2857
1003 gi|Fabrus|VH3-23_IGHD2-15*01>3′_IGHJ6*01 2858
1004 gi|Fabrus|VH3-23_IGHD2-21*01>1′_IGHJ6*01 2859
1005 gi|Fabrus|VH3-23_IGHD2-21*01>3′_IGHJ6*01 2860
1006 gi|Fabrus|VH3-23_IGHD3-3*01>1′_IGHJ6*01 2861
1007 gi|Fabrus|VH3-23_IGHD3-3*01>3′_IGHJ6*01 2862
1008 gi|Fabrus|VH3-23_IGHD3-9*01>1′_IGHJ6*01 2863
1009 gi|Fabrus|VH3-23_IGHD3-9*01>3′_IGHJ6*01 2864
1010 gi|Fabrus|VH3-23_IGHD3-10*01>1′_IGHJ6*01 2865
1011 gi|Fabrus|VH3-23_IGHD3-10*01>3′_IGHJ6*01 2866
1012 gi|Fabrus|VH3-23_IGHD3-16*01>1′_IGHJ6*01 2867
1013 gi|Fabrus|VH3-23_IGHD3-16*01>3′_IGHJ6*01 2868
1014 gi|Fabrus|VH3-23_IGHD3-22*01>1′_IGHJ6*01 2869
1015 gi|Fabrus|VH3-23_IGHD4-4*01(1)>1′_IGHJ6*01 2870
1016 gi|Fabrus|VH3-23_IGHD4-4*01(1)>3′_IGHJ6*01 2871
1017 gi|Fabrus|VH3-23_IGHD4-11*01(1)>1′_IGHJ6*01 2872
1018 gi|Fabrus|VH3-23_IGHD4-11*01(1)>3′_IGHJ6*01 2873
1019 gi|Fabrus|VH3-23_IGHD4-17*01>1′_IGHJ6*01 2874
1020 gi|Fabrus|VH3-23_IGHD4-17*01>3′_IGHJ6*01 2875
1021 gi|Fabrus|VH3-23_IGHD4-23*01>1′_IGHJ6*01 2876
1022 gi|Fabrus|VH3-23_IGHD4-23*01>3′_IGHJ6*01 2877
1023 gi|Fabrus|VH3-23_IGHD5-5*01(2)>1′_IGHJ6*01 2878
1024 gi|Fabrus|VH3-23_IGHD5-5*01(2)>3′_IGHJ6*01 2879
1025 gi|Fabrus|VH3-23_IGHD5-12*01>1′_IGHJ6*01 2880
1026 gi|Fabrus|VH3-23_IGHD5-12*01>3′_IGHJ6*01 2881
1027 gi|Fabrus|VH3-23_IGHD5-18*01(2)>1′_IGHJ6*01 2882
1028 gi|Fabrus|VH3-23_IGHD5-18*01(2)>3′_IGHJ6*01 2883
1029 gi|Fabrus|VH3-23_IGHD5-24*01>1′_IGHJ6*01 2884
1030 gi|Fabrus|VH3-23_IGHD5-24*01>3′_IGHJ6*01 2885
1031 gi|Fabrus|VH3-23_IGHD6-6*01>1′_IGHJ6*01 2886
1032 gi|Fabrus|VH3-23_IGHD6-6*01>2′_IGHJ6*01 2887
1033 gi|Fabrus|VH3-23_IGHD6-6*01>3′_IGHJ6*01 2888
1034 gi|Fabrus|VH3-23_IGHD6-13*01>1′_IGHJ6*01 2889
1035 gi|Fabrus|VH3-23_IGHD6-13*01>2′_IGHJ6*01 2890
1036 gi|Fabrus|VH3-23_IGHD6-13*01>3′_IGHJ6*01 2891
1037 gi|Fabrus|VH3-23_IGHD6-19*01>1′_IGHJ6*01 2892
1038 gi|Fabrus|VH3-23_IGHD6-19*01>2′_IGHJ6*01 2893
1039 gi|Fabrus|VH3-23_IGHD6-19*01>3′_IGHJ6*01 2894
1040 gi|Fabrus|VH3-23_IGHD6-25*01>1′_IGHJ6*01 2895
1041 gi|Fabrus|VH3-23_IGHD6-25*01>3′_IGHJ6*01 2896
1042 gi|Fabrus|VH3-23_IGHD7-27*01>1′_IGHJ6*01 2897
1043 gi|Fabrus|VH3-23_IGHD7-27*01>2′_IGHJ6*01 2898
Light Chains
1 gnl|Fabrus|A14_IGKJ1*01 2163
2 gnl|Fabrus|A17_IGKJ1*01 113
3 gnl|Fabrus|A2_IGKJ1*01 2164
4 gnl|Fabrus|A20_IGKJ1*01 2165
5 gnl|Fabrus|A23_IGKJ1*01 2166
6 gnl|Fabrus|A26_IGKJ1*01 2167
7 gnl|Fabrus|A27_IGKJ1*01 110
8 gnl|Fabrus|A27_IGKJ3*01 2168
9 gnl|Fabrus|A30_IGKJ1*01 2169
10 gnl|Fabrus|B2_IGKJ1*01 2170
11 gnl|Fabrus|B2_IGKJ3*01 2171
12 gnl|Fabrus|B3_IGKJ1*01 111
14 gnl|Fabrus|L11_IGKJ1*01 2173
15 gnl|Fabrus|L12_IGKJ1*01 115
16 gnl|Fabrus|L14_IGKJ1*01 2174
17 gnl|Fabrus|L2_IGKJ1*01 112
18 gnl|Fabrus|L22_IGKJ3*01 2175
19 gnl|Fabrus|L23_IGKJ1*01 2176
20 gnl|Fabrus|L25_IGKJ1*01 120
21 gnl|Fabrus|L25_IGKJ3*01 2177
22 gnl|Fabrus|L4/18a_IGKJ1*01 2178
23 gnl|Fabrus|L5_IGKJ1*01 114
24 gnl|Fabrus|L6_IGKJ1*01 107
25 gnl|Fabrus|L8_IGKJ1*01 2179
26 gnl|Fabrus|L9_IGKJ2*01 2180
27 gnl|Fabrus|O1_IGKJ1*01 116
28 gnl|Fabrus|O12_IGKJ1*01 119
29 gnl|Fabrus|O18_IGKJ1*01 2181
31 gnl|Fabrus|V1-11_IGLJ2*01 2183
32 gnl|Fabrus|V1-13_IGLJ5*01 2184
33 gnl|Fabrus|V1-16_IGLJ6*01 2185
34 gnl|Fabrus|V1-18_IGLJ2*01 2186
35 gnl|Fabrus|V1-2_IGLJ7*01 2187
36 gnl|Fabrus|V1-20_IGLJ6*01 2188
37 gnl|Fabrus|V1-3_IGLJ1*01 2189
38 gnl|Fabrus|V1-4_IGLJ4*01 117
39 gnl|Fabrus|V1-5_IGLJ2*01 2190
40 gnl|Fabrus|V1-7_IGLJ1*01 2191
41 gnl|Fabrus|V1-9_IGLJ6*01 2192
42 gnl|Fabrus|V2-1_IGLJ6*01 2193
43 gnl|Fabrus|V2-11_IGLJ7*01 2194
44 gnl|Fabrus|V2-13_IGLJ2*01 2195
45 gnl|Fabrus|V2-14_IGLJ4*01 2196
46 gnl|Fabrus|V2-15_IGLJ7*01 2197
47 gnl|Fabrus|V2-17_IGLJ2*01 2198
48 gnl|Fabrus|V2-19_IGLJ4*01 2199
49 gnl|Fabrus|V2-6_IGLJ4*01 2200
50 gnl|Fabrus|V2-7_IGLJ2*01 2201
51 gnl|Fabrus|V2-7_IGLJ7*01 2202
52 gnl|Fabrus|V2-8_IGLJ6*01 2203
53 gnl|Fabrus|V3-2_IGLJ4*01 2204
54 gnl|Fabrus|V3-3_IGLJ7*01 2205
55 gnl|Fabrus|V3-4_IGLJ1*01 108
56 gnl|Fabrus|V4-1_IGLJ4*01 2206
57 gnl|Fabrus|V4-2_IGLJ4*01 2207
58 gnl|Fabrus|V4-3_IGLJ4*01 109
59 gnl|Fabrus|V4-4_IGLJ5*01 2208
60 gnl|Fabrus|V4-6_IGLJ4*01 118
61 gnl|Fabrus|V5-4_IGLJ2*01 2209
62 gnl|Fabrus|V5-6_IGLJ1*01 2210

TABLE 4
Exemplary Paired Nucleic Acid Library
SEQ SEQ
ID ID
HEAVY CHAIN NO LIGHT CHAIN NO
1 gnl|Fabrus|VH3-23_IGHD1-1*01_IGHJ4*01 863 gnl|Fabrus|O12_IGKJ1*01 1101
2 gnl|Fabrus|VH3-23_IGHD2-15*01_IGHJ4*01 866 gnl|Fabrus|O12_IGKJ1*01 1101
3 gnl|Fabrus|VH3-23_IGHD3-22*01_IGHJ4*01 870 gnl|Fabrus|O12_IGKJ1*01 1101
4 gnl|Fabrus|VH3-23_IGHD4-11*01_IGHJ4*01 872 gnl|Fabrus|O12_IGKJ1*01 1101
5 gnl|Fabrus|VH3-23_IGHD5-12*01_IGHJ4*01 874 gnl|Fabrus|O12_IGKJ1*01 1101
6 gnl|Fabrus|VH3-23_IGHD5-5*01_IGHJ4*01 876 gnl|Fabrus|O12_IGKJ1*01 1101
7 gnl|Fabrus|VH3-23_IGHD6-13*01_IGHJ4*01 877 gnl|Fabrus|O12_IGKJ1*01 1101
8 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ4*01 880 gnl|Fabrus|O12_IGKJ1*01 1101
9 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ6*01 881 gnl|Fabrus|O12_IGKJ1*01 1101
10 gnl|Fabrus|VH1-69_IGHD1-14*01_IGHJ4*01 770 gnl|Fabrus|O12_IGKJ1*01 1101
11 gnl|Fabrus|VH1-69_IGHD2-2*01_IGHJ4*01 771 gnl|Fabrus|O12_IGKJ1*01 1101
12 gnl|Fabrus|VH1-69_IGHD2-8*01_IGHJ6*01 772 gnl|Fabrus|O12_IGKJ1*01 1101
13 gnl|Fabrus|VH1-69_IGHD3-16*01_IGHJ4*01 773 gnl|Fabrus|O12_IGKJ1*01 1101
14 gnl|Fabrus|VH1-69_IGHD3-3*01_IGHJ4*01 774 gnl|Fabrus|O12_IGKJ1*01 1101
15 gnl|Fabrus|VH1-69_IGHD4-17*01_IGHJ4*01 776 gnl|Fabrus|O12_IGKJ1*01 1101
16 gnl|Fabrus|VH1-69_IGHD5-12*01_IGHJ4*01 777 gnl|Fabrus|O12_IGKJ1*01 1101
17 gnl|Fabrus|VH1-69_IGHD6-19*01_IGHJ4*01 779 gnl|Fabrus|O12_IGKJ1*01 1101
18 gnl|Fabrus|VH1-69_IGHD7-27*01_IGHJ4*01 781 gnl|Fabrus|O12_IGKJ1*01 1101
19 gnl|Fabrus|VH4-34_IGHD1-7*01_IGHJ4*01 1017 gnl|Fabrus|O12_IGKJ1*01 1101
20 gnl|Fabrus|VH4-34_IGHD2-2*01_IGHJ4*01 1018 gnl|Fabrus|O12_IGKJ1*01 1101
21 gnl|Fabrus|VH4-34_IGHD3-16*01_IGHJ4*01 1019 gnl|Fabrus|O12_IGKJ1*01 1101
22 gnl|Fabrus|VH4-34_IGHD4-17*01_IGHJ4*01 1021 gnl|Fabrus|O12_IGKJ1*01 1101
23 gnl|Fabrus|VH4-34_IGHD5-12*01_IGHJ4*01 1022 gnl|Fabrus|O12_IGKJ1*01 1101
24 gnl|Fabrus|VH4-34_IGHD6-13*01_IGHJ4*01 1023 gnl|Fabrus|O12_IGKJ1*01 1101
25 gnl|Fabrus|VH4-34_IGHD6-25*01_IGHJ6*01 1024 gnl|Fabrus|O12_IGKJ1*01 1101
26 gnl|Fabrus|VH4-34_IGHD7-27*01_IGHJ4*01 1026 gnl|Fabrus|O12_IGKJ1*01 1101
27 gnl|Fabrus|VH2-26_IGHD1-20*01_IGHJ4*01 789 gnl|Fabrus|O12_IGKJ1*01 1101
28 gnl|Fabrus|VH2-26_IGHD2-2*01_IGHJ4*01 791 gnl|Fabrus|O12_IGKJ1*01 1101
29 gnl|Fabrus|VH2-26_IGHD3-10*01_IGHJ4*01 792 gnl|Fabrus|O12_IGKJ1*01 1101
30 gnl|Fabrus|VH2-26_IGHD4-11*01_IGHJ4*01 794 gnl|Fabrus|O12_IGKJ1*01 1101
31 gnl|Fabrus|VH2-26_IGHD5-18*01_IGHJ4*01 796 gnl|Fabrus|O12_IGKJ1*01 1101
32 gnl|Fabrus|VH2-26_IGHD6-13*01_IGHJ4*01 797 gnl|Fabrus|O12_IGKJ1*01 1101
33 gnl|Fabrus|VH2-26_IGHD7-27*01_IGHJ4*01 798 gnl|Fabrus|O12_IGKJ1*01 1101
34 gnl|Fabrus|VH5-51_IGHD1-14*01_IGHJ4*01 1044 gnl|Fabrus|O12_IGKJ1*01 1101
35 gnl|Fabrus|VH5-51_IGHD2-8*01_IGHJ4*01 1046 gnl|Fabrus|O12_IGKJ1*01 1101
36 gnl|Fabrus|VH5-51_IGHD3-3*01_IGHJ4*01 1048 gnl|Fabrus|O12_IGKJ1*01 1101
37 gnl|Fabrus|VH5-51_IGHD4-17*01_IGHJ4*01 1049 gnl|Fabrus|O12_IGKJ1*01 1101
38 gnl|Fabrus|VH5-51_IGHD5- 1050 gnl|Fabrus|O12_IGKJ1*01 1101
18*01>3_IGHJ4*01
39 gnl|Fabrus|VH5-51_IGHD5- 1051 gnl|Fabrus|O12_IGKJ1*01 1101
18*01>1_IGHJ4*01
40 gnl|Fabrus|VH5-51_IGHD6-25*01_IGHJ4*01 1052 gnl|Fabrus|O12_IGKJ1*01 1101
41 gnl|Fabrus|VH5-51_IGHD7-27*01_IGHJ4*01 1053 gnl|Fabrus|O12_IGKJ1*01 1101
42 gnl|Fabrus|VH6-1_IGHD1-1*01_IGHJ4*01 1054 gnl|Fabrus|O12_IGKJ1*01 1101
43 gnl|Fabrus|VH6-1_IGHD2-15*01_IGHJ4*01 1056 gnl|Fabrus|O12_IGKJ1*01 1101
44 gnl|Fabrus|VH6-1_IGHD3-3*01_IGHJ4*01 1059 gnl|Fabrus|O12_IGKJ1*01 1101
45 gnl|Fabrus|VH6-1_IGHD4-23*01_IGHJ4*01 1061 gnl|Fabrus|O12_IGKJ1*01 1101
46 gnl|Fabrus|VH6-1_IGHD4-11*01_IGHJ6*01 1060 gnl|Fabrus|O12_IGKJ1*01 1101
47 gnl|Fabrus|VH6-1_IGHD5-5*01_IGHJ4*01 1062 gnl|Fabrus|O12_IGKJ1*01 1101
48 gnl|Fabrus|VH6-1_IGHD6-13*01_IGHJ4*01 1063 gnl|Fabrus|O12_IGKJ1*01 1101
49 gnl|Fabrus|VH6-1_IGHD6-25*01_IGHJ6*01 1064 gnl|Fabrus|O12_IGKJ1*01 1101
50 gnl|Fabrus|VH6-1_IGHD7-27*01_IGHJ4*01 1065 gnl|Fabrus|O12_IGKJ1*01 1101
51 gnl|Fabrus|VH4-59_IGHD6-25*01_IGHJ3*01 1043 gnl|Fabrus|O12_IGKJ1*01 1101
52 gnl|Fabrus|VH3-48_IGHD6-6*01_IGHJ1*01 923 gnl|Fabrus|O12_IGKJ1*01 1101
53 gnl|Fabrus|VH3-30_IGHD6-6*01_IGHJ1*01 893 gnl|Fabrus|O12_IGKJ1*01 1101
54 gnl|Fabrus|VH3-66_IGHD6-6*01_IGHJ1*01 949 gnl|Fabrus|O12_IGKJ1*01 1101
55 gnl|Fabrus|VH3-53_IGHD5-5*01_IGHJ4*01 938 gnl|Fabrus|O12_IGKJ1*01 1101
56 gnl|Fabrus|VH2-5_IGHD5-12*01_IGHJ4*01 804 gnl|Fabrus|O12_IGKJ1*01 1101
57 gnl|Fabrus|VH2-70_IGHD5-12*01_IGHJ4*01 811 gnl|Fabrus|O12_IGKJ1*01 1101
58 gnl|Fabrus|VH3-15_IGHD5-12*01_IGHJ4*01 835 gnl|Fabrus|O12_IGKJ1*01 1101
59 gnl|Fabrus|VH3-15_IGHD3-10*01_IGHJ4*01 833 gnl|Fabrus|O12_IGKJ1*01 1101
60 gnl|Fabrus|VH3-49_IGHD5-18*01_IGHJ4*01 930 gnl|Fabrus|O12_IGKJ1*01 1101
61 gnl|Fabrus|VH3-49_IGHD6-13*01_IGHJ4*01 931 gnl|Fabrus|O12_IGKJ1*01 1101
62 gnl|Fabrus|VH3-72_IGHD5-18*01_IGHJ4*01 967 gnl|Fabrus|O12_IGKJ1*01 1101
63 gnl|Fabrus|VH3-72_IGHD6-6*01_IGHJ1*01 969 gnl|Fabrus|O12_IGKJ1*01 1101
64 gnl|Fabrus|VH3-73_IGHD5-12*01_IGHJ4*01 977 gnl|Fabrus|O12_IGKJ1*01 1101
65 gnl|Fabrus|VH3-73_IGHD4-23*01_IGHJ5*01 976 gnl|Fabrus|O12_IGKJ1*01 1101
66 gnl|Fabrus|VH3-43_IGHD3-22*01_IGHJ4*01 918 gnl|Fabrus|O12_IGKJ1*01 1101
67 gnl|Fabrus|VH3-43_IGHD6-13*01_IGHJ4*01 921 gnl|Fabrus|O12_IGKJ1*01 1101
68 gnl|Fabrus|VH3-9_IGHD3-22*01_IGHJ4*01 992 gnl|Fabrus|O12_IGKJ1*01 1101
69 gnl|Fabrus|VH3-9_IGHD1-7*01_IGHJ5*01 989 gnl|Fabrus|O12_IGKJ1*01 1101
70 gnl|Fabrus|VH3-9_IGHD6-13*01_IGHJ4*01 995 gnl|Fabrus|O12_IGKJ1*01 1101
71 gnl|Fabrus|VH4-39_IGHD3-10*01_IGHJ4*01 1030 gnl|Fabrus|O12_IGKJ1*01 1101
72 gnl|Fabrus|VH4-39_IGHD5-12*01_IGHJ4*01 1034 gnl|Fabrus|O12_IGKJ1*01 1101
73 gnl|Fabrus|VH1-18_IGHD6-6*01_IGHJ1*01 728 gnl|Fabrus|O12_IGKJ1*01 1101
74 gnl|Fabrus|VH1-24_IGHD5-12*01_IGHJ4*01 735 gnl|Fabrus|O12_IGKJ1*01 1101
75 gnl|Fabrus|VH1-2_IGHD1-1*01_IGHJ3*01 729 gnl|Fabrus|O12_IGKJ1*01 1101
76 gnl|Fabrus|VH1-3_IGHD6-6*01_IGHJ1*01 743 gnl|Fabrus|O12_IGKJ1*01 1101
77 gnl|Fabrus|VH1-45_IGHD3-10*01_IGHJ4*01 748 gnl|Fabrus|O12_IGKJ1*01 1101
78 gnl|Fabrus|VH1-46_IGHD1-26*01_IGHJ4*01 754 gnl|Fabrus|O12_IGKJ1*01 1101
79 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ6*01 1068 gnl|Fabrus|O12_IGKJ1*01 1101
80 gnl|Fabrus|VH2-70_IGHD3-9*01_IGHJ6*01 810 gnl|Fabrus|O12_IGKJ1*01 1101
81 gnl|Fabrus|VH1-58_IGHD3-10*01_IGHJ6*01 764 gnl|Fabrus|O12_IGKJ1*01 1101
82 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ2*01 1067 gnl|Fabrus|O12_IGKJ1*01 1101
83 gnl|Fabrus|VH4-28_IGHD3-9*01_IGHJ6*01 1002 gnl|Fabrus|O12_IGKJ1*01 1101
84 gnl|Fabrus|VH4-31_IGHD2-15*01_IGHJ2*01 1008 gnl|Fabrus|O12_IGKJ1*01 1101
85 gnl|Fabrus|VH2-5_IGHD3-9*01_IGHJ6*01 803 gnl|Fabrus|O12_IGKJ1*01 1101
86 gnl|Fabrus|VH1-8_IGHD2-15*01_IGHJ6*01 783 gnl|Fabrus|O12_IGKJ1*01 1101
87 gnl|Fabrus|VH2-70_IGHD2-15*01_IGHJ2*01 808 gnl|Fabrus|O12_IGKJ1*01 1101
88 gnl|Fabrus|VH3-38_IGHD3-10*01_IGHJ4*01 907 gnl|Fabrus|O12_IGKJ1*01 1101
89 gnl|Fabrus|VH3-16_IGHD1-7*01_IGHJ6*01 838 gnl|Fabrus|O12_IGKJ1*01 1101
90 gnl|Fabrus|VH3-73_IGHD3-9*01_IGHJ6*01 974 gnl|Fabrus|O12_IGKJ1*01 1101
91 gnl|Fabrus|VH3-11_IGHD3-9*01_IGHJ6*01 816 gnl|Fabrus|O12_IGKJ1*01 1101
92 gnl|Fabrus|VH3-11_IGHD6-6*01_IGHJ1*01 820 gnl|Fabrus|O12_IGKJ1*01 1101
93 gnl|Fabrus|VH3-20_IGHD5-12*01_IGHJ4*01 852 gnl|Fabrus|O12_IGKJ1*01 1101
94 gnl|Fabrus|VH3-16_IGHD2-15*01_IGHJ2*01 839 gnl|Fabrus|O12_IGKJ1*01 1101
95 gnl|Fabrus|VH3-7_IGHD6-6*01_IGHJ1*01 960 gnl|Fabrus|O12_IGKJ1*01 1101
96 gnl|Fabrus|VH3-16_IGHD6-13*01_IGHJ4*01 844 gnl|Fabrus|O12_IGKJ1*01 1101
97 gnl|Fabrus|VH3-23_IGHD1-1*01_IGHJ4*01 863 gnl|Fabrus|O12_IGKJ1*01 1102
98 gnl|Fabrus|VH3-23_IGHD2-15*01_IGHJ4*01 866 gnl|Fabrus|O12_IGKJ1*01 1102
99 gnl|Fabrus|VH3-23_IGHD3-22*01_IGHJ4*01 870 gnl|Fabrus|O12_IGKJ1*01 1102
100 gnl|Fabrus|VH3-23_IGHD4-11*01_IGHJ4*01 872 gnl|Fabrus|O12_IGKJ1*01 1102
101 gnl|Fabrus|VH3-23_IGHD5-12*01_IGHJ4*01 874 gnl|Fabrus|O12_IGKJ1*01 1102
102 gnl|Fabrus|VH3-23_IGHD5-5*01_IGHJ4*01 876 gnl|Fabrus|O12_IGKJ1*01 1102
103 gnl|Fabrus|VH3-23_IGHD6-13*01_IGHJ4*01 877 gnl|Fabrus|O12_IGKJ1*01 1102
104 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ4*01 880 gnl|Fabrus|O12_IGKJ1*01 1102
105 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ6*01 881 gnl|Fabrus|O18_IGKJ1*01 1102
106 gnl|Fabrus|VH1-69_IGHD1-14*01_IGHJ4*01 770 gnl|Fabrus|O18_IGKJ1*01 1102
107 gnl|Fabrus|VH1-69_IGHD2-2*01_IGHJ4*01 771 gnl|Fabrus|O18_IGKJ1*01 1102
108 gnl|Fabrus|VH1-69_IGHD2-8*01_IGHJ6*01 772 gnl|Fabrus|O18_IGKJ1*01 1102
109 gnl|Fabrus|VH1-69_IGHD3-16*01_IGHJ4*01 773 gnl|Fabrus|O18_IGKJ1*01 1102
110 gnl|Fabrus|VH1-69_IGHD3-3*01_IGHJ4*01 774 gnl|Fabrus|O18_IGKJ1*01 1102
111 gnl|Fabrus|VH1-69_IGHD4-17*01_IGHJ4*01 776 gnl|Fabrus|O18_IGKJ1*01 1102
112 gnl|Fabrus|VH1-69_IGHD5-12*01_IGHJ4*01 777 gnl|Fabrus|O18_IGKJ1*01 1102
113 gnl|Fabrus|VH1-69_IGHD6-19*01_IGHJ4*01 779 gnl|Fabrus|O18_IGKJ1*01 1102
114 gnl|Fabrus|VH1-69_IGHD7-27*01_IGHJ4*01 781 gnl|Fabrus|O18_IGKJ1*01 1102
115 gnl|Fabrus|VH4-34_IGHD1-7*01_IGHJ4*01 1017 gnl|Fabrus|O18_IGKJ1*01 1102
116 gnl|Fabrus|VH4-34_IGHD2-2*01_IGHJ4*01 1018 gnl|Fabrus|O18_IGKJ1*01 1102
117 gnl|Fabrus|VH4-34_IGHD3-16*01_IGHJ4*01 1019 gnl|Fabrus|O18_IGKJ1*01 1102
118 gnl|Fabrus|VH4-34_IGHD4-17*01_IGHJ4*01 1021 gnl|Fabrus|O18_IGKJ1*01 1102
119 gnl|Fabrus|VH4-34_IGHD5-12*01_IGHJ4*01 1022 gnl|Fabrus|O18_IGKJ1*01 1102
120 gnl|Fabrus|VH4-34_IGHD6-13*01_IGHJ4*01 1023 gnl|Fabrus|O18_IGKJ1*01 1102
121 gnl|Fabrus|VH4-34_IGHD6-25*01_IGHJ6*01 1024 gnl|Fabrus|O18_IGKJ1*01 1102
122 gnl|Fabrus|VH4-34_IGHD7-27*01_IGHJ4*01 1026 gnl|Fabrus|O18_IGKJ1*01 1102
123 gnl|Fabrus|VH2-26_IGHD1-20*01_IGHJ4*01 789 gnl|Fabrus|O18_IGKJ1*01 1102
124 gnl|Fabrus|VH2-26_IGHD2-2*01_IGHJ4*01 791 gnl|Fabrus|O18_IGKJ1*01 1102
125 gnl|Fabrus|VH2-26_IGHD3-10*01_IGHJ4*01 792 gnl|Fabrus|O18_IGKJ1*01 1102
126 gnl|Fabrus|VH2-26_IGHD4-11*01_IGHJ4*01 794 gnl|Fabrus|O18_IGKJ1*01 1102
127 gnl|Fabrus|VH2-26_IGHD5-18*01_IGHJ4*01 796 gnl|Fabrus|O18_IGKJ1*01 1102
128 gnl|Fabrus|VH2-26_IGHD6-13*01_IGHJ4*01 797 gnl|Fabrus|O18_IGKJ1*01 1102
129 gnl|Fabrus|VH2-26_IGHD7-27*01_IGHJ4*01 798 gnl|Fabrus|O18_IGKJ1*01 1102
130 gnl|Fabrus|VH5-51_IGHD1-14*01_IGHJ4*01 1044 gnl|Fabrus|O18_IGKJ1*01 1102
131 gnl|Fabrus|VH5-51_IGHD2-8*01_IGHJ4*01 1046 gnl|Fabrus|O18_IGKJ1*01 1102
132 gnl|Fabrus|VH5-51_IGHD3-3*01_IGHJ4*01 1048 gnl|Fabrus|O18_IGKJ1*01 1102
133 gnl|Fabrus|VH5-51_IGHD4-17*01_IGHJ4*01 1049 gnl|Fabrus|O18_IGKJ1*01 1102
134 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1050 gnl|Fabrus|O18_IGKJ1*01 1102
135 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1051 gnl|Fabrus|O18_IGKJ1*01 1102
136 gnl|Fabrus|VH5-51_IGHD6-25*01_IGHJ4*01 1052 gnl|Fabrus|O18_IGKJ1*01 1102
137 gnl|Fabrus|VH5-51_IGHD7-27*01_IGHJ4*01 1053 gnl|Fabrus|O18_IGKJ1*01 1102
138 gnl|Fabrus|VH6-1_IGHD1-1*01_IGHJ4*01 1054 gnl|Fabrus|O18_IGKJ1*01 1102
139 gnl|Fabrus|VH6-1_IGHD2-15*01_IGHJ4*01 1056 gnl|Fabrus|O18_IGKJ1*01 1102
140 gnl|Fabrus|VH6-1_IGHD3-3*01_IGHJ4*01 1059 gnl|Fabrus|O18_IGKJ1*01 1102
141 gnl|Fabrus|VH6-1_IGHD4-23*01_IGHJ4*01 1061 gnl|Fabrus|O18_IGKJ1*01 1102
142 gnl|Fabrus|VH6-1_IGHD4-11*01_IGHJ6*01 1060 gnl|Fabrus|O18_IGKJ1*01 1102
143 gnl|Fabrus|VH6-1_IGHD5-5*01_IGHJ4*01 1062 gnl|Fabrus|O18_IGKJ1*01 1102
144 gnl|Fabrus|VH6-1_IGHD6-13*01_IGHJ4*01 1063 gnl|Fabrus|O18_IGKJ1*01 1102
145 gnl|Fabrus|VH6-1_IGHD6-25*01_IGHJ6*01 1064 gnl|Fabrus|O18_IGKJ1*01 1102
146 gnl|Fabrus|VH6-1_IGHD7-27*01_IGHJ4*01 1065 gnl|Fabrus|O18_IGKJ1*01 1102
147 gnl|Fabrus|VH4-59_IGHD6-25*01_IGHJ3*01 1043 gnl|Fabrus|O18_IGKJ1*01 1102
148 gnl|Fabrus|VH3-48_IGHD6-6*01_IGHJ1*01 923 gnl|Fabrus|O18_IGKJ1*01 1102
149 gnl|Fabrus|VH3-30_IGHD6-6*01_IGHJ1*01 893 gnl|Fabrus|O18_IGKJ1*01 1102
150 gnl|Fabrus|VH3-66_IGHD6-6*01_IGHJ1*01 949 gnl|Fabrus|O18_IGKJ1*01 1102
151 gnl|Fabrus|VH3-53_IGHD5-5*01_IGHJ4*01 938 gnl|Fabrus|O18_IGKJ1*01 1102
152 gnl|Fabrus|VH2-5_IGHD5-12*01_IGHJ4*01 804 gnl|Fabrus|O18_IGKJ1*01 1102
153 gnl|Fabrus|VH2-70_IGHD5-12*01_IGHJ4*01 811 gnl|Fabrus|O18_IGKJ1*01 1102
154 gnl|Fabrus|VH3-15_IGHD5-12*01_IGHJ4*01 835 gnl|Fabrus|O18_IGKJ1*01 1102
155 gnl|Fabrus|VH3-15_IGHD3-10*01_IGHJ4*01 833 gnl|Fabrus|O18_IGKJ1*01 1102
156 gnl|Fabrus|VH3-49_IGHD5-18*01_IGHJ4*01 930 gnl|Fabrus|O18_IGKJ1*01 1102
157 gnl|Fabrus|VH3-49_IGHD6-13*01_IGHJ4*01 931 gnl|Fabrus|O18_IGKJ1*01 1102
158 gnl|Fabrus|VH3-72_IGHD5-18*01_IGHJ4*01 967 gnl|Fabrus|O18_IGKJ1*01 1102
159 gnl|Fabrus|VH3-72_IGHD6-6*01_IGHJ1*01 969 gnl|Fabrus|O18_IGKJ1*01 1102
160 gnl|Fabrus|VH3-73_IGHD5-12*01_IGHJ4*01 977 gnl|Fabrus|O18_IGKJ1*01 1102
161 gnl|Fabrus|VH3-73_IGHD4-23*01_IGHJ5*01 976 gnl|Fabrus|O18_IGKJ1*01 1102
162 gnl|Fabrus|VH3-43_IGHD3-22*01_IGHJ4*01 918 gnl|Fabrus|O18_IGKJ1*01 1102
163 gnl|Fabrus|VH3-43_IGHD6-13*01_IGHJ4*01 921 gnl|Fabrus|O18_IGKJ1*01 1102
164 gnl|Fabrus|VH3-9_IGHD3-22*01_IGHJ4*01 992 gnl|Fabrus|O18_IGKJ1*01 1102
165 gnl|Fabrus|VH3-9_IGHD1-7*01_IGHJ5*01 989 gnl|Fabrus|O18_IGKJ1*01 1102
166 gnl|Fabrus|VH3-9_IGHD6-13*01_IGHJ4*01 995 gnl|Fabrus|O18_IGKJ1*01 1102
167 gnl|Fabrus|VH4-39_IGHD3-10*01_IGHJ4*01 1030 gnl|Fabrus|O18_IGKJ1*01 1102
168 gnl|Fabrus|VH4-39_IGHD5-12*01_IGHJ4*01 1034 gnl|Fabrus|O18_IGKJ1*01 1102
169 gnl|Fabrus|VH1-18_IGHD6-6*01_IGHJ1*01 728 gnl|Fabrus|O18_IGKJ1*01 1102
170 gnl|Fabrus|VH1-24_IGHD5-12*01_IGHJ4*01 735 gnl|Fabrus|O18_IGKJ1*01 1102
171 gnl|Fabrus|VH1-2_IGHD1-1*01_IGHJ3*01 729 gnl|Fabrus|O18_IGKJ1*01 1102
172 gnl|Fabrus|VH1-3_IGHD6-6*01_IGHJ1*01 743 gnl|Fabrus|O18_IGKJ1*01 1102
173 gnl|Fabrus|VH1-45_IGHD3-10*01_IGHJ4*01 748 gnl|Fabrus|O18_IGKJ1*01 1102
174 gnl|Fabrus|VH1-46_IGHD1-26*01_IGHJ4*01 754 gnl|Fabrus|O18_IGKJ1*01 1102
175 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ6*01 1068 gnl|Fabrus|O18_IGKJ1*01 1102
176 gnl|Fabrus|VH2-70_IGHD3-9*01_IGHJ6*01 810 gnl|Fabrus|O18_IGKJ1*01 1102
177 gnl|Fabrus|VH1-58_IGHD3-10*01_IGHJ6*01 764 gnl|Fabrus|O18_IGKJ1*01 1102
178 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ2*01 1067 gnl|Fabrus|O18_IGKJ1*01 1102
179 gnl|Fabrus|VH4-28_IGHD3-9*01_IGHJ6*01 1002 gnl|Fabrus|O18_IGKJ1*01 1102
180 gnl|Fabrus|VH4-31_IGHD2-15*01_IGHJ2*01 1008 gnl|Fabrus|O18_IGKJ1*01 1102
181 gnl|Fabrus|VH2-5_IGHD3-9*01_IGHJ6*01 803 gnl|Fabrus|O18_IGKJ1*01 1102
182 gnl|Fabrus|VH1-8_IGHD2-15*01_IGHJ6*01 783 gnl|Fabrus|O18_IGKJ1*01 1102
183 gnl|Fabrus|VH2-70_IGHD2-15*01_IGHJ2*01 808 gnl|Fabrus|O18_IGKJ1*01 1102
184 gnl|Fabrus|VH3-38_IGHD3-10*01_IGHJ4*01 907 gnl|Fabrus|O18_IGKJ1*01 1102
185 gnl|Fabrus|VH3-16_IGHD1-7*01_IGHJ6*01 838 gnl|Fabrus|O18_IGKJ1*01 1102
186 gnl|Fabrus|VH3-73_IGHD3-9*01_IGHJ6*01 974 gnl|Fabrus|O18_IGKJ1*01 1102
187 gnl|Fabrus|VH3-11_IGHD3-9*01_IGHJ6*01 816 gnl|Fabrus|O18_IGKJ1*01 1102
188 gnl|Fabrus|VH3-11_IGHD6-6*01_IGHJ1*01 820 gnl|Fabrus|O18_IGKJ1*01 1102
189 gnl|Fabrus|VH3-20_IGHD5-12*01_IGHJ4*01 852 gnl|Fabrus|O18_IGKJ1*01 1102
190 gnl|Fabrus|VH3-16_IGHD2-15*01_IGHJ2*01 839 gnl|Fabrus|O18_IGKJ1*01 1102
191 gnl|Fabrus|VH3-7_IGHD6-6*01_IGHJ1*01 960 gnl|Fabrus|O18_IGKJ1*01 1102
192 gnl|Fabrus|VH3-16_IGHD6-13*01_IGHJ4*01 844 gnl|Fabrus|O18_IGKJ1*01 1102
193 gnl|Fabrus|VH3-23_IGHD1-1*01_IGHJ4*01 863 gnl|Fabrus|A20_IGKJ1*01 1077
194 gnl|Fabrus|VH3-23_IGHD2-15*01_IGHJ4*01 866 gnl|Fabrus|A20_IGKJ1*01 1077
195 gnl|Fabrus|VH3-23_IGHD3-22*01_IGHJ4*01 870 gnl|Fabrus|A20_IGKJ1*01 1077
196 gnl|Fabrus|VH3-23_IGHD4-11*01_IGHJ4*01 872 gnl|Fabrus|A20_IGKJ1*01 1077
197 gnl|Fabrus|VH3-23_IGHD5-12*01_IGHJ4*01 874 gnl|Fabrus|A20_IGKJ1*01 1077
198 gnl|Fabrus|VH3-23_IGHD5-5*01_IGHJ4*01 876 gnl|Fabrus|A20_IGKJ1*01 1077
199 gnl|Fabrus|VH3-23_IGHD6-13*01_IGHJ4*01 877 gnl|Fabrus|A20_IGKJ1*01 1077
200 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ4*01 880 gnl|Fabrus|A20_IGKJ1*01 1077
201 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ6*01 881 gnl|Fabrus|A20_IGKJ1*01 1077
202 gnl|Fabrus|VH1-69_IGHD1-14*01_IGHJ4*01 770 gnl|Fabrus|A20_IGKJ1*01 1077
203 gnl|Fabrus|VH1-69_IGHD2-2*01_IGHJ4*01 771 gnl|Fabrus|A20_IGKJ1*01 1077
204 gnl|Fabrus|VH1-69_IGHD2-8*01_IGHJ6*01 772 gnl|Fabrus|A20_IGKJ1*01 1077
205 gnl|Fabrus|VH1-69_IGHD3-16*01_IGHJ4*01 773 gnl|Fabrus|A20_IGKJ1*01 1077
206 gnl|Fabrus|VH1-69_IGHD3-3*01_IGHJ4*01 774 gnl|Fabrus|A20_IGKJ1*01 1077
207 gnl|Fabrus|VH1-69_IGHD4-17*01_IGHJ4*01 776 gnl|Fabrus|A20_IGKJ1*01 1077
208 gnl|Fabrus|VH1-69_IGHD5-12*01_IGHJ4*01 777 gnl|Fabrus|A20_IGKJ1*01 1077
209 gnl|Fabrus|VH1-69_IGHD6-19*01_IGHJ4*01 779 gnl|Fabrus|A20_IGKJ1*01 1077
210 gnl|Fabrus|VH1-69_IGHD7-27*01_IGHJ4*01 781 gnl|Fabrus|A20_IGKJ1*01 1077
211 gnl|Fabrus|VH4-34_IGHD1-7*01_IGHJ4*01 1017 gnl|Fabrus|A20_IGKJ1*01 1077
212 gnl|Fabrus|VH4-34_IGHD2-2*01_IGHJ4*01 1018 gnl|Fabrus|A20_IGKJ1*01 1077
213 gnl|Fabrus|VH4-34_IGHD3-16*01_IGHJ4*01 1019 gnl|Fabrus|A20_IGKJ1*01 1077
214 gnl|Fabrus|VH4-34_IGHD4-17*01_IGHJ4*01 1021 gnl|Fabrus|A20_IGKJ1*01 1077
215 gnl|Fabrus|VH4-34_IGHD5-12*01_IGHJ4*01 1022 gnl|Fabrus|A20_IGKJ1*01 1077
216 gnl|Fabrus|VH4-34_IGHD6-13*01_IGHJ4*01 1023 gnl|Fabrus|A20_IGKJ1*01 1077
217 gnl|Fabrus|VH4-34_IGHD6-25*01_IGHJ6*01 1024 gnl|Fabrus|A20_IGKJ1*01 1077
218 gnl|Fabrus|VH4-34_IGHD7-27*01_IGHJ4*01 1026 gnl|Fabrus|A20_IGKJ1*01 1077
219 gnl|Fabrus|VH2-26_IGHD1-20*01_IGHJ4*01 789 gnl|Fabrus|A20_IGKJ1*01 1077
220 gnl|Fabrus|VH2-26_IGHD2-2*01_IGHJ4*01 791 gnl|Fabrus|A20_IGKJ1*01 1077
221 gnl|Fabrus|VH2-26_IGHD3-10*01_IGHJ4*01 792 gnl|Fabrus|A20_IGKJ1*01 1077
222 gnl|Fabrus|VH2-26_IGHD4-11*01_IGHJ4*01 794 gnl|Fabrus|A20_IGKJ1*01 1077
223 gnl|Fabrus|VH2-26_IGHD5-18*01_IGHJ4*01 796 gnl|Fabrus|A20_IGKJ1*01 1077
224 gnl|Fabrus|VH2-26_IGHD6-13*01_IGHJ4*01 797 gnl|Fabrus|A20_IGKJ1*01 1077
225 gnl|Fabrus|VH2-26_IGHD7-27*01_IGHJ4*01 798 gnl|Fabrus|A20_IGKJ1*01 1077
226 gnl|Fabrus|VH5-51_IGHD1-14*01_IGHJ4*01 1044 gnl|Fabrus|A20_IGKJ1*01 1077
227 gnl|Fabrus|VH5-51_IGHD2-8*01_IGHJ4*01 1046 gnl|Fabrus|A20_IGKJ1*01 1077
228 gnl|Fabrus|VH5-51_IGHD3-3*01_IGHJ4*01 1048 gnl|Fabrus|A20_IGKJ1*01 1077
229 gnl|Fabrus|VH5-51_IGHD4-17*01_IGHJ4*01 1049 gnl|Fabrus|A20_IGKJ1*01 1077
230 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1050 gnl|Fabrus|A20_IGKJ1*01 1077
231 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1051 gnl|Fabrus|A20_IGKJ1*01 1077
232 gnl|Fabrus|VH5-51_IGHD6-25*01_IGHJ4*01 1052 gnl|Fabrus|A20_IGKJ1*01 1077
233 gnl|Fabrus|VH5-51_IGHD7-27*01_IGHJ4*01 1053 gnl|Fabrus|A20_IGKJ1*01 1077
234 gnl|Fabrus|VH6-1_IGHD1-1*01_IGHJ4*01 1054 gnl|Fabrus|A20_IGKJ1*01 1077
235 gnl|Fabrus|VH6-1_IGHD2-15*01_IGHJ4*01 1056 gnl|Fabrus|A20_IGKJ1*01 1077
236 gnl|Fabrus|VH6-1_IGHD3-3*01_IGHJ4*01 1059 gnl|Fabrus|A20_IGKJ1*01 1077
237 gnl|Fabrus|VH6-1_IGHD4-23*01_IGHJ4*01 1061 gnl|Fabrus|A20_IGKJ1*01 1077
238 gnl|Fabrus|VH6-1_IGHD4-11*01_IGHJ6*01 1060 gnl|Fabrus|A20_IGKJ1*01 1077
239 gnl|Fabrus|VH6-1_IGHD5-5*01_IGHJ4*01 1062 gnl|Fabrus|A20_IGKJ1*01 1077
240 gnl|Fabrus|VH6-1_IGHD6-13*01_IGHJ4*01 1063 gnl|Fabrus|A20_IGKJ1*01 1077
241 gnl|Fabrus|VH6-1_IGHD6-25*01_IGHJ6*01 1064 gnl|Fabrus|A20_IGKJ1*01 1077
242 gnl|Fabrus|VH6-1_IGHD7-27*01_IGHJ4*01 1065 gnl|Fabrus|A20_IGKJ1*01 1077
243 gnl|Fabrus|VH4-59_IGHD6-25*01_IGHJ3*01 1043 gnl|Fabrus|A20_IGKJ1*01 1077
244 gnl|Fabrus|VH3-48_IGHD6-6*01_IGHJ1*01 923 gnl|Fabrus|A20_IGKJ1*01 1077
245 gnl|Fabrus|VH3-30_IGHD6-6*01_IGHJ1*01 893 gnl|Fabrus|A20_IGKJ1*01 1077
246 gnl|Fabrus|VH3-66_IGHD6-6*01_IGHJ1*01 949 gnl|Fabrus|A20_IGKJ1*01 1077
247 gnl|Fabrus|VH3-53_IGHD5-5*01_IGHJ4*01 938 gnl|Fabrus|A20_IGKJ1*01 1077
248 gnl|Fabrus|VH2-5_IGHD5-12*01_IGHJ4*01 804 gnl|Fabrus|A20_IGKJ1*01 1077
249 gnl|Fabrus|VH2-70_IGHD5-12*01_IGHJ4*01 811 gnl|Fabrus|A20_IGKJ1*01 1077
250 gnl|Fabrus|VH3-15_IGHD5-12*01_IGHJ4*01 835 gnl|Fabrus|A20_IGKJ1*01 1077
251 gnl|Fabrus|VH3-15_IGHD3-10*01_IGHJ4*01 833 gnl|Fabrus|A20_IGKJ1*01 1077
252 gnl|Fabrus|VH3-49_IGHD5-18*01_IGHJ4*01 930 gnl|Fabrus|A20_IGKJ1*01 1077
253 gnl|Fabrus|VH3-49_IGHD6-13*01_IGHJ4*01 931 gnl|Fabrus|A20_IGKJ1*01 1077
254 gnl|Fabrus|VH3-72_IGHD5-18*01_IGHJ4*01 967 gnl|Fabrus|A20_IGKJ1*01 1077
255 gnl|Fabrus|VH3-72_IGHD6-6*01_IGHJ1*01 969 gnl|Fabrus|A20_IGKJ1*01 1077
256 gnl|Fabrus|VH3-73_IGHD5-12*01_IGHJ4*01 977 gnl|Fabrus|A20_IGKJ1*01 1077
257 gnl|Fabrus|VH3-73_IGHD4-23*01_IGHJ5*01 976 gnl|Fabrus|A20_IGKJ1*01 1077
258 gnl|Fabrus|VH3-43_IGHD3-22*01_IGHJ4*01 918 gnl|Fabrus|A20_IGKJ1*01 1077
259 gnl|Fabrus|VH3-43_IGHD6-13*01_IGHJ4*01 921 gnl|Fabrus|A20_IGKJ1*01 1077
260 gnl|Fabrus|VH3-9_IGHD3-22*01_IGHJ4*01 992 gnl|Fabrus|A20_IGKJ1*01 1077
261 gnl|Fabrus|VH3-9_IGHD1-7*01_IGHJ5*01 989 gnl|Fabrus|A20_IGKJ1*01 1077
262 gnl|Fabrus|VH3-9_IGHD6-13*01_IGHJ4*01 995 gnl|Fabrus|A20_IGKJ1*01 1077
263 gnl|Fabrus|VH4-39_IGHD3-10*01_IGHJ4*01 1030 gnl|Fabrus|A20_IGKJ1*01 1077
264 gnl|Fabrus|VH4-39_IGHD5-12*01_IGHJ4*01 1034 gnl|Fabrus|A20_IGKJ1*01 1077
265 gnl|Fabrus|VH1-18_IGHD6-6*01_IGHJ1*01 728 gnl|Fabrus|A20_IGKJ1*01 1077
266 gnl|Fabrus|VH1-24_IGHD5-12*01_IGHJ4*01 735 gnl|Fabrus|A20_IGKJ1*01 1077
267 gnl|Fabrus|VH1-2_IGHD1-1*01_IGHJ3*01 729 gnl|Fabrus|A20_IGKJ1*01 1077
268 gnl|Fabrus|VH1-3_IGHD6-6*01_IGHJ1*01 743 gnl|Fabrus|A20_IGKJ1*01 1077
269 gnl|Fabrus|VH1-45_IGHD3-10*01_IGHJ4*01 748 gnl|Fabrus|A20_IGKJ1*01 1077
270 gnl|Fabrus|VH1-46_IGHD1-26*01_IGHJ4*01 754 gnl|Fabrus|A20_IGKJ1*01 1077
271 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ6*01 1068 gnl|Fabrus|A20_IGKJ1*01 1077
272 gnl|Fabrus|VH2-70_IGHD3-9*01_IGHJ6*01 810 gnl|Fabrus|A20_IGKJ1*01 1077
273 gnl|Fabrus|VH1-58_IGHD3-10*01_IGHJ6*01 764 gnl|Fabrus|A20_IGKJ1*01 1077
274 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ2*01 1067 gnl|Fabrus|A20_IGKJ1*01 1077
275 gnl|Fabrus|VH4-28_IGHD3-9*01_IGHJ6*01 1002 gnl|Fabrus|A20_IGKJ1*01 1077
276 gnl|Fabrus|VH4-31_IGHD2-15*01_IGHJ2*01 1008 gnl|Fabrus|A20_IGKJ1*01 1077
277 gnl|Fabrus|VH2-5_IGHD3-9*01_IGHJ6*01 803 gnl|Fabrus|A20_IGKJ1*01 1077
278 gnl|Fabrus|VH1-8_IGHD2-15*01_IGHJ6*01 783 gnl|Fabrus|A20_IGKJ1*01 1077
279 gnl|Fabrus|VH2-70_IGHD2-15*01_IGHJ2*01 808 gnl|Fabrus|A20_IGKJ1*01 1077
280 gnl|Fabrus|VH3-38_IGHD3-10*01_IGHJ4*01 907 gnl|Fabrus|A20_IGKJ1*01 1077
281 gnl|Fabrus|VH3-16_IGHD1-7*01_IGHJ6*01 838 gnl|Fabrus|A20_IGKJ1*01 1077
282 gnl|Fabrus|VH3-73_IGHD3-9*01_IGHJ6*01 974 gnl|Fabrus|A20_IGKJ1*01 1077
283 gnl|Fabrus|VH3-11_IGHD3-9*01_IGHJ6*01 816 gnl|Fabrus|A20_IGKJ1*01 1077
284 gnl|Fabrus|VH3-11_IGHD6-6*01_IGHJ1*01 820 gnl|Fabrus|A20_IGKJ1*01 1077
285 gnl|Fabrus|VH3-20_IGHD5-12*01_IGHJ4*01 852 gnl|Fabrus|A20_IGKJ1*01 1077
286 gnl|Fabrus|VH3-16_IGHD2-15*01_IGHJ2*01 839 gnl|Fabrus|A20_IGKJ1*01 1077
287 gnl|Fabrus|VH3-7_IGHD6-6*01_IGHJ1*01 960 gnl|Fabrus|A20_IGKJ1*01 1077
288 gnl|Fabrus|VH3-16_IGHD6-13*01_IGHJ4*01 844 gnl|Fabrus|A20_IGKJ1*01 1077
289 gnl|Fabrus|VH3-23_IGHD1-1*01_IGHJ4*01 863 gnl|Fabrus|A30_IGKJ1*01 1082
290 gnl|Fabrus|VH3-23_IGHD2-15*01_IGHJ4*01 866 gnl|Fabrus|A30_IGKJ1*01 1082
291 gnl|Fabrus|VH3-23_IGHD3-22*01_IGHJ4*01 870 gnl|Fabrus|A30_IGKJ1*01 1082
292 gnl|Fabrus|VH3-23_IGHD4-11*01_IGHJ4*01 872 gnl|Fabrus|A30_IGKJ1*01 1082
293 gnl|Fabrus|VH3-23_IGHD5-12*01_IGHJ4*01 874 gnl|Fabrus|A30_IGKJ1*01 1082
294 gnl|Fabrus|VH3-23_IGHD5-5*01_IGHJ4*01 876 gnl|Fabrus|A30_IGKJ1*01 1082
295 gnl|Fabrus|VH3-23_IGHD6-13*01_IGHJ4*01 877 gnl|Fabrus|A30_IGKJ1*01 1082
296 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ4*01 880 gnl|Fabrus|A30_IGKJ1*01 1082
297 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ6*01 881 gnl|Fabrus|A30_IGKJ1*01 1082
298 gnl|Fabrus|VH1-69_IGHD1-14*01_IGHJ4*01 770 gnl|Fabrus|A30_IGKJ1*01 1082
299 gnl|Fabrus|VH1-69_IGHD2-2*01_IGHJ4*01 771 gnl|Fabrus|A30_IGKJ1*01 1082
300 gnl|Fabrus|VH1-69_IGHD2-8*01_IGHJ6*01 772 gnl|Fabrus|A30_IGKJ1*01 1082
301 gnl|Fabrus|VH1-69_IGHD3-16*01_IGHJ4*01 773 gnl|Fabrus|A30_IGKJ1*01 1082
302 gnl|Fabrus|VH1-69_IGHD3-3*01_IGHJ4*01 774 gnl|Fabrus|A30_IGKJ1*01 1082
303 gnl|Fabrus|VH1-69_IGHD4-17*01_IGHJ4*01 776 gnl|Fabrus|A30_IGKJ1*01 1082
304 gnl|Fabrus|VH1-69_IGHD5-12*01_IGHJ4*01 777 gnl|Fabrus|A30_IGKJ1*01 1082
305 gnl|Fabrus|VH1-69_IGHD6-19*01_IGHJ4*01 779 gnl|Fabrus|A30_IGKJ1*01 1082
306 gnl|Fabrus|VH1-69_IGHD7-27*01_IGHJ4*01 781 gnl|Fabrus|A30_IGKJ1*01 1082
307 gnl|Fabrus|VH4-34_IGHD1-7*01_IGHJ4*01 1017 gnl|Fabrus|A30_IGKJ1*01 1082
308 gnl|Fabrus|VH4-34_IGHD2-2*01_IGHJ4*01 1018 gnl|Fabrus|A30_IGKJ1*01 1082
309 gnl|Fabrus|VH4-34_IGHD3-16*01_IGHJ4*01 1019 gnl|Fabrus|A30_IGKJ1*01 1082
310 gnl|Fabrus|VH4-34_IGHD4-17*01_IGHJ4*01 1021 gnl|Fabrus|A30_IGKJ1*01 1082
311 gnl|Fabrus|VH4-34_IGHD5-12*01_IGHJ4*01 1022 gnl|Fabrus|A30_IGKJ1*01 1082
312 gnl|Fabrus|VH4-34_IGHD6-13*01_IGHJ4*01 1023 gnl|Fabrus|A30_IGKJ1*01 1082
313 gnl|Fabrus|VH4-34_IGHD6-25*01_IGHJ6*01 1024 gnl|Fabrus|A30_IGKJ1*01 1082
314 gnl|Fabrus|VH4-34_IGHD7-27*01_IGHJ4*01 1026 gnl|Fabrus|A30_IGKJ1*01 1082
315 gnl|Fabrus|VH2-26_IGHD1-20*01_IGHJ4*01 789 gnl|Fabrus|A30_IGKJ1*01 1082
316 gnl|Fabrus|VH2-26_IGHD2-2*01_IGHJ4*01 791 gnl|Fabrus|A30_IGKJ1*01 1082
317 gnl|Fabrus|VH2-26_IGHD3-10*01_IGHJ4*01 792 gnl|Fabrus|A30_IGKJ1*01 1082
318 gnl|Fabrus|VH2-26_IGHD4-11*01_IGHJ4*01 794 gnl|Fabrus|A30_IGKJ1*01 1082
319 gnl|Fabrus|VH2-26_IGHD5-18*01_IGHJ4*01 796 gnl|Fabrus|A30_IGKJ1*01 1082
320 gnl|Fabrus|VH2-26_IGHD6-13*01_IGHJ4*01 797 gnl|Fabrus|A30_IGKJ1*01 1082
321 gnl|Fabrus|VH2-26_IGHD7-27*01_IGHJ4*01 798 gnl|Fabrus|A30_IGKJ1*01 1082
322 gnl|Fabrus|VH5-51_IGHD1-14*01_IGHJ4*01 1044 gnl|Fabrus|A30_IGKJ1*01 1082
323 gnl|Fabrus|VH5-51_IGHD2-8*01_IGHJ4*01 1046 gnl|Fabrus|A30_IGKJ1*01 1082
324 gnl|Fabrus|VH5-51_IGHD3-3*01_IGHJ4*01 1048 gnl|Fabrus|A30_IGKJ1*01 1082
325 gnl|Fabrus|VH5-51_IGHD4-17*01_IGHJ4*01 1049 gnl|Fabrus|A30_IGKJ1*01 1082
326 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1050 gnl|Fabrus|A30_IGKJ1*01 1082
327 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1051 gnl|Fabrus|A30_IGKJ1*01 1082
328 gnl|Fabrus|VH5-51_IGHD6-25*01_IGHJ4*01 1052 gnl|Fabrus|A30_IGKJ1*01 1082
329 gnl|Fabrus|VH5-51_IGHD7-27*01_IGHJ4*01 1053 gnl|Fabrus|A30_IGKJ1*01 1082
330 gnl|Fabrus|VH6-1_IGHD1-1*01_IGHJ4*01 1054 gnl|Fabrus|A30_IGKJ1*01 1082
331 gnl|Fabrus|VH6-1_IGHD2-15*01_IGHJ4*01 1056 gnl|Fabrus|A30_IGKJ1*01 1082
332 gnl|Fabrus|VH6-1_IGHD3-3*01_IGHJ4*01 1059 gnl|Fabrus|A30_IGKJ1*01 1082
333 gnl|Fabrus|VH6-1_IGHD4-23*01_IGHJ4*01 1061 gnl|Fabrus|A30_IGKJ1*01 1082
334 gnl|Fabrus|VH6-1_IGHD4-11*01_IGHJ6*01 1060 gnl|Fabrus|A30_IGKJ1*01 1082
335 gnl|Fabrus|VH6-1_IGHD5-5*01_IGHJ4*01 1062 gnl|Fabrus|A30_IGKJ1*01 1082
336 gnl|Fabrus|VH6-1_IGHD6-13*01_IGHJ4*01 1063 gnl|Fabrus|A30_IGKJ1*01 1082
337 gnl|Fabrus|VH6-1_IGHD6-25*01_IGHJ6*01 1064 gnl|Fabrus|A30_IGKJ1*01 1082
338 gnl|Fabrus|VH6-1_IGHD7-27*01_IGHJ4*01 1065 gnl|Fabrus|A30_IGKJ1*01 1082
339 gnl|Fabrus|VH4-59_IGHD6-25*01_IGHJ3*01 1043 gnl|Fabrus|A30_IGKJ1*01 1082
340 gnl|Fabrus|VH3-48_IGHD6-6*01_IGHJ1*01 923 gnl|Fabrus|A30_IGKJ1*01 1082
341 gnl|Fabrus|VH3-30_IGHD6-6*01_IGHJ1*01 893 gnl|Fabrus|A30_IGKJ1*01 1082
342 gnl|Fabrus|VH3-66_IGHD6-6*01_IGHJ1*01 949 gnl|Fabrus|A30_IGKJ1*01 1082
343 gnl|Fabrus|VH3-53_IGHD5-5*01_IGHJ4*01 938 gnl|Fabrus|A30_IGKJ1*01 1082
344 gnl|Fabrus|VH2-5_IGHD5-12*01_IGHJ4*01 804 gnl|Fabrus|A30_IGKJ1*01 1082
345 gnl|Fabrus|VH2-70_IGHD5-12*01_IGHJ4*01 811 gnl|Fabrus|A30_IGKJ1*01 1082
346 gnl|Fabrus|VH3-15_IGHD5-12*01_IGHJ4*01 835 gnl|Fabrus|A30_IGKJ1*01 1082
347 gnl|Fabrus|VH3-15_IGHD3-10*01_IGHJ4*01 833 gnl|Fabrus|A30_IGKJ1*01 1082
348 gnl|Fabrus|VH3-49_IGHD5-18*01_IGHJ4*01 930 gnl|Fabrus|A30_IGKJ1*01 1082
349 gnl|Fabrus|VH3-49_IGHD6-13*01_IGHJ4*01 931 gnl|Fabrus|A30_IGKJ1*01 1082
350 gnl|Fabrus|VH3-72_IGHD5-18*01_IGHJ4*01 967 gnl|Fabrus|A30_IGKJ1*01 1082
351 gnl|Fabrus|VH3-72_IGHD6-6*01_IGHJ1*01 969 gnl|Fabrus|A30_IGKJ1*01 1082
352 gnl|Fabrus|VH3-73_IGHD5-12*01_IGHJ4*01 977 gnl|Fabrus|A30_IGKJ1*01 1082
353 gnl|Fabrus|VH3-73_IGHD4-23*01_IGHJ5*01 976 gnl|Fabrus|A30_IGKJ1*01 1082
354 gnl|Fabrus|VH3-43_IGHD3-22*01_IGHJ4*01 918 gnl|Fabrus|A30_IGKJ1*01 1082
355 gnl|Fabrus|VH3-43_IGHD6-13*01_IGHJ4*01 921 gnl|Fabrus|A30_IGKJ1*01 1082
356 gnl|Fabrus|VH3-9_IGHD3-22*01_IGHJ4*01 992 gnl|Fabrus|A30_IGKJ1*01 1082
357 gnl|Fabrus|VH3-9_IGHD1-7*01_IGHJ5*01 989 gnl|Fabrus|A30_IGKJ1*01 1082
358 gnl|Fabrus|VH3-9_IGHD6-13*01_IGHJ4*01 995 gnl|Fabrus|A30_IGKJ1*01 1082
359 gnl|Fabrus|VH4-39_IGHD3-10*01_IGHJ4*01 1030 gnl|Fabrus|A30_IGKJ1*01 1082
360 gnl|Fabrus|VH4-39_IGHD5-12*01_IGHJ4*01 1034 gnl|Fabrus|A30_IGKJ1*01 1082
361 gnl|Fabrus|VH1-18_IGHD6-6*01_IGHJ1*01 728 gnl|Fabrus|A30_IGKJ1*01 1082
362 gnl|Fabrus|VH1-24_IGHD5-12*01_IGHJ4*01 735 gnl|Fabrus|A30_IGKJ1*01 1082
363 gnl|Fabrus|VH1-2_IGHD1-1*01_IGHJ3*01 729 gnl|Fabrus|A30_IGKJ1*01 1082
364 gnl|Fabrus|VH1-3_IGHD6-6*01_IGHJ1*01 743 gnl|Fabrus|A30_IGKJ1*01 1082
365 gnl|Fabrus|VH1-45_IGHD3-10*01_IGHJ4*01 748 gnl|Fabrus|A30_IGKJ1*01 1082
366 gnl|Fabrus|VH1-46_IGHD1-26*01_IGHJ4*01 754 gnl|Fabrus|A30_IGKJ1*01 1082
367 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ6*01 1068 gnl|Fabrus|A30_IGKJ1*01 1082
368 gnl|Fabrus|VH2-70_IGHD3-9*01_IGHJ6*01 810 gnl|Fabrus|A30_IGKJ1*01 1082
369 gnl|Fabrus|VH1-58_IGHD3-10*01_IGHJ6*01 764 gnl|Fabrus|A30_IGKJ1*01 1082
370 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ2*01 1067 gnl|Fabrus|A30_IGKJ1*01 1082
371 gnl|Fabrus|VH4-28_IGHD3-9*01_IGHJ6*01 1002 gnl|Fabrus|A30_IGKJ1*01 1082
372 gnl|Fabrus|VH4-31_IGHD2-15*01_IGHJ2*01 1008 gnl|Fabrus|A30_IGKJ1*01 1082
373 gnl|Fabrus|VH2-5_IGHD3-9*01_IGHJ6*01 803 gnl|Fabrus|A30_IGKJ1*01 1082
374 gnl|Fabrus|VH1-8_IGHD2-15*01_IGHJ6*01 783 gnl|Fabrus|A30_IGKJ1*01 1082
375 gnl|Fabrus|VH2-70_IGHD2-15*01_IGHJ2*01 808 gnl|Fabrus|A30_IGKJ1*01 1082
376 gnl|Fabrus|VH3-38_IGHD3-10*01_IGHJ4*01 907 gnl|Fabrus|A30_IGKJ1*01 1082
377 gnl|Fabrus|VH3-16_IGHD1-7*01_IGHJ6*01 838 gnl|Fabrus|A30_IGKJ1*01 1082
378 gnl|Fabrus|VH3-73_IGHD3-9*01_IGHJ6*01 974 gnl|Fabrus|A30_IGKJ1*01 1082
379 gnl|Fabrus|VH3-11_IGHD3-9*01_IGHJ6*01 816 gnl|Fabrus|A30_IGKJ1*01 1082
380 gnl|Fabrus|VH3-11_IGHD6-6*01_IGHJ1*01 820 gnl|Fabrus|A30_IGKJ1*01 1082
381 gnl|Fabrus|VH3-20_IGHD5-12*01_IGHJ4*01 852 gnl|Fabrus|A30_IGKJ1*01 1082
382 gnl|Fabrus|VH3-16_IGHD2-15*01_IGHJ2*01 839 gnl|Fabrus|A30_IGKJ1*01 1082
383 gnl|Fabrus|VH3-7_IGHD6-6*01_IGHJ1*01 960 gnl|Fabrus|A30_IGKJ1*01 1082
384 gnl|Fabrus|VH3-16_IGHD6-13*01_IGHJ4*01 844 gnl|Fabrus|A30_IGKJ1*01 1082
385 gnl|Fabrus|VH3-23_IGHD1-1*01_IGHJ4*01 863 gnl|Fabrus|L4/18a_IGKJ1*01 1095
386 gnl|Fabrus|VH3-23_IGHD2-15*01_IGHJ4*01 866 gnl|Fabrus|L4/18a_IGKJ1*01 1095
387 gnl|Fabrus|VH3-23_IGHD3-22*01_IGHJ4*01 870 gnl|Fabrus|L4/18a_IGKJ1*01 1095
388 gnl|Fabrus|VH3-23_IGHD4-11*01_IGHJ4*01 872 gnl|Fabrus|L4/18a_IGKJ1*01 1095
389 gnl|Fabrus|VH3-23_IGHD5-12*01_IGHJ4*01 874 gnl|Fabrus|L4/18a_IGKJ1*01 1095
390 gnl|Fabrus|VH3-23_IGHD5-5*01_IGHJ4*01 876 gnl|Fabrus|L4/18a_IGKJ1*01 1095
391 gnl|Fabrus|VH3-23_IGHD6-13*01_IGHJ4*01 877 gnl|Fabrus|L4/18a_IGKJ1*01 1095
392 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ4*01 880 gnl|Fabrus|L4/18a_IGKJ1*01 1095
393 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ6*01 881 gnl|Fabrus|L4/18a_IGKJ1*01 1095
394 gnl|Fabrus|VH1-69_IGHD1-14*01_IGHJ4*01 770 gnl|Fabrus|L4/18a_IGKJ1*01 1095
395 gnl|Fabrus|VH1-69_IGHD2-2*01_IGHJ4*01 771 gnl|Fabrus|L4/18a_IGKJ1*01 1095
396 gnl|Fabrus|VH1-69_IGHD2-8*01_IGHJ6*01 772 gnl|Fabrus|L4/18a_IGKJ1*01 1095
397 gnl|Fabrus|VH1-69_IGHD3-16*01_IGHJ4*01 773 gnl|Fabrus|L4/18a_IGKJ1*01 1095
398 gnl|Fabrus|VH1-69_IGHD3-3*01_IGHJ4*01 774 gnl|Fabrus|L4/18a_IGKJ1*01 1095
399 gnl|Fabrus|VH1-69_IGHD4-17*01_IGHJ4*01 776 gnl|Fabrus|L4/18a_IGKJ1*01 1095
400 gnl|Fabrus|VH1-69_IGHD5-12*01_IGHJ4*01 777 gnl|Fabrus|L4/18a_IGKJ1*01 1095
401 gnl|Fabrus|VH1-69_IGHD6-19*01_IGHJ4*01 779 gnl|Fabrus|L4/18a_IGKJ1*01 1095
402 gnl|Fabrus|VH1-69_IGHD7-27*01_IGHJ4*01 781 gnl|Fabrus|L4/18a_IGKJ1*01 1095
403 gnl|Fabrus|VH4-34_IGHD1-7*01_IGHJ4*01 1017 gnl|Fabrus|L4/18a_IGKJ1*01 1095
404 gnl|Fabrus|VH4-34_IGHD2-2*01_IGHJ4*01 1018 gnl|Fabrus|L4/18a_IGKJ1*01 1095
405 gnl|Fabrus|VH4-34_IGHD3-16*01_IGHJ4*01 1019 gnl|Fabrus|L4/18a_IGKJ1*01 1095
406 gnl|Fabrus|VH4-34_IGHD4-17*01_IGHJ4*01 1021 gnl|Fabrus|L4/18a_IGKJ1*01 1095
407 gnl|Fabrus|VH4-34_IGHD5-12*01_IGHJ4*01 1022 gnl|Fabrus|L4/18a_IGKJ1*01 1095
408 gnl|Fabrus|VH4-34_IGHD6-13*01_IGHJ4*01 1023 gnl|Fabrus|L4/18a_IGKJ1*01 1095
409 gnl|Fabrus|VH4-34_IGHD6-25*01_IGHJ6*01 1024 gnl|Fabrus|L4/18a_IGKJ1*01 1095
410 gnl|Fabrus|VH4-34_IGHD7-27*01_IGHJ4*01 1026 gnl|Fabrus|L4/18a_IGKJ1*01 1095
411 gnl|Fabrus|VH2-26_IGHD1-20*01_IGHJ4*01 789 gnl|Fabrus|L4/18a_IGKJ1*01 1095
412 gnl|Fabrus|VH2-26_IGHD2-2*01_IGHJ4*01 791 gnl|Fabrus|L4/18a_IGKJ1*01 1095
413 gnl|Fabrus|VH2-26_IGHD3-10*01_IGHJ4*01 792 gnl|Fabrus|L4/18a_IGKJ1*01 1095
414 gnl|Fabrus|VH2-26_IGHD4-11*01_IGHJ4*01 794 gnl|Fabrus|L4/18a_IGKJ1*01 1095
415 gnl|Fabrus|VH2-26_IGHD5-18*01_IGHJ4*01 796 gnl|Fabrus|L4/18a_IGKJ1*01 1095
416 gnl|Fabrus|VH2-26_IGHD6-13*01_IGHJ4*01 797 gnl|Fabrus|L4/18a_IGKJ1*01 1095
417 gnl|Fabrus|VH2-26_IGHD7-27*01_IGHJ4*01 798 gnl|Fabrus|L4/18a_IGKJ1*01 1095
418 gnl|Fabrus|VH5-51_IGHD1-14*01_IGHJ4*01 1044 gnl|Fabrus|L4/18a_IGKJ1*01 1095
419 gnl|Fabrus|VH5-51_IGHD2-8*01_IGHJ4*01 1046 gnl|Fabrus|L4/18a_IGKJ1*01 1095
420 gnl|Fabrus|VH5-51_IGHD3-3*01_IGHJ4*01 1048 gnl|Fabrus|L4/18a_IGKJ1*01 1095
421 gnl|Fabrus|VH5-51_IGHD4-17*01_IGHJ4*01 1049 gnl|Fabrus|L4/18a_IGKJ1*01 1095
422 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1050 gnl|Fabrus|L4/18a_IGKJ1*01 1095
423 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1051 gnl|Fabrus|L4/18a_IGKJ1*01 1095
424 gnl|Fabrus|VH5-51_IGHD6-25*01_IGHJ4*01 1052 gnl|Fabrus|L4/18a_IGKJ1*01 1095
425 gnl|Fabrus|VH5-51_IGHD7-27*01_IGHJ4*01 1053 gnl|Fabrus|L4/18a_IGKJ1*01 1095
426 gnl|Fabrus|VH6-1_IGHD1-1*01_IGHJ4*01 1054 gnl|Fabrus|L4/18a_IGKJ1*01 1095
427 gnl|Fabrus|VH6-1_IGHD2-15*01_IGHJ4*01 1056 gnl|Fabrus|L4/18a_IGKJ1*01 1095
428 gnl|Fabrus|VH6-1_IGHD3-3*01_IGHJ4*01 1059 gnl|Fabrus|L4/18a_IGKJ1*01 1095
429 gnl|Fabrus|VH6-1_IGHD4-23*01_IGHJ4*01 1061 gnl|Fabrus|L4/18a_IGKJ1*01 1095
430 gnl|Fabrus|VH6-1_IGHD4-11*01_IGHJ6*01 1060 gnl|Fabrus|L4/18a_IGKJ1*01 1095
431 gnl|Fabrus|VH6-1_IGHD5-5*01_IGHJ4*01 1062 gnl|Fabrus|L4/18a_IGKJ1*01 1095
432 gnl|Fabrus|VH6-1_IGHD6-13*01_IGHJ4*01 1063 gnl|Fabrus|L4/18a_IGKJ1*01 1095
433 gnl|Fabrus|VH6-1_IGHD6-25*01_IGHJ6*01 1064 gnl|Fabrus|L4/18a_IGKJ1*01 1095
434 gnl|Fabrus|VH6-1_IGHD7-27*01_IGHJ4*01 1065 gnl|Fabrus|L4/18a_IGKJ1*01 1095
435 gnl|Fabrus|VH4-59_IGHD6-25*01_IGHJ3*01 1043 gnl|Fabrus|L4/18a_IGKJ1*01 1095
436 gnl|Fabrus|VH3-48_IGHD6-6*01_IGHJ1*01 923 gnl|Fabrus|L4/18a_IGKJ1*01 1095
437 gnl|Fabrus|VH3-30_IGHD6-6*01_IGHJ1*01 893 gnl|Fabrus|L4/18a_IGKJ1*01 1095
438 gnl|Fabrus|VH3-66_IGHD6-6*01_IGHJ1*01 949 gnl|Fabrus|L4/18a_IGKJ1*01 1095
439 gnl|Fabrus|VH3-53_IGHD5-5*01_IGHJ4*01 938 gnl|Fabrus|L4/18a_IGKJ1*01 1095
440 gnl|Fabrus|VH2-5_IGHD5-12*01_IGHJ4*01 804 gnl|Fabrus|L4/18a_IGKJ1*01 1095
441 gnl|Fabrus|VH2-70_IGHD5-12*01_IGHJ4*01 811 gnl|Fabrus|L4/18a_IGKJ1*01 1095
442 gnl|Fabrus|VH3-15_IGHD5-12*01_IGHJ4*01 835 gnl|Fabrus|L4/18a_IGKJ1*01 1095
443 gnl|Fabrus|VH3-15_IGHD3-10*01_IGHJ4*01 833 gnl|Fabrus|L4/18a_IGKJ1*01 1095
444 gnl|Fabrus|VH3-49_IGHD5-18*01_IGHJ4*01 930 gnl|Fabrus|L4/18a_IGKJ1*01 1095
445 gnl|Fabrus|VH3-49_IGHD6-13*01_IGHJ4*01 931 gnl|Fabrus|L4/18a_IGKJ1*01 1095
446 gnl|Fabrus|VH3-72_IGHD5-18*01_IGHJ4*01 967 gnl|Fabrus|L4/18a_IGKJ1*01 1095
447 gnl|Fabrus|VH3-72_IGHD6-6*01_IGHJ1*01 969 gnl|Fabrus|L4/18a_IGKJ1*01 1095
448 gnl|Fabrus|VH3-73_IGHD5-12*01_IGHJ4*01 977 gnl|Fabrus|L4/18a_IGKJ1*01 1095
449 gnl|Fabrus|VH3-73_IGHD4-23*01_IGHJ5*01 976 gnl|Fabrus|L4/18a_IGKJ1*01 1095
450 gnl|Fabrus|VH3-43_IGHD3-22*01_IGHJ4*01 918 gnl|Fabrus|L4/18a_IGKJ1*01 1095
451 gnl|Fabrus|VH3-43_IGHD6-13*01_IGHJ4*01 921 gnl|Fabrus|L4/18a_IGKJ1*01 1095
452 gnl|Fabrus|VH3-9_IGHD3-22*01_IGHJ4*01 992 gnl|Fabrus|L4/18a_IGKJ1*01 1095
453 gnl|Fabrus|VH3-9_IGHD1-7*01_IGHJ5*01 989 gnl|Fabrus|L4/18a_IGKJ1*01 1095
454 gnl|Fabrus|VH3-9_IGHD6-13*01_IGHJ4*01 995 gnl|Fabrus|L4/18a_IGKJ1*01 1095
455 gnl|Fabrus|VH4-39_IGHD3-10*01_IGHJ4*01 1030 gnl|Fabrus|L4/18a_IGKJ1*01 1095
456 gnl|Fabrus|VH4-39_IGHD5-12*01_IGHJ4*01 1034 gnl|Fabrus|L4/18a_IGKJ1*01 1095
457 gnl|Fabrus|VH1-18_IGHD6-6*01_IGHJ1*01 728 gnl|Fabrus|L4/18a_IGKJ1*01 1095
458 gnl|Fabrus|VH1-24_IGHD5-12*01_IGHJ4*01 735 gnl|Fabrus|L4/18a_IGKJ1*01 1095
459 gnl|Fabrus|VH1-2_IGHD1-1*01_IGHJ3*01 729 gnl|Fabrus|L4/18a_IGKJ1*01 1095
460 gnl|Fabrus|VH1-3_IGHD6-6*01_IGHJ1*01 743 gnl|Fabrus|L4/18a_IGKJ1*01 1095
461 gnl|Fabrus|VH1-45_IGHD3-10*01_IGHJ4*01 748 gnl|Fabrus|L4/18a_IGKJ1*01 1095
462 gnl|Fabrus|VH1-46_IGHD1-26*01_IGHJ4*01 754 gnl|Fabrus|L4/18a_IGKJ1*01 1095
463 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ6*01 1068 gnl|Fabrus|L4/18a_IGKJ1*01 1095
464 gnl|Fabrus|VH2-70_IGHD3-9*01_IGHJ6*01 810 gnl|Fabrus|L4/18a_IGKJ1*01 1095
465 gnl|Fabrus|VH1-58_IGHD3-10*01_IGHJ6*01 764 gnl|Fabrus|L4/18a_IGKJ1*01 1095
466 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ2*01 1067 gnl|Fabrus|L4/18a_IGKJ1*01 1095
467 gnl|Fabrus|VH4-28_IGHD3-9*01_IGHJ6*01 1002 gnl|Fabrus|L4/18a_IGKJ1*01 1095
468 gnl|Fabrus|VH4-31_IGHD2-15*01_IGHJ2*01 1008 gnl|Fabrus|L4/18a_IGKJ1*01 1095
469 gnl|Fabrus|VH2-5_IGHD3-9*01_IGHJ6*01 803 gnl|Fabrus|L4/18a_IGKJ1*01 1095
470 gnl|Fabrus|VH1-8_IGHD2-15*01_IGHJ6*01 783 gnl|Fabrus|L4/18a_IGKJ1*01 1095
471 gnl|Fabrus|VH2-70_IGHD2-15*01_IGHJ2*01 808 gnl|Fabrus|L4/18a_IGKJ1*01 1095
472 gnl|Fabrus|VH3-38_IGHD3-10*01_IGHJ4*01 907 gnl|Fabrus|L4/18a_IGKJ1*01 1095
473 gnl|Fabrus|VH3-16_IGHD1-7*01_IGHJ6*01 838 gnl|Fabrus|L4/18a_IGKJ1*01 1095
474 gnl|Fabrus|VH3-73_IGHD3-9*01_IGHJ6*01 974 gnl|Fabrus|L4/18a_IGKJ1*01 1095
475 gnl|Fabrus|VH3-11_IGHD3-9*01_IGHJ6*01 816 gnl|Fabrus|L4/18a_IGKJ1*01 1095
476 gnl|Fabrus|VH3-11_IGHD6-6*01_IGHJ1*01 820 gnl|Fabrus|L4/18a_IGKJ1*01 1095
477 gnl|Fabrus|VH3-20_IGHD5-12*01_IGHJ4*01 852 gnl|Fabrus|L4/18a_IGKJ1*01 1095
478 gnl|Fabrus|VH3-16_IGHD2-15*01_IGHJ2*01 839 gnl|Fabrus|L4/18a_IGKJ1*01 1095
479 gnl|Fabrus|VH3-7_IGHD6-6*01_IGHJ1*01 960 gnl|Fabrus|L4/18a_IGKJ1*01 1095
480 gnl|Fabrus|VH3-16_IGHD6-13*01_IGHJ4*01 844 gnl|Fabrus|L4/18a_IGKJ1*01 1095
481 gnl|Fabrus|VH3-23_IGHD1-1*01_IGHJ4*01 863 gnl|Fabrus|L5_IGKJ1*01 1096
482 gnl|Fabrus|VH3-23_IGHD2-15*01_IGHJ4*01 866 gnl|Fabrus|L5_IGKJ1*01 1096
483 gnl|Fabrus|VH3-23_IGHD3-22*01_IGHJ4*01 870 gnl|Fabrus|L5_IGKJ1*01 1096
484 gnl|Fabrus|VH3-23_IGHD4-11*01_IGHJ4*01 872 gnl|Fabrus|L5_IGKJ1*01 1096
485 gnl|Fabrus|VH3-23_IGHD5-12*01_IGHJ4*01 874 gnl|Fabrus|L5_IGKJ1*01 1096
486 gnl|Fabrus|VH3-23_IGHD5-5*01_IGHJ4*01 876 gnl|Fabrus|L5_IGKJ1*01 1096
487 gnl|Fabrus|VH3-23_IGHD6-13*01_IGHJ4*01 877 gnl|Fabrus|L5_IGKJ1*01 1096
488 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ4*01 880 gnl|Fabrus|L5_IGKJ1*01 1096
489 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ6*01 881 gnl|Fabrus|L5_IGKJ1*01 1096
490 gnl|Fabrus|VH1-69_IGHD1-14*01_IGHJ4*01 770 gnl|Fabrus|L5_IGKJ1*01 1096
491 gnl|Fabrus|VH1-69_IGHD2-2*01_IGHJ4*01 771 gnl|Fabrus|L5_IGKJ1*01 1096
492 gnl|Fabrus|VH1-69_IGHD2-8*01_IGHJ6*01 772 gnl|Fabrus|L5_IGKJ1*01 1096
493 gnl|Fabrus|VH1-69_IGHD3-16*01_IGHJ4*01 773 gnl|Fabrus|L5_IGKJ1*01 1096
494 gnl|Fabrus|VH1-69_IGHD3-3*01_IGHJ4*01 774 gnl|Fabrus|L5_IGKJ1*01 1096
495 gnl|Fabrus|VH1-69_IGHD4-17*01_IGHJ4*01 776 gnl|Fabrus|L5_IGKJ1*01 1096
496 gnl|Fabrus|VH1-69_IGHD5-12*01_IGHJ4*01 777 gnl|Fabrus|L5_IGKJ1*01 1096
497 gnl|Fabrus|VH1-69_IGHD6-19*01_IGHJ4*01 779 gnl|Fabrus|L5_IGKJ1*01 1096
498 gnl|Fabrus|VH1-69_IGHD7-27*01_IGHJ4*01 781 gnl|Fabrus|L5_IGKJ1*01 1096
499 gnl|Fabrus|VH4-34_IGHD1-7*01_IGHJ4*01 1017 gnl|Fabrus|L5_IGKJ1*01 1096
500 gnl|Fabrus|VH4-34_IGHD2-2*01_IGHJ4*01 1018 gnl|Fabrus|L5_IGKJ1*01 1096
501 gnl|Fabrus|VH4-34_IGHD3-16*01_IGHJ4*01 1019 gnl|Fabrus|L5_IGKJ1*01 1096
502 gnl|Fabrus|VH4-34_IGHD4-17*01_IGHJ4*01 1021 gnl|Fabrus|L5_IGKJ1*01 1096
503 gnl|Fabrus|VH4-34_IGHD5-12*01_IGHJ4*01 1022 gnl|Fabrus|L5_IGKJ1*01 1096
504 gnl|Fabrus|VH4-34_IGHD6-13*01_IGHJ4*01 1023 gnl|Fabrus|L5_IGKJ1*01 1096
505 gnl|Fabrus|VH4-34_IGHD6-25*01_IGHJ6*01 1024 gnl|Fabrus|L5_IGKJ1*01 1096
506 gnl|Fabrus|VH4-34_IGHD7-27*01_IGHJ4*01 1026 gnl|Fabrus|L5_IGKJ1*01 1096
507 gnl|Fabrus|VH2-26_IGHD1-20*01_IGHJ4*01 789 gnl|Fabrus|L5_IGKJ1*01 1096
508 gnl|Fabrus|VH2-26_IGHD2-2*01_IGHJ4*01 791 gnl|Fabrus|L5_IGKJ1*01 1096
509 gnl|Fabrus|VH2-26_IGHD3-10*01_IGHJ4*01 792 gnl|Fabrus|L5_IGKJ1*01 1096
510 gnl|Fabrus|VH2-26_IGHD4-11*01_IGHJ4*01 794 gnl|Fabrus|L5_IGKJ1*01 1096
511 gnl|Fabrus|VH2-26_IGHD5-18*01_IGHJ4*01 796 gnl|Fabrus|L5_IGKJ1*01 1096
512 gnl|Fabrus|VH2-26_IGHD6-13*01_IGHJ4*01 797 gnl|Fabrus|L5_IGKJ1*01 1096
513 gnl|Fabrus|VH2-26_IGHD7-27*01_IGHJ4*01 798 gnl|Fabrus|L5_IGKJ1*01 1096
514 gnl|Fabrus|VH5-51_IGHD1-14*01_IGHJ4*01 1044 gnl|Fabrus|L5_IGKJ1*01 1096
515 gnl|Fabrus|VH5-51_IGHD2-8*01_IGHJ4*01 1046 gnl|Fabrus|L5_IGKJ1*01 1096
516 gnl|Fabrus|VH5-51_IGHD3-3*01_IGHJ4*01 1048 gnl|Fabrus|L5_IGKJ1*01 1096
517 gnl|Fabrus|VH5-51_IGHD4-17*01_IGHJ4*01 1049 gnl|Fabrus|L5_IGKJ1*01 1096
518 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1050 gnl|Fabrus|L5_IGKJ1*01 1096
519 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1051 gnl|Fabrus|L5_IGKJ1*01 1096
520 gnl|Fabrus|VH5-51_IGHD6-25*01_IGHJ4*01 1052 gnl|Fabrus|L5_IGKJ1*01 1096
521 gnl|Fabrus|VH5-51_IGHD7-27*01_IGHJ4*01 1053 gnl|Fabrus|L5_IGKJ1*01 1096
522 gnl|Fabrus|VH6-1_IGHD1-1*01_IGHJ4*01 1054 gnl|Fabrus|L5_IGKJ1*01 1096
523 gnl|Fabrus|VH6-1_IGHD2-15*01_IGHJ4*01 1056 gnl|Fabrus|L5_IGKJ1*01 1096
524 gnl|Fabrus|VH6-1_IGHD3-3*01_IGHJ4*01 1059 gnl|Fabrus|L5_IGKJ1*01 1096
525 gnl|Fabrus|VH6-1_IGHD4-23*01_IGHJ4*01 1061 gnl|Fabrus|L5_IGKJ1*01 1096
526 gnl|Fabrus|VH6-1_IGHD4-11*01_IGHJ6*01 1060 gnl|Fabrus|L5_IGKJ1*01 1096
527 gnl|Fabrus|VH6-1_IGHD5-5*01_IGHJ4*01 1062 gnl|Fabrus|L5_IGKJ1*01 1096
528 gnl|Fabrus|VH6-1_IGHD6-13*01_IGHJ4*01 1063 gnl|Fabrus|L5_IGKJ1*01 1096
529 gnl|Fabrus|VH6-1_IGHD6-25*01_IGHJ6*01 1064 gnl|Fabrus|L5_IGKJ1*01 1096
530 gnl|Fabrus|VH6-1_IGHD7-27*01_IGHJ4*01 1065 gnl|Fabrus|L5_IGKJ1*01 1096
531 gnl|Fabrus|VH4-59_IGHD6-25*01_IGHJ3*01 1043 gnl|Fabrus|L5_IGKJ1*01 1096
532 gnl|Fabrus|VH3-48_IGHD6-6*01_IGHJ1*01 923 gnl|Fabrus|L5_IGKJ1*01 1096
533 gnl|Fabrus|VH3-30_IGHD6-6*01_IGHJ1*01 893 gnl|Fabrus|L5_IGKJ1*01 1096
534 gnl|Fabrus|VH3-66_IGHD6-6*01_IGHJ1*01 949 gnl|Fabrus|L5_IGKJ1*01 1096
535 gnl|Fabrus|VH3-53_IGHD5-5*01_IGHJ4*01 938 gnl|Fabrus|L5_IGKJ1*01 1096
536 gnl|Fabrus|VH2-5_IGHD5-12*01_IGHJ4*01 804 gnl|Fabrus|L5_IGKJ1*01 1096
537 gnl|Fabrus|VH2-70_IGHD5-12*01_IGHJ4*01 811 gnl|Fabrus|L5_IGKJ1*01 1096
538 gnl|Fabrus|VH3-15_IGHD5-12*01_IGHJ4*01 835 gnl|Fabrus|L5_IGKJ1*01 1096
539 gnl|Fabrus|VH3-15_IGHD3-10*01_IGHJ4*01 833 gnl|Fabrus|L5_IGKJ1*01 1096
540 gnl|Fabrus|VH3-49_IGHD5-18*01_IGHJ4*01 930 gnl|Fabrus|L5_IGKJ1*01 1096
541 gnl|Fabrus|VH3-49_IGHD6-13*01_IGHJ4*01 931 gnl|Fabrus|L5_IGKJ1*01 1096
542 gnl|Fabrus|VH3-72_IGHD5-18*01_IGHJ4*01 967 gnl|Fabrus|L5_IGKJ1*01 1096
543 gnl|Fabrus|VH3-72_IGHD6-6*01_IGHJ1*01 969 gnl|Fabrus|L5_IGKJ1*01 1096
544 gnl|Fabrus|VH3-73_IGHD5-12*01_IGHJ4*01 977 gnl|Fabrus|L5_IGKJ1*01 1096
545 gnl|Fabrus|VH3-73_IGHD4-23*01_IGHJ5*01 976 gnl|Fabrus|L5_IGKJ1*01 1096
546 gnl|Fabrus|VH3-43_IGHD3-22*01_IGHJ4*01 918 gnl|Fabrus|L5_IGKJ1*01 1096
547 gnl|Fabrus|VH3-43_IGHD6-13*01_IGHJ4*01 921 gnl|Fabrus|L5_IGKJ1*01 1096
548 gnl|Fabrus|VH3-9_IGHD3-22*01_IGHJ4*01 992 gnl|Fabrus|L5_IGKJ1*01 1096
549 gnl|Fabrus|VH3-9_IGHD1-7*01_IGHJ5*01 989 gnl|Fabrus|L5_IGKJ1*01 1096
550 gnl|Fabrus|VH3-9_IGHD6-13*01_IGHJ4*01 995 gnl|Fabrus|L5_IGKJ1*01 1096
551 gnl|Fabrus|VH4-39_IGHD3-10*01_IGHJ4*01 1030 gnl|Fabrus|L5_IGKJ1*01 1096
552 gnl|Fabrus|VH4-39_IGHD5-12*01_IGHJ4*01 1034 gnl|Fabrus|L5_IGKJ1*01 1096
553 gnl|Fabrus|VH1-18_IGHD6-6*01_IGHJ1*01 728 gnl|Fabrus|L5_IGKJ1*01 1096
554 gnl|Fabrus|VH1-24_IGHD5-12*01_IGHJ4*01 735 gnl|Fabrus|L5_IGKJ1*01 1096
555 gnl|Fabrus|VH1-2_IGHD1-1*01_IGHJ3*01 729 gnl|Fabrus|L5_IGKJ1*01 1096
556 gnl|Fabrus|VH1-3_IGHD6-6*01_IGHJ1*01 743 gnl|Fabrus|L5_IGKJ1*01 1096
557 gnl|Fabrus|VH1-45_IGHD3-10*01_IGHJ4*01 748 gnl|Fabrus|L5_IGKJ1*01 1096
558 gnl|Fabrus|VH1-46_IGHD1-26*01_IGHJ4*01 754 gnl|Fabrus|L5_IGKJ1*01 1096
559 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ6*01 1068 gnl|Fabrus|L5_IGKJ1*01 1096
560 gnl|Fabrus|VH2-70_IGHD3-9*01_IGHJ6*01 810 gnl|Fabrus|L5_IGKJ1*01 1096
561 gnl|Fabrus|VH1-58_IGHD3-10*01_IGHJ6*01 764 gnl|Fabrus|L5_IGKJ1*01 1096
562 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ2*01 1067 gnl|Fabrus|L5_IGKJ1*01 1096
563 gnl|Fabrus|VH4-28_IGHD3-9*01_IGHJ6*01 1002 gnl|Fabrus|L5_IGKJ1*01 1096
564 gnl|Fabrus|VH4-31_IGHD2-15*01_IGHJ2*01 1008 gnl|Fabrus|L5_IGKJ1*01 1096
565 gnl|Fabrus|VH2-5_IGHD3-9*01_IGHJ6*01 803 gnl|Fabrus|L5_IGKJ1*01 1096
566 gnl|Fabrus|VH1-8_IGHD2-15*01_IGHJ6*01 783 gnl|Fabrus|L5_IGKJ1*01 1096
567 gnl|Fabrus|VH2-70_IGHD2-15*01_IGHJ2*01 808 gnl|Fabrus|L5_IGKJ1*01 1096
568 gnl|Fabrus|VH3-38_IGHD3-10*01_IGHJ4*01 907 gnl|Fabrus|L5_IGKJ1*01 1096
569 gnl|Fabrus|VH3-16_IGHD1-7*01_IGHJ6*01 838 gnl|Fabrus|L5_IGKJ1*01 1096
570 gnl|Fabrus|VH3-73_IGHD3-9*01_IGHJ6*01 974 gnl|Fabrus|L5_IGKJ1*01 1096
571 gnl|Fabrus|VH3-11_IGHD3-9*01_IGHJ6*01 816 gnl|Fabrus|L5_IGKJ1*01 1096
572 gnl|Fabrus|VH3-11_IGHD6-6*01_IGHJ1*01 820 gnl|Fabrus|L5_IGKJ1*01 1096
573 gnl|Fabrus|VH3-20_IGHD5-12*01_IGHJ4*01 852 gnl|Fabrus|L5_IGKJ1*01 1096
574 gnl|Fabrus|VH3-16_IGHD2-15*01_IGHJ2*01 839 gnl|Fabrus|L5_IGKJ1*01 1096
575 gnl|Fabrus|VH3-7_IGHD6-6*01_IGHJ1*01 960 gnl|Fabrus|L5_IGKJ1*01 1096
576 gnl|Fabrus|VH3-16_IGHD6-13*01_IGHJ4*01 844 gnl|Fabrus|L5_IGKJ1*01 1096
577 gnl|Fabrus|VH3-23_IGHD1-1*01_IGHJ4*01 863 gnl|Fabrus|L8_IGKJ1*01 1098
578 gnl|Fabrus|VH3-23_IGHD2-15*01_IGHJ4*01 866 gnl|Fabrus|L8_IGKJ1*01 1098
579 gnl|Fabrus|VH3-23_IGHD3-22*01_IGHJ4*01 870 gnl|Fabrus|L8_IGKJ1*01 1098
580 gnl|Fabrus|VH3-23_IGHD4-11*01_IGHJ4*01 872 gnl|Fabrus|L8_IGKJ1*01 1098
581 gnl|Fabrus|VH3-23_IGHD5-12*01_IGHJ4*01 874 gnl|Fabrus|L8_IGKJ1*01 1098
582 gnl|Fabrus|VH3-23_IGHD5-5*01_IGHJ4*01 876 gnl|Fabrus|L8_IGKJ1*01 1098
583 gnl|Fabrus|VH3-23_IGHD6-13*01_IGHJ4*01 877 gnl|Fabrus|L8_IGKJ1*01 1098
584 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ4*01 880 gnl|Fabrus|L8_IGKJ1*01 1098
585 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ6*01 881 gnl|Fabrus|L8_IGKJ1*01 1098
586 gnl|Fabrus|VH1-69_IGHD1-14*01_IGHJ4*01 770 gnl|Fabrus|L8_IGKJ1*01 1098
587 gnl|Fabrus|VH1-69_IGHD2-2*01_IGHJ4*01 771 gnl|Fabrus|L8_IGKJ1*01 1098
588 gnl|Fabrus|VH1-69_IGHD2-8*01_IGHJ6*01 772 gnl|Fabrus|L8_IGKJ1*01 1098
589 gnl|Fabrus|VH1-69_IGHD3-16*01_IGHJ4*01 773 gnl|Fabrus|L8_IGKJ1*01 1098
590 gnl|Fabrus|VH1-69_IGHD3-3*01_IGHJ4*01 774 gnl|Fabrus|L8_IGKJ1*01 1098
591 gnl|Fabrus|VH1-69_IGHD4-17*01_IGHJ4*01 776 gnl|Fabrus|L8_IGKJ1*01 1098
592 gnl|Fabrus|VH1-69_IGHD5-12*01_IGHJ4*01 777 gnl|Fabrus|L8_IGKJ1*01 1098
593 gnl|Fabrus|VH1-69_IGHD6-19*01_IGHJ4*01 779 gnl|Fabrus|L8_IGKJ1*01 1098
594 gnl|Fabrus|VH1-69_IGHD7-27*01_IGHJ4*01 781 gnl|Fabrus|L8_IGKJ1*01 1098
595 gnl|Fabrus|VH4-34_IGHD1-7*01_IGHJ4*01 1017 gnl|Fabrus|L8_IGKJ1*01 1098
596 gnl|Fabrus|VH4-34_IGHD2-2*01_IGHJ4*01 1018 gnl|Fabrus|L8_IGKJ1*01 1098
597 gnl|Fabrus|VH4-34_IGHD3-16*01_IGHJ4*01 1019 gnl|Fabrus|L8_IGKJ1*01 1098
598 gnl|Fabrus|VH4-34_IGHD4-17*01_IGHJ4*01 1021 gnl|Fabrus|L8_IGKJ1*01 1098
599 gnl|Fabrus|VH4-34_IGHD5-12*01_IGHJ4*01 1022 gnl|Fabrus|L8_IGKJ1*01 1098
600 gnl|Fabrus|VH4-34_IGHD6-13*01_IGHJ4*01 1023 gnl|Fabrus|L8_IGKJ1*01 1098
601 gnl|Fabrus|VH4-34_IGHD6-25*01_IGHJ6*01 1024 gnl|Fabrus|L8_IGKJ1*01 1098
602 gnl|Fabrus|VH4-34_IGHD7-27*01_IGHJ4*01 1026 gnl|Fabrus|L8_IGKJ1*01 1098
603 gnl|Fabrus|VH2-26_IGHD1-20*01_IGHJ4*01 789 gnl|Fabrus|L8_IGKJ1*01 1098
604 gnl|Fabrus|VH2-26_IGHD2-2*01_IGHJ4*01 791 gnl|Fabrus|L8_IGKJ1*01 1098
605 gnl|Fabrus|VH2-26_IGHD3-10*01_IGHJ4*01 792 gnl|Fabrus|L8_IGKJ1*01 1098
606 gnl|Fabrus|VH2-26_IGHD4-11*01_IGHJ4*01 794 gnl|Fabrus|L8_IGKJ1*01 1098
607 gnl|Fabrus|VH2-26_IGHD5-18*01_IGHJ4*01 796 gnl|Fabrus|L8_IGKJ1*01 1098
608 gnl|Fabrus|VH2-26_IGHD6-13*01_IGHJ4*01 797 gnl|Fabrus|L8_IGKJ1*01 1098
609 gnl|Fabrus|VH2-26_IGHD7-27*01_IGHJ4*01 798 gnl|Fabrus|L8_IGKJ1*01 1098
610 gnl|Fabrus|VH5-51_IGHD1-14*01_IGHJ4*01 1044 gnl|Fabrus|L8_IGKJ1*01 1098
611 gnl|Fabrus|VH5-51_IGHD2-8*01_IGHJ4*01 1046 gnl|Fabrus|L8_IGKJ1*01 1098
612 gnl|Fabrus|VH5-51_IGHD3-3*01_IGHJ4*01 1048 gnl|Fabrus|L8_IGKJ1*01 1098
613 gnl|Fabrus|VH5-51_IGHD4-17*01_IGHJ4*01 1049 gnl|Fabrus|L8_IGKJ1*01 1098
614 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1050 gnl|Fabrus|L8_IGKJ1*01 1098
615 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1051 gnl|Fabrus|L8_IGKJ1*01 1098
616 gnl|Fabrus|VH5-51_IGHD6-25*01_IGHJ4*01 1052 gnl|Fabrus|L8_IGKJ1*01 1098
617 gnl|Fabrus|VH5-51_IGHD7-27*01_IGHJ4*01 1053 gnl|Fabrus|L8_IGKJ1*01 1098
618 gnl|Fabrus|VH6-1_IGHD1-1*01_IGHJ4*01 1054 gnl|Fabrus|L8_IGKJ1*01 1098
619 gnl|Fabrus|VH6-1_IGHD2-15*01_IGHJ4*01 1056 gnl|Fabrus|L8_IGKJ1*01 1098
620 gnl|Fabrus|VH6-1_IGHD3-3*01_IGHJ4*01 1059 gnl|Fabrus|L8_IGKJ1*01 1098
621 gnl|Fabrus|VH6-1_IGHD4-23*01_IGHJ4*01 1061 gnl|Fabrus|L8_IGKJ1*01 1098
622 gnl|Fabrus|VH6-1_IGHD4-11*01_IGHJ6*01 1060 gnl|Fabrus|L8_IGKJ1*01 1098
623 gnl|Fabrus|VH6-1_IGHD5-5*01_IGHJ4*01 1062 gnl|Fabrus|L8_IGKJ1*01 1098
624 gnl|Fabrus|VH6-1_IGHD6-13*01_IGHJ4*01 1063 gnl|Fabrus|L8_IGKJ1*01 1098
625 gnl|Fabrus|VH6-1_IGHD6-25*01_IGHJ6*01 1064 gnl|Fabrus|L8_IGKJ1*01 1098
626 gnl|Fabrus|VH6-1_IGHD7-27*01_IGHJ4*01 1065 gnl|Fabrus|L8_IGKJ1*01 1098
627 gnl|Fabrus|VH4-59_IGHD6-25*01_IGHJ3*01 1043 gnl|Fabrus|L8_IGKJ1*01 1098
628 gnl|Fabrus|VH3-48_IGHD6-6*01_IGHJ1*01 923 gnl|Fabrus|L8_IGKJ1*01 1098
629 gnl|Fabrus|VH3-30_IGHD6-6*01_IGHJ1*01 893 gnl|Fabrus|L8_IGKJ1*01 1098
630 gnl|Fabrus|VH3-66_IGHD6-6*01_IGHJ1*01 949 gnl|Fabrus|L8_IGKJ1*01 1098
631 gnl|Fabrus|VH3-53_IGHD5-5*01_IGHJ4*01 938 gnl|Fabrus|L8_IGKJ1*01 1098
632 gnl|Fabrus|VH2-5_IGHD5-12*01_IGHJ4*01 804 gnl|Fabrus|L8_IGKJ1*01 1098
633 gnl|Fabrus|VH2-70_IGHD5-12*01_IGHJ4*01 811 gnl|Fabrus|L8_IGKJ1*01 1098
634 gnl|Fabrus|VH3-15_IGHD5-12*01_IGHJ4*01 835 gnl|Fabrus|L8_IGKJ1*01 1098
635 gnl|Fabrus|VH3-15_IGHD3-10*01_IGHJ4*01 833 gnl|Fabrus|L8_IGKJ1*01 1098
636 gnl|Fabrus|VH3-49_IGHD5-18*01_IGHJ4*01 930 gnl|Fabrus|L8_IGKJ1*01 1098
637 gnl|Fabrus|VH3-49_IGHD6-13*01_IGHJ4*01 931 gnl|Fabrus|L8_IGKJ1*01 1098
638 gnl|Fabrus|VH3-72_IGHD5-18*01_IGHJ4*01 967 gnl|Fabrus|L8_IGKJ1*01 1098
639 gnl|Fabrus|VH3-72_IGHD6-6*01_IGHJ1*01 969 gnl|Fabrus|L8_IGKJ1*01 1098
640 gnl|Fabrus|VH3-73_IGHD5-12*01_IGHJ4*01 977 gnl|Fabrus|L8_IGKJ1*01 1098
641 gnl|Fabrus|VH3-73_IGHD4-23*01_IGHJ5*01 976 gnl|Fabrus|L8_IGKJ1*01 1098
642 gnl|Fabrus|VH3-43_IGHD3-22*01_IGHJ4*01 918 gnl|Fabrus|L8_IGKJ1*01 1098
643 gnl|Fabrus|VH3-43_IGHD6-13*01_IGHJ4*01 921 gnl|Fabrus|L8_IGKJ1*01 1098
644 gnl|Fabrus|VH3-9_IGHD3-22*01_IGHJ4*01 992 gnl|Fabrus|L8_IGKJ1*01 1098
645 gnl|Fabrus|VH3-9_IGHD1-7*01_IGHJ5*01 989 gnl|Fabrus|L8_IGKJ1*01 1098
646 gnl|Fabrus|VH3-9_IGHD6-13*01_IGHJ4*01 995 gnl|Fabrus|L8_IGKJ1*01 1098
647 gnl|Fabrus|VH4-39_IGHD3-10*01_IGHJ4*01 1030 gnl|Fabrus|L8_IGKJ1*01 1098
648 gnl|Fabrus|VH4-39_IGHD5-12*01_IGHJ4*01 1034 gnl|Fabrus|L8_IGKJ1*01 1098
649 gnl|Fabrus|VH1-18_IGHD6-6*01_IGHJ1*01 728 gnl|Fabrus|L8_IGKJ1*01 1098
650 gnl|Fabrus|VH1-24_IGHD5-12*01_IGHJ4*01 735 gnl|Fabrus|L8_IGKJ1*01 1098
651 gnl|Fabrus|VH1-2_IGHD1-1*01_IGHJ3*01 729 gnl|Fabrus|L8_IGKJ1*01 1098
652 gnl|Fabrus|VH1-3_IGHD6-6*01_IGHJ1*01 743 gnl|Fabrus|L8_IGKJ1*01 1098
653 gnl|Fabrus|VH1-45_IGHD3-10*01_IGHJ4*01 748 gnl|Fabrus|L8_IGKJ1*01 1098
654 gnl|Fabrus|VH1-46_IGHD1-26*01_IGHJ4*01 754 gnl|Fabrus|L8_IGKJ1*01 1098
655 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ6*01 1068 gnl|Fabrus|L8_IGKJ1*01 1098
656 gnl|Fabrus|VH2-70_IGHD3-9*01_IGHJ6*01 810 gnl|Fabrus|L8_IGKJ1*01 1098
657 gnl|Fabrus|VH1-58_IGHD3-10*01_IGHJ6*01 764 gnl|Fabrus|L8_IGKJ1*01 1098
658 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ2*01 1067 gnl|Fabrus|L8_IGKJ1*01 1098
659 gnl|Fabrus|VH4-28_IGHD3-9*01_IGHJ6*01 1002 gnl|Fabrus|L8_IGKJ1*01 1098
660 gnl|Fabrus|VH4-31_IGHD2-15*01_IGHJ2*01 1008 gnl|Fabrus|L8_IGKJ1*01 1098
661 gnl|Fabrus|VH2-5_IGHD3-9*01_IGHJ6*01 803 gnl|Fabrus|L8_IGKJ1*01 1098
662 gnl|Fabrus|VH1-8_IGHD2-15*01_IGHJ6*01 783 gnl|Fabrus|L8_IGKJ1*01 1098
663 gnl|Fabrus|VH2-70_IGHD2-15*01_IGHJ2*01 808 gnl|Fabrus|L8_IGKJ1*01 1098
664 gnl|Fabrus|VH3-38_IGHD3-10*01_IGHJ4*01 907 gnl|Fabrus|L8_IGKJ1*01 1098
665 gnl|Fabrus|VH3-16_IGHD1-7*01_IGHJ6*01 838 gnl|Fabrus|L8_IGKJ1*01 1098
666 gnl|Fabrus|VH3-73_IGHD3-9*01_IGHJ6*01 974 gnl|Fabrus|L8_IGKJ1*01 1098
667 gnl|Fabrus|VH3-11_IGHD3-9*01_IGHJ6*01 816 gnl|Fabrus|L8_IGKJ1*01 1098
668 gnl|Fabrus|VH3-11_IGHD6-6*01_IGHJ1*01 820 gnl|Fabrus|L8_IGKJ1*01 1098
669 gnl|Fabrus|VH3-20_IGHD5-12*01_IGHJ4*01 852 gnl|Fabrus|L8_IGKJ1*01 1098
670 gnl|Fabrus|VH3-16_IGHD2-15*01_IGHJ2*01 839 gnl|Fabrus|L8_IGKJ1*01 1098
671 gnl|Fabrus|VH3-7_IGHD6-6*01_IGHJ1*01 960 gnl|Fabrus|L8_IGKJ1*01 1098
672 gnl|Fabrus|VH3-16_IGHD6-13*01_IGHJ4*01 844 gnl|Fabrus|L8_IGKJ1*01 1098
673 gnl|Fabrus|VH3-23_IGHD1-1*01_IGHJ4*01 863 gnl|Fabrus|L11_IGKJ1*01 1087
674 gnl|Fabrus|VH3-23_IGHD2-15*01_IGHJ4*01 866 gnl|Fabrus|L11_IGKJ1*01 1087
675 gnl|Fabrus|VH3-23_IGHD3-22*01_IGHJ4*01 870 gnl|Fabrus|L11_IGKJ1*01 1087
676 gnl|Fabrus|VH3-23_IGHD4-11*01_IGHJ4*01 872 gnl|Fabrus|L11_IGKJ1*01 1087
677 gnl|Fabrus|VH3-23_IGHD5-12*01_IGHJ4*01 874 gnl|Fabrus|L11_IGKJ1*01 1087
678 gnl|Fabrus|VH3-23_IGHD5-5*01_IGHJ4*01 876 gnl|Fabrus|L11_IGKJ1*01 1087
679 gnl|Fabrus|VH3-23_IGHD6-13*01_IGHJ4*01 877 gnl|Fabrus|L11_IGKJ1*01 1087
680 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ4*01 880 gnl|Fabrus|L11_IGKJ1*01 1087
681 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ6*01 881 gnl|Fabrus|L11_IGKJ1*01 1087
682 gnl|Fabrus|VH1-69_IGHD1-14*01_IGHJ4*01 770 gnl|Fabrus|L11_IGKJ1*01 1087
683 gnl|Fabrus|VH1-69_IGHD2-2*01_IGHJ4*01 771 gnl|Fabrus|L11_IGKJ1*01 1087
684 gnl|Fabrus|VH1-69_IGHD2-8*01_IGHJ6*01 772 gnl|Fabrus|L11_IGKJ1*01 1087
685 gnl|Fabrus|VH1-69_IGHD3-16*01_IGHJ4*01 773 gnl|Fabrus|L11_IGKJ1*01 1087
686 gnl|Fabrus|VH1-69_IGHD3-3*01_IGHJ4*01 774 gnl|Fabrus|L11_IGKJ1*01 1087
687 gnl|Fabrus|VH1-69_IGHD4-17*01_IGHJ4*01 776 gnl|Fabrus|L11_IGKJ1*01 1087
688 gnl|Fabrus|VH1-69_IGHD5-12*01_IGHJ4*01 777 gnl|Fabrus|L11_IGKJ1*01 1087
689 gnl|Fabrus|VH1-69_IGHD6-19*01_IGHJ4*01 779 gnl|Fabrus|L11_IGKJ1*01 1087
690 gnl|Fabrus|VH1-69_IGHD7-27*01_IGHJ4*01 781 gnl|Fabrus|L11_IGKJ1*01 1087
691 gnl|Fabrus|VH4-34_IGHD1-7*01_IGHJ4*01 1017 gnl|Fabrus|L11_IGKJ1*01 1087
692 gnl|Fabrus|VH4-34_IGHD2-2*01_IGHJ4*01 1018 gnl|Fabrus|L11_IGKJ1*01 1087
693 gnl|Fabrus|VH4-34_IGHD3-16*01_IGHJ4*01 1019 gnl|Fabrus|L11_IGKJ1*01 1087
694 gnl|Fabrus|VH4-34_IGHD4-17*01_IGHJ4*01 1021 gnl|Fabrus|L11_IGKJ1*01 1087
695 gnl|Fabrus|VH4-34_IGHD5-12*01_IGHJ4*01 1022 gnl|Fabrus|L11_IGKJ1*01 1087
696 gnl|Fabrus|VH4-34_IGHD6-13*01_IGHJ4*01 1023 gnl|Fabrus|L11_IGKJ1*01 1087
697 gnl|Fabrus|VH4-34_IGHD6-25*01_IGHJ6*01 1024 gnl|Fabrus|L11_IGKJ1*01 1087
698 gnl|Fabrus|VH4-34_IGHD7-27*01_IGHJ4*01 1026 gnl|Fabrus|L11_IGKJ1*01 1087
699 gnl|Fabrus|VH2-26_IGHD1-20*01_IGHJ4*01 789 gnl|Fabrus|L11_IGKJ1*01 1087
700 gnl|Fabrus|VH2-26_IGHD2-2*01_IGHJ4*01 791 gnl|Fabrus|L11_IGKJ1*01 1087
701 gnl|Fabrus|VH2-26_IGHD3-10*01_IGHJ4*01 792 gnl|Fabrus|L11_IGKJ1*01 1087
702 gnl|Fabrus|VH2-26_IGHD4-11*01_IGHJ4*01 794 gnl|Fabrus|L11_IGKJ1*01 1087
703 gnl|Fabrus|VH2-26_IGHD5-18*01_IGHJ4*01 796 gnl|Fabrus|L11_IGKJ1*01 1087
704 gnl|Fabrus|VH2-26_IGHD6-13*01_IGHJ4*01 797 gnl|Fabrus|L11_IGKJ1*01 1087
705 gnl|Fabrus|VH2-26_IGHD7-27*01_IGHJ4*01 798 gnl|Fabrus|L11_IGKJ1*01 1087
706 gnl|Fabrus|VH5-51_IGHD1-14*01_IGHJ4*01 1044 gnl|Fabrus|L11_IGKJ1*01 1087
707 gnl|Fabrus|VH5-51_IGHD2-8*01_IGHJ4*01 1046 gnl|Fabrus|L11_IGKJ1*01 1087
708 gnl|Fabrus|VH5-51_IGHD3-3*01_IGHJ4*01 1048 gnl|Fabrus|L11_IGKJ1*01 1087
709 gnl|Fabrus|HV5-51_IGHD4-17*01_IGHJ4*01 1049 gnl|Fabrus|L11_IGKJ1*01 1087
710 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1050 gnl|Fabrus|L11_IGKJ1*01 1087
711 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1051 gnl|Fabrus|L11_IGKJ1*01 1087
712 gnl|Fabrus|VH5-51_IGHD6-25*01_IGHJ4*01 1052 gnl|Fabrus|L11_IGKJ1*01 1087
713 gnl|Fabrus|VH5-51_IGHD7-27*01_IGHJ4*01 1053 gnl|Fabrus|L11_IGKJ1*01 1087
714 gnl|Fabrus|VH6-1_IGHD1-1*01_IGHJ4*01 1054 gnl|Fabrus|L11_IGKJ1*01 1087
715 gnl|Fabrus|VH6-1_IGHD2-15*01_IGHJ4*01 1056 gnl|Fabrus|L11_IGKJ1*01 1087
716 gnl|Fabrus|VH6-1_IGHD3-3*01_IGHJ4*01 1059 gnl|Fabrus|L11_IGKJ1*01 1087
717 gnl|Fabrus|VH6-1_IGHD4-23*01_IGHJ4*01 1061 gnl|Fabrus|L11_IGKJ1*01 1087
718 gnl|Fabrus|VH6-1_IGHD4-11*01_IGHJ6*01 1060 gnl|Fabrus|L11_IGKJ1*01 1087
719 gnl|Fabrus|VH6-1_IGHD5-5*01_IGHJ4*01 1062 gnl|Fabrus|L11_IGKJ1*01 1087
720 gnl|Fabrus|VH6-1_IGHD6-13*01_IGHJ4*01 1063 gnl|Fabrus|L11_IGKJ1*01 1087
721 gnl|Fabrus|VH6-1_IGHD6-25*01_IGHJ6*01 1064 gnl|Fabrus|L11_IGKJ1*01 1087
722 gnl|Fabrus|VH6-1_IGHD7-27*01_IGHJ4*01 1065 gnl|Fabrus|L11_IGKJ1*01 1087
723 gnl|Fabrus|VH4-59_IGHD6-25*01_IGHJ3*01 1043 gnl|Fabrus|L11_IGKJ1*01 1087
724 gnl|Fabrus|VH3-48_IGHD6-6*01_IGHJ1*01 923 gnl|Fabrus|L11_IGKJ1*01 1087
725 gnl|Fabrus|VH3-30_IGHD6-6*01_IGHJ1*01 893 gnl|Fabrus|L11_IGKJ1*01 1087
726 gnl|Fabrus|VH3-66_IGHD6-6*01_IGHJ1*01 949 gnl|Fabrus|L11_IGKJ1*01 1087
727 gnl|Fabrus|VH3-53_IGHD5-5*01_IGHJ4*01 938 gnl|Fabrus|L11_IGKJ1*01 1087
728 gnl|Fabrus|VH2-5_IGHD5-12*01_IGHJ4*01 804 gnl|Fabrus|L11_IGKJ1*01 1087
729 gnl|Fabrus|VH2-70_IGHD5-12*01_IGHJ4*01 811 gnl|Fabrus|L11_IGKJ1*01 1087
730 gnl|Fabrus|VH3-15_IGHD5-12*01_IGHJ4*01 835 gnl|Fabrus|L11_IGKJ1*01 1087
731 gnl|Fabrus|VH3-15_IGHD3-10*01_IGHJ4*01 833 gnl|Fabrus|L11_IGKJ1*01 1087
732 gnl|Fabrus|VH3-49_IGHD5-18*01_IGHJ4*01 930 gnl|Fabrus|L11_IGKJ1*01 1087
733 gnl|Fabrus|VH3-49_IGHD6-13*01_IGHJ4*01 931 gnl|Fabrus|L11_IGKJ1*01 1087
734 gnl|Fabrus|VH3-72_IGHD5-18*01_IGHJ4*01 967 gnl|Fabrus|L11_IGKJ1*01 1087
735 gnl|Fabrus|VH3-72_IGHD6-6*01_IGHJ1*01 969 gnl|Fabrus|L11_IGKJ1*01 1087
736 gnl|Fabrus|VH3-73_IGHD5-12*01_IGHJ4*01 977 gnl|Fabrus|L11_IGKJ1*01 1087
737 gnl|Fabrus|VH3-73_IGHD4-23*01_IGHJ5*01 976 gnl|Fabrus|L11_IGKJ1*01 1087
738 gnl|Fabrus|VH3-43_IGHD3-22*01_IGHJ4*01 918 gnl|Fabrus|L11_IGKJ1*01 1087
739 gnl|Fabrus|VH3-43_IGHD6-13*01_IGHJ4*01 921 gnl|Fabrus|L11_IGKJ1*01 1087
740 gnl|Fabrus|VH3-9_IGHD3-22*01_IGHJ4*01 992 gnl|Fabrus|L11_IGKJ1*01 1087
741 gnl|Fabrus|VH3-9_IGHD1-7*01_IGHJ5*01 989 gnl|Fabrus|L11_IGKJ1*01 1087
742 gnl|Fabrus|VH3-9_IGHD6-13*01_IGHJ4*01 995 gnl|Fabrus|L11_IGKJ1*01 1087
743 gnl|Fabrus|VH4-39_IGHD3-10*01_IGHJ4*01 1030 gnl|Fabrus|L11_IGKJ1*01 1087
744 gnl|Fabrus|VH4-39_IGHD5-12*01_IGHJ4*01 1034 gnl|Fabrus|L11_IGKJ1*01 1087
745 gnl|Fabrus|VH1-18_IGHD6-6*01_IGHJ1*01 728 gnl|Fabrus|L11_IGKJ1*01 1087
746 gnl|Fabrus|VH1-24_IGHD5-12*01_IGHJ4*01 735 gnl|Fabrus|L11_IGKJ1*01 1087
747 gnl|Fabrus|VH1-2_IGHD1-1*01_IGHJ3*01 729 gnl|Fabrus|L11_IGKJ1*01 1087
748 gnl|Fabrus|VH1-3_IGHD6-6*01_IGHJ1*01 743 gnl|Fabrus|L11_IGKJ1*01 1087
749 gnl|Fabrus|VH1-45_IGHD3-10*01_IGHJ4*01 748 gnl|Fabrus|L11_IGKJ1*01 1087
750 gnl|Fabrus|VH1-46_IGHD1-26*01_IGHJ4*01 754 gnl|Fabrus|L11_IGKJ1*01 1087
751 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ6*01 1068 gnl|Fabrus|L11_IGKJ1*01 1087
752 gnl|Fabrus|VH2-70_IGHD3-9*01_IGHJ6*01 810 gnl|Fabrus|L11_IGKJ1*01 1087
753 gnl|Fabrus|VH1-58_IGHD3-10*01_IGHJ6*01 764 gnl|Fabrus|L11_IGKJ1*01 1087
754 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ2*01 1067 gnl|Fabrus|L11_IGKJ1*01 1087
755 gnl|Fabrus|VH4-28_IGHD3-9*01_IGHJ6*01 1002 gnl|Fabrus|L11_IGKJ1*01 1087
756 gnl|Fabrus|VH4-31_IGHD2-15*01_IGHJ2*01 1008 gnl|Fabrus|L11_IGKJ1*01 1087
757 gnl|Fabrus|VH2-5_IGHD3-9*01_IGHJ6*01 803 gnl|Fabrus|L11_IGKJ1*01 1087
758 gnl|Fabrus|VH1-8_IGHD2-15*01_IGHJ6*01 783 gnl|Fabrus|L11_IGKJ1*01 1087
759 gnl|Fabrus|VH2-70_IGHD2-15*01_IGHJ2*01 808 gnl|Fabrus|L11_IGKJ1*01 1087
760 gnl|Fabrus|VH3-38_IGHD3-10*01_IGHJ4*01 907 gnl|Fabrus|L11_IGKJ1*01 1087
761 gnl|Fabrus|VH3-16_IGHD1-7*01_IGHJ6*01 838 gnl|Fabrus|L11_IGKJ1*01 1087
762 gnl|Fabrus|VH3-73_IGHD3-9*01_IGHJ6*01 974 gnl|Fabrus|L11_IGKJ1*01 1087
763 gnl|Fabrus|VH3-11_IGHD3-9*01_IGHJ6*01 816 gnl|Fabrus|L11_IGKJ1*01 1087
764 gnl|Fabrus|VH3-11_IGHD6-6*01_IGHJ1*01 820 gnl|Fabrus|L11_IGKJ1*01 1087
765 gnl|Fabrus|VH3-20_IGHD5-12*01_IGHJ4*01 852 gnl|Fabrus|L11_IGKJ1*01 1087
766 gnl|Fabrus|VH3-16_IGHD2-15*01_IGHJ2*01 839 gnl|Fabrus|L11_IGKJ1*01 1087
767 gnl|Fabrus|VH3-7_IGHD6-6*01_IGHJ1*01 960 gnl|Fabrus|L11_IGKJ1*01 1087
768 gnl|Fabrus|VH3-16_IGHD6-13*01_IGHJ4*01 844 gnl|Fabrus|L11_IGKJ1*01 1087
769 gnl|Fabrus|VH3-23_IGHD1-1*01_IGHJ4*01 863 gnl|Fabrus|L12_IGKJ1*01 1088
770 gnl|Fabrus|VH3-23_IGHD2-15*01_IGHJ4*01 866 gnl|Fabrus|L12_IGKJ1*01 1088
771 gnl|Fabrus|VH3-23_IGHD3-22*01_IGHJ4*01 870 gnl|Fabrus|L12_IGKJ1*01 1088
772 gnl|Fabrus|VH3-23_IGHD4-11*01_IGHJ4*01 872 gnl|Fabrus|L12_IGKJ1*01 1088
773 gnl|Fabrus|VH3-23_IGHD5-12*01_IGHJ4*01 874 gnl|Fabrus|L12_IGKJ1*01 1088
774 gnl|Fabrus|VH3-23_IGHD5-5*01_IGHJ4*01 876 gnl|Fabrus|L12_IGKJ1*01 1088
775 gnl|Fabrus|VH3-23_IGHD6-13*01_IGHJ4*01 877 gnl|Fabrus|L12_IGKJ1*01 1088
776 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ4*01 880 gnl|Fabrus|L12_IGKJ1*01 1088
777 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ6*01 881 gnl|Fabrus|L12_IGKJ1*01 1088
778 gnl|Fabrus|VH1-69_IGHD1-14*01_IGHJ4*01 770 gnl|Fabrus|L12_IGKJ1*01 1088
779 gnl|Fabrus|VH1-69_IGHD2-2*01_IGHJ4*01 771 gnl|Fabrus|L12_IGKJ1*01 1088
780 gnl|Fabrus|VH1-69_IGHD2-8*01_IGHJ6*01 772 gnl|Fabrus|L12_IGKJ1*01 1088
781 gnl|Fabrus|VH1-69_IGHD3-16*01_IGHJ4*01 773 gnl|Fabrus|L12_IGKJ1*01 1088
782 gnl|Fabrus|VH1-69_IGHD3-3*01_IGHJ4*01 774 gnl|Fabrus|L12_IGKJ1*01 1088
783 gnl|Fabrus|VH1-69_IGHD4-17*01_IGHJ4*01 776 gnl|Fabrus|L12_IGKJ1*01 1088
784 gnl|Fabrus|VH1-69_IGHD5-12*01_IGHJ4*01 777 gnl|Fabrus|L12_IGKJ1*01 1088
785 gnl|Fabrus|VH1-69_IGHD6-19*01_IGHJ4*01 779 gnl|Fabrus|L12_IGKJ1*01 1088
786 gnl|Fabrus|VH1-69_IGHD7-27*01_IGHJ4*01 781 gnl|Fabrus|L12_IGKJ1*01 1088
787 gnl|Fabrus|VH4-34_IGHD1-7*01_IGHJ4*01 1017 gnl|Fabrus|L12_IGKJ1*01 1088
788 gnl|Fabrus|VH4-34_IGHD2-2*01_IGHJ4*01 1018 gnl|Fabrus|L12_IGKJ1*01 1088
789 gnl|Fabrus|VH4-34_IGHD3-16*01_IGHJ4*01 1019 gnl|Fabrus|L12_IGKJ1*01 1088
790 gnl|Fabrus|VH4-34_IGHD4-17*01_IGHJ4*01 1021 gnl|Fabrus|L12_IGKJ1*01 1088
791 gnl|Fabrus|VH4-34_IGHD5-12*01_IGHJ4*01 1022 gnl|Fabrus|L12_IGKJ1*01 1088
792 gnl|Fabrus|VH4-34_IGHD6-13*01_IGHJ4*01 1023 gnl|Fabrus|L12_IGKJ1*01 1088
793 gnl|Fabrus|VH4-34_IGHD6-25*01_IGHJ6*01 1024 gnl|Fabrus|L12_IGKJ1*01 1088
794 gnl|Fabrus|VH4-34_IGHD7-27*01_IGHJ4*01 1026 gnl|Fabrus|L12_IGKJ1*01 1088
795 gnl|Fabrus|VH2-26_IGHD1-20*01_IGHJ4*01 789 gnl|Fabrus|L12_IGKJ1*01 1088
796 gnl|Fabrus|VH2-26_IGHD2-2*01_IGHJ4*01 791 gnl|Fabrus|L12_IGKJ1*01 1088
797 gnl|Fabrus|VH2-26_IGHD3-10*01_IGHJ4*01 792 gnl|Fabrus|L12_IGKJ1*01 1088
798 gnl|Fabrus|VH2-26_IGHD4-11*01_IGHJ4*01 794 gnl|Fabrus|L12_IGKJ1*01 1088
799 gnl|Fabrus|VH2-26_IGHD5-18*01_IGHJ4*01 796 gnl|Fabrus|L12_IGKJ1*01 1088
800 gnl|Fabrus|VH2-26_IGHD6-13*01_IGHJ4*01 797 gnl|Fabrus|L12_IGKJ1*01 1088
801 gnl|Fabrus|VH2-26_IGHD7-27*01_IGHJ4*01 798 gnl|Fabrus|L12_IGKJ1*01 1088
802 gnl|Fabrus|VH5-51_IGHD1-14*01_IGHJ4*01 1044 gnl|Fabrus|L12_IGKJ1*01 1088
803 gnl|Fabrus|VH5-51_IGHD2-8*01_IGHJ4*01 1046 gnl|Fabrus|L12_IGKJ1*01 1088
804 gnl|Fabrus|VH5-51_IGHD3-3*01_IGHJ4*01 1048 gnl|Fabrus|L12_IGKJ1*01 1088
805 gnl|Fabrus|VH5-51_IGHD4-17*01_IGHJ4*01 1049 gnl|Fabrus|L12_IGKJ1*01 1088
806 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1050 gnl|Fabrus|L12_IGKJ1*01 1088
807 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1051 gnl|Fabrus|L12_IGKJ1*01 1088
808 gnl|Fabrus|VH5-51_IGHD6-25*01_IGHJ4*01 1052 gnl|Fabrus|L12_IGKJ1*01 1088
809 gnl|Fabrus|VH5-51_IGHD7-27*01_IGHJ4*01 1053 gnl|Fabrus|L12_IGKJ1*01 1088
810 gnl|Fabrus|VH6-1_IGHD1-1*01_IGHJ4*01 1054 gnl|Fabrus|L12_IGKJ1*01 1088
811 gnl|Fabrus|VH6-1_IGHD2-15*01_IGHJ4*01 1056 gnl|Fabrus|L12_IGKJ1*01 1088
812 gnl|Fabrus|VH6-1_IGHD3-3*01_IGHJ4*01 1059 gnl|Fabrus|L12_IGKJ1*01 1088
813 gnl|Fabrus|VH6-1_IGHD4-23*01_IGHJ4*01 1061 gnl|Fabrus|L12_IGKJ1*01 1088
814 gnl|Fabrus|VH6-1_IGHD4-11*01_IGHJ6*01 1060 gnl|Fabrus|L12_IGKJ1*01 1088
815 gnl|Fabrus|VH6-1_IGHD5-5*01_IGHJ4*01 1062 gnl|Fabrus|L12_IGKJ1*01 1088
816 gnl|Fabrus|VH6-1_IGHD6-13*01_IGHJ4*01 1063 gnl|Fabrus|L12_IGKJ1*01 1088
817 gnl|Fabrus|VH6-1_IGHD6-25*01_IGHJ6*01 1064 gnl|Fabrus|L12_IGKJ1*01 1088
818 gnl|Fabrus|VH6-1_IGHD7-27*01_IGHJ4*01 1065 gnl|Fabrus|L12_IGKJ1*01 1088
819 gnl|Fabrus|VH4-59_IGHD6-25*01_IGHJ3*01 1043 gnl|Fabrus|L12_IGKJ1*01 1088
820 gnl|Fabrus|VH3-48_IGHD6-6*01_IGHJ1*01 923 gnl|Fabrus|L12_IGKJ1*01 1088
821 gnl|Fabrus|VH3-30_IGHD6-6*01_IGHJ1*01 893 gnl|Fabrus|L12_IGKJ1*01 1088
822 gnl|Fabrus|VH3-66_IGHD6-6*01_IGHJ1*01 949 gnl|Fabrus|L12_IGKJ1*01 1088
823 gnl|Fabrus|VH3-53_IGHD5-5*01_IGHJ4*01 938 gnl|Fabrus|L12_IGKJ1*01 1088
824 gnl|Fabrus|VH2-5_IGHD5-12*01_IGHJ4*01 804 gnl|Fabrus|L12_IGKJ1*01 1088
825 gnl|Fabrus|VH2-70_IGHD5-12*01_IGHJ4*01 811 gnl|Fabrus|L12_IGKJ1*01 1088
826 gnl|Fabrus|VH3-15_IGHD5-12*01_IGHJ4*01 835 gnl|Fabrus|L12_IGKJ1*01 1088
827 gnl|Fabrus|VH3-15_IGHD3-10*01_IGHJ4*01 833 gnl|Fabrus|L12_IGKJ1*01 1088
828 gnl|Fabrus|VH3-49_IGHD5-18*01_IGHJ4*01 930 gnl|Fabrus|L12_IGKJ1*01 1088
829 gnl|Fabrus|VH3-49_IGHD6-13*01_IGHJ4*01 931 gnl|Fabrus|L12_IGKJ1*01 1088
830 gnl|Fabrus|VH3-72_IGHD5-18*01_IGHJ4*01 967 gnl|Fabrus|L12_IGKJ1*01 1088
831 gnl|Fabrus|VH3-72_IGHD6-6*01_IGHJ1*01 969 gnl|Fabrus|L12_IGKJ1*01 1088
832 gnl|Fabrus|VH3-73_IGHD5-12*01_IGHJ4*01 977 gnl|Fabrus|L12_IGKJ1*01 1088
833 gnl|Fabrus|VH3-73_IGHD4-23*01_IGHJ5*01 976 gnl|Fabrus|L12_IGKJ1*01 1088
834 gnl|Fabrus|VH3-43_IGHD3-22*01_IGHJ4*01 918 gnl|Fabrus|L12_IGKJ1*01 1088
835 gnl|Fabrus|VH3-43_IGHD6-13*01_IGHJ4*01 921 gnl|Fabrus|L12_IGKJ1*01 1088
836 gnl|Fabrus|VH3-9_IGHD3-22*01_IGHJ4*01 992 gnl|Fabrus|L12_IGKJ1*01 1088
837 gnl|Fabrus|VH3-9_IGHD1-7*01_IGHJ5*01 989 gnl|Fabrus|L12_IGKJ1*01 1088
838 gnl|Fabrus|VH3-9_IGHD6-13*01_IGHJ4*01 995 gnl|Fabrus|L12_IGKJ1*01 1088
839 gnl|Fabrus|VH4-39_IGHD3-10*01_IGHJ4*01 1030 gnl|Fabrus|L12_IGKJ1*01 1088
840 gnl|Fabrus|VH4-39_IGHD5-12*01_IGHJ4*01 1034 gnl|Fabrus|L12_IGKJ1*01 1088
841 gnl|Fabrus|VH1-18_IGHD6-6*01_IGHJ1*01 728 gnl|Fabrus|L12_IGKJ1*01 1088
842 gnl|Fabrus|VH1-24_IGHD5-12*01_IGHJ4*01 735 gnl|Fabrus|L12_IGKJ1*01 1088
843 gnl|Fabrus|VH1-2_IGHD1-1*01_IGHJ3*01 729 gnl|Fabrus|L12_IGKJ1*01 1088
844 gnl|Fabrus|VH1-3_IGHD6-6*01_IGHJ1*01 743 gnl|Fabrus|L12_IGKJ1*01 1088
845 gnl|Fabrus|VH1-45_IGHD3-10*01_IGHJ4*01 748 gnl|Fabrus|L12_IGKJ1*01 1088
846 gnl|Fabrus|VH1-46_IGHD1-26*01_IGHJ4*01 754 gnl|Fabrus|L12_IGKJ1*01 1088
847 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ6*01 1068 gnl|Fabrus|L12_IGKJ1*01 1088
848 gnl|Fabrus|VH2-70_IGHD3-9*01_IGHJ6*01 810 gnl|Fabrus|L12_IGKJ1*01 1088
849 gnl|Fabrus|VH1-58_IGHD3-10*01_IGHJ6*01 764 gnl|Fabrus|L12_IGKJ1*01 1088
850 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ2*01 1067 gnl|Fabrus|L12_IGKJ1*01 1088
851 gnl|Fabrus|VH4-28_IGHD3-9*01_IGHJ6*01 1002 gnl|Fabrus|L12_IGKJ1*01 1088
852 gnl|Fabrus|VH4-31_IGHD2-15*01_IGHJ2*01 1008 gnl|Fabrus|L12_IGKJ1*01 1088
853 gnl|Fabrus|VH2-5_IGHD3-9*01_IGHJ6*01 803 gnl|Fabrus|L12_IGKJ1*01 1088
854 gnl|Fabrus|VH1-8_IGHD2-15*01_IGHJ6*01 783 gnl|Fabrus|L12_IGKJ1*01 1088
855 gnl|Fabrus|VH2-70_IGHD2-15*01_IGHJ2*01 808 gnl|Fabrus|L12_IGKJ1*01 1088
856 gnl|Fabrus|VH3-38_IGHD3-10*01_IGHJ4*01 907 gnl|Fabrus|L12_IGKJ1*01 1088
857 gnl|Fabrus|VH3-16_IGHD1-7*01_IGHJ6*01 838 gnl|Fabrus|L12_IGKJ1*01 1088
858 gnl|Fabrus|VH3-73_IGHD3-9*01_IGHJ6*01 974 gnl|Fabrus|L12_IGKJ1*01 1088
859 gnl|Fabrus|VH3-11_IGHD3-9*01_IGHJ6*01 816 gnl|Fabrus|L12_IGKJ1*01 1088
860 gnl|Fabrus|VH3-11_IGHD6-6*01_IGHJ1*01 820 gnl|Fabrus|L12_IGKJ1*01 1088
861 gnl|Fabrus|VH3-20_IGHD5-12*01_IGHJ4*01 852 gnl|Fabrus|L12_IGKJ1*01 1088
862 gnl|Fabrus|VH3-16_IGHD2-15*01_IGHJ2*01 839 gnl|Fabrus|L12_IGKJ1*01 1088
863 gnl|Fabrus|VH3-7_IGHD6-6*01_IGHJ1*01 960 gnl|Fabrus|L12_IGKJ1*01 1088
864 gnl|Fabrus|VH3-16_IGHD6-13*01_IGHJ4*01 844 gnl|Fabrus|L12_IGKJ1*01 1088
865 gnl|Fabrus|VH3-23_IGHD1-1*01_IGHJ4*01 863 gnl|Fabrus|O1_IGKJ1*01 1100
866 gnl|Fabrus|VH3-23_IGHD2-15*01_IGHJ4*01 866 gnl|Fabrus|O1_IGKJ1*01 1100
867 gnl|Fabrus|VH3-23_IGHD3-22*01_IGHJ4*01 870 gnl|Fabrus|O1_IGKJ1*01 1100
868 gnl|Fabrus|VH3-23_IGHD4-11*01_IGHJ4*01 872 gnl|Fabrus|O1_IGKJ1*01 1100
869 gnl|Fabrus|VH3-23_IGHD5-12*01_IGHJ4*01 874 gnl|Fabrus|O1_IGKJ1*01 1100
870 gnl|Fabrus|VH3-23_IGHD5-5*01_IGHJ4*01 876 gnl|Fabrus|O1_IGKJ1*01 1100
871 gnl|Fabrus|VH3-23_IGHD6-13*01_IGHJ4*01 877 gnl|Fabrus|O1_IGKJ1*01 1100
872 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ4*01 880 gnl|Fabrus|O1_IGKJ1*01 1100
873 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ6*01 881 gnl|Fabrus|O1_IGKJ1*01 1100
874 gnl|Fabrus|VH1-69_IGHD1-14*01_IGHJ4*01 770 gnl|Fabrus|O1_IGKJ1*01 1100
875 gnl|Fabrus|VH1-69_IGHD2-2*01_IGHJ4*01 771 gnl|Fabrus|O1_IGKJ1*01 1100
876 gnl|Fabrus|VH1-69_IGHD2-8*01_IGHJ6*01 772 gnl|Fabrus|O1_IGKJ1*01 1100
877 gnl|Fabrus|VH1-69_IGHD3-16*01_IGHJ4*01 773 gnl|Fabrus|O1_IGKJ1*01 1100
878 gnl|Fabrus|VH1-69_IGHD3-3*01_IGHJ4*01 774 gnl|Fabrus|O1_IGKJ1*01 1100
879 gnl|Fabrus|VH1-69_IGHD4-17*01_IGHJ4*01 776 gnl|Fabrus|O1_IGKJ1*01 1100
880 gnl|Fabrus|VH1-69_IGHD5-12*01_IGHJ4*01 777 gnl|Fabrus|O1_IGKJ1*01 1100
881 gnl|Fabrus|VH1-69_IGHD6-19*01_IGHJ4*01 779 gnl|Fabrus|O1_IGKJ1*01 1100
882 gnl|Fabrus|VH1-69_IGHD7-27*01_IGHJ4*01 781 gnl|Fabrus|O1_IGKJ1*01 1100
883 gnl|Fabrus|VH4-34_IGHD1-7*01_IGHJ4*01 1017 gnl|Fabrus|O1_IGKJ1*01 1100
884 gnl|Fabrus|VH4-34_IGHD2-2*01_IGHJ4*01 1018 gnl|Fabrus|O1_IGKJ1*01 1100
885 gnl|Fabrus|VH4-34_IGHD3-16*01_IGHJ4*01 1019 gnl|Fabrus|O1_IGKJ1*01 1100
886 gnl|Fabrus|VH4-34_IGHD4-17*01_IGHJ4*01 1021 gnl|Fabrus|O1_IGKJ1*01 1100
887 gnl|Fabrus|VH4-34_IGHD5-12*01_IGHJ4*01 1022 gnl|Fabrus|O1_IGKJ1*01 1100
888 gnl|Fabrus|VH4-34_IGHD6-13*01_IGHJ4*01 1023 gnl|Fabrus|O1_IGKJ1*01 1100
889 gnl|Fabrus|VH4-34_IGHD6-25*01_IGHJ6*01 1024 gnl|Fabrus|O1_IGKJ1*01 1100
890 gnl|Fabrus|VH4-34_IGHD7-27*01_IGHJ4*01 1026 gnl|Fabrus|O1_IGKJ1*01 1100
891 gnl|Fabrus|VH2-26_IGHD1-20*01_IGHJ4*01 789 gnl|Fabrus|O1_IGKJ1*01 1100
892 gnl|Fabrus|VH2-26_IGHD2-2*01_IGHJ4*01 791 gnl|Fabrus|O1_IGKJ1*01 1100
893 gnl|Fabrus|VH2-26_IGHD3-10*01_IGHJ4*01 792 gnl|Fabrus|O1_IGKJ1*01 1100
894 gnl|Fabrus|VH2-26_IGHD4-11*01_IGHJ4*01 794 gnl|Fabrus|O1_IGKJ1*01 1100
895 gnl|Fabrus|VH2-26_IGHD5-18*01_IGHJ4*01 796 gnl|Fabrus|O1_IGKJ1*01 1100
896 gnl|Fabrus|VH2-26_IGHD6-13*01_IGHJ4*01 797 gnl|Fabrus|O1_IGKJ1*01 1100
897 gnl|Fabrus|VH2-26_IGHD7-27*01_IGHJ4*01 798 gnl|Fabrus|O1_IGKJ1*01 1100
898 gnl|Fabrus|VH5-51_IGHD1-14*01_IGHJ4*01 1044 gnl|Fabrus|O1_IGKJ1*01 1100
899 gnl|Fabrus|VH5-51_IGHD2-8*01_IGHJ4*01 1046 gnl|Fabrus|O1_IGKJ1*01 1100
900 gnl|Fabrus|VH5-51_IGHD3-3*01_IGHJ4*01 1048 gnl|Fabrus|O1_IGKJ1*01 1100
901 gnl|Fabrus|VH5-51_IGHD4-17*01_IGHJ4*01 1049 gnl|Fabrus|O1_IGKJ1*01 1100
902 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1050 gnl|Fabrus|O1_IGKJ1*01 1100
903 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1051 gnl|Fabrus|O1_IGKJ1*01 1100
904 gnl|Fabrus|VH5-51_IGHD6-25*01_IGHJ4*01 1052 gnl|Fabrus|O1_IGKJ1*01 1100
905 gnl|Fabrus|VH5-51_IGHD7-27*01_IGHJ4*01 1053 gnl|Fabrus|O1_IGKJ1*01 1100
906 gnl|Fabrus|VH6-1_IGHD1-1*01_IGHJ4*01 1054 gnl|Fabrus|O1_IGKJ1*01 1100
907 gnl|Fabrus|VH6-1_IGHD2-15*01_IGHJ4*01 1056 gnl|Fabrus|O1_IGKJ1*01 1100
908 gnl|Fabrus|VH6-1_IGHD3-3*01_IGHJ4*01 1059 gnl|Fabrus|O1_IGKJ1*01 1100
909 gnl|Fabrus|VH6-1_IGHD4-23*01_IGHJ4*01 1061 gnl|Fabrus|O1_IGKJ1*01 1100
910 gnl|Fabrus|VH6-1_IGHD4-11*01_IGHJ6*01 1060 gnl|Fabrus|O1_IGKJ1*01 1100
911 gnl|Fabrus|VH6-1_IGHD5-5*01_IGHJ4*01 1062 gnl|Fabrus|O1_IGKJ1*01 1100
912 gnl|Fabrus|VH6-1_IGHD6-13*01_IGHJ4*01 1063 gnl|Fabrus|O1_IGKJ1*01 1100
913 gnl|Fabrus|VH6-1_IGHD6-25*01_IGHJ6*01 1064 gnl|Fabrus|O1_IGKJ1*01 1100
914 gnl|Fabrus|VH6-1_IGHD7-27*01_IGHJ4*01 1065 gnl|Fabrus|O1_IGKJ1*01 1100
915 gnl|Fabrus|VH4-59_IGHD6-25*01_IGHJ3*01 1043 gnl|Fabrus|O1_IGKJ1*01 1100
916 gnl|Fabrus|VH3-48_IGHD6-6*01_IGHJ1*01 923 gnl|Fabrus|O1_IGKJ1*01 1100
917 gnl|Fabrus|VH3-30_IGHD6-6*01_IGHJ1*01 893 gnl|Fabrus|O1_IGKJ1*01 1100
918 gnl|Fabrus|VH3-66_IGHD6-6*01_IGHJ1*01 949 gnl|Fabrus|O1_IGKJ1*01 1100
919 gnl|Fabrus|VH3-53_IGHD5-5*01_IGHJ4*01 938 gnl|Fabrus|O1_IGKJ1*01 1100
920 gnl|Fabrus|VH2-5_IGHD5-12*01_IGHJ4*01 804 gnl|Fabrus|O1_IGKJ1*01 1100
921 gnl|Fabrus|VH2-70_IGHD5-12*01_IGHJ4*01 811 gnl|Fabrus|O1_IGKJ1*01 1100
922 gnl|Fabrus|VH3-15_IGHD5-12*01_IGHJ4*01 835 gnl|Fabrus|O1_IGKJ1*01 1100
923 gnl|Fabrus|VH3-15_IGHD3-10*01_IGHJ4*01 833 gnl|Fabrus|O1_IGKJ1*01 1100
924 gnl|Fabrus|VH3-49_IGHD5-18*01_IGHJ4*01 930 gnl|Fabrus|O1_IGKJ1*01 1100
925 gnl|Fabrus|VH3-49_IGHD6-13*01_IGHJ4*01 931 gnl|Fabrus|O1_IGKJ1*01 1100
926 gnl|Fabrus|VH3-72_IGHD5-18*01_IGHJ4*01 967 gnl|Fabrus|O1_IGKJ1*01 1100
927 gnl|Fabrus|VH3-72_IGHD6-6*01_IGHJ1*01 969 gnl|Fabrus|O1_IGKJ1*01 1100
928 gnl|Fabrus|VH3-73_IGHD5-12*01_IGHJ4*01 977 gnl|Fabrus|O1_IGKJ1*01 1100
929 gnl|Fabrus|VH3-73_IGHD4-23*01_IGHJ5*01 976 gnl|Fabrus|O1_IGKJ1*01 1100
930 gnl|Fabrus|VH3-43_IGHD3-22*01_IGHJ4*01 918 gnl|Fabrus|O1_IGKJ1*01 1100
931 gnl|Fabrus|VH3-43_IGHD6-13*01_IGHJ4*01 921 gnl|Fabrus|O1_IGKJ1*01 1100
932 gnl|Fabrus|VH3-9_IGHD3-22*01_IGHJ4*01 992 gnl|Fabrus|O1_IGKJ1*01 1100
933 gnl|Fabrus|VH3-9_IGHD1-7*01_IGHJ5*01 989 gnl|Fabrus|O1_IGKJ1*01 1100
934 gnl|Fabrus|VH3-9_IGHD6-13*01_IGHJ4*01 995 gnl|Fabrus|O1_IGKJ1*01 1100
935 gnl|Fabrus|VH4-39_IGHD3-10*01_IGHJ4*01 1030 gnl|Fabrus|O1_IGKJ1*01 1100
936 gnl|Fabrus|VH4-39_IGHD5-12*01_IGHJ4*01 1034 gnl|Fabrus|O1_IGKJ1*01 1100
937 gnl|Fabrus|VH1-18_IGHD6-6*01_IGHJ1*01 728 gnl|Fabrus|O1_IGKJ1*01 1100
938 gnl|Fabrus|VH1-24_IGHD5-12*01_IGHJ4*01 735 gnl|Fabrus|O1_IGKJ1*01 1100
939 gnl|Fabrus|VH1-2_IGHD1-1*01_IGHJ3*01 729 gnl|Fabrus|O1_IGKJ1*01 1100
940 gnl|Fabrus|VH1-3_IGHD6-6*01_IGHJ1*01 743 gnl|Fabrus|O1_IGKJ1*01 1100
941 gnl|Fabrus|VH1-45_IGHD3-10*01_IGHJ4*01 748 gnl|Fabrus|O1_IGKJ1*01 1100
942 gnl|Fabrus|VH1-46_IGHD1-26*01_IGHJ4*01 754 gnl|Fabrus|O1_IGKJ1*01 1100
943 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ6*01 1068 gnl|Fabrus|O1_IGKJ1*01 1100
944 gnl|Fabrus|VH2-70_IGHD3-9*01_IGHJ6*01 810 gnl|Fabrus|O1_IGKJ1*01 1100
945 gnl|Fabrus|VH1-58_IGHD3-10*01_IGHJ6*01 764 gnl|Fabrus|O1_IGKJ1*01 1100
946 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ2*01 1067 gnl|Fabrus|O1_IGKJ1*01 1100
947 gnl|Fabrus|VH4-28_IGHD3-9*01_IGHJ6*01 1002 gnl|Fabrus|O1_IGKJ1*01 1100
948 gnl|Fabrus|VH4-31_IGHD2-15*01_IGHJ2*01 1008 gnl|Fabrus|O1_IGKJ1*01 1100
949 gnl|Fabrus|VH2-5_IGHD3-9*01_IGHJ6*01 803 gnl|Fabrus|O1_IGKJ1*01 1100
950 gnl|Fabrus|VH1-8_IGHD2-15*01_IGHJ6*01 783 gnl|Fabrus|O1_IGKJ1*01 1100
951 gnl|Fabrus|VH2-70_IGHD2-15*01_IGHJ2*01 808 gnl|Fabrus|O1_IGKJ1*01 1100
952 gnl|Fabrus|VH3-38_IGHD3-10*01_IGHJ4*01 907 gnl|Fabrus|O1_IGKJ1*01 1100
953 gnl|Fabrus|VH3-16_IGHD1-7*01_IGHJ6*01 838 gnl|Fabrus|O1_IGKJ1*01 1100
954 gnl|Fabrus|VH3-73_IGHD3-9*01_IGHJ6*01 974 gnl|Fabrus|O1_IGKJ1*01 1100
955 gnl|Fabrus|VH3-11_IGHD3-9*01_IGHJ6*01 816 gnl|Fabrus|O1_IGKJ1*01 1100
956 gnl|Fabrus|VH3-11_IGHD6-6*01_IGHJ1*01 820 gnl|Fabrus|O1_IGKJ1*01 1100
957 gnl|Fabrus|VH3-20_IGHD5-12*01_IGHJ4*01 852 gnl|Fabrus|O1_IGKJ1*01 1100
958 gnl|Fabrus|VH3-16_IGHD2-15*01_IGHJ2*01 839 gnl|Fabrus|O1_IGKJ1*01 1100
959 gnl|Fabrus|VH3-7_IGHD6-6*01_IGHJ1*01 960 gnl|Fabrus|O1_IGKJ1*01 1100
960 gnl|Fabrus|VH3-16_IGHD6-13*01_IGHJ4*01 844 gnl|Fabrus|O1_IGKJ1*01 1100
961 gnl|Fabrus|VH3-23_IGHD1-1*01_IGHJ4*01 863 gnl|Fabrus|L25_IGKJ3*01 1094
962 gnl|Fabrus|VH3-23_IGHD2-15*01_IGHJ4*01 866 gnl|Fabrus|L25_IGKJ3*01 1094
963 gnl|Fabrus|VH3-23_IGHD3-22*01_IGHJ4*01 870 gnl|Fabrus|L25_IGKJ3*01 1094
964 gnl|Fabrus|VH3-23_IGHD4-11*01_IGHJ4*01 872 gnl|Fabrus|L25_IGKJ3*01 1094
965 gnl|Fabrus|VH3-23_IGHD5-12*01_IGHJ4*01 874 gnl|Fabrus|L25_IGKJ3*01 1094
966 gnl|Fabrus|VH3-23_IGHD5-5*01_IGHJ4*01 876 gnl|Fabrus|L25_IGKJ3*01 1094
967 gnl|Fabrus|VH3-23_IGHD6-13*01_IGHJ4*01 877 gnl|Fabrus|L25_IGKJ3*01 1094
968 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ4*01 880 gnl|Fabrus|L25_IGKJ3*01 1094
969 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ6*01 881 gnl|Fabrus|L25_IGKJ3*01 1094
970 gnl|Fabrus|VH1-69_IGHD1-14*01_IGHJ4*01 770 gnl|Fabrus|L25_IGKJ3*01 1094
971 gnl|Fabrus|VH1-69_IGHD2-2*01_IGHJ4*01 771 gnl|Fabrus|L25_IGKJ3*01 1094
972 gnl|Fabrus|VH1-69_IGHD2-8*01_IGHJ6*01 772 gnl|Fabrus|L25_IGKJ3*01 1094
973 gnl|Fabrus|VH1-69_IGHD3-16*01_IGHJ4*01 773 gnl|Fabrus|L25_IGKJ3*01 1094
974 gnl|Fabrus|VH1-69_IGHD3-3*01_IGHJ4*01 774 gnl|Fabrus|L25_IGKJ3*01 1094
975 gnl|Fabrus|VH1-69_IGHD4-17*01_IGHJ4*01 776 gnl|Fabrus|L25_IGKJ3*01 1094
976 gnl|Fabrus|VH1-69_IGHD5-12*01_IGHJ4*01 777 gnl|Fabrus|L25_IGKJ3*01 1094
977 gnl|Fabrus|VH1-69_IGHD6-19*01_IGHJ4*01 779 gnl|Fabrus|L25_IGKJ3*01 1094
978 gnl|Fabrus|VH1-69_IGHD7-27*01_IGHJ4*01 781 gnl|Fabrus|L25_IGKJ3*01 1094
979 gnl|Fabrus|VH4-34_IGHD1-7*01_IGHJ4*01 1017 gnl|Fabrus|L25_IGKJ3*01 1094
980 gnl|Fabrus|VH4-34_IGHD2-2*01_IGHJ4*01 1018 gnl|Fabrus|L25_IGKJ3*01 1094
981 gnl|Fabrus|VH4-34_IGHD3-16*01_IGHJ4*01 1019 gnl|Fabrus|L25_IGKJ3*01 1094
982 gnl|Fabrus|VH4-34_IGHD4-17*01_IGHJ4*01 1021 gnl|Fabrus|L25_IGKJ3*01 1094
983 gnl|Fabrus|VH4-34_IGHD5-12*01_IGHJ4*01 1022 gnl|Fabrus|L25_IGKJ3*01 1094
984 gnl|Fabrus|VH4-34_IGHD6-13*01_IGHJ4*01 1023 gnl|Fabrus|L25_IGKJ3*01 1094
985 gnl|Fabrus|VH4-34_IGHD6-25*01_IGHJ6*01 1024 gnl|Fabrus|L25_IGKJ3*01 1094
986 gnl|Fabrus|VH4-34_IGHD7-27*01_IGHJ4*01 1026 gnl|Fabrus|L25_IGKJ3*01 1094
987 gnl|Fabrus|VH2-26_IGHD1-20*01_IGHJ4*01 789 gnl|Fabrus|L25_IGKJ3*01 1094
988 gnl|Fabrus|VH2-26_IGHD2-2*01_IGHJ4*01 791 gnl|Fabrus|L25_IGKJ3*01 1094
989 gnl|Fabrus|VH2-26_IGHD3-10*01_IGHJ4*01 792 gnl|Fabrus|L25_IGKJ3*01 1094
990 gnl|Fabrus|VH2-26_IGHD4-11*01_IGHJ4*01 794 gnl|Fabrus|L25_IGKJ3*01 1094
991 gnl|Fabrus|VH2-26_IGHD5-18*01_IGHJ4*01 796 gnl|Fabrus|L25_IGKJ3*01 1094
992 gnl|Fabrus|VH2-26_IGHD6-13*01_IGHJ4*01 797 gnl|Fabrus|L25_IGKJ3*01 1094
993 gnl|Fabrus|VH2-26_IGHD7-27*01_IGHJ4*01 798 gnl|Fabrus|L25_IGKJ3*01 1094
994 gnl|Fabrus|VH5-51_IGHD1-14*01_IGHJ4*01 1044 gnl|Fabrus|L25_IGKJ3*01 1094
995 gnl|Fabrus|VH5-51_IGHD2-8*01_IGHJ4*01 1046 gnl|Fabrus|L25_IGKJ3*01 1094
996 gnl|Fabrus|VH5-51_IGHD3-3*01_IGHJ4*01 1048 gnl|Fabrus|L25_IGKJ3*01 1094
997 gnl|Fabrus|VH5-51_IGHD4-17*01_IGHJ4*01 1049 gnl|Fabrus|L25_IGKJ3*01 1094
998 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1050 gnl|Fabrus|L25_IGKJ3*01 1094
999 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1051 gnl|Fabrus|L25_IGKJ3*01 1094
1000 gnl|Fabrus|VH5-51_IGHD6-25*01_IGHJ4*01 1052 gnl|Fabrus|L25_IGKJ3*01 1094
1001 gnl|Fabrus|VH5-51_IGHD7-27*01_IGHJ4*01 1053 gnl|Fabrus|L25_IGKJ3*01 1094
1002 gnl|Fabrus|VH6-1_IGHD1-1*01_IGHJ4*01 1054 gnl|Fabrus|L25_IGKJ3*01 1094
1003 gnl|Fabrus|VH6-1_IGHD2-15*01_IGHJ4*01 1056 gnl|Fabrus|L25_IGKJ3*01 1094
1004 gnl|Fabrus|VH6-1_IGHD3-3*01_IGHJ4*01 1059 gnl|Fabrus|L25_IGKJ3*01 1094
1005 gnl|Fabrus|VH6-1_IGHD4-23*01_IGHJ4*01 1061 gnl|Fabrus|L25_IGKJ3*01 1094
1006 gnl|Fabrus|VH6-1_IGHD4-11*01_IGHJ6*01 1060 gnl|Fabrus|L25_IGKJ3*01 1094
1007 gnl|Fabrus|VH6-1_IGHD5-5*01_IGHJ4*01 1062 gnl|Fabrus|L25_IGKJ3*01 1094
1008 gnl|Fabrus|VH6-1_IGHD6-13*01_IGHJ4*01 1063 gnl|Fabrus|L25_IGKJ3*01 1094
1009 gnl|Fabrus|VH6-1_IGHD6-25*01_IGHJ6*01 1064 gnl|Fabrus|L25_IGKJ3*01 1094
1010 gnl|Fabrus|VH6-1_IGHD7-27*01_IGHJ4*01 1065 gnl|Fabrus|L25_IGKJ3*01 1094
1011 gnl|Fabrus|VH4-59_IGHD6-25*01_IGHJ3*01 1043 gnl|Fabrus|L25_IGKJ3*01 1094
1012 gnl|Fabrus|VH3-48_IGHD6-6*01_IGHJ1*01 923 gnl|Fabrus|L25_IGKJ3*01 1094
1013 gnl|Fabrus|VH3-30_IGHD6-6*01_IGHJ1*01 893 gnl|Fabrus|L25_IGKJ3*01 1094
1014 gnl|Fabrus|VH3-66_IGHD6-6*01_IGHJ1*01 949 gnl|Fabrus|L25_IGKJ3*01 1094
1015 gnl|Fabrus|VH3-53_IGHD5-5*01_IGHJ4*01 938 gnl|Fabrus|L25_IGKJ3*01 1094
1016 gnl|Fabrus|VH2-5_IGHD5-12*01_IGHJ4*01 804 gnl|Fabrus|L25_IGKJ3*01 1094
1017 gnl|Fabrus|VH2-70_IGHD5-12*01_IGHJ4*01 811 gnl|Fabrus|L25_IGKJ3*01 1094
1018 gnl|Fabrus|VH3-15_IGHD5-12*01_IGHJ4*01 835 gnl|Fabrus|L25_IGKJ3*01 1094
1019 gnl|Fabrus|VH3-15_IGHD3-10*01_IGHJ4*01 833 gnl|Fabrus|L25_IGKJ3*01 1094
1020 gnl|Fabrus|VH3-49_IGHD5-18*01_IGHJ4*01 930 gnl|Fabrus|L25_IGKJ3*01 1094
1021 gnl|Fabrus|VH3-49_IGHD6-13*01_IGHJ4*01 931 gnl|Fabrus|L25_IGKJ3*01 1094
1022 gnl|Fabrus|VH3-72_IGHD5-18*01_IGHJ4*01 967 gnl|Fabrus|L25_IGKJ3*01 1094
1023 gnl|Fabrus|VH3-72_IGHD6-6*01_IGHJ1*01 969 gnl|Fabrus|L25_IGKJ3*01 1094
1024 gnl|Fabrus|VH3-73_IGHD5-12*01_IGHJ4*01 977 gnl|Fabrus|L25_IGKJ3*01 1094
1025 gnl|Fabrus|VH3-73_IGHD4-23*01_IGHJ5*01 976 gnl|Fabrus|L25_IGKJ3*01 1094
1026 gnl|Fabrus|VH3-43_IGHD3-22*01_IGHJ4*01 918 gnl|Fabrus|L25_IGKJ3*01 1094
1027 gnl|Fabrus|VH3-43_IGHD6-13*01_IGHJ4*01 921 gnl|Fabrus|L25_IGKJ3*01 1094
1028 gnl|Fabrus|VH3-9_IGHD3-22*01_IGHJ4*01 992 gnl|Fabrus|L25_IGKJ3*01 1094
1029 gnl|Fabrus|VH3-9_IGHD1-7*01_IGHJ5*01 989 gnl|Fabrus|L25_IGKJ3*01 1094
1030 gnl|Fabrus|VH3-9_IGHD6-13*01_IGHJ4*01 995 gnl|Fabrus|L25_IGKJ3*01 1094
1031 gnl|Fabrus|VH4-39_IGHD3-10*01_IGHJ4*01 1030 gnl|Fabrus|L25_IGKJ3*01 1094
1032 gnl|Fabrus|VH4-39_IGHD5-12*01_IGHJ4*01 1034 gnl|Fabrus|L25_IGKJ3*01 1094
1033 gnl|Fabrus|VH1-18_IGHD6-6*01_IGHJ1*01 728 gnl|Fabrus|L25_IGKJ3*01 1094
1034 gnl|Fabrus|VH1-24_IGHD5-12*01_IGHJ4*01 735 gnl|Fabrus|L25_IGKJ3*01 1094
1035 gnl|Fabrus|VH1-2_IGHD1-1*01_IGHJ3*01 729 gnl|Fabrus|L25_IGKJ3*01 1094
1036 gnl|Fabrus|VH1-3_IGHD6-6*01_IGHJ1*01 743 gnl|Fabrus|L25_IGKJ3*01 1094
1037 gnl|Fabrus|VH1-45_IGHD3-10*01_IGHJ4*01 748 gnl|Fabrus|L25_IGKJ3*01 1094
1038 gnl|Fabrus|VH1-46_IGHD1-26*01_IGHJ4*01 754 gnl|Fabrus|L25_IGKJ3*01 1094
1039 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ6*01 1068 gnl|Fabrus|L25_IGKJ3*01 1094
1040 gnl|Fabrus|VH2-70_IGHD3-9*01_IGHJ6*01 810 gnl|Fabrus|L25_IGKJ3*01 1094
1041 gnl|Fabrus|VH1-58_IGHD3-10*01_IGHJ6*01 764 gnl|Fabrus|L25_IGKJ3*01 1094
1042 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ2*01 1067 gnl|Fabrus|L25_IGKJ3*01 1094
1043 gnl|Fabrus|VH4-28_IGHD3-9*01_IGHJ6*01 1002 gnl|Fabrus|L25_IGKJ3*01 1094
1044 gnl|Fabrus|VH4-31_IGHD2-15*01_IGHJ2*01 1008 gnl|Fabrus|L25_IGKJ3*01 1094
1045 gnl|Fabrus|VH2-5_IGHD3-9*01_IGHJ6*01 803 gnl|Fabrus|L25_IGKJ3*01 1094
1046 gnl|Fabrus|VH1-8_IGHD2-15*01_IGHJ6*01 783 gnl|Fabrus|L25_IGKJ3*01 1094
1047 gnl|Fabrus|VH2-70_IGHD2-15*01_IGHJ2*01 808 gnl|Fabrus|L25_IGKJ3*01 1094
1048 gnl|Fabrus|VH3-38_IGHD3-10*01_IGHJ4*01 907 gnl|Fabrus|L25_IGKJ3*01 1094
1049 gnl|Fabrus|VH3-16_IGHD1-7*01_IGHJ6*01 838 gnl|Fabrus|L25_IGKJ3*01 1094
1050 gnl|Fabrus|VH3-73_IGHD3-9*01_IGHJ6*01 974 gnl|Fabrus|L25_IGKJ3*01 1094
1051 gnl|Fabrus|VH3-11_IGHD3-9*01_IGHJ6*01 816 gnl|Fabrus|L25_IGKJ3*01 1094
1052 gnl|Fabrus|VH3-11_IGHD6-6*01_IGHJ1*01 820 gnl|Fabrus|L25_IGKJ3*01 1094
1053 gnl|Fabrus|VH3-20_IGHD5-12*01_IGHJ4*01 852 gnl|Fabrus|L25_IGKJ3*01 1094
1054 gnl|Fabrus|VH3-16_IGHD2-15*01_IGHJ2*01 839 gnl|Fabrus|L25_IGKJ3*01 1094
1055 gnl|Fabrus|VH3-7_IGHD6-6*01_IGHJ1*01 960 gnl|Fabrus|L25_IGKJ3*01 1094
1056 gnl|Fabrus|VH3-16_IGHD6-13*01_IGHJ4*01 844 gnl|Fabrus|L25_IGKJ3*01 1094
1057 gnl|Fabrus|VH3-23_IGHD1-1*01_IGHJ4*01 863 gnl|Fabrus|A27_IGKJ1*01 1080
1058 gnl|Fabrus|VH3-23_IGHD2-15*01_IGHJ4*01 866 gnl|Fabrus|A27_IGKJ1*01 1080
1059 gnl|Fabrus|VH3-23_IGHD3-22*01_IGHJ4*01 870 gnl|Fabrus|A27_IGKJ1*01 1080
1060 gnl|Fabrus|VH3-23_IGHD4-11*01_IGHJ4*01 872 gnl|Fabrus|A27_IGKJ1*01 1080
1061 gnl|Fabrus|VH3-23_IGHD5-12*01_IGHJ4*01 874 gnl|Fabrus|A27_IGKJ1*01 1080
1062 gnl|Fabrus|VH3-23_IGHD5-5*01_IGHJ4*01 876 gnl|Fabrus|A27_IGKJ1*01 1080
1063 gnl|Fabrus|VH3-23_IGHD6-13*01_IGHJ4*01 877 gnl|Fabrus|A27_IGKJ1*01 1080
1064 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ4*01 880 gnl|Fabrus|A27_IGKJ1*01 1080
1065 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ6*01 881 gnl|Fabrus|A27_IGKJ1*01 1080
1066 gnl|Fabrus|VH1-69_IGHD1-14*01_IGHJ4*01 770 gnl|Fabrus|A27_IGKJ1*01 1080
1067 gnl|Fabrus|VH1-69_IGHD2-2*01_IGHJ4*01 771 gnl|Fabrus|A27_IGKJ1*01 1080
1068 gnl|Fabrus|VH1-69_IGHD2-8*01_IGHJ6*01 772 gnl|Fabrus|A27_IGKJ1*01 1080
1069 gnl|Fabrus|VH1-69_IGHD3-16*01_IGHJ4*01 773 gnl|Fabrus|A27_IGKJ1*01 1080
1070 gnl|Fabrus|VH1-69_IGHD3-3*01_IGHJ4*01 774 gnl|Fabrus|A27_IGKJ1*01 1080
1071 gnl|Fabrus|VH1-69_IGHD4-17*01_IGHJ4*01 776 gnl|Fabrus|A27_IGKJ1*01 1080
1072 gnl|Fabrus|VH1-69_IGHD5-12*01_IGHJ4*01 777 gnl|Fabrus|A27_IGKJ1*01 1080
1073 gnl|Fabrus|VH1-69_IGHD6-19*01_IGHJ4*01 779 gnl|Fabrus|A27_IGKJ1*01 1080
1074 gnl|Fabrus|VH1-69_IGHD7-27*01_IGHJ4*01 781 gnl|Fabrus|A27_IGKJ1*01 1080
1075 gnl|Fabrus|VH4-34_IGHD1-7*01_IGHJ4*01 1017 gnl|Fabrus|A27_IGKJ1*01 1080
1076 gnl|Fabrus|VH4-34_IGHD2-2*01_IGHJ4*01 1018 gnl|Fabrus|A27_IGKJ1*01 1080
1077 gnl|Fabrus|VH4-34_IGHD3-16*01_IGHJ4*01 1019 gnl|Fabrus|A27_IGKJ1*01 1080
1078 gnl|Fabrus|VH4-34_IGHD4-17*01_IGHJ4*01 1021 gnl|Fabrus|A27_IGKJ1*01 1080
1079 gnl|Fabrus|VH4-34_IGHD5-12*01_IGHJ4*01 1022 gnl|Fabrus|A27_IGKJ1*01 1080
1080 gnl|Fabrus|VH4-34_IGHD6-13*01_IGHJ4*01 1023 gnl|Fabrus|A27_IGKJ1*01 1080
1081 gnl|Fabrus|VH4-34_IGHD6-25*01_IGHJ6*01 1024 gnl|Fabrus|A27_IGKJ1*01 1080
1082 gnl|Fabrus|VH4-34_IGHD7-27*01_IGHJ4*01 1026 gnl|Fabrus|A27_IGKJ1*01 1080
1083 gnl|Fabrus|VH2-26_IGHD1-20*01_IGHJ4*01 789 gnl|Fabrus|A27_IGKJ1*01 1080
1084 gnl|Fabrus|VH2-26_IGHD2-2*01_IGHJ4*01 791 gnl|Fabrus|A27_IGKJ1*01 1080
1085 gnl|Fabrus|VH2-26_IGHD3-10*01_IGHJ4*01 792 gnl|Fabrus|A27_IGKJ1*01 1080
1086 gnl|Fabrus|VH2-26_IGHD4-11*01_IGHJ4*01 794 gnl|Fabrus|A27_IGKJ1*01 1080
1087 gnl|Fabrus|VH2-26_IGHD5-18*01_IGHJ4*01 796 gnl|Fabrus|A27_IGKJ1*01 1080
1088 gnl|Fabrus|VH2-26_IGHD6-13*01_IGHJ4*01 797 gnl|Fabrus|A27_IGKJ1*01 1080
1089 gnl|Fabrus|VH2-26_IGHD7-27*01_IGHJ4*01 798 gnl|Fabrus|A27_IGKJ1*01 1080
1090 gnl|Fabrus|VH5-51_IGHD1-14*01_IGHJ4*01 1044 gnl|Fabrus|A27_IGKJ1*01 1080
1091 gnl|Fabrus|VH5-51_IGHD2-8*01_IGHJ4*01 1046 gnl|Fabrus|A27_IGKJ1*01 1080
1092 gnl|Fabrus|VH5-51_IGHD3-3*01_IGHJ4*01 1048 gnl|Fabrus|A27_IGKJ1*01 1080
1093 gnl|Fabrus|VH5-51_IGHD4-17*01_IGHJ4*01 1049 gnl|Fabrus|A27_IGKJ1*01 1080
1094 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1050 gnl|Fabrus|A27_IGKJ1*01 1080
1095 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1051 gnl|Fabrus|A27_IGKJ1*01 1080
1096 gnl|Fabrus|VH5-51_IGHD6-25*01_IGHJ4*01 1052 gnl|Fabrus|A27_IGKJ1*01 1080
1097 gnl|Fabrus|VH5-51_IGHD7-27*01_IGHJ4*01 1053 gnl|Fabrus|A27_IGKJ1*01 1080
1098 gnl|Fabrus|VH6-1_IGHD1-1*01_IGHJ4*01 1054 gnl|Fabrus|A27_IGKJ1*01 1080
1099 gnl|Fabrus|VH6-1_IGHD2-15*01_IGHJ4*01 1056 gnl|Fabrus|A27_IGKJ1*01 1080
1100 gnl|Fabrus|VH6-1_IGHD3-3*01_IGHJ4*01 1059 gnl|Fabrus|A27_IGKJ1*01 1080
1101 gnl|Fabrus|VH6-1_IGHD4-23*01_IGHJ4*01 1061 gnl|Fabrus|A27_IGKJ1*01 1080
1102 gnl|Fabrus|VH6-1_IGHD4-11*01_IGHJ6*01 1060 gnl|Fabrus|A27_IGKJ1*01 1080
1103 gnl|Fabrus|VH6-1_IGHD5-5*01_IGHJ4*01 1062 gnl|Fabrus|A27_IGKJ1*01 1080
1104 gnl|Fabrus|VH6-1_IGHD6-13*01_IGHJ4*01 1063 gnl|Fabrus|A27_IGKJ1*01 1080
1105 gnl|Fabrus|VH6-1_IGHD6-25*01_IGHJ6*01 1064 gnl|Fabrus|A27_IGKJ1*01 1080
1106 gnl|Fabrus|VH6-1_IGHD7-27*01_IGHJ4*01 1065 gnl|Fabrus|A27_IGKJ1*01 1080
1107 gnl|Fabrus|VH4-59_IGHD6-25*01_IGHJ3*01 1043 gnl|Fabrus|A27_IGKJ1*01 1080
1108 gnl|Fabrus|VH3-48_IGHD6-6*01_IGHJ1*01 923 gnl|Fabrus|A27_IGKJ1*01 1080
1109 gnl|Fabrus|VH3-30_IGHD6-6*01_IGHJ1*01 893 gnl|Fabrus|A27_IGKJ1*01 1080
1110 gnl|Fabrus|VH3-66_IGHD6-6*01_IGHJ1*01 949 gnl|Fabrus|A27_IGKJ1*01 1080
1111 gnl|Fabrus|VH3-53_IGHD5-5*01_IGHJ4*01 938 gnl|Fabrus|A27_IGKJ1*01 1080
1112 gnl|Fabrus|VH2-5_IGHD5-12*01_IGHJ4*01 804 gnl|Fabrus|A27_IGKJ1*01 1080
1113 gnl|Fabrus|VH2-70_IGHD5-12*01_IGHJ4*01 811 gnl|Fabrus|A27_IGKJ1*01 1080
1114 gnl|Fabrus|VH3-15_IGHD5-12*01_IGHJ4*01 835 gnl|Fabrus|A27_IGKJ1*01 1080
1115 gnl|Fabrus|VH3-15_IGHD3-10*01_IGHJ4*01 833 gnl|Fabrus|A27_IGKJ1*01 1080
1116 gnl|Fabrus|VH3-49_IGHD5-18*01_IGHJ4*01 930 gnl|Fabrus|A27_IGKJ1*01 1080
1117 gnl|Fabrus|VH3-49_IGHD6-13*01_IGHJ4*01 931 gnl|Fabrus|A27_IGKJ1*01 1080
1118 gnl|Fabrus|VH3-72_IGHD5-18*01_IGHJ4*01 967 gnl|Fabrus|A27_IGKJ1*01 1080
1119 gnl|Fabrus|VH3-72_IGHD6-6*01_IGHJ1*01 969 gnl|Fabrus|A27_IGKJ1*01 1080
1120 gnl|Fabrus|VH3-73_IGHD5-12*01_IGHJ4*01 977 gnl|Fabrus|A27_IGKJ1*01 1080
1121 gnl|Fabrus|VH3-73_IGHD4-23*01_IGHJ5*01 976 gnl|Fabrus|A27_IGKJ1*01 1080
1122 gnl|Fabrus|VH3-43_IGHD3-22*01_IGHJ4*01 918 gnl|Fabrus|A27_IGKJ1*01 1080
1123 gnl|Fabrus|VH3-43_IGHD6-13*01_IGHJ4*01 921 gnl|Fabrus|A27_IGKJ1*01 1080
1124 gnl|Fabrus|VH3-9_IGHD3-22*01_IGHJ4*01 992 gnl|Fabrus|A27_IGKJ1*01 1080
1125 gnl|Fabrus|VH3-9_IGHD1-7*01_IGHJ5*01 989 gnl|Fabrus|A27_IGKJ1*01 1080
1126 gnl|Fabrus|VH3-9_IGHD6-13*01_IGHJ4*01 995 gnl|Fabrus|A27_IGKJ1*01 1080
1127 gnl|Fabrus|VH4-39_IGHD3-10*01_IGHJ4*01 1030 gnl|Fabrus|A27_IGKJ1*01 1080
1128 gnl|Fabrus|VH4-39_IGHD5-12*01_IGHJ4*01 1034 gnl|Fabrus|A27_IGKJ1*01 1080
1129 gnl|Fabrus|VH1-18_IGHD6-6*01_IGHJ1*01 728 gnl|Fabrus|A27_IGKJ1*01 1080
1130 gnl|Fabrus|VH1-24_IGHD5-12*01_IGHJ4*01 735 gnl|Fabrus|A27_IGKJ1*01 1080
1131 gnl|Fabrus|VH1-2_IGHD1-1*01_IGHJ3*01 729 gnl|Fabrus|A27_IGKJ1*01 1080
1132 gnl|Fabrus|VH1-3_IGHD6-6*01_IGHJ1*01 743 gnl|Fabrus|A27_IGKJ1*01 1080
1133 gnl|Fabrus|VH1-45_IGHD3-10*01_IGHJ4*01 748 gnl|Fabrus|A27_IGKJ1*01 1080
1134 gnl|Fabrus|VH1-46_IGHD1-26*01_IGHJ4*01 754 gnl|Fabrus|A27_IGKJ1*01 1080
1135 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ6*01 1068 gnl|Fabrus|A27_IGKJ1*01 1080
1136 gnl|Fabrus|VH2-70_IGHD3-9*01_IGHJ6*01 810 gnl|Fabrus|A27_IGKJ1*01 1080
1137 gnl|Fabrus|VH1-58_IGHD3-10*01_IGHJ6*01 764 gnl|Fabrus|A27_IGKJ1*01 1080
1138 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ2*01 1067 gnl|Fabrus|A27_IGKJ1*01 1080
1139 gnl|Fabrus|VH4-28_IGHD3-9*01_IGHJ6*01 1002 gnl|Fabrus|A27_IGKJ1*01 1080
1140 gnl|Fabrus|VH4-31_IGHD2-15*01_IGHJ2*01 1008 gnl|Fabrus|A27_IGKJ1*01 1080
1141 gnl|Fabrus|VH2-5_IGHD3-9*01_IGHJ6*01 803 gnl|Fabrus|A27_IGKJ1*01 1080
1142 gnl|Fabrus|VH1-8_IGHD2-15*01_IGHJ6*01 783 gnl|Fabrus|A27_IGKJ1*01 1080
1143 gnl|Fabrus|VH2-70_IGHD2-15*01_IGHJ2*01 808 gnl|Fabrus|A27_IGKJ1*01 1080
1144 gnl|Fabrus|VH3-38_IGHD3-10*01_IGHJ4*01 907 gnl|Fabrus|A27_IGKJ1*01 1080
1145 gnl|Fabrus|VH3-16_IGHD1-7*01_IGHJ6*01 838 gnl|Fabrus|A27_IGKJ1*01 1080
1146 gnl|Fabrus|VH3-73_IGHD3-9*01_IGHJ6*01 974 gnl|Fabrus|A27_IGKJ1*01 1080
1147 gnl|Fabrus|VH3-11_IGHD3-9*01_IGHJ6*01 816 gnl|Fabrus|A27_IGKJ1*01 1080
1148 gnl|Fabrus|VH3-11_IGHD6-6*01_IGHJ1*01 820 gnl|Fabrus|A27_IGKJ1*01 1080
1149 gnl|Fabrus|VH3-20_IGHD5-12*01_IGHJ4*01 852 gnl|Fabrus|A27_IGKJ1*01 1080
1150 gnl|Fabrus|VH3-16_IGHD2-15*01_IGHJ2*01 839 gnl|Fabrus|A27_IGKJ1*01 1080
1151 gnl|Fabrus|VH3-7_IGHD6-6*01_IGHJ1*01 960 gnl|Fabrus|A27_IGKJ1*01 1080
1152 gnl|Fabrus|VH3-16_IGHD6-13*01_IGHJ4*01 844 gnl|Fabrus|A27_IGKJ1*01 1080
1153 gnl|Fabrus|VH3-23_IGHD1-1*01_IGHJ4*01 863 gnl|Fabrus|A2_IGKJ1*01 1076
1154 gnl|Fabrus|VH3-23_IGHD2-15*01_IGHJ4*01 866 gnl|Fabrus|A2_IGKJ1*01 1076
1155 gnl|Fabrus|VH3-23_IGHD3-22*01_IGHJ4*01 870 gnl|Fabrus|A2_IGKJ1*01 1076
1156 gnl|Fabrus|VH3-23_IGHD4-11*01_IGHJ4*01 872 gnl|Fabrus|A2_IGKJ1*01 1076
1157 gnl|Fabrus|VH3-23_IGHD5-12*01_IGHJ4*01 874 gnl|Fabrus|A2_IGKJ1*01 1076
1158 gnl|Fabrus|VH3-23_IGHD5-5*01_IGHJ4*01 876 gnl|Fabrus|A2_IGKJ1*01 1076
1159 gnl|Fabrus|VH3-23_IGHD6-13*01_IGHJ4*01 877 gnl|Fabrus|A2_IGKJ1*01 1076
1160 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ4*01 880 gnl|Fabrus|A2_IGKJ1*01 1076
1161 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ6*01 881 gnl|Fabrus|A2_IGKJ1*01 1076
1162 gnl|Fabrus|VH1-69_IGHD1-14*01_IGHJ4*01 770 gnl|Fabrus|A2_IGKJ1*01 1076
1163 gnl|Fabrus|VH1-69_IGHD2-2*01_IGHJ4*01 771 gnl|Fabrus|A2_IGKJ1*01 1076
1164 gnl|Fabrus|VH1-69_IGHD2-8*01_IGHJ6*01 772 gnl|Fabrus|A2_IGKJ1*01 1076
1165 gnl|Fabrus|VH1-69_IGHD3-16*01_IGHJ4*01 773 gnl|Fabrus|A2_IGKJ1*01 1076
1166 gnl|Fabrus|VH1-69_IGHD3-3*01_IGHJ4*01 774 gnl|Fabrus|A2_IGKJ1*01 1076
1167 gnl|Fabrus|VH1-69_IGHD4-17*01_IGHJ4*01 776 gnl|Fabrus|A2_IGKJ1*01 1076
1168 gnl|Fabrus|VH1-69_IGHD5-12*01_IGHJ4*01 777 gnl|Fabrus|A2_IGKJ1*01 1076
1169 gnl|Fabrus|VH1-69_IGHD6-19*01_IGHJ4*01 779 gnl|Fabrus|A2_IGKJ1*01 1076
1170 gnl|Fabrus|VH1-69_IGHD7-27*01_IGHJ4*01 781 gnl|Fabrus|A2_IGKJ1*01 1076
1171 gnl|Fabrus|VH4-34_IGHD1-7*01_IGHJ4*01 1017 gnl|Fabrus|A2_IGKJ1*01 1076
1172 gnl|Fabrus|VH4-34_IGHD2-2*01_IGHJ4*01 1018 gnl|Fabrus|A2_IGKJ1*01 1076
1173 gnl|Fabrus|VH4-34_IGHD3-16*01_IGHJ4*01 1019 gnl|Fabrus|A2_IGKJ1*01 1076
1174 gnl|Fabrus|VH4-34_IGHD4-17*01_IGHJ4*01 1021 gnl|Fabrus|A2_IGKJ1*01 1076
1175 gnl|Fabrus|VH4-34_IGHD5-12*01_IGHJ4*01 1022 gnl|Fabrus|A2_IGKJ1*01 1076
1176 gnl|Fabrus|VH4-34_IGHD6-13*01_IGHJ4*01 1023 gnl|Fabrus|A2_IGKJ1*01 1076
1177 gnl|Fabrus|VH4-34_IGHD6-25*01_IGHJ6*01 1024 gnl|Fabrus|A2_IGKJ1*01 1076
1178 gnl|Fabrus|VH4-34_IGHD7-27*01_IGHJ4*01 1026 gnl|Fabrus|A2_IGKJ1*01 1076
1179 gnl|Fabrus|VH2-26_IGHD1-20*01_IGHJ4*01 789 gnl|Fabrus|A2_IGKJ1*01 1076
1180 gnl|Fabrus|VH2-26_IGHD2-2*01_IGHJ4*01 791 gnl|Fabrus|A2_IGKJ1*01 1076
1181 gnl|Fabrus|VH2-26_IGHD3-10*01_IGHJ4*01 792 gnl|Fabrus|A2_IGKJ1*01 1076
1182 gnl|Fabrus|VH2-26_IGHD4-11*01_IGHJ4*01 794 gnl|Fabrus|A2_IGKJ1*01 1076
1183 gnl|Fabrus|VH2-26_IGHD5-18*01_IGHJ4*01 796 gnl|Fabrus|A2_IGKJ1*01 1076
1184 gnl|Fabrus|VH2-26_IGHD6-13*01_IGHJ4*01 797 gnl|Fabrus|A2_IGKJ1*01 1076
1185 gnl|Fabrus|VH2-26_IGHD7-27*01_IGHJ4*01 798 gnl|Fabrus|A2_IGKJ1*01 1076
1186 gnl|Fabrus|VH5-51_IGHD1-14*01_IGHJ4*01 1044 gnl|Fabrus|A2_IGKJ1*01 1076
1187 gnl|Fabrus|VH5-51_IGHD2-8*01_IGHJ4*01 1046 gnl|Fabrus|A2_IGKJ1*01 1076
1188 gnl|Fabrus|VH5-51_IGHD3-3*01_IGHJ4*01 1048 gnl|Fabrus|A2_IGKJ1*01 1076
1189 gnl|Fabrus|VH5-51_IGHD4-17*01_IGHJ4*01 1049 gnl|Fabrus|A2_IGKJ1*01 1076
1190 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1050 gnl|Fabrus|A2_IGKJ1*01 1076
1191 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1051 gnl|Fabrus|A2_IGKJ1*01 1076
1192 gnl|Fabrus|VH5-51_IGHD6-25*01_IGHJ4*01 1052 gnl|Fabrus|A2_IGKJ1*01 1076
1193 gnl|Fabrus|VH5-51_IGHD7-27*01_IGHJ4*01 1053 gnl|Fabrus|A2_IGKJ1*01 1076
1194 gnl|Fabrus|VH6-1_IGHD1-1*01_IGHJ4*01 1054 gnl|Fabrus|A2_IGKJ1*01 1076
1195 gnl|Fabrus|VH6-1_IGHD2-15*01_IGHJ4*01 1056 gnl|Fabrus|A2_IGKJ1*01 1076
1196 gnl|Fabrus|VH6-1_IGHD3-3*01_IGHJ4*01 1059 gnl|Fabrus|A2_IGKJ1*01 1076
1197 gnl|Fabrus|VH6-1_IGHD4-23*01_IGHJ4*01 1061 gnl|Fabrus|A2_IGKJ1*01 1076
1198 gnl|Fabrus|VH6-1_IGHD4-11*01_IGHJ6*01 1060 gnl|Fabrus|A2_IGKJ1*01 1076
1199 gnl|Fabrus|VH6-1_IGHD5-5*01_IGHJ4*01 1062 gnl|Fabrus|A2_IGKJ1*01 1076
1200 gnl|Fabrus|VH6-1_IGHD6-13*01_IGHJ4*01 1063 gnl|Fabrus|A2_IGKJ1*01 1076
1201 gnl|Fabrus|VH6-1_IGHD6-25*01_IGHJ6*01 1064 gnl|Fabrus|A2_IGKJ1*01 1076
1202 gnl|Fabrus|VH6-1_IGHD7-27*01_IGHJ4*01 1065 gnl|Fabrus|A2_IGKJ1*01 1076
1203 gnl|Fabrus|VH4-59_IGHD6-25*01_IGHJ3*01 1043 gnl|Fabrus|A2_IGKJ1*01 1076
1204 gnl|Fabrus|VH3-48_IGHD6-6*01_IGHJ1*01 923 gnl|Fabrus|A2_IGKJ1*01 1076
1205 gnl|Fabrus|VH3-30_IGHD6-6*01_IGHJ1*01 893 gnl|Fabrus|A2_IGKJ1*01 1076
1206 gnl|Fabrus|VH3-66_IGHD6-6*01_IGHJ1*01 949 gnl|Fabrus|A2_IGKJ1*01 1076
1207 gnl|Fabrus|VH3-53_IGHD5-5*01_IGHJ4*01 938 gnl|Fabrus|A2_IGKJ1*01 1076
1208 gnl|Fabrus|VH2-5_IGHD5-12*01_IGHJ4*01 804 gnl|Fabrus|A2_IGKJ1*01 1076
1209 gnl|Fabrus|VH2-70_IGHD5-12*01_IGHJ4*01 811 gnl|Fabrus|A2_IGKJ1*01 1076
1210 gnl|Fabrus|VH3-15_IGHD5-12*01_IGHJ4*01 835 gnl|Fabrus|A2_IGKJ1*01 1076
1211 gnl|Fabrus|VH3-15_IGHD3-10*01_IGHJ4*01 833 gnl|Fabrus|A2_IGKJ1*01 1076
1212 gnl|Fabrus|VH3-49_IGHD5-18*01_IGHJ4*01 930 gnl|Fabrus|A2_IGKJ1*01 1076
1213 gnl|Fabrus|VH3-49_IGHD6-13*01_IGHJ4*01 931 gnl|Fabrus|A2_IGKJ1*01 1076
1214 gnl|Fabrus|VH3-72_IGHD5-18*01_IGHJ4*01 967 gnl|Fabrus|A2_IGKJ1*01 1076
1215 gnl|Fabrus|VH3-72_IGHD6-6*01_IGHJ1*01 969 gnl|Fabrus|A2_IGKJ1*01 1076
1216 gnl|Fabrus|VH3-73_IGHD5-12*01_IGHJ4*01 977 gnl|Fabrus|A2_IGKJ1*01 1076
1217 gnl|Fabrus|VH3-73_IGHD4-23*01_IGHJ5*01 976 gnl|Fabrus|A2_IGKJ1*01 1076
1218 gnl|Fabrus|VH3-43_IGHD3-22*01_IGHJ4*01 918 gnl|Fabrus|A2_IGKJ1*01 1076
1219 gnl|Fabrus|VH3-43_IGHD6-13*01_IGHJ4*01 921 gnl|Fabrus|A2_IGKJ1*01 1076
1220 gnl|Fabrus|VH3-9_IGHD3-22*01_IGHJ4*01 992 gnl|Fabrus|A2_IGKJ1*01 1076
1221 gnl|Fabrus|VH3-9_IGHD1-7*01_IGHJ5*01 989 gnl|Fabrus|A2_IGKJ1*01 1076
1222 gnl|Fabrus|VH3-9_IGHD6-13*01_IGHJ4*01 995 gnl|Fabrus|A2_IGKJ1*01 1076
1223 gnl|Fabrus|VH4-39_IGHD3-10*01_IGHJ4*01 1030 gnl|Fabrus|A2_IGKJ1*01 1076
1224 gnl|Fabrus|VH4-39_IGHD5-12*01_IGHJ4*01 1034 gnl|Fabrus|A2_IGKJ1*01 1076
1225 gnl|Fabrus|VH1-18_IGHD6-6*01_IGHJ1*01 728 gnl|Fabrus|A2_IGKJ1*01 1076
1226 gnl|Fabrus|VH1-24_IGHD5-12*01_IGHJ4*01 735 gnl|Fabrus|A2_IGKJ1*01 1076
1227 gnl|Fabrus|VH1-2_IGHD1-1*01_IGHJ3*01 729 gnl|Fabrus|A2_IGKJ1*01 1076
1228 gnl|Fabrus|VH1-3_IGHD6-6*01_IGHJ1*01 743 gnl|Fabrus|A2_IGKJ1*01 1076
1229 gnl|Fabrus|VH1-45_IGHD3-10*01_IGHJ4*01 748 gnl|Fabrus|A2_IGKJ1*01 1076
1230 gnl|Fabrus|VH1-46_IGHD1-26*01_IGHJ4*01 754 gnl|Fabrus|A2_IGKJ1*01 1076
1231 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ6*01 1068 gnl|Fabrus|A2_IGKJ1*01 1076
1232 gnl|Fabrus|VH2-70_IGHD3-9*01_IGHJ6*01 810 gnl|Fabrus|A2_IGKJ1*01 1076
1233 gnl|Fabrus|VH1-58_IGHD3-10*01_IGHJ6*01 764 gnl|Fabrus|A2_IGKJ1*01 1076
1234 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ2*01 1067 gnl|Fabrus|A2_IGKJ1*01 1076
1235 gnl|Fabrus|VH4-28_IGHD3-9*01_IGHJ6*01 1002 gnl|Fabrus|A2_IGKJ1*01 1076
1236 gnl|Fabrus|VH4-31_IGHD2-15*01_IGHJ2*01 1008 gnl|Fabrus|A2_IGKJ1*01 1076
1237 gnl|Fabrus|VH2-5_IGHD3-9*01_IGHJ6*01 803 gnl|Fabrus|A2_IGKJ1*01 1076
1238 gnl|Fabrus|VH1-8_IGHD2-15*01_IGHJ6*01 783 gnl|Fabrus|A2_IGKJ1*01 1076
1239 gnl|Fabrus|VH2-70_IGHD2-15*01_IGHJ2*01 808 gnl|Fabrus|A2_IGKJ1*01 1076
1240 gnl|Fabrus|VH3-38_IGHD3-10*01_IGHJ4*01 907 gnl|Fabrus|A2_IGKJ1*01 1076
1241 gnl|Fabrus|VH3-16_IGHD1-7*01_IGHJ6*01 838 gnl|Fabrus|A2_IGKJ1*01 1076
1242 gnl|Fabrus|VH3-73_IGHD3-9*01_IGHJ6*01 974 gnl|Fabrus|A2_IGKJ1*01 1076
1243 gnl|Fabrus|VH3-11_IGHD3-9*01_IGHJ6*01 816 gnl|Fabrus|A2_IGKJ1*01 1076
1244 gnl|Fabrus|VH3-11_IGHD6-6*01_IGHJ1*01 820 gnl|Fabrus|A2_IGKJ1*01 1076
1245 gnl|Fabrus|VH3-20_IGHD5-12*01_IGHJ4*01 852 gnl|Fabrus|A2_IGKJ1*01 1076
1246 gnl|Fabrus|VH3-16_IGHD2-15*01_IGHJ2*01 839 gnl|Fabrus|A2_IGKJ1*01 1076
1247 gnl|Fabrus|VH3-7_IGHD6-6*01_IGHJ1*01 960 gnl|Fabrus|A2_IGKJ1*01 1076
1248 gnl|Fabrus|VH3-16_IGHD6-13*01_IGHJ4*01 844 gnl|Fabrus|A2_IGKJ1*01 1076
1249 gnl|Fabrus|VH3-23_IGHD1-1*01_IGHJ4*01 863 gnl|Fabrus|HerceptinLC 1086
1250 gnl|Fabrus|VH3-23_IGHD2-15*01_IGHJ4*01 866 gnl|Fabrus|HerceptinLC 1086
1251 gnl|Fabrus|VH3-23_IGHD3-22*01_IGHJ4*01 870 gnl|Fabrus|HerceptinLC 1086
1252 gnl|Fabrus|VH3-23_IGHD4-11*01_IGHJ4*01 872 gnl|Fabrus|HerceptinLC 1086
1253 gnl|Fabrus|VH3-23_IGHD5-12*01_IGHJ4*01 874 gnl|Fabrus|HerceptinLC 1086
1254 gnl|Fabrus|VH3-23_IGHD5-5*01_IGHJ4*01 876 gnl|Fabrus|HerceptinLC 1086
1255 gnl|Fabrus|VH3-23_IGHD6-13*01_IGHJ4*01 877 gnl|Fabrus|HerceptinLC 1086
1256 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ4*01 880 gnl|Fabrus|HerceptinLC 1086
1257 gnl|Fabrus|VH3-23_IGHD7-27*01_IGHJ6*01 881 gnl|Fabrus|HerceptinLC 1086
1258 gnl|Fabrus|VH1-69_IGHD1-14*01_IGHJ4*01 770 gnl|Fabrus|HerceptinLC 1086
1259 gnl|Fabrus|VH1-69_IGHD2-2*01_IGHJ4*01 771 gnl|Fabrus|HerceptinLC 1086
1260 gnl|Fabrus|VH1-69_IGHD2-8*01_IGHJ6*01 772 gnl|Fabrus|HerceptinLC 1086
1261 gnl|Fabrus|VH1-69_IGHD3-16*01_IGHJ4*01 773 gnl|Fabrus|HerceptinLC 1086
1262 gnl|Fabrus|VH1-69_IGHD3-3*01_IGHJ4*01 774 gnl|Fabrus|HerceptinLC 1086
1263 gnl|Fabrus|VH1-69_IGHD4-17*01_IGHJ4*01 776 gnl|Fabrus|HerceptinLC 1086
1264 gnl|Fabrus|VH1-69_IGHD5-12*01_IGHJ4*01 777 gnl|Fabrus|HerceptinLC 1086
1265 gnl|Fabrus|VH1-69_IGHD6-19*01_IGHJ4*01 779 gnl|Fabrus|HerceptinLC 1086
1266 gnl|Fabrus|VH1-69_IGHD7-27*01_IGHJ4*01 781 gnl|Fabrus|HerceptinLC 1086
1267 gnl|Fabrus|VH4-34_IGHD1-7*01_IGHJ4*01 1017 gnl|Fabrus|HerceptinLC 1086
1268 gnl|Fabrus|VH4-34_IGHD2-2*01_IGHJ4*01 1018 gnl|Fabrus|HerceptinLC 1086
1269 gnl|Fabrus|VH4-34_IGHD3-16*01_IGHJ4*01 1019 gnl|Fabrus|HerceptinLC 1086
1270 gnl|Fabrus|VH4-34_IGHD4-17*01_IGHJ4*01 1021 gnl|Fabrus|HerceptinLC 1086
1271 gnl|Fabrus|VH4-34_IGHD5-12*01_IGHJ4*01 1022 gnl|Fabrus|HerceptinLC 1086
1272 gnl|Fabrus|VH4-34_IGHD6-13*01_IGHJ4*01 1023 gnl|Fabrus|HerceptinLC 1086
1273 gnl|Fabrus|VH4-34_IGHD6-25*01_IGHJ6*01 1024 gnl|Fabrus|HerceptinLC 1086
1274 gnl|Fabrus|VH4-34_IGHD7-27*01_IGHJ4*01 1026 gnl|Fabrus|HerceptinLC 1086
1275 gnl|Fabrus|VH2-26_IGHD1-20*01_IGHJ4*01 789 gnl|Fabrus|HerceptinLC 1086
1276 gnl|Fabrus|VH2-26_IGHD2-2*01_IGHJ4*01 791 gnl|Fabrus|HerceptinLC 1086
1277 gnl|Fabrus|VH2-26_IGHD3-10*01_IGHJ4*01 792 gnl|Fabrus|HerceptinLC 1086
1278 gnl|Fabrus|VH2-26_IGHD4-11*01_IGHJ4*01 794 gnl|Fabrus|HerceptinLC 1086
1279 gnl|Fabrus|VH2-26_IGHD5-18*01_IGHJ4*01 796 gnl|Fabrus|HerceptinLC 1086
1280 gnl|Fabrus|VH2-26_IGHD6-13*01_IGHJ4*01 797 gnl|Fabrus|HerceptinLC 1086
1281 gnl|Fabrus|VH2-26_IGHD7-27*01_IGHJ4*01 798 gnl|Fabrus|HerceptinLC 1086
1282 gnl|Fabrus|VH5-51_IGHD1-14*01_IGHJ4*01 1044 gnl|Fabrus|HerceptinLC 1086
1283 gnl|Fabrus|VH5-51_IGHD2-8*01_IGHJ4*01 1046 gnl|Fabrus|HerceptinLC 1086
1284 gnl|Fabrus|VH5-51_IGHD3-3*01_IGHJ4*01 1048 gnl|Fabrus|HerceptinLC 1086
1285 gnl|Fabrus|VH5-51_IGHD4-17*01_IGHJ4*01 1049 gnl|Fabrus|HerceptinLC 1086
1286 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1050 gnl|Fabrus|HerceptinLC 1086
1287 gnl|Fabrus|VH5-51_IGHD5-18*01_IGHJ4*01 1051 gnl|Fabrus|HerceptinLC 1086
1288 gnl|Fabrus|VH5-51_IGHD6-25*01_IGHJ4*01 1052 gnl|Fabrus|HerceptinLC 1086
1289 gnl|Fabrus|VH5-51_IGHD7-27*01_IGHJ4*01 1053 gnl|Fabrus|HerceptinLC 1086
1290 gnl|Fabrus|VH6-1_IGHD1-1*01_IGHJ4*01 1054 gnl|Fabrus|HerceptinLC 1086
1291 gnl|Fabrus|VH6-1_IGHD2-15*01_IGHJ4*01 1056 gnl|Fabrus|HerceptinLC 1086
1292 gnl|Fabrus|VH6-1_IGHD3-3*01_IGHJ4*01 1059 gnl|Fabrus|HerceptinLC 1086
1293 gnl|Fabrus|VH6-1_IGHD4-23*01_IGHJ4*01 1061 gnl|Fabrus|HerceptinLC 1086
1294 gnl|Fabrus|VH6-1_IGHD4-11*01_IGHJ6*01 1060 gnl|Fabrus|HerceptinLC 1086
1295 gnl|Fabrus|VH6-1_IGHD5-5*01_IGHJ4*01 1062 gnl|Fabrus|HerceptinLC 1086
1296 gnl|Fabrus|VH6-1_IGHD6-13*01_IGHJ4*01 1063 gnl|Fabrus|HerceptinLC 1086
1297 gnl|Fabrus|VH6-1_IGHD6-25*01_IGHJ6*01 1064 gnl|Fabrus|HerceptinLC 1086
1298 gnl|Fabrus|VH6-1_IGHD7-27*01_IGHJ4*01 1065 gnl|Fabrus|HerceptinLC 1086
1299 gnl|Fabrus|VH4-59_IGHD6-25*01_IGHJ3*01 1043 gnl|Fabrus|HerceptinLC 1086
1300 gnl|Fabrus|VH3-48_IGHD6-6*01_IGHJ1*01 923 gnl|Fabrus|HerceptinLC 1086
1301 gnl|Fabrus|VH3-30_IGHD6-6*01_IGHJ1*01 893 gnl|Fabrus|HerceptinLC 1086
1302 gnl|Fabrus|VH3-66_IGHD6-6*01_IGHJ1*01 949 gnl|Fabrus|HerceptinLC 1086
1303 gnl|Fabrus|VH3-53_IGHD5-5*01_IGHJ4*01 938 gnl|Fabrus|HerceptinLC 1086
1304 gnl|Fabrus|VH2-5_IGHD5-12*01_IGHJ4*01 804 gnl|Fabrus|HerceptinLC 1086
1305 gnl|Fabrus|VH2-70_IGHD5-12*01_IGHJ4*01 811 gnl|Fabrus|HerceptinLC 1086
1306 gnl|Fabrus|VH3-15_IGHD5-12*01_IGHJ4*01 835 gnl|Fabrus|HerceptinLC 1086
1307 gnl|Fabrus|VH3-15_IGHD3-10*01_IGHJ4*01 833 gnl|Fabrus|HerceptinLC 1086
1308 gnl|Fabrus|VH3-49_IGHD5-18*01_IGHJ4*01 930 gnl|Fabrus|HerceptinLC 1086
1309 gnl|Fabrus|VH3-49_IGHD6-13*01_IGHJ4*01 931 gnl|Fabrus|HerceptinLC 1086
1310 gnl|Fabrus|VH3-72_IGHD5-18*01_IGHJ4*01 967 gnl|Fabrus|HerceptinLC 1086
1311 gnl|Fabrus|VH3-72_IGHD6-6*01_IGHJ1*01 969 gnl|Fabrus|HerceptinLC 1086
1312 gnl|Fabrus|VH3-73_IGHD5-12*01_IGHJ4*01 977 gnl|Fabrus|HerceptinLC 1086
1313 gnl|Fabrus|VH3-73_IGHD4-23*01_IGHJ5*01 976 gnl|Fabrus|HerceptinLC 1086
1314 gnl|Fabrus|VH3-43_IGHD3-22*01_IGHJ4*01 918 gnl|Fabrus|HerceptinLC 1086
1315 gnl|Fabrus|VH3-43_IGHD6-13*01_IGHJ4*01 921 gnl|Fabrus|HerceptinLC 1086
1316 gnl|Fabrus|VH3-9_IGHD3-22*01_IGHJ4*01 992 gnl|Fabrus|HerceptinLC 1086
1317 gnl|Fabrus|VH3-9_IGHD1-7*01_IGHJ5*01 989 gnl|Fabrus|HerceptinLC 1086
1318 gnl|Fabrus|VH3-9_IGHD6-13*01_IGHJ4*01 995 gnl|Fabrus|HerceptinLC 1086
1319 gnl|Fabrus|VH4-39_IGHD3-10*01_IGHJ4*01 1030 gnl|Fabrus|HerceptinLC 1086
1320 gnl|Fabrus|VH4-39_IGHD5-12*01_IGHJ4*01 1034 gnl|Fabrus|HerceptinLC 1086
1321 gnl|Fabrus|VH1-18_IGHD6-6*01_IGHJ1*01 728 gnl|Fabrus|HerceptinLC 1086
1322 gnl|Fabrus|VH1-24_IGHD5-12*01_IGHJ4*01 735 gnl|Fabrus|HerceptinLC 1086
1323 gnl|Fabrus|VH1-2_IGHD1-1*01_IGHJ3*01 729 gnl|Fabrus|HerceptinLC 1086
1324 gnl|Fabrus|VH1-3_IGHD6-6*01_IGHJ1*01 743 gnl|Fabrus|HerceptinLC 1086
1325 gnl|Fabrus|VH1-45_IGHD3-10*01_IGHJ4*01 748 gnl|Fabrus|HerceptinLC 1086
1326 gnl|Fabrus|VH1-46_IGHD1-26*01_IGHJ4*01 754 gnl|Fabrus|HerceptinLC 1086
1327 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ6*01 1068 gnl|Fabrus|HerceptinLC 1086
1328 gnl|Fabrus|VH2-70_IGHD3-9*01_IGHJ6*01 810 gnl|Fabrus|HerceptinLC 1086
1329 gnl|Fabrus|VH1-58_IGHD3-10*01_IGHJ6*01 764 gnl|Fabrus|HerceptinLC 1086
1330 gnl|Fabrus|VH7-81_IGHD2-21*01_IGHJ2*01 1067 gnl|Fabrus|HerceptinLC 1086
1331 gnl|Fabrus|VH4-28_IGHD3-9*01_IGHJ6*01 1002 gnl|Fabrus|HerceptinLC 1086
1332 gnl|Fabrus|VH4-31_IGHD2-15*01_IGHJ2*01 1008 gnl|Fabrus|HerceptinLC 1086
1333 gnl|Fabrus|VH2-5_IGHD3-9*01_IGHJ6*01 803 gnl|Fabrus|HerceptinLC 1086
1334 gnl|Fabrus|VH1-8_IGHD2-15*01_IGHJ6*01 783 gnl|Fabrus|HerceptinLC 1086
1335 gnl|Fabrus|VH2-70_IGHD2-15*01_IGHJ2*01 808 gnl|Fabrus|HerceptinLC 1086
1336 gnl|Fabrus|VH3-38_IGHD3-10*01_IGHJ4*01 907 gnl|Fabrus|HerceptinLC 1086
1337 gnl|Fabrus|VH3-16_IGHD1-7*01_IGHJ6*01 838 gnl|Fabrus|HerceptinLC 1086
1338 gnl|Fabrus|VH3-73_IGHD3-9*01_IGHJ6*01 974 gnl|Fabrus|HerceptinLC 1086
1339 gnl|Fabrus|VH3-11_IGHD3-9*01_IGHJ6*01 816 gnl|Fabrus|HerceptinLC 1086
1340 gnl|Fabrus|VH3-11_IGHD6-6*01_IGHJ1*01 820 gnl|Fabrus|HerceptinLC 1086
1341 gnl|Fabrus|VH3-20_IGHD5-12*01_IGHJ4*01 852 gnl|Fabrus|HerceptinLC 1086
1342 gnl|Fabrus|VH3-16_IGHD2-15*01_IGHJ2*01 839 gnl|Fabrus|HerceptinLC 1086
1343 gnl|Fabrus|VH3-7_IGHD6-6*01_IGHJ1*01 960 gnl|Fabrus|HerceptinLC 1086
1344 gnl|Fabrus|VH3-16_IGHD6-13*01_IGHJ4*01 844 gnl|Fabrus|HerceptinLC 1086
1345 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|O12_IGKJ1*01 1101
1346 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|O18_IGKJ1*01 1102
1347 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|A20_IGKJ1*01 1077
1348 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|A30_IGKJ1*01 1082
1349 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|L14_IGKJ1*01 1089
1350 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|L4/18a_IGKJ1*01 1095
1351 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|L5_IGKJ1*01 1096
1352 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|L8_IGKJ1*01 1097
1353 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|L23_IGKJ1*01 1092
1354 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|L11_IGKJ1*01 1087
1355 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|L12_IGKJ1*01 1088
1356 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|O1_IGKJ1*01 1100
1357 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|A17_IGKJ1*01 1075
1358 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|A2_IGKJ1*01 1076
1359 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|A23_IGKJ1*01 1078
1360 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|A27_IGKJ3*01 1081
1361 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|L2_IGKJ1*01 1090
1362 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|L6_IGKJ1*01 1097
1363 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|L25_IGKJ1*01 1094
1364 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|B3_IGKJ1*01 1085
1365 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|B2_IGKJ1*01 1083
1366 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|A26_IGKJ1*01 1079
1367 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|A14_IGKJ1*01 1074
1368 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|L9_IGKJ2*01 1099
1369 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|A27_IGKJ1*01 1080
1370 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|B2_IGKJ3*01 1084
1371 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|L25_IGKJ3*01 1094
1372 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|RituxanLC 1103
1373 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|L22_IGKJ3*01 1091
1374 gnl|Fabrus|VH3-23_IGHD3-10*01_IGHJ4*01 868 gnl|Fabrus|HerceptinLC 1086
1375 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|O12_IGKJ1*01 1101
1376 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|O18_IGKJ1*01 1102
1377 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|A20_IGKJ1*01 1077
1378 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|A30_IGKJ1*01 1082
1379 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|L14_IGKJ1*01 1089
1380 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|L4/18a_IGKJ1*01 1095
1381 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|L5_IGKJ1*01 1096
1382 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|L8_IGKJ1*01 1097
1383 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|L23_IGKJ1*01 1092
1384 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|L11_IGKJ1*01 1087
1385 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|L12_IGKJ1*01 1088
1386 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|O1_IGKJ1*01 1100
1387 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|A17_IGKJ1*01 1075
1388 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|A2_IGKJ1*01 1076
1389 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|A23_IGKJ1*01 1078
1390 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|A27_IGKJ3*01 1081
1391 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|L2_IGKJ1*01 1090
1392 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|L6_IGKJ1*01 1097
1393 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|L25_IGKJ1*01 1094
1394 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|B3_IGKJ1*01 1085
1395 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|B2_IGKJ1*01 1083
1396 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|A26_IGKJ1*01 1079
1397 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|A14_IGKJ1*01 1074
1398 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|L9_IGKJ2*01 1099
1399 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|A27_IGKJ1*01 1080
1400 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|B2_IGKJ3*01 1084
1401 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|L25_IGKJ3*01 1094
1402 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|RituxanLC 1103
1403 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|L22_IGKJ3*01 1091
1404 gnl|Fabrus|VH4-31_IGHD6-6*01_IGHJ1*01 1015 gnl|Fabrus|HerceptinLC 1086
1405 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|O12_IGKJ1*01 1101
1406 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|O18_IGKJ1*01 1102
1407 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|A20_IGKJ1*01 1077
1408 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|A30_IGKJ1*01 1082
1409 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|L14_IGKJ1*01 1089
1410 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|L4/18a_IGKJ1*01 1095
1411 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|L5_IGKJ1*01 1096
1412 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|L8_IGKJ1*01 1097
1413 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|L23_IGKJ1*01 1092
1414 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|L11_IGKJ1*01 1087
1415 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|L12_IGKJ1*01 1088
1416 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|O1_IGKJ1*01 1100
1417 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|A17_IGKJ1*01 1075
1418 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|A2_IGKJ1*01 1076
1419 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|A23_IGKJ1*01 1078
1420 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|A27_IGKJ3*01 1081
1421 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|L2_IGKJ1*01 1090
1422 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|L6_IGKJ1*01 1097
1423 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|L25_IGKJ1*01 1094
1424 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|B3_IGKJ1*01 1085
1425 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|B2_IGKJ1*01 1083
1426 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|A26_IGKJ1*01 1079
1427 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|A14_IGKJ1*01 1074
1428 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|L9_IGKJ2*01 1099
1429 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|A27_IGKJ1*01 1080
1430 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|B2_IGKJ3*01 1084
1431 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|L25_IGKJ3*01 1094
1432 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|RituxanLC 1103
1433 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|L22_IGKJ3*01 1091
1434 gnl|Fabrus|RituxanHC 721 gnl|Fabrus|HerceptinLC 1086
1435 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|O12_IGKJ1*01 1101
1436 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|O18_IGKJ1*01 1102
1437 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|A20_IGKJ1*01 1077
1438 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|A30_IGKJ1*01 1082
1439 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|L14_IGKJ1*01 1089
1440 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|L4/18a_IGKJ1*01 1095
1441 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|L5_IGKJ1*01 1096
1442 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|L8_IGKJ1*01 1097
1443 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|L23_IGKJ1*01 1092
1444 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|L11_IGKJ1*01 1087
1445 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|L12_IGKJ1*01 1088
1446 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|O1_IGKJ1*01 1100
1447 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|A17_IGKJ1*01 1075
1448 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|A2_IGKJ1*01 1076
1449 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|A23_IGKJ1*01 1078
1450 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|A27_IGKJ3*01 1081
1451 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|L2_IGKJ1*01 1090
1452 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|L6_IGKJ1*01 1097
1453 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|L25_IGKJ1*01 1094
1454 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|B3_IGKJ1*01 1085
1455 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|B2_IGKJ1*01 1083
1456 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|A26_IGKJ1*01 1079
1457 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|A14_IGKJ1*01 1074
1458 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|L9_IGKJ2*01 1099
1459 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|A27_IGKJ1*01 1080
1460 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|B2_IGKJ3*01 1084
1461 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|L25_IGKJ3*01 1094
1462 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|RituxanLC 1103
1463 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|L22_IGKJ3*01 1091
1464 gnl|Fabrus|HerceptinHC 720 gnl|Fabrus|HerceptinLC 1086
1465 VH3-23_IGHD1-1*01>1_IGHJ1*01 1136 gnl|Fabrus|O12_IGKJ1*01 1101
1466 VH3-23_IGHD1-1*01>2_IGHJ1*01 1137 gnl|Fabrus|O12_IGKJ1*01 1101
1467 VH3-23_IGHD1-1*01>3_IGHJ1*01 1138 gnl|Fabrus|O12_IGKJ1*01 1101
1468 VH3-23_IGHD1-7*01>1_IGHJ1*01 1139 gnl|Fabrus|O12_IGKJ1*01 1101
1469 VH3-23_IGHD1-7*01>3_IGHJ1*01 1140 gnl|Fabrus|O12_IGKJ1*01 1101
1470 VH3-23_IGHD1-14*01>1_IGHJ1*01 1141 gnl|Fabrus|O12_IGKJ1*01 1101
1471 VH3-23_IGHD1-14*01>3_IGHJ1*01 1142 gnl|Fabrus|O12_IGKJ1*01 1101
1472 VH3-23_IGHD1-20*01>1_IGHJ1*01 1143 gnl|Fabrus|O12_IGKJ1*01 1101
1473 VH3-23_IGHD1-20*01>3_IGHJ1*01 1144 gnl|Fabrus|O12_IGKJ1*01 1101
1474 VH3-23_IGHD1-26*01>1_IGHJ1*01 1145 gnl|Fabrus|O12_IGKJ1*01 1101
1475 VH3-23_IGHD1-26*01>3_IGHJ1*01 1146 gnl|Fabrus|O12_IGKJ1*01 1101
1476 VH3-23_IGHD2-2*01>2_IGHJ1*01 1147 gnl|Fabrus|O12_IGKJ1*01 1101
1477 VH3-23_IGHD2-2*01>3_IGHJ1*01 1148 gnl|Fabrus|O12_IGKJ1*01 1101
1478 VH3-23_IGHD2-8*01>2_IGHJ1*01 1149 gnl|Fabrus|O12_IGKJ1*01 1101
1479 VH3-23_IGHD2-8*01>3_IGHJ1*01 1150 gnl|Fabrus|O12_IGKJ1*01 1101
1480 VH3-23_IGHD2-15*01>2_IGHJ1*01 1151 gnl|Fabrus|O12_IGKJ1*01 1101
1481 VH3-23_IGHD2-15*01>3_IGHJ1*01 1152 gnl|Fabrus|O12_IGKJ1*01 1101
1482 VH3-23_IGHD2-21*01>2_IGHJ1*01 1153 gnl|Fabrus|O12_IGKJ1*01 1101
1483 VH3-23_IGHD2-21*01>3_IGHJ1*01 1154 gnl|Fabrus|O12_IGKJ1*01 1101
1484 VH3-23_IGHD3-3*01>1_IGHJ1*01 1155 gnl|Fabrus|O12_IGKJ1*01 1101
1485 VH3-23_IGHD3-3*01>2_IGHJ1*01 1156 gnl|Fabrus|O12_IGKJ1*01 1101
1486 VH3-23_IGHD3-3*01>3_IGHJ1*01 1157 gnl|Fabrus|O12_IGKJ1*01 1101
1487 VH3-23_IGHD3-9*01>2_IGHJ1*01 1158 gnl|Fabrus|O12_IGKJ1*01 1101
1488 VH3-23_IGHD3-10*01>2_IGHJ1*01 1159 gnl|Fabrus|O12_IGKJ1*01 1101
1489 VH3-23_IGHD3-10*01>3_IGHJ1*01 1160 gnl|Fabrus|O12_IGKJ1*01 1101
1490 VH3-23_IGHD3-16*01>2_IGHJ1*01 1161 gnl|Fabrus|O12_IGKJ1*01 1101
1491 VH3-23_IGHD3-16*01>3_IGHJ1*01 1162 gnl|Fabrus|O12_IGKJ1*01 1101
1492 VH3-23_IGHD3-22*01>2_IGHJ1*01 1163 gnl|Fabrus|O12_IGKJ1*01 1101
1493 VH3-23_IGHD3-22*01>3_IGHJ1*01 1164 gnl|Fabrus|O12_IGKJ1*01 1101
1494 VH3-23_IGHD4-4*01 (1) >2_IGHJ1*01 1165 gnl|Fabrus|O12_IGKJ1*01 1101
1495 VH3-23_IGHD4-4*01 (1) >3_IGHJ1*01 1166 gnl|Fabrus|O12_IGKJ1*01 1101
1496 VH3-23_IGHD4-11*01 (1) >2_IGHJ1*01 1167 gnl|Fabrus|O12_IGKJ1*01 1101
1497 VH3-23_IGHD4-11*01 (1) >3_IGHJ1*01 1168 gnl|Fabrus|O12_IGKJ1*01 1101
1498 VH3-23_IGHD4-17*01>2_IGHJ1*01 1169 gnl|Fabrus|O12_IGKJ1*01 1101
1499 VH3-23_IGHD4-17*01>3_IGHJ1*01 1170 gnl|Fabrus|O12_IGKJ1*01 1101
1500 VH3-23_IGHD4-23*01>2_IGHJ1*01 1171 gnl|Fabrus|O12_IGKJ1*01 1101
1501 VH3-23_IGHD4-23*01>3_IGHJ1*01 1172 gnl|Fabrus|O12_IGKJ1*01 1101
1502 VH3-23_IGHD5-5*01 (2) >1_IGHJ1*01 1173 gnl|Fabrus|O12_IGKJ1*01 1101
1503 VH3-23_IGHD5-5*01 (2) >2_IGHJ1*01 1174 gnl|Fabrus|O12_IGKJ1*01 1101
1504 VH3-23_IGHD5-5*01 (2) >3_IGHJ1*01 1175 gnl|Fabrus|O12_IGKJ1*01 1101
1505 VH3-23_IGHD5-12*01>1_IGHJ1*01 1176 gnl|Fabrus|O12_IGKJ1*01 1101
1506 VH3-23_IGHD5-12*01>3_IGHJ1*01 1177 gnl|Fabrus|O12_IGKJ1*01 1101
1507 VH3-23_IGHD5-18*01 (2) >1_IGHJ1*01 1178 gnl|Fabrus|O12_IGKJ1*01 1101
1508 VH3-23_IGHD5-18*01 (2) >2_IGHJ1*01 1179 gnl|Fabrus|O12_IGKJ1*01 1101
1509 VH3-23_IGHD5-18*01 (2) >3_IGHJ1*01 1180 gnl|Fabrus|O12_IGKJ1*01 1101
1510 VH3-23_IGHD5-24*01>1_IGHJ1*01 1181 gnl|Fabrus|O12_IGKJ1*01 1101
1511 VH3-23_IGHD5-24*01>3_IGHJ1*01 1182 gnl|Fabrus|O12_IGKJ1*01 1101
1512 VH3-23_IGHD6-6*01>1_IGHJ1*01 1183 gnl|Fabrus|O12_IGKJ1*01 1101
1513 VH3-23_IGHD1-1*01>1′_IGHJ1*01 1193 gnl|Fabrus|O12_IGKJ1*01 1101
1514 VH3-23_IGHD1-1*01>2′_IGHJ1*01 1194 gnl|Fabrus|O12_IGKJ1*01 1101
1515 VH3-23_IGHD1-1*01>3′_IGHJ1*01 1195 gnl|Fabrus|O12_IGKJ1*01 1101
1516 VH3-23_IGHD1-7*01>1′_IGHJ1*01 1196 gnl|Fabrus|O12_IGKJ1*01 1101
1517 VH3-23_IGHD1-7*01>3′_IGHJ1*01 1197 gnl|Fabrus|O12_IGKJ1*01 1101
1518 VH3-23_IGHD1-14*01>1′_IGHJ1*01 1198 gnl|Fabrus|O12_IGKJ1*01 1101
1519 VH3-23_IGHD1-14*01>2′_IGHJ1*01 1199 gnl|Fabrus|O12_IGKJ1*01 1101
1520 VH3-23_IGHD1-14*01>3′_IGHJ1*01 1200 gnl|Fabrus|O12_IGKJ1*01 1101
1521 VH3-23_IGHD1-20*01>1′_IGHJ1*01 1201 gnl|Fabrus|O12_IGKJ1*01 1101
1522 VH3-23_IGHD1-20*01>2′_IGHJ1*01 1202 gnl|Fabrus|O12_IGKJ1*01 1101
1523 VH3-23_IGHD1-20*01>3′_IGHJ1*01 1203 gnl|Fabrus|O12_IGKJ1*01 1101
1524 VH3-23_IGHD1-26*01>1′_IGHJ1*01 1204 gnl|Fabrus|O12_IGKJ1*01 1101
1525 VH3-23_IGHD1-26*01>3′_IGHJ1*01 1205 gnl|Fabrus|O12_IGKJ1*01 1101
1526 VH3-23_IGHD2-2*01>1′_IGHJ1*01 1206 gnl|Fabrus|O12_IGKJ1*01 1101
1527 VH3-23_IGHD2-2*01>3′_IGHJ1*01 1207 gnl|Fabrus|O12_IGKJ1*01 1101
1528 VH3-23_IGHD2-8*01>1′_IGHJ1*01 1208 gnl|Fabrus|O12_IGKJ1*01 1101
1529 VH3-23_IGHD2-15*01>1′_IGHJ1*01 1209 gnl|Fabrus|O12_IGKJ1*01 1101
1530 VH3-23_IGHD2-15*01>3′_IGHJ1*01 1210 gnl|Fabrus|O12_IGKJ1*01 1101
1531 VH3-23_IGHD2-21*01>1′_IGHJ1*01 1211 gnl|Fabrus|O12_IGKJ1*01 1101
1532 VH3-23_IGHD2-21*01>3′_IGHJ1*01 1212 gnl|Fabrus|O12_IGKJ1*01 1101
1533 VH3-23_IGHD3-3*01>1′_IGHJ1*01 1213 gnl|Fabrus|O12_IGKJ1*01 1101
1534 VH3-23_IGHD3-3*01>3′_IGHJ1*01 1214 gnl|Fabrus|O12_IGKJ1*01 1101
1535 VH3-23_IGHD3-9*01>1′_IGHJ1*01 1215 gnl|Fabrus|O12_IGKJ1*01 1101
1536 VH3-23_IGHD3-9*01>3′_IGHJ1*01 1216 gnl|Fabrus|O12_IGKJ1*01 1101
1537 VH3-23_IGHD3-10*01>1′_IGHJ1*01 1217 gnl|Fabrus|O12_IGKJ1*01 1101
1538 VH3-23_IGHD3-10*01>3′_IGHJ1*01 1218 gnl|Fabrus|O12_IGKJ1*01 1101
1539 VH3-23_IGHD3-16*01>1′_IGHJ1*01 1219 gnl|Fabrus|O12_IGKJ1*01 1101
1540 VH3-23_IGHD3-16*01>3′_IGHJ1*01 1220 gnl|Fabrus|O12_IGKJ1*01 1101
1541 VH3-23_IGHD3-22*01>1′_IGHJ1*01 1221 gnl|Fabrus|O12_IGKJ1*01 1101
1542 VH3-23_IGHD4-4*01 (1) >1′_IGHJ1*01 1222 gnl|Fabrus|O12_IGKJ1*01 1101
1543 VH3-23_IGHD4-4*01 (1) >3′_IGHJ1*01 1223 gnl|Fabrus|O12_IGKJ1*01 1101
1544 VH3-23_IGHD4-11*01 (1) >1′_IGHJ1*01 1224 gnl|Fabrus|O12_IGKJ1*01 1101
1545 VH3-23_IGHD4-11*01 (1) >3′_IGHJ1*01 1225 gnl|Fabrus|O12_IGKJ1*01 1101
1546 VH3-23_IGHD4-17*01>1′_IGHJ1*01 1226 gnl|Fabrus|O12_IGKJ1*01 1101
1547 VH3-23_IGHD4-17*01>3′_IGHJ1*01 1227 gnl|Fabrus|O12_IGKJ1*01 1101
1548 VH3-23_IGHD4-23*01>1′_IGHJ1*01 1228 gnl|Fabrus|O12_IGKJ1*01 1101
1549 VH3-23_IGHD4-23*01>3′_IGHJ1*01 1229 gnl|Fabrus|O12_IGKJ1*01 1101
1550 VH3-23_IGHD5-5*01 (2) >1′_IGHJ1*01 1230 gnl|Fabrus|O12_IGKJ1*01 1101
1551 VH3-23_IGHD5-5*01 (2) >3′_IGHJ1*01 1231 gnl|Fabrus|O12_IGKJ1*01 1101
1552 VH3-23_IGHD5-12*01>1′_IGHJ1*01 1232 gnl|Fabrus|O12_IGKJ1*01 1101
1553 VH3-23_IGHD5-12*01>3′_IGHJ1*01 1233 gnl|Fabrus|O12_IGKJ1*01 1101
1554 VH3-23_IGHD5-18*01 (2) >1′_IGHJ1*01 1234 gnl|Fabrus|O12_IGKJ1*01 1101
1555 VH3-23_IGHD5-18*01 (2) >3′_IGHJ1*01 1235 gnl|Fabrus|O12_IGKJ1*01 1101
1556 VH3-23_IGHD5-24*01>1′_IGHJ1*01 1236 gnl|Fabrus|O12_IGKJ1*01 1101
1557 VH3-23_IGHD5-24*01>3′_IGHJ1*01 1237 gnl|Fabrus|O12_IGKJ1*01 1101
1558 VH3-23_IGHD6-6*01>1′_IGHJ1*01 1238 gnl|Fabrus|O12_IGKJ1*01 1101
1559 VH3-23_IGHD6-6*01>2′_IGHJ1*01 1239 gnl|Fabrus|O12_IGKJ1*01 1101
1560 VH3-23_IGHD6-6*01>3′_IGHJ1*01 1240 gnl|Fabrus|O12_IGKJ1*01 1101
1561 VH3-23_IGHD6-6*01>2_IGHJ1*01 1184 gnl|Fabrus|O12_IGKJ1*01 1101
1562 VH3-23_IGHD6-13*01>1_IGHJ1*01 1185 gnl|Fabrus|O12_IGKJ1*01 1101
1563 VH3-23_IGHD6-13*01>2_IGHJ1*01 1186 gnl|Fabrus|O12_IGKJ1*01 1101
1564 VH3-23_IGHD6-19*01>1_IGHJ1*01 1187 gnl|Fabrus|O12_IGKJ1*01 1101
1565 VH3-23_IGHD6-19*01>2_IGHJ1*01 1188 gnl|Fabrus|O12_IGKJ1*01 1101
1566 VH3-23_IGHD6-25*01>1_IGHJ1*01 1189 gnl|Fabrus|O12_IGKJ1*01 1101
1567 VH3-23_IGHD6-25*01>2_IGHJ1*01 1190 gnl|Fabrus|O12_IGKJ1*01 1101
1568 VH3-23_IGHD7-27*01>1_IGHJ1*01 1191 gnl|Fabrus|O12_IGKJ1*01 1101
1569 VH3-23_IGHD7-27*01>3_IGHJ1*01 1192 gnl|Fabrus|O12_IGKJ1*01 1101
1570 VH3-23_IGHD6-13*01>1′_IGHJ1*01 1241 gnl|Fabrus|O12_IGKJ1*01 1101
1571 VH3-23_IGHD6-13*01>2′_IGHJ1*01 1242 gnl|Fabrus|O12_IGKJ1*01 1101
1572 VH3-23_IGHD6-13*01>2_IGHJ1*01_B 1243 gnl|Fabrus|O12_IGKJ1*01 1101
1573 VH3-23_IGHD6-19*01>1′_IGHJ1*01 1244 gnl|Fabrus|O12_IGKJ1*01 1101
1574 VH3-23_IGHD6-19*01>2′_IGHJ1*01 1245 gnl|Fabrus|O12_IGKJ1*01 1101
1575 VH3-23_IGHD6-19*01>2_IGHJ1*01_B 1246 gnl|Fabrus|O12_IGKJ1*01 1101
1576 VH3-23_IGHD6-25*01>1′_IGHJ1*01 1247 gnl|Fabrus|O12_IGKJ1*01 1101
1577 VH3-23_IGHD6-25*01>3′_IGHJ1*01 1248 gnl|Fabrus|O12_IGKJ1*01 1101
1578 VH3-23_IGHD7-27*01>1′_IGHJ1*01_B 1249 gnl|Fabrus|O12_IGKJ1*01 1101
1579 VH3-23_IGHD7-27*01>2′_IGHJ2*01 1250 gnl|Fabrus|O12_IGKJ1*01 1101
1580 VH3-23_IGHD1-1*01>1_IGHJ2*01 1251 gnl|Fabrus|O12_IGKJ1*01 1101
1581 VH3-23_IGHD1-1*01>2_IGHJ2*01 1252 gnl|Fabrus|O12_IGKJ1*01 1101
1582 VH3-23_IGHD1-1*01>3_IGHJ2*01 1253 gnl|Fabrus|O12_IGKJ1*01 1101
1583 VH3-23_IGHD1-7*01>1_IGHJ2*01 1254 gnl|Fabrus|O12_IGKJ1*01 1101
1584 VH3-23_IGHD1-7*01>3_IGHJ2*01 1255 gnl|Fabrus|O12_IGKJ1*01 1101
1585 VH3-23_IGHD1-14*01>1_IGHJ2*01 1256 gnl|Fabrus|O12_IGKJ1*01 1101
1586 VH3-23_IGHD1-14*01>3_IGHJ2*01 1257 gnl|Fabrus|O12_IGKJ1*01 1101
1587 VH3-23_IGHD1-20*01>1_IGHJ2*01 1258 gnl|Fabrus|O12_IGKJ1*01 1101
1588 VH3-23_IGHD1-20*01>3_IGHJ2*01 1259 gnl|Fabrus|O12_IGKJ1*01 1101
1589 VH3-23_IGHD1-26*01>1_IGHJ2*01 1260 gnl|Fabrus|O12_IGKJ1*01 1101
1590 VH3-23_IGHD1-26*01>3_IGHJ2*01 1261 gnl|Fabrus|O12_IGKJ1*01 1101
1591 VH3-23_IGHD2-2*01>2_IGHJ2*01 1262 gnl|Fabrus|O12_IGKJ1*01 1101
1592 VH3-23_IGHD2-2*01>3_IGHJ2*01 1263 gnl|Fabrus|O12_IGKJ1*01 1101
1593 VH3-23_IGHD2-8*01>2_IGHJ2*01 1264 gnl|Fabrus|O12_IGKJ1*01 1101
1594 VH3-23_IGHD2-8*01>3_IGHJ2*01 1265 gnl|Fabrus|O12_IGKJ1*01 1101
1595 VH3-23_IGHD2-15*01>2_IGHJ2*01 1266 gnl|Fabrus|O12_IGKJ1*01 1101
1596 VH3-23_IGHD2-15*01>3_IGHJ2*01 1267 gnl|Fabrus|O12_IGKJ1*01 1101
1597 VH3-23_IGHD2-21*01>2_IGHJ2*01 1268 gnl|Fabrus|O12_IGKJ1*01 1101
1598 VH3-23_IGHD2-21*01>3_IGHJ2*01 1269 gnl|Fabrus|O12_IGKJ1*01 1101
1599 VH3-23_IGHD3-3*01>1_IGHJ2*01 1270 gnl|Fabrus|O12_IGKJ1*01 1101
1600 VH3-23_IGHD3-3*01>2_IGHJ2*01 1271 gnl|Fabrus|O12_IGKJ1*01 1101
1601 VH3-23_IGHD3-3*01>3_IGHJ2*01 1272 gnl|Fabrus|O12_IGKJ1*01 1101
1602 VH3-23_IGHD3-9*01>2_IGHJ2*01 1273 gnl|Fabrus|O12_IGKJ1*01 1101
1603 VH3-23_IGHD3-10*01>2_IGHJ2*01 1274 gnl|Fabrus|O12_IGKJ1*01 1101
1604 VH3-23_IGHD3-10*01>3_IGHJ2*01 1275 gnl|Fabrus|O12_IGKJ1*01 1101
1605 VH3-23_IGHD3-16*01>2_IGHJ2*01 1276 gnl|Fabrus|O12_IGKJ1*01 1101
1606 VH3-23_IGHD3-16*01>3_IGHJ2*01 1277 gnl|Fabrus|O12_IGKJ1*01 1101
1607 VH3-23_IGHD3-22*01>2_IGHJ2*01 1278 gnl|Fabrus|O12_IGKJ1*01 1101
1608 VH3-23_IGHD3-22*01>3_IGHJ2*01 1279 gnl|Fabrus|O12_IGKJ1*01 1101
1609 VH3-23_IGHD4-4*01 (1) >2_IGHJ2*01 1280 gnl|Fabrus|O12_IGKJ1*01 1101
1610 VH3-23_IGHD4-4*01 (1) >3_IGHJ2*01 1281 gnl|Fabrus|O12_IGKJ1*01 1101
1611 VH3-23_IGHD4-11*01 (1) >2_IGHJ2*01 1282 gnl|Fabrus|O12_IGKJ1*01 1101
1612 VH3-23_IGHD4-11*01 (1) >3_IGHJ2*01 1283 gnl|Fabrus|O12_IGKJ1*01 1101
1613 VH3-23_IGHD4-17*01>2_IGHJ2*01 1284 gnl|Fabrus|O12_IGKJ1*01 1101
1614 VH3-23_IGHD4-17*01>3_IGHJ2*01 1285 gnl|Fabrus|O12_IGKJ1*01 1101
1615 VH3-23_IGHD4-23*01>2_IGHJ2*01 1286 gnl|Fabrus|O12_IGKJ1*01 1101
1616 VH3-23_IGHD4-23*01>3_IGHJ2*01 1287 gnl|Fabrus|O12_IGKJ1*01 1101
1617 VH3-23_IGHD5-5*01 (2) >1_IGHJ2*01 1288 gnl|Fabrus|O12_IGKJ1*01 1101
1618 VH3-23_IGHD5-5*01 (2) >2_IGHJ2*01 1289 gnl|Fabrus|O12_IGKJ1*01 1101
1619 VH3-23_IGHD5-5*01 (2) >3_IGHJ2*01 1290 gnl|Fabrus|O12_IGKJ1*01 1101
1620 VH3-23_IGHD5-12*01>1_IGHJ2*01 1291 gnl|Fabrus|O12_IGKJ1*01 1101
1621 VH3-23_IGHD5-12*01>3_IGHJ2*01 1292 gnl|Fabrus|O12_IGKJ1*01 1101
1622 VH3-23_IGHD5-18*01 (2) >1_IGHJ2*01 1293 gnl|Fabrus|O12_IGKJ1*01 1101
1623 VH3-23_IGHD5-18*01 (2) >2_IGHJ2*01 1294 gnl|Fabrus|O12_IGKJ1*01 1101
1624 VH3-23_IGHD5-18*01 (2) >3_IGHJ2*01 1295 gnl|Fabrus|O12_IGKJ1*01 1101
1625 VH3-23_IGHD5-24*01>1_IGHJ2*01 1296 gnl|Fabrus|O12_IGKJ1*01 1101
1626 VH3-23_IGHD5-24*01>3_IGHJ2*01 1297 gnl|Fabrus|O12_IGKJ1*01 1101
1627 VH3-23_IGHD6-6*01>1_IGHJ2*01 1298 gnl|Fabrus|O12_IGKJ1*01 1101
1628 VH3-23_IGHD1-1*01>1′_IGHJ2*01 1308 gnl|Fabrus|O12_IGKJ1*01 1101
1629 VH3-23_IGHD1-1*01>2′_IGHJ2*01 1309 gnl|Fabrus|O12_IGKJ1*01 1101
1630 VH3-23_IGHD1-1*01>3′_IGHJ2*01 1310 gnl|Fabrus|O12_IGKJ1*01 1101
1631 VH3-23_IGHD1-7*01>1′_IGHJ2*01 1311 gnl|Fabrus|O12_IGKJ1*01 1101
1632 VH3-23_IGHD1-7*01>3′_IGHJ2*01 1312 gnl|Fabrus|O12_IGKJ1*01 1101
1633 VH3-23_IGHD1-14*01>1′_IGHJ2*01 1313 gnl|Fabrus|O12_IGKJ1*01 1101
1634 VH3-23_IGHD1-14*01>2′_IGHJ2*01 1314 gnl|Fabrus|O12_IGKJ1*01 1101
1635 VH3-23_IGHD1-14*01>3′_IGHJ2*01 1315 gnl|Fabrus|O12_IGKJ1*01 1101
1636 VH3-23_IGHD1-20*01>1′_IGHJ2*01 1316 gnl|Fabrus|O12_IGKJ1*01 1101
1637 VH3-23_IGHD1-20*01>2′_IGHJ2*01 1317 gnl|Fabrus|O12_IGKJ1*01 1101
1638 VH3-23_IGHD1-20*01>3′_IGHJ2*01 1318 gnl|Fabrus|O12_IGKJ1*01 1101
1639 VH3-23_IGHD1-26*01>1′_IGHJ2*01 1319 gnl|Fabrus|O12_IGKJ1*01 1101
1640 VH3-23_IGHD1-26*01>1_IGHJ2*01_B 1320 gnl|Fabrus|O12_IGKJ1*01 1101
1641 VH3-23_IGHD2-2*01>1′_IGHJ2*01 1321 gnl|Fabrus|O12_IGKJ1*01 1101
1642 VH3-23_IGHD2-2*01>3′_IGHJ2*01 1322 gnl|Fabrus|O12_IGKJ1*01 1101
1643 VH3-23_IGHD2-8*01>1′_IGHJ2*01 1323 gnl|Fabrus|O12_IGKJ1*01 1101
1644 VH3-23_IGHD2-15*01>1′_IGHJ2*01 1324 gnl|Fabrus|O12_IGKJ1*01 1101
1645 VH3-23_IGHD2-15*01>3′_IGHJ2*01 1325 gnl|Fabrus|O12_IGKJ1*01 1101
1646 VH3-23_IGHD2-21*01>1′_IGHJ2*01 1326 gnl|Fabrus|O12_IGKJ1*01 1101
1647 VH3-23_IGHD2-21*01>3′_IGHJ2*01 1327 gnl|Fabrus|O12_IGKJ1*01 1101
1648 VH3-23_IGHD3-3*01>1′_IGHJ2*01 1328 gnl|Fabrus|O12_IGKJ1*01 1101
1649 VH3-23_IGHD3-3*01>3′_IGHJ2*01 1329 gnl|Fabrus|O12_IGKJ1*01 1101
1650 VH3-23_IGHD3-9*01>1′_IGHJ2*01 1330 gnl|Fabrus|O12_IGKJ1*01 1101
1651 VH3-23_IGHD3-9*01>3′_IGHJ2*01 1331 gnl|Fabrus|O12_IGKJ1*01 1101
1652 VH3-23_IGHD3-10*01>1′_IGHJ2*01 1332 gnl|Fabrus|O12_IGKJ1*01 1101
1653 VH3-23_IGHD3-10*01>3′_IGHJ2*01 1333 gnl|Fabrus|O12_IGKJ1*01 1101
1654 VH3-23_IGHD3-16*01>1′_IGHJ2*01 1334 gnl|Fabrus|O12_IGKJ1*01 1101
1655 VH3-23_IGHD3-16*01>3′_IGHJ2*01 1335 gnl|Fabrus|O12_IGKJ1*01 1101
1656 VH3-23_IGHD3-22*01>1′_IGHJ2*01 1336 gnl|Fabrus|O12_IGKJ1*01 1101
1657 VH3-23_IGHD4-4*01 (1) >1′_IGHJ2*01 1337 gnl|Fabrus|O12_IGKJ1*01 1101
1658 VH3-23_IGHD4-4*01 (1) >3′_IGHJ2*01 1338 gnl|Fabrus|O12_IGKJ1*01 1101
1659 VH3-23_IGHD4-11*01 (1) >1′_IGHJ2*01 1339 gnl|Fabrus|O12_IGKJ1*01 1101
1660 VH3-23_IGHD4-11*01 (1) >3′_IGHJ2*01 1340 gnl|Fabrus|O12_IGKJ1*01 1101
1661 VH3-23_IGHD4-17*01>1′_IGHJ2*01 1341 gnl|Fabrus|O12_IGKJ1*01 1101
1662 VH3-23_IGHD4-17*01>3′_IGHJ2*01 1342 gnl|Fabrus|O12_IGKJ1*01 1101
1663 VH3-23_IGHD4-23*01>1′_IGHJ2*01 1343 gnl|Fabrus|O12_IGKJ1*01 1101
1664 VH3-23_IGHD4-23*01>3′_IGHJ2*01 1344 gnl|Fabrus|O12_IGKJ1*01 1101
1665 VH3-23_IGHD5-5*01 (2) >1′_IGHJ2*01 1345 gnl|Fabrus|O12_IGKJ1*01 1101
1666 VH3-23_IGHD5-5*01 (2) >3′_IGHJ2*01 1346 gnl|Fabrus|O12_IGKJ1*01 1101
1667 VH3-23_IGHD5-12*01>1′_IGHJ2*01 1347 gnl|Fabrus|O12_IGKJ1*01 1101
1668 VH3-23_IGHD5-12*01>3′_IGHJ2*01 1348 gnl|Fabrus|O12_IGKJ1*01 1101
1669 VH3-23_IGHD5-18*01 (2) >1′_IGHJ2*01 1349 gnl|Fabrus|O12_IGKJ1*01 1101
1670 VH3-23_IGHD5-18*01 (2) >3′_IGHJ2*01 1350 gnl|Fabrus|O12_IGKJ1*01 1101
1671 VH3-23_IGHD5-24*01>1′_IGHJ2*01 1351 gnl|Fabrus|O12_IGKJ1*01 1101
1672 VH3-23_IGHD5-24*01>3′_IGHJ2*01 1352 gnl|Fabrus|O12_IGKJ1*01 1101
1673 VH3-23_IGHD6-6*01>1′_IGHJ2*01 1353 gnl|Fabrus|O12_IGKJ1*01 1101
1674 VH3-23_IGHD6-6*01>2′_IGHJ2*01 1354 gnl|Fabrus|O12_IGKJ1*01 1101
1675 VH3-23_IGHD6-6*01>3′_IGHJ2*01 1355 gnl|Fabrus|O12_IGKJ1*01 1101
1676 VH3-23_IGHD6-6*01>2_IGHJ2*01 1299 gnl|Fabrus|O12_IGKJ1*01 1101
1677 VH3-23_IGHD6-13*01>1_IGHJ2*01 1300 gnl|Fabrus|O12_IGKJ1*01 1101
1678 VH3-23_IGHD6-13*01>2_IGHJ2*01 1301 gnl|Fabrus|O12_IGKJ1*01 1101
1679 VH3-23_IGHD6-19*01>1_IGHJ2*01 1302 gnl|Fabrus|O12_IGKJ1*01 1101
1680 VH3-23_IGHD6-19*01>2_IGHJ2*01 1303 gnl|Fabrus|O12_IGKJ1*01 1101
1681 VH3-23_IGHD6-25*01>1_IGHJ2*01 1304 gnl|Fabrus|O12_IGKJ1*01 1101
1682 VH3-23_IGHD6-25*01>2_IGHJ2*01 1305 gnl|Fabrus|O12_IGKJ1*01 1101
1683 VH3-23_IGHD7-27*01>1_IGHJ2*01 1306 gnl|Fabrus|O12_IGKJ1*01 1101
1684 VH3-23_IGHD7-27*01>3_IGHJ2*01 1307 gnl|Fabrus|O12_IGKJ1*01 1101
1685 VH3-23_IGHD6-13*01>1′_IGHJ2*01 1356 gnl|Fabrus|O12_IGKJ1*01 1101
1686 VH3-23_IGHD6-13*01>2′_IGHJ2*01 1357 gnl|Fabrus|O12_IGKJ1*01 1101
1687 VH3-23_IGHD6-13*01>2_IGHJ2*01_B 1358 gnl|Fabrus|O12_IGKJ1*01 1101
1688 VH3-23_IGHD6-19*01>1′_IGHJ2*01 1359 gnl|Fabrus|O12_IGKJ1*01 1101
1689 VH3-23_IGHD6-19*01>2′_IGHJ2*01 1360 gnl|Fabrus|O12_IGKJ1*01 1101
1690 VH3-23_IGHD6-19*01>2_IGHJ2*01_B 1361 gnl|Fabrus|O12_IGKJ1*01 1101
1691 VH3-23_IGHD6-25*01>1′_IGHJ2*01 1362 gnl|Fabrus|O12_IGKJ1*01 1101
1692 VH3-23_IGHD6-25*01>3′_IGHJ2*01 1363 gnl|Fabrus|O12_IGKJ1*01 1101
1693 VH3-23_IGHD7-27*01>1′_IGHJ2*01 1364 gnl|Fabrus|O12_IGKJ1*01 1101
1694 VH3-23_IGHD7-27*01>2′_IGHJ2*01 1365 gnl|Fabrus|O12_IGKJ1*01 1101
1695 VH3-23_IGHD1-1*01>1_IGHJ3*01 1366 gnl|Fabrus|O12_IGKJ1*01 1101
1696 VH3-23_IGHD1-1*01>2_IGHJ3*01 1367 gnl|Fabrus|O12_IGKJ1*01 1101
1697 VH3-23_IGHD1-1*01>3_IGHJ3*01 1368 gnl|Fabrus|O12_IGKJ1*01 1101
1698 VH3-23_IGHD1-7*01>1_IGHJ3*01 1369 gnl|Fabrus|O12_IGKJ1*01 1101
1699 VH3-23_IGHD1-7*01>3_IGHJ3*01 1370 gnl|Fabrus|O12_IGKJ1*01 1101
1700 VH3-23_IGHD1-14*01>1_IGHJ3*01 1371 gnl|Fabrus|O12_IGKJ1*01 1101
1701 VH3-23_IGHD1-14*01>3_IGHJ3*01 1372 gnl|Fabrus|O12_IGKJ1*01 1101
1702 VH3-23_IGHD1-20*01>1_IGHJ3*01 1373 gnl|Fabrus|O12_IGKJ1*01 1101
1703 VH3-23_IGHD1-20*01>3_IGHJ3*01 1374 gnl|Fabrus|O12_IGKJ1*01 1101
1704 VH3-23_IGHD1-26*01>1_IGHJ3*01 1375 gnl|Fabrus|O12_IGKJ1*01 1101
1705 VH3-23_IGHD1-26*01>3_IGHJ3*01 1376 gnl|Fabrus|O12_IGKJ1*01 1101
1706 VH3-23_IGHD2-2*01>2_IGHJ3*01 1377 gnl|Fabrus|O12_IGKJ1*01 1101
1707 VH3-23_IGHD2-2*01>3_IGHJ3*01 1378 gnl|Fabrus|O12_IGKJ1*01 1101
1708 VH3-23_IGHD2-8*01>2_IGHJ3*01 1379 gnl|Fabrus|O12_IGKJ1*01 1101
1709 VH3-23_IGHD2-8*01>3_IGHJ3*01 1380 gnl|Fabrus|O12_IGKJ1*01 1101
1710 VH3-23_IGHD2-15*01>2_IGHJ3*01 1381 gnl|Fabrus|O12_IGKJ1*01 1101
1711 VH3-23_IGHD2-15*01>3_IGHJ3*01 1382 gnl|Fabrus|O12_IGKJ1*01 1101
1712 VH3-23_IGHD2-21*01>2_IGHJ3*01 1383 gnl|Fabrus|O12_IGKJ1*01 1101
1713 VH3-23_IGHD2-21*01>3_IGHJ3*01 1384 gnl|Fabrus|O12_IGKJ1*01 1101
1714 VH3-23_IGHD3-3*01>1_IGHJ3*01 1385 gnl|Fabrus|O12_IGKJ1*01 1101
1715 VH3-23_IGHD3-3*01>2_IGHJ3*01 1386 gnl|Fabrus|O12_IGKJ1*01 1101
1716 VH3-23_IGHD3-3*01>3_IGHJ3*01 1387 gnl|Fabrus|O12_IGKJ1*01 1101
1717 VH3-23_IGHD3-9*01>2_IGHJ3*01 1388 gnl|Fabrus|O12_IGKJ1*01 1101
1718 VH3-23_IGHD3-10*01>2_IGHJ3*01 1389 gnl|Fabrus|O12_IGKJ1*01 1101
1719 VH3-23_IGHD3-10*01>3_IGHJ3*01 1390 gnl|Fabrus|O12_IGKJ1*01 1101
1720 VH3-23_IGHD3-16*01>2_IGHJ3*01 1391 gnl|Fabrus|O12_IGKJ1*01 1101
1721 VH3-23_IGHD3-16*01>3_IGHJ3*01 1392 gnl|Fabrus|O12_IGKJ1*01 1101
1722 VH3-23_IGHD3-22*01>2_IGHJ3*01 1393 gnl|Fabrus|O12_IGKJ1*01 1101
1723 VH3-23_IGHD3-22*01>3_IGHJ3*01 1394 gnl|Fabrus|O12_IGKJ1*01 1101
1724 VH3-23_IGHD4-4*01 (1) >2_IGHJ3*01 1395 gnl|Fabrus|O12_IGKJ1*01 1101
1725 VH3-23_IGHD4-4*01 (1) >3_IGHJ3*01 1396 gnl|Fabrus|O12_IGKJ1*01 1101
1726 VH3-23_IGHD4-11*01 (1) >2_IGHJ3*01 1397 gnl|Fabrus|O12_IGKJ1*01 1101
1727 VH3-23_IGHD4-11*01 (1) >3_IGHJ3*01 1398 gnl|Fabrus|O12_IGKJ1*01 1101
1728 VH3-23_IGHD4-17*01>2_IGHJ3*01 1399 gnl|Fabrus|O12_IGKJ1*01 1101
1729 VH3-23_IGHD4-17*01>3_IGHJ3*01 1400 gnl|Fabrus|O12_IGKJ1*01 1101
1730 VH3-23_IGHD4-23*01>2_IGHJ3*01 1401 gnl|Fabrus|O12_IGKJ1*01 1101
1731 VH3-23_IGHD4-23*01>3_IGHJ3*01 1402 gnl|Fabrus|O12_IGKJ1*01 1101
1732 VH3-23_IGHD5-5*01 (2) >1_IGHJ3*01 1403 gnl|Fabrus|O12_IGKJ1*01 1101
1733 VH3-23_IGHD5-5*01 (2) >2_IGHJ3*01 1404 gnl|Fabrus|O12_IGKJ1*01 1101
1734 VH3-23_IGHD5-5*01 (2) >3_IGHJ3*01 1405 gnl|Fabrus|O12_IGKJ1*01 1101
1735 VH3-23_IGHD5-12*01>1_IGHJ3*01 1406 gnl|Fabrus|O12_IGKJ1*01 1101
1736 VH3-23_IGHD5-12*01>3_IGHJ3*01 1407 gnl|Fabrus|O12_IGKJ1*01 1101
1737 VH3-23_IGHD5-18*01 (2) >1_IGHJ3*01 1408 gnl|Fabrus|O12_IGKJ1*01 1101
1738 VH3-23_IGHD5-18*01 (2) >2_IGHJ3*01 1409 gnl|Fabrus|O12_IGKJ1*01 1101
1739 VH3-23_IGHD5-18*01 (2) >3_IGHJ3*01 1410 gnl|Fabrus|O12_IGKJ1*01 1101
1740 VH3-23_IGHD5-24*01>1_IGHJ3*01 1411 gnl|Fabrus|O12_IGKJ1*01 1101
1741 VH3-23_IGHD5-24*01>3_IGHJ3*01 1412 gnl|Fabrus|O12_IGKJ1*01 1101
1742 VH3-23_IGHD6-6*01>1_IGHJ3*01 1413 gnl|Fabrus|O12_IGKJ1*01 1101
1743 VH3-23_IGHD1-1*01>1′_IGHJ3*01 1423 gnl|Fabrus|O12_IGKJ1*01 1101
1744 VH3-23_IGHD1-1*01>2′_IGHJ3*01 1424 gnl|Fabrus|O12_IGKJ1*01 1101
1745 VH3-23_IGHD1-1*01>3′_IGHJ3*01 1425 gnl|Fabrus|O12_IGKJ1*01 1101
1746 VH3-23_IGHD1-7*01>1′_IGHJ3*01 1426 gnl|Fabrus|O12_IGKJ1*01 1101
1747 VH3-23_IGHD1-7*01>3′_IGHJ3*01 1427 gnl|Fabrus|O12_IGKJ1*01 1101
1748 VH3-23_IGHD1-14*01>1′_IGHJ3*01 1428 gnl|Fabrus|O12_IGKJ1*01 1101
1749 VH3-23_IGHD1-14*01>2′_IGHJ3*01 1429 gnl|Fabrus|O12_IGKJ1*01 1101
1750 VH3-23_IGHD1-14*01>3′_IGHJ3*01 1430 gnl|Fabrus|O12_IGKJ1*01 1101
1751 VH3-23_IGHD1-20*01>1′_IGHJ3*01 1431 gnl|Fabrus|O12_IGKJ1*01 1101
1752 VH3-23_IGHD1-20*01>2′_IGHJ3*01 1432 gnl|Fabrus|O12_IGKJ1*01 1101
1753 VH3-23_IGHD1-20*01>3′_IGHJ3*01 1433 gnl|Fabrus|O12_IGKJ1*01 1101
1754 VH3-23_IGHD1-26*01>1′_IGHJ3*01 1434 gnl|Fabrus|O12_IGKJ1*01 1101
1755 VH3-23_IGHD1-26*01>3′_IGHJ3*01 1435 gnl|Fabrus|O12_IGKJ1*01 1101
1756 VH3-23_IGHD2-2*01>1′_IGHJ3*01 1436 gnl|Fabrus|O12_IGKJ1*01 1101
1757 VH3-23_IGHD2-2*01>3′_IGHJ3*01 1437 gnl|Fabrus|O12_IGKJ1*01 1101
1758 VH3-23_IGHD2-8*01>1′_IGHJ3*01 1438 gnl|Fabrus|O12_IGKJ1*01 1101
1759 VH3-23_IGHD2-15*01>1′_IGHJ3*01 1439 gnl|Fabrus|O12_IGKJ1*01 1101
1760 VH3-23_IGHD2-15*01>3′_IGHJ3*01 1440 gnl|Fabrus|O12_IGKJ1*01 1101
1761 VH3-23_IGHD2-21*01>1′_IGHJ3*01 1441 gnl|Fabrus|O12_IGKJ1*01 1101
1762 VH3-23_IGHD2-21*01>3′_IGHJ3*01 1442 gnl|Fabrus|O12_IGKJ1*01 1101
1763 VH3-23_IGHD3-3*01>1′_IGHJ3*01 1443 gnl|Fabrus|O12_IGKJ1*01 1101
1764 VH3-23_IGHD3-3*01>3′_IGHJ3*01 1444 gnl|Fabrus|O12_IGKJ1*01 1101
1765 VH3-23_IGHD3-9*01>1′_IGHJ3*01 1445 gnl|Fabrus|O12_IGKJ1*01 1101
1766 VH3-23_IGHD3-9*01>3′_IGHJ3*01 1446 gnl|Fabrus|O12_IGKJ1*01 1101
1767 VH3-23_IGHD3-10*01>1′_IGHJ3*01 1447 gnl|Fabrus|O12_IGKJ1*01 1101
1768 VH3-23_IGHD3-10*01>3′_IGHJ3*01 1448 gnl|Fabrus|O12_IGKJ1*01 1101
1769 VH3-23_IGHD3-16*01>1′_IGHJ3*01 1449 gnl|Fabrus|O12_IGKJ1*01 1101
1770 VH3-23_IGHD3-16*01>3′_IGHJ3*01 1450 gnl|Fabrus|O12_IGKJ1*01 1101
1771 VH3-23_IGHD3-22*01>1′_IGHJ3*01 1451 gnl|Fabrus|O12_IGKJ1*01 1101
1772 VH3-23_IGHD4-4*01 (1) >1′_IGHJ3*01 1452 gnl|Fabrus|O12_IGKJ1*01 1101
1773 VH3-23_IGHD4-4*01 (1) >3′_IGHJ3*01 1453 gnl|Fabrus|O12_IGKJ1*01 1101
1774 VH3-23_IGHD4-11*01 (1) >1′_IGHJ3*01 1454 gnl|Fabrus|O12_IGKJ1*01 1101
1775 VH3-23_IGHD4-11*01 (1) >3′_IGHJ3*01 1455 gnl|Fabrus|O12_IGKJ1*01 1101
1776 VH3-23_IGHD4-17*01>1′_IGHJ3*01 1456 gnl|Fabrus|O12_IGKJ1*01 1101
1777 VH3-23_IGHD4-17*01>3′_IGHJ3*01 1457 gnl|Fabrus|O12_IGKJ1*01 1101
1778 VH3-23_IGHD4-23*01>1′_IGHJ3*01 1458 gnl|Fabrus|O12_IGKJ1*01 1101
1779 VH3-23_IGHD4-23*01>3′_IGHJ3*01 1459 gnl|Fabrus|O12_IGKJ1*01 1101
1780 VH3-23_IGHD5-5*01 (2) >1′_IGHJ3*01 1460 gnl|Fabrus|O12_IGKJ1*01 1101
1781 VH3-23_IGHD5-5*01 (2) >3′_IGHJ3*01 1461 gnl|Fabrus|O12_IGKJ1*01 1101
1782 VH3-23_IGHD5-12*01>1′_IGHJ3*01 1462 gnl|Fabrus|O12_IGKJ1*01 1101
1783 VH3-23_IGHD5-12*01>3′_IGHJ3*01 1463 gnl|Fabrus|O12_IGKJ1*01 1101
1784 VH3-23_IGHD5-18*01 (2) >1′_IGHJ3*01 1464 gnl|Fabrus|O12_IGKJ1*01 1101
1785 VH3-23_IGHD5-18*01 (2) >3′_IGHJ3*01 1465 gnl|Fabrus|O12_IGKJ1*01 1101
1786 VH3-23_IGHD5-24*01>1′_IGHJ3*01 1466 gnl|Fabrus|O12_IGKJ1*01 1101
1787 VH3-23_IGHD5-24*01>3′_IGHJ3*01 1467 gnl|Fabrus|O12_IGKJ1*01 1101
1788 VH3-23_IGHD6-6*01>1′_IGHJ3*01 1468 gnl|Fabrus|O12_IGKJ1*01 1101
1789 VH3-23_IGHD6-6*01>2′_IGHJ3*01 1469 gnl|Fabrus|O12_IGKJ1*01 1101
1790 VH3-23_IGHD6-6*01>3′_IGHJ3*01 1470 gnl|Fabrus|O12_IGKJ1*01 1101
1791 VH3-23_IGHD6-6*01>2_IGHJ3*01 1414 gnl|Fabrus|O12_IGKJ1*01 1101
1792 VH3-23_IGHD6-13*01>1_IGHJ3*01 1415 gnl|Fabrus|O12_IGKJ1*01 1101
1793 VH3-23_IGHD6-13*01>2_IGHJ3*01 1416 gnl|Fabrus|O12_IGKJ1*01 1101
1794 VH3-23_IGHD6-19*01>1_IGHJ3*01 1417 gnl|Fabrus|O12_IGKJ1*01 1101
1795 VH3-23_IGHD6-19*01>2_IGHJ3*01 1418 gnl|Fabrus|O12_IGKJ1*01 1101
1796 VH3-23_IGHD6-25*01>1_IGHJ3*01 1419 gnl|Fabrus|O12_IGKJ1*01 1101
1797 VH3-23_IGHD6-25*01>2_IGHJ3*01 1420 gnl|Fabrus|O12_IGKJ1*01 1101
1798 VH3-23_IGHD7-27*01>1_IGHJ3*01 1421 gnl|Fabrus|O12_IGKJ1*01 1101
1799 VH3-23_IGHD7-27*01>3_IGHJ3*01 1422 gnl|Fabrus|O12_IGKJ1*01 1101
1800 VH3-23_IGHD6-13*01>1′_IGHJ3*01 1471 gnl|Fabrus|O12_IGKJ1*01 1101
1801 VH3-23_IGHD6-13*01>2′_IGHJ3*01 1472 gnl|Fabrus|O12_IGKJ1*01 1101
1802 VH3-23_IGHD6-13*01>1_IGHJ6*01 1473 gnl|Fabrus|O12_IGKJ1*01 1101
1803 VH3-23_IGHD6-19*01>1′_IGHJ3*01 1474 gnl|Fabrus|O12_IGKJ1*01 1101
1804 VH3-23_IGHD6-19*01>2′_IGHJ3*01 1475 gnl|Fabrus|O12_IGKJ1*01 1101
1805 VH3-23_IGHD6-19*01>3′_IGHJ3*01 1476 gnl|Fabrus|O12_IGKJ1*01 1101
1806 VH3-23_IGHD6-25*01>1′_IGHJ3*01 1477 gnl|Fabrus|O12_IGKJ1*01 1101
1807 VH3-23_IGHD6-25*01>3′_IGHJ3*01 1478 gnl|Fabrus|O12_IGKJ1*01 1101
1808 VH3-23_IGHD7-27*01>1′_IGHJ3*01 1479 gnl|Fabrus|O12_IGKJ1*01 1101
1809 VH3-23_IGHD7-27*01>2′_IGHJ3*01 1480 gnl|Fabrus|O12_IGKJ1*01 1101
1810 VH3-23_IGHD1-1*01>1_IGHJ4*01 1481 gnl|Fabrus|O12_IGKJ1*01 1101
1811 VH3-23_IGHD1-1*01>2_IGHJ4*01 1482 gnl|Fabrus|O12_IGKJ1*01 1101
1812 VH3-23_IGHD1-1*01>3_IGHJ4*01 1483 gnl|Fabrus|O12_IGKJ1*01 1101
1813 VH3-23_IGHD1-7*01>1_IGHJ4*01 1484 gnl|Fabrus|O12_IGKJ1*01 1101
1814 VH3-23_IGHD1-7*01>3_IGHJ4*01 1485 gnl|Fabrus|O12_IGKJ1*01 1101
1815 VH3-23_IGHD1-14*01>1_IGHJ4*01 1486 gnl|Fabrus|O12_IGKJ1*01 1101
1816 VH3-23_IGHD1-14*01>3_IGHJ4*01 1487 gnl|Fabrus|O12_IGKJ1*01 1101
1817 VH3-23_IGHD1-20*01>1_IGHJ4*01 1488 gnl|Fabrus|O12_IGKJ1*01 1101
1818 VH3-23_IGHD1-20*01>3_IGHJ4*01 1489 gnl|Fabrus|O12_IGKJ1*01 1101
1819 VH3-23_IGHD1-26*01>1_IGHJ4*01 1490 gnl|Fabrus|O12_IGKJ1*01 1101
1820 VH3-23_IGHD1-26*01>3_IGHJ4*01 1491 gnl|Fabrus|O12_IGKJ1*01 1101
1821 VH3-23_IGHD2-2*01>2_IGHJ4*01 1492 gnl|Fabrus|O12_IGKJ1*01 1101
1822 VH3-23_IGHD2-2*01>3_IGHJ4*01 1493 gnl|Fabrus|O12_IGKJ1*01 1101
1823 VH3-23_IGHD2-8*01>2_IGHJ4*01 1494 gnl|Fabrus|O12_IGKJ1*01 1101
1824 VH3-23_IGHD2-8*01>3_IGHJ4*01 1495 gnl|Fabrus|O12_IGKJ1*01 1101
1825 VH3-23_IGHD2-15*01>2_IGHJ4*01 1496 gnl|Fabrus|O12_IGKJ1*01 1101
1826 VH3-23_IGHD2-15*01>3_IGHJ4*01 1497 gnl|Fabrus|O12_IGKJ1*01 1101
1827 VH3-23_IGHD2-21*01>2_IGHJ4*01 1498 gnl|Fabrus|O12_IGKJ1*01 1101
1828 VH3-23_IGHD2-21*01>3_IGHJ4*01 1499 gnl|Fabrus|O12_IGKJ1*01 1101
1829 VH3-23_IGHD3-3*01>1_IGHJ4*01 1500 gnl|Fabrus|O12_IGKJ1*01 1101
1830 VH3-23_IGHD3-3*01>2_IGHJ4*01 1501 gnl|Fabrus|O12_IGKJ1*01 1101
1831 VH3-23_IGHD3-3*01>3_IGHJ4*01 1502 gnl|Fabrus|O12_IGKJ1*01 1101
1832 VH3-23_IGHD3-9*01>2_IGHJ4*01 1503 gnl|Fabrus|O12_IGKJ1*01 1101
1833 VH3-23_IGHD3-10*01>2_IGHJ4*01 1504 gnl|Fabrus|O12_IGKJ1*01 1101
1834 VH3-23_IGHD3-10*01>3_IGHJ4*01 1505 gnl|Fabrus|O12_IGKJ1*01 1101
1835 VH3-23_IGHD3-16*01>2_IGHJ4*01 1506 gnl|Fabrus|O12_IGKJ1*01 1101
1836 VH3-23_IGHD3-16*01>3_IGHJ4*01 1507 gnl|Fabrus|O12_IGKJ1*01 1101
1837 VH3-23_IGHD3-22*01>2_IGHJ4*01 1508 gnl|Fabrus|O12_IGKJ1*01 1101
1838 VH3-23_IGHD3-22*01>3_IGHJ4*01 1509 gnl|Fabrus|O12_IGKJ1*01 1101
1839 VH3-23_IGHD4-4*01 (1) >2_IGHJ4*01 1510 gnl|Fabrus|O12_IGKJ1*01 1101
1840 VH3-23_IGHD4-4*01 (1) >3_IGHJ4*01 1511 gnl|Fabrus|O12_IGKJ1*01 1101
1841 VH3-23_IGHD4-11*01 (1) >2_IGHJ4*01 1512 gnl|Fabrus|O12_IGKJ1*01 1101
1842 VH3-23_IGHD4-11*01 (1) >3_IGHJ4*01 1513 gnl|Fabrus|O12_IGKJ1*01 1101
1843 VH3-23_IGHD4-17*01>2_IGHJ4*01 1514 gnl|Fabrus|O12_IGKJ1*01 1101
1844 VH3-23_IGHD4-17*01>3_IGHJ4*01 1515 gnl|Fabrus|O12_IGKJ1*01 1101
1845 VH3-23_IGHD4-23*01>2_IGHJ4*01 1516 gnl|Fabrus|O12_IGKJ1*01 1101
1846 VH3-23_IGHD4-23*01>3_IGHJ4*01 1517 gnl|Fabrus|O12_IGKJ1*01 1101
1847 VH3-23_IGHD5-5*01 (2) >1_IGHJ4*01 1518 gnl|Fabrus|O12_IGKJ1*01 1101
1848 VH3-23_IGHD5-5*01 (2) >2_IGHJ4*01 1519 gnl|Fabrus|O12_IGKJ1*01 1101
1849 VH3-23_IGHD5-5*01 (2) >3_IGHJ4*01 1520 gnl|Fabrus|O12_IGKJ1*01 1101
1850 VH3-23_IGHD5-12*01>1_IGHJ4*01 1521 gnl|Fabrus|O12_IGKJ1*01 1101
1851 VH3-23_IGHD5-12*01>3_IGHJ4*01 1522 gnl|Fabrus|O12_IGKJ1*01 1101
1852 VH3-23_IGHD5-18*01 (2) >1_IGHJ4*01 1523 gnl|Fabrus|O12_IGKJ1*01 1101
1853 VH3-23_IGHD5-18*01 (2) >2_IGHJ4*01 1524 gnl|Fabrus|O12_IGKJ1*01 1101
1854 VH3-23_IGHD5-18*01 (2) >3_IGHJ4*01 1525 gnl|Fabrus|O12_IGKJ1*01 1101
1855 VH3-23_IGHD5-24*01>1_IGHJ4*01 1526 gnl|Fabrus|O12_IGKJ1*01 1101
1856 VH3-23_IGHD5-24*01>3_IGHJ4*01 1527 gnl|Fabrus|O12_IGKJ1*01 1101
1857 VH3-23_IGHD6-6*01>1_IGHJ4*01 1528 gnl|Fabrus|O12_IGKJ1*01 1101
1858 VH3-23_IGHD1-1*01>1′_IGHJ4*01 1538 gnl|Fabrus|O12_IGKJ1*01 1101
1859 VH3-23_IGHD1-1*01>2′_IGHJ4*01 1539 gnl|Fabrus|O12_IGKJ1*01 1101
1860 VH3-23_IGHD1-1*01>3′_IGHJ4*01 1540 gnl|Fabrus|O12_IGKJ1*01 1101
1861 VH3-23_IGHD1-7*01>1′_IGHJ4*01 1541 gnl|Fabrus|O12_IGKJ1*01 1101
1862 VH3-23_IGHD1-7*01>3′_IGHJ4*01 1542 gnl|Fabrus|O12_IGKJ1*01 1101
1863 VH3-23_IGHD1-14*01>1′_IGHJ4*01 1543 gnl|Fabrus|O12_IGKJ1*01 1101
1864 VH3-23_IGHD1-14*01>2′_IGHJ4*01 1544 gnl|Fabrus|O12_IGKJ1*01 1101
1865 VH3-23_IGHD1-14*01>3′_IGHJ4*01 1545 gnl|Fabrus|O12_IGKJ1*01 1101
1866 VH3-23_IGHD1-20*01>1′_IGHJ4*01 1546 gnl|Fabrus|O12_IGKJ1*01 1101
1867 VH3-23_IGHD1-20*01>2′_IGHJ4*01 1547 gnl|Fabrus|O12_IGKJ1*01 1101
1868 VH3-23_IGHD1-20*01>3′_IGHJ4*01 1548 gnl|Fabrus|O12_IGKJ1*01 1101
1869 VH3-23_IGHD1-26*01>1′_IGHJ4*01 1549 gnl|Fabrus|O12_IGKJ1*01 1101
1870 VH3-23_IGHD1-26*01>1_IGHJ4*01_B 1550 gnl|Fabrus|O12_IGKJ1*01 1101
1871 VH3-23_IGHD2-2*01>1′_IGHJ4*01 1551 gnl|Fabrus|O12_IGKJ1*01 1101
1872 VH3-23_IGHD2-2*01>3′_IGHJ4*01 1552 gnl|Fabrus|O12_IGKJ1*01 1101
1873 VH3-23_IGHD2-8*01>1′_IGHJ4*01 1553 gnl|Fabrus|O12_IGKJ1*01 1101
1874 VH3-23_IGHD2-15*01>1′_IGHJ4*01 1554 gnl|Fabrus|O12_IGKJ1*01 1101
1875 VH3-23_IGHD2-15*01>3′_IGHJ4*01 1555 gnl|Fabrus|O12_IGKJ1*01 1101
1876 VH3-23_IGHD2-21*01>1′_IGHJ4*01 1556 gnl|Fabrus|O12_IGKJ1*01 1101
1877 VH3-23_IGHD2-21*01>3′_IGHJ4*01 1557 gnl|Fabrus|O12_IGKJ1*01 1101
1878 VH3-23_IGHD3-3*01>1′_IGHJ4*01 1558 gnl|Fabrus|O12_IGKJ1*01 1101
1879 VH3-23_IGHD3-3*01>3′_IGHJ4*01 1559 gnl|Fabrus|O12_IGKJ1*01 1101
1880 VH3-23_IGHD3-9*01>1′_IGHJ4*01 1560 gnl|Fabrus|O12_IGKJ1*01 1101
1881 VH3-23_IGHD3-9*01>3′_IGHJ4*01 1561 gnl|Fabrus|O12_IGKJ1*01 1101
1882 VH3-23_IGHD3-10*01>1′_IGHJ4*01 1562 gnl|Fabrus|O12_IGKJ1*01 1101
1883 VH3-23_IGHD3-10*01>3′_IGHJ4*01 1563 gnl|Fabrus|O12_IGKJ1*01 1101
1884 VH3-23_IGHD3-16*01>1′_IGHJ4*01 1564 gnl|Fabrus|O12_IGKJ1*01 1101
1885 VH3-23_IGHD3-16*01>3′_IGHJ4*01 1565 gnl|Fabrus|O12_IGKJ1*01 1101
1886 VH3-23_IGHD3-22*01>1′_IGHJ4*01 1566 gnl|Fabrus|O12_IGKJ1*01 1101
1887 VH3-23_IGHD4-4*01 (1) >1′_IGHJ4*01 1567 gnl|Fabrus|O12_IGKJ1*01 1101
1888 VH3-23_IGHD4-4*01 (1) >3′_IGHJ4*01 1568 gnl|Fabrus|O12_IGKJ1*01 1101
1889 VH3-23_IGHD4-11*01 (1) >1′_IGHJ4*01 1569 gnl|Fabrus|O12_IGKJ1*01 1101
1890 VH3-23_IGHD4-11*01 (1) >3′_IGHJ4*01 1570 gnl|Fabrus|O12_IGKJ1*01 1101
1891 VH3-23_IGHD4-17*01>1′_IGHJ4*01 1571 gnl|Fabrus|O12_IGKJ1*01 1101
1892 VH3-23_IGHD4-17*01>3′_IGHJ4*01 1572 gnl|Fabrus|O12_IGKJ1*01 1101
1893 VH3-23_IGHD4-23*01>1′_IGHJ4*01 1573 gnl|Fabrus|O12_IGKJ1*01 1101
1894 VH3-23_IGHD4-23*01>3′_IGHJ4*01 1574 gnl|Fabrus|O12_IGKJ1*01 1101
1895 VH3-23_IGHD5-5*01 (2) >1′_IGHJ4*01 1575 gnl|Fabrus|O12_IGKJ1*01 1101
1896 VH3-23_IGHD5-5*01 (2) >3′_IGHJ4*01 1576 gnl|Fabrus|O12_IGKJ1*01 1101
1897 VH3-23_IGHD5-12*01>1′_IGHJ4*01 1577 gnl|Fabrus|O12_IGKJ1*01 1101
1898 VH3-23_IGHD5-12*01>3′_IGHJ4*01 1578 gnl|Fabrus|O12_IGKJ1*01 1101
1899 VH3-23_IGHD5-18*01 (2) >1′_IGHJ4*01 1579 gnl|Fabrus|O12_IGKJ1*01 1101
1900 VH3-23_IGHD5-18*01 (2) >3′_IGHJ4*01 1580 gnl|Fabrus|O12_IGKJ1*01 1101
1901 VH3-23_IGHD5-24*01>1′_IGHJ4*01 1581 gnl|Fabrus|O12_IGKJ1*01 1101
1902 VH3-23_IGHD5-24*01>3′_IGHJ4*01 1582 gnl|Fabrus|O12_IGKJ1*01 1101
1903 VH3-23_IGHD6-6*01>1′_IGHJ4*01 1583 gnl|Fabrus|O12_IGKJ1*01 1101
1904 VH3-23_IGHD6-6*01>2′_IGHJ4*01 1584 gnl|Fabrus|O12_IGKJ1*01 1101
1905 VH3-23_IGHD6-6*01>3′_IGHJ4*01 1585 gnl|Fabrus|O12_IGKJ1*01 1101
1906 VH3-23_IGHD6-6*01>2_IGHJ4*01 1529 gnl|Fabrus|O12_IGKJ1*01 1101
1907 VH3-23_IGHD6-13*01>1_IGHJ4*01 1530 gnl|Fabrus|O12_IGKJ1*01 1101
1908 VH3-23_IGHD6-13*01>2_IGHJ4*01 1531 gnl|Fabrus|O12_IGKJ1*01 1101
1909 VH3-23_IGHD6-19*01>1_IGHJ4*01 1532 gnl|Fabrus|O12_IGKJ1*01 1101
1910 VH3-23_IGHD6-19*01>2_IGHJ4*01 1533 gnl|Fabrus|O12_IGKJ1*01 1101
1911 VH3-23_IGHD6-25*01>1_IGHJ4*01 1534 gnl|Fabrus|O12_IGKJ1*01 1101
1912 VH3-23_IGHD6-25*01>2_IGHJ4*01 1535 gnl|Fabrus|O12_IGKJ1*01 1101
1913 VH3-23_IGHD7-27*01>1_IGHJ4*01 1536 gnl|Fabrus|O12_IGKJ1*01 1101
1914 VH3-23_IGHD7-27*01>3_IGHJ4*01 1537 gnl|Fabrus|O12_IGKJ1*01 1101
1915 VH3-23_IGHD6-13*01>1′_IGHJ4*01 1586 gnl|Fabrus|O12_IGKJ1*01 1101
1916 VH3-23_IGHD6-13*01>2′_IGHJ4*01 1587 gnl|Fabrus|O12_IGKJ1*01 1101
1917 VH3-23_IGHD6-13*01>2_IGHJ4*01_B 1588 gnl|Fabrus|O12_IGKJ1*01 1101
1918 VH3-23_IGHD6-19*01>1′_IGHJ4*01 1589 gnl|Fabrus|O12_IGKJ1*01 1101
1919 VH3-23_IGHD6-19*01>2′_IGHJ4*01 1590 gnl|Fabrus|O12_IGKJ1*01 1101
1920 VH3-23_IGHD6-19*01>2_IGHJ4*01_B 1591 gnl|Fabrus|O12_IGKJ1*01 1101
1921 VH3-23_IGHD6-25*01>1′_IGHJ4*01 1592 gnl|Fabrus|O12_IGKJ1*01 1101
1922 VH3-23_IGHD6-25*01>3′_IGHJ4*01 1593 gnl|Fabrus|O12_IGKJ1*01 1101
1923 VH3-23_IGHD7-27*01>1′_IGHJ4*01 1594 gnl|Fabrus|O12_IGKJ1*01 1101
1924 VH3-23_IGHD7-27*01>2′_IGHJ4*01 1595 gnl|Fabrus|O12_IGKJ1*01 1101
1925 VH3-23_IGHD1-1*01>1_IGHJ5*01 1596 gnl|Fabrus|O12_IGKJ1*01 1101
1926 VH3-23_IGHD1-1*01>2_IGHJ5*01 1597 gnl|Fabrus|O12_IGKJ1*01 1101
1927 VH3-23_IGHD1-1*01>3_IGHJ5*01 1598 gnl|Fabrus|O12_IGKJ1*01 1101
1928 VH3-23_IGHD1-7*01>1_IGHJ5*01 1599 gnl|Fabrus|O12_IGKJ1*01 1101
1929 VH3-23_IGHD1-7*01>3_IGHJ5*01 1600 gnl|Fabrus|O12_IGKJ1*01 1101
1930 VH3-23_IGHD1-14*01>1_IGHJ5*01 1601 gnl|Fabrus|O12_IGKJ1*01 1101
1931 VH3-23_IGHD1-14*01>3_IGHJ5*01 1602 gnl|Fabrus|O12_IGKJ1*01 1101
1932 VH3-23_IGHD1-20*01>1_IGHJ5*01 1603 gnl|Fabrus|O12_IGKJ1*01 1101
1933 VH3-23_IGHD1-20*01>3_IGHJ5*01 1604 gnl|Fabrus|O12_IGKJ1*01 1101
1934 VH3-23_IGHD1-26*01>1_IGHJ5*01 1605 gnl|Fabrus|O12_IGKJ1*01 1101
1935 VH3-23_IGHD1-26*01>3_IGHJ5*01 1606 gnl|Fabrus|O12_IGKJ1*01 1101
1936 VH3-23_IGHD2-2*01>2_IGHJ5*01 1607 gnl|Fabrus|O12_IGKJ1*01 1101
1937 VH3-23_IGHD2-2*01>3_IGHJ5*01 1608 gnl|Fabrus|O12_IGKJ1*01 1101
1938 VH3-23_IGHD2-8*01>2_IGHJ5*01 1609 gnl|Fabrus|O12_IGKJ1*01 1101
1939 VH3-23_IGHD2-8*01>3_IGHJ5*01 1610 gnl|Fabrus|O12_IGKJ1*01 1101
1940 VH3-23_IGHD2-15*01>2_IGHJ5*01 1611 gnl|Fabrus|O12_IGKJ1*01 1101
1941 VH3-23_IGHD2-15*01>3_IGHJ5*01 1612 gnl|Fabrus|O12_IGKJ1*01 1101
1942 VH3-23_IGHD2-21*01>2_IGHJ5*01 1613 gnl|Fabrus|O12_IGKJ1*01 1101
1943 VH3-23_IGHD2-21*01>3_IGHJ5*01 1614 gnl|Fabrus|O12_IGKJ1*01 1101
1944 VH3-23_IGHD3-3*01>1_IGHJ5*01 1615 gnl|Fabrus|O12_IGKJ1*01 1101
1945 VH3-23_IGHD3-3*01>2_IGHJ5*01 1616 gnl|Fabrus|O12_IGKJ1*01 1101
1946 VH3-23_IGHD3-3*01>3_IGHJ5*01 1617 gnl|Fabrus|O12_IGKJ1*01 1101
1947 VH3-23_IGHD3-9*01>2_IGHJ5*01 1618 gnl|Fabrus|O12_IGKJ1*01 1101
1948 VH3-23_IGHD3-10*01>2_IGHJ5*01 1619 gnl|Fabrus|O12_IGKJ1*01 1101
1949 VH3-23_IGHD3-10*01>3_IGHJ5*01 1620 gnl|Fabrus|O12_IGKJ1*01 1101
1950 VH3-23_IGHD3-16*01>2_IGHJ5*01 1621 gnl|Fabrus|O12_IGKJ1*01 1101
1951 VH3-23_IGHD3-16*01>3_IGHJ5*01 1622 gnl|Fabrus|O12_IGKJ1*01 1101
1952 VH3-23_IGHD3-22*01>2_IGHJ5*01 1623 gnl|Fabrus|O12_IGKJ1*01 1101
1953 VH3-23_IGHD3-22*01>3_IGHJ5*01 1624 gnl|Fabrus|O12_IGKJ1*01 1101
1954 VH3-23_IGHD4-4*01 (1) >2_IGHJ5*01 1625 gnl|Fabrus|O12_IGKJ1*01 1101
1955 VH3-23_IGHD4-4*01 (1) >3_IGHJ5*01 1626 gnl|Fabrus|O12_IGKJ1*01 1101
1956 VH3-23_IGHD4-11*01 (1) >2_IGHJ5*01 1627 gnl|Fabrus|O12_IGKJ1*01 1101
1957 VH3-23_IGHD4-11*01 (1) >3_IGHJ5*01 1628 gnl|Fabrus|O12_IGKJ1*01 1101
1958 VH3-23_IGHD4-17*01>2_IGHJ5*01 1629 gnl|Fabrus|O12_IGKJ1*01 1101
1959 VH3-23_IGHD4-17*01>3_IGHJ5*01 1630 gnl|Fabrus|O12_IGKJ1*01 1101
1960 VH3-23_IGHD4-23*01>2_IGHJ5*01 1631 gnl|Fabrus|O12_IGKJ1*01 1101
1961 VH3-23_IGHD4-23*01>3_IGHJ5*01 1632 gnl|Fabrus|O12_IGKJ1*01 1101
1962 VH3-23_IGHD5-5*01 (2) >1_IGHJ5*01 1633 gnl|Fabrus|O12_IGKJ1*01 1101
1963 VH3-23_IGHD5-5*01 (2) >2_IGHJ5*01 1634 gnl|Fabrus|O12_IGKJ1*01 1101
1964 VH3-23_IGHD5-5*01 (2) >3_IGHJ5*01 1635 gnl|Fabrus|O12_IGKJ1*01 1101
1965 VH3-23_IGHD5-12*01>1_IGHJ5*01 1636 gnl|Fabrus|O12_IGKJ1*01 1101
1966 VH3-23_IGHD5-12*01>3_IGHJ5*01 1637 gnl|Fabrus|O12_IGKJ1*01 1101
1967 VH3-23_IGHD5-18*01 (2) >1_IGHJ5*01 1638 gnl|Fabrus|O12_IGKJ1*01 1101
1968 VH3-23_IGHD5-18*01 (2) >2_IGHJ5*01 1639 gnl|Fabrus|O12_IGKJ1*01 1101
1969 VH3-23_IGHD5-18*01 (2) >3_IGHJ5*01 1640 gnl|Fabrus|O12_IGKJ1*01 1101
1970 VH3-23_IGHD5-24*01>1_IGHJ5*01 1641 gnl|Fabrus|O12_IGKJ1*01 1101
1971 VH3-23_IGHD5-24*01>3_IGHJ5*01 1642 gnl|Fabrus|O12_IGKJ1*01 1101
1972 VH3-23_IGHD6-6*01>1_IGHJ5*01 1643 gnl|Fabrus|O12_IGKJ1*01 1101
1973 VH3-23_IGHD1-1*01>1′_IGHJ5*01 1653 gnl|Fabrus|O12_IGKJ1*01 1101
1974 VH3-23_IGHD1-1*01>2′_IGHJ5*01 1654 gnl|Fabrus|O12_IGKJ1*01 1101
1975 VH3-23_IGHD1-1*01>3′_IGHJ5*01 1655 gnl|Fabrus|O12_IGKJ1*01 1101
1976 VH3-23_IGHD1-7*01>1′_IGHJ5*01 1656 gnl|Fabrus|O12_IGKJ1*01 1101
1977 VH3-23_IGHD1-7*01>3′_IGHJ5*01 1657 gnl|Fabrus|O12_IGKJ1*01 1101
1978 VH3-23_IGHD1-14*01>1′_IGHJ5*01 1658 gnl|Fabrus|O12_IGKJ1*01 1101
1979 VH3-23_IGHD1-14*01>2′_IGHJ5*01 1659 gnl|Fabrus|O12_IGKJ1*01 1101
1980 VH3-23_IGHD1-14*01>3′_IGHJ5*01 1660 gnl|Fabrus|O12_IGKJ1*01 1101
1981 VH3-23_IGHD1-20*01>1′_IGHJ5*01 1661 gnl|Fabrus|O12_IGKJ1*01 1101
1982 VH3-23_IGHD1-20*01>2′_IGHJ5*01 1662 gnl|Fabrus|O12_IGKJ1*01 1101
1983 VH3-23_IGHD1-20*01>3′_IGHJ5*01 1663 gnl|Fabrus|O12_IGKJ1*01 1101
1984 VH3-23_IGHD1-26*01>1′_IGHJ5*01 1664 gnl|Fabrus|O12_IGKJ1*01 1101
1985 VH3-23_IGHD1-26*01>3′_IGHJ5*01 1665 gnl|Fabrus|O12_IGKJ1*01 1101
1986 VH3-23_IGHD2-2*01>1′_IGHJ5*01 1666 gnl|Fabrus|O12_IGKJ1*01 1101
1987 VH3-23_IGHD2-2*01>3′_IGHJ5*01 1667 gnl|Fabrus|O12_IGKJ1*01 1101
1988 VH3-23_IGHD2-8*01>1′_IGHJ5*01 1668 gnl|Fabrus|O12_IGKJ1*01 1101
1989 VH3-23_IGHD2-15*01>1′_IGHJ5*01 1669 gnl|Fabrus|O12_IGKJ1*01 1101
1990 VH3-23_IGHD2-15*01>3′_IGHJ5*01 1670 gnl|Fabrus|O12_IGKJ1*01 1101
1991 VH3-23_IGHD2-21*01>1′_IGHJ5*01 1671 gnl|Fabrus|O12_IGKJ1*01 1101
1992 VH3-23_IGHD2-21*01>3′_IGHJ5*01 1672 gnl|Fabrus|O12_IGKJ1*01 1101
1993 VH3-23_IGHD3-3*01>1′_IGHJ5*01 1673 gnl|Fabrus|O12_IGKJ1*01 1101
1994 VH3-23_IGHD3-3*01>3′_IGHJ5*01 1674 gnl|Fabrus|O12_IGKJ1*01 1101
1995 VH3-23_IGHD3-9*01>1′_IGHJ5*01 1675 gnl|Fabrus|O12_IGKJ1*01 1101
1996 VH3-23_IGHD3-9*01>3′_IGHJ5*01 1676 gnl|Fabrus|O12_IGKJ1*01 1101
1997 VH3-23_IGHD3-10*01>1′_IGHJ5*01 1677 gnl|Fabrus|O12_IGKJ1*01 1101
1998 VH3-23_IGHD3-10*01>3′_IGHJ5*01 1678 gnl|Fabrus|O12_IGKJ1*01 1101
1999 VH3-23_IGHD3-16*01>1′_IGHJ5*01 1679 gnl|Fabrus|O12_IGKJ1*01 1101
2000 VH3-23_IGHD3-16*01>3′_IGHJ5*01 1680 gnl|Fabrus|O12_IGKJ1*01 1101
2001 VH3-23_IGHD3-22*01>1′_IGHJ5*01 1681 gnl|Fabrus|O12_IGKJ1*01 1101
2002 VH3-23_IGHD4-4*01 (1) >1′_IGHJ5*01 1682 gnl|Fabrus|O12_IGKJ1*01 1101
2003 VH3-23_IGHD4-4*01 (1) >3′_IGHJ5*01 1683 gnl|Fabrus|O12_IGKJ1*01 1101
2004 VH3-23_IGHD4-11*01 (1) >1′_IGHJ5*01 1684 gnl|Fabrus|O12_IGKJ1*01 1101
2005 VH3-23_IGHD4-11*01 (1) >3′_IGHJ5*01 1685 gnl|Fabrus|O12_IGKJ1*01 1101
2006 VH3-23_IGHD4-17*01>1′_IGHJ5*01 1686 gnl|Fabrus|O12_IGKJ1*01 1101
2007 VH3-23_IGHD4-17*01>3′_IGHJ5*01 1687 gnl|Fabrus|O12_IGKJ1*01 1101
2008 VH3-23_IGHD4-23*01>1′_IGHJ5*01 1688 gnl|Fabrus|O12_IGKJ1*01 1101
2009 VH3-23_IGHD4-23*01>3′_IGHJ5*01 1689 gnl|Fabrus|O12_IGKJ1*01 1101
2010 VH3-23_IGHD5-5*01 (2) >1′_IGHJ5*01 1690 gnl|Fabrus|O12_IGKJ1*01 1101
2011 VH3-23_IGHD5-5*01 (2) >3′_IGHJ5*01 1691 gnl|Fabrus|O12_IGKJ1*01 1101
2012 VH3-23_IGHD5-12*01>1′_IGHJ5*01 1692 gnl|Fabrus|O12_IGKJ1*01 1101
2013 VH3-23_IGHD5-12*01>3′_IGHJ5*01 1693 gnl|Fabrus|O12_IGKJ1*01 1101
2014 VH3-23_IGHD5-18*01 (2) >1′_IGHJ5*01 1694 gnl|Fabrus|O12_IGKJ1*01 1101
2015 VH3-23_IGHD5-18*01 (2) >3′_IGHJ5*01 1695 gnl|Fabrus|O12_IGKJ1*01 1101
2016 VH3-23_IGHD5-24*01>1′_IGHJ5*01 1696 gnl|Fabrus|O12_IGKJ1*01 1101
2017 VH3-23_IGHD5-24*01>3′_IGHJ5*01 1697 gnl|Fabrus|O12_IGKJ1*01 1101
2018 VH3-23_IGHD6-6*01>1′_IGHJ5*01 1698 gnl|Fabrus|O12_IGKJ1*01 1101
2019 VH3-23_IGHD6-6*01>2′_IGHJ5*01 1699 gnl|Fabrus|O12_IGKJ1*01 1101
2020 VH3-23_IGHD6-6*01>3′_IGHJ5*01 1700 gnl|Fabrus|O12_IGKJ1*01 1101
2021 VH3-23_IGHD6-6*01>2_IGHJ5*01 1644 gnl|Fabrus|O12_IGKJ1*01 1101
2022 VH3-23_IGHD6-13*01>1_IGHJ5*01 1645 gnl|Fabrus|O12_IGKJ1*01 1101
2023 VH3-23_IGHD6-13*01>2_IGHJ5*01 1646 gnl|Fabrus|O12_IGKJ1*01 1101
2024 VH3-23_IGHD6-19*01>1_IGHJ5*01 1647 gnl|Fabrus|O12_IGKJ1*01 1101
2025 VH3-23_IGHD6-19*01>2_IGHJ5*01 1648 gnl|Fabrus|O12_IGKJ1*01 1101
2026 VH3-23_IGHD6-25*01>1_IGHJ5*01 1649 gnl|Fabrus|O12_IGKJ1*01 1101
2027 VH3-23_IGHD6-25*01>2_IGHJ5*01 1650 gnl|Fabrus|O12_IGKJ1*01 1101
2028 VH3-23_IGHD7-27*01>1_IGHJ5*01 1651 gnl|Fabrus|O12_IGKJ1*01 1101
2029 VH3-23_IGHD7-27*01>3_IGHJ5*01 1652 gnl|Fabrus|O12_IGKJ1*01 1101
2030 VH3-23_IGHD6-13*01>1′_IGHJ5*01 1701 gnl|Fabrus|O12_IGKJ1*01 1101
2031 VH3-23_IGHD6-13*01>2′_IGHJ5*01 1702 gnl|Fabrus|O12_IGKJ1*01 1101
2032 VH3-23_IGHD6-13*01>3′_IGHJ5*01 1703 gnl|Fabrus|O12_IGKJ1*01 1101
2033 VH3-23_IGHD6-19*01>1′_IGHJ5*01 1704 gnl|Fabrus|O12_IGKJ1*01 1101
2034 VH3-23_IGHD6-19*01>2′_IGHJ5*01 1705 gnl|Fabrus|O12_IGKJ1*01 1101
2035 VH3-23_IGHD6-19*01>2_IGHJ5*01_B 1706 gnl|Fabrus|O12_IGKJ1*01 1101
2036 VH3-23_IGHD6-25*01>1′_IGHJ5*01 1707 gnl|Fabrus|O12_IGKJ1*01 1101
2037 VH3-23_IGHD6-25*01>3′_IGHJ5*01 1708 gnl|Fabrus|O12_IGKJ1*01 1101
2038 VH3-23_IGHD7-27*01>1′_IGHJ5*01 1709 gnl|Fabrus|O12_IGKJ1*01 1101
2039 VH3-23_IGHD7-27*01>2′_IGHJ5*01 1710 gnl|Fabrus|O12_IGKJ1*01 1101
2040 VH3-23_IGHD1-1*01>1_IGHJ6*01 1711 gnl|Fabrus|O12_IGKJ1*01 1101
2041 VH3-23_IGHD1-1*01>2_IGHJ6*01 1712 gnl|Fabrus|O12_IGKJ1*01 1101
2042 VH3-23_IGHD1-1*01>3_IGHJ6*01 1713 gnl|Fabrus|O12_IGKJ1*01 1101
2043 VH3-23_IGHD1-7*01>1_IGHJ6*01 1714 gnl|Fabrus|O12_IGKJ1*01 1101
2044 VH3-23_IGHD1-7*01>3_IGHJ6*01 1715 gnl|Fabrus|O12_IGKJ1*01 1101
2045 VH3-23_IGHD1-14*01>1_IGHJ6*01 1716 gnl|Fabrus|O12_IGKJ1*01 1101
2046 VH3-23_IGHD1-14*01>3_IGHJ6*01 1717 gnl|Fabrus|O12_IGKJ1*01 1101
2047 VH3-23_IGHD1-20*01>1_IGHJ6*01 1718 gnl|Fabrus|O12_IGKJ1*01 1101
2048 VH3-23_IGHD1-20*01>3_IGHJ6*01 1719 gnl|Fabrus|O12_IGKJ1*01 1101
2049 VH3-23_IGHD1-26*01>1_IGHJ6*01 1720 gnl|Fabrus|O12_IGKJ1*01 1101
2050 VH3-23_IGHD1-26*01>3_IGHJ6*01 1721 gnl|Fabrus|O12_IGKJ1*01 1101
2051 VH3-23_IGHD2-2*01>2_IGHJ6*01 1722 gnl|Fabrus|O12_IGKJ1*01 1101
2052 VH3-23_IGHD2-2*01>3_IGHJ6*01 1723 gnl|Fabrus|O12_IGKJ1*01 1101
2053 VH3-23_IGHD2-8*01>2_IGHJ6*01 1724 gnl|Fabrus|O12_IGKJ1*01 1101
2054 VH3-23_IGHD2-8*01>3_IGHJ6*01 1725 gnl|Fabrus|O12_IGKJ1*01 1101
2055 VH3-23_IGHD2-15*01>2_IGHJ6*01 1726 gnl|Fabrus|O12_IGKJ1*01 1101
2056 VH3-23_IGHD2-15*01>3_IGHJ6*01 1727 gnl|Fabrus|O12_IGKJ1*01 1101
2057 VH3-23_IGHD2-21*01>2_IGHJ6*01 1728 gnl|Fabrus|O12_IGKJ1*01 1101
2058 VH3-23_IGHD2-21*01>3_IGHJ6*01 1729 gnl|Fabrus|O12_IGKJ1*01 1101
2059 VH3-23_IGHD3-3*01>1_IGHJ6*01 1730 gnl|Fabrus|O12_IGKJ1*01 1101
2060 VH3-23_IGHD3-3*01>2_IGHJ6*01 1731 gnl|Fabrus|O12_IGKJ1*01 1101
2061 VH3-23_IGHD3-3*01>3_IGHJ6*01 1732 gnl|Fabrus|O12_IGKJ1*01 1101
2062 VH3-23_IGHD3-9*01>2_IGHJ6*01 1733 gnl|Fabrus|O12_IGKJ1*01 1101
2063 VH3-23_IGHD3-10*01>2_IGHJ6*01 1734 gnl|Fabrus|O12_IGKJ1*01 1101
2064 VH3-23_IGHD3-10*01>3_IGHJ6*01 1735 gnl|Fabrus|O12_IGKJ1*01 1101
2065 VH3-23_IGHD3-16*01>2_IGHJ6*01 1736 gnl|Fabrus|O12_IGKJ1*01 1101
2066 VH3-23_IGHD3-16*01>3_IGHJ6*01 1737 gnl|Fabrus|O12_IGKJ1*01 1101
2067 VH3-23_IGHD3-22*01>2_IGHJ6*01 1738 gnl|Fabrus|O12_IGKJ1*01 1101
2068 VH3-23_IGHD3-22*01>3_IGHJ6*01 1739 gnl|Fabrus|O12_IGKJ1*01 1101
2069 VH3-23_IGHD4-4*01 (1) >2_IGHJ6*01 1740 gnl|Fabrus|O12_IGKJ1*01 1101
2070 VH3-23_IGHD4-4*01 (1) >3_IGHJ6*01 1741 gnl|Fabrus|O12_IGKJ1*01 1101
2071 VH3-23_IGHD4-11*01 (1) >2_IGHJ6*01 1742 gnl|Fabrus|O12_IGKJ1*01 1101
2072 VH3-23_IGHD4-11*01 (1) >3_IGHJ6*01 1743 gnl|Fabrus|O12_IGKJ1*01 1101
2073 VH3-23_IGHD4-17*01>2_IGHJ6*01 1744 gnl|Fabrus|O12_IGKJ1*01 1101
2074 VH3-23_IGHD4-17*01>3_IGHJ6*01 1745 gnl|Fabrus|O12_IGKJ1*01 1101
2075 VH3-23_IGHD4-23*01>2_IGHJ6*01 1746 gnl|Fabrus|O12_IGKJ1*01 1101
2076 VH3-23_IGHD4-23*01>3_IGHJ6*01 1747 gnl|Fabrus|O12_IGKJ1*01 1101
2077 VH3-23_IGHD5-5*01 (2) >1_IGHJ6*01 1748 gnl|Fabrus|O12_IGKJ1*01 1101
2078 VH3-23_IGHD5-5*01 (2) >2_IGHJ6*01 1749 gnl|Fabrus|O12_IGKJ1*01 1101
2079 VH3-23_IGHD5-5*01 (2) >3_IGHJ6*01 1750 gnl|Fabrus|O12_IGKJ1*01 1101
2080 VH3-23_IGHD5-12*01>1_IGHJ6*01 1751 gnl|Fabrus|O12_IGKJ1*01 1101
2081 VH3-23_IGHD5-12*01>3_IGHJ6*01 1752 gnl|Fabrus|O12_IGKJ1*01 1101
2082 VH3-23_IGHD5-18*01 (2) >1_IGHJ6*01 1753 gnl|Fabrus|O12_IGKJ1*01 1101
2083 VH3-23_IGHD5-18*01 (2) >2_IGHJ6*01 1754 gnl|Fabrus|O12_IGKJ1*01 1101
2084 VH3-23_IGHD5-18*01 (2) >3_IGHJ6*01 1755 gnl|Fabrus|O12_IGKJ1*01 1101
2085 VH3-23_IGHD5-24*01>1_IGHJ6*01 1756 gnl|Fabrus|O12_IGKJ1*01 1101
2086 VH3-23_IGHD5-24*01>3_IGHJ6*01 1757 gnl|Fabrus|O12_IGKJ1*01 1101
2087 VH3-23_IGHD6-6*01>1_IGHJ6*01 1758 gnl|Fabrus|O12_IGKJ1*01 1101
2088 VH3-23_IGHD6-6*01>2_IGHJ6*01 1759 gnl|Fabrus|O12_IGKJ1*01 1101
2089 VH3-23_IGHD5-12*01>3′_IGHJ6*01 1815 gnl|Fabrus|O12_IGKJ1*01 1101
2090 VH3-23_IGHD5-18*01(2)>1′_IGHJ6*01 1809 gnl|Fabrus|O12_IGKJ1*01 1101
2091 VH3-23_IGHD5-18*01(2)>3′_IGHJ6*01 1810 gnl|Fabrus|O12_IGKJ1*01 1101
2092 VH3-23_IGHD5-24*01>1′_IGHJ6*01 1811 gnl|Fabrus|O12_IGKJ1*01 1101
2093 VH3-23_IGHD5-24*01>3′_IGHJ6*01 1812 gnl|Fabrus|O12_IGKJ1*01 1101
2094 VH3-23_IGHD6-6*01>1′_IGHJ6*01 1813 gnl|Fabrus|O12_IGKJ1*01 1101
2095 VH3-23_IGHD6-6*01>2′_IGHJ6*01 1814 gnl|Fabrus|O12_IGKJ1*01 1101
2096 VH3-23_IGHD6-6*01>3′_IGHJ6*01 1815 gnl|Fabrus|O12_IGKJ1*01 1101
2097 VH3-23_IGHD1-1*01>1′_IGHJ6*01 1768 gnl|Fabrus|O12_IGKJ1*01 1101
2098 VH3-23_IGHD1-1*01>2′_IGHJ6*01 1769 gnl|Fabrus|O12_IGKJ1*01 1101
2099 VH3-23_IGHD1-1*01>3′_IGHJ6*01 1770 gnl|Fabrus|O12_IGKJ1*01 1101
2100 VH3-23_IGHD1-7*01>1′_IGHJ6*01 1771 gnl|Fabrus|O12_IGKJ1*01 1101
2101 VH3-23_IGHD1-7*01>3′_IGHJ6*01 1772 gnl|Fabrus|O12_IGKJ1*01 1101
2102 VH3-23_IGHD1-14*01>1′_IGHJ6*01 1773 gnl|Fabrus|O12_IGKJ1*01 1101
2103 VH3-23_IGHD1-14*01>2′_IGHJ6*01 1774 gnl|Fabrus|O12_IGKJ1*01 1101
2104 VH3-23_IGHD1-14*01>3′_IGHJ6*01 1775 gnl|Fabrus|O12_IGKJ1*01 1101
2105 VH3-23_IGHD1-20*01>1′_IGHJ6*01 1776 gnl|Fabrus|O12_IGKJ1*01 1101
2106 VH3-23_IGHD1-20*01>2′_IGHJ6*01 1777 gnl|Fabrus|O12_IGKJ1*01 1101
2107 VH3-23_IGHD1-20*01>3′_IGHJ6*01 1778 gnl|Fabrus|O12_IGKJ1*01 1101
2108 VH3-23_IGHD1-26*01>1′_IGHJ6*01 1779 gnl|Fabrus|O12_IGKJ1*01 1101
2109 VH3-23_IGHD1-26*01>1_IGHJ6*01_B 1780 gnl|Fabrus|O12_IGKJ1*01 1101
2110 VH3-23_IGHD2-2*01>2_IGHJ6*01_B 1781 gnl|Fabrus|O12_IGKJ1*01 1101
2111 VH3-23_IGHD2-2*01>3′_IGHJ6*01 1782 gnl|Fabrus|O12_IGKJ1*01 1101
2112 VH3-23_IGHD2-8*01>1′_IGHJ6*01 1783 gnl|Fabrus|O12_IGKJ1*01 1101
2113 VH3-23_IGHD2-15*01>1′_IGHJ6*01 1784 gnl|Fabrus|O12_IGKJ1*01 1101
2114 VH3-23_IGHD2-15*01>3′_IGHJ6*01 1785 gnl|Fabrus|O12_IGKJ1*01 1101
2115 VH3-23_IGHD2-21*01>1′_IGHJ6*01 1786 gnl|Fabrus|O12_IGKJ1*01 1101
2116 VH3-23_IGHD2-21*01>3′_IGHJ6*01 1787 gnl|Fabrus|O12_IGKJ1*01 1101
2117 VH3-23_IGHD3-3*01>1′_IGHJ6*01 1788 gnl|Fabrus|O12_IGKJ1*01 1101
2118 VH3-23_IGHD3-3*01>3′_IGHJ6*01 1789 gnl|Fabrus|O12_IGKJ1*01 1101
2119 VH3-23_IGHD3-9*01>1′_IGHJ6*01 1790 gnl|Fabrus|O12_IGKJ1*01 1101
2120 VH3-23_IGHD3-9*01>3′_IGHJ6*01 1791 gnl|Fabrus|O12_IGKJ1*01 1101
2121 VH3-23_IGHD3-10*01>1′_IGHJ6*01 1792 gnl|Fabrus|O12_IGKJ1*01 1101
2122 VH3-23_IGHD3-10*01>3′_IGHJ6*01 1793 gnl|Fabrus|O12_IGKJ1*01 1101
2123 VH3-23_IGHD3-16*01>1′_IGHJ6*01 1794 gnl|Fabrus|O12_IGKJ1*01 1101
2124 VH3-23_IGHD3-16*01>3′_IGHJ6*01 1795 gnl|Fabrus|O12_IGKJ1*01 1101
2125 VH3-23_IGHD3-22*01>1′_IGHJ6*01 1796 gnl|Fabrus|O12_IGKJ1*01 1101
2126 VH3-23_IGHD4-4*01 (1) >1′_IGHJ6*01 1797 gnl|Fabrus|O12_IGKJ1*01 1101
2127 VH3-23_IGHD4-4*01 (1) >3′_IGHJ6*01 1798 gnl|Fabrus|O12_IGKJ1*01 1101
2128 VH3-23_IGHD4-11*01 (1) >1′_IGHJ6*01 1799 gnl|Fabrus|O12_IGKJ1*01 1101
2129 VH3-23_IGHD4-11*01 (1) >3′_IGHJ6*01 1800 gnl|Fabrus|O12_IGKJ1*01 1101
2130 VH3-23_IGHD4-17*01>1′_IGHJ6*01 1801 gnl|Fabrus|O12_IGKJ1*01 1101
2131 VH3-23_IGHD4-17*01>3′_IGHJ6*01 1802 gnl|Fabrus|O12_IGKJ1*01 1101
2132 VH3-23_IGHD4-23*01>1′_IGHJ6*01 1803 gnl|Fabrus|O12_IGKJ1*01 1101
2133 VH3-23_IGHD4-23*01>3′_IGHJ6*01 1804 gnl|Fabrus|O12_IGKJ1*01 1101
2134 VH3-23_IGHD5-5*01 (2) >1′_IGHJ6*01 1805 gnl|Fabrus|O12_IGKJ1*01 1101
2135 VH3-23_IGHD5-5*01 (2) >3′_IGHJ6*01 1806 gnl|Fabrus|O12_IGKJ1*01 1101
2136 VH3-23_IGHD5-12*01>1′_IGHJ6*01 1807 gnl|Fabrus|O12_IGKJ1*01 1101
2137 VH3-23_IGHD5-12*01>3′_IGHJ6*01 1808 gnl|Fabrus|O12_IGKJ1*01 1101
2138 VH3-23_IGHD5-18*01 (2) >1′_IGHJ6*01 1809 gnl|Fabrus|O12_IGKJ1*01 1101
2139 VH3-23_IGHD5-18*01 (2) >3′_IGHJ6*01 1810 gnl|Fabrus|O12_IGKJ1*01 1101
2140 VH3-23_IGHD5-24*01>1′_IGHJ6*01 1811 gnl|Fabrus|O12_IGKJ1*01 1101
2141 VH3-23_IGHD5-24*01>3′_IGHJ6*01 1812 gnl|Fabrus|O12_IGKJ1*01 1101
2142 VH3-23_IGHD6-6*01>1′_IGHJ6*01 1813 gnl|Fabrus|O12_IGKJ1*01 1101
2143 VH3-23_IGHD6-6*01>2′_IGHJ6*01 1814 gnl|Fabrus|O12_IGKJ1*01 1101
2144 VH3-23_IGHD6-6*01>3′_IGHJ6*01 1815 gnl|Fabrus|O12_IGKJ1*01 1101
2145 VH3-23_IGHD6-13*01>1′_IGHJ6*01 1816 gnl|Fabrus|O12_IGKJ1*01 1101
2146 VH3-23_IGHD6-13*01>2′_IGHJ6*01 1817 gnl|Fabrus|O12_IGKJ1*01 1101
2147 VH3-23_IGHD6-13*01>3′_IGHJ6*01 1818 gnl|Fabrus|O12_IGKJ1*01 1101
2148 VH3-23_IGHD6-19*01>1′_IGHJ6*01 1819 gnl|Fabrus|O12_IGKJ1*01 1101
2149 VH3-23_IGHD6-19*01>2′_IGHJ6*01 1820 gnl|Fabrus|O12_IGKJ1*01 1101
2150 VH3-23_IGHD6-19*01>3′_IGHJ6*01 1821 gnl|Fabrus|O12_IGKJ1*01 1101
2151 VH3-23_IGHD6-25*01>1′_IGHJ6*01 1822 gnl|Fabrus|O12_IGKJ1*01 1101
2152 VH3-23_IGHD6-25*01>3′_IGHJ6*01 1823 gnl|Fabrus|O12_IGKJ1*01 1101
2153 VH3-23_IGHD7-27*01>1′_IGHJ6*01 1824 gnl|Fabrus|O12_IGKJ1*01 1101
2154 VH3-23_IGHD7-27*01>2′_IGHJ6*01 1825 gnl|Fabrus|O12_IGKJ1*01 1101
2155 VH3-23_IGHD1-1*01>1_IGHJ1*01 1136 gnl|Fabrus|O18_IGKJ1*01 1102
2156 VH3-23_IGHD1-1*01>2_IGHJ1*01 1137 gnl|Fabrus|O18_IGKJ1*01 1102
2157 VH3-23_IGHD1-1*01>3_IGHJ1*01 1138 gnl|Fabrus|O18_IGKJ1*01 1102
2158 VH3-23_IGHD1-7*01>1_IGHJ1*01 1139 gnl|Fabrus|O18_IGKJ1*01 1102
2159 VH3-23_IGHD1-7*01>3_IGHJ1*01 1140 gnl|Fabrus|O18_IGKJ1*01 1102
2160 VH3-23_IGHD1-14*01>1_IGHJ1*01 1141 gnl|Fabrus|O18_IGKJ1*01 1102
2161 VH3-23_IGHD1-14*01>3_IGHJ1*01 1142 gnl|Fabrus|O18_IGKJ1*01 1102
2162 VH3-23_IGHD1-20*01>1_IGHJ1*01 1143 gnl|Fabrus|O18_IGKJ1*01 1102
2163 VH3-23_IGHD1-20*01>3_IGHJ1*01 1144 gnl|Fabrus|O18_IGKJ1*01 1102
2164 VH3-23_IGHD1-26*01>1_IGHJ1*01 1145 gnl|Fabrus|O18_IGKJ1*01 1102
2165 VH3-23_IGHD1-26*01>3_IGHJ1*01 1146 gnl|Fabrus|O18_IGKJ1*01 1102
2166 VH3-23_IGHD2-2*01>2_IGHJ1*01 1147 gnl|Fabrus|O18_IGKJ1*01 1102
2167 VH3-23_IGHD2-2*01>3_IGHJ1*01 1148 gnl|Fabrus|O18_IGKJ1*01 1102
2168 VH3-23_IGHD2-8*01>2_IGHJ1*01 1149 gnl|Fabrus|O18_IGKJ1*01 1102
2169 VH3-23_IGHD2-8*01>3_IGHJ1*01 1150 gnl|Fabrus|O18_IGKJ1*01 1102
2170 VH3-23_IGHD2-15*01>2_IGHJ1*01 1151 gnl|Fabrus|O18_IGKJ1*01 1102
2171 VH3-23_IGHD2-15*01>3_IGHJ1*01 1152 gnl|Fabrus|O18_IGKJ1*01 1102
2172 VH3-23_IGHD2-21*01>2_IGHJ1*01 1153 gnl|Fabrus|O18_IGKJ1*01 1102
2173 VH3-23_IGHD2-21*01>3_IGHJ1*01 1154 gnl|Fabrus|O18_IGKJ1*01 1102
2174 VH3-23_IGHD3-3*01>1_IGHJ1*01 1155 gnl|Fabrus|O18_IGKJ1*01 1102
2175 VH3-23_IGHD3-3*01>2_IGHJ1*01 1156 gnl|Fabrus|O18_IGKJ1*01 1102
2176 VH3-23_IGHD3-3*01>3_IGHJ1*01 1157 gnl|Fabrus|O18_IGKJ1*01 1102
2177 VH3-23_IGHD3-9*01>2_IGHJ1*01 1158 gnl|Fabrus|O18_IGKJ1*01 1102
2178 VH3-23_IGHD3-10*01>2_IGHJ1*01 1159 gnl|Fabrus|O18_IGKJ1*01 1102
2179 VH3-23_IGHD3-10*01>3_IGHJ1*01 1160 gnl|Fabrus|O18_IGKJ1*01 1102
2180 VH3-23_IGHD3-16*01>2_IGHJ1*01 1161 gnl|Fabrus|O18_IGKJ1*01 1102
2181 VH3-23_IGHD3-16*01>3_IGHJ1*01 1162 gnl|Fabrus|O18_IGKJ1*01 1102
2182 VH3-23_IGHD3-22*01>2_IGHJ1*01 1163 gnl|Fabrus|O18_IGKJ1*01 1102
2183 VH3-23_IGHD3-22*01>3_IGHJ1*01 1164 gnl|Fabrus|O18_IGKJ1*01 1102
2184 VH3-23_IGHD4-4*01 (1) >2_IGHJ1*01 1165 gnl|Fabrus|O18_IGKJ1*01 1102
2185 VH3-23_IGHD4-4*01 (1) >3_IGHJ1*01 1166 gnl|Fabrus|O18_IGKJ1*01 1102
2186 VH3-23_IGHD4-11*01 (1) >2_IGHJ1*01 1167 gnl|Fabrus|O18_IGKJ1*01 1102
2187 VH3-23_IGHD4-11*01 (1) >3_IGHJ1*01 1168 gnl|Fabrus|O18_IGKJ1*01 1102
2188 VH3-23_IGHD4-17*01>2_IGHJ1*01 1169 gnl|Fabrus|O18_IGKJ1*01 1102
2189 VH3-23_IGHD4-17*01>3_IGHJ1*01 1170 gnl|Fabrus|O18_IGKJ1*01 1102
2190 VH3-23_IGHD4-23*01>2_IGHJ1*01 1171 gnl|Fabrus|O18_IGKJ1*01 1102
2191 VH3-23_IGHD4-23*01>3_IGHJ1*01 1172 gnl|Fabrus|O18_IGKJ1*01 1102
2192 VH3-23_IGHD5-5*01 (2) >1_IGHJ1*01 1173 gnl|Fabrus|O18_IGKJ1*01 1102
2193 VH3-23_IGHD5-5*01 (2) >2_IGHJ1*01 1174 gnl|Fabrus|O18_IGKJ1*01 1102
2194 VH3-23_IGHD5-5*01 (2) >3_IGHJ1*01 1175 gnl|Fabrus|O18_IGKJ1*01 1102
2195 VH3-23_IGHD5-12*01>1_IGHJ1*01 1176 gnl|Fabrus|O18_IGKJ1*01 1102
2196 VH3-23_IGHD5-12*01>3_IGHJ1*01 1177 gnl|Fabrus|O18_IGKJ1*01 1102
2197 VH3-23_IGHD5-18*01 (2) >1_IGHJ1*01 1178 gnl|Fabrus|O18_IGKJ1*01 1102
2198 VH3-23_IGHD5-18*01 (2) >2_IGHJ1*01 1179 gnl|Fabrus|O18_IGKJ1*01 1102
2199 VH3-23_IGHD5-18*01 (2) >3_IGHJ1*01 1180 gnl|Fabrus|O18_IGKJ1*01 1102
2200 VH3-23_IGHD5-24*01>1_IGHJ1*01 1181 gnl|Fabrus|O18_IGKJ1*01 1102
2201 VH3-23_IGHD5-24*01>3_IGHJ1*01 1182 gnl|Fabrus|O18_IGKJ1*01 1102
2202 VH3-23_IGHD6-6*01>1_IGHJ1*01 1183 gnl|Fabrus|O18_IGKJ1*01 1102
2203 VH3-23_IGHD1-1*01>1′_IGHJ1*01 1193 gnl|Fabrus|O18_IGKJ1*01 1102
2204 VH3-23_IGHD1-1*01>2′_IGHJ1*01 1194 gnl|Fabrus|O18_IGKJ1*01 1102
2205 VH3-23_IGHD1-1*01>3′_IGHJ1*01 1195 gnl|Fabrus|O18_IGKJ1*01 1102
2206 VH3-23_IGHD1-7*01>1′_IGHJ1*01 1196 gnl|Fabrus|O18_IGKJ1*01 1102
2207 VH3-23_IGHD1-7*01>3′_IGHJ1*01 1197 gnl|Fabrus|O18_IGKJ1*01 1102
2208 VH3-23_IGHD1-14*01>1′_IGHJ1*01 1198 gnl|Fabrus|O18_IGKJ1*01 1102
2209 VH3-23_IGHD1-14*01>2′_IGHJ1*01 1199 gnl|Fabrus|O18_IGKJ1*01 1102
2210 VH3-23_IGHD1-14*01>3′_IGHJ1*01 1200 gnl|Fabrus|O18_IGKJ1*01 1102
2211 VH3-23_IGHD1-20*01>1′_IGHJ1*01 1201 gnl|Fabrus|O18_IGKJ1*01 1102
2212 VH3-23_IGHD1-20*01>2′_IGHJ1*01 1202 gnl|Fabrus|O18_IGKJ1*01 1102
2213 VH3-23_IGHD1-20*01>3′_IGHJ1*01 1203 gnl|Fabrus|O18_IGKJ1*01 1102
2214 VH3-23_IGHD1-26*01>1′_IGHJ1*01 1204 gnl|Fabrus|O18_IGKJ1*01 1102
2215 VH3-23_IGHD1-26*01>3′_IGHJ1*01 1205 gnl|Fabrus|O18_IGKJ1*01 1102
2216 VH3-23_IGHD2-2*01>1′_IGHJ1*01 1206 gnl|Fabrus|O18_IGKJ1*01 1102
2217 VH3-23_IGHD2-2*01>3′_IGHJ1*01 1207 gnl|Fabrus|O18_IGKJ1*01 1102
2218 VH3-23_IGHD2-8*01>1′_IGHJ1*01 1208 gnl|Fabrus|O18_IGKJ1*01 1102
2219 VH3-23_IGHD2-15*01>1′_IGHJ1*01 1209 gnl|Fabrus|O18_IGKJ1*01 1102
2220 VH3-23_IGHD2-15*01>3′_IGHJ1*01 1210 gnl|Fabrus|O18_IGKJ1*01 1102
2221 VH3-23_IGHD2-21*01>1′_IGHJ1*01 1211 gnl|Fabrus|O18_IGKJ1*01 1102
2222 VH3-23_IGHD2-21*01>3′_IGHJ1*01 1212 gnl|Fabrus|O18_IGKJ1*01 1102
2223 VH3-23_IGHD3-3*01>1′_IGHJ1*01 1213 gnl|Fabrus|O18_IGKJ1*01 1102
2224 VH3-23_IGHD3-3*01>3′_IGHJ1*01 1214 gnl|Fabrus|O18_IGKJ1*01 1102
2225 VH3-23_IGHD3-9*01>1′_IGHJ1*01 1215 gnl|Fabrus|O18_IGKJ1*01 1102
2226 VH3-23_IGHD3-9*01>3′_IGHJ1*01 1216 gnl|Fabrus|O18_IGKJ1*01 1102
2227 VH3-23_IGHD3-10*01>1′_IGHJ1*01 1217 gnl|Fabrus|O18_IGKJ1*01 1102
2228 VH3-23_IGHD3-10*01>3′_IGHJ1*01 1218 gnl|Fabrus|O18_IGKJ1*01 1102
2229 VH3-23_IGHD3-16*01>1′_IGHJ1*01 1219 gnl|Fabrus|O18_IGKJ1*01 1102
2230 VH3-23_IGHD3-16*01>3′_IGHJ1*01 1220 gnl|Fabrus|O18_IGKJ1*01 1102
2231 VH3-23_IGHD3-22*01>1′_IGHJ1*01 1221 gnl|Fabrus|O18_IGKJ1*01 1102
2232 VH3-23_IGHD4-4*01 (1) >1′_IGHJ1*01 1222 gnl|Fabrus|O18_IGKJ1*01 1102
2233 VH3-23_IGHD4-4*01 (1) >3′_IGHJ1*01 1223 gnl|Fabrus|O18_IGKJ1*01 1102
2234 VH3-23_IGHD4-11*01 (1) >1′_IGHJ1*01 1224 gnl|Fabrus|O18_IGKJ1*01 1102
2235 VH3-23_IGHD4-11*01 (1) >3′_IGHJ1*01 1225 gnl|Fabrus|O18_IGKJ1*01 1102
2236 VH3-23_IGHD4-17*01>1′_IGHJ1*01 1226 gnl|Fabrus|O18_IGKJ1*01 1102
2237 VH3-23_IGHD4-17*01>3′_IGHJ1*01 1227 gnl|Fabrus|O18_IGKJ1*01 1102
2238 VH3-23_IGHD4-23*01>1′_IGHJ1*01 1228 gnl|Fabrus|O18_IGKJ1*01 1102
2239 VH3-23_IGHD4-23*01>3′_IGHJ1*01 1229 gnl|Fabrus|O18_IGKJ1*01 1102
2240 VH3-23_IGHD5-5*01 (2) >1′_IGHJ1*01 1230 gnl|Fabrus|O18_IGKJ1*01 1102
2241 VH3-23_IGHD5-5*01 (2) >3′_IGHJ1*01 1231 gnl|Fabrus|O18_IGKJ1*01 1102
2242 VH3-23_IGHD5-12*01>1′_IGHJ1*01 1232 gnl|Fabrus|O18_IGKJ1*01 1102
2243 VH3-23_IGHD5-12*01>3′_IGHJ1*01 1233 gnl|Fabrus|O18_IGKJ1*01 1102
2244 VH3-23_IGHD5-18*01 (2) >1′_IGHJ1*01 1234 gnl|Fabrus|O18_IGKJ1*01 1102
2245 VH3-23_IGHD5-18*01 (2) >3′_IGHJ1*01 1235 gnl|Fabrus|O18_IGKJ1*01 1102
2246 VH3-23_IGHD5-24*01>1′_IGHJ1*01 1236 gnl|Fabrus|O18_IGKJ1*01 1102
2247 VH3-23_IGHD5-24*01>3′_IGHJ1*01 1237 gnl|Fabrus|O18_IGKJ1*01 1102
2248 VH3-23_IGHD6-6*01>1′_IGHJ1*01 1238 gnl|Fabrus|O18_IGKJ1*01 1102
2249 VH3-23_IGHD6-6*01>2′_IGHJ1*01 1239 gnl|Fabrus|O18_IGKJ1*01 1102
2250 VH3-23_IGHD6-6*01>3′_IGHJ1*01 1240 gnl|Fabrus|O18_IGKJ1*01 1102
2251 VH3-23_IGHD7-27*01>1′_IGHJ6*01 1824 gnl|Fabrus|O18_IGKJ1*01 1102
2252 VH3-23_IGHD6-13*01>2_IGHJ6*01 1761 gnl|Fabrus|O18_IGKJ1*01 1102
2253 VH3-23_IGHD6-19*01>1_IGHJ6*01 1762 gnl|Fabrus|O18_IGKJ1*01 1102
2254 VH3-23_IGHD6-19*01>2_IGHJ6*01 1763 gnl|Fabrus|O18_IGKJ1*01 1102
2255 VH3-23_IGHD6-25*01>1_IGHJ6*01 1764 gnl|Fabrus|O18_IGKJ1*01 1102
2256 VH3-23_IGHD6-25*01>2_IGHJ6*01 1765 gnl|Fabrus|O18_IGKJ1*01 1102
2257 VH3-23_IGHD7-27*01>1_IGHJ6*01 1766 gnl|Fabrus|O18_IGKJ1*01 1102
2258 VH3-23_IGHD7-27*01>3_IGHJ6*01 1767 gnl|Fabrus|O18_IGKJ1*01 1102
2259 VH3-23_IGHD6-13*01>1′_IGHJ6*01 1816 gnl|Fabrus|O18_IGKJ1*01 1102
2260 VH3-23_IGHD6-13*01>2′_IGHJ6*01 1817 gnl|Fabrus|O18_IGKJ1*01 1102
2261 VH3-23_IGHD6-13*01>2_IGHJ6*01_B 1761 gnl|Fabrus|O18_IGKJ1*01 1102
2262 VH3-23_IGHD6-19*01>1′_IGHJ6*01 1819 gnl|Fabrus|O18_IGKJ1*01 1102
2263 VH3-23_IGHD6-19*01>2′_IGHJ6*01 1820 gnl|Fabrus|O18_IGKJ1*01 1102
2264 VH3-23_IGHD6-25*01>1_IGHJ6*01_B 1764 gnl|Fabrus|O18_IGKJ1*01 1102
2265 VH3-23_IGHD6-25*01>1′_IGHJ6*01 1822 gnl|Fabrus|O18_IGKJ1*01 1102
2266 VH3-23_IGHD6-25*01>3′_IGHJ6*01 1823 gnl|Fabrus|O18_IGKJ1*01 1102
2267 VH3-23_IGHD7-27*01>1′_IGHJ6*01 1824 gnl|Fabrus|O18_IGKJ1*01 1102
2268 VH3-23_IGHD7-27*01>2′_IGHJ6*01 1825 gnl|Fabrus|O18_IGKJ1*01 1102
2269 VH3-23_IGHD7-27*01>1′_IGHJ6*01 1824 gnl|Fabrus|A20_IGKJ1*01 1077
2270 VH3-23_IGHD6-13*01>2_IGHJ6*01 1761 gnl|Fabrus|A20_IGKJ1*01 1077
2271 VH3-23_IGHD6-19*01>1_IGHJ6*01 1762 gnl|Fabrus|A20_IGKJ1*01 1077
2272 VH3-23_IGHD6-19*01>2_IGHJ6*01 1763 gnl|Fabrus|A20_IGKJ1*01 1077
2273 VH3-23_IGHD6-25*01>1_IGHJ6*01 1764 gnl|Fabrus|A20_IGKJ1*01 1077
2274 VH3-23_IGHD6-25*01>2_IGHJ6*01 1765 gnl|Fabrus|A20_IGKJ1*01 1077
2275 VH3-23_IGHD7-27*01>1_IGHJ6*01 1766 gnl|Fabrus|A20_IGKJ1*01 1077
2276 VH3-23_IGHD7-27*01>3_IGHJ6*01 1767 gnl|Fabrus|A20_IGKJ1*01 1077
2277 VH3-23_IGHD6-13*01>1′_IGHJ6*01 1816 gnl|Fabrus|A20_IGKJ1*01 1077
2278 VH3-23_IGHD6-13*01>2′_IGHJ6*01 1817 gnl|Fabrus|A20_IGKJ1*01 1077
2279 VH3-23_IGHD6-13*01>2_IGHJ6*01_B 1761 gnl|Fabrus|A20_IGKJ1*01 1077
2280 VH3-23_IGHD6-19*01>1′_IGHJ6*01 1819 gnl|Fabrus|A20_IGKJ1*01 1077
2281 VH3-23_IGHD6-19*01>2′_IGHJ6*01 1820 gnl|Fabrus|A20_IGKJ1*01 1077
2282 VH3-23_IGHD6-25*01>1_IGHJ6*01_B 1764 gnl|Fabrus|A20_IGKJ1*01 1077
2283 VH3-23_IGHD6-25*01>1′_IGHJ6*01 1822 gnl|Fabrus|A20_IGKJ1*01 1077
2284 VH3-23_IGHD6-25*01>3′_IGHJ6*01 1823 gnl|Fabrus|A20_IGKJ1*01 1077
2285 VH3-23_IGHD7-27*01>1′_IGHJ6*01 1824 gnl|Fabrus|A20_IGKJ1*01 1077
2286 VH3-23_IGHD7-27*01>2′_IGHJ6*01 1825 gnl|Fabrus|A20_IGKJ1*01 1077
2287 VH3-23_IGHD1-1*01>1_IGHJ6*01 1711 gnl|Fabrus|L11_IGKJ1*01 1087
2288 VH3-23_IGHD1-1*01>2_IGHJ6*01 1712 gnl|Fabrus|L11_IGKJ1*01 1087
2289 VH3-23_IGHD1-1*01>3_IGHJ6*01 1713 gnl|Fabrus|L11_IGKJ1*01 1087
2290 VH3-23_IGHD1-7*01>1_IGHJ6*01 1714 gnl|Fabrus|L11_IGKJ1*01 1087
2291 VH3-23_IGHD1-7*01>3_IGHJ6*01 1715 gnl|Fabrus|L11_IGKJ1*01 1087
2292 VH3-23_IGHD1-14*01>1_IGHJ6*01 1716 gnl|Fabrus|L11_IGKJ1*01 1087
2293 VH3-23_IGHD1-14*01>3_IGHJ6*01 1717 gnl|Fabrus|L11_IGKJ1*01 1087
2294 VH3-23_IGHD1-20*01>1_IGHJ6*01 1718 gnl|Fabrus|L11_IGKJ1*01 1087
2295 VH3-23_IGHD1-20*01>3_IGHJ6*01 1719 gnl|Fabrus|L11_IGKJ1*01 1087
2296 VH3-23_IGHD1-26*01>1_IGHJ6*01 1720 gnl|Fabrus|L11_IGKJ1*01 1087
2297 VH3-23_IGHD1-26*01>3_IGHJ6*01 1721 gnl|Fabrus|L11_IGKJ1*01 1087
2298 VH3-23_IGHD2-2*01>2_IGHJ6*01 1722 gnl|Fabrus|L11_IGKJ1*01 1087
2299 VH3-23_IGHD2-2*01>3_IGHJ6*01 1723 gnl|Fabrus|L11_IGKJ1*01 1087
2300 VH3-23_IGHD2-8*01>2_IGHJ6*01 1724 gnl|Fabrus|L11_IGKJ1*01 1087
2301 VH3-23_IGHD2-8*01>3_IGHJ6*01 1725 gnl|Fabrus|L11_IGKJ1*01 1087
2302 VH3-23_IGHD2-15*01>2_IGHJ6*01 1726 gnl|Fabrus|L11_IGKJ1*01 1087
2303 VH3-23_IGHD2-15*01>3_IGHJ6*01 1727 gnl|Fabrus|L11_IGKJ1*01 1087
2304 VH3-23_IGHD2-21*01>2_IGHJ6*01 1728 gnl|Fabrus|L11_IGKJ1*01 1087
2305 VH3-23_IGHD2-21*01>3_IGHJ6*01 1729 gnl|Fabrus|L11_IGKJ1*01 1087
2306 VH3-23_IGHD3-3*01>1_IGHJ6*01 1730 gnl|Fabrus|L11_IGKJ1*01 1087
2307 VH3-23_IGHD3-3*01>2_IGHJ6*01 1731 gnl|Fabrus|L11_IGKJ1*01 1087
2308 VH3-23_IGHD3-3*01>3_IGHJ6*01 1732 gnl|Fabrus|L11_IGKJ1*01 1087
2309 VH3-23_IGHD3-9*01>2_IGHJ6*01 1733 gnl|Fabrus|L11_IGKJ1*01 1087
2310 VH3-23_IGHD3-10*01>2_IGHJ6*01 1734 gnl|Fabrus|L11_IGKJ1*01 1087
2311 VH3-23_IGHD3-10*01>3_IGHJ6*01 1735 gnl|Fabrus|L11_IGKJ1*01 1087
2312 VH3-23_IGHD3-16*01>2_IGHJ6*01 1736 gnl|Fabrus|L11_IGKJ1*01 1087
2313 VH3-23_IGHD3-16*01>3_IGHJ6*01 1737 gnl|Fabrus|L11_IGKJ1*01 1087
2314 VH3-23_IGHD3-22*01>2_IGHJ6*01 1738 gnl|Fabrus|L11_IGKJ1*01 1087
2315 VH3-23_IGHD3-22*01>3_IGHJ6*01 1739 gnl|Fabrus|L11_IGKJ1*01 1087
2316 VH3-23_IGHD4-4*01 (1) >2_IGHJ6*01 1740 gnl|Fabrus|L11_IGKJ1*01 1087
2317 VH3-23_IGHD4-4*01 (1) >3_IGHJ6*01 1741 gnl|Fabrus|L11_IGKJ1*01 1087
2318 VH3-23_IGHD4-11*01 (1) >2_IGHJ6*01 1742 gnl|Fabrus|L11_IGKJ1*01 1087
2319 VH3-23_IGHD4-11*01 (1) >3_IGHJ6*01 1743 gnl|Fabrus|L11_IGKJ1*01 1087
2320 VH3-23_IGHD4-17*01>2_IGHJ6*01 1744 gnl|Fabrus|L11_IGKJ1*01 1087
2321 VH3-23_IGHD4-17*01>3_IGHJ6*01 1745 gnl|Fabrus|L11_IGKJ1*01 1087
2322 VH3-23_IGHD4-23*01>2_IGHJ6*01 1746 gnl|Fabrus|L11_IGKJ1*01 1087
2323 VH3-23_IGHD4-23*01>3_IGHJ6*01 1747 gnl|Fabrus|L11_IGKJ1*01 1087
2324 VH3-23_IGHD5-5*01 (2) >1_IGHJ6*01 1748 gnl|Fabrus|L11_IGKJ1*01 1087
2325 VH3-23_IGHD5-5*01 (2) >2_IGHJ6*01 1749 gnl|Fabrus|L11_IGKJ1*01 1087
2326 VH3-23_IGHD5-5*01 (2) >3_IGHJ6*01 1750 gnl|Fabrus|L11_IGKJ1*01 1087
2327 VH3-23_IGHD5-12*01>1_IGHJ6*01 1751 gnl|Fabrus|L11_IGKJ1*01 1087
2328 VH3-23_IGHD5-12*01>3_IGHJ6*01 1752 gnl|Fabrus|L11_IGKJ1*01 1087
2329 VH3-23_IGHD5-18*01 (2) >1_IGHJ6*01 1753 gnl|Fabrus|L11_IGKJ1*01 1087
2330 VH3-23_IGHD5-18*01 (2) >2_IGHJ6*01 1754 gnl|Fabrus|L11_IGKJ1*01 1087
2331 VH3-23_IGHD5-18*01 (2) >3_IGHJ6*01 1755 gnl|Fabrus|L11_IGKJ1*01 1087
2332 VH3-23_IGHD5-24*01>1_IGHJ6*01 1756 gnl|Fabrus|L11_IGKJ1*01 1087
2333 VH3-23_IGHD5-24*01>3_IGHJ6*01 1757 gnl|Fabrus|L11_IGKJ1*01 1087
2334 VH3-23_IGHD6-6*01>1_IGHJ6*01 1758 gnl|Fabrus|L11_IGKJ1*01 1087
2335 VH3-23_IGHD1-1*01>1′_IGHJ6*01 1768 gnl|Fabrus|L11_IGKJ1*01 1087
2336 VH3-23_IGHD1-1*01>2′_IGHJ6*01 1769 gnl|Fabrus|L11_IGKJ1*01 1087
2337 VH3-23_IGHD1-1*01>3′_IGHJ6*01 1770 gnl|Fabrus|L11_IGKJ1*01 1087
2338 VH3-23_IGHD1-7*01>1′_IGHJ6*01 1771 gnl|Fabrus|L11_IGKJ1*01 1087
2339 VH3-23_IGHD1-7*01>3′_IGHJ6*01 1772 gnl|Fabrus|L11_IGKJ1*01 1087
2340 VH3-23_IGHD1-14*01>1′_IGHJ6*01 1773 gnl|Fabrus|L11_IGKJ1*01 1087
2341 VH3-23_IGHD1-14*01>2′_IGHJ6*01 1774 gnl|Fabrus|L11_IGKJ1*01 1087
2342 VH3-23_IGHD1-14*01>3′_IGHJ6*01 1775 gnl|Fabrus|L11_IGKJ1*01 1087
2343 VH3-23_IGHD1-20*01>1′_IGHJ6*01 1776 gnl|Fabrus|L11_IGKJ1*01 1087
2344 VH3-23_IGHD1-20*01>2′_IGHJ6*01 1777 gnl|Fabrus|L11_IGKJ1*01 1087
2345 VH3-23_IGHD1-20*01>3′_IGHJ6*01 1778 gnl|Fabrus|L11_IGKJ1*01 1087
2346 VH3-23_IGHD1-26*01>1′_IGHJ6*01 1779 gnl|Fabrus|L11_IGKJ1*01 1087
2347 VH3-23_IGHD1-26*01>1_IGHJ6*01_B 1780 gnl|Fabrus|L11_IGKJ1*01 1087
2348 VH3-23_IGHD2-2*01>2_IGHJ6*01_B 1781 gnl|Fabrus|L11_IGKJ1*01 1087
2349 VH3-23_IGHD2-2*01>3′_IGHJ6*01 1782 gnl|Fabrus|L11_IGKJ1*01 1087
2350 VH3-23_IGHD2-8*01>1′_IGHJ6*01 1783 gnl|Fabrus|L11_IGKJ1*01 1087
2351 VH3-23_IGHD2-15*01>1′_IGHJ6*01 1784 gnl|Fabrus|L11_IGKJ1*01 1087
2352 VH3-23_IGHD2-15*01>3′_IGHJ6*01 1785 gnl|Fabrus|L11_IGKJ1*01 1087
2353 VH3-23_IGHD2-21*01>1′_IGHJ6*01 1786 gnl|Fabrus|L11_IGKJ1*01 1087
2354 VH3-23_IGHD2-21*01>3′_IGHJ6*01 1787 gnl|Fabrus|L11_IGKJ1*01 1087
2355 VH3-23_IGHD3-3*01>1′_IGHJ6*01 1788 gnl|Fabrus|L11_IGKJ1*01 1087
2356 VH3-23_IGHD3-3*01>3′_IGHJ6*01 1789 gnl|Fabrus|L11_IGKJ1*01 1087
2357 VH3-23_IGHD3-9*01>1′_IGHJ6*01 1790 gnl|Fabrus|L11_IGKJ1*01 1087
2358 VH3-23_IGHD3-9*01>3′_IGHJ6*01 1791 gnl|Fabrus|L11_IGKJ1*01 1087
2359 VH3-23_IGHD3-10*01>1′_IGHJ6*01 1792 gnl|Fabrus|L11_IGKJ1*01 1087
2360 VH3-23_IGHD3-10*01>3′_IGHJ6*01 1793 gnl|Fabrus|L11_IGKJ1*01 1087
2361 VH3-23_IGHD3-16*01>1′_IGHJ6*01 1794 gnl|Fabrus|L11_IGKJ1*01 1087
2362 VH3-23_IGHD3-16*01>3′_IGHJ6*01 1795 gnl|Fabrus|L11_IGKJ1*01 1087
2363 VH3-23_IGHD3-22*01>1′_IGHJ6*01 1796 gnl|Fabrus|L11_IGKJ1*01 1087
2364 VH3-23_IGHD4-4*01 (1) >1′_IGHJ6*01 1797 gnl|Fabrus|L11_IGKJ1*01 1087
2365 VH3-23_IGHD4-4*01 (1) >3′_IGHJ6*01 1798 gnl|Fabrus|L11_IGKJ1*01 1087
2366 VH3-23_IGHD4-11*01 (1) >1′_IGHJ6*01 1799 gnl|Fabrus|L11_IGKJ1*01 1087
2367 VH3-23_IGHD4-11*01 (1) >3′_IGHJ6*01 1800 gnl|Fabrus|L11_IGKJ1*01 1087
2368 VH3-23_IGHD4-17*01>1′_IGHJ6*01 1801 gnl|Fabrus|L11_IGKJ1*01 1087
2369 VH3-23_IGHD4-17*01>3′_IGHJ6*01 1802 gnl|Fabrus|L11_IGKJ1*01 1087
2370 VH3-23_IGHD4-23*01>1′_IGHJ6*01 1803 gnl|Fabrus|L11_IGKJ1*01 1087
2371 VH3-23_IGHD4-23*01>3′_IGHJ6*01 1804 gnl|Fabrus|L11_IGKJ1*01 1087
2372 VH3-23_IGHD5-5*01 (2) >1′_IGHJ6*01 1805 gnl|Fabrus|L11_IGKJ1*01 1087
2373 VH3-23_IGHD5-5*01 (2) >3′_IGHJ6*01 1806 gnl|Fabrus|L11_IGKJ1*01 1087
2374 VH3-23_IGHD5-12*01>1′_IGHJ6*01 1807 gnl|Fabrus|L11_IGKJ1*01 1087
2375 VH3-23_IGHD5-12*01>3′_IGHJ6*01 1808 gnl|Fabrus|L11_IGKJ1*01 1087
2376 VH3-23_IGHD5-18*01 (2) >1′_IGHJ6*01 1809 gnl|Fabrus|L11_IGKJ1*01 1087
2377 VH3-23_IGHD5-18*01 (2) >3′_IGHJ6*01 1810 gnl|Fabrus|L11_IGKJ1*01 1087
2378 VH3-23_IGHD5-24*01>1′_IGHJ6*01 1811 gnl|Fabrus|L11_IGKJ1*01 1087
2379 VH3-23_IGHD5-24*01>3′_IGHJ6*01 1812 gnl|Fabrus|L11_IGKJ1*01 1087
2380 VH3-23_IGHD6-6*01>1′_IGHJ6*01 1813 gnl|Fabrus|L11_IGKJ1*01 1087
2381 VH3-23_IGHD6-6*01>2′_IGHJ6*01 1814 gnl|Fabrus|L11_IGKJ1*01 1087
2382 VH3-23_IGHD6-6*01>3′_IGHJ6*01 1815 gnl|Fabrus|L11_IGKJ1*01 1087
2383 VH3-23_IGHD1-1*01>1_IGHJ6*01 1711 gnl|Fabrus|L12_IGKJ1*01 1088
2384 VH3-23_IGHD1-1*01>2_IGHJ6*01 1712 gnl|Fabrus|L12_IGKJ1*01 1088
2385 VH3-23_IGHD1-1*01>3_IGHJ6*01 1713 gnl|Fabrus|L12_IGKJ1*01 1088
2386 VH3-23_IGHD1-7*01>1_IGHJ6*01 1714 gnl|Fabrus|L12_IGKJ1*01 1088
2387 VH3-23_IGHD1-7*01>3_IGHJ6*01 1715 gnl|Fabrus|L12_IGKJ1*01 1088
2388 VH3-23_IGHD1-14*01>1_IGHJ6*01 1716 gnl|Fabrus|L12_IGKJ1*01 1088
2389 VH3-23_IGHD1-14*01>3_IGHJ6*01 1717 gnl|Fabrus|L12_IGKJ1*01 1088
2390 VH3-23_IGHD1-20*01>1_IGHJ6*01 1718 gnl|Fabrus|L12_IGKJ1*01 1088
2391 VH3-23_IGHD1-20*01>3_IGHJ6*01 1719 gnl|Fabrus|L12_IGKJ1*01 1088
2392 VH3-23_IGHD1-26*01>1_IGHJ6*01 1720 gnl|Fabrus|L12_IGKJ1*01 1088
2393 VH3-23_IGHD1-26*01>3_IGHJ6*01 1721 gnl|Fabrus|L12_IGKJ1*01 1088
2394 VH3-23_IGHD2-2*01>2_IGHJ6*01 1722 gnl|Fabrus|L12_IGKJ1*01 1088
2395 VH3-23_IGHD2-2*01>3_IGHJ6*01 1723 gnl|Fabrus|L12_IGKJ1*01 1088
2396 VH3-23_IGHD2-8*01>2_IGHJ6*01 1724 gnl|Fabrus|L12_IGKJ1*01 1088
2397 VH3-23_IGHD2-8*01>3_IGHJ6*01 1725 gnl|Fabrus|L12_IGKJ1*01 1088
2398 VH3-23_IGHD2-15*01>2_IGHJ6*01 1726 gnl|Fabrus|L12_IGKJ1*01 1088
2399 VH3-23_IGHD2-15*01>3_IGHJ6*01 1727 gnl|Fabrus|L12_IGKJ1*01 1088
2400 VH3-23_IGHD2-21*01>2_IGHJ6*01 1728 gnl|Fabrus|L12_IGKJ1*01 1088
2401 VH3-23_IGHD2-21*01>3_IGHJ6*01 1729 gnl|Fabrus|L12_IGKJ1*01 1088
2402 VH3-23_IGHD3-3*01>1_IGHJ6*01 1730 gnl|Fabrus|L12_IGKJ1*01 1088
2403 VH3-23_IGHD3-3*01>2_IGHJ6*01 1731 gnl|Fabrus|L12_IGKJ1*01 1088
2404 VH3-23_IGHD3-3*01>3_IGHJ6*01 1732 gnl|Fabrus|L12_IGKJ1*01 1088
2405 VH3-23_IGHD3-9*01>2_IGHJ6*01 1733 gnl|Fabrus|L12_IGKJ1*01 1088
2406 VH3-23_IGHD3-10*01>2_IGHJ6*01 1734 gnl|Fabrus|L12_IGKJ1*01 1088
2407 VH3-23_IGHD3-10*01>3_IGHJ6*01 1735 gnl|Fabrus|L12_IGKJ1*01 1088
2408 VH3-23_IGHD3-16*01>2_IGHJ6*01 1736 gnl|Fabrus|L12_IGKJ1*01 1088
2409 VH3-23_IGHD3-16*01>3_IGHJ6*01 1737 gnl|Fabrus|L12_IGKJ1*01 1088
2410 VH3-23_IGHD3-22*01>2_IGHJ6*01 1738 gnl|Fabrus|L12_IGKJ1*01 1088
2411 VH3-23_IGHD3-22*01>3_IGHJ6*01 1739 gnl|Fabrus|L12_IGKJ1*01 1088
2412 VH3-23_IGHD4-4*01 (1) >2_IGHJ6*01 1740 gnl|Fabrus|L12_IGKJ1*01 1088
2413 VH3-23_IGHD4-4*01 (1) >3_IGHJ6*01 1741 gnl|Fabrus|L12_IGKJ1*01 1088
2414 VH3-23_IGHD4-11*01 (1) >2_IGHJ6*01 1742 gnl|Fabrus|L12_IGKJ1*01 1088
2415 VH3-23_IGHD4-11*01 (1) >3_IGHJ6*01 1743 gnl|Fabrus|L12_IGKJ1*01 1088
2416 VH3-23_IGHD4-17*01>2_IGHJ6*01 1744 gnl|Fabrus|L12_IGKJ1*01 1088
2417 VH3-23_IGHD4-17*01>3_IGHJ6*01 1745 gnl|Fabrus|L12_IGKJ1*01 1088
2418 VH3-23_IGHD4-23*01>2_IGHJ6*01 1746 gnl|Fabrus|L12_IGKJ1*01 1088
2419 VH3-23_IGHD4-23*01>3_IGHJ6*01 1747 gnl|Fabrus|L12_IGKJ1*01 1088
2420 VH3-23_IGHD5-5*01 (2) >1_IGHJ6*01 1748 gnl|Fabrus|L12_IGKJ1*01 1088
2421 VH3-23_IGHD5-5*01 (2) >2_IGHJ6*01 1749 gnl|Fabrus|L12_IGKJ1*01 1088
2422 VH3-23_IGHD5-5*01 (2) >3_IGHJ6*01 1750 gnl|Fabrus|L12_IGKJ1*01 1088
2423 VH3-23_IGHD5-12*01>1_IGHJ6*01 1751 gnl|Fabrus|L12_IGKJ1*01 1088
2424 VH3-23_IGHD5-12*01>3_IGHJ6*01 1752 gnl|Fabrus|L12_IGKJ1*01 1088
2425 VH3-23_IGHD5-18*01 (2) >1_IGHJ6*01 1753 gnl|Fabrus|L12_IGKJ1*01 1088
2426 VH3-23_IGHD5-18*01 (2) >2_IGHJ6*01 1754 gnl|Fabrus|L12_IGKJ1*01 1088
2427 VH3-23_IGHD5-18*01 (2) >3_IGHJ6*01 1755 gnl|Fabrus|L12_IGKJ1*01 1088
2428 VH3-23_IGHD5-24*01>1_IGHJ6*01 1756 gnl|Fabrus|L12_IGKJ1*01 1088
2429 VH3-23_IGHD5-24*01>3_IGHJ6*01 1757 gnl|Fabrus|L12_IGKJ1*01 1088
2430 VH3-23_IGHD6-6*01>1_IGHJ6*01 1758 gnl|Fabrus|L12_IGKJ1*01 1088
2431 VH3-23_IGHD1-1*01>1′_IGHJ6*01 1768 gnl|Fabrus|L12_IGKJ1*01 1088
2432 VH3-23_IGHD1-1*01>2′_IGHJ6*01 1769 gnl|Fabrus|L12_IGKJ1*01 1088
2433 VH3-23_IGHD1-1*01>3′_IGHJ6*01 1770 gnl|Fabrus|L12_IGKJ1*01 1088
2434 VH3-23_IGHD1-7*01>1′_IGHJ6*01 1771 gnl|Fabrus|L12_IGKJ1*01 1088
2435 VH3-23_IGHD1-7*01>3′_IGHJ6*01 1772 gnl|Fabrus|L12_IGKJ1*01 1088
2436 VH3-23_IGHD1-14*01>1′_IGHJ6*01 1773 gnl|Fabrus|L12_IGKJ1*01 1088
2437 VH3-23_IGHD1-14*01>2′_IGHJ6*01 1774 gnl|Fabrus|L12_IGKJ1*01 1088
2438 VH3-23_IGHD1-14*01>3′_IGHJ6*01 1775 gnl|Fabrus|L12_IGKJ1*01 1088
2439 VH3-23_IGHD1-20*01>1′_IGHJ6*01 1776 gnl|Fabrus|L12_IGKJ1*01 1088
2440 VH3-23_IGHD1-20*01>2′_IGHJ6*01 1777 gnl|Fabrus|L12_IGKJ1*01 1088
2441 VH3-23_IGHD1-20*01>3′_IGHJ6*01 1778 gnl|Fabrus|L12_IGKJ1*01 1088
2442 VH3-23_IGHD1-26*01>1′_IGHJ6*01 1779 gnl|Fabrus|L12_IGKJ1*01 1088
2443 VH3-23_IGHD1-26*01>1_IGHJ6*01_B 1780 gnl|Fabrus|L12_IGKJ1*01 1088
2444 VH3-23_IGHD2-2*01>2_IGHJ6*01_B 1781 gnl|Fabrus|L12_IGKJ1*01 1088
2445 VH3-23_IGHD2-2*01>3′_IGHJ6*01 1782 gnl|Fabrus|L12_IGKJ1*01 1088
2446 VH3-23_IGHD2-8*01>1′_IGHJ6*01 1783 gnl|Fabrus|L12_IGKJ1*01 1088
2447 VH3-23_IGHD2-15*01>1′_IGHJ6*01 1784 gnl|Fabrus|L12_IGKJ1*01 1088
2448 VH3-23_IGHD2-15*01>3′_IGHJ6*01 1785 gnl|Fabrus|L12_IGKJ1*01 1088
2449 VH3-23_IGHD2-21*01>1′_IGHJ6*01 1786 gnl|Fabrus|L12_IGKJ1*01 1088
2450 VH3-23_IGHD2-21*01>3′_IGHJ6*01 1787 gnl|Fabrus|L12_IGKJ1*01 1088
2451 VH3-23_IGHD3-3*01>1′_IGHJ6*01 1788 gnl|Fabrus|L12_IGKJ1*01 1088
2452 VH3-23_IGHD3-3*01>3′_IGHJ6*01 1789 gnl|Fabrus|L12_IGKJ1*01 1088
2453 VH3-23_IGHD3-9*01>1′_IGHJ6*01 1790 gnl|Fabrus|L12_IGKJ1*01 1088
2454 VH3-23_IGHD3-9*01>3′_IGHJ6*01 1791 gnl|Fabrus|L12_IGKJ1*01 1088
2455 VH3-23_IGHD3-10*01>1′_IGHJ6*01 1792 gnl|Fabrus|L12_IGKJ1*01 1088
2456 VH3-23_IGHD3-10*01>3′_IGHJ6*01 1793 gnl|Fabrus|L12_IGKJ1*01 1088
2457 VH3-23_IGHD3-16*01>1′_IGHJ6*01 1794 gnl|Fabrus|L12_IGKJ1*01 1088
2458 VH3-23_IGHD3-16*01>3′_IGHJ6*01 1795 gnl|Fabrus|L12_IGKJ1*01 1088
2459 VH3-23_IGHD3-22*01>1′_IGHJ6*01 1796 gnl|Fabrus|L12_IGKJ1*01 1088
2460 VH3-23_IGHD4-4*01 (1) >1′_IGHJ6*01 1797 gnl|Fabrus|L12_IGKJ1*01 1088
2461 VH3-23_IGHD4-4*01 (1) >3′_IGHJ6*01 1798 gnl|Fabrus|L12_IGKJ1*01 1088
2462 VH3-23_IGHD4-11*01 (1) >1′_IGHJ6*01 1799 gnl|Fabrus|L12_IGKJ1*01 1088
2463 VH3-23_IGHD4-11*01 (1) >3′_IGHJ6*01 1800 gnl|Fabrus|L12_IGKJ1*01 1088
2464 VH3-23_IGHD4-17*01>1′_IGHI6*01 1801 gnl|Fabrus|L12_IGKJ1*01 1088
2465 VH3-23_IGHD4-17*01>3′_IGHJ6*01 1802 gnl|Fabrus|L12_IGKJ1*01 1088
2466 VH3-23_IGHD4-23*01>1′_IGHJ6*01 1803 gnl|Fabrus|L12_IGKJ1*01 1088
2467 VH3-23_IGHD4-23*01>3′_IGHJ6*01 1804 gnl|Fabrus|L12_IGKJ1*01 1088
2468 VH3-23_IGHD5-5*01 (2) >1′_IGHJ6*01 1805 gnl|Fabrus|L12_IGKJ1*01 1088
2469 VH3-23_IGHD5-5*01 (2) >3′_IGHJ6*01 1806 gnl|Fabrus|L12_IGKJ1*01 1088
2470 VH3-23_IGHD5-12*01>1′_IGHJ6*01 1807 gnl|Fabrus|L12_IGKJ1*01 1088
2471 VH3-23_IGHD5-12*01>3′_IGHJ6*01 1808 gnl|Fabrus|L12_IGKJ1*01 1088
2472 VH3-23_IGHD5-18*01 (2) >1′_IGHJ6*01 1809 gnl|Fabrus|L12_IGKJ1*01 1088
2473 VH3-23_IGHD5-18*01 (2) >3′_IGHJ6*01 1810 gnl|Fabrus|L12_IGKJ1*01 1088
2474 VH3-23_IGHD5-24*01>1′_IGHJ6*01 1811 gnl|Fabrus|L12_IGKJ1*01 1088
2475 VH3-23_IGHD5-24*01>3′_IGHI6*01 1812 gnl|Fabrus|L12_IGKJ1*01 1088
2476 VH3-23_IGHD6-6*01>1′_IGHJ6*01 1813 gnl|Fabrus|L12_IGKJ1*01 1088
2477 VH3-23_IGHD6-6*01>2′_IGHJ6*01 1814 gnl|Fabrus|L12_IGKJ1*01 1088
2478 VH3-23_IGHD6-6*01>3′_IGHJ6*01 1815 gnl|Fabrus|L12_IGKJ1*01 1088
2479 VH3-23_IGHD1-1*01>1_IGHJ6*01 1711 gnl|Fabrus|O1_IGKJ1*01 1100
2480 VH3-23_IGHD1-1*01>2_IGHJ6*01 1712 gnl|Fabrus|O1_IGKJ1*01 1100
2481 VH3-23_IGHD1-1*01>3_IGHJ6*01 1713 gnl|Fabrus|O1_IGKJ1*01 1100
2482 VH3-23_IGHD1-7*01>1_IGHJ6*01 1714 gnl|Fabrus|O1_IGKJ1*01 1100
2483 VH3-23_IGHD1-7*01>3_IGHJ6*01 1715 gnl|Fabrus|O1_IGKJ1*01 1100
2484 VH3-23_IGHD1-14*01>1_IGHJ6*01 1716 gnl|Fabrus|O1_IGKJ1*01 1100
2485 VH3-23_IGHD1-14*01>3_IGHJ6*01 1717 gnl|Fabrus|O1_IGKJ1*01 1100
2486 VH3-23_IGHD1-20*01>1_IGHJ6*01 1718 gnl|Fabrus|O1_IGKJ1*01 1100
2487 VH3-23_IGHD1-20*01>3_IGHJ6*01 1719 gnl|Fabrus|O1_IGKJ1*01 1100
2488 VH3-23_IGHD1-26*01>1_IGHJ6*01 1720 gnl|Fabrus|O1_IGKJ1*01 1100
2489 VH3-23_IGHD1-26*01>3_IGHJ6*01 1721 gnl|Fabrus|O1_IGKJ1*01 1100
2490 VH3-23_IGHD2-2*01>2_IGHJ6*01 1722 gnl|Fabrus|O1_IGKJ1*01 1100
2491 VH3-23_IGHD2-2*01>3_IGHJ6*01 1723 gnl|Fabrus|O1_IGKJ1*01 1100
2492 VH3-23_IGHD2-8*01>2_IGHJ6*01 1724 gnl|Fabrus|O1_IGKJ1*01 1100
2493 VH3-23_IGHD2-8*01>3_IGHJ6*01 1725 gnl|Fabrus|O1_IGKJ1*01 1100
2494 VH3-23_IGHD2-15*01>2_IGHJ6*01 1726 gnl|Fabrus|O1_IGKJ1*01 1100
2495 VH3-23_IGHD2-15*01>3_IGHJ6*01 1727 gnl|Fabrus|O1_IGKJ1*01 1100
2496 VH3-23_IGHD2-21*01>2_IGHJ6*01 1728 gnl|Fabrus|O1_IGKJ1*01 1100
2497 VH3-23_IGHD2-21*01>3_IGHJ6*01 1729 gnl|Fabrus|O1_IGKJ1*01 1100
2498 VH3-23_IGHD3-3*01>1_IGHJ6*01 1730 gnl|Fabrus|O1_IGKJ1*01 1100
2499 VH3-23_IGHD3-3*01>2_IGHJ6*01 1731 gnl|Fabrus|O1_IGKJ1*01 1100
2500 VH3-23_IGHD3-3*01>3_IGHJ6*01 1732 gnl|Fabrus|O1_IGKJ1*01 1100
2501 VH3-23_IGHD3-9*01>2_IGHJ6*01 1733 gnl|Fabrus|O1_IGKJ1*01 1100
2502 VH3-23_IGHD3-10*01>2_IGHJ6*01 1734 gnl|Fabrus|O1_IGKJ1*01 1100
2503 VH3-23_IGHD3-10*01>3_IGHJ6*01 1735 gnl|Fabrus|O1_IGKJ1*01 1100
2504 VH3-23_IGHD3-16*01>2_IGHJ6*01 1736 gnl|Fabrus|O1_IGKJ1*01 1100
2505 VH3-23_IGHD3-16*01>3_IGHJ6*01 1737 gnl|Fabrus|O1_IGKJ1*01 1100
2506 VH3-23_IGHD3-22*01>2_IGHJ6*01 1738 gnl|Fabrus|O1_IGKJ1*01 1100
2507 VH3-23_IGHD3-22*01>3_IGHJ6*01 1739 gnl|Fabrus|O1_IGKJ1*01 1100
2508 VH3-23_IGHD4-4*01 (1) >2_IGHJ6*01 1740 gnl|Fabrus|O1_IGKJ1*01 1100
2509 VH3-23_IGHD4-4*01 (1) >3_IGHJ6*01 1741 gnl|Fabrus|O1_IGKJ1*01 1100
2510 VH3-23_IGHD4-11*01 (1) >2_IGHJ6*01 1742 gnl|Fabrus|O1_IGKJ1*01 1100
2511 VH3-23_IGHD4-11*01 (1) >3_IGHJ6*01 1743 gnl|Fabrus|O1_IGKJ1*01 1100
2512 VH3-23_IGHD4-17*01>2_IGHJ6*01 1744 gnl|Fabrus|O1_IGKJ1*01 1100
2513 VH3-23_IGHD4-17*01>3_IGHJ6*01 1745 gnl|Fabrus|O1_IGKJ1*01 1100
2514 VH3-23_IGHD4-23*01>2_IGHJ6*01 1746 gnl|Fabrus|O1_IGKJ1*01 1100
2515 VH3-23_IGHD4-23*01>3_IGHJ6*01 1747 gnl|Fabrus|O1_IGKJ1*01 1100
2516 VH3-23_IGHD5-5*01 (2) >1_IGHJ6*01 1748 gnl|Fabrus|O1_IGKJ1*01 1100
2517 VH3-23_IGHD5-5*01 (2) >2_IGHJ6*01 1749 gnl|Fabrus|O1_IGKJ1*01 1100
2518 VH3-23_IGHD5-5*01 (2) >3_IGHJ6*01 1750 gnl|Fabrus|O1_IGKJ1*01 1100
2519 VH3-23_IGHD5-12*01>1_IGHJ6*01 1751 gnl|Fabrus|O1_IGKJ1*01 1100
2520 VH3-23_IGHD5-12*01>3_IGHJ6*01 1752 gnl|Fabrus|O1_IGKJ1*01 1100
2521 VH3-23_IGHD5-18*01 (2) >1_IGHJ6*01 1753 gnl|Fabrus|O1_IGKJ1*01 1100
2522 VH3-23_IGHD5-18*01 (2) >2_IGHJ6*01 1754 gnl|Fabrus|O1_IGKJ1*01 1100
2523 VH3-23_IGHD5-18*01 (2) >3_IGHJ6*01 1755 gnl|Fabrus|O1_IGKJ1*01 1100
2524 VH3-23_IGHD5-24*01>1_IGHJ6*01 1756 gnl|Fabrus|O1_IGKJ1*01 1100
2525 VH3-23_IGHD5-24*01>3_IGHJ6*01 1757 gnl|Fabrus|O1_IGKJ1*01 1100
2526 VH3-23_IGHD6-6*01>1_IGHJ6*01 1758 gnl|Fabrus|O1_IGKJ1*01 1100
2527 VH3-23_IGHD1-1*01>1′_IGHJ6*01 1768 gnl|Fabrus|O1_IGKJ1*01 1100
2528 VH3-23_IGHD1-1*01>2′_IGHJ6*01 1769 gnl|Fabrus|O1_IGKJ1*01 1100
2529 VH3-23_IGHD1-1*01>3′_IGHJ6*01 1770 gnl|Fabrus|O1_IGKJ1*01 1100
2530 VH3-23_IGHD1-7*01>1′_IGHJ6*01 1771 gnl|Fabrus|O1_IGKJ1*01 1100
2531 VH3-23_IGHD1-7*01>3′_IGHJ6*01 1772 gnl|Fabrus|O1_IGKJ1*01 1100
2532 VH3-23_IGHD1-14*01>1′_IGHJ6*01 1773 gnl|Fabrus|O1_IGKJ1*01 1100
2533 VH3-23_IGHD1-14*01>2′_IGHJ6*01 1774 gnl|Fabrus|O1_IGKJ1*01 1100
2534 VH3-23_IGHD1-14*01>3′_IGHJ6*01 1775 gnl|Fabrus|O1_IGKJ1*01 1100
2535 VH3-23_IGHD1-20*01>1′_IGHJ6*01 1776 gnl|Fabrus|O1_IGKJ1*01 1100
2536 VH3-23_IGHD1-20*01>2′_IGHJ6*01 1777 gnl|Fabrus|O1_IGKJ1*01 1100
2537 VH3-23_IGHD1-20*01>3′_IGHJ6*01 1778 gnl|Fabrus|O1_IGKJ1*01 1100
2538 VH3-23_IGHD1-26*01>1′_IGHJ6*01 1779 gnl|Fabrus|O1_IGKJ1*01 1100
2539 VH3-23_IGHD1-26*01>1_IGHJ6*01_B 1780 gnl|Fabrus|O1_IGKJ1*01 1100
2540 VH3-23_IGHD2-2*01>2_IGHJ6*01_B 1781 gnl|Fabrus|O1_IGKJ1*01 1100
2541 VH3-23_IGHD2-2*01>3′_IGHJ6*01 1782 gnl|Fabrus|O1_IGKJ1*01 1100
2542 VH3-23_IGHD2-8*01>1′_IGHJ6*01 1783 gnl|Fabrus|O1_IGKJ1*01 1100
2543 VH3-23_IGHD2-15*01>1′_IGHJ6*01 1784 gnl|Fabrus|O1_IGKJ1*01 1100
2544 VH3-23_IGHD2-15*01>3′_IGHJ6*01 1785 gnl|Fabrus|O1_IGKJ1*01 1100
2545 VH3-23_IGHD2-21*01>1′_IGHJ6*01 1786 gnl|Fabrus|O1_IGKJ1*01 1100
2546 VH3-23_IGHD2-21*01>3′_IGHJ6*01 1787 gnl|Fabrus|O1_IGKJ1*01 1100
2547 VH3-23_IGHD3-3*01>1′_IGHJ6*01 1788 gnl|Fabrus|O1_IGKJ1*01 1100
2548 VH3-23_IGHD3-3*01>3′_IGHJ6*01 1789 gnl|Fabrus|O1_IGKJ1*01 1100
2549 VH3-23_IGHD3-9*01>1′_IGHJ6*01 1790 gnl|Fabrus|O1_IGKJ1*01 1100
2550 VH3-23_IGHD3-9*01>3′_IGHJ6*01 1791 gnl|Fabrus|O1_IGKJ1*01 1100
2551 VH3-23_IGHD3-10*01>1′_IGHJ6*01 1792 gnl|Fabrus|O1_IGKJ1*01 1100
2552 VH3-23_IGHD3-10*01>3′_IGHJ6*01 1793 gnl|Fabrus|O1_IGKJ1*01 1100
2553 VH3-23_IGHD3-16*01>1′_IGHJ6*01 1794 gnl|Fabrus|O1_IGKJ1*01 1100
2554 VH3-23_IGHD3-16*01>3′_IGHJ6*01 1795 gnl|Fabrus|O1_IGKJ1*01 1100
2555 VH3-23_IGHD3-22*01>1′_1GHJ6*01 1796 gnl|Fabrus|O1_IGKJ1*01 1100
2556 VH3-23_IGHD4-4*01 (1) >1′_IGHJ6*01 1797 gnl|Fabrus|O1_IGKJ1*01 1100
2557 VH3-23_IGHD4-4*01 (1) >3′_IGHJ6*01 1798 gnl|Fabrus|O1_IGKJ1*01 1100
2558 VH3-23_IGHD4-11*01 (1) >1′_IGHJ6*01 1799 gnl|Fabrus|O1_IGKJ1*01 1100
2559 VH3-23_IGHD4-11*01 (1) >3′_IGHJ6*01 1800 gnl|Fabrus|O1_IGKJ1*01 1100
2560 VH3-23_IGHD4-17*01>1′_IGHJ6*01 1801 gnl|Fabrus|O1_IGKJ1*01 1100
2561 VH3-23_IGHD4-17*01>3′_IGHJ6*01 1802 gnl|Fabrus|O1_IGKJ1*01 1100
2562 VH3-23_IGHD4-23*01>1′_IGHJ6*01 1803 gnl|Fabrus|O1_IGKJ1*01 1100
2563 VH3-23_IGHD4-23*01>3′_IGHJ6*01 1804 gnl|Fabrus|O1_IGKJ1*01 1100
2564 VH3-23_IGHD5-5*01 (2) >1′_IGHJ6*01 1805 gnl|Fabrus|O1_IGKJ1*01 1100
2565 VH3-23_IGHD5-5*01 (2) >3′_IGHJ6*01 1806 gnl|Fabrus|O1_IGKJ1*01 1100
2566 VH3-23_IGHD5-12*01>1′_IGHJ6*01 1807 gnl|Fabrus|O1_IGKJ1*01 1100
2567 VH3-23_IGHD5-12*01>3′_IGHJ6*01 1808 gnl|Fabrus|O1_IGKJ1*01 1100
2568 VH3-23_IGHD5-18*01 (2) >1′_IGHJ6*01 1809 gnl|Fabrus|O1_IGKJ1*01 1100
2569 VH3-23_IGHD5-18*01 (2) >3′_IGHJ6*01 1810 gnl|Fabrus|O1_IGKJ1*01 1100
2570 VH3-23_IGHD5-24*01>1′_IGHJ6*01 1811 gnl|Fabrus|O1_IGKJ1*01 1100
2571 VH3-23_IGHD5-24*01>3′_IGHJ6*01 1812 gnl|Fabrus|O1_IGKJ1*01 1100
2572 VH3-23_IGHD6-6*01>1′_IGHJ6*01 1813 gnl|Fabrus|O1_IGKJ1*01 1100
2573 VH3-23_IGHD6-6*01>2′_IGHJ6*01 1814 gnl|Fabrus|O1_IGKJ1*01 1100
2574 VH3-23_IGHD6-6*01>3′_IGHJ6*01 1815 gnl|Fabrus|O1_IGKJ1*01 1100
2575 VH3-23_IGHD1-1*01>1_IGHJ5*01 1596 gnl|Fabrus|A2_IGKJ1*01 1076
2576 VH3-23_IGHD1-1*01>2_IGHJ5*01 1597 gnl|Fabrus|A2_IGKJ1*01 1076
2577 VH3-23_IGHD1-1*01>3_IGHJ5*01 1598 gnl|Fabrus|A2_IGKJ1*01 1076
2578 VH3-23_IGHD1-7*01>1_IGHJ5*01 1599 gnl|Fabrus|A2_IGKJ1*01 1076
2579 VH3-23_IGHD1-7*01>3_IGHJ5*01 1600 gnl|Fabrus|A2_IGKJ1*01 1076
2580 VH3-23_IGHD1-14*01>1_IGHJ5*01 1601 gnl|Fabrus|A2_IGKJ1*01 1076
2581 VH3-23_IGHD1-14*01>3_IGHJ5*01 1602 gnl|Fabrus|A2_IGKJ1*01 1076
2582 VH3-23_IGHD1-20*01>1_IGHJ5*01 1603 gnl|Fabrus|A2_IGKJ1*01 1076
2583 VH3-23_IGHD1-20*01>3_IGHJ5*01 1604 gnl|Fabrus|A2_IGKJ1*01 1076
2584 VH3-23_IGHD1-26*01>1_IGHJ5*01 1605 gnl|Fabrus|A2_IGKJ1*01 1076
2585 VH3-23_IGHD1-26*01>3_IGHJ5*01 1606 gnl|Fabrus|A2_IGKJ1*01 1076
2586 VH3-23_IGHD2-2*01>2_IGHJ5*01 1607 gnl|Fabrus|A2_IGKJ1*01 1076
2587 VH3-23_IGHD2-2*01>3_IGHJ5*01 1608 gnl|Fabrus|A2_IGKJ1*01 1076
2588 VH3-23_IGHD2-8*01>2_IGHJ5*01 1609 gnl|Fabrus|A2_IGKJ1*01 1076
2589 VH3-23_IGHD2-8*01>3_IGHJ5*01 1610 gnl|Fabrus|A2_IGKJ1*01 1076
2590 VH3-23_IGHD2-15*01>2_IGHJ5*01 1611 gnl|Fabrus|A2_IGKJ1*01 1076
2591 VH3-23_IGHD2-15*01>3_IGHJ5*01 1612 gnl|Fabrus|A2_IGKJ1*01 1076
2592 VH3-23_IGHD2-21*01>2_IGHJ5*01 1613 gnl|Fabrus|A2_IGKJ1*01 1076
2593 VH3-23_IGHD2-21*01>3_IGHJ5*01 1614 gnl|Fabrus|A2_IGKJ1*01 1076
2594 VH3-23_IGHD3-3*01>1_IGHJ5*01 1615 gnl|Fabrus|A2_IGKJ1*01 1076
2595 VH3-23_IGHD3-3*01>2_IGHJ5*01 1616 gnl|Fabrus|A2_IGKJ1*01 1076
2596 VH3-23_IGHD3-3*01>3_IGHJ5*01 1617 gnl|Fabrus|A2_IGKJ1*01 1076
2597 VH3-23_IGHD3-9*01>2_IGHJ5*01 1618 gnl|Fabrus|A2_IGKJ1*01 1076
2598 VH3-23_IGHD3-10*01>2_IGHJ5*01 1619 gnl|Fabrus|A2_IGKJ1*01 1076
2599 VH3-23_IGHD3-10*01>3_IGHJ5*01 1620 gnl|Fabrus|A2_IGKJ1*01 1076
2600 VH3-23_IGHD3-16*01>2_IGHJ5*01 1621 gnl|Fabrus|A2_IGKJ1*01 1076
2601 VH3-23_IGHD3-16*01>3_IGHJ5*01 1622 gnl|Fabrus|A2_IGKJ1*01 1076
2602 VH3-23_IGHD3-22*01>2_IGHJ5*01 1623 gnl|Fabrus|A2_IGKJ1*01 1076
2603 VH3-23_IGHD3-22*01>3_IGHJ5*01 1624 gnl|Fabrus|A2_IGKJ1*01 1076
2604 VH3-23_IGHD4-4*01 (1) >2_IGHJ5*01 1625 gnl|Fabrus|A2_IGKJ1*01 1076
2605 VH3-23_IGHD4-4*01 (1) >3_IGHJ5*01 1626 gnl|Fabrus|A2_IGKJ1*01 1076
2606 VH3-23_IGHD4-11*01 (1) >2_IGHJ5*01 1627 gnl|Fabrus|A2_IGKJ1*01 1076
2607 VH3-23_IGHD4-11*01 (1) >3_IGHJ5*01 1628 gnl|Fabrus|A2_IGKJ1*01 1076
2608 VH3-23_IGHD4-17*01>2_IGHJ5*01 1629 gnl|Fabrus|A2_IGKJ1*01 1076
2609 VH3-23_IGHD4-17*01>3_IGHJ5*01 1630 gnl|Fabrus|A2_IGKJ1*01 1076
2610 VH3-23_IGHD4-23*01>2_IGHJ5*01 1631 gnl|Fabrus|A2_IGKJ1*01 1076
2611 VH3-23_IGHD4-23*01>3_IGHJ5*01 1632 gnl|Fabrus|A2_IGKJ1*01 1076
2612 VH3-23_IGHD5-5*01 (2) >1_IGHJ5*01 1633 gnl|Fabrus|A2_IGKJ1*01 1076
2613 VH3-23_IGHD5-5*01 (2) >2_IGHJ5*01 1634 gnl|Fabrus|A2_IGKJ1*01 1076
2614 VH3-23_IGHD5-5*01 (2) >3_IGHJ5*01 1635 gnl|Fabrus|A2_IGKJ1*01 1076
2615 VH3-23_IGHD5-12*01>1_IGHJ5*01 1636 gnl|Fabrus|A2_IGKJ1*01 1076
2616 VH3-23_IGHD5-12*01>3_IGHJ5*01 1637 gnl|Fabrus|A2_IGKJ1*01 1076
2617 VH3-23_IGHD5-18*01 (2) >1_IGHJ5*01 1638 gnl|Fabrus|A2_IGKJ1*01 1076
2618 VH3-23_IGHD5-18*01 (2) >2_IGHJ5*01 1639 gnl|Fabrus|A2_IGKJ1*01 1076
2619 VH3-23_IGHD5-18*01 (2) >3_IGHJ5*01 1640 gnl|Fabrus|A2_IGKJ1*01 1076
2620 VH3-23_IGHD5-24*01>1_IGHJ5*01 1641 gnl|Fabrus|A2_IGKJ1*01 1076
2621 VH3-23_IGHD5-24*01>3_IGHJ5*01 1642 gnl|Fabrus|A2_IGKJ1*01 1076
2622 VH3-23_IGHD6-6*01>1_IGHJ5*01 1643 gnl|Fabrus|A2_IGKJ1*01 1076
2623 VH3-23_IGHD1-1*01>1′_IGHJ5*01 1653 gnl|Fabrus|A2_IGKJ1*01 1076
2624 VH3-23_IGHD1-1*01>2′_IGHJ5*01 1654 gnl|Fabrus|A2_IGKJ1*01 1076
2625 VH3-23_IGHD1-1*01>3′_IGHJ5*01 1655 gnl|Fabrus|A2_IGKJ1*01 1076
2626 VH3-23_IGHD1-7*01>1′_IGHJ5*01 1656 gnl|Fabrus|A2_IGKJ1*01 1076
2627 VH3-23_IGHD1-7*01>3′_IGHJ5*01 1657 gnl|Fabrus|A2_IGKJ1*01 1076
2628 VH3-23_IGHD1-14*01>1′_IGHJ5*01 1658 gnl|Fabrus|A2_IGKJ1*01 1076
2629 VH3-23_IGHD1-14*01>2′_IGHJ5*01 1659 gnl|Fabrus|A2_IGKJ1*01 1076
2630 VH3-23_IGHD1-14*01>3′_IGHJ5*01 1660 gnl|Fabrus|A2_IGKJ1*01 1076
2631 VH3-23_IGHD1-20*01>1′_IGHJ5*01 1661 gnl|Fabrus|A2_IGKJ1*01 1076
2632 VH3-23_IGHD1-20*01>2′_IGHJ5*01 1662 gnl|Fabrus|A2_IGKJ1*01 1076
2633 VH3-23_IGHD1-20*01>3′_IGHJ5*01 1663 gnl|Fabrus|A2_IGKJ1*01 1076
2634 VH3-23_IGHD1-26*01>1′_IGHJ5*01 1664 gnl|Fabrus|A2_IGKJ1*01 1076
2635 VH3-23_IGHD1-26*01>3′_IGHJ5*01 1665 gnl|Fabrus|A2_IGKJ1*01 1076
2636 VH3-23_IGHD2-2*01>1′_IGHJ5*01 1666 gnl|Fabrus|A2_IGKJ1*01 1076
2637 VH3-23_IGHD2-2*01>3′_IGHJ5*01 1667 gnl|Fabrus|A2_IGKJ1*01 1076
2638 VH3-23_IGHD2-8*01>1′_IGHJ5*01 1668 gnl|Fabrus|A2_IGKJ1*01 1076
2639 VH3-23_IGHD2-15*01>1′_IGHJ5*01 1669 gnl|Fabrus|A2_IGKJ1*01 1076
2640 VH3-23_IGHD2-15*01>3′_IGHJ5*01 1670 gnl|Fabrus|A2_IGKJ1*01 1076
2641 VH3-23_IGHD2-21*01>1′_IGHJ5*01 1671 gnl|Fabrus|A2_IGKJ1*01 1076
2642 VH3-23_IGHD2-21*01>3′_IGHJ5*01 1672 gnl|Fabrus|A2_IGKJ1*01 1076
2643 VH3-23_IGHD3-3*01>1′_IGHJ5*01 1673 gnl|Fabrus|A2_IGKJ1*01 1076
2644 VH3-23_IGHD3-3*01>3′_IGHJ5*01 1674 gnl|Fabrus|A2_IGKJ1*01 1076
2645 VH3-23_IGHD3-9*01>1′_IGHJ5*01 1675 gnl|Fabrus|A2_IGKJ1*01 1076
2646 VH3-23_IGHD3-9*01>3′_IGHJ5*01 1676 gnl|Fabrus|A2_IGKJ1*01 1076
2647 VH3-23_IGHD3-10*01>1′_IGHJ5*01 1677 gnl|Fabrus|A2_IGKJ1*01 1076
2648 VH3-23_IGHD3-10*01>3′_IGHJ5*01 1678 gnl|Fabrus|A2_IGKJ1*01 1076
2649 VH3-23_IGHD3-16*01>1′_IGHJ5*01 1679 gnl|Fabrus|A2_IGKJ1*01 1076
2650 VH3-23_IGHD3-16*01>3′_IGHJ5*01 1680 gnl|Fabrus|A2_IGKJ1*01 1076
2651 VH3-23_IGHD3-22*01>1′_IGHJ5*01 1681 gnl|Fabrus|A2_IGKJ1*01 1076
2652 VH3-23_IGHD4-4*01 (1) >1′_IGHJ5*01 1682 gnl|Fabrus|A2_IGKJ1*01 1076
2653 VH3-23_IGHD4-4*01 (1) >3′_IGHJ5*01 1683 gnl|Fabrus|A2_IGKJ1*01 1076
2654 VH3-23_IGHD4-11*01 (1) >1′_IGHJ5*01 1684 gnl|Fabrus|A2_IGKJ1*01 1076
2655 VH3-23_IGHD4-11*01 (1) >3′_IGHJ5*01 1685 gnl|Fabrus|A2_IGKJ1*01 1076
2656 VH3-23_IGHD4-17*01>1′_IGHJ5*01 1686 gnl|Fabrus|A2_IGKJ1*01 1076
2657 VH3-23_IGHD4-17*01>3′_IGHJ5*01 1687 gnl|Fabrus|A2_IGKJ1*01 1076
2658 VH3-23_IGHD4-23*01>1′_IGHJ5*01 1688 gnl|Fabrus|A2_IGKJ1*01 1076
2659 VH3-23_IGHD4-23*01>3′_IGHJ5*01 1689 gnl|Fabrus|A2_IGKJ1*01 1076
2660 VH3-23_IGHD5-5*01 (2) >1′_IGHJ5*01 1690 gnl|Fabrus|A2_IGKJ1*01 1076
2661 VH3-23_IGHD5-5*01 (2) >3′_IGHJ5*01 1691 gnl|Fabrus|A2_IGKJ1*01 1076
2662 VH3-23_IGHD5-12*01>1′_IGHJ5*01 1692 gnl|Fabrus|A2_IGKJ1*01 1076
2663 VH3-23_IGHD5-12*01>3′_IGHJ5*01 1693 gnl|Fabrus|A2_IGKJ1*01 1076
2664 VH3-23_IGHD5-18*01 (2) >1′_IGHJ5*01 1694 gnl|Fabrus|A2_IGKJ1*01 1076
2665 VH3-23_IGHD5-18*01 (2) >3′_IGHJ5*01 1695 gnl|Fabrus|A2_IGKJ1*01 1076
2666 VH3-23_IGHD5-24*01>1′_IGHJ5*01 1696 gnl|Fabrus|A2_IGKJ1*01 1076
2667 VH3-23_IGHD5-24*01>3′_IGHJ5*01 1697 gnl|Fabrus|A2_IGKJ1*01 1076
2668 VH3-23_IGHD6-6*01>1′_IGHJ5*01 1698 gnl|Fabrus|A2_IGKJ1*01 1076
2669 VH3-23_IGHD6-6*01>2′_IGHJ5*01 1699 gnl|Fabrus|A2_IGKJ1*01 1076
2670 VH3-23_IGHD6-6*01>3′_IGHJ5*01 1700 gnl|Fabrus|A2_IGKJ1*01 1076
2671 VH3-23_IGHD1-1*01>1_IGHJ6*01 1711 gnl|Fabrus|L2_IGKJ1*01 1090
2672 VH3-23_IGHD1-1*01>2_IGHJ6*01 1712 gnl|Fabrus|L2_IGKJ1*01 1090
2673 VH3-23_IGHD1-1*01>3_IGHJ6*01 1713 gnl|Fabrus|L2_IGKJ1*01 1090
2674 VH3-23_IGHD1-7*01>1_IGHJ6*01 1714 gnl|Fabrus|L2_IGKJ1*01 1090
2675 VH3-23_IGHD1-7*01>3_IGHJ6*01 1715 gnl|Fabrus|L2_IGKJ1*01 1090
2676 VH3-23_IGHD1-14*01>1_IGHJ6*01 1716 gnl|Fabrus|L2_IGKJ1*01 1090
2677 VH3-23_IGHD1-14*01>3_IGHJ6*01 1717 gnl|Fabrus|L2_IGKJ1*01 1090
2678 VH3-23_IGHD1-20*01>1_IGHJ6*01 1718 gnl|Fabrus|L2_IGKJ1*01 1090
2679 VH3-23_IGHD1-20*01>3_IGHJ6*01 1719 gnl|Fabrus|L2_IGKJ1*01 1090
2680 VH3-23_IGHD1-26*01>1_IGHJ6*01 1720 gnl|Fabrus|L2_IGKJ1*01 1090
2681 VH3-23_IGHD1-26*01>3_IGHJ6*01 1721 gnl|Fabrus|L2_IGKJ1*01 1090
2682 VH3-23_IGHD2-2*01>2_IGHJ6*01 1722 gnl|Fabrus|L2_IGKJ1*01 1090
2683 VH3-23_IGHD2-2*01>3_IGHJ6*01 1723 gnl|Fabrus|L2_IGKJ1*01 1090
2684 VH3-23_IGHD2-8*01>2_IGHJ6*01 1724 gnl|Fabrus|L2_IGKJ1*01 1090
2685 VH3-23_IGHD2-8*01>3_IGHJ6*01 1725 gnl|Fabrus|L2_IGKJ1*01 1090
2686 VH3-23_IGHD2-15*01>2_IGHJ6*01 1726 gnl|Fabrus|L2_IGKJ1*01 1090
2687 VH3-23_IGHD2-15*01>3_IGHJ6*01 1727 gnl|Fabrus|L2_IGKJ1*01 1090
2688 VH3-23_IGHD2-21*01>2_IGHJ6*01 1728 gnl|Fabrus|L2_IGKJ1*01 1090
2689 VH3-23_IGHD2-21*01>3_IGHJ6*01 1729 gnl|Fabrus|L2_IGKJ1*01 1090
2690 VH3-23_IGHD3-3*01>1_IGHJ6*01 1730 gnl|Fabrus|L2_IGKJ1*01 1090
2691 VH3-23_IGHD3-3*01>2_IGHJ6*01 1731 gnl|Fabrus|L2_IGKJ1*01 1090
2692 VH3-23_IGHD3-3*01>3_IGHJ6*01 1732 gnl|Fabrus|L2_IGKJ1*01 1090
2693 VH3-23_IGHD3-9*01>2_IGHJ6*01 1733 gnl|Fabrus|L2_IGKJ1*01 1090
2694 VH3-23_IGHD3-10*01>2_IGHJ6*01 1734 gnl|Fabrus|L2_IGKJ1*01 1090
2695 VH3-23_IGHD3-10*01>3_IGHJ6*01 1735 gnl|Fabrus|L2_IGKJ1*01 1090
2696 VH3-23_IGHD3-16*01>2_IGHJ6*01 1736 gnl|Fabrus|L2_IGKJ1*01 1090
2697 VH3-23_IGHD3-16*01>3_IGHJ6*01 1737 gnl|Fabrus|L2_IGKJ1*01 1090
2698 VH3-23_IGHD3-22*01>2_IGHJ6*01 1738 gnl|Fabrus|L2_IGKJ1*01 1090
2699 VH3-23_IGHD3-22*01>3_IGHJ6*01 1739 gnl|Fabrus|L2_IGKJ1*01 1090
2700 VH3-23_IGHD4-4*01 (1) >2_IGHJ6*01 1740 gnl|Fabrus|L2_IGKJ1*01 1090
2701 VH3-23_IGHD4-4*01 (1) >3_IGHJ6*01 1741 gnl|Fabrus|L2_IGKJ1*01 1090
2702 VH3-23_IGHD4-11*01 (1) >2_IGHJ6*01 1742 gnl|Fabrus|L2_IGKJ1*01 1090
2703 VH3-23_IGHD4-11*01 (1) >3_IGHJ6*01 1743 gnl|Fabrus|L2_IGKJ1*01 1090
2704 VH3-23_IGHD4-17*01>2_IGHJ6*01 1744 gnl|Fabrus|L2_IGKJ1*01 1090
2705 VH3-23_IGHD4-17*01>3_IGHJ6*01 1745 gnl|Fabrus|L2_IGKJ1*01 1090
2706 VH3-23_IGHD4-23*01>2_IGHJ6*01 1746 gnl|Fabrus|L2_IGKJ1*01 1090
2707 VH3-23_IGHD4-23*01>3_IGHJ6*01 1747 gnl|Fabrus|L2_IGKJ1*01 1090
2708 VH3-23_IGHD5-5*01 (2) >1_IGHJ6*01 1748 gnl|Fabrus|L2_IGKJ1*01 1090
2709 VH3-23_IGHD5-5*01 (2) >2_IGHJ6*01 1749 gnl|Fabrus|L2_IGKJ1*01 1090
2710 VH3-23_IGHD5-5*01 (2) >3_IGHJ6*01 1750 gnl|Fabrus|L2_IGKJ1*01 1090
2711 VH3-23_IGHD5-12*01>1_IGHJ6*01 1751 gnl|Fabrus|L2_IGKJ1*01 1090
2712 VH3-23_IGHD5-12*01>3_IGHJ6*01 1752 gnl|Fabrus|L2_IGKJ1*01 1090
2713 VH3-23_IGHD5-18*01 (2) >1_IGHJ6*01 1753 gnl|Fabrus|L2_IGKJ1*01 1090
2714 VH3-23_IGHD5-18*01 (2) >2_IGHJ6*01 1754 gnl|Fabrus|L2_IGKJ1*01 1090
2715 VH3-23_IGHD5-18*01 (2) >3_IGHJ6*01 1755 gnl|Fabrus|L2_IGKJ1*01 1090
2716 VH3-23_IGHD5-24*01>1_IGHJ6*01 1756 gnl|Fabrus|L2_IGKJ1*01 1090
2717 VH3-23_IGHD5-24*01>3_IGHJ6*01 1757 gnl|Fabrus|L2_IGKJ1*01 1090
2718 VH3-23_IGHD6-6*01>1_IGHJ6*01 1758 gnl|Fabrus|L2_IGKJ1*01 1090
2719 VH3-23_IGHD1-1*01>1′_IGHJ6*01 1768 gnl|Fabrus|L2_IGKJ1*01 1090
2720 VH3-23_IGHD1-1*01>2′_IGHJ6*01 1769 gnl|Fabrus|L2_IGKJ1*01 1090
2721 VH3-23_IGHD1-1*01>3′_IGHJ6*01 1770 gnl|Fabrus|L2_IGKJ1*01 1090
2722 VH3-23_IGHD1-7*01>1′_IGHJ6*01 1771 gnl|Fabrus|L2_IGKJ1*01 1090
2723 VH3-23_IGHD1-7*01>3′_IGHJ6*01 1772 gnl|Fabrus|L2_IGKJ1*01 1090
2724 VH3-23_IGHD1-14*01>1′_IGHJ6*01 1773 gnl|Fabrus|L2_IGKJ1*01 1090
2725 VH3-23_IGHD1-14*01>2′_IGHJ6*01 1774 gnl|Fabrus|L2_IGKJ1*01 1090
2726 VH3-23_IGHD1-14*01>3′_IGHJ6*01 1775 gnl|Fabrus|L2_IGKJ1*01 1090
2727 VH3-23_IGHD1-20*01>1′_IGHJ6*01 1776 gnl|Fabrus|L2_IGKJ1*01 1090
2728 VH3-23_IGHD1-20*01>2′_IGHJ6*01 1777 gnl|Fabrus|L2_IGKJ1*01 1090
2729 VH3-23_IGHD1-20*01>3′_IGHJ6*01 1778 gnl|Fabrus|L2_IGKJ1*01 1090
2730 VH3-23_IGHD1-26*01>1′_IGHJ6*01 1779 gnl|Fabrus|L2_IGKJ1*01 1090
2731 VH3-23_IGHD1-26*01>1_IGHJ6*01_B 1780 gnl|Fabrus|L2_IGKJ1*01 1090
2732 VH3-23_IGHD2-2*01>2_IGHJ6*01_B 1781 gnl|Fabrus|L2_IGKJ1*01 1090
2733 VH3-23_IGHD2-2*01>3′_IGHJ6*01 1782 gnl|Fabrus|L2_IGKJ1*01 1090
2734 VH3-23_IGHD2-8*01>1′_IGHJ6*01 1783 gnl|Fabrus|L2_IGKJ1*01 1090
2735 VH3-23_IGHD2-15*01>1′_IGHJ6*01 1784 gnl|Fabrus|L2_IGKJ1*01 1090
2736 VH3-23_IGHD2-15*01>3′_IGHJ6*01 1785 gnl|Fabrus|L2_IGKJ1*01 1090
2737 VH3-23_IGHD2-21*01>1′_IGHJ6*01 1786 gnl|Fabrus|L2_IGKJ1*01 1090
2738 VH3-23_IGHD2-21*01>3′_IGHJ6*01 1787 gnl|Fabrus|L2_IGKJ1*01 1090
2739 VH3-23_IGHD3-3*01>1′_IGHJ6*01 1788 gnl|Fabrus|L2_IGKJ1*01 1090
2740 VH3-23_IGHD3-3*01>3′_IGHJ6*01 1789 gnl|Fabrus|L2_IGKJ1*01 1090
2741 VH3-23_IGHD3-9*01>1′_IGHJ6*01 1790 gnl|Fabrus|L2_IGKJ1*01 1090
2742 VH3-23_IGHD3-9*01>3′_IGHJ6*01 1791 gnl|Fabrus|L2_IGKJ1*01 1090
2743 VH3-23_IGHD3-10*01>1′_IGHJ6*01 1792 gnl|Fabrus|L2_IGKJ1*01 1090
2744 VH3-23_IGHD3-10*01>3′_IGHJ6*01 1793 gnl|Fabrus|L2_IGKJ1*01 1090
2745 VH3-23_IGHD3-16*01>1′_IGHJ6*01 1794 gnl|Fabrus|L2_IGKJ1*01 1090
2746 VH3-23_IGHD3-16*01>3′_IGHJ6*01 1795 gnl|Fabrus|L2_IGKJ1*01 1090
2747 VH3-23_IGHD3-22*01>1′_IGHJ6*01 1796 gnl|Fabrus|L2_IGKJ1*01 1090
2748 VH3-23_IGHD4-4*01 (1) >1′_IGHJ6*01 1797 gnl|Fabrus|L2_IGKJ1*01 1090
2749 VH3-23_IGHD4-4*01 (1) >3′_IGHJ6*01 1798 gnl|Fabrus|L2_IGKJ1*01 1090
2750 VH3-23_IGHD4-11*01 (1) >1′_IGHJ6*01 1799 gnl|Fabrus|L2_IGKJ1*01 1090
2751 VH3-23_IGHD4-11*01 (1) >3′_IGHJ6*01 1800 gnl|Fabrus|L2_IGKJ1*01 1090
2752 VH3-23_IGHD4-17*01>1′_IGHJ6*01 1801 gnl|Fabrus|L2_IGKJ1*01 1090
2753 VH3-23_IGHD4-17*01>3′_IGHJ6*01 1802 gnl|Fabrus|L2_IGKJ1*01 1090
2754 VH3-23_IGHD4-23*01>1′_IGHJ6*01 1803 gnl|Fabrus|L2_IGKJ1*01 1090
2755 VH3-23_IGHD4-23*01>3′_IGHJ6*01 1804 gnl|Fabrus|L2_IGKJ1*01 1090
2756 VH3-23_IGHD5-5*01 (2) >1′_IGHJ6*01 1805 gnl|Fabrus|L2_IGKJ1*01 1090
2757 VH3-23_IGHD5-5*01 (2) >3′_IGHJ6*01 1806 gnl|Fabrus|L2_IGKJ1*01 1090
2758 VH3-23_IGHD5-12*01>1′_IGHJ6*01 1807 gnl|Fabrus|L2_IGKJ1*01 1090
2759 VH3-23_IGHD5-12*01>3′_IGHJ6*01 1808 gnl|Fabrus|L2_IGKJ1*01 1090
2760 VH3-23_IGHD5-18*01 (2) >1′_IGHJ6*01 1809 gnl|Fabrus|L2_IGKJ1*01 1090
2761 VH3-23_IGHD5-18*01 (2) >3′_IGHJ6*01 1810 gnl|Fabrus|L2_IGKJ1*01 1090
2762 VH3-23_IGHD5-24*01>1′_IGHJ6*01 1811 gnl|Fabrus|L2_IGKJ1*01 1090
2763 VH3-23_IGHD5-24*01>3′_IGHJ6*01 1812 gnl|Fabrus|L2_IGKJ1*01 1090
2764 VH3-23_IGHD6-6*01>1′_IGHJ6*01 1813 gnl|Fabrus|L2_IGKJ1*01 1090
2765 VH3-23_IGHD6-6*01>2′_IGHJ6*01 1814 gnl|Fabrus|L2_IGKJ1*01 1090
2766 VH3-23_IGHD6-6*01>3′_IGHJ6*01 1815 gnl|Fabrus|L2_IGKJ1*01 1090
2767 VH3-23_IGHD1-1*01>1_IGHJ6*01 1711 gnl|Fabrus|L6_IGKJ1*01 1097
2768 VH3-23_IGHD1-1*01>2_IGHJ6*01 1712 gnl|Fabrus|L6_IGKJ1*01 1097
2769 VH3-23_IGHD1-1*01>3_IGHJ6*01 1713 gnl|Fabrus|L6_IGKJ1*01 1097
2770 VH3-23_IGHD1-7*01>1_IGHJ6*01 1714 gnl|Fabrus|L6_IGKJ1*01 1097
2771 VH3-23_IGHD1-7*01>3_IGHJ6*01 1715 gnl|Fabrus|L6_IGKJ1*01 1097
2772 VH3-23_IGHD1-14*01>1_IGHJ6*01 1716 gnl|Fabrus|L6_IGKJ1*01 1097
2773 VH3-23_IGHD1-14*01>3_IGHJ6*01 1717 gnl|Fabrus|L6_IGKJ1*01 1097
2774 VH3-23_IGHD1-20*01>1_IGHJ6*01 1718 gnl|Fabrus|L6_IGKJ1*01 1097
2775 VH3-23_IGHD1-20*01>3_IGHJ6*01 1719 gnl|Fabrus|L6_IGKJ1*01 1097
2776 VH3-23_IGHD1-26*01>1_IGHJ6*01 1720 gnl|Fabrus|L6_IGKJ1*01 1097
2777 VH3-23_IGHD1-26*01>3_IGHJ6*01 1721 gnl|Fabrus|L6_IGKJ1*01 1097
2778 VH3-23_IGHD2-2*01>2_IGHJ6*01 1722 gnl|Fabrus|L6_IGKJ1*01 1097
2779 VH3-23_IGHD2-2*01>3_IGHJ6*01 1723 gnl|Fabrus|L6_IGKJ1*01 1097
2780 VH3-23_IGHD2-8*01>2_IGHJ6*01 1724 gnl|Fabrus|L6_IGKJ1*01 1097
2781 VH3-23_IGHD2-8*01>3_IGHJ6*01 1725 gnl|Fabrus|L6_IGKJ1*01 1097
2782 VH3-23_IGHD2-15*01>2_IGHJ6*01 1726 gnl|Fabrus|L6_IGKJ1*01 1097
2783 VH3-23_IGHD2-15*01>3_IGHJ6*01 1727 gnl|Fabrus|L6_IGKJ1*01 1097
2784 VH3-23_IGHD2-21*01>2_IGHJ6*01 1728 gnl|Fabrus|L6_IGKJ1*01 1097
2785 VH3-23_IGHD2-21*01>3_IGHJ6*01 1729 gnl|Fabrus|L6_IGKJ1*01 1097
2786 VH3-23_IGHD3-3*01>1_IGHJ6*01 1730 gnl|Fabrus|L6_IGKJ1*01 1097
2787 VH3-23_IGHD3-3*01>2_IGHJ6*01 1731 gnl|Fabrus|L6_IGKJ1*01 1097
2788 VH3-23_IGHD3-3*01>3_IGHJ6*01 1732 gnl|Fabrus|L6_IGKJ1*01 1097
2789 VH3-23_IGHD3-9*01>2_IGHJ6*01 1733 gnl|Fabrus|L6_IGKJ1*01 1097
2790 VH3-23_IGHD3-10*01>2_IGHJ6*01 1734 gnl|Fabrus|L6_IGKJ1*01 1097
2791 VH3-23_IGHD3-10*01>3_IGHJ6*01 1735 gnl|Fabrus|L6_IGKJ1*01 1097
2792 VH3-23_IGHD3-16*01>2_IGHJ6*01 1736 gnl|Fabrus|L6_IGKJ1*01 1097
2793 VH3-23_IGHD3-16*01>3_IGHJ6*01 1737 gnl|Fabrus|L6_IGKJ1*01 1097
2794 VH3-23_IGHD3-22*01>2_IGHJ6*01 1738 gnl|Fabrus|L6_IGKJ1*01 1097
2795 VH3-23_IGHD3-22*01>3_IGHJ6*01 1739 gnl|Fabrus|L6_IGKJ1*01 1097
2796 VH3-23_IGHD4-4*01 (1) >2_IGHJ6*01 1740 gnl|Fabrus|L6_IGKJ1*01 1097
2797 VH3-23_IGHD4-4*01 (1) >3_IGHJ6*01 1741 gnl|Fabrus|L6_IGKJ1*01 1097
2798 VH3-23_IGHD4-11*01 (1) >2_IGHJ6*01 1742 gnl|Fabrus|L6_IGKJ1*01 1097
2799 VH3-23_IGHD4-11*01 (1) >3_IGHJ6*01 1743 gnl|Fabrus|L6_IGKJ1*01 1097
2800 VH3-23_IGHD4-17*01>2_IGHJ6*01 1744 gnl|Fabrus|L6_IGKJ1*01 1097
2801 VH3-23_IGHD4-17*01>3_IGHJ6*01 1745 gnl|Fabrus|L6_IGKJ1*01 1097
2802 VH3-23_IGHD4-23*01>2_IGHJ6*01 1746 gnl|Fabrus|L6_IGKJ1*01 1097
2803 VH3-23_IGHD4-23*01>3_IGHJ6*01 1747 gnl|Fabrus|L6_IGKJ1*01 1097
2804 VH3-23_IGHD5-5*01 (2) >1_IGHJ6*01 1748 gnl|Fabrus|L6_IGKJ1*01 1097
2805 VH3-23_IGHD5-5*01 (2) >2_IGHJ6*01 1749 gnl|Fabrus|L6_IGKJ1*01 1097
2806 VH3-23_IGHD5-5*01 (2) >3_IGHJ6*01 1750 gnl|Fabrus|L6_IGKJ1*01 1097
2807 VH3-23_IGHD5-12*01>1_IGHJ6*01 1751 gnl|Fabrus|L6_IGKJ1*01 1097
2808 VH3-23_IGHD5-12*01>3_IGHJ6*01 1752 gnl|Fabrus|L6_IGKJ1*01 1097
2809 VH3-23_IGHD5-18*01 (2) >1_IGHJ6*01 1753 gnl|Fabrus|L6_IGKJ1*01 1097
2810 VH3-23_IGHD5-18*01 (2) >2_IGHJ6*01 1754 gnl|Fabrus|L6_IGKJ1*01 1097
2811 VH3-23_IGHD5-18*01 (2) >3_IGHJ6*01 1755 gnl|Fabrus|L6_IGKJ1*01 1097
2812 VH3-23_IGHD5-24*01>1_IGHJ6*01 1756 gnl|Fabrus|L6_IGKJ1*01 1097
2813 VH3-23_IGHD5-24*01>3_IGHJ6*01 1757 gnl|Fabrus|L6_IGKJ1*01 1097
2814 VH3-23_IGHD6-6*01>1_IGHJ6*01 1758 gnl|Fabrus|L6_IGKJ1*01 1097
2815 VH3-23_IGHD1-1*01>1′_IGHJ6*01 1768 gnl|Fabrus|L6_IGKJ1*01 1097
2816 VH3-23_IGHD1-1*01>2′_IGHJ6*01 1769 gnl|Fabrus|L6_IGKJ1*01 1097
2817 VH3-23_IGHD1-1*01>3′_IGHJ6*01 1770 gnl|Fabrus|L6_IGKJ1*01 1097
2818 VH3-23_IGHD1-7*01>1′_IGHJ6*01 1771 gnl|Fabrus|L6_IGKJ1*01 1097
2819 VH3-23_IGHD1-7*01>3′_IGHJ6*01 1772 gnl|Fabrus|L6_IGKJ1*01 1097
2820 VH3-23_IGHD1-14*01>1′_IGHJ6*01 1773 gnl|Fabrus|L6_IGKJ1*01 1097
2821 VH3-23_IGHD1-14*01>2′_IGHJ6*01 1774 gnl|Fabrus|L6_IGKJ1*01 1097
2822 VH3-23_IGHD1-14*01>3′_IGHJ6*01 1775 gnl|Fabrus|L6_IGKJ1*01 1097
2823 VH3-23_IGHD1-20*01>1′_IGHJ6*01 1776 gnl|Fabrus|L6_IGKJ1*01 1097
2824 VH3-23_IGHD1-20*01>2′_IGHJ6*01 1777 gnl|Fabrus|L6_IGKJ1*01 1097
2825 VH3-23_IGHD1-20*01>3′_IGHJ6*01 1778 gnl|Fabrus|L6_IGKJ1*01 1097
2826 VH3-23_IGHD1-26*01>1′_IGHJ6*01 1779 gnl|Fabrus|L6_IGKJ1*01 1097
2827 VH3-23_IGHD1-26*01>1_IGHJ6*01_B 1780 gnl|Fabrus|L6_IGKJ1*01 1097
2828 VH3-23_IGHD2-2*01>2_IGHJ6*01_B 1781 gnl|Fabrus|L6_IGKJ1*01 1097
2829 VH3-23_IGHD2-2*01>3′_IGHJ6*01 1782 gnl|Fabrus|L6_IGKJ1*01 1097
2830 VH3-23_IGHD2-8*01>1′_IGHJ6*01 1783 gnl|Fabrus|L6_IGKJ1*01 1097
2831 VH3-23_IGHD2-15*01>1′_IGHJ6*01 1784 gnl|Fabrus|L6_IGKJ1*01 1097
2832 VH3-23_IGHD2-15*01>3′_IGHJ6*01 1785 gnl|Fabrus|L6_IGKJ1*01 1097
2833 VH3-23_IGHD2-21*01>1′_IGHJ6*01 1786 gnl|Fabrus|L6_IGKJ1*01 1097
2834 VH3-23_IGHD2-21*01>3′_IGHJ6*01 1787 gnl|Fabrus|L6_IGKJ1*01 1097
2835 VH3-23_IGHD3-3*01>1′_IGHJ6*01 1788 gnl|Fabrus|L6_IGKJ1*01 1097
2836 VH3-23_IGHD3-3*01>3′_IGHJ6*01 1789 gnl|Fabrus|L6_IGKJ1*01 1097
2837 VH3-23_IGHD3-9*01>1′_IGHJ6*01 1790 gnl|Fabrus|L6_IGKJ1*01 1097
2838 VH3-23_IGHD3-9*01>3′_IGHJ6*01 1791 gnl|Fabrus|L6_IGKJ1*01 1097
2839 VH3-23_IGHD3-10*01>1′_IGHJ6*01 1792 gnl|Fabrus|L6_IGKJ1*01 1097
2840 VH3-23_IGHD3-10*01>3′_IGHJ6*01 1793 gnl|Fabrus|L6_IGKJ1*01 1097
2841 VH3-23_IGHD3-16*01>1′_IGHJ6*01 1794 gnl|Fabrus|L6_IGKJ1*01 1097
2842 VH3-23_IGHD3-16*01>3′_IGHJ6*01 1795 gnl|Fabrus|L6_IGKJ1*01 1097
2843 VH3-23_IGHD3-22*01>1′_IGHJ6*01 1796 gnl|Fabrus|L6_IGKJ1*01 1097
2844 VH3-23_IGHD4-4*01 (1) >1′_IGHJ6*01 1797 gnl|Fabrus|L6_IGKJ1*01 1097
2845 VH3-23_IGHD4-4*01 (1) >3′_IGHJ6*01 1798 gnl|Fabrus|L6_IGKJ1*01 1097
2846 VH3-23_IGHD4-11*01 (1) >1′_IGHJ6*01 1799 gnl|Fabrus|L6_IGKJ1*01 1097
2847 VH3-23_IGHD4-11*01 (1) >3′_IGHJ6*01 1800 gnl|Fabrus|L6_IGKJ1*01 1097
2848 VH3-23_IGHD4-17*01>1′_IGHJ6*01 1801 gnl|Fabrus|L6_IGKJ1*01 1097
2849 VH3-23_IGHD4-17*01>3′_IGHJ6*01 1802 gnl|Fabrus|L6_IGKJ1*01 1097
2850 VH3-23_IGHD4-23*01>1′_IGHJ6*01 1803 gnl|Fabrus|L6_IGKJ1*01 1097
2851 VH3-23_IGHD4-23*01>3′_IGHJ6*01 1804 gnl|Fabrus|L6_IGKJ1*01 1097
2852 VH3-23_IGHD5-5*01 (2) >1′_IGHJ6*01 1805 gnl|Fabrus|L6_IGKJ1*01 1097
2853 VH3-23_IGHD5-5*01 (2) >3′_IGHJ6*01 1806 gnl|Fabrus|L6_IGKJ1*01 1097
2854 VH3-23_IGHD5-12*01>1′_IGHJ6*01 1807 gnl|Fabrus|L6_IGKJ1*01 1097
2855 VH3-23_IGHD5-12*01>3′_IGHJ6*01 1808 gnl|Fabrus|L6_IGKJ1*01 1097
2856 VH3-23_IGHD5-18*01 (2) >1′_IGHJ6*01 1809 gnl|Fabrus|L6_IGKJ1*01 1097
2857 VH3-23_IGHD5-18*01 (2) >3′_IGHJ6*01 1810 gnl|Fabrus|L6_IGKJ1*01 1097
2858 VH3-23_IGHD5-24*01>1′_IGHJ6*01 1811 gnl|Fabrus|L6_IGKJ1*01 1097
2859 VH3-23_IGHD5-24*01>3′_IGHJ6*01 1812 gnl|Fabrus|L6_IGKJ1*01 1097
2860 VH3-23_IGHD6-6*01>1′_IGHJ6*01 1813 gnl|Fabrus|L6_IGKJ1*01 1097
2861 VH3-23_IGHD6-6*01>2′_IGHJ6*01 1814 gnl|Fabrus|L6_IGKJ1*01 1097
2862 VH3-23_IGHD6-6*01>3′_IGHJ6*01 1815 gnl|Fabrus|L6_IGKJ1*01 1097
2863 VH3-23_IGHD1-1*01>1_IGHJ5*01 1596 gnl|Fabrus|L25_IGKJ1*01 1093
2864 VH3-23_IGHD1-1*01>2_IGHJ5*01 1597 gnl|Fabrus|L25_IGKJ1*01 1093
2865 VH3-23_IGHD1-1*01>3_IGHJ5*01 1598 gnl|Fabrus|L25_IGKJ1*01 1093
2866 VH3-23_IGHD1-7*01>1_IGHJ5*01 1599 gnl|Fabrus|L25_IGKJ1*01 1093
2867 VH3-23_IGHD1-7*01>3_IGHJ5*01 1600 gnl|Fabrus|L25_IGKJ1*01 1093
2868 VH3-23_IGHD1-14*01>1_IGHJ5*01 1601 gnl|Fabrus|L25_IGKJ1*01 1093
2869 VH3-23_IGHD1-14*01>3_IGHJ5*01 1602 gnl|Fabrus|L25_IGKJ1*01 1093
2870 VH3-23_IGHD1-20*01>1_IGHJ5*01 1603 gnl|Fabrus|L25_IGKJ1*01 1093
2871 VH3-23_IGHD1-20*01>3_IGHJ5*01 1604 gnl|Fabrus|L25_IGKJ1*01 1093
2872 VH3-23_IGHD1-26*01>1_IGHJ5*01 1605 gnl|Fabrus|L25_IGKJ1*01 1093
2873 VH3-23_IGHD1-26*01>3_IGHJ5*01 1606 gnl|Fabrus|L25_IGKJ1*01 1093
2874 VH3-23_IGHD2-2*01>2_IGHJ5*01 1607 gnl|Fabrus|L25_IGKJ1*01 1093
2875 VH3-23_IGHD2-2*01>3_IGHJ5*01 1608 gnl|Fabrus|L25_IGKJ1*01 1093
2876 VH3-23_IGHD2-8*01>2_IGHJ5*01 1609 gnl|Fabrus|L25_IGKJ1*01 1093
2877 VH3-23_IGHD2-8*01>3_IGHJ5*01 1610 gnl|Fabrus|L25_IGKJ1*01 1093
2878 VH3-23_IGHD2-15*01>2_IGHJ5*01 1611 gnl|Fabrus|L25_IGKJ1*01 1093
2879 VH3-23_IGHD2-15*01>3_IGHJ5*01 1612 gnl|Fabrus|L25_IGKJ1*01 1093
2880 VH3-23_IGHD2-21*01>2_IGHJ5*01 1613 gnl|Fabrus|L25_IGKJ1*01 1093
2881 VH3-23_IGHD2-21*01>3_IGHJ5*01 1614 gnl|Fabrus|L25_IGKJ1*01 1093
2882 VH3-23_IGHD3-3*01>1_IGHJ5*01 1615 gnl|Fabrus|L25_IGKJ1*01 1093
2883 VH3-23_IGHD3-3*01>2_IGHJ5*01 1616 gnl|Fabrus|L25_IGKJ1*01 1093
2884 VH3-23_IGHD3-3*01>3_IGHJ5*01 1617 gnl|Fabrus|L25_IGKJ1*01 1093
2885 VH3-23_IGHD3-9*01>2_IGHJ5*01 1618 gnl|Fabrus|L25_IGKJ1*01 1093
2886 VH3-23_IGHD3-10*01>2_IGHJ5*01 1619 gnl|Fabrus|L25_IGKJ1*01 1093
2887 VH3-23_IGHD3-10*01>3_IGHJ5*01 1620 gnl|Fabrus|L25_IGKJ1*01 1093
2888 VH3-23_IGHD3-16*01>2_IGHJ5*01 1621 gnl|Fabrus|L25_IGKJ1*01 1093
2889 VH3-23_IGHD3-16*01>3_IGHJ5*01 1622 gnl|Fabrus|L25_IGKJ1*01 1093
2890 VH3-23_IGHD3-22*01>2_IGHJ5*01 1623 gnl|Fabrus|L25_IGKJ1*01 1093
2891 VH3-23_IGHD3-22*01>3_IGHJ5*01 1624 gnl|Fabrus|L25_IGKJ1*01 1093
2892 VH3-23_IGHD4-4*01 (1) >2_IGHJ5*01 1625 gnl|Fabrus|L25_IGKJ1*01 1093
2893 VH3-23_IGHD4-4*01 (1) >3_IGHJ5*01 1626 gnl|Fabrus|L25_IGKJ1*01 1093
2894 VH3-23_IGHD4-11*01 (1) >2_IGHJ5*01 1627 gnl|Fabrus|L25_IGKJ1*01 1093
2895 VH3-23_IGHD4-11*01 (1) >3_IGHJ5*01 1628 gnl|Fabrus|L25_IGKJ1*01 1093
2896 VH3-23_IGHD4-17*01>2_IGHJ5*01 1629 gnl|Fabrus|L25_IGKJ1*01 1093
2897 VH3-23_IGHD4-17*01>3_IGHJ5*01 1630 gnl|Fabrus|L25_IGKJ1*01 1093
2898 VH3-23_IGHD4-23*01>2_IGHJ5*01 1631 gnl|Fabrus|L25_IGKJ1*01 1093
2899 VH3-23_IGHD4-23*01>3_IGHJ5*01 1632 gnl|Fabrus|L25_IGKJ1*01 1093
2900 VH3-23_IGHD5-5*01 (2) >1_IGHJ5*01 1633 gnl|Fabrus|L25_IGKJ1*01 1093
2901 VH3-23_IGHD5-5*01 (2) >2_IGHJ5*01 1634 gnl|Fabrus|L25_IGKJ1*01 1093
2902 VH3-23_IGHD5-5*01 (2) >3_IGHJ5*01 1635 gnl|Fabrus|L25_IGKJ1*01 1093
2903 VH3-23_IGHD5-12*01>1_IGHJ5*01 1636 gnl|Fabrus|L25_IGKJ1*01 1093
2904 VH3-23_IGHD5-12*01>3_IGHJ5*01 1637 gnl|Fabrus|L25_IGKJ1*01 1093
2905 VH3-23_IGHD5-18*01 (2) >1_IGHJ5*01 1638 gnl|Fabrus|L25_IGKJ1*01 1093
2906 VH3-23_IGHD5-18*01 (2) >2_IGHJ5*01 1639 gnl|Fabrus|L25_IGKJ1*01 1093
2907 VH3-23_IGHD5-18*01 (2) >3_IGHJ5*01 1640 gnl|Fabrus|L25_IGKJ1*01 1093
2908 VH3-23_IGHD5-24*01>1_IGHJ5*01 1641 gnl|Fabrus|L25_IGKJ1*01 1093
2909 VH3-23_IGHD5-24*01>3_IGHJ5*01 1642 gnl|Fabrus|L25_IGKJ1*01 1093
2910 VH3-23_IGHD6-6*01>1_IGHJ5*01 1643 gnl|Fabrus|L25_IGKJ1*01 1093
2911 VH3-23_IGHD1-1*01>1′_IGHJ5*01 1653 gnl|Fabrus|L25_IGKJ1*01 1093
2912 VH3-23_IGHD1-1*01>2′_IGHJ5*01 1654 gnl|Fabrus|L25_IGKJ1*01 1093
2913 VH3-23_IGHD1-1*01>3′_IGHJ5*01 1655 gnl|Fabrus|L25_IGKJ1*01 1093
2914 VH3-23_IGHD1-7*01>1′_IGHJ5*01 1656 gnl|Fabrus|L25_IGKJ1*01 1093
2915 VH3-23_IGHD1-7*01>3′_IGHJ5*01 1657 gnl|Fabrus|L25_IGKJ1*01 1093
2916 VH3-23_IGHD1-14*01>1′_IGHJ5*01 1658 gnl|Fabrus|L25_IGKJ1*01 1093
2917 VH3-23_IGHD1-14*01>2′_IGHJ5*01 1659 gnl|Fabrus|L25_IGKJ1*01 1093
2918 VH3-23_IGHD1-14*01>3′_IGHJ5*01 1660 gnl|Fabrus|L25_IGKJ1*01 1093
2919 VH3-23_IGHD1-20*01>1′_IGHJ5*01 1661 gnl|Fabrus|L25_IGKJ1*01 1093
2920 VH3-23_IGHD1-20*01>2′_IGHJ5*01 1662 gnl|Fabrus|L25_IGKJ1*01 1093
2921 VH3-23_IGHD1-20*01>3′_IGHJ5*01 1663 gnl|Fabrus|L25_IGKJ1*01 1093
2922 VH3-23_IGHD1-26*01>1′_IGHJ5*01 1664 gnl|Fabrus|L25_IGKJ1*01 1093
2923 VH3-23_IGHD1-26*01>3′_IGHJ5*01 1665 gnl|Fabrus|L25_IGKJ1*01 1093
2924 VH3-23_IGHD2-2*01>1′_IGHJ5*01 1666 gnl|Fabrus|L25_IGKJ1*01 1093
2925 VH3-23_IGHD2-2*01>3′_IGHJ5*01 1667 gnl|Fabrus|L25_IGKJ1*01 1093
2926 VH3-23_IGHD2-8*01>1′_IGHJ5*01 1668 gnl|Fabrus|L25_IGKJ1*01 1093
2927 VH3-23_IGHD2-15*01>1′_IGHJ5*01 1669 gnl|Fabrus|L25_IGKJ1*01 1093
2928 VH3-23_IGHD2-15*01>3′_IGHJ5*01 1670 gnl|Fabrus|L25_IGKJ1*01 1093
2929 VH3-23_IGHD2-21*01>1′_IGHJ5*01 1671 gnl|Fabrus|L25_IGKJ1*01 1093
2930 VH3-23_IGHD2-21*01>3′_IGHJ5*01 1672 gnl|Fabrus|L25_IGKJ1*01 1093
2931 VH3-23_IGHD3-3*01>1′_IGHJ5*01 1673 gnl|Fabrus|L25_IGKJ1*01 1093
2932 VH3-23_IGHD3-3*01>3′_IGHJ5*0 1 1674 gnl|Fabrus|L25_IGKJ1*01 1093
2933 VH3-23_IGHD3-9*01>1′_IGHJ5*01 1675 gnl|Fabrus|L25_IGKJ1*01 1093
2934 VH3-23_IGHD3-9*01>3′_IGHJ5*01 1676 gnl|Fabrus|L25_IGKJ1*01 1093
2935 VH3-23_IGHD3-10*01>1′_IGHJ5*01 1677 gnl|Fabrus|L25_IGKJ1*01 1093
2936 VH3-23_IGHD3-10*01>3′_IGHJ5*01 1678 gnl|Fabrus|L25_IGKJ1*01 1093
2937 VH3-23_IGHD3-16*01>1′_IGHJ5*01 1679 gnl|Fabrus|L25_IGKJ1*01 1093
2938 VH3-23_IGHD3-16*01>3′_IGHJ5*01 1680 gnl|Fabrus|L25_IGKJ1*01 1093
2939 VH3-23_IGHD3-22*01>1′_IGHJ5*01 1681 gnl|Fabrus|L25_IGKJ1*01 1093
2940 VH3-23_IGHD4-4*01 (1) >1′_IGHJ5*01 1682 gnl|Fabrus|L25_IGKJ1*01 1093
2941 VH3-23_IGHD4-4*01 (1) >3′_IGHJ5*01 1683 gnl|Fabrus|L25_IGKJ1*01 1093
2942 VH3-23_IGHD4-11*01 (1) >1′_IGHJ5*01 1684 gnl|Fabrus|L25_IGKJ1*01 1093
2943 VH3-23_IGHD4-11*01 (1) >3′_IGHJ5*01 1685 gnl|Fabrus|L25_IGKJ1*01 1093
2944 VH3-23_IGHD4-17*01>1′_IGHJ5*01 1686 gnl|Fabrus|L25_IGKJ1*01 1093
2945 VH3-23_IGHD4-17*01>3′_IGHJ5*01 1687 gnl|Fabrus|L25_IGKJ1*01 1093
2946 VH3-23_IGHD4-23*01>1′_IGHJ5*01 1688 gnl|Fabrus|L25_IGKJ1*01 1093
2947 VH3-23_IGHD4-23*01>3′_IGHJ5*01 1689 gnl|Fabrus|L25_IGKJ1*01 1093
2948 VH3-23_IGHD5-5*01 (2) >1′_IGHJ5*01 1690 gnl|Fabrus|L25_IGKJ1*01 1093
2949 VH3-23_IGHD5-5*01 (2) >3′_IGHJ5*01 1691 gnl|Fabrus|L25_IGKJ1*01 1093
2950 VH3-23_IGHD5-12*01>1′_IGHJ5*01 1692 gnl|Fabrus|L25_IGKJ1*01 1093
2951 VH3-23_IGHD5-12*01>3′_IGHJ5*01 1693 gnl|Fabrus|L25_IGKJ1*01 1093
2952 VH3-23_IGHD5-18*01 (2) >1′_IGHJ5*01 1694 gnl|Fabrus|L25_IGKJ1*01 1093
2953 VH3-23_IGHD5-18*01 (2) >3′_IGHJ5*01 1695 gnl|Fabrus|L25_IGKJ1*01 1093
2954 VH3-23_IGHD5-24*01>1′_IGHJ5*01 1696 gnl|Fabrus|L25_IGKJ1*01 1093
2955 VH3-23_IGHD5-24*01>3′_IGHJ5*01 1697 gnl|Fabrus|L25_IGKJ1*01 1093
2956 VH3-23_IGHD6-6*01>1′_IGHJ5*01 1698 gnl|Fabrus|L25_IGKJ1*01 1093
2957 VH3-23_IGHD6-6*01>2′_IGHJ5*01 1699 gnl|Fabrus|L25_IGKJ1*01 1093
2958 VH3-23_IGHD6-6*01>3′_IGHJ5*01 1700 gnl|Fabrus|L25_IGKJ1*01 1093
2959 VH3-23_IGHD1-1*01>1_IGHJ5*01 1596 gnl|Fabrus|B3_IGKJ1*01 1085
2960 VH3-23_IGHD1-1*01>2_IGHJ5*01 1597 gnl|Fabrus|B3_IGKJ1*01 1085
2961 VH3-23_IGHD1-1*01>3_IGHJ5*01 1598 gnl|Fabrus|B3_IGKJ1*01 1085
2962 VH3-23_IGHD1-7*01>1_IGHJ5*01 1599 gnl|Fabrus|B3_IGKJ1*01 1085
2963 VH3-23_IGHD1-7*01>3_IGHJ5*01 1600 gnl|Fabrus|B3_IGKJ1*01 1085
2964 VH3-23_IGHD1-14*01>1_IGHJ5*01 1601 gnl|Fabrus|B3_IGKJ1*01 1085
2965 VH3-23_IGHD1-14*01>3_IGHJ5*01 1602 gnl|Fabrus|B3_IGKJ1*01 1085
2966 VH3-23_IGHD1-20*01>1_IGHJ5*01 1603 gnl|Fabrus|B3_IGKJ1*01 1085
2967 VH3-23_IGHD1-20*01>3_IGHJ5*01 1604 gnl|Fabrus|B3_IGKJ1*01 1085
2968 VH3-23_IGHD1-26*01>1_IGHJ5*01 1605 gnl|Fabrus|B3_IGKJ1*01 1085
2969 VH3-23_IGHD1-26*01>3_IGHJ5*01 1606 gnl|Fabrus|B3_IGKJ1*01 1085
2970 VH3-23_IGHD2-2*01>2_IGHJ5*01 1607 gnl|Fabrus|B3_IGKJ1*01 1085
2971 VH3-23_IGHD2-2*01>3_IGHJ5*01 1608 gnl|Fabrus|B3_IGKJ1*01 1085
2972 VH3-23_IGHD2-8*01>2_IGHJ5*01 1609 gnl|Fabrus|B3_IGKJ1*01 1085
2973 VH3-23_IGHD2-8*01>3_IGHJ5*01 1610 gnl|Fabrus|B3_IGKJ1*01 1085
2974 VH3-23_IGHD2-15*01>2_IGHJ5*01 1611 gnl|Fabrus|B3_IGKJ1*01 1085
2975 VH3-23_IGHD2-15*01>3_IGHJ5*01 1612 gnl|Fabrus|B3_IGKJ1*01 1085
2976 VH3-23_IGHD2-21*01>2_IGHJ5*01 1613 gnl|Fabrus|B3_IGKJ1*01 1085
2977 VH3-23_IGHD2-21*01>3_IGHJ5*01 1614 gnl|Fabrus|B3_IGKJ1*01 1085
2978 VH3-23_IGHD3-3*01>1_IGHJ5*01 1615 gnl|Fabrus|B3_IGKJ1*01 1085
2979 VH3-23_IGHD3-3*01>2_IGHJ5*01 1616 gnl|Fabrus|B3_IGKJ1*01 1085
2980 VH3-23_IGHD3-3*01>3_IGHJ5*01 1617 gnl|Fabrus|B3_IGKJ1*01 1085
2981 VH3-23_IGHD3-9*01>2_IGHJ5*01 1618 gnl|Fabrus|B3_IGKJ1*01 1085
2982 VH3-23_IGHD3-10*01>2_IGHJ5*01 1619 gnl|Fabrus|B3_IGKJ1*01 1085
2983 VH3-23_IGHD3-10*01>3_IGHJ5*01 1620 gnl|Fabrus|B3_IGKJ1*01 1085
2984 VH3-23_IGHD3-16*01>2_IGHJ5*01 1621 gnl|Fabrus|B3_IGKJ1*01 1085
2985 VH3-23_IGHD3-16*01>3_IGHJ5*01 1622 gnl|Fabrus|B3_IGKJ1*01 1085
2986 VH3-23_IGHD3-22*01>2_IGHJ5*01 1623 gnl|Fabrus|B3_IGKJ1*01 1085
2987 VH3-23_IGHD3-22*01>3_IGHJ5*01 1624 gnl|Fabrus|B3_IGKJ1*01 1085
2988 VH3-23_IGHD4-4*01 (1) >2_IGHJ5*01 1625 gnl|Fabrus|B3_IGKJ1*01 1085
2989 VH3-23_IGHD4-4*01 (1) >3_IGHJ5*01 1626 gnl|Fabrus|B3_IGKJ1*01 1085
2990 VH3-23_IGHD4-11*01 (1) >2_IGHJ5*01 1627 gnl|Fabrus|B3_IGKJ1*01 1085
2991 VH3-23_IGHD4-11*01 (1) >3_IGHJ5*01 1628 gnl|Fabrus|B3_IGKJ1*01 1085
2992 VH3-23_IGHD4-17*01>2_IGHJ5*01 1629 gnl|Fabrus|B3_IGKJ1*01 1085
2993 VH3-23_IGHD4-17*01>3_IGHJ5*01 1630 gnl|Fabrus|B3_IGKJ1*01 1085
2994 VH3-23_IGHD4-23*01>2_IGHJ5*01 1631 gnl|Fabrus|B3_IGKJ1*01 1085
2995 VH3-23_IGHD4-23*01>3_IGHJ5*01 1632 gnl|Fabrus|B3_IGKJ1*01 1085
2996 VH3-23_IGHD5-5*01 (2) >1_IGHJ5*01 1633 gnl|Fabrus|B3_IGKJ1*01 1085
2997 VH3-23_IGHD5-5*01 (2) >2_IGHJ5*01 1634 gnl|Fabrus|B3_IGKJ1*01 1085
2998 VH3-23_IGHD5-5*01 (2) >3_IGHJ5*01 1635 gnl|Fabrus|B3_IGKJ1*01 1085
2999 VH3-23_IGHD5-12*01>1_IGHJ5*01 1636 gnl|Fabrus|B3_IGKJ1*01 1085
3000 VH3-23_IGHD5-12*01>3_IGHJ5*01 1637 gnl|Fabrus|B3_IGKJ1*01 1085
3001 VH3-23_IGHD5-18*01 (2) >1_IGHJ5*01 1638 gnl|Fabrus|B3_IGKJ1*01 1085
3002 VH3-23_IGHD5-18*01 (2) >2_IGHJ5*01 1639 gnl|Fabrus|B3_IGKJ1*01 1085
3003 VH3-23_IGHD5-18*01 (2) >3_IGHJ5*01 1640 gnl|Fabrus|B3_IGKJ1*01 1085
3004 VH3-23_IGHD5-24*01>1_IGHJ5*01 1641 gnl|Fabrus|B3_IGKJ1*01 1085
3005 VH3-23_IGHD5-24*01>3_IGHJ5*01 1642 gnl|Fabrus|B3_IGKJ1*01 1085
3006 VH3-23_IGHD6-6*01>1_IGHJ5*01 1643 gnl|Fabrus|B3_IGKJ1*01 1085
3007 VH3-23_IGHD1-1*01>1′_IGHJ5*01 1653 gnl|Fabrus|B3_IGKJ1*01 1085
3008 VH3-23_IGHD1-1*01>2′_IGHJ5*01 1654 gnl|Fabrus|B3_IGKJ1*01 1085
3009 VH3-23_IGHD1-1*01>3′_IGHJ5*01 1655 gnl|Fabrus|B3_IGKJ1*01 1085
3010 VH3-23_IGHD1-7*01>1′_IGHJ5*01 1656 gnl|Fabrus|B3_IGKJ1*01 1085
3011 VH3-23_IGHD1-7*01>3′_IGHJ5*01 1657 gnl|Fabrus|B3_IGKJ1*01 1085
3012 VH3-23_IGHD1-14*01>1′_IGHJ5*01 1658 gnl|Fabrus|B3_IGKJ1*01 1085
3013 VH3-23_IGHD1-14*01>2′_IGHJ5*01 1659 gnl|Fabrus|B3_IGKJ1*01 1085
3014 VH3-23_IGHD1-14*01>3′_IGHJ5*01 1660 gnl|Fabrus|B3_IGKJ1*01 1085
3015 VH3-23_IGHD1-20*01>1′_IGHJ5*01 1661 gnl|Fabrus|B3_IGKJ1*01 1085
3016 VH3-23_IGHD1-20*01>2′_IGHJ5*01 1662 gnl|Fabrus|B3_IGKJ1*01 1085
3017 VH3-23_IGHD1-20*01>3′_IGHJ5*01 1663 gnl|Fabrus|B3_IGKJ1*01 1085
3018 VH3-23_IGHD1-26*01>1′_IGHJ5*01 1664 gnl|Fabrus|B3_IGKJ1*01 1085
3019 VH3-23_IGHD1-26*01>3′_IGHJ5*01 1665 gnl|Fabrus|B3_IGKJ1*01 1085
3020 VH3-23_IGHD2-2*01>1′_IGHJ5*01 1666 gnl|Fabrus|B3_IGKJ1*01 1085
3021 VH3-23_IGHD2-2*01>3′_IGHJ5*01 1667 gnl|Fabrus|B3_IGKJ1*01 1085
3022 VH3-23_IGHD2-8*01>1′_IGHJ5*01 1668 gnl|Fabrus|B3_IGKJ1*01 1085
3023 VH3-23_IGHD2-15*01>1′_IGHJ5*01 1669 gnl|Fabrus|B3_IGKJ1*01 1085
3024 VH3-23_IGHD2-15*01>3′_IGHJ5*01 1670 gnl|Fabrus|B3_IGKJ1*01 1085
3025 VH3-23_IGHD2-21*01>1′_IGHJ5*01 1671 gnl|Fabrus|B3_IGKJ1*01 1085
3026 VH3-23_IGHD2-21*01>3′_IGHJ5*01 1672 gnl|Fabrus|B3_IGKJ1*01 1085
3027 VH3-23_IGHD3-3*01>1′_IGHJ5*01 1673 gnl|Fabrus|B3_IGKJ1*01 1085
3028 VH3-23_IGHD3-3*01>3′_IGHJ5*01 1674 gnl|Fabrus|B3_IGKJ1*01 1085
3029 VH3-23_IGHD3-9*01>1′_IGHJ5*01 1675 gnl|Fabrus|B3_IGKJ1*01 1085
3030 VH3-23_IGHD3-9*01>3′_IGHJ5*01 1676 gnl|Fabrus|B3_IGKJ1*01 1085
3031 VH3-23_IGHD3-10*01>1′_IGHJ5*01 1677 gnl|Fabrus|B3_IGKJ1*01 1085
3032 VH3-23_IGHD3-10*01>3′_IGHJ5*01 1678 gnl|Fabrus|B3_IGKJ1*01 1085
3033 VH3-23_IGHD3-16*01>1′_IGHJ5*01 1679 gnl|Fabrus|B3_IGKJ1*01 1085
3034 VH3-23_IGHD3-16*01>3′_IGHJ5*01 1680 gnl|Fabrus|B3_IGKJ1*01 1085
3035 VH3-23_IGHD3-22*01>1′_IGHJ5*01 1681 gnl|Fabrus|B3_IGKJ1*01 1085
3036 VH3-23_IGHD4-4*01 (1) >1′_IGHJ5*01 1682 gnl|Fabrus|B3_IGKJ1*01 1085
3037 VH3-23_IGHD4-4*01 (1) >3′_IGHJ5*01 1683 gnl|Fabrus|B3_IGKJ1*01 1085
3038 VH3-23_IGHD4-11*01 (1) >1′_IGHJ5*01 1684 gnl|Fabrus|B3_IGKJ1*01 1085
3039 VH3-23_IGHD4-11*01 (1) >3′_IGHJ5*01 1685 gnl|Fabrus|B3_IGKJ1*01 1085
3040 VH3-23_IGHD4-17*01>1′_IGHJ5*01 1686 gnl|Fabrus|B3_IGKJ1*01 1085
3041 VH3-23_IGHD4-17*01>3′_IGHJ5*01 1687 gnl|Fabrus|B3_IGKJ1*01 1085
3042 VH3-23_IGHD4-23*01>1′_IGHJ5*01 1688 gnl|Fabrus|B3_IGKJ1*01 1085
3043 VH3-23_IGHD4-23*01>3′_IGHJ5*01 1689 gnl|Fabrus|B3_IGKJ1*01 1085
3044 VH3-23_IGHD5-5*01 (2) >1′_IGHJ5*01 1690 gnl|Fabrus|B3_IGKJ1*01 1085
3045 VH3-23_IGHD5-5*01 (2) >3′_IGHJ5*01 1691 gnl|Fabrus|B3_IGKJ1*01 1085
3046 VH3-23_IGHD5-12*01>1′_IGHJ5*01 1692 gnl|Fabrus|B3_IGKJ1*01 1085
3047 VH3-23_IGHD5-12*01>3′_IGHJ5*01 1693 gnl|Fabrus|B3_IGKJ1*01 1085
3048 VH3-23_IGHD5-18*01 (2) >1′_IGHJ5*01 1694 gnl|Fabrus|B3_IGKJ1*01 1085
3049 VH3-23_IGHD5-18*01 (2) >3′_IGHJ5*01 1695 gnl|Fabrus|B3_IGKJ1*01 1085
3050 VH3-23_IGHD5-24*01>1′_IGHJ5*01 1696 gnl|Fabrus|B3_IGKJ1*01 1085
3051 VH3-23_IGHD5-24*01>3′_IGHJ5*01 1697 gnl|Fabrus|B3_IGKJ1*01 1085
3052 VH3-23_IGHD6-6*01>1′_IGHJ5*01 1698 gnl|Fabrus|B3_IGKJ1*01 1085
3053 VH3-23_IGHD6-6*01>2′_IGHJ5*01 1699 gnl|Fabrus|B3_IGKJ1*01 1085
3054 VH3-23_IGHD6-6*01>3′_IGHJ5*01 1700 gnl|Fabrus|B3_IGKJ1*01 1085
3055 VH3-23_IGHD1-1*01>1_IGHJ5*01 1596 gnl|Fabrus|A26_IGKJ1*01 1079
3056 VH3-23_IGHD1-1*01>2_IGHJ5*01 1597 gnl|Fabrus|A26_IGKJ1*01 1079
3057 VH3-23_IGHD1-1*01>3_IGHJ5*01 1598 gnl|Fabrus|A26_IGKJ1*01 1079
3058 VH3-23_IGHD1-7*01>1_IGHJ5*01 1599 gnl|Fabrus|A26_IGKJ1*01 1079
3059 VH3-23_IGHD1-7*01>3_IGHJ5*01 1600 gnl|Fabrus|A26_IGKJ1*01 1079
3060 VH3-23_IGHD1-14*01>1_IGHJ5*01 1601 gnl|Fabrus|A26_IGKJ1*01 1079
3061 VH3-23_IGHD1-14*01>3_IGHJ5*01 1602 gnl|Fabrus|A26_IGKJ1*01 1079
3062 VH3-23_IGHD1-20*01>1_IGHJ5*01 1603 gnl|Fabrus|A26_IGKJ1*01 1079
3063 VH3-23_IGHD1-20*01>3_IGHJ5*01 1604 gnl|Fabrus|A26_IGKJ1*01 1079
3064 VH3-23_IGHD1-26*01>1_IGHJ5*01 1605 gnl|Fabrus|A26_IGKJ1*01 1079
3065 VH3-23_IGHD1-26*01>3_IGHJ5*01 1606 gnl|Fabrus|A26_IGKJ1*01 1079
3066 VH3-23_IGHD2-2*01>2_IGHJ5*01 1607 gnl|Fabrus|A26_IGKJ1*01 1079
3067 VH3-23_IGHD2-2*01>3_IGHJ5*01 1608 gnl|Fabrus|A26_IGKJ1*01 1079
3068 VH3-23_IGHD2-8*01>2_IGHJ5*01 1609 gnl|Fabrus|A26_IGKJ1*01 1079
3069 VH3-23_IGHD2-8*01>3_IGHJ5*01 1610 gnl|Fabrus|A26_IGKJ1*01 1079
3070 VH3-23_IGHD2-15*01>2_IGHJ5*01 1611 gnl|Fabrus|A26_IGKJ1*01 1079
3071 VH3-23_IGHD2-15*01>3_IGHJ5*01 1612 gnl|Fabrus|A26_IGKJ1*01 1079
3072 VH3-23_IGHD2-21*01>2_IGHJ5*01 1613 gnl|Fabrus|A26_IGKJ1*01 1079
3073 VH3-23_IGHD2-21*01>3_IGHJ5*01 1614 gnl|Fabrus|A26_IGKJ1*01 1079
3074 VH3-23_IGHD3-3*01>1_IGHJ5*01 1615 gnl|Fabrus|A26_IGKJ1*01 1079
3075 VH3-23_IGHD3-3*01>2_IGHJ5*01 1616 gnl|Fabrus|A26_IGKJ1*01 1079
3076 VH3-23_IGHD3-3*01>3_IGHJ5*01 1617 gnl|Fabrus|A26_IGKJ1*01 1079
3077 VH3-23_IGHD3-9*01>2_IGHJ5*01 1618 gnl|Fabrus|A26_IGKJ1*01 1079
3078 VH3-23_IGHD3-10*01>2_IGHJ5*01 1619 gnl|Fabrus|A26_IGKJ1*01 1079
3079 VH3-23_IGHD3-10*01>3_IGHJ5*01 1620 gnl|Fabrus|A26_IGKJ1*01 1079
3080 VH3-23_IGHD3-16*01>2_IGHJ5*01 1621 gnl|Fabrus|A26_IGKJ1*01 1079
3081 VH3-23_IGHD3-16*01>3_IGHJ5*01 1622 gnl|Fabrus|A26_IGKJ1*01 1079
3082 VH3-23_IGHD3-22*01>2_IGHJ5*01 1623 gnl|Fabrus|A26_IGKJ1*01 1079
3083 VH3-23_IGHD3-22*01>3_IGHJ5*01 1624 gnl|Fabrus|A26_IGKJ1*01 1079
3084 VH3-23_IGHD4-4*01 (1) >2_IGHJ5*01 1625 gnl|Fabrus|A26_IGKJ1*01 1079
3085 VH3-23_IGHD4-4*01 (1) >3_IGHJ5*01 1626 gnl|Fabrus|A26_IGKJ1*01 1079
3086 VH3-23_IGHD4-11*01 (1) >2_IGHJ5*01 1627 gnl|Fabrus|A26_IGKJ1*01 1079
3087 VH3-23_IGHD4-11*01 (1) >3_IGHJ5*01 1628 gnl|Fabrus|A26_IGKJ1*01 1079
3088 VH3-23_IGHD4-17*01>2_IGHJ5*01 1629 gnl|Fabrus|A26_IGKJ1*01 1079
3089 VH3-23_IGHD4-17*01>3_IGHJ5*01 1630 gnl|Fabrus|A26_IGKJ1*01 1079
3090 VH3-23_IGHD4-23*01>2_IGHJ5*01 1631 gnl|Fabrus|A26_IGKJ1*01 1079
3091 VH3-23_IGHD4-23*01>3_IGHJ5*01 1632 gnl|Fabrus|A26_IGKJ1*01 1079
3092 VH3-23_IGHD5-5*01 (2) >1_IGHJ5*01 1633 gnl|Fabrus|A26_IGKJ1*01 1079
3093 VH3-23_IGHD5-5*01 (2) >2_IGHJ5*01 1634 gnl|Fabrus|A26_IGKJ1*01 1079
3094 VH3-23_IGHD5-5*01 (2) >3_IGHJ5*01 1635 gnl|Fabrus|A26_IGKJ1*01 1079
3095 VH3-23_IGHD5-12*01>1_IGHJ5*01 1636 gnl|Fabrus|A26_IGKJ1*01 1079
3096 VH3-23_IGHD5-12*01>3_IGHJ5*01 1637 gnl|Fabrus|A26_IGKJ1*01 1079
3097 VH3-23_IGHD5-18*01 (2) >1_IGHJ5*01 1638 gnl|Fabrus|A26_IGKJ1*01 1079
3098 VH3-23_IGHD5-18*01 (2) >2_IGHJ5*01 1639 gnl|Fabrus|A26_IGKJ1*01 1079
3099 VH3-23_IGHD5-18*01 (2) >3_IGHJ5*01 1640 gnl|Fabrus|A26_IGKJ1*01 1079
3100 VH3-23_IGHD5-24*01>1_IGHJ5*01 1641 gnl|Fabrus|A26_IGKJ1*01 1079
3101 VH3-23_IGHD5-24*01>3_IGHJ5*01 1642 gnl|Fabrus|A26_IGKJ1*01 1079
3102 VH3-23_IGHD6-6*01>1_IGHJ5*01 1643 gnl|Fabrus|A26_IGKJ1*01 1079
3103 VH3-23_IGHD1-1*01>1′_IGHJ5*01 1653 gnl|Fabrus|A26_IGKJ1*01 1079
3104 VH3-23_IGHD1-1*01>2′_IGHJ5*01 1654 gnl|Fabrus|A26_IGKJ1*01 1079
3105 VH3-23_IGHD1-1*01>3′_IGHJ5*01 1655 gnl|Fabrus|A26_IGKJ1*01 1079
3106 VH3-23_IGHD1-7*01>1′_IGHJ5*01 1656 gnl|Fabrus|A26_IGKJ1*01 1079
3107 VH3-23_IGHD1-7*01>3′_IGHJ5*01 1657 gnl|Fabrus|A26_IGKJ1*01 1079
3108 VH3-23_IGHD1-14*01>1′_IGHJ5*01 1658 gnl|Fabrus|A26_IGKJ1*01 1079
3109 VH3-23_IGHD1-14*01>2′_IGHJ5*01 1659 gnl|Fabrus|A26_IGKJ1*01 1079
3110 VH3-23_IGHD1-14*01>3′_IGHJ5*01 1660 gnl|Fabrus|A26_IGKJ1*01 1079
3111 VH3-23_IGHD1-20*01>1′_IGHJ5*01 1661 gnl|Fabrus|A26_IGKJ1*01 1079
3112 VH3-23_IGHD1-20*01>2′_IGHJ5*01 1662 gnl|Fabrus|A26_IGKJ1*01 1079
3113 VH3-23_IGHD1-20*01>3′_IGHJ5*01 1663 gnl|Fabrus|A26_IGKJ1*01 1079
3114 VH3-23_IGHD1-26*01>1′_IGHJ5*01 1664 gnl|Fabrus|A26_IGKJ1*01 1079
3115 VH3-23_IGHD1-26*01>3′_IGHJ5*01 1665 gnl|Fabrus|A26_IGKJ1*01 1079
3116 VH3-23_IGHD2-2*01>1′_IGHJ5*01 1666 gnl|Fabrus|A26_IGKJ1*01 1079
3117 VH3-23_IGHD2-2*01>3′_IGHJ5*01 1667 gnl|Fabrus|A26_IGKJ1*01 1079
3118 VH3-23_IGHD2-8*01>1′_IGHJ5*01 1668 gnl|Fabrus|A26_IGKJ1*01 1079
3119 VH3-23_IGHD2-15*01>1′_IGHJ5*01 1669 gnl|Fabrus|A26_IGKJ1*01 1079
3120 VH3-23_IGHD2-15*01>3′_IGHJ5*01 1670 gnl|Fabrus|A26_IGKJ1*01 1079
3121 VH3-23_IGHD2-21*01>1′_IGHJ5*01 1671 gnl|Fabrus|A26_IGKJ1*01 1079
3122 VH3-23_IGHD2-21*01>3′_IGHJ5*01 1672 gnl|Fabrus|A26_IGKJ1*01 1079
3123 VH3-23_IGHD3-3*01>1′_IGHJ5*01 1673 gnl|Fabrus|A26_IGKJ1*01 1079
3124 VH3-23_IGHD3-3*01>3′_IGHJ5*01 1674 gnl|Fabrus|A26_IGKJ1*01 1079
3125 VH3-23_IGHD3-9*01>1′_IGHJ5*01 1675 gnl|Fabrus|A26_IGKJ1*01 1079
3126 VH3-23_IGHD3-9*01>3′_IGHJ5*01 1676 gnl|Fabrus|A26_IGKJ1*01 1079
3127 VH3-23_IGHD3-10*01>1′_IGHJ5*01 1677 gnl|Fabrus|A26_IGKJ1*01 1079
3128 VH3-23_IGHD3-10*01>3′_IGHJ5*01 1678 gnl|Fabrus|A26_IGKJ1*01 1079
3129 VH3-23_IGHD3-16*01>1′_IGHJ5*01 1679 gnl|Fabrus|A26_IGKJ1*01 1079
3130 VH3-23_IGHD3-16*01>3′_IGHJ5*01 1680 gnl|Fabrus|A26_IGKJ1*01 1079
3131 VH3-23_IGHD3-22*01>1′_IGHJ5*01 1681 gnl|Fabrus|A26_IGKJ1*01 1079
3132 VH3-23_IGHD4-4*01 (1) >1′_IGHJ5*01 1682 gnl|Fabrus|A26_IGKJ1*01 1079
3133 VH3-23_IGHD4-4*01 (1) >3′_IGHJ5*01 1683 gnl|Fabrus|A26_IGKJ1*01 1079
3134 VH3-23_IGHD4-11*01 (1) >1′_IGHJ5*01 1684 gnl|Fabrus|A26_IGKJ1*01 1079
3135 VH3-23_IGHD4-11*01 (1) >3′_IGHJ5*01 1685 gnl|Fabrus|A26_IGKJ1*01 1079
3136 VH3-23_IGHD4-17*01>1′_IGHJ5*01 1686 gnl|Fabrus|A26_IGKJ1*01 1079
3137 VH3-23_IGHD4-17*01>3′_IGHJ5*01 1687 gnl|Fabrus|A26_IGKJ1*01 1079
3138 VH3-23_IGHD4-23*01>1′_IGHJ5*01 1688 gnl|Fabrus|A26_IGKJ1*01 1079
3139 VH3-23_IGHD4-23*01>3′_IGHJ5*01 1689 gnl|Fabrus|A26_IGKJ1*01 1079
3140 VH3-23_IGHD5-5*01 (2) >1′_IGHJ5*01 1690 gnl|Fabrus|A26_IGKJ1*01 1079
3141 VH3-23_IGHD5-5*01 (2) >3′_IGHJ5*01 1691 gnl|Fabrus|A26_IGKJ1*01 1079
3142 VH3-23_IGHD5-12*01>1′_IGHJ5*01 1692 gnl|Fabrus|A26_IGKJ1*01 1079
3143 VH3-23_IGHD5-12*01>3′_IGHJ5*01 1693 gnl|Fabrus|A26_IGKJ1*01 1079
3144 VH3-23_IGHD5-18*01 (2) >1′_IGHJ5*01 1694 gnl|Fabrus|A26_IGKJ1*01 1079
3145 VH3-23_IGHD5-18*01 (2) >3′_IGHJ5*01 1695 gnl|Fabrus|A26_IGKJ1*01 1079
3146 VH3-23_IGHD5-24*01>1′_IGHJ5*01 1696 gnl|Fabrus|A26_IGKJ1*01 1079
3147 VH3-23_IGHD5-24*01>3′_IGHJ5*01 1697 gnl|Fabrus|A26_IGKJ1*01 1079
3148 VH3-23_IGHD6-6*01>1′_IGHJ5*01 1698 gnl|Fabrus|A26_IGKJ1*01 1079
3149 VH3-23_IGHD6-6*01>2′_IGHJ5*01 1699 gnl|Fabrus|A26_IGKJ1*01 1079
3150 VH3-23_IGHD6-6*01>3′_IGHJ5*01 1700 gnl|Fabrus|A26_IGKJ1*01 1079
3151 VH3-23_IGHD1-1*01>1_IGHJ5*01 1596 gnl|Fabrus|A14_IGKJ1*01 1074
3152 VH3-23_IGHD1-1*01>2_IGHJ5*01 1597 gnl|Fabrus|A14_IGKJ1*01 1074
3153 VH3-23_IGHD1-1*01>3_IGHJ5*01 1598 gnl|Fabrus|A14_IGKJ1*01 1074
3154 VH3-23_IGHD1-7*01>1_IGHJ5*01 1599 gnl|Fabrus|A14_IGKJ1*01 1074
3155 VH3-23_IGHD1-7*01>3_IGHJ5*01 1600 gnl|Fabrus|A14_IGKJ1*01 1074
3156 VH3-23_IGHD1-14*01>1_IGHJ5*01 1601 gnl|Fabrus|A14_IGKJ1*01 1074
3157 VH3-23_IGHD1-14*01>3_IGHJ5*01 1602 gnl|Fabrus|A14_IGKJ1*01 1074
3158 VH3-23_IGHD1-20*01>1_IGHJ5*01 1603 gnl|Fabrus|A14_IGKJ1*01 1074
3159 VH3-23_IGHD1-20*01>3_IGHJ5*01 1604 gnl|Fabrus|A14_IGKJ1*01 1074
3160 VH3-23_IGHD1-26*01>1_IGHJ5*01 1605 gnl|Fabrus|A14_IGKJ1*01 1074
3161 VH3-23_IGHD1-26*01>3_IGHJ5*01 1606 gnl|Fabrus|A14_IGKJ1*01 1074
3162 VH3-23_IGHD2-2*01>2_IGHJ5*01 1607 gnl|Fabrus|A14_IGKJ1*01 1074
3163 VH3-23_IGHD2-2*01>3_IGHJ5*01 1608 gnl|Fabrus|A14_IGKJ1*01 1074
3164 VH3-23_IGHD2-8*01>2_IGHJ5*01 1609 gnl|Fabrus|A14_IGKJ1*01 1074
3165 VH3-23_IGHD2-8*01>3_IGHJ5*01 1610 gnl|Fabrus|A14_IGKJ1*01 1074
3166 VH3-23_IGHD2-15*01>2_IGHJ5*01 1611 gnl|Fabrus|A14_IGKJ1*01 1074
3167 VH3-23_IGHD2-15*01>3_IGHJ5*01 1612 gnl|Fabrus|A14_IGKJ1*01 1074
3168 VH3-23_IGHD2-21*01>2_IGHJ5*01 1613 gnl|Fabrus|A14_IGKJ1*01 1074
3169 VH3-23_IGHD2-21*01>3_IGHJ5*01 1614 gnl|Fabrus|A14_IGKJ1*01 1074
3170 VH3-23_IGHD3-3*01>1_IGHJ5*01 1615 gnl|Fabrus|A14_IGKJ1*01 1074
3171 VH3-23_IGHD3-3*01>2_IGHJ5*01 1616 gnl|Fabrus|A14_IGKJ1*01 1074
3172 VH3-23_IGHD3-3*01>3_IGHJ5*01 1617 gnl|Fabrus|A14_IGKJ1*01 1074
3173 VH3-23_IGHD3-9*01>2_IGHJ5*01 1618 gnl|Fabrus|A14_IGKJ1*01 1074
3174 VH3-23_IGHD3-10*01>2_IGHJ5*01 1619 gnl|Fabrus|A14_IGKJ1*01 1074
3175 VH3-23_IGHD3-10*01>3_IGHJ5*01 1620 gnl|Fabrus|A14_IGKJ1*01 1074
3176 VH3-23_IGHD3-16*01>2_IGHJ5*01 1621 gnl|Fabrus|A14_IGKJ1*01 1074
3177 VH3-23_IGHD3-16*01>3_IGHJ5*01 1622 gnl|Fabrus|A14_IGKJ1*01 1074
3178 VH3-23_IGHD3-22*01>2_IGHJ5*01 1623 gnl|Fabrus|A14_IGKJ1*01 1074
3179 VH3-23_IGHD3-22*01>3_IGHJ5*01 1624 gnl|Fabrus|A14_IGKJ1*01 1074
3180 VH3-23_IGHD4-4*01 (1) >2_IGHJ5*01 1625 gnl|Fabrus|A14_IGKJ1*01 1074
3181 VH3-23_IGHD4-4*01 (1) >3_IGHJ5*01 1626 gnl|Fabrus|A14_IGKJ1*01 1074
3182 VH3-23_IGHD4-11*01 (1) >2_IGHJ5*01 1627 gnl|Fabrus|A14_IGKJ1*01 1074
3183 VH3-23_IGHD4-11*01 (1) >3_IGHJ5*01 1628 gnl|Fabrus|A14_IGKJ1*01 1074
3184 VH3-23_IGHD4-17*01>2_IGHJ5*01 1629 gnl|Fabrus|A14_IGKJ1*01 1074
3185 VH3-23_IGHD4-17*01>3_IGHJ5*01 1630 gnl|Fabrus|A14_IGKJ1*01 1074
3186 VH3-23_IGHD4-23*01>2_IGHJ5*01 1631 gnl|Fabrus|A14_IGKJ1*01 1074
3187 VH3-23_IGHD4-23*01>3_IGHJ5*01 1632 gnl|Fabrus|A14_IGKJ1*01 1074
3188 VH3-23_IGHD5-5*01 (2) >1_IGHJ5*01 1633 gnl|Fabrus|A14_IGKJ1*01 1074
3189 VH3-23_IGHD5-5*01 (2) >2_IGHJ5*01 1634 gnl|Fabrus|A14_IGKJ1*01 1074
3190 VH3-23_IGHD5-5*01 (2) >3_IGHJ5*01 1635 gnl|Fabrus|A14_IGKJ1*01 1074
3191 VH3-23_IGHD5-12*01>1_IGHJ5*01 1636 gnl|Fabrus|A14_IGKJ1*01 1074
3192 VH3-23_IGHD5-12*01>3_IGHJ5*01 1637 gnl|Fabrus|A14_IGKJ1*01 1074
3193 VH3-23_IGHD5-18*01 (2) >1_IGHJ5*01 1638 gnl|Fabrus|A14_IGKJ1*01 1074
3194 VH3-23_IGHD5-18*01 (2) >2_IGHJ5*01 1639 gnl|Fabrus|A14_IGKJ1*01 1074
3195 VH3-23_IGHD5-18*01 (2) >3_IGHJ5*01 1640 gnl|Fabrus|A14_IGKJ1*01 1074
3196 VH3-23_IGHD5-24*01>1_IGHJ5*01 1641 gnl|Fabrus|A14_IGKJ1*01 1074
3197 VH3-23_IGHD5-24*01>3_IGHJ5*01 1642 gnl|Fabrus|A14_IGKJ1*01 1074
3198 VH3-23_IGHD6-6*01>1_IGHJ5*01 1643 gnl|Fabrus|A14_IGKJ1*01 1074
3199 VH3-23_IGHD1-1*01>1′_IGHJ5*01 1653 gnl|Fabrus|A14_IGKJ1*01 1074
3200 VH3-23_IGHD1-1*01>2′_IGHJ5*01 1654 gnl|Fabrus|A14_IGKJ1*01 1074
3201 VH3-23_IGHD1-1*01>3′_IGHJ5*01 1655 gnl|Fabrus|A14_IGKJ1*01 1074
3202 VH3-23_IGHD1-7*01>1′_IGHJ5*01 1656 gnl|Fabrus|A14_IGKJ1*01 1074
3203 VH3-23_IGHD1-7*01>3′_IGHJ5*01 1657 gnl|Fabrus|A14_IGKJ1*01 1074
3204 VH3-23_IGHD1-14*01>1′_IGHJ5*01 1658 gnl|Fabrus|A14_IGKJ1*01 1074
3205 VH3-23_IGHD1-14*01>2′_IGHJ5*01 1659 gnl|Fabrus|A14_IGKJ1*01 1074
3206 VH3-23_IGHD1-14*01>3′_IGHJ5*01 1660 gnl|Fabrus|A14_IGKJ1*01 1074
3207 VH3-23_IGHD1-20*01>1′_IGHJ5*01 1661 gnl|Fabrus|A14_IGKJ1*01 1074
3208 VH3-23_IGHD1-20*01>2′_IGHJ5*01 1662 gnl|Fabrus|A14_IGKJ1*01 1074
3209 VH3-23_IGHD1-20*01>3′_IGHJ5*01 1663 gnl|Fabrus|A14_IGKJ1*01 1074
3210 VH3-23_IGHD1-26*01>1′_IGHJ5*01 1664 gnl|Fabrus|A14_IGKJ1*01 1074
3211 VH3-23_IGHD1-26*01>3′_IGHJ5*01 1665 gnl|Fabrus|A14_IGKJ1*01 1074
3212 VH3-23_IGHD2-2*01>1′_IGHJ5*01 1666 gnl|Fabrus|A14_IGKJ1*01 1074
3213 VH3-23_IGHD2-2*01>3′_IGHJ5*01 1667 gnl|Fabrus|A14_IGKJ1*01 1074
3214 VH3-23_IGHD2-8*01>1′_IGHJ5*01 1668 gnl|Fabrus|A14_IGKJ1*01 1074
3215 VH3-23_IGHD2-15*01>1′_IGHJ5*01 1669 gnl|Fabrus|A14_IGKJ1*01 1074
3216 VH3-23_IGHD2-15*01>3′_IGHJ5*01 1670 gnl|Fabrus|A14_IGKJ1*01 1074
3217 VH3-23_IGHD2-21*01>1′_IGHJ5*01 1671 gnl|Fabrus|A14_IGKJ1*01 1074
3218 VH3-23_IGHD2-21*01>3′_IGHJ5*01 1672 gnl|Fabrus|A14_IGKJ1*01 1074
3219 VH3-23_IGHD3-3*01>1′_IGHJ5*01 1673 gnl|Fabrus|A14_IGKJ1*01 1074
3220 VH3-23_IGHD3-3*01>3′_IGHJ5*01 1674 gnl|Fabrus|A14_IGKJ1*01 1074
3221 VH3-23_IGHD3-9*01>1′_IGHJ5*01 1675 gnl|Fabrus|A14_IGKJ1*01 1074
3222 VH3-23_IGHD3-9*01>3′_IGHJ5*01 1676 gnl|Fabrus|A14_IGKJ1*01 1074
3223 VH3-23_IGHD3-10*01>1′_IGHJ5*01 1677 gnl|Fabrus|A14_IGKJ1*01 1074
3224 VH3-23_IGHD3-10*01>3′_IGHJ5*01 1678 gnl|Fabrus|A14_IGKJ1*01 1074
3225 VH3-23_IGHD3-16*01>1′_IGHJ5*01 1679 gnl|Fabrus|A14_IGKJ1*01 1074
3226 VH3-23_IGHD3-16*01>3′_IGHJ5*01 1680 gnl|Fabrus|A14_IGKJ1*01 1074
3227 VH3-23_IGHD3-22*01>1′_IGHJ5*01 1681 gnl|Fabrus|A14_IGKJ1*01 1074
3228 VH3-23_IGHD4-4*01 (1) >1′_IGHJ5*01 1682 gnl|Fabrus|A14_IGKJ1*01 1074
3229 VH3-23_IGHD4-4*01 (1) >3′_IGHJ5*01 1683 gnl|Fabrus|A14_IGKJ1*01 1074
3230 VH3-23_IGHD4-11*01 (1) >1′_IGHJ5*01 1684 gnl|Fabrus|A14_IGKJ1*01 1074
3231 VH3-23_IGHD4-11*01 (1) >3′_IGHJ5*01 1685 gnl|Fabrus|A14_IGKJ1*01 1074
3232 VH3-23_IGHD4-17*01>1′_IGHJ5*01 1686 gnl|Fabrus|A14_IGKJ1*01 1074
3233 VH3-23_IGHD4-17*01>3′_IGHJ5*01 1687 gnl|Fabrus|A14_IGKJ1*01 1074
3234 VH3-23_IGHD4-23*01>1′_IGHJ5*01 1688 gnl|Fabrus|A14_IGKJ1*01 1074
3235 VH3-23_IGHD4-23*01>3′_IGHJ5*01 1689 gnl|Fabrus|A14_IGKJ1*01 1074
3236 VH3-23_IGHD5-5*01 (2) >1′_IGHJ5*01 1690 gnl|Fabrus|A14_IGKJ1*01 1074
3237 VH3-23_IGHD5-5*01 (2) >3′_IGHJ5*01 1691 gnl|Fabrus|A14_IGKJ1*01 1074
3238 VH3-23_IGHD5-12*01>1′_IGHJ5*01 1692 gnl|Fabrus|A14_IGKJ1*01 1074
3239 VH3-23_IGHD5-12*01>3′_IGHJ5*01 1693 gnl|Fabrus|A14_IGKJ1*01 1074
3240 VH3-23_IGHD5-18*01 (2) >1′_IGHJ5*01 1694 gnl|Fabrus|A14_IGKJ1*01 1074
3241 VH3-23_IGHD5-18*01 (2) >3′_IGHJ5*01 1695 gnl|Fabrus|A14_IGKJ1*01 1074
3242 VH3-23_IGHD5-24*01>1′_IGHJ5*01 1696 gnl|Fabrus|A14_IGKJ1*01 1074
3243 VH3-23_IGHD5-24*01>3′_IGHJ5*01 1697 gnl|Fabrus|A14_IGKJ1*01 1074
3244 VH3-23_IGHD6-6*01>1′_IGHJ5*01 1698 gnl|Fabrus|A14_IGKJ1*01 1074
3245 VH3-23_IGHD6-6*01>2′_IGHJ5*01 1699 gnl|Fabrus|A14_IGKJ1*01 1074
3246 VH3-23_IGHD6-6*01>3′_IGHJ5*01 1700 gnl|Fabrus|A14_IGKJ1*01 1074
3247 VH3-23_IGHD1-1*01>1_IGHJ5*01 1596 gnl|Fabrus|A27_IGKJ1*01 1080
3248 VH3-23_IGHD1-1*01>2_IGHJ5*01 1597 gnl|Fabrus|A27_IGKJ1*01 1080
3249 VH3-23_IGHD1-1*01>3_IGHJ5*01 1598 gnl|Fabrus|A27_IGKJ1*01 1080
3250 VH3-23_IGHD1-7*01>1_IGHJ5*01 1599 gnl|Fabrus|A27_IGKJ1*01 1080
3251 VH3-23_IGHD1-7*01>3_IGHJ5*01 1600 gnl|Fabrus|A27_IGKJ1*01 1080
3252 VH3-23_IGHD1-14*01>1_IGHJ5*01 1601 gnl|Fabrus|A27_IGKJ1*01 1080
3253 VH3-23_IGHD1-14*01>3_IGHJ5*01 1602 gnl|Fabrus|A27_IGKJ1*01 1080
3254 VH3-23_IGHD1-20*01>1_IGHJ5*01 1603 gnl|Fabrus|A27_IGKJ1*01 1080
3255 VH3-23_IGHD1-20*01>3_IGHJ5*01 1604 gnl|Fabrus|A27_IGKJ1*01 1080
3256 VH3-23_IGHD1-26*01>1_IGHJ5*01 1605 gnl|Fabrus|A27_IGKJ1*01 1080
3257 VH3-23_IGHD1-26*01>3_IGHJ5*01 1606 gnl|Fabrus|A27_IGKJ1*01 1080
3258 VH3-23_IGHD2-2*01>2_IGHJ5*01 1607 gnl|Fabrus|A27_IGKJ1*01 1080
3259 VH3-23_IGHD2-2*01>3_IGHJ5*01 1608 gnl|Fabrus|A27_IGKJ1*01 1080
3260 VH3-23_IGHD2-8*01>2_IGHJ5*01 1609 gnl|Fabrus|A27_IGKJ1*01 1080
3261 VH3-23_IGHD2-8*01>3_IGHJ5*01 1610 gnl|Fabrus|A27_IGKJ1*01 1080
3262 VH3-23_IGHD2-15*01>2_IGHJ5*01 1611 gnl|Fabrus|A27_IGKJ1*01 1080
3263 VH3-23_IGHD2-15*01>3_IGHJ5*01 1612 gnl|Fabrus|A27_IGKJ1*01 1080
3264 VH3-23_IGHD2-21*01>2_IGHJ5*01 1613 gnl|Fabrus|A27_IGKJ1*01 1080
3265 VH3-23_IGHD2-21*01>3_IGHJ5*01 1614 gnl|Fabrus|A27_IGKJ1*01 1080
3266 VH3-23_IGHD3-3*01>1_IGHJ5*01 1615 gnl|Fabrus|A27_IGKJ1*01 1080
3267 VH3-23_IGHD3-3*01>2_IGHJ5*01 1616 gnl|Fabrus|A27_IGKJ1*01 1080
3268 VH3-23_IGHD3-3*01>3_IGHJ5*01 1617 gnl|Fabrus|A27_IGKJ1*01 1080
3269 VH3-23_IGHD3-9*01>2_IGHJ5*01 1618 gnl|Fabrus|A27_IGKJ1*01 1080
3270 VH3-23_IGHD3-10*01>2_IGHJ5*01 1619 gnl|Fabrus|A27_IGKJ1*01 1080
3271 VH3-23_IGHD3-10*01>3_IGHJ5*01 1620 gnl|Fabrus|A27_IGKJ1*01 1080
3272 VH3-23_IGHD3-16*01>2_IGHJ5*01 1621 gnl|Fabrus|A27_IGKJ1*01 1080
3273 VH3-23_IGHD3-16*01>3_IGHJ5*01 1622 gnl|Fabrus|A27_IGKJ1*01 1080
3274 VH3-23_IGHD3-22*01>2_IGHJ5*01 1623 gnl|Fabrus|A27_IGKJ1*01 1080
3275 VH3-23_IGHD3-22*01>3_IGHJ5*01 1624 gnl|Fabrus|A27_IGKJ1*01 1080
3276 VH3-23_IGHD4-4*01 (1) >2_IGHJ5*01 1625 gnl|Fabrus|A27_IGKJ1*01 1080
3277 VH3-23_IGHD4-4*01 (1) >3_IGHJ5*01 1626 gnl|Fabrus|A27_IGKJ1*01 1080
3278 VH3-23_IGHD4-11*01 (1) >2_IGHJ5*01 1627 gnl|Fabrus|A27_IGKJ1*01 1080
3279 VH3-23_IGHD4-11*01 (1) >3_IGHJ5*01 1628 gnl|Fabrus|A27_IGKJ1*01 1080
3280 VH3-23_IGHD4-17*01>2_IGHJ5*01 1629 gnl|Fabrus|A27_IGKJ1*01 1080
3281 VH3-23_IGHD4-17*01>3_IGHJ5*01 1630 gnl|Fabrus|A27_IGKJ1*01 1080
3282 VH3-23_IGHD4-23*01>2_IGHJ5*01 1631 gnl|Fabrus|A27_IGKJ1*01 1080
3283 VH3-23_IGHD4-23*01>3_IGHJ5*01 1632 gnl|Fabrus|A27_IGKJ1*01 1080
3284 VH3-23_IGHD5-5*01 (2) >1_IGHJ5*01 1633 gnl|Fabrus|A27_IGKJ1*01 1080
3285 VH3-23_IGHD5-5*01 (2) >2_IGHJ5*01 1634 gnl|Fabrus|A27_IGKJ1*01 1080
3286 VH3-23_IGHD5-5*01 (2) >3_IGHJ5*01 1635 gnl|Fabrus|A27_IGKJ1*01 1080
3287 VH3-23_IGHD5-12*01>1_IGHJ5*01 1636 gnl|Fabrus|A27_IGKJ1*01 1080
3288 VH3-23_IGHD5-12*01>3_IGHJ5*01 1637 gnl|Fabrus|A27_IGKJ1*01 1080
3289 VH3-23_IGHD5-18*01 (2) >1_IGHJ5*01 1638 gnl|Fabrus|A27_IGKJ1*01 1080
3290 VH3-23_IGHD5-18*01 (2) >2_IGHJ5*01 1639 gnl|Fabrus|A27_IGKJ1*01 1080
3291 VH3-23_IGHD5-18*01 (2) >3_IGHJ5*01 1640 gnl|Fabrus|A27_IGKJ1*01 1080
3292 VH3-23_IGHD5-24*01>1_IGHJ5*01 1641 gnl|Fabrus|A27_IGKJ1*01 1080
3293 VH3-23_IGHD5-24*01>3_IGHJ5*01 1642 gnl|Fabrus|A27_IGKJ1*01 1080
3294 VH3-23_IGHD6-6*01>1_IGHJ5*01 1643 gnl|Fabrus|A27_IGKJ1*01 1080
3295 VH3-23_IGHD1-1*01>1′_IGHJ5*01 1653 gnl|Fabrus|A27_IGKJ1*01 1080
3296 VH3-23_IGHD1-1*01>2′_IGHJ5*01 1654 gnl|Fabrus|A27_IGKJ1*01 1080
3297 VH3-23_IGHD1-1*01>3′_IGHJ5*01 1655 gnl|Fabrus|A27_IGKJ1*01 1080
3298 VH3-23_IGHD1-7*01>1′_IGHJ5*01 1656 gnl|Fabrus|A27_IGKJ1*01 1080
3299 VH3-23_IGHD1-7*01>3′_IGHJ5*01 1657 gnl|Fabrus|A27_IGKJ1*01 1080
3300 VH3-23_IGHD1-14*01>1′_IGHJ5*01 1658 gnl|Fabrus|A27_IGKJ1*01 1080
3301 VH3-23_IGHD1-14*01>2′_IGHJ5*01 1659 gnl|Fabrus|A27_IGKJ1*01 1080
3302 VH3-23_IGHD1-14*01>3′_IGHJ5*01 1660 gnl|Fabrus|A27_IGKJ1*01 1080
3303 VH3-23_IGHD1-20*01>1′_IGHJ5*01 1661 gnl|Fabrus|A27_IGKJ1*01 1080
3304 VH3-23_IGHD1-20*01>2′_IGHJ5*01 1662 gnl|Fabrus|A27_IGKJ1*01 1080
3305 VH3-23_IGHD1-20*01>3′_IGHJ5*01 1663 gnl|Fabrus|A27_IGKJ1*01 1080
3306 VH3-23_IGHD1-26*01>1′_IGHJ5*01 1664 gnl|Fabrus|A27_IGKJ1*01 1080
3307 VH3-23_IGHD1-26*01>3′_IGHJ5*01 1665 gnl|Fabrus|A27_IGKJ1*01 1080
3308 VH3-23_IGHD2-2*01>1′_IGHJ5*01 1666 gnl|Fabrus|A27_IGKJ1*01 1080
3309 VH3-23_IGHD2-2*01>3′_IGHJ5*01 1667 gnl|Fabrus|A27_IGKJ1*01 1080
3310 VH3-23_IGHD2-8*01>1′_IGHJ5*01 1668 gnl|Fabrus|A27_IGKJ1*01 1080
3311 VH3-23_IGHD2-15*01>1′_IGHJ5*01 1669 gnl|Fabrus|A27_IGKJ1*01 1080
3312 VH3-23_IGHD2-15*01>3′_IGHJ5*01 1670 gnl|Fabrus|A27_IGKJ1*01 1080
3313 VH3-23_IGHD2-21*01>1′_IGHJ5*01 1671 gnl|Fabrus|A27_IGKJ1*01 1080
3314 VH3-23_IGHD2-21*01>3′_IGHJ5*01 1672 gnl|Fabrus|A27_IGKJ1*01 1080
3315 VH3-23_IGHD3-3*01>1′_IGHJ5*01 1673 gnl|Fabrus|A27_IGKJ1*01 1080
3316 VH3-23_IGHD3-3*01>3′_IGHJ5*01 1674 gnl|Fabrus|A27_IGKJ1*01 1080
3317 VH3-23_IGHD3-9*01>1′_IGHJ5*01 1675 gnl|Fabrus|A27_IGKJ1*01 1080
3318 VH3-23_IGHD3-9*01>3′_IGHJ5*01 1676 gnl|Fabrus|A27_IGKJ1*01 1080
3319 VH3-23_IGHD3-10*01>1′_IGHJ5*01 1677 gnl|Fabrus|A27_IGKJ1*01 1080
3320 VH3-23_IGHD3-10*01>3′_IGHJ5*01 1678 gnl|Fabrus|A27_IGKJ1*01 1080
3321 VH3-23_IGHD3-16*01>1′_IGHJ5*01 1679 gnl|Fabrus|A27_IGKJ1*01 1080
3322 VH3-23_IGHD3-16*01>3′_IGHJ5*01 1680 gnl|Fabrus|A27_IGKJ1*01 1080
3323 VH3-23_IGHD3-22*01>1′_IGHJ5*01 1681 gnl|Fabrus|A27_IGKJ1*01 1080
3324 VH3-23_IGHD4-4*01 (1) >1′_IGHJ5*01 1682 gnl|Fabrus|A27_IGKJ1*01 1080
3325 VH3-23_IGHD4-4*01 (1) >3′_IGHJ5*01 1683 gnl|Fabrus|A27_IGKJ1*01 1080
3326 VH3-23_IGHD4-11*01 (1) >1′_IGHJ5*01 1684 gnl|Fabrus|A27_IGKJ1*01 1080
3327 VH3-23_IGHD4-11*01 (1) >3′_IGHJ5*01 1685 gnl|Fabrus|A27_IGKJ1*01 1080
3328 VH3-23_IGHD4-17*01>1′_IGHJ5*01 1686 gnl|Fabrus|A27_IGKJ1*01 1080
3329 VH3-23_IGHD4-17*01>3′_IGHJ5*01 1687 gnl|Fabrus|A27_IGKJ1*01 1080
3330 VH3-23_IGHD4-23*01>1′_IGHJ5*01 1688 gnl|Fabrus|A27_IGKJ1*01 1080
3331 VH3-23_IGHD4-23*01>3′_IGHJ5*01 1689 gnl|Fabrus|A27_IGKJ1*01 1080
3332 VH3-23_IGHD5-5*01 (2) >1′_IGHJ5*01 1690 gnl|Fabrus|A27_IGKJ1*01 1080
3333 VH3-23_IGHD5-5*01 (2) >3′_IGHJ5*01 1691 gnl|Fabrus|A27_IGKJ1*01 1080
3334 VH3-23_IGHD5-12*01>1′_IGHJ5*01 1692 gnl|Fabrus|A27_IGKJ1*01 1080
3335 VH3-23_IGHD5-12*01>3′_IGHJ5*01 1693 gnl|Fabrus|A27_IGKJ1*01 1080
3336 VH3-23_IGHD5-18*01 (2) >1′_IGHJ5*01 1694 gnl|Fabrus|A27_IGKJ1*01 1080
3337 VH3-23_IGHD5-18*01 (2) >3′_IGHJ5*01 1695 gnl|Fabrus|A27_IGKJ1*01 1080
3338 VH3-23_IGHD5-24*01>1′_IGHJ5*01 1696 gnl|Fabrus|A27_IGKJ1*01 1080
3339 VH3-23_IGHD5-24*01>3′_IGHJ5*01 1697 gnl|Fabrus|A27_IGKJ1*01 1080
3340 VH3-23_IGHD6-6*01>1′_IGHJ5*01 1698 gnl|Fabrus|A27_IGKJ1*01 1080
3341 VH3-23_IGHD6-6*01>2′_IGHJ5*01 1699 gnl|Fabrus|A27_IGKJ1*01 1080
3342 VH3-23_IGHD6-6*01>3′_IGHJ5*01 1700 gnl|Fabrus|A27_IGKJ1*01 1080
3343 VH3-23_IGHD6-6*01>2_IGHJ1*01 1184 gnl|Fabrus|V1-11_IGLJ2*01 1104
3344 VH3-23_IGHD6-13*01>1_IGHJ1*01 1185 gnl|Fabrus|V1-11_IGLJ2*01 1104
3345 VH3-23_IGHD6-13*01>2_IGHJ1*01 1186 gnl|Fabrus|V1-11_IGLJ2*01 1104
3346 VH3-23_IGHD6-19*01>1_IGHJ1*01 1187 gnl|Fabrus|V1-11_IGLJ2*01 1104
3347 VH3-23_IGHD6-19*01>2_IGHJ1*01 1188 gnl|Fabrus|V1-11_IGLJ2*01 1104
3348 VH3-23_IGHD6-25*01>1_IGHJ1*01 1189 gnl|Fabrus|V1-11_IGLJ2*01 1104
3349 VH3-23_IGHD6-25*01>2_IGHJ1*01 1190 gnl|Fabrus|V1-11_IGLJ2*01 1104
3350 VH3-23_IGHD7-27*01>1_IGHJ1*01 1191 gnl|Fabrus|V1-11_IGLJ2*01 1104
3351 VH3-23_IGHD7-27*01>3_IGHJ1*01 1192 gnl|Fabrus|V1-11_IGLJ2*01 1104
3352 VH3-23_IGHD6-13*01>1′_IGHJ1*01 1241 gnl|Fabrus|V1-11_IGLJ2*01 1104
3353 VH3-23_IGHD6-13*01>2′_IGHJ1*01 1242 gnl|Fabrus|V1-11_IGLJ2*01 1104
3354 VH3-23_IGHD6-13*01>2_IGHJ1*01_B 1243 gnl|Fabrus|V1-11_IGLJ2*01 1104
3355 VH3-23_IGHD6-19*01>1′_IGHJ1*01 1244 gnl|Fabrus|V1-11_IGLJ2*01 1104
3356 VH3-23_IGHD6-19*01>2′_IGHJ1*01 1245 gnl|Fabrus|V1-11_IGLJ2*01 1104
3357 VH3-23_IGHD6-19*01>2_IGHJ1*01_B 1246 gnl|Fabrus|V1-11_IGLJ2*01 1104
3358 VH3-23_IGHD6-25*01>1′_IGHJ1*01 1247 gnl|Fabrus|V1-11_IGLJ2*01 1104
3359 VH3-23_IGHD6-25*01>3′_IGHJ1*01 1248 gnl|Fabrus|V1-11_IGLJ2*01 1104
3360 VH3-23_IGHD7-27*01>1′_IGHJ1*01_B 1249 gnl|Fabrus|V1-11_IGLJ2*01 1104
3361 VH3-23_IGHD7-27*01>2′_IGHJ1*01 1250 gnl|Fabrus|V1-11_IGLJ2*01 1104
3362 VH3-23_IGHD6-6*01>2_IGHJ2*01 1299 gnl|Fabrus|V1-11_IGLJ2*01 1104
3363 VH3-23_IGHD6-13*01>1_IGHJ2*01 1300 gnl|Fabrus|V1-11_IGLJ2*01 1104
3364 VH3-23_IGHD6-13*01>2_IGHJ2*01 1301 gnl|Fabrus|V1-11_IGLJ2*01 1104
3365 VH3-23_IGHD6-19*01>1_IGHJ2*01 1302 gnl|Fabrus|V1-11_IGLJ2*01 1104
3366 VH3-23_IGHD6-19*01>2_IGHJ2*01 1303 gnl|Fabrus|V1-11_IGLJ2*01 1104
3367 VH3-23_IGHD6-25*01>1_IGHJ2*01 1304 gnl|Fabrus|V1-11_IGLJ2*01 1104
3368 VH3-23_IGHD6-25*01>2_IGHJ2*01 1305 gnl|Fabrus|V1-11_IGLJ2*01 1104
3369 VH3-23_IGHD7-27*01>1_IGHJ2*01 1306 gnl|Fabrus|V1-11_IGLJ2*01 1104
3370 VH3-23_IGHD7-27*01>3_IGHJ2*01 1307 gnl|Fabrus|V1-11_IGLJ2*01 1104
3371 VH3-23_IGHD6-13*01>1′_IGHJ2*01 1356 gnl|Fabrus|V1-11_IGLJ2*01 1104
3372 VH3-23_IGHD6-13*01>2′_IGHJ2*01 1357 gnl|Fabrus|V1-11_IGLJ2*01 1104
3373 VH3-23_IGHD6-13*01>2_IGHJ2*01_B 1358 gnl|Fabrus|V1-11_IGLJ2*01 1104
3374 VH3-23_IGHD6-19*01>1′_IGHJ2*01 1359 gnl|Fabrus|V1-11_IGLJ2*01 1104
3375 VH3-23_IGHD6-19*01>2′_IGHJ2*01 1360 gnl|Fabrus|V1-11_IGLJ2*01 1104
3376 VH3-23_IGHD6-19*01>2_IGHJ2*01_B 1361 gnl|Fabrus|V1-11_IGLJ2*01 1104
3377 VH3-23_IGHD6-25*01>1′_IGHJ2*01 1362 gnl|Fabrus|V1-11_IGLJ2*01 1104
3378 VH3-23_IGHD6-25*01>3′_IGHJ2*01 1363 gnl|Fabrus|V1-11_IGLJ2*01 1104
3379 VH3-23_IGHD7-27*01>1′_IGHJ2*01 1364 gnl|Fabrus|V1-11_IGLJ2*01 1104
3380 VH3-23_IGHD7-27*01>2′_IGHJ2*01 1365 gnl|Fabrus|V1-11_IGLJ2*01 1104
3381 VH3-23_IGHD6-6*01>2_IGHJ3*01 1414 gnl|Fabrus|V1-11_IGLJ2*01 1104
3382 VH3-23_IGHD6-13*01>1_IGHJ3*01 1415 gnl|Fabrus|V1-11_IGLJ2*01 1104
3383 VH3-23_IGHD6-13*01>2_IGHJ3*01 1416 gnl|Fabrus|V1-11_IGLJ2*01 1104
3384 VH3-23_IGHD6-19*01>1_IGHJ3*01 1417 gnl|Fabrus|V1-11_IGLJ2*01 1104
3385 VH3-23_IGHD6-19*01>2_IGHJ3*01 1418 gnl|Fabrus|V1-11_IGLJ2*01 1104
3386 VH3-23_IGHD6-25*01>1_IGHJ3*01 1419 gnl|Fabrus|V1-11_IGLJ2*01 1104
3387 VH3-23_IGHD6-25*01>2_IGHJ3*01 1420 gnl|Fabrus|V1-11_IGLJ2*01 1104
3388 VH3-23_IGHD7-27*01>1_IGHJ3*01 1421 gnl|Fabrus|V1-11_IGLJ2*01 1104
3389 VH3-23_IGHD7-27*01>3_IGHJ3*01 1422 gnl|Fabrus|V1-11_IGLJ2*01 1104
3390 VH3-23_IGHD6-13*01>1′_IGHJ3*01 1471 gnl|Fabrus|V1-11_IGLJ2*01 1104
3391 VH3-23_IGHD6-13*01>2′_IGHJ3*01 1472 gnl|Fabrus|V1-11_IGLJ2*01 1104
3392 VH3-23_IGHD6-13*01>3′_IGHJ6*01 1818 gnl|Fabrus|V1-11_IGLJ2*01 1104
3393 VH3-23_IGHD6-19*01>1′_IGHJ3*01 1474 gnl|Fabrus|V1-11_IGLJ2*01 1104
3394 VH3-23_IGHD6-19*01>2′_IGHJ3*01 1475 gnl|Fabrus|V1-11_IGLJ2*01 1104
3395 VH3-23_IGHD6-19*01>3′_IGHJ3*01 1476 gnl|Fabrus|V1-11_IGLJ2*01 1104
3396 VH3-23_IGHD6-25*01>1′_IGHJ3*01 1477 gnl|Fabrus|V1-11_IGLJ2*01 1104
3397 VH3-23_IGHD6-25*01>3′_IGHJ3*01 1478 gnl|Fabrus|V1-11_IGLJ2*01 1104
3398 VH3-23_IGHD7-27*01>1′_IGHJ3*01 1479 gnl|Fabrus|V1-11_IGLJ2*01 1104
3399 VH3-23_IGHD7-27*01>2′_IGHJ3*01 1480 gnl|Fabrus|V1-11_IGLJ2*01 1104
3400 VH3-23_IGHD6-6*01>2_IGHJ4*01 1529 gnl|Fabrus|V1-11_IGLJ2*01 1104
3401 VH3-23_IGHD6-13*01>1_IGHJ4*01 1530 gnl|Fabrus|V1-11_IGLJ2*01 1104
3402 VH3-23_IGHD6-13*01>2_IGHJ4*01 1531 gnl|Fabrus|V1-11_IGLJ2*01 1104
3403 VH3-23_IGHD6-19*01>1_IGHJ4*01 1532 gnl|Fabrus|V1-11_IGLJ2*01 1104
3404 VH3-23_IGHD6-19*01>2_IGHJ4*01 1533 gnl|Fabrus|V1-11_IGLJ2*01 1104
3405 VH3-23_IGHD6-25*01>1_IGHJ4*01 1534 gnl|Fabrus|V1-11_IGLJ2*01 1104
3406 VH3-23_IGHD6-25*01>2_IGHJ4*01 1535 gnl|Fabrus|V1-11_IGLJ2*01 1104
3407 VH3-23_IGHD7-27*01>1_IGHJ4*01 1536 gnl|Fabrus|V1-11_IGLJ2*01 1104
3408 VH3-23_IGHD7-27*01>3_IGHJ4*01 1537 gnl|Fabrus|V1-11_IGLJ2*01 1104
3409 VH3-23_IGHD6-13*01>1′_IGHJ4*01 1586 gnl|Fabrus|V1-11_IGLJ2*01 1104
3410 VH3-23_IGHD6-13*01>2′_IGHJ4*01 1587 gnl|Fabrus|V1-11_IGLJ2*01 1104
3411 VH3-23_IGHD6-13*01>2_IGHJ4*01_B 1588 gnl|Fabrus|V1-11_IGLJ2*01 1104
3412 VH3-23_IGHD6-19*01>1′_IGHJ4*01 1589 gnl|Fabrus|V1-11_IGLJ2*01 1104
3413 VH3-23_IGHD6-19*01>2′_IGHJ4*01 1590 gnl|Fabrus|V1-11_IGLJ2*01 1104
3414 VH3-23_IGHD6-19*01>2_IGHJ4*01_B 1591 gnl|Fabrus|V1-11_IGLJ2*01 1104
3415 VH3-23_IGHD6-25*01>1′_IGHJ4*01 1592 gnl|Fabrus|V1-11_IGLJ2*01 1104
3416 VH3-23_IGHD6-25*01>3′_IGHJ4*01 1593 gnl|Fabrus|V1-11_IGLJ2*01 1104
3417 VH3-23_IGHD7-27*01>1′_IGHJ4*01 1594 gnl|Fabrus|V1-11_IGLJ2*01 1104
3418 VH3-23_IGHD7-27*01>2′_IGHJ4*01 1595 gnl|Fabrus|V1-11_IGLJ2*01 1104
3419 VH3-23_IGHD6-6*01>2_IGHJ5*01 1644 gnl|Fabrus|V1-11_IGLJ2*01 1104
3420 VH3-23_IGHD6-13*01>1_IGHJ5*01 1645 gnl|Fabrus|V1-11_IGLJ2*01 1104
3421 VH3-23_IGHD6-13*01>2_IGHJ5*01 1646 gnl|Fabrus|V1-11_IGLJ2*01 1104
3422 VH3-23_IGHD6-19*01>1_IGHJ5*01 1647 gnl|Fabrus|V1-11_IGLJ2*01 1104
3423 VH3-23_IGHD6-19*01>2_IGHJ5*01 1648 gnl|Fabrus|V1-11_IGLJ2*01 1104
3424 VH3-23_IGHD6-25*01>1_IGHJ5*01 1649 gnl|Fabrus|V1-11_IGLJ2*01 1104
3425 VH3-23_IGHD6-25*01>2_IGHJ5*01 1650 gnl|Fabrus|V1-11_IGLJ2*01 1104
3426 VH3-23_IGHD7-27*01>1_IGHJ5*01 1651 gnl|Fabrus|V1-11_IGLJ2*01 1104
3427 VH3-23_IGHD7-27*01>3_IGHJ5*01 1652 gnl|Fabrus|V1-11_IGLJ2*01 1104
3428 VH3-23_IGHD6-13*01>1′_IGHJ5*01 1701 gnl|Fabrus|V1-11_IGLJ2*01 1104
3429 VH3-23_IGHD6-13*01>2′_IGHJ5*01 1702 gnl|Fabrus|V1-11_IGLJ2*01 1104
3430 VH3-23_IGHD6-13*01>3′_IGHJ5*01 1703 gnl|Fabrus|V1-11_IGLJ2*01 1104
3431 VH3-23_IGHD6-19*01>1′_IGHJ5*01 1704 gnl|Fabrus|V1-11_IGLJ2*01 1104
3432 VH3-23_IGHD6-19*01>2′_IGHJ5*01 1705 gnl|Fabrus|V1-11_IGLJ2*01 1104
3433 VH3-23_IGHD6-19*01>2_IGHJ5*01_B 1706 gnl|Fabrus|V1-11_IGLJ2*01 1104
3434 VH3-23_IGHD6-25*01>1′_IGHJ5*01 1707 gnl|Fabrus|V1-11_IGLJ2*01 1104
3435 VH3-23_IGHD6-25*01>3′_IGHJ5*01 1708 gnl|Fabrus|V1-11_IGLJ2*01 1104
3436 VH3-23_IGHD7-27*01>1′_IGHJ5*01 1709 gnl|Fabrus|V1-11_IGLJ2*01 1104
3437 VH3-23_IGHD7-27*01>2′_IGHJ5*01 1710 gnl|Fabrus|V1-11_IGLJ2*01 1104
3438 VH3-23_IGHD6-6*01>2_IGHJ6*01 1759 gnl|Fabrus|V1-11_IGLJ2*01 1104
3439 VH3-23_IGHD6-6*01>2_IGHJ1*01 1184 gnl|Fabrus|V1-13_IGLJ5*01 1105
3440 VH3-23_IGHD6-13*01>1_IGHJ1*01 1185 gnl|Fabrus|V1-13_IGLJ5*01 1105
3441 VH3-23_IGHD6-13*01>2_IGHJ1*01 1186 gnl|Fabrus|V1-13_IGLJ5*01 1105
3442 VH3-23_IGHD6-19*01>1_IGHJ1*01 1187 gnl|Fabrus|V1-13_IGLJ5*01 1105
3443 VH3-23_IGHD6-19*01>2_IGHJ1*01 1188 gnl|Fabrus|V1-13_IGLJ5*01 1105
3444 VH3-23_IGHD6-25*01>1_IGHJ1*01 1189 gnl|Fabrus|V1-13_IGLJ5*01 1105
3445 VH3-23_IGHD6-25*01>2_IGHJ1*01 1190 gnl|Fabrus|V1-13_IGLJ5*01 1105
3446 VH3-23_IGHD7-27*01>1_IGHJ1*01 1191 gnl|Fabrus|V1-13_IGLJ5*01 1105
3447 VH3-23_IGHD7-27*01>3_IGHJ1*01 1192 gnl|Fabrus|V1-13_IGLJ5*01 1105
3448 VH3-23_IGHD6-13*01>1′_IGHJ1*01 1241 gnl|Fabrus|V1-13_IGLJ5*01 1105
3449 VH3-23_IGHD6-13*01>2′_IGHJ1*01 1242 gnl|Fabrus|V1-13_IGLJ5*01 1105
3450 VH3-23_IGHD6-13*01>2_IGHJ1*01_B 1243 gnl|Fabrus|V1-13_IGLJ5*01 1105
3451 VH3-23_IGHD6-19*01>1′_IGHJ1*01 1244 gnl|Fabrus|V1-13_IGLJ5*01 1105
3452 VH3-23_IGHD6-19*01>2′_IGHJ1*01 1245 gnl|Fabrus|V1-13_IGLJ5*01 1105
3453 VH3-23_IGHD6-19*01>2_IGHJ1*01_B 1246 gnl|Fabrus|V1-13_IGLJ5*01 1105
3454 VH3-23_IGHD6-25*01>1′_IGHJ1*01 1247 gnl|Fabrus|V1-13_IGLJ5*01 1105
3455 VH3-23_IGHD6-25*01>3′_IGHJ1*01 1248 gnl|Fabrus|V1-13_IGLJ5*01 1105
3456 VH3-23_IGHD7-27*01>1′_IGHJ1*01_B 1249 gnl|Fabrus|V1-13_IGLJ5*01 1105
3457 VH3-23_IGHD7-27*01>2′_IGHJ1*01 1250 gnl|Fabrus|V1-13_IGLJ5*01 1105
3458 VH3-23_IGHD6-6*01>2_IGHJ2*01 1299 gnl|Fabrus|V1-13_IGLJ5*01 1105
3459 VH3-23_IGHD6-13*01>1_IGHJ2*01 1300 gnl|Fabrus|V1-13_IGLJ5*01 1105
3460 VH3-23_IGHD6-13*01>2_IGHJ2*01 1301 gnl|Fabrus|V1-13_IGLJ5*01 1105
3461 VH3-23_IGHD6-19*01>1_IGHJ2*01 1302 gnl|Fabrus|V1-13_IGLJ5*01 1105
3462 VH3-23_IGHD6-19*01>2_IGHJ2*01 1303 gnl|Fabrus|V1-13_IGLJ5*01 1105
3463 VH3-23_IGHD6-25*01>1_IGHJ2*01 1304 gnl|Fabrus|V1-13_IGLJ5*01 1105
3464 VH3-23_IGHD6-25*01>2_IGHJ2*01 1305 gnl|Fabrus|V1-13_IGLJ5*01 1105
3465 VH3-23_IGHD7-27*01>1_IGHJ2*01 1306 gnl|Fabrus|V1-13_IGLJ5*01 1105
3466 VH3-23_IGHD7-27*01>3_IGHJ2*01 1307 gnl|Fabrus|V1-13_IGLJ5*01 1105
3467 VH3-23_IGHD6-13*01>1′_IGHJ2*01 1356 gnl|Fabrus|V1-13_IGLJ5*01 1105
3468 VH3-23_IGHD6-13*01>2′_IGHJ2*01 1357 gnl|Fabrus|V1-13_IGLJ5*01 1105
3469 VH3-23_IGHD6-13*01>2_IGHJ2*01_B 1358 gnl|Fabrus|V1-13_IGLJ5*01 1105
3470 VH3-23_IGHD6-19*01>1′_IGHJ2*01 1359 gnl|Fabrus|V1-13_IGLJ5*01 1105
3471 VH3-23_IGHD6-19*01>2′_IGHJ2*01 1360 gnl|Fabrus|V1-13_IGLJ5*01 1105
3472 VH3-23_IGHD6-19*01>2_IGHJ2*01_B 1361 gnl|Fabrus|V1-13_IGLJ5*01 1105
3473 VH3-23_IGHD6-25*01>1′_IGHJ2*01 1362 gnl|Fabrus|V1-13_IGLJ5*01 1105
3474 VH3-23_IGHD6-25*01>3′_IGHJ2*01 1363 gnl|Fabrus|V1-13_IGLJ5*01 1105
3475 VH3-23_IGHD7-27*01>1′_IGHJ2*01 1364 gnl|Fabrus|V1-13_IGLJ5*01 1105
3476 VH3-23_IGHD7-27*01>2′_IGHJ2*01 1365 gnl|Fabrus|V1-13_IGLJ5*01 1105
3477 VH3-23_IGHD6-6*01>2_IGHJ3*01 1414 gnl|Fabrus|V1-13_IGLJ5*01 1105
3478 VH3-23_IGHD6-13*01>1_IGHJ3*01 1415 gnl|Fabrus|V1-13_IGLJ5*01 1105
3479 VH3-23_IGHD6-13*01>2_IGHJ3*01 1416 gnl|Fabrus|V1-13_IGLJ5*01 1105
3480 VH3-23_IGHD6-19*01>1_IGHJ3*01 1417 gnl|Fabrus|V1-13_IGLJ5*01 1105
3481 VH3-23_IGHD6-19*01>2_IGHJ3*01 1418 gnl|Fabrus|V1-13_IGLJ5*01 1105
3482 VH3-23_IGHD6-25*01>1_IGHJ3*01 1419 gnl|Fabrus|V1-13_IGLJ5*01 1105
3483 VH3-23_IGHD6-25*01>2_IGHJ3*01 1420 gnl|Fabrus|V1-13_IGLJ5*01 1105
3484 VH3-23_IGHD7-27*01>1_IGHJ3*01 1421 gnl|Fabrus|V1-13_IGLJ5*01 1105
3485 VH3-23_IGHD7-27*01>3_IGHJ3*01 1422 gnl|Fabrus|V1-13_IGLJ5*01 1105
3486 VH3-23_IGHD6-13*01>1′_IGHJ3*01 1471 gnl|Fabrus|V1-13_IGLJ5*01 1105
3487 VH3-23_IGHD6-13*01>2′_IGHJ3*01 1472 gnl|Fabrus|V1-13_IGLJ5*01 1105
3488 VH3-23_IGHD6-13*01>1_IGHJ6*01 1818 gnl|Fabrus|V1-13_IGLJ5*01 1105
3489 VH3-23_IGHD6-19*01>1′_IGHJ3*01 1474 gnl|Fabrus|V1-13_IGLJ5*01 1105
3490 VH3-23_IGHD6-19*01>2′_IGHJ3*01 1475 gnl|Fabrus|V1-13_IGLJ5*01 1105
3491 VH3-23_IGHD6-19*01>3′_IGHJ3*01 1476 gnl|Fabrus|V1-13_IGLJ5*01 1105
3492 VH3-23_IGHD6-25*01>1′_IGHJ3*01 1477 gnl|Fabrus|V1-13_IGLJ5*01 1105
3493 VH3-23_IGHD6-25*01>3′_IGHJ3*01 1478 gnl|Fabrus|V1-13_IGLJ5*01 1105
3494 VH3-23_IGHD7-27*01>1′_IGHJ3*01 1479 gnl|Fabrus|V1-13_IGLJ5*01 1105
3495 VH3-23_IGHD7-27*01>2′_IGHJ3*01 1480 gnl|Fabrus|V1-13_IGLJ5*01 1105
3496 VH3-23_IGHD6-6*01>2_IGHJ4*01 1529 gnl|Fabrus|V1-13_IGLJ5*01 1105
3497 VH3-23_IGHD6-13*01>1_IGHJ4*01 1530 gnl|Fabrus|V1-13_IGLJ5*01 1105
3498 VH3-23_IGHD6-13*01>2_IGHJ4*01 1531 gnl|Fabrus|V1-13_IGLJ5*01 1105
3499 VH3-23_IGHD6-19*01>1_IGHJ4*01 1532 gnl|Fabrus|V1-13_IGLJ5*01 1105
3500 VH3-23_IGHD6-19*01>2_IGHJ4*01 1533 gnl|Fabrus|V1-13_IGLJ5*01 1105
3501 VH3-23_IGHD6-25*01>1_IGHJ4*01 1534 gnl|Fabrus|V1-13_IGLJ5*01 1105
3502 VH3-23_IGHD6-25*01>2_IGHJ4*01 1535 gnl|Fabrus|V1-13_IGLJ5*01 1105
3503 VH3-23_IGHD7-27*01>1_IGHJ4*01 1536 gnl|Fabrus|V1-13_IGLJ5*01 1105
3504 VH3-23_IGHD7-27*01>3_IGHJ4*01 1537 gnl|Fabrus|V1-13_IGLJ5*01 1105
3505 VH3-23_IGHD6-13*01>1′_IGHJ4*01 1586 gnl|Fabrus|V1-13_IGLJ5*01 1105
3506 VH3-23_IGHD6-13*01>2′_IGHJ4*01 1587 gnl|Fabrus|V1-13_IGLJ5*01 1105
3507 VH3-23_IGHD6-13*01>2_IGHJ4*01_B 1588 gnl|Fabrus|V1-13_IGLJ5*01 1105
3508 VH3-23_IGHD6-19*01>1′_IGHJ4*01 1589 gnl|Fabrus|V1-13_IGLJ5*01 1105
3509 VH3-23_IGHD6-19*01>2′_IGHJ4*01 1590 gnl|Fabrus|V1-13_IGLJ5*01 1105
3510 VH3-23_IGHD6-19*01>2_IGHJ4*01_B 1591 gnl|Fabrus|V1-13_IGLJ5*01 1105
3511 VH3-23_IGHD6-25*01>1′_IGHJ4*01 1592 gnl|Fabrus|V1-13_IGLJ5*01 1105
3512 VH3-23_IGHD6-25*01>3′_IGHJ4*01 1593 gnl|Fabrus|V1-13_IGLJ5*01 1105
3513 VH3-23_IGHD7-27*01>1′_IGHJ4*01 1594 gnl|Fabrus|V1-13_IGLJ5*01 1105
3514 VH3-23_IGHD7-27*01>2′_IGHJ4*01 1595 gnl|Fabrus|V1-13_IGLJ5*01 1105
3515 VH3-23_IGHD6-6*01>2_IGHJ5*01 1644 gnl|Fabrus|V1-13_IGLJ5*01 1105
3516 VH3-23_IGHD6-13*01>1_IGHJ5*01 1645 gnl|Fabrus|V1-13_IGLJ5*01 1105
3517 VH3-23_IGHD6-13*01>2_IGHJ5*01 1646 gnl|Fabrus|V1-13_IGLJ5*01 1105
3518 VH3-23_IGHD6-19*01>1_IGHJ5*01 1647 gnl|Fabrus|V1-13_IGLJ5*01 1105
3519 VH3-23_IGHD6-19*01>2_IGHJ5*01 1648 gnl|Fabrus|V1-13_IGLJ5*01 1105
3520 VH3-23_IGHD6-25*01>1_IGHJ5*01 1649 gnl|Fabrus|V1-13_IGLJ5*01 1105
3521 VH3-23_IGHD6-25*01>2_IGHJ5*01 1650 gnl|Fabrus|V1-13_IGLJ5*01 1105
3522 VH3-23_IGHD7-27*01>1_IGHJ5*01 1651 gnl|Fabrus|V1-13_IGLJ5*01 1105
3523 VH3-23_IGHD7-27*01>3_IGHJ5*01 1652 gnl|Fabrus|V1-13_IGLJ5*01 1105
3524 VH3-23_IGHD6-13*01>1′_IGHJ5*01 1701 gnl|Fabrus|V1-13_IGLJ5*01 1105
3525 VH3-23_IGHD6-13*01>2′_IGHJ5*01 1702 gnl|Fabrus|V1-13_IGLJ5*01 1105
3526 VH3-23_IGHD6-13*01>3′_IGHJ5*01 1703 gnl|Fabrus|V1-13_IGLJ5*01 1105
3527 VH3-23_IGHD6-19*01>1′_IGHJ5*01 1704 gnl|Fabrus|V1-13_IGLJ5*01 1105
3528 VH3-23_IGHD6-19*01>2′_IGHJ5*01 1705 gnl|Fabrus|V1-13_IGLJ5*01 1105
3529 VH3-23_IGHD6-19*01>2_IGHJ5*01_B 1706 gnl|Fabrus|V1-13_IGLJ5*01 1105
3530 VH3-23_IGHD6-25*01>1′_IGHJ5*01 1707 gnl|Fabrus|V1-13_IGLJ5*01 1105
3531 VH3-23_IGHD6-25*01>3′_IGHJ5*01 1708 gnl|Fabrus|V1-13_IGLJ5*01 1105
3532 VH3-23_IGHD7-27*01>1′_IGHJ5*01 1709 gnl|Fabrus|V1-13_IGLJ5*01 1105
3533 VH3-23_IGHD7-27*01>2′_IGHJ5*01 1710 gnl|Fabrus|V1-13_IGLJ5*01 1105
3534 VH3-23_IGHD6-6*01>2_IGHJ6*01 1759 gnl|Fabrus|V1-13_IGLJ5*01 1105
3535 VH3-23_IGHD6-6*01>2_IGHJ1*01 1184 gnl|Fabrus|V1-16_IGLJ6*01 1106
3536 VH3-23_IGHD6-13*01>1_IGHJ1*01 1185 gnl|Fabrus|V1-16_IGLJ6*01 1106
3537 VH3-23_IGHD6-13*01>2_IGHJ1*01 1186 gnl|Fabrus|V1-16_IGLJ6*01 1106
3538 VH3-23_IGHD6-19*01>1_IGHJ1*01 1187 gnl|Fabrus|V1-16_IGLJ6*01 1106
3539 VH3-23_IGHD6-19*01>2_IGHJ1*01 1188 gnl|Fabrus|V1-16_IGLJ6*01 1106
3540 VH3-23_IGHD6-25*01>1_IGHJ1*01 1189 gnl|Fabrus|V1-16_IGLJ6*01 1106
3541 VH3-23_IGHD6-25*01>2_IGHJ1*01 1190 gnl|Fabrus|V1-16_IGLJ6*01 1106
3542 VH3-23_IGHD7-27*01>1_IGHJ1*01 1191 gnl|Fabrus|V1-16_IGLJ6*01 1106
3543 VH3-23_IGHD7-27*01>3_IGHJ1*01 1192 gnl|Fabrus|V1-16_IGLJ6*01 1106
3544 VH3-23_IGHD6-13*01>1′_IGHJ1*01 1241 gnl|Fabrus|V1-16_IGLJ6*01 1106
3545 VH3-23_IGHD6-13*01>2′_IGHJ1*01 1242 gnl|Fabrus|V1-16_IGLJ6*01 1106
3546 VH3-23_IGHD6-13*01>2_IGHJ1*01_B 1243 gnl|Fabrus|V1-16_IGLJ6*01 1106
3547 VH3-23_IGHD6-19*01>1′_IGHJ1*01 1244 gnl|Fabrus|V1-16_IGLJ6*01 1106
3548 VH3-23_IGHD6-19*01>2′_IGHJ1*01 1245 gnl|Fabrus|V1-16_IGLJ6*01 1106
3549 VH3-23_IGHD6-19*01>2_IGHJ1*01_B 1246 gnl|Fabrus|V1-16_IGLJ6*01 1106
3550 VH3-23_IGHD6-25*01>1′_IGHJ1*01 1247 gnl|Fabrus|V1-16_IGLJ6*01 1106
3551 VH3-23_IGHD6-25*01>3′_IGHJ1*01 1248 gnl|Fabrus|V1-16_IGLJ6*01 1106
3552 VH3-23_IGHD7-27*01>1′_IGHJ1*01_B 1249 gnl|Fabrus|V1-16_IGLJ6*01 1106
3553 VH3-23_IGHD7-27*01>2′_IGHJ1*01 1250 gnl|Fabrus|V1-16_IGLJ6*01 1106
3554 VH3-23_IGHD6-6*01>2_IGHJ2*01 1299 gnl|Fabrus|V1-16_IGLJ6*01 1106
3555 VH3-23_IGHD6-13*01>1_IGHJ2*01 1300 gnl|Fabrus|V1-16_IGLJ6*01 1106
3556 VH3-23_IGHD6-13*01>2_IGHJ2*01 1301 gnl|Fabrus|V1-16_IGLJ6*01 1106
3557 VH3-23_IGHD6-19*01>1_IGHJ2*01 1302 gnl|Fabrus|V1-16_IGLJ6*01 1106
3558 VH3-23_IGHD6-19*01>2_IGHJ2*01 1303 gnl|Fabrus|V1-16_IGLJ6*01 1106
3559 VH3-23_IGHD6-25*01>1_IGHJ2*01 1304 gnl|Fabrus|V1-16_IGLJ6*01 1106
3560 VH3-23_IGHD6-25*01>2_IGHJ2*01 1305 gnl|Fabrus|V1-16_IGLJ6*01 1106
3561 VH3-23_IGHD7-27*01>1_IGHJ2*01 1306 gnl|Fabrus|V1-16_IGLJ6*01 1106
3562 VH3-23_IGHD7-27*01>3_IGHJ2*01 1307 gnl|Fabrus|V1-16_IGLJ6*01 1106
3563 VH3-23_IGHD6-13*01>1′_IGHJ2*01 1356 gnl|Fabrus|V1-16_IGLJ6*01 1106
3564 VH3-23_IGHD6-13*01>2′_IGHJ2*01 1357 gnl|Fabrus|V1-16_IGLJ6*01 1106
3565 VH3-23_IGHD6-13*01>2_IGHJ2*01_B 1358 gnl|Fabrus|V1-16_IGLJ6*01 1106
3566 VH3-23_IGHD6-19*01>1′_IGHJ2*01 1359 gnl|Fabrus|V1-16_IGLJ6*01 1106
3567 VH3-23_IGHD6-19*01>2′_IGHJ2*01 1360 gnl|Fabrus|V1-16_IGLJ6*01 1106
3568 VH3-23_IGHD6-19*01>2_IGHJ2*01_B 1361 gnl|Fabrus|V1-16_IGLJ6*01 1106
3569 VH3-23_IGHD6-25*01>1′_IGHJ2*01 1362 gnl|Fabrus|V1-16_IGLJ6*01 1106
3570 VH3-23_IGHD6-25*01>3′_IGHJ2*01 1363 gnl|Fabrus|V1-16_IGLJ6*01 1106
3571 VH3-23_IGHD7-27*01>1′_IGHJ2*01 1364 gnl|Fabrus|V1-16_IGLJ6*01 1106
3572 VH3-23_IGHD7-27*01>2′_IGHJ2*01 1365 gnl|Fabrus|V1-16_IGLJ6*01 1106
3573 VH3-23_IGHD6-6*01>2_IGHJ3*01 1414 gnl|Fabrus|V1-16_IGLJ6*01 1106
3574 VH3-23_IGHD6-13*01>1_IGHJ3*01 1415 gnl|Fabrus|V1-16_IGLJ6*01 1106
3575 VH3-23_IGHD6-13*01>2_IGHJ3*01 1416 gnl|Fabrus|V1-16_IGLJ6*01 1106
3576 VH3-23_IGHD6-19*01>1_IGHJ3*01 1417 gnl|Fabrus|V1-16_IGLJ6*01 1106
3577 VH3-23_IGHD6-19*01>2_IGHJ3*01 1418 gnl|Fabrus|V1-16_IGLJ6*01 1106
3578 VH3-23_IGHD6-25*01>1_IGHJ3*01 1419 gnl|Fabrus|V1-16_IGLJ6*01 1106
3579 VH3-23_IGHD6-25*01>2_IGHJ3*01 1420 gnl|Fabrus|V1-16_IGLJ6*01 1106
3580 VH3-23_IGHD7-27*01>1_IGHJ3*01 1421 gnl|Fabrus|V1-16_IGLJ6*01 1106
3581 VH3-23_IGHD7-27*01>3_IGHJ3*01 1422 gnl|Fabrus|V1-16_IGLJ6*01 1106
3582 VH3-23_IGHD6-13*01>1′_IGHJ3*01 1471 gnl|Fabrus|V1-16_IGLJ6*01 1106
3583 VH3-23_IGHD6-13*01>2′_IGHJ3*01 1472 gnl|Fabrus|V1-16_IGLJ6*01 1106
3584 VH3-23_IGHD6-13*01>1_IGHJ6*01 1818 gnl|Fabrus|V1-16_IGLJ6*01 1106
3585 VH3-23_IGHD6-19*01>1′_IGHJ3*01 1474 gnl|Fabrus|V1-16_IGLJ6*01 1106
3586 VH3-23_IGHD6-19*01>2′_IGHJ3*01 1475 gnl|Fabrus|V1-16_IGLJ6*01 1106
3587 VH3-23_IGHD6-19*01>3′_IGHJ3*01 1476 gnl|Fabrus|V1-16_IGLJ6*01 1106
3588 VH3-23_IGHD6-25*01>1′_IGHJ3*01 1477 gnl|Fabrus|V1-16_IGLJ6*01 1106
3589 VH3-23_IGHD6-25*01>3′_IGHJ3*01 1478 gnl|Fabrus|V1-16_IGLJ6*01 1106
3590 VH3-23_IGHD7-27*01>1′_IGHJ3*01 1479 gnl|Fabrus|V1-16_IGLJ6*01 1106
3591 VH3-23_IGHD7-27*01>2′_IGHJ3*01 1480 gnl|Fabrus|V1-16_IGLJ6*01 1106
3592 VH3-23_IGHD6-6*01>2_IGHJ4*01 1529 gnl|Fabrus|V1-16_IGLJ6*01 1106
3593 VH3-23_IGHD6-13*01>1_IGHJ4*01 1530 gnl|Fabrus|V1-16_IGLJ6*01 1106
3594 VH3-23_IGHD6-13*01>2_IGHJ4*01 1531 gnl|Fabrus|V1-16_IGLJ6*01 1106
3595 VH3-23_IGHD6-19*01>1_IGHJ4*01 1532 gnl|Fabrus|V1-16_IGLJ6*01 1106
3596 VH3-23_IGHD6-19*01>2_IGHJ4*01 1533 gnl|Fabrus|V1-16_IGLJ6*01 1106
3597 VH3-23_IGHD6-25*01>1_IGHJ4*01 1534 gnl|Fabrus|V1-16_IGLJ6*01 1106
3598 VH3-23_IGHD6-25*01>2_IGHJ4*01 1535 gnl|Fabrus|V1-16_IGLJ6*01 1106
3599 VH3-23_IGHD7-27*01>1_IGHJ4*01 1536 gnl|Fabrus|V1-16_IGLJ6*01 1106
3600 VH3-23_IGHD7-27*01>3_IGHJ4*01 1537 gnl|Fabrus|V1-16_IGLJ6*01 1106
3601 VH3-23_IGHD6-13*01>1′_IGHJ4*01 1586 gnl|Fabrus|V1-16_IGLJ6*01 1106
3602 VH3-23_IGHD6-13*01>2′_IGHJ4*01 1587 gnl|Fabrus|V1-16_IGLJ6*01 1106
3603 VH3-23_IGHD6-13*01>2_IGHJ4*01_B 1588 gnl|Fabrus|V1-16_IGLJ6*01 1106
3604 VH3-23_IGHD6-19*01>1′_IGHJ4*01 1589 gnl|Fabrus|V1-16_IGLJ6*01 1106
3605 VH3-23_IGHD6-19*01>2′_IGHJ4*01 1590 gnl|Fabrus|V1-16_IGLJ6*01 1106
3606 VH3-23_IGHD6-19*01>2_IGHJ4*01_B 1591 gnl|Fabrus|V1-16_IGLJ6*01 1106
3607 VH3-23_IGHD6-25*01>1′_IGHJ4*01 1592 gnl|Fabrus|V1-16_IGLJ6*01 1106
3608 VH3-23_IGHD6-25*01>3′_IGHJ4*01 1593 gnl|Fabrus|V1-16_IGLJ6*01 1106
3609 VH3-23_IGHD7-27*01>1′_IGHJ4*01 1594 gnl|Fabrus|V1-16_IGLJ6*01 1106
3610 VH3-23_IGHD7-27*01>2′_IGHJ4*01 1595 gnl|Fabrus|V1-16_IGLJ6*01 1106
3611 VH3-23_IGHD6-6*01>2_IGHJ5*01 1644 gnl|Fabrus|V1-16_IGLJ6*01 1106
3612 VH3-23_IGHD6-13*01>1_IGHJ5*01 1645 gnl|Fabrus|V1-16_IGLJ6*01 1106
3613 VH3-23_IGHD6-13*01>2_IGHJ5*01 1646 gnl|Fabrus|V1-16_IGLJ6*01 1106
3614 VH3-23_IGHD6-19*01>1_IGHJ5*01 1647 gnl|Fabrus|V1-16_IGLJ6*01 1106
3615 VH3-23_IGHD6-19*01>2_IGHJ5*01 1648 gnl|Fabrus|V1-16_IGLJ6*01 1106
3616 VH3-23_IGHD6-25*01>1_IGHJ5*01 1649 gnl|Fabrus|V1-16_IGLJ6*01 1106
3617 VH3-23_IGHD6-25*01>2_IGHJ5*01 1650 gnl|Fabrus|V1-16_IGLJ6*01 1106
3618 VH3-23_IGHD7-27*01>1_IGHJ5*01 1651 gnl|Fabrus|V1-16_IGLJ6*01 1106
3619 VH3-23_IGHD7-27*01>3_IGHJ5*01 1652 gnl|Fabrus|V1-16_IGLJ6*01 1106
3620 VH3-23_IGHD6-13*01>1′_IGHJ5*01 1701 gnl|Fabrus|V1-16_IGLJ6*01 1106
3621 VH3-23_IGHD6-13*01>2′_IGHJ5*01 1702 gnl|Fabrus|V1-16_IGLJ6*01 1106
3622 VH3-23_IGHD6-13*01>3′_IGHJ5*01 1703 gnl|Fabrus|V1-16_IGLJ6*01 1106
3623 VH3-23_IGHD6-19*01>1′_IGHJ5*01 1704 gnl|Fabrus|V1-16_IGLJ6*01 1106
3624 VH3-23_IGHD6-19*01>2′_IGHJ5*01 1705 gnl|Fabrus|V1-16_IGLJ6*01 1106
3625 VH3-23_IGHD6-19*01>2_IGHJ5*01_B 1706 gnl|Fabrus|V1-16_IGLJ6*01 1106
3626 VH3-23_IGHD6-25*01>1′_IGHJ5*01 1707 gnl|Fabrus|V1-16_IGLJ6*01 1106
3627 VH3-23_IGHD6-25*01>3′_IGHJ5*01 1708 gnl|Fabrus|V1-16_IGLJ6*01 1106
3628 VH3-23_IGHD7-27*01>1′_IGHJ5*01 1709 gnl|Fabrus|V1-16_IGLJ6*01 1106
3629 VH3-23_IGHD7-27*01>2′_IGHJ5*01 1710 gnl|Fabrus|V1-16_IGLJ6*01 1106
3630 VH3-23_IGHD6-6*01>2_IGHJ6*01 1759 gnl|Fabrus|V1-16_IGLJ6*01 1106
3631 VH3-23_IGHD6-6*01>2_IGHJ1*01 1184 gnl|Fabrus|V1-2_IGLJ7*01 1108
3632 VH3-23_IGHD6-13*01>1_IGHJ1*01 1185 gnl|Fabrus|V1-2_IGLJ7*01 1108
3633 VH3-23_IGHD6-13*01>2_IGHJ1*01 1186 gnl|Fabrus|V1-2_IGLJ7*01 1108
3634 VH3-23_IGHD6-19*01>1_IGHJ1*01 1187 gnl|Fabrus|V1-2_IGLJ7*01 1108
3635 VH3-23_IGHD6-19*01>2_IGHJ1*01 1188 gnl|Fabrus|V1-2_IGLJ7*01 1108
3636 VH3-23_IGHD6-25*01>1_IGHJ1*01 1189 gnl|Fabrus|V1-2_IGLJ7*01 1108
3637 VH3-23_IGHD6-25*01>2_IGHJ1*01 1190 gnl|Fabrus|V1-2_IGLJ7*01 1108
3638 VH3-23_IGHD7-27*01>1_IGHJ1*01 1191 gnl|Fabrus|V1-2_IGLJ7*01 1108
3639 VH3-23_IGHD7-27*01>3_IGHJ1*01 1192 gnl|Fabrus|V1-2_IGLJ7*01 1108
3640 VH3-23_IGHD6-13*01>1′_IGHJ1*01 1241 gnl|Fabrus|V1-2_IGLJ7*01 1108
3641 VH3-23_IGHD6-13*01>2′_IGHJ1*01 1242 gnl|Fabrus|V1-2_IGLJ7*01 1108
3642 VH3-23_IGHD6-13*01>2_IGHJ1*01_B 1243 gnl|Fabrus|V1-2_IGLJ7*01 1108
3643 VH3-23_IGHD6-19*01>1′_IGHJ1*01 1244 gnl|Fabrus|V1-2_IGLJ7*01 1108
3644 VH3-23_IGHD6-19*01>2′_IGHJ1*01 1245 gnl|Fabrus|V1-2_IGLJ7*01 1108
3645 VH3-23_IGHD6-19*01>2_IGHJ1*01_B 1246 gnl|Fabrus|V1-2_IGLJ7*01 1108
3646 VH3-23_IGHD6-25*01>1′_IGHJ1*01 1247 gnl|Fabrus|V1-2_IGLJ7*01 1108
3647 VH3-23_IGHD6-25*01>3′_IGHJ1*01 1248 gnl|Fabrus|V1-2_IGLJ7*01 1108
3648 VH3-23_IGHD7-27*01>1′_IGHJ1*01_B 1249 gnl|Fabrus|V1-2_IGLJ7*01 1108
3649 VH3-23_IGHD7-27*01>2′_IGHJ1*01 1250 gnl|Fabrus|V1-2_IGLJ7*01 1108
3650 VH3-23_IGHD6-6*01>2_IGHJ2*01 1299 gnl|Fabrus|V1-2_IGLJ7*01 1108
3651 VH3-23_IGHD6-13*01>1_IGHJ2*01 1300 gnl|Fabrus|V1-2_IGLJ7*01 1108
3652 VH3-23_IGHD6-13*01>2_IGHJ2*01 1301 gnl|Fabrus|V1-2_IGLJ7*01 1108
3653 VH3-23_IGHD6-19*01>1_IGHJ2*01 1302 gnl|Fabrus|V1-2_IGLJ7*01 1108
3654 VH3-23_IGHD6-19*01>2_IGHJ2*01 1303 gnl|Fabrus|V1-2_IGLJ7*01 1108
3655 VH3-23_IGHD6-25*01>1_IGHJ2*01 1304 gnl|Fabrus|V1-2_IGLJ7*01 1108
3656 VH3-23_IGHD6-25*01>2_IGHJ2*01 1305 gnl|Fabrus|V1-2_IGLJ7*01 1108
3657 VH3-23_IGHD7-27*01>1_IGHJ2*01 1306 gnl|Fabrus|V1-2_IGLJ7*01 1108
3658 VH3-23_IGHD7-27*01>3_IGHJ2*01 1307 gnl|Fabrus|V1-2_IGLJ7*01 1108
3659 VH3-23_IGHD6-13*01>1′_IGHJ2*01 1356 gnl|Fabrus|V1-2_IGLJ7*01 1108
3660 VH3-23_IGHD6-13*01>2′_IGHJ2*01 1357 gnl|Fabrus|V1-2_IGLJ7*01 1108
3661 VH3-23_IGHD6-13*01>2_IGHJ2*01_B 1358 gnl|Fabrus|V1-2_IGLJ7*01 1108
3662 VH3-23_IGHD6-19*01>1′_IGHJ2*01 1359 gnl|Fabrus|V1-2_IGLJ7*01 1108
3663 VH3-23_IGHD6-19*01>2′_IGHJ2*01 1360 gnl|Fabrus|V1-2_IGLJ7*01 1108
3664 VH3-23_IGHD6-19*01>2_IGHJ2*01_B 1361 gnl|Fabrus|V1-2_IGLJ7*01 1108
3665 VH3-23_IGHD6-25*01>1′_IGHJ2*01 1362 gnl|Fabrus|V1-2_IGLJ7*01 1108
3666 VH3-23_IGHD6-25*01>3′_IGHJ2*01 1363 gnl|Fabrus|V1-2_IGLJ7*01 1108
3667 VH3-23_IGHD7-27*01>1′_IGHJ2*01 1364 gnl|Fabrus|V1-2_IGLJ7*01 1108
3668 VH3-23_IGHD7-27*01>2′_IGHJ2*01 1365 gnl|Fabrus|V1-2_IGLJ7*01 1108
3669 VH3-23_IGHD6-6*01>2_IGHJ3*01 1414 gnl|Fabrus|V1-2_IGLJ7*01 1108
3670 VH3-23_IGHD6-13*01>1_IGHJ3*01 1415 gnl|Fabrus|V1-2_IGLJ7*01 1108
3671 VH3-23_IGHD6-13*01>2_IGHJ3*01 1416 gnl|Fabrus|V1-2_IGLJ7*01 1108
3672 VH3-23_IGHD6-19*01>1_IGHJ3*01 1417 gnl|Fabrus|V1-2_IGLJ7*01 1108
3673 VH3-23_IGHD6-19*01>2_IGHJ3*01 1418 gnl|Fabrus|V1-2_IGLJ7*01 1108
3674 VH3-23_IGHD6-25*01>1_IGHJ3*01 1419 gnl|Fabrus|V1-2_IGLJ7*01 1108
3675 VH3-23_IGHD6-25*01>2_IGHJ3*01 1420 gnl|Fabrus|V1-2_IGLJ7*01 1108
3676 VH3-23_IGHD7-27*01>1_IGHJ3*01 1421 gnl|Fabrus|V1-2_IGLJ7*01 1108
3677 VH3-23_IGHD7-27*01>3_IGHJ3*01 1422 gnl|Fabrus|V1-2_IGLJ7*01 1108
3678 VH3-23_IGHD6-13*01>1′_IGHJ3*01 1471 gnl|Fabrus|V1-2_IGLJ7*01 1108
3679 VH3-23_IGHD6-13*01>2′_IGHJ3*01 1472 gnl|Fabrus|V1-2_IGLJ7*01 1108
3680 VH3-23_IGHD6-13*01>1_IGHJ6*01 1818 gnl|Fabrus|V1-2_IGLJ7*01 1108
3681 VH3-23_IGHD6-19*01>1′_IGHJ3*01 1474 gnl|Fabrus|V1-2_IGLJ7*01 1108
3682 VH3-23_IGHD6-19*01>2′_IGHJ3*01 1475 gnl|Fabrus|V1-2_IGLJ7*01 1108
3683 VH3-23_IGHD6-19*01>3′_IGHJ3*01 1476 gnl|Fabrus|V1-2_IGLJ7*01 1108
3684 VH3-23_IGHD6-25*01>1′_IGHJ3*01 1477 gnl|Fabrus|V1-2_IGLJ7*01 1108
3685 VH3-23_IGHD6-25*01>3′_IGHJ3*01 1478 gnl|Fabrus|V1-2_IGLJ7*01 1108
3686 VH3-23_IGHD7-27*01>1′_IGHJ3*01 1479 gnl|Fabrus|V1-2_IGLJ7*01 1108
3687 VH3-23_IGHD7-27*01>2′_IGHJ3*01 1480 gnl|Fabrus|V1-2_IGLJ7*01 1108
3688 VH3-23_IGHD6-6*01>2_IGHJ4*01 1529 gnl|Fabrus|V1-2_IGLJ7*01 1108
3689 VH3-23_IGHD6-13*01>1_IGHJ4*01 1530 gnl|Fabrus|V1-2_IGLJ7*01 1108
3690 VH3-23_IGHD6-13*01>2_IGHJ4*01 1531 gnl|Fabrus|V1-2_IGLJ7*01 1108
3691 VH3-23_IGHD6-19*01>1_IGHJ4*01 1532 gnl|Fabrus|V1-2_IGLJ7*01 1108
3692 VH3-23_IGHD6-19*01>2_IGHJ4*01 1533 gnl|Fabrus|V1-2_IGLJ7*01 1108
3693 VH3-23_IGHD6-25*01>1_IGHJ4*01 1534 gnl|Fabrus|V1-2_IGLJ7*01 1108
3694 VH3-23_IGHD6-25*01>2_IGHJ4*01 1535 gnl|Fabrus|V1-2_IGLJ7*01 1108
3695 VH3-23_IGHD7-27*01>1_IGHJ4*01 1536 gnl|Fabrus|V1-2_IGLJ7*01 1108
3696 VH3-23_IGHD7-27*01>3_IGHJ4*01 1537 gnl|Fabrus|V1-2_IGLJ7*01 1108
3697 VH3-23_IGHD6-13*01>1′_IGHJ4*01 1586 gnl|Fabrus|V1-2_IGLJ7*01 1108
3698 VH3-23_IGHD6-13*01>2′_IGHJ4*01 1587 gnl|Fabrus|V1-2_IGLJ7*01 1108
3699 VH3-23_IGHD6-13*01>2_IGHJ4*01_B 1588 gnl|Fabrus|V1-2_IGLJ7*01 1108
3700 VH3-23_IGHD6-19*01>1′_IGHJ4*01 1589 gnl|Fabrus|V1-2_IGLJ7*01 1108
3701 VH3-23_IGHD6-19*01>2′_IGHJ4*01 1590 gnl|Fabrus|V1-2_IGLJ7*01 1108
3702 VH3-23_IGHD6-19*01>2_IGHJ4*01_B 1591 gnl|Fabrus|V1-2_IGLJ7*01 1108
3703 VH3-23_IGHD6-25*01>1′_IGHJ4*01 1592 gnl|Fabrus|V1-2_IGLJ7*01 1108
3704 VH3-23_IGHD6-25*01>3′_IGHJ4*01 1593 gnl|Fabrus|V1-2_IGLJ7*01 1108
3705 VH3-23_IGHD7-27*01>1′_IGHJ4*01 1594 gnl|Fabrus|V1-2_IGLJ7*01 1108
3706 VH3-23_IGHD7-27*01>2′_IGHJ4*01 1595 gnl|Fabrus|V1-2_IGLJ7*01 1108
3707 VH3-23_IGHD6-6*01>2_IGHJ5*01 1644 gnl|Fabrus|V1-2_IGLJ7*01 1108
3708 VH3-23_IGHD6-13*01>1_IGHJ5*01 1645 gnl|Fabrus|V1-2_IGLJ7*01 1108
3709 VH3-23_IGHD6-13*01>2_IGHJ5*01 1646 gnl|Fabrus|V1-2_IGLJ7*01 1108
3710 VH3-23_IGHD6-19*01>1_IGHJ5*01 1647 gnl|Fabrus|V1-2_IGLJ7*01 1108
3711 VH3-23_IGHD6-19*01>2_IGHJ5*01 1648 gnl|Fabrus|V1-2_IGLJ7*01 1108
3712 VH3-23_IGHD6-25*01>1_IGHJ5*01 1649 gnl|Fabrus|V1-2_IGLJ7*01 1108
3713 VH3-23_IGHD6-25*01>2_IGHJ5*01 1650 gnl|Fabrus|V1-2_IGLJ7*01 1108
3714 VH3-23_IGHD7-27*01>1_IGHJ5*01 1651 gnl|Fabrus|V1-2_IGLJ7*01 1108
3715 VH3-23_IGHD7-27*01>3_IGHJ5*01 1652 gnl|Fabrus|V1-2_IGLJ7*01 1108
3716 VH3-23_IGHD6-13*01>1′_IGHJ5*01 1701 gnl|Fabrus|V1-2_IGLJ7*01 1108
3717 VH3-23_IGHD6-13*01>2′_IGHJ5*01 1702 gnl|Fabrus|V1-2_IGLJ7*01 1108
3718 VH3-23_IGHD6-13*01>3′_IGHJ5*01 1703 gnl|Fabrus|V1-2_IGLJ7*01 1108
3719 VH3-23_IGHD6-19*01>1′_IGHJ5*01 1704 gnl|Fabrus|V1-2_IGLJ7*01 1108
3720 VH3-23_IGHD6-19*01>2′_IGHJ5*01 1705 gnl|Fabrus|V1-2_IGLJ7*01 1108
3721 VH3-23_IGHD6-19*01>2_IGHJ5*01_B 1706 gnl|Fabrus|V1-2_IGLJ7*01 1108
3722 VH3-23_IGHD6-25*01>1′_IGHJ5*01 1707 gnl|Fabrus|V1-2_IGLJ7*01 1108
3723 VH3-23_IGHD6-25*01>3′_IGHJ5*01 1708 gnl|Fabrus|V1-2_IGLJ7*01 1108
3724 VH3-23_IGHD7-27*01>1′_IGHJ5*01 1709 gnl|Fabrus|V1-2_IGLJ7*01 1108
3725 VH3-23_IGHD7-27*01>2′_IGHJ5*01 1710 gnl|Fabrus|V1-2_IGLJ7*01 1108
3726 VH3-23_IGHD6-6*01>2_IGHJ6*01 1759 gnl|Fabrus|V1-2_IGLJ7*01 1108
3727 VH3-23_IGHD6-6*01>2_IGHJ1*01 1184 gnl|Fabrus|V1-20_IGLJ6*01 1109
3728 VH3-23_IGHD6-13*01>1_IGHJ1*01 1185 gnl|Fabrus|V1-20_IGLJ6*01 1109
3729 VH3-23_IGHD6-13*01>2_IGHJ1*01 1186 gnl|Fabrus|V1-20_IGLJ6*01 1109
3730 VH3-23_IGHD6-19*01>1_IGHJ1*01 1187 gnl|Fabrus|V1-20_IGLJ6*01 1109
3731 VH3-23_IGHD6-19*01>2_IGHJ1*01 1188 gnl|Fabrus|V1-20_IGLJ6*01 1109
3732 VH3-23_IGHD6-25*01>1_IGHJ1*01 1189 gnl|Fabrus|V1-20_IGLJ6*01 1109
3733 VH3-23_IGHD6-25*01>2_IGHJ1*01 1190 gnl|Fabrus|V1-20_IGLJ6*01 1109
3734 VH3-23_IGHD7-27*01>1_IGHJ1*01 1191 gnl|Fabrus|V1-20_IGLJ6*01 1109
3735 VH3-23_IGHD7-27*01>3_IGHJ1*01 1192 gnl|Fabrus|V1-20_IGLJ6*01 1109
3736 VH3-23_IGHD6-13*01>1′_IGHJ1*01 1241 gnl|Fabrus|V1-20_IGLJ6*01 1109
3737 VH3-23_IGHD6-13*01>2′_IGHJ1*01 1242 gnl|Fabrus|V1-20_IGLJ6*01 1109
3738 VH3-23_IGHD6-13*01>2_IGHJ1*01_B 1243 gnl|Fabrus|V1-20_IGLJ6*01 1109
3739 VH3-23_IGHD6-19*01>1′_IGHJ1*01 1244 gnl|Fabrus|V1-20_IGLJ6*01 1109
3740 VH3-23_IGHD6-19*01>2′_IGHJ1*01 1245 gnl|Fabrus|V1-20_IGLJ6*01 1109
3741 VH3-23_IGHD6-19*01>2_IGHJ1*01_B 1246 gnl|Fabrus|V1-20_IGLJ6*01 1109
3742 VH3-23_IGHD6-25*01>1′_IGHJ1*01 1247 gnl|Fabrus|V1-20_IGLJ6*01 1109
3743 VH3-23_IGHD6-25*01>3′_IGHJ1*01 1248 gnl|Fabrus|V1-20_IGLJ6*01 1109
3744 VH3-23_IGHD7-27*01>1′_IGHJ1*01_B 1249 gnl|Fabrus|V1-20_IGLJ6*01 1109
3745 VH3-23_IGHD7-27*01>2′_IGHJ1*01 1250 gnl|Fabrus|V1-20_IGLJ6*01 1109
3746 VH3-23_IGHD6-6*01>2_IGHJ2*01 1299 gnl|Fabrus|V1-20_IGLJ6*01 1109
3747 VH3-23_IGHD6-13*01>1_IGHJ2*01 1300 gnl|Fabrus|V1-20_IGLJ6*01 1109
3748 VH3-23_IGHD6-13*01>2_IGHJ2*01 1301 gnl|Fabrus|V1-20_IGLJ6*01 1109
3749 VH3-23_IGHD6-19*01>1_IGHJ2*01 1302 gnl|Fabrus|V1-20_IGLJ6*01 1109
3750 VH3-23_IGHD6-19*01>2_IGHJ2*01 1303 gnl|Fabrus|V1-20_IGLJ6*01 1109
3751 VH3-23_IGHD6-25*01>1_IGHJ2*01 1304 gnl|Fabrus|V1-20_IGLJ6*01 1109
3752 VH3-23_IGHD6-25*01>2_IGHJ2*01 1305 gnl|Fabrus|V1-20_IGLJ6*01 1109
3753 VH3-23_IGHD7-27*01>1_IGHJ2*01 1306 gnl|Fabrus|V1-20_IGLJ6*01 1109
3754 VH3-23_IGHD7-27*01>3_IGHJ2*01 1307 gnl|Fabrus|V1-20_IGLJ6*01 1109
3755 VH3-23_IGHD6-13*01>1′_IGHJ2*01 1356 gnl|Fabrus|V1-20_IGLJ6*01 1109
3756 VH3-23_IGHD6-13*01>2′_IGHJ2*01 1357 gnl|Fabrus|V1-20_IGLJ6*01 1109
3757 VH3-23_IGHD6-13*01>2_IGHJ2*01_B 1358 gnl|Fabrus|V1-20_IGLJ6*01 1109
3758 VH3-23_IGHD6-19*01>1′_IGHJ2*01 1359 gnl|Fabrus|V1-20_IGLJ6*01 1109
3759 VH3-23_IGHD6-19*01>2′_IGHJ2*01 1360 gnl|Fabrus|V1-20_IGLJ6*01 1109
3760 VH3-23_IGHD6-19*01>2_IGHJ2*01_B 1361 gnl|Fabrus|V1-20_IGLJ6*01 1109
3761 VH3-23_IGHD6-25*01>1′_IGHJ2*01 1362 gnl|Fabrus|V1-20_IGLJ6*01 1109
3762 VH3-23_IGHD6-25*01>3′_IGHJ2*01 1363 gnl|Fabrus|V1-20_IGLJ6*01 1109
3763 VH3-23_IGHD7-27*01>1′_IGHJ2*01 1364 gnl|Fabrus|V1-20_IGLJ6*01 1109
3764 VH3-23_IGHD7-27*01>2′_IGHJ2*01 1365 gnl|Fabrus|V1-20_IGLJ6*01 1109
3765 VH3-23_IGHD6-6*01>2_IGHJ3*01 1414 gnl|Fabrus|V1-20_IGLJ6*01 1109
3766 VH3-23_IGHD6-13*01>1_IGHJ3*01 1415 gnl|Fabrus|V1-20_IGLJ6*01 1109
3767 VH3-23_IGHD6-13*01>2_IGHJ3*01 1416 gnl|Fabrus|V1-20_IGLJ6*01 1109
3768 VH3-23_IGHD6-19*01>1_IGHJ3*01 1417 gnl|Fabrus|V1-20_IGLJ6*01 1109
3769 VH3-23_IGHD6-19*01>2_IGHJ3*01 1418 gnl|Fabrus|V1-20_IGLJ6*01 1109
3770 VH3-23_IGHD6-25*01>1_IGHJ3*01 1419 gnl|Fabrus|V1-20_IGLJ6*01 1109
3771 VH3-23_IGHD6-25*01>2_IGHJ3*01 1420 gnl|Fabrus|V1-20_IGLJ6*01 1109
3772 VH3-23_IGHD7-27*01>1_IGHJ3*01 1421 gnl|Fabrus|V1-20_IGLJ6*01 1109
3773 VH3-23_IGHD7-27*01>3_IGHJ3*01 1422 gnl|Fabrus|V1-20_IGLJ6*01 1109
3774 VH3-23_IGHD6-13*01>1′_IGHJ3*01 1471 gnl|Fabrus|V1-20_IGLJ6*01 1109
3775 VH3-23_IGHD6-13*01>2′_IGHJ3*01 1472 gnl|Fabrus|V1-20_IGLJ6*01 1109
3776 VH3-23_IGHD6-13*01>1_IGHJ6*01 1818 gnl|Fabrus|V1-20_IGLJ6*01 1109
3777 VH3-23_IGHD6-19*01>1′_IGHJ3*01 1474 gnl|Fabrus|V1-20_IGLJ6*01 1109
3778 VH3-23_IGHD6-19*01>2′_IGHJ3*01 1475 gnl|Fabrus|V1-20_IGLJ6*01 1109
3779 VH3-23_IGHD6-19*01>3′_IGHJ3*01 1476 gnl|Fabrus|V1-20_IGLJ6*01 1109
3780 VH3-23_IGHD6-25*01>1′_IGHJ3*01 1477 gnl|Fabrus|V1-20_IGLJ6*01 1109
3781 VH3-23_IGHD6-25*01>3′_IGHJ3*01 1478 gnl|Fabrus|V1-20_IGLJ6*01 1109
3782 VH3-23_IGHD7-27*01>1′_IGHJ3*01 1479 gnl|Fabrus|V1-20_IGLJ6*01 1109
3783 VH3-23_IGHD7-27*01>2′_IGHJ3*01 1480 gnl|Fabrus|V1-20_IGLJ6*01 1109
3784 VH3-23_IGHD6-6*01>2_IGHJ4*01 1529 gnl|Fabrus|V1-20_IGLJ6*01 1109
3785 VH3-23_IGHD6-13*01>1_IGHJ4*01 1530 gnl|Fabrus|V1-20_IGLJ6*01 1109
3786 VH3-23_IGHD6-13*01>2_IGHJ4*01 1531 gnl|Fabrus|V1-20_IGLJ6*01 1109
3787 VH3-23_IGHD6-19*01>1_IGHJ4*01 1532 gnl|Fabrus|V1-20_IGLJ6*01 1109
3788 VH3-23_IGHD6-19*01>2_IGHJ4*01 1533 gnl|Fabrus|V1-20_IGLJ6*01 1109
3789 VH3-23_IGHD6-25*01>1_IGHJ4*01 1534 gnl|Fabrus|V1-20_IGLJ6*01 1109
3790 VH3-23_IGHD6-25*01>2_IGHJ4*01 1535 gnl|Fabrus|V1-20_IGLJ6*01 1109
3791 VH3-23_IGHD7-27*01>1_IGHJ4*01 1536 gnl|Fabrus|V1-20_IGLJ6*01 1109
3792 VH3-23_IGHD7-27*01>3_IGHJ4*01 1537 gnl|Fabrus|V1-20_IGLJ6*01 1109
3793 VH3-23_IGHD6-13*01>1′_IGHJ4*01 1586 gnl|Fabrus|V1-20_IGLJ6*01 1109
3794 VH3-23_IGHD6-13*01>2′_IGHJ4*01 1587 gnl|Fabrus|V1-20_IGLJ6*01 1109
3795 VH3-23_IGHD6-13*01>2_IGHJ4*01_B 1588 gnl|Fabrus|V1-20_IGLJ6*01 1109
3796 VH3-23_IGHD6-19*01>1′_IGHJ4*01 1589 gnl|Fabrus|V1-20_IGLJ6*01 1109
3797 VH3-23_IGHD6-19*01>2′_IGHJ4*01 1590 gnl|Fabrus|V1-20_IGLJ6*01 1109
3798 VH3-23_IGHD6-19*01>2_IGHJ4*01_B 1591 gnl|Fabrus|V1-20_IGLJ6*01 1109
3799 VH3-23_IGHD6-25*01>1′_IGHJ4*01 1592 gnl|Fabrus|V1-20_IGLJ6*01 1109
3800 VH3-23_IGHD6-25*01>3′_IGHJ4*01 1593 gnl|Fabrus|V1-20_IGLJ6*01 1109
3801 VH3-23_IGHD7-27*01>1′_IGHJ4*01 1594 gnl|Fabrus|V1-20_IGLJ6*01 1109
3802 VH3-23_IGHD7-27*01>2′_IGHJ4*01 1595 gnl|Fabrus|V1-20_IGLJ6*01 1109
3803 VH3-23_IGHD6-6*01>2_IGHJ5*01 1644 gnl|Fabrus|V1-20_IGLJ6*01 1109
3804 VH3-23_IGHD6-13*01>1_IGHJ5*01 1645 gnl|Fabrus|V1-20_IGLJ6*01 1109
3805 VH3-23_IGHD6-13*01>2_IGHJ5*01 1646 gnl|Fabrus|V1-20_IGLJ6*01 1109
3806 VH3-23_IGHD6-19*01>1_IGHJ5*01 1647 gnl|Fabrus|V1-20_IGLJ6*01 1109
3807 VH3-23_IGHD6-19*01>2_IGHJ5*01 1648 gnl|Fabrus|V1-20_IGLJ6*01 1109
3808 VH3-23_IGHD6-25*01>1_IGHJ5*01 1649 gnl|Fabrus|V1-20_IGLJ6*01 1109
3809 VH3-23_IGHD6-25*01>2_IGHJ5*01 1650 gnl|Fabrus|V1-20_IGLJ6*01 1109
3810 VH3-23_IGHD7-27*01>1_IGHJ5*01 1651 gnl|Fabrus|V1-20_IGLJ6*01 1109
3811 VH3-23_IGHD7-27*01>3_IGHJ5*01 1652 gnl|Fabrus|V1-20_IGLJ6*01 1109
3812 VH3-23_IGHD6-13*01>1′_IGHJ5*01 1701 gnl|Fabrus|V1-20_IGLJ6*01 1109
3813 VH3-23_IGHD6-13*01>2′_IGHJ5*01 1702 gnl|Fabrus|V1-20_IGLJ6*01 1109
3814 VH3-23_IGHD6-13*01>3′_IGHJ5*01 1703 gnl|Fabrus|V1-20_IGLJ6*01 1109
3815 VH3-23_IGHD6-19*01>1′_IGHJ5*01 1704 gnl|Fabrus|V1-20_IGLJ6*01 1109
3816 VH3-23_IGHD6-19*01>2′_IGHJ5*01 1705 gnl|Fabrus|V1-20_IGLJ6*01 1109
3817 VH3-23_IGHD6-19*01>2_IGHJ5*01_B 1706 gnl|Fabrus|V1-20_IGLJ6*01 1109
3818 VH3-23_IGHD6-25*01>1′_IGHJ5*01 1707 gnl|Fabrus|V1-20_IGLJ6*01 1109
3819 VH3-23_IGHD6-25*01>3′_IGHJ5*01 1708 gnl|Fabrus|V1-20_IGLJ6*01 1109
3820 VH3-23_IGHD7-27*01>1′_IGHJ5*01 1709 gnl|Fabrus|V1-20_IGLJ6*01 1109
3821 VH3-23_IGHD7-27*01>2′_IGHJ5*01 1710 gnl|Fabrus|V1-20_IGLJ6*01 1109
3822 VH3-23_IGHD6-6*01>2_IGHJ6*01 1759 gnl|Fabrus|V1-20_IGLJ6*01 1109
3823 VH3-23_IGHD6-6*01>2_IGHJ1*01 1184 gnl|Fabrus|V1-3_IGLJ1*01 1110
3824 VH3-23_IGHD6-13*01>1_IGHJ1*01 1185 gnl|Fabrus|V1-3_IGLJ1*01 1110
3825 VH3-23_IGHD6-13*01>2_IGHJ1*01 1186 gnl|Fabrus|V1-3_IGLJ1*01 1110
3826 VH3-23_IGHD6-19*01>1_IGHJ1*01 1187 gnl|Fabrus|V1-3_IGLJ1*01 1110
3827 VH3-23_IGHD6-19*01>2_IGHJ1*01 1188 gnl|Fabrus|V1-3_IGLJ1*01 1110
3828 VH3-23_IGHD6-25*01>1_IGHJ1*01 1189 gnl|Fabrus|V1-3_IGLJ1*01 1110
3829 VH3-23_IGHD6-25*01>2_IGHJ1*01 1190 gnl|Fabrus|V1-3_IGLJ1*01 1110
3830 VH3-23_IGHD7-27*01>1_IGHJ1*01 1191 gnl|Fabrus|V1-3_IGLJ1*01 1110
3831 VH3-23_IGHD7-27*01>3_IGHJ1*01 1192 gnl|Fabrus|V1-3_IGLJ1*01 1110
3832 VH3-23_IGHD6-13*01>1′_IGHJ1*01 1241 gnl|Fabrus|V1-3_IGLJ1*01 1110
3833 VH3-23_IGHD6-13*01>2′_IGHJ1*01 1242 gnl|Fabrus|V1-3_IGLJ1*01 1110
3834 VH3-23_IGHD6-13*01>2_IGHJ1*01_B 1243 gnl|Fabrus|V1-3_IGLJ1*01 1110
3835 VH3-23_IGHD6-19*01>1′_IGHJ1*01 1244 gnl|Fabrus|V1-3_IGLJ1*01 1110
3836 VH3-23_IGHD6-19*01>2′_IGHJ1*01 1245 gnl|Fabrus|V1-3_IGLJ1*01 1110
3837 VH3-23_IGHD6-19*01>2_IGHJ1*01_B 1246 gnl|Fabrus|V1-3_IGLJ1*01 1110
3838 VH3-23_IGHD6-25*01>1′_IGHJ1*01 1247 gnl|Fabrus|V1-3_IGLJ1*01 1110
3839 VH3-23_IGHD6-25*01>3′_IGHJ1*01 1248 gnl|Fabrus|V1-3_IGLJ1*01 1110
3840 VH3-23_IGHD7-27*01>1′_IGHJ1*01_B 1249 gnl|Fabrus|V1-3_IGLJ1*01 1110
3841 VH3-23_IGHD7-27*01>2′_IGHJ1*01 1250 gnl|Fabrus|V1-3_IGLJ1*01 1110
3842 VH3-23_IGHD6-6*01>2_IGHJ2*01 1299 gnl|Fabrus|V1-3_IGLJ1*01 1110
3843 VH3-23_IGHD6-13*01>1_IGHJ2*01 1300 gnl|Fabrus|V1-3_IGLJ1*01 1110
3844 VH3-23_IGHD6-13*01>2_IGHJ2*01 1301 gnl|Fabrus|V1-3_IGLJ1*01 1110
3845 VH3-23_IGHD6-19*01>1_IGHJ2*01 1302 gnl|Fabrus|V1-3_IGLJ1*01 1110
3846 VH3-23_IGHD6-19*01>2_IGHJ2*01 1303 gnl|Fabrus|V1-3_IGLJ1*01 1110
3847 VH3-23_IGHD6-25*01>1_IGHJ2*01 1304 gnl|Fabrus|V1-3_IGLJ1*01 1110
3848 VH3-23_IGHD6-25*01>2_IGHJ2*01 1305 gnl|Fabrus|V1-3_IGLJ1*01 1110
3849 VH3-23_IGHD7-27*01>1_IGHJ2*01 1306 gnl|Fabrus|V1-3_IGLJ1*01 1110
3850 VH3-23_IGHD7-27*01>3_IGHJ2*01 1307 gnl|Fabrus|V1-3_IGLJ1*01 1110
3851 VH3-23_IGHD6-13*01>1′_IGHJ2*01 1356 gnl|Fabrus|V1-3_IGLJ1*01 1110
3852 VH3-23_IGHD6-13*01>2′_IGHJ2*01 1357 gnl|Fabrus|V1-3_IGLJ1*01 1110
3853 VH3-23_IGHD6-13*01>2_IGHJ2*01_B 1358 gnl|Fabrus|V1-3_IGLJ1*01 1110
3854 VH3-23_IGHD6-19*01>1′_IGHJ2*01 1359 gnl|Fabrus|V1-3_IGLJ1*01 1110
3855 VH3-23_IGHD6-19*01>2′_IGHJ2*01 1360 gnl|Fabrus|V1-3_IGLJ1*01 1110
3856 VH3-23_IGHD6-19*01>2_IGHJ2*01_B 1361 gnl|Fabrus|V1-3_IGLJ1*01 1110
3857 VH3-23_IGHD6-25*01>1′_IGHJ2*01 1362 gnl|Fabrus|V1-3_IGLJ1*01 1110
3858 VH3-23_IGHD6-25*01>3′_IGHJ2*01 1363 gnl|Fabrus|V1-3_IGLJ1*01 1110
3859 VH3-23_IGHD7-27*01>1′_IGHJ2*01 1364 gnl|Fabrus|V1-3_IGLJ1*01 1110
3860 VH3-23_IGHD7-27*01>2′_IGHJ2*01 1365 gnl|Fabrus|V1-3_IGLJ1*01 1110
3861 VH3-23_IGHD6-6*01>2_IGHJ3*01 1414 gnl|Fabrus|V1-3_IGLJ1*01 1110
3862 VH3-23_IGHD6-13*01>1_IGHJ3*01 1415 gnl|Fabrus|V1-3_IGLJ1*01 1110
3863 VH3-23_IGHD6-13*01>2_IGHJ3*01 1416 gnl|Fabrus|V1-3_IGLJ1*01 1110
3864 VH3-23_IGHD6-19*01>1_IGHJ3*01 1417 gnl|Fabrus|V1-3_IGLJ1*01 1110
3865 VH3-23_IGHD6-19*01>2_IGHJ3*01 1418 gnl|Fabrus|V1-3_IGLJ1*01 1110
3866 VH3-23_IGHD6-25*01>1_IGHJ3*01 1419 gnl|Fabrus|V1-3_IGLJ1*01 1110
3867 VH3-23_IGHD6-25*01>2_IGHJ3*01 1420 gnl|Fabrus|V1-3_IGLJ1*01 1110
3868 VH3-23_IGHD7-27*01>1_IGHJ3*01 1421 gnl|Fabrus|V1-3_IGLJ1*01 1110
3869 VH3-23_IGHD7-27*01>3_IGHJ3*01 1422 gnl|Fabrus|V1-3_IGLJ1*01 1110
3870 VH3-23_IGHD6-13*01>1′_IGHJ3*01 1471 gnl|Fabrus|V1-3_IGLJ1*01 1110
3871 VH3-23_IGHD6-13*01>2′_IGHJ3*01 1472 gnl|Fabrus|V1-3_IGLJ1*01 1110
3872 VH3-23_IGHD6-13*01>1_IGHJ6*01 1818 gnl|Fabrus|V1-3_IGLJ1*01 1110
3873 VH3-23_IGHD6-19*01>1′_IGHJ3*01 1474 gnl|Fabrus|V1-3_IGLJ1*01 1110
3874 VH3-23_IGHD6-19*01>2′_IGHJ3*01 1475 gnl|Fabrus|V1-3_IGLJ1*01 1110
3875 VH3-23_IGHD6-19*01>3′_IGHJ3*01 1476 gnl|Fabrus|V1-3_IGLJ1*01 1110
3876 VH3-23_IGHD6-25*01>1′_IGHJ3*01 1477 gnl|Fabrus|V1-3_IGLJ1*01 1110
3877 VH3-23_IGHD6-25*01>3′_IGHJ3*01 1478 gnl|Fabrus|V1-3_IGLJ1*01 1110
3878 VH3-23_IGHD7-27*01>1′_IGHJ3*01 1479 gnl|Fabrus|V1-3_IGLJ1*01 1110
3879 VH3-23_IGHD7-27*01>2′_IGHJ3*01 1480 gnl|Fabrus|V1-3_IGLJ1*01 1110
3880 VH3-23_IGHD6-6*01>2_IGHJ4*01 1529 gnl|Fabrus|V1-3_IGLJ1*01 1110
3881 VH3-23_IGHD6-13*01>1_IGHJ4*01 1530 gnl|Fabrus|V1-3_IGLJ1*01 1110
3882 VH3-23_IGHD6-13*01>2_IGHJ4*01 1531 gnl|Fabrus|V1-3_IGLJ1*01 1110
3883 VH3-23_IGHD6-19*01>1_IGHJ4*01 1532 gnl|Fabrus|V1-3_IGLJ1*01 1110
3884 VH3-23_IGHD6-19*01>2_IGHJ4*01 1533 gnl|Fabrus|V1-3_IGLJ1*01 1110
3885 VH3-23_IGHD6-25*01>1_IGHJ4*01 1534 gnl|Fabrus|V1-3_IGLJ1*01 1110
3886 VH3-23_IGHD6-25*01>2_IGHJ4*01 1535 gnl|Fabrus|V1-3_IGLJ1*01 1110
3887 VH3-23_IGHD7-27*01>1_IGHJ4*01 1536 gnl|Fabrus|V1-3_IGLJ1*01 1110
3888 VH3-23_IGHD7-27*01>3_IGHJ4*01 1537 gnl|Fabrus|V1-3_IGLJ1*01 1110
3889 VH3-23_IGHD6-13*01>1′_IGHJ4*01 1586 gnl|Fabrus|V1-3_IGLJ1*01 1110
3890 VH3-23_IGHD6-13*01>2′_IGHJ4*01 1587 gnl|Fabrus|V1-3_IGLJ1*01 1110
3891 VH3-23_IGHD6-13*01>2_IGHJ4*01_B 1588 gnl|Fabrus|V1-3_IGLJ1*01 1110
3892 VH3-23_IGHD6-19*01>1′_IGHJ4*01 1589 gnl|Fabrus|V1-3_IGLJ1*01 1110
3893 VH3-23_IGHD6-19*01>2′_IGHJ4*01 1590 gnl|Fabrus|V1-3_IGLJ1*01 1110
3894 VH3-23_IGHD6-19*01>2_IGHJ4*01_B 1591 gnl|Fabrus|V1-3_IGLJ1*01 1110
3895 VH3-23_IGHD6-25*01>1′_IGHJ4*01 1592 gnl|Fabrus|V1-3_IGLJ1*01 1110
3896 VH3-23_IGHD6-25*01>3′_IGHJ4*01 1593 gnl|Fabrus|V1-3_IGLJ1*01 1110
3897 VH3-23_IGHD7-27*01>1′_IGHJ4*01 1594 gnl|Fabrus|V1-3_IGLJ1*01 1110
3898 VH3-23_IGHD7-27*01>2′_IGHJ4*01 1595 gnl|Fabrus|V1-3_IGLJ1*01 1110
3899 VH3-23_IGHD6-6*01>2_IGHJ5*01 1644 gnl|Fabrus|V1-3_IGLJ1*01 1110
3900 VH3-23_IGHD6-13*01>1_IGHJ5*01 1645 gnl|Fabrus|V1-3_IGLJ1*01 1110
3901 VH3-23_IGHD6-13*01>2_IGHJ5*01 1646 gnl|Fabrus|V1-3_IGLJ1*01 1110
3902 VH3-23_IGHD6-19*01>1_IGHJ5*01 1647 gnl|Fabrus|V1-3_IGLJ1*01 1110
3903 VH3-23_IGHD6-19*01>2_IGHJ5*01 1648 gnl|Fabrus|V1-3_IGLJ1*01 1110
3904 VH3-23_IGHD6-25*01>1_IGHJ5*01 1649 gnl|Fabrus|V1-3_IGLJ1*01 1110
3905 VH3-23_IGHD6-25*01>2_IGHJ5*01 1650 gnl|Fabrus|V1-3_IGLJ1*01 1110
3906 VH3-23_IGHD7-27*01>1_IGHJ5*01 1651 gnl|Fabrus|V1-3_IGLJ1*01 1110
3907 VH3-23_IGHD7-27*01>3_IGHJ5*01 1652 gnl|Fabrus|V1-3_IGLJ1*01 1110
3908 VH3-23_IGHD6-13*01>1′_IGHJ5*01 1701 gnl|Fabrus|V1-3_IGLJ1*01 1110
3909 VH3-23_IGHD6-13*01>2′_IGHJ5*01 1702 gnl|Fabrus|V1-3_IGLJ1*01 1110
3910 VH3-23_IGHD6-13*01>3′_IGHJ5*01 1703 gnl|Fabrus|V1-3_IGLJ1*01 1110
3911 VH3-23_IGHD6-19*01>1′_IGHJ5*01 1704 gnl|Fabrus|V1-3_IGLJ1*01 1110
3912 VH3-23_IGHD6-19*01>2′_IGHJ5*01 1705 gnl|Fabrus|V1-3_IGLJ1*01 1110
3913 VH3-23_IGHD6-19*01>2_IGHJ5*01_B 1706 gnl|Fabrus|V1-3_IGLJ1*01 1110
3914 VH3-23_IGHD6-25*01>1′_IGHJ5*01 1707 gnl|Fabrus|V1-3_IGLJ1*01 1110
3915 VH3-23_IGHD6-25*01>3′_IGHJ5*01 1708 gnl|Fabrus|V1-3_IGLJ1*01 1110
3916 VH3-23_IGHD7-27*01>1′_IGHJ5*01 1709 gnl|Fabrus|V1-3_IGLJ1*01 1110
3917 VH3-23_IGHD7-27*01>2′_IGHJ5*01 1710 gnl|Fabrus|V1-3_IGLJ1*01 1110
3918 VH3-23_IGHD6-6*01>2_IGHJ6*01 1759 gnl|Fabrus|V1-3_IGLJ1*01 1110
3919 VH3-23_IGHD1-1*01>1_IGHJ6*01 1711 gnl|Fabrus|V2-13_IGLJ2*01 1117
3920 VH3-23_IGHD1-1*01>2_IGHJ6*01 1712 gnl|Fabrus|V2-13_IGLJ2*01 1117
3921 VH3-23_IGHD1-1*01>3_IGHJ6*01 1713 gnl|Fabrus|V2-13_IGLJ2*01 1117
3922 VH3-23_IGHD1-7*01>1_IGHJ6*01 1714 gnl|Fabrus|V2-13_IGLJ2*01 1117
3923 VH3-23_IGHD1-7*01>3_IGHJ6*01 1715 gnl|Fabrus|V2-13_IGLJ2*01 1117
3924 VH3-23_IGHD1-14*01>1_IGHJ6*01 1716 gnl|Fabrus|V2-13_IGLJ2*01 1117
3925 VH3-23_IGHD1-14*01>3_IGHJ6*01 1717 gnl|Fabrus|V2-13_IGLJ2*01 1117
3926 VH3-23_IGHD1-20*01>1_IGHJ6*01 1718 gnl|Fabrus|V2-13_IGLJ2*01 1117
3927 VH3-23_IGHD1-20*01>3_IGHJ6*01 1719 gnl|Fabrus|V2-13_IGLJ2*01 1117
3928 VH3-23_IGHD1-26*01>1_IGHJ6*01 1720 gnl|Fabrus|V2-13_IGLJ2*01 1117
3929 VH3-23_IGHD1-26*01>3_IGHJ6*01 1721 gnl|Fabrus|V2-13_IGLJ2*01 1117
3930 VH3-23_IGHD2-2*01>2_IGHJ6*01 1722 gnl|Fabrus|V2-13_IGLJ2*01 1117
3931 VH3-23_IGHD2-2*01>3_IGHJ6*01 1723 gnl|Fabrus|V2-13_IGLJ2*01 1117
3932 VH3-23_IGHD2-8*01>2_IGHJ6*01 1724 gnl|Fabrus|V2-13_IGLJ2*01 1117
3933 VH3-23_IGHD2-8*01>3_IGHJ6*01 1725 gnl|Fabrus|V2-13_IGLJ2*01 1117
3934 VH3-23_IGHD2-15*01>2_IGHJ6*01 1726 gnl|Fabrus|V2-13_IGLJ2*01 1117
3935 VH3-23_IGHD2-15*01>3_IGHJ6*01 1727 gnl|Fabrus|V2-13_IGLJ2*01 1117
3936 VH3-23_IGHD2-21*01>2_IGHJ6*01 1728 gnl|Fabrus|V2-13_IGLJ2*01 1117
3937 VH3-23_IGHD2-21*01>3_IGHJ6*01 1729 gnl|Fabrus|V2-13_IGLJ2*01 1117
3938 VH3-23_IGHD3-3*01>1_IGHJ6*01 1730 gnl|Fabrus|V2-13_IGLJ2*01 1117
3939 VH3-23_IGHD3-3*01>2_IGHJ6*01 1731 gnl|Fabrus|V2-13_IGLJ2*01 1117
3940 VH3-23_IGHD3-3*01>3_IGHJ6*01 1732 gnl|Fabrus|V2-13_IGLJ2*01 1117
3941 VH3-23_IGHD3-9*01>2_IGHJ6*01 1733 gnl|Fabrus|V2-13_IGLJ2*01 1117
3942 VH3-23_IGHD3-10*01>2_IGHJ6*01 1734 gnl|Fabrus|V2-13_IGLJ2*01 1117
3943 VH3-23_IGHD3-10*01>3_IGHJ6*01 1735 gnl|Fabrus|V2-13_IGLJ2*01 1117
3944 VH3-23_IGHD3-16*01>2_IGHJ6*01 1736 gnl|Fabrus|V2-13_IGLJ2*01 1117
3945 VH3-23_IGHD3-16*01>3_IGHJ6*01 1737 gnl|Fabrus|V2-13_IGLJ2*01 1117
3946 VH3-23_IGHD3-22*01>2_IGHJ6*01 1738 gnl|Fabrus|V2-13_IGLJ2*01 1117
3947 VH3-23_IGHD3-22*01>3_IGHJ6*01 1739 gnl|Fabrus|V2-13_IGLJ2*01 1117
3948 VH3-23_IGHD4-4*01 (1) >2_IGHJ6*01 1740 gnl|Fabrus|V2-13_IGLJ2*01 1117
3949 VH3-23_IGHD4-4*01 (1) >3_IGHJ6*01 1741 gnl|Fabrus|V2-13_IGLJ2*01 1117
3950 VH3-23_IGHD4-11*01 (1) >2_IGHJ6*01 1742 gnl|Fabrus|V2-13_IGLJ2*01 1117
3951 VH3-23_IGHD4-11*01 (1) >3_IGHJ6*01 1743 gnl|Fabrus|V2-13_IGLJ2*01 1117
3952 VH3-23_IGHD4-17*01>2_IGHJ6*01 1744 gnl|Fabrus|V2-13_IGLJ2*01 1117
3953 VH3-23_IGHD4-17*01>3_IGHJ6*01 1745 gnl|Fabrus|V2-13_IGLJ2*01 1117
3954 VH3-23_IGHD4-23*01>2_IGHJ6*01 1746 gnl|Fabrus|V2-13_IGLJ2*01 1117
3955 VH3-23_IGHD4-23*01>3_IGHJ6*01 1747 gnl|Fabrus|V2-13_IGLJ2*01 1117
3956 VH3-23_IGHD5-5*01 (2) >1_IGHJ6*01 1748 gnl|Fabrus|V2-13_IGLJ2*01 1117
3957 VH3-23_IGHD5-5*01 (2) >2_IGHJ6*01 1749 gnl|Fabrus|V2-13_IGLJ2*01 1117
3958 VH3-23_IGHD5-5*01 (2) >3_IGHJ6*01 1750 gnl|Fabrus|V2-13_IGLJ2*01 1117
3959 VH3-23_IGHD5-12*01>1_IGHJ6*01 1751 gnl|Fabrus|V2-13_IGLJ2*01 1117
3960 VH3-23_IGHD5-12*01>3_IGHJ6*01 1752 gnl|Fabrus|V2-13_IGLJ2*01 1117
3961 VH3-23_IGHD5-18*01 (2) >1_IGHJ6*01 1753 gnl|Fabrus|V2-13_IGLJ2*01 1117
3962 VH3-23_IGHD5-18*01 (2) >2_IGHJ6*01 1754 gnl|Fabrus|V2-13_IGLJ2*01 1117
3963 VH3-23_IGHD5-18*01 (2) >3_IGHJ6*01 1755 gnl|Fabrus|V2-13_IGLJ2*01 1117
3964 VH3-23_IGHD5-24*01>1_IGHJ6*01 1756 gnl|Fabrus|V2-13_IGLJ2*01 1117
3965 VH3-23_IGHD5-24*01>3_IGHJ6*01 1757 gnl|Fabrus|V2-13_IGLJ2*01 1117
3966 VH3-23_IGHD6-6*01>1_IGHJ6*01 1758 gnl|Fabrus|V2-13_IGLJ2*01 1117
3967 VH3-23_IGHD1-1*01>1′_IGHJ6*01 1768 gnl|Fabrus|V2-13_IGLJ2*01 1117
3968 VH3-23_IGHD1-1*01>2′_IGHJ6*01 1769 gnl|Fabrus|V2-13_IGLJ2*01 1117
3969 VH3-23_IGHD1-1*01>3′_IGHJ6*01 1770 gnl|Fabrus|V2-13_IGLJ2*01 1117
3970 VH3-23_IGHD1-7*01>1′_IGHJ6*01 1771 gnl|Fabrus|V2-13_IGLJ2*01 1117
3971 VH3-23_IGHD1-7*01>3′_IGHJ6*01 1772 gnl|Fabrus|V2-13_IGLJ2*01 1117
3972 VH3-23_IGHD1-14*01>1′_IGHJ6*01 1773 gnl|Fabrus|V2-13_IGLJ2*01 1117
3973 VH3-23_IGHD1-14*01>2′_IGHJ6*01 1774 gnl|Fabrus|V2-13_IGLJ2*01 1117
3974 VH3-23_IGHD1-14*01>3′_IGHJ6*01 1775 gnl|Fabrus|V2-13_IGLJ2*01 1117
3975 VH3-23_IGHD1-20*01>1′_IGHJ6*01 1776 gnl|Fabrus|V2-13_IGLJ2*01 1117
3976 VH3-23_IGHD1-20*01>2′_IGHJ6*01 1777 gnl|Fabrus|V2-13_IGLJ2*01 1117
3977 VH3-23_IGHD1-20*01>3′_IGHJ6*01 1778 gnl|Fabrus|V2-13_IGLJ2*01 1117
3978 VH3-23_IGHD1-26*01>1′_IGHJ6*01 1779 gnl|Fabrus|V2-13_IGLJ2*01 1117
3979 VH3-23_IGHD1-26*01>1_IGHJ6*01_B 1780 gnl|Fabrus|V2-13_IGLJ2*01 1117
3980 VH3-23_IGHD2-2*01>2_IGHJ6*01_B 1781 gnl|Fabrus|V2-13_IGLJ2*01 1117
3981 VH3-23_IGHD2-2*01>3′_IGHJ6*01 1782 gnl|Fabrus|V2-13_IGLJ2*01 1117
3982 VH3-23_IGHD2-8*01>1′_IGHJ6*01 1783 gnl|Fabrus|V2-13_IGLJ2*01 1117
3983 VH3-23_IGHD2-15*01>1′_IGHJ6*01 1784 gnl|Fabrus|V2-13_IGLJ2*01 1117
3984 VH3-23_IGHD2-15*01>3′_IGHJ6*01 1785 gnl|Fabrus|V2-13_IGLJ2*01 1117
3985 VH3-23_IGHD2-21*01>1′_IGHJ6*01 1786 gnl|Fabrus|V2-13_IGLJ2*01 1117
3986 VH3-23_IGHD2-21*01>3′_IGHJ6*01 1787 gnl|Fabrus|V2-13_IGLJ2*01 1117
3987 VH3-23_IGHD3-3*01>1′_IGHJ6*01 1788 gnl|Fabrus|V2-13_IGLJ2*01 1117
3988 VH3-23_IGHD3-3*01>3′_IGHJ6*01 1789 gnl|Fabrus|V2-13_IGLJ2*01 1117
3989 VH3-23_IGHD3-9*01>1′_IGHJ6*01 1790 gnl|Fabrus|V2-13_IGLJ2*01 1117
3990 VH3-23_IGHD3-9*01>3′_IGHJ6*01 1791 gnl|Fabrus|V2-13_IGLJ2*01 1117
3991 VH3-23_IGHD3-10*01>1′_IGHJ6*01 1792 gnl|Fabrus|V2-13_IGLJ2*01 1117
3992 VH3-23_IGHD3-10*01>3′_IGHJ6*01 1793 gnl|Fabrus|V2-13_IGLJ2*01 1117
3993 VH3-23_IGHD3-16*01>1′_IGHJ6*01 1794 gnl|Fabrus|V2-13_IGLJ2*01 1117
3994 VH3-23_IGHD3-16*01>3′_IGHJ6*01 1795 gnl|Fabrus|V2-13_IGLJ2*01 1117
3995 VH3-23_IGHD3-22*01>1′_IGHJ6*01 1796 gnl|Fabrus|V2-13_IGLJ2*01 1117
3996 VH3-23_IGHD4-4*01 (1) >1′_IGHJ6*01 1797 gnl|Fabrus|V2-13_IGLJ2*01 1117
3997 VH3-23_IGHD4-4*01 (1) >3′_IGHJ6*01 1798 gnl|Fabrus|V2-13_IGLJ2*01 1117
3998 VH3-23_IGHD4-11*01 (1) >1′_IGHJ6*01 1799 gnl|Fabrus|V2-13_IGLJ2*01 1117
3999 VH3-23_IGHD4-11*01 (1) >3′_IGHJ6*01 1800 gnl|Fabrus|V2-13_IGLJ2*01 1117
4000 VH3-23_IGHD4-17*01>1′_IGHJ6*01 1801 gnl|Fabrus|V2-13_IGLJ2*01 1117
4001 VH3-23_IGHD4-17*01>3′_IGHJ6*01 1802 gnl|Fabrus|V2-13_IGLJ2*01 1117
4002 VH3-23_IGHD4-23*01>1′_IGHJ6*01 1803 gnl|Fabrus|V2-13_IGLJ2*01 1117
4003 VH3-23_IGHD4-23*01>3′_IGHJ6*01 1804 gnl|Fabrus|V2-13_IGLJ2*01 1117
4004 VH3-23_IGHD5-5*01 (2) >1′_IGHJ6*01 1805 gnl|Fabrus|V2-13_IGLJ2*01 1117
4005 VH3-23_IGHD5-5*01 (2) >3′_IGHJ6*01 1806 gnl|Fabrus|V2-13_IGLJ2*01 1117
4006 VH3-23_IGHD5-12*01>1′_IGHJ6*01 1807 gnl|Fabrus|V2-13_IGLJ2*01 1117
4007 VH3-23_IGHD5-12*01>3′_IGHJ6*01 1808 gnl|Fabrus|V2-13_IGLJ2*01 1117
4008 VH3-23_IGHD5-18*01 (2) >1′_IGHJ6*01 1809 gnl|Fabrus|V2-13_IGLJ2*01 1117
4009 VH3-23_IGHD5-18*01 (2) >3′_IGHJ6*01 1810 gnl|Fabrus|V2-13_IGLJ2*01 1117
4010 VH3-23_IGHD5-24*01>1′_IGHJ6*01 1811 gnl|Fabrus|V2-13_IGLJ2*01 1117
4011 VH3-23_IGHD5-24*01>3′_IGHJ6*01 1812 gnl|Fabrus|V2-13_IGLJ2*01 1117
4012 VH3-23_IGHD6-6*01>1′_IGHJ6*01 1813 gnl|Fabrus|V2-13_IGLJ2*01 1117
4013 VH3-23_IGHD6-6*01>2′_IGHJ6*01 1814 gnl|Fabrus|V2-13_IGLJ2*01 1117
4014 VH3-23_IGHD6-6*01>3′_IGHJ6*01 1815 gnl|Fabrus|V2-13_IGLJ2*01 1117
4015 VH3-23_IGHD1-1*01>1_IGHJ6*01 1711 gnl|Fabrus|V2-14_IGLJ4*01 1118
4016 VH3-23_IGHD1-1*01>2_IGHJ6*01 1712 gnl|Fabrus|V2-14_IGLJ4*01 1118
4017 VH3-23_IGHD1-1*01>3_IGHJ6*01 1713 gnl|Fabrus|V2-14_IGLJ4*01 1118
4018 VH3-23_IGHD1-7*01>1_IGHJ6*01 1714 gnl|Fabrus|V2-14_IGLJ4*01 1118
4019 VH3-23_IGHD1-7*01>3_IGHJ6*01 1715 gnl|Fabrus|V2-14_IGLJ4*01 1118
4020 VH3-23_IGHD1-14*01>1_IGHJ6*01 1716 gnl|Fabrus|V2-14_IGLJ4*01 1118
4021 VH3-23_IGHD1-14*01>3_IGHJ6*01 1717 gnl|Fabrus|V2-14_IGLJ4*01 1118
4022 VH3-23_IGHD1-20*01>1_IGHJ6*01 1718 gnl|Fabrus|V2-14_IGLJ4*01 1118
4023 VH3-23_IGHD1-20*01>3_IGHJ6*01 1719 gnl|Fabrus|V2-14_IGLJ4*01 1118
4024 VH3-23_IGHD1-26*01>1_IGHJ6*01 1720 gnl|Fabrus|V2-14_IGLJ4*01 1118
4025 VH3-23_IGHD1-26*01>3_IGHJ6*01 1721 gnl|Fabrus|V2-14_IGLJ4*01 1118
4026 VH3-23_IGHD2-2*01>2_IGHJ6*01 1722 gnl|Fabrus|V2-14_IGLJ4*01 1118
4027 VH3-23_IGHD2-2*01>3_IGHJ6*01 1723 gnl|Fabrus|V2-14_IGLJ4*01 1118
4028 VH3-23_IGHD2-8*01>2_IGHJ6*01 1724 gnl|Fabrus|V2-14_IGLJ4*01 1118
4029 VH3-23_IGHD2-8*01>3_IGHJ6*01 1725 gnl|Fabrus|V2-14_IGLJ4*01 1118
4030 VH3-23_IGHD2-15*01>2_IGHJ6*01 1726 gnl|Fabrus|V2-14_IGLJ4*01 1118
4031 VH3-23_IGHD2-15*01>3_IGHJ6*01 1727 gnl|Fabrus|V2-14_IGLJ4*01 1118
4032 VH3-23_IGHD2-21*01>2_IGHJ6*01 1728 gnl|Fabrus|V2-14_IGLJ4*01 1118
4033 VH3-23_IGHD2-21*01>3_IGHJ6*01 1729 gnl|Fabrus|V2-14_IGLJ4*01 1118
4034 VH3-23_IGHD3-3*01>1_IGHJ6*01 1730 gnl|Fabrus|V2-14_IGLJ4*01 1118
4035 VH3-23_IGHD3-3*01>2_IGHJ6*01 1731 gnl|Fabrus|V2-14_IGLJ4*01 1118
4036 VH3-23_IGHD3-3*01>3_IGHJ6*01 1732 gnl|Fabrus|V2-14_IGLJ4*01 1118
4037 VH3-23_IGHD3-9*01>2_IGHJ6*01 1733 gnl|Fabrus|V2-14_IGLJ4*01 1118
4038 VH3-23_IGHD3-10*01>2_IGHJ6*01 1734 gnl|Fabrus|V2-14_IGLJ4*01 1118
4039 VH3-23_IGHD3-10*01>3_IGHJ6*01 1735 gnl|Fabrus|V2-14_IGLJ4*01 1118
4040 VH3-23_IGHD3-16*01>2_IGHJ6*01 1736 gnl|Fabrus|V2-14_IGLJ4*01 1118
4041 VH3-23_IGHD3-16*01>3_IGHJ6*01 1737 gnl|Fabrus|V2-14_IGLJ4*01 1118
4042 VH3-23_IGHD3-22*01>2_IGHJ6*01 1738 gnl|Fabrus|V2-14_IGLJ4*01 1118
4043 VH3-23_IGHD3-22*01>3_IGHJ6*01 1739 gnl|Fabrus|V2-14_IGLJ4*01 1118
4044 VH3-23_IGHD4-4*01 (1) >2_IGHJ6*01 1740 gnl|Fabrus|V2-14_IGLJ4*01 1118
4045 VH3-23_IGHD4-4*01 (1) >3_IGHJ6*01 1741 gnl|Fabrus|V2-14_IGLJ4*01 1118
4046 VH3-23_IGHD4-11*01 (1) >2_IGHJ6*01 1742 gnl|Fabrus|V2-14_IGLJ4*01 1118
4047 VH3-23_IGHD4-11*01 (1) >3_IGHJ6*01 1743 gnl|Fabrus|V2-14_IGLJ4*01 1118
4048 VH3-23_IGHD4-17*01>2_IGHJ6*01 1744 gnl|Fabrus|V2-14_IGLJ4*01 1118
4049 VH3-23_IGHD4-17*01>3_IGHJ6*01 1745 gnl|Fabrus|V2-14_IGLJ4*01 1118
4050 VH3-23_IGHD4-23*01>2_IGHJ6*01 1746 gnl|Fabrus|V2-14_IGLJ4*01 1118
4051 VH3-23_IGHD4-23*01>3_IGHJ6*01 1747 gnl|Fabrus|V2-14_IGLJ4*01 1118
4052 VH3-23_IGHD5-5*01 (2) >1_IGHJ6*01 1748 gnl|Fabrus|V2-14_IGLJ4*01 1118
4053 VH3-23_IGHD5-5*01 (2) >2_IGHJ6*01 1749 gnl|Fabrus|V2-14_IGLJ4*01 1118
4054 VH3-23_IGHD5-5*01 (2) >3_IGHJ6*01 1750 gnl|Fabrus|V2-14_IGLJ4*01 1118
4055 VH3-23_IGHD5-12*01>1_IGHJ6*01 1751 gnl|Fabrus|V2-14_IGLJ4*01 1118
4056 VH3-23_IGHD5-12*01>3_IGHJ6*01 1752 gnl|Fabrus|V2-14_IGLJ4*01 1118
4057 VH3-23_IGHD5-18*01 (2) >1_IGHJ6*01 1753 gnl|Fabrus|V2-14_IGLJ4*01 1118
4058 VH3-23_IGHD5-18*01 (2) >2_IGHJ6*01 1754 gnl|Fabrus|V2-14_IGLJ4*01 1118
4059 VH3-23_IGHD5-18*01 (2) >3_IGHJ6*01 1755 gnl|Fabrus|V2-14_IGLJ4*01 1118
4060 VH3-23_IGHD5-24*01>1_IGHJ6*01 1756 gnl|Fabrus|V2-14_IGLJ4*01 1118
4061 VH3-23_IGHD5-24*01>3_IGHJ6*01 1757 gnl|Fabrus|V2-14_IGLJ4*01 1118
4062 VH3-23_IGHD6-6*01>1_IGHJ6*01 1758 gnl|Fabrus|V2-14_IGLJ4*01 1118
4063 VH3-23_IGHD1-1*01>1′_IGHJ6*01 1768 gnl|Fabrus|V2-14_IGLJ4*01 1118
4064 VH3-23_IGHD1-1*01>2′_IGHJ6*01 1769 gnl|Fabrus|V2-14_IGLJ4*01 1118
4065 VH3-23_IGHD1-1*01>3′_IGHJ6*01 1770 gnl|Fabrus|V2-14_IGLJ4*01 1118
4066 VH3-23_IGHD1-7*01>1′_IGHJ6*01 1771 gnl|Fabrus|V2-14_IGLJ4*01 1118
4067 VH3-23_IGHD1-7*01>3′_IGHJ6*01 1772 gnl|Fabrus|V2-14_IGLJ4*01 1118
4068 VH3-23_IGHD1-14*01>1′_IGHJ6*01 1773 gnl|Fabrus|V2-14_IGLJ4*01 1118
4069 VH3-23_IGHD1-14*01>2′_IGHJ6*01 1774 gnl|Fabrus|V2-14_IGLJ4*01 1118
4070 VH3-23_IGHD1-14*01>3′_IGHJ6*01 1775 gnl|Fabrus|V2-14_IGLJ4*01 1118
4071 VH3-23_IGHD1-20*01>1′_IGHJ6*01 1776 gnl|Fabrus|V2-14_IGLJ4*01 1118
4072 VH3-23_IGHD1-20*01>2′_IGHJ6*01 1777 gnl|Fabrus|V2-14_IGLJ4*01 1118
4073 VH3-23_IGHD1-20*01>3′_IGHJ6*01 1778 gnl|Fabrus|V2-14_IGLJ4*01 1118
4074 VH3-23_IGHD1-26*01>1′_IGHJ6*01 1779 gnl|Fabrus|V2-14_IGLJ4*01 1118
4075 VH3-23_IGHD1-26*01>1_IGHJ6*01_B 1780 gnl|Fabrus|V2-14_IGLJ4*01 1118
4076 VH3-23_IGHD2-2*01>2_IGHJ6*01_B 1781 gnl|Fabrus|V2-14_IGLJ4*01 1118
4077 VH3-23_IGHD2-2*01>3′_IGHJ6*01 1782 gnl|Fabrus|V2-14_IGLJ4*01 1118
4078 VH3-23_IGHD2-8*01>1′_IGHJ6*01 1783 gnl|Fabrus|V2-14_IGLJ4*01 1118
4079 VH3-23_IGHD2-15*01>1′_IGHJ6*01 1784 gnl|Fabrus|V2-14_IGLJ4*01 1118
4080 VH3-23_IGHD2-15*01>3′_IGHJ6*01 1785 gnl|Fabrus|V2-14_IGLJ4*01 1118
4081 VH3-23_IGHD2-21*01>1′_IGHJ6*01 1786 gnl|Fabrus|V2-14_IGLJ4*01 1118
4082 VH3-23_IGHD2-21*01>3′_IGHJ6*01 1787 gnl|Fabrus|V2-14_IGLJ4*01 1118
4083 VH3-23_IGHD3-3*01>1′_IGHJ6*01 1788 gnl|Fabrus|V2-14_IGLJ4*01 1118
4084 VH3-23_IGHD3-3*01>3′_IGHJ6*01 1789 gnl|Fabrus|V2-14_IGLJ4*01 1118
4085 VH3-23_IGHD3-9*01>1′_IGHJ6*01 1790 gnl|Fabrus|V2-14_IGLJ4*01 1118
4086 VH3-23_IGHD3-9*01>3′_IGHJ6*01 1791 gnl|Fabrus|V2-14_IGLJ4*01 1118
4087 VH3-23_IGHD3-10*01>1′_IGHJ6*01 1792 gnl|Fabrus|V2-14_IGLJ4*01 1118
4088 VH3-23_IGHD3-10*01>3′_IGHJ6*01 1793 gnl|Fabrus|V2-14_IGLJ4*01 1118
4089 VH3-23_IGHD3-16*01>1′_IGHJ6*01 1794 gnl|Fabrus|V2-14_IGLJ4*01 1118
4090 VH3-23_IGHD3-16*01>3′_IGHJ6*01 1795 gnl|Fabrus|V2-14_IGLJ4*01 1118
4091 VH3-23_IGHD3-22*01>1′_IGHJ6*01 1796 gnl|Fabrus|V2-14_IGLJ4*01 1118
4092 VH3-23_IGHD4-4*01 (1) >1′_IGHJ6*01 1797 gnl|Fabrus|V2-14_IGLJ4*01 1118
4093 VH3-23_IGHD4-4*01 (1) >3′_IGHJ6*01 1798 gnl|Fabrus|V2-14_IGLJ4*01 1118
4094 VH3-23_IGHD4-11*01 (1) >1′_IGHJ6*01 1799 gnl|Fabrus|V2-14_IGLJ4*01 1118
4095 VH3-23_IGHD4-11*01 (1) >3′_IGHJ6*01 1800 gnl|Fabrus|V2-14_IGLJ4*01 1118
4096 VH3-23_IGHD4-17*01>1′_IGHJ6*01 1801 gnl|Fabrus|V2-14_IGLJ4*01 1118
4097 VH3-23_IGHD4-17*01>3′_IGHJ6*01 1802 gnl|Fabrus|V2-14_IGLJ4*01 1118
4098 VH3-23_IGHD4-23*01>1′_IGHJ6*01 1803 gnl|Fabrus|V2-14_IGLJ4*01 1118
4099 VH3-23_IGHD4-23*01>3′_IGHJ6*01 1804 gnl|Fabrus|V2-14_IGLJ4*01 1118
4100 VH3-23_IGHD5-5*01 (2) >1′_IGHJ6*01 1805 gnl|Fabrus|V2-14_IGLJ4*01 1118
4101 VH3-23_IGHD5-5*01 (2) >3′_IGHJ6*01 1806 gnl|Fabrus|V2-14_IGLJ4*01 1118
4102 VH3-23_IGHD5-12*01>1′_IGHJ6*01 1807 gnl|Fabrus|V2-14_IGLJ4*01 1118
4103 VH3-23_IGHD5-12*01>3′_IGHJ6*01 1808 gnl|Fabrus|V2-14_IGLJ4*01 1118
4104 VH3-23_IGHD5-18*01 (2) >1′_IGHJ6*01 1809 gnl|Fabrus|V2-14_IGLJ4*01 1118
4105 VH3-23_IGHD5-18*01 (2) >3′_IGHJ6*01 1810 gnl|Fabrus|V2-14_IGLJ4*01 1118
4106 VH3-23_IGHD5-24*01>1′_IGHJ6*01 1811 gnl|Fabrus|V2-14_IGLJ4*01 1118
4107 VH3-23_IGHD5-24*01>3′_IGHJ6*01 1812 gnl|Fabrus|V2-14_IGLJ4*01 1118
4108 VH3-23_IGHD6-6*01>1′_IGHJ6*01 1813 gnl|Fabrus|V2-14_IGLJ4*01 1118
4109 VH3-23_IGHD6-6*01>2′_IGHJ6*01 1814 gnl|Fabrus|V2-14_IGLJ4*01 1118
4110 VH3-23_IGHD6-6*01>3′_IGHJ6*01 1815 gnl|Fabrus|V2-14_IGLJ4*01 1118
4111 VH3-23_IGHD1-1*01>1_IGHJ6*01 1711 gnl|Fabrus|V2-15_IGLJ7*01 1118
4112 VH3-23_IGHD1-1*01>2_IGHJ6*01 1712 gnl|Fabrus|V2-15_IGLJ7*01 1119
4113 VH3-23_IGHD1-1*01>3_IGHJ6*01 1713 gnl|Fabrus|V2-15_IGLJ7*01 1119
4114 VH3-23_IGHD1-7*01>1_IGHJ6*01 1714 gnl|Fabrus|V2-15_IGLJ7*01 1119
4115 VH3-23_IGHD1-7*01>3_IGHJ6*01 1715 gnl|Fabrus|V2-15_IGLJ7*01 1119
4116 VH3-23_IGHD1-14*01>1_IGHJ6*01 1716 gnl|Fabrus|V2-15_IGLJ7*01 1119
4117 VH3-23_IGHD1-14*01>3_IGHJ6*01 1717 gnl|Fabrus|V2-15_IGLJ7*01 1119
4118 VH3-23_IGHD1-20*01>1_IGHJ6*01 1718 gnl|Fabrus|V2-15_IGLJ7*01 1119
4119 VH3-23_IGHD1-20*01>3_IGHJ6*01 1719 gnl|Fabrus|V2-15_IGLJ7*01 1119
4120 VH3-23_IGHD1-26*01>1_IGHJ6*01 1720 gnl|Fabrus|V2-15_IGLJ7*01 1119
4121 VH3-23_IGHD1-26*01>3_IGHJ6*01 1721 gnl|Fabrus|V2-15_IGLJ7*01 1119
4122 VH3-23_IGHD2-2*01>2_IGHJ6*01 1722 gnl|Fabrus|V2-15_IGLJ7*01 1119
4123 VH3-23_IGHD2-2*01>3_IGHJ6*01 1723 gnl|Fabrus|V2-15_IGLJ7*01 1119
4124 VH3-23_IGHD2-8*01>2_IGHJ6*01 1724 gnl|Fabrus|V2-15_IGLJ7*01 1119
4125 VH3-23_IGHD2-8*01>3_IGHJ6*01 1725 gnl|Fabrus|V2-15_IGLJ7*01 1119
4126 VH3-23_IGHD2-15*01>2_IGHJ6*01 1726 gnl|Fabrus|V2-15_IGLJ7*01 1119
4127 VH3-23_IGHD2-15*01>3_IGHJ6*01 1727 gnl|Fabrus|V2-15_IGLJ7*01 1119
4128 VH3-23_IGHD2-21*01>2_IGHJ6*01 1728 gnl|Fabrus|V2-15_IGLJ7*01 1119
4129 VH3-23_IGHD2-21*01>3_IGHJ6*01 1729 gnl|Fabrus|V2-15_IGLJ7*01 1119
4130 VH3-23_IGHD3-3*01>1_IGHJ6*01 1730 gnl|Fabrus|V2-15_IGLJ7*01 1119
4131 VH3-23_IGHD3-3*01>2_IGHJ6*01 1731 gnl|Fabrus|V2-15_IGLJ7*01 1119
4132 VH3-23_IGHD3-3*01>3_IGHJ6*01 1732 gnl|Fabrus|V2-15_IGLJ7*01 1119
4133 VH3-23_IGHD3-9*01>2_IGHJ6*01 1733 gnl|Fabrus|V2-15_IGLJ7*01 1119
4134 VH3-23_IGHD3-10*01>2_IGHJ6*01 1734 gnl|Fabrus|V2-15_IGLJ7*01 1119
4135 VH3-23_IGHD3-10*01>3_IGHJ6*01 1735 gnl|Fabrus|V2-15_IGLJ7*01 1119
4136 VH3-23_IGHD3-16*01>2_IGHJ6*01 1736 gnl|Fabrus|V2-15_IGLJ7*01 1119
4137 VH3-23_IGHD3-16*01>3_IGHJ6*01 1737 gnl|Fabrus|V2-15_IGLJ7*01 1119
4138 VH3-23_IGHD3-22*01>2_IGHJ6*01 1738 gnl|Fabrus|V2-15_IGLJ7*01 1119
4139 VH3-23_IGHD3-22*01>3_IGHJ6*01 1739 gnl|Fabrus|V2-15_IGLJ7*01 1119
4140 VH3-23_IGHD4-4*01 (1) >2_IGHJ6*01 1740 gnl|Fabrus|V2-15_IGLJ7*01 1119
4141 VH3-23_IGHD4-4*01 (1) >3_IGHJ6*01 1741 gnl|Fabrus|V2-15_IGLJ7*01 1119
4142 VH3-23_IGHD4-11*01 (1) >2_IGHJ6*01 1742 gnl|Fabrus|V2-15_IGLJ7*01 1119
4143 VH3-23_IGHD4-11*01 (1) >3_IGHJ6*01 1743 gnl|Fabrus|V2-15_IGLJ7*01 1119
4144 VH3-23_IGHD4-17*01>2_IGHJ6*01 1744 gnl|Fabrus|V2-15_IGLJ7*01 1119
4145 VH3-23_IGHD4-17*01>3_IGHJ6*01 1745 gnl|Fabrus|V2-15_IGLJ7*01 1119
4146 VH3-23_IGHD4-23*01>2_IGHJ6*01 1746 gnl|Fabrus|V2-15_IGLJ7*01 1119
4147 VH3-23_IGHD4-23*01>3_IGHJ6*01 1747 gnl|Fabrus|V2-15_IGLJ7*01 1119
4148 VH3-23_IGHD5-5*01 (2) >1_IGHJ6*01 1748 gnl|Fabrus|V2-15_IGLJ7*01 1119
4149 VH3-23_IGHD5-5*01 (2) >2_IGHJ6*01 1749 gnl|Fabrus|V2-15_IGLJ7*01 1119
4150 VH3-23_IGHD5-5*01 (2) >3_IGHJ6*01 1750 gnl|Fabrus|V2-15_IGLJ7*01 1119
4151 VH3-23_IGHD5-12*01>1_IGHJ6*01 1751 gnl|Fabrus|V2-15_IGLJ7*01 1119
4152 VH3-23_IGHD5-12*01>3_IGHJ6*01 1752 gnl|Fabrus|V2-15_IGLJ7*01 1119
4153 VH3-23_IGHD5-18*01 (2) >1_IGHJ6*01 1753 gnl|Fabrus|V2-15_IGLJ7*01 1119
4154 VH3-23_IGHD5-18*01 (2) >2_IGHJ6*01 1754 gnl|Fabrus|V2-15_IGLJ7*01 1119
4155 VH3-23_IGHD5-18*01 (2) >3_IGHJ6*01 1755 gnl|Fabrus|V2-15_IGLJ7*01 1119
4156 VH3-23_IGHD5-24*01>1_IGHJ6*01 1756 gnl|Fabrus|V2-15_IGLJ7*01 1119
4157 VH3-23_IGHD5-24*01>3_IGHJ6*01 1757 gnl|Fabrus|V2-15_IGLJ7*01 1119
4158 VH3-23_IGHD6-6*01>1_IGHJ6*01 1758 gnl|Fabrus|V2-15_IGLJ7*01 1119
4159 VH3-23_IGHD1-1*01>1′_IGHJ6*01 1768 gnl|Fabrus|V2-15_IGLJ7*01 1119
4160 VH3-23_IGHD1-1*01>2′_IGHJ6*01 1769 gnl|Fabrus|V2-15_IGLJ7*01 1119
4161 VH3-23_IGHD1-1*01>3′_IGHJ6*01 1770 gnl|Fabrus|V2-15_IGLJ7*01 1119
4162 VH3-23_IGHD1-7*01>1′_IGHJ6*01 1771 gnl|Fabrus|V2-15_IGLJ7*01 1119
4163 VH3-23_IGHD1-7*01>3′_IGHJ6*01 1772 gnl|Fabrus|V2-15_IGLJ7*01 1119
4164 VH3-23_IGHD1-14*01>1′_IGHJ6*01 1773 gnl|Fabrus|V2-15_IGLJ7*01 1119
4165 VH3-23_IGHD1-14*01>2′_IGHJ6*01 1774 gnl|Fabrus|V2-15_IGLJ7*01 1119
4166 VH3-23_IGHD1-14*01>3′_IGHJ6*01 1775 gnl|Fabrus|V2-15_IGLJ7*01 1119
4167 VH3-23_IGHD1-20*01>1′_IGHJ6*01 1776 gnl|Fabrus|V2-15_IGLJ7*01 1119
4168 VH3-23_IGHD1-20*01>2′_IGHJ6*01 1777 gnl|Fabrus|V2-15_IGLJ7*01 1119
4169 VH3-23_IGHD1-20*01>3′_IGHJ6*01 1778 gnl|Fabrus|V2-15_IGLJ7*01 1119
4170 VH3-23_IGHD1-26*01>1′_IGHJ6*01 1779 gnl|Fabrus|V2-15_IGLJ7*01 1119
4171 VH3-23_IGHD1-26*01>1_IGHJ6*01_B 1780 gnl|Fabrus|V2-15_IGLJ7*01 1119
4172 VH3-23_IGHD2-2*01>2_IGHJ6*01_B 1781 gnl|Fabrus|V2-15_IGLJ7*01 1119
4173 VH3-23_IGHD2-2*01>3′_IGHJ6*01 1782 gnl|Fabrus|V2-15_IGLJ7*01 1119
4174 VH3-23_IGHD2-8*01>1′_IGHJ6*01 1783 gnl|Fabrus|V2-15_IGLJ7*01 1119
4175 VH3-23_IGHD2-15*01>1′_IGHJ6*01 1784 gnl|Fabrus|V2-15_IGLJ7*01 1119
4176 VH3-23_IGHD2-15*01>3′_IGHJ6*01 1785 gnl|Fabrus|V2-15_IGLJ7*01 1119
4177 VH3-23_IGHD2-21*01>1′_IGHJ6*01 1786 gnl|Fabrus|V2-15_IGLJ7*01 1119
4178 VH3-23_IGHD2-21*01>3′_IGHJ6*01 1787 gnl|Fabrus|V2-15_IGLJ7*01 1119
4179 VH3-23_IGHD3-3*01>1′_IGHJ6*01 1788 gnl|Fabrus|V2-15_IGLJ7*01 1119
4180 VH3-23_IGHD3-3*01>3′_IGHJ6*01 1789 gnl|Fabrus|V2-15_IGLJ7*01 1119
4181 VH3-23_IGHD3-9*01>1′_IGHJ6*01 1790 gnl|Fabrus|V2-15_IGLJ7*01 1119
4182 VH3-23_IGHD3-9*01>3′_IGHJ6*01 1791 gnl|Fabrus|V2-15_IGLJ7*01 1119
4183 VH3-23_IGHD3-10*01>1′_IGHJ6*01 1792 gnl|Fabrus|V2-15_IGLJ7*01 1119
4184 VH3-23_IGHD3-10*01>3′_IGHJ6*01 1793 gnl|Fabrus|V2-15_IGLJ7*01 1119
4185 VH3-23_IGHD3-16*01>1′_IGHJ6*01 1794 gnl|Fabrus|V2-15_IGLJ7*01 1119
4186 VH3-23_IGHD3-16*01>3′_IGHJ6*01 1795 gnl|Fabrus|V2-15_IGLJ7*01 1119
4187 VH3-23_IGHD3-22*01>1′_IGHJ6*01 1796 gnl|Fabrus|V2-15_IGLJ7*01 1119
4188 VH3-23_IGHD4-4*01 (1) >1′_IGHJ6*01 1797 gnl|Fabrus|V2-15_IGLJ7*01 1119
4189 VH3-23_IGHD4-4*01 (1) >3′_IGHJ6*01 1798 gnl|Fabrus|V2-15_IGLJ7*01 1119
4190 VH3-23_IGHD4-11*01 (1) >1′_IGHJ6*01 1799 gnl|Fabrus|V2-15_IGLJ7*01 1119
4191 VH3-23_IGHD4-11*01 (1) >3′_IGHJ6*01 1800 gnl|Fabrus|V2-15_IGLJ7*01 1119
4192 VH3-23_IGHD4-17*01>1′_IGHJ6*01 1801 gnl|Fabrus|V2-15_IGLJ7*01 1119
4193 VH3-23_IGHD4-17*01>3′_IGHJ6*01 1802 gnl|Fabrus|V2-15_IGLJ7*01 1119
4194 VH3-23_IGHD4-23*01>1′_IGHJ6*01 1803 gnl|Fabrus|V2-15_IGLJ7*01 1119
4195 VH3-23_IGHD4-23*01>3′_IGHJ6*01 1804 gnl|Fabrus|V2-15_IGLJ7*01 1119
4196 VH3-23_IGHD5-5*01 (2) >1′_IGHJ6*01 1805 gnl|Fabrus|V2-15_IGLJ7*01 1119
4197 VH3-23_IGHD5-5*01 (2) >3′_IGHJ6*01 1806 gnl|Fabrus|V2-15_IGLJ7*01 1119
4198 VH3-23_IGHD5-12*01>1′_IGHJ6*01 1807 gnl|Fabrus|V2-15_IGLJ7*01 1119
4199 VH3-23_IGHD5-12*01>3′_IGHJ6*01 1808 gnl|Fabrus|V2-15_IGLJ7*01 1119
4200 VH3-23_IGHD5-18*01 (2) >1′_IGHJ6*01 1809 gnl|Fabrus|V2-15_IGLJ7*01 1119
4201 VH3-23_IGHD5-18*01 (2) >3′_IGHJ6*01 1810 gnl|Fabrus|V2-15_IGLJ7*01 1119
4202 VH3-23_IGHD5-24*01>1′_IGHJ6*01 1811 gnl|Fabrus|V2-15_IGLJ7*01 1119
4203 VH3-23_IGHD5-24*01>3′_IGHJ6*01 1812 gnl|Fabrus|V2-15_IGLJ7*01 1119
4204 VH3-23_IGHD6-6*01>1′_IGHJ6*01 1813 gnl|Fabrus|V2-15_IGLJ7*01 1119
4205 VH3-23_IGHD6-6*01>2′_IGHJ6*01 1814 gnl|Fabrus|V2-15_IGLJ7*01 1119
4206 VH3-23_IGHD6-6*01>3′_IGHJ6*01 1815 gnl|Fabrus|V2-15_IGLJ7*01 1119
4207 VH3-23_IGHD1-1*01>1_IGHJ6*01 1711 gnl|Fabrus|V2-17_IGLJ2*01 1120
4208 VH3-23_IGHD1-1*01>2_IGHJ6*01 1712 gnl|Fabrus|V2-17_IGLJ2*01 1120
4209 VH3-23_IGHD1-1*01>3_IGHJ6*01 1713 gnl|Fabrus|V2-17_IGLJ2*01 1120
4210 VH3-23_IGHD1-7*01>1_IGHJ6*01 1714 gnl|Fabrus|V2-17_IGLJ2*01 1120
4211 VH3-23_IGHD1-7*01>3_IGHJ6*01 1715 gnl|Fabrus|V2-17_IGLJ2*01 1120
4212 VH3-23_IGHD1-14*01>1_IGHJ6*01 1716 gnl|Fabrus|V2-17_IGLJ2*01 1120
4213 VH3-23_IGHD1-14*01>3_IGHJ6*01 1717 gnl|Fabrus|V2-17_IGLJ2*01 1120
4214 VH3-23_IGHD1-20*01>1_IGHJ6*01 1718 gnl|Fabrus|V2-17_IGLJ2*01 1120
4215 VH3-23_IGHD1-20*01>3_IGHJ6*01 1719 gnl|Fabrus|V2-17_IGLJ2*01 1120
4216 VH3-23_IGHD1-26*01>1_IGHJ6*01 1720 gnl|Fabrus|V2-17_IGLJ2*01 1120
4217 VH3-23_IGHD1-26*01>3_IGHJ6*01 1721 gnl|Fabrus|V2-17_IGLJ2*01 1120
4218 VH3-23_IGHD2-2*01>2_IGHJ6*01 1722 gnl|Fabrus|V2-17_IGLJ2*01 1120
4219 VH3-23_IGHD2-2*01>3_IGHJ6*01 1723 gnl|Fabrus|V2-17_IGLJ2*01 1120
4220 VH3-23_IGHD2-8*01>2_IGHJ6*01 1724 gnl|Fabrus|V2-17_IGLJ2*01 1120
4221 VH3-23_IGHD2-8*01>3_IGHJ6*01 1725 gnl|Fabrus|V2-17_IGLJ2*01 1120
4222 VH3-23_IGHD2-15*01>2_IGHJ6*01 1726 gnl|Fabrus|V2-17_IGLJ2*01 1120
4223 VH3-23_IGHD2-15*01>3_IGHJ6*01 1727 gnl|Fabrus|V2-17_IGLJ2*01 1120
4224 VH3-23_IGHD2-21*01>2_IGHJ6*01 1728 gnl|Fabrus|V2-17_IGLJ2*01 1120
4225 VH3-23_IGHD2-21*01>3_IGHJ6*01 1729 gnl|Fabrus|V2-17_IGLJ2*01 1120
4226 VH3-23_IGHD3-3*01>1_IGHJ6*01 1730 gnl|Fabrus|V2-17_IGLJ2*01 1120
4227 VH3-23_IGHD3-3*01>2_IGHJ6*01 1731 gnl|Fabrus|V2-17_IGLJ2*01 1120
4228 VH3-23_IGHD3-3*01>3_IGHJ6*01 1732 gnl|Fabrus|V2-17_IGLJ2*01 1120
4229 VH3-23_IGHD3-9*01>2_IGHJ6*01 1733 gnl|Fabrus|V2-17_IGLJ2*01 1120
4230 VH3-23_IGHD3-10*01>2_IGHJ6*01 1734 gnl|Fabrus|V2-17_IGLJ2*01 1120
4231 VH3-23_IGHD3-10*01>3_IGHJ6*01 1735 gnl|Fabrus|V2-17_IGLJ2*01 1120
4232 VH3-23_IGHD3-16*01>2_IGHJ6*01 1736 gnl|Fabrus|V2-17_IGLJ2*01 1120
4233 VH3-23_IGHD3-16*01>3_IGHJ6*01 1737 gnl|Fabrus|V2-17_IGLJ2*01 1120
4234 VH3-23_IGHD3-22*01>2_IGHJ6*01 1738 gnl|Fabrus|V2-17_IGLJ2*01 1120
4235 VH3-23_IGHD3-22*01>3_IGHJ6*01 1739 gnl|Fabrus|V2-17_IGLJ2*01 1120
4236 VH3-23_IGHD4-4*01 (1) >2_IGHJ6*01 1740 gnl|Fabrus|V2-17_IGLJ2*01 1120
4237 VH3-23_IGHD4-4*01 (1) >3_IGHJ6*01 1741 gnl|Fabrus|V2-17_IGLJ2*01 1120
4238 VH3-23_IGHD4-11*01 (1) >2_IGHJ6*01 1742 gnl|Fabrus|V2-17_IGLJ2*01 1120
4239 VH3-23_IGHD4-11*01 (1) >3_IGHJ6*01 1743 gnl|Fabrus|V2-17_IGLJ2*01 1120
4240 VH3-23_IGHD4-17*01>2_IGHJ6*01 1744 gnl|Fabrus|V2-17_IGLJ2*01 1120
4241 VH3-23_IGHD4-17*01>3_IGHJ6*01 1745 gnl|Fabrus|V2-17_IGLJ2*01 1120
4242 VH3-23_IGHD4-23*01>2_IGHJ6*01 1746 gnl|Fabrus|V2-17_IGLJ2*01 1120
4243 VH3-23_IGHD4-23*01>3_IGHJ6*01 1747 gnl|Fabrus|V2-17_IGLJ2*01 1120
4244 VH3-23_IGHD5-5*01 (2) >1_IGHJ6*01 1748 gnl|Fabrus|V2-17_IGLJ2*01 1120
4245 VH3-23_IGHD5-5*01 (2) >2_IGHJ6*01 1749 gnl|Fabrus|V2-17_IGLJ2*01 1120
4246 VH3-23_IGHD5-5*01 (2) >3_IGHJ6*01 1750 gnl|Fabrus|V2-17_IGLJ2*01 1120
4247 VH3-23_IGHD5-12*01>1_IGHJ6*01 1751 gnl|Fabrus|V2-17_IGLJ2*01 1120
4248 VH3-23_IGHD5-12*01>3_IGHJ6*01 1752 gnl|Fabrus|V2-17_IGLJ2*01 1120
4249 VH3-23_IGHD5-18*01 (2) >1_IGHJ6*01 1753 gnl|Fabrus|V2-17_IGLJ2*01 1120
4250 VH3-23_IGHD5-18*01 (2) >2_IGHJ6*01 1754 gnl|Fabrus|V2-17_IGLJ2*01 1120
4251 VH3-23_IGHD5-18*01 (2) >3_IGHJ6*01 1755 gnl|Fabrus|V2-17_IGLJ2*01 1120
4252 VH3-23_IGHD5-24*01>1_IGHJ6*01 1756 gnl|Fabrus|V2-17_IGLJ2*01 1120
4253 VH3-23_IGHD5-24*01>3_IGHJ6*01 1757 gnl|Fabrus|V2-17_IGLJ2*01 1120
4254 VH3-23_IGHD6-6*01>1_IGHJ6*01 1758 gnl|Fabrus|V2-17_IGLJ2*01 1120
4255 VH3-23_IGHD1-1*01>1′_IGHJ6*01 1768 gnl|Fabrus|V2-17_IGLJ2*01 1120
4256 VH3-23_IGHD1-1*01>2′_IGHJ6*01 1769 gnl|Fabrus|V2-17_IGLJ2*01 1120
4257 VH3-23_IGHD1-1*01>3′_IGHJ6*01 1770 gnl|Fabrus|V2-17_IGLJ2*01 1120
4258 VH3-23_IGHD1-7*01>1′_IGHJ6*01 1771 gnl|Fabrus|V2-17_IGLJ2*01 1120
4259 VH3-23_IGHD1-7*01>3′_IGHJ6*01 1772 gnl|Fabrus|V2-17_IGLJ2*01 1120
4260 VH3-23_IGHD1-14*01>1′_IGHJ6*01 1773 gnl|Fabrus|V2-17_IGLJ2*01 1120
4261 VH3-23_IGHD1-14*01>2′_IGHJ6*01 1774 gnl|Fabrus|V2-17_IGLJ2*01 1120
4262 VH3-23_IGHD1-14*01>3′_IGHJ6*01 1775 gnl|Fabrus|V2-17_IGLJ2*01 1120
4263 VH3-23_IGHD1-20*01>1′_IGHJ6*01 1776 gnl|Fabrus|V2-17_IGLJ2*01 1120
4264 VH3-23_IGHD1-20*01>2′_IGHJ6*01 1777 gnl|Fabrus|V2-17_IGLJ2*01 1120
4265 VH3-23_IGHD1-20*01>3′_IGHJ6*01 1778 gnl|Fabrus|V2-17_IGLJ2*01 1120
4266 VH3-23_IGHD1-26*01>1′_IGHJ6*01 1779 gnl|Fabrus|V2-17_IGLJ2*01 1120
4267 VH3-23_IGHD1-26*01>1_IGHJ6*01_B 1780 gnl|Fabrus|V2-17_IGLJ2*01 1120
4268 VH3-23_IGHD2-2*01>2_IGHJ6*01_B 1781 gnl|Fabrus|V2-17_IGLJ2*01 1120
4269 VH3-23_IGHD2-2*01>3′_IGHJ6*01 1782 gnl|Fabrus|V2-17_IGLJ2*01 1120
4270 VH3-23_IGHD2-8*01>1′_IGHJ6*01 1783 gnl|Fabrus|V2-17_IGLJ2*01 1120
4271 VH3-23_IGHD2-15*01>1′_IGHJ6*01 1784 gnl|Fabrus|V2-17_IGLJ2*01 1120
4272 VH3-23_IGHD2-15*01>3′_IGHJ6*01 1785 gnl|Fabrus|V2-17_IGLJ2*01 1120
4273 VH3-23_IGHD2-21*01>1′_IGHJ6*01 1786 gnl|Fabrus|V2-17_IGLJ2*01 1120
4274 VH3-23_IGHD2-21*01>3′_IGHJ6*01 1787 gnl|Fabrus|V2-17_IGLJ2*01 1120
4275 VH3-23_IGHD3-3*01>1′_IGHJ6*01 1788 gnl|Fabrus|V2-17_IGLJ2*01 1120
4276 VH3-23_IGHD3-3*01>3′_IGHJ6*01 1789 gnl|Fabrus|V2-17_IGLJ2*01 1120
4277 VH3-23_IGHD3-9*01>1′_IGHJ6*01 1790 gnl|Fabrus|V2-17_IGLJ2*01 1120
4278 VH3-23_IGHD3-9*01>3′_IGHJ6*01 1791 gnl|Fabrus|V2-17_IGLJ2*01 1120
4279 VH3-23_IGHD3-10*01>1′_IGHJ6*01 1792 gnl|Fabrus|V2-17_IGLJ2*01 1120
4280 VH3-23_IGHD3-10*01>3′_IGHJ6*01 1793 gnl|Fabrus|V2-17_IGLJ2*01 1120
4281 VH3-23_IGHD3-16*01>1′_IGHJ6*01 1794 gnl|Fabrus|V2-17_IGLJ2*01 1120
4282 VH3-23_IGHD3-16*01>3′_IGHJ6*01 1795 gnl|Fabrus|V2-17_IGLJ2*01 1120
4283 VH3-23_IGHD3-22*01>1′_IGHJ6*01 1796 gnl|Fabrus|V2-17_IGLJ2*01 1120
4284 VH3-23_IGHD4-4*01 (1) >1′_IGHJ6*01 1797 gnl|Fabrus|V2-17_IGLJ2*01 1120
4285 VH3-23_IGHD4-4*01 (1) >3′_IGHJ6*01 1798 gnl|Fabrus|V2-17_IGLJ2*01 1120
4286 VH3-23_IGHD4-11*01 (1) >1′_IGHJ6*01 1799 gnl|Fabrus|V2-17_IGLJ2*01 1120
4287 VH3-23_IGHD4-11*01 (1) >3′_IGHJ6*01 1800 gnl|Fabrus|V2-17_IGLJ2*01 1120
4288 VH3-23_IGHD4-17*01>1′_IGHJ6*01 1801 gnl|Fabrus|V2-17_IGLJ2*01 1120
4289 VH3-23_IGHD4-17*01>3′_IGHJ6*01 1802 gnl|Fabrus|V2-17_IGLJ2*01 1120
4290 VH3-23_IGHD4-23*01>1′_IGHJ6*01 1803 gnl|Fabrus|V2-17_IGLJ2*01 1120
4291 VH3-23_IGHD4-23*01>3′_IGHJ6*01 1804 gnl|Fabrus|V2-17_IGLJ2*01 1120
4292 VH3-23_IGHD5-5*01 (2) >1′_IGHJ6*01 1805 gnl|Fabrus|V2-17_IGLJ2*01 1120
4293 VH3-23_IGHD5-5*01 (2) >3′_IGHJ6*01 1806 gnl|Fabrus|V2-17_IGLJ2*01 1120
4294 VH3-23_IGHD5-12*01>1′_IGHJ6*01 1807 gnl|Fabrus|V2-17_IGLJ2*01 1120
4295 VH3-23_IGHD5-12*01>3′_IGHJ6*01 1808 gnl|Fabrus|V2-17_IGLJ2*01 1120
4296 VH3-23_IGHD5-18*01 (2) >1′_IGHJ6*01 1809 gnl|Fabrus|V2-17_IGLJ2*01 1120
4297 VH3-23_IGHD5-18*01 (2) >3′_IGHJ6*01 1810 gnl|Fabrus|V2-17_IGLJ2*01 1120
4298 VH3-23_IGHD5-24*01>1′_IGHJ6*01 1811 gnl|Fabrus|V2-17_IGLJ2*01 1120
4299 VH3-23_IGHD5-24*01>3′_IGHJ6*01 1812 gnl|Fabrus|V2-17_IGLJ2*01 1120
4300 VH3-23_IGHD6-6*01>1′_IGHJ6*01 1813 gnl|Fabrus|V2-17_IGLJ2*01 1120
4301 VH3-23_IGHD6-6*01>2′_IGHJ6*01 1814 gnl|Fabrus|V2-17_IGLJ2*01 1120
4302 VH3-23_IGHD6-6*01>3′_IGHJ6*01 1815 gnl|Fabrus|V2-17_IGLJ2*01 1120
4303 VH3-23_IGHD1-1*01>1_IGHJ6*01 1711 gnl|Fabrus|V2-6_IGLJ4*01 1122
4304 VH3-23_IGHD1-1*01>2_IGHJ6*01 1712 gnl|Fabrus|V2-6_IGLJ4*01 1122
4305 VH3-23_IGHD1-1*01>3_IGHJ6*01 1713 gnl|Fabrus|V2-6_IGLJ4*01 1122
4306 VH3-23_IGHD1-7*01>1_IGHJ6*01 1714 gnl|Fabrus|V2-6_IGLJ4*01 1122
4307 VH3-23_IGHD1-7*01>3_IGHJ6*01 1715 gnl|Fabrus|V2-6_IGLJ4*01 1122
4308 VH3-23_IGHD1-14*01>1_IGHJ6*01 1716 gnl|Fabrus|V2-6_IGLJ4*01 1122
4309 VH3-23_IGHD1-14*01>3_IGHJ6*01 1717 gnl|Fabrus|V2-6_IGLJ4*01 1122
4310 VH3-23_IGHD1-20*01>1_IGHJ6*01 1718 gnl|Fabrus|V2-6_IGLJ4*01 1122
4311 VH3-23_IGHD1-20*01>3_IGHJ6*01 1719 gnl|Fabrus|V2-6_IGLJ4*01 1122
4312 VH3-23_IGHD1-26*01>1_IGHJ6*01 1720 gnl|Fabrus|V2-6_IGLJ4*01 1122
4313 VH3-23_IGHD1-26*01>3_IGHJ6*01 1721 gnl|Fabrus|V2-6_IGLJ4*01 1122
4314 VH3-23_IGHD2-2*01>2_IGHJ6*01 1722 gnl|Fabrus|V2-6_IGLJ4*01 1122
4315 VH3-23_IGHD2-2*01>3_IGHJ6*01 1723 gnl|Fabrus|V2-6_IGLJ4*01 1122
4316 VH3-23_IGHD2-8*01>2_IGHJ6*01 1724 gnl|Fabrus|V2-6_IGLJ4*01 1122
4317 VH3-23_IGHD2-8*01>3_IGHJ6*01 1725 gnl|Fabrus|V2-6_IGLJ4*01 1122
4318 VH3-23_IGHD2-15*01>2_IGHJ6*01 1726 gnl|Fabrus|V2-6_IGLJ4*01 1122
4319 VH3-23_IGHD2-15*01>3_IGHJ6*01 1727 gnl|Fabrus|V2-6_IGLJ4*01 1122
4320 VH3-23_IGHD2-21*01>2_IGHJ6*01 1728 gnl|Fabrus|V2-6_IGLJ4*01 1122
4321 VH3-23_IGHD2-21*01>3_IGHJ6*01 1729 gnl|Fabrus|V2-6_IGLJ4*01 1122
4322 VH3-23_IGHD3-3*01>1_IGHJ6*01 1730 gnl|Fabrus|V2-6_IGLJ4*01 1122
4323 VH3-23_IGHD3-3*01>2_IGHJ6*01 1731 gnl|Fabrus|V2-6_IGLJ4*01 1122
4324 VH3-23_IGHD3-3*01>3_IGHJ6*01 1732 gnl|Fabrus|V2-6_IGLJ4*01 1122
4325 VH3-23_IGHD3-9*01>2_IGHJ6*01 1733 gnl|Fabrus|V2-6_IGLJ4*01 1122
4326 VH3-23_IGHD3-10*01>2_IGHJ6*01 1734 gnl|Fabrus|V2-6_IGLJ4*01 1122
4327 VH3-23_IGHD3-10*01>3_IGHJ6*01 1735 gnl|Fabrus|V2-6_IGLJ4*01 1122
4328 VH3-23_IGHD3-16*01>2_IGHJ6*01 1736 gnl|Fabrus|V2-6_IGLJ4*01 1122
4329 VH3-23_IGHD3-16*01>3_IGHJ6*01 1737 gnl|Fabrus|V2-6_IGLJ4*01 1122
4330 VH3-23_IGHD3-22*01>2_IGHJ6*01 1738 gnl|Fabrus|V2-6_IGLJ4*01 1122
4331 VH3-23_IGHD3-22*01>3_IGHJ6*01 1739 gnl|Fabrus|V2-6_IGLJ4*01 1122
4332 VH3-23_IGHD4-4*01 (1) >2_IGHJ6*01 1740 gnl|Fabrus|V2-6_IGLJ4*01 1122
4333 VH3-23_IGHD4-4*01 (1) >3_IGHJ6*01 1741 gnl|Fabrus|V2-6_IGLJ4*01 1122
4334 VH3-23_IGHD4-11*01 (1) >2_IGHJ6*01 1742 gnl|Fabrus|V2-6_IGLJ4*01 1122
4335 VH3-23_IGHD4-11*01 (1) >3_IGHJ6*01 1743 gnl|Fabrus|V2-6_IGLJ4*01 1122
4336 VH3-23_IGHD4-17*01>2_IGHJ6*01 1744 gnl|Fabrus|V2-6_IGLJ4*01 1122
4337 VH3-23_IGHD4-17*01>3_IGHJ6*01 1745 gnl|Fabrus|V2-6_IGLJ4*01 1122
4338 VH3-23_IGHD4-23*01>2_IGHJ6*01 1746 gnl|Fabrus|V2-6_IGLJ4*01 1122
4339 VH3-23_IGHD4-23*01>3_IGHJ6*01 1747 gnl|Fabrus|V2-6_IGLJ4*01 1122
4340 VH3-23_IGHD5-5*01 (2) >1_IGHJ6*01 1748 gnl|Fabrus|V2-6_IGLJ4*01 1122
4341 VH3-23_IGHD5-5*01 (2) >2_IGHJ6*01 1749 gnl|Fabrus|V2-6_IGLJ4*01 1122
4342 VH3-23_IGHD5-5*01 (2) >3_IGHJ6*01 1750 gnl|Fabrus|V2-6_IGLJ4*01 1122
4343 VH3-23_IGHD5-12*01>1_IGHJ6*01 1751 gnl|Fabrus|V2-6_IGLJ4*01 1122
4344 VH3-23_IGHD5-12*01>3_IGHJ6*01 1752 gnl|Fabrus|V2-6_IGLJ4*01 1122
4345 VH3-23_IGHD5-18*01 (2) >1_IGHJ6*01 1753 gnl|Fabrus|V2-6_IGLJ4*01 1122
4346 VH3-23_IGHD5-18*01 (2) >2_IGHJ6*01 1754 gnl|Fabrus|V2-6_IGLJ4*01 1122
4347 VH3-23_IGHD5-18*01 (2) >3_IGHJ6*01 1755 gnl|Fabrus|V2-6_IGLJ4*01 1122
4348 VH3-23_IGHD5-24*01>1_IGHJ6*01 1756 gnl|Fabrus|V2-6_IGLJ4*01 1122
4349 VH3-23_IGHD5-24*01>3_IGHJ6*01 1757 gnl|Fabrus|V2-6_IGLJ4*01 1122
4350 VH3-23_IGHD6-6*01>1_IGHJ6*01 1758 gnl|Fabrus|V2-6_IGLJ4*01 1122
4351 VH3-23_IGHD1-1*01>1′_IGHJ6*01 1768 gnl|Fabrus|V2-6_IGLJ4*01 1122
4352 VH3-23_IGHD1-1*01>2′_IGHJ6*01 1769 gnl|Fabrus|V2-6_IGLJ4*01 1122
4353 VH3-23_IGHD1-1*01>3′_IGHJ6*01 1770 gnl|Fabrus|V2-6_IGLJ4*01 1122
4354 VH3-23_IGHD1-7*01>1′_IGHJ6*01 1771 gnl|Fabrus|V2-6_IGLJ4*01 1122
4355 VH3-23_IGHD1-7*01>3′_IGHJ6*01 1772 gnl|Fabrus|V2-6_IGLJ4*01 1122
4356 VH3-23_IGHD1-14*01>1′_IGHJ6*01 1773 gnl|Fabrus|V2-6_IGLJ4*01 1122
4357 VH3-23_IGHD1-14*01>2′_IGHJ6*01 1774 gnl|Fabrus|V2-6_IGLJ4*01 1122
4358 VH3-23_IGHD1-14*01>3′_IGHJ6*01 1775 gnl|Fabrus|V2-6_IGLJ4*01 1122
4359 VH3-23_IGHD1-20*01>1′_IGHJ6*01 1776 gnl|Fabrus|V2-6_IGLJ4*01 1122
4360 VH3-23_IGHD1-20*01>2′_IGHJ6*01 1777 gnl|Fabrus|V2-6_IGLJ4*01 1122
4361 VH3-23_IGHD1-20*01>3′_IGHJ6*01 1778 gnl|Fabrus|V2-6_IGLJ4*01 1122
4362 VH3-23_IGHD1-26*01>1′_IGHJ6*01 1779 gnl|Fabrus|V2-6_IGLJ4*01 1122
4363 VH3-23_IGHD1-26*01>1_IGHJ6*01_B 1780 gnl|Fabrus|V2-6_IGLJ4*01 1122
4364 VH3-23_IGHD2-2*01>2_IGHJ6*01_B 1781 gnl|Fabrus|V2-6_IGLJ4*01 1122
4365 VH3-23_IGHD2-2*01>3′_IGHJ6*01 1782 gnl|Fabrus|V2-6_IGLJ4*01 1122
4366 VH3-23_IGHD2-8*01>1′_IGHJ6*01 1783 gnl|Fabrus|V2-6_IGLJ4*01 1122
4367 VH3-23_IGHD2-15*01>1′_IGHJ6*01 1784 gnl|Fabrus|V2-6_IGLJ4*01 1122
4368 VH3-23_IGHD2-15*01>3′_IGHJ6*01 1785 gnl|Fabrus|V2-6_IGLJ4*01 1122
4369 VH3-23_IGHD2-21*01>1′_IGHJ6*01 1786 gnl|Fabrus|V2-6_IGLJ4*01 1122
4370 VH3-23_IGHD2-21*01>3′_IGHJ6*01 1787 gnl|Fabrus|V2-6_IGLJ4*01 1122
4371 VH3-23_IGHD3-3*01>1′_IGHJ6*01 1788 gnl|Fabrus|V2-6_IGLJ4*01 1122
4372 VH3-23_IGHD3-3*01>3′_IGHJ6*01 1789 gnl|Fabrus|V2-6_IGLJ4*01 1122
4373 VH3-23_IGHD3-9*01>1′_IGHJ6*01 1790 gnl|Fabrus|V2-6_IGLJ4*01 1122
4374 VH3-23_IGHD3-9*01>3′_IGHJ6*01 1791 gnl|Fabrus|V2-6_IGLJ4*01 1122
4375 VH3-23_IGHD3-10*01>1′_IGHJ6*01 1792 gnl|Fabrus|V2-6_IGLJ4*01 1122
4376 VH3-23_IGHD3-10*01>3′_IGHJ6*01 1793 gnl|Fabrus|V2-6_IGLJ4*01 1122
4377 VH3-23_IGHD3-16*01>1′_IGHJ6*01 1794 gnl|Fabrus|V2-6_IGLJ4*01 1122
4378 VH3-23_IGHD3-16*01>3′_IGHJ6*01 1795 gnl|Fabrus|V2-6_IGLJ4*01 1122
4379 VH3-23_IGHD3-22*01>1′_IGHJ6*01 1796 gnl|Fabrus|V2-6_IGLJ4*01 1122
4380 VH3-23_IGHD4-4*01 (1) >1′_IGHJ6*01 1797 gnl|Fabrus|V2-6_IGLJ4*01 1122
4381 VH3-23_IGHD4-4*01 (1) >3′_IGHJ6*01 1798 gnl|Fabrus|V2-6_IGLJ4*01 1122
4382 VH3-23_IGHD4-11*01 (1) >1′_IGHJ6*01 1799 gnl|Fabrus|V2-6_IGLJ4*01 1122
4383 VH3-23_IGHD4-11*01 (1) >3′_IGHJ6*01 1800 gnl|Fabrus|V2-6_IGLJ4*01 1122
4384 VH3-23_IGHD4-17*01>1′_IGHJ6*01 1801 gnl|Fabrus|V2-6_IGLJ4*01 1122
4385 VH3-23_IGHD4-17*01>3′_IGHJ6*01 1802 gnl|Fabrus|V2-6_IGLJ4*01 1122
4386 VH3-23_IGHD4-23*01>1′_IGHJ6*01 1803 gnl|Fabrus|V2-6_IGLJ4*01 1122
4387 VH3-23_IGHD4-23*01>3′_IGHJ6*01 1804 gnl|Fabrus|V2-6_IGLJ4*01 1122
4388 VH3-23_IGHD5-5*01 (2) >1′_IGHJ6*01 1805 gnl|Fabrus|V2-6_IGLJ4*01 1122
4389 VH3-23_IGHD5-5*01 (2) >3′_IGHJ6*01 1806 gnl|Fabrus|V2-6_IGLJ4*01 1122
4390 VH3-23_IGHD5-12*01>1′_IGHJ6*01 1807 gnl|Fabrus|V2-6_IGLJ4*01 1122
4391 VH3-23_IGHD5-12*01>3′_IGHJ6*01 1808 gnl|Fabrus|V2-6_IGLJ4*01 1122
4392 VH3-23_IGHD5-18*01 (2) >1′_IGHJ6*01 1809 gnl|Fabrus|V2-6_IGLJ4*01 1122
4393 VH3-23_IGHD5-18*01 (2) >3′_IGHJ6*01 1810 gnl|Fabrus|V2-6_IGLJ4*01 1122
4394 VH3-23_IGHD5-24*01>1′_IGHJ6*01 1811 gnl|Fabrus|V2-6_IGLJ4*01 1122
4395 VH3-23_IGHD5-24*01>3′_IGHJ6*01 1812 gnl|Fabrus|V2-6_IGLJ4*01 1122
4396 VH3-23_IGHD6-6*01>1′_IGHJ6*01 1813 gnl|Fabrus|V2-6_IGLJ4*01 1122
4397 VH3-23_IGHD6-6*01>2′_IGHJ6*01 1814 gnl|Fabrus|V2-6_IGLJ4*01 1122
4398 VH3-23_IGHD6-6*01>3′_IGHJ6*01 1815 gnl|Fabrus|V2-6_IGLJ4*01 1122
4399 VH3-23_IGHD1-1*01>1_IGHJ6*01 1711 gnl|Fabrus|V2-7_IGLJ2*01 1123
4400 VH3-23_IGHD1-1*01>2_IGHJ6*01 1712 gnl|Fabrus|V2-7_IGLJ2*01 1123
4401 VH3-23_IGHD1-1*01>3_IGHJ6*01 1713 gnl|Fabrus|V2-7_IGLJ2*01 1123
4402 VH3-23_IGHD1-7*01>1_IGHJ6*01 1714 gnl|Fabrus|V2-7_IGLJ2*01 1123
4403 VH3-23_IGHD1-7*01>3_IGHJ6*01 1715 gnl|Fabrus|V2-7_IGLJ2*01 1123
4404 VH3-23_IGHD1-14*01>1_IGHJ6*01 1716 gnl|Fabrus|V2-7_IGLJ2*01 1123
4405 VH3-23_IGHD1-14*01>3_IGHJ6*01 1717 gnl|Fabrus|V2-7_IGLJ2*01 1123
4406 VH3-23_IGHD1-20*01>1_IGHJ6*01 1718 gnl|Fabrus|V2-7_IGLJ2*01 1123
4407 VH3-23_IGHD1-20*01>3_IGHJ6*01 1719 gnl|Fabrus|V2-7_IGLJ2*01 1123
4408 VH3-23_IGHD1-26*01>1_IGHJ6*01 1720 gnl|Fabrus|V2-7_IGLJ2*01 1123
4409 VH3-23_IGHD1-26*01>3_IGHJ6*01 1721 gnl|Fabrus|V2-7_IGLJ2*01 1123
4410 VH3-23_IGHD2-2*01>2_IGHJ6*01 1722 gnl|Fabrus|V2-7_IGLJ2*01 1123
4411 VH3-23_IGHD2-2*01>3_IGHJ6*01 1723 gnl|Fabrus|V2-7_IGLJ2*01 1123
4412 VH3-23_IGHD2-8*01>2_IGHJ6*01 1724 gnl|Fabrus|V2-7_IGLJ2*01 1123
4413 VH3-23_IGHD2-8*01>3_IGHJ6*01 1725 gnl|Fabrus|V2-7_IGLJ2*01 1123
4414 VH3-23_IGHD2-15*01>2_IGHJ6*01 1726 gnl|Fabrus|V2-7_IGLJ2*01 1123
4415 VH3-23_IGHD2-15*01>3_IGHJ6*01 1727 gnl|Fabrus|V2-7_IGLJ2*01 1123
4416 VH3-23_IGHD2-21*01>2_IGHJ6*01 1728 gnl|Fabrus|V2-7_IGLJ2*01 1123
4417 VH3-23_IGHD2-21*01>3_IGHJ6*01 1729 gnl|Fabrus|V2-7_IGLJ2*01 1123
4418 VH3-23_IGHD3-3*01>1_IGHJ6*01 1730 gnl|Fabrus|V2-7_IGLJ2*01 1123
4419 VH3-23_IGHD3-3*01>2_IGHJ6*01 1731 gnl|Fabrus|V2-7_IGLJ2*01 1123
4420 VH3-23_IGHD3-3*01>3_IGHJ6*01 1732 gnl|Fabrus|V2-7_IGLJ2*01 1123
4421 VH3-23_IGHD3-9*01>2_IGHJ6*01 1733 gnl|Fabrus|V2-7_IGLJ2*01 1123
4422 VH3-23_IGHD3-10*01>2_IGHJ6*01 1734 gnl|Fabrus|V2-7_IGLJ2*01 1123
4423 VH3-23_IGHD3-10*01>3_IGHJ6*01 1735 gnl|Fabrus|V2-7_IGLJ2*01 1123
4424 VH3-23_IGHD3-16*01>2_IGHJ6*01 1736 gnl|Fabrus|V2-7_IGLJ2*01 1123
4425 VH3-23_IGHD3-16*01>3_IGHJ6*01 1737 gnl|Fabrus|V2-7_IGLJ2*01 1123
4426 VH3-23_IGHD3-22*01>2_IGHJ6*01 1738 gnl|Fabrus|V2-7_IGLJ2*01 1123
4427 VH3-23_IGHD3-22*01>3_IGHJ6*01 1739 gnl|Fabrus|V2-7_IGLJ2*01 1123
4428 VH3-23_IGHD4-4*01 (1) >2_IGHJ6*01 1740 gnl|Fabrus|V2-7_IGLJ2*01 1123
4429 VH3-23_IGHD4-4*01 (1) >3_IGHJ6*01 1741 gnl|Fabrus|V2-7_IGLJ2*01 1123
4430 VH3-23_IGHD4-11*01 (1) >2_IGHJ6*01 1742 gnl|Fabrus|V2-7_IGLJ2*01 1123
4431 VH3-23_IGHD4-11*01 (1) >3_IGHJ6*01 1743 gnl|Fabrus|V2-7_IGLJ2*01 1123
4432 VH3-23_IGHD4-17*01>2_IGHJ6*01 1744 gnl|Fabrus|V2-7_IGLJ2*01 1123
4433 VH3-23_IGHD4-17*01>3_IGHJ6*01 1745 gnl|Fabrus|V2-7_IGLJ2*01 1123
4434 VH3-23_IGHD4-23*01>2_IGHJ6*01 1746 gnl|Fabrus|V2-7_IGLJ2*01 1123
4435 VH3-23_IGHD4-23*01>3_IGHJ6*01 1747 gnl|Fabrus|V2-7_IGLJ2*01 1123
4436 VH3-23_IGHD5-5*01 (2) >1_IGHJ6*01 1748 gnl|Fabrus|V2-7_IGLJ2*01 1123
4437 VH3-23_IGHD5-5*01 (2) >2_IGHJ6*01 1749 gnl|Fabrus|V2-7_IGLJ2*01 1123
4438 VH3-23_IGHD5-5*01 (2) >3_IGHJ6*01 1750 gnl|Fabrus|V2-7_IGLJ2*01 1123
4439 VH3-23_IGHD5-12*01>1_IGHJ6*01 1751 gnl|Fabrus|V2-7_IGLJ2*01 1123
4440 VH3-23_IGHD5-12*01>3_IGHJ6*01 1752 gnl|Fabrus|V2-7_IGLJ2*01 1123
4441 VH3-23_IGHD5-18*01 (2) >1_IGHJ6*01 1753 gnl|Fabrus|V2-7_IGLJ2*01 1123
4442 VH3-23_IGHD5-18*01 (2) >2_IGHJ6*01 1754 gnl|Fabrus|V2-7_IGLJ2*01 1123
4443 VH3-23_IGHD5-18*01 (2) >3_IGHJ6*01 1755 gnl|Fabrus|V2-7_IGLJ2*01 1123
4444 VH3-23_IGHD5-24*01>1_IGHJ6*01 1756 gnl|Fabrus|V2-7_IGLJ2*01 1123
4445 VH3-23_IGHD5-24*01>3_IGHJ6*01 1757 gnl|Fabrus|V2-7_IGLJ2*01 1123
4446 VH3-23_IGHD6-6*01>1_IGHJ6*01 1758 gnl|Fabrus|V2-7_IGLJ2*01 1123
4447 VH3-23_IGHD1-1*01>1′_IGHJ6*01 1768 gnl|Fabrus|V2-7_IGLJ2*01 1123
4448 VH3-23_IGHD1-1*01>2′_IGHJ6*01 1769 gnl|Fabrus|V2-7_IGLJ2*01 1123
4449 VH3-23_IGHD1-1*01>3′_IGHJ6*01 1770 gnl|Fabrus|V2-7_IGLJ2*01 1123
4450 VH3-23_IGHD1-7*01>1′_IGHJ6*01 1771 gnl|Fabrus|V2-7_IGLJ2*01 1123
4451 VH3-23_IGHD1-7*01>3′_IGHJ6*01 1772 gnl|Fabrus|V2-7_IGLJ2*01 1123
4452 VH3-23_IGHD1-14*01>1′_IGHJ6*01 1773 gnl|Fabrus|V2-7_IGLJ2*01 1123
4453 VH3-23_IGHD1-14*01>2′_IGHJ6*01 1774 gnl|Fabrus|V2-7_IGLJ2*01 1123
4454 VH3-23_IGHD1-14*01>3′_IGHJ6*01 1775 gnl|Fabrus|V2-7_IGLJ2*01 1123
4455 VH3-23_IGHD1-20*01>1′_IGHJ6*01 1776 gnl|Fabrus|V2-7_IGLJ2*01 1123
4456 VH3-23_IGHD1-20*01>2′_IGHJ6*01 1777 gnl|Fabrus|V2-7_IGLJ2*01 1123
4457 VH3-23_IGHD1-20*01>3′_IGHJ6*01 1778 gnl|Fabrus|V2-7_IGLJ2*01 1123
4458 VH3-23_IGHD1-26*01>1′_IGHJ6*01 1779 gnl|Fabrus|V2-7_IGLJ2*01 1123
4459 VH3-23_IGHD1-26*01>1_IGHJ6*01_B 1780 gnl|Fabrus|V2-7_IGLJ2*01 1123
4460 VH3-23_IGHD2-2*01>2_IGHJ6*01_B 1781 gnl|Fabrus|V2-7_IGLJ2*01 1123
4461 VH3-23_IGHD2-2*01>3′_IGHJ6*01 1782 gnl|Fabrus|V2-7_IGLJ2*01 1123
4462 VH3-23_IGHD2-8*01>1′_IGHJ6*01 1783 gnl|Fabrus|V2-7_IGLJ2*01 1123
4463 VH3-23_IGHD2-15*01>1′_IGHJ6*01 1784 gnl|Fabrus|V2-7_IGLJ2*01 1123
4464 VH3-23_IGHD2-15*01>3′_IGHJ6*01 1785 gnl|Fabrus|V2-7_IGLJ2*01 1123
4465 VH3-23_IGHD2-21*01>1′_IGHJ6*01 1786 gnl|Fabrus|V2-7_IGLJ2*01 1123
4466 VH3-23_IGHD2-21*01>3′_IGHJ6*01 1787 gnl|Fabrus|V2-7_IGLJ2*01 1123
4467 VH3-23_IGHD3-3*01>1′_IGHJ6*01 1788 gnl|Fabrus|V2-7_IGLJ2*01 1123
4468 VH3-23_IGHD3-3*01>3′_IGHJ6*01 1789 gnl|Fabrus|V2-7_IGLJ2*01 1123
4469 VH3-23_IGHD3-9*01>1′_IGHJ6*01 1790 gnl|Fabrus|V2-7_IGLJ2*01 1123
4470 VH3-23_IGHD3-9*01>3′_IGHJ6*01 1791 gnl|Fabrus|V2-7_IGLJ2*01 1123
4471 VH3-23_IGHD3-10*01>1′_IGHJ6*01 1792 gnl|Fabrus|V2-7_IGLJ2*01 1123
4472 VH3-23_IGHD3-10*01>3′_IGHJ6*01 1793 gnl|Fabrus|V2-7_IGLJ2*01 1123
4473 VH3-23_IGHD3-16*01>1′_IGHJ6*01 1794 gnl|Fabrus|V2-7_IGLJ2*01 1123
4474 VH3-23_IGHD3-16*01>3′_IGHJ6*01 1795 gnl|Fabrus|V2-7_IGLJ2*01 1123
4475 VH3-23_IGHD3-22*01>1′_IGHJ6*01 1796 gnl|Fabrus|V2-7_IGLJ2*01 1123
4476 VH3-23_IGHD4-4*01 (1) >1′_IGHJ6*01 1797 gnl|Fabrus|V2-7_IGLJ2*01 1123
4477 VH3-23_IGHD4-4*01 (1) >3′_IGHJ6*01 1798 gnl|Fabrus|V2-7_IGLJ2*01 1123
4478 VH3-23_IGHD4-11*01 (1) >1′_IGHJ6*01 1799 gnl|Fabrus|V2-7_IGLJ2*01 1123
4479 VH3-23_IGHD4-11*01 (1) >3′_IGHJ6*01 1800 gnl|Fabrus|V2-7_IGLJ2*01 1123
4480 VH3-23_IGHD4-17*01>1′_IGHJ6*01 1801 gnl|Fabrus|V2-7_IGLJ2*01 1123
4481 VH3-23_IGHD4-17*01>3′_IGHJ6*01 1802 gnl|Fabrus|V2-7_IGLJ2*01 1123
4482 VH3-23_IGHD4-23*01>1′_IGHJ6*01 1803 gnl|Fabrus|V2-7_IGLJ2*01 1123
4483 VH3-23_IGHD4-23*01>3′_IGHJ6*01 1804 gnl|Fabrus|V2-7_IGLJ2*01 1123
4484 VH3-23_IGHD5-5*01 (2) >1′_IGHJ6*01 1805 gnl|Fabrus|V2-7_IGLJ2*01 1123
4485 VH3-23_IGHD5-5*01 (2) >3′_IGHJ6*01 1806 gnl|Fabrus|V2-7_IGLJ2*01 1123
4486 VH3-23_IGHD5-12*01>1′_IGHJ6*01 1807 gnl|Fabrus|V2-7_IGLJ2*01 1123
4487 VH3-23_IGHD5-12*01>3′_IGHJ6*01 1808 gnl|Fabrus|V2-7_IGLJ2*01 1123
4488 VH3-23_IGHD5-18*01 (2) >1′_IGHJ6*01 1809 gnl|Fabrus|V2-7_IGLJ2*01 1123
4489 VH3-23_IGHD5-18*01 (2) >3′_IGHJ6*01 1810 gnl|Fabrus|V2-7_IGLJ2*01 1123
4490 VH3-23_IGHD5-24*01>1′_IGHJ6*01 1811 gnl|Fabrus|V2-7_IGLJ2*01 1123
4491 VH3-23_IGHD5-24*01>3′_IGHJ6*01 1812 gnl|Fabrus|V2-7_IGLJ2*01 1123
4492 VH3-23_IGHD6-6*01>1′_IGHJ6*01 1813 gnl|Fabrus|V2-7_IGLJ2*01 1123
4493 VH3-23_IGHD6-6*01>2′_IGHJ6*01 1814 gnl|Fabrus|V2-7_IGLJ2*01 1123
4494 VH3-23_IGHD6-6*01>3′_IGHJ6*01 1815 gnl|Fabrus|V2-7_IGLJ2*01 1123

Typically, the addressable combinatorial germline libraries are spatially arrayed in a multiwell plate, such as a 96-well plate, wherein each well of the plate corresponds to one antibody that is different from the antibodies in all the other wells. The antibodies can be immobilized to the surface of the wells of the plate or can be present in solution. Alternatively, the antibodies are attached to a solid support, such as for example, a filter, chip, slide, bead or cellulose. The antibodies can also be identifiably labeled, such as for example, with a colored, chromogenic, luminescent, chemical, fluorescent or electronic label. The combinatorial addressable germline antibody libraries can be screened for binding or activity against a target protein to identify antibodies or portions thereof that bind to a target protein and/or modulate an activity of a target protein. By virtue of the fact that these libaries are arrayed, the identity of each individual member in the collection is known during screening thereby allowing facile identification of a “Hit” antibody. Screening for binding or a functional activity can be by any method known to one of skill in the art, for example, any described in Section E.1.

For example, as described in the Examples, an addressable antibody library is exemplified to screen for “Hits” against a target antigen using an MSD electrochemiluminescence binding assay or by ELISA. Since the library was addressable, the sequence of the identified “Hit” was immediately known. A similar assay is exemplified to identify a related antibody as discussed further below.

b. Identification of a Related Antibody

In the method provided herein, comparison to a related antibody that has reduced or less activity for the target antigen than the first antibody provides information of SAR that can be used for affinity maturation herein. In the method, residues to mutagenize in the antibody to be affinity matured are identified by comparison of the amino acid sequence of the variable heavy or light chain of the first antibody (e.g.“Hit”) with the corresponding amino acid sequence of the variable heavy or light chain of a related antibody. For purposes of practice of the method herein, a related antibody has sequence similarity or identity to the “Hit” antibody across the entire sequence of the antibody (heavy and light chain), but is not itself identical in sequence to the “Hit” antibody. In addition, the related antibody exhibits less activity (e.g. binding or binding affinity) for the target antigen than the first antibody.

In the method herein, once a first antibody is chosen for affinity maturation herein as set forth above, one or more related antibodies are selected. It is not necessary that the first antibody and related antibodies are identified from the same library or even using the same screening method. All that is necessary is that the related antibody has less activity to a target antigen than the first antibody and that the related antibody exhibits sequence similarity to the antibody that is being affinity matured. For convenience, a related antibody is typically identified using the same screening method and assay system used for identification of the first antibody. Hence, any of the methods of generating an antibody, including any of the antibody libraries, described in Section C.1 above can be used for identification of a related antibody. Exemplary of an antibody library is an addressable combinatorial antibody library described above and herein in the Examples. As previously mentioned, the addressable combinatorial antibody library has the benefit of immediate knowledge of the structure-activity relationship of all members of the library for binding to a target antigen. Hence, like a “Hit” antibody, the sequence and activity of a related antibody is immediately known. Accordingly, assessment of sequence similarity between a “Hit” and related antibody can be determined almost instantaneously upon completion of a screening assay for a target antigen.

Generally, the related antibody is an antibody that exhibits 80% of less of the activity of the first antibody, generally 5% to 80% of the activity, and in particular 5% to 50% of the activity, such as 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less the activity towards the target antigen compared to the first antibody. For example, the related antibody can be an antibody that does not bind or that shows negligible binding to the target antigen for which the “Hit” antibody binds (e.g. a level of binding that is the same or similar to binding of a negative control used in the assay). Thus, a related antibody can be initially identified because it does not specifically bind to the target antigen for which the chosen first antibody specifically binds. For example, a related antibody can exhibit a binding affinity that is 10−4 M or higher, for example, 10−4 M, 10−3 M, 10−2 M, or higher. In comparing an activity (e.g. binding and/or binding affinity) of first antibody to a related antibody, the same target antigen is used and activity is assessed in the same or similar assay. In addition, corresponding forms of the antibodies are compared such that the structure of the antibody also is the same (e.g. full-length antibody or fragment thereof such as a Fab).

A related antibody that is chosen for practice of the method is related to the first antibody because it exhibits sequence similarity or identity to a first antibody across its entire sequence (heavy and light chain) or across its variable heavy or variable light chain. For example, the amino acid sequence of the variable heavy chain and/or variable light chain of the related antibody is at least 50% identical in amino acid sequence to the first antibody, generally at least 75% identical in sequence, for example it is or is about 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical in amino acid sequence to the first antibody, typically at least at or about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95% similar in sequence. The related antibody is not identical to the first antibody in both the variable heavy and light chain, but can be identical to the first antibody in one of the variable heavy or light chains and exhibit less than 100% sequence similarity in the other chain. Thus, it is understood that for practice of the method, the variable portion of the related antibody used in the method is less than 100% identical to the identified “Hit” antibody. For example, in many instances, a related antibody might exhibit 100% sequence identity to the first antibody in the variable light chain sequence, but less than 100% sequence similarity to the first antibody in the variable heavy chain sequence, while still exhibiting a requisite sequence similarity. In that instance, only the variable heavy chain sequence of the related antibody is used in the practice of the method as described herein. Any method for determining sequence similarity known to one of skill in the art can be used as described elsewhere herein, including, but not limited to, manual methods or the use of available programs such as BLAST.

For example, a related antibody can contain a variable heavy chain that is identical to the variable heavy chain of the first antibody, and a variable light chain that exhibits sequence similarity to the first antibody. In other examples, neither the variable heavy or variable light chain of the related antibody are identical to the amino acid sequence of the first antibody, but both exhibit sequence similarity to the first antibody. Thus, in some instances, a related antibody used in the method of affinity maturing the variable heavy chain of the first antibody is different from a related antibody used in the method of affinity maturing the variable light chain of the first antibody. Accordingly, more than one related antibody can be selected for practice of the method herein. For example, as exemplified in the examples, three related antibodies are selected for affinity maturation of the variable light chain. In either case, a variable chain (heavy or light) of a related antibody that exhibits sequence similarity to the corresponding heavy or light chain of the first antibody is used in the method to identify a region or regions in the first antibody that differ and thus are responsible for the differing binding abilities of the “first antibody and related antibodies. Such region or regions are targeted for affinity maturation and mutagenesis in the method herein as described further below.

Generally, the variable heavy and/or light chain of a first antibody and a related antibody are derived from the same or related, such as from the same gene family, antibody variable region germline segments. For example, a related antibody is encoded by a sequence of nucleic acids that contains one or more variable heavy chain VH, DH and/or JH germline segments or variable light chain Vκ and Jκ or Vλ and Jλ germline segments that is not identical to, but is of the same gene family, as contained in the nucleic acid sequence encoding the first antibody. Typically, a related antibody is encoded by a sequence of nucleic acids that contains identical germline segments to the nucleic acid sequence encoding the first antibody, except that 1, 2, 3, 4, or 5 of the germline segments are different or related. For example, a related antibody is encoded by a nucleic acid sequence encoding the VH or VL chain that contains the same variable heavy chain VH, and DH germline segments, or the same variable light chain Vκ or Vλ germline segments, but different or related JH, and Jκ or Jλ germline segments. As exemplified in the Examples, the variable heavy chain of a related antibody was chosen for practice of the method herein because it was encoded by a sequence of nucleic acids that contained identical variable heavy chain VH and JH germline segments (i.e., VH5-51 and IGHJ4*01) but had a different DH germline segment (i.e., IGHD5-51*01>3 versus IGHD6-25*01) compared to the sequence of nucleic acids encoding the variable heavy chain sequence of the chosen “Hit”. The sequence of the variable heavy chain of the related antibody exhibits 98% sequence similarity to the first antibody. In another example, the variable heavy chain of a related antibody was chosen for practice of the method herein because it was encoded by a sequence of nucleic acids that contained identical VH germline segments (i.e., VH1-46), but different JH germline segments (i.e., IGHJ4*01 versus IGHJ1*01), and related DH germline segments (i.e., IGHD6-13*01 versus IGHD6-6*01, sharing the same gene family IGHD6) compared to the sequence of nucleic acids encoding the variable heavy chain sequence of the chosen first antibody. The sequence of the variable heavy chain of the related antibody exhibits 95% sequence similarity to the first antibody.

One of skill in the art knows and is familiar with germline segment sequences of antibodies, and can identify the germline segment sequences encoding an antibody heavy or light chain. Exemplary antibody germline sources include but are not limited to databases at the National Center for Biotechnology Information (NCBI), the international ImMunoGeneTics information System® (IMGT), the Kabat database and the Tomlinson's VBase database (Lefranc (2003) Nucleic Acids Res., 31:307-310; Martin et al., Bioinformatics Tools for Antibody Engineering in Handbook of Therapeutic Antibodies, Wiley-VCH (2007), pp. 104-107). Germline segments also are known for non-humans. For example, an exemplary mouse germline databases is ABG database available at ibt.unam.mx/vir/v_mice.html. Germline segment sequences are known by various nomenclatures, including for example, IMGT gene names and definitions approved by the Human Genome Organization (HUGO) nomenclature committee, Lefranc, M.-P. Exp Clin Immunogenet, 18:100-116 (2001), Zachau, H. G. Immunologist, 4:49-54 (1996), Lefranc, M.-P. Exp Clin Immunogenet, 18:161-174 (2000), Kawasaki et al, Genome Res, 7:250-261 (1997), Lefranc, M.-P. Exp Clin Immunogenet, 18:242-254 (2001). Any desired naming convention can be used to identify antibody germline segments. One of skill in the art can identify a nucleic acid sequence using any desired naming convention. For example, for IMGT nomenclature, the first three letters indicate the locus (IGH, IGK or IGL), the fourth letter represents the gene (e.g., V for V-gene, D for D-gene, J for J-gene), the fifth position indicates the number of the subgroup, followed by a hyphen indicating the gene number classification. For alleles, the IMGT name is followed by an asterisk and a two figure number. U.S. Provisional Application Nos. 61/198,764 and 61/211,204 set forth exemplary human heavy chain and light chain (kappa and lambda) germline segment sequences.

c. Comparison of the Amino Acid Sequences of the First Antibody and Related Antibodies

Once a first antibody is chosen and a related antibody or antibodies are identified that have a related variable heavy chain and/or variable light chain, sequence comparison of the antibodies is effected. Comparison of the amino acid sequence of the variable heavy chain and/or the variable light chain of the parent or first antibody and the related antibody permits identification of regions that differ between the first antibody and the related antibody. Such region or regions are targeted for affinity maturation and mutagenesis.

In the method, the amino acid sequence of the VH chain and/or the VL chain of the parent first antibody is aligned to the respective VH chain or VL chain of at least one related antibody to identify regions of the polypeptide that differ, or vary, between the first antibody and related antibodies. The amino acid sequences of the antibodies can be aligned by any method commonly known in the art. The methods include manual alignment, computer assisted sequence alignment, and combinations thereof. A number of algorithms (which are generally computer implemented) for performing sequence alignment are widely available, or can be produced by one of skill. These methods include, e.g., the local homology algorithm of Smith and Waterman (1981) Adv. Appl. Math. 2:482; the homology alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443; the search for similarity method of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. (USA) 85:2444; and/or by computerized implementations of these algorithms (e.g., GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Dr., Madison, Wis.).

For example, software for performing sequence identity (and sequence similarity) analysis using the BLAST algorithm is described in Altschul et al., (1990) J. Mol. Biol. 215:403-410. This software is publicly available, e.g., through the National Center for Biotechnology Information on the world wide web at ncbi.nlm.nih.gov. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold. These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100, M=5, N=−4, and a comparison of both strands. For amino acid sequences, the BLASTP (BLAST Protein) program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see, Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915).

Additionally, the BLAST algorithm performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul (1993) Proc. Nat'l. Acad. Sci. USA 90:5873-5787). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences occurs by chance. For example, a nucleic acid is considered similar to a reference sequence (and, therefore, in this context, homologous) if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1, or less than about 0.01, and or even less than about 0.001.

An additional example of an algorithm that is suitable for multiple DNA, or amino acid, sequence alignments is the CLUSTALW program (Thompson, J. D. et al., (1994) Nucl. Acids. Res. 22: 4673-4680). CLUSTALW performs multiple pairwise comparisons between groups of sequences and assembles them into a multiple alignment based on homology. Gap open and Gap extension penalties can be, e.g., 10 and 0.05 respectively. For amino acid alignments, the BLOSUM algorithm can be used as a protein weight matrix. See, e.g., Henikoff and Henikoff (1992) Proc. Natl. Acad. Sci. USA 89: 10915-10919.

By aligning the amino acid sequences of the antibodies, one skilled in the art can identify regions that differ between the amino acid sequence of the first antibody and the related antibodies. A region that differs between the antibodies can occur along any portion of the VH chain and/or VL chain. Typically, a region that differs or varies occurs at a CDR or framework (FR) region, for example, CDR1, CDR2, CDR3, FR1, FR2, FR3 and/or FR4, and in particular in a CDR, for example CDR3. One of skill in the art knows and can identify the CDRs and FR based on Kabat or Chothia numbering (see e.g., Kabat, E. A. et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242, and Chothia, C. et al. (1987) J. Mol. Biol. 196:901-917). For example, based on Kabat numbering, CDR-L1 corresponds to residues L24-L34; CDR-L2 corresponds to residues L50-L56; CDR-L3 corresponds to residues L89-L97; CDR-H1 corresponds to residues H31-H35, 35a or 35b depending on the length; CDR-H2 corresponds to residues H50-H65; and CDR-H3 corresponds to residues H95-H102. For example, based on Kabat numbering, FR-L1 corresponds to residues L1-L23; FR-L2 corresponds to residues L35-L49; FR-L3 corresponds to residues L57-L88; FR-L4 corresponds to residues L98-L109; FR-H1 corresponds to residues H1-H30; FR-H2 corresponds to residues H36-H49; FR-H3 corresponds to residues H66-H94; and FR-H4 corresponds to residues H103-H113.

A region(s) that differs is identified as a target region because it contains at least one acid differences or variation at corresponding amino acid positions in the variable heavy chain and/or variable light chain amino acid sequence of a first antibody and a related antibody. A variant position includes an amino acid deletion, addition or substitution in the first antibody polypeptide as compared to the related antibody polypeptide. For purposes herein, an identified region contains one or more, typically two or more, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more variant amino acid positions in at least one region of a variable chain of the first antibody compared to a related antibody. In some examples, more then one region, for example, 1, 2, 3, 4 or more regions can be identified that contain at least one variant amino acid positions between a first antibody and a related antibody. Any one or more of the regions can be targeted for affinity maturation by mutagenesis. Generally, a CDR is targeted for mutagenesis.

d. Mutagenesis of an Identified Region

In the method, mutagenesis is performed on target residues within the identified target region. For example, some or up to all amino acid residues of the selected target region in the heavy chain and/or light chain of the first antibody are mutated, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more amino acid residues. Each target amino acid residue selected for mutagenesis can be mutated to all 19 other amino acid residues, or to a restricted subset thereof.

In one example, all amino acid residues in the identified target region, e.g. CDR3, can be subject to mutagenesis. In another example, a subset of amino acid residues in the selected target region can be subject to mutagenesis. For example, only the amino acid residues at positions that differ between the first antibody and related antibody are subject to mutagenesis. In another example, only the amino acid residues at positions that are the same between the first antibody and a related antibody are subject to mutagenesis. In an additional example, scanning mutagenesis is optionally performed to identify residues that increase binding to the target antigen. In such examples, only those residues that are identified as “UP” mutants as discussed below are subject to further saturation mutagenesis.

For example, typically, a CDR can contain 3 to 25 amino acid residues. All or subset of the amino acids within a CDR can be targeted for mutagenesis, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid residues can be targeted for mutagenesis. In some examples, all amino acids within a CDR are selected for mutagenesis. In other examples, only a subset of amino acids within a CDR are selected for mutagenesis. In some instances, only one amino acid residue within a CDR is selected for mutagenesis. In other instances, two or more amino acids are selected for mutagenesis.

The amino acid residues that are selected for further mutagenesis can be modified by any method known to one of skill in the art. The amino acid residues can be modified rationally or can be modified by random mutagenesis. This can be accomplished by modifying the encoding DNA. One of skill in the art is familiar with mutagenesis methods. Mutagenesis methods include, but are not limited to, site-mediated mutagenesis, PCR mutagenesis, cassette mutagenesis, site-directed mutagenesis, random point mutagenesis, mutagenesis using uracil containing templates, oligonucleotide-directed mutagenesis, phosphorothioate-modified DNA mutagenesis, mutagenesis using gapped duplex DNA, point mismatch repair, mutagenesis using repair-deficient host strains, restriction-selection and restriction-purification, deletion mutagenesis, mutagenesis by total gene synthesis, double-strand break repair, and many others known to persons of skill. See, e.g., Arnold (1993) Current Opinion in Biotechnology 4:450-455; Bass et al., (1988) Science 242:240-245; Botstein and Shortie (1985) Science 229:1193-1201; Carter et al., (1985) Nucl. Acids Res. 13: 4431-4443; Carter (1986) Biochem. J. 237:1-7; Carter (1987) Methods in Enzymol. 154: 382-403; Dale et al., (1996) Methods Mol. Biol. 57:369-374; Eghtedarzadeh and Henikoff (1986) Nucl. Acids Res. 14: 5115; Fritz et al., (1988) Nucl. Acids Res. 16: 6987-6999; Grundstrom et al., (1985) Nucl. Acids Res. 13: 3305-3316; Kunkel (1987) “The efficiency of oligonucleotide directed mutagenesis” in Nucleic Acids and Molecular Biology (Eckstein, F. and Lilley, D. M. J. eds., Springer Verlag, Berlin); Kunkel (1985) Proc. Natl. Acad. Sci. USA 82:488-492; Kunkel et al., (1987) Methods in Enzymol. 154, 367-382; Kramer et al., (1984) Nucl. Acids Res. 12: 9441-9456; Kramer and Fritz (1987) Methods in Enzymol. 154:350-367; Kramer et al., (1984) Cell 38:879-887; Kramer et al., (1988) Nucl. Acids Res. 16: 7207; Ling et al., (1997) Anal Biochem. 254(2): 157-178; Lorimer and Pastan (1995) Nucleic Acids Res. 23, 3067-8; Mandecki (1986) Proc. Natl. Acad. Sci. USA 83:7177-7181; Nakamaye and Eckstein (1986) Nucl. Acids Res. 14: 9679-9698; Nambiar et al., (1984) Science 223: 1299-1301; Sakamar and Khorana (1988) Nucl. Acids Res. 14: 6361-6372; Sayers et al., (1988) Nucl. Acids Res. 16:791-802; Sayers et al., (1988) Nucl. Acids Res. 16:803-814; Sieber et al., (2001) Nature Biotechnology 19:456-460; Smith (1985) Ann. Rev. Genet. 19:423-462; Stemmer (1994) Nature 370, 389-91; Taylor et al., (1985) Nucl. Acids Res. 13: 8749-8764; Taylor et al., (1985) Nucl. Acids Res. 13: 8765-8787; Wells et al., (1986) Phil. Trans. R. Soc. Load. A 317: 415-423; Wells et al. (1985) Gene 34:315-323; Zoller and Smith (1982) Nucleic Acids Res. 10:6487-6500; Zoller and Smith (1983) Methods in Enzymol. 100:468-500; and Zoller and Smith (1987) Methods in Enzymol. 154:329-350. In some examples, the amino acid residues are modified by NNK mutagenesis. In other examples, the amino acid residues are modified by cassette mutagenesis.

In some examples, selected target amino acid residues can be mutagenized individually such that each mutagenesis is performed by the replacement of a single amino acid residue at only one target position, such that each individual mutant generated is the single product of each single mutagenesis reaction. The single amino acid replacement mutagenesis reactions can be repeated for each of the replacing amino acids selected at each of the target positions in the selected region. Thus, a plurality of mutant protein molecules are produced, whereby each mutant protein contains a single amino acid replacement at only one of the target positions. The mutagenesis can be effected in an addressable array such that the identity of each mutant protein is known. For example, site-directed mutagenesis methods can be used to individually generate mutant proteins.

In other examples, a mutagenized antibody can be generated that has random amino acids at specific target positions in the variable heavy or light chain Generally, selected target amino acid residues can be mutagenized simultaneously, i.e., one or more amino acid residues are mutagenized at the same time. For example, random mutagenesis methodology can be used such that target amino acids are replaced by all (or a group) of the 20 amino acids. Either single or multiple replacements at different amino acid positions are generated on the same molecule, at the same time. In this approach neither the amino acid position nor the amino acid type are restricted; and every possible mutation is generated and tested. Multiple replacements can randomly happen at the same time on the same molecule. The resulting collection of mutant molecules can be assessed for activity as described below, and those that exhibit binding are identified and sequenced.

In random mutagenesis methods, it is contemplated that any known method of introducing randomization into a sequence can be utilized. For example, error prone PCR can introduce random mutations into nucleic acid sequences encoding the polypeptide of interest (see, e.g., Hawkins et al., J. Mol. Biol., (1992) 226(3): 889-96). Briefly, PCR is run under conditions which compromise the fidelity of replication, thus introducing random mutations in sequences as those skilled in the art can accomplish.

Exemplary of a method of introducing randomization into one or more target amino acid positions is the use of a deoxyribonucleotide “doping strategy,” which can cover the introduction of all 20 amino acids while minimizing the number of encoded stop codons. For example, NNK mutagenesis can be employed whereby N can be A, C, G, or T (nominally equimolar) and K is G or T (nominally equimolar). In other examples, NNS mutagenesis can be employed whereby S can be G or C. Thus, NNK or NNS (i) code for all the amino acids, (ii) code for only one stop codon, and (iii) reduce the range of codon bias from 6:1 to 3:1. There are 32 possible codons resulting from the NNK motif: 1 for each of 12 amino acids, 2 for each of 5 amino acids, 3 for each of 3 amino acids, and only one of the three stop codons. Other alternatives include, but are not limited to: NNN which can provide all possible amino acids and all stops; NNY which eliminates all stops and still cover 14 of 20 amino acids; and NNR which covers 14 of 20 amino acids. The third nucleotide position in the codon can be custom engineered using any of the known degenerate mixtures. However, the group NNK, NNN, NNY, NNR, NNS covers the most commonly used doping strategies and the ones used herein.

Mutagenized proteins are expressed and assessed for activity to the target antigen. Any method known to one of skill in the art to assess activity, for example, as described further herein below in Section E.1, can be used. For example, exemplary binding assays include, but are not limited to immunoassays such as competitive and non-competitive assay systems using techniques such as western blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), “sandwich” immunoassays, Meso Scale Discovery electrochemiluminescence assays (MSD, Gaithersburg, Md.), immunoprecipitation assays, ELISPOT, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, and protein A immunoassays. Such assays are routine and well known in the art (see, e.g., Ausubel et al., cds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York, which is incorporated by reference herein in its entirety). For example, in the methods provided herein, binding of an antibody to a target antigen is determined using an ECL binding assay. In another example, binding is determined by ELISA.

Identified mutant antibodies that exhibit improved or increased binding to the target antigen compared to the parent first antibody are identified. The amino acid mutations in the variable heavy or light chain in the identified mutant antibody can be determined. As discussed below, further mutagenesis and iterative screening can be effected on an identified mutant antibody to further optimize the activity for a target antigen. For example, the mutations of all mutant antibodies of a parent first antibody that were identified as exhibiting improved binding for a target antigen can be determined. All or a subset of the identified amino acid mutations can be combined to generate a combination mutant antibody.

2. SAR by Scanning Mutagenesis

Scanning mutagenesis is a simple and widely used technique in the determination of the functional role of protein residues. Scanning mutagenesis can be used in methods of affinity maturation herein to determine SAR of a first antibody. Scanning mutagenesis can be performed on a first antibody without comparison to a related antibody. In other examples, scanning mutagenesis is optionally performed prior to mutagenesis of a target region above in order to more rationally identify amino acif residues to mutate.

In the scanning mutagenesis methods herein, every residue across the full-length of the variable heavy chain and/or variable light chain of the antibody is replaced by a scanning amino acid. Alternatively, every residue in a region of the variable heavy chain or variable light chain is replaced by a scanning amino acid. For example, at least one CDR (e.g. a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 or CDRL3) is selected for scanning. The scanning amino acid can be any amino acid, but is generally an alanine, theronine, proline or glycine Amino acid substitution is typically effected by site-directed mutagenesis Alanine is generally the substitution residue of choice since it eliminates the side chain beyond the [beta] carbon and yet does not alter the main-chain conformation (as can glycine or proline), nor does it impose extreme electrostatic or steric effects. Generally, all amino acid residues selected for mutageneis are scanned (e.g. mutated to) the same amino acid residue. Often, it is necessary to use other scanning amino acid residues. For example, if the target amino acid residue already is an alanine, then another amino acid residue such as threonine, proline or glycine can be used.

When performing scanning mutagenesis, all or a subset of amino acids across the full-length polypeptide or in a selected region are targeted for scanning mutagenesis, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acid residues are subjected to scanning mutagenesis. In examples where scanning mutagenesis is performed in addition to comparison to a related antibody, all amino acid residues in a target region, or a subset or amino acid residues in a target region, are scanned. In one example, only the amino acid residues that differ between the first antibody and a related antibody are targeted for scanning mutagenesis. Generally, all amino acid residues in a target region are subjected to scanning mutagenesis. Mutagenized proteins are expressed and assessed for activity to the target antigen as described above and in Section E below.

Following scanning, scanned (e.g. mutated) antibodies are screened for an activity to identify amino acid residues for further mutation. Generally, most prior art scanning mutagenesis methods involve or are limited to identification of scanned positions that knock down or decrease the activity of the protein of interest. The rationale is that these residues are critical for activity in some way. For purposes of practice of the method herein, however, residues that are “Up” mutants are selected for further mutagenesis following scanning. These are antibodies that exhibit retained or increased activity when mutated to contain a scanned amino acid compared to the parent antibody. Further, only residues with scanned substitutions that are in contact-making CDRs are selected. Thus in an exemplary embodiment, only residues with scanned substitutions that are in contact-making CDRs and that do not affect activity or confer an improvement are selected herein to further mutate individually to other amino acids.

A benefit of this approach is that generally antibodies that are selected for affinity maturation herein exhibit a micromolar or high nanomolar affinity. Such affinities mean that the antibodies exhibit a low interaction for the target antigen. This is in contrast to many proteins that are typically affinity matured that already are highly evolved for their functional activity. Thus, for antibodies selected for affinity maturation that exhibit a weaker activity for a target antigen, there is more opportunity to improve or optimize weak interactions. Thus, in practicing the method herein, scanned residues that result in an increased or retained activity of the antibody are selected for further mutagenesis. This, allows new interactions to take place, for example, creating new contact residues, that did not exist prior to affinity maturation.

Thus, in scanning mutagenesis methods herein, selected amino acids are subjected to scanning mutagenesis to identify those amino acid residues that are “Up” mutants (i.e. exhibit retained or increased activity). Further mutagenesis is performed only at scanned amino acid positions that exhibit a retained or an increase in activity to the target antigen compared to the parent antibody. An antibody that retains an activity to a target antigen can exhibit some increase or decrease in binding, but generally exhibits the same binding as the first antibody not containing the scanned mutation, for example, exhibits at least 75% of the binding activity, such as 75% to 120% of the binding, for example, 75%, 80%, 85%, 90%, 95%, 100%, 105%, 110% or 115% of the binding. An antibody that exhibits increased activity to a target antigen generally exhibits greater than 115% of the activity, such as greater than 115%, 120%, 130%, 140%, 150%, 200% or more activity than the first antibody not containing the mutation. Thus, scanning mutagenesis can be employed to restrict the subset of target amino acid residues in the target region that are further mutagenized. Once identified, mutagenesis is performed on all or a subset of the amino acid residues as described in Section C.4 above. The further mutagenized antibodies are expressed and assessed for activity to the target antigen as described above and in Section E below. Antibodies that exhibit an improved or optimized activity compared to the first antibody are selected.

3. Further Optimization

The affinity maturation methods provided herein can be performed iteratively to further optimize antibodies. Additionally or alternatively, all or a subset of the amino acid modifications within a variable heavy or light chain that result in improved or increased activity to the target antigen can be selected and combined and further assessed for activity. These intermediate antibodies also can be used as templates for further mutagenesis using the affinity maturation methods herein. In some examples, variable heavy or light chains with one or more amino acid modification(s) incorporated can be used as templates for further mutagenesis and optimization of activity. In addition, further regions of an antibody can be mutagenized.

The method further provides for optimization of regions of the variable heavy or light chain that were not initially selected for mutagenesis based on the amino acid sequence comparison of the first antibody and related antibodies. An additional region selected for further mutagenesis can occur along any portion of the variable heavy or light chain. For example, a further region can include a CDR or a framework region. Typically, a CDR, for example, CDR1, CDR2 and/or CDR3, is selected and targeted. Any one or more of the regions can be targeted for affinity maturation by mutagenesis. As exemplified in Examples 9 and 12 below, CDRH1 and CDRH2 are selected for additional mutagenesis.

Additional regions of the variable heavy or light chain can be subjected to further mutagenesis at the same time, or alternatively, they can be mutagenized iteratively. For example, mutations in one region that optimize an activity of the antibody can first be identified by further mutagenesis herein, followed by optimization of a second region. The selection of amino acid residues to mutagenize within a selected target region can be determined by the person practicing the method. In some examples, all amino acids in that region are targeted for mutagenesis. In other examples, only a subset of amino acids in that region are targeted for mutagenesis. In an additional example, scanning mutagenesis is performed to identify residues that increase or retain activity to the target antigen. In such examples, only residues that increase or do not affect binding affinity are further mutagenized to identify mutations that increase binding affinity to the target antigen. Typically, mutagenesis is performed for one or both of the heavy and/or light chain(s) independently of the other. The amino acid residues that are selected for further mutagenesis can be modified by any method known to one of skill in the art. Mutagenized proteins are expressed and assessed for binding to the target antigen. Exemplary binding assays are described in Section E.1 below.

The amino acid residues in a region that are selected for further mutagenesis can be modified by any method known to one of skill in the art, as described in Sections C.4 and C.5 above. In some examples, the selected amino acids are subjected to scanning mutagenesis to identify “Up” mutants for further mutagenesis. In other examples, the selected amino acids are randomly mutagenized, for example, the amino acid residues are modified by saturation mutagenesis and/or cassette mutagenesis. Mutagenized proteins are expressed and assessed for activity to the target antigen, as described in Sections F and E. Antibodies containing amino acid mutations that increase activity to the target antigen are identified.

Combination mutants also can be generated. In the methods provided herein, amino acid mutations that result in increased activity of the antibody towards the target antigen can be combined to generate a variable heavy or light chain with multiple amino acid modifications. Typically, combination mutants have 2, 3, 4, 5, 6, 7, 8, 9, 10 or more mutations per variable heavy and/or light chain. In some examples, combination mutants contain two amino acid modifications. In other examples, combination mutants contain three or more amino acid modifications. As exemplified in Example 9 below, a variable heavy chain is generated containing 4 amino acid mutations.

In addition, intermediate antibodies containing multiple amino acid modifications within the variable heavy or light chain can be generated at any step in the method. A variable heavy and/or light chain of an intermediate antibody, i.e., one containing multiple previously identified amino acid modifications, can be used as a “template” for further mutagenesis and affinity maturation.

Further, the method herein provides for pairing of any modified heavy chains with any modified light chains thereby generating intermediate or affinity matured antibodies in which both the heavy and light chains contain mutations. Mutated heavy and light chains can be paired at any step in the method, expressed and assessed for binding to the target antigen. Thus, further optimization of an antibody can be achieved.

At any step in of further optimization in the methods herein, the affinity matured antibodies can be further evaluated for activity as described in Section E.

a. Complementarity Determining Regions

In some examples, a region is selected for further mutagenesis. Generally, a region is a CDR, for example, CDR1, CDR2 and/or CDR3 of the variable heavy or light chain. The amino acid residues within a variable heavy or light chain CDR can be identified by one of skill in the art. CDRs can be identified by any standard definition, including those of Kabat (see, e.g., Kabat et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition. NIH Publication No. 91-3242.); Chothia (see, e.g. Chothia & Lesk, (1987) J Mol Biol. 196(4):901-17; Al-Lazikani et al., (1997) J Mol Biol. 273(4):927-48); Abm (see, e.g., Martin et al., (1989) Proc Natl Acad Sci USA 86:9268-9272); or contact residues based on crystal structure data (see, e.g., MacCalllum et al., (1996) J. Mol. Biol. 262, 732-745). Amino acids contained within heavy and light chain CDRs, as defined based on Kabat numbering, are described in Section C.3. above.

Typically, a CDR contains 3 to 25 residues, all or part of which can be targeted for further mutagenesis. For example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid residues can be targeted for mutagenesis. As exemplified in Example 9, only selected residues of CDRH1 were mutagenized whereas in Example 10, all residues within CDRL2 were mutagenized.

Selected amino acids are subjected to mutagenesis and the antibodies are expressed and assayed for activity to the target antigen as described in sections C.4 above and E. and F. below.

b. Framework Regions

In some examples, a region selected for further mutagenesis is part of a framework region, for example, FR1, FR2, FR3 and/or FR4, of the variable heavy or light chain. As is the case for CDRs, framework regions can be identified by any standard definition, according to the numbering of Kabat, Chothia, Abm or contact residues Amino acids that make up the framework regions within the heavy and light chain variable regions as defined based on Kabat numbering are described in Section C.3. above. Typically, a framework region contains 11 to 32 amino acids. All or part of a framework region can be targeted for mutagenesis, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32 amino acids can be subjected to full or partial saturation mutagenesis. A selected region with a framework region can include one or more amino acid residues. In some examples, only one amino acid residue is mutagenized. In other examples, two or more amino acid residues are mutagenized. Selected amino acid residues can be mutagenized individually, or alternatively, selected amino acid residues can be mutagenized simultaneously, i.e., one or more amino acid residues are mutagenized at the same time. For example, double mutants are generated and assayed for their ability to bind to the target antigen.

Selected amino acids are subjected to mutagenesis and the antibodies are expressed and assayed for activity to the target antigen as described in sections C.4 above and E. and F below.

c. Germline Swapping

In some examples, a region selected for further mutagenesis is a germline segment, i.e., a variable heavy chain V, D or J segment, or a variable kappa or lambda light chain V or J segment, e.g., VH, DH, JH, Vκ, Vλ, Jκ, and Jλ. In a variable heavy chain, germline segment VH contains amino acids within CDR1 and CDR2 while germline segments DH and JH contain amino acid residues within CDR3. In a variable light chain, V germline segments (e.g., Vκ or Vλ) contain amino acid residues within CDR1, CDR2 and the 5′ end of CDR3 while J germline segments (e.g., Vλ and Jκ) contain amino acid residues at the 3′ end of CDR3. When a germline segment is targeted for mutagenesis, amino acid modifications are introduced into a variable heavy or light chain by swapping, or replacing, an entire germline segment with another germline segment of the same type. For example, a JH germline segment, e.g., IGHJ1*01, is replaced with a different JH germline segment, e.g., IGHJ2*01, or any other IGHJ germline segment. As exemplified in Example 13A and FIG. 4A, swapping of IGHJ1*01 allows for simultaneous mutation of 6 amino acid residues within heavy chain CDR3 and a seventh residue within framework region 4. One germline segment is swapped, such as, for example, JH, or alternatively, two germline segments can be swapped, for example, both DH and JH can be swapped within one variable heavy chain.

Typically, a D or J germline segment is selected for mutagenesis since these germline segments encode for CDR3 of both the heavy and light chain. More specifically, germline segments DH, JH, Jκ, and/or Jλ are selected. As exemplified in Example 13B, swapping of both DH and JH segments leads to an almost complete scan of heavy chain CDR3. As shown in FIG. 4B, germline segment JH is swapped with three different JH segments serving to mutate 6 amino acids at the 3′ end of CDRH3 and as shown in FIG. 4C, 5 amino acids within the middle of CDRH3 are modified.

Germline swapped antibodies are expressed and assayed for activity to the target antigen as described in section E. and F below. Antibodies containing swapped germline segments that increase activity to the target antigen can be used as intermediate antibodies for further modifications, as described in this section herein.

D. METHOD OF ANTIBODY CONVERSION

Provided herein is a method of antibody conversion. The method is based on the elucidation that antibodies with varying affinities, while maintaining their specificity to a target antigen, can exhibit a range of activities ranging from agonist or activator-modulator activity to antagonist activity for the same target antigen. As described herein, the pharmacologic activity of antibodies is dependent on their affinity, with qualitatively different activities (activations vs. inhibition) occurring in antibodies recognizing the same epitope but with disparate affinities. It is contemplated herein that activation of an activity is due to the enhancement of signaling through receptor clustering and rapid on/off kinetics of the low affinity variant. In contrast, high affinity binders grab on to their ligand and do not let go, thereby preventing transmission of a signal. Thus, an antibody can have a therapeutic benefit as a low affinity agonist or activator-modulator or as a high affinity antagonist of the same target antigen.

Nearly all antibodies in clinical use are high-affinity antagonists, despite the fact that multiple mechanisms of action are typically seen for several classes of small molecule drugs. For example, small molecule drugs have several mechanisms of action, including acting as antagonists, agonists, partial agonists or antagonists and modulators. In contrast, most antibody therapeutics act as antagonists. The discovery selection mechanisms in hybridoma and display-based systems drive affinity and dominant epitope binding. Thus, most methods of antibody engineering exhibit affinity-based bias. This is because most existing display-based libraries select antibodies based on the ability to rapidly identify high-affinity binders. For example, most methods rely on competitive selection based on target affinity. Thus, most existing methods, for example, traditional display-based methods that rely on competitive affinity screens can miss potential therapeutics simply because they are incompatible with high affinity.

Thus, provided herein are methods of antibody conversion, whereby antibodies are converted from antagonists to partial agonists, antagonists or activators-modulators, or can be converted from agonists or activators-modulators to antagonists or partial antagonists. The method is based on converting antibodies by modulating or altering the binding affinity of an antibody for the same target antigen in order to get a range of activities from antagonism, partial antagonism or activation-modulation. The methods combine mutagenesis approaches of a starting antibody with endpoint analysis for binding affinity and functional activity assessment of resulting activities. By employing random or rational mutagenesis strategies, libraries can be generated that can be screened through a wide dynamic range of affinities to identify antibodies with antagonist, partial antagonist or activator/modulator activities. In some examples, the libraries are in arrayed formats such that the identity of each member in the library is known. In another example, a structure/activity relationship (SAR) mutagensis strategy can be employed similar to the affinity maturation method described in Section C.

1. Choosing the Starting or Reference Antibody

In the method, a starting or reference antibody, or portion thereof, to be converted is chosen. The antibody that is chosen is one that 1) exhibits a known activity against a particular target antigen (e.g. antagonist or agonist), and 2) for which there would be a potential therapeutic benefit if the activity of the antibody was inversed or partially inversed. For example, an antibody that exhibits an antagonist or partial antagonist activity can be chosen, whereby an antibody exhibiting the inverse agonist, partial agonist or activator-modulator activity towards the same target antigen also is desired. In another example, an antibody that exhibits an agonist, partial agonist or activator-modulator activity towards a target antigen can be chosen, whereby an antibody exhibiting the inverse antagonist or partial antagonist activity towards the same target antigen also is desired.

The first or starting antibody is an antibody that is known or that is identified as having an activity to a target antigen. The target antigen can be a polypeptide, carbohydrate, lipid, nucleic acid or a small molecule (e.g. neurotransmitter). The antibody can exhibit activity for the antigen expressed on the surface of a virus, bacterial, tumor or other cell, or exhibits an activity (e.g. binding) for the purified antigen. Generally, the target antigen is a protein that is a target for a therapeutic intervention. Exemplary target antigens include, but are not limited to, targets involved in cell proliferation and differentiation, cell migration, apoptosis and angiogenesis. Such targets include, but are not limited to, growth factors, cytokines, lymphocytic antigens, other cellular activators and receptors thereof. Exemplary of such targets include, membrane bound receptors, such as cell surface receptors, including, but are not limited to, a VEGFR-1, VEGFR-2, VEGFR-3 (vascular endothelial growth factor receptors 1, 2, and 3), a epidermal growth factor receptor (EGFR), ErbB-2, ErbB-b3, IGF-R1, C-Met (also known as hepatocyte growth factor receptor; HGFR), DLL4, DDR1 (discoidin domain receptor), KIT (receptor for c-kit), FGFR1, FGFR2, FGFR4 (fibroblast growth factor receptors 1, 2, and 4), RON (recepteur d'origine nantais; also known as macrophage stimulating 1 receptor), TEK (endothelial-specific receptor tyrosine kinase), TIE (tyrosine kinase with immunoglobulin and epidermal growth factor homology domains receptor), CSF1R (colony stimulating factor 1 receptor), PDGFRB (platelet-derived growth factor receptor B), EPHA1, EPHA2, EPHB1 (erythropoietin-producing hepatocellular receptor A1, A2 and B1), TNF-R1, TNF-R2, HVEM, LT-βR, CD20, CD3, CD25, NOTCH, G-CSF-R, GM-CSF-R and EPO-R. Other targets include membrane-bound proteins such as selected from among a cadherin, integrin, CD52 or CD44. Exemplary ligands that can be targets, include, but are not limited to, VEGF-A, VEGF-B, VEGF-C, VEGF-D, PIGF, EGF, HGF, TNF-α, LIGHT, BTLA, lymphotoxin (LT), IgE, G-CSF, GM-CSF and EPO.

The first or starting antibody that has activity for the target antigen is known in the art or is identified as having a particular activity for a target antigen or antigens. For example, any method for identifying or selecting antibodies against particular target antigens can be used to choose or select a starting antibody including, but not limited to, immunization and hybridoma screening approaches, display library screening methods (e.g. antibody phage display libraries), or addressable combinatorial antibody libraries. For example, methods of identifying antibodies with particular activities or affinities is described in Section B.2 herein. Further, it is understood that the description of the methods for choosing or selecting a first or starting antibody described for the affinity maturation method herein in Section C.1, and in particular in section C.1.ai and ii, can also be used choose or select a first antibody to be converted in the antibody conversion method herein. In addition, any antibody that has been affinity matured, and which, typically, exhibits antagonist activity, can be selected as the starting or first antibody. As discussed elsewhere herein, affinity maturation methods are known in the art (see e.g. Section B.3). Also, the affinity maturation method described in Section C also can be used to identify an antibody, generally one with high affinity, that can be subsequently used in the conversion method herein.

If not known, the activity of a first or starting antibody can be determined. The binding affinity and/or functional activity (e.g. as an agonist, antagonist or activator-modulator) can be determined. Exemplary assays are described herein in Section E and in the Examples. The particular assay chosen depends on the target antigen and/or its requirements for activity. For example, DLL4 is a cell-surface ligand that activates the Notch1 receptor, also expressed on the cell surface. Thus, typically, cell-based assays are employed to assess activity. Exemplary of cell-based assays are reporter assays as described herein and in the Examples. Based on the descriptions herein, it is within the level of one of skill in the art to determine and or optimize a particular assay for each antibody.

2. Mutagenesis

Once a first or starting antibody is chosen, amino acid residues in the variable heavy chain and/or variable light chain are subjected to mutagenesis. Generally, amino acid residues in a CDR or CDRs are mutated, for example, residues in CDRL1, CDRL2, CDRL3, CDRH1, CDRH2 and/or CDRH3 of the antibody are mutated. For example, typically, a CDR can contain 3 to 25 amino acid residues. All or subset of the amino acids within a CDR can be targeted for mutagenesis, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid residues can be targeted for mutagenesis.

The amino acid residues that are selected for further mutagenesis can be modified by any method known to one of skill in the art. The amino acid residues can be modified rationally or can be modified by random mutagenesis. This can be accomplished by modifying the encoding DNA. One of skill in the art is familiar with mutagenesis methods. For example, any of the mutagenesis methods described in Section C.1.d can be used. In one example, if residues in the first or starting antibody are known that are involved in binding, those residues can be rationally targeted by any of a variety of mutagenesis strategies. In another example, random mutagenesis methods can be employed. Exemplary of such mutagenesis strategies introduce randomization into a sequence using methods know in the art, including but not limited to, error prone PCR or doping strategies. Mutagenized proteins are expressed as described in Section F. Libraries or collections of variant antibodies can be generated and screened for conversion as described herein below. In some examples, the libraries are addressable libraries.

3. Selecting for a Converted Antibody

Mutagenized proteins are expressed and assessed for their binding affinity to the target antigen and/or for effects on modulation of a functional activity towards the target antigen. Converted antibodies are selected for that have a binding affinity and activity that is inversed (e.g. higher or lower; antagonist vs. agonist/activator-modulator) compared to the starting of first antibody.

a. Binding

In the first step of selection of a converted antibody, binding affinity is assessed. Any method known to one of skill in the art to assess activity, for example, as described further herein below in Section E.1, can be used. For example, exemplary binding assays include, but are not limited to immunoassays such as competitive and non-competitive assay systems using techniques such as western blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), “sandwich” immunoassays, Meso Scale Discovery electrochemiluminescence assays (MSD, Gaithersburg, Md.), immunoprecipitation assays, ELISPOT, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, and protein A immunoassays. Such assays are routine and well known in the art (see, e.g., Ausubel et al., eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York, which is incorporated by reference herein in its entirety). For example, in the methods provided herein, binding of an antibody to a target antigen is determined using an ECL binding assay. In another example, binding is determined by ELISA. As discussed elsewhere herein, comparison of binding affinities between a first antibody and a mutagenized antibody are typically made between antibodies that have the same structure, e.g. Fab compared to Fab of IgG compated to IgG.

For example, if an antagonist antibody is chosen as the first or starting antibody, an agonist, partial agonist or activator-modulator is selected by first testing the antibody for its binding affinity. Antibodies that exhibit a decreased binding affinity (e.g. higher binding affinity) than the first or starting antibody are selected. For example, antibodies are selected that exhibit a binding affinity that is decreased by 2-fold to 5000-fold, for example, 10-fold to 5000-fold, such as 100-fold to 1000-fold. For example, if the binding affinity of the first or starting antibody is 10−9 M, and antibody exhibiting a binding affinity of 10−7 M exhibits a 1000-fold decreased binding affinity.

In another example, if an agonist, partial agonist, or an activator-modulator antibody is chosen as the first or starting antibody, an antagonist or partial antagonist antibody is selected by first testing the antibody for its binding affinity. Antibodies that exhibit an enhanced or increased binding affinity (e.g. lower binding affinity) then the first or starting antibody are selected. For example, antibodies are selected that exhibit a binding affinity that is enhanced or increased by 10-fold to 10,000 fold, for example, 100-fold to 5000-fold, such as about 500-fold to 2500-fold. For example, if the binding affinity of the first or starting antibody is 10−7 M, an antibody exhibiting a binding affinity of 10−9 M is selected as exhibiting a 1000-fold increased or enhanced binding affinity.

b. Functional Activity

Mutagenized antibodies initially selected based on binding affinity are then selected for the inversed modulation of a functional activity. Assays to assess the functional activities are well known to those of skill in the art and can be empirically determined depending on the particular target protein. Typically, the assay is a cell-based assay. Exemplary assays, including exemplary cell lines, are described herein in Section E. The cells to be assayed express the particular target protein of interest. Control cells not expressing the protein also can be used to assess specificity. The assay that is employed is one that is capable of providing a read-out that that provides a quantitative assessment of activity, which can be readily assessed. For example, exemplary functional assays include reporter assays, whereby upon activation of a cell-surface receptor, for example by an exogenously added ligand, a reporter signal is induced that can be measured. In the presence of an antagonist or partial antagonist antibody to the cell-surface receptor or ligand, the measured read-out is decreased consistent with the inhibitory effect of the antibody. In contrast, in the presence of an agonist, partial agonist or activator-modulator, the measured read-out is increased consistent with an activating effect of the antibody.

For example, if the starting or first antibody is an antagonist of a target protein, mutant antibodies of the first antibody that are initially selected as having decreased binding affinity in a) above (e.g. higher binding affinity), are further tested for activity as an agonist, partial agonist and/or activator-modulator for the same target protein. Antibodies selected as being converted are those that exhibit an activating activity on the target protein. Thus, the presence of the antibody results in increased activity of the target protein, or on the end-point activity of the target protein, compared to the activity that is exhibited under the same activating conditions without the antibody present. For example, if a target protein is normally activated in the presence of a ligand, a set measured activity is achieved; in the additional presence of an agonist, partial agonist or activator-modulator antibody, the measured activity is increased. In another example, if the target protein is a ligand that normally activates a receptor, the ligand-receptor interaction results in a set measured activity; in the additional presence of an antibody to the ligand the measured activity is increased. For example, activity of the target protein is increased by 1.2 to 2-fold, 2-fold to 1000-fold, for example, is increased 5-fold to 500-fold, such as 10-fold to 200-fold, for example, is increased 1.2-fold, 1.5-fold, 2-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700-fold, 800-fold, 900-fold, 1000-fold or more compared to the activity of the target protein under the same activating conditions without the antibody present.

In another example, if the starting or first antibody is an agonist, partial agonist or activator-modulator of a target protein, mutant antibodies of the first antibody that are initially selected as having increased or enhanced binding affinity in a) above (e.g. lower binding affinity), are further tested for activity as an antagonist or partial antagonist for the same target protein. Antibodies selected as being converted are those that exhibit an inhibitory activity on the target protein. Thus, the presence of the antibody results in decreased activity of the target protein, or on the end-point activity of the target protein, compared to the activity that is exhibited under the same activating conditions without the antibody present. For example, if a target protein is normally activated in the presence of a ligand, a set measured activity is achieved; in the additional presence of an antagonist or partial antagonist antibody, the measured activity is decreased. In another example, if the target protein is a ligand that normally activates a receptor, the ligand-receptor interaction results in a set measured activity; in the additional presence of an antibody to the ligand the measured activity is decreased. For example, activity of the target protein is decreased by 1.2 to 2-fold, 2-fold to 1000-fold, for example, is decreased by 5-fold to 500-fold, such as 10-fold to 200-fold, for example, is deceased 1.2-fold, 1.5-fold, 2-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700-fold, 800-fold, 900-fold, 1000-fold or more compared to the activity of the target protein under the same activating conditions without the antibody present.

In some examples of the antibody conversion method herein, the initial step of selecting an antibody based on an increased or decreased binding affinity is not performed. Hence, the method of antibody conversion herein can be effected directly by choosing a first or starting antibody as described herein, mutagenizing it as described herein, and directly testing the collection of mutant antibodies for an inverse functional activity of the first or starting antibody. Converted antibodies are selected that exhibit the inverse activity.

In practicing the method provided herein, typically only the variable heavy chain and/or variable light chain of the antibody is subjected to mutagenesis. The ultimate antibody that is selected typically at least contains a variable heavy chain and a variable light chain, or portion thereof sufficient to form an antigen binding site. It is understood, however, that the antibody also can include all or a portion of the constant heavy chain (e.g. one or more CH domains, such as CH1, CH2, CH3 and CH4, and/or a constant light chain (CL)). Hence, the antibody can include those that are full-length antibodies, and also include fragments or portions thereof including, for example, Fab, Fab′, F(ab′)2, single-chain Fvs (scFv), Fv, dsFv, diabody, Fd and Fd′ fragments, Fab fragments, scFv fragments, and scFab fragments. It also is understood that once the antibody is converted as provided herein, the resulting antibody can be produced as a full-length antibody or a fragment thereof, such as a Fab, Fab′, F(ab′)2, single-chain Fvs (scFv), Fv, dsFv, diabody, Fd and Fd′ fragments, Fab fragments, scFv fragments, and scFab fragments. Further, the constant region of any isotype can be used in the generation of full or partial antibody fragments, including IgG, IgM, IgA, IgD and IgE constant regions. Such constant regions can be obtained from any human or animal species. It is understood that activities and binding affinities can differ depending on the structure of an antibody, although it is not expected that an activity as, for example an agonist or antagonist, will substantially change. For example, generally a bivalent antibody, for example a bivalent F(ab′)2 fragment or full-length IgG, has a better binding affinity then a monovalent Fab antibody. As a result, where a Fab has a specified binding affinity for a particular target, it is excepted that the binding affinity is even greater for a full-length IgG that is bivalent.

The resulting converted antibodies are candidate therapeutics. Exemplary of practice of the method is described herein in the Examples. For example, Example 19 shows that two different anti-DLL4 germline antibodies, having low affinity for DLL4, exhibited agonist activity. Mutagenesis of each of the antibodies by the affinity maturation method described herein resulted in conversion of the antibodies to antagonist antibodies with higher affinity for the same target antigen.

E. ASSAYS

Antibodies produced in the methods herein can be assessed for their activity towards the target antigen. Antibodies can be screened to identify mutant or modified antibodies that have improved binding affinity or that alter or modulate (increase or decrease) an activity of a target. Typically, the methods herein includes screening or testing antibodies for their binding to a target antigen. Other activities also can be assayed for, including but not limited to cytotoxicity, differentiation or proliferation of cells, cell migration, apoptosis, angiogenesis and alteration of gene expression.

1. Binding Assays

The antibodies provided herein can be screened for their ability to bind a selected target by any method known to one of skill in the art. Exemplary target antigens are described in Section C.1. Binding assays can be performed in solution, suspension or on a solid support. For example, target antigens can be immobilized to a solid support (e.g. a carbon or plastic surface or chip) and contacted with antibody. Unbound antibody or target protein can be washed away and bound complexes can then be detected. Binding assays can be performed under conditions to reduce nonspecific binding, such as by using a high ionic strength buffer (e.g. 0.3-0.4 M NaCl) with nonionic detergent (e.g. 0.1% Triton X-100 or Tween 20) and/or blocking proteins (e.g. bovine serum albumin or gelatin). Negative controls also can be including in such assays as a measure of background binding. Binding affinities can be determined using Scatchard analysis (Munson et al., Anal. Biochem., 107:220 (1980)), BIACore or other methods known to one of skill in the art.

Exemplary binding assays include, but are not limited to immunoassays such as competitive and non-competitive assay systems using techniques such as western blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), “sandwich” immunoassays, Meso Scale Discovery (MSD, Gaithersburg, Md.), immunoprecipitation assays, ELISPOT, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, and protein A immunoassays. Such assays are routine and well known in the art (see, e.g., Ausubel et al., eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York, which is incorporated by reference herein in its entirety). Other assay formats include liposome immunoassays (LIA), which use liposomes designed to bind specific molecules (e.g., antibodies) and release encapsulated reagents or markers. The released chemicals are then detected according to standard techniques (see Monroe et al., (1986) Amer. Clin. Prod. Rev. 5:34-41).

Generally, binding is detected using a detectable moiety or label (e.g. an enzyme, a radionuclide, a fluorescent probe, electrochemiluminescent label, or a color dye) typically attached to the target or, if desired, directly to the antibody members in the library. Alternatively, binding can be detected by a further third reagent that itself is labeled or detectable. For example, detection of an antibody bound to a target protein can be achieved using a labeled capture molecule in a sandwich assay format. Other proteins capable of specifically binding immunoglobulin constant regions, such as protein A or protein G also can be used as the label agent. These proteins exhibit a strong non-immunogenic reactivity with immunoglobulin constant regions from a variety of species (see, e.g., Kronval et al., (1973) J. Immunol. 111:1401-1406; Akerstrom et al., (1985) J. Immunol. 135:2589-2542). The detection agent can be modified with a detectable moiety, such as biotin, to which another molecule can specifically bind, such as streptavidin. A variety of detectable moieties are well known to those skilled in the art.

The choice of label or detectable group used in the assay is not critical, as long as it does not significantly interfere with the specific binding of the antibody used in the assay. Generally, the choice depends on sensitivity required, ease of conjugation with the compound, stability requirements, available instrumentation, and disposal provisions. One of skill in the art is familiar with labels and can identify a detectable label suitable for and compatible with the assay employed.

The detectable group can be any material having a detectable physical or chemical property. Such detectable labels have been well-developed in the field of immunoassays and, in general, most any label useful in such methods can be applied herein. Thus, a label is any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means. Useful labels include magnetic beads (e.g., DYNABEADS™), fluorescent dyes (e.g., fluorescein isothiocyanate, Texas red, rhodamine, and the like), radiolabels (e.g., 3H, 125I, 35S, 14C, or 32P), enzymes (e.g., horse radish peroxidase, alkaline phosphatase and others commonly used in an ELISA), chemiluminescent labels (luciferin and 2,3-dihydrophtahlazinediones, e.g., luminol), and colorimetric labels such as colloidal gold or colored glass or plastic beads (e.g., polystyrene, polypropylene, latex, etc.). For a review of various labeling or signal producing systems that can be used, see e.g. U.S. Pat. No. 4,391,904.

Means of detecting labels are well known to those of skill in the art. Thus, for example, where the label is a radioactive label, means for detection include a scintillation counter or photographic film as in autoradiography. Where the label is a fluorescent label, it can be detected by exciting the fluorochrome with the appropriate wavelength of light and detecting the resulting fluorescence. The fluorescence can be detected visually, by the use of electronic detectors such as charge coupled devices (CCDs) or photomultipliers and the like. Similarly, enzymatic labels can be detected by providing the appropriate substrates for the enzyme and detecting the resulting reaction product. Finally simple colorimetric labels can be detected simply by observing the color associated with the label.

Some assay formats do not require the use of labeled components. For instance, agglutination assays can be used to detect the presence of the target antibodies. In this case, antigen-coated particles are agglutinated by samples containing the target antibodies. In this format, none of the components need be labeled and the presence of the target antibody is detected by simple visual inspection.

Alternatively, the antibodies provided herein can be screened for their ability to bind to cells, using whole cell panning, with or without subtractive panning. Screening can be done against live cells or against intact, mildly fixed target cells. Methods for whole cell panning have been described previously (see e.g. Siegel et al. (1997) J. Immunol. Methods 206:73-85 incorporated herein by reference). Other techniques for screening which can be applied include fluorescent activated cell sorting (FACS).

For high-throughput screening, assays can be multiplexed. Thus, the binding affinities of antibodies to a number of different target proteins can be determined at once. In one example, different target proteins can be separately labeled with different detectable moieities. For example, different antigens can be coupled to color-coded beads (Schwenk et al. (2007) Mol. Cell. Prot., 6:125-132). In another example, multi-spot plates can be used that permit assay multiplexing by absorption of up to 100 proteins in a locus of the plate (e.g. using Multi-Array or Multi-Spot plates from Meso Scale Discovery; MSD, Gaithersburg, Md.). In such an example, antibodies can be screened by addition of a different antibody to each well of a multi-spot plate. The assay readily permits the screening of thousands of antibodies at once against numerous target proteins.

In the methods of screening herein, antibodies generally are identified that specifically bind to a target antigen, and that have an increased binding affinity compared to a first antibody. The increase in affinity, measured as decrease in Kd, can be achieved either through an increase in association rate (kon), or a reduction in dissociation rate koff; or both. For example, the binding affinity of the antibodies is determined to identify or select antibodies that have high affinity for a target protein. For example, the affinity matured antibodies generated by practice of the method can have a binding affinity for a target antigen that is 1×10−9 M or less, generally 1×10−9 M to 1×10−11 M, for example that is or is about 1×10−9 M, 2×10−9 M, 3×10−9 M, 4×10−9 M, 5×10−9 M, 6×10−9 M, 7×10−9 M, 8×10−9 M, 9×10−9 M, 1×10−10 M, 2×10−10 M, 3×10−10 M, 4×10−10 M, 5×10−10 M, 6×10−10 M, 7×10−10 M, 8×10−10 M, 9×10−10 M or less.

Any method known to one of skill in the art can be used to measure the binding affinity of an antibody. For example, the binding properties of an antibody can be assessed by performing a saturation binding assay, for example, a saturation ELISA, whereby binding to a target protein is assessed with increasing amounts of antibody. In such experiments, it is possible to assess whether the binding is dose-dependent and/or saturable. In addition, the binding affinity can be extrapolated from the 50% binding signal. Typically, apparent binding affinity is measured in terms of its association constant (Ka) or dissociation constant (Kd) and determined using Scatchard analysis (Munson et al., Anal. Biochem., 107:220 (1980). For example, binding affinity to a target protein can be assessed in a competition binding assay in where increasing concentrations of unlabeled protein is added, such as by radioimmunoassay (RIA) or ELISA. Binding affinity also can be analyzed using BIAcore kinetic analysis. This involves analyzing the binding and dissociation of an antibody member from chips containing immobilized target proteins on their surface. The Biacore evaluation software generates the values of Ka and Kd by fitting the data to interaction models. It is understood that the binding affinity of an antibody can vary depending on the assay and conditions employed, although all assays for binding affinity provide a rough approximation. By performing various assays under various conditions it is possible to estimate the binding affinity of an antibody.

In addition, binding affinities can differ depending on the structure of an antibody. For example, generally a bivalent antibody, for example a bivalent F(ab′)2 fragment or full-length IgG, has a better binding affinity then a monovalent Fab antibody. Hence, it is understood that where a Fab has a specified binding affinity for a particular target, it is excepted that the binding affinity is even greater for a full-length IgG that is bivalent.

2. Functional Activity

The antibodies generated by the method herein can be screened for their ability to modulate the functional activity of a target by any method known to one of skill in the art. Assays can be designed to identify antibodies capable of binding and/or modulating cell surface receptors. Such antibodies can either be agonists, mimicking the normal effects of receptor binding, or antagonists, inhibiting the normal effects of receptor binding. Of particular interest is the identification of agents which bind to the receptors and modulate intracellular signaling.

In some example, such assays are cell-based assays. Generally, assays are performed using cell lines known to express the target of interest. Such cells are known to one of skill in the art. For example, one can consult the ATCC Catalog (atcc.org) to identify cell lines. Also, if a particular cell type is desired, the means for obtaining such cells, and/or their instantly available source is known to those in the art. An analysis of the scientific literature can readily reveal appropriate choice of cells expressing any desired target. Table 5 lists exemplary cells lines that express targets of interest that can be screened in functional activities herein against antibody libraries provided herein.

TABLE 5
Cell lines expressing targets
Target Cell Lines References
GP IIb/IIIa MEG-01 chronic Ogura et al. Establishment of a novel human
myelogenous leukemia megakaryoblastic leukemia cell line, MEG-01, with positive
megakaryoblast cells Philadelphia chromosome. Blood 66: 1384-1392, 1985;
(ATCC CRL-2021); Komatsu et al. Establishment and Characterization of a
UT-7 human leukemia Human Leukemic Cell Line with Megakaryocytic Features:
cell ine Dependency on Granulocyte-Macrophage Colony-
stimulating Factor, Interleukin 3, or Erythropoietin for
Growth and Survival. Cancer Research 51: 341-348 (1991)
GM-CSF-R VA-ES-BJ epitheloid Int J Oncol 1995; 7: 51-56; Ali Habib et al. A urokinase-
sarcoma cells (ATCC activated recombinant diphtheria toxin targeting the
CRL-2138); granulocyte-macrophage colony-stimulating factor receptor
TF1-HaRas; is selectively cytotoxic to human acute myeloid leukemia
TF1-vRaf; blasts. Blood 104(7): 2143-2148 (2004); Kiser et al.
TF1-vSrc; Oncogene-dependent engraftment of human myeloid
HL-60 (ATCC CCL- leukemia cells in immunosuppressed mice. Leukemia
240); 15(5): 814-818 (2001)
U-937 (ATCC CRL-
1593.2);
ML-2
VEGFA Human A673 Gerber et al. Complete inhibition of rhabdomyosarcoma
rhabdomyosarcoma cells xenograft growth and neovascularization requires blockade
(ATCC CRL-1598); of both tumor and host vascular endothelial growth factor.
Breast carcinoma MDA- Cancer Res. 60(22): 6253-8 (2000); Presta et al.
MB-435 cells (ATCC); Humanization of an anti-vascular endothelial growth factor
Bovine adrenal cortex- monoclonal antibody for the therapy of solid tumors and
derived capillary other disorders. Cancer Research, 57(20): 4593-4599 (1997)
endothelial cells
CD3 Jurkat E6.1 Human Buhler et al. A bispecific diabody directed against prostate-
leukemic T cell specific membrane antigen and CD3 induces T-cell
lymphoblast (Sigma mediated lysis of prostate cancer cells. Cancer Immunol
Aldrich 88042803) Immunother. 57(1): 43-52 (2008)
EGFR DiFi human colorectal Olive et al. Characterization of the DiFi rectal carcinoma
carcinoma cells; cell line derived from a familial adenomatous polyposis
A431 cells (ATCC CRL- patient. In Vitro Cell Dev Biol. 29A(3 Pt 1): 239-248 (1993);
1555); Wu et al. Apoptosis induced by an anti-epidermal growth
Caco-2 colorectal factor receptor monoclonal antibody in a human colorectal
adenocarcinoma cells carcinoma cell line and its delay by insulin. Clin. Invest.
(ATCC HTB-37); 95(4): 1897-1905 (1995)
HRT-18 colorectal
adenocarcinoma cells
(ATCC CCL-244);
HT-29 colorectal
adenocarcinoma cells
(ATCC HTB-38)
EPO A2780 ovarian cancer Jeong et al. Characterization of erythropoietin receptor and
receptor cells; erythropoietin expression and function in human ovarian
UT-7 human leukemia cancer cells. Int J Cancer. 122(2): 274-280 (2008); Elliott et
cell ine al. Activation of the Erythropoietin (EPO) Receptor by
Bivalent Anti-EPO Receptor Antibodies. J Biol Chem.
271(40): 24691-24697 (1996)
Her2/Neu BT-474 ductal Le et al. Roles of human epidermal growth factor receptor 2,
receptor carcinoma breast cancer c-jun NH2-terminal kinase, phosphoinositide 3-kinase, and
cell (ATCC HTB-20); p70 S6 kinase pathways in regulation of cyclin G2
SK-BR-3 expression in human breast cancer cells. Mol Cancer Ther.
adenocarcinoma breast 6(11): 2843-2857 (2007)
cancer cell (ATCC HTB-
30);
MDA-MB-453
metastatic carcinoma cell
line (ATCC HTB-131)
cMet H1993 lung Ma et al. Functional expression and mutations of c-Met and
adenocarcinoma cells its therapeutic inhibition with SU11274 and small interfering
(ATCC CRL-5909); RNA in non-small cell lung cancer. Cancer Res. 65(4): 1479-1488
H1838 lung (2005);
adenocarcinoma cells Ma et al. A selective small molecule c-MET Inhibitor,
(ATCC CRL-5899); PHA665752, cooperates with rapamycin. Clin Cancer Res
SW 900 lung squamous 11(6): 2312-2319 (2005)
cell carcinoma cells
(ATCC HTB-59);
H358 lung
bronchioalveolar
carcinoma cells (ATCC
CRL-5807);
SK-Lu-1 lung
adenocarcinoma cells
(ATCC HTB-57);
H441 Non-small cell
lung cancer cells (ATCC
HTB-174)
CD20 Ramos Burkitt's Jazirehi et al. Rituximab (anti-CD20) selectively modifies
lymphoma B cells Bcl-xL and apoptosis protease activating factor-1 (Apaf-1)
(ATCC CRL-1596); expression and sensitizes human non-Hodgkin's lymphoma
Raji Burkitt's lymphoma B cell lines to paclitaxel-induced apoptosis. Mol Cancer
B cells (ATCC CCL-86): Ther. 2(11): 1183-1193 (2003)
Daudi Burkitt's
lymphoma B cells
(ATCC CCL-213);
2F7 Burkitt's lymphoma
B cells

In addition, cells lines expressing a target of interest can be generated by transient or stable transfection with an expression vector expressing a target of interest. Methods of transfection and expression are known to those of skill in the art (see e.g., Kaufman R. J. (1990) Methods in Enzymology 185:537-566; Kaufman et al. (1990) Methods in Enzymology 185:537-566). In addition, any primary cell or cell line can be assessed for expression of a particular target (e.g. cell surface marker). Cell surface markers can be assayed using fluorescently labeled antibodies and FACS. Suitable cell lines include A549 (lung), HeLa, Jurkat, BJAB, Colo205, H1299, MCF7, MDA-MB-231, PC3, HUMEC, HUVEC, and PrEC.

Any suitable functional effect can be measured, as described herein. For example, cellular morphology (e.g., cell volume, nuclear volume, cell perimeter, and nuclear perimeter), ligand binding, substrate binding, nuclease activity, apoptosis, chemotaxis or cell migrations, cell surface marker expression, cellular proliferation, GFP positivity and dye dilution assays (e.g., cell tracker assays with dyes that bind to cell membranes), DNA synthesis assays (e.g., 3H-thymidine and fluorescent DNA-binding dyes such as BrdU or Hoechst dye with FACS analysis) and nuclear foci assays, are all suitable assays to identify potential modulators using a cell based system. Other functional activities that can be measured include, but are not limited to, ligand binding, substrate binding, endonuclease and/or exonuclease activity, transcriptional changes to both known and uncharacterized genetic markers (e.g., northern blots), changes in cell metabolism, changes related to cellular proliferation, cell surface marker expression, DNA synthesis, marker and dye dilution assays (e.g., GFP and cell tracker assays), contact inhibition, tumor growth in nude mice, and others.

For example, antibodies generated by the method provided herein can be assessed for their modulation of one or more phenotypes of a cell known to express a target protein. Phenotypic assays, kits and reagents for their use are well known to those skilled in the art and are herein used to screen antibody libraries. Representative phenotypic assays, which can be purchased from any one of several commercial vendors, include those for determining cell viability, cytotoxicity, proliferation or cell survival (Molecular Probes, Eugene, Oreg.; PerkinElmer, Boston, Mass.), protein-based assays including enzymatic assays (Panvera, LLC, Madison, Wis.; BD Biosciences, Franklin Lakes, N.J.; Oncogene Research Products, San Diego, Calif.), cell regulation, signal transduction, inflammation, oxidative processes and apoptosis (Assay Designs Inc., Ann Arbor, Mich.), triglyceride accumulation (Sigma-Aldrich, St. Louis, Mo.), angiogenesis assays, tube formation assays, cytokine and hormone assays and metabolic assays (Chemicon International Inc., Temecula, Calif.; Amersham Biosciences, Piscataway, N.J.).

Cells determined to be appropriate for a particular phenotypic assay (i.e., A549, HeLa, Jurkat, BJAB, Colo205, H1299, MCF7, MDA-MB-231, PC3, HUMEC, HUVEC, and PrEC and any others known to express the target of interest) are treated with antibodies as well as control compounds. If necessary, a ligand for the receptor target is included so that activation of the receptor is effected. At the end of the treatment period, treated and untreated cells are analyzed by one or more methods specific for the assay to determine phenotypic outcomes and endpoints.

Phenotypic endpoints include changes in cell morphology over time or treatment dose as well as changes in levels of cellular components such as proteins, lipids, nucleic acids, hormones, saccharides or metals. Measurements of cellular status which include pH, stage of the cell cycle, intake or excretion of biological indicators by the cell, are also endpoints of interest.

The assays can be performed to assess the direct effects of an antibody on a target protein. For example, if the target protein is a cell surface receptor, an antibody can be added to assess whether the target protein directly modulates, such as by stimulation, the activity or function of the receptor. In such instances, the antibody is deemed an agonist antibody. In other examples, if the target protein is a cell surface receptor, the activity of the receptor can be stimulated in the presence of a ligand or other stimulating agent in the presence or absence of the antibody to determine if the antibody modulates (e.g. inhibits) the actions of the antibody. For example, the antibody can act by blocking the ability of the ligand to interact with the receptor and/or otherwise induce a negative stimulatory signal. In such instances, the antibody is deemed to be an antagonist of the receptor. Thus, the methods of screening herein by functional activity permits identification of agonist and antagonist antibodies.

a. Differentiation

Cellular differentiation can be analyzed using any assay that allows a detection of a physical, chemical or phenotypic change. Various assays are used to quantitatively determine cellular proliferation and activation in response to an external stimuli. Cell proliferation assays are used to quantitatively determine cellular proliferation by incorporating a reagent into the DNA of newly synthesized cells upon cell division. Such reagents include, but are not limited to 3H-thymidine, 5-bromo-2′-deoxyuridine (BrdU) and fluorescent Hoechst dyes. Cell viability assays are used to determine the number of healthy cells in a sample by staining cells with a dye and measuring how many cells uptake the dye based on the fact that living cells will exclude the dye. Such dyes include but are not limited to 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MIT), 2,3-Bis(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide inner salt (XTT), and 4-[3-(4-iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1,3-benzene disulfonate (WST-1). Uptake of the reagent is measured either colorimetrically using a spectrophotometer or by measuring radiation with a scintillation counter. Details of these methods are well-known to one skilled in the art.

Fluorescent dyes are commonly used for the detection of live cells and key functional activities in a variety of cell-based assays. There are several non-radioactive, fluorescence-based assays that are not dependent on cellular metabolism. The fluorescent dye binds nucleic acids and the fluorescence can then be measured quantitatively or qualitatively. Such dyes include, but are not limited to, propidium iodide and Hoechst 33342. The cell number can then be quantitated based on the fluorescence. DNA content can also be quantitated using the tools available in the imaging instruments. Details of these methods are well known to one skilled in the art.

The degree of invasiveness into Matrigel or some other extracellular matrix constituent can be used as an assay to identify antibodies that are capable of inhibiting abnormal cell proliferation and tumor growth. Tumor cells exhibit a good correlation between malignancy and invasiveness of cells into Matrigel or some other extracellular matrix constituent. In this assay, tumorigenic cells are typically used as host cells. Therefore, antibodies can be identified by measuring changes in the level of invasiveness between the host cells before and after the introduction of potential modulators.

Briefly, the level of invasion of host cells can be measured by using filters coated with Matrigel or some other extracellular matrix constituent. Penetration into the gel, or through to the distal side of the filter, is rated as invasiveness, and rated histologically by number of cells and distance moved, or by prelabeling the cells with 125I and counting the radioactivity on the distal side of the filter or bottom of the dish. (see, e.g., Freshney, Culture of Animal Cells a Manual of Basic Technique, 3rd ed., Wiley-Liss, New York (1994), herein incorporated by reference).

b. Alteration of Gene Expression

Detection of binding and/or modulation of a target by an antibody can be accomplished by detecting a biological response, such as, for example, measuring Ca2+ ion flux, cAMP, IP3, PIP3 or transcription of reporter genes. Analysis of the genotype of the cell (measurement of the expression of one or more of the genes of the cell using a reporter gene assay) after treatment is also used as an indicator of the efficacy or potency of the antibody. Hallmark genes, or those genes suspected to be associated with a signal transduction pathway are measured in both treated and untreated cells.

Assays can be performed that measure the activation of a reporter gene. Suitable reporter genes include endogenous genes as well as exogenous genes that are introduced into a cell by any of the standard methods familiar to the skilled artisan, such as transfection, electroporation, lipofection and viral infection. For example, cells expressing a recombinant receptor can be transfected with a reporter gene (e.g., chloramphenicol acetyltransferase, firefly luciferase, bacterial luciferase, β-galactosidase and alkaline phosphatase) operably linked to a response element. The cells are then incubated with antibodies and the expression of the reporter gene is compared to expression in control cells that do not express the recombinant receptor but that are essentially identical in other respects. A statistically significant change in reporter gene expression in the receptor-expressing cells is indicative of a test compound that interacts with the receptor. Furthermore, the protein of interest can be used as an indirect reporter via attachment to a second reporter such as red or green fluorescent protein (see, e.g., Mistili & Spector, (1997) Nature Biotechnology 15:961-964).

The reporter construct is typically transfected into a cell. After treatment with a potential modulator, the amount of reporter gene transcription, translation, or activity is measured according to standard techniques known to those of skill in the art. The use of a reporter gene assay using luciferase to measure activiation of STATS directly or by induction of cyclin-D promoter is exemplified in Example 12.

c. Cytotoxicity Activity

Antibodies can be screened for their ability to directly induce apoptosis or programmed cell death or to indirectly induce apoptosis by blocking growth factor receptors, thereby effectively arresting proliferation. Antibodies also bind complement, leading to direct cell toxicity, known as complement dependent cytotoxicity (CDC). Thus, assays can be performed to assess complement-dependent cytotoxicity.

A variety of assays to assess apoptosis are known to one of skill in the art. For example, apoptosis assays include those that assay for the activation of a caspase, which are enzymes involved in apoptosis. Caspase assays are based on the measurement of zymogen processing to an active enzyme and proteolytic activity. A number of commercial kits and reagents are available to assess apoptosis based on caspase function including, but not limited to, PhiPhiLux (OncoImmunin, Inc.), Caspase 3 activity assay (Roche Applied science), Homogenous Caspase assay (Roche Applied Science), Caspase-Glo Assays (Promega), Apo-ONE Homogeneous Caspase-3/7 Assay (Promega), CaspACE Assay System Colorimetric or Fluormetric (Promega), EnzChek Caspase-3 Assay Kit (Invitrogen), Imag-iT LIVE green Caspase-3 and 7 Detection Kit (Invitrogen), Active Caspase-3 Detection Kits (Stratagene), Caspase-mediated Apoptosis Products (BioVision) and CasPASE Apoptosis Assay Kit (Genotech).

Assays for apoptosis include TUNEL and DNA fragmentation assays that measure the activation of nucleases and subsequent cleavage of DNA into 180 to 200 base pair increments. Such assays and kits are commercially available and include, but are not limited to, Apoptotic DNA Ladder Kit (Roche Applied Science), Cellular DNA Fragmentation ELISA (Roche Applied Science), Cell Death Detection ELISAPLUS (Roche Applied Science), In Situ Cell Death Detection Kit (Roche Applied Science), DeadEnd Fluorometirc or Colorimetric TUNEL System (Promega), APO-BrdU TUNEL Assay Kit (Invitrogen), and TUNEL Apoptosis Detection Kit (Upstate).

Other assays to assess apoptosis include, for example, cell permeability assays that evaluate the loss of membrane integrity. For example, to determine whether the antibody is able to induce cell death, loss of membrane integrity as evaluated by uptake of propidium iodide (PI), trypan blue, or 7-aminoactinomycin D (7AAD) can be assessed relative to untreated cells. In addition, commercial kits such as APOPercentage Assay (Biocolor Assays) can be used to measure apoptosis. Annexin V assays also can be employed. Annexin V binds to phosphatidylserine, which is normally found on the inner surface of the cytoplasmic membrane. During apoptosis, phosphatidylserine is translocated to the outer surface and can be detected by Annexin V. For example, standard binding assays using a fluorescent labeled Annexin V can be used (e.g. Annexin V, Alex Fluor 350 Conjugate from Invitrogen). Apoptosis also can be measured by assessing the presence of other markers of apoptosis, assessing protein cleavage, and/or by mitochondrial and ATP/ADP assays. Such assays are routine and known to one of skill in the art.

For example, apoptosis analysis can be used as an assay to identify functional antibodies using cell lines, such as RKO or HCT116, or other cells expressing a target protein of interest. The cells can be co-transfected with a construct containing a marker gene, such as a gene that encodes green fluorescent protein, or a cell tracker dye. The apoptotic change can be determined using methods known in the art, such as DAPI staining and TUNEL assay using fluorescent microscope. For TUNEL assay, commercially available kit can be used (e.g., Fluorescein FragEL DNA Fragmentation Detection Kit (Oncogene Research Products, Cat.# QIA39) and Tetramethyl-rhodamine-5-dUTP (Roche, Cat. #1534 378)). Cells contacted with an antibody exhibit, e.g., an increased apoptosis compared to control.

Cell death in vitro can be determined in the absence of complement and immune effector cells to distinguish cell death induced by antibody dependent cellular cytotoxicity (ADCC) or complement dependent cytotoxicity (CDC). Thus, the assay for cell death can be performed using heat inactivated serum (i.e. in the absence of complement) and in the absence of immune effector cells.

3. In Vivo Assays

Once an affinity matured antibody or converted antibody is generated by the methods herein, it can be assessed in vivo assays associated with aberrant activity of the target. In general, the method involves administering an antibody to a subject, generally a non-human animal model for a disease or condition and determining the effect of the antibody on the on the disease or condition of the model animal. In vivo assays include controls, where suitable controls include a sample in the absence of the antibody. Generally a plurality of assay mixtures is run in parallel with different antibody concentrations to obtain a differential response to the various concentrations. Typically, one of these concentrations serves as a negative control, i.e. at zero concentration or below the level of detection.

Non-human animals models include those induced to have a disease such as by injection with disease and/or phenotype-inducing substances prior to administration of the antibodies to monitor the effects on disease progression. Genetic models also are useful. Animals, such as mice, can be generated which mimic a disease or condition by the overexpression, underexpression or knock-out of one or more genes. Such animals can be generated by transgenic animal production techniques well-known in the art or using naturally-occurring or induced mutant strains. One of skill in the art is familiar with various animal models associated with particular targets.

Such animal model systems include, but are not limited to, mice, rats, rabbits, guinea pigs, sheep, goats, pigs, and non-human primates, e.g. baboons, chimpanzees and monkey. Any animal system well-known in the art can be used. Several aspects of the procedure can vary; said aspects include, but are not limited to, the temporal regime of administering the antibodies (e.g., prophylactic and/or therapeutic agents), whether such antibodies are administered separately or as an admixture, and the frequency of administration of the antibodies.

Recombinant (transgenic) animal models can be engineered by introducing the coding portion of the genes identified herein into the genome of animals of interest, using standard techniques for producing transgenic animals Animals that can serve as a target for transgenic manipulation include, without limitation, mice, rats, rabbits, guinea pigs, sheep, goats, pigs, and non-human primates, e.g. baboons, chimpanzees and monkeys. Techniques known in the art to introduce a transgene into such animals include pronucleic microinjection (U.S. Pat. No. 4,873,191); retrovirus-mediated gene transfer into germ lines (e.g., Van der Putten et al., (1985) Proc. Natl. Acad. Sci. USA 82:6148-615); gene targeting in embryonic stem cells (Thompson et al., (1989) Cell 56:313-321); electroporation of embryos (Lo, (1983) Mol. Cel. Biol. 3:1803-1814); sperm-mediated gene transfer (Lavitrano et al., (1989) Cell 57:717-73). For review, see, for example, U.S. Pat. No. 4,736,866.

Animal models can be used to assess the efficacy of an antibody, a composition, or a combination therapy provided herein. Examples of animal models for lung cancer include, but are not limited to, lung cancer animal models (see e.g. Zhang et al., (1994) In Vivo 8(5):755-69) and a transgenic mouse model with disrupted p53 function (see, e.g., Morris et al., (1998) J La State Med Soc 150(4):179-85). An example of an animal model for breast cancer includes, but is not limited to, a transgenic mouse that overexpresses cyclin D1 (see, e.g., Hosokawa et al., (2001) Transgenic Res 10(5):471-8). An example of an animal model for colon cancer includes, but is not limited to, a TCR b and p53 double knockout mouse (see, e.g., Kado et al., (2001), Cancer Res 61(6):2395-8). Examples of animal models for pancreatic cancer include, but are not limited to, a metastatic model of Panc02 murine pancreatic adenocarcinoma (see, e.g., Wang et al., (2001) Int J Pancreatol 29(1):37-46) and nu-nu mice generated in subcutaneous pancreatic tumors (see, e.g., Ghaneh et al., (2001) Gene Ther 8(3):199-208). Examples of animal models for non-Hodgkin's lymphoma include, but are not limited to, a severe combined immunodeficiency (“SCID”) mouse (see, e.g., Bryant et al., (2000) Lab Invest 80(4):553-73) and an IgHmu-HOX11 transgenic mouse (see, e.g., Hough et al., (1998) Proc Natl Acad Sci USA 95(23):13853-8). An example of an animal model for esophageal cancer includes, but is not limited to, a mouse transgenic for the human papillomavirus type 16 E7 oncogene (see, e.g., Herber et al., (1996) J Virol 70(3):1873-81). Examples of animal models for colorectal carcinomas include, but are not limited to, Apc mouse models (see, e.g., Fodde & Smits, (2001) Trends Mol Med 7(8):369-73 and Kuraguchi et al., (2000) Oncogene 19(50):5755-63).

Animal models for arthritis include, but are not limited to, rheumatoid arthritis rats (see e.g. Pearson, (1956) Proc. Soc. Exp. Biol. Med., 91:95-101) and collagen induced arthritis in mice and rats (see e.g. Current Protocols in Immunology, Eds. J. E. Cologan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach and W. Strober, John Wiley & Sons, Inc., 1994). An example of an animal model for asthma, includes but is not limited to, a mouse model of pulmonary hypersensitivity (see e.g. Riese et al. (1998) J. Clin. Invest. 101:2351-2363 and Shi, et al. (1999) Immunity 10:197-206). Animal models for allogenic rejection include, but are not limited to, rat allogeneic heart transplant models (see e.g. Tanabe et al. (1994) Transplantation 58:23-27 and Tinubu et al. (1994) J. Immunol. 153:4330-4338) and rat heterocardiac allograft rejection (Jae-Hyuck Sim et al. (2002) Proc Natl Acad Sci 99(16):10617-10622). Steel mice are used as a model of human aplastic anemia (see e.g. Jones, (1983) Exp. Hematol., 11:571-580). An example of an animal model for anemia, includes but is not limited to, hemolytic anemia guinea pigs (see e.g. Schreiber, et al. (1972) J. Clin. Invest. 51:575). An example of an animal model for neutropenia, includes but is not limited to, neutropenia neutropenic CD rats (see, e.g. Nohynek et al. (1997) Cancer Chemother. Pharmacol. 39:259-266).

F. METHODS OF PRODUCTION OF ANTIBODIES

Nucleic acid molecules and antibodies generated by the methods provided herein can be made by any method known to one of skill in the art. Such procedures are routine and are well known to the skill artisan. They include routine molecular biology techniques including gene synthesis, PCR, ligation, cloning, transfection and purification techniques. A description of such procedures is provided below.

For example, nucleic acid sequences can be constructed using gene synthesis techniques as discussed herein above. Gene synthesis or routine molecular biology techniques also can be used to effect insertion, deletion, addition or replacement of nucleotides. For example, additional nucleotide sequences can be joined to a nucleic acid sequence. In one example linker sequences can be added, such as sequences containing restriction endonuclease sites for the purpose of cloning the synthetic gene into a vector, for example, a protein expression vector or a vector designed for the amplification of the antibody constant region coding DNA sequences. Furthermore, additional nucleotide sequences specifying functional DNA elements can be operatively linked to a recombined germline encoding nucleic acid molecule. Examples of such sequences include, but are not limited to, promoter sequences designed to facilitate intracellular protein expression, and leader peptide sequences designed to facilitate protein secretion. Additional nucleotide sequences such as sequences specifying protein binding regions also can be linked to nucleic acid sequences. Such regions include, but are not limited to, sequences to facilitate uptake of recombined antibodies or fragments thereof into specific target cells, or otherwise enhance the pharmacokinetics of the synthetic gene.

Nucleic acid sequences can be further engineered as described herein, such as by mutagenesis, to generate mutant antibodies. Mutagenesis can be effected entirely through gene synthesis. For example, nucleic acid molecules can be designed manually or in silico for synthesis to encode mutant antibodies. The benefit of using gene synthesis methods is that the mutations can be effected so that the resulting nucleic acid molecules are in-frame and are “productive” as discussed herein above. Other methods of synthesis exist where randomization can be achieved during the gene synthesis. For example, a protocol has been developed by which synthesis of an oligonucleotide is “doped” with non-native phosphoramidites, resulting in randomization of the gene section targeted for random mutagenesis (Wang and Hoover (1997) J. Bacteriol., 179:5812-9). This method allows control of position selection while retaining a random substitution rate. Alternatively, mutagenesis can be effected through other molecular biology techniques. Generally, site-directed mutagenesis strategies can be employed.

Other current methods can be used to create mutant antibodies include, but are not limited to, error-prone polymerase chain reaction (Caldwell and Joyce (1992); Gram et al. (1992) Proc. Natl. Acad. Sci., 89:3576-80); cassette mutagenesis in which the specific region to be optimized is replaced with a synthetically mutagenized oligonucleotide (Stemmer and Morris (1992) Biotechniques, 13:214-20); Arkin and Youvan (1992) Proc. Natl. Acad. Sci., 89:7811-7815; Oliphant et al. (1986) Gene, 44:177-83; Hermes et al. (1990) Proc. Natl. Acad. Sci, 87:696-700); the use of mutator strains of hosts cells to add mutational frequency (Greener et al. (1997) Mol. Biotechnol., 7:189-95); DNA shuffling (Crameri et al. (1998) Nature, 391:288-291; U.S. Pat. No. 6,177,263; U.S. Pat. No. 5,965,408; Ostermeier et al. (1999) Nat. Biotechnol., 17:1205-1209); and other random mutagenesis methods.

Antibodies provided herein can be generated or expressed as full-length antibodies or as antibodies that are less than full length, including, but not limited to Fabs, Fab hinge fragment, scFv fragment, scFv tandem fragment and scFv hinge and scFv hinge (ΔE) fragments. Various techniques have been developed for the production of antibody fragments. Traditionally, these fragments were derived via proteolytic digestion of intact antibodies (see e.g. Morimoto et al. (1992) Journal of Biochemical and Biophysical Methods, 24:107-117; Brennance et al. (1985) Science, 229:81). Fragments also can be produced directly by recombinant host cells. Fab, Fv and scFv antibody fragments can all be expressed in and secreted from host cells, such as E. coli, thus allowing the facile production of large amounts of these fragments. Also, Fab′-SH fragments can be chemically coupled to form F(ab′)2 fragments (Carter et al. (1992) Bio/Technology, 10:163-167). According to another approach, F(ab′)2 fragments can be isolated directly from recombinant host cell culture. In other examples, the antibody of choice is a single chain Fv fragment (scFv) (see e.g. WO93/16185; U.S. Pat. No. 5,571,894 and U.S. Pat. No. 5,587,458. Fv and sFv are the only species with intact combining sites that are devoid of constant regions; thus, they are suitable for reduced nonspecific binding during in vivo use. sFv fusion proteins can be constructed to yield fusion of an effector protein at either the amino or the carboxy terminius of an sFv. The antibody fragment can also be a linear antibody (see e.g. U.S. Pat. No. 5,641,870). Such linear antibody fragments can be monospecific or bispecific. Other techniques for the production of antibody fragments or antibody multimers are known to one of skill in the art.

For example, upon expression, antibody heavy and light chains pair by disulfide bond to form a full-length antibody or fragments thereof. For example, for expression of a full-length Ig, sequences encoding the VH-CH1-hinge-CH2-CH3 can be cloned into a first expression vector and sequences encoding the VL-CL domains can be cloned into a second expression vector. Upon co-expression with the second expression vector encoding the VL-CL domains, a full-length antibody is expressed. In another example, to generate a Fab, sequences encoding the VH-CH1 can be cloned into a first expression vector and sequences encoding the VL-CL domains can be cloned into a second expression vector. The heavy chain pairs with a light chain and a Fab monomer is generated. In this example, exemplary vectors include Plasmids A, C, D and E as described elsewhere herein. Sequences of CH1, hinge, CH2 and/or CH3 of various IgG sub-types are known to one of skill in the art (see e.g. U.S. Published Application No. 20080248028; see also SEQ ID NO: 2922). Similarly, sequences of CL, lambda or kappa, also is known (see e.g. U.S. Published Application No. 20080248028; see also SEQ ID NOS: 2923-2924).

1. Vectors

Provided herein are vectors for expression of nucleic acid encoding variable heavy chain or a variable light chain. The nucleic acids encoding antibody polypeptides are typically cloned into a intermediate vector before transformation into prokaryotic or eukaryotic cells. Choice of vector can depend on the desired application. For example, after insertion of the nucleic acid, the vectors typically are used to transform host cells, for example, to amplify the antibody genes for replication and/or expression thereof. In such examples, a vector suitable for high level expression is used. In other cases, a vector is chosen that is compatible with display of the expressed polypeptide on the surface of the cell.

The nucleic acids encoding antibody polypeptides are typically cloned into a vector before transformation into prokaryotic or eukaryotic cells. Choice of vector can depend on the desired application. For example, after insertion of the nucleic acid, the vectors typically are used to transform host cells, for example, to amplify the antibody genes for replication and/or expression thereof. In such examples, a vector suitable for high level expression is used. Expression can be in any cell expression system known to one of skill in the art. Exemplary cells for expression include, but are not limited to, 293FS cells, HEK293-6E cells or CHO cells. Other expression vectors and host cells are described below.

Generally, nucleic acid encoding the heavy chain of an antibody is cloned into a vector and the nucleic acid encoding the light chain of an antibody is cloned into the vector. The genes can be cloned into a single vector for dual expression thereof, or into separate vectors. If desired, the vectors also can contain further sequences encoding additional constant region(s) or hinge regions to generate other antibody forms.

Many expression vectors are available and known to those of skill in the art for the expression of antibodies or portions thereof. The choice of an expression vector is influenced by the choice of host expression system. Such selection is well within the level of skill of the skilled artisan. In general, expression vectors can include transcriptional promoters and optionally enhancers, translational signals, and transcriptional and translational termination signals. Expression vectors that are used for stable transformation typically have a selectable marker which allows selection and maintenance of the transformed cells. In some cases, an origin of replication can be used to amplify the copy number of the vectors in the cells. Vectors also generally can contain additional nucleotide sequences operably linked to the ligated nucleic acid molecule (e.g. His tag, Flag tag). For purposes herein, vectors generally include sequences encoding the constant region. Thus, recombined antibodies or portions thereof also can be expressed as protein fusions. For example, a fusion can be generated to add additional functionality to a polypeptide. Examples of fusion proteins include, but are not limited to, fusions of a signal sequence, an epitope tag such as for localization, e.g. a his6 tag or a myc tag, or a tag for purification, for example, a GST fusion, and a sequence for directing protein secretion and/or membrane association.

For example, expression of the proteins can be controlled by any promoter/enhancer known in the art. Suitable bacterial promoters are well known in the art and described herein below. Other suitable promoters for mammalian cells, yeast cells and insect cells are well known in the art and some are exemplified below. Selection of the promoter used to direct expression of a heterologous nucleic acid depends on the particular application. Promoters which can be used include but are not limited to eukaryotic expression vectors containing the SV40 early promoter (Bernoist and Chambon, Nature 290:304-310 (1981)), the promoter contained in the 3′ long terminal repeat of Rous sarcoma virus (Yamamoto et al. Cell 22:787-797 (1980)), the herpes thymidine kinase promoter (Wagner et al., Proc. Natl. Acad. Sci. USA 78:1441-1445 (1981)), the regulatory sequences of the metallothionein gene (Brinster et al., Nature 296:39-42 (1982)); prokaryotic expression vectors such as the β-lactamase promoter (Jay et al., (1981) Proc. Natl. Acad. Sci. USA 78:5543) or the tac promoter (DeBoer et al., Proc. Natl. Acad. Sci. USA 80:21-25 (1983)); see also “Useful Proteins from Recombinant Bacteria”: in Scientific American 242:79-94 (1980)); plant expression vectors containing the nopaline synthetase promoter (Herrara-Estrella et al., Nature 303:209-213 (1984)) or the cauliflower mosaic virus 35S RNA promoter (Gardner et al., Nucleic Acids Res. 9:2871 (1981)), and the promoter of the photosynthetic enzyme ribulose bisphosphate carboxylase (Herrera-Estrella et al., Nature 310:115-120 (1984)); promoter elements from yeast and other fungi such as the Gal4 promoter, the alcohol dehydrogenase promoter, the phosphoglycerol kinase promoter, the alkaline phosphatase promoter, and the following animal transcriptional control regions that exhibit tissue specificity and have been used in transgenic animals: elastase I gene control region which is active in pancreatic acinar cells (Swift et al., Cell 38:639-646 (1984); Ornitz et al., Cold Spring Harbor Symp. Quant. Biol. 50:399-409 (1986); MacDonald, Hepatology 7:425-515 (1987)); insulin gene control region which is active in pancreatic beta cells (Hanahan et al., Nature 315:115-122 (1985)), immunoglobulin gene control region which is active in lymphoid cells (Grosschedl et al., Cell 38:647-658 (1984); Adams et al., Nature 318:533-538 (1985); Alexander et al., Mol. Cell Biol. 7:1436-1444 (1987)), mouse mammary tumor virus control region which is active in testicular, breast, lymphoid and mast cells (Leder et al., Cell 45:485-495 (1986)), albumin gene control region which is active in liver (Pinckert et al., Genes and Devel. 1:268-276 (1987)), alpha-fetoprotein gene control region which is active in liver (Krumlauf et al., Mol. Cell. Biol. 5:1639-1648 (1985); Hammer et al., Science 235:53-58 1987)), alpha-1 antitrypsin gene control region which is active in liver (Kelsey et al., Genes and Devel. 1:161-171 (1987)), beta globin gene control region which is active in myeloid cells (Magram et al., Nature 315:338-340 (1985); Kollias et al., Cell 46:89-94 (1986)), myelin basic protein gene control region which is active in oligodendrocyte cells of the brain (Readhead et al., Cell 48:703-712 (1987)), myosin light chain-2 gene control region which is active in skeletal muscle (Shani, Nature 314:283-286 (1985)), and gonadotrophic releasing hormone gene control region which is active in gonadotrophs of the hypothalamus (Mason et al., Science 234:1372-1378 (1986)).

In addition to the promoter, the expression vector typically contains a transcription unit or expression cassette that contains all the additional elements required for the expression of the antibody, or portion thereof, in host cells. A typical expression cassette contains a promoter operably linked to the nucleic acid sequence encoding the germline antibody chain and signals required for efficient polyadenylation of the transcript, ribosome binding sites and translation termination. Additional elements of the cassette can include enhancers. In addition, the cassette typically contains a transcription termination region downstream of the structural gene to provide for efficient termination. The termination region can be obtained from the same gene as the promoter sequence or can be obtained from different genes.

Some expression systems have markers that provide gene amplification such as thymidine kinase and dihydrofolate reductase. Alternatively, high yield expression systems not involving gene amplification are also suitable, such as using a baculovirus vector in insect cells, with a nucleic acid sequence encoding a germline antibody chain under the direction of the polyhedron promoter or other strong baculovirus promoter.

Exemplary expression vectors include any mammalian expression vector such as, for example, pCMV. For bacterial expression, such vectors include pBR322, pUC, pSKF, pET23D, and fusion vectors such as MBP, GST and LacZ. Exemplary of such a vector are bacterial expression vectors such as, for example, plasmid A, plasmid C, plasmid D and plasmid E, described herein. Other eukaryotic vectors, for example any containing regulatory elements from eukaryotic viruses can be used as eukaryotic expression vectors. These include, for example, SV40 vectors, papilloma virus vectors, and vectors derived from Epstein-Bar virus. Other exemplary eukaryotic vectors include pMSG, pAV009/A+, pMT010/A+, pMAMneo-5, baculovirus pDSCE, and any other vector allowing expression of proteins under the direction of the CMV promoter, SV40 early promoter, SV40 late promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedron promoter, or other promoters shown effective for expression in eukaryotes.

Vectors can be provided that contain a sequence of nucleotides that encodes a constant region of an antibody operably linked to the nucleic acid sequence encoding the variable region of the antibody. The vector can include the sequence for one or all of a CH1, CH2, CH3 or CH4 and/or CL. Generally, such as for expression of Fabs, the vector contains the sequence for a CH1 or CL. In one example, nucleic acid encoding the heavy chain of an antibody, is ligated into a first expression vector and nucleic acid encoding the light chain of an antibody, is ligated into a second expression vector. The expression vectors can be the same or different, although generally they are sufficiently compatible to allow comparable expression of proteins (heavy and light chain) therefrom. The first and second expression vectors are generally co-transfected into host cells, typically at a 1:1 ratio. Exemplary of vectors include, but are not limited to, pγ1HC and pκLC (Tiller et al. (2008) J Immunol. Methods, 329:112-24). Other expression vectors include the light chain expression vector pAG4622 and the heavy chain expression vector pAH4604 (Coloma et al. (1992) J Immunol. Methods, 152:89-104). The pAG4622 vector contains the genomic sequence encoding the C-region domain of the human κL chain and the gpt selectable marker. The pAH4604 vectors contain the hisD selectable marker and sequences encoding the human H chain γ1 C-region domain. In another example, the heavy and light chain can be cloned into a single vector that has expression cassettes for both the heavy and light chain. Other exemplary expression vectors include Plasmids A, C, D and E, described elsewhere herein.

For purposes herein, vectors are provided that contain a sequence of nucleotides that encodes a constant region of an antibody operably linked to the nucleic acid sequence encoding the recombined variable region of the antibody. The vector can include the sequence for one or all of a CH1, CH2, hinge, CH3 or CH4 and/or CL. Generally, such as for expression of Fabs, the vector contains the sequence for a CH1 (amino acids 1-103 of SEQ ID NO:2922) or CL (for kappa light chains, see SEQ ID NO:2923; for lambda light chains, see SEQ ID NO:2924). The sequences of constant regions or hinge regions are known to one of skill in the art (see e.g. U.S. Published Application No. 20080248028 and SEQ ID NOS:2922-2924, including CH1 (amino acids 1-103 of SEQ ID NO:2922), IgG1 hinge region (amino acids 104-119 of SEQ ID NO:2922), IgG1 CH2 (amino acids 120-223 of SEQ ID NO:2922), IgG1 CH3 (amino acids 224-330 of SEQ ID NO:2922), CL kappa (SEQ ID NO:2923) and CL lambda (SEQ ID NO:2924). Exemplary of such vectors containing a heavy chain constant region gene (e.g. CH1) are plasmids A and D, described herein. Exemplary of such vectors containing a light chain constant region genes are plasmids C and E, described herein.

Exemplary plasmid vectors for transformation of E. coli cells, include, for example, the ColE1 replication vectors described herein. Several features common to all these vectors include (a) a pBAD inducible promoter; (b) an AraC gene, which controls the pBAD promoter; (c) a synthetic ribosomal binding site (RBS) for efficient translation; (d) a ColE1 origin of replication, allowing for high copy expression; (e) a STII leader sequence, allowing for expressed proteins to be translocated to the periplasm; (f) a f1 origin of replication; and (g) a gene for conferring antibiotic resistance. Such plasmids include plasmid A (SEQ ID NO:84), plasmid C (SEQ ID NO:86), plasmid D (SEQ ID NO:85) and plasmid E (SEQ ID NO:87). Plasmid A and Plasmid D are utilized for expression of heavy chain antibody genes in as they contain a gene for the heavy chain constant region (CH1) operably linked to the inserted gene for the heavy chain variable region. The vectors contain NheI and NcoI restriction sites to allow for cloning of the recombined antibody genes described herein. Both vectors contain a pUC origin of replication, a ColE1 type origin of replication, and an aminoglycoside phosphotransferase gene conferring kanamycin resistance. Plasmid A contains a (His)6 Tag and a Flag Tag for protein purification. Plasmid D contains both a (His)6 Tag and a Flag Tag, and an additional LPETG tag, which allows for covalent attachment of the resulting protein using a sortase. Plasmid C and Plasmid E are utilized for expression of light chain antibody genes in as they contain a gene for the light chain constant region (CL) operably linked to the inserted gene for the light chain variable region. Plasmid C is specific for kappa light chains and contains BseWI and NcoI restriction sites to allow for cloning of the recombined antibody genes described herein. Plasmid E is specific for lambda light chains and contains AcrII and NcoI restriction sites to allow for cloning of the recombined antibody genes described herein. Both vectors contain a 3.3 origin of replication, a ColE1 type origin of replication, and a gene conferring chloramphenicol resistance. The vectors described above are designed to be utilized in a dual vector system, in which a light chain vector and a heavy chain vector are co-transformed. Thus, they contain two different but compatible ColE1 origins of replication utilized, one for heavy chains and one light chain. This allows for efficient expression of both chains of the antibody when the vectors are co-transformed and expressed.

Any methods known to those of skill in the art for the insertion of DNA fragments into a vector can be used to construct expression vectors containing a nucleic acid encoding an antibody chain. These methods can include in vitro recombinant DNA and synthetic techniques and in vivo recombinants (genetic recombination). The insertion into a cloning vector can, for example, be accomplished by ligating the DNA fragment into a cloning vector which has complementary cohesive termini. If the complementary restriction sites used to fragment the DNA are not present in the cloning vector, the ends of the DNA molecules can be enzymatically modified. Alternatively, any site desired can be produced by ligating nucleotide sequences (linkers) onto the DNA termini; these ligated linkers can contain specific chemically synthesized nucleic acids encoding restriction endonuclease recognition sequences.

2. Cells and Expression Systems

Cells containing the vectors also are provided. Generally, any cell type that can be engineered to express heterologous DNA and has a secretory pathway is suitable. Expression hosts include prokaryotic and eukaryotic organisms such as bacterial cells (e.g. E. coli), yeast cells, fungal cells, Archea, plant cells, insect cells and animal cells including human cells. Expression hosts can differ in their protein production levels as well as the types of post-translational modifications that are present on the expressed proteins. Further, the choice of expression host is often related to the choice of vector and transcription and translation elements used. For example, the choice of expression host is often, but not always, dependent on the choice of precursor sequence utilized. For example, many heterologous signal sequences can only be expressed in a host cell of the same species (i.e., an insect cell signal sequence is optimally expressed in an insect cell). In contrast, other signal sequences can be used in heterologous hosts such as, for example, the human serum albumin (hHSA) signal sequence which works well in yeast, insect, or mammalian host cells and the tissue plasminogen activator pre/pro sequence which has been demonstrated to be functional in insect and mammalian cells (Tan et al., (2002) Protein Eng. 15:337). The choice of expression host can be made based on these and other factors, such as regulatory and safety considerations, production costs and the need and methods for purification. Thus, the vector system must be compatible with the host cell used.

Expression in eukaryotic hosts can include expression in yeasts such as Saccharomyces cerevisiae and Pichia pastoris, insect cells such as Drosophila cells and lepidopteran cells, plants and plant cells such as tobacco, corn, rice, algae, and lemna. Eukaryotic cells for expression also include mammalian cells lines such as Chinese hamster ovary (CHO) cells or baby hamster kidney (BHK) cells. Eukaryotic expression hosts also include production in transgenic animals, for example, including production in serum, milk and eggs.

Recombinant molecules can be introduced into host cells via, for example, transformation, transfection, infection, electroporation and sonoporation, so that many copies of the gene sequence are generated. Generally, standard transfection methods are used to produce bacterial, mammalian, yeast, or insect cell lines that express large quantity of antibody chains, which is then purified using standard techniques (see e.g., Colley et al. (1989) J. Biol. Chem., 264:17619-17622; Guide to Protein Purification, in Methods in Enzymology, vol. 182 (Deutscher, ed.), 1990). Transformation of eukaryotic and prokaryotic cells are performed according to standard techniques (see, e.g., Morrison (1977) J. Bact. 132:349-351; Clark-Curtiss and Curtiss (1983) Methods in Enzymology, 101, 347-362). For example, any of the well-known procedures for introducing foreign nucleotide sequences into host cells can be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, biolistics, liposomes, microinjection, plasma vectors, viral vectors and any other the other well known methods for introducing cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into a host cell. Generally, for purposes herein, host cells are transfected with a first vector encoding at least a VH chain and a second vector encoding at least a VL chain. Thus, it is only necessary that the particular genetic engineering procedure used be capable of successfully introducing at least both genes into the host cell capable of expressing germline, or modified form thereof, antibody polypeptide.

Transformation of host cells with recombinant DNA molecules that incorporate the isolated recombined variable region gene, cDNA, or synthesized DNA sequence enables generation of multiple copies of the gene. Thus, the gene can be obtained in large quantities by growing transformants, isolating the recombinant DNA molecules from the transformants and, when necessary, retrieving the inserted gene from the isolated recombinant DNA. Generally, After the expression vector is introduced into the cells, the transfected cells are cultured under conditions favoring expression of the germline chain, which is recovered from the culture using standard purification techniques identified below.

Antibodies and portions thereof can be produced using a high throughput approach by any methods known in the art for protein production including in vitro and in vivo methods such as, for example, the introduction of nucleic acid molecules encoding antibodies or portions thereof into a host cell or host animal and expression from nucleic acid molecules encoding antibodies in vitro. Prokaryotes, especially E. coli, provide a system for producing large amounts of antibodies or portions thereof, and are particularly desired in applications of high-throughput expression and purification of proteins. Transformation of E. coli is a simple and rapid technique well known to those of skill in the art. E. coli host strains for high throughput expression include, but are not limited to, BL21 (EMD Biosciences) and LMG194 (ATCC). Exemplary of such an E. coli host strain is BL21. Vectors for high throughput expression include, but are not limited to, pBR322 and pUC vectors. Exemplary of such vectors are the vectors described herein, including plasmid A, plasmid C, plasmid D and plasmid E. Automation of expression and purification can facilitate high-throughput expression. For example, use of a Piccolo™ system (Wollerton et al. (2006) JALA, 11:291-303), a fully automatic system that combines cell culture with automated harvesting, lysing and purification units, or other similar robotic system can be employed.

a. Prokaryotic Expression

Prokaryotes, especially E. coli, provide a system for producing large amounts of antibodies or portions thereof. Transformation of E. coli is a simple and rapid technique well known to those of skill in the art. Expression vectors for E. coli can contain inducible promoters that are useful for inducing high levels of protein expression and for expressing proteins that exhibit some toxicity to the host cells. Examples of inducible promoters include the lac promoter, the trp promoter, the hybrid tac promoter, the T7 and SP6 RNA promoters and the temperature regulated λPL promoter.

Antibodies or portions thereof can be expressed in the cytoplasmic environment of E. coli. The cytoplasm is a reducing environment and for some molecules, this can result in the formation of insoluble inclusion bodies. Reducing agents such as dithiothreitol and (3-mercaptoethanol and denaturants (e.g., such as guanidine-HCl and urea) can be used to resolubilize the proteins. An exemplary alternative approach is the expression of antibodies or fragments thereof in the periplasmic space of bacteria which provides an oxidizing environment and chaperonin-like and disulfide isomerases leading to the production of soluble protein. Typically, a leader sequence is fused to the protein to be expressed which directs the protein to the periplasm. The leader is then removed by signal peptidases inside the periplasm. There are three major pathways to translocate expressed proteins into the periplasm, namely the Sec pathway, the SRP pathway and the TAT pathway. Examples of periplasmic-targeting leader sequences include the pelB leader from the pectate lyase gene, the StII leader sequence, and the DsbA leader sequence. An exemplary leader sequence is a DsbA leader sequence. In some cases, periplasmic expression allows leakage of the expressed protein into the culture medium. The secretion of proteins allows quick and simple purification from the culture supernatant. Proteins that are not secreted can be obtained from the periplasm by osmotic lysis. Similar to cytoplasmic expression, in some cases proteins can become insoluble and denaturants and reducing agents can be used to facilitate solubilization and refolding. Temperature of induction and growth also can influence expression levels and solubility. Typically, temperatures between 25° C. and 37° C. are used. Mutations also can be used to increase solubility of expressed proteins. Typically, bacteria produce aglycosylated proteins. Thus, if proteins require glycosylation for function, glycosylation can be added in vitro after purification from host cells.

b. Yeast

Yeasts such as Saccharomyces cerevisiae, Schizosaccharomyces pombe, Yarrowia lipolytica, Kluyveromyces lactis, and Pichia pastoris are useful expression hosts for recombined antibodies or portions thereof. Yeast can be transformed with episomal replicating vectors or by stable chromosomal integration by homologous recombination. Typically, inducible promoters are used to regulate gene expression. Examples of such promoters include AOX1, GAL1, GAL7, and GAL5 and metallothionein promoters such as CUP1. Expression vectors often include a selectable marker such as LEU2, TRP1, HIS3, and URA3 for selection and maintenance of the transformed DNA. Proteins expressed in yeast are often soluble. Co-expression with chaperonins such as Bip and protein disulfide isomerase can improve expression levels and solubility. Additionally, proteins expressed in yeast can be directed for secretion using secretion signal peptide fusions such as the yeast mating type alpha-factor secretion signal from Saccharomyces cerevisae and fusions with yeast cell surface proteins such as the Aga2p mating adhesion receptor or the Arxula adeninivorans glucoamylase. A protease cleavage site such as for the Kex-2 protease, can be engineered to remove the fused sequences from the expressed polypeptides as they exit the secretion pathway. Yeast also is capable of glycosylation at Asn-X-Ser/Thr motifs.

c. Insects

Insect cells, particularly using baculovirus expression, are useful for expressing antibodies or portions thereof. Insect cells express high levels of protein and are capable of most of the post-translational modifications used by higher eukaryotes. Baculovirus have a restrictive host range which improves the safety and reduces regulatory concerns of eukaryotic expression. Typical expression vectors use a promoter for high level expression such as the polyhedrin promoter and p10 promoter of baculovirus. Commonly used baculovirus systems include the baculoviruses such as Autographa californica nuclear polyhedrosis virus (AcNPV), and the Bombyx mori nuclear polyhedrosis virus (BmNPV) and an insect cell line such as Sf9 derived from Spodoptera frugiperda and TN derived from Trichoplusia ni. For high-level expression, the nucleotide sequence of the molecule to be expressed is fused immediately downstream of the polyhedrin initiation codon of the virus. To generate baculovirus recombinants capable of expressing human antibodies, a dual-expression transfer, such as pAcUW51 (PharMingen) is utilized. Mammalian secretion signals are accurately processed in insect cells and can be used to secrete the expressed protein into the culture medium

An alternative expression system in insect cells is the use of stably transformed cells. Cell lines such as Sf9 derived cells from Spodoptera frugiperda and TN derived cells from Trichoplusia ni can be used for expression. The baculovirus immediate early gene promoter IE1 can be used to induce consistent levels of expression. Typical expression vectors include the pIE1-3 and pI31-4 transfer vectors (Novagen). Expression vectors are typically maintained by the use of selectable markers such as neomycin and hygromycin.

d. Mammalian Cells

Mammalian expression systems can be used to express antibodies or portions thereof. Expression constructs can be transferred to mammalian cells by viral infection such as adenovirus or by direct DNA transfer such as liposomes, calcium phosphate, DEAE-dextran and by physical means such as electroporation and microinjection. Expression vectors for mammalian cells typically include an mRNA cap site, a TATA box, a translational initiation sequence (Kozak consensus sequence) and polyadenylation elements. Such vectors often include transcriptional promoter-enhancers for high-level expression, for example the SV40 promoter-enhancer, the human cytomegalovirus (CMV) promoter and the long terminal repeat of Rous sarcoma virus (RSV). These promoter-enhancers are active in many cell types. Tissue and cell-type promoters and enhancer regions also can be used for expression. Exemplary promoter/enhancer regions include, but are not limited to, those from genes such as elastase I, insulin, immunoglobulin, mouse mammary tumor virus, albumin, alpha fetoprotein, alpha 1 antitrypsin, beta globin, myelin basic protein, myosin light chain 2, and gonadotropic releasing hormone gene control. Selectable markers can be used to select for and maintain cells with the expression construct. Examples of selectable marker genes include, but are not limited to, hygromycin B phosphotransferase, adenosine deaminase, xanthine-guanine phosphoribosyl transferase, aminoglycoside phosphotransferase, dihydrofolate reductase and thymidine kinase. Antibodies are typically produced using a NEOR/G418 system, a dihydrofolate reductase (DHFR) system or a glutamine synthetase (GS) system. The GS system uses joint expression vectors, such as pEE12/pEE6, to express both heavy chain and light chain. Fusion with cell surface signaling molecules such as TCR-ζ and FcεRI-γ can direct expression of the proteins in an active state on the cell surface.

Many cell lines are available for mammalian expression including mouse, rat human, monkey, chicken and hamster cells. Exemplary cell lines include but are not limited to CHO, Balb/3T3, HeLa, MT2, mouse NS0 (nonsecreting) and other myeloma cell lines, hybridoma and heterohybridoma cell lines, lymphocytes, fibroblasts, Sp2/0, COS, NIH3T3, HEK293, 293S, 2B8, and HKB cells. Cell lines also are available adapted to serum-free media which facilitates purification of secreted proteins from the cell culture media. One such example is the serum free EBNA-1 cell line (Pham et al., (2003) Biotechnol. Bioeng. 84:332-42.)

e. Plants

Transgenic plant cells and plants can be used to express proteins such as any antibody or portion thereof described herein. Expression constructs are typically transferred to plants using direct DNA transfer such as microprojectile bombardment and PEG-mediated transfer into protoplasts, and with agrobacterium-mediated transformation. Expression vectors can include promoter and enhancer sequences, transcriptional termination elements and translational control elements. Expression vectors and transformation techniques are usually divided between dicot hosts, such as Arabidopsis and tobacco, and monocot hosts, such as corn and rice. Examples of plant promoters used for expression include the cauliflower mosaic virus CaMV 35S promoter, the nopaline synthase promoter, the ribose bisphosphate carboxylase promoter and the maize ubiquitin-1 (ubi-1) promoter promoters. Selectable markers such as hygromycin, phosphomannose isomerase and neomycin phosphotransferase are often used to facilitate selection and maintenance of transformed cells. Transformed plant cells can be maintained in culture as cells, aggregates (callus tissue) or regenerated into whole plants. Transgenic plant cells also can include algae engineered to produce proteases or modified proteases (see for example, Mayfield et al. (2003) PNAS 100:438-442). Because plants have different glycosylation patterns than mammalian cells, this can influence the choice of protein produced in these hosts.

3. Purification

Antibodies and portions thereof are purified by any procedure known to one of skill in the art. The antibodies generated or used by the methods herein can be purified to substantial purity using standard protein purification techniques known in the art including but not limited to, SDS-PAGE, size fraction and size exclusion chromatography, ammonium sulfate precipitation, chelate chromatography, ionic exchange chromatography or column chromatography. For example, antibodies can be purified by column chromatography. Exemplary of a method to purify antibodies is by using column chromatography, wherein a solid support column material is linked to Protein G, a cell surface-associated protein from Streptococcus, that binds immunoglobulins with high affinity. The antibodies can be purified to 60%, 70%, 80% purity and typically at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% purity. Purity can be assessed by standard methods such as by SDS-PAGE and coomassie staining.

Methods for purification of antibodies or portions thereof from host cells depend on the chosen host cells and expression systems. For secreted molecules, proteins are generally purified from the culture media after removing the cells. For intracellular expression, cells can be lysed and the proteins purified from the extract. When transgenic organisms such as transgenic plants and animals are used for expression, tissues or organs can be used as starting material to make a lysed cell extract. Additionally, transgenic animal production can include the production of polypeptides in milk or eggs, which can be collected, and if necessary further the proteins can be extracted and further purified using standard methods in the art.

When antibodies are expressed by transformed bacteria in large amounts, typically after promoter induction, although expression can be constitutive, the polypeptides can form insoluble aggregates. There are several protocols that are suitable for purification of polypeptide inclusion bodies known to one of skill in the art. Numerous variations will be apparent to those of skill in the art.

For example, in one method, the cell suspension is generally centrifuged and the pellet containing the inclusion bodies resuspended in buffer which does not dissolve but washes the inclusion bodies, e.g., 20 mM Tris-HCL (pH 7.2), 1 mM EDTA, 150 mM NaCl and 2% Triton-X 100, a non-ionic detergent. It can be necessary to repeat the wash step to remove as much cellular debris as possible. The remaining pellet of inclusion bodies can be resuspended in an appropriate buffer (e.g., 20 mM sodium phosphate, pH 6.8, 150 mM NaCl). Other appropriate buffers are apparent to those of skill in the art.

Alternatively, antibodies can be purified from bacteria periplasm. Where the polypeptide is exported into the periplasm of the bacteria, the periplasmic fraction of the bacteria can be isolated by cold osmotic shock in addition to other methods known to those of skill in the art. For example, in one method, to isolate recombinant polypeptides from the periplasm, the bacterial cells are centrifuged to form a pellet. The pellet is resuspended in a buffer containing 20% sucrose. To lyse the cells, the bacteria are centrifuged and the pellet is resuspended in ice-cold 5 mM MgSO4 and kept in an ice bath for approximately 10 minutes. The cell suspension is centrifuged and the supernatant decanted and saved. The recombinant polypeptides present in the supernatant can be separated from the host proteins by standard separation techniques well known to those of skill in the art. These methods include, but are not limited to, the following steps: solubility fractionation, size differential filtration, and column chromatography.

G. ANTI-DLL4 ACTIVATOR/MODULATOR ANTIBODIES AND USES THEREOF

Provided herein are anti-DLL4 multimer antibodies that specifically bind to human Delta-like ligand 4 (DLL4) DLL4 and that are activator/modulators of DLL4 activity. Thus, the multimer antibodies can be used as antiangiogenic therapeutics to treat diseases or disorders characterized by excessive or aberrant angiogenesis, such as for example, cancer or macular degeneration.

1. DLL4

a. Structure

DLL4 (set forth in SEQ ID NO:2904; and encoded by a sequence of nucleotides set forth in SEQ ID NO:2905) is a transmembrane protein ligand for Notch transmembrane receptors. The extracellular region contains 8 EGF-like repeats, as well as a DSL domain that is conserved among all Notch ligands and is necessary for receptor binding. The protein also contains a transmembrane region, and a cytoplasmic tail lacking any catalytic motifs. Human DLL4 is a 685 amino acid protein and contains the following domains corresponding to amino acids set forth in SEQ ID NO:2904: signal peptide (amino acids 1-25); MNNL (amino acids 26-92); DSL (amino acids 155-217); EGF-Like 1 (EGF1; amino acids 221-251); EGF-Like 2 (EGF2; amino acids 252-282); EGF-Like 3 (EGF3; amino acids 284-322); EGF-Like 4 (EGF4; amino acids 324-360); EGF-Like 5 (EGF5; amino acids 366-400); EGF-Like 6 (EGF6; amino acids 402-438); EGF-Like 7 (EGF7; amino acids 440-476); EGF-Like 8 (EGFR; amino acids 480-518); transmembrane (amino acids 529-551); and cytoplasmic domain (amino acids 553-685).

b. Expression

DLL4 is expressed widely in a variety of tissues, but its expression is predominantly localized to the vasculature. It is required for normal vascular development and is expressed on tumor vessels. It is upregulated in blood vessels during tumor angiogenesis and expression is dependent on VEGF signaling. DLL4 also is expressed on activated macrophages exposed to proinflammatory stimuli such as lipopolysaccharide, interleukin-1β, Toll-like receptor 4 ligands and other proinflammatory stimuli and it's signaling through the Notch pathway plays a role in inflammatory states characterized by macrophage activation (Fung et al. (2007) Circulation, 115: 2948-2956).

c. Function

DLL4 binds to Notch receptors. The evolutionary conserved Notch pathway is a key regulator of many developmental processes as well as postnatal self-renewing organ systems. From invertebrates to mammals, Notch signaling guides cells through a myriad of cell fate decisions and incluences proliferation, differentiation and apoptosis (Miele and Osborne (1999) J Cell Physiol., 181:393-409). The Notch family is made up of structurally conserved cell surface receptors that are activated by membrane bound ligands of the DSL gene family (named for Delta and Serrate from Drosophila and Lag-2 from C. elegans). Mammals have four receptors (Notch 1, Notch 2, Notch 3 and Notch 4) and five ligands (Jag 1, Jag 2, DLL1, DLL3, and DLL4). Upon activation by ligands presented on neighboring cells, Notch receptors undergo successive proteolytic cleavages; an extracellular cleavage mediated by an ADAM protease and a cleavage within the trnamembrane domain mediated by gamma secretase. This leads to the release of the Notch Intra-Cellular Domain (NICD), which translocates into the nucleus and forms a transcriptional complex with the DNA binding protein, RBP-Jk (also known as CSL for CBF1/Su(H)/Lag-1) and other transcriptional cofactors. The primary target genes of Notch activation include the HES (Hairy/Enhance of Split) gene family and HES-related genes (Hey, CHF, HRT, HESR), which in turn regulate the downstream transcriptional effectors in a tissue and cell-type specific manner (Iso et al. (2003) J Cell Physiol., 194:237-255; L1 and Harris (2005) Cancer Cell, 8:1-3).

Signaling by Notch receptors implicate a variety of cellular processes including, but not limited to, the normal maintenance and leukemic transformation of hematopoietic stem cells (HSCs; Kopper & Hajdu (2004) Pathol. Oncol. Res., 10:69-73); maintenance of neural stem cells including in their normal maintenance as well as in brain cancers (Kopper & Hajdu (2004) Pathol. Oncol. Res., 10:69-73; Purow et al. (2005) Cancer Res. 65:2353-63; Hallahan et al., (2004) Cancer Res. 64:7794-800); generation of a number of human cancers including in lymphoblastic leukemia/lymphoma (Ellisen et al. (1991) Cell, 66:649-61; Robey et al. (1996) Cell, 87:483-92; Pear et al. (1996) J. Exp. Med. 183:2283-91; Yan et al. (2001) Blood 98:3793-9; Bellavia et al. (2000) EMBO J. 19:3337-48; Pear & Aster (2004) Curr. Opin. Hematol., 11:416-33); breast cancer (Gallahan & Callahan (1987) J. Virol., 61:66-74; Brennan & Brown (2003) Breast Cancer Res., 5:69; Politi et al. (2004) Semin. Cancer Biol., 14:341-7; Weijzen et al. (2002) Nat. Med., 8:979-86; Parr et al. (2004) Int. J. Mol. Med., 14:779-86); cervical cancer (Zagouras et al. (1995) PNAS, 92:6414-8); renal cell carcinomas (Rae et al (2000) Int. J. Cancer, 88:726-32); head and neck squamous cell carcinomas (Leethanakul et al (2000) Oncogene, 19:3220-4); endometrial cancers (Suzuki et al. (2000) Int. J. Oncol., 17:1131-9); and neuroblastomas (van Limpt et al. (2000) Med. Pediatr. Oncol., 35:554-8). The Notch pathway also is involved in multiple aspects of vascular development including proliferation, migration, smooth muscle differentiation, angiogenesis and arterial-venous differentiation (Iso et al. (2003) Arterioscler. Thromb. Vasc. Biol. 23: 543).

The Notch ligand DLL4, which interacts with Notch-1 (Uniprot accession No. P46531; SEQ ID NO:2906) and Notch-4 receptors (Uniprot accession No. Q99466; SEQ ID NO:2907), is expressed predominantly in the vasculature. Studies assessing the effects of overexpression of DLL4 have shown that DLL4 is a negative regulator of angiogenesis, endothelial cell proliferation, migration and vessel branching (see e.g. Trindade et al. (2008) Blood 1:112). One explanation for the antiangiogenic activity of DLL4 is that it is a VEGF responsive gene and acts as a negative regulator of VEGF signaling, which is a proangiogenic factor. Thus, targeting the activation of DLL4 promotes the antiangiogenic activity of DLL4.

In contrast, blocking DLL4 is associated with nonproductive angiogensis. Although DLL4 increases angiogenesis characterized by sprouting and branching of blood vessels, it also is associated with a decrease in vessel function, thereby resulting in decreased tumor growth (Ridgway et al. (2006) Nature, 444:1083; Noguera-Troise et al. (2006) Nature, 444:1032). Accordingly, DLL4 function is associated with deregulated angiogenesis by uncoupling of tumor growth from tumor vascular density. Thus, blocking DLL4 signaling effectively reduces tumor growth by disrupting productive angiogenesis. Accordingly, targeting the inhibition of DLL4 also can be used to treat tumors undergoing angiogenesis (see e.g. International PCT application No. WO2009/085209).

2. Activator/Modulator Anti-DLL4 Multimer Antibodies

Provided herein are antibodies or antibody fragments thereof that are activator/modulators of DLL4 activity. The antibodies activate or increase the activity of DLL4, and thereby act as anti-angiogenic agents. For example, the antibody multimers provided herein increase the activity of DLL4-mediated receptor activation, for example activation of DLL4-mediated Notch-1 or Notch-4 signaling, compared to activation in the absence of the antibody multimer. DLL4-mediated activity is increased at least 1.1-fold, for example, between or about 1.2-fold to 5-fold, such as 1.1-fold, 1.2-, 1.3-, 1.4-, 1.5-, 1.6-, 1.7-, 1.8-, 1.9-, 2.0-, 2.5-, 3.0-, 3.5-, 4.0-, 4.5-, 5-fold or more in the presence of the antibody multimer compared to activation in its absence. Thus, the antibodies can be used to treat angiogenic diseases or disorders. In some examples, the antibodies provided herein are agonists. In other examples, the antibodies provided herein are activator/modulators of DLL4 by activating Notch signaling.

The antibody multimers provided herein exhibit rapid on/off kinetics for their binding site on DLL4. In particular, the antibody exhibits a fast koff. For example, when assessed as a monomeric Ig fragment, antibodies provided herein have a koff that is or is about between 1 s−1 to 5×10−2 s−1, for example, 0.5 s−1 to 0.01 s−1, such as for example, at or about 0.1 s−1. For example, the koff of antibodies provided herein, when assessed in Fab form, is at or about 5×10−2 s−1, 4×10−2 s−1, 3×10−2 s−1, 2×10−2 s−1, 1×10−2 s−1, 0.02 s−1, 0.03 s−1, 0.04 s−1, 0.05 s−1, 0.06 s−1, 0.07 s−1, 0.08 s−1, 0.09 s−1, 0.1 s−1, 0.2 s−1, 0.3 s−1, 0.4 s−1, 0.5 s−1, 0.6 s−1, 0.7 s−1, 0.8 s−1, 0.9 s−1, 1 s−1 or faster, so long as the antibody multimer specifically binds to DLL4. In some examples, the antibodies provided herein exhibit a dissociation half-life (t1/2), when assessed as a monomeric Ig fragment, that is between 0.5 seconds (s) to 150 s, for example, 1 s to 100 s, 5 s to 50 s or 5 s to 10 s. For example, the t1/2 of antibodies provided herein, when assessed as a monomeric Ig fragment, is or is about 1 s, 2 s, 3 s, 4 s, 5 s, 6 s, 7 s, 8 s, 9 s, 10 s, 20 s, 30 s, 40 s, 50 s, 60 s, 70 s, 80 s, 90 s, 100 s, 110 s, 120 s, 130 s, 140 s or 150 s. Methods to determine kinetic rate constants of antibodies are known to one of skill in the art. For example, surface plasmon resonance using Biacore™ instrument can be used (BiaCore Life Science; GE Healthcare). Services offering Biacore instrumentation and other instrumentations are available (Biosensor Tools; Salt Lake City, Utah; biosensortools.com/index.php).

Typically, antibody multimers provided herein exhibit a generally low binding affinity. For example, when assessed as a monomeric Ig fragment, antibodies provided herein exhibit a binding affinity that is 10−8 M or lower binding affinity. For example, the binding affinity is between 10−6 M to 10−8 M, such as between 4×10−6 M to 10−8 M, for example between 1×10−7 M to 10−8 M. For example, the binding affinity of antibodies provided herein, as a monomeric Ig fragment, is at or about 1×10−6 M, 2×10−6 M, 3×10−6 M, 4×10−6 M, 5×10−6 M, 6×10−6 M, 7×10−6 M, 8×10−6 M, 9×10−6 M, 1×10−7 M, 2×10−7 M, 3×10−7 M, 4×10−7 M, 5×10−7 M, 6×10−7 M, 7×10−7 M, 8×10−7 M, 9×10−7 M or 1×10−8 M. Methods to assess binding affinity are known to one of skill in the art and are described elsewhere herein in Section E.

The antibodies provided herein are multimers, such that they contain at least two antigen-binding sites. Generally, the antibodies provided herein contain at least two variable heavy chain, or a sufficient portion thereof to bind antigen; and two variable light chains, or a sufficient portion thereof to bind antigen that are associated by a multimerization domain. The multimers can be dimers, trimers or higher-order multimers of monomeric immunoglobulin molecules. The multimers include those that are bivalent, trivalent, tetravalent, pentavalent, hexavalent, heptavalent, or greater valency (i.e., containing 2, 3, 4, 5, 6, 7 or more antigen-binding sites). For example, dimers of whole immunoglobulin molecules or of F(ab′)2 fragments are tetravalent, whereas dimers of Fab fragments or scFv molecules are bivalent.

Individual antibodies within a multimer can have the same or different binding specificites. Typically, the multimers are monospecific, containing two or more antigen-binding domains that immunospecifically bind to the same epitope on DLL4. In some examples, antibody multimers can be generated that are multispecific, containing two or more antigen-binding domains that immunospecifically bind to two of more different epitopes. The epitopes can be DLL4 epitopes. In some examples, the antibody multimers bind an epitope in DLL4 and also bind an epitope in another different target antigen.

Techniques for engineering antibody multimers are known in the art, and include, for example, linkage of two or more variable heavy chains and variable light chains via covalent, non-covalent, or chemical linkage. Multimerization of antibodies can be accomplished through natural aggregation of antibodies or through chemical or recombinant linking techniques known in the art. Thus, multimerization between two antibody polypeptide chains or antigen-binding fragments can be spontaneous, or can occur due to forced linkage of two or more polypeptides. In one example, antibody multimers can be generated by disulfide bonds formed between cysteine residues on different polypeptide chains. In another example, antibody multimers are generated by joining polypeptides via covalent or non-covalent interactions. In some examples, multimers can be generated form peptides such as peptide linkers (spacers), or peptides that have the property of promoting multimerization. In some examples, antibody multimers can be formed through chemical linkage, such as for example, by using heterobifunctional linkers.

For example, antibody multimers include antibodies that contain a light chain containing a VL-CL and a heavy chain containing a VH-CH1-hinge and a sufficient portion of CH2-CH3 (or CH4 if of an IgE or IgM class) to permit association of heavy chains. Upon purification, such antibodies (e.g. full length IgG1) spontaneously form aggregates containing antibody homodimers, and other higher-order antibody multimers. Exemplary of a constant region can include a constant region portion of an immunoglobulin molecule, such as from IgG1, IgG2, IgG3, IgG4, IgA, IgD, IgM, and IgE. Sequences of antibody regions are known and can be used to recombinantly generate antibody multimers (see e.g. US20080248028). For example, a light chain amino acid sequence can include the CL domain, kappa (set forth in SEQ ID NO:2923) or lambda (SEQ ID NO:2924). A heavy chain amino acid sequence can include one or more of a CH1, hinge, CH2, CH3 or CH4 from an IgG1 (SEQ ID NO:2922), IgG2 (SEQ ID NO: 2937), IgG3 (SEQ ID NO:2925), IgA (SEQ ID NO:2926 or 2927) or IgM (SEQ ID NO:2928 or 2929) subclass. In particular, antibody multimers provided herein are full-length antibodies that contain a light chain containing a VL-CL and a heavy chain containing a VH-CH1-hinge-CH2-CH3. For example, in such an antibody multimer, the resulting antibody molecule is at least a four chain molecule where each heavy chain is linked to a light chain by a disulfide bond, and the two heavy chains are linked to each other by disulfide bonds. Linkage of the heavy chains also is mediated by a flexible region of the heavy chain, known as the hinge region.

Alternatively, antibody homodimers can be formed through chemical linkage techniques known in the art. For example, heterobifunctional crosslinking agents, including, but not limited to, SMCC [succinimidyl 4-(maleimidomethyl)cyclohexane-1-carboxylate] and SATA [N-succinimidyl S-acethylthio-acetate] (available, for example, from Pierce Biotechnology, Inc. (Rockford, Ill.)) can be used to form antibody multimers. An exemplary protocol for the formation of antibody homodimers is given in Ghetie et al., Proceedings of the National Academy of Sciences USA (1997) 94:7509-7514. Antibody homodimers can be converted to Fab′2 homodimers through digestion with pepsin. Another way to form antibody homodimers is through the use of the autophilic T15 peptide described in Zhao and Kohler, The Journal of Immunology (2002) 25:396-404.

ScFv dimers can also be formed through recombinant techniques known in the art. For example, such an antibody multimer contains a variable heavy chain connected to a variable light chain on the same polypeptide chain (VH-VL) connected by a peptide linker that is too short to allow pairing between the two domains on the same chain. This forces pairing with the complementary domains of another chain and promotes the assembly of a dimeric molecule with two functional antigen binding sites. An example of the construction of scFv dimers is given in Goel et al., (2000) Cancer Research 60:6964-6971.

Alternatively, antibodies can be made to multimerize through recombinant DNA techniques. IgM and IgA naturally form antibody multimers through the interaction with the mature J chain polypeptide (e.g., SEQ ID NO:2930). Non-IgA or non-IgM molecules, such as IgG molecules, can be engineered to contain the J chain interaction domain of IgA or IgM, thereby conferring the ability to form higher order multimers on the non-IgA or non-IgM molecules. (see, for example, Chintalacharuvu et al., (2001) Clinical Immunology 101:21-31. and Frigerio et al., (2000) Plant Physiology 123:1483-94). IgA dimers are naturally secreted into the lumen of mucosa-lined organs. This secretion is mediated through interaction of the J chain with the polymeric IgA receptor (pIgR) on epithelial cells. If secretion of an IgA form of an antibody (or of an antibody engineered to contain a J chain interaction domain) is not desired, it can be greatly reduced by expressing the antibody molecule in association with a mutant J chain that does not interact well with pIgR (e.g., SEQ ID NOS:2931-2933; Johansen et al., The Journal of Immunology (2001) 167:5185-5192). SEQ ID NO:2931 is a mutant form of a human mature J chain with C134S mutation compared to the mature form of human J chain (SEQ ID NO:2930). SEQ ID NO:2932 is a mutant form of a human mature J chain with amino acids 113-137 deleted compared to the mature form of human J chain (SEQ ID NO:2930). SEQ ID NO:2933 shows a mutant form of human mature J chain with C109S and C134S mutation compared to the mature form of human J chain (SEQ ID NO:2930). Expression of an antibody with one of these mutant J chains will reduce its ability to bind to the polymeric IgA receptor on epithelial cells, thereby reducing transport of the antibody across the epithelial cell and its resultant secretion into the lumen of mucosa lined organs.

Antibody multimers may be purified using any suitable method known in the art, including, but not limited to, size exclusion chromatography. Exemplary methods for purifying antibodies are described elsewhere herein.

Exemplary Antibodies

An exemplary antibody multimer provided herein contains a variable heavy chain that contains a CDRH1 (corresponding to amino acid positions 26-35 based on kabat numbering) that has a sequence of amino acids of SYYMH (SEQ ID NO:2920), such as GYTFTSYYMH (SEQ ID NO: 2908), a CDRH2 (corresponding to amino acid positions 50-65 based on kabat numbering) that has a sequence of amino acids of IINPSGGSTSYAQKFQG (SEQ ID NO:2909), and a CDRH3 (corresponding to amino acid positions 95-102) that has a sequence of amino acids of EEYSSSSAEYFQH (SEQ ID NO:2910); and contains a variable light chain that contains a CDRL1 (corresponding to amino acid positions 24 to 33 or 34 based on kabat numbering) that has a sequence of amino acids of RASQSVSSYLA (SEQ ID NO: 2911), a CDRL2 (corresponding to amino acid positions 50-56 based on kabat numbering) that has a sequence of amino acids of amino acids of DASNRAT (SEQ ID NO:2912), and a CDRL3 (corresponding to amino acid positions 89-97 based on kabat numbering) that has a sequence of amino acids of QQRSNWPPWT (SEQ ID NO:2913). Also provided are antibody multimers that have a variable heavy chain containing a CDRH1, CDRH2 and CDRH3 that is at least 70% identical to any of SEQ ID NOS:2908-2910, respectively and a variable light chain containing a CDRL1, CDRL2, and CDRL3 that is at least 70% identical to any of SEQ ID NOS:2911-2913, respectively, whereby the antibody multimer binds to DLL4 and is an activator of DLL4. For example, sequence identity can be at or about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, or more. For example, the antibody multimer is an antibody that at least contains a variable heavy chain set forth in SEQ ID NO:88 and a variable light chain set forth in SEQ ED NO:107, or a variable heavy chain or variable light chain that is at least 60% identical to SEQ ID NO:88 and/or 107, respectively. The antibody can be multimerized as described herein above. For example, provided herein is an antibody multimer that has a heavy chain containing a variable heavy chain region set forth in SEQ ID NO:88, and a CH1-hinge-CH2-CH3 set forth in SEQ ID NO: 2922, and contains a light chain containing a variable light chain set forth in SEQ ID NO:107 and a kappa or lambda CL chain set forth in SEQ ID NO:2923 or 2924.

In another example, an exemplary antibody multimer provided herein contains a variable heavy chain that contains a CDRH1 (corresponding to amino acid positions 26-35 based on kabat numbering) that has a sequence of amino acids of SYWIG (SEQ ID NO: 2921), such as GYSFTSYWIG (SEQ ID NO:2914), a CDRH2 (corresponding to amino acid positions 50-65 based on kabat numbering) that has a sequence of amino acids of IIYPGDSDTRYSPSFQG (SEQ ID NO:2915), and a CDRH3 (corresponding to amino acid positions 95-102) that has a sequence of amino acids of RGYSYGYDYFDY (SEQ ID NO:2916); a contains a variable light chain that contains CDRL1 (corresponding to amino acid positions 24 to 33 or 34 based on kabat numbering) that has a sequence of amino acids of GLSSGSVSTSYYPS (SEQ ID NO:2917); a CDRL2 (corresponding to amino acid positions 50-56 based on kabat numbering) that has a sequence of amino acids of amino acids of STNTRSS (SEQ ID NO: 2918); and a CDRL3 (corresponding to amino acid positions 89-97 based on kabat numbering) that has a sequence of amino acids of VLYMGSGISYV (SEQ ID NO:2919). Also provided are antibody multimers that have a variable heavy chain containing a CDRH1, CDRH2 and CDRH3 that is at least 70% identical to any of SEQ ID NOS:2914-2916, respectively and a variable light chain containing a CDRL1, CDRL2, and CDRL3 that is at least 70% identical to any of SEQ ID NOS:2917-2919, respectively, whereby the antibody multimer binds to DLL4 and is an activator of DLL4. For example, sequence identity can be at or about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, or more. For example, the antibody multimer is an antibody that at least contains a variable heavy chain set forth in SEQ ID NO:89 and a variable light chain set forth in SEQ ID NO:108, or a variable heavy chain or variable light chain that is at least 60% identical to SEQ ID NO:89 and/or 108, respectively. The antibody can be multimerized as described herein above. For example, provided herein is an antibody multimer that has a heavy chain containing a variable heavy chain region set forth in SEQ ID NO:89, and a CH1-hinge-CH2-CH3 set forth in SEQ ID NO: 2922, and contains a light chain containing a variable light chain set forth in SEQ ID NO:108 and a kappa or lambda CL chain set forth in SEQ ID NO:2923 or 2924.

In some examples, that anti-DLL4 antibody multimers provided herein include activator/modulators of DLL4 activity, with the proviso that the antibody is not an antibody that has a heavy chain containing a variable heavy chain set forth in SEQ ID NO:88 and a variable light chain set forth in SEQ ID NO:107; or is not an antibody that has a heavy chain containing a variable heavy chain set forth in SEQ ID NO:89 and a variable light chain set forth in SEQ ID NO:108.

3. Modifications

The anti-DLL4 antibody multimers provided herein can be further modified so long as the antibody retains binding to DLL4 and is an activator of DLL4 activity. Modification of an anti-DLL4 antibody multimer provided herein can improve one or more properties of the antibody, including, but not limited to, decreasing the immunogenicity of the antibody; improving the half-life of the antibody, such as reducing the susceptibility to proteolysis and/or reducing susceptibility to oxidation; altering or improving of the binding properties of the antibody; and/or modulating the effector functions of the antibody. Exemplary modifications include modification of the primary sequence of the antibody and/or alteration of the post-translational modification of an antibody. Exemplary post-translational modifications include, for example, glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization with protecting/blocking group, proteolytic cleavage, and linkage to a cellular ligand or other protein. Other exemplary modifications include attachment of one or more heterologous peptides to the antibody to alter or improve one or more properties of the antibody.

Generally, the modifications do not result in increased immunogenicity of the antibody or antigen-binding fragment thereof or significantly negatively affect the binding of the antibody to DLL4 or its activity as an activator. Methods of assessing the binding of the modified antibodies to DLL4 are provided herein and are known in the art. For example, modified antibodies can be assayed for binding to DLL4 by methods such as, but not limited to, ELISA or FACS binding assays. Methods to assess activating activity of the antibody also are known to one of skill in the art and described elsewhere herein, for examples, in the Examples. For example, activity can be determined using a reporter assay for activity of a Notch receptor.

Modification of the anti-DLL4 antibodies produced herein can include one or more amino acid substitutions, deletions or additions, compared to the parent antibody from which it was derived. Methods for modification of polypeptides, such as antibodies, are known in the art and can be employed for the modification of any antibody or antigen-binding fragment provided herein. Standard techniques known to those of skill in the art can be used to introduce mutations in the nucleotide molecule encoding an antibody or an antigen-binding fragment provided herein in order to produce a polypeptide with one or more amino acid substitutions. Exemplary techniques for introducing mutations include, but are not limited to, site-directed mutagenesis and PCR-mediated mutagenesis.

The antibodies can be recombinantly fused to a heterologous polypeptide at the N-terminus or C-terminus or chemically conjugated, including covalent and non-covalent conjugation, to a heterologous polypeptide or other composition. The fusion does not necessarily need to be direct, but can occur through a linker peptide. In some examples, the linker peptide contains a protease cleavage site which allows for removal of the purification peptide following purification by cleavage with a protease that specifically recognizes the protease cleavage site.

For example, the anti-DLL4 antibodies provided herein can be modified by the attachment of a heterologous peptide to facilitate purification. Generally such peptides are expressed as a fusion protein containing the antibody fused to the peptide at the C- or N-terminus of the antibody. Exemplary peptides commonly used for purification include, but are not limited to, hexa-histidine peptides, hemagglutinin (HA) peptides, and flag tag peptides (see e.g., Wilson et al. (1984) Cell 37:767; Witzgall et al. (1994) Anal Biochem 223:2, 291-8). In another example, the anti-DLL4 antibodies provided herein can be modified by the covalent attachment of any type of molecule, such as a diagnostic or therapeutic molecule. Exemplary diagnostic and therapeutic moieties include, but are not limited to, drugs, radionucleotides, toxins, fluorescent molecules (see, e.g. International PCT Publication Nos. WO 92/08495; WO 91/14438; WO 89/12624; U.S. Pat. No. 5,314,995; and EP 396,387). Diagnostic polypeptides or diagnostic moieties can be used, for example, as labels for in vivo or in vitro detection. In a further example, anti-DLL4 antibody multimers provided herein can be modified by attachment to other molecules or moieties, such as any that increase the half-life, stability, immunogenicity or that affect or alter the targeting of the antibody in vivo.

Exemplary modifications are described herein below. It is within the level of one of skill in the art to modify any of the antibodies provided herein depending on the particular application of the antibody.

a. Modifications to Reduce Immunogenicity

In some examples, the antibodies provided herein can be modified to reduce the immunogenicity in a subject, such as a human subject. For example, one or more amino acids in the antibody can be modified to alter potential epitopes for human T-cells in order to eliminate or reduce the immunogenicity of the antibody when exposed to the immune system of the subject. Exemplary modifications include substitutions, deletions and insertion of one or more amino acids, which eliminate or reduce the immunogenicity of the antibody. Generally, such modifications do not alter the binding specificity of the antibody for its respective antigen. Reducing the immunogenicity of the antibody can improve one or more properties of the antibody, such as, for example, improving the therapeutic efficacy of the antibody and/or increasing the half-life of the antibody in vivo.

b. Glycosylation

The anti-DLL4 antibodies provided herein can be modified by either N-linked or O-linked glycosylation. N-linked glycosylation includes the attachment of a carbohydrate moiety to the side chain of an asparagine residue within the tripeptide sequences asparagine-X-serine and asparagine-X-threonine, where X is any amino acid except proline. O-linked glycosylation includes the attachment of one of the sugars N-aceylgalactosamine, galactose, or xylose to a hydroxyamino acid, most commonly serine or threonine, although 5-hydroxyproline or 5-hydroxylysine can also be used. The anti-DLL4 antibodies can be further modified to incorporate additional glycosylation sites by altering the amino acid sequence such that it contains one or more of the above-described tripeptide sequences (for N-linked glycosylation sites). The alteration can also be made by the addition of, or substitution by, one or more serine or threonine residues to the sequence of the original antibody (for O-linked glycosylation sites). Where the antibody comprises an Fc region, the carbohydrate attached thereto can be altered (see, e.g., U.S. Patent Pub. Nos. 2003/0157108, 2005/0123546 and US 2004/0093621; International Patent Pub. Nos. WO 2003/011878, WO 1997/30087, WO 1998/58964, WO 1999/22764; and U.S. Pat. No. 6,602,684).

For example, a glycosylation variantion is in the Fc region of the antibody, wherein a carbohydrate structure attached to the Fc region lacks fucose. Such variants have improved ADCC function. Optionally, the Fc region further contains one or more amino acid substitutions therein which further improve ADCC, for example, substitutions at positions 298, 333, and/or 334 of the Fc region (Eu numbering of residues) (see, e.g., US 2003/0157108; WO 2000/61739; WO 2001/29246; US 2003/0115614; US 2002/0164328; US 2004/0093621; US 2004/0132140; US 2004/0110704; US 2004/0110282; US 2004/0109865; WO 2003/085119; WO 2003/084570; WO 2005/035586; WO 2005/035778; WO2005/053742; Okazaki et al. J. Mol. Biol. 336:1239-1249 (2004); Yamane-Ohnuki et al. Biotech. Bioeng. 87: 614 (2004)). Examples of cell lines producing defucosylated antibodies include Lec13 CHO cells deficient in protein fucosylation (Ripka et al. Arch. Biochem. Biophys. 249:533-545 (1986); US Pat Appl No US 2003/0157108 A1, Presta, L; and WO 2004/056312 A1, Adams et al., especially at Example 11), and knockout cell lines, such as alpha-1,6-fucosyltransferase gene, FUT8, knockout CHO cells (Yamane-Ohnuki et al. Biotech. Bioeng. 87: 614 (2004)).

c. Fc Modifications

The anti-DLL4 antibody multimers provided herein can contain wild-type or modified Fc region. The antibodies provided herein can be engineered to contain modified Fc regions. In some examples, the Fc region can be modified to alter one or more properties of the Fc polypeptide. For example, the Fc region can be modified to alter (i.e. increase or decrease) effector functions compared to the effector function of an Fc region of a wild-type immunoglobulin heavy chain. Thus, a modified Fc domain can have altered affinity, including but not limited to, increased or low or no affinity for the Fc receptor. Altering the affinity of an Fc region for a receptor can modulate the effector functions induced by the Fc domain.

In one example, an Fc region is used that is modified for optimized binding to certain FcγRs to better mediate effector functions, such as for example, antibody-dependent cellular cytotoxicity, ADCC. Such modified Fc regions can contain modifications at one or more of amino acid residues (according to the Kabat numbering scheme, Kabat et al. (1991) Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services), including, but not limited to, amino acid positions 249, 252, 259, 262, 268, 271, 273, 277, 280, 281, 285, 287, 296, 300, 317, 323, 343, 345, 346, 349, 351, 352, 353, and 424. For example, modifications in an Fc region can be made corresponding to any one or more of G119S, G119A, S122D, S122E, S122N, S122Q, S122T, K129H, K129Y, D132Y, R138Y, E141Y, T143H, V147I, S150E, H151D, E155Y, E155I, E155H, K157E, G164D, E166L, E166H, S181A, S181D, S187T, S207G, S2071, K209T, K209E, K209D, A210D, A213Y, A213L, A213I, I215D, I215E, I215N, I215Q, E216Y, E216A, K217T, K217F, K217A, and P279L of the exemplary Fc sequence set forth in SEQ ID NO:2922, or combinations thereof. A modified Fc containing these mutations can have enhanced binding to an FcR such as, for example, the activating receptor FcγIIIa and/or can have reduced binding to the inhibitory receptor FcγRIIb (see e.g., US 2006/0024298). Fc regions modified to have increased binding to FcRs can be more effective in facilitating the destruction of the fungal cells in patients.

In some examples, the antibodies or antigen-binding fragments provided herein can be further modified to improve the interaction of the antibody with the FcRn receptor in order to increase the in vivo half-life and pharmacokinetics of the antibody (see, e.g. U.S. Pat. No. 7,217,797; and U.S. Pat. Pub. Nos. 2006/0198840 and 2008/0287657). FcRn is the neonatal FcR, the binding of which recycles endocytosed antibody from the endosomes back to the bloodstream. This process, coupled with preclusion of kidney filtration due to the large size of the full length molecule, results in favorable antibody serum half-lives ranging from one to three weeks. Binding of Fc to FcRn also plays a role in antibody transport.

Exemplary modifications of the Fc region include but are not limited to, mutation of the Fc described in U.S. Pat. No. 7,217,797; U.S. Pat. Pub. Nos. 2006/0198840, 2006/0024298 and 2008/0287657; and International Patent Pub. No. WO 2005/063816, such as mutations at one or more of amino acid residues (Kabat numbering, Kabat et al. (1991)) 251-256, 285-90, 308-314, in the CH2 domain and/or amino acids residues 385-389, and 428-436 in the CH3 domain of the Fc heavy chain constant region, where the modification alters Fc receptor binding affinity and/or serum half-life relative to unmodified antibody. In some examples, the Fc region is modified at one or more of amino acid positions 250, 251, 252, 254, 255, 256, 263, 308, 309, 311, 312 and 314 in the CH2 domain and/or amino acid positions 385, 386, 387, 389, 428, 433, 434, 436, and 459 in the CH3 domain of the Fc heavy chain constant region. Such modifications correspond to amino acids Gly120, Pro121, Ser122, Phe124 Leu125, Phe126, Thr133, Pro174, Arg175, Glu177, Gln178, and Asn180 in the CH2 domain and amino acids Gln245, Val246, Ser247, Thr249, Ser283, Gly285, Ser286, Phe288, and Met311 in the CH3 domain in an exemplary Fc sequence set forth in SEQ ID NO:2922 In some examples, the modification is at one or more surface-exposed residues, and the modification is a substitution with a residue of similar charge, polarity or hydrophobicity to the residue being substituted.

In particular examples, a Fc heavy chain constant region is modified at one or more of amino acid positions 251, 252, 254, 255, and 256 (Kabat numbering), where position 251 is substituted with Leu or Arg, position 252 is substituted with Tyr, Phe, Ser, Trp or Thr, position 254 is substituted with Thr or Ser, position 255 is substituted with Leu, Gly, Ile or Arg, and/or position 256 is substituted with Ser, Arg, Gln, Glu, Asp, Ala, Asp or Thr. In some examples, a Fc heavy chain constant region is modified at one or more of amino acid positions 308, 309, 311, 312, and 314 (Kabat numbering), where position 308 is substituted with Thr or Ile, position 309 is substituted with Pro, position 311 is substituted with serine or Glu, position 312 is substituted with Asp, and/or position 314 is substituted with Leu. In some examples, a Fc heavy chain constant region is modified at one or more of amino acid positions 428, 433, 434, and 436 (Kabat numbering), where position 428 is substituted with Met, Thr, Leu, Phe, or Ser, position 433 is substituted with Lys, Arg, Ser, Ile, Pro, Gln, or His, position 434 is substituted with Phe, Tyr, or His, and/or position 436 is substituted with His, Asn, Asp, Thr, Lys, Met, or Thr. In some examples, a Fc heavy chain constant region is modified at one or more of amino acid positions 263 and 459 (Kabat numbering), where position 263 is substituted with Gln or Glu and/or position 459 is substituted with Leu or Phe.

In some examples, a Fc heavy chain constant region can be modified to enhance binding to the complement protein C1q. In addition to interacting with FcRs, Fc also interact with the complement protein C1q to mediate complement dependent cytotoxicity (CDC). C1q forms a complex with the serine proteases C1r and C1s to form the C1 complex. C1q is capable of binding six antibodies, although binding to two IgGs is sufficient to activate the complement cascade. Similar to Fc interaction with FcRs, different IgG subclasses have different affinity for C1q, with IgG1 and IgG3 typically binding substantially better than IgG2 and IgG4. Thus, a modified Fc having increased binding to C1q can mediate enhanced CDC, and can enhance destruction of fungal cells. Exemplary modifications in an Fc region that increase binding to C1q include, but are not limited to, amino acid modifications at positions 345 and 253 (Kabat numbering). Exemplary modifications are include those corresponding to K209W, K209Y, and E216S in an exemplary Fc sequence set forth in SEQ ID NO:2922.

In another example, a variety of Fc mutants with substitutions to reduce or ablate binding with FcγRs also are known. Such muteins are useful in instances where there is a need for reduced or eliminated effector function mediated by Fc. This is often the case where antagonism, but not killing of the cells bearing a target antigen is desired. Exemplary of such an Fc is an Fc mutein described in U.S. Pat. No. 5,457,035, which is modified at amino acid positions 248, 249 and 251 (Kabat numbering). In an exemplary Fc sequence set forth in amino acids 100-330 of SEQ ID NO:2922, amino acid 118 is modified from Leu to Ala, amino acid 119 is modified from Leu to Glu, and amino acid 121 is modified from Gly to Ala. Similar mutations can be made in any Fc sequence such as, for example, the exemplary Fc sequence. This mutein exhibits reduced affinity for Fc receptors.

d. Pegylation

The anti-DLL4 antibody multimers provided herein can be conjugated to polymer molecules, or water soluble polymers, such as high molecular weight polyethylene glycol (PEG) to increase half-life and/or improve their pharmacokinetic profiles. Water soluble polymers include, but are not limited to, polyethylene glycol (PEG), copolymers of ethylene glycol/propylene glycol, carboxymethylcellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, poly-1,3-dioxolane, poly-1,3,6-trioxane, ethylene/maleic anhydride copolymer, polyaminoacids (either homopolymers or random copolymers), and dextran or poly(n-vinyl pyrrolidone)polyethylene glycol, propropylene glycol homopolymers, prolypropylene oxide/ethylene oxide co-polymers, polyoxyethylated polyols (e.g., glycerol), polyvinyl alcohol, and mixtures thereof. Polyethylene glycol propionaldehyde can have advantages in manufacturing due to its stability in water. The polymer can be of any molecular weight, and can be branched or unbranched. The number of polymers attached to the antibody can vary, and if more than one polymer is attached, they can be the same or different molecules. In general, the number and/or type of polymers used for derivatization can be determined based on considerations including, but not limited to, the particular properties or functions of the antibody to be improved, and whether the antibody derivative will be used in a therapy under defined conditions.

Conjugation can be carried out by techniques known to those skilled in the art. Conjugation of therapeutic antibodies with PEG has been shown to enhance pharmacodynamics while not interfering with function (see, e.g., Deckert et al., Int. J. Cancer 87: 382-390, 2000; Knight et al., Platelets 15: 409-418, 2004; Leong et al., Cytokine 16: 106-119, 2001; and Yang et al., Protein Eng. 16: 761-770, 2003). PEG can be attached to the antibodies or antigen-binding fragments with or without a multifunctional linker either through site-specific conjugation of the PEG to the N- or C-terminus of the antibodies or antigen-binding fragments or via epsilon-amino groups present on lysine residues. Linear or branched polymer derivatization that results in minimal loss of biological activity can be used. The degree of conjugation can be monitored by SDS-PAGE and mass spectrometry to ensure proper conjugation of PEG molecules to the antibodies. Unreacted PEG can be separated from antibody-PEG conjugates by, e.g., size exclusion or ion-exchange chromatography. PEG-derivatized antibodies can be tested for binding activity to DLL4 as well as for in vivo efficacy using methods known to those skilled in the art, for example, by functional assays described herein.

4. Compositions, Formulations, Administration and Articles of Manufacture/Kits

a. Compositions and Formulations

The antibody multimers provided herein can be provided as a formulation for administration. While it is possible for the active ingredient to be administered alone, generally it is present as a pharmaceutical formulation. Compositions or formulations contain at least one active ingredient, together with one or more acceptable carriers thereof. Each carrier must be both pharmaceutically and physiologically acceptable in the sense of being compatible with the other ingredients and not injurious to the patient. Formulations include those suitable for oral, rectal, nasal, or parenteral (including subcutaneous, intramuscular, intravenous and intradermal) administration. The formulations can conveniently be presented in unit dosage form and can be prepared by methods well known in the art of pharmacy. See, e.g., Gilman, et al. (eds. 1990) Goodman and Gilman's: The Pharmacological Bases of Therapeutics, 8th Ed., Pergamon Press; and Remington's Pharmaceutical Sciences, 17th ed. (1990), Mack Publishing Co., Easton, Pa.; Avis, et al. (eds. 1993) Pharmaceutical Dosage Forms: Parenteral Medications Dekker, NY; Lieberman, et al. (eds. 1990) Pharmaceutical Dosage Forms Tablets Dekker, NY; and Lieberman, et al. (eds. 1990) Pharmaceutical Dosage Forms Disperse Systems Dekker, NY.

The route of antibody administration is in accord with known methods, e.g., injection or infusion by intravenous, intraperitoneal, intracerebral, intramuscular, subcutaneous, intraocular, intraarterial, intrathecal, inhalation or intralesional routes, topical or by sustained release systems as noted below. The antibody is typically administered continuously by infusion or by bolus injection. One can administer the antibodies in a local or systemic manner.

The antibody multimers provided herein can be prepared in a mixture with a pharmaceutically acceptable carrier. Techniques for formulation and administration of the compounds are known to one of skill in the art (see e.g. “Remington's Pharmaceutical Sciences,” Mack Publishing Co., Easton, Pa.). This therapeutic composition can be administered intravenously or through the nose or lung, preferably as a liquid or powder aerosol (lyophilized). The composition also can be administered parenterally or subcutaneously as desired. When administered systematically, the therapeutic composition should be sterile, pyrogen-free and in a parenterally acceptable solution having due regard for pH, isotonicity, and stability. These conditions are known to those skilled in the art.

Therapeutic formulations can be administered in many conventional dosage formulations. Briefly, dosage formulations of the antibodies provided herein are prepared for storage or administration by mixing the compound having the desired degree of purity with physiologically acceptable carriers, excipients, or stabilizers. Such materials are non-toxic to the recipients at the dosages and concentrations employed, and can include buffers such as TRIS HCl, phosphate, citrate, acetate and other organic acid salts; antioxidants such as ascorbic acid; low molecular weight (less than about ten residues) peptides such as polyarginine, proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidinone; amino acids such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; counterions such as sodium and/or nonionic surfactants such as TWEEN, PLURONICS or polyethyleneglycol.

When used for in vivo administration, the antibody multimer formulation should be sterile and can be formulated according to conventional pharmaceutical practice. This is readily accomplished by filtration through sterile filtration membranes, prior to or following lyophilization and reconstitution. The antibody ordinarily will be stored in lyophilized foam or in solution. Other vehicles such as naturally occurring vegetable oil like sesame, peanut, or cottonseed oil or a synthetic fatty vehicle like ethyl oleate or the like may be desired. Buffers, preservatives, antioxidants and the like can be incorporated according to accepted pharmaceutical practice.

Pharmaceutical compositions suitable for use include compositions wherein one or more antibody multimers are contained in an amount effective to achieve their intended purpose. Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein. Therapeutically effective dosages can be determined by using in vitro and in vivo methods.

An effective amount of antibody to be employed therapeutically will depend, for example, upon the therapeutic objectives, the route of administration, and the condition of the patient. In addition, the attending physician takes into consideration various factors known to modify the action of drugs including severity and type of disease, body weight, sex, diet, time and route of administration, other medications and other relevant clinical factors. Accordingly, it will be necessary for the therapist to titer the dosage and modify the route of administration as required to obtain the optimal therapeutic effect. Typically, the clinician will administer antibody until a dosage is reached that achieves the desired effect. The progress of this therapy is easily monitored by conventional assays.

For any antibody containing a peptide, the therapeutically effective dose can be estimated initially from cell culture assays. For example, a dose can be formulated in animal models to achieve a circulating concentration range that includes the EC50 as determined in cell culture (e.g., the concentration of the test molecule which promotes or inhibits cellular proliferation or differentiation). Such information can be used to more accurately determine useful doses in humans.

Toxicity and therapeutic efficacy of the antibody multimers described herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio between LD50 and ED50. Molecules which exhibit high therapeutic indices can be used. The data obtained from these cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage of such molecules lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl et al., 1975, in “The Pharmacological Basis of Therapeutics”, Ch. 1, p. 1).

Dosage amount and interval can be adjusted individually to provide plasma levels of the antibody which are sufficient to promote or inhibit cellular proliferation or differentiation or minimal effective concentration (MEC). The MEC will vary for each antibody, but can be estimated from in vitro data using described assays. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. However, HPLC assays or bioassays can be used to determine plasma concentrations.

Dosage intervals can also be determined using MEC value. Antibody molecules should be administered using a regimen which maintains plasma levels above the MEC for 10-90% of the time, preferably between 30-90% and most preferably between 50-90%.

In cases of local administration or selective uptake, the effective local concentration of the antibody may not be related to plasma concentration.

A typical daily dosage might range of antibody multimers provided herein is from about 1 μ/kg to up to 1000 mg/kg or more, depending on the factors mentioned above. Typically, the clinician will administer the molecule until a dosage is reached that achieves the desired effect. The progress of this therapy is easily monitored by conventional assays.

Depending on the type and severity of the disease, from about 0.001 mg/kg to abut 1000 mg/kg, such as about 0.01 mg to 100 mg/kg, for example about 0.010 to 20 mg/kg of the antibody multimer, is an initial candidate dosage for administration to the patient, whether, for example, by one or more separate administrations, or by continuous infusion. For repeated administrations over several days or longer, depending on the condition, the treatment is repeated until a desired suppression of disease symptoms occurs or the desired improvement in the patient's condition is achieved. However, other dosage regimes also are contemplated.

b. Articles of Manufacture and Kits

Pharmaceutical compounds of selected antibodies or nucleic acids encoding selected antibodies, or a derivative or a biologically active portion thereof can be packaged as articles of manufacture containing packaging material, a pharmaceutical composition which is effective for treating the disease or disorder, and a label that indicates that selected antibody or nucleic acid molecule is to be used for treating the disease or disorder.

The articles of manufacture provided herein contain packaging materials. Packaging materials for use in packaging pharmaceutical products are well known to those of skill in the art. See, for example, U.S. Pat. Nos. 5,323,907, 5,052,558 and 5,033,252, each of which is incorporated herein in its entirety. Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes, inhalers, pumps, bags, vials, containers, syringes, bottles, and any packaging material suitable for a selected formulation and intended mode of administration and treatment. A wide array of formulations of the compounds and compositions provided herein are contemplated as are a variety of treatments for any EPO-mediated disease or disorder or therapeutic polypeptide-mediated disease or disorder.

Antibodies and nucleic acid molecules encoding the antibodies thereof also can be provided as kits. Kits can include a pharmaceutical composition described herein and an item for administration. For example, a selected antibody can be supplied with a device for administration, such as a syringe, an inhaler, a dosage cup, a dropper, or an applicator. The kit can, optionally, include instructions for application including dosages, dosing regimens and instructions for modes of administration. Kits also can include a pharmaceutical composition described herein and an item for diagnosis. For example, such kits can include an item for measuring the concentration, amount or activity of the antibody in a subject.

5. Methods of Treatment and Uses

Provided herein are methods of treatment or uses of anti-DLL4 antibody multimers to treat diseases that manifest aberrant angiogenesis or neovascularization. Angiogenesis is a process by which new blood vessels are formed. It occurs for example, in a healthy body for healing wounds and for restoring blood flow to tissues after injury or insult. In females, angiogenesis also occurs during the monthly reproductive cycle to rebuild the uterus lining, to mature the egg during ovulation and during pregnancy to build the placenta. In some situations ‘too much’ angiogenesis can be detrimental, such as angiogenesis that supplies blood to tumor foci, in inflammatory responses and other aberrant angiogenic-related conditions. The growth of tumors, or sites of proliferation in chronic inflammation, generally requires the recruitment of neighboring blood vessels and vascular endothelial cells to support their metabolic requirements. This is because the diffusion is limited for oxygen in tissues. Exemplary conditions associated with angiogenesis include, but are not limited to solid tumors and hematologic malignancies such as lymphomas, acute leukemia, and multiple myeloma, where increased numbers of blood vessels are observed in the pathologic bone marrow.

Hence, angiogenesis is implicated in the pathogenesis of a variety of disorders. These include solid tumors and metastasis, atherosclerosis, retrolental fibroplasia, hemangiomas, chronic inflammation, intraocular neovascular diseases such as proliferative retinopathies, e.g., diabetic retinopathy, age-related macular degeneration (AMD), neovascular glaucoma, immune rejection of transplanted corneal tissue and other tissues, rheumatoid arthritis, and psoriasis. Folkman et al., J. Biol. Chem. 267:10931-34 (1992); Klagsbrun et al., Annu. Rev. Physiol. 53:217-39 (1991); and Garner A., “Vascular diseases,” In: Pathobiology of Ocular Disease. A Dynamic Approach, Garner A., Klintworth G K, eds., 2nd Edition (Marcel Dekker, NY, 1994), pp 1625-1710.

In the case of tumor growth, angiogenesis appears to be crucial for the transition from hyperplasia to neoplasia, and for providing nourishment for the growth and metastasis of the tumor. Folkman et al., Nature 339:58 (1989). The neovascularization allows the tumor cells to acquire a growth advantage and proliferative autonomy compared to the normal cells. A tumor usually begins as a single aberrant cell which can proliferate only to a size of a few cubic millimeters due to the distance from available capillary beds, and it can stay ‘dormant’ without further growth and dissemination for a long period of time. Some tumor cells then switch to the angiogenic phenotype to activate endothelial cells, which proliferate and mature into new capillary blood vessels. These newly formed blood vessels not only allow for continued growth of the primary tumor, but also for the dissemination and recolonization of metastatic tumor cells. Accordingly, a correlation has been observed between density of microvessels in tumor sections and patient survival in breast cancer as well as in several other tumors. Weidner et al., N Engl. J. Med. 324:1-6 (1991); Horak et al., Lancet 340:1120-24 (1992); Macchiarini et al., Lancet 340:145-46 (1992). The precise mechanisms that control the angiogenic switch is not well understood, but it is believed that neovascularization of tumor mass results from the net balance of a multitude of angiogenesis stimulators and inhibitors (Folkman, Nat. Med. 1(1):27-31 (1995)).

Angiogenesis also play a role in inflammatory diseases. These diseases have a proliferative component, similar to a tumor focus. In rheumatoid arthritis, one component of this is characterized by aberrant proliferation of synovial fibroblasts, resulting in pannus formation. The pannus is composed of synovial fibroblasts which have some phenotypic characteristics with transformed cells. As a pannus grows within the joint it expresses many proangiogenic signals, and experiences many of the same neo-angiogenic requirements as a tumor. The need for additional blood supply, neoangiogenesis, is critical. Similarly, many chronic inflammatory conditions also have a proliferative component in which some of the cells composing it may have characteristics usually attributed to transformed cells.

Another example of a condition involving excess angiogenesis is diabetic retinopathy (Lip et al. Br J Ophthalmology 88: 1543, 2004)). Diabetic retinopathy has angiogenic, inflammatory and proliferative components; overexpression of VEGF, and angiopoietin-2 are common. This overexpression is likely required for disease-associated remodeling and branching of blood vessels, which then supports the proliferative component of the disease.

Hence, provided herein are methods of treatment with anti-DLL4 antibody multimers for angiogenic diseases and conditions. Such diseases or conditions include, but are not limited to, inflammatory diseases, immune diseases, cancers, and other diseases that manifest aberrant angiogenesis and abnormal vascularization. Cancers include breast, lung, colon, gastric cancers, pancreatic cancers and others. Inflammatory diseases, include, for example, diabetic retinopathies and/or neuropathies and other inflammatory vascular complications of diabetes, autoimmune diseases, including autoimmune diabetes, atherosclerosis, Crohn's disease, diabetic kidney disease, cystic fibrosis, endometriosis, diabetes-induced vascular injury, inflammatory bowel disease, Alzheimers disease and other neurodegenerative diseases. Treatment can be effected by administering by suitable route formulations of the antibody multimers, which can be provided in compositions as polypeptides. In some examples, the antibody multimers can be linked to targeting agents, for targeted delivery or encapsulated in delivery vehicles, such as liposomes.

For example, treatments using the anti-DLL4 multimers provided herein, include, but are not limited to treatment of diabetes-related diseases and conditions including periodontal, autoimmune, vascular, and tubulointerstitial diseases. Treatments using the anti-DLL4 antibody multimers also include treatment of ocular disease including macular degeneration, cardiovascular disease, neurodegenerative disease including Alzheimer's disease, inflammatory diseases and conditions including rhematoid arthritis, and diseases and conditions associated with cell proliferation including cancers. One of skill in the art can assess based on the type of disease to be treated, the severity and course of the disease, whether the molecule is administered for preventive or therapeutic purposes, previous therapy, the patient's clinical history and response to therapy, and the discretion of the attending physician appropriate dosage of a molecule to administer.

Combination Therapy

Anti-DLL4 antibody multimers provided herein can be administered in combination with another therapy. For example, anti-DLL4 antibody multimers are used in combinations with anti-cancer therapeutics or anti-neovascularization therapeutics to treat various neoplastic or non-neoplastic conditions. In one embodiment, the neoplastic or non-neoplastic condition is characterized by pathological disorder associated with aberrant or undesired angiogenesis. Exemplary combination therapies also include any set forth in U.S. Published application No. 20090246199. The anti-DLL4 antibody multimer can be administered serially or in combination with another agent that is effective for those purposes, either in the same composition or as separate compositions. The anti-DLL4 antibody multimers can be administered sequentially, simultaneously or intermittently with a therapeutic agent. Alternatively, or additionally, multiple inhibitors of DLL4 can be administered.

The administration of the anti-DLL4 antibody multimer can be done simultaneously, e.g., as a single composition or as two or more distinct compositions using the same or different administration routes. Alternatively, or additionally, the administration can be done sequentially, in any order. In certain embodiments, intervals ranging from minutes to days, to weeks to months, can be present between the administrations of the two or more compositions. For example, the anti-cancer agent can be administered first, followed by the DLL4 antibody multimer. Simultaneous administration or administration of the anti-DLL4 antibody multimer first also is contemplated.

The effective amounts of therapeutic agents administered in combination with an anti-DLL4 antibody multimer will be at the physician's or veterinarian's discretion. Dosage administration and adjustment is done to achieve maximal management of the conditions to be treated. The dose will additionally depend on such factors as the type of therapeutic agent to be used and the specific patient being treated. Suitable dosages for the anti-cancer agent are those presently used and can be lowered due to the combined action (synergy) of the anti-cancer agent and the anti-DLL4 antibody multimer.

Typically, the anti-DLL4 antibody multimer and anti-cancer agents are suitable for the same or similar diseases to block or reduce a pathological disorder such as tumor growth or growth of a cancer cell. In one embodiment the anti-cancer agent is an anti-angiogenesis agent. Antiangiogenic therapy in relationship to cancer is a cancer treatment strategy aimed at inhibiting the development of tumor blood vessels required for providing nutrients to support tumor growth. Because angiogenesis is involved in both primary tumor growth and metastasis, the antiangiogenic treatment is generally capable of inhibiting the neoplastic growth of tumor at the primary site as well as preventing metastasis of tumors at the secondary sites, therefore allowing attack of the tumors by other therapeutics.

Many anti-angiogenic agents have been identified and are known in the arts, including those listed herein, e.g., listed under Definitions, and by, e.g., Carmeliet and Jain, Nature 407:249-257 (2000); Ferrara et al., Nature Reviews. Drug Discovery, 3:391-400 (2004); and Sato Int. J. Clin. Oncol., 8:200-206 (2003). See also, US Patent Application US20030055006. In one embodiment, an anti-DLL4 antibody multimer is used in combination with an anti-VEGF neutralizing antibody (or fragment) and/or another VEGF antagonist or a VEGF receptor antagonist including, but not limited to, for example, soluble VEGF receptor (e.g., VEGFR-1, VEGFR-2, VEGFR-3, neuropillins (e.g., NRP1, NRP2)) fragments, aptamers capable of blocking VEGF or VEGFR, neutralizing anti-VEGFR antibodies, low molecule weight inhibitors of VEGFR tyrosine kinases (RTK), antisense strategies for VEGF, ribozymes against VEGF or VEGF receptors, antagonist variants of VEGF; and any combinations thereof. Alternatively, or additionally, two or more angiogenesis inhibitors can optionally be co-administered to the patient in addition to VEGF antagonist and other agent. In certain embodiment, one or more additional therapeutic agents, e.g., anti-cancer agents, can be administered in combination with anti-DLL4 antibody multimer, the VEGF antagonist, and an anti-angiogenesis agent.

In certain aspects, other therapeutic agents useful for combination angiogenic or tumor therapy with a anti-DLL4 antibody mulitmer include other cancer therapies, (e.g., surgery, radiological treatments (e.g., involving irradiation or administration of radioactive substances), chemotherapy, treatment with anti-cancer agents listed herein and known in the art, or combinations thereof). Alternatively, or additionally, two or more antibodies binding the same or two or more different antigens disclosed herein can be co-administered to the patient. Sometimes, it can be beneficial to also administer one or more cytokines to the patient.

H. EXAMPLES

The following examples are included for illustrative purposes only and are not intended to limit the scope of the invention.

Example 1

Generation of Mutant Fab Antibodies

In this Example, mutant Fab antibodies were generated by alanine-scanning, NNK mutagenesis, and ligation of oligo pairs into BsaI modified plasmids that allow cloning of any modified CDR region in a high-throughput manner

A. Alanine Scanning Mutagenesis

Alanine mutants were generated by overlapping PCR using the parent heavy or light chain DNA as a template. Forward and reverse primers that specifically generate the desired mutation at the target codon were used to amplify the parent DNA in the appropriate plasmid.

In the first round of PCR, two separate PCR reactions with different primer pairs were used to amplify two segments of the gene. The first reaction used the specific reverse primer with an EcoRI forward primer and amplified the first half of the gene. The second reaction used the specific forward primer with an FLXhoI reverse primer and amplified the second half of the gene. The gene segments were generated using 20 cycles of PCR with the following conditions: 94° C. for 30 sec; 50° C. for 30 sec; and 72° C. for 90 sec. The PCR products were isolated and purified from 1% agarose gel and mixed together as a template for the second round of PCR. In the second round of PCR, EcoRI forward and FLXhoI reverse primers were used to amplify the full length gene product. The gene product was generated using 20 cycles of PCR with the following conditions: 94° C. for 30 sec; 55° C. for 30 sec; and 72° C. for 90 sec.

The PCR product was isolated and subsequently digested with EcoRI and XhoI (New England Biolabs) and ligated into the similarly digested plasmid. After transformation of the ligation product in E. coli DH5α and plating, individual colonies were selected and grown in a 96-well block containing 1.5 ml of Terrific Broth (EMD, San Diego, Calif.) supplemented with 50 μg/ml Kanamycin, and 0.4% glucose, and grown at 37° C. overnight. The DNA was isolated using a mini-prep kit (Qiagen) and alanine mutations were confirmed by DNA sequencing.

As an example, Table 6 sets forth primer pairs used to generate the mutant VH5-51_IGHD5-18*01>3_IGHJ4*01 R99A and VH1-46_IGHD6-6*01_IGHJ1*01 E100A. Primers R99A_F and R99A_R were utilized to specifically amplify the R99 to alanine mutation. Primers E100A_F and E100A_R were utilized to specifically amplify the E100 to alanine mutation. Primers EcoRI_F and FLXhoI_R were utilized to amplify the remaining segments of the gene.

TABLE 6
Example primer pairs for alanine scanning mutagenesis
Primer Sequence SEQ ID NO
VH5-51_IGHD5-18*01>3_IGHJ4*01
R99A_F GCCATGTATTACTGTGCGAGAGCCGGATACAGCTATGGTTACGAC 1
R99A_R GTCGTAACCATAGCTGTATCCGGCTCTCGCACAGTAATACATGGC 2
VH1-46_IGHD6-6*01_IGHJ1*01
E100A_F GTGTATTACTGTGCGAGAGAGGCCTATAGCAGCTCGTCCGCTG 3
E100A_R CAGCGGACGAGCTGCTATAGGCCTCTCTCGCACAGTAATACAC 4
Plasmid A and D
EcoRI_F TTGGGCGAATTCCCTAGATAATTAATTAGGAGG 5
FLXhoI_R TTAAACCTCGAGCCGCGGTTCATTAAAG 6

B. NNK Mutagenesis by Overlapping PCR

NNK mutagenesis by overlapping PCR was carried out as described above for alanine scanning mutagenesis, with initial primers that generate the desired NNK mutations. Therefore, in the first round of PCR, specific primer pairs were used in which the target codon was replaced with NNK (forward) and MNN (reverse). For example, Table 7 below sets forth forward and reverse primers used to generate VH5-51_IGHD5-18*01>3_IGHJ4*01 G100 NNK mutants and VH1-46_IGHD6-6*01_IGHJ1*01 S102 NNK mutants.

Individual clones were subjected to DNA sequencing (by BATJ, Inc., San Diego, Calif.) to identify the amino acid substitution. Depending on the number of colonies picked per NNK mutation reaction, mutation rate varies—as low as 4 to 5 amino acid changes, and as high as 18 to 19 amino acid changes per mutation were observed.

TABLE 7
Example primer pairs for NNK mutagenesis
SEQ
ID
Primer Sequence NO
VH5-51_IGHD5-18*01>3_IGHJ4*01
G100_NNK_F GTATTACTGTGCGAGACGTNNKTACAGCTATGGTT 7
ACGAC
G100_NNK_R GTCGTAACCATAGCTGTAMNNACGTCTCGCACAGT 8
AATAC
VH1-46_IGHD6-6*01_IGHJ1*01
S102_NNK_F TGCGAGAGAGGGGTATNNKAGCAGCTGGTACGACT 9
S102_NNK_R AGTCGTACCAGCTGCTMNNATACCCCTCTCTCGCA 10

C. Cassette Mutagenesis Using Type II Restriction Enzyme Based Digestion and Ligation of Oligo Pairs

In this example, Fab mutants were generated in a in a high-throughput manner by cloning of specific synthetic CDR1, CDR2 and/or CDR3 sequences into plasmids previously modified to contain BsaI cloning sites. Specifically, for each heavy or light chain, three vectors each were generated whereby a BsaI restriction site was incorporated at both the 5′ and 3′ end of each CDR region. To generate Fab mutants, forward and reverse primers encoding a CDR with specific mutations and additionally BsaI overlapping ends were synthesized and annealed. These cassettes, or mutated CDR regions, were then ligated into the corresponding BsaI digested vector, thereby generating a plasmid containing a specifically modified CDR region.

For example, specific primers were synthesized (IDT, see Table 8 below) and used to generate three vectors each for heavy chains VH1-46_IGHD6-6*01_IGHJ1*01 and VH5-51_IGHD5-18*01>3_IGHJ4*01 and light chains L6_IGKJ1*01 and V3-4_IGLJ1*01, to incorporate a BsaI site at the beginning and end of CDR1, CDR2 and CDR3. The vectors were generated as described above using the specific forward and reverse primers in the first round of PCR and the parent heavy or light chain DNA as a template. Individual clones were subjected to DNA sequencing (by BATJ, Inc., San Diego, Calif.) to confirm the incorporation of two BsaI sites in each CDR.

Subsequently, each BsaI containing plasmid was digested with BsaI (New England Biolabs) and the DNA was gel purified. Specific primers were synthesized (IDT) to generate desired mutants. Briefly, 1 μl of each forward and reverse primer were annealed by heating to 95° C. in TE for 2 min, followed by slow cooling to room temperature. 1 μl of the annealed primers were then ligated with 2 ng of the BsaI digested vector and transformed into E. coli DH5a cell. Mutations were confirmed by DNA sequencing. The ligation reactions can be carried out in a 96-well plate thereby allowing for high-throughput mutagenesis.

For example, Table 8-9 below sets forth primers to generate VH1-46_IGHD6-6*01_IGHJ1*01_APFF CDR2 mutants.

TABLE 8
BsaI restriction enzyme mutagenesis primers
SEQ ID
Primer Sequence NO
VH1-46_C DR1_F gagacctactatggttcgggtctctgggtgcgacaggcc 11
VH1-46_C DR2_F gagacctactatggttcgggtctcaagttccagggcagagtcac 12
VH1-46_C DR3_F gagacctactatggttcgggtctctggggccagggcac 13
VH5-51_C DR1_F gagacctactatggttcgggtctctgggtgcgccagatg 14
VH5-51_C DR2_F gagacctactatggttcgggtctccaggtcaccatctcagccg 15
VH5-51_C DR3_F gagacctactatggttcgggtctctggggccaaggaaccc 16
L6_CDR1_F gagacctactatggttcgggtctctggtaccaacagaaacctggc 17
L6_CDR2_F gagacctactatggttcgggtctcggcatcccagccagg 18
L6_CDR3_F gagacctactatggttcgggtctcttcggccaagggacca 19
V3-4 CDR1_F gagacctactatggttcgggtctctggtaccagcagacccca 20
V3-4 CDR2_F gagacctactatggttcgggtctcggggtccctgatcgcttc 21
V3-4 CDR3_F gagacctactatggttcgggtctcttcggaactgggaccaag 22
Lambda_BSA_F gagtggagacgaccacaccc 23
VH1-46_C DR1_R GAGACCCGAACCATAGTAGGTCTCAGATGCCTTGCAGGAAACC 24
VH1-46_C DR2_R GAGACCCGAACCATAGTAGGTCTCTCCCATCCACTCAAGCCC 25
VH1-46_C DR3_R GAGACCCGAACCATAGTAGGTCTCTCTCGCACAGTAATACACGG 26
C
VH5-51_C DR1_R GAGACCCGAACCATAGTAGGTCTCAGAACCCTTACAGGAGATCT 27
TCA
VH5-51_C DR2_R GAGACCCGAACCATAGTAGGTCTCCCCCATCCACTCCAGGC 28
VH5-51_C DR3_R GAGACCCGAACCATAGTAGGTCTCTCTCGCACAGTAATACATGG 29
C
L6_CDR1_R GAGACCCGAACCATAGTAGGTCTCGCAGGAGAGGGTGGCTC 30
L6_CDR2_R GAGACCCGAACCATAGTAGGTCTCATAGATGAGGAGCCTGGGA 31
G
L6_CDR3_R GAGACCCGAACCATAGTAGGTCTCACAGTAATAAACTGCAAAAT 32
CTTCAG
V3-4_CDR1_R GAGACCCGAACCATAGTAGGTCTCACAAGTGAGTGTGACTGTCC 33
CT
V3-4_CDR2_R GAGACCCGAACCATAGTAGGTCTCGTAGATGAGCGTGCGTGG 34
V3-4_CDR3_R GAGACCCGAACCATAGTAGGTCTCACAGTAATAATCAGATTCAT 35
CATCTGC

TABLE 9
VH1-46_IGHD6-6*01_IGHJ1*01_APFF_CDR2 BsaI mutagenesis primers
SEQ ID
Primer Sequence NO
A_ILPTH_F tgggaataattctccctactggtcatagcacaagctacgcacaga 36
A_VLPTH_F tgggaatagtgctccctactggtcatagcacaagctacgcacaga 37
A_ALPTH_F tgggaatagctctccctactggtcatagcacaagctacgcacaga 38
A_GLPTH_F tgggaataggcctccctactggtcatagcacaagctacgcacaga 39
A_TLPTH_F tgggaataaccctccctactggtcatagcacaagctacgcacaga 40
A_SLPTH_F tgggaatatccctccctactggtcatagcacaagctacgcacaga 41
A_YLPTH_F tgggaatatacctccctactggtcatagcacaagctacgcacaga 42
A_WLPTH_F tgggaatatggctccctactggtcatagcacaagctacgcacaga 43
A_HLPTH_F tgggaatacacctccctactggtcatagcacaagctacgcacaga 44
A_RLPTH_F tgggaatacgcctccctactggtcatagcacaagctacgcacaga 45
A_ELPTH_F tgggaatagaactccctactggtcatagcacaagctacgcacaga 46
A_NLPTH_F tgggaataaacctccctactggtcatagcacaagctacgcacaga 47
A_TLVTH_F tgggaataaccctcgtgactggtcatagcacaagctacgcacaga 48
A_TLATH_F tgggaataaccctcgctactggtcatagcacaagctacgcacaga 49
A_TLGTH_F tgggaataaccctcggcactggtcatagcacaagctacgcacaga 50
A_TLTTH_F tgggaataaccctcaccactggtcatagcacaagctacgcacaga 51
A_TLSTH_F tgggaataaccctctccactggtcatagcacaagctacgcacaga 52
A_TLYTH_F tgggaataaccctctacactggtcatagcacaagctacgcacaga 53
A_TLWTH_F tgggaataaccctctggactggtcatagcacaagctacgcacaga 54
A_TLHTH_F tgggaataaccctccacactggtcatagcacaagctacgcacaga 55
A_TLRTH_F tgggaataaccctccgcactggtcatagcacaagctacgcacaga 56
A_TLETH_F tgggaataaccctcgaaactggtcatagcacaagctacgcacaga 57
A_TLNTH_F tgggaataaccctcggcactggtcatagcacaagctacgcacaga 58
A_TLMTH_F tgggaataaccctcatgactggtcatagcacaagctacgcacaga 59
A_ILPTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTAGGGAGAATTATT 60
A_VLPTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTAGGGAGCACTATT 61
A_ALPTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTAGGGAGAGCTATT 62
A_GLPTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTAGGGAGGCCTATT 63
A_TLPTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTAGGGAGGGTTATT 64
A_SLPTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTAGGGAGGGATATT 65
A_YLPTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTAGGGAGGTATATT 66
A_WLPTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTAGGGAGCCATATT 67
A_HLPTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTAGGGAGGTGTATT 68
A_RLPTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTAGGGAGGCGTATT 69
A_ELPTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTAGGGAGTTCTATT 70
A_NLPTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTAGGGAGGTTTATT 71
A_TLVTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTCACGAGGGTTATT 72
A_TLATH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTAGCGAGGGTTATT 73
A_TLGTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTGCCGAGGGTTATT 74
A_TLTTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTGGTGAGGGTTATT 75
A_TLSTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTGGAGAGGGTTATT 76
A_TLYTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTGTAGAGGGTTATT 77
A_TLWTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTCCAGAGGGTTATT 78
A_TLHTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTGTGGAGGGTTATT 79
A_TLRTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTGCGGAGGGTTATT 80
A_TLETH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTTTCGAGGGTTATT 81
A_TLNTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTGCCGAGGGTTATT 82
A_TLMTH_R AACTTCTGTGCGTAGCTTGTGCTATGACCAGTCATGAGGGTTATT 83

Example 2

Cloning and High Throughput Growth and Purification of Fab Libraries

In this Example, Fab antibodies were generated by cloning heavy or light chain variable region DNA into their respective plasmids followed by co-transformation and high throughput protein growth/purification.

A. Cloning and Co-Transformation of Variable Heavy and Light Chains

DNA encoding a heavy or light chain variable region was cloned into plasmids containing constant heavy or light chains as appropriate for co-transformation and expression of combinatorial Fabs. Plasmid A (SEQ ID NO:84) and plasmid D (SEQ ID NO:85) contain heavy chain constant regions sequences. Plasmid C (SEQ ID NO:86) contains a kappa light chain constant region sequence and Plasmid E (SEQ ID NO:87) contains a lambda light chain constant region sequence.

DNA encoding a variable heavy chain was digested with Nhe I and Nco I and ligated into Plasmid A with a StII leader sequence using standard molecular techniques. DNA encoding a variable kappa light chain was digested with NcoI and BsiWI and DNA encoding a variable lambda chain was digested with NcoI and AvrII, and were ligated into Plasmid C or Plasmid E, respectively, with a StII leader sequence, using standard molecular biology techniques.

Plasmid A and one of either Plasmid C or Plasmid E, each containing various combinations of variable heavy and light chains, were co-transformed into E. coli. The process was repeated for all combinations of heavy and light chains. Briefly, plasmid A (encoding a Fab heavy chain) and plasmid C or Plasmid E (encoding a Fab light chain) were resuspended separately in TE buffer to a final concentration of 1 ng/μl. One (1) μL of heavy chain plasmid and 1 μL of light chain plasmid were combined in a PCR tube or a PCR plate and were mixed with 20 μL ice cold LMG194 competent cells. The transformation reaction was incubated on ice for 10 minutes followed by heat shock in a preheated PCR block at 42° C. for 45 seconds. The tube was then placed on ice for an additional 2 minutes followed by addition of 200 μL SOC medium. The cells were allowed to recover for 1.5 hours at 37° C. A 100 μL aliquot of the transformation culture was used to inoculate 0.9 mL LB (Luria-Bertani Broth) containing 0.4% (w/v) glucose, 17 μg/mL kanamycin (Sigma Aldrich) and 34 chloramphenicol (Sigma Aldrich). The culture was grown at 30° C. with vigorous shaking for 20 hours. The transformation culture was grown and purified using the Piccolo™ system as described below.

B. High Throughput Growth and Purification of Fab Antibodies

Following transformation, the cells were grown overnight in 2 ml deep well 96-well plates (VWR) block covered with breathable tape. The overnight culture was used directly for inoculation in Piccolo™ (Wollerton et al. (2006) JALA, 11:291-303.)

High throughput, parallel expression and purification of Fab antibodies was performed using Piccolo™ (The Automation Partnership (TAP)), which automates protein expression and purification. The expression and purification parameters for Piccolo™ were prepared using Run Composer software (TAP). A ‘Strain File’ was generated mapping the location of each clone in the seed culture plate. This was submitted to the Run Composer software and the basic machine settings were set as follows: Pre-induction Incubator set at 30° C.; Expression Incubator 1 set at 16° C.; Centrifuge set at 6° C. and 5000×g; Media Pump 1 primed with TB (Terrific Broth; per liter contains 12 g tryptone, 24 g yeast extract, 9.4 g potassium phosphate, dibasic, and 2.2 g potassium phosphate, monobasic) (EMD Biosciences; catalog No. 71754), 50 μg/mL kanamycin (Sigma Aldrich), 35 μg/mL chloramphenicol (Sigma Aldrich), 0.4% (w/v) glucose (Sigma Aldrich) and 0.015% (v/v) Antifoam 204 (Sigma Aldrich); Inducer Pump 1 primed with 0.2% (w/v) arabinose (EMD Biosciences); Incubator Gassing Rate set at 2 sec with 51% oxygen, 0.1 mL inoculation volume; Induction Statistic Mean set w/o Outliers (i.e. block mean OD600 determined after excluding the 3 highest and 3 lowest values); culture vessel blocks (CVB) pre-induction delay set at 1 hr 20 min and Expression Incubator Acclimatization set at 30 min.

The seed cultures were prepared and loaded into Piccolo™ along with the necessary labware: 24-well culture vessel blocks (CVBs; The Automation Partnership), 24-well Filter Plates (The Automation Partnership), 24-well Output Plates (Seahorse Bioscience) and Pipette Tip Boxes (MBP) as specified by the manufacturer. The TB media supplemented as described above, arabinose inducer and associated pumps were prepared under sterile conditions and attached to the machine. The centrifuge counterbalance weight was set and placed inside the centrifuge. Lastly, purification reagents were prepared and attached to the system pumps (lysis buffer, resin, wash buffer and elution buffer as described below). Once this was complete, the machine was started and processing began.

Before inoculation, the inocula were mapped to specific wells of 24-well CVB, and expression and induction conditions were set as described below. Each well of the CVBs was filled with 10 mL of TB media supplemented as described above prior to inoculation from the seed plate. Each well of each CVB was inoculated with 0.1 mL seed culture and then returned to the storage carousel to await scheduled admission to pre-induction incubation. Once a CVB was queued to begin pre-induction incubation it was removed from the storage carousel and coupled to an aeration assembly (which provides agitation, well sealing and a means for controlled administration of oxygen/air) and then placed in the pre-induction incubator set at 30° C. OD600 readings were taken upon commencement of incubation and approximately every 30 minutes thereafter. Piccolo operation control software monitors the OD600 measurements to predict when each CVB will reach the 1.0 OD600 set point. Approximately 30 minutes prior to the CVB reaching the OD600 set point the assembly was moved to the expression incubator to equilibrate to the expression temperature of 20° C., and then the cultures in the CVB were induced by addition of 0.032% arabinose inducer followed by 45 hours of expression.

Following culture inoculation and growth induction of cultures, the cells were harvested and lysed for purification of Fabs. Piccolo™ was used for purification of the expressed Fab proteins using an automated expression and purification ‘Lifecycle’ of a whole culture purification. After controlled expression, CVBs were chilled for 30 minutes at 6° C. in the storage carousel prior to lysis. The CVB was moved to the liquid handling bed and lysis buffer (2.5 mL of Popculture with 1:1000 Lysonase (EMD Biosciences)) was added to each well with thorough mixing. The lysis proceeded for 10 minutes and then the CVB was centrifuged for 10 minutes at 5000×g to pellet cell debris. During centrifugation, a Filter Plate was placed in the filter bed and resin (2 mL of a 50% slurry of Ni-charged His-Bind resin (EMD Biosciences)) was added to each well. Soluble lysate was added to the corresponding wells of the filter plate containing resin and allowed to bind for 10 minutes prior to draining to waste. Wash buffer (12 mL, of wash buffer (50 mM Sodium Phosphate, 300 mM NaCl, 30 mM Imidazole, pH 8.0)) was added in two steps to each well and allowed to drain to waste. Finally, an Output Plate was placed under the Filter Plate in the filter bed and IMAC elution buffer (50 mM Sodium Phosphate, 300 mM NaCl, 500 mM Imidazole) was added in two steps draining into the output plate. The output plate was returned to the storage carousel as was all other labware. Once this process was complete for each CVB in the designed run, the machine was unloaded.

Example 3

Orthogonal Secondary Purification of Fab Antibodies

To rapidly further purify partially pure Fabs generated after the Piccolo™ process, an orthogonal method of purification was developed. Fabs were expressed and purified as described above in Example 2 using the Piccolo™ machine.

Two different affinity resins were used depending on the light chain classes. Fabs with a kappa light chain were further purified on Protein G column (GE Healthcare), and Fabs with a lambda light chain were further purified on CaptureSelect Fab Lambda affinity column (BAC, Netherlands). First, the protein samples were transferred to a deep well 96-well block (VWR). Approximately 1.8 mL of the IMAC elution per Fab sample was purified on either a 1 mL Hi-Trap Protein G column or a 0.5 mL CaptureSelect Fab Lambda affinity column at 4° C. using the Akta purifier (GE Healthcare) and A-905 autosampler (GE Healthcare) according to the manufacturer's protocol. Protein concentration was determined by measuring absorbance at A280 on a Molecular Dynamic plate reader and calculated from the exctinction coefficient of the corresponding Fab. Extinction coefficients are calculated based on the total numbers of Tyrosine+Tryptophan+Phenylalanine in the Fab heavy and light chains. Following purification using the Piccolo™ system, expressed protein was generally less than 20% pure. After orthogonal purification with protein G, Fab purity was greater than 95% pure as indicated by SDS-PAGE.

Example 4

Electrochemiluminescence Binding Assay

In this example, an electrochemiluminescence (ECL) binding assay was used to screen a Fab library (e.g. see Table 4) for antibodies capable of binding to one of nine different antigens, including the human epidermal growth factor 2 receptor (ErbB2), epidermal growth factor receptor (EGF R), hepatocyte growth factor receptor (HGF R/c-Met), Notch-1, CD44, insulin-like growth factor-1 soluble receptor (IGF-1 sR), P-cadherin, erythropoietin receptor (Epo R) and delta-like protein 4 (DLL4). In an ECL assay, an antigen-antibody interaction is detected by addition of a detection antibody labeled with ruthenium tri-bispyridine-(4-methysulfone) (Ru(bpy)22+). Upon application of an electric current, the Ru(bpy)22+-label undergoes an oxidation-reduction cycle in the presence of a co-reactant and light is emitted. A signal is only generated when the Ru(bpy)22+-label is in close proximity to the electrode, eliminating the need for washing. Detected light intensity is proportional to the amount of captured protein.

Recombinant human proteins were obtained from R&D Systems and included: rHuman ErbB2/Fc Chimera, CF (Cat#1129-ER); rHuman EGF R/Fc Chimera, CF (Cat#344-ER); rHuman HGF R/c-MET/Fc Chimera, CF (Cat#358-MT/CF); rHuman Notch-1/Fc Chimera, CF (Cat#3647-TK); rHuman CD44/Fc Chimera, CF (Cat#3660-CD); rHuman IGF-1 sR, (IGF-1 sR), CF (Cat#391-GR); rHuman P-Cadherin/Fc Chimera, CF (Cat#861-PC); rHuman Erythropoietin R/Fc Chimera, CF (Cat#963-ER); and Recombinant Human DLL4 (Cat#1506-D4/CF).

A. Multispot ECL Assay for Binding to Multiple Antigens

Each of the antigens listed above were immobilized onto each well of 10 plates by spotting 50 nanoliters (nl) of each protein (of a 60 μg/mL antigen) on the surface of a 96-well Multi-Spot 10 Highbind plate (Meso Scale Discovery; Gaithersburg Md.). Spot 10 was left blank as a control.

An 150 μl aliquot of 1% Bovine Serum Albumin (BSA) in Tris-buffered Saline Tween (TBST) was added to each well and allowed to incubate for 30 min at 20° C. followed by washing and tap drying to completely remove any residual solution. Subsequently, a 12.5 μl aliquot of 1% BSA TBST was added to each well followed by the addition of a 12.5 μl aliquot of a purified Fab. The plate was sealed and incubated for 1 hour at 20° C. with shaking

Detection antibodies were prepared by individually conjugating both goat anti-human Kappa light chain polyclonal antibody (K3502-1MG, Sigma-Aldrich) and goat anti-human Lambda light chain polyclonal antibody (L1645-1ML, Sigma-Aldrich) with Ruthenium (II) tris-bipyridine-(4-methylsulfone)-N-hydroxysuccinimide (SULFO-TAG NHS-ester, Meso. Scale Discovery) according to the manufacturer's instructions. TAG-detection antibody at 25 μl was added to each well and allowed to incubate for 1 hour at 20° C. with shaking. Finally, 15 μl of Read Buffer P with Surfactant (Cat # R92PC-1, Meso Scale Discovery) was added to each well. The electrochemiluminescence was measured using a Sector Imager 2400 (Meso Scale Discovery). Data was analyzed by comparing the ECL signals for an antigen to the blank of each well. A signal to blank ratio of 4 or more was considered a “Hit” Fab.

Using the Multispot ECL assay antibodies were identified that bind to the selected antigens. Table 10, below, lists the Fabs (including the heavy chain and light chain) that were identified as “hits” using the Multispot ECL assay and the target(s) of the identified Fab “hit.” Several Fabs were identified that bind to multiple targets. For example, VH1-46_IGHD6-13*01_IGH41*01 & B3_IGKJ1*01, shows affinity for both Human ErbB2/Fc and Human Erythropoietin R/Fc chimeras; Fab VH1-46_IGHD2-15*01_IGHJ2*01 & L12_IGKJ1*01 binds to EGF R, Epo R and DLL4 and Fab VH1-46_IGHD3-10*01_IGHJ4*01 & L12_IGKJ1*01 binds to Notch-1, P-cadherin and DLL4.

TABLE 10
IDENTIFIED FAB “HITS”
SEQ SEQ ID
Target Heavy Chain ID NO Light Chain NO
rHuman DLL4 VH1-46_IGHD6- 88 L6_IGKJ1*01 107
6*01_IGHJ1*01
rHuman DLL4 VH5-51_IGHD5- 89 V3- 108
18*01>3_IGHJ4*01 4_IGLJ1*01
rHuman DLL4 VH6-1_IGHD3- 90 V4- 109
3*01_IGHJ4*01 3_IGLJ4*01
rHuman ErbB2/Fc chimera VH4-31_IGHD1- 91 A27_IGKJ1*01 110
26*01_IGHJ2*01
rHuman Epo R/Fc chimera VH1-46_IGHD3- 92 B3_IGKJ1*01 111
10*01_IGHJ4*01
rHuman ErbB2/Fc chimera and VH1-46_IGHD6- 93 B3_IGKJ1*01 111
rHuman Epo R/Fc chimera 13*01_IGHJ4*01
Epo R/Fc chimera VH4-28_IGHD7- 94 L2_IGKJ1*01 112
27*01_IGHJ1*01
Epo R/Fc chimera VH4-31_IGHD7- 95 L2_IGKJ1*01 112
27*01_IGHJ5*01
ErbB2/Fc chimera VH2-5_IGHD7- 96 L2_IGKJ1*01 112
27*01_IGHJ2*01
Epo R/Fc chimera VH1-46_IGHD7- 97 A27_IGKJ1*01 110
27*01_IGHJ2*01
ErbB2/Fc chimera VH1-69_IGHD1- 98 A17_IGKJ1*01 113
1*01_IGHJ6*01
Epo R/Fc chimera and EGF R/Fc VH1-46_IGHD2- 99 L2_IGKJ1*01 112
chimera 15*01_IGHJ2*01
EGF R/Fc chimera, Notch-1/Fc VH1-46_IGHD6- 93 L2_IGKJ1*01 112
chimera, P-cadherin/Fc chimera, 13*01_IGHJ4*01
Epo R/Fc chimera and DLL4
DLL4 VH4-34_IGHD7- 100 L5_IGKJ1*01 114
27*01_IGHJ4*01
Notch-1/Fc chimera, P- VH1-46_IGHD6- 93 A27_IGKJ1*01 110
cadherin/Fc chimera, Epo R/Fc 13*01_IGHJ4*01
chimera and DLL4
P-cadherin/Fc chimera VH1-46_IGHD7- 97 L6_IGKJ1*01 107
27*01_IGHJ2*01
DLL4 VH1-3_IGHD4- 101 L12_IGKJ1*01 115
23*01_IGHJ4*01
EGF R/Fc chimera, Epo R/Fc VH1-46_IGHD2- 99 L12_IGKJ1*01 115
chimera and DLL4 15*01_IGHJ2*01
Notch-1/Fc chimera, P- VH1-46_IGHD3- 92 L12_IGKJ1*01 115
cadherin/Fc chimera and DLL4 10*01_IGHJ4*01
DLL4 VH1-8_IGHD2- 102 L12_IGKJ1*01 115
2*01_IGHJ6*01
Epo R/Fc chimera VH1-46_IGHD3- 92 O1_IGKJ1*01 116
10*01_IGHJ4*01
Epo R/Fc chimera and DLL4 VH1-46_IGHD6- 93 O1_IGKJ1*01 116
13*01_IGHJ4*01
DLL4 VH4-34_IGHD7- 100 V1- 117
27*01_IGHJ4*01 4_IGLJ4*01
DLL4 VH4-31_IGHD2- 103 V1- 117
15*01_IGHJ2*01 4_IGLJ4*01
DLL4 VH4-34_IGHD7- 100 V4- 118
27*01_IGHJ4*01 6_IGLJ4*01
P-cadherin/Fc chimera and Epo VH3-23_IGHD3- 104 O12_IGKJ1*01 119
R/Fc chimera 10*01>3_IGHJ6*01
P-cadherin/Fc chimera VH3-23_IGHD3- 105 O12_IGKJ1*01 119
10*01>1′_IGHJ3*01

To confirm a “Hit” from the initial Multispot ECL screening, a Fab concentration dependent titration was carried out to determine the Fab-antigen binding affinity. The Multispot ECL assay procedure was the same as described above, except that the concentration of Fab antibody was varied between wells from 0.1 nM to 2.4 μM as indicated in the Tables below depending on each Fab tested. The data are set forth in Tables 11-33 below.

TABLE 11
Binding affinity of Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01
Fab[nM] 2383 595.8 148.9 37.2 9.3 2.3 0.6 0.1
ErbB2/Fc 454 321 247 384 354 291 215 306
EGF R/Fc 621 403 290 228 424 289 309 311
HGF R/Fc 762 353 205 207 324 253 256 286
Notch-1/Fc 690 306 375 402 492 333 337 378
CD44/Fc 559 372 348 356 396 317 238 323
IGF-1 sR 527 335 322 295 315 231 313 241
P-Cadherin/Fc 728 617 687 649 452 401 321 235
EPO R/Fc 658 378 373 315 306 429 337 373
DLL4 11794 17203 16253 16717 13210 3055 508 317
Blank 344 285 218 199 287 234 226 201

TABLE 12
Binding affinity of Fab VH5-51_IGHD5-
18*01>3_IGHJ4*01 & V3-4_IGLJ1*01
Fab[nM] 154 51 17 6
ErbB2/Fc 1593 1248 1033 873
EGF R/Fc 1398 816 805 742
HGF R/Fc 1520 1044 914 831
Notch-1/Fc 929 685 558 464
CD44/Fc 960 651 518 547
IGF-1 sR 1396 1051 872 854
P-Cadherin/Fc 1733 854 542 358
EPO R/Fc 1195 750 620 548
DLL4 40392 17025 7158 1946
Blank 447 335 143 191

TABLE 13
Binding affinity of Fab VH6-
1_IGHD3-3*01_IGHJ4*01 & V4-3_IGLJ4*01
Fab[nM] 480 240 120 60 30 15 7.5 3.8
ErbB2/Fc 965 833 822 777 726 713 695 714
EGF R/Fc 877 690 658 679 585 584 582 511
HGF R/Fc 951 834 785 623 640 694 558 519
Notch-1/Fc 545 368 472 415 425 508 392 383
CD44/Fc 541 470 442 434 484 454 444 419
IGF-1 sR 741 625 813 654 697 705 642 463
P-Cadherin/Fc 596 383 450 372 440 351 352 281
EPO R/Fc 621 478 431 423 325 397 443 407
DLL4 1532 1273 938 875 736 690 598 462
Blank 362 316 363 237 213 261 217 198

TABLE 14
Binding affinity of Fab VH4-
31_IGHD1-26*01_IGHJ2*01 & A27_IGKJ1*01
Fab[nM] 410 205 102.5 51.3 25.6 12.8 6.4 3.2
ErbB2/Fc 5422 5260 4355 3588 2992 2255 1796 868
EGF R/Fc 734 595 455 379 373 320 249 254
HGF R/Fc 753 735 425 456 382 258 234 294
Notch-1/Fc 804 722 607 408 270 249 279 275
CD44/Fc 767 613 461 409 332 273 240 295
IGF-1 sR 600 565 443 316 311 323 209 313
P-Cadherin/Fc 814 769 714 424 323 245 197 206
EPO R/Fc 797 595 587 498 409 338 264 233
DLL4 859 599 550 474 384 268 256 242
Blank 637 430 437 337 345 227 133 172

TABLE 15
Binding affinity of Fab VH1-
46_IGHD3-10*01_IGHJ4*01 & B3_IGKJ1*01
Fab[nM] 1410 705 352.5 176.3 88.1 44.1 22 11
ErbB2/Fc 932 671 514 448 200 347 363 216
EGF R/Fc 1071 692 769 428 376 428 312 201
HGF R/Fc 903 839 606 418 392 336 203 268
Notch-1/Fc 1034 958 715 664 440 331 389 404
CD44/Fc 885 693 556 376 340 302 317 296
IGF-1 sR 426 630 528 393 273 309 347 289
P-Cadherin/Fc 1059 827 649 532 278 343 215 270
EPO R/Fc 4314 4894 4105 3519 3368 2387 2241 1824
DLL4 1265 981 660 460 434 388 342 254
Blank 709 483 494 346 301 200 289 212

TABLE 16
Binding affinity of Fab VH1-46_IGHD6-13*01_IGHJ4*01 & B3_IGKJ1*01
Fab[nM] 1000 500 250 125 62.5 31.3 15.6 7.8
ErbB2/Fc 8731 10241 11026 12956 13124 13911 14791 13220
EGF R/Fc 2236 1468 1138 860 602 447 346 379
HGF R/Fc 2109 1371 1221 778 578 299 293 282
Notch-1/Fc 2267 1975 1241 802 536 563 418 486
CD44/Fc 1966 1685 1175 764 591 439 473 409
IGF-1 sR 1667 1334 993 654 491 385 349 353
P-Cadherin/Fc 4495 3447 2784 1481 1173 1105 971 695
EPO R/Fc 8594 10305 8535 9237 7749 7878 8357 6765
DLL4 2785 2319 1560 912 715 528 525 407
Blank 1133 680 590 403 268 250 294 316

TABLE 17
Binding affinity of Fab VH4-
28_IGHD7-27*01_IGHJ1*01 & L2_IGKJ1*01
Fab[nM] 360 36
ErbB2/Fc 647 600
EGF R/Fc 957 711
HGF R/Fc 581 613
Notch-1/Fc 1026 773
CD44/Fc 740 679
IGF-1 sR 535 486
P-Cadherin/Fc 636 693
EPO R/Fc 4715 2977
DLL4 866 799
Blank 462 413

TABLE 18
Binding affinity of Fab VH1-46_IGHD2-15*01_IGHJ2*01 &
L2_IGKJ1*01
Fab[μM] 0.25 0.0625 0.01563 0.00391
ErbB2/Fc 29608 9033 4495 1667
EGF R/Fc 116674 94778 70836 35936
HGF R/Fc 13427 4108 1998 913
Notch-1/Fc 21447 5848 2800 1282
CD44/Fc 23015 6746 3182 1295
IGF-1 sR 11050 3150 1742 822
P-Cadherin/Fc 25459 7739 4945 1962
EPO R/Fc 49177 21136 11342 5022
DLL4 27691 8051 4015 1551
Blank 6344 1738 906 576

TABLE 19
Binding affinity of Fab VH1-46_IGHD6-13*01_IGHJ4*01 &
L2_IGKJ1*01
Fab[μM] 1.19 0.2975 0.07438 0.01859
ErbB2/Fc 38410 15111 7551 5531
EGF R/Fc 62454 42213 16605 11750
HGF R/Fc 45494 17396 6611 4566
Notch-1/Fc 72018 37503 21990 17565
CD44/Fc 47145 28601 10922 7322
IGF-1 sR 35187 17389 5804 3779
P-Cadherin/Fc 69710 26043 14807 11672
EPO R/Fc 192967 167064 153692 188065
DLL4 74900 34726 20719 18888
Blank 24999 5019 2504 1776

TABLE 20
Binding affinity of Fab VH4-34_IGHD7-27*01_IGHJ4*01 &
L5_IGKJ1*01
Fab[μM] 0.51 0.1275 0.03188 0.00797
ErbB2/Fc 1532 857 584 493
EGF R/Fc 2363 1061 694 530
HGF R/Fc 1989 853 693 419
Notch-1/Fc 2773 1497 849 654
CD44/Fc 2012 926 653 490
IGF-1 sR 2236 1045 765 564
P-Cadherin/Fc 2389 957 775 502
EPO R/Fc 2624 1067 789 566
DLL4 5183 2382 1282 872
Blank 1096 530 536 364

TABLE 21
Binding affinity of Fab VH1-46_IGHD6-
13*01_IGHJ4*01 & A27_IGKJ1*01
Fab[μM] 0.48 0.096 0.0192
ErbB2/Fc 11287 3365 2313
EGF R/Fc 14638 4509 3115
HGF R/Fc 8002 2328 1582
Notch-1/Fc 15931 4802 3041
CD44/Fc 13445 4320 2915
IGF-1 sR 8927 2449 1826
P-Cadherin/Fc 15595 6654 5040
EPO R/Fc 70938 57356 62037
DLL4 16065 5586 3555
Blank 2945 917 751

TABLE 22
Binding affinity of Fab VH1-46_IGHD7-
27*01_IGHJ2*01 & L6_IGKJ1*01
Fab[μM] 1.56 0.312 0.0624
ErbB2/Fc 7577 3659 2146
EGF R/Fc 7832 4328 2415
HGF R/Fc 10267 4691 2453
Notch-1/Fc 9447 4462 2352
CD44/Fc 7595 4171 2110
IGF-1 sR 6913 3508 2034
P-Cadherin/Fc 15016 7098 4226
EPO R/Fc 9480 5020 2678
DLL4 10897 5484 2585
Blank 4357 1977 960

TABLE 23
Binding affinity of Fab VH1-3_IGHD4-23*01_IGHJ4*01 &
L12_IGKJ1*01
Fab[nM] 60 15 3.75 0.9375
ErbB2/Fc 2155 740 291 268
EGF R/Fc 2563 842 371 224
HGF R/Fc 2298 743 394 243
Notch-1/Fc 2886 1058 375 348
CD44/Fc 2355 748 307 251
IGF-1 sR 2666 859 314 204
P-Cadherin/Fc 2662 837 331 191
EPO R/Fc 3214 970 358 238
DLL4 17270 7728 1569 453
Blank 1433 536 191 153

TABLE 24
Binding affinity of Fab VH1-46_IGHD2-15*01_IGHJ2*01 &
L12_IGKJ1*01
Fab[nM] 280 70 17.5 4.375
ErbB2/Fc 3953 1358 541 384
EGF R/Fc 6667 2574 1305 542
HGF R/Fc 3564 1289 565 193
Notch-1/Fc 4382 1492 680 480
CD44/Fc 4069 1370 664 424
IGF-1 sR 3533 1319 626 369
P-Cadherin/Fc 5400 1817 949 469
EPO R/Fc 8496 2485 1262 594
DLL4 8111 2747 1219 558
Blank 1691 635 304 305

TABLE 25
Binding affinity of Fab VH1-46_IGHD3-10*01_IGHJ4*01 &
L12_IGKJ1*01
Fab[nM] 920 230 57.5 14.375
ErbB2/Fc 10924 4078 2447 1594
EGF R/Fc 13406 5723 3858 2672
HGF R/Fc 10708 3934 2297 1600
Notch-1/Fc 20086 9737 5886 4206
CD44/Fc 9698 3817 2313 1488
IGF-1 sR 10246 4764 2833 1746
P-Cadherin/Fc 16666 6484 4110 2318
EPO R/Fc 16429 6949 4038 2718
DLL4 73638 119436 144126 125422
Blank 4082 1656 954 738

TABLE 26
Binding affinity of Fab VH1-8_IGHD2-2*01_IGHJ6*01 &
L12_IGKJ1*01
Fab[nM] 130 32.5 8.1 2.0
ErbB2/Fc 1533 556 557 382
EGF R/Fc 1746 645 560 424
HGF R/Fc 1882 525 551 356
Notch-1/Fc 1759 706 612 539
CD44/Fc 1754 573 528 447
IGF-1 sR 1973 561 518 367
P-Cadherin/Fc 1845 556 573 250
EPO R/Fc 2151 673 660 433
DLL4 7738 2989 1548 605
Blank 1153 473 435 316

TABLE 27
Binding affinity of Fab FabVH1-46_IGHD3-10*01_IGHJ4*01
& O1_IGKJ1*01
Fab[nM] 1570 392.5 98.1 24.5
ErbB2/Fc 1263 539 247 241
EGF R/Fc 2481 744 4386 317
HGF R/Fc 1638 581 335 211
Notch-1/Fc 1639 749 313 434
CD44/Fc 1381 498 265 267
IGF-1 sR 1428 466 309 239
P-Cadherin/Fc 1793 459 347 257
EPO R/Fc 6121 5863 5628 4531
DLL4 2701 735 402 339
Blank 866 338 210 149

TABLE 28
Binding affinity of Fab VH1-46_IGHD6-13*01_IGHJ4*01 &
O1_IGKJ1*01
Fab[nM] 930 232.5 58.1 14.5
ErbB2/Fc 2225 779 322 274
EGF R/Fc 3110 803 444 357
HGF R/Fc 2344 790 432 373
Notch-1/Fc 2206 778 388 317
CD44/Fc 1917 607 375 212
IGF-1 sR 1915 569 343 234
P-Cadherin/Fc 2438 655 478 277
EPO R/Fc 3009 1472 829 660
DLL4 8162 3586 1876 1149
Blank 1206 460 225 117

TABLE 29
Binding affinity of Fab VH4-34_IGHD7-27*01_IGHJ4*01 &
V1-4_IGLJ4*01
Fab[nM] 580 145 36.3 9.1
ErbB2/Fc 1712 1123 1029 987
EGF R/Fc 1631 856 831 800
HGF R/Fc 2341 1173 1065 894
Notch-1/Fc 1585 860 633 754
CD44/Fc 1228 692 629 607
IGF-1 sR 1364 794 799 788
P-Cadherin/Fc 2240 850 684 589
EPO R/Fc 1579 845 722 697
DLL4 4420 2140 1399 1030
Blank 679 357 314 276

TABLE 30
Binding affinity of Fab VH4-31_IGHD2-15*01_IGHJ2*01 &
V1-4_IGLJ4*01
Fab [nM] 210 52.5 13.1 3.3
ErbB2/Fc 1977 1511 930 1031
EGF R/Fc 1617 1109 824 847
HGF R/Fc 2060 1286 981 849
Notch-1/Fc 1972 1323 669 726
CD44/Fc 1395 897 708 621
IGF-1 sR 1431 911 814 743
P-Cadherin/Fc 4410 2161 1062 678
EPO R/Fc 2123 1319 776 695
DLL4 4108 1951 1107 922
Blank 833 467 376 359

TABLE 31
Binding affinity of Fab VH4-34_IGHD7-27*01_IGHJ4*01 &
V4-6_IGLJ4*01
Fab [nM] 340 170 85.0 42.5
ErbB2/Fc 1226 964 844 866
EGF R/Fc 1208 826 1001 528
HGF R/Fc 1238 757 998 607
Notch-1/Fc 1209 816 780 649
CD44/Fc 959 660 693 522
IGF-1 sR 1042 832 891 646
P-Cadherin/Fc 1160 744 709 421
EPO R/Fc 1255 790 817 494
DLL4 2332 1462 1311 877
Blank 554 262 292 162

TABLE 32
Binding affinity of Fab VH3-23_IGHD3-10*01>3_IGHJ6*01 &
O12_IGKJ1*01
Fab [nM] 120 12 1.2 0.12
ErbB2/Fc 17294 4358 677 287
EGF R/Fc 14925 1984 464 272
HGF R/Fc 15917 2703 412 287
Notch-1/Fc 14382 2582 660 218
CD44/Fc 13519 1321 341 291
IGF-1 sR 13265 1135 181 175
P-Cadherin/Fc 61714 28490 1684 318
EPO R/Fc 33268 10966 1014 260
DLL4 20627 2510 319 210
Blank 6749 573 227 264

TABLE 33
Binding affinity of Fab VH3-23_IGHD3-10*01>1′_IGHJ3*01 &
O12_IGKJ1*01
Fab [nM] 421.12 42.112
ErbB2/Fc 868 524
EGF R/Fc 765 422
HGF R/Fc 1202 565
Notch-1/Fc 1061 437
CD44/Fc 903 360
IGF-1 sR 1065 364
P-Cadherin/Fc 2949 1546
EPO R/Fc 1299 759
DLL4 1090 404
Blank 639 323

B. 96-Well Plate ECL Assay for Binding to DLL4

A similar ECL assay was performed as above, except only one antigen was immobilized to a single-spot per well plate for testing. Recombinant Human DLL4 (Cat#1506-D4/CF) was immobilized onto a 96-well plate by adding 5 μL (of 10 μg/ml DLL4 in PBS+0.03% Triton-X-100) to each well and incubating overnight at 20° C. One well was left blank as a control. The protein was removed and an 150 μl aliquot of 1% BSA in TBST was added to each well and allowed to incubate for 1 hour at 20° C. followed by washing 2 times with 150 μl TBST and tap drying to completely remove any residual solution. Subsequently, 25 μl aliquot of each Fab (with 1% BSA with TBST) was added to each well. The plate was sealed and incubated for 1 hour at 20° C. with shaking. As described in Examples 7 and 12, two different combinations of antigen and Fab concentrations were utilized. In one experiment, 5 μL of 30 μg/mL antigen was used to coat the plate and each Fab was tested at a concentration of 0.02 μM. In the other experiment, 5 μL of 15 μg/mL antigen was used to coat the plate and each Fab was tested at a concentration of 0.004 μM.

The Fab was subsequently removed and 25 μl anti-human Kappa Ruthenium antibody or anti-human Lambda Ruthenium antibody (1 μg/ml in 1% BSA with TBST) was added to each well and allowed to incubate for 1 hour at 20° C. with shaking Finally, 15 μl of Read Buffer P with Surfactant (Cat # R92PC-1, Meso Scale Discovery) was added to each well. The electrochemiluminescence was measured using a Sector Imager 2400 (Meso Scale Discovery). Data was analyzed by comparing the ECL signals for an antigen to the blank of each well. A signal to blank ratio of 4 or more was considered a “Hit” Fab. The results are depicted in Examples 7-15 below.

Example 5

Surface Plasmon Resonance

In this example, the binding affinities of selected Fabs to recombinant human DLL4 (R&D Systems) were analyzed using Surface Plasmon Resonance (SPR) (Biosensor Tools, Salt Lake City, Utah). The Fabs include germline antibodies identified in the initial ECL screen as binding to DLL4 (as shown in Example 4).

The results are shown in Table 34 below. Table 34 sets forth the Fab, the ka (M−1s−1), the kd (s−1), and the KD (nM) and the standard deviation (in parentheses). Germline Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01 has an average KD of 4.8 μM. Germline Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 binds DLL4 with an average KD of 730 nM. Germline Fab VH6-1_IGHD3-3*01_IGHJ4*01 & V4-3_IGLJ4*01 has an average binding affinity of 38 μM while germline Fab VH1-46_IGHD3-10*01_IGHJ4*01 & L12_IGKJ1*01 has an average KD of 500 nM.

TABLE 34
Binding affinity of DLL4 Fabs
SEQ SEQ
Heavy Chain ID NO Light Chain ID NO ka (M−1s−1) kd (s−1) KD (nM)
VH5-51_IGHD5- 89 V3-4_IGLJ1*01 108 n/a n/a 4800(200) 
18*01 > 3_IGHJ4*01
VH1-46_IGHD6- 88 L6_IGKJ1*01 107 1.63(3)e5 0.101(2) 730(130)
6*01_IGHJ1*01
VH6-1_IGHD3- 90 V4-3_IGLJ4*01 109 n/a n/a 38000(4000) 
3*01_IGHJ4*01
VH1-46_IGHD3- 92 L12_IGKJ1*01 115   5(1)e5 0.29(2) 500(100)
10*01_IGHJ4*01

Example 6

ELISA Binding Assay

In this example, an ELISA binding assay was used to determine the binding of Fab antibodies to DLL4.

A. 96-Well Plate

Briefly, 50 μl of a 0.5 μg/ml solution of DLL4 in 100 mM NaHCO3, pH 9 was added to each well of a 96-well Costar plate (Cat #3370, Corning Inc.) and allowed to incubate for 1 hour at room temperature. The plate was blocked by adding 1% BSA in Tris-buffered Saline Tween (TBST) and incubating for 1 hour at room temperature followed by washing 2 times with 150 μl TBST. A Fab antibody was serially diluted in 1% BSA in TBST, starting at a concentration of 1000 nM. A 50 μl aliquot of each serial dilution was added, in triplicate, to each well and the plate was incubated for 1 hour at room temperature followed by washing 2 times with TBST. 50 μl of goat anti-DDDDK tag HRP conjugated polyclonal antibody diluted 1:1000 in 1% BSA TBST (Cat # AB1238-200, Abeam), was added to each well and the plate was incubated for 30 minutes at room temperature followed by washing 3 times with 200 μl TBST. Finally, 100 μl TMB one-component reagent (Cat # TMBW-1000-01, BioFax) was added and allowed to develop for 2 minutes at room temperature. The reaction was immediately halted by the addition of 100 μl 0.5 M H2SO4 and the absorbance at 450 nm was measured using an ELISA plate reader. Results using this assay are depicted in Examples 9 and 10.

B. 384-Well Plate

Briefly, 10 μl of a 0.5 μg/ml solution of DLL4 in 100 mM NaHCO3, pH 9 was added to each well of a 384-well Nunc Maxisorp plate (Cat #464718, Nalgene Nunc International) and allowed to incubate for 90 minutes at room temperature. The plate was blocked by adding 1% BSA in Tris-buffered Saline Tween (TBST) and incubating for 1 hour at room temperature followed by washing 2 times with 100 μl TBST. Fab antibody was serially diluted in 1% BSA in TBST, starting at a concentration of 1000 nM. A 20 μl aliquot of each serial dilution was added, in triplicate, to each well and the plate was incubated for 1 hour at room temperature followed by washing 2 times with 100 μl TBST. Depending on the light chain, 20 μl of goat anti-kappa HRP conjugated polyclonal antibody, diluted 1:1000 in 1% BSA TBST (Cat # A7164-1mL, Sigma-Aldrich) or goat anti-lambda HRP conjugated polyclonal antibody, diluted 1:1000 in 1% BSA TBST (Cat # L1645-1ml, Sigma-Aldrich) was added to each well and the plate was incubated for 1 hour at room temperature followed by washing 4 times with 100 μl TBST. Finally, 25 μl TMB one-component reagent (Cat # TMBW-1000-01, BioFax) was added and allowed to develop for 1-5 minutes at room temperature. The reaction was immediately halted by the addition of 25 μl 0.5 M H2SO4 and the absorbance at 450 nm was measured using an ELISA plate reader. Results using this assay are depicted in Examples 9 and 10.

Example 7

Affinity Maturation of the Heavy Chain of Anti-DLL4 “Hit” VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01

a. Summary

The heavy and light chain amino acid sequence of Fab “Hit” VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 (SEQ ID NOS:88 and 107) against DLL4, identified in Example 4 using the Multispot ECL binding assay, was aligned with the heavy and light chain amino acid sequence of a related “non-Hit” Fab antibody that had a related heavy or light chain but did not bind to DLL4. Based on the alignment, amino acid residues that differed between the “Hit” and “non-Hit” antibodies were identified in each of the heavy and light chain as potential amino acids involved in binding for subsequent affinity maturation. Affinity maturation of the heavy chain is described in Examples 7-9. Affinity maturation of the light chain is described in Example 10.

Briefly, the identified amino acid residues were subjected to alanine-scanning mutagenesis and resultant mutant Fabs tested to assess the affect of the mutation on binding of the antibody to DLL4. Mutated residues that did not affect binding of the antibody to DLL4 were identified and subjected to further mutagenesis using overlapping PCR with NNK mutagenesis. Mutant antibodies were assessed for DLL4 binding, and mutations that improved binding to DLL4 were identified. Combinations mutants were generated containing each of the identified single mutants; combination mutants were further assayed for binding to DLL4. Further optimization was performed by mutating other regions of the antibody. By this method, anti-DLL4 antibodies were generated with significantly improved binding affinity for DLL4 compared to the parent “Hit” VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 Fab antibody.

b. Affinity Maturation of Heavy Chain

i. Identification of the CDR Potential Binding Site

The amino acid sequence of the heavy chain (SEQ ID NO:88) for the parent “Hit” VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 was aligned with the amino acid sequence of a related heavy chain (SEQ ID NO:93) of a non-Hit that was identified as not binding to DLL4, i.e. VH1-46_IGHD6-13*01_IGHJ4*01 & L6_IGKJ1*01. “Hit” Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 had an ECL signal/blank ratio of 23.1 while that of the non-Hit Fab VH1-46_IGHD6-13*01_IGHJ4*01 & L6_IGKJ1*01 was only 2.4. These two Fabs are related because they share the same VH germline segment. Further, the DH germline segment is of the same gene family (i.e. IGHD6). The sequence alignment is set forth in FIG. 1. Based on the alignment, amino acid residues were identified that differed between the “Hit” and “non-Hit,” thus accounting for the differences in binding of the “Hit” and “non-Hit” anti-DLL4 antibodies. The identified amino acid residues were located in CDR3, which was identified as the region of the heavy chain that is important for binding affinity.

ii. Alanine Scanning of CDR3

Alanine scanning mutagenesis was performed on amino acid residues in the CDR3 of the heavy chain sequence of parent Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 to identify amino acid residues that do not appear to be involved in DLL4 binding. Alanine-scanning of the CDR3 region of the heavy chain sequence of parent Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 was performed by mutating every residue of the CDR3 region to an alanine, except amino acid residues A106, Y108, and F109. The mutant Fab antibodies were expressed and purified as described in Example 2 above.

Purified Fab alanine mutants were tested for binding to DLL4 using the ECL 96-well plate assay as described in Example 4B. 5 μL of 10 μg/mL recombinant Human DLL4 antigen was coated to a 96-well plate, and tested Fab mutants were added at a concentration of 0.04 μM. As a control, background binding of the Fab to a blank well of the 96-well plate also was determined. The data were depicted as a Signal/Noise ratio of the ECL signal, which is the ratio of the ECL signal for binding to DLL4 divided by the ECL signal for residual binding to the plate. Table 35 sets forth the mutant Fabs tested and the Signal/Noise ratio observed for binding to DLL4. The results show that mutation of E100, Y101, 5105, E107 or Q110 with alanine caused a reduction in the ECL signal and therefore decreased binding affinity to DLL4. These residues, therefore, appeared to be involved in the DLL4 binding and were not further mutagenized. In contrast, mutation of S102, S103, S104 or H111 with alanine resulted in either an increased ECL signal or no difference in ECL signal compared to the parent and thus either improved binding affinity or did not affect binding affinity to DLL4. Accordingly, these residues were identified as residues for further mutagenesis.

The ECL binding experiments above were repeated, except with varying concentrations of mutant Fab and DLL4 protein. Table 36 sets forth the mutant Fab, the ECL signal, and the Signal/Noise ratio for two different concentrations of DLL4 antigen and mutant Fab. The results are consistent for both assays and confirm the initial results above. Substitution of E100, Y101, 5105, E107 or Q110 with alanine caused a reduction in ECL signal for binding to DLL4 while substitution of S102, S103, S104 or H111 with alanine either improved the ECL signal for binding or did not affect the ECL signal for binding to DLL4.

TABLE 35
Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 alanine mutant
binding data
Fab Signal/Noise
Heavy Chain SEQ ID NO Light Chain SEQ ID NO (0.04 μM)
E100A 129 L6_IGKJ1*01 107 0.9
Y101A 130 L6_IGKJ1*01 107 0.8
S102A 124 L6_IGKJ1*01 107 5.6
S103A 131 L6_IGKJ1*01 107 3.5
S104A 122 L6_IGKJ1*01 107 1.3
S105A 132 L6_IGKJ1*01 107 0.8
E107A 133 L6_IGKJ1*01 107 0.7
Q110A 134 L6_IGKJ1*01 107 0.9
H111A 135 L6_IGKJ1*01 107 2.4
parental 88 L6_IGKJ1*01 107 3.1

TABLE 36
Fab VH1-46_IGHD6-6*01_IGHJ1*01 &
L6_IGKJ1*01 alanine mutant binding data
Fab
0.02 μM Fab 0.004 μM Fab
30 μg/mL DLL4 15 μg/mL DLL4
SEQ Light Chain ECL Signal/ ECL Signal/
Heavy Chain ID NO (SEQ ID NO: 107) Signal Noise Signal Noise
VH1-46_IGHD6- 88 L6_IGKJ1*01 8714 23.0 4261 29.2
6*01_IGHJ1*01
E100A 129 L6_IGKJ1*01 1296 3.4 536 3.7
Y101A 130 L6_IGKJ1*01 237 0.6 340 2.3
S102A 124 L6_IGKJ1*01 19056 50.3 10338 70.8
S103A 131 L6_IGKJ1*01 11553 30.5 5150 35.3
S104A 122 L6_IGKJ1*01 163452 431.3 3614 24.8
S105A 132 L6_IGKJ1*01 1103 2.9 181 1.2
E107A 133 L6_IGKJ1*01 338 0.9 146 1.0
Q110A 134 L6_IGKJ1*01 257 0.7 128 0.9
H111A 135 L6_IGKJ1*01 11582 30.6 5023 34.4

iii. NNK Mutagenesis of Heavy Chain Amino Acid Residues S102, S103, S104

Following alanine scanning mutagenesis of CDR3, heavy chain amino acid residues S102, S103 and S104 were selected for further mutation using overlapping PCR with NNK mutagenesis as described in Example 1 using parent Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 as a template.

The binding affinity of each generated Fab mutant for DLL4 was determined using the 96-well plate ECL assay described in Example 4 with varying concentrations of Fab and DLL4 protein. Table 37 sets forth the Signal/Noise ratio for each of the S102, S103 and S104 NNK mutants. Fab NNK mutants were selected at random prior to sequencing and therefore several mutants, such as S103L, were purified and tested multiple times giving consistent results. Three mutations in Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 were identified that resulted in a Fab with an increased signal/noise ratio and therefore improved binding affinity to DLL4. Two Fab mutants, S102A and S103P, each had an signal/noise ratio for DLL4 approximately 3-fold greater than parent Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01. A third mutant, heavy chain Fab mutant S104F, had a signal/noise ratio for binding to DLL4 at least 4-fold greater than that of parent Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01. Two additional mutations were identified that resulted in a slight increase in the signal/noise ratio for binding to DLL4, namely Fab heavy chain mutants S103A and S104H.

TABLE 37
NNK mutagenesis of Fab VH1-46_IGHD6-6*01_IGHJ1*01 and
L6_IGKJ1*01 at amino acid residues S102, S103 and S104
0.02 μM 0.004 μM
Fab Fab Fab
SEQ Light Chain 30 μg/mL 15 μg/mL
ID (SEQ ID DLL4 DLL4
Heavy Chain NO NO: 107) Signal/Noise Signal/Noise
VH1-46_IGHD6- 88 L6_IGKJ1*01 19.5 25.0
6*01_IGHJ1*01
VH1-46_IGHD6- 88 L6_IGKJ1*01 24.8 19.5
6*01_IGHJ1*01
VH1-46_IGHD6- 88 L6_IGKJ1*01 20.3 28.3
6*01_IGHJ1*01
S102Q 136 L6_IGKJ1*01 40.6 31.9
S102V 137 L6_IGKJ1*01 35.9 36.5
S102I 138 L6_IGKJ1*01 35.3 34.5
S102A 124 L6_IGKJ1*01 51.7 69.8
S102G 139 L6_IGKJ1*01 5.1 5.2
S103stop 234 L6_IGKJ1*01 0.8 1.1
S103L 140 L6_IGKJ1*01 25.8 36.6
S103W 141 L6_IGKJ1*01 16.3 25.0
S103L 140 L6_IGKJ1*01 27.0 36.8
S103L 140 L6_IGKJ1*01 39.8 44.9
S103F 142 L6_IGKJ1*01 16.4 20.7
S103L 140 L6_IGKJ1*01 22.5 30.7
S103L 140 L6_IGKJ1*01 18.7 28.1
S103N 143 L6_IGKJ1*01 18.8 23.8
S103H 144 L6_IGKJ1*01 21.7 31.7
S103C 145 L6_IGKJ1*01 27.1 27.4
S103L 140 L6_IGKJ1*01 22.1 36.3
S103L 140 L6_IGKJ1*01 24.0 40.4
S103A 131 L6_IGKJ1*01 30.9 44.5
S103A 131 L6_IGKJ1*01 29.1 32.9
S103L 140 L6_IGKJ1*01 26.6 30.7
S103G 146 L6_IGKJ1*01 9.1 8.3
S103W 141 L6_IGKJ1*01 25.8 38.8
S103F 142 L6_IGKJ1*01 21.9 21.2
S103P 123 L6_IGKJ1*01 59.7 82.4
S103N 143 L6_IGKJ1*01 13.4 22.4
S104G 147 L6_IGKJ1*01 23.4 20.0
S104C 148 L6_IGKJ1*01 9.9 8.4
S104H 149 L6_IGKJ1*01 24.9 79.2
S104L 150 L6_IGKJ1*01 23.5 43.8
S104R 151 L6_IGKJ1*01 23.4 28.6
S104G 147 L6_IGKJ1*01 45.5 67.8
S104F 121 L6_IGKJ1*01 76.5 134.2
S104L 150 L6_IGKJ1*01 24.8 25.6

The Fab heavy chain mutants, S102A, S103A, S103P, S104H and S104F, each containing a mutation in the heavy chain parent Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01, were subsequently re-assayed using the ECL multispot assay as describe in Example 4A to confirm the observed increased binding affinity for DLL4. Each Fab mutant was tested against a panel of antigens at two different Fab concentrations. The results are set forth in Tables 38-39 below. Table 29 sets forth the results for the ECL signal and signal/noise ratio of each mutant for binding to DLL4. Table 38 sets forth the signal/noise ratio for binding to all of the tested antigens. The results show that the heavy chain mutants S102A, S103P, S104H and S104F all have increased signals for binding to DLL4 as compared to parent Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01, and additionally these mutants bind in a dose-dependent and antigen specific manner. Further, the results show that the signal for binding of heavy chain mutant S103A to DLL4 is about the same as binding of parent Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01.

TABLE 38
Binding affinity of Fab VH1-46_IGHD6-6*01_IGHJ1*01 and L6_IGKJ1*01
heavy chain mutants S102A, S103A, S103P, S104H, and S104F for DLL4
SEQ Light Chain Fab Signal/
Heavy Chain ID NO (SEQ ID NO: 107) [μM] Signal Blank Noise
S103A 131 L6_IGKJ1*01 0.1 7108 225 31.6
S103A 131 L6_IGKJ1*01 0.01 1192 265 4.5
S103P 123 L6_IGKJ1*01 0.1 19284 139 138.7
S103P 123 L6_IGKJ1*01 0.01 4095 179 22.9
S104H 149 L6_IGKJ1*01 0.1 20053 227 88.3
S104H 149 L6_IGKJ1*01 0.01 4159 154 27.0
S104F 121 L6_IGKJ1*01 0.1 27072 139 194.8
S104F 121 L6_IGKJ1*01 0.01 4283 280 15.3
Parent 88 L6_IGKJ1*01 0.1 7002 171 40.9
Parent 88 L6_IGKJ1*01 0.01 1030 210 4.9
S102A 124 L6_IGKJ1*01 0.1 15754 220 71.6
S102A 124 L6_IGKJ1*01 0.01 2598 259 10.0

TABLE 39
Binding affinity and specificity of Fab VH1-46_IGHD6-6*01_IGHJ1*01 and
L6_IGKJ1*01 heavy chain mutants S102A, S103A, S103P, S104H, and S104F
Fab
[μM] ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R DLL4
S103A 0.1 1.0 1.2 1.0 1.2 1.4 1.2 1.4 1.4 31.6
S103A 0.01 0.9 1.3 1.2 1.4 1.3 1.1 1.3 1.1 4.5
S103P 0.1 2.2 2.3 1.9 2.6 2.1 2.0 1.4 2.4 138.7
S103P 0.01 2.0 1.8 1.2 1.8 1.5 1.0 1.1 1.8 22.9
S104H 0.1 1.0 0.6 0.8 0.8 1.1 1.0 0.8 1.0 88.3
S104H 0.01 1.0 1.0 1.0 1.4 1.4 1.5 1.0 1.2 27.0
S104F 0.1 1.8 2.0 1.6 2.6 1.9 1.7 1.4 2.1 194.8
S104F 0.01 0.7 0.8 0.6 0.8 0.8 0.6 0.4 0.7 15.3
Parent 0.1 1.2 1.2 1.3 1.7 1.8 1.6 1.6 1.2 40.9
Parent 0.01 1.0 0.9 0.9 0.5 1.1 0.8 1.0 1.0 4.9
S102A 0.1 0.8 0.9 0.5 1.4 1.3 1.3 1.0 1.3 71.6
S102A 0.01 1.0 0.8 0.5 0.6 0.9 0.5 0.2 0.8 10.0

iv. Combination Mutants Based on NNK Mutagenesis Results

Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 heavy chain mutants S102A, S103P and S104F, identified as contributing to increased binding to DLL4, were combined to generate a triple mutant. The triple mutant is designated as Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F & L6_IGKJ1*01 (H:APF & L:wt). The binding affinity and specificity of the Fab APF triple mutant was determined using both the ECL multispot assay and ELISA.

The ECL multispot assay described in Example 4A was used to compare the specificity and binding affinity of the APF triple mutant and the parent antibody for binding to DLL4 and other antigens at various concentrations of antibody. Table 40 sets forth the signal/noise ratio for binding of the parent and APF triple mutant against the tested antigens. The results show that the heavy chain APF triple mutant binds DLL4 with 10-fold greater binding affinity than the parent antibody. Additionally, the APF triple mutant specifically binds DLL4, since no detectable signal was observed for binding to any other tested antigen.

The binding of the APF triple mutant to DLL4 was further analyzed by ELISA as described in Example 6 at Fab concentrations of 125 nm to 1000 nm antibody. The results are set forth in Table 41 below. At the tested concentrations, the parent Fab antibody did not show a detectable signal for binding to DLL4. In contrast, the APF triple mutant had a detectable signal evidencing DLL4 binding in a concentration dependent manner. These results confirm that the ECL assay is more sensitive then the ELISA assay.

TABLE 40
Binding affinity and specificity of triple mutant Fab VH1-46_IGHD6-6*01_IGHJ1*01
S102A/S103P/S104F (APF) & L6_IGKJ1*01 (SEQ ID NOS: 125 and 107) as compared to parent Fab
VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 (SEQ ID NOS: 88 and 107)
Fab
[μM] ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R DLL4
Wt 500.00 0.3 0.7 0.3 0.8 0.4 0.4 0.2 0.8 16.2
50.00 0.6 0.9 0.6 0.6 0.3 0.5 0.7 0.9 33.5
5.00 1.0 1.0 0.9 0.8 1.3 1.1 0.9 1.1 32.5
0.50 1.0 1.4 0.6 2.0 1.0 1.2 1.3 0.9 2.9
S102A, 500.00 1.7 5.5 2.2 4.2 2.4 1.5 3.4 10.4 181.4
S103P, 50.00 0.7 1.0 0.7 1.1 0.7 0.5 0.9 1.6 274.5
S104F 5.00 1.1 1.1 0.8 0.9 1.3 1.1 1.0 1.8 482.1
0.50 1.0 1.1 0.8 1.4 1.0 1.3 0.8 0.9 34.5

TABLE 41
Binding affinity of triple mutant Fab VH1-46_IGHD6-6*01_IGHJ1*01
S102A/S103P/S104F (APF) & L6_IGKJ1*01 (SEQ ID NOS: 125 and
107) as compared to parent Fab VH1-46_IGHD6-6*01_IGHJ1*01
& L6_IGKJ1*01 (SEQ ID NOS: 88 and 107)
S102A, S103P,
Fab [nM] Wildtype Blank S104F Blank
1000 0.071 0.060 0.463 0.080
500 0.070 0.069 0.307 0.074
250 0.069 0.064 0.231 0.071
125 0.070 0.066 0.173 0.075

Example 8

Further Optimization of the Heavy Chain of Anti-DLL4 APF Triple Mutant for Binding to DLL4

In this example, the heavy chain of the APF triple mutant described and generated in Example 7 was further optimized to improve its binding affinity for DLL4. The APF triple mutant Fab was used as a template for further mutagenesis of heavy chain amino acid residues in the remaining CDR regions of the antibody heavy chain Amino acid residue G55 of CDR2 and amino acid residues E100, A106, Y108, F109, and H111 of CDR3 were subjected to mutagenesis using overlapping PCR with NNK mutagenesis, as described above in Example 1.

The Fab APF triple mutant containing further mutations at amino acid residues E100, A106, Y108, F109, and H111 were tested for binding to DLL4 and other antigens using the ECL Multispot Assay at a concentration of 10 nM Fab. The results are set forth in Tables 42-43 below. The Signal/Noise ratio of each mutant Fab tested for binding to DLL4 is set forth in Table 42. Table 43 sets forth the ECL signal and blank (background binding to control well containing no antigen) for the binding of each mutant Fab to various tested antigens. Amino acid mutations designated with X (for any amino acid) did not show appreciable binding and therefore were not sequenced to identify the exact mutation. The results show that mutation of amino acid residues G55, E100, A106, Y108, or F109 with any other amino acid generally caused a reduction in binding affinity to DLL4 as evidenced by a reduction in ECL signal while substitution of H111 either improved binding affinity or did not affect binding affinity to DLL4 as evidenced by an increased ECL signal or no change in ECL signal. In particular, Fab heavy chain mutant VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F & L6_IGKJ1*01 (H:APFF & L:wt) had a 2 to 4-fold better signal/noise ratio for binding to DLL4 than the Fab APF triple mutant. Additionally, none of the mutants showed any appreciable binding to any of the other tested antigens (see Table 43 below.)

TABLE 42
NNK mutagenesis of Fab VH1-46_IGHD6-6*01_IGHJ1*01
S102A/S103P/S104F (APF) & L6_IGKJ1*01 at amino acid residues
G55, E100, A106, Y108, F109 and H111
Fab [10 nM]
Light (SEQ Signal/
Heavy SEQ ID NO ID NO: 107) Noise
S102A/S103P/S104F 125 L6_IGKJ1*01 12.8
S102A/S103P/S104F 125 L6_IGKJ1*01 10.4
S102A/S103P/S104F G55W 152 L6_IGKJ1*01 8.0
S102A/S103P/S104F G55X 235 L6_IGKJ1*01 1.4
S102A/S103P/S104F G55X 235 L6_IGKJ1*01 1.1
S102A/S103P/S104F G55X 235 L6_IGKJ1*01 1.0
S102A/S103P/S104F G55X 235 L6_IGKJ1*01 0.8
S102A/S103P/S104F G55X 235 L6_IGKJ1*01 0.6
S102A/S103P/S104F G55D 153 L6_IGKJ1*01 1.2
S102A/S103P/S104F 125 L6_IGKJ1*01 11.1
S102A/S103P/S104F G55X 235 L6_IGKJ1*01 1.3
S102A/S103P/S104F E100X 236 L6_IGKJ1*01 1.2
S102A/S103P/S104F E100X 236 L6_IGKJ1*01 1.0
S102A/S103P/S104F 125 L6_IGKJ1*01 20.4
S102A/S103P/S104F E100X 236 L6_IGKJ1*01 1.1
S102A/S103P/S104F E100X 236 L6_IGKJ1*01 1.0
S102A/S103P/S104F E100X 236 L6_IGKJ1*01 1.7
S102A/S103P/S104F E100X 236 L6_IGKJ1*01 1.2
S102A/S103P/S104F E100X 236 L6_IGKJ1*01 1.5
S102A/S103P/S104F 125 L6_IGKJ1*01 14.9
S102A/S103P/S104F A106X 237 L6_IGKJ1*01 0.7
S102A/S103P/S104F A106X 237 L6_IGKJ1*01 0.9
S102A/S103P/S104F A106X 237 L6_IGKJ1*01 1.2
S102A/S103P/S104F A106X 237 L6_IGKJ1*01 1.7
S102A/S103P/S104F A106X 237 L6_IGKJ1*01 1.1
S102A/S103P/S104F A106X 237 L6_IGKJ1*01 1.5
S102A/S103P/S104F A106X 237 L6_IGKJ1*01 1.9
S102A/S103P/S104F 125 L6_IGKJ1*01 16.0
S102A/S103P/S104F 125 L6_IGKJ1*01 13.8
S102A/S103P/S104F A106X 237 L6_IGKJ1*01 1.1
S102A/S103P/S104F Y108X 238 L6_IGKJ1*01 0.9
S102A/S103P/S104F Y108X 238 L6_IGKJ1*01 1.6
S102A/S103P/S104F Y108X 238 L6_IGKJ1*01 11.7
S102A/S103P/S104F Y108X 238 L6_IGKJ1*01 1.2
S102A/S103P/S104F 125 L6_IGKJ1*01 17.6
S102A/S103P/S104F Y108X 238 L6_IGKJ1*01 6.2
S102A/S103P/S104F 125 L6_IGKJ1*01 18.0
S102A/S103P/S104F A106E 154 L6_IGKJ1*01 4.3
S102A/S103P/S104F Y108X 238 L6_IGKJ1*01 8.0
S102A/S103P/S104F Y108X 238 L6_IGKJ1*01 0.8
S102A/S103P/S104F F109X 239 L6_IGKJ1*01 1.1
S102A/S103P/S104F F109X 239 L6_IGKJ1*01 1.2
S102A/S103P/S104F 125 L6_IGKJ1*01 9.9
S102A/S103P/S104F F109X 239 L6_IGKJ1*01 4.5
S102A/S103P/S104F F109X 239 L6_IGKJ1*01 0.9
S102A/S103P/S104F 125 L6_IGKJ1*01 12.0
S102A/S103P/S104F F109X 239 L6_IGKJ1*01 1.0
S102A/S103P/S104F F109X 239 L6_IGKJ1*01 1.3
S102A/S103P/S104F F109X 239 L6_IGKJ1*01 26.4
S102A/S103P/S104F 125 L6_IGKJ1*01 1.8
S102A/S103P/S104F H111X 240 L6_IGKJ1*01 1.1
S102A/S103P/S104F H111F 126 L6_IGKJ1*01 42.5
S102A/S103P/S104F 125 L6_IGKJ1*01 14.5
S102A/S103P/S104F 125 L6_IGKJ1*01 13.7
S102A/S103P/S104F H111X 240 L6_IGKJ1*01 2.4
S102A/S103P/S104F 125 L6_IGKJ1*01 12.3
S102A/S103P/S104F H111X 240 L6_IGKJ1*01 12.4
S102A/S103P/S104F H111X 240 L6_IGKJ1*01 6.2
S102A/S103P/S104F 125 L6_IGKJ1*01 24.7
S102A/S103P/S104F H111S 155 L6_IGKJ1*01 24.0

TABLE 43
NNK mutagenesis of Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F
(APF) & L6_IGKJ1*01 at amino acid residues G55, E100, A106, Y108, F109 and H111
Heavy Chain
[10 nM Fab] ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R Blank
APF 330 272 306 257 189 241 297 304 271
APF 157 237 272 334 96 197 208 329 204
APF G55W 334 312 365 327 159 250 391 296 271
APF G55X 284 190 331 333 165 330 234 275 317
APF G55X 189 280 182 208 256 202 190 235 301
APF G55X 145 207 277 436 298 228 301 339 314
APF G55X 323 307 301 334 257 247 357 261 324
APF G55X 113 192 254 182 172 192 128 279 235
APF G55D 302 272 268 302 173 191 243 329 248
APF 340 216 171 130 236 174 256 285 239
APF G55X 305 352 377 383 234 248 440 343 245
APF E100X 273 273 322 265 291 309 271 304 222
APF E100X 358 287 318 358 304 249 226 284 297
APF 91 159 212 181 127 238 59 159 95
APF E100X 314 365 451 418 262 177 430 327 326
APF E100X 357 267 379 171 257 241 205 222 229
APF E100X 172 158 188 142 197 169 206 140 132
APF E100X 229 285 306 144 159 177 249 324 273
APF E100X 279 267 395 293 295 355 436 302 220
APF 314 241 388 304 188 291 396 303 243
APF A106X 200 170 441 336 158 241 267 309 366
APF A106X 288 244 319 153 276 221 235 248 283
APF A106X 306 428 452 268 268 320 336 398 390
APF A106X 349 350 324 270 239 215 367 239 157
APF A106X 24 253 177 319 297 248 368 258 232
APF A106X 393 406 380 434 339 404 506 333 237
APF A106X 174 238 122 63 296 246 159 161 247
APF 202 138 190 189 199 190 152 179 214
APF 378 277 317 370 262 207 422 312 306
APF A106X 273 324 240 331 242 229 251 308 249
APF Y108X 270 300 294 315 169 285 285 384 385
APF Y108X 283 272 236 306 321 258 313 334 167
APF Y108X 322 253 314 314 295 240 189 345 219
APF Y108X 405 355 438 464 376 334 340 399 321
APF 413 324 269 390 385 270 301 421 320
APF Y108X 336 320 276 297 208 343 246 178 211
APF 200 255 258 336 214 230 280 228 198
APF A106E 189 226 212 156 192 312 308 204 219
APF Y108X 239 261 277 292 325 337 333 271 368
APF Y108X 388 355 423 348 248 380 469 276 336
APF F109X 378 397 429 362 440 400 509 479 428
APF F109X 405 444 462 544 324 442 503 441 402
APF 513 460 339 433 298 318 338 252 372
APF F109X 294 442 433 382 350 272 379 440 387
APF F109X 417 334 371 446 235 320 416 463 438
APF 356 371 434 363 417 293 293 389 344
APF F109X 304 241 246 369 392 320 351 340 347
APF F109X 350 399 340 217 338 407 314 376 331
APF F109X 147 158 298 249 334 260 206 241 148
APF 221 296 319 251 221 344 449 222 182
APF H111X 410 414 382 427 362 488 607 430 476
APF H111F 370 409 493 356 360 345 461 343 290
APF 381 206 379 450 363 453 384 326 487
APF 391 428 426 299 400 434 433 480 472
APF H111X 395 315 298 380 322 387 392 443 454
APF 525 467 422 376 345 361 305 494 363
APF H111X 91 292 134 297 164 158 143 291 186
APF H111X 207 188 256 177 192 142 223 181 185
APF 302 394 200 283 340 213 118 343 204
APF H111S 314 286 235 272 244 136 178 277 203

The APF triple mutant and APFF mutant were further compared for binding to DLL4 using the ECL Multispot Assay. The Fab antibodies were assayed at various concentrations to assess the dose dependence for binding to DLL4. The Fab antibodies also were assayed against various antigens to assess the specificity. The APFF mutant was tested in duplicate. Table 44 sets forth the signal/noise ratio for binding to DLL4. The results show that the H:APFF & L:wt mutant exhibits slightly increased affinity (70 nM) for DLL4 as compared to the H:APF & L:wt mutant (122 nM). Additionally, the results in Table 45, which depict the ECL signal observed in the assay, confirm that both Fab mutants specifically bind to DLL4 compared to other antigens tested.

TABLE 44
Binding affinity of Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/
S103P/S104F (APF) & L6_IGKJ1*01 versus Fab VH1-46_IGHD6-
6*01_IGHJ1*01 S102A/S103P/S104F/H111F (APFF) & L6_IGKJ1*01
Heavy Chain
S102A/S103P/ S102A/S103P/ S102A/S103P/
S104F S104F/H111F S104F/H111F
(SEQ ID NO: 125) (SEQ ID NO: 126) (SEQ ID NO: 126)
Light Chain
L6_IGKJ1*01 L6_IGKJ1*01 L6_IGKJ1*01
Fab (SEQ ID NO: 107) (SEQ ID NO: 107) (SEQ ID NO: 107)
[nM] Signal/Noise
500.00 65.9 47.3 54.8
50.00 207.3 239.1 355.7
5.00 260.4 747.6 282.9
0.50 46.9 87.6 36.6

TABLE 45
Binding affinity and specificity of Fab VH1-46_IGHD6-6*01_IGHJ1*01
S102A/S103P/S104F (APF) & L6_IGKJ1*01 versus Fab VH1-46_IGHD6-6*01_IGHJ1*01
S102A/S103P/S104F/H111F (APFF) & L6_IGKJ1*01
Fab
[μM] ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R DLL4 Blank
S102A 500.00 1578 1477 760 785 874 613 1008 1213 28930 439
S103P 50.00 672 585 525 509 557 558 652 768 80005 386
S104F 5.00 401 356 309 338 343 300 547 423 54938 211
0.50 199 152 182 230 207 190 161 235 6666 142
S102A 500.00 908 2409 945 1607 1282 722 1011 4722 26937 570
S103P 50.00 394 452 368 559 449 283 349 736 79372 332
S104F 5.00 225 229 208 260 168 232 290 294 76254 102
H111F 0.50 130 137 104 158 129 94 106 122 8322 95
S102A 500.00 712 2895 723 1333 1143 736 785 4966 27150 495
S103P 50.00 503 552 380 470 550 485 453 879 79326 223
S104F 5.00 286 303 258 304 313 323 280 423 75810 268
H111F 0.50 222 266 215 265 279 184 201 298 7539 206

Example 9

Further Optimization of the Heavy Chain of Anti-DLL4 APFF Mutant for Binding to DLL4

In this Example, the heavy chain amino acid sequence of the APFF mutant that was affinity matured for binding to DLL4 as described in Examples 7 and 8, was used as a template for further mutations of other CDR regions of the antibody polypeptide. Mutant Fabs were expressed and assayed for binding to DLL4.

i. Alanine Scanning of CDR1

Heavy chain APFF mutant was used as a template for alanine scanning mutagenesis of amino acid residues in CDR1 (amino acids 26-35) to determine residues involved in antibody binding to DLL4. Alanine scanning was performed by mutating only residues T28, F29, T30, S31 and Y33 of CDR1 to an alanine. The mutant Fab antibodies were expressed and purified as described in Example 2 above.

Purified Fab alanine mutants were tested at a concentration of 10 nM for binding to DLL4 and other antigens using the ECL multispot binding assay. The results for the ECL assay are set forth in Tables 46 and 47. Table 46 sets forth the mutant Fabs and the Signal/Noise ratio for binding to DLL4. The results show that mutation of amino acid residues F29 and Y33 with alanine caused a reduction in the signal/noise ratio for binding to DLL4. Thus, these residues were not selected for further mutagenesis. Mutation of amino acid residues T28, T30 or S31 with alanine resulted in a slight increase in the signal/noise ratio for binding to DLL4 compared to the parent heavy chain APFF mutant. Table 47, which sets forth the ECL signal for binding to various antigens and to a blank well containing no antigen, shows that all antibodies tested exhibited specificity for DLL4. Table 46 also depicts the results of an ELISA assay performed as described in Example 6 using 100 nM of Fab mutant. The results of the ELISA also show that amino acid residue Y33 is involved in DLL4 binding. The differing results observed in the ECL assay compared to the ELISA are likely due to the fact that the ELISA assay selects for long off-rates whereas the ECL assay detects equilibrium binding. Therefore a mutant with a reduced on-rate but improved off rate can exhibit strong binding by ELISA, but it will not necessarily correlate to a strong ECL signal. In contrast, a mutant with an improved on-rate but reduced off rate can exhibit weak binding by ELISA.

A further experiment was performed to confirm binding of the alanine mutants to DLL4 using an ECL Assay. Table 48 sets forth the ECL signal for DLL4 antigen and blank and signal/ration of each mutant Fab for binding to DLL4. Table 40 sets forth the ECL signals of each mutant Fab for binding to all tested antigens. The results in Tables 48 and 49 confirm the ECL results observed in Tables 46 and 47, respectively.

TABLE 46
Binding of Fab heavy chain VH1-46_IGHD6-6*01_IGHJ1*01
S102A/S103P/S104F/H111F (APFF) & L6_IGKJ1 CDR1 alanine mutants to DLL4
Fab
SEQ Light Chain ECL
Heavy Chain ID (SEQ ID Signal/Noise ELISA
VH1-46_IGHD6-6*01_IGHJ1*01 NO NO: 107) [10 nM Fab] (Signal-Noise)
S102A/S103P/S104F/H111F 126 L6_IGKJ1*01 202.2 0.78
S102A/S103P/S104F/H111F T28A 156 L6_IGKJ1*01 334.0 0.77
S102A/S103P/S104F/H111F F29A 157 L6_IGKJ1*01 189.8 0.67
S102A/S103P/S104F/H111F T30A 158 L6_IGKJ1*01 456.9 0.64
S102A/S103P/S104F/H111F S31A 159 L6_IGKJ1*01 453.3 0.47
S102A/S103P/S104F/H111F Y33A 160 L6_IGKJ1*01 136.3 0.09

TABLE 47
Binding and specificity of Fab heavy chain VH1-46_IGHD6-6*01_IGHJ1*01
S102A/S103P/S104F/H111F (APFF) & L6_IGKJ1 CDR1 alanine mutants
Heavy Chain ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R DLL4 Blank
APFF 354 383 347 369 404 397 347 438 78437 388
APFF T28A 411 389 427 432 471 408 381 480 140295 420
APFF F29A 244 293 404 374 414 315 276 466 80652 425
APFF T30A 272 427 413 270 439 356 275 428 140273 307
APFF S31A 207 394 398 333 379 405 255 454 137810 304
APFF Y33A 394 372 345 244 294 308 383 373 26978 198

TABLE 48
Binding of Fab heavy chain VH1-46_IGHD6-6*01_IGHJ1*01
S102A/S103P/S104F/H111F (APFF) & L6_IGKJ1*01 CDR1
alanine mutants to DLL4
Heavy Chain Light Chain
VH1-46_IGHD6- (SEQ ID Signal/
6*01_IGHJ1*01 NO: 107) Signal Blank Noise
S102A/S103P/S104F/H111F L6_IGKJ1*01 181427 449 404.1
T28A
S102A/S103P/S104F/H111F L6_IGKJ1*01 109225 459 238.0
F29A
S102A/S103P/S104F/H111F L6_IGKJ1*01 177678 353 503.3
T30A
S102A/S103P/S104F/H111F L6_IGKJ1*01 176308 333 529.5
S31A
APFF L6_IGKJ1*01 196536 283 694.5
S102A/S103P/S104F/H111F L6_IGKJ1*01 59547 265 224.7
Y33A

TABLE 49
Binding and specificity of Fab heavy chain VH1-46_IGHD6-6*01_IGHJ1*01
S102A/S103P/S104F/H111F (APFF) & L6_IGKJ1*01 CDR1 alanine mutants
Heavy Chain ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R DLL4 Blank
APFF T28A 316 329 353 478 497 377 477 477 181427 449
APFF F29A 1292 537 512 6089 978 439 508 1055 109225 459
APFF T30A 408 351 353 368 396 343 337 479 177678 353
APFF S31A 253 377 358 427 235 268 262 507 176308 333
APFF 263 279 252 389 425 342 318 536 196536 283
APFF Y33A 298 281 248 334 290 227 178 430 59547 265

ii. Alanine Scanning of CDR2

Heavy chain APFF mutant was used as a template for alanine scanning mutagenesis of amino acid residues in CDR2 (amino acids 50-66) to determine residues involved in antibody binding to DLL4 Amino acid residues Y60 to G66 were not mutated. The mutant Fab antibodies were expressed and purified as described in Example 2 above.

Purified Fab alanine mutants were tested at a concentration of 10 nM for binding to DLL4 using the ECL multispot binding assay. The results for the ECL assay are set forth in Tables 50 and 51. Table 50 sets forth the mutant Fabs and the Signal/Noise ratio for binding to DLL4. The results show that mutation of amino acid residues 150, G55, S57, T58, or S59 with alanine caused a reduction in the signal/noise ratio for binding to DLL4, and thus these residues were not further mutagenized. In contrast, mutation of amino acid residues I51, N52, P53, S54 or G56 with alanine improved the signal/noise ratio for binding to DLL4 2- to 4-fold over the parent heavy chain APFF mutant, and thus these residues were identified as residues for further mutagenesis. Table 51, which sets forth the ECL signals for binding various antigens and to a blank well containing no antigen, shows that all antibodies tested exhibited specificity for DLL4. Table 50 also depicts the results of an ELISA assay performed as described in Example 6 using 100 nM of Fab mutant. The results of the ELISA generally confirmed the results observed by the ECL assay. Mutation of amino acid residues 150, G55, S57, T58 and S59 exhibited decreased binding to DLL4 compared to the parent APFF mutant as observed by ELISA.

TABLE 50
Binding of Fab heavy chain VH1-46_IGHD6-6*01_IGHJ1*01
S102A/S103P/S104F/H111F CDR1 and CDR2 alanine mutants to DLL4
Fab
Light Chain Signal/Noise ELISA
Heavy Chain (SEQ ID [10 nM (Signal-
VH1-46_IGHD6-6*01_IGHJ1*01 SEQ ID NO NO: 107) Fab] Noise)
APFF 126 L6_IGKJ1*01 202.2 0.78
S102A/S103P/S104F/H111F I50A 161 L6_IGKJ1*01 9.8 0.01
S102A/S103P/S104F/H111F I51A 162 L6_IGKJ1*01 637.2 0.49
S102A/S103P/S104F/H111F N52A 163 L6_IGKJ1*01 721.1 0.60
S102A/S103P/S104F/H111F P53A 164 L6_IGKJ1*01 462.3 0.41
S102A/S103P/S104F/H111F G55A 166 L6_IGKJ1*01 44.2 0.02
S102A/S103P/S104F/H111F G56A 167 L6_IGKJ1*01 441.5 1.60
S102A/S103P/S104F/H111F S57A 168 L6_IGKJ1*01 293.1 0.39
S102A/S103P/S104F/H111F T58A 169 L6_IGKJ1*01 142.4 0.14
S102A/S103P/S104F/H111F S59A 170 L6_IGKJ1*01 17.1 0.02
S102A/S103P/S104F/H111F S54A 165 L6_IGKJ1*01 122.1 0.255
APFF 126 L6_IGKJ1*01 71.1 0.123

TABLE 51
Binding and specificity of Fab heavy chain VH1-46_IGHD6-6*01_IGHJ1*01
S102A/S103P/S104F/H111F CDR1 and CDR2 alanine mutants
Heavy Chain ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R DLL4 Blank
APFF 354 383 347 369 404 397 347 438 78437 388
I50A 369 402 301 297 326 247 313 252 2668 271
I51A 344 373 440 312 391 383 144 380 159290 250
N52A 378 340 369 383 362 362 353 468 168745 234
P53A 203 439 337 393 378 374 390 427 151173 327
G55A 474 217 221 381 365 392 426 305 14500 328
G56A 279 355 313 331 330 422 214 466 189405 429
S57A 304 302 388 365 439 417 232 477 112266 383
T58A 320 384 304 289 318 271 294 329 47422 333
S59A 312 358 280 333 346 273 339 382 4502 264

iii. NNK Mutagenesis of CDR2 Residues N52, S54 and G56

The Fab heavy chain APFF mutant was subsequently used as a template for further mutagenesis of amino acid residues N52, S54, G56 using NNK mutagenesis, as described above.

Fab heavy chain mutants containing mutations of amino acid residues N52, S65 and G56 in the parent APFF mutant template I-LAPFF & L:wt were tested for binding to DLL4 using the 96-well plate DLL4 ECL binding assay described in Example 4B and the ELISA assay described in Example 6. Table 52 depicts the ECL and ELISA signal for binding to DLL4 for the various mutants tested. Double mutants, such as I51T/N52V, were inadvertently generated during the PCR reaction. Several Fab mutants that contained a combination of two mutations at a specific amino acid position are designated as such. For example, G56E/D indicates the tested antibody was a mixture of two Fabs, one containing the mutation G56E and the other containing the mutation G56D. Both the ECL and ELISA results show that several Fab heavy chain mutants containing mutations in the Fab APFF mutant, including N52L, N52W, S54T, G56H and G56W, all bind DLL4 with greater affinity than the parent Fab APFF mutant.

TABLE 52
Binding of Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F
(APFF) & L6_IGKJ1*01 NNK heavy chain mutants to DLL4
Fab ECL ELISA
Heavy Chain SEQ Light Chain Signal Signal
VH1-46_IGHD6-6*01_IGHJ1*01 ID (SEQ ID [10 nM [100 nM
Mutant NO NO: 107) Fab] Fab]
S102A/S103P/S104F/H111F I51T/N52V 171 L6_IGKJ1*01 71708 1.23
S102A/S103P/S104F/H111F N52G 172 L6_IGKJ1*01 55584 0.47
S102A/S103P/S104F/H111F N52T 173 L6_IGKJ1*01 66771 0.61
S102A/S103P/S104F/H111F N52P 174 L6_IGKJ1*01 44756 0.18
APFF 126 L6_IGKJ1*01 42782 0.18
S102A/S103P/S104F/H111F N52L 175 L6_IGKJ1*01 75452 1.06
S102A/S103P/S104F/H111F N52W 176 L6_IGKJ1*01 87011 0.42
S102A/S103P/S104F/H111F N52Y 177 L6_IGKJ1*01 24501 0.01
S102A/S103P/S104F/H111F N52R 183 L6_IGKJ1*01 21642 0.01
S102A/S103P/S104F/H111F N52V 178 L6_IGKJ1*01 64665 0.24
S102A/S103P/S104F/H111F N52S 179 L6_IGKJ1*01 62211 0.28
S102A/S103P/S104F/H111F N52Q 180 L6_IGKJ1*01 60646 0.10
S102A/S103P/S104F/H111F N52K 181 L6_IGKJ1*01 67116 0.45
S102A/S103P/S104F/H111F N52A 163 L6_IGKJ1*01 52534 0.12
S102A/S103P/S104F/H111F G56V 182 L6_IGKJ1*01 68585 0.23
S102A/S103P/S104F/H111F G56E/G 241 L6_IGKJ1*01 61039 0.21
S102A/S103P/S104F/H111F G56V/N 242 L6_IGKJ1*01 68876 0.25
S102A/S103P/S104F/H111F G56S 184 L6_IGKJ1*01 65728 0.18
S102A/S103P/S104F/H111F G56K 185 L6_IGKJ1*01 66152 0.19
S102A/S103P/S104F/H111F G56E/D 243 L6_IGKJ1*01 70474 0.24
S102A/S103P/S104F/H111F G56T 186 L6_IGKJ1*01 60689 0.20
S102A/S103P/S104F/H111F G56L 187 L6_IGKJ1*01 64709 0.12
S102A/S103P/S104F/H111F G56A 167 L6_IGKJ1*01 63058 0.24
APFF 126 L6_IGKJ1*01 51792 0.09
S102A/S103P/S104F/H111F G56R 188 L6_IGKJ1*01 64277 0.20
S102A/S103P/S104F/H111F G56H 189 L6_IGKJ1*01 68804 0.65
S102A/S103P/S104F/H111F G56I 190 L6_IGKJ1*01 76973 0.23
S102A/S103P/S104F/H111F G56L 187 L6_IGKJ1*01 63372 0.19
S102A/S103P/S104F/H111F G56W 191 L6_IGKJ1*01 69571 0.54
S102A/S103P/S104F/H111F G56A 167 L6_IGKJ1*01 65124 0.26
S102A/S103P/S104F/H111F S54I 192 L6_IGKJ1*01 18450 0.03
APFF 126 L6_IGKJ1*01 46641 0.07
S102A/S103P/S104F/H111F S54E 193 L6_IGKJ1*01 36826 0.04
S102A/S103P/S104F/H111F S54R 194 L6_IGKJ1*01 26284 0.02
S102A/S103P/S104F/H111F S54G 195 L6_IGKJ1*01 47033 0.06
S102A/S103P/S104F/H111F S54T 196 L6_IGKJ1*01 57232 0.08
S102A/S103P/S104F/H111F S54L 197 L6_IGKJ1*01 28172 0.02
S102A/S103P/S104F/H111F S54V 198 L6_IGKJ1*01 22155 0.00
S102A/S103P/S104F/H111F S54Q 264 L6_IGKJ1*01 41757 0.07
S102A/S103P/S104F/H111F S54A 165 L6_IGKJ1*01 32598 0.02
S102A/S103P/S104F/H111F S54N 199 L6_IGKJ1*01 31710 0.02
S102A/S103P/S104F/H111F S54P 200 L6_IGKJ1*01 10059 0.00
S102A/S103P/S104F/H111F I50T/S54P 201 L6_IGKJ1*01 229 0.00
S102A/S103P/S104F/H111F S54A 165 L6_IGKJ1*01 35277 0.02
S102A/S103P/S104F/H111F S54A/S59N 202 L6_IGKJ1*01 17305 0.100
APFF 126 L6_IGKJ1*01 42886 0.06

iv. Further Mutagenesis of CDR2 Amino Acid Residue I51

A Fab mutant containing N52L, S54T and G56H was generated. Thus, the resulting Fab mutant contains seven mutations in the heavy chain of the antibody: S102A/S103P/S104F/H111F N52L/S54T/G56H, and is designated Fab mutant VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F N52L/S54T/G56H & L6_IGKJ1*01 (H:APFF LTH & L:wt). The H:APFF LTH mutant was used as a template for further NNK mutagenesis of CDR2 amino acid residue I51. The I51 mutants were tested for binding to DLL4 using the 96-well plate ECL binding assay described in Example 4B and ELISA described in Example 6. The results are depicted in Table 53, which sets forth the ECL and ELISA signals. The results show that mutation of amino acid residue I51 to valine (I51V) in the H:APFF LTH parent backbone caused a further increase in binding affinity to DLL4 compared to the H:APFF LTH parent.

TABLE 53
Binding of Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F
(APFF) & L6_IGKJ1*01 I51 NNK heavy chain mutants to DLL4
Fab ECL ELISA
Heavy Chain SEQ Light Chain Signal Signal
VH1-46_IGHD6-6*01_IGHJ1*01 ID (SEQ ID [10 nM [100 nM
Mutant NO NO: 107) Fab] Fab]
S102A/S103P/S104F/H111F/ 203 L6_IGKJ1*01 165312 1.101
N52L/S54T/G56H (APFF LTH)
S102A/S103P/S104F/H111F/ 204 L6_IGKJ1*01 142542 0.620
I51A/N52L/S54T/G56H (APFF ALTH)
S102A/S103P/S104F/H111F/ 205 L6_IGKJ1*01 123199 0.641
I51T/N52L/S54T/G56H (APFF TLTH)
S102A/S103P/S104F/H111F/ 206 L6_IGKJ1*01 154612 0.513
I51Y/N52L/S54T/G56H (APFF YLTH)
S102A/S103P/S104F/H111F/ 207 L6_IGKJ1*01 155073 0.647
I51H/N52L/S54T/G56H (APFF HLTH)
S102A/S103P/S104F/H111F/ 208 L6_IGKJ1*01 166549 0.995
I51E/N52L/S54T/G56H (APFF ELTH)
S102A/S103P/S104F/H111F/ 209 L6_IGKJ1*01 192273 1.105
I51V/N52L/S54T/G56H (APFF VLTH)
S102A/S103P/S104F/H111F/ 210 L6_IGKJ1*01 130722 0.407
I51G/N52L/S54T/G56H (APFF GLTH)
S102A/S103P/S104F/H111F/ 211 L6_IGKJ1*01 134860 0.786
I51S/N52L/S54T/G56H (APFF SLTH)
S102A/S103P/S104F/H111F/ 212 L6_IGKJ1*01 126271 0.088
I51W/N52L/S54T/G56H (APFF WLTH)
S102A/S103P/S104F/H111F/ 213 L6_IGKJ1*01 92415 0.512
I51R/N52L/S54T/G56H (APFF RLTH)
S102A/S103P/S104F/H111F/ 214 L6_IGKJ1*01 125869 1.091
I51N/N52L/S54T/G56H (APFF NLTH)

v. NNK Mutagenesis of CDR2 Amino Acid Residue P53

Fab mutant VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F I51T/N52L/S54T/G56H & L6_IGKJ1*01 (H:APFF TLTH) was used as a template for NNK mutagenesis of CDR2 amino acid residue P53. The P53 mutants were tested for binding to DLL4 using the 96-well plate ECL binding assay described in Example 4B and ELISA assay described in Example 6. Table 54 sets forth the ECL and ELISA signals. The results show that mutation of Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F I51T/N52L/S54T/G56H(H:APFF TLTH) & L6_IGKJ1*01 heavy chain residue P53 to alanine (P53A) causes an increase in binding affinity to DLL4 compared to the H:APFF TLTH mutant.

TABLE 54
Binding of Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F
(APFF) & L6_IGKJ1*01 P53 NNK heavy chain mutants to DLL4
Fab ECL ELISA
SEQ Light Chain Signal Signal
Heavy Chain ID (SEQ ID [10 nM [100 nM
VH1-46_IGHD6-6*01_IGHJ1*01 Mutant NO NO: 107) Fab] Fab]
S102A/S103P/S104F/H111F/ 205 L6_IGKJ1*01 123199 0.641
I51T/N52L/S54T/G56H (APFF TLTH)
S102A/S103P/S104F/H111F/ 215 L6_IGKJ1*01 91483 0.035
I51T/N52L/P53V/S54T/G56H (APFF TLVTH)
S102A/S103P/S104F/H111F/ 216 L6_IGKJ1*01 103398 0.018
I51T/N52L/P53G/S54T/G56H (APFF TLGTH)
S102A/S103P/S104F/H111F/ 217 L6_IGKJ1*01 135290 0.076
I51T/N52L/P53S/S54T/G56H (APFF TLSTH)
S102A/S103P/S104F/H111F/ 218 L6_IGKJ1*01 126454 0.433
I51T/N52L/P53W/S54T/G56H
(APFF TLWTH)
S102A/S103P/S104F/H111F/ 219 L6_IGKJ1*01 63200 0.070
I51T/N52L/P53R/S54T/G56H (APFF TLRTH)
S102A/S103P/S104F/H111F/ 220 L6_IGKJ1*01 113788 0.021
I51T/N52L/P53N/S54T/G56H (APFF TLNTH)
S102A/S103P/S104F/H111F/ 221 L6_IGKJ1*01 163025 0.330
I51T/N52L/P53A/S54T/G56H (APFF
TLATH)
S102A/S103P/S104F/H111F/ 222 L6_IGKJ1*01 124867 0.219
I51T/N52L/P53T/S54T/G56H (APFF TLTTH)
S102A/S103P/S104F/H111F/ 223 L6_IGKJ1*01 99517 0.274
I51T/N52L/P53Y/S54T/G56H (APFF TLYTH)
S102A/S103P/S104F/H111F/ 224 L6_IGKJ1*01 107908 0.287
I51T/N52L/P53H/S54T/G56H (APFF TLHTH)
S102A/S103P/S104F/H111F/ 225 L6_IGKJ1*01 91504 0.017
I51T/N52L/P53E/S54T/G56H (APFF TLETH)
S102A/S103P/S104F/H111F/ 226 L6_IGKJ1*01 105485 0.341
I51T/N52L/P53M/S54T/G56H (APFF
TLMTH)

Heavy chain mutants APFF LTH (SEQ ID NO:203), APFF ELTH (SEQ ID NO: 208), APPF VLTH (SEQ ID NO: 209), APFF NLTH (SEQ ID NO: 214), APFF TLATH (SEQ ID NO: 221) and APFF I51T/N52V (SEQ ID NO: 171) were each paired with parent light chain L6_IGKJ1*01 (SEQ ID NO:107) and further analyzed for binding to DLL4 by ELISA using 2-fold serial dilutions of Fab, starting at a concentration of 20 nM. The results are set forth in Table 55 below. The results show that Fabs containing heavy chain mutants APFF LTH (SEQ ID NO:206), APFF ELTH (SEQ ID NO: 208), APPF VLTH (SEQ ID NO: 209) and APFF NLTH (SEQ ID NO: 214) bind DLL4 with a Kd of approximately between 1 nM and 10 nM. Fabs containing heavy chain mutants APFF TLATH (SEQ ID NO: 221) and APFF I51T/N52V (SEQ ID NO:171) have lower affinity for DLL4 as compared to the other tested Fabs. Heavy chain mutant APFF TLATH has an approximate Kd greater than 100 nM and heavy chain mutant APFF I51T/N52V has a Kd between 10 and 100 nM.

TABLE 55
Heavy chain Fab mutant VH1-46_IGHD6-6*01_IGHJ1*01
S102A/S103P/S104F/H111F (APFF) & L6_IGKJ1*01 (SEQ
ID NO: 107) binding to DLL4 by ELISA
Fab APFF APFF APFF APFF APFF APFF
[nM] LTH ELTH VLTH NLTH TLATH I51T/N52V
20 2.402 2.290 2.052 1.627 1.109 0.648
10 2.345 2.168 1.854 1.362 0.875 0.506
5 2.477 2.333 2.198 1.751 1.272 0.724
2.5 2.151 1.982 1.656 1.165 0.592 0.358
1.3 0.653 0.402 0.252 0.143 0.078 0.055
0.63 1.367 1.010 0.785 0.419 0.227 0.115
0.31 2.402 2.290 2.052 1.627 1.109 0.648
0.16 2.345 2.168 1.854 1.362 0.875 0.506

vi. NNK Mutagenesis of Framework Amino Acid Residue S84

Fab heavy chain APFF mutant was used as a template for further mutagenesis of amino acid residue S84 in the framework region of the heavy chain using overlapping PCR with NNK mutagenesis, as described above. The resulting mutants were tested for binding to DLL4 and other antigens using the ECL Multispot binding assay as described in Example 4A and ELISA as described in Example 6. The results for the ECL and ELISA are set forth in Tables 56. Table 56 sets forth mutant Fabs and the Signal/Noise ratio for binding to DLL4 by the ECL method or the ELISA assay. Table 57 sets forth the ECL signals of each mutant Fab for binding to all tested antigens. In general, the results show that Fab heavy chain VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F S84 mutants showed no increase in binding to DLL4 by either ECL or ELISA. One mutant, Fab heavy chain VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F S84T (SEQ ID NO:233), showed greater binding to DLL4 by the ECL MSD assay but had the same binding by ELISA.

TABLE 56
Binding of Fab heavy chain VH1-46_IGHD6-6*01_IGHJ1*01
S102A/S103P/S104F/H111F S84 NNK mutants to DLL4
Fab ELISA
Heavy Chain SEQ ID Light Chain Signal/Blank (Signal-
VH1-46_IGHD6-6*01_IGHJ1*01 NO (SEQ ID NO: 107) [10 nM Fab] Noise)
S102A/S103P/S104F/H111F S84G 227 L6_IGKJ1*01 346.1 0.53
S102A/S103P/S104F/H111F S84Q 228 L6_IGKJ1*01 413.1 0.39
S102A/S103P/S104F/H111F S84N 229 L6_IGKJ1*01 497.4 0.47
S102A/S103P/S104F/H111F S84H 230 L6_IGKJ1*01 457.0 0.41
S102A/S103P/S104F/H111F S84R 231 L6_IGKJ1*01 432.9 0.26
S102A/S103P/S104F/H111F S84K 232 L6_IGKJ1*01 447.6 0.29
S102A/S103P/S104F/H111F S84T 233 L6_IGKJ1*01 1079.0 0.40
S102A/S103P/S104F/H111F 126 L6_IGKJ1*01 441.3 0.57
S102A/S103P/S104F/H111F 126 L6_IGKJ1*01 309.9 0.24
S102A/S103P/S104F/H111F 126 L6_IGKJ1*01 584.6 0.26
S102A/S103P/S104F/H111F 126 L6_IGKJ1*01 718.7 0.37

TABLE 57
Binding and specificity of Fab heavy chain VH1-46_IGHD6-6*01_IGHJ1*01
S102A/S103P/S104F/H111F S84 NNK mutants
Heavy Chain ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R DLL4 Blank
APFF S84G 299 435 419 473 457 395 434 429 130821 378
APFF S84Q 311 347 255 416 372 373 357 288 122273 296
APFF S84N 307 337 375 309 251 324 167 415 134783 271
APFF S84H 301 306 374 331 382 353 319 318 138028 302
APFF S84R 372 435 392 377 335 395 310 393 139388 322
APFF S84K 354 301 317 400 386 405 517 528 164261 367
APFF S84T 297 293 274 372 352 281 180 328 162923 151
APFF 379 425 332 429 470 468 399 437 149144 338
APFF 292 329 237 377 326 357 277 449 126118 407
APFF 351 209 176 359 332 306 138 414 148493 254
APFF 322 409 263 417 316 173 240 328 132249 184

Example 10

Affinity Maturation of the Light Chain of Identified “Hit” Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 Against DLL4

In this Example, the light chain of parent “Hit” Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 against DLL4 was subjected to affinity maturation similar to the affinity maturation of the heavy chain as described in Examples 7-9 above.

i. Identification of the CDR Potential Binding Site

The amino acid sequence of the light chain (SEQ ID NO:107) for the “Hit” VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 was aligned with the amino acid sequence of related light chains of three “non-Hits” that were identified as not binding to DLL4 (see Table 58 below) These four Fabs are related because they share the same JL germline segment. Further, the VL germline segment is of the same subgroup (i.e. IGKV3). The sequence alignment is set forth in FIG. 2. Based on the alignment, amino acid residues were identified that differed between the “Hit” and “non-Hits,” thus accounting for the differences in binding affinity of the “Hit” and “non-Hits.” The identified amino acid residues were located in CDR3, which was identified as the region of the light chain that is important for binding affinity.

TABLE 58
“Hit” and “non-Hit” Antibodies for Light Chain Sequence Alignment
SEQ SEQ ECL
ID ID signal/
Heavy Chain NO Light Chain NO blank
VH1- 88 L6_IGKJ1*01 107 23.1
46_IGHD6-6*01_IGHJ1*01
VH1- 88 A27_IGKJ1*01 110 1.3
46_IGHD6-6*01_IGHJ1*01
VH1- 88 L25_IGKJ1*01 120 1.4
46_IGHD6-6*01_IGHJ1*01
VH1- 88 L2_IGKJ1*01 112 1.4
46_IGHD6-6*01_IGHJ1*01

NNK Mutagenesis of CDR3

Amino acid residues R91, S92, N93, and W94 of CDR3 of the light chain L6_IGKJ1*01 were mutated by NNK mutagenesis using overlapping PCR to further identify amino acid residues that are in binding to DLL4. CDR3 amino acid residues Q89, Q90, P95, P96, W97 and T98 were conserved among the four aligned light chains (see FIG. 2), and therefore were not subjected to NNK mutagenesis. Heavy chain triple mutant APF (see e.g. Example 7; Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F (H:APF) & L6_IGKJ1*01) was used as a parent template for NNK mutagenesis of amino acid residues R91 and S92. Heavy chain quadruple mutant APFF (see e.g., Example 9; Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F (H:APFF) & L6_IGKJ1*01) was used as a parent template for NNK mutagenesis of amino acid residues S92, N93 and W94. Amino acid mutations designated with X (for any amino acid) did not show appreciable binding and therefore were not sequenced to identify the exact mutation. The resulting mutants were assayed using the ECL multispot assay as described in Example 4A. The results are set forth in Tables 59 and 60 below. Amino acid mutations designated with X (for any amino acid) did not show appreciable binding and therefore were not sequenced to identify the exact mutation. The results show that mutagenesis of amino acid residues R91, S92, N93 and W94 caused a reduction in ECL signal for binding to DLL4 compared either the APF or APFF parent template antibody, and therefore these residues were not further mutagenized.

TABLE 59
NNK mutagenesis of Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F
(APF) (SEQ ID NO: 125) & L6_IGKJ1*01 or Fab VH1-46_IGHD6-6*01_IGHJ1*01
S102A/S103P/S104F/H111F (APFF) (SEQ ID NO: 126) & L6_IGKJ1*01 at light chain
amino acid residues R91, S92, N93 and W94
Fab
Heavy Chain
VH1-46_IGHD6- Light Chain Signal/
6*01_IGHJ1*01 L6_IGKJ1*01 SEQ ID NO Signal Blank Blank
S102A/S103P/S104F R91P 247 1280 271 4.7
S102A/S103P/S104F R91L 248 375 273 1.4
S102A/S103P/S104F parent 107 2585 229 11.3
S102A/S103P/S104F R91G 249 292 209 1.4
S102A/S103P/S104F R91X 361 1673 262 6.4
S102A/S103P/S104F parent 107 2442 287 8.5
S102A/S103P/S104F R91Q 250 817 261 3.1
S102A/S103P/S104F R91X 361 248 296 0.8
S102A/S103P/S104F S92X 362 180 259 0.7
S102A/S103P/S104F S92X 362 255 395 0.6
S102A/S103P/S104F S92X 362 2911 244 11.9
S102A/S103P/S104F parent 107 2832 224 12.6
S102A/S103P/S104F S92N 251 2092 271 7.7
S102A/S103P/S104F S92X 362 701 140 5.0
S102A/S103P/S104F S92X 362 2204 342 6.4
S102A/S103P/S104F S92C 252 401 338 1.2
S102A/S103P/S104F parent 107 3482 271 12.8
S102A/S103P/S104F parent 107 2123 204 10.4
S102A/S103P/S104F/H111F N93Y 253 1385 270 5.1
S102A/S103P/S104F/H111F N93S 254 6436 206 31.2
S102A/S103P/S104F/H111F N93H 255 14711 331 44.4
S102A/S103P/S104F/H111F N93Q 256 704 239 2.9
S102A/S103P/S104F/H111F W94R 257 75771 256 296.0
S102A/S103P/S104F/H111F W94S 258 108653 479 226.8
S102A/S103P/S104F/H111F W94T 259 23228 438 53.0
S102A/S103P/S104F/H111F W94L 260 11613 200 58.1
S102A/S103P/S104F/H111F W94P 261 332 169 2.0
S102A/S103P/S104F/H111F W94M 262 33801 241 140.3
S102A/S103P/S104F/H111F S92P 263 2412 292 8.3
S102A/S103P/S104F/H111F S92P 263 446 166 2.7
S102A/S103P/S104F/H111F S92A/X 363 1755 265 6.6
S102A/S103P/S104F/H111F S92Q 265 348 255 1.4
S102A/S103P/S104F/H111F S92V 266 327 317 1.0
S102A/S103P/S104F/H111F parent 107 164982 282 585.0
S102A/S103P/S104F/H111F parent 107 164992 277 595.6
S102A/S103P/S104F/H111F parent 107 164224 274 599.4
S102A/S103P/S104F/H111F S92T 267 54083 278 194.5
S102A/S103P/S104F/H111F S92C 252 1343 348 3.9
S102A/S103P/S104F/H111F S92C 252 1263 504 2.5
S102A/S103P/S104F/H111F S92C 252 1229 428 2.9
S102A/S103P/S104F/H111F S92R 252 418 252 1.7
S102A/S103P/S104F/H111F S92G 269 89202 254 351.2
S102A/S103P/S104F/H111F S92V 266 405 225 1.8
S102A/S103P/S104F/H111F S92M 271 390 201 1.9
S102A/S103P/S104F/H111F S92N 251 824 224 3.7
S102A/S103P/S104F/H111F S92G 269 80151 294 272.6
S102A/S103P/S104F/H111F S92G 269 80671 208 387.8
S102A/S103P/S104F/H111F parent 107 188914 309 611.4
S102A/S103P/S104F/H111F S92R 268 587 219 2.7
S102A/S103P/S104F/H111F S92P 263 484 220 2.2
S102A/S103P/S104F/H111F S92P 263 4751 296 16.1
S102A/S103P/S104F/H111F S92G 269 91432 325 281.3

TABLE 60
NNK mutagenesis of Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F (APF) (SEQ
ID NO: 125) & L6_IGKJ1*01 or Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F
(APFF) (SEQ ID NO: 126) & L6_IGKJ1*01 at light chain amino acid residues R91, S92, N93 and W94
Heavy Light
Chain Chain ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R DLL4 Blank
APF R91P 333 216 273 228 252 199 296 275 1280 271
APF R91L 526 367 255 383 236 382 437 459 375 273
APF parent 331 363 307 398 223 223 189 252 2585 229
APF R91G 236 271 239 170 163 260 235 306 292 209
APF R91X 268 329 279 297 254 282 180 193 1673 262
APF parent 317 226 344 358 205 162 250 319 2442 287
APF R91Q 234 290 325 229 268 210 314 263 817 261
APF R91X 219 210 341 138 191 269 324 193 248 296
APF S92X 262 163 260 82 228 208 176 208 180 259
APF S92X 258 209 267 354 257 264 323 327 255 395
APF S92X 257 306 334 272 270 216 326 220 2911 244
APF parent 149 279 275 171 197 168 171 0 2832 224
APF S92N 293 346 405 193 316 211 240 304 2092 271
APF S92X 298 228 131 135 99 200 290 227 701 140
APF S92X 248 300 333 243 279 247 266 309 2204 342
APF S92C 295 143 335 125 156 303 265 302 401 338
APF parent 330 272 306 257 189 241 297 304 3482 271
APF parent 157 237 272 334 96 197 208 329 2123 204
APFF N93Y 369 464 380 453 333 318 499 541 1385 270
APFF N93S 351 364 328 345 346 238 321 420 6436 206
APFF N93H 307 347 307 342 345 268 293 425 14711 331
APFF N93Q 240 337 309 310 452 256 304 477 704 239
APFF W94R 283 325 293 375 443 303 364 546 75771 256
APFF W94S 351 419 453 486 469 450 466 506 108653 479
APFF W94T 396 414 377 418 453 387 481 432 23228 438
APFF W94L 274 257 187 369 309 263 296 333 11613 200
APFF W94P 299 267 275 228 241 187 268 292 332 169
APFF W94M 244 302 302 321 327 340 346 435 33801 241
APFF S92P 219 345 242 346 282 236 354 391 2412 292
APFF S92P 268 317 256 328 292 280 307 385 446 166
APFF S92A/X 212 268 252 242 228 193 325 262 1755 265
APFF S92Q 282 332 373 351 312 246 340 330 348 255
APFF S92V 188 319 230 262 248 244 373 371 327 317
APFF parent 259 290 321 380 346 249 302 1062 164982 282
APFF parent 311 307 267 266 351 221 299 467 164992 277
APFF parent 236 266 339 279 367 305 283 473 164224 274
APFF S92T 237 295 290 231 290 308 387 424 54083 278
APFF S92C 425 452 472 439 458 471 786 601 1343 348
APFF S92C 573 638 616 611 646 666 930 845 1263 504
APFF S92C 526 588 589 642 554 642 805 742 1229 428
APFF S92R 272 292 265 386 365 248 387 318 418 252
APFF S92G 274 273 238 296 263 229 213 405 89202 254
APFF S92V 246 305 288 347 331 237 390 368 405 225
APFF S92M 301 367 346 385 304 271 328 340 390 201
APFF S92N 242 293 243 407 336 312 271 314 824 224
APFF S92G 384 347 296 280 306 257 294 428 80151 294
APFF S92G 228 160 314 203 284 297 238 418 80671 208
APFF parent 289 326 185 310 211 336 295 433 188914 309
APFF S92R 266 322 315 437 358 256 410 395 587 219
APFF S92P 240 332 281 399 367 282 321 378 484 220
APFF S92P 299 315 222 397 393 296 288 495 4751 296
APFF S92G 377 420 287 541 413 323 402 543 91432 325

iii. NNK Mutagenesis of CDR1

Amino acid residues S28, S30, S31, and Y32 of CDR1 of the light chain L6_IGKJ1*01 were mutated by NNK mutagenesis using overlapping PCR to further identify amino acid residues that are important for binding to DLL4. The APF triple mutant (see e.g. Example 7; Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F (H:APF) & L6_IGKJ1*01) was used as a template for NNK mutagenesis of S30 and Y32. The APFF heavy chain quadruple mutant (see e.g. Example 9; Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F (H:APFF) & L6_IGKJ1*01) was used as a template for NNK mutagenesis of S28, S30 and S31. The resulting mutants were assayed using the ECL multispot assay as described in Example 4A above. The results are set forth in Tables 61 and 62 below. Double mutants, such as R24G/Q27L, were inadvertently generated during the PCR reaction. Amino acid mutations designated with X (for any amino acid) did not show appreciable binding and therefore were not sequenced to identify the exact mutation. The results show that mutagenesis of amino acid residue Y32 caused a reduction in binding affinity to DLL4 compared to the APF parent template, and therefore this residue was not further mutagenized. Mutagenesis of amino acid residue S28, S30 and S31 either improved binding affinity or did not affect binding affinity to DLL4 compared to the APF or APFF parent templates, and thus these residues were identified as residues for further mutagenesis. Three light chain mutants, namely L6_IGKJ1*01 S28D, S30N, and S31H, slightly increased antibody binding affinity to DLL4.

TABLE 61
NNK mutagenesis of Fab VH1-46_IGHD6-6*01_IGHJ1*01
S102A/S103P/S104F (APF) (SEQ ID NO: 125) & L6_IGKJ1*01 or Fab
VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F (APFF) (SEQ ID NO:
126) & L6_IGKJ1*01 at light chain amino acid residues S28, S30, S31 and Y32
Heavy Chain
VH1-46_IGHD6- Light Chain Signal/
6*01_IGHJ1*01 L6_IGKJ1*01 SEQ ID NO Signal Blank Blank
S102A/S103P/S104F S30W 300 791 186 4.3
S102A/S103P/S104F parent 107 803 125 6.4
S102A/S103P/S104F S30X 364 101 112 0.9
S102A/S103P/S104F S30R 298 745 95 7.8
S102A/S103P/S104F S30X 364 593 204 2.9
S102A/S103P/S104F S30T 297 1016 206 4.9
S102A/S103P/S104F S30X 364 1374 204 6.7
S102A/S103P/S104F S30X 364 1299 210 6.2
S102A/S103P/S104F S30L 296 1627 235 6.9
S102A/S103P/S104F Y32X 365 648 196 3.3
S102A/S103P/S104F Y32X 365 817 193 4.2
S102A/S103P/S104F Y32X 365 1753 261 6.7
S102A/S103P/S104F Y32X 365 1209 155 7.8
S102A/S103P/S104F R24G/Q27L 276 197 87 2.3
S102A/S103P/S104F Y32V 277 427 164 2.6
S102A/S103P/S104F Y32S 278 1031 210 4.9
S102A/S103P/S104F parent 107 4266 256 16.7
S102A/S103P/S104F Y32X 365 293 253 1.2
S102A/S103P/S104F parent 107 3052 242 12.6
S102A/S103P/S104F/H111F S28G 279 182961 343 533.4
S102A/S103P/S104F/H111F S28K 280 124246 395 314.5
S102A/S103P/S104F/H111F S28V 281 83083 237 350.6
S102A/S103P/S104F/H111F S28F 282 133659 249 536.8
S102A/S103P/S104F/H111F parent 107 182026 400 455.1
S102A/S103P/S104F/H111F S28P 244 178227 393 453.5
S102A/S103P/S104F/H111F S28T 283 159288 305 522.3
S102A/S103P/S104F/H111F S28L 284 72299 329 219.8
S102A/S103P/S104F/H111F S28Q 285 133486 353 378.1
S102A/S103P/S104F/H111F S28A 286 156761 332 472.2
S102A/S103P/S104F/H111F S28N 287 203926 262 778.3
S102A/S103P/S104F/H111F S28H 288 209433 344 608.8
S102A/S103P/S104F/H111F S28I 289 106041 343 309.2
S102A/S103P/S104F/H111F S28R 290 110363 449 245.8
S102A/S103P/S104F/H111F S28W 291 165026 303 544.6
S102A/S103P/S104F/H111F S28M 292 108166 322 335.9
S102A/S103P/S104F/H111F S28E 293 184227 420 438.6
S102A/S103P/S104F/H111F S30C 294 128661 915 140.6
S102A/S103P/S104F/H111F S30D 295 225396 397 567.7
S102A/S103P/S104F/H111F S30L 296 198641 379 524.1
S102A/S103P/S104F/H111F S30T 297 122207 407 300.3
S102A/S103P/S104F/H111F S30R 298 145575 416 349.9
S102A/S103P/S104F/H111F S30P 299 1143 262 4.4
S102A/S103P/S104F/H111F parent 107 207955 306 679.6
S102A/S103P/S104F/H111F S30W 300 190872 289 660.5
S102A/S103P/S104F/H111F S30Y/S 366 143412 294 487.8
S102A/S103P/S104F/H111F S30Q 302 202637 198 1023.4
S102A/S103P/S104F/H111F S30A 303 183649 356 515.9
S102A/S103P/S104F/H111F S30G 304 180489 272 663.6
S102A/S103P/S104F/H111F S30N 245 174926 352 496.9
S102A/S103P/S104F/H111F S30P 299 1262 302 4.2
S102A/S103P/S104F/H111F S30G 304 177646 351 506.1
S102A/S103P/S104F/H111F S30A 303 186732 184 1014.8
S102A/S103P/S104F/H111F S30T 297 136426 392 348.0
S102A/S103P/S104F/H111F S30V 305 141111 284 496.9
S102A/S103P/S104F/H111F S30R 298 189471 278 681.6
S102A/S103P/S104F/H111F S30Q 302 196711 327 601.6
S102A/S103P/S104F/H111F S31T 306 191253 332 576.1
S102A/S103P/S104F/H111F S31N 307 177897 294 605.1
S102A/S103P/S104F/H111F S31K 246 179257 511 350.8
S102A/S103P/S104F/H111F parent 107 171775 442 388.6
S102A/S103P/S104F/H111F S31L 308 155112 416 372.9
S102A/S103P/S104F/H111F S31M 309 167080 442 378.0
S102A/S103P/S104F/H111F S31F 310 188723 411 459.2
S102A/S103P/S104F/H111F S31I 311 173649 321 541.0
S102A/S103P/S104F/H111F S31V 312 176358 345 511.2
S102A/S103P/S104F/H111F S31H 313 221327 264 838.4
S102A/S103P/S104F/H111F S31A 314 192365 218 882.4
S102A/S103P/S104F/H111F S31P 315 53282 341 156.3
S102A/S103P/S104F/H111F S31D 316 154331 493 313.0
S102A/S103P/S104F/H111F S31R 317 166188 298 557.7
S102A/S103P/S104F/H111F S31Y 318 187896 284 661.6
S102A/S103P/S104F/H111F S31Q 319 165030 407 405.5
S102A/S103P/S104F/H111F S31E 320 171114 331 517.0
S102A/S103P/S104F/H111F S31G 321 65521 231 283.6

TABLE 62
NNK mutagenesis of Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F (APF) (SEQ
ID NO: 125) & L6_IGKJ1*01 or Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F
(APFF) (SEQ ID NO: 126) & L6_IGKJ1*01 at light chain amino acid residues S28, S30, S31 and Y32
Heavy Light
Chain Chain ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R DLL4 Blank
APF S30W 73 132 62 105 186 157 39 30 791 186
APF parent 61 161 86 135 66 217 117 105 803 125
APF S30X 119 67 75 45 6 56 83 93 101 112
APF S30R 35 140 108 155 89 86 39 87 745 95
APF S30X 319 99 122 231 239 144 224 227 593 204
APF S30T 243 274 297 127 229 204 195 207 1016 206
APF S30X 213 188 337 247 223 176 233 267 1374 204
APF S30X 210 218 311 79 156 207 262 211 1299 210
APF S30L 244 288 250 296 240 193 260 259 1627 235
APF Y32X 240 223 259 241 203 170 199 248 648 196
APF Y32X 155 93 176 148 147 142 38 190 817 193
APF Y32X 125 240 299 168 236 247 260 214 1753 261
APF Y32X 124 256 167 255 147 139 148 170 1209 155
APF R24G/Q27L 225 252 185 177 119 49 236 191 197 87
APF Y32V 156 57 283 56 120 151 186 144 427 164
APF Y32S 154 208 222 137 162 175 51 230 1031 210
APF parent 223 268 205 344 200 332 285 366 4266 256
APF Y32X 275 266 358 306 206 304 382 374 293 253
APF parent 383 296 265 107 273 132 366 254 3052 242
APFF S28G 334 360 333 324 436 360 491 494 182961 343
APFF S28K 270 386 355 395 464 348 443 477 124246 395
APFF S28V 231 327 338 289 380 284 344 446 83083 237
APFF S28F 242 283 223 367 402 275 336 413 133659 249
APFF parent 333 406 432 350 451 386 368 539 182026 400
APFF S28P 427 370 318 416 365 392 605 492 178227 393
APFF S28T 271 321 371 249 368 355 676 380 159288 305
APFF S28L 222 378 317 392 365 346 418 404 72299 329
APFF S28Q 345 517 380 331 420 404 809 437 133486 353
APFF S28A 348 351 377 440 502 378 521 424 156761 332
APFF S28N 363 325 406 243 399 331 447 440 203926 262
APFF S28H 381 435 346 482 513 355 447 517 209433 344
APFF S28I 265 386 369 442 412 353 416 450 106041 343
APFF S28R 318 403 378 425 378 437 395 542 110363 449
APFF S28W 316 283 414 349 404 489 385 489 165026 303
APFF S28M 271 320 305 382 313 341 410 360 108166 322
APFF S28E 389 396 401 433 461 361 393 513 184227 420
APFF S30C 1007 1187 1229 1472 1081 1027 1686 1792 128661 915
APFF S30D 284 325 312 415 434 357 543 496 225396 397
APFF S30L 270 406 315 389 295 332 351 540 198641 379
APFF S30T 332 360 375 413 423 410 370 497 122207 407
APFF S30R 434 456 458 576 455 404 465 571 145575 416
APFF S30P 391 394 328 544 334 356 348 520 1143 262
APFF parent 412 386 349 565 411 409 466 540 207955 306
APFF S30W 289 398 399 372 500 471 342 542 190872 289
APFF S30Y/S 319 299 345 306 346 283 429 520 143412 294
APFF S30Q 262 353 339 243 400 342 298 423 202637 198
APFF S30A 251 322 414 380 390 400 454 561 183649 356
APFF S30G 404 387 355 382 427 393 369 485 180489 272
APFF S30N 241 400 297 296 437 362 396 525 174926 352
APFF S30P 358 385 383 346 411 312 413 418 1262 302
APFF S30G 260 298 263 346 343 304 397 480 177646 351
APFF S30A 295 337 311 364 451 342 317 475 186732 184
APFF S30T 269 383 320 375 521 401 418 470 136426 392
APFF S30V 279 412 394 294 375 365 333 536 141111 284
APFF S30R 404 395 452 313 472 422 442 525 189471 278
APFF S30Q 340 381 344 326 411 354 393 376 196711 327
APFF S31T 285 351 432 261 384 303 332 423 191253 332
APFF S31N 197 246 300 267 384 379 342 363 177897 294
APFF S31K 262 355 221 334 370 505 471 522 179257 511
APFF parent 312 370 347 367 457 433 450 438 171775 442
APFF S31L 288 375 319 365 371 405 346 427 155112 416
APFF S31M 352 380 293 474 488 445 510 573 167080 442
APFF S31F 295 342 280 349 256 267 369 599 188723 411
APFF S31I 222 363 303 421 506 365 444 500 173649 321
APFF S31V 300 363 288 374 384 335 360 509 176358 345
APFF S31H 307 373 352 421 426 350 480 504 221327 264
APFF S31A 383 415 309 424 406 334 361 461 192365 218
APFF S31P 372 488 431 461 466 404 493 594 53282 341
APFF S31D 479 438 429 510 471 407 451 596 154331 493
APFF S31R 313 331 261 358 423 374 270 465 166188 298
APFF S31Y 236 320 197 351 445 293 361 604 187896 284
APFF S31Q 392 390 329 383 438 415 379 548 165030 407
APFF S31E 313 297 324 460 390 367 273 441 171114 331
APFF S31G 311 391 378 426 381 301 384 414 65521 231

Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F (H:APFF) & L6_IGKJ1*01 light chain mutants S28D, S281I, S30N and S31H were subsequently re-assayed for binding to DLL4 by ELISA. The results are set forth in Table 63 below. The results show that Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F (H:APFF) & L6_IGKJ1*01 light chain mutants S28N, and S31H slightly increase binding affinity to DLL4 compared to the H:APFF parental template antibody. By ELISA at the concentrations tested, the Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F (H:APFF) & L6_IGKJ1*01 light chain mutant S28H and S30D did not increase binding affinity to DLL4 compared to the APFF parental template antibody.

TABLE 63
Binding affinity of VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F
(H: APFF) & L6_IGKJ1*01 Fab mutants to DLL4
Heavy Chain
S102A/S103P/S104F/H111F (SEQ ID NO: 126)
Light Chain
L6_IGKJ1*01 S28N S28H S30D L6_IGKJ1*01 S31H
(SEQ ID (SEQ ID (SEQ ID (SEQ ID (SEQ ID (SEQ ID
NO: 107) NO: 287) NO: 288) NO: 295) NO: 107) NO: 313)
400 nM 0.13 0.19 0.13 0.13 0.13 0.20
200 nM 0.10 0.17 0.14 0.11 0.08 0.11
100 nM 0.07 0.13 0.09 0.09 0.07 0.09
 50 nM 0.06 0.07 0.05 0.06 0.04 0.05
 25 nM 0.02 0.04 0.03 0.03 0.02 0.03
 25 nM 0.03 0.05 0.03 0.03 0.02 0.03
0 0.00 0.00 0.01 0.00 0.00 0.00
0 0.00 0.00 0.00 0.01 0.01 0.00

iv. Combination Mutants Based on NNK Mutagenesis of CDR1

Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F (H:APFF) & L6_IGKJ1*01 light chain mutants S28D, S30N and S31H were combined into one triple mutant, designated as Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F (H:APFF) & L6_IGKJ1*01 S28D/S30N/S31H (L:NDH) (H:APFF & L:NDH). The binding affinity of the H:APFF & L:NDH mutant to DLL4 was assayed using both ELISA and the 96-well plate ECL assay. Additionally, the light chain triple mutant L6_IGKJ1*01 S28D/S30N/S31H (L:NDH) was assayed in combination with heavy chain mutants VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F/G56A (H:APFF G56A) and VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F/S54A (H:APFF S54A).

The results are set forth in Tables 64 and 65 below. The results show the antibody mutant APFF-NDH binds DLL4 with 4-fold increased affinity as compared to parent antibody APFF mutant. The antibody Fab H:APFF G56A & L:NDH resulted in 8-fold greater affinity for binding to DLL4 as compared to the H:APFF & L:wt parental antibody mutant, and also exhibited increased binding affinity compared to the other antibodies tested. The antibody Fab H:APFF S54A & L:NDH resulted in a slight decrease in binding affinity compared to the H:APFF & L:NDH antibody mutant. Table 65 provides a comparison of binding affinity of antibodies containing the triple light chain mutant and various mutated heavy chain mutants. The results in Tables 64 and 65 show that the H:APFF G56A & L:NDH, containing 5 mutations in the heavy chain and three mutations in the light chain, exhibited the highest binding affinity of the antibodies tested.

TABLE 64
Binding affinity of VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 Fab mutants
Heavy Chain
APFF G56A APFF G56A APFF S54A
APFF (SEQ ID APFF (SEQ ID (SEQ ID (SEQ ID (SEQ ID
NO: 126) NO: 126) NO: 167) NO: 167) NO: 165)
Light Chain
Parent S28N/S30D/ Parent S28N/S30D/ S28N/S30D/
(SEQ ID S31H (SEQ ID (SEQ ID S31H (SEQ ID S31H (SEQ ID
NO: 107) NO: 323) NO: 107) NO: 323) NO: 323)
100 nM  0.072 0.259 0.338 0.453 0.213
75 nM 0.072 0.268 0.399 0.543 0.212
50 nM 0.060 0.202 0.301 0.366 0.154
0 0.006 0.002 0.002 0.002 0.000

TABLE 65
Binding affinity of VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 Fab mutants
Fab ELISA
SEQ SEQ ECL Signal
Heavy Chain ID Light Chain ID Signal [100 nM
VH1-46_IGHD6-6*01_IGHJ1*01 NO L6_IGKJ1*01 NO [10 nM Fab] Fab]
S102A/S103P/S104F/H111F 126 S28N/S30D/S31H 323 48997 0.08
S102A/S103P/S104F/H111F/G56A 167 S28N/S30D/S31H 323 71603 0.20
S102A/S103P/S104F/H111F/S54A 165 S28N/S30D/S31H 323 46700 0.08

v. Alanine Scanning of CDR2

Amino acid residues D50, A51, S52, N53, R54, A55 and T56 of CDR2 of the light chain L6_IGKJ1*01 were mutated by alanine scanning mutagenesis to further identify amino acid residues that are important for binding to DLL4. Amino acid residues A51 and A55 were mutated to threonine. The APFF heavy chain quadruple mutant (see e.g. Example 9; Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F (H:APFF) & L6_IGKJ1*01) was used as a template.

The results are set forth in Table 66 below. The results show that mutation of amino acid residues D50, R54 and T56 with alanine and substitution of amino acid residue A51 with threonine caused a reduction in ECL signal for binding to DLL4 and therefore these residues were not further mutagenized. Mutation of amino acid residues S52 and N53 with alanine and mutation of amino acid residue A55 with threonine either improved the ECL signal or did not affect the ECL signal for binding to DLL4 and therefore these residues were identified as amino acid residues for further mutagenesis.

TABLE 66
Binding affinity of Fab VH1-46_IGHD6-6*01_IGHJ1*01
S102A/S103P/S104F/H111F (APFF) & L6_IGKJ1*01 CDR2 alanine mutants
Heavy Chain VH1-46_IGHD6- SEQ ID Light Chain SEQ ID
6*01_IGHJ1*01 NO L6_IGKJ1*01 NO Signal [10 nM Fab]
S102A/S103P/S104F/H111F 126 wildtype 107 13516
S102A/S103P/S104F/H111F 126 D50A 324 4231
S102A/S103P/S104F/H111F 126 A51T 325 2849
S102A/S103P/S104F/H111F 126 S52A 326 19311
S102A/S103P/S104F/H111F 126 N53A 327 14166
S102A/S103P/S104F/H111F 126 R54A 328 11626
S102A/S103P/S104F/H111F 126 A55T 329 13228
S102A/S103P/S104F/H111F 126 T56A 330 7260

vi. NNK Mutagenesis of CDR2 Residues S52, N53, and A55

Fab mutant H:APFF & L:NDH (see Example 10 above; VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F (H:APFF) & L6_IGKJ1*01 S28D/S30N/S31H (L:NDH)) was used as a template for NNK mutagenesis of CDR2 amino acid residues S52, N53 and A55. The Fab mutants were tested for binding to DLL4 using the 96-well plate ECL binding assay and ELISA. Table 67 sets forth the ECL and ELISA signals. Amino acid mutations designated with X (for any amino acid) did not show appreciable binding and therefore were not sequenced to identify the exact mutation. The results show that various mutants of H:APFF & L:NDH exhibited greater ECL and ELISA signals for binding to DLL4 as compared to the parental H:APFF & L:NDH, including those having further mutations S52T, S52L, N53H, A55S and A55G in the light chain.

Light chain mutants H:APFF & L:NDH S52T, H:APFF & L:NDH S52L, H:APFF & L:NDH S52T/S, H:APFF & L:NDH S52X, H:APFF & L:NDH N53H, H:APFF & L:NDH A55S and H:APFF & L:NDH A55G were further analyzed for binding to DLL4 by ELISA using 2-fold serial dilutions of Fab, starting at a concentration of 100 nM. The results are set forth in Table 68 below. Antibody mutants H:APFF & L:NDH S52L, H:APFF & L:NDH A55S and H:APFF & L:NDH A55G had a slightly increased affinity for binding to DLL4 as compared to the parental H:APFF & L:NDH mutant. All of the Fab light chain mutants bind DLL4 within the same range of affinity as the parental H:APFF & L:NDH mutant.

TABLE 67
Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F (H:APFF) &
L6_IGKJ1*01 S28N/S30D/S31H (L:NDH) light chain CDR2 NNK mutant binding data
Fab
Heavy Chain ELISA
VH1-46_IGHD6- SEQ (Avgerage
6*01_IGHJ1*01 (SEQ ID ID ECL signal-
NO: 126) Light Chain NO Signal noise)
S102A/S103P/S104F/H111F S28N/S30D/S31H S52L 331 17810 0.285
S102A/S103P/S104F/H111F S28N/S30D/S31H S52G/V 367 17589 0.233
S102A/S103P/S104F/H111F S28N/S30D/S31H S52T/S 368 17769 0.261
S102A/S103P/S104F/H111F S28N/S30D/S31H S52R 333 20009 0.244
S102A/S103P/S104F/H111F S28N/S30D/S31H S52S/Y 369 15572 0.218
S102A/S103P/S104F/H111F S28N/S30D/S31H S52X 370 2757 0.077
S102A/S103P/S104F/H111F S28N/S30D/S31H S52X 370 15250 0.232
S102A/S103P/S104F/H111F S28N/S30D/S31H S52X 370 16779 0.299
S102A/S103P/S104F/H111F S28N/S30D/S31H S52X 370 16012 0.303
S102A/S103P/S104F/H111F S28N/S30D/S31H S52X 370 15424 0.272
S102A/S103P/S104F/H111F S28N/S30D/S31H S52X 370 16839 0.366
S102A/S103P/S104F/H111F S28N/S30D/S31H S52X 370 15263 0.273
S102A/S103P/S104F/H111F S28N/S30D/S31H S52W 334 16341 0.177
S102A/S103P/S104F/H111F S28N/S30D/S31H S52R 333 20497 0.179
S102A/S103P/S104F/H111F NDH 323 18697 0.165
S102A/S103P/S104F/H111F S28N/S30D/S31H S52N/X 371 20512 0.221
S102A/S103P/S104F/H111F S28N/S30D/S31H S52R 333 20573 0.243
S102A/S103P/S104F/H111F S28N/S30D/S31H S52P/X 372 19361 0.233
S102A/S103P/S104F/H111F S28N/S30D/S31H S52T 332 20097 0.263
S102A/S103P/S104F/H111F S28N/S30D/S31H S52M 337 19458 0.185
S102A/S103P/S104F/H111F S28N/S30D/S31H N53X 373 12235 0.106
S102A/S103P/S104F/H111F S28N/S30D/S31H N53E 338 17553 0.204
S102A/S103P/S104F/H111F S28N/S30D/S31H N53X 373 200 0.000
S102A/S103P/S104F/H111F S28N/S30D/S31H N53X 373 9412 0.110
S102A/S103P/S104F/H111F S28N/S30D/S31H N53G 339 20572 0.163
S102A/S103P/S104F/H111F S28N/S30D/S31H N53X 373 15916 0.132
S102A/S103P/S104F/H111F S28N/S30D/S31H N53X 373 3627 −0.001
S102A/S103P/S104F/H111F S28N/S30D/S31H N53M 340 17793 0.162
S102A/S103P/S104F/H111F S28N/S30D/S31H N53X 373 13341 0.161
S102A/S103P/S104F/H111F S28N/S30D/S31H N53C/F 374 18046 0.266
S102A/S103P/S104F/H111F S28N/S30D/S31H N53H 342 20061 0.230
S102A/S103P/S104F/H111F S28N/S30D/S31H N53X 373 14078 0.139
S102A/S103P/S104F/H111F S28N/S30D/S31H N53X 373 456 0.060
S102A/S103P/S104F/H111F S28N/S30D/S31H 375 16809 0.166
N53M/L
S102A/S103P/S104F/H111F S28N/S30D/S31H N53P 343 18132 0.120
S102A/S103P/S104F/H111F S28N/S30D/S31H N53X 373 203 0.015
S102A/S103P/S104F/H111F S28N/S30D/S31H N53A 344 14213 0.151
S102A/S103P/S104F/H111F S28N/S30D/S31H N53X 373 14322 0.127
S102A/S103P/S104F/H111F S28N/S30D/S31H N53X 373 260 −0.001
S102A/S103P/S104F/H111F S28N/S30D/S31H A55R 345 9031 0.106
S102A/S103P/S104F/H111F S28N/S30D/S31H A55C 346 8226 0.146
S102A/S103P/S104F/H111F S28N/S30D/S31H A55X 376 14187 0.202
S102A/S103P/S104F/H111F S28N/S30D/S31H A55S 347 20047 0.383
S102A/S103P/S104F/H111F S28N/S30D/S31H A55X 376 899 0.019
S102A/S103P/S104F/H111F S28N/S30D/S31H A55G 348 21381 0.323
S102A/S103P/S104F/H111F S28N/S30D/S31H A55X 376 8799 0.092
S102A/S103P/S104F/H111F S28N/S30D/S31H A55X 376 5320 0.068
S102A/S103P/S104F/H111F NDH 323 17201 0.214
S102A/S103P/S104F/H111F S28N/S30D/S31H A55X 376 13643 0.116
S102A/S103P/S104F/H111F S28N/S30D/S31H A55X 376 275 0.016
S102A/S103P/S104F/H111F S28N/S30D/S31H A55X 376 1370 0.010
S102A/S103P/S104F/H111F S28N/S30D/S31H A55X 376 13611 0.151
S102A/S103P/S104F/H111F S28N/S30D/S31H A55X 376 167 0.007
S102A/S103P/S104F/H111F S28N/S30D/S31H A55G 348 18042 0.301
S102A/S103P/S104F/H111F S28N/S30D/S31H A55X 376 296 0.023
S102A/S103P/S104F/H111F S28N/S30D/S31H A55G 348 19264 0.298
S102A/S103P/S104F/H111F S28N/S30D/S31H A55X 376 5246 0.068

TABLE 68
Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F (APFF) (SEQ ID NO: 126) &
L6_IGKJ1*01 S28N/S30D/S31H (NDH) light chain S52, N53 and A55 mutant binding to DLL4 by ELISA
H
APFF APFF APFF APFF APFF APFF APFF APFF
Fab L
[nM] NDH/S52L NDH/S52T/S NDH/S52X NDH/S52T NDH/N53H NDH/A55S NDH/A55G NDH
100 0.791 0.696 0.686 0.653 0.608 0.858 0.814 0.686
50 0.546 0.500 0.508 0.490 0.416 0.588 0.510 0.507
25 0.335 0.297 0.309 0.323 0.238 0.407 0.316 0.310
12.5 0.215 0.186 0.192 0.215 0.167 0.258 0.198 0.192
6.25 0.142 0.115 0.125 0.130 0.109 0.154 0.125 0.125
3.125 0.095 0.088 0.096 0.099 0.089 0.108 0.093 0.096

vii. NNK Mutagenesis of Framework 3 Residues S76 and F62

Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F (H:APFF) and L6_IGKJ1*01 was used as template for further mutagenesis of amino acid residues S76 and F62 in the framework 3 region of the light chain. These residues were mutated using overlapping PCR with NNK mutagenesis, as described above. Binding to DLL4 was assayed using an ECL Multispot assay as described in Example 4A or in an ELISA assay as described in Example 6. The results are set forth in Tables 69-71, below. The results show that mutation of amino acid residues S76 and F62 caused a decrease in the ECL and ELISA signals for binding to DLL4.

TABLE 69
Binding affinity of Fab VH1-46_IGHD6-6*01_IGHJ1*01
S102A/S103P/S104F/H111F (APFF) & L6_IGKJ1*01 S76 and F62 Mutants
Heavy Chain VH1-46_IGHD6- SEQ ID Light Chain SEQ ID
6*01_IGHJ1*01 NO L6_IGKJ1*01 NO Signal [10 nM Fab]
S102A/S103P/S104F/H111F 126 S76L 351 13688
S102A/S103P/S104F/H111F 126 S76T 352 15747
S102A/S103P/S104F/H111F 126 S76G 353 13404
S102A/S103P/S104F/H111F 126 wildtype 107 13516
S102A/S103P/S104F/H111F 126 S76A/K 377 16525
S102A/S103P/S104F/H111F 126 S76Y 355 14825
S102A/S103P/S104F/H111F 126 F62L 356 261

TABLE 70
Binding affinity of Fab VH1-46_IGHD6-6*01_IGHJ1*01
S102A/S103P/S104F/H111F (H:APFF) & L6_IGKJ1*01 S76 and F62 Mutants
Heavy Chain Light Chain ELISA
VH1-46_IGHD6- SEQ ID L6_IGKJ1* SEQ ID ECL (Signal-
6*01_IGHJ1*01 NO 01 NO Signal/Noise Noise)
S102A/S103P/S104F/H111F 126 S76E 357 217.5 0.36
S102A/S103P/S104F/H111F 126 S76Q 358 187.3 0.32
S102A/S103P/S104F/H111F 126 S76P 359 100.0 0.29
S102A/S103P/S104F/H111F 126 S76N 360 118.2 0.28
S102A/S103P/S104F/H111F 126 wildtype 107 441.3 0.57
S102A/S103P/S104F/H111F 126 wildtype 107 309.9 0.24
S102A/S103P/S104F/H111F 126 wildtype 107 584.6 0.26
S102A/S103P/S104F/H111F 126 wildtype 107 718.7 0.37

TABLE 71
Binding affinity and specificity of Fab VH1-46_IGHD6-6*01_IGHJ1*01
S102A/S103P/S104F/H111F (H: APFF) (SEQ ID NO: 126) & L6_IGKJ1*01 S76 and F62 Mutants
Light ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R DLL4 Blank
S76E 277 266 228 313 439 336 338 440 51555 237
S76Q 264 324 386 255 287 188 364 430 48330 258
S76P 260 331 394 402 313 347 271 371 29787 298
S76N 436 385 429 298 369 378 329 384 51989 440
wildtype 379 425 332 429 470 468 399 437 149144 338
wildtype 292 329 237 377 326 357 277 449 126118 407
wildtype 351 209 176 359 332 306 138 414 148493 254
wildtype 322 409 263 417 316 173 240 328 132249 184

Example 11

Heavy Chain and Light Chain Fab Combination Mutants

Heavy chain and light chain mutants that were identified in Examples 7-10 as contributing to binding to DLL4 were paired into various combination mutants. Heavy chain mutants included VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F N52L/S54T/G56H(H:APFF LTH), VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F I51A/N52L/S54T/G56H(H:APFF ALTH), and VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F I51V/N52L/S54T/G56H(H:APFF VLTH). Light chain mutants included L6_IGKJ1*01 S28D/S30N/S31H S52L/A55S (L:NDH LS) and L6_IGKJ1*01 S28D/S30N/S31H S52L/A55G (L:NDH LG).

Table 72 below sets forth the Fabs and the ECL signal for binding to DLL4. In general, Fabs with H:APFF LTH and H:APFF VLTH heavy chains had an increased ECL signal for binding to DLL4 as compared to a Fab with a heavy chain H:APFF ALTH. Depending on the antibody tested, the particular light chain mutants also further affected binding to DLL4. Similar results were obtained by ELISA (Table 73). The mutants were further analyzed for binding to DLL4 by ELISA using 3-fold serial dilutions of Fab, starting at a concentration of 20 nM. The results are set forth in Table 73 below. Antibodies containing the H:APFF LTH and APFF H:VLTH heavy chain mutations had approximately 10-fold increased binding affinity to DLL4 compared to the antibody mutants containing the heavy chain mutant H:APFF ALTH.

TABLE 72
Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F
(H:APFF) & L6_IGKJ1*01 S28N/S30D/S31H (L:NDH) CDR2 combination mutants
Fab
Heavy Chain
VH1-46_IGHD6- Light Chain
6*01_IGHJ1*01 L6_IGKJ1*01 SEQ
S102A/S103P/S104F/H111F SEQ ID S28N/S30D/S31H ID ECL
(APFF) NO (NDH) NO Signal
N52L/S54T/G56H (LTH) 203 (NDH) 323 6023
N52L/S54T/G56H (LTH) 203 S52L/A55G (NDH LG) 349 9007
N52L/S54T/G56H (LTH) 203 S52L/A55S (NDH LS) 350 11493
I51A/N52L/S54T/G56H (ALTH) 204 (NDH) 323 1840
I51A/N52L/S54T/G56H (ALTH) 204 S52L/A55G (NDH LG) 349 1759
I51A/N52L/S54T/G56H (ALTH) 204 S52L/A55S (NDH LS) 350 3720
I51V/N52L/S54T/G56H (VLTH) 209 (NDH) 323 9789
I51V/N52L/S54T/G56H (VLTH) 209 S52L/A55G (NDH LG) 349 12246
I51V/N52L/S54T/G56H (VLTH) 209 S52L/A55S (NDH LS) 350 8000

TABLE 73
Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ*01 mutant binding to DLL4
by ELISA
Heavy Chain Light Chain
VH1-46_IGHD6-6*01_IGHJ1*01 L6_IGKJ1*01
S102A/S103P/S104F/H111F S28N/S30D/S31H
(APFF) (NDH) 20 6.67 2.22 0.74
N52L/S54T/G56H (LTH) (NDH) 0.863 0.739 0.463 0.270
N52L/S54T/G56H (LTH) S52L/A55G (NDH LG) 1.008 0.880 0.594 0.368
N52L/S54T/G56H (LTH) S52L/A55S (NDH LS) 1.054 0.916 0.557 0.398
I51A/N52L/S54T/G56H (ALTH) (NDH) 0.391 0.232 0.069 0.024
I51A/N52L/S54T/G56H (ALTH) S52L/A55G (NDH LG) 0.390 0.212 0.069 0.028
I51A/N52L/S54T/G56H (ALTH) S52L/A55S (NDH LS) 0.458 0.282 0.040 0.046
I51V/N52L/S54T/G56H (VLTH) (NDH) 0.979 0.776 0.608 0.288
I51V/N52L/S54T/G56H (VLTH) S52L/A55G (NDH LG) 1.057 0.916 0.755 0.397
I51V/N52L/S54T/G56H (VLTH) S52L/A55S (NDH LS) 0.910 0.747 0.523 0.263

Summary

As a result of affinity maturation, the affinity of parental Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 for binding to DLL4 was increased 430-fold. Table 75 below sets for the binding affinity of the various affinity matured antibodies for DLL4, as determined by SPR (see Example 5). Parent Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 binds DLL4 with a KD of 730 nM. Mutation of four heavy chain amino acids, namely S102A/S103P/S104F/H111F (H:APFF), resulted in a Fab with 10-fold increased affinity for DLL4 (KD=70.6 nM). Affinity matured heavy and light chain mutant Fab H:APFF VLTH & L:NDH LS has a KD of 1.7 nM, a 430-fold increase in binding affinity for DLL4.

TABLE 75
Surface Plasmon Resonance Binding affinity of DLL4 Fabs
ka (×105) kd KD
Heavy Chain Light Chain (M−1s−1) (s−1) (nM)
VH1-46_IGHD6-6*01_IGHJ1*01 L6_IGKJ1*01  1.63 0.101  730  
(parental) (parental) (±3)   (±2)     (±130)   
VH1-46_IGHD6-6*01_IGHJ1*01 L6_IGKJ1*01  5.0 0.19  380  
S104F (±0.8)  (±0.01)   (±60)  
VH1-46_IGHD6-6*01_IGHJ1*01 L6_IGKJ1*01  4.05 0.0492 122  
S102A/S103P/S104F (APF) (±0.05) (±0.0004)  (±1)  
VH1-46_IGHD6-6*01_IGHJ1*01 L6_IGKJ1*01  4.25 0.0300  70.6
S102A/S103P/S104F/H111F (±0.04) (±0.0002)  (±0.7)
(APFF)
VH1-46_IGHD6-6*01_IGHJ1*01 L6_IGKJ1*01  3.40 0.0317  93.1
S102A/S103P/S104F/H111Y (±0.03) (±0.0002)  (±0.9)
(APFY)
VH1-46_IGHD6-6*01_IGHJ1*01 L6_IGKJ1*01 S31K  3.50 0.0392 112  
S102A/S103P/S104F (APF) (±0.05) (0.0004) (±2)  
VH1-46_IGHD6-6*01_IGHJ1*01 L6_IGKJ1*01  3.51 0.0101  32.7
S102A/S103P/S104F/H111F (±1.84) (±0.000716) (±11.6) 
G56H (APFF G56H)
VH1-46_IGHD6-6*01_IGHJ1*01 L6_IGKJ1*01  4.44 0.0689 *155.2
S102A/S103P/S104F/H111F S28N/S30D/S31H and 14
(APFF) (NDH)
VH1-46_IGHD6-6*01_IGHJ1*01 L6_IGKJ1*01  4.30  0.00113   2.7
S102A/S103P/S104F/H111F S28N/S30D/S31H (±1.45) (±0.000138) (±0.6)
I51V/N52L/S54T/G56H (NDH)
(APFF VLTH)
VH1-46_IGHD6-6*01_IGHJ1*01 L6_IGKJ1*01  6.84  0.00109   1.7
S102A/S103P/S104F/H111F S28N/S30D/S31H (±2.51) (±0.000106) (±0.5)
I51V/N52L/S54T/G56H S52L/A55S
(APFF VLTH) (NDH LS)
*Fab Fab VH1-46_IGHD6-6*01_IGHJ1*01 S102A/S103P/S104F/H111F & L6_IGKJ1*01 S28N/S30D/S31H displays 2-site binding: 89% with Kd of 155.2 nM and 10% with Kd of 14 nM.

Example 12

Affinity Maturation of Identified Parent “Hit” Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01 Against DLL4

The parent “Hit” Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01 (SEQ ID NOS:89 and 108) against DLL4, identified in Example 4 using the electroluminescence Meso Scale Discovery (MSD) multispot binding assay, was subjected to affinity maturation as described above in Examples 7-11. By this method, an anti-DLL4 antibody was generated with significantly improved binding affinity for DLL4 compared to the parent “Hit” VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01 Fab antibody.

A. Heavy Chain

1. Identification of the CDR Potential Binding Site

The amino acid sequence of the heavy chain (SEQ ID NO:89) for the parent “Hit” VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01 was aligned with the amino acid sequence of a related heavy chain (SEQ ID NO:106) of a non-Hit that was identified as not binding to DLL4, i.e. VH5-51_IGHD6-25*01_IGHJ4*01. These two Fabs are related because they share the same VH and JH germline segments. The sequence alignment is set forth in FIG. 3. Based on the alignment, amino acid residues were identified that differed between the “Hit” and “non-Hit,” thus accounting for the differences in binding of the “Hit” and “non-Hit” antibody for DLL4. The identified amino acid residues were located in CDR3, which was identified as the region of the heavy chain that is important for binding affinity.

2. Alanine Scanning of CDR3

Alanine scanning mutagenesis was performed on amino acid residues in the CDR3 of the heavy chain sequence of parent Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01 to identify amino acid residues that do not appear to be involved in DLL4 binding. Alanine-scanning of the CDR3 region of the heavy chain was performed by mutating every residue of the CDR3 region to an alanine, except amino acid residues Y107, F108, D109, and Y110. Purified Fab alanine mutants were tested for binding to DLL4. The results are set forth in Table 76. Mutation of R99, Y101, S102, Y103, Y105, or D106 with alanine caused a reduction in the ECL signal for binding to DLL4, and therefore these residues were not further mutagenized. In contrast, mutation of G100 or G104 with alanine either resulted in an increased ECL signal or did not affect the ECL signal for binding to DLL4, and thus these residues were identified as residues for further mutagenesis. The results were confirmed in a repeat experiment using varying concentrations of mutant Fab and DLL4 protein (see Table 77).

TABLE 76
Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01 alanine
mutant binding data
Heavy Chain Signal/
VH5-51_IGHD5- SEQ ID SEQ ID Noise
18*01_IGHJ4*01 NO Light Chain NO (0.04 μM)
wildtype 89 V3-4_IGLJ1*01 108 14.7
R99A 382 V3-4_IGLJ1*01 108 1.3
G100A 383 V3-4_IGLJ1*01 108 30.4
Y101A 384 V3-4_IGLJ1*01 108 1.2
S102A 385 V3-4_IGLJ1*01 108 2
Y103A 386 V3-4_IGLJI*01 108 1.2
G104A 387 V3-4_IGLJ1*01 108 15.5
Y105A 388 V3-4_IGLJ1*01 108 9.6
D106A 389 V3-4_IGLJ1*01 108 1.2
wildtype 89 V3-4_IGLJ1*01 108 15.5

TABLE 77
Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01 alanine
mutant binding data
0.1 μM 0.02 μM
Fab Fab
Fab 30 μg/mL 15 μg/mL
Heavy Chain Light Chain DLL4 DLL4
VH5-51_IGHD5- SEQ ID (SEQ ID Signal/ Signal/
18*01_IGHJ4*01 NO NO: 108) Noise Noise
wildtype 89 V3-4_IGLJ1*01 24.0 15.2
R99A 382 V3-4_IGLJ1*01 1.1 1.0
G100A 383 V3-4_IGLJ1*01 53.3 24.2
Y101A 384 V3-4_IGLJ1*01 1.1 1.3
S102A 385 V3-4_IGLJ1*01 4.7 1.8
Y103A 386 V3-4_IGLJ1*01 4.0 1.5
G104A 387 V3-4_IGLJ1*01 41.5 12.5
Y105A 388 V3-4_IGLJ1*01 1.0 1.0
D106A 389 V3-4_IGLJ1*01 1.3 1.0

3. NNK Mutagenesis of Heavy Chain Amino Acid Residues G100 and G104

Following alanine scanning mutagenesis of CDR3, heavy chain amino acid residues G100 and G104 were selected for further mutation using overlapping PCR with NNK mutagenesis using wildtype Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01 as a template, similar to the experiment described in Example 7.b.iii above. The results are set forth in Table 78 below. Amino acid mutations designated with X (for any amino acid) did not show appreciable binding and therefore were not sequenced to identify the exact mutation. Two mutations, G100K and G104T, in the heavy chain were identified that resulted in a Fab with an improved ECL signal for binding to DLL4. Each mutant exhibited an ECL signal for binding to DLL4 approximately 2-fold greater than parent Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01.

TABLE 78
NNK mutagenesis of parent Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 &
V3-4_IGLJ1*01 at amino acid residues G100 and G104
0.1 μM Fab 0.02 μM Fab
Fab 30 μg/mL 15 μg/mL
Light Chain DLL4 DLL4
Heavy Chain SEQ (SEQ ID Signal/ Signal/
VH5-51_IGHD5-18*01_IGHJ4*01 ID NO NO: 108) Noise Noise
G100L 390 V3-4_IGLJ1*01 27.2 13.0
G104stop 436 V3-4_IGLJ1*01 1.0 1.1
G100L 390 V3-4_IGLJ1*01 66.2 32.5
G100D 391 V3-4_IGLJ1*01 5.8 2.0
G100T 392 V3-4_IGLJ1*01 26.0 11.0
G100K 378 V3-4_IGLJ1*01 133.9 72.6
G100R 379 V3-4_IGLJ1*01 90.6 39.9
G100L 390 V3-4_IGLJ1*01 40.2 15.6
G100L 390 V3-4_IGLJ1*01 59.0 28.7
G104D 393 V3-4_IGLJ1*01 42.5 23.2
G104A 387 V3-4_IGLJ1*01 6.7 2.6
G104L 394 V3-4_IGLJ1*01 28.4 9.3
G104P 395 V3-4_IGLJ1*01 1.0 1.0
wildtype 89 V3-4_IGLJ1*01 31.4 13.2
G104R 396 V3-4_IGLJ1*01 23.2 9.1
G104T 380 V3-4_IGLJ1*01 45.4 20.2
G104X 437 V3-4_IGLJ1*01 44.5 22.5
G104T 380 V3-4_IGLJ1*01 63.2 29.0
G104stop 436 V3-4_IGLJ1*01 1.2 0.9
G104M 397 V3-4_IGLJ1*01 29.1 12.3
wildtype 89 V3-4_IGLJ1*01 32.6 15.6
G104L 394 V3-4_IGLJ1*01 23.4 10.8
G104stop 436 V3-4_IGLJ1*01 1.0 1.0
G104K 398 V3-4_IGLJ1*01 17.6 9.1
wildtype 89 V3-4_IGLJ1*01 42.4 17.6
G104R 396 V3-4_IGLJ1*01 20.4 7.8
G104S 399 V3-4_IGLJ1*01 47.8 25.6
G104R/Y101H 400 V3-4_IGLJ1*01 1.2 1.0
G104T 380 V3-4_IGLJ1*01 67.8 35.8

4. Combination Mutant Based on NNK Mutagenesis of CDR3

Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01 heavy chain mutants G100K and G104T, identified as having increased binding affinity to DLL4, were combined to generate a double mutant, designated as Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/G104T & V3-4_IGLJ1*01 (H:KT). The binding of the KT double mutant to DLL4 was compared to the binding of the parent Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01 to DLL4 by assaying various concentrations each antibody. The results are set forth in Tables 79-80 below. The results show that the KT double mutant exhibits an increased ECL signal for binding to DLL4 as compared to the parent Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01. Both Fabs exhibit specific binding to DLL4 as compared to the various other tested antigens (see Table 80).

TABLE 79
Binding affinity of double mutant Fab VH5-51_IGHD5-
18*01>3_IGHJ4*01 G100K/G104T & V3-4_IGLJ1*01
(SEQ ID NO: 108) as compared to wildtype Fab VH5-
51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01
Wildtype G100K, G104T G100K, G104T
Heavy (SEQ ID (SEQ ID Wildtype (SEQ (SEQ ID
Chain NO: 89) NO: 381) ID NO: 89) NO: 381)
Fab [μM] Signal Signal Signal/Noise Signal/Noise
200.00 4750 69079 36.3 76.9
20.00 2199 45123 21.1 157.2
2.00 443 5379 2.2 72.7
0.20 348 350 3.0 3.0

TABLE 80
Binding affinity and specificity of double mutant Fab VH5-51_IGHD5-18*01 >
3_IGHJ4*01 G100K/G104T & V3-4_IGLJ1*01 as compared to wildtype Fab
VH5-51_IGHD5-18*01 > 3_IGHJ4*01 & V3-4_IGLJ1*01
Fab
Heavy Chain [μM] ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R DLL4
Wt 200.00 3.1 2.9 3.5 1.3 1.6 2.8 1.5 2.2 36.3
20.00 4.4 2.5 4.0 1.6 2.6 1.8 0.9 2.0 21.1
2.00 1.8 1.1 1.8 1.5 1.1 1.6 1.1 1.2 2.2
0.20 2.6 3.4 3.1 1.7 1.4 2.9 1.5 2.5 3.0
G100K, 200.00 1.7 1.6 1.7 1.7 1.4 1.5 2.0 1.7 76.9
G104T 20.00 1.2 1.1 0.9 1.2 1.1 1.1 1.1 1.1 157.2
2.00 3.2 3.8 6.0 1.9 3.5 3.7 4.3 4.1 72.7
0.20 2.5 1.5 2.4 1.9 1.3 1.9 1.7 1.7 3.0

B. Further Optimization of the Heavy Chain

1. Summary

The heavy chain of the KT double mutant described and generated above was further optimized to improve its binding for DLL4. The heavy chain mutant KT double mutant was used as a template for further mutagenesis of heavy chain amino acid residues in the CDR1 (amino acids 26-35), CDR2 (amino acid residues 50-66) and framework region of the heavy chain by alanine scanning mutagenesis.

2. Alaninie Scanning of Residues in CDR1

Alanine scanning was performed by mutating every amino acid residue of CDR1, except G26. Three additional flanking amino acid residues, namely G24, I34, and G35 were also mutated to alanine. Purified Fab alanine mutants were tested for binding to DLL4 using the ECL multispot binding assay. The results are set forth in Tables 81-83 below. Mutation of amino acid residues Y27, F29, T30, S31, Y32, W33, or 134 with alanine caused a reduction in the ECL and ELISA signals for binding to DLL4, and thus these residues were not further mutagenized. Mutation of amino acid residues G24, S28, or G35 with alanine either improved the ECL signal or did not affect the ECL signal for binding to DLL4, and thus these residues were identified as residues for further mutagenesis. ELISA experiments also were performed, but little or no detectable signal was observed in the ELISA experiments (Table 81). Table 83 shows that the tested antibodies exhibit specificity for DLL4 compared to other tested antigens.

TABLE 81
Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/G104T (KT)
& V3-4_IGLJ1*01 CDR1 alanine mutant binding data
Fab
Heavy Chain ECL ELISA
VH5-51_IGHD5- SEQ Light Chain Signal/ (Signal-
18*01_IGHJ4*01 ID NO (SEQ ID NO: 108) Blank Noise)
G100K/G104T G24A 401 V3-4_IGLJ1*01 122.1 0.02
G100K/G104T I34A 402 V3-4_IGLJ1*01 2.6 0.01
G100K/G104T G35A 403 V3-4_IGLJ1*01 180.5 0.02
G100K/G104T S28A 404 V3-4_IGLJ1*01 112.1 0.01
G100K/G104T 381 V3-4_IGLJ1*01 85.9 0.00
G100K/G104T F29A 405 V3-4_IGLJ1*01 67.9 0.02
G100K/G104T T30A 406 V3-4_IGLJ1*01 69.4 0.00
G100K/G104T 381 V3-4_IGLJ1*01 188.0 0.00
G100K/G104T W33A 407 V3-4_IGLJ1*01 3.0 0.02
G100K/G104T 381 V3-4_IGLJ1*01 153.3 0.01

TABLE 82
Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/G104T (KT)
& V3-4_IGLJ1*01 CDR1 alanine mutant binding data
Fab
Heavy Chain ECL
VH5-51_IGHD5- SEQ Light Chain Signal/
18*01_IGHJ4*01 ID NO (SEQ ID NO: 108) Blank
G100K/G104T 381 V3-4_IGLJ1*01 49.2
G100K/G104T Y27A 2899 V3-4_IGLJ1*01 9.1
G100K/G104T S31A 2900 V3-4_IGLJ1*01 3.0
G100K/G104T Y32A 2901 V3-4_IGLJ1*01 2.7

TABLE 83
Fab VH5-51_IGHD5-18*01 > 3_IGHJ4*01 G100K/G104T (KT)
& V3-4_IGLJ1*01 CDR1 alanine mutant binding data
Heavy Chain ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R DLL4 Blank
KT G24A 869 757 803 493 547 879 212 551 45546 373
KT I34A 1149 883 1084 564 608 923 349 505 772 300
KT G35A 911 760 939 400 624 899 305 506 53618 297
KT S28A 1072 839 1040 432 497 924 317 586 35439 316
KT 1095 852 838 543 579 877 319 554 36440 424
KT F29A 1040 887 985 601 621 945 502 586 22867 337
KT T30A 1071 853 868 539 698 968 438 553 24346 351
KT 1068 915 936 507 633 964 346 497 45120 240
KT W33A 921 761 735 561 513 788 302 424 731 240
KT 1098 768 867 437 540 781 226 421 32658 213

3. NNK Mutagenesis of Amino Acid Residues G24, S28 and G35

Following alanine scanning mutagenesis of CDR1, heavy chain amino acid residues G24, S28 and G35 were selected for further mutation using overlapping PCR with NNK mutagenesis using the heavy chain KT double mutant as a template. The results are set forth in Table 84 below. Amino acid mutations designated with X (for any amino acid) did not show appreciable binding and therefore were not sequenced to identify the exact mutation. Several Fab mutants that contained a combination of two mutations at a specific amino acid position are designated as such. For example, G24S/T indicates the tested antibody was a mixture of two Fabs, one containing the mutation G24S and the other containing the mutation G24T. The results show that mutation of additional amino acids (G24L, S28R, S28K and G35V) in the heavy chain of the KT double mutant result in increase the ECL signal for binding to DLL4 compared to the parental KT double mutant template.

TABLE 84
Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/G104T (KT) &
V3-4_IGLJ1*01 CDR1 NNK mutant binding data
Fab
Heavy Chain SEQ ELISA
VH5-51_IGHD5- ID Light Chain ECL (Signal-
18*01_IGHJ4*01 NO (SEQ ID NO: 108) Signal Noise)
G100K/G104T G24L 408 V3-4_IGLJ1*01 19617 0.09
G100K/G104T G24X 438 V3-4_IGLJ1*01 291 0.03
G100K/G104T G24X 438 V3-4_IGLJ1*01 13304 0.06
G100K/G104T G24X 438 V3-4_IGLJ1*01 250 0.03
G100K/G104T G24X 438 V3-4_IGLJ1*01 10339 0.06
G100K/G104T G24X 438 V3-4_IGLJ1*01 7395 0.05
G100K/G104T G24X 438 V3-4_IGLJ1*01 1294 0.03
G100K/G104T G24X 438 V3-4_IGLJ1*01 4299 0.04
G100K/G104T G24X 438 V3-4_IGLJ1*01 319 0.02
G100K/G104T G24S/T 439 V3-4_IGLJ1*01 22221 0.09
G100K/G104T G24X 438 V3-4_IGLJ1*01 9771 0.06
G100K/G104T G24X 438 V3-4_IGLJ1*01 7554 0.05
G100K/G104T G24L/G 440 V3-4_IGLJ1*01 7970 0.05
G100K/G104T G24X 438 V3-4_IGLJ1*01 517 0.04
G100K/G104T G24X 438 V3-4_IGLJ1*01 1267 0.04
G100K/G104T G24X 438 V3-4_IGLJ1*01 12665 0.05
G100K/G104T G24X 438 V3-4_IGLJ1*01 12614 0.06
G100K/G104T G24X 438 V3-4_IGLJ1*01 8746 0.05
G100K/G104T G24X 438 V3-4_IGLJ1*01 2330 0.04
G100K/G104T G24X 438 V3-4_IGLJ1*01 7003 0.05
G100K/G104T S28R 411 V3-4_IGLJ1*01 36903 0.25
G100K/G104T S28X 441 V3-4_IGLJ1*01 1882 0.06
G100K/G104T S28K 412 V3-4_IGLJ1*01 32324 0.28
G100K/G104T S28X 441 V3-4_IGLJ1*01 5811 0.06
G100K/G104T G24R 410 V3-4_IGLJ1*01 4203 0.06
G100K/G104T S28X 441 V3-4_IGLJ1*01 6855 0.05
G100K/G104T S28X 441 V3-4_IGLJ1*01 356 0.03
G100K/G104T S28X 441 V3-4_IGLJ1*01 8482 0.05
G100K/G104T S28R 411 V3-4_IGLJ1*01 64124 0.49
G100K/G104T S28X 441 V3-4_IGLJ1*01 14585 0.10
G100K/G104T S28X 441 V3-4_IGLJ1*01 10205 0.07
G100K/G104T S28X 441 V3-4_IGLJ1*01 834 0.04
G100K/G104T S28X 441 V3-4_IGLJ1*01 4605 0.04
G100K/G104T S28X 441 V3-4_IGLJ1*01 344 0.03
G100K/G104T S28X 441 V3-4_IGLJ1*01 8017 0.05
G100K/G104T S28X 441 V3-4_IGLJ1*01 9895 0.05
G100K/G104T S28R 411 V3-4_IGLJ1*01 51418 0.29
G100K/G104T S28N 413 V3-4_IGLJ1*01 17255 0.09
G100K/G104T S28X 441 V3-4_IGLJ1*01 7681 0.05
G100K/G104T G35X 442 V3-4_IGLJ1*01 6027 0.05
G100K/G104T G35X 442 V3-4_IGLJ1*01 302 0.02
G100K/G104T G35T 414 V3-4_IGLJ1*01 14452 0.07
G100K/G104T G35X 442 V3-4_IGLJ1*01 937 0.04
G100K/G104T G35X 442 V3-4_IGLJ1*01 4954 0.05
G100K/G104T G35X 442 V3-4_IGLJ1*01 812 0.03
G100K/G104T G35X 442 V3-4_IGLJ1*01 1088 0.04
G100K/G104T G35X 442 V3-4_IGLJ1*01 1231 0.03
G100K/G104T G35X 442 V3-4_IGLJ1*01 5067 0.04
G100K/G104T G35A 403 V3-4_IGLJ1*01 19695 0.06
G100K/G104T G35V 416 V3-4_IGLJ1*01 21169 0.09
G100K/G104T G35X 442 V3-4_IGLJ1*01 2122 0.04
G100K/G104T G35X 442 V3-4_IGLJ1*01 1426 0.04
G100K/G104T G35X 442 V3-4_IGLJ1*01 326 0.03
G100K/G104T G35X 442 V3-4_IGLJ1*01 3106 0.03
G100K/G104T G35X 442 V3-4_IGLJ1*01 1373 0.03
G100K/G104T G35X 442 V3-4_IGLJ1*01 5986 0.06
G100K/G104T G35X 442 V3-4_IGLJ1*01 3787 0.04
G100K/G104T G35X 442 V3-4_IGLJ1*01 4871 0.04
G100K/G104T G35X 442 V3-4_IGLJ1*01 370 0.03
G100K/G104T G35X 442 V3-4_IGLJ1*01 841 0.04

4. Combination Mutants of G24, S28 and G35

Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/G104T (KT) & V3-4_IGLJ1*01 heavy chain mutants G24L, G24T, G24A, S28R and G35V were combined to generate antibodies containing three to five mutations in the heavy chain. The mutants generated are set forth in Table 85. The mutants were assessed for binding to DLL4 using an ECL assay. All combination mutants exhibited greater ECL signals for binding to DLL4 compared to the KT double mutant. The results show that the mutant Fab H:KT TRV & L:wt had the greatest affinity towards binding to DLL4.

TABLE 85
Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/G104T (KT) &
V3-4_IGLJ1*01 CDR1 combination mutants
Fab
Heavy Chain SEQ ID SEQ ID ECL
VH5-51_IGHD5-18*01_IGHJ4*01 NO Light Chain NO Signal
G100K/G104T (KT) 381 V3-4_IGLJ1*01 108 588
G100K/G104T/S28R (KT S28R) 411 V3-4_IGLJ1*01 108 6423
G100K/G104T/G24L/S28R/G35V 417 V3-4_IGLJ1*01 108 15333
(KT LRV)
G100K/G104T/G24T/S28R/G35V 430 V3-4_IGLJ1*01 108 26072
(KT TRV)
G100K/G104T/G24A/S28R/G35V 431 V3-4_IGLJ1*01 108 17357
(KT ARV)

5. Alanine Scanning of CDR2

The KT double mutant was used as a template for alanine scanning mutagenesis of CDR2 (amino acids 50-58) to determine residues important for antibody binding to DLL4. Purified Fab alanine mutants were tested for binding to DLL4 using the ECL multispot binding assay. The results are set forth in Tables 86-88 below. Mutation of amino acid residues 150, 151, Y52, P53, G54, D55, or D57 with alanine caused a reduction in the ECL signal for binding to DLL4, and thus these residues were not targeted for further mutagenesis. Substitution of amino acid residues S56 or T58 with alanine either improved the ECL signal or did not affect the ECL signal for binding to DLL4, and thus these residues were subjected to further mutagenesis. Similar experiments also were performed by ELISA, although little to no detectable signal was observed. Table 88 shows that all antibodies exhibit specificity for DLL4.

TABLE 86
Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/G104T (KT) &
V3-4_IGLJ1*01 CDR2 alanine mutant binding data
Fab
Heavy Chain ECL ELISA
VH5-51_IGHD5- SEQ Light Chain Signal/ (Signal-
18*01_IGHJ4*01 ID NO (SEQ ID NO: 108) Blank Noise)
G100K/G104T D57A 418 V3-4_IGLJ1*01 2.8 0.01
G100K/G104T 381 V3-4_IGLJ1*01 85.9 0.00
G100K/G104T 381 V3-4_IGLJ1*01 188.0 0.00
G100K/G104T 381 V3-4_IGLJ1*01 153.3 0.01
G100K/G104T I50A 419 V3-4_IGLJ1*01 40.9 0.02
G100K/G104T I51A 420 V3-4_IGLJ1*01 30.6 0.01
G100K/G104T Y52A 421 V3-4_IGLJ1*01 2.7 0.04
G100K/G104T P53A 422 V3-4_IGLJ1*01 57.7 0.00
G100K/G104T D55A 423 V3-4_IGLJ1*01 2.5 0.00

TABLE 87
Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/G104T (KT)
& V3-4_IGLJ1*01 CDR2 alanine mutant binding data
Fab
Heavy Chain ECL
VH5-51_IGHD5- SEQ Light Chain Signal/
18*01_IGHJ4*01 ID NO (SEQ ID NO: 108) Blank
G100K/G104T 381 V3-4_IGLJ1*01 49.2
G100K/G104T G54A 2902 V3-4_IGLJ1*01 4.1
G100K/G104T S56A 2903 V3-4_IGLJ1*01 55
G100K/G104T T58A 425 V3-4_IGLJ1*01 101.9

TABLE 88
Fab VH5-51_IGHD5-18*01 > 3_IGHJ4*01 G100K/G104T (KT) &
V3-4_IGLJ1*01 CDR1 and CDR2 alanine mutant binding data
Heavy Chain ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R DLL4 Blank
KT D57A 1203 915 1126 523 600 982 365 456 888 321
KT 1095 852 838 543 579 877 319 554 36440 424
KT 1068 915 936 507 633 964 346 497 45120 240
KT 1098 768 867 437 540 781 226 421 32658 213
KT I50A 925 794 822 443 632 785 343 523 9682 237
KT I51A 1092 803 875 612 517 828 432 497 6578 215
KT Y52A 989 745 803 566 591 827 334 584 735 277
KT P53A 1145 976 1000 536 556 943 424 563 20135 349
KT D55A 1028 729 856 683 606 898 310 479 761 306

6. NNK Mutagenesis of Amino Acid Residues T58 and S56

Following alanine scanning mutagenesis of CDR2, heavy chain amino acid residues T58 and S56 were selected for further mutation using overlapping PCR with NNK mutagenesis using the H:KT & L:wt double mutant as a template. The results are set forth in Table 89 below Amino acid mutations designated with X (for any amino acid) did not show appreciable binding and therefore were not sequenced to identify the exact mutation. Mutation of heavy chain KT amino acid residue T58 to alanine (T58A) and aspartic acid (T58D) resulted in an increase in ECL signal for binding to DLL4.

TABLE 89
Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/G104T (H:KT) & V3-
4_IGLJ1*01 CDR1 and CDR2 T58 and S56 NNK mutant binding data
Fab
Heavy Chain SEQ ELISA
VH5-51_IGHD5- ID Light Chain ECL (Signal-
18*01_IGHJ4*01 NO (SEQ ID NO: 108) Signal Noise)
G100K/G104T T58D/K 443 V3-4_IGLJ1*01 823 0.03
G100K/G104T/T58X 444 V3-4_IGLJ1*01 5040 0.03
G100K/G104T/T58X 444 V3-4_IGLJ1*01 765 0.03
G100K/G104T/T58X 444 V3-4_IGLJ1*01 520 0.02
G100K/G104T/T58A 425 V3-4_IGLJ1*01 12938 0.07
G100K/G104T/T58X 444 V3-4_IGLJ1*01 2272 0.03
G100K/G104T/T58X 444 V3-4_IGLJ1*01 1059 0.03
G100K/G104T/T58X 444 V3-4_IGLJ1*01 619 0.03
G100K/G104T/T58X 444 V3-4_IGLJ1*01 2994 0.04
G100K/G104T/T58X 444 V3-4_IGLJ1*01 7341 0.05
G100K/G104T/T58X 444 V3-4_IGLJ1*01 1422 0.03
G100K/G104T/T58X 444 V3-4_IGLJ1*01 5119 0.05
G100K/G104T/T58D 424 V3-4_IGLJ1*01 11468 0.07
G100K/G104T/T58D 424 V3-4_IGLJ1*01 10459 0.06
G100K/G104T/T58X 444 V3-4_IGLJ1*01 476 0.03
G100K/G104T/T58X 444 V3-4_IGLJ1*01 1421 0.03
G100K/G104T/T58X 444 V3-4_IGLJ1*01 658 0.03
G100K/G104T/T58X 444 V3-4_IGLJ1*01 4278 0.03
G100K/G104T/S56X 445 V3-4_IGLJ1*01 1436 0.04
G100K/G104T/S56X 445 V3-4_IGLJ1*01 1553 0.03
G100K/G104T/S56X 445 V3-4_IGLJ1*01 1372 0.04
G100K/G104T/S56X 445 V3-4_IGLJ1*01 585 0.03
G100K/G104T/S56X 445 V3-4_IGLJ1*01 1165 0.03
G100K/G104T/S56X 445 V3-4_IGLJ1*01 335 0.03
G100K/G104T/S56X 445 V3-4_IGLJ1*01 1139 0.04
G100K/G104T/S56X 445 V3-4_IGLJ1*01 3206 0.04
G100K/G104T/S56X 445 V3-4_IGLJ1*01 3239 0.03
G100K/G104T/S56G 426 V3-4_IGLJ1*01 8433 0.05
G100K/G104T/S56X 445 V3-4_IGLJ1*01 1125 0.03
G100K/G104T/S56X 445 V3-4_IGLJ1*01 1927 0.04
G100K/G104T/S56X 445 V3-4_IGLJ1*01 502 0.04
G100K/G104T/S56X 445 V3-4_IGLJ1*01 1509 0.04
G100K/G104T/S56X 445 V3-4_IGLJ1*01 1951 0.03
G100K/G104T/S56X 445 V3-4_IGLJ1*01 4317 0.04
G100K/G104T/S56X 445 V3-4_IGLJ1*01 2065 0.04
G100K/G104T/S56X 445 V3-4_IGLJ1*01 1486 0.02

7. Mutagenesis of Amino Acid Residues S84 and D109

The heavy chain KT double mutant was used as a template for mutagenesis of amino acid residues S84 and D109. These amino acid residues were mutated using overlapping PCR with NNK mutagenesis or by alanine scanning. The results are shown in Tables 90-92 below, which depict ECL and ELISA results for binding to DLL4 or various antigens. Mutation of heavy chain residues S84 and D109 caused a reduction in ECL signal for binding to DLL4 as compared to heavy chain mutant Fab KT & V3-4_IGLJ*01.

TABLE 90
Binding of Fab heavy chain VH5-51_IGHD5-18*01>3_IGHJ4*01
G100K/G104T (H:KT) & V3-4_IGLJ1*01 S84 and
D109A mutants to DLL4
Fab
Heavy Chain ELISA
VH5-51_IGHD5- SEQ Light Chain ECL (Signal-
18*01_IGHJ4*01 ID NO (SEQ ID NO: 108) Signal Noise)
G100K/G104T S84V 427 V3-4_IGLJ1*01 37.7 0.02
G100K/G104T S84L 428 V3-4_IGLJ1*01 3.2 0.00
G100K/G104T D109A 429 V3-4_IGLJ1*01 76.8 0.00
G100K/G104T 381 V3-4_IGLJ1*01 85.9 0.00

TABLE 91
Binding and specificity of Fab heavy chain VH5-51_IGHD5-18*01 >
3_IGHJ4*01 G100K/G104T (H: KT) & V3-4_IGLJ1*01 S84 and D109A mutants to DLL4
Heavy Chain ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R DLL4 Blank
S84V 1042 805 811 505 577 914 362 484 8889 236
S84L 1092 864 933 410 545 908 320 458 713 223
D109A 1099 791 846 443 538 967 406 612 21807 284
G100K/G104T 1095 852 838 543 579 877 319 554 36440 424

TABLE 92
Binding of Fab heavy chain VH5-51_IGHD5-18*01>3_IGHJ4*01
G100K/G104T (H:KT) & V3-4_IGLJ1*01 S84I to DLL4
SEQ Light Chain
Heavy Chain ID (SEQ ID ECL
VH5-51_IGHD5-18*01_IGHJ4*01 NO NO: 108) Signal
G100K/G104T 381 V3-4_IGLJ1*01 9355
G100K/G104T S84I 409 V3-4_IGLJ1*01 7937

C. Light Chain

1. Alanine Scanning of CDR3

Alanine scanning mutagenesis was performed on amino acid residues in the CDR3 of the light chain of parent Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/G104T (H:KT) & V3-4_IGLJ*01 to identify amino acid residues that do not appear to be involved in DLL4 binding. Alanine scanning mutagenesis was performed by mutation of every residue of CDR3. Purified Fab alanine mutants were tested at a concentration of 0.04 μM for binding to DLL4 using the ECL multispot assay. The results are set forth in Tables 93-94 below. The results show that mutation of amino acid residues L92, Y93, G95, G97, I98, or S99 with alanine resulted in reduced binding to DLL4, and therefore these residues were not further mutagenized. Substitution of V91, M94, or S96 with alanine either improved binding or did not affect binding to DLL4 and thus these residues were identified as residues for further mutagenesis.

TABLE 93
Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/G104T
(H:KT) & V3-4_IGLJ1*01 alanine mutant binding data
Fab
Heavy Chain
VH5-51_IGHD5- SEQ ID Light Chain SEQ ID ECL Signal/
18*01_IGHJ4*01 NO V3-4_IGLJ1*01 NO Noise
G100K/G104T 381 Parental 108 49.2
G100K/G104T 381 V91A 446 48.5
G100K/G104T 381 L92A 447 30.3
G100K/G104T 381 Y93A 448 21.3
G100K/G104T 381 M94A 449 53.1
G100K/G104T 381 G95A 450 34.4
G100K/G104T 381 G97A 451 24.7
G100K/G104T 381 S96A 452 57.9
G100K/G104T 381 I98A 453 32.6
G100K/G104T 381 S99A 454 41.0

TABLE 94
Fab VH5-51_IGHD5-18*01 > 3_IGHJ4*01 G100K/G104T (H:
KT) & V3-4_IGLJ1*01 CDR3 alanine mutant binding data
Light Chain ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R DLL4 Blank
V91A 1118 833 1107 682 632 1031 484 675 33377 372
L92A 1374 1012 1172 693 695 959 326 582 11698 328
Y93A 1404 918 1130 725 700 1049 497 602 8107 388
M94A 1203 1126 1151 574 633 1094 472 614 35311 388
G95A 1250 995 999 707 657 1091 345 637 10445 341
G97A 1292 1059 1112 660 642 1034 474 528 14892 248
S96A 1275 1004 1115 715 678 927 491 684 32312 321
I98A 1375 1054 1227 700 708 1098 359 584 15096 1623
S99A 1323 956 909 674 670 943 500 693 18191 394

2. NNK Mutagenesis of CDR3 Amino Acid Residues V91, M94 and S96

Following alanine scanning mutagenesis of CDR3, light chain amino acid residues V91, M94 and S96 were selected for further mutation using overlapping PCR with NNK mutagenesis using Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/G104T & V3-4_IGLJ*01 as a template. The resulting mutants were assayed using the ECL multispot assay as described in Example 4 or by ELISA as described in Example 6. The results are set forth in Table 95. The ECL results show that V3-4_IGLJ*01 amino acid mutants M94R, S96M and S96E exhibited increased binding to DLL4. No detectable signal was observed by ELISA for any of the mutants tested.

TABLE 95
Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/G104T (H:KT) &
V3-4_IGLJ1*01 V91, M94 and S96 NNK mutant binding data
Fab
Heavy Chain ECL ELISA
VH5-51_IGHD5- Light Chain SEQ Signal Signal
18*01>3_IGHJ4*01 V3- ID [10 nM [100 nM
(SEQ ID NO: 381) 4_IGLJ1*01 NO Fab] Fab]
G100K/G104T V91P 455 920 0.06
G100K/G104T V91T 456 32717 0.01
G100K/G104T V91S 457 32077 0.01
G100K/G104T V91L 458 41576 0.02
G100K/G104T V91R 459 13432 0.00
G100K/G104T V91A 446 35576 0.01
G100K/G104T parent 108 42851 0.01
G100K/G104T V91C 460 38330 0.02
G100K/G104T V91E 461 22524 0.00
G100K/G104T V91W 462 12523 0.00
G100K/G104T V91N 463 46674 0.00
G100K/G104T V91I 464 51236 0.01
G100K/G104T V91G 465 45254 0.01
G100K/G104T V91H 466 27123 0.01
G100K/G104T V91A 446 33817 0.02
G100K/G104T M94E 467 32481 0.01
G100K/G104T M94S 468 49579 0.02
G100K/G104T M94G 469 20338 0.01
G100K/G104T M94L 470 46770 0.02
G100K/G104T M94P 471 39930 0.01
G100K/G104T M94V 472 47326 0.02
G100K/G104T M94D 473 52677 0.01
G100K/G104T M94R 474 77777 0.01
G100K/G104T M94N 475 51284 0.01
G100K/G104T M94T 476 43017 0.02
G100K/G104T M94F 477 26330 0.01
G100K/G104T M94A 449 33484 0.01
G100K/G104T M94A 449 37962 0.00
G100K/G104T S96W 478 52299 0.02
G100K/G104T S96G 479 40377 0.01
G100K/G104T S96P 480 53997 0.03
G100K/G104T S96A/E 579 43247 0.02
G100K/G104T S96R 481 54259 0.02
G100K/G104T S96L 482 39950 0.02
G100K/G104T S96M 483 61737 0.02
G100K/G104T S96E 484 57030 0.02
G100K/G104T parent 108 36614 0.01
G100K/G104T S96V 485 42293 0.01
G100K/G104T S96A 452 1128 0.00

3. Combination Mutants of M94 and S96

V3-4_IGLJ1*01 light chain mutants M94R and S96M, identified as contributing to increased binding to DLL4, were combined to generate a double mutant. The double mutant is designated as V3-4_IGLJ1*01 M94R/S96M (L:RM). The binding affinity of the L:RM double mutant, as paired with various heavy chain mutants including H:KT, H:KT S28R, H:KT LRV, H:KT TRV, and H:KT ARV, was determined by ECL assay as described in Example 4. The results are set forth in Table 96 below. Fab H:KT TRV & L:RM exhibited the greatest ECL signal for binding to DLL4 compared to other Fab antibodies tested.

The mutant Fabs above were further analyzed for binding to DLL4 by ELISA as described in Example 6 using 3-fold serial dilutions of Fab, starting at a concentration of 20 nM. The results are set forth in Table 97 below. Similar to the ECL results, Fab H:KT TRV & L:RM exhibited the greatest ELISA signal for binding to DLL4 compared to other mutant Fab antibodies tested.

TABLE 96
Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/G104T (KT)
& V3-4_IGLJ1*01 CDR3 combination mutants
Fab
Heavy Chain SEQ ID Light Chain SEQ ID ECL
VH5-51_IGHD5-18*01_IGHJ4*01 NO V3-4_IGLJ1*01 NO Signal
G100K/G104T 381 M94R/S96M 486 564
G100K/G104T S28R 411 M94R/S96M 486 530
G100K/G104T G24L/S28R/G35V 417 M94R/S96M 486 889
G100K/G104T G24T/S28R/G35V 430 M94R/S96M 486 17277
G100K/G104T G24A/S28R/G35V 431 M94R/S96M 486 1202

TABLE 97
Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ*01
mutant binding to DLL4 by ELISA
Heavy Chain
VH5-51_IGHD5- Light Chain
18*01>3_IGHJ4*01 V3-4_IGLJ*01 20 6.67 2.22 0.74
G100K/G104T parent 0.018 0.042 0.014 0.019
G100K/G104T S28R parent 0.009 0.003 0.000 0.000
G100K/G104T parent 0.027 0.005 0.000 0.006
G24L/S28R/G35V
G100K/G104T parent 0.054 0.023 0.000 0.002
G24T/S28R/G35V
G100K/G104T parent 0.054 0.025 0.002 0.008
G24A/S28R/G35V
G100K/G104T M94R/S96M 0.087 0.023 0.007 0.000
G100K/G104T 0.011 0.001 0.003 0.000
S28R M94R/S96M
G100K/G104T M94R/S96M 0.003 0.000 0.000 0.000
G24L/S28R/G35V
G100K/G104T M94R/S96M 0.122 0.062 0.028 0.006
G24T/S28R/G35V
G100K/G104T M94R/S96M 0.006 0.034 0.000 0.000
G24A/S28R/G35V

4. Alanine Scanning of CDR1 of Light Chain

Heavy chain KT double mutant (Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/G104T & V3-4_IGLJ*01) was used as a template for alanine scanning mutagenesis of CDR1 (amino acids 23-33) of the light chain to determine residues important for antibody binding to DLL4.

Purified Fab alanine mutants were tested for at a concentration of 100 nM for binding to DLL4 using the ECL multispot binding assay as described in Example 4A. The results are set forth in Table 98 below. Mutation of amino acid residues Y33, Y34 and P35 with alanine resulted in reduced binding to DLL4 as evidenced by the reduced ECL signal. Mutation of amino acid residues G23, L24, S25, S26, G27, S28, V29, S30, T31, and S32 with alanine either improved binding or did not affect binding to DLL4 as evidenced by an increased ECL signal or no change in ECL signal compared to the parent KT double mutant having no mutations in the light chain.

TABLE 98
Binding affinity of Fab VH5-51_IGHD5-18*01>3_IGHJ4*01
G100K/G104T (H:KT) & V3-4_IGLJ*01 light chain CDR1 and
CDR2 alanine mutants
Heavy Chain
VH5-51_IGHD5-
18*03_IGHJ4*01 Light Chain SEQ ID
(SEQ ID NO: 381) V3-4_IGLJ1*01 NO ECL Signal
G100K/G104T wildtype 108 9355
G100K/G104T L24A 487 9631
G100K/G104T S26A 488 11673
G100K/G104T G27A 489 10680
G100K/G104T S28A 490 11488
G100K/G104T V29A 491 9323
G100K/G104T S30A 492 10342
G100K/G104T T31A 493 13507
G100K/G104T S32A 494 10377
G100K/G104T Y33A 495 7705
G100K/G104T Y34A 496 2198
G100K/G104T P35A 497 8255
G100K/G104T S36A 498 9690
G100K/G104T G23A 499 13487
G100K/G104T S25A 500 10150

5. NNK Mutagenesis of Amino Acid Residue G23

Following alanine scanning mutagenesis of CDR1, the light chain amino acid residue G23 was selected for further NNK mutagenesis using the Fab H:KT & L:wt double mutant as a template. The ECL and ELISA signals are set forth in Table 99 below. Amino acid mutations designated with X (for any amino acid) did not show appreciable binding and therefore were not sequenced to identify the exact mutation.

TABLE 99
Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/G104T (H:KT) &
V3-4_IGLJ*01 CDR1 G23 NNK mutant binding data
Fab
Heavy Chain
VH5-51_IGHD5-
18*01>3_IGHJ4*01
G100K/G104T SEQ ID ECL ELISA
(SEQ ID NO: 381) Light Chain NO Signal Signal
G100K/G104T G23R 501 68243 0.11
G100K/G104T G23X 580 61919 0.10
G100K/G104T G23X 580 327 0.09
G100K/G104T G23X 580 68201 0.12
G100K/G104T G23X 580 384 0.09
G100K/G104T G23X 580 67230 0.11
G100K/G104T G23X 580 70515 0.09
G100K/G104T G23X 580 56769 0.10
G100K/G104T G23X 580 322 0.09
G100K/G104T G23L 502 67320 0.10
G100K/G104T G23L 502 67618 0.10
G100K/G104T G23X 580 66603 0.12
G100K/G104T G23X 580 62101 0.10
G100K/G104T G23X 580 50904 0.10
G100K/G104T G23X 580 61718 0.11
G100K/G104T G23X 580 67917 0.11
G100K/G104T G23X 580 414 0.09
G100K/G104T G23X 580 52864 0.10
G100K/G104T G23X 580 53493 0.10

6. Alanine Scanning of CDR2

Heavy chain KT double mutant (Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/G104T & V3-4_IGLJ*01) was used as a template for alanine scanning mutagenesis of CDR2 (amino acids 52-58) to determine residues important for antibody binding to DLL4.

Purified Fab alanine mutants were tested for binding to DLL4 using the ECL multispot binding assay as described in Example 4. The results are set forth in Table 100 below. Mutation of amino acid residues S52, T53, N54, T55, R56, S57 and S58 with alanine either improved binding or did not affect binding to DLL4 as evidenced by an increased ECL signal or no change in ECL signal compared to the parent KT double mutant having no mutations in the light chain.

TABLE 100
Binding affinity of Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/
G104T (H:KT) & V3-4_IGLJ*01 light chain CDR2 alanine mutants
Heavy Chain
VH5-51_IGHD5-
18*03_IGHJ4*01 Light Chain SEQ ID
(SEQ ID NO: 381) V3-4_IGLJ1*01 NO ECL Signal
G100K/G104T wildtype 108 9355
G100K/G104T S52A 503 15240
G100K/G104T T53A 504 13197
G100K/G104T N54A 505 12936
G100K/G104T T55A 506 12717
G100K/G104T R56A 507 16833
G100K/G104T S57A 508 12612
G100K/G104T S58A 509 12557
G100K/G104T R56A 507 13609

7. NNK Mutagenesis of Amino Acid Residues S52 and R56

Following alanine scanning mutagenesis of CDR2, light chain amino acid residues S52 and R56 were selected for further NNK mutagenesis using the heavy chain KT double mutant as a template. The ECL and ELISA signals are set forth in Table 101 below. Amino acid mutations designated with X (for any amino acid) did not show appreciable binding and therefore were not sequenced to identify the exact mutation. Light chain mutants S52G, R56Y/S, R56A and R56G exhibited increased binding to DLL4 as assessed by both ECL and ELISA.

Various Fabs, containing various combinations of mutations of the heavy chain and light chain, were further analyzed for binding to DLL4 by ELISA using 2-fold serial dilutions of Fab, starting at a concentration of 100 nM. The results are set forth in Table 102 below. Fab H:KT S28R & L:wt exhibited the greatest binding to DLL4 as evidenced by the ELISA signal compared to other Fab mutants tested.

TABLE 101
Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/G104T (KT) & V3-
4_IGLJ*01 CDR1 S52 and R56 NNK mutant binding data
Fab
Heavy Chain
VH5-51_IGHD5-
18*01>3_IGHJ4*01
G100K/G104T Light Chain SEQ ID ECL ELISA
(SEQ ID NO: 381) V3-4_IGLJ*01 NO Signal Signal
G100K/G104T S52X 581 64794 0.10
G100K/G104T S52X 581 58732 0.10
G100K/G104T S52C 511 64255 0.10
G100K/G104T S52X 581 84622 0.13
G100K/G104T S52X 581 78239 0.14
G100K/G104T S52X 581 62099 0.11
G100K/G104T S52X 581 76278 0.14
G100K/G104T S52X 581 84797 0.15
G100K/G104T S52G 510 85929 0.21
G100K/G104T S52G 510 86660 0.18
G100K/G104T S52X 581 81950 0.13
G100K/G104T S52X 581 79552 0.11
G100K/G104T S52X 581 84470 0.14
G100K/G104T S52X 581 356 0.09
G100K/G104T S52R 512 85879 0.15
G100K/G104T S52X 581 84017 0.16
G100K/G104T S52X 581 67861 0.14
G100K/G104T S52X 581 100221 0.17
G100K/G104T S52X 581 61304 0.12
G100K/G104T R56X 582 69586 0.13
G100K/G104T R56X 582 75844 0.15
G100K/G104T R56X 582 93607 0.13
G100K/G104T R56X 582 58626 0.11
G100K/G104T R56X 582 82996 0.14
G100K/G104T R56X 582 71685 0.12
G100K/G104T R56X 582 73639 0.11
G100K/G104T R56I 513 94265 0.13
G100K/G104T R56Y/S 583 95103 0.28
G100K/G104T R56X 582 367 0.09
G100K/G104T R56X 582 82747 0.26
G100K/G104T R56X 582 80011 0.16
G100K/G104T R56D 515 87363 0.19
G100K/G104T R56G 516 93708 0.19
G100K/G104T R56A 507 83853 0.27
G100K/G104T R56X 582 91910 0.15
G100K/G104T R56X 582 58466 0.11
G100K/G104T R56X 582 45685 0.11
G100K/G104T R56X 582 55229 0.12

TABLE 102
Fab VH5-51_IGHD5-18*01 > 3_IGHJ4*01 & V3-
4_IGLJ*01 mutant binding to DLL4 by ELISA
H
KT KT KT KT KT
G24L S28R G35V T58A T58D KT KT KT
L
Fab par- par- par- par- par-
[nM] ent ent ent ent ent S52G R56Y R56A
100 0.298 0.529 0.271 0.253 0.219 0.209 0.231 0.251
50 0.245 0.456 0.232 0.209 0.230 0.194 0.211 0.239
25 0.221 0.365 0.232 0.220 0.218 0.227 0.205 0.227
12.5 0.233 0.309 0.244 0.230 0.223 0.215 0.184 0.212
6.25 0.278 0.303 0.245 0.249 0.224 0.207 0.182 0.200
3.125 0.257 0.246 0.251 0.244 0.252 0.216 0.180 0.213
H—heavy chain
L—Light Chain

8. Mutagenesis of Framework 3 Amino Acid Residue T78

The KT heavy chain double mutant (Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/G104T (H:KT) & V3-4_IGLJ*01) was used as a template for further mutagenesis of amino acid residue T78 in the framework 3 region of the light chain. This residue was mutated using overlapping PCR with NNK mutagenesis. Table 103 sets forth the ECL signal for binding to DLL4. Mutation of amino acid residue T78 either improved binding or did not affect binding to DLL4 as evidenced by an increased ECL signal or no change in ECL signal compared to the parent KT double mutant having no mutations in the light chain. Two additional light chain double mutants G23A/N175K (in the constant region) and S52A/A116T (in the framework 4 region) also were generated and they exhibited improved binding for DLL4 compared to the KT double mutant template antibody as evidenced by an increased ECL signal.

TABLE 103
Binding affinity of Fab VH5-51_IGHD5-18*01>3_IGHJ4*01
G100K/G104T (H:KT) & V3-4_IGLJ*01 light chain mutants
Heavy Chain
VH5-51_IGHD5-
18*03_IGHJ4*01 Light Chain SEQ ID
(SEQ ID NO: 381) V3-4_IGLJ1*01 NO ECL Signal
G100K/G104T wildtype 108 9355
G100K/G104T T78S 518 7554
G100K/G104T T78E 519 10559
G100K/G104T T78Y/M 584 12364
G100K/G104T T78L 522 9554
G100K/G104T T78K 523 9620
G100K/G104T T78V 524 9833
G100K/G104T G23A, N175K 525 17828
G100K/G104T S25A, A116T 526 12178

9. Paired Mutants of Heavy Chain KT TRV

The SPR data (see Example 5 and Table 108) for Fabs H:KT TRV & V3-4_IGLJ1*01 and H:KT TRV & L:RM indicated that these Fabs have a short off-rate. Thus, in order to increase binding affinity of these antibodies, heavy chain H:KT TRV was paired with various V3-4_IGLJ1*01 light chain mutants and the binding affinity towards DLL4 was assayed by ELISA since the ELISA assay selects for long off-rates whereas the ECL assay detects equilibrium binding.

Purified Fab mutants were tested for binding to DLL4 using ELISA performed as described in Example 6 at a concentration of 100 nM Fab. The results for the ELISA assay are set forth in Table 104. Fabs containing light chain mutants V91A, T31A, S52A, T53A, S57A, V91L, S96G and S96P exhibited increased binding to DLL4 as compared to a Fab with parental light chain V3-4_IGLJ1*01 as evidenced by a greater ELISA signal-blank.

TABLE 104
Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/G104T G24T/S28R/G35V (H:KT
TRV) & V3-4_IGLJ1*01 light chain mutant binding data
Fab ELISA Signal-
Heavy Chain SEQ ID Light Chain SEQ ID blank
VH5-51_IGHD5-18*01_IGHJ4*01 NO V3-4_IGLJ1*01 NO (100 nM Fab)
G100K/G104T G24T/S28R/G35V 430 V91A 446 0.606
G100K/G104T G24T/S28R/G35V 430 L92A 447 0.186
G100K/G104T G24T/S28R/G35V 430 Y93A 448 0.185
G100K/G104T G24T/S28R/G35V 430 M94A 449 0.277
G100K/G104T G24T/S28R/G35V 430 G95A 450 0.216
G100K/G104T G24T/S28R/G35V 430 S96A 452 0.436
G100K/G104T G24T/S28R/G35V 430 G97A 451 0.129
G100K/G104T G24T/S28R/G35V 430 I98A 453 0.162
G100K/G104T G24T/S28R/G35V 430 S99A 454 0.300
G100K/G104T G24T/S28R/G35V 430 T78S 518 0.093
G100K/G104T G24T/S28R/G35V 430 T78E 519 0.217
G100K/G104T G24T/S28R/G35V 430 T78Y/M 584 0.459
G100K/G104T G24T/S28R/G35V 430 T78L 522 0.347
G100K/G104T G24T/S28R/G35V 430 T78K 523 0.480
G100K/G104T G24T/S28R/G35V 430 T78V 524 0.340
G100K/G104T G24T/S28R/G35V 430 G23A 499 0.405
G100K/G104T G24T/S28R/G35V 430 L24A 487 0.244
G100K/G104T G24T/S28R/G35V 430 S25A 500 0.483
G100K/G104T G24T/S28R/G35V 430 S26A 488 0.395
G100K/G104T G24T/S28R/G35V 430 G27A 489 0.398
G100K/G104T G24T/S28R/G35V 430 S28A 490 0.478
G100K/G104T G24T/S28R/G35V 430 V29A 491 0.394
G100K/G104T G24T/S28R/G35V 430 S30A 492 0.344
G100K/G104T G24T/S28R/G35V 430 T31A 493 0.552
G100K/G104T G24T/S28R/G35V 430 S32A 494 0.502
G100K/G104T G24T/S28R/G35V 430 Y33A 495 0.301
G100K/G104T G24T/S28R/G35V 430 Y34A 496 0.085
G100K/G104T G24T/S28R/G35V 430 P35A 497 0.236
G100K/G104T G24T/S28R/G35V 430 S36A 498 0.380
G100K/G104T G24T/S28R/G35V 430 S52A 503 0.574
G100K/G104T G24T/S28R/G35V 430 T53A 504 0.532
G100K/G104T G24T/S28R/G35V 430 N54A 505 0.318
G100K/G104T G24T/S28R/G35V 430 T55A 506 0.382
G100K/G104T G24T/S28R/G35V 430 R56A 507 0.442
G100K/G104T G24T/S28R/G35V 430 S57A 508 0.598
G100K/G104T G24T/S28R/G35V 430 S58A 509 0.451
G100K/G104T G24T/S28R/G35V 430 V91L 458 0.734
G100K/G104T G24T/S28R/G35V 430 V91P 455 0.078
G100K/G104T G24T/S28R/G35V 430 V91T 456 0.197
G100K/G104T G24T/S28R/G35V 430 V91S 457 0.264
G100K/G104T G24T/S28R/G35V 430 V91R 459 0.025
G100K/G104T G24T/S28R/G35V 430 V91A 446 0.529
G100K/G104T G24T/S28R/G35V 430 Parent 108 0.393
G100K/G104T G24T/S28R/G35V 430 V91C 460 0.625
G100K/G104T G24T/S28R/G35V 430 V91E 461 0.152
G100K/G104T G24T/S28R/G35V 430 V91W 462 0.080
G100K/G104T G24T/S28R/G35V 430 V91N 463 0.203
G100K/G104T G24T/S28R/G35V 430 V91I 464 0.336
G100K/G104T G24T/S28R/G35V 430 V91G 465 0.248
G100K/G104T G24T/S28R/G35V 430 V91H 466 0.127
G100K/G104T G24T/S28R/G35V 430 M94T 476 0.395
G100K/G104T G24T/S28R/G35V 430 M94E 467 0.171
G100K/G104T G24T/S28R/G35V 430 M94S 468 0.195
G100K/G104T G24T/S28R/G35V 430 M94G 469 0.199
G100K/G104T G24T/S28R/G35V 430 M94L 470 0.388
G100K/G104T G24T/S28R/G35V 430 M94P 471 0.256
G100K/G104T G24T/S28R/G35V 430 M94V 472 0.315
G100K/G104T G24T/S28R/G35V 430 M94D 473 0.070
G100K/G104T G24T/S28R/G35V 430 M94R 474 0.197
G100K/G104T G24T/S28R/G35V 430 M94N 475 0.205
G100K/G104T G24T/S28R/G35V 430 M94F 477 0.317
G100K/G104T G24T/S28R/G35V 430 M94A 449 0.216
G100K/G104T G24T/S28R/G35V 430 S96W 478 0.261
G100K/G104T G24T/S28R/G35V 430 S96G 479 0.562
G100K/G104T G24T/S28R/G35V 430 S96P 480 0.813
G100K/G104T G24T/S28R/G35V 430 S96A/E 579 0.538
G100K/G104T G24T/S28R/G35V 430 S96R 481 0.499
G100K/G104T G24T/S28R/G35V 430 S96L 482 0.355
G100K/G104T G24T/S28R/G35V 430 S96M 483 0.358
G100K/G104T G24T/S28R/G35V 430 S96E 484 0.439
G100K/G104T G24T/S28R/G35V 430 Parent 108 0.437
G100K/G104T G24T/S28R/G35V 430 S96V 485 0.452
G100K/G104T G24T/S28R/G35V 430 Parent 108 0.455
G100K/G104T G24T/S28R/G35V 430 Parent 108 0.430

10. Cassette Mutagenesis Using Type II Restriction Enzyme Ligatioin of Amino Acid Residues S52, T53 and S57

Following analysis of paired Fab mutants of heavy chain H:KT TRV, light chain double mutant V3-4_IGLJ1*01 V91L/S96P (L:LP) was generated. Three additional light chain amino acid residues (S52, T53 and S57) that exhibited increased binding to DLL4 by ELISA (see Table 103 above) were selected for further mutagenesis using type II restriction enzyme ligation using Fab H: KT TRV & L:LP as a template. The ELISA signals are set forth in Table 105 below. Light chain mutants L:LP S52G, L:LP S52 M, L:LP S52N and L:LP S52H exhibited increased binding to DLL4 as assessed by ELISA.

Four Fabs, containing various combinations of mutations of the heavy chain and light chain, were further analyzed for binding to DLL4 by ELISA using 3-fold serial dilutions of Fab, starting at a concentration of 100 nM. The results are set forth in Table 106 below. Fab H:KT TRV & L:LP S52G exhibited the greatest binding to DLL4 as evidenced by the ELISA signal compared to other Fab mutants tested.

TABLE 105
Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 G100K/G104T G24T/S28R/G35V (H:KT
TRV) & V3-4_IGLJ1*01 V91L/S96P (L:LP) light chain mutant binding data
Fab ELISA Signal-
Heavy Chain SEQ ID Light Chain SEQ ID blank
VH5-51_IGHD5-18*01_IGHJ4*01 NO V3-4_IGLJ1*01 NO (100 nM Fab)
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S52F 527 0.33
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S52L 528 0.40
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S52I 529 0.42
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S52M 530 0.46
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S52V 531 0.44
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S52P 532 0.32
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S52T 533 0.34
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S52Y 534 0.41
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S52H 535 0.44
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S52Q 536 0.39
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S52N 537 0.45
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S52K 538 0.32
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S52D 539 0.39
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S52E 540 0.38
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S52W 541 0.29
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S52G 543 0.53
G100K/G104T G24T/S28R/G35V 430 V91L/S96P 544 0.39
G100K/G104T G24T/S28R/G35V 430 V91L/S96P T53F 545 0.15
G100K/G104T G24T/S28R/G35V 430 V91L/S96P T53L 546 0.18
G100K/G104T G24T/S28R/G35V 430 V91L/S96P T53I 547 0.30
G100K/G104T G24T/S28R/G35V 430 V91L/S96P T53M 548 0.01
G100K/G104T G24T/S28R/G35V 430 V91L/S96P T53V 549 0.29
G100K/G104T G24T/S28R/G35V 430 V91L/S96P T53S 550 0.18
G100K/G104T G24T/S28R/G35V 430 V91L/S96P T53P 551 0.39
G100K/G104T G24T/S28R/G35V 430 V91L/S96P T53Y 552 0.22
G100K/G104T G24T/S28R/G35V 430 V91L/S96P T53H 553 0.14
G100K/G104T G24T/S28R/G35V 430 V91L/S96P T53Q 554 0.11
G100K/G104T G24T/S28R/G35V 430 V91L/S96P T53N 555 0.15
G100K/G104T G24T/S28R/G35V 430 V91L/S96P T53K 556 0.12
G100K/G104T G24T/S28R/G35V 430 V91L/S96P T53D 557 0.16
G100K/G104T G24T/S28R/G35V 430 V91L/S96P T53E 558 0.09
G100K/G104T G24T/S28R/G35V 430 V91L/S96P T53W 559 0.06
G100K/G104T G24T/S28R/G35V 430 V91L/S96P T53R 560 0.05
G100K/G104T G24T/S28R/G35V 430 V91L/S96P T53G 561 0.08
G100K/G104T G24T/S28R/G35V 430 V91L/S96P 544 0.30
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S57F 562 0.10
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S57L 563 0.30
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S57I 564 0.24
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S57M 565 0.30
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S57V 566 0.34
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S57P 567 0.36
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S57T 568 0.30
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S57Y 569 0.28
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S57H 570 0.21
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S57Q 571 0.21
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S57N 572 0.24
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S57K 573 0.17
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S57D 574 0.17
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S57E 575 0.20
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S57W 576 0.12
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S57R 577 0.18
G100K/G104T G24T/S28R/G35V 430 V91L/S96P S57G 578 0.23
G100K/G104T G24T/S28R/G35V 430 V91L/S96P 544 0.29

TABLE 106
Binding affinity of Fab VH5-51_IGHD5-18*01>3_IGHJ4*01
G100K/G104T G24T/S28R/G35V (H:KT TRV) & V3-4_IGLJ1*01
light chain mutants
V91L/S96P V91L/S96P
Wildtype V91L/S96P S52M S52G
(SEQ ID (SEQ ID (SEQ ID (SEQ ID
Light Chain NO: 108) NO: 544) NO: 530) NO: 543)
Fab [μM] Signal Signal Signal Signal
100 0.16 0.34 0.24 0.69
33.33 0.08 0.19 0.12 0.35
11.11 0.04 0.07 0.06 0.17
3.70 0.03 0.03 0.03 0.06
1.23 0.01 0.03 0.03 0.03
0.41 0.01 0.02 0.03 0.01
0.14 0.00 0.03 0.02 0.02
0.05 0.01 0.02 0.02 0.02

11. Paired Fab Mutants

Twenty four mutant Fabs, containing various combinations of mutations of the heavy chain and light chain, were further analyzed for binding to DLL4 by ELISA using 2-fold serial dilutions of Fab, starting at a concentration of 100 nM. The results are set forth in Table 107 below. Fabs H:KT TRV & L:LP S52K and H:KT TRV & L:LP S52G exhibited the greatest binding affinity to DLL4 as evidenced by the ELISA signal compared to other Fab mutants tested. Fabs H:KT TRV & L:LP S52H and H:KT TRV & L:LP S52N had slightly reduced binding affinity to DLL4 as compared to Fabs H:KT TRV & L:LP S52K and H:KT TRV & L:LP S52G.

TABLE 107
Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ*01 mutant binding to DLL4
by ELISA
Heavy Chain Light Chain
VH5-51_IGHD5-18*01>3_IGHJ4*01 V3-4_IGLJ*01 100 50 25 12.5
G100K/G104T G24L/S28R/G35V Y105H Wildtype 0.23 0.20 0.19 0.21
(SEQ ID NO: 432)
G100K/G104T G24T/S28R/G35V Y105N Wildtype 0.25 0.18 0.19 0.21
(SEQ ID NO: 433)
G100K/G104T G24A/S28R/G35V Y107F Wildtype 0.28 0.24 0.20 0.21
(SEQ ID NO: 434)
G100K/G104T G24L/S28R/G35V D109Q Wildtype 0.30 0.25 0.22 0.24
(SEQ ID NO: 435)
G100K/G104T G24T/S28R/G35V V91L/S96P 1.00 0.81 0.58 0.45
G100K Wildtype 0.20 0.19 0.18 0.19
Wildtype Wildtype 0.17 0.16 0.18 0.17
G104T Wildtype 0.17 0.17 0.18 0.19
G100K/G104T Wildtype 0.18 0.18 0.16 0.18
G100K/G104T G24T/S28R/G35V Wildtype 0.45 0.32 0.26 0.23
G100K/G104T S28R Wildtype 0.26 0.23 0.20 0.18
G100K/G104T G24A/S28R/G35V V91L/S96P S52V 0.95 0.74 0.60 0.43
G100K/G104T G24L/S28R/G35V V91L/S96P S52F 0.99 0.69 0.49 0.42
G100K/G104T G24T/S28R/G35V V91L/S96P S52L 1.02 0.78 0.58 0.43
G100K/G104T G24A/S28R/G35V V91L/S96P S52I 1.04 0.82 0.60 0.40
G100K/G104T G24L/S28R/G35V V91L/S96P S52M 1.01 0.80 0.59 0.41
G100K/G104T G24T/S28R/G35V V91L/S96P S52G 1.14 1.02 0.90 0.63
G100K/G104T G24A/S28R/G35V V91L/S96P S52P 1.00 0.79 0.59 0.43
G100K/G104T G24L/S28R/G35V V91L/S96P S52T 0.99 0.79 0.62 0.41
G100K/G104T G24T/S28R/G35V V91L/S96P S52Y 0.90 0.72 0.56 0.41
G100K/G104T G24A/S28R/G35V V91L/S96P S52H 1.09 0.91 0.73 0.50
G100K/G104T G24L/S28R/G35V V91L/S96P S52Q 0.96 0.81 0.67 0.47
G100K/G104T G24T/S28R/G35V V91L/S96P S52N 1.05 0.90 0.86 0.65
G100K/G104T G24T/S28R/G35V V91L/S96P S52K 1.23 1.03 0.79 0.56

Summary

As a result of affinity maturation, the affinity of parental Hit Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01 for binding to DLL4 was increased 130-fold (see SPR data in Table 108 below). Parental Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01 binds DLL4 with a KD of 4.8 μM. Heavy chain mutant Fab H:KT & L:wt has 13-fold increased affinity for DLL4 (KD=355 nM). Affinity matured heavy and light chain mutant Fab H:KT TRV & L:wt has a KD of 36.2 nM, a 130-fold increase in binding affinity for DLL4. Affinity matured heavy and light chain mutant Fabs H:KT TRV & L:LP and H:KT TRV & L:LP S52G have a KD of 3.3 and 5.0 nM, respectively, a 1000-fold increase in binding affinity for DLL4.

TABLE 108
Binding affinity of VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01 DLL4
mutant Fabs by Surface Plasmon Resonance
ka (×105) kd (×10−3) KD
Heavy Chain Light Chain (M−1s−1) (s−1) (nM)
VH5-51_IGHD5-18*01>3_IGHJ4*01 V3-4_IGLJ1*01 n/a n/a 4800   
(parental) (parental) (±200)   
VH5-51_IGHD5-18*01>3_IGHJ4*01 V3-4_IGLJ1*01 0.645 0.023 355  
G100K/G104T (KT) (±0.092) (±0.004) (±7)  
VH5-51_IGHD5-18*01>3_IGHJ4*01 V3-4_IGLJ1*01 7.4 0.0845 114  
G100K/G104T S28R (KT S28R) (±0.6) (±0.0050) (±6)  
VH5-51_IGHD5-18*01>3_IGHJ4*01 V3-4_IGLJ1*01 20.90 0.0717 36.2
G100K/G104T G24T/S28R/G35V (±6.24) (±0.00351) (±8.5)
(KT TRV)
VH5-51_IGHD5-18*01>3_IGHJ4*01 V3-4_IGLJ1*01 25.30 0.101 40.3
G100K/G104T G24T/S28R/G35V M94R/S96M (RM) (±4.16) (±0.0153) (±9.3)
(KT TRV)
VH5-51_IGHD5-18*01>3_IGHJ4*01 V3-4_IGLJ1*01 110 36  3.3
G100K/G104T G24T/S28R/G35V V91L/S96P
(KT TRV) (LP)
VH5-51_IGHD5-18*01>3_IGHJ4*01 V3-4_IGLJ1*01 29.6 14.7  5.0
G100K/G104T G24T/S28R/G35V V91L/S96P S52G
(KT TRV) (LP S52G)

Example 13

Germline Segment Swapping

In this example, two antibody “Hit” Fabs against DLL4, identified in Example 4 using the Multispot ECL binding assay, were subjected to mutagenesis by J-swapping or D-swapping of the JH or DH germline segments, respectively. J-swapping involves substitution of the parent “Hit” Fab JH germline segment with a different JH germline segment. D-swapping involves substitution of the parent “Hit” DH germline segment with a different DH germline segment. Since the DH germline segment constitutes the 5′ end of the heavy chain CDR3 and JH segment constitutes the 3′ end of the heavy chain CDR3, D-swapping and J-swapping allow for facile mutagenesis of this important antibody binding region.

A. Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01

For Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01, J-swapping of IGHJ1*01 with IGHJ2*01, IGHJ4*01, and IGHJ5*01 allowed analysis of the 3′ end of CDR3 from amino acid residues A106 to H111 (see FIG. 4A). Purified Fab J-swapped mutants were tested for binding to DLL4 using the ECL assay as described in Example 4. The results are set forth in Tables 109-110 below. The results show that swapping of IGHJ1*01 with either IGHJ2*01, IGHJ4*01, or IGHJ5*01 reduced binding of the antibody to DLL4 as assessed by a decreased ECL signal compared to the parent template antibody containing the IGHJ1*01 JH germline segment.

TABLE 109
Fab VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 J-swap binding
data
Sig-
nal/
SEQ SEQ Noise
ID ID (0.04
Heavy Chain NO Light Chain NO μM)
VH1-46_IGHD6-6*01_IGHJ2*01 585 L6_IGKJ1*01 107 0.8
wildtype 88 L6_IGKJ1*01 107 1.7
VH1-46_IGHD6-6*01_IGHJ4*01 586 L6_IGKJ1*01 107 0.8
VH1-46_IGHD6-6*01_IGHJ5*01 587 L6_IGKJ1*01 107 0.8

TABLE 110
Fab VH1-46 _IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 J-swap mutant
binding data
0.02 μM Fab 0.004 μM Fab
30 μg/mL DLL4 15 μg/mL DLL4
Fab ECL Signal/ ECL Signal/
Heavy Chain Light Chain Signal Noise Signal Noise
IGHJ2*01 L6_IGKJ1*01 232 0.6 185 1.3
wildtype L6_IGKJ1*01 8714 23.0 4261 29.2
IGHJ4*01 L6_IGKJ1*01 203 0.5 178 1.2
IGHJ5*01 L6_IGKJ1*01 244 0.6 137 0.9

B. Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ*01

For Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ*01, J-swapping of IGHJ4*01 with IGHJ1*01, IGHJ3*01, and IGHJ5*01 allowed analysis of the 3′ end of CDR3 from amino acid residues 106-110 (see FIG. 4B). D-swapping of IGHD5-18*01 with IGHD5-12*01 and IGHD5-24*01 allowed analysis of the 5′ end of CDR3 from amino acid residues 100-104 (see FIG. 4C). Purified J-swapped and D-swapped mutants were tested for binding to DLL4 using the ECL assay as described in Example 4. The ECL results for binding to DLL4 are set forth in Tables 111-112 below. The results show that swapping of IGHJ4*01 with either IGHJ1*01, IGHJ3*01, or IGHJ5*01 reduced binding of the antibody to DLL4 as assessed by a decreased ECL signal compared to the parent template antibody containing the IGHJ4*01 JH germline segment. Additionally, swapping of IGHD5-18*01 with IGHD5-12*01 or IGHD5-24*01 reduced binding of the antibody to DLL4 as assessed by a decreased ECL signal compared to the parent template antibody containing the IGHD5-18*01 DH germline segment.

TABLE 111
Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ*01
D-swap and J-swap mutant binding data
Heavy Chain SEQ SEQ Signal/
VH5-51_IGHD5- ID ID Noise
18*01>3_IGHJ4*01 NO Light Chain NO (0.04 μM)
IGHJ1*01 588 V3-4_IGLJ1*01 108 1.2
wildtype 89 V3-4_IGLJ1*01 108 14.7
IGHJ3*01 589 V3-4_IGLJ1*01 108 3.1
IGHJ5*01 590 V3-4_IGLJ1*01 108 1.2
IGHD5-12*01 591 V3-4_IGLJ1*01 108 1.2
IGHD5-24*01 592 V3-4_IGLJ1*01 108 1.3
wildtype 89 V3-4_IGLJ1*01 108 15.5

TABLE 112
Fab VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ*01
D-swap and J-swap mutant binding data
0.1 μM 0.02 μM
Fab Fab
Fab 30 μg/mL 15 μg/mL
Heavy Chain SEQ Light Chain DLL4 DLL4
VH5-51_IGHD5- ID (SEQ ID Signal/ Signal/
18*01_IGHJ4*01 NO NO: 108) Noise Noise
IGHJ1*01 588 V3-4_IGLJ1*01 1.0 1.1
wildtype 89 V3-4_IGLJ1*01 24.0 15.2
IGHJ3*01 589 V3-4_IGLJ1*01 7.9 3.5
IGHJ5*01 590 V3-4_IGLJ1*01 1.0 0.9
IGHD5-12*01 591 V3-4_IGLJ1*01 1.1 1.2
IGHD5-24*01 592 V3-4_IGLJ1*01 1.7 1.0

Example 14

Affinity Maturation of Fab VH3-23_IGHD2-21*01>3_IGHJ6*01 & V2-13_IGLJ2*01 Against Hepatocyte Growth Factor Receptor

Fab VH3-23_IGHD2-21*01>3_IGHJ6*01 & V2-13_IGLJ2*01 (SEQ ID NOS:2803 and 594) against hepatocyte growth factor receptor (HGFR; C-Met) identified using the electroluminescence Meso Scale Discovery (MSD) multispot binding assay, was subjected to affinity maturation as described above in Examples 7-9. Mutations of amino acid residues were carried out by ligation of oligo pairs using method described in Example 1C.

i. Identification of the CDR Potential Binding Site

The amino acid sequence of the heavy chain (SEQ ID NO:2803) for the parent “Hit” VH3-23_IGHD2-21*01>3_IGHJ6*01 & V2-13_IGLJ2*01 was aligned with the amino acid sequences of three heavy chains (SEQ ID NOS:2797, 2799 and 2801) of three related “Hits” that also bind HGFR, albeit with slightly reduced affinity. These four Fabs share the same VH and JH germline segments. The sequence alignment is set forth in FIG. 5. Based on the alignment, amino acid residues were identified that differed between the “Hit” and the related “Hits”, thus accounting for differences in binding of the “Hit” and related “Hits” for HGFR. The identified amino acid residues were located in CDR3, which was identified as the region of the heavy chain that is important for binding affinity.

ii. Alanine Scanning of Heavy Chain CDR3

CDR3 of the heavy chain sequence of parent Fab VH3-23_IGHD2-21*01>3_IGHJ6*01 & V2-13_IGLJ2*01 (SEQ ID NOS:2803 and 594) was subjected to alanine scanning mutagenesis and analyzed using the ECL multispot assay using 100 nM Fab. The results are set forth in Table 113 below. Mutation of amino acid residues E99, V102, V103, V104, and I105 with alanine and A106 with threonine caused a significant reduction in binding to HGFR as assessed by a decreased ECL signal. Mutation of H100, I101, I107, and S108 with alanine slightly reduced binding to HGFR as assessed by a decreased ECL signal.

TABLE 113
Binding of Fab VH3-23_IGHD2-21*01 > 3_IGHJ6*01
& V2-13_IGLJ2*01 CDR3 alanine mutants to HGFR
SEQ
ID NO ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R DLL4
Wt 2803 2.4 2.8 18.5 1.7 1.6 0.9 12.7 16.5 1.3
E99A 595 2.5 2.3 5.8 1.9 1.4 1.1 9.7 11.6 1.4
H100A 596 1.3 1.8 14.1 1.0 1.0 1.0 4.8 7.2 2.2
I101A 597 2.8 3.0 14.8 1.7 1.2 1.1 23.2 26.6 1.5
V102A 598 1.4 1.4 5.3 1.0 1.0 1.0 4.9 8.3 1.4
V103A 599 0.9 1.1 2.2 0.8 0.7 0.9 3.9 6.2 1.0
V104A 600 1.3 1.4 2.3 1.3 1.1 1.1 2.6 5.3 1.4
I105A 601 1.0 1.1 1.1 1.2 0.9 1.1 1.2 5.5 1.1
A106T 602 1.3 1.4 6.9 1.5 1.3 1.4 2.3 3.2 1.9
I107A 603 4.8 4.3 13.7 2.7 1.5 1.1 19.6 43.6 3.6
S108A 604 1.9 2.0 12.9 1.5 1.3 1.2 4.8 9.5 2.3

iii. NNK Mutagenesis of Y113

Amino acid residue Y113 of the heavy chain sequence of Fab VH3-23_IGHD2-21*01>3_IGHJ6*01 H100E/S108P(H:EP) & V2-13_IGLJ2*01 (SEQ ID NOS:593 and 594) was subjected to NNK mutagenesis and analyzed using the ECL multispot assay using 20 nM Fab. The results are set forth in Table 114 below. EP mutants Y113G, Y113I, Y113S, Y113T, Y113N, Y113N and Y113W had increased binding to HGFR as compared to heavy chain EP as evidenced by an increase in ECL signal.

TABLE 114
Binding of Fab VH3-23_IGHD2-21*01 > 3_IGHJ6*01 H100E/S108P
(EP) & V2-13_IGLJ2*01 mutants to HGFR
SEQ
ID NO ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R DLL4
Parent 593 4.1 4.2 33.4 2.1 1.8 1.6 20.6 39.4 2.3
Y113G 605 11.7 8.4 104.6 2.3 1.7 1.7 27.5 126.1 2.3
Y113I 606 40.7 17.8 178.9 5.5 3.7 3.3 58.6 116.5 5.0
Y113S 607 19.1 9.2 133.1 3.3 2.3 1.8 41.0 142.2 3.0
Y113P 608 1.6 1.4 13.0 1.4 1.1 1.4 2.3 2.1 1.6
Y113T 609 35.4 18.9 185.0 6.1 4.1 3.1 65.9 174.4 5.5
Y113H 610 6.3 3.6 107.1 1.7 1.4 1.5 16.0 55.9 2.0
Y113N 611 28.4 11.0 122.6 4.3 2.4 1.6 38.5 114.2 3.1
Y113E 612 50.6 20.0 48.6 7.3 3.9 3.4 41.8 142.0 5.3
Y113W 613 21.8 11.7 130.8 4.2 3.9 1.9 44.3 169.8 3.3
Y113R 614 48.4 19.3 76.4 9.4 6.5 3.4 56.3 183.2 4.6

iv. NNK Mutagenesis of Y109, Y110, Y111, Y112 and Y114

Amino acid residues Y109, Y110, Y111, Y112 and Y114 of the heavy chain sequence of Fab VH3-23_IGHD2-21*01>3_IGHJ6*01 H100E/S108P/Y113G (EPG) & V2-13_IGLJ2*01 (SEQ ID NOS:605 and 594) were subjected to NNK mutagenesis and analyzed using the ECL multispot assay using 20 nM Fab. The results are set forth in Table 115 below. Mutation of EPG heavy chain residue Y110 to isoleucine resulted in increased binding to HGFR as evidenced by an increased ECL signal as compared to heavy chain EPG. EPG mutants Y109W, Y112, Y112T and Y112W had slightly increased binding to HGFR as compared to heavy chain EPG as evidenced by a slight increase in ECL signal.

TABLE 115
Binding of Fab VH3-23_IGHD2-21*01 > 3_IGHJ6*01 H100E/S108P/Y113G
(EPG) & V2-13_IGLJ2*01 Y109, Y110, Y111, Y112, and Y114 mutants to HGFR
SEQ
ID NO ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R DLL4
Parent 2803 4.1 4.2 33.4 2.1 1.8 1.6 20.6 39.4 2.3
EPG 605 11.7 8.4 104.6 2.3 1.7 1.7 27.5 126.1 2.3
Y109L 615 2.1 2.2 52.9 1.9 1.6 1.7 4.0 22.1 2.0
Y109P 616 1.5 1.6 1.8 1.1 1.1 1.4 1.9 1.8 1.6
Y109T 617 1.7 1.4 16.0 1.7 1.1 1.3 2.1 6.0 1.5
Y109H 618 1.7 1.4 27.7 1.2 1.1 1.2 3.9 18.3 1.4
Y109Q 619 1.3 1.7 14.7 1.3 1.3 1.1 2.2 3.1 1.2
Y109D 620 1.3 1.4 2.9 1.3 1.0 1.4 1.8 2.0 1.4
Y109W 621 16.1 11.1 125.3 4.4 2.4 1.5 32.0 168.8 4.3
Y109R 622 2.0 1.8 39.6 1.4 1.0 1.3 7.4 30.1 1.5
Y109G 623 1.4 2.0 8.7 1.5 1.5 1.6 2.7 11.1 1.9
Y110I 624 11.4 8.6 163.2 2.5 1.7 1.4 39.0 73.7 2.0
Y110S 625 1.0 1.3 13.1 0.8 1.0 1.1 1.9 4.5 1.2
Y110P 626 0.9 1.1 4.8 1.1 1.2 1.2 1.7 2.9 1.4
Y110T 627 0.8 1.8 21.1 2.3 1.6 1.8 1.0 3.5 1.8
Y110H 628 2.2 1.7 8.8 1.4 1.4 1.3 2.9 3.7 1.9
Y110N 629 1.2 0.9 2.3 1.3 0.8 0.9 1.2 1.6 1.2
Y110E 630 1.7 1.6 1.8 1.5 1.3 1.4 2.0 2.2 1.8
Y110W 631 16.5 7.6 110.2 3.2 2.1 2.3 38.8 116.8 3.9
Y110R 632 2.1 1.6 3.9 1.6 1.3 1.4 3.3 4.8 1.8
Y110G 633 1.3 1.5 1.0 1.6 1.0 1.4 0.8 2.0 1.3
Y111I 634 1.7 1.9 10.2 1.8 1.3 1.0 1.9 6.9 1.5
Y111S 635 2.1 1.8 23.9 1.9 1.2 1.3 5.0 30.1 1.7
Y111P 636 1.6 1.5 1.7 1.6 1.3 1.2 1.3 1.9 1.4
Y111T 637 2.6 2.6 42.0 2.0 1.8 1.2 6.2 38.8 2.2
Y111H 638 3.0 2.9 37.5 1.5 1.3 1.2 7.7 49.8 1.6
Y111N 639 1.5 1.4 17.0 1.3 0.9 0.8 2.9 9.3 1.1
Y111E 640 1.5 1.4 2.2 1.5 1.1 1.4 2.3 2.9 1.5
Y111W 641 26.5 16.3 121.4 5.3 3.4 1.4 49.2 195.3 2.8
Y111R 642 3.3 2.6 24.3 2.3 1.4 1.3 15.7 22.6 1.4
Y111G 643 2.2 1.5 18.8 1.9 1.3 1.1 5.0 10.0 1.7
Y112I 644 25.0 21.5 126.2 10.4 6.5 2.1 43.1 81.7 3.7
Y112S 645 3.5 2.3 67.9 2.3 1.5 1.3 7.1 31.0 1.7
Y112P 646 2.3 1.8 41.8 1.4 1.1 1.1 5.0 32.2 1.5
Y112T 647 8.8 8.4 137.6 2.1 1.8 1.2 25.5 90.9 1.7
Y112H 648 3.4 2.7 86.6 1.8 1.4 1.7 9.7 40.6 1.8
Y112N 649 1.2 1.3 29.5 0.8 0.9 1.1 1.9 4.2 1.3
Y112E 650 1.4 1.5 7.3 1.2 1.1 1.2 2.0 4.7 1.3
Y112W 651 25.5 18.7 127.0 9.2 5.8 2.1 50.5 156.8 3.2
Y112R 652 5.9 3.7 120.5 2.7 1.6 1.5 30.0 85.1 2.6
Y112G 653 1.4 1.7 10.0 2.1 1.2 1.0 2.3 7.9 1.3
Y114I 654 11.4 7.1 82.2 2.6 1.8 1.4 22.6 161.8 2.4
Y114S 655 8.7 5.0 48.9 2.9 1.4 1.3 15.8 68.5 2.2
Y114P 656 1.4 1.2 2.7 1.4 1.1 0.9 1.3 2.3 1.1
Y114T 657 1.4 1.3 1.8 1.8 1.1 1.1 1.7 2.0 1.6
Y114H 658 12.5 8.7 67.5 3.3 1.8 1.4 27.0 119.7 2.3
Y114N 659 3.5 2.6 23.1 2.0 1.2 1.2 5.9 35.0 1.6
Y114E 660 7.4 6.8 18.2 3.3 1.5 1.5 13.9 69.2 2.2
Y114W 661 9.3 6.6 56.7 2.2 1.6 1.1 16.7 51.5 1.9
Y114R 662 6.4 4.3 70.4 2.0 1.4 1.1 15.6 61.8 1.9
Y114G 663 3.2 2.1 14.7 1.6 1.2 1.2 6.4 15.8 1.7

v. Alanine Scanning of Heavy Chain CDR1

CDR1 of the heavy chain sequence of Fab VH3-23_IGHD2-21*01>3_IGHJ6*01 H100E/S108P/Y113G (H:EPG) & V2-13_IGLJ2*01 (SEQ ID NOS:605 and 594) was subjected to alanine scanning mutagenesis and analyzed using the ECL multispot assay using 20 nM Fab. The results are set forth in Table 116 below. Mutation of amino acid residues F27 and A33 with alanine resulted in reduced binding to HGFR as evidenced by a reduced ECL signal. Mutation of amino acid residues G26, T28, F29, S30, S31, Y32, M34, and S35 with alanine either improved binding or did not affect binding to HGFR as evidenced by an increased ECL signal or no change in ECL signal compared to the EPG triple mutant having no mutations in the light chain.

TABLE 116
Binding of Fab VH3-23_IGHD2-21*01 > 3_IGHJ6*01 H100E/S108P/Y113G
(H: EPG) & V2-13_IGLJ2*01 CDR1 alanine mutants to HGFR
SEQ
ID NO ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R DLL4
G26A 664 12.1 7.5 110.9 2.3 2.0 1.6 29.4 161.3 2.7
F27A 665 6.1 3.6 87.3 1.4 1.3 1.1 14.8 64.2 1.7
T28A 666 13.3 8.7 140.3 2.2 1.8 1.3 32.6 180.5 2.2
F29A 667 11.6 8.1 120.5 2.4 1.5 1.4 32.7 157.6 2.5
S30A 668 11.4 8.9 118.3 2.4 1.7 1.3 26.8 153.7 2.0
S31A 669 12.4 9.1 121.2 2.1 1.7 1.3 32.4 143.5 4.3
Y32A 670 5.8 4.1 104.7 1.9 1.4 1.6 14.7 65.8 2.3
A33T 671 6.3 5.3 35.7 1.7 1.2 1.1 25.9 114.3 1.8
M34A 672 12.0 9.8 129.2 2.5 1.9 1.3 32.2 197.6 2.6
S35A 673 12.0 8.3 108.5 2.6 1.8 1.3 32.4 184.4 2.4
Parent 2803 4.1 4.2 33.4 2.1 1.8 1.6 20.6 39.4 2.3
EPG 605 11.7 8.4 104.6 2.3 1.7 1.7 27.5 126.1 2.3

vi. Alanine Scanning of Heavy Chain CDR2

CDR2 of the heavy chain sequence of Fab VH3-23_IGHD2-21*01>3_IGHJ6*01 H100E/S108P/Y113G (H:EPG) & V2-13_IGLJ2*01 (SEQ ID NOS:605 and 594) was subjected to alanine scanning mutagenesis and analyzed using the ECL multispot assay using 20 nM Fab. The results are set forth in Table 117 below. Mutation of amino acid residues I51, G56, Y59, and A61 with alanine resulted in reduced binding to HGFR as evidenced by a reduced ECL signal. Double mutant S46A/G47A had reduced binding to HGFR as evidenced by a reduced ECL signal. Mutation of amino acid residues G53, S54 G55, S57, T58, Y60, D62, V64 and K65 with alanine either improved binding or did not affect binding to HGFR as evidenced by an increased ECL signal or no change in ECL signal compared to the H:EPG triple mutant having no mutations in the light chain.

TABLE 117
Binding of Fab VH3-23_IGHD2-21*01 > 3_IGHJ6*01 H100E/S108P (H:
EP) or H100E/S108P/Y113G (H: EPG) & V2-13_IGLJ2*01 CDR2 alanine mutants to HGFR
SEQ
ID NO ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R DLL4
Parent 2803 4.1 4.2 33.4 2.1 1.8 1.6 20.6 39.4 2.3
EPG 605 11.7 8.4 104.6 2.3 1.7 1.7 27.5 126.1 2.3
I51A 674 9.4 5.3 77.4 2.8 1.6 1.3 20.3 112.6 2.2
S52A/G53A 675 8.3 5.2 85.0 2.2 1.5 1.4 16.7 75.6 2.3
G53A 676 16.7 10.9 159.2 3.9 2.5 1.8 36.5 222.6 3.1
S54A 677 15.1 8.9 115.2 2.8 1.9 1.3 33.4 160.7 2.4
G55A 678 11.1 7.7 111.3 2.5 1.7 1.3 26.9 143.0 2.1
G56A 679 9.5 6.8 79.4 2.7 1.6 1.4 23.6 100.0 2.3
S57A 680 12.9 8.7 124.0 3.4 1.8 1.7 33.0 150.8 2.5
T58A 681 15.9 9.6 167.0 3.1 1.5 1.2 36.9 158.1 2.3
Y59A 682 1.6 1.4 3.3 2.1 1.4 1.3 2.4 2.5 2.8
Y60A 683 11.5 6.2 112.7 2.6 1.5 1.2 25.3 109.8 2.3
A61T 684 11.2 7.1 81.4 2.9 2.0 1.6 20.9 146.7 2.6
D62A 685 21.7 11.6 154.4 3.5 2.0 1.4 45.8 244.1 2.4
EP V64A 686 16.5 9.1 100.9 3.0 2.2 1.2 30.6 172.9 2.7
EP K65A 687 12.1 7.1 95.8 3.0 1.7 1.4 21.6 120.4 2.5

Example 15

Affinity Maturation of Fab VH3-23_IGHD3-10*01>3_IGHJ6*01 & O12_IGKJ1*01 Against P-Cadherin and Epo

Fab VH3-23_IGHD3-10*01>3_IGHJ6*01 & V2-13_IGLJ2*01 (SEQ ID NOS:688 and 594) against P-cadherin and EPO, identified as described in Example 4 using the electroluminescence Meso Scale Discovery (MSD) multispot binding assay, was subjected to affinity maturation as described above in Examples 7-9.

vii. NNK Mutagenesis of CDR3 Amino Acid Residues R104, Y110, Y112, Y113, and Y114

CDR3 amino acid residues R104, Y110, Y112, Y113, and Y114 were mutagenized using NNK mutagenesis and tested for their ability to bind P-cadherin and EPO by ECL multispot assay. The results are set forth in Table 118 below. Mutant-3Y is a deletion mutant in which tyrosines 110, 111 and 112 were deleted. Mutation of amino acid residue Y115 to proline (Y115P) and Y110 to valine (Y110V) resulted an increased binding to both P-cadherin and EPO as compared to the wildtype template antibody as evidenced by an increase in ECL binding signal. Mutation of amino acid residue Y111 to arginine (Y111R) resulted in an increase in binding to P-cadherin as compared to wildtype as evidenced by an increase in ECL binding signal. Additionally, as set forth in Table 116 below, mutants Y115P, Y110V and Y111R all bind P-cadherin as evidenced by ELISA binding results.

TABLE 118
Binding of Fab VH3-23_IGHD3-10*01 > 3_IGHJ6*01 & O12_IGKJ1*01 NNK mutants
SEQ
ID NO ErbB2 EGF R HGF R Notch-1 CD44 IGF-1 P-Cad EPO R DLL4
Y114N 689 1.1 1.0 1.2 1.2 1.2 1.0 1.7 1.3 1.2
Y114T 690 0.8 0.8 1.2 0.7 0.9 0.7 1.3 1.2 0.9
Y114I 691 1.2 1.4 1.5 1.1 1.2 0.7 1.1 1.4 1.2
Y115P 692 3.4 2.7 4.3 1.7 1.3 1.7 27.2 37.0 4.2
Y115R 693 1.9 1.7 2.0 1.7 1.5 1.4 4.7 3.9 1.9
Y115G 694 1.9 2.0 2.1 1.7 1.5 1.9 9.7 17.0 2.7
Y115E 695 1.3 1.1 1.3 0.8 1.4 1.0 1.3 1.4 1.1
R104A 696 1.8 1.4 2.3 2.0 1.3 1.1 9.3 8.5 2.7
-3Y 697 1.2 1.4 1.1 0.7 0.9 1.0 1.1 1.7 1.3
Y110V 698 1.5 1.2 2.0 1.3 1.1 1.1 17.2 10.8 2.0
Y110S 699 1.6 1.2 1.4 1.4 1.4 1.1 1.5 1.4 1.4
Y110P 700 1.3 1.6 1.5 1.6 1.4 1.2 1.1 1.7 1.5
Y110G 701 1.3 1.2 0.9 1.4 0.9 1.2 1.0 1.4 1.3
Y110R 702 2.5 2.1 3.0 2.8 1.4 2.5 11.3 9.2 3.0
Y111S 703 1.2 1.3 1.3 1.3 1.0 0.9 1.4 1.5 1.2
Y111D 704 1.2 0.9 1.1 2.0 1.4 1.4 1.1 1.1 1.1
Y111R 705 2.5 2.4 3.2 3.0 1.5 1.9 11.9 7.3 2.9
Y112A 706 1.3 1.5 0.8 1.1 1.5 1.4 1.1 1.6 1.2
Y112G 707 2.9 2.1 2.3 3.3 2.5 2.3 1.4 1.6 2.2
Y112Q 708 1.5 1.2 1.4 1.7 1.4 1.6 3.0 2.4 1.8
Y112P 709 0.9 1.0 1.1 1.1 1.1 0.8 1.4 0.9 1.0
Y112V 710 1.6 1.2 1.3 1.4 1.0 0.8 9.8 4.3 2.0
Y113H 711 1.4 1.4 1.6 1.0 1.0 1.2 7.3 5.1 1.8
Y113L 712 0.8 1.6 1.0 1.5 1.2 1.4 1.4 1.7 1.4
Y113W 713 1.8 1.5 2.0 1.4 1.4 1.2 5.6 4.0 1.8
Y113E 714 1.1 1.1 1.2 1.3 1.3 1.0 1.2 1.6 1.4
Y113P 715 1.3 1.4 1.4 1.4 0.8 1.2 2.0 2.0 1.3
Y113K 716 0.9 1.1 1.2 1.2 1.0 0.8 1.2 1.3 1.3
Y114K 717 0.8 0.9 0.9 1.0 0.8 0.6 1.0 1.2 1.1
Y114F 718 1.1 1.1 1.4 1.0 1.0 1.1 2.0 2.1 1.2
Y114R 719 2.0 2.0 2.4 2.4 1.6 1.5 2.9 2.3 2.4
wt 688 1.8 1.4 1.6 1.2 0.9 1.1 9.2 7.9 1.6
wt 688 1.6 1.5 2.0 1.4 1.3 1.4 9.5 9.3 1.7

Example 16

Binding to DLL4 Expressed on the Surface of CHO Cells

In this example, Fabs H:APFF VLTH & L:NDH LS (SEQ ID NOS:209 and 350; identified as exhibiting about 1.7 nM affinity as shown in Table 75) and H:KT TRV & L:LP S52G (SEQ ID NOS:430 and 543; identified as exhibiting about 5 nM affinity as shown in Table 108) were tested for their ability to bind to DLL4 expressed on the surface of CHO cells as detected by flow cytometry.

To generate a DLL4 expression construct, human DLL4 cDNA (SEQ ID NO:2905, Accession No. BC106950; and encoding amino acids set forth in SEQ ID NO:2904, Accession No. AAI06951) in pCR-BluntII-TOPO (SEQ ID NO:2934) as a glycerol stock was obtained from Open Biosystems (Clone ID#40034887). The stock was streaked on kanamycin agar plates and a colony picked for purification of the DNA. DNA was obtained with Purelink™ Quick Plasmid Miniprep Kit (Invitrogen, Catalog #K210010).

Full-length DLL4 was digested out from the OpenBiosystems vector and ligated into pcDNA5/FRT (SEQ ID NO:2935; Invitrogen Catalog #K601001) between NheI and NotI. Ligation was performed with Rapid DNA Ligation Kit (Roche, Catalog #11 635 379 001) and cells transformed using heat shock into One Shot® Max Efficiency® DH5α™-T1® Competent Cells (Invitrogen, Catalog #12297016). Cells were selected on carbenicillin plates. Colonies were picked and inoculated overnight in luria broth (LB) containing 1:1000 100 mg/mL, carbenicillin. Plasmid DNA was extracted by miniprep (Invitrogen; Catalog #K210011).

Using Invitrogen's Lipofectamine™ Transfection Reagent, pcDNA5/FRT containing full-length DLL4 and pOG44 recombinase vector (SEQ ID NO:2936; Invitrogen Catalog #K601001) were transfected into Invitrogen's Flp-In™-CHO Cell Line (Cat. No. R75807) according to Flp-In™ System protocol. Cells were approximately 90% confluent in a 12-well plate. Transfected cells were selected with 400 μg/ml Hygromycin after a couple days. Colonies were picked about 5 days after and transferred into a 10 cm2 tissue culture dish. These cell lines were maintained with hygromycin selection

CHO cells expressing full-length DLL4 and control CHO cells were detached from tissue culture plates (BD Falcon 10 cm2) using Accutase™ Enzyme Cell Detachment Medium (Cat#00-4555-56, eBioscience). After washing the cells in 2% Bovine Serum Albumin in Phosphate Buffered Saline (2% BSA/PBS), 10 nM to 50 nM Fab in 2% BSA/PBS was added and incubated at on ice for 30 minutes. The cells were washed one time with 2% BSA/PBS and mouse anti-human kappa-PE antibody (diluted 1:100, Cat# MH10514, Invitrogen) or mouse anti-human lambda-PE antibody (diluted 1:100, Cat# MH10614, Invitrogen) was added and incubated on ice for 10 minutes. Secondary antibody mouse anti-human kappa-PE alone (without Fab) was used as a control for DLL4-expressing CHO cells. The cells were then washed twice in 2% BSA/PBS and analyzed by flow cytometry on a BD FACSAria. The results show that the tested Fabs bind DLL4 expressed on the surface of CHO cells. Neither Fab showed significant binding to CHO cells without DLL4 over-expression.

Example 17

Inhibition of DLL4-Notch Interaction by Flow Cytometry

In this example, three DLL4 binding Fabs were functionally screened for their ability to block the binding of Notch-Fc to DLL4. In this assay, DLL4-expressing CHO cells were incubated in the presence of both Fab and biotinylated-Notch-Fc. Streptavidin-PE was used as a detection molecule. If Notch-Fc binds to DLL4-expressing CHO cells, these cells will be detected by a PE signal at 578 nm. Alternatively, if the Fab blocks the binding of Notch-Fc to DLL4, the DLL4-expressing CHO cells will not be labeled or detected. The tested Fabs included H:APFF VLTH & L:NDH LS (SEQ ID NOS:209 and 350), H:KT TRV & V3-4_IGLJ1*01 (SEQ ID NOS:430 and 108) and H:KT TRV & L:LP S52G (SEQ ID NOS:430 and 543).

In short, CHO cells expressing full-length DLL4 (CHO-DLL4) as described in Example 16 were detached from tissue culture plates using Accutase™ Enzyme Cell Detachment Medium (Cat#00-4555-56, eBioscience). Fab was 5-fold serially diluted in 2% BSA/PBS from a starting concentration of 50 nM. Notch-FC (cat#3647-TK-050, R&D Systems) was biotinylated following using EZ-Link NHS-Biotin Reagent (cat#20217. Pierce) according to the manufacturers instructions. Detached cells were treated with 250 nM biotinylated Notch-FC in 2% BSA/PBS and 30 μL Fab for 30 minutes on ice. PE-labeled streptavidin (Cat#21627, Pierce-Thermo Scientific) was then added to a final dilution of 1:5 followed by incubation for 10 minutes at room temperature. The cells were then washed twice in 2% BSA/PBS and analyzed by flow cytometry on a BD FACSAria.

The results are set forth in Table 119 below. All three Fabs effectively block Notch-Fc binding to CHO-DLL4. Fab H:APFF VLTH & L:NDH LS completely blocks the binding of Notch to DLL4 by 80% at a Fab concentration of 2 nM. Fab H:KT TRV & V3-4_IGLJ1*01 blocks the binding of Notch to DLL4 by 50% at a concentration of 50 nM Fab. Fab H:KT TRV & L:LP S52G blocks the binding of Notch to DLL4 by 80% at a concentration of 50 nM Fab.

TABLE 119
Inhibition of DLL4-Notch interaction
Fab H:APFF VLTH & H:KT TRV & H:KT TRV &
[nM] L:NDH LS L:wt L:LP S52G
50 30 141 105
10 30 244 190
2 117 448 250
0.4 277 Not tested 324
0 531 531 531

Example 18

IgG Cloning and Expression

In this example, Fab antibodies that bind to DLL4 were converted into IgGs by cloning into the pFUSE vectors. Briefly, sequences encoding heavy and light chains were cloned separately into the pFUSE family of vectors (pFUSE-hIgG2-Fc2, Cat# pfuse-hfc2, InvivoGen; SEQ ID NO:2938)) behind the included IL-2 signal sequence. These two vectors were then co-transformed into 293F cells and the protein was expressed and purified.

Light Chain:

The Sequence encoding the Fab light chain (excluding the N-terminal E. coli sorting signal Met Ala) was amplified by PCR with primers containing EcoRI and NheI ends. The amplified Fab light chain was subcloned into pFUSE-hIgG2-Fc2, previously digested with EcoRI and NheI. The Fab light chain immediately follows the IL-2 signal sequence, and completely replaces the Fc sequence in pFUSE-hIgG2-Fc2.

Heavy Chain:

A full-length IgG1 heavy chain sequence (SEQ ID NO:2922) also including a NheI site between VH and CH1-CH2-CH3 was synthesized by Genscript, amplified by PCR with primers containing EcoRI and XbaI ends, and subcloned into pFUSE-hIgG2-Fc2, previously digested with EcoRI and NheI. Ligation of the XbaI and NheI compatible cohesive ends eliminates both sties at this position, making the NheI site between VH and CH1-CH2-CH3 of the IgG1 heavy chain sequence unique. The sequence encoding Fab heavy chain (excluding the N-terminal E. coli sorting signal Met Ala) was amplified by PCR with EcoRI and NheI ends. The vector containing the full length IgG1 heavy chain was then digested with EcoRI and NheI, which removed the VH sequence, and the amplified Fab heavy chain was subcloned into the digested vector. Thus the Fab Heavy chain was subcloned between IL-2 and the IgG1 heavy chain.

Protein Expression and Purification:

To produce IgG, the heavy and light chain plasmids were co-transfected into 293F cells (Cat# R790-07, Invitrogen) using 293fectin (Cat#12347, Invitrogen) per manufacturer's instructions. Cells grown in serum-free 293Freestyle media (Cat#12338026, Invitrogen) were transfected at 1×106 cells/ml in 50 ml spinner flask. Cell culture media were harvested 3 and 6 days after transfection and pooled together for purification by column chromatography using Protein-G Sepharose (GE Healthcare). IgG elution fractions were pooled and dialysed into PBS.

Example 19

Activity of Antibodies by DLL4-Notch Interaction by a Reporter Assay

In this example, two DLL4 binding antibodies were assayed for their ability to inhibit DLL4-dependent Notch 1 signaling using a luciferase reporter assay. Reporter cells were generated by stably transfecting human glioma T98G cells, known for the presence of Notch 1 on their cell surface (see Purow et al. (2005) Cancer Res., 65:2353-63), with a Notch reporter plasmid (p6xCBF) containing six C promoter binding factor-1 (CBF-1) responsive elements (set forth in SEQ ID NO:2939; see Nefedova et al. (2004), Blood. 103(9):3503-10). Subsequent addition of DLL4-CHO cells (see Example 16 above) to the reporter T98G cells results in expression of firefly luciferase due to the Notch1-DLL4 interaction. Disruption of the Notch1-DLL4 by a DLL4 binding antibody therefore causes a decrease in luciferase expression.

A. Notch Reporter Plasmids

A reporter construct containing six C promoter binding factor-1 (CBF-1) response elements (set forth in SEQ ID NO:2939; CBF Notch-response elements are indicated by bold; ggtacctgagctcgctagcgatctggtgtaaacacgccgtgggaaaaaatttatggatctggtgtaaacacgccgtgggaaaaaattta tggagctcgctagcgatctggtgtaaacacgccgtgggaaaaaatttatggatctggtgtaaacacgccgtgggaaaaaatttatgac gaggatctggtgtaaacacgccgtgggaaaaaatttatggatctggtgtaaacacgccgtgggaaaaaatttatgaagctt;) was digested with KpnI and HindIII. The digested product was then into the luciferase reporter vectors pGL4.26 (SEQ ID NO:2940; Promega, Catalog #E8441)) at the KpnI and HindIII sites. The pGL4.26 vector allows for hygromycin selection, which facilitates the production of a cell line with a stably-integrated copy of the reporter. Also, the use of pGL4.26 eliminates the need to transiently transfect the reporter and normalize for variable transfection efficiency.

B. Assay

T98G cells from ATCC (No. CRL-1690™) were plated onto a 96-well tissue culture plate at 20,000 cells per well in Eagle's Minimum Essential Media (EMEM, Invitrogen) supplemented with 10% Fetal Bovine Serum (BSA, Invitrogen) and 1× penicillin/streptomycin/glutamine (P/S/G, Invitrogen).

The following day, T98G cells were transfected with the Notch reporter construct expressing Firefly luciferase (p6xCBF) and stable integrants were selected with 200 ug/ml Hygromycin B (Invitrogen). CHO cells expressing DLL4 or control CHO cells were propagated in F12 media (Invitrogen) supplemented with 10% FBS and P/S/G. Separately, T98G Notch reporter cells (2×105 cells/well) in EMEM with 10% FBS and P/S/G were plated onto 96-well tissue culture plates. Notch-expressing T98G cells were stimulated by CHO-DLL4 or control CHO cells (1×105 cells/well). Media on T98G cells was replaced by 100 μl of serum free F12 media supplemented with P/S/G. Fabs H:APFF VLTH & L:NDH LS (SEQ ID NOS:209 and 350) and H:KT TRV & L:LP S52G (SEQ ID NOS:430 and 543) and their corresponding IgGs, and control Fab (that does not bind DLL4; VH6-1_IGHD6-13*01_IGHJ4*01 and V2-17_IGLJ2*01 set forth in SEQ ID NOS: 2152 and 2941, respectively) were added at 100, 20, 4 and 0.8 nM. In addition, the non-affinity matured germline parent Fabs also were tested to determine their Notch reporter response. For this, corresponding IgGs of VH5-51_IGHD5-18*01>3_IGHJ4*01 & V3-4_IGLJ1*01 (set forth in SEQ ID NOS: 89 and 108; the parent germline Fab of H:KT TRV & L:LP S52G) and VH1-46_IGHD6-6*01_IGHJ1*01 & L6_IGKJ1*01 (set forth in SEQ ID NOS:88 and 107; the parent germline Fab of H:APFF VLTH & L:NDH LS) were control IgG was added at 200, 100 and 20 nM.

After 24 hours, luciferase-reporter expression was measured with Bright-Glo luciferase assay reagent (Cat# E2620, Promega). Luminenscence was read using a Wallac Victor II model 1420 plate reader. Each condition was performed in quadruplicate.

The results are depicted in Tables 120 below. The results in Table 120 show that incubation of the T98G reporter cells with CHO-DLL4 resulted in 8- to 9-fold increase in Notch1 reporter levels compared to those incubated with CHO cells alone. The Notch1 activation remained constant in the presence of the control Fab that does not bind to DLL4. The activation was reduced in the presence of increasing concentration of anti-DLL4 antibody Fabs H:APFF VLTH & L:NDH LS and H:KT TRV & L:LP S52G. The reduction was even more pronounced with an IgG version of H:APFF VLTH & L:NDH LS (IC50˜6 nM), which was almost 10-fold more efficient than the corresponding Fab. The IgG version of H:KT TRV & L:LP S52G was also more effective than the corresponding Fab, displaying about 30% reduction in Notch1 activation at 0.8 nM. Neither Fab nor IgG form of H:KT TRV & L:LP S52G showed complete suppression of Notch1 activation at higher concentrations (>100 nM). The results show that the IgG H:APFF VLTH & L:NDH LS is a complete inhibitor, whereas IgG H:KT TRV & L:LP S52G is a partial antagonist of the DLL4-Notch activation.

TABLE 120
Cell type treatment Conc [nM] 1 2 3 4 Avg ± SE
CHO-DLL4 VH6-1 IGH36- 0.8 4482 4541 3908 4221 4288 ± 144
13*01 4 4809 4921 4187 4520 4609 ± 164
IGHJ4*01 and 20 5402 4988 4323 4546 4815 ± 240
V2- 100 4821 4813 4034 4473 4535 ± 186
17_IGLJ2*01
(control Fab)
H: KT TRV & 0.8 4878 4716 4078 4278 4488 ± 186
L: LP S52G 4 4792 4771 4321 4469 4588 ± 116
(Fab) 20 4245 4371 4148 4075 4210 ± 64 
100 3321 3483 3012 3083 3225 ± 109
H: KT TRV & 0.8 3711 3485 3092 3292 3395 ± 132
L: LP S52G 4 3276 3339 3091 2911 3154 ± 97 
(IgG) 20 3020 2904 2598 2652 2794 ± 101
100 2811 2545 2276 2519 2538 ± 109
H: APFF 0.8 4739 4886 3818 4076 4380 ± 257
VLTH & 4 4837 4877 4251 4667 4658 ± 143
L: NDH LS 20 4376 4482 3960 3993 4203 ± 133
(Fab) 100 2397 2285 2148 2169 2250 ± 58 
H: APFF 0.8 4445 4521 3899 3985 4213 ± 158
VLTH & 4 4261 3862 3949 3765 3959 ± 107
L: NDH LS 20 1250 1269 1174 1191 1221 ± 23 
(IgG) 100 757 807 678 688 733 ± 30
CHO VH6-1 IGH36- 0.8 572 569 555 583 570 ± 6 
13*01 4 557 547 539 450 523 ± 25
IGHJ4*01 and 20 508 532 550 476 517 ± 16
V2- 100 488 487 491 464 483 ± 6 
17_IGLJ2*01
(control Fab)

Since modifications will be apparent to those of skill in this art, it is intended that this invention be limited only by the scope of the appended claims.

Claims

1-97. (canceled)

98. A method of affinity maturation of a first antibody, or antigen-binding portion thereof, for a target antigen, comprising:

a) identifying a related antibody, or antigen-binding portion thereof, that exhibits a reduced activity for the target antigen than the corresponding form of a first antibody, wherein the related antibody, or antigen-binding portion thereof, contains a related variable heavy chain or a related variable light chain that is either:

one in which the corresponding variable heavy chain or variable light chain of the related antibody, or antigen-binding portion thereof, exhibits at least 75% amino acid sequence identity to the variable heavy chain or variable light chain of the first antibody, or antigen-binding portion thereof, but does not exhibit 100% sequence identity therewith; or

one in which at least one of the VH, DH, and JH germline segments of a nucleic acid molecule encoding the variable heavy chain of the related antibody, or antigen-binding portion thereof, is identical to one of the VH, DH, and JH germline segments of the nucleic acid molecule encoding the variable heavy chain of the first antibody, or antigen-binding portion thereof, and/or at least one of the Vκ and Jκ or at least one of the Vλ and Jλ germline segments of the nucleic acid molecule encoding the variable light chain is identical to one of the Vκ and Jκ or Vλ and Jλ germline segments of the nucleic acid molecule encoding the variable light chain of the first antibody, or antigen-binding portion thereof; and

b) comparing the amino acid sequence of the variable heavy chain or variable light chain of the first antibody, or antigen-binding portion thereof, to the amino acid sequence of the corresponding related variable heavy chain or variable light chain of the related antibody, or antigen-binding portion thereof;

c) identifying a target region within the variable heavy chain or variable light chain of a first antibody, or antigen-binding portion thereof, wherein the target region exhibits at least one amino acid difference compared to the same region in the related antibody, or antigen-binding portion thereof;

d) producing a plurality of modified antibodies, or antigen-binding portions thereof, each comprising a variable heavy chain and a variable light chain, or a portion thereof, wherein at least one of the variable heavy chain or variable light chain is modified in its target region by replacement of a single amino acid residue, whereby the target region in each of the plurality of antibodies, or antigen-binding portions thereof, contains replacement of an amino acid to a different amino acid compared to the first antibody, or antigen-binding portion thereof;

e) screening each of the plurality of modified antibodies, or antigen-binding portions thereof, for an activity to the target antigen; and

f) selecting those modified antibodies, or antigen-binding portions thereof, that exhibit increased activity for the target antigen compared to the first antibody, or antigen-binding portion thereof.

99. A method according to claim 98 that further includes at least one of the following:

a) wherein the plurality of modified antibodies, or antigen-binding portions thereof, in part (d) are produced by producing a plurality of nucleic acid molecules that encode modified forms of a variable heavy chain or a variable light chain of the first antibody, or antigen-binding portion thereof, wherein the nucleic acid molecules contain one codon encoding an amino acid in the target region that encodes a different amino acid as compared to the unmodified variable heavy or variable light chain, whereby each nucleic acid molecule of the plurality encodes a variable heavy chain or variable light chain that is modified in its target region by replacement of a single amino acid residue;

b) wherein the target region in the first antibody, or antigen-binding portion thereof, exhibits 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid differences compared to the corresponding region in the related antibody, or antigen-binding portion thereof;

c) wherein the related antibody, or antigen-binding portion thereof, is 1, 2, 3, 4, or 5 related antibodies, or antigen-binding portions thereof;

d) wherein the activity is selected from the group consisting of:

i. binding, optionally binding as assessed by a method selected from the group consisting of an immunoassay, optionally an immunoassay selected from the group consisting of a radioimmunoassay, an enzyme linked immunosorbent assay (ELISA), and an electrochemiluminescence assay, wherein the electrochemiluminescence assay optionally is meso-scale discovery (MSD); whole cell panning; and surface plasmon resonance (SPR);

ii. signal transduction;

iii. differentiation;

iv. alteration of gene expression;

v. cellular proliferation;

vi. apoptosis;

vii. chemotaxis;

viii. cytotoxicity;

ix. cancer cell invasion;

x. endothelial cell proliferation; and

xi. tube formation;

e) wherein the first antibody, or antigen-binding portion thereof, binds to the target antigen when in a Fab form with a binding affinity that is about 10−4 M or lower, about 10−4 M to about 10−8 M, or at or about 10−4 M, 10−5 M, 10−6 M, 10−7 M, 10−8 M, or lower;

f) wherein the related antibody, or antigen-binding portion thereof, exhibits a binding affinity that is less than the binding affinity of the first antibody, or antigen-binding portion thereof, whereby the binding affinity of the related antibody, or antigen-binding portion thereof, in its Fab form is about 10−4 M or lower; about 10−4 M to about 10−8 M; or at or about 10−4 M, 10−5 M, 10−6 M, 10−7 M, 10−8 M, or lower;

g) wherein the related antibody, or antigen-binding portion thereof, exhibits about 80% or less activity than the corresponding form of the first antibody, or antigen-binding portion thereof; about 5% to about 80% of the activity of the corresponding form of the first antibody; or less than or about 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, or less activity than the corresponding form of the first antibody.

h) wherein the related antibody, or antigen-binding portion thereof, exhibits the same or similar level of activity to the target antigen compared to a negative control;

i) wherein the target region is identified within the variable heavy chain of the first antibody, or antigen-binding portion thereof, and steps d)-f) are performed therefrom;

j) wherein the target region is identified within the variable light chain of the first antibody, or antigen-binding portion thereof, and steps d)-f) are performed therefrom;

k) wherein:

a target region is identified within the variable heavy chain of the first antibody, or antigen-binding portion thereof, and steps d)-f) are performed therefrom; and

separately and independently a target region is identified within the variable light chain of the first antibody, or antigen-binding portion thereof, and steps d)-f) are performed therefrom;

l) wherein a related antibody, or antigen-binding portion thereof, that contains the related corresponding variable heavy chain is different than a related antibody, or antigen-binding portion thereof, that contains the related corresponding variable light chain;

m) wherein a related antibody, or antigen-binding portion thereof, that contains the related corresponding variable heavy chain is the same as a related antibody, or antigen-binding portion thereof, that contains the related corresponding variable light chain;

n) wherein the amino acid sequence of the variable heavy chain or variable light chain of the first antibody, or antigen-binding portion thereof, exhibits at least about 80% or more sequence identity with the corresponding amino acid sequence of the related variable heavy chain or variable light chain of the related antibody, or antigen-binding portion thereof; about 80% to about 99% of the sequence identity with the corresponding amino acid sequence of the related variable heavy chain or variable light chain of the related antibody, or antigen-binding portion thereof; or at least or about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the corresponding amino acid sequence of the related variable heavy chain or variable light chain of the related antibody, or antigen-binding portion thereof;

o) wherein the variable heavy chain or variable light chain of the first antibody, or antigen-binding portion thereof, exhibits at least about 95% sequence identity with the corresponding amino acid sequence of the related variable heavy chain or variable light chain of the related antibody, or antigen-binding portion thereof;

p) wherein the related antibody, or antigen-binding portion thereof, contains a related variable heavy chain or variable light chain that is one in which at least one of the VH, DH, and JH germline segments of the nucleic acid molecule encoding the variable heavy chain of the first antibody, or antigen-binding portion thereof, is identical to one of the VH, DH, and JH germline segments of the nucleic acid molecule encoding the variable heavy chain of the related antibody, or antigen-binding portion thereof; and/or at least one of the Vκ and Jκ or at least one of the Vλ and Jλ germline segments of the nucleic acid molecule encoding the variable light chain of the first antibody, or antigen-binding portion thereof, is identical to one of the Vκ and Jκ or Vλ and Jλ germline segments of the nucleic acid molecule encoding the variable light chain of the related antibody, or antigen-binding portion thereof;

q) wherein the target antigen is selected from the group consisting of a polypeptide, carbohydrate, lipid, nucleic acid, and a small molecule;

r) wherein the target antigen is expressed on the surface of a virus, bacteria, tumor or other cell, or is a recombinant protein or peptide;

s) wherein the target antigen is a protein that is a target for therapeutic intervention, optionally selected from the group consisting of VEGFR-1, VEGFR-2, VEGFR-3 (vascular endothelial growth factor receptors 1, 2, and 3), a epidermal growth factor receptor (EGFR), ErbB-2, ErbB-3, IGF-R1, C-Met (also known as hepatocyte growth factor receptor; HGFR), DLL4, DDR1 (discoidin domain receptor), KIT (receptor for c-kit), FGFR1, FGFR2, FGFR4 (fibroblast growth factor receptors 1, 2, and 4), RON (recepteur d'origine nantais; also known as macrophage stimulating 1 receptor), TEK (endothelial-specific receptor tyrosine kinase), TIE (tyrosine kinase with immunoglobulin and epidermal growth factor homology domains receptor), CSF1R (colony stimulating factor 1 receptor), PDGFRB (platelet-derived growth factor receptor B), EPHA1, EPHA2, EPHB1 (erythropoietin-producing hepatocellular receptor A1, A2 and B1), TNF-R1, TNF-R2, HVEM, LT-βR, CD20, CD3, CD25, NOTCH, G-CSF-R, GM-CSF-R, EPO-R., a cadherin, an integrin, CD52, CD44, VEGF-A, VEGF-B, VEGF-C, VEGF-D, PIGF, EGF, HGF, TNF-α, LIGHT, BTLA, lymphotoxin (LT), IgE, G-CSF, GM-CSF and EPO;

t) wherein the target antigen is involved in cell proliferation and differentiation, cell migration, apoptosis or angiogenesis;

u) wherein a subset of the amino acid residues in the target region are modified by amino acid replacement;

v) wherein only the amino acid residues that differ between the first antibody and related antibody in the target region are modified by amino acid replacement;

w) wherein only the amino acid residues that are the same between the first antibody and the related antibody in the target region are modified by amino acid replacement;

x) wherein all of the amino acids residues in the target region are modified by amino acid replacement;

y) wherein each amino acid residue that is modified in the target region is modified to all 19 other amino acid residues, or a restricted subset thereof;

z) further comprising determining the amino acid modifications that are altered in the modified antibody compared to the first antibody not containing the amino acid replacements;

aa) wherein the method is repeated iteratively, wherein a modified antibody, or antigen-binding portion thereof, is selected and used in step a) as the first antibody, or antigen-binding portion thereof, for subsequent affinity maturation thereof;

bb) wherein one or more amino acid replacements in the target region of one or more variable heavy chains or one or more variable light chains of selected modified antibodies, or antigen-binding portions thereof, are combined to generate a further modified antibody, or antigen-binding portion thereof, whereby the further modified antibody(ies), or antigen-binding portion(s) thereof, are screened for an activity to the target antigen to identify a further modified antibody, or antigen-binding portion thereof, that exhibits an increased activity for the target antigen compared to the first antibody, or antigen-binding portion thereof, and to the selected modified antibody(ies), or antigen-binding portion(s) thereof; and

cc) wherein the antibody, or antigen-binding portion thereof, comprising a variable heavy chain and a variable light chain, or a portion thereof, is selected from the group consisting of a Fab, Fab′, F(ab′)2, single-chain Fv (scFv), scFab, Fv, dsFv, diabody, Fd, Fd′, Fab fragment, Fd fragment, Fd′ fragment, scFv fragment, and scFab fragment.

100. A method according to claim 98, wherein the related antibody, or antigen-binding portion thereof, contains a related variable heavy chain or variable light that is one in which at least one of the VH, DH, and JH germline segments of the nucleic acid molecule encoding the variable heavy chain of the first antibody, or antigen-binding portion thereof, is from the same gene family as one of the VH, DH, and JH germline segments of the nucleic acid molecule encoding the variable heavy chain of the related antibody, or antigen-binding portion thereof; and/or at least one of the Vκ and Jκ or at least one of the Vλ and Jλ germline segments of the nucleic acid molecule encoding the variable light chain of the first antibody, or antigen-binding portion thereof, is from the same gene family as one of the Vκ and Jκ or Vλ and Jλ germline segments of the nucleic acid molecule encoding the variable light chain of the related antibody, or antigen-binding portion thereof.

101. A method according to claim 98, wherein the variable heavy chain or variable light chain of the first antibody, or antigen binding portion thereof, exhibits at least 60% or more sequence identity with the corresponding related variable heavy chain or variable light chain of the related antibody, or antigen binding portion thereof; 60% to 99% of the sequence identity with the corresponding related variable heavy chain or variable light chain of the related antibody, or antigen binding portion thereof; or at least or about 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the corresponding related variable heavy chain or variable light chain of the related antibody, or antigen binding portion thereof.

102. A method according to claim 98, wherein the target region is selected from the group consisting of a CDR1, CDR2, CDR3, FR1, FR2, FR3, and FR4.

103. A method according to claim 98, wherein:

a) the first antibody, or antigen-binding portion thereof, is identified by screening a combinatorial antibody library or combinatorial antigen-binding antibody fragment library;

b) the combinatorial library is produced by a method comprising:

i) combining a VH, a DH, and a JH human germline segment or portion thereof in frame to generate a sequence of a nucleic acid molecule encoding a VH chain or a portion thereof;

ii) combining a Vκ and a Jκ human germline segment or portion thereof, or a Vλ and a Jλ germline segment or portion thereof in frame to generate a sequence of a nucleic acid molecule encoding a VL chain or a portion thereof, wherein:

in steps i) and ii), each of the portions of the VH, DH, JH, Vκ, Jκ, Vλ, or Jλ are sufficient to produce an antibody or antigen-binding portion thereof containing a VH or VL or portion thereof that forms a sufficient antigen binding site;

iii) repeating steps i) and ii) a plurality of times to generate sequences of a plurality of different nucleic acid molecules;

iv) synthesizing the nucleic acid molecules to produce two libraries, wherein:

the first library comprises nucleic acid molecules encoding a VH chain or a portion thereof; and

the second library comprises nucleic acid molecules encoding a VL chain or a portion thereof;

v) introducing a nucleic acid molecule from the first library and from the second library into a cell and repeating this a plurality of times to produce a library of cells, wherein each cell contains nucleic acid molecules encoding a different combination of VH and VL from at least some of the other cells in the library of cells; and

vi) growing the cells to express the antibodies, or antigen-binding portions thereof, thereby producing a plurality of antibodies, or antigen-binding portion thereof, wherein the different antibodies, or antigen-binding portions thereof, in the library each comprise a different combination of a VH and a VL chain or a sufficient portion thereof to form an antigen binding site; and

c) screening of the library is effected by:

i) contacting an antibody, or antigen-binding portion thereof, in the library with a target protein;

ii) assessing binding of the antibody, or antigen-binding portion thereof, with the target protein and/or whether the antibody, or antigen-binding portion thereof, modulates a functional activity of the target protein; and

iii) identifying an antibody, or antigen-binding portion thereof, that exhibits an activity for the target protein, wherein the identified antibody, or antigen-binding portion thereof, is a first antibody.

104. A method according to claim 103 that further includes at least one of the following:

a) the related antibody also is identified by screening a combinatorial antibody library by steps a)-c), whereby the related antibody exhibits reduced activity for the target antigen compared to the first antibody;

b) the library is an addressable library, whereby:

in step iv), the synthesized nucleic acid sequences are individually addressed, thereby generating a first addressed nucleic acid library and a second addressed nucleic acid library;

in step v), the cells are addressed, wherein each locus comprises a cell that contains nucleic acid molecules encoding a different combination of a VH and a VL from every other cell in the addressed library of cells; and

in step vi) the plurality of antibodies or portions thereof are addressed, wherein:

the antibodies or portions thereof at each locus in the library are the same antibody and are different from those at each and every other locus; and

the identity of the antibody or portion thereof is known by its address, wherein optionally the antibodies in the addressable library are arranged in a spatial array, optionally a multiwell plate, wherein each individual locus of the array corresponds to a different antibody member;

c) wherein the antibodies are in an addressable library, wherein optionally the antibodies in the addressable library are arranged in a spatial array, optionally a multiwell plate, wherein optionally each individual locus of the array corresponds to a different antibody member are attached to a solid support selected from the group consisting of a filter, chip, slide, bead or cellulose, and the different antibody members are immobilized to the surface thereof;

d) wherein the plurality of nucleic acid molecules are generated by a method selected from the group consisting of PCR mutagenesis, cassette mutagenesis, site-directed mutagenesis, random point mutagenesis, mutagenesis using uracil containing templates, oligonucleotide-directed mutagenesis, phosphorothioate-modified DNA mutagenesis, mutagenesis using gapped duplex DNA, point mismatch repair, mutagenesis using repair-deficient host strains, restriction-selection and restriction-purification, deletion mutagenesis, mutagenesis by total gene synthesis, and double-strand break repair; and

e) wherein the plurality of nucleic acid molecules are generated by a method selected from the group consisting of NNK, NNS, NNN, NNY or NNR mutagenesis.

105. A method according to claim 98, further comprising before step d),

g) performing scanning mutagenesis of the first antibody, or antigen-binding portion thereof, comprising producing a plurality of modified antibodies, or antigen-binding portions thereof, comprising a variable heavy chain and a variable light chain, or a portion thereof, wherein at least one of the variable heavy chain or variable light chain, or portion thereof, is one that is modified by replacement of a single amino acid residue with a scanned amino acid residue in the target region, whereby each of the plurality of antibodies, or antigen-binding portion thereof, contains replacement of an amino acid in the target region compared to the first antibody, or antigen-binding portion thereof, wherein the scanned amino acid optionally is selected from the group consisting of alanine, threonine, proline, glycine, and a non-natural amino acid;

h) screening each of the plurality of modified antibodies, or antigen-binding portions thereof, for an activity to the target antigen; and

i) selecting a second antibody, or antigen-binding portion thereof, from among the modified antibodies, or antigen-binding portions thereof, that exhibits retained or increased activity for the target antigen compared to the first antibody, or antigen-binding portion thereof, not containing the amino acid replacement, whereby the second antibody, or antigen-binding portion thereof, is used in place of the first antibody, or antigen-binding portion thereof, in step b).

106. A method according to claim 105 that further includes at least one of the following:

a) wherein the plurality of modified antibodies, or antigen-binding portions thereof, in step g) are produced by producing a plurality of nucleic acid molecules that encode modified forms of a variable heavy chain or a variable light chain of the first antibody, or antigen-binding portion thereof, containing the target region, wherein the nucleic acid molecules contain one codon that encodes a scanned amino acid in the target region compared to the corresponding codon of the unmodified variable heavy or variable light chain that does not encode the scanned amino acid, whereby each nucleic acid molecule of the plurality encodes a variable heavy chain or variable light chain that is modified by replacement of a single amino acid residue to the same scanned amino acid residue in the target region;

b) wherein a second antibody is, or antigen-binding portion thereof, selected that exhibits an activity that is at least 75% or more of the activity of the corresponding form of the first antibody, or antigen-binding portion thereof; is at least 75% to 200% of the activity of the corresponding form of the first antibody, or antigen-binding portion thereof; or is at least or about 75%, 80%, 85%, 90%, 95%, 100%, 105%, 110%, 115%, 120%, 130%, 140%, 150%, 200% or more of the activity of the corresponding form of the first antibody, or antigen-binding portion thereof;

c) further comprising after step i) determining the amino acid residue position that is modified in the second antibody, or antigen-binding portion thereof, to contain a neutral amino acid compared to the first antibody not containing the amino acid replacement;

d) wherein a subset of the amino acid residues in the target region are modified by amino acid replacement to a scanned amino acid;

e) wherein only the amino acid residues that differ between the first antibody, or antigen-binding portion thereof, and related antibody, or antigen-binding portion thereof, in the target region are modified by amino acid replacement to a scanned amino acid;

f) wherein all of the amino acids in the target region are modified by amino acid replacement to a scanned amino acid;

g) wherein the selected modified antibody, or antigen-binding portion thereof, exhibits about 2-fold, 5-fold, 10-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700-fold, 800-fold, 900-fold, 1000-fold, 2000-fold, 3000-fold, 4000-fold, 5000-fold, 10000-fold, or more improved activity for the target antigen compared to the first antibody, or antigen-binding portion thereof; and

h) wherein the modified antibody, or antigen-binding portion thereof, exhibits a binding affinity that is greater than the binding affinity of the first antibody, or antigen-binding portion thereof, and is about 1×10−9 M or less; 1×10−9 M to 1×10−11 M; or is or is about 1×10−9 M, 2×10−9 M, 3×10−9 M, 4×10−9 M, 5×10−9 M, 6×10−9 M, 7×10−9 M, 8×10−9 M, 9×10−9 M, 1×10−10 M, 2×10−10 M, 3×10−10 M, 4×10−10 M, 5×10−10 M, 6×10−10 M, 7×10−10 M, 8×10−10 M, 9×10−10 M, or less

107. A method according to claim 98, comprising:

performing steps a)-f) on the variable heavy chain of the first antibody, or antigen-binding portion thereof, and selecting first modified antibodies, or antigen-binding portions thereof, each containing an amino acid replacement in the target region;

performing steps a)-f) independently and separately on the variable light chain of the first antibody and selecting second modified antibodies, or antigen-binding portions thereof, each containing an amino acid replacement in the target region;

combining the variable heavy chain of a first modified antibody, or antigen-binding portion thereof, with the variable light chain of a second modified antibody, or antigen-binding portion thereof, to generate a plurality of different third modified antibodies, or antigen-binding portions thereof, each comprising an amino acid replacement in the target region of the variable heavy chain and variable light chain; and

screening each of the plurality of third modified antibodies, or antigen-binding portions thereof, for binding to the target antigen; and

selecting those third modified antibodies, or antigen-binding portions thereof, that exhibit an increased activity for the target antigen compared to the first and second modified antibodies.

108. A method according to claim 98, further comprising after selecting a first modified antibody, or antigen-binding portion thereof, in step f):

j) selecting another different region within the variable heavy chain or variable light chain of the first modified antibody, or antigen-binding portion thereof, for further mutagenesis, wherein optionally the further different region is selected from the group consisting of a CDR1, CDR2, CDR3, FR1, FR2, FR3, and FR4;

k) producing a plurality of nucleic acid molecules that encode modified forms of the variable heavy chain or variable light chain of the first modified antibody, or antigen-binding portion thereof, wherein the nucleic acid molecules contain one codon encoding an amino acid in the selected region that encodes a different amino acid from the first modified variable heavy or variable light chain, whereby each nucleic acid molecule of the plurality encodes a variable heavy chain or variable light chain that is modified in the selected region by replacement of a single amino acid residue;

l) producing a plurality of further modified antibodies, or antigen-binding portions thereof, each comprising a variable heavy chain and a variable light chain, or a portion thereof, wherein at least one of the variable heavy chain or variable light chain is one produced in step k), whereby the selected region in each of the plurality of antibodies, or antigen-binding portions thereof, contains replacement of an amino acid to a different amino acid compared to the first modified antibody, or antigen-binding portion thereof;

m) screening each of the plurality of further modified antibodies, or antigen-binding portions thereof, for binding to the target antigen; and

n) selecting those further modified antibodies, or antigen-binding portions thereof, that exhibit increased activity for the target antigen compared to the first modified antibody, or antigen-binding portion thereof.

109. A method of affinity maturation of an antibody, or antigen-binding portion thereof, for a target antigen, comprising:

a) performing scanning mutagenesis of a first antibody, or antigen-binding portion thereof, comprising producing a plurality of nucleic acid molecules that encode modified forms of a variable heavy chain or a variable light chain of a first antibody, or antigen-binding portion thereof, wherein the nucleic acid molecules contain one codon that encodes another amino acid compared to the corresponding codon of the unmodified variable heavy or variable light chain, or portion thereof, that does not encode the other amino acid, whereby each nucleic acid molecule of the plurality encodes a variable heavy chain or variable light chain, or portion thereof, that is modified by replacement of a single amino acid residue to another amino acid such that every position across the full-length of the encoded variable heavy or light chain, or portion thereof, is replaced or every position in a selected region of the encoded variable heavy or variable light chain, or portion thereof, is replaced, whereby each replacement is to the same amino acid residue;

b) producing a plurality of modified antibodies, or antigen-binding portions thereof, each comprising a variable heavy chain and a variable light chain, or a portion thereof, wherein at least one of the variable heavy chain or variable light chain, or portion thereof, is one produced in step a), whereby each of the plurality of antibodies, or antigen-binding portions thereof, contains replacement of an amino acid position with another amino acid compared to the first antibody, or antigen-binding portion thereof;

c) screening each of the plurality of modified antibodies, or antigen-binding portions thereof, for an activity to the target antigen;

d) selecting a second antibody, or antigen-binding portion thereof, from among the modified antibodies, or antigen-binding portions thereof, that exhibits retained or increased activity for the target antigen compared to the first antibody, or antigen-binding portion thereof, not containing the amino acid replacement;

e) performing further mutagenesis of the second antibody, or antigen-binding portion thereof, comprising producing a plurality of nucleic acid molecules that encode modified forms of a variable heavy chain or a variable light chain, or portion thereof, of the second antibody, or antigen-binding portion thereof, wherein the nucleic acid molecules contain one codon encoding an amino acid at the scanned amino acid position that encodes a different amino acid than the scanned amino acid in the second antibody, or antigen-binding portion thereof, whereby each nucleic acid molecule of the plurality encodes a variable heavy chain or variable light chain, or portion thereof, that is modified at the scanned amino acid position by a single amino acid residue; and

f) producing a plurality of further modified antibodies, or antigen-binding portions thereof, each comprising a variable heavy chain and a variable light chain, or a portion thereof, wherein at least one of the variable heavy chain or variable light chain, or portion thereof, is one produced in step e), whereby the scanned amino acid position contains replacement to a different amino acid compared to the second antibody, or antigen-binding portion thereof;

g) screening each of the plurality of further modified antibodies, or antigen-binding portions thereof, for an activity to the target antigen; and

h) selecting a third antibody, or antigen-binding portion thereof, that exhibits increased activity for the target antigen compared to the first and/or second antibody, or antigen-binding portion(s) thereof.

110. A method according to claim 109 that further includes at least one of the following:

a) wherein in step a) every position in a region of the encoded variable heavy or variable light chain is replaced;

b) wherein the selected region is a complementary determining region in the variable heavy chain or variable light chain selected from the group consisting of a CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3;

c) wherein a second antibody, or antigen-binding portion thereof, is selected that exhibits an activity that is at least 75% or more of the activity of the corresponding form of the first antibody; is 75% to 200% of the activity of the corresponding form of the first antibody, or antigen-binding portion thereof; or is at least or about 75%, 80%, 85%, 90%, 95%, 100%, 105%, 110%, 115%, 120%, 130%, 140%, 150%, 200% or more of the activity of the corresponding form of the first antibody, or antigen-binding portion thereof;

d) a method further comprising after step d) determining the amino acid residue position that is modified in the second antibody, or antigen-binding portion thereof, to contain a scanned amino acid compared to the first antibody, or antigen-binding portion thereof, not containing the amino acid replacement;

e) wherein the other amino acid is selected from the group consisting of alanine, threonine, proline, glycine, and non-natural amino acid;

f) wherein each of the plurality of nucleic acid molecules encodes a variable heavy chain or variable light chain, or portion thereof, that is modified by replacement of a single amino acid residue to the same scanned amino acid;

g) wherein an activity is selected from the group consisting of binding, signal transduction, differentiation, alteration of gene expression, cellular proliferation, apoptosis, chemotaxis, cytotoxicity, cancer cell invasion, endothelial cell proliferation and tube formation;

h) wherein the activity is selected from the group consisting of:

i. binding, optionally binding as assessed by a method selected from the group consisting of an immunoassay, optionally an immunoassay selected from the group consisting of a radioimmunoassay, an enzyme linked immunosorbent assay (ELISA), and an electrochemiluminescence assay, wherein the electrochemiluminescence assay optionally is meso-scale discovery (MSD); whole cell panning; and surface plasmon resonance (SPR);

ii. signal transduction;

iii. differentiation;

iv. alteration of gene expression;

v. cellular proliferation;

vi. apoptosis;

vii. chemotaxis;

viii. cytotoxicity;

ix. cancer cell invasion;

x. endothelial cell proliferation; and

xi. tube formation;

i) wherein the plurality of nucleic acid molecules produced in step e) are generated by a method selected from the group consisting of PCR mutagenesis, cassette mutagenesis, site-directed mutagenesis, random point mutagenesis, mutagenesis using uracil containing templates, oligonucleotide-directed mutagenesis, phosphorothioate-modified DNA mutagenesis, mutagenesis using gapped duplex DNA, point mismatch repair, mutagenesis using repair-deficient host strains, restriction-selection and restriction-purification, deletion mutagenesis, mutagenesis by total gene synthesis, and double-strand break repair;

j) wherein the plurality of nucleic acid molecules produced in step e) are generated by a method selected from the group consisting of NNK, NNS, NNN, NNY or NNR mutagenesis

k) wherein in step e), the scanned amino acid position is modified by amino acid replacement to all other amino acid residues, or to a restricted subset thereof, wherein optionally the modification does not include amino acid replacement to the scanned amino acid or to the original amino acid at that position in the first antibody, or antigen-binding portion thereof;

l) wherein the target antigen is selected from the group consisting of a polypeptide, carbohydrate, lipid, nucleic acid, and a small molecule;

m) wherein the target antigen is expressed on the surface of a virus, bacteria, tumor or other cell, or is a recombinant protein or peptide;

n) wherein the target antigen is a protein that is a target for therapeutic intervention;

o) wherein the target antigen is involved in cell proliferation and differentiation, cell migration, apoptosis or angiogenesis;

p) wherein the target antigen is selected from the group consisting of a VEGFR-1, VEGFR-2, VEGFR-3 (vascular endothelial growth factor receptors 1, 2, and 3), a epidermal growth factor receptor (EGFR), ErbB-2, ErbB-3, IGF-R1, C-Met (also known as hepatocyte growth factor receptor; HGFR), DLL4, DDR1 (discoidin domain receptor), KIT (receptor for c-kit), FGFR1, FGFR2, FGFR4 (fibroblast growth factor receptors 1, 2, and 4), RON (recepteur d'origine nantais; also known as macrophage stimulating 1 receptor), TEK (endothelial-specific receptor tyrosine kinase), TIE (tyrosine kinase with immunoglobulin and epidermal growth factor homology domains receptor), CSF1R (colony stimulating factor 1 receptor), PDGFRB (platelet-derived growth factor receptor B), EPHA1, EPHA2, EPHB1 (erythropoietin-producing hepatocellular receptor A1, A2 and B1), TNF-R1, TNF-R2, HVEM, LT-βR, CD20, CD3, CD25, NOTCH, G-CSF-R, GM-CSF-R, EPO-R., a cadherin, an integrin, CD52, CD44, VEGF-A, VEGF-B, VEGF-C, VEGF-D, PIGF, EGF, HGF, TNF-α, LIGHT, BTLA, lymphotoxin (LT), IgE, G-CSF, GM-CSF and EPO;

q) wherein the first antibody, or antigen-binding portion thereof, binds to the target antigen with a binding affinity when the antibody, or antigen-binding portion thereof, is in a Fab form that is about 10−4 M or lower; about 10−4 M to about 10−8 M; or that is at or about 10−4 M, 10−5 M, 10−6 M, 10−7 M, 10−8 M, or lower;

r) wherein scanning mutagenesis is performed within the variable heavy chain of the first antibody, or antigen-binding portion thereof, and steps a)-h) are performed therefrom;

s) wherein scanning mutagenesis is performed within the variable light chain of the first antibody, or antigen-binding portion thereof, and steps a)-h) are performed therefrom

t) wherein scanning mutagenesis is performed within the variable heavy chain of the first antibody and steps a)-h) are performed therefrom, and separately and independently, scanning mutagenesis is performed within the variable light chain of the first antibody, and steps a)-h) are performed therefrom;

u) wherein the third antibody, or antigen-binding portion thereof, exhibits at least 2-fold improved activity for the target antigen compared to the first and/or second antibody(ies), or antigen-binding portion(s) thereof; 2-fold to 10000-fold or 2-fold to 1000-fold improved activity for the target antigen compared to the first and/or second antibody(ies), or antigen-binding portion(s) thereof; or at least 2-fold, 5-fold, 10-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700-fold, 800-fold, 900-fold, 1000-fold, 2000-fold, 3000-fold, 4000-fold, 5000-fold, 10000-fold or more improved activity for the target antigen compared to the first and/or second antibody(ies), or antigen-binding portion(s) thereof;

v) wherein the third antibody, or antigen-binding portion thereof, exhibits a binding affinity that is greater than the binding affinity of the first antibody, or antigen-binding portion thereof, and is about 1×10−9 M or less; is 1×10−9 M to 1×10−11 M; or is or is about 1×10−9 M, 2×10−9 M, 3×10−9 M, 4×10−9 M, 5×10−9 M, 6×10−9 M, 7×10−9 M, 8×10−9 M, 9×10−9 M, 1×10−10 M, 2×10−10 M, 3×10−10 M, 4×10−10 M, 5×10−10 M, 6×10−10 M, 7×10−10 M, 8×10−10 M, 9×10−10 M, or less;

w) further comprising determining the amino acid modifications that are altered in the third antibody, or antigen-binding portion thereof, compared to the first antibody, or antigen-binding portion thereof, not containing the amino acid replacements;

x) wherein the method is repeated iteratively, and wherein the third antibody, or antigen-binding portion thereof, identified in step h) is selected and used in step a) as the first antibody, or antigen-binding portion thereof, for subsequent maturation thereof, whereby the amino acid residue that is modified is not further modified in subsequent iterations of the method;

y) wherein one or more amino acid replacement in one or more variable heavy chains or one or more variable light chains, or portions thereof, of selected third antibodies, or antigen-binding portions thereof, are combined to generate a further modified antibody, or antigen-binding portion thereof, whereby the further modified antibodies, or antigen-binding portions thereof, are screened for an activity to the target antigen to identify a further modified antibody, or antigen-binding portion thereof, that exhibits an increased activity for the target antigen compared to the first, second, and/or third antibodies, or antigen-binding portions thereof; and

z) wherein the method comprises performing steps a)-h) on the variable heavy chain, or portion thereof, of the first antibody, or antigen-binding portion thereof, and selecting third antibodies, or antigen-binding portion thereof, each containing an amino acid replacement in the variable heavy chain, or portion thereof, compared to the corresponding variable heavy chain, or portion thereof, of the first antibody, or antigen-binding portion thereof;

performing steps a)-h) independently and separately on the variable light chain, or portion thereof, of the first antibody, or antigen-binding portion thereof, and selecting different third modified antibodies, or antigen-binding portions thereof, each containing an amino replacement in the variable light chain, or portion thereof, compared to the corresponding variable light chain, or portion thereof, of the first antibody;

combining the variable heavy chain, or portion thereof, of a third antibody, or antigen-binding portion thereof, with the variable light chain, or portion thereof, of a different third antibody, or antigen-binding portion thereof, to generate a plurality of different further modified antibodies, or antigen-binding portions thereof, each comprising an amino acid replacement of the variable heavy chain, or portion thereof, and variable light chain, or portion thereof, compared to the corresponding variable heavy or light chains, or portion(s) thereof, of the first antibody, or antigen-binding portion thereof;

screening each of the plurality of further modified antibodies, or antigen-binding portions thereof, for binding to the target antigen; and

selecting those fourth antibodies, or antigen-binding portions thereof, that exhibit an increased activity for the target antigen compared to the first, second, and/or third antibodies, or antigen-binding portions thereof; and

aa) wherein the antibody, or antigen-binding portion thereof, comprising a variable heavy chain and a variable light chain, or a portion thereof, is selected from the group consisting of a Fab, Fab′, F(ab′)2, single-chain Fv (scFv), scFab, Fv, dsFv, diabody, Fd, Fd′, Fab fragment, Fd fragment, Fd′ fragment, scFv fragment, and scFab fragment.

111. A method according to claim 109, further comprising after selecting a third antibody in step h),

i) selecting another different region within the variable heavy chain or variable light chain of the third antibody, or antigen-binding portion thereof, optionally a different region selected from the group consisting of a CDR1, CDR2, CDR3, FR1, FR2, FR3, and FR4, for further mutagenesis;

j) producing a plurality of nucleic acid molecules that encode modified forms of the variable heavy chain or variable light chain of the third antibody, or antigen-binding portion thereof, wherein the nucleic acids molecules contain one codon encoding an amino acid in the selected region that encodes a different amino acid from the first modified variable heavy or variable light chain, whereby each nucleic acid molecule of the plurality encodes a variable heavy chain or variable light chain that is modified in the selected region by replacement of a single amino acid residue;

k) producing a plurality of further modified antibodies each comprising a variable heavy chain and a variable light chain, or a portion thereof, wherein at least one of the variable heavy chain or variable light chain is one produced in step j), whereby the selected region in each of the plurality of antibodies, or antigen-binding portions thereof, contains replacement of an amino acid to a different amino acid compared to the third antibody, or antigen-binding portion thereof;

l) screening each of the plurality of further modified antibodies, or antigen-binding portions thereof, for binding to the target antigen; and

m) selecting those further modified antibodies, or antigen-binding portions thereof, that exhibit increased activity for the target antigen compared to the third antibody, or antigen-binding portion thereof.