US20130130293A1
2013-05-23
13/346,798
2012-01-10
Methods are provided for making restriction endonucleases with reduced star activity by one or more targeted mutations to a catalytic site within the restriction endonuclease. Examples of modifications to restriction endonucleases with significant sequence identity with KpnI are provided and reduced star activity demonstrated.
Get notified when new applications in this technology area are published.
C12N9/16 » CPC main
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Hydrolases (3) acting on ester bonds (3.1)
This application is a divisional of U.S. application Ser. No. 12/065,384 filed Feb. 29, 2008, which is a §371 application of international application number PCT/US2006/032519 filed on Aug. 18, 2006, which claims priority from U.S. provisional application Ser. No. 60/713,129 filed Aug. 31, 2005, herein incorporated by reference.
The KpnI restriction endonuclease is an orthodox Type IIP enzyme, which binds to DNA in the absence of metal ions and cleaves in the presence of Mg2+. KpnI restriction endonuclease from Klebsiella pneumoniae, was characterized by Tomassini et al. Nucleic Acids Res. 5:4055-4064 (1978); Kiss et al. Nucleic Acids Res. 19:3460 (1991); Chandrashekaran et al. Nucleic Acids Res. 32:3148-3155 (2004) and cloned and sequenced as described in U.S. Pat. Nos. 5,192,675 and 5,082,784. KpnI is sold commercially in a buffer containing 10 mM Bis Tris Propane-HCl, 10 mM MgCl2, 1 mM dithtiothreitol (pH 7.0 at 25° C.) (New England Biolabs, Inc., Ipswich, Mass.).
KpnI recognizes the palindromic double-stranded hexameric DNA sequence 5′-GGTAC↓C-3′ cleaving the DNA at the indicated position [↓] to generate a 3′, 4-base overhang (Kosinski et al. Proteins 53:369-379 (2003)). KpnI restriction endonuclease forms a restriction-modification system together with KpnI methyltransferase, which transfers a methyl group from the cofactor AdoMet onto the N6-position of the adenine in both strands within the same sequence.
In an embodiment of the invention, a KpnI restriction endonuclease is provided in an effective cleavage buffer, the KpnI having reduced star activity for substrate DNA, compared with star activity of KpnI for the same substrate in 10 mM Bis Tris Propane-HCl, 10mM MgCl2, 1 mM dithiothreitol pH 7.0 at 25° C., as determined by gel electrophoresis.
In further embodiments of the invention, the effective cleavage buffer contains calcium ions.
Further embodiments of the invention provide a DNA encoding a modified KpnI restriction endonuclease; a host cell expressing the modified KpnI restriction endonuclease; and a modified KpnI restriction endonuclease. The modified KpnI restriction endonuclease is characterized by properties that include the following: having a catalytic motif PDX . . . D/EXK (SEQ ID NO:16) wherein one or more amino acids in the motif are mutated; and having reduced star activity in a buffer for substrate DNA, compared with star activity of unmodified KpnI in the same buffer as determined by gel electrophoresis. In examples of mutations that result in reduced star activity, the one or more amino acid mutations may be a single mutation, for example D163 or K165, more particularly D163I or K165A; or two amino acid mutations, for example, D163 and K165, more particularly D163I and K165A.
In a further embodiment of the invention, a method is provided for reducing star activity of a restriction endonuclease, that includes: (a) creating one or more mutations targeted to DNA encoding a catalytic site within DNA encoding the restriction endonuclease; (b) transforming a host cell with DNA encoding the mutated restriction endonuclease; (c) assaying the mutated restriction endonuclease produced by the transformed host cells for reduced star activity; and (d) selecting the restriction endonuclease with reduced star activity.
According to the method, the restriction endonuclease may be further defined as having at least 50%, 60%, 70%, 80% or 90% sequence homology with KpnI. Additionally, the one or more mutations may be targeted to amino acids in the PDX . . . D/EXK (SEQ ID NO:16) motif to generate a modified restriction endonuclease with reduced star activity. In a further embodiment, two mutations may be targeted to the PDX . . . D/EXK (SEQ ID NO:16) motif.
FIGS. 1A-1E show promiscuous cleavage by wild-type KpnI restriction endonuclease. Plasmid DNA was cleaved by KpnI in the presence Mg2+(FIG. 1A), Mn2+(FIG. 1B), and Ca2+(FIG. 1C).
Different amounts of KpnI restriction endonuclease were incubated with pUC18 DNA in assay buffer containing 5 mM Mg2+ or Mn2+ or Ca2+ and 10 mM Tris-HCl (pH 7.4) at 37° C. for 1 h. The cleavage products were analyzed by 1% agarose gel electrophoresis. FIGS. 1D and 1E show cleavage of methylated plasmid DNA substrates by KpnI restriction endonuclease. The plasmids pUC18 (FIG. 1D) and pUCΔK (FIG. 1E) isolated from E. coli DH10B (pACMK) expressing KpnI methyltransferase were incubated with different concentrations of KpnI restriction endonuclease (0-100 units) in the presence of 5 mM Mg2+.
The reactions were terminated by adding a mixture of 0.6% SDS and 25 mM EDTA. The samples were analyzed on 1% agarose gel. In each panel, Lane 0 represents the buffer control with the respective metal ions as indicated.
FIGS. 2A-2B show a comparison of cleavage activity using KpnI wild type and D163I/K165A, D163I and K165A mutants. The reaction conditions were: 3 μl of KpnI cell extract (approximately 4000 units of enzyme) were reacted with 0.5 μg pUC19 (one-site substrate with size 2.6Kb) for 30 min at 37° C. in 1×NEB1 buffer (New England Biolabs, Inc., Ipswich, Mass.); the total reaction volume was 30 μl.
FIG. 2A: KpnI D163I and K165A:
Lane 1: NEB 1kb DNA marker (New England Biolabs, Inc., Ipswich, Mass.);
Lanes 2-5: The D163I extract diluted at 1, 10, 100, 1000 fold (Lane 5). Lanes 6-9 duplicate Lanes 2-5;
Lanes 10-12: The K165A extract diluted at 1, 10, 100, 1000 fold (Lane 5); and
Lanes 13-16: duplicate of Lanes 10-12.
FIG. 2B: KpnI wild-type and D163I/K165A.
Lane 1: NEB 1kb DNA marker (New England Biolabs, Inc., Ipswich, Mass.);
Lanes 2-5: The wild-type extract diluted at 1, 10, 100, 1000 fold;
Lanes 6-9: duplicate of Lanes 2-5.
Lanes 10-12: The D163I/K165A extract diluted at 1, 10, 100, 1000 fold;
Lanes 13-16: duplicate of Lanes 10-12.
The arrows indicate lanes containing undiluted endonuclease. At high concentrations, the wild-type has star activity, which is evident from the smears in Lanes 2 and 6 in FIG. 2B compared with the sharp bands in Lanes 2, 6, 10 and 14 in FIG. 2A and Lanes 10 and 14 in FIG. 2B. D163I has reduced star activity compared with K165A. The double mutant has still further reduced star activity.
FIG. 3 show a comparison of KpnI wild-type (FIG. 3B) and D163I/K165A mutant KpnI (FIG. 3A) over an extended dilution range where the mutant shows significantly reduced star activity evan at 64 fold greater concentration compared with wild-type KpnI.
Lane 1: 1 kb DNA marker (New England Biolabs, Inc., Ipswich, Mass.);
Lanes 2-17: The KpnI D163I/K165A (FIG. 3A) and wild type (FIG. 3B) each diluted at 1, 2, 4, 8, 16, 32, 64, 128, 256, 512, 1024, 2048, 4096, 8192, 16384, 32768 fold; 3 μl serial diluted extract digested 0.5 μg pUC19 in NEB1 at 37° C. for 1 hour (New England Biolabs, Inc., Ipswich, Mass.).
Lane 18: undigested pUC19.
The arrow in FIG. 3B points to the extra bands corresponding to cleavage fragments resulting from star activity of wild-type KpnI.
FIG. 4 shows sequence matching between the amino acid sequence for KpnI (SEQ ID NO:13) and the amino acid for CsyAM12ORFAP (SEQ ID NO:14).
The sequence comparison was achieved using the following parameters:
Query=KpnI(218 letters)>CsyAM12ORFAP GGTACC Length=259
Score=263 bits (672), Expect=2e-75
It is well established that KpnI has star activity in Mg2+ buffer. Star activity results from the recognition and cleavage of secondary cleavage sites in addition to a primary cleavage site. The secondary cleavage sites differ by one or more nucleotides from the primary recognition site. For KpnI, the primary cleavage site is GGTAC↓C. Secondary cleavage sites include tGTACC, GtTACC, GaTACC, GGaACC, GGTcCC, GGTAtC, GGTACg, and GGTACt.
Star activity for KpnI is generally observed in longer pieces of DNA substrates (greater then 1 kb) in which secondary cleavage sites are more likely to arise. Certain buffers such as manganese buffers are more likely to favor star activity. In addition star activity is observed when the restriction endonuclease is present at increased concentrations (for example greater than 15 units). However, the cause or mechanism of star activity is not well understood either for KpnI or for other restriction endonucleases.
While not wishing to be limited by theory, KpnI is believed to have two catalytic sites so that inhibition of one of the sites (by, for example, calcium ions) or mutation (to inhibit cleavage activity) will reduce star activity. Any restriction endonuclease having significant sequence homology to KpnI such as CsyAM12OREAP (See FIG. 4) is believed to have star activity, which can be reduced in the presence of Ca2+ or mutation(s) in one of its catalytic domains.
A structural and bioinformatic approach to analyzing promiscuous cleavage activity was undertaken by Chandrashekaren et al. (J. Biol. Chem. 279:49736-49740 (2004)) hereby incorporated by reference.
Although the properties of each restriction endonuclease is very variable from one endonuclease to another and there are no general rules about structure or sequence, some endonucleases have been noted to contain somewhere in their sequence, one or more PDX10-30(D/E)XK (SEQ ID NO:16) motifs involved in metal binding and DNA cleavage.
Bioinformatics analysis revealed that KpnI restriction endonuclease contains a ββαMe-finger fold, which is characteristic of many HNH-superfamily endonucleases. Members of the HNH-superfamily include homing endonuclease I-HmuI, structure-specific T4 endonuclease VII, colicin E9, sequence non-specific Serratia nuclease and sequence-specific homing endonuclease I-PpoI. In addition to the HNH catalytic site, KpnI also contains the PDX . . . D/EXK (SEQ ID NO:16) catalytic motif mentioned above. CsyAM12OREAP, which shares 54% sequence identity with KpnI, is expected to have a similar catalytic sequence and folding properties to KpnI. It is generally predicted that any restriction endonuclease sequence in GenBank having a sequence identity of about 30%, more particularly 40% more particularly 50% or greater will have a similar catalytic sequence and folding properties (see for example, CsyAM12OREAP, which has 54% amino acid sequence identity).
Once the catalytic sites of the KpnI were identified, individual amino acid residues were mutated within the sites. In specific embodiments, mutations at D148, H149 and Q175 of KpnI corresponding to the critical D, H and N or H residues of the HNH nucleases do not result in a change in star activity but instead resulted in loss of catalytic cleavage. For example, H149L mutant showed reduced DNA binding and complete loss of DNA cleavage in the presence of both Mg2+ and Mn2+. Mg2+-mediated DNA cleavage was drastically reduced in selected mutants such as D148G and Q175E, while Mn2+-mediated cleavage was not affected. The mutant Q175E fails to bind DNA at standard conditions, although the DNA binding and cleavage could be rescued at pH 6.0, indicating a role for Q175 in DNA binding and cleavage. While not wishing to be limited by theory, it is suggested that D148 and Q175 are involved in Mg2+ coordination and H149 could be acting as a general base essential for DNA cleavage.
Mutation of amino acids in PDX . . . D/EXK (SEQ ID NO:16) surprisingly did not lead to loss of catalytic activity as observed for other restriction endonucleases (see for example, BamHI, Xu et al. J. Bacteriology 173:5030 (1991)). Instead when D163 or K165, which are part of the PDX14 D163 P164 K165 motif, were mutated, reduction in star activity was observed (see FIGS. 2A-2B and 3A-3B). A further reduction of star activity was observed when both D163 and K165 were mutated. The reduction of star activity was observed in standard magnesium buffer.
An unexpected reduction in star activity can also be achieved for wild-type KpnI when magnesium or manganese buffers are substituted with a calcium buffer (see FIGS. 1A-1E).
The present invention is further illustrated by the following Examples. These Examples are provided to aid in the understanding of the invention and should not be considered as a limitation thereof.
All references cited above and below are herein incorporated by reference including Chandrashekaren et al. J. Biological Chemistry 279:49736-49740 (2004), Saravanan et al. Nucleic Acid Research 32:6129-6135 (2004), Saravanan et al. Published Abstract: 5th New England Biolabs Meeting on Restriction/Modification Sep. 4-8, 2004 and U.S. Provisional Application No. 60/713,129 filed Aug. 31, 2005.
Sequence searches of the non-redundant database were carried out with PSI-BLAST (Kurowski And Bujnicki Nucleic Acids Res. 31:3305-3307 (2003)) via the NCBI website (http://www.ncbi.nlm.nih.gov), using the sequence of T4 Endonuclease VII (EndoVII) as a query. An expectation (e)-value <10−3 was used to identify HNH-superfamily members related to EndoVIl and build a multiple sequence alignment, subsequently converted to a position-specific scoring matrix (PSSM). The searches were iterated with the PSSM as a query until no more homologs with e-value <10−3 could be identified. Then, the cutoff was lowered to 0.1 and searches were continued with an additional criterion that potential HNH-superfamily members had to exhibit the residues of the common active site (otherwise, the sequences were not included in the PSSM). Protein structure prediction was carried out via the GeneSilico metaserver gateway [http://genesilico.pl/meta/(Kosinski et al. Proteins 53:369-379 (2003). The sequence alignment between KpnI (Genbank X61796) and structurally characterized HNH-superfamily nucleases obtained from PSI-BLAST (after 15 iterations) was used as a starting point for homology modelling using the ‘Frankenstein's monster’ approach, comprising cycles of model building, evaluation, realignment in poorly scored regions and merging of best-scoring fragments (see Altschul et al. Nucleic Acids Res. 25:3389-3402 (1997)) for a detailed description. The positions of predicted catalytic residues and secondary structure elements were used as spatial restraints.
PSI-BLAST sequence searches of the non-redundant database revealed remote homology between EndoVII and KpnI (see also Aravind et al. Nucleic Acids Res. 28:3417-3432 (2000)). Our analyses resulted in a sequence alignment slightly different from that published in the earlier work (Aravind et al. Nucleic Acids Res. 28:3417-3432 (2000)). We confirmed the earlier prediction of the catalytic core, but also identified a potential Zn-finger conserved between KpnI and EndoVII, which were partially misaligned previously (Aravind et al. Nucleic Acids Res. 28:3417-3432 (2000)). In order to facilitate the interpretation of experimental data in the sequence-structure-function context, we built a theoretical model of the KpnI catalytic domain (residues 97-190) in complex with the target DNA. The homology model of the KpnI monomer was generated based on the sequence alignment with known structures of HNH-superfamily members. The mutual orientation of the two KpnI monomers as well as the coordinates of the DNA molecule and the Mg2+ ions were based on superposition onto the subunits A and B in the I-PpoI co-crystal structure (Galburt et al. Nature Struct Biol. 6:1096-1099 (1999)). The GGTACC site recognized by KpnI was generated by ‘mutating’ bases in the original I-PpoI target (CTTAAG) and optimizing their geometry using HyperChem 7.1 (Hypercube, Inc., Gainesville, Fla.). The final model of the KpnI dimer complexed with the GGTACC sequence (available for download from ftp://genesilico.pl/iamb/models/KpnI/) was obtained after steric clashes between a few residues from both monomers and the DNA was removed by selecting different rotamers of the respective side chains.
Plasmid pETRK contains the wild-type KpnI restriction endonuclease gene cloned into the pET11d expression vector (Chandrashekaran et al. J. Biosci 24:269-277 (1999)). KpnI restriction endonuclease and its mutants were purified as described previously (Chandrashekaran et al. J. Biosci 24:269-277 (1999)). The enzymes were diluted in binding buffer [20 mM Tris-HCl (pH 7.4), 25 mM NaCl and 5 mM 2-mercaptoethanol] for all the studies. The concentration of the proteins was estimated by the method of Bradford (Anal. Biochem. 72:248-254 (1976)). T4 polynucleotide kinase, Pfu DNA polymerase and DpnI were purchased from New England Biolabs, Inc. (Ipswich, Mass.) for use in inverse PCR.
Oligonucleotide primers (Microsynth Inc, Balgach, Switzerland) were purified on 18% urea-polyacrylamide gel (Sambrook et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., pp. 35-38 (1989)). The purified oligonucleotides were end-labeled with T4 polynucleotide kinase and [λ-32P]ATP (6000 Ci/mmol).
KpnI restriction endonuclease mutants were generated by site-directed mutagenesis using the megaprimer inverse PCR method (Kirsch and Joly, Nucleic Acids Res. 26:1848-1850 (1998))). Expression plasmid pETRK encoding the wild-type kpnR gene was used as a template. The oligonucleotide primers carrying the respective mutant amino acid codon substitutions were used as forward primers. These were as follows:
| (SEQ ID NO: 1) | |
| D148G: 5′ CTAACACCTGGCCATATGACAC-3′ | |
| (SEQ ID NO: 2) | |
| H149L: 5′ ACACCAGACCTTATGACACCTC-3′ | |
| (SEQ ID NO: 3) | |
| Q175E: 5′-TGTGGACGTTCATGAAGTTATGAAA-3′ | |
| (SEQ ID NO: 4) | |
| D148A: 5′-AACTAACACCAGCCCATATGACA-3′ | |
| (SEQ ID NO: 5) | |
| H149A: 5′-ACACCAGACGCTATGACACCTC-3′ |
and T7 terminator primer was used as reverse primer:
| (SEQ ID NO: 6) | |
| 5′-GCTAGTTATTGTTCAGCGGTGGG-3′ |
The mega primers generated were used as complementary primers for the second round of PCR amplification. After confirming the mutation by sequencing, the mutant restriction endonucleases were expressed in E. coli BL26 [F− omp T hsdSB (rB− mB−) gal dcm Δlac (DE3) nin5 lac UV5-T7 gene 1] expressing M.KpnI and purified as described previously (Chandrashekaran et al. J. Biosci. 24:269-277 (1999)).
The homology model of KpnI restriction endonuclease reveals the ββα-Me finger fold composed of two antiparallel β-strands, an α-helix and a metal ion, between the first strand and the helix. Based on the bioinformatics analysis, amino acid residues D148, H149 and Q175 of KpnI restriction endonuclease are predicted to be functionally equivalent to the catalytic/metal-binding residues D40, H41 and N62 of T4 EndoVII (Raaijmakers et al. J. Mol. Biol. 308:311-323 (2001)), and the corresponding residues of other HNH nucleases. Thus, D148, H149 and Q175 were targeted for mutagenesis. The mutations were confirmed by restriction digestion and sequencing analysis. The mutant kpnlR genes present in the pET11d vector were expressed in E. coli BL26 and the mutant proteins were purified. During purification steps, all the mutants exhibited properties similar to that of wild-type enzyme, suggesting that they were properly folded.
Different concentrations of the wild-type and mutant KpnI restriction endonuclease (0.1-128 nM) were incubated with 3.75 nM of end-labeled double-stranded oligonucleotides containing cognate site in the buffers [20 mM Tris-HCl (pH 7.4), 25 mM NaCl and 5 mM 2-mercaptoethanol or 20 mM HEPES (pH 6.0), 25 mM NaCl and 5 mM 2-mercaptoethanol] on ice for 15 min. The free DNA and the enzyme-bound complexes were then separated on 8% native polyacrylamide gels with running buffers containing 90 mM Tris-borate pH 8.0 and 1 mM EDTA or 50 mM HEPES, pH 6.0 and 1 mM EDTA. The gels were electrophoresed at 4° C. for 1 h, dried and autoradiographed. The amounts of DNA in free and bound form were quantitated using Phosphorimager Image Gauge software version 2.54. The assays were repeated three times and the average values were considered for Scatchard analysis to determine the affinity of the proteins.
Purified KpnI restriction endonuclease and its mutants were incubated in 20 mM HEPES-KOH (pH 6.0) or 10 mM Tris-HCl (pH 7.0-9.0), 1 mM EDTA, 5 mM β-mercaptoethanol, 5 mM MgCl2 for 1 h at 37° C. and 500 ng of plasmid DNA. The cleavage products were analyzed on 1% agarose gel.
Wild-type KpnI restriction endonuclease and its mutants were assayed for the ability to cleave DNA. pUC18 DNA was completely linearized by 1 nM wild-type enzyme. Under the same assay conditions, no cleavage product was detected with the mutant H149L even at 100-fold excess protein concentrations. Mutant H149A also behaved in the same fashion. Mutants D148G and Q175E showed only traces of the DNA cleavage activity when used in large excess. Similar results were observed with D148A. In order to measure the residual activity more precisely, reactions were performed with higher concentrations of D148G and Q175E. No complete linearization of the DNA substrate could be observed even at 2 μM (2000-fold excess) of the enzyme concentration. However, prolonged incubation for 12 h resulted in near-complete DNA cleavage with D148G, while the pattern with H149L and Q175E did not change significantly under standard assay conditions. In contrast, incubation with very low amounts of the wild-type enzyme (0.05 units) for prolonged incubation lead to complete DNA cleavage. Thus, all three residues of the predicted HNH motif were found to be essential for the restriction endonuclease activity.
KpnI restriction endonuclease was purified as described previously (Tomassini et al. Nucleic Acids Res. 5:4055-4064 (1988)). The enzyme was diluted in binding buffer (20 mM Tris-HCl (pH 7.4), 25 mM NaCl, and 5 mM 2-mercaptoethanol) for all the studies. The concentration of the enzyme was estimated by the method of Bradford (Anal. Biochem. 72:248-254 (1976)). One unit of KpnI Restriction endonuclease is defined as the amount of enzyme required for complete digestion of 1 μg of λDNA at 37° C. for 1 h by using assay buffer containing 5 mM Mg2+.
Standard assay conditions involved lower enzyme units to DNA ratio (up to 10 units of enzyme), whereas in relaxed assay conditions, more than 15 units of enzyme were used. Digestions were carried out by incubating different units of KpnI restriction endonuclease with plasmid DNA or 0.2 pmol of labeled oligonucleotides in assay buffer containing 10 mM Tris-HCl (pH 7.4), 5 mM β-mercaptoethanol, and appropriate concentrations of divalent metal ions at 37° C. for 1 h. The reactions were terminated by adding stop dye containing 0.6% SDS and 25 mM EDTA. The cleavage products of plasmid DNA and oligonucleotides were analyzed on 1% agarose or 12% urea-polyacrylamide gel, respectively. The Ca2+ chase reactions were carried out at a fixed concentration of Mg2+ (2 mM) or Mn2+ (0.5 mM) by using increasing concentrations of Ca2+.
The effect of divalent metal ions (FIGS. 1A-1E) on the activity of KpnI restriction endonuclease was studied by using plasmid DNA as substrates (for example, pUC18 or pACMK (from New England Biolabs, Inc., Ipswich, Mass.). KpnI restriction endonuclease exhibits relaxed specificity at high enzyme to substrate ratios. A high degree of promiscuous activity was observed when more than 15 units of the enzyme were used in the presence of Mg2+ (FIG. 1A).
KpnI restriction endonuclease exhibits specific DNA cleavage in presence of Ca2+ (FIG. 1C) showing greater specificity at high enzyme to substrate ratios in contrast to the cleavage pattern with Mg2+.
No DNA cleavage was detected at the noncanonical sites in the presence of Ca2+ even at a high enzyme to substrate ratio (FIG. 1C). The Ca2+-mediated DNA cleavage is confined to the canonical site irrespective of plasmid or oligonucleotide substrates.
The plasmid pSYX20-KpnIM and pAGR3-KpnIR was extracted from NEB strain 977 by standard Qiagen miniprep kit (Qiagen, Valencia, Calif.). The mixture of plasmids was used to transform ER2502 by chemical means. The transformants were plated on Kanamycin (Kan) plates. Ten of the transformed colonies were picked and each transformant was checked to determine the presence of a single plasmid. The genomic DNA from these cells was also checked for protective modification against KpnI digestion. These colonies were grown and made into chemical competent cells.
KpnI mutants D163I, K165A and D163/K165A were constructed by inverse PCR. The PCR primers were as following:
| (SEQ ID NO: 7) |
| 5′ CCCGCAACTGATGTAAATATTCCTAAAATGTGGCAAGCA 3′ |
| (D163IF) |
| (SEQ ID NO: 8) |
| 5′ TGCTTGCCACATTTTAGGAATATTTACATCAGTTGCGGG 3′ |
| (D163IR) |
| (SEQ ID NO: 9) |
| 5′ ACTGATGTAAATGATCCTGCAATGTGGCAAGCATTGTGT 3′ |
| (K165AF) |
| (SEQ ID NO: 10) |
| 5′ ACACAATGCTTGCCACATTGCAGGATCATTTACATCAGT 3′ |
| (K165AR) |
| (SEQ ID NO: 11) |
| 5′ CCCGCAACTGATGTAAATATTCCTGCAATGTGGCAAGCATTGTG |
| T 3′ |
| (D163I/K165AF) |
| (SEQ ID NO: 12) |
| 5′ ACACAATGCTTGCCACATTGCAGGAATATTTACATCAGTTGCGG |
| G 3′ |
| (D163I/K165AR) |
The PCR composition was as follows: 1 μl pAGR3-KpnIR as template, 2 μl each of the primers, 4 μl 10 mM dNTP, 10 μl 10×Thermopol buffer, 2 μl Deep Vent DNA polymerase (4 units) (New England Biolabs, Inc., Ipswich, Mass.); 0, 2, or 6 μl 100 mM MgSO4. H2O was added to a final volume of 100 μl . The reaction condition was: 94° C. 5 min, followed by 20 cycles of 94° C. 30 sec, 55° C. 30 sec and 72° C. 6 min and 36 sec, and a final 72° C. for 7 min. 4 μl PCR product was treated with 40 units of DpnI and then transformed into ER2502[pSYX20-KpnIM] and selected on ampiciillin- and kanamycin-containing plates. Four colonies corresponding to each of the transformants were grown and plasmid DNA extracted and sequenced to confirm the presence of the desired mutations.
Two of the colonies were grown into 10 ml overnight cultures. 200 μl of each overnight culture were inoculated into 10 ml LB with ampicillin and kanamycin. After 5 hours growth, the cells were induced with 0.5 mM IPTG (isopropyl-beta-D-thiogalactopyranoside) and grown overnight. The cultures were spun down and sonicated in 1 ml sonication buffer (10 mM pH7.5 Tris-HCl, 50 mM NaCl, and 10 mM β-Me). The extracts were diluted 10, 100 or 1000 fold, and 3 μl from each dilution were reacted with 0.5 μg pUC19 (one-site substrate) for 30 min at 37° C. in 1×NEB1 buffer (New England Biolabs, Inc., Ipswich, Mass.). The digested pUC19 was run on 0.8% agarose gel. At undiluted concentration of the extract, the wild-type KpnI digested pUC19 into multiple bands (star activity), while the D163I/K165A, D163I and K165A mutant KpnI all showed enhanced amounts of single band cleavage product compared with wild-type KpnI. At a high protein concentration, the DNA band was bound and retarded in the gel. A comparison of the mutants revealed that the double KpnI mutant D163I/K165A yielded cleavage product with the least star activity compared with the single mutants. A side-by-side comparison was made again for KpnI D163I/K165A with wild-type at 1:2 serial dilution. 3 μl serial diluted extract digested 0.5 μg pUC19 in NEB1 at 37° C. for 1 hour (New England Biolabs, Inc., Ipswich, Mass.). The KpnI D163I/K165A retained the same specific activity to turn pUC19 from super-coiled form to linear form, while it cleaved pUC19 into a single band. In contrast, wild-type KpnI digested pUC19 into multiple bands. The KpnI D163I/K165A was found to have no more than 1/64 of the wild-type KpnI star activity, and could be expressed in a host cell preparation at 10,000,000 units/gram of wet cells.
1. A KpnI restriction endonuclease in an effective cleavage buffer, the KpnI having reduced star activity for substrate DNA, compared with star activity of KpnI for the same substrate in 10 mM Bis Tris Propane-HCl, 10mM MgCl2, 1 mM dithiothreitol pH 7.0 at 25° C., as determined by gel electrophoresis.
2. A KpnI restriction endonuclease according to claim 1, wherein the effective cleavage buffer contains calcium ions.
3. (withdrawn and currently amended) A modified KpnI restriction endonuclease having a catalytic motif (SEQ ID NO:16), wherein one or more amino acids in the motif are mutated, the modified KpnI restriction endonuclease having reduced star activity in a buffer for substrate DNA, compared with star activity of unmodified KpnI in the same buffer as determined by gel electrophoresis.
4. A KpnI restriction endonuclease according to claim 3, wherein the one or more amino acid mutations is a single mutation selected from D163 and K165.
5. A KpnI restriction endonuclease according to claim 4, wherein the one or more amino acid mutations is a single mutation selected from D163I and K165A.
6. A KpnI restriction endonuclease according to claim 3, wherein the one or more amino acid mutations are two amino acid mutations.
7. A KpnI restriction endonuclease according to claim 6, wherein the two amino acid mutations are D163 and K165.
8. A KpnI restriction endonuclease according to claim 7, wherein the two amino acid mutations are D163I and K165A.
9. A DNA encoding the restriction endonuclease of claim 3, 5 or 7.
10. A host cell transformed with DNA of claim 9.
11. A method for reducing star activity of a restriction endonuclease, comprising:
(a) creating one or more mutations targeted to DNA encoding a catalytic site within a DNA encoding the restriction endonuclease;
(b) transforming a host cell with the DNA encoding the mutated restriction endonuclease;
(c) assaying the mutated restriction endonuclease produced by the transformed host cells for reduced star activity; and
(d) selecting the restriction endonuclease with reduced star activity.
12. A method according to claim 11, wherein the restriction endonuclease has at least 50% sequence homology with KpnI.
13. A method according to claim 11, wherein the restriction endonuclease has at least 60% sequence homology with KpnI.
14. A method according to claim 11, wherein the restriction endonuclease has at least 70% sequence homology with KpnI.
15. A method according to claim 11, wherein the restriction endonuclease has at least 80% sequence homology with KpnI.
16. A method according to claim 11, wherein the restriction endonuclease has at least 90% sequence homology with KpnI.
17. A method according to any of claims 11 through 16 wherein the one or more mutations are targeted to the (SEQ ID NO:16) motif.
18. A method according to claims 11 through 17 further comprising two mutations.