US20130150251A1
2013-06-13
13/663,240
2012-10-29
The present invention relates to compositions and methods useful for analyzing lariat RNA, which plays a role in the regulation of gene expression. A sample of RNA is specifically treated to remove linear mRNA and enrich for lariat RNA. The enriched lariat RNA sample may be analyzed further to identify introns, branch point sequences, alternative splicing patters, and gene transcription levels. The enriched lariat RNA sample may also be exploited as a detection or compound screening tool, as well as other uses.
Get notified when new applications in this technology area are published.
C12N9/16 » CPC main
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Hydrolases (3) acting on ester bonds (3.1)
The present invention relates to compositions, methods, and kits for analyzing lariat RNA. In particular, the invention relates to enriching an RNA population for lariat RNA and then analyzing the lariat RNA population.
Pre-mRNA introns play an important role in the regulation of gene expression for many eukaryotes because their presence allows for the occurrence of alternative splicing. Such alternative splicing results in the creation of multiple proteins from a single gene, many of which are expressed in cell- or tissue-specific patterns. The pre-mRNA introns are excised in a lariat conformation to produce mRNA. Following excision, the 3′ tails of the lariats are subject to exonucleolytic degradation up to the lariat branch point. The predominant pathway for further exonucleolytic degradation requires cleavage of the 2′-5′ bond located at the branch point. This cleavage event occurs via a RNA debranching enzyme, a 2′-5′ phosphodiesterase.
Although intron RNA sequences contain information necessary for their removal from pre-mRNAs, some introns contain additional information. In most eukaryotes microRNAs (miRNAs) and small nucleolar RNAs (snoRNAs) are encoded within introns. In studies with human cells it has been found that the vast majority of intronic miRNAs are excised from pre-mRNAs. Intronic snoRNAs, on the other hand, are processed from excised introns, as determined in baker's yeast, humans, and other eukaryotes.
Debranching and subsequent degradation of most intron RNAs are rapid, resulting in low steady state levels of intron RNAs relative levels of the corresponding mRNAs. The exceptions are intron sequences corresponding to RNAs with additional functions (e.g. snoRNAs). Studies in many different organisms have determined that cleavage of the 2′-5′ bond by an RNA debranching enzyme is important for the maturation of intron-encoded snoRNAs and mirtrons, which is another class of miRNAs that are processed from excised introns.
Genome-wide studies analyzing excised intron RNAs in fruit flies and yeast have identified new introns and alternative splicing patterns. These analyses relied on creating cell populations that accumulate excised intron RNAs at elevated levels due to either mutation of the gene encoding debranching enzyme or knock down of debranching enzyme expression with siRNA. Analysis of RNA samples with elevated levels of RNA lariats increases the detectability of rare splicing variants. Cells defective for RNA debranching activity accumulate excised introns in their lariat forms with shorted 3′ tails. Without the full length 3′ tail, information for the 3′ intron-exon junction is not obtainable from the intron lariat RNA sequences. However, studies have shown that the positions of RNA branch points may be deduced from analyzing intron RNA lariats. Direct information on branch points is only obtainable from analysis of RNA lariats. Therefore, there is a need to provide new compositions and methods for the analysis of RNA lariats that allow analysis of rare splicing variants and branch point sequences.
The application file contains at least one photograph executed in color. Copies of this patent application publication with color photographs will be provided by the Office upon request and payment of the necessary fee. The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
FIG. 1 illustrates reverse transcriptase polymerase chain reaction (RT-PCR) detection of lariat RNA. FIG. 1A shows the annealing positions of primers for RT-PCR detection of ACT1 gene intron lariat RNA and mRNA. The intron lariat RNA is detected using primers oligo 146 and oligo 363 (depicted by arrows within the intron lariat RNA loop). The linear mRNA is detected using primers oliog 215 and oligo 216 (depicted by small arrows below the mRNA arrow). FIG. 1B shows an agarose gel analysis of RT-PCRs for ACT1 RNA detected using the primers illustrated in FIG. 1A (mRNA=oligos 215/216; intron=oligos 146/363). Lanes 1-4 contain reactions run 15 cycles after the touchdown phase of polymerase chain reaction (PCR); lanes 5-8 contain reactions run 11 cycles after the touchdown phase of PCR; Lanes 1, 2, 5, and 6 contain reactions using wild type (DBR1) RNA samples; and, lanes 3, 4, 7, and 8 contain reactions using dbr1 mutant RNA samples. The different numbers of cycles were run to show the linearity of the PCRs.
FIG. 2 illustrates selective degradation of linear RNAs and not lariat RNAs. FIG. 2A shows an agarose gel analysis of RT-PCRs for ACT1 intron lariat RNA following a series of enzyme treatments (PNPase) at decreasing amounts (indicated by the wedge at the tope of the gel image, highest amount of enzyme used in lane 1 and lowest in lane 7). RT-PCRs for ACT1 intron lariat RNA were performed with primers 146 and 363 (see FIG. 1) and run for 15 cycles after the touchdown phase of the reaction.
FIG. 2B shows an agarose gel analysis of RT-PCRs for ACT1 linear mRNA from the same series of enzyme treatments of FIG. 2A. Lanes 15 and 16 contain ACT1 intron lariat and ACT1 linear mRNA RT-PCRs, respectively, of RNA samples that did not undergo PNPase treatment. The products in these lanes serve as size markers for the intron lariat and mRNA products in lanes 1-14. RT-PCRs for ACT1 mRNA were performed with primers 215 and 216 (see FIG. 1) and run for 24 cycles after the touchdown phase of the reaction.
FIG. 3 illustrates processivity of PNPase on FLO8 mRNA. FIG. 3A shows primer pairs for amplifying different segments along the length of FLO8 mRNA: ½=primers 372 and 373; ¾=primers 374 and 375; ⅚=primers 376 and 377; ⅞=primers 378/and 379; 9/10=primers 380 and 381; 11/12=primers 382 and 383. FIG. 3B shows a PAGE analysis of RT-PCRs for FLO8 mRNA segments following enzyme treatment (PNPase, + lanes) and mock treatment (− lanes) of a total cellular RNA sample that had been pretreated with DNase I. Lanes containing the various FLO8 RT-PCRs are indicated below the gel image; the FLO8 primer pairs are indicated above the gel image. RT-PCRs for ACT1 RNAs are in the four lanes under the ACT1 title and serve as controls that indicate the PNPase reactions preceded as expected. The RT-PCRs for ACT1 mRNA and intron RNA are indicated below the corresponding lanes. These reactions used primer pairs 215/216 and 146/363, respectively. The lane marked “M” contains a DNA molecular weight standard (50 base pair (bp) ladder). FIG. 3C shows a PAGE analysis of RT-PCRs as described for FIG. 3B except that the total cellular nucleic acid samples were not treated with DNase I prior to PNPase enzyme treatment and RT-PCRs. For all RT-PCRs in FIGS. 3B and 3C, reactions were performed with 24 cycles after the touchdown phase.
FIG. 4 illustrates the purification of Dbr1p. FIG. 4A shows the elution profile of histidine-tagged yeast Dbr1p, purified from E. coli, collected for 100 mM and 200 mM concentrations of imidazole. Dbr1p bound to a nickel-nitrilotriacetic acid (nickel-NTA) column was eluted with increasing concentrations of imidazole. Six, ˜1.5 mL fractions were collected for each imidazole concentration. FIG. 4B shows the elution profile of histidine-tagged yeast Dbr1p collected for 300 mM and 500 mM concentrations of imidazole. Key: “M” is the protein molecular weight standard; and, 1-6 are the fractions collected from the nickel-nitrilotriacetic column. FIG. 4C shows the matrix-assisted laser desorption/ionization-time-of-flight (MALDI-TOF) mass spectrometry analysis to assess the molecular mass of the main elution product in fractions 2-6 of the 100 mM imidazole elution.
FIG. 5 illustrates an in vitro debranching reaction. Specifically, FIG. 5 shows an agarose gel analysis of RT-PCRs for ACT1 RNAs following treatment with Dbr1p (+ lanes) and mock treatment (− lanes) of total cellular RNA sample. Key: lanes 2 and 4 contain RT-PCRs for ACT1 intron lariat RNA; lanes 1 and 3 are RT-PCRs for ACT1 mRNA; lane M contains a DNA molecular weight standard (50 bp ladder). RT-PCRs for ACT1 intron lariat RNA were run for 19 cycles after the touchdown phase of the reaction; RT-PCRs for ACT1 mRNA were run for 24 cycles after the touchdown phase of the reaction.
FIG. 6 shows combinations of PNPase and Dbr1p enzyme treatments. FIG. 6A shows an agarose gel analysis of RT-PCRs for ACT1 RNAs following treatment of a total cellular RNA sample from a dbr1 strain with Dbr1p (+Dbr1p) and PNPase (+PNPase) as well as mock treatment (− treatment). In this experiment, PNPase treatment preceded Dbr1p treatment for samples that were treated with both enzymes. Lanes 1, 3, 5, and 7 contain RT-PCRs for ACT1 mRNA of a total cellular RNA sample. Lanes 2, 4, 6, and 8 contain parallel RT-PCRs for ACT1 intron lariat RNA. FIG. 6B shows an agarose gel analysis of RT-PCRs for ACT1 RNAs following treatment of a total cellular RNA sample from a dbr1 strain with Dbr1p and PNPase as well as mock treatment. In this experiment, Dbr1p treatment preceded PNPase treatment for samples that were treated with both enzymes. Lanes 1-4 contain RT-PCRs for ACT1 mRNA of a total cellular RNA sample. Lanes 5-8 contain parallel RT-PCRs for ACT1 intron lariat RNA. For both FIGS. 6A and 6B, RT-PCRs for ACT1 intron lariat RNA were run for 19 cycles after the touchdown phase of the reaction and RT-PCRs for ACT1 mRNA were run for 24 cycles after the touchdown phase of the reaction. The lanes marked “M” and “m” contain DNA molecular weight standards (“M”=A phage DNA cut with HinDIII+EcoRI; “m”=50 bp ladder).
FIG. 7 shows real-time quantitative RT-PCR (qRT-PCR) measurement of lariat RNA levels. FIG. 7A shows the annealing positions of primers for RT-PCR detection of mRNA (FWDm primer and REVm primer) and intron lariat RNA species (FWDi primer and REVi primer). A TaqMan probe is designed to span the same exon-exon junction. The star and the triangle at opposite ends of the TaqMan probes represent the fluorescent reporter molecule and the quencher that are bound to the 5′ and 3′ ends, respectively. The TaqMan probes that anneal to a particular mRNA and lariat RNA pair contain different fluorescent reporter molecules, indicated by solid and stippled stars. Note that lariat RNA detection does not involve annealing of PCR primers or TaqMan probes across lariat branch points. FIG. 7B graphically illustrates the relative quantification of ACT1 intron lariat RNA in total RNA samples from different yeast strains. RQ, the relative quantification, is the ratio of intron RNA to mRNA for a particular sample relative to the ratio of intron RNA to mRNA for the DBR1 (wild-type) sample at the left end of the bar graph (which sets the RQ for DBR1 itself to 1). Quantification experiments were repeated three times and the qPCRs were performed in triplicate each time. The standard error bars display the calculated maximum (RQmax) and minimum (RQMin) expression levels that represent standard error of the mean expression level (RQ value). FIG. 7C graphically illustrates the relative quantification of RPP1B intron lariat RNA for the same RNA samples presented in FIG. 7B. FIG. 7D graphically illustrates the relative quantification of YRA1 intron lariat RNA for the same RNA samples presented in FIG. 7B.
FIG. 8 graphically illustrates a time course of in vitro debranching reaction.
FIG. 9 illustrates the RNA lariat enrichment following treatment of an RNA sample with a 3′ exonuclease. The parentheses at the left end of the linear RNA mean that these RNAs include both 5′ capped and 5′ uncapped species. The circular dot within the parentheses represents the cap. The arrow on the right side of the linear RNA represents the 3′ end. Dashed lines represent degradation.
FIG. 10 illustrates the RNA lariat enrichment following treatment of a decapped RNA sample with a 5′ exonuclease. Linear RNAs at the top, below the lariat RNA, are a mixture of 5′ capped and 5′ uncapped species. The circular dot at the left of the 5′ capped RNA represents the cap. The arrows on the right side of the linear RNAs represent the 3′ ends. Dashed lines represent degradation.
FIG. 11 illustrates RT-PCR detection of ACT1 mRNA (linear RNA) and intron (lariat RNA) in a total RNA sample from Saccharomyces cerevisiae cells following treatment with the 3′ exonuclease polynucleotide phosphorylase (PNPase) (lanes 1 and 2), debranching enzyme (Dbr1p) followed by PNPase (lanes 3 and 4), and no treatment (lanes 5 and 6).
FIG. 12 illustrates the RT-PCR detection of ACT1 mRNA (linear RNA) and intron (lariat RNA) in total RNA samples from dbr1 mutant yeast cells following Dbr1p treatment (lanes 3 and 4) or no treatment (lanes 1 and 2).
FIG. 13 illustrates the high-throughput sequencing of cDNAs representing PNPase-treated S. cerevisiae RNA. FIG. 13A shows chromosome 6 is depicted at the top, below which a 20 kilo-base pair (kbp) segment is highlighted (black bar), along with a detailed map of the genes that lie within this segment. Gene open reading frames (ORFs) are indicated by red or blue bars, depending on which DNA strand of the chromosome encodes the sense strand for each ORF (red for the upper strand, blue for the lower strand). FIG. 13B graphically illustrates the number of sequence reads that map within the 20 kbp segment. The ACT1 gene is the only gene in this 20 kbp segment that contains an intron, which is depicted as a white box within the blue ACT1 ORF.
FIG. 14 shows the conserved amino acid conservation among RNA debranching enzymes using the sequence of Saccharomyces cerevisiae Dbr1 (405 total amino acid residues) as a representative example. (Key: green numbers=amino acid residue number of first and last amino acid in each line (out of 405 total amino acids residues); highlighted yellow=identical among all RNA debranching enzymes; red=conserved among all RNA debranching enzymes; blue=not conserved; [X].=gaps in sequence between conserved regions (number of amino acid residues).
The present invention is directed to compositions and methods for analyzing lariat RNA. The compositions of the invention include isolated enzymes and supportive buffers for efficient use of the isolated enzymes. The methods of the invention include methods of enriching an RNA population for lariat RNA and analyzing lariat RNA. The compositions and methods of the invention may be provided in a kit.
The enzymes of the invention include linear RNA degrading enzymes, 5′ cap removing enzymes and debranching enzymes. Suitable linear RNA degrading enzymes include those capable of degrading linear RNA or mRNA. Such linear RNA degrading enzymes include, without limitation, exonucleases, 3′ exonucleases, 5′ exonucleases, those with both 5′ and 3′ exonuclease activity, those known in the art or yet to be discovered, and combinations thereof.
Suitable 5′ cap removing enzymes include those capable of degrading or excising the 5′ cap of linear RNA or mRNA. Such enzymes include those commonly known in the art, such as Dcp1 or Dcp2, as well as those yet to be discovered, and combinations thereof.
Suitable debranching enzymes include those capable of degrading, excising, or cleaving the 2′-5′ bond at the branch point of lariat RNA. Such enzymes include 2′-5′ phosphodiesterases, such as Dbr1, all those known in the art or yet to be discovered, and combinations thereof. Also, such enzymes include those encoding an amino acid sequence having at least 35% sequence identity to at least one of SEQ ID NOs: 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, or 66. The sequence identity may be about 40, 45, 50, 55, 60, 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or more. In another embodiment, the nucleic acid sequence may have at least 35% sequence identity to the metallophosphatase domain of at least one of SEQ ID NO: 46-66. The sequence identity may be about 40, 45, 50, 55, 60, 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or more. In S. cerevisiae Dbr1 (SEQ ID NO: 47), the metallophosphatase domain is located at amino acid residues 6 to 238 (FIG. 14).
The invention also includes methods of enriching an RNA population for lariat RNA. Such methods include providing an RNA population and contacting the RNA population with a linear RNA degrading enzyme to form a lariat RNA enriched population. Suitable methods may further include contacting the RNA population with a debranching enzyme.
The invention also includes methods of analyzing the lariat RNA in an RNA sample or population. Such methods include providing an RNA population and contacting the RNA population with a linear RNA degrading enzyme to form a lariat RNA enriched population. The lariat RNA enriched population may be used to create a cDNA library. In one embodiment the cDNA library is created by reverse transcribing the lariat RNA enriched population. Methods known in the art for creating a cDNA library may be used. Suitable methods may also further include sequencing the cDNA library created using the lariat RNA enriched population.
The invention includes kits for practicing the methods of the invention. Suitable kits contain at least one linear RNA degrading enzyme and instructions. Kits may also include a linear RNA degrading enzyme buffer, debranching enzyme, debranching enzyme buffer, 5′ decapping enzyme, 5′ decapping enzyme buffer, and combinations thereof.
In accordance with the present invention, processes of comprehensively analyzing lariat RNA have been discovered. In particular, the present invention provides compositions, methods, and kits useful for analyzing lariat RNA. The compositions and methods are directed to enriching an RNA population for lariat RNA and analyzing the lariat RNA.
Various aspects of the invention are described in further detail in the following subsections.
A. Enzymes
One aspect of the invention pertains to isolated enzymes that are used in the methods described herein. Suitable enzymes include those capable of degrading linear RNA, linearizing lariat RNA, removing the 5′ cap from linear RNA (mRNA), or combinations thereof.
Enzymes capable of degrading linear RNA are used to remove the linear RNA from the RNA population, enriching the population for lariat RNA. Suitable linear RNA degrading enzymes include, without limitation, 3′ exonucleases, 5′ exonucleases, 5′/3′ exonucleases, and combinations thereof. Any enzyme capable of degrading linear RNA is contemplated herein, as well as those not yet discovered. For example, the polynucleotide phosphorylases of Bacillus stearothermophilus (BsPNPase) and Thermus thermophilus (TtPNPase), as well as the RNase of E. coli (RNase R) are suitable linear RNA degrading enzymes.
Enzymes capable of removing the 5′ cap from linear RNA or mRNA are used to allow linear RNA degrading enzymes to work, where the 5′ cap may inhibit degradation. Suitable 5′ cap removing enzymes include those capable of cleaving or degrading the 5′ cap from linear RNA or mRNA. Any enzyme capable of 5′ cap removal is contemplated herein, as well as those not yet discovered. For example, the 5′ cap removing enzymes Dcp1 and Dcp2 are suitable for the invention. The invention also includes 5′ cap removal treatments known in the art or yet to be discovered.
Enzymes capable of linearizing lariat RNA are debranching enzymes, which are used to unfold the lariat structure of the RNA to allow further analysis. Suitable debranching enzymes are those capable of cleaving the 2′-5′ bond at the branch point of lariat RNA. Such debranching enzymes include, without limitation, debranching enzymes having sequence homology to SEQ ID NO: 46-66.
Preferably, the nucleic acid sequence of debranching enzymes have at least 35% sequence identity to the nucleic acid sequence that encodes the amino acid sequence of at least one of SEQ ID NO: 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, or 66. The sequence identity may be about 40, 45, 50, 55, 60, 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or more. In another embodiment, the nucleic acid sequence may have at least 35% sequence identity to the metallophosphatase domain of the nucleic acid sequence that encodes at least one of SEQ ID NO: 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, or 66. The sequence identity may be about 40, 45, 50, 55, 60, 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or more. In S. cerevisiae Dbr1 (SEQ ID NO: 47), the metallophosphatase domain is located at amino acid residues 6 to 238 (FIG. 14).
A nucleic acid molecule of the present invention, e.g., a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 46-66, or a complement of any of these nucleotide sequences, may be isolated using standard molecular biology techniques and the sequence information provided herein. Using all or portion of the nucleic acid sequences of SEQ ID NO:46-66, debranching enzyme nucleic acid molecules may be isolated using standard hybridization and cloning techniques (e.g., as described in Sambrook et al., eds., Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989).
Accordingly, another aspect of the invention pertains to nucleic acid molecules encoding debranching enzymes that contain changes in amino acid residues that may or may not be essential for activity. Such debranching enzymes proteins differ in amino acid sequence from SEQ ID NO: 46-66. In one embodiment, the isolated nucleic acid molecule includes a nucleotide sequence encoding a protein that includes an amino acid sequence that is at least about 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more identical to the amino acid sequence of SEQ ID NO: 46-66. An isolated nucleic acid molecule encoding a debranching enzymes having a sequence which differs from that of SEQ ID NO: 46-66, may be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of debranching enzymes (SEQ ID NO: 46-66) such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations may be introduced by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis.
The present invention encompasses antisense nucleic acid molecules. Antisense molecules are complementary to a sense nucleic acid encoding a protein, complementary to the coding strand of a double-stranded cDNA molecule, or complementary to an mRNA sequence. Accordingly, an antisense nucleic acid hydrogen bonds to a sense nucleic acid. The antisense nucleic acid can be complementary to an entire debranching enzyme coding strand, or to only a portion thereof, such as all or part of the protein coding region (or open reading frame). An antisense nucleic acid molecule can be antisense to a non-coding region of the coding strand of a nucleotide sequence encoding a debranching enzyme. The non-coding regions (“5′ and 3′ untranslated regions”) are the 5′ and 3′ sequences that flank the coding region and are not translated into amino acids. Given the coding strand sequences encoding debranching enzymes disclosed herein, antisense nucleic acids of the invention may be designed according to the rules of Watson and Crick base pairing. The antisense nucleic acid molecule may be complementary to the entire coding region of debranching enzyme mRNA, but more preferably is an oligonucleotide which is antisense to only a portion of the coding or non-coding region of a debranching enzyme mRNA. For example, the antisense oligonucleotide may be complementary to the region surrounding the translation start site of a debranching enzyme mRNA. An antisense oligonucleotide may be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length. An antisense nucleic acid of the invention may be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid (e.g., an antisense oligonucleotide) may be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used. Examples of modified nucleotides which may be used to generate the antisense nucleic acid include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5′-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N-6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-aino-3-N2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the antisense nucleic acid may be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest).
The antisense nucleic acid molecules of the invention are generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding a debranching enzyme to thereby inhibit expression of the enzyme, e.g., by inhibiting transcription and/or translation. The hybridization may be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule which binds to DNA duplexes, through specific interactions in the major groove of the double helix.
The invention also encompasses ribozymes. Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes (described in Haselhoff and Gerlach (1988) Nature 334:585-591)) may be used to catalytically cleave debranching enzyme mRNA transcripts to thereby inhibit translation of debranching enzyme mRNA. A ribozyme having specificity for a debranching enzyme-encoding nucleic acid may be designed based upon the nucleotide sequence of the debranching enzyme cDNA. For example, debranching enzyme mRNA may be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel and Szostak (1993) Science 261:1411-1418.
The invention also encompasses nucleic acid molecules which form triple helical structures. For example, debranching enzyme gene expression may be inhibited by targeting nucleotide sequences complementary to the regulatory region of the debranching enzyme gene (e.g., promoter and/or enhancers) to form triple helical structures that prevent transcription of the debranching enzyme gene in target cells. See generally, Helene (1991) Anticancer Drug Des. 6(6):569-84; Helene (1992) Ann. N.Y. Acad. Sci. 660:27-36; and Maher (1992) Bioassays 14(12):807-15.
A useful debranching enzyme protein is a protein which includes an amino acid sequence at least about 45%, preferably 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more identical to the amino acid sequence of SEQ ID NO: 46-66, and retains the functional activity of a debranching protein of SEQ ID NO:46-66.
To determine the percent identity of two amino acid sequences or of two nucleic acids, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity=# of identical positions/total # of positions.times.100).
The determination of percent homology between two sequences may be accomplished using a mathematical algorithm. A preferred, non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul (1990) Proc. Nat'l Acad. Sci. USA 87:2264-2268, modified as in Karlin and Altschul (1993) Proc. Nat'l Acad. Sci. USA 90:5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul, et al. (1990) J. Mol. Biol. 215:403-410. BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences similar or homologous to nucleic acid sequences of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used.
One useful fusion protein is a fusion protein in which the debranching enzyme sequences are fused to tag or marker sequences. Such fusion proteins can facilitate the purification of recombinant debranching enzymes. Suitable tag and marker sequences are well known in the prior art and include all those known in the art or yet to be discovered. Exemplary tags or markers include, without limitation, HIS tag, GST, MYC tag, fluorescent proteins, fluorophores, and others that are too numerous to include herein.
One skilled in the art will recognize that activity of enzymes depends upon conditions that are specific to each enzyme. Some enzymes are active at higher temperatures, such at 65° C., while others are active at lower temperatures, such at 37° C. Other conditions include pH and salt content. As such conditions depend upon the enzyme; the invention includes all conditions for which the enzymes useful for the invention are active.
The present invention includes methods of preparing and analyzing lariat RNA populations. Methods of the invention also include using the compositions described herein to modulate the proportion of lariat RNA in an RNA population.
Methods of preparing lariat RNA populations or enriched lariat RNA populations include providing an RNA population and contacting it with a linear RNA degrading enzyme to form a lariat RNA enriched population. In some embodiments, methods may further include contacting the RNA population with a debranching enzyme. The order with which the RNA population is contacted with the linear RNA degrading enzyme and debranching enzyme determines the composition of the resulting enriched RNA population. If the RNA population is contacted with the linear RNA degrading enzyme before the debranching enzyme, then the resulting enriched RNA population will be enriched for lariat RNA. If the RNA population is contacted with the debranching enzyme before the linear RNA degrading enzyme, then the resulting enriched RNA population will not be enriched for lariat RNA or linear RNA.
In some embodiments, methods may further include contacting the RNA population with a 5′ cap removing enzyme or be subjected to a 5′ cap removal treatment. Preferably, the 5′ cap removing enzyme or treatment is contacted or used on the RNA population before the linear RNA degrading enzyme.
In some embodiments, methods may include inhibiting the RNA debranching enzyme in a population of cells prior to the methods of enriching for lariat RNA. Inhibiting the RNA debranching enzyme in a population of cells would allow the proportion of lariat RNA in a population of cells to increase, thereby allowing the enriched lariat RNA population to increase. The RNA debranching enzyme may be inhibited using methods known in the art. Such methods may include, without limitation, siRNA technology, ribozymes, knockout cell lines, knock down cell lines, and other methods known in the art.
The invention also includes methods of analyzing the lariat RNA in an RNA sample or population. In some embodiments, methods include providing an RNA population and contacting the RNA population with a linear RNA degrading enzyme to form a lariat RNA enriched population. The lariat RNA enriched population is contacted with a debranching enzyme and then subsequently with a linear RNA degrading enzyme to confirm true lariat RNAs are present.
In other embodiments, methods include providing an RNA population and contacting the RNA population with a linear RNA degrading enzyme to form a lariat RNA enriched population. The lariat RNA enriched population is then used to create a cDNA library. In one embodiment, the cDNA library is created by reverse transcribing the lariat RNA enriched population. Methods known in the art for creating a cDNA library may be used. Suitable methods may also further include sequencing the cDNA library created using the lariat RNA enriched population. Methods known in the art for sequencing may be used.
The present invention includes articles of manufacture and kits containing materials useful for preparing enriched lariat RNA populations as described herein. The article of manufacture may include a container of a composition as described herein with a label. Suitable containers include, for example, bottles, vials, and test tubes. The containers may be formed from a variety of materials such as glass or plastic.
In one embodiment, containers hold a composition having an active agent which is effective for degrading linear RNA or linearizing lariat RNA. The active agent may be an enzyme. Suitable enzymes include 3′ exonucleases, 5′ exonucleases, 5′/3′ exonucleases, debranching enzymes, decapping enzymes, or combinations thereof. Active agents may be combined into a single container or provided in separate containers. Preferably, the active agents are provided in separate containers.
In another embodiment, containers may hold a composition having a supportive agent, which is supportive of the active agent. Such supportive agents may be buffers. The supportive agent will depend upon the active agent. Exemplary supportive agents include, without limitation, exonuclease reaction buffer, debranching enzyme reaction buffer, decapping enzyme reaction buffer, siRNA reaction buffer, RT-PCR reaction buffer, or combinations thereof. Supportive agents may be combined into a single container or provided in separate containers. Preferably, the active agents are provided in separate containers.
In another embodiment, containers may contain siRNAs or sources for producing siRNA. The siRNA may be species specific. Any siRNA known in the art or yet to be discovered may be provided with the kit.
In another embodiment, containers may contain total RNA for control RT-PCRs to assess lariat purification. The total RNA may be from any species.
In another embodiment, containers may contain oligonucleotides, or primers, for control RT-PCRs. Such primers will amplify a well characterized linear RNA, lariat RNA, or combinations thereof, depending upon the control desired. One skilled in the art will recognize that the primers may be species specific and may depend upon the source species of the total RNA. For example, if the source of the total RNA is Saccharomyces cervisiae, then the control primers could be those that would amplify ACT1 mRNA and the ACT1 intron lariat RNA.
The article of manufacture may also contain instructs of use.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art. All patents, applications, published applications and other publications are incorporated by reference in their entirety. In the event that there is a plurality of definitions for a term herein, those in this section prevail unless stated otherwise.
As used herein, the phrase “metallophosphatase domain” refers to the amino acids that are conserved among debranching enzymes isolated from various species.
As used herein, the term “enrich” or forms thereof refer to increasing the amount of a substance found in a heterogeneous population. For example, enriching for lariat RNA in an RNA population refers to increasing the proportion of lariat RNA in an RNA population to a proportion above the other types of RNA found in the RNA population. The enrichment includes purifying an RNA population to only include a specific type of RNA, such as lariat RNA.
As used herein, the term “hybridizes under stringent conditions” is intended to describe conditions for hybridization and washing under which nucleotide sequences at least 60% (65%, 70%, preferably 75%) identical to each other typically remain hybridized to each other. Such stringent conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. A, non-limiting example of stringent hybridization conditions are hybridization in 6× sodium chloride/sodium citrate (SSC) at about 45° C., followed by one or more washes in 0.2.×SSC, 0.1% SDS at 50-65° C. (e.g., 50° C. or 60° C. or 65° C.) Preferably, the isolated nucleic acid molecule of the invention that hybridizes under stringent conditions corresponds to a naturally-occurring nucleic acid molecule. As used herein, a “naturally-occurring” nucleic acid molecule refers to RNA or DNA molecules having a nucleotide sequence that occurs in a human cell in nature (e.g., encodes a natural protein).
As used herein, the phrase “lariat RNA” refers to the pre-mRNA that is excised during the formation of mRNA. This excised pre-mRNA forms a lariat structure.
As used herein, the phrase “linear RNA” refers to RNA that does not form a lariat structure and that can be degraded by exonucleases.
As used herein, the phrase “linear RNA degrading enzyme” refers to any enzyme capable of degrading linear RNA. Such enzymes include, without limitation, 3′ exonucleases, 5′ exonucleases, exonucleases with 3′ and 5′ activity, as well as others known in the art or yet to be discovered.
As used herein, the term “nucleic acid sequence” is intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mRNA or lariat) and analogs of the DNA or RNA generated using nucleotide analogs. The nucleic acid molecule can be single-stranded or double-stranded.
As used herein, the phrase “RNA population” refers to a sample containing ribonucleic acid. The RNA population may or may not be purified RNA.
The following examples are simply intended to further illustrate and explain the present invention. The invention, therefore, should not be limited to any of the details in these examples.
Yeast and Bacterial Strains, Plasmids, and General Procedures.
The following yeast strains were used: TMY30 (MATα ura3-52 lys2-801 ade2-101 trpl-Δ63 h is 3-Δ 200 leu2-Δ1), TMY60 (TMY30 dbr1::neor), TMY497 [=TMY30 mutated to dbr1 (D180Y allele)], TMY498 [TMY30 mutated to dbr1 (G84A allele)], TMY499 [=TMY30 mutated to dbr1 (Y68S allele)}. TMY453, a dbrl1Δ::hisG version of sigma strain 10560-23C, was used for FLO8 RT-PCR experiments (sigma strain 10560-23C=MATalpha ura3-52 his3::hisG leu2::hisG). The dbr1Δ::hisG allele was created using pTM513, a DBR1 gene blaster plasmid containing dbr1 Δ::hisG-URA3-hisG, and targeted to replace DBR1 chromosomal sequences by digestion with PvuII.
The following E. coli strains were used: Rosetta DE3 [F ompT hsdSB(rB− mB−) gal dcm (DE3) pLysSRARE (CamR)]; XL1 Blue [F′::Tn10 proA+B+ lacIq Δ(lacZ)M15/recA1 endA1 gyrA96 (Nalr) thi hsdR17 (rk− mk+) supE44 relA1 lac]; JM109 [F′ traD36 lacIq− Δ(lacZ)M15 proA+ B+/e14− (McrA−) Δ(lac-proAB) thi gyrA96 (Na1r) endA1 hsdR17 (rk− mk+) relA1 supE44 recA1], ES1301 [lacZ53 thyA36 rha-5 metB1 deoC IN(rrnD-rrnE) mutS201::Tn5]; and TOP10 (F-mcrA Δ (mrr-hsdRMS-mcrBC) φ80lacZ Δ M15 ΔlacX74 recA1 deoR araD139 D(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG).
The following plasmids were used for this study: pET16b-DBR1 was used to express Dbr1p in E. coli. pRS306 was used as a URA3 template for making a PCR fragment to create a dbr1Δ::URA3 allele at the DBR1 locus. YEp351 (LEU2) was used in co-transformations with the PCR fragment that resulted in the creation of a dbr1Δ::URA3 strain. This strain was an intermediate in the creation of dbr1 point mutants. pTM431, pTM432, and pTM435 were all created by random mutagenesis of pYES2/GS-DBR1 and encode Dbr1p D180Y, Dbr1p G84A, and Dbr1p Y68S, respectively. The DBR1 gene blaster plasmid pTM513 was created in three steps. First, the 3.8 kbp BamHI-BglII fragment from pNKY51, containing hisG-URA3-hisG, was ligated into the BamHI site of pBluescript to create pTM509. Second, the 5′ UTR of DBR1 was amplified from genomic DNA using oligonucleotide primers 331 and 332, then the PCR product was trimmed with EcoRI and BamHI and ligated into EcoRI and BamHI sites of pTM509 to create pTM511. Third, the 3′ UTR of DBR1 was amplified from genomic DNA using oligonucleotide primers 333 and 336, then the PCR product was trimmed with XbaI and NotI and ligated into XbaI and NotI sites of pTM511 to create pTM513.
When not specifically described, general molecular techniques (Ausubel et al. 2003) as well as standard yeast media and general procedures (Kaiser et al. 1994) were used. Oligonucleotides are listed in Tables 1 and 2.
RNA Extraction.
Yeast strains were grown to mid-logarithmic phase prior to isolating total cellular RNA. In some cases yeast cells were used directly for RNA preparation after cell growth was complete. In other cases, yeast cells were pelleted and flash frozen in a dry ice ethanol bath and stored at −80° C. prior to RNA preparation. No difference was found in results for RNAs prepared from cells processed in these two ways. Total yeast RNA was prepared by the hot acid phenol method (Ausubel et al. 2003) or by a column purification method (RNeasy kit, Qiagen) from small cultures (10 ml) grown to mid-logarithmic phase (OD600=˜1). RNA samples were treated with RNase free DNase I to remove DNA contamination. RNA concentration was measured spectrophotometrically by reading OD260. The OD260/OD280 ratio was used as an RNA quality assessment.
Preparation of Dbr1p Enzyme from E. Coli.
The pET16b-DBR1 expression plasmid encodes yeast Dbr1p as an N-terminal 10×-histidine-tagged protein. Expression and purification of the histidine-tagged Dbr1p were performed as described in Martin et al. 2002. Rosetta DE3 E. coli cells were used for expression of Dbr1p instead of E. coli strain BL21-Codon Plus(DE3)RIL. Sonication of cells was performed on ice for 60 sec., in 1 sec. pulses, with a large probe at 50% power. Triton X-100 was added after sonication to a final concentration of 0.1%. The tagged Dbr1p was purified from E. coli extracts by binding to and eluting from Nickel-nitrilotriacetic acid-agarose columns and fractions were assessed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Peak fractions from the elution were dialyzed against debranching buffer (20 mM HEPES KOH, pH 7.9; 125 mM KCl; 0.5 mM MgCl2; 1 mM DTT; 10% glycerol). In some cases, Dbr1p was concentrated by spinning through a Microcon YM-30 spin concentrator at 14,000×g for 40 min. at 4° C. in a Beckman Allegra 25R centrifuge (TA-15-1.5 rotor). The concentrations of Dbr1p preparations were 50-100 ng/μl. Mass spectrometry of purified Dbr1p was performed.
Enzymatic Treatments of RNA.
Bacillus stearothermophilus PNPase was acquired (Sigma, St. Louis, Mo.) and a stock of 3.5 units/ml was prepared by dissolving the protein in water, then adding Tris HCl, pH 8.5, to a final concentration of 50 mM. PNPase reactions were performed in PNPase buffer (50 mM Tris HCl, pH 8.5; 1 mM 2-mercaptoethanol; 1 mM EDTA; 20 mM KCl; 15 mM MgCl2; 10 mM Na2HPO4, pH 8.3) on 20-1000 ng of total yeast RNA in 20 μl reactions for 1 h at 60° C., using 1 μl of the PNPase stock. Upon completion of reactions, samples were heated to 85° C. for 10 min, then either used directly in RT-PCRs or ethanol precipitated. Mock treatments were performed in the same way, minus PNPase.
Approximately 50-100 ng of yeast Dbr1p prepared from E. coli was used for in vitro debranching reactions of 20-200 ng of RNA. Reactions were performed at 30° C. for 45 min. in a 20 μl volume containing lx debranching buffer (20 mM HEPES-KOH pH 7.9, 125 mM KCl, 0.5 mM MgCl2, 1 mM DTT and 10% glycerol). Reactions were stopped by heating at 65° C. for 10 minutes (min.). Mock treatments were performed in the same way, minus Dbr1p.
For sequential enzymatic treatments, RNA samples were phenol/chloroform extracted and ethanol precipitated after the first treatment (PNPase or Dbr1p) then resuspended and treated with the second enzyme.
RT-PCR Methods.
RT-PCRs of lariat and linear RNAs were performed with QIAGEN one-step RT-PCR kit (Valencia, Calif.) under the following general conditions: 50° C., 30 min; 95° C., 15 min; 9 cycles of 94° C. for 30 sec, 54° C. for 30-60 sec [touchdown to 46° C. (−1° C. per cycle)], 72° C. for 30 sec; X cycles (see below) of 94° C. for 30 sec, 46° C. for 30 sec, 72° C. for 3045 sec; 72° C. for 5-10 min; 4° C. hold. The number of cycles in the post-touchdown phase of different RT-PCRs (X cycles above) varied with the experiment and are reflected in the following reaction profile names: ACT1-1, 29 cycles, post-touchdown; ACT1-2, 24 cycles, post-touchdown; ACT1-3, 19 cycles, post-touchdown; ACT1-4, 15 cycles, post-touchdown; and ACT1-5, 11 cycles, post-touchdown. RNA amounts between 2 ng and 50 ng were used in RT-PCRs. RT-PCRs were analyzed by either PAGE or agarose gel electrophoresis.
Real-Time RT-PCR (qRT-PCR) of Lariat and Linear RNAs.
Primers and probes for qPCR were designed using Sequence Detection Systems software from Applied Biosystems (Carlsbad, Calif.) and are listed in Table 1. All probes and primers for qRT-PCR were purchased from Applied Biosystems. Validation experiments were performed that demonstrated that the efficiencies of target and reference PCRs are approximately equal.
| TABLE 1 |
| Primers and probes for qRT-PCR. |
| Target | |||
| SEQ | and | ||
| ID | Primers | ||
| NO: | Probe | Sequence | Positiona |
| 28 | FWD | TCCCAAGATCGAAAATTTACTGAAT | −30 to 6 |
| primer | |||
| 29 | REV | TTTACACATACCAGAACCGTTATCAAT | 54 to 28 |
| primer | |||
| 30 | TaqMan | VIC-TGAATTAACAAGGTTGCTGCT- | −4 to 26 |
| probe | MGBNFQ | ||
| ACT1 | |||
| intron: | |||
| 31 | FWD | ATTTTTCACTCTCCCATAACCTCCTATA | 94 to 121 |
| primer | |||
| 32 | REV | TTTCAAGCCCCTATTTATTCCAAT | 173 to 150 |
| primer | |||
| 33 | TaqMan | 6FAM-TGACTGATCTGTAATAACCA- | 123 to 142 |
| probe | MGBNFQ | ||
| RPP1B | |||
| mRNA: | |||
| 34 | FWD | AGGCCGCTGGTGCTAATG | 89 to 106 |
| primer | |||
| 35 | REV | TCCAAAGCCTTAGCGTAAACATC | 146 to 124 |
| primer | |||
| 36 | TaqMan | VIC-CGACAACGTCTGGGC- | 108 to 122 |
| probe | MGBNFQ | ||
| RPP1B | |||
| intron: | |||
| 37 | FWD | AATGCAACCTAAAACGACTTTGTG | 12 to 35 |
| primer | |||
| 38 | REV | TTTCTCGGGACGATTGTTGTC | 77 to 57 |
| primer | |||
| 39 | TaqMan | 6FAM-ACTACGAAGAGAAAGATT- | 38 to 55 |
| probe | MGBNFQ | ||
| YRA1 | |||
| mRNA: | |||
| 40 | FWD | AGGTTTGCCAAGGGACATTAAG | 249 to 270 |
| primer | |||
| 41 | REV | ACACCACCTACTTGAGATGCAAAA | 314 to 291 |
| primer | |||
| 42 | TaqMan | VIC-AGGATGCTGTAAGAGAAT- | 272 to 289 |
| probe | MGBNFQ | ||
| YRA1 | |||
| intron: | |||
| 43 | FWD | CGCATCGTCTCGTGTGGAT | 42 to 60 |
| primer | |||
| 44 | REV | GATCAAAAGCGTGTGCCATATC | 107 to 86 |
| primer | |||
| 45 | TaqMan | 6FAM- | 62 to 84 |
| probe | CGAGAAATATTCTTTGTAAGGAA- | ||
| MGBNFQ | |||
| aRelative to start of coding sequence for mRNA primers and probes. Relative to start of intron sequence for intron primers and probes. |
For total RNA samples (untreated or treated with Dbr1p/PNPase, as described above), 20-1000 ng of RNA was reverse transcribed into cDNA using random hexamers in a 100 μl reaction at 45° C. for 60 min.
PCR MasterMix reagents from Applied Biosystems were used for qPCR reactions, which were performed in triplicate for each sample. Reactions were prepared and run according to a standard protocol established by Applied Biosystems on an ABI 7500 real-time PCR machine. Briefly, reactions contained 2×PCR MasterMix, 900 nM forward primer, 900 nM reverse primer, 250 nM TaqMan probe, and cDNA (˜20 ng). Reactions were incubated for 2 minutes at 50° C. and then 10 minutes at 95° C. and before proceeding through 40 cycles of a 30 second (sec) incubation at 95° C. and a 60 second incubation at 60° C. Completed reactions were held at 4° C.
Relative quantification (RQ) of results was performed using the comparative CT method (ΔΔCT) (Schmittgen and Livak 2008). The amplification of each target intron sequence was compared to amplification of the corresponding mRNA sequence and a ΔCT was determined. To compare the different samples to each other, the wild-type sample was used as the calibrator sample. Therefore, the ΔCT of the wild-type sample was subtracted from the ΔCT for each sample to determine −ΔΔCT values. In FIG. 7, RQ 2−ΔΔCT for each −ΔΔCT and represents the fold-difference in intron levels between a given sample and the wild-type sample (DBR1).
In Vitro Debranching Time Course.
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA, the exogenous control for qPCR in these experiments, was generated by reverse transcribing 600 ng of human RNA at 45° C. for 1 hour (hr) using the reverse transcriptase (RT) kit from Applied Biosystems. A debranching reaction mix was set up on ice and contained 5600 ng of total RNA from TMY60 (dbr1) cells, about 6 ng GAPDH cDNA, 140 μl of purified Dbr1p, and 350 μl 2× debranching buffer in a final volume of 700 μl. Seven 100 μl aliquots of this mix were distributed to 0.2 mL PCR tubes. The debranching reaction was directly inactivated in one tube (0 min reaction time) by raising the temperature to 95° C., followed by phenol/chloroform extraction and ethanol precipitation. The remaining six tubes were incubated at 30° C. and individual reactions were stopped after 2.5 min, 5 min, 10 min, 15 min, 30 min, and 60 min. Reactions were stopped by raising the temperature to 95° C., followed by phenol/chloroform extraction and ethanol precipitation. RNAs were then treated with PNPase, as described above, to degrade intron lariats linearized by Dbr1p. Reverse transcription of the RNAs remaining from the different debranching reactions was performed using the RT kit from Applied Biosystems and random hexamer primers. qPCRs using these cDNAs were performed as described above, amplifying a volume of cDNA roughly corresponding to about 20 ng of starting total RNA, using primers and probes for yeast ACT1, YRA1, and RPP1B introns as well as human GAPDH. GAPDH cDNA was the exogenous control because it is insensitive to PNPase and remained at a constant level in each reaction.
Creation of dbr1 Point Mutant Strains.
Mutants were created using modifications of the delitto perfetto method (Storici et al. 2001) and the site specific genomic (SSG) method (Gray et al. 2004). Initially, a dbr1Δ::URA3 strain was created to facilitate the introduction of point mutant alleles of dbr1 into the DBR1 locus. Yeast strain TMY490, containing a URA3-marked deletion of 1090 bp of the 1215 bp DBR1 coding sequence (nts 71-1160 deleted), was constructed by transformation of TMY30 with a PCR fragment containing the URA3 gene from pRS306 flanked by ends corresponding to 5′ and 3′ segments of the DBR1 coding region.
The fragment used for making the dbr1Δ::URA3 allele was created by PCR of pRS306 with oligonucleotides 443 and 444, the 3′ 20 nucleotide (nt) of which anneal to the ends of the URA3 gene on pRS306 and the 5′ 40 nt of which correspond to DBR1 sequences (see Table 2).
| TABLE 2 |
| Oligonucleotides. |
| SEQ | |||
| ID | |||
| NO: | Primer | Sequence | Positiona |
| 1 | 146 | cactctcccataacctccta | ACT1 intron nt 100-119 |
| 2 | 215 | ctcaaaccaagaagaaaaagaa | ACT1 nt −128 to −107 |
| 3 | 216 | tgataccttggtgtcttggtct | ACT1 nt 130 to 109 |
| 4 | 331 | aggatgtttccgtctttagaa | −761 to −741 upstream |
| of DBR1 ORF | |||
| 5 | 332 | gaggatcctgataaatgtctgcccatctt | −10 to −30 upstream of |
| DBR1 ORF; EcoRI site | |||
| added at 5′ end | |||
| 6 | 333 | gctctagaacgaatgcagacggaattaga | 16 to 30 after of DBR1 |
| stop codon; | |||
| XbaI site added at 5′ | |||
| end | |||
| 7 | 336 | ataagaatgcggccgcaaagggatccaatgtggtga | 779 to 760 after of |
| DBR1 stop codon; NotI | |||
| site added at 5′ end | |||
| 8 | 363 | gcaagcgctagaacatacttag | ACT1 intron nt 18-1, |
| 265-262 | |||
| 9 | 372 | agtgaatagttcgtatccagattc | FLO8 nt 12-35 |
| 10 | 373 | catacaaaaagccttgaggtg | FLO8 nt 418-398 |
| 11 | 374 | ggtagcaaatattctgggacatct | FLO8 nt 422-445 |
| 12 | 375 | attctgggttggccctacattt | FLO8 nt 837-816 |
| 13 | 376 | agtcaaaacgttactggctgg | FLO8 nt 841-861 |
| 14 | 377 | tgcttgattgcggaagttag | FLO8 nt 1260-1241 |
| 15 | 378 | ttggcgaggaagatatttattc | FLO8 nt 1268-1289 |
| 16 | 379 | aagataatggactggatacagccg | FLO8 nt 1675-1652 |
| 17 | 380 | ttcgatccagaaagtggcaa | FLO8 nt 1693-1712 |
| 18 | 381 | ttttcctctggagtagataatgtg | FLO8 nt 2036-2013 |
| 19 | 382 | atcaaggatatgattttgacgc | FLO8 nt 2054-2075 |
| 20 | 383 | cagccttcccaattaataaaattg | FLO8 nt 2399-2376 |
| 21 | 408 | taaatagcttggcagcaacagg | URA3 nt 67-46 |
| 22 | 417 | ttgcgaattgctgtacaagg | DBR1 nt 10-29 |
| 23 | 418 | caagtcatgaatttagagataaatgc | DBR1 nt 1217-1192 |
| 24 | 443 | gctgtcatggtcagctaaaccaaatttataaagaagtgt | 5′ 40 nt = DBR1 nt 31- |
| . . . | 70 | ||
| 25 | 443cont | . . . taactatgcggcatcagagc | 3′ 20 nt = URA3 flank in |
| pRS306 | |||
| 26 | 444 | gataaatgctttagtttgtcgtacttcatctttctgaata | 5′ 40 nt = DBR1 nt |
| . . . | 1200-1161 | ||
| 27 | 444cont | . . . cctgatgcggtattttctcc | 3′ 20 nt = URA3 flank in |
| pRS306 | |||
| aFor the ACT1, FLO8, URA3 and DBR1 genes, the nucleotide positions are relative to the first nucleotide of the coding sequence, except for the ACT1 intron, where positions are relative to the first nucleotide of the intron. |
The dbr1Δ::URA3 disruption on yeast chromosome XI was created by homologous recombination between the DBR1 locus and the dbr1Δ:: URA3 PCR fragment. Briefly, TMY30 was transformed with the dbr1Δ:: URA3 PCR fragment and transformants were selected on SD-Uracil plates. Transformants were screened by PCR with primer pairs 401/402, which anneal within the DBR1 sequences that are deleted in the dbr1Δ:: URA3 allele, and 417/418, which anneal outside the DBR1 sequences that are deleted in the dbr1Δ:: URA3 allele. Transformants containing the dbr1Δ:: URA3 allele template a 417/418 PCR product but not a 401/402 PCR product. DNA sequencing of PCR products was performed to verify the presence of the dbr1Δ:: URA3 allele.
Replacement of the chromosomal dbr1Δ:: URA3 allele with dbr1 point mutations was accomplished by transformation. TMY490 (dbr1Δ:: URA3 strain) was co-transformed with YEp351(LEU2) and PCR fragments of dbr1 point mutants. The PCR fragments were generated from plasmids pTM431, pTM432, and pTM435 with PCR primer pairs 417/418. Transformants (with YEp351) were selected in SD-leucine liquid media during a 48 hr incubation period at 30° C. (with shaking). After this selection period, cells were spread onto 5-fluoroorotic acid plates to select for cells that lost function of the URA3 gene within the DBR1 locus. Recombinants within the FOAr population that have replaced the dbr1Δ:: URA3 allele with a dbr1 point mutant allele were identified by PCR screening. Positive clones were identified as those that template a 417/418 PCR product but not a 417/408 PCR product (specific for the dbr1Δ:: URA3 allele). DNA sequencing of PCR products was performed to verify the presence of a dbr1 point mutant allele.
S. cerevisiae ACT1, which encodes actin, is a robustly expressed gene that contains an intron of 308 nt. The first example of a spliceosomal intron discovered in yeast, the ACT1 intron contains all the canonical features of yeast introns and is efficiently spliced from pre-mRNA, producing an excised lariat with a 265 nt circle. This well-characterized gene was chosen to assess intron levels as tools were developed and tested for detecting and enriching excised intron lariats. Primers were designed for use in RT-PCR to detect the lariat form of the ACT1 intron RNA and, as a control, ACT1 mRNA (FIG. 1A). RT-PCR of total yeast RNA using primers that flank the ACT1 exon-exon junction (primers 215 and 216) amplifies a 285 bp product from ACT1 mRNA. Primer 363 spans the ACT1 intron lariat branch point and is used in combination with primer 146, which anneals to sequences complementary to the ACT1 intron upstream of the lariat branch point, in an RT-PCR that amplifies a 184 bp product from the lariat form of the ACT1 intron RNA. As expected, when RT-PCRs are performed using total RNA samples from wild-type (TMY30) and dbr1 mutant yeast cells (TMY60), the amounts of ACT1 mRNA products are similar when using equivalent amounts of RNA from the two cell types (FIG. 1B, lanes 1 and 3 as well as lanes 5 and 7). However, the ACT1 intron RNA lariat product is much more readily produced from dbr1 cells (FIG. 1B, lane 4 vs. 2 and lane 8 vs. 6). These data clearly show that a dbr1 mutant strain or, where appropriate, a Dbr1p knock-down strain contains a rich source of expressed intron sequences. It is also evident that the use of intron-specific RT-PCR could be used to detect excised introns from genes expressed at very low levels. For studies on alternative splicing, the use of RT-PCR on RNA from Dbr1p-deficient cells can allow detection of rare splice variants.
A previous report described the use of radiolabeled primers spanning intron RNA branch points for analyzing intron populations by primer extension (Spingola et al. 1999). The RT-PCR method we describe could be modified to survey intron lariats containing specific sequences at intron 5′ ends and branch points. RT-PCR has added utility because the products can be cloned and sequenced to identify the individual introns represented in a lariat population.
Linear and lariat RNAs have different sensitivities to 3′ exonucleases, including PNPase, a component of bacterial RNA degradation systems. PNPase degrades linear RNAs but does not proceed past the 2′ branch present in intron RNA lariats. Therefore, treatment of RNA samples with an enzyme like PNPase should result in a vast enrichment of excised intron lariats in the RNA that remains intact after treatment. This difference should be evident in the results of the RT-PCR assay described above when amplifying PNPase-treated RNA samples. Since RNA secondary structures reduce the efficiency of PNPases, reactions were performed at elevated temperature (60° C.) using PNPase from Bacillus strearothermophilus to circumvent this problem. Total RNA samples from a dbr1 mutant strain (TMY60) were treated with a range of PNPase concentrations and then subjected to RT-PCR to detect ACT1 intron RNA lariats as well as the linear mRNA (FIG. 2). Results are consistent with expectations that the use of PNPase selectively preserves RNA lariats.
The high temperature reaction using PNPase from a thermophile appears to be much more efficient than the reported reaction with the E. coli PNPase at 37° C. In order to eliminate the RT-PCR product from the ACT1 mRNA, PNPase must degrade, at the very least, the RNA corresponding to the binding site for the downstream primer (oligonucleotide 216). To accomplish this, PNPase must degrade all the RNA that lies to the 3′ side of the oligonucleotide 216 binding site, which includes 998 nt of the ACT1 coding sequence plus the 3′ UTR and the polyA tail. To further examine the processivity of Bacillus strearothermophilus PNPase, the degradation of FLO8 mRNA was assessed. FLO8 mRNA is >2.4 kb in length. Primer pairs were designed to amplify different portions of this mRNA along its length (FIG. 3A). Total nucleic acid samples and RNA samples (DNased total nucleic acid samples) were treated with PNPase and subjected to RT-PCR to detect the various segments of FLO8. As shown in FIG. 3B, PNPase readily degrades every segment of FLO8 mRNA assayed. As expected, PNPase has no effect on FLO8 DNA present in the total nucleic acid samples (FIG. 3C). Other enzymes that worked as well as Bacillus strearothermophilus PNPase in our studies are Thermus thermophilus PNPase at 65° C. and Escherichia coli RNase R at 37° C.
Linear and lariat RNAs also have different sensitivities to RNA debranching enzyme, which can be exploited to confirm that an RNA species have a lariat conformation. The RT-PCR strategy employing a primer that spans a lariat branch point, as described above for the ACT1 intron, can be used to demonstrate the cleavage of the 2′-5′ bond. This is due to the fact that after Dbr1p treatment the binding site for the primer that spans the ACT1 intron branch point (oligonucleotide 363) is split into two non-contiguous sections, with the section that anneals to the 3′ end of the primer being only 3 base pairs (bp) in length. After debranching of the lariat, the critical 3′ end of the primer will not effectively anneal to the intron RNA to prime RT-PCR. Dbr1p treatment has no effect on ACT1 mRNA, which should still be readily detected by RT-PCR.
In order to perform Dbr1p treatments, S. cerevisiae Dbr1p was expressed in E. coli and purified by metal affinity chromatography (FIGS. 4A and 4B). Although histidine-tagged Dbr1p is expected to have a mass of about 50 kilo-dalton (kDa), the mobility of the main product in SDS-PAGE is about 45 kDa. Others have observed this anomalous mobility for histidine-tagged Dbr1p and have speculated that the protein may undergo limited proteolysis in E. coli. However, mass spectrometric analysis of the main band in the stained gel shows it to be the expected molecular mass of the histidine-tagged Dbr1p (50062 Dalton (Da)) (FIG. 4C), indicating that the protein is intact and must run anomalously in SDS-PAGE because of its physical properties.
Using the Dbr1p enzyme preparation, debranching reactions were carried out on total RNA samples from a dbr1 mutant strain. RT-PCR analysis reflects the differential sensitivity of linear and lariat RNAs to Dbr1p. After Dbr1p treatment, RT-PCR detection of ACT1 RNA lariat is greatly decreased (FIG. 5, lane 4 vs. 2). On the other hand, the product indicative of ACT1 linear mRNA is still readily detectable after Dbr1p treatment (FIG. 5, lane 3 vs. 1).
PNPase and Dbr1p treatments can be used in combination when exploring the properties of a particular RNA species. Sequential enzymatic treatments can also be used to enrich for RNA lariats and then linearize them for further manipulations. To demonstrate this, ACT1 RNA species present within a total RNA sample from a dbr1 mutant strain were analyzed by RT-PCR following sequential PNPase and Dbr1p treatments. As shown in FIG. 6A (lanes 1-4), initial treatment of the RNA sample with PNPase degrades the linear mRNA (lanes 1 and 3), but leaves lariat RNA intact (lane 2). Subsequent treatment with Dbr1p shows that the resistant RNA is a lariat (lane 4). As shown in FIG. 6A (lanes 5-8), skipping the initial PNPase treatment leaves the linear mRNA intact (lanes 5 and 7) as well as the lariat RNA (lane 6). The lariat RNA is then distinguished by its sensitivity to cutting with Dbr1p (lane 8). The order of the PNPase and Dbr1p reactions can be switched to generate a complementary set of predictable results (FIG. 6B).
A real-time RT-PCR method (qRT-PCR), using the TaqMan detection system (Applied Biosystems), was developed to quantitatively compare the intron RNA lariat levels of different samples. The study included not only the ACT1 intron but also the YRA1 and RPP1B introns to investigate the generality of the methods. YRA1 encodes an RNA binding protein involved in mRNA export from the nucleus and is moderately expressed, although less than ACT1. The YRA1 intron is 765 nt in length, which is larger than the 300 nt average for yeast introns, and contains a non-canonical branch point sequence. Furthermore, the intron is inefficiently spliced from pre-mRNA, which is important for the auto-regulation of Yra1p protein levels. RPP1B encodes a ribosomal protein and is even more highly expressed than ACT1. The RPP1B intron is typical for yeast, 301 nt in length, with canonical sequences.
Initially, a strategy similar to the one used for RT-PCR of ACT1 intron lariats described above, with one primer spanning the lariat branch point and serving as both the RT primer and the reverse primer for PCR was used. However, a different strategy using random primers for the RT step was also used to allow amplification of the different target sequences from a common pool of cDNA. Consequently, both PCR primers anneal upstream of the branch point for each target gene, with a TaqMan probe annealing between them (FIG. 7A). Since these types of primers will also prime amplification of genomic DNA we ran control PCRs for each sample without a prior RT step to ensure that DNA contamination was not contributing to the PCR product. The mRNA for each target gene served as the endogenous control for qRT-PCR (FIG. 7A, top). Using this strategy, intron sequences for ACT1, RPP1B, and YRA1 were amplified from dbr1 and wild-type yeast strains (TMY60 and TMY30). As shown in FIGS. 7B, 7C and 7D [DBR1 (wild type) vs. dbr1 null mutant), the real-time method generated the expected results: the different intron RNAs accumulate at higher levels in the dbr1 null mutant strain than in wild type.
qRT-PCR was also used to analyze mutant variants of Dbr1p. Previously, a set of point mutants had been created by random PCR mutagenesis and analyzed for intron RNA levels by an RNase protection assay. In these experiments, the dbr1 mutant alleles were under the control of a strong, inducible promoter (pGAL1) and carried on a high copy plasmid. The yeast strain carried a dbr1Δ mutation [open reading frame (ORF) deletion] at the DBR1 locus so the plasmid-borne dbr1 mutant alleles were the only sources of Dbr1p. For the current study, three dbr1 point mutants (D180Y, G84A, and Y68S) were analyzed by qRT-PCR to determine their levels of intron lariat RNA relative to wild-type (DBR1) and dbr1Δ. To make the analysis more biologically relevant, each of the dbr1 mutant alleles was placed at the DBR1 locus, replacing the wild-type allele, and was under the control of the native DBR1 promoter. After log-phase growth of cells, RNA samples from wild-type and mutant strains were harvested and subjected to qRT-PCR to amplify intron and messenger RNA sequences from ACT1, RPP1B, and YRA1. The three dbr1 alleles tested show strong intron RNA accumulation phenotypes, comparable to the dbr1Δ knockout allele (FIGS. 7B, 7C, and 7D).
Using a combination of Dbr1p and PNPase treatments, in vitro debranching reactions of total cellular RNA from a dbr1 strain were followed over time courses of thirty minutes. Debranching reactions were stopped at different times and the reaction products were treated with PNPase to degrade linearized intron RNAs. The remaining intron lariats were detected by qRT-PCR as described herein. Because the PNPase treatment step degrades all linear RNAs, human GAPDH cDNA was added to the yeast RNA samples as an exogenous control. The GAPDH cDNA is insensitive to both Dbr1p and PNPase, remaining at the same level in the various samples. Debranching of the ACT1 and RPP1B intron lariats was almost complete within the first 5 minutes of the reactions (FIG. 8). However, the debranching rate of the ACT1 intron lariat appeared to be only two-thirds the initial rate of the RPP1B intron lariat.
The results observed from using qRT-PCR to follow in vitro debranching, show that the debranching rates can vary from one intron lariat to another. The ACT1 intron is debranched at only two-thirds the initial rate at which the RPP1B intron lariat is debranched. These data suggest that different intron lariats are debranched at different rates in vivo, which may be of functional significance. Slower rates of debranching may occur for introns that contain snoRNAs or mirtrons, reflecting the binding of additional factors to intron sequences or specific folding properties of the RNA. Thus, the rate of the debranching of introns can be used to predict which introns may contain additional information. Relative debranching rates can be inferred from quantitative analysis of intron RNA levels relative to mature mRNA levels for a given gene compared to a standard, rapidly debranching intron RNA. For these types of experiments, RNA samples could be taken from a wild-type strain (DBR1), where lariat RNAs are not stabilized. Inefficient splicing would have to be ruled out before further study of candidate slow debranchers. As described above, YRA1 is an example of a gene that uses splicing inefficiency to regulate protein levels.
Quantitative RT-PCR of lariat RNAs can be used to determine the relative rates of transcription for different intron-containing genes. The use of intron RNA lariats as a novel data source for estimating relative levels of transcription for pre-mRNAs limits the utility to intron-containing genes, a notable limitation for S. cerevisiae. Furthermore, a Dbr1p-deficient strain would have to be used for intron lariats to be a stable record of transcription. Work with yeast dbr1 mutants over the years has not found any significant perturbation of cellular physiology other than the accumulation of intron RNA lariats. In the experiments shown in FIG. 7B-D, the level of RPP1B intron RNA in a dbr1 strain relative to the level in wild type is much greater (about 330-fold) than the corresponding levels of ACT1 and YRA1 intron RNAs (about 13-fold). These data indicate that the transcription rate for RPP1B is almost 30-fold greater than the rates for ACT1 and YRA1 (summarized in Table 3). These relative transcription rates are very different from estimates based on nuclear run-on assays, mRNA steady state levels plus half-lives, and DTA (Table 3).
| TABLE 3 |
| ACT1, YRA1, and RPP1B mRNA expression. |
| Relative intron | |||
| Gene | Transcriptional frequencya | DTAb | levelsc |
| ACT1 | 45.5d (1) | 7.2e (1) | 63.2 (1) | 1.0 |
| (YFL039C) | ||||
| YRA1 | 16.2d (0.4) | 80.6e (11.2) | 88.9 (1.4) | 1.1 |
| (YDR381W) | ||||
| RPP1B | 120.0d (2.6) | 23.0e (3.2) | 192.7 (3) | 28.1 |
| (YDL130W) | ||||
| amRNAs/cell/hr; numbers in parentheses are levels normalized to ACT1 level; | ||||
| bDTA = dynamic transcriptome analysis, measured as mRNAs/cell/cell cycle time (150 min); numbers in parentheses are levels normalized to ACT1 level; | ||||
| cDerived from data in FIG. 7 for the dbr1 null strain versus wild type for each gene and normalized to ACT1 level; | ||||
| dEstimated from RNA expression levels and mRNA half-lives; | ||||
| eEstimated from genomic run on experiments. |
An area where the utility of excised introns is clearer is in determining relative rates of alternative splicing for a particular gene. Variable stabilities of different mRNAs confound estimates of their rate of synthesis, whether the synthesis that produces the mRNAs in question is transcription or alternative splicing. The use of a Dbr1p-deficient strain, which stabilizes the alternatively excised intron lariats equivalently, results in intron RNA lariat levels that directly reflect the rate of alternative splicing.
The methods described herein can also be applied to genome-wide analysis of introns themselves and are an improvement on previous analyses that also directly analyzed intron RNA lariats. RNA-seq of intron RNA lariat populations prepared using PNPase can provide complementary information to RNA-seq of whole transcriptomes and may reveal new lariat sequences not evident from transcriptome analysis alone. Intron RNA lariat levels can be greatly enhanced by blocking the RNA debranching reaction, which increases the likelihood of detecting even rare splicing events. Because cells defective for RNA debranching activity accumulate excised introns in their lariat forms, with shorted 3′ tails, information on the 3′ intron-exon junction is not obtainable from intron lariat RNA sequences. Nevertheless, lariat sequences provide information about branch points that is not obtainable from whole transcriptome sequencing. Such information is especially useful for studies of introns in organisms whose branch point sequences are not as highly conserved as those in S. cerevisiae [e.g. humans]. Finally, the absence of known intron sequences from an RNA population enriched-for RNA lariats can indicate that a gene is not expressed under the growth regimen employed. However, if an intron-containing gene is known to be expressed during the experiment, absence of intron sequences from the RNA lariat population could be an indication that the intron is removed by the hydrolytic splicing pathway observed for self splicing group II introns rather than the predominant branching pathway. High-throughput sequencing of enriched lariat RNAs from human cells is useful for much more detailed analysis of human branch point sequences.
Dbr1 is an RNA lariat debranching enzyme that hydrolyzes 2′-5′ phosphodiester bonds at the branch points of excised intron lariats. The alignment model shown in FIG. 14 represents the N-terminal metallophosphatase domain of Dbr1. This domain belongs to the metallophosphatase (MPP) superfamily. MPPs are functionally diverse, but all share a conserved domain with an active site consisting of two metal ions (usually manganese, iron, or zinc) coordinated with octahedral geometry by a cage of histidine, aspartate, and asparagine residues. The MPP superfamily includes: Mre11/SbcD-like exonucleases, Dbr1-like RNA lariat debranching enzymes, YfcE-like phosphodiesterases, purple acid phosphatases (PAPs), YbbF-like UDP-2,3-diacylglucosamine hydrolases, and acid sphingomyelinases (ASMases). The conserved domain is a double beta-sheet sandwich with a di-metal active site made up of residues located at the C-terminal side of the sheets. This domain allows for productive metal coordination.
Linear and lariat RNAs have different sensitivities to exonucleolytic enzymes. Almost all linear RNAs are susceptible to complete or nearly complete degradation by enzymes that have 3′ exonucleolytic activity. The key is to use an enzyme that is blocked by the lariat branch point and cannot degrade past the branch point. Such enzymes leave the lariat loop intact. Since lariat RNAs lack a 5′ end, they are insensitive to 5′ exonucleolytic activity; however, many linear RNAs are also sensitive to 5′ exonucleolytic activity. Linear RNAs with 5′ cap structures, which protect RNAs from 5′ exonucleolytic activity, are made sensitive to 5′ exonucleolytic activity by removing their caps. Cap removal treatments do not make lariat RNAs sensitive to exonucleases with 5′ exonucleolytic activity. FIG. 9 and FIG. 10 illustrate the 3′ and 5′ exonucleolytic strategies, respectively, to create an RNA population that is highly enriched for RNA lariats.
Several methods may be employed to create an RNA population that is highly enriched for RNA lariats. Such methods include: 1) treat the RNA sample with a nuclease that has 3′ exonucleolytic activity, a combination of nucleases with 3′ exonucleolytic activity can also be used; 2) treat the RNA sample to remove the 5′ cap structure from mRNAs, then treat with a nuclease that has 5′ exonucleolytic activity, a combination of nucleases with 5′ exonucleolytic activity can also be used; 3) treat the RNA sample with a nuclease that has both 5′ and 3′ exonucleolytic activity, with or without prior treatment to remove the 5′ cap structure from mRNAs, a combination of nucleases, one or more with 5′ exonucleolytic activity plus one or more with 3′ exonucleolytic activity, can also be used.
To increase the proportion of lariat RNAs in the RNA population, RNA samples can be obtained from cells in which RNA debranching enzyme activity has been lowered or eliminated. Because the enhancement of RNA lariat levels in these cells is so dramatic, the resulting sample is useful for identifying RNA lariat species that are normally present at very low levels (i.e. in cells that have wild-type levels of RNA debranching enzyme activity). Another method that can be employed to increase the proportion of lariat RNAs in the RNA population being studied is to selectively remove rRNA species from the RNA sample prior to lariat RNA enrichment.
A control RNA sample that is depleted of lariat RNAs can be created and processed in parallel to the exonuclease-treated RNA sample to identify which RNAs are lariats in the exonuclease-resistant RNA population. The lariat depleted RNA sample is created by treatment of an RNA sample with RNA debranching enzyme prior to the exonucleolytic treatment protocol.
Following acquisition and treatment of RNA samples as outlined above, RNAs are processed for high-throughput sequencing. Although different platforms for high-throughput sequencing have been developed and continue to be developed, all of platforms involve parallel sequencing of large numbers of DNA fragments. All of these platforms are used for RNA sequencing by incorporating cDNA production protocols. The lariat-seq technique requires conversion of lariat-enriched RNA samples into cDNA populations, which are then processed for high-throughput sequencing according to the methods developed for the individual high-throughput sequencing platforms.
To aid in determining which cDNA sequences represent lariat RNAs, sequencing data resulting from experimental and control RNA samples are compared. RNAs originally in a lariat conformation will be represented at lower levels (proportionally and absolutely) in the control sample, resulting in a proportional (and absolute) reduction in the number of their corresponding cDNA sequences relative to the experimental sample. Some RNAs that are not in a lariat conformation in samples extracted from cells will survive the treatments to create an RNA population enriched for RNA lariats, for example RNAs with covalent modifications, other than a 2′-5′ branch, that block the exonuclease used to create the experimental sample. These RNAs will be represented approximately equally (in absolute terms) in experimental and control samples. Selective removal of rRNA species from the RNA sample prior to lariat RNA enrichment, as stated above, will remove many RNAs that contain non-lariat covalent modifications that block the exonuclease.
Further evidence that a nuclease-resistant RNA identified by lariat-seq has a lariat conformation comes from signature cDNA products unique to lariat RNAs. Reverse transcriptase (RT) used for creating cDNA for sequencing is blocked by the presence of a 2′ branch in an RNA substrate. However, when traveling along the branch segment itself, RT will read across the 2′-5′ bond, creating cDNAs that juxtapose sequences that are not contiguous in the reference genome. Furthermore, when RT reads across the 2′-5′ bond it inserts a nucleotide that is not expected according to Watson-Crick base pairing rules. Typically, for an intron lariat branch point, RT inserts an A opposite the branch point A instead of a T. Sequence reads that contain discontinuous genome segments with an unexpected nucleotide at the junction of the two segments are evidence that the cDNA was created from a lariat RNA.
The different sensitivities of linear and lariat RNAs to the 3′ exonuclease polynucleotide phosphorylase (PNPase) are shown in FIG. 11. Using RT-PCR to measure RNA levels, it is apparent that exonuclease treatment degrades a linear RNA down to the limit of detection while a lariat RNA remains virtually untouched (comparing lanes 1 and 2 (PNPase treatment) to lanes 5 and 6 (untreated)).
Linear and lariat RNAs also have different sensitivities to RNA debranching enzyme, which can be exploited to confirm that an RNA species has a lariat conformation. In vitro cleavage of intron RNA lariats with purified S. cerevisiae Dbr1p is readily detectable with an RT-PCR assay, as shown in FIG. 12, lanes 3 and 4 (Dbr1p treatment) versus lanes 1 and 2 (untreated). For the RT-PCR in FIG. 12, a primer that spans the branch point was used for RT-PCR, which is why the intron signal is reduced upon Dbr1p treatment.
The use of sequential Dbr1p and PNPase treatments to explore the properties of a particular RNA species (control described above) is depicted in FIG. 11. As shown in FIG. 11, lanes 3 and 4 show the loss of a known lariat RNA when Dbr1p treatment precedes PNPase treatment. Compare to lanes 1 and 2 (PNPase treatment only) as well as lanes 5 and 6 (no treatment).
Data from high-throughput sequencing of cDNAs created from PNPase-treated RNA samples support the feasibility and operability of lariat-seq. Total S. cerevisiae RNA from a strain lacking a functioning RNA debranching enzyme was converted into cDNA after PNPase treatment and subjected to a high-throughput sequencing protocol (Illumina platform). An example of a small portion of the results obtained is depicted in FIG. 13, which shows the sequence reads that match to a segment of chromosome 6 (FIG. 13A). What is striking about the results is that the only sequence reads that map to this 20 kbp segment of the S. cerevisiae genome are from cDNAs that represent the intron region of the ACT1 gene (FIG. 13B). Furthermore, all these reads map within the sequences corresponding to the lariat loop of the intron; none of the sequence reads represent the 43 by that lie within the intron downstream of the lariat branch point. The fact that no sequence reads mapped to the ACT1 coding region or any other gene in the 20 kbp segment depicted in FIG. 13 indicates how efficiently the 3′ exonuclease degraded the linear RNAs in the sample.
The components necessary for RNA lariat enrichment can be provided in a kit for ease of use. An example of such a kit is described below. Variations of the kit are also contemplated.
Components of RNA lariat purification and analysis kit include the following: Bacillus stearothermophilus polynucleotide phosphorylase (BsPNPase); 2× BsPNPase reaction buffer: 100 mM Tris HCl, pH 8.5; 2 mM 2-mercaptoethanol; 2 mM EDTA; 40 mM KCl; 3 mM MgCl2; 20 mM Na2HPO4, pH 8.3; Saccharomyces cerevisiae RNA debranching enzyme (ScDbr1); 10× ScDbr1 reaction buffer: 200 mM HEPES KOH (pH 7.9), 1.25 M KCl, 5 mM MgCl2, 10 mM dithiothreitol; siRNAs (or siRNA sources) targeting mRNA for RNA debranching enzyme (different siRNA resources are packaged, depending on the organism for which the kit is specified); Saccharomyces cerevisiae total RNA samples (from dbr1 mutant and wild-type cells) for control RT-PCRs to assess lariat purification; primers for control RT-PCRs [to amplify ACT1 mRNA (linear RNA) and the ACT1 intron lariat RNA from Saccharomyces cerevisiae total RNA samples]; and, primers for control RT-PCRs for the organism for which the kit is specified [to amplify a known linear RNA and a known lariat RNA].
The kit also includes instructions of use. An example of such instructions includes the following:
The kit may also include a control sample that is not enriched for RNA lariats. A control RNA sample that reflects the total RNA sample purified from cells is created by performing the above procedure but without BsPNPase in step 3.
The kit may also include a control sample that contains debranched RNA lariats. True lariat RNAs present in the BsPNPase-resistant RNA population will be sensitive to BsPNPase in RNA samples pretreated with ScDbr1.
In order to Confirm the enrichment of RNA lariats, control RT-PCRs for known linear and lariat RNAs are performed on treated RNA samples (both the samples enriched for RNA lariats and the control samples). Primers are provided for use with Saccharomyces cerevisiae RNA as well as for the organism for which the kit is specified.
Following treatment of RNA samples as outlined above (and confirmation of lariat-enrichment), RNAs are processed for high-throughput sequencing. The next step is to create a cDNA library from each treated RNA sample using procedures established for the high-throughput sequencing platform to be used (Illumina, SOLiD, etc). Materials for creating cDNA libraries are available from several different manufacturers.
Bacillus stearothermophilus polynucleotide phosphorylase (BsPNPase) storage buffer: 50% glycerol, 50 mM Tris-HCl (pH 8.5), 100 mM NaCl, 0.1 mM EDTA, 0.1% Triton X-100 and 1 mM dithiothreitol.
Saccharomyces cerevisiae RNA debranching enzyme (ScDbr1) storage buffer: 50% glycerol, 20 mM HEPES KOH (pH 7.9), 125 mM KCl, 0.5 mM MgCl2, 1 mM dithiothreitol.
One unit of BsPNPase activity is defined as the amount of PNPase that forms 1 μmol of ADP per hour at 60° C. by depolymerizing of Poly A.
One unit of ScDbr1 activity is defined as the amount of ScDbr1 that debranches 50% of the ACT1 intron present in 1 microgram of a total Saccharomyces cerevisiae RNA preparation (from mid-log phase cells) from a dbr1 mutant strain per hour at 30° C.
The invention illustratively disclosed herein suitably may be practiced in the absence of any element, which is not specifically disclosed herein. It is apparent to those skilled in the art, however, that many changes, variations, modifications, other uses, and applications to the method are possible, and also changes, variations, modifications, other uses, and applications which do not depart from the spirit and scope of the invention are deemed to be covered by the invention, which is limited only by the claims which follow.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.
1. An isolated debranching enzyme comprising an amino acid sequence having at least 35% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 46-66.
2. The isolated debranching enzyme of claim 1, wherein the sequence identity is selected from the group consisting of about 40, 45, 50, 55, 60, 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or more.
3. The isolated debranching enzyme of claim 1, wherein the amino acid sequence has at least 75% sequence identity to the metallophosphatase domain of a sequence selected from the group consisting of SEQ ID NO: 46-66.
4. The isolated debranching enzyme of claim 3, wherein the sequence identity is selected from the group consisting of about 40, 45, 50, 55, 60, 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or more.
5. A method of enriching an RNA population for lariat RNA comprising:
a. providing an RNA population; and,
b. contacting the RNA population with a linear RNA degrading enzyme to form a lariat RNA enriched population.
6. The method of claim 5 further comprising contacting the RNA population with a debranching enzyme.
7. The method of claim 6, wherein the debranching enzyme comprises an amino acid sequence having at least 35% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 46-66.
8. The method of claim 5, wherein the linear RNA degrading enzyme is selected from the group consisting of 3′ exonuclease, 5′ exonuclease, 5′/3′ exonuclease, or combinations thereof.
9. A method of analyzing lariat RNA in an RNA sample comprising the steps of:
a. providing an RNA population;
b. contacting the RNA population with a linear RNA degrading enzyme to form a lariat RNA enriched population; and,
c. creating a cDNA library from the lariat RNA population.
10. The method of claim 9, wherein the linear RNA degrading enzyme is selected from the group consisting of 3′ exonuclease, 5′ exonuclease, 5′/3′ exonuclease, or combinations thereof.
11. The method of claim 9 further comprising contacting the lariat RNA enriched population with a debranching enzyme.
12. The method of claim 10, wherein the debranching enzyme comprises an amino acid sequence having at least 35% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 46-66.
13. The method of claim 9 further comprising sequencing the cDNA library.
14. A kit comprising:
a. a linear RNA degrading enzyme;
b. buffer; and,
c. instructions.
15. The kit of claim 14 further comprising a debranching enzyme.
16. The kit of claim 14 further comprising a debranching enzyme buffer.
17. The kit of claim 15, wherein the debranching enzyme comprises a amino acid sequence having at least 35% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 46-66.
18. The kit of claim 17, wherein the sequence identity is selected from the group consisting of about 40, 45, 50, 55, 60, 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or more.
19. The kit of claim 14, wherein the linear RNA degrading enzyme is selected from the group consisting of 3′ exonuclease, 5′ exonuclease, 5′/3′ exonuclease, or combinations thereof.
20. The kit of claim 14 further comprising a 5′ decapping enzyme.