Patent application title:

MUTANT POLYMERASES WITH FAST ELONGATING ACTIVITY

Publication number:

US20130252309A1

Publication date:
Application number:

13/907,891

Filed date:

2013-06-01

Abstract:

An isolated polypeptide having fast elongating polymerase activity. Also provided are kits containing the isolated polypeptide and isolated polynucleotides encoding the isolated polypeptide.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N9/1252 »  CPC main

Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7); Nucleotidyltransferases (2.7.7) DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase

C12N9/12 IPC

Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

The present application is a Continuation of U.S. application Ser. No. 12/330,201 filed on 8 Dec. 2008, which is a Divisional of U.S. application Ser. No. 11/005,559 filed on 6 Dec. 2004 issued as U.S. Pat. No. 7,462,475 on 9 Dec. 2008, which is a Continuation-in-part of U.S. application Ser. No. 10/850,816 filed 20 May 2004, each incorporated herein by reference in their entirety to the extent permitted by law, and claims benefit of priority therefrom.

INCORPORATION BY REFERENCE OF SEQUENCE LISTING

The Sequence Listing, which is a part of the present disclosure, includes a computer readable form and a written sequence listing comprising nucleotide and/or amino acid sequences of the present invention. The sequence listing information recorded in computer readable form is identical to the written sequence listing. The subject matter of the Sequence Listing is incorporated herein by reference in its entirety.

BACKGROUND

The polymerase chain reaction (PCR) is a sensitive DNA amplification procedure that permits the selection and detection of specific nucleic acids from a complex mixture. In its most rudimentary form, PCR is employed using a sample that contains a target nucleic acid (DNA), a set of DNA primers that hybridize to the target, and a DNA polymerase that is capable of primer-based synthesis of complementary strands of the target. During the nucleic acid amplification process, the target:primer:polymerase mixture is subjected to successive rounds of heating at different temperatures to facilitate target DNA strand separation (performed at 90-99° C.), primer:target DNA strand annealing (performed at ˜40-70° C.), and DNA polymerase-mediated primer elongation (performed at ˜50-72° C.) to create new complementary target strands. Because the reaction may be subjected to ˜25-45 rounds of cycling to yield the desired DNA amplification product, PCR is usually conducted using thermostable DNA polymerases that can withstand the very high temperatures associated with target strand separation without suffering inactivation due to heat-induced protein denaturation. Since its introduction in the mid-1980's, PCR has become the de facto standard for detecting minute quantities of nucleic acids in samples, and obtaining specific genes from complex DNA genomes and samples.

A major problem with diagnostic and forensic techniques based on PCR is the false-negative reactions or low sensitivity caused by inhibitory substances that interfere with PCR (1, 2, 3). Of particular clinical importance is the PCR analysis of blood samples, which represents the largest fraction of human health related tests for diagnosis of genetic diseases, virus and microbial infections, blood typing, and safe blood banking. Various studies indicate that the inhibitory effect of blood on PCR is primarily associated with direct inactivation of the thermostable DNA polymerase and/or capturing or degradation of the target DNA and primers. It has been reported that the protease activity in blood also contributes to the reduced efficiency of PCR (1-5, 7, 10, 12).

The blood resistance characteristics of the thermostable DNA polymerases vary with the source of the enzyme (6). Widely used thermostable polymerases like Thermus aquaticus DNA polymerase (Taq) and AmpliTaq Gold® are completely inhibited in the presence of 0.004-0.2% whole human blood (vol/vol; 3, 4, 6). Various agents have been tested for reducing the inhibitory effect of blood on Taq. It was found that an addition of betaine, bovine serum albumin, the single-stranded DNA binding protein of the T4 32 gene (gp 32), or a cocktail of protease inhibitors can partially relieve the blood inhibition and allow Taq to work in up to 2% blood (vol/vol), although this effect could be sample specific (3, 8, 9, 11).

Several major inhibitors of PCR in human blood have been characterized such as immunoglobulin G, hemoglobin, lactoferrin and excess of leukocyte DNA (4, 7, 10). The IgG, hemoglobin, and lactoferrin have been purified from plasma, erythrocytes and leukocytes, respectively, using size-exclusion and anion-exchange chromatography (4, 7). The heme has been reported to inactivate the Taq polymerase by binding to its catalytic domain (10), while the mechanism of action of the other inhibitory components is more poorly understood. The inhibitory effect of IgG can be reduced when this plasma fraction is heated at 95° C. before adding it to PCR, or with the addition of excess non-target DNA to the PCR mixture. However, heating of IgG together with target DNA at 95° C. was found to block amplification. Inhibition by IgG may be due to an interaction with the single-stranded DNA fraction in the target DNA. The inhibitory effect could be removed also by treating the plasma with DNA-agarose beads prior to amplification (4).

Other complicating factors include EDTA and heparin, used as anti-coagulants, which can also inhibit DNA amplification. The addition of heparinase has been shown to counteract the heparin-mediated inhibition (13, 14). Therefore, various laboratory procedures of sample preparation have been developed to reduce the inhibitory effect of blood. The DNA purification methods suitable for PCR can include additional steps like dialysis, treatment with DNA-agarose beads or Chelex 100 resin, multiple DNA washes, or a combination of dilution with buffer which causes lysis of red blood cells, centrifugation to recover the white blood cells, washing with NaOH and the addition of bovine serum albumin (2,3, 15-19).

These pre-treatment steps of the blood samples are generally time-consuming, labor-intensive, and can be sample specific. The guanidinium thiocyanate method for DNA isolation is not suitable for reliable detection of Mycobacterium tuberculosis in clinical samples. An alternative method of DNA purification with protease K treatment followed by phenol-chloroform extraction has to be employed to relieve the inhibition (20). Separation with a QIAamp kit followed by dialysis with a Millipore filter are required for eliminating the heme inhibition of hepatitis B virus detection (21). In addition, some the above steps carry a risk of target DNA losses and are not suitable for automation. Moreover, even commercial kits specially formulated for DNA purification from blood samples such as QIAmp or GeneReleaser are not always satisfactory. The reason is due to an incomplete removal of Taq inhibitors, which can result in false-negative results. For example, 14% of the human blood samples tested for hepatitis B virus yielded false-negative results when using such blood kits (21).

The objective of achieving specificity of amplification reactions for samples containing whole blood is further complicated by two types of unwanted DNA synthesis reactions that occur during PCR. Both types of side-reactions are frequently competitive with the desired target and can lead to impure product or failed amplification. This is particularly problematic for PCR assays containing a low copy number of the nucleic acid template target, wherein the PCR conditions are modified to include a greater number of amplification cycles to achieve an adequate yield of the desired amplification product.

The first type of unwanted DNA synthesis is priming on less specific sequences in the template. This is only an issue if the template is contaminated with single-stranded nucleic acid or if the template is single-stranded, which is the case if the DNA preparation has been subjected to melting conditions during its isolation.

The second type of unwanted DNA synthesis is primers acting as templates for themselves and/or each other, with at least the result of modifying their 3′ ends by the addition of additional nucleotides. These so-modified primers are able to anneal to the nucleic acid target; however, they do not serve as primers for complementary strand synthesis due to the presence of mismatched nucleotides at the site of elongation between the 3′ end of the primer and the desired target. This problem is often referred to as “primer dimer”, although this name is not accurately descriptive. This problem can often be reduced or avoided by careful primer design, and it is more of a problem with multiplex PCR, since there is more opportunity for accidental homology among multiple pairs of primers.

A procedure known as “hot start PCR” avoids the occurrence of both types of unwanted DNA synthesis side-reactions. According to this method, the enzyme DNA polymerase, or a buffer component essential to its activity, such as the magnesium (II) cation and/or the dNTPs, is withheld from the other PCR assay mixture ingredients until the PCR reaction has been heated to at least the normal primer-annealing (or, preferably, the DNA extension) temperature (55-75° C., optimal 68° C.). At this temperature the primers can presumably not form stable duplexes with themselves or at unwanted template sequences. After the selective temperature is achieved, the omitted component is added to reaction to reconstitute a functional amplification mixture.

Typical hot start PCR procedures are not only labor-intensive, they expose the PCR reactions to contamination with each other and with molecules that have been previously amplified in the thermal cycler machine.

The more standard ways of executing a hot start consist of formulating the PCR reaction in two parts, such that the DNA polymerase is not able to act on the DNA until the two portions are combined at high temperature, usually 65-85° C. For instance, an initial solution containing all of the magnesium is introduced to the reaction tube encapsulated in a wax bead or sealed under a layer of wax. The rest of the reaction, without Mg, is then added, along with an overlay of oil, if appropriate. While the reaction heats for the first cycle, the wax melts and floats to the surface, allowing the magnesium to mix with the reaction volume. The DNA polymerase activity is therefore reconstituted at a temperature that does not allow non-specific or unwanted primer interactions. A great drawback to the wax method comes after the PCR cycling is complete, and the product must be withdrawn for analysis. The wax then tends to plug the pipette tip, greatly adding to the time and effort of reaction analysis.

Recently, a method of hot start which is not hot at all, but which uses anti-Taq antibodies, has been described, patented and made commercially available (33-35). The antibodies largely neutralize the enzyme activity of the Taq polymerase, and can be added any time prior to the primers, or be conveniently present during storage of the stock enzyme. The antibodies are thermolabile, thus permitting the Taq polymerase to resume activity after the first heat step. The antibodies so far developed for this method must be used in 10-fold molar excess and are expensive. Furthermore, the antibodies inhibit some long PCR assays that are conducted with the KlentaqLA polymerase mixture.

A chemically inactivated form of the Taq polymerase has been introduced recently, termed AmpliTaq Gold®. The nature of the inactivation is proprietary, but the inactivation is reversible by heating the polymerase at 95° C. This method may be even more convenient than the other methods, but it has at least one current disadvantage: the time for reactivation is about 10 minutes at 95° C. This procedure is incompatible with long PCR applications, as this treatment would excessively depurinate nucleic acid targets longer than a few kb.

Thus, the analysis of whole blood samples using PCR would be benefited by the discovery of new reagents and methods that overcome the aforementioned shortcomings of current PCR technologies. The invention disclosed herein addresses and solves many of these shortcomings.

SUMMARY OF THE INVENTION

In a first aspect, the present invention is a method of obtaining DNA amplification of a nucleic acid target from a volume of whole blood comprising performing DNA amplification in a PCR assay mixture with a blood-resistant polymerase.

In a second aspect, the present invention is a method of obtaining DNA amplification of a nucleic acid target from a volume of whole blood comprising performing DNA amplification in a PCR assay mixture with KT-1 (SEQ ID NO:2) or Z-TAQ™.

In a third aspect, the present invention is a method of obtaining DNA amplification of a nucleic acid target from a whole blood sample with a DNA amplification cocktail by avoiding mixing of the whole blood sample with the DNA amplification cocktail in a reaction vessel before thermal cycling that includes the following steps: adding the DNA amplification cocktail to the reaction vessel, wherein the DNA amplification cocktail comprises at least one DNA polymerase; adding the whole blood sample to the reaction vessel, wherein the whole blood sample is layered beneath the DNA amplification cocktail regardless of the order of addition of the DNA amplification cocktail and the whole blood sample to the reaction vessel; and performing a thermal cycling program to effect DNA amplification of the nucleic acid target.

In a fourth aspect, the present invention is a method of obtaining a hot start for DNA amplification of a nucleic acid target that includes the preparation of the reaction cocktail comprising at least a first volume component and a second volume component. The second volume component is heavier than the first volume component. The first volume component comprises a DNA polymerase cocktail lacking an essential constituent required for DNA amplification activity. The second volume component includes the essential constituent required for DNA amplification activity. The second volume component is underlayed below the first volume component without undue mixing before a DNA amplification reaction is initiated.

In a fifth aspect, the present invention is an isolated polypeptide comprising an amino acid sequence having at least 80% amino acid sequence identity with at least one member selected from the group consisting of KT-6 (SEQ ID NO:4), KT-7 (SEQ ID NO:6), KT-10 (SEQ ID NO:20), KT-12 (SEQ ID NO:24), FL-10 (SEQ ID NO:28), and FL-12 (SEQ ID NO:30), wherein the isolated polypeptide comprises a blood-resistant polymerase.

In a sixth aspect, the present invention is an isolated polypeptide comprising an amino acid sequence having at least 80% amino acid sequence identity with at least one member selected from the group consisting of KT-7 (SEQ ID NO:6), KT-11 (SEQ ID NO:22), KT-12 (SEQ ID NO:24), and FL-12 (SEQ ID NO:30), wherein the isolated polypeptide comprises a faster elongating polymerase.

In a seventh aspect, the present invention is an isolated polypeptide comprising at least one member selected from the group consisting of KT-6 (SEQ ID NO:4), KT-7 (SEQ ID NO:6), KT-10 (SEQ ID NO:20), KT-11 (SEQ ID NO:22), KT-12 (SEQ ID NO:24), FL-10 (SEQ ID NO:28), and FL-12 (SEQ ID NO:30).

In an eighth aspect, the present invention is an isolated polypeptide comprising KT-1 (SEQ ID NO:2) having at least two amino acid residue substitutions, wherein one of the at least two amino acid residue substitutions comprises amino acid residue position 430 such that the isolated polypeptide encodes a blood-resistant polymerase, a faster elongating polymerase, or a blood-resistant, faster elongating polymerase.

In a ninth aspect, the present invention is an isolated polypeptide comprising Taq DNA polymerase (SEQ ID NO:26) having at least three amino acid residue substitutions, wherein one of the at least three amino acid residue substitutions comprises amino acid residue position 708 such that the isolated polypeptide encodes a blood-resistant polymerase, a faster elongating polymerase, or a blood-resistant, faster elongating polymerase.

In a tenth aspect, the present invention is an isolated nucleic acid comprising a nucleotide sequence having at least 80% nucleotide sequence identity with at least one member selected from the group consisting of KT-1 (SEQ ID NO:1), KT-6 (SEQ ID NO:3), KT-7 (SEQ ID NO:5), KT-10 (SEQ ID NO:19), KT-12 (SEQ ID NO:23), Taq DNA polymerase (SEQ ID NO:25), FL-10 (SEQ ID NO:27), and FL-12 (SEQ ID NO:29), wherein the isolated nucleic acid encodes a blood-resistant polymerase.

In a eleventh aspect, the present invention is an isolated nucleic acid comprising a nucleotide sequence having at least 80% nucleotide sequence identity with at least one member selected from the group consisting of KT-1 (SEQ ID NO:1), KT-7 (SEQ ID NO:5), KT-11 (SEQ ID NO:21), KT-12 (SEQ ID NO:23), Taq DNA polymerase (SEQ ID NO:25), and FL-12 (SEQ ID NO:29), wherein the isolated nucleic acid encodes a faster elongating polymerase.

In a twelfth aspect, the present invention is an isolated nucleic acid comprising at least one member selected from the group consisting of KT-6 (SEQ ID NO:3), KT-7 (SEQ ID NO:5), KT-10 (SEQ ID NO:19), KT-11 (SEQ ID NO:21), KT-12 (SEQ ID NO:23), FL-10 (SEQ ID NO:27), and FL-12 (SEQ ID NO:29).

In a thirteenth aspect, the present invention is an isolated nucleic acid comprising KT-1 (SEQ ID NO:1) having at least two codon substitutions, wherein one of the at least two codon substitutions comprises codon position 430 such that the isolated nucleic acid encodes a blood-resistant polymerase, a faster elongating polymerase, or a blood-resistant, faster elongating polymerase.

In a fourteenth aspect, the present invention is an isolated nucleic acid comprising Taq DNA polymerase (SEQ ID NO:25) having at least three codon substitutions, wherein one of the at least three codon substitutions comprises codon position 708 such that the isolated nucleic acid encodes a blood-resistant polymerase, a faster elongating polymerase, or a blood-resistant, faster elongating polymerase.

In a fifteenth aspect, the present invention is a method of obtaining rapid DNA amplification of a nucleic acid target in a PCR assay mixture comprising a faster elongating DNA polymerase.

In a sixteenth aspect, the present invention is a kit for performing PCR assays on samples of whole blood, wherein the kit comprises a blood-resistant polymerase.

In a seventeenth aspect, the present invention is a kit for performing PCR assays on samples of whole blood, wherein the kit comprises KT-1 (SEQ ID NO:2) or Z-TAQ™.

Other objects and features will be in part apparent and in part pointed out hereinafter.

BRIEF DESCRIPTION OF THE DRAWINGS

Those of skill in the art will understand that the drawings, described below, are for illustrative purposes only. The drawings are not intended to limit the scope of the present teachings in any way.

FIG. 1 depicts results of PCR assays with different forms of Klentaq polymerase (40 mutants and wild-type form of Klentaq) conducted in the presence of inhibitory amounts of blood. Clones KT-6 and KT-7 were capable of amplifying a 1.65 kbp target DNA from added plasmid template in the presence of 10% whole human blood.

FIG. 2A depicts results of PCR amplification of a 0.32 kbp endogenous target DNA directly from whole blood with two mutant forms of Klentaq (KT-6 and KT-7) in the presence of increasing amounts of whole human blood (lane 1: 0%; lane 2: 5%; lane 3: 10%; lane 4: 15%).

FIG. 2B depicts results of PCR assays directed toward the amplification of a 0.32 kbp endogenous human Dystrophin gene fragment in the presence of the indicated percentages of whole blood (vol/vol) in homogeneous PCR assay solutions with two mutant forms of Klentaq (KT-10 and KT-12), as shown above the figure.

FIG. 2C depicts results of PCR assays directed toward amplification of a 1.1 kbp endogenous CCR5 gene fragment in the presence of the indicated percentages of whole blood (vol/vol) in homogeneous PCR assay solutions with two mutant forms of Klentaq (KT-10 and KT-12), as shown above the figure.

FIG. 3A depicts results of PCR assays directed toward the amplification of a 0.32 kbp fragment of the endogenous human Dystrophin gene, 1.1 kbp and 2.5 kbp fragments of the endogenous human CCR5 gene, or a 4.3 kbp endogenous human Tissue Plasminogen Activator (TPA) gene fragment in the presence of the indicated amounts of whole blood (vol/vol) (as shown above the figure) in homogeneous PCR assay solutions using a blood-resistant mutant form of full-length Taq DNA polymerase (FL-10) in comparison to blood-inactive commercial Taq enzymes (JumpStart™ Taq (Sigma), AmpliTaq Gold® (Applied Biosystems) and Ex Taq (Takara)) (lanes denoted by “0” are PCR assays conducted in the absence of blood and lanes indicated by “0+” refer to PCR assays conducted in the presence of 10 ng of human DNA).

FIG. 3B depicts results of DNA amplification of a 1.1 kbp endogenous CCR5 human gene fragment (indicated by the arrow) in reactions of homogeneous PCR assay solutions containing whole blood at the indicated percentages (vol/vol) (as shown below the figure) using FL-12 and Z-TAQ™ (Takara) Taq DNA polymerases.

FIG. 4A depicts results of PCR amplification of a 1.65 kbp target DNA as a function of elongation time for reactions containing Klentaq1 polymerase (lane 1), two mutant Klentaq polymerases (KT-6 (lane 2) and KT-7 (lane 3)), and another commercially available Taq polymerase (lane 4). The extension times are indicated below the panel.

FIG. 4B depicts results of PCR amplification of a 1.65 kbp target DNA as a function of exogenous template concentration and elongation time for reactions containing a mutant Klentaq polymerase (KT-7) and a DNA polymerase that possesses the highest prior art elongation rates (Z-TAQ™). The added nucleic acid target amounts were as follows: 0.5 ng (lane 1); 0.25 ng (lane 2); 0.125 ng (lane 3); and 0.06 ng (lane 4). The extension times were as follows: 60 sec (upper panel); 15 sec (central panel); and 12 sec (lower panel).

FIG. 4C depicts results of PCR amplification of a 1.65 kbp target DNA (denoted by arrow) using either mutant Klentaq DNA polymerases KT-7 (lane 1), KT-11 (lane 2), or KT-12 (lane 3), the wild-type Klentaq DNA polymerase (lane 4), the mutant full-length Taq DNA polymerase FL-12 (lane 5), or Z-TAQ™ (Takara; lane 6) performed with PCR cycles having extension steps reduced to 30 sec.

FIG. 5A illustrates the results of heavy hot start PCR assays (100 μl reaction volumes) conducted with KT-1 (SEQ ID NO:2), KT-6 (SEQ ID NO:4) and KT-7 (SEQ ID NO:6) in the presence of whole blood and under different conditions of pre-treatment of the reaction samples prior to initiating the thermal cycling program. The asterisks indicate those reaction vessels wherein the heavy and light volume component layers were premixed by vortexing, i.e., reactions that a contain homogeneous PCR assay solution and that were not subjected to a heavy hot start procedure as described herein. Lanes 1-13, 15 and 17 are PCR assays directed toward the amplification of a 1.1 kbp target from the human CCR5 gene whereas lanes 14, 16, and 18 are PCR assays directed toward the amplification of a 2.5 kbp target from the human CCR5 gene.

FIG. 5B illustrates an example of PCR assay tubes from reaction mixtures 9-14 of FIG. 5A that were not mixed prior to initiating the thermal cycling reaction (heavy hot start reactions; reaction nos. 9, 10, 13, and 14) or mixed by vortexing briefly prior to initiating the thermal cycling reaction (non-heavy hot start reactions; reaction nos. 11 and 12);

FIG. 6 depicts results of heavy hot start PCR amplification of a 0.5 kbp target from the human CCR5 gene of cells present in whole blood. The reactions were conducted in the presence of whole blood in the lower layer at the percentages indicated below each lane (vol/vol; adjusted for total volume of both layers), in the absence of whole blood (indicated by “0”), or in absence of blood and in the presence of 10 ng of human DNA (indicated by “0+”).

FIG. 7 depicts results of PCR assays directed toward the amplification of a 2.5 kbp target from the human CCR5 gene derived from 2 ng of genomic DNA (designated “DNA”) or from 3% whole blood (vol/vol) (designated “Blood”) using either KT-1 (SEQ ID NO:2), KT-6 (SEQ ID NO:4), or KT-7 (SEQ ID NO:6) in the absence of Deep Vent polymerase (lanes 1-3 and 7-9) or in the presence of Deep Vent polymerase (lanes 4-6 and 10-12), wherein the ratio of the KT enzyme to Deep Vent polymerase is about 360 to 1.

ABBREVIATIONS AND DEFINITIONS

The following definitions and methods are provided to better define the present invention and to guide those of ordinary skill in the art in the practice of the present invention. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art.

The term “amplicon” refers to the nucleic acid that is the target of DNA amplification of a PCR assay.

The phrase “amplification activity” refers to the functional ability of a DNA polymerase to synthesize copies of a nucleic acid target under the PCR conditions disclosed herein to yield a quantity of amplified DNA product that is discernable by intercalative dye (e.g., ethidium bromide) staining methods that are well known in the art.

The phrase “homogeneous PCR assay solution” as used herein refers to a solution that is homogenous with respect to the absence of discrete phases. A homogeneous PCR assay solution is one that is typically prepared by mixing the contents of a reaction vessel using a vortexer or comparable mixing apparatus. In the context of heavy hot start PCR assays, the PCR assay solution is composed of two phases prior to initiating the thermal cycling program; that is, the PCR assay solution of a heavy hot start PCR assay is not premixed prior to initiating a thermal cycling program and is not considered a homogenous PCR assay solution.

The phrase “blood-resistant polymerase” as used herein refers to a mutant form of either Klentaq-278 DNA polymerase or full-length Taq DNA polymerase wherein the mutant enzyme is cold sensitive and displays amplification activity in a homogeneous PCR assay solution containing whole blood in the range from about 3% (vol/vol) to about 25% (vol/vol). By “cold sensitive,” the mutant enzyme displays lower amplification activity than wild-type Taq DNA polymerase at reduced temperatures relative to the normal temperature at which DNA extension reactions are performed (−72° C.). Such a mutant enzyme displays DNA amplification activity under hot start PCR conditions. A mutant form of Klentaq-278 DNA polymerase includes a polypeptide that does not encode the identical amino acid sequence of Klentaq-278 DNA polymerase (SEQ ID NO:2). Examples of such mutant forms include a deletion of at least one amino acid, an insertion of additional amino acids, or a change of at least one amino acid relative to the amino acid sequence of the Klentaq-278 DNA polymerase (SEQ ID NO:2). A mutant form of full-length Taq DNA polymerase includes a polypeptide that does not encode the identical amino acid sequence of the full-length Taq DNA polymerase (GenBank Accession No. J04639; SEQ ID NO:25). Examples of such mutant forms include a deletion of at least one amino acid, an insertion of additional amino acids, or a change of at least one amino acid relative to the amino acid sequence of the full-length Taq DNA polymerase (SEQ ID NO:25).

The phrase “faster elongating polymerase” as used herein refers to a derivative of Taq DNA polymerase that displays amplification activity in PCR assays conducted with extension times in the range from about 12 seconds to about 50 seconds to complete up to 2 kb.

The phrase “physiologically compatible buffer” as used herein refers to any solution that is compatible with the function of enzyme activities and enables cells and biological macromolecules to retain their normal physiological and biochemical functions. Typically, a physiologically compatible buffer will include a buffering agent (e.g., TRIS, MES, PO4, HEPES, etc.), a chelating agent (e.g., EDTA, EGTA, or the like), a salt (e.g., NaCl, KCl, MgCl2, CaCl2, NaOAc, KOAc, Mg(OAc)2, etc.) and optionally a stabilizing agent (e.g., sucrose, glycerine, Tween20, etc.).

The polymerases referred to throughout this description have the following structures and properties: (1) Taq refers to the wild-type, full-length DNA Polymerase from Thermus aquaticus (GenBank Accession No. J04639) and also used for chemically modified variants thereof, such as AmpliTaq Gold®; (2) Klentaq-235 refers to an N-terminal deletion of the first 235 amino acids of Taq. Klentaq-235 is also known in commerce as DeltaTaq, ATaq, Klentaq, and Klentaq5; (3) Klentaq-278 refers to an N-terminal deletion of the first 278 amino acids of Taq (Klentaq-278 is also referred to as “Klentaq1” or “KT-1” or wild-type Klentaq1) and is described in claims 1-5 of U.S. Pat. No. 5,436,149; (4) Klentaq6 (abbreviated as KT-6) refers to Klentaq-278 with two amino-acid changes; (5) Klentaq7 (abbreviated as KT-7) refers to Klentaq-278 with three amino-acid changes; (6) Klentaq10 (abbreviated as KT-10) refers to Klentaq-278 with three amino acid changes; Klentaq11 (abbreviated as KT-11) refers to Klentaq-278 with four amino acid changes; Klentaq12 (abbreviated as KT-12) refers to Klentaq-278 with four amino acid changes; FL-10 refers to full-length Taq polypeptide with three amino acid changes; and FL-12 refers to full-length Taq polypeptide with four amino acid changes. These codon changes of the relevant Taq polymerase mutants are summarized in abbreviated form in Table I.

TABLE I
Codon changes in Taq DNA polymerase mutants
SEQ Amino
ID DNA Change2 Codon Acid
NO:1 Moniker <WT>nuc<MUT> Change(s) Change(s)2 Phenotype3
3 KT-6 A2119C; ATT to I707L; CS
4 (1285) CTT; (429) BR
A2123T; GAG to E708V
(1289) GTG (430)
5 KT-7 G1876A; GAG to E626K; CS
6 (1042) AAG; (348) CS
A2119C; ATT to I707L; BR*,
(1285) CTT; (429) FAST*
G2122T/A2123G GAG to E708W
(1288) (1289) TGG (430)
19 KT-10 G1876A; GAG to E626K; CS
20 (1042) AAG; (348) CS
A2119C; ATT to I707L; BR
(1285) CTT; (429)
G2122A GAG to E708K
(1288) AAG (430)
21 KT-11 G1876A; GAG to E626K; CS
22 (1042) AAG; (348) FAST
G1945A; GTC to V649I; CS
(1111) ATC; (371); FAST
A2119C; ATT to I707L;
(1285) CTT; (429)
G2122A/A2123C GAG to E708S
(1288) (1289) TCG (430)
23 KT-12 T1826C; CTG to L609P; BR*,
24 (992) CCG; (331) FAST*
G1876A; GAG to E626K; CS
(1042) AAG; (348) CS
A2119C; ATT to I707L; BR*,
(1285) CTT; (429) FAST*
G2122T/A2123T GAG to E708L
(1288) (1289) TTG (430)
27 FL-10 G1876A; GAG to E626K; CS
28 A2119C; AAG; I707L; CS
G2122A ATT to E708K BR
CTT;
GAG to
AAG
29  FL-12 T1826C; CTG to L609P; BR*,
30 G1876A; CCG; E626K; FAST*
A2119C; GAG to I707L; CS
G2122T/A2123T AAG; E708L CS
ATT to BR*,
CTT; FAST*
GAG to
TTG
1Odd- and even-numbered SEQ ID NOs refer to nucleic acid and polypeptide sequences, respectively, as illustrated in the Sequence Listing.
2Wild-type (“WT”) base of top (codon) strand on the left, mutant (“MUT”) base on the right, of numerical positions of changes (“nuc”) which numbers are in reference to the full-length Taq DNA polymerase encoding nucleic acid and polypeptide (herein SEQ ID NOs: 25 & 26, respectively; disclosed in GenBank Acc. No. J04639); parenthetical numbers refer to the corresponding Klentaq-278 sequence positions (herein SEQ ID NOs: 1 & 2, respectively; disclosed in U.S. Pat. No. 5,436,149).
3Phenotype that was conferred when this mutation was added to its parent; CS, cold sensitive; BR, blood-resistant; FAST, fast DNA extension.
*In the cases of KT-7, KT-12, and its respective FL-version, both BR and FAST phenotypes are present, presuming a possible double effect of these changes. Testing each mutation individually will clarify the linkage between the phenotypes.

The suffix “LA” means “Long and Accurate” and refers to a mixture of thermostable DNA polymerases, after claims 6-16 of U.S. Pat. No. 5,436,149 and Barnes (1994). Major component is usually Taq or Klentaq1. A minor component is usually an archaebacterial DNA polymerase such as Pfu polymerase, Pwu polymerase, Vent polymerase, or Deep Vent polymerase.

KlentagLA is a mixture of 47:1::Klentaq1:Deep Vent by volume of commercially available enzymes. This mixture also may be modified to 24:1 as noted in the text. Since commercially distributed Klentaq1 is about 15-20 times more concentrated than commercially distributed Deep Vent, the true ratio, by units or protein, is approximately 15-20 times higher, i.e., 705:1 or 360:1

TaqLA is a mixture of 47:1::Taq:Deep Vent, or 16:1::Taq:Pfu, or an unspecified mixture of Taq:Pfu that is commercially known as “TaqPlus.”

Control sequences are DNA sequences that enable the expression of an operably-linked coding sequence in a particular host organism. Prokaryotic control sequences include promoters, operator sequences, and ribosome binding sites. Eukaryotic cells utilize promoters, polyadenylation signals, and enhancers.

The phrase “a reaction vessel” refers to any container that may be used for performing a biological, biochemical, or chemical reaction. In the context of PCR assays, a reaction vessel is any suitable container that can withstand the temperatures carried out during a typical DNA amplification reaction. Preferably, a reaction vessel that used for PCR assays includes a tube fitted with a closure, wherein both the tube and the closure are made of polymeric material such as polypropylene or similar material commonly employed in the art.

The phrase “isolated nucleic acid molecule” is purified from the setting in which it is found in nature and is separated from at least one contaminant nucleic acid molecule.

The phrase “isolated polypeptide molecule” is purified from the setting in which it is found in nature and is separated from at least one contaminant polypeptide molecule.

The phrase “purified polypeptide” refers to a polypeptide molecule that has been purified to greater than 80% homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or silver stain. Isolated polypeptides include those expressed heterologously in genetically engineered cells or expressed in vitro. Ordinarily, isolated polypeptides are prepared by at least one purification step.

DETAILED DESCRIPTION OF THE INVENTION

The present invention makes use of the discovery that Taq polymerases bearing certain N-terminal deletions are unusually resistant to whole blood, making them ideally suited for use in analytical PCR assays of nucleic acid targets from human blood. Furthermore, mutant(s) of full-length Taq DNA polymerase with even higher resistance to blood inhibitors have been developed that remain fully functional in the presence of at least about 20-25% blood or the equivalent of blood fractions. This level of blood tolerance exceeds that of the existing thermostable DNA polymerases (and even exceeds the amount of blood that can be practically or conveniently handled in the PCR analysis due to physical clumping). Moreover, mutants that display a high resistance to blood inhibitors have been identified that possess faster elongation rates. The use of these novel enzymes is expected to simplify and accelerate the performance of clinical and forensic tests as well as render such tests more sensitive and economical. Finally, the present invention provides methods for enhancing DNA amplification specificity using these polymerases with samples from whole blood. These Taq polymerase mutants and methods for their use are described below.

Identification of Klentaq mutants that are highly resistant to blood inhibition.

Klentaq1 polymerase (SEQ ID NO: 1 (nucleic acid) and SEQ ID NO:2 (polypeptide)) is an improved and more robust version of the Taq polymerase that bears an N-terminal deletion of 278 amino acids from the full-length (832 amino acids) enzyme. Klentaq1 displays higher fidelity and greater thermostability than Taq. Klentaq1 is also inhibited to a lesser extent than Taq when the polymerase is used in PCR assays carried out in the presence of blood products. For example, the purified Klentaq1 enzyme easily amplifies a nucleic acid target in the presence of about 5% whole blood in reaction mixture (vol/vol). This was a highly unexpected result, as the full-length Taq enzyme is completely inhibited in a blood concentration range of about 0.004% to about 0.2% whole blood in the reaction mixture (vol/vol). No correlation between the N-terminal deletion of Taq, which generates Klentaq1, and the blood resistance feature of the enzyme has been reported.

Several mutant Klentaq clones were analyzed by PCR assays for their ability to tolerate whole blood. About 40 mutagenized, yet PCR-functional Klentaq clones were constructed and tested in PCR assay mixtures containing about 10% whole human blood (vol/vol). These 40 clones are cold sensitive or are mutants of clones whose enzyme product exhibited the cold sensitive phenotype. The cold sensitivity of the additional mutant clones has not yet been determined Remarkably, two mutants of this small collection, KT-6 (SEQ ID NO: 3 (nucleic acid); SEQ ID NO: 4 (polypeptide)) and KT-7 (SEQ ID: 5 (nucleic acid); SEQ ID NO:6 (polypeptide)), clearly outperformed the rest of the clones and the wild-type Klentaq1 protein under these conditions (FIG. 1).

These results were confirmed by performing PCR assays in the presence of increasing amounts of whole blood. As shown in FIG. 2A, clones KT-6 and KT-7 remained functionally active in the presence of whole blood, being able to amplify an endogenous gene target directly from blood cells present in reactions containing about 15% whole human blood (vol/vol) without any DNA purification step. The presence of as little as 1% whole blood (vol/vol) in PCR assays was inhibitory for Taq (Roche) (see Example 4). Two additional mutant forms of Klentaq-278, clones KT-10 (SEQ ID NO:19 (nucleic acid) and SEQ ID NO:20 (polypeptide)) and KT-12 (SEQ ID NO:23 (nucleic acid) and SEQ ID NO:24 (polypeptide)) also displayed the ability to amplify endogenous gene targets from whole blood samples (FIGS. 2B and 2C).

The foregoing results reveal that whole blood may be used directly in screening assays to identify mutants of Klentaq-278 that are even more resistant to blood. The present invention is drawn in part to mutant forms of the Klentaq-278 DNA polymerase that display activity in PCR assays containing from about 5% whole blood to about 25% whole blood in the reaction mixture (vol/vol). More preferably, the invention is drawn to mutant forms of the Klentaq DNA polymerase that display amplification activity in PCR assays containing from about 5% whole blood to about 20% whole blood in the reaction mixture (vol/vol), including 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, and 19% whole blood in the reaction mixture (vol/vol).

Derivation of full-length Taq mutants that are highly resistant to blood inhibition.

Because the mutant forms of Klentaq-278 were more robust polymerases in whole blood PCR assays than Klentaq-278, we considered it likely that the additional amino acid changes within the structure of this truncated Taq polypeptide might confer similar blood-resistant activities when incorporated into the full-length Taq enzyme. To test this hypothesis, the region of the KT-10 gene (SEQ ID NO:19) that contains the relevant codon substitutions was re-introduced into the background of a wild-type full-length Taq (SEQ ID NO: 25 (nucleic acid) and SEQ ID NO:26 (polypeptide)) using standard recombinant DNA methods to yield the resultant mutant Taq gene, termed FL-10 (SEQ ID NO:27 (nucleic acid) and SEQ ID NO:28 (polypeptide)). The resultant polypeptide was expressed and tested in conjunction with other commercially available Taq polymerases in homogenous PCR assay solutions containing varying amounts of whole blood (0%, 10%, or 20% (vol/vol)). As is shown in FIG. 3A, FL-10 displays remarkably robust, blood-resistant, DNA amplification activity in comparison with JumpStart™ Taq, AmpliTaq Gold®, or Ex Taq™.

Similar to that found for FL-10, another mutant form of full-length Taq DNA polymerase was identified that displayed high blood-resistant DNA amplification activity. This mutant was derived by cloning the region of the KT-12 (SEQ ID NO:23) that contains the relevant codon substitutions that impart blood-resistant DNA amplification activity to the KT-12 polymerase (SEQ ID NO:24) into the background of the wild-type full-length Taq (SEQ ID NO:25) using standard recombinant DNA methods to yield the resultant mutant Taq polymerase, termed FL-12 (SEQ ID NO:29 (nucleic acid) and SEQ ID NO:30 (polypeptide)). This full-length Taq polymerase mutant displayed blood-resistant DNA amplification activity that mirrors the activity observed for the KT-12 polymerase mutant (SEQ ID NO:24) (FIG. 3B). These findings provide evidence that the region of any Klentaq-278 mutant that encodes blood-resistant DNA amplification activity will impart similar properties to the full-length Taq DNA polymerase when re-introduced into the context of the wild-type gene background.

Although both FL-10 and FL-12 Taq polymerases displayed high blood-resistant DNA amplification activity, only the FL-12 Taq polymerase displays both faster-elongating activity and high blood-resistant activity. Because these two properties are discrete attributes, we tested whether faster-elongating activity correlated with high blood-resistant activity. As described herein, Z-TAQ™ (Takara) is a proprietary form of the full-length Taq DNA polymerase that displays 5-fold faster elongation rates relative to Taq DNA polymerase. The nature of the alteration of Z-TAQ™ that is responsible for its enhanced elongation activity is unknown in the art, owing to the fact that the manufacturer of the enzyme regards Z-TAQ™ as a proprietary product. For this experiment, FL-12 Taq and Z-TAQ™ were evaluated for their respective blood-resistant DNA amplification activities. As shown in FIG. 3B, both FL-12 and Z-TAQ™ displayed blood-resistant DNA amplification activity in homogeneous PCR assay solutions, albeit the FL-12 enzyme was more robust than Z-TAQ™ in reactions containing significant amounts of whole blood (20% (vol/vol)).

One functional characteristic that distinguishes the aforementioned FL mutants (i.e., FL-10 and FL-12) from Z-TAQ™ is that the FL mutants display a cold sensitive phenotype whereas Z-TAQ™ does not. One additional functional attribute that distinguishes the aforementioned FL mutants from Z-TAQ™ is that the FL mutants are capable of carrying out DNA amplifications under hot start conditions whereas the Z-TAQ™ polymerase lacks this capability. Thus, whatever chemical or genetic attribute that endows Z-TAQ™ with its unusually high activity in whole blood PCR assays, it is not the identical modifications that render the FL mutants blood-resistant. For the purposes of this disclosure, blood-resistant DNA polymerases are defined to have three attributes: (1) display a cold sensitive phenotype in PCR assays relative to the wild-type Taq DNA polymerase; (2) display DNA amplification activity under hot start PCR conditions; and (3) display DNA amplification activity in PCR assays containing whole blood in the range from about 3% to about 25% (vol/vol).

The foregoing results reveal that whole blood may be used directly in screening assays to identify mutants of Klentaq-278 that are even more resistant to blood and that the methods are readily extendable to identifying mutants of full-length Taq that display blood-resistant DNA amplification activity. The present invention is drawn in part to mutant forms of the full-length Taq DNA polymerase that display activity in PCR assays containing from about 5% whole blood to about 25% whole blood in the reaction mixture (vol/vol). More preferably, the invention is drawn to mutant forms of the full-length Taq DNA polymerase that display amplification activity in PCR assays containing from about 5% whole blood to about 20% whole blood in the reaction mixture (vol/vol), including 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, and 19% whole blood in the reaction mixture (vol/vol).

The presently preferred procedure for identifying blood-resistant Taq DNA polymerases is to perform two screening operations on a collection of mutants: (1) identifying those mutants that display a cold sensitive phenotype in modified PCR assays; followed by (2) characterizing the subset of cold sensitive Taq DNA polymerase mutants for DNA amplification activity in whole blood PCR assays. Even more preferably, one may initially identify blood-resistant polymerases using an adaptation of a selection procedure termed compartmentalized self-replication (25, 26) for obtaining DNA polymerase mutants with a predetermined activity. As illustrated in the Prophetic Example, one would initially select the Taq DNA polymerase mutant for its blood-resistant activity, followed secondarily by a screening procedure to characterize its cold sensitive phenotype (e.g., DNA amplification activity under hot start PCR conditions). All mutants that are blood-resistant and display a cold sensitive phenotype would comprise members of the group of blood-resistant polymerases as defined herein.

Identification of Klentaq and Taq Mutants with Faster DNA Elongation Rates

“Rapid” thermostable DNA polymerase mutants have been discovered that display a faster DNA elongation rate than found for the wild-type Klentaq-278 polymerase. By lowering the DNA extension times during PCR, certain PCR conditions have been determined where the elongation step in the cycle becomes limiting for successful amplification by the wild-type Klentaq-278 enzyme. In the case of using the Klentaq-278 gene as a target (1.65 kb long), the minimum extension time required was about 1 minute. For example, the Klentaq-278 polymerase did not possess amplification activity in PCR assays performed under conditions that employ extension times of 50 seconds. Similar results were obtained with Taq enzyme.

About 40 functional mutant Klentaq clones were evaluated as a function of elongation rate. A 30 sec extension time was initially employed in the PCR assays, which reflect conditions that were found ineffective for the wild-type Klentaq and AmpliTaq Gold®. Interestingly, the mutants KT-6 (SEQ ID NO:4) and KT-7 (SEQ ID NO:6) were able to efficiently amplify the target with this shorter extension time (FIG. 4). This feature of the two mutant enzymes was confirmed in further tests, wherein one of them (clone KT-7 (SEQ ID NO:6)) yielded amplification products with a 20 sec extension time (FIG. 4A). This enzyme feature was characterized further and yielded good amplification products even with 15 and 12 sec extension times (FIG. 4B). Remarkably, the selected mutant completely outperformed the Z-TAQ™ (Takara) at these low extension times (FIG. 4B, central and lower panels). Similar results were obtained with two additional mutant forms of Klentaq-278, clone KT-11 (SEQ ID NO:21 (nucleic acid) and SEQ ID NO:22 (polypeptide)) and clone KT-12 (SEQ ID NO:23 (nucleic acid) and SEQ ID NO:24 (polypeptide)) (FIG. 4C). This is noteworthy because Z-TAQ™, a proprietary Taq enzyme, is one of the fastest DNA elongating PCR enzymes that is commercially available.

Because some of the mutant forms of Klentaq-278 were faster-elongating polymerases than observed for Klentaq-278, we considered it likely that the additional amino acid changes within the structure of this truncated polypeptide might confer similar faster elongating activities when incorporated into the full-length Taq enzyme. To test this hypothesis, the region of KT-12 gene (SEQ ID NO:23) that contains the relevant codon substitutions was re-introduced into the background of a wild-type full-length Taq (SEQ ID NO:25 (nucleic acid) and SEQ ID NO:26 (polypeptide)) using standard recombinant DNA methods to yield the resultant mutant Taq gene, termed FL-12 (SEQ ID NO:29 (nucleic acid) and SEQ ID NO:30 (polypeptide)). The resultant polypeptide was expressed and tested in conjunction with other commercially available Taq polymerases in homogenous PCR assay solutions using PCR conditions wherein the extension time was reduced to 30 sec. As is shown in FIG. 4C, FL-12 displays remarkably robust, faster-elongating, DNA amplification activity in comparison to Z-TAQ™.

These results demonstrate that the elongation speed of the Klentaq DNA polymerase and the full-length Taq DNA polymerase can be improved by mutagenesis. The present invention is drawn in part to mutant forms of the Klentaq and full-length Taq DNA polymerases that display increased elongation rate in PCR assays under conditions where the respective enzymes fail to display successful amplification activity. Preferably, the invention is drawn to mutant forms of the Klentaq-278 and full-length Taq DNA polymerases that display amplification activity in PCR assays under conditions where the elongation step is time-limiting for the reaction with the wild-type Klentaq-278 polymerase. Even more preferably, the invention is drawn to mutant forms of Klentaq-278 and full-length Taq DNA polymerases that display amplification activity under PCR conditions disclosed herein and having extension times in the range from about 12 sec to about 50 sec, including 15 sec, 18 sec, 20 sec, 22 sec, 24 sec, 25 sec, 26 sec, 28 sec, 30 sec, 32 sec, 34 sec, 36 sec, 38 sec, 40 sec, 42 sec, 44 sec, 45 sec, 46 sec, and 48 sec.

Heavy Hot Start PCR Procedures and Applications to Whole Blood PCR

The new protocol described here uses no wax or antibodies, and requires no manipulations once the thermal cycling program has commenced. This protocol uses two aqueous layers at the time of setup of the PCR assay. The lower layer, which represents about 1/10 to about ¼ of the final volume, includes the dNTPs and magnesium(II) that is required for the reaction. The upper layer contains the polymerase enzyme, the primers, and the nucleic acid target. Both layers contain equivalent concentrations of other buffer components at the concentrations required for amplification. The lower layer also contains a constituent to make it heavy, such as about 10-20% (wt/vol) sucrose, sorbitol or DMSO (or a suitable combination of similar reagents compatible with PCR up to about 10-20% (wt/vol)).

Optionally, other components that impart greater density to the lower layer may substitute for or supplement the items described above. For instance, Baskaran and co-workers have demonstrated that 1.4 M betaine, 5% DMSO is good for PCR assays involving nucleic acid targets possessing high GC content (36). These results suggest that inclusion of 2.8 M betaine, 10% DMSO is feasible as the heavy start component of the lower layer containing the MgCl2 and the dNTPs. Optionally and routinely, color in the form of 0.05% cresol red is also included in the lower, heavy layer.

In reactions that include whole blood, the addition of components that impart greater density to the lower layer and a color agent are not required. These features are superfluous because whole blood imparts a density to the lower layer that approximates that of the aforementioned heavy layer components and because the hemoglobin of blood provides color. In reactions containing whole blood, the template is included in the heavy layer, and all other components of the reaction are in the upper layer. The range of volumes appropriate to the use of whole blood in the heavy layer comprises 1% to 25%.

Some adverse components of blood attack various components of the PCR reaction, such as the enzyme or the primers, yet the adverse components may be heat labile. Thus, the addition of the blood carefully as an unmixed underlay allows it to be added without significant contact with the putatively sensitive PCR reaction components. Upon heating to normal PCR thermal cycling temperatures of 90-95° C., many of the blood components appeared denatured and aggregated in place, were visible as brown after the cycling, and either did not mix with the PCR components before being inactivated by the heat, or never did mix appreciably with the PCR reaction components. Nevertheless, the genomic DNA template, and presumably other target templates such as viral and other microbial genomes, become timely available to the amplification reaction by convective mixing.

This principal of segregating heat labile inhibitors during reaction setup may have application to other situations of complex or environmental samples that do not involve blood.

The order of addition of the DNA polymerase cocktail and the whole blood sample to the PCR reaction vessel is not the critical aspect to the heavy hot start PCR procedure. Rather, the important aspect to the set-up of the heavy hot start PCR reaction is the careful addition of the DNA polymerase cocktail and the lower, heavier solution (e.g., a whole blood sample) to the PCR reaction vessel so as to avoid as little mixing of the individual layers of solutions as possible before thermal cycling begins. Thus, the lower, heavier solution can be initially added to the PCR reaction vessel, followed by the careful addition of the DNA polymerase cocktail as an overlayer. More preferably, however, the DNA polymerase cocktail is initially added to the PCR reaction vessel, followed by the careful addition of the lower, heavy solution to the PCR reaction vessel as an underlayer.

In the preferred embodiment, mixing of the layers occurs by diffusion and/or convection after the thermal cycler has warmed and cooled the reaction to begin the PCR process. Layered reaction tubes containing whole blood that are experimentally premixed by vortex treatment are variably unable to support PCR amplification activity, depending on the resistance of the reaction components, and the most sensitive component was discovered to be the DNA polymerase enzyme (FIG. 5A). FIG. 5B illustrates an example of PCR assay tubes that contain discrete layers prior to reaction and the mixing of the layers during reaction.

It is well understood to one of ordinary skill in the art that the combinations of components in the separate layers may be formulated in a variety of permutations. The only criteria that must be met in the present invention is that the polymerase is separated from at least one component essential to the amplification reaction (e.g., the primers, and/or the template, and/or Mg2+), that the lower layer contains a component that imparts greater density to the solution, and that the mixing of the two layers results in reconstitution of the PCR assay conditions to permit amplification activity.

Because the inclusion of heavy reagents, such as sucrose, sorbitol or DMSO will decrease slightly the melting temperature of the nucleic acid target, the denaturation step of the PCR cycle may have to be reduced by about 1-2° C. to compensate for this effect.

Mutant forms of Taq DNA polymerase include full-length Taq DNA polymerases that contain at least one amino acid change relative to the wild-type polypeptide (SEQ ID NO:26) encoded by the nucleic acid (SEQ ID NO:25) that are illustrated in the Sequence Listing. Examples of such mutant forms of Taq DNA polymerase include FL-10 (SEQ ID NO:28) and FL-12 (SEQ ID NO:30). Additional mutant forms of Taq DNA polymerase used in the invention include truncation mutants, such as Klentaq-278 that comprises the amino acid sequence (SEQ ID NO:2) encoded by the nucleic acid (SEQ ID NO:1) whose sequences are illustrated in the Sequence Listing, or other codons that encode those amino acids, or those amino acids with a few extra codons on the amino terminus thereof. The invention also uses a mutant or variant gene encoding full-length Taq or Klentaq-278, any of whose bases may be changed from the corresponding base shown in Tables 1-6 and 8-19 while still encoding a protein that maintains the activities and physiological functions of full-length Taq or of Klentaq-278, or a slightly longer or shorter version of Klentaq-278 at the N-terminus. Further included are nucleic acids whose sequences are complementary to those just described, including complementary nucleic acid fragments. Additionally, nucleic acids or nucleic acid fragments, or complements thereto, whose structures include chemical modifications, are also included. Such modifications include, by way of nonlimiting example, modified bases, and nucleic acids whose sugar phosphate backbones are modified or derivatized. In the mutant or variant nucleic acids, and their complements, up to 20% or more of the bases may be so changed.

The invention also includes the use of polypeptides and nucleotides having 80-100% sequence identity to SEQ ID NOs:1-6 and 19-30, including 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, and 99% sequence identity to SEQ ID NOs:1-6 and 19-30, as well as nucleotides encoding any of these polypeptides, and complements of any of these nucleotides. In the case of Klentaq1 (SEQ ID NO:1), the invention includes mutant forms that contain at least one codon change in the open reading frame of Klentaq1 (SEQ ID NO:2). In the case of Taq DNA polymerase (SEQ ID NO:25), the invention includes mutant forms that contain at least one codon change in the open reading frame of Taq DNA polymerase (SEQ ID NO:26).

Percentage Sequence Identity

“Percent (%) nucleic acid sequence identity” with respect to Klentaq-278—encoding nucleic acid sequences identified herein is defined as the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in the Klentaq-278 sequence of interest, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining % nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared. The same methods and principles apply to ascertain “percent (%) nucleic sequence identity with respect to Taq DNA polymerase-encoding nucleic acid sequences in a candidate nucleic acid sequence when the two sequences are aligned.

When nucleotide sequences are aligned, the percent (%) nucleic acid sequence identity of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D (which can alternatively be phrased as a given nucleic acid sequence C that has or comprises a certain % nucleic acid sequence identity to, with, or against a given nucleic acid sequence D) can be calculated as follows:

% nucleic acid sequence identity=W/Z*100

where

W is the number of nucleotides scored as identical matches by the sequence alignment program's or algorithm's alignment of C and D

and

Z is the total number of nucleotides in D.

When the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, the % nucleic acid sequence identity of C to D will not equal the % nucleic acid sequence identity of D to C.

“Percent (%) amino acid sequence identity” is defined as the percentage of amino acid residues that are identical with amino acid residues in the disclosed Klentaq-278 DNA polymerase polypeptide sequences in a candidate sequence when the two sequences are aligned. To determine % amino acid identity, sequences are aligned and if necessary, gaps are introduced to achieve the maximum % sequence identity; conservative substitutions are not considered as part of the sequence identity. Amino acid sequence alignment procedures to determine percent identity are well known to those of skill in the art. Often publicly available computer software such as BLAST, BLAST2, ALIGN2 or Megalign (DNASTAR) software is used to align peptide sequences. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared. The same methods and principles apply to ascertain “percent (%) amino acid sequence identity with respect to Taq DNA polymerase-encoding polypeptide sequences in candidate sequences when the two sequences are aligned.

When amino acid sequences are aligned, the % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B (which can alternatively be phrased as a given amino acid sequence A that has or comprises a certain % amino acid sequence identity to, with, or against a given amino acid sequence B) can be calculated as:

% amino acid sequence identity=X/Y*100

where

X is the number of amino acid residues scored as identical matches by the sequence alignment program's or algorithm's alignment of A and B; and

Y is the total number of amino acid residues in B.

If the length of amino acid sequence A is not equal to the length of amino acid sequence B, the % amino acid sequence identity of A to B will not equal the % amino acid sequence identity of B to A.

A nucleic acid molecule used in the invention, e.g., a nucleic acid molecule having the nucleotide sequence of SEQ ID NOs:1, 3, 5, 19, 21, 23, 25, 27, or 29 or a complement of this aforementioned nucleotide sequence, can be isolated using standard molecular biology techniques and the provided sequence information. Using all or a portion of the nucleic acid sequence of SEQ ID NOs:1, 3, 5, 19, 21, 23, 25, 27, or 29 as a hybridization probe, Klentaq-278 or Taq gene molecules can be isolated using standard hybridization and cloning techniques (29, 30).

PCR amplification techniques can be used to amplify Klentaq-278 or Taq encoding DNA using Thermus aquaticus genomic DNA as a template and appropriate oligonucleotide primers. Furthermore, oligonucleotides corresponding to Klentaq-278 or Taq gene sequences can be prepared by standard synthetic techniques, e.g., an automated DNA synthesizer.

Klentaq-278 is the subject of U.S. Pat. No. 5,436,149 (31), which is incorporated herein by reference.

Klentaq-235 is the subject of U.S. Pat. No. 5,616,494 (32), which is incorporated herein by reference.

Medical Applications

The applications of the present invention include diagnostic evaluations of whole blood samples for the presence and status of genetic disorders (e.g., cancer, blood disorders, diabetes, etc.) and diseases caused by blood borne microbial agents (e.g., viruses, bacteria, fungi, etc.); tissue-typing using polymorphisms, and forensic research. One of ordinary skill would recognize the utilities of blood-resistant polymerases and high elongating polymerases of the present invention toward advancing the application of PCR to whole blood samples directed to these objectives.

Kits

The present invention also contemplates kits that may be employed in the clinical setting or in the field for permitting a simplified set of reagents for rapid PCR analysis of whole blood samples using the blood-resistant polymerases and high elongating polymerases of the present invention. Kits would typically include suitable oligonucleotide primers, PCR reaction buffer components, control solutions, and a suitable DNA polymerase, as well as instructions for the kit's use. Preferred DNA polymerases include the disclosed blood-resistant polymerases as defined herein (e.g., KT mutants that are blood-resistant and display a cold sensitive phenotype) as well as the Z-TAQ™ enzyme and the KT-1 enzyme (each of which displayed moderate blood resistance, but not cold sensitive).

Having described the invention in detail, it will be apparent that modifications, variations, and equivalent embodiments are possible without departing the scope of the invention defined in the appended claims. Furthermore, it should be appreciated that all examples in the present disclosure are provided as non-limiting examples.

EXAMPLES

The following non-limiting examples are provided to further illustrate the present invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent approaches the inventors have found function well in the practice of the invention, and thus can be considered to constitute examples of modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

Example 1

Screening of Mutagenized Klentaq Clones for Blood-Resistant Mutant Enzyme Activity

In order to functionally characterize new mutants, it is desirable to produce highly-purified enzyme from expression systems. The procedure, which included PEI treatment, BioRex-70 chromatography, and Heparin-Agarose chromatography, yielded DNA-free and nuclease-free Klentaq enzyme purified to homogeneity, as judged by a single band in Coomassie stained protein gel (23). The same purification procedure also worked very well for purification of cold sensitive Klentaq mutants (23). This procedure was readily adaptable to accommodate purification of mutant polymerases that display unusual features such as changed affinity and elution profile on a particular chromatography resin. The efficiency of each step in the purification scheme was monitored easily by a standard DNA incorporation assay.

The amplification activity of the obtained mutant enzymes were extensively evaluated in PCR amplification of various gene targets. The new enzymes were tested both in conventional and real-time PCR with SYBR green fluorescent detection. These tests included at least about 20% whole human blood (untreated, EDTA-treated, or heparinized), or blood IgG and hemoglobin fractions equivalent. Optionally, the differential sensitivities that the polymerase mutants display toward whole blood were evaluated by performing an amplification activity titration experiment with increasing incremental amounts of whole blood added to the assay mixtures from about 5% whole blood (vol/vol) to about 25% whole blood (vol/vol).

FIG. 1 illustrates the results of screening of a collection of 40 KT mutants by PCR assay with homogeneous PCR assay solutions containing 10% whole blood (vol/vol), wherein the Klentaq gene represented the target nucleic acid. The primers used in the PCR assays comprise KT1 (SEQ ID NO:11) and RevTaqH (SEQ ID NO:12), which resulted in the specific amplification of a 1.65 kbp target fragment.

FIG. 2A illustrates the results of typical PCR assays with homogeneous PCR assay solutions containing different amounts of whole blood (vol/vol) in the reaction, wherein an endogenous human gene from blood represents the target nucleic acid. The primers used in the PCR assays comprise DMDex21 f (SEQ ID NO:13) and DMDex21r (SEQ ID NO:14), which resulted in the specific amplification of a 0.32 kbp target fragment of the endogenous human Duchenne muscular dystrophy gene (Dystrophin).

In order to confirm the blood resistance feature of the Klentaq mutant enzymes, numerous exogenous and endogenous test gene targets were used. Two to three ng plasmid pWB254 DNA or human DNA were used as exogenous targets to amplify the Klentaq gene itself (1.65 kb fragment, which was obtained with primers KT1 (SEQ ID NO:11) and RevTaqH (SEQ ID NO:12)) or a 4.3 kb fragment of the human TPA gene (obtained with primers TPA forward (SEQ ID NO:17) and TPA reverse (SEQ ID NO:18)), respectively. The endogenous targets (from DNA present in the blood cells) included a 0.32 kb amplicon of the human Dystrophin gene (obtained with primers DMDex21f (SEQ ID NO:13) and DMDex21r (SEQ ID NO:14) and 1.1 kb or 2.5 kb amplicons of the human CCR5 gene (obtained with primer pairs ccr5+1 kb (SEQ ID NO:9)/CCR5-KOZ (SEQ ID NO:7) and CCR5−2 kb (SEQ ID NO:8)/ccr5deltaRT (SEQ ID NO:10), respectively). Whole or EDTA-treated (4.8 mM EDTA) human blood was added at concentrations 0%-20% to the PCR cocktail prior to PCR (homogeneous PCR setup). As illustrated in FIGS. 2B and 2C, KT-10 and KT-12 mutants easily amplified the targets in at least 20% whole blood. The wild-type Taq enzyme failed under comparable conditions. The amplification signal obtained with the mutants when detecting endogenous blood genes was gene-dose—responsive.

Example 2

Full-Length Taq DNA Polymerase Mutants Display Blood-Resistant Activity

Importantly, the amino acid changes responsible for the blood-resistant phenotype of the Klentaq, were also sufficient to render the full-length Taq blood-resistant when these amino acid changes were incorporated into the full-length gene. For example, the amino acid changes of KT-10 and KT-12 mutants were incorporated into the full-length Taq gene to generate the analogous Taq-mutants FL-10 and FL-12. As shown in FIG. 3A (for FL-10) and FIG. 3B (for FL-12), both full-length Taq mutants exhibited very high resistance to blood inhibition, and successfully amplified the endogenous human Dystrophin and CCR5 genes in homogeneous PCR solutions containing 20% blood. The observed high blood resistance of these mutants reflects dramatic change in the property of the Taq enzyme, considering the fact that the wild-type Taq is typically inactivated in homogeneous PCR assay solutions containing as little as 0.1-0.5% whole blood. Various commercial Taq enzymes, including AmpliTaq Gold®, JumpStart™ Taq, and Ex Taq™ failed to detect endogenous blood genes even at the lowest blood concentrations tested. One surprising exception was the enzyme Z-TAQ™, which showed a significant blood resistance at 5% and 10% blood; however, the FL-12 polymerase mutant outperformed Z-TAQ™ when used in homogeneous PCR assay solutions containing 20% blood to amplify a 1.1 kbp fragment of the endogenous CCR5 gene with primers ccr5+1 kb (SEQ ID NO:9) and CCR5-KOZ (SEQ ID NO:7)) (FIG. 3B). The molecular change in the Z-TAQ™ enzyme responsible for its blood-resistant property is unknown, as the manufacturer (Takara) maintains its composition as a proprietary secret.

Example 3

Mutagenized Klentaq Mutants with a Faster DNA Elongation Rate

The screening factor here is to simply shorten the DNA extension step of the PCR cycle beyond the point where the wild-type or prior art enzyme stops working. In the case when wild-type Klentaq amplified its own gene, the amplification efficiency was significantly lower at 60 seconds extension step (FIG. 4A, lane 1 at 1 min). Additional tests with discrete extension times showed that the Klentaq polymerase did not display amplification activity in PCR assays performed under conditions that employ an extension time of about 50 sec or less (e.g., see FIG. 4A, lane 1 at 30 sec and 20 sec). On the other hand, mutant Klentaq clone KT-7 displayed amplification activity with the same target in PCR assays under conditions having an extension step of as little as about 12 sec. (FIG. 4B, lower panel). For the evaluation of fast-elongating mutants, extension times in the PCR cycle not exceeding 20 sec per 2 kb amplicon were used. The KT mutants, KT-7 (SEQ ID NO:6), KT-11 (SEQ ID NO:21), and KT-12 (SEQ ID NO:24) were markedly faster elongating polymerases than KT-1 (SEQ ID NO:2), whereas the full-length Taq mutant, FL-12 (SEQ ID NO:30), displayed increased elongation activity relative to Z-TAQ™ (FIG. 4C). For these experiments, the PCR assays were conducted using homogeneous PCR assay solutions with KT1 (SEQ ID NO:11) and RevTaqH (SEQ ID NO:12), which resulted in the specific amplification of a 1.65 kbp target fragment from the Klentaq1 gene.

Example 4

L Hot Start Achieved by Underlay of Heavy Liquid Component can Enhance Yield of Specific Amplification Products—“Heavy Hot Start” Amplification

This amplification procedure permits one to obtain an enhanced specificity and reliability from a PCR assay. The strategy is also amenable to PCR assays involving whole blood, as described below. In two preferred embodiments, two heavy hot start mixes are disclosed that differ mainly in the amounts of Mg2+ and dNTPs present in the reaction mixture, since the optimum Mg and dNTP concentrations for Klentag1 and KlentagLA is higher than for Taq and TagLA. These heavy hot start mixes can be stored for at least a month at 4° C.

10×TCA is 500 mM Tris-HCl pH 9.2, 160 mM ammonium sulfate. When the pH of the Tris-HCl stock was adjusted to pH 9.2, the pH of the aliquots was measured at a buffer concentration of 50 mM in water at room temperature. The concentration of the 1 M MgCl2 stock was confirmed by determining the refractive index of the solution using a refractometer and by reference to Refractive Index-Concentration Data in a technical manual, such as THE HANDBOOK OF CHEMISTRY AND PHYSICS by Chemical Rubber Company.

The heavy mix recipe for the KlentagLA yielded a final Mg(II) cation concentration that was 2.5 mM greater than the total concentration of the dNTP. This heavy mix recipe consists of the following components: 100 μl of 10×TCA; 100 μl of a dNTP mix consisting of 10 mM dATP, 10 mM dGTP, 10 mM dCTP, and 10 mM dTTP; 140 μl of 100 mM MgCl2, 67 μl of 0.75 mM Cresol Red, 4.25 mM Tris Base, 400 μl of 50% Sucrose or Sorbitol; and 193 μl of water to 1 ml.

The heavy mix recipe for Taq or TagLA yielded final Mg(II) cation concentration that was 0.75 mM greater than the total concentration of the dNTPs. This heavy mix recipe consists of the following components: 100 μl of 10×TCA; 94 of 100 mM MgCl2, 16 μl of 100 mM dATP; 16 Ill of 100 mM dGTP; 16 μl of 100 mM dCTP; 16111 of 100 mM dTTP; 67 μl of 0.75 mM Cresol Red, 4.25 mM Tris Base 400 μl of 50% Sucrose or Sorbitol; and 275 μl of water to 1 ml.

Typical reaction mixtures were assembled with the following components: 3.75 μl 10×TCA; 1.0 ng target DNA; 1.0 μl (each) 10 μl primers; 0.25 to 0.50 μl enzyme; 30.25 μl water to a final volume of 37.5 μl. This initial mixture represented the top layer. The top layer was added to the PCR assay tube, followed by the addition of oil (if desired or necessary). The PCR tube was subjected to a brief centrifugation step to resolve the aqueous and oil layers. Finally, 13.0 μl of heavy mix was added as an underlayer of the PCR tube contents without mixing. The tubes were closed and carefully carried to and installed into the thermal cycler without undue agitation. The thermal cycler was set to start with a 5 min heating step from 60° C. to 68° C. before the first heat denaturation step. A visual inspection of the tubes thereafter confirmed that the two layers had already mixed during this time.

For heavy hot start PCR assays that included whole blood in the heavy layer, the following experiment was performed. One hundred microliter reactions were assembled with the whole blood being added last. The top layer consisted of 80 μl mixtures, wherein each mixture contained 0.25 μl of polymerase selected from the group consisting of Klentaq1 (Klentaq-278), Klentaq5 (Klentaq-235), Klentaq6, Klentaq7, additional mutants, and Taq. Before the blood was added, water was added to complement the blood volume, so that at the final volume would be 100 μl even though the volume of the heavy, whole blood underlay ranged from 0.5 μl to 20. The blood was carefully added at the bottom of the tubes, underneath the 80 μl top layer. For example, in PCR assays that contained 0.5 μl of blood, 19.5 μl of water was added to the upper layer before the blood was added as an underlay at the bottom of the tube. The layers were not manually mixed before the PCR assay was performed. The primers were present at 20 pmoles each per 100 μl reaction. The buffer was KLA pH 9, the concentration of dNTPs was 100 μm each, and 1.3 M betaine was present (all concentrations as final in the 100 μL). Ten nanograms of human DNA (from Novagen) was included in the two of the no-blood reactions (the ones catalyzed by Klentaq-235 and Taq) (indicated by lanes denoted by “0+”) to provide a positive control for the polymerase activity. The thermal cycling program was 3 min preheat at 60° C., 35 cycles of (71 sec at 93° C., 60 sec at 60° C., and 5 min at 68° C.).

FIG. 5A illustrates the results of heavy hot start PCR assays (100 μL reaction volumes) conducted with KT-1 (SEQ ID NO:2), KT-6 (SEQ ID NO:4) and KT-7 (SEQ ID NO:6) in the presence of whole blood and under different conditions of pre-treatment of the reaction samples prior to initiating the thermal cycling program. The asterisks indicate those reaction vessels wherein the heavy and light volume component layers were premixed by vortexing, i.e., reactions that a contain homogeneous PCR assay solution and that were not subjected to a heavy hot start procedure as described herein. Lanes 1-13, 15 and 17 are PCR assays directed toward the amplification of a 1.1 kbp target from the human CCR5 gene using ccr5+1 kb (SEQ ID NO:9) and CCR5-KOZ (SEQ ID NO:7). Lanes 14, 16, and 18 are PCR assays directed toward the amplification of a 2.5 kbp target from the human CCR5 gene using CCR5−2 kb (SEQ ID NO:8) and ccr5deltaRT (SEQ ID NO:10).

FIG. 6 depicts the additional results of this type of experiment. The amplification activity was revealed by the specific amplification of a 0.5 kbp DNA product from the CCR5 gene endogenous to the human cells in the blood (except for the lanes indicated by “0+”, which indicates the presence 10 ng of exogenous human DNA template without whole blood). KT-1 (SEQ ID NO:2), KT-6 (SEQ ID NO:4), and KT-7 (SEQ ID NO:6) displayed DNA amplification activity in reaction containing from about 1% whole blood (vol/vol) to about 20% whole blood (vol/vol) whereas Klentaq5 and Taq did not display amplification activity in reactions containing as little as about 1% whole blood (vol/vol). The primers used to generate this amplification product were CCR5-D5 (SEQ ID NO:15) and CCR5-D3 (SEQ ID NO:16).

Example 5

Whole Blood PCR Assays that Employ KT Mutant Polymerases with a Second Thermostable DNA Polymerase Having a 3′-Exonuclease Activity

This example shows that long and accurate PCR works with whole blood as the source of the target template. Since long and accurate PCR (U.S. Pat. No. 5,436,149, claims 6-16) comprises the use of a mixture of DNA polymerases, this example also illustrates that the minor component of the mixture, an archaebacterial DNA polymerase which is thermostable and which exhibits 3′-exonuclease activity, is surprisingly active with whole blood.

The master PCR cocktail was assembled as follows:

200 μl 10×KLA pH 9

20 μl 10/40 (mix of 10 mM each dNTP and 40 mM MgC12)

520 μl 5 M Betaine

40 μl primer CCR5−2 kb (SEQ ID NO:8)

40 μl primer ccr5deltaRT (SEQ ID NO:10)

1120 μl water to make 20×97 μl reaction mixture aliquots

1940 μl total cocktail volume

It is worth noting that the PCR cocktail lacked target nucleic acid template and the DNA polymerase at this stage.

Enzyme dilutions were prepared on ice by mixing them with a portion of the master mix as follows: six aliquots (75 μl each) of master mix were withdrawn and added to an aliquot (0.75 μl) of enzymes KT-1 (SEQ ID NO:2), KT-6 (SEQ ID NO:4), or KT-7 (SEQ ID NO:6) each at about 30 U/μl, and the same three enzymes that have been previously mixed with 1:24 dilution volume of the archaebacterial enzyme Deep Vent, which is available commercially at 2 U/μl. These latter enzyme mixtures possessed a ratio of KT enzyme to Deep Vent enzyme of about 1:360.

Aliquots of the master mix (72 μl) were dispensed to reaction tubes, then aliquots of the appropriate enzyme dilution mix (25 μl) were dispensed into the reaction tubes to provide for a total volume of 97 μl.

Pure human DNA (Novagen), stored at a temperature of 4° C. and at a concentration of 3 ng/μl, was diluted 3-fold with standard TEN buffer (10 mM Tris pH 7.9, 10 mM NaCl, 0.1 mM EDTA) to make 1 ng/μl, and then an aliquot of this solution (3 μl) was pipetted into the aforementioned 97 μl mixture to yield the final PCR assay mastermix.

Whole blood, which is typically stored in an aliquot of 0.5 ml with 4.5 mM EDTA at −80° C., was thawed at room temperature for about 15 to 30 minutes and mixed by gentle inversion before 3 μl was pipetted underneath the aforementioned 97 μl mixture in additional PCR reaction tubes, avoiding mixing. The pipettor was set to 3.2 μl and care was exercised not eject the last small amount of blood volume (0.2 μl), so as to avoid injecting a bubble of air into the PCR assay solution and thereby disturb the heavy phase at the bottom of the tube.

Thermal cycling for the PCR amplification was carried out using a similar program as described above (2 minutes at 93° C., followed by 33 cycles of (71 seconds at 93° C., 1 minute at 60° C., 10 minutes at 68° C.). After the PCR assays were completed, aliquots of the reactions (18 μl) were mixed with 4.4 μl of blue dye mix, and analyzed by electrophoresis on a 1.4% agarose gel.

FIG. 7 illustrates that little or no PCR product of the expected size (2.5 kbp) is obtained unless an amount of Deep Vent polymerase is present to complement the major DNA polymerase Klentaq1 (SEQ ID NO:2), Klentaq6 (SEQ ID NO:4), or Klentaq7 (SEQ ID NO:6), all of which perform equally well under these conditions.

Example 6

Selection of Blood-Resistant Klentaq DNA Polymerase Mutants Using Compartmentalized Self-Replication

The recently described highly effective compartmentalized self-replication (CSR) strategy for directed evolution of enzymes (25, 26) could be adapted to select for blood-resistant Klentaq mutants. The existence of blood-resistant mutant(s) of Klentaq should be evident in the library as a manifestation of detectable self-replication of the Klentaq gene in the presence of 10% blood, a concentration that is inhibitory for the wild-type Klentaq. Blood-resistant Klentaq clones could be isolated and Klentaq mutant proteins prepared according to the procedures set forth in Example 1. Individual Klentaq polymerase mutants could then subjected to screening procedures to ascertain whether each displays a cold sensitive phenotype. Those Klentaq mutants that are blood-resistant and display a cold sensitive phenotype would be expected to conform to the group of blood-resistant DNA polymerases as defined herein. The aforementioned selection/screening procedure should also be amenable to identifying full-length Taq DNA polymerase mutants that are blood-resistant DNA polymerases as defined herein.

Sequence Information

The nucleic acids and polypeptides of the various DNA polymerases and the oligonucleotide primers described in this application include the sequences shown in the Sequence Listing. Table II provides the nucleic acid sequences for the specific oligonucleotide primers used in the various examples disclosed in this application.

TABLE II
Nucleic acid sequences of oligonucleotides
SEQ ID NO.: Name Primer Sequence (5′→3′)
 7 CCR5-KOZ TGGAACAAGATGGATTATCAAGTGTCAAGTCCA
|        |         |         |
1        10        20        30
 8 CCR5-2kb AGAAGAGCTGAGACATCCGTTCCCCTACAAGAA
|        |         |         |
1        10        20        30
 9 ccr5+1kb AGGCTGTGTATGAAAACTAAGCCATGTGCACAA
|        |         |         |
1        10        20        30
10 ccr5deltaRT GCAGCGGCAGGACCAGCCCCAAGATGACTATCT
|        |         |         |
1        10        20        30
11 KT1 GAGCCATGGTCCTCCTCCACGAGTTCGGCCTTCTGG
|        |         |         |
1        10        20        30
12 RevTaqH CGGTCCGAAAGCTTCTATCACTCCTTGGCGG
|        |         |         |
1        10        20        30
13 DMDex2lf GGCTGTGATAGAGGCTTGTCTATA
|        |         |
1        10        20
14 DMDex21r CTGGCCTGCACATCAGAAAAGACT
|        |         |
1        10        20
15 CCR5-D5 AGGTACCTGGCTGTCGTCCATGCTGTGTTT
|        |         |         |
1        10        20        30
16 CCR5-D3 GATGATGGGGTTGATGCAGCAGTGCGTCAT
|        |         |         |
1        10        20        30
17 TPA forward GGAAGTACAGCTCAGAGTTCTGCAGCACCCCTGC
|        |         |         |
1        10        20        30
18 TPA reverse GATGCGAAACTGAGGCTGGCTGTACTGTCTC
|        |         |         |
1        10        20        30

REFERENCES

  • Lantz P-G, Al-Soud W A, Knutsson R, Hahn-Hagerdal B, Radstrom P. 2000. Biotechnical use of the polymerase chain reaction for microbial analysis of biological samples, p. 87-130. In M. R. El-Gewely (ed.), BIOTECHNOLOGY ANNUAL REVIEW, vol. 5. (Elsevier Science B.V., Amsterdam, The Netherlands).
  • Altwegg M, Verhoef J. 1995. Amplification methods in diagnostic microbiology. J. Microbiol. Methods 23:3-138.
  • Al-Soud W A, Radstrom P. 2000. Effect of amplification facilitators on diagnostic PCR in the presence of blood, feces and meat. J. Clin. Microbiol. 38:4463-70.
  • Al-Soud A W, Jonsson L J, Radstrom P. 2000. Identification and characterization of immunoglobulin G in blood as a major inhibitor of diagnostic PCR. I Clin. Microbiol. 38:345-50.
  • de Franchis R, Cross N C P, Foulkes N S, Cox T M. 1988. A potent inhibitor of Tag polymerase copurifies with human genomic DNA. Nucleic Acids Res. 16:10355.
  • Al-Soud A W, Radstrom P. 1998. Capacity of nine thermostable DNA polymerases to mediate DNA amplification in the presence of PCR-inhibiting samples. Appl. Environ. Microbiol. 64:3748-53.
  • Al-Soud W A, Radstrom P. 2001. Purification ands characterization of PCR-inhibitory components in blood cells. J. Clin. Microbiol. 39:485-93.
  • Frackman S, Kobs G, Simpson D, Storts D. 1998. Betaine and DMSO: enhancing agents for PCR. Promega Notes 65:27.
  • Topal M D, Sinha N K. 1983. Products of bacteriophage T4 genes 32 and 45 improve the accuracy of DNA replication in vitro. J. Biol. Chem. 258:12274-79.
  • Akane A, Matsubara K, Nakamura H, Takahashi S, Kimura K. 1994. Identification of the heme compound copurified with deoxyribonucleic acid (DNA) from bloodstains, a major inhibitor of polymerase chain reaction (PCR) amplification. J. Forensic Sci. 39:362-72.
  • Kreader C A. 1996. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl. Environ. Microbiol. 62:1102-06.
  • Morata P, Queipo-Ortuno I, Colmenero J. 1998. Strategy for optimizing DNA amplification in a peripheral blood PCR assay used for diagnosis of human brucellosis. J. Clin. Microbiol. 36:2443-46.
  • Rossen L, Noskoy P, Holmstrom K, Rasmussen O F. 1992. Inhibition of PCR by components of food samples, microbial diagnostic assays and DNA-extraction solution. Int. J. Food Microbiol. 17:37-45.
  • Izraeli S, Pfleiderer C, Lion T. 1991. Detection of gene expression by PCR amplification of RNA derived from frozen heparinized whole blood. Nucleic Acids Res. 19:6051.
  • Wilson I G. 1997 Inhibition and facilitation of nucleic acid amplification. Appl. Environ. Microbiol. 63:3741-51.
  • Al-Soud A W, Lantz P-G, Backman A, Olcen P, Radstrom P. 1998. A sample preparation method which facilitates detection of bacteria in blood cultures by the polymerase chain reaction. J. Microbiol. Methods 32:217-224.
  • Klein A, Barsuk R, Dagan S, Nusbaum O, Shouval D, Galun E. 1997. Comparison of methods for extraction of nucleic acid from hemolytic serum for PCR amplification of hepatitis B virus DNA sequences. J. Clin. Microbiol. 35:1897-99.
  • Cattaneo C, Graig O E, James N T, Bolton H. 1997. Comparison of three DNA extraction methods on bone and blood stains up to 43 years old and amplification of three different gene sequences. J Forensic Sci. 42:1126-35.
  • Bourke M T, Scherczinger C A, Ladd C, Lee H C. 1999. NaOH treatment to neutralize inhibitors of Taq polymerase. J Forensic Sci. 44:1046-50.
  • Kox L F, Rhienthong D, Miranda A M, Udomsantisuk N, Ellis K, van Leeuwven J, van Heusden S, Kuijper S, Kolk A H. 1994. A more reliable PCR for detection of Mycobacterium tuberculosis in clinical samples. J. Clin. Microbiol. 32:672-80.
  • Kramvis A, Bukovzer S, Kew M C. 1996. Comparison of hepatitis B virus DNA extractions from serum by the QIAamp blood kit, Genereleaser, and the phenol-chloroform method. J. Clin. Microbiol. 34:2731-33.
  • Barnes W M. 1992. The fidelity of taq polymerase catalyzing PCR is improved by an N-terminal deletion. Gene 112:29-35.
  • Kermekchiev M B, Tzekov A, Barnes W M. 2003. Cold-sensitive mutants of Taq DNA polymerase provide a hot start PCR. Nucleic Acids Res. 31:6139-47.
  • Tabor S, Richardson C C. 1995. A single residue in DNA polymerises of the E. coli DNA polymerase I family is critical for distinguishing between deoxy- and dideoxyribonucleotides. Proc. Natl. Acad. Sci., USA 92:6339-43.
  • Tawfik D S, Griffiths A D. 1998. Man-made cell-like compartments for molecular evolution. Nature Biotech. 16:652-56.
  • Ghadessy F J, Ong J L, Holliger P. 2001. Direct evolution of polymerase function by compartmentalized self-replication. Proc. Natl. Acad. Sci., USA 98:4552-57.
  • Barnes W M. 1994. PCR amplification of up to 35 kb DNA with high fidelity and high yield from bacteriophage templates. Proc. Natl. Acad. Sci., USA 91:2216-20.
  • Barnes W M. 1994. Tips and tricks for long and accurate PCR. TIBS 19:342-46.
  • Ausubel F M, Brent R, Kingston R E, Moore D D et al. 1987. Current Protocols In Molecular Biology. John Wiley & Sons, New York.
  • Sambrook J. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor.
  • Barnes W M. Jul. 25, 1995. U.S. Pat. No. 5,436,149, Thermostable DNA polymerase with enhanced thermostability and enhanced length and efficiency of primer extension.
  • Barnes W M. Apr. 1, 1997. U.S. Pat. No. 5,616,494, Thermus aquaticus DNA polymerase lacking the n-terminal 235 amino acids of taq DNA polymerase.
  • Scalice E R, Sharkey D J, Daiss J L. 1994. Monoclonal antibodies prepared against the DNA polymerase from Thermus aquaticus are potent inhibitors of enzyme activity. J. Immunol. Methods 172:147-63.
  • Sharkey D J, Scalice E R, Christy K G Jr, Atwood S M, Daiss J L. 1994. Antibodies as thermolabile switches: high temperature triggering for the polymerase chain reaction. Biotechnology 12:506-9.
  • Kellogg D E, Rybalkin I, Chen S, Mukhamedova N, Vlasik T, Siebert P D, Chenchik A. 1994. TaqStart Antibody: “hot start” PCR facilitated by a neutralizing monoclonal antibody directed against Taq DNA polymerase. Biotechniques 16:1134-7.
  • Baskaran N, Kandpal R P, Bhargava A K, Glynn M W, Bale A, Weissman S M. 1996. Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content. Genome Res. 6:633-8.

Claims

What is claimed is:

1. An isolated polypeptide comprising an amino acid sequence selected from the group consisting of:

(i) SEQ ID NO: 22 or a variant thereof having at least 95% sequence identity to SEQ ID NO: 22, wherein position 430 of the variant of SEQ ID NO: 22 is serine (S), tryptophan (W), leucine (L), and the variant of SEQ ID NO: 22 has fast elongating polymerase activity; or

(ii) a fragment of (i) comprising position 430 of SEQ ID NO: 22 or serine (S), tryptophan (W), or leucine (L) at position 430 of the variant of SEQ ID NO: 22, wherein the fragment has fast elongating polymerase activity.

2. The isolated polypeptide of claim 1, wherein the isolated polypeptide comprises the variant having at least 95% sequence identity to SEQ ID NO: 22, position 430 of the variant of SEQ ID NO: 22 is serine (S), and the variant of SEQ ID NO: 22 has fast elongating polymerase activity.

3. The isolated polypeptide of claim 1, wherein the isolated polypeptide comprises the variant having at least 95% sequence identity to SEQ ID NO: 22, position 430 of the variant of SEQ ID NO: 22 is tryptophan (W), and the variant of SEQ ID NO: 22 has fast elongating polymerase activity.

4. The isolated polypeptide of claim 1, wherein the isolated polypeptide comprises the variant having at least 95% sequence identity to SEQ ID NO: 22, position 430 of the variant of SEQ ID NO: 22 is leucine (L), and the variant of SEQ ID NO: 22 has fast elongating polymerase activity.

5. The isolated polypeptide of claim 1, wherein:

the variant of SEQ ID NO: 22 comprises at least one of:

position 331 of the variant of SEQ ID NO: 22 is proline (P);

position 348 of the variant of SEQ ID NO: 22 is lysine (K);

position 371 of the variant of SEQ ID NO: 22 is isoleucine (I); and

position 429 of the variant of SEQ ID NO: 22 is leucine (L); and

the variant of SEQ ID NO: 22 has fast elongating polymerase activity.

6. The isolated polypeptide of claim 1, wherein the isolated polypeptide comprises:

(i) the variant having at least 95% sequence identity to SEQ ID NO: 22, position

position 348 of the variant of SEQ ID NO: 22 is lysine (K), position 429 of the variant of SEQ ID NO: 22 is leucine (L), and position 430 of the variant of SEQ ID NO: 22 is tryptophan (W), and the variant of SEQ ID NO: 22 has fast elongating polymerase activity; or

(ii) SEQ ID NO: 6 (KT-7).

7. The isolated polypeptide of claim 1, wherein the isolated polypeptide comprises:

(i) the variant having at least 95% sequence identity to SEQ ID NO: 22, position 348 of the variant of SEQ ID NO: 22 is lysine (K), position 371 of the variant of SEQ ID NO: 22 is isoleucine (I), position 429 of the variant of SEQ ID NO: 22 is leucine (L), and position 430 of the variant of SEQ ID NO: 22 is serine (S), and the variant of SEQ ID NO: 22 has fast elongating polymerase activity; or

(ii) SEQ ID NO: 22 (KT-11).

8. The isolated polypeptide of claim 1, wherein the isolated polypeptide comprises:

(i) the variant having at least 95% sequence identity to SEQ ID NO: 22, position 331 of the variant of SEQ ID NO: 22 is proline (P), position 348 of the variant of SEQ ID NO: 22 is lysine (K), position 429 of the variant of SEQ ID NO: 22 is leucine (L), and position 430 of the variant of SEQ ID NO: 22 is leucine (L), and the variant of SEQ ID NO: 22 has fast elongating polymerase activity; or

(ii) SEQ ID NO: 24 (KT-12).

9. The isolated polypeptide of claim 1, wherein the isolated polypeptide comprises:

(i) the variant having at least 95% sequence identity to SEQ ID NO: 22, position 331 of the variant of SEQ ID NO: 22 is proline (P), position 348 of the variant of SEQ ID NO: 22 is lysine (K), position 429 of the variant of SEQ ID NO: 22 is leucine (L), and position 430 of the variant of SEQ ID NO: 22 is leucine (L), and the variant of SEQ ID NO: 22 has fast elongating polymerase activity; or

(ii) SEQ ID NO: 30 (FL-12).

10. The isolated polypeptide of claim 1, wherein the isolated polypeptide comprises SEQ ID NO: 6 (KT-7); SEQ ID NO: 22 (KT-11); SEQ ID NO: 24 (KT-12); or SEQ ID NO: 30 (FL-12), and the isolated polypeptide has fast elongating polymerase activity.

11. An isolated polynucleotide encoding the isolated polypeptide of claim 1.

12. The isolated polynucleotide of claim 11, wherein the polynucleotide comprises a nucleic acid sequence of SEQ ID NO: 5 (KT-7), SEQ ID NO: 21 (KT-11), SEQ ID NO: 23 (KT-12), or SEQ ID NO: 29 (FL-12).

13. A kit for performing PCR assays, wherein the kit comprises an isolated polypeptide according to claim 1.

Resources

Images & Drawings included:

Sources:

Recent applications in this class:

Recent applications for this Assignee: