US20130323736A1
2013-12-05
13/796,766
2013-03-12
A polynucleotide primer comprising at least the final six nucleotides of one of the following primer sequences, or a sequence complementary thereto: SEQ. ID NOS. 1 to 18, 21 to 45 or 74 to 77.
Get notified when new applications in this technology area are published.
C12Q1/6886 » CPC main
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
C12Q1/68 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids
This application is a continuation of U.S. patent application Ser. No. 11/910,511 filed Jun. 2, 2008, which in turn is a 371 filing of PCT/GB2006/001227 filed Apr. 4, 2006, which claims priority from GB 0506807.7, filed Apr. 4, 2005. These prior applications are incorporated herein by reference.
The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is entitled 3974-102SequenceListing.txt, was created on 12 Mar. 2013 and is 15 kb in size. The information in the electronic format of the Sequence Listing is part of the present application and is incorporated herein by reference in its entirety.
The present invention relates to a polynucleotide, a kit comprising a polynucleotide and a method for detecting the presence or absence of mutations in a gene.
Epidermal Growth Factor (EGF) and its corresponding receptor (EGFR) are responsible for modulating growth of many classes of cells. Mutations of EGFR have been implicated in uncontrolled cell proliferation and tumour growth.
Although there are many examples of nucleic acid changes having potential as tumour markers, their value as clinical tools in cancer diagnosis, staging or even screening, needs to be demonstrated and two important criteria must be met. Firstly, nucleic acids of adequate yield and quality must be extracted from the clinical material; secondly, robust and accurate methods of analysis are required. For reliable tumour genotyping to be useful in disease staging any test has to be adequately validated and there should be demonstrable benefits over current methods.
A number of studies have examined the association of lung cancer and its response to gefinitib (AstraZeneca's IRESSA) with mutations in the oncogene, EGFR. However, there have been differences in the spectrum and reported frequencies of EGFR mutations. One major issue is that in order to identify a wide range of possible mutations, nucleotide sequencing of the kinase domain of the EGFR gene has been undertaken in excised tumours. The utility of this approach is limited by a number of factors, mainly:
For example, as little as 10% of a specimen may be tumour, the remainder being marginal non-tumour cells. Tumours are notoriously heterogeneous in their genetic makeup and as little as 10% of the tumour cells may contain any particular genetic change. In total therefore as little as 1% of a tumour sample for genetic analysis may contain the specific variation of interest.
The detection limits for sequencing are of the order of 15-25%; that is sequencing can detect the rarer allele at levels no worse than 1 in 4 to 1 in 6. As discussed above, the prevalence of the mutation in a given tumour sample may be significantly below such levels. Current approaches require that a degree of sample enrichment be performed, namely an attempt to excise selectively the tumour material from a paraffin-embedded tissue section. This is expensive, time consuming and lacks sensitivity.
In the present invention we have now devised novel diagnostic methods for the detection of EGFR mutations based on the amplification refractory mutation system (ARMS) as disclosed in, for example, EP-A-0332435. Validated tests for four EGFR point mutations and four deletions have been developed and the tests have been applied in an investigation of the incidence of the mutations in tumours from patients. The ARMS technology is capable of selectively amplifying specific sequence variants in a background of alternative sequences.
ARMS is a simple and accurate method and has several benefits over other PCR-based mutation detection systems. Specifically, the technique does not require the use of radioisotopes nor the multiple probing of immobilised PCR amplicons nor the cloning of PCR amplicons.
ARMS avoids the need for DNA sequencing of single-strand conformation polymorphism products, a procedure that could be expected to be constrained by sequence under-representation as discussed above. Similarly, under-represented mutant sequences could go undetected using PCR in conjunction with restriction fragment length polymorphism which is limited to low cycle numbers for the PCR to avoid false positive results. Previously generated amplicons therefore have the potential to cause carry-over contamination when PCR is resumed. ARMS can be performed under conditions in which carry-over contamination is avoided, as in the present invention, allowing the use of high PCR cycle numbers and resulting in exceptionally high detection sensitivity.
Thus, in general terms the present invention relates to a diagnostic method for the detection of EGFR mutations in cancer, particularly lung cancer, using the amplification refractory mutation system (ARMS). The invention also relates to mutation specific primers suitable for use in the method and to diagnostic kits containing these primers.
According to one aspect of the present invention, there is provided a polynucleotide comprising at least the final six nucleotides of one of the following primer sequences, or a sequence complementary thereto: SEQ. ID NOS. 1 to 18, 21 to 45 or 74 to 77. The term âthe final six nucleotidesâ means the six nucleotides at the 3Ⲡend of the polynucleotide.
Conveniently, the polynucleotide is less than 100 nucleotides long, preferably less than 80 nucleotides long, more preferably less than 60 nucleotides long, more preferably less than 40 nucleotides, more preferably less than 30 nucleotides long.
Preferably, the polynucleotide comprises at least 75% and more preferably 100% of the final 8, 10, 12, 14, 16, 17, 18 or 20 nucleotides, or the entirety of one of the following primer sequences, or a sequence complementary thereto: SEQ. ID NOS. 1 to 18, 21 to 45 or 74 to 77.
Advantageously, the polynucleotide further comprises a quencher group and a fluorophore group. âFluorophore groupsâ are those groups which are capable of absorbing light at a first wavelength and in response emitting light at a second wavelength. A âquencher groupâ is a group which, when in sufficiently close proximity to a fluorophore group, is capable of preventing, or âquenchingâ, the emission of light from the fluorophore group. Typically, a particular type of quencher group will only work with respect to certain types of fluorophore group.
Conveniently, the quencher group and the fluorophore group are separated by a nucleotide tail sequence comprising first and second regions, the nucleotides of the first region being complementary to but in reverse order from the nucleotides of the second region, such that hybridisation of the first region to the second group results in the quencher group to be sufficiently close to the fluorophore group to quench the fluorophore group.
Preferably, the tail sequence further comprises a third region having a sequence complementary to a region of the EGFR gene.
Advantageously, the polynucleotide comprises at least the final six nucleotides of SEQ. ID NO. 3 or 10 and the tail sequence comprise SEQ. ID NO. 19.
Alternatively, the polynucleotide comprises at least the final six nucleotides of SEQ. ID NOS. 6 or 12 and the tail sequence comprises SEQ. ID NO. 20.
Alternatively, the polynucleotide comprises at least the final six nucleotides of SEQ. ID NO: 76 and the tail sequence comprises SEQ. ID NO: 77.
Conveniently, the quencher group comprises black hole quencher 1 (BHQ1) and the fluorophore group comprises FAM.
Alternatively, the quencher group comprises black hole quencher 2 (BHQ2) and the fluorophore comprises Cal Red.
Preferably, a blocking moiety is provided between the primer sequence and the tail sequence to prevent polymerase mediated chain extension of the tail sequence. A preferred blocking moiety is a hexethylene glycol (HEG) monomer.
According to another aspect of the present invention, there is provided a kit comprising at least a pair of polynucleotides, wherein the pair of polynucleotides comprises at least four or five of the final six nucleotides of one of the following pairs of primer sequences, respectively, or sequences complementary thereto: SEQ. ID NO. 1 and SEQ. ID NO. 15, or SEQ. ID NO. 2 and SEQ. ID NO 15, or SEQ. ID NO. 3 and SEQ. ID NO. 15, or SEQ. ID NO. 4 and SEQ. ID NO. 15, or SEQ. ID NO. 5 and SEQ. ID NO. 15, or SEQ. ID NO. 6 and SEQ. ID NO. 16, or SEQ. ID NO. 7 and SEQ. ID NO. 17, or SEQ. ID NO. 8 and SEQ. ID NO. 18, or SEQ. ID NO. 9 and SEQ. ID NO. 18, or SEQ. ID NO. 10 and SEQ. ID NO. 15, or SEQ. ID NO. 11 and SEQ. ID NO. 15 or SEQ. ID NO. 12 and SEQ. ID NO. 16, or SEQ. ID NO. 13 and SEQ. ID NO. 17, or SEQ. ID NO. 14 and SEQ. ID NO. 18 or SEQ. ID NO. 21 and SEQ. ID NO. 15, or SEQ. ID NO. 22 and SEQ. ID NO. 24, or SEQ. ID NO. 23 and SEQ. ID NO. 24, or SEQ. ID NO. 25 and SEQ. ID NO. 41, or SEQ. ID NO. 26 and SEQ. ID NO. 41, or SEQ. ID NO. 27 and SEQ. ID NO. 41, or SEQ. ID NO. 28 and SEQ. ID NO. 41, or SEQ. ID NO. 29 and SEQ. ID NO. 42, or SEQ. ID NO. 30 and SEQ. ID NO. 43, or SEQ. ID NO. 31 and SEQ. ID NO. 44, or SEQ. ID NO. 32 and SEQ. ID NO. 44, or SEQ. ID NO. 33 and SEQ. ID NO. 41, or SEQ. ID NO. 34 and SEQ. ID NO. 45, or SEQ. ID NO. 35 and SEQ. ID NO. 41, or SEQ. ID NO. 36 and SEQ. ID NO. 41, or SEQ. ID NO. 37 and SEQ. ID NO. 42, or SEQ. ID NO. 38 and SEQ. ID NO. 43, or SEQ. ID NO. 39 and SEQ. ID NO. 44, or SEQ. ID NO. 40 and SEQ. ID NO. 45, or SEQ. ID NO. 74 and SEQ. ID NO. 76 or SEQ. ID NO. 75 and SEQ. ID NO. 76. For example, the pair of polynucleotides comprises a first polynucleotide consisting of the final six nucleotides of SEQ ID NO. 1 and a second polynucleotide consisting of the final six nucleotides of SEQ ID NO. 15.
According to a further aspect of the present invention, there is provided a kit comprising at least a set of three polynucleotides wherein the set of three polynucleotides comprises at least four or five of the final six nucleotides of one of the following sets of three primer sequences, respectively, or sequences complementary thereto: SEQ. ID NOS. 1, 10 and 15, or SEQ. ID NOS. 2, 10 and 15, or SEQ. ID NOS. 3, 10 and 15, or SEQ. ID NOS. 4, 11 and 15, or SEQ. ID NOS. 5, 11 and 15, or SEQ. ID NOS. 6, 12 and 16, or SEQ. ID NOS. 7, 13 and 17, or SEQ. ID NOS. 8, 14 and 18, or SEQ. ID NOS. 9, 14 and 18, or SEQ. ID NOS. 21, 10 and 15, or SEQ. ID NOS. 22, 23 and 24, or SEQ. ID NOS. 25, 35 and 41, or SEQ. ID NOS. 26, 35 and 41, or SEQ. ID NOS. 27, 36 and 41, or SEQ. ID NOS. 28, 36 and 41, or SEQ. ID NOS. 29, 32 and 42, or SEQ. ID NOS. 30, 38 and 43, or SEQ. ID NOS. 31, 39 and 44, or SEQ. ID NOS. 32, 39 and 44, or SEQ. ID NOS. 33, 35 and 41, or SEQ. ID NOS. 34, 40 and 45 or SEQ. ID NOS. 74, 75, 76. For example, the set of three polynucleotides comprises a first polynucleotide consisting of the final six nucleotides of SEQ ID NO. 1, a second polynucleotide consisting of the final six nucleotides of SEQ IS NO. 10 and a third polynucleotide consisting of the final six nucleotides of SEQ ID NO. 15.
Conveniently the polynucleotides in the kit are as described above.
Preferably, the kit further comprises nucleotide triphosphates, a polymerisation enzyme and/or a buffer solution.
According to another aspect of the present invention, there is provided the use of a polynucleotide or a kit as described above or a polynucleotide comprising four or five of the final six nucleotides of SEQ. ID NOS. 1 to 18, 21 to 45 or 74 to 77 or sequences complementary thereto for detecting a mutation in a nucleic acid sample containing at least a fragment of the EGFR gene.
Advantageously, the fragment of the EGFR gene in the nucleic acid sample is at least 10 nucleotides long, preferably 20 nucleotides long, more preferably 30 nucleotides long and more preferably 40 nucleotides long.
According to a further aspect of the present invention, there is provided a method of detecting the presence or absence of a mutation in the EGFR gene comprising the steps of:
Advantageously, the polynucleotide is a polynucleotide as described above and comprises at least for or five of the final six nucleotides of SEQ. ID NOS. 1 to 9, 21, 22, 25 to 34 or 75 or sequences complementary thereto and step b) indicates the presence of a mutation.
Preferably, the polynucleotide is a polynucleotide as described above and comprises at least for or five of the final six nucleotides of SEQ. ID NOS. 10 to 14, 23, 35 to 40 or 74 or sequences complementary thereto; and step b) indicates the absence of a mutation.
Conveniently, the method further comprises the step of prior to step a), amplifying the number of copies of the fragment of the EGFR gene using thermal cycling nucleic acid amplification, preferably PCR.
Preferably step b) comprises carrying out DNA polymerisation using the polynucleotide as a first primer and detecting the extension product of polymerisation.
Advantageously, the method step b) comprises the step of mixing the nucleic acid sample and the polynucleotide with a second primer which corresponds to a region of the fragment of the EGFR sequence downstream of the region to which the polynucleotide is complementary and carrying out PCR on the mixture.
Conveniently, the second primer comprises: SEQ. ID NO. 15 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 1 to 5, 10, 11 or 21; SEQ. ID NO. 16 and the polynucleotide comprises at least the four or five final six nucleotides of SEQ. ID NOS. 6 or 12; SEQ. ID NO. 17 and the polynucleotide comprises at least the four or five final six nucleotides of SEQ. ID NOS. 7 or 13; or SEQ. ID NO. 18 and the polynucleotide comprises at least the four or five final six nucleotides of SEQ. ID NOS. 8, 9 or 14; SEQ. ID NO. 24 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS: 22 or 23; SEQ. ID NO. 41 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 25 to 28, 33, 35 or 36; SEQ. ID NO. 42 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 29 or 37; SEQ. ID NO. 43 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 30 to 38; SEQ. ID NO. 44 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 31, 32 or 39; or SEQ. ID NO. 45 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 34 or 40; SEQ. ID NO. 76 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NO. 74 or 75.
Preferably step a) comprises the step of mixing the nucleic acid sample with a pair of a mutation specific polynucleotide and a wild-type specific polynucleotide, the pair being selected from at least four or five of the final six sequences of: SEQ. ID NO: 1 and SEQ. ID NO: 10; SEQ. ID NO: 2 and SEQ. ID NO: 10; SEQ. ID NO: 3 and SEQ. ID NO: 10; SEQ. ID NO: 4 and SEQ. ID NO: 11; SEQ. ID NO: 5 and SEQ. ID NO: 11; SEQ. ID NO: 6 and SEQ. ID NO: 12; SEQ. ID NO: 7 and SEQ. ID NO: 13; SEQ. ID NO: 8 and SEQ. ID NO: 14; SEQ. ID NO: 9 and SEQ. ID NO: 14; SEQ. ID NO: 21 and SEQ. ID NO: 10; SEQ. ID NO: 22 and SEQ. ID NO: 23; SEQ. ID NO: 25 and SEQ. ID NO: 35; SEQ. ID NO: 26 and SEQ. ID NO: 35; SEQ. ID NO: 27 and SEQ. ID NO: 36; SEQ. ID NO: 28 and SEQ. ID NO: 36; SEQ. ID NO: 29 and SEQ. ID NO: 37; SEQ. ID NO: 30 and SEQ. ID NO: 38; SEQ. ID NO: 31 and SEQ. ID NO: 39; SEQ. ID NO: 32 and SEQ. ID NO: 39; SEQ. ID NO: 33 and SEQ. ID NO: 35; SEQ. ID NO: 34 and SEQ. ID NO: 40; or SEQ. ID NO. 74 and SEQ. ID NO. 75.
Advantageously the nucleic acid sample comprises wild-type sequences and mutated sequences and further comprising step c) wherein the number of amplification cycles required to amplify the wild-type sequences to a predetermined quantity is compared with the number of amplification cycles required to amplify the mutated sequences to the predetermined quantity thereby providing an indication of the ratio of the wild type sequences to mutated sequences in the sample.
Conveniently the nucleic acid sample comprises a portion of tumourous tissue and a portion of non-tumourous tissue and wherein step c) further comprises the step determining the ratio of tumourous tissue to non-tumourous tissue in the sample.
Preferably the method further comprises the step of, prior to step a), enriching the nucleic acid sample to increase the ratio of tumourous tissue to non-tumourous tissue in the sample.
Preferably step b) comprises detecting if amplification of at least a portion of the EGFR gene occurs.
Advantageously the polynucleotide comprises a quencher group and a fluorophore group and step b) comprises exposing the mixture to light of a wavelength to which the fluorophore is responsive in the absence of the quencher group and detecting light at the wavelength emitted by the fluorophore group in the absence of the quencher group.
Where reference is made in the specification to âat least four or five of the final six sequencesâ of a reference sequence, this means that, of the six nucleotides in the reference sequence, either one or two of the nucleotides may be missing or replaced with a different nucleotide. Of course, in some embodiments, the sequence comprises all six of the nucleotides of the reference sequence.
In preferred embodiments of the present invention, reference to âEGFRâ is to the human EGFR gene available as accession number NCâ000007 in Homo sapiens chromosome 7, region 55054219.55242525 as on 30 Mar. 2006. In some other embodiments, reference is to the sequence as on 4 Mar. 2005. Both sequences are incorporated herein by reference. In some embodiments, the EGFR gene is not identical to these sequences but is at least 90% identical to either or both of the sequences.
A reference in this specification is made to a percentage of a polynucleotide compared with a reference polynucleotide, this can be determined by algorithms known in the art.
For example the percentage identity between two sequences can be determined using the BLASTP algorithm version 2.2.2 (Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), âGapped BLAST and PSI-BLAST: a new generation of protein database search programsâ, Nucleic Acids Res. 25:3389-3402) using default parameters.
In order that the present invention may be more readily understood and so that further features thereof may be appreciated, embodiments of the invention will now be described, by way of example, with reference to the accompanying figures in which:
FIG. 1 is a graph showing the results of PCR amplification carried out on a sample in the presence of a primer of the present invention and control primers;
FIG. 2 is a graph showing the results of PCR amplification carried out on a sample in the presence of a primer specific for del S752-1759 (SEQ. ID NO. 5) and a corresponding wild-type specific primer;
FIG. 3 is a graph showing the results of PCR amplification carried out on a sample in the presence of a primer specific for the L858R mutation (SEQ. ID NO. 6) and a corresponding wild-type specific primer;
FIG. 4 is a graph (lower) showing the results of PCR amplification carried out on a sample in the presence of a primer specific to a mutation and a corresponding wild-type specific primer, and a graph (upper) showing the results of sequencing of the sample;
FIG. 5 is a graph (lower) showing the results of PCR amplification carried out on a sample in the presence of a primer specific to a mutation and a corresponding wild-type specific primer, and a graph (upper) showing the results of sequencing of the sample; and
FIG. 6 is a graph showing the results of PCR amplification carried out on a set of samples, in the presence of a primer specific to a mutation; and
FIG. 7 is a graph showing the results of PCR amplification, using control primers, of the samples analysed in the results shown in FIG. 6.
In general terms, the present invention provides a diagnostic method of the detection of EGFR mutations in cancer, which method comprises contacting a test sample of nucleic acid with a diagnostic primer for a EGFR mutation in the presence of appropriate nucleotide triphosphates and an agent for polymerisation, such that the diagnostic primer is efficiently extended only when a EGFR mutation is present in the sample; and detecting the presence or absence of a EGFR mutation by reference to the presence or absence of a diagnostic primer extension product.
There are disclosed herein, primers (SEQ. ID NOS: 1 to 9, 21, 22 and 75) which can be used in the method of the invention.
Each of the diagnostic primers detects the presence or absence of one of the following EGFR mutations:
Mutations 1) to 8) confer sensitivity of an individual to gefinitib whereas mutation 9) confers resistance to gefinitib.
In some embodiments, diagnostic primers specific for the corresponding mutations on the opposite DNA strand are used (SEQ. ID NOS: 25 to 34).
The test sample of nucleic acid is conveniently a sample of blood, faeces, sputum, colonic lavage, bronchial lavage or other body fluid, or tissue obtained from an individual. The individual is conveniently human, preferably Homo sapiens. It will be appreciated that the test sample may equally be a nucleic acid sequence corresponding to the sequence in the test sample. That is to say that all or a part of the region in the sample nucleic acid may firstly be amplified using any convenient technique such as PCR or whole genome amplification (WGA) before use in the method of the invention.
Any convenient enzyme for polymerisation may be used provided that it does not affect the ability of the DNA polymerase to discriminate between normal and mutant template sequences to any significant extent. Examples of convenient enzymes include thermostable enzymes which have no significant 3â˛-5Ⲡexonuclease activity, for example Taq DNA polymerase, particularly âAmpli Taq Goldâ⢠DNA polymerase (PE Applied Biosystems), Stoffel fragment, or other appropriately N-terminal deleted modifications of Taq or Tth (Thermus thermophilus) DNA polymerases.
There are disclosed herein primers for the above EGFR point mutations which have been shown to detect the specific mutations reliably and robustly. Therefore in a further aspect of the invention we provide diagnostic primers comprising SEQ. ID NOS: 1 to 9, 21, 22, 25 to 34 or 75 and derivatives thereof wherein 6-8 of the nucleotides at the 3Ⲡend are identical to the sequences and wherein up to 10, such as up to 8, 6, 4, 2, 1, of the remaining nucleotides are optionally varied without significantly affecting the properties of the diagnostic primer. Conveniently, the sequence of the diagnostic primer is exactly as shown in any one of SEQ. ID NOS: 1 to 9, 21, 22, 25 to 34 or 75.
It is to be appreciated that alternative versions of the above described diagnostic methods are configured so that extension of the diagnostic primer indicates the absence of the EGFR mutation. For example, in the embodiments the primers comprise 6-8 nucleotides from the 3Ⲡend of any one of SEQ. ID NOS. 10 to 14, 23 or 74. In some embodiments, primers specific for the wild type sequences present the corresponding section of the complementary DNA strand are used (SEQ. ID NOS. 35 to 40).
In many embodiments, it is convenient to use a diagnostic primer of the invention with a further amplification primer in one or more cycles of PCR amplification. A convenient example of this aspect is set out European patent number EP-A-1-0332435. The further amplification primer is either a forward or a reverse common primer. Examples of such common primers are SEQ. ID NOS: 15 to 18, 24 and 76 and, to be used in conjunction with the primers for the complementary strand, SEQ. ID NOS: 41 to 45.
Any convenient control primer pair may be used. Control primers from an unrelated region of the genome, namely part of the human albumen gene, are used herein.
The diagnostic methods of the invention as outlined above are conveniently effected in one or more reaction vessels in some embodiments. Where more than one diagnostic mutation is to be assayed, the diagnostic primer (and corresponding amplification primer) are provided in individual tubes i.e. one tube per mutation in certain embodiments. Alternatively, the reactions are multiplexed, that is to say that all the diagnostic primers and amplification primers are in one tube (see EP-A-1-0332435) in other embodiments.
A variety of methods may be used to detect the presence or absence of diagnostic primer extension products and/or amplification products. These will be apparent to the person skilled in the art of nucleic aid detection procedures. Preferred methods avoid the need for radio-labelled reagents. Particular detection methods include âTaqManâ⢠product detection, for example as described in U.S. Pat. No. 5,487,972 & U.S. Pat. No. 5,210,015; Scorpions (WO-A-99/066071), which has particular benefits because specific diagnostic primers may be linked to a specific detector fluorophore, allowing the detection of multiple mutation targets from the same region of the genome.
Conveniently, real-time detection is employed which allows the quantitation of the mutation(s) within the sample. More specifically, the number of cycles required to amplify a DNA sample to a predetermined level using primers specific for the wild-type sequences is compared with the number of cycles required using primers specific for a mutant sequence. By the use of this comparison and by reference to control amplifications containing standardised proportions of mutant target, the ratio of the amount of DNA in the sample containing the mutation relative to the amount of wild type DNA is quantified. Of course this only relates to the sample as presented and does not compensate for low tumour representation within the sample. For this reason, it is preferred to combine this quantitative allele specific approach with a method to estimate the level of tumour within the sample. Alternatively, the quantitative allele specific approach is combined with a method to enrich the sample by specifically excising the tumour material from the overall sample.
In some embodiments, one or more of the diagnostic primers of the invention is conveniently packaged with instructions for use in the method of the invention and appropriate packaging and sold as a kit. The kits conveniently include one or more of the following: appropriate nucleotide triphosphates, for example dATP, dCTP, dGTP, dTTP, a suitable polymerase as previously described, and a buffer solution.
The invention will now be illustrated but not limited by reference to the following Examples.
In the absence of validated and uniform genomic material that carries each of the mutations, it was necessary to construct synthetic templates. For EGFR deletion tests this was done using long synthetic overlapping oligonucleotides, each comprising approximately half the desired amplicon. The sequences of these long oligonucleotides are shown in Table 1.
| TABLEâ1 | ||
| SEQ.âID | ||
| Name | Sequence | NO. |
| EGFRDEL15 | AAAATTCCCGTCGCTATCAAAACATCTCCGAAAGCCAACAAGG | 47 |
| CONFOR | AAATCCTCGATGTGAGTTTCTGCTTTGCTGTGTGGGGGTCCAT | |
| GGCTCTGAACCTCA | ||
| EGFRDEL15 | AACATTTAGGATGTGGAGATGAGCAGGGTCTAGAGCAGAGCA | 48 |
| CONREV | GCTGCCAGACATGAGAAAAGGTGGGCCTGAGGTTCAGAGCC | |
| ATGGACC | ||
| EGFRDEL18 | CGCTATCAAGGAATCGAAAGCCAACAAGGAAATCCTCGATGT | 49 |
| CONFOR | GAGTTTCTGCTTTGCTGTGTGGGGGTCCATGGCTCTGAACCT | |
| CAGGCCCACCTTTTCT | ||
| EGFRDEL18 | AGAAAGACATAGAAAGTGAACATTTAGGATGTGGAGATGAGC | 50 |
| CONREV | AGGGTCTAGAGCAGAGCAGCTGCCAGACATGAGAAAAGGTG | |
| GGCCTGAGGT | ||
| EGFRDEL24 | GCTATCAAGGAATTAAGAGAAGCAACACTCGATGTGAGTTTCT | 51 |
| CONFOR | GCTTTGCTGTGTGGGGGTCCATGGCTCTGAACCTCAGGCCCA | |
| CCTTTTCTCATGTCT | ||
| EGFRDEL24 | AGAAAGACATAGAAAGTGAACATTTAGGATGTGGAGATGAGC | 52 |
| CONREV | AGGGTCTAGAGCAGAGCAGCTGCCAGACATGAGAAAAGGTG | |
| GGC | ||
| EGFRDEL12 | AATTCCCGTCGCTATCAAGGAACCATCTCCGAAAGCCAACAA | 53 |
| CONFOR | GGAAATCCTCGATGTGAGTTTCTGCTTTGCTGTGTGGGGGTC | |
| CATGGCTCTGAACCTC | ||
| EGFRDEL12 | GTGAACATTTAGGATGTGGAGATGAGCAGGGTCTAGAGCAGA | 54 |
| CONREV | GCAGCTGCCAGACATGAGAAAAGGTGGGCCTGAGGTTCAGA | |
| GCCATGGACC | ||
In order to construct the targets, the two overlapping ½-amplicons were mixed in equimolar concentrations in the presence of polymerase, buffer and dNTPs. The primer mix was then incubated for 25 cycles of 1 minute each with an increment of 1° C. per cycle from 50° C. to 75° C. Synthetic templates were subsequently diluted 1 in 1 million into genomic DNA for use as controls in PCR reactions.
For SNP tests synthetic cassettes were produced using PCR to incorporate required mutations into two half cassettes. Half cassettes were then mixed in equimolar concentrations and used as a template for the construction of full length cassettes containing the required SNP target mutation. Specific primer sequences for the construction of cassettes are shown in Table 2.
| TABLEâ2 | |||
| SEQ. | |||
| ID | |||
| Name | Sequence | NO. | |
| EGFRâEx18âAU | CGCCATGCACAACTTCCCTAC | 55 | |
| EGFRâEx18âAL | TCCAGAATTTAATGATGCTGCGTCT | 56 | |
| EGFRâEx18âML | GAACGCACCGGAGCACA | 57 | |
| EGFRâEx18âBU | TTGGTGACATGTTGGTACATCCATC | 58 | |
| EGFRâEx18âMU | TTCAAAAAGATCAAAGTGCTGTGC | 59 | |
| EGFRâEx18âBL | CGTTAACTGGCAATTGTGAGATGGT | 60 | |
| EGFRâEx21âAU | AGTCCAGTAAGTTCAAGCCCAGGTC | 61 | |
| EGFRâEx21âAL | GTTCCTTAGGTGTCCTTGACAGCAG | 62 | |
| EGFRâEx21 | CCAGCAGTTTGGCCCGC | 63 | |
| L858RâML | |||
| EGFRâEx21âBU | CAGAGATTTCAATTGCAGCGAGATT | 64 | |
| EGFRâEx21 | AGATCACAGATTTTGGGCGGG | 65 | |
| L858RâMU | |||
| EGFRâEx21âBL | TAGGTTTCTGAGCACCCTCTGTGTC | 66 | |
| EGFRâEx21 | TCTCTTCCGCACCCAGCTGT | 67 | |
| L861QâML | |||
| EGFRâEx21 | TTGGGCTGGCCAAACAGC | 68 | |
| L861QâMU | |||
| EGFRâExâ20 | ACCGTGCAGCTCATCATGC | 46 | |
| T790MâMU | |||
| EGFRâExâ20 | GCTGTGAAATACCTGGCTTGTTGTT | 69 | |
| T790MâBL | |||
| EGFRâExâ20 | GAAGGGCATGAGCTGCATG | 70 | |
| T790MâBU | |||
| EGFRâExâ20 | CCAGGCAGCCTTTAGTCACTGTAGA | 71 | |
| T790MâML | |||
| EGFRâExâ20 | GGCCTCTCTGTCATGGGGAAT | 72 | |
| T790MâAU | |||
| EGFRâExâ20 | ACCTGCTCCACTCCACCACTATCAC | 73 | |
| T790MâAL | |||
Specific primer sequences for each ARMS reaction and control are shown in Tables 3 and 4.
Reactions were performed in 0.2 ml vessels (single tubes, strips or plates). Reactions (25 Îźl) typically contained:
Some reactions performed better in the presence of Qiagen Multiplex Reaction buffer that contains a proprietary mixture of Ammonium Sulphate, MgCl2, and volume excluders such as Poly (ethylene glycol) MW 8000, and/or Dextran (MW 50,000); see US-A-2004-0115712. For Real Time Quantitative PCR, YO-PRO-1 (Molecular Probes) was included at a final concentration of 1 ÎźM. This dye binds double-stranded DNA and fluoresces with high efficiency, enabling a general detection of PCR product in a reaction. Alternatively, and more preferred, we used Scorpions (a molecule that combines a primer and fluorogenic probe), which offers specific detection of target amplicons.
| TABLEâ3 |
| AlleleâSpecificâprimersâ(1) |
| WILDâTYPEâPRIMERS | MUTANTâPRIMERS | COMMONâPRIMERS |
| SEQ | SEQ | SEQ | |||||||
| ID | ID | ID | |||||||
| Test | NAME | NO. | SEQUENCE | NAME | NO. | SEQUENCE | NAME | NO. | SEQUENCE |
| delâL747- | EGFR | 10 | CGTâCGCâTATâCAAâ | EGFRâDEL | â1 | CCCâGTCâGCTâATCâ | EGFR | 15 | GAGâATGâAGC |
| T751âinsS | WTA | GGAâATTâAAGâAGAâ | 12 | AAGâGAâCCA | EX19â | AGGâGTCâTAG | |||
| AGC | REV | AGCâAGAâG | |||||||
| delâE746- | EGFR | 10 | CGTâCGCâTATâCAAâ | EGFRâDEL | â2 | TTAâAAAâTTCâCCGâ | EGFR | 15 | GAGâATGâAGC |
| A750 | WTA | GGAâATTâAAGâAGAâ | 15 | TCGâCTAâTCAâAAAâC | EX19â | AGGâGTCâTAG | |||
| AGC | REV | AGCâAGAâG | |||||||
| delâE746- | EGFR | 19 | FAMâCCGCGG | EGFRâDEL | 19 | CALâREDâCCGCGG | EGFR | 15 | GAGâATGâAGC |
| A750 | WTA | and | GATTTCCTTGTTGGCTTTCG | 15 | and | GATTTCCTTGTTGGCTT | EX19â | AGGâGTCâTAG | |
| Scorpions | Scorpion | 10 | CCGCGGâBHQ1âHEG | Scorpionsâ | â3 | TCGâCCGCGGâBHQ2 | REV | AGCâAGAâG | |
| CGTCGCTATCAAGGAATTAA | HEG | ||||||||
| GAGAAGC | TTAAAATTCCCGTCGCT | ||||||||
| ATCAAAAC | |||||||||
| delâL747- | EGFR | 11 | GAGâAGâCAâCATâ | EGFRâDEL | â4 | CCGâTCGâCTAâTCAâ | EGFR | 15 | GAGâATGâAGC |
| P753âinsS | WT | CTCâCGAâAAGâCC | 18 | AGGâAATâCGA | EX19â | AGGâGTCâTAG | |||
| REV | AGCâAGAâG | ||||||||
| delâS752- | EGFR | 11 | GAGâAGâCAâCATâ | EGFRâDEL | â5 | CAAâGGAâATTâAAGâ | EGFR | 15 | GAGâATGâAGC |
| 1759 | WT | CTCâCGAâAAGâCC | 24 | AGAâAGCâAACâACTâ | EX19â | AGGâGTCâTAG | |||
| CGA | REV | AGCâAGAâG | |||||||
| Exonâ21 | EGFR | 12 | CATâGTCâAAGâATCâ | EGFR | â6 | CATâGTCâAAGâATCâ | EGFR | 16 | GCTâGACâCTA |
| L858R | EX21 | ACAâGATâTTTâGGCâ | EX21 | ACAâGATâTTTâGGGâ | EX21 | AAGâCCAâCCT | |||
| L858R | CT | L858R | AG | L858R | CCTâTACâT | ||||
| WT | MUT | COM | |||||||
| Exonâ21 | EGFR | 20 | FAMâCCGCGG | EGFR | 20 | CALâREDâCCGCGG | EGFR | 16 | GCTâGACâCTA |
| L858R | EX21 | and | ATTCTTTCTCTTCCGCACCC | EX21 | and | ATTCTTTCTCTTCCGCA | EX21 | AAGâCCAâCCT | |
| Scorpions | L858R | 12 | CCGCGGâBHQ1âHEG | L858R | â6 | CCCâCCGCGGâBHQ2 | L858R | CCTâTACâT | |
| WT | CATGTCAAGATCACAGATTTT | MUT | HEG | COM | |||||
| Scorpion | GGCCT | Scorpions | CATGTCAAGATCACAGA | ||||||
| TTTTGGGAG | |||||||||
| Exonâ21 | EGFR | 13 | TTTâCTCâTTCâCGCâ | EGFR | â7 | TTTâCTCâTTCâCGCâ | EGFR | 17 | CTGâTTTâCAG |
| L861Q | EX21 | ACCâCACâCA | EX21 | ACCâCAGâAT | EX21 | GGCâATGâAAC | |||
| L861Q | L861Q | L861Q | TACâTTGâG | ||||||
| WT | MUT | COM | |||||||
| Exonâ18 | EGFR | 14 | CTGâAATâTCAâAAAâ | EGFR | â8 | CTGâAATâTCAâAAAâ | EGFR | 18 | CCTâTTGâGTCâ |
| G719C | EX18 | AGAâTCAâAAGâTGCâ | EX18 | AGAâTCAâAAGâTGCâ | EX18â | TGTâGAAâTTGâ | |||
| G719C | TCG | G719C | CGT | COM | GTCâTCAâC | ||||
| WT | MUT | ||||||||
| TABLEâ4 |
| AlleleâSpecificâprimersâ(2) |
| WILDâTYPEâPRIMERS | MUTANTâPRIMERS | COMMONâPRIMERS |
| SEQ | SEQ | SEQ | |||||||
| ID | ID | ID | |||||||
| Test | NAME | NO. | SEQUENCE | NAME | NO. | SEQUENCE | NAME | NO. | SEQUENCE |
| Exonâ | EGFR | 14 | CTGâAATâTCAâAAAâ | EGFR | â9 | CTGâAATâTCAâAAAâ | EGFR | 18 | CCTâTTGâGTCâ |
| 18 | EX18 | AGAâTCAâAAGâTGCâ | EX18 | AGAâTCAâAAGâTGCâ | EX18â | TGTâGAAâTTGâ | |||
| G719S | G719S | TCG | G719S | CGA | COM | GTCâTCAâC | |||
| WT | MUT | ||||||||
| EGFRâ | EGFR | 10 | CGTâCGCâTATâCAAâ | EGFRâ | 21 | TTAAAATTCCCGTCGC | EGFR | 15 | GAGâATGâAGC |
| del | WTA | GGAâATTâAAGâAGAâ | del | TATCAAGACA | EX19â | AGGâGTCâTAG | |||
| 15â2 | AGC | 15â2 | REV | AGCâAGAâG | |||||
| For | |||||||||
| EGFR | EGFR | 23 | ACCTCCACCGTGCAGCTCAT | EGFR | 22 | ACCTCCACCGTGCAGC | EGFR | 24 | ATGGCAAACTCTT |
| T790M | T790M | AAC | T790Mâ | TCATCCT | T790M | GCTATCCCAGGA | |||
| FC | FT | Reverse | |||||||
| EGFR | T790Mâ | 74 | TCCACCGTGCAGCTCATCTC | T790Mâ | 75 | TCCACCGTGCAGCTCA | EGFR | 76 | TTGTCTTTGTGTT |
| T790M | A | B | TCTT | T790M | CCCGGACAT | ||||
| Reverseâ | |||||||||
| II | |||||||||
| EGFR | T790Mâ | 74 | TCCACCGTGCAGCTCATCTC | T790Mâ | 75 | TCCACCGTGCAGCTCA | EGRR | 76â | FAM- |
| T790M | A | B | TCTT | T790M | and | CCGCGGCTCATG | |||
| Reverseâ | 77 | CCCTTCGGCTCC | |||||||
| II | GCGG-DABCYL- | ||||||||
| Scorpions | HEG- | ||||||||
| TTGTCTTTGTGTT | |||||||||
| CCCGGACAT-3Ⲡ| |||||||||
PCRs were performed in Real Time PCR cyclers (Mx4000 and Mx3000P from Stratagene), using standard conditions:
For SNP tests, the anneal/extend step was modified to 60° C., for 60 s.
The amount of DNA extracted from each tumour sample was measured by real time amplification of a control locus. Standard curves for this reaction were generated using known concentrations of high quality DNA extracted from cell lines (ECACC, Wiltshire, UK).
Sequencing was performed on amplicons generated from exon specific primers, by standard cycle sequencing, using big dye terminators. Reactions were separated using an ABI 3100 capillary sequencing instrument, according to the manufacturer's instructions.
ARMS tests specific for each of the deletions and SNPs were tested against:
Reactions included the fluorescent DNA binding dye YO-PRO-1 and were monitored in real time. In such reactions, the point at which amplification becomes visible above baseline (known as the Ct) is an indicator of the quantity of target.
Primers which are specific for the same mutations but on the complementary DNA strand have also been developed and these are shown in Tables 5 and 6.
| TABLEâ5 |
| AlleleâSpecificâprimersâforâReverseâStrandâ(I) |
| WILDâTYPEâPRIMERS | MUTANTâPRIMERS | COMMONâPRIMERS |
| SEQ | SEQ | SEQ | |||||||
| ID | ID | ID | |||||||
| Test | NAME | NO. | SEQUENCE | NAME | NO. | SEQUENCE | NAME | NO. | SEQUENCE |
| del | EGFR | 35 | GGCTTTCGGAGATGTTGCTTCTC | EGFR | 25 | CTTGTTGGCTTTCGGAGAT | EGFR | 41 | CTGGTAACATCCAC |
| L747- | WT | del | GGT | Exâ19 | CCAGATCACTG | ||||
| T751 | Rev | 12 | For | ||||||
| insS | del | rev | |||||||
| 15â+ | |||||||||
| 12 | |||||||||
| del | EGFR | 35 | GGCTTTCGGAGATGTTGCTTCTC | EGFR | 26 | TTGTTGGCTTTCGGAGATG | EGFR | 41 | CTGGTAACATCCAC |
| E746- | WT | del | TTTTG | Exâ19 | CCAGATCACTG | ||||
| A750 | Rev | 151 | For | ||||||
| del | rev | ||||||||
| 15â+ | |||||||||
| 12 | |||||||||
| del | EGFR | 36 | GCTTCTCTTAATTCCTTGATAGCG | EGFR | 27 | GGATTTCCTTGTTGGCTTTC | EGFR | 41 | CTGGTAACATCCAC |
| L747- | WT | ACG | del | GAT | Exâ19 | CCAGATCACTG | |||
| P753 | Rev | 18 | For | ||||||
| insS | 18â+ | rev | |||||||
| 24 | |||||||||
| del | EGFR | 36 | GCTTCTCTTAATTCCTTGATAGCG | EGFR | 28 | CAAAGCAGAAACTCACATC | EGFR | 41 | CTGGTAACATCCAC |
| S752- | WT | ACG | del | GAGTG | Exâ19 | CCAGATCACTG | |||
| 1759 | Rev | 24 | For | ||||||
| 18â+ | rev | ||||||||
| 24 | |||||||||
| Exon | EGFR | 37 | CTCTTCCGCACCCAGCAGTTTGG | EGFR | 29 | CTCTTCCGCACCCAGCAGT | EGFR | 42 | TTCCCATGATGATCT |
| 21 | L858R | TCA | L858R | TTGGCAC | L858R | GTCCCTCACAGCA | |||
| L858R | RT | RG | Forward | ||||||
| Exon | EGFR | 38 | ATCACAGATTTTGGGCTGGCCAA | EGFR | 30 | ATCACAGATTTTGGGCTGG | EGFR | 43 | GAGCTCACCCAGAA |
| 21 | L861Q | TCA | L861Q | CCAATAA | L861Q | TGTCTGGAGAGCAT | |||
| L861Q | FA | FT | Reverse | ||||||
| Exon | EGFR | 39 | TATACACCGTGCCGAACGCACCG | EGFR | 31 | TATACACCGTGCCGAACGC | G719 | 44 | GGGCTGAGGTGAC |
| 18 | G719 | GAGAC | G719C | ACCGGAACA | Forward | CCTTGTCTCTGTGTT | |||
| G719C | R | RT | |||||||
| WT | |||||||||
| Exon | EGFR | 39 | TATACACCGTGCCGAACGCACCG | EGFR | 32 | TATACACCGTGCCGAACGC | G719 | 44 | GGGCTGAGGTGAC |
| 18 | G719 | GAGAC | G719S | ACCGGATCT | Forward | CCTTGTCTCTGTGTT | |||
| G719S | R | RA | |||||||
| WT | |||||||||
| EGFR | EGFR | 35 | GGCTTTCGGAGATGTTGCTTCTC | EGFR | 33 | TTGTTGGCTTTCGGAGATG | EGFR | 41 | CTGGTAACATCCAC |
| del | WT | del | TCT | Exâ19 | CCAGATCACTG | ||||
| 15â2 | Rev | 15â2 | For | ||||||
| Reverse | del | rev | |||||||
| 15â+ | |||||||||
| 12 | |||||||||
| TABLEâ6 |
| AlleleâSpecificâprimersâforâReverseâStrandâ(II) |
| WILDâTYPEâPRIMERS | MUTANTâPRIMERS | COMMONâPRIMERS |
| SEQ | SEQ | SEQ | |||||||
| ID | ID | ID | |||||||
| Test | NAME | NO | SEQUENCE | NAME | NO. | SEQUENCE | NAME | NO. | SEQUENCE |
| EGFR | EGFR | 40 | AGCCGAAGGGCATGAGCTTCA | EGFR | 34 | AGCCGAAGGGCATGAGCTG | EGFR | 45 | GCACAGCTTTTCCT |
| T790M | T790M | T790M | AG | T790M | CCATGAGTACG | ||||
| Reverse | RT | RT | Forward | ||||||
| WT | |||||||||
The mutation specific primer EGFR Del 12 was tested against matched synthetic target and three mismatched mutant synthetic targets (del 15 (1), del 18 and del 24), as well as normal DNA and a water control. The results are shown in FIG. 1.
It is clear that in this reaction the primer shows absolute specificity for its own target and does not detect wild type sequences nor any of the other deletion mutations found in the same genomic region.
Forty-two DNA samples from Non-Small Cell Lung Cancers and cell lines were analysed using each of the mutation specific primers SEQ. ID NOS: 1 to 9. Tumour DNA had been extracted from paraffin embedded tissue on slides.
A number of samples were found to be positive using this method: nine for the L858R SNP and one for the 15 base pair deletion del E746-A750.
Confirmatory sequencing was performed for the region surrounding the putative mutations.
FIG. 2 shows a typical negative result for a batch of 8 samples tested with the del S752-1759 specific primers. It is clear that the wild type specific reactions perform efficiently while the mutation specific primers (SEQ. ID NO: 5) do not amplify indicating the absence of this mutation in these samples.
FIG. 3 shows the L858R analysis for 8 positive samples. In each case, the reaction using the mutation primers (SEQ. ID NO: 6) is positive as is the wild type reaction. The fact that the mutant reaction appears several cycles later than the corresponding wild type reaction indicates that the mutation is not the majority sequence in the samples.
FIG. 4 shows more detailed analysis of the allele specific PCR analysis, combined with sequencing of the same exon from this sample. In this sample, the sequencing approach would have failed to detect the mutation that was clearly identified by the ARMS approach (no peak is visible at the circled position).
FIG. 5 shows more detailed analysis of the allele specific PCR analysis, combined with sequencing of the same exon from this sample. In this sample, the sequencing approach could have detected the mutation that was clearly identified by the ARMS approach (a very weak peak is visible at the circled position). The differential (ÎCt) between the wild type and mutant specific reactions was smaller in this sample, indicating that the mutation was relatively more prevalent than in the sample whose analysis is shown in FIG. 4.
FIG. 6 shows the results of PCR amplification of samples containing DNA with, and without the T790M mutation. Five DNA samples were provided, each comprising 0%, 1%, 10%, 50% or 100% DNA with the T790M mutation. The samples were amplified using the mutant primer of SEQ. ID NO. 75 and the reverse Scorpion primer of SEQ. ID NOS. 76 and 77. The results show that the mutant primer was specific for DNA having the T780M mutation because the sample without any DNA having the mutation showed no amplification. Furthermore, detection was shown to be quantitative in that the Ct (threshold cycle) was related directly to the relative amount of matched target, even in the presence of excess unmatched target.
FIG. 7 shows the results of a control assay carried out on the samples which were tested and reported in FIG. 6. PCR amplification was carried out using control primers. FIG. 7 confirms that each sample had the same total amount of target since the threshold cycles for each sample were the same in this control amplification.
1. A polynucleotide comprising at least the final six nucleotides of one of the following primer sequences, or a sequence complementary thereto: SEQ. ID NOS. 1 to 18, 21 to 45 or 74 to 77.
2. A polynucleotide according to claim 1 wherein the polynucleotide is less than 100 nucleotides long, preferably less than 80 nucleotides long, more preferably less than 60 nucleotides long, more preferably less than 40 nucleotides, more preferably less than 30 nucleotides long.
3. A polynucleotide according to claim 1 comprising at least 75% of the final 8, 10, 12, 14, 16, 17, 18 or 20 nucleotides, or the entirety of one of the following primer sequences, or a sequence complementary thereto: SEQ. ID NOS. 1 to 18, 21 to 45 or 74 to 77.
4. A polynucleotide according to claim 1 further comprising a quencher group and a fluorophore group.
5. A polynucleotide according to claim 4 wherein the quencher group and the fluorophore group are separated by a nucleotide tail sequence comprising first and second regions, the nucleotides of the first region being complementary to but in reverse order from the nucleotides of the second region, such that hybridisation of the first region to the second group results in the quencher group to be sufficiently close to the fluorophore group to quench the fluorophore group.
6. A polynucleotide according to claim 5 wherein the tail sequence further comprises a third region having a sequence complementary to a region of the EGFR gene.
7. A polynucleotide according to claim 6 comprising at least the final six nucleotides of SEQ. ID NO. 3 or 10 and the tail sequence comprises SEQ. ID NO. 19.
8. A polynucleotide according to claim 6 comprising at least the final six nucleotides of SEQ. ID NOS. 6 or 12 and the tail sequence comprises SEQ. ID NO. 20.
9. A polynucleotide according to claim 6 comprising at least the final six nucleotides of SEQ. ID NO. 76 and the tail sequence comprises SEQ. ID NO. 77.
10. A polynucleotide according to claim 4 wherein the quencher group comprises black hole quencher 1 (BHQ1) and the fluorophore group comprises FAM.
11. A polynucleotide according to claim 4 wherein the quencher group comprises black hole quencher 2 (BHQ2) and the fluorophore comprises Cal Red.
12. A kit comprising at least a pair of polynucleotides wherein the pair of polynucleotides comprises at least four or five of the final six nucleotides of one of the following pairs of primer sequences, respectively, or sequences complementary thereto: SEQ. ID NO. 1 and SEQ. ID NO. 15, or SEQ. ID NO. 2 and SEQ. ID NO 15, or SEQ. ID NO. 3 and SEQ. ID NO. 15, or SEQ. ID NO. 4 and SEQ. ID NO. 15, or SEQ. ID NO. 5 and SEQ. ID NO. 15, or SEQ. ID NO. 6 and SEQ. ID NO. 16, or SEQ. ID NO. 7 and SEQ. ID NO. 17, or SEQ. ID NO. 8 and SEQ. ID NO. 18, or SEQ. ID NO. 9 and SEQ. ID NO. 18, or SEQ. ID NO. 10 and SEQ. ID NO. 15, or SEQ. ID NO. 11 and SEQ. ID NO. 15 or SEQ. ID NO. 12 and SEQ. ID NO. 16, or SEQ. ID NO. 13 and SEQ. ID NO. 17, or SEQ. ID NO. 14 and SEQ. ID NO. 18 or SEQ. ID NO. 21 and SEQ. ID NO. 15, or SEQ. ID NO. 22 and SEQ. ID NO. 24, or SEQ. ID NO. 23 and SEQ. ID NO. 24, or SEQ. ID NO. 25 and SEQ. ID NO. 41, or SEQ. ID NO. 26 and SEQ. ID NO. 41, or SEQ. ID NO. 27 and SEQ. ID NO. 41, or SEQ. ID NO. 28 and SEQ. ID NO. 41, or SEQ. ID NO. 29 and SEQ. ID NO. 42, or SEQ. ID NO. 30 and SEQ. ID NO. 43, or SEQ. ID NO. 31 and SEQ. ID NO. 44, or SEQ. ID NO. 32 and SEQ. ID NO. 44, or SEQ. ID NO. 33 and SEQ. ID NO. 41, or SEQ. ID NO. 34 and SEQ. ID NO. 45, or SEQ. ID NO. 35 and SEQ. ID NO. 41, or SEQ. ID NO. 36 and SEQ. ID NO. 41, or SEQ. ID NO. 37 and SEQ. ID NO. 42, or SEQ. ID NO. 38 and SEQ. ID NO. 43, or SEQ. ID NO. 39 and SEQ. ID NO. 44, or SEQ. ID NO. 40 and SEQ. ID NO. 45, or SEQ. ID NO. 74 and SEQ. ID NO. 76 or SEQ. ID NO. 75 and SEQ. ID NO. 76.
13. A kit according to claim 12 wherein the pair of polynucleotides are each polynucleotides comprising at least the final six nucleotides of one of the following primer sequences, or a sequence complementary thereto: SEQ. ID NOS. 1 to 18, 21 to 45 or 74 to 77.
14. A kit comprising at least a set of three polynucleotides, wherein the set of three polynucleotides comprises at least four or five of the final six nucleotides of one of the following sets of three primer sequences, respectively, or sequences complementary thereto: SEQ. ID NOS. 1, 10 and 15, or SEQ. ID NOS. 2, 10 and 15, or SEQ. ID NOS. 3, 10 and 15, or SEQ. ID NOS. 4, 11 and 15, or SEQ. ID NOS. 5, 11 and 15, or SEQ. ID NOS. 6, 12 and 16, or SEQ. ID NOS. 7, 13 and 17, or SEQ. ID NOS. 8, 14 and 18, or SEQ. ID NOS. 9, 14 and 18 or SEQ. ID NOS. 21, 10 and 15, or SEQ. ID NOS. 22, 23 and 24, or SEQ. ID NOS. 25, 35 and 41, or SEQ. ID NOS. 26, 35 and 41, or SEQ. ID NOS. 27, 36 and 41, or SEQ. ID NOS. 28, 36 and 41, or SEQ. ID NOS. 29, 32 and 42, or SEQ. ID NOS. 30, 38 and 43, or SEQ. ID NOS. 31, 39 and 44, or SEQ. ID NOS. 32, 39 and 44, or SEQ. ID NOS. 33, 35 and 41, or SEQ. ID NOS. 34, 40 and 45, SEQ. ID NOS. 74, 75 and 76.
15. A kit according to claim 14 wherein the set of three polynucleotides are each polynucleotides comprising at least the final six nucleotides of one of the following primer sequences, or a sequence complementary thereto: SEQ. ID NOS. 1 to 18, 21 to 45 or 74 to 77.
16. A kit according to claim 12 further comprising nucleotide triphosphates, a polymerisation enzyme and/or a buffer solution.
17. A method of detecting the presence or absence of a mutation in the EGFR gene comprising the steps of:
a) mixing a nucleic acid sample comprising at least a fragment of the EGFR gene with a polynucleotide complementary to a region of the fragment of the EGFR gene; and
b) detecting hybridisation of the polynucleotide to the nucleic acid sample wherein hybridisation indicates the presence or absence of a mutation.
18. A method according to claim 17 wherein the polynucleotide is a polynucleotide comprising at least the final six nucleotides of one of the following primer sequences, or a sequence complementary thereto: SEQ. ID NOS. 1 to 18, 21 to 45 or 74 to 77 and comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 1 to 9, 21, 22, 25 to 34 or 75 or sequences complementary thereto and step b) indicates the presence of a mutation.
19. A method according to claim 17 wherein the polynucleotide is a polynucleotide comprising at least the final six nucleotides of one of the following primer sequences, or a sequence complementary thereto: SEQ. ID NOS. 1 to 18, 21 to 45 or 74 to 77 and comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 10 to 14, 23, 35 to 40 or 74 or sequences complementary thereto; and step b) indicates the absence of a mutation.
20. A method according to claim 17 further comprising the step of, prior to step a), amplifying the number of copies of the fragment of the EGFR gene using thermal cycling nucleic acid amplification, preferably PCR.
21. A method according to claim 17, wherein step b) comprises carrying out DNA polymerisation using the polynucleotide as a first primer and detecting the extension product of polymerisation.
22. A method according to claim 20 wherein step b) comprises the step of mixing the nucleic acid sample and the polynucleotide with a second primer which corresponds to a region of the fragment of the EGFR sequence downstream of the region to which the polynucleotide is complementary and carrying out PCR on the mixture.
23. A method according to claim 22 wherein the second primer comprises: SEQ. ID NO. 15 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 1 to 5, 10, 11 or 21; SEQ. ID NO. 16 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 6 or 12; SEQ. ID NO. 17 and the polynucleotide comprises at least for or five of the final six nucleotides of SEQ. ID NOS. 7 or 13; SEQ. ID NO. 18 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 8, 9 or 14; SEQ. ID NO. 24 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS: 22 or 23; SEQ. ID NO. 41 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 25 to 28, 33, 35 or 36; SEQ. ID NO. 42 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 29 or 37; SEQ. ID NO. 43 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 30 to 38; SEQ. ID NO. 44 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 31, 32 or 39; SEQ. ID NO. 45 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 34 or 40; or SEQ. ID NO. 76 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NO. 74 or 75.
24. A method according to claim 21 wherein step b) comprises the step of mixing the nucleic acid sample and the polynucleotide with a second primer which corresponds to a region of the fragment of the EGFR sequence downstream of the region to which the polynucleotide is complementary and carrying out PCR on the mixture.
25. A method according to claim 24 wherein the second primer comprises: SEQ. ID NO. 15 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 1 to 5, 10, 11 or 21; SEQ. ID NO. 16 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 6 or 12; SEQ. ID NO. 17 and the polynucleotide comprises at least for or five of the final six nucleotides of SEQ. ID NOS. 7 or 13; SEQ. ID NO. 18 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 8, 9 or 14; SEQ. ID NO. 24 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS: 22 or 23; SEQ. ID NO. 41 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 25 to 28, 33, 35 or 36; SEQ. ID NO. 42 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 29 or 37; SEQ. ID NO. 43 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 30 to 38; SEQ. ID NO. 44 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 31, 32 or 39; SEQ. ID NO. 45 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NOS. 34 or 40; or SEQ. ID NO. 76 and the polynucleotide comprises at least four or five of the final six nucleotides of SEQ. ID NO. 74 or 75.
26. A method according to claim 21 wherein step a) comprises the step of mixing the nucleic acid sample with a pair of a mutation specific polynucleotide and a wild-type specific polynucleotide, the pair being selected from at least four or five of the final six sequences of: SEQ. ID NO: 1 and SEQ. ID NO: 10; SEQ. ID NO: 2 and SEQ. ID NO: 10; SEQ. ID NO: 3 and SEQ. ID NO: 10; SEQ. ID NO: 4 and SEQ. ID NO: 11; SEQ. ID NO: 5 and SEQ. ID NO: 11; SEQ. ID NO: 6 and SEQ. ID NO: 12; SEQ. ID NO: 7 and SEQ. ID NO: 13; SEQ. ID NO: 8 and SEQ. ID NO: 14; SEQ. ID NO: 9 and SEQ. ID NO: 14; SEQ. ID NO: 21 and SEQ. ID NO: 10; SEQ. ID NO: 22 and SEQ. ID NO: 23; SEQ. ID NO: 25 and SEQ. ID NO: 35; SEQ. ID NO: 26 and SEQ. ID NO: 35; SEQ. ID NO: 27 and SEQ. ID NO: 36; SEQ. ID NO: 28 and SEQ. ID NO: 36; SEQ. ID NO: 29 and SEQ. ID NO: 37; SEQ. ID NO: 30 and SEQ. ID NO: 38; SEQ. ID NO: 31 and SEQ. ID NO: 39; SEQ. ID NO: 32 and SEQ. ID NO: 39; SEQ. ID NO: 33 and SEQ. ID NO: 35; SEQ. ID NO: 34 and SEQ. ID NO: 40; or SEQ. ID NO. 74 and SEQ. ID NO. 75.
27. A method according to claim 26 wherein the nucleic acid sample comprises wild-type sequences and mutated sequences and further comprising step c) wherein the number of amplification cycles required to amplify the wild-type sequences to a predetermined quantity is compared with the number of amplification cycles required to amplify the mutated sequences to the predetermined quantity thereby providing an indication of the ratio of the wild type sequences to mutated sequences in the sample.
28. A method according to claim 27 wherein the nucleic acid sample comprises a portion of tumourous tissue and a portion of non-tumourous tissue and wherein step c) further comprises the step determining the ratio of tumourous tissue to non-tumourous tissue in the sample.
29. A method according to claim 27 further comprising the step of, prior to step a), enriching the nucleic acid sample to increase the ratio of tumourous tissue to non-tumourous tissue in the sample.
30. A method according to claim 28 further comprising the step of, prior to step a), enriching the nucleic acid sample to increase the ratio of tumourous tissue to non-tumourous tissue in the sample.
31. A method according to claim 22 wherein step b) comprises detecting if amplification of at least a portion of the EGFR gene occurs.
32. A method according to claim 17 wherein the polynucleotide comprise a quencher group and a fluorophore group and wherein step b) comprises exposing the mixture to light of a wavelength to which the fluorophore is responsive in the absence of the quencher group and detecting light at the wavelength emitted by the fluorophore group in the absence of the quencher group.