US20140041067A1
2014-02-06
14/052,259
2013-10-11
The invention relates to the provision of antibody therapeutics and prophylactics that are tailored specifically for human use. The present invention provides libraries, vertebrates and cells, such as transgenic mice or rats or transgenic mouse or rat cells. Furthermore, the invention relates to methods of using the vertebrates to isolate antibodies or nucleotide sequences encoding antibodies. Antibodies, heavy chains, polypeptides, nucleotide sequences, pharmaceutical compositions and uses are also provided by the invention.
Get notified when new applications in this technology area are published.
A01K67/0278 » CPC main
Rearing or breeding animals, not otherwise provided for; New breeds of animals; New breeds of vertebrates; Genetically modified vertebrates, e.g. transgenic Humanized animals, e.g. knockin
A01K67/027 IPC
Rearing or breeding animals, not otherwise provided for; New breeds of animals New breeds of vertebrates
This is a Continuation Application of PCT/GB2012/052296 filed Sep. 18, 2012, which claims priority to GB 1116122.1 filed Sep. 19, 2011, GB 1116120.5 filed Sep. 19, 2011, GB 1203257.9 filed Feb. 24, 2012, GB 1204592.8 filed Mar. 15, 2012, GB 1205702.2 filed Mar. 29, 2012, GB 1208749.0 filed May 18, 2012 and GB 1211692.7 filed Jul. 2, 2012, all of which are hereby incorporated by reference.
The present invention relates to the provision of antibody therapeutics and prophylactics that are tailored specifically for human use.
The present invention provides libraries, vertebrates and cells, such as transgenic mice or rats or transgenic mouse or rat cells. Furthermore, the invention relates to methods of using the vertebrates to isolate antibodies or nucleotide sequences encoding antibodies. Antibodies, heavy chains, polypeptides, nucleotide sequences, pharmaceutical compositions and uses are also provided by the invention.
The state of the art provides non-human vertebrates (e.g., mice and rats) and cells comprising transgenic immunoglobulin loci, such loci comprising human variable (V), diversity (D) and/or joining (J) segments, and optionally human constant regions. Alternatively, endogenous constant regions of the host vertebrate (e.g., mouse or rat constant regions) are provided in the transgenic loci. Methods of constructing such transgenic vertebrates and use of these to generate antibodies and nucleic acids thereof following antigen immunisation are known in the art, e.g., see U.S. Pat. No. 7,501,552 (Medarex), U.S. Pat. No. 5,939,598 (Abgenix), U.S. Pat. No. 6,130,364 (Abgenix), WO02/066630 (Regeneron), WO2011004192 (Genome Research Limited), WO2009076464, WO2009143472 and WO2010039900 (Ablexis), the disclosures of which are explicitly incorporated herein. Such transgenic loci in the art include varying amounts of the human V(D) J repertoire. Existing transgenic immunoglobulin loci are based on a single human DNA source. The potential diversity of human antibody variable regions in non-human vertebrates bearing such transgenic loci is thus confined.
The inventors considered that it would be desirable to tailor the genomes of these transgenic non-human vertebrates (and thus antibody and antibody chain products of these) to address the variability—and commonality—in the natural antibody gene usage of humans. The inventors wanted to do this in order to better address human use of antibody-based therapeutic and prophylactic drugs.
It would be desirable also to provide for novel and potentially expanded repertoire and diversity of human variable regions in transgenic immunoglobulin loci and non-human vertebrates harbouring these, as well as in antibodies produced following immunisation of such animals.
The present invention has been developed from extensive bioinformatics analysis of natural antibody gene segment distributions across a myriad of different human populations and across more than two thousand samples from human individuals. The inventors have undertaken this huge task to more thoroughly understand and design non-human vertebrate systems and resultant antibodies to better address human medical therapeutics as a whole, as well as to enable rational design to address specific ethnic populations of humans. Using such rational design, the inventors have constructed transgenic non-human vertebrates and isolated antibodies, antibody chains and cells expressing these in a way that yields products that utilise gene segments that have been purposely included on the basis of the human bioinformatics analysis. The examples illustrate worked experiments where the inventors isolated many cells and antibodies to this effect.
The invention also relates to synthetically-extended & ethnically-diverse superhuman immunoglobulin gene repertoires. The present invention thus provides for novel and potentially expanded synthetic immunoglobulin diversities, thus providing a pool of diversity from which human antibody therapeutic leads can be selected. This expanded pool is useful when seeking to find antibodies with desirable characteristics, such as relatively high affinity to target antigen without the need for further affinity maturation (e.g., using laborious in vitro techniques such as phage or ribosome display), or improved biophysical characteristics, or to address targets and new epitopes that have previously been difficult to address with antibodies are not reached by prior antibody binding sites.
The invention also provides for diversity that is potentially biased towards variable gene usage common to members of a specific human population, which is useful for generating antibodies for treating and/or preventing diseases or conditions within such population. This ability to bias the antibody repertoire allows one to tailor antibody therapeutics with the aim of more effectively treating and/or preventing disease or medical conditions in specific human populations.
The present inventors realised the possibility of providing immunoglobulin gene segments from disparate sources in transgenic loci, in order to provide for novel and potentially-expanded antibody diversities from which antibody therapeutics (and antibody tool reagents) could be generated. This—opens up the potential of transgenic human-mouse/rat technologies to the possibility of interrogating different and possibly larger antibody sequence-spaces than has hitherto been possible.
In rationally designing transgenic antibody loci, as well as antibodies and antibody chains, the inventors also realised that a relatively long HCDR3 length (at least 20 amino acids) is often desirable to address epitopes. For example, naturally-occurring antibodies have been isolated from humans infected with infectious disease pathogens, such antibodies having a long HCDR3 length. Neutralizing antibodies have been found in this respect. A long HCDR3 length would be desirable to address other antigens (e.g., receptor clefts or enzyme active sites), not just limited to infectious disease pathogens, and thus the inventors realised the general desirability of the possibility of engineering transgenic loci to be able to produce long HCDR3 antibodies and heavy chains. The inventors, through laborious execution of bioinformatics on in excess of 2000 human DNA samples via the 1000 Genomes project together with rational sequence choices, identified that the inclusion of the specific human gene segment variant JH6*02 is desirable for producing long HCDR3 antibodies and chains.
Additional rational design and bioinformatics has led the inventors to realise that specific human constant region variants are conserved across many diverse human populations. The inventors realised that this opens up the possibility of making a choice to humanize antibodies, chains and variable domains by using such specific constant regions in products, rather than arbitrarily choosing the human constant region (or a synthetic version of a human constant region). This aspect of the invention also enables one to tailor antibody-based drugs to specific human ethnic populations, thereby more closely matching drug to patient (and thus disease setting) than has hitherto been performed. It can be a problem in the state of the art that antibodies are humanized with an arbitrary choice of human constant region (presumably derived from one (often unknown) ethnic population or non-naturally occurring) that does not function as well in patients of a different human ethnic population. This is important, since the constant region has the major role in providing antibody effector functions, e.g., for antibody recycling, cellular and complement recruitment and for cell killing.
To this end, in a first configuration of the invention, there is provided
A non-human vertebrate or vertebrate cell (optionally an ES cell or antibody-producing cell) comprising a genome having a superhuman immunoglobulin heavy chain human VH and/or D and/or J gene repertoire.
A non-human vertebrate or vertebrate cell (optionally an ES cell or antibody-producing cell) comprising a genome having a superhuman immunoglobulin light chain human VL gene repertoire; optionally wherein the vertebrate or cell is according to the first configuration.
A non-human vertebrate or vertebrate cell (optionally an ES cell or antibody-producing cell) whose genome comprises a transgenic immunoglobulin locus (e.g., a heavy chain locus or a light chain locus), said locus comprising immunoglobulin gene segments according to the first and second human immunoglobulin gene segments (optionally V segments) as mentioned below operably connected upstream of an immunoglobulin constant region; optionally wherein the genome is homozygous for said transgenic immunoglobulin locus;
optionally wherein the immunoglobulin locus comprises more than the natural human complement of functional V gene segments; and/or
optionally wherein the immunoglobulin locus comprises more than the natural human complement of functional D gene segments; and/or
optionally wherein the immunoglobulin locus comprises more than the natural human complement of functional J gene segments.
A transgenic non-human vertebrate (e.g., a mouse or rat) or vertebrate cell (optionally an ES cell or antibody-producing cell) whose genome comprises a transgenic immunoglobulin locus comprising a plurality of human immunoglobulin gene segments operably connected upstream of a non-human vertebrate constant region for the production of a repertoire of chimaeric antibodies, or chimaeric light or heavy chains, having a non-human vertebrate constant region and a human variable region; wherein the transgenic locus comprises one or more human immunoglobulin V gene segments, one or more human J gene segments and optionally one or more human D gene segments, a first (optionally a V segment) of said gene segments and a second (optionally a V segment) of said gene segments being different and derived from the genomes of first and second human individuals respectively, wherein the individuals are different; and optionally not related; optionally wherein the immunoglobulin locus comprises more than the natural human complement of functional V gene segments; and/or
optionally wherein the immunoglobulin locus comprises more than the natural human complement of functional D gene segments; and/or
optionally wherein the immunoglobulin locus comprises more than the natural human complement of functional J gene segments.
A transgenic non-human vertebrate (e.g., a mouse or rat) or vertebrate cell (optionally an ES cell or antibody-producing cell) whose genome comprises first and second transgenic immunoglobulin loci, each locus comprising a plurality of human immunoglobulin gene segments operably connected upstream of a non-human vertebrate constant region for the production of a repertoire of chimaeric antibodies, or chimaeric light or heavy chains, having a non-human vertebrate constant region and a human variable region;
wherein (i) the first transgenic locus comprises one or more human immunoglobulin V gene segments, one or more human J gene segments and optionally one or more human D gene segments, (ii) the second transgenic locus comprises one or more human immunoglobulin V gene segments, one or more human J gene segments and optionally one or more human D gene segments; and (iii) wherein a first (optionally a V) gene segment of said first locus and a second (optionally a V) gene segment of said second gene locus are different and derived from the genomes of first and second human individuals respectively, wherein the individuals are different; and optionally not related;
optionally wherein the first and second loci are on different chromosomes (optionally chromosomes with the same chromosome number) in said genome;
optionally wherein each immunoglobulin locus comprises more than the natural human complement of functional V gene segments; and/or
optionally wherein each immunoglobulin locus comprises more than the natural human complement of functional D gene segments; and/or
optionally wherein each immunoglobulin locus comprises more than the natural human complement of functional J gene segments.
A method of constructing a cell (e.g., an ES cell) according to the invention, the method comprising
In one embodiment, the gene segment(s) in step (b) are identified from an immunoglobulin gene database selected from the 1000 Genomes, Ensembl, Genbank and IMGT databases.
Throughout this text, Genbank is a reference to Genbank release number 185.0 or 191.0; the 1000 Genomes database is Phase 1, release v3, 16 Mar. 2012; the Ensembl database is assembly GRCh37.p8 (Oct. 4, 2012); the IMGT database is available at www.imgt.org.
In one embodiment, the first and second human individuals are members of first and second ethnic populations respectively, wherein the populations are different, optionally wherein the human immunoglobulin gene segment derived from the genome sequence of the second individual is low-frequency (optionally rare) within the second ethnic population.
This configuration of the invention also provides a method of making a transgenic non-human vertebrate (e.g., a mouse or rat), the method comprising
In one embodiment, the invention provides a method of isolating an antibody that binds a predetermined antigen (e.g., a bacterial or viral pathogen antigen), the method comprising immunizing a non-human vertebrate according to the invention.
A library of antibody-producing transgenic cells whose genomes collectively encode a repertoire of antibodies, wherein
In one embodiment, the first and second human individuals are members of first and second ethnic populations respectively, wherein the populations are different; optionally wherein the ethnic populations are selected from those identified in the 1000 Genomes database.
In another embodiment, the second human immunoglobulin gene segment is a polymorphic variant of the first human immunoglobulin gene segment; optionally wherein the second gene segment is selected from the group consisting of a gene segment in any of Tables 1 to 7 and 9 to 14 below (e.g., selected from Table 13 or Table 14), e.g., the second gene segment is a polymorphic variant of VH1-69.
Third Configuration An isolated antibody having
The invention also provides an isolated nucleotide sequence encoding the antibody, optionally wherein the sequence is provided in an antibody expression vector, optionally in a host cell.
The invention also provides a method of producing a human antibody, the method comprising replacing the non-human vertebrate constant regions of the antibody of the third configuration with human antibody constant regions.
The invention also provides a pharmaceutical composition comprising an antibody according to the third configuration, or an antibody produced according to the method above and a diluent, excipient or carrier; optionally wherein the composition is provided in a container connected to an IV needle or syringe or in an IV bag.
The invention also provides an antibody-producing cell that expresses the second antibody recited in any one of the configurations.
In an alternative configuration, the invention contemplates the combination of nucleotide sequences of first and second immunoglobulin gene segments (e.g., two or more polymorphic variants of a particular human germline VH or VL gene segment) to provide a synthetic gene segment. Such synthetic gene segment is used, in one embodiment, to build a transgenic immunoglobulin locus, wherein the synthetic gene segment is provided in combination with one or more human variable and J regions (and optionally one or more human D regions) operably connected upstream of a constant region. When provided in the genome of a non-human vertebrate or cell (e.g., mouse or rat cell, e.g., ES cell), the invention provides for superhuman gene segment diversity. The sequences to be combined can be selected from gene segments that have been observed to be commonly used in human antibodies raised against a particular antigen (e.g., a flu antigen, such as haemaglutinin). By combining the sequences, the synthetic gene segment may recombine in vivo to produce an antibody that is well suited to the treatment and/or prevention of a disease or condition (e.g., influenza) mediated by said antigen.
A non-human vertebrate (optionally a mouse or a rat) or vertebrate cell whose genome comprises an immunoglobulin heavy chain locus comprising human gene segment JH6*02, one or more VH gene segments and one or more D gene segments upstream of a constant region; wherein the gene segments in the heavy chain locus are operably linked to the constant region thereof so that the mouse is capable of producing an antibody heavy chain produced by recombination of the human JH6*02 with a D segment and a VH segment.
A non-human vertebrate cell (optionally a mouse cell or a rat cell) whose genome comprises an immunoglobulin heavy chain locus comprising human gene segment JH6*02, one or more VH gene segments and one or more D gene segments upstream of a constant region; wherein the gene segments in the heavy chain locus are operably linked to the constant region thereof for producing (e.g., in a subsequent progeny cell) an antibody heavy chain produced by recombination of the human JH6*02 with a D segment and a VH segment.
A heavy chain (e.g., comprised by an antibody) isolated from a vertebrate of the invention wherein the heavy chain comprises a HCDR3 of at least 20 amino acids.
A method for producing a heavy chain, VH domain or an antibody specific to a target antigen, the method comprising immunizing a non-human vertebrate according to the invention with the antigen and isolating the heavy chain, VH domain or an antibody specific to a target antigen or a cell producing the heavy chain, VH domain or an antibody, wherein the heavy chain, VH domain or an antibody comprises a HCDR3 that is derived from the recombination of human JH6*02 with a VH gene segment and a D gene segment.
A heavy chain, VH domain or an antibody produced by the method.
A B-cell or hybridoma expressing a heavy chain VH domain that is identical to the VH domain of the heavy chain.
A nucleic acid encoding the VH domain of the heavy chain of claim 22, 23 or 28, or encoding the heavy chain.
A vector (e.g., a CHO cell or HEK293 cell vector) comprising the nucleic acid; optionally wherein the vector is in a host cell (e.g., a CHO cell or HEK293 cell).
A pharmaceutical composition comprising the antibody, heavy chain or VH domain (e.g., comprised by an antibody), together with a pharmaceutically-acceptable excipient, diluent or a medicament (e.g., a further antigen-specific variable domain, heavy chain or antibody).
The antibody, heavy chain or VH domain (e.g., comprised by an antibody) as above for use in medicine.
The use of an antibody, heavy chain or VH domain (e.g., comprised by an antibody) as above in the manufacture of a medicament for treating and/or preventing a medical condition in a human.
A method of producing an antibody heavy chain, the method comprising
An antibody comprising a human heavy chain, the heavy chain comprising a variable domain that is specific for an antigen and a constant region that is an IGHG1 ref, IGHG2ref, IGHG2a, IGHG3ref, IGHG3a, IGHG3b, IGHG4ref or IGHG4a constant region. Optionally, the variable domain comprises mouse-pattern AID somatic mutations.
A polypeptide comprising (in N- to C-terminal direction) a leader sequence, a human variable domain that is specific for an antigen and a human constant region that is an IGHG1 ref, IGHG2ref, IGHG2a, IGHG3ref, IGHG3a, IGHG3b, IGHG4ref or IGHG4a constant region wherein (i) the leader sequence is not the native human variable domain leader sequence; and/or (ii) the variable domain comprises mouse AID-pattern somatic mutations and/or mouse Terminal deoxynucleotidyl transferase (TdT)-pattern junctional mutations.
A nucleotide sequence encoding (in 5′ to 3′ direction) a leader sequence and a human antibody heavy chain, the heavy chain comprising a variable domain that is specific for an antigen and a constant region that is an IGHG1ref, IGHG2ref, IGHG2a, IGHG3ref, IGHG3a, IGHG3b, IGHG4ref or IGHG4a constant region; and the leader sequence being operable for expression of the heavy chain and wherein the leader sequence is not the native human variable domain leader sequence.
A nucleotide sequence encoding (in 5′ to 3′ direction) a promoter and a human antibody heavy chain, the heavy chain comprising a variable domain that is specific for an antigen and a constant region that is an IGHG1ref, IGHG2ref, IGHG2a, IGHG3ref, IGHG3a, IGHG3b, IGHG4ref or IGHG4a constant region; and the promoter being operable for expression of the heavy chain and wherein the promoter is not the native human promoter.
A vector (e.g., a CHO cell or HEK293 cell vector) comprising a IGHG1ref, IGHG2ref, IGHG2a, IGHG3ref, IGHG3a, IGHG3b, IGHG4ref or IGHG4a constant region nucleotide sequence that is 3′ of a cloning site for the insertion of a human antibody heavy chain variable domain nucleotide sequence, such that upon insertion of such a variable domain sequence the vector comprises (in 5′ to 3′ direction) a promoter, a leader sequence, the variable domain sequence and the constant region sequence so that the vector is capable of expressing a human antibody heavy chain when present in a host cell.
A non-human vertebrate (e.g., a mouse or rat) or a non-human vertebrate cell (e.g., an ES cell or a B-cell) having a genome comprising at least 3 human variable region gene segments of the same type (e.g., at least 3 human VH6-1 gene segments, at least 3 human JH6 gene segments, at least 3 human VK1-39 gene segments, at least 3 human D2-2 gene segments or at least 3 human JK1 gene segments), wherein at least two of the human gene segments are variants that are not identical to each other.
A non-human vertebrate (e.g., a mouse or rat) or a non-human vertebrate cell (e.g., an ES cell or a B-cell) having a genome comprising at least 2 different non-endogenous variable region gene segments of the same type (e.g., at least 2 human VH6-1 gene segments, at least 3 human JH6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JK1 gene segments) cis at the same Ig locus.
A non-human vertebrate (e.g., a mouse or rat) or a non-human vertebrate cell (e.g., an ES cell or a B-cell) having a genome comprising at least 2 different human variable region gene segments of the same type (e.g., at least 2 human VH6-1 gene segments, at least 2 human JH6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JK1 gene segments) trans at the same Ig locus; and optionally a third human gene segment of the same type, wherein the third gene segment is cis with one of said 2 different gene segments.
A population of non-human vertebrates (e.g., mice or rats) comprising a repertoire of human variable region gene segments, wherein the plurality comprises at least 2 human variable region gene segments of the same type (e.g., at least 2 human VH6-1 gene segments, at least 2 human JH6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JK1 gene segments), a first of said different gene segments is provided in the genome of a
first vertebrate of the population, and a second of said different gene segments being provided in the genome of a second vertebrate of the population, wherein the genome of the first vertebrate does not comprise the second gene segment.
A non-human vertebrate (e.g., a mouse or rat) or a non-human vertebrate cell (e.g., an ES cell or a B-cell) having a genome comprising at least 2 different non-endogenous variable region gene segments of the same type (e.g., at least 2 human VH6-1 gene segments, at least 2 human JH6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JK1 gene segments), wherein the gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations.
A method of enhancing the human immunoglobulin gene diversity of a non-human vertebrate (e.g., a mouse or rat), the method comprising providing the vertebrate with a genome comprising at least 3 human variable region gene segments of the same type (e.g., at least 3 human VH6-1 gene segments, at least 3 human JH6 gene segments, at least 3 human VK1-39 gene segments, at least 3 human D2-2 gene segments or at least 3 human JK1 gene segments), wherein at least two of the human gene segments are variants that are not identical to each other.
A method of enhancing the immunoglobulin gene diversity of a non-human vertebrate (e.g., a mouse or rat), the method comprising providing the vertebrate with a genome comprising at least 2 different non-endogenous variable region gene segments of the same type (e.g., at least 2 human VH6-1 gene segments, at least 2 human JH6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JK1 gene segments) cis at the same Ig locus.
A method of enhancing the immunoglobulin gene diversity of a non-human vertebrate (e.g., a mouse or rat), the method comprising providing the vertebrate with a genome comprising at least 2 different human variable region gene segments of the same type (e.g., at least 2 human VH6-1 gene segments, at least 2 human JH6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JK1 gene segments) trans at the same Ig locus; and optionally a third human gene segment of the same type, wherein the third gene segment is cis with one of said 2 different gene segments.
A method of providing an enhanced human immunoglobulin variable region gene segment repertoire, the method comprising providing a population of non-human vertebrates (e.g., a mouse or rat) comprising a repertoire of human variable region gene segments, wherein the method comprises providing at least 2 different human variable region gene segments of the same type (e.g., at least 2 human VH6-1 gene segments, at least 2 human JH6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JK1 gene segments), wherein a first of said different gene segments is provided in the genome of a first vertebrate of the population, and a second of said different gene segments is provided in the genome of a second vertebrate of the population, wherein the genome of the first vertebrate does not comprise the second gene segment.
A method of enhancing the human immunoglobulin gene diversity of a non-human vertebrate (e.g., a mouse or rat), the method comprising providing the vertebrate with a genome comprising at least 2 different non-endogenous variable region gene segments of the same type (e.g., at least 2 human VH6-1 gene segments, at least 2 human JH6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JK1 gene segments), wherein the gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations.
A method of enhancing the human immunoglobulin gene diversity of a non-human vertebrate (e.g., a mouse or rat), the method comprising providing the vertebrate with a genome comprising at least 2 human variable region gene segments of the same type (e.g., at least 2 human VH6-1 gene segments, at least 2 human JH6 gene segments, at least 2 human VK1-39 gene segments, at least 2 human D2-2 gene segments or at least 2 human JK1 gene segments), wherein the gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations; optionally wherein at least 2 or 3 of said different gene segments are provided at the same Ig locus in said genome.
A non-human vertebrate (e.g., a mouse or rat) or a non-human vertebrate cell (e.g., an ES cell or a B-cell) having a genome comprising first and second human Ig locus gene segments of the same type (e.g., first and second human JH6 gene segments; or first and second IgG2 gene segments; or first and second human JA7 gene segments), wherein the first gene segment is a gene segment selected from any one of Tables 1 and 9 to 14 (e.g., selected from Table 13 or Table 14) (e.g., IGHJ6-a) and the second gene segment is the corresponding reference sequence.
A population of non-human vertebrates (e.g., mice or rats) comprising first and second human Ig locus gene segments of the same type (e.g., first and second human JH6 gene segments; or first and second IgG2 gene segments; or first and second human JA7 gene segments), wherein the first gene segment is a gene segment selected from any one of Tables 1 and 9 to 14 (e.g., selected from Table 13 or Table 14) (e.g., IGHJ6-a) and the second gene segment is the corresponding reference sequence, wherein the first gene segment is provided in the genome of a first vertebrate of the population, and the second gene segment is provided in the genome of a second vertebrate of the population.
A method of enhancing the human immunoglobulin gene diversity of a non-human vertebrate (e.g., a mouse or rat), the method comprising providing the vertebrate with a genome comprising first and second human Ig locus gene segments of the same type (e.g., first and second human JH6 gene segments; or first and second IgG2 gene segments; or first and second human JA7 gene segments), wherein the first gene segment is a gene segment selected from any one of Tables 1 and 9 to 14 (e.g., selected from Table 13 or Table 14) (e.g., IGHJ6-a) and the second gene segment is the corresponding reference sequence.
In one aspect of this configuration, the invention relates to human D gene segment variants as described further below.
In one aspect of this configuration, the invention relates to human V gene segment variants as described further below.
In one aspect of this configuration, the invention relates to human J gene segment variants as described further below.
FIGS. 1 to 3: Schematic illustrating a protocol for producing recombineered BAC vectors to add V gene segments into a mouse genome;
FIG. 4: Schematic illustrating a protocol for adding V gene segments to a mouse genome using sequential recombinase mediated cassette exchange (sRMCE); and
FIG. 5 (in 4 parts): Alignment of 13 IGHV1-69 variants showing the variable (V) coding region only. Nucleotides that differ from VH1-69 variant *01 are indicated at the appropriate position whereas identical nucleotides are marked with a dash. Where nucleotide changes result in amino acid differences, the encoded amino acid is shown above the corresponding triplet. Boxed regions correspond to CDR1, CDR2 and CDR3 as indicated.
FIG. 6 is a schematic illustrating gene segment diversity and the effect of including variant variants in cis according to the invention:—
FIG. 7: Alignment of human JH6*02 variants. Nucleotides that differ from JH6*01 are indicated at the appropriate position whereas identical nucleotides are marked with a dash. Where nucleotide changes result in amino acid differences, the encoded amino acid is shown above. Accession numbers (e.g., J00256) are shown to the left of the IMGT variant name.
FIG. 8: Alignment of JH sequences from various species.
FIG. 9: Codon Table
FIG. 10: BAC database extract
A suitable source of JH6*02 and other human DNA sequences for use in the invention will be readily apparent to the skilled person. For example, it is possible to collect a DNA sample from a consenting human donor (e.g., a cheek swab sample as per the Example herein) from which can be obtained suitable DNA sequences for use in constructing a locus of the invention. Other sources of human DNA are commercially available, as will be known to the skilled person. Alternatively, the skilled person is able to construct gene segment sequence by referring to one or more databases of human Ig gene segment sequences disclosed herein.
An example source for human V, D and J gene segments according to the invention are Bacterial Artificial Chromosomes (RPCI-11 BACs) obtained from Roswell Park Cancer Institute (RPCI)/Invitrogen. See http://bacpac.chori.org/hmale11.htm which describes the BACs as follows: —
The RPCI-11 Human Male BAC Library (Osoegawa et al., 2001) was constructed using improved cloning techniques (Osoegawa et al., 1998) developed by Kazutoyo Osoegawa. The library was generated by Kazutoyo Osoegawa. Construction was funded by a grant from the National Human Genome Research Institute (NHGRI, NIH) (#1R01RG01165-03). This library was generated according to the new NHGRI/DOE “Guidance on Human Subjects in Large-Scale DNA Sequencing . . . .
“Male blood was obtained via a double-blind selection protocol. Male blood DNA was isolated from one randomly chosen donor (out of 10 male donors)”.
The invention relates to synthetically-extended & ethnically-diverse superhuman immunoglobulin gene repertoires. The human immunoglobulin repertoires are beyond those found in nature (i.e., “Superhuman”), for example, they are more diverse than a natural human repertoire or they comprise combinations of human immunoglobulin gene segments from disparate sources in a way that is non-natural. Thus, the repertoires of the invention are “superhuman” immunoglobulin repertoires, and the invention relates to the application of these in transgenic cells and non-human vertebrates for utility in producing chimaeric antibodies (with the possibility of converting these into fully-human, isolated antibodies using recombinant DNA technology). The present invention thus provides for novel and potentially expanded synthetic immunoglobulin diversities, which provides for a pool of diversity from which antibody therapeutic leads (antibody therapeutics and antibody tool reagents) can be selected. This opens up the potential of transgenic human-mouse/rat technologies to the possibility of interrogating different and possibly larger antibody sequence-spaces than has hitherto been possible. To this end, in one embodiment, the invention provides a SUPERHUMAN MOUSE™ (aka SUPRA-MOUSE™) and a SUPERHUMAN RAT™ (aka SUPRA-RAT™)
In developing this thinking, the present inventors have realised the possibility of mining the huge genetics resources now available to the skilled person thanks to efforts such as the HapMap Project, 1000 Genomes Project and sundry other immunoglobulin gene databases (see below for more details). Thus, in some embodiments, the inventors realised the application of these genome sequencing developments in the present invention to generate synthetically-produced and ethnically-diverse artificial immunoglobulin gene repertoires. In one aspect, the inventors realised that such repertoires are useful for the production of antibodies having improved affinity and/or biophysical characteristics, and/or wherein the range of epitope specificities produced by means of such repertoire is novel, provides for antibodies to epitopes that have hitherto been intractable by prior transgenic immunoglobulin loci or difficult to address.
The present invention provides libraries, vertebrates and cells, such as transgenic mice or rats or transgenic mouse or rat cells. Furthermore, the invention relates to methods of using the vertebrates to isolate antibodies or nucleotide sequences encoding antibodies. Antibodies, nucleotide sequences, pharmaceutical compositions and uses are also provided by the invention.
The present inventors have realized methods and antibody loci designs that harness the power of genetic variation analysis. The reference human genome provides a foundation for experimental work and genetic analysis of human samples. The reference human is a compilation of the genomes from a small number of individuals and for any one segment of the genome a high quality single reference genome for one of the two chromosomes is available. Because the reference genome was assembled from a series of very large insert clones, the identity of these clones is known. Accordingly, experimental work with human genomic DNA is usually conducted on the clones from which the reference sequence was derived.
Individual humans differ in their sequence and recently several individuals have had their genomes sequenced, for instance James Watson and Craig Venter. Comparison of the genome sequence of these individuals has revealed differences between their sequences and the reference genome in both coding and non-coding parts of the genome, approximately 1 in 1000 bases are different. Some variants will be significant and contribute to differences between individuals. In extreme cases these will result in genetic disease. Variation can be implicated in differing responses to drugs administered to human patients, e.g., yielding an undesirable lowering of patient response to treatment.
The 1000-Genomes Project has the objective of identifying the most frequent variations in the human genome. This public domain project involved sequencing the genomes of more than 1000 individuals from diverse ethnic groups, comparing these sequences to the reference and assembling a catalogue of variants. This has enabled the annotation of variants in coding regions, but because this sequence wasn't derived from large clones of DNA, the analysis of the sequence from diploid individuals can't discriminate the distribution of the variation between the maternal and paternally inherited chromosomes. Where more than one variant is identified in a protein coding gene, it is not possible to illuminate the distribution of the pattern of variants in each version of the protein. For example, if two variants are detected in different positions of the same protein in an individual, this could have resulted from one copy with two variants and none in the other or each copy could have just one variant. To illuminate the sequence of real proteins, the 1000-Genome Project has sequenced mother-father-child trios. This allows one to “phase” the sequence variants, in other words identify blocks of sequence that are inherited from one or other parent and deconvolute the variants.
To further understand the variation within the 1000-genome set a tool has been developed that can identify the significant variants (defined as non-synonymous amino acid changes) from a region of DNA from the phased data in the 1000-genome data set. This tool has been made available online http://www.1000genomes.org/variation-pattern-finder. This tool allows an investigator to download non-synonymous variation delimited between specific coordinates. The downloaded files are configured as individual genotypes, but the data is phased so the haplotype information and the frequencies of specific halotypes in different populations can be extracted.
The inventors' analysis of the 1000-genome data for the individual human coding segments of the C, V D and J genes from the heavy and light chains reveals that there is significant variation in these segments. Individuals will usually have two different heavy chain alleles and also different light chain alleles at both kappa and lambda loci. The repertoire of antibodies that can be generated from each allele will be different. This variation will contribute to a better or differing immune response to certain antigens.
Humanized mice that have hitherto been generated with immunoglobulin heavy and light chain loci contain just one type of immunoglobulin locus. Even if these mice contain a full human heavy chain locus, the variation will be less than contained in a typical human because only one set of C, V, D and J genes are available, while a typical human would have two sets.
The inventors have devised ways to improve on this limitation when constructing transgenic non-human vertebrates and cells for human antibody and variable region production in vivo.
Mice can be generated with two different loci, each engineered to have a different repertoire of V, D and J segments. This could be in a single mouse or two or more separate mouse strains and would be analogous to or beyond the repertoire found in a normal human. The engineering of such a mouse would go beyond the repertoire described in humanized mice to date which only have one set of alleles.
However, the inventors also realized that this also has limitations, because the different loci would not normally interact to shuffle V, D and J variants between loci. This same limitation is also inherent in a human, thus this system does not utilize the advantage of recombining variants in all combinations.
To go beyond the normal repertoire in humans and take advantage of combinations of C, V, D and J variants the inventors decided, in one embodiment, to provide these on the same chromosome in cis. See FIG. 6. These loci would be characterized by having more than the normal number of J, D or V genes. For example n=6 for the J genes, but including one J6 variant and one J2 variant would increase this to n=8. This could be combined with additional variants for the D and V genes, for example. By detailed analysis of the 1000-Genomes database, the inventors have devised a collection of candidate polymorphic human variant gene segments, e.g., JH gene segments (e.g., see the examples), that can be built into the design of transgenic heavy and light chain loci in mice for expressing increasingly diverse and new, synthetic repertoires of human variable regions. Moreover, by utilizing naturally-occurring human variant gene segments, as per embodiments of the invention, this addresses compatibility with human patients since the inventors analysis has drawn out candidate variants that are naturally conserved and sometimes very prevalent amongst human ethnic populations. Additionally this enables one to tailor the configurations of the invention to provide for antibody-based drugs that better address specific human ethnic populations.
In an example according to any configuration of the invention, loci (and cells and vertebrates comprising these) are provided in which gene segments from different human populations are used. This is desirable to increase antibody gene diversity to better address more diverse human patients. In an example, the gene segments are from first and second different human populations respectively, and thus the second gene segment is found in the second human population, but not so (or rarely) in the first human population. Rarely means, for example, that the gene segment is found in 5, 4, 3, 2, or 1 or zero individuals in the first population in the 1000 Genomes database. For example, the first gene segment may be shown as present in a first population by reference to Table 13 or 14 herein, the second gene segment may be shown as present in the second population by reference to Table 13 and not in the first population. Optionally, the first gene segment may also be shown as being present in the second population by reference to Table 13 or 14.
In any configuration or aspect of the invention, where a V gene segment is used, this may be used optionally with the native leader sequence. For example, use of genomic DNA (e.g., from BACs as in the examples) will mean that the native leader will be used for each V gene segment incorporated into the locus and genomes of the invention. In an alternative, the skilled person may wish to inert a non-native leader sequence together with one or more of the V gene segments. Similarly, in any configuration or aspect of the invention, where a V gene segment is used, this may be used optionally with the native 5′ UTR sequence. For example, use of genomic DNA (e.g., from BACs as in the examples) will mean that the native 5′ UTR sequence will be used for each V gene segment incorporated into the locus and genomes of the invention. In an alternative, the skilled person may wish to exclude the native 5′ UTR sequence.
In this way, the locus provides a superhuman repertoire of VL gene segments.
In one embodiment of the vertebrate or cell,
In this way, the locus provides a superhuman repertoire of VL gene segments.
In one embodiment of the vertebrate or cell,
In this way, the locus provides a superhuman repertoire of VL gene segments.
In one embodiment of the vertebrate or cell, the genome comprises a (or said) transgenic immunoglobulin light chain locus comprising a plurality of human immunoglobulin VL gene segments and a plurality of human JL gene segments, wherein the plurality of J gene segments consists of more than the natural human repertoire of functional J gene segments; optionally wherein the genome is homozygous for said transgenic heavy chain locus.
In one embodiment of the vertebrate or cell,
A library of antibody-producing transgenic cells whose genomes collectively encode a repertoire of antibodies, wherein
In one embodiment, the library is provided in vitro. In another embodiment, the library is provided in vivo by one or a plurality of transgenic non-human vertebrates. For example, the or each vertebrate is according to any aspect of the first configuration of the invention.
In one embodiment, the library encodes an antibody repertoire of from 10 to 109 antibodies, for example, 10, 20, 30, 40, 50, 100 or 1000 to 108; or 10, 20, 30, 40, 50, 100 or 1000 to 107; or 10, 20, 30, 40, 50, 100 or 1000 to 106; or 10, 20, 30, 40, 50, 100 or 1000 to 105; or 10, 20, 30, 40, 50, 100 or 1000 to 104 antibodies. In an example, library encodes an antibody repertoire of at least 103, 104, 105, 106, 107, 108, 109, or 1010 antibodies.
The first variable domain nucleotide sequence is produced following recombination of the first human unrearranged immunoglobulin gene segment with one or more other immunoglobulin gene segments (for example, human immunoglobulin gene segments). For example, where the first gene segment is a VH, the first variable domain nucleotide sequence (a VH domain) is produced following recombination of the VH with a human D and JH segments in vivo, optionally with somatic hypermutation, in the first transgenic cell or an ancestor thereof. For example, where the first gene segment is a VL, the first variable domain nucleotide sequence (a VL domain) is produced following recombination of the VL with a human JL segment in vivo, optionally with somatic hypermutation, in the first transgenic cell or an ancestor thereof.
The second variable domain nucleotide sequence is produced following recombination of the second human unrearranged immunoglobulin gene segment with one or more other immunoglobulin gene segments (for example, human immunoglobulin gene segments). For example, where the second gene segment is a VH, the second variable domain nucleotide sequence (a VH domain) is produced following recombination of the VH with a human D and JH segments in vivo, optionally with somatic hypermutation, in the second transgenic cell or an ancestor thereof. For example, where the second gene segment is a VL, the second variable domain nucleotide sequence (a VL domain) is produced following recombination of the VL with a human JL segment in vivo, optionally with somatic hypermutation, in the second transgenic cell or an ancestor thereof.
The first and second gene segments are respectively derived from genome sequences of first and second human individuals. In one example, such a gene segment is isolated or cloned from a sample cell taken from said individual using standard molecular biology techniques as know to the skilled person. The sequence of the gene segment may be mutated (e.g., by the introduction of up to 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 nucleotide changes) prior to use in the present invention. In another example, a gene segment is derived by identifying a candidate human immunoglobulin gene segment in a database (see guidance below) and a nucleotide sequence encoding a gene segment for use in the present invention is made by reference (e.g., to be identical or a mutant with up to 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 nucleotide changes to the reference sequence) to the database sequence. The skilled person will be aware of methods of obtaining nucleotide sequences by reference to databases or by obtaining from cellular samples.
In one embodiment of the vertebrate, cell or library of any configuration of the invention, the first and second human individuals are members of first and second ethnic populations respectively, wherein the populations are different. This, therefore, provides for superhuman gene diversity in transgenic loci, cells and vertebrates as per the invention.
Optionally the ethnic populations are selected from those identified in the 1000 Genomes Project of database. In this respect, see Table 8 which provides details of the ethnic populations on which the 1000 Genomes database is based.
N A Rosenberg et al (Science 20 Dec. 2002: vol. 298 no. 5602 2342-2343) studied the genetic structure of human populations of differing geographical ancestry. In total, 52 populations were sampled, these being populations with:
(Mbuti Pygmies, Biaka Pygmies, San peoples, and speakers of Niger-Kordofanian languages (Bantu, Yoruba or Mandenka populations),
(European ancestry (Orcadian, Adygei, Basque, French, Russians, Italians, Sardinian, Tuscan), Middle Eastern ancestry (Mozabite, Bedouin, Druze, Palestinians),
Central/South Asian ancestry (Balochl, Brahul, Makrani, Sindhi, Pathan, Burusho, Hazara, Uygur, Kalash)),
(Han, Dal, Daur, Hezhen, Lahu, Miao, Orogen, She, Tujia, Tu, Xibo, Yi, Mongola, Naxi, Cambodian, Japanese, Yakut), Oceanic ancestry (Melanesian, Papuan); or
The International HapMap Project, Nature, 2003 Dec. 18; 426(6968):789-96, discloses that goal of the HapMap Project: to determine the common patterns of DNA sequence variation in the human genome by determining the genotypes of one million or more sequence variants, their frequencies and the degree of association between them in DNA samples from populations with ancestry from parts of Africa, Asia and Europe. The relevant human populations of differing geographical ancestry include Yoruba, Japanese, Chinese, Northern European and Western European populations. More specifically:—
Utah population with Northern or Western European ancestry (samples collected in 1980 by the Centre d'Etude du Polymorphisme Humain (CEPH)); population with ancestry of Yoruba people from Ibadan, Nigeria; population with Japanese ancestry; and population with ancestry of Han Chinese from China.
The authors, citing earlier publications, suggest that ancestral geography is a reasonable basis for sampling human populations.
A suitable sample of human populations from which the populations used in the present invention are selected is as follows:—
In any configuration of the invention, in one embodiment, each human population is selected from a population marked “(a)” above.
In any configuration of the invention, in another embodiment, each human population is selected from a population marked “(b)” above.
In any configuration of the invention, in another embodiment, each human population is selected from a population marked “(c)” above.
In one embodiment of the library of the vertebrate, cell or library of the invention, the first and second ethnic populations are selected from the group consisting of an ethnic population with
European ancestry, an ethnic population with East Asian, an ethnic population with West African ancestry, an ethnic population with Americas ancestry and an ethnic population with South Asian ancestry.
In one embodiment of the library of the vertebrate, cell or library of the invention, the first and second ethnic populations are selected from the group consisting of an ethnic population with Northern European ancestry; or an ethnic population with Western European ancestry; or an ethnic population with Toscani ancestry; or an ethnic population with British ancestry; or an ethnic population with Icelandic ancestry; or an ethnic population with Finnish ancestry; or an ethnic population with Iberian ancestry; or an ethnic population with Japanese ancestry; or an ethnic population with Chinese ancestry; or an ethnic population Vietnamese ancestry; or an ethnic population with Yoruba ancestry; or an ethnic population with Luhya ancestry; or an ethnic population with Gambian ancestry; or an ethnic population with Malawian ancestry; or an ethnic population with Native American ancestry; or an ethnic population with Afro-Caribbean ancestry; or an ethnic population with Mexican ancestry; or an ethnic population with Puerto Rican ancestry; or an ethnic population with Columbian ancestry; or an ethnic population with Peruvian ancestry; or an ethnic population with Ahom ancestry; or an ethnic population with Kayadtha ancestry; or an ethnic population with Reddy ancestry; or an ethnic population with Maratha; or an ethnic population with Punjabi ancestry.
In one embodiment of any configuration of the vertebrate, cell or library of the invention, the human immunoglobulin gene segment derived from the genome sequence of the second individual is low-frequency (optionally rare) within the second ethnic population. Optionally human immunoglobulin gene segment has a Minor Allele Frequency (MAF) (cumulative frequency) of between 0.5%-5%, optionally less than 0.5%, in the second human population, e.g., as in the 1000 Genomes database.
In one embodiment of any configuration of the vertebrate, cell or library of the invention, the first variable region nucleotide sequence is produced by recombination of the first human immunoglobulin gene segment with a first J gene segment and optionally a first D gene segment, wherein the first human immunoglobulin gene segment is a V gene segment and the V, D and J segments are derived from the first human population, optionally from the genome of one individual
of the first human population.
In one embodiment of the library of the vertebrate, cell or library of the invention, the second variable region nucleotide sequence is produced by recombination of the second human immunoglobulin gene segment with a second J gene segment and optionally a second D gene segment, wherein the second human immunoglobulin gene segment is a V gene segment derived from the second population and the D and/or J segments are derived from the first human population, optionally the D and J gene segments being from the genome of one individual of the first human population.
In one embodiment of the library of the vertebrate, cell or library of the invention, all of the D and J segments that have been recombined with the first and second V gene segments are D and J segments derived from the first human population, optionally the D and J gene segments being from the genome of one individual of the first human population.
In one embodiment of the library, the second human immunoglobulin gene segment is a polymorphic variant of the first human immunoglobulin gene segment; optionally wherein the second gene segment is selected from the group consisting of a gene segment in any of Tables 1 to 7 and 9 to 14 (e.g., selected from Table 13 or 14).
In one embodiment of the library, the first and second human immunoglobulin gene segments are both (i) VH gene segments; (ii) D segments; (iii) J segments (optionally both JH segments, both JK segments or both Ĵ segments); (iv) constant regions (optionally both a gamma constant region, optionally both a C gamma-1 constant region); (v) CH1 regions; (vi) CH2 regions; or (vii) CH3 regions.
The library is, for example, a naive and optionally has a library size of from 10 or 102 to 109 cells. For example, from 10, 20, 30, 40, 50, 100 or 1000 to 108; or 10, 20, 30, 40, 50, 100 or 1000 to 107; or 10, 20, 30, 40, 50, 100 or 1000 to 10s; or 10, 20, 30, 40, 50, 100 or 1000 to 105; or 10, 20, 30, 40, 50, 100 or 1000 to 104 cells.
The library has, for example, been selected against a predetermined antigen and optionally has a library size of from 10 or 102 to 109 cells. For example, from 10, 20, 30, 40, 50, 100 or 1000 to 108; or 10, 20, 30, 40, 50, 100 or 1000 to 107; or 10, 20, 30, 40, 50, 100 or 1000 to 10s; or 10, 20, 30, 40, 50, 100 or 1000 to 105; or 10, 20, 30, 40, 50, 100 or 1000 to 104 cells.
In one embodiment of the library of the invention, said first and second cells are progeny of first and second ancestor non-human vertebrate cells respectively, wherein the first ancestor cell comprises a genome comprising said first human immunoglobulin gene segment; and the second ancestor cell comprises a genome comprising said second human immunoglobulin gene segment.
The invention further provides a library of antibody-producing transgenic cells whose genomes collectively encode a repertoire of antibodies, wherein the library comprises the first and second ancestor cells described above.
The invention further provides a library of hybridoma cells produced by fusion of the library of the invention (e.g., a B-cell library) with fusion partner cells and optionally has a library size of from 10 or 102 to 109 cells. For example, from 10, 20, 30, 40, 50, 100 or 1000 to 108; or 10, 20, 30, 40, 50, 100 or 1000 to 107; or 10, 20, 30, 40, 50, 100 or 1000 to 10s; or 10, 20, 30, 40, 50, 100 or 1000 to 105; or 10, 20, 30, 40, 50, 100 or 1000 to 104 cells. Production of hybridomas is well known to the skilled person. Examples of fusion partners are SP2/0-g14 (obtainable from ECACC), P3XS3-Ag8.S53 (obtainable from LGC Standards; CRL-1580), NS1 and NS0 cells. PEG fusion or electrofusion can be carried out, as is conventional.
An isolated antibody having
The invention also provides an isolated nucleotide sequence encoding the antibody of the third configuration, optionally wherein the sequence is provided in an antibody expression vector, optionally in a host cell. Suitable vectors are mammalian expression vectors (e.g., CHO cell vectors or HEK293 cell vectors), yeast vectors (e.g., a vector for expression in Picchia pastoris, or a bacterial expression vector, e.g., a vector for E. coli expression.
The invention also provides a method of producing a human antibody, the method comprising replacing the non-human vertebrate constant regions of the antibody of the third configuration with human antibody constant regions (e.g., a C variant disclosed in table 13 or 18). The skilled person will be aware of standard molecular biology techniques to do this. For example, see Harlow, E. & Lane, D. 1998, 5th edition, Antibodies: A Laboratory Manual, Cold Spring Harbor Lab. Press, Plainview, N.Y.; and Pasqualini and Arap, Proceedings of the National Academy of Sciences (2004) 101:257-259 for standard immunisation. Joining of the variable regions of an antibody to a human constant region can be effected by techniques readily available in the art, such as using conventional recombinant DNA and RNA technology as will be apparent to the skilled person. See e.g. Sambrook, J and Russell, D. (2001, 3'd edition) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Lab. Press, Plainview, N.Y.).
In one embodiment, the method comprises further making a mutant or derivative of the antibody.
The invention also provides a pharmaceutical composition comprising an antibody according to the third configuration, or a human antibody of the invention and a diluent, excipient or carrier; optionally wherein the composition is provided in a container connected to an IV needle or syringe or in an IV bag.
The invention also provides an antibody-producing cell (e.g., a mammalian cell, e.g., CHO or HEK293; a yeast cell, e.g., P. pastoris; a bacterial cell, e.g., E. coli; a B-cell; or a hybridoma) that expresses the second antibody of the third configuration or the isolated antibody of the invention.
A non-human vertebrate or vertebrate cell (optionally an ES cell or antibody-producing cell) whose genome comprises a transgenic immunoglobulin locus (e.g., a heavy chain locus or a light chain locus), said locus comprising immunoglobulin gene segments according to the first and second human immunoglobulin gene segments (optionally V segments) described above in connection with the third configuration. The gene segments are operably connected upstream of an immunoglobulin constant region; optionally wherein the genome is homozygous for said transgenic immunoglobulin locus.
Optionally the immunoglobulin locus comprises more than the natural human complement of functional V gene segments; and/or
Optionally wherein the immunoglobulin locus comprises more than the natural human complement of functional D gene segments; and/or
Optionally wherein the immunoglobulin locus comprises more than the natural human complement of functional J gene segments.
In this way, a superhuman immunoglobulin gene repertoire is provided in a transgenic non-human vertebrate or vertebrate cell according to the invention.
A transgenic non-human vertebrate (e.g., a mouse or rat) or vertebrate cell (optionally an ES cell or antibody-producing cell) whose genome comprises a transgenic immunoglobulin locus comprising a plurality of human immunoglobulin gene segments operably connected upstream of a non-human vertebrate constant region for the production of a repertoire of chimaeric antibodies, or chimaeric light or heavy chains, having a non-human vertebrate constant region and a human variable region; wherein the transgenic locus comprises one or more human immunoglobulin V gene segments, one or more human J gene segments and optionally one or more human D gene segments, a first (optionally a V segment) of said gene segments and a second (optionally a V segment) of said gene segments being different and derived from the genomes of first and second human individuals respectively, wherein the individuals are different; and optionally not related;
optionally wherein the immunoglobulin locus comprises more than the natural human complement of functional V gene segments; and/or
optionally wherein the immunoglobulin locus comprises more than the natural human complement of functional D gene segments; and/or
optionally wherein the immunoglobulin locus comprises more than the natural human complement of functional J gene segments.
In this way, a superhuman immunoglobulin gene repertoire is provided in a transgenic non-human vertebrate or vertebrate cell according to the invention.
A transgenic non-human vertebrate (e.g., a mouse or rat) or vertebrate cell (optionally an ES cell or antibody-producing cell) whose genome comprises first and second transgenic immunoglobulin loci, each locus comprising a plurality of human immunoglobulin gene segments operably connected upstream of a non-human vertebrate constant region for the production of a repertoire of chimaeric antibodies, or chimaeric light or heavy chains, having a non-human vertebrate constant region and a human variable region;
wherein (i) the first transgenic locus comprises one or more human immunoglobulin V gene segments, one or more human J gene segments and optionally one or more human D gene segments, (ii) the second transgenic locus comprises one or more human immunoglobulin V gene segments, one or more human J gene segments and optionally one or more human D gene segments; and (iii) wherein a first (optionally a V) gene segment of said first locus and a second (optionally a V) gene segment of said second gene locus are different and derived from the genomes of first and second human individuals respectively, wherein the individuals are different; and optionally not related;
optionally wherein the first and second loci are on different chromosomes (optionally chromosomes with the same chromosome number) in said genome;
optionally wherein each immunoglobulin locus comprises more than the natural human complement of functional V gene segments; and/or
optionally wherein each immunoglobulin locus comprises more than the natural human complement of functional D gene segments; and/or
optionally wherein each immunoglobulin locus comprises more than the natural human complement of functional J gene segments.
In this way, a superhuman immunoglobulin gene repertoire is provided in a transgenic non-human vertebrate or vertebrate cell according to the invention.
In these embodiments of the first configuration, the immunoglobulin gene segments are optionally as described for the third configuration.
In these embodiments of the first configuration, the genome optionally comprises a third immunoglobulin gene segment (optionally a V segment), the third gene segment being derived from a human individual that is different from the individual from which the first (and optionally also the second) gene segment is derived; optionally wherein the first, second and third gene segments are polymorphic variants of a human immunoglobulin gene segment (e.g., VH1-69—see the examples for further description).
In these embodiments of the first configuration, the genome of the vertebrate or cell is optionally homozygous for the first, second and optional third gene segment, wherein a copy of the first, second and optional third gene segments are provided together on the same chromosome operably connected upstream of a common non-human vertebrate constant region.
For example, each first, second and optional third gene segment is a V gene segment.
In one example, the library of the invention is provided by a collection of non-human vertebrates (optionally a collection of rodents, mice or rats); optionally, wherein a first member of said collection produces said first antibody but not said second antibody, and a second member of the collection produces said second antibody (but optionally not said first antibody). It is therefore contemplated to make non-human vertebrates where different human genomes have been used as a source for building the transgenic loci in the vertebrates. For example, a first vertebrate comprises a transgenic heavy chain locus having gene segments only from a first (and optionally a second) human population or individual; a second vertebrate comprises a transgenic heavy chain locus having gene segments only from a third (and optionally a fourth) human population or individual; and optionally third and more vertebrates can be built similarly based on unique or overlapping human population genomes. However, when provided as a mixed population of transgenic vertebrates, the mixed population provides a collective pool of human immunoglobulin genes that is greater than found in a natural human repertoire. This is useful to extend the antibody and gene sequence space beyond those possible with prior transgenic mice and rats bearing human immunoglobulin loci. As explained above, these have been based on a single human genome.
In one embodiment, the collection of non-human vertebrates bear human immunoglobulin genes confined to human populations that are together grouped under the same population genus “(a)” mentioned above. This provides for a gene repertoire that is biased to producing human antibody variable regions prevalent in the population genus (a) and thus useful for generating antibody therapeutics/prophylactics for members of said population. Alternatively, where gene segments from different human populations are provided in a single transgene according to the invention (not necessarily in a collection of vertebrates), the different human populations are for example together grouped under the same population genus “(a)” mentioned above.
The invention also provides a repertoire of antibodies expressed from a library of cells according to the invention.
In the non-human vertebrate or cell of any configuration of the invention, the constant region of the transgenic locus is, in one example, an endogenous constant region of said vertebrate (e.g., endogenous mouse or rat constant region, e.g., from the same strain of mouse or rat as the non-human vertebrate itself).
The invention also provides a method of constructing a cell (e.g., an ES cell) according to the invention, the method comprising
Optionally the cell comprises a heavy chain locus constructed according to steps (a) to (c) and/or a light chain locus (kappa and/or lambda loci) constructed according to steps (a) to (c).
Optionally the cell is homozygous for the or each transgenic locus; optionally wherein antibody expression from loci endogenous to said cell has been inactivated. This is useful for confining the functional antibody gene repertoire, and thus antibody production, to antibodies bearing human variable regions.
Optionally the gene segment(s) in step (b) are identified from an immunoglobulin gene database selected from the 1000 Genomes, Ensembl, Genbank and IMGT databases.
Optionally the first and second human individuals are members of first and second ethnic populations respectively, wherein the populations are different, optionally wherein the human immunoglobulin gene segment derived from the genome sequence of the second individual is low-frequency (optionally rare) within the second ethnic population.
The invention also provides a method of making a transgenic non-human vertebrate (e.g., a mouse or rat), the method comprising
The invention provides a transgenic non-human vertebrate (e.g., a mouse or rat) made by the method or a progeny thereof. The invention also provides a population of such non-human vertebrates.
Microinjection of ES cells into blastocysts and generation of transgenic mice therafter are conventional practices in the state of the art, and the skilled person is aware of techniques useful to effect this. C57BL/6N, C57BL/6J, 129S5 or 129Sv mouse strains and ES cells are readily and publicly available.
The invention also provides a method of isolating an antibody that binds a predetermined antigen (e.g., a bacterial or viral pathogen antigen), the method comprising
This method optionally further comprises after step (e) the step of isolating from said B lymphocytes nucleic acid encoding said antibody that binds said antigen; optionally exchanging the heavy chain constant region nucleotide sequence of the antibody with a nucleotide sequence encoding a human or humanized heavy chain constant region and optionally affinity maturing the variable region of said antibody; and optionally inserting said nucleic acid into an expression vector and optionally a host.
See also the discussion on variation analysis above.
The skilled person will know of sources of human antibody gene sequences, such as IMGT (www.imgt.org) GenBank (www.ncbi.nlm.nih.gov/genbank) Bioinformatics tools for database manipulation are also readily available and known to the skilled person, e.g., as publicly available from the 1000 Genomes Project/EBI (www.1000genomes.org)
As a source of antibody gene segment sequences, the skilled person will also be aware of e following available databases and resources (including updates thereof):—
See also Antibody Engineering Methods and Protocols, Ed. Benny K C Lo, Methods in Molecular Biology™, Human Press. Also at http://www.blogsua.com/odf/antibody-engineering-methods-and-protocolsantibody-engineering-methods-and-protocols.pdf
As a source of genomic sequence variation data, the skilled person will also be aware of the following available databases and resources (including updates thereof):—
It is possible to identify variants in immunoglobulin genes classed as low-frequency or rare variants that segregate with specific human ethnic populations. For the purpose of this analysis, a low-frequency immunoglobulin gene segment is classed as one with ‘Minor Allele Frequency’ (MAF) (cumulative frequency) of between 0.5%-5%, rare variants are those classed as having a MAF of less than 0.5% in a particular human population.
The following bioinformatics protocol is envisaged to identify human immunoglobulin gene segments for use in the present invention:
In one embodiment throughout the present text, “germline” refers to the canonical germline gene segment sequence.
By detailed analysis of the 1000 Genomes database, the inventors have devised a collection of candidate polymorphic antibody gene segment variants, e.g., human variant JH gene segments (e.g., see Example 4), that can be built into the design of transgenic heavy chain loci in mice for expressing increasingly diverse and new, synthetic repertoires of human variable regions. To this end, the invention provides the following embodiments.
As explained above, in designing transgenic Ig heavy chain loci the present inventors have considered the huge amount of data available from the 1000 Genomes project (see www.1000genomes.org) that analyses gene distributions amongst many human populations, and in particular data on Ig gene segments. The inventors were also aware of human gene segments disclosed in the IMGT database (see www.imgt.org) and in Ensembl (see www.ensembl.org). The inventors needed to make choices about which human gene segments to include amongst the large number of human gene segments presented in these databases and the other sources of human Ig gene segment information known in the art, including those other databases disclosed herein. When choosing human JH gene segments, the inventors were aware that human JH6 encodes a relatively long amino acid sequence, and thus the inventors thought it desirable to include this for increasing the chances of producing IgH chains with relatively long HCDR3 regions. Antibodies with long HCDR3 (at least 20 amino acids according to IMGT nomenclature) have been shown to neutralize a variety of pathogens effectively including HIV, Influenza virus, malaria and Africa trypanosomes. Reference is also made to naturally-occurring Camelid (e.g., llama or camel) heavy chain-only antibodies which bear long HCDR3s for reaching relatively inaccessible epitopes (see, e.g., EP0937140). Long HCDR3s can form unique stable subdomains with extended loop structure that towers above the antibody surface to confer fine specificity. In some cases, the long HCDR3 itself is sufficient for epitope binding and neutralization (Liu, L et al; Journal of Virology. 2011. 85: 8467-8476, incorporated herein by reference). The unique structure of the long HCDR3 allows it to bind to cognate epitopes within inaccessible structure or extensive glycosylation on a pathogen surface. In human peripheral blood, there is around 3.5% of naive B antibodies or 1.9% of memory B IgG antibodies containing the HCDR3s with lengths of more than 24 amino acids (PLoS One. 2012; 7(5):e36750. Epub 2012 May 9; “Human peripheral blood antibodies with long HCDR3s are established primarily at original recombination using a limited subset of germline genes”; Briney BS e al, incorporated herein by reference) (FIG. 1). The usage analysis indicates that these antibodies have the preference to use human JH6 with human D2-2, D3-3 or D2-15 (Brinley, B S et al, FIGS. 2-5). See also PLoS One. 2011 Mar. 30; 6(3):e16857; Comparison of antibody repertoires produced by HIV-1 infection, other chronic and acute infections, and systemic autoimmune disease”; Breden F et al, incorporated herein by reference. Around 20% of all HCDR3 of antibodies use JH6. However, in those antibodies with HCDR3 of more than 24 amino acids, 70% use JH6 (Brinley, B S et al, FIG. 2).
There is a need in the art for genetically modified non-human vertebrates and cells that can make antibodies and heavy chains that have long human HCDR3s, as well as antibodies, chains and VH domains that can be selected from such vertebrates and cells wherein these can address target epitopes better accessed by long HCDR3s.
The inventors, therefore, chose in this configuration of the invention to include a human JH6 gene segment as a mandatory human gene segment in their IgH locus design. Several different naturally-occurring human JH6 variants are known (e.g., JH6*01 to *04 as well as others; IMGT nomenclature). The inventors considered this when deciding upon which human JH6 variant should be included in the transgenic IgH locus design. An alignment of some human JH6 variants is shown in FIG. 7 (from www.imgt.org; dashes indicate identical nucleotides; nucleotide changes versus the *01 variant are shown by underlined nucleotides and corresponding amino acid changes are shown by underlined amino acids; Genbank accession numbers (release 185.0) are shown prefixed by J, X, M or A). The inventors used sequencing of human genomic DNA samples, inspection of public IgH DNA databases as well as informed choices on the basis of variant sequences as means to arrive at a rational choice of which JH6 variant to use.
The 1000 Genomes database uses human JH6*03 as the reference sequence, which would be a possible choice for the skilled person wishing to construct a transgenic IgH locus. The inventors noticed (e.g., FIG. 7 herein) that position 6 in JH6*03 is a tyrosine (Y) encoded by a TAC codon, whereas some other naturally-occurring human variants have a glycine (G) encoded by a GGT codon (the glycine being present as a YYG motif, forming part of a larger YYGXDX motif). To understand the potential significance of this, the inventors carried out analysis of JH sequences from other vertebrate species. The inventors surprisingly noticed that YYG and YYGXDX motifs are conserved across many vertebrate species (see FIGS. 7 & 8). This suggested to the inventors, therefore, that preservation of this motif might be desirable, which could guide the choice of JH6 variant for use in the present invention.
Another pointer arose when the inventors considered the TAC codon versus the GGT codon encoding Y or G respectively. The inventors considered the impact of these nucleotide sequences on the action of activation-induced cytidine deaminase (AID). The inventors knew that activation-induced cytidine deaminase (AID) is believed to initiate Ig somatic hypermutation (SHM) in a multi-step mechanism and they addressed this activity when rationally designing the locus. AID catalyses the deamination of C to U in DNA, generating mutations at C bases. Cytidines located within hotspot motifs are preferentially deaminated. Certain motifs are hotspots for AID activity (DGYW, WRC, WRCY, WRCH, RGYW, AGY, TAC, WGCW, wherein W=A or T, Y=C or T, D=A, G or T, H=A or C or T, and R=A or G). The presence of a TAC codon encoding Y at position 6 in JH6*03 creates AID mutation hotspots (the cytidine being the substrate of AID), these hotspots being the underlined motifs in the previous sentence. The inventors considered the impact of this and in doing so they considered possible mutants created by AID activity at the cytidine. Reference is made to FIG. 9. The inventors noticed that a mutation at the third base of the TAC codon would yield 3 possible outcomes: Y, stop or stop. Thus, out of the three stop codons possible in the genetic code (the other being encoded by TGA—see FIG. 9), two of them would be provided by mutation of the cytidine in the TAC codon encoding position 6 in JH6*03. The inventors, therefore, considered that this might increase the chances of non-productive IgH variable region production in transgenic loci based on JH6*03. Moreover, the inventors noticed that provision of a GGT codon instead (as per the other human JH6 variants) seemed preferable since mutation of the third base would never yield a stop codon (see FIG. 9), and furthermore would retain coding, and thus conservation, of glycine at position 6, which the inventors also noticed was is in the YYG and YYGXDX motifs conserved across species.
Having decided against using JH6*03, the inventors needed to make a choice from other possible human variants. The MDV motif is at the C-terminus of HCDR3 based on human JH6, the adjacent framework 4 (FW4) starting with the WGQ motif (with reference to the sequence shown encoded by JH6*01; FIG. 7). In making their choices for locus design, the inventors wished to maximise conservation of this HCDR3/FW4 junction in product IgH chains and antibodies including these. The inventors believed this to be desirable for heavy chain variable domain functionality and conformation. The inventors thought that this might in some cases be desirable to minimise immunogenicity (suitable for human pharmaceutical use). Consistent with these considerations, the inventors wanted to make a choice that would minimise mutation around the HCDR3/FW4 junction as a result of SHM in vivo to conserve junction configuration. See Rogozin & Diaz; “Cutting Edge: DGYW/WRCH Is a Better Predictor of Mutability at G:C Bases in Ig Hypermutation Than the Widely Accepted RGYW/WRCY Motif and Probably Reflects a Two-Step Activation-Induced Cytidine Deaminase-Triggered Process”; Journal of Immunology; Mar. 15, 2004 vol. 172 no. 6 3382-3384. An example of a DGYW motif is GGCA. The inventors had this in mind when analysing the variant sequences.
With these considerations in mind, the inventors decided specifically to use human JH6*02 as the mandatory human JH6 for their IgH locus design. JH6*01 was rejected as the mandatory JH6 gene segment since the nucleotide sequence GGG CAA (encoding G and Q) contains a GGCA motif which is an AID recognition hotspot. The inventors realised that JH6*04 also contains such a motif due to the presence of the sequence GGC AAA encoding G and K (positions 11 and 12 respectively). The inventors also realised that the *02 variant has a C instead of a G that is in the *01 variant, the C desirably being a synonymous change (i.e., not changing the encoded amino acid sequence around the CDR3/FW4 junction) and also this does not provide a GGCA AID hotspot motif. The inventors, therefore, decided that the mandatory JH6 should have this C base and this too pointed them to using the human JH6*02 variant.
In one example of any configuration of the invention herein, the only JH6 species included in the locus or genome is human JH6*02.
The inventors obtained 9 anonymised DNA samples from cheek swabs of 9 consenting human adults. Sequencing was performed on IgH locus DNA to confirm natural JH6 variant usage. It was found that the genome of all 9 humans contained a JH6*02 variant gene segment. In 7 out of the 9 humans, the genome was homozygous for JH6*02 (i.e., each chromosome 14 had JH6*02 as its JH6 gene segment in the IgH locus). The inventors also inspected the publicly-available sequence information from the genomes of well-known scientists Craig Venter and Jim Watson. Both of these genomes contain JH6*02 too. This indicated to the inventors that this variant is common in humans.
So, the inventors made a choice of human JH6*02 on the basis of
This rationale was tested by the inventors in laboratory examples, in order to see if human JH6*02 could desirably participate in antibody gene segment recombination and heavy chain production in a foreign (non-human vertebrate) setting, and moreover to assess if long HCDR3s based on human JH6*02 could be produced in vivo (in naive and immunised settings) in such non-human systems. It was noted that in some non-human settings, such as a mouse, the YYG and YYGXDX motifs are not conserved, and thus the inventors decided that it was important to test whether or not JH6*02 (having the YYG and YYGXDX motifs) could function properly in such a foreign setting to participate in VDJ recombination and selection against antigen.
Thus, as explained further in the examples, the inventors constructed transgenic JH6*02-containing IgH loci in ES cells, generated transgenic non-human vertebrates from the ES cells (both naive and immunised with a range of different target antigen types), isolated antibodies and heavy chain sequences based on JH6*02 as well as B-cells expressing these and made hybridomas expressing antigen-specific antibodies that are based on the chosen JH6*02 variant. The inventors found that the JH6*02 variant was extensively used and could contribute to the production of HCDR3 of at least 20 amino acids in many different heavy chains (including antigen-specific heavy chains). The chosen variant was preferably used over other JH gene segments in all settings (naive, immunised and antigen-specific) for the production of HCDR3 of at least 20 amino acids.
Thus, the present invention provides an IgH locus including human JH6*02 (IMGT nomenclature) as a mandatory JH gene segment. In one embodiment, the locus comprises non-human vertebrate (e.g., mouse or rat) constant region gene segments downstream (i.e., 3′ of) the human JH6*02; and one or more VH gene segments (e.g., a plurality of human VH gene segments) and one or more D gene segments (e.g., a plurality of human D gene segments) upstream of (i.e., 5′ of) the human JH6*02. For example, the locus is comprised by a vector (e.g., a DNA vector, e.g., a yeast artificial chromosome (YAC), BAC or PAC). Such a vector (e.g., YAC) can be introduced into a non-human vertebrate (e.g., mouse or rat) cell using standard techniques (e.g., pronuclear injection) so that the locus is integrated into the cell genome for expression of IgH chains comprising at least one chain whose variable domain is a product of the recombination of human JH6*02 with a VH and a D gene segment.
In another example, the locus (e.g., with a completely human, rat or mouse constant region, or a human/mouse chimaeric constant region) can be provided in the genome of a non-human vertebrate (e.g., mouse or rat) cell. For example, the cell is an ES cell or an antibody-producing cell (e.g., an isolated B-cell, an iPS cell or a hybridoma).
In another example, the invention provides a non-human vertebrate (e.g., a mouse or a rat) comprising an IgH locus of the invention which comprises a human JH6*02 gene segment, wherein the locus can express an IgH chain whose variable domain is a product of the recombination of human JH6*02 with a VH and a D gene segment. As shown in the examples, the inventors have successfully produced such mice which produce such IgH chains with VH domains based on human JH6*02. The inventors isolated and sequenced IgH chains from the mice before (naive) and after (immunised) exposure to a range of target antigens and confirmed by comparison to IMGT IgH gene segment sequences that the isolated chains (and antibodies containing these) were produced based on JH6*02. Such chains were found in naive mice, as well as in antigen-specific antibodies from immunised mice. B-cells were isolated from immunised mice, wherein the B-cells express antibodies based on JH6*02 and hybridomas were generated from the B-cells, the hybridomas expressing antigen-specific antibodies based on JH6*02. The inventors, therefore, provided the locus, vertebrate, cell and hybridoma of the invention based on the use of human JH6*02 and showed that antibodies based on JH6*02 and B-cells expressing these can be successfully produced and isolated following immunisation of the vertebrates, corresponding hybridomas being a good source of antibodies whose VH domains are based on JH6*02, e.g. for administration to a patient, e.g., for human medicine. Furthermore, it was found possible to produce and isolated antigen-specific antibodies whose VH domains are based on JH6*02 and which had a relatively long HCDR3 (e.g., 20 amino acids).
Thus, the present invention provides embodiments as in the following clauses:—
For example, the locus comprises the following human VH gene segments
Optionally also (i) and/or (ii)
(i)
(ii)
For example, the locus comprises the following human VH gene segment variants
Optionally also (iii) or (iv)
(ii)
(iv)
For example, the locus comprises the following human JH gene segment variants
For example, the locus comprises the following human D gene segments
and optionally also (v) or (vi)
(v)
(vi)
Additional rational design and bioinformatics has led the inventors to realise that specific human constant region variants are conserved across many diverse human populations. The inventors realised that this opens up the possibility of making a choice to humanize antibodies, chains and variable domains by using such specific constant regions in products, rather than arbitrarily choosing the human constant region (or a synthetic version of a human constant region). This aspect of the invention also enables one to tailor antibody-based drugs to specific human ethnic populations, thereby more closely matching drug to patient (and thus disease setting) than has hitherto been performed. It can be a problem in the state of the art that antibodies are humanized with an arbitrary choice of human constant region (presumably derived from one (often unknown) ethnic population or non-naturally occurring) that does not function as well in patients of a different human ethnic population. This is important, since the constant region has the major role in providing antibody effector functions, e.g., for antibody recycling, cellular and complement recruitment and for cell killing.
As discussed further in WO2011066501, human IgG sub-types IgG1, IgG2, gG3 and IgG4 exhibit differential capacity to recruit immune functions, such as antibody-dependent cellular cytotoxicity (ADCC, e.g., IgG1 and IgG3), antibody-dependent cellular phagocytosis (ADCP, e.g., IgG1, IgG2, IgG3 and IgG4), and complement dependent cytotoxicity (CDC, e.g., IgG1, IgG3). Sub-type-specific engagement of such immune functions is based on selectivity for Fc receptors on distinct immune cells and the ability to bind C1q and activate the assembly of a membrane attack complex (MAC).
Among the various types, relative affinity for FcY receptors (e.g., FcYRI, FcYRIIa/b/c, FcYRIIIa/b) is high for IgG1 and IgG3, however, there is minimal affinity for IgG2 (restricted to the FcYRIIa 131H polymorphism), and IgG4 only has measurable affinity for FcYRI. Using comparative sequence analysis and co-crystal structures, the key contact residues for receptor binding have been mapped to the amino acid residues spanning the lower hinge and CH2 region. Using standard protein engineering techniques, some success in enhancing or reducing the affinity of an antibody preparation for Fc receptors and the C1q component of complement has been achieved.
Among the isotypes, IgG2 is least capable of binding the family of Fc receptors. Using IgG2 as the starting point, efforts have been made to find a mutant with diminished effector functions but which retains FcRn binding, prolonged stability, and low immunogenicity. Improved mutants of this nature may provide improved antibody therapeutics with retained safety. Human IgG1 therapeutic antibodies that bind to cell surface targets are able to engage effector cells that may mediate cell lysis of the target cell by antibody-dependent cellular cytotoxicity (ADCC) or complement dependent cytotoxicity (CDC). These mechanisms occur through interaction of the CH2 region of the antibody Fc domain to FcyR receptors on immune effector cells or with C1q, the first component of the complement cascade. Table 19 shows the activities of different human gamma sub-types. The skilled person may choose accordingly to promote or dampen-down activity depending upon the disease setting in humans of interest. For example, use of a human gamma-1 constant region is desirable when one wishes to isolated totally human heavy chains and antibodies that have relatively high complement activation activity by the classical pathway and FcYR1 recognition in human patients. See also Mol Immunol. 2003 December; 40(9):585-93; “Differential binding to human Fcgamma RIIe and Fcgamma RIIb receptors by human IgG wild type and mutant antibodies”; Armour K L et al, which is incorporated herein by reference.
IgG2 constant regions are well suited to producing antibodies and heavy chains according to the invention for binding to cytokines or soluble targets in humans, since IgG2 is essentially FcYRI,III-silent, FcYRIIa-active and has little Complement activity.
IgG1 constant regions have wide utility for human therapeutics, since IgG1 antibodies and heavy chains are FcYRI,II,III-active and have complement activity. This can be enhanced by using a human gamma-1 constant region that has been activated by engineering as is known in the art.
The work of the inventors has therefore identified a collection of human constant region of different isotypes from which an informed choice can be made when humanizing chimaeric antibody chains (or conjugating V domains, such as dAbs or Camelid VHH, to constant regions). The collection was identified on the basis of bioinformatics analysis of the 1000 Genomes database, the inventors selecting constant region variants that are frequently occurring across several human ethnic populations, as well as those that appear with relatively high frequency within individual populations (as assessed by the number of individuals whose genomes comprise the variant). By sorting through the myriad possible sequences on this basis, the inventors have provided a collection of human constant region variants that are naturally-occurring and which can be used when rationally designing
antibodies, heavy chains and other antibody-based formats that bear a human constant region. In particular, this is useful when humanizing chimaeric heavy chains to produce totally human chains in which both the variable and constant regions are human. This is useful for compatibility with human patients receiving antibody-based drugs.
To this end, the invention provides the following aspects:—
For the constant region according to any aspect of this configuration, either genomic DNA or equivalent (i.e., having introns and exons and optionally also 5′ UTR sequences, e.g., with native or a non-native leader sequence) can be used for the constant region. For example, any of the “GENOMIC” sequences disclosed as SEQ ID NO: 365 onwards herein. Alternatively, an intron less sequence can be used, for example any of the “CDS” sequences disclosed as SEQ ID NO: 365 onwards herein (e.g., with native or a non-native leader sequence).
| ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCCACCGCCACCGGCG |
| TGCACAGC |
| MGWSCIILFLVATATGVHS |
Wherein the populations are numbered as follows (population labels being according to 1000 Genomes Project nomenclature)
The inventors' analysis has revealed groupings of naturally-occurring human antibody gene segment variants as set out in Table 13 and Table 14. This revealed the possibility of producing transgenic genomes in non-human vertebrates and cells wherein the genomes contain more than the natural human complement of specific human gene segments. In one example, this can be achieved by providing more than the natural human complement of a specific gene segment type on one or both of the respective Ig locus (e.g., one or both chromosomes harbouring IgH in a mouse genome or mouse cell genome).
To this end, this configuration of the invention provides the following (as set out in numbered paragraphs):—
In another aspect, it is of note that certain human gene segment variants may appear relatively frequently in one or a small number of populations, but is not found prevalently across many different human populations. There is thinking that specific germline gene segment repertoires have evolved in individual human ethnic populations due to iterative exposure to antigens (e.g., disease pathogen antigens) to which the population is often exposed. Repeated exposure and mutation may have lead to the evolution of gene segment variants that can provide an effective response to the antigen (pathogen) in the population, and this may explain the conservation of the gene segments in those populations (as opposed to other human ethnic populations that may not have frequently encountered the antigen). With this in mind, the inventors identified gene segment variants from their analysis that are relatively prevalent in a small number of human populations, and not across many populations. The inventors realized that inclusion of one or more of such gene segments in the configurations of the invention (e.g., in transgenic Ig loci, vertebrates and cells) would be useful for producing antibodies, Ig chains and variable domains that can address antigens (e.g., disease-causing antigens or pathogens) to which the small number of human populations may become exposed. Such products would be useful for treating and/or preventing disease or medical conditions in members of such a population. This aspect could also be useful for addressing infectious disease pathogens that may have been common in the small number of populations, but which in the future or relatively recently in evolution has become a more prevalent disease-causing pathogen in other human populations (i.e., those not listed in Table 13 against the gene segment variant(s) in question). To this end, from the 1000 Genomes database the inventors have identified the gene segment variants listed in Table 20.
Thus, according to any configuration or aspect described herein, one, more or all of the gene segments used in the present invention can be a gene segment listed in Table 20A, 20B, 20C or 20D.
A specific application of this configuration is the provision of multiple human JH gene segments as follows.
A non-human vertebrate (e.g., a mouse or rat) or a non-human vertebrate cell (e.g., an ES cell or a B-cell) having a genome comprising at least 3 human JH gene segments of the same type (JH1, JH2, JH3, JH4, JH5 or JH6), wherein at least two of the human JH gene segments are variants that are not identical to each other.
In an example, any cell of the invention is an isolated cell. An “isolated” cell is one that has been identified, separated and/or recovered from a component of its production environment (e.g., naturally or recombinantly). Preferably, the isolated cell is free of association with all other components from its production environment, e.g., so that the cell can produce an antibody to an FDA-approvable or approved standard. Contaminant components of its production environment, such as that resulting from recombinant transfected cells, are materials that would typically interfere with research, diagnostic or therapeutic uses for the resultant antibody, and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. In preferred embodiments, the polypeptide will be purified: (1) to greater than 95% by weight of antibody as determined by, for example, the Lowry method, and in some embodiments, to greater than 99% by weight; (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or, preferably, silver stain. Ordinarily, however, an isolated cell will be prepared by at least one purification step.
A non-human vertebrate (e.g., a mouse or rat) or a non-human vertebrate cell (e.g., an ES cell or a B-cell) having a genome comprising at least 2 different non-endogenous JH gene segments (e.g., human gene segments) of the same type (JH1, JH2, JH3, JH4, JH5 or JH6) cis at the same Ig (e.g., IgH, e.g., endogenous IgH, e.g., mouse or rat IgH) locus. In an example, the genome comprises a human VH, D and JH repertoire comprising said different JH gene segments. Optionally the non-endogenous JH gene segments are non-mouse or non-rat, e.g., human JH gene segments. In an example one or more or all of the non-endogenous gene segments are synthetic.
A non-human vertebrate (e.g., a mouse or rat) or a non-human vertebrate cell (e.g., an ES cell or a B-cell) having a genome comprising at least 2 different human JH gene segments of the same type (JH1, JH2, JH3, JH4, JH5 or JH6) trans at the same Ig (e.g., IgH, e.g., endogenous IgH, e.g., mouse or rat IgH) locus; and optionally a third human JH gene segments of the same type, wherein the third JH is cis with one of said 2 different JH gene segments.
A population of non-human vertebrates (e.g., mice or rats) comprising a repertoire of human JH gene segments, wherein the plurality comprises at least 2 different human JH gene segments of the same type (JH1, JH2, JH3, JH4, JH5 or JH6), a first of said different JH gene segments is provided in the genome of a first vertebrate of the population, and a second of said different JH gene segments being provided in the genome of a second vertebrate of the population, wherein the genome of the first vertebrate does not comprise the second JH gene segment.
A non-human vertebrate (e.g., a mouse or rat) or a non-human vertebrate cell (e.g., an ES cell or a B-cell) having a genome comprising at least 2 different non-endogenous (e.g., human) JH gene segments of the same type (JH1, JH2, JH3, JH4, JH5 or JH6), wherein the JH gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations (e.g., 3, 4, 5 or 6 generations). Optionally the non-endogenous JH gene segments are human JH gene segments. In an example one or more or all of the non-endogenous gene segments are synthetic.
A method of enhancing the human immunoglobulin gene diversity of a non-human vertebrate (e.g., a mouse or rat), the method comprising providing the vertebrate with a genome comprising at least 3 human JH gene segments of the same type (JH1, JH2, JH3, JH4, JH5 or JH6), wherein at least two of the human JH gene segments are variants that are not identical to each other.
A method of enhancing the immunoglobulin gene diversity of a non-human vertebrate (e.g., a mouse or rat), the method comprising providing the vertebrate with a genome comprising at least 2 different non-endogenous (e.g., human) JH gene segments of the same type (JH1, JH2, JH3, JH4, JH5 or JH6) cis at the same Ig (e.g., IgH, e.g., endogenous IgH, e.g., mouse or rat IgH) locus). Optionally the non-endogenous JH gene segments are non-mouse or non-rat, e.g., human JH gene segments. In an example one or more or all of the non-endogenous gene segments are synthetic.
A method of enhancing the immunoglobulin gene diversity of a non-human vertebrate (e.g., a mouse or rat), the method comprising providing the vertebrate with a genome comprising at least 2 different human JH gene segments of the same type (JH1, JH2, JH3, JH4, JH5 or JH6) trans at the same Ig (e.g., IgH, e.g., endogenous IgH, e.g., mouse or rat IgH) locus; and optionally a third human JH gene segments of the same type, wherein the third JH is cis with one of said 2 different JH gene segments.
A method of providing an enhanced human immunoglobulin JH gene segment repertoire, the method comprising providing a population of non-human vertebrates (e.g., a mouse or rat) comprising a repertoire of human JH gene segments, wherein the method comprises providing at least 2 different human JH gene segments of the same type (JH1, JH2, JH3, JH4, JH5 or JH6), wherein a first of said different JH gene segments is provided in the genome of a first vertebrate of the population, and a second of said different JH gene segments is provided in the genome of a second vertebrate of the population, wherein the genome of the first vertebrate does not comprise the second JH gene segment.
A method of enhancing the human immunoglobulin gene diversity of a non-human vertebrate (e.g., a mouse or rat), the method comprising providing the vertebrate with a genome comprising at least 2 different non-endogenous (e.g., human) JH gene segments of the same type (JH1, JH2, JH3, JH4, JH5 or JH6), wherein the JH gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations (e.g., 3, 4, 5, or 6 generations). Optionally the non-endogenous JH gene segments are human JH gene segments. In an example one or more or all of the non-endogenous gene segments are synthetic.
In an example of the vertebrate or cell or the method of the invention at least 2 or 3 of said different gene segments are provided cis at the same Ig locus in said genome.
In an example of the vertebrate or cell or the method of the invention the JH gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations (e.g., 3, 4, 5, or 6 generations).
In an example of the vertebrate or cell or the method of the invention the JH gene segments are derived from the genome sequence of two or more different human individuals; optionally wherein the different human individuals are from different human populations.
In an example of the vertebrate or cell or the method of the invention the individuals are not genetically related (e.g., going back 3, 4, 5, or 6 generations).
In an example of the vertebrate or cell or the method of the invention at least one of the different JH segments is a synthetic mutant of a human germline JH gene segment.
The invention also provides a method of enhancing the human immunoglobulin gene diversity of a non-human vertebrate (e.g., a mouse or rat), the method comprising providing the vertebrate with a genome comprising at least 2 human JH gene segments of the same type (JH1, JH2, JH3, JH4, JH5 or JH6), wherein the JH gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations (e.g., 3, 4, 5, or 6 generations); optionally wherein at least 2 or 3 of said different gene segments are provided at the same IgH locus in said genome.
In an example of the vertebrate or cell or the method of this embodiment of the invention the genome comprises a substantially complete functional repertoire of human JH gene segment types supplemented with one, two or more human JH gene segments, wherein said substantially complete functional repertoire and the supplementary JH gene segments are not found together in the germline genome of a human individual.
In an example of the population of the invention, the population comprises a substantially complete functional repertoire of human JH gene segment types supplemented with one, two or more human JH gene segments, wherein said substantially complete functional repertoire and the supplementary JH gene segments are not found together in the germline genome of a human individual.
A non-human vertebrate (e.g., a mouse or rat) or a non-human cell (e.g., an ES cell or a B-cell) having a genome comprising a substantially complete functional repertoire of human JH gene segment types supplemented with one, two or more human JH gene segments, wherein said substantially complete functional repertoire and the supplementary JH gene segments are not found together in the germline genome of a human individual.
A population of non-human vertebrates (e.g., mice or rats) comprising a substantially complete functional repertoire of human JH gene segment types supplemented with one, two or more human JH gene segments, wherein said substantially complete functional repertoire and the supplementary JH gene segments are not found together in the germline genome of a human individual.
In an example of the vertebrate or the population, at least one of said JH gene segments is SEQ ID NO: 1, 2, 3 or 4. For example, at least one of said JH gene segments is SEQ ID NO: 1 and at least one, two or more of said supplementary JH gene segments is a variant according to any example above. For example, at least one of said JH gene segments is SEQ ID NO: 2 and at least one, two or more of said supplementary JH gene segments is a variant according to any one of the examples above. For example, at least one of said JH gene segments is SEQ ID NO: 2 and at least one, two or more of said supplementary JH gene segments is a variant according to any one of the examples above.
In an embodiment, the non-human vertebrate or vertebrate cell of the invention comprises a genome that comprises VH, D and JH gene repertoires comprising human gene segments, the JH gene repertoire (e.g., a human JH gene segment repertoire) comprising a plurality of JH1 gene segments provided by at least 2 different JH1 gene segments in cis at the same Ig locus in said genome;
a plurality of JH2 gene segments provided by at least 2 different JH2 gene segments in cis at the same Ig locus in said genome;
a plurality of JH3 gene segments provided by at least 2 different JH3 gene segments in cis at the same Ig locus in said genome;
a plurality of JH4 gene segments provided by at least 2 different JH4 gene segments in cis at the same Ig locus in said genome;
a plurality of JH5 gene segments provided by at least 2 different JH5 gene segments in cis at the same Ig locus in said genome; and/or
a plurality of JH6 gene segments provided by at least 2 different JH6 gene segments in cis at the same Ig locus in said genome;
optionally wherein the JH gene segments are derived from the genome sequence of two or more different human individuals.
Optionally said at least 2 different JH gene segments are human gene segments or synthetic gene segments derived from human gene segments.
Optionally, the Ig locus is a IgH locus, e.g., an endogenous locus, e.g., a mouse or rat IgH locus.
In an embodiment, the non-human vertebrate or vertebrate cell of the invention comprises a genome that comprises VH, D and JH gene repertoires comprising human gene segments, the JH gene repertoire (e.g., a human JH gene segment repertoire) comprising a plurality of JH1 gene segments provided by at least 3 different JH1 gene segments; a plurality of JH2 gene segments provided by at least 3 different JH2 gene segments; a plurality of JH3 gene segments provided by at least 3 different JH3 gene segments; a plurality of JH4 gene segments provided by at least 3 different JH4 gene segments; a plurality of JH5 gene segments provided by at least 3 different JH5 gene segments; and/or a plurality of JH6 gene segments provided by at least 3 different JH6 gene segments; optionally wherein the JH gene segments are derived from the genome sequence of two or three different human individuals;
optionally wherein at least 2 or 3 of said different gene segments are provided in cis at the same Ig locus in said genome.
Optionally said at least 3 different JH gene segments are human gene segments or synthetic gene segments derived from human gene segments.
Optionally, the Ig locus is a IgH locus, e.g., an endogenous locus, e.g., a mouse or rat IgH locus.
Optionally in the vertebrate or cell the different human individuals are from different human populations.
Optionally in the vertebrate or cell the individuals are not genetically related (e.g., Going back 3, 4, 5 or 6 generations).
Optionally in the vertebrate or cell at least one of the different JH segments is a synthetic mutant of a human germline JH gene segment.
In an embodiment of a non-human vertebrate or vertebrate cell (optionally an ES cell or B-cell) according to the invention, the vertebrate or cell genome comprises human VH, D and JH gene repertoires, the JH gene repertoire (e.g., a human JH gene repertoire) comprising a plurality of JH1 gene segments provided by at least 2 different human JH1 gene segments, optionally in cis at the same Ig locus in said genome;
a plurality of JH2 gene segments provided by at least 2 different human JH2 gene segments, optionally in cis at the same Ig locus in said genome;
a plurality of JH3 gene segments provided by at least 2 different human JH3 gene segments, optionally in cis at the same Ig locus in said genome;
a plurality of JH4 gene segments provided by at least 2 different human JH4 gene segments, optionally in cis at the same Ig locus in said genome;
a plurality of JH5 gene segments provided by at least 2 different human JH5 gene segments, optionally in cis at the same Ig locus in said genome; and/or
a plurality of JH6 gene segments provided by at least 2 different human JH6 gene segments, optionally in cis at the same Ig locus in said genome;
wherein the JH gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations (e.g., 3, 4, 5 or 6 generations).
Optionally said at least 2 different JH gene segments are human gene segments or synthetic gene segments derived from human gene segments.
Optionally, the Ig locus is a IgH locus, e.g., an endogenous locus, e.g., a mouse or rat IgH locus. Optionally in the vertebrate or cell the human individuals are from different human populations.
An embodiment provides a vertebrate, cell or population of the invention whose genome comprises a plurality of JH5 gene segments, wherein the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises a nucleotide mutation at one or more positions corresponding to positions
106,330,024
106,330,027
106,330,032
106,330,041
106.330.44
106.330.45
106.330.62
106.330.63
106.330.65
106.330.66
106.330.67
106.330.68 and
106,330,071
on human chromosome 14.
In the vertebrate, cell or population optionally the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises a guanine at a position corresponding to position 106,330,067 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
Optionally the variant comprises additionally a mutation at a position corresponding to (i) position 106,330,071 on human chromosome 14 (optionally the additional mutation being a guanine); (ii) position 106,330,066 on human chromosome 14 (optionally the additional mutation being a guanine); and/or (iii) position 106,330,068 on human chromosome 14 (optionally the additional mutation being a thymine).
Optionally the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises a guanine at a position corresponding to position 106,330,071 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
Optionally the variant comprises additionally a mutation at a position corresponding to (i) position 106,330,063 on human chromosome 14 (optionally the additional mutation being an adenine); and/or (ii) position 106,330,067 on human chromosome 14 (optionally the additional mutation being a guanine).
Optionally the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises a cytosine at a position corresponding to position 106,330,045 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
Optionally the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises an adenine at a position corresponding to position 106,330,044 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
Optionally the variant comprises additionally a mutation at a position corresponding to (i) position 106.330.66 on human chromosome 14 (optionally the additional mutation being a guanine); and/or (ii) position 106,330,068 on human chromosome 14 (optionally the additional mutation being a thymine).
Optionally the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises a guanine at a position corresponding to position 106,330,066 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
Optionally the variant comprises additionally a mutation at a position corresponding to (i) position 106.330.67 on human chromosome 14 (optionally the additional mutation being a guanine); and/or (ii) position 106,330,068 on human chromosome 14 (optionally the additional mutation being a thymine).
Optionally the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises a thymine at a position corresponding to position 106,330,068 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
Optionally the variant comprises additionally a mutation at a position corresponding to (i) position 106,330,067 on human chromosome 14 (optionally the additional mutation being a guanine); and/or (ii) position 106,330,066 on human chromosome 14 (optionally the additional mutation being a guanine).
Optionally the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises a cytosine at a position corresponding to position 106,330,027 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
Optionally the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises an adenine at a position corresponding to position 106,330,024 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
Optionally the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises a thymine at a position corresponding to position 106,330,032 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
Optionally the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises a thymine at a position corresponding to position 106,330,041 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
Optionally the plurality comprises a human JH5 gene variant of SEQ ID NO: 1, wherein the variant comprises an adenine or thymine at a position corresponding to position 106,330,063 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
Optionally the variant comprises additionally a mutation at a position corresponding to position 106,330,071 on human chromosome 14 (optionally the additional mutation being a guanine).
Optionally the plurality comprises a human JH5 gene variant of SEQ ID NO: 1,wherein the variant comprises a cytosine at a position corresponding to position 106,330,062 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 1.
Optionally the genome comprises SEQ ID NO:1; optionally in cis at the same Ig locus as one, two or more of the variants.
An embodiment provides a vertebrate, cell or population of the invention whose genome comprises a plurality of JH6 gene segments, wherein the plurality comprises a human JH6 gene variant of SEQ ID NO: 2, wherein the variant comprises a nucleotide mutation at one or more positions corresponding to positions
106,329,411
106.329.413
106.329.414
106,329,417
106,329,419
106,329,426
106,329,434
106,329,435, and
106,329,468
on human chromosome 14.
Optionally the genome of the vertebrate, cell or population comprises a plurality of JH6 gene segments, wherein the plurality comprises a human JH6 gene variant of SEQ ID NO: 2, wherein the variant comprises a guanine at a position corresponding to position 106,329,435 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 2.
Optionally the variant comprises additionally a mutation at a position corresponding to (i) position 106,329,468 on human chromosome 14 (optionally the additional mutation being a guanine); (ii) position 106,329,419 on human chromosome 14 (optionally the additional mutation being an adenine); (iii) position 106,329,434 on human chromosome 14 (optionally the additional mutation being a cytosine) and/or position 106,329,414 on human chromosome 14 (optionally the additional mutation being a guanine); (iv) position 106,329,426 on human chromosome 14 (optionally the additional mutation being an adenine); (v) position 106,329,413 on human chromosome 14 (optionally the additional mutation being an adenine); (vi) position 106,329,417 on human chromosome 14 (optionally the additional mutation being a thymine); (vii) position 106,329,411 on human chromosome 14 (optionally the additional mutation being a thymine); (viii) position 106,329,451 on human chromosome 14 (optionally the additional mutation being an adenine); (ix) position 106,329,452 on human chromosome 14 (optionally the additional mutation being a cytosine); and/or (x) position 106,329,453 on human chromosome 14 (optionally the additional mutation being a cytosine).
Optionally the variant comprises additionally mutations at positions corresponding to position 106.329.451 on human chromosome 14, the additional mutation being an adenine; position 106.329.452 on human chromosome 14, the additional mutation being a cytosine; and position 106.329.453 on human chromosome 14, the additional mutation being a cytosine.
The vertebrate, cell or population optionally comprises a plurality of JH6 gene segments, wherein the plurality comprises a human JH6 gene variant of SEQ ID NO: 2, wherein the variant comprises a guanine at a position corresponding to position 106,329,468 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 2.
Optionally the variant comprises additionally a mutation at a position corresponding to position 106,329,435 on human chromosome 14 (optionally the additional mutation being a guanine).
Optionally the vertebrate, cell or population comprises a plurality of JH6 gene segments, wherein the plurality comprises a human JH6 gene variant of SEQ ID NO: 2, wherein the variant comprises a thymine at a position corresponding to position 106,329,417 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 2.
Optionally the variant comprises additionally a mutation at a position corresponding to position 106,329,435 on human chromosome 14 (optionally the additional mutation being a guanine).
Optionally the vertebrate, cell or population comprises a plurality of JH6 gene segments, wherein the plurality comprises a human JH6 gene variant of SEQ ID NO: 2, wherein the variant comprises a cytosine at a position corresponding to position 106,329,434 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 2.
Optionally the variant comprises additionally a mutation at a position corresponding to (i) position 106,329,414 on human chromosome 14 (optionally the additional mutation being a guanine); and/or (ii) position 106,329,435 on human chromosome 14 (optionally the additional mutation being a guanine).
Optionally the vertebrate, cell or population comprises a plurality of JH6 gene segments, wherein the plurality comprises a human JH6 gene variant of SEQ ID NO: 2, wherein the variant comprises a thymine at a position corresponding to position 106,329,411 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 2.
Optionally the variant comprises additionally a mutation at a position corresponding to position 106,329,435 on human chromosome 14 (optionally the additional mutation being a guanine).
Optionally the vertebrate, cell or population comprises a plurality of JH6 gene segments, wherein the plurality comprises a human JH6 gene variant that is an antisense sequence of a variant described above.
Optionally the genome comprises SEQ ID NO:2; optionally cis at the same Ig locus as one, two or more of the JH6 variants.
An embodiment provides a vertebrate, cell or population of the invention whose genome comprises a plurality of JH2 gene segments, wherein the plurality comprises a human JH2 gene variant of SEQ ID NO: 3, wherein the variant comprises a nucleotide mutation at one or more positions corresponding to positions
106,331,455
106,331,453, and
106,331,409
on human chromosome 14.
Optionally the vertebrate, cell or population comprises said plurality of JH2 gene segments, wherein the plurality comprises a human JH2 gene variant of SEQ ID NO: 3, wherein the variant comprises a guanine at a position corresponding to position 106,331,455 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 3.
Optionally the variant comprises additionally a mutation at a position corresponding to (i) position 106,331,453 on human chromosome 14 (optionally the additional mutation being an adenine); and/or (ii) position 106,331,409 on human chromosome 14 (optionally the additional mutation being an adenine); (iii) position 106,329,434 on human chromosome 14 (optionally the additional mutation being an adenine).
Optionally the vertebrate, cell or population comprises a plurality of JH2 gene segments, wherein the plurality comprises a human JH2 gene variant of SEQ ID NO: 3, wherein the variant comprises an adenine at a position corresponding to position 106,331,453 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 3.
Optionally the variant comprises additionally a mutation at a position corresponding to position 106,331,409 on human chromosome 14 (optionally the additional mutation being an adenine).
Optionally the vertebrate, cell or population comprises a plurality of JH2 gene segments, wherein the plurality comprises a human JH2 gene variant of SEQ ID NO: 3, wherein the variant comprises an adenine at a position corresponding to position 106,331,409 on human chromosome 14; and optionally no further mutation from the sequence of SEQ ID NO: 3.
Optionally the vertebrate, cell or population comprises a plurality of JH2 gene segments, wherein the plurality comprises a human JH2 gene variant that is an antisense sequence of a variant described above.
Optionally the genome comprises SEQ ID NO:3; optionally cis at the same Ig locus as one, two or more of the JH2 variants.
Optionally the vertebrate, cell or population genome comprises two or more different JH gene segments selected from SEQ ID NOs: 1 to 3 and variants described above; optionally wherein said JH gene segments are cis at the same immunoglobulin Ig locus.
A specific application of this configuration is the provision of multiple human D gene segments as follows (as set out in numbered clauses, starting at clause number 154).
A specific application of this configuration is the provision of multiple human JLgene segments (JK and/or JA) as follows (as set out in numbered paragraphs, starting at paragraph number 80).
wherein the JL gene segments are derived from the genome sequence of different human individuals that are not genetically related over at least 3 generations; optionally wherein at least 2 or 3 of said different gene segments are provided at the same IgL locus in said genome.
The inventors realised that it would be desirable to provide for vertebrates, cells, methods etc for the production of therapeutic and/or prophylactic antibodies based on natural human immune responses to antigens, such as antigens of infectious disease pathogens. In this respect, the literature observes frequently used immunoglobulin gene segments to raise anti-infective responses in humans (Table 9).
In the various configurations, aspects, embodiments and examples above, the invention provides the skilled addressee with the possibility of choosing immunoglobulin gene segments in a way that tailors or biases the repertoire for application to generating antibodies to treat and/or prevent infectious diseases. The inventors have categorized the following groups of gene segments for use in the invention according to the desired application of resultant antibodies.
Immunoglobulin Gene Segments for Antibodies that Bind an Antigen Expressed by a Pathogen
Immunoglobulin Gene Segments for Antibodies that Bind an Antigen Expressed by a Pathogen
Immunoglobulin Gene Segments for Antibodies that Bind an Antigen Expressed by H Influenza
Immunoglobulin Gene Segments for Antibodies that Bind an Antigen Expressed by E. coli or Neisseria meningitidis
Immunoglobulin Gene Segments for Antibodies that Bind an Antigen Expressed by a Viral Pathogen
Immunoglobulin Gene Segments for Antibodies that Bind an Antigen Expressed by Herpes Virus Family (e.g., VZV or HSV)
Immunoglobulin Gene Segments for Antibodies that Bind an Antigen Expressed by CMV
Immunoglobulin Gene Segments for Antibodies that Bind an Antigen Expressed by Influenza Virus
Thus,
Where one wishes to generate an antibody or antibody mixture to treat and/or prevent an infectious disease, one or more V, D and/or or all J gene segments used in any configuration, aspect, method, example or embodiment of the invention can be selected from List A1. Thus, for example in (a) of the first configuration of the invention, the recited heavy chain V gene segment is selected from the VH gene segments in List A, optionally with a D in that list.
Where one wishes to generate an antibody or antibody mixture to treat and/or prevent an infectious disease caused or mediated by a bacterial pathogen, one or more or all V, D and/or J gene segments used in any configuration, aspect, method, example or embodiment of the invention can be selected from List A1.
Where one wishes to generate an antibody or antibody mixture to treat and/or prevent an infectious disease caused or mediated by a viral pathogen, one or more or all V, D and/or J gene segments used in any configuration, aspect, method, example or embodiment of the invention can be selected from List A2.
Where one wishes to generate an antibody or antibody mixture to treat and/or prevent an infectious disease caused or mediated by H influenza, one or more or all V, D and/or J gene segments used in any configuration, aspect, method, example or embodiment of the invention can be selected from List A1.1.
Where one wishes to generate an antibody or antibody mixture to treat and/or prevent an infectious disease caused or mediated by E. coli or Neisseria meningitidis, one or more or all V, D and/or J gene segments used in any configuration, aspect, method, example or embodiment of the invention can be selected from List A1.2.
Where one wishes to generate an antibody or antibody mixture to treat and/or prevent an infectious disease caused or mediated by Herpes Virus Family (e.g., VZV or HSV), one or more or all V, D and/or J gene segments used in any configuration, aspect, method, example or embodiment of the invention can be selected from List A2.1.
Where one wishes to generate an antibody or antibody mixture to treat and/or prevent an infectious disease caused or mediated by CMV, one or more or all V, D and/or J gene segments used in any configuration, aspect, method, example or embodiment of the invention can be selected from List A2.2.
Where one wishes to generate an antibody or antibody mixture to treat and/or prevent an infectious disease caused or mediated by HIV, one or more or all V, D and/or J gene segments used in any configuration, aspect, method, example or embodiment of the invention can be selected from List A2.3.
Where one wishes to generate an antibody or antibody mixture to treat and/or prevent an infectious disease caused or mediated by Influenza Virus, one or more or all V, D and/or J gene segments used in any configuration, aspect, method, example or embodiment of the invention can be selected from List A2.4.
Optionally each VH segment in the locus of the invention is selected from List A1, A2, A1.1, A1.2, A2.1, A2.2, A2.3 or A2.4.
Optionally each VL segment in the locus of the invention is selected from List A1, A2, A1.1, A1.2, A2.1, A2.2, A2.3 or A2.4
Optionally each D segment in the locus of the invention is selected from List A1, A2, A1.1, A1.2, A2.1, A2.2, A2.3 or A2.4.
Optionally each JL segment in the locus of the invention is selected from List A1, A2, A1.1, A1.2, A2.1, A2.2, A2.3 or A2.4.
The inventors, having undertaken the extensive Bioinformatics analysis exercise described herein, realised that the output of that analysis has made it possible to identify specific gene segments that are useful to produce antibody- and VH domain-based drugs that are tailored specifically to a patient's ancestry (i.e., genotype). That is, antibodies can be selected on the basis that they are made in vivo in a transgenic non-human vertebrate (e.g., mouse or rat with transgenic IgH loci) and particularly derived from gene segments that are relatively prevalent in members of the patient's population, i.e., from individuals of the same human ancestry. Since variant distributions differ across different populations (see Table 13), this presumably reflects the effects of evolution, adaptation and conservation of useful variant gene types in those populations. Thus, by tailoring the antibody-based drugs according to the invention, it is possible to match the drug to the population gene biases, thus with the aim of making better drugs for that specific population of humans. Better can, for example, mean more efficacious, better neutralizing, higher target antigen affinity, less immunogenic, less patient reactions to the drug etc. This can be determined empirically, as is standard in drug research and development processes.
Thus, the invention provides the following embodiments (numbered from clause 345 onwards):—
In another embodiment, the invention provides
An antibody heavy chain or VH domain (e.g., provided as part of an antibody) for therapy and/or prophylaxis of a disease or medical condition in a Chinese patient, wherein the heavy chain is a heavy chain produced by the following steps (or is a copy of such a heavy chain):—
In an example, the VH gene segment is found in the 1000 Genomes database. In an example, the gene segment is found in Table 13.
In another embodiment, the invention provides
The antibody of clause 361 or 362, wherein the variable domain is derived from the recombination of a human VH gene segment with a human D gene segment and a human JH gene segment, the VH gene segment being selected from a VH present in a Chinese population with a cumulative frequency of at least 5%.
In an example, the gene segment is found in the 1000 Genomes database. In an example, the gene segment is found in Table 13.
The present invention is described in more detail in the following non limiting prophetic Examples.
FIG. 1 through 3 depict recombineering methods (see references above) that can be used to introduce polymorphic V-gene regions into genomic DNA. In one embodiment, a genomic fragment from the human heavy chain region is inserted into a bacterial artificial chromosome (BAC) vector by standard techniques. Preferably, such a BAC, which can range in size from 20-kb to 200-kb or more, can be isolated from libraries of BACs by standard techniques including sequence searches of commercially available libraries or by hybridization to bacterial colonies containing BACs to identify those with a BAC of interest.
A BAC is chosen that has several VH gene segments; in FIG. 1, these are generically identified as VH[a] through VH[z] for example. One skilled in the art will readily identify appropriate genomic fragments, for example, an approximately 120-kb fragment from human VH5-78 through VH1-68 which includes 5 endogenous active VH gene segments and 7 VH pseudogenes. Using recombineering techniques, the endogenous VH gene segments can be replaced by polymorphic VH or VL gene segments. In this example, two steps are required. The first step replaces the V-region coding exon of an endogenous VH gene segment with a positive-negative selection operon, in this example, an operon encoding an ampicillin resistance gene (Amp) and a streptomycin-sensitizing ribosomal protein (rpsL). Certain strains of bacteria can be selected for the absence of the rpsL gene by resistance to streptomycin. Short stretches of DNA homologous to sequences flanking the endogenous VH gene exon are placed 5′ and 3′ of the rpsL-Amp operon. In the presence of appropriate recombination factors per standard recombineering techniques (see references above) recombination between the operon fragment and the BAC will result in replacement of the endogenous VH gene exon with the operon (FIG. 1a) which are selected by resistance to ampicillin. The second step uses the same homologous sequences in order to replace the inserted operon with a desired polymorphic VH gene segment. In this example, a human VH1-69 gene is inserted (FIGS. 1b and 1c). In particular the *02 variant of VH1-69 is used [ref IMGT and FIG. 5]. Successful integrations of the polymorphic VH gene segment are selected in bacteria that become resistant to streptomycin due to the loss of the operon, specifically the rpsL portion.
In this example, the two step process as described can be repeated for each of the endogenous VH gene segments or for as many endogenous gene segments that one wishes to replace with polymorphic V gene segments (FIG. 1d).
As is apparent, any polymorphic V gene segment can be inserted in this manner and any endogenous V gene segment can act as a target, including pseudogenes. V gene segments in each of the heavy chain and two light chain loci can be replaced using this technique with appropriate genomic fragments available as BAC inserts.
FIG. 2 depicts another method for creating a genomic fragment encoding polymorphic V gene segments. In this example, polymorphic V gene segments are inserted into a region of genomic DNA devoid of other genes, control elements or other functions. Such ‘desert’ regions can be selected based on sequence analysis and corresponding DNA fragments cloned into BACs or identified in existing BAC libraries. Starting with such a genomic fragment, recombineering techniques can be used to insert polymorphic V gene segments at intervals of, for example, 10-kb. In this example, a 150-kb genomic fragment might accommodate insertion of up to 15 polymorphic V gene segments. Insertion of the segments is a two-step process. The first recombineering step inserts the rpsL-Amp operon at a specific site. Sequences homologous to a specific site are used to flank the operon. These are used by the recombineering system to insert the element specifically into the BAC genomic fragment and positive events are selected by resistance to ampicillin (FIG. 2a). The second step replaces the operon in the genomic fragment with a polymorphic V gene segment by a similar recombineering step using the same sequence homology (FIG. 2b). In this example, both
exons and promoter element of a polymorphic VH gene segment are inserted, resulting in replacement of the rpsL-Amp operon and therefore resistance to streptomycin (FIG. 2c).
The two step technique for inserting polymorphic V gene segments into a specific site on the genomic fragment can be repeated multiple times resulting in a BAC genomic fragment with several polymorphic gene segments, including their promoter elements. It is apparent that the examples shown in FIGS. 1 and 2 can be combined wherein the technique for insertion can be used to add extra polymorphic V gene segments to a BAC genomic fragment as depicted in FIG. 1. One might choose to add these extra segments to an IG genomic fragment since such a fragment would be more amenable to proper IG gene expression once inserted into a non-human mammal's genome. It is known that a genomic fragment can have elements such as enhancers or elements that contribute to certain chromatin conformations, both important in wild-type gene expression.
FIG. 3 depicts an additional method to create genomic fragments with polymorphic V gene segments. This method depends upon the efficiency with which short (around 50 to 150 bases, preferably 100 bases) single stranded DNA fragments recombine with a homologous sequence using recombineering (Nat Rev Genet. 2001 October; 2(10):769-79; Recombineering: a powerful new tool for mouse functional genomics; Copeland N G, Jenkins N A, Court D L). The recombinases used in recombineering preferentially bind and use such short single-stranded fragments of DNA as a substrate for initiating homologous recombination. The efficiency can be as high as 10-2, that is, a positive event can be found in approximately 100 randomly picked (not selected) clones resulting from recombineering. A positive event in this example occurring when one or more single nucleotide changes introduced into the single-stranded fragment get transferred to the BAC insert containing V gene segments and surrounding genomic DNA, said nucleotide change or changes occurring at a homologous sequence on the BAC.
Polymorphic V gene segments can differ from endogenous V gene segments by only 1 or 2, or up to 10 or 15 nucleotide changes, for example. An example of such nucleotide polymorphisms are depicted in FIG. 5. Short single stranded regions that encompass the polymorphic nucleotide changes can be chemically synthesized using standard techniques. The resulting single stranded DNA fragments are introduced into bacteria and via recombineering techniques approximately 1 in 100 BAC fragments will have incorporated the polymorphic nucleotides via homologous incorporation of the single stranded fragment (FIG. 3a). BACs with the desired nucleotide change can be identified by screening for example several hundred individual clones by polymerase chain reaction (PCR) amplification and sequencing, both by standard techniques. In the example, two nucleotide changes will convert a VH1-69*01 gene segment into a VH1-69*02 gene segment (FIG. 3b).
It is clear that this process can be repeated for multiple endogenous V gene segments contained on a single BAC genomic fragment. In addition, the techniques depicted in FIG. 2 can be used to add additional polymorphic V gene segments by insertion into regions between existing V gene segments. As would be evident to one skilled in the art, a combination of these techniques can be used to create numerous variations of both polymorphic and endogenous human V gene segments. And it would be evident that several different genomic fragments with engineered polymorphic V gene segments and endogenous human V gene segments can be combined to create even more variations.
Modified BACs with polymorphic V gene segments created using the methods described in Example 1 can be used to alter the genome of non-human mammals. These alterations can result in an intact IG locus in which normal immunoglobin region recombination results in VDJ or VJ combinations which includes the human V gene segments. An example of how such an animal can be created is by altering the genome of, for example, mouse embryonic stem (ES) cells using the strategy outlined in FIG. 4.
One technique to integrate modified BACs with polymorphic V gene segments into a genome is sequential recombinase mediated cassette exchange (SRMCE). The technique is described in WO2011004192 (Genome Research Limited), which is incorporated here in its entirety by reference.
SRMCE provides for a locus modified with a ‘landing pad’ inserted at a specific location. This insertion can either be de novo via homologous recombination or as a consequence of a previous BAC insertion. In this example, the landing pad is inserted in the mouse IGH locus between the most 3′ J gene segment and the CA gene segment and a previous BAC insertion via SRMCE techniques have resulted in the addition of 5 human V gene segments and 2 V region pseudogenes. The landing pad has elements as shown in FIG. 4 that will allow the selection of correct insertion of a second targeting BAC fragment. The specificity of this insertion is provided by cre recombinase-mediated exchange between permissive lox sites. A lox site is permissive for recombination only with a compatible lox site. In this example, the loxP site will only recombine with loxP and lox2272 will only recombine with lox2272. This provides directionality to the insertion of the BAC fragment as depicted in FIGS. 4b and 4c.
ES cell clones with correct insertions are selected from a pool of clones without insertions or with non-productive insertions by resistance to puromycin. Resistance to puromycin results from the juxtaposition of an active promoter element, PGK, with the puroTK coding region. Correct insertions are verified by standard techniques including PCR of junctions, PCR of internal elements, Southern blotting, comparative genomic hybridization (CGH), sequencing and etc. In the example, correct lox2272-lox2272 and loxP-loxP recombination also results in two intact sets of piggyBac elements that did not exist prior to insertion. An intact piggyBac element is comprised of a set of inverted repeats which are depicted in the figure by “PB5′” and “PB3′”. An appropriated oriented set of piggyBac elements are the substrate of piggyBac transposase which can catalyse recombination between the elements, resulting in deletion of intervening sequences as well as both elements. The DNA remaining after a piggyBac transposition is left intact and is lacking any remnant of the piggyBac element. In the example, ES cell clones with successful piggyBac transposition are selected by loss of the active puroTK element which renders the cells resistant to the drug FIAU (FIGS. 4c and 4d).
The final product of the SRMCE method in this example is a IGH locus with several polymorphic V gene segments inserted along with a set of endogenous unmodified VH gene segments between sequences of the mouse genome on the 5′ side and the mouse IGH constant region gene segments on the 3′ side. The polymorphic V gene segments are positioned such that they can participate in the recombination events associated with B cell maturation yielding VDJ gene segments. These gene
segments can then be transcribed and spliced to the mouse constant region. Translation of these transcripts will result in the production of an antibody heavy chain encoded by the polymorphic V gene segment, a human DH gene segment, a human JH gene segment and a mouse constant heavy chain gene segment.
As is well known to those skilled in the art, an ES cell clone can be used to create a line of genetically modified mice via injection of said cells into a mouse blastocyst embryo, transferring the injected embryo to a suitable recipient and breeding the chimeric offspring that result. The modified gene locus can be propagated through breeding and made either heterozygous or homozygous depending on the genetic cross.
It is evident from the structure of the IGH locus provided in this example and by knowledge of the mechanisms involved in B cell receptor (BCR) and antibody gene rearrangements that a large set of different combinations of polymorphic V gene segments with various DH and JH gene segments will result and these can contribute to a large repertoire of functional antibody genes in a population of B cells in genetically modified animals. In this example, several different human VH1-69 polymorphs are incorporated to provide superhuman VH diversity. This particular VH gene segment is known to be prevalent in antibodies that bind infectious disease pathogens (such as influenza virus) and therefore the antibody repertoire of a mouse with the genetic modification of this example would be expected to produce antibodies with a bias in favour of those that bind infectious disease pathogens. The repertoire, in other words, would have a larger subset of antibodies with superior affinities for pathogen antigens. Examples of such pathogens include influenza virus, hepatitis C virus (HCV) and human immunodeficiency virus-1 (HIV-1) (see also table above).
Building a more diverse antibody repertoire by incorporating additional V gene segment polymorphs requires availability of polymorphic variants of V gene segments. One source of such variants include sequence databases. In this example, 13 distinct variants of the VH1-69 gene segment are provided.
These variant sequences and comparisons are drawn from the “IMmunoGeneTics” IMGT Information System (www.imgt.com) database. FIG. 5 is a diagram of the alignment of variants *02 through *13 with the *01 variant. The VH1-69*01 nucleotide and amino acid sequence is provided at the top of the figure. Where the remaining variants are identical to the *01 variant sequence a dash is inserted below the sequence. Nucleotide differences are noted alongside the appropriate variant and if the sequence change results in a protein coding change, the amino acid change is indicated above the triplet.
FIG. 5 depicts between 1 and 4 amino acid changes for each variant in comparison to the *01 variant. All of the amino acid changes occur in the part of the heavy chain protein encoding the complementarity determining regions (CDRs). These regions are responsible for antigen specificity and the affinity of the antibody for the antigen. It is evident that providing additional polymorphic CDRs in a repertoire of antibodies will increase the likelihood of there being an antibody with superior binding characteristics for various antigens. In several reports, it has been observed that the VH1-69-encoded variable region of the heavy chain is often found in antibodies that bind influenza virus, HCV and HIV-1 antigens (see table above). Therefore incorporating the polymorphic V gene segments of this example into a transgenic animal model using the methods of Examples 1 and 2 would likely result in an antibody repertoire in said transgenic animal with more antibodies that bind to antigens associated with these and other pathogens. And as is known in the art, a larger repertoire increases the probability of finding monoclonal antibodies using, for example, hybridoma technology, that bind with high affinity and specificity to a desired antigen.
This disclosure therefore describes in these examples a transgenic mouse model which can be immunized with pathogen or other antigens. Plasma B cells from such an immunized mouse can be used to make a hybridoma library that can be screened for production of antibodies that bind the pathogen antigens. This library will be superior to libraries from traditional transgenic mice for finding such antibodies given the addition of polymorphic VH1-69 gene segments to the IGH locus in said transgenic mouse.
These examples are not limiting to the human polymorphic V gene segments that can be chosen or to the methods used to introduce them into an animal model. The method can be used to construct a transgenic locus with immunoglobulin D and/or J segments. The V, D, J segments can be from a plurality of human sources (optionally more than one human ethnic population).
Data is presented for human JH2, 5 and 6 variants. In Tables 10A, 11A and 12A samples from humans from various populations are listed where the sequence analysis of the inventors has revealed the presence of polymorphisms in one or both IgH JH alleles. The population codes are explained in Table 8 above. The polymorphisms are nucleotide variants from JH2, 5 and 6 reference sequences (SEQ ID NOs: 1, 2 and 3 respectively; see below). All references are sequences taken from the Ensembl database (www.ensembl.org). The JH5 reference is human IgH J5-001 disclosed in that database. The JH6 reference is human IgH J6-001 disclosed in that database. The JH2 reference is human IgH J2-001 disclosed in that database.
The reference nucleotide and encoded amino acid sequences are shown on the next page. Alignments with encoded amino acid sequences are also provided, including the corresponding position numbers on human chromosome 14.
Variant Frequencies are shown in Tables 10A, 11A and 12A and these relate to the frequency of the variants in the 1000 Genomes Database (release current at October 2011).
Tables 10B, 11B and 12B show the non-synonymous nucleotide polymorphisms in the human JH variants, as sorted by the present inventors from the 1000 Genomes database. Position numbers corresponding to nucleotide positions on human chromosome 14 are shown for variant positions (chromosome 14 being the chromosome bearing the IgH locus in humans). Thus, for example, the first entry in Table 11B is “14:106330027:A/C” which refers to a position in a variant JH5 sequence wherein the position corresponds to position 106,330,027 on human chromosome 14, such position being A (adenine) in the reference sequence. The “C” indicates that the present inventors observed a mutation to cytosine at this position in the variants found in the 1000 Genomes database. This change leads to a change at the amino acid level of the encoded sequence (i.e., a “non-synonymous” change), in this case a change from a serine (found in the reference) to an alanine in the variant.
The genomic coding region coordinates for each target gene for variant analysis were identified from the Ensembl WWW site (www.ensembl.org) using coordinates from the GRCh.p8 Human Genome assembly (www.ncbi.nlm.nih.gov/projects/genome/assembly/grc). Using the collected gene location coordinates, variant data was extracted from the public ftp site of the 1000 Genomes Project using the Perl ‘Variant Pattern Finder’ (VPF—www.1000genomes.org/variation-pattern-finder-api-documentation).
Data extracted by VPF was post processed using software to extract all non-synonymous (NSS) variants with their associated genotype calls. Genotypes calls were assembled to form unique haplotypes, representing groups of NSS variants associated with 1000 Genome population groups and frequency of occurrence within those populations.
The output of the analysis results in tables such as in Table 13. The main body of the table describes each haplotype in turn giving a unique ID for that gene (in the range a-z,aa-zz), the population frequencies and occurrence in individuals and unique population groups; one or more subsequent columns describe the DNA base calls at each location that form the haplotype giving both the base from the reference sequence or the variant base call.
The first four columns (left to right) consist of (1) the haplotype ID letter ('ref indicates reference—the DNA base call at each genomic location from the GRCh37 Human Reference Assembly) (2) the observed cumulative frequency of the haplotype among the different populations (3) the number of individuals in which a specific haplotype was observed (4) the number of unique population groups that the identified individuals belong to (the actual population group identifiers are displayed as a string of ID's in the most right hand column for each haplotype. For example haplotype ‘a’ has a population ID string of ‘3,4,9,13’).
The populations are numbered as follows (population labels being according to 1000 Genomes Project nomenclature)
Subsequent columns detail a single point variant and have the following format (top to bottom) (1) the human genomic location of the variant (format [chromosome number]: [location] e.g. ‘14:106204113’); (2) The identifier for the point variant as defined in DbSNP (www.ncbi.nlm.nih.gov/projects/SNP/); (3) One or additional rows show the amino acid change as result of the variant for a specific transcript (denoted by the Ensembl transcript ID in the most right-hand column for each row), the format is the amino acid in the reference sequence followed by ‘->’ and the amino acid caused by the substitution of the variant in the reference sequence (e.g. ‘Gly->Arg’ means a that the translated reference sequence would result in a glycine at that location, whereas the substitution of the identified variant would result in translated protein containing arginine) using the IUPAC three letter amino acid codes (http://pac.iupac.org/publications/pac/pdf/1972/pdf/3104×0639.pdf). Subsequent rows (one per haplotype) show the DNA base at each location, bases matching the reference sequence are shown in black on white back ground, bases varying from the reference are shown as white text on a black background.
The most right-hand column contains the Ensembl transcript ID's (e.g. ‘ENST00000390542’) for each of the gene transcript and relates to the amino acid changes to the left of this column.
Because the transcripts are differing lengths each variant position may or may not have an associated amino acid change at the that position.
A functional human gene segment repertoire (from VH2-26 to JH6, see the IMGT database for the structure of the human IgH locus;
http://www.imgt.org/IMGTrepertoire/index.php?section=LocusGenes&repertoire=locus&species=human&group=IGK) was sectored by the inventors to produce two different transgenic heavy chain alleles (denoted S2F and S3F) and corresponding mice. The transgenic alleles were expressed in the mice and the heavy chain repertoires were assessed at the RNA transcript level. Deep sequence analysis was carried out using Bioinformatics methods to assess V, D and JH gene usage, including in variable domain sequences having a HCDR3 length of at least 20 amino acids. Endogenous, mouse variable region gene segments were inactivated by inversion (as per the method described in WO2011004192, this disclosure being incorporated herein by reference).
DNA samples from 9 anonymised consenting human donors were obtained by taking cheek swabs.
The samples were processed and the DNA Samples were extracted follow the protocol of QIAamp DNA Mini Kit (Cat. No. 51304, Qiagen).
PCR reactions were set up to amplify the JH6 region and PCR products were sequenced (PCR Oligos sequence: Fwd. 5′-AGGCCAGCAGAGGGTTCCATG-3′ (SEQ ID NO: 444), Rev. 5′-GGCTCCCAGATCCTCAACCCAC-3′ (SEC) ID NO: 445)).
Sequence analysis was carried out by comparing to the JH6 reference sequence from IMGT annotated database (http://www.imgt.org/) and this identified that all 9 donor genomes contained the human JH6*02 variant, with this variant being in the homozygous state in 7 out of the 9 donors. The inventors also consulted the genomic sequences publicly available for Jim Watson and Craig Venter at Ensembl human genome database [http://www.ensembl.org/]. These too contained the human JH6*02 variant. This confirmed to the inventors that human JH6*02 is a common, conserved variant in humans, and thus a good candidate for construction of a transgenic IgH locus as per the invention
A series of human bacterial artificial chromosome (BAC) clones were identified from Ensemble (http://www.ensembl.org/index.html) or UCSC (http://genome.ucsc.edu/) human database searches based on gene name (IGH) or location (chromosome 14: 106026574-107346185). Seven human RP11 BAC clones (see an extract of the UCSC database in FIG. 10, identified BACs being circled) were selected, RP11-1065N8 BAC carrying human JH6*02. In total, the following BACs were identified as sources of human IgH locus DNA: RP11-1065N8, RP11-659B19, RP11-14117, RP-112H5, RP11-101G24, RP11-12F16 and RP11-47P23.
With a similar approach, different BAC clones (e.g., different RP11 clone IDs or different sources from RP11) or genetically engineered BACs can be selected for insertion into the mouse IGH locus to provide different sets of human repertoires in the transgenic mouse.
Insertion of human heavy gene segments from a 1st IGH BAC (RP11-1065N8) into the IGH locus of mouse AB2.1 ES cells (Baylor College of Medicine) was performed to create a heavy chain allele denoted the S1 allele. The inserted human sequence corresponds to the sequence of human chromosome 14 from position 106494908 to position 106328951 and comprises functional heavy gene segments VH2-5, VH7-4-1, VH4-4, VH1-3, VH1-2, VH6-1, D1-1, D2-2, D3-9, D3-10, D4-11, D5-12, D6-13, D1-14, D2-15, D3-16, D4-17, D5-18, D6-19, D1-20, D2-21, D3-22, D4-23, D5-24, D6-25, D1-26, D7-27, JH1, JH2, JH3, JH4, JH5 and JH6 (in 5′ to 3′ order), wherein the JH6 was chosen to be the human JH6*02 variant. The insertion was made between positions 114666435 and 114666436 on mouse chromosome 12, which is upstream of the mouse Ĉ region. The mouse VH, D and J H gene segments were retained in the locus, immediately upstream of (5′ of) the inserted human heavy chain DNA.
A second allele, S2 was constructed in which more human functional VH gene segments were inserted upstream (5′) of the 5′-most VH inserted in the 51 allele by the sequential insertion of human DNA from a second BAC (BAC2). The inserted human sequence from BAC2 corresponds to the sequence of human chromosome 14 from position 106601551 to position 106494909 and comprises functional heavy chain gene segments VH3-13, VH3-11, VH3-9, VH1-8, VH3-7. The mouse VH, D and JH gene segments were retained in the locus, immediately upstream of (5′ of) the inserted human heavy chain DNA. In a subsequent step, these were inverted to inactivate them, thereby producing S2F mice in which only the human heavy chain variable region gene segments are active.
A third allele, S3 was constructed in which more human functional VH gene segments were inserted upstream (5′) of the 5′-most VH inserted in the S2 allele by the sequential insertion of human DNA from a third BAC (BAC3). The inserted sequence corresponds to the sequence of human chromosome 14 from position 106759988 to position 106609301, and comprises functional heavy chain gene segments, VH2-26, VH1-24, VH3-23, VH3-21, VH3-20, VH1-18, and VH3-15. The mouse VH, D and JH gene segments were retained in the locus, immediately upstream of (5′ of) the inserted human heavy chain DNA. In a subsequent step, these were inverted to inactivate them, thereby producing S3F mice in which only the human heavy chain variable region gene segments are active.
Mice bearing either the S2F or S3F insertion into an endogenous heavy chain locus were generated from the ES cells using standard procedures. The other endogenous heavy chain locus was inactivated in the mice by insertion of an inactivating sequence comprising neoR into the mouse JH-Ĉ intron (to produce the “HA” allele).
Transgenic mice of the S2F or S3F genotype were primed with 20-40 ug recombinant proteins obtained commercially or produced in house with Antigen 1 (OVA (Sigma A7641); Antigen 2 (a human infectious disease pathogen antigen) and Antigen 3 (a human antigen) via the ip route in complete Freunds adjuvant (Sigma F 5881) and 10 ug/animal CpG (CpG oligo; Invivogen, San Diego, Calif., USA) and then boosted twice in about two weekly intervals with about half the amount of antigen in incomplete Freunds adjuvant (Sigma F 5506) and 10 ug/animal CpG. Final boosts were administered two weeks later iv without any adjuvant and contained 5-10 ug protein in PBS.
Spleens were taken 3 days after the final boost and spleenocytes were treated with CpG (25 ̂m final concentration) for and left until the following day. Cells were then fused with SPO/2 Ag14 myeloma cells (HPA Cultures Cat No 85072401) using a BTX ECM2001 electrofusion instrument. Fused cells were left to recover for 20 minutes then seeded in a T75 flask until next morning. Then the cells were spun down and plated out by dilution series on 96-well culture plates and left for about 10 days before screening. Media was changed 1-3 times during this period.
Culture supernatants of the hybridoma wells above were screened using homogenious time resolved fluorescence assay (htrf) using Europium cryptate labelled anti-mouse IgG (Cisbio anti-mouse Ig Europium Cryptate) and a biotin tagged target antigen with a commercially available streptavidin conjucated donor (Cisbio; streptaviding conjugated D2) or by IgG-specific 384 well ELISA. Positive wells identified by htrf were scaled to 24-well plates or immediately counterscreened using an IgG-specific detection ELISA method. Positives identified by primary ELISA screen were immediately expanded to 24-well plates. Once cultures were expanded to 24-well stage and reached conflueny, supernatants were re-tested using htrf or IgG-specific ELISA to confirm binding to target antigen. Supernatant of such confirmed cultures were then also analysed by surface plasmon resonance using a BioRad ProteOn XPR36 instrument. For this, antibody expressed in the hybridoma cultures was captured on a biosensor GLM chip (BioRad 176-512) which had an anti-mouse IgG (GE Healthcare BR-1008-38)) covalently coupled the biosensor chip surface. The antigen was then used as the analyte and passed over the captured hybridoma antibody surface. For Antigen 2 and Antigen 3, concentrations of 256 nM, 64 nM, 16 nM, 4 nM and 1 nM were typically used, for Antigen 1, concentrations of 1028 nM, 256 nM, 64 nM, 16 nM and 4 nM were typically used, binding curves were double referenced using a 0 nM injection (i.e. buffer alone). Kinetics and overall affinities were determined using the 1:1 model inherent to the BioRad ProteOn XPR36 analysis software.
Any clones with confirmed binding activity were used for preparing total RNA and followed by PCR to recover the heavy chain variable region sequences. Standard 5′-RACE was carried out to analyse RNA transcripts from the transgenic heavy chain loci in the S2F and S3F mice. Additionally, deep sequence analysis of almost 2000 sequences produced by the mice was carried out.
Sequences for analysis were obtained from two different methods:
The sequences from the first method can either be from IgM from Naive mice or IgG from immunised mice. The samples from the second method are all from IgG from immunised mice, and specific to the immunizing antigen. Almost 2000 sequences were analysed.
The sequences were obtained as a pair of forward and reverse reads. These were first trimmed to remove low-quality base calls from the ends of the reads (trimmed from both ends until a 19 nucleotide window had an average quality score of 25 or more). The reads were combined together by taking the reverse complement of the reverse read, and aligning it against the forward read. The alignment scoring was 5 for a match, −4 for a mismatch, a gap open penalty of 10 and a gap extension penalty of 1. A consensus sequence was then produced by stepping through the alignment and comparing bases. When there was a disagreement the base with the highest quality value from sequencing was used.
The BLAST© (Basic Local Alignment Search Tool) (Camacho C., Coulouris G., Avagyan V., Ma N., Papadopoulos J., Beeler K., & Madden T. L. (2008) “BLAST©: architecture and applications.”BMC Bioinformatics 10:421 http://www.ncbi.nlm.nih.gov/pubmed/20003500) program ‘blastn’ was then used to find the germline J and V segments used in each sequence. A wordsize of 30 was used for V matching, and 15 for J matching. The database searched against was constructed from the NGS sequencing of the BACs which were used to generate the Kymouse.
If a sequence matched both a V and a J segment, the sequence between the two was then compared to a database of germline D segments in the mouse using ‘blastn’ with a wordsize of 4 and the options ‘blastn-short’ and ‘ungapped’. This was used to assign a D segment, if possible. The CDR3 was identified by searching for the conserved “TATTACTGT” sequence in the V segment, and the “CTGGGG” in the J segment. If these motifs were not found, then up to 4 mismatches were allowed. The IMGT definition of CDR3 was used, so the CDR3 length is calculated from after the “TGT” in the V to before the “TGG” in the J. Sequences with an out of frame junction (those which do not have a CDR3 nucleotide length divisible by 3) or which contained a stop codon (“TAA”, “TAG” or “TGA”) were excluded.
The identity of the matching V, J and D segments as well as the CDR3 length from this assignment were then saved as a table for downstream analysis. The ratio of IGHJ6*02 used increased from the naive to immunised mice, as well as being enriched in the sub-population of sequences with a long HCDR3 (defined as consisting of 20 or more amino acids):
| All | HCDR3 > 20 |
| Total | Total | ||||
| JH6 * 02% | Count | JH6 * 02% | Count | % HCDR3 > 20 | |
| Naive | 22.31% | 1340 | 91.11% | 45 | 3.36% |
| Immunised | 37.50% | 256 | 66.67% | 9 | 3.52% |
| Hybridoma | 36.13% | 119 | 63.64% | 11 | 9.24% |
This shows that the JH6*02 gene segment is selected for by immunisation, as the proportion of JH6*02 usage increases after immunisation. JH6*02 is also used in the majority of antibodies with a long HCDR3 length, which is desirable for targets which are specifically bound by long HCDR3 length antibodies.
| SEQ ID NO: 1 (JH5 Reference) |
| T | T | G | A | C | C | A | A | G | C | T | G | G | G | G | A | C | C | C | C |
| G | G | T | C | C | C | T | T | G | G | G | A | C | C | A | G | T | G | G | C |
| A | G | A | G | G | A | G | T | C | |||||||||||
| JH5 Alignment: |
| (top line = SEQ ID NO: 1, Middle line = SEQ ID NO: 5, Bottom line = SEQ ID NO: 6) |
| LgH J5001 | 106, 330, 072 | 106, 330, 071 | 106, 330, 068, | 106, | 106, | 106, | 106, | 106, | 106, | 106, |
| 106, 330, 041 | 106, 330, 082 | 106, 330, 027, | 106, 330, 024 | 330, 067 | 330, 065 | 330, 065 | 330, 063 | 330, 062 | 330, 045, | 330, 044 |
| T | T | G | A | C | C | A | A | G | C | T | G | G | G | G | A | C | C | C | C |
| G | C | C | T | T | G | G | G | A | C | C | A | G | T | G | G | C | A | G | A |
| G | G- | A | A | C | T | G | G | T | T | C | G | A | C | C | C | C | T | G | G |
| C | T | G | G | — | C | A | C | C | G | T | C | C | T | C | A | G | W | ||
| P | W | G | Q | G | T | L | V | T | V | S | S | ||||||||
| SEQ ID NO: 2(JH6Reference) |
| A | T | G | A | T | G | A | T | G | A | T | G | A | T | G | A | T | G | T | A |
| C | C | T | G | C | A | G | A | C | C | C | C | G | T | T | T | C | C | C | T |
| G | G | T | G | C | C | A | G | T | G | G | C | A | G | A | G | G | A | G | T |
| JH6 Alignment: |
| (top line = SEQ ID NO: 2, Middle line = SEQ ID NO: 7, Bottom line = SEQ ID NO: 8) |
| LgH J6001 | 106, 329, 468 | 106, 329, 453 | 106, 329, 452, | 106, 329, 451 | 106, 329, 435 | ||||||||
| T | T | G | A | C | C | A | A | G | C | T | G | G | G | G | A | C | C | C | C |
| G | C | C | T | T | G | G | G | A | C | C | A | G | T | G | G | C | A | G | A |
| G | G- | A | A | ||||||||||||||||
| 106, 329, 426 | 106, | 106, | 106, | 106, | 106, | ||||||||
| 106, 329, 413 | 329, 411 | 329, 408 | 329, 419 | 329 417 | 329, 414 | ||||||||
| C | C | C | T | G | G | T | G | C | C | A | G | T | G | G | C | A | G | A | G |
| G | A | G | T | C | |||||||||||||||
| G | G | G | A | C | C | A | C | G | G | T | C | A | C | C | G | T | C | T | C |
| C | T | C | A | G | G | T | T | V | T | V | S | S | |||||||
| SEQ ID NO: 3 JH 2 Reference) |
| A | T | G | A | C | C | A | T | G | A | A | G | C | T | A | G | A | G | A | C |
| C | C | C | G | G | C | A | C | C | G | T | G | G | G | A | C | C | A | G | T |
| G | A | C | A | G | A | G | G | A | G | T | C | ||||||||
| JH2 Alignment: |
| (top line = SEQ ID NO: 3, Middle line = SEQ ID NO: 9, Bottom line = SEQ ID NO: 10) |
| 106, | 106, | 106, | ||||||||||||
| IgH J5-001 | 331, 460 | 331, 455 | 331, 453 | 106, 331, 453 | ||||||||||
| A | T | G | A | C | C | A | T | G | A | A | G | C | T | A | G | A | G | A | C |
| C | C | C | G | G | C | A | C | C | G | T | G | G | G | A | C | C | A | G | T |
| G | A | C | A | G | A | G | G | A | G | T | C | T | A | C | T | G | G | — | A |
| C | T | T | C | G | A | — | C | T | C | T | G | G | G | G | C | C | G | T | G |
| G | C | A | C | C | C | T | G | G | T | C | A | C | T | G | T | C | T | C | C |
| T | C | A | G | Y | W | Y | F | D | L | W | G | R | G | T | L | V | T | V | |
| S | S | ||||||||||||||||||
In the tables, the notation is illustrated by the following example
| IGLV1 40 | G1 40 * 02 | X53936 | :g9 > Ic1) > g, L4 > VI | |
Polymorphic variant IGV lambda VI-40*02 has Genbank Accession No. X53936 and when compared to the *01 variant, the VI-40*02 variant has mutations at positions 9, 10 and 4. For example, at position 9, a “C” appears instead of a “G” that is present in the *01 variant. The “|” is simply a notation separator, and does not indicate any mutation. For example the “g282|” notation indicates no change (i.e., position 282 is a g). “del#” means that the residue at that position is absent.
| Lengthy table referenced here |
| US20140041067A1-20140206-T00001 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00002 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00003 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00004 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00005 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00006 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00007 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00008 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00009 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00010 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00011 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00012 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00013 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00014 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00015 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00016 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00017 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00018 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00019 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00020 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00021 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00022 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00023 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00024 |
| Please refer to the end of the specification for access instructions. |
| Lengthy table referenced here |
| US20140041067A1-20140206-T00025 |
| Please refer to the end of the specification for access instructions. |
| LENGTHY TABLES |
| The patent application contains a lengthy table section. A copy of the table is available in electronic form from the USPTO web site (<![CDATA[http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20140041067A1]]>). An electronic copy of the table will also be available from the USPTO upon request and payment of the fee set forth in 37 CFR 1.19(b)(3). |
1. A non-human vertebrate whose genome comprises an immunoglobulin heavy chain locus comprising one or more VH gene segments, one or more D gene segments, and one or more J segments comprising human gene segment JH6*02, upstream of a constant region; wherein said gene segments in said heavy chain locus are operably linked to said constant region, and said vertebrate is functional to recombine a said VH gene segment, a said D gene segment and said human JH6*02 to form a VH-D-JH6*02 variable region gene.
2. The vertebrate of claim 1, wherein said vertebrate has been immunised with a target antigen and comprises an antibody heavy chain comprising a variable domain encoded by said VH-D-JH6*02 gene produced by recombination of said heavy chain gene segments with said human JH6*02, wherein said variable domain comprises an HCDR3 having a length of at least 20 amino acids.
3. A non-human vertebrate cell whose genome comprises an immunoglobulin heavy chain locus comprising one or more VH gene segments, one or more D gene segments and one or more J segments comprising human gene segment JH6*02, upstream of a constant region, wherein said gene segments of said heavy chain locus are operably linked to said constant region and said vertebrate is functional to recombine a said VH segment, a said D segment and said human JH6*02 gene segment to form a VH-D-JH6*02 variable region gene.
4. The cell of claim 3, which is an ES cell, wherein said ES cell is capable of developing into a mouse comprising said immunoglobulin heavy chain locus in its germ line, and wherein said mouse comprises an antibody-producing cell that expresses an antibody comprising said heavy chain.
5. The vertebrate of claim 1, wherein said heavy chain locus comprises a human JH6*02 recombination signal sequence (RSS) positioned upstream of and operably linked to said JH6*02 gene segment.
6. The cell of claim 3, wherein the heavy chain locus comprises a human JH6*02 recombination signal sequence (RSS) positioned upstream of and operably linked to said JH6*02 gene segment.
7. The vertebrate of claim 5, wherein said RSS is SEQ ID NO: 238 or, wherein said SEQ ID NO: 238 comprises a flanking 9mer, a central 22mer and a flanking 7mer, and said sequence comprises identical 9mer and 7mer flanking sequences and said central sequence is at least 70% identical to said 22mer central sequence of SEQ ID NO: 238.
8. The cell of claim of claim 6, wherein the RSS is SEQ ID NO: 238 or, wherein said SEQ ID NO: 238 comprises a flanking 9mer, a central 22mer and a flanking 7mer, and said sequence comprises identical 9mer and 7mer flanking sequences and said central sequence is at least 70% identical to said 22mer central sequence of SEQ ID NO: 238.
9. The vertebrate of claim 6, wherein said RSS and JH6*02 are provided as SEQ ID NO: 237.
10. The cell of claim 8, wherein said RSS and JH6*02 are provided as SEQ ID NO: 237.
11. The vertebrate of claim 1, wherein said JH6*02 is the only JH6 gene segment in the genome.
12. The cell of claim 3, wherein said JH6*02 is the only JH6 gene segment in said genome.
13. The vertebrate of claim 1, wherein said J gene segments comprise a plurality of J gene segments comprising a 3′ J gene segment positioned downstream in said plurality and upstream of said constant region in said locus, and said 3′ J gene segment comprises said JH6*02 gene segment.
14. The cell of claim 3, wherein said J gene segments comprise a plurality of J gene segments comprising a 3′ J gene segment positioned downstream in said plurality and upstream of said constant region in said locus, and said 3′ J gene segment comprises said JH6*02 gene segment.
15. The vertebrate of claim 1, wherein said locus comprises one, more or all human D gene segments D3-9; D4-17; D3-10; D2-2; D5-24; D6-19; D3-22; D6-13; D5-12; D1-26; D1-20; D5-18; D3-16; D2-21; D1-14; D7-27; D1-1; D6-25; D2-14; and D4-23.
16. The cell of claim 3, wherein the locus comprises one, more or all human D gene segments D3-9; D4-17; D3-10; D2-2; D5-24; D6-19; D3-22; D6-13; D5-12; D1-26; D1-20; D5-18; D3-16; D2-21; D1-14; D7-27; D1-1; D6-25; D2-14; and D4-23.
17. The vertebrate of claim 15, wherein the locus comprises one, more or all human D gene segments D3-9, D3-10, D6-19, D4-17, D6-13, D3-22, D2-2, D2-25 and D3-3.
18. The cell of claim 16, wherein the locus comprises one, more or all human D gene segments D3-9, D3-10, D6-19, D4-17, D6-13, D3-22, D2-2, D2-25 and D3-3.
19. The vertebrate of claim 1, wherein the locus comprises a plurality of human D gene segments and said JH6*02 is in human germline configuration with respect to the 3′-most human D gene segment.
20. The cell of claim 3, wherein the locus comprises a plurality of human D gene segments and the JH6*02 is in human germline configuration with respect to the 3′-most human D gene segment.
21. The vertebrate of claim 1, wherein the locus comprises one, more or all of IGHV gene segments selected from V3-21, V3-13, V3-7, V6-1, V1-8, V1-2, V7-4-1, V1-3, V1-18, V4-4, V3-9, V3-23, V3-11 and V3-20.
22. The cell of claim 3, wherein the locus comprises one, more or all of IGHV gene segments selected from V3-21, V3-13, V3-7, V6-1, V1-8, V1-2, V7-4-1, V1-3, V1-18, V4-4, V3-9, V3-23, V3-11 and V3-20.
23. The vertebrate of claim 1, wherein the locus comprises one, more or all of human D3-9*01, D3-10*01, D6-19*01, D6-13*01, D1-26*01, IGHV1-8*01, IGHV4-61*01, IGHV6-1*01, IGHV4-4*02, IGHV1-3*01, IGHV3-66*03, IGHV3-7*01 and IGHV3-9*01.
24. The cell of claim 3, wherein the locus comprises one, more or all of human D3-9*01, D3-10*01, D6-19*01, D6-13*01, D1-26*01, IGHV1-8*01, IGHV4-61*01, IGHV6-1*01, IGHV4-4*02, IGHV1-3*01, IGHV3-66*03, IGHV3-7*01 and IGHV3-9*01.
25. An antibody-producing cell that is a progeny of the cell of claim 3, wherein the antibody-producing cell comprises a heavy chain locus comprising a rearranged variable region produced by recombination of human JH6*02 with a D gene segment and a VH gene segment.
26. The cell of claim 25, which is a B-cell or hybridoma that expresses a target antigen-specific antibody comprising a heavy chain that comprises a rearranged variable region encoded by a recombined Vh-D-human JH6*02 gene produced by recombination of said gene segments with said human JH6*02.
27. The vertebrate of claim 1, wherein the antibody heavy chain specifically binds a target antigen.
28. The cell of claim 3, wherein the antibody heavy chain specifically binds a target antigen.
29. The vertebrate of claim 1, wherein said antibody heavy chain comprises a variable region comprising a HCDR3 length of at least 20 amino acids.
30. The cell of claim 3, wherein said antibody heavy chain comprises a variable region comprising a HCDR3 length of at least 20 amino acids.
31. The vertebrate of claim 1, wherein said antibody heavy chain is a product of the recombination of JH6*02 with a human VH gene segment recited in claim 21 or 23 and/or a D gene segment recited in claim 15, 17 or 23.
33. The vertebrate of claim 1, wherein said genome comprises endogenous heavy chain variable region gene segments which are nonfunctional to produce endogenous Ig heavy chain.
34. The cell of claim 3, wherein said genome comprises endogenous heavy chain variable region gene segments which are nonfunctional to produce endogenous Ig heavy chain.
35. The vertebrate of claim 1, wherein the genome is homozygous for said heavy chain locus.
36. The cell of claim 3, wherein the genome is homozygous for said heavy chain locus.
37. The vertebrate of claim 1, wherein the constant region is an endogenous constant region.
38. The cell of claim 3, wherein the constant region is an endogenous constant region.
39. A method for producing an antibody specific to a target antigen, the method comprising immunizing the non-human vertebrate according to claim 1 with said antigen, thereby producing said antibody specific to said target antigen, wherein said antibody comprises a heavy chain variable region comprising an HCDR3, and wherein said heavy chain variable region is a product of the recombination of human JH6*02 with a VH and a D gene segment.
40. The method of claim 39, further comprising the step of isolating said antibody.
41. The method of claim 40, wherein the constant region is an endogenous constant region.
42. A method for producing a human an antibody comprising carrying out the method of claim 40 or 41, wherein the constant region of the locus is a non-human vertebrate constant region, further comprising the step of replacing the non-human constant region of the isolated antibody with a human constant region.
43. The method of claim 39, further comprising the step of isolating a B cell from said mouse, wherein said B cell expresses said antibody.
44. The method of claim 43, further comprising the step of producing a hybridoma from said B cell.
45. The method of claim 44, further comprising the step of isolating said antibody from said hybridoma.
46. The method of claim 39, wherein the non-constant region is an endogenous constant region.
47. The method of claim 46, further comprising the step of isolating a B cell from said mouse, wherein said B cell expresses said antibody.
48. The method of claim 47, further comprising the step of producing a hybridoma from said B cell, wherein said hybridoma expresses said antibody.
49. The method of claim 48, further comprising the step of isolating said antibody from said hybridoma.
50. A method for producing a heavy chain or VH domain thereof, of an antibody specific to a target antigen, the method comprising immunizing a non-human vertebrate according to claim 1 with the antigen, thereby producing said heavy chain or VH domain thereof, of an antibody specific to said target antigen, wherein the heavy chain or VH domain thereof comprises an HCDR3, and wherein said VH domain is a product of the recombination of human JH6*02 with a VH and a D gene segment.
51. The method of claim 50, further comprising the step of isolating said heavy chain or VH domain thereof.
52. The method of claim 51, wherein the constant region is an endogenous constant region.
53. The method of claim 50, 51 or 52, wherein the heavy chain or VH domain thereof, comprises mouse AID-pattern somatic hypermutations and/or mouse dTd-pattern mutations.
54. The method of claim 39 or 46, wherein the heavy chain or VH domain thereof, of said antibody comprises mouse AID-pattern somatic hypermutations and/or mouse dTd-pattern mutations.
55. A method for producing a human an antibody comprising carrying out the method of claim 40 or 41, wherein the constant region of the locus is a non-human vertebrate constant region, wherein the heavy chain or VH domain of said antibody comprises mouse AID-pattern somatic hypermutations and/or mouse dTd-pattern mutations, further comprising the step of replacing the non-human constant region of the isolated antibody with a human constant region.
56. The method of claim 50, further comprising the step of operably linking the VH domain with a human constant domain.