US20140086982A1
2014-03-27
14/036,960
2013-09-25
US 9,562,066 B2
2017-02-07
-
-
Nita M Minnifield
Baker Botts, LLP
2033-10-20
The present invention relates to methods of treating or reducing the risk of necrotizing enterocolitis (NEC) in an infant comprising orally administering an effective amount of a CpG-ODN. It is based, at least in part, on the results of experiments in which orally administered CpG-ODNs were observed to reduce the histopathology and markers of inflammation in a murine model for NEC. The present invention further provides for oral formulations of CpG-ODN for administration to infants.
Get notified when new applications in this technology area are published.
C07H21/04 » CPC main
Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
A23L33/17 » CPC further
Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives Amino acids, peptides or proteins
A61K39/00 IPC
Medicinal preparations containing antigens or antibodies
A61K31/711 » CPC further
Medicinal preparations containing organic active ingredients; Carbohydrates; Sugars; Derivatives thereof; Compounds having three or more nucleosides or nucleotides Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
A23L33/40 » CPC further
Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof Complete food formulations for specific consumer groups or specific purposes, e.g. infant formula
C12N15/117 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
A61K45/06 » CPC further
Medicinal preparations containing active ingredients not provided for in groups  - Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
This application claims priority to U.S. Provisional Application Ser. No. 61/705,401 filed on Sep. 25, 2012, which is incorporated by reference herein in its entirety.
This work was funded in part by Grant Number 1R01DK083752 from the National Institutes of Health. The United States Government has certain rights in the invention.
The present invention relates to orally administered therapy to treat or reduce the risk of developing necrotizing enterocolitis in an infant.
The leading cause of death from gastrointestinal disease in neonates is necrotizing enterocolitis (âNECâ; as reviewed in reference 51). 90 percent of the cases of NEC occur in premature infants (51). Over forty years of research have unfortunately made relatively little progress towards improving the prognosis of patients with NEC (3), which, after surgical treatment, bears a survival rate of only approximately 50% (4).
One area of recent development is the discovery that a class of bacterial receptors named Toll like receptors (âTLR'sâ) play an essential role in the pathogenesis of NEC. Of particular importance is TLR4, the receptor for lipopolysaccharide (LPS), which is the outer membrane component of gram negative bacteria (12). It has been found that (i) mice with mutations in TLR4 are protected from the development of NEC (22); (ii) TLR4 signaling regulates the balance between injury and repair in the newborn intestine (21); and (iii) TLR4 is increased in the intestinal mucosa of mice, rats and humans with NEC compared to controls (21, 23). TLR4 activation appears to not only promote intestinal injury, but also reduces the ability of the mucosa to heal. It has been postulated that that prematurity, hypoxia and endotoxemia, each of which are linked to NEC, result in persistent upregulation of intestinal TLR4 and consequent disease (21). Therapeutic approaches to NEC have been developed that involve inhibiting activity of TLR4. For example, see U.S. Pat. No. 8,188,058 by Hackam.
Modulation of other TLRs may also be used therapeutically. Activation of TLR9, the enterocyte receptor for bacterial DNA (which, unlike mammalian DNA, is rich in CpG groups and significantly hypomethylated) with CpG-DNA led to reduced TLR4 signaling both in vitro and in newborn's intestine (U.S. Pat. No. 8,188,058 by Hackam and 40). The potential use of oral CpG-ODNs in asthma has been explored (53).
The present invention relates to methods of treating or reducing the risk of necrotizing enterocolitis (NEC) in an infant comprising orally administering an effective amount of a CpG-ODN. It is based, at least in part, on the results of experiments in which orally administered CpG-ODNs were observed to reduce the histopathology and markers of inflammation in a murine model for NEC. The present invention further provides for oral formulations of CpG-ODN for administration to infants.
FIG. 1. Quantitative RT-PCR showing the effects of orally administered CpG-1 or CpG-2 on expression of tumor necrosis factor alpha (âTNRÎąâ) in the intestines of newborn mice which were either breast-fed controls (âBFâ) or treated by formula gavage and hypoxia to induce a murine model for NEC (âmNECâ). Measurements were made on day 4 after mNEC induction.
FIG. 2A-F. Representative hematoxylin and eosin (âH&Eâ) stained histo-micrographs of the small intestine of newborn mice which were either BF controls or treated to produce mNEC. (A) Untreated BF control. (B) Untreated mNECI. (C) mNEC treated with CpG-1. (D) mNEC treated with CpG-2. (E) BF control treated with CpG-1. (F) BF control treated with CpG-2.
FIG. 3A-B. (A) Disease severity in BF controls or mNEC animals treated with either CpG-1 or CpG-2. Results for CpG-2 trended towards but did not reach statistical significance. (B) Inducible nitric oxide synthase (iNOS) as measured by qRT-PCR in BF controls or mNEC animals treated with CpG-1.
FIG. 4A-D. Confocal microscopy showing extent of NFÎşB activation in intestinal mucosa of newborn transgenic mice that express NFÎşB-GFP. Nuclei are indicated by areas of blue fluorescence. NFÎşB is detected by a red fluorescent anti-GFP antibody, and is more punctate. Newborn mice were either (A) BF controls treated with saline; (B) mNEC mice treated with saline; or (C) mNEC mice treated with CpG-2. (D) is graphical depiction of results, showing the relative red (GFP) pixel intensity for each animal.
FIG. 5. Gross images of mice with mNEC that are untreated or have been treated with oral CpG-1 or CpG-2.
FIG. 6A-C. Effects of pre-treatment of mice prior to induction of NEC. (A) Mucosal iNOS expression (as measured by RT-PCR) in BF controls, untreated mNEC animals, mice pre-treated with CpG-1 for 48 hours prior to attempted induction of NEC (âmNEC Cpg1â) and BF mice treated with CpG-1 for 48 hours. (B) Mucosal TNFa expression (as measured by RT-PCR) in BF controls, untreated mNEC animals, mice pre-treated with CpG-1 for 48 hours prior to attempted induction of NEC (âmNEC Cpg1â) and BF mice treated with CpG-1 for 48 hours. (C) Weight at the time of euthanasia of BF controls, untreated mNEC animals, mice pre-treated with CpG-1 for 48 hours prior to attempted induction of NEC (âmNEC Cpg1â) and BF mice treated with CpG-1 for 48 hours.
FIG. 7A-B. Oral CpG attenuates intestinal inflammation in experimental NEC. (A) Representative photomicrographs (i-iv) and gross images (v-viii) of the ileum from neonatal mice that were either breast fed (BF) (i, v), BF in the presence of CpG (ii, vi), induced to develop NEC by formula feeding (FF) along with vehicle (iii, vii), or induced to develop NEC by FF in the presence of oral CpG (1 mg/kg/day) (iv, viii). (B) qRT-PCR showing the expression of iNOS (i) and IL-6 (ii) in the intestinal mucosa and NEC severity score (iii) of newborn mice that were either breast fed (BF), BF in the presence of CpG, induced to develop NEC (FF), or induced to develop NEC (FF) in the presence of oral CpG (1 mg/kg). Size bar=10 Îźm. Shown are meanÂąSEM. *p<0.05 FF vs BF; **p<0.05 FF+CpG vs F F. Representative of 5 separate experiments with over 5 neonatal mice per group.
FIG. 8A-B. CpG inhibits TLR4-mediated inflammation in human ex vivo control and NEC intestinal tissue. (A) qRT-PCR showing expression of IL1β (i) and TLR4 (ii) in the resected Heal tissue from neonates with healed NEC at the time of stoma closure that was pretreated with or without CpG for 30 minutes prior to subsequent LPS administration for 3 hours. (B) qRT-PCR showing expression of iNOS (i) and IL-6 (ii) in the resected Heal tissue from neonates with NEC that was pretreated with or without CpG for 30 minutes prior to subsequent LPS administration for 3 hours. Shown is mean¹SEM from 3 separate specimens; *p<0.05 LPS vs Control (Ctrl); **p<0.05 LPS vs LPS+CpG.
The specification further incorporates by reference the Sequence Listing submitted herewith via EFS on Sep. 25, 2013. Pursuant to 37 C.F.R. §1.52(e)(5), the Sequence Listing text file, identified as 0723960496US_ST25.txt, is 8,390 bytes and was created on Sep. 25, 2013. The Sequence Listing, electronically filed herewith, does not extend beyond the scope of the specification and thus does not contain new matter.
For clarity of disclosure, and not by way of limitation, the detailed description of the invention is divided into the following subsections:
(i) CpG oligonucleotides;
(ii) CpG formulations;
(iii) methods of treating NEC; and
(iv) methods of reducing the risk of NEC.
CpG oligonucleotides, as that term is used herein, are oligonucleotides comprising one or more unmethylated CpG dinucleotide (âCpG ODNsâ).
In certain non-limited embodiments a CpG ODN is between about 7 and 200 nucleotides in length, or between about 10 and 100 nucleotides in length, or between about 10 and 50 bases nucleotides in length, or between about 10 and 30 nucleotides in length.
In some non-limiting embodiments, the CpG ODN is at least 6, or at least 7, or at least 8, or at least 9, or at least 10, or at least 11, or at least 12, or at least 13, or at least 14, or at least 15, or at least 16, or at least 17, or at least 18, or at least 19, or at least 20, or at least 21, or at least 22, or at least 23, or at least 24, or at least 25, or at least 26, or at least 27, or at least 28, or at least 29, or at least 30 nucleotides in length.
In some non-limiting embodiments, the CpG-ODN is up to about 25, up to about 30, up to about 35, up to about 40, up to about 45 or up to about 50 nucleotides in length.
In one non-limiting embodiment, the CpG ODN is about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, or about 35 nucleotides in length.
In non-limiting embodiments of the invention, such oligonucleotides may contain one or more phosphorothioate linkages (at some or all bonds) or other modifications which improve stability, uptake, etc., (for example, but not limited to, a poly-G tail (for example, but not by way of limitation, of at least five or at least ten or at least 15 residues in length)). The CpG ODN may be double stranded, single stranded, or contain single and double-stranded regions (e.g., contain a hairpin). The CpG oligonucleotide may be DNA or RNA and may contain non-naturally occurring bases and/or linkages.
In certain non-limiting embodiments a CpG ODN may promote activation of TLR9 in vitro and/or in vivo. A number of CpG ODNs that activate TLR9 are known in the art. Some are species specific. Non-limiting examples follow.
Human CpG ODNs have been divided into three types, as follows:
In further embodiments, the present invention provides for the use of CpG ODNs which are at least 90 percent and preferably at least 95 percent homologous to any of the CpG ODNs referred to herein (where homology may be detetinined by standard software such as BLAST or PASTA).
In one particular, non-limiting embodiment, the CpG ODN, 5â˛-TCCATGACGTTCCTGACGTT-3Ⲡ(SEQ ID NO:6), containing phosphorothioate linkages, known in the art as CpG ODN 1826 (Coley Pharmaceutical Group, Ottawa, Ontario, Canada (Pfizer)), which shows selective activation of murine TLR9, may be used. In addition, CpG ODNs which are at least about 90 percent, and preferably at least about 95 percent, homologous to CpG ODN 1826 may be used, where homology may be measured using a standard software program such as BLAST or FASTA. CpG ODN 1826 is referred to as CpG-1 in Example 6 below.
In yet another specific, non-limiting embodiment, the CpG-ODN 5â˛TCGTCGTTTTGTCGTTCCTGACGTT 3Ⲡ(SEQ ID NO:9), referred to herein as CpG-2, may be used. In addition, CpG ODNs which are at least about 90 percent, and preferably at least about 95 percent, homologous to CpG 2 may be used, where homology may be measured using a standard software program such as BLAST or FASTA. In non-limiting embodiments of the invention, a mixture of two or more CpG ODNs may be used.
In some non-limiting embodiments, the CpG-ODN comprises the sequence 5ⲠGTCGTT 3Ⲡ(SEQ ID NO: 10).
In some non-limiting embodiments, the CpG-ODN comprises the sequence 5ⲠGTCGTTT 3Ⲡ(SEQ ID NO:11).
In some non-limiting embodiments, the CpG-ODN comprises the sequence 5ⲠCGTCGTTT 3Ⲡ(SEQ ID NO:12).
In some non-limiting embodiments, the CpG-ODN comprises the sequence 5ⲠGTCGTTTT 3Ⲡ(SEQ ID NO:13).
In some non-limiting embodiments, the CpG-ODN comprises the sequence 5ⲠCGTCGTTTT 3Ⲡ(SEQ ID NO:14).
In some non-limiting embodiments, the CpG-ODN comprises the sequence 5ⲠGTCGTTTTGTC 3Ⲡ(SEQ ID NO:15).
In some non-limiting embodiments, the CpG-ODN comprises the sequence 5ⲠTCGTCGTTTTGTC 3Ⲡ(SEQ ID NO:16).
In some non-limiting embodiments, the CpG-ODN comprises the sequence 5ⲠGACGTT 3Ⲡ(SEQ ID NO:17).
In some non-limiting embodiments, the CpG-ODN comprises the sequence 5ⲠTGACGTT 3Ⲡ(SEQ ID NO:18).
In some non-limiting embodiments, the CpG-ODN comprises the sequence 5ⲠCTGACGTT 3Ⲡ(SEQ ID NO:19).
In some non-limiting embodiments, the CpG-ODN comprises the sequence 5â˛TCCTGACGTT 3Ⲡ(SEQ ID NO:20).
In some non-limiting embodiments, the CpG-ODN comprises one or more of SEQ ID NO:10, for example, one, two, three or four of SEQ ID NO:10.
In some non-limiting embodiments, the CpG-ODN comprises one or more copy of SEQ ID NO:10, 11, 12, 13, 14, 15, 16, or a combination thereof, for example, one, two, three or four copy or copies of SEQ ID NO:10, 11, 12, 13, 14, 15, 16, or a combination thereof.
In some non-limiting embodiments, the CpG-ODN comprises one or more copy of SEQ ID NO:10, for example, one, two, three or four copy or copies of SEQ ID NO:10, and also comprises one or more copy or copies of SEQ ID NO: 17, 18, 19, 20, or a combination thereof.
In some non-limiting embodiments, the CpG-ODN comprises one or more copy of SEQ ID NO:10, 11, 12, 13, 14, 15, 16, or a combination thereof, for example, one, two, three or four copy or copies of SEQ ID NO:10, and also comprises one or more copy or copies of SEQ ID NO: 17, 18, 19, 20, or a combination thereof. In some nonlimiting embodiments, the CpG-ODN comprises 5ⲠGTCGTT 3Ⲡ(SEQ ID NO:10) and 5ⲠGACGTT 3Ⲡ(SEQ ID NO:17).
For additional TLR9 agonists, see Daubenberger, 2007, Curr. Opin. Molee. Ther. 9:45-52 and Krieg, 2006, Nat. Rev. Drug Disc. 5:471-484.
The CpG-ODN may optionally be linked to a carrier compound which may or may not be a nucleic acid, for example, but not limited to, a transport peptide that facilitates cellular uptake. The CpG-ODN may optionally be complexed with one or more additional compound, such as a peptide, or comprised in a micelle or liposome, to facilitate uptake. In non-limiting embodiments, the present invention provides for methods of identifying a CpG-ODN which may be used according to the invention comprising identifying a molecule which is capable of binding to TLR9 under physiologic conditions and which, in an in vivo system, in the presence of a TLR4-activating amount of LPS, decreases one or more of the relative amount of phosphorylated p38, the relative amount of phosphorylated ERK, the relative translocation of NFÎşB into the nucleus, or the amount of IL-6 produced. In addition to identifying test agents suitable for TLR9 activation, such method may also be used to confirm the activity or optimize the dosage of any of the particular CpG ODNs listed herein.
The present invention provides for pharmaceutical and nutriceutical formulations of CpG-ODNs for oral administration to an infant.
In certain non-limiting embodiments, the formulation is in the form of a liquid, a powder, a capsule, a tablet, or an orally disintegrating tablet.
A CpG comprised in said formulation may be contained in a particle such as a micelle, liposome, microsphere or nanoparticle.
In certain embodiments, where the formulation is a liquid, said formulation may be a solution, an emulsion, or a suspension.
In certain embodiments, where the formulation is a liquid, the formulation comprises a pharmaceutically suitable liquid such as, but not limited to, water, saline, or an emulsion formed between an aqueous solution and an oil or other liquid that is not substantially miscible with water. In a specific non-limiting embodiment a liquid formulation may comprise a hydrophobic compound as well as an emulsifier. Specific non-limiting examples of compounds which may be incorporated into formulations of the invention include: one or more fatty acid such as linoleic acid and/or oleic acid (and/or other fatty acids), cholesterol, vitamin E, phospholipid, casein, whey, and soy protein (and/or other milk proteins derived from cow, pig or other animal), and oligosaccharides including milk oligosaccharides and other complex or simple sugars.
In certain non-limiting embodiments, a therapeutically or prophylactically effective amount of CpG-ODN, optionally comprised in a particle such as a micelle, liposome, microsphere or nanoparticle, may be comprised in an infant nutritional formula. In certain non-limiting embodiments, the CpG-ODN may be added to a known infant nutritional formula for example, but not limited to, SimilacÂŽ, EnfamilÂŽ or GerberÂŽ formulas. In specific non-limiting embodiments such formula may be SimilacÂŽ Premature Infant Formula, EnfamilÂŽ Premature LIPIL, SimilacÂŽ Premature Infant Formula, or GerberÂŽ Good Start. In certain non-limiting embodiments, a solid (e.g. powder) or liquid composition comprising CpG-ODN, optionally comprised in a particle such as a micelle, liposome, microsphere or nanoparticle, may be added to a commercially available infant nutritional formula prior to administration. Alternatively, CpG-ODN may be comprised into an infant nutritional formula that has not hitherto been commercially available, where said infant nutritional formula further comprises one or more nutrients such as proteins, lipids, carbohydrates, electrolytes, and/or vitamins; in a specific non-limiting embodiment said formula may be nutritionally complete (suitable as a sole source of nutrition for a normal or premature infant). The infant nutritional formula may be, without limitation, a liquid or a powder for reconstitution with liquid.
In specific non-limiting embodiments where the formulation is a liquid, the concentration of CpG-ODN may be such that it provides a daily dose of between about 0.1-10 mg/kg, or a daily dose of between about 0.5-10 mg/kg, or a daily dose of between about 0.1-3 mg/kg, or a daily dose of between about 0.5-2 mg/kg, for example but not limited to a daily dose of about 1 mg/kg (all ranges recited herein include the recited limits), or a daily dose of 0.5 mg/kg, 0.6 mg/kg, 0.7 mg/kg, 0.8 mg/kg, 0.9 mg/kg, 1.1 mg/kg, 1.2 mg/kg, 1.3 mg/kg, 1.4 mg/kg, 1.5 mg/kg, 1.6 mg/kg, 1.7 mg/kg, 1.8 mg/kg, 1.9 mg/kg, or 2.0 mg/kg. In one specific non-limiting embodiment, where the liquid formulation, further, is an infant nutritional formula, the concentration of CpG-ODN may be such that it provides a daily dose of between about 0.1-10 mg/kg, or between about 0.5-10 mg/kg, or between about 0.1-3 mg/kg, or between about 0.5-2 mg/kg, for example but not limited to a daily dose of about 1 mg/kg, where the amount to be consumed by an infant per day may be between about 2 and 50 fluid ounces or between about 2 and 15 fluid ounces or between about 5 and 30 fluid ounces or between about 12 and 40 fluid ounces. In specific non-limiting embodiments, the concentration of CpG-ODN in an infant nutritional formula may be between about 0.005-5.0 mg/fluid ounce, or between about 0.005-1.0 mg/fluid ounce or between about 0.01-1.0 mg/fluid ounce.
In one specific non-limiting embodiment the CpG-ODN may be added to other components of the formulation shortly prior to use, for example within 24 hours or within 6 hours or within 2 hours or within 1 hour of use.
The present invention provides for a method of treating NEC comprising orally administering, to an infant suffering from NEC, a therapeutically effective amount of a CpG-ODN. âTreatmentâ according to the invention includes, without limitation, (1) decreasing the level of one or more index of inflammation (e.g., inflammatory cytokines such as TNF-Îą, IL-6, IL-12p40, IL-113); (2) decreasing a clinical marker of inflammation, such as leukocyte count, fever, hypotension; and/or (3) reducing the risk of an adverse outcome, such as death, organ failure, hypoxia, or the need for surgery. âTreatmentâ does not necessarily mean that the condition being treated will be cured. A âtherapeutically effective amountâ achieves treatment. The CpG-ODN may be comprised in a CpG formulation as set forth above.
In certain non-limiting embodiments of the invention, a therapeutically effective daily dose is between about 0.1-10 mg/kg, or between about 0.1-3 mg/kg, or between about 0.5-2 mg/kg, for example about 1 mg/kg, or a daily dose of 0.5 mg/kg, 0.6 mg/kg, 0.7 mg/kg, 0.8 mg/kg, 0.9 mg/kg, 1.1 mg/kg, 1.2 mg/kg, 1.3 mg/kg, 1.4 mg/kg, 1.5 mg/kg, 1.6 mg/kg, 1.7 mg/kg, 1.8 mg/kg, 1.9 mg/kg, or 2.0 mg/kg, which may be administered as a single or divided dose. In certain non-limiting embodiments, the period of treatment may be at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 10 days, at least 11 days, at least 12 days, at least 13 days, at least 14 days, or at least three weeks up to one month or up to three months or up to 6 months or up to one year.
The present invention provides for a method of reducing the risk of developing NEC comprising orally administering, to an infant in need of such treatment, a prophylactically effective amount of a CpG-ODN. âReducing the riskâ does not necessarily mean that the infant being treated will not develop NEC. A âprophylactically effective amountâ reduces the risk of NEC by at least about 1/5 or by at least about 1/3. Any infant may be eligible for such prophylactic treatment, and infants at higher risk for NEC as a result of premature birth or low birth rate may particularly benefit. The CpG-ODN may be comprised in a CpG formulation as set forth above.
In certain non-limiting embodiments of the invention, a prophylactically effective daily dose is between about 0.1-10 mg/kg, for example about 1 mg/kg or between about 0.1-3 mg/kg or between about 0.5-1 mg/kg, or between about 0.1-1 mg/kg, or 0.1-0.5 mg/kg, or less than 1 mg/kg, which may be administered as a single or divided dose. In certain non-limiting embodiments, the period of prophylaxis may be at least one week, at least two weeks, at least three weeks, at least one month, at least two months, at least three months, at least four months, at least five months or at least six months up to one year.
A murine model for NEC (âmNECâ) was produced in newborn mice by 4 days of hypoxia and formula gavage (52), which leads to the induction of iNOS, reduced enterocyte proliferation, and disruption of the ileal mucosa (âmNECâ mice) as compared to control mice that were allowed to breast feed (âBFâ miceâ). Specifically, mNEC was induced in 10-d-old mice (12) using formula gavage [Similac Advance infant formula (Abbott Nutrition):Esbilac canine milk replacer, 2:1] 50 ÎźL/g body weight, five times per day for 4 d, and hypoxia (5% O2, 95% N2) administered for 10 min twice daily for 4 d using a hypoxia chamber (Billups-Rothenberg Inc.). CpG-1 was TCCATGACGTTCCTGACGTT-3Ⲡ(SEQ ID NO:6), containing phosphorothioate linkages, known in the art as CpG ODN 1826 (Coley Pharmaceutical Group, Ottawa, Ontario, Canada (Pfizer)). CpG-2 was 5ⲠTCGTCGTTTTGTCGTTCCTGACGTT 3Ⲡ(SEQ ID NO:9). CpG-1 or CpG-2 was administered at a dose of 1 mg/kg at a frequency of twice per day in the infant formula described above. Oral administration to breast-fed and NEC animals was achieved by gavage with a silastic foam tipped angiocatheter.
Quantitative RT-PCR was used to assess the effects of orally administered CpG-1 or CpG-2 on expression of the inflammatory cytokine tumor necrosis factor alpha (TNFÎą) in mNEC versus BF mice. Measurements were made on day 4 after mNEC induction. As shown in FIG. 1, oral administration of either CpG-1 or CpG-2 brought the levels of TNFÎą in mNEC animals down to approach the level in BF controls. Similarly, the elevated level of inducible nitric oxide synthase (iNOS) obseved in mNEC mice versus BF controls was substantially reduced by oral CpG (FIG. 3B). This effect was reflected by histologic evaluation, as depicted in FIG. 2A-F, where the disruption of the small intestine mucosa observed in untreated mNEC mice (FIG. 2B) is ameliorated in mNEC mice orally treated with CpG-1 or CpG-2 (FIGS. 2C and 2D, respectively) to resemble the mucosa of BF control (FIG. 2A).
Consistent with these observations, oral CpG was found to decrease activation of NFÎşB, as indicated by localization of NFÎşB in the nucleus. As shown in FIG. 4A-C, confocal microscopy studies of BF or mNEC mice treated with saline (FIGS. 4A and 4B) showed nuclear localization of NFÎşB (punctate red fluorescence) in the saline-treated mNEC animals which was largely absent in mNEC mice treated with CpG-2 (FIG. 4C). A bar graph depiction of these results is shown in FIG. 4D. Further, the gross morphology of mNEC mice treated with oral CpG-1 or CpG-2 was much more robust than that of untreated mNEC mice (FIG. 5). This was reflected by a higher body weight in the treated animals.
Finally, it was shown that when CpG-1 was administered 48 hours prior to attempted induction of mNEC, mucosal expression of iNOS and TNFa were reduced almost to baseline levels and the weight of the pre-treated animals also approached controls (FIG. 6A-C). This data suggests that CpG-ODNs may be used to reduce the risk that an infant will develop NEC.
The effect of CpG-ODN 5â˛-TCCATGACGTTCCTGACGTT-3Ⲡ(SEQ ID NO:6; ODN 1826) on inhibiting NEC in a murine NEC model in vivo, and in ex vivo human samples from infants undergoing intestinal resection for active NEC or at the time of stoma closure was examined. To determine the level of NEC inhibition, the extent of LPS signaling was determined by the degree of expression of pro-inflammatory cytokines iNOS and TNFÎą by Quantitative real-time PCR (qRT-PCR).
Induction of necrotizing enterocolitis in mouse model
All mice experiments were approved by the Institutional Animal Care and Use
Committee of the University of Pittsburgh. Swiss Webster mice were obtained from Charles River Laboratories. NEC was induced in 7-10 day old mice as described by Leaphart et al. (21) and Afrazi et al. (54) using formula gavage (a 2:1 ratio of Similac Advance infant formula (Ross Pediatrics):Esbilac canine milk replacer) administered five times/day, along with hypoxia (5% O2, 95% N2) for 10 min in a hypoxic chamber (Billups-Rothenberg, Inc., Del Mar, Calif.) twice daily, for 4 days. This protocol results in the development of patchy necrosis involving the small intestine, which is similar to human NEC, with an increase in circulating cytokines that mimics that observed in human NEC (40). CpG was administered via the oral route at a concentration of 1 mg/kg/day, which included 4 days of pretreatment prior to the start of the NEC model. Disease severity was determined on histological sections of the terminal ileum by a pediatric pathologist blinded to the study condition according to a scoring system from 0 (normal) to 3 (severe), as described by Leaphart et al. (21).
All human tissue was obtained and processed as discarded tissue via waiver of consent with approval from the University of Pittsburgh Institutional Review Board and in accordance with the University of Pittsburgh anatomical tissue procurement guidelines. Human tissue was obtained from infants undergoing intestinal resection for active NEC or at the time of stoma closure (healed NEC at the time of stoma closure). After initial review by the duty pathologist to ensure that adequate diagnostic information was obtained from the gross tissue specimen, the intestinal resection was divided into multiple pieces, and treated in triplicate with media alone, LPS 50 ug/ml, CpG (1 uM) alone or LPS+CpG as described by Neal et al. (55). After 3 hours of treatment, tissue was processed for qRT-PCR, and assessed for the expression of IL1β, TLR4, iNOS or IL-6.
The extent of LPS signaling was determined by the degree of pro-inflammatory cytokines, iNOS, and TNFa by Quantitative real-time PCR (qRT-PCR). qRT-PCR was performed using the Bio-Rad CFX96 Real-Time System (Biorad, Hercules, Calif.) using the primers listed in the table below.
| Amplicon | ||||
| Gene | Species | Forwardâsequence | Reverseâsequence | Sizeâ(bP) |
| iNOS | Mouse/Rat | CTGCTGGTGGTGACAA | ATGTCATGAGCAAAGG | 167 |
| GCACATTTâ(SEQâID | CGCAGAACâ(SEQâID | |||
| NO:â21) | NO:â22) | |||
| Human | AATGAGTCCCCGCAGC | AGTCATCCCGCTGCCC | 143 | |
| CCCTâ(SEQâIDâNO:â23) | CAGTâ(SEQâIDâNO:â24) | |||
| RPLO | Mouse/Rat/ | GGCGACCTGGAAGTCC | CCATCAGCACCACAGC | 143 |
| Human | AACTâ(SEQâIDâNO:â25) | CTTCâ(SEQâIDâNO:â26) | ||
| IL-6 | Mouse/Rat | GGCTAAGGACCAAGA | TCTGACCACAGTGAGG | 138 |
| CCATCCAAâ(SEQâID | AATGTCCAâ(SEQâID | |||
| NO:â27) | NO:â28) | |||
| Human | TCTCCACAAGCGCCTT | CTCAGGGCTGAGATGC | 193 | |
| CGâ(SEQâIDâNO:â29) | CGâ(SEQâIDâNO:â30) | |||
| IL1β | Human | AGTGTGGATCCCAAGC | TGTCCTGACCACTGTT | 175 |
| AATACCCAâ(SEQâID | GTTTCCCAâ(SEQâID | |||
| NO:â31) | NO:â32) | |||
| TLR4 | Human | AAGCCGAAAGGTGATT | CTGAGCAGGGTCTTCT | 153 |
| GTTGâ(SEQâIDâNO:â33) | CCACâ(SEQâIDâNO:â34) | |||
| TNFa | Mouse/Rat | CATCTTCTCAAAATTC | TGGGAGTAGACAAGGT | 175 |
| GAGTGACAAâ(SEQâID | ACAACCCâ(SEQâID | |||
| NO:â35) | NO:â36) | |||
| Human | GGCGTGGAGCTGAGA | GGTGTGGGTGAGGAGC | 120 | |
| GATAACâ(SEQâID | ACATâ(SEQâIDâNO:â38) | |||
| NO:â37) | ||||
Statistical analysis was performed using SPSS 13.0 software. ANOVA was used for comparisons for experiments involving more than two experimental groups. Two-tailed student's t-test was used for comparison for experiments consisting of two experimental groups. For analysis of the severity of NEC, chi-square analysis was performed.
As shown in FIG. 7A, oral administration of CpG attenuates intestinal inflammation in experimental NEC induced in mouse through formula feeding. Additionally, oral administration of CpG to the mice with NEC induced through formula feeding reduced the expression of iNOS and IL-6 in the intestinal mucosa, and reduced the NEC severity score (FIG. 7B).
As shown in FIG. 8, CpG treatment inhibited TLR4-mediated inflammation in human ex vivo control and NEC intestinal tissue. As shown in FIG. 8A, the increase in expression of IL 1β and TLR4 caused by LPS treatment in control tissue was reduced when CpG was also administered to the tissue. Similarly, in human NEC tissue, LPS treatment increased iNOS and IL-6 expression. However, when CpG was added to the treatment, the expression of the Expression of iNOS and IL-6 was reduced.
Various publications are cited herein, the contents of which are hereby incorporated by reference in their entireties.
1. An infant nutritional formula comprising a therapeutically effective amount of a CpG-ODN, further comprising one or more nutrients selected from the group consisting of proteins, lipids, carbohydrates, electrolytes, and vitamins.
2. The infant nutritional formula of claim 1 where the CpG-ODN comprises 5â˛-TCCATGACGTTCCTGACGTT-3Ⲡ(SEQ ID NO:6).
3. The infant nutritional formula of claim 1 where the CpG-ODN comprises 5ⲠTCGTCGTTTTGTCGTTCCTGACGTT 3Ⲡ(SEQ ID NO:9).
4. The infant nutritional formula of claim 1, where the formula is nutritionally complete.
5. The infant nutritional formula of claim 1, where the concentration of CpG-ODN provides a daily dose of between about 0.1-10 mg/kg.
6. The infant nutritional formula of claim 5 where the daily dose provided is about 1 mg/kg.
7. The infant nutritional formula of claim 1, where the CpG-ODN is comprised in a particle selected from the group consisting of a micelle, liposome, microsphere or nanoparticle.
8. A method of treating necrotizing enterocolitis comprising orally administering, to an infant suffering from necrotizing enterocolitis, a therapeutically effective amount of a CpG-ODN.
9. The method of claim 8 where the CpG-ODN comprises 5â˛-TCCATGACGTTCCTGACGTT-3Ⲡ(SEQ ID NO:6).
10. The method of claim 8 where the CpG-ODN comprises 5ⲠTCGTCGTTTTGTCGTTCCTGACGTT 3Ⲡ(SEQ ID NO:9).
11. The method of claim 8, where the CPG-ODN is comprised in an infant formula.
12. The method of claim 11, where the infant formula is nutritionally complete.
13. The method of claim 8, where the daily dose of CpG-ODN administered is between about 0.1-10 mg/kg.
14. The method of claim 13, where the daily dose provided is about 1 mg/kg.
15. method of claim 8, where the CpG-ODN is comprised in a particle selected from the group consisting of a micelle, liposome, microsphere or nanoparticle.
16. A method of reducing the risk of developing necrotizing enterocolitis comprising orally administering, to an infant in need of such treatment, a prophylactically effective amount of a CpG-ODN.
17. The method of claim 16 where the CpG-ODN comprises 5â˛-TCCATGACGTTCCTGACGTT-3Ⲡ(SEQ ID NO:6).
18. The method of claim 16 where the CpG-ODN comprises 5ⲠTCGTCGTTTTGTCGTTCCTGACGTT 3Ⲡ(SEQ ID NO:9).
19. The method of claim 16, where the CPG-ODN is comprised in an infant formula.
20. The method of claim 19, where the infant formula is nutritionally complete.
21. The method of claim 16, where the daily dose of CpG-ODN administered is between about 0.1-1 mg/kg.
22. The method of claim 16, where the CpG-ODN is comprised in a particle selected from the group consisting of a micelle, liposome, microsphere or nanoparticle.