Patent application title:

OVER EXPRESSION OF FOLDASES AND CHAPERONES IMPROVES PROTEIN PRODUCTION

Publication number:

US20140087443A1

Publication date:
Application number:

14/011,506

Filed date:

2013-08-27

Abstract:

The present teachings provide methods for increasing protein secretion, e.g., chymosin in filamentous fungi by co-expressing certain chaperone(s) and/or foldase(s). The present teachings also provide filamentous fungi containing certain chaperone(s) and/or foldase(s) and a protein of interest for increased secretion.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N9/64 IPC

Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Hydrolases (3) acting on peptide bonds (3.4); Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue

Description

This application claims priority of U.S. Provisional applications 60/919,332, filed Mar. 21, 2007, the contents of which is herein incorporated by reference in their entirety.

INTRODUCTION

Protein secretion is an important aspect of protein production in various cell expression systems. One of the factors associated with protein secretion is protein folding. Many proteins can be reversibly unfolded and refolded in vitro at dilute concentrations since all of the information required to specify a compact folded protein structure is present in the amino acid sequence of a protein. However, protein folding in vivo occurs in a concentrated milieu of numerous proteins in which intermolecular aggregation reactions compete with the intramolecular folding process. The first step in the eukaryotic secretory pathway is translocation of the nascent polypeptide across the ER membrane in extended form. Correct folding and assembly of a polypeptide occurs in the ER through the secretory pathway. Many proteins are often highly overexpressed, but poorly secreted even though secretion signals are present on these proteins. There is a need in the art to produce proteins efficiently in cellular production systems.

SUMMARY

The present teachings are based, at least in part, on the discovery that protein secretion in filamentous fungi can be modulated by a group of chaperones and/or foldases. Accordingly the present teachings provide methods for increasing protein secretion in filamentous fungi by co-expressing certain chaperone(s) and/or foldase(s). The present teachings also provide filamentous fungi containing certain chaperone(s) and/or foldase(s) and a protein of interest for increased secretion.

In some embodiments, the present teachings provide a method for increasing the secretion of a secretable polypeptide in a filamentous fungus host. The method comprises expressing a secretion enhancing protein in a filamentous fungus host containing a secretable polypeptide, wherein the secretion enhancing protein comprises bip1, clx1, ero1, lhs1, prp3, prp4, prp1, tig1, pdi1, ppi1, ppi2, Scj1, erv2, EDEM, and/or sil1, and wherein the secretable polypeptide can be a chymosin.

In some embodiments, the present teachings provide a filamentous fungus host containing a first polynucleotide encoding a secretion enhancing protein and a second polynucleotide encoding a chymosin, wherein the secretion enhancing protein comprises bip1, clx1, ero1, lhs1, prp3, prp4, prp1, tig1, pdi1, ppi1, ppi2, Scj1, erv2, EDEM, and/or sil1, and wherein the first polynucleotide can be operably linked to a first promoter and the second polynucleotide can be operably linked to a second promoter.

One aspect of the invention is a method for production of a secretable polypeptide in a filamentous fungal host by expressing a secretion enhancing protein in a filamentous fungal host containing a secretable polypeptide, wherein the secretion enhancing protein is bip1 and the secretable polypeptide is a chymosin. In some embodiments, at least two secretion enhancing proteins are expressed. In some embodiments, the method includes expression of at least a second chaperone protein and/or a foldase. In some embodiments, the filamentous fungal host is T. reesei. In some embodiments, the host is selected from the following hosts: Aspergillus, Acremonium, Aureobasidium, Beauveria, Cephalosporium, Ceriporiopsis, Chaetomium paecilomyces, Chrysosporium, Claviceps, Cochiobolus, Cryptococcus, Cyathus, Endothia, Endothia mucor, Fusarium, Gilocladium, Humicola, Magnaporthe, Myceliophthora, Myrothecium, Mucor, Neurospora, Phanerochaete, Podospora, Paecilomyces, Penicillium, Pyricularia, Rhizomucor, Rhizopus, Schizophylum, Stagonospora, Talaromyces, Trichoderma, Thermomyces, Thermoascus, Thielavia, Tolypocladium, Trichophyton, Trametes, and Pleurotus. In some embodiments, the chymosin is a bovine chymosin. In some embodiments, the chymosin is expressed through a promoter of the filamentous fungal host. In further embodiments, the chymo sin is expressed under a cbh1 promoter in T. reesei. In some embodiments, the chymosin is produced as a fusion protein. In some embodiments, the chymosin is produced as a fusion protein with a CBHI, or a portion thereof. In some embodiments, the chymosin is produced as a fusion protein with a CBHI, or a portion thereof, and the CBHI amino acid sequence is altered to reduce or eliminate catalytic activity. In other embodiments, the method includes inoculating a suitable growth medium with the host and incubating under conditions permitting growth of the host.

Other aspects of the invention include a filamentous fungal host having a first polynucleotide encoding a secretion enhancing protein and a second polynucleotide encoding a chymosin, wherein the secretion enhancing protein is bip1, and wherein the first polynucleotide is operably linked to a first promoter and the second polynucleotide is operably linked to a second promoter. In some embodiments, the host also contains a third polynucleotide operably linked to a third promoter, wherein the third polynucleotide encodes a secretion enhancing protein selected from: bip1, clx1, ero1, lhs1, prp3, prp4, prp1, tig1, pdi1, ppi1, ppi2, Scj1, erv2, EDEM, and sil1. In some embodiments, the first polynucleotide encodes a chaperone protein and the third polynucleotide encodes a foldase. In some embodiments, the first promoter and the third promoter is a constitutive promoter. In some embodiments, the first promoter is a constitutive promoter. In some embodiments, the filamentous fungus is T. reesei. In some embodiments, the second promoter is a promoter obtained from the filamentous fungal host. In some embodiments, the filamentous fungus is T. reesei and the second promoter is a CBH1 promoter of T. reesei. In some embodiments, the second polynucleotide encodes a bovine chymosin. In some embodiments, the secretion level of the chymosin in the filamentous fungus is at least 50 mg/liter when the filamentous fungus grows in a fermentation condition.

Further aspects of the invention include a biologically pure culture comprising a population of filamentous fungi disclosed above. In some embodiments, the culture also contains the chymosin secreted by the filamentous fungi.

Further aspects of the invention include a supernatant obtained from a culture of the filamentous fungus host, wherein the supernatant contains substantial amount of chymosin, but not substantial amount of the filamentous fungus.

Further aspects of the invention include a supernatant obtained using the method disclosed above, wherein the supernatant contains substantial amount of chymosin, but not substantial amount of the filamentous fungus.

BRIEF DESCRIPTION OF THE DRAWINGS

The skilled artisan will understand that the drawings are for illustration purposes only. The drawings are not intended to limit the scope of the present teaching in any way.

FIG. 1 depicts a Gateway compatible vector for expression cloning in Trichoderma reesei (pTrex2g/HygB).

FIG. 2 is the DNA sequence of a synthetic prochymosin gene (SEQ ID NO: 42).

FIG. 3 depicts a CBH1-prochymosin B expression vector, pTrex4-CHYGA.

FIG. 4 depicts chymosin band density analysis of Western blots of three day shake flask culture samples.

FIG. 5 depicts the levels of bip1, chymosin and cbh1 mRNA in Trichoderma reesei strains.

DESCRIPTION OF VARIOUS EMBODIMENTS

Definition Section

The term “promoter” is defined herein as a nucleic acid that directs transcription of a downstream polynucleotide in a cell. In certain cases, the polynucleotide may contain a coding sequence and the promoter may direct the transcription of the coding sequence into translatable RNA.

The term “isolated” as defined herein means a compound, a protein, cell, nucleic acid sequence or amino acid that is removed from at least one component with which it is naturally associated.

The term “% homology” is used interchangeably herein with the term “% identity” herein and refers to the level of nucleic acid or amino acid sequence identity between the nucleic acid sequences, when aligned using a sequence alignment program. For example, as used herein, 80% homology means the same thing as 80% sequence identity determined by a defined algorithm, and accordingly a homologue of a given sequence has greater than 80% sequence identity over a length of the given sequence. Exemplary levels of sequence identity include, but are not limited to, 80, 85, 90, 95, 98% or more sequence identity to a given sequence. The term “coding sequence” is defined herein as a nucleic acid that, when placed under the control of appropriate control sequences including a promoter, is transcribed into mRNA which can be translated into a polypeptide. A coding sequence may contain a single open reading frame, or several open reading frames separated by introns, for example. A coding sequence may be cDNA, genomic DNA, synthetic DNA or recombinant DNA, for example. A coding sequence generally starts at a start codon (e.g., ATG) and ends at a stop codon (e.g., UAA, UAG and UGA).

The term “recombinant” refers to a polynucleotide or polypeptide that does not naturally occur in a host cell. A recombinant molecule may contain two or more naturally occurring sequences that are linked together in a way that does not occur naturally.

The term “heterologous” refers to elements that are not normally associated with each other. For example, if a recombinant host cell produces a heterologous protein, that protein is not produced in a wild-type host cell of the same type, a heterologous promoter is a promoter that is not present in nucleic acid that is endogenous to a wild type host cell, and a promoter operably linked to a heterologous coding sequence is a promoter that is operably linked to a coding sequence that it is not usually operably linked to in a wild-type host cell.

The term “operably linked” refers to an arrangement of elements that allows them to be functionally related. For example, a promoter is operably linked to a coding sequence if it controls the transcription of the sequence, and a signal sequence is operably linked to a protein if the signal sequence directs the protein through the secretion system of a host cell.

The term “nucleic acid” and “polynucleotide” are used interchangeably and encompass DNA, RNA, cDNA, single stranded or double stranded and chemical modifications thereof. Because the genetic code is degenerate, more than one codon may be used to encode a particular amino acid, and the present invention encompasses all polynucleotides, which encode a particular amino acid sequence.

The term “DNA construct” as used herein means a nucleic acid sequence that comprises at least two DNA polynucleotide fragments.

The term “signal sequence” refers to a sequence of amino acids at the N-terminal portion of a protein, which facilitates the secretion of the mature form of the protein outside the cell. The mature form of the extracellular protein lacks the signal sequence which is cleaved off during the secretion process.

The term “vector” is defined herein as a polynucleotide designed to carry nucleic acid sequences to be introduced into one or more cell types. Vectors include cloning vectors, expression vectors, shuttle vectors, plasmids, phage or virus particles, DNA constructs, cassettes and the like. Expression vectors may include regulatory sequences such as promoters, signal sequences, coding sequences and transcription terminators.

An “expression vector” as used herein means a DNA construct comprising a coding sequence that is operably linked to suitable control sequences capable of effecting expression of a protein in a suitable host. Such control sequences may include a promoter to effect transcription, an optional operator sequence to control transcription, a sequence encoding suitable ribosome binding sites, enhancers and sequences which control termination of transcription and translation.

As used herein, the terms “polypeptide” and “protein” are used interchangeably and include reference to a polymer of any number of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analog of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The terms also apply to polymers containing conservative amino acid substitutions such that the polypeptide remains functional.

A “host” refers to a suitable host for an expression vector comprising a DNA construct encoding a desired protein. A host may be any cell type.

The term “filamentous fungi” refers to all filamentous forms of the subdivision Eumycotina (See, Alexopoulos, C. J. (1962), INTRODUCTORY MYCOLOGY, Wiley, New York). These fungi are characterized by a vegetative mycelium with a cell wall composed of chitin, glucans, and other complex polysaccharides. The filamentous fungi of the present teachings are morphologically, physiologically, and genetically distinct from yeasts. Vegetative growth by filamentous fungi is by hyphal elongation and carbon catabolism is obligatory aerobic.

A “heterologous” nucleic acid construct or sequence has a portion of the sequence which is not native to the cell in which it is expressed. Heterologous, with respect to a control sequence refers to a control sequence (i.e. promoter or enhancer) that does not function in nature to regulate the same gene the expression of which it is currently regulating. Generally, heterologous nucleic acid sequences are not endogenous to the cell or part of the genome in which they are present, and have been added to the cell, by infection, transfection, transformation, microinjection, electroporation, or the like. A “heterologous” nucleic acid construct may contain a control sequence/DNA coding sequence combination that is the same as, or different from a control sequence/DNA coding sequence combination found in the native cell.

The present teachings are based on the discovery that protein secretion in a host can be modulated by a group of chaperones and/or foldases. Accordingly the present teachings provide methods for increasing protein secretion in a host, e.g., filamentous fungi by co-expressing certain chaperone(s) and/or foldase(s). The present teachings also provide expression hosts, e.g., filamentous fungi containing certain chaperone(s) and/or foldase(s) and a polypeptide of interest for increased secretion.

According to one aspect of the present teachings, it provides methods for increasing the secretion of a polypeptide of interest in a host by expressing a secretion enhancing protein along with the desired polypeptide in the host. The secretion enhancing protein of the present teachings can be any suitable protein associated with protein folding and/or secretion. In some embodiments, the secretion enhancing protein of the present teachings can be a member of chaperone or foldase protein family. In some embodiments, the secretion enhancing protein can be a member of chaperone or foldase protein family of the host origin. In some embodiments, the secretion enhancing protein includes a combination of a chaperone protein and a foldase protein. In some embodiments, the secretion enhancing protein can be a fragment of a chaperone or foldase protein with substantially the same protein secretion enhancing function as the full-length chaperone or foldase.

In various embodiments, the secretion enhancing protein of the present teachings can be bip1, clx1, ero1, lhs1, prp3, prp4, prp1, tig1, pdi1, ppi1, ppi2, Scj1, erv2, EDEM, and/or sil1 or combinations thereof. In the context of the present teachings, the name of any particular chaperone or foldase means that particular chaperone or foldase from any species, native or recombinant, or any particular chaperone or foldase with an amino acid sequence identical or substantially identical, e.g., at least 50%, 60%, 70%, 80%, 90%, or 95% identical to the corresponding chaperone or foldase sequence illustrated in the present application, or any polypeptide that can be a homolog of that particular chaperone or foldase, e.g., based on function or structure similarities commonly accepted by one skilled in the art. Examples of nucleic acid and polypeptide sequences of bip1, clx1, ero1, lhs1, prp3, prp4, prp1, tig1, pdi1, ppi1, ppi2, Scj1, erv2, EDEM, and sil1 are illustrated in the present application as SEQ ID NOs. 1-30 (see Table 1).

TABLE 1
Exemplary nucleic acid and polypeptide sequences
of secretion enhancing proteins.
Exemplary Nucleotide Exemplary Polypeptide
Protein Acid Sequence Sequence
bip1 SEQ ID NO: 1 SEQ ID NO: 16
clx1 SEQ ID NO: 2 SEQ ID NO: 17
ero1 SEQ ID NO: 3 SEQ ID NO: 18
lhs1 SEQ ID NO: 4 SEQ ID NO: 19
prp3 SEQ ID NO: 5 SEQ ID NO: 20
prp4 SEQ ID NO: 6 SEQ ID NO: 21
prp1 SEQ ID NO: 7 SEQ ID NO: 22
tig1 SEQ ID NO: 8 SEQ ID NO: 23
pdi1 SEQ ID NO: 9 SEQ ID NO: 24
ppi1 SEQ ID NO: 10 SEQ ID NO: 25
ppi2 SEQ ID NO: 11 SEQ ID NO: 26
Scj1 SEQ ID NO: 12 SEQ ID NO: 27
erv2 SEQ ID NO: 13 SEQ ID NO: 28
EDEM SEQ ID NO: 14 SEQ ID NO: 29
sil1 SEQ ID NO: 15 SEQ ID NO: 30

In general, the secretion enhancing protein of the present teachings can be co-expressed along with one or more desired polypeptides, e.g., polypeptides of interest in a host. The expression of the secretion enhancing protein can be under any suitable promoter known or later discovered in the art. In some embodiments, the secretion enhancing protein can be expressed under a promoter native to the host. In some embodiments, the secretion enhancing protein can be expressed under a heterologous promoter. In some embodiments, the secretion enhancing protein can be expressed under a constitutive or inducible promoter.

As used herein, the term “promoter” refers to a nucleic acid sequence that functions to direct transcription of a downstream gene. A promoter can include necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element. The promoter together with other transcriptional and translational regulatory nucleic acid sequences, collectively referred to as regulatory sequences controls the expression of a gene. In general, the regulatory sequences include, but are not limited to, promoter sequences, ribosomal binding sites, transcriptional start and stop sequences, translational start and stop sequences, and enhancer or activator sequences. The regulatory sequences will generally be appropriate to and recognized by the host in which the downstream gene is being expressed.

A constitutive promoter is a promoter that is active under most environmental and developmental conditions. An inducible or repressible promoter is a promoter that is active under environmental or developmental regulation. Promoters can be inducible or repressible by changes in environment factors such as, but not limited to, carbon, nitrogen or other nutrient availability, temperature, pH, osmolarity, the presence of heavy metal, the concentration of an inhibitor, stress, or a combination of the foregoing, as is known in the art. Promoters can be inducible or repressible by metabolic factors, such as the level of certain carbon sources, the level of certain energy sources, the level of certain catabolites, or a combination of the foregoing, as is known in the art.

Suitable non-limiting examples of promoters include cbh1, cbh2, egl1, egl2, egl3, eg14, egl5, xyn1, and xyn2, repressible acid phosphatase gene (phoA) promoter of P. chrysogenum (see Graessle et al., Applied and Environmental Microbiology (1997), 63(2), 753-756), glucose-repressible PCK1 promoter (see Leuker et al. Gene (1997), 192(2), 235-240), maltose-inducible, glucose-repressible MRP1 promoter (see Munro et al. Molecular Microbiology (2001), 39(5), 1414-1426), methionine-repressible MET3 promoter (see Liu et al. Eukaryotic Cell (2006), 5(4), 638-649).

In some embodiments of the present teachings, the promoter in the reporter gene construct is a temperature-sensitive promoter. Preferably, the activity of the temperature-sensitive promoter is repressed by elevated temperature. In some embodiments, the promoter is a catabolite-repressed promoter. In some embodiments, the promoter is repressed by changes in osmolarity. In some embodiments, the promoter is inducible or repressible by the levels of polysaccharides, disaccharides, or monosaccharides.

An example of an inducible promoter useful in the present teachings is the cbh1 promoter of Trichoderma reesei, the nucleotide sequence of which is deposited in GenBank under Accession Number D86235. Other exemplary promoters are promoters involved in the regulation of genes encoding cellulase enzymes, such as, but not limited to, cbh2, egl1, egl2, egl3, egl5, xyn1 and xyn2.

According to the present teachings, the secretion enhancing protein can be used to increase the secretion of any suitable polypeptide in a host. In some embodiments, the polypeptide can be a heterologous polypeptide. In some embodiments, the polypeptide can be a secretable polypeptide. For example, a secretable polypeptide can be a protein or polypeptide usually secreted outside of a cell or a protein or polypeptide operably linked to a signal sequence, e.g., an amino acid sequence tag leading proteins or polypeptides through the secretion pathway of a cell. Usually any suitable signal sequence known or later discovered can be used including, without any limitation, signal sequences derived from preprochymosin, e.g., bovine preprochymosin, glucoamylase, e.g., A. niger glucoamylase, aspartic protease, e.g., Rhizomucor miehei or Trichoderma reesei aspartic proteases or cellulases, e.g., Trichoderma reesei cellobiohydrolase I, cellobiohydrolase II, endoglucanase I, endoglucanase II or endoglucanase III.

In some embodiments, the polypeptide of interest can be a member of the aspartic proteinase family, e.g., family A1 of aspartic proteinases according to the MEROPS classification (Rawlings et al., Nucleic Acids Res (2006) 34: D270-72). This protein family contains endopeptidases with a catalytic center formed by two aspartic acid residues that are active at acidic pH. Chymosins (peptidase 3.4.23.4 by the NC-IUMB classification) are aspartic proteases that perform limited digestion of kappa-casein in neonatal gastric digestion. Bovine chymosin is used to clot milk during cheese making. In some embodiments, the polypeptide of interest can be a member of chymosin family, e.g. chymosin of any species including, without any limitation, chymosin of bovine, sheep, or goat origin. In some embodiments, the polypeptide of interest can be a modified chymosin, e.g., chymosin modified, such as mutated, to increase its function in any cheese making or milk coagulation process or optimize its expression in expression hosts. In some embodiments, the polypeptide of interest can be a fusion chymosin including at least two chymosins from two different species. In the context of the present application, the term “chymosin” means chymosin of any species, native or recombinant, or any polypeptide with substantially the same amino acid sequence as chymosin, e.g., any polypeptide having at least 60%, 70%, 80%, 90%, or 95% sequence identity of a chymosin, or any polypeptide with substantially the same protein folding characteristics of a chymosin, or a chymosin homolog, e.g., based on function or structure similarities commonly accepted by one skilled in the art. In some embodiments, the heterologous protein can be any protein expressible in a filamentous fungal host. Examples of proteins expressible in filamentous fungal hosts include, but are not limited to, laccases, endopeptidases, glucoamylases, alpha-amylase, granular starch hydrolyzing enzyme, cellulases, lipases, xylanases, cutinases, hemicellulases, proteases, oxidases, and combinations thereof. In general, the expression of a desired polypeptide in the present teachings can be under any suitable promoter known or later discovered in the art. In some embodiments, the polypeptide of interest in the present teachings can be expressed under a promoter native to the host. In some embodiments, the polypeptide of interest in the present teachings can be expressed under a heterologous promoter. In some embodiments, the polypeptide of interest in the present teachings can be expressed under a constitutive or inducible promoter. In some embodiments, the polypeptide of interest in the present teachings can be expressed in a Trichoderma expression system with a cellulase promoter, e.g., cbh1 promoter.

According to the present teachings, the secretion enhancing protein can be used in any host, e.g., expression host to increase the secretion of a desired polypeptide in the host. For example, the expression hosts of the present teachings can be filamentous fungi. In general, the “filamentous fungi” of the present teachings are eukaryotic microorganisms and include all filamentous forms of the subdivision Eumycotina. These fungi are characterized by a vegetative mycelium with a cell wall composed of chitin, beta-glucan, and other complex polysaccharides. In various embodiments, the filamentous fungi of the present teachings are morphologically, physiologically, and genetically distinct from yeasts. In some embodiments, the filamentous fungi of the present teachings include, but are not limited to the following genera: Aspergillus, Acremonium, Aureobasidium, Beauveria, Cephalosporium, Ceriporiopsis, Chaetomium paecilomyces, Chrysosporium, Claviceps, Cochiobolus, Cryptococcus, Cyathus, Endothia, Endothia mucor, Fusarium, Gilocladium, Humicola, Magnaporthe, Myceliophthora, Myrothecium, Mucor, Neurospora, Phanerochaete, Podospora, Paecilomyces, Penicillium, Pyricularia, Rhizomucor, Rhizopus, Schizophylum, Stagonospora, Talaromyces, Trichoderma, Thermomyces, Thermoascus, Thielavia, Tolypocladium, Trichophyton, Trametes, and Pleurotus. In some embodiments, the filamentous fungi of the present teachings include, but are not limited to the following: A. nidulans, A. niger, A. awamori, e.g., NRRL 3112, ATCC 22342 (NRRL 3112), ATCC 44733, ATCC 14331 and strain UVK 143f, A. oryzae, e.g., ATCC 11490, N. crassa, Trichoderma reesei, e.g. NRRL 15709, ATCC 13631, 56764, 56765, 56766, 56767, and Trichoderma viride, e.g., ATCC 32098 and 32086.

According to another aspect of the present teachings, it provides an expression host expressing a secretion enhancing protein and a desired polypeptide, e.g., polypeptide of interest. In some embodiments, the expression host of the present teachings contains a first polynucleotide encoding a secretion enhancing protein and a second polynucleotide encoding a polypeptide of interest. In some embodiments, the expression host of the present teachings contains a first polynucleotide encoding a secretion enhancing protein, a second polynucleotide encoding a polypeptide of interest, and a third polynucleotide encoding a secretion enhancing protein, e.g., different from the one encoded by the first polynucleotide.

In some embodiments, the expression host of the present teachings contains a first polynucleotide encoding a secretion enhancing protein that can be a chaperone or foldase protein and a second polynucleotide encoding a polypeptide of interest. In some embodiments, the expression host of the present teachings contains a first polynucleotide encoding a secretion enhancing protein that can be a chaperone, a second polynucleotide encoding a polypeptide of interest, and a third polynucleotide encoding a secretion enhancing protein that can be a foldase.

According to the present teachings, the first, second, and/or third polynucleotide in the expression host of the present teachings can be operably linked to one or more promoters, e.g., native or heterologous promoters of the expression host. Any suitable promoter can be used in the present teachings. In some embodiments, the promoter operably linked to the first and/or third polynucleotide can be a constitutive or inducible promoter. In some embodiments, the promoter operably linked to the second polynucleotide can be a promoter native to the expression host containing the second polynucleotide. In some embodiments, the promoter operably linked to the second polynucleotide can be a native promoter associated with any gene characteristic of active transcription or expression in the expression host. In some embodiments, the promoter operably linked to the second polynucleotide can be a modified native promoter, e.g., mutated native promoter with enhanced transcription activity of the promoter. In some embodiments, the promoter operably linked to the second polypeptide in a Trichoderma expression system can be a cellulase promoter, e.g., cbh1 promoter.

In some embodiments the desired polypeptide may be produced as a fusion polypeptide. In some embodiments the desired polypeptide may be fused to a polypeptide that is efficiently secreted by a filamentous fungus. In some embodiments the desired polypeptide may be fused to a CBHI polypeptide, or portion thereof. In some embodiments the desired polypeptide may be fused to a CBHI polypeptide, or portion thereof, that is altered to minimize or eliminate catalytic activity. In some embodiments the desired polypeptide may be fused to a polypeptide to enhance secretion, facilitate subsequent purification or enhance stability.

In general, the first, second, and/or third polynucleotide in the expression host of the present teachings can be either genetically inserted or integrated into the genomic makeup of the expression host, e.g., integrated into the chromosome of the expression host, or existing extrachromosomally, e.g., existing as a replicating vector within the expression host under selection condition for a selection marker carried by the vector.

According to the present teachings, the secretion level of a desired polypeptide in the expression host of the present teachings can be determined by various factors, e.g., growth conditions of the host, etc., however normally higher than the secretion level of the desired polypeptide expressed in the host without the expression of a secretion enhancing protein. In some embodiments, the secretion level of a desired polypeptide, e.g., bovine chymosin in the expression host of the present teachings, e.g., T. reesei can be at least 1 mg/liter, 2 mg/liter, 3 mg/liter, 4 mg/liter, or 5 mg/liter when the host grows in a batch fermentation mode in a shake flask, or at least 50 mg/liter, 100 mg/liter, 150 mg/liter, 200 mg/liter, 250 mg/liter, or 300 mg/liter when the host grows in a fermenter environment with controlled pH, feed-rate, etc. e.g., fed-batch fermentation.

In general, the secretion level of a polypeptide can be evaluated via various assays. For example, in order to evaluate the expression and/or secretion of a secretable polypeptide, assays can be carried out at the protein level, the RNA level or by use of functional bioassays particular to secretable polypeptide activity and/or production. Exemplary assays employed to analyze the expression and/or secretion of secretable polypeptide include, Northern blotting, dot blotting (DNA or RNA analysis), RT-PCR (reverse transcriptase polymerase chain reaction), or in situ hybridization, using an appropriately labeled probe (based on the nucleic acid coding sequence) and conventional Southern blotting and autoradiography.

In addition, the production, expression and/or secretion of a secretable polypeptide can be measured in a sample directly, for example, by assays for enzyme activity, expression and/or production. Protein expression, may be evaluated by immunological methods, such as immunohistochemical staining of cells, tissue sections or immunoassay of tissue culture medium, e.g., by Western blot or ELISA. Such immunoassays can be used to qualitatively and quantitatively evaluate expression of secretable polypeptide. The details of such methods are known to those of skill in the art and many reagents for practicing such methods are commercially available.

According to yet another aspect of the present teachings, it provides extracts, e.g., solids or supernatant obtained from the culture of the expression host of the present teachings. In some embodiments, the supernatant does not contain substantial amount of the expression host, in some embodiments, the supernatant does not contain any amount of the expression host.

EXAMPLES

Aspects of the present teachings may be further understood in light of the Examples, which should not be construed as limiting the present teachings in any way.

Example 1

Vector for Over-Expression of Bip1 in T. Reesei

A Gateway-compatible expression vector, pTrex2g/hygB, was designed to enable over-expression of the T. reesei chaperone gene bip1. After insertion into pTrex2g/hygB the open reading frame of the bip1 gene was flanked by the promoter sequences of the T. reesei pki1 gene and the terminator sequences of the T. reesei cbh1 gene. The vector also contained the E. coli hygromycin phosphotransferase (hph) gene flanked by the promoter sequences of the Neurospora crassa cpc-1 gene and the terminator sequences of the Aspergillus nidulans trpC gene.

The following segments of DNA were assembled in the construction of Trex2g/HygB (see FIG. 1):

A 728 bp fragment of T. reesei genomic DNA representing the promoter region from the pki1 (pyruvate kinase) gene. At the 5′ end of this DNA were 6 bp of synthetic DNA representing a SpeI restriction site and at the 3′ end were 6 bp of synthetic DNA adding a SacII restriction site.

The 1714 bp Gateway cassette to allow insertion of the chaperone or foldase sequence using Gateway cloning technology (InVitrogen Corporation, USA). This cassette has the following components; the 125 bp E. coli attR1 phage Îť0 attachment site, a chloramphenicol resistance gene, the E. coli ccdB gene and the 125 bp E. coli attR2 phage Îť attachment site.

The Gateway cassette was followed by a 17 bp fragment of synthetic DNA ending with an AscI site. The native T. reesei cbh1 terminator region (356 bp) immediately followed the AscI site. This terminator region ended with 4 bp of synthetic DNA being the half of a PmeI restriction site (GTTT) remaining after digestion.

A 2.6 kb cassette consisting of the Neurospora crassa cpc-1 promoter fused to the E. coli hph open reading frame followed by the Aspergillus nidulans trpC terminator. This cassette was amplified by PCR from the vector pFAC1 described by Barreau et al. (1998). The PCR product had 55 bp of synthetic DNA (part of a multiple cloning site) at one end and was blunt-end ligated to the digested PmeI site at the end of the cbh1 terminator. At the other end the PCR product had 20 bp of synthetic DNA terminating in a SphI site that was digested to link with pSL1180 below.

The above DNA fragments were inserted in the E. coli vector pSL1180 between the SpeI and SphI sites of the multiple cloning sites.

Example 2

The Trichoderma reesei Chymosin Production Strain CHY1-2

A synthetic version of the bovine prochymosin B open reading frame (see FIG. 2, SEQ ID NO: 42) was constructed with codon usage optimized for expression in Trichoderma. A vector, pTrex4-ChyGA was designed for the expression of an open reading frame encoding a fusion protein that consists of the following components from the amino-terminus: the T. reesei CBHI secretion signal sequence, the T. reesei CBHI catalytic core and linker region, and the bovine prochymosin B protein. This open reading frame is flanked by the promoter and terminator sequences of the T. reesei cbh1 gene. The vector also contains the Aspergillus nidulans amdS gene, encoding acetamidase, as a selectable marker for transformation of T. reesei.

The following segments of DNA were assembled in the construction of pTrex4-ChyGA (see FIG. 3):

The T. reesei cbh1 promoter and coding region. This DNA sequence begins at a naturally occurring HindIII site approximately 2250 bp upstream of the coding region. It ends at a SpeI site created at the end of the sequence encoding the CBHI linker region by changing the codon for the threonine residue at position 478 of preCBHI from ACC to ACT and adding AGT nucleotides immediately afterwards.

The synthetic coding region for bovine prochymosin B was directly fused to the end of the CBHI coding region. The sequence of this DNA is shown in FIG. 2. Immediately after the prochymosin B stop codon are 8 nucleotides of synthetic DNA representing an AscI restriction site (GGCGCGCC).

The native T. reesei cbh1 terminator region (356 bp) immediately followed the above AscI site.

A 2.75 kb fragment of Aspergillus nidulans genomic DNA including the promoter, coding region and terminator of the amdS (acetamidase) gene. This is a blunt-ended fragment generated by digestion with SspI at naturally occurring restriction sites

The above DNA fragments were inserted in the E. coli vector pSL1180 (Pharmacia) between the HindIII and StuI sites of the multiple cloning site.

Plasmid pTrex4-CHY GA was inserted into the Trichoderma reesei Morph1 1.1 pyr4+, a strain derived from RL-P37 (Sheir-Neiss, G. and Montenecourt, B. S., 1984, Appl. Microbiol. Biotechnol. 20:46-53) and deleted for the cbh1, cbh2, egl1, and egl2 genes described by Bower et al (Carbohydrases from Trichoderma reesei and other micro-organisms, Royal Society of Chemistry, Cambridge, 1998, p. 327-334) by polyethylene glycol (PEG)-mediated transformation of protoplasts. Transformants were selected on agar medium containing acetamide as sole nitrogen source. This resulted in the chymosin production host strain T. reesei CHY1-2.

Example 3

Cloning the T. Reesei bip1 Gene and Insertion into pTrex2g/hygB

In order to insert the T. reesei bip1 gene into pTrex2g/HygB the DNA sequence was amplified by PCR using attB PCR primers. The forward primer (F-attB1) had the following sequence at the 5′ end, 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3′, followed by a sequence specific to the 5′ end of the bip1 open reading frame. The reverse primer (R-attB2) had the following sequence at the 5′ end, 5′-GGGGACCACTTTGTACAAGAAAGCTGGGT-3′, followed by a sequence specific to the 3′ end of the bip1 open reading frame. The full sequence of the two primers was:

(SEQ ID NO: 31)
5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTATGGCTCGTTCACGGAG
CTCCC-3′
(SEQ ID NO: 32)
5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTTACAATTCGTCGTGGA
AGTCGCC-3′

The bip1 gene was amplified using Phusion polymerase from Finnzymes (Cat. No. F-530) according to the manufacturer's directions. The PCR mixture contained 1 μl T. reesei genomic DNA, 10 μl 5× buffer HF, 1 μl of 10 mM dNTPs, 1.5 μl DMSO, 0.5 μl Phusion DNA polymerase, 2 μl each of the forward and reverse bip1 primers and 32 μl MilliQ H2O. The following temperature and time conditions were used for the PCR. Denaturation of DNA at 98° C. for 30 sec followed by 30 cycles at 98° C. for 10 sec, 55° C. for 30 sec and 72° C. for 90 sec, and a final extension at 72° C. for 10 min.

After agarose gel electrophoresis the 2.3 kb PCR product was purified using a Qiagen gel extraction kit (Cat. No. 28706) according to the manufacturers instructions. The purified PCR product was inserted into the vector pDONR201 (Invitrogen; Cat. No. 11798014) using a BP Clonase reaction (Invitrogen; Cat. No. 11789013) according the following protocol. The following components were mixed; 2 Οl pDONR201, 4 Οl PCR product, 4 Οl BP Enzyme buffer, 6 Οl TE buffer, and 4 Οl BP Enyzme. After overnight incubation at 25° C. the reaction was stopped by adding Proteinase K solution and incubating for 10 minutes at 37° C. 2 Οl of the reaction mixture was used for transformation of E. coli TOP10 chemical competent cells (Invitrogen Cat. No. C4040-10) according to the manufacturer's directions. After sequence analysis, the bip1 sequence was transferred to the expression vector pTrex2g/hygB using the LR Clonase reaction (Invitrogen; Cat. No. 11791019) according to the following protocol. The following components were mixed. 2 Οl pDON201R with inserted bip1 gene, 2 Οl pTrex2g/hygB, 4 Οl LR enzyme buffer, 4 Οl LR enzyme mix, and 8 Οl TE. Following overnight incubation at 25° C. the reaction was stopped by addition of Proteinase K solution and incubation for 10 minutes at 37° C. 2 Οl of the reaction mixture was transformed into E. coli MAX EFFICIENCY DH5ι Competent Cells (Invitrogen; Cat. No. 18258012). Plasmid DNA, pTrex2g/HygB/bip1 was isolated from two resulting E. coli colonies for transformation of T. reesei CHY1-2

Example 4

Trichoderma Transformation

Expression vector pTrex2g/HygB/bip1 was inserted into spores of T. reesei CHY1-2 using a biolistic transformation procedure. DNA-coated tungsten particles were prepared as follows. 60 mg of M10 tungsten particles were added to 1 ml ethanol (70% or 100%) in a microcentrifuge tube. This mixture was allowed to soak for 15 minutes, followed by centrifugation for 15 min at 15,000 rpm. The supernatant was then decanted and the pellet washed three times with sterile distilled water. The majority of the distilled water was removed after the final wash. The pellet was then resuspended in 1 ml of a 50% glycerol (v/v, sterile) solution. While continuously vortexing a 25 Îźl aliquot of this particle suspension was removed and placed in a microcentrifuge tube. To this tube the following components were added (while continuously vortexing) in the following order. 0.5-5 Îźl of pTrex2g/HygB/bip1 DNA solution (1 Îźg/Îźl), 25 Îźl 2.5M CaCl2, and 10 Îźl 0.1 M spermidine

The mixture was allowed to coat the particles for 5-15 minutes during continuous vortexing, and was used as soon as possible to avoid tungsten degradation of the DNA. The mixture was then centrifuged for approximately three seconds. The supernatant was then removed and the pellet was washed with approx 200 Îźl of 70% ethanol (v/v) followed by a 3 second centrifugation and removal of the supernatant. The pellet was again washed with 200 Îźl of 100% ethanol, followed by another 3 second centrifugation. The supernatant was removed and the pellet was then resuspended in 24 Îźl 100% ethanol and mixed by pipetting. 8 Îźl aliquots were placed onto macrocarrier discs (Bio-Rad, Hercules, Calif.) by pipetting the aliquots in the exact center of the disks while the disks were in a desiccator. The discs were kept in a desiccator until thoroughly dry and kept there until immediately before use. The macrocarrier discs were inserted into a Model PDS-1000/He Biolistic Particle Delivery System (Bio-Rad, Hercules, Calif.). This apparatus was used according to the manufacturer's directions to propel the DNA-coated tungsten particles at the T. reesei spores prepared as below.

A spore suspension of strain CHY1-2 was made with approximately 5×108 spores/ml. 100-200 μl aliquots of the spore suspension was spread over an area approximately 6 cm in diameter at the center of a plate of agar medium containing acetamide as sole nitrogen source. After the biolistic transformation, the plates were placed in a 25° C. incubator for 1 day. Then, 1 ml Hygromycin B solution (4 mg/ml) was spread onto the plates and an additional incubation of 3 days at 28° C. was performed. Transformants were transferred onto fresh agar plates with acetamide as sole nitrogen source and Hygromycin B (200 μl/ml), and placed at 28° C.

Example 5

Chymosin Expression in Shake Flasks

Lactose defined liquid medium contained the following components. Casamino acids, 9 g/L; (NH4) 2SO4, 5 g/L; MgSO4.7H2O, 1 g/L; KH2PO4, 4.5 g/L; CaCl2.2H2O, 1 g/L, PIPPS, 33 g/L, 400× T. reesei trace elements, 2.5 ml/L; pH adjusted to 5.5 with NaOH. After sterilization, lactose was added to a final concentration of 20% v/v.

400× T. reesei trace elements solution contained the following: citric Acid (anhydrous), 175 g/L; FeSO4.7 H2O, 200 g/L, ZnSO4.7 H2O, 16 g/L, CuSO4.5 H2O, 3.2 g/L; MnSO4.H2O, 1.4 g/L; H3BO3, 0.8 g/L.

Ten transformants of T. reesei strain CHY1-2 with the bip1 expression vector were evaluated by shake flask culture in lactose defined liquid medium for improved chymosin production. From each morphologically stable transformant colony on a Petri dish one square cm was excised and used to inoculate a single 30 ml LD medium in a baffled shake flask. After 3 days of growth at 28° C. and 150 rpm, 5 ml of this pre-culture was used to inoculate 45 ml LD medium in a baffled shake flask. This production culture was grown for 3 days at 28° C. and 150 rpm. Supernatants were collected by centrifugation of the fermentation broth. Chymosin activity was measured and SDS-PAGE and Western analysis were performed to determine the chymosin concentration.

The chymosin activity in the culture supernatant was measured using essentially the same methods as previously described (Dunn-Coleman et al., 1991, Bio/Technology 9:976-981). Two transformants, bip1 #1.2 and bip1 #1.10 were chosen for further study because they showed a significant improvement in chymosin production compared to the host strain T. reesei CHY1-2 (see Table 2, column 2).

Culture supernatants from these two transformants were subjected to SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). Following electrophoresis protein was stained with Coomassie Brilliant Blue. Based on the intensity of the 35 kDa band corresponding to mature chymosin transformants bip1 #1.2 and bip1 #1.10 produced more chymosin than strain CHY 1-2.

Four replicate shake flask cultures of bip1 #1.2, bip1 #1.10 and strain CHY 1-2 were grown and chymosin activity analysis was performed. Again, transformants bip1 #1.2 and bip1 #1.10 clearly produced more active chymosin than the host strain T. reesei CHY1-2 (Table 2, column 3).

TABLE 2
Percentage of chymosin activity in shake flask
supernatants of transformants bip1 #1.2 and bip1
#1.10 compared to T. reesei CHY1-2
% of chymosin activity % of chymosin activity
Strain (Single shake flask experiment) (Average of four flasks)
CHY 1-2 100 100
Bip1 #1.2 282 363
Bip1 #1.10 240 370

It was possible that some secreted chymosin was present in an inactive form due to degradation. Chymosin was initially secreted as a CBHI-prochymosin fusion protein. At low pH, mature active chymosin was expected to be released by autocatalytic cleavage at the junction between the chymosin pro-region and mature chymosin. Therefore, it was also possible that some chymosin was present as CBHI-prochymosin fusion protein in the culture supernatant and consequently inactive. For these reasons, Western blot analysis was performed to determine the total amount of secreted chymosin; as active, inactive and fused protein. Proteins were separated by SDS-PAGE using the NuPAGE Novex pre-cast gel system according to the manufacturer's instructions (InVitrogen, Carlsbad, Calif.). Following electrophoresis the proteins were electro-blotted onto a PVDF membrane using an XCell II Blot Module as directed by the manufacturer (InVitrogen, Carlsbad, Calif.). The BM chromogenic Western Blotting Kit from Roche (Cat. No. 1647644) was used to detect alkaline phosphatase-labeled antibodies. Primary antibodies (affinity-purified polyclonal rabbit anti-chymosin) were diluted 1000 times. The blot was scanned and the intensities of the chymosin-specific bands were measured using Total Lab Software (see FIG. 4). Based on this measure of total chymosin production, transformants bip1 #1.2 and bip1 #1.10 showed a clear increase compared to strain CHY 1-2.

Example 6

mRNA Analysis of T. Reesei CHY1-2 and Bip1 #1.10

Shake flask fermentations were performed to collect mycelium for mRNA level analysis for chymosin, CBH1 and Bip1 in two T. reesei strains, CHY1-2 and bip1 #1.10. Broth was collected after 72 hrs of culture and frozen in liquid nitrogen. Total RNA was isolated using a FastRNA Red Kit (Bio 101, Inc., Carlsbad, Calif.) according to the manufacturer's instructions. In brief, the following protocol was used. Lysing tubes were chilled on dry ice and 500 Îźl CRSR RED, 500 Îźl PAR, and 100 ul CIA were added and frozen.

A piece of frozen mycelia (approx. 0.7 cm cubed) was added to the lysing tube with frozen reagents. The tube was placed at 60° C. for 2-5 minutes, until bottom reagents around the beads started to thaw, but not top reagents or sample. The tube was immediately secured in a FastPrep machine, and shaken for 3×30 seconds at setting 6, allowing 1 min rest between disruptions. The tubes were removed and placed on wet ice 5 min before centrifugation. The aqueous phase was drawn off to a new tube and an equal volume of CIA was added, vortexed to mix and centrifuged. The last step was repeated and an equal volume of DIPS was added, mixed and incubated at room temperature for 1-2 minutes. The tube was centrifuged to pellet the RNA and the supernatant was removed. The pellet was washed with 500 μl SEWS by adding the wash and removing immediately. The last traces of wash were removed and the pellet was air dried for 5-10 min before resuspending in 200 μl RNase-free water. 40 μl of LiCl solution was added and the sample was incubated at 4° C. overnight. The tube was centrifuged to pellet the RNA, the RNA was washed as before, and finally resuspended in 100-200 μl of RNase-free water.

Complementary DNA synthesis was performed with a High Archive cDNA synthesis kit from Applied Biosystems Inc. according to the manufacturer's directions, after which the cDNA was amplified with gene specific primers (Table 3).

TABLE 3 
Gene-specific primers designed for use in TaqMan 
Gene Expression Assays
Name Sequence
CBH1 forward AGTTACCACGAGCGGTAACAG
(SEQ ID NO: 33)
CBH1 reverse AAGAGAACTCGTTGCCAAGC
(SEQ ID NO: 34)
Bip1 forward CACCAACACCGTCTACGATG
(SEQ ID NO: 35)
Bip1 reverse CGTTCTTCTCAATGACCTTGTAG
(SEQ ID NO: 36)
Chymosin forward CAGCAAGCTCGTCGGC
(SEQ ID NO: 37)
Chymosin reverse GGTACATCTTGCCGTTGATCTC
(SEQ ID NO: 38)

Quantification of the amplified cDNA was performed using the TaqMan Gene Expression Assay kit from Applied Biosystems, Inc. with an Applied Biosystems 7900 HT thermal cycler according the manufacturer's instructions. In brief, the TaqMan Universal PCR Master Mix, No AmpErase UNG was mixed with 20× TaqMan Gene Expression Assay Mix (containing unlabelled gene-specific primers and TaqMan MGB probe) and cDNA. The following thermal cycler conditions were then applied. Two minutes at 50° C., 10 min at 95° C., and 40 cycles of 15 sec at 95° C., 1 min at 60° C. The bip1, chymosin and cbh1 levels were determined relative to the native T. reesei genes, gpd1 (encoding glyceraldehyde-3-phosphate dehydrogenase) and act1 (encoding actin). For each gene, a cycle threshold value was determined. This value is equivalent to the number of PCR cycles required for a fluorescence signal to be detectable. The difference between the cycle threshold value (ACT) for each of bip1, chymosin or cbh1 and either gpd1 or act1 was calculated. The units on the y axis of FIG. 5 represent ΔCT and one unit increase represents a doubling of mRNA level.

The above mRNA analyses showed that bip1, chymosin and cbh1 levels are all increased as a result of bip1 over-expression in transformant bip1 #1.10 compared to strain CHY 1-2. (see FIG. 5).

Example 7

T. Reesei Strain for Chymosin Production

A vector, pCBHI×CBD-Chy, was designed for the expression of an open reading frame encoding a fusion protein that consists of the following components from the amino-terminus: the T. reesei CBHI secretion signal sequence, the full-length T. reesei CBHI mature protein (including catalytic domain, linker region and cellulose binding domain), and the Bos taurus prochymosin B protein. A single codon was altered within the CBHI catalytic domain in order to inactivate the CBHI enzyme. This open reading frame is flanked by the promoter and terminator sequences of the T. reesei cbh1 gene. The vector also contains the Aspergillus nidulans amdS gene, encoding acetamidase, as a selectable marker for transformation of T. reesei.

The following segments of DNA were assembled in the construction of pCBHI×CBD-Chy. The T. reesei cbh1 promoter and coding region. This DNA sequence begins at a naturally occurring XbaI site approximately 1500 bp upstream of the coding region. The following changes to the native T. reesei genomic DNA sequence were made. Within the CBHI coding region the codon for amino acid 212 of the mature CBHI protein was changed from GAG (Glutamic acid) to CAG (Glutamine), known to result in production of an inactive form of CBHI (Stahlberg, J. (1996) J. Mol. Biol. 264:337-349).

Within the segment of the coding region encoding the CBHI linker region a change was made to create a SpeI restriction site. This changed the sequence from ACC CAG to ACT AGT ACC CAG (SEQ ID NO: 39) altering the amino acid sequence by insertion of two residues from Thr Gln to Thr Ser Thr Gln. The Gln in this sequence represents the first amino acid of the cellulose binding domain of CBHI. At the end of the CBHI coding sequence two additional codons (ACT AGT encoding Ser Thr) were added to create a SpeI restriction site.

The synthetic coding region for bovine prochymosin B is directly fused to the end of the CBHI coding region. The sequence of this DNA, and the encoded protein, are shown in FIG. 2. Immediately after the prochymosin B stop codon are 8 nucleotides of synthetic DNA representing an AscI restriction site (GGCGCGCC).

The native T. reesei cbh1 terminator region (356 bp) immediately follows the above AscI site. This terminator region ends with 4 bp of synthetic DNA being the half of a PmeI restriction site (GTTT) remaining after digestion.

A 2.75 kb fragment of Aspergillus nidulans genomic DNA including the promoter, coding region and terminator of the amdS (acetamidase) gene. This is a blunt-ended fragment generated by digestion with SspI at naturally occurring restriction sites. A natural XbaI site occurs before the SspI site at the end of the terminator region. A 55 bp fragment of the multiple cloning site of pSL1180 from the StuI to the KpnI site.

The above DNA fragments were inserted in the E. coli vector pNEB 193 (New England Biolabs, Inc., USA) between the XbaI and KpnI sites of the multiple cloning site. pNEB 193 is identical to pUC19 (Yannisch-Perron et al., 1985) except for the addition of several restriction endonuclease sites to the multiple cloning site.

The expression vector pCBHI×CBD-Chy was digested with XbaI to release a fragment of DNA containing only the cbh1 promoter, CHI-prochymosin B coding sequence, cbh1 terminator and A. nidulans amdS gene. Only this XbaI fragment of DNA, not the entire pCBHI×CBD-Chy expression vector, was inserted into the T. reesei production strain.

In more detail, this XbaI fragment contains the following segments of DNA. The T. reesei cbh1 promoter and coding region. This DNA sequence begins at a naturally occurring XbaI site approximately 1500 bp upstream of the coding region. The following changes to the native T. reesei genomic DNA sequence were made.

Within the CBHI coding region the codon for amino acid 212 of the mature CBHI protein was changed from GAG (Glutamic acid) to CAG (Glutamine) resulting in production of an inactive form of CBHI. Within the segment of the coding region encoding the CBHI linker region a change was made to create a SpeI restriction site. This changed the sequence from ACC CAG to ACT AGT ACC CAG altering the amino acid sequence by insertion of two residues from Thr Gln to Thr Ser Thr Gln. The Gln in this sequence represents the first amino acid of the cellulose binding domain of CBHI. At the end of the CBHI coding sequence two additional codons (ACT AGT encoding Ser Thr) were added to create a SpeI restriction site.

The synthetic coding region for bovine prochymosin B was directly fused to the end of the CBHI coding region. The sequence of this DNA, and the encoded protein, are shown in FIG. 2. Immediately after the prochymosin B stop codon are 8 nucleotides of synthetic DNA representing an AscI restriction site (GGCGCGCC).

The native T. reesei cbh1 terminator region (356 bp) immediately follows the above AscI site. This terminator region ends with 4 bp of synthetic DNA being the half of a PmeI restriction site (GTTT) remaining after digestion. A 2.75 kb fragment of Aspergillus nidulans genomic DNA including the promoter, coding region and terminator of the amdS (acetamidase) gene. This fragment begins at a naturally occurring SspI site and ends at a natural XbaI site.

The expression vector pTrex2g/HygB/Bip1 was described in Example 1. This vector was digested with SpeI and BmrI to release a fragment of DNA containing only the pki1 promoter, bip1 coding region, and cbh1 terminator. Only this SpeI-BmrI fragment of DNA, not the entire pTrex2g/HygB/Bip1 expression vector, was inserted into the T. reesei production strain. In more detail, this SpeI-BmrI fragment contains the following segments of DNA.

A 728 bp fragment of T. reesei genomic DNA representing the promoter region from the pki1 (pyruvate kinase) gene. At the 5′ end of this DNA are 5 bp of synthetic DNA representing a digested SpeI restriction site and at the 3, end are 6 bp of synthetic DNA adding a SacII restriction site. The 25 bp E. coli attB1 phage λ attachment site that remains after insertion of the sequence bip1 sequence (below) using Gateway cloning technology (InVitrogen Corporation, USA). A 2.3 kb fragment of T. reesei genomic DNA representing only the coding region of the bip1 gene. The 25 bp E. coli attB2 phage λ attachment site that remains after insertion of the sequence bip1 sequence (below) using Gateway cloning technology (InVitrogen Corporation, USA) followed by a 17 bp fragment of synthetic DNA ending with an AscI site.

The native T. reesei cbh1 terminator region (356 bp) immediately follows the above AscI site. This terminator region ends at a naturally occurring BmrI restriction site. Plasmid pCBHI×CBD-Chy was digested with XbaI and the CBHI-prochymosin B expression cassette (with amdS gene) was purified by agarose gel electrophoresis. Plasmid pTrex2g/HygB/Bip1 was digested with SpeI and BmrI and the Bip1 expression cassette was purified by agarose gel electrophoresis. T. reesei strain Pent Δ (derived from strain RL-P37 with deletions in the cbh1, cbh2, egl1, egl2 and egl3 genes) was transformed with a mixture of the purified CBHI-prochymosin B and Bip1 expression cassettes using a PEG-mediated protoplast transformation protocol.

Several transformants were isolated, grown in shake flasks and examined for chymosin production. One transformant was chosen and called strain Trichoderma reesei Pent CHY-Bip 3. The integration of DNA in transformant Pent CHY-Bip 3 was investigated by Southern analysis to show that only the intended modifications to the T. reesei Pent A strain had been made. Chromosomal DNA was extracted (see Appendix 1) from the transformant, as well as from the host strain PentΔ. The chromosomal DNA was digested, independently, with XbaI, SpeI or StuI. The digests were purified and concentrated by ethanol precipitation. Digested DNA (5-10 ug) was subjected to electrophoresis on 1% agarose gels. DNA molecular weight markers, and expression vectors pCBHI×CBD-Chy (digested with XbaI) and pTrex2g/HygB/Bip1 (digested with BmrI), were also run on appropriate gels. Following electrophoresis, DNA was transferred to nylon membrane (Nytran SuperCharge; Schleicher & Schuell BioScience). After blotting, the membranes were hybridized with 32P-labeled pCBHI×CBD-Chy, pTrex2g/HygB/Bip1, pUC18, or a PCR product consisting of the entire Hygromycin B resistance cassette (including cpc-1 promoter, hph coding region, and trpC terminator). The latter PCR product was generated from pTrex2g/HygB/Bip1 as template using the following two primers:

(SEQ ID NO: 40)
hph1, 5′ TCTCCGGTGTCCCTTGTCCCTTC-3′
and
(SEQ ID NO: 41)
hph2, 5′-ACCTGTGGCGCCGGTGATGCCGG-3′.

No hybridizing bands were observed with chromosomal DNA extracted from T. reesei Pent Δ or transformant Pent CHY-Bip 3 using the pUC18 probe demonstrating that no bacterial vector DNA was integrated in either of these strains. Similarly, hybridization with the Hygromycin B resistance cassette demonstrated that this DNA had not integrated in strain Pent CHY-Bip 3. The hybridization results with pCBHI×CBD-Chy and pTrex2g/HygB/Bip1 demonstrated that both the CBHI-prochymosin B expression cassette and the Bip1 expression cassette were integrated in strain Pent CHY-Bip 3. These results showed that only the intended CBHI-prochymosin B and Bip1 expression cassettes were integrated into the T. reesei chromosome.

Claims

1. A method for production of a secretable polypeptide in a filamentous fungal host comprising:

expressing a secretion enhancing protein in a filamentous fungal host containing a secretable polypeptide, wherein the secretion enhancing protein is bip1 and the secretable polypeptide is a chymosin.

2. The method of claim 1, comprising expressing at least two secretion enhancing proteins.

3. The method of claim 1, further comprising expressing a second chaperone protein and/or a foldase.

4. The method of claim 1, wherein the filamentous fungal host is T. reesei.

5. The method of claim 1, wherein the filamentous fungal host is selected from: Aspergillus, Acremonium, Aureobasidium, Beauveria, Cephalosporium, Ceriporiopsis, Chaetomium paecilomyces, Chrysosporium, Claviceps, Cochiobolus, Cryptococcus, Cyathus, Endothia, Endothia mucor, Fusarium, Gilocladium, Humicola, Magnaporthe, Myceliophthora, Myrothecium, Mucor, Neurospora, Phanerochaete, Podospora, Paecilomyces, Penicillium, Pyricularia, Rhizomucor, Rhizopus, Schizophylum, Stagonospora, Talaromyces, Trichoderma, Thermomyces, Thermoascus, Thielavia, Tolypocladium, Trichophyton, Trametes, and Pleurotus.

6. The method of claim 1, wherein the chymosin is a bovine chymosin.

7. The method of claim 1, wherein the chymosin is expressed through a promoter of the filamentous fungal host.

8. The method of claim 1, wherein the chymosin is expressed under a cbh1 promoter in T. reesei.

9. The method of claim 1, wherein the chymosin is produced as a fusion protein.

10. The method of claim 1, wherein the chymosin is produced as a fusion protein with a CBHI, or a portion thereof.

11. The method of claim 1, wherein the chymosin is produced as a fusion protein with a CBHI, or a portion thereof, and the CBHI amino acid sequence is altered to reduce or eliminate catalytic activity.

12. The method of claim 1 further comprising inoculating a suitable growth medium with the host and incubating under conditions permitting growth of the host.

13-25. (canceled)

26. A supernatant obtained using the method of claim 1, wherein the supernatant contains substantial amount of chymosin, but not substantial amount of the filamentous fungus.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: