Patent application title:

MicroRNA-Based Methods and Compositions For the Diagnosis, Prognosis and Treatment of Breast Cancer

Publication number:

US20140147495A1

Publication date:
Application number:

14/145,364

Filed date:

2013-12-31

Abstract:

The present invention provides novel methods and compositions for the diagnosis, prognosis and treatment of breast cancer. The invention also provides methods of identifying anti-breast cancer agents.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12Q1/6886 »  CPC main

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer

C12Q1/68 IPC

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids

C12N15/113 »  CPC further

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a divisional application claiming the benefit of U.S. application Ser. No. 12/012,235, now U.S. Pat. No. ______, issued ______, 2014, which entered the National Phase on Jan. 31, 2008, from the International PCT Application No. US06/029889, filed Jul. 31, 2006, which claims the benefit of U.S. Provisional Application No. 60/704,464, filed Aug. 1, 2005. The disclosures of each of the aforementioned applications are incorporated herein by reference for all purposes.

GOVERNMENT SUPPORT

This invention was supported by a grant under Program Project Grant P01CA76259, P01CA81534, and P30CA56036 from the National Cancer Institute. The Government has certain rights in this invention.

BACKGROUND OF THE INVENTION

Breast cancer is a significant health problem for women in the United States and throughout the world. Although advances have been made in the detection and treatment of the disease, breast cancer remains the second leading cause of cancer-related deaths in women, affecting more than 180,000 women in the United States each year. For women in North America, the life-time odds of getting breast cancer are now one in eight.

No universally successful method for the treatment or prevention of breast cancer is currently available. Management of breast cancer currently relies on a combination of early diagnosis (for example, through routine breast screening procedures) and aggressive treatment, which may include one or more of a variety of treatments, such as surgery, radiotherapy, chemotherapy and hormone therapy. The course of treatment for a particular breast cancer is often selected based on a variety of prognostic parameters including an analysis of specific tumor markers.

Although the discovery of BRCA1 and BRCA2 were important steps in identifying key genetic factors involved in breast cancer, it has become clear that mutations in BRCA1 and BRCA2 account for only a fraction of inherited susceptibility to breast cancer. In spite of considerable research into therapies for breast cancer, breast cancer remains difficult to diagnose and treat effectively, and the high mortality observed in breast cancer patients indicates that improvements are needed in the diagnosis, treatment and prevention of the disease.

MicroRNAs are a class of small, non-coding RNAs that control gene expression by hybridizing to and triggering either translational repression or, less frequently, degradation of a messenger RNA (mRNA) target. The discovery and study of miRNAs has revealed miRNA-mediated gene regulatory mechanisms that play important roles in organismal development and various cellular processes, such as cell differentiation, cell growth and cell death. Recent studies suggest that aberrant expression of particular miRNAs may be involved in human diseases, such as neurological disorders and cancer. In particular, misexpression of miR-16-1 and/or miR-15a has been found in human chronic lymphocytic leukemias.

The development and use of microarrays containing all known human microRNAs has permitted a simultaneous analysis of the expression of every miRNA in a sample. These microRNA microarrays have not only been used to confirm that miR-16-1 is deregulated in human CLL cells, but also to generate miRNA expression signatures that are associated with well-defined clinico-pathological features of human CLL.

The use of microRNA microarrays to identify a group of microRNAs, which are differentially-expressed between normal cells and breast cancer cells (for example, an expression signature or expression profile), may help pinpoint specific miRNAs that are involved in breast cancer. Furthermore, the identification of putative targets of these miRNAs may help to unravel their pathogenic role. The present invention provides novel methods and compositions for the diagnosis, prognosis and treatment of breast cancer.

SUMMARY OF THE INVENTION

The present invention is based, in part, on the identification of a breast cancer-specific signature of miRNAs that are differentially-expressed in breast cancer cells, relative to normal control cells.

Accordingly, embodiments of the invention encompass methods of diagnosing whether a subject has, or is at risk for developing, breast cancer, comprising measuring the level of at least one miR gene product in a test sample from the subject and comparing the level of the miR gene product in the test sample to the level of a corresponding miR gene product in a control sample. An alteration (for example, an increase, a decrease) in the level of the miR gene product in the test sample, relative to the level of a corresponding miR gene product in a control sample, is indicative of the subject either having, or being at risk for developing, breast cancer. In certain embodiments, the at least one miR gene product is selected from the group consisting of miR-125b-1, miR125b-2, miR-145, miR-21, miR-155, miR-10b and combinations thereof.

The level of the at least one miR gene product can be measured using a variety of techniques that are well known to those of skill in the art. In one embodiment, the level of the at least one miR gene product is measured using Northern blot analysis. In another embodiment, the level of the at least one miR gene product is measured by reverse transcribing RNA from a test sample obtained from the subject to provide a set of target oligodeoxynucleotides, hybridizing the target oligodeoxynucleotides to a microarray that comprises miRNA-specific probe oligonucleotides to provide a hybridization profile for the test sample, and comparing the test sample hybridization profile to a hybridization profile generated from a control sample. An alteration in the signal of at least one miRNA in the test sample relative to the control sample is indicative of the subject either having, or being at risk for developing, breast cancer. In a particular embodiment, the microarray comprises miRNA-specific probe oligonucleotides for a substantial portion of the human miRNome. In a further embodiment, the microarray comprises miRNA-specific probe oligonucleotides for one or more miRNAs selected from the group consisting of miR-145, miR-21, miR-155, miR-10b, miR-009-1 (miR131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, miR-213, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, let-7i (let-7d-v2), miR-101-1, miR-122a, miR-128b, miR-136, miR-143, miR-149, miR-191, miR-196-1, miR-196-2, miR-202, miR-203, miR-205, miR-206, miR-210 and combinations thereof.

Embodiments of the invention also provide methods of diagnosing a breast cancer associated with one or more prognostic markers, comprising measuring the level of at least one miR gene product in a breast cancer test sample from a subject and comparing the level of the at least one miR gene product in the breast cancer test sample to the level of a corresponding miR gene product in a control sample. The breast cancer can be associated with one or more adverse prognostic markers associated with breast cancer, such as, but not limited to, estrogen receptor expression, progesterone receptor expression, positive lymph node metastasis, high proliferative index, detectable p53 expression, advanced tumor stage, and high vascular invasion. In one embodiment, the level of the at least one miR gene product is measured by reverse transcribing RNA from a test sample obtained from the subject to provide a set of target oligodeoxynucleotides, hybridizing the target oligodeoxynucleotides to a microarray that comprises miRNA-specific probe oligonucleotides to provide a hybridization profile for the test sample, and comparing the test sample hybridization profile to a hybridization profile generated from a control sample. An alteration in the signal of at least one miRNA in the test sample relative to the control sample is indicative of the subject either having, or being at risk for developing, a breast cancer associated with the one or more prognostic markers. In a particular embodiment, the microarray comprises at least one miRNA-specific probe oligonucleotide for a miRNA selected from the group consisting of miR-26a, miR-26b, miR-102 (miR-29b), miR-30a-5p, miR-30b, miR-30c, miR-30d, miR-185, miR-191, miR-206, miR-212, let-7c, miR-9-2, miR-15-a, miR-21, miR-30a-s, miR-133a-1, miR-137, miR-153-2, miR-154, miR-181a, miR-203, miR-213, let-7f-1, let-7a-3, let-7a-2, miR-9-3, miR-10b, miR-27a, miR-29a, miR-123, miR-205, let-7d, miR-145, miR-16a, miR-128b and combinations thereof.

Embodiments of the invention also encompass methods of treating breast cancer in a subject, wherein at least one miR gene product is de-regulated (for example, down-regulated, up-regulated) in the cancer cells of the subject. When the at least one isolated miR gene product is down-regulated in the breast cancer cells, the method comprises administering an effective amount of the at least one isolated miR gene product, such that proliferation of cancer cells in the subject is inhibited. In one embodiment, the method comprises administering an effective amount of the at least one isolated miR gene product, provided that the miR gene is not miR-15a or miR-16-1, such that proliferation of cancer cells in the subject is inhibited. When the at least one isolated miR gene product is up-regulated in the cancer cells, the method comprises administering to the subject an effective amount of at least one compound for inhibiting expression of the at least one miR gene, such that proliferation of breast cancer cells is inhibited.

In related embodiments, the invention provides methods of treating breast cancer in a subject, comprising determining the amount of at least one miR gene product in breast cancer cells from the subject, relative to control cells. If expression of the miR gene product is deregulated in breast cancer cells, the methods further comprise altering the amount of the at least one miR gene product expressed in the breast cancer cells. If the amount of the miR gene product expressed in the cancer cells is less than the amount of the miR gene product expressed in control cells, the method comprises administering an effective amount of at least one isolated miR gene product. In one embodiment, the miR gene product is not miR-15a or miR-16-1. If the amount of the miR gene product expressed in the cancer cells is greater than the amount of the miR gene product expressed in control cells, the method comprises administering to the subject an effective amount of at least one compound for inhibiting expression of the at least one miR gene. In one embodiment, the miR gene product is not miR-15a or miR-16-1.

The invention further provides pharmaceutical compositions for treating breast cancer. In one embodiment, the pharmaceutical compositions comprise at least one isolated miR gene product and a pharmaceutically-acceptable carrier. In a particular embodiment, the at least one miR gene product corresponds to a miR gene product that has a decreased level of expression in breast cancer cells relative to suitable control cells. In certain embodiments the isolated miR gene product is selected from the group consisting of miR-145, miR-10b, miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, miR-101-1, miR-143 and combinations thereof.

In another embodiment, the pharmaceutical compositions of the invention comprise at least one miR expression inhibition compound. In a particular embodiment, the at least one miR expression inhibition compound is specific for a miR gene whose expression is greater in breast cancer cells than control cells. In certain embodiments, the miR expression inhibition compound is specific for one or more miR gene products selected from the group consisting of miR-21, miR-155, miR-009-1 (miR131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-213, let-7i (let-7d-v2), miR-122a, miR-128b, miR-136, miR-149, miR-191, miR-196-1, miR-196-2, miR-202, miR-203, miR-206, miR-210, miR-213 and combinations thereof.

Embodiments of the invention also encompass methods of identifying an anti-breast cancer agent, comprising providing a test agent to a cell and measuring the level of at least one miR gene product in the cell. In one embodiment, the method comprises providing a test agent to a cell and measuring the level of at least one miR gene product associated with decreased expression levels in breast cancer cells. An increase in the level of the miR gene product in the cell, relative to a suitable control cell, is indicative of the test agent being an anti-breast cancer agent. In a particular embodiment, the at least one miR gene product associated with decreased expression levels in breast cancer cells is selected from the group consisting of miR-145, miR-10b, miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, miR-101-1, miR-143 and combinations thereof.

In other embodiments the method comprises providing a test agent to a cell and measuring the level of at least one miR gene product associated with increased expression levels in breast cancer cells. A decrease in the level of the miR gene product in the cell, relative to a suitable control cell, is indicative of the test agent being an anti-breast cancer agent. In a particular embodiment, at least one miR gene product associated with increased expression levels in breast cancer cells is selected from the group consisting of miR-21, miR-155, miR-009-1 (miR131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-213, let-7i (let-7d-v2), miR-122a, miR-128b, miR-136, miR-149, miR-191, miR-196-1, miR-196-2, miR-202, miR-203, miR-206, miR-210, miR-213 and combinations thereof.

BRIEF DESCRIPTION OF THE DRAWINGS

The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

FIG. 1 depicts a tree generated by cluster analysis showing a separation of breast cancer from normal tissues on the basis of differential microRNA expression (P<0.05). The bar at the bottom of the figure indicates the group of cancer (red) or normal breast tissues (yellow).

FIG. 2 is a graph depicting the probability (0.0 to 1.0) of each sample being a cancerous or normal tissue based on PAM analysis. All breast cancer and normal tissues were correctly predicted by the miR signature shown in Table 2.

FIG. 3A is a Northern blot depicting the expression level of miR-125b, using a miR-125b complementary probe, in a normal sample, as well as several tumor samples from breast cancer patients (P). The U6 probe was used for normalization of expression levels for each sample.

FIG. 3B is a Northern blot depicting the expression level of miR-145, using a miR-145 complementary probe, in a normal sample, as well as several tumor samples from breast cancer patients (P). The U6 probe was used for normalization of expression levels for each sample.

FIG. 3C is a Northern blot depicting the expression level of miR-21, using a miR-21 complementary probe, in a normal sample, as well as several tumor samples from breast cancer patients (labeled as numbered patients). The U6 probe was used for normalization of expression levels for each sample.

FIG. 3D is a Northern blot depicting the expression levels of microRNAs miR-125b, miR-145 and miR-21 in various breast cancer cell lines. The expression level of each microRNA was also determined in a sample from normal tissues. The U6 probe was used for normalization of expression levels for each sample.

FIG. 4A is a table listing miRNAs that are differentially-expressed in breast cancer samples associated with the presence (ER+) or absence (ER−) of estrogen receptor.

FIG. 4B is a table listing miRNAs that are differentially-expressed in breast cancer samples associated with the presence (PR+) or absence (PR−) of progesterone receptor.

FIG. 4C is a table listing miRNAs that are differentially-expressed in breast cancer samples associated with stage 1 (pT1) or stage 2 or 3 (pT2-3) tumors.

FIG. 4D is a table listing miRNAs that are differentially-expressed in breast cancer samples associated with the presence (pN0) or absence (pN10+) of lymph node metastasis.

FIG. 4E is a table listing miRNAs that are differentially-expressed in breast cancer samples associated with the presence or absence of vascular invasion.

FIG. 4F is a table listing miRNAs that are differentially-expressed in breast cancer samples associated with a high (MIB-1>30) or low (MIB-1<20) proliferative index (PI).

FIG. 4G is a table listing miRNAs that are differentially-expressed in breast cancer samples associated with positive (p53+) or negative (p53−) immunostaining of p53.

DETAILED DESCRIPTION OF THE INVENTION

The present invention is based, in part, on the identification of particular miRNAs whose expression is altered in breast cancer cells relative to normal control cells, and microRNAs whose expression is altered in breast cancer cells associated with particular prognostic features, relative to breast cancer cells lacking such features.

As used herein interchangeably, a “miR gene product,” “microRNA,” “miR,” or “miRNA” refers to the unprocessed or processed RNA transcript from an miR gene. As the miR gene products are not translated into protein, the term “miR gene products” does not include proteins. The unprocessed miR gene transcript is also called an “miR precursor,” and typically comprises an RNA transcript of about 70-100 nucleotides in length. The miR precursor can be processed by digestion with an RNAse (for example, Dicer, Argonaut, or RNAse III, for example, E. coli RNAse III)) into an active 19-25 nucleotide RNA molecule. This active 19-25 nucleotide RNA molecule is also called the “processed” miR gene transcript or “mature” miRNA.

The active 19-25 nucleotide RNA molecule can be obtained from the miR precursor through natural processing routes (for example, using intact cells or cell lysates) or by synthetic processing routes (for example, using isolated processing enzymes, such as isolated Dicer, Argonaut, or RNAase III). It is understood that the active 19-25 nucleotide RNA molecule can also be produced directly by biological or chemical synthesis, without having been processed from the miR precursor.

The sequences of 187 miR gene products are provided in Table 1. All nucleic acid sequences herein are given in the 5′ to 3′ direction. In addition, genes are represented by italics, and gene products are represented by normal type; for example, mir-17 is the gene and miR-17 is the gene product.

The present invention encompasses methods of diagnosing whether a subject has, or is at risk for developing, breast cancer, comprising measuring the level of at least one miR gene product in a test sample from the subject and comparing the level of the miR gene product in the test sample to the level of a corresponding miR gene product in a control sample. As used herein, a “subject” can be any mammal that has, or is suspected of having, breast cancer. In a particular embodiment, the subject is a human who has, or is suspected of having, breast cancer.

The breast cancer can be any form of breast cancer and may be associated with one or more prognostic markers or features, including, but not limited to, estrogen receptor expression, progesterone receptor expression, lymph node metastasis, high proliferative index, detectable p53 expression, advanced tumor stage, and high vascular invasion. The prognostic marker can be associated with an adverse or negative prognosis, or it may be associated with a good or positive prognosis.

TABLE 1
Human miR Gene Product Sequences
SEQ ID
Name Precursor Sequence (5′ to 3′)* NO.
hsa-let-7a-1-prec CACTGTGGGATGAGGTAGTAGGTTGTATAGTTTTAGGGTCACACCCACCACT 1
GGGAGATAACTATACAATCTACTGTCTTTCCTAACGTG
hsa-let-7a-2-prec AGGTTGAGGTAGTAGGTTGTATAGTTTAGAATTACATCAAGGGAGATAACTG 2
TACAGCCTCCTAGCTTTCCT
hsa-let-7a-3-prec GGGTGAGGTAGTAGGTTGTATAGTTTGGGGCTCTGCCCTGCTATGGGATAAC 3
TATACAATCTACTGTCTTTCCT
hsa-let-7a-4-prec GTGACTGCATGCTCCCAGGTTGAGGTAGTAGGTTGTATAGTTTAGAATTACA 4
CAAGGGAGATAACTGTACAGCCTCCTAGCTTTCCTTGGGTCTTGCACTAAAC
AAC
hsa-let-7b-prec GGCGGGGTGAGGTAGTAGGTTGTGTGGTTTCAGGGCAGTGATGTTGCCCCTC 5
GGAAGATAACTATACAACCTACTGCCTTCCCTG
hsa-let-7c-prec GCATCCGGGTTGAGGTAGTAGGTTGTATGGTTTAGAGTTACACCCTGGGAGT 6
TAACTGTACAACCTTCTAGCTTTCCTTGGAGC
hsa-let-7d-prec CCTAGGAAGAGGTAGTAGGTTGCATAGTTTTAGGGCAGGGATTTTGCCCACA 7
AGGAGGTAACTATACGACCTGCTGCCTTTCTTAGG
hsa-let-7d-v1- CTAGGAAGAGGTAGTAGTTTGCATAGTTTTAGGGCAAAGATTTTGCCCACAA 8
prec GTAGTTAGCTATACGACCTGCAGCCTTTTGTAG
hsa-let-7d-v2- CTGGCTGAGGTAGTAGTTTGTGCTGTTGGTCGGGTTGTGACATTGCCCGCTGT 9
prec GGAGATAACTGCGCAAGCTACTGCCTTGCTAG
hsa-let-7e-prec CCCGGGCTGAGGTAGGAGGTTGTATAGTTGAGGAGGACACCCAAGGAGATC 10
ACTATACGGCCTCCTAGCTTTCCCCAGG
hsa-let-7f-1-prec TCAGAGTGAGGTAGTAGATTGTATAGTTGTGGGGTAGTGATTTTACCCTGTT 11
CAGGAGATAACTATACAATCTATTGCCTTCCCTGA
hsa-let-7f-2-prec CTGTGGGATGAGGTAGTAGATTGTATAGTTGTGGGGTAGTGATTTTACCCTG 12
TTCAGGAGATAACTATACAATCTATTGCCTTCCCTGA
hsa-let-7f-2-prec CTGTGGGATGAGGTAGTAGATTGTATAGTTTTAGGGTCATACCCCATCTTGG 13
AGATAACTATACAGTCTACTGTCTTTCCCACGG
hsa-let-7g-prec TTGCCTGATTCCAGGCTGAGGTAGTAGTTTGTACAGTTTGAGGGTCTATGAT 14
ACCACCCGGTACAGGAGATAACTGTACAGGCCACTGCCTTGCCAGGAACAG
CGCGC
hsa-let-7i-prec CTGGCTGAGGTAGTAGTTTGTGCTGTTGGTCGGGTTGTGACATTGCCCGCTGT 15
GGAGATAACTGCGCAAGCTACTGCCTTGCTAG
hsa-mir-001b-1- ACCTACTCAGAGTACATACTTCTTTATGTACCCATATGAACATACAATGCTAT 16
prec GGAATGTAAAGAAGTATGTATTTTTGGTAGGC
hsa-mir-001b-1- CAGCTAACAACTTAGTAATACCTACTCAGAGTACATACTTCTTTATGTACCCA 17
prec TATGAACATACAATGCTATGGAATGTAAAGAAGTATGTATTTTTGGTAGGCA
ATA
hsa-mir-001b-2- GCCTGCTTGGGAAACATACTTCTTTATATGCCCATATGGACCTGCTAAGCTAT 18
prec GGAATGTAAAGAAGTATGTATCTCAGGCCGGG
hsa-mir-001b- TGGGAAACATACTTCTTTATATGCCCATATGGACCTGCTAAGCTATGGAATG 19
prec TAAAGAAGTATGTATCTCA
hsa-mir-001d- ACCTACTCAGAGTACATACTTCTTTATGTACCCATATGAACATACAATGCTAT 20
prec GGAATGTAAAGAAGTATGTATTTTTGGTAGGC
hsa-mir-007-1 TGGATGTTGGCCTAGTTCTGTGTGGAAGACTAGTGATTTTGTTGTTTTTAGAT 21
AACTAAATCGACAACAAATCACAGTCTGCCATATGGCACAGGCCATGCCTCT
ACA
hsa-mir-007-1- TTGGATGTTGGCCTAGTTCTGTGTGGAAGACTAGTGATTTTGTTGTTTTTAGA 22
prec TAACTAAATCGACAACAAATCACAGTCTGCCATATGGCACAGGCCATGCCTC
TACAG
hsa-mir-007-2 CTGGATACAGAGTGGACCGGCTGGCCCCATCTGGAAGACTAGTGATTTTGTT 23
GTTGTCTTACTGCGCTCAACAACAAATCCCAGTCTACCTAATGGTGCCAGCC
ATCGCA
hsa-mir-007-2- CTGGATACAGAGTGGACCGGCTGGCCCCATCTGGAAGACTAGTGATTTTGTT 24
prec GTTGTCTTACTGCGCTCAACAACAAATCCCAGTCTACCTAATGGTGCCAGCC
ATCGCA
hsa-mir-007-3 AGATTAGAGTGGCTGTGGTCTAGTGCTGTGTGGAAGACTAGTGATTTTGTTG 25
TTCTGATGTACTACGACAACAAGTCACAGCCGGCCTCATAGCGCAGACTCCC
TTCGAC
hsa-mir-007-3- AGATTAGAGTGGCTGTGGTCTAGTGCTGTGTGGAAGACTAGTGATTTTGTTG 26
prec TTCTGATGTACTACGACAACAAGTCACAGCCGGCCTCATAGCGCAGACTCCC
TTCGAC
hsa-mir-009-1 CGGGGTTGGTTGTTATCTTTGGTTATCTAGCTGTATGAGTGGTGTGGAGTCTT 27
CATAAAGCTAGATAACCGAAAGTAAAAATAACCCCA
hsa-mir-009-2 GGAAGCGAGTTGTTATCTTTGGTTATCTAGCTGTATGAGTGTATTGGTCTTCA 28
TAAAGCTAGATAACCGAAAGTAAAAACTCCTTCA
hsa-mir-009-3 GGAGGCCCGTTTCTCTCTTTGGTTATCTAGCTGTATGAGTGCCACAGAGCCGT 29
CATAAAGCTAGATAACCGAAAGTAGAAATGATTCTCA
hsa-mir-010a- GATCTGTCTGTCTTCTGTATATACCCTGTAGATCCGAATTTGTGTAAGGAATT 30
prec TTGTGGTCACAAATTCGTATCTAGGGGAATATGTAGTTGACATAAACACTCC
GCTCT
hsa-mir-010b- CCAGAGGTTGTAACGTTGTCTATATATACCCTGTAGAACCGAATTTGTGTGG 31
prec TATCCGTATAGTCACAGATTCGATTCTAGGGGAATATATGGTCGATGCAAAA
ACTTCA
hsa-mir-015a-2- GCGCGAATGTGTGTTTAAAAAAAATAAAACCTTGGAGTAAAGTAGCAGCAC 32
prec ATAATGGTTTGTGGATTTTGAAAAGGTGCAGGCCATATTGTGCTGCCTCAAA
AATAC
hsa-mir-015a- CCTTGGAGTAAAGTAGCAGCACATAATGGTTTGTGGATTTTGAAAAGGTGCA 33
prec GGCCATATTGTGCTGCCTCAAAAATACAAGG
hsa-mir-015b- CTGTAGCAGCACATCATGGTTTACATGCTACAGTCAAGATGCGAATCATTAT 34
prec TTGCTGCTCTAG
hsa-mir-015b- TTGAGGCCTTAAAGTACTGTAGCAGCACATCATGGTTTACATGCTACAGTCA 35
prec AGATGCGAATCATTATTTGCTGCTCTAGAAATTTAAGGAAATTCAT
hsa-mir-016a- GTCAGCAGTGCCTTAGCAGCACGTAAATATTGGCGTTAAGATTCTAAAATTA 36
chr13 TCTCCAGTATTAACTGTGCTGCTGAAGTAAGGTTGAC
hsa-mir-016b- GTTCCACTCTAGCAGCACGTAAATATTGGCGTAGTGAAATATATATTAAACA 37
chr3 CCAATATTACTGTGCTGCTTTAGTGTGAC
hsa-mir-016- GCAGTGCCTTAGCAGCACGTAAATATTGGCGTTAAGATTCTAAAATTATCTC 38
prec-13 CAGTATTAACTGTGCTGCTGAAGTAAGGT
hsa-mit-017-prec GTCAGAATAATGTCAAAGTGCTTACAGTGCAGGTAGTGATATGTGCATCTAC 39
TGCAGTGAAGGCACTTGTAGCATTATGGTGAC
hsa-mir-018-prec TGTTCTAAGGTGCATCTAGTGCAGATAGTGAAGTAGATTAGCATCTACTGCC 40
CTAAGTGCTCCTTCTGGCA
hsa-mir-018- TTTTTGTTCTAAGGTGCATCTAGTGCAGATAGTGAAGTAGATTAGCATCTACT 41
prec-13 GCCCTAAGTGCTCCTTCTGGCATAAGAA
hsa-mir-019a- GCAGTCCTCTGTTAGTTTTGCATAGTTGCACTACAAGAAGAATGTAGTTGTG 42
prec CAAATCTATGCAAAACTGATGGTGGCCTGC
hsa-mir-019a- CAGTCCTCTGTTAGTTTTGCATAGTTGCACTACAAGAAGAATGTAGTTGTGC 43
prec-13 AAATCTATGCAAAACTGATGGTGGCCTG
hsa-mir-019b-1- CACTGTTCTATGGTTAGTTTTGCAGGTTTGCATCCAGCTGTGTGATATTCTGC 44
prec TGTGCAAATCCATGCAAAACTGACTGTGGTAGTG
hsa-mir-019b-2- ACATTGCTACTTACAATTAGTTTTGCAGGTTTGCATTTCAGCGTATATATGTA 45
prec TATGTGGCTGTGCAAATCCATGCAAAACTGATTGTGATAATGT
hsa-mir-019b- TTCTATGGTTAGTTTTGCAGGTTTGCATCCAGCTGTGTGATATTCTGCTGTGC 46
prec-13 AAATCCATGCAAAACTGACTGTGGTAG
hsa-mir-019b- TTACAATTAGTTTTGCAGGTTTGCATTTCAGCGTATATATGTATATGTGGCTG 47
prec--X TGCAAATCCATGCAAAACTGATTGTGAT
hsa-mir-020-prec GTAGCACTAAAGTGCTTATAGTGCAGGTAGTGTTTAGTTATCTACTGCATTAT 48
GAGCACTTAAAGTACTGC
hsa-mir-021-prec TGTCGGGTAGCTTATCAGACTGATGTTGACTGTTGAATCTCATGGCAACACC 49
AGTCGATGGGCTGTCTGACA
hsa-mir-021- ACCTTGTCGGGTAGCTTATCAGACTGATGTTGACTGTTGAATCTCATGGCAA 50
prec-17 CACCAGTCGATGGGCTGTCTGACATTTTG
hsa-mir-022-prec GGCTGAGCCGCAGTAGTTCTTCAGTGGCAAGCTTTATGTCCTGACCCAGCTA 51
AAGCTGCCAGTTGAAGAACTGTTGCCCTCTGCC
hsa-mir-023a- GGCCGGCTGGGGTTCCTGGGGATGGGATTTGCTTCCTGTCACAAATCACATT 52
prec GCCAGGGATTTCCAACCGACC
hsa-mir-023b- CTCAGGTGCTCTGGCTGCTTGGGTTCCTGGCATGCTGATTTGTGACTTAAGAT 53
prec TAAAATCACATTGCCAGGGATTACCACGCAACCACGACCTTGGC
hsa-mir-023- CCACGGCCGGCTGGGGTTCCTGGGGATGGGATTTGCTTCCTGTCACAAATCA 54
prec-19 CATTGCCAGGGATTTCCAACCGACCCTGA
hsa-mir-024-1- CTCCGGTGCCTACTGAGCTGATATCAGTTCTCATTTTACACACTGGCTCAGTT 55
prec CAGCAGGAACAGGAG
hsa-mir-024-2- CTCTGCCTCCCGTGCCTACTGAGCTGAAACACAGTTGGTTTGTGTACACTGGC 56
prec TCAGTTCAGCAGGAACAGGG
hsa-mir-024- CCCTGGGCTCTGCCTCCCGTGCCTACTGAGCTGAAACACAGTTGGTTTGTGTA 57
prec-19 CACTGGCTCAGTTCAGCAGGAACAGGGG
hsa-mir-024- CCCTCCGGTGCCTACTGAGCTGATATCAGTTCTCATTTTACACACTGGCTCAG 58
prec-9 TTCAGCAGGAACAGCATC
hsa-mir-025-prec GGCCAGTGTTGAGAGGCGGAGACTTGGGCAATTGCTGGACGCTGCCCTGGG 59
CATTGCACTTGTCTCGGTCTGACAGTGCCGGCC
hsa-mir-026a- AGGCCGTGGCCTCGTTCAAGTAATCCAGGATAGGCTGTGCAGGTCCCAATGG 60
prec CCTATCTTGGTTACTTGCACGGGGACGCGGGCCT
hsa-mir-026b- CCGGGACCCAGTTCAAGTAATTCAGGATAGGTTGTGTGCTGTCCAGCCTGTT 61
prec CTCCATTACTTGGCTCGGGGACCGG
hsa-mir-027a- CTGAGGAGCAGGGCTTAGCTGCTTGTGAGCAGGGTCCACACCAASGTCGTGTT 62
prec CACAGTGGCTAAGTTCCGCCCCCCAG
hsa-mir-027b- AGGTGCAGAGCTTAGCTGATTGGTGAACAGTGATTGGTTTCCGCTTTGTTCA 63
prec CAGTGGCTAAGTTCTGCACCT
hsa-mir-027b- ACCTCTCTAACAAGGTGCAGAGCTTAGCTGATTGGTGAACAGTGATTGGTTT 64
prec CCGCTTTGTTCACAGTGGCTAAGTTCTGCACCTGAAGAGAAGGTG
hsa-mir-027- CCTGAGGAGCAGGGCTTAGCTGCTTGTGAGCAGGGTCCACACCAAGTCGTGT 65
prec-19 TCACAGTGGCTAAGTTCCGCCCCCCAGG
hsa-mir-028-prec GGTCCTTGCCCTCAAGGAGCTCACAGTCTATTGAGTTACCTTTCTGACTTTCC 66
CACTAGATTGTGAGCTCCTGGAGGGCAGGCACT
hsa-mir-029a-2 CCTTCTGTGACCCCTTAGAGGATGACTGATTTCTTTTGGTGTTCAGAGTCAAT 67
ATAATTTTCTAGCACCATCTGAAATCGGTTATAATGATTGGGGAAGAGCACC
ATG
hsa-mir-029a- ATGACTGATTTCTTTTGGTGTTCAGAGTCAATATAATTTTCTAGCACCATCTG 68
prec AAATCGGTTAT
hsa-mir-029c- ACCACTGGCCCATCTCTTACACAGGCTGACCGATTTCTCCTGGTGTTCAGAGT 69
prec CTGTTTTTGTCTAGCACCATTTGAAATCGGTTATGATGTAGGGGGAAAAGCA
GCAGC
hsa-mir-030a- GCGACTGTAAACATCCTCGACTGGAAGCTGTGAAGCCACAGATGGGCTTTCA 70
prec GTCGGATGTTTGCAGCTGC
hsa-mir-030b- ATGTAAACATCCTACACTCAGCTGTAATACATGGATTGGCTGGGAGGTGGAT 71
prec GTTTACGT
hsa-mir-030b- ACCAAGTTTCAGTTCATGTAAACATCCTACACTCAGCTGTAATACATGGATT 72
prec GGCTGGGAGGTGGATGTTTACTTCAGCTGACTTGGA
hsa-mir-030c- AGATACTGTAAACATCCTACACTCTCAGCTGTGGAAAGTAAGAAAGCTGGG 73
prec AGAAGGCTGTTTACTCTTTCT
hsa-mir-030d- GTTGTTGTAAACATCCCCGACTGGAAGCTGTAAGACACAGCTAAGCTTTCAG 74
prec TCAGATGTTTGCTGCTAC
hsa-mir-031-prec GGAGAGGAGGCAAGATGCTGGCATAGCTGTTGAACTGGGAACCTGCTATGC 75
CAACATATTGCCATCTTTCC
hsa-mir-032-prec GGAGATATTGCACATTACTAAGTTGCATGTTGTCACGGCCTCAATGCAATTT 76
AGTGTGTGTGATATTTTC
hsa-mir-033b- GGGGGCCGAGAGAGGCGGGCGGCCCCGCGGTGCATTGCTGTTGCATTGCAC 77
prec GTGTGTGAGGCGGGTGCAGTGCCTCGGCAGTGCAGCCCGGAGCCGGCCCCT
GGCACCAC
hsa-mir-033-prec CTGTGGTGCATTGTAGTTGCATTGCATGTTCTGGTGGTACCCATGCAATGTTT 78
CCACAGTGCATCACAG
hsa-mir-034-prec GGCCAGCTGTGAGTGTTTCTTTGGCAGTGTCTTAGCTGGTTGTTGTGAGCAAT 79
AGTAAGGAAGCAATCAGCAAGTATACTGCCCTAGAAGTGCTGCACGTTGTG
GGGCCC
hsa-mir-091- TCAGAATAATGTCAAAGTGCTTACAGTGCAGGTAGTGATATGTGCATCTACT 80
prec-13 GCAGTGAAGGCACTTGTAGCATTATGGTGA
hsa-mir-092- CTTTCTACACAGGTTGGGATCGGTTGCAATGCTGTGTTTCTGTATGGTATTGC 81
prec-13 = 092-1 ACTTGTCCCGGCCTGTTGAGTTTGG
hsa-mir-092- TCATCCCTGGGTGGGGATTTGTTGCATTACTTGTGTTCTATATAAAGTATTGC 82
prec-X = 092-2 ACTTGTCCCGGCCTGTGGAAGA
hsa-mir-093- CTGGGGGCTCCAAAGTGCTGTTCGTGCAGGTAGTGTGATTACCCAACCTACT 83
prec-7.1 = 093-1 GCTGAGCTAGCACTTCCCGAGCCCCCGG
hsa-mir-093- CTGGGGGCTCCAAAGTGCTGTTCGTGCAGGTAGTGTGATTACCCAACCTACT 84
prec-7.2 = 093-2 GCTGAGCTAGCACTTCCCGAGCCCCCGG
hsa-mir-095- AACACAGTGGGCACTCAATAAATGTCTGTTGAATTGAAATGCGTTACATTCA 85
prec-4 ACGGGTATTTATTGAGCACCCACTCTGTG
hsa-mir-096- TGGCCGATTTTGGCACTAGCACATTTTTGCTTGTGTCTCTCCGCTCTGAGCAA 86
prec-7 TCATGTGCAGTGCCAATATGGGAAA
hsa-mir-098- GTGAGGTAGTAAGTTGTATTGTTGTGGGGTAGGGATATTAGGCCCCAATTAG 87
prec-X AAGATAACTATACAACTTACTACTTTCC
hsa-mir-099b- GGCACCCACCCGTAGAACCGACCTTGCGGGGCCTTCGCCGCACACAAGCTCG 88
prec-19 TGTCTGTGGGTCCGTGTC
hsa-mir-099- CCCATTGGCATAAACCCGTAGATCCGATCTTGTGGTGAAGTGGACCGCACAA 89
prec-21 GCTCGCTTCTATGGGTCTGTGTCAGTGTG
hsa-mir-100-1/2- AAGAGAGAAGATATTGAGGCCTGTTGCCACAAACCCGTAGATCCGAACTTGT 90
prec GGTATTAGTCCGCACAAGCTTGTATCTATAGGTATGTGTCTGTTAGGCAATCT
CAC
hsa-mir-100- CCTGTTGCCACAAACCCGTAGATCCGAACTTGTGGTATTAGTCCGCACAAGC 91
prec-11 TTGTATCTATAGGTATGTGTCTGTTAGG
hsa-mir-101-1/2- AGGCTGCCCTGGCTCAGTTATCACAGTGCTGATGCTGTCTATTCTAAAGGTA 92
prec CAGTACTGTGATAACTGAAGGATGGCAGCCATCTTACCTTCCATCAGAGGAG
CCTCAC
hsa-mir-101-prec TCAGTTATCACAGTGCTGATGCTGTCCATTCTAAAGGTACAGTACTGTGATA 93
ACTGA
hsa-mir-101- TGCCCTGGCTCAGTTATCACAGTGCTGATGCTGTCTATTCTAAAGGTACAGTA 94
prec-1 CTGTGATAACTGAAGGATGGCA
hsa-mir-101- TGTCCTTTTTCGGTTATCATGGTACCGATGCTGTATATCTGAAAGGTACAGTA 95
prec-9 CTGTGATAACTGAAGAATGGTG
hsa-mir-102- CTTCTGGAAGCTGGTTTCACATGGTGGCTTAGATTTTTCCATCTTTGTATCTA 96
prec-1 GCACCATTTGAAATCAGTGTTTTAGGAG
hsa-mir-102- CTTCAGGAAGCTGGTTTCATATGGTGGTTTAGATTTAAATAGTGATTGTCTAG 97
prec-7.1 CACCATTTGAAATCAGTGTTCTTGGGGG
hsa-mir-102- CTTCAGGAAGCTGGTTTCATATGGTGGTTTAGATTTAAATAGTGATTGTCTAG 98
prec-7.2 CACCATTTGAAATCAGTGTTCTTGGGGG
hsa-mir-103-2- TTGTGCTTTCAGCTTCTTTACAGTGCTGCCTTGTAGCATTCAGGTCAAGCAAC 99
prec ATTGTACAGGGCTATGAAAGAACCA
hsa-mir-103- TTGTGCTTTCAGCTTCTTTACAGTGCTGCCTTGTAGCATTCAGGTCAAGCAAC 100
prec-20 ATTGTACAGGGCTATGAAAGAACCA
hsa-mir-103- TACTGCCCTCGGCTTCTTTACAGTGCTGCCTTGTTGCATATGGATCAAGCAGC 101
prec-5 = 103-1 ATTGTACAGGGCTATGAAGGCATTG
hsa-mir-104- AAATGTCAGACAGCCCATCGACTGGTGTTGCCATGAGATTCAACAGTCAACA 102
prec-17 TCAGTCTGATAAGCTACCCGACAAGG
hsa-mir-105- TGTGCATCGTGGTCAAATGCTCAGACTCCTGTGGTGGCTGCTCATGCACCAC 103
prec-X.1 = 105-1 GGATGTTTGAGCATGTGCTACGGTGTCTA
hsa-mir-105- TGTGCATCGTGGTCAAATGCTCAGACTCCTGTGGTGGCTGCTCATGCACCAC 104
prec-X.2 = 105-2 GGATGTTTGAGCATGTGCTACGGTGTCTA
hsa-mir-106- CCTTGGCCATGTAAAAGTGCTTACAGTGCAGGTAGCTTTTTGAGATCTACTG 105
prec-X CAATGTAAGCACTTCTTACATTACCATGG
hsa-mir-107- CTCTCTGCTTTCAGCTTCTTTACAGTGTTGCCTTGTGGCATGGAGTTCAAGCA 106
prec-10 GCATTGTACAGGGCTATCAAAGCACAGA
hsa-mir-122a- CCTTAGCAGAGCTGTGGAGTGTGACAATGGTGTTTGTGTCTAAACTATCAAA 107
prec CGCCATTATCACACTAAATAGCTACTGCTAGGC
hsa-mir-122a- AGCTGTGGAGTGTGACAATGGTGTTTGTGTCCAAACTATCAAACGCCATTAT 108
prec CACACTAAATAGCT
hsa-mir-123-prec ACATTATTACTTTTGGTACGCGCTGTGACACTTCAAACTCGTACCGTGAGTAA 109
TAATGCGC
hsa-mir-124a-1- tccttcctCAGGAGAAAGGCCTCTCTCTCCGTGTTCACAGCGGACCTTGATTTAAA 110
prec TGTCCATACAATTAAGGCACGCGGTGAATGCCAAGAATGGGGCT
hsa-mir-124a-1- AGGCCTCTCTCTCCGTGTTCACAGCGGACCTTGATTTAAATGTCCATACAATT 111
prec AAGGCACGCGGTGAATGCCAAGAATGGGGCTG
hsa-mir-124a-2- ATCAAGATTAGAGGCTCTGCTCTCCGTGTTCACAGCGGACCTTGATTTAATGT 112
prec CATACAATTAAGGCACGCGGTGAATGCCAAGAGCGGAGCCTACGGCTGCAC
TTGAAG
hsa-mir-124a-3- CCCGCCCCAGCCCTGAGGGCCCCTCTGCGTGTTCACAGCGGACCTTGATTTA 113
prec ATGTCTATACAATTAAGGCACGCGGTGAATGCCAAGAGAGGCGCCTCCGCC
GCTCCTT
hsa-mir-124a-3- TGAGGGCCCCTCTGCGTGTTCACAGCGGACCTTGATTTAATGTCTATACAATT 114
prec AAGGCACGCGGTGAATGCCAAGAGAGGCGCCTCC
hsa-mir-124a- CTCTGCGTGTTCACAGCGGACCTTGATTTAATGTCTATACAATTAAGGCACG 115
prec CGGTGAATGCCAAGAG
hsa-mir-124b- CTCTCCGTGTTCACAGCGGACCTTGATTTAATGTCATACAATTAAGGCACGC 116
prec GGTGAATGCCAAGAG
hsa-mir-125a- TGCCAGTCTCTAGGTCCCTGAGACCCTTTAACCTGTGAGGACATCCAGGGTC 117
prec ACAGGTGAGGTTCTTGGGAGCCTGGCGTCTGGCC
hsa-mir-125a- GGTCCCTGAGACCCTTTAACCTGTGAGGACATCCAGGGTCACAGGTGAGGTT 118
prec CTTGGGAGCCTGG
hsa-mir-125b-1 ACATTGTTGCGCTCCTCTCAGTCCCTGAGACCCTAACTTGTGATGTTTACCGT 119
TTAAATCCACGGGTTAGGCTCTTGGGAGCTGCGAGTCGTGCTTTTGCATCCTG
GA
hsa-mir-125b-1 TGCGCTCCTCTCAGTCCCTGAGACCCTAACTTGTGATGTTTACCGTTTAAATC 120
CACGGGTTAGGCTCTTGGGAGCTGCGAGTCGTGCT
hsa-mir-125b-2- ACCAGACTTTTCCTAGTCCCTGAGACCCTAACTTGTGAGGTATTTTAGTAACA 121
prec TCACAAGTCAGGCTCTTGGGACCTAGGCGGAGGGGA
hsa-mir-125b-2- CCTAGTCCCTGAGACCCTAACTTGTGAGGTATTTTAGTAACATCACAAGTCA 122
prec GGCTCTTGGGACCTAGGC
hsa-mir-126-prec CGCTGGCGACGGGACATTATTACTTTTGGTACGCGCTGTGACACTTCAAACT 123
CGTACCGTGAGTAATAATGCGCCGTCCACGGCA
hsa-mir-126-prec ACATTATTACTTTTGGTACGCGCTGTGACACTTCAAACTCGTACCGTGAGTAA 124
TAATGCGC
hsa-mir-127-prec TGTGATCACTGTCTCCAGCCTGCTGAAGCTCAGAGGGCTCTGATTCAGAAAG 125
ATCATCGGATCCGTCTGAGCTTGGCTGGTCGGAAGTCTCATCATC
hsa-mir-127-prec CCAGCCTGCTGAAGCTCAGAGGGCTCTGATTCAGAAAGATCATCGGATCCGT 126
CTGAGCTTGGCTGGTCGG
hsa-mir-128a- TGAGCTGTTGGATTCGGGGCCGTAGCACTGTCTGAGAGGTTTACATTTCTCA 127
prec CAGTGAACCGGTCTCTTTTTCAGCTGCTTC
hsa-mir-128b- GCCCGGCAGCCACTGTGCAGTGGGAAGGGGGGCCGATACACTGTACGAGAG 128
prec TGAGTAGCAGGTCTCACAGTGAACCGGTCTCTTTCCCTACTGTGTCACACTCC
TAATGG
hsa-mir-128-prec GTTGGATTCGGGGCCGTAGCACTGTCTGAGAGGTTTACATTTCTCACAGTGA 129
ACCGGTCTCTTTTTCAGC
hsa-mir-129-prec TGGATCTTTTTGCGGTCTGGGCTTGCTGTTCCTCTCAACAGTAGTCAGGAAGC 130
CCTTACCCCAAAAAGTATCTA
hsa-mir-130a- TGCTGCTGGCCAGAGCTCTTTTCACATTGTGCTACTGTCTGCACCTGTCACTA 131
prec GCAGTGCAATGTTAAAAGGGCATTGGCCGTGTAGTG
hsa-mir-131-1- gccaggaggcggGGTTGGTTGTTATCTTTGGTTATCTAGCTGTATGAGTGGTGTGG 132
prec AGTCTTCATAAAGCTAGATAACCGAAAGTAAAAATAACCCCATACACTGCGC
AG
hsa-mir-131-3- CACGGCGCGGCAGCGGCACTGGCTAAGGGAGGCCCGTTTCTCTCTTTGGTTA 133
prec TCTAGCTGTATGAGTGCCACAGAGCCGTCATAAAGCTAGATAACCGAAAGTA
GAAATG
hsa-mir-131-prec GTTGTTATCTTTGGTTATCTAGCTGTATGAGTGTATTGGTCTTCATAAAGCTA 134
GATAACCGAAAGTAAAAAC
hsa-mir-132-prec CCGCCCCCGCGTCTCCAGGGCAACCGTGGCTTTCGATTGTTACTGTGGGAAC 135
TGGAGGTAACAGTCTACAGCCATGGTCGCCCCGCAGCACGCCCACGCGC
hsa-mir-132-prec GGGCAACCGTGGCTTTCGATTGTTACTGTGGGAACTGGAGGTAACAGTCTAC 136
AGCCATGGTCGCCC
hsa-mir-133a-1 ACAATGCTTTGCTAGAGCTGGTAAAATGGAACCAAATCGCCTCTTCAATGGA 137
TTTGGTCCCCTTCAACCAGCTGTAGCTATGCATTGA
hsa-mir-133a-2 GGGAGCCAAATGCTTTGCTAGAGCTGGTAAAATGGAACCAAATCGACTGTCC 138
AATGGATTTGGTCCCCTTCAACCAGCTGTAGCTGTGCATTGATGGCGCCG
hsa-mir-133-prec GCTAGAGCTGGTAAAATGGAACCAAATCGCCTCTTCAATGGATTTGGTCCCC 139
TTCAACCAGCTGTAGC
hsa-mir-134-prec CAGGGTGTGTGACTGGTTGACCAGAGGGGCATGCACTGTGTTCACCCTGTGG 140
GCCACCTAGTCACCAACCCTC
hsa-mir-134-prec AGGGTGTGTGACTGGTTGACCAGAGGGGCATGCACTGTGTTCACCCTGTGGG 141
CCACCTAGTCACCAACCCT
hsa-mir-135-1- AGGCCTCGCTGTTCTCTATGGCTTTTTATTCCTATGTGATTCTACTGCTCACTC 142
prec ATATAGGGATTGGAGCCGTGGCGCACGGCGGGGACA
hsa-mir-135-2- AGATAAATTCACTCTAGTGCTTTATGGCTTTTTATTCCTATGTGATAGTAATA 143
prec AAGTCTCATGTAGGGATGGAAGCCATGAAATACATTGTGAAAAATCA
hsa-mir-135-prec CTATGGCTTTTTATTCCTATGTGATTCTACTGCTCACTCATATAGGGATTGGA 144
GCCGTGG
hsa-mir-136-prec TGAGCCCTCGGAGGACTCCATTTGTTTTGATGATGGATTCTTATGCTCCATCA 145
TCGTCTCAAATGAGTCTTCAGAGGGTTCT
hsa-mir-136-prec GAGGACTCCATTTGTTTTGATGATGGATTCTTATGCTCCATCATCGTCTCAAA 146
TGAGTCTTC
hsa-mir-137-prec CTTCGGTGACGGGTATTCTTGGGTGGATAATACGGATTACGTTGTTATTGCTT 147
AAGAATACGCGTAGTCGAGG
hsa-mir-138-1- CCCTGGCATGGTGTGGTGGGGCAGCTGGTGTTGTGAATCAGGCCGTTGCCAA 148
prec TCAGAGAACGGCTACTTCACAACACCAGGGCCACACCACACTACAGG
hsa-mir-138-2- CGTTGCTGCAGCTGGTGTTGTGAATCAGGCCGACGAGCAGCGCATCCTCTTA 149
prec CCCGGCTATTTCACGACACCAGGGTTGCATCA
hsa-mir-138-prec CAGCTGGTGTTGTGAATCAGGCCGACGAGCAGCGCATCCTCTTACCCGGCTA 150
TTTCACGACACCAGGGTTG
hsa-mir-139-prec GTGTATTCTACAGTGCACGTGTCTCCAGTGTGGCTCGGAGGCTGGAGACGCG 151
GCCCTGTTGGAGTAAC
hsa-mir-140 TGTGTCTCTCTCTGTGTCCTGCCAGTGGTTTTACCCTATGGTAGGTTACGTCA 152
TGCTGTTCTACCACAGGGTAGAACCACGGACAGGATACCGGGGCACC
hsa-mir-140as- TCCTGCCAGTGGTTTTACCCTATGGTAGGTTACGTCATGCTGTTCTACCACAG 153
prec GGTAGAACCACGGACAGGA
hsa-mir-140s- CCTGCCAGTGGTTTTACCCTATGGTAGGTTACGTCATGCTGTTCTACCACAGG 154
prec GTAGAACCACGGACAGG
hsa-mir-141-prec CGGCCGGCCCTGGGTCCATCTTCCAGTACAGTGTTGGATGGTCTAATTGTGA 155
AGCTCCTAACACTGTCTGGTAAAGATGGCTCCCGGGTGGGTTC
hsa-mir-141-prec GGGTCCATCTTCCAGTACAGTGTTGGATGGTCTAATTGTGAAGCTCCTAACA 156
CTGTCTGGTAAAGATGGCCC
hsa-mir-142as- ACCCATAAAGTAGAAAGCACTACTAACAGCACTGGAGGGTGTAGTGTTTCCT 157
prec ACTTTATGGATG
hsa-mir-142-prec GACAGTGCAGTCACCCATAAAGTAGAAAGCACTACTAACAGCACTGGAGGG 158
TGTAGTGTTTCCTACTTTATGGATGAGTGTACTGTG
hsa-mir-142s- ACCCATAAAGTAGAAAGCACTACTAACAGCACTGGAGGGTGTAGTGTTTCCT 159
prec ACTTTATGGATG
hsa-mir-143-prec GCGCAGCGCCCTGTCTCCCAGCCTGAGGTGCAGTGCTGCATCTCTGGTCAGT 160
TGGGAGTCTGAGATGAAGCACTGTAGCTCAGGAAGAGAGAAGTTGTTCTGC
AGC
hsa-mir-143-prec CCTGAGGTGCAGTGCTGCATCTCTGGTCAGTTGGGAGTCTGAGATGAAGCAC 161
TGTAGCTCAGG
hsa-mir-144-prec TGGGGCCCTGGCTGGGATATCATCATATACTGTAAGTTTGCGATGAGACACT 162
ACAGTATAGATGATGTACTAGTCCGGGCACCCCC
hsa-mir-144-prec GGCTGGGATATCATCATATACTGTAAGTTTGCGATGAGACACTACAGTATAG 163
ATGATGTACTAGTC
hsa-mir-145-prec CACCTTGTCCTCACGGTCCAGTTTTCCCAGGAATCCCTTAGATGCTAAGATGG 164
GGATTCCTGGAAATACTGTTCTTGAGGTCATGGTT
hsa-mir-145-prec CTCACGGTCCAGTTTTCCCAGGAATCCCTTAGATGCTAAGATGGGGATTCCT 165
GGAAATACTGTTCTTGAG
hsa-mir-146-prec CCGATGTGTATCCTCAGCTTTGAGAACTGAATTCCATGGGTTGTGTCAGTGTC 166
AGACCTCTGAAATTCAGTTCTTCAGCTGGGATATCTCTGTCATCGT
hsa-mir-146-prec AGCTTTGAGAACTGAATTCCATGGGTTGTGTCAGTGTCAGACCTGTGAAATT 167
CAGTTCTTCAGCT
hsa-mir-147-prec AATCTAAAGACAACATTTCTGCACACACACCAGACTATGGAAGCCAGTGTGT 168
GGAAATGCTTCTGCTAGATT
hsa-mir-148-prec GAGGCAAAGTTCTGAGACACTCCGACTCTGAGTATGATAGAAGTCAGTGCAC 169
TACAGAACTTTGTCTC
hsa-mir-149-prec GCCGGCGCCCGAGCTCTGGCTCCGTGTCTTCACTCCCGTGCTTGTCCGAGGA 170
GGGAGGGAGGGACGGGGGCTGTGCTGGGGCAGCTGGA
hsa-mir-149-prec GCTCTGGCTCCGTGTCTTCACTCCCGTGCTTGTCCGAGGAGGGAGGGAGGGA 171
C
hsa-mir-150-prec CTCCCCATGGCCCTGTCTCCCAACCCTTGTACCAGTGCTGGGCTCAGACCCTG 172
GTACAGGCCTGGGGGACAGGGACCTGGGGAC
hsa-mir-150-prec CCCTGTCTCCCAACCCTTGTACCAGTGCTGGGCTCAGACCCTGGTACAGGCC 173
TGGGGGACAGGG
hsa-mir-151-prec CCTGCCCTCGAGGAGCTCACAGTCTAGTATGTCTCATCCCCTACTAGACTGA 174
AGCTCCTTGAGGACAGG
hsa-mir-152-prec TGTCCCCCCCGGCCCAGGTTCTGTGATACACTCCGACTCGGGCTCTGGAGCA 175
GTCAGTGCATGACAGAACTTGGGCCCGGAAGGACC
hsa-mir-152-prec GGCCCAGGTTCTGTGATACACTCCGACTCGGGCTCTGGAGCAGTCAGTGCAT 176
GACAGAACTTGGGCCCCGG
hsa-mir-153-1- CTCACAGCTGCCAGTGTCATTTTTGTGATCTGCAGCTAGTATTCTCACTCCAG 177
prec TTGCATAGTCACAAAAGTGATCATTGGCAGGTGTGGC
hsa-mir-153-1- tctctctctccctcACAGCTGCCAGTGTCATTGTCACAAAAGTGATCATTGGCAGGTG 178
prec TGGCTGCTGCATG
hsa-mir-153-2- AGCGGTGGCCAGTGTCATTTTTGTGATGTTGCAGCTAGTAATATGAGCCCAG 179
prec TTGCATAGTCACAAAAGTGATCATTGGAAACTGTG
hsa-mir-153-2- CAGTGTCATTTTTGTGATGTTGCAGCTAGTAATATGAGCCCAGTTGCATAGTC 180
prec ACAAAAGTGATCATTG
hsa-mir-154-prec GTGGTACTTGAAGATAGGTTATCCGTGTTGCCTTCGCTTTATTTGTGACGAAT 181
CATACACGGTTGACCTATTTTTCAGTACCAA
hsa-mir-154-prec GAAGATAGGTTATCCGTGTTGCCTTCGCTTTATTTGTGACGAATCATACACGG 182
TTGACCTATTTTT
hsa-mir-155-prec CTGTTAATGCTAATCGTGATAGGGGTTTTTGCCTCCAACTGACTCCTACATAT 183
TAGCATTAACAG
hsa-mir-16-2- CAATGTCAGCAGTGCCTTAGCAGCACGTAAATATTGGCGTTAAGATTCTAAA 184
prec ATTATCTCCAGTATTAACTGTGCTGCTGAAGTAAGGTTGACCATACTCTACA
GTTG
hsa-mir-181a- AGAAGGGCTATCAGGCCAGCCTTCAGAGGACTCCAAGGAACATTCAACGCT 185
prec GTCGGTGAGTTTGGGATTTGAAAAAACCACTGACCGTTGACTGTACCTTGGG
GTCCTTA
hsa-mir-181b- TGAGTTTTGAGGTTGCTTCAGTGAACATTCAACGCTGTCGGTGAGTTTGGAA 186
prec TTAAAATCAAAACCATCGACCGTTGATTGTACCCTATGGCTAACCATCATCT
ACTCCA
hsa-mir-181c- CGGAAAATTTGCCAAGGGTTTGGGGGAACATTCAACCTGTCGGTGAGTTTGG 187
prec GCAGCTCAGGCAAACCATCGACCGTTGAGTGGACCCTGAGGCCTGGAATTGC
CATCCT
hsa-mir-182-as- GAGCTGCTTGCCTCCCCCCGTTTTTGGCAATGGTAGAACTCACACTGGTGAG 188
prec GTAACAGGATCCGGTGGTTCTAGACTTGCCAACTATGGGGCGAGGACTCAGC
CGGCAC
hsa-mir-182-prec TTTTTGGCAATGGTAGAACTCACACTGGTGAGGTAACAGGATCCGGTGGTTC 189
TAGACTTGCCAACTATGG
hsa-mir-183-prec CCGCAGAGTGTGACTCCTGTTCTGTGTATGGCACTGGTAGAATTCACTGTGA 190
ACAGTCTCAGTCAGTGAATTACCGAAGGGCCATAAACAGAGCAGAGACAGA
TCCACGA
hsa-mir-184-prec CCAGTCACGTCCCCTTATCACTTTTCCAGCCCAGCTTTGTGACTGTAAGTGTT 191
GGACGGAGAACTGATAAGGGTAGGTGATTGA
hsa-mir-184-prec CCTTATCACTTTTCCAGCCCAGCTTTGTGACTGTAAGTGTTGGACGGAGAACT 192
GATAAGGGTAGG
hsa-mir-185-prec AGGGGGCGAGGGATTGGAGAGAAAGGCAGTTCCTGATGGTCCCCTCCCCAG 193
GGGCTGGCTTTCCTCTGGTCCTTCCCTCCCA
hsa-mir-185-prec AGGGATTGGAGAGAAAGGCAGTTCCTGATGGTCCCCTCCCCAGGGGCTGGCT 194
TTCCTCTGGTCCTT
hsa-mir-186-prec TGCTTGTAACTTTCCAAAGAATTCTCCTTTTGGGCTTTCTGGTTTTATTTTAAG 195
CCCAAAGGTGAATTTTTTGGGAAGTTTGAGCT
hsa-mir-186-prec ACTTTCCAAAGAATTCTCCTTTTGGGCTTTCTGGTTTTATTTTAAGCCCAAAG 196
GTGAATTTTTTGGGAAGT
hsa-mir-187-prec GGTCGGGCTCACCATGACACAGTGTGAGACTCGGGCTACAACACAGGACCC 197
GGGGCGCTGCTCTGACCCCTCGTGTCTTGTGTTGCAGCCGGAGGGACGCAGG
TCCGCA
hsa-mir-188-prec TGCTCCCTCTCTCACATCCCTTGCATGGTGGAGGGTGAGCTTTCTGAAAACCC 198
CTCCCACATGCAGGGTTTGCAGGATGGCGAGCC
hsa-mir-188-prec TCTCACATCCCTTGCATGGTGGAGGGTGAGCTTTCTGAAAACCCCTCCCACA 199
TGCAGGGTTTGCAGGA
hsa-mir-189-prec CTGTCGATTGGACCCGCCCTCCGGTGCCTACTGAGCTGATATCAGTTCTCATT 200
TTACACACTGGCTCAGTTCAGCAGGAACAGGAGTCGAGCCCTTGAGCAA
hsa-mir-189-prec CTCCGGTGCCTACTGAGCTGATATCAGTTCTCATTTTACACACTGGCTCAGTT 201
CAGCAGGAACAGGAG
hsa-mir-190-prec TGCAGGCCTCTGTGTGATATGTTTGATATATTAGGTTGTTATTTAATCCAACT 202
ATATATCAAACATATTCCTACAGTGTCTTGCC
hsa-mir-190-prec CTGTGTGATATGTTTGATATATTAGGTTGTTATTTAATCCAACTATATATCAA 203
ACATATTCCTACAG
hsa-mir-191-prec CGGCTGGACAGCGGGCAACGGAATCCCAAAAGCAGCTGTTGTCTCCAGAGC 204
ATTCCAGCTGCGCTTGGATTTCGTCCCCTGCTCTCCTGCCT
hsa-mir-191-prec AGCGGGCAACGGAATCCCAAAAGCAGCTGTTGTCTCCAGAGCATTCCAGCTG 205
CGCTTGGATTTCGTCCCCTGCT
hsa-mir-192-2/3 CCGAGACCGAGTGCACAGGGCTCTGACCTATGAATTGACAGCCAGTGCTCTC 206
GTCTCCCCTCTGGCTGCCAATTCCATAGGTCACAGGTATGTTCGCCTCAATGC
CAG
hsa-mir-192-prec GCCGAGACCGAGTGCACAGGGCTCTGACCTATGAATTGACAGCCAGTGCTCT 207
CGTCTCCCCTCTGGCTGCCAATTCCATAGGTCACAGGTATGTTCGCCTCAATG
CCAGC
hsa-mir-193-prec CGAGGATGGGAGCTGAGGGCTGGGTCTTTGCGGGCGAGATGAGGGTGTCGG 208
ATCAACTGGCCTACAAAGTCCCAGTTCTCGGCCCCCG
hsa-mir-193-prec GCTGGGTCTTTGCGGGCGAGATGAGGGTGTCGGATCAACTGGCCTACAAAGT 209
CCCAGT
hsa-mir-194-prec ATGGTGTTATCAAGTGTAACAGCAACTCCATGTGGACTGTGTACCAATTTCC 210
AGTGGAGATGCTGTTACTTTTGATGGTTACCAA
hsa-mir-194-prec GTGTAACAGCAACTCCATGTGGACTGTGTACCAATTTCCAGTGGAGATGCTG 211
TTACTTTTGAT
hsa-mir-195-prec AGCTTCCCTGGCTCTAGCAGCACAGAAATATTGGCACAGGGAAGCGAGTCTG 212
CCAATATTGGCTGTGCTGCTCCAGGCAGGGTGGTG
hsa-mir-195-prec TAGCAGCACAGAAATATTGGCACAGGGAAGCGAGTCTGCCAATATTGGCTG 213
TGCTGCT
hsa-mir-196-1- CTAGAGCTTGAATTGGAACTGCTGAGTGAATTAGGTAGTTTCATGTTGTTGG 214
prec GCCTGGGTTTCTGAACACAACAACATTAAACCACCCGATTCACGGCAGTTAC
TGCTCC
hsa-mir-196-1- GTGAATTAGGTAGTTTCATGTTGTTGGGCCTGGGTTTCTGAACACAACAACA 215
prec TTAAACCACCCGATTCAC
hsa-mir-196-2- TGCTCGCTCAGCTGATCTGTGGCTTAGGTAGTTTCATGTTGTTGGGATTGAGT 216
prec TTTGAACTCGGCAACAAGAAACTGCCTGAGTTACATCAGTCGGTTTTCGTCG
AGGGC
hsa-mir-196-prec GTGAATTAGGTAGTTTCATGTTGTTGGGCCTGGGTTTCTGAACACAACAACA 217
TTAAACCACCCGATTCAC
hsa-mir-197-prec GGCTGTGCCGGGTAGAGAGGGCAGTGGGAGGTAAGAGCTCTTCACCCTTCA 218
CCACCTTCTCCACCCAGCATGGCC
hsa-mir-198-prec TCATTGGTCCAGAGGGGAGATAGGTTCCTGTGATTTTTCCTTCTTCTCTATAG 219
AATAAATGA
hsa-mir-199a-1- GCCAACCCAGTGTTCAGACTACCTGTTCAGGAGGCTCTCAATGTGTACAGTA 220
prec GTCTGCACATTGGTTAGGC
hsa-mir-199a-2- AGGAAGCTTCTGGAGATCCTGCTCCGTCGCCCCAGTGTTCAGACTACCTGTT 221
prec CAGGACAATGCCGTTGTACAGTAGTCTGCACATTGGTTAGACTGGGCAAGGG
AGAGCA
hsa-mir-199b- CCAGAGGACACCTCCACTCCGTCTACCCAGTGTTTAGACTATCTGTTCAGGA 222
prec CTCCCAAATTGTACAGTAGTCTGCACATTGGTTAGGCTGGGCTGGGTTAGAC
CCTCGG
hsa-mir-199s- GCCAACCCAGTGTTCAGACTACCTGTTCAGGAGGCTCTCAATGTGTACAGTA 223
prec GTCTGCACATTGGTTAGGC
hsa-mir-200a- GCCGTGGCCATCTTACTGGGCAGCATTGGATGGAGTCAGGTCTCTAATACTG 224
prec CCTGGTAATGATGACGGC
hsa-mir-200b- CCAGCTCGGGCAGCCGTGGCCATCTTACTGGGCAGCATTGGATGGAGTCAGG 225
prec TCTCTAATACTGCCTGGTAATGATGACGGCGGAGCCCTGCACG
hsa-mir-202-prec GTTCCTTTTTCCTATGCATATACTTCTTTGAGGATCTGGCCTAAAGAGGTATA 226
GGGCATGGGAAGATGGAGC
hsa-mir-203-prec GTGTTGGGGACTCGCGCGCTGGGTCCAGTGGTTCTTAACAGTTCAACAGTTC 227
TGTAGCGCAATTGTGAAATGTTTAGGACCACTAGACCCGGCGGGCGCGGCG
ACAGCGA
hsa-mir-204-prec GGCTACAGTCTTTCTTCATGTGACTCGTGGACTTCCCTTTGTCATCCTATGCC 228
TGAGAATATATGAAGGAGGCTGGGAAGGCAAAGGGACGTTCAATTGTCATC
ACTGGC
hsa-mir-205-prec AAAGATCCTCAGACAATCCATGTGCTTCTCTTGTCCTTCATTCCACCGGAGTC 229
TGTCTCATACCCAACCAGATTTCAGTGGAGTGAAGTTCAGGAGGCATGGAGC
TGACA
hsa-mir-206-prec TGCTTCCCGAGGCCACATGCTTCTTTATATCCCCATATGGATTACTTTGCTAT 230
GGAATGTAAGGAAGTGTGTGGTTTCGGCAAGTG
hsa-mir-206-prec AGGCCACATGCTTCTTTATATCCCCATATGGATTACTTTGCTATGGAATGTAA 231
GGAAGTGTGTGGTTTT
hsa-mir-208-prec TGACGGGCGAGCTTTTGGCCCGGGTTATACCTGATGCTCACGTATAAGACGA 232
GCAAAAAGCTTGTTGGTCA
hsa-mir-210-prec ACCCGGCAGTGCCTCCAGGCGCAGGGCAGCCCCTGCCCACCGCACACTGCGC 233
TGCCCCAGACCCACTGTGCGTGTGACAGCGGCTGATCTGTGCCTGGGCAGCG
CGACCC
hsa-mir-211-prec TCACCTGGCCATGTGACTTGTGGGCTTCCCTTTGTCATCCTTCGCCTAGGGCT 234
CTGAGCAGGGCAGGGACAGCAAAGGGGTGCTCAGTTGTCACTTCCCACAGC
ACGGAG
hsa-mir-212-prec CGGGGCACCCCGCCCGGACAGCGCGCCGGCACCTTGGCTCTAGACTGCTTAC 235
TGCCCGGGCCGCCCTCAGTAACAGTCTCCAGTCACGGCCACCGACGCCTGGC
CCCGCC
hsa-mir-213-prec CCTGTGCAGAGATTATTTTTTAAAAGGTCACAATCAACATTCATTGCTGTCGG 236
TGGGTTGAACTGTGTGGACAAGCTCACTGAACAATGAATGCAACTGTGGCCC
CGCTT
hsa-mir-213- GAGTTTTGAGGTTGCTTCAGTGAACATTCAACGCTGTCGGTGAGTTTGGAAT 237
prec-LIM TAAAATCAAAACCATCGACCGTTGATTGTACCCTATGGCTAACCATCATCTA
CTCC
hsa-mir-214-prec GGCCTGGCTGGACAGAGTTGTCATGTGTCTGCCTGTCTACACTTGCTGTGCA 238
GAACATCCGCTCACCTGTACAGCAGGCACAGACAGGCAGTCACATGACAAC
CCAGCCT
hsa-mir-215-prec ATCATTCAGAAATGGTATACAGGAAAATGACCTATGAATTGACAGACAATAT 239
AGCTGAGTTTGTCTGTCATTTCTTTAGGCCAATATTCTGTATGACTGTGCTAC
TTCAA
hsa-mir-216-prec GATGGCTGTGAGTTGGCTTAATCTCAGCTGGCAACTGTGAGATGTTCATACA 240
ATCCCTCACAGTGGTCTCTGGGATTATGCTAAACAGAGCAATTTCCTAGCCC
TCACGA
hsa-mir-217-prec AGTATAATTATTACATAGTTTTTGATGTCGCAGATACTGCATCAGGAACTGA 241
TTGGATAAGAATCAGTCACCATCAGTTCCTAATGCATTGCCTTCAGCATCTA
AACAAG
hsa-mir-218-1- GTGATAATGTAGCGAGATTTTCTGTTGTGCTTGATCTAACCATGTGGTTGCGA 242
prec GGTATGAGTAAAACATGGTTCCGTCAAGCACCATGGAACGTCACGCAGCTTT
CTACA
hsa-mir-218-2- GACCAGTCGCTGCGGGGCTTTCCTTTGTGCTTGATCTAACCATGTGGTGGAA 243
prec CGATGGAAACGGAACATGGTTCTGTCAAGCACCGCGGAAAGCACCGTGCTC
TCCTGCA
hsa-mir-219-prec CCGCCCCGGGCCGCGGCTCCTGATTGTCCAAACGCAATTCTCGAGTCTATGG 244
CTCCGGCCGAGAGTTGAGTCTGGACGTCCCGAGCCGCCGCCCCCAAACCTCG
AGCGGG
hsa-mir-220-prec GACAGTGTGGCATTGTAGGGCTCCACACCGTATCTGACACTTTGGGCGAGGG 245
CACCATGCTGAAGGTGTTCATGATGCGGTCTGGGAACTCCTCACGGATCTTA
CTGATG
hsa-mir-221-prec TGAACATCCAGGTCTGGGGCATGAACCTGGCATACAATGTAGATTTCTGTGT 246
TCGTTAGGCAACAGCTACATTGTCTGCTGGGTTTCAGGCTACCTGGAAACAT
GTTCTC
hsa-mir-222-prec GCTGCTGGAAGGTGTAGGTACCCTCAATGGCTCAGTAGCCAGTGTAGATCCT 247
GTCTTTCGTAATCAGCAGCTACATCTGGCTACTGGGTCTCTGATGGCATCTTC
TAGCT
hsa-mir-223-prec CCTGGCCTCCTGCAGTGCCACGCTCCGTGTATTTGACAAGCTGAGTTGGACA 248
CTCCATGTGGTAGAGTGTCAGTTTGTCAAATACCCCAAGTGCGGCACATGCT
TACCAG
hsa-mir-224-prec GGGCTTTCAAGTCACTAGTGGTTCCGTTTAGTAGATGATTGTGCATTGTTTCA 249
AAATGGTGCCCTAGTGACTACAAAGCCC
hsA-mir-29b- CTTCTGGAAGCTGGTTTCACATGGTGGCTTAGATTTTTCCATCTTTGTATCTA 250
1 = 102-prec1 GCACCATTTGAAATCAGTGTTTTAGGAG
hsA-mir-29b- CTTCAGGAAGCTGGTTTCATATGGTGGTTTAGATTTAAATAGTGATTGTCTAG 251
2 = 102prec7.1 = CACCATTTGAAATCAGTGTTCTTGGGGG
7.2
hsA-mir-29b- CTTCAGGAAGCTGGTTTCATATGGTGGTTTAGATTTAAATAGTGATTGTCTAG 252
3 = 102prec7.1 = CACCATTTGAAATCAGTGTTCTTGGGGG
7.2
hsa-mir- GTGAGCGACTGTAAACATCCTCGACTGGAAGCTGTGAAGCCACAGATGGGC 253
30* = mir-097- TTTCAGTCGGATGTTTGCAGCTGCCTACT
prec-6
mir-033b ACCAAGTTTCAGTTCATGTAAACATCCTACACTCAGCTGTAATACATGGATT 254
GGCTGGGAGGTGGATGTTTACTTCAGCTGACTTGGA
mir-101- TGCCCTGGCTCAGTTATCACAGTGCTGATGCTGTCTATTCTAAAGGTACAGTA 255
precursor-9 = mir- CTGTGATAACTGAAGGATGGCA
101-3
mir-108-1-small ACACTGCAAGAACAATAAGGATTTTTAGGGGCATTATGACTGAGTCAGAAA 256
ACACAGCTGCCCCTGAAAGTCCCTCATTTTTCTTGCTGT
mir-108-2-small ACTGCAAGAGCAATAAGGATTTTTAGGGGCATTATGATAGTGGAATGGAAA 257
CACATCTGCCCCCAAAAGTCCCTCATTTT
mir-123-prec = CGCTGGCGACGGGACATTATTACTTTTGGTACGCGCTGTGACACTTCAAACT 258
mir-126-prec CGTACCGTGAGTAATAATGCGCCGTCCACGGCA
mir-123-prec = ACATTATTACTTTTGGTACGCGCTGTGACACTTCAAACTCGTACCGTGAGTAA 259
mir-126-prec TAATGCGC
mir-129-1-prec TGGATCTTTTTGCGGTCTGGGCTTGCTGTTCCTCTCAACAGTAGTCAGGAAGC 260
CCTTACCCCAAAAAGTATCTA
mir-129-small- TGCCCTTCGCGAATCTTTTTGCGGTCTGGGCTTGCTGTACATAACTCAATAGC 261
2 = 129b? CGGAAGCCCTTACCCCAAAAAGCATTTGCGGAGGGCG
mir-133b-small GCCCCCTGCTCTGGCTGGTCAAACGGAACCAAGTCCGTCTTCCTGAGAGGTT 262
TGGTCCCCTTCAACCAGCTACAGCAGGG
mir-135-small-2 AGATAAATTCACTCTAGTGCTTTATGGCTTTTTATTCCTATGTGATAGTAATA 263
AAGTCTCATGTAGGGATGGAAGCCATGAAATACATTGTGAAAAATCA
mir-148b-small AAGCACGATTAGCATTTGAGGTGAAGTTCTGTTATACACTCAGGCTGTGGCT 264
CTCTGAAAGTCAGTGCAT
mir-151-prec CCTGTCCTCAAGGAGCTTCAGTCTAGTAGGGGATGAGACATACTAGACTGTG 265
AGCTCCTCGAGGGCAGG
mir-155- CTGTTAATGCTAATCGTGATAGGGGTTTTTGCCTCCAACTGACTCCTACATAT 266
prec(BIC) TAGCATTAACAG
mir-156 = mir- CCTAACACTGTCTGGTAAAGATGGCTCCCGGGTGGGTTCTCTCGGCAGTAAC 267
157 = overlap CTTCAGGGAGCCCTGAAGACCATGGAGGAC
mir-141
mir-158-small = GCCGAGACCGAGTGCACAGGGCT AGTGCTCT 268
mir-192 CGTCTCCCCTCTGGCTGCCAATTCCATAGGTCACAGGTATGTTCGCCTCAATG
CCAGC
mir-159-1-small TCCCGCCCCCTGTAACAGCAACTCCATGTGGAAGTGCCCACTGGTTCCAGTG 269
GGGCTGCTGTTATCTGGGGCGAGGGCCA
mir-161-small AAAGCTGGGTTGAGAGGGCGAAAAAGGATGAGGTGACTGGTCTGGGCTACG 270
CTATGCTGCGGCGCTCGGG
mir-163-1b- CATTGGCCTCCTAAGCCAGGGATTGTGGGTTCGAGTCCCACCCGGGGTAAAG 271
small AAAGGCCGAATT
mir-163-3-small CCTAAGCCAGGGATTGTGGGTTCGAGTCCCACCTGGGGTAGAGGTGAAAGTT 272
CCTTTTACGGAATTTTTT
mir-175- GGGCTTTCAAGTCACTAGTGGTTCCGTTTAGTAGATGATTGTGCATTGTTTCA 273
small = mir-224 AAATGGTGCCCTAGTGACTACAAAGCCC
mir-177- small ACGCAAGTGTCCTAAGGTGAGCTCAGGGAGCACAGAAACCTCCAGTGGAAC 274
AGAAGGGCAAAAGCTCATT
mir-180- small CATGTGTCACTTTCAGGTGGAGTTTCAAGAGTCCCTTCCTGGTTCACCGTCTC 275
CTTTGCTCTTCCACAAC
mir-187-prec GGTCGGGCTCACCATGACACAGTGTGAGACTCGGGCTACAACACAGGACCC 276
GGGGCGCTGCTCTGACCCCTCGTGTCTTGTGTTGCAGCCGGAGGGACGCAGG
TCCGCA
mir-188-prec TGCTCCCTCTCTCACATCCCTTGCATGGTGGAGGGTGAGCTTTCTGAAAACCC 277
CTCCCACATGCAGGGTTTGCAGGATGGCGAGCC
mir-190-prec TGCAGGCCTCTGTGTGATATGTTTGATATATTAGGTTGTTATTTAATCCAACT 278
ATATATCAAACATATTCCTACAGTGTCTTGCC
mir-197-2 GTGCATGTGTATGTATGTGTGCATGTGCATGTGTATGTGTATGAGTGCATGC 279
GTGTGTGC
mir-197-prec GGCTGTGCCGGGTAGAGAGGGCAGTGGGAGGTAAGAGCTCTTCACCCTTCA 280
CCACCTTCTCCACCCAGCATGGCC
mir-202-prec GTTCCTTTTTCCTATGCATATACTTCTTTGAGGATCTGGCCTAAAGAGGTATA 281
GGGCATGGGAAGATGGAGC
mir-294-1 CAATCTTCCTTTATCATGGTATTGATTTTTCAGTGCTTCCCTTTTGTGTGAGAG 282
(chr16) AAGATA
mir-hes1 ATGGAGCTGCTCACCCTGTGGGCCTCAAATGTGGAGGAACTATTCTGATGTC 283
CAAGTGGAAAGTGCTGCGACATTTGAGCGTCACCGGTGACGCCCATATCA
mir-hes2 GCATCCCCTCAGCCTGTGGCACTCAAACTGTGGGGGCACTTTCTGCTCTCTGG 284
TGAAAGTGCCGCCATCTTTTGAGTGTTACCGCTTGAGAAGACTCAACC
mir-hes3 CGAGGAGCTCATACTGGGATACTCAAAATGGGGGCGCTTTCCTTTTTGTCTG 285
TTACTGGGAAGTGCTTCGATTTTGGGGTGTCCCTGTTTGAGTAGGGCATC
hsa-mir-29b-1 CTTCAGGAAGCTGGTTTCATATGGTGGTTTAGATTTAAATAGTGATTGTCTAG 286
CACCATTTGAAATCAGTGTTCTTGGGGG
*An underlined sequence within a precursor sequence represents a processed miR transcript. All sequences are human.

The level of at least one miR gene product can be measured in cells of a biological sample obtained from the subject. For example, a tissue sample can be removed from a subject suspected of having breast cancer associated with by conventional biopsy techniques. In another example, a blood sample can be removed from the subject, and white blood cells can be isolated for DNA extraction by standard techniques. The blood or tissue sample is preferably obtained from the subject prior to initiation of radiotherapy, chemotherapy or other therapeutic treatment. A corresponding control tissue or blood sample can be obtained from unaffected tissues of the subject, from a normal human individual or population of normal individuals, or from cultured cells corresponding to the majority of cells in the subject's sample. The control tissue or blood sample is then processed along with the sample from the subject, so that the levels of miR gene product produced from a given miR gene in cells from the subject's sample can be compared to the corresponding miR gene product levels from cells of the control sample.

An alteration (i.e., an increase or decrease) in the level of a miR gene product in the sample obtained from the subject, relative to the level of a corresponding miR gene product in a control sample, is indicative of the presence of breast cancer in the subject. In one embodiment, the level of the at least one miR gene product in the test sample is greater than the level of the corresponding miR gene product in the control sample (i.e., expression of the miR gene product is “up-regulated”). As used herein, expression of a miR gene product is “up-regulated” when the amount of miR gene product in a cell or tissue sample from a subject is greater than the amount the same gene product in a control cell or tissue sample. In another embodiment, the level of the at least one miR gene product in the test sample is less than the level of the corresponding miR gene product in the control sample (i.e., expression of the miR gene product is “down-regulated”). As used herein, expression of a miR gene is “down-regulated” when the amount of miR gene product produced from that gene in a cell or tissue sample from a subject is less than the amount produced from the same gene in a control cell or tissue sample. The relative miR gene expression in the control and normal samples can be determined with respect to one or more RNA expression standards. The standards can comprise, for example, a zero miR gene expression level, the miR gene expression level in a standard cell line, or the average level of miR gene expression previously obtained for a population of normal human controls.

The level of a miR gene product in a sample can be measured using any technique that is suitable for detecting RNA expression levels in a biological sample. Suitable techniques for determining RNA expression levels in cells from a biological sample (for example, Northern blot analysis, RT-PCR, in situ hybridization) are well known to those of skill in the art. In a particular embodiment, the level of at least one miR gene product is detected using Northern blot analysis. For example, total cellular RNA can be purified from cells by homogenization in the presence of nucleic acid extraction buffer, followed by centrifugation. Nucleic acids are precipitated, and DNA is removed by treatment with DNase and precipitation. The RNA molecules are then separated by gel electrophoresis on agarose gels according to standard techniques, and transferred to nitrocellulose filters. The RNA is then immobilized on the filters by heating. Detection and quantification of specific RNA is accomplished using appropriately labeled DNA or RNA probes complementary to the RNA in question. See, for example, Molecular Cloning: A Laboratory Manual, J. Sambrook et al., eds., 2nd edition, Cold Spring Harbor Laboratory Press, 1989, Chapter 7, the entire disclosure of which is incorporated by reference.

Suitable probes for Northern blot hybridization of a given miR gene product can be produced from the nucleic acid sequences provided in Table 1. Methods for preparation of labeled DNA and RNA probes, and the conditions for hybridization thereof to target nucleotide sequences, are described in Molecular Cloning: A Laboratory Manual, J. Sambrook et al., eds., 2nd edition, Cold Spring Harbor Laboratory Press, 1989, Chapters 10 and 11, the disclosures of which are incorporated herein by reference.

For example, the nucleic acid probe can be labeled with, for example, a radionuclide, such as 3H, 32P, 33P, 14C, or 35S; a heavy metal; or a ligand capable of functioning as a specific binding pair member for a labeled ligand (for example, biotin, avidin or an antibody), a fluorescent molecule, a chemiluminescent molecule, an enzyme or the like.

Probes can be labeled to high specific activity by either the nick translation method of Rigby et al. (1977), J. Mol. Biol. 113:237-251 or by the random priming method of Fienberg et al. (1983), Anal. Biochem. 132:6-13, the entire disclosures of which are incorporated herein by reference. The latter is the method of choice for synthesizing 32P-labeled probes of high specific activity from single-stranded DNA or from RNA templates. For example, by replacing preexisting nucleotides with highly radioactive nucleotides according to the nick translation method, it is possible to prepare 32P-labeled nucleic acid probes with a specific activity well in excess of 108 cpm/microgram. Autoradiographic detection of hybridization can then be performed by exposing hybridized filters to photographic film. Densitometric scanning of the photographic films exposed by the hybridized filters provides an accurate measurement of miR gene transcript levels. Using another approach, miR gene transcript levels can be quantified by computerized imaging systems, such the Molecular Dynamics 400-B 2D Phosphorimager available from Amersham Biosciences, Piscataway, N.J.

Where radionuclide labeling of DNA or RNA probes is not practical, the random-primer method can be used to incorporate an analogue, for example, the dTTP analogue 5-(N—(N-biotinyl-epsilon-aminocaproyl)-3-aminoallyl)deoxyuridine triphosphate, into the probe molecule. The biotinylated probe oligonucleotide can be detected by reaction with biotin-binding proteins, such as avidin, streptavidin, and antibodies (for example, anti-biotin antibodies) coupled to fluorescent dyes or enzymes that produce color reactions.

In addition to Northern and other RNA hybridization techniques, determining the levels of RNA transcripts can be accomplished using the technique of in situ hybridization. This technique requires fewer cells than the Northern blotting technique, and involves depositing whole cells onto a microscope cover slip and probing the nucleic acid content of the cell with a solution containing radioactive or otherwise labeled nucleic acid (for example, cDNA or RNA) probes. This technique is particularly well-suited for analyzing tissue biopsy samples from subjects. The practice of the in situ hybridization technique is described in more detail in U.S. Pat. No. 5,427,916, the entire disclosure of which is incorporated herein by reference. Suitable probes for in situ hybridization of a given miR gene product can be produced from the nucleic acid sequences provided in Table 1, as described above.

The relative number of miR gene transcripts in cells can also be determined by reverse transcription of miR gene transcripts, followed by amplification of the reverse-transcribed transcripts by polymerase chain reaction (RT-PCR). The levels of miR gene transcripts can be quantified in comparison with an internal standard, for example, the level of mRNA from a “housekeeping” gene present in the same sample. A suitable “housekeeping” gene for use as an internal standard includes, for example, myosin or glyceraldehyde-3-phosphate dehydrogenase (G3PDH). The methods for quantitative RT-PCR and variations thereof are within the skill in the art.

In some instances, it may be desirable to simultaneously determine the expression level of a plurality of different miR gene products in a sample. In other instances, it may be desirable to determine the expression level of the transcripts of all known miR genes correlated with a cancer. Assessing cancer-specific expression levels for hundreds of miR genes is time consuming and requires a large amount of total RNA (at least 20 μg for each Northern blot) and autoradiographic techniques that require radioactive isotopes.

To overcome these limitations, an oligolibrary, in microchip format (i.e., a microarray), may be constructed containing a set of probe oligodeoxynucleotides that are specific for a set of miR genes. Using such a microarray, the expression level of multiple microRNAs in a biological sample can be determined by reverse transcribing the RNAs to generate a set of target oligodeoxynucleotides, and hybridizing them to probe oligodeoxynucleotides on the microarray to generate a hybridization, or expression, profile. The hybridization profile of the test sample can then be compared to that of a control sample to determine which microRNAs have an altered expression level in breast cancer cells. As used herein, “probe oligonucleotide” or “probe oligodeoxynucleotide” refers to an oligonucleotide that is capable of hybridizing to a target oligonucleotide. “Target oligonucleotide” or “target oligodeoxynucleotide” refers to a molecule to be detected (for example, via hybridization). By “miR-specific probe oligonucleotide” or “probe oligonucleotide specific for a miR” is meant a probe oligonucleotide that has a sequence selected to hybridize to a specific miR gene product, or to a reverse transcript of the specific miR gene product.

An “expression profile” or “hybridization profile” of a particular sample is essentially a fingerprint of the state of the sample; while two states may have any particular gene similarly expressed, the evaluation of a number of genes simultaneously allows the generation of a gene expression profile that is unique to the state of the cell. That is, normal tissue may be distinguished from breast cancer tissue, and within breast cancer tissue, different prognosis states (good or poor long term survival prospects, for example) may be determined. By comparing expression profiles of breast cancer tissue in different states, information regarding which genes are important (including both up- and down-regulation of genes) in each of these states is obtained. The identification of sequences that are differentially expressed in breast cancer tissue or normal breast tissue, as well as differential expression resulting in different prognostic outcomes, allows the use of this information in a number of ways. For example, a particular treatment regime may be evaluated (for example, to determine whether a chemotherapeutic drug act to improve the long-term prognosis in a particular patient). Similarly, diagnosis may be done or confirmed by comparing patient samples with the known expression profiles. Furthermore, these gene expression profiles (or individual genes) allow screening of drug candidates that suppress the breast cancer expression profile or convert a poor prognosis profile to a better prognosis profile.

Accordingly, the invention provides methods of diagnosing whether a subject has, or is at risk for developing, breast cancer, comprising reverse transcribing RNA from a test sample obtained from the subject to provide a set of target oligo-deoxynucleotides, hybridizing the target oligo-deoxynucleotides to a microarray comprising miRNA-specific probe oligonucleotides to provide a hybridization profile for the test sample, and comparing the test sample hybridization profile to a hybridization profile generated from a control sample, wherein an alteration in the signal of at least one miRNA is indicative of the subject either having, or being at risk for developing, breast cancer. In one embodiment, the microarray comprises miRNA-specific probe oligonucleotides for a substantial portion of the human miRNome. In a particular embodiment, the microarray comprises miRNA-specific probe oligo-nucleotides for one or more miRNAs selected from the group consisting of miR-125b, miR-145, miR-21, miR-155, miR-10b, miR-009-1 (miR131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, miR-213, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, let-7i (let-7d-v2), miR-101-1, miR-122a, miR-128b, miR-136, miR-143, miR-149, miR-191, miR-196-1, miR-196-2, miR-202, miR-203, miR-206, miR-210 and combinations thereof. In a further embodiment, the at least one miR gene product is selected from the group consisting of miR-125b, miR-145, miR-21, miR-155, miR-10b and combinations thereof.

The microarray can be prepared from gene-specific oligonucleotide probes generated from known miRNA sequences. The array may contain two different oligonucleotide probes for each miRNA, one containing the active, mature sequence and the other being specific for the precursor of the miRNA. The array may also contain controls, such as one or more mouse sequences differing from human orthologs by only a few bases, which can serve as controls for hybridization stringency conditions. tRNAs from both species may also be printed on the microchip, providing an internal, relatively stable, positive control for specific hybridization. One or more appropriate controls for non-specific hybridization may also be included on the microchip. For this purpose, sequences are selected based upon the absence of any homology with any known miRNAs.

The microarray may be fabricated using techniques known in the art. For example, probe oligonucleotides of an appropriate length, for example, 40 nucleotides, are 5′-amine modified at position C6 and printed using commercially available microarray systems, for example, the GeneMachine OmniGrid™ 100 Microarrayer and Amersham CodeLink™ activated slides. Labeled cDNA oligomer corresponding to the target RNAs is prepared by reverse transcribing the target RNA with labeled primer. Following first strand synthesis, the RNA/DNA hybrids are denatured to degrade the RNA templates. The labeled target cDNAs thus prepared are then hybridized to the microarray chip under hybridizing conditions, for example, 6×SSPE/30% formamide at 25° C. for 18 hours, followed by washing in 0.75×TNT at 37° C. for 40 minutes. At positions on the array where the immobilized probe DNA recognizes a complementary target cDNA in the sample, hybridization occurs. The labeled target cDNA marks the exact position on the array where binding occurs, allowing automatic detection and quantification. The output consists of a list of hybridization events, indicating the relative abundance of specific cDNA sequences, and therefore the relative abundance of the corresponding complementary miRs, in the patient sample. According to one embodiment, the labeled cDNA oligomer is a biotin-labeled cDNA, prepared from a biotin-labeled primer. The microarray is then processed by direct detection of the biotin-containing transcripts using, for example, Streptavidin-Alexa647 conjugate, and scanned utilizing conventional scanning methods. Image intensities of each spot on the array are proportional to the abundance of the corresponding miR in the patient sample.

The use of the array has several advantages for miRNA expression detection. First, the global expression of several hundred genes can be identified in the same sample at one time point. Second, through careful design of the oligonucleotide probes, expression of both mature and precursor molecules can be identified. Third, in comparison with Northern blot analysis, the chip requires a small amount of RNA, and provides reproducible results using 2.5 μg of total RNA. The relatively limited number of miRNAs (a few hundred per species) allows the construction of a common microarray for several species, with distinct oligonucleotide probes for each. Such a tool would allow for analysis of trans-species expression for each known miR under various conditions.

In addition to use for quantitative expression level assays of specific miRs, a microchip containing miRNA-specific probe oligonucleotides corresponding to a substantial portion of the miRNome, preferably the entire miRNome, may be employed to carry out miR gene expression profiling, for analysis of miR expression patterns. Distinct miR signatures can be associated with established disease markers, or directly with a disease state.

According to the expression profiling methods described herein, total RNA from a sample from a subject suspected of having a cancer (such as breast cancer) is quantitatively reverse transcribed to provide a set of labeled target oligodeoxynucleotides complementary to the RNA in the sample. The target oligodeoxynucleotides are then hybridized to a microarray comprising miRNA-specific probe oligonucleotides to provide a hybridization profile for the sample. The result is a hybridization profile for the sample representing the expression pattern of miRNA in the sample. The hybridization profile comprises the signal from the binding of the target oligodeoxynucleotides from the sample to the miRNA-specific probe oligonucleotides in the microarray. The profile may be recorded as the presence or absence of binding (signal vs. zero signal). More preferably, the profile recorded includes the intensity of the signal from each hybridization. The profile is compared to the hybridization profile generated from a normal, noncancerous, control sample. An alteration in the signal is indicative of the presence of the cancer in the subject.

Other techniques for measuring miR gene expression are also within the skill in the art, and include various techniques for measuring rates of RNA transcription and degradation.

The invention also provides methods of diagnosing a breast cancer associated with one or more prognostic markers, comprising measuring the level of at least one miR gene product in a breast cancer test sample from a subject and comparing the level of the at least one miR gene product in the breast cancer test sample to the level of a corresponding miR gene product in a control sample. An alteration (for example, an increase, a decrease) in the signal of at least one miRNA in the test sample relative to the control sample is indicative of the subject either having, or being at risk for developing, breast cancer associated with the one or more prognostic markers.

The breast cancer can be associated with one or more prognostic markers or features, including, a marker associated with an adverse (negative) prognosis, or a marker associated with a good (positive) prognosis. In certain embodiments, the breast cancer that is diagnosed using the methods described herein is associated with one or more adverse prognostic features selected from the group consisting of estrogen receptor expression, progesterone receptor expression, positive lymph node metastasis, high proliferative index, detectable p53 expression, advanced tumor stage, and high vascular invasion. Particular microRNAs whose expression is altered in breast cancer cells associated with each of these prognostic markers are described herein (see, for example, Example 3 and FIG. 4). In one embodiment, the level of the at least one miR gene product is measured by reverse transcribing RNA from a test sample obtained from the subject to provide a set of target oligodeoxynucleotides, hybridizing the target oligodeoxynucleotides to a microarray that comprises miRNA-specific probe oligonucleotides to provide a hybridization profile for the test sample, and comparing the test sample hybridization profile to a hybridization profile generated from a control sample.

Without wishing to be bound by any one theory, it is believed that alterations in the level of one or more miR gene products in cells can result in the deregulation of one or more intended targets for these miRs, which can lead to the formation of breast cancer. Therefore, altering the level of the miR gene product (for example, by decreasing the level of a miR that is up-regulated in breast cancer cells and/or by increasing the level of a miR that is down-regulated in cancer cells) may successfully treat the breast cancer. Examples of putative gene targets for miRNAs that are deregulated in breast cancer tissues are described herein (see, for example, Example 2 and Table 4).

Accordingly, the present invention encompasses methods of treating breast cancer in a subject, wherein at least one miR gene product is de-regulated (for example, down-regulated or up-regulated) in the cancer cells of the subject. When the at least one isolated miR gene product is down-regulated in the breast cancer cells, the method comprises administering an effective amount of the at least one isolated miR gene product, provided that the miR gene is not miR15 or miR16, such that proliferation of cancer cells in the subject is inhibited. When the at least one isolated miR gene product is up-regulated in the cancer cells, the method comprises administering to the subject an effective amount of at least one compound for inhibiting expression of the at least one miR gene, referred to herein as miR gene expression inhibition compounds, such that proliferation of breast cancer cells is inhibited.

The terms “treat”, “treating” and “treatment”, as used herein, refer to ameliorating symptoms associated with a disease or condition, for example, breast cancer, including preventing or delaying the onset of the disease symptoms, and/or lessening the severity or frequency of symptoms of the disease or condition. The terms “subject” and “individual” are defined herein to include animals, such as mammals, including but not limited to, primates, cows, sheep, goats, horses, dogs, cats, rabbits, guinea pigs, rats, mice or other bovine, ovine, equine, canine, feline, rodent, or murine species. In a preferred embodiment, the animal is a human.

As used herein, an “effective amount” of an isolated miR gene product is an amount sufficient to inhibit proliferation of a cancer cell in a subject suffering from breast cancer. One skilled in the art can readily determine an effective amount of an miR gene product to be administered to a given subject, by taking into account factors, such as the size and weight of the subject; the extent of disease penetration; the age, health and sex of the subject; the route of administration; and whether the administration is regional or systemic.

For example, an effective amount of an isolated miR gene product can be based on the approximate weight of a tumor mass to be treated. The approximate weight of a tumor mass can be determined by calculating the approximate volume of the mass, wherein one cubic centimeter of volume is roughly equivalent to one gram. An effective amount of the isolated miR gene product based on the weight of a tumor mass can be in the range of about 10-500 micrograms/gram of tumor mass. In certain embodiments, the tumor mass can be at least about 10 micrograms/gram of tumor mass, at least about 60 micrograms/gram of tumor mass or at least about 100 micrograms/gram of tumor mass.

An effective amount of an isolated miR gene product can also be based on the approximate or estimated body weight of a subject to be treated. Preferably, such effective amounts are administered parenterally or enterally, as described herein. For example, an effective amount of the isolated miR gene product is administered to a subject can range from about 5-3000 micrograms/kg of body weight, from about 700-1000 micrograms/kg of body weight, or greater than about 1000 micrograms/kg of body weight.

One skilled in the art can also readily determine an appropriate dosage regimen for the administration of an isolated miR gene product to a given subject. For example, a miR gene product can be administered to the subject once (for example, as a single injection or deposition). Alternatively, a miR gene product can be administered once or twice daily to a subject for a period of from about three to about twenty-eight days, more particularly from about seven to about ten days. In a particular dosage regimen, a miR gene product is administered once a day for seven days. Where a dosage regimen comprises multiple administrations, it is understood that the effective amount of the miR gene product administered to the subject can comprise the total amount of gene product administered over the entire dosage regimen.

As used herein, an “isolated” miR gene product is one which is synthesized, or altered or removed from the natural state through human intervention. For example, a synthetic miR gene product, or a miR gene product partially or completely separated from the coexisting materials of its natural state, is considered to be “isolated.” An isolated miR gene product can exist in substantially-purified form, or can exist in a cell into which the miR gene product has been delivered. Thus, a miR gene product which is deliberately delivered to, or expressed in, a cell is considered an “isolated” miR gene product. A miR gene product produced inside a cell from a miR precursor molecule is also considered to be “isolated” molecule.

Isolated miR gene products can be obtained using a number of standard techniques. For example, the miR gene products can be chemically synthesized or recombinantly produced using methods known in the art. In one embodiment, miR gene products are chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer. Commercial suppliers of synthetic RNA molecules or synthesis reagents include, for example, Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo., U.S.A.), Pierce Chemical (part of Perbio Science, Rockford, Ill., U.S.A.), Glen Research (Sterling, Va., U.S.A.), ChemGenes (Ashland, Mass., U.S.A.) and Cruachem (Glasgow, UK).

Alternatively, the miR gene products can be expressed from recombinant circular or linear DNA plasmids using any suitable promoter. Suitable promoters for expressing RNA from a plasmid include, for example, the U6 or H1 RNA pol III promoter sequences, or the cytomegalovirus promoters. Selection of other suitable promoters is within the skill in the art. The recombinant plasmids of the invention can also comprise inducible or regulatable promoters for expression of the miR gene products in cancer cells.

The miR gene products that are expressed from recombinant plasmids can be isolated from cultured cell expression systems by standard techniques. The miR gene products which are expressed from recombinant plasmids can also be delivered to, and expressed directly in, the cancer cells. The use of recombinant plasmids to deliver the miR gene products to cancer cells is discussed in more detail below.

The miR gene products can be expressed from a separate recombinant plasmid, or they can be expressed from the same recombinant plasmid. In one embodiment, the miR gene products are expressed as RNA precursor molecules from a single plasmid, and the precursor molecules are processed into the functional miR gene product by a suitable processing system, including, but not limited to, processing systems extant within a cancer cell. Other suitable processing systems include, for example, the in vitro Drosophila cell lysate system (for example, as described in U.S. Published Patent Application No. 2002/0086356 to Tuschl et al., the entire disclosure of which are incorporated herein by reference) and the E. coli RNAse III system (for example, as described in U.S. Published Patent Application No. 2004/0014113 to Yang et al., the entire disclosure of which are incorporated herein by reference).

Selection of plasmids suitable for expressing the miR gene products, methods for inserting nucleic acid sequences into the plasmid to express the gene products, and methods of delivering the recombinant plasmid to the cells of interest are within the skill in the art. See, for example, Zeng et al. (2002), Molecular Cell 9:1327-1333; Tuschl (2002), Nat. Biotechnol, 20:446-448; Brummelkamp et al. (2002), Science 296:550-553; Miyagishi et al. (2002), Nat. Biotechnol. 20:497-500; Paddison et al. (2002), Genes Dev. 16:948-958; Lee et al. (2002), Nat. Biotechnol. 20:500-505; and Paul et al. (2002), Nat. Biotechnol. 20:505-508, the entire disclosures of which are incorporated herein by reference.

In one embodiment, a plasmid expressing the miR gene products comprises a sequence encoding a miR precursor RNA under the control of the CMV intermediate-early promoter. As used herein, “under the control” of a promoter means that the nucleic acid sequences encoding the miR gene product are located 3′ of the promoter, so that the promoter can initiate transcription of the miR gene product coding sequences.

The miR gene products can also be expressed from recombinant viral vectors. It is contemplated that the miR gene products can be expressed from two separate recombinant viral vectors, or from the same viral vector. The RNA expressed from the recombinant viral vectors can either be isolated from cultured cell expression systems by standard techniques, or can be expressed directly in cancer cells. The use of recombinant viral vectors to deliver the miR gene products to cancer cells is discussed in more detail below.

The recombinant viral vectors of the invention comprise sequences encoding the miR gene products and any suitable promoter for expressing the RNA sequences. Suitable promoters include, for example, the U6 or H1 RNA pol III promoter sequences, or the cytomegalovirus promoters. Selection of other suitable promoters is within the skill in the art. The recombinant viral vectors of the invention can also comprise inducible or regulatable promoters for expression of the miR gene products in a cancer cell.

Any viral vector capable of accepting the coding sequences for the miR gene products can be used; for example, vectors derived from adenovirus (AV); adeno-associated virus (AAV); retroviruses (for example, lentiviruses (LV), Rhabdoviruses, murine leukemia virus); herpes virus, and the like. The tropism of the viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses, or by substituting different viral capsid proteins, as appropriate.

For example, lentiviral vectors of the invention can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, and the like. AAV vectors of the invention can be made to target different cells by engineering the vectors to express different capsid protein serotypes. For example, an AAV vector expressing a serotype 2 capsid on a serotype 2 genome is called AAV 2/2. This serotype 2 capsid gene in the AAV 2/2 vector can be replaced by a serotype 5 capsid gene to produce an AAV 2/5 vector. Techniques for constructing AAV vectors that express different capsid protein serotypes are within the skill in the art; see, for example, Rabinowitz, J. E., et al. (2002), J. Virol. 76:791-801, the entire disclosure of which is incorporated herein by reference.

Selection of recombinant viral vectors suitable for use in the invention, methods for inserting nucleic acid sequences for expressing RNA into the vector, methods of delivering the viral vector to the cells of interest, and recovery of the expressed RNA products are within the skill in the art. See, for example, Dornburg (1995), Gene Therap. 2:301-310; Eglitis (1988), Biotechniques 6:608-614; Miller (1990), Hum. Gene Therap. 1:5-14; and Anderson (1998), Nature 392:25-30, the entire disclosures of which are incorporated herein by reference.

Particularly suitable viral vectors are those derived from AV and AAV. A suitable AV vector for expressing the miR gene products, a method for constructing the recombinant AV vector, and a method for delivering the vector into target cells, are described in Xia et al. (2002), Nat. Biotech. 20:1006-1010, the entire disclosure of which is incorporated herein by reference. Suitable AAV vectors for expressing the miR gene products, methods for constructing the recombinant AAV vector, and methods for delivering the vectors into target cells are described in Samulski et al. (1987), J. Virol. 61:3096-3101; Fisher et al. (1996), J. Virol., 70:520-532; Samulski et al. (1989), J. Virol. 63:3822-3826; U.S. Pat. No. 5,252,479; U.S. Pat. No. 5,139,941; International Patent Application No. WO 94/13788; and International Patent Application No. WO 93/24641, the entire disclosures of which are incorporated herein by reference. In one embodiment, the miR gene products are expressed from a single recombinant AAV vector comprising the CMV intermediate early promoter.

In a certain embodiment, a recombinant AAV viral vector of the invention comprises a nucleic acid sequence encoding a miR precursor RNA in operable connection with a polyT termination sequence under the control of a human U6 RNA promoter. As used herein, “in operable connection with a polyT termination sequence” means that the nucleic acid sequences encoding the sense or antisense strands are immediately adjacent to the polyT termination signal in the 5′ direction. During transcription of the miR sequences from the vector, the polyT termination signals act to terminate transcription.

In other embodiments of the treatment methods of the invention, an effective amount of at least one compound which inhibits miR expression can also be administered to the subject. As used herein, “inhibiting miR expression” means that the production of the active, mature form of miR gene product after treatment is less than the amount produced prior to treatment. One skilled in the art can readily determine whether miR expression has been inhibited in a cancer cell, using for example the techniques for determining miR transcript level discussed above for the diagnostic method Inhibition can occur at the level of gene expression (such as, by inhibiting transcription of a miR gene encoding the miR gene product) or at the level of processing (such as, by inhibiting processing of a miR precursor into a mature, active miR).

As used herein, an “effective amount” of a compound that inhibits miR expression is an amount sufficient to inhibit proliferation of a cancer cell in a subject suffering from a cancer associated with a cancer-associated chromosomal feature. One skilled in the art can readily determine an effective amount of an miR expression-inhibiting compound to be administered to a given subject, by taking into account factors, such as the size and weight of the subject; the extent of disease penetration; the age, health and sex of the subject; the route of administration; and whether the administration is regional or systemic.

For example, an effective amount of the expression-inhibiting compound can be based on the approximate weight of a tumor mass to be treated. The approximate weight of a tumor mass can be determined by calculating the approximate volume of the mass, wherein one cubic centimeter of volume is roughly equivalent to one gram. An effective amount based on the weight of a tumor mass can be between about 10-500 micrograms/gram of tumor mass, at least about 10 micrograms/gram of tumor mass, at least about 60 micrograms/gram of tumor mass, and at least about 100 micrograms/gram of tumor mass.

An effective amount of a compound that inhibits miR expression can also be based on the approximate or estimated body weight of a subject to be treated. Such effective amounts are administered parenterally or enterally, among others, as described herein. For example, an effective amount of the expression-inhibiting compound administered to a subject can range from about 5-3000 micrograms/kg of body weight, from about 700-1000 micrograms/kg of body weight, or it can be greater than about 1000 micrograms/kg of body weight.

One skilled in the art can also readily determine an appropriate dosage regimen for administering a compound that inhibits miR expression to a given subject. For example, an expression-inhibiting compound can be administered to the subject once (for example, as a single injection or deposition). Alternatively, an expression-inhibiting compound can be administered once or twice daily to a subject for a period of from about three to about twenty-eight days, more preferably from about seven to about ten days. In a particular dosage regimen, an expression-inhibiting compound is administered once a day for seven days. Where a dosage regimen comprises multiple administrations, it is understood that the effective amount of the expression-inhibiting compound administered to the subject can comprise the total amount of compound administered over the entire dosage regimen.

Suitable compounds for inhibiting miR gene expression include double-stranded RNA (such as short- or small-interfering RNA or “siRNA”), antisense nucleic acids, and enzymatic RNA molecules, such as ribozymes. Each of these compounds can be targeted to a given miR gene product and destroy or induce the destruction of the target miR gene product.

For example, expression of a given miR gene can be inhibited by inducing RNA interference of the miR gene with an isolated double-stranded RNA (“dsRNA”) molecule which has at least 90%, for example at least 95%, at least 98%, at least 99% or 100%, sequence homology with at least a portion of the miR gene product. In a particular embodiment, the dsRNA molecule is a “short or small interfering RNA” or “siRNA.”

siRNA useful in the present methods comprise short double-stranded RNA from about 17 nucleotides to about 29 nucleotides in length, preferably from about 19 to about 25 nucleotides in length. The siRNA comprise a sense RNA strand and a complementary antisense RNA strand annealed together by standard Watson-Crick base-pairing interactions (hereinafter “base-paired”). The sense strand comprises a nucleic acid sequence which is substantially identical to a nucleic acid sequence contained within the target miR gene product.

As used herein, a nucleic acid sequence in a siRNA which is “substantially identical” to a target sequence contained within the target mRNA is a nucleic acid sequence that is identical to the target sequence, or that differs from the target sequence by one or two nucleotides. The sense and antisense strands of the siRNA can comprise two complementary, single-stranded RNA molecules, or can comprise a single molecule in which two complementary portions are base-paired and are covalently linked by a single-stranded “hairpin” area.

The siRNA can also be altered RNA that differs from naturally-occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of the siRNA or to one or more internal nucleotides of the siRNA, or modifications that make the siRNA resistant to nuclease digestion, or the substitution of one or more nucleotides in the siRNA with deoxyribonucleotides.

One or both strands of the siRNA can also comprise a 3′ overhang. As used herein, a “3′ overhang” refers to at least one unpaired nucleotide extending from the 3′-end of a duplexed RNA strand. Thus, in certain embodiments, the siRNA comprises at least one 3′ overhang of from 1 to about 6 nucleotides (which includes ribonucleotides or deoxyribonucleotides) in length, from 1 to about 5 nucleotides in length, from 1 to about 4 nucleotides in length, or from about 2 to about 4 nucleotides in length. In a particular embodiment, the 3′ overhang is present on both strands of the siRNA, and is 2 nucleotides in length. For example, each strand of the siRNA can comprise 3′ overhangs of dithymidylic acid (“TT”) or diuridylic acid (“uu”).

The siRNA can be produced chemically or biologically, or can be expressed from a recombinant plasmid or viral vector, as described above for the isolated miR gene products. Exemplary methods for producing and testing dsRNA or siRNA molecules are described in U.S. Published Patent Application No. 2002/0173478 to Gewirtz and in U.S. Pat. No. 7,148,342 to Reich et al., the entire disclosures of which are incorporated herein by reference.

Expression of a given miR gene can also be inhibited by an antisense nucleic acid. As used herein, an “antisense nucleic acid” refers to a nucleic acid molecule that binds to target RNA by means of RNA-RNA or RNA-DNA or RNA-peptide nucleic acid interactions, which alters the activity of the target RNA. Antisense nucleic acids suitable for use in the present methods are single-stranded nucleic acids (for example, RNA, DNA, RNA-DNA chimeras, PNA) that generally comprise a nucleic acid sequence complementary to a contiguous nucleic acid sequence in an miR gene product. The antisense nucleic acid can comprise a nucleic acid sequence that is 50-100% complementary, 75-100% complementary, or 95-100% complementary to a contiguous nucleic acid sequence in an miR gene product. Nucleic acid sequences for the miR gene products are provided in Table 1. Without wishing to be bound by any theory, it is believed that the antisense nucleic acids activate RNase H or another cellular nuclease that digests the miR gene product/antisense nucleic acid duplex.

Antisense nucleic acids can also contain modifications to the nucleic acid backbone or to the sugar and base moieties (or their equivalent) to enhance target specificity, nuclease resistance, delivery or other properties related to efficacy of the molecule. Such modifications include cholesterol moieties, duplex intercalators, such as acridine, or one or more nuclease-resistant groups.

Antisense nucleic acids can be produced chemically or biologically, or can be expressed from a recombinant plasmid or viral vector, as described above for the isolated miR gene products. Exemplary methods for producing and testing are within the skill in the art; see, for example, Stein and Cheng (1993), Science 261:1004 and U.S. Pat. No. 5,849,902 to Woolf et al., the entire disclosures of which are incorporated herein by reference.

Expression of a given miR gene can also be inhibited by an enzymatic nucleic acid. As used herein, an “enzymatic nucleic acid” refers to a nucleic acid comprising a substrate binding region that has complementarity to a contiguous nucleic acid sequence of an miR gene product, and which is able to specifically cleave the miR gene product. The enzymatic nucleic acid substrate binding region can be, for example, 50-100% complementary, 75-100% complementary, or 95-100% complementary to a contiguous nucleic acid sequence in a miR gene product. The enzymatic nucleic acids can also comprise modifications at the base, sugar, and/or phosphate groups. An exemplary enzymatic nucleic acid for use in the present methods is a ribozyme.

The enzymatic nucleic acids can be produced chemically or biologically, or can be expressed from a recombinant plasmid or viral vector, as described above for the isolated miR gene products. Exemplary methods for producing and testing dsRNA or siRNA molecules are described in Werner and Uhlenbeck (1995), Nucl. Acids Res. 23:2092-96; Hammann et al. (1999), Antisense and Nucleic Acid Drug Dev. 9:25-31; and U.S. Pat. No. 4,987,071 to Cech et al, the entire disclosures of which are incorporated herein by reference.

Administration of at least one miR gene product, or at least one compound for inhibiting miR expression, will inhibit the proliferation of cancer cells in a subject who has a cancer associated with a cancer-associated chromosomal feature. As used herein, to “inhibit the proliferation of a cancer cell” means to kill the cell, or permanently or temporarily arrest or slow the growth of the cell. Inhibition of cancer cell proliferation can be inferred if the number of such cells in the subject remains constant or decreases after administration of the miR gene products or miR gene expression-inhibiting compounds. An inhibition of cancer cell proliferation can also be inferred if the absolute number of such cells increases, but the rate of tumor growth decreases.

The number of cancer cells in a subject's body can be determined by direct measurement, or by estimation from the size of primary or metastatic tumor masses. For example, the number of cancer cells in a subject can be measured by immunohistological methods, flow cytometry, or other techniques designed to detect characteristic surface markers of cancer cells.

The size of a tumor mass can be ascertained by direct visual observation, or by diagnostic imaging methods, such as X-ray, magnetic resonance imaging, ultrasound, and scintigraphy. Diagnostic imaging methods used to ascertain size of the tumor mass can be employed with or without contrast agents, as is known in the art. The size of a tumor mass can also be ascertained by physical means, such as palpation of the tissue mass or measurement of the tissue mass with a measuring instrument, such as a caliper.

The miR gene products or miR gene expression-inhibiting compounds can be administered to a subject by any means suitable for delivering these compounds to cancer cells of the subject. For example, the miR gene products or miR expression inhibiting compounds can be administered by methods suitable to transfect cells of the subject with these compounds, or with nucleic acids comprising sequences encoding these compounds. In one embodiment, the cells are transfected with a plasmid or viral vector comprising sequences encoding at least one miR gene product or miR gene expression inhibiting compound.

Transfection methods for eukaryotic cells are well known in the art, and include, for example, direct injection of the nucleic acid into the nucleus or pronucleus of a cell; electroporation; liposome transfer or transfer mediated by lipophilic materials; receptor-mediated nucleic acid delivery, bioballistic or particle acceleration; calcium phosphate precipitation, and transfection mediated by viral vectors.

For example, cells can be transfected with a liposomal transfer compound, such as, DOTAP (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-ammonium methylsulfate, Boehringer-Mannheim) or an equivalent, such as LIPOFECTIN. The amount of nucleic acid used is not critical to the practice of the invention; acceptable results may be achieved with 0.1-100 micrograms of nucleic acid/105 cells. For example, a ratio of about 0.5 micrograms of plasmid vector in 3 micrograms of DOTAP per 105 cells can be used.

A miR gene product or miR gene expression inhibiting compound can also be administered to a subject by any suitable enteral or parenteral administration route. Suitable enteral administration routes for the present methods include, for example, oral, rectal, or intranasal delivery. Suitable parenteral administration routes include, for example, intravascular administration (for example, intravenous bolus injection, intravenous infusion, intra-arterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature); pen- and intra-tissue injection (for example, peri-tumoral and intra-tumoral injection, intra-retinal injection, or subretinal injection); subcutaneous injection or deposition, including subcutaneous infusion (such as by osmotic pumps); direct application to the tissue of interest, for example by a catheter or other placement device (for example, a retinal pellet or a suppository or an implant comprising a porous, non-porous, or gelatinous material); and inhalation. Particularly suitable administration routes are injection, infusion and direct injection into the tumor.

In the present methods, a miR gene product or miR gene product expression inhibiting compound can be administered to the subject either as naked RNA, in combination with a delivery reagent, or as a nucleic acid (for example, a recombinant plasmid or viral vector) comprising sequences that express the miR gene product or expression inhibiting compound. Suitable delivery reagents include, for example, the Mirus Transit TKO lipophilic reagent; lipofectin; lipofectamine; cellfectin; polycations (for example, polylysine), and liposomes.

Recombinant plasmids and viral vectors comprising sequences that express the miR gene products or miR gene expression inhibiting compounds, and techniques for delivering such plasmids and vectors to cancer cells, are discussed herein.

In a particular embodiment, liposomes are used to deliver a miR gene product or miR gene expression-inhibiting compound (or nucleic acids comprising sequences encoding them) to a subject. Liposomes can also increase the blood half-life of the gene products or nucleic acids. Suitable liposomes for use in the invention can be formed from standard vesicle-forming lipids, which generally include neutral or negatively charged phospholipids and a sterol, such as cholesterol. The selection of lipids is generally guided by consideration of factors, such as the desired liposome size and half-life of the liposomes in the blood stream. A variety of methods are known for preparing liposomes, for example, as described in Szoka et al. (1980), Ann. Rev. Biophys. Bioeng. 9:467; and U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369, the entire disclosures of which are incorporated herein by reference.

The liposomes for use in the present methods can comprise a ligand molecule that targets the liposome to cancer cells. Ligands which bind to receptors prevalent in cancer cells, such as monoclonal antibodies that bind to tumor cell antigens, are preferred.

The liposomes for use in the present methods can also be modified so as to avoid clearance by the mononuclear macrophage system (“MMS”) and reticuloendothelial system (“RES”). Such modified liposomes have opsonization-inhibition moieties on the surface or incorporated into the liposome structure. In a particularly preferred embodiment, a liposome of the invention can comprise both opsonization-inhibition moieties and a ligand.

Opsonization-inhibiting moieties for use in preparing the liposomes of the invention are typically large hydrophilic polymers that are bound to the liposome membrane. As used herein, an opsonization inhibiting moiety is “bound” to a liposome membrane when it is chemically or physically attached to the membrane, for example, by the intercalation of a lipid-soluble anchor into the membrane itself, or by binding directly to active groups of membrane lipids. These opsonization-inhibiting hydrophilic polymers form a protective surface layer that significantly decreases the uptake of the liposomes by the MMS and RES; for example, as described in U.S. Pat. No. 4,920,016, the entire disclosure of which is incorporated herein by reference.

Opsonization inhibiting moieties suitable for modifying liposomes are preferably water-soluble polymers with a number-average molecular weight from about 500 to about 40,000 daltons, and more preferably from about 2,000 to about 20,000 daltons. Such polymers include polyethylene glycol (PEG) or polypropylene glycol (PPG) derivatives; for example, methoxy PEG or PPG, and PEG or PPG stearate; synthetic polymers, such as polyacrylamide or poly N-vinyl pyrrolidone; linear, branched, or dendrimeric polyamidoamines; polyacrylic acids; polyalcohols, for example, polyvinylalcohol and polyxylitol to which carboxylic or amino groups are chemically linked, as well as gangliosides, such as ganglioside GM1. Copolymers of PEG, methoxy PEG, or methoxy PPG, or derivatives thereof, are also suitable. In addition, the opsonization inhibiting polymer can be a block copolymer of PEG and either a polyamino acid, polysaccharide, polyamidoamine, polyethyleneamine, or polynucleotide. The opsonization inhibiting polymers can also be natural polysaccharides containing amino acids or carboxylic acids, for example, galacturonic acid, glucuronic acid, mannuronic acid, hyaluronic acid, pectic acid, neuraminic acid, alginic acid, carrageenan; aminated polysaccharides or oligosaccharides (linear or branched); or carboxylated polysaccharides or oligosaccharides, for example, reacted with derivatives of carbonic acids with resultant linking of carboxylic groups. Preferably, the opsonization-inhibiting moiety is a PEG, PPG, or derivatives thereof. Liposomes modified with PEG or PEG-derivatives are sometimes called “PEGylated liposomes.”

The opsonization inhibiting moiety can be bound to the liposome membrane by any one of numerous well-known techniques. For example, an N-hydroxysuccinimide ester of PEG can be bound to a phosphatidyl-ethanolamine lipid-soluble anchor, and then bound to a membrane. Similarly, a dextran polymer can be derivatized with a stearylamine lipid-soluble anchor via reductive amination using Na(CN)BH3 and a solvent mixture, such as tetrahydrofuran and water in a 30:12 ratio at 60° C.

Liposomes modified with opsonization-inhibition moieties remain in the circulation much longer than unmodified liposomes. For this reason, such liposomes are sometimes called “stealth” liposomes. Stealth liposomes are known to accumulate in tissues fed by porous or “leaky” microvasculature. Thus, tissue characterized by such microvasculature defects, for example solid tumors, will efficiently accumulate these liposomes; see Gabizon, et al. (1988), Proc. Natl. Acad. Sci., U.S.A., 18:6949-53. In addition, the reduced uptake by the RES lowers the toxicity of stealth liposomes by preventing significant accumulation of the liposomes in the liver and spleen. Thus, liposomes that are modified with opsonization-inhibition moieties are particularly suited to deliver the miR gene products or miR gene expression inhibition compounds (or nucleic acids comprising sequences encoding them) to tumor cells.

The miR gene products or miR gene expression inhibition compounds can be formulated as pharmaceutical compositions, sometimes called “medicaments,” prior to administering them to a subject, according to techniques known in the art. Accordingly, the invention encompasses pharmaceutical compositions for treating breast cancer. In one embodiment, the pharmaceutical compositions comprise at least one isolated miR gene product and a pharmaceutically-acceptable carrier. In a particular embodiment, the at least one miR gene product corresponds to a miR gene product that has a decreased level of expression in breast cancer cells relative to suitable control cells. In certain embodiments the isolated miR gene product is selected from the group consisting of miR-145, miR-10b, miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, miR-101-1, miR-143 and combinations thereof.

In other embodiments, the pharmaceutical compositions of the invention comprise at least one miR expression inhibition compound. In a particular embodiment, the at least one miR gene expression inhibition compound is specific for a miR gene whose expression is greater in breast cancer cells than control cells. In certain embodiments, the miR gene expression inhibition compound is specific for one or more miR gene products selected from the group consisting of miR-21, miR-155, miR-009-1 (miR131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-213, let-7i (let-7d-v2), miR-122a, miR-128b, miR-136, miR-149, miR-191, miR-196-1, miR-196-2, miR-202, miR-203, miR-206, miR-210, miR-213 and combinations thereof.

Pharmaceutical compositions of the present invention are characterized as being at least sterile and pyrogen-free. As used herein, “pharmaceutical formulations” include formulations for human and veterinary use. Methods for preparing pharmaceutical compositions of the invention are within the skill in the art, for example as described in Remington's Pharmaceutical Science, 17th ed., Mack Publishing Company, Easton, Pa. (1985), the entire disclosure of which is incorporated herein by reference.

The present pharmaceutical formulations comprise at least one miR gene product or miR gene expression inhibition compound (or at least one nucleic acid comprising sequences encoding them) (for example, 0.1 to 90% by weight), or a physiologically acceptable salt thereof, mixed with a pharmaceutically-acceptable carrier. The pharmaceutical formulations of the invention can also comprise at least one miR gene product or miR gene expression inhibition compound (or at least one nucleic acid comprising sequences encoding them) which are encapsulated by liposomes and a pharmaceutically-acceptable carrier. In one embodiment, the pharmaceutical compositions comprise a miR gene or gene product that is not miR-15, miR-16, miR-143 and/or miR-145.

Especially suitable pharmaceutically-acceptable carriers are water, buffered water, normal saline, 0.4% saline, 0.3% glycine, hyaluronic acid and the like.

In a particular embodiment, the pharmaceutical compositions of the invention comprise at least one miR gene product or miR gene expression inhibition compound (or at least one nucleic acid comprising sequences encoding them) which is resistant to degradation by nucleases. One skilled in the art can readily synthesize nucleic acids which are nuclease resistant, for example by incorporating one or more ribonucleotides that are modified at the 2′-position into the miR gene products. Suitable 2′-modified ribonucleotides include those modified at the 2′-position with fluoro, amino, alkyl, alkoxy, and O-allyl.

Pharmaceutical compositions of the invention can also comprise conventional pharmaceutical excipients and/or additives. Suitable pharmaceutical excipients include stabilizers, antioxidants, osmolality adjusting agents, buffers, and pH adjusting agents. Suitable additives include, for example, physiologically biocompatible buffers (for example, tromethamine hydrochloride), additions of chelants (such as, for example, DTPA or DTPA-bisamide) or calcium chelate complexes (such as, for example, calcium DTPA, CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate). Pharmaceutical compositions of the invention can be packaged for use in liquid form, or can be lyophilized.

For solid pharmaceutical compositions of the invention, conventional nontoxic solid pharmaceutically-acceptable carriers can be used; for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.

For example, a solid pharmaceutical composition for oral administration can comprise any of the carriers and excipients listed above and 10-95%, preferably 25%-75%, of the at least one miR gene product or miR gene expression inhibition compound (or at least one nucleic acid comprising sequences encoding them). A pharmaceutical composition for aerosol (inhalational) administration can comprise 0.01-20% by weight, preferably 1%-10% by weight, of the at least one miR gene product or miR gene expression inhibition compound (or at least one nucleic acid comprising sequences encoding them) encapsulated in a liposome as described above, and a propellant. A carrier can also be included as desired; for example, lecithin for intranasal delivery.

The invention also encompasses methods of identifying an anti-breast cancer agent, comprising providing a test agent to a cell and measuring the level of at least one miR gene product in the cell. In one embodiment, the method comprises providing a test agent to a cell and measuring the level of at least one miR gene product associated with decreased expression levels in breast cancer cells. An increase in the level of the miR gene product in the cell, relative to a suitable control cell, is indicative of the test agent being an anti-breast cancer agent. In a particular embodiment, at least one miR gene product associated with decreased expression levels in breast cancer cells is selected from the group consisting of miR-145, miR-10b, miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, miR-101-1, miR-143 and combinations thereof.

In other embodiments the method comprises providing a test agent to a cell and measuring the level of at least one miR gene product associated with increased expression levels in breast cancer cells. A decrease in the level of the miR gene product in the cell, relative to a suitable control cell, is indicative of the test agent being an anti-breast cancer agent. In a particular embodiment, at least one miR gene product associated with increased expression levels in breast cancer cells is selected from the group consisting of miR-21, miR-155, miR-009-1 (miR131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-213, let-7i (let-7d-v2), miR-122a, miR-128b, miR-136, miR-149, miR-191, miR-196-1, miR-196-2, miR-202, miR-203, miR-206, miR-210, miR-213 and combinations thereof.

Suitable agents include, but are not limited to drugs (for example, small molecules, peptides), and biological macromolecules (for example, proteins, nucleic acids). The agent can be produced recombinantly, synthetically, or it may be isolated (i.e., purified) from a natural source. Various methods for providing such agents to a cell (for example, transfection) are well known in the art, and several of such methods are described hereinabove. Methods for detecting the expression of at least one miR gene product (for example, Northern blotting, in situ hybridization, RT-PCR, expression profiling) are also well known in the art. Several of these methods are also described hereinabove.

The invention will now be illustrated by the following non-limiting examples.

Example 1

Identification of a microRNA Expression Signature that Discriminates Breast Cancer Tissues from Normal Tissues

Materials and Methods

Breast Cancer Samples and Cell Lines.

RNAs from primary tumors were obtained from 76 samples collected at the University of Ferrara (Italy), Istituto Nazionale dei Tumori, Milano (Italy) and Thomas Jefferson University (Philadelphia, Pa.). Clinico-pathological information was available for 58 tumor samples. RNA from normal samples consisted of 6 pools of RNA from 5 normal breast tissues each, as well as RNA from 4 additional single breast tissues. Breast cancer RNAs were also obtained from the following cell lines: Hs578-T, MCF7, T47D, BT20, SK-BR-3, HBL100, HCC2218, MDA-MB-175, MDA-MB-231, MDA-MB-361, MDA-MB-435, MDA-MB-436, MDA-MB-453 and MDAMB-468.

miRNA Microarray.

Total RNA isolation was performed with Trizol Reagent (Invitrogen) according to the manufacturer's instructions. RNA labeling and hybridization on microRNA microarray chips was performed as previously described (Liu, C.-G., et al., Proc. Natl. Acad. Sci. U.S.A. 101:9740-9744 (2004)). Briefly, 5 μg of RNA from each sample was labeled with biotin during reverse transcription using random hexamers. Hybridization was carried out on a miRNA microarray chip (KCl version 1.0), which contains 368 probes, including 245 human and mouse miRNA genes, in triplicate. Hybridization signals were detected by binding of biotin to a Streptavidin-Alexa647 conjugate using a Perkin-Elmer ScanArray XL5K. Scanner images were quantified by the Quantarray software (Perkin Elmer).

Statistical and bioinformatic analysis of microarray data. Raw data were normalized and analyzed using the GeneSpring® software, version 7.2 (SiliconGenetics, Redwood City, Calif.). Expression data were median centered. Statistical comparisons were performed by ANOVA (Analysis of Variance), using the Benjamini and Hochberg correction for reduction of false positives. Prognostic miRNAs for tumor or normal class prediction were determined using both the PAM software (Prediction Analysis of Microarrays) (Tibshirani, R., et al. Proc. Natl. Acad. Sci. U.S.A. 99:6567-6572 (2002)) and the Support Vector Machine (Furey, T. S., et al. Bioinformatics 16: 906-914 (2000)) software. Both algorithms were used for Cross-validation and Test-set prediction. All data were submitted using MIAMExpress to the Array Express database.

Northern Blotting.

Northern blot analysis was performed as previously described (Calin, G. A., et al., Proc. Natl. Acad. Sci. U.S.A. 99:15524-29 (2002)). RNA samples (10 μg each) were electrophoresed on 15% acrylamide, 7 M urea Criterion pre-casted gels (Bio-Rad) and transferred onto Hybond-N+ membrane (Amersham Pharmacia Biotech). The hybridization was performed at 37° C. in 7% sodium dodecyl sulfate (SDS)/0.2M Na2PO4 (pH 7.0) for 16 hours. Membranes were washed twice at 42° C. with 2× standard saline phosphate (0.18 M NaCl/10 mM phosphate, pH 7.4), supplemented with 1 mM EDTA (SSPE) and 0.1% SDS, and twice with 0.5×SSPE/0.1% SDS. Oligonucleotide probes were complementary to the sequence of the corresponding mature microRNA (see Sanger miR Registry): miR-21 5′-TCA ACA TCA GTC TGA TAA GCT A-3′ (SEQ ID NO:287); miR-125b1: 5′-TCA CAA GTT AGG GTC TCA GGG A-3′ (SEQ ID NO:288); miR-145: 5′-AAG GGA TTC CTG GGA AAA CTG GAC-3′ (SEQ ID NO:289). An oligonucleotide that was complementary to the U6 RNA (5′-GCA GGG GCC ATG CTA ATC TTC TCT GTA TCG-3′ (SEQ ID NO:290)) was used for normalizing expression levels. 200 ng of each probe was end labeled with 100 mCi [gamma-32P]-ATP using a polynucleotide kinase (Roche). Northern Blots were stripped in a boiling 0.1% SDS solution for 10 minutes before re-hybridization.

Results

A microRNA microarray (Liu, C.-G., et al., Proc. Natl. Acad. Sci. U.S.A. 101:9740-9744 (2004)) was used to generate microRNA expression profiles for 10 normal and 76 neoplastic breast tissues. Each tumor sample was derived from a single specimen, while 6 of the 10 normal samples consisted of pools of RNA made from five different normal breast tissues. Hence, 34 normal breast samples were actually examined in the study.

To identify miRNAs that were differentially-expressed between normal and tumor samples, and, therefore, can be used to distinguish normal from cancerous breast tissues, analyses of variance and class prediction statistical tools were utilized. Results of the ANOVA analysis on normalized data generated a profile of differentially-expressed miRNAs (p<0.05) between normal and cancerous breast tissues (Table 2). Cluster analysis, based on differentially-expressed miRNA, generated a tree having a clear distinction between normal and cancer tissues (FIG. 1A).

To accurately identify a set of predictive miRNAs capable of differentiating normal from breast cancer tissues, we used Support Vector Machine (GeneSpring software) and PAM (Prediction Analysis of Microarrays). Results from the two class prediction analyses largely overlapped (Table 3 and FIG. 1B). Among the miRNAs listed in Table 3, 11 of 15 have an ANOVA p-value of less than 0.05. To confirm the results obtained by microarray analysis, we performed Northern blot analysis to assess expression levels for a subset of microRNAs, namely, mir-125b, mir-145 and mir-21, that were differentially-expressed in normal and cancerous breast tissues. Northern blot analysis confirmed results obtained by microarray analysis. In many cases, expression differences appeared stronger than those anticipated by the microarray studies (FIG. 1C).

TABLE 2
miRNAs differentially-expressed between breast carcinoma and normal breast tissue.
Breast Cancer Normal Breast
Median Range Median Range
P-value Normalized Min Max Normalized Min Max
let-7a-2 1.94E−02 1.67 0.96 - 6.21 2.30 1.34 - 5.00
let-7a-3 4.19E−02 1.28 0.81 - 3.79 1.58 1.02 - 2.91
let-7d (= 7d-v1) 4.81E−03 0.90 0.59 - 1.54 1.01 0.83 - 1.25
let-7f-2 6.57E−03 0.84 0.61 - 1.58 0.92 0.76 - 1.03
let-7f (= let-7d-v2) 3.38E−02 2.05 1.02 - 7.49 1.53 1.01 - 3.47
mir-009-1 (mir-131-1) 9.12E−03 1.38 0.69 - 4.18 1.01 0.81 - 2.44
mir-010b 4.49E−02 1.11 0.69 - 4.78 1.70 0.96 - 8.32
mir-021 4.67E−03 1.67 0.66 - 28.43 1.08 0.80 - 2.31
mir-034 (=mir-17D) 1.06E−02 1.87 0.70 - 8.40 1.09 0.65 - 3.17
mir-101-1 4.15E−03 0.83 0.52 - 1.28 0.90 0.77 - 1.05
mir-122a 3.43E−03 2.21 0.93 - 8.08 1.48 1.06 - 3.67
mir-125a 3.28E−03 1.20 0.69 - 2.35 1.73 1.21 - 3.34
mir-125b-1 2.85E−02 1.30 0.55 - 8.85 2.87 1.45 - 18.38
mir-125b-2 2.33E−02 1.26 0.69 - 8.29 2.83 1.40 - 18.78
mir-126b 1.60E−02 1.12 0.68 - 7.34 1.02 0.89 - 1.27
mir-136 2.42E−03 1.32 0.74 - 10.28 1.06 0.76 - 1.47
mir-143 7.11E−03 0.87 0.68 - 1.33 0.98 0.81 - 1.17
mir-145 4.02E−03 1.52 0.92 - 8.46 3.61 1.65 - 14.45
mir-149 2.75E−02 1.11 0.53 - 1.73 1.03 0.83 - 1.22
mir-155(BIC) 1.24E−03 1.75 0.95 - 11.45 1.37 1.11 - 1.88
mir-191 4.28E−02 5.17 1.03 - 37.81 3.12 1.45 - 14.58
mir-196-1 1.07E−02 1.20 0.57 - 3.95 0.95 0.66 - 1.75
mir-196-2 1.16E−03 1.46 0.57 - 5.55 1.04 0.79 - 1.80
mir-202 1.25E−02 1.05 0.71 - 2.03 0.89 0.65 - 1.20
mir-203 4.08E−07 1.12 0.50 - 5.89 0.86 0.71 - 1.04
mir-204 2.15E−03 0.78 0.48 - 1.04 0.89 0.72 - 1.08
mir-206 1.42E−02 2.55 1.22 - 8.42 1.95 1.34 - 3.22
mir-210 6.40E−13 1.60 0.98 - 12.13 1.12 0.97 - 1.29
mir-213 1.08E−02 3.72 1.42 - 40.83 2.47 1.35 - 5.91

TABLE 3
Normal and tumor breast tissues class predictor microRNAs
Median expression ANOVAa SVM prediction PAM scorec
miRNA name Cancer Normal Probability strengthb Cancer Normal Chromos map
mir-009-1 1.36 1.01 0.0091 8.05 0.011 −0.102 1q22
mir-010b 1.11 1.70 0.0449 8.70 −0.032 0.299 2q31
mir-021 1.67 1.08 0.0047 10.20 0.025 −0.235 17q23.2
mir-034 1.67 1.09 0.0108 8.05 0.011 −0.106 1p36.22
mir-102 (mir-29b) 1.36 1.14 >0.10 8.92 0.000 −0.004 1q32.2-32.3
mir-123 (mir-126) 0.92 1.13 0.0940 9.13 −0.015 0.138 9q34
mir-125a 1.20 1.73 0.0033 8.99 −0.040 0.381 19q13.4
mir-125b-1 1.30 2.87 0.0265 14.78 −0.096 0.915 11q24.1
mir-125b-2 1.26 2.63 0.0233 17.62 −0.106 1.006 21q11.2
mir-140-as 0.93 1.10 0.0695 11.01 −0.005 0.050 16q22.1
mir-145 1.52 3.61 0.0040 12.93 −0.158 1.502 5q32-33
mir-155(BIC) 1.75 1.37 0.0012 10.92 0.003 −0.030 21q21
mir-194 0.96 1.09 >0.10 11.12 −0.025 0.234 1q41
mir-204 0.78 0.89 0.0022 8.10 −0.015 0.144 9q21.1
mir-213 3.72 2.47 0.0108 9.44 0.023 −0.220 1q31.3-q32.1
aAnalysis of Variance (Welch t-test in Genespring software package) as calculated in Table 2.
bSupport Vector Machine prediction analysis tool (from Genespring 7.2 software package).

Prediction strengths are calculated as negative natural log of the probability to predict the observed number of samples, in one of the two classes, by chance. The higher is the score, the best is the prediction strength.
c—Centroid scores for the two classes of the Prediction Analysis of Microarrays (Tibshirani, R., et al. Proc. Natl. Acad. Sci. U.S.A. 99:6567-6572 (2002)).

Of the 29 miRNAs whose expression is significantly (p<0.05) deregulated according to the microarray analysis, a set of 15 miRNAs were able to correctly predict the nature of the sample analyzed (i.e., normal vs. tumor) with 100% accuracy. Among the differentially-expressed miRNAs, miR-10b, miR-125b, miR145, miR-21 and miR-155 were the most consistently deregulated miRNAs in breast cancer samples. Three of these, namely, miR-10b, miR-125b and miR-145, were down-regulated, while the remaining two, miR-21 and miR-155, were up-regulated, suggesting that they might act as tumor suppressor genes or oncogenes, respectively.

Example 2

Determination of Putative Gene Targets of miRNAs that are Deregulated in Breast Cancer Tissues

At present, the lack of knowledge about bona fide miRNA gene targets hampers a full understanding of which biological functions are deregulated in cancers characterized by aberrant miRNA expression. To identify putative targets of the most significantly de-regulated miRNAs from our study: miR-10b, miR125b, miR-145, miR-21 and miR-155 (see Example 1), we utilized multiple computational approaches. In particular, the analysis was performed using three algorithms, miRanda, TargetScan and PicTar, which are used to predict human miRNA gene targets (Enright, A. J., et al. Genome Biol. 5:R1 (2003); Lewis, B. P. et al., Cell 115:787-798 (2003); Krek, A., et al., Nat. Genet. 37:495-500 (2005)). The results obtained using each of the three algorithms were cross-referenced with one another to validate putative targets, and only targets that were identified by at least 2 of the 3 algorithms were considered. Results of this analysis are presented in Table 4.

Several genes with potential oncogenic functions were identified as putative targets of miRNAs that are down-regulated in breast cancer samples. Notably, oncogenes were identified as targets of miR-10b (for example, FLT1, the v-crk homolog, the growth factor BDNF and the transducing factor SHC1), miR-125b (for example, YES, ETS1, TEL, AKT3, the growth factor receptor FGFR2 and members of the mitogen-activated signal transduction pathway VTS58635, MAP3K10, MAP3K11, MAPK14), and miR-145 (for example, MYCN, FOS, YES and FLI1, integration site of Friend leukemia virus, cell cycle promoters, such as cyclins D2 and L1, MAPK transduction proteins, such as MAP3K3 and MAP4K4). The proto-oncogene, YES, and the core-binding transcription factor, CBFB, were determined to be potential targets of both miR-125 and miR-145.

Consistent with these findings, multiple tumor suppressor genes were identified as targets of miR-21 and miR-155, miRNAs that are up-regulated in breast cancer cells. For miR-21, the TGFB gene was predicted as target by all three methods. For miR-155, potential targets included the tumor suppressor genes, SOCS1 and APC, and the kinase, WEE1, which blocks the activity of Cdc2 and prevents entry into mitosis. The hypoxia inducible factor, HIF1A, was also a predicted target of miR-155. Notably, the tripartite motif-containing protein TRIM2, the proto-oncogene, SKI, and the RAS homologs, RAB6A and RAB6C, were found as potential targets of both miR-21 and miR-155.

TABLE 4
Putative gene targets of differentially-expressed miRNA identified by at least two prediction methods
Gene Prediction
miRNA Genbank Symbol Gene Name algorithm Gene Ontology condensed
miR- AL117516 38596 strand-exchange protein 1 P + T exonuclease activity|nucleus
10b
miR- NM_004915 ABCG1 ATP-binding cassette, P + T ATP binding|ATPase activity|ATPase activity,
10b sub-family G (WHITE), coupled to transmembrane movement of
member 1 substances|L-tryptophan transporter
activity|cholesterol homeostasis|cholesterol
metabolism|detection of hormone stimulus|integral to
plasma membrane|lipid
transport|membrane|membrane fraction|permease
activity|protein dimerization activity|purine nucleotide
transporter activity|response to organic substance
miR- NM_001148 ANK2 ankyrin 2, neuronal P + T actin
10b cytoskeleton|membrane|metabolism|oxidoreductase
activity|protein binding|signal transduction|structural
constituent of cytoskeleton
miR- NM_020987 ANK3 ankyrin 3, node of P + T Golgi apparatus|cytoskeletal
10b Ranvier (ankyrin G) anchoring|cytoskeleton|cytoskeleton|endoplasmic
reticulum|protein binding|protein targeting|signal
transduction|structural constituent of cytoskeleton
miR- NM_016376 ANKHZN ANKHZN protein P + T endocytosis|endosome membrane|membrane|protein
10b binding|zinc ion binding
miR- NM_006380 APPBP2 amyloid beta precursor P + T binding|cytoplasm|intracellular protein
10b protein (cytoplasmic transport|membrane|microtubule associated
tail) binding protein 2 complex|microtubule motor activity|nucleus
miR- NM_006321 ARIH2 ariadne homolog 2 P + T development|nucleic acid binding|nucleus|protein
10b (Drosophila) ubiquitination|ubiquitin ligase complex|ubiquitin-
protein ligase activity|zinc ion binding
miR- NM_001668 ARNT aryl hydrocarbon P + T aryl hydrocarbon receptor nuclear translocator
10b receptor nuclear activity|nucleus|nucleus|protein-nucleus import,
translocator translocation|receptor activity|regulation of
transcription, DNA-dependent|signal transducer
activity|signal transduction|transcription coactivator
activity|transcription factor activity|transcription
factor activity
miR- AI829840 ASXL1 ESTs, Weakly similar P + T nucleus|regulation of transcription, DNA-
10b to SFRB_HUMAN dependent|transcription
Splicing factor
arginine/serine-rich 11
(Arginine-rich 54 kDa
nuclear protein) (P54)
[H. sapiens]
miR- NM_021813 BACH2 BTB and CNC P + T DNA binding|nucleus|protein binding|regulation of
10b homology 1, basic transcription, DNA-dependent|transcription
leucine zipper
transcription factor 2
miR- NM_013450 BAZ2B bromodomain adjacent P + T DNA binding|nucleus|regulation of transcription,
10b to zinc finger domain, DNA-dependent|transcription
2B
miR- NM_001706 BCL6 B-cell CLL/lymphoma P + T inflammatory response|mediator complex|negative
10b 6 (zinc finger protein regulation of transcription from RNA polymerase II
51) promoter|nucleus|positive regulation of cell
proliferation|protein binding|regulation of
transcription, DNA-
dependent|transcription|transcription factor
activity|zinc ion binding
miR- NM_001709 BDNF brain-derived P + T growth factor activity|growth factor
10b neurotrophic factor activity|neurogenesis
miR- NM_006624 BS69 adenovirus 5 E1A P + T DNA binding|cell cycle|cell proliferation|negative
10b binding protein regulation of cell cycle|negative regulation of
transcription from RNA polymerase II
promoter|nucleus|regulation of transcription, DNA-
dependent|transcription
miR- AF101784 BTRC beta-transducin repeat P + T Wnt receptor signaling pathway|endoplasmic
10b containing reticulum|ligase activity|signal transduction|ubiquitin
conjugating enzyme activity|ubiquitin cycle|ubiquitin-
dependent protein catabolism
miR- NM_005808 C3orf8 HYA22 protein P + T biological_process unknown|molecular_function
10b unknown|nucleus
miR- BF111268 CAMK2G calcium/calmodulin- P + T ATP binding|ATP binding|calcium- and calmodulin-
10b dependent protein dependent protein kinase activity|calcium-dependent
kinase (CaM kinase) II protein serine/threonine phosphatase
gamma activity|calmodulin binding|cellular_component
unknown|insulin secretion|kinase activity|protein
amino acid phosphorylation|protein amino acid
phosphorylation|protein serine/threonine kinase
activity|protein-tyrosine kinase activity|signal
transduction|transferase activity
miR- NM_020184 CNNM4 cyclin M4 P + T
10b
miR- NM_022730 COPS7B COP9 constitutive P + T signalosome complex
10b photomorphogenic
homolog subunit 7B
(Arabidopsis)
miR- NM_016823 CRK v-crk sarcoma virus P + T SH3/SH2 adaptor activity|actin cytoskeleton
10b CT10 oncogene organization and biogenesis|cell
homolog (avian) motility|cytoplasm|intracellular signaling
cascade|nucleus|regulation of transcription from RNA
polymerase II promoter
miR- NM_020248 CTNNBIP1 catenin, beta interacting P + T Wnt receptor signaling pathway|beta-catenin
10b protein 1 binding|cell
proliferation|development|nucleus|regulation of
transcription, DNA-dependent|signal transduction
miR- NM_018959 DAZAP1 DAZ associated protein 1 P + T RNA binding|cell differentiation|nucleotide
10b binding|nucleus|spermatogenesis
miR- AL136828 DKFZP434K0427 hypothetical protein P + T cation transport|cation transporter activity
10b DKFZp434K0427
miR- R20763 DKFZp547J036 ELAV (embryonic P + T
10b lethal, abnormal vision,
Drosophila)-like 3 (Hu
antigen C)
miR- AF009204 DLGAP2 discs, large P + T cell-cell signaling|membrane|nerve-nerve synaptic
10b (Drosophila) homolog- transmission|neurofilament|protein binding
associated protein 2
miR- NM_001949 E2F3 E2F transcription factor 3 P + T nucleus|protein binding|regulation of cell
10b cycle|regulation of transcription, DNA-
dependent|transcription|transcription factor
activity|transcription factor complex|transcription
initiation from RNA polymerase II promoter
miR- NM_022659 EBF2 early B-cell factor 2 P + T DNA binding|development|nucleus|regulation of
10b transcription, DNA-dependent|transcription
miR- NM_004432 ELAVL2 ELAV (embryonic P + T RNA binding|mRNA 3′-UTR binding|nucleotide
10b lethal, abnormal vision, binding|regulation of transcription, DNA-dependent
Drosophila)-like 2 (Hu
antigen B)
miR- NM_001420 ELAVL3 ELAV (embryonic P + T RNA binding|cell differentiation|mRNA 3′-UTR
10b lethal, abnormal vision, binding|neurogenesis|nucleotide binding
Drosophila)-like 3 (Hu
antigen C)
miR- NM_004438 EPHA4 EphA4 P + T ATP binding|ephrin receptor activity|integral to
10b plasma membrane|membrane|protein amino acid
phosphorylation|receptor activity|signal
transduction|transferase activity|transmembrane
receptor protein tyrosine kinase signaling pathway
miR- AL035703 EPHA8; EphA8 P + T
10b EEK;
HEK3;
Hek3;
KIAA1459
miR- NM_004468 FHL3 four and a half LIM P + T muscle development|zinc ion binding
10b domains 3
miR- NM_024679 FLJ11939 hypothetical protein P + T
10b FLJ11939
miR- AI742838 FLJ32122 hypothetical protein P + T GTP binding|GTPase binding|guanyl-nucleotide
10b FLJ32122 exchange factor activity
miR- AL040935 FLJ33957 hypothetical protein P + T protein binding
10b FLJ33957
miR- AA058828 FLT1 ESTs P + T ATP binding|angiogenesis|cell
10b differentiation|extracellular space|integral to plasma
membrane|membrane|positive regulation of cell
proliferation|pregnancy|protein amino acid
phosphorylation|receptor activity|transferase
activity|transmembrane receptor protein tyrosine
kinase signaling pathway|vascular endothelial growth
factor receptor activity
miR- NM_004860 FXR2 fragile X mental P + T RNA binding|cytoplasm|cytosolic large ribosomal
10b retardation, autosomal subunit (sensu Eukaryota)|nucleus
homolog 2
miR- NM_020474 GALNT1 UDP-N-acetyl-alpha-D- P + T Golgi apparatus|O-linked glycosylation|integral to
10b galactosamine:polypeptide membrane|manganese ion binding|polypeptide N-
N- acetylgalactosaminyltransferase activity|sugar
acetylgalactosaminyl- binding|transferase activity, transferring glycosyl
transferase 1 groups
(GalNAc-T1)
miR- D87811 GATA6 GATA binding protein 6 P + T muscle development|nucleus|positive regulation of
10b transcription|regulation of transcription, DNA-
dependent|transcription|transcription factor
activity|transcriptional activator activity|zinc ion
binding
miR- NM_000840 GRM3 glutamate receptor, P + T G-protein coupled receptor protein signaling
10b metabotropic 3 pathway|integral to plasma
membrane|membrane|metabotropic glutamate,
GABA-B-like receptor activity|negative regulation of
adenylate cyclase activity|receptor activity|signal
transduction|synaptic transmission
miR- NM_005316 GTF2H1 general transcription P + T DNA repair|[RNA-polymerase]-subunit kinase
10b factor IIH, polypeptide activity|general RNA polymerase II transcription
1, 62 kDa factor activity|nucleus|regulation of cyclin dependent
protein kinase activity|regulation of transcription,
DNA-dependent|transcription|transcription factor
TFIIH complex|transcription from RNA polymerase
II promoter
miR- AF232772 HAS3 hyaluronan synthase 3 P + T carbohydrate metabolism|hyaluronan synthase
10b activity|integral to plasma membrane|transferase
activity, transferring glycosyl groups
miR- AL023584 HIVEP2 human P + T
10b immunodeficiency virus
type I enhancer binding
protein 2
miR- S79910 HOXA1 homeo box A1 P + T RNA polymerase II transcription factor
10b activity|development|nucleus|regulation of
transcription, DNA-dependent|transcription factor
activity
miR- NM_030661 HOXA3 homeo box A3 P + T development|nucleus|regulation of transcription,
10b DNA-dependent|transcription factor activity
miR- AW299531 HOXD10 homeo box D10 P + T RNA polymerase II transcription factor
10b activity|development|nucleus|regulation of
transcription, DNA-dependent|transcription factor
activity
miR- BF031714 HYA22 HYA22 protein P + T
10b
miR- NM_001546 ID4 inhibitor of DNA P + T nucleus|regulation of transcription from RNA
10b binding 4, dominant polymerase II promoter|transcription corepressor
negative helix-loop- activity
helix protein
miR- NM_014333 IGSF4 immunoglobulin P + T
10b superfamily, member 4
miR- NM_014271 IL1RAPL1 interleukin 1 receptor P + T integral to membrane|learning and/or
10b accessory protein-like 1 memory|membrane|signal
transduction|transmembrane receptor activity
miR- D87450 KIAA0261 KIAA0261 protein P + T
10b
miR- AL117518 KIAA0978 KIAA0978 protein P + T nucleus|regulation of transcription, DNA-
10b dependent|transcription
miR- AK025960 KIAA1255 KIAA1255 protein P + T endocytosis|endosome membrane|membrane|protein
10b binding|zinc ion binding
miR- AB037797 KIAA1376 KIAA1376 protein P + T
10b
miR- NM_004795 KL klotho P + T beta-glucosidase activity|carbohydrate
10b metabolism|extracellular space|glucosidase
activity|integral to membrane|integral to plasma
membrane|membrane fraction|signal transducer
activity|soluble fraction
miR- NM_015995 KLF13 Kruppel-like factor 13 P + T DNA binding|RNA polymerase II transcription factor
10b activity|nucleus|regulation of transcription, DNA-
dependent|transcription|transcription from RNA
polymerase II promoter|zinc ion binding
miR- NM_004235 KLF4 Kruppel-like factor 4 P + T mesodermal cell fate determination|negative
10b (gut) regulation of cell proliferation|negative regulation of
transcription, DNA-dependent|negative regulation of
transcription, DNA-dependent|nucleic acid
binding|nucleus|transcription|transcription factor
activity|transcription factor activity|transcriptional
activator activity|transcriptional activator
activity|transcriptional repressor
activity|transcriptional repressor activity|zinc ion
binding|zinc ion binding
miR- AW511293 LOC144455 hypothetical protein P + T regulation of cell cycle|regulation of transcription,
10b BC016658 DNA-dependent|transcription factor
activity|transcription factor complex
miR- NM_014921 LPHN1 lectomedin-2 P + T G-protein coupled receptor activity|integral to
10b membrane|latrotoxin receptor
activity|membrane|neuropeptide signaling
pathway|receptor activity|signal transduction|sugar
binding
miR- NM_012325 MAPRE1 microtubule-associated P + T cell proliferation|cytokinesis|microtubule
10b protein, RP/EB family, binding|mitosis|protein C-terminus binding|regulation
member 1 of cell cycle
miR- AA824369 MGC4643 hypothetical protein P + T Wnt receptor signaling pathway|endoplasmic
10b MGC4643 reticulum|ligase activity|signal transduction|ubiquitin
conjugating enzyme activity|ubiquitin cycle|ubiquitin-
dependent protein catabolism
miR- NM_021090 MTMR3 myotubularin related P + T cytoplasm|hydrolase activity|inositol or
10b protein 3 phosphatidylinositol phosphatase
activity|membrane|membrane fraction|phospholipid
dephosphorylation|protein amino acid
dephosphorylation|protein serine/threonine
phosphatase activity|protein tyrosine phosphatase
activity|protein tyrosine/serine/threonine phosphatase
activity|zinc ion binding
miR- AI498126 NAC1 transcriptional repressor P + T protein binding
10b NAC1
miR- AF128458 NCOA6 nuclear receptor P + T DNA recombination|DNA repair|DNA
10b coactivator 6 replication|brain development|chromatin
binding|embryonic development (sensu
Mammalia)|estrogen receptor binding|estrogen
receptor signaling pathway|glucocorticoid receptor
signaling pathway|heart development|ligand-
dependent nuclear receptor transcription coactivator
activity|myeloid blood cell
differentiation|nucleus|nucleus|positive regulation of
transcription from RNA polymerase II
promoter|protein binding|regulation of transcription,
DNA-dependent|response to hormone
stimulus|retinoid X receptor binding|thyroid hormone
receptor binding|transcription|transcription factor
complex|transcription initiation from RNA
polymerase II promoter|transcriptional activator
activity
miR- NM_006312 NCOR2 nuclear receptor co- P + T DNA binding|nucleus|regulation of transcription,
10b repressor 2 DNA-dependent|transcription corepressor activity
miR- NM_006599 NFAT5 nuclear factor of P + T RNA polymerase II transcription factor
10b activated T-cells 5, activity|excretion|nucleus|regulation of transcription,
tonicity-responsive DNA-dependent|signal transduction|transcription
factor activity|transcription from RNA polymerase II
promoter
miR- NM_006981 NR4A3 nuclear receptor M + P + T binding|nucleus|nucleus|regulation of transcription,
10b subfamily 4, group A, DNA-dependent|steroid hormone receptor
member 3 activity|steroid hormone receptor activity|thyroid
hormone receptor activity|transcription|transcription
factor activity
miR- NM_003822 NR5A2 nuclear receptor P + T RNA polymerase II transcription factor activity,
10b subfamily 5, group A, enhancer
member 2 binding|morphogenesis|nucleus|nucleus|regulation of
transcription, DNA-dependent|steroid hormone
receptor activity|transcription|transcription factor
activity|transcription from RNA polymerase II
promoter
miR- AA295257 NRP2 neuropilin 2 P + T angiogenesis|axon guidance|cell adhesion|cell
10b adhesion|cell differentiation|electron transport|electron
transporter activity|integral to membrane|integral to
membrane|membrane|membrane
fraction|neurogenesis|receptor activity|semaphorin
receptor activity|vascular endothelial growth factor
receptor activity|vascular endothelial growth factor
receptor activity
miR- NM_000430 PAFAH1B1 platelet-activating P + T astral microtubule|cell cortex|cell cycle|cell
10b factor acetylhydrolase, differentiation|cell
isoform Ib, alpha motility|cytokinesis|cytoskeleton|dynein
subunit 45 kDa binding|establishment of mitotic spindle
orientation|kinetochore|lipid metabolism|microtubule
associated complex|microtubule-based
process|mitosis|neurogenesis|nuclear membrane|signal
transduction
miR- NM_013382 POMT2 putative protein O- P + T O-linked glycosylation|dolichyl-phosphate-mannose-
10b mannosyltransferase protein mannosyltransferase activity|endoplasmic
reticulum|integral to membrane|magnesium ion
binding|membrane|transferase activity, transferring
glycosyl groups
miR- BF337790 PURB purine-rich element P + T
10b binding protein B
miR- AI302106 RAP2A RAP2A, member of P + T GTP binding|GTPase activity|membrane|signal
10b RAS oncogene family transduction|small GTPase mediated signal
transduction
miR- NM_002886 RAP2B RAP2B, member of P + T GTP binding|protein transport|small GTPase mediated
10b RAS oncogene family signal transduction
miR- NM_014781 RB1CC1 RB1-inducible coiled- P + T kinase activity
10b coil 1
miR- NM_012234 RYBP RING1 and YY1 P + T development|negative regulation of transcription from
10b binding protein RNA polymerase II promoter|nucleus|transcription
corepressor activity
miR- NM_005506 SCARB2 scavenger receptor class P + T cell adhesion|integral to plasma membrane|lysosomal
10b B, member 2 membrane|membrane fraction|receptor activity
miR- AF225986 SCN3A sodium channel, P + T cation channel activity|cation transport|integral to
10b voltage-gated, type III, membrane|membrane|sodium ion transport|voltage-
alpha polypeptide gated sodium channel activity|voltage-gated sodium
channel complex
miR- NM_002997 SDC1 syndecan 1 P + T cytoskeletal protein binding|integral to plasma
10b membrane|membrane
miR- NM_006924 SFRS1 splicing factor, P + T RNA binding|mRNA splice site selection|nuclear
10b arginine/serine-rich 1 mRNA splicing, via spliceosome|nucleotide
(splicing factor 2, binding|nucleus
alternate splicing factor)
miR- AI809967 SHC1 SHC (Src homology 2 P + T activation of MAPK|activation of MAPK|intracellular
10b domain containing) signaling cascade|phospholipid binding|phospholipid
transforming protein 1 binding|plasma membrane|plasma membrane|positive
regulation of cell proliferation|positive regulation of
cell proliferation|positive regulation of
mitosis|positive regulation of mitosis|regulation of cell
growth|regulation of epidermal growth factor receptor
activity|transmembrane receptor protein tyrosine
kinase adaptor protein activity|transmembrane
receptor protein tyrosine kinase adaptor protein
activity
miR- NM_018976 SLC38A solute carrier family 38, P + T amino acid transport|amino acid-polyamine
10b member 2 transporter activity|integral to
membrane|membrane|oxygen transport|oxygen
transporter activity|transport
miR- NM_003794 SNX4 sorting nexin 4 P + T endocytosis|intracellular signaling cascade|protein
10b transport
miR- NM_003103 SON SON DNA binding P + T DNA binding|DNA binding|anti-apoptosis|double-
10b protein stranded RNA binding|intracellular|nucleic acid
binding|nucleus
miR- Z48199 syndecan-1 P + T
10b
miR- NM_003222 TFAP2C transcription factor AP- P + T cell-cell signaling|nucleus|regulation of transcription
10b 2 gamma (activating from RNA polymerase II
enhancer binding promoter|transcription|transcription factor activity
protein 2 gamma)
miR- NM_003275 TMOD1 tropomodulin P + T actin binding|cytoskeleton|cytoskeleton organization
10b and biogenesis|tropomyosin binding
miR- NM_003367 USF2 upstream transcription P + T RNA polymerase II transcription factor
10b factor 2, c-fos activity|nucleus|regulation of transcription, DNA-
interacting dependent|transcription|transcription factor activity
miR- N62196 ZNF367 zinc finger protein 367 P + T nucleic acid binding|nucleus|zinc ion binding
10b
miR- AI948503 ABCC4 ATP-binding cassette, P + T 15-hydroxyprostaglandin dehydrogenase (NAD+)
125b sub-family C activity|ATP binding|ATPase activity|ATPase
(CFTR/MRP), member 4 activity, coupled to transmembrane movement of
substances|chloride channel activity|integral to
membrane|ion transport|membrane
miR- AL534702 ABHD3 abhydrolase domain M + P + T
125b containing 3
miR- AL527773 ABR active BCR-related P + T GTPase activator activity|guanyl-nucleotide exchange
125b gene factor activity|small GTPase mediated signal
transduction
miR- NM_020039 ACCN2 amiloride-sensitive P + T amiloride-sensitive sodium channel activity|integral to
125b cation channel 2, plasma membrane|ion channel activity|ion
neuronal transport|membrane|response to pH|signal
transduction|sodium ion transport
miR- NM_003816 ADAM9 a disintegrin and P + T SH3 domain binding|integral to plasma
125b metalloproteinase membrane|integrin binding|metalloendopeptidase
domain 9 (meltrin activity|protein binding|protein kinase binding|protein
gamma) kinase cascade|proteolysis and peptidolysis|zinc ion
binding
miR- L05500 ADCY1 adenylate cyclase 1 P + T cAMP biosynthesis|calcium- and calmodulin-
125b (brain) responsive adenylate cyclase activity|calmodulin
binding|integral to membrane|intracellular signaling
cascade|magnesium ion binding
miR- NM_017488 ADD2 adducin 2 (beta) P + T actin binding|actin cytoskeleton|calmodulin
125b binding|membrane
miR- NM_003488 AKAP1 A kinase (PRKA) P + T RNA binding|integral to
125b anchor protein 1 membrane|mitochondrion|outer membrane
miR- NM_005465 AKT3 v-akt murine thymoma P + T ATP binding|protein amino acid
125b viral oncogene homolog phosphorylation|protein serine/threonine kinase
3 (protein kinase B, activity|signal transduction|transferase activity
gamma)
miR- NM_001150 ANPEP alanyl (membrane) P + T aminopeptidase activity|angiogenesis|cell
125b aminopeptidase differentiation|integral to plasma
(aminopeptidase N, membrane|membrane alanyl aminopeptidase
aminopeptidase M, activity|metallopeptidase activity|proteolysis and
microsomal peptidolysis|receptor activity|zinc ion binding
aminopeptidase, CD13,
p150)
miR- AF193759 APBA2BP amyloid beta (A4) M + P + T Golgi cis cisterna|Golgi cis cisterna|antibiotic
125b precursor protein- biosynthesis|calcium ion
binding, family A, binding|cytoplasm|cytoplasm|endoplasmic reticulum
member 2 binding membrane|endoplasmic reticulum
protein membrane|nucleus|oxidoreductase activity|protein
binding|protein binding|protein binding|protein
metabolism|protein metabolism|protein
secretion|protein secretion|regulation of amyloid
precursor protein biosynthesis
miR- NM_000038 APC adenomatosis polyposis P + T Wnt receptor signaling pathway|beta-catenin
125b coli binding|cell adhesion|microtubule binding|negative
regulation of cell cycle|protein complex
assembly|signal transduction
miR- NM_001655 ARCN1 archain 1 P + T COPI vesicle coat|Golgi apparatus|clathrin vesicle
125b coat|intra-Golgi transport|intracellular protein
transport|intracellular protein
transport|membrane|retrograde transport, Golgi to
ER|transport
miR- BC001719 ASB6 ankyrin repeat and M + P intracellular signaling cascade
125b SOCS box-containing 6
miR- AI478147 ATP10D ATPase, Class V, type P + T ATP binding|ATPase activity|cation
125b 10D transport|hydrolase activity|integral to
membrane|magnesium ion
binding|membrane|phospholipid-translocating ATPase
activity
miR- NM_012069 ATP1B4 ATPase, (Na+)/K+ P + T hydrogen ion transporter activity|integral to plasma
125b transporting, beta 4 membrane|ion transport|membrane|potassium ion
polypeptide transport|proton transport|sodium ion
transport|sodium:potassium-exchanging ATPase
activity
miR- NM_005176 ATP5G2 ATP synthase, H+ M + P + T ATP synthesis coupled proton transport|hydrogen-
125b transporting, transporting ATP synthase activity, rotational
mitochondrial F0 mechanism|hydrogen-transporting ATPase activity,
complex, subunit c rotational mechanismlion transport|lipid
(subunit 9), isoform 2 binding|membrane|membrane
fraction|mitochondrion|proton transport|proton-
transporting ATP synthase complex (sensu
Eukaryota)|proton-transporting two-sector ATPase
complex|transporter activity
miR- NM_001702 BAI1 brain-specific M + P + T G-protein coupled receptor
125b angiogenesis inhibitor 1 activity|axonogenesis|brain-specific angiogenesis
inhibitor activity|cell adhesion|integral to plasma
membrane|intercellular junction|negative regulation of
cell proliferation|neuropeptide signaling
pathway|peripheral nervous system
development|plasma membrane|protein
binding|receptor activity|signal transduction
miR- NM_001188 BAK1 BCL2-antagonist/killer 1 M + T apoptotic mitochondrial changes|induction of
125b apoptosis|integral to membrane|protein
heterodimerization activity|regulation of apoptosis
miR- NM_013449 BAZ2A bromodomain adjacent P + T DNA binding|chromatin remodeling|nucleolus
125b to zinc finger domain, organizer complex|nucleus|regulation of transcription,
2A DNA-dependent|transcription|transcription regulator
activity
miR- NM_004634 BRPF1 bromodomain and PHD M + P + T DNA binding|nucleus|nucleus|regulation of
125b finger containing, 1 transcription, DNA-dependent|transcription|zinc ion
binding
miR- NM_003458 BSN bassoon (presynaptic P + T cytoskeleton|metal ion binding|nucleus|structural
125b cytomatrix protein) constituent of cytoskeleton|synapse|synaptic
transmission|synaptosome
miR- NM_018108 C14orf130 hypothetical protein P + T ubiquitin cycle|ubiquitin-protein ligase activity
125b FLJ10483
miR- AA025877 C20orf136 chromosome 20 open P + T
125b reading frame 136
miR- AB054985 CACNB1 calcium channel, M + P + T calcium ion transport|ion transport|membrane
125b voltage-dependent, beta fraction|muscle contraction|voltage-gated calcium
1 subunit channel activity|voltage-gated calcium channel
complex
miR- NM_001224 CASP2 caspase 2, apoptosis- P + T anti-apoptosis|apoptotic program|caspase
125b related cysteine activity|caspase activity|caspase activity|cysteine-type
protease (neural peptidase activity|enzyme binding|intracellular|protein
precursor cell binding|proteolysis and peptidolysis|proteolysis and
expressed, peptidolysis|regulation of apoptosis
developmentally down-
regulated 2)
miR- NM_001755 CBFB core-binding factor, M + P + T RNA polymerase II transcription factor
125b beta subunit activity|nucleus|transcription coactivator
activity|transcription factor activity|transcription from
RNA polymerase II promoter
miR- AV648364 CBX7 ESTs, Highly similar to P + T chromatin|chromatin assembly or
125b potassium voltage-gated disassembly|chromatin binding|chromatin
channel, Isk-related modification|nucleus|regulation of transcription,
subfamily, gene 4; DNA-dependent|transcription
potassium voltage-gated
channel-like protein,
Isk-related subfamily
[Homo sapiens]
[H. sapiens]
miR- NM_001408 CELSR2 cadherin, EGF LAG M + P + T G-protein coupled receptor activity|calcium ion
125b seven-pass G-type binding|cell adhesion|development|homophilic cell
receptor 2 (flamingo adhesion|integral to
homolog, Drosophila) membrane|membrane|neuropeptide signaling
pathway|receptor activity|signal
transduction|structural molecule activity
miR- NM_015955 CGI-27 C21orf19-like protein P + T
125b
miR- AF263462 CGN cingulin P + T actin binding|biological_process unknown|motor
125b activity|myosin|protein binding|tight junction
miR- AF064491 CLIM2 LIM domain binding 1 P + T LIM domain
125b binding|development|development|negative regulation
of transcription, DNA-dependent|nucleus|transcription
cofactor activity|transcriptional repressor activity
miR- AU152178 CMG2 capillary P + T integral to membrane|receptor activity
125b morphogenesis protein 2
miR- NM_004073 CNK cytokine-inducible P + T ATP binding|protein amino acid
125b kinase phosphorylation|protein binding|protein
serine/threonine kinase activity|regulation of cell
cycle|transferase activity
miR- NM_020348 CNNM1 cyclin M1 M + P + T fatty acid biosynthesis
125b
miR- NM_022730 COPS7B COP9 constitutive M + P + T signalosome complex
125b photomorphogenic
homolog subunit 7B
(Arabidopsis)
miR- NM_003389 CORO2A coronin, actin binding P + T actin binding|glutamate-ammonia ligase
125b protein, 2A activity|glutamine biosynthesis|intracellular signaling
cascade|nitrogen compound metabolism|protein
binding
miR- BF939649 CORO2B coronin, actin binding P + T actin binding|actin cytoskeleton|actin cytoskeleton
125b protein, 2B organization and biogenesis|membrane
miR- NM_007007 CPSF6 cleavage and P + T RNA binding|mRNA processing|nucleic acid
125b polyadenylation binding|nucleotide binding|nucleus
specific factor 6, 68 kDa
miR- NM_004386 CSPG3 chondroitin sulfate P + T calcium ion binding|cell adhesion|cell
125b proteoglycan 3 motility|hyaluronic acid binding|sugar binding
(neurocan)
miR- NM_004393 DAG1 dystroglycan 1 M + P + T actin cytoskeleton|calcium ion binding|extracellular
125b (dystrophin-associated matrix (sensu Metazoa)|integral to plasma
glycoprotein 1) membrane|laminin receptor activity|membrane
fraction|muscle contraction|plasma membrane|protein
binding|protein complex assembly
miR- NM_014764 DAZAP2 DAZ associated protein 2 P + T
125b
miR- NM_030927 DC- tetraspanin similar to P + T integral to membrane
125b TM4F2 TM4SF9
miR- NM_004082 DCTN1 dynactin 1 (p150, glued M + P + T cytoplasm|cytoskeleton|dynein complex|mitosis|motor
125b homolog, Drosophila) activity|neurogenesis
miR- NM_030621 DICER1 Dicer1, Dcr-1 homolog P + T ATP binding|ATP-dependent helicase activity|RNA
125b (Drosophila) interference, targeting of mRNA for destruction|RNA
processing|double-stranded RNA
binding|endonuclease activity|hydrolase
activity|intracellular|ribonuclease III activity
miR- U53506 DIO2 deiodinase, P + T integral to membrane|membrane|selenium
125b iodothyronine, type II binding|selenocysteine incorporation|thyroid hormone
generation|thyroxine 5′-deiodinase activity|thyroxine
5′-deiodinase activity
miR- AL136139 dJ761I2.1 P + T
125b
miR- AL357503 dJ899C14.1 Q9H4T4 like P + T
125b
miR- AL117482 DKFZP434C131 DKFZP434C131 P + T ATP binding|protein amino acid
125b protein phosphorylation|protein serine/threonine kinase
activity|protein-tyrosine kinase activity|transferase
activity
miR- AK023580 DKFZP434H0820 hypothetical protein P + T
125b DKFZp434H0820
miR- T16388 DKFZp564A176 hypothetical protein P + T development|integral to membrane|membrane|receptor
125b DKFZp564A176 activity|semaphorin receptor activity
miR- AL137517 DKFZp564O1278 hypothetical protein P + T integral to membrane
125b DKFZp564O1278
miR- BE781961 DKFZp762A2013 hypothetical protein P + T electron transport|electron transporter activity
125b DKFZp762A2013
miR- AB036931 DLL4 delta-like 4 M + P + T Notch binding|Notch signaling pathway|cell
125b (Drosophila) differentiation|circulation|integral to
membrane|membrane|signal transduction
miR- NM_012266 DNAJB5 DnaJ (Hsp40) homolog, P + T heat shock protein binding|protein folding|response to
125b subfamily B, member 5 unfolded protein|unfolded protein binding
miR- NM_005740 DNAL4 dynein, axonemal, light P + T ATPase activity, coupled|axonemal dynein
125b polypeptide 4 complex|microtubule motor activity|microtubule-
based movement
miR- BF593175 DOCK3 dedicator of cyto- P + T GTP binding|GTPase binding|guanyl-nucleotide
125b kinesis 3 exchange factor activity
miR- NM_006426 DPYSL4 dihydropyrimidinase- P + T hydrolase activity|neurogenesis
125b like 4
miR- NM_006465 DRIL2 dead ringer P + T DNA binding|biological_process unknown|nucleus
125b (Drosophila)-like 2
(bright and dead ringer)
miR- BC005047 DUSP6 dual specificity P + T MAP kinase phosphatase activity|cytoplasm|hydrolase
125b phosphatase 6 activity|inactivation of MAPK|protein amino acid
dephosphorylation|protein serine/threonine
phosphatase activity|protein tyrosine phosphatase
activity|regulation of cell cycle|soluble fraction
miR- NM_004423 DVL3 dishevelled, dsh P + T development|frizzled signaling pathway|heart
125b homolog 3 (Drosophila) development|intracellular|intracellular signaling
cascade|kinase activity|neurogenesis|protein
binding|signal transducer activity
miR- NM_001949 E2F3 E2F transcription factor 3 P + T nucleus|protein binding|regulation of cell
125b cycle|regulation of transcription, DNA-
dependent|transcription|transcription factor
activity|transcription factor complex|transcription
initiation from RNA polymerase II promoter
miR- AU149385 EAF1 Homo sapiens cDNA P + T
125b FLJ13155 fis, clone
NT2RP3003433,
mRNA sequence
miR- NM_014674 EDEM KIAA0212 gene P + T ER-associated protein catabolism|GTP binding|N-
125b product linked glycosylation|calcium ion binding|endoplasmic
reticulum|integral to endoplasmic reticulum
membrane|integral to membrane|mannosyl-
oligosaccharide 1,2-alpha-mannosidase
activity|membrane|protein binding|response to
unfolded protein
miR- NM_001955 EDN1 endothelin 1 M + P + T cell-cell signaling|extracellular space|hormone
125b activity|pathogenesis|positive regulation of cell
proliferation|regulation of blood pressure|regulation of
vasoconstriction|signal transduction|soluble fraction
miR- AI832074 EIF2C2 eukaryotic translation M + P cellular_component unknown|protein
125b initiation factor 2C, 2 biosynthesis|translation initiation factor activity
miR- AB044548 EIF4EBP1 eukaryotic translation P + T eukaryotic initiation factor 4E binding|negative
125b initiation factor 4E regulation of protein biosynthesis|negative regulation
binding protein 1 of translational initiation|regulation of translation
miR- NM_020390 EIF5A2 eukaryotic translation P + T DNA binding|protein biosynthesis|translation
125b initiation factor 5A2 initiation factor activity|translational initiation
miR- NM_004438 EPHA4 EphA4 P + T ATP binding|ephrin receptor activity|integral to
125b plasma membrane|membrane|protein amino acid
phosphorylation|receptor activity|signal
transduction|transferase activity|transmembrane
receptor protein tyrosine kinase signaling pathway
miR- NM_004451 ESRRA estrogen-related P + T nucleus|regulation of transcription, DNA-
125b receptor alpha dependent|steroid binding|steroid hormone receptor
activity|transcription|transcription factor activity
miR- NM_004907 ETR101 immediate early protein P + T
125b
miR- NM_005238 ETS1 v-ets erythroblastosis P + T RNA polymerase II transcription factor
125b virus E26 oncogene activity|immune response|negative regulation of cell
homolog 1 (avian) proliferation|nucleus|regulation of transcription,
DNA-dependent|transcription|transcription factor
activity|transcription from RNA polymerase II
promoter
miR- NM_001987 ETV6 ets variant gene 6 (TEL P + T nucleus|regulation of transcription, DNA-
125b oncogene) dependent|transcription|transcription factor activity
miR- NM_022763 FAD104 FAD104 P + T
125b
miR- AF308300 FAPP2 phosphoinositol 4- P + T
125b phosphate adaptor
protein-2
miR- NM_022976 FGFR2 fibroblast growth factor M + P + T ATP binding|cell growth|fibroblast growth factor
125b receptor 2 (bacteria- receptor activity|heparin binding|integral to
expressed kinase, membrane|membrane|protein amino acid
keratinocyte growth phosphorylation|protein amino acid
factor receptor, phosphorylation|protein serine/threonine kinase
craniofacial dysostosis activity|protein-tyrosine kinase activity|protein-
1, Crouzon syndrome, tyrosine kinase activity|receptor activity|transferase
Pfeiffer syndrome, activity
Jackson-Weiss
syndrome)
miR- NM_004470 FKBP2 FK506 binding protein P + T FK506 binding|endoplasmic reticulum|isomerase
125b 2, 13 kDa activity|peptidyl-prolyl cis-trans isomerase
activity|protein folding
miR- AL160175 FKHL18 forkhead-like 18 P + T
125b (Drosophila)
miR- BF515132 FLJ00024 hypothetical protein P + T
125b FLJ00024
miR- BC002945 FLJ10101 hypothetical protein M + P GTP binding|protein transport|small GTPase mediated
125b FLJ10101 signal transduction
miR- NM_018243 FLJ10849 hypothetical protein P + T GTP binding|cell cycle|cytokinesis
125b FLJ10849
miR- NM_019084 FLJ10895 hypothetical protein P + T nucleus|regulation of cell cycle
125b FLJ10895
miR- NM_018320 FLJ11099 hypothetical protein P + T protein ubiquitination|ubiquitin ligase
125b FLJ11099 complex|ubiquitin-protein ligase activity|zinc ion
binding
miR- NM_018375 FLJ11274 hypothetical protein M + P + T membrane|metal ion transport|metal ion transporter
125b FLJ11274 activity
miR- NM_024954 FLJ11807 hypothetical protein P + T protein modification
125b FLJ11807
miR- BF434995 FLJ14708 hypothetical protein P + T
125b FLJ14708
miR- NM_018992 FLJ20040 hypothetical protein P + T membrane|potassium ion transport|protein
125b FLJ20040 binding|voltage-gated potassium channel
activity|voltage-gated potassium channel complex
miR- NM_017911 FLJ20635 hypothetical protein P + T
125b FLJ20635
miR- NM_017936 FLJ2070 hypothetical protein M + P + T ATP synthesis coupled proton
125b FLJ20707 transport|cytoplasm|hydrogen-transporting ATP
synthase activity, rotational mechanism|hydrogen-
transporting ATPase activity, rotational
mechanism|membrane|phosphate transport|proton-
transporting two-sector ATPase complex
miR- NM_024789 FLJ22529 hypothetical protein P + T
125b FLJ22529
miR- AA721230 FLJ25604 hypothetical protein P + T guanyl-nucleotide exchange factor activity|small
125b FLJ25604 GTPase mediated signal transduction
miR- AI677701 FLJ30829 hypothetical protein P + T nucleic acid binding|nucleotide binding
125b FLJ30829
miR- NM_004475 FLOT2 flotillin 2 M + P + T cell adhesion|epidermis development|flotillin
125b complex|integral to membrane|plasma
membrane|protein binding
miR- AA830884 FMR1 fragile X mental M + T mRNA binding|mRNA processing|mRNA-nucleus
125b retardation 1 export|nucleoplasm|polysome|ribosome|soluble
fraction|transport
miR- AF305083 FUT4 fucosyltransferase 4 P + T Golgi apparatus|L-fucose catabolism|alpha(1,3)-
125b (alpha (1,3) fucosyltransferase activity|carbohydrate
fucosyltransferase, metabolism|integral to
myeloid-specific) membrane|membrane|membrane fraction|protein
amino acid glycosylation|transferase activity,
transferring glycosyl groups
miR- X92762 G4.5 tafazzin M + P + T acyltransferase activity|heart development|integral to
125b (cardiomyopathy, membrane|metabolism|muscle contraction|muscle
dilated 3A (X-linked); development
endocardial
fibroelastosis 2; Barth
syndrome)
miR- NM_012296 GAB2 GRB2-associated P + T
125b binding protein 2
miR- NM_015044 GGA2 golgi associated, M + T ADP-ribosylation factor binding|Golgi stack|Golgi
125b gamma adaptin ear trans face|clathrin coat of trans-Golgi network
containing, ARF vesicle|intra-Golgi transport|intracellular protein
binding protein 2 transport|intracellular protein
transport|membrane|protein complex assembly|protein
transporter activity
miR- AL049709 GGTL3 gamma- M + P + T
125b glutamyltransferase-like 3
miR- NM_000165 GJA1 gap junction protein, P + T cell-cell signaling|connexon channel
125b alpha 1, 43 kDa activity|connexon complex|gap junction
(connexin 43) assembly|heart development|integral to plasma
membrane|ion transporter activity|muscle
contraction|perception of sound|positive regulation of
I-kappaB kinase/NF-kappaB cascade|protein
binding|signal transducer activity|transport
miR- NM_014905 GLS glutaminase P + T glutaminase activity|glutamine catabolism|hydrolase
125b activity|mitochondrion
miR- NM_005113 GOLGA5 golgi autoantigen, P + T ATP binding|Golgi membrane|cell surface receptor
125b golgin subfamily a, 5 linked signal transduction|integral to plasma
membrane|protein amino acid
phosphorylation|protein-tyrosine kinase activity
miR- NM_001448 GPC4 glypican 4 M + P + T cell proliferation|extracellular matrix (sensu
125b Metazoa)|integral to plasma
membrane|membrane|morphogenesis
miR- NM_005296 GPR23 G protein-coupled M + T G-protein coupled receptor protein signaling
125b receptor 23 pathway|integral to plasma membrane|purinergic
nucleotide receptor activity, G-protein
coupled|receptor activity|rhodopsin-like receptor
activity|signal transduction
miR- U66065 GRB10 growth factor receptor- M + T SH3/SH2 adaptor activity|cell-cell
125b bound protein 10 signaling|cytoplasm|insulin receptor signaling
pathway|intracellular signaling cascade|plasma
membrane
miR- NM_021643 GS3955 GS3955 protein P + T ATP binding|protein amino acid
125b phosphorylation|protein kinase activity|transferase
activity
miR- NM_019096 GTPBP2 GTP binding protein 2 M + T GTP binding|GTPase activity|protein
125b biosynthesis|small GTPase mediated signal
transduction
miR- U78181 hBNaC2 amiloride-sensitive P + T amiloride-sensitive sodium channel activity|integral to
125b cation channel 2, plasma membrane|ion channel activity|ion
neuronal transport|membrane|response to pH|signal
transduction|sodium ion transport
miR- NM_005477 HCN4 hyperpolarization P + T 3′,5′-cAMP binding|cation channel activity|cation
125b activated cyclic transport|circulation|integral to plasma
nucleotide-gated membrane|membrane|membrane fraction|muscle
potassium channel 4 contraction|nucleotide binding|potassium ion
transport|sodium ion transport|voltage-gated
potassium channel activity
miR- NM_002112 HDC histidine decarboxylase P + T amino acid metabolism|catecholamine
125b biosynthesis|histidine decarboxylase activity|histidine
metabolism|lyase activity
miR- U64317 HEF1 enhancer of P + T actin filament bundle formation|cell adhesion|
125b filamentation 1 (cas-like cytokinesis|cytoplasm|cytoskeleton|cytoskeleton
docking; Crk-associated organization and biogenesis|integrin-mediated
substrate related) signaling pathway|mitosis|nucleus|protein
binding|regulation of cell cycle|regulation of cell
growth|signal transduction|spindle
miR- L38487 hERRa estrogen-related P + T nucleus|regulation of transcription, DNA-
125b receptor alpha dependent|steroid binding|steroid hormone receptor
activity|transcription|transcription factor activity
miR- AB028943 HIC2 hypermethylated in P + T DNA binding|negative regulation of transcription,
125b cancer 2 DNA-dependent|nucleus|protein C-terminus
binding|transcription|zinc ion binding
miR- AL023584 HIVEP2 human P + T
125b immunodeficiency virus
type I enhancer binding
protein 2
miR- AL023584 HIVEP2 human P + T
125b immunodeficiency virus
type I enhancer binding
protein 2
miR- NM_005342 HMGB3 high-mobility group P + T DNA bending activity|DNA
125b box 3 binding|chromatin|development|nucleus|regulation of
transcription, DNA-dependent
miR- AL031295 HMGCL; lysophospholipase II M + P + T
125b HL
miR- NM_004503 HOXC6 homeo box C6 P + T development|development|nucleus|regulation of
125b transcription from RNA polymerase II
promoter|regulation of transcription, DNA-
dependent|transcription corepressor
activity|transcription factor activity
miR- AA844682 HRD1 HRD1 protein P + T protein ubiquitination|ubiquitin ligase
125b complex|ubiquitin-protein ligase activity|zinc ion
binding
miR- AL136667 HSPC039 HSPC039 protein P + T integral to membrane
125b
miR- AF245044 HT023 hypothetical protein P + T
125b HT023
miR- U13022 Ich-1 caspase 2, apoptosis- P + T anti-apoptosis|apoptotic program|caspase
125b related cysteine activity|caspase activity|caspase activity|cysteine-type
protease (neural peptidase activity|enzyme binding|intracellular|protein
precursor cell binding|proteolysis and peptidolysis|proteolysis and
expressed, peptidolysis|regulation of apoptosis
developmentally down-
regulated 2)
miR- NM_004513 IL16 interleukin 16 M + P + T chemotaxis|cytokine activity|extracellular
125b (lymphocyte space|immune response|protein binding|sensory
chemoattractant factor) perception
miR- NM_002460 IRF4 interferon regulatory P + T RNA polymerase II transcription factor activity|T-cell
125b factor 4 activation|T-cell
activation|nucleus|nucleus|nucleus|positive regulation
of interleukin-10 biosynthesis|positive regulation of
interleukin-10 biosynthesis|positive regulation of
interleukin-13 biosynthesis|positive regulation of
interleukin-13 biosynthesis|positive regulation of
interleukin-2 biosynthesis|positive regulation of
interleukin-2 biosynthesis|positive regulation of
interleukin-4 biosynthesis|positive regulation of
interleukin-4 biosynthesis|positive regulation of
transcription|positive regulation of
transcription|regulation of T-helper cell
differentiation|regulation of T-helper cell
differentiation|regulation of transcription, DNA-
dependent|regulation of transcription, DNA-
dependent|transcription|transcription factor
activity|transcription factor activity|transcription
factor binding|transcription factor
binding|transcriptional activator
activity|transcriptional activator activity
miR- NM_002207 ITGA9 integrin, alpha 9 P + T cell-matrix adhesion|integral to membrane|integrin
125b complex|integrin-mediated signaling pathway|protein
binding|receptor activity
miR- NM_000212 ITGB3 integrin, beta 3 (platelet P + T blood coagulation|cell-matrix adhesion|integrin
125b glycoprotein IIIa, complex|integrin-mediated signaling pathway|protein
antigen CD61) binding|receptor activity
miR- NM_021991 JUP junction plakoglobin P + T cell adhesion|cell adhesion|cytoplasm|cytoskeletal
125b protein binding|cytoskeleton|cytoskeleton|membrane
fraction|mitotic chromosome condensation|protein
binding|soluble fraction|structural molecule activity
miR- AF032897 KCNH7 potassium voltage-gated P + T cation transport|integral to
125b channel, subfamily H membrane|membrane|potassium ion
(eag-related), member 7 transport|regulation of transcription, DNA-
dependent|signal transducer activity|signal
transduction|voltage-gated potassium channel activity
miR- NM_002252 KCNS3 potassium voltage-gated M + P + T cation transport|delayed rectifier potassium channel
125b channel, delayed- activity|membrane|membrane fraction|potassium
rectifier, subfamily S, channel regulator activity|potassium ion
member 3 transport|protein binding|voltage-gated potassium
channel complex
miR- NM_014735 KIAA0215 KIAA0215 gene P + T DNA binding|regulation of transcription, DNA-
125b product dependent
miR- NM_015288 KIAA0239 KIAA0239 protein P + T DNA binding|regulation of transcription, DNA-
125b dependent
miR- D87469 KIAA0279 cadherin, EGF LAG M + P + T G-protein coupled receptor activity|calcium ion
125b seven-pass G-type binding|cell adhesion|development|homophilic cell
receptor 2 (flamingo adhesion|integral to
homolog, Drosophila) membrane|membrane|neuropeptide signaling
pathway|receptor activity|signal
transduction|structural molecule activity
miR- AB002356 KIAA0358 MAP-kinase activating P + T cell surface receptor linked signal
125b death domain transduction|cytoplasm|death receptor binding|kinase
activity|plasma membrane|protein kinase activator
activity
miR- NM_014871 KIAA0710 KIAA0710 gene P + T cysteine-type endopeptidase activity|exonuclease
125b product activity|nucleus|ubiquitin cycle|ubiquitin thiolesterase
activity|ubiquitin-dependent protein catabolism
miR- AB 018333 KIAA0790 KIAA0790 protein P + T cell cycle|negative regulation of cell cycle
125b
miR- NM_014912 KIAA0940 KIAA0940 protein P + T nucleic acid binding
125b
miR- AB028957 KIAA1034 KIAA1034 protein P + T DNA binding|nucleus|regulation of transcription,
125b DNA-dependent|transcription factor activity
miR- NM_014901 KIAA1100 KIAA1100 protein M + P + T protein ubiquitination|ubiquitin ligase
125b complex|ubiquitin-protein ligase activity|zinc ion
binding
miR- AB033016 KIAA1190 hypothetical protein P + T DNA binding|nucleic acid binding|nucleus|protein
125b KIAA1190 binding|regulation of transcription, DNA-
dependent|zinc ion binding
miR- AA056548 KIAA1268 KIAA1268 protein P + T NAD + ADP-ribosyltransferase
125b activity|nucleus|protein amino acid ADP-ribosylation
miR- BE670098 KIAA1594 KIAA1594 protein M + P + T cysteine-type endopeptidase activity|ubiquitin
125b cycle|ubiquitin thiolesterase activity|ubiquitin-
dependent protein catabolism
miR- AU157109 KIAA1598 KIAA1598 protein P + T
125b
miR- AA772278 KIAA1673 KIAA1673 P + T
125b
miR- NM_015995 KLF13 Kruppel-like factor 13 P + T DNA binding|RNA polymerase II transcription factor
125b activity|nucleus|regulation of transcription, DNA-
dependent|transcription|transcription from RNA
polymerase II promoter|zinc ion binding
miR- NM_016531 KLF3 Kruppel-like factor 3 P + T development|negative regulation of transcription from
125b (basic) RNA polymerase II promoter|nucleus|regulation of
transcription, DNA-
dependent|transcription|transcription factor
activity|zinc ion binding
miR- BE892574 LACTB lactamase, beta P + T hydrolase activity|integral to membrane|response to
125b antibiotic
miR- BE566136 LBP-32 LBP protein 32 P + T
125b
miR- NM_024090 LCE long-chain fatty-acyl P + T integral to membrane
125b elongase
miR- NM_003893 LDB1 LIM domain binding 1 P + T LIM domain
125b binding|development|development|negative regulation
of transcription, DNA-dependent|nucleus|transcription
cofactor activity|transcriptional repressor activity
miR- U94354 LFNG lunatic fringe homolog M + T Golgi apparatus|development|extracellular
125b (Drosophila) region|integral to
membrane|membrane|organogenesis|transferase
activity, transferring glycosyl groups
miR- NM_002310 LIFR leukemia inhibitory M + P + T cell surface receptor linked signal
125b factor receptor transduction|integral to plasma membrane|leukemia
inhibitory factor receptor activity|membrane|receptor
activity
miR- NM_016339 Link- Link guanine nucleotide P + T G-protein coupled receptor protein signaling
125b GEFII exchange factor II pathway|guanyl-nucleotide exchange factor
activity|membrane fraction|neurogenesis|small
GTPase mediated signal transduction
miR- NM_005575 LNPEP leucyl/cystinyl P + T aminopeptidase activity|cell-cell signaling|integral to
125b aminopeptidase plasma membrane|membrane alanyl aminopeptidase
activity|metallopeptidase activity|plasma
membrane|pregnancy|proteolysis and peptidolysis|zinc
ion binding
miR- AL031186 LOC129080 putative emu1 P + T
125b
miR- AI884701 LOC221002 CG4853 gene product M + P guanyl-nucleotide exchange factor activity|small
125b GTPase mediated signal transduction
miR- AI953847 LOC255488 Homo sapiens mRNA P + T electron transport|electron transporter activity|integral
125b full length insert cDNA to membrane|iron ion binding|ligase activity|protein
clone EUROIMAGE binding|protein ubiquitination during ubiquitin-
186647, mRNA dependent protein catabolism|ubiquitin ligase
sequence complex|ubiquitin-protein ligase activity|zinc ion
binding
miR- NM_015899 LOC51054 putative glycolipid P + T
125b transfer protein
miR- AA209239 LOC57406 lipase protein P + T aromatic compound metabolism|hydrolase
125b activity|response to toxin|xenobiotic metabolism
miR- NM_005576 LOXL1 lysyl oxidase-like 1 M + P + T copper ion binding|electron transporter
125b activity|extracellular region|oxidoreductase
activity|protein modification|protein-lysine 6-oxidase
activity
miR- AA584297 LRP4 low density lipoprotein M + T calcium ion binding|endocytosis|integral to
125b receptor-related protein 4 membrane|membrane|receptor activity
miR- NM_007260 LYPLA2 lysophospholipase II M + P + T fatty acid metabolism|hydrolase activity|lipid
125b metabolism
miR- NM_004901 LYSAL1 lysosomal apyrase-like 1 P + T Golgi apparatus|UDP catabolism|apyrase
125b activity|hydrolase activity|integral to Golgi
membrane|integral to membrane|lysosome|magnesium
ion binding|nucleobase, nucleoside, nucleotide and
nucleic acid metabolism|uridine-diphosphatase
activity|vacuolar membrane
miR- NM_002355 M6PR mannose-6-phosphate M + P + T endosome to lysosome transport|integral to plasma
125b receptor (cation membrane|lysosome|receptor mediated
dependent) endocytosis|transmembrane receptor
activity|transport|transporter activity
miR- AB002356 MADD MAP-kinase activating P + T cell surface receptor linked signal
125b death domain transduction|cytoplasm|death receptor binding|kinase
activity|plasma membrane|protein kinase activator
activity
miR- NM_016219 MAN1B1 mannosidase, alpha, P + T N-linked glycosylation|N-linked
125b class 1B, member 1 glycosylation|calcium ion binding|calcium ion
binding|carbohydrate metabolism|endoplasmic
reticulum|hydrolase activity, acting on glycosyl
bonds|integral to membrane|mannosyl-
oligosaccharide 1,2-alpha-mannosidase
activity|mannosyl-oligosaccharide 1,2-alpha-
mannosidase activity|membrane|membrane
fraction|oligosaccharide metabolism
miR- NM_002446 MAP3K10 mitogen-activated P + T ATP binding|JUN kinase kinase kinase
125b protein kinase kinase activity|activation of
kinase 10 JNK|autophosphorylation|induction of
apoptosis|protein homodimerization activity|protein
serine/threonine kinase activity|protein-tyrosine
kinase activity|signal transduction|transferase activity
miR- NM_002419 MAP3K11 mitogen-activated M + P + T ATP binding|G1 phase of mitotic cell cycle|JUN
125b protein kinase kinase kinase kinase kinase activity|activation of
kinase 11 JNK|autophosphorylation|cell
proliferation|centrosome|microtubule|microtubule-
based process|protein homodimerization
activity|protein oligomerization|protein
serine/threonine kinase activity|protein-tyrosine
kinase activity|transferase activity
miR- Z25432 MAPK14 mitogen-activated P + T ATP binding|MAP kinase activity|MAP kinase kinase
125b protein kinase 14 activity|MP kinase activity|antimicrobial humoral
response (sensu Vertebrata)|cell motility|cell surface
receptor linked signal
transduction|chemotaxis|cytoplasm|nucleus|protein
amino acid phosphorylation|protein kinase
cascade|protein serine/threonine kinase
activity|protein-tyrosine kinase activity|response to
stress|transferase activity
miR- NM_018650 MARK1 MAP/microtubule P + T ATP binding|cytoplasm|cytoskeleton|cytoskeleton
125b affinity-regulating organization and biogenesis|magnesium ion
kinase 1 binding|microtubule cytoskeleton|protein amino acid
phosphorylation|protein amino acid
phosphorylation|protein kinase cascade|protein
serine/threonine kinase activity|protein
serine/threonine kinase activity|transferase activity
miR- NM_001879 MASP1 mannan-binding lectin P + T calcium ion binding|chymotrypsin
125b serine protease 1 activity|complement activation|complement
(C4/C2 activating activation, classical pathway|extracellular
component of Ra- region|immune response|peptidase activity|proteolysis
reactive factor) and peptidolysis|trypsin activity
miR- NM_005911 MAT2A methionine P + T ATP binding|magnesium ion binding|methionine
125b adenosyltransferase II, adenosyltransferase activity|one-carbon compound
alpha metabolism|transferase activity
miR- NM_005920 MEF2D MADS box P + T muscle development|nucleus|regulation of
125b transcription enhancer transcription, DNA-
factor 2, polypeptide D dependent|transcription|transcription coactivator
(myocyte enhancer activity|transcription factor activity|transcription from
factor 2D) RNA polymerase II promoter
miR- NM_020149 MEIS2 Meis1, myeloid M + P negative regulation of transcription from RNA
125b ecotropic viral polymerase II promoter|nucleus|regulation of
integration site 1 transcription, DNA-dependent|specific RNA
homolog 2 (mouse) polymerase II transcription factor
activity|transcription corepressor activity|transcription
factor activity|transcription factor activity
miR- NM_017927 MEN1 mitofusin 1 P + T GTP binding|GTPase activity|hydrolase
125b activity|integral to membrane|mitochondrial
fusion|mitochondrial outer membrane|mitochondrion
miR- AI139252 MGC16063 ribosomal protein L35a P + T JAK-STAT cascadelacute-phase response|calcium ion
125b binding|cell
motility|cytoplasm|hematopoietin/interferon-class
(D200-domain) cytokine receptor signal transducer
activity|intracellular signaling cascade|negative
regulation of transcription from RNA polymerase II
promoter|neurogenesis|nucleus|nucleus|regulation of
transcription, DNA-dependent|signal transducer
activity|transcription|transcription factor
activity|transcription factor activity
miR- AI862120 MGC21981 hypothetical protein P + T membrane
125b MGC21981
miR- AL515061 MGC24302 hypothetical protein P + T
125b MGC24302
miR- BE618656 MGC2541 similar to RIKEN M + P + T
125b cDNA 2610030J16
gene
miR- BC005842 MGC2705 hypothetical protein P + T
125b MGC2705
miR- NM_024293 MGC3035 hypothetical protein M + P
125b MGC3035
miR- NM_017572 MKNK2 MAP kinase-interacting P + T ATP binding|ATP binding|cell surface receptor linked
125b serine/threonine kinase 2 signal transduction|protein amino acid
phosphorylation|protein amino acid
phosphorylation|protein kinase cascade|protein
serine/threonine kinase activity|protein
serine/threonine kinase activity|protein-tyrosine
kinase activity|regulation of translation|response to
stress|transferase activity
miR- NM_005439 MLF2 myeloid leukemia factor 2 P + T defense response|nucleus
125b
miR- NM_007359 MLN51 MLN51 protein P + T mRNA processing|mRNA-nucleus
125b export|molecular_function unknown|nucleus|transport
miR- NM_002442 MSI1 musashi homolog 1 M + P + T RNA binding|neurogenesis|nucleotide binding|nucleus
125b (Drosophila)
miR- NM_021090 MTMR3 myotubularin related M + P + T cytoplasm|hydrolase activity|inositol or
125b protein 3 phosphatidylinositol phosphatase
activity|membrane|membrane fraction|phospholipid
dephosphorylation|protein amino acid
dephosphorylation|protein serine/threonine
phosphatase activity|protein tyrosine phosphatase
activity|protein tyrosine/serine/threonine phosphatase
activity|zinc ion binding
miR- AK024501 MXD4 MAX dimerization M + P + T DNA binding|negative regulation of cell
125b protein 4 proliferation|negative regulation of transcription from
RNA polymerase II promoter|nucleus|protein
binding|regulation of transcription, DNA-
dependent|transcription|transcription corepressor
activity
miR- AB020642 MYT1 myelin transcription M + P + T nucleus|regulation of transcription, DNA-
125b factor 1 dependent|transcription|transcription factor
activity|zinc ion binding
miR- NM_004540 NCAM2 neural cell adhesion P + T cell adhesion|integral to membrane|membrane|neuron
125b molecule 2 adhesion|plasma membrane|protein binding
miR- NM_012338 NET-2 transmembrane 4 P + T integral to membrane|membrane fraction
125b superfamily member
tetraspan NET-2
miR- U84246 NEU1 sialidase 1 (lysosomal P + T carbohydrate metabolism|exo-alpha-sialidase
125b sialidase) activity|hydrolase activity, acting on glycosyl
bonds|lysosome
miR- AI824012 NRIP1 nuclear receptor P + T nucleus|regulation of transcription, DNA-
125b interacting protein 1 dependent|transcription|transcription coactivator
activity
miR- D81048 NRM nurim (nuclear envelope P + T
125b membrane protein)
miR- BC001794 NUMBL numb homolog P + T neurogenesis
125b (Drosophila)-like
miR- AB020713 NUP210 nucleoporin 210 P + T development|nucleus
125b
miR- NM_002537 OAZ2 ornithine decarboxylase M + P + T ornithine decarboxylase inhibitor activity|polyamine
125b antizyme 2 metabolism
miR- NM_024586 OSBPL9 oxysterol binding P + T lipid transport|steroid metabolism
125b protein-like 9
miR- U64661 PABP ESTs, Highly similar to P + T
125b PAB1_HUMAN
Polyadenylate-binding
protein 1 (Poly(A)-
binding protein 1)
(PABP 1) (PABP1)
[H. sapiens]
miR- AK000003 PCQAP PC2 (positive cofactor P + T
125b 2, multiprotein
complex) glutamine/Q-
rich-associated protein
miR- NM_004716 PCSK7 proprotein convertase M + P + T integral to Golgi membrane|integral to
125b subtilisin/kexin type 7 membrane|peptidase activity|peptidase activity|peptide
hormone processing|proteolysis and
peptidolysis|subtilase activity
miR- NM_006201 PCTK1 PCTAIRE protein M + P + T ATP binding|protein amino acid
125b kinase 1 phosphorylation|protein amino acid
phosphorylation|protein serine/threonine kinase
activity|protein serine/threonine kinase
activity|regulation of cell cycle|transferase activity
miR- NM_021213 PCTP phosphatidylcholine M + P + T cytosol|lipid binding|lipid
125b transfer protein transport|phosphatidylcholine transporter activity
miR- NM_021255 PELI2 pellino homolog 2 M + P + T
125b (Drosophila)
miR- NM_002646 PIK3C2B phosphoinositide-3- P + T inositol or phosphatidylinositol kinase
125b kinase, class 2, beta activity|intracellular signaling
polypeptide cascade|microsome (phosphatidylinositol 3-kinase
activity|phosphatidylinositol-4-phosphate 3-kinase
activity|phosphoinositide 3-kinase complex|plasma
membrane|transferase activity
miR- NM_003628 PKP4 plakophilin 4 P + T cell adhesion|cytoskeleton|intercellular
125b junction|protein binding|structural molecule activity
miR- NM_006718 PLAGL1 pleiomorphic adenoma P + T DNA binding|cell cycle arrest|induction of
125b gene-like 1 apoptosis|nucleic acid binding|nucleus|regulation of
transcription, DNA-dependent|transcription|zinc ion
binding
miR- AI457120 PPAT phosphoribosyl P + T amidophosphoribosyltransferase activity|glutamine
125b pyrophosphate metabolism|magnesium ion
amidotransferase binding|metabolism|nucleoside metabolism|purine
base biosynthesis|purine nucleotide
biosynthesis|transferase activity, transferring glycosyl
groups
miR- NM_002719 PPP2R5C protein phosphatase 2, P + T hydrolase activity|nucleus|phosphoprotein
125b regulatory subunit B phosphatase activity|protein phosphatase type 2A
(B56), gamma isoform complex|protein phosphatase type 2A complex|protein
phosphatase type 2A regulator activity|protein
phosphatase type 2A regulator activity|signal
transduction|signal transduction
miR- AL022067 PRDM1 PR domain containing P + T
125b 1, with ZNF domain
miR- U23736 PRDM2 PR domain containing P + T DNA binding|metal ion
125b 2, with ZNF domain binding|nucleus|nucleus|regulation of
transcription|regulation of transcription, DNA-
dependent|transcription factor activity|transcription
regulator activity|zinc ion binding|zinc ion binding
miR- AF083033 PRKRA protein kinase, P + T double-stranded RNA binding|enzyme activator
125b interferon-inducible activity|immune response|intracellular|kinase
double stranded RNA activity|negative regulation of cell
dependent activator proliferation|response to virus|signal transducer
activity|signal transduction
miR- NM_014369 PTPN18 protein tyrosine P + T hydrolase activity|non-membrane spanning protein
125b phosphatase, non- tyrosine phosphatase activity|protein amino acid
receptor type 18 (brain- dephosphorylation|protein amino acid
derived) dephosphorylation|protein tyrosine phosphatase
activity
miR- AI762627 PTPRF protein tyrosine P + T cell adhesion|hydrolase activity|integral to
125b phosphatase, receptor membrane|integral to plasma membrane|protein
type, F amino acid dephosphorylation|protein binding|protein
tyrosine phosphatase activity|receptor
activity|transmembrane receptor protein tyrosine
phosphatase activity|transmembrane receptor protein
tyrosine phosphatase signaling pathway
miR- NM_002840 PTPRF protein tyrosine P + T cell adhesion|hydrolase activity|integral to
125b phosphatase, receptor membrane|integral to plasma membrane|protein
type, F amino acid dephosphorylation|protein binding|protein
tyrosine phosphatase activity|receptor
activity|transmembrane receptor protein tyrosine
phosphatase activity|transmembrane receptor protein
tyrosine phosphatase signaling pathway
miR- AF142419 QKI homolog of mouse P + T
125b quaking QKI (KH
domain RNA binding
protein)
miR- NM_004283 RAB3D RAB3D, member RAS P + T GTP binding|GTPase activity|exocytosis|hemocyte
125b oncogene family development|protein transport|small GTPase mediated
signal transduction
miR- BC002510 RAB6B RAB6B, member RAS P + T GTP binding|GTPase activity|Golgi
125b oncogene family apparatus|intracellular protein transport|retrograde
transport, Golgi to ER|small GTPase mediated signal
transduction
miR- AK022662 RASAL2 RAS protein activator P + T GTPase activator activity|Ras GTPase activator
125b like 2 activity|signal transduction
miR- NM_004841 RASAL2 RAS protein activator P + T GTPase activator activity|Ras GTPase activator
125b like 2 activity|signal transduction
miR- NM_016090 RBM7 RNA binding motif P + T RNA binding|meiosis|nucleic acid binding|nucleotide
125b protein 7 binding
miR- NM_006268 REQ requiem, apoptosis M + P + T DNA binding|apoptosis|induction of apoptosis by
125b response zinc finger extracellular signals|nucleus|protein
gene ubiquitination|regulation of transcription, DNA-
dependent|transcription|ubiquitin ligase
complex|ubiquitin-protein ligase activity|zinc ion
binding
miR- NM_000449 RFX5 regulatory factor X, 5 P + T nucleus|regulation of transcription, DNA-
125b (influences HLA class dependent|transcription|transcription coactivator
II expression) activity|transcription factor activity|transcription from
RNA polymerase II promoter
miR- NM_003721 RFXANK regulatory factor X- P + T humoral immune response|nucleus|regulation of
125b associated ankyrin- transcription, DNA-
containing protein dependent|transcription|transcription coactivator
activity|transcription factor activity|transcription from
RNA polymerase II promoter
miR- NM_014746 RNF144 likely ortholog of P + T nucleus|protein ubiquitination|ubiquitin ligase
125b mouse ubiquitin complex|ubiquitin-protein ligase activity|zinc ion
conjugating enzyme 7 binding
interacting protein 4
miR- NM_014771 RNF40 ring finger protein 40 M + P + T protein ubiquitination|ubiquitin ligase
125b complex|ubiquitin-protein ligase activity|zinc ion
binding
miR- AL109955 RNPC1 RNA-binding region P + T
125b (RNP1, RRM)
containing 1
miR- AF116627 RPL29 ribosomal protein L29 M + T
125b
miR- NM_002953 RPS6KA1 ribosomal protein S6 M + P + T ATP binding|protein amino acid
125b kinase, 90 kDa, phosphorylation|protein serine/threonine kinase
polypeptide 1 activity|protein serine/threonine kinase
activity|protein-tyrosine kinase activity|signal
transduction|transferase activity
miR- NM_000332 SCA1 spinocerebellar ataxia 1 P + T RNA binding|cytoplasm|nucleus
125b (olivopontocerebellar
ataxia 1, autosomal
dominant, ataxin 1)
miR- NM_012429 SEC14L2 SEC14-like 2 P + T cytoplasm|intracellular protein
125b (S. cerevisiae) transport|membrane|nucleus|phospholipid
binding|positive regulation of transcription, DNA-
dependent|protein carrier activity|regulation of
cholesterol biosynthesis|transcription|transcriptional
activator activity|transport|vitamin E binding
miR- NM_005065 SEL1L sel-1 suppressor of lin- P + T catalytic activity|integral to membrane
125b 12-like (C. elegans)
miR- NM_017789 SEMA4C sema domain, M + P + T cell differentiation|integral to
125b immunoglobulin membrane|membrane|neurogenesis|receptor activity
domain (Ig),
transmembrane domain
(TM) and short
cytoplasmic domain,
(semaphorin) 4C
miR- NM_006378 SEMA4D sema domain, P + T anti-apoptosis|cell adhesion|cell
125b immunoglobulin differentiation|immune response|integral to
domain (Ig), membrane|membrane|neurogenesis|receptor activity
transmembrane domain
(TM) and short
cytoplasmic domain,
(semaphorin) 4D
miR- BE622841 SENP2 sentrin-specific protease M + P
125b
miR- NM_003011 SET SET translocation M + T DNA replication|endoplasmic reticulum|histone
125b (myeloid leukemia- binding|negative regulation of histone
associated) acetylation|nucleocytoplasmic transport|nucleosome
assembly|nucleosome disassembly|nucleus|perinuclear
region|protein phosphatase inhibitor activity|protein
phosphatase type 2A regulator activity
miR- NM_006275 SFRS6 splicing factor, P + T RNA binding|mRNA splice site selection|nuclear
125b arginine/serine-rich 6 mRNA splicing, via spliceosome|nucleotide
binding|nucleus
miR- AF015043 SH3BP4 SH3-domain binding P + T cell cycle|endocytosis|nucleus|signal transducer
125b protein 4 activity
miR- NM_016538 SIRT7 sirtuin silent mating P + T DNA binding|chromatin silencing|chromatin silencing
125b type information complex|hydrolase activity|regulation of transcription,
regulation 2 homolog 7 DNA-dependent
(S. cerevisiae)
miR- NM_020309 SLC17A7 solute carrier family 17 P + T integral to membrane|phosphate transport|sodium-
125b (sodium-dependent dependent phosphate transporter
inorganic phosphate activity|transport|transporter activity
cotransporter), member 7
miR- NM_013272 SLC21A11 solute carrier family 21 P + T integral to membrane|ion
125b (organic anion transport|membrane|transporter activity
transporter), member 11
miR- AK000722 SLC27A4 solute carrier family 27 P + T catalytic activity|fatty acid transport|fatty acid
125b (fatty acid transporter), transporter activity|ligase activity|lipid
member 4 metabolism|lipid transport|metabolism
miR- NM_003759 SLC4A4 solute carrier family 4, P + T anion transport|inorganic anion exchanger
125b sodium bicarbonate activity|integral to membrane|integral to plasma
cotransporter, member 4 membrane|membrane|sodium:bicarbonate symporter
activity|transport
miR- NM_003045 SLC7A1 solute carrier family 7 P + T amino acid metabolism|amino acid permease
125b (cationic amino acid activity|amino acid transport|basic amino acid
transporter, y+ system), transporter activity|integral to plasma
member 1 membrane|membrane|receptor activity|transport
miR- NM_003983 SLC7A6 solute carrier family 7 P + T amino acid metabolism|amino acid transport|amino
125b (cationic amino acid acid-polyamine transporter activity|integral to plasma
transporter, y+ system), membrane|plasma membrane|protein complex
member 6 assembly|transport
miR- AF113019 SMARCD2 SWI/SNF related, M + P + T chromatin remodeling|nucleoplasm|regulation of
125b matrix associated, actin transcription from RNA polymerase II
dependent regulator of promoter|transcription|transcription coactivator
chromatin, subfamily d, activity
member 2
miR- NM_005985 SNAI1 snail homolog 1 P + T DNA binding|cartilage
125b (Drosophila) condensation|development|neurogenesis|nucleus|zinc
ion binding
miR- AB037750 SORCS2 VPS10 domain receptor P + T integral to membrane|intracellular protein
125b protein transport|membrane|membrane|neuropeptide receptor
activity|neuropeptide signaling pathway|protein
binding|protein transporter activity|sugar binding
miR- BE742268 SORT1 sortilin 1 P + T endocytosis|endosome|integral to membrane|integral
125b to membrane|intracellular protein
transport|membrane|neurotensin receptor activity, G-
protein coupled|protein transporter activity|receptor
activity
miR- AI360875 SOX11 SRY (sex determining M + T DNA binding|neurogenesis|nucleus|regulation of
125b region Y)-box 11 transcription, DNA-dependent|transcription
miR- AU121035 SP1 Sp1 transcription factor P + T DNA binding|RNA polymerase II transcription factor
125b activity|nucleus|regulation of transcription, DNA-
dependent|transcription|transcriptional activator
activity|zinc ion binding
miR- NM_003131 SRF serum response factor M + T RNA polymerase II transcription factor
125b (c-fos serum response activity|nucleus|regulation of transcription from RNA
element-binding polymerase II promoter|signal
transcription factor) transduction|transcription|transcription factor activity
miR- NM_005637 SS18 synovial sarcoma P + T nucleus
125b translocation,
chromosome 18
miR- AF343880 SSX2 synovial sarcoma, X P + T nucleus
125b breakpoint 2
miR- NM_014682 ST18 suppression of P + T nucleus|regulation of transcription, DNA-
125b tumorigenicity 18 dependent|transcription factor activity
(breast carcinoma) (zinc
finger protein)
miR- AA128023 STARD13 START domain P + T
125b containing 13
miR- BC000627 STAT3 signal transducer and P + T JAK-STAT cascade|acute-phase response|calcium ion
125b activator of binding|cell
transcription 3 (acute- motility|cytoplasm|hematopoietin/interferon-class
phase response factor) (D200-domain) cytokine receptor signal transducer
activity|intracellular signaling cascade|negative
regulation of transcription from RNA polymerase II
promoter|neurogenesis|nucleus|nucleus|regulation of
transcription, DNA-dependent|signal transducer
activity|transcription|transcription factor
activity|transcription factor activity
miR- NM_003155 STC1 stanniocalcin 1 P + T calcium ion homeostasis|cell surface receptor linked
125b signal transduction|cell-cell signaling|extracellular
region|hormone activity|response to nutrients
miR- NM_003173 SUV39H1 suppressor of P + T DNA replication and chromosome cycle|S-
125b variegation 3-9 adenosylmethionine-dependent methyltransferase
homolog 1 (Drosophila) activity|chromatin|chromatin assembly or
disassembly|chromatin binding|chromatin
modification|condensed nuclear chromosome|histone
lysine N-methyltransferase activity (H3-K9
specific)|histone-lysine N-methyltransferase
activity|methyltransferase
activity|nucleus|nucleus|protein binding|transferase
activity|zinc ion binding
miR- AW139618 SYN2 synapsin II P + T neurotransmitter secretion|synapse|synaptic
125b transmission|synaptic vesicle
miR- R60550 TAF5L TAF5-like RNA M + P + T nucleus|regulation of transcription, DNA-
125b polymerase II, dependent|transcription factor activity|transcription
p300/CBP-associated from RNA polymerase II promoter
factor (PCAF)-
associated factor,
65 kDa
miR- AF220509 TAF9L TAF9-like RNA P + T DNA binding|nucleus|regulation of transcription,
125b polymerase II, TATA DNA-dependent|transcription factor TFIID
box binding protein complex|transcription initiation
(TBP)-associated factor,
31 kDa
miR- NM_000116 TAZ tafazzin M + P + T acyltransferase activity|heart development|integral to
125b (cardiomyopathy, membrane|metabolism|muscle contraction|muscle
dilated 3A (X-linked); development
endocardial
fibroelastosis 2; Barth
syndrome)
miR- NM_018488 TBX4 T-box 4 P + T development|nucleus|regulation of transcription,
125b DNA-dependent|transcription|transcription factor
activity
miR- NM_012249 TC10 ras-like protein TC10 M + T GTP binding|GTPase activity|plasma membrane|small
125b GTPase mediated signal transduction
miR- BG387172 TEAD2 TEA domain family P + T nucleus|nucleus|regulation of transcription, DNA-
125b member 2 dependent|regulation of transcription, DNA-
dependent|transcription|transcription factor
activity|transcription factor activity
miR- U06935 TEF thyrotrophic embryonic P + T RNA polymerase II transcription factor
125b factor activity|nucleus|regulation of transcription from RNA
polymerase II promoter|rhythmic
process|transcription|transcription factor activity
miR- NM_006464 TGOLN2 trans-golgi network P + T Golgi trans face|integral to membrane|transport
125b protein 2 vesicle
miR- BE219311 TIMM22 translocase of inner P + T integral to membrane|mitochondrial inner
125b mitochondrial membrane|mitochondrion|protein transport|protein
membrane 22 homolog transporter activity
(yeast)
miR- NM_003326 TNFSF4 tumor necrosis factor P + T cell-cell signaling|immune response|integral to plasma
125b (ligand) superfamily, membrane|membrane|positive regulation of cell
member 4 (tax- proliferation|signal transduction|tumor necrosis factor
transcriptionally receptor binding
activated glycoprotein
1, 34 kDa)
miR- AA873275 TOR2A torsin family 2, member A P + T ATP binding|GTP cyclohydrolase I
125b activity|biosynthesis|chaperone cofactor dependent
protein folding|endoplasmic reticulum|nucleoside-
triphosphatase activity|nucleotide binding
miR- AW341649 TP53INP1 tumor protein p53 M + P + T apoptosis|nucleus
125b inducible nuclear
protein 1
miR- NM_014112 TRPS1 trichorhinophalangeal P + T NLS-bearing substrate-nucleus
125b syndrome I import|nucleus|regulation of transcription, DNA-
dependent|skeletal
development|transcription|transcription factor
activity|transcription from RNA polymerase II
promoter|zinc ion binding
miR- NM_001070 TUBG1 tubulin, gamma 1 P + T GTP binding|GTPase activity|centrosome|condensed
125b nuclear chromosome|gamma-tubulin complex|meiotic
spindle organization and
biogenesis|microtubule|microtubule
nucleation|microtubule-based movement|mitotic
spindle organization and biogenesis|polar
microtubule|protein binding|protein
polymerization|spindle pole body|structural
constituent of cytoskeleton
miR- NM_003330 TXNRD1 thioredoxin reductase 1 P + T FAD binding|cell redox
125b homeostasis|cytoplasm|disulfide oxidoreductase
activity|electron transport|electron transporter
activity|oxidoreductase activity, acting on NADH or
NADPH, disulfide as acceptor|signal
transduction|thioredoxin-disulfide reductase activity
miR- BC004862 UBE2R2 ubiquitin-conjugating P + T ligase activity|ubiquitin conjugating enzyme
125b enzyme E2R 2 activity|ubiquitin cycle|ubiquitin-protein ligase
activity
miR- NM_003728 UNC5C unc-5 homolog B P + T apoptosis|axon guidance|brain
125b (C. elegans) development|development|integral to membrane |netrin
receptor activity|protein binding|receptor
activity|signal transduction
miR- NM_003369 UVRAG UV radiation resistance P + T DNA repair|cytoplasm
125b associated gene
miR- AF195514 VPS4B vacuolar protein sorting M + P + T ATP binding|ATPase activity,
125b 4B (yeast) coupled|membrane|membrane fusion|nucleoside-
triphosphatase activity|nucleotide binding|peroxisome
organization and biogenesis|protein binding|regulation
of transcription, DNA-dependent
miR- R51061 VTS58635 mitogen-activated P + T GTP binding|small GTPase mediated signal
125b protein kinase kinase transduction
kinase kinase 1
miR- NM_004184 WARS tryptophanyl-tRNA M + T ATP binding|cytoplasm|ligase activity|negative
125b synthetase regulation of cell proliferation|protein
biosynthesis|soluble fraction|tryptophan-tRNA ligase
activity|tryptophanyl-tRNA
aminoacylation|tryptophanyl-tRNA aminoacylation
miR- NM_005433 YES1 v-yes-1 Yamaguchi P + T ATP binding|intracellular signaling cascade|protein
125b sarcoma viral oncogene amino acid phosphorylation|protein-tyrosine kinase
homolog 1 activity|transferase activity
miR- NM_017740 ZDHHC7 zinc finger, DHHC P + T integral to membrane|metal ion binding
125b domain containing 7
miR- BF525395 ZFP385 likely ortholog of M + P + T DNA binding|nucleic acid binding|nucleus|regulation
125b mouse zinc finger of transcription, DNA-dependent|transcription|zinc
protein 385 ion binding
miR- NM_007345 ZNF236 zinc finger protein 236 P + T nucleus|regulation of transcription, DNA-
125b dependent|transcription|transcription factor
activity|zinc ion binding
miR- NM_012482 ZNF281 zinc finger protein 281 M + P + T DNA binding|DNA-directed RNA polymerase II, core
125b complex|negative regulation of transcription from
RNA polymerase II promoter|nucleus|regulation of
transcription, DNA-dependent|specific RNA
polymerase II transcription factor
activity|transcription|zinc ion binding
miR- NM_003427 ZNF76 zinc finger protein 76 P + T DNA binding|nucleus|regulation of transcription from
125b (expressed in testis) RNA polymerase II promoter|regulation of
transcription from RNA polymerase III
promoter|transcription|zinc ion binding
miR- NM_022465 ZNFN1A4 zinc finger protein, M + P + T nucleic acid binding|nucleus|transcription factor
125b subfamily 1A, 4 (Eos) activity|transcriptional repressor activity|zinc ion
binding
miR- NM_005502 ABCA1 ATP-binding cassette, P + T ATP binding|ATP binding|ATPase activity|anion
145 sub-family A (ABC1), transporter activity|cholesterol metabolism|integral to
member 1 plasma membrane|lipid metabolism|membrane
fraction|nucleotide binding|steroid metabolism|sterol
transporter activity|transport|transport
miR- AL527773 ABR active BCR-related M + P + T GTPase activator activity|guanyl-nucleotide exchange
145 gene factor activity|small GTPase mediated signal
transduction
miR- NM_001616 ACVR2 activin A receptor, type M + P + T ATP binding|integral to plasma
145 II membrane|membrane|protein amino acid
phosphorylation|receptor activity|transferase
activity|transforming growth factor beta receptor
activity|transmembrane receptor protein
serine/threonine kinase signaling pathway
miR- NM_003183 ADAM17 a disintegrin and P + T cell-cell signaling|integral to plasma
145 metalloproteinase membrane|metalloendopeptidase activity|proteolysis
domain 17 (tumor and peptidolysis|zinc ion binding
necrosis factor, alpha,
converting enzyme)
miR- NM_019903 ADD3 adducin 3 (gamma) M + P + T calmodulin binding|cytoskeleton|membrane|structural
145 constituent of cytoskeleton
miR- AB003476 AKAP12 A kinase (PRKA) P + T G-protein coupled receptor protein signaling
145 anchor protein (gravin) pathway|cytoplasm|protein binding|protein kinase A
12 binding|protein targeting|signal transduction
miR- NM_016201 AMOTL2 angiomotin like 2 M + P + T
145
miR- NM_001128 AP1G1 adaptor-related protein M + P + T Golgi apparatus|binding|clathrin coat of trans-Golgi
145 complex 1, gamma 1 network vesicle|coated pit|endocytosis|intracellular
subunit protein transport|intracellular protein
transport|membrane coat adaptor complex|protein
complex assembly|transporter activity
miR- NM_001284 AP3S1 adaptor-related protein M + P + T Golgi apparatus|clathrin vesicle coat|insulin receptor
145 complex 3, sigma 1 signaling pathway|intracellular protein
subunit transport|membrane coat adaptor
complex|transport|transport vesicle|transporter activity
miR- NM_006380 APPBP2 amyloid beta precursor M + P + T binding|cytoplasm|intracellular protein
145 protein (cytoplasmic transport|membrane|microtubule associated
tail) binding protein 2 complex|microtubule motor activity|nucleus
miR- AB037845 ARHGAP10 Rho-GTPase activating M + T protein binding
145 protein 10
miR- AL516350 ARPC5 actin related protein 2/3 P + T Arp2/3 protein complex|actin cytoskeleton
145 complex, subunit 5, organization and biogenesis|cell
16 kDa motility|cytoplasm|cytoskeleton|regulation of actin
filament polymerization|structural constituent of
cytoskeleton
miR- U72937 ATRX alpha M + T ATP binding|DNA binding|DNA helicase
145 thalassemia/mental activity|DNA methylation|DNA recombination|DNA
retardation syndrome repair|chromosome organization and biogenesis
X-linked (RAD54 (sensu Eukaryota)|helicase activity|hydrolase
homolog, S. cerevisiae) activity|nuclear heterochromatin|nucleus|perception of
sound|regulation of transcription, DNA-
dependent|transcription factor activity
miR- NM_021813 BACH2 BTB and CNC P + T DNA binding|nucleus|protein binding|regulation of
145 homology 1, basic transcription, DNA-dependent|transcription
leucine zipper
transcription factor 2
miR- NM_013449 BAZ2A bromodomain adjacent P + T DNA binding|chromatin remodeling|nucleolus
145 to zinc finger domain, organizer complex|nucleus|regulation of transcription,
2A DNA-dependent|transcription|transcription regulator
activity
miR- NM_007005 BCE-1 BCE-1 protein M + P frizzled signaling pathway|molecular_function
145 unknown|nucleus|nucleus|regulation of
transcription|regulation of transcription, DNA-
dependent
miR- NM_003458 BSN bassoon (presynaptic P + T cytoskeleton|metal ion binding|nucleus|structural
145 cytomatrix protein) constituent of cytoskeleton|synapse|synaptic
transmission|synaptosome
miR- NM_013279 C11orf9 chromosome 11 open M + P + T
145 reading frame 9
miR- NM_024643 C14orf140 hypothetical protein P + T
145 FLJ23093
miR- NM_018270 C20orf20 chromosome 20 open P + T chromatin modification|nucleus|regulation of cell
145 reading frame 20 growth|regulation of transcription, DNA-
dependent|transcription
miR- NM_004276 CABP1 calcium binding protein P + T calcium ion binding|calcium ion binding|enzyme
145 1 (calbrain) inhibitor activity
miR- NM_001755 CBFB core-binding factor, M + P + T RNA polymerase II transcription factor
145 beta subunit activity|nucleus|transcription coactivator
activity|transcription factor activity|transcription from
RNA polymerase II promoter
miR- NM_001759 CCND2 cyclin D2 P + T cytokinesis|nucleus|regulation of cell cycle
145
miR- NM_020307 CCNL1 cyclin L ania-6a M + P + T cell cycle|regulation of cell cycle
145
miR- AL118798 CD47 CD47 antigen (Rh- P + T cell-matrix adhesion|integral to plasma
145 related antigen, membrane|integrin-mediated signaling
integrin-associated pathway|plasma membrane|protein binding
signal transducer)
miR- BF576053 CFL2 cofilin 2 (muscle) M + P + T actin binding|cytoskeleton|nucleus
145
miR- AA835485 CKLiK CamKI-like protein P + T ATP binding|calcium- and calmodulin-dependent
145 kinase protein kinase activity|calmodulin
binding|nucleus|protein amino acid
phosphorylation|protein serine/threonine kinase
activity|transferase activity
miR- NM_004921 CLCA3 chloride channel, P + T extracellular space|transport|transporter activity
145 calcium activated,
family member 3
miR- NM_001326 CSTF3 cleavage stimulation M + P + T RNA binding|binding|mRNA cleavage|mRNA
145 factor, 3′ pre-RNA, polyadenylylation|nucleus
subunit 3, 77 kDa
miR- NM_020248 CTNNBIP1 catenin, beta interacting P + T Wnt receptor signaling pathway|beta-catenin
145 protein 1 binding|cell
proliferation|development|nucleus|regulation of
transcription, DNA-dependent|signal transduction
miR- AW772082 DACH dachshund homolog P + T DNA binding|development|eye morphogenesis (sensu
145 (Drosophila) Endopterygota)|nucleus|regulation of transcription,
DNA-dependent|transcription
miR- NM_004393 DAG1 dystroglycan 1 M + P + T actin cytoskeleton|calcium ion binding|extracellular
145 (dystrophin-associated matrix (sensu Metazoa)|integral to plasma
glycoprotein 1) membrane|laminin receptor activity|membrane
fraction|muscle contraction|plasma membrane|protein
binding|protein complex assembly
miR- NM_003887 DDEF2 development and P + T GTPase activator activity|Golgi apparatus|regulation
145 differentiation of GTPase activity
enhancing factor 2
miR- AL080239 DKFZp547M2010 hypothetical protein M + P + T
145 DKFZp547M2010
miR- AL137517 DKFZp564O1278 hypothetical protein P + T integral to membrane
145 DKFZp564O1278
miR- NM_001386 DPYSL2 dihydropyrimidinase- P + T dihydropyrimidinase activity|hydrolase
145 like 2 activity|neurogenesis|nucleobase, nucleoside,
nucleotide and nucleic acid metabolism|signal
transduction
miR- BC003143 DUSP6 dual specificity P + T MAP kinase phosphatase activity|cytoplasm|hydrolase
145 phosphatase 6 activity|inactivation of MAPK|protein amino acid
dephosphorylation|protein serine/threonine
phosphatase activity|protein tyrosine phosphatase
activity|regulation of cell cycle|soluble fraction
miR- D86550 DYRK1A dual-specificity P + T ATP binding|neurogenesis|nucleus|protein amino acid
145 tyrosine-(Y)- phosphorylation|protein serine/threonine kinase
phosphorylation activity|protein-tyrosine kinase activity|transferase
regulated kinase 1A activity
miR- NM_001967 EIF4A2 eukaryotic translation M + P + T ATP binding|ATP-dependent helicase activity|DNA
145 initiation factor 4A, binding|RNA binding|eukaryotic translation initiation
isoform 2 factor 4F complex|hydrolase activity|protein
biosynthesis|regulation of translational
initiation|translation initiation factor activity
miR- NM_001417 EIF4B eukaryotic translation M + T RNA binding|eukaryotic translation initiation factor
145 initiation factor 4B 4F complex|nucleic acid binding|nucleotide
binding|protein biosynthesis|regulation of translational
initiation|translation initiation factor
activity|translation initiation factor activity
miR- BC005057 EIF4EBP2 eukaryotic translation P + T eukaryotic initiation factor 4E binding|negative
145 initiation factor 4E regulation of protein biosynthesis|negative regulation
binding protein 2 of translational initiation|regulation of translation
miR- NM_020909 EPB41L5 erythrocyte membrane P + T binding|cytoplasm|cytoskeletal protein
145 protein band 4.1 like 5 binding|cytoskeleton|membrane
miR- NM_005797 EVA1 epithelial V-like antigen 1 P + T cell adhesion|cytoskeleton|homophilic cell
145 adhesion|integral to
membrane|membrane|morphogenesis|protein binding
miR- NM_022977 FACL4 fatty-acid-Coenzyme A M + P + T fatty acid metabolism|integral to membrane|learning
145 ligase, long-chain 4 and/or memory|ligase activity|lipid metabolism|long-
chain-fatty-acid-CoA ligase activity|magnesium ion
binding|metabolism
miR- AL042120 FHOD2 formin homology 2 M + P Rho GTPase binding|actin binding|actin cytoskeleton
145 domain containing 2 organization and biogenesis|cell organization and
biogenesis|nucleus|regulation of transcription, DNA-
dependent|transcription factor activity|translation
initiation factor activity|translational initiation
miR- NM_002013 FKBP3 FK506 binding protein P + T FK506 binding|isomerase activity|nucleus|peptidyl-
145 3, 25 kDa prolyl cis-trans isomerase activity|protein
folding|receptor activity
miR- NM_002017 FLI1 Friend leukemia virus M + P + T hemostasis|nucleus|organogenesis|regulation of
145 integration 1 transcription, DNA-
dependent|transcription|transcription factor activity
miR- NM_023071 FLJ13117 hypothetical protein P + T
145 FLJ13117
miR- AL561281 FLJ20373 hypothetical protein M + P + T ATP binding|cellular_component unknown|protein
145 FLJ20373 amino acid phosphorylation|protein kinase
cascade|protein serine/threonine kinase
activity|response to stress|signal transduction|small
GTPase regulator activity|transferase activity
miR- AK025444 FLJ21791 hypothetical protein M + T
145 FLJ21791
miR- NM_024713 FLJ22557 hypothetical protein P + T
145 FLJ22557
miR- AA872588 FLJ36155 likely ortholog of P + T DNA binding|negative regulation of transcription
145 mouse Gli-similar 1 from RNA polymerase II promoter|nucleus|positive
Kruppel-like zinc finger regulation of transcription from RNA polymerase II
(Glis1) promoter|regulation of transcription, DNA-
dependent|specific RNA polymerase II transcription
factor activity|transcription|zinc ion binding
miR- AI434509 FLJ38499 Unnamed protein P + T nucleic acid binding
145 product [Homo
sapiens], mRNA
sequence
miR- M62994 FLNB filamin B, beta (actin P + T actin binding|actin binding|actin cytoskeleton|actin
145 binding protein 278) cytoskeleton organization and biogenesis|cell
differentiation|cytoskeletal anchoring|integral to
plasma membrane|myogenesis|signal transduction
miR- NM_002025 FMR2 fragile X mental M + T brain development|learning and/or memory
145 retardation 2
miR- N29672 FOS v-fos FBJ murine M + T proto-oncogene
145 osteosarcoma viral
oncogene homolog
miR- NM_002015 FOX01A forkhead box O1A M + P + T anti-apoptosis|nucleus|regulation of transcription from
145 (rhabdomyosarcoma) RNA polymerase II
promoter|transcription|transcription factor activity
miR- NM_003507 FZD7 frizzled homolog 7 M + P + T G-protein coupled receptor activity|G-protein coupled
145 (Drosophila) receptor protein signaling pathway|Wnt receptor
activity|development|frizzled signaling
pathway|integral to membrane|plasma membrane
miR- AL049709 GGTL3 gamma- M + P + T
145 glutamyltransferase-like 3
miR- NM_022735 GOCAP1 golgi complex M + P + T Golgi apparatuslacyl-CoA binding|catalytic
145 associated protein 1, activity|intracellular protein
60 kDa transport|membrane|mitochondrion|protein carrier
activity|steroid biosynthesis
miR- NM_020806 GPHN gephyrin P + T Mo-molybdopterin cofactor biosynthesis|catalytic
145 activity|cytoskeleton
miR- NM_015071 GRAF GTPase regulator P + T Rho GTPase activator activitylactin cytoskeleton
145 associated with focal organization and biogenesis|cellular_component
adhesion kinase unknown|neurogenesis
pp125(FAK)
miR- NM_017913 HARC Hsp90-associating P + T cytokinesis|regulation of cell cycle
145 relative of Cdc37
miR- BC006237 HECTD1 HECT domain M + T intracellular|ligase activity|receptor activity|ubiquitin
145 containing 1 cycle|ubiquitin-protein ligase activity
miR- U64317 HEF1 enhancer of P + T actin filament bundle formation|cell
145 filamentation 1 (cas-like adhesion|cytokinesis|cytoplasm|cytoskeleton|
docking; Crk-associated cytoskeleton organization and biogenesis|integrin-
substrate related) mediated signaling pathway|mitosis|nucleus|
protein binding|regulation of cell cycle|regulation
of cell growth|signal transduction|spindle
miR- NM_016258 HGRG8 high-glucose-regulated P + T
145 protein 8
miR- AL162003 HIC2 hypermethylated in P + T DNA binding|negative regulation of transcription,
145 cancer 2 DNA-dependent|nucleus|protein C-terminus
binding|transcription|zinc ion binding
miR- NM_014212 HOXC11 homeo box C11 M + P + T RNA polymerase II transcription factor
145 activity|development|endoderm
development|nucleus|regulation of transcription,
DNA-dependent|transcription factor activity
miR- NM_002193 INHBB inhibin, beta B (activin M + P + T cell differentiation|cytokine activity|defense
145 AB beta polypeptide) response|extracellular region|growth|growth factor
activity|hormone activity|host cell surface receptor
binding|negative regulation of follicle-stimulating
hormone secretion|negative regulation of hepatocyte
growth factor biosynthesis|ovarian follicle
development|positive regulation of follicle-
stimulating hormone secretion|protein binding|protein
homodimerization activity|response to external
stimulus
miR- NM_005544 IRS1 insulin receptor M + P + T cytoplasm|insulin receptor binding|protein
145 substrate 1 binding|signal transducer activity|signal
transduction|transmembrane receptor protein tyrosine
kinase docking protein activity
miR- NM_006459 KEO4 similar to P + T catalytic activity
145 Caenorhabditis elegans
protein C42C1.9
miR- NM_014686 KIAA0355 KIAA0355 gene P + T
145 product
miR- NM_015176 KIAA0483 KIAA0483 protein P + T ubiquitin cycle
145
miR- NM_014871 KIAA0710 KIAA0710 gene M + P + T cysteine-type endopeptidase activity|exonuclease
145 product activity|nucleus|ubiquitin cycle|ubiquitin thiolesterase
activity|ubiquitin-dependent protein catabolism
miR- AA772278 KIAA1673 KIAA1673 M + P + T
145
miR- AB051495 KIAA1708 KIAA1708 protein P + T ATP binding|microtubule associated
145 complex|microtubule motor activity|microtubule-
based movement
miR- AI814587 KIAA1715 KIAA1715 protein M + T
145
miR- AI187364 KIAA1894 KIAA1894 protein P + T integral to membrane
145
miR- AF155117 KIF21A kinesin family member P + T ATP binding|microtubule associated
145 21A complex|microtubule motor activity|microtubule-
based movement
miR- NM_004235 KLF4 Kruppel-like factor 4 M + T mesodermal cell fate determination|negative
145 (gut) regulation of cell proliferation|negative regulation of
transcription, DNA-dependent|negative regulation of
transcription, DNA-dependent|nucleic acid
binding|nucleus|transcription|transcription factor
activity|transcription factor activity|transcriptional
activator activity|transcriptional activator
activity|transcriptional repressor
activity|transcriptional repressor activity|zinc ion
binding|zinc ion binding
miR- T68150 LL5beta hypothetical protein M + T
145 FLJ21791
miR- AI797833 LOC285148 a disintegrin and P + T catalytic activity
145 metalloproteinase
domain 17 (tumor
necrosis factor, alpha,
converting enzyme)
miR- NM_025146 MAK3P likely ortholog of P + T N-acetyltransferase activity
145 mouse Mak3p homolog
(S. cerevisiae)
miR- BF971923 MAP3K3 mitogen-activated M + P ATP binding|MAP kinase kinase kinase
145 protein kinase kinase activity|MAPKKK cascade|magnesium ion
kinase 3 binding|positive regulation of I-kappaB kinase/NF-
kappaB cascade|protein amino acid
phosphorylation|protein kinase activity|protein
serine/threonine kinase activity|signal transducer
activity|transferase activity
miR- NM_004834 MAP4K4 mitogen-activated M + P + T ATP binding|cellular_component unknown|protein
145 protein kinase kinase amino acid phosphorylation|protein kinase
kinase kinase 4 cascade|protein serine/threonine kinase
activity|response to stress|signal transduction|small
GTPase regulator activity|transferase activity
miR- BF382281 MGC10120 Homo sapiens cDNA P + T
145 FLJ30135 fis, clone
BRACE2000061,
mRNA sequence
miR- BG231756 MGC10986 hypothetical protein M + P ATP binding|MAP kinase kinase kinase
145 MGC10986 activity|MAPKKK cascade|magnesium ion
binding|positive regulation of I-kappaB kinase/NF-
kappaB cascade|protein amino acid
phosphorylation|protein kinase activity|protein
serine/threonine kinase activity|signal transducer
activity|transferase activity
miR- BC004869 MGC2817 hypothetical protein P + T outer membrane|protein transport
145 MGC2817
miR- BC002712 MYCN v-myc M + T chromatin|nucleus|protein binding|regulation of
145 myelocytomatosis viral transcription from RNA polymerase II
related oncogene, promoter|transcription factor activity
neuroblastoma derived
(avian)
miR- AB007899 NEDD4L neural precursor cell P + T excretion|intracellular|intracellular|ligase
145 expressed, activity|positive regulation of endocytosis|protein
developmentally down- binding|protein ubiquitination|regulation of protein
regulated 4-like catabolism|response to metal ion|sodium channel
regulator activity|sodium ion homeostasis|sodium ion
transport|ubiquitin cycle|ubiquitin-protein ligase
activity|ubiquitin-protein ligase activity|water
homeostasis
miR- NM_005863 NET1 neuroepithelial cell P + T guanyl-nucleotide exchange factor
145 transforming gene 1 activity|nucleus|regulation of cell growth|signal
transduction
miR- NM_003204 NFE2L1 nuclear factor P + T DNA binding|heme biosynthesis|inflammatory
145 (erythroid-derived 2)- response|morphogenesis|nucleus|nucleus|regulation of
like 1 transcription, DNA-
dependent|transcription|transcription cofactor
activity|transcription factor activity|transcription from
RNA polymerase II promoter
miR- NM_006469 NS1-BP NS1-binding protein M + P + T RNA splicing|protein binding|response to
145 virus|spliceosome complex|transcription factor
complex|transcription from RNA polymerase III
promoter
miR- NM_019094 NUDT4 nudix (nucleoside P + T calcium-mediated signaling|cyclic nucleotide
145 diphosphate linked metabolism|cyclic-nucleotide-mediated
moiety X)-type motif 4 signaling|diphosphoinositol-polyphosphate
diphosphatase activity|hydrolase
activity|intracellular|intracellular signaling
cascade|intracellular transport|magnesium ion
binding|regulation of RNA-nucleus export
miR- AW149417 OAZ OLF-1/EBF associated P + T nucleic acid binding|nucleus|zinc ion binding
145 zinc finger gene
miR- NM_024586 OSBPL9 oxysterol binding M + P lipid transport|steroid metabolism
145 protein-like 9
miR- AB040812 PAK7 p21(CDKN1A)- M + T ATP binding|protein amino acid
145 activated kinase 7 phosphorylation|protein serine/threonine kinase
activity|transferase activity
miR- NM_014456 PDCD4 programmed cell death M + P + T apoptosis
145 4 (neoplastic
transformation
inhibitor)
miR- NM_002657 PLAGL2 pleiomorphic adenoma M + P + T nucleus|regulation of transcription, DNA-
145 gene-like 2 dependent|transcription|transcription factor
activity|zinc ion binding
miR- AK023546 PLCL2 phospholipase C-like 2 P + T calcium ion binding|intracellular signaling
145 cascade|lipid metabolism|phosphoinositide
phospholipase C activity
miR- AI274352 PLN phospholamban P + T
145
miR- NM_000944 PPP3CA protein phosphatase 3 P + T calcineurin complex|calcium ion binding|calmodulin
145 (formerly 2B), catalytic binding|hydrolase activity|protein amino acid
subunit, alpha isoform dephosphorylation|protein serine/threonine
(calcineurin A alpha) phosphatase activity
miR- BF247371 PRO1843 hypothetical protein M + T
145 PRO1843
miR- NM_000959 PTGFR prostaglandin F receptor P + T G-protein coupled receptor protein signaling
145 (FP) pathway|G-protein coupled receptor protein signaling
pathway|integral to membrane|integral to plasma
membrane|parturition|prostaglandin F receptor
activity|prostaglandin F receptor activity|receptor
activity|rhodopsin-like receptor activity|signal
transduction|thromboxane receptor activity
miR- NM_002890 RASA1 RAS p21 protein P + T Ras GTPase activator activity|intracellular signaling
145 activator (GTPase cascade
activating protein) 1
miR- NM_006506 RASA2 RAS p21 protein P + T Ras GTPase activator activity|intracellular signaling
145 activator 2 cascade
miR- NM_002912 REV3L REV3-like, catalytic M + P + T 3′-5′ exonuclease activity|DNA binding|DNA
145 subunit of DNA repair|DNA replication|DNA-dependent DNA
polymerase zeta (yeast) replication|DNA-directed DNA polymerase
activity|nucleotide binding|nucleus|transferase
activity|zeta DNA polymerase activity|zeta DNA
polymerase complex
miR- NM_002924 RGS7 regulator of G-protein P + T heterotrimeric G-protein complex|intracellular
145 signalling 7 signaling cascade|regulation of G-protein coupled
receptor protein signaling pathway|regulator of G-
protein signaling activity|signal transducer activity
miR- AL136924 RIN2 Ras and Rab interactor 2 P + T GTPase activator activity|Rab guanyl-nucleotide
145 exchange factor activity|cellular_component
unknown|endocytosis|intracellular signaling
cascade|small GTPase mediated signal
transduction|small GTPase regulator activity
miR- BE463945 RTKN rhotekin P + T intracellular|protein binding|signal transduction|signal
145 transduction
miR- AF225986 SCN3A sodium channel, P + T cation channel activity|cation transport|integral to
145 voltage-gated, type III, membrane|membrane|sodium ion transport|voltage-
alpha polypeptide gated sodium channel activity|voltage-gated sodium
channel complex
miR- NM_006080 SEMA3A sema domain, P + T cell differentiation|extracellular region|neurogenesis
145 immunoglobulin
domain (Ig), short basic
domain, secreted,
(semaphorin) 3A
miR- NM_020796 SEMA6A sema domain, P + T apoptosis|axonlaxon guidance|cell differentiation|cell
145 transmembrane domain surface receptor linked signal
(TM), and cytoplasmic transduction|cytoskeleton organization and
domain, (semaphorin) biogenesis|development|integral to
6A membrane|membrane|neurogenesis|protein
binding|receptor activity
miR- NM_004171 SLC1A2 solute carrier family 1 P + T L-glutamate transport|L-glutamate transporter
145 (glial high affinity activity|dicarboxylic acid transport|integral to
glutamate transporter), membrane|membrane|membrane
member 2 fraction|sodium:dicarboxylate symporter
activity|symporter activity|synaptic
transmission|transport
miR- NM_003759 SLC4A4 solute carrier family 4, P + T anion transport|inorganic anion exchanger
145 sodium bicarbonate activity|integral to membrane|integral to plasma
cotransporter, member 4 membrane|membrane|sodium:bicarbonate symporter
activity|transport
miR- NM_030918 SNX27 hypothetical protein M + P + T intracellular signaling cascade|protein binding|protein
145 My014 transport
miR- AI360875 SOX11 SRY (sex determining M + T DNA binding|neurogenesis|nucleus|regulation of
145 region Y)-box 11 transcription, DNA-dependent|transcription
miR- NM_000346 SOX9 SRY (sex determining P + T DNA binding|cartilage
145 region Y)-box 9 condensation|nucleus|regulation of transcription from
(campomelic dysplasia, RNA polymerase II promoter|skeletal
autosomal sex-reversal) development|specific RNA polymerase II
transcription factor activity|transcription
miR- AK023899 SRGAP1 SLIT-ROBO Rho P + T GTPase activator activity
145 GTPase activating
protein 1
miR- NM_003155 STC1 stanniocalcin 1 M + T calcium ion homeostasis|cell surface receptor linked
145 signal transduction|cell-cell signaling|extracellular
region|hormone activity|response to nutrients
miR- BE219311 TIMM22 translocase of inner M + P + T integral to membrane|mitochondrial inner
145 mitochondrial membrane|mitochondrion|protein transport|protein
membrane 22 homolog transporter activity
(yeast)
miR- AA705845 TLE4 transducin-like M + P frizzled signaling pathway|molecular_function
145 enhancer of split 4 unknown|nucleus|nucleus|regulation of
(E(sp1) homolog, transcription|regulation of transcription, DNA-
Drosophila) dependent
miR- BC005016 TRIM2 tripartite motif- P + T cytoplasm|myosin binding|protein
145 containing 2 ubiquitination|ubiquitin ligase complex|ubiquitin-
protein ligase activity|zinc ion binding
miR- NM_025076 UXS1 UDP-glucuronate M + P + T carbohydrate metabolism|isomerase
145 decarboxylase 1 activity|nucleotide-sugar metabolism
miR- NM_005433 YES1 v-yes-1 Yamaguchi P + T ATP binding|intracellular signaling cascade|protein
145 sarcoma viral oncogene amino acid phosphorylation|protein-tyrosine kinase
homolog 1 activity|transferase activity
miR- BC003128 ZDHHC9 zinc finger, DHHC P + T integral to membrane|metal ion binding
145 domain containing 9
miR- NM_019903 ADD3 adducin 3 (gamma) P + T calmodulin binding|cytoskeleton|membrane|structural
155 constituent of cytoskeleton
miR- NM_020661 AICDA activation-induced P + T B-cell differentiation|cellular_component
155 cytidine deaminase unknown|cytidine deaminase activity|hydrolase
activity|mRNA processing|zinc ion binding
miR- NM_007202 AKAP10 A kinase (PRKA) P + T kinase activity|mitochondrion|protein binding|protein
155 anchor protein 10 localization|signal transducer activity|signal
transduction
miR- AI806395 ALFY ALFY P + T binding|zinc ion binding
155
miR- NM_000038 APC adenomatosis polyposis P + T Wnt receptor signaling pathway|beta-catenin
155 coli binding|cell adhesion|microtubule binding|negative
regulation of cell cycle|protein complex
assembly|signal transduction
miR- NM_017610 ARK Arkadia P + T protein ubiquitination|ubiquitin ligase
155 complex|ubiquitin-protein ligase activity|zinc ion
binding
miR- BG032269 ARL8 ADP-ribosylation-like M + P + T GTP binding|small GTPase mediated signal
155 factor 8 transduction
miR- AB000815 ARNTL aryl hydrocarbon P + T circadian rhythm|nucleus|regulation of transcription,
155 receptor nuclear DNA-dependent|signal transducer activity|signal
translocator-like transduction|transcription|transcription factor activity
miR- NM_001670 ARVCF armadillo repeat gene P + T cell adhesion|cytoskeleton|development|protein
155 deletes in binding|structural molecule activity
velocardiofacial
syndrome
miR- AK024064 ASTN2 astrotactin 2 P + T integral to membrane
155
miR- M95541 ATP2B1 ATPase, Ca++ M + P + T ATP binding|calcium ion binding|calcium ion
155 transporting, plasma transport|calcium-transporting ATPase
membrane 1 activity|calmodulin binding|cation transport|hydrolase
activity|hydrolase activity, acting on acid anhydrides,
catalyzing transmembrane movement of
substances|integral to plasma membrane|magnesium
ion binding|membrane|metabolism
miR- NM_001186 BACH1 BTB and CNC P + T DNA binding|nucleus|protein binding|regulation of
155 homology 1, basic transcription, DNA-
leucine zipper dependent|transcription|transcription factor activity
transcription factor 1
miR- NM_007005 BCE-1 BCE-1 protein P + T frizzled signaling pathway|molecular_function
155 unknown|nucleus|nucleus|regulation of
transcription|regulation of transcription, DNA-
dependent
miR- NM_022893 BCL11A B-cell CLL/lymphoma P + T cytoplasm|hemopoiesis|nucleic acid
155 11A (zinc finger binding|nucleus|nucleus|regulation of transcription,
protein) DNA-dependent|transcription|zinc ion binding
miR- NM_001709 BDNF brain-derived M + T growth factor activity|growth factor
155 neurotrophic factor activity|neurogenesis
miR- NM_014577 BRD1 bromodomain P + T DNA binding|cell cycle|nucleus|nucleus|regulation of
155 containing 1 transcription, DNA-dependent
miR- NM_024529 C1orf28 chromosome 1 open M + P + T
155 reading frame 28
miR- NM_000719 CACNA1C calcium channel, P + T calcium ion binding|calcium ion transport|cation
155 voltage-dependent, L transport|integral to membrane|ion channel
type, alpha 1C subunit activity|ion transport|membrane|regulation of heart
contraction rate|voltage-gated calcium channel
activity|voltage-gated calcium channel
activity|voltage-gated calcium channel
complex|voltage-gated calcium channel complex
miR- AL118798 CD47 CD47 antigen (Rh- P + T cell-matrix adhesion|integral to plasma
155 related antigen, membrane|integrin-mediated signaling
integrin-associated pathway|plasma membrane|protein binding
signal transducer)
miR- AL564683 CEBPB CCAAT/enhancer M + P + T acute-phase response|inflammatory
155 binding protein response|nucleus|regulation of transcription, DNA-
(C/EBP), beta dependent|transcription|transcription factor
activity|transcription from RNA polymerase II
promoter
miR- NM_007023 CGEF2 cAMP-regulated M + P 3′,5′-cAMP binding|G-protein coupled receptor
155 guanine nucleotide protein signaling pathway|cAMP-dependent protein
exchange factor II kinase complex|cAMP-dependent protein kinase
regulator activity|exocytosis|guanyl-nucleotide
exchange factor activity|membrane fraction|nucleotide
binding|protein amino acid phosphorylation|small
GTPase mediated signal transduction
miR- AU152178 CMG2 capillary P + T integral to membrane|receptor activity
155 morphogenesis protein 2
miR- NM_005776 CNIH cornichon homolog P + T immune response|integral to membrane|intracellular
155 (Drosophila) signaling cascade|membrane
miR- AW241703 CNTN4 Homo sapiens cDNA P + T cell adhesion|membrane|protein binding
155 FLJ32716 fis, clone
TESTI2000808, highly
similar to Rattus
norvegicus neural cell
adhesion protein BIG-2
precursor (BIG-2)
mRNA, mRNA
sequence
miR- NM_000094 COL7A1 collagen, type VII, P + T basement membrane|cell adhesion|collagen type
155 alpha 1 (epidermolysis VII|cytoplasm|epidermis development|phosphate
bullosa, dystrophic, transport|protein binding|serine-type endopeptidase
dominant and recessive) inhibitor activity|structural molecule activity
miR- NM_003653 COPS3 COP9 constitutive P + T signalosome complex
155 photomorphogenic
homolog subunit 3
(Arabidopsis)
miR- NM_005211 CSF1R colony stimulating M + P + T ATP binding|antimicrobial humoral response (sensu
155 factor 1 receptor, Vertebrata)|cell proliferation|development|integral to
formerly McDonough plasma membrane|macrophage colony stimulating
feline sarcoma viral (v- factor receptor activity|plasma membrane|protein
fms) oncogene homolog amino acid phosphorylation|receptor activity|signal
transduction|transferase activity|transmembrane
receptor protein tyrosine kinase signaling pathway
miR- NM_001892 CSNK1A1 casein kinase 1, alpha 1 P + T ATP binding|Wnt receptor signaling pathway|casein
155 kinase I activity|protein amino acid
phosphorylation|protein amino acid
phosphorylation|protein serine/threonine kinase
activity|protein-tyrosine kinase activity|transferase
activity
miR- NM_005214 CTLA4 cytotoxic T- P + T immune response|immune response|integral to plasma
155 lymphocyte-associated membrane|membrane
protein 4
miR- U69546 CUGBP2 CUG triplet repeat, M + P + T RNA binding|RNA binding|RNA
155 RNA binding protein 2 processing|neuromuscular junction
development|nucleotide binding|regulation of heart
contraction rate
miR- NM_030927 DC- tetraspanin similar to P + T integral to membrane
155 TM4F2 TM4SF9
miR- NM_015652 DKFZP564P1916 DKFZP564P1916 P + T
155 protein
miR- AF151831 DKFZP566C134 DKFZP566C134 P + T protein binding
155 protein
miR- NM_004411 DNCI1 dynein, cytoplasmic, P + T cytoplasmic dynein complex|motor activity
155 intermediate
polypeptide 1
miR- NM_001400 EDG1 endothelial P + T G-protein coupled receptor protein signaling
155 differentiation, pathway|cell adhesion|integral to plasma
sphingolipid G-protein- membrane|lysosphingolipid and lysophosphatidic acid
coupled receptor, 1 receptor activity|plasma membrane|receptor
activity|signal transduction
miR- NM_006795 EHD1 EH-domain containing 1 P + T ATP binding|GTP binding|GTPase
155 activity|biological_process unknown|calcium ion
binding|cellular_component unknown
miR- NM_012081 ELL2 ELL-related RNA M + P + T RNA elongation from RNA polymerase II
155 polymerase II, promoter|RNA polymerase II transcription factor
elongation factor activity|nucleus|regulation of transcription, DNA-
dependent|transcription|transcription elongation factor
complex
miR- NM_005238 ETS1 v-ets erythroblastosis P + T RNA polymerase II transcription factor
155 virus E26 oncogene activity|immune response|negative regulation of cell
homolog 1 (avian) proliferation|nucleus|regulation of transcription,
DNA-dependent|transcription|transcription factor
activity|transcription from RNA polymerase II
promoter
miR- NM_002009 FGF7 fibroblast growth factor P + T cell proliferation|cell-cell signaling|epidermis
155 7 (keratinocyte growth development|extracellular region|growth factor
factor) activity|positive regulation of cell
proliferation|regulation of cell cycle|response to
wounding|signal transduction
miR- NM_018208 FLJ10761 hypothetical protein P + T biological_process unknown|cellular_component
155 FLJ10761 unknown|choline kinase activity|transferase activity
miR- NM_018243 FLJ10849 hypothetical protein P + T GTP binding|cell cycle|cytokinesis
155 FLJ10849
miR- NM_022064 FLJ12565 hypothetical protein P + T ligase activity|protein ubiquitination|ubiquitin ligase
155 FLJ12565 complex|ubiquitin-protein ligase activity|zinc ion
binding
miR- NM_018391 FLJ23277 FLJ23277 protein P + T
155
miR- NM_021078 GCN5L2 GCN5 general control M + P + T N-acetyltransferase activity|chromatin
155 of amino-acid synthesis remodeling|histone acetyltransferase activity|histone
5-like 2 (yeast) deacetylase binding|nucleus|protein amino acid
acetylation|regulation of transcription from RNA
polymerase II promoter|transcription|transcription
coactivator activity|transferase activity
miR- NM_018178 GPP34R hypothetical protein P + T
155 FLJ10687
miR- AF019214 HBP1 HMG-box containing M + P DNA binding|nucleus|regulation of transcription,
155 protein 1 DNA-dependent
miR- NM_006037 HDAC4 histone deacetylase 4 P + T B-cell differentiation|cell cycle|chromatin
155 modification|cytoplasm|development|histone
deacetylase activity|histone deacetylase
complex|hydrolase activity|inflammatory
response|negative regulation of
myogenesis|neurogenesis|nucleus|regulation of
transcription, DNA-
dependent|transcription|transcription factor
binding|transcriptional repressor activity
miR- NM_001530 HIF1A hypoxia-inducible P + T RNA polymerase II transcription factor activity,
155 factor 1, alpha subunit enhancer binding|electron transport|histone
(basic helix-loop-helix acetyltransferase
transcription factor) binding|homeostasis|nucleus|nucleus|protein
heterodimerization activity|protein heterodimerization
activity|regulation of transcription, DNA-
dependent|response to hypoxia|signal transducer
activity|signal transduction|signal
transduction|transcription factor activity
miR- AL023584 HIVEP2 human P + T
155 immunodeficiency virus
type I enhancer binding
protein 2
miR- AI682088 HLCS holocarboxylase P + T biotin-[acetyl-CoA-carboxylase] ligase activity|biotin-
155 synthetase (biotin- [methylcrotonoyl-CoA-carboxylase] ligase
[proprionyl-Coenzyme activity|biotin-[methylmalonyl-CoA-
A-carboxylase (ATP- carboxytransferase] ligase activity|biotin-[propionyl-
hydrolysing)] ligase) CoA-carboxylase (ATP-hydrolyzing)] ligase
activity|ligase activity|protein modification
miR- NM_020190 HNOEL- HNOEL-iso protein P + T
155 iso
miR- NM_014002 IKBKE inhibitor of kappa light P + T ATP binding|NF-kappaB-inducing kinase
155 polypeptide gene activity|cytoplasm|immune response|positive
enhancer in B-cells, regulation of I-kappaB kinase/NF-kappaB
kinase epsilon cascade|protein amino acid phosphorylation|protein
serine/threonine kinase activity|signal transducer
activity|transferase activity
miR- D13720 ITK IL2-inducible T-cell P + T ATP binding|cellular defense response|intracellular
155 kinase signaling cascade|non-membrane spanning protein
tyrosine kinase activity|protein amino acid
phosphorylation|transferase activity
miR- NM_002249 KCNN3 potassium P + T calcium-activated potassium channel activity|calcium-
155 intermediate/small activated potassium channel activity|calmodulin
conductance calcium- binding|integral to membrane|ion channel activity|ion
activated channel, transport|membrane|membrane
subfamily N, member 3 fraction|neurogenesis|potassium ion
transport|potassium ion transport|small conductance
calcium-activated potassium channel activity|synaptic
transmission|voltage-gated potassium channel
complex
miR- AB033100 KIAA1274 KIAA protein (similar P + T protein tyrosine phosphatase activity
155 to mouse paladin)
miR- NM_017780 KIAA1416 KIAA1416 protein P + T ATP binding|chromatin|chromatin assembly or
155 disassembly|chromatin binding|helicase
activity|nucleus
miR- NM_002264 KPNA1 karyopherin alpha 1 P + T NLS-bearing substrate-nucleus
155 (importin alpha 5) import|cytoplasm|intracellular protein
transport|nuclear localization sequence
binding|nuclear pore|nucleus|protein binding|protein
transporter activity|regulation of DNA recombination
miR- AK021602 KPNA4 karyopherin alpha 4 P + T NLS-bearing substrate-nucleus
155 (importin alpha 3) import|binding|intracellular protein
transport|nucleus|protein transporter activity
miR- NM_020354 LALP1 lysosomal apyrase-like M + P + T hydrolase activity
155 protein 1
miR- AW242408 LOC151531 Similar to uridine M + P + T cytosol|nucleoside metabolism|nucleotide
155 phosphorylase [Homo catabolism|protein binding|transferase activity,
sapiens], mRNA transferring glycosyl groups|type III intermediate
sequence filament|uridine metabolism|uridine phosphorylase
activity
miR- NM_016210 LOC51161 g20 protein P + T
155
miR- NM_018557 LRP1B low density lipoprotein- P + T calcium ion binding|integral to membrane|low-density
155 related protein 1B lipoprotein receptor activity|membrane|protein
(deleted in tumors) transport|receptor activity|receptor mediated
endocytosis
miR- NM_002446 MAP3K10 mitogen-activated M + P + T ATP binding|JUN kinase kinase kinase
155 protein kinase kinase activity|activation of
kinase 10 JNK|autophosphorylation|induction of
apoptosis|protein homodimerization activity|protein
serine/threonine kinase activity|protein-tyrosine
kinase activity|signal transduction|transferase activity
miR- NM_003954 MAP3K14 mitogen-activated P + T ATP binding|protein amino acid
155 protein kinase kinase phosphorylation|protein serine/threonine kinase
kinase 14 activity|transferase activity
miR- AL117407 MAP3K7IP2 mitogen-activated P + T kinase activity|positive regulation of I-kappaB
155 protein kinase kinase kinase/NF-kappaB cascade|positive regulation of I-
kinase 7 interacting kappaB kinase/NF-kappaB cascade|signal transducer
protein 2 activity|signal transducer activity
miR- NM_004992 MECP2 methyl CpG binding M + P + T DNA binding|negative regulation of transcription
155 protein 2 (Rett from RNA polymerase II promoter|nucleus|regulation
syndrome) of transcription, DNA-
dependent|transcription|transcription corepressor
activity
miR- NM_002398 MEIS1 Meis1, myeloid M + P + T RNA polymerase II transcription factor
155 ecotropic viral activity|nucleus|regulation of transcription, DNA-
integration site 1 dependent|transcription factor activity
homolog (mouse)
miR- NM_016289 MO25 MO25 protein P + T
155
miR- AA621962 MYO1D myosin ID M + P + T ATP bindinglactin binding|calmodulin binding|motor
155 activity|myosin
miR- NM_030571 N4WBP5 likely ortholog of P + T positive regulation of I-kappaB kinase/NF-kappaB
155 mouse Nedd4 WW cascade|signal transducer activity
binding protein 5
miR- NM_014903 NAV3 neuron navigator 3 P + T ATP binding|mitochondrion|nucleoside-
155 triphosphatase activity|nucleotide binding
miR- NM_030571 NDFIP1 likely ortholog of P + T positive regulation of I-kappaB kinase/NF-kappaB
155 mouse Nedd4 WW cascade|signal transducer activity
binding protein 5
miR- NM_006599 NFAT5 nuclear factor of M + P + T RNA polymerase II transcription factor
155 activated T-cells 5, activity|excretion|nucleus|regulation of transcription,
tonicity-responsive DNA-dependent|signal transduction|transcription
factor activity|transcription from RNA polymerase II
promoter
miR- NM_002515 NOVA1 neuro-oncological M + P + T RNA binding|RNA binding|RNA splicing|RNA
155 ventral antigen 1 splicing|locomotory behavior|locomotory
behavior|nucleus|synaptic transmission|synaptic
transmission
miR- AI373299 PANK1 pantothenate kinase 1 P + T ATP binding|coenzyme A biosynthesis|pantothenate
155 kinase activity|transferase activity
miR- BG110231 PAPOLA poly(A) polymerase P + T RNA binding|cytoplasm|mRNA
155 alpha polyadenylylation|mRNA
processing|nucleus|polynucleotide adenylyltransferase
activity|transcription|transferase activity
miR- NM_020403 PCDH9 protocadherin 9 M + P + T calcium ion binding|cell adhesion|homophilic cell
155 adhesion|integral to membrane|membrane|protein
binding
miR- NM_002655 PLAG1 pleiomorphic adenoma P + T nucleic acid binding|nucleus|transcription factor
155 gene 1 activity|zinc ion binding
miR- AJ272212 PSKH1 protein serine kinase H1 P + T ATP binding|Golgi apparatus|nucleus|protein amino
155 acid phosphorylation|protein serine/threonine kinase
activity|transferase activity
miR- NM_014904 Rab11- KIAA0941 protein P + T
155 FIP2
miR- AF322067 RAB34 RAB34, member RAS P + T GTP binding|Golgi apparatus|protein transport|small
155 oncogene family GTPase mediated signal transduction
miR- NM_002869 RAB6A RAB6A, member RAS M + P + T GTP binding|GTPase activity|Golgi apparatus|protein
155 oncogene family transport|small GTPase mediated signal transduction
miR- AL136727 RAB6C RAB6C, member RAS M + P + T GTP binding|GTPase activity|intracellular|protein
155 oncogene family transport|response to drug|small GTPase mediated
signal transduction
miR- NM_002902 RCN2 reticulocalbin 2, EF- P + T calcium ion binding|endoplasmic reticulum|protein
155 hand calcium binding binding
domain
miR- AJ223321 RP58 zinc finger protein 238 M + P + T
155
miR- NM_002968 SALL1 sal-like 1 (Drosophila) P + T morphogenesis|nucleus|regulation of transcription,
155 DNA-dependent|transcription|transcription factor
activity|zinc ion binding
miR- NM_002971 SATB1 special AT-rich P + T double-stranded DNA binding|establishment and/or
155 sequence binding maintenance of chromatin
protein 1 (binds to architecture|nucleus|regulation of transcription, DNA-
nuclear matrix/scaffold- dependent|transcription factor activity
associating DNA's)
miR- NM_003469 SCG2 secretogranin II P + T calcium ion binding|protein secretion
155 (chromogranin C)
miR- NM_005625 SDCBP syndecan binding P + T actin cytoskeleton organization and
155 protein (syntenin) biogenesis|adherens junction|cytoskeletal adaptor
activity|cytoskeleton|endoplasmic
reticulum|interleukin-5 receptor binding|interleukin-5
receptor complex|intracellular signaling
cascade|metabolism|neurexin
binding|nucleus|oxidoreductase activity|plasma
membrane|protein binding|protein heterodimerization
activity|protein-membrane targeting|substrate-bound
cell migration, cell extension|synaptic
transmission|syndecan binding
miR- NM_000232 SGCB sarcoglycan, beta P + T cytoskeleton|cytoskeleton organization and
155 (43 kDa dystrophin- biogenesis|integral to plasma membrane|muscle
associated glycoprotein) development|sarcoglycan complex
miR- NM_013257 SGKL serum/glucocorticoid P + T ATP binding|intracellular signaling cascade|protein
155 regulated kinase-like amino acid phosphorylation|protein amino acid
phosphorylation|protein serine/threonine kinase
activity|protein serine/threonine kinase
activity|protein-tyrosine kinase activity|response to
stress|transferase activity
miR- NM_005069 SIM2 single-minded homolog P + T cell differentiation|neurogenesis|nucleus|regulation of
155 2 (Drosophila) transcription, DNA-dependent|signal transducer
activity|signal transduction|transcription|transcription
factor activity
miR- AA927480 SKI v-ski sarcoma viral P + T
155 oncogene homolog
(avian)
miR- NM_006748 SLA Src-like-adaptor P + T SH3/SH2 adaptor activity|intracellular signaling
155 cascade
miR- AI684141 SMARCA4 SWI/SNF related, P + T ATP binding|DNA binding|helicase activity|helicase
155 matrix associated, actin activity|hydrolase
dependent regulator of activity|nucleoplasm|nucleus|regulation of
chromatin, subfamily a, transcription from RNA polymerase II
member 4 promoter|transcription|transcription coactivator
activity|transcription factor activity
miR- AB005043 SOCS1 suppressor of cytokine M + P + T JAK-STAT cascade|cytoplasm|insulin-like growth
155 signaling 1 factor receptor binding|intracellular signaling
cascade|negative regulation of JAK-STAT
cascade|protein kinase binding|protein kinase inhibitor
activity|regulation of cell growth|ubiquitin cycle
miR- NM_004232 SOCS4 suppressor of cytokine M + P JAK-STAT cascade|cytoplasm|defense
155 signaling 4 response|intracellular signaling cascade|regulation of
cell growth
miR- NM_005986 SOX1 SRY (sex determining P + T DNA binding|establishment and/or maintenance of
155 region Y)-box 1 chromatin architecture|nucleus|regulation of
transcription, DNA-dependent|regulation of
transcription, DNA-dependent|transcription factor
activity
miR- AI360875 SOX11 SRY (sex determining M + T DNA binding|neurogenesis|nucleus|regulation of
155 region Y)-box 11 transcription, DNA-dependent|transcription
miR- AL136780 SOX6 SRY (sex determining P + T establishment and/or maintenance of chromatin
155 region Y)-box 6 architecture|heart development|muscle
development|nucleus|regulation of transcription,
DNA-dependent|transcription|transcription factor
activity
miR- AW470841 SP3 Sp3 transcription factor P + T DNA binding|nucleus|regulation of transcription,
155 DNA-dependent|transcription|transcriptional activator
activity|transcriptional repressor activity|zinc ion
binding
miR- BF224259 SPF30 splicing factor 30, P + T RNA splicing|RNA splicing factor activity,
155 survival of motor transesterification
neuron-related mechanism|apoptosis|cytoplasm|induction of
apoptosis|spliceosome assembly|spliceosome complex
miR- NM_003120 SPI1 spleen focus forming M + T negative regulation of transcription from RNA
155 virus (SFFV) proviral polymerase II promoter|nucleus|regulation of
integration oncogene transcription, DNA-
spi1 dependent|transcription|transcription factor activity
miR- BE676214 SSH2 slingshot 2 P + T protein amino acid dephosphorylation|protein
155 tyrosine/serine/threonine phosphatase activity
miR- AF159447 SUFU suppressor of fused P + T cell cycle|cytoplasm|development|negative regulation
155 homolog (Drosophila) of cell cycle|nucleus|proteolysis and
peptidolysis|signal transducer activity|signal
transduction|skeletal development|transcription
corepressor activity
miR- NM_006754 SYPL synaptophysin-like M + P + T integral to plasma membrane|membrane|synaptic
155 protein transmission|synaptic vesicle|transport|transporter
activity
miR- NM_006286 TFDP2 transcription factor Dp- P + T DNA metabolism|nucleus|regulation of cell
155 2 (E2F dimerization cycle|regulation of transcription from RNA
partner 2) polymerase II promoter|transcription|transcription
cofactor activity|transcription factor
activity|transcription factor complex
miR- AA705845 TLE4 transducin-like P + T frizzled signaling pathway|molecular_function
155 enhancer of split 4 unknown|nucleus|nucleus|regulation of
(E(sp1) homolog, transcription|regulation of transcription, DNA-
Drosophila) dependent
miR- NM_014765 TOMM20 translocase of outer P + T integral to membrane|mitochondrial outer membrane
155 mitochondrial translocase complex|mitochondrion|outer
membrane 20 (yeast) membrane|protein translocase activity|protein-
homolog mitochondrial targeting
miR- AW341649 TP53INP1 tumor protein p53 P + T apoptosis|nucleus
155 inducible nuclear
protein 1
miR- BC005016 TRIM2 tripartite motif- P + T cytoplasm|myosin binding|protein
155 containing 2 ubiquitination|ubiquitin ligase complex|ubiquitin-
protein ligase activity|zinc ion binding
miR- AA524505 TSGA zinc finger protein P + T nucleus
155
miR- AW157525 TSGA14 testis specific, 14 M + P + T centrosome
155
miR- X62048 WEE1 WEE1 homolog (S. pombe) P + T ATP binding|cytokinesis|mitosis|nucleus|protein
155 amino acid phosphorylation|protein serine/threonine
kinase activity|protein-tyrosine kinase
activity|regulation of cell cycle|transferase activity
miR- AC005539 WUGSC:H_NH0335J18.1 Similar to uridine M + P + T
155 phosphorylase [Homo
sapiens], mRNA
sequence
miR- NM_003413 ZIC3 Zic family member 3 P + T DNA binding|determination of left/right
155 heterotaxy 1 (odd- symmetry|nucleus|regulation of transcription, DNA-
paired homolog, dependent|transcription|zinc ion binding
Drosophila)
miR- NM_007345 ZNF236 zinc finger protein 236 P + T nucleus|regulation of transcription, DNA-
155 dependent|transcription|transcription factor
activity|zinc ion binding
miR- NM_006352 ZNF238 zinc finger protein 238 M + P + T chromosome organization and biogenesis (sensu
155 Eukaryota)|negative regulation of transcription from
RNA polymerase II promoter|nuclear
chromosome|nucleic acid binding|nucleus|protein
binding|protein binding|regulation of transcription,
DNA-dependent|specific RNA polymerase II
transcription factor activity|transcription|transcription
factor activity|transport|zinc ion binding
miR-21 NM_005164 ABCD2 ATP-binding cassette, M + P ATP binding|ATP-binding cassette (ABC) transporter
sub-family D (ALD), complex|ATPase activity|ATPase activity, coupled to
member 2 transmembrane movement of substances|fatty acid
metabolism|integral to plasma
membrane|membrane|peroxisome|transport
miR-21 NM_001616 ACVR2 activin A receptor, type P + T ATP binding|integral to plasma
II membrane|membrane|protein amino acid
phosphorylation|receptor activity|transferase
activity|transforming growth factor beta receptor
activity|transmembrane receptor protein
serine/threonine kinase signaling pathway
miR-21 NM_015339 ADNP activity-dependent P + T nucleus|regulation of transcription, DNA-
neuroprotector dependent|transcription factor activity|zinc ion
binding
miR-21 AI990366 ARHGEF7 Rho guanine nucleotide P + T guanyl-nucleotide exchange factor activity|signal
exchange factor (GEF) 7 transduction
miR-21 NM_017610 ARK Arkadia P + T protein ubiquitination|ubiquitin ligase
complex|ubiquitin-protein ligase activity|zinc ion
binding
miR-21 NM_014034 ASF1A DKFZP547E2110 P + T chromatin binding|loss of chromatin silencing|nucleus
protein
miR-21 NM_017680 ASPN asporin (LRR class 1) P + T
miR-21 NM_000657 BCL2 B-cell CLL/lymphoma 2 P + T anti-apoptosis|endoplasmic reticulum|humoral
immune response|integral to
membrane|membrane|mitochondrial outer
membrane|mitochondrial outer
membrane|mitochondrion|negative regulation of cell
proliferation|nucleus|protein binding|regulation of
apoptosis|regulation of cell cycle|release of
cytochrome c from mitochondria
miR-21 NM_014577 BRD1 bromodomain P + T DNA binding|cell cycle|nucleus|nucleus|regulation of
containing 1 transcription, DNA-dependent
miR-21 AA902767 BRD2 bromodomain P + T nucleus|protein serine/threonine kinase
containing 2 activity|spermatogenesis
miR-21 NM_014962 BTBD3 BTB (POZ) domain P + T protein binding
containing 3
miR-21 NM_006763 BTG2 BTG family, member 2 P + T DNA repair|negative regulation of cell
proliferation|regulation of transcription, DNA-
dependent|transcription|transcription factor activity
miR-21 AK025768 C20orf99 chromosome 20 open P + T nucleic acid binding
reading frame 99
miR-21 AI671238 CAPN3 Homo sapiens cDNA P + T calcium ion binding|calpain activity|calpain
FLJ23750 fis, clone activity|intracellular|intracellular|muscle
HEP16527, mRNA development|proteolysis and peptidolysis|proteolysis
sequence and peptidolysis|signal transducer activity
miR-21 NM_002981 CCL1 chemokine (C-C motif) P + T calcium ion homeostasis|cell-cell signaling|chemokine
ligand 1 activity|chemotaxis|extracellular space|inflammatory
response|sensory perception|signal transduction|viral
life cycle
miR-21 BF939071 CCM1 cerebral cavernous M + P binding|catalytic activity|cytoskeleton|small GTPase
malformations 1 mediated signal transduction|small GTPase regulator
activity
miR-21 NM_001789 CDC25A cell division cycle 25A AP + T cell proliferation|cytokinesis|hydrolase
activity|intracellular|mitosis|protein amino acid
dephosphorylation|protein tyrosine phosphatase
activity|regulation of cyclin dependent protein kinase
activity
miR-21 NM_001842 CNTFR ciliary neurotrophic M + P + T ciliary neurotrophic factor receptor activity|cytokine
factor receptor binding|extrinsic to membrane|neurogenesis|receptor
activity|signal transduction
miR-21 NM_001310 CREBL2 cAMP responsive P + T nucleus|regulation of transcription, DNA-
element binding dependent|signal
protein-like 2 transduction|transcription|transcription factor activity
miR-21 NM_016441 CRIM1 cysteine-rich motor M + P + T insulin-like growth factor receptor activity|integral to
neuron 1 membrane|membrane fraction|neurogenesis|serine-
type endopeptidase inhibitor activity
miR-21 NM_015396 DKFZP434A043 DKFZP434A043 P + T cell adhesion|cytoskeleton|mitotic chromosome
protein condensation|protein binding|structural molecule
activity
miR-21 AL047650 DKFZp434A2417 endozepine-related P + T acyl-CoA binding
protein precursor
miR-21 AB028628 DKFZP547E2110 DKFZP547E2110 P + T chromatin binding|loss of chromatin silencing|nucleus
protein
miR-21 NM_031305 DKFZP564B1162 hypothetical protein P + T GTPase activator activity
DKFZp564B1162
miR-21 NM_004405 DLX2 distal-less homeo box 2 P + T brain development|development|nucleus|regulation of
transcription, DNA-dependent|transcription factor
activity
miR-21 NM_001949 E2F3 E2F transcription factor 3 M + P + T nucleus|protein binding|regulation of cell
cycle|regulation of transcription, DNA-
dependent|transcription|transcription factor
activity|transcription factor complex|transcription
initiation from RNA polymerase II promoter
miR-21 NM_006795 EHD1 EH-domain containing 1 P + T ATP binding|GTP binding|GTPase
activity|biological_process unknown|calcium ion
binding|cellular_component unknown
miR-21 NM_001412 EIF1A eukaryotic translation P + T RNA binding|eukaryotic translation initiation factor
initiation factor 1A 4F complex|protein biosynthesis|translation initiation
factor activity|translational initiation|translational
initiation
miR-21 AI832074 EIF2C2 eukaryotic translation P + T cellular_component unknown|protein
initiation factor 2C, 2 biosynthesis|translation initiation factor activity
miR-21 NM_006874 ELF2 E74-like factor 2 (ets P + T nucleus|nucleus|protein binding|protein
domain transcription binding|regulation of transcription from RNA
factor) polymerase II promoter|regulation of transcription,
DNA-dependent|transcription factor
activity|transcriptional activator
activity|transcriptional activator activity
miR-21 NM_004438 EPHA4 EphA4 P + T ATP binding|ephrin receptor activity|integral to
plasma membrane|membrane|protein amino acid
phosphorylation|receptor activity|signal
transduction|transferase activity|transmembrane
receptor protein tyrosine kinase signaling pathway
miR-21 BE888593 FLJ11220 hypothetical protein P + T
FLJ11220
miR-21 NM_017637 FLJ20043 hypothetical protein P + T nucleic acid binding|nucleus|zinc ion binding
FLJ20043
miR-21 AF019214 HBP1 HMG-box containing M + P + T DNA binding|nucleus|regulation of transcription,
protein 1 DNA-dependent
miR-21 NM_000214 JAG1 jagged 1 (Alagille M + P + T Notch binding|Notch signaling
syndrome) pathway|angiogenesis|calcium ion binding|calcium
ion binding|cell communication|cell fate
determination|development|endothelial cell
differentiation|extracellular region|growth factor
activity|hemopoiesis|integral to plasma
membrane|keratinocyte
differentiation|membrane|myoblast
differentiation|neurogenesis|regulation of cell
migration|regulation of cell proliferation|structural
molecule activity
miR-21 NM_002232 KCNA3 potassium voltage-gated M + P + T cation transport|delayed rectifier potassium channel
channel, shaker-related activity|integral to membrane|membrane|membrane
subfamily, member 3 fraction|potassium ion transport|voltage-gated
potassium channel complex
miR-21 NM_014766 KIAA0193 KIAA0193 gene P + T cellular_component unknown|dipeptidase
product activity|exocytosis|proteolysis and peptidolysis
miR-21 NM_014912 KIAA0940 KIAA0940 protein M + P + T nucleic acid binding
miR-21 NM_014952 KIAA0945 KIAA0945 protein P + T DNA binding
miR-21 NM_017780 KIAA1416 KIAA1416 protein P + T ATP binding|chromatin|chromatin assembly or
disassembly|chromatin binding|helicase
activity|nucleus
miR-21 AB040901 KIAA1468 KIAA1468 protein P + T binding|mitotic chromosome condensation
miR-21 U90268 Krit1 cerebral cavernous M + P binding|catalytic activity|cytoskeleton|small GTPase
malformations 1 mediated signal transduction|small GTPase regulator
activity
miR-21 BF591611 LOC147632 hypothetical protein P + T oxidoreductase activity|zinc ion binding
BC010734
miR-21 NM_005904 MADH7 MAD, mothers against P + T intracellular|protein binding|receptor signaling protein
decapentaplegic serine/threonine kinase signaling protein
homolog 7 (Drosophila) activity|regulation of transcription, DNA-
dependent|response to
stress|transcription|transforming growth factor beta
receptor signaling pathway|transforming growth
factor beta receptor, inhibitory cytoplasmic mediator
activity
miR-21 NM_025146 MAK3P likely ortholog of P + T N-acetyltransferase activity
mouse Mak3p homolog
(S. cerevisiae)
miR-21 NM_014319 MAN1 integral inner nuclear P + T integral to membrane|integral to nuclear inner
membrane protein membrane|membrane fraction|nuclear
membrane|nucleotide binding
miR-21 AW025150 MAP3K12 mitogen-activated M + T ATP binding|JNK cascade|cytoplasm|magnesium ion
protein kinase kinase binding|plasma membrane|protein amino acid
kinase 12 phosphorylation|protein kinase cascade|protein
serine/threonine kinase activity|protein-tyrosine
kinase activity|transferase activity
miR-21 NM_012325 MAPRE1 microtubule-associated P + T cell proliferation|cytokinesis|microtubule
protein, RP/EB family, binding|mitosis|protein C-terminus binding|regulation
member 1 of cell cycle
miR-21 NM_002380 MATN2 matrilin 2 P + T biological_process unknown|calcium ion
binding|extracellular matrix (sensu Metazoa)
miR-21 NM_018834 MATR3 matrin 3 M + P + T RNA binding|nuclear inner membrane|nucleotide
binding|nucleus|structural molecule activity|zinc ion
binding
miR-21 NM_021038 MBNL1 muscleblind-like M + P + T cytoplasm|double-stranded RNA binding|embryonic
(Drosophila) development (sensu Mammalia)|embryonic limb
morphogenesis|muscle development|myoblast
differentiation|neurogenesis|nucleic acid
binding|nucleus|nucleus
miR-21 AI139252 MGC16063 ribosomal protein L35a P + T JAK-STAT cascadelacute-phase response|calcium ion
binding|cell
motility|cytoplasm|hematopoietin/interferon-class
(D200-domain) cytokine receptor signal transducer
activity|intracellular signaling cascade|negative
regulation of transcription from RNA polymerase II
promoter|neurogenesis|nucleus|nucleus|regulation of
transcription, DNA-dependent|signal transducer
activity|transcription|transcription factor
activity|transcription factor activity
miR-21 BC004162 MGC2452 hypothetical protein P + T fatty acid metabolism|generation of precursor
MGC2452 metabolites and energy|ligand-dependent nuclear
receptor activity|lipid
metabolism|nucleus|nucleus|regulation of
transcription, DNA-dependent|steroid hormone
receptor activity|transcription|transcription factor
activity|transcription factor activity|transcription from
RNA polymerase II promoter
miR-21 NM_024052 MGC3048 hypothetical protein P + T
MGC3048
miR-21 AB049636 MRPL9 mitochondrial P + T mitochondrion|protein
ribosomal protein L9 biosynthesis|ribosome|structural constituent of
ribosome
miR-21 NM_015678 NBEA neurobeachin P + T Golgi trans face|cytosol|endomembrane
system|plasma membrane|post-Golgi
transport|postsynaptic membrane|protein kinase A
binding
miR-21 AI700518 NFIB nuclear factor I/B M + T DNA replication|nucleus|nucleus|regulation of
transcription, DNA-
dependent|transcription|transcription factor
activity|transcription factor activity
miR-21 NM_002527 NTF3 neurotrophin 3 M + P anti-apoptosis|cell motility|cell-cell signaling|growth
factor activity|neurogenesis|signal transduction
miR-21 U24223 PCBP1 poly(rC) binding M + P + T RNA binding|catalytic activity|cytoplasm|mRNA
protein 1 metabolism|nucleus|ribonucleoprotein
complex|single-stranded DNA binding
miR-21 NM_005016 PCBP2 poly(rC) binding M + T DNA binding|RNA binding|cytoplasm|mRNA
protein 2 metabolism|nucleic acid
binding|nucleus|ribonucleoprotein complex
miR-21 NM_014456 PDCD4 programmed cell death P + T apoptosis
4 (neoplastic
transformation
inhibitor)
miR-21 AF338650 PDZD2 PDZ domain containing 2 P + T
miR-21 NM_000325 PITX2 paired-like M + P + T determination of left/right
homeodomain symmetry|development|nucleus|organogenesis|
transcription factor 2 regulation of transcription, DNA-dependent|
transcription factor activity
miR-21 NM_002655 PLAG1 pleiomorphic adenoma P + T nucleic acid binding|nucleus|transcription factor
gene 1 activity|zinc ion binding
miR-21 NM_005036 PPARA peroxisome P + T fatty acid metabolism|generation of precursor
proliferative activated metabolites and energy|ligand-dependent nuclear
receptor, alpha receptor activity|lipid
metabolism|nucleus|nucleus|regulation of
transcription, DNA-dependent|steroid hormone
receptor activity|transcription|transcription factor
activity|transcription factor activity|transcription from
RNA polymerase II promoter
miR-21 NM_002711 PPP1R3A protein phosphatase 1, P + T carbohydrate metabolism|glycogen
regulatory (inhibitor) metabolism|hydrolase activity|integral to
subunit 3A (glycogen membrane|phosphoprotein phosphatase activity|type 1
and sarcoplasmic serine/threonine specific protein phosphatase inhibitor
reticulum binding activity
subunit, skeletal
muscle)
miR-21 NM_000944 PPP3CA protein phosphatase 3 P + T calcineurin complex|calcium ion binding|calmodulin
(formerly 2B), catalytic binding|hydrolase activity|protein amino acid
subunit, alpha isoform dephosphorylation|protein serine/threonine
(calcineurin A alpha) phosphatase activity
miR-21 NM_018569 PRO0971 hypothetical protein P + T
PRO0971
miR-21 AA156948 PRPF4B PRP4 pre-mRNA M + T ATP binding|RNA splicing|nuclear mRNA splicing,
processing factor 4 via spliceosome|nucleus|protein amino acid
homolog B (yeast) phosphorylation|protein serine/threonine kinase
activity|transferase activity
miR-21 BF337790 PURB purine-rich element M + P + T
binding protein B
miR-21 NM_002869 RAB6A RAB6A, member RAS P + T GTP binding|GTPase activity|Golgi apparatus|protein
oncogene family transport|small GTPase mediated signal transduction
miR-21 AL136727 RAB6C RAB6C, member RAS P + T GTP binding|GTPase activity|intracellular|protein
oncogene family transport|response to drug|small GTPase mediated
signal transduction
miR-21 NM_002890 RASA1 RAS p21 protein P + T Ras GTPase activator activity|intracellular signaling
activator (GTPase cascade
activating protein) 1
miR-21 NM_005739 RASGRP1 RAS guanyl releasing P + T Ras guanyl-nucleotide exchange factor activity|Ras
protein 1 (calcium and protein signal transduction|calcium ion
DAG-regulated) binding|calcium ion binding|diacylglycerol
binding|guanyl-nucleotide exchange factor
activity|membrane fraction|small GTPase mediated
signal transduction
miR-21 NM_021111 RECK reversion-inducing- M + P + T cell cycle|membrane|membrane
cysteine-rich protein fraction|metalloendopeptidase inhibitor
with kazal motifs activity|negative regulation of cell cycle|serine-type
endopeptidase inhibitor activity
miR-21 NM_006915 RP2 retinitis pigmentosa 2 P + T beta-tubulin folding|membrane|sensory
(X-linked recessive) perception|unfolded protein binding|visual perception
miR-21 AA906056 RPS6KA3 ribosomal protein S6 M + T ATP binding|central nervous system
kinase, 90 kDa, development|protein amino acid
polypeptide 3 phosphorylation|protein serine/threonine kinase
activity|signal transduction|skeletal
development|transferase activity
miR-21 NM_002971 SATB1 special AT-rich M + P + T double-stranded DNA binding|establishment and/or
sequence binding maintenance of chromatin
protein 1 (binds to architecture|nucleus|regulation of transcription, DNA-
nuclear matrix/scaffold- dependent|transcription factor activity
associating DNA's)
miR-21 NM_014191 SCN8A sodium channel, voltage M + P + T ATP binding|cation channel activity|cation
gated, type VIII, alpha transport|integral to
polypeptide membrane|membrane|neurogenesis|sodium ion
transport|voltage-gated sodium channel
activity|voltage-gated sodium channel complex
miR-21 AA927480 SKI v-ski sarcoma viral M + P + T
oncogene homolog
(avian)
miR-21 NM_003983 SLC7A6 solute carrier family 7 P + T amino acid metabolism|amino acid transport|amino
(cationic amino acid acid-polyamine transporter activity|integral to plasma
transporter, y+ system), membrane|plasma membrane|protein complex
member 6 assembly|transport
miR-21 NM_006359 SLC9A6 solute carrier family 9 P + T antiporter activity|endoplasmic reticulum
(sodium/hydrogen membrane|integral to membrane|integral to
exchanger), isoform 6 membrane|ion
transport|microsome|mitochondrion|regulation of
pH|sodium ion transport|sodium:hydrogen antiporter
activity|solute:hydrogen antiporter activity
miR-21 NM_003076 SMARCD1 SWI/SNF related, P + T chromatin remodeling|chromatin remodeling
matrix associated, actin complex|regulation of transcription from RNA
dependent regulator of polymerase II promoter|transcription coactivator
chromatin, subfamily d, activity
member 1
miR-21 AI669815 SOX2 SRY (sex determining P + T establishment and/or maintenance of chromatin
region Y)-box 2 architecture|nucleus|regulation of transcription, DNA-
dependent|transcription|transcription factor activity
miR-21 NM_006940 SOX5 SRY (sex determining P + T nucleus|regulation of transcription, DNA-
region Y)-box 5 dependent|transcription|transcription factor
activity|transcription from RNA polymerase II
promoter
miR-21 AI808807 SOX7 SRY (sex determining P + T DNA binding|nucleus|regulation of transcription,
region Y)-box 7 DNA-dependent|transcription
miR-21 NM_006717 SPIN Spindling P + T gametogenesis|ribonucleoprotein complex
miR-21 NM_005842 SPRY2 sprouty homolog 2 P + T cell-cell
(Drosophila) signaling|development|membrane|organogenesis|
regulation of signal transduction
miR-21 NM_006751 SSFA2 sperm specific antigen 2 P + T plasma membrane
miR-21 NM_006603 STAG2 stromal antigen 2 P + T cell cycle|chromosome
segregation|cytokinesis|meiosis|mitosis|
molecular_function unknown|nucleus
miR-21 BC000627 STAT3 signal transducer and P + T JAK-STAT cascade|acute-phase response|calcium ion
activator of binding|cell
transcription 3 (acute- motility|cytoplasm|hematopoietin/interferon-class
phase response factor) (D200-domain) cytokine receptor signal transducer
activity|intracellular signaling cascade|negative
regulation of transcription from RNA polymerase II
promoter|neurogenesis|nucleus|nucleus|regulation of
transcription, DNA-dependent|signal transducer
activity|transcription|transcription factor
activity|transcription factor activity
miR-21 AW138827 TAF5 TAF5 RNA polymerase P + T nucleus|regulation of transcription, DNA-
II, TATA box binding dependent|transcription factor TFIID
protein (TBP)- complex|transcription factor activity
associated factor,
100 kDa
miR-21 BF591040 TAGAP T-cell activation P + T GTPase activator activity
GTPase activating
protein
miR-21 NM_000358 TGFBI transforming growth M + P + T cell adhesion|cell proliferation|extracellular matrix
factor, beta-induced, (sensu Metazoa)|extracellular space|integrin
68 kDa binding|negative regulation of cell adhesion|protein
binding|sensory perception|visual perception
miR-21 NM_000362 TIMP3 tissue inhibitor of P + T enzyme inhibitor activity|extracellular matrix (sensu
metalloproteinase 3 Metazoa)|extracellular matrix (sensu
(Sorsby fundus Metazoa)|induction of apoptosis by extracellular
dystrophy, signals|metalloendopeptidase inhibitor
pseudoinflammatory) activity|sensory perception|visual perception
miR-21 AA149745 TRIM2 tripartite motif- M + P + T cytoplasm|myosin binding|protein
containing 2 ubiquitination|ubiquitin ligase complex|ubiquitin-
protein ligase activity|zinc ion binding
miR-21 AF346629 TRPM7 transient receptor P + T ATP binding|calcium channel activity|calcium ion
potential cation transport|cation transport|integral to
channel, subfamily M, membrane|membrane|protein amino acid
member 7 phosphorylation|protein serine/threonine kinase
activity|transferase activity
miR-21 AI745185 YAP1 Yes-associated protein P + T
1, 65 kDa
miR-21 NM_005667 ZFP103 zinc finger protein 103 P + T central nervous system development|integral to
homolog (mouse) membrane|protein ubiquitination|ubiquitin ligase
complex|ubiquitin-protein ligase activity|zinc ion
binding
miR-21 N62196 ZNF367 zinc finger protein 367 M + P + T nucleic acid binding|nucleus|zinc ion binding
M = MiRanda
P = PicTar
T = TargetScan

Example 3

Bio-Pathological Features and microRNA Expression

Materials and Methods

Immunohistochemical Analysis of Breast Cancer Samples.

Staining procedures were performed as described (Querzoli, P., et al., Anal. Quant. Cytol. Histol. 21:151-160 (1999)). Hormonal receptors were evaluated with 6F11 antibody for estrogen receptor α (ER) and PGR-1A6 antibody for progesterone receptor (PR) (Ventana, Tucson, Ariz., U.S.A.). The proliferation index was assessed with MIB1 antibody (DAKO, Copenhagen). ERBB2 was detected with CB11 antibody (Ventana, Tucson, Ariz., U.S.A.) and p53 protein expression was examined with DO7 antibody (Ventana, Tucson, Ariz., U.S.A.). Only tumor cells with distinct nuclear immunostaining for ER, PR, Mib1 and p53 were recorded as positive. Tumor cells were considered positive for ERBB2 when they showed distinct membrane immunoreactivity.

To perform a quantitative analysis of the expression of these various biological markers, the Eureka Menarini computerized image analysis system was used. For each tumor section, at least 20 microscopic fields of invasive carcinoma were measured using a 40× objective. The following cut-off values were employed: 10% of positive nuclear area for ER, PR, c-erbB2 and p53, 13% of nuclei expressing Mib1 was introduced to discriminate cases with high and low proliferative activity.

Results

To evaluate whether a correlation exists between various bio-pathological features associated with breast cancer and the expression of particular miRNAs, we generated and compared miRNA expression profiles for various cancer samples associated with the presence or absence of a particular breast cancer feature. In particular, we analyzed breast cancers with lobular or ductal histotypes, breast cancers with differential expression of either estrogen receptor alpha (ER) or progesterone receptor, and breast cancers with differences in lymph node metastasis, vascular invasion, proliferation index, and expression of ERBB2 and p53.

Expression profiles of lobular or ductal and +/−ERBB2 expression classes did not reveal any microRNAs that were differentially-expressed, while all other comparisons revealed a small number of differentially-expressed microRNAs (P<0.05). The results of this analysis are shown in FIG. 4.

Differentially-expressed miRNA families were identified for various bio-pathological features that are associated with human breast cancer. For example, all miR-30 miRNAs are down-regulated in both ER- and PR-tumors, suggesting that expression of miR-30 miRNAs is regulated by these hormones. In addition, the expression of various let-7 miRNAs was down-regulated in breast cancer samples with either lymph node metastasis or a high proliferation index, suggesting that reduced let-7 expression could be associated with a poor prognosis, a result that is consistent with previous findings. The discovery that the let-7 family of miRNAs regulates the expression of members of the RAS oncogene family provides a potential explanation for the role of let-7 miRNAs in human cancer.

miR-145 and miR-21, two miRNAs whose expression could differentiate cancer or normal tissues, were also differentially-expressed in cancers with a different proliferation index or different tumor stage. In particular, miR-145 is progressively down-regulated from normal breast to cancers with a high proliferation index. Similarly, miR-21 is progressively up-regulated from normal breast to cancers with high tumor stage. These findings suggest that deregulation of these two miRNAs may affect critical molecular events involved in tumor progression.

Another miRNA potentially involved in cancer progression is miR-9-3. miR-9-3 was downregulated in breast cancers with either high vascular invasion or lymph node metastasis, suggesting that its down-regulation was acquired during the course of tumor progression and, in particular, during the acquisition of metastatic potential.

The relevant teachings of all publications cited herein that have not explicitly been incorporated by reference, are incorporated herein by reference in their entirety. While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims

Claims

What is claimed is:

1. A method of diagnosing a breast cancer associated with one or more prognostic markers in a subject, comprising:

measuring the level of at least one miR gene product in a breast cancer sample from said subject,

wherein an alteration in the level of the at least one miR gene product in the test sample, relative to the level of a corresponding miR gene product in a control sample, is indicative of the subject having a breast cancer associated with the one or more prognostic markers,

wherein the breast cancer associated with one or more prognostic markers and the at least one miR gene product are selected from the group consisting of:

(i) the breast cancer is a breast cancer associated with estrogen receptor expression and the miR gene product is selected from the group consisting of miR-26a, miR-26b, miR-102 (miR-29b), miR-30a-5p, miR-30b, miR-30c, miR-30d, miR-185, miR-191, miR-206, miR-212, and combinations thereof;

(ii) the breast cancer is a breast cancer associated with progesterone receptor expression and the miR gene product is selected from the group consisting of let-7c, miR-26a, miR-29b, miR-30a-5p, miR-30b, miR-30c, miR-30d, and combinations thereof;

(iii) the breast cancer is a breast cancer associated with positive lymph node metastasis and the miR gene product is selected from the group consisting of let-7f-1, let-7a-3, let-7a-2, miR-9-3, and combinations thereof;

(iv) the breast cancer is a breast cancer associated with a high proliferative index and the miR gene product is selected from the group consisting of let-7c, let-7d, miR-26a, miR-26b, miR-30a-5p, miR-102, miR-145, and combinations thereof;

(v) the breast cancer is a breast cancer associated with detectable p53 expression and the miR gene product is selected from the group consisting of miR-16a, miR-128b and a combination thereof;

(vi) the breast cancer is a breast cancer associated with high vascular invasion and the miR gene product is selected from the group consisting of miR-9-3, miR-10b, miR-27a, miR-29a, miR-123, miR-205 and combinations thereof; and

(vii) the breast cancer is a breast cancer associated with an advanced tumor stage and the miR gene product is selected from the group consisting of miR-9-2, miR-15-a, miR-21, miR-30a-s, miR-133a-1, miR-137, miR-153-2, miR-154, miR-181a, miR-203, miR-213, and combinations thereof.

2. The method of claim 1, further comprising: administering, to the subject, a pharmaceutical composition for treating breast cancer, wherein the pharmaceutical composition comprises: at least one miR expression inhibitor compound or at least one miR gene product and a pharmaceutically-acceptable carrier.

3. The method of claim 1, comprising:

reverse transcribing RNA from a test sample obtained from the subject to provide a set of target oligodeoxynucleotides;

hybridizing the target oligodeoxynucleotides to a microarray comprising miRNA-specific probe oligonucleotides to provide a hybridization profile for the test sample; and

comparing the test sample hybridization profile to a hybridization profile generated from a control sample,

wherein an alteration in the signal of at least one miRNA is indicative of the subject either having, or being at risk for developing, breast cancer.

4. A method of treating breast cancer in a subject who has a breast cancer in which at least one miR gene product is down-regulated or up-regulated in the cancer cells of the subject relative to control cells, comprising:

(1) when the at least one miR gene product is down-regulated in the cancer cells, administering to the subject an effective amount of at least one isolated miR gene product, provided that the miR gene product is not miR-15a or miR-16-1, such that proliferation of cancer cells in the subject is inhibited; or

(2) when the at least one miR gene product is up-regulated in the cancer cells, administering to the subject an effective amount of at least one compound for inhibiting expression of the at least one miR gene product, such that proliferation of cancer cells in the subject is inhibited.

5. The method of claim 4, wherein the at least one isolated miR gene product in step (1) is selected from the group consisting of miR-145, miR-10b, miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, miR-101-1, miR-143 and combinations thereof.

6. The method of claim 4 wherein the at least one miR gene product in step (2) is selected from the group consisting of: miR-21, miR-155, miR-009-1 (miR131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-213, let-7i (let-7d-v2), miR-122a, miR-128b, miR-136, miR-149, miR-191, miR-196-1, miR-196-2, miR-202, miR-203, miR-206, miR-210, miR-213 and combinations thereof.

7. The method of claim 4, further comprising:

determining the amount of at least one miR gene product in breast cancer cells, relative to control cells; and

altering the amount of miR gene product expressed in the breast cancer cells by:

(i) administering to the subject an effective amount of at least one isolated miR gene product, provided that the miR gene product is not miR-15a or miR-16-1, if the amount of the miR gene product expressed in the cancer cells is less than the amount of the miR gene product expressed in control cells; or

(ii) administering to the subject an effective amount of at least one compound for inhibiting expression of the at least one miR gene product, if the amount of the miR gene product expressed in the cancer cells is greater than the amount of the miR gene product expressed in control cells,

such that proliferation of cancer cells in the subject is inhibited.

8. The method of claim 7, wherein the at least one isolated miR gene product in step (i) is selected from the group consisting of: miR-145, miR-10b, miR-123 (miR-126), miR-140-as, miR-125a, miR-125b-1, miR-125b-2, miR-194, miR-204, let-7a-2, let-7a-3, let-7d (let-7d-v1), let-7f-2, miR-101-1, miR-143 and combinations thereof.

9. The method of claim 7, wherein the at least one miR gene product in step (ii) is selected from the group consisting of miR-21, miR-155, miR-009-1 (miR-131-1), miR-34 (miR-170), miR-102 (miR-29b), miR-213, let-7i (let-7d-v2), miR-122a, miR-128b, miR-136, miR-149, miR-191, miR-196-1, miR-196-2, miR-202, miR-203, miR-206, miR-210, miR-213 and combinations thereof.

10. A pharmaceutical composition for treating breast cancer, comprising at least one isolated miR gene product of claim 8 and a pharmaceutically-acceptable carrier.

11. A pharmaceutical composition for treating breast cancer, comprising at least one miR expression inhibitor compound of claim 9, and a pharmaceutically-acceptable carrier.

12. A method of diagnosing whether a subject has, or is at risk for developing, breast cancer, comprising

measuring the level of at least one miR-125b gene product in a test sample from said subject,

wherein a decrease in the level of the miR-125b gene product in the test sample, relative to the level of a corresponding miR-155 gene product in a control sample, is indicative of the subject either having, or being at risk for developing, breast cancer.

13. The method of claim 12, which further comprises measuring at least one miR-125b-1 gene product.

14. The method of claim 12, which further comprises measuring at least one miR-125b-2 gene product.

15. The method of claim 12, which further comprises measuring at least one miR-10b gene product.

16. The method of claim 12, which further comprises measuring at least one miR-145 gene product.

17. The method of claim 12, which further comprises measuring at least one miR-21 gene product.

18. The method of claim 12, wherein the level of the at least one miR-125b gene product is measured using Northern blot analysis.

19. The method of claim 12, wherein the level of the at least one miR-125b gene product in the test sample is less than the level of the corresponding miR-125b gene product in the control sample.

20. The method of claim 12, wherein the level of the at least one miR-125b gene product in the test sample is greater than the level of the corresponding miR-125b gene product in the control sample.

21. A method of treating cancer in a subject in need thereof, comprising

administering to the subject an effective amount of a compound for inhibiting the expression of a gene encoding one or more gene products in the subject, wherein the gene products are selected from one or more of miR-155, miR-10b, and miR-125b;

thereby inhibiting the proliferation of cancer cells in the subject.

22. The method of claim 21, wherein the compound for inhibiting the expression of a gene encoding the gene product is an antisense nucleic acid.

23. The method of claim 21, wherein the antisense nucleic acid is selected from the group consisting of a single-stranded RNA, a single-stranded DNA, a single-stranded RNA-DNA chimera and a single-stranded PNA.

24. The method of claim 21, wherein the antisense nucleic acid contains one or more modifications to the nucleic acid backbone, a sugar moiety, a base moiety or a combination thereof.

25. The method of claim 21, wherein the compound for inhibiting the expression of a gene encoding the gene product is a double-stranded RNA molecule having at least 90% sequence homology with the mature miRNAs of: miR-10b in SEQ ID NO:31, miR-125b-1 in SEQ ID NO: 118, miR-125b-2 in SEQ ID NO: 121, and miR-155 in SEQ ID NO:183.

26. The method of claim 25, wherein the double-stranded RNA molecule is about 17 to about 29 nucleotides in length.

27. The method of claim 21, wherein the compound for inhibiting the expression of the gene encoding the gene product is a ribozyme.

28. The method of claim 21, wherein the compound for inhibiting the expression of a gene encoding the gene product is formulated as a pharmaceutical composition comprising the compound or a pharmaceutically-acceptable salt thereof, and a pharmaceutically-acceptable carrier.

29. The method of claim 21, wherein the compound for inhibiting the expression of a gene encoding the gene product is administered to the subject orally, parenterally, by injection or infusion.

30. The method of claim 21, wherein the compound for inhibiting the expression of a gene encoding the gene product is administered to the subject by direct injection into a tumor in the subject.

31. The method of claim 21, wherein the compound for inhibiting the expression of a gene encoding the gene product is administered in combination with a delivery reagent.

32. The method of claim 31, wherein the delivery reagent is a liposome.

33. The method of claim 21, wherein the nucleic acid encoding the compound for inhibiting the expression of a gene encoding the gene product is a recombinant plasmid or viral vector.

34. A method for inhibiting the proliferation of cancer cells, comprising administering a compound for inhibiting the expression of a gene encoding a miR-155 gene product to the cancer cells, thereby arresting or slowing the growth of the cancer cells.

35. The method of claim 34, wherein the compound for inhibiting the expression of a gene encoding a miR-155 gene product is an antisense nucleic acid.

36. A method for inhibiting the proliferation of cancer cells, comprising administering a compound for increasing the expression of a gene encoding one or more of a miR-10b, miR-125b-1 or miR-125b-2 gene product to the cancer cells, thereby arresting or slowing the growth of the cancer cells.

37. The method of claim 36, wherein the compound for increasing the expression of a gene encoding one or more of a miR-10b, miR-125b-1 or miR-125b-2g gene product is a sense nucleic acid.

38. A method of treating a subject with a breast cancer, comprising: i) selecting a subject with the breast cancer; and, ii) administering to the subject an isolated nucleic acid molecule encoding at least one transcript of: miR-155, miR-10b, miR-125b-1, and miR-125b-2, thereby treating the subject.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: