US20140189897A1
2014-07-03
14/125,841
2012-06-21
This document relates to methods and materials involved in the removal of senescent cells within a mammal. For example, transgenic non-human animals that can be induced to delete senescent cells are provided.
Get notified when new applications in this technology area are published.
A61K49/0008 » CPC main
Preparations for testing; Screening or testing of compounds for diagnosis of disorders, assessment of conditions, e.g. renal clearance, gastric emptying, testing for diabetes, allergy, rheuma, pancreas functions Screening agents using (non-human) animal models or transgenic animal models or chimeric hosts, e.g. Alzheimer disease animal model, transgenic model for heart failure
A61K49/00 IPC
Preparations for testing
This application claims the benefit of U.S. Provisional application Ser. No. 61/567,587, filed Dec. 6, 2011 and U.S. Provisional application Ser. No. 61/499,616, filed Jun. 21, 2011. The disclosures of these prior applications are considered part of (and are incorporated by reference in) the disclosure of this application.
1. Technical Field
This document relates to methods and materials involved in the removal of senescent cells within a mammal For example, this document provides transgenic non-human animals that can be induced to delete senescent cells.
2. Background Information
Cellular senescence, which halts the proliferation of damaged or dysfunctional cells, is widely recognized as an important mechanism to constrain the malignant progression of tumor cells (Campisi, Curr. Opin. Genet. Dev., 21:107-112 (2011); and Kuilman et al., Genes Develop., 24:2463-2479 (2010)). As cells senesce, they can develop a unique phenotype, referred to as the senescence-associated secretory phenotype (SASP, or alternatively called SMS), in which they acquire the ability to secrete a variety of growth factors, cytokines, chemokines, and proteases (Coppe et al., PLoS Biol., 6:2853-2868 (2008)). The observation that senescent cells can accumulate in several tissues and organs during organismal aging and are present at sites of age-related pathologies has led to speculation that they contribute to aging and age-related dysfunction (Campisi, Cell, 120:513-522 (2005)).
This document relates to methods and materials involved in the removal of senescent cells within a mammal For example, this document provides transgenic non- human animals that can be induced to delete senescent cells (e.g., p16Ink4a-positive senescent cells). As described herein, transgenic mice can be produced to contain nucleic acid that allows for the controlled clearance of senescent cells (e.g., p16Ink4a-positive senescent cells) by controllably inducing apoptosis of senescent cells while inducing little, or no, apoptosis of non-senescent cells. For example, a transgenic non-human animal provided herein can be allowed to grow and develop for a period of time and then can be treated with a compound (e.g., AP20187) capable of inducing apoptosis of senescent cells within the transgenic animal while inducing little, or no, apoptosis of non-senescent cells within the transgenic animal. As described herein, clearance of senescent cells within a transgenic non-human animal can delay or reduce the likelihood of age-related disorders and can maximize healthy lifespan. In some cases, a transgenic non-human animal provided herein can include nucleic acid encoding a marker polypeptide (e.g., a fluorescent polypeptide such as a green fluorescent protein (GFP)) configured to be expressed by senescent cells with little, or no, expression by non-senescent cells. In some cases, a transgenic non-human animal provided herein can have a genetic background (e.g., a BubR1 hypomorphic (BubR1H/H) genetic background) that results in a markedly shortened lifespan with or without exhibiting one or more age-related phenotypes such as infertility, lordokyphosis, sarcopenia, cataracts, fat loss, cardiac arrhythmias, arterial wall stiffening, impaired wound healing, and dermal thinning.
The transgenic non-human animals provided herein can be used in assays designed to identify agents having the ability to kill, or to facilitate the killing of, senescent cells. For example, transgenic non-human animals provided herein can be used as controls (e.g., positive controls) for the successful clearance of senescent cells. In some cases, transgenic non-human animals provided herein can be used as controls (e.g., positive controls) for the successful clearance of senescent cells with minimal or no killing of non-senescent cells.
In some cases, transgenic non-human animals provided herein can be used as test animals in assays designed to identify agents having the ability to kill, or to facilitate the killing of, senescent cells. In such cases, the ability of a test agent to kill, or to facilitate the killing of, senescent cells can be monitored based, at least in part, on the expression of a marker polypeptide (e.g., a fluorescent polypeptide such as GFP) configured to be expressed by senescent cells. In some cases, the ability of the test agent to kill, or to facilitate the killing of, senescent cells can be evaluated by comparing its effects in a particular animal at a first time point to the effects observed in the same animal after treatment with a compound (e.g., AP20187) capable of inducing apoptosis of senescent cells within that transgenic animal at a second time point. Such a comparison can be used to identify test agents that are less effective or at least as effective as the compound capable of inducing apoptosis of senescent cells at the second time point. In some cases, the compound capable of inducing apoptosis of senescent cells can be used at the first time point, and the test agent can be used as the second time point to identify test agents that are more effective than the compound used at the first time point.
In some cases, the transgenic non-human animals provided herein can be used in assays designed to identify agents having the ability to delay or reduce the likelihood of age-related disorders and/or maximize healthy lifespan. For example, transgenic non-human animals provided herein can be used as controls (e.g., positive controls) for the successful delay of age-related disorders and/or for the successful increased duration of a healthy lifespan.
In some cases, transgenic non-human animals provided herein can be used as test animals in assays designed to identify agents having the ability to delay or reduce the likelihood of age-related disorders and/or maximize healthy lifespan. In such cases, the ability of a test agent to delay or reduce the likelihood of age-related disorders and/or maximize healthy lifespan can be monitored based, at least in part, on the expression of a marker polypeptide (e.g., a fluorescent polypeptide such as GFP) configured to be expressed by senescent cells. In some cases, the ability of the test agent to delay or reduce the likelihood of age-related disorders and/or maximize healthy lifespan can be evaluated by comparing its effects in a particular animal at a first time point to the effects observed in the same animal after treatment with a compound (e.g., AP20187) capable of inducing apoptosis of senescent cells within that transgenic animal at a second time point. Such a comparison can be used to identify test agents that are less effective or at least as effective as the compound capable of inducing apoptosis of senescent cells at the second time point. In some cases, the compound capable of inducing apoptosis of senescent cells can be used at the first time point, and the test agent can be used at the second time point to identify test agents that are more effective at delaying or reducing the likelihood of age-related disorders and/or maximizing healthy lifespan than the compound used at the first time point.
In general, one aspect of this document features a transgenic mouse, the nucleated cells of which contain a transgene. The transgene comprises, or consists essentially of, a promoter sequence operably linked to a nucleic acid sequence encoding a polypeptide having the ability to kill a cell or facilitate the killing of a cell when the transgenic mouse is administered a compound, wherein senescent cells of the transgenic mouse express the polypeptide, and wherein the senescent cells of the transgenic mouse are killed when the compound is administered to the transgenic mouse. Less than 10 percent of non-senescent cells of the transgenic mouse can be killed when the compound is administered to the transgenic mouse. The promoter sequence can be a p16Ink4a promoter sequence. The polypeptide can comprise a caspase 8 polypeptide sequence. The polypeptide can comprise a FKBP polypeptide sequence. The polypeptide can be a FKBP-caspase 8 fusion polypeptide. The compound can be AP20187. The genetic background of the transgenic mouse can be a BubR1H/H genetic background. The transgene can comprise nucleic acid encoding a marker polypeptide. The marker polypeptide can be a GFP polypeptide.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
Other features and advantages of the invention will be apparent from the following detailed description, and from the claims.
FIG. 1. p16Ink4a-specific expression of the INK-ATTAC transgene. A, Schematic representation of the INK-ATTAC transgenic construct and the mechanism of apoptosis activation. B, GFP intensity of IAT collected from 5-month-old untreated mice with the indicated genotypes. C, qRT-PCR analysis of untreated 9-month-old mouse tissue analyzed for relative expression of p16Ink4a (left), FKBP-Casp8 (middle), and EGFP (right). Error bars, s.d.; n=3 female mice per genotype. Abbreviation: SkM, skeletal muscle (gastrocnemius). D, Cultured bone marrow cells from 2-month-old WT:INKATTAC-3 mice treated with rosiglitazone for 48 hours and immunostained for Flag antibody (visualizing Flag-FKBP-Casp8). Scale bar, 20 μm.
FIG. 2. Validation of p16Ink4a-specific expression of the INK-ATTAC-5 transgene. A, GFP intensity of IAT collected from 5-month-old untreated mice with the indicated genotypes. Scale bar, 20 μm. B, qRT-PCR analysis of untreated 9-month-old mouse tissue analyzed for the relative expression of p16Ink4a (left), FKBP-Casp8 (middle), and EGFP (right). Error bars, s.d.; n=3 female mice per genotype. Abbreviation: SkM, skeletal muscle (gastrocnemius).
FIG. 3. Tissues expressing the INK-ATTAC transgene have high levels of cellular senescence markers. A, SA-β-Gal staining of IAT in 9-month-old untreated mice with the indicated genotypes. B, qRT-PCR analysis of the indicated tissues for selected markers of senescence. Tissues were collected from 9-month-old untreated mice with the indicated genotypes. Abbreviation: SkM, skeletal muscle (gastrocnemius). C, Representative FACS profile of single-cell suspensions of IAT reveals two distinct cell populations based on GFP intensity of untreated BubR1H/H:INK-ATTAC-3 mice (dashed line indicates GFP− versus GFP+ cells). D, Sorted GFP+ cells from IAT express higher levels of senescence-associated genes than GFP− cells. For B and D: error bars, s.d.; n=3 female mice per genotype.
FIG. 4. Tissues expressing the INK-ATTAC-5 transgene display elevated indicators of senescence. A, qRT-PCR analysis of the indicated tissues for selected markers of senescence. Tissues were collected from 9-month-old untreated mice with the indicated genotypes. Abbreviation: SkM, skeletal muscle (gastrocnemius). B, Sorted GFP+ cells from IAT express higher levels of senescence-associated genes than GFP− cells. For A and B, error bars, s.d.; n=3 female mice per genotype.
FIG. 5. Delayed onset of p16Ink4a-mediated age-related phenotypes in AP20187-treated BubR1H/H:INK-ATTAC mice. A, Bone marrow cells collected from 2-month-old WT:INK-ATTAC-3 mice were exposed to rosiglitazone for 5 days to induce senescence and then cultured in the presence or absence of AP20187. After 48 hours, cells were stained for SA-β-Gal. Scale bar, 50 μm. B, Lordokyphosis (left) and cataracts (right) are significantly delayed when BubR1H/H:INK-ATTAC transgenic mice were continuously treated with AP20187 from weaning age on. Lordokyphosis: *, P<0.0001 and **, P=0.0077; cataracts: *, P=0.0017 and **, P=0.0158 log-rank tests. C, Representative images of 9-month-old AP20187 treated (top) and untreated (bottom) BubR1H/H: INKATTAC-3 mice. D, AP20187 treatment increases average muscle fiber diameter of gastrocnemius (Gastro) and abdominal (ABD) muscles of BubR1H/H:INK-ATTAC mice. Error bars, s.e.m.; n=6 mice per genotype. *, P=0.0157; **, P=0.0007; ***, P=0.0239, unpaired t tests. E, Duration of exercise to exhaustion reveals that AP20187-treated BubR1H/H:INK-ATTAC mice have extended running time. Error bars, s.d.; n=6 mice per genotype; *, P=0.0236; **, P=0.0009, unpaired t tests. F, BubR1H/H: INK-ATTAC mice treated with AP20187 travel longer distances on a treadmill. Error bars, s.d.; n=6 mice per genotype; *, P=0.0187; **, P=0.0012, unpaired t tests. G, AP20187-treated BubR1H/H:INK-ATTAC mice exert more energy during exercise ability tests. Error bars, s.d.; n=6 mice per genotype; *, P=0.0065; **, P=0.0002, unpaired t tests. H, Sizes of various fat depots of BubR1H/H:INK-ATTAC transgenic mice are increased in response to AP20187 treatment. Parentheses, s.d.; n=6 mice per genotype. Asterisks denote significant (P<0.05) changes compared to untreated animals of the same transgenic line, unpaired t tests. Abbreviations: POV, paraovarian; Peri, perirenal; Mes, mesenteric; SSAT, subscapular adipose tissue. Total fat percentage was determined by DEXA scanning. I, Cell diameter of IAT in BubR1H/H:INK-ATTAC mice increases in response to AP20187 treatment. Error bars, s.e.m.; n=6 female mice per genotype; *, P=0.0031; **, P=0.0003, unpaired t tests. J, Dermal and subcutaneous adipose layer thickness of BubR1H/H:INK-ATTAC mice indicates consistently increased adiposity with treatment. Error bars, s.e.m.; n=6 female mice per genotype; *, P=0.0016 and **, P=0.0015, unpaired t tests. FIG. 6. Age-associated traits of BubR1 hypomorphic mice that are p16Ink4a-independent are not influenced by clearance of p16Ink4a-positive cells. A, The percentage of sinus pause rhythm disturbances is similarly increased in both treated and non-treated BubR1H/H:INK-ATTAC heart tissue. Abbreviation: BPM, beats per minute. B, Thinning of the aorta is not corrected by drug treatment in BubR1H/H:INK-ATTAC animals. Error bars, s.e.m.; n=6 female mice per genotype. Consistent with this, p16Ink4a and the INK-ATTAC transgene are not expressed in this tissue. Error bars, s.d.; n=3. FIG. 6C is a graph plotting overall survival for the indicated mice.
FIG. 7. AP20187-treated BubR1H/H:INK-ATTAC animals have reduced numbers of p16Ink4a-positive senescent cells. A, SA-β-Gal staining of IAT reveals that AP20187-treated adipose tissue attenuates the senescent phenotype driven by BubR1 hypomorphism. qRT-PCR analysis for indicators of senescence in IAT. B-D, Treatment of BubR1H/H:INK-ATTAC animals with AP20187 leads to lower levels of senescence-associated markers in IAT (B), skeletal muscle (C), and eye (D). Error bars, s.d.; n=3 female mice per genotype. E, BrdU incorporation rates as a measure of replicative senescence are elevated in IAT and skeletal muscle of BubR1H/H:INK-ATTAC mice. Error bars, s.e.m.; n=6 mice per genotype. Statistical analysis was by unpaired t test: *,
P=0.0146 and **, P=0.0137.
FIG. 8 contains graphs plotting the relative expression of the indicated polypeptides in IAT (A), skeletal muscle (B), and eye (C).
FIG. 9 is a listing of the nucleic acid sequence of a pBLUESCRIPT II KS vector containing a p16Ink4a-ATTAC-IRES-GFP nucleic acid construct.
FIG. 10 is a listing of the nucleic acid sequence of FIG. 9 with the various vector components and construct components labeled.
This document relates to methods and materials involved in the removal of senescent cells within a mammal For example, this document provides transgenic non-human animals that can be induced to delete senescent cells (e.g., p16Ink4a-positive senescent cells). Such non-human animals can be farm animals such as pigs, goats, sheep, cows, horses, and rabbits, rodents such as rats, guinea pigs, and mice, and non-human primates such as baboons, monkeys, and chimpanzees. The term “transgenic non-human animal” as used herein includes, without limitation, founder transgenic non-human animals as well as progeny of the founders, progeny of the progeny, and so forth, provided that the progeny retain the transgene. The nucleated cells of the transgenic non-human animals provided herein can contain a transgene that includes a promoter sequence (e.g., a p16Ink4a promoter sequence) operably linked to a nucleic acid sequence encoding a polypeptide capable of killing a cell or capable of facilitating the killing of a cell. A promoter sequence of a transgene described herein can be one that drives polypeptide expression in senescent cells while driving less, little, or no expression in non-senescent cells. Examples of such promoters include, without limitation, a p16Ink4a promoter sequence, a p21cip promoter sequence, and a Pai1 promoter sequence.
In some cases, a polypeptide capable of killing a cell or capable of facilitating the killing of a cell can be a polypeptide that includes two polypeptide sequences fused together (e.g., a fusion polypeptide). An example of such a fusion polypeptide can be a FKBP-caspase 8 fusion protein. See, e.g., Pajvani et al., Nat. Med., 11:797-803 (2005). Other examples of polypeptides capable of killing a cell or capable of facilitating the killing of a cell that can be used as described herein include, without limitation, a FKBP-caspase-1 fusion polypeptide or FKBP-caspase-3 fusion polypeptide. In some cases, a polypeptide capable of killing a cell or capable of facilitating the killing of a cell can be engineered to include a tag (e.g., a Flag tag). In some cases, a transgene provided herein can include nucleic acid encoding a marker polypeptide such as a fluorescent polypeptide (e.g., GFP, BFP, or RFP). For example, a transgene provided herein can include nucleic acid encoding a polypeptide capable of killing a cell or capable of facilitating the killing of a cell followed by an internal ribosome entry site followed by a marker polypeptide (e.g., GFP).
In some cases, a transgene can include a p16Ink4a promoter sequence followed by nucleic acid encoding an FKBP-caspase 8 fusion protein. In such cases, administration of a compound such as AP20187 can result in apoptosis of cells expressing the FKBP-caspase 8 fusion protein. For example, senescent cells of a transgenic non-human animal provided herein can express the FKBP-caspase 8 fusion protein of a transgene by virtue of the p16Ink4a promoter sequence and can be selectively and controllably killed following administration of AP20187. AP20187 can be obtained as described elsewhere (U.S. Patent Application Publication No. 2004/0006233).
The term “operably linked” as used herein refers to positioning a regulatory element (e.g., a promoter sequence, an inducible element, or an enhancer sequence) relative to a nucleic acid sequence encoding a polypeptide in such a way as to permit or facilitate expression of the encoded polypeptide. In the transgenes disclosed herein, for example, a promoter sequence (e.g., a p16Ink4a promoter sequence) can be positioned 5′ relative to a nucleic acid encoding a polypeptide (e.g., an FKBP-caspase 8 fusion protein).
Various techniques known in the art can be used to introduce transgenes into non-human animals to produce founder lines, in which the transgene is integrated into the genome. Such techniques include, without limitation, pronuclear microinjection (See, e.g., U.S. Pat. No. 4,873,191), retrovirus mediated gene transfer into germ lines (Van der Putten et al., Proc. Natl. Acad. Sci. USA, 82:6148-1652 (1985)), gene targeting into embryonic stem cells (Thompson et al., Cell 56:313-321 (1989)), electroporation of embryos (Lo, Mol. Cell. Biol., 3:1803-1814 (1983)), and in vitro transformation of somatic cells, such as cumulus or mammary cells, followed by nuclear transplantation (Wilmut et al., Nature, 385:810-813 (1997); and Wakayama et al., Nature, 394:369-374 (1998)). For example, fetal fibroblasts can be genetically modified to contain an INK-ATTAC construct (FIG. 1A), and then fused with enucleated oocytes. After activation of the oocytes, the eggs are cultured to the blastocyst stage. See, for example, Cibelli et al., Science, 280:1256-1258 (1998). Standard breeding techniques can be used to create animals that are homozygous for the transgene from the initial heterozygous founder animals. Homozygosity is not required, however, as the phenotype can be observed in hemizygotic animals.
Once transgenic non-human animals have been generated, expression of an encoded polypeptide (e.g., an FKBP-caspase 8 fusion protein or marker polypeptide) can be assessed using standard techniques. Initial screening can be accomplished by Southern blot analysis to determine whether or not integration of the transgene has taken place. For a description of Southern analysis, see sections 9.37-9.52 of Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, second edition, Cold Spring Harbor Press, Plainview; N.Y. Polymerase chain reaction (PCR) techniques also can be used in the initial screening. PCR refers to a procedure or technique in which target nucleic acids are amplified. Generally, sequence information from the ends of the region of interest or beyond is employed to design oligonucleotide primers that are identical or similar in sequence to opposite strands of the template to be amplified. PCR can be used to amplify specific sequences from DNA as well as RNA, including sequences from total genomic DNA or total cellular RNA. Primers typically are 14 to 40 nucleotides in length, but can range from 10 nucleotides to hundreds of nucleotides in length. PCR is described in, for example PCR Primer: A Laboratory Manual, ed. Dieffenbach and Dveksler, Cold Spring Harbor Laboratory Press, 1995. Nucleic acids also can be amplified by ligase chain reaction, strand displacement amplification, self-sustained sequence replication, or nucleic acid sequence-based amplified. See, for example, Lewis, Genetic Engineering News, 12:1 (1992); Guatelli et al., Proc. Natl. Acad. Sci. USA, 87:1874-1878 (1990); and Weiss, Science, 254:1292-1293 (1991).
Expression of a nucleic acid sequence encoding a polypeptide (e.g., an FKBP-caspase 8 fusion protein or marker polypeptide) in senescent cells of transgenic non-human animals can be assessed using techniques that include, without limitation, Northern blot analysis of tissue samples obtained from the animal, in situ hybridization analysis, Western analysis, immunoassays such as enzyme-linked immunosorbent assays, and reverse-transcriptase PCR (RT-PCR). As described herein, expression of an FKBP-caspase 8 fusion protein by senescent cells within the transgenic animal can result in transgenic animals that can be treated with AP20187 such that the senescent cells are killed. Such transgenic animals can exhibit delayed, or a reduced likelihood of, age-related disorders and/or a maximized healthy lifespan. It is understood that a particular phenotype in a transgenic animal typically is assessed by comparing the phenotype in the transgenic animal to the corresponding phenotype exhibited by a control non-human animal that lacks the transgene.
A transgenic non-human animal provided herein can have any appropriate genetic background. In some cases, a transgenic non-human animal provided herein can have a BubR1 hypomorphic (BubR1H/H) genetic background, a Tert−/− genetic background, or a bGH+ (bovine growth hormone) genetic background.
This document also provides tissues (e.g., skin, eye, fat, muscle, lung, heart, bone, liver, intestine, kidney, spleen, brain, cartilage, marrow, adrenal glands, ovaries, and testes) and cells (e.g., fat cells, preadipocytes, skin or lung fibroblasts, muscle satellite cells, osteoblasts, bone marrow progenitor cells, neuronal progenitor cells, hepatocytes, endothelial cells, chondroblasts, and splenocytes cells) obtained from a transgenic non-human animal provided herein.
This document also provides methods for identifying agents having the ability to kill, or to facilitate the killing of, senescent cells and methods for identifying agents having the ability to delay, or reduce the likelihood of age-related disorders, and/or maximize healthy lifespan. Such methods can include, for example, (1) targeting senescent cells based on compounds activated by enzyme activities that are higher in them than other cells (such as senescence-associated β-galactosidase), such compounds killing the senescent cells upon activation, (2) use of compounds that kill cells to which they bind through receptors that are more highly expressed by senescent than other cells (such receptors being identified by proteomic or expression profiling of senescent versus non-senescent cells or other approaches), or (3) compounds that are activated by metabolic processes that are more active in senescent than non-senescent cells (with such metabolic processes being identified through metabolomic, proteomic, expression profiling, or other means), with the compounds so activated killing the senescent cell.
In some cases, methods for identifying agents having the ability to kill, or to facilitate the killing of, senescent cells and methods for identifying agents having the ability to delay, or reduce the likelihood of age-related disorders, and/or maximize healthy lifespan can include obtaining senescent cells from a mammal (e.g., an animal model or a human). For example, a transgenic mouse provided herein such as a transgenic mouse that expresses a marker polypeptide (e.g., GFP) in senescent cells can be used to obtain senescent cells. Such a transgenic mouse can contain a transgene that includes a marker polypeptide (e.g., GFP) operably linked to a promoter sequence that drives polypeptide expression in senescent cells while driving less, little, or no expression in non-senescent cells. Examples of such promoters include, without limitation, a p16Ink4a promoter sequence, a p21cip promoter sequence, and a Pai1 promoter sequence. The senescent cell can be any appropriate cell type or from any appropriate tissue. For example, senescent cells can be obtained from fat or endothelial tissue. In some cases, senescent cells can be obtained from liver, bone marrow, heart, lung, or skin tissue.
Any appropriate method can be used to obtain senescent cells from a mammal For example, senescent cells expressing a marker polypeptide (e.g., GFP) under the control of a p16Ink4a promoter sequence can be separated from non-senescent cells using standard techniques such as cell sorting methods based on the expression of the marker polypeptide. In some cases, cell lines of senescent cells can be used in place of freshly obtained senescent cells to identify agents having the ability to kill, or to facilitate the killing of, senescent cells and agents having the ability to delay, or reduce the likelihood of age-related disorders, and/or maximize healthy lifespan as described herein. In some cases, senescent cells can be obtained by cell passage in culture (e.g., greater than about 12 to 15 cell passages for mouse embryonic fibroblasts and greater than about 20 cell passages at a 1:2 split ratio for human cells) or by radiation treatment (e.g., treatment with about 5 to about 50 Grays), a ceramide (e.g., C6, C16, or C18) treatment (e.g., treatment with about 7 μM to about 15 μM (e.g., 13 μM) of ceramide such as C16 for at least about 15 days), exposure to oncogenes or increased expression of oncogenes such as H-Ras or K-Ras (e.g., K-RasG12V), exposure to non-oncogenes or increased expression of non-oncogenes such as JAK or STAT, or exposure to glucose (e.g., about 16.5 mM to about 22.5 mM of D-glucose) for at least 10 days (e.g., greater than 30 days). In some cases, senescent cells can be obtained by exposing cells to reactive oxygen species or hydrogen peroxide to induce senescence via a p53 pathway.
Once obtained, the senescent cells can be exposed to a library of test agents individually or in pools to identify those agents or pools of agents having the ability to kill, or to facilitate the killing of, the senescent cells. Once identified as having the ability to kill, or to facilitate the killing of, the senescent cells, the identified agent can be applied to comparable non-senescent cells in comparable concentrations to confirm that the agent has a reduced ability to kill, or to facilitate the killing of, non-senescent cells. Those agents having the ability to kill, or to facilitate the killing of, senescent cells with a reduced or no ability to kill, or to facilitate the killing of, non-senescent cells can be classified as being an agent having the ability to delay, or reduce the likelihood of age-related disorders, and/or maximize healthy lifespan. In some cases, senescent cells obtained from a transgenic mammal provided herein and treated in a manner that results in senescent cell death can be used as positive controls.
In some cases, an agent can be identified as having the ability to kill, or to facilitate the killing of, senescent cells or as having the ability to delay, or reduce the likelihood of age-related disorders, and/or maximize healthy lifespan using in vivo techniques. For example, an animal model such as wild-type mice or animals, mice with a BubR1 hypomorphic (BubR1H/H) genetic background, or other mouse or animal models can be used. In such cases, a library of test agents can be administered individually or in pools to the animals (e.g., mice), and the animals (e.g., mice) can be assessed for indications that the test agent is capable of killing, or facilitating the killing of, senescent cells or is capable of delaying, or reducing the likelihood of age-related disorders, and/or maximizing healthy lifespan. Indications of senescent cell killing or indications of delayed or reduced likelihood of age-related disorders, and/or indications of maximized healthy lifespan can be detected and assessed as described herein. For example, the ability of an agent to increase the length of lifespan can be assessed comparing treated and untreated mice with, for example, a BubR1 hypomorphic (BubR1H/H) genetic background.
This document also provides methods and materials for identifying molecules (e.g., polypeptides, carbohydrates, lipids, and nucleic acids) possessed or expressed by senescent cells. For example, senescent cells can be obtained as described herein and assessed to identify molecules (e.g., polypeptides) possessed or expressed by those senescent cells. Any appropriate method can be used to identify molecules possessed or expressed by senescent cells. For example, polypeptide isolation and sequencing techniques can be used to identify polypeptides expressed by senescent cells.
In some cases, a transgenic mouse provided herein can be used to identify molecules (e.g., polypeptides and carbohydrates) possessed or expressed by senescent cells. For example, a transgenic mouse provided herein can be treated with a compound (e.g., AP20187) starting at or before birth (e.g., shortly after fertilization via treatment of the mouse's mother) such that senescent cells are killed or prevented from developing. In such cases, the resulting mouse can be immunologically naive with respect to the molecules exclusively expressed by senescent cells. The immunologically nave mouse can then be exposed to senescent cells or components from senescent cells (e.g., plasma membranes) in a manner designed to trigger an immune response. Resulting antibodies or antibody-producing cells can be isolated and assessed to confirm that the antibodies recognize a molecule presented or expressed by senescent cells. In some cases, the antibodies can be assessed for the ability to not recognize molecules presented or expressed by non-senescent cells. Once such antibodies are obtained, they can be used to identify the molecule present or expressed by the senescent cells.
In some cases, antibodies directed to a molecule present or expressed by senescent cells can be used to kill, or to facilitate the killing of, senescent cells or to delay, or reduce the likelihood of age-related disorders, and/or to maximize healthy lifespan. For example, antibodies directed to a molecule present or expressed by senescent cells can be conjugated with isotopes or toxins to form conjugates having the ability to kill, or to facilitate the killing of, senescent cells or as having the ability to delay, or reduce the likelihood of age-related disorders, and/or maximize healthy lifespan.
The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
Clearance of p16Ink4a-positive senescent cells delays aging-associated disorders
To examine the role of senescence in aging and age-related pathologies and to test whether elimination of senescent cells has beneficial effects, a transgenic strategy that enabled clearance of senescent cells in mice was designed. A 2617-bp fragment of the p16Ink4a gene promoter, which is transcriptionally active in senescent, but not non-senescent, cells (Wang et al., J. Biol. Chem., 276:48655-48661 (2001)), was engineered into a nucleic acid construct upstream of nucleic acid encoding a FKBP-caspase 8 fusion protein containing a Flag tag (Pajvani et al., Nat. Med., 11:797-803 (2005)) to create an
INK-ATTAC construct (FIG. 1A). As shown in FIG. 1A, the INK-ATTAC construct was designed to express the FKBP-caspase 8 fusion protein within senescent cells. Once myristoylated, the FKBP-caspase 8 fusion protein becomes membrane-bound, and addition of AP20187, a synthetic drug, is capable of inducing dimerization of the membrane-bound myristoylated FKBP-caspase 8 fusion protein, thereby inducing apoptosis.
In addition, an internal ribosome entry site (IRES) followed by an open reading frame coding for EGFP was added downstream of the nucleic acid encoding the FKBP-caspase 8 fusion protein (FIG. 1A). The nucleic acid encoding EGFP was added to allow for detection and collection of p16Ink4a-positive senescent cells. Injection of the resulting construct into fertilized eggs yielded nine transgenic INK-ATTAC founder lines.
To examine whether removal of p16Ink4a-expressing cells is technically feasible and whether this impacts age-associated deficits in mice, each of the founder lines were bred onto a BubR1 hypomorphic (BubR1H/H) genetic background. BubR1H/H mice have a markedly shortened lifespan and exhibit a variety of age-related phenotypes including, without limitation, infertility, lordokyphosis, sarcopenia, cataracts, fat loss, cardiac arrhythmias, arterial wall stiffening, impaired wound healing, and dermal thinning (Baker et al., Nat. Genet., 36:744-749 (2004); Hartman et al., Neurobiol. Aging, 28:921-927 (2007); and Matsumoto et al., Stroke, 38:1050-1056 (2007)). BubR1H/H mice can accumulate p16Ink4a-positive cells in several tissues in which age-associated pathologies develop including, without limitation, adipose tissue, skeletal muscle, and eye.
To screen for transgene activity in p16Ink4a-positive cells, samples of inguinal adipose tissue (IAT) were collected from each of the nine BubR1H/H:INK-ATTAC strains at five months of age and analyzed for GFP expression by fluorescence microscopy. GFP fluorescence was observed in two of these strains, BubR1H/H:INK-ATTAC-3 and BubR1H/H:INK-ATTAC-5 (FIGS. 1B and 2A). Next, the extent to which expression of INK-ATTAC and endogenous p16Ink4a overlap was determined using a quantitative (q)RT-PCR approach. Consistent with earlier data from BubR1H/H mice (Baker et al., Nat. Cell Biol., 10:825-836 (2008)), skeletal muscle, IAT, and eye exhibited increased p16Ink4a expression with aging (FIGS. 1C and 2B). BubR1H/H : INK-ATTAC- 3 and BubR1H/H:INK-ATTAC-5 mice also exhibited elevated INK-ATTAC and GFP transcript levels in these tissues. On the other hand, BubR1H/H tissues in which p16Ink4a is not induced, such as brain, lung, colon, liver, and heart, had no clear induction of INK-ATTAC or GFP in BubR1H/H:INK-ATTAC-3 and BubR1H/H:INK-ATTAC-5 mice (FIGS. 1C and 2B).
To confirm that transgenic INK-ATTAC and endogenous p16Ink4a are under the same transcriptional control mechanism outside the context of BubR1 hypomorphism, bone marrow of wildtype (WT):INK-ATTAC transgenic lines 3 and 5 were harvested and cultured in the absence or presence of rosiglitazone, a drug that can induce cellular senescence and p16Ink4a expression through activation of PPARγ (Gan et al., J. Cell Sci. 121:2235-2245 (2008)) Immunofluorescence microscopy revealed that a high proportion of cells expressed Flag-tagged FKBP-Casp8 fusion protein in the presence of rosiglitazone, but not in its absence (FIG. 1D). Together, these data indicated that INK-ATTAC gene activity in the two transgenic founder lines overlaps with endogenous p16Ink4a expression.
Next, the following was performed to determine whether INK-ATTAC is expressed in senescent cells in BubR1 hypomorphic tissue. Fat tissue of aged BubR1H/H:INK-ATTAC mice was strongly positive for senescence-associated-β-galactosidase (SA-β-Gal; FIG. 3A). qRT-PCR analysis demonstrated that INK-ATTAC expression correlates with expression of senescence markers in IAT, including p21, Pai1, IL-6, and Igfbp2 (FIGS. 3B and 4A). Skeletal muscle and lens tissue of aged BubR1H/H:INK-ATTAC mice were SA-β-Gal negative, but both these tissues expressed other markers of senescence, including Mmp13, Pai1, p21, and IL6 (FIGS. 3B and 4A). To obtain additional evidence for selective expression of INK-ATTAC in senescent cells, IAT was collected from aged BubR1H/H:INK-ATTAC animals. Single-cell suspensions were prepared by collagenase treatment, and GFP+ and GFP− cell populations were separated by fluorescence activated cell sorting (FACS; FIG. 3C). Each population was analyzed for expression of INK-ATTAC and senescence markers by qRT-PCR. GFP+ cells not only expressed much higher levels of p16Ink4a than GFP− cells, but also exhibited elevated levels of other key senescence markers for IAT (FIGS. 3D and 4B). Senescence markers in GFP− cells from BubR1H/H:INK-ATTAC mice were as low as in GFP− cells from age-matched WT:INK-ATTAC mice. Taken together, these results indicated that INK-ATTAC is selectively expressed in p16Ink4a-positive senescent cells.
To determine whether INK-ATTAC can eliminate senescent cells, bone marrow cells of WT:INK-ATTAC transgenic lines 3 and 5 were cultured in the presence of rosiglitazone to induce senescence, and cell survival was monitored after activating the FKBP-Casp8 fusion protein by AP20187 treatment. The vast majority of cells from both transgenic lines were found to be either dead or in the process of dying 48 hours after adding AP20187 (FIG. 5A). In contrast, parallel cultures that remained untreated consisted almost entirely of viable SA-β-Gal-positive cells. These data demonstrated that FKBP-Casp8 activation efficiently eliminates p16Ink4a-positive senescent cells in vitro.
The following was performed to examine whether clearance of p16Ink4a-expressing cells from BubR1H/H mice prevents or delays the onset of age-related phenotypes in this progeroid background. To this end, cohorts of BubR1H/H:INK-ATTAC-3 and BubR1H/H:INK-ATTAC-5 mice were established, which were either treated with AP20187 every third day beginning at 3 weeks of age or left untreated. Both treated and untreated mice were monitored for development of age-associated deficits known to accompany p16Ink4a induction, including sarcopenia, cataracts, and loss of adipose tissue (Baker et al., Nat. Cell Biol., 10:825-836 (2008)). Treated mice of both BubR1H/H:INK-ATTAC lines exhibited substantially delayed onset of lordokyphosis (a measure of sarcopenia in this model) and cataracts compared to untreated mice, which developed these phenotypes at a rate similar to BubR1H/H mice lacking the INK-ATTAC transgene (FIGS. 5B and 5C). Consistent with decreased lordokyphosis, muscle fiber diameters of AP20187-treated BubR1H/H:INK-ATTAC animals were larger than those of untreated counterparts (FIG. 5D). In addition to muscle retention, treadmill exercise tests revealed that duration of exercise (FIG. 5E), distance traveled (FIG. 5F), and overall amount of work performed (FIG. 5G) were all significantly increased in the animals treated with AP20187, indicating preservation of muscle function. Dual-energy x-ray absorptiometry (DEXA) scans of BubR1H/H:INK-ATTAC mice confirmed that AP20187 treatment prevented loss of adipose tissue (FIG. 5H). All major fat deposits were larger in AP20187-treated BubR1H/H:INK-ATTAC animals (FIG. 5H), and individual adipocytes were markedly increased in size (FIG. 5I). Consistent with this generally increased adiposity, dorsal skin contained significantly more adipose tissue (FIG. 5J).
Age-related phenotypes of BubR1H/H mice that arise in a p16Ink4a-independent fashion, such as cardiac arrhythmias and arterial wall stiffening (Matsumoto et al., Stroke, 38:1050-1056 (2007)), were not attenuated in AP20187-treated BubR1H/H:INK-ATTAC-3 and BubR1H/H:INK-ATTAC-5 mice (FIGS. 6A and 6B). This correlated with lack of INK-ATTAC induction in heart and aorta (FIG. 1C and 6B). Cardiac failure is presumably the main cause of death in BubR1H/H which could explain why the overall survival of AP20187-treated BubR1H/H:INK-ATTAC mice was not substantially extended (FIG. 6C). To examine whether clearance of p16Ink4a-positive cells might have any overtly negative side effects, WT:INK-ATTAC mice were continuously treated with AP20187 until eight months of age. No such overtly negative side effects were observed. Taken together, these results indicated that continuous removal of p16Ink4a-expressing cells from BubR1H/H:INK-ATTAC mice selectively delays age-related phenotypes that depend on p16Ink4a induction.
The following was performed to determine whether the delayed onset of age-related pathologies coincided with a reduction in the number of senescent cells in these tissues. TAT of AP20187-treated BubR1H/H:INK-ATTAC mice exhibited a dramatic decrease in SA-β-Gal staining compared with TAT of untreated counterparts (FIG. 7A). Corresponding decreases of other senescence-associated markers were also observed, as well as expected reductions in INK-ATTAC and GFP (FIGS. 7B and 8A). Skeletal muscle (FIGS. 7C and 8B) and eye (FIGS. 7D and 8C) exhibited a similar reduction in senescence indicators. BrdU incorporation was lower in TAT and muscle tissue of untreated than in treated animals (FIG. 7E), further supporting the contention that senescence-associated replicative arrest is decreased upon administration of AP20187 in BubR1H/H:INK-ATTAC transgenic animals. Together, these results indicated that senescent cells were cleared from tissues and that this delays acquisition of age-related dysfunction in BubR1 hypomorphic mice.
The results provided herein demonstrate the generation of a transgenic mouse model that allows for the inducible removal of p16Ink4a-positive senescent cells. By breeding this model into a progeroid mouse genetic background, the clearance of p16Ink4a-expressing senescent cells selectively was shown to delay onset of age-related pathologies in tissues that accumulate these cells, demonstrating that development of age-related pathologies and cellular senescence are clearly linked in this model. These results also demonstrate that therapeutic interventions to clear senescent cells or block their effects represent an avenue for treating or delaying age-related diseases and improving healthy human lifespan.
The INK-ATTAC transgenic construct was made as follows. The FKBP-Casp8 fragment was subcloned from the aP2-ATTAC transgenic construct (Pajvani et al., Nat. Med., 11:797-803 (2005)), and inserted into pBlueScriptII (Stratagene). A 2617-bp segment of the murine p16Ink4a promoter was PCR amplified from BAC DNA to replace the aP2 promoter. An IRES-EGFP fragment was inserted 3′ of the ATTAC. Nine transgenic founder lines of mice were obtained by injection of this construct into FVB oocytes using standard methods. A PCR-based method was used for INK-ATTAC transgene identification. BubR1H/H mice were generated as described elsewhere (Baker et al., Nat. Genet., 36:744-749 (2004)). For AP20187 (ARIAD Pharmaceuticals, Inc.; Cambridge, Mass.) treatments, animals were injected intraperitoneally (i.p.) every three days with 0.2 μg/g body weight of the dimer-inducing drug (Pajvani et al., Nat. Med., 11:797-803 (2005)). All mice were on a mixed 129×C57BL/6×FVB genetic background. Animals were housed in a pathogen-free barrier environment throughout the study. Experimental procedures involving the use of laboratory mice were reviewed and approved by the appropriate committee. GraphPad Prism software was used for generating survival curves and for statistical analyses.
Bone marrow cells were obtained by flushing of tibia and femur bones of 2-month-old WT:INK-ATTAC transgenic mouse lines and cultured as described elsewhere (Soleimani and Nadri, Nat. Protoc., 4:102-106 (2009)). In brief, after washing by centrifugation at 400×g for 10 minutes and counting of viable cells with trypan blue, cells were resuspended in DMEM containing 15% FBS to a final concentration of 5×106 viable cells per mL. Initially, cells were plated in 6-well tissue culture dishes at 3.5 mL/well (1.9×106 cells/cm2). Cultures were kept in a humidified 5% CO2 incubator at 37° C. for 72 hours, when non-adherent cells were removed by changing the medium. Assays were performed on cells that had been trypsinized and seeded to confluency in 24-well plates. To induce senescence and evaluate expression of the INK-ATTAC transgene, cells were treated with 1 μM rosiglitazone (Cayman Chemical Company, Ann Arbor, Mich.) or with vehicle. The accumulation of GFP-positive cells was observed by fluorescence microscopy. After 5 days of rosiglitazone treatment, cells were then washed with PBS and treated with vehicle, 1 μM rosiglitazone, 10 nM AP20187, or both. After 48 hours, cultures were fixed and stained for SA-β-Gal activity as described elsewhere (Dimri et al., Proc. Natl. Acad. Sci. USA, 92:9363-9367 (1995)).
qRT-PCR and Flow Cytometry
RNA extraction, cDNA synthesis, and qRT-PCR from whole-mouse tissue were performed as described elsewhere (Baker et al., Nat. Cell Biol., 10:825-836 (2008)). To perform qRT-PCR on GFP+ and GFP− cell populations of IAT, single-cell suspensions of stromal vascular fraction were prepared from about 50 mg IAT as described elsewhere (Kirkland et al., Int. J. Obes. Relat. Metab. Disord., 20(Suppl 3):5102-107 (1996)). GFP+ and GFP− cells were then separated and collected using a FACS Aria Cell Sorter running FACSDiva software (BD Biosciences). RNA was extracted from these cells using an RNeasy Micro Kit (Qiagen), and cDNA synthesized using a WT-Ovation RNA Amplification kit (NuGEN Technologies, Inc.) according to the manufacturers' protocols.
qRT-PCR primers were as follows: FKBP-Casp8 forward, GAATCACAGACT-TTGGACAAAGTT (SEQ ID NO:25); FKBPCasp8 reverse, GGTCAAAGCCCCT-GCATCCAAG (SEQ ID NO:26); EGFP forward, CAAACTACAACAGCCACAACG (SEQ ID NO:27); and EGFP reverse, GGTCACGAACTCCAGCAG (SEQ ID NO:28). Sequences of other primers used were as described elsewhere (Baker et al., Nat. Cell Biol., 10:825-836 (2008)). Statistical differences were determined using two-tailed unpaired t tests.
Bi-weekly checks for lordokyphosis and cataracts were performed as described elsewhere (Baker et al., Nat. Cell Biol., 10:825-836 (2008)). Skeletal muscle fiber diameter measurements were performed on cross sections of gastrocnemius and abdominal muscles of female mice (n=6 mice per genotype). Fifty total fibers per sample were measured using a calibrated computer program (Olympus MicroSuite Five). Fat cell diameter measurements were performed on IAT according to the same method. Dissection, histology, and measurements of dermal and adipose layers of dorsal skin were performed as described elsewhere (Baker et al., Nat. Genet., 36:744-749 (2004)). Measurements of body weight, length, gastrocnemius muscle, and assorted adipose deposits were performed on 8-10-month-old females (n=6 per genotype). Bone mineral content, bone mineral density, and total body adipose tissue were analyzed by DEXA scanning as described elsewhere (Krishnamurthy et al., J. Clin. Invest., 114:1299-1307 (2004)) (n=6 per genotype). Exercise measurements were performed on 8-10-month-old mice as described elsewhere (Handschin et al., J. Biol. Chem., 282:30014-30021 (2007); and LeBrasseur et al., J. Gerontol. A. Biol. Sci. Med. Sci., 64:940-948 (2009)). Animals were acclimated for three days for 5 minutes at a speed of 5 m/minute prior to experimentation. For the experiment, the speed of the treadmill began at 5 m/minute and was increased to 8 m/minute after 2 minutes. Thereafter, the speed was increased at a rate of 2 m/minute every 2 minutes, and the time (in seconds) and distance (in meters) to exhaustion, as defined by an inability to move along the treadmill with stimulation, were determined The formula to determine the amount of work (J) performed was: mass (kg) *g (9.8 m/s2)*distance (m)*sin(θ) (with an incline of θ=5°.
In vivo BrdU Incorporation and SA-β-Gal Staining
Analyses for in vivo BrdU incorporation were performed in 8-10-month-old female mice (n=6 per genotype) as described 13. Adipose tissue depots were stained for SA-β-Gal activity as described elsewhere (Baker et al., Nat. Cell Biol., 10:825-836 (2008)).
It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
1. A transgenic mouse, the nucleated cells of which contain a transgene, said transgene containing a promoter sequence operably linked to a nucleic acid sequence encoding a polypeptide having the ability to kill a cell or facilitate the killing of a cell when said transgenic mouse is administered a compound, wherein senescent cells of said transgenic mouse express said polypeptide, and wherein said senescent cells of said transgenic mouse are killed when said compound is administered to said transgenic mouse.
2. The transgenic mouse of claim 1, wherein less than 10 percent of non-senescent cells of said transgenic mouse are killed when said compound is administered to said transgenic mouse.
3. The transgenic mouse of claim 1, wherein said promoter sequence is a p16Ink4a promoter sequence.
4. The transgenic mouse of claim 1, wherein said polypeptide comprises a caspase 8 polypeptide sequence.
5. The transgenic mouse of claim 1, wherein said polypeptide comprises a FKBP polypeptide sequence.
6. The transgenic mouse of claim 1, wherein said polypeptide is a FKBP-caspase 8 fusion polypeptide.
7. The transgenic mouse of claim 1, wherein said compound is AP20187.
8. The transgenic mouse of claim 1, wherein the genetic background of said transgenic mouse is a BubR1H/H genetic background.
9. The transgenic mouse of claim 1, wherein said transgene comprises nucleic acid encoding a marker polypeptide.
10. The transgenic mouse of claim 9, wherein said marker polypeptide is a GFP polypeptide.