US20140308269A1
2014-10-16
14/083,146
2013-11-18
Humanized antibodies that bind ICAM-1 are provided. Antibodies include those selected from: SEQ ID NO:1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI). Subsequences of the humanized antibodies capable of finding an ICAM-1 epitope are also provided. Methods of inhibiting pathogen infection (e.g., HRV) of a cell employing humanized antibodies capable of finding an ICAM-1 epitope are further provided.
Get notified when new applications in this technology area are published.
C07K16/2896 » CPC main
Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against molecules with a "CD"-designation, not provided for elsewhere
C07K16/28 IPC
Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
This application is a divisional application of U.S. Ser. No. 12/748,304 filed Mar. 26, 2010 (now U.S. Pat. No. 8,586,712), which is a divisional application of U.S. Ser. No. 11/519,322 filed Sep. 11, 2006 (now U.S. Pat. No. 7,696,324), which is a continuation of U.S. Ser. No. 09/910,483 filed Jul. 19, 2001 (now abandoned), which is a continuation-in-part of U.S. Ser. No. 09/555,446, filed on Aug. 16, 2000 (now abandoned) as a 371 national stage of PCT/US98/25422 filed on Nov. 30, 1998, each of which is hereby incorporated by reference in its entirety.
The invention relates to humanized antibody compositions and methods of making and using humanized antibodies.
Monoclonal antibodies have become an important class of therapeutic proteins. However, foreign immunoglobulins used in humans can elicit an anti-globulin response which may interfere with therapy or cause allergic or immune complex hypersensitivity. To avoid this problem, a monoclonal antibody may be âhumanized,â and this is typically carried out by CDR grafting.
CDR's, also called hypervariable regions, are present in immunoglobulin light and heavy chains and are flanked by âframeworkâ regions. CDR grafting was first described in Jones et al. ((1986) Nature 321:522-525). In this and later publications, the CDRs of three mouse antibodies were grafted onto the variable domain frameworks of the human immunoglobulin NEW (VH) and REI (VL). The resulting humanized antibodies had the same antigen specificity and a similar affinity as the parental murine monoclonal antibody (mAb) (Jones et al. supra; Verhoeyen et al. (1988) Science 239:1534-1536; Riechmann et al. (1988) Nature 332:323-327; U.S. Pat. No. 5,225,539).
CDR grafting has been described by Queen and coworkers who reported the humanization of four murine monoclonal antibodies (Queen et al. (1989) Proc. Natl. Acad. Sci. USA 86:10029-10033; Co et al. (1991)Proc. Natl. Acad. Sci. USA 88:2869-2873; Co et al. (1992) J. Immunol. 148:1149-1154; and U.S. Pat. Nos. 5,585,089; 5,693,761; and 5,693,762). Murine residues were inserted in the human framework in order to maintain affinity and, in each case the original antigen specificity was maintained. The affinities of the humanized antibodies ranged from â to 3 times of the parental unmodified murine antibodies.
The invention provides humanized antibodies that bind ICAM-1. In one embodiment, the antibody is selected from: SEQ ID NO:1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI). Subsequences of antibodies that bind ICAM-1 are provided, for example, single chain, Fab, FabⲠand (Fab)2 fragments. In particular aspects, the humanized antibody has greater affinity for ICAM-1 than the parental (non-human) antibody. Variant and modified forms of antibodies that bind ICAM-1 are also provided, for example, antibodies selected from SEQ ID NO:1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI) having one or more amino acid substitutions, insertions or deletions.
The invention also provides humanized antibodies that bind ICAM-1 and inhibit pathogen infection of cells expressing ICAM-1. Such invention antibodies include antibodies that provide greater protection from pathogen infection than parental (non-human) antibody. In particular aspects, a humanized antibody has a protective efficacy at least 2 times greater, 5 times greater, 10 times greater, 20 times greater, 30 times greater than the non-humanized antibody. In other aspects, the pathogen is human rhinovirus (HRV), coxackie A virus, respiratory syncytial virus (RSV), or malaria.
The humanized antibodies of the invention include intact immunoglobulin molecules, comprising 2 full-length heavy chains and 2 full-length light chains, and subsequences that inhibit pathogen infection. Particular subsequences include, for example, single chain, Fab, FabⲠor (Fab)2 fragment.
The humanized antibodies of the invention include multispecific or multifunctional antibodies. In one aspect, such an antibody is formed by linking a humanized antibody to one or more identical or different antibodies to form a multimer (e.g. using a linker). Antibody multimers include a homo- or hetero-dimer, trimer, tetramer or any other higher order oligomer. Antibody multimers that include different antibodies are human, humanized or non-human. Multimeric forms include antibody oligomers that form via a multimerization domain (e.g. a human amino acid sequence) or a covalent bond. Antibody multimers that include a multimerization domain further include forms having a linker located between the multimerization domain and the antibody.
The invention additionally provides nucleic acid sequences encoding humanized antibodies, subsequences and modified from thereof (e.g., aurin acid additions, deletions or substitutions). Nucleic acid sequences further include expression cassettes in which nucleic acid encoding humanized antibodies are operably linked to an expression control element. Vectors and cells (prokaryotic and eukaryotic) that include the nucleic acids also are provided.
The invention further provides pharmaceutical compositions including humanized antibodies, subsequences, multimers, variants and modified forms, and nucleic acids encoding them, and a pharmaceutically acceptable carrier. In particular aspects, the pharmaceutically acceptable carrier is compatible with inhalation or nasal delivery to a subject.
The invention further provides methods of inhibiting pathogen infection of a cell. In one embodiment, a method includes contacting a pathogen or a cell with an amount of a humanized antibody, subsequence, multimer, variant or modified form sufficient to inhibit pathogen infection of the cell. In one aspect, the cell expresses ICAM-1. In another aspect, the cell (e.g., epithelial cell) is present in a subject.
The invention also provides methods of inhibiting HRV infection of a cell. In one embodiment, a method includes contacting HRV or a cell susceptible to HRV infection with an amount of a humanized antibody, subsequence, multimer, variant or modified form effective to inhibit HRV infection of the cell (e.g., epithelial cell). In one aspect, the cell is present in a subject. In another aspect, the cell is present in a subject having or at risk of having asthma. In yet another aspect, the subject is a newborn or between the ages of 1 to 5, 5 to 10 or 10 to 18. In still another aspect, the antibody, subsequence, multimer, variant or modified form binds to an antigen present on the surface of the cell (e.g., ICAM-1). In various additional aspects, the humanized antibody is administered locally, via inhalation or intranasally.
The invention also provides methods of inhibiting HRV infection, inhibiting HRV progression or treating HRV infection of a subject. In one embodiment, a method includes administering to a subject having or at risk of having HRV infection an amount of a humanized antibody, subsequence, multimer, variant or modified form effective to inhibit HRV infection, inhibit HRV progression or treat HRV infection of the subject. In one aspect, the subject has or is at risk of having asthma. In another aspect, the subject is a newborn or between the ages of 1 to 5, 5 to 10 or 10 to 18. In various additional aspects, the humanized antibody is administered locally, via inhalation or intranasally.
The invention additionally provides methods of decreasing or inhibiting one or more symptoms of the common cold in a subject. In one embodiment, a method includes administering to a subject having a common cold an amount of a humanized antibody, subsequence, multimer, variant or modified form effective to decrease or inhibit one or more symptoms of the common cold in the subject. In one aspect, the subject has or is at risk of having asthma. In another aspect, the subject is a newborn or between the ages of 1 to 5, 5 to 10 or 10 to 18. In various additional aspects, the humanized antibody is administered locally, via inhalation or intranasally.
FIG. 1. shows the amino acid sequence of the VH and VL domains of murine 1A6 antibody (SEQ ID NOs: 37 and 38, respectively) and human consensus sequence of heavy chain subgroup III (Humiii) (SEQ ID NO: 39) and light chain kappa subgroup (SEQ ID NO:40). Asterisks denote amino acid differences between human and mouse sequence. CDR amino acids are in bold face.
FIGS. 2A-2C show a molecular model of humanized 1A6 (Hum B). (A) side view of humB variable domains which include: VH; VL; CDRs; the six high risk âVernier zoneâ residues and the VH60-64. (B) Top view of the humB variable domains which include: VH; VL; CDRs; the six high risk âVernier zoneâ residues and the VH60-64. (C) VL49 and its surrounding residues which include: ICAM-1; VH and VL residues; residues at VH-VL interphase; W102 in VH.
FIG. 3 shows the amino acid sequences of the VH domain of murine 1A6 antibody (SEQ ID NO: 37), humanized VH domain of 1A6 (HumB/Hum19) (SEQ ID NO: 43), and human consensus sequences of heavy chain subgroup III (Humiii) (SEQ ID NO: 39), as well as the VL domain of murine 1A6 antibody (SEQ ID NO: 38), humanized VL domain of 1A6 (HumB/Hum19) (SEQ ID NO: 44), and light chain kappa subgroup I (SEQ ID NO: 40). Asterisks and bold face amino acids are as previously indicated.
FIG. 4 shows the cDNA sequence of humanized scFV3 (HumA) antibody (SEQ ID NO: 47). Restriction sites are indicated by underlining.
FIG. 5 shows protection from HRV15 infection with mouse 1A6 scFv antibody and humanized 1A6 scFv antibody HumA, HumB, HumC, HumD, HumF, HumH and HumI.
The present invention is based, at least in part, upon producing humanized antibodies. More particularly, complementarity determining region (CDR) from a non-human antibody are grafted into a human framework region. Following grafting, one or more amino acids of the antibody are mutated to human sequences. For example, mutating a murine amino acid to a human amino acid in a framework region or CDR of the grafted antibody can produce a humanized antibody having increased antigen binding affinity relative to the non-human or grafted antibody. Humanized antibodies are not immunogenic or are less immunogenic than non-human antibodies when administered to human subjects. Therefore, humanized antibodies are useful in a variety of therapeutic and diagnostic applications. For example, as exemplified herein, a humanized antibody of the invention protects cells from HRV infection, a virus that can cause the common cold, and other associated disorders (e.g. otitis media, bronchitis, sinusitis etc.).
Thus, in accordance with the invention, there are provided humanized antibodies. In one embodiment, a humanized antibody binds to ICAM-1. In one aspect, a humanized antibody that binds ICAM-1 protects against pathogen infection of cells expressing ICAM-1. In other aspects, a humanized antibody is selected from any of SEQ ID NO:1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ED NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI). In another embodiment, a humanized antibody has a greater or less affinity for the antigen than the donor non-human antibody. In various aspects, affinities range from greater or less affinity for the antigen than either the donor or recombinant antibody. In particular aspects, humanized antibody has an antigen binding affinity 4-fold, 5-fold, 5- to 8-fold, 5- to 10-fold, 8- to 15-fold, 10- to 20-fold, 20- to 40-fold, 20- to 100-fold or greater than the parental antibody.
Human antibody sequence regions can be used for producing humanized antibodies of the invention. For example, a âconsensus sequence,â an antibody sequence having the most frequently occurring amino acid residues at particular positions in an antibody or an antibody region, may be used. As an example, human variable region domain sequences are described in Kabat (Sequences of Proteins of Immunologicul Interest. 4th Ed. US Department of Health and Human Services. Public Health Service (1987)). Sequences that are completely determined in the framework regions, 1-23, 35-49, and 57-88 in the light chains, and in the framework regions, 1-30, 36-49, and 66-94, in the heavy chains, are included in the survey. For the fourth framework region, 98-107 in the light chain and 103-113 in the heavy chain, residues that can be derived from the known J-minigene segments are surveyed.
At the end of the survey, the most frequently occurring residue at a given position is chosen as the residue in the consensus sequence. Consensus sequences may therefore be identified by surveying amino acid residues at each position of a plurality of antibodies; the most frequently occurring amino acid at a given position in the region of interest is a part of the consensus. In many instances, more than one residue will be found at high frequency at a given position. In such cases, if the amino acid that occurs at least one-fourth as frequently as the most frequently occurring the amino acid residue is considered a part of the consensus sequence.
The published consensus sequence of human VH subgroup III, based on a survey of 22 known human VH III sequences, and the published consensus sequence of human VL kappa-chain subgroup I, based on a survey of 30 known human kappa I sequences may be used for human antibody (Padlan (1994) Mol. Immunol. 31:169-217; Padlan (1991) Mol. Immunol. 28:489-498). These human consensus sequences were previously used to humanize two antibodies (Carter et al. (1992) Proc. Natl. Acad. Sci. USA 89:4285-4289; Presta et al. (1993) J. Immunol. 151: 2623-2632). These human VH subgroup III and VL-kappa subgroup I consensus sequences are selected as frameworks, respectively, to humanize mAb1A6 as described in Example 1. Thus, consensus sequences known in the art, as exemplified for human VH subgroup III or VL-kappa subgroup I, can be chosen as acceptor frameworks for producing humanized antibody in accordance with the invention.
Any mouse, rat, guinea pig, goat, non-human primate (e.g., ape, chimpanzee, macaque, orangutan, etc.) or other animal antibody may be used as a CDR donor for producing humanized antibody. Murine antibodies secreted by hybridoma cell lines can also be used. Donor CDRs are selected based upon the antigen to which the antibody binds. Thus, donor CDRs include sequences from antibodies that bind to pathogens, such as bacteria, viruses, protozoa and other microorganisms. Donor CDRs also include antibodies that bind to molecules to which the pathogens bind, for example, cell surface proteins (e.g., adhesion proteins, receptor proteins, immune-recognition/modulation proteins such as HLA, tumor associated antigens, etc.). In one particular example, the donor antibody is a mouse monoclonal antibody 1A6 (mAb1A6), which specifically binds to ICAM-1.
âComplementarity determining regionsâ or âCDRsâ are among the sequences that can be grafted into framework sequences. CDRs refer to sequence regions that confer antibody specificity and affinity. CDRs are also generally known as supervariable regions or hypervariable loops. CDR regions of antibodies have been mapped and are defined as in Kabat (Sequences of Proteins of Immunological Interest. 4th Ed. US Department of Health and Human Services. Public Health Service (1987)) and Chothia and Lesk ((1987) J. Mol. Biol. 186:651-663)). In particular, for heavy chain, CDR1 is defined as H26-H35, CDR2 is H50-65 and CDR3 is H95-H102; for light chain, CDR 1 is L24-L34, CDR2 is L50-L56 and CDR3 is L89-L97. The amino acids are numbered according to the scheme described in Kabat (Sequences of Proteins of Immunological Interest. 4th Ed. US Department of Health and Human Services. Public Health Service (1987)). Variable region domains typically comprise the amino-terminal approximately 105-115 amino acids a of a naturally-occurring immunoglobulin chain (e.g., amino acids 1-110). Variable domains shorter or longer than these exemplary sequence lengths may also be used.
Thus, the invention provides humanized antibodies, methods of making the antibodies and methods of using the antibodies, including therapeutic and diagnostic methods. In one embodiment, a humanized antibody has increased affinity for the antigen relative to non-humanized antibody (e.g., less than 1.18Ă10â6 M in KD against ICAM-1; less than 1Ă10â7 M in KD, less than 5Ă10â7 M in KD, less than 1Ă10â8 M in KD, less than 5Ă10â8 M in KD). In various aspects, a humanized antibody comprises an amino acid sequence set forth in any of SEQ ID NO:1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI); and antigen binding subsequences thereof. In various additional aspects, an antibody subsequence comprises Fab, Fabâ˛, (Fabâ˛)2, Fv, and single chain antibody (SCA), e.g., scFv fragments.
The humanized antibodies of the invention also include antibody multimers. In various aspects, a multimer comprises a dimer, trimer, tetramer or other higher order oligomer. In other aspects, multimers comprise combinations of the same antibodies (homo-oligomers) and different antibodies (hetero-oligomers), the different antibodies being human, humanized or non-human.
The terms âprotein,â âpolypeptideâ and âpeptideâ are used interchangeably herein to refer to two or more covalently linked amino acids, also referred to as âresidues,â through an amide bond or equivalent Polypeptides are of unlimited length and may be comprised of L- or D-amino acids as well as mixtures thereof. Amino acids may be linked by non-natural and non-amide chemical bonds including, for example, those formed with glutaraldehyde, N-hydroxysuccinimide esters, bifunctional maleimides, or N,Nâ˛-dicyclohexylcarbodiimide (DCC). Non-amide bonds include, for example, ketomethylene, aminomethylene, olefin, ether, thioether and the like (see, e.g., Spatola (1983) in Chemistry and Biochemistry of Amino Acids, Peptides and Proteins, Vol. 7, pp 267-357, âPeptide and Backbone Modifications,â Marcel Decker, NY). Polypeptides may have one or more cyclic structures such as an end-to-end amide bond between the amino and carboxy-terminus of the molecule or intra- or inter-molecular disulfide bond. Polypeptides may be modified in vitro or in vivo, e.g., post-translationally modified to include, for example, sugar residues, phosphate groups, ubiquitin, fatty acids or lipids. Polypeptides further include amino acid structural and functional analogues, for example, peptidomimetics having synthetic or non-natural amino acids or amino acid analogues.
The term âantibodyâ refers to a protein that binds to other molecules (antigens) via heavy and light chain variable domains. VH and VL respectively. Antibodies include IgG, IgD, IgA, IgM and IgE. The antibodies may be intact immunoglobulin molecules, two full length heavy chains linked by disulfide bonds to two full length light chains, as well as subsequences (i.e. fragments) of immunoglobulin molecules, with our without constant region, that bind to an epitope of an antigen, or subsequences thereof (i.e. fragments) of immunoglobulin molecules, with or without constant region, that bind to an epitope of an antigen. Antibodies may comprise full length heavy and light chain variable domains, VH and VL, individually or in any combination. For example, each of SEQ ID NO:1 and 3 (HumA): SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI) are included individually and in any combination.
Polypeptide sequences can be made using recombinant DNA technology of polypeptide encoding nucleic acids via cell expression or in vitro translation, or chemical synthesis of polypeptide chains using methods known in the art. Antibodies according to the invention, including humanized sequences and subsequences can be expressed from recombinantly produced antibody-encoding nucleic acid (see, e.g., Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1989; Harlow and Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1999; Fitzgerald et al., J.A.C.S. 117:11075 (1995); Gram et al., Proc. Natl. Acad. Sci. USA 89:3576-80 (1992)). For example, as described in Example 3, cDNA encoding humanized antibody sequences can be expressed in bacteria in order to produce invention antibodies. Antibodies may also be produced by expressing encoding nucleic acids in mammalian; insect, and plant cells. Polypeptide sequences including antibodies can also be produced by a chemical synthesizer (see, e.g., Applied Biosystems, Foster City, Calif.).
As used herein, the term âsubsequenceâ or âfragmentâ means a portion of the full length molecule. For example, a subsequence of an antibody is one or more amino acid less in length than full length polypeptide (e.g. one or more internal or terminal amino acid deletions from either amino or carboxy-termini). Subsequences therefore can be any length up to the full length molecule.
Specific examples of antibody subsequences include, for example, Fab, Fabâ˛, (Fabâ˛)2, Fv, or single chain antibody (SCA) fragment (e.g., scFv). Subsequences include portions which retain at least part of the function or activity of full length sequence. For example, an antibody subsequence will retain the ability to selectively bind to an antigen even though the binding affinity of the subsequence may be greater or less than the binding affinity of the full length antibody. Subsequences can comprise a portion of any of the invention humanized sequences, for example, any of SEQ ID NO:1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI).
Pepsin or papain digestion of whole antibodies can be used to generate antibody fragments. In particular, an Fab fragment consists of a monovalent antigen-binding fragment of an antibody molecule, and can be produced by digestion of a whole antibody molecule with the enzyme papain, to yield a fragment consisting of an intact light chain and a portion of a heavy chain. An (Fabâ˛)2 fragment of an antibody can be obtained by treating a whole antibody molecule with the enzyme pepsin, without subsequent reduction. An FabⲠfragment of an antibody molecule can be obtained from (Fabâ˛)2 by reduction with a thiol reducing agent, which yields a molecule consisting of an intact light chain and a portion of a heavy chain. Two FabⲠfragments are obtained per antibody molecule treated in this manner.
An Fv fragment is a fragment containing the variable region of a light chain VL and the variable region of a heavy chain VH expressed as two chains. The association may be non-covalent or may be covalent, such as a chemical cross-linking agent or an intermolecular disulfide bond (lnbar et al., (1972) Proc. Natl. Acad. Sci. USA 69:2659; Sandhu (1992) Crit. Rev. Biotech. 12:437).
A single chain antibody (âSCAâ) is a genetically engineered or enzymatically digested antibody containing the variable region of a light chain VL and the variable region of a heavy chain, optionally linked by a flexible linker, such as a polypeptide sequence, in either VL-linker-VH orientation or in VH-linker-VL orientation. Alternatively, a single chain Fv fragment can be produced by linking two variable domains via a disulfide linkage between two cysteine residues. Methods for producing scFv antibodies are described, for example, by Whitlow et 4, (1991) In: Methods: A Companion to Methods in Enzymology 2:97; U.S. Pat. No. 4,946,778; and Pack et al., (1993) Bio/Technology 11:1271.
Other methods of producing antibody subsequences, such as separation of heavy chains to form monovalent light-heavy chain fragments, further cleavage of fragments, or other enzymatic, chemical, or genetic techniques may also be used, provided that the subsequences bind to the antigen to which the intact antibody binds.
As used herein, the term âbindâ or âbindingâ means that the compositions referred to have affinity for each other. âSpecific bindingâ is where the binding is selective between two molecules. A particular example of specific binding is that which occurs between an antibody and an antigen. Typically, specific binding can be distinguished from non-specific when the dissociation constant (KD) is less than about 1Ă10â5 M or less than about 1Ă10â6 M or 1Ă10â7 M. Specific binding can be detected, for example, by ELISA, immunoprecipitation, coprecipitation, with or without chemical crosslinking, two-hybrid assays and the like. Appropriate controls can be used to distinguish between âspecificâ and ânon-specificâ binding.
Invention antibodies, including full length antibodies, subsequences (e.g., single chain forms) may be present as dimer, trimers, tetramers, pentamers, hexamers or any other higher order oligomer that retains at least a part of antigen binding activity of monomer. Multimers can comprise heteromeric or homomeric combinations of full length antibody, subsequences, unmodified or modified as set forth herein and known in the art. Antibody multimers are useful for increasing antigen avidity in comparison to monomer due to the multimer having multiple antigen binding sites. Antibody multimers are also useful for producing oligomeric (e.g., dimer, trimer, tetramer, etc.) combinations of different antibodies thereby producing compositions of antibodies that are multifunctional (e.g., bifunctional, trifunctional, tetrafunctional, etc.).
The term âmultifunctionalâ means that the composition referred to has two or more activities or functions (e.g., antigen binding, enzyme activity, ligand or receptor binding, toxin, etc.). For example, an antibody that binds to a particular antigen which also has an attached polypeptide with enzyme activity (e.g., luciferase, acetyltransferase, galactosidase, peroxidase, etc.) is one particular example of a multifunctional antibody.
Multifunctional antibodies further include multispecific (e.g., bispecific, trispecific, tetraspecific, etc.) forms. The term âmultispecificâ means an antibody that binds to two or more different antigenic epitopes. The term âmultispecificâ means that the antibody contains two or more variable region sequences that bind to different epitopes. The different epitopes may be present on the same antigen or different antigens. For example, a multispecific antibody oligomer comprises a mixture of two or more antibodies each having different epitope binding specificity and which form a multimer. Multispecific antibodies may be comprised of individual antigen binding polypeptides each of which have distinct variable domains. For example, one of the antibodies may have two variable domains each of which recognizes a different epitope.
Candidate functions for multifunctional antibodies other than antigen binding and in addition to enzyme activity include, for example, detectable moieties such as radioisotopes and amino acid sequences (e.g., 35S, 131I, T7, immunoglobulin or polyhistidine tags, toxins (e.g., ricin, cholera, pertussis), cell surface proteins such as receptors, ligands (substrates, agonists and antagonists), adhesion proteins (e.g., streptavidin, avidin, lectins), growth factors, differentiative factors and chemotactic factors.
Multifunctional humanized antibodies can be produced through chemical crosslinking of the selected molecules (which have been produced by synthetic means or by expression of nucleic acid that encode the polypeptides) or through recombinant DNA technology combined with in vitro, or cellular expression of the polypeptide, and subsequent oligomerization. Multispecific antibodies can be similarly produced through recombinant technology and expression, fusion of hybridomas that produce antibodies with different epitopic specificities, or expression of multiple nucleic acid encoding antibody variable chains with different epitopic specificities in a single cell.
Antibodies may be either joined directly or indirectly through covalent or non-covalent binding, e.g. via a multimerization domain, to produce multimers. A âmultimerization domainâ mediates non-covalent protein-protein interactions. Specific examples include coiled-coil (e.g., leucine zipper structures) and alpha-helical protein sequences. Sequences that mediate protein-protein binding via Van der Waals' forces, hydrogen bonding or charge-charge bonds are also contemplated as multimerization domains. Additional examples include basic-helix-loop-helix domains and other protein sequences that mediate heteromeric or homomeric protein-protein interactions among nucleic acid binding proteins (e.g., DNA binding transcription factors, such as TAFs). One specific example of a multimerization domain is p53 residues 319 to 360 which mediate tetramer formation. Another example is human platelet factor 4, which self-assembles into tetramers. Yet another example is extracellular protein TSP4, a member of the thrombospondin family, which can form pentamers. Additional specific examples are the leucine zippers of jun, fos, and yeast protein GCN4.
Humanized antibodies may be directly linked to each other via a chemical cross linking agent or can be connected via a linker sequence (e.g., a peptide sequence) to form multimers. As used herein, âlinkerâ or âspacerâ refers to a molecule or group of molecules that connects two or more molecules to each other. A flexible linker allows rotation of the two molecules linked to each other to the extent that the molecules do not block each others function. For example, a linker such as an amino acid sequence attached to a humanized antibody which is itself attached to a multimerization domain, allows the antibody to bind to antigen without significant steric interference from the multimers of the oligomer. Non-peptide linkers include chemical cross linking agents and polyethylene glycol.
One specific example of a peptide linker is an immunoglobulin hinge sequence. Additional specific examples are polylysine, polyglutamic acid and mixtures of randomized amino acid sequences. Linker amino acid sequences may be fully human, humanized or non-human amino acid sequences, unmodified or modified as set forth herein. The invention therefore further provides humanized antibodies that include a linker sequence. Linker sequences include, for example, sequences from about 2 to 10, 10 to 20, 10 to 30, 25 to 50, 30 to 60 and 50 to 75 amino acids in length.
Antibodies also include modified forms such as sequences having one or more amino acid substitutions, additions or deletions, provided the modification does not destroy function, e.g., does not destroy antigen binding activity; the antibody retains, at least in part, antigen binding activity. For example, a modified humanized antibody will retain, at least in part, affinity for the antigen to which unmodified antibody binds. The term âmodificationâ therefore denotes an alteration of a molecule that does not destroy an activity of the modified molecule.
Modifications therefore include, for example, amino acid additions, insertions, deletions and substitutions. An example of an addition is where one or more amino acids are added to the N- or C-terminal end of a humanized antibody. An example of an insertion is where an amino acid is inserted into the sequence. An example of a deletion is where one or more amino acids are deleted from the N- or C-terminal end, or internally within the sequence.
The invention therefore also provides modified forms of the humanized antibodies, including one or more amino acid additions, insertions, deletions and substitutions. In one embodiment, a humanized antibody has one or more amino acid substitutions of a sequence set forth in SEQ ID NO:1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI), provided that the substituted antibody is capable of antigen binding. In a particular aspect, one or more of the amino acid substitutions are conservative amino acid substitutions. In another aspect, the substitution comprises 1-3, 3-5 or 5-10 amino acids. In yet another aspect, the substitution is with a human amino acid.
Exemplary amino acid substitutions include conservative amino acid substitutions. The term âconservative substitutionâ means the replacement of one amino acid by a biologically or chemically similar residue. Biologically similar means that the substitution is compatible with biological activity, e.g., for a humanized antibody, antigen binding. Particular examples of conservative substitutions include the substitution of one hydrophobic residue, such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as the substitution of arginine for lysine, glutamic for aspartic acids, or glutamine for asparagine, serine for threonine, and the like.
Modifications also include derivatized sequences, for example, amino acids in which free amino groups form amine hydrochlorides, p-toluene sulfonyl groups, carbobenzoxy groups; the free carboxy groups from salts, methyl and ethyl esters; free hydroxy groups that form O-acyl or O-alkyl derivatives, as well as naturally occurring amino acid derivatives, for example, 4-hydroxyproline, for proline, 5-hydroxylysine for lysine, homoserine for serine, ornithine for lysine, etc. Also included are modifications that confer covalent bonding, for example, a disulfide linkage between two cysteine residues thereby producing a cyclic polypeptide. Modifications can be produced using any of a variety of methods well known in the art (e.g., PCR based sited-directed, deletion and insertion mutagenesis, chemical modification and mutagenesis, cross-linking, etc.).
Modifications also include addition of functional entities such as tags (e.g., polyhistidine, T7, immunoglobulin, etc.), gold particles, covalently or non-covalently attached to the humanized antibodies or subsequences or multimers. Thus, the invention provides modified humanized antibodies having one or more activities (e.g., retain at least part of the antigen binding activity) of unmodified parent antibody. Modifications include radioactive alternatively non-radioactive detectable labels attached to or incorporated into the molecule.
The term âidenticalâ or âidentityâ means that two or more referenced entities are the same. Thus, where two nucleic acid sequences are identical, they have the same sequence. âAreas of identityâ means that a portion of two or more referenced entities are the same. Thus, where two nucleic acid sequences are identical over one or more parts of their sequence, they share identity in these areas. The term âsubstantial identityâ means that the identity is structurally or functionally significant. That is, the identity is such that the molecules are structurally identical or perform the same function (e.g., biological function) even though the molecules differ. Due to variation in the amount of sequence conservation between structurally and functionally related proteins, the amount of sequence identity for substantial identity will depend upon the type of region/domain and its function. For nucleic acid sequences, 50% sequence homology and above may constitute substantial homology. Substantial homology for proteins can be significantly less, for example, as little as 30% sequence homology, but typically is more, e.g., 50%, 60%, 75%, 85% or more.
The extent of identity between two sequences can be ascertained using various computer programs and mathematical algorithms known in the art. Such algorithms that calculate percent sequence identity (homology) generally account for sequence gaps and mismatches over the comparison region. For example, a BLAST (e.g., BLAST 2.0) search algorithm (see, e.g., Altschul et al. (1990) J. Biol. 215:403-10, publicly available through NCBI at http:/www.ncbi.nlm.nikgov) has exemplary search parameters as follows: Mismatch-2; gap open 5; gap extension 2. For polypeptide sequence comparisons, a BLASTP algorithm is typically used in combination with a scoring matrix, such as PAM100, PAM 250, BLOSUM 62 and the like.
As used herein, the term âisolated,â when used as a modifier of invention compositions (e.g., antibodies, subsequences, modified forms, multimers, nucleic acids encoding same, cells, vectors, etc.), means that the compositions are made by the hand of man and are separated from their naturally occurring in vivo environment. Generally, compositions so separated are substantially free of one or more materials with which they normally associate with in nature, for example, one or more protein, nucleic acid, lipid, carbohydrate, cell membrane. An âisolatedâ antibody can also be âsubstantially pureâ when free of most or all of the materials with which they may normally associate with in nature. Thus, an isolated molecule that also is substantially pure does not include polypeptides or polynucleotides present among millions of other sequences, such as antibodies of an antibody library or nucleic acids in a genomic or cDNA library, for example. Purity can be at least about 60% or more by mass. The purity can also be about 70% or 80% or more, and can be greater, for example, 90% or more. Purity can be determined by any appropriate method, including, for example, UV spectroscopy, chromatography (e.g., HPLC, gas phase), gel electrophoresis (e.g., silver or coomassie staining) and sequence analysis (nucleic acid and peptide).
The invention also provides nucleic acids encoding invention humanized antibodies, including high affinity humanized antibodies, subsequences, modified forms and multimers thereof. In various embodiments, a nucleic acid encodes a polypeptide set forth in SEQ ID NO:1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI).
As used herein, a ânucleic acidâ refers to at least two or more ribo- or deoxy-ribonucleic acid base pairs that are linked through a phosphoester bond or equivalent. Nucleic acids include polynucleotides and polynucleosides. Nucleic acids include single, double or triplex, circular or linear, molecules. A nucleic acid molecule may belong exclusively or in a mixture to any group of nucleotide-containing molecules, as exemplified by, but not limited to, the following groups of nucleic acid molecules: RNA, DNA, cDNA, genomic nucleic acids, non-genomic nucleic acids, naturally occurring and non naturally occurring nucleic acids and synthetic nucleic acids. This includes, by way of example, nucleic acids associated with any organelle, such as the mitochondria, ribosomal RNA, and nucleic acid molecules comprised chimerically of one or more components that are not naturally occurring along with naturally occurring components.
Additionally, a ânucleic acid moleculeâ may contain in part one or more non-nucleotide-based components as exemplified by, but not limited to, amino acids and sugars. Thus, by way of example, but not limitation, a ribozyme that is in part nucleotide-based and in part protein-based is considered a ânucleic acid molecule.â
Nucleic acids can be of any length. Nucleic acid lengths typically range from about 20 to 10 Kb, 10 to 5 Kb, 1 to 5 Kb or less, 1000 to about 500 base pairs or less in length. Nucleic acids can also be shorter, for example, 100 to about 500 base pairs, or from about 12 to 25, 25 to 50, 50 to 100, 100 to 250, or about 250 to 500 base pairs in length.
As a result of the degeneracy of the genetic code, nucleic acids include sequences and subsequences degenerate with respect to nucleic acids that encode SEQ ID NO:1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI), and subsequences thereof. Nucleic acids also include sequences complementary to a sequence that encodes SEQ ID NO:1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI), and subsequences thereof. Nucleic acid subsequences have from about 15 to 25, 25 to 50 or 50 to 100 nucleotides. Such nucleic acids are useful for hybridization to detect the presence or an amount of humanized antibody in a sample (in vitro, cell, culture medium, tissue or organ, serum, in a subject, etc.).
The invention further includes nucleic acids that hybridize at high stringency to nucleic acids that encode SEQ ID NO:1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI), subsequences thereof and nucleic acid sequences complementary thereto. Hybridizing nucleic acids are also useful for detecting the presence or an amount of humanized antibody in a sample.
The term âhybridizeâ refers to the binding between complementary nucleic acids. Sequences will generally have more than about 50% homology to a nucleic acid that encodes SEQ ID NO:1 or 3 (HumA); SEQ ID NO:5 or 7 (HumB); SEQ ID NO:9 or 11 (HumC); SEQ ID NO:13 or 15 (HumD); SEQ ID NO:17 or 19 (HumE); SEQ ID NO:21 or 23 (HumF); SEQ. ID NO:25 or 27 (HumG); SEQ ID NO:29 or 31 (HumH); and SEQ ID NO:33 or 35 (HumI). The region between related sequences can extend over at least about 30 base pairs, or about 50 base pairs, or about 100 to 200 or more residues.
As is understood by those skilled in the art, the TM (melting temperature) refers to the temperature at which binding between complementary sequences is no longer stable. For two sequences to bind, the temperature of a hybridization reaction must be less than the calculated TM for the sequences. The TM is influenced by the amount of sequence complementarity, length, composition (% GC), type of nucleic acid (RNA vs. DNA), and the amount of salt, detergent and other components in the reaction (e.g., formamide). All of these factors are considered in establishing appropriate hybridization conditions (see, e.g., the hybridization techniques and formula for calculating TM described in Sambrook et al., 1989, supra).
Typically, wash conditions are adjusted so as to attain the desired degree of hybridization stringency. Thus, hybridization stringency can be determined empirically, for example, by washing under particular conditions, e.g., at low stringency conditions or high stringency conditions. Optimal conditions for selective hybridization will vary depending on the particular hybridization reaction involved. An example of high stringency hybridization conditions are as follows: 2ĂSSC/0.1% SDS at about 37EC or 42EC (hybridization conditions); 0.5ĂSSC/0.1% SDS at about room temperature (low stringency wash); 0.5ĂSSC/0.1% SDS at about 42EC (moderate stringency wash); and 0.1ĂSSC/0.1% SDS at about 65EC (high stringency wash).
Nucleic acids of the invention can be produced using various standard cloning and chemical synthesis techniques. Such techniques include, but are not limited to: 1) nucleic acid amplification, e.g., polymerase chain reaction (PCR), with genomic DNA or cDNA targets using primers (e.g., a degenerate primer mixture) capable of annealing to antibody sequence; 2) chemical synthesis of nucleic acid sequences which can then be cloned into a plasmid, propagated amplified and purified and; 3) computer searches of databases for related sequences. Purity of nucleic acids can be determined through sequencing, gel electrophoresis and the like.
The invention further provides expression cassettes comprising a nucleic acid encoding a humanized antibody operably linked to an expression control element. As used herein, the term âoperably linkedâ refers to a physical or a functional relationship between the elements referred to that permit them to operate in their intended fashion. Thus, an expression control element âoperably linkedâ to a nucleic acid means that the control element modulates transcription and as appropriate, translation of the transcript.
There need not be physical linkage to nucleic acid in order to control expression. Thus, physical linkage is not required for the elements to be operably linked. For example, a minimal element can be linked to a nucleic acid encoding a humanized antibody. A second element that controls expression of an operably linked nucleic acid encoding a protein that functions âin transâ to bind to the minimal element can influence expression of the humanized antibody. Because the second element regulates expression of humanized antibody, the second element is operably linked to the nucleic acid encoding the humanized antibody.
The term âexpression control elementâ refers to nucleic acid that influences expression of an operably linked nucleic acid. Promoters and enhancers are particular non-limiting examples of expression control elements. A âpromoter sequenceâ is a DNA regulatory region capable of initiating transcription of a downstream (3Ⲡdirection) coding sequence. The promoter sequence includes a minimum number of bases necessary to initiate transcription. Enhancers also regulate gene expression but can function a distance from the transcription start site of the gene to which it is operably linked. Enhancers also function at either 5Ⲡor 3Ⲡends of the gene, as well as within the gene (e.g., in introns or coding sequences).
An expression control element can confer expression in a manner that is âconstitutive,â such that transcription of the operably linked nucleic acid occurs without the presence of a signal or stimuli. Expression control elements can confer expression in a manner that is âregulatable,â that is, a signal or stimuli increases or decreases expression of the operably linked nucleic acid. A regulatable element that increases expression of the operably linked nucleic acid in response to a signal or stimuli is also referred to as an âinducible elementâ A regulatable element that decreases expression of the operably linked nucleic acid in response to a signal or stimuli is referred to as a ârepressible elementâ (i.e., the signal decreases expression such that when the signal, is removed or absent, expression is increased).
Expression control elements include elements active in a particular tissue or cell type, referred to herein as a âtissue-specific expression control elements.â Tissue-specific expression control elements are typically active in specific cell or tissue because they are recognized by transcriptional activator proteins, or other regulators of transcription, that are unique to a specific cell or tissue type.
Expression control elements additionally include elements that confer expression at a particular stage of the cell cycle or differentiation. Accordingly, the invention further includes expression control elements that confer constitutive, regulatable, tissue-specific, cell cycle specific, and differentiation stage specific expression.
Expression control elements include full-length nucleic acid sequences, such as native promoter and enhancer elements, as well as subsequences or nucleotide variants thereof (e.g., substituted/mutated or other forms that differ from native sequences) which retain all or part of full-length or non-variant control element function (confer regulation, e.g., retain some amount of inducibility in response to a signal or stimuli).
For bacterial systems, constitutive promoters such as T7 and the like, as well as inducible promoters such as pL of bacteriophage Îť, plac, ptrp, ptac (ptrp-lac hybrid promoter) may be used. In insect cell systems, constitutive or inducible promoters (e.g., ecdysone) may be used. In yeast, constitutive or inducible promoters may be used (see, e.g., Ausubel et al., In: Current Protocols in Molecular Biology, Vol. 2, Ch. 13, ed., Greene Publish. Assoc. & Wiley Interscience, 1988; Grant et al., (1987) In: Methods in Enzymology, 153, 516-544, eds. Wu & Grossman, 31987, Acad. Press, N.Y.; Glover, DNA Cloning, Vol. II, Ch. 3, IRL Press, Wash., D.C., 1986; Bitter (1987) In: Methods in Enzymology, 152, 673-684, eds. Berger & Kimmel, Acad. Press, N.Y.; and, Strathern et al., The Molecular Biology of the Yeast Saccharomyces (1982) eds. Cold Spring Harbor Press, Vols. I and II). A constitutive yeast promoter such as ADH or LEU2 or an inducible promoter such as GAL may be used (R. Rothstein In: DNA Cloning. A Practical Approach. Vol. II, Ch. 3, ed. D. M. Glover, IRL Press, Wash.; D.C., 1986).
For mammalian cells, constitutive promoters of viral or other origins may be used. For example, SV40, or viral long terminal repeats (LTRs) and the like, or inducible promoters derived from the genome of mammalian cells (e.g., metallothionein IIA promoter; heat shock promoter, steroid/thyroid hormone/retinoic acid response elements) or from mammalian viruses (e.g., the adenovirus late promoter; the inducible mouse mammary tumor virus LTR) can be used for expression.
The invention also provides transformed cells and progeny thereof into which a nucleic acid molecule encoding humanized antibody has been introduced by means of recombinant DNA techniques in vitro, ex vivo or in vivo. The transformed cells can be propagated and the introduced nucleic acid transcribed, or encoded protein expressed. It is understood that a progeny cell may not be identical to the parental cell, since there may be mutations that occur during replication. Transformed cells include but are not limited to prokaryotic and eukaryotic cells such as bacteria, fungi, plant, insect, and animal (e.g., mammalian, including human) cells. The cells may be present in culture, in a cell, tissue or organ ex vivo or present in a subject.
The term âtransformedâ means a genetic change in a cell following incorporation of nucleic acid (e.g., a transgene) exogenous to the cell. Thus, a âtransformed cellâ is a cell into which, or a progeny of which a nucleic acid Molecule has been introduced by means of recombinant DNA techniques. Cell transformation to produce host cells may be carried out as described herein or using techniques known in the art. Accordingly, methods of producing cells containing the nucleic acids and cells expressing the humanized antibodies of the invention are also provided.
Typically cell transformation employs a vector. The term âvector,â refers to, e.g., a plasmid, virus, such as a viral vector, or other vehicle known in the art that can be manipulated by insertion or incorporation of a nucleic acid, for genetic manipulation (i.e., âcloning vectorsâ), or can be used to transcribe or translate the inserted polynucleotide (i.e., âexpression vectorsâ). Such vectors are useful for introducing nucleic acids, including a nucleic acid that encodes a humanized antibody operably linked with an expression control element, and expressing the encoded protein in vitro (e.g., in solution or in solid phase), in cells or in vivo.
A vector generally contains at least an origin of replication for propagation in a cell. Control elements, including expression control elements as set forth herein, present within a vector, are included to facilitate transcription and translation. The term âexpression control elementâ is intended to include, at a minimum, one or more components whose presence can influence expression, and can include components other than or in addition to promoters or enhancers, for example, leader sequences and fusion partner sequences, internal ribosome binding sites (IRES) elements for the creation of multigene, or polycistronic, messages, splicing signal for introits, maintenance of the correct reading frame of the gene to permit in-frame translation of mRNA, polyadenylation signal to provide proper polyadenylation of the transcript of a gene of interest, stop codons, etc.
Vectors can include a selection marker. As is known in the art, âselection markerâ means a gene that allows for the selection of cells containing the gene. âPositive selectionâ refers to a process whereby only cells that contain the selection marker will survive upon exposure to the positive selection. Drug resistance is one example of a positive selection marker; cells containing the marker will survive in culture medium containing the selection drug, and cells which do not contain the marker will die. Such markers include drug resistance genes such as neo, which confers resistance to G418, hygr, which confers resistance to hygromycin, or puro which confers resistance to puromycin, among others. Other positive selection marker genes include genes that allow identification or screening of cells containing the marker. These genes include genes for fluorescent proteins (GFP), the lacZ gene, the alkaline phosphatase gene, and surface markers such as CD8, among others.
Vectors can contain negative selection markers. âNegative selectionâ refers to a process whereby cells containing a negative selection marker are killed upon exposure to an appropriate negative selection agent. For example, cells which contain the herpes simplex virus-thymidine kinase (HSV-tk) gene (Wigler et al., Cell 11:223 (1977)) are sensitive to the drug gancyclovir (GANC). Similarly, the gpt gene renders cells sensitive to 6-thioxanthine.
Additional selection systems may be used, including, but not limited to the hypoxanthine-guanine phosphoribosyltransferase gene (Szybalska et al., Proc Natl. Acad. Sci. USA 48:2026 (1962)), and the adenine phosphoribosyltransferase (Lowy et al, Cell 22:817 (1980)) genes. Additional selectable genes have been described, namely trpB, which allows cells to utilize indole in place of tryptophan; hisD, which allows cells to utilize histinol in place of histidine (Hartman et al., Proc. Natl. Acad. Set. USA 85:8047 (1988)); and ODC (ornithine decarboxylase), which confers resistance to the ornithine decarboxylase inhibitor, 2-(difluoromethyl)-DL-ornithine, DFMO (McConlogue (1987) In: Current Communications in Molecular Biology, Cold Spring Harbor Laboratory, ed.).
Vectors included are those based on viral vectors, such as retroviral, adeno-associated virus, adenovirus, reovirus, lentivirus, rotavirus genomes, simian virus 40 (SV40) or bovine papilloma virus, etc., modified for introducing and expressing a nucleic acid in a cell (Cone et al., Proc. Natl. Acad. Sci. USA 81:6349 (1984)). (Eukaryotic Viral Vectors, Cold Spring Harbor Laboratory, Gluzman ed., 1982; Sarver et al., Mol. Biol. 1:486 (1981)). Additional viral vectors useful for expression include parvovirus, rotavirus, Norwalk virus, cornaviruses, paramyxo and rhabdoviruses, togavirus (e.g., sindbis virus and semliki forest virus) and vesicular stomatitis virus.
Mammalian expression systems further include vectors specifically designed for in vivo and ex vivo expression. Such systems include adeno-associated virus (AAV) vectors (U.S. Pat. No. 5,604,090). AAV vectors have previously been shown to provide expression of Factor IX in humans and in mice at levels sufficient for therapeutic benefit (Kay et al., Nat. Genet. 24:257 (2000); Nakai et al., Blood 91:4600 (1998)). Adenoviral vectors (U.S. Pat. Nos. 5,700,470, 5,731,172 and 5,928,944), herpes simplex virus vectors (U.S. Pat. No. 5,501,979) and retroviral (e.g., lentivirus vectors are useful for infecting dividing as well as non-dividing cells and foamy viruses) vectors (U.S. Pat. Nos. 5,624,820, 5,693,508, 5,665,577, 6,013,516 and 5,674,703 and WIPO publications WO92/05266 and WO92/14829) and papilloma virus vectors (e.g., human and bovine papilloma virus) have all been employed in gene therapy (U.S. Pat. No. 5,719,054). Vectors also include cytomegalovirus (CMV) based vectors (U.S. Pat. No. 5,561,063). Vectors that efficiently deliver genes to cells of the intestinal tract have been developed and also may be used (see, e.g., U.S. Pat. Nos. 5,821,235, 5,786,340 and 6,110,456).
In yeast, vectors that facilitate integration of foreign nucleic acid sequences into a chromosome, via homologous recombination, for example, are known in the art and can be used. Yeast artificial chromosomes (YAC) are typically used when the inserted nucleic acids are too large for more conventional vectors (e.g., greater than about 12 kb).
Introduction of nucleic acid encoding humanized antibody and humanized antibody into target cells can also be carried out by conventional methods known in the art such as osmotic shock (e.g., calcium phosphate), electroporation, microinjection, cell fusion, etc. Introduction of nucleic acid and polypeptide in vitro, ex vivo and in vivo can also be accomplished using other techniques. For example, a polymeric substance, such as polyesters, polyamine acids, hydrogel, polyvinyl pyrrolidone, ethylenevinylacetate, methylcellulose, carboxymethylcellulose, protamine sulfate, or lactide/glycolide copolymers, polylactide/glycolide copolythers, or ethylenevinylacetate copolymers. A nucleic acid can be entrapped in microcapsules prepared by coacervation techniques or by interfacial polymerization, for example, by the use of hydroxymethylcellulose or gelatin-microcapsules, or poly(methylmethacrolate) microcapsules, respectively, or in a colloid drug delivery system. Colloidal dispersion systems include macromolecule complexes, nano-capsules, microspheres, beads, and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
The use of liposomes for introducing various compositions into cells, including nucleic acids, is known to those skilled in the art (see, e.g., U.S. Pat. Nos. 4,844,904, 5,000,959, 4,863,740, and 4,975,282). A carrier comprising a natural polymer, or a derivative or a hydrolysate of a natural polymer, described in WO 94/20078 and U.S. Pat. No. 6,096,291, is suitable for mucosal delivery of molecules, such as polypeptides and polynucleotides. Piperazine based amphilic cationic lipids useful for gene therapy also are known (see, e.g., U.S. Pat. No. 5,861,397). Cationic lipid systems also are known (see, e.g., U.S. Pat. No. 5,459,127). Accordingly, viral and non-viral vector means of delivery into cells or tissue, in vitro, in vivo and ex vivo are included.
The invention further provides kits comprising one or more compositions of the invention, including pharmaceutical formulations, packaged into suitable packaging material. In one embodiment, a kit includes a humanized antibody or subsequence. In another embodiment, a kit includes a nucleic acid encoding humanized antibody or subsequence. In additional embodiments, a kit includes nucleic acids that further include an expression control element; an expression vector; a viral expression vector; an adeno-associated virus expression vector, an adenoviral expression vector, and a retroviral expression vector. In yet an additional embodiment, a kit includes a cell that expresses a humanized antibody or subsequence.
In additional embodiments, a kit includes a label or packaging insert including instructions for expressing a humanized antibody or a nucleic acid encoding a humanized antibody in cells in vitro, in vivo, or ex vivo. In yet additional embodiments, a kit includes a label or packaging insert including instructions for treating a subject (e.g., a subject having or at risk of having asthma) with a humanized antibody or a nucleic acid encoding a humanized antibody in vivo, or ex vivo.
As used herein, the term âpackaging materialâ refers to a physical structure housing the components of the kit. The packaging material can maintain the components sterilely, and can be made of material commonly used for such purposes (e.g., paper, corrugated fiber, glass, plastic, foil, ampules, etc.). The label or packaging insert can include appropriate written instructions, for example, practicing a method of the invention, e.g., treating the common cold. Kits of the invention therefore can additionally include instructions for using the kit components in a method of the invention.
Instructions can include instructions for practicing any of the methods of the invention described herein. Thus, invention pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration to a subject. Instructions may additionally include indications of a satisfactory clinical endpoint or any adverse symptoms that may occur, or additional information required by the Food and Drug Administration for use on a human subject.
The instructions may be on âprinted matter,â e.g., on paper or cardboard within the kit, on a label affixed to the kit or packaging material, or attached to a vial or tube containing a component of the kit. Instructions may comprise voice or video tape and additionally be included on a computer readable medium, such as a disk (floppy diskette or hard disk), optical CD such as CD- or DVD-ROM/RAM, magnetic tape, electrical storage media such as RAM and ROM and hybrids of these such as magnetic/optical storage media.
Invention kits can additionally include a buffering agent, a preservative, or a protein/nucleic acid stabilizing agent. The kit can also include control components for assaying for activity, e.g., a control sample or a standard. Each component of the kit can be enclosed within an individual container or in a mixture and all of the various containers can be within single or multiple packages. For example, an invention composition can be packaged into a hand pump container or pressurized (e.g., aerosol) container for spraying the composition into the throat or nasal or sinus passages of a subject.
The humanized antibodies of the invention, including subsequences, modified forms, multimers and nucleic acids encoding them, can be incorporated into pharmaceutical compositions. Such pharmaceutical compositions are useful for administration to a subject in vivo or ex vivo, and for providing therapy for a physiological disorder or condition treatable with a humanized antibody.
Pharmaceutical compositions include âpharmaceutically acceptableâ and âphysiologically acceptableâ carriers, diluents or excipients. As used herein the terms âpharmaceutically acceptableâ and âphysiologically acceptableâ include solvents (aqueous or non-aqueous), solutions, emulsions, dispersion media, coatings, isotonic and absorption promoting or delaying agents, compatible with pharmaceutical administration. Such formulations can be contained in a liquid; emulsion, suspension, syrup or elixir, or solid form; tablet (coated or uncoated), capsule (hard or soft), powder, granule, crystal, of microbead. Supplementary active compounds (e.g., preservatives, antibacterial, antiviral and antifungal agents) can also be incorporated into the compositions.
Pharmaceutical compositions can be formulated to be compatible with a particular local or systemic route of administration. Thus, pharmaceutical compositions include carriers, diluents, or excipients suitable for administration by particular routes.
Specific non-limiting examples of routes of administration for compositions of the invention are inhalation or intranasal delivery. Additional routes include parenteral, e.g., intravenous, intradermal, subcutaneous, oral, transdermal (topical), transmucosal, and rectal administration.
Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
Pharmaceutical compositions for injection include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor ELâ˘. (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. Fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Antibacterial and antifungal agents include, for example, parabens, chlorobutanol, phenol, ascorbic acid and thimerosal. Isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride can be included in the composition. Including an agent which delays absorption, for example, aluminum monostearate and gelatin can prolong absorption of injectable compositions.
Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of above ingredients followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and other ingredients as above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation include, for example, vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays, inhalation devices (e.g., aspirators) or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
Invention humanized antibodies, including subsequences and modified forms and nucleic acids encoding them, can be prepared with carriers that protect against rapid elimination from the body, such as a controlled release formulation or a time delay material such as glyceryl monostearate or glyceryl stearate. The compositions can also be delivered using implants and microencapsulated delivery systems to achieve local or systemic sustained delivery or controlled release.
Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to cells or tissues using antibodies or viral coat proteins) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
Additional pharmaceutical formulations appropriate for the compositions for administration in the methods of the invention are known in the art (see, e.g., Remington's Pharmaceutical Sciences (1990) 18th ed., Mack Publishing Co., Easton, Pa.; The Merck Index (1996) 12th ed., Merck Publishing Group, Whitehouse, N.J.; and Pharmaceutical Principles of Solid Dosage Forms, Technonic Publishing Co., Inc., Lancaster, Pa., (1993)).
The pharmaceutical formulations can be packaged in dosage unit form for ease of administration and uniformity of dosage. âDosage unit formâ as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the pharmaceutical carrier or excipient.
Humanized antibodies of the invention include antibodies that protect against virus infection of cells. For example, HumA, HumB, HumC, HumD, HumF, HumH and HumI protect against HRV infection of cells (FIG. 4). Thus, in another embodiment, the invention provides antibodies that protect against human rhinovirus (HRV) infection of cells. In one embodiment, an antibody has a protective efficacy at least 2 to 5 times greater than the non-humanized antibody. In another embodiment, an antibody has a protective efficacy at least 5 to 10 times greater than the non-humanized antibody. In yet another embodiment, an antibody has a protective efficacy at least 10 to 20 times greater than the non-humanized antibody. In still another embodiment, an antibody has a protective efficacy at least 20 to 30 times greater than the non-humanized antibody.
As used herein, âhuman rhinovirusâ or âHRVâ means major and minor group human serotypes of rhinoviruses that have been identified (see, e.g., Hamparian et al., (1987) Virology 159:191) and those that are identified later as falling within this class of virus. Major group HRV binds to ICAM-1 and minor group HRV binds low density lipoprotein (LDL) receptor.
As used herein, the term âprotective efficacyâ is the amount of an antibody which can protect 50% of susceptible cells from infection (i.e. EC50). For example, for HRV, protective efficacy in EC.sub.50) is the amount of antibody that protects 50% of hela cells from HRV infection. Thus, a humanized antibody having a protective efficacy 5 times greater than another antibody (e.g., non-humanized) can be used in an amount 5 fold less than non-humanized antibody while still providing the same degree of protection from infection.
Humanized antibodies of the invention include antibodies that bind to ICAM-1. Although not wishing to be bound by theory, it is believed that antibody binding to ICAM-1 inhibits viral binding or the ability to infect or penetrate the cell thereby inhibiting viral infection or proliferation. Such antibodies are therefore useful for inhibiting pathogens such as viruses (e.g., HRV and coxackie A virus, respiratory syncytial virus (RSV)), bacteria, fungi and protozoa (e.g., malaria) that bind to ICAM-1. Thus, the antibodies are useful for inhibiting HRV infection as well as for inhibiting any microorganism or other pathogens in which ICAM-1 receptor participates. Accordingly, the invention provides antibodies that inhibit pathogen infection of cells where infection is mediated, at least in part, by binding to ICAM-1, and methods for inhibiting pathogen infection of cells where infection is mediated, at least in part, by binding to ICAM-1.
In one embodiment, a method includes contacting a virus or cell with an amount of humanized antibody that binds to ICAM-1 sufficient to inhibit viral infection of the cell. In one aspect, the cell is an epithelial cell. In another embodiment, a method includes administering to a subject an amount of humanized antibody that binds to ICAM-1 sufficient to inhibit viral infection of the subject. In various aspects, the virus is HRV, coxackie A virus and respiratory syncytial virus. In yet another embodiment, a method includes administering to a subject an amount of humanized antibody that binds to ICAM-1 sufficient to inhibit infection of the subject by a pathogen.
The invention also provides methods for inhibiting infection, inhibiting progression or treating a pathogenic infection of a subject. In one embodiment, a method includes administering to a subject having or at risk of having an HRV infection an amount of humanized antibody sufficient to inhibit, inhibit progression or to treat HRV infection of the subject. In another embodiment, a method includes administering to a subject having or at risk of having an coxackie A virus or respiratory syncytial virus infection an amount of humanized antibody sufficient to inhibit infection, inhibit progression or to treat coxackie A virus or respiratory syncytial virus infection of the subject. In still another embodiment, a method includes administering to a subject having or at risk of having malaria an amount of humanized antibody sufficient to inhibit, inhibit progression or to treat malaria of the subject. In various aspects, a humanized antibody is selected from SEQ ID NO:1 and 3 (HumA); SEQ ID NO:5 and 7 (HumB); SEQ ID NO:9 and 11 (HumC); SEQ ID NO:13 and 15 (HumD); SEQ ID NO:17 and 19 (HumE); SEQ ID NO:21 and 23 (HumF); SEQ ID NO:25 and 27 (HumG); SEQ ID NO:29 and 31 (HumH); and SEQ ID NO:33 and 35 (HumI), and antigen binding subsequences thereof.
The invention further provides methods of decreasing or inhibiting one or more symptoms of a pathogen infection (e.g., caused by HRV, coxackie A virus, respiratory syncytial virus or malaria). In one embodiment, a method includes administering to a subject having one or more symptoms associated with HRV, coxackie A virus, respiratory syncytial virus or malaria an amount of a humanized antibody sufficient to decrease or inhibit one or more symptoms associated with HRV, coxackie A virus, respiratory syncytial virus or malaria in the subject. Symptoms decreased or inhibited include, for example, for HRV, one or more of fever, congestion, cough, nasal drip, sore throat, and the like associated with the common cold. In another embodiment, a method includes administering to a subject having otitis media an amount of a humanized antibody sufficient to decrease or inhibit one or more symptoms of otitis media in the subject. In yet another embodiment, a method includes administering to a subject having bronchitis an amount of a humanized antibody sufficient to decrease or inhibit one or more symptoms of bronchitis in the subject. In still another embodiment, a method includes administering to a subject having sinusitis an amount of a humanized antibody sufficient to decrease or inhibit one or more symptoms of sinusitis in the subject. In a further embodiment, a method includes administering to a subject having or at risk of having asthma an amount of a humanized antibody sufficient to decrease or inhibit asthma exacerbation. In one aspect, the humanized antibody is administered locally. In another aspect, the humanized antibody is administered via inhalation or intranasally.
In addition to inhibiting pathogens that function directly or indirectly through ICAM-1, invention humanized antibodies can be used to treat undesirable physiological conditions, such as disease or disorders in which ICAM-1 plays a role. For example, LFA-1 interaction with ICAM-1 participates in inflammation. Thus, an invention antibody may be used to inhibit this interaction thereby modulating (e.g., decrease) local or systemic inflammation. Furthermore, ICAM-1 plays a role in other immune response pathways, cancer and metastasis. Thus, an invention antibody may be used to reduce or prevent organ transplant rejection or autoimmune diseases or cancer or metastasis. Accordingly, the invention provides antibodies that modulate immune responsiveness (e.g., inflammation) and other cellular processes in which ICAM-1 participates and methods for modulating immune response pathways.
The methods of the invention may be practiced prior to infection (i.e. prophylaxis) or after infection, before or after acute or chronic symptoms of the infection or physiological condition or disorder develops (e.g., before organ transplantation). Administering a composition prior to or immediately following development of symptoms may lessen the severity of the symptoms in the subject. Administering a composition prior to development of symptoms in the subject may decrease contagiousness of the subject thereby decreasing the likelihood of other subjects becoming infected from the infected subject.
The term âsubjectâ refers to animals, typically mammalian animals, such as a non-human primate (gorillas, chimpanzees, orangutans, macaques, gibbons), a domestic animal (dogs and cats), a farm animal (horses, cows, goats, sheep, pigs), experimental animal (mouse, rat, rabbit, guinea pig) and humans. Human subjects include adults, and children, for example, newborns and older children, for example, between the ages of 1 and 5, 5 and 10 and 10 and 18. Human subjects may include those having or at risk of having a viral infection, such as HRV, and which develops one or more symptoms of the infection, for example, those typically associated with the common cold. Human subjects include those having or at risk of having asthma, including asthmatics suffering from chronic asthma prior to or following suffering an acute asthma attack. Subjects include disease model animals (e.g., such as mice and non-human primates) for testing in viva efficacy of humanized antibodies of the invention (e.g., an HRV animal model, an asthma animal model, an organ transplant model, an autoimmune disorder model, cancer model, etc.).
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described herein.
All publications, patents and other references cited herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
As used herein, the singular forms âaâ, âand,â and âtheâ include plural referents unless the context clearly indicates otherwise. Thus, for example, reference to âa transformed cellâ includes a plurality of such cells and reference to âa humanized antibodyâ can include reference to one or more such cells or antibodies, and so forth.
A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, the following examples are intended to illustrate but not limit the scope of invention described in the claims.
This example describes the strategy for humanizing 1A6.
Mouse monoclonal antibody 1A6 (mAb1A6) was developed by Colonno et al., and has been shown to bind specifically to ICAM-1 and protect cells against infection by human rhinovirus (HRV) major group (Colonno R J, et al. (1991) European Patent Application #91201243.2; Publication number: 0 459 577 A2, which also describes the sequence of mouse mAb1A6). The parental mouse monoclonal antibody 1A6 was synthesized in the form of scFv. The purified protein, Msc1A6, has an affinity of 1.18Ă10â6M in KD against ICAM-1 (Table 4).
To humanize mAb1A6, selected human VH subgroup III and VL-kappa subgroup I consensus sequences were selected as the acceptor VH and VL frameworks, respectively (Padlan (1994) Molecular Immunol. 31:169-217; Padlan (1991) Molecular Immunol. 28:489-498): These human sequences have previously been used to humanize two antibodies (Carter et al. (1992) Proc. Natl. Acad. Sci. USA 89:4285-4289; Presta et al. (1993) J. Immunol. 151:2623-2632).
Among a total of 82 amino acid residues in the heavy chain framework, the human VH III consensus sequence and mAb1A6 antibody share 56 identical amino acid residues, which amounts to 68.3% identity. Among 81 light chain framework residues, the human Îş I consensus sequence and mAb1A6 antibody have 52 amino acid residues in common, which equals to 64.2% identity. (FIG. 1).
Among a total of 55 framework amino acid residues that are different between mAb1A6 and human consensus sequences, 49 of them are either located on the surface of the antibody molecule, or are residues with similar characteristics, therefore human consensus residues can be used to replace mouse residues. The remaining six positions, VH 37, 69, 71, 73, 94 and VL 49, belong to the âVernierâ zone as described by Toote and Winter (1992, J. Mol. Biol. 224:487-499). Because âVernierâ zone residues form a layer underlying the CDRs and may impact on the structure of CDRs and the affinity of the antibody, residues at these positions were chosen based on molecular model building of the antibody (FIG. 2).
VL 49:
Inspection reveals that this position is both at the center of the antibody combining site and at the light chain/heavy chain interface. Substituting an ideal residue at this position can improve antigen binding by both providing additional direct binding contact and by improving the character of the interface. Tyrosine, found in human antibodies at this position, does both. Model building suggests that Y49 can form both Van der Waals and H bond contact with ICAM. Y49 also can interact with heavy chain W102, completing a network of interacting aromatic residues that provide both binding interaction and flexibility at the light chain/heavy chain interface. Therefore, human consensus residue tyrosine at this position is superior to the parental mouse residue lysine.
VH 37:
This residue is at the interface between the light and heavy chains. Comparing to the parental mouse residue methionine, the human consensus residue valine intrudes less on the interface, potentially providing additional flexibility. Flexibility at the interface can enhance binding affinity by increasing conformational adaptability of the antibody. (FIG. 2C)
VH 69:
This residue is packed in the interior of the variable domain. The murine residue, methionine, makes a potentially destabilizing contact with the backbone of a neighboring beta strand. In contrast, the human residue isoleucine packs well in the interior of the protein.
VH 73:
Molecular modeling indicates that the human consensus residue, aspartic acid (D73) can interact with K30 of heavy chain CDR1. Since model building suggests that K30 is not involved directly in antigen binding, this stabilizing change is predicted to be either neutral or beneficial.
VH 71 and VH94:
Structural inspection indicated that both of these positions require a residue with a small side chain for maintenance of proper antibody conformation. Therefore, the human consensus residue at this position, arginine, is not appropriate. Serine and glycine were selected for position 71.
According to Chothia et al., residues at VH94 is related with the canonical structure of H1 or CDR1 (defined as VH26-VH32). The CDR1 of 1A6 belongs to the canonical structure 1 and family 1 (Chothia and Lesk (1987) J. Mol. Biol. 186:651-663; Chothia et al. (1992) J. Mol. Biol. 227:799-817; Chothia et al. (1989) Nature 342:877-883). Corresponding to this canonical structure, human sequences showed three possible residues at VH94 position: arginine, threonine or alanine (Chothia et al. (1992) J. Mol. Biol. 227:799-817). Since arginine is not appropriate for this particular antibody, alanine, threonine and another small residue, aspartic acid were chosen.
Finally, molecular model building indicates that a portion of the CDR2 in the VH domain, VH60-64, does not have direct contact with the antigen. Therefore mouse residues at these positions (DPKVQ) can be replaced by human residues ADSVK.
This example describes the preparation of several humanized scFv expression constructs.
The humanized scFv A (HumA) cDNA (FIG. 4) containing 750 bb was synthesized using a series of overlapping oligonucleotides. These overlapping oligonucleotides (Table 1) were designed to encode the amino acids of the variable region of the heavy (VH) and light (VL) chains linked by a linker ((G4S)4) with a Bam H1 site. The heavy chain and light chain were cloned separately in TOPO 2.1 vector. After DNA sequencing conformation, the heavy and light chain were subcloned into expression vector (pBAD/pIII A) to form full length DNA.
The oligonucleotides were first annealed in six groups consisting of oligo AVH1/AVH2, oligo AVH3/AVH4, oligo AVH5/AVH6 for heavy chain, and oligo AVL1/AVL2, oligo AVL3/AVL4, oligo AVL5/AVL6 for the light chain. Each annealed group was extended with the Klenow fragment of DNA polymerase. The annealed and extended products of group 1-3 were pooled with oligo AVH7 as overlapping templates that were amplified via polymerase chain reaction (PCR) using the high-fidelity thermostable DNA polymerase (Roche) with oligo AVH8 and AVH9 as primers. The annealed and extended products of group 4-6 were pooled with oligo AVL7 as overlapping templates that were also amplified via polymerase chain reaction (PCR) using oligo AVL8 and AVL9 as primers. The PCR products were directly inserted into the TA cloning vector pCR2.1-TOPO (Invitrogen) and transferred into TOP10 competent cells. The plasmids with inserts were isolated and sequenced.
The light chain and the heavy chain DNA fragments were isolated from their cloning vector by digestion with Nco I/Bam H I and Barn H I/Hpa I respectively, and cloned into expression vector pBAD/pIII A cutting with Nco I/Sal I (blunted) to be in frame with the carboxy-terminal His tag. Both strands of the expression construct pBAD-HumA was sequenced (MWG Biotech, Inc.).
All other human scFv expression constructs (HumB to H) were made with the same procedure as HumA described above except using different oligonucleotides (Table 1).
For HumB, using BVH6 and BVH7 to replace AVH6 and AVH7; for HumC, using CVH5, CVH6 and CVH7 to replace AVH5, AVH6 and AVH7; for HumD, using DVH6 and DVH7 to replace AVH6 and AVH7; for HumE, using EVH4, EVH5, EVH6 and EVH7 to replace AVH4, AVH5, AVH6 and AVH7; for HumF, using FVH6 and FVH7 to replace AVH6 and AVH7; for HumG, using GVL3, GVL4, GVH5, GVH6 and GVH7 to replace AVL3, AVL4, AVH5, AVH6 and AVH7; for HumH, using HVL3, HVL4, HVH4, HVH5, HVH6 and HVH7 to replace AVL3, AVL4, AVH4, AVH5, AVH6 and AVH7; for HumI, using IVL3, IVL4, IVH5, IVH6 and IVH7 to replace AVL3, AVL4, AVH4, AVH5, AVH6 and AVH7.
| TABLEâ1 |
| OligonucleotidesâforâhumanizedâscFvs |
| Oligonucleotidesâforâtheâlightâ(VH)âchainâofâHumA: |
| AVL-1: |
| CGAACCATGGGCGATATCCAGATGACCCAATCTCCGTCTAGCCTGAGCGC |
| CAGTGTTGGTGâ(SEQâIDâNO:â48) |
| AVL-2: |
| GTGAAGATTATTACTGATAGATTGGCTGGCGCGGCAAGTAATGGTAACTC |
| GATCACCAACACTGGCGCTCAGâ(SEQâIDâNO:â49) |
| AVL-3: |
| CTATCAGTAATAATCTTCACTGGTATCAACAAAAACCGGGTAAAGCTCCG |
| AAACTTCTTATCTATCACGCCâ(SEQâIDâNO:â50) |
| AVL-4: |
| CCCGAGCCAGAGCCAGAGAAGCGGCTCGGAACGCCGCTAATGCTCTGAGA |
| GGCGTGATAGATAAGAAGâ(SEQâIDâNO:â51) |
| AVL-5: |
| CTCTGGCTCTGGCTCGGGCACGGACTTTACCCTTACCATCAGCTCTCTTC |
| AGCCGGAAGACTTTGCCACCâ(SEQâIDâNO:â52) |
| AVL-6: |
| CCTTGACCGAAGGTATACGGCCAGCTATTAGACTGCTGACAATAATAGGT |
| GGCAAAGTCTTCCGGCâ(SEQâIDâNO:â53) |
| AVL-7: |
| GTATACCTTCGGTCAAGGTACCAAGGTCGAGATTAAGCGCGGCGGTGGCG |
| GTTCTGGTGGCGGTGGTAGCGâ(SEQâIDâNO:â54) |
| AVL-8:âCGAACCATGGGCGATATCCAGATGACCCAATCâ |
| (SEQâIDâNO:â55) |
| AVL-9:âCGGATCCACCGCCACCGCTACCACCGCCACCAGâ |
| (SEQâIDâNO:â56) |
| Oligonucleotidesâforâtheâheavyâ(VH)âchainâofâHumA: |
| AVH-1: |
| GGTGGCGGTGGATCCGGTGGCGGTGGCAGCGAAGTTCAACTTGTTGAGTC |
| TGGTGGCGGTCTGGTTCAGCCGGâ(SEQâIDâNO:â57) |
| AVH-2: |
| GTCCTTAATGTTGAAACCGCTTGCTGCGCAAGACAGGCGCAGAGAGCCAC |
| CCGGCTGAACCAGACCGCCACâ(SEQâIDâNO:â58) |
| AVH-3: |
| GGTTTCAACATTAAGGACACCTACATCCATTGGGTGAGGCAAGCTCCGGG |
| TAAGGGTCTGGAGTGGGâ(SEQâIDâNO:â59) |
| AVH-4: |
| GGCCCTTCACGCTGTCAGCGTAAATGGTGTTGTCGTTTGCCGGGTCGATA |
| CGTGCCACCCACTCCAGACCCTTACCâ(SEQâIDâNO:â60) |
| AVH-5: |
| CGCTGACAGCGTGAAGGGCCGTTTTACTATTTCTAGCGACGACTCTAAGA |
| ACACCGCGTACCTTCAGATGAACTCTCTGCGâ(SEQâIDâNO:â61) |
| AVH-6: |
| CCAGTAGCCAGAGTCCGTGCAGTAGTAGACGGCGGTGTCCTCGGCACGCA |
| GAGAGTTCATCTGAAGGâ(SEQâIDâNO:â62) |
| AVH-7: |
| GGACTCTGGCTACTGGTTTGCCTACTGGGGCCAGGGCACGCTTGTCACCG |
| TCTCTTCTGGTTAACâ(SEQâIDâNO:â63) |
| AVH-8:âGGTGGCGGTGGATCCGGTâ(SEQâIDâNO:â64) |
| AVH-9:âGGGTTAACCAGAAGAGACGGâ(SEQâIDâNO:â65) |
| Oligonucleotidesâforâmakingâother |
| humanâscFvâ(HumâB-I): |
| BVH-6: |
| CCAGTAGCCAGAGGCCGTGCAGTAGTAGACGGCGGTGTCCTCGGCACGCA |
| GAGAGTTCATCTGAAGGâ(SEQâIDâNO:â66) |
| BVH-7: |
| GGCCTCTGGCTACTGGTTTGCCTACTGGGGCCAGGGCACGCTTGTCACCG |
| TCTCTTCTGGTTAACâ(SEQâIDâNO:â67) |
| CVH-5: |
| CGCTGACAGCGTGAAGGGCCGTTTTACTATTTCTGGCGACGACTCTAAGA |
| ACACCGCGTACCTTCAGATGAACTCTCTGCGâ(SEQâIDâNO:â68) |
| CVH-6: |
| CCAGTAGCCAGAGGTCGTGCAGTAGTAGACGGCGGTGTCCTCGGCACGCA |
| GAGAGTTCATCTGAAGGâ(SEQâIDâNO:â69) |
| CVH-7: |
| GACCTCTGGCTACTGGTTTGCCTACTGGGGCCAGGGCACGCTTGTCACCG |
| TCTCTTCTGGTTAACâ(SEQâIDâNO:â70) |
| DVH-6: |
| CCAGTAGCCAGAGGTCGTGCAGTAGTAGACGGCGGTGTCCTCGGCACGCA |
| GAGAGTTCATCTGAAGGâ(SEQâIDâNO:â71) |
| DVH-7: |
| GACCTCTGGCTACTGGTTTGCCTACTGGGGCCAGGGCACGCTTGTCACCG |
| TCTCTTCTGGTTAACâ(SEQâIDâNO:â72) |
| EVH-4: |
| GGCCCTGCACCTTCGGATCGTAAATGGTGTTGTCGTTTGCCGGGTCGATA |
| CGTGCCACCCACTCCAGACCCTTACCâ(SEQâIDâNO:â73) |
| EVH-5: |
| CGATCCGAAGGTGCAGGGCCGTTTTACTATTTCTGCGGACGACTCTAAGA |
| ACACCGCGTACCTTCAGATGAACTCTCTGCGâ(SEQâIDâNO:â74) |
| EVH-6: |
| CCAGTAGCCAGAGGTCGTGCAGTAGTAGACGGCGGTGTCCTCGGCACGCA |
| GAGAGTTCATCTGAAGGâ(SEQâIDâNO:â75) |
| EVH-7: |
| GACCTCTGGCTACTGGTTTGCCTACTGGGGCCAGGGCACGCTTGTCACCG |
| TCTCTTCTGGTTAACâ(SEQâIDâNO:â76) |
| FVH-6: |
| CCAGTAGCCAGAGGTCGTGCAGTAGTAGACGGCGGTGTCCTCGGCACGCA |
| GAGAGTTCATCTGAAGGâ(SEQâIDâNO:â77) |
| FVH-7: |
| GACCTCTGGCTACTGGTTTGCCTACTGGGGCCAGGGCACGCTTGTCACCG |
| TCTCTTCTGGTTAACâ(SEQâIDâNO:â78) |
| GVL-3: |
| CTATCAGTAATAATCTTCACTGGTATCAACAAAAACCGGGTAAAGCTCCG |
| AAACTTCTTATCAAACACGCCâ(SEQâIDâNO:â79) |
| GVL-4: |
| CCCGAGCCAGAGCCAGAGAAGCGGCTCGGAACGCCGCTAATGCTCTGAGA |
| GGCGTGAAAGATAAGAAGâ(SEQâIDâNO:â80) |
| GVH-5: |
| CGCTGACAGCGTGAAGGGCCGTTTTACTATTTCTGCGGACGACTCTAAGA |
| ACACCGCGTACCTTCAGATGAACTCTCTGCGâ(SEQâIDâNO:â81) |
| GVH-6: |
| CCAGTAGCCAGAGGTCGTGCAGTAGTAGACGGCGGTGTCCTCGGCACGCA |
| GAGAGTTCATCTGAAGGâ(SEQâIDâNO:â82) |
| GVH-7: |
| GACCTCTGGCTACTGGTTTGCCTACTGGGGCCAGGGCACGCTTGTCACCG |
| TCTCTTCTGGTTAACâ(SEQâIDâNO:â83) |
| HVL-3: |
| CTATCAGTAATAATCTTCACTGGTATCAACAAAAACCGGGTAAAGCTCCG |
| AAACTTCTTATCAAACACGCCâ(SEQâIDâNO:â84) |
| HVL-4: |
| CCCGAGCCAGAGCCAGAGAAGCGGCTCGGAACGCCGCTAATGCTCTGAGA |
| GGCGTGAAAGATAAGAAGâ(SEQâIDâNO:â85) |
| HVH-4: |
| GGCCCTGCACCTTCGGATCGTAAATGGTGTTGTCGTTTGCCGGGTCGATA |
| CGTGCCACCCACTCCAGACCCTTACCâ(SEQâIDâNO:â86) |
| HVH-5: |
| CGATCCGAAGGTGCAGGGCCGTTTTACTATTTCTGCGGACGACTCTAAGA |
| ACACCGCGTACCTTCAGATGAACTCTCTGCGâ(SEQâIDâNO:â87) |
| HVH-6: |
| CCAGTAGCCAGAGGTCGTGCAGTAGTAGACGGCGGTGTCCTCGGCACGCA |
| GAGAGTTCATCTGAAGGâ(SEQâIDâNO:â88) |
| HVH-7: |
| GACCTCTGGCTACTGGTTTGCCTACTGGGGCCAGGGCACGCTTGTCACCG |
| TCTCTTCTGGTTAACâ(SEQâIDâNO:â89) |
| IVL-3: |
| CTATCAGTAATAATCTTCACTGGTATCAACAAAAACCGGGTAAAGCTCCG |
| AAACTTCTTATCAAACACGCCâ(SEQâIDâNO:â90) |
| IVL-4: |
| CCCGAGCCAGAGCCAGAGAAGCGGCTCGGAACGCCGCTAATGCTCTGAGA |
| GGCGTGAAAGATAAGAAGâ(SEQâIDâNO:â91) |
| IVH-4: |
| GGCCCTGCACCTTCGGATCGTAAATGGTGTTGTCGTTTGCCGGGTCGATA |
| CGTGCCACCCACTCCAGACCCTTACCâ(SEQâIDâNO:â92) |
| IVH-5: |
| CGATCCGAAGGTGCAGGGCCGTTTTACTATGTCTGCGGACACCTCTAAGA |
| ACACCGCGTACCTTCAGATGAACTCTCTGCGâ(SEQâIDâNO:â93) |
| IVH-6: |
| CCAGTAGCCAGAGGTCGTGCAGTAGTAGACGGCGGTGTCCTCGGCACGCA |
| GAGAGTTCATCTGAAGGâ(SEQâIDâNO:â94) |
| IVH-7: |
| GACCTCTGGCTACTGGTTTGCCTACTGGGGCCAGGGCACGCTTGTCACCG |
| TCTCTTCTGGTTAACâ(SEQâIDâNO:â95) |
Molecular model building enabled synthesis of 9 versions of humanized antibodies in the form of scFv (HumA-HumI, summarized in Tables 2 and 3). Four of the humanized antibodies, HumA-HumD, do not have parental mouse framework residues, and five of them, HumE-HumI, contain various number of parental mouse residues in the framework. The sequence of HumB is compared against parental mouse 1A6 and human consensus framework in FIG. 3.
| TABLEâ2 |
| HumanizationâConstructs |
| Position | H60-64 | ||||||
| Human/ | L49 | H37 | ADSVK/ | H69 | H71 | H73 | H94 |
| Mouse | Y/K | V/M | DPKVQ | I/M | R/A | D/T | R/T |
| HumA | Y | V | ADSVK | I | S | D | D |
| HumB | Y | V | ADSVK | I | S | D | A |
| HumC | Y | V | ADSVK | I | G | D | T |
| HumD | Y | V | ADSVK | I | S | D | T |
| HumE | Y | V | DPKVQ | I | A | D | T |
| HumF | Y | V | ADSVK | I | A | D | T |
| HumG | K | V | ADSVK | I | A | D | T |
| HumH | K | V | DPKVQ | I | A | D | T |
| HumI | K | M | DPKVQ | M | A | T | T |
| TABLEâ3 |
| AminoâAcidâSequencesâofâHumanizedâAntibody |
| HumâA: |
| vHâDomain |
| GluâValâGlnâLeuâValâGluâSerâGlyâGlyâGlyâLeuâValâGlnâProâGlyâGlyâSerâLeuâArgâLeuâSer |
| CysâAlaâAlaâSerâ(GlyâPheâAsnâIleâLysâAspâThrâTyrâIleâHis)âTrpâValâArgâGlnâAlaâPro |
| GlyâLysâGlyâLeuâGluâTrpâValâAlaâ(ArgâIleâAspâProâAlaâAsnâAspâAsnâThrâIleâTyrâAla |
| AspâSerâValâLysâGly)âArgâPheâThrâIleâSerâSerâAspâAspâSerâLysâAsnâThrâAlaâTyrâLeuâGln |
| MetâAsnâSerâLeuâArgâAlaâGluâAspâThrâAlaâValâTyrâTyrâCysâThrâAspâ(SerâGlyâTyrâTrp |
| PheâAlaâTyr)âTrpâGlyâGlnâGlyâThrâLeuâValâThrâValâSerâSerâ(SEQâIDâNO:â1) |
| VLâDomain |
| AspâIleâGlnâMetâThrâGlnâSerâProâSerâSerâLeuâSerâAlaâSerâValâGlyâAspâArgâValâThrâIle |
| ThrâCysâ(ArgâAlaâSerâGlnâSerâIleâSerâAsnâAsnâLeuâHis)âTrpâTyrâGlnâGlnâLysâPro |
| GlyâLysâAlaâProâLysâLeuâLeuâIleâTyrâ(HisâAlaâSerâGlnâSerâIleâSer)âGlyâValâProâSer |
| ArgâPheâSerâGlyâSerâGlyâSerâGlyâThrâAspâPheâThrâLeuâThrâIleâSerâSerâLeuâGlnâPro |
| GluâAspâPheâAlaâThrâTyrâTyrâCysâ(GlnâGlnâSerâAsnâSerâTrpâProâTyrâThr)âPheâGlyâGln |
| GlyâThrâLysâValâGluâIleâLysâArgâ(SEQâIDâNO:â3) |
| HumâB: |
| VHâDomain |
| GluâValâGlnâLeuâValâGluâSerâGlyâGlyâGlyâLeuâValâGlnâProâGlyâGlyâSerâLeuâArgâLeu |
| SerâCysâAlaâAlaâSerâ(GlyâPheâAsnâIleâLysâAspâThrâTyrâIleâHis)âTrpâValâArgâGlnâAla |
| ProâGlyâLysâGlyâLeuâGluâTrpâValâAlaâ(ArgâIleâAspâProâAlaâAsnâAspâAsnâThrâIleâTyrâAla |
| AspâSerâValâLysâGly)âArgâPheâThrâIleâSerâSerâAspâAspâSerâLysâAsnâThrâAlaâTyrâLeu |
| GlnâMetâAsnâSerâLeuâArgâAlaâGluâAspâThrâAlaâValâTyrâTyrâCysâThrâAlaâ(SerâGlyâTyr |
| TrpâPheâAlaâTyr)âTrpâGlyâGlnâGlyâThrâLeuâValâThrâValâSerâSerâ(SEQâIDâNO:â5) |
| VLâDomain |
| AspâIleâGlnâMetâThrâGlnâSerâProâSerâSerâLeuâSerâAlaâSerâValâGlyâAspâArgâValâThr |
| IleâThrâCysâ(ArgâAlaâSerâGlnâSerâIleâSerâAsnâAsnâLeuâHis)âTrpâTyrâGlnâGlnâLysâPro |
| GlyâLysâAlaâProâLysâLeuâLeuâIleâTyrâ(HisâAlaâSerâGlnâSerâIleâSer)âGlyâValâProâSer |
| ArgâPheâSerâGlyâSerâGlyâSerâGlyâThrâAspâPheâThrâLeuâThrâIleâSerâSerâLeuâGlnâPro |
| GluâAspâPheâAlaâThrâTyrâTyrâCysâ(GlnâGlnâSerâAsnâSerâTrpâProâTyrâThr)âPheâGlyâGln |
| GlyâThrâLysâValâGluâIleâLysâArgâ(SEQâIDâNO:â7) |
| HumâC: |
| VHâDomain |
| GluâValâGlnâLeuâValâGluâSerâGlyâGlyâGlyâLeuâValâGlnâProâGlyâGlyâSerâLeuâArgâLeu |
| SerâCysâAlaâAlaâSerâ(GlyâPheâAsnâIleâLysâAspâThrâTyrâIleâHis)âTrpâValâArgâGlnâAla |
| ProâGlyâLysâGlyâLeuâGluâTrpâValâAlaâ(ArgâIleâAspâProâAlaâAsnâAspâAsnâThrâIleâTyrâAla |
| AspâSerâValâLysâGly)âArgâPheâThrâIleâSerâGlyâAspâAspâSerâLysâAsnâThrâAlaâTyrâLeu |
| GlnâMetâAsnâSerâLeuâArgâAlaâGluâAspâThrâAlaâValâTyrâTyrâCysâThrâThrâ(SerâGlyâTyr |
| TrpâPheâAlaâTyr)âTrpâGlyâGlnâGlyâThrâLeuâValâThrâValâSerâSerâ(SEQâIDâNO:â9) |
| VLâDomain |
| AspâIleâGlnâMetâThrâGlnâSerâProâSerâSerâLeuâSerâAlaâSerâValâGlyâAspâArgâValâThr |
| IleâThrâCysâ(ArgâAlaâSerâGlnâSerâIleâSerâAsnâAsnâLeuâHis)âTrpâTyrâGlnâGlnâLysâPro |
| GlyâLysâAlaâProâLysâLeuâLeuâIleâTyrâ(HisâAlaâSerâGlnâSerâIleâSer)âGlyâValâProâSer |
| ArgâPheâSerâGlyâSerâGlyâSerâGlyâThrâAspâPheâThrâLeuâThrâIleâSerâSerâLeuâGlnâPro |
| GluâAspâPheâAlaâThrâTyrâTyrâCysâ(GlnâGlnâSerâAsnâSerâTrpâProâTyrâThr)âPheâGlyâGln |
| GlyâThrâLysâValâGluâIleâLysâArgâ(SEQâIDâNO:â11) |
| HumâD: |
| VHâDomain |
| GluâValâGlnâLeuâValâGluâSerâGlyâGlyâGlyâLeuâValâGlnâProâGlyâGlyâSerâLeuâArgâLeu |
| SerâCysâAlaâAlaâSerâ(GlyâPheâAsnâIleâLysâAspâThrâTyrâIleâHis)âTrpâValâArgâGlnâAla |
| ProâGlyâLysâGlyâLeuâGluâTrpâValâAlaâ(ArgâIleâAspâProâAlaâAsnâAspâAsnâThrâIleâTyrâAla |
| AspâSerâValâLysâGly)âArgâPheâThrâIleâSerâSerâAspâAspâSerâLysâAsnâThrâAlaâTyrâLeu |
| GlnâMetâAsnâSerâLeuâArgâAlaâGluâAspâThrâAlaâValâTyrâTyrâCysâThrâThrâ(SerâGlyâTyr |
| TrpâPheâAlaâTyr)âTrpâGlyâGlnâGlyâThrâLeuâValâThrâValâSerâSerâ(SEQâIDâNO:â13) |
| VLâDomain |
| AspâIleâGlnâMetâThrâGlnâSerâProâSerâSerâLeuâSerâAlaâSerâValâGlyâAspâArgâValâThr |
| IleâThrâCysâ(ArgâAlaâSerâGlnâSerâIleâSerâAsnâAsnâLeuâHis)âTrpâTyrâGlnâGlnâLysâPro |
| GlyâLysâAlaâProâLysâLeuâLeuâIleâTyrâ(HisâAlaâSerâGlnâSerâIleâSer)âGlyâValâProâSer |
| ArgâPheâSerâGlyâSerâGlyâSerâGlyâThrâAspâPheâThrâLeuâThrâIleâSerâSerâLeuâGlnâPro |
| GluâAspâPheâAlaâThrâTyrâTyrâCysâ(GlnâGlnâSerâAsnâSerâTrpâProâTyrâThr)âPheâGlyâGln |
| GlyâThrâLysâValâGluâIleâLysâArgâ(SEQâIDâNO:â15) |
| HumâE: |
| VHâDomain |
| GluâValâGlnâLeuâValâGluâSerâGlyâGlyâGlyâLeuâValâGlnâProâGlyâGlyâSerâLeuâArgâLeu |
| SerâCysâAlaâAlaâSerâ(GlyâPheâAsnâIleâLysâAspâThrâTyrâIleâHis)âTrpâValâArgâGlnâAla |
| ProâGlyâLysâGlyâLeuâGluâTrpâValâAlaâ(ArgâIleâAspâProâAlaâAsnâAspâAsnâThrâIleâTyr |
| AspâProâLysâValâGlnâGly)âArgâPheâThrâIleâSerâAlaâAspâAspâSerâLysâAsnâThrâAlaâTyr |
| LeuâGlnâMetâAsnâSerâLeuâArgâAlaâGluâAspâThrâAlaâValâTyrâTyrâCysâThrâThrâ(SerâGly |
| TyrâTrpâPheâAlaâTyr)âTrpâGlyâGlnâGlyâThrâLeuâValâThrâValâSerâSerâ(SEQâIDâNO:â17) |
| VLâDomain |
| AspâIleâGlnâMetâThrâGlnâSerâProâSerâSerâLeuâSerâAlaâSerâValâGlyâAspâArgâValâThr |
| IleâThrâCysâ(ArgâAlaâSerâGlnâSerâIleâSerâAsnâAsnâLeuâHis)âTrpâTyrâGlnâGlnâLysâPro |
| GlyâLysâAlaâProâLysâLeuâLeuâIleâTyrâ(HisâAlaâSerâGlnâSerâIleâSer)âGlyâValâProâSer |
| ArgâPheâSerâGlyâSerâGlyâSerâGlyâThrâAspâPheâThrâLeuâThrâIleâSerâSerâLeuâGlnâPro |
| GluâAspâPheâAlaâThrâTyrâTyrâCysâ(GlnâGlnâSerâAsnâSerâTrpâProâTyrâThr)âPheâGlyâGln |
| GlyâThrâLysâValâGluâIleâLysâArgâ(SEQâIDâNO:â19) |
| HumâF: |
| VHâDomain |
| GluâValâGlnâLeuâValâGluâSerâGlyâGlyâGlyâLeuâValâGlnâProâGlyâGlyâSerâLeuâArgâLeu |
| SerâCysâAlaâAlaâSerâ(GlyâPheâAsnâIleâLysâAspâThrâTyrâIleâHis)âTrpâValâArgâGlnâAla |
| ProâGlyâLysâGlyâLeuâGluâTrpâValâAlaâ(ArgâIleâAspâProâAlaâAsnâAspâAsnâThrâIleâTyrâAla |
| AspâSerâValâLysâGly)âArgâPheâThrâIleâSerâAlaâAspâAspâSerâLysâAsnâThrâAlaâTyrâLeu |
| GlnâMetâAsnâSerâLeuâArgâAlaâGluâAspâThrâAlaâValâTyrâTyrâCysâThrâThrâ(SerâGlyâTyr |
| TrpâPheâAlaâTyr)âTrpâGlyâGlnâGlyâThrâLeuâValâThrâValâSerâSerâ(SEQâIDâNO:â21) |
| VLâDomain |
| AspâIleâGlnâMetâThrâGlnâSerâProâSerâSerâLeuâSerâAlaâSerâValâGlyâAspâArgâValâThr |
| IleâThrâCysâ(ArgâAlaâSerâGlnâSerâIleâSerâAsnâAsnâLeuâHis)âTrpâTyrâGlnâGlnâLysâPro |
| GlyâLysâAlaâProâLysâLeuâLeuâIleâTyrâ(HisâAlaâSerâGlnâSerâIleâSer)âGlyâValâProâSer |
| ArgâPheâSerâGlyâSerâGlyâSerâGlyâThrâAspâPheâThrâLeuâThrâIleâSerâSerâLeuâGlnâPro |
| GluâAspâPheâAlaâThrâTyrâTyrâCysâ(GlnâGlnâSerâAsnâSerâTrpâProâTyrâThr)âPheâGlyâGln |
| GlyâThrâLysâValâGluâIleâLysâArgâ(SEQâIDâNO:â23) |
| HumâG: |
| VHâDomain |
| GluâValâGlnâLeuâValâGluâSerâGlyâGlyâGlyâLeuâValâGlnâProâGlyâGlyâSerâLeuâArgâLeu |
| SerâCysâAlaâAlaâSerâ(GlyâPheâAsnâIleâLysâAspâThrâTyrâIleâHis)âTrpâValâArgâGlnâAla |
| ProâGlyâLysâGlyâLeuâGluâTrpâValâAlaâ(ArgâIleâAspâProâAlaâAsnâAspâAsnâThrâIleâTyrâAla |
| AspâSerâValâLysâGly)âArgâPheâThrâIleâSerâAlaâAspâAspâSerâLysâAsnâThrâAlaâTyrâLeu |
| GlnâMetâAsnâSerâLeuâArgâAlaâGluâAspâThrâAlaâValâTyrâTyrâCysâThrâThrâ(SerâGlyâTyr |
| TrpâPheâAlaâTyr)âTrpâGlyâGlnâGlyâThrâLeuâValâThrâValâSerâSerâ(SEQâIDâNO:â25) |
| VLâDomain |
| AspâIleâGlnâMetâThrâGlnâSerâProâSerâSerâLeuâSerâAlaâSerâValâGlyâAspâArgâValâThr |
| IleâThrâCysâ(ArgâAlaâSerâGlnâSerâIleâSerâAsnâAsnâLeuâHis)âTrpâTyrâGlnâGlnâLysâPro |
| GlyâLysâAlaâProâLysâLeuâLeuâIleâLysâ(HisâAlaâSerâGlnâSerâIleâSer)âGlyâValâProâSer |
| ArgâPheâSerâGlyâSerâGlyâSerâGlyâThrâAspâPheâThrâLeuâThrâIleâSerâSerâLeuâGlnâPro |
| GluâAspâPheâAlaâThrâTyrâTyrâCysâ(GlnâGlnâSerâAsnâSerâTrpâProâTyrâThr)âPheâGlyâGln |
| GlyâThrâLysâValâGluâIleâLysâArgâ(SEQâIDâNO:â27) |
| HumâH: |
| VHâDomain |
| GluâValâGlnâLeuâValâGluâSerâGlyâGlyâGlyâLeuâValâGlnâProâGlyâGlyâSerâLeuâArgâLeu |
| SerâCysâAlaâAlaâSerâ(GlyâPheâAsnâIleâLysâAspâThrâTyrâIleâHis)âTrpâValâArgâGlnâAla |
| ProâGlyâLysâGlyâLeuâGluâTrpâValâAlaâ(ArgâIleâAspâProâAlaâAsnâAspâAsnâThrâIleâTyr |
| AspâProâLysâValâGlnâGly)âArgâPheâThrâIleâSerâAlaâAspâAspâSerâLysâAsnâThrâAlaâTyr |
| LeuâGlnâMetâAsnâSerâLeuâArgâAlaâGluâAspâThrâAlaâValâTyrâTyrâCysâThrâThrâ(SerâGly |
| TyrâTrpâPheâAlaâTyr)âTrpâGlyâGlnâGlyâThrâLeuâValâThrâValâSerâSerâ(SEQâIDâNO:â29) |
| VLâDomain |
| AspâIleâGlnâMetâThrâGlnâSerâProâSerâSerâLeuâSerâAlaâSerâValâGlyâAspâArgâValâThr |
| IleâThrâCysâ(ArgâAlaâSerâGlnâSerâIleâSerâAsnâAsnâLeuâHis)âTrpâTyrâGlnâGlnâLysâPro |
| GlyâLysâAlaâProâLysâLeuâLeuâIleâLysâ(HisâAlaâSerâGlnâSerâIleâSer)âGlyâValâProâSer |
| ArgâPheâSerâGlyâSerâGlyâSerâGlyâThrâAspâPheâThrâLeuâThrâIleâSerâSerâLeuâGlnâPro |
| GluâAspâPheâAlaâThrâTyrâTyrâCysâ(GlnâGlnâSerâAsnâSerâTrpâProâTyrâThr)âPheâGlyâGln |
| GlyâThrâLysâValâGluâIleâLysâArgâ(SEQâIDâNO:â31) |
| HumâI: |
| VHâDomain |
| GluâValâGlnâLeuâValâGluâSerâGlyâGlyâGlyâLeuâValâGlnâProâGlyâGlyâSerâLeuâArgâLeu |
| SerâCysâAlaâAlaâSerâ(GlyâPheâAsnâIleâLysâAspâThrâTyrâIleâHis)âTrpâMetâArgâGlnâAla |
| ProâGlyâLysâGlyâLeuâGluâTrpâValâAlaâ(ArgâIleâAspâProâAlaâAsnâAspâAsnâThrâIleâTyr |
| AspâProâLysâValâGlnâGly)âArgâPheâThrâMetâSerâAlaâAspâThrâSerâLysâAsnâThrâAlaâTyr |
| LeuâGlnâMetâAsnâSerâLeuâArgâAlaâGluâAspâThrâAlaâValâTyrâTyrâCysâThrâThrâ(SerâGly |
| TyrâTrpâPheâAlaâTyr)âTrpâGlyâGlnâGlyâThrâLeuâValâThrâValâSerâSerâ(SEQâIDâNO:â33) |
| VLâDomain |
| AspâIleâGlnâMetâThrâGlnâSerâProâSerâSerâLeuâSerâAlaâSerâValâGlyâAspâArgâValâThr |
| IleâThrâCysâ(ArgâAlaâSerâGlnâSerâIleâSerâAsnâAsnâLeuâHis)âTrpâTyrâGlnâGlnâLysâPro |
| GlyâLysâAlaâProâLysâLeuâLeuâIleâLysâ(HisâAlaâSerâGlnâSerâIleâSer)âGlyâValâProâSer |
| ArgâPheâSerâGlyâSerâGlyâSerâGlyâThrâAspâPheâThrâLeuâThrâIleâSerâSerâLeuâGlnâPro |
| GluâAspâPheâAlaâThrâTyrâTyrâCysâ(GlnâGlnâSerâAsnâSerâTrpâProâTyrâThr)âPheâGlyâGln |
| GlyâThrâLysâValâGluâIleâLysâArgâ(SEQâIDâNO:â35) |
The CDR residues are included within brackets.
This example describes expression and purification of humanized 1A6 single chain antibody proteins.
For production of the humanized 1A6 scFv, TOP10 cells transformed with desired expression construct were grown in shaker flasks in TB medium (Bio 101) until they reached an OD600 of 0.8. Protein expression was induced with 0.02% arabinose for eighteen hours at room temperature. Cells were pelleted by centrifugation at 4,000 g for 15 minutes. Cell pellets were resuspended in 1/50th volume of lysis buffer (20 mM sodium phosphate, 1% Triton X-100, 500 mM NaCl, 40 mM imidazole, 2 mM 2-mercaptoethanol), 0.2 mM PMSF, 1 mg/ml lysozyme and incubated on ice for 30 minutes. The cell suspension was sonicated and another aliquot of PMSF was added. The cell debris was pelleted by centrifugation at 12,000Ăg and the clarified sonicate was filtered and fractionated by metal affinity chromatography. Induced histidine-tagged proteins were bound to a Hi Trap⢠metal chelating column (Amersham/Pharmacia) equilibrated with Ni2+ according to the manufacturer's instructions. The column was then washed with four column volumes of buffer consisting of 100 mM imidazole, 20 mM sodium phosphate, pH 7.4, 500 mM NaCl. Fractions of proteins eluted from the column in 500 mM Imidazole, 20 mM sodium phosphate, pH 7.4 were collected, pooled and dialyzed at 4° C. against phosphate buffered saline (PBS)/2 mM EDTA, then dialyzed against PBS.
This example describes studies measuring binding affinity of humanized single chain antibody proteins for ICAM-1.
To evaluate the binding affinity of histidine-tagged human single chain (hsc) proteins soluble ICAM was used in an ELISA assay. A 96-well EIA plate (Corning, Inc.) was coated with 100 Îźl/well soluble ICAM-1 (Bender MedSystems) at 1 Îźg/ml in 0.1 M. NaHCO3. After washing with TBST (50 mM Tris, pH8.0, 150 mM NaCl, 0.05% Tween-20), the plate was blocked with 3% non-fat milk in TBST at 37° C. for 1 hour. After washing with TBST, the plate was incubated with scFv samples (100 Îźl/well) diluted in 1% non-fat milk/TBST solution at room temperature for 1 hour. After washing with TBST, the horse radish peroxidase-conjugated anti-His (C-term) antibody (Invitrogen) diluted 1:2000 in 1% non-fat milk/TBST was added and the plate was incubated at room temperature for 1 hour. The plate was washed thoroughly with TBST and 100 Îźl/well 3,3â˛,5,5â˛-tetramethylbenzidine substrate solution (Kirkegaard and Perry Laboratories) was added. After 5 min incubation, the color development was stopped by adding 100 ml/well 0.12 N HCl and the absorbance of the wells at 450 nm was measured by a plate reader (ICN).
Binding studies revealed that all of the humanized scFv proteins (hsc) demonstrate greater than ten times higher binding affinity for ICAM-1 than the parental mouse scFv (Table 4).
| TABEL 4 |
| Mouse IA6 scFv and Humanized 1A6 scFv |
| ScFv | KD (M) | EC 50 (ÎźM)* | |
| Msc1A6 | 1.18 Ă 10â6 | >10 | |
| HscA | 1.50 Ă 10â7 | 2.8 | |
| HscB | 2.62 Ă 10â8 | 0.19 | |
| HscC | 5.80 Ă 10â8 | .22 | |
| HscD | 2.33 Ă 10â8 | 0.05 | |
| HscF | 4.60 Ă 10â8 | 0.29 | |
| HscH | 2.09 Ă 10â8 | 4.2 | |
| HscI | 1.50 Ă 10â7 | >10 | |
| *50% protection fo HeLa cells against HRV15 infection at 1 MOL |
This example describes data demonstrating that humanized 1A6 antibodies protect against HRV infection. This example also describes data that demonstrate that protection was significantly greater than mouse 1A6 antibody.
HeLa cells were plated at 1Ă105 cells per well of a 48-well tissue culture dish and cultured for 24 hours. Culture medium was aspirated and 100 Îźl of humanized 1A6 proteins was added to each well at the dilution indicated. The plates were incubated for one hour in a 37° C. incubator, the protein solution removed, 200 Îźl HRV15 (at MOI of 1) was added and the plates incubated for one hour at 33° C. The cells were then washed and 1 ml/well growth medium added. The infected cells were incubated at 33° C. for 48 hours. The medium was then aspirated and the remaining viable cells stained with crystal violet. Finally, the crystal violet was extracted with 2 ml methanol per well, and the extracted stain determined by measuring the A570. The percentage protection was calculated for each point in triplicate using the formula:
( 100 ) î˘ % î˘ î˘ protection = ( Absorbance î˘ î˘ of î˘ î˘ sample - Absorbance î˘ î˘ of î˘ î˘ virus î˘ î˘ only ) ( Absorbance î˘ î˘ of î˘ î˘ uninfected î˘ î˘ cells - Absorbance î˘ î˘ of î˘ î˘ virus î˘ î˘ only )
The protection efficacy was quantified as EC50, which is the dose of an antibody protein which can protect 50% of hela cells from HRV infection. EC50, of several humanized 1A6 proteins are summarized in Table 2, and the data from this protection assay is shown in FIG. 4. This assay revealed that the EC50 of Hum 19 scFv protein was more than sixty times higher than that of the parental mouse 1A6 scFv protein (FIG. 4). In vitro protection results correlate well with the antibody binding affinity.
1. An antibody that binds ICAM-1 comprising:
i) a VH region having at least 60% sequence homology to SEQ ID NO: 9, or
ii) a VL region having at least 60% sequence homology to SEQ ID NO: 11.
2. The antibody or antibody subsequence of claim 1 having a protective efficacy against pathogen infection greater than an antibody having mouse monoclonal antibody 1A6 variable domains.
3. The antibody of claim 1 having a binding affinity for ICAM-1 greater than an antibody having mouse monoclonal antibody 1A6 variable domains.
4. The antibody of claim 2, wherein said pathogen is human rhinovirus (HRV), coxackie A virus, respiratory syncytial virus (RSV) or malaria.
5. The antibody of claim 1, wherein said antibody or antibody subsequence is linked to one or more identical or different antibodies to form a multimeric antibody complex.
6. The antibody of claim 5, wherein said multimeric complex is formed via a multimerization domain.
7. The antibody of claim 6, further comprising a linker between said t multimerization domain and said antibody.
8. The antibody of claim 5, wherein said multimeric complex is a homo- or hetero-dimer, trimer, tetramer or pentamer.
9. The antibody of claim 1, wherein said antibody or antibody subsequence has 1-10 amino acid substitutions.
10. The antibody of claim 9, wherein said substitutions are conservative substitutions.
11. The antibody of claim 2, wherein said mouse monoclonal antibody 1A6 variable domains comprise a heavy and light chains of SEQ ID NOs: 77 and 79, respectively.
12. The antibody of claim 3, wherein said mouse monoclonal antibody 1A6 variable domains comprise a heavy and light chains of SEQ ID NOs: 77 and 79, respectively.
13. The antibody or antibody subsequence of claim 1, said antibody having a protective efficacy at least 2 times greater than mouse monoclonal antibody 1A6.
14. The antibody of claim 1, wherein said antibody is an intact immunoglobulin molecule comprising 2 full-length heavy chains and 2 full-length light chains.
15. The antibody of claim 1, wherein an acceptor variable framework region of said VH or VL region has at least one non-human donor amino acid.
16. A nucleic acid sequence encoding the antibody or antibody subsequence of claim 1.
17. A vector comprising the nucleic acid sequence of claim 16.
18. A pharmaceutical composition comprising the antibody or antibody subsequence of claim 1 and a pharmaceutically acceptable carrier.
19. A method for inhibiting pathogen infection of a cell, said method comprising contacting a pathogen or cell susceptible to the pathogen infection with an amount of antibody or antibody subsequence of claim 1 in an amount sufficient to inhibit pathogen infection of the cell.
20. The method of claim 19, wherein said cell is an epithelial cell.