US20140336079A1
2014-11-13
14/447,230
2014-07-30
Provided in certain embodiments are new methods for forming azido modified nucleic acid conjugates of reporter molecules, carrier molecules or solid support. In other embodiments are provided methods for enzymatically labeling nucleic acids with an azide group.
Get notified when new applications in this technology area are published.
C12Q1/6806 » CPC main
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
C12Q1/686 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid amplification reactions Polymerase chain reaction [PCR]
C12Q1/6841 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Hybridisation assays hybridisation
C12Q1/68 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids
This application is a Continuation-in-Part of U.S. Ser. No. 11/674,140, filed Feb. 12, 2007, which claims priority to U.S. Provisional Application No. 60/772,221, filed Feb. 10, 2006 and U.S. Provisional Application No. 60/804,640, filed Jun. 13, 2006, the contents of which are incorporated by reference as if set forth fully herein.
The invention generally relates to methods of labeling nucleic acid polymers and their use.
Conventional methods for labeling nucleotides are straightforward, but have significant drawbacks. With direct fluorophore labeling, the bulky dye molecule on the nucleotide makes it difficult for the enzyme to incorporate nucleotides into DNA or RNA strands. Additionally, protocols optimized for one fluorophore may not be optimal for another, chemically different fluorophore.
Various methods have been used to generate labeled probes for hybridization to Southern blots and microarrays, for example, 5Ⲡand 3Ⲡend labeling with 32P. Additionally, nick translation uses DNAse Ito generate single stranded nicks in the nucleic acid starting material and DNA polymerase to fill in the nicks. A labeled deoxynucleotide (for example dUTP-digoxigenin or dUTP fluorescein) is included in the reaction mixture, along with the other unlabeled deoxynucleotides. While these methods generate labeled probes, they do not provide a method of amplifying the starting material.
Polymerase chain reaction (PCR) in the presence of a mixture of nucleotides (for example dATP, dCTP, dGTP, dTTP, and modified dUTP-digoxigenin or fluorescein) can be used to synthesize copies of a template strand. These amplicons can be used as probes for hybridization assays. The mixture must contain unmodified dTTP in addition to modified dUTP in order for the reaction to take place.
PCR uses a double stranded DNA template as starting material. This template can be made from RNA by reverse transcription and subsequently labeled by PCR incorporation of labeled nucleotides. While this method does result in an amplification of the starting material, the substitution of the deoxynucleotide fluorescent analogue is less than 100% and the specific activity may be variable, depending on the label.
Accordingly, one object of the present invention is to provide an improved method for nucleotide labeling that circumvents problems associated with conventional methods. Preferably, the methods will be amenable to a variety of uses including generating FISH probes, generating probes for Southern blots, generating probes for Northern blots, colorimetric in situ hybridization probes (CISH), in situ PCR, isothermal amplification in situ, DNA fingerprinting, and SNP detection.
One aspect of the invention provides a method of forming a nucleic acid conjugate, wherein the method comprises:
Another aspect of the invention provides method of forming a nucleic acid conjugate, wherein the method comprises:
Another aspect of the invention provides a method of forming a nucleic acid conjugate, wherein the method comprises:
incorporating a phosphine modified nucleotide into the nucleic acid polymer by contacting the phosphine modified nucleotide nucleotide with at least one other nucleotide in the presence of a DNA amplification enzyme to form a phosphine modified nucleic acid polymer; and
Another aspect of the invention provides a method for making an azido, alkyne or phosphine modified nucleic acid polymer, wherein the method comprises:
In another embodiment, the nucleic acid enzyme is a DNA polymerase.
In another embodiment, the nucleic acid enzyme is a RNA polymerase.
In another embodiment, the melting temperature of the azido, alkyne or phosphine modified nucleic acid polymer is increased.
In another embodiment, the reporter molecule is a xanthene, cyanine, coumarin, borapolyazaindacene or pyrene dye. In another embodiment, the reporter molecule is an enzyme substrate or hapten.
In another embodiment, the carrier molecule is an amino acid, a peptide, a protein, a polysaccharide, a nucleotide, a nucleoside, an oligonucleotide, a nucleic acid, a hapten, a psoralen, a drug, a hormone, a lipid, a lipid assembly, a synthetic polymer, a polymeric microparticle, a biological cell or a virus. In another embodiment, the carrier molecule comprises an antibody or fragment thereof, an avidin or streptavidin, a biotin, a blood component protein, a dextran, an enzyme, an enzyme inhibitor, a hormone, an IgG binding protein, a fluorescent protein, a growth factor, a lectin, a lipopolysaccharide, a microorganism, a metal binding protein, a metal chelating moiety, a non-biological microparticle, a peptide toxin, a phosphotidylserine-binding protein, a structural protein, a small-molecule drug, or a tyramide.
In another embodiment, the solid support is a microfluidic chip, a silicon chip, a microscope slide, a microplate well, silica gels, polymeric membranes, particles, derivatized plastic films, glass beads, cotton, plastic beads, alumina gels, polysaccharides, polyvinylchloride, polypropylene, polyethylene, nylon, latex bead, magnetic bead, paramagnetic bead, or superparamagnetic bead.
In another embodiment, the solid support is Sepharose, poly(acrylate), polystyrene, poly(acrylamide), polyol, agarose, agar, cellulose, dextran, starch, FICOLL, heparin, glycogen, amylopectin, mannan, inulin, nitrocellulose, diazocellulose or starch.
Another aspect of the invention provides a method of detecting an azido modified nucleic acid polymer, comprising:
In a more particular embodiment the forming step further comprises
In another embodiment, the reporter molecule is xanthene, cyanine, coumarin, borapolyazaindacene or pyrene dye. In another embodiment, the reporter molecule is an enzyme substrate, fluorescent protein or hapten.
In another embodiment, the copper chelator is a copper (I) chelator. In another embodiment, the copper chelator is N,N,Nâ˛,Nâ˛-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN), EDTA, neocuproine, N-(2-acetamido)iminodiacetic acid (ADA), pyridine-2,6-dicarboxylic acid (PDA), S-carboxymethyl-L-cysteine (SCMC), 1,10 phenanthroline, or a derivative thereof, trientine, glutathione, histadine, polyhistadine or tetra-ethylenepolyamine (TEPA). In another embodiment, the copper chelator is 1,10 phenanthroline, bathophenanthroline disulfonic acid (4,7odiphenyl-1,10-phenanthroline disulfonic acid) or bathocuproine disulfonic acid (2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline disulfonate).
In another embodiment, the reducing agent is acorbate, Tris(2-Carboxyethyl) Phosphine (TCEP), TCP (2,4,6-trichlorophenol), NADH, NADPH, thiosulfate, 2-mercaptoethanol, dithiothreotol, glutathione, cysteine, metallic copper, quinone, hydroquinone, vitamin K1, Fe2+, Co2+, or an applied electric potential. In another embodiment, the reducing agent is ascorbate.
In another embodiment, the separating step comprises chromatography or electrophoresis. In another embodiment, the chromatography comprises one or more of FPLC, HPLC, liquid chromatography (LC), size exclusion chromatography, ion exchange chromatography, or affinity chromatography.
In another embodiment, electrophoresis comprises gel electrophoresis, 1 dimensional (1D) gel electrophoresis, 2 dimensional (2D) gel electrophoresis, native gel electrophoresis, denaturing gel electrophoresis, isoelectric focusing, or capillary electrophoresis.
Another aspect of the invention provides an azide-alkyne cycloaddition reaction mixture comprising:
Another aspect of the invention provides a method for detecting immobilized azido modified nucleic acids, wherein the method comprises:
Another aspect of the invention provides a method for detecting immobilized alkyne modified nucleic acids, wherein the method comprises:
In another embodiment, the solid or semi-solid support is a slide, an array, an agarose gel, a polyacrylamide gel, a hydrogel, a polymeric particle or glass.
Another aspect of the invention provides a kit comprising:
Another aspect of the invention provides a kit for labeling a nucleic acid polymer comprising:
A more particular embodiment thereof further comprises a nucleic acid amplification enzyme.
Another aspect of the invention provides a method of measuring Telomerase Enzyme Activity, comprising steps of:
Another aspect of the invention provides a method of measuring Telomerase Enzyme Activity, comprising steps of:
FIG. 1: Shows in gel detection Telomerase incorporation of N3-dATP.
FIG. 2: Shows in gel detection and dose-dependence of Telomerase incorporation of N3-dATP and not N3-dAUP.
FIG. 3: Shows in gel detection and dose-dependence of Telomerase incorporation of N3-dATP and labeled with alkyne-TAMRA using âclickâ chemistry.
FIG. 4: Shows in gel detection of Telomerase incorporation of ethynyl-dAUP and labeled with azide-TAMRA using âclickâ chemistry.
FIG. 5: Shows in gel detection of Telomerase incorporation of ethynyl-dAUP and labeled with azide-TAMRA using âclickâ chemistry.
FIG. 6: Shows in gel detection of incorporation of ethynyl-dAUP using linear amplification and various polymerases. The ethynyl-dAUP was labeled with azide-TAMRA using âclickâ chemistry.
FIG. 7: Shows that the presence of a copper chelator (BCS) maintains Telomerase laddering.
FIG. 8: Is a schematic diagram showing amplification using helicase enzyme.
FIG. 9: Is a schematic diagram showing Strand Displacement Amplification (SDA)
FIG. 10: Illustration of the position of the primers used in Example 13, giving a predicted amplicon size of 293 bp.
FIG. 11: Is a linear amplification plot showing that the onset of exponential amplification or threshold cycle (CT) for the click modified dUTP mix is very similar to that shown for the unmodified dUTP mix. The average CT for click dUTP is 9.78 vs 10.97 for unmodified dUTP.
FIG. 12: Shows dissociation curves for the reactions in Example 13, showing the change in fluorescence as a function of temperature. Click modified dUTP mix melts at 93 C, vs unmodified dUTP mix at 88 C.
FIG. 13: Gel analysis of real-time PCR products scanned for TAMRA (left) or scanned after labeling with SYBR GOLD (right).
FIG. 14. shows images of reaction tubes for TAMRA.
FIG. 15: shows a dot blot of reaction products scanned for TAMRA.
FIG. 16: shows the experimental setup for Example 15.
Before describing the present invention in detail, it is to be understood that this invention is not limited to specific compositions or process steps, as such may vary. It must be noted that, as used in this specification and the appended claims, the singular form âaâ, âanâ and âtheâ include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to âa ligandâ includes a plurality of ligands and reference to âa nucleic acidâ includes a plurality of nucleic acids and the like.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention is related. The following terms and abbreviations (Table 1) are defined for purposes of the invention as described herein.
| TABLE 1 |
| List of Abbreviations |
| Abbreviation | Term. | |
| E-dNTP | ethynyl deoxynucleoside triphosphate | |
| E-ATP | ethynyl deoxyadenosine triphosphate | |
| E-GTP | ethynyl deoxyguanosine triphosphate | |
| E-CTP | ethynyl deoxycytidine triphosphate | |
| E-TTP | ethynyl deoxythymidine triphosphate | |
Certain compounds of the present invention can exist in unsolvated forms as well as solvated forms, including hydrated forms. In general, the solvated forms are equivalent to unsolvated forms and are encompassed within the scope of the present invention. Certain compounds of the present invention may exist in multiple crystalline or amorphous forms. In general, all physical forms are equivalent for the uses contemplated by the present invention and are intended to be within the scope of the present invention.
Certain compounds of the present invention possess asymmetric carbon atoms (optical centers) or double bonds; the racemates, diastereomers, geometric isomers and individual isomers are encompassed within the scope of the present invention.
The compounds described herein may be prepared as a single isomer (e.g., enantiomer, cis-trans, positional, diastereomer) or as a mixture of isomers. In a preferred embodiment, the compounds are prepared as substantially a single isomer. Methods of preparing substantially isomerically pure compounds are known in the art. For example, enantiomerically enriched mixtures and pure enantiomeric compounds can be prepared by using synthetic intermediates that are enantiomerically pure in combination with reactions that either leave the stereochemistry at a chiral center unchanged or result in its complete inversion. Alternatively, the final product or intermediates along the synthetic route can be resolved into a single stereoisomer. Techniques for inverting or leaving unchanged a particular stereocenter, and those for resolving mixtures of stereoisomers are well known in the art and it is well within the ability of one of skill in the art to choose and appropriate method for a particular situation. See, generally, Furniss et al. (eds.), VoGEL'S ENCYCLOPEDIA OF PRACTICAL ORGANIC CHEMISTRY 5TH ED., Longman Scientific and Technical Ltd., Essex, 1991, pp. 809-816; and Heller, Acc. Chem. Res. 23: 128 (1990).
The compounds disclosed herein may also contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute such compounds. For example, the compounds may be radiolabeled with radioactive isotopes, such as for example tritium (3H), iodine-125 (125I) or carbon-14 (14C). All isotopic variations of the compounds of the present invention, whether radioactive or not, are intended to be encompassed within the scope of the present invention.
Where a disclosed compound includes a conjugated ring system, resonance stabilization may permit a formal electronic charge to be distributed over the entire molecule. While a particular charge may be depicted as localized on a particular ring system, or a particular heteroatom, it is commonly understood that a comparable resonance structure can be drawn in which the charge may be formally localized on an alternative portion of the compound.
Selected compounds having a formal electronic charge may be shown without an appropriate biologically compatible counterion. Such a counterion serves to balance the positive or negative charge present on the compound. As used herein, a substance that is biologically compatible is not toxic as used, and does not have a substantially deleterious effect on biomolecules. Examples of negatively charged counterions include, among others, chloride, bromide, iodide, sulfate, alkanesulfonate, arylsulfonate, phosphate, perchlorate, tetrafluoroborate, tetraarylboride, nitrate and anions of aromatic or aliphatic carboxylic acids. Preferred counterions may include chloride, iodide, perchlorate and various sulfonates. Examples of positively charged counterions include, among others, alkali metal, or alkaline earth metal ions, ammonium, or alkylammonium ions.
Where substituent groups are specified by their conventional chemical formulae, written from left to right, they equally encompass the chemically identical substituents, which would result from writing the structure from right to left, e.g., âCH2Oâ is intended to also recite âOCH2â.
The term âacylâ or âalkanoylâ by itself or in combination with another term, means, unless otherwise stated, a stable straight or branched chain, or cyclic hydrocarbon radical, or combinations thereof, consisting of the stated number of carbon atoms and an acyl radical on at least one terminus of the alkane radical. The âacyl radicalâ is the group derived from a carboxylic acid by removing the âOH moiety therefrom.
The term âalkyl,â by itself or as part of another substituent means, unless otherwise stated, a straight or branched chain, or cyclic hydrocarbon radical, or combination thereof, which may be fully saturated, mono- or polyunsaturated and can include divalent (âalkyleneâ) and multivalent radicals, having the number of carbon atoms designated (i.e. C1-C10 means one to ten carbons). Examples of saturated hydrocarbon radicals include, but are not limited to, groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, isobutyl, sec-butyl, cyclohexyl, (cyclohexyl)methyl, cyclopropylmethyl, homologs and isomers of, for example, n-pentyl, n-hexyl, n-heptyl, n-octyl, and the like. An unsaturated alkyl group is one having one or more double bonds or triple bonds. Examples of unsaturated alkyl groups include, but are not limited to, vinyl, 2-propenyl, crotyl, 2-isopentenyl, 2-(butadienyl), 2,4-pentadienyl, 3-(1,4-pentadienyl), ethynyl, 1- and 3-propynyl, 3-butynyl, and the higher homologs and isomers. The term âalkyl,â unless otherwise noted, is also meant to include those derivatives of alkyl defined in more detail below, such as âheteroalkyl.â Alkyl groups that are limited to hydrocarbon groups are termed âhomoalkylâ.
Exemplary alkyl groups of use in the present invention contain between about one and about twenty five carbon atoms (e.g. methyl, ethyl and the like). Straight, branched or cyclic hydrocarbon chains having eight or fewer carbon atoms will also be referred to herein as âlower alkylâ. In addition, the term âalkylâ as used herein further includes one or more substitutions at one or more carbon atoms of the hydrocarbon chain fragment.
The term âaminoâ or âamine groupâ refers to the group âNRâ˛Râł (or NRRâ˛Râł) where R, RⲠand Râł are independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, aryl alkyl, substituted aryl alkyl, heteroaryl, and substituted heteroaryl. A substituted amine being an amine group wherein RⲠor Râł is other than hydrogen. In a primary amino group, both RⲠand Râł are hydrogen, whereas in a secondary amino group, either, but not both, RⲠor Râł is hydrogen. In addition, the terms âamineâ and âaminoâ can include protonated and quaternized versions of nitrogen, comprising the group âNRRâ˛Râł and its biologically compatible anionic counterions.
The term âarylâ as used herein refers to cyclic aromatic carbon chain having twenty or fewer carbon atoms, e.g., phenyl, naphthyl, biphenyl, and anthracenyl. One or more carbon atoms of the aryl group may also be substituted with, e.g., alkyl; aryl; heteroaryl; a halogen; nitro; cyano; hydroxyl, alkoxyl or aryloxyl; thio or mercapto, alkyl-, or arylthio; amino, alkylamino, arylamino, dialkyl-, diaryl-, or arylalkylamino; aminocarbonyl, alkylaminocarbonyl, arylaminocarbonyl, dialkylaminocarbonyl, diarylaminocarbonyl, or arylalkylaminocarbonyl; carboxyl, or alkyl- or aryloxycarbonyl; aldehyde; aryl- or alkylcarbonyl; iminyl, or aryl- or alkyliminyl; sulfo; alkyl- or alkylcarbonyl; iminyl, or aryl- or alkyliminyl; sulfo; alkyl- or arylsulfonyl; hydroximinyl, or aryl- or alkoximinyl. In addition, two or more alkyl or heteroalkyl substituents of an aryl group may be combined to form fused aryl-alkyl or aryl-heteroalkyl ring systems (e.g., tetrahydronaphthyl). Substituents including heterocyclic groups (e.g., heteroaryloxy, and heteroaralkylthio) are defined by analogy to the above-described terms.
The terms âalkoxy,â âalkylaminoâ and âalkylthioâ (or thioalkoxy) are used in their conventional sense, and refer to those alkyl groups attached to the remainder of the molecule via an oxygen atom, an amino group, or a sulfur atom, respectively.
The term âheteroalkyl,â by itself or in combination with another term, means, unless otherwise stated, a straight or branched chain, or cyclic carbon-containing radical, or combinations thereof, consisting of the stated number of carbon atoms and at least one heteroatom selected from the group consisting of O, N, Si, P, S, and Se and wherein the nitrogen, phosphorous, sulfur, and selenium atoms are optionally oxidized, and the nitrogen heteroatom is optionally be quaternized. The heteroatom(s) O, N, P, S, Si, and Se may be placed at any interior position of the heteroalkyl group or at the position at which the alkyl group is attached to the remainder of the molecule. Examples include, but are not limited to, âCH2âCH2âOâCH3, âCH2âCH2âNHâCH3, âCH2âCH2âN(CH3)âCH3, âCH2âSâCH2âCH3, âCH2âCH2, âS(O)âCH3, âCH2âCH2âS(O)2âCH3, âCHâCHâOâCH3, âSi(CH3)3, âCH2âCHâNâOCH3, and âCHâCHâN(CH3)âCH3. Up to two heteroatoms may be consecutive, such as, for example, âCH2âNHâOCH3 and âCH2âOâSi(CH3)3. Similarly, the term âheteroalkyleneâ by itself or as part of another substituent means a divalent radical derived from heteroalkyl, as exemplified, but not limited by, âCH2âCH2âSâCH2âCH2â and âCH2âSâCH2âCH2âNHâCH2â. For heteroalkylene groups, heteroatoms can also occupy either or both of the chain termini (e.g., alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, and the like). Still further, for alkylene and heteroalkylene linking groups, no orientation of the linking group is implied by the direction in which the formula of the linking group is written. For example, the formula âC(O)2Râ˛â represents both âC(O)2Râ˛â and âRâ˛C(O)2â.
The terms âcycloalkylâ and âheterocycloalkylâ, by themselves or in combination with other terms, represent, unless otherwise stated, cyclic versions of âalkylâ and âheteroalkylâ, respectively. Additionally, for heterocycloalkyl, a heteroatom can occupy the position at which the heterocycle is attached to the remainder of the molecule. Examples of cycloalkyl include, but are not limited to, cyclopentyl, cyclohexyl, 1-cyclohexenyl, 3-cyclohexenyl, cycloheptyl, and the like. Examples of heterocycloalkyl include, but are not limited to, 1-(1,2,5,6-tetrahydropyridyl), 1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-morpholinyl, 3-morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3-yl, tetrahydrothien-2-yl, tetrahydrothien-3-yl, 1-piperazinyl, 2-piperazinyl, and the like.
The term âarylâ means, unless otherwise stated, a polyunsaturated, aromatic moiety that can be a single ring or multiple rings (preferably from 1 to 3 rings), which are fused together or linked covalently. The term âheteroarylâ refers to aryl groups (or rings) that contain from one to four heteroatoms selected from N, O, S, and Se, wherein the nitrogen, sulfur, and selenium atoms are optionally oxidized, and the nitrogen atom(s) are optionally quaternized. A heteroaryl group can be attached to the remainder of the molecule through a heteroatom. Non-limiting examples of aryl and heteroaryl groups include phenyl, 1-naphthyl, 2-naphthyl, 4-biphenyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrazolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidyl, 4-pyrimidyl, 5-benzothiazolyl, purinyl, 2-benzimidazolyl, 5-indolyl, 1-isoquinolyl, 5-isoquinolyl, 2-quinoxalinyl, 5-quinoxalinyl, 3-quinolyl, tetrazolyl, benzo[b]furanyl, benzo[b]thienyl, 2,3-dihydrobenzo[1,4]dioxin-6-yl, benzo[1,3]dioxol-5-yl and 6-quinolyl. Substituents for each of the above noted aryl and heteroaryl ring systems are selected from the group of acceptable substituents described below.
For brevity, the term âarylâ when used in combination with other terms (e.g., aryloxy, arylthioxy, arylalkyl) includes both aryl and heteroaryl rings as defined above. Thus, the term âarylalkylâ is meant to include those radicals in which an aryl group is attached to an alkyl group (e.g., benzyl, phenethyl, pyridylmethyl and the like) including those alkyl groups in which a carbon atom (e.g., a methylene group) has been replaced by, for example, an oxygen atom (e.g., phenoxymethyl, 2-pyridyloxymethyl, 3-(1-naphthyloxy)propyl, and the like).
Each of the above terms (e.g., âalkyl,â âheteroalkyl,â âarylâ and âheteroarylâ) includes both substituted and unsubstituted forms of the indicated radical. Preferred substituents for each type of radical are provided below.
Substituents for the alkyl and heteroalkyl radicals (including those groups often referred to as alkylene, alkenyl, heteroalkylene, heteroalkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl) are generically referred to as âalkyl group substituents,â and they can be one or more of a variety of groups selected from, but not limited to: âORâ˛, âO, âNRâ˛, âNâORâ˛, âNRâ˛Râł, âSRâ˛, -halogen, âSiRâ˛RâłRâłâ˛, âOC(O)Râ˛, âC(O)Râ˛, âCO2Râ˛, âCONRâ˛Râł, âOC(O)NRâ˛Râł, âNRâłC(O)Râ˛, âNRâ˛âC(O)NRâłRâłâ˛, âNRâłC(O)2Râ˛, âNRâC(NRâ˛RâłRâ˛âł)âNRâłâł, âNRâC(NRâ˛Râł)âNRâłâ˛, âS(O)Râ˛, âS(O)2Râ˛, âS(O)2NRâ˛Râł, âNRSO2Râ˛, âCN and âNO2 in a number ranging from zero to (2 mâ˛+1), where mⲠis the total number of carbon atoms in such radical. Râ˛, Râł, Râłâ˛ and Râłâł each preferably independently refer to hydrogen, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, e.g., aryl substituted with 1-3 halogens, substituted or unsubstituted alkyl, alkoxy or thioalkoxy groups, or arylalkyl groups. When a compound includes more than one R group, for example, each of the R groups is independently selected as are each Râ˛, Râł, Râłâ˛ and Râłâł groups when more than one of these groups is present. When RⲠand Râł are attached to the same nitrogen atom, they can be combined with the nitrogen atom to form a 5-, 6-, or 7-membered ring. For example, âNRâ˛Râł is meant to include, but not be limited to, 1-pyrrolidinyl and 4-morpholinyl. From the above discussion of substituents, one of skill in the art will understand that the term âalkylâ is meant to include groups including carbon atoms bound to groups other than hydrogen groups, such as haloalkyl (e.g., âCF3 and âCH2CF3) and acyl (e.g., âC(O)CH3, âC(O)CF3, âC(O)CH2OCH3, and the like).
Similar to the substituents described for the alkyl radical, substituents for the aryl and heteroaryl groups are generically referred to as âaryl group substituents.â The substituents are selected from, for example: halogen, âORâ˛, âO, âNRâ˛, âNâORâ˛, âNRâ˛Râł, âSRâ˛, -halogen, âSiRâ˛RâłRâłâ˛, âOC(O)Râ˛, âC(O)Râ˛, âCO2Râ˛, âCONRâ˛Râł, âOC(O)NRâ˛Râł, âNRâłC(O)Râ˛, âNRâ˛âC(O)NRâłRâłâ˛, âNRâłC(O)2Râ˛, âNRâC(NRâ˛RâłRâłâ˛)âNRâłâł, âNRâC(NRâ˛Râł)âNRâłâ˛, âS(O)Râ˛, âS(O)2Râ˛, âS(O)2NRâ˛Râł, âNRSO2Râ˛, âCN and âNO2, âRâ˛, âN3, âCH(Ph)2, fluoro(C1-C4)alkoxy, and fluoro(C1-C4)alkyl, in a number ranging from zero to the total number of open valences on the aromatic ring system; and where Râ˛, Râł, Râłâ˛ and Râłâł are preferably independently selected from hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl and substituted or unsubstituted heteroaryl. When a compound includes more than one R group, for example, each of the R groups is independently selected as are each Râ˛, Râł, Râłâ˛ and Râłâł groups when more than one of these groups is present. In the schemes that follow, the symbol X represents âRâ as described above.
Two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a substituent of the formula -T-C(O)â(CRRâ˛)qâUâ, wherein T and U are independently âNRâ, âOâ, âCRRâ˛â or a single bond, and q is an integer of from 0 to 3. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a substituent of the formula -A-(CH2)râB-, wherein A and B are independently âCRRâ˛â, âOâ, âNRâ, âSâ, âS(O)â, âS(O)2â, âS(O)2NRâ˛â or a single bond, and r is an integer of from 1 to 4. One of the single bonds of the new ring so formed may optionally be replaced with a double bond. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a substituent of the formula â(CRRâ˛)sâXâ(CRâłRâłâ˛)dâ, where s and d are independently integers of from 0 to 3, and X is âOâ, âNRâ˛â, âSâ, âS(O)â, âS(O)2â, or âS(O)2NRâ˛â. The substituents R, Râ˛, Râł and Râłâ˛ are preferably independently selected from hydrogen or substituted or unsubstituted (C1-C6)alkyl.
As used herein, the term âheteroatomâ includes oxygen (O), nitrogen (N), sulfur (S), phosphorus (P), silicon (Si), and selenium (Se).
The term âaminoâ or âamine groupâ refers to the group âNRâ˛Râł (or N+RRâ˛Râł) where R, RⲠand Râł are independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, aryl alkyl, substituted aryl alkyl, heteroaryl, and substituted heteroaryl. A substituted amine being an amine group wherein RⲠor Râł is other than hydrogen. In a primary amino group, both RⲠand Râł are hydrogen, whereas in a secondary amino group, either, but not both, RⲠor Râł is hydrogen. In addition, the terms âamineâ and âaminoâ can include protonated and quaternized versions of nitrogen, comprising the group âN+RRâ˛Râł and its biologically compatible anionic counterions.
The term âaqueous solutionâ as used herein refers to a solution that is predominantly water and retains the solution characteristics of water. Where the aqueous solution contains solvents in addition to water, water is typically the predominant solvent.
The term âCarboxyalkylâ as used herein refers to a group having the general formula â(CH2)nCOOH wherein n is 1-18.
The term âactivated alkyne,â as used herein, refers to a chemical moiety that selectively reacts with an alkyne reactive group, such as an azido moiety or an phosphine moiety, on another molecule to form a covalent chemical bond between the activated alkyne group and the alkyne reactive group. Examples of alkyne-reactive groups include azides. âAlkyne-reactiveâ can also refer to a molecule that contains a chemical moiety that selectively reacts with an alkyne group. As used herein activated alkyne encompasses any terminal alkynes or cyclooctynes (dipolarophiles) that will react with 1,3-dipoles such as azides in a facile fashion.
The term âaqueous solution,â as used herein, refers to a solution that is predominantly water and retains the solution characteristics of water. Where the aqueous solution contains solvents in addition to water, water is typically the predominant solvent.
The term âazide reactive,â as used herein, refers to a chemical moiety that selectively reacts with an azido modified group on another molecule to form a covalent chemical bond between the azido modified group and the azide reactive group. Examples of azide-reactive groups include alkynes and phospines (e.g. triaryl phosphine). âAzide-reactiveâ can also refer to a molecule that contains a chemical moiety that selectively reacts with an azido group.
The term âbuffer,â as used herein, refers to a system that acts to minimize the change in acidity or basicity of the solution against addition or depletion of chemical substances.
The term âcarrier molecule,â as used herein, refers to a biological or a non-biological component that is covalently bonded to compound of the present invention. Such components include, but are not limited to, an amino acid, a peptide, a protein, a polysaccharide, a nucleoside, a nucleotide, an oligonucleotide, a nucleic acid, a hapten, a psoralen, a drug, a hormone, a lipid, a lipid assembly, a synthetic polymer, a polymeric microparticle, a biological cell, a virus and combinations thereof.
The term, âchemical handleâ as used herein refers to a specific functional group, such as an azide, alkyne, activated alkyne, phosphite, phosphine, and the like. The chemical handle is distinct from the reactive group, defined below, in that the chemical handle are moieties that are rarely found in naturally-occurring biomolecules and are chemically inert towards biomolecules (e.g, native cellular components), but when reacted with an azide- or alkyne-reactive group the reaction can take place efficiently under biologically relevant conditions (e.g., cell culture conditions, such as in the absence of excess heat or harse reactants).
The term âclick chemistry,â as used herein, refers to the Huisgen cycloaddition or the 2,3-dipolar cycloaddition between an azide and a terminal alkyne to form a 1,2,4-triazole. Such chemical reactions can use, but are not limited to, simple heteroatomic organic reactants and are reliable, selective, stereospecific, and exothermic.
The term âcycloadditionâ as used herein refers to a chemical reaction in which two or more Ď-electron systems (e.g., unsaturated molecules or unsaturated parts of the same molecule) combine to form a cyclic product in which there is a net reduction of the bond multiplicity. In a cycloaddition, the it electrons are used to form new sigma bonds. The product of a cycloaddition is called an âadductâ or âcycloadductâ. Different types of cycloadditions are known in the art including, but not limited to, [3+2] cycloadditions and Diels-Alder reactions. [3+2] cycloadditions, which are also called 2,3-dipolar cycloadditions, occur between a 1,3-dipole and a dipolarophile and are typically used for the construction of five-membered heterocyclic rings. The terms â[3+2] cycloadditionâ also encompasses âcopperlessâ [3+2] cycloadditions between azides and cyclooctynes and difluorocyclooctynes described by Bertozzi et al. J. Am. Chem. Soc., 2004, 126:15046-15047.
The term âdetectable responseâ as used herein refers to an occurrence of, or a change in, a signal that is directly or indirectly detectable either by observation or by instrumentation. Typically, the detectable response is an occurrence of a signal wherein the fluorophore is inherently fluorescent and does not produce a change in signal upon binding to a metal ion or biological compound. Alternatively, the detectable response is an optical response resulting in a change in the wavelength distribution patterns or intensity of absorbance or fluorescence or a change in light scatter, fluorescence lifetime, fluorescence polarization, or a combination of the above parameters. Other detectable responses include, for example, chemiluminescence, phosphorescence, radiation from radioisotopes, magnetic attraction, and electron density.
The term âdetectably distinctâ as used herein refers to a signal that is distinguishable or separable by a physical property either by observation or by instrumentation. For example, a fluorophore is readily distinguishable either by spectral characteristics or by fluorescence intensity, lifetime, polarization or photo-bleaching rate from another fluorophore in the sample, as well as from additional materials that are optionally present.
The term âdirectly detectableâ as used herein refers to the presence of a material or the signal generated from the material is immediately detectable by observation, instrumentation, or film without requiring chemical modifications or additional substances.
The term âfluorophoreâ as used herein refers to a composition that is inherently fluorescent or demonstrates a change in fluorescence upon binding to a biological compound or metal ion, i.e., fluorogenic. Fluorophores may contain substitutents that alter the solubility, spectral properties or physical properties of the fluorophore. Numerous fluorophores are known to those skilled in the art and include, but are not limited to coumarin, cyanine, benzofuran, a quinoline, a quinazolinone, an indole, a benzazole, a borapolyazaindacene and xanthenes including fluoroscein, rhodamine and rhodol as well as other fluorophores described in RICHARD P. HAUGLAND, MOLECULAR PROBES HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS (10th edition, CD-ROM, September 2005), which is herein incorporated by reference in its entirety.
The term âisolatedâ, when used herein in reference to a nucleic acid polymer, means a nucleic acid polymer, which by virtue of its origin or manipulation is separated from at least some of the components with which it is naturally associated or with which it is associated when initially obtained. By âisolatedâ, it is alternatively or additionally meant that the nucleic acid polymer of interest is produced or synthesized by the hand of man.
The term âkit,â as used herein, refers to a packaged set of related components, typically one or more compounds or compositions.
The term âlabel,â as used herein, refers to a chemical moiety or protein that is directly or indirectly detectable (e.g. due to its spectral properties, conformation or activity) when attached to a target or compound and used in the present methods, including reporter molecules and carrier molecules. The label can be directly detectable (fluorophore) or indirectly detectable (hapten or enzyme). Such labels include, but are not limited to, radiolabels that can be measured with radiation-counting devices; pigments, dyes or other chromogens that can be visually observed or measured with a spectrophotometer; spin labels that can be measured with a spin label analyzer; and fluorescent labels (fluorophores), where the output signal is generated by the excitation of a suitable molecular adduct and that can be visualized by excitation with light that is absorbed by the dye or can be measured with standard fluorometers or imaging systems, for example. The label can be a chemiluminescent substance, where the output signal is generated by chemical modification of the signal compound; a metal-containing substance; or an enzyme, where there occurs an enzyme-dependent secondary generation of signal, such as the formation of a colored product from a colorless substrate. The term label can also refer to a âtagâ or hapten that can bind selectively to a conjugated molecule such that the conjugated molecule, when added subsequently along with a substrate, is used to generate a detectable signal. For example, one can use biotin as a tag and then use an avidin or streptavidin conjugate of horseradish peroxidate (HRP) to bind to the tag, and then use a colorimetric substrate (e.g., tetramethylbenzidine (TMB)) or a fluorogenic substrate such as Amplex Red reagent (Molecular Probes, Inc.) to detect the presence of HRP. Numerous labels are know by those of skill in the art and include, but are not limited to, particles, fluorophores, haptens, enzymes and their colorimetric, fluorogenic and chemiluminescent substrates and other labels that are described in RICHARD P. HAUGLAND, MOLECULAR PROBES HANDBOOK OF FLUORESCENT PROBES AND RESEARCH PRODUCTS (10th edition, CD-ROM, September 2005), supra.
The term âlinkerâ or âLâ, as used herein, refers to a single covalent bond or a series of stable covalent bonds incorporating 1-30 nonhydrogen atoms selected from the group consisting of C, N, O, S and P. In addition, the linker covalently attaches a carrier molecule or solid support to the present azido or activated alkyne modified nucleotides or nucleaic acid polymers. Exemplary linking members include a moiety that includes âC(O)NHâ, âC(O)Oâ, âNHâ, âSâ, âOâ, and the like. A âcleavable linkerâ is a linker that has one or more cleavable groups that may be broken by the result of a reaction or condition. The term âcleavable groupâ refers to a moiety that allows for release of a portion, e.g., a reporter molecule, carrier molecule or solid support, of a conjugate from the remainder of the conjugate by cleaving a bond linking the released moiety to the remainder of the conjugate. Such cleavage is either chemical in nature, or enzymatically mediated. Exemplary enzymatically cleavable groups include natural amino acids or peptide sequences that end with a natural amino acid. In addition to enzymatically cleavable groups, it is within the scope of the present invention to include one or more sites that are cleaved by the action of an agent other than an enzyme. Exemplary non-enzymatic cleavage agents include, but are not limited to, acids, bases, light (e.g., nitrobenzyl derivatives, phenacyl groups, benzoin esters), and heat. Many cleaveable groups are known in the art. See, for example, Jung et al., Biochem. Biophys. Acta, 761: 152-162 (1983); Joshi et al., J. Biol. Chem., 265: 14518-14525 (1990); Zarling et al., J. Immunol., 124: 913-920 (1980); Bouizar et al., Eur. J. Biochem., 155: 141-147 (1986); Park et al., J. Biol. Chem., 261: 205-210 (1986); Browning et al., J. Immunol., 143: 1859-1867 (1989). Moreover a broad range of cleavable, bifunctional (both homo- and hetero-bifunctional) spacer arms are commercially available. An exemplary cleavable group, an ester, is cleavable group that may be cleaved by a reagent, e.g. sodium hydroxide, resulting in a carboxylate-containing fragment and a hydroxyl-containing product.
The term ânucleic acid polymerâ as used herein refers to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, including DNA and RNA, and unless otherwise stated encompasses nucleic acid-like structures with synthetic backbones, as well as amplification products. In the context of the present invention, a nucleic acid polymer may be an isolated molecule, present in an amplification reaction or present in a hybridization reaction.
As used herein, the term ânucleotide analogueâ refers to a molecule that is structurally similar to a natural nucleotide and that can function in a similar manner as the naturally occurring nucleotide (e.g., exhibits similar ability to base pair with one of the naturally occurring bases). The term ânucleoside analogueâ, as used herein, refers to a molecule that is structurally similar to a natural nucleoside and that can function in a similar manner as the naturally occurring nucleoside (e.g., exhibits similar ability to be incorporated into DNA by DNA replication). The term ânucleotideâ refers to a monomeric unit of DNA or RNA containing a sugar moiety (pentose), a phosphate or polyphosphate and a nitrogenous heterocyclic base. The base is linked to the sugar moiety via the glycosidic carbon (i.e., the 1â˛-carbon of the pentose) and that combination of base and sugar is called a ânucleosideâ. The base characterizes the nucleotide (or nucleoside) with the four bases of DNA being adenine (or A), guanine (G), cytosine (C) and thymine (T), and the four bases of RNA being adenine, guanine, cytosine, and uracil (U). In certain embodiments of the present invention a nucleotide analogue (or nucleoside analogue) comprises a chemical handle and as used herein also referred to as âmodified nucleotidesâ or âmodified nucleic acid polymersâ.
The term âreactive groupâ as used herein refers to a group that is capable of reacting with another chemical group to form a covalent bond, i.e. is covalently reactive under suitable reaction conditions, and generally represents a point of attachment for another substance. As used herein, reactive groups refer to chemical moieties generally found in biological systems and that react under normal biological conditions, these are herein distinguished from the chemical handel, defined above, the azido and activated alkyne moieties of the present invention. As referred to herein the reactive group is a moiety, such as carboxylic acid or succinimidyl ester, that is capable of chemically reacting with a functional group on a different compound to form a covalent linkage. Reactive groups generally include nucleophiles, electrophiles and photoactivatable groups.
The term âreporter moleculeâ refers to any moiety capable of being attached to a carrier molecule or solid support, such as a modified nucleotide or nucleic acid polymer, and detected either directly or indirectly. Reporter molecules include, without limitation, a chromophore, a fluorophore, a fluorescent protein, a phosphorescent dye, a tandem dye, a particle, a hapten, an enzyme and a radioisotope. Preferred reporter molecules include fluorophores, fluorescent proteins, haptens, and enzymes.
The term âsampleâ as used herein refers to any material that may contain an analyte for detection or quantification or a modified nucleotide or nucleic acid polymer. The analyte may include a reactive group, e.g., a group through which a compound of the invention can be conjugated to the analyte. The sample may also include diluents, buffers, detergents, and contaminating species, debris and the like that are found mixed with the target. Illustrative examples include urine, sera, blood plasma, total blood, saliva, tear fluid, cerebrospinal fluid, secretory fluids from nipples and the like. Also included are solid, gel or sol substances such as mucus, body tissues, cells and the like suspended or dissolved in liquid materials such as buffers, extractants, solvents and the like. Typically, the sample is a live cell, a biological fluid that comprises endogenous host cell proteins, nucleic acid polymers, nucleotides, oligonucleotides, peptides and buffer solutions. The sample may be in an aqueous solution, a viable cell culture or immobilized on a solid or semi solid surface such as a polyacrylamide gel, membrane blot or on a microarray.
The term âsolid support,â as used herein, refers to a material that is substantially insoluble in a selected solvent system, or which can be readily separated (e.g., by precipitation) from a selected solvent system in which it is soluble. Solid supports useful in practicing the present invention can include groups that are activated or capable of activation to allow selected one or more compounds described herein to be bound to the solid support.
The term âStaudinger ligationâ as used herein refers to a chemical reaction developed by Saxon and Bertozzi (E. Saxon and C. Bertozzi, Science, 2000, 287: 2007-2010) that is a modification of the classical Staudinger reaction. The classical Staudinger reaction is a chemical reaction in which the combination of an azide with a phosphine or phosphite produces an aza-ylide intermediate, which upon hydrolysis yields a phosphine oxide and an amine. A Staudinger reaction is a mild method of reducing an azide to an amine; and triphenylphosphine is commonly used as the reducing agent. In a Staudinger ligation, an electrophilic trap (usually a methyl ester) is appropriately placed on a triarylphosphine aryl group (usually ortho to the phosphorus atom) and reacted with the azide, to yield an aza-ylide intermediate, which rearranges in aqueous media to produce a compound with amide group and a phosphine oxide function. The Staudinger ligation is so named because it ligates (attaches/covalently links) the two starting molecules together, whereas in the classical Staudinger reaction, the two products are not covalently linked after hydrolysis.
The terms âstructural integrity of the [nucleic acid] is not reducedâ or âpreservation of the structural integrity of the [nucleic acid]â, as used herein, means that either: 1) when analyzed by gel electrophoresis and detection (such as staining), a band or spot arising from the labeled nucleic acid is not reduced in intensity by more than 20%, and preferably not reduced by more than 10%, with respect to the corresponding band or spot arising from the same amount of the electrophoresed unlabeled nucleic acid, arising from the labeled nucleic acid analyzed; or 2) when analyzed by gel electrophoresis, a band or spot arising from the labeled nucleic acid is not observed to be significantly less sharp than the corresponding band or spot arising from the same amount of the electrophoresed unlabeled nucleic acid, where âsignificantly less sharpâ (synonymous with âsignificantly more diffuseâ) means the detectable band or spot takes up at least 5% more, preferably 10% more, more preferably 20% more area on the gel than the corresponding unlabeled nucleic acid. Other reproducible tests for structural integrity of labeled nucleic acids include, without limitation detection of released amino acids or peptides, or mass spectrometry.
In general, for ease of understanding the present invention, the metabolic and enzymatic labeling of nucleic acids with azide moieties, alkyne moieties or phosphine, and the chemical labeling of such moieties with azide reactive moieties, alkyne reactive moieties or phosphine reactive moieties will first be described in detail. This will be followed by some embodiments in which such labeled nucleic acids can be detected, isolated and/or analyzed. Exemplified methods are then disclosed.
The nucleic acid polymers produced according to methods described herein, or utilized in methods described herein, are single- or double-stranded deoxyribonucleotide or ribonucleotide polymers. As will be appreciated by one of ordinary skill in the art, the nucleic acid polymers can be polynucleotides of any of a wide range of sizes including short oligonucleotides comprising at least about 8 nucleotides as well as full genomic DNA molecules.
Some of the labeling methods described herein generally include a [3+2] cycloaddition between a first reactive unsaturated group on a nucleotide incorporated into a nucleic acid polymer and a second reactive unsaturated group attached to a reporter molecule, a carrier molecule and/or a solid support. Thus, in one aspect the modified nucleic acid polymer comprises an azido group with reacts with an activated alkyne on a reporter molecule, a carrier molecule and/or a solid support to form a covalent bond. In another aspect the modified nucleic acid polymer comprises an activated alkynes that reacts with an azido moiety on reporter molecule, a carrier molecule and/or a solid support to form a covalent bond.
As described herein the tagging/labeling of nucleic acid polymers, also referred to herein as nucleic acids, utilize the incorporation of a bioorthoganol moieties into a nucleic acid polymer followed by chemical attachment of a label. The bioorthoganol moieties can be incorporated into a nucleic acid using in vitro extension and/or amplification techniques including but not limited to, polymerase chain reaction (PCR), ligation-based thermocycling approaches, reverse transcription-PCR, real-time PCR, linear amplification techniques and isothermal DNA amplification techniques such as, by way of example only, real-time strand displacement amplification (SDA), rolling-circle amplification (RCA), multiple-displacement amplification (MDA), Q-beta replicase amplification, automated Q-beta replicase amplification assay and other RNA polymerase mediated techniques such as, for example, nucleic acid sequence based amplification or NASBA and transcription mediated amplification (TMA). In certain embodiments, such bioorthoganol moieties are incorporated using telomerase based incorporation. These bioorthogonol moieties are non-native, non-perturbing chemical handles possessing unique chemical functionality that can be modified through highly selective reactions. Examples of such moieties includes, but is not limited to hyrazide and aminooxy derivatives, azides that can be selectively modified with phosphines (Staudinger ligation), azides that can be selectively modified with activated alkynes, and azides that can be selectively modified with terminal alkynes (âclickâ chemistry). The nucleic acids in which such bioorthoganol moieties can be incorporated into include, but are not limited to, DNA, RNA and oligonuceotides.
In certain embodiments the isothermal DNA amplification technology using Helicase Dependent amplification is used to incorporate bioorthoganol moieties into a nucleic acid. Examples of such Helicase Dependent amplification include:
In certain embodiments the isothermal DNA amplification technology Strand Displacement Amplification (SDA) is used to incorporate bioorthoganol moieties into a nucleic acid. In SDA a primer contains a restriction site is annealed to template. Amplification primers are then annealed to 5Ⲡadjacent sequences (form a nick) and start amplification at a fixed temperature. Newly synthesized DNA are nicked by a restriction enzyme, polymerase starts amplification again, displacing the newly synthesized strands. 109 copies of DNA can be made in one reaction.
In certain embodiments the isothermal DNA amplification technology Loop mediated Isothermal DNA amplification is used to incorporate bioorthoganol moieties into a nucleic acid. Loop-mediated Isothermal Amplification (LAMP) uses 4 primers, which recognize 6 distinct regions on the target gene and a DNA polymerase with strand displacement activity to carry out reaction under isothermal condition. Amplification and detection of gene can be completed in a single step, by incubating the mixture of samples, primers, DNA polymerase with strand displacement activity and substrate at a constant temperature between 60-65° C. It provides high amplification efficiency, with DNA being amplified 109-1010 times in 15-60 minutes. Because of its high specificity, the presence of amplified product can indicate the presence of target gene. LAMP also uses Bst DNA polymerase.
In certain embodiments, rolling circle DNA amplification/Phi29 based DNA whole genome (or partial genome) amplification is used to incorporate bioorthoganol moieties into a nucleic acid. This method uses phi 29 DNA polymerase and can amplify DNA (Linear or circular) with high fidelity and efficiency. Such amplification methods can be use for the preparation of DNA probes from in situ hybridizations.
Nucleic acid polymers containing at least one nucleotide analogue may be alternatively be prepared by any of a variety of methods well known in the art including synthetic and enzymatic methods (J. Sambrook et al., âMolecular Cloning: A Laboratory Manualâ, 1989, 2nd Ed., Cold Spring Harbour Laboratory Press: New York, N.Y.; âPCR Protocols: A Guide to Methods and Applicationsâ, 1990, M. A. Innis (Ed.), Academic Press: New York, N.Y.; P. Tijssen âHybridization with Nucleic Acid ProbesâLaboratory Techniques in Biochemistry and Molecular Biology (Parts I and II)â, 1993, Elsevier Science; âPCR Strategiesâ, 1995, M. A. Innis (Ed.), Academic Press: New York, N.Y.; and âShort Protocols in Molecular Biologyâ, 2002, F. M. Ausubel (Ed.), 5th Ed., John Wiley & Sons: Secaucus, N.J.).
Nucleic acids used in the methods described herein may be prepared using automated, solid-phase procedure based on the phosphoramidite approach. In such a method, each nucleotide (including nucleotide analogues) is individually added to the 5â˛-end of the growing polynucleotide chain, which is attached at the 3â˛-end to a solid support. The added nucleotides are in the form of trivalent 3â˛-phosphoramidites that are protected from polymerization by a dimethoxytriyl (or DMT) group at the 5â˛-position. After base-induced phosphoramidite coupling, mild oxidation to give a pentavalent phosphotriester intermediate, DMT removal provides a new site for polynucleotide elongation. The nucleic acid polymers are then cleaved off the solid support, and the phosphodiester and exocyclic amino groups are deprotected with ammonium hydroxide. These syntheses may be performed on oligo synthesizers such as those commercially available from Perkin Elmer/Applied Biosystems, Inc (Foster City, Calif.), DuPont (Wilmington, Del.) or Milligen (Bedford, Mass.).
As will be appreciated by one of ordinary skill in the art, nucleic acid polymers of the described herein may be prepared either by a pre-synthetic modification method (i.e., incorporation of nucleotides analogues into the nucleic acid molecule) or a post-synthetic modification method (i.e., modification of naturally occurring nucleotides to nucleotide analogues in the nucleic acid molecule). Alternatively, nucleotide analogues can be incorporated into the DNA of cells or living systems by DNA replication, or into RNA by reaction, as described below.
Thus, in certain embodiments are provided methods for making modified nucleic acid polymers and the polymers themselves.
In one aspect is a method for making an azido, alkyne or phosphine modified nucleic acid polymer, wherein the method comprises:
Isolation or purification of the nucleic acid polymers of the present invention, where necessary, may be carried out by any of a variety of methods well-known in the art. Purification of nucleic acid polymers is typically performed either by native acrylamide gel electrophoresis, agarose electrophoresis or by size exclusion or by anion-exchange HPLC as described, for example by J. D. Pearson and F. E. Regnier (J. Chrom., 1983, 255: 137-149) or by reverse phase HPLC (G. D. McFarland and P. N. Borer, Nucleic Acids Res., 1979, 7: 1067-1080).
If desired, the sequence of synthetic nucleic acid polymers can be verified using any suitable sequencing method including, but not limited to, chemical degradation (A. M. Maxam and W. Gilbert, Methods of Enzymology, 1980, 65: 499-560), matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry (U. Pieles et al., Nucleic Acids Res., 1993, 21: 3191-3196), mass spectrometry following alkaline phosphatase and exonuclease digestions (H. Wu and H. Aboleneen, Anal. Biochem., 2001, 290: 347-352), and the like.
Provided herein are methods and compositions for detection, isolation and/or analysis of labeled nucleic acids facilitated by the incorporation of nucleotides comprising azide moieties, alkyne moieties, or phosphine moieties. In particular, presented are a novel methods for A) amplification methods for incorporating a nucleotide comprising an azide moiety into a nucleic acid, B) labeling such azido modified nucleic acids in solution followed by separation using methods known in the art for separating nucleic acids, C) labeling immobilized modified nucleic acids and D) novel methods for telomerase based assays using such modified nucleic acids. In addition, these azide, activated alkyne or phosphine modified nucleic acids can form conjugates with reporter molecules, carrier molecules and/or solid supports using methods provided herein. The reporter molecules can include, but are not limited to labels, while the solid supports can include, but are not limited to, solid support resins, microtiter plates and microarray slides. The carrier molecules can include, but are not limited to, affinity tags, nucleotides, oligonucleotides and polymers. In certain embodiments, the nucleic acids are modified with alkyne containing nucleotides, and in other embodiments, the nucleic acids are modified with phosphine containing nucleotides.
Nucleoside analogues (or nucleotide analogues) suitable for use in the methods described herein include any nucleoside analogue (or nucleotide analogue), as defined herein, that contains a reactive bioorthoganol moiety that can undergo a [3+2] cycloaddition or Staudinger ligation. In some embodiments, the reactive bioorthoganol moiety is carried by the base of the nucleoside (or nucleotide). The base carrying the reactive bioorthoganol moiety can be a purine (e.g., adenine or guanine) or a pyrimidine (e.g., cytosine, uracil or thymine). In certain embodiments, the base is uracil; in some such embodiments, uracil carries the reactive bioorthoganol moiety on the 5-position. In certain embodiments, the base is adenine; in some such embodiments, adenine carries the reactive bioorthoganol moiety. In certain embodiments, the bioorthoganol moiety is indirectly attached to the base, while in other embodiments the bioorthoganol moiety is directly covalently attached to the base. Non-limiting examples of the nucleoside analogues that may be used in the methods described herein include 5-ethynyl-2Ⲡdeoxyuracil (also termed herein ethynyluracil or EdU) and 5-azido-2â˛-deoxyuracil (also termed herein azidouracil or AdU) as well as their triphosphate and phosphoramidite forms. EdU can be synthesized essentially as described by C.-S. Yu and F. Oberdorfer, Synlett, 2000, 1: 86-88; and AdU can be synthesized using a method similar to that described in P. Sunthankar et al., Anal. Biochem., 1998, 258: 195-201 to synthesize azido-dUMP. EdU is also commercially available from Berry and Associates, Inc. (Dexter, Mich.).
In certain embodiments, the reactive bioorthoganol moiety is carried by the sugar (ribose and deoxyribose) of the nucleoside (or nucleotide). In certain embodiments, the bioorthoganol moiety is indirectly attached to the sugar, while in other embodiments the bioorthoganol moiety is directly covalently attached to the sugar. In certain embodiments, the nucleotide is a nucleotide monophosphate with the reactive bioorthogal moiety attached to the phosphate moiety. In certain embodiments, the nucleotide is a nucleotide diphosphate with the reactive bioorthoganol moiety attached to the terminal phosphate moiety. In certain embodiments, the nucleotide is a nucleotide triphosphate with the reactive bioorthoganol moiety attached to the terminal phosphate moiety. The sugar carrying the reactive bioorthoganol moiety can covalently attached to a purine (e.g., adenine or guanine) or a pyrimidine (e.g., cytosine, uracil or thymine). In certain embodiments, the base is uracil, while in other embodiments the base is adenine. Non-limiting examples of the nucleotide triphosphate analogues that may be used in the methods described herein (see FIG. 1) include N3-dATP (azide-dATP), N3-dUTP(azide-dUTP), N3-dTTP, N3-dGTP, N3-dCTP, E-dATP (ethynyl-dATP) and E-dUTP (ethynyl-dUTP), E-dGTP, E-dCTP, E-dTTP.
The reactive bioorthoganol moiety can be a 1,3-dipole such as a nitrile oxide, an azide, a diazomethane, a nitrone or a nitrile imine. In certain embodiments, the 1,3-dipole is an azide. Alternatively, the reactive bioorthoganol moiety can be a dipolarophile such as an alkene (e.g., vinyl, propylenyl, and the like) or an alkyne (e.g., ethynyl, propynyl, and the like). In certain embodiments, the dipolarophile is an alkyne, such as, for example, an ethynyl group.
The nucleic acids that can be chemically modified using the methods described herein contain azide moieties, alkyne moieties or phosphine moieties that are incorporated into nucleic acids using various amplification techniques utilizing nucleobases that contain azide moieties, alkyne moieties or phosphine moieties. Such nucleobases have been chemical synthesized as described herein. These azide moieties, alkyne moieties and phosphine moieties are non-native, non-perturbing bioorthogonol chemical moieties that possess unique chemical functionality that can be modified through highly selective reactions. Non-limiting examples of such reactions used in the methods described herein are shown in FIG. 2, wherein the chemical labeling of nucleic acids that contain azide moieties or alkyne moieties utilize Copper(I)-catalyzed Azide-Alkyne Cycloaddition, also referred to herein as âclickâ chemistry, the chemical labeling of nucleic acids that contain azide moieties or phosphine moieties utilize Staudinger ligation, and the chemical labeling of nucleic acids that contain activated-alkyne moieties or activated-alkyne reactive moieties.
Azides and terminal or internal alkynes can undergo a 1,3-dipolar cycloaddition (Huisgen cycloaddition) reaction to give a 1,2,3-triazole. However, this reaction requires long reaction times and elevated temperatures. Alternatively, azides and terminal alkynes can undergo Copper(I)-catalyzed Azide-Alkyne Cycloaddition (CuAAC) at room temperature. Such copper(I)-catalyzed azide-alkyne cycloadditions, also known as âclickâ chemistry, is a variant of the Huisgen 1,3-dipolar cycloaddition wherein organic azides and terminal alkynes react to give 1,4-regioisomers of 1,2,3-triazoles. Examples of âclickâ chemistry reactions are described by Sharpless et al. (U.S. Patent Application Publication No. 20050222427, published Oct. 6, 2005, PCT/US03/17311; Lewis W G, et al., Angewandte Chemie-Int'l Ed. 41 (6): 1053; method reviewed in Kolb, H. C., et al., Angew. Chem. Inst. Ed. 2001, 40:2004-2021), which developed reagents that react with each other in high yield and with few side reactions in a heteroatom linkage (as opposed to carbon-carbon bonds) in order to create libraries of chemical compounds. As described herein, âclickâ chemistry is used in the methods for labeling nucleic acids.
The copper used as a catalyst for the âclick chemistry reaction used in the methods described herein to conjugate a label (reporter group, solid support or carrier molecule) to a nucleic acid is in the Cu (I) reduction state. The sources of copper(I) used in such copper(I)-catalyzed azide-alkyne cycloadditions can be any cuprous salt including, but not limited to, cuprous halides such as cuprous bromide or cuprous iodide. However, this regioselective cycloaddition can also be conducted in the presence of a metal catalyst and a reducing agent. In certain embodiments, copper can be provided in the Cu (II) reduction state (for example, as a salt, such as but not limited to Cu(NO3)2 Cu(OAc)2 or CuSO4), in the presence of a reducing agent wherein Cu(I) is formed in situ by the reduction of Cu(II). Such reducing agents include, but are not limited to, ascorbate, Tris(2-Carboxyethyl) Phosphine (TCEP), 2,4,6-trichlorophenol (TCP), NADH, NADPH, thiosulfate, metallic copper, quinone, hydroquinone, vitamin K1, glutathione, cysteine, 2-mercaptoethanol, dithiothreitol, Fe2+, Co2+, or an applied electric potential. In other embodiments, the reducing agents include metals selected from Al, Be, Co, Cr, Fe, Mg, Mn, Ni, Zn, Au, Ag, Hg, Cd, Zr, Ru, Fe, Co, Pt, Pd, Ni, Rh, and W.
The copper(I)-catalyzed azide-alkyne cycloadditions for labeling nucleic acids can be performed in water and a variety of solvents, including mixtures of water and a variety of (partially) miscible organic solvents including alcohols, dimethyl sulfoxide (DMSO), dimethyl formamide (DMF), tert-butanol (tBuOH) and acetone.
Without limitation to any particular mechanism, copper in the Cu (I) state is a preferred catalyst for the copper(I)-catalyzed azide-alkyne cycloadditions, or âclickâ chemistry reactions, used in the methods described herein. Certain metal ions are unstable in aqueous solvents, by way of example Cu(I), therefore stabilizing ligands/chelators can be used to improve the reaction. In certain embodiments at least one copper chelator is used in the methods described herein, wherein such chelators binds copper in the Cu (I) state. In certain embodiments at least one copper chelator is used in the methods described herein, wherein such chelators binds copper in the Cu (II) state. In certain embodiments, the copper (I) chelator is a 1,10 phenanthroline-containing copper (I) chelator. Non-limiting examples of such phenanthroline-containing copper (I) chelators include, but are not limited to, bathophenanthroline disulfonic acid (4,7-diphenyl-1,10-phenanthroline disulfonic acid) and bathocuproine disulfonic acid (BCS; 2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline disulfonate). Other chelators used in such methods include, but are not limited to, N-(2-acetamido)iminodiacetic acid (ADA), pyridine-2,6-dicarboxylic acid (PDA), S-carboxymethyl-L-cysteine (SCMC), trientine, tetra-ethylenepolyamine (TEPA), NNNN-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN), EDTA, neocuproine, N-(2-acetamido)iminodiacetic acid (ADA), pyridine-2,6-dicarboxylic acid (PDA), S-carboxymethyl-L-cysteine (SCMC), tris-(benzyl-triazolylmethyl)amine (TBTA), or a derivative thereof. Most metal chelators, a wide variety of which are known in the chemical, biochemical, and medical arts, are known to chelate several metals, and thus metal chelators in general can be tested for their function in 1,3 cycloaddition reactions catatlyzed by copper. In certain embodiments, histidine is used as a chelator, while in other embodiments glutathione is used as a chelator and a reducing agent.
The concentration of the reducing agents used in the âclickâ chemistry reaction described herein can be in the micromolar to millimolar range. In certain embodiments the concentration of the reducing agent is from about 100 micromolar to about 100 millimolar. In other embodiments the concentration of the reducing agent is from about 10 micromolar to about 10 millimolar. In other embodiments the concentration of the reducing agent is from about 1 micromolar to about 1 millimolar.
In certain embodiments, the methods describe herein for labeling nucleic acids using âclickâ chemistry, at least one copper chelator is added after copper(II) used in the reaction has been contacted with a reducing agent. In other embodiments, at least one copper chelator can be added immediately after contacting copper(II) with a reducing agent. In other embodiments, the copper chelator(s) is added between about five seconds and about twenty-four hours after copper(II) and a reducing agent have been combined in a reaction mixture. In other embodiments, at least one copper chelator can be added any time to a reaction mixture that includes copper(II) and a reducing agent, such as, by way of example only, immediately after contacting copper(II) and a reducing agent, or within about five minutes of contacting copper(II) and a reducing agent in the reaction mixture. In some embodiments, at least one copper chelator can be added between about five seconds and about one hour, between about one minute and about thirty minutes, between about five minutes and about one hour, between about thirty minutes and about two hours, between about one hour and about twenty-four hours, between about one hour and about five hours, between about two hours and about eight hours, after copper(II) and a reducing agent have been combined for use in a reaction mixture.
In other embodiments, one or more copper chelators can be added more than once to such âclickâ chemistry reactions. In embodiments in which more than one copper chelator is added to a reaction, two or more of the copper chelators can bind copper in the Cu (I) state or, one or more of the copper chelators can bind copper in the Cu (I) state and one or more additional chelators can bind copper in the Cu (II) state. In certain embodiments, one or more copper chelators can be added after the initial addition of a copper chelator to the âclickâ chemistry reaction. In certain embodiments, the one or more copper chelators added after the initial addition of a copper chelator to the reaction can be the same or different from a copper chelator added at an earlier time to the reaction.
The concentration of a copper chelator used in the âclickâ chemistry reaction described herein can be determined and optimized using methods well known in the art, including those disclosed herein using âclickâ chemistry to label nucleic acids followed by detecting such labeled nucleic acids to determine the efficiency of the labeling reaction and the integrity of the labeled nucleic acid(s). In certain embodiments, the chelator concentrations used in the methods described herein is in the micromolar to millimolar range, by way of example only, from 1 micromolar to 100 millimolar. In certain embodiments the chelator concentration is from about 10 micromolar to about 10 millimolar. In other embodiments the chelator concentration is from about 50 micromolar to about 10 millimolar. In other embodiments the chelator, can be provided in a solution that includes a water miscible solvent such as, alcohols, dimethyl sulfoxide (DMSO), dimethyl formamide (DMF), tert-butanol (tBuOH) and acetone. In other embodiments the chelator, can be provided in a solution that includes a solvent such as, for example, dimethyl sulfoxide (DMSO) or dimethylformamide (DMF).
In certain embodiments of the methods for labeling nucleic acids utilizing âclickâ chemistry described herein, the nucleic acid can possess an azide moiety, whereupon the label possesses an alkyne moiety, whereas in other embodiments the nucleic acid can possess an alkyne moiety, and the label possesses an azide moiety.
In certain embodiments are provided methods for forming a modified nucleic acid polymer conjugate, wherein the method comprises:
incorporating an azide modified nucleotide into the nucleic acid polymer by contacting the azide modified nucleotide nucleotide with at least one other nucleotide in the presence of a DNA amplification enzyme to form an azide modified nucleic acid polymer; and
contacting the azide modified nucleic acid polymer with a reporter molecule, carrier molecule or solid support that comprises an activated or terminal alkyne or phosphine moiety to form a nucleic acid polymer-reporter molecule, carrier molecule, solid support conjugate.
In an alternative embodiment are provided methods for forming a modified nucleic acid polymer conjugate, wherein the method comprises:
incorporating a terminal alkyne modified nucleotide into the nucleic acid polymer by contacting the terminal alkyne modified nucleotide with at least one other nucleotide in the presence of a DNA amplification enzyme to form a terminal alkyne modified nucleic acid polymer; and
contacting the terminal alkyne modified nucleic acid polymer with a reporter molecule, carrier molecule or solid support that comprises an azido moiety to form a nucleic acid polymer-reporter molecule, carrier molecule, solid support conjugate.
The Staudinger reaction, which involves reaction between trivalent phosphorous compounds and organic azides (Staudinger et al. Helv. Chim. Acta 1919, 2, 635), has been used for a multitude of applications. (Gololobov et al. Tetrahedron 1980, 37, 437); (Gololobov et al. Tetrahedron 1992, 48, 1353). There are almost no restrictions on the nature of the two reactants. The Staudinger ligation is a modification of the Staudinger reaction in which an electrophilic trap (usually a methyl ester) is placed on a triaryl phosphine. In the Staudinger ligation, the aza-ylide intermediate rearranges, in aqueous media, to produce an amide linkage and the phosphine oxide, ligating the two molecules together, whereas in the Staudinger reaction the two products are not covalently linked after hydrolysis. Such ligations have been described in U.S. Patent Application No. 20060276658. In certain embodiments, the phosphine can have a neighboring acyl group such as an ester, thioester or N-acyl imidazole (i.e. a phosphinoester, phosphinothioester, phosphinoimidazole) to trap the aza-ylide intermediate and form a stable amide bond upon hydrolysis. In certain embodiments, the phosphine can be a di- or triarylphosphine to stabilize the phosphine. The phosphines used in the Staudinger ligation methods described herein to conjugate a label to a nucleic acid include, but are not limited to, cyclic or acyclic, halogenated, bisphosphorus, or even polymeric. Similarly, the azides can be alkyl, aryl, acyl or phosphoryl. In certain embodiments, such ligations are carried out under oxygen-free anhydrous conditions.
In certain embodiments of the methods for labeling nucleic acid utilizing Staudinger ligation described herein, the nucleic acid can possess an azide moiety, whereupon the label possesses a phosphine moiety, whereas in other embodiments the nucleic acid can possess a phosphine moiety, and the label possesses an azide moiety.
In certain embodiments are provided methods for forming a modified nucleic acid polymer conjugate, wherein the methods comprises:
incorporating a phosphine modified nucleotide into the nucleic acid polymer by contacting the phosphine modified nucleotide nucleotide with at least one other nucleotide in the presence of a DNA amplification enzyme to form a phosphine modified nucleic acid polymer; and
contacting the phosphine modified nucleic acid polymer with a reporter molecule, carrier molecule or solid support that comprises an azido moiety to form a nucleic acid polymer-reporter molecule, carrier molecule, solid support conjugate.
Azides and alkynes can undergo catalyst-free [3+2] cycloaddition by a using the reaction of activated alkynes with azides. Such catalyst free [3+2] cycloaddition can be used in methods described herein to conjugate a label (reporter molecule, solid support or carrier molecule) to a nucleic acid. Alkynes can be activated by ring strain such as, by way of example only, eight membered ring structures, appending electron-withdrawing groups to such alkyne rings, or alkynes can be activated by the addition of a Lewis acid such as, by way of example only, Au(I) or Au(III).
In certain embodiments of the methods for labeling nucleic acids utilizing activated alkynes described herein, the nucleic acid can possess an azide moiety, whereupon the label possesses an activated alkyne moiety, whereas in other embodiments the nucleic acid can possess an activated alkyne moiety, and the label possesses an azide moiety.
After nucleic acids have been modified with azide moieties, alkyne moieties or phosphine moieties, they can be reacted under appropriate conditions to form conjugates with reporter molecules, solid supports or carrier molecules. In the methods and compositions described herein the azide moiety, alkyne moiety or phosphine moiety is used as a reactive functional group or chemical handle on the modified nucleic acid wherein an azide reactive moiety on a reporter molecule, a solid support or a carrier molecule, or an alkyne reactive moiety on a reporter molecule, a solid support or a carrier molecule, or a phosphine reactive moiety on a reporter molecule, a solid support or a carrier molecule is reacted with the modified nucleic acid to form a covalent conjugate comprising the nucleic acid and at least one reporter molecule, at least one solid support and/or at least one carrier molecule.
In certain embodiments, two azide-reactive groups are used to label nucleic acids: the first is an alkyne moiety used in a âclickâ chemistry reaction, and the second is a phosphine, such as a triarylphosphine, used in a Staudinger ligation. In one embodiment, âclickâ chemistry is utilized to form a conjugate with a nucleic acid polymer containing an azide moiety and a reporter molecule, solid support or carrier molecule, wherein the reporter molecule, solid support and carrier molecule contain an alkyne moiety. In another embodiment, âclickâ chemistry is utilized to form a conjugate with a nucleic acid polymer containing an alkyne moiety and a reporter molecule, solid support and/or carrier molecule, wherein the reporter molecule, solid support and carrier molecule contain an azide moiety. In another embodiment, a Staudinger ligation is utilized to form a conjugate with a nucleic acid polymer containing an azide moiety and a reporter molecule, solid support and/or carrier molecule, wherein the reporter molecule, solid support and carrier molecule contain an triaryl phosphine moiety. In another embodiment, a Staudinger ligation is utilized to form a conjugate with a nucleic acid polymer containing a triaryl phosphine moiety and a reporter molecule, solid support and/or carrier molecule, wherein the reporter molecule, solid support and carrier molecule contain an azide moiety. The methods described herein are not intended to be limited to these two azide-reactive groups, or chemical reactions, but it is envisioned that any chemical reaction utilizing an azide-reactive group attached to a reporter molecule, solid support or carrier molecule can be used with the azide, alkyne or phosphine modified nucleic acid polymers described herein.
In certain embodiments are provided methods for forming a modified nucleic acid polymer conjugate, wherein the method comprises:
incorporating an azide modified nucleotide into the nucleic acid polymer by contacting the azide modified nucleotide nucleotide with at least one other nucleotide in the presence of a DNA amplification enzyme to form an azide modified nucleic acid polymer; and
contacting the azide modified nucleic acid polymer with a reporter molecule, carrier molecule or solid support that comprises an activated or terminal alkyne or phosphine moiety to form a nucleic acid polymer-reporter molecule, carrier molecule, solid support conjugate.
In an alternative embodiment are provided methods for forming a modified nucleic acid polymer conjugate, wherein the method comprises:
incorporating a terminal alkyne modified nucleotide into the nucleic acid polymer by contacting the terminal alkyne modified nucleotide with at least one other nucleotide in the presence of a DNA amplification enzyme to form a terminal alkyne modified nucleic acid polymer; and
contacting the terminal alkyne modified nucleic acid polymer with a reporter molecule, carrier molecule or solid support that comprises an azido moiety to form a nucleic acid polymer-reporter molecule, carrier molecule, solid support conjugate.
The methods, as described herein, that utilize cycloaddition reactions to label nucleic acids can be carried out at room temperature in aqueous conditions with excellent regioselectivity by the addition of catalytic amounts of Cu(I) salts to the reaction mixture. See, e.g., Tomoe, et al., (2002) Org. Chem. 67:3057-3064; and, Rostovtsev, et al., (2002) Angew. Chem. Int. Ed. 41:2596-2599. The resulting five-membered ring resulting from âclickâ chemistry cycloaddition is not generally reversible in reducing environments and is stable against hydrolysis for extended periods in aqueous environments. Thus, nucleic acids attached to a labeling agent, a detection agent, a reporter molecule, a solid support or a carrier molecule via such five-membered ring are stable.
The reporter molecules, solid supports and carrier molecules used in the methods and compositions described herein, can contain at least one alkyne moiety or at least one phosphine moiety capable of reacting with an azide moiety. The reporter molecules, solid supports and carrier molecules used in the methods and compositions described herein, can contain at least one azide moiety capable of reacting with an alkyne moiety or a phosphine moiety. The reporter molecules, solid supports and carrier molecules used in the methods and compositions described herein, can contain at least one phosphine moiety capable of reacting with an azide moiety. In certain embodiments, the phosphine moieties of the reporter molecules solid supports and carrier molecules described herein are triarylphosphine moieties.
In certain embodiments, the reporter molecules used in the methods and compositions described herein can include, but are not limited to labels, while the solid supports can include, but are not limited to, solid support resins, microtiter plates and microarray slides. The carrier molecules can include, but are not limited to, affinity tags, nucleotides, oligonucleotides and polymers.
The reporter molecules used in the methods and compositions provided herein include any directly or indirectly detectable reporter molecule known by one skilled in the art that can be covalently attached to a modified nucleic acid described herein. In certain embodiments, the reporter molecules used in the methods and compositions provided herein include any directly or indirectly detectable reporter molecule known by one skilled in the art that can be covalently attached to an azide modified nucleic acid, an alkyne modified nucleic acid or a phosphine modified nucleic acid.
Reporter molecules used in the methods and compositions described herein can contain, but are not limited to, a chromophore, a fluorophore, a fluorescent protein, a phosphorescent dye, a tandem dye, a particle, a hapten, an enzyme and a radioisotope. In certain embodiments, such reporter molecules include fluorophores, fluorescent proteins, haptens, and enzymes.
A fluorophore used in reporter molecule in the methods and compositions described herein, can contain one or more aromatic or heteroaromatic rings, that are optionally substituted one or more times by a variety of substituents, including without limitation, halogen, nitro, cyano, alkyl, perfluoroalkyl, alkoxy, alkenyl, alkynyl, cycloalkyl, arylalkyl, acyl, aryl or heteroaryl ring system, benzo, or other substituents typically present on fluorophores known in the art.
A fluorophore used in reporter molecule in the methods and compositions described herein, is any chemical moiety that exhibits an absorption maximum at wavelengths greater than 280 nm, and retains its spectral properties when covalently attached to a modified nucleotide such as, by way of example only, an azide, and alkyne or a phosphine. Fluorophores used as in reporter molecule in the methods and compositions described herein include, without limitation; a pyrene (including any of the corresponding derivative compounds disclosed in U.S. Pat. No. 5,132,432), an anthracene, a naphthalene, an acridine, a stilbene, an indole or benzindole, an oxazole or benzoxazole, a thiazole or benzothiazole, a 4-amino-7-nitrobenz-2-oxa-1,3-diazole (NBD), a cyanine (including any corresponding compounds in U.S. Ser. Nos. 09/968,401 and 09/969,853), a carbocyanine (including any corresponding compounds in U.S. Ser. Nos. 09/557,275; 09/969,853 and 09/968,401; U.S. Pat. Nos. 4,981,977; 5,268,486; 5,569,587; 5,569,766; 5,486,616; 5,627,027; 5,808,044; 5,877,310; 6,002,003; 6,004,536; 6,008,373; 6,043,025; 6,127,134; 6,130,094; 6,133,445; and publications WO 02/26891, WO 97/40104, WO 99/51702, WO 01/21624; EP 1 065 250 A1), a carbostyryl, a porphyrin, a salicylate, an anthranilate, an azulene, a perylene, a pyridine, a quinoline, a borapolyazaindacene (including any corresponding compounds disclosed in U.S. Pat. Nos. 4,774,339; 5,187,288; 5,248,782; 5,274,113; and 5,433,896), a xanthene (including any corresponding compounds disclosed in U.S. Pat. Nos. 6,162,931; 6,130,101; 6,229,055; 6,339,392; 5,451,343 and U.S. Ser. No. 09/922,333), an oxazine (including any corresponding compounds disclosed in U.S. Pat. No. 4,714,763) or a benzoxazine, a carbazine (including any corresponding compounds disclosed in U.S. Pat. No. 4,810,636), a phenalenone, a coumarin (including an corresponding compounds disclosed in U.S. Pat. Nos. 5,696,157; 5,459,276; 5,501,980 and 5,830,912), a benzofuran (including an corresponding compounds disclosed in U.S. Pat. Nos. 4,603,209 and 4,849,362) and benzphenalenone (including any corresponding compounds disclosed in U.S. Pat. No. 4,812,409) and derivatives thereof. As used herein, oxazines include resorufins (including any corresponding compounds disclosed in U.S. Pat. No. 5,242,805), aminooxazinones, diaminooxazines, and their benzo-substituted analogs.
Xanthene type fluorophores used in reporter molecule in the methods and compositions described herein include, but are not limited to, a fluorescein, a rhodol (including any corresponding compounds disclosed in U.S. Pat. Nos. 5,227,487 and 5,442,045), or a rhodamine (including any corresponding compounds in U.S. Pat. Nos. 5,798,276; 5,846,737; U.S. Ser. No. 09/129,015). As used herein, fluorescein includes benzo- or dibenzofluoresceins, seminaphthofluoresceins, or naphthofluoresceins. Similarly, as used herein rhodol includes seminaphthorhodafluors (including any corresponding compounds disclosed in U.S. Pat. No. 4,945,171). In certain embodiments, the fluorophore is a xanthene that is bound via a linkage that is a single covalent bond at the 9-position of the xanthene. In other embodiments, the xanthenes include derivatives of 3H-xanthen-6-ol-3-one attached at the 9-position, derivatives of 6-amino-3H-xanthen-3-one attached at the 9-position, or derivatives of 6-amino-3H-xanthen-3-imine attached at the 9-position.
In certain embodiments, the fluorophores used in reporter molecules in the methods and compositions described herein include xanthene (rhodol, rhodamine, fluorescein and derivatives thereof) coumarin, cyanine, pyrene, oxazine and borapolyazaindacene. In other embodiments, such fluorophores are sulfonated xanthenes, fluorinated xanthenes, sulfonated coumarins, fluorinated coumarins and sulfonated cyanines
Non-limiting examples of the fluorophores used in reporter molecules in the methods and compositions described herein are shown in FIG. 3, wherein such fluorphores have been modified with azide moieties, alkyne moieties or phosphine moieties. In certain embodiments, the such fluorphores used in âclickâ chemistry reactions form triazole products wherein the conjugate does not requires UV excitation and any quenching effect due to conjugation of azido or alkyne groups to the fluorescent Ď-system is overcome.
The choice of the fluorophore attached to the modified nucleic acid will determine the absorption and fluorescence emission properties of the modified nucleic acid. Physical properties of a fluorophore label that can be used for detection of modified nucleic acids include, but are not limited to, spectral characteristics (absorption, emission and stokes shift), fluorescence intensity, lifetime, polarization and photo-bleaching rate, or combination thereof. All of these physical properties can be used to distinguish one fluorophore from another, and thereby allow for multiplexed analysis. In certain embodiments, the fluorophore has an absorption maximum at wavelengths greater than 480 nm. In other embodiments, the fluorophore absorbs at or near 488 nm to 514 nm (particularly suitable for excitation by the output of the argon-ion laser excitation source) or near 546 nm (particularly suitable for excitation by a mercury arc lamp). In other embodiment a fluorophore can emit in the NIR (near infra red region) for tissue or whole organism applications.
Many of fluorophores can also function as chromophores and thus the described fluorophores are also chromophores used in reporter molecules in the methods and compositions described herein.
In addition to fluorophores, enzymes also find use as labels for the detection reagents/reporter molecules used in the methods and compositions described herein. Enzymes are desirable labels because amplification of the detectable signal can be obtained resulting in increased assay sensitivity. The enzyme itself does not produce a detectable response but functions to break down a substrate when it is contacted by an appropriate substrate such that the converted substrate produces a fluorescent, colorimetric or luminescent signal. Enzymes amplify the detectable signal because one enzyme on a labeling reagent can result in multiple substrates being converted to a detectable signal. This is advantageous where there is a low quantity of target present in the sample or a fluorophore does not exist that will give comparable or stronger signal than the enzyme. However, fluorophores are most preferred because they do not require additional assay steps and thus reduce the overall time required to complete an assay. The enzyme substrate is selected to yield the preferred measurable product, e.g. colorimetric, fluorescent or chemiluminescence. Such substrates are extensively used in the art, many of which are described in the MOLECULAR PROBES HANDBOOK, supra.
In certain embodiments, colorimetric or fluorogenic substrate and enzyme combination use oxidoreductases such as, by way of example only, horseradish peroxidase and a substrate such as, by way of example only, 3,3â˛-diaminobenzidine (DAB) or 3-amino-9-ethylcarbazole (AEC), which yield a distinguishing color (brown and red, respectively). Other colorimetric oxidoreductase substrates used with the enzymatic reporter molecules described herein include, but are not limited to: 2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), o-phenylenediamine (OPD), 3,3â˛,5,5â˛-tetramethylbenzidine (TMB), o-dianisidine, 5-aminosalicylic acid, 4-chloro-1-naphthol. Fluorogenic substrates used with the enzymatic reporter molecules described herein include, but are not limited to, homovanillic acid or 4-hydroxy-3-methoxyphenylacetic acid, reduced phenoxazines and reduced benzothiazines, including AmplexÂŽ Red reagent and its variants (U.S. Pat. No. 4,384,042), Amplex UltraRed and its variants in (WO05042504) and reduced dihydroxanthenes, including dihydrofluoresceins (U.S. Pat. No. 6,162,931) and dihydrorhodamines including dihydrorhodamine 123. Peroxidase substrates can be used with the enzymatic reporter molecules described herein. Such peroxide substrates include, but are not limited to, tyramides (U.S. Pat. Nos. 5,196,306; 5,583,001 and 5,731,158) which represent a unique class of peroxidase substrates in that they can be intrinsically detectable before action of the enzyme but are âfixed in placeâ by the action of a peroxidase in the process described as tyramide signal amplification (TSA). These substrates are extensively utilized to label targets in samples that are cells, tissues or arrays for their subsequent detection by microscopy, flow cytometry, optical scanning and fluorometry.
In other embodiments the colorimetric (and in some cases fluorogenic) substrates and enzymes combination used in reporter molecules described herein include a phosphatase enzyme such as, by way of example only, an acid phosphatase, an alkaline phosphatase or a recombinant version of such a phosphatase. A colorimetric substrate used in combination with such phosphatases include, but are not limited to, 5-bromo-6-chloro-3-indolyl phosphate (BCIP), 6-chloro-3-indolyl phosphate, 5-bromo-6-chloro-3-indolyl phosphate, p-nitrophenyl phosphate, or o-nitrophenyl phosphate or with a fluorogenic substrate such as 4-methylumbelliferyl phosphate, 6,8-difluoro-7-hydroxy-4-methylcoumarinyl phosphate (DiFMUP, U.S. Pat. No. 5,830,912), fluorescein diphosphate, 3-O-methylfluorescein phosphate, resorufin phosphate, 9H-(1,3-dichloro-9,9-dimethylacridin-2-one-7-yl) phosphate (DDAO phosphate), or ELF 97, ELF 39 or related phosphates (U.S. Pat. Nos. 5,316,906 and 5,443,986).
Other enzymes used in reporter molecules described herein include glycosidases, including, but not limited to, beta-galactosidase, beta-glucuronidase and beta-glucosidase. The colorimetric substrates used with such enzymes include, but are not limited to, 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside (X-gal) and similar indolyl galactosides, glucosides, and glucuronides, o-nitrophenyl beta-D-galactopyranoside (ONPG) and p-nitrophenyl beta-D-galactopyranoside. Preferred fluorogenic substrates include resorufin beta-D-galactopyranoside, fluorescein digalactoside (FDG), fluorescein diglucuronide and their structural variants (U.S. Pat. Nos. 5,208,148; 5,242,805; 5,362,628; 5,576,424 and 5,773,236), 4-methylumbelliferyl beta-D-galactopyranoside, carboxyumbelliferyl beta-D-galactopyranoside and fluorinated coumarin beta-D-galactopyranosides (U.S. Pat. No. 5,830,912).
Additional enzymes used in reporter molecules described herein include, but are not limited to, hydrolases such as cholinesterases and peptidases, oxidases such as glucose oxidase and cytochrome oxidases, and reductases for which suitable substrates are known.
Enzymes and their appropriate substrates that produce chemiluminescence can also be used in reporter molecules described herein. Such enzymes include, but are not limited to, natural and recombinant forms of luciferases and aequorins. In addition, the chemiluminescence-producing substrates for phosphatases, glycosidases and oxidases such as those containing stable dioxetanes, luminol, isoluminol and acridinium esters an also be used in reporter molecules described herein.
In addition to enzymes, haptens can be used in label/reporter molecules described herein. In certain embodiments, such haptens include hormones, naturally occurring and synthetic drugs, pollutants, allergens, affector molecules, growth factors, chemokines, cytokines, lymphokines, amino acids, peptides, chemical intermediates, nucleotides, digoxin, biotin and the like. Biotin is useful because it can function in an enzyme system to further amplify the detectable signal, and it can function as a tag to be used in affinity chromatography for isolation purposes. For detection purposes, an enzyme conjugate that has affinity for biotin is used, such as, by way of example only, avidin-Horse Radish Peroxidase (HRP). Subsequently a peroxidase substrate as described herein can be added to produce a detectable signal.
Fluorescent proteins can also be used in label/reporter molecules described herein for use in the methods, compositions and modified nucleic acids described herein. Non-limiting examples of such fluorescent proteins include green fluorescent protein (GFP) and the phycobiliproteins and the derivatives thereof. The fluorescent proteins, especially phycobiliprotein, are particularly useful for creating tandem dye labeled modified nucleic acids. These tandem dyes comprise a fluorescent protein and a fluorophore for the purposes of obtaining a larger stokes shift wherein the emission spectra is farther shifted from the wavelength of the fluorescent protein's absorption spectra. This is particularly advantageous for detecting a low quantity of a target in a sample wherein the emitted fluorescent light is maximally optimized, in other words little to none of the emitted light is reabsorbed by the fluorescent protein. The fluorescent protein and fluorophore function as an energy transfer pair wherein the fluorescent protein emits at the wavelength that the fluorophore absorbs and the fluorophore then emits at a wavelength farther from the fluorescent proteins emission wavelength than could have been obtained with only the fluorescent protein. A particularly useful combination is the phycobiliproteins disclosed in U.S. Pat. Nos. 4,520,110; 4,859,582; 5,055,556 and the sulforhodamine fluorophores disclosed in U.S. Pat. No. 5,798,276, or the sulfonated cyanine fluorophores disclosed in U.S. Ser. Nos. 09/968,401 and 09/969,853; or the sulfonated xanthene derivatives disclosed in U.S. Pat. No. 6,130,101 and those combinations disclosed in U.S. Pat. No. 4,542,104. Alternatively, the fluorophore functions as the energy donor and the fluorescent protein is the energy acceptor.
In the methods and compositions described herein the modified nucleic acids can be conjugated to a carrier molecule. In certain embodiments, the modified nucleic acids contain at least one alkyne moiety or at least one phosphine moiety capable of reacting with a carrier molecule containing an azide moiety. In other embodiments, the modified nucleic acids contain at least one azide moiety capable of reacting with a carrier molecule containing an alkyne moiety or a phosphine moiety. In other embodiments, the modified nucleic acids contain at least one phosphine moiety capable of reacting with a carrier molecule containing an azide moiety. In certain embodiments, the phosphine moieties of the modified nucleic acids and carrier molecules are triaryl phosphine moieties.
A variety of carrier molecules can be used in the methods and compositions described herein, including, but not limited to, antigens, steroids, vitamins, drugs, haptens, metabolites, toxins, environmental pollutants, amino acids, peptides, proteins, nucleic acids, nucleic acid polymers, carbohydrates, lipids, and polymers. In certain embodiments, the carrier molecule contain an amino acid, a peptide, a protein, a polysaccharide, a nucleoside, a nucleotide, an oligonucleotide, a nucleic acid, a hapten, a psoralen, a drug, a hormone, a lipid, a lipid assembly, a synthetic polymer, a polymeric microparticle, a biological cell, a virus or combinations thereof.
In other embodiments, the carrier molecule is selected from a hapten, a nucleotide, an oligonucleotide, a nucleic acid polymer, a protein, a peptide or a polysaccharide. In still other embodiments, the carrier molecule is an amino acid, a peptide, a protein, a polysaccharide, a nucleoside, a nucleotide, an oligonucleotide, a nucleic acid, a hapten, a psoralen, a drug, a hormone, a lipid, a lipid assembly, a tyramine, a synthetic polymer, a polymeric microparticle, a biological cell, cellular components, an ion chelating moiety, an enzymatic substrate or a virus. In further embodiments, the carrier molecule is an antibody or fragment thereof, an antigen, an avidin or streptavidin, a biotin, a dextran, an IgG binding protein, a fluorescent protein, agarose, and a non-biological microparticle.
In certain embodiments wherein the carrier molecule is an enzymatic substrate, the enzymatic substrate is selected from an amino acid, a peptide, a sugar, an alcohol, alkanoic acid, 4-guanidinobenzoic acid, a nucleic acid, a lipid, sulfate, phosphate, âCH2OCO-alkyl and combinations thereof. In certain embodiments, such enzyme substrates can be cleaved by enzymes selected from peptidases, phosphatases, glycosidases, dealkylases, esterases, guanidinobenzotases, sulfatases, lipases, peroxidases, histone deacetylases, exonucleases, reductases, endoglycoceramidases and endonucleases.
In other embodiments, the carrier molecule is an amino acid (including those that are protected or are substituted by phosphates, carbohydrates, or C1 to C22 carboxylic acids), or a polymer of amino acids such as a peptide or protein. In a related embodiment, the carrier molecule contains at least five amino acids, more preferably 5 to 36 amino acids. Such peptides include, but are not limited to, neuropeptides, cytokines, toxins, protease substrates, and protein kinase substrates. Other peptides may function as organelle localization peptides, that is, peptides that serve to target the conjugated compound for localization within a particular cellular substructure by cellular transport mechanisms, including, but not limited to, nuclear localization signal sequences. In certain embodiments, the protein carrier molecules include enzymes, antibodies, lectins, glycoproteins, histones, albumins, lipoproteins, avidin, streptavidin, protein A, protein G, phycobiliproteins and other fluorescent proteins, hormones, toxins and growth factors. In other embodiments, the protein carrier molecule is an antibody, an antibody fragment, avidin, streptavidin, a toxin, a lectin, or a growth factor. In further embodiments, the carrier molecules contain haptens including, but not limited to, biotin, digoxin, digoxigenin and fluorophores.
The carrier molecules used in the methods and composition described herein can also contain a nucleic acid base, nucleoside, nucleotide or a nucleic acid polymer, optionally containing an additional linker or spacer for attachment of a fluorophore or other ligand, such as an alkynyl linkage (U.S. Pat. No. 5,047,519), an aminoallyl linkage (U.S. Pat. No. 4,711,955) or other linkage. In other embodiments, the nucleotide carrier molecule is a nucleoside or a deoxynucleoside or a dideoxynucleoside, while in other embodiments, the carrier molecule contains a peptide nucleic acid (PNA) sequence or a locked nucleic acid (LNA) sequence. In certain embodiments, the nucleic acid polymer carrier molecules are single- or multi-stranded, natural or synthetic DNA or RNA oligonucleotides, or DNA/RNA hybrids, or incorporating an unusual linker such as morpholine derivatized phosphates (AntiVirals, Inc., Corvallis Oreg.), or peptide nucleic acids such as N-(2-aminoethyl)glycine units, where the nucleic acid contains fewer than 50 nucleotides, more typically fewer than 25 nucleotides.
The carrier molecules used in the methods and composition described herein can also contain a carbohydrate or polyol, including a polysaccharide, such as dextran, FICOLL, heparin, glycogen, amylopectin, mannan, inulin, starch, agarose and cellulose, or a polymer such as a poly(ethylene glycol). In certain embodiments, the polysaccharide carrier molecule includes dextran, agarose or FICOLL.
The carrier molecules used in the methods and composition described herein can also include a lipid including, but not limited to, glycolipids, phospholipids, and sphingolipids. In certain embodiments, such lipids contain 6-25 carbons. In other embodiments, the carrier molecules include a lipid vesicle, such as a liposome,
The carrier molecules used in the methods and composition described herein can also be a cell, cellular systems, cellular fragment, or subcellular particles, including virus particles, bacterial particles, virus components, biological cells (such as animal cells, plant cells, bacteria, or yeast), or cellular components. Non-limiting examples of such cellular components that are useful as carrier molecules in the methods and composition described herein include lysosomes, endosomes, cytoplasm, nuclei, histones, mitochondria, Golgi apparatus, endoplasmic reticulum and vacuoles.
The carrier molecules used in the methods and composition described herein can also non-covalently associates with organic or inorganic materials.
The carrier molecules used in the methods and composition described herein can also include a specific binding pair member wherein the nucleic acid can be conjugated to a specific binding pair member and used in the formation of a bound pair. In certain embodiments, the presence of a labeled specific binding pair member indicates the location of the complementary member of that specific binding pair; each specific binding pair member having an area on the surface or in a cavity which specifically binds to, and is complementary with, a particular spatial and polar organization of the other. In certain embodiments, the dye compounds (fluorophores or chromophores) described herein function as a reporter molecule for the specific binding pair. Exemplary binding pairs are set forth in Table 2.
| TABLE 2 |
| Representative Specific Binding Pairs |
| antigen | antibody | |
| biotin | avidin (or streptavidin or anti-biotin) | |
| IgG* | protein A or protein G | |
| drug | drug receptor | |
| folate | folate binding protein | |
| toxin | toxin receptor | |
| carbohydrate | lectin or carbohydrate receptor | |
| peptide | peptide receptor | |
| protein | protein receptor | |
| enzyme substrate | enzyme | |
| DNA (RNA) | cDNA (cRNA)â | |
| hormone | hormone receptor | |
| ion | chelator | |
| *IgG is an immunoglobulin | ||
| â cDNA and cRNA are the complementary strands used for hybridization |
In a particular aspect the carrier molecule, used in the methods and compositions described herein, is an antibody fragment, such as, but not limited to, anti-Fc, an anti-Fc isotype, anti-J chain, anti-kappa light chain, anti-lambda light chain, or a single-chain fragment variable protein; or a non-antibody peptide or protein, such as, for example but not limited to, soluble Fc receptor, protein G, protein A, protein L, lectins, or a fragment thereof. In one aspect the carrier molecule is a Fab fragment specific to the Fc portion of the target-binding antibody or to an isotype of the Fc portion of the target-binding antibody (U.S. Ser. No. 10/118,204). The monovalent Fab fragments are typically produced from either murine monoclonal antibodies or polyclonal antibodies generated in a variety of animals, for example but not limited to, rabbit or goat. These fragments can be generated from any isotype such as murine IgM, IgG1, IgG2a, IgG2b or IgG3.
In alternative embodiments, a non-antibody protein or peptide such as protein G, or other suitable proteins, can be used alone or coupled with albumin. Preferred albumins include human and bovine serum albumins or ovalbumin. Protein A, G and L are defined to include those proteins known to one skilled in the art or derivatives thereof that comprise at least one binding domain for IgG, i.e. proteins that have affinity for IgG. These proteins can be modified but do not need to be and are conjugated to a reactive moiety in the same manner as the other carrier molecules described.
In another aspect, the carrier molecules, used in the methods and compositions described herein, can be whole intact antibodies. Antibody is a term of the art denoting the soluble substance or molecule secreted or produced by an animal in response to an antigen, and which has the particular property of combining specifically with the antigen that induced its formation. Antibodies themselves also serve are antigens or immunogens because they are glycoproteins and therefore are used to generate anti-species antibodies. Antibodies, also known as immunoglobulins, are classified into five distinct classesâIgG, IgA, IgM, IgD, and IgE. The basic IgG immunoglobulin structure consists of two identical light polypeptide chains and two identical heavy polypeptide chains (linked together by disulfide bonds).
When IgG is treated with the enzyme papain a monovalent antigen-binding fragment can be isolated, referred herein to as a Fab fragment. When IgG is treated with pepsin (another proteolytic enzyme), a larger fragment is produced, F(abâ˛)2. This fragment can be split in half by treating with a mild reducing buffer that results in the monovalent FabⲠfragment. The FabⲠfragment is slightly larger than the Fab and contains one or more free sulfhydryls from the hinge region (which are not found in the smaller Fab fragment). The term âantibody fragmentâ is used herein to define the Fabâ˛, F(abâ˛)2 and Fab portions of the antibody. It is well known in the art to treat antibody molecules with pepsin and papain in order to produce antibody fragments (Gorevic et al., Methods of Enzyol., 116:3 (1985)).
The monovalent Fab fragments used as carrier molecules in the methods and compositions described herein are produced from either murine monoclonal antibodies or polyclonal antibodies generated in a variety of animals that have been immunized with a foreign antibody or fragment thereof (U.S. Pat. No. 4,196,265 discloses a method of producing monoclonal antibodies). Typically, secondary antibodies are derived from a polyclonal antibody that has been produced in a rabbit or goat but any animal known to one skilled in the art to produce polyclonal antibodies can be used to generate anti-species antibodies. The term âprimary antibodyâ describes an antibody that binds directly to the antigen as opposed to a âsecondary antibodyâ that binds to a region of the primary antibody. Monoclonal antibodies are equal, and in some cases, preferred over polyclonal antibodies provided that the ligand-binding antibody is compatible with the monoclonal antibodies that are typically produced from murine hybridoma cell lines using methods well known to one skilled in the art.
In one aspect the antibodies used as carrier molecules in the methods and compositions described herein are generated against only the Fc region of a foreign antibody. Essentially, the animal is immunized with only the Fc region fragment of a foreign antibody, such as murine. The polyclonal antibodies are collected from subsequent bleeds, digested with an enzyme, pepsin or papain, to produce monovalent fragments. The fragments are then affinity purified on a column comprising whole immunoglobulin protein that the animal was immunized against or just the Fc fragments.
In an aspect of the methods and composition described herein, the modified nucleic acids can be covalently conjugated to a solid support. This includes, but is not limited to, any azide modified nucleic acid disclosed herein and any solid support disclosed herein. In certain embodiments, the modified nucleic acids contain at least one alkyne moiety or at least one phosphine moiety capable of reacting with a solid support containing an azide moiety. In other embodiments, the modified nucleic acids contain at least one azide moiety capable of reacting with a solid support containing an alkyne moiety or a phosphine moiety. In other embodiments, the modified nucleic acids contain at least one phosphine moiety capable of reacting with a solid support containing an azide moiety. In certain embodiments, the phosphine moieties of the modified nucleic acids and solid supports are triarylphosphine moieties.
A variety of solid supports can be used in the methods and compositions described herein. Such solid supports are not limited to a specific type of support, and therefore a large number of supports are available and are known to one of ordinary skill in the art. Such solid supports include, but are not limited to, solid and semi-solid matrixes, such as aerogels and hydrogels, resins, beads, biochips (including thin film coated biochips), microfluidic chip, a silicon chip, multi-well plates (also referred to as microtitre plates or microplates), membranes, conducting and nonconducting metals, glass (including microscope slides) and magnetic supports. Other non-limiting examples of solid supports used in the methods and compositions described herein include silica gels, polymeric membranes, particles, derivatized plastic films, derivatized glass, derivatized silica, glass beads, cotton, plastic beads, alumina gels, polysaccharides such as Sepharose, poly(acrylate), polystyrene, poly(acrylamide), polyol, agarose, agar, cellulose, dextran, starch, FICOLL, heparin, glycogen, amylopectin, mannan, inulin, nitrocellulose, diazocellulose, polyvinylchloride, polypropylene, polyethylene (including poly(ethylene glycol)), nylon, latex bead, magnetic bead, paramagnetic bead, superparamagnetic bead, starch and the like. In certain embodiments, the solid supports used in the methods and compositions described herein are substantially insoluble in liquid phases.
In certain embodiments, the solid support may include a solid support reactive functional group, including, but not limited to, hydroxyl, carboxyl, amino, thiol, aldehyde, halogen, nitro, cyano, amido, urea, carbonate, carbamate, isocyanate, sulfone, sulfonate, sulfonamide, sulfoxide, wherein such functional groups are used to covalently attach the azide-containing nucleic acids described herein. In other embodiments, the solid support may include a solid support reactive functional group, including, but not limited to, hydroxyl, carboxyl, amino, thiol, aldehyde, halogen, nitro, cyano, amido, urea, carbonate, carbamate, isocyanate, sulfone, sulfonate, sulfonamide, sulfoxide, wherein such functional groups are used to covalently attach the alkyne-containing nucleic acids described herein. In still other embodiments, the solid support may include a solid support reactive functional group, including, but not limited to, hydroxyl, carboxyl, amino, thiol, aldehyde, halogen, nitro, cyano, amido, urea, carbonate, carbamate, isocyanate, sulfone, sulfonate, sulfonamide, sulfoxide, wherein such functional groups are used to covalently attach the phosphine-containing nucleic acids described herein. In other embodiments, the solid supports include azide, alkyne or phosphine functional groups to covalently attach nucleic acids modified with azide, alkyne or phosphine moieties.
A suitable solid phase support used in the methods and compositions described herein, can be selected on the basis of desired end use and suitability for various synthetic protocols. By way of example only, where amide bond formation is desirable to attach the modified nucleic acids described herein to the solid support, resins generally useful in peptide synthesis may be employed, such as polystyrene (e.g., PAM-resin obtained from Bachem Inc., Peninsula Laboratories, etc.), POLYHIPE⢠resin (obtained from Aminotech, Canada), polyamide resin (obtained from Peninsula Laboratories), polystyrene resin grafted with polyethylene glycol (TentaGelâ˘, Rapp Polymere, Tubingen, Germany), polydimethyl-acrylamide resin (available from Milligen/Biosearch, California), or PEGA beads (obtained from Polymer Laboratories). In certain embodiments, the modified nucleic acids described herein are deposited onto a solid support in an array format. In certain embodiments, such deposition is accomplished by direct surface contact between the support surface and a delivery mechanism, such as a pin or a capillary, or by ink jet technologies which utilize piezoelectric and other forms of propulsion to transfer liquids from miniature nozzles to solid surfaces. In the case of contact printing, robotic control systems and multiplexed printheads allow automated microarray fabrication. For contactless deposition by piezoelectric propulsion technologies, robotic systems also allow for automatic microarray fabrication using either continuous and drop-on-demand devices.
In one aspect, the modified nucleic acids, reporter molecules and carrier molecules provided herein can be used to form a first composition that includes a modified nucleic acids, a first reporter molecule, and a carrier molecule. In another embodiment, a second nucleic acid that includes a first composition in combination with a second conjugate, wherein the second conjugate comprises a carrier molecule or solid support that is covalently bonded to a second reporter molecule. The first and second reporter molecules have different structures and preferably have different emission spectra. In other embodiments, the first and second reporter molecules are selected so that their fluorescence emissions essentially do not overlap. In other embodiments, the reporter molecules have different excitation spectra, while in other embodiments the reporter molecules have similar excitation wavelengths and are excited by the same laser. In such compositions, the carrier molecule (or solid support) of the conjugates in the second composition may be the same or a different molecule. The discussion herein pertaining to the identity of various carrier molecules is generally applicable to this embodiment as well as other embodiments.
In another aspect, the modified nucleic acids, reporter molecules and solid supports provided herein can be used to form a first composition that comprises a modified nucleic acid, a first reporter molecule, and a solid support. In another embodiment, a second composition that includes a first composition in combination with a second conjugate. The second conjugate comprises a solid support or carrier molecule (described herein) that is covalently bonded to a second reporter molecule. The first and second reporter molecules have different structures and preferably have different emission spectra. In other embodiments, the first and second reporter molecules are selected so that their fluorescence emissions essentially do not overlap. In other embodiments, the reporter molecules have different excitation spectra, while in other embodiments the reporter molecules have similar excitation wavelengths and are excited by the same laser. In such composition, the solid support (or carrier molecule) of the conjugates in the second composition may be the same or a different molecule. The discussion herein pertaining to the identity of various solid supports is generally applicable to this embodiment of the invention as well as other embodiments.
Methods for forming modified nucleic acid-label (reporter molecule, solid support or carrier molecule) conjugates are described herein. In one aspect the modified biomolecule-reporter molecule conjugates are formed in solution and then separated using methods known in the art. It was unexpectedly found that by adding a copper chelator to the âclickâ chemistry conjugation reaction the labeling efficiency of modified nucleic acids and their resolution in gel electrophoresis improved as compared to those reactions without the addition of a copper chelator. In certain embodiments, the methods of labeling nucleic acids using âclickâ chemistry, involve an azide modified nucleic acid and a label that includes a terminal alkyne that are reacted in a mixture that includes copper (II), a reducing agent, and at least one copper (I) chelator. In other embodiments, novel methods are provided for forming conjugates in solution with azide modified nucleic acids and a reporter molecule comprising a terminal alkyne under âclickâ chemistry conditions. In other embodiments, âclickâ chemistry is used to form conjugates with alkyne modified nucleic acids and a reporter molecule comprising an azide. In other embodiments, Staudinger ligation is used to form conjugates with azide modified nucleic acids and a reporter molecule comprising a phosphine, while other embodiments use Staudinger ligation to form conjugates with phosphine modified nucleic acids and a reporter molecule comprising an azide. Still other embodiments use activated alkyne modified nucleic acids to form conjugates with reporter molecules comprising azides, or azide modified nucleic acids forming conjugates with activated alkyne containing reporter molecules.
In other aspects provided herein, the methods of labeling nucleic acids using âclickâ chemistry, wherein a nucleic acid that includes an azido group and a label that comprises a terminal alkyne are reacted in a mixture that includes copper (II), a reducing agent, and at least one copper (I) chelator to produce a labeled nucleic acid, results in the preservation of the structural integrity of the labeled nucleic acid. In other embodiments, methods of labeling glycoproteins wherein the structural integrity of the nucleic acid after labeling is not reduced includes âclickâ chemistry in which a nucleic acid that includes a terminal alkyne and a label that comprises an azido group are reacted in a mixture that includes copper (II), a reducing agent, and at least one copper chelator.
The methods for labeling nucleic acids that comprise an azido group using âclickâ chemistry described herein can also be used for nucleic acids that comprise a terminal alkyne, wherein the label to be reacted with the nucleic acid comprises an azido group. The methods for labeling and detecting nucleic acids that comprise an azido group using âclickâ chemistry described herein can also be used for nucleic acids that comprise a terminal alkyne, wherein the label to be reacted with the nucleic acid comprises an azido group. In one embodiment, is a method using the âclickâ chemistry reaction described herein to form nucleic acid-reporter molecule conjugates in which the reaction mixture includes a reporter molecule with an azide moiety, an alkyne modified nucleic acid, copper (II) ions, at least one reducing agent and a copper chelator. In certain embodiments, such alkyne modified nucleic acids are alkyne modified glycoproteins and such reporter molecule with an azide moiety are any reporter molecule described herein. In other embodiments, such alkyne modified nucleic acids are alkyne modified glycoproteins and such reporter molecule with an azide moiety are any fluorophore based reporter molecule described herein.
Other methods provided herein, are methods for labeling and detecting separated nucleic acids using the âclickâ chemistry cycloaddition reaction described herein. The method includes: combining in a reaction mixture a nucleic acid that comprises an azido group, a label that includes a terminal alkyne group, copper (II), a reducing agent, and a copper chelator; incubating the reaction mixture under conditions that promote chemical conjugation of the label to the nucleic acid, separating the nucleic acid using one or more biochemical or biophysical separation techniques, and detecting the nucleic acid. In other embodiments, the method includes: combining in a reaction mixture a nucleic acid that comprises an alkyne group, a label that includes an azide group, copper (II), a reducing agent, and a copper chelator; incubating the reaction mixture under conditions that promote chemical conjugation of the label to the nucleic acid, separating the nucleic acid using one or more biochemical or biophysical separation techniques, and detecting the nucleic acid.
In one embodiment is a method for forming a modified nucleic acid label (reporter molecule, solid support or carrier molecule) conjugate, wherein the method includes the steps of:
In an alternative embodiment, step a) comprises a label having an azido moiety and the modified nucleic acid comprises an alkyne.
In another alternative embodiment, step a) comprises forming a Staudinger ligation reaction.
In yet another embodiment, step a) does not comprise copper(II) ions, at least one reducing agent and a copper chelator wherein the label comprises an azido moiety or an activated alkyne and the modified nucleic acid comprises an azido moiety or an activated alkyne.
In another embodiment is a method for detecting modified nucleic acids, wherein the method includes the steps of:
In another embodiment is a method for detecting modified nucleic acids, wherein the method includes the steps of:
In addition such âclickâ chemistry reaction mixtures can include, without limitation, one or more buffers, polymers, salts, detergents, or solubilizing agents. The reaction can be performed under anaerobic conditions, such as under nitrogen or argon gas, and can be performed for any feasible length of time, such as, for example, from ten minutes to six hours, from about twenty minutes to about three hours, or from about thirty minutes to about two hours. The reaction can be performed at a wide range of temperatures, for example ranging from about 4 degrees Celsius to about 50 degrees Celsius, and is preferably performed at temperatures between about 10 degrees and about 40 degrees, and typically between about 15 degrees and about 30 degrees.
Another aspect provided herein are methods directed toward detecting modified nucleic acids after the modified nucleic acids have been labeled, using âclickâ chemistry reactions, Staudinger ligation or activated alkyne reactions, and separated using, for example, chromatographic methods or electrophoresis methods such as, but not limited to, gel electrophoresis. In certain embodiments such nucleic acids have been modified using the methods described herein. The separation methods used to separate such modified nucleic acids includes, but are not limited to, thin layer or column chromatography (including, for example, size exclusion, ion exchange, or affinity chromatography) or isoelectric focusing, gel electrophoresis, capillary electrophoresis, capillary gel electrophoresis, and slab gel electrophoresis. Gel electrophoresis can be denaturing or nondenaturing gel electrophoresis, and can include denaturing gel electrophoresis followed by nondenaturing gel electrophoresis (e.g., â2Dâ gels). In certain embodiments, the modified nucleic acids are used to form conjugates with a reporter molecule, a carrier molecule and/or a solid support prior to separation using the methods described herein. In other embodiments, the modified nucleic acids are used to form conjugates with a reporter molecule, a carrier molecule and/or a solid support after separation using the methods described herein.
In other embodiments, the separation methods used in such separation and detection methods can be any separation methods used for nucleic acids, such as, for example, chromatography, capture to solid supports, and electrophoresis. In certain embodiments of such separation and detection methods, gel electrophoresis is used to separate nucleic acids and the separated nucleic acids are detected in the gel by the attached labels. By way of example only, nucleic acids that have incorporated azido moieties can be labeled in a solution reaction with a terminal alkyne-containing fluorophore, and the nucleic acids can be optionally further purified from the reaction mixture and electrophoresed. The nucleic acids can be visualized in the gel using light of the appropriate wavelength to stimulate the fluorophore label. Single or double stranded nucleic acids can be attached to solid supports prior to incorporation of azido or alkyne nucleotides followed by âclickâ reaction with a respective azido or alkyne chemical or polymer. Nucleic acids that have alkyne or azide-nucleotides can be attached to solid supports before or after the click reaction.
Gel electrophoresis can use any feasible buffer system described herein including, but not limited to, Tris-acetate EDTA, Tris-borate EDTA, Tris-glycine, BisTris and Bistris-Tricine. In certain embodiments, the electrophoresis gel used in the methods described herein comprise acrylamide, including by way for example only, acrylamide at a concentration from about 2.5% to about 30%, or from about 5% to about 20%. In certain embodiments, such polyacrylamide electrophoresis gel comprise 1% to 10% crosslinker, including but not limited to, bisacrylamide. In certain embodiments, the electrophoresis gel used in the methods described herein comprises agarose, including by way for example only, agarose at concentration from about 0.1% to about 5%, or from about 0.5% to about 4%, or from about 1% to about 3%. In certain embodiments, the electrophoresis gel used in the methods described herein comprises acrylamide and agarose, including by way for example only, electrophoresis gels comprising from about 2.5% to about 30% acrylamide and from about 0.1% to about 5% agarose, or from about 5% to about 20% acrylamide and from about 0.2% to about 2.5% agarose. In certain embodiments, such polyacrylamide/agarose electrophoresis gels comprise 1% to 10% crosslinker, including but not limited to, bisacrylamide. In certain embodiments, the gels used to separate nucleic acids can be gradient gels.
The methods described herein can be used to detect modified nucleic acids for âin-gelâ detection using slab gel electrophoresis or capillary gel electrophoresis. In one aspect, the method includes combining an azido modified nucleic acid, a label that includes a terminal alkyne, copper (II), a reducing agent, and a copper (I) chelator in a reaction mixture; incubating the reaction mixture under conditions that promote chemical conjugation of the label to the nucleic acid; separating the nucleic acid using one or more biochemical separation techniques; and detecting the nucleic acid. The label used in such methods can be any label described herein. The copper (I) chelator used in such methods can be any chelator described herein. In certain embodiments, the copper (I) chelator use in such methods is a 1,10 phenanthroline-containing copper (I) chelator. In other embodiments, the copper(I) chelator is bathocuproine disulfonic acid (BCS; 2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline disulfonate). In other embodiments, the copper (I) chelator used in such methods can be used to chelate copper(II).
Without limitation to any specific mechanism, it is known that copper can promote the cleavage of nucleic acids. The addition of a copper chelator in such methods reduces the detrimental effects of copper used in the âclickâ chemistry reactions, and thereby preserves the structural integrity of the nucleic acids. Thus, the methods described herein preserve the structural integrity of labeled and detected nucleic acids, and thereby provide improved methods of separating and detecting nucleic acids labeled using âclickâ chemistry. In addition, the methods of detecting separated nucleic acids using click chemistry, in which the structural integrity of the separated molecules is preserved, improves the detection of such nucleic acids.
In certain embodiments, the addition of a chelator including, but not limited to BCS, preserves Telomerase Laddering (see FIG. 10).
In another embodiment of âin-gelâ detection, the method includes combining an alkyne modified nucleic acid that comprises a terminal alkyne, a label that includes an azido group, copper (II), a reducing agent, and a copper (I) chelator in a reaction mixture; incubating the reaction mixture under conditions that promote chemical conjugation of the label to the nucleic acid; separating the labeled nucleic acid using one or more biochemical separation techniques; and detecting the nucleic acid. In these methods, the structural integrity of labeled and detected nucleic acids is preserved. The label used in such methods can be any label described herein. The copper (I) chelator used in such methods can be any chelator described herein. In certain embodiments, the copper (I) chelator use in such methods is a 1,10 phenanthroline-containing copper (I) chelator. In other embodiments, the copper(I) chelator is bathocuproine disulfonic acid (BCS; 2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline disulfonate. In other embodiments, the copper (I) chelator used in such methods can be used to chelate copper(II).
In certain embodiments, in-gel fluorescence detection utilizes fluorescent- and/or UV-excitable alkyne containing probes, or fluorescent- and/or UV-excitable azide containing probes. In certain embodiments, the labels used in such separation and detection methods are any fluorophores described herein which has been derivatized to contain an alkyne, an azide or a phosphine. In certain embodiments, such fluorphores include, but are not limited to, fluorescein, rhodamine, TAMRA, an Alexa dye, a SYPRO dye, or a BODIPY dye.
The method described herein can be used for multiplexed detection of nucleic acids, by labeling a modified nucleic acid using the methods described herein, and then using a total nucleic acid stain to stain the gel that includes the modified nucleic acids labeled with a fluorophore having distinct spectral emission.
In another aspect, nucleic acids can be labeled with an azido tag, electrophoresed on gels, and the resulting gels can be incubated with an alkyne tag, such as a fluorescent alkyne tag in the presence of copper (I). Copper (I) can be added in its natural form (e.g. CuBr) or can be produced in situ from copper (II) compounds with the addition of a reducing agent. The reducing agent used in such methods can be any reducing agent described herein, including but not limited to, ascorbate or TCEP. Addition of a chelator that stabilizes copper (I) can enhance the chemical ligation. The fluorescent label used in such methods can be any fluorophore described herein. The copper (I) chelator used in such methods can be any chelator described herein. In certain embodiments, the copper (I) chelator use in such methods is a 1,10 phenanthroline-containing copper (I) chelator. In other embodiments, the copper(I) chelator is bathocuproine disulfonic acid (BCS; 2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline disulfonate). In other embodiments, the copper (I) chelator used in such methods can be used to chelate copper(II). After the ligation step, the gel is washed and the tagged proteins are visualized using standard fluorescence scanning devices.
In other embodiments, nucleic acids can be labeled with an alkyne tag, electrophoresed on gels, and the resulting gels can be incubated with an azide tag, such as a fluorescent azide tag in the presence of copper (I). Copper (I) can be added in its natural form (e.g. CuBr) or can be produced in situ from copper (II) compounds with the addition of a reducing agent. The reducing agent used in such methods can be any reducing agent described herein, including but not limited to, ascorbate or TCEP. Addition of a chelator that stabilizes copper (I) can enhance the chemical ligation. The fluorescent label used in such methods can be any fluorophore described herein. The copper (I) chelator used in such methods can be any chelator described herein. In certain embodiments, the copper (I) chelator use in such methods is a 1,10 phenanthroline-containing copper (I) chelator. In other embodiments, the copper(I) chelator is bathocuproine disulfonic acid (BCS; 2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline disulfonate. In other embodiments, the copper (I) chelator used in such methods can be used to chelate copper(II). After the ligation step, the gel is washed and the tagged proteins are visualized using standard fluorescence scanning devices.
In further embodiments, nucleic acids can be labeled with an azide tag, electrophoresed on gels, and the resulting gels can be incubated with a phosphine tag, such as a fluorescent phosphine containing tag, using Staudinger ligation. After the ligation step, the gel is washed and the tagged nucleic acids are visualized using standard fluorescence scanning devices. In such methods the use of copper, which contributes to the degradation of nucleic acids such as proteins, can be avoided.
In certain embodiments, a label attached to a nucleic acid using a âclickâ chemistry reaction with a copper (I) chelator as disclosed herein, can also be used for the separation of nucleic acids. By way of example only, affinity chromatography or bead capture techniques can be used to separate nucleic acids labeled with biotin or other affinity tags using the methods described herein. The captured molecules can be detected using the affinity tags or by other means, and/or further analyzed for structure or function.
Another aspect provides a method for labeling modified nucleic acids that have been immobilized on a solid support. Solid supports used in such methods have been described herein, and can be solid or semi-solid matrix. Such solid supports include, but are not limited to, glass, slides, arrays, silica particles, polymeric particles, microtiter plates and polymeric gels. In this aspect the nucleic acids are modified using the methods described herein. In certain aspects it is advantageous to first immobilize the modified nucleic acids and then to subsequently form a nucleic acid conjugate comprising the nucleic acid and a reporter molecule, carrier molecule and the solid support, wherein the reporter molecule, carrier molecule or solid support comprise a reactive group used to form the conjugate. In certain embodiments such reactive groups are alkynes for reacting with azides. In certain embodiments such reactive groups are activated alkynes for reacting with azides. In certain embodiments such reactive groups are phosphines for reacting with azides. In certain embodiments such reactive groups are azides for reacting with alkynes. In certain embodiments, the conjugate is formed under âclickâ chemistry conditions wherein the reporter molecule, carrier molecule or solid support comprises an alkyne or an azide. In another aspect the conjugate is formed under Staudinger ligation conditions wherein the reporter molecule, carrier molecule or solid support comprises a triaryl phosphine or an azide. In another aspect the conjugate is formed using activated alkynes wherein the reporter molecule, carrier molecule or solid support comprises an activated alkyne or an azide.
In certain aspects it is advantageous to first immobilize the modified nucleic acid and then to detect the immobilized nucleic acid using standard hybridization techniques wherein the hybridized probe is detected using methods well known in the art. In this instance the modified nucleic acid comprises a reactive group that are alkynes for reacting with azides. In certain embodiments such reactive groups are activated alkynes for reacting with azides. In certain embodiments such reactive groups are phosphines for reacting with azides. In certain embodiments such reactive groups are azides for reacting with alkynes. subsequently form a nucleic acid conjugate comprising the nucleic acid and a solid support, wherein the solid support comprises a reactive group used to form the conjugate.
In certain embodiments, it is advantageous to first immobilize the azido modified nucleic acids and then to subsequently form the nucleic acid conjugate comprising a reporter molecule, carrier molecule or solid support wherein the reporter molecule, carrier molecule or solid support comprise an azide reactive group prior to forming the conjugate. In certain embodiments, the conjugate is formed under âclickâ chemistry conditions wherein the reporter molecule, carrier molecule or solid support comprises a terminal alkyne. In another aspect the conjugate is formed under Staudinger ligation conditions wherein the reporter molecule, carrier molecule or solid support comprises a triaryl phosphine.
In another aspect, the modified nucleic acid is attached to a solid support using functional groups other than functional groups used in âclickâ chemistry or Staudinger ligation, whereupon the attached modified nucleic acid is used to form a conjugate under âclickâ chemistry conditions or Staudinger ligation with reporter molecules, carrier molecule or another solid support that have functional groups used in âclickâ chemistry or Staudinger ligation. By way of example only, the modified nucleic acid can be immobilized to a solid support using hydroxyl, carboxyl, amino, thiol, aldehyde, halogen, nitro, cyano, amido, urea, carbonate, carbamate, isocyanate, sulfone, sulfonate, sulfonamide or sulfoxide functional groups. In certain embodiments the modified nucleic acid is an azido modified nucleic acid, an alkyne modified nucleic acid or a phosphine modified nucleic acid.
In certain embodiments, the azido modified nucleic acid is attached to a solid support using functional groups other than azide reactive functional groups, whereupon the attached azido modified nucleic acid is used to form a conjugate under click chemistry conditions wherein the reporter molecule, carrier molecule or another solid support comprises a terminal alkyne. In another embodiment the azido modified nucleic acid is attached to a solid support using functional groups other than azide reactive functional groups, whereupon the attached azido modified nucleic acid is used to form a conjugate under Staudinger ligation conditions wherein the reporter molecule, carrier molecule or other solid support comprises a triaryle phosphine.
In another aspect is provided a method for detecting immobilized azido modified nucleic acids, wherein the method includes the following:
In another aspect is provided a method for detecting immobilized alkyne modified nucleic acids, wherein the method includes the following:
RNAi is method for selectively decreasing gene expression and is a cost effective method used to study specific gene targets. Typically RNAi oligos are short 20 basepair nucleotides. Hybridization of the oligonucleotide to a targeted gene triggers specific degradation of the gene and thereby decreases gene expression. Using Click modified oligos could potentially increase the specificity of the Watson-Crick binding of these short oligonucleotides by increasing the Tm. Similar types of experiments have been done with locked nucleic acids (LNA) (Elmen, J. et al 2005, Nuc Acid Res). The Click modification could also potentially decrease the susceptibility of the free RNAi oligos to destruction by nucleases after transfection, thereby increasing the half life and effectiveness of the oligonucleotides.
It was unexpectedly observed that azide modified-dATP and alkyne modified-dUTP could be incorporated into a nucleic acid polymer using amplification techniques including, but not limited to PCR. It was also unexpectedly observed that azide modified-dATP and alkyne modified-dUTP could be incorporated into a nucleic acid polymer using a Telomerase resulting in Telomerase laddering (see FIGS. 4-7 (Example 1-4). Telomerase is an enzyme that adds specific DNA sequence repeats (âTTAGGGâ in all vertebrates) to the 3Ⲡ(âthree primeâ) end of DNA strands in the telomere regions, which are found at the ends of eukaryotic chromosomes. The enzyme is a reverse transcriptase that carries its own RNA molecule, which is used as a template when it elongates telomeres, which are shortened after each replication cycle. Therefore, one aspect of the methods of using the modified nucleotides described herein is in a telomerase activity assay.
In another aspect, such modified nucleotides are labeled using click-chemistry based, while in other embodiments such modified nucleotides are labeled using Staudinger Ligation. In still other embodiments, such modified nucleotides are labeled using activated alkyne reactivity. In certain embodiments, the modified nucleotides are azide modified nucleotides which are labeled using click-chemistry, while in other embodiments such modified nucleotides are azide nucleotides labeled using Staudinger Ligation. In still other embodiments, such modified nucleotides are azide modified nucleotides which are labeled using activated alkyne reactivity. In certain embodiments, the modified nucleotides are alkyne modified nucleotides which are labeled using click-chemistry, while in other embodiments such modified nucleotides are activated alkyne modified nucleotides which are labeled using activated alkyne reactions with azides. In certain embodiments, the modified nucleotides are azide modified-dATP which are labeled using click-chemistry (see FIG. 6), while in other embodiments such modified nucleotides are azide modified-dATP labeled using Staudinger Ligation. In still other embodiments, such modified nucleotides are azide modified-dATP which are labeled using activated alkyne reactivity. In certain embodiments, the modified nucleotides are alkyne modified-dATP which are labeled using click-chemistry, while in other embodiments such modified nucleotides are activated alkyne modified-dATP which are labeled using activated alkyne reactions with azides. In certain embodiments, the modified nucleotides are azide modified-dATP which are labeled using click-chemistry, while in other embodiments such modified nucleotides are azide modified-dUTP labeled using Staudinger Ligation. In still other embodiments, such modified nucleotides are azide modified-dATP or dUTP which are labeled using activated alkyne reactivity. In certain embodiments, the modified nucleotides are alkyne modified-dUTP which are labeled using click-chemistry (see FIGS. 7-9), while in other embodiments such modified nucleotides are activated alkyne modified-dUTP which are labeled using activated alkyne reactions with azides. The telomerase assay can serve as a highly significant cancer diagnostic as this enzyme is activated in 90% of known human and other animal cancers. The level of telomerase activity can be used as a reliable biomarker that represents the different levels of the cancer disease. Therefore, this assay can help diagnose and evaluate the level of cancer progression in a patient and help determine the response to anticancer treatments.
Thus, in one embodiment is provided a method of measuring Telomerase Enzyme Activity, comprising steps of:
In another aspect, such modified nucleotides described herein are incorporated into nucleic acid polymers using the methods described herein including, but not limited to, polymerase chain reaction (PCR), ligation-based thermocycling approaches, reverse transcription-PCR, real-time PCR, linear amplification techniques and isothermal DNA amplification techniques such as, by way of example only, real-time strand displacement amplification (SDA), rolling-circle amplification (RCA), multiple-displacement amplification (MDA), Q-beta replicase amplification, automated Q-beta replicase amplification assay and other RNA polymerase mediated techniques such as, for example, nucleic acid sequence based amplification or NASBA. Such incorporated nucleotides are then labeled using click-chemistry, while in other embodiments such modified nucleotides are labeled using Staudinger Ligation. In still other embodiments, such incorporated nucleotides are labeled using activated alkyne reactivity. In certain embodiments, the incorporated nucleotides are azide modified nucleotides which are labeled using click-chemistry, while in other embodiments such modified nucleotides are azide nucleotides labeled using Staudinger Ligation. In still other embodiments, such incorporated nucleotides are azide modified nucleotides which are labeled using activated alkyne reactivity. In certain embodiments, the incorporated nucleotides are alkyne modified nucleotides which are labeled using click-chemistry, while in other embodiments such modified nucleotides are activated alkyne modified nucleotides which are labeled using activated alkyne reactions with azides. In certain embodiments, the incorporated nucleotides are azide modified-dATP which are labeled using click-chemistry (see FIG. 6), while in other embodiments such modified nucleotides are azide modified-dATP labeled using Staudinger Ligation. In still other embodiments, such incorporated nucleotides are azide modified-dATP which are labeled using activated alkyne reactivity. In certain embodiments, the incorporated nucleotides are alkyne modified-dATP which are labeled using click-chemistry, while in other embodiments such modified nucleotides are activated alkyne modified-dATP which are labeled using activated alkyne reactions with azides. In certain embodiments, the incorporated nucleotides are azide modified-dUTP which are labeled using click-chemistry, while in other embodiments such modified nucleotides are azide modified-dUTP labeled using Staudinger Ligation. In still other embodiments, such modified nucleotides are azide modified-dUTP which are labeled using activated alkyne reactivity. In certain embodiments, the incorporated nucleotides are alkyne modified-dUTP which are labeled using click-chemistry (see FIGS. 7-9), while in other embodiments such modified nucleotides are activated alkyne modified-d UTP which are labeled using activated alkyne reactions with azides.
In another aspect, such modified nucleotides described herein are incorporated into nucleic acid polymers using isothermal amplification. Such incorporated nucleotides are then labeled using click-chemistry, while in other embodiments such modified nucleotides are labeled using Staudinger Ligation. In still other embodiments, such incorporated nucleotides are labeled using activated alkyne reactivity. In certain embodiments, the incorporated nucleotides are azide modified nucleotides which are labeled using click-chemistry, while in other embodiments such modified nucleotides are azide nucleotides labeled using Staudinger Ligation. In still other embodiments, such incorporated nucleotides are azide modified nucleotides which are labeled using activated alkyne reactivity. In certain embodiments, the incorporated nucleotides are alkyne modified nucleotides which are labeled using click-chemistry, while in other embodiments such modified nucleotides are activated alkyne modified nucleotides which are labeled using activated alkyne reactions with azides. In certain embodiments, the incorporated nucleotides are azide modified-dATP which are labeled using click-chemistry, while in other embodiments such modified nucleotides are azide modified-dATP labeled using Staudinger Ligation. In still other embodiments, such incorporated nucleotides are azide modified-dATP which are labeled using activated alkyne reactivity. In certain embodiments, the incorporated nucleotides are alkyne modified-dATP which are labeled using click-chemistry, while in other embodiments such modified nucleotides are activated alkyne modified-dATP which are labeled using activated alkyne reactions with azides. In certain embodiments, the incorporated nucleotides are azide modified-dUTP which are labeled using click-chemistry, while in other embodiments such modified nucleotides are azide modified-dUTP labeled using Staudinger Ligation. In still other embodiments, such modified nucleotides are azide modified-dUTP which are labeled using activated alkyne reactivity. In certain embodiments, the incorporated nucleotides are alkyne modified-dUTP which are labeled using click-chemistry (see FIGS. 7-9), while in other embodiments such modified nucleotides are activated alkyne modified-dUTP which are labeled using activated alkyne reactions with azides. In particular, FIG. 9 shows that E-dUTP can be incorporated using various polymerases, thereby showing an isothermal DNA extension assay for second strand cDNA synthesis using primer extension.
In certain embodiments, a mixture of modified nucleotides are incorporated using the methods described herein including, but not limited to, polymerase chain reaction (PCR), ligation-based thermocycling approaches, reverse transcription-PCR, real-time PCR, linear amplification techniques and isothermal DNA amplification techniques such as, by way of example only, real-time strand displacement amplification (SDA), rolling-circle amplification (RCA), multiple-displacement amplification (MDA), Q-beta replicase amplification, automated Q-beta replicase amplification assay and other RNA polymerase mediated techniques such as, for example, nucleic acid sequence based amplification or NASBA. In certain embodiments the mixture of modified nucleotides is a mixture of azide modified nucleotides, while in other embodiments the mixture of modified nucleotides is a mixture of alkyne modified nucleotides. In certain embodiments the mixture of modified nucleotides is a mixture of azide modified dATP and dUTP nucleotides, while in other embodiments the mixture of modified nucleotides is a mixture of alkyne modified dATP and dUTP. In certain embodiments, the nucleic acid polymers having a mixtures of modified nucleotides is labeled as described above.
FIGS. 4 and 5 demonstrate that azido-dATP is incorporated by telomerase enzyme which is a reverse transcriptase (RNA dependent DNA polymerase), while FIG. 7 demonstrates that ethynyl-dUTP is also incorporated by telomerase enzyme. Thus, another aspect of methods using the modified nucleotides described herein is to detect products of RT-PCR using a nucleotide mixtures containing either an ethynyl or azido dNTP or enzymes such as reverse transcriptase and DNA polymerase. The product of such an experiment will be purified and then subjected to click based labeling method. The final labeled product can be purified either by precipitation or size exclusion chromatography. Additionally, the starting telomerase primer can be biotinylated allowing for purification of the telomerase modified product after the click reaction. The method is an example of first strand cDNA synthesis (RT-PCR).
Another aspect using the modified nucleotides described herein is âclickâ chemistry based oligonucleotide labeling for Fluorescene In-Situ Hybridization (FISH) and Chromogenic In-Situ Hybridization (CISH) and Silver In-situ Hybridization (SISH). In such methods, standard polymerases including, but not limited to, Klenow (Exo-), modified or wild type T7 DNA polymerase (Sequenase) or Bst polymerase (Large fragment) are used to amplify a template strand for a given sequence using primers as well as using ethynyl or azido dNTPs. The prepared DNA fragments can then be purified and subjected to the âclickâ reaction with either azido or alkyne labels, fluorescent labels, Qdots and nanoparticles to create a labeled probe. In certain embodiments, such probes are labeled using Staudinger Ligation, while in other embodiments such probes are labeled using activated alkyne reactions. Probes for methods like in situ hybridization can also be created using PCR and all of the commercially available PCR polymerases. Isothermal amplification of plasmids or bacterial artificial chromosomes (BAC) templates using phi29 DNA polymerase or other polymerases with strand displacement activity can also be done. In certain embodiments, labeling is done during a diagnostic or clinical assay. In other embodiments, such labeling in FISH and CISH is an automated in situ hybridization platforms where the hybridization can be followed by the click reaction to generate the signal. By way of example only, such automated systems are instruments from Dako, Ventana Medical Systems, and Vision Biosystems.
In another aspect RNA probes can be used for FISH and CISH, wherein such probes are labeled using âclickâ chemistry. In certain embodiments, such probes are labeled using Staudinger Ligation, while in other embodiments such probes are labeled using activated alkyne reactions. In certain embodiments, such RNA probes are prepared by the incorporation of modified nucleotides using in-vitro transcription system to generate an RNA probe. Alternative methods use small RNA oligonucleotides that can be labeled via aminoallyl-NHS ester chemistry. In certain embodiments, DNA dependent RNA polymerase from phage T7 or SP6 are used to incorporate alkyne modified oligonucleotide, by way of example only ethynyl oligonucleotides, or azido oligonucleotides to produce a modified RNA probe. Such modified RNA probes are the labeled with either azido or alkyne fluorescent or chromogenic labels using âclick chemistryâ, thereby generating fluoregenic or chromogenic RNA probes.
In another aspect, phosphoproteins can be modified in vivo or in vitro using alkyne or azide-tagged nucleotides whereby the azide or alkyne moiety is placed on the gamma phosphate of phosphoroproteins. By way of example only, such modifications can be accomplished by adding one of the nucleotides shown in FIG. 1 to a reaction mixture containing a protein kinase and a kinase target molecule. In certain embodiments, the phosphoroprotein is an azide-containing phosphoroprotein that can be reacted under âclickâ chemistry conditions with an alkyne containing label including, but not limited to, fluorphores or affinity reagent for quantitation, visualization, or enrichment. In certain embodiments, the phosphoroprotein is an alkyne-containing phosphoroprotein that can be reacted under âclickâ chemistry conditions with an azide containing label including, but not limited to, fluorphores or affinity reagent for quantitation, visualization, or enrichment. In other embodiments, such modified phosphoroproteins can be used to form conjugates with a reporter molecule, a carrier molecule and/or a solid substrate.
In one aspect, modified nucleotide substrates containing azide or alkyne moieties are added directly to cultured cells for metabolic incorporation of the tagged gamma-phosphate molecule into cellular macromolecules including proteins. The process may involve treatment of the cells with pharmacological agents to detect alterations in phosphorylation dynamics. Entry of the compounds into live cultured cells could be enhanced by modifying the nucleotides with functional groups that would afford permeability, or by concomitant addition of cell permeablizing agents.
In another aspect, the kinase reaction could be performed in vitro using cellular extracts as the source of kinases and substrates. The modified nucleotides would be added to the reaction mixture and the reaction mixtures incubated with or without the addition of pharmacological agents of interest. The in vitro reaction may also entail adding an exogenous kinase or substrate source to the cellular extract along with the nucleotide analogs. In another application, the method could be used in vitro without cellular extracts, using purified kinases and kinase substrates. In certain embodiments, the kinase reaction can be conducted using kinase substrates deposited as an array on a solid substrate.
In each of these aspects the reaction mix may contain a buffer optimized for the particular kinase(s) of interest, a kinase source, a metal ion source, glycerol, nucleotide ATP analog, and ATP. The âclickâ detection reaction with an alkyne probe would be performed in the presence of copper(I), or copper(II) in the presence of a copper(II) reducing agent, a copper(I) chelating agent, and an appropriate buffer to maintaining optimal pH conditions.
In another aspect of methods using the modified nucleotides described herein is the preparation of Peptide-nucleic Acid (PNA) Conjugates using Click Chemistry, Staudinger Ligation or activated alkyne reactions. In such methods, a peptide with an O-GlcNac modification on one or more amino acids is subjected to a GalT1 reaction in the presence of UDP-GalNAz, resulting in an azido modified peptide. Such Post-Translational modifications have been described in the co-pending application entitled âLabeling of Glycoproteinsâ with Ser. No. 60/772,221, which is herein incorporated by reference in its entirety. In addition any post-translationally modified protein described in the co-pending application entitled âLabeling of Glycoproteinsâ with Ser. No. 60/772,221 can be used in the methods using modified nucleotide as described herein In certain embodiments, a peptide-nucleic acid conjugate is created by reacting the an azido-linked peptide with an alkynyl modified oligonucleotides under âclickâ chemistry reaction conditions. In certain embodiments, a peptide-nucleic acid conjugate is created by reacting the an azido-linked peptide with an alkynyl modified oligonucleotides in presence of 1 or 2 mM copper, 10 mM Sodium Ascorbate and 20 mM BCS. In certain embodiments, a peptide-nucleic acid conjugate is created by reacting the an azido-linked peptide with an ethynyl modified oligonucleotides under âclickâ chemistry reaction conditions. In certain embodiments, a peptide-nucleic acid conjugate is created by reacting the an azido-linked peptide with an ethynyl modified oligonucleotides in presence of 1 or 2 mM copper, 10 mM Sodium Ascorbate and 20 mM BCS.
In certain embodiments, a peptide-nucleic acid conjugate is created by reacting the an alkyne-linked peptide with an azide modified oligonucleotide under âclickâ chemistry reaction conditions. In certain embodiments, a peptide-nucleic acid conjugate is created by reacting the an alkyne-linked peptide with an azide modified oligonucleotide in presence of 1 or 2 mM copper, 10 mM Sodium Ascorbate and 20 mM BCS. In certain embodiments, a peptide-nucleic acid conjugate is created by reacting an ethynyl-linked peptide with an azide modified oligonucleotides under âclickâ chemistry reaction conditions. In certain embodiments, a peptide-nucleic acid conjugate is created by reacting the ethynyl-linked peptide with an azide modified oligonucleotides in presence of 1 or 2 mM copper, 10 mM Sodium Ascorbate and 20 mM BCS.
The end user will determine the choice of the sample and the way in which the sample is prepared. Samples that can be used with the methods and compositions described herein include, but are not limited to, any biological derived material or aqueous solution that contains a nucleic acid. In certain embodiments, a sample also includes material in which a nucleic acid has been added. The sample that can be used with the methods and compositions described herein can be a biological fluid including, but not limited to, whole blood, plasma, serum, nasal secretions, sputum, saliva, urine, sweat, transdermal exudates, cerebrospinal fluid, or the like. In other embodiments, the samples are biological fluids that include tissue and cell culture medium wherein nucleic acid of interest has been secreted into the medium. Cells used in such cultures include, but are not limited to, prokaryotic cells and eukaryotic cells that include primary cultures and immortalized cell lines. Such eukaryotic cells include, without limitation, ovary cells, epithelial cells, circulating immune cells, β cells, hepatocytes, and neurons. In certain embodiments, the sample may be whole organs, tissue or cells from an animal, including but not limited to, muscle, eye, skin, gonads, lymph nodes, heart, brain, lung, liver, kidney, spleen, thymus, pancreas, solid tumors, macrophages, mammary glands, mesothelium, and the like.
Various buffers can be used in the methods described herein, including inorganic and organic buffers. In certain embodiments the organic buffer is a zwitterionic buffer. By way of example only, buffers that can be used in the methods described herein include phosphate buffered saline (PBS), phosphate, succinate, citrate, borate, maleate, cacodylate, N-(2-Acetamido)iminodiacetic acid (ADA), 2-(N-morpholino)-ethanesulfonic acid (MES), N-(2-acetamido)-2-aminoethanesulfonic acid (ACES), piperazine-N,Nâ˛-2-ethanesulfonic acid (PIPES), 2-(N-morpholino)-2-hydroxypropanesulfonic acid (MOPSO), N,N-bis-(hydroxyethyl)-2-aminoethanesulfonic acid (BES), 3-(N-morpholino)-propanesulfonic acid (MOPS), N-tris-(hydroxymethyl)-2-ethanesulfonic acid (TES), N-2-hydroxyethyl-piperazine-N-2-ethanesulfonic acid (HEPES), 3-(N-tris-(hydroxymethyl)methylamino)-2-hydroxypropanesulfonic acid (TAPSO), 3-(N,N-Bis[2-hydroxyethyl]amino)-2-hydroxypropanesulfonic acid (DIPSO), N-(2-Hydroxyethyl)piperazine-Nâ˛-(2-hydroxypropanesulfonic acid) (HEPPSO), 4-(2-Hydroxyethyl)-1-piperazinepropanesulfonic acid (EPPS), N-[Tris(hydroxymethyl)methyl]glycine (Tricine), N,N-Bis(2-hydroxyethyl)glycine (Bicine), (2-Hydroxy-1,1-bis(hydroxymethyl)ethyl)amino]-1-propanesulfonic acid (TAPS), N-(1,1-Dimethyl-2-hydroxyethyl)-3-amino-2-hydroxypropanesulfonic acid (AMPSO), tris (hydroxy methyl)amino-methane (Tris), TRIS-Acetate-EDTA (TAE), glycine, bis[2-hydroxyethyl]iminotris[hydroxymethyl]methane (BisTris), or combinations thereof. In certain embodiments, wherein such buffers are used in gel electrophoresis separations the buffer can also include ethylene diamine tetraacetic acid (EDTA).
The concentration of such buffers used in the methods described herein is from about 0.1 mM to 1 M. In certain embodiments the concentration is between 10 mM to about 1 M. In certain embodiments the concentration is between about 20 mM and about 500 mM, and in other embodiments the concentration is between about 50 mM and about 300 mM. In certain embodiments, the buffer concentration is from about 0.1 mM to about 50 mM, while in other embodiments the buffer concentration if from about 0.5 mM to about 20 mM.
The pH will vary depending upon the particular assay system, generally within a readily determinable range wherein one or more of the sulfonic acid moieties is deprotonated.
In certain embodiments, buffers used in the methods described herein have a pH between 5 and 9 at ambient temperature. In certain embodiments the buffer has a pH between 6 and 8.5 at ambient temperature. In certain embodiments the buffer has a pH between 6 and 8 at ambient temperature. In certain embodiments the buffer has a pH between 6 and 7 at ambient temperature. In certain embodiments the buffer has a pH between 5 and 9 at 25° C. In certain embodiments the buffer has a pH between 6 and 8.5 at 25° C. In certain embodiments the buffer has a pH between 6 and 8 at 25° C. In certain embodiments the buffer has a pH between 6 and 7 at 25° C.
In certain embodiments, the samples used in the methods described herein have a non-ionic detergent to the sample. Non-limiting examples of such non-ionic detergents added to the samples used in the methods described herein are polyoxyalkylene diols, ethers of fatty alcohols including alcohol ethoxylates (Neodol from Shell Chemical Company and Tergitol from Union Carbide Corporation), alkyl phenol ethoxylates (Igepal surfactants from General Aniline and Film Corporation), ethylene oxide/propylene oxide block copolymers (PLURONIC⢠Series from BASF Wyandotte Corporation), polyoxyethylene ester of a fatty acids (Stearox CD from Monsanto Company), alkyl phenol surfactants (Triton series, including Triton X-100 from Rohm and Haas Company), polyoxyethylene mercaptan analogs of alcohol ethoxylates (Nonic 218 and Stearox SK from Monsanto Company), polyoxyethylene adducts of alkyl amines (Ethoduomeen and Ethomeen surfactants from Armak Company), polyoxyethylene alkyl amides, sorbitan esters (such as sorbitan monolaurate) and alcohol phenol ethoxylate (Surfonic from Jefferson Chemical Company, Inc.). Non-limiting examples of sorbitan esters include polyoxyethylene(20) sorbitan monolaurate (TWEEN20), polyoxyethylene(20) sorbitan monopalmitate (TWEEN40), polyoxyethylene(20) sorbitan monostearate (TWEEN60) and polyoxyethylene(20) sorbitan monooleate (TWEEN 80). In certain embodiments, the concentration of such non-ionic detergents added to a sample is from 0.01 to 0.5%. In other embodiments the concentration is from about 0.01 to 0.4 vol. %. In other embodiments the concentration is from about 0.01 to 0.3 vol. %. In other embodiments the concentration is from about 0.01 to 0.2 vol. %. In other embodiments the concentration is from about 0.01 to 0.1 vol. %.
The compounds and compositions described herein may, at any time before, after or during an assay, be illuminated with a wavelength of light that results in a detectable optical response, and observed with a means for detecting the optical response. In certain embodiments, such illumination can be by a violet or visible wavelength emission lamp, an arc lamp, a laser, or even sunlight or ordinary room light, wherein the wavelength of such sources overlap the absortion spectrum of a fluorpohore or chromaphore of the compounds or compositions described herein. In certain embodiments, such illumination can be by a violet or visible wavelength emission lamp, an arc lamp, a laser, or even sunlight or ordinary room light, wherein the fluorescent compounds, including those bound to the complementary specific binding pair member, display intense visible absorption as well as fluorescence emission.
In certain embodiments, the sources used for illuminating the fluorpohore or chromophore of the compounds or compositions described herein include, but are not limited to, hand-held ultraviolet lamps, mercury arc lamps, xenon lamps, argon lasers, laser diodes, blue laser diodes, and YAG lasers. These illumination sources are optionally integrated into laser scanners, flow cytometer, fluorescence microplate readers, standard or mini fluorometers, or chromatographic detectors. These fluorescence emission of such fluorophores is optionally detected by visual inspection, or by use of any of the following devices: CCD cameras, video cameras, photographic film, laser scanning devices, fluorometers, photodiodes, photodiode arrays, quantum counters, epifluorescence microscopes, scanning microscopes, flow cytometers, fluorescence microplate readers, or by means for amplifying the signal such as photomultiplier tubes. Where the sample is examined using a flow cytometer, a fluorescence microscope or a fluorometer, the instrument is optionally used to distinguish and discriminate between the fluorescent compounds of the invention and a second fluorophore with detectably different optical properties, typically by distinguishing the fluorescence response of the fluorescent compounds of the invention from that of the second fluorophore. Where a sample is examined using a flow cytometer, examination of the sample optionally includes isolation of particles within the sample based on the fluorescence response by using a sorting device.
In certain embodiments, fluorescence is optionally quenched using either physical or chemical quenching agents. Examples of quenching moieties include, but are not limited to DABCYL (i.e., 4-(4â˛-dimethylaminophenylazo)-benzoic acid) succinimidyl ester, diarylrhodamine carboxylic acid, succinimidyl ester (or QSY-7), and 4â˛,5â˛-dinitrofluorescein carboxylic acid, succinimidyl ester (or QSY-33) (all available, for example, from Molecular Probes), quencher 1 (Q1; available from Epoch Biosciences, Bothell, Wash.), or âBlack hole quenchersâ BHQ-1, BHQ-2, and BHQ-3 (available from BioSearch Technologies, Inc., Novato, Calif.).
In another aspect, the present invention provides kits that include N3-dATP, an enzyme; an azide reactive reporter molecule, carrier molecule or solid support.
In one aspect, the invention includes a kit for labeling a nucleic acid that includes at least one label that comprises a terminal alkyne, a solution comprising copper, and a solution that comprises a copper (I) chelator. The kit can further comprise a solution that comprises a reducing agent, one or more buffers, or one or more detergents.
In one embodiment, an alkyne label provided in a kit is a fluorophore, such as, but not limited to, a xanthene, coumarin, borapolyazaindacene, pyrene and cyanine. In one embodiment, a kit provides two or more different terminal alkyne-containing labels one or more of which is a fluorophore, In other embodiments, an alkyne label provided in a kit is a tag, such as but not limited to a peptide or a hapten, such as biotin.
In preferred embodiments, a copper (I) chelator provided in the kit is a 1,10 phenanthroline, preferably bathocuproine disulfonic acid. In some embodiments, copper is provided in the form of a copper sulfate or copper acetate solution. In some embodiments, a reducing agent is provided in the form of ascorbate.
In another aspect, the invention includes a kit for labeling a nucleic acid that includes at least one label that comprises an azido group, a solution comprising copper, an a solution that comprises a copper (I) chelator. The kit can further comprise a solution that comprises a reducing agent, one or more buffers, or one or more detergents.
In one embodiment of this aspect, an azido-containing label provided in a kit is a fluorophore, such as, but not limited to, a xanthene, coumarin, borapolyazaindacene, pyrene and cyanine. In other embodiments, an azido label provided in a kit is a tag, such as but not limited to a peptide or a hapten, such as biotin.
In one embodiment, a kit provides two or more different azido-containing labels one or more of which is a fluorophore, In preferred embodiments, a copper (I) chelator provided in the kit is a 1,10 phenanthroline, preferably bathocuproine disulfonic acid. In some embodiments, copper is provided in the form of a copper sulfate or copper acetate solution. In some embodiments, a reducing agent is provided in the form of ascorbate.
A detailed description of the invention having been provided above, the following examples are given for the purpose of illustrating the invention and shall not be construed as being a limitation on the scope of the invention or claims.
TRAPeze⢠TELOMERASE assays (Chemicon Kit 57700) were performed with N3-dUTP and N3-dATP. Each reaction contained the following:
The reaction was carried out in an Applied Biosystems PCR instrument under the following conditions: 30° C.â30 minutesâhold
The results of the amplification are shown in FIG. 4, and the listing of the dNTP combinations in each reaction (gel lane) is given in Table 1.
| TABLE 1 |
| dNTP combinations in the reactions |
| Lanes (in gel) | dNTPs |
| 1 | 50 ÎźM of dATP dTTP, dCTP, and dGTP. |
| 2 | 50 ÎźM of N3 -dUTP, dATP, dCTP, and dGTP |
| 3 | 50 ÎźM of N3 -dATP, dATP, dCTP, and dGTP |
| 4 | 50 ÎźM of N3 -dUTP, N3 -dATP, dCTP, and dGTP |
From FIG. 4 it is seen that N3-dUTP is incorporated by Taq polymerase (lane 2), and that N3-dATP is incorporated both by telomerase and Taq polymerase (lane 3).
TRAPeze⢠TELOMERASE assays (Chemicon Kit 57700) were performed with N3-dUTP and N3-dATP. Each reaction contained the following:
The reaction was carried out in an Applied Biosystems PCR instrument under the following conditions: 30° C.â30 minutesâhold (At the end of the 30 minute Telomerase reaction, appropriate volumes of azido-dNTPs were added to bring the final concentration to 50 ÎźM. The PCR step was then carried out after that)
The results of the amplification are shown in FIG. 5, and the listing of the dNTP combinations in each reaction (gel lane) is given in Table 2.
| TABLE 2 |
| dNTP combinations in the reactions |
| Lanes (in gel) | dNTPs |
| 1 | â50 ÎźM of dATP, dTTP, dCTP, and dGTP. |
| 2 | â50 ÎźM N3 -dUTP, dATP, dCTP, and dGTP |
| 3 | â10 ÎźM N3 -dUTP, 50 ÎźM dATP, dCTP, and dGTP |
| 4 | ââ1 ÎźM N3 -dUTP, 50 ÎźM dATP, dCTP, and dGTP |
| 5 | 0.1 ÎźM N3 -dUTP, 50 ÎźM dATP, dCTP, and dGTP |
| 6 | â50 ÎźM N3 -dATP, dTTP, dCTP, and dGTP |
| 7 | â10 ÎźM N3 -dATP, 50 ÎźM dATP, dCTP, and dGTP |
| 8 | ââ1 ÎźM N3 -dATP, 50 ÎźM dATP, dCTP, and dGTP |
| 9 | 0.1 ÎźM N3 -dATP, 50 ÎźM dATP, dCTP, and dGTP |
From FIG. 5 it is seen that N3-dUTP is not incorporated by the Telomerase enzyme within a range of 100 nM to 50 micro molar, but it is incorporated by Taq polymerase (lane 2-5). However, N3-dATP is incorporated both by telomerase and Taq polymerase (lanes 6-9).
TRAPeze⢠TELOMERASE assays (Chemicon Kit 57700) were performed with N3-dATP. Each reaction contained the following:
The reaction was carried out in an Applied Biosystems PCR instrument under the following conditions: 30° C.â30 minutesâhold
The reactions were cleaned through size exclusion columns (Chromaspin TE30, Clonetech). The eluate was then subjected to click reaction using a final concentration of 25% propylene glycol; 1 mM copper sulfate; 10 mM bathocuproinedisulfonic acid (BCS), 10 mM Sodium Ascorbate and 50 ÎźM alkyne-TAMRA. The reaction was performed for 30 minutes at room temperature. This was followed by clean up on a size exclusion as described above. The reactions were pulled out, mixed with the TRACK-IT Cyan orange loading dye. The reactions (see FIG. 6 and Table 3) were subjected to a 20% TBE-polyacrylamide gel. The gel was run at 10V for 10 minutes; 190V for 90 minutes. The gel was pulled out of the cassette and scanned for TAMRA (Ex: 530 nm Em: 580 nm). The same gel was then stained with SYBR GOLD for 30 minutes and then scanned as described above.
The results of the amplification are shown in FIG. 6, and the listing of the dNTP combinations in each reaction (gel lane) is given in Table 3.
| TABLE 3 |
| dNTP combinations in the reactions |
| Lanes | |
| (in gel) | dNTPs |
| 1 or a | 50 ÎźM of dATP, dTTP, dCTP, and dGTP. |
| 2 or b | 50 ÎźM of dATP, dTTP, dCTP, and dGTP |
| 3 or c | 10 ÎźM N3 -dATP + 40 ÎźM dATP, 50 ÎźM dATP, dCTP, and dGTP |
| 4 or d | 30 ÎźM dATP + 20 ÎźM N3 -dATP, 50 ÎźM dTTP, dCTP, and dGTP |
| 5 or e | 25 ÎźM dATP + 25 ÎźM N3 -dATP, 50 ÎźM dTTP, dCTP, and dGTP |
| 6 or f | 20 ÎźM dATP + 30 ÎźM N3 -dATP, 50 ÎźM dTTP, dCTP, and dGTP |
| 7 or g | 10 ÎźM dATP + 40 ÎźM N3 -dATP, 50 ÎźM dTTP, dCTP, and dGTP |
| 8 or h | 50 ÎźM N3 -dATP, 50 ÎźM dTTP, dCTP, and dGTP |
From FIG. 6 it is seen that there is a dose dependence of the âclickâ reaction with the best signal coming from the 100% 50 ÎźM of N3-dATP. Also the PCR reaction with 50 ÎźM of N3-dATP was not as efficient.
TRAPeze⢠TELOMERASE assays (Chemicon Kit 57700) were performed with ethynyl-dUTP. Each reaction contained the following:
The reaction was carried out in an Applied Biosystems PCR instrument under the following conditions: 30° C.â30 minutesâhold
The reactions were cleaned through size exclusion columns (Chromaspin TE30, Clonetech). The eluate was then subjected to click reaction using a final concentration of 25% propylene glycol; 1 mM copper sulfate; 10 mM BCS, 10 mM Sodium Ascorbate and 50 ÎźM azido-TAMRA. The reaction was performed for 30 minutes at room temperature. This was followed by clean up on a size exclusion as described above. The reactions were pulled out, mixed with the TRACK-IT Cyan orange loading dye. The reactions (see FIG. 7 and Table 4) were subjected to a 20% TBE-polyacrylamide gel. The gel was run at 10V for 10 minutes; 190V for 90 minutes. The gel was pulled out of the cassette and scanned for TAMRA (Ex: 530 nm Em: 580 nm). The same gel was then stained with SYBR GOLD for 30 minutes and then scanned as described above.
The results of the amplification are shown in FIG. 7, and the listing of the dNTP combinations in each reaction (gel lane) is given in Table 4.
| TABLE 4 |
| dNTP combinations in the reactions |
| Lanes | |
| (in gel) | dNTPs |
| 1 or A | 50 ÎźM of dATP, dTTP, dCTP, and dGTP. |
| 2 or B | 50 ÎźM of dATP, dTTP, dCTP, and dGTP |
| 3 or C | 40 ÎźM dTTP + 10 ÎźM e-dUTP, 50 ÎźM dATP, dCTP, and dGTP |
| 4 or D | 30 ÎźM dTTP + 20 ÎźM e-dUTP, 50 ÎźM dATP, dCTP, and dGTP |
| 5 or E | 25 ÎźM dTTP + 25 ÎźM e-dUTP, 50 ÎźM dATP, dCTP, and dGTP |
| 6 or F | 20 ÎźM dTTP + 30 ÎźM e-dUTP, 50 ÎźM dATP, dCTP, and dGTP |
| 7 or G | 10 ÎźM dTTP + 40 ÎźM e-dUTP, 50 ÎźM dATP, dCTP, and dGTP |
| 8 or H | 50 ÎźM e-dUTP, 50 ÎźM dTTP, dCTP, and dGTP |
From FIG. 7 it is seen that there is a dose dependence of the click reaction with the best signal coming from the 100% 50 ÎźM of N3-dATP. Also the PCR reaction with 50 ÎźM of E-dUTP was as efficient as with natural dNTPs.
The reaction was carried out in an Applied Biosystems PCR instrument under the following conditions: 30° C.â30 minutesâhold
The reactions were cleaned through size exclusion columns (Chromaspin TE30, Clonetech). The eluate was then subjected to click reaction using a final concentration of 25% propylene glycol; 1 mM copper sulfate; 10 mM BCS, 10 mM Sodium Ascorbate and 50 ÎźM azido-TAMRA or 50 ÎźM alkyne-TAMRA. The reaction was performed for 30 minutes at room temperature. This was followed by clean up on a size exclusion as described above. The reactions were pulled out, mixed with the TRACK-IT Cyan orange loading dye. The reactions (see FIG. 8 and Table 4) were subjected to a 20% TBE-polyacrylamide gel. The gel was run at 10V for 10 minutes; 190V for 90 minutes. The gel was pulled out of the cassette and scanned for TAMRA (Ex: 530 nm Em: 580 nm). The same gel was then stained with SYBR GOLD for 30 minutes and then scanned as described above.
FIG. 8 shows a 20% TBE PAGE that has been scanned for TAMRA (left; Ex 532-Em 580) followed by staining with SYBR GOLD (right). Lanes 1, 2, 3 and 4 (or a, b, c, d) have been loaded with 2 ul of the PCR product while lanes 5, 6, 7 and 8 (or f, g, h, l, k) have been loaded with 6 ul of the PCR product. The fact that one can see ladders or the 36 bp internal control band in a TRAP assay indicates that not only can Telomerase incorporate azido or alkyne modified compounds but Taq polymerase can also do the same, since the subsequent step in TRAP assay after Telomerase reaction is the PCR step.
Single stranded DNA oligomers shown below were used for a primer extension assay using âclickableâ dNTPs. The oligos used were designed to titrate the dUTP in the sequence.
| Oligoâ3 | |
| (SEQâIDâN0:â1) | |
| 5â˛-TTAGGGTTAGGGTTAGGGTTTGGGTTTGGGTTTGGGTTTGG | |
| GTTTGGGTTTGGGCTGGCCGTCGTTTTAC | |
| Oligoâ4 | |
| (SEQâIDâNO:â2) | |
| 5â˛-TTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTTAGG | |
| GTTTGGGTTTGGGCTGGCCGTCGTTTTAC |
| (SEQâIDâNO:â3) | |
| 5â˛-GTAAAACGACGGCCAG-3Ⲡ|
100 pmol of Oligo 3 or 4 were annealed with the 500 pmol M13 primer in an annealing buffer (7 mM Tris-HCl pH 7.5, 2.5 mM MgCl2, 20 mM NaCl). The reaction mix was heated up to 95 C for 5 minutes, 20 minutes at 65 C and then cooled to ambient temperatures. All the reactions were supplied with 50 uM dNTPs each. The dNTP mix consisted of 50 uM of e-dUTP, dATP, dGTP, dCTP each. The reaction was initiated by addition of the polymerase. Details of the different reactions are given in Table 5:
| TABLE 5 | |||
| Lane | Oligo | polymerase | Conditions of experiment |
| 1 or a | O3 | Klenow (Exo â ve) | Annealing buffer/30 â @37 C. |
| 2 or b | O3 | Taq polymerase | 1X TS buffer (1.5 mM MgCl2)/ |
| 30 â @72 C. for 30, in a dry bath | |||
| 3 or c | O3 | Pfu (Turbo) | 1X Pfu turbo buffer/95 C. for 30 |
| seconds; 59 C. for 1 minute; 72 C. | |||
| for 2â in an applied biosystems | |||
| PCR instrument | |||
| 4 or d | O3 | Taq polymerase | 1X annealing buffer (2.5 mM |
| MgCl2)/same conditions as for | |||
| reaction 3 | |||
| 5 or e | O4 | Klenow (Exo â ve) | Annealing buffer/30 â @37 C. |
| 6 or f | O4 | Taq polymerase | 1X TS buffer (1.5 mM MgCl2)/ |
| 30 â @72 C. for 30, in a dry bath | |||
| 7 or g | O4 | Pfu (Turbo) | 1X Pfu turbo buffer/95 C. for 30 |
| seconds; 59 C. for 1 minute; 72 C. | |||
| for 2â in an applied biosystems | |||
| PCR instrument | |||
| 8 or h | O4 | Pfu (Turbo) | 1X Pfu turbo buffer/95 C. for 30 |
| seconds; 59 C. for 1 minute; 72 C. | |||
| for 2â in an applied biosystems | |||
| PCR instrument | |||
The extended dsDNA product was subjected to a âclickâ reaction. The volume of the reaction product was brought to 25 of 50 ul. The final concentrations of the reaction components were 25% propylene glycol, 1 mM Copper (II), 10 mM Sodium Ascorbate, 10 mM BCS and 50 uM azido-TAMRA. The reactions were rocked on a tube shaker for 30-60 minutes at room temperature. The contents of the tube were then subjected to size exclusion chromatography using Chroamspin columns. The purified ds DNA was then mixed with 1/10 volume of 10Ă blue juice and loaded on to a 2-% TBE PAGE which was run at constant 200V for 2 hours.
After completion of the run the gel was scanned for TAMRA (Ex: 530 nm and Em 580 nm), the results of which are shown on the left part of FIG. 9. After scanning for TAMRA the gel was stained with 1:10,000 fold dilution of SYBR GOLD in 1ĂTBE and scanned for signal (Ex: 473 Em: 580) shown on the right.
TRAPeze⢠TELOMERASE assays (Chemicon Kit 57700) were performed with BCS. Each reaction contained the following:
The reaction was carried out in an Applied Biosystems PCR instrument under the following conditions: 30° C.â30 minutesâhold
The reactions were cleaned through size exclusion columns (Chromaspin TE30, Clonetech). The eluate was then subjected to click reaction using a final concentration of 25% propylene glycol; 1 mM copper sulfate; in presence or absence of 10 mM BCS (see Table 6), 10 mM Sodium Ascorbate and 50 ÎźM alkyne-TAMRA. The reaction was performed for 30 minutes at room temperature. This was followed by clean up on the size exclusion as described above. The reactions were mixed with the TRACK-IT Cyan orange loading dye and were subjected to a 20% TBE-polyacrylamide gel (see FIG. 10). The gel was run at 10V for 10 minutes; 190V for 90 minutes. The gel was pulled out of the cassette and scanned for TAMRA (Ex: 530 nm Em: 580 nm). The same gel was then stained with SYBR GOLD for 30 minutes and then scanned with an excitation source at 473 nm and emission at 520 nm.
| TABLE 6 | |||
| Chelator for click | |||
| Lane | Telomerase | labeling | Comments |
| 1 or a | 500 cells (Telomerase +ve) | none | All other components of the click |
| 2 or b | 500 cells (Telomerase +ve) | 10 mM BCS | reaction are as described |
| 3 or c | 500 cells (Telomerase âve) | None | Sau 3 cells do not express |
| 4 or d | 500 cells (Telomerase âve) | 10 mM BCS | Telomerase. |
| 5 or e | Heat inactivated cells | None | Telomerase enzyme is sensitive to |
| 6 or f | Heat inactivated cells | 10 mM BCS | heat. Heating the +ve control cells |
| for 10 minutes at 80 C. destroys | |||
| telomerase activity. | |||
The results of the amplification are shown in FIG. 10, where the gel shows a high molecular weight product that appears in the absence of BCS irrespective of the activity of Telomerase. However, the TRAP âladderingâ pattern of the assay product is restored upon addition of the BCS.
8a) Helicase Dependent Amplification (See FIG. 11)
a. mHDA: A mixture of DNA Helicase, a DNA polymerase, deoxyoligonucleotide primers and deoxynucleotide triphosphates with either: (1) an azido-dATP or an ethylene-dUTP (in place of dTTP) or (2) an azido-dUTP or ethylene-dUTP in addition to the four dNTPs are added together. The reaction mixture is heated to 95° C. for 5 minutes followed by incubation of the reaction mix at 37° C. for 1 to 3 hours depending upon the length of the target and amount of final product required.
After completion the polymerase reaction is complete, Click reaction components are added to the amplified DNA. The click reaction components are CuSo4, BCS, Na-Ascorbate and either an azido-fluorophore or an alkyne-fluorophore. The reaction is then run directly on an agarose gel or detected using a secondary matrix.
8b) b. tHDA: A mixture of DNA Helicase, Bst DNA polymerase (from Bacillus stearoethermophillus), deoxyoligonucleotide primers and deoxynucleotide triphosphates with either: (1) an azido-dATP or an ethylene-dUTP (in place of dTTP) or (2) an azido-dUTP or ethylene-dUTP in addition to the four dNTPs are added together. The reaction mixture is heated to 95° C. for 5 minutes followed by incubation of the reaction mix at 65° C. for 1 to 2 hours depending upon the length of the target and amount of final product required.
After completion the polymerase reaction is complete, Click reaction components are added to the amplified DNA. The click reaction components are CuSO4, BCS, Na-Ascorbate and either an azido-fluorophore or an alkyne-fluorophore. The reaction is then run directly on an agarose gel.
c. Circular HDA: This method of DNA amplification uses T7 Helicase and T7DNA polymerase and is similar to rolling circle DNA amplification. Other accessory proteins in this platform include T7 single strand DNA binding protein. This platform can be used for in vitro amplification of plasmid or covalent closed circular DNA. This technology has significant use in clinical diagnostics and molecular biology e.g., in DNA sequencing and mutagenesis. As described above azido or alkyne modified nucleotides triphosphates are used during the DNA amplification methods and then either the alkyne or azido dye molecules are added to create a label on the newly synthesized DNA.
d. rt-HDA: this method takes advantage of the reverse transcriptase activity of reverse transcriptase under constant temperature conditions combined with polymerase activity of Bst polymerase. Detection of the amplified DNA is performed as described above using an azido or alkyne dNTPs and azido/alkyne dyes are added at the end of the amplification reaction under conditions that promote a Click reaction between the modified dNTP and the dye label.
Strand Displacement Amplification (SDA) (see FIG. 12):
SDA is an isothermal nucleic acid amplification method. Primer containing a restriction site is annealed to template. Amplification primers are then annealed to 5Ⲡadjacent sequences (form a nick) and amplification is started at a fixed temperature. Newly synthesized DNA are nicked by a restriction enzyme, polymerase starts amplification again, displacing the newly synthesized strands. One hundred and nine copies of DNA can be made in one reaction. For better labeling and detection of the amplified product, an azido or alkyne dUTP is added which will be incorporated into the newly synthesized strand because the enzyme is a member of a family of pol I DNA polymerases which have been shown in the art to incorporate azido or alkyne modified dNTPs using Taq polymerase. Once the amplification reaction is finished, the azido or alkyne dNTP in the polymerized strand is ligated to an azido or alkyne dye under conditions that will promote the Click reaction.
Loop Mediated Isothermal DNA Amplification:
LAMP (Loop-mediated Isothermal Amplification) method is a nucleic acid amplification method that uses 4 primers, which recognize 6 distinct regions on the target gene and a DNA polymerase with strand displacement activity to carry out reaction under isothermal condition. Amplification and detection of a gene can be completed in a single step, by incubating the mixture of samples, primers, DNA polymerase with strand displacement activity and substrate at a constant temperature between 60-65° C. The method provides high amplification efficiency, with DNA being amplified 109-110 times in 15-60 minutes. Because of its high specificity, the presence of amplified product can indicate the presence of target gene. Since this also uses Bst DNA polymerase, Click chemistry can be used to detect labeling.
Rolling Circle DNA Amplification/Phi29 Based DNA Amplification:
This method uses phi 29 DNA polymerase and can amplify DNA (Linear or circular) with high fidelity and efficiency. Many labs, industrial and academic use it for clinical pathology, academic research and preparation of DNA probes from in situ hybridizations. We propose to do either of the following steps:
(1) add either an azido-dUTP or ethylene-dUTP to replace dTTP in the reaction mix or
(2) add either an azido-dUTP or ethylene-dUTP in addition to the four dNTPs
Once the polymerase reaction is complete, Click reaction components are added to the amplified DNA. The Click reaction components are CuSo4, BCS, Na-Ascorbate and either an azido-fluorophore or an alkyne-fluorophore. The reaction can then be run directly on an agarose gel
As has been described above, Click chemistry can be used between azido/alkyne nucleotides and alkyne/azido dyes to label and detect DNA in other isothermal DNA amplification technologies such as multiple displacement amplification, transcription mediated amplification, etc.
Preparation of Probes for ISH/FISH
The probes for in situ hybridization can also be made using âClickâ labeling. Using standard polymerases e.g., Klenow (Exo-), T7 DNA polymerase (Sequenase) or Bst polymerase (Large fragment), one can amplify a template strand for a given sequence using primers as well as using ethynyl or azido dNTPs. The prepared DNA fragments can then be purified and subjected to the click reaction with either azido or alkyne dyes or nanoparticles to create a labeled probe. This is suited to both chromogenically detectable in situ hybridization as well as fluorescent (dyes and Qdots) based probes.
A major advantage that is predicted is that this kind of labeling can be done at the time of diagnostic or clinical assay. In addition the applications include automated in situ hybridization platforms such as instruments from Dako, Ventana Medical Systems, and Vision Biosystems where the hybridization can be followed by the Click reaction to generate the signal.
First Strand cDNA Synthesis (RT-PCR)
As has been demonstrated, ethynyl-dUTP or azido-dATP are incorporated by the telomerase enzyme which is a reverse transcriptase (RNA dependent DNA polymerase). Therefore, this methodology can be used to detect products of RT-PCR. In this method the nucleotide mix can contain either an ethynyl or azido dNTP and enzymes such as reverse transcriptase and DNA polymerase. The product of such an experiment is purified and then subjected to the Click based labeling method. The final labeled product is purified either by precipitation or size exclusion chromatography.
Second Strand cDNA Synthesis (Primer Extension)
The isothermal DNA extension assay shown above was carried out with various different polymerase and serves as an example of second strand cDNA synthesis.
Preparation of RNA Probes for FISH
Currently, the two methods of choice for preparation of the RNA FISH probes are the following:
(1) The small RNA oligonucleotides that can be labeled either via aminoallyl-NHS ester chemistry.
(2) The incorporation of modified nucleotides using in vitro transcription system to generate a RNA probe.
Based on these two technologies and our understanding of the âClickableâ nucleotides, DNA dependent RNA polymerase from phage T7 or SP6 is used to incorporate the ethynyl or azido oligonucleotides to produce a modified RNA probe that is subjected to Click chemistry using either azido or alkyne fluorescent or chromogenic labels. This is used to generate fluoregenic or chromogenic RNA probes.
Method to Prepare Peptide-Nucleic Acid Conjugates Using Click Chemistry:
A peptide with a O-GlcNac modification on one or more amino acids is subjected to a Gal T1 reaction in the presence of UDP-GalNAz. This results in an azido modified peptide. As explained above, an oligodeoxynucleotide can be created using either alkyne or azido linked nucleotides. A peptide-nucleic acid conjugate is then created by reacting the Azido-linked peptide and ethynyl decorated oligonucleotides in presence of 1 or 2 mM copper, 10 mM Sodium Ascorbate and 20 mM BCS.
Induce apoptosis in cells using the desired method. It may be desirable to prepare a negative control sample using the cell line of interest by incubating cells in the absence of inducing agent.
Suspend 1-2Ă106 cells in 0.5 mL of phosphate-buffered saline (PBS). Add the cell suspension into 5 mL of 1% (w/v) paraformaldehyde in PBS and place on ice for 15 minutes. Centrifuge the cells for 5 minutes at 300Ăg and discard the supernatant. Wash the cells in 5 mL of PBS then pellet the cells by centrifugation. Repeat. Resuspend the cells in 0.5 ml of PBS. Add the cells to 5 mL of ice-cold 70% (v/v) ethanol. Let the cells stand for a minimum of 30 minutes on ice or in a â20° C. freezer. In some biological systems, storage of the cells at â20° C. in 70% (v/v) ethanol for at least 12-18 hours prior to performing the assay yields the best results. Cells can be stored at â20° C. for several days before use.
Resuspend the positive and negative control cells by swirling the vials. Remove 1 mL aliquots of the control cell suspensions (approximately 1Ă106 cells/mL) and place in 12Ă75 mm flow cytometry centrifuge tubes. Centrifuge (300Ăg) the control cell suspensions for 5 minutes and remove the 70% (v/v) ethanol by aspiration, being careful to not disturb the cell pellet. Resuspend the control cells of each tube with 1 mL of Wash Buffer (Component H of Molecular Probes product A23210). Centrifuge for 5 minutes at 300Ăg and remove the supernatants by aspiration. Repeat. Prepare a DNA-labeling solution; a total volume of 50 ÎźL is required for each sample. Mix 10 ÎźL of reaction buffer (Compenent G, Molecular Probes Product A23210), 0.75 ÎźL of TdT enzyme (terminal deoxynucleotidyltransferase. Component C, Molecular Probes Product A23210), 8.0 ÎźL of EdUTP (violet cap) and 31.25 ÎźL of dH2O. The DNA-labeling solution is active for approximately 24 hours. Resuspend the control cell pellets of each tube in 50 ÎźL of the DNA-labeling solution. Incubate the cells in the DNA-labeling solution for 60 minutes at 37° C. in a temperature controlled bath. Shake the samples every 15 minutes to keep the cells in suspension. For samples other than the control cells, incubation times at 37° C. may need to be adjusted to longer or shorter periods depending on the characteristics of the experimental samples. The DNA-labeling reaction for the control cells can also be carried out at 22-24° C. overnight. At the end of the incubation time add 1.0 mL of Rinse Buffer (Compenent I, Molecular Probes product A23210) to each tube and centrifuge at 300Ăg for 5 minutes. Remove the supernatants by aspiration. Repeat the cell rinsing with 1.0 mL of Rinse Buffer. Centrifuge the samples at 300Ăg and remove the supernatants by aspiration. Prepare 100 ÎźL of Click Chemistry labeling solution for each sample by mixing 5.0 ÎźL of the Alexa Fluor 488 dye-labeled azide with 95 ÎźL of Rinse Buffer, containing copper sulfate, sodium ascorbate, and BCS in concentrations and proportions as described above. Resuspend the cell pellets in 100 ÎźL of the Click Chemistry labeling solution. Incubate the cells in this solution for 1-3 hours at room temperature. Protect the samples from light during the incubation. Add 0.5 mL of the Propidium Iodide/RNase A Staining Buffer (Compenent F, Molecular Probes product A23210) to each sample. Incubate the cells for an additional 30 minutes at room temperature. Protect the samples from light during the incubation. Analyze the samples by flow cytometry. It is recommended that the samples be analyzed within 3 hours of completing the staining procedure. For microscopy applications, it is recommended that the cells be deposited onto slides after the Click Chemistry labeling staining step, but prior to the propidium iodide/RNase treatment. Cells that have undergone apoptosis should fluorescence brightly when viewed with filter sets appropriate for fluorescein. For adherent cell lines, detached cells present in the supernatant have a higher probability of being apoptotic than do cells that have remained adherent. Detached cells should be collected prior to trypsinization of the adherent cell layer.
Mild acid hydrolysis of digoxin will cleave the sugar moieties and provide the known alcohol derivative. Reaction of this alcohol with phosgene, followed by alkylation with 6-amino-hexanyl-1-azide trifluoroacetic acid salt, will provide the desired azido-digoxin analogue.
Mild acid hydrolysis of digoxin will effectively cleave the sugar moieties and provide the known alcohol derivative. Reaction of this alcohol with phosgene, followed by alkylation with propargylamine will provide the desired alkynyl-digoxin analogue.
The synthesis of DapoxylÂŽ alkyne is shown in the following reaction scheme.
To a solution of DapoxylÂŽ carboxylic acid, succinimidyl ester (50 mg, 0.12 mmol) in DMF (0.4 mL) at RT was added propargylamine (42 ÎźL, 0.61 mmol). The initial clear orange solution turned yellow and cloudy. After Ë15 min at RT the reaction was complete, and the solution was concentrated to dryness. The residue was purified via HPLC to afford the product (36 mg, 84%). TLC (10% EtOAc, CHCl3) Rf=0.30; ESI m/z 346 (M+, C21H19N3O2 requires 346).
The synthesis of 5-Carboxytetramethyl rhodamine alkyne (5-TAMRA-alkyne) is shown in the following reaction scheme.
To a solution of 5-carboxytetramethyl rhodamine, succinimidyl ester (5-TAMRA-SE, 0.10 g, 0.19 mmol) in DMF (0.5 mL) was added propargylamine (25 ÎźL, 0.38 mmol) and H2O (0.5 mL). After stirring the solution for 30 min at RT, the solution was concentrated in vacuo. Purification via HPLC (Phenomenex Prodigy ODS, internal diameter 21.2 mm, eluent 25-40% CH3CN in 25 mM TEAA, pH 4.7, flow rate of 15 mL/min) gave 68 mg of product (82%, a purple solid) tR=23-33 min. TLC(CH3CN: H2O, 8:2) Rf=0.67.
The synthesis of Biotin alkyne is shown in the following reaction scheme.
To a solution of EZ-link NHS-PEO4-biotin (25 mg, 0.004 mmol, Pierce) in DMF (0.1 mL) was added propargylamine (0.1 mL). After stirring the solution for 90 min at RT, some starting material was still seen. Additional propargylamine (0.2 mL) was added and the solution was stirred for another 60 min. The solution was concentrated in vacuo. The crude material was purified via HPLC to afford 14.4 mg (64%) of the product as a yellow solid. TLC(CHCl3: MeOH, 7:1) Rf=0.23; ESI m/z 529 (M+, C24H40N4O7S requires 529).
The synthesis of Compound 1 is shown in the following reaction scheme.
To a solution of Alexa FluorÂŽ 488 carboxylic acid, succinimidyl ester, dilithium salt (mixed isomers, 50 mg, 0.079 mmol) in DMF (2.0 mL) was added propargylamine (54 âĄL, 0.79 mmol). The solution was stirred overnight at RT. The initial deep red solution turned pale yellow in color and became clear. The solution was concentrated in vacuo and purified via silica gel thin layer chromatography (prep plate, 20% H2O, CH3CN) to afford the product (20 mg, 44%) as an orange solid. TLC (3:1, CH3CN:H2O) Rf=0.70; ESI neg m/z 570 (M+, C24H16N3O10S2â requires 570).
The synthesis of Compound 2 is shown in the following reaction scheme.
To a solution of Alexa FluorÂŽ 532 carboxylic acid, succinimidyl ester (50 mg, 0.070 mmol) in DMF (2.2 mL) was added propargylamine (100 ÎźL, 1.46 mmol). The solution was stirred overnight at RT. H2O (1.0 mL) was added to the solution and the solution was stirred an additional hour. The solution was concentrated in vacuo and the crude material was purified via HPLC to afford the product (30 mg, 65%). TLC (8:2, CH3CN:H2O) Rf=0.58; ESI m/z 664 (M+, C33H33N3O8S2 requires 664).
The synthesis of Compound 3 is shown in the following reaction scheme.
To a solution of Alexa FluorÂŽ 633 carboxylic acid, succinimidyl ester, bis(triethylammonium salt) (50 mg, 0.041 mmol) in DMF (2.0 mL) was added propargylamine (28 ÎźL, 0.40 mmol). The solution was stirred overnight at RT. H2O (1.0 mL) was added to the solution and the solution was stirred an additional hour. The solution was concentrated in vacuo and the product (39 mg, 99%). TLC (8:2, CH3CN:H2O) Rf=0.66; ESI m/z 963 (M+, C40H34F2N3O11S6 requires 963).
The synthesis of triarylphosphine-TAMRA dye is shown in the reaction scheme below.
To a solution of acid 1 (ref: Science 2000, 287, 2007-2010) (80 mg, 0.26 mmol) in CH2Cl2 (5 mL) was added N-(3-dimethylaminopropyl)-Nâ˛-ethylcarbodiimide hydrochloride (EDCI, 75 mg, 0.39 mmol) and N-hydroxysuccinimide (NHS, 5 mg). The solution was stirred at RT. After 2.5 h, amine 2 (50 ÎźL, 0.26 mmol) was added and the solution was stirred overnight. The solution was partitioned between CHCl3 (15 mL) and H2O (5 mL). The organic layer was separated and the aqueous layer was reextracted with CHCl3 (15 mL). The combined organic layers were rinsed once with H2O (5 mL), followed by saturated aqueous NaCl (5 mL). The organic layer was dried over Na2SO4, decanted and concentrated. The crude was purified via chromatography (silica, 2% MeOH, CHCl3) to afford the product (99 mg, 71%) as a clear, yellow oil.
To a solution of 3 (10 mg, 0.018 mmol) in CH2Cl2 (1.0 mL) was added trifluoracetic acid (TFA, 0.5 mL) and the solution was stirred at RT. After 30 min, the solution was concentrated and reevaporated from toluene (2Ă2 mL). The residue (4, 0.018 mmol) was dissolved in DMF (0.2 mL) and N-ethyldiisopropylamine (DIEA, 12 âĄL, 0.72 mmol), and 5-carboxytetramethyl rhodamine, succinimidyl ester (5-TAMRA-SE, 9 mg, 0.022 mmol) were added. The solution was stirred at RT for 2.5 h, concentrated and purified via silica gel (prep plate, 20% H2O in CH3CN) to afford the product (7.4 mg, 48%). TLC (20% H2O in CH3CN)Rf=0.23; ESI m/z 529 (M+, C24H40N4O7S requires 529).
The synthesis of triarylphosphine-biotin is shown in the following reaction scheme.
To a solution of 3 (5.3 mg, 0.010 mmol) in CH2Cl2 (1.2 mL) was added trifluoracetic acid (TFA, 0.5 mL) and the solution was stirred at RT. After 2 h, the solution was concentrated and reevaporated from toluene (2Ă2 mL). The residue (4, 0.010 mmol) was dissolved in DMF (0.1 mL) and N-ethyldiisopropylamine (DIEA, 3 âĄL, 0.02 mmol), and EZ-link NHS-PEO4-biotin (7 mg, 0.012 mmol) were added. The solution was stirred at RT for 1 h, quenched with saturated NH4+Clâ and partitioned between CHCl3 (10 mL) and H2O (1 mL). The aqueous layer was extracted repeatedly with CHCl3 (10 mL per extraction) until no ultraviolet spot was observed by TLC. The combined organic layers were concentrated and purified via silica gel (prep plate, 7:1 CHCl3:MeOH) to afford the product (2.2 mg, 25%). TLC (7:1 CHCl3:MeOH, developed 3 times) Rf=0.50; ESI m/z 909 (M+H+, C46H63N5O10PS requires 909).
To a solution of 6-(amino)-hexanyl-1-azide trifluoroacetic acid salt (see Scheme 1 for synthesis, 0.034 mmol) in DMF (0.1 mL) and DIEA (6.0 ÎźL, 0.034 mmol) was added Cyâ˘5.5 succinimidyl ester (5 mg, 3.4 nmol). After stirring the solution at RT for 10 min, the reaction solution was concentrated in vacuo. The crude was purified via HPLC.
To a solution of 6-(amino)-hexanyl-1-azide trifluoroacetic acid salt (see Scheme 1 for synthesis, 0.052 mmol) in DMF (0.1 mL) and DIEA (9.2 ÎźL, 0.052 mmol) was added Cyâ˘3 succinimidyl ester (5.0 mg, 5.2 nmol). After stirring the solution at RT for 10 min, the reaction solution was concentrated in vacuo. The crude was purified via HPLC.
To a solution of Cyâ˘5.5 succinimidyl ester (GE Amersham, 5.0 mg, 3.7 nmol) in DMF (0.1 mL) was added propargylamine (2.5 ÎźL, 0.037 mmol) and H2O (0.2 mL). The solution was stirred at RT for 30 min then concentrated in vacuo. The crude was purified via HPLC.
To a solution of Cyâ˘3 succinimidyl ester (GE Amersham, 5.0 mg, 5.7 nmol) in DMF (0.1 mL) was added propargylamine (3.9 ÎźL, 0.057 mmol) and H2O (0.2 mL). The solution was stirred at RT for 30 min then concentrated in vacuo. The crude was purified via HPLC.
The synthesis of succinimidyl ester azide is shown in the following reaction scheme.
To a solution of 6-(Boc-amino)-1-hexanol (3.0 g, 13.8 mmol) in CHCl3 (50 mL) was added TEA (3.8 mL, 27.6 mmol) and p-toluenesulfonyl chloride (3.9 g, 20.7 mmol). The solution was stirred at RT overnight, diluted with CHCl3 (200 mL), washed with H2O (4Ă50 mL), rinsed with brine (1Ă50 mL) and dried over Na2SO4. The solution was decanted, concentrated and purified via silica gel chromatography (6.0Ă41 cm, 20-70% EtOAc/hexanes) to afford the product as a white solid (3.5 g, 69%). TLC (35% EtOAC/hexanes) Rf=0.72, UV active.
To a solution of 6-(Boc-amino)-hexanyl-1-p-toluenesulfonate (3.2 g, 8.63 mmol) in DMF (21 mL) was added sodium azide (1.12 g, 17.3 mmol). The solution was refluxed at 95° C. overnight. After cooling to RT, the solution was diluted with Et2O (160 mL) and washed with H2O (100 mL). The aqueous layer was extracted a second time with Et2O (100 mL) and the combined organics were dried over Na2SO4. After decanting and concentrating, the crude material was purified via silica gel chromatography (6Ă26 cm, 25-30% EtOAc/hexanes) to afford the product as a clear, colorless oil (2.0 g, 97%). TLC, (35% EtOAC/hexanes) Rf=0.74, brown spot with ninhydrin stain.
To a solution of 6-(Boc-amino)-hexanyl-1-azide (0.2 g, 0.83 mmol) in CH2Cl2 (1.0 mL) was added TFA (1.0 mL). The solution was stirred at RT for 2 h, evaporated to dryness and re-evaporated twice from toluene. The product, 6-amino-hexanyl-1-azide trifluoroacetic acid salt (0.83 mmol) was used directly without further purification/
6-Amino-hexanyl-1-azide (0.83 mmol) was dissolved in THF (1.0 mL) and N,N-diisopropylethylamine (0.29 mL, 1.65 mmol) was added. The solution was stirred at RT for 10 min then glutaric anhydride (0.47 g, 4.13 mmol) was added. The pale yellow solution was stirred at RT overnight. The reaction solution was diluted with CHCl3 (30 mL) and H2O (10 mL), and acidified to a pH of 1 with 1% HCl; the organic layer was removed. The aqueous layer was extracted two more times with CHCl3 (2Ă30 mL). The combined organic layers were rinsed with brine (2Ă10 mL) and dried over Na2SO4. The solution was decanted, and concentrated. The crude was purified via silica gel chromatography (10% MeOH/CHCl3 containing 0.1% AcOH) to afford the product as a clear, colorless oil (0.16 g, 75%). The column was loaded with 10% MeOH/CHCl3. TLC (10% MeOH/CHCl3 with 0.1% AcOH)Rf=0.41, pink with p-anisaldehyde stain, no UV activity.
To a solution of the (N-6-azido-hexanyl) glutaramide (75 mg, 0.29 mmol) in THF (4.0 mL) was added pyridine (110 ÎźL, 1.36 mmol) followed by succinimidyl trifluoroacetate (200 mg, 0.95 mmol). The clear, colorless solution was stirred at RT for 4 h. The reaction solution was diluted with CHCl3 (20 mL) and rinsed sequentially with 1% AcOH (2Ă5 mL), H2O (2Ă5 mL) and brine (1Ă5 mL). The crude solution was dried over Na2SO4, decanted, and concentrated to afford the product as a clear, colorless oil (0.10 g, 99%). TLC: (1:1, EtOAc/hexanes) Rf=0.64, orange with ninhydrin, UV active.
The synthesis of succinimidyl ester alkyne is shown in the following reaction scheme.
To a solution of 10-undecynoic acid (0.40 g, 2.2 mmol) in CH3CN (10 mL) was added Oâ(N-succinimidyl)-N,N,Nâ˛,Nâ˛-tetramethyluronium tetrafluoroborate (0.99 g, 3.29 mmol). After stirring for 2 min at RT, the reaction was quenched with 1% AcOH and diluted with CHCl3 (150 mL). The organic solution was then extracted with 1% AcOH (10 mL), rinsed with H2O (2Ă40 mL), then dried over Na2SO4. The solution was then decanted and concentrated. A quantitative yield was assumed and the material was taken on directly to the next step. TLC (10% MeOH/CHCl3) Rf=0.90, UV active.
To a solution of 10-undecynoic acid succinimidyl ester (0.61 g, 2.19 mmol) in CH3CN (8 mL) was added amino-dPEGâ˘2-tert-butyl ester (0.46 g, 1.97 mmol, Quanta BioDesign) in CH3CN (2 mL) at RT. After 2 hrs, the solution was diluted with CHCl3 (50 mL) and extracted with H2O (5 mL). The aqueous layer was reextracted with CHCl3 (2Ă50 mL). Combined organics were dried over Na2SO4, decanted and concentrated. The crude was purified via silica gel chromatography (2.5% MeOH/CHCl3) to afford the product as a clear, pale yellow oil (0.48 g, 55%). TLC (9:1 CH3CN:H2O) Rf=0.81.
To a solution of tert-butyl alkyne (0.48 g, 1.2 mmol) in CH2Cl2 (2.0 mL) was added TFA (2.0 mL). The solution was stirred for 1 h, then concentrated and reevaporated from toluene (2Ă1 mL). The resulting brown residue was dissolved in CH3CN (5.0 mL) and N,N-diisopropylethylamine (0.84 mL, 4.83 mmol) was added. The solution was stirred at RT for 2 min, and then Oâ(N-succinimidyl)-N,N,Nâ˛,Nâ˛-tetramethyluronium tetrafluoroborate (0.47 g, 1.56 mmol) was added. After 15 min the reaction was quenched and acidified with 1% AcOH to a pH of 4-5. The solution was extracted with CHCl3 (3Ă50 mL). The combined organics were reextracted with H2O (1Ă10 mL), then dried over Na2SO4, decanted and concentrated to afford a tan solid (0.46 g, 87%). The crude material was pure enough for testing without further purification. TLC (8:2 CH3CN/H2O) Rf=0.79.
The synthesis of Iodoacetamide azide is shown in the following reaction scheme.
To a solution of 6-amino-hexanyl-1-azide trifluoroacetic acid salt (35 mg, 0.14 mmol) in DMF (0.1 mL) was added iodoacetic anhydride (0.10 g, 0.28 mmol) in the dark. After 2 hr, the reaction was stopped and the solution was partitioned between CHCl3 (10 mL) and H2O (10 mL). The organic layer was removed and the aqueous layer was reextracted with CHCl3 (1Ă10 mL). The combined organics were rinsed with saturated NaCl (1Ă5 mL), dried over Na2SO4, decanted and concentrated. Purification via silica gel chromatography (2% MeOH/CHCl3 containing 0.1% AcOH) provided the product (35 mg, 81%) as a yellow oil. TLC (10% MeOH/CHCl3) Rf=0.75.
The synthesis of Iodoacetamide alkyne is shown in the following reaction scheme.
To a solution of propargylamine in DMF was added iodoacetic anhydride in the dark. After 2 hr, the reaction was stopped and the solution was partitioned between CHCl3 and H2O. The organic layer was removed and the aqueous layer was reextracted with CHCl3. The combined organics were rinsed with saturated NaCl, dried over Na2SO4, decanted and concentrated.
The synthesis of Maleimide alkyne is shown in the following reaction scheme.
Propargylamine Maleimide.
After the reaction of propargylamine and maleic anhydride in the presence of TEA, the intermediate acid was cyclized in the presence of acetic anhydride and sodium acetate at 70° C., to afford the desired propargylamine maleimide.
The synthesis of Maleimide azide is shown in the following reaction scheme.
After the reaction of 6-amino-hexanyl-1-azide trifluoroacetic acid salt and maleic anhydride in the presence of TEA, the intermediate acid was cyclized in the presence of acetic anhydride and sodium acetate at 70° C., to afford the desired N-(6-azido-aminohexyl)maleimide.
5-TAMRA Azide.
To a solution of 6-(amino)-hexanyl-1-azide trifluoroacetic acid salt
(see Scheme 1 for synthesis, 0.19 mmol) in DMF (0.5 mL) and DIEA (33 ÎźL, 0.19 mmol) was added 5-carboxytetramethylrhodamine, succinimidyl ester (5-TAMRA-SE, 50 mg, 0.094 mmol). After stirring the solution at RT for 10 min, the reaction solution was concentrated in vacuo. The crude was purified via silica gel chromatography (prep plate, 9:1 CH3CN: H2O) to afford the product as a pink solid (45.6 mg, 87%). TLC(CH3CN: H2O, 8:2) Rf=0.61, pink fluorescent spot; ESI-pos m/z 555 M+, C31H35N6O4 (requires 555).
It is envisioned that any reporter molecule comprising a succinimidyl ester can be azido modified using the methods described herein. Provided below are additional non-limiting examples.
PEG-Biotin Azide.
To a solution of 6-(amino)-hexanyl-1-azide trifluoroacetic acid salt (see Scheme 1 for synthesis, 0.17 mmol) in DMF (0.5 mL) and DIEA (60 ÎźL, 0.34 mmol) was added NHS-PEO4-biotin (Pierce, 50 mg, 0.08 mmol). After stirring the solution at RT overnight, the solution was concentrated in vacuo. The crude was purified via silica gel chromatography (7:1 CHCl3: MeOH) to afford the product as a cloudy, white residue (12.3 mg, 12%). TLC (7:1, CHCl3: MeOH, 8:2) Rf=0.54, faint UV active spot, stains pink with biotin dip; ESI-pos m/z 616 M+, C27H49N7O7S (requires 616).
Rhodamine Green⢠Azide (Mix of 5- and 6-Isomers).
To a solution of 6-(amino)-hexanyl-1-azide trifluoroacetic acid salt (see Scheme 1 for synthesis, 0.20 mmol) in DMF (0.5 mL) and DIEA (50 ΟL, 0.28 mmol) was added Rhodamine Green⢠carboxylic acid, succinimidyl ester, hydrochloride (mix of 5- and 6-isomers, 50 mg, 0.10 mmol). After stirring the solution at RT for 2 h the solution was concentrated in vacuo. HPLC (Phenomenex Prodigy ODS, internal diameter 21.2 mm, eluent 5-50% CH3CN (over 60 min) in 25 mM TEAA, pH=4.7, flow rate of 20 mL/min) gave 21.1 mg of product (43%) tR=43-47 min; TLC(CH3CN: H2O: AcOH, 8:1:1) Rf=0.74, fluorescent yellow spot; ESI-pos m/z 499 (M+H, C27H27N6O4 requires 499).
Alexa FluorÂŽ 488 Azide (5 Isomer).
To a solution of 6-(amino)-hexanyl-1-azide trifluoroacetic acid salt (see Scheme 1 for synthesis, 0.44 mmol) in DMF (0.5 mL) and DIEA (0.11 mL, 0.88 mmol) was added Alexa FluorÂŽ 4885-carboxylic acid, 2,3,5,6-tetrafluorophenyl ester, bis(triethylammonium salt) (200 mg, 0.22 mmol). After stirring the solution at RT for 1 h, the solution was concentrated in vacuo. HPLC (Phenomenex Prodigy ODS, internal diameter 21.2 mm, eluent 0-60% CH3CN (over 30 min) in 25 mM TEAA, pH=4.7, flow rate of 20 mL/min) gave 58.1 mg of product (30%) tR=23-27 min; TLC(CH3CN: H2O, 8:2) Rf=0.58, fluorescent yellow spot; ESI-neg m/z 657 (Mâ, C27H25N6O10S2â requires 657).
Alexa FuorÂŽ 546 Azide.
To a solution of 6-(amino)-hexanyl-1-azide trifluoroacetic acid salt (see Scheme 1 for synthesis, 0.093 mmol) in DMF (0.5 mL) and DIEA (32 ÎźL, 0.19 mmol) was added Alexa FluorÂŽ 546 carboxylic acid, succinimidyl ester, (50 mg, 0.05 mmol). After stirring the solution at RT for 2 h, the solution was concentrated in vacuo.
HPLC (Phenomenex Prodigy ODS, internal diameter 21.2 mm, eluent 10-60% CH3CN (over 60 min) in 25 mM TEAA, pH=4.7, flow rate of 20 mL/min) gave 27.2 mg of product (54%) tR=48-52 min; TLC(CH3CN: H2O, 9:1) Rf=0.24, fluorescent pink spot; ESI-neg m/z 1084 (Mâ, C46H55Cl3N7O11S3â requires 1084).
Alexa FluorÂŽ 594 Azide (5 Isomer).
To a solution of 6-(amino)-hexanyl-1-azide trifluoroacetic acid salt (see Scheme 1 for synthesis, 0.12 mmol) in DMF (0.5 mL) and DIEA (42 ÎźL, 0.24 mmol) was added Alexa FluorÂŽ 594 carboxylic acid, succinimidyl ester*5-isomer* (50 mg, 0.06 mmol). After stirring the solution at RT for 2 h, the solution was concentrated in vacuo. HPLC (Phenomenex Prodigy ODS, internal diameter 21.2 mm, eluent 25-60% CH3CN (over 30 min) in 25 mM TEAA, pH=4.7, flow rate of 20 mL/min) gave 16.5 mg of product (32%) tR=23-25 min; TLC(CH3CN: H2O, 9:1) Rf=0.36, fluorescent red spot; ESI-neg m/z 845 (Mâ, C41H45N6O10S2 requires 845).
Dapoxyl Azide.
To a solution of 6-(amino)-hexanyl-1-azide trifluoroacetic acid salt (see Scheme 1 for synthesis, 0.25 mmol) in DMF (0.5 mL) and DIEA (43 ÎźL, 0.25 mmol) was added DapoxylÂŽ carboxylic acid, succinimidyl ester (50 mg, 0.12 mmol). After stirring the solution at RT for 1 h, the solution was concentrated in vacuo. Purified by SPE (Supelco C18 DSC) to give 41.6 mg of product (78%); ESI-pos m/z 433 (M+, C24H28N6O2 requires 433).
Alexa FluorÂŽ 568-Azide.
To a solution of 6-(amino)-hexanyl-1-azide (see Scheme 1 for synthesis, 0.04 mmol) in DMF (0.2 mL) and DIEA (7 ÎźL, 0.04 mmol) was added Alexa FluorÂŽ 568 carboxylic acid, succinimidyl ester (mix of isomers, 25 mg, 0.02 mmol). After stirring the solution at RT for 2.5 h, H2O (0.2 mL) was added and the solution was concentrated in vacuo. HPLC (Phenomenex Prodigy ODS, internal diameter 21.2 mm, eluent 20-35% CH3CN in 25 mM NH4Ac, pH 4.7, flow rate of 15 mL/min) gave 15.3 mg of product (99%) tR=24-30 min; TLC(CH3CN: H2O, 8:2) Rf=0.63, fluorescent pink spot; ESI-neg m/z 817 (Mâ2, C39H41N6O10S2 requires 817).
Oregon GreenÂŽ 488-Alkyne.
To a solution of Oregon GreenÂŽ 488 carboxylic acid, succinimidyl ester (50 mg, 0.98 mmol) in DMF (0.5 mL) was added propargylamine (0.26 ÎźL, 0.40 mmol) and H2O (0.1 mL). After stirring at RT for 15 min, the solution was concentrated. HPLC (Phenomenex Prodigy ODS, internal diameter 21.2 mm, eluent 15-30% CH3Cn in 25 mM TEAA pH 4.7, flow rate of 15 mL/min) gave 44.5 mg of product (99%) tR=5-13 min; TLC(CH3CN: H2O, 8:2) Rf=0.60, fluorescent yellow spot; ESI-neg m/z 448 (MâH+, C24H12F2NO6â requires 448).
It is envisioned that any reporter molecule comprising a succinimidyl ester can be alkyne modified using the methods described herein. Provided below are additional non-limiting examples.
Alkynyl-PEG-Biotin.
To a solution of NHS-PEO4-biotin (Pierce, 25 mg, 0.004 mmol) in DMF (0.1 mL) at RT was added propargylamine (0.3 mL, 4.5 mmol). After stirring for 3 h, the solution was concentrated in vacuo and re-evaporated twice from toluene. HPLC (Phenomenex Prodigy ODS, internal diameter 21.2 mm, eluent 35-50% MeOH in 25 mM NH4Ac, pH 6.5, flow rate of 15 mL/min) gave 14.4 mg, (64%, a white solid) tR=26-30 min; TLC(CHCl3:MeOH, 7:1) Rf=0.20, UV active spot; ESI m/z 529 (M+H+, C24H40N4O7S requires 529).
5-TAMRA-Alkyne.
To a solution of 5-carboxytetramethylrhodamine, succinimidyl ester (5-TAMRA-SE, 0.10 g, 0.19 mmol) in DMF (0.5 mL) was added propargylamine (25 ÎźL, 0.38 mmol) and H2O (0.5 mL). After stirring the solution for 30 min at RT, the solution was concentrated in vacuo. HPLC (Phenomenex Prodigy ODS, internal diameter 21.2 mm, eluent 25-40% CH3CN in 25 mM TEAA, pH 4.7, flow rate of 15 mL/min) gave 68 mg of product (82%, a purple solid) tR=23-33 min; TLC(CH3CN: H2O, 8:2) Rf=0.67, fluorescent orange spot; ESI m/z 469 (M+H+, C28H26N3O4 requires 469).
Oregon GreenÂŽ 488-Alkyne.
To a solution of Oregon GreenÂŽ 488 carboxylic acid, succinimidyl ester (50 mg, 0.98 mmol) in DMF (0.5 mL) was added propargylamine (0.26 ÎźL, 0.40 mmol) and H2O (0.1 mL). After stirring at RT for 15 min, the solution was concentrated. HPLC (Phenomenex Prodigy ODS, internal diameter 21.2 mm, eluent 15-30% CH3Cn in 25 mM TEAA pH 4.7, flow rate of 15 mL/min) gave 44.5 mg of product (99%) tR=5-13 min; TLC(CH3CN: H2O, 8:2) Rf=0.60, fluorescent yellow spot; ESI-neg m/z 448 (MâH+, C24H12F2NO6â requires 448).
Alexa FluorÂŽ 532-Alkyne.
To a solution of Alexa FluorÂŽ 532 carboxylic acid, succinimidyl ester (51 mg, 0.07 mmol) in DMF (4.0 mL) was added propargylamine (0.1 mL) and H2O (1.0 mL). The solution was stirred at RT for 1 h then concentrated in vacuo to afford the crude product. HPLC (Phenomenex Prodigy ODS, internal diameter 21.2 mm, eluent 25-40% CH3CN in 25 mM NH4Ac, pH 4.7, flow rate of 15 mL/min) gave 30 mg of product (65%, a red solid) tR=23-30 min; TLC (CH3CN:H2O, 1:1) Rf=0.58, fluorescent red spot; ESI m/z 664 (M+, C33H34N3O8S2 requires 664).
Alexa FluorÂŽ 488-Alkyne.
To a solution of Alexa FluorÂŽ 488 carboxylic acid, succinimidyl ester, dilithium salt, mixed isomers, (51 mg, 0.08 mmol) in DMF (2.0 mL) was added propargylamine (54 ÎźL, 0.80 mmol). The solution was stirred at RT for 4 h then concentrated in vacuo. The crude product was purified using column chromatography on silica gel (CH3CN: H2O, 8:2) to afford 20 mg (44%, an orange solid). TLC (CH3CN: H2O, 3:1) Rf=0.68; ESI-neg m/z 570 (Mâ2, C24H16N3O10S22â requires 570).
5-TAMRA-Triarylphosphine.
To a solution of N-Boc-triarylphosphine-amine (see Scheme 2 for synthesis, 10 mg, 0.018 mmol) in CH2Cl2 (1.0 mL) was added TFA (0.5 mL). The reaction solution was stirred at RT for 30 min, concentrated in vacuo, and re-evaporated twice from toluene. The crude amine (0.018 mmol, 99%) was used directly in the next reaction without further purification.
To a solution of triarylphosphine-amine (0.018 mmol) in DMF (0.2 mL) and DIEA (12 ÎźL, 0.089 mmol) was added 5-carboxytetramethyl rhodamine, succinimidyl ester (5-TAMRA-SE, 9 mg, 0.022 mmol). After stirring the solution at RT for 2.5 h, the solution was concentrated in vacuo. HPLC (Phenomenex Luna C18(2), internal diameter 10 mm, eluent 40-55% CH3CN in 25 mM NH4Ac, pH=7, flow rate of 5.0 mL/min) gave 4.1 mg of product (27%) tR=32-34 min; TLC (MeOH:CHCl3, 1:9) Rf=0.67, fluorescent pink spot; ESI m/z 848 (M+H+, C50H48N4O7P requires 848).
A solid silica glass surface such as a glass slide is derivatized with 3-azidopropyl(triethoxy)silane, using standard conditions for covalent attachment of alkyl(trialkoxy)silanes to glass. The residual labeling reagents are rinsed thoroughly, and the azide-derivatized glass is stored under subdued light. The azide functionalized glass surfaces are incubated in water or organic solvent such as methanol with excess acetylene-functionalized partners such as small molecules, dyes, peptides, proteins, enzymes, and nucleic acids over the course of 1-2 days in darkness in the presence of excess BCS and Cu(I), which is formed in situ from copper sulfate and sodium ascorbate. The derivatized glass surface is rinsed thoroughly with water, and stored cold either dry or suspended in solution so as to optimize the lifetime of the bound partner.
A solid silica glass surface such as a glass slide is derivatized with 3-alkynylpropyl(triethoxy)silane, using standard conditions for covalent attachment of alkyl(trialkoxy)silanes to glass. The residual labeling reagents are rinsed thoroughly, and the alkyne-derivatized glass is stored cold. The alkyne-functionalized glass surfaces are incubated in water or organic solvent such as methanol with excess azido-functionalized partners such as small molecules, dyes, peptides, proteins, enzymes, and nucleic acids over the course of 1-2 days in darkness in the presence of excess BCS and Cu(I), which is formed in situ from copper sulfate and sodium ascorbate. The derivatized glass surface is rinsed thoroughly with water, and stored cold either dry or suspended in solution so as to optimize the lifetime of the bound partner.
This assay is used to determine the specificity and identification of protein binding sites on a given ds or ss DNA/RNA molecule. Currently the technique uses radiolabeled DNA which is laborious, tedious and requires high level of safety. With the advent of Click chemistry in DNA labeling one can perform the same technique with great ease and convenience.
A ss or ds nucleic acid oligo can be synthesized e.g., by IDT or Invitrogen or Sigma that has a 5ⲠE-dUMP followed by the sequence of interest to the end user. The oligo can then be labeled with and azido Fluorphore and further used for binding to the protein of interest followed by PAGE and EMSA. Alternatively the putative sequence of DNA to which the protein binds can be designed to have a singly azido or alkyne nucleotide. If the protein binds to the sequence it would block access to the azido dye or tag resulting in no labeling. If the protein does not bind to the sequence then the DNA will get readily labeled in the click reaction giving a clear cut result.
The reaction was set up as follows:
A 2ĂSYBR Greener mastermix was used. It was prepared with the same components as the commercial mix (Taq polymerase, buffer, MgCl2, SYBR Greener dye) but without dNTPs and the passive reference dye ROX. The reaction mixes were prepared according to the following table:
| Unmodified dUTP | [final] | ||
| dH2O | 6.75 | ||
| 2X mix no ROX | 12.5 | 1X | |
| dNTP unmodified mix 25 mM | 0.2 | 200 uM each | |
| 10 uM B act 300 primers F + R | 0.5 | 200 nM each | |
| 25 uM ROX | 0.05 | 50 nM | |
| 20 | |||
| Add template | 5 | ||
| Click modified dUTP | [final] | ||
| dH2O | 2.95 | ||
| 2X mix no ROX | 12.5 | 1X | |
| Modified dNTP mix 1.2 mM | 4 | 200 uM each | |
| 10 uM B act 300 primers F + R | 0.5 | 200 nM each | |
| 25 uM ROX | 0.05 | 50 nM | |
| 20 | |||
| Add template | 5 | ||
The template used was Invitrogen qPCR standards, containing 50,000,000 (5E7) copies of plasmid with the human B actin CDS, shown below. The samples were run as 3 replicates. The location of the primers is shown in FIG. 16, giving a predicted amplicon size of 293 bp.
The cycling conditions were:
Initial denaturation and activation of Taq:
95 C 10 minutes
1) 95 C 15 seconds
2) 60 C 30 seconds, fluorescence captured at the end of this step
Repeated for 45 cycles
Melting Curve:
The amplicon was heated from 55 C to 95 C in 2 C/minute steps, with fluorescence captured at each step. SBR Green and ROX band pass filters were used to measure fluorescence, on a MX3000P machine (Stratagene).
Results: The data are shown in FIG. 11 and FIG. 12. The linear amplification plot shown in FIG. 11 shows that the onset of exponential amplification or threshold cycle (CT) for the click modified dUTP mix is very similar to that shown for the unmodified dUTP mix. The average CT for click dUTP is 9.78 vs 10.97 for unmodified dUTP.
The data from the melting curve of FIG. 12 suggests a potential application for Click modified nucleotides as a way to increase the Tm of oligonucleotides. For example, if designing PCR primers in an A-T rich region, this modification could be used to raise the Tm of the primers so that shorter primers could be made that would show the same melting temperature as longer primers.
The higher Tm could be used for generating a cDNA library through random priming. Normally, random 6-8 mers are used. These will naturally have a very low Tm. However the click modified random primers could potentially be used at a higher temperature for greater specificity. Researchers are using octamers to get longer and more specific reads during random priming but the click modified oligos could provide the enhanced specificity without the need for longer oligos. Thus, the advantage of using short oligos (more matches) can be combined with enhanced hybridization stability.
The product from the real time PCR experiment was either directly or indirectly labeled (PCR product cleaned up using Invitrogen PCR purification kit prior to Click) with azido-TAMRA in the presence of âClickâ conditions. The labeling reaction was composed of a final concentration of 25% propylene glycol; 2 mM copper (II); 10 mM BCS, 10 mM Sodium Ascorbate and 50 ÎźM azido-TAMRA. The reaction was performed for 60 minutes at room temperature. This was followed by precipitation of the DNA using 3M sodium acetate, glucagon as a carrier and 100% ethanol. The final DNA pellet was washed twice with 70% ethanol. The pellet was then dissolved in 50 ul of 10 mM TE buffer pH 8.0. The DNA solution was warmed up to enhance dissolution of the DNA pellet. 27 ul of the solution was mixed with 3 ul of 10Ă Blue Juice loading buffer (Invitrogen). 6 ul of the sample was loaded on to a 4-20% TBE-polyacrylamide gel. The gel was run at 10V for 10 minutes; 190V for 90 minutes. The gel was pulled out of the cassette and scanned for TAMRA (Ex: 530 nm Em: 580 nm), which is shown as the left image of FIG. 13. The same gel was then stained with SYBR GOLD for 30 minutes and then scanned as described above, as shown in the right image of FIG. 13. Lanes 1 and 2 are the PCR products that have been generated using ethynyl dUTP and other dNTPs. L is the 25 bp ladder DNA marker. The arrows point to the Ë300 bp labeled product. FIG. 13 also illustrates that there is no quenching of the signal.
TRAPeze⢠TELOMERASE assay Chemicon Kit 57700. The experiment is summarized in FIG. 22.
A 250 ul reaction mix (5Ă) for each of the three different reaction variables was composed as follows. 25 Îźl of 10Ă Trap buffer was mixed with 50 uM e-dNTPs (50 ÎźM of ethynyl dUTP+50 ÎźM of each of dATP, dGTP, and dCTP) and 344 nM of either the TS primer or biotinylated TS primer. 5 Îźl of Primer Mix (contains three separate primersâa K1 Fwd primer, RP Rev Primer and TSK 1 internal control primer from the (TRAPeze Telomerase Kit, Chemicon). The source of telomerase was 1000 positive control cells that are supplied with the Chemicon TRAPeze⢠TELOMERASE assay kit. Sau3 cells were used as a negative control as they do not express any Telomerase enzyme. Each of the three reactions also contained 10 units of Taq DNA polymerase. 1ĂTRAP reaction buffer (20 mM Tris-HCl, pH 8.3, 1.5 MgCl2 63 mM KCl, 0.05% Tween 20, 1 mM EGTA)
The three different reactions were based on
(a) TS primer with +ve control cells (b) Biotinylated TS primer with +ve control cells (c) Biotinylated primer with Sau 3 cells.
After the three reaction were set up, â th volume of each of the reaction was subjected to PCR aided Telomerase assay as has been discussed above. The other 4/5 volumes of each the three reactions were incubated at 30° C. for 30 minutes and then heated at 95° C. for 10 minutes. As shown in the flow chart above, one half of each of the three reactions was cleaned using size exclusion âChromaspinâ columns. The eluate was then subjected to click reaction using a final concentration of 25% propylene glycol; 2 mM copper (II); 10 mM BCS, 10 mM Sodium Ascorbate and 50 ÎźM azido-TAMRA. The reaction was performed for 30 minutes at room temperature. This was followed by clean up on a size exclusion as described above. The TAMRA labeled dsDNA (PCR aided Telomerase products) or ss DNA (PCR free Telomerase products) were blotted on to a Biodyne plus nucleic acid binding membrane. The membrane was scanned for a TAMRA signal.
The other half of the three reactions were incubated with 25 Îźl of the streptavidin coated polystyrene beads (Spherotek) and incubated at 40 C for over night. The beads were washed five times with 50 mM Tris pH 8.0. Click chemistry was performed on the oligos attached to the beads using the exact same reaction composition and conditions as described above. After incubation, the labeled beads were washed 5 times with 50 mM Tris pH 8.0. The beads were semi dried in the speed vac and then scanned for TAMRA.
As seen in FIG. 14, the tube containing beads coated with biotinylated TS primer show a signal for TAMRA, while the tubes with either TS primer or negative control cells do not show the signal.
Additionally, as shown in FIG. 15, spots on the PCR aided +ve control and TS biotinylated primer show TAMRA signal on the Biodyne nucleic acid membrane. The signal intensity from the PCR positive control is far greater than PCR free Telomerase assay.
Phosphoproteins are labeled in vivo or in vitro using alkyne or azide-tagged nucleotides whereby the azide or alkyne moiety is placed on the gamma phosphate. For example one of the nucleotides shown below is added to a reaction mixture containing a protein kinase and a kinase target molecule. After tagging the molecule is reacted with the appropriate alkyne or azide detection or affinity reagent for quantitation, visualization, or enrichment. In one example reaction, modified nucleotide substrates may be added directly to cultured cells for metabolic incorporation of the tagged gamma-phosphate molecule into cellular macromolecules including proteins. The process may involve treatment of the cells with pharmacological agents to detect alterations in phosphorylation dynamics. Entry of the compounds into live cultured cells could be enhanced by modifying the nucleotides with functional groups that would afford permeability, or by concomitant addition of cell permeablizing agents. In another example reaction, the kinase reaction could be performed in vitro using cellular extracts as the source of kinases and substrates. The modified nucleotides is added to the reaction mixture and the reaction mixtures incubated with or without the addition of pharmacological agents of interest. The in vitro reaction optionally entails adding an exogenous kinase or substrate source to the cellular extract along with the nucleotide analogs. In another application, the method is used in vitro without cellular extracts, using purified kinases and kinase substrates. In all of the disclosed examples the reaction mix may contain a buffer optimized for the particular kinases of interest, a kinase source, a metal ion source, glycerol, nucleotide ATP analog, and ATP. The âclickâ detection reaction with an alkyne probe would be performed in the presence of copper(I), or copper(II) in the presence of a copper(II) reducing agent, a copper(I) chelating agent, and an appropriate buffer to maintaining optimal pH conditions.
The reagents employed in the examples are commercially available or can be prepared using commercially available instrumentation, methods, or reagents known in the art. The foregoing examples illustrate various aspects of the invention and practice of the methods of the invention. The examples are not intended to provide an exhaustive description of the many different embodiments of the invention. Thus, although the forgoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, those of ordinary skill in the art will realize readily that many changes and modifications can be made thereto without departing from the spirit or scope of the appended claims.
Each of the references cited herein are hereby incorporated by reference as if set forth fully herein.
1. A method of forming a nucleic acid conjugate, wherein the method comprises:
a) incorporating an azide modified nucleotide into the nucleic acid polymer by contacting the azide modified nucleotide nucleotide with at least one other nucleotide in the presence of a DNA amplification enzyme to form an azide modified nucleic acid polymer; and
b) contacting the azide modified nucleic acid polymer with a reporter molecule, carrier molecule or solid support that comprises an activated or terminal alkyne or phosphine moiety to form a nucleic acid polymer-reporter molecule, carrier molecule, solid support conjugate.
2. A method of forming a nucleic acid conjugate, wherein the method comprises:
a) incorporating a terminal alkyne modified nucleotide into the nucleic acid polymer by contacting the terminal alkyne modified nucleotide nucleotide with at least one other nucleotide in the presence of a DNA amplification enzyme to form a terminal alkyne modified nucleic acid polymer; and
b) contacting the terminal alkyne modified nucleic acid polymer with a reporter molecule, carrier molecule or solid support that comprises an azido moiety to form a nucleic acid polymer-reporter molecule, carrier molecule, solid support conjugate.
3. A method of forming a nucleic acid conjugate, wherein the method comprises:
a) incorporating a phosphine modified nucleotide into the nucleic acid polymer by contacting the phosphine modified nucleotide nucleotide with at least one other nucleotide in the presence of a DNA amplification enzyme to form a phosphine modified nucleic acid polymer; and
b) contacting the phosphine modified nucleic acid polymer with a reporter molecule, carrier molecule or solid support that comprises an azido moiety to form a nucleic acid polymer-reporter molecule, carrier molecule, solid support conjugate.
4. A method for making an azido, alkyne or phosphine modified nucleic acid polymer, wherein the method comprises:
incubating at least one azido, alkyne or phosphine modified nucleotide in the presence of a nucleic acid amplification enzyme to form an azido, alkyne or phosphine modified nucleic acid polymer.
5. The method according to claim 4, wherein the nucleic acid enzyme is a DNA polymerase.
6. The method according to claim 4, wherein the nucleic acid enzyme is a RNA polymerase.
7. The method according to claim 4, wherein the melting temperature of the azido, alkyne or phosphine modified nucleic acid polymer is increased.
8. The method according to claim 1, wherein the reporter molecule is a xanthene, cyanine, coumarin, borapolyazaindacene or pyrene dye.
9. The method according to claim 1, wherein the reporter molecule is an enzyme substrate or hapten.
10. The method according to claim 1, wherein the carrier molecule is an amino acid, a peptide, a protein, a polysaccharide, a nucleotide, a nucleoside, an oligonucleotide, a nucleic acid, a hapten, a psoralen, a drug, a hormone, a lipid, a lipid assembly, a synthetic polymer, a polymeric microparticle, a biological cell or a virus.
11. The method according to claim 1, wherein the carrier molecule comprises an antibody or fragment thereof, an avidin or streptavidin, a biotin, a blood component protein, a dextran, an enzyme, an enzyme inhibitor, a hormone, an IgG binding protein, a fluorescent protein, a growth factor, a lectin, a lipopolysaccharide, a microorganism, a metal binding protein, a metal chelating moiety, a non-biological microparticle, a peptide toxin, a phosphotidylserine-binding protein, a structural protein, a small-molecule drug, or a tyramide.
12. The method according to claim 1, wherein the solid support is a microfluidic chip, a silicon chip, a microscope slide, a microplate well, silica gels, polymeric membranes, particles, derivatized plastic films, glass beads, cotton, plastic beads, alumina gels, polysaccharides, polyvinylchloride, polypropylene, polyethylene, nylon, latex bead, magnetic bead, paramagnetic bead, or superparamagnetic bead.
13. The method according to claim 1, wherein the solid support is Sepharose, poly(acrylate), polystyrene, poly(acrylamide), polyol, agarose, agar, cellulose, dextran, starch, FICOLL, heparin, glycogen, amylopectin, mannan, inulin, nitrocellulose, diazocellulose or starch.
14. A method of detecting an azido modified nucleic acid polymer, comprising:
a) forming an azide-alkyne cycloaddition reaction mixture comprising:
a reporter molecule that comprises a terminal alkyne moiety:
an azido modified nucleic acid polymer;
b) incubating the azide-alkyne cycloaddition reaction mixture for a sufficient amount of time to form a nucleic acid polymer-reporter molecule conjugate;
c) separating the nucleic acid polymer-reporter conjugate by size and/or weight of the nucleic acid polymer-reporter-reporter molecule conjugate to form a separated nucleic acid polymer-reporter-reporter molecule conjugate;
d) illuminating the separated nucleic acid polymer-reporter-reporter molecule conjugate with an appropriate wavelength to form an illuminated nucleic acid polymer-reporter-reporter molecule conjugate;
e) observing the illuminated nucleic acid polymer-reporter-reporter molecule conjugate wherein the nucleic acid polymer is detected.
16. The method according to claim 14, wherein step a) further comprises
a. copper ions;
b. at least one reducing agent; and
c. a copper chelator.
16. The method according to claim 14, wherein the reporter molecule is xanthene, cyanine, coumarin, borapolyazaindacene or pyrene dye.
17. The method according to claim 14, wherein the reporter molecule is an enzyme substrate, fluorescent protein or hapten.
18. The method according to claim 15, wherein the copper chelator is a copper (I) chelator.
19. The method according to claim 15, wherein the copper chelator is N,N,Nâ˛,Nâ˛-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN), EDTA, neocuproine, N-(2-acetamido)iminodiacetic acid (ADA), pyridine-2,6-dicarboxylic acid (PDA), S-carboxymethyl-L-cysteine (SCMC), 1,10 phenanthroline, or a derivative thereof, trientine, glutathione, histadine, polyhistadine or tetra-ethylenepolyamine (TEPA).
20. The method according to claim 15, wherein the copper chelator is 1,10 phenanthroline, bathophenanthroline disulfonic acid (4,7odiphenyl-1,10-phenanthroline disulfonic acid) or bathocuproine disulfonic acid (2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline disulfonate).
21. The method according to claim 15, wherein the reducing agent is acorbate, Tris(2-Carboxyethyl) Phosphine (TCEP), TCP (2,4,6-trichlorophenol), NADH, NADPH, thiosulfate, 2-mercaptoethanol, dithiothreotol, glutathione, cysteine, metallic copper, quinone, hydroquinone, vitamin K1, Fe2+, Co2+, or an applied electric potential.
22. The method according to claim 15, wherein the reducing agent is ascorbate.
23. The method according to claim 14, wherein the separating step comprises chromatography or electrophoresis.
24. The method according to claim 23, wherein the chromatography comprises one or more of FPLC, HPLC, liquid chromatograpy (LC), size exclusion chromatography, ion exchange chromatography, or affinity chromatography.
25. The method according to claim 23, wherein electrophoresis comprises gel electrophoresis, 1 dimensional (1D) gel electrophoresis, 2 dimensional (2D) gel electrophoresis, native gel electrophoresis, denaturing gel electrophoresis, isoelectric focusing, or capillary electrophoresis.
26. An azide-alkyne cycloaddition reaction mixture comprising:
a reporter molecule that comprises a terminal alkyne moiety:
an azido modified nucleic acid;
copper ions;
at least one reducing agent; and
a copper chelator.
27. A method for detecting immobilized azido modified nucleic acids, wherein the method comprises:
a) immobilizing the azido modified nucleic acids on a solid or semi-solid matrix to form an immobilized azido modified nucleic acid;
b) contacting the immobilized azido modified nucleic acid with a reporter molecule that contains an azide reactive group to form a contacted azido modified nucleic acid;
c) incubating the contacted azido modified nucleic acid for a sufficient amount of time to form a reporter molecule-nucleic acid conjugate;
d) illuminating the reporter molecule-nucleic acid conjugate with an appropriate wavelength to form an illuminated reporter molecule-nucleic acid conjugate;
e) observing the illuminated reporter molecule-nucleic acid conjugate whereby the immobilized azido modified nucleic acid is detected.
28. A method for detecting immobilized alkyne modified nucleic acids, wherein the method comprises:
a) immobilizing the alkyne modified nucleic acids on a solid or semi-solid matrix to form an immobilized alkyne modified nucleic acid;
f) contacting the immobilized alkyne modified nucleic acid with a reporter molecule that contains an azido group to form a contacted alkyne modified nucleic acid;
g) incubating the contacted alkyne modified nucleic acid for a sufficient amount of time to form a reporter molecule-nucleic acid conjugate;
h) illuminating the reporter molecule-nucleic acid conjugate with an appropriate wavelength to form an illuminated reporter molecule-nucleic acid conjugate;
i) observing the illuminated reporter molecule-nucleic acid conjugate whereby the immobilized alkyne modified nucleic acid is detected.
29. The method according to claim 28, wherein the solid or semi-solid support is a slide, an array, an agarose gel, a polyacrylamide gel, a hydrogel, a polymeric particle or glass.
30. A kit comprising:
Azide or alkyne-dUTP;
a telomerase enzyme;
an azide or alkyne reactive reporter molecule, carrier molecule or solid support.
31. A kit for labeling a nucleic acid polymer comprising:
at least one nucleotide analogue that comprises an azide, alkyne or phosphine moiety; and
a reporter molecule, carrier molecule or solid support comprising an azide, alkyne or phosphine moiety.
32. The kit according to claim 31, further comprising a nucleic acid amplification enzyme.
33. A method of measuring Telomerase Enzyme Activity, comprising steps of:
a) contacting a cell with an effective amount of a dNTP nucleotide that comprises an azide group and a Telomerase enzyme such that the dNTP nucleotide is incorporated into at least one nucleic acid polymer;
b) contacting the nucleic acid polymer with a reporter molecule comprising an alkyne or phosphine moiety to form a azido modified nucleic acid polymer reporter molecule conjugate;
c) separating the azido modified nucleic acid polymer reporter molecule conjugate from nucleic acid polymers that do not comprise a reporter molecule, and
d) illuminating the azido modified nucleic acid polymer reporter molecule conjugate to determine Telomerase activity.
34. A method of measuring Telomerase Enzyme Activity, comprising steps of:
a) contacting a cell with an effective amount of a dNTP nucleotide that comprises an alkyne or phosphine group and a Telomerase enzyme such that the dNTP nucleotide is incorporated into at least one nucleic acid polymer;
b) contacting the nucleic acid polymer with a reporter molecule comprising an azido moiety to form an alkyne or phosphine modified nucleic acid polymer reporter molecule conjugate;
c) separating the alkyne or phosphine modified nucleic acid polymer reporter molecule conjugate from nucleic acid polymers that do not comprise a reporter molecule, and
d) illuminating the alkyne or phosphine modified nucleic acid polymer reporter molecule conjugate to determine Telomerase activity.