Patent application title:

NOVEL MUTATED TISSUE PLASMINOGEN ACTIVATORS AND USES THEREOF

Publication number:

US20150050264A2

Publication date:
Application number:

14/342,164

Filed date:

2012-09-07

Abstract:

The present invention relates to mutated tissue plasminogen activators, and their use for treating thrombotic diseases.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

Description

FIELD OF THE INVENTION

The invention relates to mutated tissue plasminogen activators (tPA) and their use for treating thrombotic and haemorrhagic diseases, preferably intra-cerebral haemorrhages and ocular haemorrhages, more preferably thrombotic neurological disorders and central retinal artery occlusion, most preferably stroke.

BACKGROUND OF THE INVENTION

Tissue type plasminogen activator (tPA) is a serine protease secreted in the neurovascular unit (NVU) by endothelial cells (Angles-Cano et al., 1985), neurons (Pecorino et al., 1991) and glial cells ((Siao and Tsirka, 2002); (Buisson et al., 1998)). Unlike other serine proteases, tPA is an unusually active zymogen, with full intrinsic activity and low zymogenicity (Loscalzo, 1988). In the vasculature, tPA promotes fibrinolysis via the conversion of the abundant and inactive fibrin-bound zymogen plasminogen into plasmin. In the brain parenchyma, tPA was reported to display critical functions such as the control of the neuronal migration, learning and memory processes notably through the control of the N-methyl-D-aspartate receptor (NMDAR) signalling ((Calabresi et al., 2000); (Nicole et al., 2001); (Su et al., 2008); (Seeds et al., 1999)).

At the time when tPA (clinically delivered as Actilyse® or Alteplase®) was approved by the Federal Food and Drug Administration for the acute treatment of ischemic stroke, experimental data favour the idea that beyond its beneficial vascular effects, tPA may have damaging properties in the cerebral parenchyma, including haemorrhagic transformations and neurotoxicity ((Fugate et al., 2010); (Yepes et al., 2009)). Indeed, beyond its ability to promote clot lysis, it is now well established, from both experimental models and clinical data, that tPA can activate metalloproteinases, growth factors, mediates neutrophils activation and thus promotes haemorrhagic transformations ((Suzuki et al., 2009); (Fredriksson et al., 2004); (Rosell et al., 2008)). Interestingly, intravenous tPA is also capable to cross both the intact and the injured blood brain barrier ((Harada et al., 2005); (Benchenane et al., 2005); (Benchenane et al., 2005)) and thus influence brain dysfunctions such as neurotoxicity ((Samson and Medcalf, 2006); (Benchenane et al., 2007); for review, (Yepes et al., 2009)).

Accordingly, in the NVU and together with endogenous parenchymal tPA, blood derived tPA interacts with several substrates in vitro and in vivo. Among its mechanisms of action, by interacting with the N-methyl-D-aspartate receptors (NMDAR) in neurons tPA is known to activate NMDAR-dependent signaling processes leading to an exacerbated neuronal death in conditions of oxygen and glucose deprivation, excitotoxicity or ischemia (Nicole et al., 2001)(Baron et al., 2010).

It is thus of major concern to identify tPA derivatives which would present a good or improved fibrinolytic activity, but without having the damaging properties in the cerebral parenchyma of the existing tPA, including exacerbated neuronal death.

It is also of major concern that said tPA derivatives have a reasonable intrinsic activity (which may be measured thanks to their amidolytic activity), so that vascular adverse effects are minimized.

The inventors have identified specific mutated tPA, which are efficient thrombolytics, which have a reasonable intrinsic activity, and which do not promote NMDAR-mediated neurotoxicity.

SUMMARY OF THE INVENTION

The present invention relates to specific mutated tPA, which have a thrombolytic and fibrinolytic activity and are thus efficient for treating thrombotic neurological disorders and central retinal artery occlusion, most preferably stroke, but which do not show the neurotoxic adverse events.

Consequently, one object of the invention is a protein chosen from the group consisting of:

i) proteins comprising the sequence SEQ ID NO: 2 or SEQ ID NO:25, preferably consisting of SEQ ID NO: 2 or of the association of SEQ ID NO:25 and SEQ ID NO:26, wherein said sequence comprises:

    • a mutation A′ consisting of the replacement of any amino acid of the Lysine Binding Site of SEQ ID NO: 2 or SEQ ID NO:25 by a hydrophilic amino acid chosen from arginine, aspartic acid, glutamic acid, lysine, asparagine, glutamine, serine, threonine, tyrosine and histidine, preferably by arginine, or
    • a mutation B consisting of the replacement of arginine in position 275 of SEQ ID NO: 2 or SEQ ID NO:25 by serine, or
    • a double mutation A′ and B consisting of the replacement of any amino acid of the Lysine Binding Site of SEQ ID NO: 2 or SEQ ID NO:25 by a hydrophilic amino acid chosen from arginine, aspartic acid, glutamic acid, lysine, asparagine, glutamine, serine, threonine, tyrosine and histidine, preferably by arginine, and the replacement of arginine in position 275 of SEQ ID NO: 2 or SEQ ID NO:25 by serine,
    • ii) proteins comprising a sequence having at least 80% homology with SEQ ID NO: 2 or SEQ ID NO:25, said proteins comprising mutation A′, mutation B, or mutation A′ and B, and
    • iii) proteins consisting of a fragment of SEQ ID NO:2, said fragment consisting of the Kringle 2 domain and the catalytic domain, said proteins comprising mutation A′, mutation B, or mutation A′ and B.

Preferably, the protein of the invention is chosen from the group consisting of:

    • i) proteins comprising the sequence SEQ ID NO: 2 or SEQ ID NO:25, preferably consisting of SEQ ID NO: 2 or of the association of SEQ ID NO:25 and SEQ ID NO:26, wherein said sequence comprises:
    • a mutation A consisting of the replacement of tryptophan in position 253 of SEQ ID NO: 2 or SEQ ID NO:25 by a hydrophilic amino acid chosen from arginine, aspartic acid, glutamic acid, lysine, asparagine, glutamine, serine, threonine, tyrosine and histidine, preferably by arginine, or
    • a mutation B consisting of the replacement of arginine in position 275 of SEQ ID NO: 2 or SEQ ID NO:25 by serine, or
    • a double mutation A and B consisting of the replacement of tryptophan in position 253 of SEQ ID NO: 2 or SEQ ID NO:25 by a hydrophilic amino acid chosen from arginine, aspartic acid, glutamic acid, lysine, asparagine, glutamine, serine, threonine, tyrosine and histidine, preferably by arginine, and the replacement of arginine in position 275 of SEQ ID NO: 2 or SEQ ID NO:25 by serine,
    • ii) proteins comprising a sequence having at least 80% homology with SEQ ID NO: 2 or SEQ ID NO:25, said proteins comprising mutation A, mutation B, or mutation A and B, and
    • iii) proteins consisting of a fragment of SEQ ID NO:2, said fragment consisting of the Kringle 2 domain and the catalytic domain, said proteins comprising mutation A, mutation B, or mutation A and B.

Another object of the invention is a polynucleotide encoding for said protein.

Another object of the invention is an expression vector comprising said polynucleotide.

Another object of the invention is a host cell comprising said expression vector or said polynucleotide.

Another object of the invention is the use of said protein as a medicament. Particularly, said protein may be used for treating thrombotic diseases, and preferably for treating intra-cerebral haemorrhages or ocular haemorrhages, more preferably for treating stroke or central retinal artery occlusion.

Another object of the invention is a method for treating a thrombotic disease in a subject in need thereof, particularly stroke or central retinal artery occlusion, comprising administering a therapeutically effective amount of a protein according to the invention to said subject.

DETAILED DESCRIPTION OF THE INVENTION

Definitions

As used herein, the terms “protein” and “polypeptide” are used herein interchangeably, and refer to an amino acid sequence having more than 500 amino acids. As used herein, the term “protein” encompasses amino acid sequences having between 500 and 1000 amino acids, preferably between 510 and 900 amino acids, preferably between 520 and 800 amino acids, preferably between 525 and 700 amino acids.

The term “homology” (or “homologous”), as used herein, is synonymous with the term “identity” and refers to the sequence similarity between two polypeptide molecules or between two nucleic acid molecule. When a position in both compared sequences is occupied by the same base or same amino acid residue, then the respective molecules are homologous at that position. The percentage of homology between two sequences corresponds to the number of matching or homologous positions shared by the two sequences divided by the number of positions compared and multiplied by 100. Generally, a comparison is made when two sequences are aligned to give maximum homology. Homologous amino acid sequences share identical or similar amino acid sequences. Similar residues are conservative substitutions for, or “allowed point mutations” of, corresponding amino acid residues in a reference sequence. “Conservative substitutions” of a residue in a reference sequence are substitutions that are physically or functionally similar to the corresponding reference residue, e.g., that have a similar size, shape, electric charge, chemical properties, including the ability to form covalent or hydrogen bonds, or the like. Particularly preferred conservative substitutions are those fulfilling the criteria defined for an “accepted point mutation” by Dayhoff et al. (“Atlas of Protein Sequence and Structure”, 1978, Nat. Biomed. Res. Foundation, Washington, D.C., Suppl. 3, 22: 354-352).

The homologous sequences are identified by alignment using, for example, the GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wisconsin) pileup program, or any of sequence comparison algorithms such as BLAST, FASTA, CLUSTALW, etc. Thus, according to the invention, a sequence having at least 80% homology with SEQ ID NO: 2 is a sequence for which the number of matching or homologous positions shared by said sequence and SEQ ID NO:2, divided by the length of SEQ ID NO:2 and multiplied by 100, is at least equal to 80.

The term “thrombotic diseases” as used herein encompasses deep vein thrombosis (DVT), pulmonary embolism (PE), coronary artery disease (CAD) and acute coronary syndrome (ACS), central retinal artery occlusion (CRAO), age related macular degeneration (AMD) and thrombotic neurological disorders, including stroke.

The telin “thrombotic neurological disorder” as used herein is defined as a disease, disorder or condition which directly or indirectly affects the normal functioning or anatomy of a subject's nervous system and includes, but is not limited to, cerebrovascular insufficiency, cerebral ischemia or cerebral infarction such as stroke, retinal ischemia (diabetic or otherwise), glaucoma, retinal degeneration, multiple sclerosis, ischemic optic neuropathy, reperfusion following acute cerebral ischemia, perinatal hypoxic-ischemic injury, or intracranial haemorrhage of any type (including, but not limited to, epidural, subdural, subarachnoid or intracerebral haemorrhage).

The term “fibrinolytic activity” or “thrombolytic activity” refers to the capacity to break down a fibrin clot.

The term “treating” a disorder or a condition refers to reversing, alleviating or inhibiting the process of one or more symptoms of such disorder or condition.

As used herein, the term “subject” denotes a mammal, such as a rodent, a feline, a canine, a pig, a bovine and a primate. Preferably a subject according to the invention is a human.

A “therapeutically effective amount” as used herein is intended for a minimal amount of active agent which is necessary to impart therapeutic benefit to a subject. For example, a “therapeutically effective amount of the active agent” to a subject is an amount of the active agent that induces, ameliorates or causes an improvement in the pathological symptoms, disease progression, or physical conditions associated with the disease affecting the subject.

The Invention

The present invention relates to a protein chosen from the group consisting of:

    • i) proteins comprising the sequence SEQ ID NO: 2 or SEQ ID NO:25, preferably consisting of SEQ ID NO: 2 or of the association of SEQ ID NO:25 and SEQ ID NO:26, wherein said sequence comprises:
    • a mutation A′ consisting of the replacement of any amino acid of the Lysine Binding Site of SEQ ID NO: 2 or SEQ ID NO:25 by a hydrophilic amino acid chosen from arginine, aspartic acid, glutamic acid, lysine, asparagine, glutamine, serine, threonine, tyrosine and histidine, preferably by arginine, or
    • a mutation B consisting of the replacement of arginine in position 275 of SEQ ID NO: 2 or SEQ ID NO:25 by serine, or
    • a double mutation A′ and B consisting of the replacement of any amino acid of the Lysine Binding Site of SEQ ID NO: 2 or SEQ ID NO:25 by a hydrophilic amino acid chosen from arginine, aspartic acid, glutamic acid, lysine, asparagine, glutamine, serine, threonine, tyrosine and histidine, preferably by arginine, and the replacement of arginine in position 275 of SEQ ID NO: 2 or SEQ ID NO:25 by serine,
    • ii) proteins comprising a sequence having at least 80% homology with SEQ ID NO: 2 or SEQ ID NO:25, said proteins comprising mutation A′, mutation B, or mutation A′ and B, and
    • iii) proteins consisting of a fragment of SEQ ID NO:2, said fragment consisting of the Kringle 2 domain and the catalytic domain, said proteins comprising mutation A′, mutation B, or mutation A′ and B.

The amino acids of the Lysine Binding Site concerned by mutation A′ are easy to identify: if one amino acid of said Lysine Binding Site is mutated, then the corresponding mutant does not induce a significant effect in the NMDA neurotoxicity test, as explained in example 1 below (see protocol for “Excitotoxic neuronal death.”).

The amino acids of the Lysine Binding Site which may be mutated according to mutation A′ are preferably the charged amino acids (positively and negatively) and the hydrophobic amino acids of the Lysine Binding Site. Preferably said amino acids are the aspartic acids in position 236 and 238, and tryptophan in position 253 of SEQ ID NO:2 or SEQ ID NO:25.

Preferably, mutation A′ is mutation A consisting of the replacement of tryptophan in position 253 of SEQ ID NO: 2 or SEQ ID NO:25 by a hydrophilic amino acid chosen from arginine, aspartic acid, glutamic acid, lysine, asparagine, glutamine, serine, threonine, tyrosine and histidine.

Preferably, the double mutation A′ and B is double mutation A and B consisting of the replacement of tryptophan in position 253 of SEQ ID NO: 2 or SEQ ID NO:25 by a hydrophilic amino acid chosen from arginine, aspartic acid, glutamic acid, lysine, asparagine, glutamine, serine, threonine, tyrosine and histidine, and the replacement of arginine in position 275 of SEQ ID NO: 2 or SEQ ID NO:25 by serine.

Preferably, the protein of the invention is chosen from the group consisting of:

    • i) proteins comprising the sequence SEQ ID NO: 2 or SEQ ID NO:25, preferably consisting of SEQ ID NO: 2 or of the association of SEQ ID NO:25 and SEQ ID NO:26, wherein said sequence comprises:
    • a mutation A consisting of the replacement of tryptophan in position 253 of SEQ ID NO: 2 or SEQ ID NO:25 by a hydrophilic amino acid chosen from arginine, aspartic acid, glutamic acid, lysine, asparagine, glutamine, serine, threonine, tyrosine and histidine, or
    • a mutation B consisting of the replacement of arginine in position 275 of SEQ ID NO: 2 or SEQ ID NO:25 by serine, or
    • a double mutation A and B consisting of the replacement of tryptophan in position 253 of SEQ ID NO: 2 or SEQ ID NO:25 by a hydrophilic amino acid chosen from arginine, aspartic acid, glutamic acid, lysine, asparagine, glutamine, serine, threonine, tyrosine and histidine, and the replacement of arginine in position 275 of SEQ ID NO: 2 or SEQ ID NO:25 by serine,
    • ii) proteins comprising a sequence having at least 80% homology with SEQ ID NO: 2 or SEQ ID NO:25, said proteins comprising mutation A, mutation B, or mutation A and B, and
    • iii) proteins consisting of a fragment of SEQ ID NO:2, said fragment consisting of the Kringle 2 domain and the catalytic domain, said proteins comprising mutation A, mutation B, or mutation A and B.

Preferably, said mutation A consists of the replacement of tryptophan in position 253 of SEQ ID NO: 2 or SEQ ID NO:25 by arginine. Preferably, said mutation A and B consists of the replacement of tryptophan in position 253 of SEQ ID NO: 2 or SEQ ID NO:25 by arginine, and of the replacement of arginine in position 275 of SEQ ID NO: 2 or SEQ ID NO:25 by serine.

Preferably, the protein according to the invention comprises mutation A′ or mutation A′ and B, preferably mutation A or mutation A and B.

Said protein according to the invention is a mutated tPA, which has a good fibrinolytic activity and which does not promote N-methyl-D-aspartate receptors (NMDAR) mediated neurotoxicity. This is notably shown in the example below.

tPA is encoded by the PLAT gene and refers to the serine protease EC 3.4.21.68. Human tPA is commercially available as Alteplase (Activase® or Actilyse®). tPA is composed of 5 domains: a Finger domain in the N-terminus, then an EGF-like domain, a Kringle 1 and a Kringle 2 domains, and finally the catalytic domain in the C-terminus. The Kringle 2 domain comprises a Lysine Binding Site (LBS). The tPA protein is well conserved among mammals: human, pig, bovine, mouse and rat tPA share at least 80% homology. Particularly, human and rat tPA share 81% homology.

Human tPA can be found in UniProtKB under the accession number P00750, and rat tPA can be found in UniProtKB under the accession number P19637. Human tPA is present under 4 isoforms: isoform 1 is the canonical sequence, whereas isofoinis 2 to 4 differ from this canonical sequence by deletions and substitutions.

The protein is modified during processing: mammalian tPA is translated in a prepropeptide form, and then processed into the mature protein. The mature protein is finally cleaved into two chains, so as to give a two-chain form, wherein both chains are linked together via a disulfide bond.

For example, human tPA is first translated in a prepropeptide form comprising 562 amino acids, and then processed into the mature protein comprising 527 amino acids (the 35 first amino acids are cleaved during processing). Finally, after cleavage of the mature protein, the human two-chain form comprises a first chain of 275 amino acids, and a second chain of 252 amino acids.

The prepropeptide of human tPA corresponds to SEQ ID NO:1 in the present invention, whereas its mature protein corresponds to SEQ ID NO2. Finally, the first chain of the human two-chain form corresponds to SEQ ID NO:25, and the second chain of the human two-chain form corresponds to SEQ ID NO:26. SEQ ID NO:25 is identical to the first 275 amino acids of SEQ ID NO:2. SEQ ID NO:26 is identical to the last 252 amino acids of SEQ ID NO:2.

As another example, rat tPA is first translated in a prepropeptide form comprising 559 amino acids, and then processed into the mature protein comprising 527 amino acids (the 32 first amino acids are cleaved during processing).

Without being bound by any theory, the inventors have shown in the example that tPA specifically mutated in the Lysine Binding Site present in the Kringle 2 domain (i.e. like SEQ ID NO:4 or SEQ ID NO:3)—and particularly in a LBS constitutive tryptophan—do not induce neurotoxicity. Nevertheless, said mutations do not decrease the thrombolytic competence of said mutated tPA, the Kringle 2 domain having a minor function in fibrinolytic activity (Bakker et al, 1995; Bennett et al, 1991).

Moreover, tPA mutants according to the invention comprising at least mutation B are more stable than their wild type version.

The proteins according to the invention comprise mutated tPA proteins, in their original mature or cleaved form. Therefore, the proteins according to the invention comprise single-chain tPA (sc-tPA) mutated with mutation A, mutation B or mutation A and B. sc-tPA has its general meaning in the art and refers to the mature protein of tPA.

The proteins according to the invention also comprise two-chain tPA (tc-tPA) mutated with mutation A, mutation B or mutation A and B. tc-tPA has its general meaning in the art and refers to the cleaved form of tPA, obtained after cleavage of sc-tPA mature protein by a proteolytic cleavage at Arg-Ile, for example at Arg275-Ile276 in human. Both chains of tc-tPA are linked together by a disulfide bond.

It has to be noted that, because of mutation B according to the invention, sc* mutant cannot be converted into tc-tPA form by its usual activators (for example plasmin or kallikrein), but only in sc-tPA form.

The protein according to the invention may be chosen from group i), i.e. proteins comprising the sequence SEQ ID NO: 2 or SEQ ID NO:25, preferably consisting of SEQ ID NO: 2 or of the association of SEQ ID NO:25 and SEQ ID NO:26, wherein said sequence comprises:

    • a mutation A consisting of the replacement of tryptophan in position 253 of SEQ ID NO: 2 or SEQ ID NO:25 by a hydrophilic amino acid chosen from arginine, aspartic acid, glutamic acid, lysine, asparagine, glutamine, serine, threonine, tyrosine and histidine, preferably arginine, or
    • a mutation B consisting of the replacement of arginine in position 275 of SEQ ID NO: 2 or SEQ ID NO:25 by serine, or
    • a double mutation A and B consisting of the replacement of tryptophan in position 253 of SEQ ID NO: 2 or SEQ ID NO:25 by a hydrophilic amino acid chosen from arginine, aspartic acid, glutamic acid, lysine, asparagine, glutamine, serine, threonine, tyrosine and histidine, preferably arginine, and the replacement of arginine in position 275 of SEQ ID NO: 2 or SEQ ID NO:25 by serine.

Said group i) corresponds to sequences comprising SEQ ID NO:2, said SEQ ID NO:2 being specifically mutated with mutation A′, mutation B or mutation A′ and B (preferably with mutation A, mutation B or mutation A and B), and also to sequences comprising SEQ ID NO:25, said SEQ ID NO:25 being specifically mutated with mutation A′, mutation B or mutation A′ and B (preferably with mutation A, mutation B or mutation A and B).

Mutation A according to the invention is the following replacement: tryptophan in position 253 is replaced by a hydrophilic amino acid chosen from arginine, aspartic acid, glutamic acid, lysine, asparagine, glutamine, serine, threonine, tyrosine and histidine, preferably arginine. Thus, preferably, mutation A is the following replacement: W253R (in the present application, this nomenclature successively indicates: the amino acid which is replaced, its position in SEQ ID NO:2 or SEQ ID NO:25, and the amino acid which is introduced).

Mutation B according to the invention is the following replacement: R275S.

Mutation A and B according to the invention is the double mutation W253(hydrophilic amino acid chosen from arginine, aspartic acid, glutamic acid, lysine, asparagine, glutamine, serine, threonine, tyrosine and histidine, preferably arginine) and R275S.

Preferably, mutation A and B according to the invention is the double mutation W253R and R275S.

Preferably, group i) corresponds to sequences consisting of SEQ ID NO:2, said SEQ ID NO:2 being specifically mutated with mutation A, mutation B or mutation A and B, and also to sequences consisting of the association of SEQ ID NO:25 and SEQ ID NO:26, said SEQ ID NO:25 being specifically mutated with mutation A, mutation B or mutation A and B.

The expression “association of” SEQ ID NO:25 and SEQ ID NO:26 means that both sequences are linked together via a disulfide bond. It corresponds to the tc-tPA form. Preferably, proteins according to group i) are SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:13 and SEQ ID NO:14.

The protein according to the invention may also be chosen from group ii), i.e. proteins comprising a sequence having at least 80% homology with (the whole sequence) SEQ ID NO: 2 or SEQ ID NO:25, said proteins comprising mutation A′, mutation B, or mutation A′ and B (preferably mutation A, mutation B or mutation A and B). Proteins according to group ii) comprise a sequence having at least 80% homology with SEQ ID NO:2 over its whole length, and said proteins comprise mutation A′, mutation B, or mutation A′ and B (preferably mutation A, mutation B or mutation A and B). Proteins according to group ii) also comprise a sequence having at least 80% homology with SEQ ID NO:25 over its whole length, and said proteins comprise mutation A′, mutation B, or mutation A′ and B (preferably mutation A, mutation B or mutation A and B); in this case, said homologous protein may be linked to a protein consisting of SEQ ID NO:26 via a disulfide bond.

Said group ii) corresponds to amino acid sequences having at least 80% homology with SEQ ID NO:2 or SEQ ID NO:25, said SEQ ID NO:2 or SEQ ID NO:25 being specifically mutated with mutation A′, mutation B or mutation A′ and B (preferably with mutation A, mutation B or mutation A and B). Preferably, proteins of group ii) have at least 81%, preferably at least 85%, preferably at least 90%, preferably at least 95%, and preferably at least 99% homology with SEQ ID NO: 2 or SEQ ID NO:25, said proteins comprising mutation A′, mutation B, or mutation A′ and B (preferably mutation A, mutation B or mutation A and B).

Provided that they comprise mutation A′, mutation B, or mutation A′ and B, proteins of group ii) may comprise at least one of the following modifications:

    • the replacement of proline in position 125 of SEQ ID NO:2 or SEQ ID NO:25 by arginine,
    • the deletion of the Finger domain in the N-terminus and/or the deletion of the EGF-like domain, in SEQ ID NO:2 or SEQ ID NO:25, and/or the replacement of asparagine in position 117 of SEQ ID NO:2 or SEQ ID NO:25 by glutamine,
    • the replacement of threonine in position 103 of SEQ ID NO:2 or SEQ ID NO:25 by asparagine, and/or the replacement of asparagine in position 117 of SEQ ID NO:2 or SEQ ID NO:25 by glutamine, and/or the replacement of lysine-histidine-arginine-arginine (KHRR) in positions 296 to 299 of SEQ ID NO:2 by alanine-alanine-alanine-alanine (AAAA),
    • the replacement of cysteine in position 84 of SEQ ID NO:2 or SEQ ID NO:25 by serine,
    • the replacement of arginine in position 275 of SEQ ID NO:2 or SEQ ID NO:25 by glutamic acid or glycine, said protein comprising mutation A only, and/or the deletion the Kringle 1 domain in SEQ ID NO:2 or SEQ ID NO:25.

Provided that it comprises mutation A′, mutation B, or mutation A′ and B, the protein according to the invention may be chosen from group iii), i.e. proteins consisting of a fragment of SEQ ID NO:2, said fragment consisting of the Kringle 2 domain and the catalytic domain. Said fragment of SEQ ID NO:2 consisting of the Kringle 2 domain and the catalytic domain is thus devoided of the Finger domain, the EGF-like domain and the Kringle 1 domain. Preferably, said fragment of SEQ ID NO:2 consists of amino acids 180 to 526 of SEQ ID NO:2. Thus, said group iii) preferably corresponds to the sequence of amino acids 180 to 526 of SEQ ID NO:2, said sequence comprising mutation A′, mutation B or mutation A′ and B (preferably mutation A, mutation B or mutation A and B).

Preferably, proteins of group ii) or iii) come from human, rat, mouse, pig or bovine.

Preferably, proteins according to group ii) are SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:11 and SEQ ID NO:12.

Preferably, the protein according to the invention is chosen from the group consisting of proteins comprising at least one of the sequences SEQ ID NO: 3 to SEQ ID NO: 14. More preferably, the protein according to the invention is selected in the group consisting of sequences SEQ ID NO: 3 to SEQ ID NO: 14; in other words, said protein consists in one of the sequences SEQ ID NO: 3 to SEQ ID NO: 14.

Another object of the invention is a polynucleotide encoding for said protein. In view of the amino acid sequence of said protein, the corresponding polynucleotide can be synthetized. Preferably, said polynucleotide derived from sequences SEQ ID NO:15 or SEQ ID NO:16.

The described sequences in the present patent application can be summarized as follows:

Sequence
(SEQ ID NO) Corresponding protein or nucleic acid
1 Human wt tPA prepropeptide form
2 Human wt tPA mature form
3 Rat mutated K2* prepropeptide form
4 Rat mutated K2* mature form
5 Human mutated K2* prepropeptide form
6 Human mutated K2* mature form
7 Rat mutated sc* prepropeptide form
8 Rat mutated sc* mature form
9 Human mutated sc* prepropeptide form
10 Human mutated sc* mature form
11 Rat mutated K2*/sc* prepropeptide form
12 Rat mutated K2*/sc* mature form
13 Human mutated K2*/sc* prepropeptide form
14 Human mutated K2*/sc* mature form
15 Rat wt tPA prepropeptide form nucleic acid
16 Rat wt tPA mature form nucleic acid
17 to 24 Nucleic acid primers
25 Human wt tPA first chain of tc-tPA
26 Human wt tPA second chain of tc-tPA
27 Human wt tPA mature form with a 6xHis tag
at the N-terminal position, followed by a
linker between the his-tag and the tPA
sequence
28 Human mutated K2* tPA mature form with a
6xHis tag at the N-terminal position,
followed by a linker between the his-tag
and the tPA sequence (hutPA K2*)
29 Human mutated sc* tPA mature form with a
6xHis tag at the N-terminal position,
followed by a linker between the his-tag
and the tPA sequence (hutPA sc*)
30 Human tPA double mutant form with a
6xHis tag at the N-terminal position,
followed by a linker between the his-tag
and the tPA sequence (Opt-PA)
31 Human wt tPA P125R W253R R275S
mutant form with a 6xHis tag at the N-
terminal position, followed by a linker
between the his-tag and the tPA sequence
(Opt-PA2)

Another object of the invention is an expression vector comprising said polynucleotide encoding for said protein. According to the invention, expression vectors suitable for use in the invention may comprise at least one expression control element operationally linked to the nucleic acid sequence. The expression control elements are inserted in the vector to control and regulate the expression of the nucleic acid sequence. Examples of expression control elements include, but are not limited to, lac system, operator and promoter regions of phage lambda, yeast promoters and promoters derived from polyoma, adenovirus, cytomegalovirus, retrovirus, lentivirus or SV40. Additional preferred or required operational elements include, but are not limited to, leader sequence, termination codons, polyadenylation signals and any other sequences necessary or preferred for the appropriate transcription and subsequent translation of the nucleic acid sequence in the host system. It will be understood by one skilled in the art that the correct combination of required or preferred expression control elements will depend on the host system chosen. It will further be understood that the expression vector should contain additional elements necessary for the transfer and subsequent replication of the expression vector containing the nucleic acid sequence in the host system. Examples of such elements include, but are not limited to, origins of replication and selectable markers. It will further be understood by one skilled in the art that such vectors are easily constructed using conventional methods or commercially available.

Another object of the invention is a host cell comprising an expression vector as described here above, or a polynucleotide as described above. According to the invention, examples of host cells that may be used are eukaryote cells, such as animal, plant, insect and yeast cells and prokaryotes cells, such as E. coli. The means by which the vector carrying the gene may be introduced into the cells include, but are not limited to, microinjection, electroporation, transduction, or transfection using DEAE-dextran, lipofection, calcium phosphate or other procedures known to one skilled in the art.

In a preferred embodiment, eukaryotic expression vectors that function in eukaryotic cells are used. Examples of such vectors include, but are not limited to, viral vectors such as retrovirus, adenovirus, adeno-associated virus, herpes virus, vaccinia virus, poxvirus, poliovirus; lentivirus, bacterial expression vectors, plasmids, such as pcDNA5 or the baculovirus transfer vectors. Preferred eukaryotic cell lines include, but are not limited to, COS cells, CHO cells, HeLa cells, NIH/3T3 cells, 293 cells (ATCC# CRL1573), T2 cells, dendritic cells, or monocytes.

The protein according to the invention may be used as a medicament. Therefore, the protein according to the invention may be introduced in a pharmaceutical composition.

Particularly, the protein according to the invention may be used for treating thrombotic diseases. Said thrombotic diseases include ischemia, artery or vein occlusions (like central retinal artery occlusion), intra-cerebral haemorrhages and ocular haemorrhages. Intra-cerebral haemorrhages include stroke, intra-parenchymatous haemorrhages, intra-ventricular haemorrhages and subarachnoid haemorrhages. The intra-cerebral hematomas (or intraparenchymal) are a type of stroke, and are characterized by a spontaneous eruption of blood within the brain parenchyma and the cause is not traumatic.

Ocular haemorrhages include macular haemorrhages, linked to ocular diseases such as age-related macular degeneration (AMD), and vitreous haemorrhages.

Particularly, the protein according to the invention may be used for treating thrombotic diseases, preferably chosen from deep vein thrombosis (DVT), pulmonary embolism (PE), coronary artery disease (CAD), acute coronary syndrome (ACS), retinal occlusion, which can be central or not, artery or venous, preferably central retinal artery occlusion (CRAO), age related macular degeneration (AMD), cerebrovascular insufficiency, cerebral ischemia, cerebral infarction such as stroke, retinal ischemia, glaucoma, retinal degeneration, multiple sclerosis, ischemic optic neuropathy, reperfusion following acute cerebral ischemia, perinatal hypoxic-ischemic injury and intracranial haemorrhage of any type. Preferably, the protein according to the invention is used for treating intra-cerebral haemorrhages or ocular haemorrhages, more preferably for treating stroke or central retinal artery occlusion.

The pharmaceutical composition of the invention may be combined with pharmaceutically acceptable excipients, and optionally sustained-release matrices, such as biodegradable polymers, to form a therapeutic composition.

In the pharmaceutical composition of the present invention for oral, sublingual, subcutaneous, intramuscular, intravenous, intraarterial, intrathecal, intra-ocular, intra-cerebral, transdermal, local or rectal administration, the active principle, alone or in combination with another active principle, can be administered in a unit administration form, as a mixture with conventional pharmaceutical supports, to animals and human beings. Preferably, the pharmaceutical composition of the present invention is administered via the intra-ocular or intra-cerebral route.

The intra-ocular route includes intra-vitreous administration (like an injection), and the orbital floor route of administration.

Suitable unit administration forms comprise oral-route forms such as tablets, gel capsules, powders, granules and oral suspensions or solutions, sublingual and buccal administration forms, aerosols, implants, subcutaneous, transdermal, topical, intraperitoneal, intramuscular, intravenous, subdermal, transdermal, intrathecal and intranasal administration forms and rectal administration forms.

Preferably, the pharmaceutical composition contains vehicles which are pharmaceutically acceptable for a formulation capable of being injected. These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions. Said solutions may comprise at least polyurethane.

The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.

Solutions comprising compounds of the invention as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

The pharmaceutical composition of the invention can be formulated into a composition in a neutral or salt form. Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like.

The carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetables oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminium monostearate and gelatin.

Sterile injectable solutions are prepared by incorporating the active substances in the required amount in the appropriate solvent with several of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, but drug release capsules and the like can also be employed. For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this connection, sterile aqueous media which can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage could be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion. Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject.

The pharmaceutical composition of the invention may be formulated within a therapeutic mixture to comprise about 0.0001 to 1.0 milligrams, or about 0.001 to 0.1 milligrams, or about 0.1 to 1.0 or even about 10 milligrams per dose or so. Multiple doses can also be administered.

In addition to the compounds of the invention formulated for parenteral administration, such as intravenous or intramuscular injection, other pharmaceutically acceptable forms include, e.g. tablets or other solids for oral administration; liposomal formulations; time release capsules; and any other form currently used.

It will be understood that the total daily usage of the compounds and compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific compound employed; the specific composition employed, the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific polypeptide employed; and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. However, the daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per adult per day. Preferably, the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the dosage to the patient to be treated. A medicament typically contains from about 0.01 mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg of the active ingredient. An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg/kg to about 20 mg/kg of body weight per day, especially from about 0.001 mg/kg to 7 mg/kg of body weight per day.

The following examples are given for the purpose of illustrating various embodiments of the invention.

BRIEF DESCRIPTION OF THE FIGURES

Important note:

In the following figures which are related to the example, amino acids are numbered from the N-terminal serine of the mature Rattus norvegicus tPA sequence (UniProtKB: P19637).

FIG. 1. Comparison table of three plasminogen activators. A) Human tPA, Rat tPA and Desmodus rotundus plasminogen activator (DSPA) exhibit an almost similar sequence of domains ranging from a finger domain at the amino terminal extremity to the protease domain at the carboxyl terminal extremity. The kringle 2 domain of tPA is absent in DSPA. Moreover human and rat tPA and DSPA share strong homologies (>80% between rat and human tPA; >65% between human tPA and DSPA). B) Map of the plasmid pcDNA5/FRT used in the experiments for the expression of rat wt tPA.

FIG. 2. Primary structure comparison of human and rat tPA and DSPA. A) Sequence analysis of the kringle domain of DSPA reveals naturally occurring amino acid substitutions leading to a non-functional lysine-binding site: the anionic charges in position D237 and D239 (black box 1) and the hydrophobic amino acid W254 (black box 2) are missing. B) DSPA is a specific protease in that it exists only in a single-chain form whereas proteases such as human or rat tPA may be processed into a two-chain form.

FIG. 3. Biochemical characterization of the tPA-related muteins. A) Equal amounts (100 ng) of wt tPA, ΔK2-tPA, K2*-tPA and sc*-tPA muteins were subjected to immunoblotting. (B-C) Activity of the tPA-related muteins measured either on a fluorogenic substrate (B) or by plasminogen-casein zymography assays (C).

FIG. 4. K2-related muteins have improved fibrinolytic properties. A) ΔK2-tPA and K2*-tPA reveal a fibrinolytic activity as wt-tPA when subjected to fibrin agarose zymography following non reduced SDS PAGE electrophoresis. B) In vitro evaluation of fibrinolytic activity using a platelet-poor plasma clot (PPP-clot). K2*-tPA and ΔK2-tPA muteins express improved global fibrinolytic efficiency compared to wt-tPA (26% and 51% respectively).

Fibrinolytic activity was normalized to rat wt-tPA, using the half-time for clot lysis. (** p<0.02; * * * p<0.01).

FIG. 5. Invalidation of the constitutive lysine-binding site of the tPA kringle 2 domain abolishes tPA-mediated neurotoxicity. (A-C) Neuronal death was assessed by measuring LDH release in the bathing media 24 hours after an 1 hour exposure of primary cultured cortical neurons (14 days in vitro—DIV) to 50 μM NMDA alone or supplemented with either (A) human tPA or rat wt-tPA (0.3 μM; n=12, 3 independent experiments) (B) wt-tPA, ΔK2-tPA or K2*-tPA (0.3 μM; n=12, 4 independent experiments) or (C) human tPA in the presence or not of 0.1 mM of the lysine analogue ε-ACA (ε-amino caproic acid) (n=19, 5 independent experiments). Data are presented as the mean value±SD of neuronal death in percent relative to control.

( * * * p<0.01; ns: not significant).

FIG. 6. Fibrin partially restores plasminogen activation function of the inactive sc*-tPA. Whereas sc*-tPA is not able to promote alone the conversion of plasminogen into plasmin, its fibrin cofactor partially brings back its plasminogen activation function as detected (A) by fibrin agarose zymography following non reduced SDS PAGE electrophoresis and (B) in a platelet-poor plasma clot (PPP-clot) lysis assay. Fibrin clots restore the activity of sc*-tPA to a higher level than half the fibrinolytic activity of wt-tPA (n=3). Fibrinolytic activity was normalized to rat wt-tPA, using the half-time for clot lysis.

( * * * p<0.01).

FIG. 7. Restoring sc-tPA zymogenicity rescues neurons from tPA potentiation of NMDA-mediated neurotoxicity. Neuronal death was assessed by measuring LDH release in the bathing media 24 hours after a 1 hour exposure of primary cultured cortical neurons (14 days in vitro—DIV) to 50 μM NMDA alone or supplemented with either rat wt-tPA or rat sc*-tPA (0.3 μM; n=12, 4 independent experiments). Data are presented as the mean value±SD of neuronal death in per cent relative to control.

( * * * p<0.01; ns: not significant).

FIG. 8. Characterization of the human tPA variants. Equal amounts (200 ng) of the human tPA variants were subjected to immunoblotting and compared to the commercially available forms of tPA (actilyse) and reteplase (rapilysin).

FIG. 9. Biochemical characterization of the tPA variants. LEFT, intrinsic activity of the tPA variants determined by measuring the increase in absorbance of the free chromophore (AMC) generated, in comparison to the original substrate, per unit time at λ440 nm. The fluorogenic substrate used is Spectrofluor tPA (formula: CH3SO2-D-Phe-Gly-Arg-AMC.AcOH, American Diagnostica). Measurements were performed in duplicate using 5 different doses, in three independent experiments. CENTER, Fibrinolytic activity of the double or triple tPA mutants normalized to the commercially available tPA (actilyse) using the half-time for clot lysis toward euglobulin-derived clots. RIGHT, Fibrinolytic activity of the double or triple tPA mutants normalized to the commercially available tPA (actilyse) using the half-time for clot lysis toward whole plasma-derived clots.

FIG. 10. In vitro proof of concept of the non-neurotoxic effect of the human tPA variants. Neuronal cell death was assessed by measuring lactate dehydrogenase release in the bathing media as described in the methods section. Human tPA (actilyse), hutPAsc* or Opt-PA2 (0.3 μM; 4 independent experiments) (for hutPAsc* and Opt-PA2 definitions, see table of the sequences above). Data are presented as the mean value±SD of neuronal death in percent relative to control; ns: not significant.

FIG. 11. In vitro proof of concept of the non-neurotoxic effect of the human tPA variants. Neuronal cell death was assessed by measuring lactate dehydrogenase release in the bathing media as described in the methods section. Human tPA (actilyse), hutPAK2* or Opt-PA (0.3 μM; 4 independent experiments) (for hutPAK2* and Opt-PA definitions, see table of the sequences above). Data are presented as the mean value±SD of neuronal death in per cent relative to control; ns: not significant.

FIG. 12. Opt-PA does not promote NMDA-induced neurotoxicity in vivo. NMDA-induced excitotoxic brain lesions were measured by Magnetic Resonance Imaging (MRI) as described in the methods section, 24 hours after intrastriatal injection of NMDA (12.5 mM) alone or in combination with either actilyse (5 μM), Opt-PA (5 or hutPA K2* (5 μM) (for hutPAK2* and Opt-PA definitions, see table of the sequences above). Data are presented as the mean values±SD of lesion volumes in mm3.

Table 1. Summary of the tPA-related muteins produced in the study.

Table 2. Biochemical characteristics of the tPA variants. (1): sequence available in the UniProt Database, accession number P19637; (2): fibrinolytic activities obtained from euglobulin clot lysis time assay by reference to the International Reference Preparation (IRP 98/714) using the time to obtain 50% clot lysis; (3-4): Kd for fibrin (3) and Km and kcat for plasminogen in the presence of fibrin (4) obtained from 3 independent experiments (12 tested doses).

EXAMPLE 1

Rat tPA Mutants

Important note:

In the following study, amino acids are numbered from the N-terminal serine of the mature Rattus norvegicus tPA sequence (UniProtKB: P19637).

Material and Methods

Chemicals.

N-methyl-D-aspartate (NMDA) was purchased from Tocris (Bristol, United Kingdom).

Spectrofluor 444FL was purchased from American Diagnostica (Stamford, USA). 6-aminocaproic acid (ε-ACA), Dulbecco's modified Eagle's medium (DMEM), poly-D-lysine, cytosine β-D-arabinoside and hygromycin B were from Sigma-Aldrich (L'Isle d'Abeau, France). The QuickChange XL site-directed mutagenesis kit was from Stratagene (La Jolla, Calif., USA). Plasminogen was purchased from Calbiochem (Nottingham, United Kingdom). Lipofectamine 2000, Opti-MEM RSM, foetal bovine and horse sera, laminin were from Invitrogen (Cergy Pontoise, France). tPA (Actilyse®) came from Boehringer-Ingleheim (Germany).

Construction of Wild-Type tPA and ΔK2-tPA Muteins in pcDNA5/FRT Vector.

The full-size rat wild-type tPA coding sequence was amplified by PCR using an upstream primer 5′ CCGGGATCCTCCTACAGAGCGACC 3′ (SEQ ID NO:17) and a downstream primer 5′ GGCAAGCTTTTGCTTCATGTTGTCTTGAATCCAGTT 3′ (SEQ ID NO:18). A 6xHis tag was placed at the N-terminal position of the mature protein. Digested PCR products were then inserted into a pcDNA5/FRT vector (Invitrogen, Cergy-Pontoise, France). Fusion PCR was performed to obtain ΔK2-tPA from wt-tPA coding sequence using the same protocol with the following fusion primers: upstream 5′ CAGGCCGCACGTGGAGTCCTGAGTTGGTCCCTTAGG 3′ (SEQ ID NO:19) and downstream 5′ TCCACCTGCGGCCTG 3′ (SEQ ID NO:20). Final constructs were checked using an automated sequence analysis.

Site-Directed Mutagenesis.

Mutagenesis of full-length tPA wt (tPA W254R) has been performed by using QuikChange® XL Site-Directed Mutagenesis Kit purchased from Stratagene (Agilent Technologies, Massy, France) and the following primers 5′ GGACCGAAAGCTGACACGGGAATATTGCGACATGTCC 3′ (SEQ ID NO:21) and 5′ GGACATGTCGCAATATTCCCGTGGTCAGCTTTCGGTCC 3′ (SEQ ID NO:22). Non-cleavable tPA (tPA R276S) has been obtained using 5′ TACAAACAGCCTCTGTTTCGAATTAAAGGAGGA 3′ (SEQ ID NO:23) and 5′ TCCTCCTTTAATTCGAAACAGAGGCTGTTTGTA 3′ (SEQ ID NO:24) primers. Mutations have been confirmed using an automated sequence analysis.

Human Embryonic Kidney (HEK)-293 Cell Cultures and Stable Transfection.

Human embryonic kidney 293 cells already stable transfected with the pFRT/lacZeo vector (HEK-FlpIn, Invitrogen) were grown in RPMI-1640 medium supplemented with 10% fetal bovine serum and 2 mM glutamine. Cells at high confluence were transfected using lipofectamine 2000 reagent according to manufacturer protocol (Invitrogen) with a mixture containing the tPA-related plasmids and the plasmid helper pOG44. After 24 hours, cells were washed. 48 hours after transfection positive clones were isolated by hygromycine B selection. The quality of the transfection was assessed by RT-PCRq.

Conditionned Media-Containing the tPA-Related Muteins.

High confluency cells stable transfected with the different tPA-related plasmids were incubated for 24 hours in minimal medium composed of Opti-MEM RSM (Invitrogen) added of 2 mM glutamine et containing 10 IU/ml aprotinin and 200 μg/m1 hygromycin B. Supernatant were harvested in 0.01% azide, 2 mM EDTA, 0.01% tween 20, centrifuged 15 minutes at 10.000 g and finally stored at −20° C.

Bioreactor Production of the tPA-Related Muteins.

To produce high level of muteins, stable transfected HEK cells were grown in a laboratory-scale bioreactor CELLine AD 1000. Two weeks after a 1×106 viable cells/ml inoculation, cell compartment is harvested twice a week during four months. Each harvested supernatant is controlled in terms of pH, turbidity, centrifuged 15 minutes at 10.000 g and stored at −20° C. prior to 6xhis purification.

6xhis Muteins Purification.

Purification was processed using nickel-nitrilotriacetic acid (Ni-NTA) metal-affinity chromatography matrice (Qiagen, Courtaboeuf, France) according to manufacturer protocol. Muteins were then conditioned in a NH4HCO3 0.5 M buffer, quantified and stored.

tPA Immunoblotting.

Immunoblottings were performed using a monoclonal mouse antibody raised against a penta-histidine sequence (1/1000eme), followed by incubation with the appropriate biotinilated-conjugated secondary antibody. Signal was amplified using the Extravidine (Sigma) biotin-peroxydase conjugate (1/5000). Immunoblots were revealed with an enhanced chemoluminescence ECL Plus immunoblotting detection system (Perkin Elmer-NEN, Paris, France).

SDS-PAGE Plasminogen-Casein Zymography.

Zymography assay was performed by addition of plasminogen (4.5 μg/ml) and casein (1%) in 10% SDS-polyacrylamide gels. Electrophoresis was performed at 4° C. Gels were washed with Triton X-100 (2.5%) and incubated for 2 hours at 37° C. Caseinolytic bands were visualized after Coomassie staining.

Amidolytic Activity Assay.

tPA-related muteins were incubated in the presence of a fluorogenic substrate (5 μM) (Spectrofluor® FL444). The reaction was carried out at 37° C. in 50 mM Tris (pH 8.0) containing 150 mM NaCl in a total volume of 100 μL. The amidolytic activity was measured as the change in fluorescence emission at 440 nm (excitation at 360 nm). Using Spectrozyme®, an amidolytic substrate (Spectrozyme tPA, SptPA)), wt-tPA and sc*-tPA (0.3 nM) were incubated with increasing concentrations of the SptPA (0-1 mM) in a microplate (200 μL per well) and OD405 nm recorded every minute using a microplate spectrophotometer (ELx 808, Biotek, USA). Then, the maximal velocity (Vmax) of the reaction was calculated and the data were plotted as follows:

1 V = f  ( 1 [ SptPA ] ) = Km V m · ( 1 [ SptPA ] ) + 1 V m .

Fibrin Agarose Zymography.

Proteins (10 ng) and reference proteins (10 μL of tPA 0.06 iu/mL, uPA 0.25 iu/mL and plasmin 200 nM) were electrophoresed in a 8% polyacrylamide gel under non-reducing conditions. SDS was then exchanged with 2.5% Triton X-100. After washing-off excess Triton X-100 with distilled water, the gel was carefully overlaid on a 1% agarose gel containing 1 mg/mL of bovine fibrinogen, 100 nM plasminogen and 0.2 NIH unit/mL of bovine thrombin. Zymograms were allowed to develop at 37° C. during 12 h and photographed at regular intervals using dark-ground illumination. Active proteins in cell lysates were identified by reference to the migration of known markers (uPA, tPA, plasmin) To verify the activator identity, zymograms were made on a fibrin-agarose gel containing a polyclonal antibody directed against tPA or a non immun IgG.

Clot Lysis Time.

Human plasma was collected and the euglobulin fractions, containing β- and γ-globulins were separated by dilution of one volume of chilled plasma in 20 volumes of chilled acetic acid 2.9 mM. After incubation at 4° C. for 15 minutes and centrifugation at 3000 g for 10 minutes, the euglobulin fraction was precipitated, the supernatant discarded and the precipitate dissolved in HEPES buffer (10 mM HEPES pH 7.4, 150 mM NaCl). The euglobulin solution (100 μL) was supplemented with 15 mM calcium chloride and 5, 10, 15, 20, 25 or 30 I.U. of the tPA muteins. The time to clot lysis was recorded by optical density (405 nm absorbance) at 37° C. Tests were performed in duplicate. Results are expressed as the time to 50% clot lysis.

Neuronal Cell Culture.

Neuronal cultures were prepared from foetal mice (embryonic day 15-16) as previously described (Nicole et al., 2001). Briefly cortices were dissected and dissociated in DMEM, and plated on 24-well plates previously coated with poly-D-Lysine (0.1 mg/mL) and laminin (0.02 mg/mL). Cells were cultured in DMEM supplemented with 5% fetal bovine serum, 5% horse serum and 2 mM glutamine. Cultures were maintained at 37° C. in a humidified 5% CO2 atmosphere. Cytosine β-D-arabinoside (10 μM) was added after 3 days in vitro (DIV) to inhibit glial proliferation. Various treatments were performed after 14DIV.

Excitotoxic Neuronal Death.

Excitotoxicity was induced by exposure of cortical neurons to NMDA (50 μM) in serum-free DMEM supplemented with 10 μM of glycine, for 1 hour. Recombinant human tPA and rat tPA-related muteins were applied with NMDA when indicated. Neuronal death was quantified 24 hours later by measuring the activity of lactate dehydrogenase (LDH) released from damaged cells into the bathing medium by using a cytotoxicity detection kit (Roche Diagnostics; Mannheim, Germany). The LDH level corresponding to the maximal neuronal death was determined in sister cultures exposed to 200 nM NMDA (LDHmax). Background LDH levels were determined in sister cultures subjected to control washes (LDHmin). Experimental values were measured after subtracting LDHmin and then normalized to LDHmax−LDHmin in order to express the results in percentage of neuronal death relative to control.

Kinetics of Plasminogen Activation in the Presence of Fibrin.

Kinetics of the activation of plasminogen on a fibrin surface were determined for each of the tPA mutants as previously describe by Angles-cano et al. Briefly, fibrinogen (0.3 μM) was immobilized on PVC plates previously activated by glutaraldehyde. Then, thrombin (10 NIH U/mL) was added for 2 h at 37° C. to convert fibrinogen into fibrin. The plates are then washed with 9 nM PPACK-containing binding buffer (50 mM PO4 pH 6.8, 80 mM NaCl, 0.4% BSA, 0.01% Tween 20, 0.01% azide and 2 mM EDTA). tPA variants were then incubated on fibrin surfaces for 1 h at 37° C. with 50 μL of binding buffer. Unbound proteins were eliminated by washing with a buffer (50 mM PO4 pH 7.4, 80 mM NaCl, 0.2% BSA, 0.01% Tween 20, 0.01% azide) and the reaction started by adding 50 μL of assay buffer (50 mM PO4 pH 7.4, 80 mM NaCl, 0.2% BSA) containing increasing amounts of plasminogen (0-500 nM) and a fixed concentration (0.75 mM) of the plasmin-selective chromogenic substrate (CBS0065, Diagnostica STAGO, Asnières, France). The absorbance at 405 nm was recorded for 18 h using a spectrophotometer (ELx 808, Biotek, USA), and data were plotted as follows: ([Pn]=f (t)).The maximal velocity (MPn·s−1) was measured for each activator concentration and was plotted against activator concentrations (Vi=f([Pg]). Kinetic parameters were determined by fitting data to the Lineweaver-Burk equation:

1 Vi = Km V M  ( 1 [ Pg ] ) + 1 V M

The kcat was calculated by using the following equation:

kcat = V M [ tPA ]

Statistical Analysis.

All the statistical analyses were performed by the two-tailed Kruskall-Wallis' test, followed by post-hoc comparisons, with the two-tailed Mann-Whitney's test. Results are expressed as mean±SD relative to control. Statistical significance is considered for p<0.05.

Results

Generation of new thrombolytics originated from tPA. Structural differences between human tPA (UniProtKB: P00750), rat tPA (UniProtKB: P19637) and DSPAα1 (named DSPA) (UniProtKB: P98119) were studied using multiple alignments. Rat tPA shares 81% amino acids identity and 89% conserved substitutions with the human tPA (FIG. 1A). DSPA shares 67% amino acids identity and 79% conserved substitutions with the rat tPA. DSPA contains a single kringle domain having a high degree of amino acid sequence homology with the tPA's kringle 1 domain (FIG. 2A), including the absence of a constitutive lysine-binding site (FIG. 2A—black boxes). On the other hand the tPA's kringle 2 domain contains a constitutive lysine-binding site formed by the pair of aspartic acid in position 237 and 239 and the tryptophane in position 254. A second point of interest is that in contrast to tPA, DSPA is an exclusive single-chain serine protease (Schleuning et al., 1992). Indeed, analysis of the primary sequence of DSPA reveals the lack of the cleavage site present in tPA, Arg276-Iso277 (FIG. 2B). All these features of DSPA when compared to tPA are interestingly associated with an increased affinity for fibrin (Schleuning et al., 1992) and a lack of neurotoxicity (Liberatore et al., 2003).

Thus, based on these observations, the inventors have designed and generated three muteins derived from the rat tPA (Rattus norvegicus) (rat wild type tPA named wt-tPA): (i) a rat tPA genetically engineered with complete deletion of its K2 domain (deletion of the amino acids 181 to 262), named ΔK2-tPA; (ii) a rat tPA containing a tryptophan to arginine point mutation at position 254 (W254R), named K2*-tPA; (iii) an exclusive rat single-chain tPA obtained by an arginine to serine point mutation at position 276 (R276S), named sc*-tPA (table 1). After PCR-induced appropriate deletion/mutation as described above, the corresponding 6x histidine-tagged cDNAs were inserted into a mammalian expression vector pcDNA5/FRT (FRT: Flp Recombination Target) (FIG. 1B) and stable transfected in HEK-293 cells expressing the Flp-In system (Invitrogen) for stable production of the corresponding recombinant proteins, as described in the methods section. Once purified using nickel affinity chromatography, the muteins were subjected to SDS-PAGE electrophoresis and immunoblotting. wt-tPA, sc*-tPA and K2*-tPA displayed similar molecular weights, whereas the K2 deleted tPA, ΔK2-tPA, showed a 15 kDa reduced molecular weight (FIG. 3A). Interestingly, sc*-tPA is present under its exclusive single-chain form whereas wt-tPA, K2*-tPA and ΔK2-tPA present two-chain forms (at 35 kDa and 25 kDa for ΔK2-tPA). Thus the R276S point mutation (sc*-tPA) leads to the generation of a non-cleavable form of tPA Because tPA binds and cleaves several substrates beyond plasminogen, such as the PDGF-C or the NR1 subunit of the NMDAR with no identified allosteric regulator, the inventors have first evaluated the intrinsic proteolytic activity of each of these muteins. Thus, plasminogen-containing zymography assays (FIG. 3B) and amidolytic activity assays toward a fluorogenic substrate (Spectrofluor) (FIG. 3C) were performed for the different tPA-related muteins cited above. Our data reveal that although wt-tPA and kringle 2-related mutants (ΔK2-tPA and K2*-tPA) display amydolytic activity comparable to that observed for wt-tPA, sc*-tPA does not. Hereafter, muteins concentrations are normalised to their intrinsic proteolytic activity.

The inventors measured the ability of each of the tPA mutants to bind fibrin with Kd's of 0.26 nM, 1.2 nM, 0.5 nM and 0.82 nM for wt-tPA, sc*-tPA, K2*-tPA and ΔK2-tPA, respectively (Table 2).

tPA is known to bind and cleave several substrates beyond plasminogen (such as the GluN1 subunit) with no identified allosteric regulator. Therefore, the inventors evaluated the intrinsic proteolytic activity of each of the tPA variants. As such, amidolytic activity assays toward a fluorogenic substrate (Spectrofluor) and plasminogen-containing zymography assays were performed for the different tPA-related mutants cited above. The data reveal that, although wt-tPA and kringle 2-related mutants (ΔK2-tPA and K2*-tPA) display an amidolytic activity comparable to that observed for wt-tPA, sc*-tPA does not. To further investigate the behavior of the sc*-tPA variant when compared to the wt-tPA, the inventors determined the Km of both plasminogen activators by using the amidolytic Spectrozyme®, as the substrate. The data showed that, the point mutation within the cleavage site of tPA leads to a 3-fold increase of the Km value when compared to the wt-tPA (2.83E-04 and 9.12E-05 M, respectively). Hereafter, concentrations of the tPA mutants are normalised to their intrinsic amidolytic activity, unless otherwise mentioned.

Kringle 2-related muteins (ΔK2-tPA and K2*-tPA) display a higher fibrinolytic activity and failed to promote NMDA receptors mediated neurotoxicity. K2-related muteins were characterized toward their ability to initiate fibrinolysis on fibrin-agar plates as described in the methods section. ΔK2-tPA and K2*-tPA trigger activation of plasminogen into plasmin in the presence of fibrin as wt-tPA does (FIG. 4A). In vitro clot lysis assay, performed on platelet-poor human plasma clot (PPP-clot) as substrate, revealed that K2*-tPA and ΔK2-tPA displayed an enhanced fibrinolytic activity when compared to wt-tPA (+26% and +51% respectively) (FIG. 4B). To estimate their effect on NMDA receptor mediated neurotoxicity, pure cultures of cortical neurons (14 days in vitro) were subjected to 1 hour exposure of 50 μM NMDA either alone or in combination with either purified ΔK2-tPA or K2*-tPA (0.3 μM equivalent of their respective amidolytic activity) prior measure of the neuronal death 24 hours later. Although the rat wt-tPA leads to a 39% potentiation of NMDAR-mediated excitotoxicity (71% of neuronal death when compared to 51% with NMDA alone), an effect similar to what is observed for actilyse®-containing human tPA (FIG. 5A; n=3, p<0.01), ΔK2-tPA and K2*-tPA (FIG. 5B; n=4, p<0.01) have no pro-neurotoxic profiles. Thus, the tryptophan 254, a constitutive amino-acid of the kringle 2 LBS of tPA is critical to mediate the pro-neurotoxicity of tPA. Accordingly, same experiments performed in the presence of ε-amino caproic acid (ε-ACA), a lysine analog known to compete with the LBS of tPA, show that blockage of the LBS function prevented wild type tPA-induced potentiation of NMDAR-mediated neurotoxicity (FIG. 5C; n=5, p<0.01).

A zymogenic tPA (sc*-tPA) displays a non pro-neurotoxic profile. The inventors have tested both the fibrinolytic activity and the pro-neurotoxicity of the non-cleavable form of rat tPA, sc*-tPA, generated and purified as described above. In contrast to its lack of intrinsic amydolytic activity (FIG. 3B-C), sc*-tPA remains fibrinolytic in the presence of fibrin (FIG. 6A) despite a lower activity to that of wt-tPA (−39%) (FIG. 6B). Then, this mutein was tested for its ability to influence NMDAR-mediated neurotoxicity in primary cultures of cortical neurons. Interestingly, sc*-tPA fails to potentiate NMDA receptors-dependent excitotoxicity when compared to wt-tPA (n=3, p<0.01) (FIG. 7).

Altogether, the inventors have generated and characterized a set of original fibrinolytics derived from tPA: a K2*-tPA (SEQ ID NO: 4) characterized by a higher fibrinolytic activity and a lack of pro-neurotoxicity and a sc*-tPA (SEQ ID NO: 8) characterized by both a lack of amydolytic activity and pro-neurotoxicity despite a conserved fibrinolytic activity. These in vitro data provide the bases of further studies to evaluate the efficacy of this new generation of fibrinolytics in experimental models of thrombosis, prior possible transfer to clinical applications.

EXAMPLE 2

Human tPA Mutants

Material and Methods

Chemicals

N-methyl-D-aspartate (NMDA) was purchased from Tocris (Bristol, United Kingdom); Spectrofluor 444FL from American Diagnostica (ADF Biomedical, Neuville-sur-oise, France); 6-aminocaproic acid (ε-ACA), Dulbecco's modified Eagle's medium (DMEM), poly-D-lysine, cytosine β-D-arabinoside and hygromycin B from Sigma-Aldrich (L'Isle d'Abeau, France). Lipofectamine 2000, foetal bovine and horse sera, laminin and the GeneArt® Site-Directed Mutagenesis System were from Invitrogen (Cergy Pontoise, France). tPA (Alteplase®) came from Boehringer-Ingleheim (Paris, France). Reteplase (Rapilysin) came from Actavis (Paris, France).

Construction of Wild-Type tPA in pcDNA5/FRT Vector.

The human tPA was amplified by PCR using primers:

5′ GGCGCTAGCATGGATGCAATGAAGAGAGGGC 3′ (SEQ ID NO:32) and 5′ CCGGGCAAGCTTTTGCTTCATGTTGTCTTGAATCCAGTT 3′ (SEQ ID NO:33) (with a 6xHis tag at the N-terminal position of the mature protein). PCR products were inserted into a pcDNA5/FRT vector (Invitrogen, Cergy-Pontoise, France). Final construct was automatically sequenced.

Site-Directed Mutagenesis

Mutagenesis of hutPAwt was performed using GeneArt® Site-Directed Mutagenesis System and the following primers:

tPA I(2* (W253R) of SEQ ID NO:28: 5′ GCCAAGCCCCGGTGCCACGTGC 3′ (SEQ ID NO:34) and 5′ GCACGTGGCACCGGGGCTTGGC 3′ (SEQ ID NO:35). tPA sc* (R2755) of SEQ ID NO:29: 5′ GTACAGCCAGCCTCAGTTTAGCATCAAAGGAGGGC 3′ (SEQ ID NO:36) and 5′ AAACTGAGGCTGGCTGTACTGTCTCAGGCCGC 3′ (SEQ ID NO:37). P125R point mutation of tPA of SEQ ID NO:31: 5′ GCAGCGCGTTGGCCCAGAAGCGCTACAGCGGGC 3′ (SEQ ID NO:38) and 5′ CTTCTGGGCCAACGCGCTGCTGTTCCAGTTGG 3′ (SEQ ID NO:39). Mutations were confirmed by sequence analysis.

Human Embryonic Kidney (HEK)-293 Cell Cultures and Stable Transfection

Stable human embryonic kidney 293 cells transfected with the pFRT/lacZeo vector (HEK-FlpIn, Invitrogen) were grown in RPMI-1640 medium supplemented with 10% foetal bovine serum and 2 mM glutamine. Cells were transfected using lipofectamine 2000. Positive clones were isolated by hygromycine B selection. The quality of the transfection was assessed by RT-PCRq.

Bioreactor Production of the tPA-Related Mutants

To produce high yields of mutant genes, stable transfected HEK cells were grown in a laboratory-scale bioreactor CELLine AD 1000 (Dominique Dutscher SAS, Brumath, France).

Purification of 6xhis Mutants

Purification was processed using nickel-nitrilotriacetic acid (Ni-NTA) metal-affinity chromatography matrice (Qiagen, Courtaboeuf, France). tPA mutants were then conditioned in a NH4HCO3 0.5 M buffer and stored.

tPA Immunoblotting

Immunoblottings were performed using a polyclonal sheep antiserum raised against human tPA (1:5000) prepared at the National institute for agronomic research (INRA, Clermont-Theix, France) and a polyclonal rabbit antiserum raised against murine tPA (125 ng/μl), followed by incubation with the appropriate peroxidase-conjugated secondary antibody. Immunoblots were revealed with an enhanced chemoluminescence ECL Plus immunoblotting detection system (Perkin Elmer-NEN, Paris, France).

Amidolytic Activity Assay

tPA variants were incubated in the presence of a fluorogenic substrate (5 μM) (Spectrofluor® FL444). The reaction was carried out at 37 ° C. in 50 mM Tris (pH 8.0) containing 150 mM NaCl in a total volume of 100 μL. The amidolytic activity was measured as the change in fluorescence emission at 440 nm (excitation at 360 nm).

Clot Lysis Time

Human plasma was obtained from citrated blood. Plasma was supplemented with 15 mM of calcium chloride and each of the tPA mutants at 400, 420, 440, 460, 480 and 500 I.U. The euglobulin fraction was recovered as described above, supplemented with 15 mM calcium chloride and 15, 20, 25, 30, 35 or 40 I.U. of the tPA muteins. The time to clot lysis was recorded by optical density measurements (A405nm) at 37° C. by reference to the commercially available form of tPA (actilyse). Tests were performed in duplicate (from 3 independent experiments). Results are expressed as the time to obtain 50% clot lysis.

Neuronal Cell Culture

Neuronal cultures were prepared from foetal mice (embryonic day 15-16). Cortices were dissected and dissociated in DMEM, and plated on 24-well plates previously coated with poly-D-Lysine (0.1 mg/mL) and laminin (0.02 mg/mL). Cells were cultured in DMEM supplemented with 5% foetal bovine serum, 5% horse serum and 2 mM glutamine. Cultures were maintained at 37° C. in a humidified 5% CO2 atmosphere. Cytosine β-D-arabinoside (10 μM) was added after 3 days in vitro (DIV) to inhibit glial proliferation. Various treatments were performed after 14 DIV.

Excitotoxic Neuronal Death

Excitotoxicity was induced by exposure of cortical neurons to NMDA (50 μM) in serum-free DMEM supplemented with 10 μM of glycine, for 1 hour. The different tPA variants were applied with NMDA when indicated. Neuronal death was quantified 24 hours later by measuring the activity of lactate dehydrogenase (LDH) released from damaged cells into the bathing medium by using a cytotoxicity detection kit (Roche Diagnostics; Mannheim, Germany). The LDH level corresponding to the maximal neuronal death was determined in sister cultures exposed to 200 μM NMDA (LDHmax). Background LDH levels were determined in sister cultures subjected to control washes (LDHmin) Experimental values were measured after subtracting LDHmin and then normalized to LDHmax−LDHmin in order to express the results in percentage of neuronal death relative to control.

Excitotoxic Lesion

Excitotoxic lesions were performed under isoflurane-induced anaesthesia in male swiss mice (25-30 g; CURB, Caen, France). Striatal injections (coordinates: 0.5 mm posterior, +2.0 mm lateral, −3.0 mm ventral to the bregma; Paxinos & Watson, 1995) of 12.5 nmol NMDA versus either NMDA/actilyse, NMDA/Opt-PA or NMDA/hutPA K2* (12.5 mM NMDA and 5 μM equivalent amidolytic activity of tPA; total volume of 1 μl) were performed after placing the animals under a stereotaxic frame. Injections were made using adapted needles (calibrated at 15 mm/μL; assistant ref 555/5; Hoecht, Sodheim-Rhoen, Germany) and removed 5 minutes later. After 24 hours, brains were MRI analysed.

Magnetic Resonance Imaging (MRI)

Experiments were carried out at 24 hours following excitotoxic lesions on a Pharmascan 7T (Bruker, Germany). T2-weighted images were acquired using a Multi-Slice Multi-Echo (MSME) sequences: TE/TR 51.3 ms/1700 ms with 70×70×350 μm3 spatial resolution. Lesion sizes were quantified on these images using ImageJ software (v1.45r).

Results

Generation of new thrombolytics originated from tPA. The inventors have designed and generated six tPA mutants derived from the human tPA: (i) a human wild-type tPA named hutPA wt (SEQ ID NO: 27); (ii) a human tPA genetically engineered with complete deletion of its K2 domain (deletion of the amino acids 180 to 261), named hutPA ΔK2; (iii) a human tPA containing a tryptophan to arginine point mutation at position 253 (W253R, SEQ ID NO: 28), named hutPA K2*; (iv) an exclusive human single-chain tPA obtained by an arginine to serine point mutation at position 275 (R275S, ID SEQ NO: 29), named hutPA sc*; (v) a human tPA containing the double mutation W253R R275S, named Opt-PA (SEQ ID NO: 30); (vi) a human tPA containing the triple mutation P125R W253R R275S (SEQ ID NO: 31), named Opt-PA2. After PCR-induced appropriate deletion/mutation as described above, the corresponding 6x histidine-tagged cDNAs were inserted into a mammalian expression vector pcDNA5/FRT and stable transfected in HEK-293 cells expressing the Flp-In system (Invitrogen) for stable production of the corresponding recombinant proteins, as described in the methods section. Once purified using nickel affinity chromatography, the tPA mutants were subjected to SDS-PAGE electrophoresis and immunoblotting. Reteplase and activase were used as standards (FIG. 8). Interestingly, tPA mutants carrying the R275S point mutation are present under their exclusive single-chain form.

Biochemical characterization of the human derived tPA mutants. The inventors have first evaluated the intrinsic proteolytic activity of each of these mutants. Thus amidolytic activity assay toward a fluorogenic substrate (Spectrofluor) (FIG. 9-LEFT) was performed. Our data reveal that sc*-tPA, Opt-PA and Opt-PA 2 show an amidolytic activity decreased by 10, 2.5 and 2 respectively. The mutants were characterized toward their ability to initiate fibrinolysis in models of in vitro clot assays performed on platelet-poor human plasma clot (PPP-clot) as substrate. These assays reveal that both Opt-PA and Opt-PA show similar potentiality to trigger fibrinolysis (FIG. 9—CENTER), even in the presence of the tPA′ inhibitors (differences are no more than order of magnitude, FIG. 9—RIGHT).

R275S point mutation is not sufficient to abolish tPA-related NMDA receptors mediated neurotoxicity. To estimate the effect of the tPA mutants hutPA sc* and Opt-PA 2 on NMDA receptor mediated neurotoxicity, pure cultures of cortical neurons (14 days in vitro) were subjected to 1 hour exposure of 50 μM NMDA either alone or in combination with the purified mutants (0.3 μM) prior measure of the neuronal death 24 hours later. Although actilyse leads to a 61% potentiation of NMDAR-mediated excitotoxicity (59% of neuronal death when compared to 37% with NMDA alone), a similar effect is observed for hutPA sc* (62% of neuronal cell death, FIG. 10; n=4, p<0.05). Thus the R275S point mutation is not sufficient by itself to abolish tPA-related NMDA receptors mediated neurotoxicity. The inventors also tested the triple mutant Opt-PA in the above experimental setting up. They observed a marked tendency (but not significant) to abolish tPA-related NMDA receptor mediated neurotoxicity (51% of neuronal cell death, n=4, p=0.08).

The kringle 2-related human tPA mutants show a non-neurotoxic profile. hutPA K2* and Opt-PA were used in place of hutPA sc* and Opt-PA2 in the excitotoxic neuronal death assay (FIG. 11). Here, although actilyse leads to a 41% potentiation of NMDAR-mediated excitotoxicity (75% of neuronal death when compared to 53% with NMDA alone), hutPA K2* and Opt-PA do not promote NMDAR-mediated neurotoxicity (64% and 62% of neuronal cell death respectively, FIG. 11; n=4, p<0.05). Thus, the tryptophan 253, a constitutive amino-acid of the kringle 2 LBS of tPA is critical to mediate the pro-neurotoxicity of tPA. The two tPA mutants hutPA K2* and Opt-PA have an interesting non-neurotoxic profile.

Opt-PA does not increase neurotoxicity in an in vivo model of striatal lesion. The inventors have then tested the neurotoxicity of both hutPA K2* and Opt-PA in a model of striatal lesion in vivo. As described in the method section, 12.5 mM of NMDA and 5 μM of the tPA variants are injected into the striatum of swiss mice. 24 hours after injection the lesion volume is measured using non-invasive MRI imaging (FIG. 12). Whereas actilyse leads to a 48% potentiation of NMDA-mediated excitotoxicity (5.36 mm3 lesion volume % when compared to 3.62 mm3 with NMDA alone), hutPA K2* has an heterogeneous neurotoxic effect (5.15 mm3 lesion volume) and Opt-PA does not promote NMDA-mediated neurotoxicity (4.00 mm3 lesion volume, FIG. 12; n=11, p<0.05)

Altogether, the inventors have generated and characterized a set of original fibrinolytics derived from human tPA. From this set of mutants, Opt-PA (SEQ ID NO: 30) is characterized by a fibrinolytic activity similar to actilyse and a lack of pro-neurotoxicity in vitro and in vivo.

These data provide the bases of further studies to evaluate the efficacy of this new fibrinolytic in experimental models of thrombosis, prior possible transfer to clinical applications.

REFERENCES

Angles-Cano E (1986). A spectrophotometric solid-phase fibrin-tissue plasminogen activator activity assay (SOFIA-tPA) for high-fibrin-affinity tissue plasminogen activators. Anal Biochem. 153, pp. 201-210.

Angles-Cano, E., Balaton, A., Le Bonniec, B., Genot, E., Elion, J. et al. (1985). Production of monoclonal antibodies to the high fibrin-affinity, tissue-type plasminogen activator of human plasma. Demonstration of its endothelial origin by immunolocalization. Blood 66, pp. 913-920.

Pecorino, L T., Darrow, A L. and Strickland, S. (1991). In vitro analysis of the tissue plasminogen activator promoter reveals a GC box-binding activity present in murine brain but undetectable in kidney and liver. Mol. Cell. Biol. 11, pp. 3139-3147.

Buisson, A., Nicole, O., Docagne, F., Sartelet, H., Mackenzie, E T. et al. (1998). Up-regulation of a serine protease inhibitor in astrocytes mediates the neuroprotective activity of transforming growth factor betal. FASEB J. 12, pp. 1683-1691.

Siao, C. and Tsirka, S E. (2002). Tissue plasminogen activator mediates microglial activation via its finger domain through annexin II. J. Neurosci. 22, pp. 3352-3358.

Loscalzo, J. (1988). Structural and kinetic comparison of recombinant human single- and two-chain tissue plasminogen activator. J. Clin. Invest. 82, pp. 1391-1397.

Matsui, H., Takano, N., Moriyama, A. and Takahashi, T. (2005). Single-chain tissue-type plasminogen activator is a substrate of mouse glandular kallikrein 24. Zool. Sci. 22, pp. 1105-1111.

Rijken, D C. and Collen, D. (1981). Purification and characterization of the plasminogen activator secreted by human melanoma cells in culture. J. Biol. Chem. 256, pp. 7035-7041.

Thelwell, C. and Longstaff, C. (2007). The regulation by fibrinogen and fibrin of tissue plasminogen activator kinetics and inhibition by plasminogen activator inhibitor 1. J. Thromb. Haemost. 5, pp. 804-811.

Samson, A L. and Medcalf, R L. (2006). Tissue-type plasminogen activator: a multifaceted modulator of neurotransmission and synaptic plasticity. Neuron 50, pp. 673-678.

Yepes, M., Roussel, B D., Ali, C. and Vivien, D. (2009). Tissue-type plasminogen activator in the ischemic brain: more than a thrombolytic. Trends Neurosci. 32, pp. 48-55.

Benchenane, K., Berezowski, V., Ali, C., Fernández-Monreal, M., López-Atalaya, J P. et al. (2005). Tissue-type plasminogen activator crosses the intact blood-brain barrier by low-density lipoprotein receptor-related protein-mediated transcytosis. Circulation 111, pp. 2241-2249.

Benchenane, K., Berezowski, V., Fernández-Monreal, M., Brillault, J., Valable, S. et al. (2005). Oxygen glucose deprivation switches the transport of tPA across the blood-brain barrier from an LRP-dependent to an increased LRP-independent process. Stroke 36, pp. 1065-1070.

Harada, T., Kano, T., Katayama, Y., Matsuzaki, T., Tejima, E. et al. (2005). Tissue plasminogen activator extravasated through the cerebral vessels: evaluation using a rat thromboembolic stroke model. Thromb. Haemost. 94, pp. 791-796.

Benchenane, K., Castel, H., Boulouard, M., Bluthé, R., Fernandez-Monreal, M. et al. (2007). Anti-NR1 N-terminal-domain vaccination unmasks the crucial action of tPA on NMDA-receptor-mediated toxicity and spatial memory. J. Cell. Sci. 120, pp. 578-585.

Fugate, J E., Giraldo, E A. and Rabinstein, A A. (2010). Thrombolysis for cerebral ischemia. Front Neurol 1, pp. 139.

Fredriksson, L., Li, H., Fieber, C., Li, X. and Eriksson, U. (2004). Tissue plasminogen activator is a potent activator of PDGF-CC. EMBO J. 23, pp. 3793-3802.

Rosell, A., Cuadrado, E., Ortega-Aznar, A., Hernández-Guillamon, M., Lo, E H. et al. (2008). MMP-9-positive neutrophil infiltration is associated to blood-brain barrier breakdown and basal lamina type IV collagen degradation during hemorrhagic transformation after human ischemic stroke. Stroke 39, pp. 1121-1126.

Su, E J., Fredriksson, L., Geyer, M., Folestad, E., Cale, J. et al. (2008). Activation of PDGF-CC by tissue plasminogen activator impairs blood-brain barrier integrity during ischemic stroke. Nat. Med. 14, pp. 731-737.

Suzuki, Y., Nagai, N., Yamakawa, K., Kawakami, J., Lijnen, H R. et al. (2009). Tissue-type plasminogen activator (t-PA) induces stromelysin-1 (MMP-3) in endothelial cells through activation of lipoprotein receptor-related protein. Blood 114, pp. 3352-3358.

Suzuki, Y., Nagai, N., Umemura, K., Collen, D. and Lijnen, H R. (2007). Stromelysin-1 (MMP-3) is critical for intracranial bleeding after t-PA treatment of stroke in mice. J. Thromb. Haemost. 5, pp. 1732-1739.

Fredriksson, L., Ehmnan, M., Fieber, C. and Eriksson, U. (2005). Structural requirements for activation of latent platelet-derived growth factor CC by tissue plasminogen activator. J. Biol. Chem. 280, pp. 26856-26862.

Baron, A., Montagne, A., Cassé, F., Launay, S., Maubert, E. et al. (2010). NR2D-containing NMDA receptors mediate tissue plasminogen activator-promoted neuronal excitotoxicity. Cell Death Differ. 17, pp. 860-871.

Nicole, O., Docagne, F., Ali, C., Margaill, I., Carmeliet, P. et al. (2001). The proteolytic activity of tissue-plasminogen activator enhances NMDA receptor-mediated signaling. Nat. Med. 7, pp. 59-64.

Lopez-Atalaya, J P., Roussel, B D., Levrat, D., Parcq, J., Nicole, O. et al. (2008). Toward safer thrombolytic agents in stroke: molecular requirements for NMDA receptor-mediated neurotoxicity. J. Cereb. Blood Flow Metab. 28, pp. 1212-1221.

Krätzschmar, J., Haendler, B., Langer, G., Boidol, W., Bringmann, P. et al. (1991). The plasminogen activator family from the salivary gland of the vampire bat Desmodus rotundus: cloning and expression. Gene 105, pp. 229-237.

Witt, W., Baldus, B., Bringmann, P., Cashion, L., Donner, P. et al. (1992). Thrombolytic properties of Desmodus rotundus (vampire bat) salivary plasminogen activator in experimental pulmonary embolism in rats. Blood 79, pp. 1213-1217.

Liberatore, G T., Samson, A., Bladin, C., Schleuning, W. and Medcalf, R L. (2003). Vampire bat salivary plasminogen activator (desmoteplase): a unique fibrinolytic enzyme that does not promote neurodegeneration. Stroke 34, pp. 537-543.

Lopez-Atalaya, J P., Roussel, B D., Ali, C., Maubert, E., Petersen, K. et al. (2007). Recombinant Desmodus rotundus salivary plasminogen activator crosses the blood-brain barrier through a low-density lipoprotein receptor-related protein-dependent mechanism without exerting neurotoxic effects. Stroke 38, pp. 1036-1043.

Reddrop, C., Moldrich, R X., Beart, P M., Farso, M., Liberatore, G T. et al. (2005). Vampire bat salivary plasminogen activator (desmoteplase) inhibits tissue-type plasminogen activator-induced potentiation of excitotoxic injury. Stroke 36, pp. 1241-1246.

Schleuning, W D., Alagon, A., Boidol, W., Bringmann, P., Petri, T. et al. (1992). Plasminogen activators from the saliva of Desmodus rotundus (common vampire bat): unique fibrin specificity. Ann. N. Y. Acad. Sci. 667, pp. 395-403.

Hacke, W., Furlan, A J., Al-Rawi, Y., Davalos, A., Fiebach, J B. et al. (2009). Intravenous desmoteplase in patients with acute ischaemic stroke selected by MRI perfusion-diffusion weighted imaging or perfusion CT (DIAS-2): a prospective, randomised, double-blind, placebo-controlled study. Lancet Neurol 8, pp. 141-150.

Lees, K R., Bluhmki, E., von Kummer, R., Brott, T G., Toni, D. et al. (2010). Time to treatment with intravenous alteplase and outcome in stroke: an updated pooled analysis of ECASS, ATLANTIS, NINDS, and EPITHET trials. Lancet 375, pp. 1695-1703.

Sandhu, S S., Manvikar, S. and Steel, D H W. (2010). Displacement of submacular hemorrhage associated with age-related macular degeneration using vitrectomy and submacular tPA injection followed by intravitreal ranibizumab. Clin Ophthalmol 4, pp. 637-642.

Thompson, J T. and Sjaarda, R N. (2005). Vitrectomy for the treatment of submacular hemorrhages from macular degeneration: a comparison of submacular hemorrhage/membrane removal and submacular tissue plasminogen activator-assisted pneumatic displacement. Trans Am Ophthalmol Soc 103, pp. 98-107; discussion 107.

Macrez, R., Bezin, L., Le Mauff, B., Ali, C. and Vivien, D. (2010). Functional Occurrence of the Interaction of Tissue Plasminogen Activator With the NR1 Subunit of N-Methyl-D-Aspartate Receptors During Stroke. Stroke 41, pp. 2950-2955.

Macrez, R., Obiang, P., Gauberti, M., Roussel, B., Baron, A. et al. (2011). Antibodies Preventing the Interaction of Tissue-Type Plasminogen Activator With N-Methyl-D-Aspartate Receptors Reduce Stroke Damages and Extend the Therapeutic Window of Thrombolysis. Stroke.

Fernández-Monreal, M., López-Atalaya, J P., Benchenane, K., Cacquevel, M., Dulin, F. et al. (2004).

Arginine 260 of the amino-terminal domain of NR1 subunit is critical for tissue-type plasminogen activator-mediated enhancement of N-methyl-D-aspartate receptor signaling. J. Biol. Chem. 279, pp. 50850-50856.

Tate, K M., Higgins, D L., Holmes, W E., Winkler, M E., Heyneker, H L. et al. (1987). Functional role of proteolytic cleavage at arginine-275 of human tissue plasminogen activator as assessed by site-directed mutagenesis. Biochemistry 26, pp. 338-343.

Kim, H. and Joe, Y A. (2010). DGDA, a local sequence of the kringle 2 domain, is a functional motif of the tissue-type plasminogen activator's antiangiogenic kringle domain. Biochem. Biophys. Res. Commun. 391, pp. 166-169.

Armstead, W M., Nassar, T., Akkawi, S., Smith, D H., Chen, X. et al. (2006). Neutralizing the neurotoxic effects of exogenous and endogenous tPA. Nat. Neurosci. 9, pp. 1150-1155.

Cheng, T., Petraglia, A L., Li, Z., Thiyagarajan, M., Zhong, Z. et al. (2006). Activated protein C inhibits tissue plasminogen activator-induced brain hemorrhage. Nat. Med. 12, pp. 1278-1285.

Liu, D., Cheng, T., Guo, H., Fernández, J A., Griffin, J H. et al. (2004). Tissue plasminogen activator neurovascular toxicity is controlled by activated protein C. Nat. Med. 10, pp. 1379-1383.

Zhu, H., Fan, X., Yu, Z., Liu, J., Murata, Y. et al. (2010). Annexin A2 combined with low-dose tPA improves thrombolytic therapy in a rat model of focal embolic stroke. J. Cereb. Blood Flow Metab. 30, pp. 1137-1146.

Claims

1. A protein selected from the group consisting of:

i) a protein comprising the sequence SEQ ID NO: 2 or SEQ ID N0:25, wherein said sequence comprises:

a mutation A′ consisting of the replacement of any amino acid of the Lysine Binding Site of SEQ ID NO: 2 or SEQ ID NO:25 by a hydrophilic amino acid selected from the group consisting of arginine, aspartic acid, glutamic acid, lysine, asparagine, glutamine, serine, threonine, tyrosine and histidine, or

a mutation B consisting of the replacement of arginine in position 275 of SEQ ID NO: 2 or SEQ ID NO:25 by serine, or

a double mutation A′ and B consisting of the replacement of any amino acid of the Lysine Binding Site of SEQ ID NO: 2 or SEQ ID NO:25 by a hydrophilic amino acid chosen from arginine, aspartic acid, glutamic acid, lysine, asparagine, glutamine, serine, threonine, tyrosine and histidine, and the replacement of arginine in position 275 of SEQ ID NO: 2 or SEQ ID NO:25 by serine,

ii) a protein comprising a sequence having at least 80% homology with SEQ ID NO: 2 or SEQ ID NO:25, said protein comprising mutation A′, mutation B, or mutation A′ and B, and

iii) a protein comprising a fragment of SEQ ID NO:2, said fragment consisting of the Kringle 2 domain, the catalytic domain, and mutation A′, mutation B, or mutation A′ and B.

2. The protein according to claim 1, wherein said amino acid of the Lysine Binding Site of mutation A′ is one or both of a charged amino acid and a hydrophobic amino acid.

3. The protein according to claim 1, wherein said mutation A′ is mutation A consisting of the replacement of tryptophan in position 253 of SEQ ID NO: 2 or SEQ ID NO:25 by a hydrophilic amino acid chosen from arginine, aspartic acid, glutamic acid, lysine, asparagine, glutamine, serine, threonine, tyrosine and histidine.

4. The protein according to claim 1, wherein said double mutation A′ and B is double mutation A and B consisting of the replacement of tryptophan in position 253 of SEQ ID NO: 2 or SEQ ID NO:25 by a hydrophilic amino acid chosen from arginine, aspartic acid, glutamic acid, lysine, asparagine, glutamine, serine, threonine, tyrosine and histidine, and the replacement of arginine in position 275 of SEQ ID NO: 2 or SEQ ID NO:25 by serine.

5. The protein according to claim 1, wherein said protein comprises mutation A′ or mutation A′ and B.

6. The protein according to claim 3, wherein said protein comprises said mutation A or said mutation A and B.

7. The protein according to claim 1, wherein said protein comprises mutation A′, mutation B, or mutations A′ and B; and wherein said protein has a level of homology with SEQ ID NO: 2 or SEQ ID NO: 25 selected from the group consisting of at least 81%, at least 85%, at least 90%, at least 95%, and at least 99%.

8. The protein according to claim 1, wherein said protein comprises at least one of the following modifications:

the replacement of proline in position 125 of SEQ ID NO:2 or SEQ ID NO:25 by arginine,

the deletion of the Finger domain in the N-terminus and/or the deletion of the EGF-like domain, in SEQ ID NO:2 or SEQ ID NO:25, and/or the replacement of asparagine in position 117 of SEQ ID NO:2 or SEQ ID NO:25 by glutamine,

the replacement of threonine in position 103 of SEQ ID NO:2 or SEQ ID NO:25 by asparagine, and/or the replacement of asparagine in position 117 of SEQ ID NO:2 or SEQ ID NO:25 by glutamine, and/or the replacement of lysine-histidine-arginine-arginine (KHRR) in positions 296 to 299 of SEQ ID NO:2 by alanine-alanine-alanine-alanine (AAAA),

the replacement of cysteine in position 84 of SEQ ID NO:2 or SEQ ID NO:25 by serine,

the replacement of arginine in position 275 of SEQ ID NO:2 or SEQ ID NO:25 by glutamic acid or glycine, said protein comprising mutation A only, and/or the deletion of the Kringle 1 domain in SEQ ID NO:2 or SEQ ID NO:25.

9. The protein according to claim 1, wherein said protein is from a rat, mouse, pig or bovine.

10. The protein according to claim 1, wherein said protein comprises at least one sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14.

11. The protein according to claim 1, wherein said protein is selected in the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, and SEQ ID NO: 14.

12. A polynucleotide encoding for a protein according to claim 1.

13. The polynucleotide according to claim 12, wherein said polynucleotide is derived from sequences SEQ ID NO:15 and SEQ ID NO:16.

14. An expression vector comprising a polynucleotide according to claim 12.

15. A host cell comprising an expression vector according to claim 14 or a polynucleotide according to claim 12.

16. A method for treating a thrombotic or hemorrhagic disease in a subject in need thereof, comprising

administering a protein according to claim 1 to said subject.

17. (canceled)

18. The method of claim 16, wherein said thrombotic or hemorrhagic disease is selected from the group consisting of ischemia, artery or vein occlusions, intra-cerebral haemorrhages and ocular haemorrhages, stroke, intra-parenchymatous haemorrhages, intra-ventricular haemorrhages, subarachnoid haemorrhages, age related macular degeneration and vitreous haemorrhages.

19. A method for treating stroke or central retinal artery occlusion in a subject, comprising administering a protein according to claim 1 to said subject.

20. The protein of claim 1, wherein said protein comprises

said sequence as set forth in SEQ ID NO: 2 or

an association of said SEQ ID NO:25 and a sequence as set forth in SEQ ID NO:26.

21. The protein according to claim 2, wherein said charged amino acid is one or both of aspartic acid at positions 236 and 238 of SEQ ID NO:2 or SEQ ID NO:25, and/or said hydrophobic amino acid is tryptophan at position 253 of SEQ ID NO:2 or SEQ ID NO:25.

22. The protein of claim 4, wherein said protein comprises mutation A or mutation A and B

23. The method of claim 18, wherein said ocular haemorrhages are caused by central retinal artery occlusion.

Resources

Images & Drawings included:

Sources:

Recent applications in this class:

Recent applications for this Assignee: