Patent application title:

SYNTHETIC POLYPEPTIDE LIBRARIES AND METHODS FOR GENERATING NATURALLY DIVERSIFIED POLYPEPTIDE VARIANTS

Publication number:

US20150119294A1

Publication date:
Application number:

14/585,551

Filed date:

2014-12-30

Abstract:

The invention provides compositions and methods for generating libraries of DNA sequences encoding homologous polypeptides, and uses of the libraries to identify naturally diversified polypeptide variants. The invention also provides compositions and methods for generating collections of synthetic antibody fragments in which one or several complementary determining regions (CDR) are replaced by a collection of the corresponding CDR captured from a natural source. The invention further provides compositions and methods for diversifying a portion of a polypeptide by inserting a diversified sequence of synthetic or natural origin without the need for modification of the original polypeptide coding sequence.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N15/1037 »  CPC main

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Processes for the isolation, preparation or purification of DNA or RNA; Isolating an individual clone by screening libraries Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display

C07K16/005 »  CPC further

Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies constructed by phage libraries

C07K2317/622 »  CPC further

Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components Single chain antibody (scFv)

C07K2317/565 »  CPC further

Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL Complementarity determining region [CDR]

C12N15/10 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology Processes for the isolation, preparation or purification of DNA or RNA

C07K16/00 IPC

Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies

Description

RELATED APPLICATIONS

This application is a continuation of U.S. patent application Ser. No. 12/784,190, filed May 20, 2010, which claims the benefit of U.S. Provisional Application No. 61/179,850, filed May 20, 2009; U.S. Provisional Application No. 61/287,336, filed Dec. 17, 2009, and U.S. Provisional Application No. 61/314,794, filed Mar. 17, 2010, the contents of each of which are hereby incorporated by reference in their entirety.

INCORPORATION BY REFERENCE OF SEQUENCE LISTING

The contents of the text file named “NOVI018C02US_USSeqList.txt,” which was created on Dec. 22, 2014 and is 141 KB in size, are hereby incorporated by reference in their entirety.

FIELD OF THE INVENTION

The invention relates to the generation of libraries of DNA sequences encoding homologous polypeptides and to the use of such libraries. This invention in particular relates to the generation of collections of synthetic antibody fragments in which one or several complementary determining regions (CDR) are replaced by a collection of the corresponding CDR captured from a natural source. The invention further relates to the generation of collections of antibody fragments containing CDR derived from an immunized animal and their use as a better source to derive high affinity antibody fragments. The invention further relates to the diversification of a portion of a polypeptide by inserting a diversified sequence of synthetic or natural origin without the need for modification of the original polypeptide coding sequence.

BACKGROUND OF THE INVENTION

An antibody is composed of four polypeptides: two heavy chains and two light chains. The antigen binding portion of an antibody is formed by the light chain variable domain (VL) and the heavy chain variable domain (VH). At one extremity of these domains six loops form the antigen binding site and also referred to as the complementarity determining regions (CDR). Three CDRs are located on the VH domain (H1, H2 and H3) and the three others are on the VL domain (L1, L2 and L3). During B cell development a unique immunoglobulin region is formed by somatic recombination known as V(D)J recombination. The variable region of the immunoglobulin heavy or light chain is encoded by different gene segments. The heavy chain is encoded by three segments called variable (V), diversity (D) and joining (J) segments whereas the light chain variable is formed by the recombination of only two segments V and J. A large number of antibody paratopes can be generated by recombination between one of the multiple copies of the V, D and J segments that are present in the genome. The V segment encodes the CDR1 and CDR2 whereas the CDR3 is generated by the recombination events. During the course of the immune response further diversity is introduced into the antigen binding site by a process called somatic hypermutation (SHM). During this process point mutations are introduced in the variable genes of the heavy and light chains and in particular into the regions encoding the CDRs. This additional variability allows for the selection and expansion of B cells expressing antibody variants with improved affinity for their cognate antigen.

In recent years several display technologies have emerged and allow for the screening of large collections of proteins or peptides. These include phage display, bacterial display, yeast display and ribosome display (Smith G P. Science. 1985 Jun. 14; 228(4705):1315-7; Hanes J and Plückthun A. Proc Natl Acad Sci USA. 1997 May 13; 94(10):4937-42; Daugherty P S et al., Protein Eng. 1998 September; 11(9):825-32; Boder E T and Wittrup K D. Nat Biotechnol. 1997 Jun.; 15(6):553-7). In particular these methods have been applied extensively to antibodies and fragments thereof. A number of methods have been described to generate libraries of polypeptides and to screen for members with desired binding properties.

A first approach is to capture by gene amplification rearranged immunoglobulin genes from natural repertoires using either tissues or cells from humans or other mammals as a source of genetic diversity. These collections of rearranged heavy and light chains (VH and VL) are then combined to generate libraries of binding pairs that can be displayed on bacteriophage or on other display packages such as bacteria, yeast or mammalian cells. In this case a large fraction of the immunoglobulin repertoire found in the donor is captured. Thus all of the frameworks encoded by the donor germline genes can be found in such repertoires as well as diversity generated both by V(D)J recombination and by somatic hypermutation (Marks J D et al., J Mol Biol. 1991 Dec. 5; 222(3):581-97; McCaffety U.S. Pat. No. 5,969,108).

A limitation of natural repertoires is that naturally occurring antibodies can be based on frameworks with low intrinsic stability that limit their expression levels, shelf life and their usefulness as reagents or therapeutic molecules. In order to overcome these limitations a number of methods have been developed to generate synthetic antibody libraries. In these approaches, a unique or a limited number of selected antibody framework encoded by their corresponding germline genes are selected. The selection of these frameworks is commonly based on their biochemical stability and/or their frequency of expression in natural antibody repertoires. In order to generate a collection of binding proteins, synthetic diversity is then introduced in all or a subset of CDRs. Typically either the whole or part of the CDR is diversified using different strategies. In some cases diversity was introduced at selected positions within the CDRs (Knappik A et al., J Mol Biol. 2000 Feb. 11; 296(1):57-86). Targeted residues can be those frequently involved in antigen contact, those displaying maximal diversity in natural antibody repertoires or even residues that would be preferentially targeted by the cellular machinery involved in generating somatic hypermutations during the natural affinity maturation process (Balint R F, Larrick J W. Gene. 1993 Dec. 27; 137(1):109-18).

Several methods have been used to diversify the antibody CDRs. Overlapping PCR using degenerate oligonucleotides have been extensively used to assemble framework and CDR elements to reconstitute antibody genes. In another approach, unique restriction enzyme sites have been engineered into the framework regions at the boundary of each CDR allowing for the introduction of diversified CDRs by restriction enzyme mediated cloning. In any case, as all the members of the library are based on frameworks with selected and preferred characteristics, it is anticipated that the antibodies derived from these repertoires are more stable and provide a better source of useful reagents. (Knappik, U.S. Pat. No. 6,696,248; Sidhu S S, et al., Methods Enzymol. 2000; 328:333-63; Lee C V et al., J Mol Biol. 2004 Jul. 23; 340(5):1073-93).

However, an important limitation of these synthetic libraries is that a significant proportion of the library members are not expressed because the randomly diversified sequences do not allow for proper expression and/or folding of the protein. This problem is particularly significant for the CDR3 of the heavy chain. Indeed, this CDR often contributes to most of the binding energy to the antigen and is highly diverse in length and sequence. While the other CDR (H1, H2, L1, L2 and L3) can only adopt a limited number of three dimensional conformations, known as canonical folds, the number of conformations that can be adopted by the heavy chain CDR3 remains too diverse to be predicted (Al-Lazikani B et al., J Mol Biol. 1997 Nov. 7; 273(4):927-48). In addition, the use of long degenerate oligonucleotides used to cover long CDR H3 often introduces single base-pair deletions. These factors significantly reduce the functional size of synthetic repertoires.

Both natural and synthetic repertoires have advantages and limitations. On one hand, strategies relying on the capture of naturally rearranged antibody variable genes are not optimal as they include potentially less favorable frameworks within the library. A positive aspect is that these rearranged variable genes include CDRs which are compatible with proper domain folding as they have been expressed in context of a natural antibody. On the other hand, strategies based on selecting frameworks and inserting synthetic diversity benefit from the improved stability of the frameworks but are limited by the large number of CDR sequences that are not compatible with folding and/or expression and can destabilize the overall domain (FIG. 1A). There is therefore a need for novel approaches that could combine the benefits of using selected frameworks with desirable characteristics and combine them with properly folded CDRs for instance derived from natural repertoires.

All described approaches to generate antibody libraries either by capturing naturally rearranged antibody sequences or by generating diversity by synthetic means are limited by the occurrence of frame shift mutations leading to non-functional antibody sequences. These mutations can appear at multiple steps of the molecular handling of the DNA encoding the antibodies such as PCR amplification and DNA fragment assembly as well as molecular cloning. The frequency of non-functional members in antibody libraries typically ranges from 15% to 45% depending of the strategies employed to capture or generate the antibody diversity (Persson M A et al., Proc Natl Acad Sci USA. 1991 Mar. 15; 88(6):2432-6; Schoonbroodt S, et al., Nucleic Acids Res. 2005 May 19; 33(9):e81; Söderling E et al., Nat Biotechnol. 2000 August; 18(8):852-6; Rothe et al., J Mol Biol. 2008 Feb. 29; 376(4):1182-200). The frequency of sequences encoding non functional antibodies has a major impact on the antibody identification process. First, the functional size of the library is reduced and, because non-functional clones often have a growth advantage during the propagation of the libraries, they expand faster and can compromise the identification process of antibody candidates (De Bruin R et al., Nat Biotechnol 1999 Apr. 17: 397-399). These issues are recognized as serious limitations for fully exploiting the potential of antibody libraries. The generation of highly functional libraries remains a challenge in the field and has prompted many efforts to improve the process. For instance, multiple diversification strategies aiming at mimicking the amino acids usage found in natural CDR sequences have been used in order to more effectively sample the huge diversity of possible sequence combination encoded by synthetic CDRs (de Kruif J et al., J Mol Biol. 1995 Apr. 21; 248(1):97-105; Sidhu S S et al., J Mol Biol. 2004 Apr. 23; 338(2):299-310). Another approach is to clean up the initial library in order to remove nonfunctional clones at the potential expense of diversity loss. This has been applied to the pre-selection of synthetic repertoires by binding the antibody library to a generic ligand. This step allowed for the enrichment of library members that are able to express and to fold properly and can be used to recreate a more functional library (Winter and Tomlinson, U.S. Pat. No. 6,696,245 B2). Regardless of the approach the quality of any library is dependent on the efficiency of the molecular biology methods applied to generate the library and generally lead to 15% to 45% non-functional members of the library. There is therefore a need for novel and highly efficient approaches that minimize the frequency on non-functional genes due to frame shifts introduced during the molecular cloning steps and that maximize the functionality of libraries by capturing CDR regions having a high propensity of being correctly folded into antibody frameworks with desirable properties. Furthermore, there is a need for approaches that allow the capture of the CDR sequences from an animal immune repertoire into a therapeutically useful context such as human antibody frameworks in order to improve the generation process of high affinity antibodies.

SUMMARY OF THE INVENTION

The present invention provides methods of generating libraries of nucleic acid sequences that combine the benefits of stable framework selection and the insertion of naturally encoded complementarity determining regions (CDRs) or amino acid sequences that can fulfill the role of a CDR that have been selected in a natural context of a functional polypeptide such as an antibody. The method allows for the recovery of long CDRs or amino acid sequences that can fulfill the role of a CDR that are very difficult to encode using synthetic approaches. This invention, by combining stable frameworks and properly folded CDRs or amino acid sequences that can fulfill the role of a CDR, maximizes the proportion of functional antibodies in the library and therefore the performance of the selection process and the quality of selected clones. The invention provides a method to capture naturally expressed CDRs from different species and to insert them into a human antibody framework. This allows for the use of CDR H3 repertoires that differ significantly in length and composition when compared to the human repertoire. The invention enables the generation of human antibody fragments featuring structural repertoires derived from other species and thus the capacity to sample different structural spaces. The present methods are also used to introduce CDRs of synthetic origin or amino acid sequences that can fulfill the role of a CDR with a higher success frequency than alternative methods introducing fewer errors causing frame shifts in the coding sequence. Libraries generated using the present methods contain a high frequency of functional variants. Libraries of variants generated according to this method are used for selection and screening with any described display, selection and screening technology.

The analysis of immune repertoires from different species or, within a species, at different development stages has revealed some striking differences in the characteristics of CDR H3 composition and length. For instance the average CDRH3 length in humans is longer in adult when compared to fetal life or to newborns (Schroeder Jr, H W et al., 2001 Blood 98; 2745-2751). Interestingly despite large similarities between human and primate antibody germline genes, the evolution of the CDRH3 length during development differs (Link J M et al., Molecular Immunol. 2005 42; 943-955). The comparison of CDR H3 sequences found in mice and humans clearly shows that the average length is significantly shorter in mice (Rock E P et al., J Exp Med 1994 179; 323-328). During early B cell development in the bone marrow, the average CDR H3 length increases in mice whereas it tends to decrease in humans and in addition the amino acid composition of the murine and human CDRH3 repertoires differ (Zemlin M et al., 2003 J Mol Biol 334; 733-749; Ivanov I et al., 2005 J Immunol 174; 7773-7780). These examples indicate that different species express different ranges of CDR H3 repertoires despite the fact that they are globally exposed to similar classes of antigens and the biological significance of these observations remain to be further studied. It has been demonstrated that the shape of the combining site of antibodies directed against small antigens such as haptens or peptides differ from those directed against large proteins and the shape of the combining site is dictated by the length and composition of the CDRs (Collis A et al., J Mol Biol 2003 325; 337-354). From these finding it can be anticipated that the CDR H3 repertoire expressed by different species have varying propensities to react efficiently against different target classes.

The methods and antibody libraries provided herein are designed to exploit the various repertoires expressed by different species for the generation of therapeutic antibodies. These repertoires that explore different tridimensional spaces might allow for the generation of antibodies against a wider variety of target classes and epitopes. Methods to generate libraries form naïve or immunized animals are well described and these methods allow for the capturing of the corresponding repertoires and the generation of antibodies. However, antibodies derived from these libraries are not of human origin and are therefore not well suited for human therapy without performing further engineering work such as humanization. There is therefore a need for novel methods to harness the diversity expressed in the repertoire from different species and to exploit this diversity in the therapeutically useful context of a human antibody.

The methods and antibody libraries provided herein address several of the limitations described above and are an improvement over the current art. First, the methods provided herein combine the benefits of stable framework selection and the insertion of naturally encoded CDRs that have been selected in a natural context of a functional antibody. Second, the methods allow for a highly efficient insertion of synthetic or natural CDRs sequences into an antibody framework that significantly minimizes the number of frame shifts in the library and therefore improves its quality. Finally, the invention allows for a novel way to use naturally occurring antibody structural diversity by capturing naturally expressed CDR H3 repertoires from different species and to insert them into human antibody frameworks. It is thus possible to exploit these structurally diverse repertoires in a productive way for the generation of antibodies for human therapy.

The methods provided herein generate antibodies that contain a stable framework and correctly folded CDRs or amino acid sequences that can fulfill the role of a CDR. The methods capture the natural diversity of sequences in stable frameworks.

In the methods provided herein, the germline sequences for framework regions 1, 2 and 3 (FR1, FR2 and FR3) are selected from the desired organism, for example, from the human genome (see e.g., FIGS. 2 and 6). In one embodiment of this method, selected antibody variable domains are modified by introducing a stuffer sequence that will serve as an integration site for diversified sequences. Diversity is introduced into the sequence outside of the immunoglobulin coding region by introducing restriction enzyme recognition sites, for example, Type IIs restriction sites, at a desired location such as the variable heavy chain complementarity determining region 3 (CDR H3), the variable light chain complementarity determining region 3 (CDR L3), the variable heavy chain complementarity determining region 1 (CDR H1), the variable light chain complementarity determining region 1 (CDR L1), the variable heavy chain complementarity determining region 2 (CDR H2) or the variable light chain complementarity determining region 2 (CDR L2). While the examples provided herein demonstrate diversity at the CDR3 region (in the variable heavy chain region and/or variable light chain region), it is understood that diversity can be achieved at any desired location, such as, but not limited to, the CDR1 region (in the variable heavy chain region and/or variable light chain region) or the CDR2 region (in the variable heavy chain region and/or variable light chain region). Diversified DNA sequences are generated with flanking sequences that include Type IIs restriction sites. In the methods provided herein, the cohesive ends generated by the restriction enzymes are compatible and the reading frame is maintained, thus allowing the diversified DNA fragments to be ligated into an acceptor framework.

The methods provided herein are also useful for generating amino acid sequences having diversified regions encoded therein. For example, in the methods provided herein, the sequences for the non-diversified portions of the encoded amino acid are selected from the desired organism, for example, from the human sequence. A portion of the encoded amino acid sequence is modified by introducing a stuffer sequence that will serve as an integration site for diversified sequences. Diversity is introduced into the sequence at the desired location(s) by introducing restriction enzyme recognition sites, for example, Type IIs restriction sites, at a desired location within the encoded amino acid sequence. Diversified DNA sequences are generated with flanking sequences that include Type IIs recognition sites. In the methods provided herein, the cohesive ends generated by the restriction enzymes are compatible and the reading frame is maintained, thus allowing the diversified DNA fragments to be ligated into an acceptor framework.

In the methods provided herein, an “Acceptor Framework” is generated using a “stuffer fragment” of DNA that contain and are, preferably, bordered by two Type IIs restriction enzyme sites. (See e.g., FIG. 6). Preferably, these two Type IIs restriction enzyme sites digest sequences at the boundary of the site at which diversity is desired, such as, for example, the CDR H3 region, the CDR L3 region, the CDR H1 region, the CDR L1 region, the CDR H2 region or the CDR L2 region. As used herein, the term “Acceptor Framework” refers to a nucleic acid sequence that include the nucleic acid sequences encoding the FR1, FR2, FR3 and FR4 regions, the nucleic acid sequences encoding two CDRs or amino acid sequences that can fulfill the role of these CDRs, and a “stuffer fragment” that serves as the site of integration for diversified nucleic acid sequence. For example, in embodiments where diversity at the CDR3 region (in the variable heavy chain region and/or the variable light chain region) is desired, the Acceptor Framework includes the nucleic acid sequences encoding the FR1, FR2, FR3 and FR4 regions, the nucleic acid sequences encoding the CDR1 and CDR2 regions, and a “stuffer fragment” that serves as the site of integration for diversified nucleic acid sequence. For example, in embodiments where diversity at the CDR2 region (in the variable heavy chain region and/or the variable light chain region) is desired, the Acceptor Framework includes the nucleic acid sequences encoding the FR1, FR2, FR3 and FR4 regions, the nucleic acid sequences encoding the CDR1 and CDR3 regions, and a “stuffer fragment” that serves as the site of integration for diversified nucleic acid sequence. For example, in embodiments where diversity at the CDR1 region (in the variable heavy chain regions and/or the variable light chain regions) is desired, the Acceptor Framework includes the nucleic acid sequences encoding the FR1, FR2, FR3 and FR4 regions, the nucleic acid sequences encoding the CDR2 and CDR3 regions, and a “stuffer fragment” that serves as the site of integration for diversified nucleic acid sequence.

The terms “stuffer fragment”, “stuffer DNA fragment” and “stuffer sequence” or any grammatical variation thereof are used interchangeably herein to refer to a nucleic acid sequence that includes at least two Type IIs recognition sites and a diversified sequence. The Acceptor Framework can be a variable heavy chain (VH) Acceptor Framework or a variable light chain (VL) Acceptor Framework. The use of the Acceptor Frameworks and the stuffer fragments contained therein allow for the integration of a CDR sequence (natural or synthetic) or an amino acid sequence that can fulfill the role of the CDR into the acceptor framework with no donor framework nucleotides or residues contained therein or needed for integration. For example, the use of the Acceptor Frameworks and the stuffer fragments contained therein allow for the integration of a CDR sequence (natural or synthetic) selected from CDR H3, CDR L3, CDR H2, CDR L2, CDR H1 and CDR L1, or an amino acid sequence that can fulfill the role of a CDR selected from CDR H3, CDR L3, CDR H2, CDR L2, CDR H1 and CDR L1 into the acceptor framework with no donor framework nucleotides or residues contained therein or needed for integration. Thus, upon integration, the stuffer fragment is removed in full, and the coding region of the acceptor protein and the inserted proteins fragments (i.e., the CDRs) are intact.

The methods provided herein use primers that are designed to contain cleavage sites for Type IIs restriction enzymes at the boundary of the site of at which diversity is desired, for example, the CDR H3 region, the CDR L3 region, the CDR H2 region, the CDR L2, the CDR H1 region or the CDR L1 region. Random, naturally occurring CDR clones (see e.g., FIG. 10) or synthetic CDR sequences (see e.g., Example 6) or amino acid sequences that can fulfill the role of the CDR are captured in the Acceptor Frameworks used herein. For example, in embodiments where diversity at the CDR3 region (in the variable heavy chain region and/or the variable light chain region) is desired, random, naturally occurring CDR3 clones (see e.g., FIG. 10) or synthetic CDR3 sequences (see e.g., Example 6) or amino acid sequences that can fulfill the role of a CDR3 are captured in the Acceptor Frameworks used herein. For example, in embodiments where diversity at the CDR2 region (in the variable heavy chain region and/or the variable light chain region) is desired, random, naturally occurring CDR2 clones (see e.g., methods shown in FIG. 10) or synthetic CDR2 sequences (see e.g., methods shown in Example 6) or amino acid sequences that can fulfill the role of a CDR2 are captured in the Acceptor Frameworks used herein. For example, in embodiments where diversity at the CDR1 region (in the variable heavy chain region and/or the variable light chain region) is desired, random, naturally occurring CDR1 clones (see e.g., methods shown in FIG. 10) or synthetic CDR1 sequences (see e.g., methods shown in Example 6) or amino acid sequences that can fulfill the role of a CDR1 are captured in the Acceptor Frameworks used herein. As an example, oligonucleotides primers specific for flanking regions of the DNA sequence encoding the CDR H3 of immunoglobulins, i.e., specific for the FR3 and FR4 of the variable region, were designed. Oligonucleotide primers specific for flanking regions of the DNA sequences encoding other regions, such as, for example, the CDR L3, CDR H1, CDR L1, CDR H2, or CDR L2, can also be designed. These oligonucleotides contain at their 5′ end a site for a Type IIs restriction enzyme whereas their 3′ portion matches the targeted DNA sequence.

In some embodiments, the primer is a nucleic acid selected from the group consisting of SEQ ID NOs: 120-254.

The methods provided herein use Type IIs restriction enzymes, such as, for example, FokI, to insert natural CDR sequences, such as, for example, natural CDR H3, CDR L3, CDR H1, CDR L1, CDR H2, or CDR L2 sequences into the acceptor frameworks described herein. The methods provided herein use Type IIs restriction enzymes, such as, for example, FokI, to insert synthetic CDR sequences, such as, for example, synthetic CDR H3, CDR L3, CDR H1, CDR L1, CDR H2, or CDR L2 sequences into the acceptor frameworks described herein. The methods provided herein use Type IIs restriction enzymes, such as, for example, FokI, to insert amino acid sequences that can fulfill the role of a desired CDR region, such as, for example, an amino acid sequence that can fulfill the role of a natural or synthetic CDR H3, CDR L3, CDR H1, CDR L1, CDR H2, or CDR L2 region into the acceptor frameworks described herein. The Type IIs restriction enzymes are enzymes that cleave outside of their recognition sequence to one side. These enzymes are intermediate in size, typically 400-650 amino acids in length, and they recognize sequences that are continuous and asymmetric. Suitable Type IIs restriction enzymes, also known as Type IIs restriction endonucleases, and the sequences they identify are described, for example, in Szybalski et al., “Class-IIS Restriction Enzymes—a Review.” Gene, vol. 100: 13-26 (1991), the contents of which are hereby incorporated in their entirety by reference.

Primary Libraries include a VH Acceptor Framework and a fixed VL sequence (also referred to as a “dummy VL” sequence) or a VL Acceptor Framework and a fixed VH sequence (also referred to as a “dummy VH” sequence). Thus, Primary Libraries exhibit diversity in only one of the heavy or light chains. Secondary Libraries are generated by ligating a VH Acceptor Framework and a VL Acceptor Framework together (see e.g., Example 7). Secondary Libraries have diversity in both the heavy and light chains.

The invention provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin heavy chain variable domain containing a plurality of heavy chain complementarity determining region 3 (CDR H3) isolated from the immunoglobulin variable domain repertoire from a non-human species. In some embodiments, the method includes the steps of: (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct human immunoglobulin heavy chain variable domains, each Acceptor Framework nucleic acid sequence containing a first framework region (FR1), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FR1 and FR2 regions are interspaced by a complementarity determining region 1 (CDR1), the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a stuffer nucleic acid sequence including at least two Type IIs restriction enzyme recognition sites interspaced by a random nucleic acid sequence; (b) providing a plurality of diversified nucleic acid sequences encoding heavy chain complementarity determining region 3 (CDR H3) sequences isolated from a non-human species immunoglobulin repertoire wherein each of the plurality of diversified nucleic acid sequences includes a Type IIs restriction enzyme recognition site at each extremity; (c) digesting each of the plurality of nucleic acid sequences encoding the CDR H3 regions using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (b) and digesting the stuffer nucleic acid sequence of step (a) from the Acceptor Framework using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (a); and (d) ligating the digested nucleic acid sequences encoding the CDR H3 regions or the amino acid sequences of step (c) into the digested Acceptor Framework of step (c) such that the FR3 and FR4 regions are interspaced by the nucleic acid sequences encoding the CDR H3 region or the amino acid sequence that can fulfill the role of a CDR3 region and a complete immunoglobulin variable domain encoding sequences that do not contain the Type IIs restriction enzyme recognition sites of steps (a) and (b) are restored.

In some embodiments, step (b) as set forth above is performed by amplifying the CDR H3 sequence from a non human species using oligonucleotide primers containing a Type IIs restriction site. In some embodiments, step (b) as set forth above is performed by amplifying the CDR H3 sequence from a non human species using oligonucleotide primers containing a FokI IIs restriction site. In some embodiments, the non-human species is non-human primate, rodent, canine, feline, sheep, goat, cattle, horse, or pig.

The invention provides methods for producing a library of nucleic acids, wherein each nucleic acid encodes an immunoglobulin variable domain by (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FR1), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FR1 and FR2 regions are interspaced by a complementarity determining region 1 (CDR1), the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a stuffer nucleic acid sequence containing at least two Type IIs restriction enzyme recognition sites interspaced by a random nucleic acid sequence; (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 3 (CDR3) regions or encoding amino acid sequences that can fulfill the role of a CDR3 region, wherein each of the plurality of diversified nucleic acid sequences includes a Type IIs restriction enzyme recognition site at each extremity; (c) digesting each of the plurality of nucleic acid sequences encoding the CDR3 regions or amino acid sequences that can fulfill the role of a CDR3 region using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (b) and digesting the stuffer nucleic acid sequence of step (a) from the Acceptor Framework using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (a); and (d) ligating the digested nucleic acid sequences encoding the CDR3 regions or the amino acid sequences that can fulfill the role of a CDR3 region of step (c) into the digested Acceptor Framework of step (c) such that the FR3 and FR4 regions are interspaced by the nucleic acid sequences encoding the CDR3 region or the amino acid sequence that can fulfill the role of a CDR3 region and a complete immunoglobulin variable domain encoding sequences that do not contain the Type IIs restriction enzyme recognition sites of steps (a) and (b) are restored.

In some embodiments, the Type IIs restriction enzyme recognition sites of step (a) and step (b) are recognized by the same Type IIs restriction enzyme. In some embodiments, the Type IIs restriction enzyme recognition sites of step (a) and step (b) are recognized by different Type IIs restriction enzymes. For example, the Type IIs restriction enzyme recognition sites are FokI recognition sites, BsaI recognition sites, and/or BsmBI recognition sites.

In some embodiments, the Acceptor Framework nucleic acid sequence is derived from a human gene sequence. For example, the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence. In some embodiments, the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51. In some embodiments, the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence. For example, the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3-15, and VK3-20. In some embodiments, the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence. For example, the human lambda light chain variable gene sequence is selected from VL1-44 and VL1-51.

In one embodiment, the plurality of diversified nucleic acids encodes CDR3 regions, and the plurality of diversified nucleic acids includes naturally occurring sequences or sequences derived from immunized animals.

In one embodiment, the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDR3 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.

In one embodiment, the plurality of diversified nucleic acids encodes CDR3 regions, and the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.

In one embodiment, the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR3 region, and the plurality of diversified nucleic acids includes synthetic sequences.

In another embodiment, the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR3 region, and the plurality of diversified nucleic acids includes synthetic sequences.

In some embodiments, the plurality of Acceptor Framework nucleic acid sequences include a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.

In some embodiments, the methods provided include the additional step of (e) transforming the expression vector of step (d) into a host cell and culturing the host cell under conditions sufficient to express the plurality of Acceptor Framework sequences. For example, the host cell is E. coli. In some embodiments, the expression vector is a phagemid vector. For example, the phagemid vector is pNDS1.

The invention also provides methods for producing a library of nucleic acids, wherein each nucleic acid encodes an immunoglobulin variable domain, by (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FR1), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FR1 and FR2 regions are interspaced by a stuffer nucleic acid sequence including at least two Type IIs restriction enzyme recognition sites interspaced by a random nucleic acid sequence, the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a complementarity determining region 3 (CDR3); (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 1 (CDR1) regions or encoding amino acid sequences that can fulfill the role of a CDR1 region, wherein each of the plurality of diversified nucleic acid sequences includes a Type IIs restriction enzyme recognition site at each extremity; (c) digesting each of the plurality of nucleic acid sequences encoding the CDR1 regions or amino acid sequences that can fulfill the role of a CDR1 region using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (b) and digesting the stuffer nucleic acid sequence of step (a) from the Acceptor Framework using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (a); and (d) ligating the digested nucleic acid sequences encoding the CDR1 regions or the amino acid sequences that can fulfill the role of a CDR1 region of step (c) into the digested Acceptor Framework of step (c) such that the FR1 and FR2 regions are interspaced by the nucleic acid sequences encoding the CDR1 region or the amino acid sequence that can fulfill the role of a CDR1 region and a complete immunoglobulin variable domain encoding sequences that do not contain the Type IIs restriction enzyme recognition sites of steps (a) and (b) are restored.

In some embodiments, the Type IIs restriction enzyme recognition sites of step (a) and step (b) are recognized by the same Type IIs restriction enzyme. In some embodiments, the Type IIs restriction enzyme recognition sites of step (a) and step (b) are recognized by different Type IIs restriction enzymes. For example, the Type IIs restriction enzyme recognition sites are FokI recognition sites, BsaI recognition sites, and/or BsmBI recognition sites.

In some embodiments, the Acceptor Framework nucleic acid sequence is derived from a human gene sequence. For example, the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence. In some embodiments, the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51. In some embodiments, the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence. For example, the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3-15, and VK3-20. In some embodiments, the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence. For example, the human lambda light chain variable gene sequence is selected from VL1-44 and VL1-51.

In one embodiment, the plurality of diversified nucleic acids encodes CDR1 regions, and the plurality of diversified nucleic acids include naturally occurring sequences or sequences derived from immunized animals.

In one embodiment, the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDR1 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.

In one embodiment, the plurality of diversified nucleic acids encodes CDR1 regions, and the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.

In one embodiment, the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR1 region, and the plurality of diversified nucleic acids includes synthetic sequences.

In another embodiment, the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR1 region, and the plurality of diversified nucleic acids includes synthetic sequences.

In some embodiments, the plurality of Acceptor Framework nucleic acid sequences include a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.

In some embodiments, the methods provided include the additional steps of (e) cloning the library of nucleic acids encoding immunoglobulin variable domains of step (d) into an expression vector and (f) transforming the expression vector of step (e) into a host cell and culturing the host cell under conditions sufficient to express a plurality of immunoglobulin variable domain encoded by the library. For example, the host cell is E. coli. In some embodiments, the expression vector is a phagemid vector. For example, the phagemid vector is pNDS1.

The invention also provides methods for producing a library of nucleic acids, wherein each nucleic acid encodes an immunoglobulin variable domain, by (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FR1), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FR1 and FR2 regions are interspaced by a complementarity determining region 1 (CDR1), the FR2 and FR3 regions are interspaced by a stuffer nucleic acid sequence including at least two Type IIs restriction enzyme recognition sites interspaced by a random nucleic acid sequence, and the FR3 and FR4 regions are interspaced by a complementarity determining region 3 (CDR3); (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 2 (CDR2) regions or encoding amino acid sequences that can fulfill the role of a CDR2 region, wherein each of the plurality of diversified nucleic acid sequences includes a Type IIs restriction enzyme recognition site at each extremity; (c) digesting each of the plurality of nucleic acid sequences encoding the CDR2 regions or amino acid sequences that can fulfill the role of a CDR2 region using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (b) and digesting the stuffer nucleic acid sequence of step (a) from the Acceptor Framework using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (a); and (d) ligating the digested nucleic acid sequences encoding the CDR2 regions or the amino acid sequences that can fulfill the role of a CDR2 region of step (c) into the digested Acceptor Framework of step (c) such that the FR2 and FR3 regions are interspaced by the nucleic acid sequences encoding the CDR2 region or the amino acid sequence that can fulfill the role of a CDR2 region and a complete immunoglobulin variable domain encoding sequences that do not contain the Type IIs restriction enzyme recognition sites of steps (a) and (b) are restored.

In some embodiments, the Type IIs restriction enzyme recognition sites of step (a) and step (b) are recognized by the same Type IIs restriction enzyme. In some embodiments, the Type IIs restriction enzyme recognition sites of step (a) and step (b) are recognized by different Type IIs restriction enzymes. For example, the Type IIs restriction enzyme recognition sites are FokI recognition sites, BsaI recognition sites, and/or BsmBI recognition sites.

In some embodiments, the Acceptor Framework nucleic acid sequence is derived from a human gene sequence. For example, the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence. In some embodiments, the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51. In some embodiments, the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence. For example, the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3-15, and VK3-20. In some embodiments, the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence. For example, the human lambda light chain variable gene sequence is selected from VL1-44 and VL1-51.

In one embodiment, the plurality of diversified nucleic acids encodes CDR2 regions, and the plurality of diversified nucleic acids includes naturally occurring sequences or sequences derived from immunized animals.

In one embodiment, the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDR2 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.

In one embodiment, the plurality of diversified nucleic acids encode CDR2 regions, and the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.

In another embodiment, the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR2 region, and the plurality of diversified nucleic acids include synthetic sequences.

In some embodiments, the plurality of Acceptor Framework nucleic acid sequences include a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.

In some embodiments, the methods provided include the additional steps of (e) cloning the library of nucleic acids encoding immunoglobulin variable domains of step (d) into an expression vector and (f) transforming the expression vector of step (e) into a host cell and culturing the host cell under conditions sufficient to express a plurality of immunoglobulin variable domain encoded by the library. For example, the host cell is E. coli. In some embodiments, the expression vector is a phagemid vector. For example, the phagemid vector is pNDS1.

The invention also provides methods for making a target-specific antibody, antibody variable region or a portion thereof, by (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FR1), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FR1 and FR2 regions are interspaced by a complementarity determining region 1 (CDR1), the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a stuffer nucleic acid sequence including at least two Type IIs restriction enzyme recognition sites interspaced by a random nucleic acid sequence; (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 3 (CDR3) regions or encoding amino acid sequences that can fulfill the role of a CDR3 region, wherein each of the plurality of diversified nucleic acid sequences includes a Type IIs restriction enzyme recognition site at each extremity; (c) digesting each of the plurality of nucleic acid sequences encoding the CDR3 regions or amino acid sequences that can fulfill the role of a CDR3 region using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (b) and digesting the stuffer nucleic acid sequence of step (a) using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (a); (d) cloning the digested nucleic acid sequences encoding the CDR3 regions or the amino acid sequences that can fulfill the role of a CDR3 region into an expression vector and ligating the digested nucleic acid sequences encoding the CDR3 regions or the amino acid sequences that can fulfill the role of a CDR3 region of step (c) into the Acceptor Framework such that the FR3 and FR4 regions are interspaced by the nucleic acid sequences encoding the CDR3 region or the amino acid sequence that can fulfill the role of a CDR3 region and a complete immunoglobulin variable gene encoding sequence is restored; (e) transforming the expression vector of step (e) into a host cell and culturing the host cell under conditions sufficient to express the plurality of Acceptor Framework sequences; (f) contacting the host cell with a target antigen; and (g) determining which expressed Acceptor Framework sequences bind to the target antigen.

In some embodiments, the Type IIs restriction enzyme recognition sites of step (a) and step (b) are recognized by the same Type IIs restriction enzyme. In some embodiments, the Type IIs restriction enzyme recognition sites of step (a) and step (b) are recognized by different Type IIs restriction enzymes. For example, the Type IIs restriction enzyme recognition sites are FokI recognition sites, BsaI recognition sites, and/or BsmBI recognition sites.

In some embodiments, the Acceptor Framework nucleic acid sequence is derived from a human gene sequence. For example, the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence. In some embodiments, the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51. In some embodiments, the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence. For example, the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3-15, and VK3-20. In some embodiments, the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence. For example, the human lambda light chain variable gene sequence is selected from VL1-44 and VL1-51.

In one embodiment, the plurality of diversified nucleic acids encodes CDR3 regions, and the plurality of diversified nucleic acids includes naturally occurring sequences or sequences derived from immunized animals.

In one embodiment, the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDR3 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.

In one embodiment, the plurality of diversified nucleic acids encodes CDR3 regions, and the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.

In another embodiment, the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR3 region, and the plurality of diversified nucleic acids include synthetic sequences.

In some embodiments, the plurality of Acceptor Framework nucleic acid sequences include a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.

In some embodiments, the expression vector is a phagemid vector. For example, the phagemid vector is pNDS1. In some embodiments, the host cell is E. coli.

In some embodiments, the method includes the additional step of (i) sequencing the immunoglobulin variable domain encoding sequences that bind the target antigen.

The invention also provides methods for making a target-specific antibody, antibody variable region or a portion thereof, by (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FR1), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FR1 and FR2 regions are interspaced by a stuffer nucleic acid sequence including at least two Type IIs restriction enzyme recognition sites interspaced by a random nucleic acid sequence, the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a complementarity determining region 3 (CDR3); (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 1 (CDR1) regions or encoding amino acid sequences that can fulfill the role of a CDR1 region, wherein each of the plurality of diversified nucleic acid sequences includes a Type IIs restriction enzyme recognition site at each extremity; (c) digesting each of the plurality of nucleic acid sequences encoding the CDR1 regions or amino acid sequences that can fulfill the role of a CDR1 region using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (b) and digesting the stuffer nucleic acid sequence of step (a) using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (a); (d) cloning the digested nucleic acid sequences encoding the CDR1 regions or the amino acid sequences that can fulfill the role of a CDR1 region into an expression vector and ligating the digested nucleic acid sequences encoding the CDR1 regions or the amino acid sequences that can fulfill the role of a CDR1 region of step (c) into the Acceptor Framework such that the FR1 and FR2 regions are interspaced by the nucleic acid sequences encoding the CDR1 region or the amino acid sequence that can fulfill the role of a CDR1 region and a complete immunoglobulin variable gene encoding sequence is restored; (e) transforming the expression vector of step (e) into a host cell and culturing the host cell under conditions sufficient to express the plurality of Acceptor Framework sequences; (f) contacting the host cell with a target antigen; and (g) determining which expressed Acceptor Framework sequences bind to the target antigen.

In some embodiments, the Type IIs restriction enzyme recognition sites of step (a) and step (b) are recognized by the same Type IIs restriction enzyme. In some embodiments, the Type IIs restriction enzyme recognition sites of step (a) and step (b) are recognized by different Type IIs restriction enzymes. For example, the Type IIs restriction enzyme recognition sites are FokI recognition sites BsaI recognition sites, and/or BsmBI recognition sites.

In some embodiments, the Acceptor Framework nucleic acid sequence is derived from a human gene sequence. For example, the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence. In some embodiments, the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51. In some embodiments, the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence. For example, the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3-15, and VK3-20. In some embodiments, the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence. For example, the human lambda light chain variable gene sequence is selected from VL1-44 and VL1-51.

In one embodiment, the plurality of diversified nucleic acids encodes CDR1 regions, and the plurality of diversified nucleic acids includes naturally occurring sequences or sequences derived from immunized animals.

In one embodiment, the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDR1 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.

In one embodiment, the plurality of diversified nucleic acids encodes CDR1 regions, and the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.

In another embodiment, the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR1 region, and the plurality of diversified nucleic acids includes synthetic sequences.

In some embodiments, the plurality of Acceptor Framework nucleic acid sequences include a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.

In some embodiments, the expression vector is a phagemid vector. For example, the phagemid vector is pNDS1. In some embodiments, the host cell is E. coli.

In some embodiments, the method includes the additional step of (i) sequencing the immunoglobulin variable domain encoding sequences that bind the target antigen.

The invention provides methods for making a target-specific antibody, antibody variable region or a portion thereof, by (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FR1), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FR1 and FR2 regions are interspaced by a complementarity determining region 1 (CDR1), the FR2 and FR3 regions are interspaced by a stuffer nucleic acid sequence including at least two Type IIs restriction enzyme recognition sites interspaced by a random nucleic acid sequence, and the FR3 and FR4 regions are interspaced by a complementarity determining region 3 (CDR3); (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 2 (CDR2) regions or encoding amino acid sequences that can fulfill the role of a CDR2 region, wherein each of the plurality of diversified nucleic acid sequences includes a Type IIs restriction enzyme recognition site at each extremity; (c) digesting each of the plurality of nucleic acid sequences encoding the CDR2 regions or amino acid sequences that can fulfill the role of a CDR2 region using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (b) and digesting the stuffer nucleic acid sequence of step (a) from the Acceptor Framework using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (a); (d) ligating the digested nucleic acid sequences encoding the CDR2 regions or the amino acid sequences that can fulfill the role of a CDR2 region of step (c) into the digested Acceptor Framework of step (c) such that the FR2 and FR3 regions are interspaced by the nucleic acid sequences encoding the CDR2 region or the amino acid sequence that can fulfill the role of a CDR2 region and complete immunoglobulin variable domain encoding sequences that do not contain the Type IIs restriction enzyme recognition sites of steps (a) and (b) are restored; (e) cloning the library of nucleic acids encoding immunoglobulin variable domains of step (d) into an expression vector; (f) transforming the expression vector of step (e) into a host cell and culturing the host cell under conditions sufficient to express a plurality of immunoglobulin variable domains encoded by the library; (g) contacting the plurality of immunoglobulin variable domains of step (f) with a target antigen; and (h) determining which expressed immunoglobulin variable domain encoding sequences bind to the target antigen.

In some embodiments, the Type IIs restriction enzyme recognition sites of step (a) and step (b) are recognized by the same Type IIs restriction enzyme. In some embodiments, the Type IIs restriction enzyme recognition sites of step (a) and step (b) are recognized by different Type IIs restriction enzymes. For example, the Type IIs restriction enzyme recognition sites are FokI recognition sites, BsaI recognition sites, and/or BsmBI recognition sites.

In some embodiments, the Acceptor Framework nucleic acid sequence is derived from a human gene sequence. For example, the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence. In some embodiments, the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51. In some embodiments, the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence. For example, the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3-15, and VK3-20. In some embodiments, the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence. For example, the human lambda light chain variable gene sequence is selected from VL1-44 and VL1-51.

In one embodiment, the plurality of diversified nucleic acids encodes CDR2 regions, and the plurality of diversified nucleic acids includes naturally occurring sequences or sequences derived from immunized animals.

In one embodiment, the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDR2 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.

In one embodiment, the plurality of diversified nucleic acids encodes CDR2 regions, and the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.

In one embodiment, the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR2 region, and the plurality of diversified nucleic acids includes synthetic sequences.

In another embodiment, the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR2 region, and the plurality of diversified nucleic acids includes synthetic sequences.

In some embodiments, the plurality of Acceptor Framework nucleic acid sequences include a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.

In some embodiments, the host cell is E. coli. In some embodiments, the expression vector is a phagemid vector. For example, the phagemid vector is pNDS1.

In some embodiments, the method includes the additional step of (i) sequencing the immunoglobulin variable domain encoding sequences that bind the target antigen.

The invention also provides methods for producing a library of nucleic acids, wherein each nucleic acid encodes an immunoglobulin variable domain. These methods include the steps of (a) providing a plurality of Ig Acceptor Framework nucleic acid sequences into which a source of diversity is introduced at a single complementarity determining region (CDR) selected from the group consisting of complementarity determining region 1 (CDR1), complementarity determining region 2 (CDR2), and complementarity determining region 3 (CDR3), wherein the Ig Acceptor Framework sequence includes a stuffer nucleic acid sequence including at least two Type IIs restriction enzyme recognition sites, and wherein the source of diversity is a CDR selected from naturally occurring CDR sequences that contain Type IIs restriction enzyme recognition sites outside the CDR region, (b) introducing the source of diversity within each Ig Acceptor Framework by digesting both the source of diversity and the Ig Acceptor Frameworks with a Type IIs restriction enzyme; and (c) ligating the digested source of diversity into the Ig Acceptor Framework such that a complete immunoglobulin variable domain encoding sequences that do not contain the Type IIs restriction enzyme recognition sites of steps (a) and (b) are restored.

The naturally occurring CDR region sequences are substantially unaltered from their wild-type, i.e., natural state. These naturally occurring CDR region sequences are flanked by amino acid sequences that have been engineered (or otherwise artificially manipulated) to contain two Type IIs restriction enzyme recognition sites, with one Type IIs restriction enzyme recognition site on each of side of the naturally occurring CDR region sequence. The Type IIS restriction enzyme recognition sites are outside the CDR encoding region. The sequence of CDR regions are unaltered at the boundaries of the CDR encoding region—the restriction enzymes recognize and splice at a region that is up to the boundary of the CDR encoding region, but does not splice within the CDR encoding region.

In some embodiments, the Type IIs restriction enzyme recognition sites within the stuffer nucleic acid sequences and flanking the naturally occurring CDR sequences are recognized by the same Type IIs restriction enzyme. In some embodiments, the Type IIs restriction enzyme recognition sites within the stuffer nucleic acid sequences and flanking the naturally occurring CDR sequences are recognized by different Type IIs restriction enzymes. For example, the Type IIs restriction enzyme recognition sites are FokI recognition sites, BsaI recognition sites, and/or BsmBI recognition sites.

In some embodiments, the Ig Acceptor Framework nucleic acid sequence is derived from a human gene sequence. For example, the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence. In some embodiments, the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51. In some embodiments, the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence. For example, the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3-15, and VK3-20. In some embodiments, the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence. For example, the human lambda light chain variable gene sequence is selected from VL1-44 and VL1-51.

In some embodiments, the set of naturally occurring nucleic acids includes or is derived from sequences selected from naturally occurring CDR3 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.

In some embodiments, the set of naturally occurring nucleic acids encode CDR3 regions, and the set of naturally occurring nucleic acids include immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.

In some embodiments, the set of naturally occurring nucleic acids includes or is derived from sequences selected from naturally occurring CDR1 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.

In some embodiments, the set of naturally occurring nucleic acids encode CDR1 regions, and the set of naturally occurring nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.

In some embodiments, the set of naturally occurring nucleic acids includes or is derived from sequences selected from naturally occurring CDR2 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.

In some embodiments, the set of naturally occurring nucleic acids encodes CDR2 regions, and the set of naturally occurring nucleic acids includes immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.

In some embodiments, the plurality of Ig Acceptor Framework nucleic acid sequences include a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain (VL) Acceptor Framework nucleic acid sequence.

In some embodiments, the methods provided include the additional steps of (e) cloning the library of nucleic acids encoding immunoglobulin variable domains of step (d) into an expression vector and (f) transforming the expression vector of step (e) into a host cell and culturing the host cell under conditions sufficient to express a plurality of immunoglobulin variable domain encoded by the library. For example, the host cell is E. coli. In some embodiments, the expression vector is a phagemid vector. For example, the phagemid vector is pNDS1.

The invention also provides methods for producing a library of nucleic acids, wherein each nucleic acid encodes an immunoglobulin variable domain. These methods include the steps of (a) providing a plurality of Ig Acceptor Framework nucleic acid sequences into which a source of diversity is introduced at a single complementarity determining region (CDR) selected from the group consisting of complementarity determining region 1 (CDR1), complementarity determining region 2 (CDR2), and complementarity determining region 3 (CDR3), where the Ig Acceptor Framework sequence includes a stuffer nucleic acid sequence including at least two Type IIs restriction enzyme recognition sites, and wherein the source of diversity is a CDR selected from synthetically produced CDR sequences that contain Type IIs restriction enzyme recognition sites outside the CDR region, (b) introducing the source of diversity within each Ig Acceptor Framework by digesting both the source of diversity and the Ig Acceptor Framework with a Type IIs restriction enzyme; and (c) ligating the digested source of diversity into the Ig Acceptor Framework such that a complete immunoglobulin variable domain encoding sequences that do not contain the Type IIs restriction enzyme recognition sites of steps (a) and (b) are restored.

In some embodiments, the Type IIs restriction enzyme recognition sites within the stuffer nucleic acid sequences and the synthetically produced CDR sequences are recognized by the same Type IIs restriction enzyme. In some embodiments, the Type IIs restriction enzyme recognition sites within the stuffer nucleic acid sequences and the synthetically produced CDR sequences are recognized by different Type IIs restriction enzymes. For example, the Type IIs restriction enzyme recognition sites are FokI recognition sites, BsaI recognition sites, and/or BsmBI recognition sites.

In some embodiments, the Ig Acceptor Framework nucleic acid sequence is derived from a human sequence. For example, the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence. In some embodiments, the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51. In some embodiments, the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence. For example, the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3-15, and VK3-20. In some embodiments, the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence. For example, the human lambda light chain variable gene sequence is selected from VL1-44 and VL1-51.

In some embodiments, the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR3 region, and the plurality of diversified nucleic acids includes synthetic sequences.

In some embodiments, the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR1 region, and the plurality of diversified nucleic acids includes synthetic sequences.

In some embodiments, the plurality of diversified nucleic acids encode amino acid sequences that can fulfill the role of a CDR2 region, and the plurality of diversified nucleic acids includes synthetic sequences.

In some embodiments, the plurality of Ig Acceptor Framework nucleic acid sequences includes a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.

In some embodiments, the methods provided include the additional steps of (e) cloning the library of nucleic acids encoding immunoglobulin variable domains of step (d) into an expression vector and (f) transforming the expression vector of step (e) into a host cell and culturing the host cell under conditions sufficient to express a plurality of immunoglobulin variable domain encoded by the library. For example, the host cell is E. coli. In some embodiments, the expression vector is a phagemid vector. For example, the phagemid vector is pNDS1.

The invention also provides methods for making an immunoglobulin polypeptide. These methods include the steps of (a) providing a plurality of Ig Acceptor Framework nucleic acid sequences into which a source of diversity is introduced at a single complementarity determining region (CDR) selected from the group consisting of complementarity determining region 1 (CDR1), complementarity determining region 2 (CDR2), and complementarity determining region 3 (CDR3), wherein the Ig Acceptor Framework sequence includes a stuffer nucleic acid sequence including at least two Type IIs restriction enzyme recognition sites, and wherein the source of diversity is a CDR selected from naturally occurring CDR sequences that contain Type IIs restriction enzyme recognition sites outside the CDR region, (b) introducing the source of diversity within each Ig Acceptor Framework by digesting both the source of diversity and the Ig Acceptor Frameworks with a Type IIs restriction enzyme; (c) ligating the digested source of diversity into the Ig Acceptor Framework such that a complete immunoglobulin variable gene encoding sequence is restored; and (d) cloning the complete immunoglobulin variable gene encoding sequence from step (c) into an expression vector; and (e) transforming the expression vector of step (d) into a host cell and culturing the host cell under conditions sufficient to express the complete immunoglobulin gene encoding sequences that do not contain the Type IIs restriction enzyme recognition sites are restored.

In these embodiments, the naturally occurring CDR region sequences are substantially unaltered from their wild-type, i.e., natural state. These naturally occurring CDR region sequences are flanked by amino acid sequences that have been engineered (or otherwise artificially manipulated) to contain two Type IIs restriction enzyme recognition sites, with one Type IIs restriction enzyme recognition site on each of side of the naturally occurring CDR region sequence.

In some embodiments, the Type IIs restriction enzyme recognition sites within the stuffer nucleic acid sequences and flanking the naturally occurring CDR sequences are recognized by the same Type IIs restriction enzyme. In some embodiments, the Type IIs restriction enzyme recognition sites within the stuffer nucleic acid sequences and flanking the naturally occurring CDR sequences are recognized by different Type IIs restriction enzymes. For example, the Type IIs restriction enzyme recognition sites are FokI recognition sites, BsaI recognition sites, and/or BsmBI recognition sites.

In some embodiments, the Acceptor Framework nucleic acid sequence is derived from a human gene sequence. For example, the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence. In some embodiments, the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51. In some embodiments, the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence. For example, the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3-15, and VK3-20. In some embodiments, the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence. For example, the human lambda light chain variable gene sequence is selected from VL1-44 and VL1-51.

In some embodiments, the set of naturally occurring nucleic acids includes or is derived from sequences selected from naturally occurring CDR3 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.

In some embodiments, the set of naturally occurring nucleic acids encode CDR3 regions, and the set of naturally occurring nucleic acids include immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.

In some embodiments, the set of naturally occurring nucleic acids includes or is derived from sequences selected from naturally occurring CDR1 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.

In some embodiments, the set of naturally occurring nucleic acids encode CDR1 regions, and the set of naturally occurring nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.

In some embodiments, the set of naturally occurring nucleic acids includes or is derived from sequences selected from naturally occurring CDR2 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.

In some embodiments, the set of naturally occurring nucleic acids encodes CDR2 regions, and the set of naturally occurring nucleic acids includes immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.

In some embodiments, the plurality of Acceptor Framework nucleic acid sequences include a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.

In some embodiments, the expression vector is a phagemid vector. In some embodiments, the host cell is E. coli.

In some embodiments, the method also includes the steps of contacting the host cell with a target antigen, and determining which expressed complete Ig variable gene encoding sequences bind to the target antigen, thereby identifying target specific antibodies, antibody variable regions or portions thereof. In some embodiments, the method includes the additional step of (i) sequencing the immunoglobulin variable domain encoding sequences that bind the target antigen.

The invention also provides methods for making an immunoglobulin polypeptide. These methods include the steps of (a) providing a plurality of Ig Acceptor Framework nucleic acid sequences into which a source of diversity is introduced at a single complementarity determining region (CDR) selected from the group consisting of complementarity determining region 1 (CDR1), complementarity determining region 2 (CDR2), and complementarity determining region 3 (CDR3), wherein the Ig Acceptor Framework sequence includes a stuffer nucleic acid sequence including at least two Type IIs restriction enzyme recognition sites, and wherein the source of diversity is a CDR selected from synthetically produced CDR sequences that contain Type IIs restriction enzyme recognition sites outside the CDR region, (b) introducing the source of diversity within each Ig Acceptor Framework by digesting both the source of diversity and the Ig Acceptor Framework with a Type IIs restriction enzyme; (c) ligating the digested source of diversity into the Ig Acceptor Framework such that a complete immunoglobulin variable gene encoding sequence is restored; (d) cloning the ligated Ig Acceptor Framework from step (c) into an expression vector; and (e) transforming the expression vector of step (d) into a host cell and culturing the host cell under conditions sufficient to express the complete immunoglobulin gene encoding sequences that do not contain the Type IIs restriction enzyme recognition sites are restored.

In some embodiments, the Type IIs restriction enzyme recognition sites within the stuffer nucleic acid sequences and the synthetically produced CDR sequences are recognized by the same Type IIs restriction enzyme. In some embodiments, the Type IIs restriction enzyme recognition sites within the stuffer nucleic acid sequences and the synthetically produced CDR sequences are recognized by different Type IIs restriction enzymes. For example, the Type IIs restriction enzyme recognition sites are FokI recognition sites, BsaI recognition sites, and/or BsmBI recognition sites.

In some embodiments, the Ig Acceptor Framework nucleic acid sequence is derived from a human gene sequence. For example, the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence. In some embodiments, the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51. In some embodiments, the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence. For example, the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3-15, and VK3-20. In some embodiments, the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence. For example, the human lambda light chain variable gene sequence is selected from VL1-44 and VL1-51.

In some embodiments, the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR3 region, and the plurality of diversified nucleic acids includes synthetic sequences.

In some embodiments, the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR1 region, and the plurality of diversified nucleic acids includes synthetic sequences.

In some embodiments, the plurality of diversified nucleic acids encode amino acid sequences that can fulfill the role of a CDR2 region, and the plurality of diversified nucleic acids includes synthetic sequences.

In some embodiments, the plurality of Ig Acceptor Framework nucleic acid sequences includes a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.

In some embodiments, the expression vector is a phagemid vector. In some embodiments, the host cell is E. coli.

In some embodiments, the method also includes the steps of contacting the host cell with a target antigen, and determining which expressed complete Ig variable gene encoding sequences bind to the target antigen, thereby identifying target specific antibodies, antibody variable regions or portions thereof. In some embodiments, the method includes the additional step of (i) sequencing the immunoglobulin variable domain encoding sequences that bind the target antigen.

The invention provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 3 (CDR3) sequences isolated separately from the immunoglobulin variable domain repertoire from a mammalian species. The invention also provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 2 (CDR2) sequences isolated separately from the immunoglobulin variable domain repertoire from a mammalian species. The invention also provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 1 (CDR1) sequences isolated separately from the immunoglobulin variable domain repertoire from a mammalian species.

The invention provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 3 (CDR3) sequences isolated separately from the immunoglobulin variable domain repertoire from a non-human mammalian species. The invention also provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 2 (CDR2) sequences isolated separately from the immunoglobulin variable domain repertoire from a non-human mammalian species. The invention also provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 1 (CDR1) sequences isolated separately from the immunoglobulin variable domain repertoire from a non-human mammalian species.

In some embodiments, the non-human species is non-human primate, rodent, canine, feline, sheep, goat, cattle, horse, a member of the Camelidae family, llama, camel, dromedary, or pig.

The invention provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 3 (CDR3) sequences isolated separately from the immunoglobulin variable domain repertoire from a human. The invention provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 2 (CDR2) sequences isolated separately from the immunoglobulin variable domain repertoire from a human. The invention provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 1 (CDR1) sequences isolated separately from the immunoglobulin variable domain repertoire from a human.

The invention provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 3 (CDR3) sequences isolated separately from the immunoglobulin variable domain repertoire from a non-human species.

In some embodiments, these methods includes the steps of (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct human immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence comprising a first framework region (FR1), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FR1 and FR2 regions are interspaced by a complementarity determining region 1 (CDR1), the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a stuffer nucleic acid sequence comprising at least two Type IIs restriction enzyme recognition sites interspaced by a random nucleic acid sequence; (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 3 (CDR3) sequences isolated from the mammalian species immunoglobulin repertoire wherein each of the plurality of diversified nucleic acid sequences comprises a Type IIs restriction enzyme recognition site at each extremity; (c) digesting each of the plurality of nucleic acid sequences encoding the CDR3 regions using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (b) and digesting the stuffer nucleic acid sequence of step (a) from the Acceptor Framework using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (a); and (d) ligating the digested nucleic acid sequences encoding the CDR3 regions or the amino acid sequences of step (c) into the digested Acceptor Framework of step (c) such that the FR3 and FR4 regions are interspaced by the nucleic acid sequences encoding the CDR3 region or the amino acid sequence that can fulfill the role of a CDR3 region and a complete immunoglobulin variable domain encoding sequences that do not contain the Type IIs restriction enzyme recognition sites of steps (a) and (b) are restored. These steps may also be performed using a plurality of diversified nucleic acid sequences encoding complementarity determining region 2 (CDR2) sequences isolated from the mammalian species immunoglobulin repertoire. These steps may also be performed using a plurality of diversified nucleic acid sequences encoding complementarity determining region 1 (CDR1) sequences isolated from the mammalian species immunoglobulin repertoire.

In some embodiments, step (b) is performed by amplifying the CDR3 sequence from a mammalian species using oligonucleotide primers containing a Type IIs restriction site. In some embodiments, the oligonucleotide primer is designed to enhance compatibility between the mammalian CDR3 sequence and the Acceptor Framework encoding a human immunoglobulin variable domain. In some embodiments, the oligonucleotide primer is designed to modify the sequence at the boundaries of the mammalian CDR3 sequences to allow efficient ligation via compatible cohesive ends into the Acceptor Framework encoding a human immunoglobulin variable domain. In some embodiments the mammalian DNA sequences flanking the CDR3 regions might not upon cleavage by Type IIS restriction enzymes generate cohesive ends compatible with the cohesive ends of the digested Acceptor Frameworks. In such cases the oligonucleotides used for amplification are designed to modify the target mammalian sequence so that after cleavage with a Type IIS restriction enzyme, the cohesive ends are compatible and efficient ligation can occur. These steps can also be performed by amplifying the CDR2 sequence from a mammalian species using oligonucleotide primers containing a Type IIs restriction site. These steps can also be performed by amplifying the CDR1 sequence from a mammalian species using oligonucleotide primers containing a Type IIs restriction site.

In some embodiments, step (b) is performed by amplifying the CDR3 sequence from a non human species using oligonucleotide primers containing a FokI IIs restriction site. These steps can also be performed by amplifying the CDR2 sequence from a mammalian species using oligonucleotide primers containing a FokI IIs restriction site. These steps can also be performed by amplifying the CDR1 sequence from a mammalian species using oligonucleotide primers containing a FokI IIs restriction site.

In some embodiments, the Type IIs restriction enzyme recognition sites of step (a) and step (b) are recognized by a different Type IIs restriction enzyme. In some embodiments, the Type IIs restriction enzyme recognition sites are BsmBI recognition sites, BsaI recognition sites, FokI recognition sites or a combination thereof.

In some embodiments, the diversified nucleic acid sequences encoding CDR3 sequences encode heavy chain CDR3 (CDR H3) sequences. In some embodiments, the diversified nucleic acid sequences encoding CDR3 sequences encode light chain CDR3 (CDR L3) sequences. In some embodiments, the diversified nucleic acid sequences encoding CDR2 sequences encode heavy chain CDR2 (CDR H2) sequences. In some embodiments, the diversified nucleic acid sequences encoding CDR2 sequences encode light chain CDR2 (CDR L2) sequences. In some embodiments, the diversified nucleic acid sequences encoding CDR1 sequences encode heavy chain CDR1 (CDR H1) sequences. In some embodiments, the diversified nucleic acid sequences encoding CDR1 sequences encode light chain CDR1 (CDR L1) sequences.

In some embodiments, the Acceptor Framework nucleic acid sequence includes or is derived from at least a portion of a human heavy chain variable gene sequence selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51. In some embodiments, the Acceptor Framework nucleic acid sequence includes is derived from at least a portion of a human kappa light chain variable gene sequence. For example, the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3-15, and VK3-20. In some embodiments, the Acceptor Framework nucleic acid sequence includes or is derived from at least a portion of a human lambda light chain variable gene sequence. For example, the human lambda light chain variable gene sequence is selected from VL1-44 and VL1-51.

In some embodiments, the plurality of Acceptor Framework nucleic acid sequences comprises a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.

In some embodiments, the methods described herein also include the steps of (e) cloning the library of nucleic acids encoding immunoglobulin variable domains of step (d) into an expression vector and (f) transforming the expression vector of step (e) into a host cell and culturing the host cell under conditions sufficient to express a plurality of immunoglobulin variable domain encoded by the library. In some embodiments, the expression vector is a phagemid or phage vector. In some embodiments, the host cell is E. coli.

The invention provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 3 (CDR3) sequences isolated separately from immunoglobulin variable domains from an immunized non-human mammal or non-human species. The invention also provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 2 (CDR2) sequences isolated separately from immunoglobulin variable domains from an immunized non-human mammal. The invention also provides methods for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain including a plurality of complementarity determining region 1 (CDR1) sequences isolated separately from immunoglobulin variable domains from an immunized non-human mammal.

In some embodiments, the non-human species is non-human primate, rodent, canine, feline, sheep, goat, cattle, horse, a member of the Camelidae family, llama, camel, dromedary, or pig.

In some embodiments, the methods include the steps of (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct human immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence comprising a first framework region (FR1), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FR1 and FR2 regions are interspaced by a complementarity determining region 1 (CDR1), the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a stuffer nucleic acid sequence comprising at least two Type IIs restriction enzyme recognition sites interspaced by a random nucleic acid sequence; (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 3 (CDR3) sequences isolated from the immunized non-human mammal wherein each of the plurality of diversified nucleic acid sequences comprises a Type IIs restriction enzyme recognition site at each extremity; (c) digesting each of the plurality of nucleic acid sequences encoding the CDR3 regions using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (b) and digesting the stuffer nucleic acid sequence of step (a) from the Acceptor Framework using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (a); and (d) ligating the digested nucleic acid sequences encoding the CDR3 regions or the amino acid sequences of step (c) into the digested Acceptor Framework of step (c) such that the FR3 and FR4 regions are interspaced by the nucleic acid sequences encoding the CDR3 region or the amino acid sequence that can fulfill the role of a CDR3 region and a complete immunoglobulin variable domain encoding sequences that do not contain the Type IIs restriction enzyme recognition sites of steps (a) and (b) are restored. These steps may also be performed using a plurality of diversified nucleic acid sequences encoding complementarity determining region 2 (CDR2) sequences isolated from the immunized non-human mammal. These steps may also be performed using a plurality of diversified nucleic acid sequences encoding complementarity determining region 1 (CDR1) sequences isolated from the immunized non-human mammal.

In some embodiments, step (b) is performed by amplifying the CDR3 sequence from the immunized non-human mammal using oligonucleotide primers containing a Type IIs restriction site. In some embodiments, the oligonucleotide primer is designed to enhance compatibility between the mammalian CDR3 sequence and the Acceptor Framework encoding a human immunoglobulin variable domain. In some embodiments, the oligonucleotide primer is designed to modify the sequence at the boundaries of the mammalian CDR3 sequences to allow efficient ligation via compatible cohesive ends into the Acceptor Framework encoding a human immunoglobulin variable domain. In some embodiments the mammalian DNA sequences flanking the CDR3 regions might not upon cleavage by Type IIS restriction enzymes generate cohesive ends compatible with the cohesive ends of the digested Acceptor Frameworks. In such cases the oligonucleotides used for amplification are designed to modify the target mammalian sequence so that after cleavage with a Type IIS restriction enzyme, the cohesive ends are compatible and efficient ligation can occur. These steps can also be performed by amplifying the CDR2 sequence from the immunized non-human mammal using oligonucleotide primers containing a Type IIs restriction site. These steps can also be performed by amplifying the CDR1 sequence from the immunized non-human mammal using oligonucleotide primers containing a Type IIs restriction site.

In some embodiments, step (b) is performed by amplifying the CDR H3 sequence from the non-human mammal using oligonucleotide primers containing a FokI IIs restriction site. These steps can also be performed by amplifying the CDR2 sequence from the non-human mammal using oligonucleotide primers containing a FokI IIs restriction site. These steps can also be performed by amplifying the CDR1 sequence from the non-human mammal using oligonucleotide primers containing a FokI IIs restriction site.

In some embodiments, the Type IIs restriction enzyme recognition sites of step (a) and step (b) are recognized by a different Type IIs restriction enzyme. In some embodiments, the Type IIs restriction enzyme recognition sites are BsmBI recognition sites, BsaI recognition sites, FokI recognition sites or a combination thereof.

In some embodiments, the diversified nucleic acid sequences encoding CDR3 sequences encode heavy chain CDR3 (CDR H3) sequences. In some embodiments, the diversified nucleic acid sequences encoding CDR3 sequences encode light chain CDR3 (CDR L3) sequences. In some embodiments, the diversified nucleic acid sequences encoding CDR2 sequences encode heavy chain CDR2 (CDR H2) sequences. In some embodiments, the diversified nucleic acid sequences encoding CDR2 sequences encode light chain CDR2 (CDR L2) sequences. In some embodiments, the diversified nucleic acid sequences encoding CDR1 sequences encode heavy chain CDR1 (CDR H1) sequences. In some embodiments, the diversified nucleic acid sequences encoding CDR1 sequences encode light chain CDR1 (CDR L1) sequences.

In some embodiments, the Acceptor Framework nucleic acid sequence includes or is derived from at least a portion of a human heavy chain variable gene sequence selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51.

In some embodiments, the Acceptor Framework nucleic acid sequence includes or is derived from at least a portion of a human kappa light chain variable gene sequence. For example, the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3-15, and VK3-20. In some embodiments, the Acceptor Framework nucleic acid sequence includes or is derived from at least a portion of a human lambda light chain variable gene sequence. For example, the human lambda light chain variable gene sequence is selected from VL1-44 and VL1-51.

In some embodiments, the plurality of Acceptor Framework nucleic acid sequences comprises a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.

In some embodiments, the methods also include the steps of (e) cloning the library of nucleic acids encoding immunoglobulin variable domains of step (d) into an expression vector and (f) transforming the expression vector of step (e) into a host cell and culturing the host cell under conditions sufficient to express a plurality of immunoglobulin variable domain encoded by the library. In some embodiments, the host cell is E. coli. In some embodiments, the expression vector is a phagemid or phage vector.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1A is a schematic representation of a protein domain with a framework and loops providing contact residues with another protein or molecule. Several situations are depicted: A stable protein domain with properly folded loop regions; properly folded loops inserted into a domain of limited intrinsic stability; an intrinsically stable protein domain which stability is affected by the loop regions.

FIG. 1B is a schematic representation of different types of libraries of protein repertoires generated using different diversification strategies.

FIG. 2 is a schematic representation of an antibody variable Acceptor Framework. Framework regions, CDRs and type IIS-RM restriction site are indicated.

FIG. 3 is a schematic representation of a strategy used for capturing CDRH3 sequences from natural repertoires.

FIG. 4 is a schematic representation of the benefit of using primers containing Type IIS-RM restriction enzymes for the amplification and insertion of natural CDR regions into Acceptor Frameworks.

FIG. 5 is an illustration depicting the germline gene sequences of the variable heavy and light chain domain selected for the generation of Acceptor Frameworks.

FIG. 6 is a schematic representation of an amplification strategy used for the generation of Acceptor Frameworks by addition to the germline sequences of a stuffer fragment and a FR4 region.

FIG. 7, top panel, is an illustration depicting the sequence detail of Stuffer fragments of VH acceptor Framework. DNA sequences recognized and cleaved by the restriction enzyme BsmBI are boxed in red and black respectively and indicated in the lower panel of the figure. The reading frame corresponding to the antibody variable sequence is underlined.

FIG. 8 is an illustration depicting the sequences of the 20 Acceptor Frameworks.

FIG. 9 is a schematic representation of the pNDS1 vector alone or combined with a dummy heavy chain variable region or a dummy light variable region.

FIG. 10 is a table depicting the sequences of CDRH3 sequences that were retrieved from a human cDNA source and inserted into human Acceptor Frameworks.

FIG. 11 is a table representing the design of synthetic CDR sequences for VH, VK and Vλ. The positions are numbered according to the Kabat numbering scheme. The theoretical diversity of the CDR using a defined codon diversification strategy (NNS, DVK, NVT, DVT) is indicated. The strategies adopted for VH CDR synthesis are boxed.

FIG. 12 is a schematic representation and sequence detail of synthetic CDR insertion into an Acceptor Framework.

FIG. 13 is a schematic representation of Primary libraries and the chain recombination performed to generate Secondary libraries.

FIG. 14 is a schematic representation of the generation of Acceptor VH libraries combined with VL synthetic libraries and the capture of CDRH3 repertoires of human or non-human origin.

FIG. 15 is a schematic representation of the MnA, MiB and MiC library generation using the CDRH3 repertoire from naïve mice or mice immunized with hIFNγ or hCCL5/RANTES as a source of diversity. The size of the libraries is indicated in the top panels. The bottom panels show the distribution of CDRH3 lengths found in these libraries.

FIG. 16 is a series of graphs depicting phage output titration during selection against hIFNγ with the secondary libraries AD1 and AE1.

FIG. 17 is a series of graphs depicting phage output titration during selection against monoclonal antibody 5E3 with the secondary libraries AD1 and AE1.

FIG. 18 is a series of graphs depicting the frequency of CDR H3 lengths found in the AE1 and AD1 libraries and after three rounds of selection against the monoclonal antibody 5E3. The distribution of each CDR H3 length within the different VH families is indicated. However, when CDR H3 are longer than 16 amino acids, the 70 bp sequences delivered by the Illumina Sequencing platform do not cover enough framework sequence to unambiguously identify the VH1 family and therefore the VH family is indicated as undetermined.

FIG. 19 is a series of graphs depicting dose response ELISA using purified 6 scFv preparations against mouse 5E3 or an irrelevant mouse antibody 1A6. The seven clones encode different scFvs. Clone A6 is a scFv specific for hIFNγ and was used as a negative control.

FIG. 20 is a graph that depicts dose response ELISA using purified scFv preparations against hIFNγ and compared to a positive scFv specific for hIFNγ (A6).

FIG. 21 is a graph that depicts the inhibitory effect of purified scFv preparations in a luciferase reporter gene assay driven by hIFNγ. The neutralizing activity of two scFv candidates (AD1R4P1A9 and AE14R3P2E4) was compared to the activity of a positive control scFv (G9) and a negative control scFv (D11).

FIG. 22 is a graph that depicts the inhibitory effect of purified scFv preparations in a MHCII induction assay in response to hIFNγ. The neutralizing activity of two scFv candidates (AD1R4P1A9 and AE14R3P2E4) was compared to the activity of a negative control scFv (D11).

FIG. 23 is a series of graphs depicting the inhibitory effect of the two candidates AD1R4P1A9 and AE14R3P2E4 reformatted into IgG in a luciferase reporter gene assay driven by hIFNγ. The neutralizing activity of two IgGs was compared to the activity of an irrelevant IgG directed against human RANTES (NI-0701).

FIG. 24 is a series of graphs depicting a dose response ELISA using the IgG G11 and DA4 against mouse 5E3, chimeric rat 5E3 and the corresponding mouse and rat isotype antibodies.

FIG. 25 is a series of graphs depicting an ELISA for the detection of mouse 5E3 in different dilutions of mouse serum using the anti-idiotypic IgGs G11 and DA4 as capture antibodies.

FIG. 26 is a graph that depicts phage output/input ratios during selection against hIFNγ with the libraries MnA and MiB.

FIG. 27 is a graph depicting the hit rates obtained in a scFv ELISA screening with clones derived from the MnA, MiB and MiC libraries after each round of selection against hIFNγ. The threshold was set to half the signal obtained with the A6 control scFv.

FIG. 28 is a graph that represents the distribution frequency of scFv giving different levels of signal in binding experiments against hIFNγ obtained with clones derived from the MnA and MiB libraries.

FIG. 29 is a graph that depicts dose response ELISA using purified scFv preparations from clones derived from the MnA and MiB libraries against hIFNγ and compared to a positive scFv specific for hIFNγ (A6).

DETAILED DESCRIPTION OF THE INVENTION

Synthetic protein libraries and in particular synthetic antibody libraries are attractive as it is possible during the library generation process to select the building blocks composing these synthetic proteins and include desired characteristics. An important limitation, however, is that the randomization of portions of these synthetic proteins to generate a collection of variants often leads to non-functional proteins and thus can dramatically decrease the functional library size and its performance. Another limitation of synthetic diversity is that the library size needed to cover the theoretical diversity of randomized amino acid stretches cannot be covered because of practical limitations. Even with display systems such as ribosome display a diversity of 1013 to 1014 can be generated and sampled which can maximally cover the complete randomization of stretches of 9 amino acids. As the average size of natural CDR H3 (also referred to herein as the heavy chain CDR3 or VH CDR3) is above 9 and can be over 20 amino acids in length, synthetic diversity is not a practicable approach to generate such CDRs.

The combination of methods generally used for DNA handling and that are used in the course of the generation of a library of protein variants introduces errors in the DNA sequences. These errors can lead to alterations in the reading frame of the DNA that will no longer encode a functional polypeptide. Typically, antibody libraries generated using assembly of DNA fragments by PCR and/or restriction cloning contain between 15% and 45% sequences that are not in the correct reading frame for protein translation. These non-functional library members can compromise the efficiency of the antibody selection and identification process and are thus recognized as a limitation in the field. The methods described allow for a more robust introduction of diversity into an antibody library by using an alternative cloning strategy. Typically the frequency of in-frame sequences is approximately 90%. Another advantage of the invention is that it combines selected acceptor antibody variable frameworks with CDR loops that have a high probability of correct folding. It allows for the capture of long CDRs that are difficult to cover with synthetic randomization approaches. Furthermore the methods described do not employ any modification within the coding region of acceptor antibody variable for cloning of the diversified sequences. Another advantage of this method is that several sources of diversity can be captured into the same set of acceptor antibody frameworks. These sources include but are not limited to: natural antibody CDRs of human or other mammal origin, CDR from chicken antibodies, CDRs of antibody-like molecules such as VHH from camelids, IgNARs from sharks, variable loops from T cell receptors. In addition, natural CDRs can be derived from naïve or immunized animals. In the latter case, the CDRs retrieved are enriched in sequences that were involved in recognition of the antigen used for immunization.

A unique feature of the methods described herein is the efficient capture of heavy chain CDR3 coding sequences from non-human species and their insertion into human immunoglobulin frameworks. Using these methods, it is therefore possible to generate different antibody combining sites that are shaped by the captured CDRH3 repertoire from another species and allow for the sampling of a different tri dimensional space. These methods allow for the generation of human antibodies with novel specificities targeting a different range of target classes and epitopes than those accessible to a human CDRH3 repertoire. Furthermore, these novel antibodies encode human framework as well as CDR1 and CDR2 regions and thus are suitable for human therapy.

In this method selected protein domains, as exemplified by antibody variable domains, are modified by introducing a stuffer sequence that will serve as an integration site for diversified sequences. Upon integration, the stuffer fragment is removed in full, thus leaving intact the coding region of the acceptor protein and the inserted proteins fragments (i.e., the CDRs). This integration event is mediated by a the use of Type IIs restriction enzyme that recognizes a defined site in the DNA sequence but cleave the DNA at a defined distance from this site. This approach has two major advantages: (1) it allows for the digestion of acceptors framework without affecting their coding sequences (no need to engineer silent restrictions sites); and (2) it allows for the digestion and cloning of naturally diversified sequences that by definition do not possess compatible restriction sites.

As described above, prior attempts to generate libraries and/or displays of antibody sequences differ from the methods provided herein. For example, some methods require the grafting of each CDR, as described for example by U.S. Pat. No. 6,300,064, in which restriction enzyme sites are engineered at the boundary of each CDR, not just the CDR H3 region. In other methods, CDR sequences from natural sources are amplified and rearranged, as described in, e.g., U.S. Pat. No. 6,989,250. In some methods, such as those described in US Patent Application Publication No. 20060134098, sequences from a mouse (or other mammal) is added to a human framework, such that the resulting antibody has CDR1 and CDR2 regions of murine origin and a CDR3 region of human origin. Other methods, such as those described in US Patent Application Publication No. 20030232333, generate antibodies that have synthetic CDR1 and/or CDR1/CDR2 regions along with a natural CDR3 region. However, these methods fail to provide libraries that contain stable framework regions and correctly folded CDRs.

The methods provided herein design the antibody acceptor frameworks for diversity cloning. A strategy was designed to introduce diversity into the CDR3 of selected human antibody domains that avoids the modification of the sequence of the original framework. The strategy relies on the introduction outside of the immunoglobulin coding region of Type IIs restriction sites. This class of restriction enzymes recognizes asymmetric and uninterrupted sequence of 4-7 base pairs but cleave DNA at a defined distance of up to 20 bases independently of the DNA sequence found at the cleavage site. In order to take advantage of this system for cloning of diversified sequences into selected frameworks, acceptor frameworks containing a stuffer DNA fragment, instead of the CDR3, that includes two Type IIs restriction sites were designed. Similarly, diversified DNA sequences are generated with flanking sequences that include Type IIs. Provided that the cohesive ends generated by the restriction enzymes are compatible and that reading frame is maintained, the DNA fragments can be ligated into the acceptor framework and restore the encoded CDR3 in the new context of the acceptor antibody framework (FIG. 2).

The methods provided herein capture natural CDR diversity. The strategy that was developed to capture naturally diversified protein fragments as a source of diversity also takes advantage of Type IIs restriction enzymes. As an example, oligonucleotides primers specific for flanking regions of the DNA sequence encoding the CDR H3 of immunoglobulins, i.e., specific for the FR3 and FR4 of the variable region, were designed. These oligonucleotides contain at their 5′ end a site for a Type IIs restriction enzyme whereas their 3′ portion matches the targeted DNA sequence. The restriction enzyme site used is preferably an enzyme that cleaves DNA far away from the DNA recognition site such as FokI. This is a key element of the method as it allows for the efficient amplification of natural DNA sequences as it maintains a good match between the 3′ end of the primer and the DNA flanking the CDR H3 while allowing for excision of the CDRH3 coding sequence by DNA cleavage at the boundary between the CDR and framework regions (FIG. 3). This precise excision of the CDR coding sequence is very difficult using Type II enzymes that cleave DNA at their recognition site as the corresponding restriction site is not present in the natural DNA sequences and that introduction of such sites during amplification would be difficult due poor primer annealing. Thus this method allows for the amplification of diversified protein sequences and their insertion into any the acceptor antibody framework regardless of origin of amplified diversity (FIG. 4).

The methods described herein produce a library of nucleic acids, wherein each nucleic acid encodes an immunoglobulin variable domain by: (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FR1), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FR1 and FR2 regions are interspaced by a complementarity determining region 1 (CDR1), the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a stuffer nucleic acid sequence containing at least two Type IIs restriction enzyme recognition sites interspaced by a random nucleic acid sequence; (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 3 (CDR3) regions or encoding amino acid sequences that can fulfill the role of a CDR3 region, wherein each of the plurality of diversified nucleic acid sequences includes a Type IIs restriction enzyme recognition site at each extremity; (c) digesting each of the plurality of nucleic acid sequences encoding the CDR3 regions or amino acid sequences that can fulfill the role of a CDR3 region using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (b) and digesting the stuffer nucleic acid sequence of step (a) from the Acceptor Framework using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (a); and (d) ligating the digested nucleic acid sequences encoding the CDR3 regions or the amino acid sequences that can fulfill the role of a CDR3 region of step (c) into the digested Acceptor Framework of step (c) such that the FR3 and FR4 regions are interspaced by the nucleic acid sequences encoding the CDR3 region or the amino acid sequence that can fulfill the role of a CDR3 region and a complete immunoglobulin variable domain encoding sequences that do not contain the Type IIs restriction enzyme recognition sites of steps (a) and (b) are restored.

The methods provided herein produce a method for producing a library of nucleic acids, wherein each nucleic acid encodes an immunoglobulin variable domain by: (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FR1), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FR1 and FR2 regions are interspaced by a stuffer nucleic acid sequence containing at least two Type IIs restriction enzyme recognition sites interspaced by a random nucleic acid sequence, the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a complementarity determining region 3 (CDR3); (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 1 (CDR1) regions or encoding amino acid sequences that can fulfill the role of a CDR1 region, wherein each of the plurality of diversified nucleic acid sequences includes a Type IIs restriction enzyme recognition site at each extremity; (c) digesting each of the plurality of nucleic acid sequences encoding the CDR1 regions or amino acid sequences that can fulfill the role of a CDR1 region using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (b) and digesting the stuffer nucleic acid sequence of step (a) from the Acceptor Framework using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (a); and (d) ligating the digested nucleic acid sequences encoding the CDR1 regions or the amino acid sequences that can fulfill the role of a CDR1 region of step (c) into the digested Acceptor Framework of step (c) such that the FR1 and FR2 regions are interspaced by the nucleic acid sequences encoding the CDR1 region or the amino acid sequence that can fulfill the role of a CDR1 region and a complete immunoglobulin variable domain encoding sequences that do not contain the Type IIs restriction enzyme recognition sites of steps (a) and (b) are restored.

The methods provided herein produce a library of nucleic acids, wherein each nucleic acid encodes an immunoglobulin variable domain, by: (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FR1), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FR1 and FR2 regions are interspaced by a complementarity determining region 1 (CDR1), the FR2 and FR3 regions are interspaced by a stuffer nucleic acid sequence including at least two Type IIs restriction enzyme recognition sites interspaced by a random nucleic acid sequence, and the FR3 and FR4 regions are interspaced by a complementarity determining region 3 (CDR3); (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 2 (CDR2) regions or encoding amino acid sequences that can fulfill the role of a CDR2 region, wherein each of the plurality of diversified nucleic acid sequences includes a Type IIs restriction enzyme recognition site at each extremity; (c) digesting each of the plurality of nucleic acid sequences encoding the CDR2 regions or amino acid sequences that can fulfill the role of a CDR2 region using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (b) and digesting the stuffer nucleic acid sequence of step (a) from the Acceptor Framework using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (a); and (d) ligating the digested nucleic acid sequences encoding the CDR2 regions or the amino acid sequences that can fulfill the role of a CDR2 region of step (c) into the digested Acceptor Framework of step (c) such that the FR2 and FR3 regions are interspaced by the nucleic acid sequences encoding the CDR2 region or the amino acid sequence that can fulfill the role of a CDR2 region and a complete immunoglobulin variable domain encoding sequences that do not contain the Type IIs restriction enzyme recognition sites of steps (a) and (b) are restored.

In some embodiments, the Type IIs restriction enzyme recognition sites of step (a) and step (b) in the methods set forth above are recognized by a different Type IIs restriction enzyme. For example, in some embodiments, the Type IIs restriction enzyme recognition sites are BsmBI recognition sites, BsaI recognition sites, FokI recognition sites or a combination thereof.

In some embodiments, the Acceptor Framework nucleic acid sequence is derived from a human gene sequence. For example, in some embodiments, the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence. In some embodiments, the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51.

In some embodiments, the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence. For example, in some embodiments, the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3-15, and VK3-20.

In some embodiments, the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence. For example, in some embodiments, the human lambda light chain variable gene sequence is selected from VL1-44 and VL1-51.

In some embodiments, the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDR3 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.

In some embodiments, the plurality of diversified nucleic acids encodes CDR3 regions, and the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.

In some embodiments, the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR3 region, and the plurality of diversified nucleic acids includes synthetic sequences.

In some embodiments, the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDR1 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.

In some embodiments, the plurality of diversified nucleic acids encodes CDR1 regions, and the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.

In some embodiments, the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR1 region, and the plurality of diversified nucleic acids includes synthetic sequences.

In some embodiments, the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDR2 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.

In some embodiments, the plurality of diversified nucleic acids encodes CDR2 regions, and the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.

In some embodiments, the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR2 region, and the plurality of diversified nucleic acids includes synthetic sequences.

In some embodiments, the plurality of Acceptor Framework nucleic acid sequences includes a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.

In some embodiments, the methods provided herein further include the steps of (e) cloning the library of nucleic acids encoding immunoglobulin variable domains of step (d) into an expression vector and (f) transforming the expression vector of step (e) into a host cell and culturing the host cell under conditions sufficient to express a plurality of immunoglobulin variable domain encoded by the library.

In some embodiments, the host cell is E. coli. In some embodiments, the expression vector is a phagemid vector.

The methods provided herein generate or otherwise produce a target-specific antibody, antibody variable region or a portion thereof, by: (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FR1), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FR1 and FR2 regions are interspaced by a complementarity determining region 1 (CDR1), the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a stuffer nucleic acid sequence having at least two Type IIs restriction enzyme recognition sites interspaced by a random nucleic acid sequence; (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 3 (CDR3) regions or encoding amino acid sequences that can fulfill the role of a CDR3 region, wherein each of the plurality of diversified nucleic acid sequences includes a Type IIs restriction enzyme recognition site at each extremity; (c) digesting each of the plurality of nucleic acid sequences encoding the CDR3 regions or amino acid sequences that can fulfill the role of a CDR3 region using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (b) and digesting the stuffer nucleic acid sequence of step (a) from the Acceptor Framework using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (a); (d) ligating the digested nucleic acid sequences encoding the CDR3 regions or the amino acid sequences that can fulfill the role of a CDR3 region of step (c) into the digested Acceptor Framework of step (c) such that the FR3 and FR4 regions are interspaced by the nucleic acid sequences encoding the CDR3 region or the amino acid sequence that can fulfill the role of a CDR3 region and complete immunoglobulin variable domain encoding sequences that do not contain the Type IIs restriction enzyme recognition sites of steps (a) and (b) are restored; (e) cloning the library of nucleic acids encoding immunoglobulin variable domains of step (d) into an expression vector; (f) transforming the expression vector of step (e) into a host cell and culturing the host cell under conditions sufficient to express a plurality of immunoglobulin variable domains encoded by the library; (g) contacting the plurality of immunoglobulin domains of step (f) with a target antigen; and (h) determining which expressed immunoglobulin variable domain encoding sequences bind to the target antigen.

The methods provided herein generate or otherwise produce a target-specific antibody, antibody variable region or a portion thereof, by: (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FR1), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FR1 and FR2 regions are interspaced by a stuffer nucleic acid sequence including at least two Type IIs restriction enzyme recognition sites interspaced by a random nucleic acid sequence, the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a complementarity determining region 3 (CDR3); (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 1 (CDR1) regions or encoding amino acid sequences that can fulfill the role of a CDR1 region, wherein each of the plurality of diversified nucleic acid sequences includes a Type IIs restriction enzyme recognition site at each extremity; (c) digesting each of the plurality of nucleic acid sequences encoding the CDR1 regions or amino acid sequences that can fulfill the role of a CDR1 region using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (b) and digesting the stuffer nucleic acid sequence of step (a) from the Acceptor Framework using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (a); (d) ligating the digested nucleic acid sequences encoding the CDR1 regions or the amino acid sequences that can fulfill the role of a CDR1 region of step (c) into the digested Acceptor Framework of step (c) such that the FR1 and FR2 regions are interspaced by the nucleic acid sequences encoding the CDR1 region or the amino acid sequence that can fulfill the role of a CDR1 region and complete immunoglobulin variable domain encoding sequences that do not contain the Type IIs restriction enzyme recognition sites of steps (a) and (b) are restored; (e) cloning the library of nucleic acids encoding immunoglobulin variable domains of step (d) into an expression vector; (f) transforming the expression vector of step (e) into a host cell and culturing the host cell under conditions sufficient to express a plurality of immunoglobulin variable domains encoded by the library; (g) contacting the plurality of immunoglobulin domains of step (f) with a target antigen; and (g) determining which expressed immunoglobulin variable domain encoding sequences bind to the target antigen.

The methods provided herein generate or otherwise produce a target-specific antibody, antibody variable region or a portion thereof, by: (a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence including a first framework region (FR1), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FR1 and FR2 regions are interspaced by a complementarity determining region 1 (CDR1), the FR2 and FR3 regions are interspaced by a stuffer nucleic acid sequence including at least two Type IIs restriction enzyme recognition sites interspaced by a random nucleic acid sequence, and the FR3 and FR4 regions are interspaced by a complementarity determining region 3 (CDR3); (b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 2 (CDR2) regions or encoding amino acid sequences that can fulfill the role of a CDR2 region, wherein each of the plurality of diversified nucleic acid sequences includes a Type IIs restriction enzyme recognition site at each extremity; (c) digesting each of the plurality of nucleic acid sequences encoding the CDR2 regions or amino acid sequences that can fulfill the role of a CDR2 region using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (b) and digesting the stuffer nucleic acid sequence of step (a) from the Acceptor Framework using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (a); (d) ligating the digested nucleic acid sequences encoding the CDR2 regions or the amino acid sequences that can fulfill the role of a CDR2 region of step (c) into the digested Acceptor Framework of step (c) such that the FR2 and FR3 regions are interspaced by the nucleic acid sequences encoding the CDR2 region or the amino acid sequence that can fulfill the role of a CDR2 region and complete immunoglobulin variable domain encoding sequences that do not contain the Type IIs restriction enzyme recognition sites of steps (a) and (b) are restored; (e) cloning the library of nucleic acids encoding immunoglobulin variable domains of step (d) into an expression vector; (f) transforming the expression vector of step (e) into a host cell and culturing the host cell under conditions sufficient to express a plurality of immunoglobulin variable domains encoded by the library; (g) contacting the plurality of immunoglobulin variable domains of step (f) with a target antigen; and (h) determining which expressed immunoglobulin variable domain encoding sequences bind to the target antigen.

In some embodiments, the methods provided herein further include the step of (i) sequencing the immunoglobulin variable domain encoding sequences that bind the target antigen.

In some embodiments, the Type IIs restriction enzyme recognition sites of step (a) and step (b) are recognized by a different Type IIs restriction enzyme.

In some embodiments, the Type IIs restriction enzyme recognition sites are BsmBI recognition sites, BsaI recognition sites, FokI recognition sites or a combination thereof.

In some embodiments, the Acceptor Framework nucleic acid sequence is derived from a human gene sequence. For example, in some embodiments, the human sequence is a human heavy chain variable gene sequence or a sequence derived from a human heavy chain variable gene sequence. For example, in some embodiments, the human heavy chain variable gene sequence is selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51.

In some embodiments, the human sequence is a human kappa light chain variable gene sequence or a sequence derived from a human kappa light chain variable gene sequence. For example, in some embodiments, the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3-15, and VK3-20.

In some embodiments, the human sequence is a human lambda light chain variable gene sequence or a sequence derived from a human lambda light chain variable gene sequence. For example, in some embodiments, the human lambda light chain variable gene sequence is selected from VL1-44 and VL1-51.

In some embodiments, the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDR3 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.

In some embodiments, the plurality of diversified nucleic acids encodes CDR3 regions, and the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.

In some embodiments, the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR3 region, and the plurality of diversified nucleic acids includes synthetic sequences.

In some embodiments, the plurality of diversified nucleic acids includes or is derived from sequences selected from naturally occurring CDR1 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.

In some embodiments, the plurality of diversified nucleic acids encodes CDR1 regions, and the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.

In some embodiments, the plurality of diversified nucleic acids encodes amino acid sequences that can fulfill the role of a CDR1 region, and the plurality of diversified nucleic acids includes synthetic sequences.

In some embodiments, the plurality of diversified nucleic acids included or is derived from sequences selected from naturally occurring CDR2 sequences, naturally occurring Ig sequences from humans, naturally occurring Ig sequences from a mammal, naturally occurring sequences from a loop region of a T cell receptor in a mammal, and other naturally diversified polypeptide collections.

In some embodiments, the plurality of diversified nucleic acids encodes CDR2 regions, and the plurality of diversified nucleic acids includes or is derived from immunoglobulin sequences that occur naturally in humans that have been exposed to a particular immunogen or sequences derived from animals that have been identified as having been exposed to a particular antigen.

In some embodiments, the plurality of Acceptor Framework nucleic acid sequences includes a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.

In some embodiments, the expression vector is a phagemid vector. In some embodiments, the host cell is E. coli.

Unless otherwise defined, scientific and technical terms used in connection with the present invention shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Generally, nomenclatures utilized in connection with, and techniques of, cell and tissue culture, molecular biology, and protein and oligo- or polynucleotide chemistry and hybridization described herein are those well known and commonly used in the art. Standard techniques are used for recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation (e.g., electroporation, lipofection). Enzymatic reactions and purification techniques are performed according to manufacturer's specifications or as commonly accomplished in the art or as described herein. The foregoing techniques and procedures are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. See e.g., Sambrook et al. Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)). The nomenclatures utilized in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques are used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.

As utilized in accordance with the present disclosure, the following terms, unless otherwise indicated, shall be understood to have the following meanings:

As used herein, the term “antibody” refers to immunoglobulin molecules and immunologically active portions of immunoglobulin (Ig) molecules, i.e., molecules that contain an antigen binding site that specifically binds (immunoreacts with) an antigen. By “specifically bind” or “immunoreacts with” or “immunospecifically bind” is meant that the antibody reacts with one or more antigenic determinants of the desired antigen and does not react with other polypeptides or binds at much lower affinity (Kd>10−6). Antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, dAb (domain antibody), single chain, Fab, Fab′ and F(ab′)2 fragments, scFvs, and an Fab expression library.

The basic antibody structural unit is known to comprise a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one “light” (about 25 kDa) and one “heavy” chain (about 50-70 kDa). The amino-terminal portion of each chain includes a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The carboxy-terminal portion of each chain defines a constant region primarily responsible for effector function. In general, antibody molecules obtained from humans relate to any of the classes IgG, IgM, IgA, IgE and IgD, which differ from one another by the nature of the heavy chain present in the molecule. Certain classes have subclasses as well, such as IgG1, IgG2, and others. Furthermore, in humans, the light chain may be a kappa chain or a lambda chain.

The term “monoclonal antibody” (MAb) or “monoclonal antibody composition”, as used herein, refers to a population of antibody molecules that contain only one molecular species of antibody molecule consisting of a unique light chain gene product and a unique heavy chain gene product. In particular, the complementarity determining regions (CDRs) of the monoclonal antibody are identical in all the molecules of the population. MAbs contain an antigen binding site capable of immunoreacting with a particular epitope of the antigen characterized by a unique binding affinity for it.

The term “antigen-binding site,” or “binding portion” refers to the part of the immunoglobulin molecule that participates in antigen binding. The antigen binding site is formed by amino acid residues of the N-terminal variable (“V”) regions of the heavy (“H”) and light (“L”) chains. Three highly divergent stretches within the V regions of the heavy and light chains, referred to as “hypervariable regions,” are interposed between more conserved flanking stretches known as “framework regions,” or “FRs”. Thus, the term “FR” refers to amino acid sequences which are naturally found between, and adjacent to, hypervariable regions in immunoglobulins. In an antibody molecule, the three hypervariable regions of a light chain and the three hypervariable regions of a heavy chain are disposed relative to each other in three dimensional space to form an antigen-binding surface. The antigen-binding surface is complementary to the three-dimensional surface of a bound antigen, and the three hypervariable regions of each of the heavy and light chains are referred to as “complementarity-determining regions,” or “CDRs.” The assignment of amino acids to each domain is in accordance with the definitions of Kabat Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987 and 1991)), or Chothia & Lesk J. Mol. Biol. 196:901-917 (1987), Chothia et al. Nature 342:878-883 (1989).

As used herein, the term “epitope” includes any protein determinant capable of specific binding to an immunoglobulin, an scFv, or a T-cell receptor. The term “epitope” includes any protein determinant capable of specific binding to an immunoglobulin or T-cell receptor. Epitopic determinants usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics. For example, antibodies may be raised against N-terminal or C-terminal peptides of a polypeptide. An antibody is said to specifically bind an antigen when the dissociation constant is ≦1 μM; e.g., ≦100 nM, preferably ≦10 nM and more preferably ≦1 nM.

As used herein, the terms “immunological binding,” and “immunological binding properties” refer to the non-covalent interactions of the type which occur between an immunoglobulin molecule and an antigen for which the immunoglobulin is specific. The strength, or affinity of immunological binding interactions can be expressed in terms of the dissociation constant (Kd) of the interaction, wherein a smaller Kd represents a greater affinity. Immunological binding properties of selected polypeptides can be quantified using methods well known in the art. One such method entails measuring the rates of antigen-binding site/antigen complex formation and dissociation, wherein those rates depend on the concentrations of the complex partners, the affinity of the interaction, and geometric parameters that equally influence the rate in both directions. Thus, both the “on rate constant” (Kon) and the “off rate constant” (Koff) can be determined by calculation of the concentrations and the actual rates of association and dissociation. (See Nature 361:186-87 (1993)). The ratio of Koff/Kon enables the cancellation of all parameters not related to affinity, and is equal to the dissociation constant Kd. (See, generally, Davies et al. (1990) Annual Rev Biochem 59:439-473). An antibody of the present invention is said to specifically bind to its target, when the equilibrium binding constant (Kd) is ≦1 μM, e.g., ≦100 nM, preferably ≦10 nM, and more preferably 1 nM, as measured by assays such as radioligand binding assays or similar assays known to those skilled in the art.

The term “isolated polynucleotide” as used herein shall mean a polynucleotide of genomic, cDNA, or synthetic origin or some combination thereof, which by virtue of its origin the “isolated polynucleotide” (1) is not associated with all or a portion of a polynucleotide in which the “isolated polynucleotide” is found in nature, (2) is operably linked to a polynucleotide which it is not linked to in nature, or (3) does not occur in nature as part of a larger sequence. Polynucleotides in accordance with the invention include the nucleic acid molecules encoding the heavy chain immunoglobulin molecules, and nucleic acid molecules encoding the light chain immunoglobulin molecules described herein.

The term “isolated protein” referred to herein means a protein of cDNA, recombinant RNA, or synthetic origin or some combination thereof, which by virtue of its origin, or source of derivation, the “isolated protein” (1) is not associated with proteins found in nature, (2) is free of other proteins from the same source, e.g., free of marine proteins, (3) is expressed by a cell from a different species, or (4) does not occur in nature.

The term “polypeptide” is used herein as a generic term to refer to native protein, fragments, or analogs of a polypeptide sequence. Hence, native protein fragments, and analogs are species of the polypeptide genus. Polypeptides in accordance with the invention comprise the heavy chain immunoglobulin molecules, and the light chain immunoglobulin molecules described herein, as well as antibody molecules formed by combinations comprising the heavy chain immunoglobulin molecules with light chain immunoglobulin molecules, such as kappa light chain immunoglobulin molecules, and vice versa, as well as fragments and analogs thereof.

The term “naturally-occurring” as used herein as applied to an object refers to the fact that an object can be found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory or otherwise is naturally-occurring.

The term “operably linked” as used herein refers to positions of components so described are in a relationship permitting them to function in their intended manner. A control sequence “operably linked” to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.

The term “control sequence” as used herein refers to polynucleotide sequences which are necessary to effect the expression and processing of coding sequences to which they are ligated. The nature of such control sequences differs depending upon the host organism in prokaryotes, such control sequences generally include promoter, ribosomal binding site, and transcription termination sequence in eukaryotes, generally, such control sequences include promoters and transcription termination sequence. The term “control sequences” is intended to include, at a minimum, all components whose presence is essential for expression and processing, and can also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences. The term “polynucleotide” as referred to herein means a polymeric boron of nucleotides of at least 10 bases in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide. The term includes single and double stranded forms of DNA.

As used herein, the twenty conventional amino acids and their abbreviations follow conventional usage. See Immunology—A Synthesis (2nd Edition, E. S. Golub and D. R. Gren, Eds., Sinauer Associates, Sunderland Mass. (1991)). Stereoisomers (e.g., D-amino acids) of the twenty conventional amino acids, unnatural amino acids such as α-, α-disubstituted amino acids, N-alkyl amino acids, lactic acid, and other unconventional amino acids may also be suitable components for polypeptides of the present invention. Examples of unconventional amino acids include: 4 hydroxyproline, γ-carboxyglutamate, ε-N,N,N-trimethyllysine, ε-N-acetyllysine, O-phosphoserine, N-acetylserine, N-formylmethionine, 3-methylhistidine, 5-hydroxylysine, σ-N-methylarginine, and other similar amino acids and imino acids (e.g., 4-hydroxyproline). In the polypeptide notation used herein, the left-hand direction is the amino terminal direction and the right-hand direction is the carboxy-terminal direction, in accordance with standard usage and convention.

As applied to polypeptides, the term “substantial identity” means that two peptide sequences, when optimally aligned, such as by the programs GAP or BESTFIT using default gap weights, share at least 80 percent sequence identity, preferably at least 90 percent sequence identity, more preferably at least 95 percent sequence identity, and most preferably at least 99 percent sequence identity.

Preferably, residue positions which are not identical differ by conservative amino acid substitutions.

Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine valine, glutamic-aspartic, and asparagine-glutamine.

As discussed herein, minor variations in the amino acid sequences of antibodies or immunoglobulin molecules are contemplated as being encompassed by the present invention, providing that the variations in the amino acid sequence maintain at least 75%, more preferably at least 80%, 90%, 95%, and most preferably 99%. In particular, conservative amino acid replacements are contemplated. Conservative replacements are those that take place within a family of amino acids that are related in their side chains. Genetically encoded amino acids are generally divided into families: (1) acidic amino acids are aspartate, glutamate; (2) basic amino acids are lysine, arginine, histidine; (3) non-polar amino acids are alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan, and (4) uncharged polar amino acids are glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. The hydrophilic amino acids include arginine, asparagine, aspartate, glutamine, glutamate, histidine, lysine, serine, and threonine. The hydrophobic amino acids include alanine, cysteine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, tyrosine and valine. Other families of amino acids include (i) serine and threonine, which are the aliphatic-hydroxy family; (ii) asparagine and glutamine, which are the amide containing family; (iii) alanine, valine, leucine and isoleucine, which are the aliphatic family; and (iv) phenylalanine, tryptophan, and tyrosine, which are the aromatic family. For example, it is reasonable to expect that an isolated replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar replacement of an amino acid with a structurally related amino acid will not have a major effect on the binding or properties of the resulting molecule, especially if the replacement does not involve an amino acid within a framework site. Whether an amino acid change results in a functional peptide can readily be determined by assaying the specific activity of the polypeptide derivative. Assays are described in detail herein. Fragments or analogs of antibodies or immunoglobulin molecules can be readily prepared by those of ordinary skill in the art. Preferred amino- and carboxy-termini of fragments or analogs occur near boundaries of functional domains. Structural and functional domains can be identified by comparison of the nucleotide and/or amino acid sequence data to public or proprietary sequence databases. Preferably, computerized comparison methods are used to identify sequence motifs or predicted protein conformation domains that occur in other proteins of known structure and/or function. Methods to identify protein sequences that fold into a known three-dimensional structure are known. Bowie et al. Science 253:164 (1991). Thus, the foregoing examples demonstrate that those of skill in the art can recognize sequence motifs and structural conformations that may be used to define structural and functional domains in accordance with the invention.

Preferred amino acid substitutions are those which: (1) reduce susceptibility to proteolysis, (2) reduce susceptibility to oxidation, (3) alter binding affinity for forming protein complexes, (4) alter binding affinities, and (4) confer or modify other physicochemical or functional properties of such analogs. Analogs can include various muteins of a sequence other than the naturally-occurring peptide sequence. For example, single or multiple amino acid substitutions (preferably conservative amino acid substitutions) may be made in the naturally-occurring sequence (preferably in the portion of the polypeptide outside the domain(s) forming intermolecular contacts. A conservative amino acid substitution should not substantially change the structural characteristics of the parent sequence (e.g., a replacement amino acid should not tend to break a helix that occurs in the parent sequence, or disrupt other types of secondary structure that characterizes the parent sequence). Examples of art-recognized polypeptide secondary and tertiary structures are described in Proteins, Structures and Molecular Principles (Creighton, Ed., W. H. Freeman and Company, New York (1984)); Introduction to Protein Structure (C. Branden and J. Tooze, eds., Garland Publishing, New York, N.Y. (1991)); and Thornton et at. Nature 354:105 (1991).

As used herein, the terms “label” or “labeled” refers to incorporation of a detectable marker, e.g., by incorporation of a radiolabeled amino acid or attachment to a polypeptide of biotinyl moieties that can be detected by marked avidin (e.g., streptavidin containing a fluorescent marker or enzymatic activity that can be detected by optical or calorimetric methods). In certain situations, the label or marker can also be therapeutic. Various methods of labeling polypeptides and glycoproteins are known in the art and may be used. Examples of labels for polypeptides include, but are not limited to, the following: radioisotopes or radionuclides (e.g., 3H, 14C, 15N, 35S, 90Y, 99Tc, 111In, 125I, 131I) fluorescent labels (e.g., FITC, rhodamine, lanthanide phosphors), enzymatic labels (e.g., horseradish peroxidase, p-galactosidase, luciferase, alkaline phosphatase), chemiluminescent, biotinyl groups, predetermined polypeptide epitopes recognized by a secondary reporter (e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags). In some embodiments, labels are attached by spacer arms of various lengths to reduce potential steric hindrance. The term “pharmaceutical agent or drug” as used herein refers to a chemical compound or composition capable of inducing a desired therapeutic effect when properly administered to a patient.

Other chemistry terms herein are used according to conventional usage in the art, as exemplified by The McGraw-Hill Dictionary of Chemical Terms (Parker, S., Ed., McGraw-Hill, San Francisco (1985)).

As used herein, “substantially pure” means an object species is the predominant species present (i.e., on a molar basis it is more abundant than any other individual species in the composition), and preferably a substantially purified fraction is a composition wherein the object species comprises at least about 50 percent (on a molar basis) of all macromolecular species present.

Generally, a substantially pure composition will comprise more than about 80 percent of all macromolecular species present in the composition, more preferably more than about 85%, 90%, 95%, and 99%. Most preferably, the object species is purified to essential homogeneity (contaminant species cannot be detected in the composition by conventional detection methods) wherein the composition consists essentially of a single macromolecular species.

The term patient includes human and veterinary subjects.

Antibodies are purified by well-known techniques, such as affinity chromatography using protein A or protein G, which provide primarily the IgG fraction of immune serum. Subsequently, or alternatively, the specific antigen which is the target of the immunoglobulin sought, or an epitope thereof, may be immobilized on a column to purify the immune specific antibody by immunoaffinity chromatography. Purification of immunoglobulins is discussed, for example, by D. Wilkinson (The Scientist, published by The Scientist, Inc., Philadelphia Pa., Vol. 14, No. 8 (Apr. 17, 2000), pp. 25-28).

The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.

EXAMPLES

Example 1

Cloning of Immunoglobulin Variable Germline Genes

Seven human heavy chain variable germline genes (VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, VH5-51), five human kappa light chain variable germline genes (VK1-33, VK1-39, VK3-11, VK3-15, VK3-20) and two human lambda light chain variable germline genes (VL1-44, VL1-51) were selected to construct the libraries (Lefranc, M.-P. et al., 1999 Nucleic Acids Research, 27, 209-212). These genes were selected because they are often used in human expressed antibody repertoires and the frameworks they encode show favorable stability and expression profiles as individual domains or in the context of a VH/VL pair (Ewert S et al., J Mol Biol. 2003 Jan. 17; 325(3):531-53). Two sets of specific primers were used to amplify these genes from human genomic DNA by nested PCR. This approach was necessary as the 5′ sequences of germline genes of the same family are identical or very similar. For each gene, a first pair of primers, called genomic locators, was designed to be specific to the 5′ and 3′ untranslated regions flanking the germline gene. The second pair was designed to be specific for the beginning of the framework 1 region (FR1) and the end of the FR2. The 14 independent PCR products were cloned into pGEMT-easy (Promega, Madison Wis.) and their identity and integrity were verified by sequencing. The amino acid sequence of the selected germline genes is shown in FIG. 5.

The primers and primer combination used are indicated below.

Genomic locators
5 K1-33 TGTTTCTAATCGCAGGTGCCAGATG (SEQ ID NO: 120)
3 K1-33 ATTTATGTTATGACTTGTTACACTG (SEQ ID NO: 121)
5 K1-39 TATTTGTTTTTATGTTTCCAATCTC (SEQ ID NO: 122)
3 K1-39 CCTTGGAGGTTTATGTTATGACTTG (SEQ ID NO: 123)
5 K3-11 TTATTTCCAATTTCAGATACCACCG (SEQ ID NO: 124)
3 K3-11 TTGTTGGGGTTTTTGTTTCATGTGG (SEQ ID NO: 125)
5 K3-15 TATTTCCAATTTCAGATACCACTGG (SEQ ID NO: 126)
3 K3-15 ATGTTGAATCACTGTGGGAGGCCAG (SEQ ID NO: 127)
5 K3-20 TTATTTCCAATCTCAGATACCACCG (SEQ ID NO: 128)
3 K3-20 TTTTGTTTCAAGCTGAATCACTGTG (SEQ ID NO: 129)
5 L1-44 ATGTCTGTGTCTCTCTCACTTCCAG (SEQ ID NO: 130)
3 L1-44 TTCCCCATTGGCCTGGAGCACTGTG (SEQ ID NO: 131)
5 L1-51 GTGTCTGTGTCTCTCCTGCTTCCAG (SEQ ID NO: 132)
3 L1-51 CTTGTCTCAGTTCCCCATTGGGCTG (SEQ ID NO: 133)
5 H1-2  ATCTCATCCACTTCTGTGTTCTCTC (SEQ ID NO: 134)
3 H1-2 TTGGGTTTCTGACACCCTCAGGATG (SEQ ID NO: 135)
5 H1-18 CAGGCCAGTCATGTGAGACTTCACC (SEQ ID NO: 136)
3 H1-18 CTGCCTCCTCCCTGGGGTTTCTGAA (SEQ ID NO: 137)
5 H1-69 CCCCTGTGTCCTCTCCACAGGTGTC (SEQ ID NO: 138)
3 H1-69 CCGGCACAGCTGCCTTCTCCCTCAG (SEQ ID NO: 139)
5 DP-47 GAGGTGCAGCTGTTGGAG (SEQ ID NO: 140)
5 H3-23 TCTGACCAGGGTTTCTTTTTGTTTGC (SEQ ID NO: 141)
3 H3-23 TTGTGTCTGGGCTCACAATGACTTC (SEQ ID NO: 142)
5 H3-30 TGGCATTTTCTGATAACGGTGTCC (SEQ ID NO: 143)
3 H3-30 CTGCAGGGAGGTTTGTGTCTGGGCG (SEQ ID NO: 144)
5 H3-48 ATATGTGTGGCAGTTTCTGACCTTG (SEQ ID NO: 145)
3 H3-48 GGTTTGTGTCTGGTGTCACACTGAC (SEQ ID NO: 146)
5 H5-a GAGTCTGTGCCGGAAGTGCAGCTGG (SEQ ID NO: 147)
Specific for coding sequence
5 VH1 TATCAGGTGCAGCTGGTGCAG (SEQ ID NO: 148)
5 VH3 TATCAGGTGCAGCTGGTGGAG (SEQ ID NO: 149)
5 VH5 TATGAGGTGCAGCTGGTGCAG (SEQ ID NO: 150)
3 VH1/3 ATATCTCTCGCACAGTAATACAC (SEQ ID NO: 151)
3 VH3 ATATCTCTCGCACAGTAATATAC (SEQ ID NO: 152)
3 VH5 ATATGTCTCGCACAGTAATACAT (SEQ ID NO: 153)
5 VK1 TATGACATCCAGATGACCCAGTCT (SEQ ID NO: 154)
CCATCCTC
3 DPK9 ATAGGAGGGGTACTGTAACT (SEQ ID NO: 155)
3 DPK1 ATAGGAGGGAGATTATCATA (SEQ ID NO: 156)
5 DPK TATGAAATTGTGTTGACGCAGTCT (SEQ ID NO: 157)
22_L6
3 DPK22 ATAGGAGGTGAGCTACCATACTG (SEQ ID NO: 158)
5 DPK21 TATGAAATAGTGATGACGCAGTCT (SEQ ID NO: 159)
3 DPK21 ATAGGAGGCCAGTTATTATACTG (SEQ ID NO: 160)
3 L6 CAGCGTAGCAACTGGCCTCCTAT (SEQ ID NO: 161)
5 DPL2 TACAGTCTGTGCTGACTCAG (SEQ ID NO: 162)
3 DPL2 ATAGGACCATTCAGGCTGTCATC (SEQ ID NO: 163)
5 DPL5 TATCAGTCTGTGTTGACGCAG (SEQ ID NO: 164)
3 DPL5 ATAGGAGCACTCAGGCTGCTAT (SEQ ID NO: 165)

Primer Combinations Used to Amplify Selected Germline Genes.

1st PCR 2nd PCR
Family germline 5′ 3′ 5′ 3′
VH1 DP-8/75 HV 1-2 5 H1-2 3 H1-2 5 VH1 3 VH1/3
DP-10 HV 1-69 5 H1-69 3 H1-69 5 VH1 3 VH1/3
DP-14 HV 1-18 5 H1-18 3 H1-18 5 VH1 3 VH1/3
VH3 DP-49 HV 3-30 5 H3-30 3 H3-30 5 VH5 3 VH1/3
DP-51 HV 3-48 5 H3-48 3 H3-48 5 VH5 3 VH1/3
DP-47 HV 3-23 5 H3-23 3 H3-23 5 VH5 3 VH3
VH5 HV 5a 5 H5a 3 VH5 5 VH5 3 VH5
VKI DPK-1 KV 1-33 5 K 1-33 3 K 1-33 5 VK1 3 DPK-1
DPK-9 KV 1-39 5 K 1-39 3 K 1-39 5 VK1 3 DPK-9
VKIII L6 KV 3-11 5 K3-11 3 K3-11 5 DPK22_L6 3 L6
DPK-21 KV 3-15 5 K3-15 3 K3-15 5 DPK21 3 DPK21
DPK-22 KV 3-20 5 K3-20 3 K3-20 5 DPK22_L6 3 DPK22
VL1 DPL-2 LV 1-44 5 L1-44 3 L1-44 5 DPL2 3 DPL2
DPL-5 LV 1-51 5 L1-51 3 L1-51 5 DPL5 3 DPL5

Example 2

Generation of Acceptor Frameworks

The sequences of the selected germline genes were analyzed for the presence of Type IIs restriction sites. No BsmBI site was present in the selected antibody variable germline genes. Two BsmBI sites were found in the backbone of pNDS1, the phagemid vector in which the Acceptor Framework would be cloned. These two sites were removed by site-directed mutagenesis so that unique BsmBI sites could be introduced into the stuffer DNA sequences of the Acceptor Frameworks. Each germline gene was amplified by multiple nested PCR in order to add a stuffer DNA sequence at the 3′ end of the FR3 sequence followed by a sequence encoding FR4 which is specific for each corresponding variable segment (VH, Vk, Vλ). The amino acid sequence of VH FR4 corresponds to the FR4 region encoded by the germline J genes JH1, JH3, JH4 and JH5. The amino acid sequence of VK FR4 corresponds to the FR4 region encoded by the germline J genes JK1. The amino acid sequence of Vλ FR4 corresponds to the FR4 region encoded by the germline J genes JL2 and JL3. Two variants of the Vk FR4 sequence were generated with a single amino acid substitution at position 106 (Arginine or Glycine). For the Acceptor Framework based on the germline gene VH3-23, two variants were also constructed differing by a single amino acid (Lysine to Arginine) at position 94, the last residue of FR3. During the final amplification step SfiI/NcoI and XhoI sites were introduced at the 5′ and 3′ end of the VH, respectively.

Similarly, SalI and NotI sites were introduced at the 5′ and 3′ end of the VL, respectively (FIG. 6). The stuffer fragment was designed so that the translation reading frame was shifted thus preventing the expression of any functional protein from the Acceptor Frameworks (FIG. 7). The primers used in this process are listed below.

VH
5 VH1 CAGCCGGCCATGGCCCAGGTGCAGCTGGTGCAG (SEQ ID NO: 166)
5 VH3-30 CAGCCGGCCATGGCCCAGGTGCAGCTGGTGGAG (SEQ ID NO: 167)
5 VH3-23 CAGCCGGCCATGGCCGAGGTGCAGCTGTTGGAG (SEQ ID NO: 168)
5 VH3-48 CAGCCGGCCATGGCCGAGGTGCAGCTGGTGGAGTCTGGGGGAG (SEQ ID NO: 169)
5 VH5-51 CAGCCGGCCATGGCCGAGGTGCAGCTGGTGCAG (SEQ ID NO: 170)
3 VH1/3 CTTACCGTTATTCGTCTCATCTCGCACAGTAATACAC (SEQ ID NO: 171)
3 VH3-23 CTTACCGTTATTCGTCTCATTTCGCACAGTAATATAC (SEQ ID NO: 172)
3 VH3-48 CTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTG (SEQ ID NO: 173)
3 VH5-51 CTTACCGTTATTCGTCTCATCTCGCACAGTAATACAT (SEQ ID NO: 174)
3 VHext1 CAATACGCGTTTAAACCTGGTAAACCGCCTTACCGTTATTCGTCTCA (SEQ ID NO: 175)
3 VHext2 GTTCCCTGGCCCCAAGAGACGCGCCTTCCCAATACGCGTTTAAACCTG (SEQ ID NO: 176)
3 VHext3 CCTCCACCGCTCGAGACTGTGACCAGGGTTCCCTGGCCCCAAGAG (SEQ ID NO: 177)
VK
5 VK1 CGGGTCGACGGACATCCAGATGACCCAGTC (SEQ ID NO: 178)
5 VK3-11 CGGGTCGACGGAAATTGTGTTGACACAGTCTCCAGC (SEQ ID NO: 179)
5 VK3-15 CGGGTCGACGGAAATAGTGATGACGCAGTCTCCAGC (SEQ ID NO: 180)
5 VK3-20 CGGGTCGACGGAAATTGTGTTGACGCAGTCTCCAGG (SEQ ID NO: 181)
3 VK1-33 CCTTACCGTTATTCGTCTCGCTGCTGACAGTAATATGTTGCAATA (SEQ ID NO: 182)
3 VK1-39 CCTTACCGTTATTCGTCTCGCTGCTGACAGTAGTAAGTTGCAAAA (SEQ ID NO: 183)
3 VK3 CCTTACCGTTATTCGTCTCGCTGCTGACAGTAATAAACTGCAAAATC (SEQ ID NO: 184)
3 VKext1 CCAATACGCGTTTAAACCTGGTAAACCGCCTTACCGTTATTCGTCTC (SEQ ID NO: 185)
3 VKext2 GGTCCCTTGGCCGAATGAGACGCGCCTTCCCAATACGCGTTTAAAC (SEQ ID NO: 186)
3 Vkext3R GTGCGGCCGCCCGTTTGATTTCCACCTTGGTCCCTTGGCCGAATG (SEQ ID NO: 187)
3 VKext3G GTGCGGCCGCCCCTTTGATTTCCACCTTGGTCCCTTGGCCGAATG (SEQ ID NO: 188)
5 VL1-44 CGGGTCGACGCAGTCTGTGCTGACTCAGCCAC (SEQ ID NO: 189)
5 VL1-51 CGGGTCGACGCAGTCTGTGTTGACGCAGCCGC (SEQ ID NO: 190)
3 VL1-44 CCTTACCGTTATTCGTCTCCTGCTGCACAGTAATAATC (SEQ ID NO: 191)
3 VL1-51 CCTTACCGTTATTCGTCTCCTGTTCCGCAGTAATAATC (SEQ ID NO: 192)
3 Vlext2 CCCTCCGCCGAACACAGAGACGCGCCTTCCCAATACGCGTTTAAAC (SEQ ID NO: 193)
3 Vlext3 GTGCGGCCGCCCCTAGGACGGTCAGCTT (SEQ ID NO: 194)
GGTCCCTCCGCCGAACACAGA

The sequences of the 20 final assembled Acceptor Frameworks are shown in FIG. 8.

Example 3

Generation of Phagemid Acceptor Vectors Containing an Invariant Variable Domain

The phagemid vector pNDS1 used for the expression of scFv was first modified to remove two BsmBI sites. A VH3-23 domain containing a defined CDR3 sequence was cloned into the modified pNDS1 using the SfiI and XhoI restriction sites to obtain the phagemid vector pNDS_VHdummy. This domain contained a BsmBI site in the FR4 region, which was corrected by silent site directed mutagenesis. In parallel, a VK1-39 domain containing a defined CDR3 sequence was then cloned into the modified pNDS1 using the SalI and NotI restriction sites to obtain the phagemid vector pNDS_VKdummy (FIG. 9). The 8 VH Acceptor Frameworks were cloned into pNDS_VKdummy using the SalI and NotI restrictions sites. The 12 VL Acceptor Frameworks were cloned into pNDS_VHdummy using the SfiI and XhoI restrictions sites. The resulting 20 pNDS phagemid vectors that are listed below could at this stage be used for cloning of diversified CDR3 using the BsmBI sites present in the stuffer DNA fragments.

VH Acceptors: pNDS_VH1-2_VKd; pNDS_VH1-18_VKd; pNDS_VH1-69_VKd; pNDS_VH3-23_R_VKd; pNDS_VH3-23K_VKd; pNDS_VH3-30_VKd; pNDS_VH5-51_VKd; pNDS_VH3-48_VKd.

VL Acceptors: pNDS_VHd_VK1-33G; pNDS_VHd_VK1-33R; pNDS_VHd_VK1-39G; pNDS_VHd_VK1-39R; pNDS_VHd_VK3-11G; pNDS_VHd_VK3-11R; pNDS_VHd_VK3-15G; pNDS_VHd_VK3-15R; pNDS_VHd_VK3-20G; pNDS_VHd_VK3-20R; pNDS_VHd_VL1-44; pNDS_VHd_VK1-51.

Example 4

Capturing Natural CDR H3 Diversity from Human Repertoires

Multiple sources of human cDNA were used as a template for amplification of CDR H3 sequences. These sources included human fetal spleen as well as pools of male and female normal adult peripheral blood purified cells. Several strategies for amplification have been used in order to recover CDR H3 sequences originating from rearranged VH cDNA encoded by a specific germline gene or CDR H3 sequences originating from any VH cDNA.

First, mixtures of primers matching the 5′ coding regions of the majority of human VH families were used in combination with primer mixtures matching all the human JH regions. This allowed for PCR amplification a majority of heavy chain immunoglobulin variable genes. The expected amplification products of approximately 400 base pairs (bp) were isolated by agarose gel electrophoresis and purified. This DNA served as template in a second PCR step using primers with a 13 bp and 14 bp match for the end FR3 region and the beginning of FR4, respectively. In most cases, the last residue of the FR3 is either an arginine or a lysine. As the last by matches are critical for primer extension by the polymerase, two different 5′ primers were used: 5 VHR_FOK (SEQ ID NO: 205 shown below) and 5 VHK_FOK (SEQ ID NO: 206 shown below). Importantly, these primers also contain a FokI restriction site for excision of the CDR H3 sequence (FIG. 4). The primers used in the second PCR step were biotinylated at their 5′ end to facilitate downstream purification steps (see example 5). This two step approach allows for an efficient amplification of the CDR H3 sequences despite the limited number of base pairs matches. Amplifications were performed at varying annealing temperatures (between 30° C. and 70° C.) and with several thermostable DNA polymerases to establish optimal conditions. An annealing temperature of 55-58° C. in combination with GoTaq polymerase (Promega) was found to be optimal for this set of primers. The second amplification product was separated on a 2% agarose gel and resulted in a smear in the lower part of the gel corresponding to CDR H3 of different length. Either the complete DNA smear was extracted from the gel or a region corresponding to larger DNA fragments in order to enrich for long CDR H3.

Alternatively, the first amplification step was performed using the 5′ primer 5 VH3-23H2 (SEQ ID NO: 201 shown below), which is specific for the sequence encoding the CDR H2 of the germline VH3-23. As the different germline genes are diverse in this CDR, VH cDNAs encoded by the selected germline gene can be preferentially amplified. The subsequent purification and amplification steps were identical. In this way, it is possible to retrieve CDRs originating from a specific framework environment and to re-introduce them into the same, a similar or different framework.

Below is a list of primers used for the amplification of natural human CDR H3 repertoires.

1st PCR step
5 VH1/5 CCGCACAGCCGGCCATGGCCCAGGTGCAGCTGGTGCAGTCTGG (SEQ ID NO: 195)
5 VH3 CCGCACAGCCGGCCATGGCCGAGGTGCAGCTGGTGGAGTCTGG (SEQ ID NO: 196)
5 VH2 CCGCACAGCCGGCCATGGCCCAGRTCACCTTGCTCGAGTCTGG (SEQ ID NO: 197)
5 VH4 CCGCACAGCCGGCCATGGCCCAGGTGCAGCTGCAGGAGTCGGG (SEQ ID NO: 198)
5 VH4DP64 CCGCACAGCCGGCCATGGCCCAGCTGCAGCTGCAGGAGTCCGG (SEQ ID NO: 199)
5 VH4DP63 CCGCACAGCCGGCCATGGCCCAGGTGCAGCTACAGCAGTGGGG (SEQ ID NO: 200)
5 VH3-23H2 TGGAGTGGGTCTCAGCTATTAGTGGTAGTGGT (SEQ ID NO: 201)
3 HJ1/2 CGATGGGCCCTTGGTGGAGGCTGAGGAGACRGTGACCAGGGTGCC (SEQ ID NO: 202)
3 HJ3/6 CGATGGGCCCTTGGTGGAGGCTGAAGAGACGGTGACCRTKGTCCC (SEQ ID NO: 203)
3 HJ4/5 CGATGGGCCCTTGGTGGAGGCTGAGGAGACGGTGACCAGGGTTCC (SEQ ID NO: 204)
2nd PCR step
5 VHR_FOK GAGCCGAGGACACGGCCGGATGTTACTGTGCGAGA (SEQ ID NO: 205)
5 VHK_FOK GAGCCGAGGACACGGCCGGATGTTACTGTGCGAAA (SEQ ID NO: 206)
3 JH1_FOK GAGGAGACGGTGACGGATGTGCCCTGGCCCCA (SEQ ID NO: 207)
3 JH2_FOK GAGGAGACGGTGACGGATGTGCCACGGCCCCA (SEQ ID NO: 208)
3 JH3456_FOK GAGGAGACGGTGACGGATGTYCCTTGGCCCCA (SEQ ID NO: 209)

Example 5

Generation of Primary Libraries by Cloning Natural Human CDR H3 into Acceptor Frameworks

The amplified CDR H3 were digested with FokI, and the cleaved extremities as well as undigested DNA was removed using streptavidin coated magnetic beads. In parallel, pNDS VH Acceptor vectors were digested using BsmBI. As the overhangs generated by these digestions are compatible, the collection of natural CDR H3 was able to be ligated into the VH Acceptor Framework restoring the appropriate reading frame. The ligated DNA was purified and concentrated for transformation into competent E. coli XL1 Blue cells, and random clones analyzed by sequencing in order to check that CDR H3 sequence had been reconstituted and that junctions between the CDR and the Framework region are correct (FIG. 10). The results indicated that all the clones contained CDR H3 sequences and that the reading frame was restored, thus encoding an immunoglobulin variable heavy chain. In addition, all the CDRs were different, indicating that a large diversity of naturally occurring sequences had been captured by this approach. The length of the CDR H3 was also variable and relatively long CDRs of 10 to 15 residues were found, thus underscoring the advantage of this approach for sampling long CDR sequences that are difficult to cover using synthetic diversity.

Using this method, natural CDR H3 sequences, derived either from pooled human peripheral blood purified cells or human fetal spleen, were cloned into each of the pNDS VH Acceptor Frameworks and transformed into electrocompetent E. coli TG1 cells and plated on 2×TYAG Bioassay plates (2×TY media containing 100 μg/ml ampicilin and 2% glucose). After overnight incubation at 30° C., 10 ml of 2×TYAG liquid medium was added to the plates and the cells were scraped from the surface and transferred to a 50 ml polypropylene tube. 2×TYAG containing 50% glycerol was added to the cell suspension to obtain a final concentration of 17% glycerol. Aliquots of the libraries were stored at −80° C. In this process, 14 primary libraries were generated representing a total of 8.1×109 transformants. 180 randomly picked clones were sequenced to determine the quality and diversity of the libraries. All clones encoded different VH sequences and >89% were in frame. These primary libraries contain diversity in the CDR H3 only as they are combined with a dummy VL domain.

Example 6

Generation of Primary Libraries by Cloning Synthetic CDR3 into Acceptor Frameworks

Although the method is of particular interest for retrieving natural diversity, it can also be applied for the integration of synthetic diversity into Acceptor Frameworks. Synthetic CDR3 sequences were designed for both the VH and VL. The design took into account the frequency of CDRs with a given length and the diversification strategy (NNS, DVK, NVT or DVT codons) that would allow a complete coverage of the theoretical diversity within a reasonable number of transformants in a library (˜5×109 transformants) (FIG. 11). Key residues to maintain the canonical structure of the CDR were kept constant in the design of CDR3 for VK and Vλ chains. For the heavy chain, only CDR3 with up to 10 diversified positions were generated as the number of clones required to cover the diversity encoded by longer CDRs is beyond practical limits of transformation efficiency.

Degenerate oligonucleotides of different length were synthesized using NNS, NVT, DVK or DVT randomized codons. For each CDR H3, two oligonucleotides were synthesized encoding either a methionine or a phenylalanine at position 100z (FIG. 11). Each oligonucleotide was extended and amplified with two external biotinylated primers to generate double stranded DNA fragments encoding the designed CDRs. These external primers contain BsmBI restriction sites for subsequent excision of the CDR sequence and insertion into the Acceptor Frameworks (FIG. 12). The assembled DNA fragments were processed without gel purification and digested with BsmBI. The cleaved extremities as well as undigested DNA was removed using streptavidin coated magnetic beads. The digested DNA fragments were concentrated by ethanol precipitation and ligated into the corresponding pNDS VH, VK or Vλ Acceptor vectors. Ligation products were purified and concentrated for transformation into electrocompetent E. coli TG1 cells and plated on 2×TYAG Bioassay plates (2×TY media containing 100 μg/ml ampicilin and 2% glucose). After overnight incubation at 30° C., 10 ml of 2×TYAG liquid medium was added to the plates and the cells were scraped from the surface and transferred to a 50 ml polypropylene tube. 2×TYAG containing 50% glycerol was added to the cell suspension to obtain a final concentration of 17% glycerol Aliquots of the libraries were stored at −80° C. A total of 24 primary heavy chain libraries were generated representing a total of 1.6×1010 transformants. Similarly, 13 primary light chain libraries were generated representing a total of 6.9×109 transformants. These primary libraries contain diversity in the CDR H3 only as they are combined with a dummy VL domain. A total of 330 randomly picked clones were sequenced to determine the quality and diversity of the libraries. All clones encoded different variable domain sequences and >90% were in frame. This low frequency of sequences containing shifts in the reading frame is in sharp contrast with results traditionally obtained during the construction of synthetic antibody fragment libraries using overlapping PCR approaches which are more prone to the introduction of insertion, and significant loss of functional clones (15-45%) has frequently been reported.

The diversity in these primary libraries was restricted to the CDR H3 or CDR L3 as they are combined with a dummy VL or VH chain, respectively.

Primers used for synthetic CDR assembly are listed below.

5 H3_R_biot
(SEQ ID NO: 210)
ATGATGCTGCTGGCACGTCTCCGAGA
3 H3_M_biot
(SEQ ID NO: 211)
CCACGTCATCCGATCCGTCTCCCCCAATAATCCAT
3 H3_F_biot
(SEQ ID NO: 212)
CCACGTCATCCGATCCGTCTCCCCCAATAATCAAA
H3_4nnsF
(SEQ ID NO: 213)
GCTGGCACGTCTCCGAGANNSNNSNNSNNSTTTGATTATTGGGGGAGACG
H3_4nnsM
(SEQ ID NO: 214)
GCTGGCACGTCTCCGAGANNSNNSNNSNNSATGGATTATTGGGGGAGACG
H3_5nnsF
(SEQ ID NO: 215)
GCTGGCACGTCTCCGAGANNSNNSNNSNNSNNSTTTGATTATTGGGGGAGACG
H3_5nnsM
(SEQ ID NO: 216)
GCTGGCACGTCTCCGAGANNSNNSNNSNNSNNSATGGATTATTGGGGGAGACG
H3_6nnsF
(SEQ ID NO: 217)
GCTGGCACGTCTCCGAGANNSNNSNNSNNSNNSNNSTTTGATTATTGGGGGAGACG
H3_6nnsM
(SEQ ID NO: 218)
GCTGGCACGTCTCCGAGANNSNNSNNSNNSNNSNNSATGGATTATTGGGGGAGACG
H3_6dvkF
(SEQ ID NO: 219)
GCTGGCACGTCTCCGAGADVKDVKDVKDVKDVKDVKTTTGATTATTGGGGGAGACG
H3_6dvkM
(SEQ ID NO: 220)
GCTGGCACGTCTCCGAGADVKDVKDVKDVKDVKDVKATGGATTATTGGGGGAGACG
H3_7dvkF
(SEQ ID NO: 221)
GCTGGCACGTCTCCGAGADVKDVKDVKDVKDVKDVKDVKTTTGATTATTGGGGGAGACG
H3_7dvkM
(SEQ ID NO: 222)
GCTGGCACGTCTCCGAGADVKDVKDVKDVKDVKDVKDVKATGGATTATTGGGGGAGACG
H3_7nvtF
(SEQ ID NO: 223)
GCTGGCACGTCTCCGAGANVTNVTNVTNVTNVTNVTNVTTTTGATTATTGGGGGAGACG
H3_7nvtM
(SEQ ID NO: 224)
GCTGGCACGTCTCCGAGANVTNVTNVTNVTNVTNVTNVTATGGATTATTGGGGGAGACG
H3_8nvtF
(SEQ ID NO: 225)
GCTGGCACGTCTCCGAGANVTNVTNVTNVTNVTNVTNVTNVTTTTGATTATTGGGGGAGACG
H3_8nvtM
(SEQ ID NO: 226)
GCTGGCACGTCTCCGAGANVTNVTNVTNVTNVTNVTNVTNVTATGGATTATTGGGGGAGACG
H3_9nvtF
(SEQ ID NO: 227)
GCTGGCACGTCTCCGAGANVTNVTNVTNVTNVTNVTNVTNVTNVTTTTGATTATTGGGGGAGAC
G
H3_9nvtM
(SEQ ID NO: 228)
GCTGGCACGTCTCCGAGANVTNVTNVTNVTNVTNVTNVTNVTNVTATGGATTATTGGGGGAGAC
G
H3_9dvtF
(SEQ ID NO: 229)
GCTGGCACGTCTCCGAGADVTDVTDVTDVTDVTDVTDVTDVTDVTTTTGATTATTGGGGGAGAC
G
H3_9dvtM
(SEQ ID NO: 230)
GCTGGCACGTCTCCGAGADVTDVTDVTDVTDVTDVTDVTDVTDVTATGGATTATTGGGGGAGAC
G
H3_10dvtF
(SEQ ID NO: 231)
GCTGGCACGTCTCCGAGADVTDVTDVTDVTDVTDVTDVTDVTDVTDVTTTTGATTATTGGGGGA
GACG
H3_10dvtM
(SEQ ID NO: 232)
GCTGGCACGTCTCCGAGADVTDVTDVTDVTDVTDVTDVTDVTDVTDVTATGGATTATTGGGGGA
GACG
5 KL3_biot
(SEQ ID NO: 233)
CCGGTGTAGCGAAGGCGTCTCAGCAG
3 KL3_biot
(SEQ ID NO: 234)
TAGGGTCGCCTTGATCGTCTCCCGAAGGTCGG
K_4nns
(SEQ ID NO: 235)
GAAGGCGTCTCAGCAGNNSNNSNNSNNSCCGACCTTCGGGAGACG
K_5nns
(SEQ ID NO: 236)
GAAGGCGTCTCAGCAGNNSNNSNNSNNSCCGNNSACCTTCGGGAGACG
K_6nns
(SEQ ID NO: 237)
GAAGGCGTCTCAGCAGNNSNNSNNSNNSNNSCCGNNSACCTTCGGGAGACG
5 L44W_biot
(SEQ ID NO: 238)
CGGTCAGTCGCAATACGTCTCCAGCATGGGAT
5 L44Y_biot
(SEQ ID NO: 239)
CGGTCAGTCGCAATACGTCTCCAGCATATGAT
3 L_biot
(SEQ ID NO: 240)
CAGGACCAGTCTCGTGAGGATCGTCTCAACAC
L44W_4nns
(SEQ ID NO: 241)
CGTCTCCAGCATGGGATNNSNNSNNSNNSGTGTTGAGACGATCCTC
L44Y_4nns
(SEQ ID NO: 242)
CGTCTCCAGCATATGATNNSNNSNNSNNSGTGTTGAGACGATCCTC
L44W_5nns
(SEQ ID NO: 243)
CGTCTCCAGCATGGGATNNSNNSNNSNNSNNSGTGTTGAGACGATCCTC
L44Y_5nns
(SEQ ID NO: 244)
CGTCTCCAGCATATGATNNSNNSNNSNNSNNSGTGTTGAGACGATCCTC
L44W_6nns
(SEQ ID NO: 245)
CGTCTCCAGCATGGGATNNSNNSNNSNNSNNSNNSGTGTTGAGACGATCCTC
L44Y_6nns
(SEQ ID NO: 246)
CGTCTCCAGCATATGATNNSNNSNNSNNSNNSNNSGTGTTGAGACGATCCTC
5 L51W_biot
(SEQ ID NO: 247)
CGGTCAGTCGCAATACGTCTCGAACATGGGAT
5 L51Y_biot
(SEQ ID NO: 248)
CGGTCAGTCGCAATACGTCTCGAACATATGAT
L51W_4nns
(SEQ ID NO: 249)
CGTCTCGAACATGGGATNNSNNSNNSNNSGTGTTGAGACGATCCTC
L51Y_4nns
(SEQ ID NO: 250)
CGTCTCGAACATATGATNNSNNSNNSNNSGTGTTGAGACGATCCTC
L51W_5nns 
(SEQ ID NO: 251)
CGTCTCGAACATGGGATNNSNNSNNSNNSNNSGTGTTGAGACGATCCTC
L51Y_5nns
(SEQ ID NO: 252)
CGTCTCGAACATATGATNNSNNSNNSNNSNNSGTGTTGAGACGATCCTC
L51W_6nns
(SEQ ID NO: 253)
CGTCTCGAACATGGGATNNSNNSNNSNNSNNSNNSGTGTTGAGACGATCCTC
L51Y_6nns
(SEQ ID NO: 254)
CGTCTCGAACATATGATNNSNNSNNSNNSNNSNNSGTGTTGAGACGATCCTC

Example 7

Generation of Secondary Libraries

In order to generate libraries of scFv carrying diversity in both the heavy and light chains, the Primary synthetic light chain libraries were combined with either the Primary synthetic heavy chain libraries or the Primary natural heavy chain libraries (FIG. 13). Phagemid DNA was prepared from each primary library and digested with XhoI/NotI restriction enzymes. The DNA fragments corresponding to the linker and light chains from the Primary synthetic libraries were inserted by ligation into the digested Primary natural or synthetic heavy chain vectors. Alternatively the Linker-VL sequence was also amplified with specific primers before digestion with XhoI/NotI and ligation. The ligation products were purified by phenol/chloroform extraction and precipitation before transformation into electrocompetent E. coli TG1 cells and plating on 2×TYAG Bioassay plates (2×TY media containing 100 μg/ml ampicilin and 2% glucose). After overnight incubation at 30° C., 10 ml of 2×TYAG liquid medium was added to the plates and the cells were scraped from the surface and transferred to a 50 ml polypropylene tube. 2×TYAG containing 50% glycerol was added to the cell suspension to obtain a final concentration of 17% glycerol. Aliquots of the libraries were stored at −80° C. To limit the number of libraries to be recombined, they were pooled by chain subclasses (i.e., VH1, VH3, VH5, VK1, VK3, Vλ1) and thus 9 library combination were performed for (i.e., VH1×VK1, VH1×VK3, VH1×Vλ1, VH3×VK1, VH3×VK3, VH3×Vλ1, VH5×VK1, VH5×VK3, VH5×Vλ1). The total size of the Secondary synthetic libraries (carrying synthetic diversity in both the VH and VL) was 7.3×109 transformants. The total size of the Secondary natural libraries (carrying natural diversity in the VH and synthetic diversity in the VL) was 1.5×1010 transformants.

Example 8

Generation of Human Antibody Libraries Displaying a CDRH3 Repertoire Derived from a Non-Human Species

In order to utilize alternative sources of diversity that would allow exploring a different tri-dimensional space within the antibody combining site, a library was created by capturing the CDRH3 of mice and introduced them into a collection of human antibody frameworks. For this approach an acceptor library containing a collection of VL genes with synthetic CDR L3 diversity was constructed and combined with a collection of acceptor sequences containing a stuffer DNA sequence ready suitable for Type IIS restriction cloning as described in Example 2. This library represents the starting point for rapid generation of secondary libraries with multiple sources of natural (human as well as non-human) or synthetic CDR H3. In this example, natural CDR H3 diversity was captured from naïve Balb/c mice and mice that had been immunized with hIFNγ or hCCL5 (hRANTES).

The first step was the generation of acceptor libraries by cloning a collection of VL containing synthetic CDR L3 diversity into acceptor VH framework vectors (FIG. 14). The VL sequences were derived from the seven Primary Synthetic Libraries described in Example 6 by PCR amplification using primers 5′biot-VHdummy and 3′biot-fdtseq. The resulting VL containing fragments of approximately 400 bp were digested using XhoI/NotI and purified on spin columns to remove primers and enzymes. Similarly the pNDS VH acceptor vectors containing a CDRH3 stuffer and a dummy light chain were digested with XhoI/NotI and SwaI (SwaI cutting inside the VL dummy) and purified on Chroma Spin TE columns with a cutoff of 1000 bp to get rid of the VL dummy fragment. The digested VL fragments were then ligated into the VH acceptor vectors (FIG. 14). To limit the number of libraries to be recombined, VH acceptor vectors and VL fragments were pooled by chain subclasses (i.e., VH1, VH3, VH5, Vκ1, Vκ3, vλ1) and thus nine library combinations were performed (i.e., VH1×Vκ1, VH1×Vκ3, VH1×Vλ1, VH3×Vκ1, VH3×Vκ3, VH3×Vλ1, VH5×Vκ1, VH5×Vκ3, VH5×Vλ1). The ligation products were transformed into electrocompetent E. coli TG1 cells and plated on 2×TYAG Bioassay plates (2×TY medium containing 100 μg/ml ampicillin and 2% glucose). After overnight incubation at 30° C., 6 ml of 2×TYAG liquid medium was added to the plates and the cells were scraped from the surface and transferred to a 50 ml polypropylene tube. Glycerol 50% was added to the cell suspension to obtain a final concentration of 17% glycerol. Aliquots of the libraries were stored at −80° C. The total size of this acceptor library, carrying synthetic diversity in the CDR L3, was 1.9×109 transformants.

The next step was to isolate CDRH3 sequences from a non-human source. Cells were isolated from the spleen of five naïve or immunized Balb/c mice and total RNA was purified. cDNA was obtained from the extracted RNA by RT-PCR. This cDNA was used as template to isolate and amplify mouse VH by PCR. A series of PCRs were performed using 15 different 5′ primers (one for each mouse VH subgroup) specific for the beginning of the FR1 region and a pool of 3′ primers (four primers covering the JH region). These first PCRs were pooled and purified on a 2% agarose gel. The purified DNA served as template to perform a second PCR to isolate the mouse CDR H3 region.

The 5′ and 3′ primers for this second PCR target the FR3 and FR4 regions of mouse VH, respectively. These primers added a FokI restriction site in order to allow for precise excision of the CDR H3 and cloning into the human acceptor vectors. However, alignments of murine VH sequences revealed that sequence at the 5′ boundary of murine CDR-H3 and that are located at the cleavage site of FokI almost always differ from human sequence by one base, whereas the 3′ end matched between these two species. The sequences cleaved by FokI are boxed in Table below:

Consequently the base had to be corrected during the second amplification step in order to generate cohesive ends that are compatible with the cohesive ends generated upon digestion of the Acceptor Frameworks. Efficient amplification was observed suggesting that this conversion occurred readily. At the 3′ end, mouse and human sequences that will be cut by the Type IIS restriction enzymes are identical thus avoiding any correction issues.

Primers for the second amplification were biotinylated at their 5′ ends to facilitate downstream purification steps. The acceptor vectors were digested with BsmBI and purified on Chroma Spin TE columns having a cutoff of 1000 bp. After digestion and purification, the nine different library combinations were pooled in equimolar ratio for ligation of the captured mouse CDRH3.

The ligated DNA was purified by phenol/chloroform extractions and concentrated by precipitation before transformation into competent E. coli TG1 cells and plated on 2×TYAG Bioassay plates (2×TY medium containing 100 μg/ml ampicillin and 2% glucose). After overnight incubation at 30° C., 6 ml of 2×TYAG liquid medium was added to the plates and the cells were scraped from the surface and transferred to a 50 ml polypropylene tube. Glycerol 50% was added to the cell suspension to obtain a final concentration of 17% glycerol. Aliquots of the libraries were stored at −80° C. Three libraries of similar size were obtained: MnA, 2.5×108 transformants (carrying a restricted natural human framework diversity, naïve mouse diversity in the CDR H3 and synthetic diversity in the CDR L3); MiB, 7.3×107 transformants (carrying a restricted natural human framework diversity, immune mouse diversity against hIFNγ in the CDR H3 and synthetic diversity in the CDR L3) and MiC, 1.8×108 transformants (carrying a restricted natural human framework diversity, immune mouse diversity against hCCL5 in the CDR H3 and synthetic diversity in the CDR L3). Random clones were analyzed by sequencing in order to check that CDR H3 sequence had been reconstituted and that junctions between the CDR and the Framework regions were correct. The results indicated that all the clones contained CDR H3 sequences and that the reading frame was restored, thus encoding an immunoglobulin variable heavy chain. All the CDRs were different and resembled typical mouse CDR H3 sequences indicating that a large diversity of naturally occurring mouse CDRH3 sequences had been captured by this approach. In addition, the analysis of the CDRH3 length profiles indicated that a Gaussian distribution was captured in the naïve library that corresponds to the expected distribution of lengths in normal mouse repertoire. In contrast, in the two immune libraries the profiles were different suggesting that a different CDRH3 repertoire had been captured (FIG. 15).

Primers Used for CDRH3 Amplification from Mice

1st PCR
5′ primers:
m5 VH1 ATGCGGCCCAGCCGGCCATGGCCSAGGTYCAGCTBCAGCAGTC
(SEQ ID NO: 256)
m5 VH2 ATGCGGCCCAGCCGGCCATGGCCCAGGTTCACCTGCAGCARTC
(SEQ ID NO: 257)
m5 VH3 ATGCGGCCCAGCCGGCCATGGCCCAGGTRCAGCTGAAGGAGTC
(SEQ ID NO: 258)
m5 VH4 ATGCGGCCCAGCCGGCCATGGCCCAGGTCCAACTVCAGCARCC
(SEQ ID NO: 259)
m5 VH5 ATGCGGCCCAGCCGGCCATGGCCCAGATCCAGTTGGTVCAGTC
(SEQ ID NO: 260)
m5 VH6 ATGCGGCCCAGCCGGCCATGGCCCAGGTGCAGCTGAAGSASTC
(SEQ ID NO: 261)
m5 VH7 ATGCGGCCCAGCCGGCCATGGCCGAGGTGCAGSKGGTGGAGTC
(SEQ ID NO: 262)
m5 VH8 ATGCGGCCCAGCCGGCCATGGCCGAAGTGAARSTTGAGGAGTC
(SEQ ID NO: 263)
m5 VH9 ATGCGGCCCAGCCGGCCATGGCCGAKGTSVAGCTTCAGGAGTC
(SEQ ID NO: 264)
m5 VH10 ATGCGGCCCAGCCGGCCATGGCCGAGGTGAASSTGGTGGAATC
(SEQ ID NO: 265)
m5 VH11 ATGCGGCCCAGCCGGCCATGGCCGAGGTGAAGCTGRTGGARTC
(SEQ ID NO: 266)
m5 VH12 ATGCGGCCCAGCCGGCCATGGCCGARGTGAAGCTGRTGGAGTC
(SEQ ID NO: 267)
m5 VH13 ATGCGGCCCAGCCGGCCATGGCCGAAGTGCAGCTGTTGGAGAC
(SEQ ID NO: 268)
m5 VH14 ATGCGGCCCAGCCGGCCATGGCCGARGTGAAGCTTCTCSAGTC
(SEQ ID NO: 269)
m5 VH15 ATGCGGCCCAGCCGGCCATGGCCCARGTTACTCTGAAAGAGT
(SEQ ID NO: 270)
3′ primers:
m3 HJ1 CCTGAACCGCCGCCTCCGCTCGAGACGGTGACCGTGGTCCC
(SEQ ID NO: 271)
m3 HJ2 CCTGAACCGCCGCCTCCGCTCGAGACTGTGAGAGTGGTGCC
(SEQ ID NO: 272)
m3 HJ3 CCTGAACCGCCGCCTCCGCTCGAGACAGTGACCAGAGTCCC
(SEQ ID NO: 273)
m3 HJ4 CCTGAACCGCCGCCTCCGCTCGAGACGGTGACTGAGGTTCC
(SEQ ID NO: 274)
2nd PCR
5′ primers:
5 VHR_FOK_biot  GAGCCGAGGACACGGCCGGATGTTACTGTGCGAGA
(SEQ ID NO: 275)
3′ primers:
3′ mJH1_Fok_biot GGGGCGCAGGGACATCCGTCACCGTCTCCTC
(SEQ ID NO: 276)
3′ mJH2_Fok_biot GAGGAGACTGTGAGGGATGTGCCTTGGCCCCA
(SEQ ID NO: 277)
3′ JH1_Fok GAGGAGACGGTGACGGATGTGCCCTGGCCCCA
(SEQ ID NO: 278)
3′ mJH4_Fok_biot GAGGAGACGGTGACGGATGTTCCTTGACCCCA
(SEQ ID NO: 279)

Example 9

Phage Rescue of the Libraries

Each Primary and Secondary library was rescued independently according to standard phage display procedures briefly summarized hereafter. A volume of cell from the frozen library aliquots sufficient to cover at least 10 times the theoretical diversity of the library was added to 500 ml of 2×TYAG and grown at 37° C. with agitation (240 rpm) until an OD600 of 0.3 to 0.5 was reached. The culture was then super-infected with MK13K07 helper phage and incubated for one hour at 37° C. (150 rpm). The medium was then changed by centrifuging the cells at 2000 rpm for 10 minutes, removing the medium and resuspending the pellet in 500 ml of 2×TY-AK (100 μg/ml ampicilin; 50 μg/ml kanamycin). The culture was then grown overnight at 30° C. (240 rpm). The culture was centrifuged at 4000 rpm for 20 minutes to pellet the cells. The supernatant was collected and 30% (vol/vol) of PEG 8000 (20%)/2.5M NaCl was added to precipitate the phage particles by incubating the mixture 1 hour on ice. The phage particles were collected by centrifugation at 10,000 rpm for 30 minutes and resuspended in 10 ml of TE buffer (10 mM tris-HCl pH 8.0; 1 mM EDTA). The resuspended solution was centrifuged at 10,000 rpm to clear the bacterial debris and the precipitation procedure was repeated. After final resuspension, phage was titrated by infection of E. coli and absorption at 280 nm. The display level of scFv at the surface of phage was also evaluated by Western blot analysis using an anti-c-myc monoclonal antibody. Purified phage from different libraries was stored frozen at −80° C. after addition of glycerol to a final concentration of 15% (w/v).

In order to use a manageable number of libraries during selection procedures, the purified phage was pooled into 4 working libraries: AA1—Phage from all Primary synthetic VH libraries; AB1—Phage from all Primary synthetic VL libraries; AC1—Phage from all Primary natural VH libraries; AD1—Phage from all Secondary natural libraries; AE1—Phage from all Secondary synthetic libraries; MnA—Libraries with diversity captured from naïve mice; MiB—Libraries with diversity captured from mice immunized with hIFNγ; MiC—Libraries with diversity captured from mice immunized with hCCL5/RANTES.

Example 10

High Throughput Sequencing of Antibody Libraries

The quality and diversity of a library can be evaluated by DNA sequencing of random library members. In most cases a few hundred clones are sequenced which represent only a very small fraction of the library (less than 1 in 10,000,000 library members). In order to analyze the performance of the methods provide herein, next generation sequencing technology was used to analyze a more representative number of library members. DNA isolated from the library AE1 was used as a template for high throughput sequencing using an illumina Genome Analyzer instrument. This next-generation DNA sequencing system allows for billions of bases to be read in a few days. The sequencing reads are relatively short (about 70 bases) but perfectly compatible with our library design. As the diversity is confined to the CDR3 regions a 70 base read is sufficient to cover the CDRH3 and part of the framework 3 region for VH family identification. This technology has been applied to sequence several millions of CDRH3 regions from the AE1 library. 5,078,705 sequences were obtained for a total of 365,666,760 bases. Analysis of the data indicated that 5,007,022 sequences (98.6% of the total) were unique. A total of 4,680,882 sequences could be unambiguously ascribed to a VH family (VH1, VH3 and VH5) and the representation of the VH families in the AE1 library determined (41% VH1; 30% VH3; 29% VH5). An important finding was that the proportion of in frame inserts ranged between 88 and 91%. This data confirmed in a far more statistical manner the sequencing results of the 24 primary VH synthetic libraries described in Example 6. This combined set of sequencing data demonstrates that the type IIs restriction cloning process used in this method is very robust, leading to an efficient and productive insertion in the 24 independent library constructions performed to generate the VH diversity of the AE1 library.

The sequencing of millions of library members represents an unprecedented quality control step for an antibody library. The results demonstrate that the method allows for the generation of high quality and high diversity libraries in a reproducible and robust manner.

Example 11

Phage Display Selections Using Secondary Libraries

Liquid Phase Selections Against Human Interferon Gamma (hIFNγ):

Aliquots of AD1 and AE1 phage libraries (1011-1012 Pfu) were blocked with PBS containing 3% (w/v) skimmed milk for one hour at room temperature on a rotary mixer. Blocked phage was then deselected on streptavidin magnetic beads (Dynal M-280) for one hour at room temperature on a rotary mixer. Deselected phage was then incubated with in vivo biotinylated hIFNγ (100 nM) for two hours at room temperature on a rotary mixer. Beads were captured using a magnetic stand followed by four washes with PBS/0.1% Tween 20 and 3 washes with PBS. Beads were then directly added to 10 ml of exponentially growing TG1 cells and incubated for one hour at 37° C. with slow shaking (100 rpm). An aliquot of the infected TG1 was serial diluted to titer the selection output. The remaining infected TG1 were spun at 3000 rpm for 15 minutes and re-suspended in 0.5 ml 2×TYAG (2×TY media containing 100 μg/ml ampicilin and 2% glucose) and spread on 2×TYAG agar Bioassay plates. After overnight incubation at 30° C., 10 ml of 2×TYAG was added to the plates and the cells were scraped from the surface and transferred to a 50 ml polypropylene tube. 2×TYAG containing 50% glycerol was added to the cell suspension to obtain a final concentration of 17% glycerol. Aliquots of the selection round were kept at −80° C. Phage outputs were titrated after each round and the progressive increase in outputs indicated that the enrichment of clones specific for the target was occurring (FIG. 16).

Selections by Panning Against the Rat Monoclonal Antibody 5E3:

Immunotubes were coated with 5E3 at 10 μg/ml in PBS over night at 4° C. and immunotubes for phage deselection were coated with an irrelevant rat antibody under the same conditions. After washing immunotubes were blocked with PBS containing 3% (w/v) skimmed milk for one hour at room temperature. Aliquots of AD1 and AE1 phage libraries (1011-1012 Pfu) were blocked with PBS containing 3% (w/v) skimmed milk for one hour at room temperature on a rotary mixer. Blocked phage was then deselected in the immunotubes coated with an irrelevant rat antibody for one hour at room temperature on a rotary mixer. Deselected phage was then transferred to the immunotubes coated with 5E3 and incubated for two hours at room temperature on a rotary mixer. Tubes were washed five times with PBS/0.1% Tween 20 and 3 times with PBS. Phage was eluted with TEA 100 mM for 10 minutes and neutralized with 1M Tris HCl pH 7.5. Phage was added to 10 ml of exponentially growing TG1 cells and incubated for one hour at 37° C. with slow shaking (100 rpm). An aliquot of the infected TG1 was serial diluted to titer the selection output. The remaining infected TG1 were spun at 3000 rpm for 15 minutes and re-suspended in 0.5 ml 2×TYAG (2×TY media containing 100 μg/ml ampicilin and 2% glucose) and spread on 2×TYAG agar Bioassay plates. After overnight incubation at 30° C., 10 ml of 2×TYAG was added to the plates and the cells were scraped from the surface and transferred to a 50 ml polypropylene tube. 2×TYAG containing 50% glycerol was added to the cell suspension to obtain a final concentration of 17% glycerol. Aliquots of the selection round were kept at −80° C. Rounds of selection were performed by alternating between rat 5E3 and a chimeric version of 5E3 in which the variable region were fused to mouse constant domains. These alternating rounds were performed in order to enrich for clones specific for the variable region of 5E3 and generate anti-idiotypic antibodies. Phage outputs were titrated after each round and the progressive increase in outputs indicated that the enrichment of clones specific for the target was occurring (FIG. 17).

Phage Rescue:

100 μl of cell suspension obtained from previous selection rounds were added to 20 ml of 2×TYAG and grown at 37° C. with agitation (240 rpm) until an OD600 of 0.3 to 0.5 was reached. The culture was then super-infected with 3.3×1010 MK13K07 helper phage and incubated for one hour at 37° C. (150 rpm). The medium was then changed by centrifuging the cells at 2000 rpm for 10 minutes, removing the medium and resuspending the pellet in 20 ml of 2×TY-AK (100 μg/ml ampicilin; 50 μg/ml kanamycin). The culture was then grown overnight at 30° C. (240 rpm).

Monoclonal Phage Rescue for ELISA:

Single clones were picked into a microtiter plate containing 150 μl of 2×TYAG media (2% glucose) per well and grown at 37° C. (100-120 rpm) for 5-6 h. M13KO7 helper phage was added to each well to obtain a multiplicity of infection (MOI) of 10 (i.e., 10 phage for each cell in the culture) and incubated at 37° C. (100 rpm) for 1 h. Following growth, plates were centrifuged at 3,200 rpm for 10 min. Supernatant was carefully removed, cells resuspended in 150 μl 2×TYAK medium and grown overnight at 30° C. (120 rpm). For the ELISA, the phage are blocked by adding 150 μl of 2× concentration PBS containing 5% skimmed milk powder followed by one hour incubation at room temperature. The plates were then centrifuged 10 minutes at 3000 rpm and the phage containing supernatant used for the ELISA.

Phage ELISA:

ELISA plates (Maxisorb, NUNC) were coated overnight with 2 μg/ml hIFNγ in PBS or 2 μg/ml rat 5E3 in PBs. Control plates were coated with 2 μg/ml BSA or an irrelevant rat monoclonal antibody. Plates were then blocked with 3% skimmed milk/PBS at room temperature for 1 h. Plates were washed 3 times with PBS 0.05% Tween 20 before transferring the pre-blocked phage supernatants and incubation for one hour at room temperature. Plates were then washed 3 times with PBS 0.05% Tween 20. 50 μl of 3% skimmed milk/PBS containing (HRP)-conjugated anti-M13 antibody (Amersham, diluted 1:10,000) to each well. Following incubation at room temperature for 1 hr, the plates were washed 5 times with PBS 0.05% Tween 20. The ELISA was then revealed by adding 50 μl of TMB (Sigma) and 50 μl of 2N H2SO4 to stop the reaction. Absorption intensity was read at 450 nm. Clones specific for hIFNγ could be identified and the hit rates ranged between 10% and 30% after the third round of selection. Clones specific for the variable region of 5E3 could also be identified and the hit rates ranged between 7 and 48% after the third round of selection.

Phage Clone Sequencing:

Single clones were grown in 5 ml of 2×TYAG media (2% glucose) per well and grown at 37° C. (120 rpm) overnight. The next day phagemid DNA was purified and used for DNA sequencing using a primer specific for pNDS1: mycseq, 5′-CTCTTCTGAGATGAGTTTTTG. (SEQ ID NO: 255).

Large scale scFv purification: A starter culture of 1 ml of 2×TYAG was inoculated with a single colony from a freshly streaked 2×TYAG agar plate and incubated with shaking (240 rpm) at 37° C. for 5 hours. 0.9 ml of this culture was used to inoculate a 400 ml culture of the same media and was grown overnight at 30° C. with vigorous shaking (300 rpm).

The next day the culture was induced by adding 400 μl of 1M IPTG and incubation was continued for an additional 3 hours. The cells were collected by centrifugation at 5,000 rpm for 10 minutes at 4° C. Pelleted cells were resuspended in 10 ml of ice-cold TES buffer complemented with protease inhibitors as described above. Osmotic shock was achieved by adding 15 ml of 1:5 diluted TES buffer and incubation for 1 hour on ice. Cells were centrifuged at 10,000 rpm for 20 minutes at 4° C. to pellet cell debris. The supernatant was carefully transferred to a fresh tube. Imidazole was added to the supernatant to a final concentration of 10 mM. 1 ml of Ni-NTA resin (Qiagen), equilibrated in PBS was added to each tube and incubated on a rotary mixer at 4° C. (20 rpm) for 1 hour. The tubes were centrifuged at 2,000 rpm for 5 minutes and the supernatant carefully removed. The pelleted resin was resuspended in 10 ml of cold (4° C.) Wash buffer 1 (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH to 8.0). The suspension was added to a polyprep column (Biorad). 8 ml of cold Wash Buffer 2 (50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, pH to 8.0) were used to wash the column by gravity flow. The scFv were eluted from the column with 2 ml of Elution buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, pH to 8.0). Fractions were analyzed by absorption at 280 nm and protein containing fractions were pooled before buffer exchange on a PD10 desalting column (Amersham) equilibrated with PBS. The scFv in PBS were analyzed by SDS-PAGE and quantified by absorption at 280 nm. The purified scFv were aliquoted and stored at −20° C. and at 4° C.

Example 12

Analysis of CDR3 Profiles Obtained after Selection Using High Throughput Sequencing

Using next generation sequencing technology as described in Example 10, the distribution of CDR H3 lengths within each VH family in the AE1 and AD1 libraries as well as in the output obtained after the third round of selection was analyzed. The profiles of the AE1 and AD1 libraries are clearly different (FIG. 18). The CDR H3 length distribution in the AE1 library corresponds to the intended library design, with lengths ranging between 9-15 amino acids. In contrast, much longer CDR H3 of up to 22 amino acids are found in the AD1 library, and the profile corresponds to the length distribution observed in human natural repertoires. These results confirm that a human natural CDR H3 repertoire has been captured during the construction of the AD1 library. A similar analysis performed after three rounds of selection against 5E3 revealed that completely different CDR H3 length profiles were selected. In particular, a dramatic enrichment of CDR H3 of 8 and 21 amino acids in length could be observed in the selection performed with the AD1 library. This set of data demonstrated that different CDR H3 profiles were enriched from the two libraries after selection against the same target. Furthermore, this analysis demonstrates that, using the present invention, long CDR H3 that are very difficult to cover using synthetic diversity could be captured into selected human frameworks and selected.

Example 13

Evaluating Identified scFvs in Binding Assays

Purified scFvs preparations of clones having different sequences and that were identified positive against the variable region of 5E3 were tested for binding against chimeric 5E3 in a dose response ELISA. These preparations were also tested against an irrelevant mouse antibody (1A6). ELISA plates (Maxisorb, NUNC) were coated overnight with 2 μg/ml mouse 5E3 in PBS. Control plates were coated with 2 μg/ml 1A6 monoclonal antibody. Plates were then blocked with 3% skimmed milk/PBS at room temperature for 1 h. Plates were washed 3 times with PBS 0.05% Tween 20 before adding different concentrations of purified scFv and incubation for one hour at room temperature. Plates were then washed 3 times with PBS 0.05% Tween 20. 50 μl of 3% skimmed milk/PBS containing (HRP)-conjugated anti-myc antibody to each well. Following incubation at room temperature for 1 hr, the plates were washed 5 times with PBS 0.05% Tween 20. The ELISA was then revealed by adding 50 μl of Amplex Red fluorescent substrate and the signal was read on fluorescence spectrophotometer. The data shows that most of the clones are highly specific for 5E3 as they do not recognize 1A6 and that they are directed against the variable regions of 5E3 (FIG. 19).

Similarly, purified scFvs preparations of clones having different sequences and that were identified in phage ELISA as binders against hIFNγ were tested for binding against hIFNγ in a dose response experiment. ELISA plates (Maxisorb, NUNC) were coated overnight with 2 μg/ml hIFNγ in PBS and control plates were coated with 2 μg/ml BSA in PBS. Plates were then blocked with 3% skimmed milk/PBS at room temperature for 1 h. Plates were washed 3 times with PBS 0.05% Tween 20 before adding different concentration of purified scFv and incubation for one hour at room temperature. Plates were then washed 3 times with PBS 0.05% Tween 20. 50 μl of 3% skimmed milk/PBS containing (HRP)-conjugated anti-myc antibody to each well. Following incubation at room temperature for 1 hr, the plates were washed 5 times with PBS 0.05% Tween 20. The ELISA was then revealed by adding 50 μl TMB substrate and 50 μl of 2N H2SO4 to stop the reaction. The signal was read on an absorbance spectrophotometer at 450 nm. The data shows that the selected clones are binding to hIFNγ in a dose dependent manner and gave a very good signal when compared to a positive control scFv A6 that has a high affinity for hIFNγ (FIG. 20).

Example 14

ScFv Inhibition of Interferon Gamma-Induced Reporter Gene Expression

A panel of selected scFv specific for hIFNγ was produced and purified as described above and tested for the capacity to block the biological activity of hIFNγ. A reporter gene (firefly luciferase), driven by the IFNγ-inducible GBP 1 promoter, was transfected into the human melanoma cell line, Me67.8. Various concentrations of scFv were incubated with 2 ng/ml of hIFNγ and then added to the cell culture. Following a 6 hour incubation time, the luciferase reporter assay was performed and the intensity of the luminescence measured. The activity was compared to a scFv isolated from another human scFv antibody library constructed by traditional capturing of the VH/VL repertoires form human donors (clone G9). The data shows that scFv isolated either from synthetic or natural human diversity libraries (AE1 and AD1) were capable of neutralizing the biological activity of hIFNγ in a dose dependent manner (FIG. 21). The neutralization potential of these scFv was superior to the benchmark scFv clone G9.

Example 15

scFv Inhibition of Interferon Gamma-Induced MHC Class II Expression

A flow cytometric assay was implemented to identify fully human IgG antibodies, or fragments thereof, capable of blocking the expression of IFNγ-induced MHC class II molecules. Following the plating of Me67.8 cells, 5 ng/ml recombinant human IFNγ was added to cultures in the presence of various concentrations of candidate fully human anti-IFNγ monoclonal antibodies. Following 48 h in culture, cells were stained with fluorescently labeled anti-human MHC class II antibody (HLA-DR) and analyzed using a FACSCalibur®. Thus, the IC50 (where 50% of the IFNγ-induced MHC class II expression is inhibited, i.e., 50% inhibitory concentration), for each candidate antibody is measured.

Purified fully human scFv were produced as described above. The effect of selected scFv on IFNγ-induced MHC class II expression on melanoma cells was evaluated using the flow cytometric cell-based assay described above. These scFv inhibited IFNγ-induced MHC II expression on melanoma cells (FIG. 22).

Example 16

Reformatting scFv into IgG Format

The VH and VL sequence of selected scFv were amplified with specific oligonucleotides introducing a leader sequence and a HindIII restriction site at the 5′ end. An ApaI site was introduced at the 3′ end of the heavy whereas an AvrII and a BsiWI site were introduced at the 3′ end of the lambda or kappa light chain sequences, respectively. The amplified VH sequences were digested HindIII/ApaI and cloned into the pCon_gamma 1 expression vector (LONZA, Basel, Switzerland). The amplified VL lambda sequences were digested HindIII/AvrII and cloned into the pCon_lambda2 expression vector and the amplified VL kappa sequences were digested HindIII/BsiWI and cloned into the pCon_kappa expression vector (LONZA, Basel, Switzerland). The constructions were verified by sequencing before transfection into mammalian cells.

The VH and VL cDNA sequences in their appropriate expression vectors were transfected into mammalian cells using the Fugene 6 Transfection Reagent (Roche, Basel, Switzerland). Briefly, Peak cells were cultured in 6-well plates at a concentration of 6×105 cells per well in 2 ml culture media containing fetal bovine serum. The expression vectors, encoding the candidate VH and VL sequences, were co-transfected into the cells using the Fugene 6 Transfection Reagent according to manufacturer's instructions. One day following transfection, the culture media was aspirated, and 3 ml of fresh serum-free media was added to cells and cultured for three days at 37° C. Following three days culture period, the supernatant was harvested for IgG purified on protein G-Sepharose 4B fast flow columns (Sigma, St. Louis, Mo.) according to manufacturer's instructions. Briefly, supernatants from transfected cells were incubated overnight at 4° C. with ImmunoPure (G) IgG binding buffer (Pierce, Rockford Ill.). Samples were then passed over Protein G-Sepharose 4B fast flow columns and the IgG consequently purified using elution buffer. The eluted IgG fraction was then dialyzed against PBS and the IgG content quantified by absorption at 280 nm. Purity and IgG integrity were verified by SDS-PAGE.

Example 17

IgG Inhibition of Interferon Gamma Biological Activity

Two scFv, AE1-4-R3-P2E4 (2E4) and A2-AD1-R4P1A9 (1A9), that had confirmed inhibitory activity against hIFNγ in functional assays were reformatted into IgG as described in Example 16 and tested in the interferon gamma-induced reporter gene assay described in Example 14. The results shown in FIG. 23 indicate that in a IgG format both 1A9 and 2E4 could neutralize the activity of hIFNγ with IC50 of 42 nM and 10 nM, respectively whereas a negative control IgG (NI-0701) had no effect in this assay. Thus these two candidates isolated from both synthetic and natural diversity libraries could be reformatted into full IgG and feature neutralizing activity against the selected target.

Example 18

Development of a Pharmacokinetic Assay for the Detection of 5E3 in Mouse Serum

Two scFv candidates AD15E3R3P1A4 and AD25E3R3P1G11 that bind specifically to mouse monoclonal antibody 5E3 (FIG. 19) were reformatted into full human IgG as described in Example 16. The specificity of the corresponding IgGs DA4 and G11 was confirmed in ELISA against mouse 5E3 and a chimeric version of this monoclonal antibody in which the mouse variable regions have been fused to rat constant IgG regions. The results shown in FIG. 24 demonstrate that the IgG DA4 and G11 are specific for the variable region of 5E3 as they bind to both mouse and chimeric rat 5E3 and not to mouse and rat isotype controls. These two monoclonals antibodies were used to develop an assay for the quantification of 5E3 in mouse serum for pharmacokinetic studies. Several dilutions of mouse serum were spiked with 5 μg/ml of mouse 5E3 antibody and serially diluted in such a way that serum concentration was maintained constant throughout the dilution series. Maxisorb plates (Nunc, Denmark) were coated overnight with 1 μg/ml of IgG DA4 or IgG G11. After blocking with PBS; 1% BSA dilution series of the spiked serum preparations were added to the wells. After incubation and washing, the signal was revealed using an anti-mouse Kappa light chain monoclonal antibody coupled to horse radish peroxydase (HRP) and a fluorescent substrate (Amplex red; Invitrogen). The results show that both antibodies can be used to specifically detect the mouse monoclonal 5E3 antibody in mouse serum (FIG. 25). The detection limit of mouse 5E3 in serum was about 200 ng/ml and the assay was not significantly affected by the serum concentration indicating that IgG DA4 and IgG G11 are highly specific for mouse 5E3 and do not bind to other mouse immunoglobulin. These experiments demonstrate that highly specific anti-idiotypic antibodies could be isolated from the natural or synthetic libraries AE1 and AD1.

Example 19

Phage Selection Using Libraries Containing CDRH3 Diversity Captured from Naïve and Immunized Mice

The MnA, MiB and MiC libraries described in Examples 8 and 9 were used in parallel for phage selections against hIFNγ following the procedure described in Example 11. During the selection process a similar enrichment of phage was observed (FIG. 26).

scFv Expression in Microtiter Plate Format:

Single clones were picked into a microtiter plate containing 150 μl of 2×TYAG media (2% glucose) per well and grown at 37° C. (100-120 rpm) for 5-6 h. Plates were centrifuged at 280 rpm, the medium discarded and the cell pellets resuspended in 100 μl of 2×TYA medium containing 1 mM IPTG. The plates were incubated overnight at 30° C. with shaking (100 rpm). Following growth, plates were centrifuged at 3,200 rpm for 10 min and the supernatant carefully transferred to a plate containing 2× concentrated PBS containing 5% skimmed milk powder for blocking.

scFv ELISA:

ELISA plates (Maxisorb, NUNC) were coated overnight with 2 μg/ml hIFNγ in PBS. Control plates were coated with 2 μg/ml recombinant BSA (Sigma). Plates were then blocked with 3% skimmed milk/PBS at room temperature for 1 h. Plates were washed 3 times with PBS 0.05% Tween 20 before transferring the pre-blocked scFv supernatants and incubation for one hour at room temperature. Plates were then washed 3 times with PBS 0.05% Tween 20. 50 μl of 3% skimmed milk/PBS containing (HRP)-conjugated anti-cMyc antibody (diluted 1:5,000) to each well. Following incubation at room temperature for 1 hr, the plates were washed 5 times with PBS 0.05% Tween 20. The ELISA was then revealed by adding 50 μl of Amplex Red (Invitrogen). Fluorescence intensity was measured at 590 nm upon excitation at 530 nm. The frequency of hits giving a signal of half the intensity of the control A6 clone was evaluated after each round of selection for the three libraries (FIG. 27). The hit rate obtained with the MiB library was dramatically higher compared to the two other libraries and the average level of signal was superior for the clones derived from the MiB library, indicating that higher affinity scFv were enriched (FIG. 28). In order to confirm this observation, positive clones were sequenced, expressed in larger scale and purified to be tested in dose response binding experiments according to Example 13. The scFv derived from the MiB library all had a higher apparent affinity for hIFNγ than those isolated from the naïve MnA library (FIG. 29). The results indicate that the CDRH3 repertoire from mice immunized with a protein could be captured into a human antibody framework context in a productive way to generate at higher frequency high affinity human antibody fragments. Libraries generated using the present invention thus represent a powerful mean of generating antibodies with therapeutic potential.

OTHER EMBODIMENTS

While the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

What is claimed is:

1. A method for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain comprising a plurality of complementarity determining region 3 (CDR3) sequences isolated separately from the immunoglobulin variable domain repertoire from a mammalian species.

2. A method for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain comprising a plurality of complementarity determining region 3 (CDR3) sequences isolated separately from the immunoglobulin variable domain repertoire from a non-human mammalian species.

3. A method for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain comprising a plurality of complementarity determining region 3 (CDR3) sequences isolated separately from the immunoglobulin variable domain repertoire from a human.

4. The method of claim 1, the method comprising:

(a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct human immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence comprising a first framework region (FR1), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FR1 and FR2 regions are interspaced by a complementarity determining region 1 (CDR1), the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a stuffer nucleic acid sequence comprising at least two Type IIs restriction enzyme recognition sites interspaced by a random nucleic acid sequence;

(b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 3 (CDR3) sequences isolated from the mammalian species immunoglobulin repertoire wherein each of the plurality of diversified nucleic acid sequences comprises a Type IIs restriction enzyme recognition site at each extremity;

(c) digesting each of the plurality of nucleic acid sequences encoding the CDR3 regions using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (b) and digesting the stuffer nucleic acid sequence of step (a) from the Acceptor Framework using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (a); and

(d) ligating the digested nucleic acid sequences encoding the CDR3 regions or the amino acid sequences of step (c) into the digested Acceptor Framework of step (c) such that the FR3 and FR4 regions are interspaced by the nucleic acid sequences encoding the CDR3 region or the amino acid sequence that can fulfill the role of a CDR3 region and a complete immunoglobulin variable domain encoding sequences that do not contain the Type IIs restriction enzyme recognition sites of steps (a) and (b) are restored.

5. The method of claim 4, wherein step (b) is performed by amplifying the CDR3 sequence from a mammalian species using oligonucleotide primers containing a Type IIs restriction site.

6. The method of claim 5, wherein the oligonucleotide primer is designed to enhance compatibility between the mammalian CDR3 sequence and the Acceptor Framework encoding a human immunoglobulin variable domain.

7. The method of claim 6, wherein the oligonucleotide primer is designed to modify a nucleic acid sequence at a boundary of the mammalian CDR3 sequence to produce a compatible cohesive nucleotide sequence in the Acceptor Framework encoding a human immunoglobulin variable domain.

8. The method of claim 5, wherein step (b) is performed by amplifying the CDR3 sequence from a non human species using oligonucleotide primers containing a FokI IIs restriction site.

9. The method of claim 2, wherein the non-human species is non-human primate, rodent, canine, feline, sheep, goat, cattle, horse, a member of the Camelidae family, llama, camel, dromedary, or pig.

10. The method of claim 4, wherein the Type IIs restriction enzyme recognition sites of step (a) and step (b) are recognized by a different Type IIs restriction enzyme.

11. The method of claim 10, wherein the Type IIs restriction enzyme recognition sites are BsmBI recognition sites, BsaI recognition sites, FokI recognition sites or a combination thereof.

12. The method of claim 4, wherein the diversified nucleic acid sequences encoding CDR3 sequences encode heavy chain CDR3 (CDR H3) sequences.

13. The method of claim 4, wherein the diversified nucleic acid sequences encoding CDR3 sequences encode light chain CDR3 (CDR L3) sequences.

14. The method of claim 4, wherein the Acceptor Framework nucleic acid sequence comprises a human heavy chain variable gene sequence selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51.

15. The method of claim 4, wherein the Acceptor Framework nucleic acid sequence comprises a human kappa light chain variable gene sequence.

16. The method of claim 15, wherein the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3-15, and VK3-20.

17. The method of claim 4, wherein the Acceptor Framework nucleic acid sequence comprises a human lambda light chain variable gene sequence.

18. The method of claim 17, wherein the human lambda light chain variable gene sequence is selected from VL1-44 and VL1-51.

19. The method of claim 4, wherein the plurality of Acceptor Framework nucleic acid sequences comprises a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.

20. The method of claim 4, further comprising the steps of (e) cloning the library of nucleic acids encoding immunoglobulin variable domains of step (d) into an expression vector and (f) transforming the expression vector of step (e) into a host cell and culturing the host cell under conditions sufficient to express a plurality of immunoglobulin variable domain encoded by the library.

21. The method of claim 20, wherein the host cell is E. coli.

22. The method according to claim 20, wherein the expression vector is a phagemid or a phage vector.

23. A method for producing a collection of nucleic acids, wherein each nucleic acid encodes a human immunoglobulin variable domain comprising a plurality of complementarity determining region 3 (CDR3) sequences isolated separately from immunoglobulin variable domains from an immunized non-human mammal.

24. The method of claim 23, the method comprising:

(a) providing a plurality of Acceptor Framework nucleic acid sequences encoding distinct human immunoglobulin variable domains, each Acceptor Framework nucleic acid sequence comprising a first framework region (FR1), a second framework region (FR2), a third framework region (FR3), and a fourth framework region (FR4), wherein the FR1 and FR2 regions are interspaced by a complementarity determining region 1 (CDR1), the FR2 and FR3 regions are interspaced by a complementarity determining region 2 (CDR2), and the FR3 and FR4 regions are interspaced by a stuffer nucleic acid sequence comprising at least two Type IIs restriction enzyme recognition sites interspaced by a random nucleic acid sequence;

(b) providing a plurality of diversified nucleic acid sequences encoding complementarity determining region 3 (CDR3) sequences isolated from the immunized non-human mammal wherein each of the plurality of diversified nucleic acid sequences comprises a Type IIs restriction enzyme recognition site at each extremity;

(c) digesting each of the plurality of nucleic acid sequences encoding the CDR3 regions using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (b) and digesting the stuffer nucleic acid sequence of step (a) from the Acceptor Framework using a Type IIs restriction enzyme that binds to the Type IIs restriction enzyme recognition site of step (a); and

(d) ligating the digested nucleic acid sequences encoding the CDR3 regions or the amino acid sequences of step (c) into the digested Acceptor Framework of step (c) such that the FR3 and FR4 regions are interspaced by the nucleic acid sequences encoding the CDR3 region or the amino acid sequence that can fulfill the role of a CDR3 region and a complete immunoglobulin variable domain encoding sequences that do not contain the Type IIs restriction enzyme recognition sites of steps (a) and (b) are restored.

25. The method of claim 24, wherein step (b) is performed by amplifying the CDR3 sequence from the immunized non-human mammal using oligonucleotide primers containing a Type IIs restriction site.

26. The method of claim 25, wherein the oligonucleotide primer is designed to enhance compatibility between the mammalian CDR3 sequence and the Acceptor Framework encoding a human immunoglobulin variable domain.

27. The method of claim 26, wherein the oligonucleotide primer is designed to modify a nucleic acid sequence at a boundary of the mammalian CDR3 sequence to produce a compatible cohesive nucleotide sequence in the Acceptor Framework encoding a human immunoglobulin variable domain.

28. The method of claim 25, wherein step (b) is performed by amplifying the CDR H3 sequence from the non-human mammal using oligonucleotide primers containing a FokI IIs restriction site.

29. The method of claim 24, wherein the non-human mammal is non-human primate, rodent, canine, feline, sheep, goat, cattle, horse, llama, camel, dromedary, or pig.

30. The method of claim 24, wherein the Type IIs restriction enzyme recognition sites of step (a) and step (b) are recognized by a different Type IIs restriction enzyme.

31. The method of claim 30, wherein the Type IIs restriction enzyme recognition sites are BsmBI recognition sites, BsaI recognition sites, FokI recognition sites or a combination thereof.

32. The method of claim 24, wherein the diversified nucleic acid sequences encoding CDR3 sequences encode heavy chain CDR3 (CDR H3) sequences.

33. The method of claim 24, wherein the diversified nucleic acid sequences encoding CDR3 sequences encode light chain CDR3 (CDR L3) sequences.

34. The method of claim 24, wherein the Acceptor Framework nucleic acid sequence comprises a human heavy chain variable gene sequence selected from VH1-2, VH1-69, VH1-18, VH3-30, VH3-48, VH3-23, and VH5-51.

35. The method of claim 24, wherein the Acceptor Framework nucleic acid sequence comprises a human kappa light chain variable gene sequence.

36. The method of claim 35, wherein the human kappa light chain variable gene sequence is selected from VK1-33, VK1-39, VK3-11, VK3-15, and VK3-20.

37. The method of claim 24, wherein the Acceptor Framework nucleic acid sequence comprises a human lambda light chain variable gene sequence.

38. The method of claim 37, wherein the human lambda light chain variable gene sequence is selected from VL1-44 and VL1-51.

39. The method of claim 24, wherein the plurality of Acceptor Framework nucleic acid sequences comprises a mixture of at least one variable heavy chain (VH) Acceptor Framework nucleic acid sequence and at least one variable light chain Acceptor Framework nucleic acid sequence.

40. The method of claim 24, further comprising the steps of (e) cloning the library of nucleic acids encoding immunoglobulin variable domains of step (d) into an expression vector and (f) transforming the expression vector of step (e) into a host cell and culturing the host cell under conditions sufficient to express a plurality of immunoglobulin variable domain encoded by the library.

41. The method of claim 40, wherein the host cell is E. coli.

42. The method according to claim 40, wherein the expression vector is a phagemid or a phage vector.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class: