Patent application title:

CELLOMICS SYSTEM

Publication number:

US20150231635A1

Publication date:
Application number:

14/640,471

Filed date:

2015-03-06

Abstract:

In labeling a cell, and separating and collecting the cell according to a degree of the labeling using a cell separator, effects on the cell is minimized and the use of the collected cell is facilitated, thereby, when labeling a cell, the cell is labeled in the state where interaction of each cell is retained. In the labeling, a specific labeling material present on a surface of a target cell is taken in the cell via a transporter, and the cell is dispersed one by one to separate the same with a cell separator. Immediately after the separation, the cell is put in a solution not containing the specific labeling substance to remove the specific labeling substance taken in the cell. This series of steps is continuously conducted with a cell separation chip.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

B01L7/50 »  CPC main

Heating or cooling apparatus ; Heat insulating devices Cryostats

A01N1/0284 »  CPC further

Preservation of bodies of humans or animals, or parts thereof; Preservation of living parts; Physical preservation processes Temperature processes, i.e. using a designated change in temperature over time

B01L7/00 IPC

Heating or cooling apparatus ; Heat insulating devices

A01N1/02 IPC

Preservation of bodies of humans or animals, or parts thereof Preservation of living parts

Description

SEQUENCE LISTING

The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-WEB and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Mar. 6, 2015, is named sequence.txt and is 6 KB.

FIELD OF THE INVENTION

The present invention relates to promotion of researches in the field of cellomics for comprehensively understanding vital functions as those of a cell assembly, and more particularly to measurement of expression of genes in discrete cells in the state where functions of each cell structure are preserved, namely in the state where interactions between cells are preserved.

BACKGROUND OF THE INVENTION

With the active researches in the fields of genomics or proteomics from the last decade of 20th century up to this day, data has been accumulated concerning types and quantities of genes in various cell groups each regarded as an assembly of cells. Especially, accumulation of data concerning precise comparisons among genome sequences different from species to species, or frequencies of expression of various genes in organs and tissues in one species has reached a level allowing sketchy descriptions of the life process. In the future, various active researches will be made not only for accumulation of data, but also for development of more advanced analysis methods for acquiring data allowing clarification of the life process at a higher level. This clarification of the life process at a higher level is a research scheme called cellomics, and different from the researches using homogeneous cell systems basically prepared by the cloning technique in the past, complex systems each formed with multicellular aggregate each having different functions are treated as objects for research in the field of cellomics.

For promotion of researches in the field of cellomics for comprehensively understanding vital functions as those of a cell assembly, it is necessary to measure expression of genes in discrete cells in the state where functions of each cell structure are preserved, namely in the state where interactions between cells are preserved. To achieve this objective, it is necessary to develop a technique for measuring local expressions of all concerned genes at a level of a cell, which has been impossible in the prior art.

For instance, the genes involved in the circadian rhythm have been identified, and the relation between the cycle and external factors (impetuses) such as insolation has been clarified. The researches as described above are generally carried out using DNA micro-arrays or kinetic PCR which is more quantitative (sometimes called as real time PCR). It is not too much to say, however, that there are few cases, excluding the cases fluctuating with certain cycles such as the circadian rhythm, in which precise data can be obtained from data concerning frequency of gene expressions. The main reason for this is that the relation between the sensitivity and reproducibility has not sufficiently be clarified in the researches using DNA micro-arrays.

To obtain data concerning a frequency of expression of a gene, mRNAs extracted from at least several hundreds of cells are required. By amplifying these mRNAs in the form of cRNAs or cDNAs, the mRNAs can be finally detected in the current situation. If the sensitivity is just insufficient, it is simply required to further amplify the mRNAs in the form of cRNAs or cDNAs, but in the quantitative analysis, sometimes amplifying operations cause errors. Even if it is tried to analyze gene expression (including protein translation) in discrete cells in the tissue, it is impossible to obtain a sufficient quantity of amplification products from a discrete cell with the conventional amplifying operation using, for instance, a DNA micro-array, and even when amplification is forcefully performed to a level allowing for analysis with a DNA micro-array, it is impossible to obtain data reflecting the actual abundance ratio of mRNAs.

Researchers in this field are not satisfied with the knowledge currently available in the fields of genomics and proteomics, and the many researchers are aware of the importance of analysis of a complex system formed with multiple cells at the “cell” level, namely the potential importance of cellomics described above. Further, as an expected application of the cellomics for industrial purposes, many researchers point out the importance of development of the measuring technique at the “cell” level available as an alternative for animal experiments in relation to recent developments of genomic sciences, acceleration of drug developments, and development of pharmaceuticals and chemicals which are safer as compared to those currently available in the market. At present, a vast number of laboratory animals such as guinea pigs or crab-eating macaque are used in experiments for testing the safety or effects of chemical substances such as pharmaceuticals or cosmetics.

However, it has been impossible to overcome the differences between humans and other animals, now the tendency for abolishing the animal experiments has been becoming stronger. When the circumstances as described above are taken into consideration, the preparation, along with its excellent reproducibility, of cell groups each having the minimal functions on the basis of a cell, and of a human cell, and also development of a testing system using the cell groups are conceivably essential to the industries and to realization of safer and more comfortable life of mankind. The cellomics enables researches and development of the technique for realization of the objects as described above.

SUMMARY OF THE INVENTION

In the cellomics, a cell is grasped and understood in relation to a cell assembly, and the understanding and knowledge are applied to the industrial utilization as described above, and the cellomics is not complete only with establishment of discrete techniques, and for promoting industrial utilization of cell measurement in a multicellular organism, it is necessary to build up a system satisfying the following three requirements:

1) technique for separating a specified cell,

2) technique for culturing the separated cell, and

3) analysis (or utilization) of the cultured cell.

Herein the “technique for separating a specified cell” means separation of cells involving in a specific function of an organ tissue such as a tissue stem cell. There is a case where the separated cell is immediately analyzed, and in this case, a technique is required for destructing the separated cell according to a prespecified procedure and quantitatively analyzing the mRNA or proteins included in the cell. Assuming that the cell size is about 10 μm, a means for analysis corresponding to the size is required.

Naturally the technique for achieving the object above is important, but only a passive analysis of a separated cell is insufficient for implementing the cellomics enabling breakthrough from the omics researches in the prior art. A key for development of cellomics is establishment of active analysis of a separated cell. The technique for active analysis of a separated cell as used herein indicates a cell networking technique for forming a desired pseudo tissue by placing the separated cell at a specified position or a technique making it possible for a researcher to give an electrical or chemical impetus to each discrete cell in a cell network organized by the researcher for obtaining a response from the cell. For achieving this objective, it is necessary to analyze a cell without killing the cell. Further it is necessary to establish a technique enabling analysis of proteins and mRNAs in each discrete cell in a cell network artificially constructed to clarify the differences between cells or distribution of the substances in each cell.

For achieving the cellomics as described above, the present inventors have made efforts for theoretical research and development of a technique allowing constitutively forming and measuring a cell network at a level of “one cell” on a microchip by making use of micro-fabrication of a particular cell separated from a tissue, and invented a cellomics system including a cell culture chip, measuring devices and the like. Further by using the cellomics system, the inventors found the fact that responses of cell assemblies substantially vary according to differences in “assembly network patterns” such as a spatial position, a type, and the number of the cell assemblies, and recognized the importance of the co-working phenomenon of a “cell assembly/cell network” one rank higher than the simple “cell” level.

The inventors anticipated, based on the achievements as described above, the possibility of preparation of a cell assembly (network) expectedly allowing responses similar to those by actual organ tissues, which can hardly be measured with “cell lines belonging to a single species”, by controlling “patterns” of the cell assembly/cell network according to the necessity. Therefore the present inventors propose herein the screening technique based on the “cell network” cultured by means of cell-by-cell control of the “patterns” of this cell assembly as the “on-chip cellomics” measuring technique.

Outline of the cellomics system according to the present invention is shown in FIG. 1. The present invention provides a general system including the broad items as described below, and researchers are required to carry out a series of operations according to the item order as described below.

1) A method and an apparatus for separating a target cell without giving substantial damages to the cell: The method also includes the steps of reversibly labeling a target cell, separating the cell, and reproducing the original cell by removing the labeled material.

2) A method and apparatus for immediately freezing and storing the separated cell according to the necessity

3) A method of and an apparatus for handling a cell: Namely a method of and an apparatus for freely handling a cell and inserting the cell into a cell culture microchip in the next step.

4) A method of and apparatus for culturing each separated cell discretely for a long time: This technique is required to allow for not only a long time incubation of a single cell but also constitutive construction of and measurement for a cell network at a “single cell level” on a microchip.

5) A method of an apparatus for acquiring information from an incubated cell or a network-constructed cell: This technique includes a method of and an apparatus for giving a stimulus to a cell network by adding a stimulating substance to a specified cell in the cell network, or by providing an electrode on a chip to stimulate a cell, and also a method of and an apparatus for measuring a response to a stimulus as an electric signal. Further the technique includes a method and an apparatus for measuring genes and proteins expressed in a cell. For achieving the objective as described above, either a method and an apparatus for destroying a cell and measuring the contents of the cell or a method of and an apparatus for acquiring information without killing the cell are employed according to the necessity.

Many methods for analysis and separation have been proposed and put into practical use in the field of cell researches and medical examination. For instance, for separation of a cell, flow cytometer has been developed and an apparatus for optically separating a cell is now available. For measurement of a separated cell, there have been developed the DNA micro-array technique, the in situ hybridization technique for detecting distribution of mRNA expressed in each discrete cell using a tissue fragment as a sample, or the immunohistochemistry for detecting distribution of proteins, and these techniques are now used for analyzing expression of a particular cell in a tissue. These techniques are used for analyzing functions of a cell or for differentiating a normal tissue from a cancer or tumor tissue, and therefore are used for screening a cancer.

These techniques have made great contributions to medical researches and services, however, when the techniques are viewed as those based on the cellomics system, the techniques are still insufficient in the points that the techniques do not systemize a series of steps from cell separation to detection, can not be used for active measurement, and can not be used for quantitative measurement for distribution of various substances in a cell.

An object of the present invention is to develop the researches on a cell assembly or a cell network constitutively constructed in the past into a pharmaceutical and medical screening system. The present system has the potentials of not only realization of a novel measurement technique at a cell level based on new understandings and recognition of the importance of “patterns” in a “cell network” not available so far, but also provision of new understandings concerning a life system based on the findings described above. In addition, if the cellomics system enabling measurement of a cell network base in place of animal experiments is successfully industrialized, high speed and low cost measurement using only a small number of samples will be possible not only in the fundamental researches but also in the field of screening technique for medical examination and food sanitary inspection, which would make great contributions to our health control.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a diagram for illustrating a concept for a cellomics system according to the present invention;

FIG. 2 is a view showing general configuration of a centrifugal separator for cell separation in Example 1 of a first embodiment of the present invention;

FIG. 3 is a plan view schematically showing configuration of a centrifugal chip in Example 2 of the first embodiment advantageously applicable to the centrifugal separator in Example 1;

FIG. 4 is a perspective view schematically showing configuration of a reservoir section of the centrifugal chip 100 shown in FIG. 3;

FIG. 5 is a view schematically showing configuration of the centrifugal chip 100 in Example 3 of the first embodiment;

FIG. 6 is a perspective view schematically showing a separation chamber 70 in Example 3;

FIG. 7 is a view schematically showing the situation in which a separated materials are moving in a separation chamber 70 where two flow paths converge;

FIG. 8 is a view showing the situation in which a separated material is moving in a separation chamber 17 where three flow paths converge;

FIG. 9 is a flowchart showing processing steps in a method of separating and collecting a cell in a second embodiment;

FIG. 10 is a view showing general characteristics in a case where a cell with the fluorescence intensity of 5000 or more is separated with a cell separator;

FIG. 11 is a histogram plotted with the number of cells taking a fluorescent labeled material against the fluorescence intensity;

FIG. 12 is a graph showing culture time of a cell on the horizontal axis and the separated cells with the fluorescence intensity of 500 or more on the vertical axis;

FIG. 13 is a plan view schematically showing an example of a cell separation chip adapted to implementation of a protocol for cell separation according to a second embodiment;

FIGS. 14(A) to 14(D) are cross-sectional views of the cell separation chip shown in FIG. 13 taken along the lines A-A, B-B, C-C, and D-D and viewed in the direction indicated by the arrows at respective positions;

FIG. 15 is a plan view schematically showing an example of a cell separator with a plurality of cell separation chips illustrated in FIG. 13 and FIG. 14 mounted thereon;

FIG. 16 is a view for illustrating an optical system of the cell separation chip;

FIG. 17 is a view showing a process flow of specifically labeling a cell surface antigen with the β-phycoerythrin-modified RNA aptamer for separating a cell according to a third embodiment of the present invention;

FIG. 18 is a diagram showing an effect of removal of the β-phycoerythrin-modified RNA aptamer used for identifying a cell by adding nuclease;

FIG. 19 is a diagram indicating the fact that a cell obtained after the β-phycoerythrin-modified RNA aptamer is removed can be cultured;

FIG. 20 is a diagram showing the generally known water phases;

FIGS. 21(A) and 21(B) are cross-sectional views illustrating outlines of a cell freezer and a method of freezing a cell according to a fourth embodiment of the present invention respectively;

FIG. 22(a) is a plan view showing a cell culture chip 22100 advantageously used in Example 1 of a fifth embodiment of the present invention, and FIG. 22(b) is a cross-sectional view showing the cell culture chip 22100 taken along the line A-A in FIG. 22(a) and viewed in the direction indicated by the arrow;

FIG. 23(a) is a conceptual diagram for illustrating configuration of a system for distributing a cell to the cell culture chip 22100 in Example 2, and FIG. 23(b) is a cross-sectional view showing the state in which the cell has been placed in a hydrophilic area 2204 of the cell culture chip 22100;

FIG. 24 is a conceptual diagram illustrating system configuration in Example 3 in which the function for exchanging a droplet 2215 enveloping a cell 2212 with a new culture fluid in the system configuration in Example 2 is emphasized;

FIG. 25 is a conceptual diagram showing system configuration in Example 4 in which the function for recovering a cell from inside of the droplet 2215 enveloping a prespecified cell 2212 in the system configuration shown in Example 2 is emphasized;

FIG. 26(a) is a plan view showing another configuration of the cell culture chip 22100 in Example 5 advantageously applicable to a fifth embodiment of the present invention; FIG. 26(b) is a cross-sectional view showing the cell culture chip 22100 above taken along the line A-A in the plan view and viewed in the direction indicated by the arrow; and FIG. 26(C) is a view illustrating a method of forming a droplet;

FIGS. 27(a) and 27(b) are views showing a tip of a pipet having two flow paths;

FIG. 28(a) is a perspective view showing a substrate applicable to the droplet manipulation according to a sixth embodiment of the present invention, FIG. 28(b) is a perspective view showing the substrate in which discrete droplets to be reacted are placed on a surface of the substrate, and FIG. 28(c) is a perspective view schematically showing the substrate during the droplet manipulation;

FIGS. 29(a) and 29(b) are views each illustrating a procedure for charging a droplet in a droplet holding area, FIG. 29(a) is a view showing the initial state in the process for charging the droplet, and FIG. 29(b) is a view showing the state in which the charged droplet has been removed to the droplet holding area;

FIG. 30(a) is a cross-sectional view showing the relation between an electrode portion for charging in the droplet holding area of a substrate 28100 and a switchboard 2874, and FIG. 30(b) is a cross-sectional view showing the relation between an electrode portion for discharging in the droplet holding area of the substrate 28100, and the switchboard 2874;

FIG. 31 is a view schematically showing the configuration in which a droplet including a cell 2862 is formed at a tip of a pipet 2861, and the cell is distributed, while optically monitoring, to the droplet holding area of the substrate 28100;

FIG. 32 is a view schematically showing the state in which a droplet 28105 is being transferred with a manipulation rod 28107 on a droplet transfer line shown in FIG. 28;

FIG. 33 is another view schematically showing the state in which a droplet 28105 is being transferred with a manipulation rod 28107 on a droplet transfer line shown in FIG. 28;

FIG. 34 is a view illustrating configuration and manipulation method for giving electric charge to a droplet;

FIG. 35 is a view for illustrating configuration and a manipulation method for controlling flight of a charged droplet 2858 to give an electric charge to a droplet;

FIG. 36(a) is a plan view showing the cell culture chip 36100 advantageously applicable in Example 1 of a seventh embodiment of the present invention, and FIG. 36(b) is a cross-sectional view showing the cell culture chip 36100 taken along the line A-A in the plan view and viewed in the direction indicated by the arrow;

FIG. 37 is a schematic diagram showing an outline of a device for controlling size of a droplet in Example 1;

FIG. 38 is a schematic diagram showing Example 2 in which size of each discrete droplet among a plurality of droplets on a substrate 3601 is controlled;

FIG. 39 is a schematic diagram showing Example 3 in which operations of forming two types of droplets on a substrate 3650, mixing the droplets to each other, and transferring the mixture droplet to a prespecified position can be easily performed;

FIG. 40 is a plan view schematically showing an example of a structure of a cell culture micro-array with an electrode according to Example 1 of an eighth embodiment of the present invention;

FIG. 41 is a cross-sectional view showing the cell culture micro-array shown in FIG. 40 taken along the line A-A and viewed in the direction indicated by the arrow;

FIG. 42 is a plan view showing Example 2 of the eighth embodiment;

FIG. 43 is a cross-sectional view showing the cell culture micro-array shown in FIG. 42 taken along the line B-B and viewed in the direction indicated by the arrow;

FIG. 44 is a plan view showing Example 3 in which a plurality of cell culture zones 4002 most important in the practical use are adjoined to each other and formed as a one-dimensional array;

FIG. 45 is a plan view schematically showing one example of a structure of a cell reconstituting device having a circuit between different types of cells according to Example 1 of a ninth embodiment of the present invention;

FIG. 46 is a view schematically showing a cross section of a cell reconstituting device shown in FIG. 45 taken along the line A-A and viewed in the direction indicated by the arrow, and also showing an optical system for forming a tunnel communicating between cell holding zones in the device as well as a control system for the optical system;

FIG. 47 is a plan view schematically showing an example of the cell reconstituting device having a circuit between different types of cells according to Example 2 of the ninth embodiment;

FIG. 48 is a view schematically showing a cross section of a cell reconstituting device shown in FIG. 47 taken along the line A-A and viewed in the direction indicated by the arrow, and also showing an optical system for forming a tunnel communicating between cell holding zones in the device as well as a control system for the optical system;

FIGS. 49(A) and 49(B) are waveform diagrams each showing a result of assessment for influences, in a case that a network consists of a oscillating myocardial cell and a neurocyte, when an electric stimulus is given to the neurocyte;

FIG. 50 is a plan view showing a different type cell bioassay chip in which cell holding zones are placed in the array state and the zones are correlated to each other;

FIGS. 51(A) to 51(D) are views each showing an example in which a cell is cultured on a cellulose membrane according to Example 1 of a tenth embodiment of the present invention, the cultured cells are recovered in the sheet state, and further a multi-layered cell sheet is formed;

FIG. 52(A) is a plan view showing a cell culture support body functioning as a support body for holding a cellulose sheet, FIG. 52(B) is a cross-sectional view showing the cell culture support above taken along the line A-A in FIG. 52(A) and viewed in the direction indicated by the arrow, and FIG. 52(C) is a cross-sectional view showing the cell culture support above taken along the line B-B in FIG. 52(A) and viewed in the direction indicated by the arrow;

FIG. 53(A) is a cross-sectional view corresponding to a view taking along the line A-A in FIG. 52 and viewed in the direction indicated by the arrow, illustrating the situation in which the cell sheet described in Example 1 is formed by using the substrate 51100 illustrated in FIG. 52, and FIG. 53(B) is a cross-sectional view showing the same situation taken along the line B-B and viewed in the direction indicated by the arrow;

FIG. 54(A) is a perspective view showing a cell culture micro-chamber according to Example 1 of an eleventh embodiment of the present invention, and FIG. 54(B) is a cross-sectional view showing the cell culture micro-chamber taken along the line A-A and viewed in the direction indicated by the arrow;

FIG. 55 is a plan view showing an example of a cell culture micro-chamber with a cell circuit formed thereon;

FIG. 56 is a cross-sectional view showing an example of a cell structure construct 5420 in which a circuit formed with a neural cell 5423 and a oscillating myocardial cell 5424 is fixed on a fibroblast sheet 5422 on a cellulose membrane 5421;

FIG. 57(A) is a perspective view showing the cell culture micro-chamber, and FIG. 57(B) is a cross-sectional view showing the cell culture micro-chamber shown in FIG. 57(A) taken along the line B-B and viewed in the direction indicated by the arrow;

FIG. 58 is a schematic view for illustrating a system in which a converging light is converted to heat with a micro-needle and an agarose gel film 5401 is processed with the heat;

FIG. 59 is a schematic view illustrating outline of the situation in which a groove between wells 5405 is formed on the agarose gel film 5401, during cell culture, with a micro-needle in the same way as that illustrated in FIG. 58;

FIG. 60 is a plan view schematically showing an example of a structure of a cardiac-myocyte-cell bioassay chip in Example 1 of a twelfth embodiment of the present invention;

FIG. 61 is a cross-sectional view showing the cardiac-myocyte-cell-bioassay chip shown in FIG. 60 taken along the line A-A and viewed in the direction indicated by the arrow;

FIG. 62 is a view showing a transmission microscope image accommodating oscillating myocardial cells in all of zones in the cardiac-myocyte-cell chip in Example 1;

FIG. 63 is a diagram showing a measuring result of the variation of palmic intervals in the cells in the cardiac-myocyte-cell chip;

FIG. 64 is a cross-sectional view showing an example of a structure of the cardiac-myocyte-cell bioassay chip in Example 4 with the cross section corresponding to that shown in FIG. 61;

FIG. 65 is a view illustrating an operation flow in a method of recovering and analyzing biological materials in a cell according to a thirteenth embodiment of the present invention;

FIG. 66(A) is an enlarged view schematically showing a tip section 6503 of a biological sample chip according to the thirteenth embodiment, while FIG. 66(B) is a perspective view schematically showing the biological sample chip according to the thirteenth embodiment;

FIG. 67 is a diagram showing a quantitative comparison of EpCAMs alternatively expressed in a cancerous focus cell in a cancerous colon tissue piece and in adjoining cells along the cancer focus cell line;

FIG. 68 is a schematic view showing the situation in which a plurality of PNAs having different sequences respectively labeled with nanoparticles of gold having different diameters are hybridizing at a tip section of the biological sample chip;

FIG. 69(A) is a schematic view showing a tip section of a biological sample chip measuring targets, and FIG. 69(B) is a cross-sectional view showing the tip section shown in FIG. 69(A) taken along the line A-A and viewed in the direction indicated by the arrow;

FIG. 70 is a view schematically showing a tip section 6503 of the biological sample chip in Example 4;

FIG. 71 is a view showing outline of a flow of operations for sampling mRNA which is an intracellular biological material in Example 1 of a fourteenth embodiment of the present invention;

FIG. 72 is a view showing a specific example of a needle 7143 used in Example 2;

FIG. 73 is a view showing outline of a method of sampling mRNA which is an intracellular biological material in Example 2;

FIG. 74(A) is a view showing a tip section 7153 of a needle which may be employed in Example 3, while FIG. 74(B) is a perspective view showing general configuration of the needle which may be employed in Example 3;

FIG. 75 is a schematic diagram showing a process flow for acquiring matured mRNAs in Example 1 of a fifteenth embodiment of the present invention;

FIG. 76 is a view illustrating outline of a process for converting, of the mRNAs obtained in steps 1 to step 5 shown in FIG. 75, only those having the substantially full length to cDNAs;

FIG. 77 is a schematic diagram showing an initial stage (step 1) of a process flow for acquiring matured mRNAs in Example 2;

FIGS. 78(a) to 78(c) are views each showing an example of configuration of a tip section of a capillary 7505 which can be used in Example 1 or in Example 2;

FIGS. 79(A) and 79(B) are views each illustrating a contrivance in an operation for inserting the capillary 7505 into a cell, for reducing damages to the cell;

FIG. 80(a) is a cross-sectional view schematically illustrating outline of a method of making a biological material separation chip which can be used in a biochemical material separator in Example 1 of a sixteenth embodiment of the present invention, while FIG. 80(b) is a cross-sectional view schematically showing one example of a structure of the completed biological material separation chip;

FIGS. 81(a) to 81(g) are views each schematically illustrating outline of a process for forming a substrate 8001 of a biological-material separation-chip 80100, and each view shows a cross section on the left side and a plan view corresponding to the cross section on the right side;

FIG. 82 is a view for illustrating an example of a biological-material separation by a biological material separation chip 80100 with a transporter 8012 fixed to a pore thereof;

FIG. 83 is a cross-sectional view showing outline of a biological material separator in Example 2 in which three sheets of biological material separation chips 80100 stored in a buffer suited to cell culture are combined with each other;

FIG. 84 is a perspective view showing an appearance of the biological material separator in Example 2 in which three sheets of biological material separation chips 80100 are combined with each other;

FIGS. 85(a) to 85(e) are views illustrating a procedure for preparing a biological material separation chip with a nucleic membrane fixed to a tip section of the capillary chip in Example 3;

FIG. 86 is a view illustrating a specific example in which an mRNA is separated and acquired by using the biological material separation chip in Example 3;

FIG. 87 is a view illustrating a simple method of realizing the example of triple structure in Example 2 with the glass capillary in Example 3;

FIG. 88 is a cross-sectional view showing outline of the relation between a cell chip in Example 1 of a seventeenth embodiment of the present invention and a cell fixed to a pore portion thereof;

FIGS. 89(a) to 89(g) are views each illustrating outline of a process for forming a cell fixing substrate 8801 in Example 1;

FIG. 90 is a cross-sectional view showing outline of the relation between the cell chip in Example 2 and a cell fixed to a pore portion thereof;

FIGS. 91(a) to 91(d) are views illustrating outline of a process for forming a cell fixing substrate 8841 in Example 2;

FIG. 92 is a conceptual diagram showing an example of a molecule measuring device based on detection of scattered light by making use of a resonance plasmon according to an eighteenth embodiment of the present invention;

FIG. 93 is a conceptual diagram showing a result of measurement with a photon counter 9206;

FIG. 94(A) is a cross-sectional view showing an example in which the measuring device based on the concept described in Example 1 is formed with a substrate and a chip-like detector placed on the substrate, while FIG. 94(B) is a plan view showing outline of the relation between the substrate of the measuring device and the chip-like detector placed on the substrate;

FIG. 95 is a cross-sectional view showing a measuring device in Example 3, in which a chip with a cell membrane including a transporter adhered thereon is placed on the chip-like detector of the measuring device described in Example 2;

FIG. 96 is a cross-sectional view showing a measuring device in which a tubule with a cell membrane including a transporter adhered thereon is placed outside the chip-like detector of the measuring device described in Example 1;

FIG. 97 is a perspective view conceptually showing a portion of a DNA chip in Example 1 of a nineteenth embodiment of the present invention;

FIG. 98 is a view schematically showing a more detailed relation among DNA probes fixed on each element 9701, a DNA piece prepared by hybridizing the DNA probe, and an AFM probe for detecting the DNA piece;

FIGS. 99(a) to 99(c) are views illustrating an effect of a pillar 9704 for speeding up the probe hybridization;

FIG. 100 is an explanatory view illustrating details of the effect provided by the pillar shown in FIG. 99;

FIG. 101 is a view schematically showing a position signal for an AFM probe 9760 obtained by scanning the chip 97100 shown in FIG. 97 with the AFM probe 9760 in the lateral direction;

FIGS. 102 (a) to 102(c) are views illustrating the effect of the pillar 9704 in Example 2 for speeding up probe hybridization;

FIG. 103 is an explanatory view illustrating details of the effect shown in FIG. 102;

FIG. 104 is a perspective view showing an example of configuration of an AFM cantilever well suited to the nineteenth embodiment of the present invention;

FIG. 105 is a view schematically showing each relation among DNA probes fixed on each element, a DNA piece obtained by hybridizing the DNA probe, and a scanning electron microscope detecting the DNA piece and the DNA probe in a twentieth embodiment of the present invention;

FIG. 106 is a view schematically showing a scanning electron microscope image obtained by two-dimensionally scanning the chip 97100 shown in FIG. 97 with a scanning electron microscope;

FIG. 107A is a plan view showing a DNA probe chip advantageously applicable to a twenty first embodiment of the present invention;

FIG. 107B is a cross-sectional view showing the DNA probe chip 107100 shown in FIG. 107A taken along the line A-A and viewed in the direction indicated by the arrow;

FIG. 108A is a view showing the state in which a sample liquid including a target polynucleotide is introduced on a surface of the DNA probe chip 107100 described with reference to FIGS. 107A and 107B;

FIG. 108B is a view showing the state in a step of process for forming a concentration gradient of the target polynucleotide on a surface of the DNA probe chip 107100;

FIG. 108C is a view showing the state in the next step for forming the concentration gradient as a cross-sectional view;

FIG. 109 is a diagram showing the effect in Example 2;

FIG. 110A is a view schematically showing the situation in which a probe 10712-3 and a target polynucleotide 10714 hybridize with each other using a root portion of the probe 10712-3 (a portion close to a surface of the DNA probe chip) as a nuclear for hybridization;

FIG. 110B is a view schematically showing the situation in which the probe 10712-3 and the target polynucleotide 10714 hybridize with each other using a tip portion of the probe 10712-3 (a portion close to a free edge of the DNA probe chip) as a nuclear for hybridization;

FIG. 111 is a diagram showing a comparison of hybridizations under the state of being formed a concentration gradient of the target polynucleotide on a surface of a substrate;

FIG. 112 is a view showing a case where the probe in Example 4 is used in the case shown in FIG. 110A showing the situation in which a probe 10712-3 and a target polynucleotide 10714 hybridize with each other using a root portion of the probe 10712-3 (a portion close to a surface of the DNA probe chip) as a nuclear for hybridization;

FIG. 113 is a view schematically showing the state in which an edge of a probe 11312-1 is configured based on the concept according to a twenty-second embodiment of the present invention;

FIG. 114 is a diagram showing a comparison between a result obtained when a sample with SEQ No. 11 is processed with a DNA probe chip with a probe with SEQ. No. 13 fixed to the 5′ terminal thereof (as indicated by a characteristic curve 113111) and a result obtained when the sample with SEQ No. 11 is processed with a DNA probe chip with SEQ. No. 13 fixed to the 3′ terminal thereof (as indicated by a characteristic curve 113113);

FIG. 115A is a plan view showing the DNA probe chip 115100 advantageously applicable in a twenty third embodiment of the present invention;

FIG. 115B is a cross-sectional view showing the DNA probe chip 115100 shown in FIG. 115(A) taken along the line A-A and viewed in the direction indicated by the arrow;

FIG. 115C is a cross-sectional view showing details of a probe fixing area of the DNA probe chip 115100 advantageously applicable to the twenty third embodiment;

FIG. 116A is a cross-sectional view showing the state in which a sample liquid containing a target polynucleotide is introduced onto a surface of the DNA probe chip;

FIG. 116B is a cross-sectional view showing the state in a first step of a process for forming a concentration gradient of the target polynucleotide from a solid-liquid interface between a surface of the DNA probe chip and of a sample liquid toward a sample liquid;

FIG. 116C is a cross-sectional view showing the state in the next step for forming the concentration gradient;

FIG. 117 is a diagram showing the effect in Example 2;

FIG. 118 is a view schematically showing the state in which an edge of the probe 11512-1 is configured based on the concept according to a twenty third embodiment of the present invention and is fixed to a surface of a pillar 11507;

FIGS. 119(A) and 119(B) are an enlarged plan view and a cross-sectional view, respectively, showing probe fixing areas 11504 according to a twenty fourth embodiment of the present invention and described in relation to FIG. 107 around one of the areas at a center;

FIGS. 120(A) and 120(B) are an enlarged plan view and a cross-sectional view, respectively, showing the probe fixing areas 11504 described in relation to FIG. 107 around one of the areas at a center;

FIG. 121A is a cross-sectional view showing the state in which a sample liquid containing a target polynucleotide is introduced onto a surface of the DNA probe chip 115100 described with reference to FIG. 107, FIG. 119, and FIG. 120;

FIG. 121B is a cross-sectional view showing the state where a first step of the process for forming a concentration gradient of a target polynucleotide from a solid-liquid interface between a surface of the DNA probe chip 115100 and a sample liquid toward the sample liquid is being performed;

FIG. 121C is a cross-sectional view showing the state in which the next step of a process for forming a concentration gradient is being performed;

FIGS. 122(A) to 122(F) are views illustrating the effect in Example 2;

FIG. 123 is a diagram showing an example of a result of examination concerning the fluorescence intensity by varying a period of time for capturing a target polynucleotide with reference to conditions of an electric field loaded to the DNA probe chip as parameters;

FIG. 124 is a cross-sectional view showing the DNA chip in Example 3 in which a surface area is increased by preparing a number of wells on the substrate;

FIG. 125 is a perspective view conceptually showing as a portion of the DNA chip in Example 1 of a twenty fifth embodiment of the present invention;

FIG. 126 is a conceptual diagram illustrating the situation in which the probe chip 12501 described with reference to FIG. 125 is being monitored with a scanning electron microscope;

FIG. 127 is a conceptual diagram illustrating a method of identifying an mRNA to which a labeling probe of gold nanoparticle is hybridized based on a correspondence between an SEM image and an element analysis image;

FIG. 128 is a view illustrating a concept of a biological sample measurement in Example 3 of a twenty sixth embodiment;

FIG. 129 is a view illustrating identification of positions and sizes of indexing particles 12841 to 12844 and assessment of a specific biological material to which a labeling particle hybridized to the indexing particles 12841 to 12844 is added;

FIG. 130(A) is a view schematically showing the indexing particles 12841 to 12844 in Example 3 and probes fixed to the surface of the particles respectively, FIG. 130(B) is a view schematically showing specific biological materials hybridizing to the probes with labeling particles added thereto, and FIG. 130(C) is a view schematically showing the situation in which the probes and the specific biological materials have been hybridized to each other;

FIG. 131(A) is a view schematically showing the indexing particles in Example 4 and probes respectively fixed to the surface of the particles, FIG. 131(B) is a view schematically showing the specific biological materials each with poly A hybridizing to probes, and FIG. 131(C) is a view schematically showing a poly T with a label hybridizing to poly A added thereto;

FIG. 132 is a view showing an operation for mixing particles, a sample, and a label, and a result that hybrids of DNA probes of the respective indexing particles, respective mRNAs, and poly-T gold nanoparticles have been obtained;

FIG. 133 is a view showing the on-going situation during a process potentially providing the more precise result as compared to the homogeneous reaction illustrated in FIG. 132 in which the indexing particles, sample mRNAs, and poly T-gold nanoparticles are reacted simultaneously;

FIG. 134(A) is a view schematically showing discrete probes fixed to the surfaces of the indexing particles like in Example 4 and Example 5, FIG. 134(B) is a view schematically showing the state in which, to specific biological materials with the poly A hybridizing to discrete probes added thereto are further added probes for a sequence in another portion of the same specific biological material, FIG. 134(C) is a view schematically showing an example in which synthetic oligonucleotides (20 to 50 bases) complementary to the probes having the sequence described above is labeled with gold nanoparticles (20 nm), and FIG. 134(D) is a view showing the state of the indexing particles, the samples, and the gold nanoparticle oligonucleotide, after hybridization;

FIGS. 135(A) to 135(D) are views illustrating an example of detection of multiple biological materials by means of the antigen-antibody reaction;

FIG. 136 is a view schematically showing the situation in which a separated band is formed by electrophoresis in Example 1 of a twenty seventh embodiment of the present invention;

FIGS. 137(A), 137(B), and 137(C) are views schematically showing melting and recovery of the separated band shown in FIG. 136 with heat;

FIGS. 138(A) and 138(B) are waveform diagrams each showing a dot 13611 of the separated band obtained as described above and a result of analysis of a solution obtained by PCR amplification before separation;

FIG. 139 is a schematic diagram showing configuration of a device for recovering a specific band separated by two-dimensional electrophoresis;

FIG. 140 is a view showing a recovery method in Example 2 which is different from a method of recovering a thermally melted gel of the electrophoretic spot section melted by being heated with converged light and a structure of a pipet used in the method;

FIG. 141(A) is a plan view showing a cell holding substrate 141100 advantageously applicable in a twenty eighth embodiment of the present invention, while FIG. 141(B) is a cross-sectional view of the cell holding substrate 141100 shown in FIG. 141(A) taken along the line A-A and viewed in the direction indicated by the arrow;

FIG. 142(A) is a conceptual diagram illustrating an example of configuration of a system for preparing a droplet containing a cell in a hydrophilic area 14103 of the cell holding substrate 141100 advantageously applicable to the twenty eighth embodiment, while FIG. 142(B) is a cross-section of a result of preparation of the droplet containing a cell in the hydrophilic area 14103 of the cell holding substrate 141100;

FIG. 143 is a perspective view showing outline of an example of a device for destroying a cell in a droplet 14115 on the substrate as a target as described with reference to FIG. 141 and FIG. 142;

FIG. 144 is a conceptual diagram illustrating a specific example of recovery of a biological material directly from a suspension of cell pieces in the droplet 14115 with the cell destroyed therein;

FIG. 145 is a waveform diagram showing an example of a migration pattern obtained by electrophoresis;

FIG. 146(A) is a plan view of a reaction substrate 146100 advantageously applicable in a twenty ninth embodiment of the present invention, while FIG. 146(B) is a cross-sectional view showing the reaction substrate 146100 shown in FIG. 146(A) taken along the line A-A and viewed in the direction indicated by the arrow;

FIG. 147(A) is a conceptual diagram illustrating an example of configuration of a system for preparing a droplet containing a material to be reacted to the hydrophilic areas 146031 and 146033 of the reaction substrate 146100 advantageously applicable in the twenty ninth embodiment, while FIG. 147(B) is a plan view showing a portion of the reaction substrate 146100 with the droplet containing a material to be reacted to the hydrophilic areas 146031 and 146033 of the reaction substrate 146100 formed thereon;

FIG. 148(A) is a perspective view showing outline of an example of a device for making two droplets 146151, 146152 formed on the reaction substrate 146100 as shown in FIG. 147(B) run into and react with each other, while FIG. 148(B) is a plan view schematically showing the situation in which the two droplets 146151, 146152 run into each other to form one droplet;

FIG. 149 is a waveform diagram showing change over time in fluorescence intensity obtained by monitoring the fluorescence intensity of a droplet 146153;

FIG. 150 is a plan view showing a example of the reaction substrate 146100 which may advantageously be used for spectroscopic measurement with a microspectroscope;

FIG. 151(A) is a plan view showing a measuring substrate 151100 advantageously applicable in Example 1 of a thirtieth embodiment of the present invention and a conceptual diagram showing a measuring system constructed with the measuring substrate as a basis, while FIG. 151(B) is a cross-sectional view showing the measuring substrate 151100 shown in FIG. 151(A) taken along the line A-A on the plan view of the measuring substrate 151100 and viewed in the direction indicated by the arrow;

FIG. 152 is a conceptual diagram illustrating an example of configuration of a system for preparing a droplet at a left edge of a hydrophilic line 15104 on the measuring substrate 151100 advantageously applicable in the thirtieth embodiment and also for measuring the droplet;

FIG. 153 is a characteristic diagram in which absorption of light measured in Example 1 is plotted;

FIG. 154(A) is a plan view showing a measuring substrate 151100 advantageously applicable in Example 2 and a conceptual diagram showing a measuring system configured with this measuring substrate, while FIG. 154(B) is a cross-sectional view showing the measuring substrate 151100 shown in FIG. 154(A) taken along the line A-A on the plan view of the substrate 151100 and viewed in the direction indicated by the arrow; and

FIG. 155 is a conceptual diagram illustrating an example of configuration of a system for preparing a droplet at a left edge of the hydrophilic line 15104, migrating the droplet with surface elastic wave, and measuring the migration.

DESCRIPTION OF THE PREFERRED EMBODIMENT

The present invention is described below with reference to specific embodiments, and the embodiments are independent from each other, and in a case where an embodiment has some connections with another embodiment, the relation is described, for instance, with reference to the related drawings.

(A) At first, a method of and a device for separating a target cell without any substantial damage thereto are described.

First Embodiment

Descriptions are provided below for a centrifugal chip and a centrifugation method enabling separation of a cell or a granule from a minute quantity of sample liquid by centrifugation as a first embodiment of the present invention.

In the first embodiment, a chip for centrifugation is attached to a rotary plate rotating around a rotary shaft. The chip for centrifugation includes flow paths for supplying a plurality of solutions having different specific gravities respectively onto a substrate, a separation chamber functioning as a separation area in which the flow paths converge, and a plurality of flow paths branching from the separation chamber. Reservoirs are provided at entrances and exits of all flow paths for supplying solutions having different specific gravities respectively to the flow paths, and in this configuration distances of all reservoirs at entrances to the flow paths from the rotary shaft are equal, and also liquid levels in reservoirs at exits from the plurality of flow paths branching from the separation chamber are equal to each other from the rotary.

Example 1

FIG. 2 is a view showing outline of a centrifugal separator according to a first embodiment of the present invention. In this figure, the reference numeral 1 indicates a rotary plate, and a space 2 is formed on a surface thereof for mounting a centrifugal chip according to the first embodiment. The centrifugal chip can easily be mounted to or dismounted from the space 2. The rotary plate 1 is rotated by a motor 3 at a prespecified rotational speed in the horizontal direction. The reference numeral 4 indicates a light source, which irradiates light onto a separation section of the centrifugal chip mounted on the rotary plate 1. The reference numeral 5 indicates a lens, which converges the light transmitted through the separation section of the centrifugal chip. The light converged by the lens 5 is reflected by a mirror 6, and the image is picked up by a high speed camera 7. The reference numeral 8 indicates a personal computer, which analyzes the separation section of the centrifugal chip photographed by the high speed camera 7 and computes a speed signal for the motor 3 to control a rotational speed of the motor 3.

In Example 1, a sample can be separated monitoring the separation state during centrifugation with the camera 7. Optical separation of a sample can be performed by monitoring a degree of separation with a monitor (not shown) equipped with the personal computer 8, or a controlling a rotational speed of the motor 3 with a program implemented in the personal computer 8. The observation is performed, for instance, as described below. For instance, the motor 3 is rotated at 1800 rpm and an image of the separation section of the centrifugal chip mounted on the space 2 is monitored with an optical system including the light source 4, lens 5, and camera 7. In this step, the rotational speed of the motor is controlled so that the number of passages of the centrifugal chip under the light source per second is a multiple of an image fetching rate of the high speed camera 7. With this control, an image of the rotating centrifugal chip can be picked up like a still picture. For instance, when photographing is performed with a camera operating with the image fetching rate of 30 frames per second, centrifugation should be performed by rotating the motor 3 with the rotational speed of 30×N/second (N: an integral number or a fraction of an integral number). Therefore, in the above case, by performed the centrifugation at the rotational speed of 1800 rpm described above, an image of the sample like a still image can be obtained. When a plurality of chips are photographed simultaneously, by dividing the fetched image to those for each discrete centrifugal chips with the personal computer 8, images of each chip can be obtained.

Example 2

FIG. 3 is a plan view schematically showing configuration of a centrifugal chip 100 advantageously applicable to a centrifugal separator in Example 1. FIG. 4 is a perspective view schematically showing cross-sectional configuration of a reservoir section of the centrifugal chip 100 shown in FIG. 3.

The reference numerals 11, 12, 13 indicate flow paths, which are independent from each other, for supplying solution having different specific gravities respectively, and edges of the flow paths are connected to reservoirs 21 to 23 on one side, and other edges of the flow paths are connected to the separation chamber 17 on the other side. The drain flow paths 14, 15, 16 are connected to the other edge of the separation chamber 17, and reservoirs 24 to 26 are connected to the other edges of the drain flow paths 14, 15, 16 respectively. Of the reservoirs 21 to 26 communicated to the flow paths respectively, the reservoir 23 contains therein a solution having the lowest specific gravity and including a sample, and reservoirs 22, 21 contain the solutions with the specific gravities in the descending order respectively. When the motor 3 is rotated in this state to perform centrifugation, layers of solutions 31, 32, 33 having the specific gravities in the descending order are formed according to the centrifugal acceleration in the separation chamber 17. Of the components of the sample, those having specified gravities higher than that of the solution 31 go into the solution layer 31, and those having the specific gravities lower as compared to those going into the solution layer 31 but higher as compared to the lowest specific gravity go into the solution layer 32, and components having specific gravities lower than the lowest one go into the solution layer 33. The components are recovered into the reservoirs 24 to 26 through the drain flow paths 14, 15, 16 corresponding to each solution layer respectively. Herein the reference numeral 30 indicates a difference between liquid levels viewed in the direction of the centrifugal acceleration in the initial state of the centrifugation. Because of the difference between the liquid levels, each solution flows in the direction 35 indicated by the arrow in the laminar flow state, and the components separated into the laminar flow in the separation chamber 17 flow into the drain flow paths 14, 15, and 16. What is important herein is the fact that the liquid levels in the reservoirs 21 to 23 and reservoirs 24 to 26 are aligned with the solution having the lowest specific gravity and therefore a liquid flow in each flow path is prevented from being disturbed.

Configuration of this centrifugal chip 100 is as described below. The flow paths 11 to 16 and separation chamber 17 are formed on one face of the PDMS substrate by casting, and the reservoirs 21 to 26 are formed with glass on the other face of the substrate and adhered thereto. The flow paths 11 to 16 and reservoirs 21 to 26 are communicated to each other with a hole penetrating the substrate. External dimensions of the chip are 30×30 mm. Although the centrifugal chip 100 is shown with a fan-like form in the figure, there is no restriction over an external form of the chip so long as the chip can be mounted on the space 2 of the rotary plate 1. At first, descriptions are provided for the casting mold for forming the flow paths 11 to 16 and the separation chamber 17 on the substrate.

A casting mold is used for mass production. At first a cleaned glass substrate or a silicon substrate is subjected to asking for 5 minutes with oxygen plasma for removing organic materials deposited on a surface thereof. Then the substrate is spin-coated with SU 8-25 which is a photosensitive resist. Excellent spin coat can be obtained by executing the spin coating at 500 rpm for 10 seconds, and then at 2000 rpm for 30 seconds. The glass substrate with SU8-25 homogeneously coated thereon by spin coating is pre-baked for 1 minute at 75° C., and then at 100° C. for 5 minutes on a hot plate to form a layer of SU8-25 with the thickness of 25 μm. The SU8-25 layer is exposed to UV light for 15 seconds with a chromium mask with a form corresponding to the flow paths 11 to 16 and separation chamber 17 punched out thereon. Then the glass substrate is baked at 75° C. for 3 minutes and then at 100° C. for 5 minutes on a hot plate. Development is performed using a SU-8 developer according to instructions in a prespecified manual. A not-polymerized portion of the SU8-25 is removed with isopropanol, and the substrate is baked at 160° C. for 30 minutes to obtain a casting mold. As a result, a projection with the height of 25 μm for the flow paths 11 to 16 and the separation chamber 17 is formed on the glass substrate or the silicon substrate. In this case, a width of each of the flow paths 11 to 16 is 50 μm, that of the separation chamber 17 (between the positions where the inlet flow paths and outlet flow paths are attached respectively) is 4 mm, and the width of the separation chamber 17 in the centrifugal direction is 150 μm (=50 μm×3).

Next descriptions are provided for a method of preparing a centrifugal chip using this casting mold. On the glass substrate or the silicon substrate, a wall with the height of 1.5 mm is provided to surround the casting mold for a projection with the height of 25 μm for the flow paths 11 to 16 and separation chamber 17. Internal size of this wall is 30×30 mm which is the same as the external size of the chip. A PDMS monomer mixture liquid prepared according to instructions provided in the manual is filled and then degassed and is heated at 75° C. for 30 minutes in an air constant temperature bath to polymerize PDMS. In this step, it is preferable to mount silicon wafer on a top surface of the wall and held thereon so that the thickness of the PDMS monomer mixture liquid layer is homogeneous. The wall is provided only for sustain the PDMS monomer mixture liquid, and therefore either a glass substrate or a silicon substrate may be used for this purpose. When the wall, silicon wafer, and casting mold are peeled off from the polymerized PDMS, a substrate 41 is obtained, and this substrate 41 has concaved portions formed on a surface of PDMS and corresponding to the flow paths 11 to 16 and separation chamber 17. FIG. 4 shows the state in which the flow paths 11 to 13 are formed on a surface of the substrate 41.

Then through holes 43, 44, and 45 each with the diameter of 2 mm are provided with a punch at positions where the flow paths and reservoirs are connected to each other on the substrate 41. Then a glass plate 42 with the dimensions of 30×30 mm and thickness of 1 mm is subjected to asking for 10 seconds with oxygen plasma, and is adhered to a surface of the substrate 41 (PDMS) on which the flow paths 11 to 16 and separation chamber 17 are formed. With this operation, the concave sections formed on the surface of the substrate 41 and corresponding to the flow paths 11 to 16 as well as to the separation chamber 17 are shielded with the glass plate 42, thus the flow paths 11 to 16 and separation chamber 17 being completed.

The reservoirs 21 to 23 formed by adhering glass plates to each other are adhered to a surface of the substrate 41 contrary to that on which the flow paths and separation chamber are formed. The reservoirs and PDMS are adhered to each other with covalent bonding. In this step, the flow paths 11 to 13 are communicated to the reservoirs 21 to 23 with the through holes 43, 44, 45 formed on the substrate 41. FIG. 3 shows the state in which the flow paths 11 to 13 are communicated to the reservoirs 21 to 23 adhered on the other surface of the substrate 41 via the through holes 43, 44, 45. FIG. 4 shows only a cross-section of a portion to indicates that the two surfaces of the substrate 41 are used, and therefore the relations between the reservoirs 24 to 26 and the flow paths 14 to 16 are not shown, but it is easily understood from the figure that the relations are the same as those shown in FIG. 3. Further it is easily understood from this figure that the separation chamber 17 is formed, like the flow paths 11 to 13, on one surface of the substrate 41. The reservoirs 21 to 23 are formed with a glass plate, and therefore the reservoirs 21 to 23 should be shown with a certain thickness respectively in FIG. 3, but only a contour thereof is shown to simplify the figure. Further the reservoirs 21 to 23 are formed by adhering glass plates to each other, but the reservoirs 21 to 23 may be molded on a glass plate having a prespecified thickness, and the plate may be adhered for forming the reservoirs 21 to 23.

Holes for injecting solutions therethrough are provided on a top surface of the reservoirs 21 to 23 on the side close to the rotation center, and the reservoirs 21 to 23 are basically independent and separated with partition walls 51, 52 from each other, and the partition walls 51, 52 are lacked in the upper sections thereof at positions closed to the holes 46, 47, 48 for injection of solutions.

Now descriptions are provided for a method of feeding solutions into the reservoirs 21 to 23 of the centrifugal chip 100 to effect the state shown in FIG. 3 with reference to FIG. 4. At first, a solution with the lowest specific gravity is poured from the hole 48 for injection of a solution into the reservoir 23. In this step, a large quantity of solution is poured into the reservoirs 23 so that the solution is also poured into the other reservoirs 22, 21 through the lacks 51, 52 of on the partition wall 51, 52 for the reservoirs 21 to 23. When a centrifugal force is loaded in the state in which the reservoirs 21 to 23 are completely filled with the solution having the lowest specific gravity, all of the flow paths 11 to 16 and separation chamber 17 are completely filled with the solution with the lowest specific gravity. The liquid levels in the reservoirs 24 to 26 on the exit side are aligned to the same level, centrifugation is stopped. In this state, a solution having a higher specific gravity is poured from the holes 47, 46 into the reservoirs 22, 21 by the quantities almost equal to capacities of the respective reservoirs. As a result, the solution having the lowest specified gravity is flooded out from the reservoirs 22, 21 and is substituted with the solution having the higher specific gravity. Further a sample solution including a target for separation is poured into the reservoir 23. This step corresponds to the state shown in FIG. 3. When the centrifugal chip 100 is mounted on the space 2 of the rotary plate 1 and centrifugation is performed by driving the motor 3, the solution layers are formed according to the specific gravities of the solutions as shown in FIG. 2, and components in the sample solution are separated into the solution layers according to the specific gravities.

Example 3

FIG. 5 is a view schematically showing configuration of the centrifugal chip 100 in Example 3. As clearly understood when the centrifugal chip 100 in Example 3 is compared to that in Example 2 shown in FIG. 2, in the centrifugal chip in Example 3, distance of the reservoirs 61, 62 on the sample side from the rotation center 10 is different from that of the reservoirs 63, 64 on the recovery side. Because of this configuration, a larger G is loaded, during rotation, to the reservoirs 61, 62 as compared to the reservoirs 63, 64, so that the potentials at liquid levels are different from each other. Therefore the liquid flows in the direction indicated by the arrow 69. Flow paths 65 to 68 from their respective reservoirs are coupled to the separation chamber 70. In this example, two types of solutions are used, and the solutions flow from the reservoirs 61, 62 on the sample side to the reservoirs 63, 64 on the recovery side because of the difference in a centrifugal force corresponding to the drop between the liquid levels. Also in this step, it is important that distances of the levels of the solution with high specific gravity in the reservoirs on the entrance side and exit side and also distances of the levels of the solution with low specific gravity on the entrance side and exit side from the center of centrifugation are equal. To satisfy this requirements, like in Example 2, it is desirable that the solution with low specific gravity covers the solution with high specific gravity in the reservoirs 63, 64. In addition, it is necessary to align the liquid levels in the reservoirs 63, 64 on the recovery side. If there is a drop between the liquid levels, a two-liquid layer is not formed in the separation chamber 70.

Also in Example 3, dimensions of the centrifugal chip 100 are the same as those in Example 2. FIG. 6 is a perspective view schematically showing the separation chamber 70 in Example 3. The width of the separation chamber 70 is 100 μm and the thickness is 25 μm in the direction in which G is loaded owing to a centrifugal force. Flow paths 65, 66, and 67, 68 each having the thickness of 25 μm and width of 50 μm are coupled to both edges of the separation section respectively. Namely the configuration is the same as that including the flow paths 11 to 13 formed on a surface of the substrate 41 shown in FIG. 4, though not shown in FIG. 5.

(Description of Operations of the Separation Section)

FIG. 7 is a view schematically showing the situation in which materials to be separated are moving in the separation chamber 70 to which the flow path 55 for a solution with low specific gravity and the flow path 56 for a solution with high specific gravity are coupled. Descriptions are provided below for a case in which a human erythrocyte and a human lymphocyte are separated with the centrifugal chip 100 in Example 3.

At first, a PBS containing 2-methacryloxyethyl phosphorylcholine polymer or BAS (pH 7.4) is put in the reservoirs 61, 62 of the chip to completely fill the flow paths 65 to 68 and separation chamber 70 with the PBS, and is left for 30 minutes in the state to coat surfaces of the flow paths with 2-methacryloxyethyl phosphorylcholine polymer or BSA. This operation is important for preventing non-specific absorption of cells. Then washing is performed with PBS to remove excessive BSA and the like in the flow paths 65 to 68 and in the separation chamber 70. Then PBS is filled in the reservoir 62 on the sample side (for a solution with low specific gravity) as well as in the reservoir 61 on the recovery side (for a solution with high specific gravity). In this step, the liquid is poured into the reservoirs up to a position above the lack on the partition wall between the reservoirs described above so that a constant pressure is loaded to the two flow paths (namely so that the liquid flows in the two flow paths at the same flow rate. Then a solution with the specific gravity adjusted to 1.077 is added in the reservoir 61 on the recovery side (for the solution with high specific gravity), and the reservoir is rotated at 1800 rpm to apply a centrifugal force thereto so that the solution with low specific gravity and that with high specific gravity are filled in the respective flow paths. The operations are performed at the room temperature. Then, an image of the separation chamber 70 is monitored with the optical system described with reference to FIG. 2. In this case, as shown in FIG. 7, it can be observed that the solution with low specific gravity and solution with high specific gravity form a two-layered laminar flow, and erythrocytes each shown with a large black circle moves into the solution with high specific gravity and the lymphocytes each shown with a small blank circle remain in the solution with low specific gravity.

FIG. 8 is a view schematically showing the situation in which separated materials are moving in the separation chamber 17 to which a flow path 13 for a solution with low specific gravity, a flow path 12 for a solution with medium specific gravity, and a flow path 11 for solution with high specific gravity are coupled. In this case, descriptions are provided for an example in which blood serum is separated with the centrifugal chip 100 in Example 1.

At first, as described by referring to FIG. 4 above, the flow path 13 (for a solution with low specific gravity), two flow paths 12, 11 (for a solution with medium specific gravity and for a solution with high specific gravity) on the sample side, and separation chamber 17 are washed. In this case, a specific gravity of the solution with low specific gravity is adjusted to about 1, that of the solution with medium specific gravity to 1.077, and that of the solution with high specific gravity to 1.113. After washing, the solution with low specific gravity is filled in the reservoir 23 on the sample side (for the solution with low specific gravity) and in the reservoirs 22, 21 on the recovery side (for solutions with medium and high specific gravities). In this step, the solution is filled up to a position above the lack on the partition wall 51 between the reservoirs described above so that a constant pressure is loaded to the three flow paths (namely, so that the solutions will flow at the same flow rate in the three flow paths). Next, the solutions with the specific gravities adjusted to 1.077 and 1.113 are filled in the reservoirs 22, 21 on the recovery side (for solutions with medium and high specific gravities) respectively and centrifugation is performed at 1800 rpm, so that the solutions with low, medium, and high specific gravities are filled in the respective flow paths. The operations are performed at the room temperature. Then a sample (serum) mixture solution is added in the reservoir 23 on the sample side (for the solution with low specific gravity) and centrifugation is carried out at 1800 rpm. In this state, an image of the separation chamber 70 is monitored with the optical system described by referring to FIG. 2, and in this case, as shown in FIG. 8, in the separation chamber 17, the solutions with low, medium, and high specific gravities form a three-layered laminar flow, and the erythrocytes each shown with a large black circle move into the solution with high specific gravity, polykaryocytes each shown with a star mark move into the solutions with medium and high specific gravities, and a monokaryocytes each shown with a small blank circle remain in the solution with low specific gravity.

In this step, by adjusting the rotational speed of the centrifugal chip 100 and the image fetching rate of the high speed camera 101 to appropriate values, the images of the separation state can be picked up as still images.

Second Embodiment

Descriptions are provided below for a method of once labeling a target cell to be separated with a particular material for identification, separating the cell, and discharging the particular material by a transporter present in the target cell after separation thereof.

At first descriptions are provided for the use of a transporter for labeling a target cell which is a feature of the second embodiment.

The transporter is generally used for transporting an amino acid such as glutamic acid, an oligopeptide such as dipeptide or tripeptide or other various types of organic materials having a low molecular weight through a cell membrane. Examples of transporters advantageously applicable to the second embodiment are shown in Table 1 each in relation to a labeling material and types of cells to be labeled. In Table 1, a transporter name is shown in item 93, a substrate moving through the cell membrane in item 94, and an organ or a cell in which the transporter is expressed in item 95.

TABLE 1
94 93 95
Substrate Transporter Tissue, cell, organ
Glucose SLC2A1-6,8,10,11 Erythrocyte, leukocyte
Fructose SLC5A1,2 Lever, renal, intestine, lung
Galactose Islet of Langerhans
Brain
Fat cell
Cardiac tissue
Testis
Placenta

It is needless to say that all of transporters present in all cells have not yet been known, and there are orphan transporters anticipated from the genome sequences, materials for which transporters are unknown, and materials which can pass through a cell membrane without using the channel as defined by the term of “transporter”, such as arginine oligomer described in Table 2. For instance, the second embodiment can be implemented, if it is known that a material having the function involved in transport through a cell membrane such as steroids, chemical substances, and organic materials generally having a high lipophilicity easily fetched into a cell is present. Namely, it is desirable to confirm the presence of a substance capable of transporting various types of fluorescent molecules or the like into and out from a cell.

TABLE 2

In order to label a target cell with a specific material by passing a transporter present in the target cell, the transporter is required to be exposed in a solution containing a specific labeling material to be passed for a prespecified period of time. However, in order to eliminate the specific material from the target cell by making a transporter pass therethrough after separating the target cell, the target cell is cultured in a solution not containing the specific labeling material for a prespecified period of time, so that the target cell can be separated causing little damage thereto. With the second embodiment, the target cell can be recognized and separated without damaging a cell surface thereof and a protein or a sugar chain of cytoplasm thereof.

FIG. 9 is a flowchart showing processing steps in the method of separating and collecting a cell according to the second embodiment.

In step A, a tissue piece containing a target cell desired to be separated and collected is obtained, and is incubated in a culture solution according to the known method. It is to be noted that a targeted tissue piece may be, depending on the type thereof, subjected to conditioning for 15 to 30 minutes prior to incubation. To prevent the problem of dispersion of a specific material to be intaked into the target cell, size of the tissue piece is preferably small in general, and more preferably, the tissue piece is sliced into a thin segment having 20 layers or less of a cell. However, for instance, with an aim that a target cell present in the upper portion of epithelium existing in a large intestine tissue piece is labeled to separate the same from that reside in the deep portion the epithelium, the tissue piece is preferably sliced into a rather thick piece and is labeled via a transporter. In this case, cells on the side opposite to the upper portion of epithelium may be removed with a razor or the like after labeling.

In step B, a specific material to be intaked into a target cell is added thereto employing a transporter presumably expressed in the target cell.

The specific material herein includes sugar substances such as glucose, fructose and galactose, amino acids such as glycine, glutamic acid and β-aminobutyric acid, an oligopeptide such as dipeptide and tripeptide, various types of medicaments, noradrenaline, dopamine, serotonin, or the like. Each specific material is labeled for an easy detection. A fluorescent material is used for labeling, and it is important that the fluorescent material does not bring about a change in a charge of the specific material. In addition, the fluorescent material with a size thereof being as small as possible is suited for the purpose, and a derivative of 6-(N-(7-nitrobenz-2-oxa-1.3-diazol-4-yl) or a derivative of 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene may be employed. When an amino acid is used for labeling, in order not to change a charge thereof, a linker portion coupling the amino acid with a fluorescent material is adjusted so as not to cause a change in the number of charges after fluorescent labeling. A method of labeling without changing a charge of an amino acid may include, for instance, introducing a labeling material by modifying an amino group of the amino acid with imido esters. Imido esters react with an amino acid at pH 8.5 to 9 to turn into imido amido, namely amidine. An amidine group is protonated at a physiological pH, like an amino group prior to the reaction, so that the amidine group is not easily affected by a charge gap when the amidine group passes a transporter.

In step C, a cell is subjected to dispersion processing by treating an issue piece with a specific material added thereto by means of, for instance, trypsin.

In step D, a dispersed cell is generally incubated for 15 minutes to 2 hours so that a specific labeling material is intaked into a target cell. In this case, when, prior to the step of separating and collecting a target cell to be implemented in step 5, the cells are rinsed with a culture solution not containing a specific labeling material to remove the excessive one if any, reproducibility is excellent and incorrect separation is scarce owing to background noise, often leading to a good result.

In step E, a target cell is separated and collected. A cell separation chip and a cell separator used in this step 5 are described hereinafter. Cell separation is optically recognized in the course where a labeled image is flowing down in a fluid, and cells having a prespecified level or more of fluorescent intensity are collected. In this case, image recognition can be done by recognition of a cell as a point light source, and for more advanced type of cell separation, distribution of a specific labeling material within a cell captured as an image is acquired, and only a cell having a specific organelle with a specific labeling material gathering therein can be separated. For instance, only a cell having mitochondria with a specific labeling material condensed therein can be separated.

In step F, in order to remove a labeling material from cells having a target cell with a labeling material as a foreign material present therein, the cells are incubated in a culture solution not containing a specific labeling material to remove the specific labeling material from a target cell. Removal of the specific labeling material may include reversibly excluding the same via a transporter, excluding the same via a transporter related to a foreign material release such as an ABC transporter, and decomposing the same in lysosome.

Removal is possible with respect to a target cell obtained according to the second embodiment, unlike the case in which a labeling material is irreversibly bonded to a cell such as a CD marker commonly used so far, so that the initial state of a target cell can be advantageously preserved.

The aforementioned processing is described below more specifically.

10 μM of a fluorescent labeled material is added to a tissue piece collected, and the piece is incubated at 37° C., a portion thereof is taken out at regular intervals, and the cells therein are dispersed according to the known method to be separated with a cell separator described later. FIG. 10 is a view showing general characteristics in a case where a cell with the fluorescence intensity of 5000 or more is separated with a cell separator, suggesting that intake of a fluorescent labeled material into a target cell becomes constant in about 20 minutes. It should be naturally understood that the period of time varies significantly according to the size and state of a cell piece or how to collect the same. It is needless to say that a user is required to determine how to set conditions for one's own samples.

Next is described whether separation of a target cell with a fluorescent labeled material intaked therein from a cell with the same not intaked therein is possible or not. FIG. 11 is a histogram showing fluorescence intensity of a fluorescent labeled material when the material is intaked into a target cell. The fluorescence intensity is shown on the horizontal axis, and the number of cells on the vertical axis on percentage. Two groups are generally obtained as shown in the figure with lines 21, 22. The group shown with the line 21 is regarded as a cell group not having been labeled, while the cell group shown with the line 22 as a cell group having been labeled.

Then the target cell group shown with the line 22 is continued to be incubated in a culture solution not containing a fluorescent labeled material, and a portion of the cells are taken out at regular intervals to separate cells, for instance, with the fluorescence intensity of 500 or more. FIG. 12 is a graph showing culture time of cells on the horizontal axis and the separated cells with the fluorescence intensity of 500 or more on the vertical axis. In this case, the figure demonstrates that the number of a cell with 90% of a labeling material removed therefrom reaches 70% of the total cell number in 24 hours, and in 48 hours, the labeling material is removed from almost all cells.

As described above, in the second embodiment, a material capable of passing a transporter present in a target cell is used as a labeling material, and the target cell, after separation, is incubated in a culture solution not containing a material fluorescently labeling the target cell, so that the target cell can be returned to its original state (native state). This is an important advantage because any foreign material does not get into a target cell in the case, for instance, where a separated target cell is returned to the body. Further in the cell researches, the availability of quickly removing a labeling material for cell separation makes it possible to minimize influences of the labeling material over the cell, and therefore this technique can make a great contribution to researches for accurately understanding the cellular physiology.

With regard to a transporter, it is generally contemplated that a plurality types of transporters exist in relation to one type of substrate, and a different type(s) of transporter is used according to the type or state of a cell. Therefore it is possible to modify a specific material as an original substrate of a transporter with a fluorescent material or to alter a side chain of the substrate itself, so that specificity of the specific material to a transporter can be altered. Thus the second embodiment in which a target cell is identified and separated using a transporter may be suited for identifying and separating a cell in various phases of cytodiffentiation or in the active state.

As described above, in the second embodiment, a target cell is separated and collected with the steps of: adding a specific material passing a transporter into a target cell by making use of a transporter for a target cell to be separated to introduce the specific material into the target cell; detecting a target cell with a specific material intaked therein using the cell separator described above; and separating the target cell with the specific material intaked therein by the cell separator, which makes it possible to obtain a target cell with little damage. In this case, the step of adding a specific material passing a transporter into a target cell to introduce the specific material into the target cell may be carried out, as the target cell is in just the state when it was collected, without making any major treatment thereon, which is effective for labeling a target cell in a further natural state thereof. For instance, in order to divide a tissue piece into discrete cells, treatment with an enzyme such as trypsin is available, however, the cells each having kept a specific form up to then become rounded, which may cause a trouble to the subsequent use depending on the circumstances. In this case, the second embodiment is designed to take steps for obtaining a target cell further accurately by exposing a tissue piece as it is in a solution containing a specific labeling material passing a transporter for a prespecified period of time, and then treating the tissue piece for being divided into discrete cells.

In the second embodiment, the aforementioned is applies to a culture cell, namely, a single-layer cell is incubated on a surface of a culture flask or the like, and then the cell is incubated as it is in a solution containing a specific labeling material passing a transporter, after which a cell group is divided into discrete cells using trypsin or the like to separate and collect the appropriate cells. In the conventional technology, a cell surface antigen is labeled using a labeled antibody after a cell group is divided into discrete cells, which means that labeling is conducted after a cell is treated with trypsin or the like, so that only a labeling material which is not affected even when a target cell is denatured with this operation can be used.

Moreover, if the cell dispersion treatment is forced to be executed after a cell surface antigen is labeled with a labeled antibody, a protein portion of a molecule assembly comprising the surface antigen or a labeled antigen is decomposed, thereby a state with high reproducibility can not be obtained. In the second embodiment, a material intaked in a target cell is used as a labeling material, so that, even when labeling is conducted before the cell dispersion processing, there is no possibility that the labeling material is discomposed or eliminated like in the case according to the conventional method. Further, if labeling is carried out before the cell dispersion processing, even though the subsequent operation changes the state of a cell, original characteristics of the cell are maintained at the time of labeling, enabling separation of a target cell without any problems.

A certain period of time is generally required for a labeling material to be intaked into a target cell via a transporter. Therefore a culture step may be provided in which a sample possibly containing a target cell is incubated for a prespecified period of time in a solution containing a specific material passing a transporter present in the target cell. With this step, a target cell can be labeled with a specific material passing a transporter. After the above culture step is completed and target cells each with a specific material for labeling identification intaked therein are separated, another culture step is added in which the separated target cells are exposed for a prespecified period of time to a solution not containing a specific labeling material passing the transporter described above, so that the target cells finally obtained do not contain any specific labeling material possibly having an effect on cell functions, or contains the specific material but only to the extent that the concentration of the same is reduced to have no effect on cell functions.

(Example of a Cell Separation Chip)

FIG. 13 is a plan view schematically showing an example of a cell separation chip adapted to implementation of a protocol for cell separation according to the second embodiment. FIG. 14 is a cross-sectional view of the cell separation chip shown in FIG. 13 taken along the lines A-A, B-B, C-C, and D-D and viewed in the direction indicated by the arrows at respective positions. FIG. 14 shows, to avoid excessive complexity, only those viewed in the vicinity of the cross section. FIG. 15 is a plan view schematically showing an example of a cell separator with a plurality of cell separation chips illustrated in FIG. 13 and FIG. 14 mounted thereon.

Reference numeral 13100 indicates a cell separation chip, size of which is about 30 mm×40 mm. Reference numeral 1350 indicates a substrate, for instance, a mold substrate made of plastic material having a thickness of about 1 mm. Reference numeral 1351 indicates a cone-shaped hole for being poured a buffer containing a target cell to be separated. Reference numerals 1352 and 1353 indicate holes with the buffer poured therein. The hole 1351 is 0.1 mmφ in diameter of the bottom face and 5 mmφ of the top face. The holes 1352 and 1353 are formed to penetrate the substrate 1350 and are about 3 mmφ in diameter. Reference numerals 1355, 1356 and 1357 are flow paths, each of whose one end is open to the holes 1351, 1352 and 1353 respectively. The flow paths 1355, 1356 and 1357 are formed on the bottom face of the substrate 1350, and have a height of about 50 μm and a width of 100 μm. On the top face of the substrate 1350 is formed a buffer retention bath 1354. The buffer retention bath 1354 is designed to be about 10 mm in height and 10 mmφ in diameter.

The flow paths 1355, 1356 and 1357 are converged together on the downstream side to form a flow path 1359. A portion of the flow path 1359 is provided to be a cell monitoring area 1360, on the downstream side of which is formed a cell separation area 1370. The flow path 1359 has, like the flow paths 1355, 1356 and 1357, a height of about 50 μm and a width of 100 μm. In the cell separation area 1370 are provided openings of gel for two gel electrodes opposing to each other on both sides of the flow path 1359. Each of the openings is placed in a position slightly deviated from the flow direction of the flow path 1359. At the rear of the openings of gel for the gel electrodes are formed spaces 1361, 1362 for holding gel, and each of the spaces has the substantially same height as that of the flow path 1359, and is provided with gel supply holes 1365, 1366 respectively. The gel supply holes 1365, 1366 are about 3 mmφ in diameter. On a portion of the spaces 1361, 1362 are deposited metal thin films 1363, 1364, and the thin films are extended from the bottom face of the substrate to a side face thereof.

A flow path 1371 as a flow path for a target cell to be collected and a flow path 1372 as a flow path for a target cell to be discharged are provided on the downstream side of the cell separation area 1370. Each of the flow paths 1371, 1372 has, like the flow paths 1355, 1356 and 1357, a height of about 50 μm and a width of 100 μm. It is assumed herein that, when a cell flowing down is determined to be labeled as a target in the cell monitoring area 1360, voltage is not applied to the two gel electrodes on both sides of the flow path 1359, in the meantime, when a cell flowing down is not determined to be labeled as a target, voltage is applied to the two gel electrodes when the cell reaches the cell separation area 1370. In this case, the two gel electrodes are placed in a position slightly deviated from the flow direction of the flow path 1359, so that the direction of force acting on a cell owing to an electrical field acted by the two gel electrodes can be turned to somewhat upper right. Consequently, force in the direction in which a cell flows down and that acting on the cell owing to an electrical field is synthesized, and the cell is thereby acted by force heading in the lower right direction, so that the flow path 1372 as a flow path for cells to be discharged is provided in a position of this direction, and the cells to be discharged can be easily introduced to the flow path 1372. When a cell flowing down is determined to be labeled as a target, because voltage is not applied to the two gel electrodes on both sides of the flow path 1359, the flowing-down target cell flows, without delay, in the flow path 1371 as a flow path for cells to be discharged.

The other end of the flow path 1372 is communicated to a discharged-cell collecting hole 1373. The discharged-cell collecting hole 1373 is about 3 mmφ in diameter. On the top face of the substrate 1350 is formed a buffer retention bath 1374 communicating to the discharged-cell collecting hole 1373. The buffer retention bath 1374 is, like the buffer retention bath 1354, designed to be about 10 mm in height and 10 mmφ in diameter. The flow path 1371 as a flow path for target cells to be collected is connected to a dialysis section 1380. The dialysis section 1380 extends from the top face to the bottom face of the substrate 1350, and forms a hooked flow path therein. The end of the hooked flow path is communicated to a collecting path 1383. When the hooked flow path is designed to have a flow path width of 100 μm, a partition width of 100 μm, and the total size of 10 mm×10 mm, the total length thereof results in about 50 cm. On the top of the hooked flow path is attached a porous membrane (0.2 μm) or a dialysis membrane (molecular weight cut 100000 Da) to form a space 1382 with a solution not containing a fluorescent labeled material flowing down on the top face thereof. On both ends of the space 1382 are provided a buffer retention bath 1386 for supplying a buffer (a solution not containing a fluorescent labeled material) and a buffer retention bath 1389 for collecting a buffer flowing down in the space 1382. When a target cell to be collected is flowing down in the hooked flow path in the dialysis section 1380, a specific labeling material intaked in the target cell is removed by a solution not containing a fluorescent labeled material. In order to sufficiently supply a solution not containing a fluorescent labeled material, it is desirable to replenish the retention bath 1386 with a solution not containing a fluorescent labeled material from a retention bath not shown, and to discharge a collected solution not containing a fluorescent labeled material from the retention bath 1389. Reference numeral 1387 indicates a flow path connecting the retention 1386 and the space 1382, while reference numeral 1386 indicates a flow path connecting the space 1382 and the retention bath 1389. These flow paths are formed on the top face of the substrate 1350. Since the retention baths 1386, 1389 are intermediary baths, the size of which is designed to be about 10 mm in height and 5 mmφ in diameter respectively.

The dialysis section 1380 on the substrate 1350 may be a lack, and in the lack may be embedded a unit with the dialysis section 1380, the porous membrane or dialysis membrane 1381 and the space 1382 integrated therein. This has an advantage in manufacturing the substrate 1350 by molding.

The other end of the collecting path 1383 is communicated to a cone-shaped hole 1385. On the top face of the substrate 1350 is formed a buffer retention bath 1384 for collecting a target cell collected via the collecting path 1383 and a flowing-down buffer. The buffer retention bath 1384 is designed to be 10 mm in height and 10 mmφ in diameter. Walls of various retention baths described above and the space 1382 are about 1 mm thick respectively.

As seen in FIG. 14, onto the bottom face of the substrate 1350 is attached a plastic thin film 1358 such as PMMA to complete the flow path on the bottom face of the substrate 1350. On the other hand, on the top face of the substrate 1350 are formed walls of various retention baths described above and the space 1382, and the walls may also be those formed with plastic made of PMMA and attached to the top face. The PMMA plastic may be substituted by polyolefin plastic. The porous membrane can be obtained by periodic acid-oxidizing a cellulose membrane (molecular weight cut off 30000 Da), partially introducing an aldehyde group therein, reacting the membrane with avidin, and reduction-stabilizing a Schiff base bonding with the hydroboration reaction, and attaching the resultant membrane to a surface of a biotin-modified chip with the biotin-avidin bonding. Biotinylation of a chip surface is introduced by, in the case of plastic, treating the surface with oxygen plasma to generate a radical, and immediately soaking the chip in a solution containing a biotin derivative having a double bond residue.

Additionally, as shown in FIG. 15, a cell separator 13300 having a number of cell separation chips 13100 can be configured to raise the throughput for cell separation as a whole. In the figure, reference numeral 1391 indicates plumbing for replenishing the retention bath 1386 with a solution not containing a fluorescent labeled material, and the plumbing is branched out to thereby replenish the retention bath 1386 on the cell separation chip 13100 with a solution not containing a fluorescent labeled material. Reference numeral 1391 indicates plumbing for discharging a solution not containing a fluorescent labeled material collected from the retention bath 1389, and the plumbing is branched out to thereby discharge the solution from the retention bath 1389 on the cell separation chip 13100. The cell separation chip 13100 is inserted in a position for a cell separation chip holder 13200 provided by hollowing a surface of the cell separator 13300, so that, when a chip is exchanged with another, the new chip can be provided in the same position. With a configuration in which voltage is applied to the gel electrodes via electrodes 1363, 1364 provided in a position corresponding to metal thin film 1363, 1364 on the plane of the cell separation chip holder 13200 extended from the plane of the cell separation chip 13100, labor of connecting an electrode can be saved in exchanging a chip. It is needless to say that, in place of providing metal thin films 1363, 1364 on the cell separation chip 13100, terminals for connection may be provided in a position adjoining to the cell separation chip 13100 on a surface of the cell separator 13300, so that voltage can be applied to the gel electrodes by inserting the terminals into the gel supply holes 1365, 1366.

Whether a cell separator is configured with a single cell separation chip 13100 or with a plurality of cell separation chips 13100 incorporated therein, it is necessary to provide an optical system for determining whether a cell flowing in a flow path in the cell monitoring area 1360 is a target cell to be collected or a cell to be discharged, and voltage is applied to the gel electrodes by means of a signal from the system according to the necessity.

FIG. 16 is a view for illustrating an optical system provided in a cell monitoring section 1360 of the cell separation chip. Although the optical system is omitted and not shown in FIG. 13 to FIG. 15, it is necessary to monitor a cell flowing down the flow path 1359, determine that the cell is a target cell to be collected or a cell to be discharged, as well as to measure the flowing speed, and to provide controls so that, when a target cell is recognized and reaches the cell separation area 1370, voltage is applied to the gel electrodes, or otherwise, voltage is not applied to the gel electrodes. The optical system is used for the purposes described above.

Reference numeral 101 indicates a light source of a stereomicroscope, for which is generally used a halogen lamp. Reference numeral 102 indicates a band pass filter for transmitting only light at a specific wavelength from light of the light source 101 for the stereomicroscope. Reference numeral 103 indicates a condenser lens, to which is introduced a phase contrast ring in the case of a phase contrast observation, and a polarizer in the case of a differential interference observation. Reference numeral 13100 indicates a cell separation chip. The state of the flow path 1359 in the cell monitoring area 1360 on the cell separation chip is observed with an objective lens 105. What is observed hereupon with the objective lens 105 is a stereoscopic image of a cell in the flow path 1359 reflected by light transmitted from the light source 101, and a fluoroscopic image reflecting fluorescence emitted by a target cell labeled with excitation light in which only a wavelength of excitation light of light from the light source 108 through the band pass filter 109 is eradicated from the objective lens 105 by a dichroic mirror 106. In this step, it is desirable that the wavelength of light used for a stereomicroscopic observation is sufficiently shorter or sufficiently longer than a fluorescent wavelength area to be observed, and, if possible, is different from the excitation light wavelength area.

Only a stereoscopic image in a flow path is observed with a camera 113 utilizing a dichroic mirror 110 and a band pass filter 112 reflecting light at the same wavelength as that transmitting the band pass filter 102 described above. On the other hand, a fluoroscopic image is observed with a camera 115 by selectively transmitting the wavelength band for the fluoroscopic observation of light passing through the objective lens 105 utilizing a mirror 111 and a band pass filter 114. Images picked up by the two cameras 113, 115 are subjected to image data processing for analysis, and comparison of the relative positional relation between the two images makes it possible to compare and identify fine structures and fluorescence emitting positions of a cell. According to this result, a computing machine 116 determines whether voltage is applied to gel electrodes or not, and, when voltage is applied to gel electrodes, sends a voltage applying signal at a prespecified timing as indicated by the arrow. It is to be noted that in this case, stereoscopic images in a single wavelength band and fluoroscopic images in a single wavelength band are observed for comparison and analysis, and similarly, stereoscopic images in two or more wavelength bands may be compared to each other, or fluoroscopic images in two or more wavelength bands may be compared and analyzed. In doing so, one or more dichroic mirror and a light source or a camera observation system may be further provided in the light path as described above.

Descriptions are made in more detail for a case in which a CCD camera is used in an optical system. In this case, the cameras 112, 115 illustrated in FIG. 16 are integrated into a single camera.

As a prerequisite, suppose that a cell is moving in the flow path 1359 at an average of 1 mm per second, and that a cell is flowing while turning around approximately once in 0.5 second in some cases, though depending on a shape of the cell. Assuming that 10 frames are required for recognizing a cell, detection of a cell image at intervals of 50 microseconds allows measurement of a shape of the cell or the like, even when the cell is turning around. Thus, on this condition, a system of observing an image at the rate of at least 20 frames/second will suffice. Assuming that one cell is picked up in the same frame on average, cell recognition becomes possible at the rate of 20 cells/second, however, a CCD camera capable of picking up an image at the rate of 200 frames/second is used herein to be on the safe side. Thus, cell recognition and separation at the rate of several ten thousands of cells/10 minutes is actually possible.

Such a camera has the cell monitoring area 1360 as an imaging range, and observes an area of 100 μm along the flow path 1359 in a position 0.5 mm upstream of the cell separation area 1370 in the flow path 1359 of the cell monitoring area 1360. A cell observed in the area reaches the cell separation area 1370 in 0.1 second. As the cell is flowing at 1 mm per second, 20 frames of a cell image are fetched while the cell passes the observation area, and the shape of a cell and fluorescent images are observed.

The camera recognizes a cell as an image by operating scanning lines of the camera in the orthogonal direction against the direction in which a cell flows. The camera constitutes an optical system in which a cell is subjected to incident light from a lens 105, fluorescence emitted by the cell returns to the lens 105, and the fluorescence is separated according to the wavelength through a band pass filter for image formation, and another optical system in which light from the light source 101 irradiates a cell, and a transmission image thereof is detected. The optical system may be designed so that a transmission image and a fluorescent image are projected in different sections on the same CCD imaging screen of the camera, which enables measurement of both transmission image and fluorescent image with a single unit of an upmarket high-speed low-light camera.

How to use the cell separation chip 13100 described above is outlined. First, the cell separation chip 13100 is warmed to about 60° C., and material for gel electrodes is supplied by applying prespecified pressure from holes 1365, 1366 on the material for gel electrodes in the amount corresponding to the space for gel electrodes 1361, 1362. Consequently, the material for gel electrodes reaches the openings of the gel electrodes 1361, 1362. Further, the holes 1365, 1366 are almost filled with the material for gel electrodes. Nevertheless, on the assumption that the chip according to the second embodiment is brought on the market, material for gel electrodes may be filled in the chip beforehand.

Next, a tank 1354 is filled with a buffer. As a result, the buffer sequentially flows in the flow path 1359, cell separation area 1370, flow path 1371, flow path 1372, dialysis section 1380 and flow path 1383 via a sample hole 1351 for supplying a fluid containing cells and the buffer holes 1352, 1353 for supplying a buffer and via flow paths 1355, 1356 and 1357. Then the buffer also flows in holes 1373, 1385. In this state, when a fluid containing cells is fed into a sample hole 1351, the cells get lined up as passing in the tapered flow path 1355, and become a laminar flow in the position where the cells converges with the flow paths 1355, 1356 to then reach the flow path 1359 in the cell monitoring area 1360. Each flowing down cell is sequentially identified as a target cell to be collected or that to be discharged, since cells are monitored with the optical system flowing down the flow path 1359. The optical system applies or does not apply voltage to the gel electrodes 1361, 1362 according to the result of identification. When prespecified voltage is applied to the gel electrodes 1361, 1362, force owing to an electric field acts on a cell to introduce the cell to the flow path 1372. When voltage is not applied to the gel electrodes 1361, 1362, force owing to an electric field does not act on a target cell, allowing the cell to flow down in the flow path 1371. The target cell flowing down in the flow path 1371 flows down in the flow path of the dialysis section 1380. In the upper section of the dialysis section 1380 is provided a porous membrane 1381, on which a buffer fed from a buffer retention bath 1386 flows, so that the target cell flowing down in the flow path of the dialysis section 1380 has a reduced amount of a fluorescent labeled material having been intaked into the target cell. Because only a capacity of a tank 86 is insufficient for the quantity of a buffer to be fed in the dialysis section 1380, buffer is to be fed also from other source, and a buffer collected into the buffer retention bath 1389 is to be discharged. The buffer retention baths 1386, 1389 are intermediary tanks for a buffer.

Taking a length of the flow path of the dialysis section 1380 and a passing speed of a cell into consideration, it is contemplated that, in some cases, a sufficient dialysis effect is not achieved with the cell separation chip described above. In such cases, it is desirable that a target cell is collected from a hole 1385 for holding a fluid containing the target cell, and then dialysis is performed separately.

Several specific examples are described below in which a protocol for cell separation according to the second embodiment is implemented with the cell separation chip shown in Examples.

(Example of Cell Separation 1)

Descriptions are provided below for a case, as a specific example, in which cerebrum tissue piece cut off from a cerebral corium of a mouse is used. Tissue cells (in this case, a cerebral tissue piece) are directly put in an isotonic culture fluid, and are incubated at 37° C. for 15 minutes in atmosphere containing 5% carbon dioxide for conditioning. Substances and labeling materials presumably available in a neural cell system are descried with reference to Table 3. The transporters are disclosed in http://www.bioparadigms.org/slc/intro.asp.

TABLE 3

More specifically, in the neural cell system, such transporters as γ-aminobutylic acid (GABA), noradrenaline (4-tetrahydro-N-methyl-1-naphthylamine), dopamine(2-dihydroxyphenylethylamine), serotonin have been known, and these amino acid sequences share homology with each other, and form a type of family. It is known that any of these transporters has a structure 12-times transmembrane structure. For instance, when labeled serotonin is added in the state of tissue piece, the labeled serotonin is taken into the neural cell system via a transporter which may be regarded as a serotonin transporter. Serotonin is labeled with a fluorescent material in use. Not only in the transporters each having homology with GABA, but also in a glutamic acid transporter which can be regarded as one belonging to a different transporter family, a labeling material can be introduced into a target cell by using a glutamic acid with a fluorescent body bonded thereto with a linker. In this example, a membrane-permeable transporter having a relatively small molecule size and no electric charge such as various derivatives of 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene is used. As a label, a fluorescent material can be introduced by using, for instance, an amino group of serotonin through the amidic group of serotonin.

At first, 10 μM serotonin labeled with the fluorescent material (described as labeled serotonin hereinafter) is added to the tissue piece and incubated at 37° C. for 30 minutes, and the cells are dispersed according to the known method, and are analyzed with a cell sorter independently developed by the inventors. Cell with the fluorescence intensity of 5000 or more obtained with this device are separated. 1000 cells are used as starting cells, and when operations are performed up to this step, 26% of the cells are separated in this process. When a group of labeled target cells are cultured in a culture fluid not containing labeled serotonin for 18 hours and then cells with the fluorescence intensity of 500 or below are separated, 156 target cells are recovered. This technique prevents foreign materials from being intaked, and provides an important merit, for instance, in a case where the separated target cells are returned to a human body. Further in the cell researches, the availability of quickly removing a labeling material for cell separation makes it possible to minimize influences of the labeling material over the cell, and therefore this technique can make a great contribution to researches for accurately understanding the cellular physiology.

(Example of Cell Separation 2)

Cell separation is performed by using any of the sugar-related transporters shown in Table 1. The glucose labeling method described in Cytometory 27, 262-268 (1997) may be used for labeling the sugar. This document suggests that cells can actually be stained by fluorescent material-labeled glucose and detected with a cell sorter (not separated and recovered in this document).

In Example 2 for cell separation, a case is described in which differences of cells are recognized by measuring differences in cell permeability of a plurality of substrates and then discrete cells are separated. In this example, cells are identified and separated by observing the cell permeability of galactose or fructose against the glucose described in the aforementioned document. Generally, glucose is often used as an energy source for cells, but galactose or fructose is not directly consumed. For instance, when Escherichia coli is cultured in a mixed culture medium of glucose and fructose, glucose is consumed at first, and then galactose is consumed when glucose decreases. Therefore, for instance, by measuring cell permeability of various types of substrates using a quantity of intaked glucose as control data, cell separation reflecting the state of cell more accurately can be performed.

In this example, a glucose labeling derivative of 6-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino) sugar (Ex465/Em540) (NBD-labeled sugar) is used. As a labeling fluorescent material for galactose or fructose, a membrane-permeable material having a relatively small molecular size and not electrically charged such as various derivatives of 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene may be used. Various types of NDM-labeled sugars are added to the culture fluid, and cells dispersed in the culture fluid via the brain tissue pieces (the cut-off site unknown) are trisected, and then the three types of NBD-labeled sugars are added to the culture fluids respectively and incubated for 15 minutes at 37° C. The culture fluid is exchanged with that not containing the NBD-labeled sugar, and the sample is immediately added to a cell sorter independently developed by the inventors, and cells with the relative fluorescence intensity of 500 or more are separated. 200 cells were processed with the sorter, and 66 cells using the NBD-labeled glucose and 13 cells using the NBD galactose were obtained respectively, and any cell using the NBD-labeled fructose could not be obtained. Similarly in a case of a sample in which cells from a lever tissue were suspended, 46 cells using the NBD-labeled glucose as an index, 37 cells using the NBD-labeled fructose, and 8 cells using the NBD-labeled galactose were obtained, and this result is different from that obtained using the brain-derived cells.

The glucose, fructose, and galactose are expressed by various transporters on cell surfaces, and substrate-specificity of each transporter is not so high, but actually the cells can be divided into several groups. This fact suggests that change in specificity due to a fluorescent material bonded to each transporter causes change in easiness of fetching glucose, fructose, and galactose into the cell.

(Example of Cell Separation 3)

In Example of cell separation 3, descriptions are provided for a case in which difference of cells are identified and discrete cells are separated by measuring the difference in cell permeability of a plurality of labeling amino acids or labeling peptides.

In Example 2 for cell separation, glucose is used as a control, but it is better to use herein substrates of transporters expressed in various organs. As shown in Table 4, thiamine, folic acid, eicosanoids, prostaglandin, L-ascorbic acid, arginine, and nucleoside may advantageously be used for this purpose. The transporters are ubiquitously present in various cells.

TABLE 4

Alternatively, a material such as arginine oligomer, a transporter for which is still unknown (intaked into a cell via another mechanism), but which is always intaked into a cell is used. As a substrate for measurement against a control, for instance, substances based on amino acid-related peptides and transporters corresponding to the substances as shown in Table 5 may be used.

TABLE 5

L-Glu or D/L-Asp is used for identification and separation of cell groups consuming much energy such as cerebral cells such as neuron or astrocyte, Purkinje cell of cerebellum, retina, small intestine, kidney, lever, skeletal muscle, and placenta. L-Ala, L-Ser, L-Thr, L-Cys and L-Gln are used for identification and separation of cells in lung, skeletal muscle, intestine, kidney, testis, and fatty tissue. L-Asn is effectively used for detection and separation of asparagines-demanding tumor cells in acute leukemia or malignant lymphoma. L-Asn may also be used for examination of the acute leukemia. For labeling, for instance, a fluorescent material modified by using isodiamido binding is used to prevent an electric charge of the amino group from being lost.

(Example of Cell Separation 4)

Descriptions are provided below for a case in which cells causing leukemia are separated by applying the technique in Example 3 for cell separation. NDB folic acid (Ex465/Em540), 4,4-difluoro-1,3,5,7-tetramethyl-4-bora-3a,4a-diaza-s-indacene-8-propionate labeled ASn, and 4,4-difluoro-5-(2-pyrrole)-4-bora-3a,4a-diaza-s-indacene-3-propionate labeled Thr are added to blood from a patient suffering from leukemia, and the mixture is incubated for 30 minutes at 37° C. Using the NDB folic acid (Ex465/Em540) as a control, the amounts of intaked 4,4-difluoro-3,5,7-tetramethyl-4-bora-3a,4a-diaza-s-indacene-8-propionate labeled ASn (Ex493/Em503) and intaked 4,4-difluoro-5-(2-pyrrole)-4-bora-3a,4a-diaza-s-indacene-3-propionate labeled Thr are measured by detecting the fluorescent intensities of various derivatives of 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene against the fluorescence intensity generated by NDB-labeled folic acid, and cells having high fluorescence intensity with the fluorescence wavelength of around 503 nm, namely cells having a large intake amount of the 4,4-difluoro-1,3,5,7-tetramethyl-4-bora-3a, 4a -diaza-s-indacene-8-propionate labeled ASn are sorted with a cell sorter. Histological examination of the sorted cells with a microscope shows that 95% or more of the sorted cells are cancerous leukocytes. An intake rate of the 4,4-difluoro-5-(2-pyrrole)-4-bora-3a,4a-diaza-s-indacene-3-propionate labeled Thr in normal cells against cancer cells is not so remarkable as compared to the intake rate of 4,4-difluoro-1,3,5,7-tetramethyl-4-bora-3a,4a-diaza-s-indacene-8-propionate labeled Asn.

(Example of Cell Separation 5)

In Example of cell separation 5, descriptions are provided for a case in which a substance taken into a target cell via an unknown mechanism is used. In this case, arginine oligomer is herein used as a substrate. The arginine oligomer can be intaked into a target cell even by conjugating, in addition to various fluorescent materials, a giant molecule such as an enzyme thereto. Further the arginine oligomer shows the cell membrane permeability to any cell (J. Mol. Recognit. 16, 260-264 (2003)). The mechanism of arginine oligomer intake into a cell is still unknown, but it is clear that the mechanism is not endocytosis nor phagocytosis, and now discussions are made for a model in which a guanidil residue of arginine forms a hydrogen binding to phospholipids present in a cell membrane and the molecule directly overcomes the membrane gap and also for the influence by a strong base in the guadinil group. The present inventors speculate, in addition to the assumptions described above, the possibility that the arginine oligomer acts as a weak denaturing agent because of the influence by chaotropic ions and the cell membrane is partially denatured.

(Example of Cell Separation 6)

In this example, sulforhodamine 101-labeled arginine octamer (Em605) and NBD-labeled Asn (Em540) are sent into a target cell, and cancerous cells are separated according to a different in intake rates of the two labeling materials. The sulforhodamine 101-labeled arginine octamer (Arg8-Cys-S-sulforhodamine 101) is ether-bonded to an SH group of Cys using a reagent having a maleimide group (produced by Molecular Probe Corp., Texas Red C2 maleimide). Actions of the arginine oligomer to a cell are specific, and additional descriptions are provided below. J. Mol. Recognit. 16, 260-264 (2003) suggests that there is an optimal value for length of arginine oligomer, and the optimal value is in the range from 6 to 8. When the length is too short, the oligomer hardly permeates a cell membrane, and when the length is too large, the oligomer tends to be bonded to the cell membrane. Further, when the length is several tens mer, the oligomer may be cytotoxic. In this Example, an octamer is used. Actually, Cys is conjugated to a COOH terminal of arginine octamer for binding a fluorescent material, and a fluorescent material having a maleimido group is conjugated to the SH group of this Cys. Alternatively, the fluorescent labeling may be performed by using, in place of Cys, Lys with a fluorescent material previously conjugated to the ∈-amino group thereof when synthesizing peptide. In this case the arginine oligomer is Arg8-Lys-∈-NH-sulforhodamine 101. A concentration of the arginine oligomer is 1 μm, and the processing time may be 0.5 hour. When labeled with arginine oligomer with the length of 6 to 8, strong fluorescence is generated in an internal structure of the nuclear, and therefore it is conceivable that the fluorescent material is specifically migrated to the nuclear. However, in which portion of the nuclear the fluorescent material is concentrated is still unknown. Fluorescence can be observed also from cytoplasm, although the intensity is not so strong as that in the nuclear. In any way, a percentage of a projection area of a nuclear in a cell can be measured. In addition to the materials described above, it is possible to use, as a fluorescent material, fluorescein, tetramethylrhodamine, sulforhodamine 101, pyrene derivatives, Cy3, Cy5, europium complexes of N,N,N1,N1-[2,6-bis(3′-aminomethyl-1′-pyrazolyl)-4-phenylpyridine], and various types of fluorescent nanoparticles (with the diameter of 30 nm). Therefore, an excitation wavelength and a fluorescence wavelength can be obtained according to the necessity.

(Example of Cell Separation 7)

In this example, descriptions are provided for cell separating operations using a tissue cut off from the overhead colon in intestine with the epithelium partially being cancerous. The two types of fluorescent substrates described above are mixed in the medium as the tissue piece, and are incubated for 30 minutes at 37° C. After the tissue is washed with 0.15 M NaCl not containing the substrate, and the cells are dispersed in a solution containing trypsin. Then immediately the dispersion is processed with an image analysis type of cell sorter according to the second embodiment of the present invention to measure fluorescence intensity distribution around the fluorescence wavelength of 605 nm from the sulforhodamine 101-labeled arginine octamer for each cell. To identify a cancer cell by making use of the fact that cancer cells have a larger size, a percentage of the nuclear in each cancer cell becomes larger as compared to that in normal cells, so that cells, in which an area ratio of the portion having high fluorescence intensity against to the total area of the cell is 20% or more, are detected. However, sometimes it is hard to make a determination only with the operation above because the actually stained structural body is not known, and a ratio of false negative may disadvantageously increase. Therefore, at the same time, by making use of the fact that a cancer cell has a high demand for Asn, the fluorescence intensity at and around the wavelength of 540 nm from the NBD-labeled Asn is observed. Then, cells showing a positive reaction with either sulforhodamine 101-labeled arginine octamer or NBD-labeled Asn are sorted with a cell sorter. The separated cells vary according to a type of tissue piece, and in this case, of 1000 cells in the tissue piece, 16 cells are separated. The separated cells are visually and histologically compared to cells (presumably not cancerous) in another portion of intestine of the same person, and based on the result of the operation above, it can be guessed that all of the separated cells are cancerous. The separated cells can be proliferated by culturing, and when cultured according to the known method, the cells can be proliferated infinitely. As described above, the cancerous cells can be separated more accurately by checking the two facts that nuclei of cancerous cells are substantially stained by the sulforhodamine 101-labeled arginine octamer, and that the NBD-labeled Asn is intaked into the cytoplasm of the cells.

(Example of Cell Separation 8)

In Example of cell separation 8, descriptions are provided for the availability of conjugating a substrate which specifically permeates to mitochondria in a cell like a mitochondria transporter and using the substrate for specifically staining mitochondria. Most arginine compounds often show the cell membrane permeability and also specifically reach mitochondria. Actually, Arg-specific transporters are present on a surface of mitochondria (See http://www.bioparadigms.org/slc/intro.asp). Therefore, it can be anticipated that the arginine oligomer conjugated to sulforhodamine 101 described in Example 5 for cell separation is taken into mitochondria. By introducing sulforhodamine 101-Arg6 into a cell and observing the situation in the cell with an optical system using a water-submerged lens with the resolution of 100 times shown in FIG. 16 as an object lens 105, spotted patterns can be observed in the cytoplasm. This result of observation suggests that the sulforhodamine 101-Arg6 has migrated into mitochondria.

Therefore, sulforhodamine 101-Arg6 is added to the cells, and the cells are sorted checking localization of fluorescence in the cells. For observing mitochondria with high resolution, the water-submerged lens with the resolution of 100 times is used as an object lens 105 in the optical system shown in FIG. 16. In this case, a degree of distribution of fluorescent light emitting points in each cell are checked, and cells with the fluorescence intensity of 40 times or more from the cytoplasm against the background are sorted as ones having taken the fluorescent material into the mitochondria. The sorted cells are transferred into a culture liquid to remove the intaked sulforhodamine 101-Arg6. The cells having lower fluorescence intensity ratio as compared to the value described above has a low survival rate after sorting, while most of cells having high fluorescence intensity can be cultured. This fact suggests that apoptosis is induced in cells with low mitochondria staining intensity, or that the cells are substantially damaged. With the second embodiment of the present invention, fresh cells can easily be sorted from damaged ones.

Third Embodiment

As a third embodiment, a method is disclosed for adding a labeling substance to a cell for separation based on a certain characteristic of the cell and after isolation removing the labeling substance, for the purpose of avoiding degeneration of the target cell to be separated by the labeling substance to the extent as much as possible, by selecting as the labeling substance to a surface antigen a substance degradable under a mild condition and by degrading and removing the labeling substance to the surface antigen under a physiological condition without impacts to the cell.

Before describing an example of the third embodiment, a method of preparing aptamer to a cell surface antigen CD4 is described as an example of the labeling substance useful in the third embodiment.

As aptamer for use as the labeling substance, aptamer to the cell surface antigen CD4 disclosed in an article “Staining of cell surface human CD4 with 3′-F-pyrimidine-containing RNA aptamers for flow cytometry” (Nucleic Acids Research 26, 3915-3924 (1998)). The aptamer is of type ribonucleotide, that is, RNA aptamer. In the above article, GDP-β-S is introduced to the 5′ end of the RNA aptamer as an identification substance by in vitro transcription, for the purpose of identifying the aptamer with fluorescence. At this stage, a thiophosphoric acid group is inserted to the 5′ end of the aptamer. A 5′ biotinylated RNA aptamer is obtained by reacting biotin introduced with an iodine acetyl group to the thiophosphoric acid group.

As a fluorescent pigment, a conjugate of phycobiliprotein and streptavidin is reacted to the 5′ biotinylated RNA aptamer and through biotin/avidin reaction phycobiliprotein-modified RNA aptamer is obtained. Of types of phycobiliprotein, β-phycoerythrin is a fluorescent substance of type fluorescent protein, characterized by a high light absorbance at 2.41×106 M−1 cm−1 as well as a high quantum yield at 0.98 and is suitable for high-sensitive detection, but a large size thereof at a molecular weight of 240K daltons as well as nonspecific adsorption and instability characteristic to proteins proves problematic occasionally. In one of the examples of the third embodiment, the phycobiliprotein-modified RNA aptamer is used. Since the molecular weight is as large as 240K daltons, it is equivalent, in terms of size, to using particles of about 10 nm in diameter as a marker substance. In addition to phycobiliprotein, therefore, a particle containing fluorescent pigment, a gold nanoparticle and a magnetic particle, all 10 nm in diameter, are also used.

An example of identification element with phycobiliprotein or a nanoparticle as the marker substance is described hereinafter.

(i) Phycobiliprotein-modified RNA aptamer: A method described in the article hereinabove may be used, but another method is used hereinafter. Synthesis of RNA aptamer is securely achieved by chemical synthesis. An amino group is introduced to the 5′ end of the synthesized RNA aptamer. The amino group is introduced at the time of chemical synthesis of the RNA aptamer. A bifunctional reagent such as N-(8-Maleimidocapryloxy) sulfosuccinimide is reacted to the amino group introduced at the 5′ end, and as a result, an SH-reactive maleimide group is introduced to the 5′ end of the RNA aptamer. Separately β-phycoerythrin with an SH group introduced thereinto is prepared. For the introduction of the SH group, an amino group of the β-phycoerythrin is modified with 2-iminothiolane. β-phycoerythrin-modified RNA aptamer is obtained by mixing the maleimide group-introduced RNA aptamer and the SH group-introduced β-phycoerythrin through 2-iminothiolane modification at pH 7.

(ii) Gold nanoparticle-modified RNA aptamer: A method of preparing gold nanoparticle-modified RNA aptamer is described hereinafter, with reference to methods disclosed by Tonya M. Herne and Michael J. Tarlov (J. Am. Chem. Soc. 1997, 119, 8916-8920) and by James J. Storhoff (J. Am. Chem. Soc. 1998, 120, 1959-1964). In a suspension of gold nanoparticles (20 nm φ) are added synthetic RNA aptamer with an SH group at the 5′ end and 6-mercapto-1-hexanol, and the mixture is left for an hour. The molar ratio of the synthetic RNA aptamer and 6-mercapto-1-hexanol is 1:100, but if gold nanoparticles get agglomerated, or the synthetic RNA aptamer does not bond with the gold nanoparticles, it is necessary to change the ratio according to the necessity until an optimal ratio is found. The gold nanoparticles easily get agglomerated, and hence it is necessary, at the time of adding synthetic RNA aptamer, to stir the liquid, so that concentration gradients of potassium carbonate buffer or the synthetic RNA aptamer do not result. The synthetic RNA aptamer and the gold nanoparticles are reacted under a condition where the molecular ratio of the synthetic RNA aptamer to the gold nanoparticles is 100 times. That is, the reaction takes place where the ratio between the number of the gold nanoparticles and the number of synthetic RNA aptamer molecules is 1:1000. The synthetic RNA aptamer with an SH group are chemically synthesized. After the reaction the solution is centrifuged at 8000 G for an hour and the supernatant is discarded. The aptamer is suspended again in 10 mM potassium carbonate buffer with 0.1 M NaCl added (pH 9), then is centrifuged again, the supernatant is discarded again, and the aptamer is finally suspended in 10 mM potassium phosphate buffer with 0.1 M NaCl added (pH 7.4) to make stock.

(iii) RNA aptamer modified with nanoparticles other than gold: Nanoparticles like quantum dot is generally inorganic nanoparticles. A product covered with biotin-introduced polyethyleneglycol is already in the market, for example, under the trade name of EviFluor from Evident Technologies, Inc. RNA aptamer bonded with streptavidin can be used together with nanoparticles with biotin introduced thereinto. A method of preparing RNA aptamer bonded with streptavidin is described hereinafter. RNA aptamer with a maleimide group introduced at the 5′ end and streptavidin introduced with an SH group by a 2-iminothiolane modification is mixed at pH 7 with the method (i) and streptavidin-bonded RNA aptamer is obtained. Mixing the streptavidin-bonded RNA aptamer with the nanoparticles with biotin results in nanoparticle-modified RNA aptamer as identification element.

From nanoparticles with a carboxyl group introduced thereinto is obtained nanoparticle-modified RNA aptamer as identification element with a well-known method of first reacting carbodiimide to the carboxyl group to obtain active ester and then reacting 5′-aminated RNA aptamer thereto.

Methods of preparing nanoparticle-modified RNA aptamer have been described above, and similar methods are applicable for preparation of DNA aptamer of type deoxyribonucleotide: phycobiliprotein-modified DNA aptamer, gold nanoparticle-modified DNA aptamer and DNA aptamer-modified with nanoparticles other than gold may be prepared each as identification element in a similar fashion, because an SH group, an amino group and the like may be introduced to the 5′ end at a time when the DNA aptamer is synthesized in a synthesizing machine, as in the case of RNA aptamer.

In addition to methods as described hereinabove, RNA aptamer may be synthesized according to a commonly used method of first synthesizing single-chain DNA with a T7-promoter at the 5′ end and then transcribing the synthesized DNA to RNA with RNA polymerase.

EXAMPLE

An example is described hereinafter with identification element made up of RNA aptamer as a labeling substance to label cell surface antigen CD4 and β-phycoerythrin as a marker substance in isolating and collecting cells bonded with the RNA aptamer. That is, cells presenting the cell surface antigen CD4 is specifically labeled with the β-phycoerythrin-modified RNA aptamer as described hereinabove, and then a cell isolation chip, which is a cell sorter formed on a plastic chip substrate as disclosed in Japan Patent Application 2004-379327.

FIG. 17 is a view showing a process flow of specifically labeling a cell presenting the cell surface antigen CD4 with the β-phycobiliprotein-modified RNA aptamer and thereafter isolating the cell with a cell sorter. The top-most part of FIG. 17 shows a sample 1710 with two kinds of cells 1703 and 1704 in a mixed manner. The cells 1703 present a cell surface antigen CD4 indicated by a triangular marked out in black with a reference numeral 1701. The cells 1704 present a surface antigen 1702 other than CD4 indicated with a circle marked out in black. With the sample is mixed β-phycoerythrin-modified RNA aptamer 1711 as described hereinabove. The RNA aptamer is indicated with a reference numeral 1705 while the β-phycoerythrin is indicated with a numeral 1706. Concentration of labeling substance 11 is 100 nM.

As a result, to the antigen 1701, which is CD4 present on a surface of the cells 1703, is bonded the labeling-substance RNA aptamer modified with β-phycoerythrin as an identification substance. To the antigen 1702, which is not CD4, the labeling-substance RNA aptamer is not bonded. The identification substance β-phycoerythrin, modifying the labeling-substance RNA aptamer, yields a strong fluorescence at around 575 nm when excited with 532-nm second harmonic of YAG laser. In the cell isolation chip, therefore, cells presenting CD4 can be isolated from the other cells through detection of this fluorescence. In the top-most part of FIG. 17, an arrow leading to the vertical line of a reverse “Y” shape extending from the sample 1710 indicates that such isolation is carried out with the cell sorter. Reference numeral 1712 at the end of one of the diagonal lines of the reverse “Y” shape indicates a group of the cells 1703 bonded to the labeling-substance RNA aptamer. Reference numeral 1713 at the end of the other diagonal line of the reverse “Y” shape indicates a group of the cells 1704 not bonded to the labeling-substance RNA aptamer.

Next the cells presenting CD4 and isolated with the cell sorter are collected into a microtube and are immediately reacted with nuclease 1714. Since the RNA aptamer has a three-dimensional structure, types of nucleases like ribonuclease A that breaks down single-chain RNAs alone may not decompose the aptamer sufficiently. A nuclease that breaks down both single- and double-chained RNAs can be used effectively. For the purpose of this example, Benzonase (registered trademark) is used, a nuclease derived from Serratia marcescens as described in “The Journal of Biological Chemistry 244, 5219-5225 (1669)” mass produced genetically (European patent No. 0229866, U.S. Pat. No. 5,173,418). The enzyme works at a temperature of 37° C., and has a working pH range at a neutral range between 6 and 9, and is therefore easy to use on cells. Highly concentrated phosphoric acid or monovalent metal ion reduces activity of the enzyme, hence buffer liquid of type non-phosphoric acid is used, for example, 10 mM HEPES at pH 7.4 with 0.15 M NaCl, 2 mM MgCl2 and 1 mg/ml BSA contained therein. If buffer liquid of type phosphoric acid must be used, then concentration of potassium phosphate/sodium phosphate should be held down to 5 mM, and the liquid should be used with 0.15 M NaCl, 2 mM MgCl2 and 1 mg/ml BSA contained therein. Benzonaze (registered trademark) nuclease is used at a concentration of 10˜100 u/ml. Alternatively, a mixture of ribonuclease A and ribonuclease T1 may be used, but nuclease derived from Serratia marcescens has wider applications.

If necessary, blood serum may be substituted with buffer liquid, although it may be necessary to adjust the concentration of Benzonase (registered trademark) nuclease for each blood serum lot, because of the effect of nuclease inhibitor found in blood serum. Generally, if blood serum is used, concentration between 100˜400 u/ml gives a good result.

In FIG. 17, an arrow representing the nuclease leading to another arrow indicated on the lower side of the group 1712 of the cells 1703 bonded with the labeling-substance RNA aptamer indicates a process of adding the nuclease. This process is given a reference numeral 1714. As a result of the nuclease acting on the aptamer, the labeling-substance RNA aptamer 1706 bonded with the CD4 antigen 1701 on the surface of the cells 1703 is degraded. In FIG. 17, the degraded labeling-substance RNA aptamers are indicated as a group of dots and are given a reference numeral 1707. A reference numeral 1715 indicates a mixture of the cells 1703, the degraded labeling-substance RNA aptamers 1707, and the identification-substance β-phycoerythrin 1706.

Next, by changing cell supernatant of this mixture and removing the decomposed substance 1717 (the mixture of the degraded labeling-substance RNA aptamers 1707 and the marker-substance β-phycoerythrin 1706), only the cells 1703 with CD4 antigen 1701 on the surface are collected. In changing the cell supernatant, centrifugal action is used. The mixture is centrifuged for 15 minutes at 3000 rpm, the cells are precipitated, and thereafter the decomposed substance 1717 can be removed by discarding the supernatant. The precipitated cells are resuspended. This process is given a reference numeral 1716. A reference numeral 18 indicates a group of the collected cells 1703 with the CD4 antigen 1701 on the surface. A reference numeral 1703′ is given to the cells 1703 and a reference numeral 1701′ to the surface antigen CD4 1701, indicating that, as a result of acting the nuclease on the cells 1703, there is a chance, be it slim, that the cells 1703 and the antigen 1704 are affected in some way, and that they may not be exactly the same as before.

FIG. 18 is a view showing a time change of fluorescence intensity of the identification-substance β-phycoerythrin bonded to the cell surface with the addition of the nuclease. Herein, the cells are placed on a preparation, the cell surface is observed under a fluorescence microscope, and an integrated value of the fluorescence intensity obtained from the entire cell is observed. When the aptamer is degraded with the nuclease, the identification-substance β-phycoerythrin is diffused from the cell surface and turns unobservable, hence by following the fluorescence intensity, progress in degradation of the aptamer by the nuclease can be followed. In FIG. 18, the horizontal axis represents time, while the vertical axis indicates integrated value of the fluorescence per cell shown as the fluorescence intensity per cell. The figure is a result of time course observation under the fluorescence microscope of the fluorescence intensity (excitation wavelength at 532 nm, fluorescence wavelength at 575 nm, a band pass filter in use) of the cell surface of the cells presenting the cell surface CD4 bonded with the β-phycoerythrin-modified RNA aptamer (the group 1712 in FIG. 17 of the cells 1703 bonded with the labeling-substance RNA aptamer) isolated with the cell sorter. In order to avoid fluorescent degradation, radiation time of the excitation light is limited to a minimum length: for instance, the light is radiated for a second at a minute interval for the fluorescence observation.

Reference numeral 1822 is a line indicating the time change of the fluorescence intensity. An arrow 1821 indicates the timing at which the Benzonase (registered trademark) nuclease is added. It is difficult to completely prevent the fluorescence degradation, even if the radiation time of the excitation light at excitation wavelength at 532 nm is kept short, and upon the defection of the Benzonase (registered trademark) nuclease (time area 1823), the fluorescence intensity slightly reduces over time. Upon the addition of the Benzonase (registered trademark) nuclease at the timing 1821, the fluorescence intensity detectable from the cells reduces rapidly in the time zone 1824, although with some delay in timing.

This indicates that during the isolation process, with the cell sorter, of the cells presenting the cell surface CD4 bonded with the β-phycoerythrin-modified RNA aptamer, the functionality of the β-phycoerythrin as the identification substance remains intact, but that when the nuclease is added, the portion of the RNA aptamer (the reference numeral 1705 in FIG. 17) of the β-phycoerythrin-modified RNA aptamer bonded with the cell surface is decomposed, and that the fluorescence-substance β-phycoerythrin 1706 is diffused into the solution.

FIG. 19 is a diagram indicating culturability of the cells presenting the surface CD4 obtained by removing the β-phycoerythrin-modified RNA aptamer according to the third embodiment. The horizontal axis represents time, while the vertical axis indicates the number of cells. From the characteristics in FIG. 18, the time necessary for the β-phycoerythrin-modified RNA aptamer to be regarded as sufficiently removed by adding Benzonase (registered trademark) is evaluated beforehand. The cells with the β-phycoerythrin-modified RNA aptamer removed are obtained after waiting for the time described hereinabove after adding the nuclease to the cells isolated with the cell sorter. The cells thus obtained are incubated in, for example, a microchamber for cell incubation disclosed in Japanese Patent Application No. 2004-305258 filed by the inventors of the present invention. The microchamber for cell incubation is made of agarose and made up of an array of microchambers, has a structure allowing changes of culture liquid at any time through a semipermeable membrane, and allows a long-term incubation of cells on an individual cell basis. Upon incubation of the cells presenting the surface CD4 with the β-phycoerythrin-modified RNA aptamer removed therefrom, the cells divide, as shown in Graph 1931. Graph 1931 shows a stepwise increase, indicating that, as the process starts with a single cell, the number of cells grows each time the cells divide. The cells not subjected to the Benzonase (registered trademark) nuclease process are unable to divide as is shown in Graph 1932, and become extinct over time.

When surface antigen is recognized by bonding an RNA aptamer to a cell marking and, when the cell marking is no longer required, the RNA aptamer is degraded and removed with ribonuclease, the cells can be returned to a state as natural to the extent as allows them to divide, like before the cell marking. This technique, as described in the first example, brings about a revolutionary impact to the cell isolation with a cell sorter. In the conventional method of cell separation by labeling a surface antigen with an antibody, the labeling substance cannot be removed from the cell after the separation of target cells, and in most cases damages to the cells are fatal. The third embodiment allows a reversible removal of the labeling substance to the surface antigen, therefore the separated cells can be used.

(Other Example of Aptamer 1)

In the previous example, a detailed description is given to a case in which RNA aptamer is used as the aptamer as the labeling substance and a cell surface antigen CD4 is used as the labeling target. In this example a use of aptamer of type DNA as the labeling substance for micro separation of a live cell tissue is described.

In preparation of the DNA aptamer, a sequence of about 40 bases long and random to the CD4 antigen, with priming sequences for PCR amplification attached to both ends, is prepared in advance, and is affinity-separated with CD4 antigen fixed to a magnetic particle. The affinity-purified fraction is PCR-amplified using the priming sequences at both ends, and is once again affinity-separated with CD4 antigen fixed to a magnetic particle. By repeating this process, DNA aptamer bonding to the CD4 antigen is obtained, although the bonding strength is weaker than that of RNA aptamer. Finally, by using primer with an SH group having a blocking group at 5′ end as one of the primers through PCR amplification, DNA aptamer with the 5′ end modified with an SH base is obtained. Thereafter, by using a method similar to that described in the example is applied: the DNA aptamer is reacted to gold nanoparticle β-phycoerythrin, and β-phycoerythrin-modified DNA aptamer is obtained as identification element.

A biopsy sample is lightly crushed up on a slide glass and fixed thereto. The sample is added with the β-phycoerythrin-modified DNA aptamer; is left for 30 minutes and cells in the sample presenting the CD4 are labeled with the β-phycoerythrin-modified DNA aptamer; then the labeled part is cut out (or the unlabeled part is removed by laser killing); the part is treated in culture fluid with Benzonase (registered trademark) nuclease or DNasel added at pH 7; and part of the tissue rich in CD4 is obtained as the tissue remains alive.

(Other Example of Aptamer 2)

In this example, labeling-substance aptamer is of type RNA bonding to EpCAM, and magnetic particles around 100 nm in diameter are used as the identification substance. The object is to identify and separate tumor-originated cells circulating in the blood and having EpCAM as surface antigen.

In preparation for RNA aptamer bonding to EpCAM, a sequence 90 bases long is synthesized by introducing a sequence of 26 bases, including a sequence for T7 promoter, to the 5′ end of a single-chain DNA random sequence of 40 bases, and a priming site for PCR made up of 24 bases to the 3′ end of the single-chain DNA. The sequence is from the 5′ end:

TAATACGACTCACTATAGGGAGACAAN (40)
TTCGACAGGAGGCTCACAACAGG.

The T7 sequence is used for transcription to RNA with RNA polymerase. For the transcription to RNA, a quantity of 500 μl of DNA at 100 pmol is reacted with 100 u of T7 polymerase. For the bases, 3 mM each of 2′-F-CTP and 2′-F-UTP as well as 1 mM each of ATP and GTP are used, and the polymerase is acted on at 25° C. for 10 hours. After the RNA transcription is completed, the DNA is degraded with DNasel and the transcribed RNA products are collected with electrophoresis. The collected transcribed RNA products are heat-denatured, and then are passed through a sepharose CL4B column, fixed with EpCAM, in PBS (at pH 7.4) added with 2 mM of MgCl2. The bonded transcribed RNA elements are eluted in solution containing 7M urea. The resultant transcribed RNA elements are reverse-transcribed and PCR-amplified with a pair of primers each complementary to each of the known sequences at both ends. The resultant PCR products are again transcribed with T7 promoter, the transcribed RNA is captured with a sepharose CL4B column fixed with EpCAM, in a similar fashion as before, and the bonded transcribed RNA elements are collected. By repeating the process of transcription, capture, collection and PCR amplification 15 times, RNA aptamer specifically reactive to EpCAM is obtained.

At the 5′ end of the resultant RNA aptamer is inserted a thiophosphoric acid group through in vitro transcription, as described in an article “Staining of cell surface human CD4 with 3′-F-pyrimidine-containing RNA aptamers for flow cytometry” (Nucleic Acids Research 26, 3915-3924 (1998)). To the thiophosphoric acid group is reacted biotin with an iodine acetyl group introduced thereinto, and 5′ biotin-modified RNA aptamer is obtained. Magnetic beads conjugated with streptavidin are reacted, and RNA aptamer specifically reactive to EpCAM with a magnetic particle as the identification substance is obtained.

Reaction of a magnetic particle with RNA aptamer label to an EpCAM-positive tumor cell is described hereinafter. 10 ml of blood is suspended in culture solution 5 times the quantity of the blood, the RNA aptamer specifically reactive to EpCAM with the marker-substance magnetic particle is added, and is stirred slowly for 30 minutes. The suspension fluid is sent through a tube with 2 mm in inner diameter, and magnetic particles are captured with an array of neodymium magnets spaced at an interval of 1 cm. The collected magnetic particles are washed with culture fluid, and cells are separated using the cell sorter in example 1. To the separated cells is added Benzonase (registered trademark) nuclease for degradation of the RNA aptamer, and live cells are obtained. The separated live cells are incubated in the microchamber disclosed in Japanese Patent Application No. 2004-305258. Tumor-derived cells, if any, can endure incubation for a prolonged period, and some of them start dividing shortly.

Generally most of live cells circulating in the blood are, apart from hematopoietic cell groups, derived from tumor. Cells other than tumor cells do not normally break off the surface of vascular endothelium alive, and if they do, they are degraded in blood with the work of host defense mechanism. On the other hand tumor cells do break off alive, resist to degradation in blood as well, and circulate in the blood alive. The number of such cells, however, is small, making it unsuitable for biopsy. If tumor-derived cells circulating in the blood are collected alive in a large number and are incubated for a certain period of time, it can be known that there is a tumor somewhere in the body, although it is not possible to identify the tumor site.

If particles or magnetic particles are used as identification substance of the identification element as used in the above example, such methods as particle imaging, scattered light detection or magnetic detection can be used in identifying cells bonded to the marker substance of the identification element.

(B) A method of and an apparatus for immediately freezing and storing the separated cell according to the necessity is described hereinafter.

Fourth Embodiment

A fourth embodiment discloses a method and a means of freezing a sample cytoplasm without destroying the same; in the fourth embodiment a freezing rate of a cell is quickened to the utmost limit, namely, water mixed with a sample is cooled in a pressurized state to a temperature of a little under 0° C. so that it won't freeze; the water is then frozen by reducing pressure rapidly, while at the same time the sample is frozen quickly. By instantly skipping over a zone of maximum ice crystal formation, and by freezing the sample cytoplasm amorphously, the cytoplasm of the sample can be frozen without being destroyed.

In general, it is difficult to freeze water mixed with a sample in a very short time by controlling outside temperature because temperature transmission depends on heat conduction of a substance and convection of a solvent. Therefore, in general, a thinly sliced section of a sample is cooled in liquid nitrogen to cope with it. However, when a thicker section is used, a heat conduction influence emerges, making it difficult to cool it at a high rate. On the other hand, because the fourth embodiment is a method dependent on pressure transmission of a substance, it is possible to cool at a much higher rate than a heat conduction method. In respect to a relationship between pressure and temperature, a pressure transmission rate can be equivalent to that of a pressurized substance itself; therefore it is possible to transmit virtually at the speed of sound.

In the fourth embodiment, water and the sample are put into a pressure-resistant vessel so that no gas phase exists. Namely, the sample is put inside the vessel so that there will be no bubbles or air space; while applying pressure slowly so that a temperature doesn't go up, the water is cooled at a temperature of not more than 0° C. in such a condition as no sample in the water freezes. After reaching the prescribed pressure and temperature, the pressure is instantly reduced. Then a temperature in the sample goes down according to a decompressing time, and finally the sample freezes. Of course, water consumes latent heat to change its phase into ice, which has to be taken into consideration. Instant freezing is made possible by reducing pressure right before the water changes its phase into ice, after the water reaches the prescribed temperature with the prescribed pressure. A phrase, “no gas phase exists” means that water is degassed; and it means that no bubbles can be seen on the walls of the pressure-resistant vessel or the outside surface of the sample.

Example 1

FIG. 20 indicates a diagram of water which is commonly known. The horizontal axis indicates pressure applied on water, while the vertical axis indicates temperature; information on a high temperature region is skipped because there is no need for it. The triple point of water coincides with the pressure 0 point on line segment 2005 (on the vertical axis of FIG. 20) which divides liquid water region 2001 and ice-I region 2002. Ice changes into various phases depending on pressure and temperature; there are ice-III region 2003 and ice-V region 2004, but here the relationship between the ice-I region 2002 and the liquid water region 2001 is important.

FIGS. 21 (A) and (B) indicate a cross-sectional view showing an outline of examples for describing a cell freezing method and a cell freezing apparatus according to the fourth embodiment. In FIG. 21 (A) the reference numeral 2122 indicates a stainless pressuring vessel having, in the middle, a cylinder, for example, with an 8 mm-bore and a 10 mm height, with its top end open for putting water 2121 and a sample 2124. The cylinder has a tapered top end. A pressurizing vessel 2122 is supposed to be sturdy enough to sustain the pressure applied on water. The numeral number 2123 indicates a piston, which is inserted into the cylinder of the pressurizing vessel 2122. The surface of the piston 2123 and the inside of the cylinder of the pressurizing vessel 2122 are mirror surfaces; and both of them have to be large enough for the piston 2123 to move inside the cylinder, but at the same time they have to have tight space in which a tight built-in can be realized so that no water leaks out from a contact surface of the piston 2123 and the cylinder of the pressurized vessel 2122.

A 0.1 g of liver cell tissue sample is put into the water 2121 as a sample 2124 (herein, it is regarded as a culture solution and is called a sample solution 2121). The sample solution 2121 is poured into the cylinder so that there will be no gas phase; that means the solution 2121 is poured to a degree that the solution is spilt from the cylinder so that no bubbles stick on the surface of the cylinder. Then the sample 2124 is put into the cylinder.

As described in FIG. 21 (B), the piston 2123 is slowly inserted into the pressurizing vessel 2122. As a matter of fact, this insertion is conducted with a pressurizing device 2125 utilizing hydraulics and the like. The pressurizing device 2125 is controlled with a control device 2126. At this time, by pouring a plenty of sample solution 2121 so that the sample solution overflows from the top of the pressurizing vessel 2122, it is possible to prevent air from coming inside the cylinder when the piston 2123 is inserted.

When the piston 2123 is inserted into the cylinder of the pressuring vessel 2122, pressure is applied slowly up until 0.1 GPa while paying attention so that the temperature of the sample solution 2121 inside the cylinder doesn't go up. A signal given by the control device 2126 to the pressuring device 2125 is programmed so that a scope of temperature drop and pressurization fall is within the range of not under the line segment 2005 as well as in the range of the line segment 2005 plus 4° C. In this case, it is permissible to write a program according to a previous experiment, and it is permissible to mount a thermometer not shown in the cylinder, in order to control this signal while feeding back the signal to the control device 2126. At a time when the pressure inside the cylinder, namely the pressure applied by the pressurizing device 2125, reaches 0.1 GPa; namely when the pressure reaches a state of almost the lowest temperature in the relationship between the ice-I region 2002 and the liquid water region 2001, the control device 2126 releases hydraulic pressure, reducing the pressure rapidly. That makes a liver cell tissue sample 2124′ inside the cylinder freeze.

Due to a latent heat influence of the pressurizing vessel 2122, it is in fact impossible to reduce a temperature of the sample to −20° C., but it can be cooled to around −10° C. According to molecular dynamic calculation of ice, it takes 250˜350 nanoseconds for water to change its phase into ice with only molecular reorganization, while ignoring heat conduction. Assuming that a slice of the sample 2124 is around 5 mm thick, and a pressure transmission rate is 1500 m/second, it takes about 3μ seconds to transmit pressure. It is assumed that a time needed for the freezing of the invention is from several μ seconds to several dozen μ seconds. Because of that, it is possible to freeze cells instantly.

(C) Next, a device and a method for handling separated cells in a cell-by-cell way are described.

Fifth Embodiment

Descriptions are provided below for example cases where, in order to place a prespecified number of the separated cells each in a prespecified position on a cell culture chip, hydrophilic areas are separately formed with a prespecified distance between one another on the surface of the cell culture chip, a suspension of cells is dropped as a droplet of an appropriate size containing a required number of cells from the tip of a pipet having sucked the suspension, and the size of a droplet and the number of cells are monitored and controlled by monitoring the tip of the pipet with an optical system.

Example 1

FIG. 22(a) is a plan view showing a cell culture chip 22100 advantageously used in Example 1, and FIG. 22(b) is a cross-sectional view showing the cell culture chip 22100 taken along the line A-A in the plan view and viewed in the direction indicated by the arrow. The reference numeral 2201 indicates a silicon substrate, for instance, with a thickness of 1 mm and with a size of 20 mm×20 mm. 2202 indicate walls, which are made of silicon substrates, with a thickness of, for instance, 1 mm, and with a height of 0.5 mm. An area surrounded by the walls 2202 is a hydrophobic area 2203, in which hydrophilic areas 2204 are regularly placed. The size of the hydrophilic area 2204, which is determined from the size or the number of cells to be placed in one of these areas, is approximately 400 μm×400 μm. Spacing between the hydrophilic areas 2204, which should have a distance sufficient for droplets containing the cells not to contact and not to be mixed one another, is preferably about 2000 to 4000 μm for convenience of handling. 2205 indicates a marker for positioning, which is formed on one side of the silicon substrate 2201.

In a method of producing hydrophilic areas and a hydrophobic area, for instance, the upper side of the hydrophobic silicon substrate 2201 is oxidized once to turn the entire area into a hydrophilic SiO2 thin film. Then, a hydrophobic area may be produced by dissolving and removing the SiO2 thin film in the area to be hydrophobic with hydrofluoric acid.

Example 2

FIG. 23(a) is a conceptual diagram for illustrating configuration of a system for distributing a cell to the cell culture chip 22100 in Example 2, and FIG. 23(b) is a cross-sectional view showing the state in which the cell has been placed in a hydrophilic area 2204 of the cell culture chip 22100.

In Example 2, a cell 2212 is placed in a hydrophilic area 2204 on a cell culture chip 22100 while optically monitoring a droplet formed at the tip of a pipet 2211 for distributing the cell 2212. In FIG. 23(a), 2219 indicates a stage to be driven in the direction of XY, and 2227 indicates a driving unit for the stage 2219. A heater 2222 for controlling the temperature of the cell culture chip 22100 is provided on the upper side of the stage 2219, on which the cell culture chip 22100 is placed. Above the cell culture chip 22100, the pipet 2211 is placed, in which a suspension 2213 containing the cell 2212 to be distributed has been sucked up in advance and held. At the root of the pipet 2211, a syringe pump 2231 is provided via a tube 2230, and the syringe pump 2231 is attached with a driving unit 2232. When the syringe pump 2231 is driven by the driving unit 2232, the suspension 2213 in the pipet 2211 is squeezed out together with the cell 2212. It is to be noted that a joint between the root of the pipet 2211 and the tube 2230 is illustrated as like they are separated because it is intended to show the pipet 2211 in an enlarged view, but they are not actually separated.

On the other hand, at the tip of the pipet 2211, the tip of another pipet 2220 for supplying a culture solution to the tip of the pipet 2211 is placed. At the root of the pipet 2220, a syringe pump 2235 is provided via a tube 2234, and the syringe pump 2235 is attached with a driving unit 2236. When the syringe pump 2235 is driven by the driving unit 2236, the culture solution in the syringe pump 2235 is squeezed out from the pipet 2220.

Also, a driving unit 2237 for vertical motion of the pipet to transfer a droplet formed at the tip of the pipet 2211 into a hydrophilic area 2204 of the cell culture chip 22100 is provided. Herein, the vertical motion driving unit 2237 is correlated to the pipet 2211. When a signal to lower the pipet 2211 is given to the vertical motion driving unit 2237 by a user, the pipet 2211 is moved downward and the droplet formed at the tip of the pipet 2211 is transferred into a hydrophilic area 2204 of the cell culture chip 22100. When a signal to restore the pipet 2211 is given to the vertical motion driving unit 37 by the user, the pipet 2211 is moved back to the position shown in the figure. Restoration of the pipet 2211 to the position shown in the figure may be carried out time-sequentially after the downward operation using a PC 2226. An alternate long and short dash line 2239 denotes a correlation between the vertical motion driving unit 2237 and the pipet 2211.

Further, a light source 2216 and a condenser lens 2217 are provided, which construct an optical system for monitoring the size of a droplet formed inside the pipet 2211 adjacent to the tip and formed at the tip of the pipet 2211, while in the opposite position to the light source and the condenser lens, a collimate lens 2218 and a monitor 2225 are provided below the cell culture chip 22100. Accordingly, the cell culture chip 22100, the heat regulator 2222, and the stage 2219 must be optically transparent. 2226 indicates a PC, which provides a control signal obtained from a prespecified program stored in advance in response to an input signal from the monitor 2225, and necessary signals for the driving units 2227, 2232 and 2236 in response to an operation input signal 2228 which the user gives while watching the display screen of the monitor 2225. Although it is not shown in the figure here, it is convenient that the same display as the screen of the monitor 2225 detecting are displayed on the monitor screen of the PC 2226. Thus, the monitor 2225 can be a small CCD camera. The operation input signal 2228 is to be given via an input device of the PC 2226.

Consideration about the size of the pipet 2211 is provided as follows. The pipet 2211 must be able to form a droplet of an appropriate size containing a required number of cells, at the tip thereof. On the other hand, in the pipet 2211, the suspension containing cells is sucked up by the pipet prior to its use, and when forming a droplet, the cells passing through the tip of the pipet 2211 must be detected by the monitor 2225 without error. Therefore, the diameter of the tip of the pipet 2211 allows only a cell or a mass of a prespecified number of cells to pass through, but does not allow cells to pass through at once so many as uncountable. Namely, unlike pipets for culture with a large diameter currently used for general purpose, it is preferable to be transparent and to have a diameter at the tip of 20 to 100 μm for general animal cells, or of about 5 μm for microbes such as bacteria.

An operation to distribute a cell 2212 into a hydrophilic area 2204 of the cell culture chip 22100 is described below. Firstly, when the system is started-up, the user positions the cell culture chip 22100 to lie in a prespecified start-up position by focusing attention on the marker 2205 described in FIG. 22(a). Next, in response to the operation input signal 2228 which transfers the first distribution position of the cell 2212 to the position corresponding to the tip of the pipet 2211 and pipet 2220, the stage 2219 is operated with the driving unit 2227. When the cell culture chip 100 reaches a prespecified position, an operation is carried out to eject the suspension 2213 in the pipet 2211 together with the cell 2212. In this step, the outside of the tip and the inside adjacent to the tip of the pipet 2211 are monitored with the optical system including the light source 2216 and the monitor 2225. Output from the monitor 2225 is captured into the PC 2226, and the driving unit 2232 is activated based on a result of image computing by the PC 2226, to control a transfer of liquid in the syringe pump 2231.

While monitoring the tip of the pipet 2211 with the monitor 2225, the driving unit 2232 is moved by activating the driving unit 2232, and a droplet 2221 is formed at the tip of the pipet 2211 by ejecting the suspension 2213 containing the cell 2212 from the tip of the pipet. In this step, the PC 2226 determines through the monitor 2225 that a prespecified number of cells are inserted into the droplet 2221, and sends a stop command to the driving unit 2232 to stop the syringe pump 2231.

To simplify descriptions, it is described below as the number of cells 2212 to be inserted into a droplet 2221 is one, but the number of cells may be discretionally determined by the user according to a purpose. For instance, it may be 10 cells. Identification of the cell 2212 may be carried out just by directly detecting the cell 2212 present in the droplet 2221 at the tip of the pipet 2211, but more efficiently, the syringe pump 2231 may be controlled by monitoring the cell 2212 passing inside the pipet 2211 with the monitor 2225, and by calculating the cell's position and passing speed inside the pipet with the PC 2226 to predict a timing of ejecting the cell into the droplet 2221 from the tip of the pipet 2211. Using the latter identification method, it is advantageous for inserting just one cell into the droplet, for instance, when a plurality of cells is passing inside the pipet 2211 at a short interval.

When the cell concentration of the cell suspension 2213 is low, each droplet 2221 can be made in a certain size by starting to form the droplet 2221 just before a cell being ejected from the tip of the pipet 2211 and then stopping droplet formation after a prespecified time period. When a droplet is not required to be formed, for instance, liquid being ejected from the tip of the pipet 2211 may be blown off with a blower. Alternatively, a drain may be provided outside the substrate 2201 to eject the unwanted liquid thereto.

On the other hand, when the cell concentration of the cell suspension 2213 is high, quantities of drops ejected from the pipet 2211 are varied. Namely, since the frequency of ejection of a cell 2212 being ejected from the pipet 2211 increases, if the time period for ejecting liquid is fixed at a prespecified time period, the next cell may possibly be inserted into the same droplet 2221 within the time period. In such a case, the pipet 2220 is to be used. In the pipet 2220 and the syringe pump 2235 correlated thereto, only culture solution or cell dilution is held. Namely, when via the monitor 2225 the PC 2226 checks that a cell 2212 enters a droplet 2221, it issues a stop command to the driving unit 2232 to stop the syringe pump 2231 as well as it calculates the volume of the droplet 2221 at that moment based on the fed quantity until that moment by the syringe pump 31 driven to form droplets 2221. The difference between this volume and the desired volume of a droplet 2221 is calculated with the PC 2226. According to this calculation result, the PC 2226 sends an operation signal to the driving unit 2236 so as to add culture solution or cell dilution with the pipet 2220 to the droplet 2221 which has been already formed, so that liquid is added to the droplet 2221 using the pipet 2220 by driving the syringe pump 2235 until the volume of the droplet 2221 reaches a prespecified value.

In this step, in order to prevent the cell in the droplet from flowing back to the pipet 2220, the tip of the pipet 2220 preferably has a size unavailable for a cell to pass through, for instance, with a diameter of 0.2 μm. Alternatively, the tip may preferably have a structure with 0.2 μm filter.

The droplet 2221 containing a single cell produced in this way is contacted with a hydrophilic area 2204 on the substrate 2201 placed on the stage 2219 using the vertical motion driving unit 2237 for the pipet 2211, then the droplet 2221 is transferred into the hydrophilic area 2204 on the substrate 2201. When the transfer is checked of the droplet 2221 containing the cell 2212 into the hydrophilic area 2204 on the substrate 2201, namely, the hydrophilic area 2204 of the cell culture chip 22100, the user gives an operation signal 2228 to move a stage driving unit 2210, and moves the cell culture chip 22100 so that the tip of the pipet is to be positioned in a position for the next droplet to be placed. This movement can be automatically carried out by the PC 2226 as positional information of the hydrophilic areas 2204 has been provided to the PC 2226. Then, in this new position, a new droplet is formed at the tip of the pipet 2211 as described above, and transferred into another hydrophilic area 2204 of the cell culture chip 22100. By repeating this step, droplets are placed in required positions in hydrophilic areas 2204 of the cell culture chip 22100. All of these operations are carried out in a moist atmosphere in order to avoid drying. When placement of droplets 2221 is finished, the whole area surrounded by the walls 2202 is filled with silicon oil 2238.

FIG. 23(b) is a cross-sectional view showing the state in which the cell has been placed in a hydrophilic area 2204 of the cell culture chip 22100, by a system for distributing a cell to the cell culture chip 22100 in Example 2, as described with reference to FIG. 23(a). A cell 2212 and a droplet 2215 enveloping thereof are placed in a hydrophilic area 2204 within the area surrounded by the walls 2202 on the silicon substrate 2201. The area surrounded by the walls 2202 is fully filled with silicon oil 2238. Since each droplet 2215 is about 0.2 to 2 al, the droplet 2215 is protected from drying by filling silicon oil 2238 inside the walls 2202 of 0.5 mm in height.

The reason for using silicon oil here is because silicon oil has excellent gas permeability. This allows to supply oxygen constantly to the cell 2212 in the droplet 2215, and to keep the cell 2212 alive in a very small quantity of culture solution. The thickness of the silicon oil is preferred to be thinner, but thick enough to cover the droplet 2215, for instance, so as to be 0.5 mm in depth, the silicon oil being poured softly. Depending on kind and state of the cell, for instance, in a case of epithelial cells, this allows them to be observed usually for several hours. For cell observation, the monitor 2225 may be used, or alternatively the chip may be transferred to another device for observation.

Example 3

In order to observe the cells by incubating for longer hours, ensuring oxygen permeability is not enough and a droplet 2215 enveloping a cell 2212 must be exchanged with a new culture solution.

FIG. 24 is a conceptual diagram illustrating system configuration in Example 3 in which the function for exchanging a droplet 2215 enveloping a cell 2212 with a new culture solution in the system configuration in Example 2 is emphasized. In practice, a pipet 2220 and a tube 2234 correlated thereto, a syringe pump 2235, and a driving unit 2236 in the system configuration in Example 2 can be used, therefore descriptions are provided with reference to FIG. 23 but without irrelevant parts deleted from the configuration. It is needless to say that a pipet 2220 and a tube 2234 correlated thereto, and a syringe pump 2235 may be exchanged with new ones from a point of view to avoid contamination or the like.

The stage 2219 is moved so that the tip of the pipet 2220 comes in a position of the droplet 2215 to be exchanged with a new culture solution, and the droplet 2215 in question is monitored with the monitor 2225. While monitoring the droplet 2215 and the tip of the pipet 2220 with the monitor 2225, the pipet 2220 is inserted into the droplet 2215. Here, the vertical motion driving unit 2237 is to be correlated to the pipet 2220. To the vertical motion driving unit 2237, a signal to lower the pipet 2220 is given by the user, then the pipet 2220 is moved downward and the tip of the pipet 2220 is inserted into the droplet 2215.

After it is checked via the monitor 2225 that the tip of the pipet 2220 is inserted into the droplet 2215, the user gives a signal 2228 to exchange culture solution to the PC 2226. If the PC 2226 has been given with information about the size of the droplet 2215 and the number and size of cells enveloped therein, in response to the signal 2228 to exchange culture solution, the PC 2226 can automatically and time sequentially carry out operations to eject (to absorb and throw away) a prespecified amount of old culture solution and to supply a new culture solution containing such as substrates and growth factors by driving the syringe pump 2236. In this step, it is important that the cell 2212 enveloped in the droplet 2215 must not be ejected together with the old culture solution, and unwanted bacteria must not contaminate with the new culture solution.

For this purpose, the tip of the pipet 2220 preferably has an inner diameter not to suck in any cell, for instance, 0.2 μm. Alternatively, the tip may have a structure with 0.2 μm filter. Further, the pipet 2220 and the tube 2234 correlated thereto, and the syringe pump 2235 should be treated to keep them sufficiently clean.

Example 4

Operations to incubate cells for a prespecified period of time, to complete observation by the monitor 2225, and to recover only a prespecified cell are described.

FIG. 25 is a conceptual diagram showing system configuration in Example 4 in which the function for recovering a cell from inside of the droplet 2215 enveloping a prespecified cell 2212 in the system configuration shown in Example 2 is emphasized. In practice, a pipet 2211 and a tube 2230 correlated thereto, a syringe pump 2231, and a driving unit 2232 in the system configuration in Example 2 can be used, therefore descriptions are provided with reference to FIG. 25 but without irrelevant parts deleted from the configuration. It is needless to say that a pipet 2211 and a tube 2230 correlated thereto, and a syringe pump 2231 may be exchanged with new ones from a point of view to avoid contamination or the like. Further, considering for recovering a cell, a pipet 2211 may have a larger diameter.

By moving the stage 2219 so as to lie in a position of the droplet 2215 enveloping the cell to be recovered, the droplet 2215 in question is monitored with the monitor 2225. While monitoring the droplet 2215 and the tip of the pipet 2211 with the monitor 2225, the pipet 2211 is inserted into the droplet 2215. Herein, the vertical motion driving unit 2237 is to be correlated to the pipet 2211. To the vertical motion driving unit 2237, a signal to lower the pipet 2211 is given by the user, then the pipet 2211 is moved downward and the tip of the pipet 11 2211 is inserted into the droplet 2215, to recover the cell 2212 in the droplet 2215 by sucking it up into the pipet 2211.

After it is checked via the monitor 2225 that the tip of the pipet 2211 is inserted into the droplet 2215, the user gives a signal 2228 to suck the cell 2212 in the droplet 2215 to the PC 2226. If the PC 2226 has been given with information about the size of the droplet 2215 and the number and size of cells enveloped therein, in response to the signal 2228 to suck in the cell 2212, the PC 2226 can automatically and time sequentially carry out an operation to suck the cell 2212 into the pipet 2211 together with the culture solution by driving the syringe pump 2231. Herein, since sucking is carried out by inserting the pipet 2211 into the droplet 2215 enveloping the cell 2212 through the silicon oil 2238, more or less the silicon oil 2238 is sucked up together, but it can be ignored without problem.

The cell 2212 sucked into the pipet 2211 is ejected to a prespecified recovery container to recover the targeted cell.

After recovering the targeted cell, when recovering a cell 2212 from another droplet 2215, the stage 2219 is moved so that a droplet 2215 enveloping a new cell to be recovered lies in a position able to be monitored with the monitor 2225, while monitoring the new droplet 2215 in question with the monitor 2225, the new cell is sucked into the pipet 2211 and ejected into a prespecified recovery container to recover the new targeted cell, according to the procedure as described above.

Consideration about the size of the pipet 2211 suitable for Example 4 is provided as follows. When producing a droplet in Example 2, the pipet 2211 preferably has a diameter at the tip of 20 to 100 μm for general animal cells, or of 5 μm for microbes such as bacteria, however, considering ejection of cells after a prespecified time period of incubation in Example 4, the pipet needs a sufficiently large diameter to suck up a mass of cells made by cell division. Specifically, it is approximately 100 to 400 μm.

Example 5

FIG. 26(a) is a plan view showing another configuration of the cell culture chip 22100 in Example 5 advantageously applicable to a fifth embodiment of the present invention; FIG. 26(b) is a cross-sectional view showing the cell culture chip 22100 above taken along the line A-A in the plan view and viewed in the direction indicated by the arrow; and FIG. 26(C) is a view illustrating a method of forming a droplet. By comparing FIG. 26(a) and FIG. 22(a), it is obvious that the cell culture chip 22100 in Example 5 has the same planar structure as that in Example 1. Also materials, size and a producing method are the same. The cross-sectional structure of the cell culture chip 22100 in Example 5 is different from that in Example 1. Namely, hydrophilic areas 2204 are formed as wells, while it is the same that the area surrounded by the walls 2202 is the hydrophobic area 2203, in which hydrophilic areas 2204 are regularly placed. The size of the well is to be 400 μm in diameter (or 400 μm×400 μm) and 100 μm in depth.

As shown in FIG. 26(c), in this Example 5, silicon oil 2238 is applied in advance over the area surrounded by the walls 2202. Passing through the layer of silicon oil 2238, the pipet 2211 and the pipet 2220 in Example 2 as described with reference to FIG. 23 are inserted, and within the well 2204, by supplying the cell suspension 2213 from the pipet 2211 and dilution from the pipet 2220, a droplet 2221 is formed directly in a well in a hydrophilic area 2204. By contacting the tips of the pipets 2211 and 2220 with walls of the well on the substrate 2201, the formed droplet 2221 is automatically formed inside the well, to be used as the droplet 2215 in Example 2.

Also in Example 5, the well area to form the droplet 2221 and the tips of the pipets 2211 and 2220 have to be controlled while monitoring with the monitor 2225, but the figures and descriptions are simplified because it can be understood easily from the description in Example 2.

Example 6

In the examples as described above, a pipet is described in each case as it has one function, while in Example 6, an example of a pipet having two functions is described.

FIG. 27(a) is a view showing a tip of a pipet 2281 having two flow paths separated by a partition plate 2282, and FIG. 27(b) is a view showing configuration in which a pipet 2289 is provided inside a pipet 2287 to form two flow paths.

In the configuration shown in FIG. 27 (a), by making a first flow path 2283 sufficiently larger than a second flow path 2284, and by designing a structure in which cell suspension can be supplied from the first flow path 2283 and dilution can be supplied from the second flow path 2284, the pipet 2211 and the pipet 2220 described in Example 2 can be integrated. It is needless to say that controls of the respective flow paths are carried out with respective independent syringe pumps.

In the configuration shown in FIG. 27(b), the inner pipet 2289 has an inner diameter of 50 μm, and spacing therefrom to the inner wall of the outer pipet 2287 is up to 8 μm. This allows cell suspension to be supplied from the inner pipet 2287 and dilution to be supplied from the outer pipet 2289, so that the pipet 2211 and the pipet 2220 described in Example 2 can be integrated. It is needless to say that controls of the respective flow paths are carried out with respective independent syringe pumps.

In each case, the size of a pipet for supplying dilution is determined so as to avoid getting mixed with cells from the pipet for supplying cell suspension, so that the pipet 2211 and the pipet 2220 described in Example 2 can be integrated.

Other Examples

In any example described above, underneath the substrate 2201, there is a device 2222 for controlling a substrate temperature in case of incubation of cells. Incubation is basically carried out while observing cells via microscope, the substrate 2201 itself should be transparent. The heater 2222 for controlling temperature should also be transparent, for which ITO element may be preferably used. When it is not ITO element, for instance, a structure inside which transparent and thermally controlled circulation fluid flows may be used. In this case, limitations may occur in the optical system of the monitor 2225, but it is to be solved by using long-focus objective lens.

With respect to measurement of the number of cells passing through the tip of a pipet, it can be measured by checking a cell being ejected from the pipet, for instance, via installation of a pair of electrodes at the tip of the pipet to capture an electrical change when ejecting a cell from the pipet, or via irradiation of laser light to the tip to detect light scattering when a cell passing through.

By using a function of exchanging a droplet 2215 enveloping a cell 2212 with a new culture solution, which is described with reference to FIG. 24, influences on cells can be assessed by injecting various materials influential on cells, for instance, substrates for culturing cells, growth factors, chemical substances such as cytokine or endocrine disrupting chemicals.

Sixth Embodiment

A reliable droplet manipulation is disclosed as a sixth embodiment in which any droplet selected from a droplet group arranging densely on the substrate are transferred to a predefined position. In particular, droplet transfer lines with hydrophilic property are arranged in the shape of matrix on the substrate with an insulating surface having water-repellent property, and a droplet holding area is provided at both ends of the droplet transfer lines. A droplet is formed at the droplet holding area and only a targeted droplet to be transferred is charged. When an electrode with the same polarity as the electricity charged to the targeted droplet closes to the targeted droplet, the targeted droplet is transferred by a repulsion force generated between the electrode and the targeted droplet along the droplet transfer line with hydrophilic property. The transferred droplet is stopped in the droplet holding area with hydrophilic property, and then discharged to keep stable at the position. The transferred droplet is contacted with any other droplet in the droplet holding area to be reacted thereto.

Example 1

FIG. 28 (a) is a perspective view showing a substrate applicable to the droplet manipulation according to the sixth embodiment of the present invention; FIG. 28(b) is a perspective view showing the substrate in which discrete droplets to be reacted are placed on a surface of the substrate; and FIG. 28(c) is a perspective view schematically showing the substrate during the droplet manipulation.

In FIG. 28(a), a reference numeral 28100 denotes a substrate made of an insulating material, the whole surface thereof having water-repellent property; droplet transfer lines 2823 and 2824 with hydrophilic property are formed in a shape of matrix on the surface thereof; droplet holding areas with hydrophilic property a, b, . . . , p and droplet-holding areas with hydrophilic property 1, 2, . . . , 16 are formed on both ends of the droplet transfer lines 2823 and 2824 in shape of matrix, in this example the droplet holding areas with hydrophilic property a, b, . . . , p and the droplet holding areas with hydrophilic property 1, 2, . . . , 8 are used as a droplet holding area for holding a droplet to be reacted, whereas the droplet-holding areas with hydrophilic property 9, 10, . . . , 16 are used as a droplet holding area for holding a droplet after two droplets are collided and reacted to each other. It is assumed in this example that the droplet is 0.1 to 1 μl in quantity, the droplet holding area is for instance 30 μmφ dot with hydrophilic property, and the hydrophilic lines 2823 or 2824 used as a path for droplet transfer is 2 μm in width. The droplet can be pushed out from the droplet holding area onto the hydrophilic lines 2823, 2824 by the repulsion force generated by the static electricity, and role along the line. The reference numeral 28101 denotes a positioning mark.

In order to make the droplet on the droplet holding area receive the repulsion force generated by the static electricity, the droplet is required to be charged. This charging manipulation is a modification based on a method described on Micro Total Analysis Systems 2004, vol. 1, pp. 144-146 (Proceedings of μ TAS 2004, 8th International Conference on Minitualized Systems for Chemistry and Life Sciences, ISBN 0-85404-643-7 or the like. FIGS. 29(a) and 29(b) are views showing a process for making the droplet on the droplet holding area to be charged, in which FIG. 29(a) shows an initial stage of making the droplet charged, and FIG. 29(b) shows a state in which the charged droplet is transferred to the droplet holding area.

In this example, the substrate 28100 is made of an insulating material, and a reference numeral 28201 is the droplet holding area described in FIG. 28 with a droplet 28204 is formed therein. There is provided an electrode 28112 on an area in the back of the substrate 28100 corresponding to the droplet holding area 28201. A capillary 28210 is provided on the droplet holding area 28201, capable of contacting the droplet 28204 freely, with a conductive solution 28211 filled therein, and contacting the electrode 28212 at the opposite side thereof. A predetermined voltage is applied to the electrodes 28112 and 28212, and then the solution 28211 on the edge of capillary 28210 contacts with the droplet 28204. As a result, when the voltage is loaded so as to make the electrode 28112 positive and the electrode 28212 negative, the droplet 28204 and the solution 28211 within the capillary are polarized generally, where the droplet 28204 carries excessive negative electricity 28221. In the state described above, when the capillary 28210 is lifted away from the droplet 28204 immediately, the droplet 28204 is charged with negative electricity as shown in FIG. 29(b). On the contrary, in a case where a voltage is loaded so as to make the electrodes 28112 negative and the electrode 28212 positive, the droplet 28204 can be charged with positive electricity. As described hereinafter, the voltage applied to between the electrodes 28112 and 28212 can be determined whether it is applied or not via a switch 28115 on a switchboard 2874.

FIG. 30(a) is a cross-sectional view showing a relation between an electrode portion for charging in the droplet holding area of the substrate 28100 and the switchboard 2874; and FIG. 30(b) is a cross-sectional view showing the relation between an electrode portion for discharging in the droplet holding area of the substrate 28100 and the switchboard 2874. Namely, FIG. 30(a) is a cross-sectional view showing the electrode portion of the hydrophilic droplet holding areas a, b, . . . , p or the hydrophilic droplet holding areas 1, 2, . . . , 8, each area holding a droplet to be reacted; and FIG. 30(b) is a cross-sectional view showing the electrode portion of the hydrophilic droplet holding areas 9, 10, . . . , 16 each holding a droplet to induce reaction by colliding droplets or a resulted droplet after reaction and integration.

As shown in FIG. 30(a), an electrode 281121 is provided at an area on the back face of the substrate 28100 corresponding to the droplet holding area 282011 with the droplet to be reacted. When the droplet is formed on the droplet holding area 282011, the droplet faces to the electrode 281121 provided in a position on the back face of the substrate 28100 corresponding to the droplet. The switchboard 2874 is provided on the back of the substrate 28100. The switchboard 2874 has a connecting electrode 281141 in a position corresponding to the electrode 281121 on the back face of the substrate 28100. When the substrate 28100 is mounted on the switchboard 2874, the electrode 281121 and the connecting electrode 281141 corresponding thereto are connected each other. The connecting electrode 281141 is connected with a power supply 28116 through the switch 28115 capable of switching open or close selectively. As described above in FIGS. 29(a) and 29(b), when the switch 28115 is closed and the voltage is applied to between the droplet on the droplet holding area 282011 and the electrode 281121, the droplet is charged. In the Figs. the switch 28115 is described as an independent part, however, it can be acceptable that the switchboard 2874 is a silicon substrate including semiconductor circuits and the on-off switching operation thereof is controlled with a personal computer 2876 as described hereinafter.

As shown in FIG. 30(b) similarly, in the droplet holding area 282012 for holding the resultant droplet after two droplets are collided and reacted to each other to be integrated, electrodes 28110 are provided to be contacted with the droplet. The electrodes 28110 are connected with an electrode 281122 provided in a position corresponding to the back of the substrate 28100 by a connecting line 28111. A connecting electrode 281142 is provided in a position corresponding to an electrode 281122 of the switchboard 2874, therefore, when the substrate 28100 is mounted on the switchboard 2874, the electrode 281122 and the connecting electrode 281142 corresponding thereto are connected to each other. The connecting electrode 281142 is grounded. As a result, when a droplet enters the droplet holding area 28201, the droplet is discharged and kept stable in the area. Needless to say that capacitance of the switchboard 2874 or circuits in the example should be minimized.

FIG. 28(b) shows a state in which a droplet is formed on the droplet holding areas a, b, . . . , p and the hydrophilic droplet holding areas 1, 2, . . . , 8 on the substrate 28100. The droplet forming is carried out, for instance, with a method described below.

FIG. 31 is a view schematically showing a configuration in which a droplet with a cell 2862 is formed at a tip of a pipet 2861, and the cell is distributed, while optically monitoring, to the droplet holding area of the substrate 28100. A reference numeral 2869 indicates a stage to be driven toward X or Y directions; and a reference numeral 2877 indicates a driving device for driving the stage 2869. The switchboard 2874 is provided on an upper surface of the stage 2869, and the substrate 28100 is mounted on the upper surface thereof. On an upper part of the substrate 28100, the pipet 2861 is provided with a suspension 2863 including the cell 2862 prepared therein. When the cell to be put in the droplet is changed, the pipet 2861 is exchanged for a new one in order to prevent contamination. At a root of the pipet 2861, a syringe pump 2881 is provided via a tube 2880 with a driving device 2882 attaching to the syringe pump 2881. When the syringe pump is driven by the driving device 2882, the suspension 2863 in the pipet 2861 is pushed out accompanying the cell 2862.

While at the tip of pipet 2861, a tip of a pipet 2870 for supplying a culture solution to the pipet 2861 is provided. At a root of the pipet 2870, a syringe pump 2885 is provided via a tube 2884, with a driving device 2886 attaching to the syringe pump 2885. When the syringe pump 2885 is driven by the driving device 2886, the culture solution in the syringe pump 2885 is pushed out from the pipet 2870.

A vertical motion driving device 2887 for a pipet is provided to place the droplet formed on the tip of the pipet 2861 to the substrate. In this example, the vertical motion driving device 2887 is connected with the pipet 2861. When the vertical motion driving force 2887 receives a signal for lowering the pipet 2861 by a user, the pipet 2861 moves downward and the droplet formed on the tip thereof is transferred to the droplet holding area on the substrate 28100. When the vertical motion driving device 2887 receives a signal for returning to the normal position by the user, the pipet returns to the normal position as described in the figure. Restoration of the pipet 2861 to the position shown in the figure may be carried out time-sequentially after the downward operation using a personal computer 2876. An alternate long and short dash line 2889 denotes a correlation between the vertical motion driving unit 2837 and the pipet 2861.

Further, in order to monitor a size of the droplet formed on the tip of the pipet 2861 and inside near the tip thereof, there is provided an optical system including a light source 2866, a condenser lens 2867, a collimating lens 2868, and a monitor 2875, the latter two provided on the bottom of the substrate 28100 in a position opposing to the former two. The substrate 28100, the switchboard 2874, and the stage 2869, therefore, are required to be optically transparent. In this example, reference numeral 2876 indicates a personal computer, which transmits controlling signals according to prespecifed program stored therein responding to an input signal via the monitor 2875 by a user and necessary signals to the driving devices 2877, 2882, 2886 and 2887 responding to the operational input signals 2878 given by the user while monitoring a display screen of the monitor 2875. Though not shown in the figure, it is convenient to display the same screen on a monitor on the personal computer 2876 as that being detected by the monitor 2875, the monitor 2875 can operate as a small CCD camera. Also, the operating input signal 2878 is transmitted via an input device of the personal computer 2876.

With regard to the size of the pipet 2861, a transparent pipet is preferable having a tip thereof with the diameter of around 20 to 100 μm for a general animal cell and of around 5 μm for a microorganism such as bacteria, based on the same reason as described in Example 2 of the fifth embodiment.

A process is described as follows in which a cell 2862 is distributed to the droplet holding area on the substrate 28100. At first when the system starts up, the user positions the substrate 28100 at a predefined starting-up position with reference to the marker 28101 shown in FIG. 28. Secondly the user operates the stage 2869 by the driving device 2877 responding to an operating input signal 2878 to adjust an initial distributing position for the cell 2862 to a position corresponding to the tips of pipet 2861 and 2870. When the substrate 28100 moves to the predefined position, an operation for discharging a cell suspension 2863 within the pipet 2861 accompanying the cell 2862, while monitoring the outside of the pipet 2861 at the tip thereof and the inside of the pipet 2861 near the tip thereof with the optical system including the light source 2866 and the monitor 2875. Controls of sending the solution from the syringe pump 2881 can be provided by capturing the output from the monitor 2875, and operating the driving device 2882 based on computed results of images by the personal computer 2876.

The droplet is formed on the tip of the pipet 2861 by operating the driving device 2882 while monitoring the tip of the pipet 2861 through the monitor 2875 to operate the syringe pump, and discharging the suspension 2863 including the cell 2862 from the tip of the pipet 2861. At that time, after the personal computer 2876 recognizes through the monitor 2875 that the predefined number of cells is inserted in the droplet, the personal computer 2876 commands the driving device 2882 to stop for stopping the syringe pump 2881.

In order to make the description simple, the number of the cell 2862 inserted in the droplet is assumed to be one in this example. However, the user can change the number thereof according to a user's purpose to, for instance, 10 or the like. In order to recognize the presence of the cell 2862, the method of directly detecting the cell 2862 present in the droplet 2871 formed at the tip of the pipet 2861 may be enough. However, more effective method is allowable such as, monitoring the cell 2862 moving inside the pipet 2861 with the monitor 2875, computing the position of the cell 2862 and a moving velocity thereof in the pipet 2861 with the personal computer 2876, and controlling the syringe pump 2881 based on the calculated timing of discharging the cell 2862 into the droplet 2821 from the tip of the pipet 2861. The latter recognizing method may bring advantages in a case where only one cell is inserted into a droplet when several cells are moving inside the pipet at a short interval.

In a case where the cell suspension 2863 has a low cell density, a droplet can be formed of a prespecified size by forming the droplet 2871 just before the cell comes out from the tip of the pipet 2861, and stopping the droplet forming after a predefined period of time. When formation of the droplet is not desired, the suspension coming out from the tip of the pipet 2861 may be blown out. Alternatively, the liquid may be discharged to a drain provided outside the substrate 2801.

On the other hand, in a case where the cell suspension 2863 has a high cell density, the amount of suspension discharged from the pipet 2861 is not varied. Namely, as the cell 2862 is discharged from the pipet 2861 more frequently, if the time for discharging the suspension is fixed, the next cell may be disadvantageously inserted into the droplet 2871 within such period of time. To deal with the case described above, the pipet 2870 is used. The pipet 2870 and the syringe pump 2885 connected thereto are filled only with the culture solution or the cell diluted solution. Namely when the personal computer 2876 recognizes via monitor 2875 the cell 2862 inserted in the droplet 2871, the personal computer 2876 commands the driving device 2882 to stop for stopping the syringe pump 2881, calculates the volume of the droplet 2871 at that time based on a fed amount from the syringe pump 2881 driven to form the droplet 2871, and computes the difference between the calculated volume of the droplet 2871 and the desired volume. According to the computed result, the personal computer 2876 sends an operational signal to driving device 2886, so that a culture solution or a cell diluted solution is added to the droplet 2871 being produced at that time with a pipet 2870, makes the syringe pump 2885 drive, and adds the solution to the extent that the volume of droplet 2871 becoming the predefined value using the pipet 2870.

To prevent the cell in the pipet 2870 from going backward, the pipet 2870 is preferably of the size through which the cell can not pass, for instance 0.2 μmφ, or has a filter structure with the size of 0.2 μm provided at the tip thereof.

The droplet 2871, which is formed with the method described above and contains a single cell, is contacted with a cell holding area on the substrate 28100 placed on the stage 2869 by the vertical motion driving device 2887 of the pipet 2861, and moves to the cell holding area on the substrate 28100. When it is confirmed that the droplet 2871 including the cell 2862 moves to the cell holding area, namely the droplet holding area on the substrate 28100, the user operates the stage driving device 2877 by giving an operational signal 2878, and moves the substrate 28100 to the position where the tip of the pipet is set to a position for placing a next droplet. The personal computer 2876 can automatically operate the process, if positional information concerning placement of the hydrophilic area 4 has been stored in the personal computer 2876 in advance. In the new position, the next droplet is formed at the tip of the pipet 2861 and is moved to the droplet holding area on the substrate 28100 as described above. By repeating this process, the droplet is placed to the correct position in the droplet holding area on the substrate 28100. In a case where the formed droplet does not include a cell or the like, the pipet 2870 for adjusting the size of the droplet and the related device thereto is not necessary.

FIG. 28(c) shows conceptually a process for integrating to react any of droplets selected from a droplet formed in the droplet holding areas a, b, . . . , p and the hydrophilic droplet holding areas 1, 2, . . . , 8 on the substrate 28100. Also FIG. 28(c) shows a state where the droplet 28102 is transferred from the droplet holding area 3 to the droplet holding area 11 and discharged, the droplet 28103 charged with negative electricity is transferred from the droplet holding area e to a point where two droplet transfer lines crossing each other, one line extending from the droplet holding area e and the other extending from the droplet holding area 3, and the droplet 28105 charged with negative electricity is transferred from the droplet holding area 1 along the droplet transfer line extending from the droplet holding area 1. Of those droplets, the droplets charged with negative electricity are transferred by a manipulation rod 28107. Because the manipulation rod 28107 is charged with electricity in the same polarity as droplets to be transferred, the droplets can be transferred just by making the manipulation rod 28107 close to the droplets from the opposite side to the direction the droplets transferred thereto, without touching the droplets. The other droplets do not move because they are not charged, even being adjacent to each other. In the figures, the droplets 28103 and 28105 are transferred at the same time, though in the actual operation, the droplet is moved one by one. The detailed process for transferring a droplet by the manipulation rod is described below.

FIG. 32 is a view schematically showing a state where the droplet 28105 is transferred with the manipulation rod 28107 on one of the droplet transfer lines shown in FIG. 28. In this case, the pipet 2861 is replaced by the insulating manipulation rod 28107 charged with electricity, as similar to the case of forming a droplet described above in FIG. 31, the manipulation rod 28107 is moved upward or downward under the control by the vertical motion driving device 2887 with an operational signal 2878 while monitoring the tip of the manipulation rod 28107 and the droplet 28105 via monitor 2875, and the direction to which the stage 2869 moves is also controlled, paying attention not to contacting the manipulation rod 28107 with the droplet 28105. With this case described above, the vertical motion driving device 2887 simply controls upward or downward operations, however, as is obvious with reference to FIG. 28(c), the driving device preferably deals with operations for the other directions because the droplet to be moved may need to be turned. Namely, desirable positioning and formation should be made for the driving device 2887, so that a droplet receives a repulsion force from backside at any time.

While the droplet 28105 is transferred between the hydrophilic droplet holding areas after pushed away by the repulsion force generated between the manipulation rod 28107 and the droplet 28105, the droplet 28105 is discharged due to contacting the electrode to be grounded, and stops automatically in a position with lower energy. The driving device 2887 lifts up the manipulation rod 28107 and prevents it from contacting with the droplet 28105.

The droplet manipulation with the manipulation rod 28107 in shape of a bar is described in FIG. 32, though it is more practical to use a manipulation rod 28107′ with a shape of ring in FIG. 33. For instance in a case where the droplet 28105 charged with negative electricity is transferred along the hydrophilic lines 23 and 24, the ring of the manipulation rod charged with negative electricity is pulled down from above the droplet so as to make the droplet placed inside the ring. As both of the droplet 28105 and the ring of manipulation rod 28107′ are charged with negative electricity, the droplet keeps within around the center of the ring stably. Therefore when the ring is transferred, the droplet is also transferred, keeping within around the center thereof. With the manipulation rod described in the FIG. 32, the droplet unavoidably swings side to side during its transfer because the rod pushes the droplet from the back thereof. As a result when the speed of transfer is too high, the droplet to be transferred may deviate from the hydrophilic line. Also, the droplet usually stops in a stable position associating with the substrate, however, in a case where the speed is too high, the droplet may not stop in the position by inertial force. With the manipulation rod with a shape of a ring, on the other hand, the droplet is transferred with support from all horizontal directions, therefore the accidents such as deviating from the hydrophilic line or passing over the stop position due to the inertial force may decrease, which enables more reliable droplet transfer.

In Example 1, to confirm the droplet position on the substrate, the optical system is used for observing the substrate with a configuration including the light source 2866, the condenser lens 2867, the collimating lens 2868, and the monitor 2875, the latter two placed at the bottom of the substrate 28100 opposite to the former two. Therefore the substrate 28100 is required to be made of a transparent material. A thin-layer silicon substrate is also applicable, in this case the infrared rays, which can be absorbed into water, are used for an observation so as to confirm the droplet position easily. Of course, the optical system such as a stereo microscope from the top surface of the substrate can also be used, which allows less limited substrate compositions. The optical system is used similarly in Examples 2 and 3 described below.

Various reactions can be generated by similarly transferring and colliding another droplet to the droplet being stopped. Or other usages are possible like preparing a cell store with droplets each including a cell arranging in a shape of array and a droplet array including various chemical materials to examine an effect of a chemical material against a cell by transferring a cell and a reaction liquid assorted from any of cells and droplets to a reaction section.

Example 2

Another method of charging a droplet is described in Example 2. As in the method used in Example 2, a charged particle is launched into a droplet, those equipments used in Example 1 for charging are not required such as the electrode 28100 and the related equipments like the connecting line, the electrode, the switchboard or the power supply.

FIG. 34 is a view showing a configuration of and manipulating method for making a droplet formed similarly to the method described in FIG. 31 in the droplet holding area on the substrate 28100 shown in FIG. 28 charged with electricity. In this state, droplets 28331, 28332, . . . 28338 are still on a hydrophilic droplet holding area 32 with no electricity. The droplet 28334, which is selected arbitrary from the droplets, is charged with electricity with a charged particle launching device 28200. The charged particle launching device 28200 includes a gas compressor 2840, a solution holding container 2841, electrodes 28421 and 28422, power supply section 2843, and a solenoid valve 2844. While the solution holding container with a conductive outlet 2846 at an edge thereof is connected with the power supply 2843 by the electrode 28421, the solution holding container and the entire circuit keep an electrically floating state and are isolated from grounding. Inside of the solution holding container 2841 is partially shown in the figure. The power supply includes a power supply 28431, a condenser 28432, a blockage section 28433 and other circuits. As the charged particle launching device 28200 is provided on an upper stage of the droplet forming measure, the configuration shown in FIG. 34 is realized after forming a droplet and putting the droplet forming measure aside. Though only the bottom parts below the substrate of the optical system in the droplet forming measure is used in this example, when the upper parts have a configuration which is not obstructive to the charged particle launching device 28200, the optical system can be used in both.

The solenoid valve 2844 and the blockage section 28433 are synchronously carried out sequence operations by an instruction of the personal computer 2876 described in FIG. 31. At first, the condenser 28432 is charged with static electricity from the power supply 28431 by an instruction of the personal computer 2876. Because the blockage section 28433 is open, an electric field is not loaded on between the electrode 28421 and the electrode 28422. Though the solution holding container 2841 is applied pressure at all times by the gas compressor 2840, as the outlet 2846 is closed by the solenoid valve 2844, a solution 2848 does not come out in this state. When the solenoid valve 2844 is opened in an instant by an instruction of the personal computer 2876, the solution comes out from the outlet 2846 because the solution holding container 2841 is applied pressure. The blockage section 28433 is closed by an instruction of the personal computer 2876, just before the droplet 2845 leaves the outlet 2846. Then the outlet 2846 is charged with negative electricity and the electrode 28422 is charged with positive electricity. Therefore the droplet 2848 leaving the outlet 2846 is charged with negative electricity. As the positive electrode 28422 has a slit 2847 opened thereto, the charged droplet 2848 gets together with the droplet 28334 on the substrate 28100 passing through the slit 2847. Therefore the droplet 28334 is also charged with negative electricity. After the droplet is charged, the stage moves while monitoring though the monitor 2875 and a next droplet to be charged is charged.

As the series of the droplets 2833 is 0.1 to 1μ1 in volume, the charged droplet 2848 to be put in the droplet 2833 should be significantly smaller than the droplet 2833. The conventional technique can be used to form an extremely small droplet. The method with the solenoid valve 2844 can form a droplet in size of nanoliter level, which has already been commercialized as a DNA micro-array forming device. Such technique can be used directly. Or another technique can also be used like a technique for forming a droplet with an oscillator like piezo instead of a solenoid valve used in an existing cell sorter.

Example 3

The charged droplet 2848 is put in a droplet directly under the charged particle launching device 28200 in the example 2, so that, the stage should shift (or the charged particle launching device 28200 should shift) to select the targeted droplet 2833 to be put in the charged particle. While in the example 3, using a fact that the particle to be put in the droplet is charged, a method for controlling flight of the charged droplet is described.

FIG. 35 is a view for illustrating configuration and a manipulation method for controlling flight of a charged droplet 2858 to give an electric charge to a droplet formed by a method similar to that illustrated in FIG. 31, in a droplet holding area of the substrate 28100 shown in FIG. 28. The droplets 28331, 28332, . . . , 28338 in which the charged droplet 2858 is put are placed on the hydrophilic droplet holding area 2832 in a state of rest. Then the charged droplet 2858 is put out in a state where the electric field is loaded on between the electrodes 28421 and 28422, and the electric field is also loaded on a plate spanned between biased electrodes 28511 and 28512. In a case, for instance, where the droplet 2858 is charged with negative electricity, the electric field is loaded to make a state in which the bias electrode 28511 become positive. By controlling the size of electric field loaded on the plate between the biased electrodes 28511 and 28512 depending on the droplet position at which the charged droplet is launched, a droplet to be launched into the charged droplet 2858 therein can be selected arbitrary. Another method is allowed such as controlling an angle, for instance changing the biased electrode 28511 to 28511′ in a state where the electric field is loaded keeping a voltage of 3000. In this method, when the biased electrode 28511 is at 28511, the charged droplet is applied the stronger electric field, so that the droplet 2858 is launched into the droplet 28331 placed at outside. On the other hand when the biased electrode 28511 is at 28511′, the charged droplet is applied the weaker electric field, so that the droplet 2858 is put in the droplet 28332. Similarly, by changing the position of electrode 28512, it can be controlled which droplets 28334 or 28335 the charged droplet 2858 should be put in. The user controls via the personal computer 2876 the voltage applied to the electrode 2851, the angle of the electrode 2851, the timing of releasing the charged particle, or the like.

(D) The method for and device of culturing separated cell one by one in a long time are described below.

Seventh Embodiment

A seventh embodiment of the present invention provides a method of and a reliable system for conducting various reactions in the droplet(s) placed on a substrate. This embodiment enables to make a reaction more reproducible by keeping the volume or size of a droplet at constant values on the substrate. Further in this embodiment, a series of chemical reactions and cell culture can be carried out without unnecessary delays by freely changing the size of a droplet on a substrate in the substantially non-contact state to control concentrations of a matrix or reaction products in the droplet.

Example 1

Detailed descriptions are provided below for a method of controlling the size of a droplet when an operation takes so long a time that a droplet on a substrate may be affected by vaporization thereof and some specific operations are required to prevent this phenomenon.

The basic idea of the seventh embodiment is to realize a balance between vaporization and agglutination by making use of the that fluctuation in the size of a droplet occurs due to the difference between a vaporization rate of the solvent from the droplet in a small area on a phase boundary between the droplet and a gas phase and an agglutination rage from the gas phase to the droplet in the same area. Generally, a droplet grows when the vapor pressure of water as a solvent increases, and the size of a droplet becomes smaller when the vapor pressure thereof decreases. Because of this, the size of a droplet can be controlled, for instance, by increasing the humidity or controlling the temperature according to the saturation vapor pressure curve of the solvent.

FIG. 36A is a plan view illustrating a cell culture chip 100 advantageously applicable to the embodiment 1, while FIG. 36B is a cross-sectional view showing the cell culture chip shown in FIG. 36A taken at the line A-A and viewed in the direction indicated by the arrow. The reference numeral 3601 indicates a silicon substrate, for instance, with the thickness of 1 mm and the size of 20 mm×20 mm. The region of the top surface of the silicon substrate 3601 is a hydrophobic region 3603 with some hydrophilic regions 3604 regularly provided at intervals therein. The size of the hydrophilic region 3604 may be approximately 400 μm×400 μm depending on the size of cells or the number of the cells placed on the region. The interval between the hydrophilic regions should be wide enough so that droplets including cells are not contacted and mixed with other cells on neighboring hydrophilic regions, and is preferably approximately 2000 μm when convenience in operations dealing with the droplet(s) is taken into consideration. When the diameter of the droplet is less than 100 μm, the interval between two hydrophilic regions 3604 may be approximately 500 μm. In general, the size of a droplet, the size of the hydrophilic region, and an interval between two hydrophilic regions should be determined in accordance with the intended use thereof. FIG. 36 shows an example where hydrophilic regions are provided at a regular interval. But, in some cases when, for instance, a number of droplets are need to be mixed and reacted on a substrate as described below, it may be more effective to provide hydrophilic regions with various intervals therebetween. Basically, positions of the hydrophilic regions on a surface of the substrate should be decided assuming the case where the interval between the droplets is narrowest and also by providing the interval which is two times or larger than the size of a droplet. The reference numeral 3605 denotes an alignment marker, and the markers 3605 are formed on the entire surface of the silicon substrate 3601.

For preparing hydrophilic regions and hydrophobic regions, for instance, the top surface of the hydrophilic silicon substrate 3601 is oxidized to cover the surface with a hydrophilic SiO2 film. Then portions of the SiO2 film to be changed to hydrophobic regions are melted and removed by using hydrofluoric Acid. Alternatively, in a case where the SiO2 film is previously formed to provide a hydrophilic surface on the surface of the material of the substrate 3601, hydrophobic regions can be formed by placing hydrophobic material like fluorocarbon resin or silicon resin thereon. In this case, the height of the hydrophilic region placed on the hydrophobic region is higher than that of the hydrophobic region by the thickness of the hydrophobic material.

Another method of forming hydrophilic regions on a surface of the substrate 3601 is to make a fractal structure on the surface of the substrate 3601 by mixing powders of fluorinated carbon having super water-shedding property (fluoride pitch) during metal plating to form various Figures of fluoride pitch on the surface to make super-hydrophobic surface having 145-170 degrees of contact angle. In this case, it is also possible by treating only necessary portions on hydrophilic surface so that it will have the water-repelling property. Also the other technique generally called the super-hydrophilic treatment may be used for portions on which water drops are to be formed. The super-hydrophilic treatment is performed by forming a thin (10-20 nm) coating film with SiO2 component on the surface of TiO2 multilayered film. For using the film of titanium oxide (TiO2), it is necessary to irradiate the substrate 1 with ultraviolet rays in advance and to introduce a hydroxyl group into the surface of the TiO2. By this previous treatment, TiO2 on the surface is converted to TiOH with the super-hydrophilic property. With this method, a super-hydrophilic region with less than 10 degrees of contact angle can be retained for several weeks.

FIG. 37 is a schematic diagram view illustrating the outline of a device capable of controlling the size of droplet in Example 1 of the seventh embodiment. The substrate 3601 in FIG. 37 is prepared by oxidizing the upper surface of the silicon substrate 3601 with the above-mentioned hydrophilic property to form a hydrophilic SiO2 thin film over the whole surface, and then by melting and removing the SiO2 thin film from the portions, where hydrophobic regions are to be formed, with a fluorinated acid. The hydrophilic region 3604 on the substrate 3601 is higher than the surface of the substrate 3601. The peripheral area around the hydrophilic region 3604 is the hydrophobic region 3603. A droplet 3614 is placed on the hydrophilic region 3604. The reference numeral 3615 denotes a temperature regulator provided on the bottom surface of the substrate 3601 to control the temperature of the substrate 3601. The reference numeral 3618 denotes a temperature sensor installed on the contact surface between the substrate 3601 and the temperature regulator 3615. The reference numerals 3619 and 3620 denote water tanks for hydration, which are provided on both sides of the substrate 3601. The reference numeral 3621 denotes a stage on which the temperature regulator 3615 and water tanks 3619 and 3620 are placed. On the stage 3621, there is an upper cover 3622 in the shape of a reversed transparent vessel. The temperature regulator 3615, substrate 3601, water tanks 3619, 3620 and droplet 3614 on the substrate 3601 are all covered with this upper cover 3622. The space defined by the upper cover 3622 and the stage 3621 is not sealed off, but is closed. Because of this feature, the inside is filled with saturated steam. The reference numeral 3623 denotes a drive unit capable of receiving a signal from a personal computer 3641 and moving the stage 3621 in both X and Y directions.

As the above temperature regulator 3615, for instance, a Peltier device may be used. With the Peltier device, it is possible to control either heating or cooling according to the direction of a current flowing through the device, and, in addition, the heating or cooling rate can be controlled by amplitude of the current flowing through the device.

The reference numeral 3631 denotes a camera, for instance, a CCD camera, for picking images of the droplet 3614 via lenses 3632, 3633. In addition, a light source 3634 is used to illuminate in the direction indicated by the arrow 3636 via a half mirror 3635 placed between the lenses 3632 and 3633. It is also allowable to illuminate the droplet 3614 directly from above the upper cover 3622 without using the half mirror 3635.

The reference numeral 3641 denotes the so-called personal computer capable of storing therein a necessary program and also receiving a temperature signal from the temperature sensor 3618 on the substrate 3601 and information concerning the size of the droplet 3614 from the camera 3631. In addition, the personal computer receives input operation-related signal inputted by a user. When the personal computer 3641 recognizes based on the information described above that the size of the droplet 3614 is not appropriate, or when the user monitors the display device (not shown) and then sends the operation signal 3642 to adjust the size of the droplet 3614, the personal computer provides controls so that an appropriate current will flow through the Peltier device constituting the temperature regulator 3615. When the user changes the droplet 3614 to be monitored by the camera 3631 to the other droplet, the user can send the operation-related signal 3642 to the personal computer 3641, and then the personal computer 3641 sends a drive signal to the drive unit 3623 to move the stage 3621.

Descriptions are provide below for outline of the operations of the control device for controlling the droplet size according to the example 1 in FIG. 37. The personal computer 3641 analyzes the image data sent from the camera 3631, and then calculates successively the size of droplet 3604 on the substrate 3601. When it is observed that the droplet is growing, the personal computer 3641 gives an instruction so that the temperature in the temperature regulator 3615 will rise, and when it is observed that the droplet is shrinking, the personal computer gives an instruction so that the temperature in the temperature regulator 3641 will decline.

Temperature of the substrate 3601 can be monitored with a temperature sensor 3618, and the temperature data is sent to the personal computer 3641 together the size data for the droplet 3614 from the camera 3631 to be used for the temperature control. In a case where there are provided a plurality of hydrophilic regions 3604 and also there are a plurality of droplets 3614, sometimes the camera 3631 may not be capable to simultaneously monitor all of the droplets with a scope thereof. In this case, only the representative droplets 3604 should be monitored. If a more accurate result is necessary, the stage 3621 on which the substrate 3601 is placed may be moved with the drive unit 3623 to measure the sizes of all the droplets to obtain the average, minimum, and maximum diameters of the droplets for controlling the temperature. In this step, if it is expected that droplets having the maximum or minimum diameters are not covered within the control range, the temperature may be controlled so that the droplets having the maximum or minimum diameter are included within the control range even if the droplets having the other diameter go out of the control range.

Since fluctuation in the temperature of a droplet may affect the chemical reaction rate on the droplet, it is preferable that the temperature fluctuation in the droplets should be controlled within about ±3° C. at the maximum. Even when the temperature fluctuation is controlled within this range, the chemical reaction rate may fluctuate by tens percent, but even in this case, a better result can be obtained as compared to a case where a diameter of a droplet changes while cell culture is performed in the droplet and a concentration of salt changes by tens percent. A temperature change rate can easily and freely be controlled in either heating or cooling by using the Peltier device as the temperature regulator 3615. But since the Peltier device is not transparent, it is impossible to build up an optical system allowing for transmission of light.

An example of the practical data is described below. For instance, the space enclosed by the vessel 3622 is filled with steam and the temperature is kept at 25° C. A sufficient quantity of water is stored in the water tanks 3619, 3620 for hydration. Assuming that the capacity enclosed with the vessel 3622 is 100 mm×100 mm×50 mm (height), the volume is 5×10−4 m3. Therefore, the saturated steam pressure and the volume of saturated steam are 31.7 hPa and 23.1 g/m3 respectively. Therefore, 11.6 mg of water exists as the steam in the space enclosed by the vessel 3622. When the temperature of the space enclosed by the vessel 3622 is 23° C., the values of saturated steam pressure and the volume of saturated steam are 28.1 hPa and 20.6 g/m3 respectively. Therefore, When the temperature in the space enclosed by the vessel lowers from 25° C. to 23° C. within a short period of time, 1.25 mg of water is vaporized due to the difference in the saturated steam pressure between 25° C. and 23° C. (because (23.1-20.6) g/m3×5×10−4 m=1.25 mg). As a result, the size of the droplets will shrink.

As an example, the temperature of the substrate 1 is set to 25° C., and four pieces of 1 μl droplets 3614 are placed on the substrate. In this situation, it is assumed that also the temperature of the space enclosed by the vessel 3622 is at 25° C. Also it is assumed that the droplet is in the stable condition under the saturated steam pressure at 25 degrees Celsius and also the size of the droplet 3614 is stable. Next the temperature of the substrate 3601 is changed to 23° C. The temperature of the droplet 3614 changes rapidly because the droplet 3614 contacts the substrate 3601, but there is no substantial change in the temperature of the space enclosed by the vessel 3622 because the thermal conductivity of the air is substantially low. As the result, because of the temperature change of the droplet 3614 due to the temperature change of the substrate 3601, the diameter of the droplet 3614 changes from 1.24 mm to 1.31 mm within a few minutes (it becomes larger because the surrounding water is agglutinated into the droplet 3614 as the temperature declines) and then the equilibrium is achieved.

In other words, when the temperature of the substrate 3601 is controlled, the temperatures of the droplet 3614 contacting thereto can also be changed within a short period of time, and therefore, also the size of the droplet 3614 can be changed flexibly. On the other hand, as described above, if the temperatures in the space enclosed by the vessel 3622 is changed rapidly, the size of the droplet 3614 will also be changed due to the subsequent change of the saturated steam pressure. But the temperature of the space enclosed by the vessel 3622 is not changed rapidly unless an external large influence is loaded to the space. On the contrary, when the temperature in the space enclosed by the vessel 3622 gradually changes according to changes in the external conditions and any change in the size of the droplet 3614 is observed, it is possible to suppress the changing rate of the size of the droplet 3614 by controlling the temperature of the substrate 3601 so that the temperature of the droplet 3614 changes in the direction reverse to the direction of size change of the droplet 3614.

Therefore, to keep the size of a droplet constant, when the growing trend of the droplet 3614 in the size is detected with a camera 3631 by monitoring the diameter of the droplet 3614, the temperature of the board is raised by 1 or 2° C. so as to vaporize the water so that the droplet 3614 will shrink. This means that, by raising the temperature of the space enclosed by the vessel 3622, it is possible to cancel the growing trend of the droplet in the size so that the size of the droplet should not exceed the predetermined size. On the contrary, if the shrinking trend of the droplet in the size is observed, the temperature of the substrate is lowered so as to help the growth of the droplet. That is to say, the data relevant to the droplet size can be used as the feedback data to control the temperature of the substrate 3601 so as to keep the diameter of the droplet 3614 substantially constant.

In a humidity control device for a microscope, generally temperature of the atmosphere in which the test sample is placed is controlled. But in this case, the response of the response to control of the atmospheric temperature is rather low. On the contrary, in the system in which an extremely small quantity of droplets is used and temperature of the droplets is directly controlled as described above, real time control of the droplet size is possible.

Example 2

FIG. 38 is a schematic diagram illustrating Example 2 in which the size of one droplet among a plurality of droplets on the substrate 3601 is controlled discretely. The configuration employed in Example 2 is the same as that employed in Example 1 described above excluding the points that independent temperature regulators 3615 are placed on each hydrophilic regions on the substrate 3601 respectively and also independent temperature sensors 3618 are placed at the positions where droplets 3614 are placed, and that temperature control signals are sent from the personal computer 3641 to each temperature regulator respectively. In FIG. 38, however, the surface of the hydrophilic regions 3604 is lower than the surface of the substrate 3601. All the surrounding are of the hydrophilic region 3604 are the hydrophobic region 3603. An appropriate spacer having a low thermal conductance is provided between adjoining temperature regulators 3615.

In Example 2, the size of each droplet is always monitored concurrently by a camera 3607. The personal computer 3641 then calculates the diameter of each droplet from the images sent from the camera 3607, and the data is used to give feedback data to control each temperature regulator 3615 for the relevant droplet respectively. With this method, it is possible to limit a fluctuation range of the diameter of each droplet within 10 percents.

Example 3

FIG. 39 is a schematic diagram illustrating Example 3 in which such operations as, for instance, forming two types of droplets, mixing them, and then transporting the mixture droplet to a predefined position can easily be performed.

In FIG. 39, the entire surface of a substrate 3650 has the hydrophobic property. On this surface, two hydrophilic regions 3651, 3652 for forming two types of droplets, one hydrophilic region 3655 for mixing the two types of droplets, one hydrophilic region 3657 for holding the mixture droplet in a position after the droplet is moved are provided, and further the hydrophilic lines 3653, 3654, 3656 connecting those hydrophilic regions to each other are provided. The substrate 3650 has a super water-shedding property with the size of 20 mm×20 mm. The sizes of the hydrophilic regions 3651, 3652, 3655, 3657 are decided according to the size of a droplet formed in each of the regions and are about 200 μm×200 μm square. The width of the hydrophilic lines 3653, 3654, 3656 is 2 μm. The substrate 3650 is provided on the temperature regulator 3615 placed on the stage 3659. The stage 3659 is driven in both X-axial and Y-axial directions with a drive unit 3623 operating according to a drive signal from a personal computer 3641. The temperature regulator 3615 is provided to control the temperature of the substrate 3650 like in example 1 and 2. In this example as well, the temperature sensor is necessary to monitor the temperature of the substrate 3650, and the sensor is placed on the contact surface between the substrate 3650 and the temperature regulator 3615, but is not shown in the figure for simplification. Also the signal transactions with personal computer 3641 are not shown.

The reference numeral 3631 denotes a camera such as, for instance, a CCD camera, for taking pictures of the droplet 3614 formed on the hydrophilic regions 3651, 3652 via lenses 3632, 3633. In this case, a light source 3634 is used to illuminate in the direction indicated by the arrow 3636 through a half mirror 3635 placed between the lenses 3632 and 3633. The light may directly be illuminated from above the substrate 3650 without using the half mirror 3635. The reference numeral 3641 denotes the so-called personal computer with necessary software stored therein and capable of receiving the size information relevant to the droplet 3614′ from the camera 3631 and operation-related signals from a user. The personal computer 3641 has a display device (not shown in the figure), and an image of the droplet 3614′ inputted from the camera 3631 is displayed thereon.

The reference numeral 3646 denotes a pipet for forming a droplet 3614′. The pipet 3646 contains therein the solution used for forming as the droplet sucked therein in advance. At the root section of the pipet 3646, a syringe pump 3644 is provided via a tube 3645, and a drive unit 3643 is attached to the syringe pump 3644. When a user gives an instruction to prepare a droplet to the personal computer 3641, the drive 3643 unit starts operating, the syringe pump 3644 is driven by the drive unit 3643, and then the solution inside the pipet 3646 is pushed out to form a droplet at the tip of the pipet 3646. While optically monitoring the droplet at the tip of the pipet 3646, the user stops forming the droplet when the droplet is grown to a prespecified size.

When the droplet 3614′ is formed in the state where the pipet 3646 is contacted to the substrate 3650, if a user gives an instruction to the personal computer 3641 to lift the pipet 3646, the instruction to lift the pipet 3646 is given to a lift up/down drive unit 3647, and then the pipet 3646 goes up and separates from the droplet. A dashed line 3648 shows coordination between the lift up/down drive unit 3647 and the pipet 3646. When the droplet 3614′ is formed with the pipet 3646, a user lowers the pipet 3646 once and moves the droplet to a hydrophilic region on the substrate 3650, and raises the pipet 3646 to separate the pipet form the droplet.

Next, to form a new droplet, the user gives an instruction to the personal computer 3641 to move the stage. In response to this instruction, the personal computer 3641 gives a drive signal to the drive unit 3623 to move the stage 3659. While monitoring the header portion of the pipet 3646, the user stops movement of the stage when the header of the pipet 3646 reaches the hydrophilic region where the droplet is formed. At the new position, as described above, a droplet is formed at the tip of the pipet and then on a hydrophilic region on the substrate 3650. It is needless to say that, in this step, the pipet 3646 has been already replaced by a new pipet containing a new solution for forming a new droplet.

Next, the user moves the droplets on the hydrophilic regions 3651, 3652 to the hydrophilic region 3655 to mix them up. In this step, each droplet is moved on the hydrophilic line 3653 or 3654 which connects the hydrophilic regions 3651 and 3655 and hydrophilic region 3652 and 3655 to each other. In other words, the droplet is moved in a manner that they are dragged on the hydrophilic line with the tip of the pipet 3646 contacting the droplet 3614. As a result, the droplet can be moved smoothly on the hydrophilic line to a new hydrophilic region.

After each droplet formed on the hydrophilic regions 3651, 3652 is moved to the hydrophilic region 3655, a specific chemical reaction occurs. In some cases, the chemical reaction may take a longer period of time as compared the time required forming or moving the droplets. Therefore the moisture content of the droplet may vaporize because of the circumstances as described above. So, like in Examples 1 and 2 described above, while the size of a droplet is monitored, the temperature of the substrate 3650 is controlled so that the diameter of the droplet is kept at the substantially constant level by controlling the temperature regulator 3615. This control is also applicable when a droplet is formed. In addition, although not shown, like in Examples 1 and 2 described above, it is preferable to install water tanks 3619, 3620 for hydration and an upper cover 3622 having a shape like a reversed transparent vessel to prevent the change in environments for the droplet during the chemical reactions.

When the two droplets are DNA and fluorochrome SYBR Green I for intercalating to the DNA, for instance, the droplets are moved to the hydrophilic region 3655 and merged with each other and left at the position for two minutes. During this process, the diameter is monitored for controlling the temperature of substrate 3650 so that the diameter of the droplet is kept substantially constant. Then the droplet is moved from the hydrophilic region 3655 to the hydrophilic region 3657 on the hydrophilic line 3656. Light is illuminated from the laser source 3661 through the half mirror 3662 to the droplets which has been merged and finished the chemical reaction on the hydrophilic line 3656 or on the hydrophilic region 3657. The fluorescence from the reactants in the droplet can be measured by detecting the fluorescence emitted from the droplet with a detector unit 3666. The reference numerals 3663, 3664 denote lenses constituting the optical system. Also in this case, it is preferable to move and slide a droplet on the hydrophilic line with the tip of the pipet 3646 contacting the droplet with the chemical reactions already finished therein. However, since it is not possible to provide both the optical system for monitoring the diameter of the droplet and the other optical system for measuring the fluorescence volume from reactants in the droplet at the same place, and therefore it is preferable to use the lift up/down drive unit 3647 capable of moving the pipet 3646 also in the X-axial and Y-axial directions.

In FIG. 39, there are two hydrophilic regions 3651, 3652 to form two types of droplets. But a single hydrophilic may be enough when the following procedure is employed. In this case, a first droplet formed on a hydrophilic region is moved to the hydrophilic region 3655 for merging the two types of droplet later, and then another droplet is formed on the same hydrophilic region and, in the same manner, moved to the hydrophilic region 3655 to be merged with the first droplet there.

If three types of droplets needs to be merged with each other, it is allowable to prepare three hydrophilic regions instead of two hydrophilic regions 3651, 3652, or to form droplet one by one on a single hydrophilic region and to move the droplets to the next hydrophilic region one by one to merge the droplets each other there.

Eighth Embodiment

In an eighth embodiment of the present invention, descriptions are provided below for a structure allowing for long term electric measurement of changes in responses of a cell network to stimulus while completely controlling a shape of the intercellular network shape to clarify functions of the cells. This structure has a plurality of cell culture zones each to confine the cell in the specific space arrangement and each zone is interconnected with a groove that the cell may not pass through reciprocally, and a plurality of electrode patterns to measure the change in the electric potential of the cell are provided in the groove. The electrode pattern is provided in the groove between adjoining cell culture zones, and has a structure suited for measurement of the difference of intercellular potential. When the measured cell is a neurocyte, the cell extends the axon. Therefore the change in the electric potential of an intercellular axon itself which is coupled with adjoining cell at synapse is measured.

Example 1

FIG. 40 is a plan view schematically illustrating an example of a structure of cell culture micro-array with electrode in Example 1 of the eighth embodiment of the present invention, and FIG. 41 is a cross-sectional view showing the cell culture micro-array shown in FIG. 40 taken along the line A-A and viewed in the direction of indicated by the arrow. The reference numeral 4001 indicates a substrate, and all the structures are constructed on substrate 4001. The reference numeral 4002 indicates a cell culture zone, and a plurality of cell culture zones 4002 are regularly constructed with a prespecified interval. The reference numeral 4003 indicates a groove which interconnects the adjoining cell culture zones. The reference numeral 4010 indicates a resin layer formed on substrate 4001, and the cell culture zones 4002 and the groove 4003 interconnecting the cell culture zones 4002 are formed by removing the resin layer 4010. The reference numeral 4004 indicates an electrode for measuring the electric potential, and is installed in each of the grooves 4003. Electrode 4004 is gold deposited with the thickness of 100 nm onto the surface of substrate 4001. The reference numeral 4005 indicates an external terminal, and is installed near substrate 4001 at a position corresponding to the electrode 4004. The reference numeral 4006 indicates wiring and the wiring connects the electrode 4004 to the external terminal 4005.

The reference numeral 4009 indicates a semipermeable membrane, and is formed tightly on the upper surface of the resin layer 4010 with the grooves 4003 each interconnecting the adjoining cell culture zones 4002 formed thereon. The reference numeral 4022 indicates an upper housing which covers the entire area of the resin layer 4010 with an appropriate space on the semipermeable membrane 4009. The reference numeral 4022-1 indicates a falling section of the upper housing 4022. The reference numeral 4021 indicates a culture fluid bath formed between the semipermeable membrane 4009 and the upper housing 4022. The reference numeral 4023 indicates an opening 4023 provided on the upper housing 4022, and the culture fluid is provided to the bath 4021 therethrough. The reference numeral 4014 indicates a common electrode, which is provided in the culture fluid bath 4021.

In Example 1, each cell culture zone 4002 has an edge of 30 μm and depth of 25 μm for the purpose of measuring a human cell while culturing the cell. The groove 4003 has the width of 5 μm and depth of 25 μm. The distance between each cell zone is in the range from 30 to 200 μm.

Descriptions are provided below for a method of preparing the substrate 4001. The substrate 4001 is made of non-luminescent glass with the thickness of 0.18 mm, which enables the observation with an object lens having the resolution of 100 times, and at first, layers for the electrode 4004, wiring 4006 and terminal 4005 are formed by deposition. Secondly the areas of the electrode 4004 and terminal 4005 are masked, and the insulating layer is formed to cover the areas. Then, the surface of electrode 4004, insulating layer, and terminal 4005 is covered with photo-curing resin SU-8 (an epoxy type photoresist material, produced by Micro Chem. Inc., U.S. Pat. No. 4,882,245) having the degree of viscosity adjusted so that the thickness of the layer may become 25 μm and resin layer 4010 is formed. Then portions of the resin layer 4010 corresponding to cell culture zones 4002 and grooves 4003 are locally eliminated. As a result, the cell culture zone 4002 and grooves 4003 are formed. The electrode 4004 is provided in the groove 4003 in the exposed state, but the wiring 4006 crossing the groove 4003 is isolated with the insulating layer. Also the terminal 4005 is exposed.

A cytophilic substance such as laminin and collagen is applied on the surfaces of the cell culture zone 4002 and groove 4003, and further the cell culture zone 4002 and groove 4003 are filled with a buffer fluid buffer, and then a cell is put into the cell culture zone 4002. After that, a lid made of semipermeable membrane 4009 is placed on the upper surface of the area for the cell culture zone 4002 and groove 4003 in order to confine the cell within the cell culture zone 4002. Then, the upper housing 4022 is set to completely cover the lid made of semipermeable membrane 4009 (the entire area of resin layer 4010). In this step, the upper housing 4022 has a suitable falling section 4022-1, and covers the semipermeable membrane 4009 with an appropriate space to form the culture liquid bath 4021. The common electrode 4014 is formed with a light-transmissible electrode such as ITO on an inner wall of upper housing 4022 of culture fluid bath 4021. The reference numeral 4023 indicates an opening of the culture fluid bath, and a fresh culture fluid is constantly supplied to the culture liquid bath 4021 through this opening 4023, and also the used culture fluid is exhausted therethrough.

For the aforementioned semipermeable membrane 4009, a transparent cellulose film is used so as not to interrupt optical observations. Cellulose with the molecular weight cut off of 30,000 Daltons is used in this example. The upper housing 4022 is also made of a transparent material, such as plastics to avoid interruption of the optical observation by the upper housing 4022.

The cell culture micro-array accommodating a plurality of cells discretely is prepared as described above. A number of methods are conceivable for putting a cell in each cell culture zone 4002. For instance, there is a method in which a micro capillary is inserted into the liquid solution including the cells, a cell is captured with the distal end thereof and put into the cell culture zone 4002. Alternatively, when the size of the cell culture zone 4002 is substantially the same as that of a cell, the cell can be set in the cell culture zone 4002 by dripping a droplet including the cell onto a top surface of the area with the cell culture zone 4002 and groove 4003 formed thereon and sliding the micro-capillary along the surface of the area to push out the surplus liquid.

The independent bonding formation based the biotin-avidin reaction is used to stabilize the cell in the cell culture zone 4002. Since the photo-curing resin SU-8 possesses a reactive epoxy group, the photo-curing resin SU-8 is subjected to pre-baking before irradiation of light thereto to form the base SU-8 layer, and then immediately a solution containing biotin hydrazide is applied to the layer to react the epoxy group to the hydrazide group for fixing biotin. By exposing to light to solidify the resin and forming a structural body, the SU-8 pattern with biotin introduced on the surface thereof is obtained.

Extension of axon in the groove 4003 can be detected by measuring an impedance between terminal 4005 connected to electrode 4004 and provided in the groove 4003 and the common electrode 4014, or by measuring an electromotive force by the cell itself detected in the terminal 4005 that is connected to electrode 4004 by referring to an electric potential in the common electrode 4014 as a reference value.

All of the operations described above can be performed observing the cell with a microscope. Further, in the cell culture micro-array with electrodes according to the eighth embodiment, it is possible to provide the stimulus to the specific cells with the same electrode or to measure a response of the cell to the stimulus by selecting a desired electrode among the plurality of electrodes provided therein.

For instance, as a result of incubation of a rat cerebellar granule cell in the cell culturing micro-array with the electrode according to the eighth embodiment, the cell confined in the cell culture zone 4002 was observed to form a network without cutting itself free from the cell culture zone 4002. It is also confirmed that the electromotive force is generated, before and after the axon extends and cells are contacted to each other, in the electrode 4004 provided in the groove 4003 between the cell culture zones 4002 where the axon extends and the cells are connected to each other, and also in the electrode 4004 provided in the groove 4003 that the axon in the opposite side of the cell does not extend. It is understood based on a result of these observations that the structure of the cell culturing micro-array with an electrode according to the eighth embodiment has the expected performance.

Furthermore, it is possible to measure responses of the cells by checking a change in electrical potential by adding a biological material, such as peptide or amino acid, and a chemical substance having suspected endocrine disrupting or toxic property.

Example 2

Example 2 are described below with reference to a case where the cell culture zone 4002 or groove 4003 is formed by using agarose gel 40100 in place of the photo-curing resin SU-8.

FIG. 42 is a plan view showing Example 2 of the eighth embodiment, and FIG. 43 is a cross-sectional view illustrating the cell culture micro-array shown in FIG. 42 taken along the line B-B position and viewed in the direction indicated by the arrow. As clearly understood from comparison of FIG. 40 and FIG. 41 to FIG. 42 and FIG. 43, the structure in Example 2 is the same as that in Example 1 excluding the points that that the groove 4003 interconnecting the cell culture zones 4002 is changed to a tunnel 4003, that a plurality of electrodes 4004 are provided in the tunnel 4003, and that the tunnel 4003 is provided only on the bottom surface of agarose gel 40100. The reference numeral 4001-1 indicates a wall provided on the substrate 4001, and an area surrounding agarose gel 40100 is formed with and sustained by this wall.

In Example 2, the electrode 4004, wiring 4006, and terminal 4005 are formed on the substrate like in Example 1, and then the wall 4001-1 is adhered to the upper face of the substrate 4001 and agarose gel 40100 is put inside the wall 4001-1. The 2% agarose gel (with the melting temperature of 65° C.) is heated with a microwave oven and melted therein. The melted agarose solution is added to inside the external wall of the lower part of the substrate 4001 heated to 65° C., and immediately spread homogeneously with a spin coater. An amount of added agarose gel and a rotational speed of the spin coater are adjusted so that the agarose gel membrane will have the thickness of 1 mm. The thickness differs according to devices used and lots of agarose gel, but a good result has been obtained with the rotational speed of 50 rpm for 15 seconds, and followed by 200 rpm for 10 seconds. The agarose gel membrane 40100 is formed with leaving the melted agarose solution in the moistening box for one hour at 25° C. At this point, the agarose gel membrane is formed on the inner side of the external wall of the substrate 4001. Next, after the agarose gel 40100 is formed, a portion corresponding to the cell culture zone 4002 is removed to form the cell culture zone 4002 with agarose gel 40100.

FIG. 43 is a cross-sectional view illustrating an agarose made cell culturing micro-array with electrodes when the cell culture zone 4002 prepared thereon and an optical system and a control system using for preparing the tunnel 4003 in the agarose gel 40100. A cellulose membrane is adhered to the upper surface of agarose gel like in Example 1. For instance, the heated and melted agarose is applied on the cellulose membrane with a spin coater to prepare a cellulose membrane with the agarose membrane formed on one surface thereof. Then the cellulose membrane is placed, after a cell is put in the zone 4002, on the agarose gel 40100 so that the agarose-applied surface thereof contacts the agarose gel 40100. Alternatively, while the agarose gel 40100 is formed, a small amount of streptavidin-conjugated agarose may be added and solidified. The streptavidin is exposed on the surface of this agarose gel derivative. Separately, in the same way like in Example 1, the cellulose membrane with an aldehyde group introduced by oxidization with periodic acid is reacted with biotin hydrazide, and the biotin-modified cellulose membrane obtained from reducing by the hydroboration reaction is prepared. By using the biotin-avidin reaction to fix the agarose gel derivatives and biotin-modified cellulose membrane, a structural body with a cell confined therein can be formed.

A laser 40141 is used to irradiate a beam with the wavelength of 1480 nm which is absorbed by water. A laser beam 40142 passes through an expander 40143, and also passes through a filter 40144 reflecting rays with the wavelength of 740 nm or more but allowing transmission of light with the wavelength of 1480 (±20 nm), and further passes through a deposition filter 40145 that transmits the light with the wavelength of 700 nm or more, and is focused by a condenser 40146 onto the surface of substrate 4001. The converging light with the wavelength of 1480 nm is absorbed by water contained in the agarose layer, and the temperature in the neighboring area rises to a level close to the boiling point. When the laser power is at 20 mW, agarose is melted with approx 20 μm of the line width in the neighboring area where the convergent light is irradiated and removed by thermal convection. The problem is that the amplitude of the convergent light absorbed by agarose changes depending upon the presence of an electrode on the substrate 4001. To solve this problem, there has been introduced in the present invention a contrivance enabling constant temperature control with irradiation of converging light by estimating a temperature of the agarose gel and feeding back the expected temperature value. The converging light having reached the agarose portion is converted to heat and simultaneously irradiates infrared rays. The infrared rays pass through the filter 40145 is reflected by the filter 40144, and reaches the infrared ray camera 40160-1. The image data picked by the infrared ray camera 40160-1 is fetched into a computing device 40161 with a video recorder, the temperature is estimated from the detected amplitude, and power of the laser 40141 is adjusted. In the case when it is difficult to control temperature only by adjusting the laser power, the moving speed of stage 40164 is controlled according to an output from computing device, so that the agarose temperature in the portion exposed to the converging light is constantly maintained at the same level. More specifically, rotation of stepping motor 40162 is controlled by the computing device 40161, and rotation of the stepping motor is delivered by power transmission device 40163 to move the state 40164.

The substrate 4001 is set on the stage 40164, and the tunnel 4003 can freely be formed in the agarose gel. An ITO transparent electrode is previously formed in the tunnel 4003. Moreover, also the optical system for detecting the transmitted light from the light source 40170 is incorporated to monitor the progress of the cell observation as well as of agarose processing. Light from the light source 40170 transmits the transparent upper housing 4022, transmits the objective lens 40146 scattering in the agarose section, and is fetched as an image with the CCD camera 40160-2 through the deposition filter (mirror) reflecting visible light. The image data is sent to the computing device 40161, overlapped with images taken the infrared ray camera 40160-1, and used, for instance, for confirmation of the portions heated by laser beam irradiation and the structure pattern.

On the upper surface of the agarose gel, the culturing solution that is supplied and discharged through the opening 4023 is constantly circulating. Alternatively, stimulating substances to the cell or various chemicals including endocrine disrupting chemicals and the like are added through the opening 4023, and the state of the cell can be monitored by the electrodes by observation with a microscope.

In Example 2, two electrodes are provided in one tunnel 4003, so that it is easy to capture fluctuation in impedance or inductance in the tunnel 4003. Each electrode is connected to the terminal 4005 respectively with the wiring 4006, and therefore it is possible to measure a single electrode or a pair of electrodes. For instance, when an axon of the neurocyte extends and the cell couples with the neighboring cell, an electrical potential of electrode 4005 can be measured by referring to that in another electrode as a reference potential.

Moreover, in Example 2, since it is possible to additionally engrave the tunnel 4003, activities of a cell can be assessed by monitoring the current situation and changing the tunnel configuration.

Example 3

FIG. 44 is a plan view illustrating Example 3 in which a plurality of cell culture zones 4002, which is most important in practical use, are connected each other for form a one-dimensional array. As it is clearly understood from comparison of FIG. 44 to FIG. 42, configuration in Example 3 is the same as that in Example 2 excluding the point that the cell culture zones 4002 formed with the agarose gel 40100 and the tunnel 4003 interconnecting the cell culture zones 4002 are formed in the lateral direction. Also in Example 3, the tunnel 4003 interconnecting the cell culture zones 4002 is not always required to be formed previously, and may be opened, for instance, only in the direction in which the axon of the neurocyte is required to extend at a point of time when the axon is formed. All electrodes 4004 should be made in the tunnels or at positions where tunnels are to be formed when practically used.

The cross-section of the device in Example 3 is the same as that in Example 2, and descriptions thereof are omitted herefrom.

(Others)

The aforementioned examples are all described as completed cell culturing micro-array. However, a researcher as a user of the cell culture micro-array is required to put in a cell or the like in the cell culture zone 4002. Accordingly, it is practical to provides the substrate 4001 with the electrode 4004, external terminal 4005, wiring 4006, cell culture zone 4002 and groove 4003 formed thereon, semipermeable membrane 4009, and upper housing 4022 as a cell culturing micro-array kit. In this case the researcher having purchased the kit prepares a culture fluid, puts a cell or the like in the cell culture zone 4002, sets the semipermeable membrane 4009 and upper housing thereon to complete the kit. Also in Examples 2 and 3, it is practical to use the cell culturing micro-array kit depending on the purposes of researches. The kit includes, as in Example 1, the substrate 4001 on which the agarose gel is placed and such as electrode, the cell culture zone 4002 and a necessary tunnel are formed on the agarose gel, the semipermeable membrane 4009, and the upper housing 4022.

Ninth Embodiment

A ninth embodiment of the present invention discloses a structure for configuring a network consisting of the minimum number of cells in which a plurality of heterogeneous cells are interacted, on a chip, for measuring a change in responses to stimulus in the cell network, by controlling a few heterogeneous intercellular network. Namely a plurality of cell culture zones are formed for keeping heterogeneous cells in the state where the cells adjoin each other within a specific space, and adjoining zones are communicated to each other with a groove or a tunnel through which the cells can not pass through. If required, a collective cell micro-array (bioassay chip) having a plurality of electrode patterns for measuring an electric potential in a cell is provided in the groove or tunnel, or in the cell culture zone.

Example 1

FIG. 45 is a plan view schematically showing an example of a structure of a cell reconstituting device having a circuit among heterogeneous cells according to the ninth embodiment of the present invention. FIG. 46 is a view schematically showing a cross section of the cell reconstituting device taken along the line A-A and viewed in the direction indicated by the arrow, and an optical system for forming a tunnel communicating adjoining cell holding zones in the device as well as a control system for the same.

The reference numeral 4501 indicates a substrate and all of the constructions are provided on the substrate 4501. The reference numerals 4502, 4503 indicate cell holding zones respectively, which are provided at a prespecified gap in-between and are communicated to each other via a groove 4504. The reference numeral 45100 indicates an agarose gel formed on the substrate 4501, and the cell holding zones 4502, 4503 and the tunnel 4504 communicating the zones to each other are formed by removing a portion of the agarose gel 45100. The reference numerals 4502-2, 4503-2 indicates electrodes respectively, which are provided in the cell holding zones 4502, 4503. If required, plural electrodes 4505 are provided on the tunnel 4504. The electrodes 4502-2, 4503-2, and 4505 are formed each with a transparent electrode (indium-tin oxide: ITO) and is deposited on a surface of the substrate 4501 with the thickness of 100 nm. The reference numeral 4506 indicates an external terminal, and is provided around the substrate 4501 at a position corresponding and adjacent to the electrode. The reference numeral 4507 indicates wiring, which connects the electrode to the external terminal. Both the external terminal 4506 and wiring 4507 have the thickness of about 100 nm and are made from transparent ITO. The wiring 4507 is complicated and is not shown in FIG. 46. The reference numeral 45101 is a bank for holding the agarose gel and is made from SU8 or glass. When the bank is made from SU8, the SU8 is coated on the substrate 4501 with the thickness of 100 μm, and UV ray is irradiated onto the SU8 for curing. When the bank is made from glass, a glass sheet with the thickness of 100 μm is adhered to the substrate 4501. The bank 45101 is made after the electrodes are prepared.

The reference numeral 4509 indicates a semipermeable membrane and is provided in adhesion to a top surface of the agarose gel 45100 with the cell holding zones 4502, 4503 and the tunnel 4504 connecting the zones 4502, 4503 to each other formed thereon. The reference numeral 4522 indicates an upper housing, which is provided on the semipermeable membrane 4509 with a proper space and entirely covers the top face of the agarose gel 45100. When the cells are not floating ones, the cells tend to be deposited on a bottom surface of the substrate, and therefore the diffusion shell is not necessarily required. The reference numeral 4522-1 indicates a fall section of the upper housing 4522. The reference numeral 4521 indicates a culture fluid bath formed between the semipermeable membrane 4509 and the upper housing 4522. The reference numeral 4523 indicates an opening provided on the upper housing 4522, and the culture fluid is supplied through this opening 4523 into the culture fluid bath 4521. The reference numeral 4514 in FIG. 45 is a common electrode. Because the culture fluid is supplied through the diffusion shell to cells held on the cell holding zones 4502, 4503, change of conditions during culture is prevented. In Example 1, a pulsating myocardial cell 4502-1 is held in the cell holding zone 4502 and a neurocyte 4503-1 in the cell holding zone 4503. The two cells are coupled to each other to form a gap-junction via the tunnel 4504 between the heterogeneous cells.

As for the procedure for preparation, after the electrodes 4502-2, 4503-2, 4505, wiring 4507, and terminal 4506 are formed on the substrate 4501, the bank 45101 is formed on a top surface of the substrate 4501, and thermal-melted agarose 45100 is poured into the bank 45101. A 2% agarose gel (with the melting point of 65° C.) is heated and melted in a microwave oven. The melted agarose gel solution heated to 65° C. is added to inside of the bank 45101 on the substrate 4501, and is immediately spread to a coat with the homogeneous thickness by a spin coater. In this step, by adjusting a quantity of added agarose solution and the rotational speed of the spin coater so that the agarose gel coating film has the thickness in the range from 0.005 mm to 0.5 mm, an agarose solution layer having the same height as that of the bank 45101 is formed. A good result is obtained by operating the spin coater at the rotational speed of 50 rpm for 15 seconds, and then at the rotational speed of 200 rpm for 10 seconds. When the agarose layer is left in a moist box for one hour at 25° C., an agarose gel film 45100 is formed. At this point of time, the agarose gel film is formed on the entire inner surface of the bank 45101 on the substrate 4501.

Then for forming the cell holding zones 4502, 4503 with the agarose gel 45100, at first the agarose gel 45100 is formed, and then portions corresponding to the cell holding zones 4502, 4503 and tunnel 4504 are removed. This operation can easily be performed by using a laser 45141 in the wavelength band (for instance, 1480 nm) which can be absorbed by water. A laser beam 45142 passes through an expander 45143, then passes through a filter 45144 which reflects the IR rays with the wavelength of 740 nm or more but allows transmission of the IR rays with the wavelength of 1480 nm (+20 nm), further passes through a deposition filter 45145 which allows transmission of the light with the wavelength of 700 nm or more, and is focused onto a top face of the substrate 4501 by a converging lens 45146. The converging light with the wavelength of 1480 nm is absorbed by water contained in the agarose gel 45100, and the temperature of the adjacent area goes up to that close to the boiling point. When the laser power is 20 mW, the agarose gel 45100 is melted in the area irradiated by the converging light with the width of about 20 μm, and is removed by thermal convection. The problem is that intensity of the converging light absorbed by the agarose gel 45100 changes according to the presence of an electrode on the substrate 4501. Therefore, the temperature in the area irradiated by the converging light can be adjusted by controlling a laser power by means of feedback control based on estimation of the temperature of the agarose gel 45100. The converging light having reached the agarose gel 45100 is converted to heat and generates the IR rays. The IR ray passing through the filter 45145, is reflected by the filter 45144, and reaches an IR camera 45160-1. Image data picked by the IR camera 45160-1 are fetched into a computing device 45161 with a video recording mechanism, and the temperature is estimated from the detected intensity of the light to adjust a required power of the laser 45141. When it is difficult to control the temperature only by adjusting the laser power, a moving velocity of a stage 45164 is controlled according to an output from the computing device so that the temperature of agarose gel in the irradiated section is kept within the prespecified range. Namely, a rotational speed of a stepping motor 45162 is controlled by the computing device 45161 so that a stage 45164 is moved according to rotation of the stepping motor transferred through a driving force transfer device 45163. When the tunnel 4504 is to be formed, it is necessary to control the laser power to keep the agarose gel from being penetrated.

As the dispersion shell 4509 provided on a top surface of the agarose gel 45100, for instance, a cellulose membrane (with the molecular cutoff of 30000 Daltons) is used. Streptoadivin is previously fixed on the bank 45101. When the bank 45101 is made from SU8, the surface is oxidized by an oxygen plasma or ozone. Then an activated silane solution prepared by leaving a 1% 3-glycidoxypropyltrimethoxysilane (0.5% acetic acid aqueous solution) for 30 minutes in the atmosphere is applied on the surface of the agarose gel for making the activated silane and agarose react to each other for one hour, and the product of the reaction is heated and dried in the atmosphere for 30 minutes at 105° C. with the glycidoxy group introduced onto the surface thereof. When the material is made from glass, it is not necessary to carry out the surface oxidization processing, and it is required only to directly apply the 3-glycidoxypropyltrimethoxysilane on the surface. Then 50 mM boric acid buffer liquid with streptavidin dissolved therein (pH 10) is coated and fixed on the surface. Separately, a biotin-modified cellulose membrane is prepared by reacting biotin hydrazide to a cellulose membrane with aldehyde group introduced by oxidization with periodic acid and reducing the reaction product by means of hydroboration.

The culture fluid is filled in the cell holding zones 4502, 4503 and tunnel 4504 formed on the agarose gel 45100, and one pulsating myocardial cell 4502-1 and one neurocyte 4503-1 are inserted into the cell holding zones 4502 and 4503 respectively with a micro-pipet under observation with a microscope. Then the entire top faces of the bank 45101 and agarose gel 45100 are covered with the biotin-modified cellulose membrane 4509. By fixing the agarose gel derivative and the biotin-modified cellulose membrane to each other by biotin-avidin reaction, a structure, in which a cell is kept in the agarose gel structure, can be formed.

ITO-permeable electrodes 4502-2, 4503-2 and ITO-permeable electrode 4505 are previously formed in the cell holding zones 4502, 4503 and in the tunnel 4504 respectively. Further to observe beating of cells or to monitor progression of agarose machining, also an optical system for detecting transmitted light from a light source 45170 is incorporated. The light from the light source 45170 transmits the upper housing 4522, further transmits an object lens 45146 being scattered by the agarose gel 45100, and is picked up as an image by a deposition filter (mirror) reflecting visible light and with a CCD camera 45160-2. The image data is transmitted to the computing device 45161 and is overlapped with the image taken by the IR camera 45160-1, and the synthesized image is used, for instance, for checking a portion heated by laser beam irradiation and a pattern of a structure. In other words, with this system, electric potentials of the pulsating myocardial cell 4502-1 and neurocyte 4503-1 kept in the cell holding zones 4502, 4503 respectively can be measured with the electrodes 4502-2, 4502-3, and also the beating state of the pulsating myocardial cell can be picked up as an image by observing with a microscope. Further by using the electrode 4505 provided in the tunnel 4504, signal transaction between the two cells can be measured.

A top surface of the agarose gel 45100 functions as a culture fluid bath 4521, and the culture fluid supplied from the opening 4523 always circulates therein. Further various types of chemical substances such as a cell-stimulating material or an endocrine disrupter are added in the culture fluid from the opening 4523, for instance, to monitor the beating state of the pulsating myocardial cell or changes of electric potentials in the pulsating myocardial cell or neurocyte by using any of the electrodes or by means of observation with a microscope. In this step, for bioassay of an ionic material affecting measurement with an electrode, observation with a microscope is employed, and for bioassay of materials not suited to observation with a microscope such as a coloring matter, an electrode may be used.

Main dimensions of a structure of the heterogeneous cell bioassay chip in Example 1 shown in FIG. 45 are as described below. The size of the cell holding zone 4502 is 30 μm×30 μm, and the depth is 0.1 mm, which is equal to that of the agarose gel 45100. There is no specific restriction over the thickness of the cell holding zone, and in a case where a cell is set on a surface of the substrate, the thickness is required to be in the range from 0.005 to 0.5 mm. A distance between adjoining cell holding zones 4502, 4503 is generally 50 μm, and the tunnel 4504 communicating to the cell holding zones 4502, 4503 to each other has the height in the range from 50 μm to 300 μm, and the width of 5 μm. When the tunnel 4504 has the height of 100 μm and the thickness of the agarose gel 45100 is 0.1 mm, not a tunnel but a groove is provided.

Example 2

Example 2 proposes a heterogeneous cell bioassay chip having the basically same structure as that described in Example 1, but allowing for independent modification of an environment for each of the cell holding zones 4502 and 4503. FIG. 47 is a view schematically showing a structure of a cell reconstituting device having a circuit between heterogeneous cells in Example 2 of the ninth embodiment of the present invention. FIG. 48 is a view schematically showing a cross section of the cell-reconstituting-device shown in FIG. 47 taken along the line A-A and viewed in the direction indicated by the arrow, and also showing an optical system and a control system for forming a tunnel communicating adjoining cell holding zones in the device.

As easily understood by comparing FIG. 45 to FIG. 47, in Example 2, a projection section 45101-1 which is a protrusion of the bank 45101 is provided not only around the agarose gel 45100, but also in a central portion of the agarose gel 45100 to device in half the agarose gel 45100 and reaches a point close to the tunnel 4504. As easily understood by comparing FIG. 46 to FIG. 48, a partition 4522-2 is provided to divide in half the culture fluid bath 4521 to a section 4521-1 and a section 4521-2. Further, as shown in FIG. 47, an opening 4523 for supplying a culture fluid into the culture fluid baths 4521-1 and 4521-2 is additionally provided.

In Example 2, even though the cell holding zones 4502, 4503 are communicated to each other with the tunnel 4504, the culture fluid bath includes the two culture fluid baths 4521-1 and 4521-2 partitioned by the projection section 45101-1 of the bank 45101 and the partition 4522-2 of the housing 4522. Two openings for supplying a culture fluid are provided in the culture fluid baths 4521-2, 4521-2, so that a culture fluid can independently be supplied into each of the culture fluid baths 4521-2, 4521-2. In other words, bioassay of heterogeneous cells can be performed by culturing cells kept in the cell holding zones 4502, 4503 in the different environments respectively.

Example 3

In Example 3, a network consisting of a pulsating myocardial cell and a neurocyte is formed by using the heterogeneous cell bioassay chip described in Example 2, and assessment is made for influence when an electric impact is given to the neurocyte. FIG. 49(A) and FIG. 49(B) are waveform diagrams each showing a result of the assessment for the influence when an electric stimulus is given to the neurocyte.

In Example 3, examination is made for whether a beat cycle of the pulsating myocardial cell 4502-1 kept in the cell holding zone 4502 changes when potassium or glucose, or suspected endocrine disrupter is added to the culture fluid of the neurocyte 4503-2 in the cell holding zone 4503, or the content is increased.

At first, the same culture fluid is filled in the culture fluid baths 4521-1, 4521-2, and a beat cycle of the pulsating myocardial cell 4502-1 is checked to obtain a myocardial pulsation pattern showing the substantially same cycle as shown in FIG. 49(A). Then, for instance, when dopamine is added to the culture fluid in the culture fluid bath 4521-2 in the cell holding zone 4503 without changing the culture fluid in the culture fluid bath 4521-1 in the cell holding zone 4502, the disturbance in the beat cycle as shown FIG. 49(B) is expected to be observed. This phenomenon occurs because a chemical substance give influences to the neurocyte and a beat cycle of the pulsating myocardial cell is fluctuated when an electric potential on a surface of the neuron changes.

In this experiment, the number of object cells for measurement is only one, so that the dispersion is around 50%. To suppress this dispersion, four or more cells and more preferably eight cells should be put in each of the cell holding zones 4502 and 4503 to suppress the dispersion of observed beat cycles of the cells to around 10%.

Example 4

FIG. 50 is a plan view showing an example of the heterogeneous cell bioassay chip in which cell holding zones each communicated to adjoining ones with a tunnel or a groove are placed side by side like an array, in place of a block of cells in each cell holding zone, and this array of cell holding zones functions like a block of cells. In FIG. 50, the number of cells in each species is five. The same reference numerals are assigned to the same or equivalent components as those in Examples 1 and 2. The reference numerals 4561 and 4562 each indicates five arrays, which house heterogeneous cells, in the cell holding zone. Electrodes are provided in each of the cell holding zones in the heterogeneous cell arrays 4561, 4562 and also in the tunnel 4504 between the heterogeneous cell arrays 4561, 4562. In this case, only one tunnel 4504 is provided between the heterogeneous cell arrays 4561, 4562. AS described in Example 2, the heterogeneous cell arrays 4561, 4562 are divided by cell type by the projecting section 45101-1 of the bank 45101, and naturally the culture layers (not shown) corresponding to the heterogeneous cell arrays 4561, 4562 are divided by the partition 4522-2 (not shown) of the housing 4522 as described in Example 2, so that different culture fluids can be used for different types of cells respectively.

Examples 2 and 3, combination of a pulsating myocardial cell and a neurocyte is described, but the combination may be changed according to an application, and for instance, a sensor cell such as an olfactory cell or a taste receptor cell or a cell with various types of receptors incorporated therein may be used to communicate with the pulsating myocardial cell or an epithelial cell of small intestine to perform a heterogeneous cell bioassay. Therefore, with this technique, there is provided the possibility of measuring influence of even a substance lethal to a particular cell and not allowing for measuring influence thereof to other cells with the conventional technique by communicating a cell having the durability to the substance and a cell not having the durability to the substance.

As described above, in the ninth embodiment of the present invention, various influences which a cell receives from the environment can objectively be examined by making use of the community effect between heterogeneous cells. Therefore the influence of medicaments, which have been expressed with the subjective words such as “feeling bad or good when a medicament is administered”, or effects of environmental conditions to a human body may be expressed digitally.

As described above, a groove may be provided in place of the tunnel 4504 in this example. Instead of measuring an electrical response of a cell, change of a form of the cell may be observed by adding a specific testing sample in a culture fluid of the cell. Further, instead of measuring an electrical response of a cell, a specific cell is stimulated using electrodes to measure a response of the cell by adding a specific testing sample in a culture fluid of the cell.

As for the industrial utilization of the heterogeneous cell bioassay chip according to the ninth embodiment of the present invention and bioassays with the bioassay chip, there are the possibilities that researches in academic research organizations or drug manufacturing companies utilize the heterogeneous cell bioassay chip, and also that people concerned in manufactures of heterogeneous cell bioassay chips use the chip. From the user's view point, the chip should preferably be provided in the state in which heterogeneous cells are accommodated in the heterogeneous cell holding zones respectively. However, a cell accommodated in the heterogeneous cell holding zone of the chip can not live for a long period of time, the chip manufactures are required to supply chips clearly showing the expiration date, or to supply a kit including the substrate 4501, electrodes, wiring, banks and agarose gel on the substrate 4501, dispersion shell 4509, and upper housing 4522. When a chip is supplied as a kit, the user is required to perform accommodation of heterogeneous cells in heterogeneous cell holding zones and assemble the kit components for building up the bioassay chip.

Tenth Embodiment

A tenth embodiment of the present invention discloses a method allowing for easy exchange of a medium for cell culture and separation of cell culture from a vessel wall without giving any damage to the cultured cell. A cellulose membrane is used as a material for the vessel, and a cell is attached to the cell membrane for culturing. After culturing, the vessel is processed with cellulase to dissolve, melt, and remove the cellulose membrane, so that damages to the cultured cell can be reduced.

In the ninth embodiment, a cell to be cultured is attached to the cellulose membrane for cell culturing. The cellulose membrane may previously be coated with an extra-cell matrix such as gelatin or laminin. After culturing, the cellulose membrane is processed with cellulase to decompose the cellulose membrane and the cultured cell is recovered. The cell membrane is spread on an ordinary dish and culturing is performed on the cellulose membrane. Finally cellulase is slowly poured along a rim of the dish so that the cellulase is spread over the dish. By decomposing the cellulose as described above, it is possible to recover, for instance, an epithelial cells in the sheet state, namely with the inter-cellular adhesion intact.

Further, by spreading the cellulose membrane on a substrate having fine flow paths, the cellulose membrane is preserved, and by feeding a cellulase solution into the fine flow path structure between the cells and the substrate, the cellulose membrane can selectively be decomposed and removed. What is important in this step is that cellulase does not decompose animal cells. For, an animal cell does not have a cell wall like that in cellulose. This fine flow path structure may be used not only for adding cellulase, but also for exchanging a medium during cell culture. Because of this feature, by using a cellulose filter with the molecular weight cut off of 10,000 to 100,000 Daltons as the cellulose membrane according to the necessity, proliferating factors in serum or metabolic decomposition products from cells can be exchanged and removed.

Example 1

FIG. 51(A) to (D) are views schematically showing a case in which cell culture is performed on a cellulose membrane in Example 1 of the ninth embodiment of the present invention, cultured cells are recovered in the sheet state, and further a multi-layered cell sheet is formed.

As shown in FIG. 51(A), a cellulose membrane 5102 (with the molecular weight cut off of 30,000 Daltons, and having the diameter of 55 mmφ) with gelatin coated thereon is spread on a dish (60 mm) 5105 storing therein 5 ml of a medium 5101 with serum. Preincubation is performed for 30 minutes in 5% CO2 at 37° C. for assimilating the cellulose membrane 5102 to the medium 5101. A suspension of pulsating myocardial cell is added to the medium by 0.5 ml, and incubation is performed in a CO2 incubator at 37° C. During this incubation, the medium 5101 may be exchanged with a new one, if necessary. When the incubation proceeds, the pulsating myocardial cells spread over the substantially entire cell membrane 5102 in the sheet form. The reference numeral 5103 indicates the pulsating myocardial cells spread in the sheet form.

When the pulsating myocardial cells are spread into the sheet form, the medium 5101 is sucked and removed with an aspirator, and immediately a 10 mg/ml cellulase solution 5104 (1 ml) is spread along a rim of the dish 5105 with a pipet 5106. Then the dish is tilted mildly to spread the cellulase solution to the entire bottom surface of the dish for rinsing the cells 5103 in the sheet form. Then the cellulase solution is removed with the aspirator, and again the cellulase solution is added by 1 ml. Processing with the cellulase solution is performed twice, because it is assumed that some cellulose inhibitors may be present in the medium. The cells in the sheet form is put in a CO2 incubator at 37° C. to incubate the cells until the cellulose membrane 5102 is decomposed and the cell sheet 5103 floats. Decomposition of the cellulose membrane can easily be observed with a microscope.

FIG. 51(B) shows the mono-layered cell sheet 5103 separated from the cellulose membrane 5102 as described above.

FIG. 51(C) shows the state in which the cell sheet 5103 already prepared is overlaid on a cell sheet 5103′ newly prepared as described in relation to FIG. 51(A).

In FIG. 51(C), after the cell sheet 5103′ is formed, it is important to overlay the cell sheet 5103 already prepared and continue incubation before a cellulase solution 5104 is added. Incubation after the already prepared cell sheet 5103 is overlaid should be performed under the same conditions as those described above. After the incubation is continued, the cellulase solution 5104 is added as described in relation to FIG. 51(A) to process the cell sheet with cellulase, a two-layered cell sheet 5112 as described in FIG. 51(D) can be obtained.

By repeating the operation steps described above, the cell layers can be laminated up to about four layers. Further, by overlaying the four-layered cell sheets on each other, it is possible to prepare an 8-layered cell sheet. Specifically, at first the four-layered cell sheet is prepared according to the procedure described above and is processed with cellulase to obtain a four-layered cell sheet. Then a four-layered sheet is prepared according to the procedure described above, and the four-layered cell sheet is overlaid on the four-layered cell sheet newly prepared, and incubation is continued. Then the cellulase solution is added as described above to process the cell sheet with cellulase, thus an 8-layered cell sheet being obtained.

Example 2

FIG. 52(A) is a plan view showing a cell culture support body having a structure for preventing cellulase from contacting the entire surface of the cell sheet. FIG. 52(B) is a cross-sectional view showing the cell culture support body shown in FIG. 52(A) taken along the line A-A and viewed in the direction indicated by the arrow. FIG. 52(C) is a cross-sectional view showing the cell culture support body shown in FIG. 52(A) taken along the line B-B and viewed in the direction indicated by the arrow.

A substrate 51100 is a vessel with the diameter of 60 mmφ, and has two-staged bottom surfaces 51101, 51102 on the internal surface. A depth of the higher bottom surface 51101 from a top surface of the vessel is about 10 mm, and that of the lower bottom surface 51102 from the top surface of the vessel is about 12 mm. Beams 51105 each with the width of 1 mm are provided on the lower bottom surface 51102. As for a height of the beam 51105, a top of the beam is at the same level as the bottom surface 51101, so that the beam 51105 is located at a relatively lower position. A space between the adjoining beams 51105 is about 1 mm. Recesses 51103 for sucking or pouring a culture fluid or the like are provided on the bottom surface 51102. Further, diffusion plates 106 are provided between the recesses 51103 and beams 51105 respectively so that the fluid is homogeneously spread into spaces between the beams when a liquid is distributed from the recesses 51103. A height of the diffusion plate is about ¾ of that of the beam so that the liquid is leaked over the plate and is spread homogeneously. If the diffusion plate is not provided, a liquid flows only in the shortest flow path, for instance, when a solution such as a culture medium is exchanged, and sometimes the liquid does not homogeneously flow into spaces between the beams.

FIG. 53(A) is a cross-sectional view illustrating the situation in which the cell sheet described in Example 1 is prepared by using the substrate 51100 described with reference to FIG. 52, and is a cross-sectional view showing the substrate shown in FIG. 52 taken along the line A-A and viewed in the direction indicated by the arrow. FIG. 53(B) is a cross-sectional view showing the substrate shown in FIG. 52 taken along the line B-B and viewed in the direction indicated by the arrow. The cellulose membrane 51104 is placed on a top face of the face formed with the beams 51105 and the bottom surface 51101. A cover 51110 is placed on a top face of the substrate 51100, and tubes 51111-1, 51111-2 extending to bottom surfaces of the recesses 51103 are attached to the cover. When the cover 51110 is set, tips of the tubes descend into spaces inside the recesses 51103.

The procedure for culturing cells using the substrate 51100 in Example 2 is described below. At first, a medium is added up to a top edge of each beam on the substrate 51100. In other words, the medium is added until a surface of the higher bottom surface 51101 is wetted by the medium. Then the cellulose membrane assimilated to the medium is sunk and is placed on the beams 51105 and the higher bottom surface 51101. Then the cover 51110 is set, and the medium is fed from the tube 51111-1 and is exhausted from the tube 51111-2. The medium is previously heated to 37° C. Then preincubation is performed for 30 minutes in a CO2 incubator (5% CO2, 37° C.)

Then the substrate 51100 is taken out from the CO2 incubator, the cover is opened, the pulsating myocardial cells are spread as described in Example 1, the cover 51110 is set, and the medium is exchanged with a new one to continue incubation. When the pulsating myocardial cells are spread to the substantially entire surface of the cellulose membrane, a 10 mg/ml cellulase solution is continuously supplied from the tube 51111-1 in place of the medium until top faces of the beams 51105 are wetted by the solution. As the cellulose membrane 5104 and top faces of the beams 51105 are not adhered tightly, the cellulase solution is spread into recesses sections between the beams 51105. When the incubation is continuously performed at 37° C., the cellulose membrane 51104 is decomposed, and the cultured cells are peeled off in the sheet-like state.

Eleventh Embodiment

An eleventh embodiment of the present invention discloses a method of constructing a cell network by controlling a small number of heterogeneous cells to form a network for clarifying functions of discrete cells, for examining responses of discrete cells to a medical agent or the like (for bioassay), or for forming an assembly of cells.

For achieving the object as described above, the various types of micro-chambers as described below are required:

1) a cell culture micro-chamber in which homogeneous or heterogeneous cells are arrayed at any positions according to any order,
2) a culture micro-chamber based on a structure enabling free and easy administration of medical agents, induction of physiological activities of each cell, and easy exchange of a culture fluid with a fresh one and including a mechanism for adding a given material during cell culture,
3) a culture micro-chamber including a mechanism enabling easy administration of a medical agent and control for cultural environment,
4) a micro-chamber for cell culture including a recovery mechanism, with which an operation can recover, after a cell network is formed, the formed cell network by removing the culture chamber used for cell culture, and also a method of constructing a cellular structure with the micro-chambers as described above is required.

In the eleventh embodiment, a support body having the structure in which an agarose gel membrane is formed on a cellulose membrane is used as a material for the cell culture chamber. The agarose gel can be melded by heating, and a space for cell culture is formed by making use of this property. For instance, an agarose membrane is provided in a sufficient quantity of aqueous solution, and a converging beam from a laser having the wavelength allowing for absorption by water, for instance, with the wavelength of 1480 nm is irradiated, the converging laser light is absorbed by the agarose gel, generates heat, and melts the agarose gel. The melted agarose gel is dispersed in the solution and the concentration drops to the level below a threshold value required for gelatinization, so that the agarose gel once melted never be gelatinized.

By using this technique, a cell holding well having the resolution of about 1 μm or a connection flow path between the wells can be formed. What is important in this technique is that, when a specified number of specified cells are cultured in each well and a portion of the cell membrane extends to form a junction with an adjoining cell, a direction in which the cell membrane extends and an order of cells with which the junction is to be formed can be controlled. In other words, it is important that a form of a micro-chamber for cell culture can freely be changed during cell culture. With the availability of this kind of technique as described above, for instance, when three types of cells, namely types A, B, and C of cells are cultured in independent wells and the number of cells belonging to each type is four, for instance, such as an operations are possible in which at first four cells belonging to type A are conjugated to four cells belonging to type B independently, then one of the four cells belonging to type A is conjugated to one of the four cells belonging to type B, and then one of the four cells belonging to type A is conjugated to one of the four cells belonging to type C. With the operations as described above, the objective 1) described is achieved.

The agarose gel membrane can easily be processed by heating the gel with converging light when the agarose gel is formed on a cellulose membrane and is present in a solution, or when the agarose gel is placed on a transparent substrate such as a glass sheet. When the agarose gel is placed on an opaque structural body, another technique according to the present invention is required. The opaque structure is, for instance, one made from a material which absorbs or scatters the converging laser beam having the wavelength employed for processing the agarose gel membrane.

When there is an opaque structural body, a flow path having a desired pattern is formed on the agarose gel by contacting a tip of a light-absorbing needle to the agarose gel and focusing the converging light beam not to the opaque structural body but to a portion of the needle. With this operation, regardless of the type of the substrate on which the agarose gel is placed, it is possible to form a desired cell circuit by linking specified cell culture wells according to a desired order. The silicon or SU8 is a structural body which is not completely transparent is disadvantageous for being irradiated by a converging laser beam, but still the materials are used because application of the micro-fabrication technique is advantageous for addition of a reagent or for formation of a micro-structural body for medium exchange.

The objectives 2) and 3) can easily be achieved by not only using a cellulose membrane and but also placing the cellulose membrane on a micro-structure made from silicon or SU8. In cell culture, it is necessary to employ a semipermeable membrane which structurally separates inside of a well accommodating cells therein from a cell fluid bath and also allows for transmission of a cell fluid. When irradiating a converging light beam onto an agarose gel membrane through this semipermeable membrane, it is necessary to make the semipermeable membrane with a material which can hardly be damaged by the converging light beam. As this material, for instance, a cellulose membrane may be used.

The micro-chamber for cell culture in the eleventh embodiment is formed on a semipermeable membrane, and further a micro flow path prepared by the micro fabrication technique contacts the semipermeable membrane, so that it is possible to exchange a culture fluid with a new one via the semipermeable membrane from the micro flow path, to add any additive for bioassay, or to recover molecules released from a cell in response to addition of the additive. Because of this configuration, the objectives 2) and 3) are achieved.

Finally the cell circuit formed as described above is separated from the substrate. Adhesion between cells is not so strong, so that cell circuits can not be mechanically separated from the substrate. It may be considered that a cell bites into a cellulose membrane. Taking into considerations the fact that a volume of the agarose gel is larger and the cells are damaged when heated, the agarose gel is used as a support body as it is. It is necessary to remove the cellulose membrane and separate the cells together with the agarose gel, but the cellulose itself can be decomposed by cellulase. In this state, the cell circuit is held by the agarose gel, and therefore by laminating a plurality of agarose gel sheets prepared as described above, it is possible to three-dimensionally form a cell network structure.

Example 1

FIG. 54(A) is a perspective view showing a micro-chamber for cell culture in Example 1, while FIG. 54(B) is a cross-sectional view showing the micro-chamber in FIG. 54(A) taken along the line A-A and viewed in the direction indicated by the arrow. An agarose gel membrane 1 is integrally formed on a cellulose membrane 5402, and is placed on a glass substrate 5403. A plurality of wells 5405 each for holding a cell thereon are formed on the agarose gel membrane 5401. The micro-chamber for cell culture 5401 is placed in a vessel 5406. A culture medium 5407 is present in the vessel, and the micro-chamber 5401 is immersed in the culture medium. In FIG. 51(A), the agarose gel membrane 5401, cellulose membrane 5402, and glass substrate 5403 are separated from each other for the purpose of simplification, but actually the components are closely attached to each other as shown in FIG. 54(B).

The agarose gel 5401 is made as described below. At first, the water-swelling cellulose membrane 5402 (with the molecular weight cut off of 100000 Daltons) is placed on the glass substrate 5403 with the dimensions of 20 mm×20 mm×1.1 mm(t), and is provided on a chuck of a spin coater. Size of the cellulose membrane 5402 must be larger than that of the glass substrate 5403, and the peripheral portions are cut off after the agarose is gelatinized. Then 0.5 ml of 50 mM sodium phosphate buffer liquid with pH of 7.4 containing 0.15 M NaCl in 1.5% agarose gel (previously heated in a microwave oven to dissolve the agarose and then cooled to about 60° C.) is applied to the agarose gel, and the agarose gel is rotated for 10 seconds at 100 rpm. Then the agarose is left in a moisture box for 30 minutes to gelatinize the agarose. With this operation, an agarose gel membrane with the thickness of about 100 μm is formed. Thickness of the gel membrane is decided by conditions for forming the membrane, so that the thickness is adjusted by changing the rotational speed and a temperature of the gel.

In this state, wells 5405 for accommodating cells therein, grooves each connecting adjoining wells 5405 to each other, and the like have not been formed yet. Size of the well 5405 as expressed by a diameter thereof is, for instance, 30 μm, and the agarose gel is removed only in portions corresponding to the well 5405. For forming the well 5405, the agarose gel is heated, melted, and removed by irradiating a converging laser beam with the wavelength adapted for absorption by water, for instance, 1480 nm to the agarose gel membrane 5401. Because a sufficient quantity of culture medium 5407 is present in the vessel 5406, the melted agarose gel is diffused, and therefore the agarose gel is not again gelatinized because the concentration is lower than the threshold value for gelatinization of the agarose gel. A desired number of wells 5405 are formed at desired positions by the method.

FIG. 55 is a plan view showing an example of the micro-chamber for cell culture with a cell circuit formed thereon. The reference numeral 5410 indicates the micro-chamber for cell culture with a cell circuit formed thereon. A cell is put in the well 5405 with a micro pipet (not shown). For instance, of 8×2 wells (with the clearance between adjoining wells of 100 μm), a neurocyte is inserted into each of the wells. A pulsating myocardial cell is put in each of the remaining eight wells. The reference numeral 5412 indicates a group of wells 5405 each with a neurocyte inserted therein, and the reference numeral 5413 indicates a group of wells 5405 each with a pulsating myocardial cell put therein. When cell culture is continued for a prespecified period of time, the neurocyte and the pulsating myocardial cell generate projections respectively. The projections start extending in random directions, but at this point of time, generation of junctions between cells is prevented by the agarose gel membrane 5401.

At first, like in the case in which a well is prepared on the agarose gel membrane 5401 between the wells 5405 in the group 5412 of eight wells each containing a neurocyte therein, a converging laser beam having the wavelength of 1480 nm is irradiated to link the wells 5405 with a groove 5411-1 for guiding the projections generated on each neurocyte into the groove 5411-1 formed on the agarose gel membrane 5401. With this operation, gap junctions between neurocytes are formed. Likely, the agarose gel membrane between each well 5405 in the group 5413 of 8 wells each containing a pulsating myocardial cell therein are linked to each other by a group 5411-2 to form a circuit between pulsating myocardial cells. Cell culture is started, only before the grooves are formed between the cells, to prevent the cells from generating projections in random directions with one cell jointing to a plurality of cells, and also for forming a series of cell circuit. If the grooves 5411-1, 5411-2 are previously formed, projections generated on the cell extend over the well 5405 and the cell may be jointed to the adjoining cell. Namely, when a cell has the high activity, the cell generates projections in random directions. On the other hand, when the cell in the adjoining well has the low activity, the cell does not substantially extend the projections. In this case, a cell having the high activity may be jointed to a plurality of cells. To prevent the phenomena as described above, the grooves are not prepared previously, and the grooves should be prepared when the cells are jointed to each other. Further, for instance, when different types of neurocytes are put in the wells 5405 in the well group 5412, it is necessary to strictly manage an order of linkage between the cells. Therefore, it is more effective to dig a groove after projections are generated on the cells.

Finally, for forming a circuit between the neurocytes in the well group 5412 and the pulsating myocardial cells in the well group 5413, a converging laser beam is irradiated onto the agarose gel between the two groups. With this operation, the eight neurocytes and eight pulsating myocardial cells are connected with the groove 5411-3 to form a cell circuit. In this example, for testing, in a case where a signal flows one-dimensionally, namely in a case a signal from a neurocyte in the well 5405 in the well group 5412 goes into a pulsating myocardial cell in the well 5405 in the well group 5413, to check how the signal is transferred to the pulsating myocardial cell in the well 5405 in the well group 5413, data analysis is easier by connecting the wells 5405 at edges of the well groups 5412 and 5413. When it is necessary to analyze signal transfer in a more complicated circuit between a neurocyte in the well 5405 in the well group 5412 and a pulsating myocardial cell in the well 5405 in the well group 5413, any selected wells 5405 may be connected according to the object.

In the cell circuit network as described above, for instance, when an electric stimulus is given to or the ionic state is changed in any of the neurocytes, it is observed that a change occurs in a cyclic beat of the pulsating myocardial cells. In other words, this cell circuit may be used in bioassay of various types of medical agents. Each group contains eight cells, because, in a pulsating myocardial cell or a neurocyte, the cooperativeness between cells can be obtained when four or more cells are linked to each other with the projections as compared to the phenomenon observed in a single cell. Especially, when there are eight cells or more, dispersion of myocardial pulsation is suppressed to about 10% (in contrast to about 50% in a test with a single cell).

In Example 1, a top face of the well 5405 formed on the agarose gel membrane 5401 is open, and with this configuration no problem occurs, because generally an animal cell can not move over a wall with the height of even several μm. Further unnecessary migration of cells can be prevented by placing a cellulose membrane on the entire opening of the well, if necessary.

Finally descriptions are provided for a method of removing the cellulose membrane 5402 and adhering fibroblast over the section with the cellulose membrane 5402 having been removed.

FIG. 56 is a cross-sectional view showing an example of a cell structure construct 5420 in which a circuit consisting of a neurone 5423 and a pulsating myocardial cell 5424 is fixed on a fibroblast sheet 5422 on the cellulose membrane 5421 taken along the line B-B in FIG. 55 and viewed in the direction indicated by the arrow.

At first, the cellulose membrane 5402 formed on the glass substrate 5403 described with reference to FIG. 54 and a structural body based on the agarose gel 5401 are separated from the glass substrate 5403 and are floated in the vessel 5406. For this purpose, cellulase is added in the culture medium 5407 in the vessel 5406 accommodating therein the cell culture micro-chamber 5410 on which the cell circuit has been prepared, and a quantity of cellulase is adjusted to 50 mg/ml as expressed by the final concentration. When the sample is incubated at 37° C., the cellulose membrane 5402 on the glass substrate 5403 is gradually decomposed.

Separately, fibroblast cultured into a sheet form is prepared, and a surface of the agarose gel membrane 5401 with the cellulose membrane 5402 melted thereof is contacted to the fibroblast. When the cell culture is continued in this state, the cell structure construct 5420, in which the agarose gel membrane 5401 is directly adhered to the fibroblast layer 5422, is obtained. A neurocyte 5423 is put in the left well 5405, and a pulsating myocardial cell 5424 is put in the right well 5405, and the two cells extend projections to joint to each other with the groove 5411-3. In FIG. 56, the reference numeral 5421 indicates a cellulose membrane, and as understood from the following description concerning construction of the sheet-formed fibroblast, the cellulose membrane 5421 is different from the cellulose membrane 5402 used for forming the agarose gel membrane 5401.

As described above, in the eleventh embodiment, a groove is formed between wells containing cells to be conjugated to each other during cell culture, and therefore after a structural body in which the cellulose membrane 5402 and the agarose gel membrane 5401 are placed on the glass substrate 5401 is formed, the wells 5405 are formed on the agarose gel membrane 5401 with cells put therein respectively, and then grooves each connecting adjoining wells 5405 to each other are formed. In other words, cell network containing cells is formed at first, and then the cellulose membrane 5402 is melted with cellulase, and the cellulose membrane 5402 is contacted to the fibroblast sheet 5422. The neurocyte 5423 and the pulsating myocardial cell 5424 extend projections to the fibroblast sheets 5422 and are attached thereto.

To culture the fibroblast into the sheet state, a cellulose membrane 5421 (with the molecular weight cut off of 30,000 Daltons, 55 mmφ) with gelatin applied thereof is spread on a dish (60 mm) with 5 ml medium 5401 including serum accommodated thereon. Incubation is performed for 30 minutes in 5% CO2 atmosphere at 37° C. to assimilate the cellulose membrane to the medium. 0.5 ml suspension of fibroblast cells is added to the medium, and incubation is further continued in the CO2 incubator at 37° C. During this incubation, the medium is exchanged with a new one, if necessary. When the cell culture proceeds, the fibroblast pulsating myocardial cells spread like a sheet on the entire surface of the cellulose membrane 5421. FIG. 22 schematically shows the state in which the fibroblast has spread into the sheet state on the cellulose membrane 5421.

Example 2

In Example 1, the cellulose membrane 5402 is placed on a top surface of the flat glass substrate 5403, but in Example 2, a support body for supporting the cellulose membrane 5402 is more improved, and a cell can more easily be controlled during incubation in the state in which the cell is placed in the well 5405 formed on the agarose gel membrane 5401.

FIG. 57(A) is a perspective view showing a micro-chamber for cell culture, while FIG. 57(B) is a cross-sectional view showing the micro-chamber shown in FIG. 57(A) taken along the line A-A and viewed in the direction indicated by the arrow. The substrate 54100 is based on a structural body 54101 with the thickness of 2 mm placed on a top surface of the glass plate 5403 with the size of 60×60 mm. The structural body 54101 may be shaped into a specific form at first with polydimethylsiloxane polymerized. Alternatively the structural body may be cut off from a plastic sheet employed in place of the glass plate 5403. Also the structural body 54101 may be made with SU 8. A rhombus pool 54102 with the depth of 2 mm, in which a solution such as a culture medium flows, is formed, and then a plurality of beams 54103 with the width of 1 mm and height of 2 mm are formed in the pool 5402. Space between the adjoining beams 54103 is about 1 mm. End sections of each beam are off from the periphery of the pool 54102. Spaces 54104, through which a solution is introduced or exhausted, are formed at positions opposite to the pool 54102. A dispersion plate 54105 with the height of 1.5 mm is formed between the space 54104 and beam 54101 so that the solution is homogeneously spread into spaces between the means 54103.

The reference numeral 5402 indicates a cellulose membrane, which has the size sufficiently covering the top surface of the structural body 54101, and the thickness varies from product to product, but is generally in the range from 30 to 100 μm. The reference numeral 54111 indicates an opening, which is provided at a position corresponding to the space 54104 through which a solution is introduced or exhausted.

The reference numeral 54115 indicates a thin plastic plate with the thickness of about 100 μm. The thickness of the thin plastic plate 54115 is preferably the same as that of the agarose gel membrane. The thin plastic plate 54115 is used as a support body for the cellulose membrane 5402, and is also used as a wall material for forming the agarose gel membrane 5401. The agarose gel membrane 5401 is formed at a position corresponding to the rhombus pool 54102 at a central portion of the thin plastic plate 54115 (which hereinafter described). Further openings are formed at positions corresponding to the spaces 54104, through which a solution is introduced or exhausted, provided at two edge sections of the thin plastic plate 54115. In FIG. 57(A), the cellulose membrane 5402 and the thin plastic plate 54115 are separated from each other, and also are off from a top surface of the structural body 54101, but actually the components are overlaid on each other as shown in FIG. 57(B).

The cellulose membrane 5402 may be adhered to the thin plastic plate 54115 with an adhesive before the agarose gel membrane 5401 is formed, and also may simply be placed on the structural body 54101 made from SU8 with the thin plastic plate 54115 overlaid thereon. In any case, the cellulose membrane 5402 and thin plastic plate 54115 are placed and assembled in the integrated state on a top surface of the structural body 54101 before the agarose gel membrane 5401 is formed.

In this process, agarose with the melting temperature of about 65° C. and a concentration of 1.5% is used. The agarose is melded in a microwave oven and is coated on a region for forming the cellulose membrane 5402 integrated with the thin plastic plate 54115, and is left for 30 minutes in the wet state at the room temperature. As a result, the thin plastic plate 54115 with the agarose gel membrane 5401 adhered on the cellulose membrane 5402 can be obtained.

Next descriptions are provided for a method of forming a groove 5411 between adjoining wells 5405. Different from Example 1, in this example, the substrate 54100 is not always required to be transparent to the converging light beams with the wavelength of 1480 nm. Therefore, in this example, the groove 5411 between the adjoining wells 5405 can not be formed by irradiating the converging light beam.

When the cellulose membrane 5402 is adhered to the thin plastic plate 54115 with an adhesive before the agarose gem membrane 5401 is formed, the wells 5405 can be formed on the glass substrate transparent to the converging light beam by removing the thin plastic plate 54115 with the agarose gem membrane 5401 formed thereon from the substrate 54100. However, another technique is required when the cellulose membrane 5402 is placed on a top surface of the structural body 54101 and held by the thin plastic plate 54115. Also another technique is required for forming a groove to be prepared after the cell culture is started.

As described above, when wells 5405 can not be formed on the glass substrate transparent to the converging light beams, a converging light beams with the wavelength, absorption of which by water can substantially be ignored, (for instance a converging light beam with the wavelength of 1064 nm) is used. When the converging light beams with the wavelength, absorption of which by water can substantially be ignored, is employed, even if the light beams is irradiated onto the agarose gel membrane 5401, the agarose gel membrane 5401 can not absorb the light beams and convert the energy to heat, so that the agarose gel membrane 5401 can not be processed. To overcome this problem, the light beam is irradiated to a micro needle functioning as a transducer to convert energy of the converging light beam to heat, and the agarose gel membrane 5401 is processed by making use of this heat.

FIG. 58 is a schematic view illustrating an outline of the system for converting a converging light beam to heat with a micro-needle and processing the agarose gel membrane 5401 with the heat. A micro-chamber for cell culture integrated with a thin plastic plate 54115 having a glass substrate 5403, the structural body 54101, the cellulose membrane 5402 and the agarose gel membrane 5401 formed thereon is put in a chamber (not shown) containing a culture medium and is placed on a stage 5459. The stage 5459 is driven in any of directions X and Y by a driving device 5435 operating according to a drive signal from the personal computer 5441. The reference numeral 5431 indicates camera which is, for instance, a CCD camera, and picks up images of a processed surface of the agarose gel membrane 5401 via lenses 5432, 5433. In this step, a light source 5434 is prepared, a light beam is introduced through a half mirror 5435 provided between the lenses 5432, 5433 and irradiated in the direction indicated by an arrow 5436. The light beam may directly be irradiated from above the micro-chamber for cell culture without using the half mirror 5435. The reference numeral 5441 indicates a so-called personal computer, which stores therein necessary programs, receives information concerning a surface to be processed from the camera 5431, and also receives an operation-related signal 5442 from a user. Although not shown in the figure, a display unit is provided on the personal computer 5441, and an image of the surface to be processed from the camera 5431 is displayed thereon.

The reference numeral 54120 indicates a micro-needle used to process the agarose gel membrane 5401. A laser beam 54121 is focused by a lens 54122 and irradiated as a converging light beam to the micro-needle 54120. The micro-needle 54120 is made from, for instance, silicon or carbon, and a diameter of a tip section thereof should preferably 2 μm. The laser beam 54121 with the wavelength of 1064 nm is irradiated through the lens 54122 onto a tip section of the micro-needle. Then a temperature of the tip portion of the micro-needle 54120 rises, so that the agarose gel membrane 5401 can be melted. An agarose gel in a necessary range can be melted and removed by moving the stage 5459 in the directions X and Y, while monitoring the processed surface of the agarose gel membrane 5401.

The micro-needle 54120 can be separated upward from the processed surface of the agarose gel membrane 5401 according to a user's instruction via the personal computer 5441. When the micro-needle 54120 is separated in the upward direction, irradiation of the converging light beam 54121 should preferably be stopped. When a user forms one well 5405 monitoring the processed surface of the agarose gel membrane 5401 with the micro-needle 54120 and converging light beam 54121, the user gives an instruction to move the micro-needle 54120 in the upward direction to the personal computer 5441, when the instruction to move the micro-needle 54120 in the upward direction is given to an up-down driving device 5447 of the micro-needle 54120, so that the micro-needle 54120 moves in the upward direction and goes off from the processed surface of the agarose gel membrane 5401. A chain line 5448 indicates coordination between an up/down movement device 5447 and the micro-needle 54120. In the state where the micro-needle 54120 has been separated from the processed surface of the agarose gel membrane 5401, the user gives an instruction for movement of the stage 5459 to the personal computer 5441 to form the next well 5405. In response to this instruction, the personal computer 5441 gives a drive signal to the driving device 5437, thus the stage 5459 being driven.

The user monitors a tip of the micro-needle 54120 and stops the stage 5459 when the tip of the micro-needle 54120 reaches a position at which the next well 5405 is to be formed. At the new position, the micro-needle 54120 is moved downward as described above, and the converging light beam 54121 is irradiated to form the next well 5405.

FIG. 59 is a schematic view showing an outline of the situation in which a groove between the wells 5405 on the agarose gel membrane 5401 is formed during cell culture. FIG. 59 schematically shows the situation in which a groove 5411-3 between the wells 5405 shown in FIG. 55 is being formed. The micro-chamber for cell culture integrated with the thin plastic plate 54115 with the glass substrate 5403, the structural body 54101 made from SU8, the cellulose membrane 5402, and the agarose gel membrane 5401 formed thereon is described with reference to FIG. 57(B). An operator is required only to engrave the groove 5411-3 from one side of the adjoining well 5405 with the micro-needle 54120 and converting light beam 54121. With the method as described above, regardless of a type of the substrate on which the agarose gel is placed, a desired cell circuit can be formed by connected selected cell culture wells according to a specified order.

In Example 2, as understood from FIG. 57(A), tubes 54117, 54118 of the micro-chamber for cell culture integrated with the thin plastic plate 54115 with the glass substrate 5403, the structural body 54101 made from SU8, the cellulose membrane, and agarose gel membrane 5401 formed thereon can be inserted into the space 54104 through which a solution can be introduced into or exhausted from the rhombus pool 54102 formed in the structural body 54101 made from SU8 through openings 54116, 54111. Therefore, the cellulose membrane 5402 can efficiently be decomposed by pouring cellulase from the contrary side of the agarose gel membrane 5401 via the tubes 54117, 54118 and directly contacting the cellulase to the cellulose membrane 5402, and also the culture medium can easily be exchanged with a new one or any additive can be added to or removed from the medium during cell culture.

(Others)

In the examples above, the micro-chamber for cell culture is described as a completed one in any case. However, the micro-chamber for cell culture is required only to allow for placement of a cell or the like in the cell culture zone 5405 and formation of a groove or grooves by a researcher using the micro-chamber. Therefore, for instance, in Example 1, it is practical to provide the gel membrane 5401 formed with the semipermeable membrane (cellulose membrane) 5402 and agarose or agarose derivative formed thereon, or the gel membrane with cell culture zones 5405 formed thereof is provided as a market product. In this case, a researcher or other persons having purchased the product places the product on an appropriate glass substrate, prepares a culture fluid, puts in a cell or the like in each of the cell culture zones 5405, and forms a groove during cell culture.

Also in Example 2, it is practical to provide an assembly prepared by adhering the cellulose membrane 5402 to the thin plastic plate 54115 with adhesive and also forming a agarose gel membrane in an area of the thin plastic plate 54115 for forming the agarose gel membrane 5401, or an assembly prepared by forming cell culture zones 5405 on the gel membrane as a market product. Further a structural body 54101 with a plurality of beams 54103 for forming a rhombus pool 54102 through which a solution such as a culture medium flows and also functioning support materials for the agarose gel membrane 5401 and the tubes 54117, 54118 may be provided as a kit for cell culture micro-chamber. In this case, a researcher or other persons prepares a culture fluid, puts a cell or the like in the cell culture zone 5405, and forms a groove between wells during cell culture.

Twelfth Embodiment

A twelfth embodiment of the present invention discloses, like in the ninth embodiment, a structure in which a network consisting of a minimum number of cells with a plurality of heterogeneous cells interacting therein on a chip for measuring change in responses of the cell network to a stimulus controlling the network consisting of a small number of heterogeneous cell.

Example 1

FIG. 60 is a plan view schematically showing an example of a cardiac muscle cell bioassay chip in Example 1 of the twelfth embodiment of the present invention. FIG. 61 is a cross-sectional view showing the bioassay chip shown in FIG. 60 taken along the line A-A and viewed in the direction indicated by the arrow. The cardiac muscle cell is not shown now. The reference numeral 6001 indicates a substrate, and all constructs are provided on the substrate 6001. The reference numeral 6002 indicates a cardiac muscle cell holding zone, and a plurality of zones 6002 are regularly formed thereon. The reference numeral 6003 indicates a groove or a tunnel, which connected adjoining cardiac muscle cell holding zones 6002 to each other. The cardiac muscle cells extend the projections through the groove or tunnel 6003 to contact each other and form a gap junction. The reference numeral 60100 indicates an agarose gel, which is formed on the substrate 6001, and the cardiac muscle cell holding zones 6002, the groove or tunnel 6003 connecting the zones 6002 to each other are formed by partially removing the agarose gel 60100. The reference numerals 6004-1, 6004-2 indicate electrodes respectively, and the electrode 6004-1 is provided in all of the groove or tunnel 6003, while the electrode 6004-2 is provided in all of the cardiac muscle cell holding zones 6002. The electrode 6004 comprises a transparent electrode (ITO) and is adhered by deposition on a surface of the substrate 6001. The reference numeral 6005 indicates an external terminal, and is provided around the substrate 6001 at a position corresponding to and close to the electrode 6004. The reference numeral 6006 indicates wiring, which connects the electrode 6004 to the external terminal 6005. The wiring 6006 is not shown in FIG. 61 for simplification. The electrode 6004 and wiring 6006 have the thickness of about 100 nm, and is made from transparent ITO. The reference numeral 6001-1 indicates a wall provided on the substrate 6001, which defines and holds a peripheral section of the agarose gel 60100. The reference numeral 6009 indicates a semipermeable membrane, which is provided and adhered to a top surface of the agarose gel 60100 with the cardiac muscle cell holding zones 6002 and the groove or tunnel 6003 communicating the zones 6002 to each other formed thereon. The reference numeral 6022 is an upper housing, which covers the entire top surface of the agarose gel 60100 and is provided on the semipermeable membrane 6009 with a proper space in-between. The reference numeral 6022-1 indicates a fall section of the upper housing 6022. The reference numeral 6021 is a culture fluid bath formed between the semipermeable membrane 6009 and the upper housing 6022. The reference numeral 6023 indicates an opening provided on the upper housing 6022, and a culture fluid is supplied through this opening into the culture fluid bath 6021. The reference numeral 6014 indicates a common electrode, which is provided in the culture fluid bath 6021. Because the culture fluid is supplied to cells held in the cardiac muscle cell holding zones 6002 through the semipermeable membrane 6009, which prevents change in conditions during culturing.

As for the procedure for preparing the structure, at first the electrode 6004, wiring 6006, and terminal 6005 are formed on the substrate 6001, and then the wall 6001-1 is adhered to the substrate 6001, and hot-melted agarose 60100 is poured into the wall 6001-1. The 2% agarose gel (with the melting point of 65° C.) is heated and melted in an microwave oven. The melted agarose solution is added to inside of the external wall 6001-1 of the substrate 6001 heated to 65° C., and is immediately spread into a sheet with the homogeneous thickness with a spin coater. An addition rate of the agarose gel and a rotational speed of the spin coater are added so that the agarose gel membrane with the thickness in the range from 0.05 mm to 0.5 mm will be obtained. Although the required thickness varies according to a device or a lot of the agarose gel, a good result is obtained with the operating conditions of 50 rpm for 15 seconds, and 200 rpm for 10 seconds. When left in a moistening box for 1 hour at 25° C. At this point of time, the agarose gel membrane is formed on the entire inner surface of the external wall 6001-1 of the substrate 6001. Then, for forming the cardiac muscle cell holding zones 6002 on the agarose gel 60100, the agarose gel 60100 is formed, and then portions corresponding to the cardiac muscle cell holding zones 6002 are removed. The portions can easily be removed by using a laser beams in the wavelength band adapted for absorption by water (for instance, 1480 nm).

FIG. 61 is a cross-sectional view showing a cardiac muscle cell bioassay chip with an agarose-made electrode on which the cardiac muscle cell holding zones 6002 have been formed, and this cross-sectional view also schematically shows an optical system and a control system used for preparing the groove or tunnel on the agarose gel 60100. A cellulose membrane (with the molecular weight cut off of 30,000 Daltons) is used as the semipermeable membrane 6009 on a top surface of the agarose gel 60100. For instance, heated and melted agarose gel is applied on a surface of the cellulose membrane with a spin coater, and an agarose film is formed on one surface thereof. After cells are put in the cardiac muscle cell holding zone 6002 respectively, the cellulose membrane previously prepared as described above is placed the agarose gel 60100 so that a surface of the cellulose membrane with agarose applied thereon contacts the agarose gel 60100. Alternatively, when the agarose gel 60100 is formed, a small quantity of streptavidin conjugated agarose is added for solidification. Streptavidin is exposed on a surface of the agarose gel derivative. Further alternatively, biotin hydradide is reacted to a cellulose membrane with an aldehyde group introduced therein by oxidization with periodic acid, and a biotin-modified cellulose membrane is prepared by reducing the reaction product above by hydroboration reaction. By fixing the agarose gel derivative and biotin-modified cellulose membrane to each other with the biotin-avidin reaction, a structural body with a cell shielded in the agarose-made structural body can be formed. The peripheral portion of the cellulose membrane may also be adhered outside the wall 6001-1 and on the substrate 6001 by the biotin-avidin reaction. Namely, because the cellulose membrane is biotin-modified, streptavidin may be fixed to the wall 6001-1 and to a surface of the substrate 6001 at an outer side from the wall 6001-1. For fixing streptavidin, for instance, a glycidoxy group is introduced into the substrate by the silane coupling reaction so that the glycidoxy group will directly react with an amino group of streptavidin, or aminosilane is introduced into the substrate and a the aminosilane and an amino group of streptavidin is bridged with a bifunctional reagent. Further the fall section 6022-1 of the upper housing 6022 may be adhered thereto.

A Laser 60141 with the wavelength of 1480 nm adapted to absorption by water is used for irradiation. The laser beam 60142 passes through an expander 60143, and passes through a filter 60144 which reflects IR rays with the wavelength of 740 nm or more but allows for transmission of the light with the wavelength of 1480 nm (±20 nm), further passes through a deposition filter which allows for passage of light with the wavelength of 700 nm or more, and is focused by a conversing lens 60146 on a top surface of the substrate 6001. The converged light beam with the wavelength of 1480 nm is absorbed by water contained in the agarose layer, and the temperature rises up to a degree near the boiling point. With the laser power is 20 mW, the agarose is melted with a line width of about 20 μm near the section irradiated by the converging light beam, and is removed by thermal convection. The problem is that amplitude of the converging light beam changes absorbed by agarose according to whether the electrode is present on the substrate 6001 or not. To solve the problem as described above, in the present embodiment, a contrivance is introduced so that a temperature caused by irradiation of a converging light beams can be controlled by controlling a laser power by means of feedback control based on estimation of a temperature of the agarose gel. The converging light beam having reached the agarose section is converted to heat and generates IR rays. The IR rays pass through the filter 60145, are reflected by the filter 60144, and reach an IR ray camera 60160-1. Image data picked up by the IR camera 60160-1 is fetched into a computing device with a video recording mechanism 60161, and the temperature is estimated based on amplitude of detected light, which is used for adjusting a power of the laser 60141. When it is difficult to control the temperature only by adjusting the laser power, a moving velocity of the stage 60164 is controlled according to an output from the computing device so that a temperature of agarose in the section irradiated by the converging light beam is kept at a constant level. Namely, a rotational speed of the stepping motor 60162 is controlled by the computing device 60161, and a torque of the stepping motor is delivered by the driving force delivering device 60163 to the stage 60164.

The substrate 6001 is set on the stage 60164, and the groove or tunnel 6003 can freely be formed on the agarose gel. An ITO-made transparent electrode 6004-1 is previously formed in each groove or tunnel 6003. Further to monitor beat of the cardiac muscle or the progress of agarose engineering, also an optical system for detecting transmitted light from a light source 60170 is also incorporated therein. The light from the light source 60170 passes through the transparent upper housing 6022, also passes through the object lens 60146 being scattered in the agarose section, and is fetched by a deposition filter (mirror) reflecting visible light and a CCD camera 60160-2 as an image. The image data is sent to the computing device 60161, overlapped with the image taken by the IR camera 60160-1, and the synthesized image is used for checking temperature-raised portions by laser irradiation and a pattern on the structural body. Namely the system can measure beat of cardiac muscle using both or either one of a microscope and the electrode.

A top surface of the agarose gel 60100 forms the culture fluid bath 6021, and a culture fluid fed from the opening 6023 is always circulating therein. Further by adding various types of chemical substances such as those stimulating cells or endocrine disrupting chemicals can be added from the opening 6023, and a beating state of the cardiac muscle can be monitored with the electrode or with a microscope. In this step, observation with a microscope is employed for bioassay of an ionic substance which may affect a result of measurement with the electrode, while observation with the electrode is employed for bioassay of a substance such as a coloring matter not suited to observation with a microscope.

Main dimensions of the cardiac muscle cell bioassay shown in FIG. 60 are as shown below. The size of the cardiac muscle cell holding zone 6002 is 30 μm×30 μm with the depth in the range from 0.05 mm to 0.5 mm which is the same as that of the agarose gel 60100. A distance between the adjoining cardiac muscle cell holding zones 6002 is 50 μm, and the tunnel 6003 communicating the adjoining cardiac muscle cell holding zones 6002 has the height in the range from 50 μm to 300 μm and the depth of 5 μm. When the height of the tunnel 6003 is 50 μm and thickness of the agarose gel 60100 is 0.05 mm, the tunnel is not a tunnel, but a groove. There are several methods available for placing a cell in each of the cardiac muscle cell holding zones 6002. For instance, there is the method in which a micro-capillary is inserted to capture a cell with a tip thereof and the cell is removed into the cardiac muscle cell holding zone 6002. There is another method available for the same purpose in which a droplet containing cells is dropped onto a top surface of a region for the cardiac muscle cell holding zone 6002 and agarose gel 60100, and the top surface of the region is slid so that an odd liquid is extruded therefrom to set the cell in the cardiac muscle cell holding zone 6002. In the latter case, the size of the cardiac muscle cell holding zone 6002 is required to be substantially the same as that of the cell.

Because two electrodes are provided in each cardiac muscle cell holding zone and in one groove or tunnel 6003, so that fluctuation of an electric potential in the cardiac muscle cell can easily be captured. Each electrode is connected with the wiring 6006 to the terminal 6005, so that electric measurement can be carried out by each single electrode or a pair of the electrodes.

FIG. 62 is a view showing an image taken by a transmission microscope and showing the state where cardiac muscle cells are accommodated in all zones on the cardiac muscle cell chip in Example 1. This microscopic image shown in FIG. 61 shows a result of observation of light irradiated from the cardiac muscle cell chip and transmitting therethrough with the CCD camera 60160-2. The IR laser 60140 or IR camera 60160-1 is not used in this observation. It is needless to say that the observation can be made with an assembly in which the CCD camera 60160-2 is attached to an inverted microscope. The reference numeral 6032 indicates the cardiac muscle cell holding zone 6002, which is the same as that indicated by the reference numeral 6002 in FIG. 60. The reference numeral 6033 indicates a groove or a tunnel, which corresponds to the tunnel 6003 shown in FIG. 60 and FIG. 61. In FIG. 62 (photograph), cardiac muscle cells 6034 are previously set in all of the cardiac muscle cell holding zones 6032, and the cells extend the projections through the tunnel 6033 to contact each other and form a gap junction. Namely the cells contact each other in this state.

Example 2

In Example 2 of this embodiment, descriptions are provided for a result of examination on a number of cells required for configuring a network of pulsating myocardial cells as a cardiac muscle cell bioassay chip.

With the cardiac muscle cell bioassay chip shown in FIG. 60 and FIG. 61, a network consisting of up to nine oscillating myocardial cells can be formed by placing a oscillating myocardial cell in each of the cardiac muscle cell holding zones. In this case, an electric potential or transfer imaging of a cardiac muscle cell while beating, which was described with reference to FIG. 49(A) and FIG. 49(B), are obtained, and a similar analysis result can be obtained.

FIG. 63 is a view plotted by accommodating a oscillating myocardial cell in each of 6001, 6003, 6004, 6008 and 6009 cardiac muscle cell holding zones respectively, measuring a beat interval of each cell 64 times to obtain CV (a value obtained by dividing the standard deviation by the average value). Plots 61, 62, 63, 64, and 65 are CVs for beat interval measurement values measured with 6001, 6003, 6004, 6008 and 6009 pulsating myocardial cells respectively, and the curve 62 is a curve obtained by supplementing sections between the plots. It was found that sometimes dispersion of beat may reach even 50% in a case of a single oscillating myocardial cell, but that the beat dispersion lowers when the oscillating myocardial cells form a network. When a number of oscillating myocardial cells forming a network is eight or more, the dispersion in beat drops to about 10%, which indicates that the cells beat in the stable state.

This result suggests that bioassay data with high reproducibility can be obtained by performing a bioassay with a network consisting of eight or more pulsating myocardial cells. A number of cells at a cross point between a string passing through dispersed points obtained with one and three cells and those obtained with eight and ten cells is four. From this point, it can be guessed that, when a network consists of four or more cells, dispersion of beat intervals drops to a substantially constant value.

When the number of cells is too large, dispersion in beat interval is more stabilized, but other negative factors increase in association with increase of a number of cells, which is not preferable. For instance, it is possible to prepare a bioassay chip consisting of 1000 cells, but the obtained result indicates only an average as described in the description of the background technology, and responses of each cell to a medical agent can not be obtained accurately, which is disadvantageous. Further when the number of cells forming network increases, also the number of electrodes and other components increase, which disadvantageously leads to increase in cost for preparing a chip or cost for a measuring device, and further a longer time is required for preparing the bioassay chip, which is also disadvantageous. Up to 32 cells are sufficient for bioassay.

As for arrangement of pulsating myocardial cells in the cardiac muscle cell bioassay chip and the number of cells therein, when viewed from the view point of the necessity to build up an environment similar to that for cells in a living organism, the space should be as compact as possible, or should be as close to a square as possible. Therefore, when the number of cells is four, the number of cardiac muscle cell holding zones should be 2×2, and when the number of cells is 32, the number of cardiac muscle cell holding zones should be 6×6 with four cells at four corners removed. Namely it is preferable that the number of cells for forming a cardiac muscle cell network is in the range from 4 to 32. For obtaining more accurate data with small dispersion, it is preferable to form a cardiac muscle cell network with cells in the range from 8 to 32. Descriptions are provides below for a procedure to carry out bioassay with a cardiac muscle cell bioassay chip with a cardiac muscle cell accommodated in each of eight cardiac muscle cell holding zones.

An additive to be measured is put in the culture fluid bath 6021 shown in FIG. 61, monitoring an electric signal between each electrode 6004-1 or 6004-2 and the common electrode 6014 shown in FIG. 61, or measuring change in brightness of each oscillating myocardial cell by monitoring the microscopic images. An interval 6052 between beat signals 6051 generated in each cell is measured as a beat cycle. With an additive not affecting a cell, no change is observed in the beat cycle. With an additive affecting a cell, the beat cycle fluctuates. An electrode used for monitoring the electric signal may be either the electrode 6004-1 or the electrode 6004-2 in the cardiac muscle cell holding zone, but when it is necessary to monitor beat of each cell, it is better to use the electrode in the cardiac muscle cell holding zone 6002.

The beat cycle data obtained with the cardiac muscle cell bioassay chip according to the twelfth embodiment has a dispersion of 10% or below, and therefore, if the data values fluctuate by 20% or more as 2 SD (a value indicating a range of twice of standard deviation), it can be determined that there are actual influences. With a single cell, the dispersion is 50%, unless the beat cycle fluctuates, it can not be determined that there is any influence by the additive. Therefore, when the cardiac muscle cell bioassay chip based on a cardiac muscle cell network consisting of eight or more cells, there is provided the merit that influences by the additive can be measured with high precision. On the other hand, in a bioassay using a large number of cells, a concentration of an additive against each discrete cell drops, and dispersion due to differences in the characteristics between cell groups becomes larger, which is disadvantageous.

Example 3

Example 3 shows a case where a cardiac muscle cell bioassay chip is formed with a glass substrate. In this case, size of each cardiac muscle cell holding zone has a diameter of 30 μm and the depth of 20 μm, and the cardiac muscle cell holding zones are prepared with a pitch of 50 μm on the glass substrate 1 by etching, and also a groove with the width of 5 μm and depth of 10 μm is formed between adjoining cardiac muscle cell holding zones. An amino group is introduced into a surface of the glass substrate by means of the silane coupling reaction, and further a carboxylic group is introduced into the amino group by reacting succinic anhydride, and this carboxylic group and streptavidin are bonded to each other by condensation with water-soluble carbodiimide. A cell is inserted into each cardiac muscle cell holding zone 6002 with a capillary pipet, and each zone may be covered with biotinated cellulose membrane. An upper circulation bath 6021 similar to that shown in FIG. 61 is attached thereon to prepare a structure in which a fluid in the upper circulation bath is always circulated or a reagent for assay is added therein.

Example 4

FIG. 64 is a cross-sectional view showing the cardiac muscle cell bioassay chip in Example 4 and shown in FIG. 61. As clearly understood by comparing FIG. 64 to FIG. 61, the cardiac muscle cell bioassay chip in Example 4 is the same as that in Example 1 excluding the point that the circulation bath 6021 is divided to three sections by setting a partition for three cardiac muscle cell holding zones which are perpendicular to a view plane. As described above, the circulation bath 6021 is divided to three sections each consisting of three cardiac muscle cell holding zones. In this configuration, different solutions may be circulated in the three sections respectively, and therefore measurement of myocardial oscillation may be performed, for instance, by adding a bioassay reagent only in the middle circulation zone and filling an ordinary buffer liquid (culture fluid) in other upper circulation zones. In this figure, the opening 6023 provided on the upper housing 6022 are shown side by side for convenience, but it is needless to say that the openings should be provided in the three cardiac muscle cell holding zones perpendicular to the view plane respectively so that each solution can be circulated more smoothly.

By measuring oscillation of cardiac muscle by adding a reagent for bioassay only in the middle circulation bath and also flowing an ordinary buffer liquid (culture fluid) in other upper circulation baths, disturbance of a beat synchronization signals from the adjoining cells can easily be measured. Namely, in addition to the direct cytotoxity when a medical chemical is administered, the effect over the inter-cellular community can be measured, and therefore the effects which have been expressed with subjective expressions such as “physical conditions are good or not good when a medicine is drunk” may be expressed with digital values.

(Others)

As described in Example 3, a communication route between adjoining cardiac muscle cell holding zones in the cardiac muscle cell bioassay chip according to the twelfth embodiment is not limited to a tunnel, and may be a groove.

As for the potentials in industrial utilization of the cardiac muscle cell bioassay chip according to the twelfth embodiment, various possibilities are conceivable from the viewpoint of utilization thereof by researchers or in pharmaceutical companies and from the viewpoints of utilization by manufacturers supplying cardiac muscle cell bioassay chips. From the user's point of view, the chip should preferably be supplied in the state where cardiac muscle cells have been accommodated in the cardiac muscle cell holding zones respectively to form a cardiac muscle cell network. However, the cardiac muscle cells accommodated in the cardiac muscle cell holding zones can not live for a long time in the state as described above, a manufacturer/supplier of bioassay chips preferably supplies chips each with the duration of effective use limited to a short period of time. Alternatively the bioassay may be separated to a portion including the substrate 6001, electrodes and related portions 6004, terminals 6005, wiring 6006 and agarose gel 60100 on the substrate 6001, and to a portion including the semipermeable membrane 6009 and upper housing 6022, and a set comprising these two portions may be supplied as a kit. When the bioassay chip is supplied as a set (kit), the user must be responsible for accommodation of a cardiac muscle cell into a cardiac muscle cell holding zone and assembly of the kit.

(E) Now descriptions are provided for a device and a method for obtaining information from cultured cells and those formed into a network.

Thirteenth Embodiment

In a thirteenth embodiment of the present invention, a method is described in which mRNA or proteins present in cytoplasm are recovered without killing the cell and in-vitro analysis is performed for the purpose to successively obtain information over time from a single cell. In this method, a tip portion of a living organism sampling chip with the tip diameter of 2 nm or below is inserted into a cell to recover the contents. An oligo T for hanging up the mRNA is fixed to the tip portion of the living organism sampling chip. Alternatively, a tip portion of the living organism sampling chip is partitioned into several areas in the sagittal direction, and the oligo based on two to four different sequences is fixed to the 3′ terminal side of the oligo T, and the mRNA is preparatively isolated being classified by the two to four bases adjoining the poly A.

As a probe used in this step, PNA or synthetic polynucleotide not having any minus electric charge like PNA is used. For the ordinary polynucleotide based on the phosphodiester bond is easily decomposed by endonuclease in a cell and the proving sequence portion of the mRNA is easily blocked due to holding. When a specific protein is to be analyzed, the RNA aptomer or DNA aptomer to specific protein groups described in the third embodiment is fixed to a tip of the living organism sampling chip, and the conjugate is used to hang up the specific protein.

When a tip of the living organism sampling chip is inserted into a cell, for reducing physical damages to the cell, a diameter of the tip portion (inserted into the cell) should be ⅕ of the cell size or below. Further the tip portion should previously be coated with titanium oxide TiO2. Alternatively the entire tip portion inserted into the cell may be coated with arginine in place of titanium oxide TiO2 to facilitate interactions with phospholipids in the cell membrane on a surface of a cell and also to facilitate smooth insertion of the tip portion of the living organism sampling chip. If necessary, the entire portion inserted into a cell is coated with arginine, and only the tip portion is coated with titanium oxide TiO2.

In this embodiment, a tip portion of the living organism sampling chip is inserted into a cell, and then the tip portion of the living organism sampling chip with an object for measurement on a surface of the prove tip is pulled off from the cell, and a quantity of the specified substance captured on a surface thereof is measured. In this step, at first the specific substance is bonded to nanoparticles by using the so-called sandwich reaction. By scanning the nanoparticles remaining on a surface of the tip portion of the living organism sampling chip with a scanning microscope, an amount of the recovered substance is quantitatively measured. Alternatively, the nanoparticles remaining on a surface of the tip portion of the living organism sampling chip is measured with an atomic force microscope.

Example 1

FIG. 65 is a flow chart showing an operation flow in the method of recovering and analyzing organic substances in a cell according to the thirteen embodiment shown in FIG. 65, while FIG. 66(A) is an enlarged view schematically showing a living organism sampling chip tip portion 6503, and FIG. 66(B) is a perspective view schematically showing the entire image of the living organism sampling chip according to the thirteenth embodiment.

In FIG. 65, the reference numeral 6501 indicates a cell, while the reference numeral 6502 is a nucleus of the cell 6501. The reference numeral 6503 is a tip portion of the living organism sampling chip according to the thirteenth embodiment. The living organism sampling chip tip portion 6503 has a diameter with the size of about ⅕ of the size of cell 6501, and is a sharp needle. The reference numeral 6505 is titanium oxide TiO2 coated on the living organism sampling chip tip portion 6503, while the reference numeral 6506 is ultra-violet rays with the wavelength of 335 nm, and irradiated to the living organism sampling chip tip portion 6503 when inserted into the cell 6501. By irradiating the ultra-violet rays with the wavelength of 335 nm to the living organism sampling chip tip portion 6503 when inserting into the cell 6501, the tip portion 6503 can easily be inserted into the cell 6501 due to the organic material decomposing action of the titanium oxide TiO2 use for coating. When prematured mRNA or core protein is to be analyzed, the living organism sampling chip tip portion 6503 is inserted into a core 6502 of the cell 6501.

The living organism sample obtained with the living sample chip tip portion 6503 is washed after the living organism sampling chip tip portion 6503 is pulled off from the cell 6501, and is labeled with gold nanoparticles. Then the sample is again washed and dried, and then measurement is performed. The arrow 6504 indicates that the living organism sampling chip tip portion 6503 is moved up and down against the cell during the operation.

As shown in FIG. 66(A), the probe 6521 is fixed to the probe area 6522 of the living organism sampling chip tip portion 6503. The probe 6521 is a substance having affinity to an intracellular biological material to be recovered. Size of the probe area 6522 may be decided by taking into consideration the cell's size, and is at most 10 μm, and 4 μm at the root of the probe area 6522. The living organism sampling chip tip portion 6503 is coated with titanium oxide TiO2 6505. As described above, the living organism sampling chip tip portion 6503 is extremely small. To make treatment thereof easier, as shown in FIG. 66(B), the living organism sampling chip tip portion 6503 according to the thirteenth embodiment has a living organism sampling chip tip portion holder 6508, and the holder 6508 is connected to the operation board 6507. A diameter of the holder 6508 is, for instance, 1 mmφ, while size of the operation board 6507 is 4 mm×5 mm. The cell 6501 is placed under an object lens of a microscope and the living organism sampling chip tip portion 6503 is inserted into the cell by operating the operating section supporting the operation board 6507, so that the operation can be performed in the stable condition with safety. Further, even when measurement is performed with an SEM or an AMF, the living organism sampling chip tip portion 6503 can be operation with the operating section supporting the operation board 6507.

In Example 1, descriptions are provided for a case in which the living organism sampling chip tip portion 6503 is inserted into a cell from a tissue sample of colon cancer and a specific mRNA present in the cell is analyzed. A 5-base random sequence oligo DNA conjugated to the 3′ terminal of a 26-base poly T is used as the probe 6521. This conjugate is used as the probe, because only the poly T is insufficient for achieving stability in mRNA hybridization. The probe 6521 is made of PNA (peptide nucleic acid) for easy interaction with the mRNA in the cell. Different from the ordinary DNA, the PNA does not have a minus electric charge originated from the phosphodiester bond, and therefore an electrostatic repelling force does not work with a DNA as a target.

Because of the feature, when the probe area 6522 of the living organism sampling chip tip portion 6503 is inserted into a cell, the probe 6521 efficiently hybridizes the specific mRNA present in the cell, which is advantageous. Also, repulsion force is not generated between phospholipid and the living organism sampling chip tip portion 6503, the tip portion 6503 can be inserted into the cell membrane smoothly. In a case where the probe 6521 is tightly fixed to a solid phase surface of the probe area 6522 like in Example 1, if an ordinary DNA is used as the probe 6521, the target DNA is required to move toward the probe 6521 overcoming a barrier of minus electric charge generated by the probe area 6522, which is disadvantageous from the both viewpoints of chemical kinetics and thermodynamics. Also the target mRNA is required to be a single chain, but is actually three-dimensionally held in a molecule, and therefore sometimes a probing site, to which the probe conjugates, may be blocked.

When a probe not having minus electric charge like PNA is used, an electric charge of the probe itself can be eliminated, so that a barrier of minus electric charge is not generated by the probe area 6522, and because of the feature, the speed and yield in hybridization can be improved. Further the PNA having no electric charge does not generate an electrostatic repelling force, so that the prove can competitively creep into the target DNA even when the target DNA is double-stranded to achieve competitive hybridization.

Further also the cell membrane is covered with negatively charged phospholipids, and therefore if a surface of the living organism sampling chip tip portion is negatively charged, a repulsion force works between the living organism sampling chip tip portion and the cell, so that insertion of the living organism sampling chip tip portion into the cell becomes difficult. In contrast, the living organism sampling chip tip portion with a PNA probe fixed thereto can easily be inserted into a cell.

The living organism sampling chip tip portion 6503 is inserted into the cell 6501, and the probe area 6522 is left in the cell for 30 seconds. Then the living organism sampling chip tip portion 6503 is pulled off from the cell 1, and is immediately washed with 2×SSC. Then a second probe labeled with gold nanoparticles with the diameter of 8.3 nm is hybridized with the mRNA hybridized to the probe 21 in the probe area 6522. In this step, an oligo PNA having a specific sequence is used as the second probe. PNA is used for the same reason as that described above. For instance, the 28-base sequence specific to EpCAM, which is reportedly expressed a lot in epithelial cell cancer, is used. The conjugate is again washed and cleaned with deionized water. In Example 1, because the PNA probe is used, the hybridized probe is never de-hybridized even when washed with deionized water.

When the ordinary DNA is used as the second probe, the hybridization is substantially affected by a dielectric constant of a solvent due to the repulsion force between the molecules generated by minus charge in the phosphodiester bond. Therefore, hybridization can not be achieved unless decreasing the repulsion force between the phosphoric acid groups at a high concentration of salt. The double-stranded bond becomes lose in deionized water, and when the ordinary oligonucleotide structure is used in a complex of oligo A and oligo T like in Example 1, it is difficult to maintain a stable double-stranded structure. In Example 1, PNA is used as the second probe, the electrostatic repelling force does not work between the probe and the mRNA as a sample. Because of the feature, the double-stranded structure of RNA and PNA hybridized to each other can be preserved in the stable state even in deionized water.

Then the gold nanoparticles labeling the second probe are dried to fix the particles on a surface of the probe area 6522 of the living organism sampling chip tip portion 6503. Because the Brownian motion of the gold nanoparticles occurs in the liquid phase state, and in that case, for instance, precision of measurement with an AFM drops, and observation by an SEM is impossible. By observing the probe area 6522 of the dried living organism sampling chip tip portion 6503 with an SEM or an AFM, the number of gold nanoparticles captured on a surface of the probe area 6522 is counted. The number of gold nanoparticles captured on a surface of the probe 6522 depends on a quantity of mRNAs captured on the surface of the probe area 6522, and the quantity of mRNAs captured on the surface of the probe area 6522 depends on a quantity of mRNAs hanged up from inside of the cell with the probe 6521 in the probe area 6522, and therefore the quantity correlates to a quantity of mRNAs present around a position of the cell into which the living organism sampling chip tip portion 6503 is inserted.

With the method described above, a quantity of mRNAs of EpCAM in a cell can be measured without killing the cell.

FIG. 67 is a view showing quantitative comparison among quantities of EpCAM which can be obtained from the cell in a cancer focus in a colon cancer tissue sample and from each of adjoining cells. In this case, the living organism sampling chip tip portion 6503 is inserted into the colon cancer tissue sample changing the inserting positions by and by and also exchanging the living organism sampling chip tip portion 6503 with a new one to assess a quantity of EpCAM expressed at each position. From this assessment, it can be understood that there are a highly EpCAM-expressing cell group 6531 and a not-highly EpCAM-expressing cell group 6532, and that the two groups are bordered by a specific cell. It can be guessed that the portion with a high EpCAM expression rate is a group of cancer cells and the portion with a low EpCAM expression rate is a group of noncancerous cells.

Example 2

In Example 2, descriptions are provided for a case in which PNA having different sequences labeled with gold nanoparticles having different diameters is used as the second probe in Example 1, and a plurality of different mRNAs captured on a surface of the probe area 6522 are simultaneously detected.

FIG. 68 is a schematic view showing the situation in which a plurality of PNAs each having a different sequence respectively and labeled with gold nanoparticles having different diameters are being hybridized to the probe 6521 fixed on a surface of the probe area 6522 of the living organism sampling chip tip portion 6503.

Like in Example 1, the 5-base random sequence DNA probe 6521 is fixed to the 3′ terminal of the 26-base poly T on the surface of the probe are 6522 of the living organism sampling chip top portion 6503. Also line in Example 1, the living organism sampling chip tip portion 6503 is inserted to the cell 6501 to hand up the mRNA with the probe 6521 of the probe area 6522 from a cell in a tissue sample of colon cancer, and the mRNA is cleaned.

As shown in FIG. 68, second probes having different sequences respectively and labeled with the gold nanoparticles 6526, 6527, and 6528 having different diameters respectively are being hybridized to the plurality of mRNAs 6525-1, 6525-2, and 6525-3 hybridized to the probe 6521 on the probe area 6522 of the living organism sampling chip tip portion 6503. The reference numeral 6525 in FIG. 68 indicates a plurality of mRNAs being hybridized to the probe 6521, but has not been hybridized to the second probe. Gold nanoparticles 6526 with the diameter of 8.3 nm and gold nanoparticles 6527 with the diameter of 11 nm, and gold nanoparticles 6528 with the diameter of 17 nm are conjugated to 5′ terminal of oligo PNA (28-base) having the EpCAM sequence and PNA probe sequences including 26 bases and 29 bases corresponding to the CD 44 and CEA mRNA sequences which are reportedly expressed a lot in a cancer cell, and the conjugates are used each as the second probe. The reference numerals 6525-1, 6525-2, and 6525-3 are the captured mRNA sample pieces for EpCAM, CD44, and CEA.

Like in Example 1, measurement of quantities of the three types of mRNAs included in the cells near the cancer focus cell provides the result as shown in FIG. 67 for EpCAM and CEA, but all of the sample cells give values of about 250 molecules/living organism sampling chip tip portion for CD44, and therefore a substantial difference is not observed. There is a report in relation to the CD44 that splicing variants are generated in the colon cancer, but a total quantity of mRNA for the CD44 may not change. The probe sequence used for CD44 is that in exon present at the closest position to the poly-A tail, and there is the possibility that the exon is used in any splicing variant, the detail is still unknown.

Example 3

In Example 3, the probe area 6522 of the living organism sampling chip tip portion 6503 is divided to a plurality of areas in the longitudinal direction, and different probes are fixed to the areas respectively.

FIG. 69(A) is a schematic view showing the state in which the probe 6522 of the living organism sampling chip tip portion 6503 is divided to five areas 6541, 6542, 6543, 6549, and 6550 along the longitudinal direction (the areas 6549 and 6550 are present in the rear side and therefore are not shown in FIG. 69(A)) and the probes 6544, 6545, and 6546 are fixed to the surfaces of the areas. FIG. 69(B) is a cross-sectional view showing the living organism sampling chip tip portion 6503 shown in FIG. 69(A) taken along the line A-A and viewed in the direction indicated by the arrow.

Complementary sequences extending over a final exon and that just ahead in each of EpCAM, CD44, and CEA (having the lengths of 28, 26, and 29 bases respectively) is fixed to each of the areas 6541, 6542, and 6543. The area 6549 is used as a negative control, and nothing is fixed thereto. The area 6550 is used as a positive control, and TTTT-T and base T each having the 26-base length are fixed thereto. For fixing the sequences, a glycidoxy group is introduced into a surface of the living organism sampling chip tip portion 6503 by means of the silane coupling reaction, and PNA having an amino group is fixed to the 5′ terminal. The probe area is divided to a plurality of subareas and different types of PNA are fixed to the subareas by suspending the PNAs to be fixed in DMSO, applying the suspension onto a support piece having a sharp tip like that of the living organism sampling chip tip portion 6503, and smoothly sliding a tip portion of the support piece only a surface of each discrete zone of the probe area 6522 of the living organism sampling chip tip portion 6503. By setting the living organism sampling chip tip portion 6503 with the surface having the suspension applied thereon downward and heating the surface for five minutes at 50° C., the probes can be fixed. After drying, another probe is fixed to another surface thereof. With the operations as described above, different probes can be fixed to the four different surfaces respectively.

When there are provided a plurality of surfaces to which different probes are fixed thereon as in Example 3, specific living biological materials are captured on each surface respectively, which ensures higher precision in measurement.

Example 4

In Example 4, arginine is fixed to the probe area 6522 of the living organism sampling chip tip portion 6503.

FIG. 70 is a view schematically showing the living organism sampling chip tip portion 6503 in Example 4. Arginine 6548 is fixed, in addition to the probe 6521, to a surface of the probe area 6522. The fixed arginine may be a single amino acid, and also the length of up to an octamer is allowable. The arginine is added to a solution to which the PNA is fixed at the molar ratio of 1/40, and the solution is homogeneously applied on the entire living organism sampling chip tip portion 6503.

The method of fixing the probe is as described below. At first 0.5% aqueous solution of γ-glycidoxypropyltrimethoxysilane (with acetic acid added therein by 0.5% or until the silane coupling agent is dissolved) is left for 30 minutes at the room temperature (25° C.) to hydrolyze the methoxy group, thus active silanol group being generated.

The living organism sampling chip tip portion 6503 made from silicon and having an oxide film on a surface thereof is immersed into the activated silane coupling agent, and left in the state for one hour. Then rinsing is performed with deionized water for five seconds. At this point of time, a silanole group in the silane coupling agent reacts to a silanole group on a surface of the silicon oxide to form a partially dehydrated compound. Further a silanole group in the silane coupling agent and oxygen on a surface of the silicon oxide form a compound by hydrogen bond. The compound formed through the hydrogen bond is in the metastable state. This mixture is heated for 30 minutes in the air at the temperature in the range from 105 to 110° C. With this operation, dehydrating condensation between the silanol group in the silane coupling agent and oxygen molecules on a surface of silicon is completed. Further dehydrating condensation proceeds between the silane coupling agents present on the silicon surface. Finally the glycidoxypropyl group is introduced into the silicon surface. A portion of the atomic group constituting the glycidoxy group is an epoxy group having high reactivity to an amino group. PNA having the amino group with the concentration of 50 pmol/μl is reacted to 1.25 μM L-Arg or arginine oligomer ((L-Arg)n (n: 2 to 8)) are reacted to each other in the aqueous solution with pH 10 for one hour at 50° C. With this reaction, the PNC fixed living organism sampling chip tip portion with arginine partially fixed thereto can be obtained.

The living organism sampling chip tip portion 6503 prepared in Example 4 can be inserted into a cell with a slight force substantially not requiring support of the cell. Because of this feature, the living organism sampling chip tip portion 6503 can relatively easily be inserted into not only the tissue cells described in Examples 1 to 3, but to a floating cell under incubation. By using a sequence originated from the mRNA of EpCAM is used to PNA, the substantially same result as that obtained in Example 1 can be obtained.

In Example 4, no comment is provided for the necessity that the living organism sampling chip tip portion 6503 is coated with titanium oxide TiO2 6505, and when the coating with titanium oxide TiO2 6505, the living organism sampling chip tip portion 6503 can be inserted into the cell 6501 more easily.

Fourteenth Embodiment

In a fourteenth embodiment of the present invention, a method is disclosed in which mRNAs, DNA or proteins can easily and instantly be taken out from a living cell several times for analysis without killing the cell. In this method, in order to obtain contents of a cell keeping the cell alive, a needle having a tip diameter substantially smaller than a cell is inserted into the cell to have the contents deposited on the needle's tip for sampling the contents.

To obtain mRNA, an oligo T is fixed as a probe to the needle's tip for sampling mRNA. Alternatively, an oligo including two to about four different sequences is fixed to the 3′ terminal of the oligo T to ensure stability in hybridization between the mRNA and poly A, and the conjugate is used as a probe. Because polynucleotide having the phosphodiester bond is easily decomposed by endonuclease in a cell, and also for the purpose to prevent the probing sequence portion of mRNA, which easily causes holding, from being blocked, PNA or synthetic polynucleotide not having minus electric charge like the PNA is used as a probe in this step.

To obtain a particular protein, an antibody fixed on the needle's tip is used for sampling the particular protein. The Fc moiety of the antibody may non-selectively absorb substances other than a target substance, so F(ab′) 2 not including the Fc moiety is used as a probe. Alternatively, a molecule having the avidity such as the RNA aptamer or DNA aptamer like an antibody is used.

When a needle is inserted into a cell, to minimize physical damages to the cell, a diameter of the needle's tip (a portion inserted into a cell) should be 1/5 of the cell size or below. Further a region 7105 coated with titanium oxide TiO2 is provided on the living organism sampling chip tip portion 7103. Alternatively, a tip portion of the needle is coated with arginine to facilitate interactions with phospholipids in a cell membrane of a surface of the cell so that the needle can smoothly be inserted into the cell. In a case of arginine, about 6 arginine monomer molecules should preferably be present in a narrow area. Alternatively, oligo arginine may be used in the fixed state.

The particular biological material captured on a surface of the needle is sampled by pulling off the needle from the cell, and when the sample is mRNA, the needle is immersed in the PCR reaction solution as it is to amplify and obtain a specific sequence portion of the particular mRNA. Alternatively, the mRNA is once reversely transcribed to obtain the cDNA, and then the particular gene may be subjected to PCR amplification. In a case of a protein, amplification is impossible, so that the sample is used as it is, and in this case measurement of q quantity of a particular substance in a cell can be made most effectively.

Example 1

FIG. 71 is a view showing outline of a flow of operations for sampling mRNA which is an intracellular biological material in Example 1. Configuration of a tip portion of a needle used in Example 1 is the same as that shown in FIG. 66.

In FIG. 71, designated at the reference numeral 7101 is a cell, at 7102 a cell core, at 7103 a tip portion of the needle, at 7104 a vessel, and at 7105 a reaction liquid for PCR method. As shown in FIG. 66(A), the probe 7121 is fixed to the tip portion 7122 of the needle 7103. The needle 7103 is supported by the base section 7107 via the support section 7108 as shown in FIG. 66(B). The tip portion of the needle 7103 is extremely small. To facilitate treatment of this needle, the tip portion of the needle 7103 has a holder 7108, and the holder 7108 is connected to an operation board 7107. A diameter of the holder 7108 is, for instance, 1 mmφ, and size of the operation board 7107 is 4 mm×5 mm.

In Example 1, descriptions are made for a method of inserting a needle into a colon cancer cell for sampling particular mRNA present in the cell. 5-base length random sequence oligo DNA conjugated to the 3′-terminal of 26-base length poly T is used as the probe 7121. The probe 7121 is made of PNA (peptide nucleic acid) to facilitate interactions with mRNA in a cell. Further, there is provided a region 7105 with TiO2 coated thereon, and therefore when the living organism sampling chip tip portion 7103 is inserted into the cell 7101, UV ray with the wavelength of 335 nm is irradiated so that the living organism sampling chip tip portion 7103 can easily be inserted into the cell 7101 because of organic material decomposing reaction of the titanium oxide 7105 coated thereon.

As shown in step 1), the needle 7103 with the tip portion having a diameter of ⅕ or below of size of a cell is inserted into the cell 7101 as a target from which an intracellular biological material is sampled. For sampling premature mRNA or a nucleic protein, the needle 7103 is inserted into the core 7102. The needle 7103 is kept in the state for 30 seconds.

In step 2), the needle 7103 is pulled off from the cell 7101.

In step 3), the tip portion 7122 of the needle 7103 is washed with 2×SSC immediately.

In step 4), particular mRNA among those capture by the probe 7121 on the tip portion 7122 of the needle 7103 is amplified. A 2 μl reaction liquid 7105 including a primer pair corresponding to the particular mRNA, heat-resistant DNA polymerase, dNTP which is a matrix for polymerase, Mg, and pH9 Tris buffer solution is contained in a vessel 7104. 2 μl mineral oil is poured onto a top surface of the reaction liquid to prevent evaporation thereof during the operation.

In Example 1, the sequence segment specific to the Homo sapiences tumor-associated calcium signal transducer 1 (TACSTD1) is amplified. TACSTD1 is mRNA with the full length of 1528 bp which is reportedly expressed a lot when an epithelial cell cancer occurs. As for the mRNA sequence of human TACSTD1, refer to HUGO Gene Nomenclature Committee, “SLC new solute carrier superfamily proposed members (SLC) HGNC approved”, “HGNC Gene Grouping/Family Nomenclature”, [online], HUGO [searched on Aug. 1, 2004], Internet <URL: http://www.gene.ucl.ac.uk/nomenclature/genefamily.shtml>.

Synthetic oligo DNAs having the sequences SEQ No. 1 and SEQ No. 2 respectively (concentration: 0.2 pmol/μl) are employed as primers, and PCR amplification is formed by the known method. PCR is repeated 35 times with the cycle of denaturing for 5 seconds at 94° C., annealing for 10 seconds at 55° C. and then for 10 seconds at 72° C. A quantity of reaction liquid is 2 μl as described above. The solution obtained by PCR amplification is analyzed with Hitach i-chip (micro electrophoresis chip) and Cosmo-i chip electrophoresis device. As a result, a substantially single electrophoresis separation band is obtained at the position of 230 bp. The base length of the PCR product estimated from the database is 233 bp.

(SEQ No. 1)
CTGAGCGAGT GAGAACCTAC TG
(SEQ No. 2)
AGCCACATCA GCTATGTCCA

Then the steps 1) to 4) are repeated in 16 hours to the cell into which the needle is inserted first for sampling mRNA and amplifying the mRNA by PCR. When the needle is inserted into the same cell, the needle 7103 used first is to be exchanged with a new one, for preventing contamination.

The mRNA obtained by the second insertion of needle is subjected to amplification with a primer having another sequence segment from the same human TACSTD1. This primer is formed with the sequences SEQ No. 3 and SEQ No. 4 respectively.

(SEQ No. 3)
GTATGAGAAG GCTGAGATAA AGG:
(SEQ No. 4)
AGCTGCTTAT ATTTTGAGTA CAGG:

To carry out PCR amplification, a cycle of denaturing for 5 seconds at 94° C., annealing for 10 seconds at 52° C. and then 10 seconds at 72° C. is repeated 35 times.

Like in a case of the mRNA obtained by the first insertion of needle, the solution obtained by the PCR amplification is analyzed with Hitach i-chip (micro electrophoresis chip) and Cosmo-i chip electrophoresis device. As a result, a single electrophoresis separation band of 215 bp is obtained. The base length computed from the sequence is 216 bp. Any band is not observed at the position of 230 bp of the solution obtained by PCR amplification of the mRNA obtained by the first insertion of needle.

This fact indicates that the cell is still alive in 16 hours after the first needle insertion. In other words, if the cell 7101 is killed when the needle is inserted first, mRNA is immediately decomposed by RNase in cytoplasm, and therefore the mRNA can not be amplified. In this Example 1, the mRNA sampled by the second needle insertion can be amplified by PCR, which indicates that the cell 7101 is not killed when the needle is inserted first into the cell 7101.

Example 2

In Example 2, descriptions are provided for a case in which mRNA is taken out from a living cell by inserting a needle into the cell once, and then a plurality of cDNAs are obtained from the mRNA. In this example, mRNA is sampled with the needle 7103 with the PNA-made probe 7121 like in Example 1.

FIG. 72 is a view showing an example of a needle 7143 used in Example 2. Like in Example 1, in addition to the probe 7121, TiO2 is fixed to a region 7109 at a tip portion of the needle 7143, and further arginine 7148 is added thereto. The fixed arginine may be one amino acid molecule, or an amino acid sequence with the length of up to an octamer. Arginine is added to a solution to be fixed to PNA at the molar ratio of 1/40, and is homogeneously coated on the entire needle. Configuration of a support section of the needle 7143 is not shown, but is the same as that shown in FIG. 66(B).

The method of fixing the probe 7121 and arginine is the same as that described in Example 4 of the thirteenth embodiment.

When the needle 7143 prepared in Example 2 is used, the needle 7143 can be inserted into the cell 7101 with a force requiring substantially no force for supporting the cell 7101. Because of the feature, the needle can relatively easily be inserted, not only into a tissue cell, but also into a floating cell.

FIG. 73 is a view showing outline of a method of sampling mRNA which is an intracellular biological material in Example 2.

In step 1), the needle 7143 is inserted into the living cell 7101, and is kept in this state for 30 seconds.

In step 2), the needle 7143 is pulled off from the cell 7101.

In step 3), the needle 7143 is immediately washed in a solution with RNase inhibitor contained therein. The matter having been hybridized to a surface of the needle 7143 is conceivably poly A-RNA.

Step 4) is a step of obtaining a 1st strand cDNA. Because the complementary poly T, which is the probe 7121, is fixed to a surface of the needle 7143, when a complementary chain is synthesized with a reverse transcriptase in this state, the complementary chain is synthesized at poly T as the base. Then RNase H is reacted to decompose the RNA chain, thus the 1st strand cDNA being obtained.

In step 5), the first PCR amplification is carried out. In Example 2, a first pair of primers having the sequence SEQ No. 1 and sequence SEQ No. 2 corresponding to the human TACSTD1 used in Example 1 respectively and a second pair of primers having the sequence SEQ No. 3 and sequence SEQ No. 4 are prepared in vessels 7144-1 and 7144-2.

In the first PCR amplification, the needle 7143 is inserted into a vessel 7144-1 containing a PCR solution 7145 including a first pair of primers having the sequence SEQ No. 1 and sequence SEQ No. 2 respectively, and PCR is carried out. The conditions for reaction are the same as those in Example 1.

In step 6), the needle 7143 is pulled off from the vessel 7144-1, and is fully washed.

In step 7), the second PCR amplification is carried out. In the second PCR amplification, the needle 7143 is inserted into a vessel 7144-2 containing a PCR solution 7146 including a second pair of primers having the sequence SEQ No. 3 and sequence SEQ No. 4 respectively, and PCR is carried out. The conditions for reaction are the same as those in Example 1.

After completion of the second PCR, the solutions obtained by the respective PCR amplifications and stored in the vessels 7144-1 and 7144-2 are analyzed with Hitachi i-chip (micro electrophoresis chip) and Cosmo-i chip electrophoresis device. A signal electrophoresis separation band with 230 bp length is detected from the solution obtained after the first PCR amplification and stored in the vessel 7144-1, while a single band with 215 bp length is detected from the solution obtained after the second PCR amplification and stored in the vessel 7144-2.

The process 50 from the steps 5 to 7 can be carried out in repetition to the 1st strand cDNA obtained in the step 4 and stored in the vessel containing a PCR solution prepared properly.

In Example 2, mRNA can easily be sampled from a living cell, and cDNA from the mRNA hybridized to the needle tip can be synthesized in the fixed state. Because the mRNA is preserved as a library on a surface of the needle, and therefore a target sequence segment of a target gene can be obtained by means of PCR. The needle with the mRNA library fixed in the form of cDNA can be preserved for a long time, and therefore a transcription product obtained when the needle is inserted into the cell can be preserved as a master library.

Example 3

In Example 3, descriptions are provided for a case in which a needle with an antibody having affinity to a particular protein fixed thereon is used to sample the particular substance. FIG. 74(A) is a view showing a needle tip portion 7153 which can be employed in Example 3, while FIG. 74(B) is a perspective view illustrating general configuration of a needle which may be employed in Example 3.

The polyclonal anti-mitochondria antibody separated from the human mitochondria membrane and having sensitivity to rabbit is used as an antibody in this example. This antibody reacts to a plurality of proteins or sugar chain antigens in mitochondria.

The needle with the anti-human mitochondria body fixed on the needle tip portion 7153 is prepared as described below. At first, an SH group is introduced into the F(ab′)2 fragment obtained by subjecting the antibody to papain decomposition. A number of SH groups introduced as described above is 3 to 4 molecules per one F(ab′)2 molecule. Then the needle tip portion 7153 is subjected to silane coupling processing to previously introduce an amino group into the surface thereof. Then 0.5% N-(β-aminoethyl)-γ-aminopropyltrimethoxysilane aqueous solution is left for 30 minutes at the room temperature to obtain an activated silane coupling solution. A silicon-made needle with the surface oxidized is immersed in the solution and left in the state for one hour. After the needle tip portion 7153 is rinsed with deionized water, the needle tip portion 7153 is dried in the air at a temperature in the range from 105 to 110° C. With this operation, an amino group fixed by covalent bond to a surface of the needle tip portion 7153 is obtained.

Then N-(maleimidoundecanoyl)sulfosuccinimide, which is a bivalent reagent having a succinimide residue in on side and a maleimide residue in the other side, is reacted to the sample above for 30 minutes at the room temperature at pH 8. 0.1 M anti-oxidation buffer solution, pH 8.5 is used. After rinsing, F(ab′)2 with SH group having been introduced therein is reacted for one hour at the room temperature at pH 6.5. 0.1M sodium phosphate buffer solution, pH 6.5 is used as a buffer solution. The obtained needle with F(ab′)2 fixed thereon is preserved in PBS containing 5% trehalose (pH 7.4). FIG. 74(A) schematically shows the situation in which the F(ab′)2 is fixed on an area 7152 of a surface of the needle tip portion 7153. As shown in FIG. 74(B), the needle tip portion 7153 with the F(ab′)2 fixed thereon is supported by the support section 7108 and is jointed to the based section 7107.

In the state where the needle tip portion 7153 is jointed to the base section 7107, the needle tip portion 7153 with the F(ab′)2 fixed thereon is inserted into cytoplasm and then the needle tip portion 7153 is pulled off. When the needle is pulled off observing the situation with an object lens with the resolution of 100 times, sometimes the situation is observed in which mitochondria comes near the needle and moves together with the needle. The needle tip portion 7153 is mildly rinsed. The substances remaining on the surface is eluted with 3M guanidine, and the eluate may be used for analysis of proteins or mRNAs included therein.

Fifteenth Embodiment

A fifteenth embodiment of the present invention discloses a method and a device for sampling matured mRNA from a living cell without giving substantial damages.

FIG. 75 is a schematic diagram showing a processing flow for sampling matured mRNA in Example 1 of the fifteenth embodiment.

Example 1

Step 1 in the figure is a preparation process, and the figure shows the situation in which a living cell as a target from which mRNA is to be sampled and a capillary of an mRNA sampling device are set in a view field of a microscope. Designated at the reference numeral 7501 is a cell (herein a cell having a nuclear like that of a human, a mouse, or a plant), at 7502 a cytoplasm, at 7503 a cell nuclear, and at 7504 a nuclear membrane separating the cytoplasm from the nuclear. The reference numeral 7505 indicates a capillary, and a diameter of a tip 7507 (a portion to be inserted into a cell) is ⅕ of the cell size or below to reduce physical damages to the cell. The capillary 7505 is set to a tool 7508 allowing for movement thereof in the X- and Y-axial directions and also allowing for change of an angle of the tip. Further a buffer generally used for cell culture is filled inside the capillary. The tool 7508 is attached to a driving device 7509 driven by water pressure. Water pressure is used for delivery of a driving force from the driving device 7509 to the tool 7508. Further a micro syringe pump 10 is attached to the capillary 7505, and a positive pressure state or a negative pressure state can be realized inside the capillary.

Although not shown, to prevent damages to the cell 7501, the cell 7501 and a tip portion of the capillary 7505 are placed in a droplet of a buffer generally used for cell culture and formed on an observation glass plate provided in the view field of the microscope. Therefore all of the operations described below are performed in the droplet.

As shown in step 2 in the figure, a cell membrane of the target cell 7501 is broken with the tip 7507 of the capillary 7505 visually checking with a microscope.

Then in step 3, the capillary tip 7507 is contacted to the cell membrane 7504 visually checking the situation with a microscope. As indicated by the reference numeral 7511, when it is recognized that capillary tip 7507 has contacted the nuclear membrane 7504, the capillary tip 7507 is tightly pressed to the nuclear membrane 7504. In this step, the driving device 7509 should be operated carefully not to break the nuclear membrane 7504. Then the micro syringe pump is driven to generate a negative pressure in the capillary 7505. What is important in this step is a degree of negative pressure generated by the micro syringe pump. Sucking is performed with a pressure not breaking the nuclear membrane 7504, but the operation should be performed carefully taking into consideration a type of a state of the cell monitoring with a microscope. With the careful operations as described above, tight contact between the capillary tip and the nuclear membrane is preserved. In this state, the capillary tip is kept in contact to the nuclear membrane for a prespecified period of time (for instance for 5 minutes) and sucking is performed. Then inside of the capillary 7505 is restored to the normal pressure, and the capillary is quietly pulled off from the cell 7501.

Then in step 4, a peripheral surface of the capillary is quickly washed with 15 mM NaOH and then with water to remove nucleic acid components or protein components deposited on the peripheral surface of the capillary 7505.

Then an internal fluid in the capillary 7505 conceivably containing mRNA having passed through the nuclear membrane 7504 is exhausted into a well 7512 on a 384 well micro plate.

With the operations described above, the mRNA having passed through the nuclear membrane 7504 can be obtained.

FIG. 76 is a view showing outline of a process for converting, of the mRNAs obtained through the steps 1 to 5 shown in FIG. 75, those having the substantially full length to cDNA. The reaction employed for this process is that described in Y. Suzuki, K. Y. Nagayama, K. Murayama, A. Suyama, and S. Sugano, Gene 200, 146-156 (1997), and the reaction was slightly modified. Namely, in Example 1, it is conceivable that an amount of sampled mRNA is sub-picograms or below, a protocol for treating the ordinary mRNA at the scale of micrograms is not applicable to this process. Therefore, it is effective to minimize the reaction volume to the limit, and the process is performed based on this concept.

At first, shown in step A in the figure is a structure of mRAN 7514 contained in the internal fluid of the capillary 7505 obtained in step 5 and poured into the well 7512 on the micro plate. Immediately 0.1 unit tobacco acid pyrophosphatase is reacted to the internal fluid in the capillary 7505 (step B). The reaction is continued for 30 minutes in a 50 mM sodium acetate buffer solution (pH 5.5) containing 1 mM EDTA, 5 mM 2-melcaptoethanol and 1 unit of RNase which is a RNase inhibitor. The reaction volume is 0.5 μl In this processing, a cap structure 7515 of mRNA 7514 is removed, and mRNA 7517 with the 5′ terminal phosphorylated is obtained.

Then RNA ligase (10 units) is used against the mRNA 7517 to obtain modified mRNA 7519 with adaptor sequence 7518 having been introduced therein (step C). The adaptor sequence is, for instance,

(SEQ NO. 5)
5′-AGCAUCGAGUCGGCCUUGUUGGCCUACUGG-3′:.

The reaction is performed in 5 mM 50 mM tris hydrochloric acid (Tris-HCl) buffer solution (pH 7.5) containing 5 mM MGCl2 and 2-melcaptoethanol, 2 mM ATP, 25% PRG8000, and 1 unit of RNasin for 16 hours. The reaction volume is 5 μl. Then oligo DNA primer-added magnetic beads including 5-base length random sequence conjugated to 3′ terminal of 26-base length poly T (T26) (particle diameter: 2.1 μm, amount of execution primer: 2 μml) and a reverse transcription enzyme are added to execute reverse transcription for 2 hours at 42° C., thus a 1st strand cDNA being synthesized (step D). The random sequence is used in this step, because only poly T is insufficient for ensuring stability in hybridization of mRNA.

Then the reaction products are washed with 15 mM NaOH, and further the products are reacted in 15 mM NaOH for 10 minutes at 65° C. to remove RNA. With the operations described above, the 1st strand cDNA 20 is obtained. 2 pmol adaptor sequence and 2 pmol random sequence-added poly T (T26) are added according to the necessity to carry out PCR at 10 μl scale to obtain a double-stranded cDNA. When the random sequence poly T (T26) without the magnetic beads added thereto is used, a large amount of cDNA-amplified products can be obtained in the solution. The cDNA obtained as described above is, in most cases, a full length cDNA including the cap structure up to the poly A sequence.

More specifically, in Example 1, mRNA passing through the nuclear membrane of a colon cancer cell is obtained as described below.

PCR amplification is carried out by using a portion of the adaptor sequence:

(SEQ No. 6)
5′-AGCATCGAGTCGGCCTTGTTG-3′
(Tm = 69° C.):

and a sequence specific to Homo sapiens tumor-associated calcium signal transducer 1 (TACSTD1):

(SEQ No. 3)
5′-AAGCCACATCAGCTATGTCCACA-3′
(Tm = 66° C.):

are used as primers against a mixture of single-stranded cDNA conceivably having the substantially full length. When full-length mRNA originated from TACSTD1 is included, it can be expected that a PCR product having the length of about 850 bp is obtained.

The Tm was computed using the Internet site; Tm Determination, Virtual Genome Center, prepared on 7 Aug. 1995, http://alces.med.umn.edu/rawtm.html programmed according to the method described in Breslauer et al., Proc. Nat. Acad. Sci. 83, 3746-50 (1986) and assuming the primer concentration of 200 nM and salt concentration of 50 mM. The sequence information for the TACSTD1 was searched using the mRNA code name NM002354 from a web side of National Center for Biotechnology Information prepared by National Institute of Health (Revised: Jul. 16, 2004). The actual PCR is performed at the initial scale of 10 μl as described above and at the primer concentration of 200 nM 15 times with a reaction cycle of denaturing for 30 seconds at 94° C., annealing for 30 seconds at 60° C. and polymerase reaction for 2 minutes at 72° C.

Then 1 μl sample containing the amplification products is added to 50 μl of PCR reaction solution, and the mixture solution is subjected to 2-stage PCR amplification 35 times under the same conditions for reaction as those described above. The solution obtained through the PCR amplification is analyzed with i-chip (micro electrophoresis chip) obtainable from Hitachi Hi-Technology and Cosmo-i chip electrophoresis unit.

As a result, a plurality of bands are detected, and the electrophoretic separation band is observed at the position of 850 bp on one of the bands. This is the substantially same as the base-length of mRNA estimated from the database. The position of the primer on the sequence is complementary to the adaptor sequence introduced to the 5′ terminal of the full length mRNA as well as to the segment from 796 to 818 bp on the mRNA sequence described in the code name NM002354. This segmental sequence is in exon 6. From the NCBI data base described above, it is known that mRNA of the TACSTD1 has 1528-base length, which indicates that the sequence segment covers a half or more of the mRNA closer to the 5′ terminal. A protocol for preparing a composition containing polyether when subjected to reverse transcription is used, so that, if the segment near the 5′ terminal can be amplified like in Example 1, it may be considered that the substantially full-length cDNA has been obtained.

When contaminated with a precursor mRNA or a genome in the nuclear, PCR should be performed with a primer corresponding to the intron portion for determination. In this case, the amplification is tried with the primer SEQ No. 7 and the intron sequence:

(SEQ No. 8)
AAGGAACAGTGATGCATGTAGATT
(Tm = 61° C.):

positioned between the exon 5 and exon 6. The two-stage amplification was performed under the same conditions for PCR as described above, any peak was not detected at a position around 211 bp expected from the database.

Based on the result as described above, it may be said that the full length mRNA can efficiently be obtained by directly recovering the mRNA passing through the nuclear membrane 4 according to the method in Example 1. When a nuclear as a whole is grated, also precursor mRNA contained in the nuclear is recovered simultaneously, but with the method in Example 1, the problem can be evaded. Further, because the tip 7507 of the capillary 7505 only contacts (is pressed to) the nuclear membrane 7504, so that the cell can be kept alive as it is. Further it is possible to pull off the capillary 7505 once from the cell and to again insert the capillary 7505 into the cell after a prespecified period of time for obtaining mRNA. The capability of obtaining mRNA without killing the cell is advantageous.

Example 2

FIG. 77 is a schematic diagram showing the initial state (step 1) of the process for obtaining matured mRNA in Example 2 of this embodiment. FIG. 77 corresponds to step 1 shown in FIG. 75, and as it is clearly understood from comparison between the two figures, the cell 7501 and capillary 7505 are placed on an observation glass plate 7539 and also are included in a droplet 7540. Further an electrode 7541 is provided in the capillary 7505, and a conductor 7542 is connected to the electrode 7541, and also an electrode 7543 is placed in cytoplasm 7502 of the cell 7501. A conductor 7544 is electrically insulated from the buffer droplet 7540. Other steps in Example 2 corresponding to those in Example 1 are different only in addition of electrodes and conductors, and therefore the steps are steps are not shown.

In Example 2, the electrodes and conductors newly introduced are very effective in step 3 described in Example 1. Namely, in Example 1, the capillary tip 7507 is only contacted to the nuclear membrane 7504 visually monitoring with a microscope, but in Example 2, the electric conductivity between the electrode 7541 and electrode 7543 can be utilized, and therefore the electric conductivity can be monitored during the steps of contacting and pressing the capillary tip 7507 to the nuclear membrane 7504. Namely, while the tip 7507 of the capillary 7505 is within the cytoplasm 7502, the electric conductivity between the electrode 7541 and electrode 7543 is extremely high (like short-circuited), but when the tip 7507 of the capillary 7505 contacts the nuclear membrane 7504 of the cell 7501, the electric conductivity between the electrode 7541 and electrode 7543 becomes larger. When the capillary tip 7507 is tightly pressed to the nuclear membrane 7504, the electric conductivity becomes further larger.

Therefore, in Example 2, contact and adhesion of the tip 7507 of the capillary 7505 to the nuclear membrane 7504 of the cell 7501 can be managed more easily by visually monitoring and controlling contact of the tip 7507 of the capillary 7505 to the nuclear 7504 of the cell 7501 and checking electric conductivity between the electrode 7541 and electrode 7543.

Further the electrodes 7541 and 7543 can also be used for sucking matured mRNA into the capillary 7505. Namely, by setting the electrode 7541 in the positive state and electrode 7543 in the negative state and loading a voltage of about 10 V/cm to a section between the two electrodes 7541 and 7543, the mRNA originally having a negative charger can electrophoretically be sucked into the capillary 7505. A voltage of about several tens mV is loaded to the cell, and sometimes the cell may be influenced, but mRNA can advantageously be recovered within a short period of time.

Example 3

FIG. 78(a) to FIG. 78(c) are views each illustrating configuration of a tip portion of the capillary 7505 which may be used in Example 1 or Example 2.

FIG. 78(a) shows a case where a partition 7521 is provided inside the capillary 7505 up to a position near a tip of the capillary 7505. With this configuration, a flow path 7522-1 and a flow path 7522-2 separated from each other with the partition 7521 are formed in the capillary 7505. Therefore, when the micro syringe pump 7510 is driven to generate a negative pressure in the capillary 7505 in step 3 for sampling mRNA in the nuclear 7503, the mRNA can be sampled by flowing a solution in the capillary 7505 from one flow path to another flow path as indicated by the reference numeral 7523. FIG. 78(b) shows a case in which a second capillary 7526 is inserted up to a position near a tip of the capillary 7505 to form a flow path 7527-1 and a flow path 7527-2. In step 3, the micro syringe pump is driven to generate a negative pressure in the capillary 7505 for sampling mRNA in the nuclear 7503. In this case the mRNA can be sampled by flowing a solution within the capillary from the outer flow oath to the inner flow path as indicated by the reference numeral 7528 using a gap in the tip portion. The second capillary 7526 is required only to be inserted into the capillary 7505, and is not required to be fixed. In this state the effect as described is achieved.

The FIG. 78(c) is similar to FIG. 78(b), and shows a case in which 5 capillaries 7532-1 to 7532-5 are provided in the capillary 7505. In this case, for instance, during a sucking operation for 5 minutes, each of the capillaries 7532-2 to 7532-4 is set in the negative pressure state for one minute respectively for sucking, and a buffer solution is supplied form the capillary 7532-1. Other capillaries are kept in the weak negative pressure state to substantially suppress migration of the fluid. With this configuration, mRNAs at different points of time are sucked into the four capillaries respectively.

FIG. 79 is a view illustrating a contrivance for reducing damages given to a cell during an operation of inserting the capillary 7505 into the cell.

FIG. 79(a) shows a case where a region 7550 with titanium oxide TiO2 fixed thereto is provided at a tip portion of the capillary 7505. With this configuration, when 335 nm UV ray is irradiated during an operation for inserting the tip portion of the capillary 7505 into the cell 7501, because of organic material decomposing activity of the titanium oxide coated thereon, the tip portion of the capillary 7505 can easily be inserted into the cell 7501 and damages given to the cell 7501 are few. More specifically, the tip of the capillary 7505 is passed through the cell membrane irradiating the US ray thereto. When the tip of the capillary 7505 has passed through the cell membrane and reached the cytoplasm, irradiation of UV ray is stopped. Then the capillary tip is contacted to the nuclear membrane. When the capillary tip is contacted to the nuclear membrane, UV ray is not irradiated to prevent damages to the nuclear membrane. When the tip has reached the nuclear membrane, sucking is performed carefully as described in Example 1, and the capillary tip is tightly pressed to the nuclear membrane. The capillary tip is left in the state for 5 minutes to diffuse and recover the mRNA passing through the nuclear membrane inside the capillary 7505.

FIG. 79(b) shows a case in which the region 7550 with titanium oxide TiO2 fixed thereto is provided at a tip portion of the capillary 7505 and further arginine 7548 is fixed thereto. The arginine fixed thereto may be one amino acid, or that having the length of an octamer. For fixing arginine thereon, PNA (peptide nucleic acid) is added to the solution to be fixed at the molar ratio of 1/40, and the mixture solution is coated on the entire tip portion of the capillary 7505. Also in this case, 335 nm UV ray is irradiated when the tip portion with TiO2 thereto passed through the cell membrane. Then irradiation of UV ray is stopped, and the capillary is further inserted into the cell until the tip portion reaches the nuclear membrane. Because of the mutual reaction between the arginine 7548 and a phosphate base section in the lipid dual layer of the cell membrane, the capillary can smoothly be inserted into the cell.

It is needless to say that the tip portion of the capillary 7505 described with reference to FIG. 79 may have the structure shown in FIG. 78(a) to FIG. 78(c).

The effect is provided also when only arginine is fixed to the tip portion of the capillary 7505.

Sixteenth Embodiment

A sixteenth embodiment discloses a novel technical means for separating an extremely small number of molecules having activity against a cell in a manner allowing a function of the cell to be traced from the viewpoint of not only separating a biochemical substance but also making the function of a cell clear.

The sixteenth embodiment is made by focusing on an analytical means known as the patch clamping method originally developed for researching a transporter and not having been related to the separation of a biochemical material so far, and by developing the means into a technique for separating a biochemical material.

As the patch clamping method, the following three types are generally used:

(1) the inside-out (the cytoplasm side of a cell membrane facing to the outside of a glass tubule) type in which a glass tubule having an opening with a tip thereof about 1 μm in diameter is pressed on a cell until electric resistance of the inside and outside of the glass tubule reaches a level of giga ohm to prepare a desired biochemical material;
(2) the whole-cell type in which a glass tubule sucks in while pressing a cell, and pierces a lipid bilayer formed in the glass tubule to obtain the whole cell attached onto the tip of the glass tubule; and
(3) the outside-out (the outside of cytoplasm facing to the outside of a glass tubule) type in which, after forming the whole-cell type of a cell, the cell is removed, leaving behind a lipid bilayer in the proximity of a glass tubule, and an opening of the tubule is sealed making use of the lipid bilayer remaining in the periphery of the tubule opening to prepare a desired biochemical material.

The patch clamping method is a technique originally developed to research a transporter and measuring mobility of ion via a transporter as change in an electric current. Of the three types of the patch claming method developed as an analytical means, either type is means for preparation of a transporter itself with an operation using a glass tubule, and thus, has not been at all recognized as a device or technique for separating and preperationg a biochemical material.

The sixteenth embodiment is made to solve the problems described above focusing attention on the patch clamping method. A transporter present in a cell membrane, a nuclear membrane or a mitochondrial membrane employed in the patch clamping method is used for separating a biochemical material. A transporter refers to a particular channel by which a specific chemical material passes through a cell membrane or the like. Such a transporter generally transports an amino acid including glutamic acid, oligopeptide including dipeptide and tripeptide, and various low molecule organic matters by making the materials pass through a cell membrane.

Examples of a transporter suited for applying to the sixteenth embodiment may be those listed in Table 1 described above. Nevertheless, not all transporters present in all cells are known, and actually, there is an orphan transporter whose existence is predicted from a genome sequence, there is a case where a transporter is unknown, and there are some substances capable of climbing over a cell membrane to transfer in and out of the cell without using a channel based on a concept as a specific transporter such as arginine oligomer described in the aforementioned Table 2. Therefore, the sixteenth embodiment can be implemented, like the second embodiment described above, if it is confirmed that there exists a function for transporting various substances.

Samples actually contain a diversified range of substances, and the types of the substances to be separated vary in many cases. Separation can be achieved by using a functional separation membrane including a transporter and employing a device with the transporter fixed thereon for collecting a separated materials. Alternatively, separation with a higher precision can be achieved by using a plurality of transporters to separate biochemical materials from a mixture sample, and more specifically, by connecting in series the membranes with the transporters embedded therein and separating biochemical material in stages. Medium in the sample is transferred by dispersion, electrophoresis or electro-osmotic flow, and a substance(s) having passed through the membranes is collected. In a case when membranes with the transporters embedded therein are connected in series to separate biochemical material in stages, biochemical materials captured between the adjoining membranes is collected. Alternatively, in the configuration where an outlet is provided each between the adjoining membranes, separation can be achieved by individually collecting a solution at each of the outlets.

Separation at a molecular level can be achieved by limiting an area of a membrane with a transporter embedded therein to several hundreds of nm2 or less. Further, in this case, how many molecules pass through a transporter can be confirmed by measuring an electrical change in front and behind the membrane.

Example 1

FIG. 80(a) is a cross-sectional view showing outline of a method of preparing a biological material separation chip which can be used for a biochemical material separator related to Example 1 of a sixteenth embodiment, and FIG. 80(b) is a cross-sectional view schematically showing an example of a structure of the completed biological material separation chip.

In FIG. 80, reference numeral 80100 indicates a biological material separation chip. Reference numeral 8001 indicates a substrate for a biological material separation chip, for instance, a silicon substrate. Size of the substrate is, for instance, 5 mm in the height direction in the figure, and 500 μm in the vertical direction in the same. Thickness of the substrate is, for instance, 100 μm. Height of a projection 8002 formed on an end of the substrate 8001 is, for instance, 5 μm, while the thickness thereof is, for instance, 2 μm. On the top of the projection is formed a pore 8003. Size of the pore 8003 is, for instance, 1˜2 μmφ. On the both sides of a lower portion of the substrate are formed electrode layers 8004, 8005, and an insulating layer 8006 is formed for covering all over the electrode layer 8004, after which an electrode layer 8007 is further formed thereon. The substrate 8001 is created making use of the semiconductor technology, outline of creating the substrate 8001 is described hereinafter with reference to FIG. 81.

The biological material separation chip 80100 is completed after taking a transporter of a cell in a portion of the pore 8003 thereon. Processing of taking a transporter of a cell in a portion of the pore 8003 is described below.

Though not shown in the figure to avoid complications, the substrate 8001 and a cell 8011 are provided opposing to each other in a droplet of a buffer suitable for cell culture dropped down on an observation glass plate for a microscope. In this step, while observing with a microscope, a transporter 8012 of the cell 8011 is positioned to face to the pore 8003 on the projecting side of the projection 8002. It is to be noted that reference numeral 8013 denotes a lipid bilayer of the cell 8011. Further, a capillary connected to a microsyringe pump is temporarily attached to the concave portion side of the projection 8002, so that inside of the capillary can be in the state of negative pressure. The buffer described above is filled inside the capillary. In addition, an electrode is provided inside the capillary, so that a lead wire connected to the electrode is drawn out, while another electrode is provided in a droplet portion, so that another lead wire connected to the electrode is drawn out. The latter lead wire is electrically isolated from the droplet of a buffer.

While observing with a microscope, a portion of the transporter 8012 of the cell 8011 is contacted to the pore 8003 on the projection 8002. In this step, while monitoring electrical conductivity between the two electrodes described above, before a portion of the transporter 8012 of the cell 8011 is contacted to the pore 8003, an electrode in the capillary and another electrode in the droplet portion are short-circuited owing to a buffer, and by contrast, after the contact, the two electrodes are substantially isolated because the pore 8003 is blocked off with the transporter 8012 and the lipid bilayer 8013 of the cell 8011.

When it is confirmed by a visual observation with a microscope and a sharp decline in electrical conductivity between the two electrodes described above, a microsyringe pump connected to a capillary temporarily attached to the concave portion side of the projection 8002 is operated, so that the inside of the capillary turns into the state of negative pressure. The cell 8011 is kept being sucked at such a pressure as not piercing the lipid bilayer 8013, and when the cell 8011 is finally peeled off, a portion of the lipid bilayer 8013 including the transporter 8012 is left behind, being fixed onto the pore 8003 on the projection 8002. With this step, the biological material separation chip 80100 is completed with a transporter of a cell taken in a portion of the pore 8003 thereon, as shown in FIG. 80(b). The chip having a transporter thereon shown in FIG. 80(b) fixes the transporter in the form of inside-out. Descriptions are provided later for the electrode layers 8004, 8005 and electrode layer 8007.

It should be understood that the completed biological material separation chip 80100 is preserved in a buffer suitable for cell culture to avoid damages of the transporter fixed onto the pore 8003.

FIG. 81(a) to FIG. 81(g) are views each illustrating outline of a process of forming a substrate 8001 for a biological material separation chip 80100. In each of FIG. 81(a) to FIG. 81(g) are shown a cross section on the left side and a plan view corresponding to the cross section on the right side.

Firstly, as shown in FIG. 81(a), a silicon substrate having a specified crystal axis is prepared, on one face of which is provided a mask 8021, and a window 8022 is formed by removing the mask 8022 in a position where a projection 8003 is to be created. As shown in FIG. 81(b), a portion corresponding to a quadrangular pyramid 8023 is removed with etching. Next, as shown in FIG. 81(c), the mask 8021 is removed, and a mask 8024 is provided on another face of the silicon substrate 8001 to form a window by removing the mask 8024 in a position where a projection 8003 is to be created, thereby concave sections 8025, 8026 each having a triangular cross section being formed. The concave sections 8025, 8026 are, as seen from the plane view, concaved and uninterrupted portions corresponding to the quadrangular pyramid 8023. Then, as shown in FIG. 81(d), a window 8028 is opened in a position surrounded by the concave sections 8025, 8026 by providing a mask 8027. Next, as shown in FIG. 81(e), a pore 8003 is opened in a position corresponding to the substrate 8001 making use of the window 8028. In this step, a projection 8002 is also formed in the periphery of the concave sections 8025, 8026 on the substrate 8001 by etching. Then, as shown in FIG. 81(f), an electrode 8004 is formed on a face having a projection 8002 on the substrate 8001. The electrode 8004 is made of an aluminum-deposited layer. Next, as shown in FIG. 81(g), the whole surface of the electrode 8004 is covered with a polyimide insulating layer 8006, on which an electrode 8007 is formed. The electrode 8007 is made of a platinum-deposited layer. After that, an electrode 8005 is formed on another face of the substrate 8001. The electrode 8005 is also made of a platinum-deposited layer. Thus the formation of the substrate 8001 for the biological material separation chip 80100 is completed. Though detailed data on the semiconductor technology is omitted herein, those skilled in the art can easily implement the steps described above.

FIG. 82 is a view illustrating an example of biological material separation by a biological material separation chip 80100 with a glucose transporter 8012 fixed onto a pore 8003 thereon. In this case, a cell derived from cardiac muscle is employed as the cell 8011 described in FIG. 80(a), and a lipid bilayer including a transporter capable of transporting glucose is fixed onto the pore 8003. The use of cardiac muscle enables to obtain the chip 80100 with a glucose transporter fixed thereon with a substantially high probability by means of the method described above. When the biological material separation chip 80100 having a glucose transporter is created by means of the method described above, a number of other transporters are naturally fixed onto the pore 8003.

The biological material separation chip 80100 is provided turning a rear face thereof having the electrode 8005 and a front face thereof having the electrode 8007 to a space 80501 and a space 80502, respectively, each discretely provided in a vessel 80500. The electrode 8004 is earthed. The electrodes 8005 and 8007 are attached to a power source 80505 and an ammeter 80506 according to the necessity.

The spaces 80501 and 80502 are firstly filled with a solution of an M9 culture medium (pH 7.1) containing a 2 mM of calcium. Although the spaces 80501 and 80502 are seemingly large in the figure, there is actually a gap of several tens of μm between the spaces, so that the solution is put into the spaces using a capillary tube. At this point in time, the value indicated by the ammeter 80506 is monitored. Next, the electric current value fluctuates when the M9 culture medium containing a 2% of glucose as a sample solution is added to the space 80501 through the use of the capillary phenomenon. This demonstrates that glucose and some other ion are coupled to pass through a membrane. After a prespecified period of time, the solution on the side of the space 80502 is collected.

The solutions collected from the space 80502 and the original M9 culture medium are collected with a capillary, into which Escherichia coli bacteria suspended in an M9 culture medium is sucked one bacterium at a time. E. coli cultured in a solution collected from the space 80502 divide after a lapse of 50 to 60 minutes, while in turn, E. coli cultured in a fresh M9 culture medium do not divide even after a lapse of 120 minutes and more. This shows that at least glucose is collected after passing through a transporter.

Example 2

FIG. 83 is a cross-sectional view showing outline of a biological material separator in Example 2 in which three sheets of the biological material separation chips 80100 preserved in a buffer suited to cell culture are combined with each other. The biological material separator according to Example 2 is assembled in a buffer suited to cell culture to avoid damages of a transporter 8012 fixed onto a pore 8003. More specifically, it is practical to assemble the separator under visual observation in droplets of a buffer dropped on an observation glass plate for a microscope and suited to cell culture. Herein, each of the biological material separation chips 80100 fixes onto each pore 8003 transporters from a plurality of types of cells present in a cell membrane, a nuclear membrane or the like and transporting a specific biological material.

In FIG. 83, reference numeral 80100 indicates a biological material separation chip 80100 shown in FIG. 80(b). Three sheets of the biological material separation chips 80100 are arrayed at intervals of 100 to 500 μm, and streptavidin sidewalls 80101, 80102 manufactured through the use of a silicon substrate are provided on both sides of the arrayed chips 80100. On the side of the inner face of the sidewalls 80101, 80102 are provided an electrode 4′ and an insulating layer 6′ corresponding to the electrode 8004 and the insulating layer 8006 provided on the biological material separation chip 80100, respectively. The sidewalls 80101, 80102 can be manufactured with the semiconductor technology, like the biological material separation chip 80100. The biological material separation chips 80100 herein are fixed with a clamp 80600 whose external appearance is as shown in FIG. 84. In this step, a suitable spacer is inserted between the biological material separation chips 80100 or between the biological material separation chip 80100 and the sidewalls 80101, 80102, or the clamp 80600 itself has a suitable spacer.

In FIG. 83, curved lines each drawn on the upper and lower ends between the biological material separation chips 80100 as well as between the biological material separation chip 80100 and the sidewalls 80101, 80102 indicate that a liquid filled in each space is maintained therein with the surface tension.

FIG. 84 is a perspective view showing an appearance of the biological material separator in Example 2 in which three sheets of the biological material separation chips 80100 are combined with each other. As shown in the figure, each chip 80100 and the sidewalls 80101, 80102 are fixed with a clamp 80600. Clearances between each chip 80100 are opened as 8030-1, 8030-2, 8030-3 and 8030-4 in FIG. 83. Gaps between each chip 80100 are several tens of μm in distance, so that a liquid can be filled in or discharged from the gaps with a capillary tube using a capillary pipet 80601. With the configuration as described above, different solutions can be filled in or discharged from each gap between the chips 80100.

As shown in FIG. 83, a biological material separator assembled under visual observation in droplets of a buffer dropped on an observation glass plate for a microscope and suited to cell culture has the buffer between the biological material separation chips 80100 and between the biological material separation chip 80100 and the sidewalls 80101, 80102 when the assemble is completed.

In this state, a sample is fed in or taken out of the space between the biological material separation chips 80100 and between the biological material separation chip 80100 and the sidewalls 80101, 80102 using a capillary pipet 80601, after both the electrodes 8004 and 8004′ are earthed. This is for the purpose of shielding static electricity generated when a solution flows on the surface of the biological material separation chip 80100 and the sidewalls 80101, 80102, and preventing current noise from being generated. A power source 8031 and a current flowing therefrom are designed to be monitored so as to apply a specified voltage between the electrodes 8005 and 8007 on both sides of the biological material separation chip 80100. When a transporter 8012 is fixed onto a pore 8003 in a stable manner, the current flowing from the power source 8031 is substantially null, while in turn, when the transporter 8012 is dropped off, a heavy electric current flows, which enables an easy detection of the state of the transporter 8012.

Reference numerals 8012-1, 8012-2 and 8012-3 indicate each of transporters 8012 for each biological material separation chip 80100 viewed from the side of the sidewall 80101, and herein the transporter 8012-1 is a transporter prepared from a neuron-derived cell membrane, the transporter 8012-2 is a transporter prepared from a testicular cell membrane, and the transporter 8012-3 is a lipid bilayer derived from a pulmonary cell membrane.

Firstly, a buffer at pH 6.5 is filled in all clearances of the separator, and an amino acid mixed solution including glutamic acid, aspartic acid, alanine and glutamine is fed in the clearance 8030-1. Then a current at an about 100 nA is observed with an ammeter 8032 and an ammeter 8033, demonstrating that some kind of substrate transport takes place. A current flowing through an ammeter 8034 is about one third of those observed with the other ammeters. Solutions in the clearances 8030-2 to 8030-4 are collected with the capillary phenomenon for amino-acid analysis using nano LC to find that glutamic acid and aspartic acid passes through the lipid bilayers 8012-1 and 8012-3 and are accumulated in the clearances 8030-2 and 8030-3. Glutamic acid and aspartic acid observed in the clearance 8030-4 is at a level below the detection limit. Alanine and glutamine is detected in all of the clearances.

In fact, a transporter in the SLC 1 family related to amino acid transport is generally expressed in the cells described above according to the SLC new solute carrier superfamily proposed members (http://www.bioparadigms.org/slc/menu.asp) described in HGNC Gene Grouping/Family Nomenclature (updated in June 2004), http://www.gene.ucl.ac.uk/nomenclature/genefamily.shtml in the transporter database (official website of HUGO), and acidic amino acid is expressed in neurons, testis, kidney, liver, heart and the like in large quantity, while alanine and glutamine, which is neutral amino acid, is expressed in a wide range of organs, these findings are consistent with the result described above.

Thus, by using the biological material separator and the method of separating biological material according to the sixteenth embodiment, an extremely trace quantity of biological material can be roughly classified depending on its property, and the difference analysis in which comparison of material transport among fixed cells is analyzed through the use of difference in material to be transported can be conducted by observing what kind of material is accumulated in each clearance.

Example 3

In Example 3, a biological material separation chip having configuration in which a nuclear membrane is fixed onto the tip section of a capillary chip is described. FIG. 85(a) to FIG. 85(f) are views illustrating a procedure for preparing a biological material separation chip with a nucleic membrane fixed onto the tip section of a capillary chip thereof in Example 3. Herein is described an example of preparing an mRNA purified chip using a nuclear membrane of an oocyte of a xenopus.

FIG. 85(a) is a view showing a preparatory step and illustrating the outline when an oocyte of a xenopus for obtaining a nuclear membrane thereof and a capillary chip are provided within the field of a microscope for a visual observation. Designated at the reference numeral 8041 is an oocyte of a xenopus, at 8042 cytoplasm, at 8043 a cell nucleus, at 8044 a nuclear membrane partitioning cytoplasm from a nucleus, and at 8045 a cell membrane. Reference numeral 8046 indicates a capillary chip, whose tip 8048 (a portion inserted into a cell) is about 400 μm in diameter and 20 mm in length in order to reduce a physical damage on a cell. The capillary 8046 is attached to a fixture 8049 capable of shifting the X, Y and Z axes thereof and changing the degree of the tip angle thereof. A buffer of the type used for cell culture is filled inside the capillary 8046. The fixture 8049 is attached to a drive unit 8050 driven by hydraulic pressure. The driveline from the drive unit 8050 to the fixture 8049 utilizes hydraulic pressure. Further a microsyringe pump 8051 is attached to the capillary 8046, and the inside of the capillary 8046 can be transformed between the states of positive and negative pressure with complete control. Reference numeral 8047 indicates a tube for connecting the capillary 8046 and the microsyringe pump 8051.

To avoid damages to a cell 8041, the cell 8041 and the tip section of the capillary 8046 are made to be always in droplets 8053 of a buffer of a type used for culturing a cell formed on an observation glass plate 8052 provided within the field of a microscope, and all of the following steps are taken in the droplets. Further, an electrode 8054 is temporarily provided in the capillary 8046, so that a lead wire 8055 connected the electrode 8054 is drawn out, while another electrode 8056 is temporarily provided in the cytoplasm 8042 of the cell 8041, so that another lead wire 8057 connected to the electrode 8056 is drawn out. To avoid complications in the figure, representation of the observation glass plate 8052, droplets 8053, electrodes 8054, 8056 and lead lines 8055, 8057 are omitted in the following FIG. 85(b) to FIG. 85(e).

FIG. 85(b) shows a state where the cell membrane 8045 of the cell 8041 is pierced with the capillary 8046, while visually observing with a microscope.

FIG. 85(c) shows a state where the tip 8048 of the capillary 8046 is contacted to the nuclear membrane 8044, the microsrynge pump 8051 is operated to obtain negative pressure inside the capillary 8046, and thereby the tip 8048 of the capillary 8046 is closely adhered to the nuclear membrane 8044. Then the degree of negative pressure by the microsrynge pump 8051 is properly adjusted, and the capillary 8046 is pulled out of the cell 8041 keeping the state where the nuclear membrane 8044 is adhered to the tip of the capillary chip, and, while sucking the nuclear membrane 8044 at such pressure as not piercing the same. Thus a capillary chip 8046 can be obtained having configuration in which the nuclear membrane 8044 with the inside thereof facing to the outside of the chip is fixed onto the tip section 8048 of the chip.

In addition to the contact of the capillary tip 8048 to the nuclear membrane 8044 while visually observing with a microscope, electrical conductivity between the electrode 8054 and the electrode 8056 can be utilized herein. Namely, the step of contacting and closely adhering the capillary tip 8048 to the nuclear membrane 8044 can be monitored with electrical conductivity. During the period when the tip 8048 of the capillary 8046 is in the cytoplasm 8042, electrical conductivity between the electrode 8054 and the electrode 8056 is extremely high (short-circuited), however, when the tip 8048 of the capillary 8046 contacts the nuclear membrane 8044 of the cell 8041, the electrical conductivity drops (electric resistance increases), and moreover, the electrical conductivity further decreases when the contact becomes somewhat tighter.

Thus the contact and adhesion of the tip 8048 of the capillary 8046 to the nuclear membrane 8044 of the cell 8041 can be controlled more easily by controlling a contact of the tip 8048 of the capillary 8046 to the nuclear membrane 8044 of the cell 8041 under visual observation, and by checking electrical conductivity between the electrode 8054 and the electrode 8056.

After the tip 8048 of the capillary 8046 is closely adhered to the nuclear membrane 8044 of the cell 8041, while keeping nuclear membrane 8044 onto the tip of the chip 8048, the capillary 8046 is pulled out from the cell 8041.

FIG. 85(d) shows the step of cleaning the periphery of the capillary 8046 having been pulled out from the cell 8041 to remove nucleic acid ingredients and protein ingredients adhering to the periphery of the capillary 8046.

FIG. 85(e) shows a state where a biological material separation chip with a nuclear membrane fixed onto the tip of a capillary chip thereof is completed. In this state, a buffer used for cell culture still remains in the capillary 8046, though, it is desired that the entire chip is put in a buffer to preserve the nuclear membrane fixed on the tip of the capillary chip.

FIG. 86 is a view illustrating a specific example in which mRNAs are prepared by using the biological material separation chip in Example 3.

For instance, liver tissue obtained from a xenopus is frozen, and is added to a phenol chloroform solution, and the mixture is immediately homogenized. After ethanol precipitation, a mixed pellet of the total RNAs and genome fragments is obtained. The mixed pellet is dissolved in 5 mM of a 50 mM Tris-HCl buffer solution (pH 7.5) to obtain a sample solution. The sample solution 80211 is poured into a vessel 80212. A configuration similar to that for preparing the biological material separation chip is used in which the biological material separation chip 8046 is attached onto the tip of a tube 8047 for a device comprising a fixture 8049, a drive unit 8050, a microsyringe pump 8051 and a tube 8047. In this step, the electrode 8054 is provided in the biological material separation chip 8046, and is connected to the positive pole of a direct current power source via the lead wire 8055. In the meantime, the electrode 8056 is immersed in the vessel 80212 with the sample solution 80211 put therein, and is connected to the negative pole of the direct current power source via the lead wire 8057.

The tip of the biological material separation chip 8046 is dipped in the vessel 80212 with the sample solution 80211 put therein, and electric field by 5 V/cm of direct current voltage is applied to a portion between the inside and the outside of the capillary chip 8046 using the direct current power source described above. With this operation, mRNAs passing through the nuclear membrane fixed onto the tip of the biological material separation chip 8046 and transferring to the inside of the capillary are collected.

The mRNAs obtained as described above and mRNAs in the solution remaining outside of the capillary chip are apparently different in size, that is, the mRNAs obtained from the solution in the capillary chip are mainly 1 k to 3 kb in size, while the mRNAs obtained from the solution outside of the capillary chip shows a smear band in a wide range up to several tens of kb. With the use of a device with a nuclear membrane fixed thereon employing the chip according to the sixteenth embodiment, mature mRNAs having a reduced size thereof by splicing with an mRNA mixture solution can be obtained.

The capillary chip having a nuclear membrane and used for Example 3 can use a configuration example described in the fifteenth embodiment with reference to FIG. 78, hence the description is omitted herein.

Example 4

FIG. 87 is a view illustrating a simple method of realizing the triple structure in Example 2 (Refer to FIG. 83) with the glass capillary shown in FIG. 78. The glass capillary is drawn out with a high frequency, and is tapered as shown in 80346-1, 80346-2 and 80346-3 in FIG. 87. Electrodes 80364-1, 80364-2 and 80364-3 are inserted between each capillary. As described with reference to FIG. 80, the tip of a capillary is pressed onto each cell membrane, and is then detached from a cell while lightly sucking the cell membrane. With this operation, the tip of the capillary with a portion of the cell membrane (lipid bilayer) 80394-1, 80394-2 and 80394-3 attached thereon can be obtained. In this state, the lipid bilayer including transporters is fixed onto each capillary tip. The lipid bilayer having the same cell as that in Example 2 is fixed onto each capillary. Three capillaries are piled up in a buffer.

FIG. 87 is a cross-sectional view showing outline of biological material separation chips prepared as described above and arrayed in three cascades. Reference numerals 80346-1 to 80346-3 indicate biological material separation chips, on the tip of which are fixed nuclear membranes 80394-1 to 80394-3 respectively. The three biological material separation chips are connected with a slight clearance remained therebetween. As shown in FIG. 87, the tip of the chip is dipped in a sample solution 80361 in a vessel 80360. Electric field is herein applied to a portion between an electrode 80364-1 and an electrode 80364-4 provided in the sample solution in order to accelerate transfer of the substrate. Naturally, material transfer may be carried out in stages by switching the electrode 80364-3, 80364-2 and 80364-1, and the electrode 80364-4 in this order. After the lapse of a specified period of time, the capillaries are separated out, pressure is applied from the side of a capillary having a larger taper to pierce a lipid bilayer on the tip, and the solution inside can be collected.

Seventeenth Embodiment

A seventeenth embodiment of the present invention discloses a method of establishing a technique for preventing outflow of contents in a cell, enabling insertion of a target substance into the cell, and recovering materials in the cell to facilitate an assay of a particular substance or production of a useful material. With this method, only a portion of cell membrane is made semipermeable. To make a portion of cell semipermeable, a chip based on a partition wall structure with small pores each smaller than an external diameter of a cell provided thereon is used. A cell is fixed on a face of this chip at a position where a pore is provided, and a cell membrane toxin such as streptolysin O is reacted from the other face through the pore to a portion of the cell to make the cell membrane at the pore position semipermeable. A substance is inserted into or taken out from the cell through this semipermeable membrane portion. Further by providing electrodes at both sides of the partition wall, ions passing through the cell membrane can be measured, or a substance can forcibly be inserted into or taken out from a cell by loading a voltage to the electrodes.

Example 1

FIG. 88 is a cross-sectional view showing general relations between a cell chip in Example 1 and a cell fixed to a pore section thereof.

In FIG. 88, the reference numeral 88100 indicates a cell chip. Reference numeral 8820 indicates a cell. As described below, the cell 8820 is fixed to a portion of a pore 8803 on the cell chip 88100.

Reference numeral 8801 indicates a cell fixing substrate of the cell chip 88100, and is made of, for instance, silicon. The size is 5 mm in the height and 500 μm in the vertical direction in the figure respectively. The thickness is, for instance, 100 μm. A projection 8802 is provided at one edge portion of the cell fixing substrate 8801. The height is, for instance, 5 μm, and thickness of the projection is, for instance, 2 μm. A pore 8803 is formed at a top of the projection 8802. The size is, for instance, in the range from 2 to 5 μmφ. Electrode layers 8804, 8805 are formed on both faces of a lower section of the cell fixing substrate 8801. The electrodes 8804, 8805 are substantially covered with insulating layers, but portions near the projection 8802 and near an edge of the cell fixing substrate 8801 are exposed.

The reference numeral 8810 is a rear plate, and is adhered to an entire portion of the rear surface of the projection 8802 to form a buffer chamber 8808 on the rear surface of the projection 8802 of the cell fixing substrate 8801. Thickness of the rear plate 8810 is, for instance, 100 μm, but as shown in the figure, a projection 8811 is formed at a position corresponding to the pore 8803 on a surface of the cell fixing substrate 8801, and further projections 8812, 8813 each having a throughhole are provided in both sides of the projection 8811 on the external side face. Capillaries 8814, 8815 are attached to the projections 8812, 8813 respectively, and a micro syringe pump (not shown) can be communicated to each of the capillaries 8814, 8815. By circulating a buffer solution in the buffer chamber 8808 making use of the capillaries 8814, 8815 as indicated by a bold line in the figure or sucking a buffer solution at a rate higher than a feed rate thereof, a negative pressure state can be generated inside the buffer chamber 8808. The projection 8811 disturbs a buffer solution supplied thereto and guides a flow of the buffer solution toward the pore 8803.

Although portions relating to a microscope are not shown for simplification of the figure, a droplet of a buffer solution suited to cell culture is dripped onto an observation glass plate of the microscope, and the projection 8802 of the cell fixing substrate 8801 and the cell 8820 are placed at positions opposite to each other in this droplet. In this step, the cell 8820 is set at a position opposite to the pore 8803 on the projection 8802. Reference numeral 8821 is a lipid dual layer of the cell 8820, and reference numeral 8022 indicates cytoplasm. In FIG. 88, a broken line surrounding the projection 8802 of the cell fixing substrate 8801 and the cell 8820 indicates an image of a region immersed in the droplet. The buffer chamber 8808 is included in the region surrounded by the broken line, but as described later, in the state where the cell 8820 is fixed on the cell fixing substrate 8801, the buffer chamber 8808 is not communicated to the droplet. On the other hand, conductors are connected to the electrode layers 8804, 8805 exposed on edge portions of the cell fixing substrate 8801 outside the droplet, and the conductors are also connected to a measuring instrument or a computer not shown in the figure.

The cell 8820 is contacted to the pore 8803 of the projection 8802 observing the situation with the microscope. In this step, by monitoring the electric conductivity between the electrode layers 8804, 8805, it is observed that the electrode layer 8805 exposed in the buffer chamber 8808 and the electrode layer 8804 exposed in the droplet are communicated to each other through the buffer solution before the cell is contacted to the pore 8803 of the projection 8802, but that, as the pore 8803 is blocked with the lipid dual layer 8821 of the cell 8820 after the cell is contacted to the pore 8803 of the projection 8802, and therefore the two electrode layers 8804, 8805 are insulated against each other, thus contact to the cell 8820 being confirmed. When contact of the cell 8820 to the pore 8803, by controlling a buffer solution through the capillaries 8814, 8815 connected to the projections 8812, 8813 to suck the buffer solution at a rate higher than a feed rage of the buffer solution, a negative pressure is generated in the buffer chamber 8808, and therefore the cell 8820 is tightly fixed to the pore 8803.

Then streptolysin O is injected with the micro syringe pump communicated to the capillaries 8814, 8815 attached to the projections 8812, 8813 on the rear plate 8810. The streptolysin O acts to a portion contacting the pore 8803 of the lipid dual layer 8821 of the cell 8820 via the pore 8803, so that only the portion is made semipermeable. In the semipermeable state, although the cell frame still remains, pores are opened in the lipid dual layer 8821. Conditions for reaction of streptolysin, for instance, the technique disclosed in Kano, Y. Sako et al, Reconstraction of Brefeldin A-induced Golgi Tabulation and Fusion with the Endoplasmic Reticulum in Semi-Intact Chinese Hamster, Molecular Biology of the Cell 11, 3073-3087 (2000) may be modified according to a type of a cell. For instance, in a case of an ovarian cell, the cell is exposed to 25 mM HEPES buffer solution (pH 7.4) containing streptolysin O (60 ng/ml), 115 mM potassium acetate, 2.5 mM MgCl2, 1 mM dithiothreitol, 2 mM EGTA for 10 minutes at 4° C. Then the cell is washed with the 25 mM HEPES buffer solution (pH 7.4) containing 115 mM potassium acetate, 2.5 mM MgCl2, 1 mM dithiothreitol, 2 mM EGTA at 32° C. The cell 8820 is kept in the droplet buffer during this step, so that the cell 8820 is damaged little.

Descriptions are provided below for a method of using the cell chip 88100 with a cell having a partially semipermeable membrane fixed thereto.

A short chain RNA which is a portion of a specific mRNA is led into the buffer chamber 8 from the capillary 8814. A portion of this RNA is introduced into the cell 8820 through the pore 8803 on the semipermeable membrane. Usually, when RNA is introduced into the cell 8820, the RNA is attacked by RNase and quickly disappears. In the cell chip 88100 in Example 1, however, fresh RNA is constantly supplied through the capillary 8814 into the buffer chamber 8808, so that RNA in the cell 8820 achieves equilibrium with those in the buffer chamber 8808 through the semipermeable membrane as indicated by the thin arrow at the pore 8803. Therefore, a constant volume of RNAs is always preserved in the cell. This phenomenon is not limited to the case of RNA, and also occurs in a case of DNA or a derivative of RNA.

Current value between the electrodes 8804 and 8805 is monitored before and after the RNA is introduced into the cell 8820. If the RNA introduced into a cell gives influences to a transporter of the cell dual membrane 8821, ion channels present in the cell dual membrane 8821 couple to each other, so that fluctuation appears in ion transfer between the membrane, and a current flows between the electrode 8804 and electrode 8805. Namely, it is possible to introduce a substance into a cell and monitor influences by the substance over the cell. This technique is applicable also for measurement of influences by any chemical substance or a protein.

Further, it is possible to add various types of chemical substances in the side not exposed to streptolysin O in which the cell dual membrane 8821 of the droplet side is present and introduce the chemical substances via a transporter into the cell 8820, and possible to check influences of the introduced materials to the cell, for instance, by monitoring difference in electric potential between the electrodes 8804 and 8805. Namely a bioassay can be performed by making use of this technique.

FIG. 89(a) to FIG. 89(g) are views each illustrating an outline of the processing for preparing the cell fixing substrate 8801 in Example 1 by making use of the semiconductor technology. Each of FIG. 89(a) to FIG. 89(g) provides a cross-sectional view in the left side and a plan view corresponding to the cross-sectional view above in the right side.

At first, as shown in FIG. 89(a), a silicon substrate 8801 having a prespecified crystal axis is prepared, and a mask 8831 is provided on a surface thereof. Further a window 8832 is formed by removing the mask 8831 at a position where a projection 8803 is to be formed. As shown in FIG. 89(b), etching is performed to remove a portion corresponding to a quadrangular pyramid 8833. Then, as shown in FIG. 89(c), the mask 8831 is removed and a mask 8834 is provided on another surface of the silicon substrate 8801. Then a window is formed by removing the mask 8834 at a position where the projection 8803 is to be formed, and with this operation, recesses 8835 and 8836 each having a triangular cross section are formed. The recesses 8835, 8836 are continuous ones corresponding to the quadrangular pyramid 8833 as understood from the plan view. Then, as shown in FIG. 89(d), a mask 8837 is provided at a position surrounded by the recesses 8835, 8836 to open a window 8838. Then as shown in FIG. 89(e), the pore 8803 is opened at a corresponding position on the substrate 8801 by making use of this window 8838. In this step, also the projection 8802 is formed by etching on the substrate 8801 around the recesses 8835, 8836. Then as shown in FIG. 89(f), the electrode 8804 is formed on a surface of the substrate 8801 with the projection 8802 provided thereon. This electrode 8804 is a deposition layer of aluminum. Then as shown in FIG. 89(g), the substantially entire surface excluding both edge sections of the electrode 8804 is covered with a polyimide insulating layer 8806. Then the electrode 8805 is formed on another surface of the substrate 8801. The electrode 8805 is a platinum deposition layer, and the substantially entire surface excluding both edge sections of the electrode 8805 is covered with a polyimide insulating layer 8807. Thus the cell fixing substrate 8801 of the cell chip 88100 is formed. Detailed data concerning the semiconductor technology is not provided here, but those skilled in the art can easily carry out the technology.

Likely, also the rear plate 8810 can be formed by machining a silicon substrate. By adhering the cell fixing substrate 8801 to the rear plate 8810, the cell chip 88100 is assembled.

Example 2

In Example 1, description was made for the cell chip allowing for a bioassay by fixing a single cell on a pore portion thereof and making the cell membrane semipermeable only at the pore portion. In a multicellular organisms, it is a rare case that a single cell functions by itself, and a cell generally functions in correlation with peripheral cells. It is conceivable that cells in the multicellular system transact information using various types of chemical substances. In most cases, a quantity of the chemical substance is extremely minute, and actually real time analysis of the chemical substance in a living cell is extremely difficult. In Example 2, there is proposed a cell chip enabling a simulated bioassay for a group of cells functioning with harmonization with peripheral cells. Example 2 is the same as Example 1 in the point that a cell is fixed to a pore portion and the cell membrane only at the pore portion is made semipermeable for carry out a bioassay.

FIG. 90 is a cross-sectional view showing an outline of a relation between the cell chip and a cell fixed to the pore portion thereof in Example 2.

In FIG. 90, reference numeral 88200 indicates a cell chip in Example 2, and the cell chip 88200 includes a cell fixing substrate 8841, a rear plate 8851, and side wall plates 8861, 8862. The side wall plates are also provided behind and in front of the view plane. The space surrounded by the side wall plates forms a buffer chamber 8871 like in Example 1. A pore 8843 is formed on the cell fixing substrate 8841. The cell fixing substrate 8841 and the pore 8843 correspond to the cell fixing substrate 8801 and pore 8803 in Example 1. Different from the cell fixing substrate 8801 in Example 1, the projection 8802 is not formed in the cell fixing substrate 8841 in Example 2, and a number of pores 8803 are provided thereon. A number of cells are arrayed on a surface of the cell fixing substrate 8841 to form a group of cells functioning as a whole in harmonization with each other. In the case shown in the figure, four pores 8843 are formed, but more pores may be provided. Size of the cell fixing substrate 8841 is, for instance, about 10×10 mm. The thickness is, for instance, 100 μm. Diameter of the pore 8843 is in the range from 2 to 5 μmφ, and the pores are arrayed with a pitch of 8 μm inbetween. The cells 8820 are fixed to positions corresponding to the pores 8803 on the cell fixing substrate 8841. Namely the cells are arrayed with a pitch of 8 μm inbetween.

The rear plate 8851 has the substantially same size as the cell fixing substrate 8841, and is placed away from the cell fixing substrate 8841 with a space of, for instance, 1 mm therefrom. The cell fixing substrate 8841 and rear plate 8851 are supported at the prespecified positions by the side wall plate behind and in front of the view plane, and the space surrounded with the side wall plates is a buffer 8871. Like in Example 1, projections 8863, 8864 each having a throughhole are formed on the side wall plates 8861, 8862. Capillaries (not shown) can be attached to the projections 8863, 8864, and the capillaries are connected to a syringe pump respectively for feeding a buffer solution or the like. A projection 8852 is formed at a position corresponding to the pore 8843 on the rear plate 8851. This projection 8852 is provided to disturb a buffer solution supplied into the buffer chamber 8871 to make it flow toward the pore 8843, like the projection 8811 in Example 1. An electrode 8853 is provided on a surface of the rear plate 8851 in the buffer chamber 8871. An outgoing line from the electrode 8852 is an insulated line, and is connected to outside of the buffer chamber 8871.

FIG. 91(a) to FIG. 91(d) are views each illustrating an outline of the processing for forming the cell fixing substrate 8841 in Example 2 by making use of the semiconductor technology. Each of the FIG. 91(a) to FIG. 91(c) shows a cross-sectional view in the left side and a plan view corresponding to the cross-sectional view in the right side. A plan view for FIG. 91(d) is the same as FIG. 4(c), and is omitted herefrom.

At first, as shown in FIG. 91(a), a silicon substrate 8801 having a prespecified crystal axis is prepared, and a mask 8831 is provided on a surface thereof. Further a window 8832 is formed by removing the mask 8831 at a position where a projection 8803 is to be formed. As shown in FIG. 91B, etching is performed to remove a portion corresponding to a quadrangular pyramid. Then, as shown in FIG. 91(c), the mask 8831 is removed and a mask 8834 is provided on another surface of the silicon substrate 8801. Then a window 8835 is formed by removing the mask 8834 at a position where the pore 8843 is to be formed. Then pores 8843 are formed by etching as shown in FIG. 91(d). With the operation, the cell fixing substrate 8841 of the cell chip 88200 is formed. Herein detail data for the semiconductor technology is not provided, but those skilled in the art can easily use the technology.

Similarly, also the rear plate 8851, side wall plates 8861, 8862 can be formed by machining a silicon substrate with the semiconductor technology. Then the cell fixing substrate 8841, rear plate 8851, and side wall plates 8861, 8862 are adhered to each other, thus the cell chip 88200 being assembled.

As clearly understood from comparison of the plan view in FIG. 89(g) to that in FIG. 91(c), the cell chip 88100 in Example 1 is used to perform a bioassay for a single cell, but the cell chip 88200 in Example 2 enables a bioassay for 4×4 cells arrayed in a square form. The cell chip 88200 is set on a culture plate and is immersed in a proper culture fluid. When the epithelial cells 8820 are cultured on the cell fixing substrate 8841 of the cell chip 88200 in this state, a single-layered cell sheet is inevitably formed on the cell fixing substrate 8841. FIG. 90 shows an image in which the cell chip 88200 and a cultured cell sheet are within a region of a culture fluid indicated by the broken like and also shows the state with a cross-sectional view in which a monolayer cell sheet is formed on the cell fixing substrate 8841 of the cell chip 88200. The pores 8843 are provided in correspondence to a pitch in a cell array, but when the pores 8843 are provided at a sufficient density against a pitch between cells (such as, for instance, 8 μm) such as, for instance, 5 μm, the pores are allocated to substantially all of the cells in the monolayer cell sheet formed on the cell fixing substrate 8841 regardless of the cell size. It is needless to say that cells may be fixed on a constant pitch and cultured on the cell fixing substrate 8841 with the pores 8843 each corresponding to the cell size arrayed thereon, for instance, with an agarose micro chamber arrays. Further any cell may be arrayed to form the cell sheet. It is to be noted that, in the cell 8820 shown in FIG. 90, designated at reference numeral 8822 is a cell dual membrane, at 8822 cytoplasm, and at 8823 a transporter present in the cell dual membrane.

Also in Example 2, at first, a buffer solution is supplied via the projections 8863, 8864 on the side wall plates 8861, 8862 into the buffer chamber 8871 like in Example 1. In this state, electric conductivity between the electrode 8855 immersed in a culture fluid on the culture plate and the electrode 8853 in the buffer chamber 8871 is monitored. When the cell sheet formed with the cells 8820 is not tightly fixed on the cell fixing substrate 8841, the electric conductivity between the electrode 8855 immersed in the culture fluid on the culture plate and the electrode 8854 exposed inside the buffer chamber 8808 is relatively low due to the buffer solution. In this state, when a buffer solution supplied via the throughholes on the projections 8861, 8862 is controlled and sucked at a rate higher than a feed rate of the buffer solution as indicated by a bold line, a negative pressure is generated inside the buffer chamber 8871 and the cell sheet is fixed to the cell fixing substrate 8841.

Then streptolysin O is injected into the buffer chamber 8871 like in Example 1. The streptolysin O acts via the pore 8843 to a portion contacting the pore 8843 on the lipid dual layer 8821 of the cell 8820 to make only the portion semipermeable. With this operation, a cell chip containing a cell having a semipermeable cell membrane only in the portion corresponding to the pore 8843 is obtained.

Not descriptions are provided for a method of using the cell chip 88200 with a cell having a partial semipermeable cell membrane fixed thereto prepared as described thereto.

Short chain RNA each as a portion of a specific mRNA is flown into the buffer chamber 8871 as indicated by the bold line. A portion of the RNA is fetched through the semipermeable membrane into the cell 8820. Generally, when introduced into the cell 8820, RNA is attacked by RNase and quickly disappears. However, in the cell chip 88200 in Example 2, fresh RNAs are sequentially supplied through the throughholes on the projections 8861, 8862, so that the RNAs inside the cell 8820 achieve equilibrium via the semipermeable membrane with those in the buffer chamber 8871 as indicated by a thin arrow in the figure. Therefore, a constant volume of RNAs is always preserved in the cell.

A current value between the electrode 8854 and electrode 8855 is monitored before and after the RNAs are introduced into the cell 8820. If the RNA introduced into the cell constituting the cell sheet give influences to the transporter 8823 for the cell dual membrane 8821 ion channels in the cell dual membrane 8821 couple to each other, so that fluctuations occur in transport of ions through the cell membrane, and therefore a current flows between the electrodes 8854 and 8855. Namely a substance can be introduced into a cell, and influences caused by the substance over the cell can be monitored. This technique can be used for measurement of influences not only by RNA, but also chemical substances and proteins. Further it is possible to add various types of chemical substances in a cell fluid in the side not exposed to streptolysin O where the cell dual membrane 8821 in the culture plate side, introduce the chemical substance via a transporter into the cell 8820, and check influences of the chemical substances over the cell, for instance, by detecting a different in electric potentials between the electrodes 8854, 8855. Namely a bioassay can be performed.

When a chemical substance indicated by a white triangle is added on the culture dish, the chemical substance is fetched into the cell via the transporter 8823 as indicated by the solid black triangles in the figure. An arrow mark penetrating the transporter 8823 indicates that the chemical substances passe therethrough. The fetched chemical substance passes through the semipermeable section of the cell membrane, and is eluted through the pore 8843 into the buffer chamber 8871 as indicated by the solid black triangle. By recovering the eluate via the through hole on the projection 8862, reactions of the cell to the chemical substance can be assessed.

The biochemical substances as used in this specification include, but not limited to, amino acids, dipeptides, oligo peptides such as tripeptides, polypeptides such as proteins, nucleic acids, RNAs such as mRNAs, monosaccharide, disaccharide or oligosaccharide, sugars such as polysaccharide, hormones such as steroids, neurotransmitters such as noradrenaline, dopamine, and serotonin, other endocrine disrupters, various types of drugs, and other materials involving in the life phenomenon such as potassium, sodium, chloride ions, hydrogen ion. The biochemical substances have various types of characteristics. Therefore the possibility of assessing the influences of these materials through direction reactions with cells is extremely useful.

For instance, the aforementioned chip is prepared with a cell in which the SLC6A1 as a transporter is forcefully expressed, the chip is useful for detection on γ-amino butyric acid. The cell in which SLC6A2 is forcefully expressed may be used for noradrenaline, and that in which SLC6A4 may be used for measurement of serotonin. Further a cell in which SLCO3A1 can be used for measurement of prostaglandin, and a cell in which SLC6A5 is forcefully expressed can be used for measurement of glycine.

Further by using the chip according to the seventeenth embodiment, a material can be refined. For instance, cells each containing a transporter for dopamine forcefully expressed therein with the technique described above are arrayed on the chip 88200 as shown in FIG. 90. Each of the cells has semipermeable cell membrane only at a potion thereof contacting the pore. In this state, a sample solution containing dopamine or a derivative thereof is added in the chip, and a voltage is loaded to the electrodes 8854 and 8855. Then dopamine as a target or homologues can be recovered through the cell membrane. A material having a completely different structure does not pass through the cell membrane. It is needless to say that other materials are recovered via the respective transporters, but a number of a transporter for the target material is substantially larger than those for other materials, so that the target material can substantially be recovered. The same refinement can also be performed for amino acids or sugars. Especially, by forcefully expressing a stereoisomer capable of being recognized by a transporter in a cell, for instance, only L-isomer can be refined from a synthetic amino acid (a mixture of D- and L-isomers) with small amount of energy.

As described above, the cell chip according to the seventeenth embodiment can be used not only for assay of chemical materials, but also for production of specific materials including refinement thereof.

Eighteenth Embodiment

An eighteenth embodiment of the present invention discloses a method of accurately counting a number of biomolecules, not only for separating the biological material, but also for separating an extremely small number of molecules having activity to a cell in the function traceable state to clarify functions of a cell. When a biomolecule moves, the biomolecule is always guided so that the biomolecule passes through a region with the space covered with the evanescent wave having a prespecified wavelength. As a result, when the molecule passes through the region, scattering of light occurs, and the scattered evanescent light goes out from the space, and therefore, by detecting this scattered light, a number of biomolecules can accurately be counted.

Example 1

FIG. 92 is a conceptual diagram showing an example of a molecule counter based on detection of scattered light by making use of resonant plasmon. Reference numeral 9201 indicates a fine tube, and the material is fused silica with low light attenuation. The fine tube 9201 is a detector. A diameter of an opening at a tip portion of the fine tune is in the range from 200 to 300 nm, and also the wall thickness is small. Inner and outer surfaces of the tip portion of the fine tune 9201 at a portion near the opening are covered with a metal foil layer 9202 to cause plasmon resonance when the evanescent waves go out of the opening at the tip portion of the fine tube. The best material for the metal foil layer 9202 is gold. Wavelength of light introduced into the fine tube 9201 should preferably be slightly larger than a diameter of the opening at the tip portion of the fine tube. Portions of fine tube other than the tip section may be thick, and when the wall thickness is sufficiently larger as compared to the wavelength of light described above, the light can be propagated by total reflection from the inlet portion to the opening of the tip portion of the fine tube. A diameter of the opening at the other edge of the tine tune is sufficiently larger as compared to the wavelength of light introduced into the fine tube 9201.

The tip portion of the fine tube 9201 can be thinned with any known method. For instance, by extending the fused silica tube by means of high-frequency heating, the tip portion can be thinned, and also the wall thickness of the tip portion can be reduced.

A sample solution containing a biomolecule 9204 as a target for detection is put in a vessel 9208 with a buffer solution filled therein, and the buffer solution is also introduced into the fine tube 9201, and then the tip portion of the fine tube 9201 is inserted into the vessel 9208. When visible laser light 9203 is irradiated from the thick wall section of the fine tube 9201, the light propagates from the thick wall portion toward the tip portion by total reflection, and light having a prespecified wavelength goes out as evanescent light wave from a balled portion of the tip section to form a evanescent wave region 9203-2. When the biomolecule 9204 passes through the evanescent wave region 9203-2, the resonant plasmon phenomenon occurs, and photons 9203-3 springs out to outside of the evanescent region 9203-3. The photons are focused with a lens 9205 and counted with a photon counter 9206, a number of biomolecules passing through the opening at the tip portion can be detected. The lens 9205 is a water-submerged lens and is approached as much as possible to the evanescent wave region 9203-2 at the tip portion of the fine tube 9201 from which the scattered light goes out.

Electrophoresis is used for transport of a biological material. Namely electrodes 9207-1 and 9207-2 are placed inside the fine tube 9201 functioning as a light guide and in a sample solution in which biomolecules are dispersed, and only a specified material can be introduced into the fine tube by loading a voltage on the electrodes 9207-1 and 9207-2. What is important in this step is a voltage applied to the electrodes 9207-1 and 9207-2. When a quantity of biological material is large, the photon counter 9206 is saturated, and the photon pulses can not accurately be counted. In the situation as described above, the voltage is lowered so that a biomolecule passes through the evanescent wave regions 9203-2 at the tip of the fine tube at a speed allowing for photon counting.

FIG. 93 is a conceptual view showing a result obtained by the photon counter 9206. The horizontal axis indicates time, and the vertical axis indicates amplitude of light introduced into the photon counter 9206. In the eighteenth embodiment, basically photon detection is performed, so that the background light should be removed as much as possible. When an electric field is loaded to the electrodes 9207-1 and 9207-2 so that the voltage at the electrode 9207-1 is set to +15 V, a signal 9222 is obtained. It is conceivable that this signal is generated by impurities contained in the buffer solution or by electric noises. Then transferrin, which is a type of protein, is added to outside of the fine tube 9201 so that the concentration is 1 fM. Signals 9221-1 and 9222-2 having a clearly stronger amplitude than the signal 9222, are detected. Namely, it is conceivable that the signal 9222 is generated by noises and also that the signal 9221-1 is generated by scattered light generated when transferrin passes through the evanescent wave region 9203-2 at the tip of the fine tube. It is conceivable that the signal 9221-2 indicates presence of other protein component contained in the transferrin solution, but the contents is unknown. Frequencies of the signals 9221-1 and 9221-2 increases when a quantity of added transferrin increases, and the frequencies drop when the quantity is reduced.

When a sample refined by chromatography using the DEAC cellulose column for transferring is used, a frequency of appearance of the signal 9221-1 becomes higher as compared to that of the signal 9221-2, and therefore the signal 9221-1 is conceivably originated from the transferrin. The signal 9221-2 can be considered as originated from other component contained in the transferring solution, but the substance is still unknown. Because an amplitude of scattered light indicated by the signal 9221-2 is lower than that indicated by the signal 9221-1, and therefore it may be guessed that this unknown substance has smaller size than transferrin.

Example 2

FIG. 94(A) is a cross-sectional view showing a case where a measurement device described in Example 1 is formed with a substrate, and a chip-like detector placed on the substrate, while FIG. 94(B) is a plan view showing general relation between a substrate of the measurement device and the chip-like detector placed on the substrate. In this case, a pore for forming the evanescent wave region is provided on the chip.

Reference numeral 9231 indicates the chip-like detector, and the chip has the width of 3 mm, length of 3 mm, and thickness of 200 μm. An opening with the diameter in the range from 200 to 300 nm is formed at a central portion thereof. A tip section 9232 of the fine tube is curved and expanded by 100 μm, and a metal foil 9233 is deposited on this curved section. An optical coupler 9240 is fixed to an edge face of the chip-like detector 9231. The optical coupler 9240 is connected to an optical fiber 9241, and a laser source 9242 is set at a tip of the optical fiber 9241. The laser light introduced from the laser source 9242 into the chip-like detector 9231 is totally reflected inside the chip-like detector, and reaches the tip portion 9232 of the fine tube. The evanescent waves go out from the tip portion 9232 of the fine tube to form the evanescent wave region 9234. Electrodes 9236-1 and 9236-2 are provided on both surfaces of the chip at an edge section of the chip-like detector 9231.

The chip-like detector 9231 is attached to the substrate 9230. A vessel 9237 containing a buffer solution is formed on a top face of the substrate 9230 at a position corresponding to the tip section 9232 of the fine tube in the detector 9231. The substrate 9230 has the thickness of, for instance, 0.4 mm, and the thickness of the bottom section of the vessel 9237 is 0.1 mm. When the detector 9231 is attached to the substrate 9230, the tip portion 9232 of the curved fine tube is approached as much as possible to the bottom surface of the vessel 9237. A buffer solution is put in the vessel 9237.

A sample solution 9235 is added through the opening into the chip-like detector 9231 from the upper position. If there is a particle with the size of 10 nm in the sample droplet 9235, when the particle passes through the evanescent wave region, scattering of light occurs, ad photons passes through a focusing lens 9243 and reaches a photomultiplier 9244 to provide a signal pattern as shown in FIG. 93 in Example 1. The electrode 9236-1 in the detector 9231 contacts the droplet 9235, while the electrode 9236-2 in the detector 9231 contacts the buffer solution in the vessel 9237, so that a molecule can be electrophoresed with a power source 92505 to control a direction of the particle passing through the opening of the chip-like detector 9231.

As indicated by the relation between the substrate and the chip-like detector placed on the substrate shown in FIG. 94(B), a hole 9247 is provided on the substrate 9230 at a position adjoining the chip-like detector 9231. The hole 9247 is communicated to the vessel 9247 through a groove 9248. Therefore, after the sample droplet is added from the top through the opening of the chip-like detector 9231 and a prespecified measurement is performed, by sucking the buffer solution from the hole 9247 with a dropping pipet, the buffer solution containing the particle moved into the buffer solution in the vessel 9237 through the opening of the chip-like detector 9231 can be taken out.

Example 3

Further, in the eighteenth embodiment, a specific biomolecule can be screen off and detected by attaching a chip 9246 with a cell membrane including a transporter 9245 selecting a biomolecule adhered to a top of the chip-like detector 9231 described in Example 2. In this case, only the materials capable of passing through a transporter can advantageously be detected in the evanescent wave region 9234. The transporter used in this case is, for instance, oocyte of xenopus (immature egg) in which a gene for a specific transporter is forcefully expressed. For instance, an mRNA sequence for a specific membrane protein is incorporated in an immature egg of xenopus, and a membrane is formed with cells in which the specific membrane protein is forcefully expressed. Then the cell membrane is cut off by patch clamping, and the cell membrane cut off as described may be adhered to the chip for use. More specifically, for instance, the transporter chip illustrated especially in FIG. 1 in Japanese Patent Application No. 2004-264866 filed by the present inventors may be used for this purpose.

FIG. 95 is a cross-sectional view showing a measurement device in Example 3 in which a chip with a cell membrane containing a transporter adhered thereon is placed on the chip-like detector of the measurement device described in Example 1. The plan view of the measurement device in Example 3 is the same as that in FIG. 94(B), and is omitted herefrom.

As clearly understood from comparison between FIG. 95 and FIG. 94, FIG. 95 is the same as FIG. 94 excluding the points that a chip 9246 with a cell membrane containing the transporter 9245 selecting a biomolecule adhered thereon is placed on the chip-like detector 9231, and that the electrode 9236-1 is provided on the chip 9246 with the cell membrane adhered thereon. Therefore, when the sample droplet 9235 is dripped on a top surface of the chip 9246 for measurement, only biomolecules capable of passing through the transporter 9245 are introduced into the chip-like detector 9231, so that passage of the biomolecules can be detected. Namely, in a case of the sample droplet 9235 for a tissue piece containing a plurality of cells, or in a case of the sample droplet 9235 containing a signal transmitter substance released from a particular cell in the cell chip on which cells are arrayed systematically, it is possible to previously select and measure the chip 9246 with the cell membrane containing the transporter 9245 selecting the biomolecule, which enables analysis of the state of each discrete cell in a multiple cell system.

Example 4

In Example 3, the structure shown in FIG. 95 is employed for measurement with a droplet and improvement in productivity by employment of a chip, but this chip is not always convenient in use when it is difficult to make a droplet of a sample. Example 4 proposes a measurement device which can advantageously be used when it is difficult to make a droplet of a sample, or when a molecule released from a region where specific cells gather is to be detected. FIG. 96 is a cross-sectional view showing a measurement device in which a fine tube with a cell membrane containing a transporter is provided outside the chip-formed detector of the measurement device described in Example 1.

Also in Example 4, the fine tube with a cell membrane containing a transporter adhered thereon can be used in the transporter chip proposed by the present inventor and disclosed especially in FIG. 9 in Japanese Patent Application No. 2004-264866. Reference numeral 9251 indicates a fine tube of the measurement device described in Example 1. An evanescent region 9258 is formed at the tip section. Reference numeral 9252 indicates a fine tube with a cell membrane containing a transporter adhered thereon. The fine tube 9252 with a cell membrane containing a transporter covers the fine tube 9251. Reference numeral 9250 is a block of cells to be measured. A specific cell as a target for measurement is present in the block 9250. The block 9250 of cells is placed in the buffer solution in the vessel 9253. An electrode 9254-1 is set in the buffer solution in the vessel 9253, while an electrode 9254-2 is attached to inside of the fine tune 9251 of the measurement device. A tip of the fine tube 9252 is approached to the specific cell 9255 in the cell block 9250. A substance 9256 released from the cell 9255 is selectively fetched into the fine tube 9252 via the transporter 9257 attached to a tip portion of the fine tube 9252 when an electric field is loaded to the electrode 9254-1 and electrode 9254-2. Materials not capable of passing through the transporter 9257 are not fetched into the fine tube 9252. A laser 9260 as a light source is attached to the other edge of the fine tube 9251. As described in Example 1, an evanescent region 9284 is formed at the tip portion of the fine tube 9251 as described in Example 1. Because of the configuration, cells having passed through the evanescent wave region 9284 of the fine tube 9251 are fetched into the fine tube one by one due to the electric field loaded to the electrode 9254-1 and electrode 9254-2, and the cells generate photons in this step. The photons are captured by a focusing lens 9259 and counted with a photon counter (not shown).

In Example 4, as a tip of the measurement device is sharp, access to a specific region of a solid block of cells is easy.

Nineteenth Embodiment

As a nineteenth embodiment, a method is described in which a polynucleotide chip and a protein chip both higher in density and better defined quantitatively and reproducibility than conventional chips are used, and also in which an atomic force microscope is used in detecting a shape of substance by tracing atomic force, in place of an optical detection which has a limitation in resolution in detecting captured DNA molecules. Although the atomic force microscope has a resolution fine enough for identifying DNA molecules in a state of a single-chain or a double-chain (approximately 3 nm in diameter), nanoparticles, which are easy to detect, are used as a marker for fast scanning.

Example 1

FIG. 97 is a conceptual oblique perspective view showing part of a DNA chip according to a first example of the nineteenth embodiment. A chip 97100 is formed on a silicon substrate 97101 with oxidized film on the surface. Each element 9701 has a form of a cylindrical column 700 nm in diameter. A spacing 9702 between each element is 300 nm. This means that the elements are lined up at a distance of 1 μm. A group of 50×50 elements, as enclosed with a single-dotted line 9703, forms an element group, and there are provided 20×20 element groups lined up on the chip. Between each element group 9703 is a groove 9705 40 nm in width and 20 nm in depth, and on each of four corners of each element is provided a pillar 9704 for indexing. The pillar 9704 between 2 elements is shared by both elements. The pillar 9704 has a form of cylindrical column, with 17 different diameters starting from 50 nm at an increment of 10 nm, and with 17 different heights starting from 5 nm at an increment of 10 nm, and a combination of four pillars 9704 at the four corners of each element is used for indexing, just like a bar code. There are therefore nine pillars 9704 of the same shape in an element group 9703, and the pillars are placed so that no adjoining pillars are of the same shape, and that the sizes of pillars are as randomly placed as possible.

FIG. 98 is a pattern diagram showing more detailed relationship between the elements 9701 each and the pillars 9704 on the substrate 97101 shown in FIG. 97, and relationship among DNA probes 9721, 9722, . . . , DNA fragments 97201, 97202 and 97203 hybridized to the DNA probes, and an AFM probe 9760 for detecting the DNA fragments. Each element 9701 on the substrate 97101 is provided at a raised level from the substrate surface. This means that there are grooves between each element, forming boundaries between each element. The element 9701 is raised by 20 nm. DNA probes and others are described hereinafter.

The pillars 9704, provided at the four corners of each element, are used, in addition for indexation, for accelerating hybridization. FIGS. 99 (a), (b) and (C) are an overall view describing the effect of the pillars 9704 for accelerating hybridization, and FIG. 100 is a detailed explanatory diagram showing the effect described in FIG. 99.

As shown in FIG. 99 (a), above the upper surface of the element 9701 on the substrate 97101 of the DNA chip 97100 is provided an upper plate 97102, at a gap of 100 μm, movable back and forth, as shown in an arrow 97103, and between the upper plate 97102 and the substrate 97101 is sandwiched 1 μl of sample solution. As shown in FIG. 99 (b), the upper plate 97102 is moved to the direction indicated by an arrow relative to the substrate 97101. Thereafter the upper plate 97102 is moved to the reverse direction relative to the substrate 97101 indicated by an arrow as shown in FIG. 99(c). The upper plate 97102 is moved back and forth at 1 Hz. Generally, in a micro device like the DNA chip, the solution tends to develop a laminar flow, resulting in poor agitation efficiency; the back-and-forth movement of the upper plate 97102 over the substrate 97101 disturbs the laminar flow, accelerating the hybridization. FIG. 100 is a cross-sectional view at a center position of two adjoining elements 9701, with a pillar 9704 visible beyond the center position. The back-and-forth movement of the upper plate 97102 in the direction shown by an arrow 97103 relative to the substrate 97101 forces surface-direction movement of the solution as marked by reference numerals 97105 and 97106, and diffusion of the dissolved substance (DNA samples and marker probes in the example) in the direction of thickness only is known to be a determinant of hybridization speed (refer, for instance, to Japanese Patent Laid-Open No. 2004-144521). Hence, the sample solution is always altering on the surface of the elements 9701 each, accelerating the hybridization. Further, in the 19th embodiment, as there are provided pillars effectively random in form between each of the elements 9701, the solution forced to move in the surface direction is disturbed more effectively by the obstacle pillars 9704, further accelerating the hybridization. As a result, the hybridization speed in the micro device is effectively close to the speed in a solution layer.

With reference to FIG. 98 again, on the upper surface of the elements 9701 in the form of a cylindrical column 700 nm in diameter and 20 nm in height are each fixed mutually different DNA probes 9721, 9722, . . . . The DNA probes used here are of type PNA. The PNAs, unlike regular DNAs, do not have a negative charge originating from a phosphodiester bond, and hence there does not work an electrostatic repulsive force with target DNAs. This improves efficiency of the hybridization. In particular, in a micro device like a DNA chip in which probes are fixed on the solid phase of the elements in high density, if regular DNA probes are used, the target DNAs need to approach the probes through the barrier of the negative charge, which is disadvantageous in terms of reaction kinetics as well as thermodynamics. Also the DNA sample must be of single chain. The use of the PNA and the like without the negative charge results in lack of charges on the surface of the element, leading to a speedier hybridization speed and a better yield. Further, due to the characteristic of lack of the charge, an electrostatic repulsive force is not generated, so that PNAs can competitively enter between the two chains of DNAs and can competitively hybridize, even if the target DNAs are of double chain.

In the example 1, to the elements 9701 each are fixed the DNA probes 9721, 9722, . . . , which are each a sequence of between 45 and 60 bases in length between a first exon and a second exon of human cDNA. This prevents false positive results and lower hybridization efficiency caused by hybridization of residual genomes. A commonly known method of fixing probes is used: probes are fixed with a silane coupling reaction. In the example, conditions of the hybridization such as composition of buffer fluid and the sample DNA probes are in accordance to a hybridization method described in Nucleic Acid Research (2002) 30, No. 16 e87. As a probe fixing method, a method described in the above document is employed, in which amino groups are introduced to an oxidized surface of the silicone substrate 101 processed with 3-aminopropyltrimethoxysilane. The amino group introduced on the surface and an SH group of the probe is bridged with N-(11-maleimidoundecanoxyloxy)succinimide. If probes about 50 bases in length are fixed with this method, the concentration of the probes is about a molecule per 15 nm2. This means that there are some 25,000 probe molecules fixed on an element.

As the sample, 1st strand cDNA is used, obtained by reverse-transcribing once mRNA originating from human leucocyte. Generally such a method as oligo-capping is employed to obtain full-length cDNA, but in the example, since it is desired to identify the quantity of mRNA in a cell, a method is used in which the cells are dripped into liquid helium little by little, resultant quick-frozen cells are drip-suspended in ultrasonic-agitated phenol together with the liquid helium, and the cells are destructed in an instant. Total RNAs are purified with a commonly known method. A reverse-transcription enzyme is worked on RNAs obtained from about 10 cells to produce the 1st strand cDNAs.

The 1st strand cDNAs obtained in the above-described manner are dissolved in 1 μl of 2×SSC and dripped on the DNA chip. At this state, there are included about 102 molecules of rare 1st strand DNAs and about 105 molecules of abundant 1st strand DNAs, and this matches the number of probes on the chip surface in terms of order.

The DNA chip is agitated for an hour at 45° C., as shown in FIGS. 99 and 100, to complete the hybridization process. Thereafter the upper plate 97102 used for agitation as described in FIGS. 99 and 100 are removed and dried. In the example 1, since the PNA probes are used, it is not necessarily required to arrange a condition with high salt concentration as is the case with regular DNA chips. This is because it is not necessary to block the negative charges of the DNA probes and the sample DNAs with salt. On the contrary the results are usually better with low ionic strength.

In the example 1, single-chain 1st strand cDNAs are used, but the hybridization can equally work with double-chain DNAs without first uncoiling them. In this case, the ironic strength should not be very high, as in this way, the sample double-chain DNAs are easier to uncoil due to the very own negative charges of the DNAs; the probes do not have negative charges and the hybridization process can proceed without problems. In this case, however, there is a competition between recoiling of the double-chain DNAs and hybridization with the probes, and the hybridization yield is inferior to the yield obtained with the hybridization of the 1st strand cDNAs.

In the example 1, the hybridization process completes very fast even on the solid phase, due to the use of the PNA probes and sufficient agitation. With DNA probes according to the conventional technology, reaction efficiency is poor with the sample concentration and the probe quantity as described above, and the reaction does not complete even after 24 hours, due mainly to the electrostatic repulsion force.

FIG. 98 illustrates a state in which a sample DNA fragment 97201 is hybridized with the probe 9721 on the element 9701.

Next, in order to identify different portion in complement sequences of the sample DNA fragments 97201, 97202 and 97203 hybridized to the probes 9721, second probes marked with gold nanoparticles 9723′, 9724′ and 9725′, the particles are to be hybridized with the sample DNA fragments 97201, 97202 and 97203, is used. For the second probe, an exon different from the exon used in the capture probe 9721 on the element 9701 is employed. For instance, PNA probes corresponding to exon 3, exon 4 and exon 5 are prepared in advance. Each probe is about 30 to 50 bases in length. Each probe is introduced with a sulphide group (an SH group) at the 5′ end at the time of synthesis. For probes corresponding to the exon 3, exon 4 and exon 5 each, gold nanoparticles with diameters 8.3 nm, 11 nm and 17 nm are mixed, respectively, and PNA probes marked with gold nanoparticles with different diameters are obtained. Each of the three gold nanoparticles-marked probes (9723′, 9724′ and 9725′) is mixed at 10 pmol/μl, each of the mixture is dripped on the DNA chip with hybridized sample DNAs, and the DNA chip is agitated for 15 minutes again with the method described in FIGS. 99 and 100.

After washing the chip with 2×SSC, the upper plate 97102 for agitation described in FIGS. 99 and 100 are removed and dried. Thereafter, the surface of the chip 97100 is scanned two-dimensionally while tapping an AFM probe 9760 at 10 Hz, as shown with an arrow 9761.

FIG. 101 is a pattern diagram showing the position signal of the AFM probe 9760 when the chip 97100 as shown in FIG. 97 is scanned in lateral direction with the AFM probe 9760. From the position signal of the AFM probe 9760, it is known that the element 9701 is located at a position shown with a dotted line 9741, and the gap 9702 between the elements 9701 is located at an adjoining area 9745. It is also known that the pillars with different sizes are located at positions indicated with dotted lines 9751 and 9752. Position signals corresponding to reference numerals 9747, 9748 and 9749 indicate that the gold nanoparticles-marked PNA probes are hybridized to the second probes (9723′, 9724′ and 9725′ in FIG. 98) corresponding to the exon 3, exon 4 and exon 5, respectively, which are further hybridized to the PNA probes fixed on the element 9701. Therefore, from the position signal of the AFM probe 9760, the positions of elements and the markers can be identified.

Example 2

FIGS. 102 (a), (b) and (c) are an overall view showing another example of illustrating the effect of the pillars 9704 for accelerating the probe hybridization, and FIG. 103 is a detailed explanatory diagram illustrating the effect described in FIG. 102.

It is known from comparison of FIGS. 102 (a), (b) and (c) with FIGS. 99 (a), (b) and (c) that there is a singular difference between the DNA chip 97100 in the example 2 and the DNA chip 97100 in the example 1, in that in place of the upper plate 97102 located over the substrate 97101, there is provided a rotating rod 97120 with 100 μm in diameter. The rod 97120 can be rotated at 200 rpm, touching the sample solution 97122 on the substrate 97101. There is a gap of 100 μm between the rod 97120 and the chip element. While the rod 97120 is rotated with a spindle motor, the stage on which is placed the chip is moved right and left once every 10 seconds. After 1 μl of sample solution or nanoparticles-marked probe solution is dripped on the substrate 97101, the substrate 97101 is moved from left to right while the rod 97120 is rotated as illustrated in FIGS. 102 (a), (b) and (c), and from right to left if necessary (arrow 97129: FIG. 103). The rotation of the rod 97120 forces surface-direction movement of the solution as marked by heavy lines 97115 and 97125, and the solution is agitated well on the substrate 97101. Hence, the sample solution is always altering on the surface of the elements 9701 each, accelerating the hybridization. Further, also in the example 2, as there are provided pillars effectively random in form between each of the elements 9701, the solution forced to move in the surface direction is disturbed more effectively due to solution turbulence by the obstacle pillars 9704, further accelerating the hybridization. In the example 2, due to interaction of the rotation of the rod 97120 and the surface direction movement, the reaction liquid for hybridization is agitated well on the elements on the chip.

The size of the chip according to the nineteenth embodiment is described hereinafter. Generally, if optical means is used to identify substances, substances less than 400 to 500 nm cannot be identified with a numerical aperture of 0.8, as shown by the formula 1. If the size is smaller, even the existence of the substances cannot be identified. Practically, the minimum size is about 700 nm.

Resolution = 0.61 · λ n · sin   θ Formula   1

(where n·sin θ is the numerical aperture) . . . (1)

In the nineteenth embodiment, substances are identified by measuring the atomic force, and therefore substances can be identified without regard to wavelength. For this reason, the element 9701 and the groove between the elements 9701 can be identified even if the diameter of the element or the spacing between the elements are less than 700 nm. In the example 1, the element 9701 has a diameter of 700 nm, and the spacing between the elements 9701 is 300 nm, but the element 9701 can be minuter, and the spacing between the elements can be shorter. For instance, if the element 9701 has a diameter of less than 500 nm and the spacing is less than 300 nm, gold nanoparticles 8.3 nm in diameter and captured on the element 9701 with the hybridization reaction can be quantitatively determined with the use of the atomic force microscope.

As for the minimum size of the element 9701 or the spacing between the elements 9701, about 70 nm is the minimum for reasons described hereinafter. Namely, it is described above that the concentration of the fixed probes is about a molecule per 15 nm2, if probes of about 50 bases in length are used. On the other hand, a smallest size of nanoparticles generally available with the current technology is about 5 nm, which is about the same size with the concentration of the probes and serves as a decision standard for the minimum size. In practice, there must be at least 1,000 particles on an element 9701 for quantitative determination. Hence, the minimum size of the element 9701 is 15×1,000 nm2. This means that the minimum diameter of the element 9701 is about 70 nm. If the quantitative determination is not required, smaller elements may be used, and the area occupied by a probe molecule when fixed is the minimum. This means that the smallest possible diameter is 3 nm.

Example 3

Protein chips are prepared in which affinity-purified anti-AFP antibody and anti-CEA antibody are fixed to different elements. Separately, SH groups are introduced to F(ab′)2 fragment obtained by papain-degradating the anti-AFP antibody and anti-CEA antibody. About 3 to 4 molecules of the SH group are introduced to a molecule of the F(ab′)2 fragment. Gold nanoparticles 20 nm in diameter is mixed, and particles with the F(ab′)2 fragment bonded on the surface is obtained. As samples, solution with AFP only with 1 zmol/μl in concentration, solution with CEA only with 5 zmol/μl in concentration, and a control without any substance are prepared. A PBS at pH 7.4 including 0.1% Tween 20 and 0.5% BAS is used as solvent. The protein chips are reacted with the solutions, and then with the gold nanoparticles-marked F(ab′)2. The reaction time is five minutes for the reaction with the samples, and another 5 minutes for the reaction with the gold nanoparticles-marked F(ab′)2. After the reaction is completed, the chip is washed with buffer solution including 0.1% Tween 20 and 0.5% BAS, and scanned with the AFM.

The chip reacted with the AFP has 120 particles per element fixed with the anti-AFP antibody and 6 particles per element fixed with the anti-CEA antibody. The chip reacted with the CEA has 7 particles per element fixed with the anti-AFP antibody and 1,340 particles per element fixed with the anti-CEA antibody.

The chip reacted with the control has only 2 to 4 gold nanoparticles per element fixed with either of the antibodies.

The nineteenth embodiment may be applied in several forms as described above as examples, but in any of the forms, the hybridized sample DNAs and others are detected practically on a molecular basis and the embodiment offers a sensitivity far exceeding the conventional method. As an ultra small amount of DNAs or RNAs with an ultra small bulk can be detected, target DNAs or RNAs can be detected without PCR amplification as a pretreatment, which is not possible with the conventional method. Further, as the size and form of marker particles can be changed for identification, some 6 to 10 different samples can be multi-analyzed on the same element. This technique can be applied to conventional differential hybridization, as well as to the detection with different marker probes after sample polynucleotides are captured to the element with a single type of probe. The multi-analysis technology of the nineteenth embodiment offers an advantage of detecting alternative splicing and of typing a plurality of SNPs with a single element.

FIG. 104 is an oblique perspective view illustrating construction of an AFM cantilever suitable for use with the nineteenth embodiment. The AFM cantilever 97130 can be formed to have a plurality of needles 97131-97134 lined up in array. The needles 97131-97134 are independently fit to levers 97141-97144, each attached with a piezoelectric element 97151-97154, and with the up-and-down movement of the needles, electromotive force of the piezoelectric elements changes and can be detected. By using a cantilever with an array structure, a plurality of lines can be scanned at a time. Therefore nanoparticles captured on the chip can be detected very fast. Further, it is possible to take advantage of the speedy scan by scanning the same part a plurality of times, in order to reduce tracing errors of figuration. Specifically, by scanning N times, the measurement error in the direction of height can be reduced to 1/√N. In the embodiment according to the present invention, a cantilever with 10 needles is used and the scans are repeated 16 times to calculate values in the direction of depth. With this method, a 1 mm×1 mm chip with 10,000 elements can be scanned in 30 minutes.

Twentieth Embodiment

A twentieth embodiment of the present invention describes a method for detecting a DNA molecular captured by a chip with high resolution like the nineteenth embodiment, but using a scanning electron microscope which detects a shape of a substance by tracing with an electric beam instead of the atom force microscope employed in the nineteenth embodiment. Though the scanning electron microscope can resolve and discriminate between a single-stranded DNA and a double-stranded DNA (with around 3 nm in diameter), the scanning electron microscope uses a nanoparticle as a marker which is easier to detect for enabling scanning at a higher speed.

FIG. 105 is a view schematically showing a more detailed relation between the element 10501 and the pillar 10502 on the substrate 105101 illustrated in FIG. 97, and also the relations among DNA probes 10521, 10522, . . . fixed on each element 10501, DNA pieces 105201, 105202, and 105203 obtained by hybridizing the DNA probes above, and a scanning electron microscope 105300. The scanning electron microscope 105300 includes an electron gun 105300-1, a condenser lens 105300-2, a scanning coil 105300-3, a detector 105300-6, and the like. Electrons of an electron beam 105300-4 irradiated from the electron gun collide with specimens (gold particles coupled to the DNA pieces 105201, 105202, or 105203), then the specimens release secondary electrons 105300-5, and then the detector 105300-6 captures the secondary electrons. Each element 10501 on the substrate 105101 is at a higher position than a surface level of the substrate 105101. Namely the elements 10501 each with the height of 20 nm are divided and bordered by a groove.

As understood from comparison of FIG. 105 to FIG. 98, the twentieth embodiment is equal to the nineteenth embodiment except for the tracing method for which the twentieth embodiment uses the electron beam 105300-4 in place of the exploring needle 10560 of the atom force microscope employed in the nineteenth embodiment. Therefore the DNA chip preferable to the twentieth embodiment is the same DNA chip used in the nineteenth embodiment shown in FIG. 97. Similarly the same method described in the nineteenth embodiment is applicable to the twentieth embodiment in the preparation for DNA probe and specimen.

FIG. 106 is a view schematically showing a scanning electron microscope image obtained by two-dimensionally scanning with the electron beam 105300-4 of the scanning electron microscope 105300. Reference numerals 10511 and 10512 indicate elements corresponding to the element 10501 shown in FIG. 105. Reference numerals 10541, 10542, . . . , 10546 indicate pillars arranged at the four corners of the elements 10511 and 10512, corresponding to the pillar 10504 described in FIG. 105, different from each other in size. Reference numerals 10551, 10552, and 10553 indicate gold nanoparticles, with 8.3 nm, 11 nm, and 17 nm in size respectively. Although there are other gold particles without any reference numeral, in the figures only the gold particles each with a reference numeral are shown. The scanning electron microscope used in the twentieth embodiment builds up an image only from substances emitting secondary electrons when exposed to the electron beam, and substances not emitting secondary electrons do not appear in the image. Therefore the pillar, the element, and the gold nanoparticles appear in the image built up by the electron microscope in the twentieth embodiment, while the probe, the DNA pieces hybridized thereto, and a polymer molecule or salt contained in the hybridization buffer do not appear in the image.

With the twentieth embodiment, substances can be detected by detecting the secondary electron due to exposure to the electron beam, so that the substances can be measured independent of the wavelength. Therefore in a case where the element 10501 or the gap between elements is 700 nm or bellow, the microscope can detect the element and the edge thereof. Though in Example 1, the element 10501 is 700 nm φ and the gap between the elements is 300 nm, a structure with the finer element 10501 or gap therebetween is acceptable. For instance even in a case where the element 10501 is 500 nm or bellow or the gap therebetween is 300 nm or bellow, the gold particles with 8.3 nm in size on the element 10501 captured through the hybridization reaction can be detected by the scanning electron microscope with a fixed quantity.

The lower limit of the element 10501 and the gap therebetween is 70 nm because of the reason described bellow. As described above in a case where a probe with around 50 bases is fixed, the probe fixing density is around one molecule in 15 nm2. While a lower limit of a nanoparticle used for detection is 5 nm in size, based on the lower limit in size to be available in common under the current state of the art, which is approximately equal to the value of the probe fixing density. This value is recognized to be a criterion for the lower limit. Though in an actual case, in the light of the fixed quantity detection, at least 1000 particles are required to be placed on the element 10501. Namely, the lower limit of the element 10501 is 15×1000 nm in size, and the diameter of the round element 10501 is at least 70 nm. Needless to say in a case not considering the fixed quantity detection, the smaller element can be used. In this case the lower limit becomes an area where one molecule of the probe to be fixed occupies, indicating that the smallest unit of the element is 3 nm.

Twenty-First Embodiment

A twenty-first embodiment discloses a DNA probe chip speeding up hybridization on the surface of a solid chip, capable of measurement in a short time, highly sensitive, and having less pseudopositive hybridization, a method of making the same, and a method of hybridization on the DNA probe chip.

Specifically, this embodiment suggests;

1) The probe should be fixed on the surface of the electrode configured to concentrate the target polynucleotide adjacent to the electrode on which the probe is fixed, and
2) The probe should be configured to have negatively dissociated residues on the free end so that the probe rises quickly when the target polynucleotide concentrated adjacent to the electrode is diffused.

In addition to the above, as a further improved embodiment;

3) By making the fixed end of the probe to be GC-rich, the probe allows the hybridization of the target polynucleotide to the risen probe to advance from the board side to the free end side. This restrains steric hindrance by adjacent probes and solid surfaces, and
4) In order for the target polynucleotide easily to hybridize the probe by using a probe removed of the negative charge from the principal chain,
The probe speeds up hybridization on the surface of a solid chip, is capable of measurement in a short time and highly sensitive, and having less pseudopositive hybridization.

With consideration of the hybridization process of the probe and the target polynucleotide, in order to implement the hybridization effectively, the following points must be considered.

1) According to the DNA probe chip, the probe is fixed on the solid surface and the hybridization of the probe and the target polynucleotide is substantially a complementary strand coupling reaction on the solid-liquid interface. For this reason, in order for the target polynucleotide in solution to collide the probe, the target polynucleotide must be diffused to reach the solid-liquid interface.

It is necessary to sufficiently stir the solution or to add a concentration gradient to the target polynucleotide to increase the concentration in the area adjacent to the solid-liquid interface until the target polynucleotide reaches the diffusion zone on the surface of the solid. Nevertheless, because simply stirring the solution depends on the diffusion coefficient of the target polynucleotide, it takes much time to attain thorough diffusion.

According to the twenty-first embodiment, the surface of the DNA probe chip (the solid surface where the probe is fixed) has the positive charge to electrostatically draw the target polynucleotide having negative charge to the surface of the DNA probe chip. This results in the concentration gradient of the target polynucleotide directing from the solid-liquid interface between the surface of the DNA probe chip and the sample solution including the target polynucleotide to the sample solution. Namely, the closer it is to the surface of the DNA probe chip, the higher the concentration of the target polynucleotide is. The positive charge of the surface of the DNA probe chip can be achieved by either preparation by introducing the positively dissociating residue (positive charge) to the surface of the DNA chip or providing electrodes on the surface of the DNA probe chip and in a portion of the sample solution away from the surface of the DNA probe chip and applying voltage thereto so that the surface of the DNA chip has the positive charge.

2) The probe on the DNA probe chip and the target polynucleotide are both negatively charged polymers. It is considered that, in the process of forming the hybridization, a portion of the probe and target polynucleotide most easily hybridized becomes a core to form the hybridization, and that full hybridization is completed by spreading the region. What must be considered in this case are the effect by the surface of the DNA probe chip and the steric hindrance by the probe.

For instance, comparing known Nucleic Acids Research, 29, 5163-5168 (2001) and Langmuir, 16, 4984-4992 (2000), it can be understood that having more probes is thermally advantageous for hybridization under the condition where the probes are sufficiently non-dense, but that the repulsive force of the charge on the adjacent probe reduces the efficiency of hybridization where the density is 7 nm or lower. Also, though not described therein, the steric hindrance reduces the efficiency of hybridization.

From a macro viewpoint, there will be an optimal probe density. However, according to the twenty-first embodiment, since the target polynucleotide is forced to exist in a high density adjacent to the probe to hit the probe, there will not exist the optimal probe density as observed from the macro viewpoint. Namely, in the twenty-first embodiment, the hybridization starts from the state where the target polynucleotide has reached the probe on the surface of the chip. Therefore, it is noticeable that the hybridization efficiency varies depending on whether the tip of the probe becomes the core of hybridization or the foot of the probe (surface of the chip) becomes the core.

Namely, in the case where the tip (free end) of the probe becomes the core of the hybridization, a huge molecule of the target polynucleotide may sterically disadvantageously collide an adjacent probe or surface of the chip in the process of looping around the probe DNA (forming a double strand) to slow down looping. On the contrary, in the case where the foot of the probe (surface of the chip) becomes the core of the hybridization, the target polynucleotide loops around the probe (forming a double strand) away from the chip surface. In this case, there is little steric hindrance because the hybridization advances in the direction away from the surface of the chip. Further, because an adjacent probe does not have the target polynucleotide looped around the tip, there is little hindrance.

With reference to drawings, the embodiment is described more specifically below.

Example 1

FIG. 107A is a plan view showing a DNA probe chip 107100 advantageously applicable to a twenty-first embodiment of the present invention, and FIG. 107B is a cross-sectional view showing the DNA probe chip 107100 shown in FIG. 107A taken along the line A-A and viewed in the direction indicated by the arrow.

The reference numeral 10701 is a float glass (20×40 mm) used as a DNA probe chip substrate. The reference numeral 10702 is an electrode deposited on the surface of the substrate 10701. The electrode is made of ITO (Indium-Tin Oxide) with the size of 10×10 mm and 10 nm thick. The reference numeral 10703 is a 10-nm thick fluorinated surface coating formed on the surface of the ITO electrode 10702. The reference numeral 10704 is a probe-fixing region where the surface of the electrode 10702 is exposed by periodically removing the fluorinated surface coating. While the probe-fixing region 10704 is indicated by 4×4 pieces of large circles on FIG. 107A, the actual size of the probe-fixing region 10704 is regarded to be about 30 μmφ diameter and, for instance, 100×100 regions are provided. Two adjacent probe-fixing regions 10704 are spaced from each other by about 60 μm and the fluorinated surface coating is provided between the adjacent probe-fixing regions 10704 to establish independency of each probe-fixing region 10704.

The fluorinated surface coating 10703 provided on the surface of the electrode 10702 is introduced in order to prevent a cross-contamination between the adjacent probe-fixing regions 10704. Since prespecified probe solution is applied to each probe-fixing region 10704 by a pin array device in the order of several hundred pl, the fluorinated surface coating must be water repellent so that the probe solution will not run off from the region. The probe-fixing region 10704 can be produced by ashing by oxygen plasma using a mask and removing the fluorinated surface coating from the surface having the fluorinated surface coating 10703 applied thereto by the printing technique. The probe-fixing region 10704 is produced by the oxygen plasma ashing, and the ITO electrode 10702 exposed in the region is hydrophilic.

There is described below a method of fixing the probe on the surface of the ITO electrode 10702 in the probe-fixing region 10704. Since the surface of the ITO electrode 10702 is in the oxidation state, the DNA probe is fixed using the silane coupling reaction. The condition for implementation of the DNA probe fixing, or the composition of the buffering solution and the sample DNA probe follows a method of hybridization described in Nucleic Acids Research (2002) 30, No. 16 e87. For the method of fixing the probe, based on the reference described above, the ITO electrode 10702 is processed by 3-aminopropyl-trimethoxysilane and the amino group is introduced to the surface. The amino group introduced to the surface is bridged to the SH group on the probe using N-(11-maleimidoundecanoxyloxy)succinimide. When a probe of about 50 bases is fixed by this method, the probe fixing density is about one molecule per 15 nm2.

Otherwise, according to another method by A. Kumar, et al. as described in (Nucleic Acids Research (2000) 28, No. 14 e71), the probe may be fixed by applying the silanized DNA probe having the trimethoxysilane residue introduced in advance to the 5′ end of synthetic oligonucleotide to the surface of the ITO electrode 10702 in the probe-fixing region 10704.

Example 2

FIG. 108A is a view showing the state in which a sample liquid including a target polynucleotide is introduced on a surface of the DNA probe chip 100 described with reference to FIGS. 107A and 107B, FIG. 108B is a view showing the state in a first step of a process for forming a concentration gradient of the target polynucleotide from a solid-liquid interface between a surface of the DNA probe chip 107100 and of a sample liquid toward a sample liquid, and FIG. 108C is a view showing the state in the next step for forming the concentration gradient as a cross-sectional view.

A suitable spacer (not shown) is inserted onto the surface of the DNA probe chip 107100 to provide a 0.1-mm gap and a cover glass 10711 is placed thereon. A 100-nm thick ITO electrode 10715 is provided on the internal surface of the cover glass 10711. 40 microliter of mRNA sample solution 10750 is applied to the gap between the surface of the DNA probe chip 107100 and the cover glass 10711. The sample solution 10750 allows a slide glass to reciprocate at a constant speed to be stirred thereby. FIG. 108A shows such a state, and each reference numeral 10712-1, 10712-2 and 10712-3 is a probe fixed on the probe-fixing region 10704. The reference numeral 10714 is a target polynucleotide diffused in the sample solution 10750. In this state, the target polynucleotide only diffuses based on the diffusion coefficient of the target polynucleotide.

FIG. 108B is a view showing the state where the electric field is applied between the electrode 10702 on the DNA probe chip 107100 and the electrode 10715 on the cover glass 10711 by a power supply 10725 achieve +15 V/cm (substantially 0.15 V between the electrodes) so that the electrode 10702 is positive. As a result, by achieving the positive charge on the surface side of the DNA probe chip, the target polynucleotide 10714 and probes 10712-1, 10712-2 and 10712-3 having the negative charge are electrostatically attracted to the surface of the DNA probe chip. The electrode 10715 does not have to be stuck on the cover glass 10711 but has only to be located apart from the surface side of the DNA probe chip in the sample solution 10750.

FIG. 108C is a view showing the state where the electric field is applied between the electrode 10702 on the DNA probe chip 107100 and the electrode 10715 on the cover glass 10711 by a power supply 10726 to achieve +15 V/cm (substantially 0.15 V between the electrodes) 30 seconds after the power supply 10725 applies voltage so that the electrode 10702 is negative and stirring is continued 0 to 30 minutes. Since the electrode 10702 becomes negative, the target polynucleotide 10714 and probes 10712-1, 10712-2 and 10712-3 having the negative charge and electrostatically attracted to the surface of the DNA probe chip leave from the surface of the DNA probe chip. The probes 10712 leave in a short time due to the shortness, and the target polynucleotide 10714 takes time to leave, and therefore the concentration of the target polynucleotide 10714 in the sample solution 10750 is higher on the side of the surface of the DNA probe chip.

Namely, as shown in FIG. 108C, when the electric field inverts, there occurs a repulsive force against the negative charge in the probe 10712 and the negative charge in the target polynucleotide 10714, which works in the direction away from the surface of the DNA probe chip. The probe 10712 tries to move away faster because of the shortness (smallness) compared with the target 10714, but, being fixed on one end, the probe molecule quickly rises from the chip surface as a straight chain. On the contrary, the target polynucleotide has so large a molecule that the motion is slow and the target polynucleotide stays on the surface of the DNA probe chip for a longer time. Namely, the concentration of the target polynucleotide is higher in an area adjacent to the fixed end of the probe than in an area adjacent to the tip.

Namely, FIG. 108C shows the state before the hybridization starts, where the probability of the hybridization of the target polynucleotide with the probe is higher at the root of the probe than at the tip. Thus it is more likely to randomly form the core of the hybridization in a portion of the probe close to the chip surface, the hybridization advances in the direction from a portion of the probe close to the substrate to the tip, and the target polynucleotide effectively hybridizes with the probe on the surface of the DNA probe chip.

FIG. 109 is a view showing the effect in Example 2. In order to evaluate the target polynucleotide captured by the probe 10712 as described with reference to FIGS. 108A, 108B and 108C, the target polynucleotide is coupled with gold particles and observed varying the time to capture the target polynucleotide using a condition of the electric field applied to the DNA probe chip as a parameter. After cleaning and drying the chip, the number of the gold particles left on the surface was counted using a scanning electron microscope. A lateral axis indicates the time of applying the electric field, and the longitudinal axis indicates the counted number of the gold particles.

A characteristic curve 101 indicates the result of the DNA probe chip capturing the target polynucleotide when −15 V/cm electric field is applied between the electrodes 10702 and 10715 by the power supply 10726 after +15 V/cm electric field is applied by the power supply 10725, a characteristic curve 107102 indicates the result of the DNA probe chip capturing the target polynucleotide when no electric field is applied as a control, and a characteristic curve 107103 indicates the result of the DNA probe chip capturing the target polynucleotide when +15 V/cm is applied by the power supply 10725 but −15 V/cm is not applied by the power supply 10726, respectively. The time of applying the first +15 V/cm in the cases of 107101 and 107103 herein are the same.

As clarified by the characteristic curve 107101, firstly the +15 V/cm electric field is applied between the electrodes 10702 and 10715 by the power supply 10725 to electrostatically attract the target polynucleotide 10714 and probes 10712-1, 10712-2 and 10712-3 having negative charge to the surface of the DNA probe chip. Next, −15 V/cm electric field is applied between the electrodes 10702 and 10715 by the power supply 10726 to detach the target polynucleotide 10714 and probes 10712-1, 10712-2 and 10712-3 having negative charge from the surface of the DNA probe chip. By this procedure, the concentration of the target polynucleotide 10714 in the sample solution 10750 is higher on the side of the surface of the DNA probe chip, which results in indicating that the target polynucleotide has been efficiently captured. As also seen from the drawing, since the capturable target polynucleotide becomes saturated as the hybridization advances to a certain degree, it is unworthy to continue the hybridization reaction for a long time.

While this embodiment uses gold nanoparticles as a marker, a sequence code 10711 labeled by Cy3 fluorescent material may be used as a sample to result in the similar tendency. Namely, in the case the fluorescent marker is used, the longitudinal axis in FIG. 109 may be replaced by the relative fluorescence intensity.

By only applying +15 V/cm electric field between the electrodes 10702 and 10715 by the power supply 10725 to electrostatically attract the target polynucleotide 10714 and probes 10712-1, 10712-2 and 10712-3 having negative charge to the surface of the DNA probe chip, even if the electric field is removed, the attracted probes do not line up in order as shown in FIG. 108C, therefore it is difficult to advance the hybridization reaction.

When no voltage is applied, since there does not occur the concentration gradient of the target polynucleotide 10714 in the sample solution 10750, the capture rate of the target polynucleotide 10714 is naturally low.

In order to charge the surface of the DNA probe chip positive, it is achievable not only by disposing the electrodes on the surface of the DNA probe chip and in a portion of the sample solution away from the surface of the DNA probe chip and applying voltage to charge the surface of the DNA probe chip positive as described above, but also by preparation by introducing the positively dissociated residue (positive charge) to the surface of the DNA probe chip. A reference numeral 10706 in FIG. 108B (an indication of + and a surrounding circle) indicates the positively dissociated residue (positive charge). In the case where the surface of the DNA probe is charged positively by introducing the positively dissociated residue (positive charge) to the surface of the DNA probe chip, the electric field applied from the outside may be only an electric field for inversion as shown in FIG. 108C.

Example 3

In Example 3, hybridization of a probe with a target polynucleotide is illustrated. In this example hybridization is performed taking into consideration an effect of a nuclear for hybridization and a direction of the hybridization.

FIG. 110A is a view schematically showing the situation in which a probe 10712-3 and a target polynucleotide 10714 hybridize with each other using a root portion of the probe 10712-3 (a portion close to a surface of the DNA probe chip) as a nuclear for hybridization, and FIG. 110B is a view schematically showing the situation in which the probe 10712-3 and the target polynucleotide 10714 hybridize with each other using a tip portion of the probe 10712-3 (a portion close to a free terminal of the DNA probe chip) as a nuclear for hybridization.

In FIG. 110A and FIG. 110B, reference numerals 10721 and 10722 indicates a portion which functions as a nuclear for hybridization. With reference to FIG. 110A, when a side where the probe is fixed, namely a root portion (a surface of the tip) of the probe is used as a nuclear for hybridization, the target polynucleotide twists around the probe (forming a double strand) at a direction of spacing away from the surface of the tip. In this case, there is little steric interruption since hybridization is developed to the direction of spacing away from the surface of the tip. Further, it could be well understood that there is little interruption also from a situation that the target polynucleotide is not twisted around a tip portion of nearest-neighbor prove. On the other hand, with reference to FIG. 110B, when the tip portion (a free terminal) is used as a nuclear for hybridization, macromolecule of the target polynucleotide collides with a nearest-neighbor probe or the surface of the tip under a process of twisting around the probe DNA (forming a double strand) and it could be well understood that twisting speed becomes slow due to this steric interruption.

For making a root portion (a surface of the tip) of the probe function as a nuclear for hybridization, it is useful to draw the target polynucleotide 10714 in the sample liquid 10750 to the surface of the DNA probe tip, and also to make larger the concentration gradient of the target polynucleotide 10714 in the sample liquid 10750 near the surface of the DNA probe tip as described. In this example, descriptions are provided for an example in which the root portion (a surface of the tip) of the probe is used as a nuclear for hybridization by devising a sequence of the probe.

As a probe, a sequence of 50-base length from human mRNA sequence is extracted for use. The 20-base segment near a substrate and another sequence segment having more than 15% GC content different from the remaining portion are used preferentially. Namely GC content near the 20-base segment is made higher. If this kind of modification is impossible in the sequence, the probe sequence is designed with a sequence mismatching the cDNA sequence forming a template from a position around the 10th base up to a position around the 30th base each from the free terminal or a blank sequence not forming a stable complementary strand with any ACGT is used for designing the probe sequence. But the mismatch sequence and the blank sequence can be inserted at maximum two places in this range because excessive insertion lowers the stability. It is important to control the stability of hybridization in the manner as described above for forming a nuclear for hybridization near a fixed terminal of the probe.

As a specific example, a complementary sequence (SEQ No. 10) for the segment sequence of bases 918 to 967 of mRNA of PON1 (Homo sapiens paraoxonase 1) is used as a probe sequence:

5′-AAAAUCUUCU UCUAUGACUC AGAGAAUCCU CCUGCAUCAG AGGUGCUUCG-3′: (SEQ No. 9)

5′-CGAAGCACCT CTGATGCAGG AGGATTCTCT GAGTCATAGA AGAAGATTTT-3′: (SEQ No. 10)

In this example, in order to compare a case in which a nuclear for hybridization is formed near a surface of the substrate to a case in which a nuclear for hybridization is formed far from a surface of the substrate, a probe having the base sequence of SEQ No. 10 is fixed at the 5′ terminal thereof to the probe fixed domain 10704 of one DNA probe chip using any of the methods described above. At the same time, a probe having a base sequence of the same SEQ No. 10 is fixed at the 3′ terminal to the probe fixed area 10704 of other DNA probe chip. When a sequence of the probe 10702 is divided to units each including 10 bases and GC % in each unit including 10 bases is calculated, it is observed that the CG % is 60%, 60%, 40%, 40% and 20% from the side of 5′ terminal. Namely, when this probe is fixed at the 5′ terminal thereof and is used for hybridization, 20 mer in the side of the 5′ terminal is hybridized first, and the hybridization area extends from the portion above as a nuclear for hybridization to the 3′ terminal of the probe. On the other hand, this probe is fixed at the 3′ terminal and is used for hybridization, 20 mer in the 5′ terminal, namely in the free terminal of the probe hybridizes first, and hybridization area extends to the side of the 3′ terminal (a surface of the tip) of the probe using this area as a nuclear.

A method for preparing a sample for hybridization will be described below. A synthetic single-stranded DNA is used as a sample. The model employed in this example has the full length of 90 bases and has a complementary sequence for SEQ No. 2 at the core portion and the core portion is conjugated at both terminals thereof to poly A (indicating as A20) including 20 bases.

5′-A20-AAAATCTTCT TCTATGACTC AGAGAATCCT CCTGCATCAG AGGTGCTTCG-A20-3′: (SEQ No. 11) Gold nanoparticle having a diameter of 10 nm is conjugated to either the 5′ terminal or 3′ terminal. The gold nanoparticle can be labeled by introducing alkane SH into either the 5′ terminal or 3′ terminal when a sample is synthesized.

FIG. 111 is a view showing a comparison between a result obtained when a sample with SEQ No. 11 is processed with the DNA probe chip with the probe with SEQ No. 10 fixed at the 5′ terminal thereof (as indicated by a characteristic curve 107111) and a result obtained when the sample with SEQ No. 10 is fixed at the 3′ terminal thereof (as indicated by a characteristic curve 107113). The conditions employed in this comparison are the same as those in FIG. 109 showing a result of Example 2 excluding the conditions for applying an electric field.

Namely, when the probe with SEQ No. 10 is fixed at the 5′ terminal thereof, 20 mer at side of 5′ terminal (a surface of DNA probe chip) is hybridized first, and then the hybridization area extends a side of probe 3′ terminal using this area as a nuclear, thus hybridization being developed rapidly as described in FIG. 110A. On the other hand, when this probe is fixed at the 3′ terminal thereof and is used for hybridization, the 5′ terminal, namely the free terminal of the probe of 20 mer is hybridized first, and then using this point as a nuclear, the hybridization area extends to the side of the 3′ terminal of the probe (a surface of the tip), thus hybridization being developed slowly as described in FIG. 110B.

FIG. 111 specifically illustrates the above statement.

In this example, gold nanoparticle is used for a labelling, but when the SEQ No. 11 labeled with Cy3 fluorescent material is used as a sample, a result indicating the same tendency can be obtained.

Example 4

For forming a nuclear for hybridization in the neighborhood of the substrate more easily, as described in the Example 2, it is one of the important items to make a probe act quickly. Example 4 relates to the probe which is designed based on this viewpoint.

FIG. 112 is a view schematically showing a case of where the probe in Example 4 is used in the case shown in FIG. 110A showing the situation in which a probe 10712-3 and a target polynucleotide 10714 hybridize with each other using a root portion of the probe 10712-3 (a portion close to a surface of the DNA probe chip) as a nuclear for hybridization.

In Example 4, an excessive amount of dissociation group 10724 is introduced into the terminal in the opposite side (free terminal) against to the fixed terminal where the probe 10712-3 is fixed on the surface of the DNA probe chip. As the dissociation group 24, a negatively charged group such as sulfuric acid group or phosphoric acid group may be used. A larger effect can be obtained by using molecules or particles containing a large amount of minus residue of the dissociation group 10724. Because the free terminal of the probe 10712-3 has a minus charge, as described in FIG. 108B, after attracting the target polynucleotide 10714 and the probe 10712-3 to the surface portion of the DNA probe chip electrostatically by the surface portion of the DNA probe chip positively charged, an electric field is reversed by the power source 10726, and then a stronger repelling force acts with the negative charge 10724 at the probe tip, so that the probe 10712-3 acts quickly.

Also when the positively charged residue 10706 is constantly introduced to the surface portion of the DNA probe, the same effect is obtained. So long as any specific operation is not performed to the surface portion of the chip, as the surface portion is always kept with a positive charge because of the introduced positive static charge, the probe and the target polynucleotide 10714 are absorbed on the surface portion as described in FIG. 108B. In this situation, by adding minus charge that is more than that enough for canceling the positive charge on the surface of the electrode 10702 as well as the opposite electrode 10715 on the chip surface, the probe with an excessive amount of minus charge introduced to the fee terminal side quickly acts. The target oligonucleotide 10714 has the larger size than the probe 10712-3 and moves more slowly, so that a nuclear for hybridization is formed at a position closer to the probe substrate, and hybridization develops towards the probe tip. For making the system described above act effectively, it is preferable that the probe should preferably have the 30 to 50-base length.

Example 5

In order to make the twenty-first embodiment of the present invention more effective, it is preferable to eliminate a charge of probe itself and introduce a large amount of minus charge to the free terminal of the probe. For instance, PNA (Peptide Nucleic Acid) in which a phosphodiester bond of synthetic oligonucleotide is changed to a peptide bond, or CAS (Cysteine Antiesnse Compound) which includes S-carboxydimethyl-L-cysteine as a base frame may be used as a non-charged probe.

Since main chains of the polymer PNA and CAS have no charge, an electrostatic repelling force does not work with the target polynucleotide. As they have amino group and carboxyl group on the terminals thereof respectively, when an amino group is used at the fixed terminal, the fee terminal is naturally changed to a negatively charged carboxyl group. Further it is possible to make the probe act quickly in response to the electrode on the surface of the substrate by introducing a large amount of minus charge with residues having minus charge like in Example 4. As the PNA and CAS do not have an electric charge in the main chain, a repelling force does not work with the target polynucleotide. When a space for hybridization is provided by making the probe act, the probe is quickly hybridized with the target polynucleotide 10714.

When the PNA and CAS are fixed as a probe, the following process is employed. An activate silanol group is formed by hydrolysis of a methoxy group by keeping 0.5% solution of 3-glycidoxypropyltrimethoxysilane for 30 minutes at the room temperature (25° C.) (0.5% of acetic acid is included as a catalyst. When the silane coupling agent cannot be dissolved, acetic acid is added until the silane coupling agent is dissolved). This activate silanol solution is coated on the substrate surface and keep at the room temperature for 45 minutes. A substrate having an ITO-electrode with glycidoxypropyl group introduced therein with covalent bond is obtained by blowing off remained solution on the substrate after washing it with pure water and then heating the substrate at 105° C. for 30 minutes in the air. A part of the atomic group constituting the introduced glycidoxypropyl group is epoxy group with high reactivity with an amino group. A mixed solution containing 10 pmol/μl of PNA or CAS having the amino group and 25 to 100 μM of Lys, pH 10 is coated on the substrate. Lys is mixed in the solution for the purpose to fix the PNA or the CAS on the substrate uniformly and also to prevent the fixing density of the PNA or the CAS from being too high (when only the PNA or the CAS is mixed in the solution without Lys, the substance attacks a surface of ITO, and places with high mixing density and low mixing density are generated as islands). The solution is reacted for one hour at 50° C. With the reaction described above, a probe chip with the PNA or the CAS fixed thereon can be obtained.

A substrate surface obtained from the above probe fixation is electrically neutral. Next, a method for preparing a positively charged is described below. 25 to 100 μM arginine oligomer (L-Arg)6 is mixed in and reacted to the DNA probe used in the method described above. When the probe is the PNA or the CAS, arginine oligomer is added in place of Lys. Thereby, a probe chip having a positively charged substrate surface can be obtained.

Even when controlling the electrode by applying an electric field thereto like in Example 2, an effect of the electric field is not remarkable since a probe to be fixed has no electric charge. However, when a sulfonic acid group is introduced to the free terminal of probe, the same effect is obtained as that obtained by introduction of an excessive mount of dissociation group 10724 described in Example 4, and an extremely high speed hybridization can be carried out. When a sample liquid is added, the target polynucleotide having minus charge in the sample liquid is condensed on the ITO-electrode surface with the probe fixed thereon because of the plus charge on the substrate surface. When the electric field is reversed, minus charge of the sulfonic acid group introduced into the fee terminal of the probe repels the electric field, so that the probe acts quickly. Also in this example, like in Example 3, when the probe is fixed to be GC rich near the substrate, hybridization progresses faster with the yield higher.

Twenty-Second Embodiment

A twenty-second embodiment of the present invention provides a device of and a method of preparing a DNA probe chip having the features of improved hybridization rate performed on a surface of a solid-state chip, as described in a twenty-first embodiment above, being measured in a shorter time, having higher sensitivity, and having less possibility of performing pseudo-positive hybridization, and a method of performing hybridization in the DNA probe chip thereof. In the twenty-first embodiment, the improvement can be achieved mainly by adding dissociation groups each having negative charge to one end of the DNA probe which is the opposite to the other end fixed to the probe fixed area of the DNA probe. In this twenty-second embodiment, an improvement can be achieved by dividing a whole DNA probe area into three areas and modifying the base sequence of the area closest to a fixed end of the DNA probe thereof so that the base sequence thereof becomes complementary to the base sequence of the target polynucleotide thereof. Apart from this feature, the twenty-second embodiment is the same as the twenty-first embodiment.

FIG. 113 is a view schematically illustrating a status that one end of probe [11312-1 is fixed to a probe fixed area 11304 according to the twenty-second embodiment. The DNA probe [11312-1 is divided into areas in order from the probe fixed area 11304. The sequence of the probe is divided into at least three areas, and the hybridization stability of each area is independently controlled. More specifically, modifications are made so that the hybridization stability of the area closest to the probe fixed 11304 should be higher than that of any other areas. The length of a first area 11333-1 which is closest to the probe fixed area 11304 is approximately 15 to 20 bases long, and the sequence of the area is substantially complementary to the base sequence of the target polynucleotide thereof. The length of a second area 11333-2 is 15 to 20 bases long, and at least one third of this area included therein are base sequence, indicated by the reference numeral 11327, that would not form any complementary hydrogen bonding with any of A,C,G, and T base sequence or should be non-complementary to the target polynucleotide thereof. The base sequence of a third area 11333-3 is substantially complementary to the target polynucleotide thereof. But it is important that the hybridization stability of the third area should be lowered than that of the first area, for instance, by making the length of the third area shorter than that of the first area.

In the probe 11312-1 that has been modified as described above, the hybridization stability of the first area is higher than that of the second and third areas. The base sequence in the third area 11333-3 is substantially complementary to the target polynucleotide thereof, so hybridization is to be performed there. But, as mentioned above, the hybridization stability of the first area is higher than that of the third area, eventually, the hybridization is to be started in the first area first.

Because of this feature, in general, the hybridization with the target polynucleotide thereof can be started in the probe fixed area 11304 of the probe first. But when the probe specificity and probe stability are taken into consideration, it is noted that the appropriate length of such probes should be in the range between 40 to 60 bases long. When the length of the first area is too long, it might become difficult to perform hybridization in or around the probe fixed area 11304 first. And there is another problem when the length of the second area is too long. It is still acceptable if the sequence of the second area is more AT-rich than that of the first area. But otherwise, it is then necessary to introduce some bases that would not perform hybridization with the target polynucleotide thereof or the other mismatch bases into the second area. This modification might affect the hybridization specificity thereof. It might be important to limit the number of bases to be modified to 1 to 3 bases out of every 9 bases. Because of this feature, the base length of the second area should be approximately 20 bases long at the maximum. The third area 11333-3 has the role to increase the hybridization stability of the first area higher than that of any other areas while the whole base length of the probe is to be adjusted as previously determined. Namely, it is most preferable that the hybridization stability level of each area should be arranged as follows: the first area>the third area>the second area. The length of the base sequence of the probe as a whole should be in the range between 30 to 50 bases long.

In one example, the sequence of 940 through 989 base portion (SEQ. ID. NO. 12) of the mRNA of PON1 (Homo sapiens paraoxonase 1) is used as the probe sequence. Obviously, the probe should be prepared chemically.

5′-AGAATCCTCC TGCATCAGAG GTGCTTCGAA TCCAGAACAT TCTAACAGAA-3′: SEQ. ID. NO. 12.

The 5′ end of the probe having the SEQ. ID. NO. 12 is fixed to the probe fixed area 11304. The sequence of the probe is divided into sections every 10 bases, and the GC-percent of each section is calculated. The results of the GC-percent of those sections from the 5′ end are 50%, 50%, 50%, 40%, and 30% respectively. Therein, the first 20 bases at the 5′ end, the next 21 to 30 bases, and 31 to 50 bases are defined herein as the first area 11333-1, the second area 11333-2, and the third area 11333-3 respectively. The GC-amount in the second area is so large that the possibility that the hybridization performed in the first area first may be decreased and the possibility that the hybridization performed in the second are first may be then increased. To correct it, the bases thereof are changed to lower the hybridization stability in the range between 20th and 30th bases thereof. In addition, the bases in the second area are apt to have a palindrome structure, so the bases are changed so as not to constitute such palindrome structure. The probe sequence after being changed as described above is given below as SEQ. ID. NO. 13.

SEQ. ID. NO. 13
5′-AGAATCCTCC TGCATCAGAG GTGBTTBGAA TCCAGAACAT
TCTAACAGAA-3′:

Therein, the base “B” should be either a pseudo-base that would not form a stable complimentary chain with any bases or a base non-complementary to the target polynucleotide thereof. For instance, either a spacer consisting of only sugar chains without having any base section therein or a pseudo-base with atoms having large atomic radius in the base section introduced therein such as 2-thiouracil is to be used. The 2-thiouracil would not be able to form a stable hydrogen bonding with Cytosine which lies in the opposite base in the sequence of the target polynucleotide thereof. The atomic radius of sulfur atoms introduced in the bases thereof is so large that it may be impossible to form hydrogen bonding with Guanine. When base “A” is introduced as the base “B”, it may cause mis-hybridization with base “C”, so base “A” can not be used. In this case, however, it is practical to change the base into “T” or 2-Thiouracil as the base “B”. To prepare mismatch bases, change the bases in the probe so that the A-G, A-A, C-C, or T-T mismatching should be prepared.

The sequence of the probe having modified sequence of SEQ. ID. NO. 13 is divided into sections every 10 bases in order, and the GC-percent of each section is calculated. The results of the GC-percent of those sections from the 5′ end are 50%, 50%, 30%, 40%, and 30% respectively. When the hybridization is to be performed with the modified probe, the hybridization starts in the 20 bases at 5′ end, and then the hybridization expands its range to the 3′ end of the probe thereof.

A method of preparing a sample for the hybridization is provided below. A synthetic single-stranded DNA is used as the sample. As a model, the sequence complementary to SEQ. ID. NO. 12 is used as the core section thereof, and Poly A (referred to as A20 hereinafter) consisting of 20 bases are bonded before and after the sequence thereof to prepare 90 bases long sequence as a whole.

(SEQ. ID. NO. 11)
5′-A20-TTCTGTTAGA ATGTTCTGGA TTCGAAGCAC
CTCTGATGCA GGAGGATTCT-A20-3′

Therein, the 5′ end of the probe is coupled with the Sulforhodamine 101, the fluorescent dye, which used to assay the hybridization.

Therein, two cases are prepared: one case is that the hybridization start on or around the surface of the probe fixed area 11304, and the other case is that the hybridization start far from the surface of the probe fixed area 411304. To compare the effects of hybridization between two DNA probe chips, two different DNA probe chips are prepared. Namely, the 5′ end of the probe with the base sequence of SEQ. ID. NO. 13 included therein is fixed at the probe fixed area 11304 of one DNA probe chip is prepared by one of the above-mentioned methods. Simultaneously, the 5′ end of the probe with the base sequence of SEQ. ID. NO. 12 included therein is fixed at the probe fixed area 11304 of the other DNA probe chip is also prepared.

With above two different DNA probe chip, the following experiment is conducted. 0.1 mm gap is created with a spacer and a cover glass is put on the chip, and 40 micro litter of DNA for fluorescent labeling according to the SEQ. ID. NO. 11 is added thereto. The sample is stirred by pumping the slide glass with the sample included therein with a constant rate. Then the electric field is applied so that the electric field at electrode 11304-1 between the electrode 11302 and the opposite electrode 11303 becomes +15V/cm (effectively 0.15 V between those electrodes). The mRNA in the sample solution is swiftly pulled to the ITO electrode section on a substrate. After 30 seconds, −15V/cm of electric field is applied to the electrode 11304-1, and the mixing continues for the period between 0 and 30 min. It is cleaned and the fluorescence (excited 545 nm, fluorescent 520 nm or more) intensity from the element surface is measured.

FIG. 114 is a view illustrating the comparison of results between two cases; one case is that the sample with the sequence of SEQ. ID. NO. 11 included therein is processed with the DNA probe chip with the probe having the sequence of SEQ. ID. NO. 13 fixed at the 5′ thereof (shown in the characteristic curve 113111), and the other case is that the same sample is processed with the DNA probe chip with the probe having the sequence of SEQ. ID. NO. 12 fixed at the 5′ thereof (shown in the characteristic curve 113113). Therein, other conditions such as applied electron field are the same as those in FIG. 109 showing the results of Example 2. Obviously, the fluorescent intensity 113111 from the element with the probe with the sequence of SEQ. ID. NO. 13 fixed thereto can increase faster than the fluorescent intensity 113113 from the element with the probe with the sequence of SEQ. ID. NO. 12 fixed thereto. This result also shows that, when stable hybridization could be performed at the 5′ end with the probe fixed thereto more easily than any other areas, the rate of the hybridization thereof would become faster. In other words, when the bases on and around the 5′ end fixed to the probe fixed area 11304 is more GC-rich than bases on and around 3′ end, the hybridization can start in the bases around the substrate and proceeds to the free end without being largely affected by the steric hindrance or the solid surface. And this is important when the DNA probe chips are designed.

Twenty-Third Embodiment

A twenty-third embodiment of the present invention discloses, like in twenty-first embodiment and twenty-second embodiment, a DNA chip enabling a higher speed hybridization on a solid chip surface and measurement within a short period of time and also rarely inducing quasi-positive hybridization, a method of preparing the DNA chip, and a method of inducing hybridization on the DNA probe chip. In the twenty-first embodiment, improvement is provided mainly by adding an dissociation group having a negative charge to a terminal different from that fixed to a probe fixing area on the DNA probe, and in the twenty-second embodiment, improvement is provided by using a DNA probe consisting of three areas and providing a sequence substantially complementary to the target polynucleotide at the area closest to the fixed edge of the DNA probe. In contrast, in the twenty-third embodiment, the improvement is provided mainly by making larger a probe fixing area of the DNA probe. Other features are the same as those in the twenty-first and twenty-second embodiments.

The twenty-third embodiment is described in detailed with reference to the related drawings.

Example 1

FIG. 115A is a plan view showing outline of a DNA probe chip advantageously available for carrying out the twenty-third embodiment; FIG. 115B is a cross-sectional view showing the outline shown in FIG. 115A taken along the line A-A and viewed in the direction indicated by the arrow; and FIG. 115C is a cross-sectional view showing details of a probe fixing area of the DNA probe chip advantageously available for carrying out the twenty-third embodiment.

Reference numeral 11501 indicates a fused quartz-glass sheet (20×40 mm) as a DNA probe chip. Reference numeral 11502 indicates and electrode, which is deposited on a surface of the substrate 11501. The electrode is ITO (Indium-Tin Oxide) having the size of 10×10 mm and the thickness of 300 nm. Reference numeral 11503 is a fluorine surface coating with the thickness of 10 nm formed on a surface of the ITO electrode 11502. The fluorine surface coating 11503 is provided to prevent cross contamination between the adjoining probe fixing areas 11504. A prespecified probe solution is applied on each of the probe fixing areas 11504 with a pin array device with the order of several hundreds pl, and therefore the water-repulsive characteristic is required for the fluorine surface coating 11503 to prevent the probe solution from overflooding from the area. The probe fixing area 11504 can be prepared by ashing a surface of the fluorine surface coating 11503 applied by printing using a mask with oxygen plasma to remove the fluorine surface coating. For preparing the probe fixing area 11504 by means of oxygen plasma ashing, the ITO electrode 11502 exposed in this area is required to be hydrophilic.

FIG. 115A shows a large disk consisting of 4×4 probe fixing areas 11504, but the actual probe fixing area 11504 has a diameter of around 30 μmφ, so that, for instance, 100×100 probe fixing areas 11504 may be provided. A space between the adjoining probe fixing areas 11504 is about 60 μm, and further the adjoining probe fixing areas 11504 are separated from each other by the fluorine surface coating.

Reference numeral 11507 indicates a pillar. To raise the reaction speed or reaction yield, it is preferable to use as many probes as possible in the probe fixing area 11504, but when the probe density is raised, the hybridization efficiency drops due to the electrostatic repulsive force. In Example 1, probes are fixed with the average space inbetween of 10 to 30 nm. A density higher than this level is not preferable in use of the ordinary polynucleotide probe, and when a probe length is as long as 50-bases polynucleotide, the density is preferably in the range from 10 to 60 nm. In the twenty-third embodiment, the probe density is not made higher, but the pillar 11507 is provided on a surface of the electrode 11502 forming the probe fixing area 11504 to enlarge the substantial area of the probe fixing area 11504, and with this configuration, it is possible to increase a number of probes fixed thereon.

The pillar 11507 is formed on a surface of the ITO electrode in the probe fixing area 11504 by applying the epoxy-based rein SU8 with a spinner on a surface of the substrate 11501 having the fluorine surface coating 11503 thereon and irradiating light thereon with a mask. Height of the pillar 11507 is 50 μm and a diameter of the base section is 10 μm. A space between the pillars 11507 is 15 μm. As compared to the case in which probes are fixed without providing the pillars, the probe fixing area can be increased about 7 times. Reference numerals 11505-1, 11505-2 are elements each indicating a group of pillars 11507 formed on the probe fixing area 11504.

It is conceivable to employ the sand blast method to increase a surface of the probe fixing area 11504 in stead of providing the pillars 11507, but in this case the aspect ratio can not be made larger, and the can be increased at most two times.

Two methods of fixing probes on a surface of the ITO electrode 11502 in the probe fixing area 11504 are described below. In the first method, oxygen plasma is irradiated, and then polylysine is coated with UV rays irradiated thereto to introduce an amino group into a surface of the pillar 11507. For fixing the DNA probe, a bivalent reagent is used. For instance, when N-(8-maleimidocapryloxy) sulfosuccinimide is reacted, the sulfosuccinimide at pH 8 ester portion reacts to an amino group in lysine, so that a maleimido group is introduced into a surface of the pillar 11507. When a synthetic DNA probe with an SH group introduced to the 5′ terminal is added at pH 6.5, the SH group present in the DNA probe reacts the maleimido group, and therefore the DNA probe is fixed on a surface of the pillar 11507. Alternatively, after polylysine is coated, the surface is modified with succinic acid anhydride to introduce a carboxylic group into the amino group. N-hydroxysuccinimide is ester-bonded thereto to convert the carboxylic group to an active ester. A synthetic DNA probe having an amino group at the 5′ terminal may be added to fix the probes on a surface of the pillars by means of peptide bond. In the second method, the pillars formed with SU8 are processed with oxygen plasma, and then a functional group is introduced by making use of the silane coupling reaction. When SU8 is subjected to processing with oxygen plasma, an OH group or radial oxygen is generated on the surface. These are unstable residues and decrease with elapse of time, so that the chip is immediately immersed in 0.5% N-(β-aminoethyl)-γ-aminopropyltrimethoxysilane (previously kept at the room temperature for 30 minutes to provide an activated silane coupling solution) and left in the state for one hour. After rinsed with deionized water, the reaction product is dried at a temperature in the range from 105 to 110° C. With this operation, an amino group is introduced also to the pillar section coated with SU8. The amino group is modified with succinic acid anhydride to introduce a carboxyl group into the amino group. N-hydroxysuccinimide is conjugated thereto by ester bond to convert the carboxyl group to an active ester. A synthetic DNA probe having an amino group at the 5′ terminal is added to fix the probes to a surface of the pillar by peptide bond.

Example 2

FIG. 116A shows the state in which a sample solution containing a target polypeptide therein is introduced into a surface of the DNA probe chip 115100 described with reference to FIG. 115A to FIG. 115C; FIG. 116B shows the state in which the first step for forming the concentration gradient of the target polypeptide from an solid-liquid interface between a surface of the DNA probe chip 115100 and the sample solution toward the sample solution; and FIG. 116C shows the state in which the next step for forming the concentration gradient of the target polypeptide is executed. Each state shown in the figures above is shown as a cross-sectional view.

A proper spacer (not shown) is set on a surface of the DNA probe chip 115100 and a glass cover is placed over the spacer with a gap of 0.1 mm. An ITO electrode 11515 with the thickness of 100 nm is provided on an inner surface of the cover glass 11511. 40 μl of mRNA sample solution 11550 is added between a gap between the surface of the DNA probe chip 115100 and the cover glass 11511. The sample solution 11550 is agitated by reciprocally moving the slide glass at a constant speed. FIG. 116A is a cross-sectional view showing the state, and reference numerals 11512-1, 11512-2, and 11512-3 indicate probes fixed on a surface of the pillar 11507 on the probe fixing area 11504. Reference numeral 11514 indicates target polypeptide distributed in the sample solution 11550. In this state, the target polypeptide is diffused according to a diffusion coefficient of the target polypeptide.

FIG. 116B is a cross-sectional view showing the state an electric field (actually 0.15 V between the electrodes) is applied by the power source 11525 to a section between the electrode 11502 on the DNA probe chip 115100 and the electrode 11515 on the cover glass 11511 so that the electrode 11502 is positively charged with +15 V/cm. As a result, the surface of the DNA probe chip 115100 is positively charged, so that also the probes 11512-1, 11512-2, and 11512-3 attracting the negatively charged target polypeptide 11514 electrostatically to a recess between pillars 11507 on the probe fixing area 11504 (on a surface of DNA probe chip) are attracted to the electrode, and therefore it is conceivable that, as one terminal of a probe molecule is sized, a free terminal thereof is attracted to the electrode and the probe molecule extends along a side face of the pillar. The electrode 11515 is not always required to be adhered to the cover glass 11511, and is required only to be off from a surface of the DNA probe chip in the sample solution 11550.

FIG. 116C is a cross-sectional view showing the state in which an electric field (actually 0.15 V between electrodes) is applied, in 30 seconds after a voltage is applied by the power source 11525, to a section between the electrode 11502 on the DNA probe chip 115100 and the electrode 11515 on the cover glass 11511 by the power source 11526 so that the electrode 11502 is charged with −15 V/cm and agitation is performed for 0 to 30 minutes. Because the electrode 11502 is negatively charged, the negatively charged target polypeptide 11514 having been electrostatically attracted to recess between the pillars 11507 on the probe fixing area 11504 (on the surface of the DNA probe chip) starts moving from the recess between the pillars 11507 (on the surface of the DNA probe chip) toward the electrode 11515.

In other words, as shown in FIG. 116C, when the electric field is reversed, a repulsive force works between a negative charge of the electrode 11502 and that of the target polypeptide 11514, and therefore the target polypeptide 11514 moves away from the surface of the DNA probe chip. In this step, the target polypeptide is larger and moves slowly, so that the provability of hybridization between the target polypeptide and the DNA probe fixed on a surface around a recess between the pillars 11507 becomes higher.

FIG. 117 is a view showing the effects provided in Example 2. For assessing the target polypeptide captured by the probe 11512 as described with reference to FIG. 116A, FIG. 116B, and FIG. 116C, a fluorescent coloring matter is used for labeling the target polypeptide to detect the fluorescence. Also nanoparticles such as gold colloid may be used for labeling and a number of particles is directly counted, and in this case, the tomographic technique may be used for reorganizing a plurality of images with a scan electronic microscope.

Changing a period of time for capturing the target polypeptide, amplitude of fluorescence emitted from the substrate after cleaning is examined with reference to conditions of an electric field applied to the DNA probe chip as a parameter. This figure is plotted with the horizontal axis for a period of time for application of an electric field and with the vertical axis for fluorescence amplitude.

The characteristic curve 115101 in FIG. 117 shows a result of capturing of target polypeptide by the DNA probe chip when an electric field of +15V/cm is applied by the power source 11525 to a section between the electrodes 11502 and 11515 and then an electric field of −15V/cm is applied by the power source 11526 to the section between the electrode 11502 and electrode 11515; the characteristic curve 115102 shows a result of capturing of target polypeptide by the DNA probe chip when no electric field is applied as a control; and the characteristic curve 115103 shows a result of capturing of target polypeptide by the DNA probe chip when an electric field of +15V/cm is applied by the power source 11525 to a section between the electrodes 11502 and 11515 and but an electric field of −15V/cm is not applied by the power source 11526 to the section between the electrodes 11502 and 11515. In the cases indicated by the characteristics curves 115101 and 115103, the +15V/cm is applied for the same period of time.

As clearly indicated by the characteristic curve 115101, at first an electric field of +15V/cm is applied by the power source 11525 to a section between the electrodes 11502 and 11515 to electrostatically attract the negative charged target polypeptide 11514 to the recess between pillars 11507 (on a surface of the DNA probe chip). Then an electric field of −15V/cm is applied by the power source 26 to the section between the electrodes 11502 and 11515 to electrostatically separated the negatively charged target polypeptide 11514 having been attracted to the recess between the pillars 11507 (on a surface of the DNA probe chip) from the recess between the pillars 11507 (on a surface of the DNA probe chip). By carrying out the steps above, the target polypeptide 11514 in the sample solution 11550 has the density gradient higher at a position closer to the recess between the pillars 11507 (on a surface of the DNA probe chip). This result indicates that the target polypeptide is captured efficiently. Also as understood from the figures, at a point of time when hybridization proceeds to some extent, the DNA probe chip is saturated with captured target polypeptide, so that the hybridization reaction is not required to be executed for a long time.

When the negatively charged target polypeptide 11514 is electrostatically attracted to the recess between the pillars 11507 (on a surface of the DNA probe) by applying the electric field of +15V/cm to the section between the electrodes 11502 and 11515 with the power source 11525, even if the electric field is removed, the attracted target polypeptide 11514 is not distributed on a surface of the pillar 11507 as shown in FIG. 116C, and in this case the hybridization reaction does not smoothly proceed.

When no voltage is applied, the density gradient of the target polypeptide 11514 is not generated in the sample solution 11550, and naturally the target polypeptide 11514 is not captured so well.

In the example described above, a direction in which an electric field is applied is reversed only once, but may be reversed several times. In this case the states shown in FIG. 116B and FIG. 116C are repeatedly reproduced, and the target polypeptide 11514 not hybridized yet is distributed at a higher density around the DNA probe on the surface of the pillar 11507, so that the provability of capturing the target polypeptide 11514 can be improved.

Example 3

In Example 2, there is provided no comment on with which form the DNA probe and target polypeptide should preferably hybridize with each other, but also in the twenty-third embodiment, hybridization proceeds more smoothly when a root portion of the DNA probe is used as a nuclear for hybridization. In this example, descriptions are provided for contrivance for utilization of a root portion of the DNA probe as a nuclear for hybridization.

To utilize a root (chip surface) of a probe as a nuclear for hybridization, it is effective, as described above, to attract the target polypeptide 11514 in the sample solution 11550 to the surface of the DNA probe chip to realize the density gradient of the target polypeptide 11514 in the sample solution 11550 higher at position closer to a surface of the DNA probe chip. In this example, descriptions are provided for contrivance for utilization of a root portion (chip surface) of the DNA probe as a nuclear for hybridization.

A sequence with 50-base length is extracted from human mRNA and used as a probe. The segment of 20 based near the substrate and other sequence segments with the GC rate of 15% higher than other portions are preferentially used. Namely the GC content is made higher at a position closer to the substrate. When this is impossible on the sequence, a probe sequence is designed by inserting a sequence mismatching the cDNA sequence functioning as a template or a blank sequence not forming a stable complementary chained at any of ACGT in a section from about 10th base up to about 30th base from a free edge thereof. However, when the mismatch sequence or blank sequence is inserted, the stability lowers, so that the places for insertion are at most two in this range. It is important to control stability of hybridization with the methods as described above for forming a nuclear for hybridization near a fixed edge of a probe.

FIG. 118 is a view schematically showing the state in which a terminal of the probe 11512-1 is constructed based on the concept according to the twenty-third embodiment and is fixed on a surface of the pillar 11507. When the probe having the construction as described above is used, the same effects as those provided in the twenty-second embodiment can be obtained.

Twenty-Fourth Embodiment

A twenty-fourth embodiment of the present invention, just like the twenty-third embodiment, discloses a DNA-probe chip which improves the hybridizing rate on the surface of a solid chip, is capable of measuring in a short time, has a high sensitivity, and has only a small amount of pseudopositive hybridization, and a method of manufacturing the same; and the twenty-fourth embodiment discloses a hybridization method of the DNA probe chip. As is the case with the twenty-third embodiment, the twenty-fourth embodiment improves a probe fixing region mainly by enlarging it. The other points are the same as those of the twenty-first embodiment and the twenty-second embodiment.

While referring to the views, more specific descriptions will be given below.

Example 1

The same kind of DNA probe chip illustrated in FIG. 107 describing DNA probe chip can be adopted as a chip suitable to the twenty-fourth embodiment.

FIG. 119 (A), (B) and FIG. 120 (A), (B) each shows a plan view or a cross-sectional view by focusing on and enlarging one of the probes in the probe fixing region 4 described in FIG. 107. In this embodiment, the probe fixing region 11504 has a square shape of 100×100 μm. The reference numeral 11507 indicates a pillar having a square shape with its bottom surface measuring 10×10 μm or a cone shape with a diameter of 10 μmφ. There are 7×7 pillars formed in the probe fixing region 11504 with a pitch of 15 μm. The pillar 11507 has a top face of 11507′ and a height of 50 μm. In FIG. 119, the pillar 11507 is a truncated cone; in FIG. 120, the pillar 11507 is a truncated square pyramid. In both FIG. 119 and FIG. 120, two cross sections of the pillar are the same. There is no need to form a top face of the pillar 11507; the top face of the pillar 11507 may be left sharp. When the top face of the pillar 11507 is left sharp, the pillar 11507 becomes a cone in FIG. 119, and a square pyramid in FIG. 120. According to the examples of the size described here, compared with the case in which the probe fixing region 11504 is a simple flat face, the truncated cone can obtain about 3.5 to 8 times the area of the probe fixing region and the truncated square pyramid can obtain about 4.4 to 10 times the area of the probe fixing region. These figures are calculated assuming that no probes are joined to the polar zone at the bottom of the pillar.

The number of probes fixed on the probe fixing region 11504 may be increased in order to raise reaction rate or reaction yield; however, as described above, when the probe density is raised, hybridization efficiency goes down by electrostatic repulsion. Fixing probes at high density is no good as long as ordinary polynucleotide probes are used; when a probe length is as long as 50-bases polynucleotide, it is better to have a probe length of as sparse as 10 to 40 nm. In the twenty-fourth embodiment, the probe density itself is not raised, but the area of the probe fixing region 11504 is enlarged to increase the number of the probes fixed to the probe fixing region 11504. Therefore, the probe fixing density doesn't have to be raised, but by fixing probes, for example, with a pitch of 10 to 20 nm on average, more probes can be fixed.

There are several methods of producing the pillar 11507. First, a method of using glass or silicon is to be described. A glass or silicon piece with a thickness of 100 μm is put together on the substrate 11501 with an electrode 11502 formed with vacuum evaporation and abraded to its prescribed thickness with spattering or etching. Alternatively, spattering is used to form a glass or a silicon layer with a thickness of 20 nm. After that, existing techniques are made full use of to produce a pyramid or a truncated pyramid depending on the convergence conditions of spattering electrons, while using a plurality of masks. An object of the twenty-fourth embodiment is just to enlarge an area of the probe fixing region 11504; therefore, the pillar 11507 does not have to be a complete cone, the pillar 11507 may be curled on the side a little. Even when a micro array producing method, a known technique, is used to produce a mountain with a high aspect ratio, the effect of the twenty-fourth embodiment can be obtained.

A method of producing a pillar made of plastic is described hereinafter. The surface of the electrode 11502, coated with a fluorine surface coating 11503, is coated with an epoxy resin with a spinner to a thickness of 50 to 100 μm, pressed with a quartz mold into the shape of FIG. 119 or FIG. 120 and irradiated with ultraviolet rays for polymerization.

The quartz mold is removed after polymerization. At this point, due to poor adhesiveness between the mold and the electrode 11502, a thin resin layer still remains on the bottom of the pillar 11507, that is, on the electrode surface 11502. Due to this resin layer, when the mold is removed, the molded pillar 11507 remains on the electrode 11502 together with this thin resin layer. The electrode is exposed to oxygen plasma for exposure in order to remove the thin resin layer on the electrode. At this time, the tip of the pillar becomes a little round and the pillar becomes short; however, there is no problem in carrying out the twenty-fourth embodiment. Alternatively, by contriving so that the plasma is intensively irradiated on the valley portion of the pillar using the mask, a more precise circular cone, truncated cone, pyramid and truncated pyramid can be formed.

From the perspective of the concentration of the sample DNA and the contact on the pillar sides, it doesn't matter whether the side of the cone of the pillar 11507 is round or the tip thereof is round; rather, it reduces the problems of sample DNA particles getting stuck on the tip.

On the other hand, measurement is performed by projecting the pillar 11507 vertically from the top surface to the bottom face; from the perspective of measurement, it is advantageous for the side of the cone to be inclined to a certain degree. For example, assuming the pillar 11507 is in a shape of a hemisphere with its bottom placed upward, the side close to the bottom face of the cone is nearly vertical; when projected in the vertical direction, a large number of DNA molecules are overlapped. On the other hand, the side of the cone gently describes an arc at the tip of the cone; therefore, only a small number of DNA molecules are overlapped. Considering fluorescence detection in such a cone, even when DNA molecules are caught at a certain density, the foot of the pillar and the tip thereof each has a different fluorescent density; therefore it is better that the side of the cone is not round. However, either case has both advantages and disadvantages; therefore, the detailed structure of the pillar is not taken into consideration in this embodiment.

A method of fixing the probe on the surface of the pillar 11507 is to be described. First, when a pillar material is glass or silicon, the method disclosed by T. Pastinen et al., Genome Research (1997) 7, 606-614 is revised to be used in this embodiment. With NN-disopropylethylamine used as a catalyst, 3-glycidoxypropyltrimethoxysilane is reacted at 80° C. for 16 hours in xylene solvent to introduce a glycidoxy group on the pillar surface. Alternatively, about 0.5% of acetic acid is added into a 2% solution of 3-glycidoxypropyltrimethoxysilane as a catalyst and left for thirty minutes; after activating a silanol group, the activated silanol group is applied on the surface of the pillar 11507, left for thirty minutes, rinsed with pure water and dried at 105° C. for thirty minutes so that a glycidoxy group can be introduced on the surface of the pillar 11507. Next, a fifty-base-long probe DNA having an amino group at 5′ end is reacted at pH 9 to 10 for two hours with a thickness of 50 μM. The probe DNA is then rinsed to obtain a DNA chip with the probe fixed on the surface of the pillar 11507.

When the surface of the pillar 11507 is made of an epoxy resin, oxygen plasma or UV ozone is used to treat the surface. An OH group or oxygen radical is generated on the surface of the pillar 11507. Because the OH group and oxygen radical are unstable residues, they are reduced over time; therefore, the surface of the pillar 11507 is immediately dipped in a 0.5% N-(β-aminoethyl)-γ-aminopropyltrimethoxy silane solution (left at room temperature for thirty minutes to become an activated silane coupling solution) and left for one hour. After rinsing in pure water, the surface of the pillar 11507 is dried in the air at 105 to 110° C. In this way, the amino group can be obtained on the surface of the pillar 11507 made of an epoxy resin. The amino group is modified with succinic anhydride to introduce a carboxyl group to the amino group. N-hydroxysuccinimide is esterified in order to make the carboxyl group an activated ester. A synthetic DNA probe with the amino group at 5′ end is added, and the probe is fixed on the surface of the pillar 11507 with peptide binding.

Example 2

The following figures each shows the state thereof in a cross-sectional view: FIG. 121A shows the state in which a sample solution including a target polynucleotide is introduced on the surface of a DNA probe chip 115100; FIG. 121B shows the state in which a first step is taken for forming a concentration gradient of the target polynucleotide from the solid-liquid interface between the surface of the DNA probe chip 115100 and the sample solution toward the sample solution; FIG. 121C shows the next step for forming the concentration gradient. Hatching of the pillar 11507 in the sense of a cross section is omitted because hatching makes it hard to see the views.

On the surface of the DNA probe chip 115100, a gap of 0.1 mm is made by putting an appropriate spacer (not shown) and a cover glass 11511 is placed on it. An ITO electrode 11515 with a thickness of 100 nm is provided on the inner face of the cover glass 11511. Forty micro liters of an mRNA sample solution 11550 is added into the space between the surface of the DNA probe chip 115100 and the cover glass 11511. The sample solution 11550 is agitated by moving the slide glass back and forth at a certain rate. FIG. 121A is a view showing this state; the reference numeral 11512 indicates a probe fixed on the surface of the pillar 11507 in the probe fixing region 11504. The reference numeral 11514 indicates the target polynucleotide dispersed in the sample solution 11550. In this state the target polynucleotide 11514 only diffuses corresponding to a diffusion coefficient of the target polynucleotide.

FIG. 121B is a view showing a state in which an electric field (effectively 0.15 V between the electrodes) is applied so that, between an electrode 11502 of the DNA probe chip 115100 and the electrode 11515 of the cover glass 11511, the electrode 11502 turns positive +15V/cm with a power source 11525. As a result, by making the surface of the DNA probe chip have a positive potential, the target polynucleotide 11514 having a negative charge is electrostatically drawn to the valley of the pillar 11507 (the surface of the DNA probe chip) in the probe fixing region 11504. At this time, a probe 11512 is also drawn to the electrode; therefore, because one end of the probe 11512 is fixed, a free end of the probe 11512 is drawn to the electrode; the probe 11512 is supposed to extend along the surface of the pillar 11507. The surface of the pillar 11507 is electrically neural or slightly has a negative charging; therefore, the probe 11512 is not adsorbed in the surface of the pillar 11507, but has a certain freedom. Because of that, the probe 11512 has a capability of causing hybridization when the target polynucleotide 11514 clashes. In fact, when the target polynucleotide 11514 is attracted by the electrode 11502, as an arrow with the reference mark 11517 shows, the target polynucleotide 11514 collides on the surface of the pillar 11507. Because of that, as the reference mark 11518 shows, some target polynucleotide 11514 is hybridized with the probe 11512 even at this step.

An electrode 11515 does not have to be attached to a cover glass 11511; it may be placed away from the surface of an electrode 11512 of the DNA probe chip 115100 inside the sample solution 11550.

FIG. 121C is a view showing the state in which, thirty seconds after a voltage is applied from a power source 11525, the electric field of −15V/cm (effectively 0.15 V between the electrodes) is impressed between an electrode 11502 of the DNA probe chip 11510 and the electrode 11515 of the cover glass 11511 from a power source 11526 so that the electrode 11502 turns negative. Because the electrode 11502 turns negative, the target polynucleotide 11514, having a negative charging and electrostatically drawn to the valley of the pillar 11507 (the surface of the DNA probe chip) in the probe fixing region 11504, starts to move toward the electrode 11515 from the valley of the pillar 11507 (the surface of the DNA probe chip).

In other words, as shown in FIG. 121C, when the electric field is inverted, repulsion between the electrode 11502 and a negative charging of the target polynucleotide 11514 works; therefore, the electrode 11502 and the target polynucleotide 11514 move in the direction away from the surface of the DNA probe chip. In this case, because a molecule of the target polynucleotide is big, it is slow to move; therefore, there is a high probability of the target polynucleotide hybridizing with the DNA probe fixed on the surface surrounding the valley of the pillar 11507. Further, the hybridization efficiency can be raised by turning on and off of the power source repeatedly.

A series of views of FIGS. (A) to (F) describe the effect of Example 2. In order to assay the target polynucleotide caught by the probe 11512 according to the way described in FIGS. 121A, 121B and 121C, the target polynucleotide is made a label by using a fluorescent dye. The fluorescence of the fluorescent dye is to be detected. A nanoparticle like a gold colloid may be made a label to count particles directly; this case can be realized by using a tomography method which reconstructs a plurality of images with a scanning electron microscope.

FIG. 122 (A) is a view showing a probe fixing position 11531, hybridized with the target polynucleotide with a fluorescent label, on the conventional flat type DNA probe chip. An incident-light fluorescence microscope is used for capturing a fluorescent image; and image processing software is used for fluorescent profiling. FIG. 122 (B) indicates a fluorescence profile 11532 obtained at this time. It can be seen that the fluorescence intensity of the probe fixing position rises a little above the background level.

The fluorescence profiles, the detection results with the DNA chip provided with the pillar on the cone of the twenty-fourth embodiment, are described hereinafter.

FIG. 122 (C) is a view showing the position of the pillar for fixing the probe. Both FIG. 122 (A) and FIG. 122(C) have the same scale size. As shown in FIG. 122 (D), a strong fluorescence is observed at the pillar position of a fluorescence profile 34 obtained with the DNA chip provided with the pillar on the cone. Because no probe is fixed on the electrode portion, the fluorescent intensity is almost on the background level. Compared with fixing the probe simply on a flat surface, the high strength can be obtained, the hybridization efficiency goes up, and the high sensitivity is realized. The strength of the apex of the pillar decreases compared with that of the side of the pillar.

FIG. 122 (E) is a view showing the position of a cylinder pillar for comparing with the pillar of the twenty-fourth embodiment. Both FIG. 122 (C) and FIG. 122(E) have the same scale size. As shown in FIG. 122 (E), the pillar is of a cylindrical form; therefore, the hybridization caused by colliding of the target polynucleotide and the probe occurred when the sample polynucleotide is drawn to the bottom face of the pillar in the electric field, as described in FIG. 121 B, is unlikely to happen: and because each side of the pillar is juxtaposed vertically, the optical stacking takes place. Such phenomena, compared with the pillar with a taper, make the hybridization efficiency decrease, or handicap the optical characteristics at the time of measurement; therefore, the fluorescence intensity of the obtained fluorescence profile 11535 remarkably decreases compared with that of FIG. 122 (D). The fluorescence intensity drop of the cylinder apex is striking.

FIG. 123 is a view showing an example of the result obtained by checking the fluorescence intensity by variously changing the time to capture the target polynucleotide, using the condition of the electric field for applying on the DNA probe chip as a parameter. The horizontal axis indicates the time to apply the electric field, while the vertical axis indicates the fluorescence intensity.

A characteristic curve 115101 shows a result of capturing the target polynucleotide of the DNA probe chip when the electric field of −15V/cm is applied between the electrodes 11502 and 11515 from the power source 11526, after the electric field of +15V/cm is applied between the electrodes 11502 and 11515 from the power source 11525, with the chip provided with the truncated cone pillar. A characteristic curve 115102 shows a result of capturing the target polynucleotide of the DNA probe chip with the chip provided with the same truncated cone pillar when no electric field is applied, as a control. A characteristic curve 115103 shows a result of capturing the target polynucleotide of the DNA probe chip when the electric field of −15V/cm is applied from the power source 11526 after the electric field of +15V/cm is applied from the power source 11525, with the chip provided with the cylindrical pillar. The time to apply the first +15V/cm in the characteristic curves 115101 and 115103 is the same. Both characteristic curves show an average fluorescence value in the probe fixing region.

As evidently shown in the characteristic curves 115101, first, the electric field of +15V/cm is applied between the electrodes 11502 and 11515 from the power source 11525 to electrostatically draw the target polynucleotide 11514 having a negative charge to the valley of the pillar 11507 (the surface of the DNA chip). At this time, the hybridization has already started, so the fluorescence intensity increases over time. After that, the electric field of −15V/cm is applied between the electrodes 11502 and 11515 from the power source 11526 to release the target polynucleotide 11514 with a negative charge, electrostatically drawn to the valley of the pillar 11507 (the surface of the DNA chip), from the valley of the pillar 11507 (the surface of the DNA chip). By following this step, the closer to the valley of the pillar 11507 (the surface of the DNA chip), the higher gradient the density of the target polynucleotide 11514 inside the sample 11550 has; therefore, the target polynucleotide can be captured efficiently. As can be seen from the view, after the prescribed time has passed, the target polynucleotide moves away from the pillar; therefore it is no use applying more voltage.

A fluorescence intensity 115103 obtained with the cylindrical pillar is low due to the reasons described above.

When no voltage is applied, there occurs no density gradient of the target polynucleotide 11514 inside the sample 11550; therefore, it is natural that a capturing rate of the target polynucleotide 11514 is low.

In this example, the direction of the electric field is changed once; however, this step may be repeated several times. When it is repeated several times, the states in FIGS. 121 B, 121C are to be repeated; because many of the unhybridized target polynucleotides 11514 are distributed near the DNA probe on the surface of the pillar 11507, the capturing rate of the target polynucleotide 11514 can be increased.

Example 3

FIG. 124 is a cross-sectional view showing the DNA chip of Example 3 for enlarging the surface area by producing many wells on the substrate; like Examples 1, 2, the side of the well has a taper so that more reaction efficiency can be obtained and the optical measurement can be easily performed. A silicon substrate 11551 is provided with the electrode 11552 thereon, on the electrode 11552 exists a component 11554 made of a well 11553 The electrode of the well 11553 is exposed on the bottom surface thereof. Chromium is evaporated on the surface of the silicon substrate 11551 to turn it to be the electrode 11552. Platinum is evaporated on the electrode 11552. Just like Example 1, the epoxy layer is formed on the platinum to form a well using plasma processing. An amino group is introduced on the surface with silane processing; and following the method of Example 1, the probe DNA is fixed. By combining the DNA chip, with an electrode, composed of the probe fixing area having many wells, produced as described above, and the fluorescence detection, the detection sensitivity at least ten times as strong as that of the conventional flat DNA probe chip can be obtained.

Further, it is possible to hybridize the target polynucleotide with a 5 nm-gold particle labeled and to detect a fixed quantity of gold particles with a scanning electron microscope. This case has an advantage which makes it possible to measure on the single molecular level in about one minute of the measuring time. On the side of the cylindrical well, the gold particles bound with the hybridization reaction vertically overlap; therefore, detection is hard even with the scanner electron microscope because the particles each overlaps on top of each other. According to the twenty-fourth embodiment for making the well have a taper, the particles each bound on the side of the well can be measured without overlapping on top of each other so much. Therefore, the twenty-fourth embodiment is useful as a DNA probe chip of a single molecule measuring type which uses nanoparticles and the scanner electron microscope.

Twenty-Fifth Embodiment

A twenty-fifth embodiment of the present invention discloses a multi-detection method of a labeling substance for labeling dozens or thousands of sample molecules in the same probe section divided into a minimum size, and a biological material using this labeling substance, in a wide-ranging biological material detection method including DNA probe array.

The twenty-fifth embodiment uses a nanoparticle made by changing a ratio of different elements of a labeling substance as a label. For example, a gold based substance blended with a trace of palladium and chromium is used below to describe this label. When a composition ratio of palladium and chromium is changed eight gradations, sixty-four kinds of nanoparticles of gold can be obtained. When three kinds of elements are added to gold, 512 kinds of nanoparticles of gold can be obtained. When a particle diameter is changed into about five kinds between 10 nm and 50 nm each every 10 nm stage, about 2500 kinds of nanoparticles of gold with different composition and size can be obtained.

Because this particle is a conductor, the location and the size thereof can be easily detected by irradiating electrons on the particles using a scanning electronic microscope, measuring the energy distribution of secondary electron beams, and obtaining the SEM image with the location and the size of the particle identified. Further, the location and the size of the particle can be obtained by using an energy dispersive character X-ray detector to obtain the element analyzed images of character X-rays generated when electrons are irradiated on the particles using the scanning electronic microscope. This method makes it possible to detect the size of a nanoparticle, the kind of element included therein and the location of the particle on the substrate section. By making the particles each with different composition and diameter become the structures each having a probe DNA binding to each different DNA sequence, it is possible to detect thousands of target DNA pieces on the same level.

Because nanoparticles are mainly composed of gold, the probe can be fixed on the particle surface by using a DNA probe with alkylsulphide group.

The twenty-fifth embodiment is basically based on the alloy manufacturing technique, so various kinds of elements can be blended; further, it is possible to combine four or more kinds of elements. For example, combining five elements makes it possible to obtain thirty some thousand nanoparticles of different composition equivalent to the number of sections of the existing DNA chips. Or, putting 250 kinds of combination of three elements into one group, and preparing a plurality of groups composed of the combination of the other elements enable distinction and detection of several thousand kinds of DNA. To change composition thereof, three to five elements are selected from the combination of elements consisting of gallium, aluminum, yttrium, erbium, horonium, cesium, cobalt, titan, nickel, iron and the like. In order to fix the probe, in addition to the gold and the SH group reaction, a functional group is introduced using a silane coupling reaction when the probe has an oxidized surface.

As described above, the twenty-fifth embodiment of the present invention overturns the conventional concept of DNA chips which have to fix different types of probes on a great many number of section elements. It is possible to analyze the mRNA expression in a short time simply by trapping mRNA on the chip with poly T fixed thereon, hybridizing each mRNA with the synthetic DNA probe having complementary sequences with nanoparticles each having different composition labeled thereon, and by analyzing with the scanning electronic microscope.

An analyzing method of analyzing thousands of different kinds of epitopes at once is to be established by using an antibody instead of the DNA probe and using it on a biological substance (for instance, protein) fixed on the substrate.

Example 1

FIG. 125 is a conceptual drawing showing a portion of the DNA chip according to an example 1 of the twenty-fifth embodiment in a diagrammatic perspective view. Chip 12501 is formed on a silicon substrate 125101 having an oxidized membrane surface. The chip 12501 has a size of 20×20 mm. A probe fixing region 125102 is the only one for fixing the DNA probe and has 10 mmφ. The surrounding portion thereof is coated with a water shedding resin 125103, a kind of Teflon (registered trademark). The coating is about 50 μm thick. In a probe fixing region 125102, the 3′ end of poly T with 26-base lengths is bound together with the 5′ end of random sequence oligo-DNA with 5-base lengths. It is because the Poly T alone cannot fully secure the stability of mRNA hybridization. The probe is made of PNA, peptide nucleic acid, so that the probe can be easily interacted with the intracellular mRNA. Similar to ordinary DNA, PNA does not have any negative charging originated from phosphodiester bond; therefore, electrostatic repulsion does not occur between the target DNA and PNA, which improves the efficiency of hybridization.

Further, using PNA for the probe to have a property without the charging does not generate electrostatic repulsion; therefore, hybridization proceeds without performing denaturation because even if a poly A portion of the target mRNA forms a partial duplex with another site in the cell, the probe can competitively get inside the duplex, and hybridize the duplex competitively.

A method disclosed by A. Kumar et al. (Nucleic Acids Research (2000) 28, No. 14 e71) is revised to make the probe fixing method used here. In this method, a silanized DNA probe, with the trimethoxysilane residue introduced to the amino end of synthetic PNA in advance, is coated on the element portion of the chip substrate to fix the probe. The silanized DNA probe, for example, can be obtained by binding a glycidoxy group of 3-glycidoxypropyltrimethoxysilane to the amino end of PNA.

For example, a 50 μl of total RNA solution extracted from the tissue pieces of intestinal cancer removed in accordance with the known method is blended with a 0.1% (w/v) solution of gold based nanoparticles (10 μm) with a ratio of gallium, aluminum, yttrium and chromium altered so that about forty base sequences complementary to each mRNA can be distinguished; and then the solution is added to the probe fixing region 125102 of the chip 12501 without performing any special treatment. The chip is preheated at 45° C. About 1-mm gap is provided, and a 40 mmφ of glass plate is placed on the top surface of the probe fixing region; the glass plate, while being decentered, is moved in circles so that the edge of the probe fixing region 125102 matches that of the glass plate. The glass plate is moved once every five seconds, which makes it possible to hybridize at a high rate. In the probe fixing region 125102 of the chip 12501, a probe fixed on the chip 12501, an mRNA and a particle labeling probe are bound in that order in a sandwich structure. An unreacted particle labeling probe or RNA is washed and removed.

FIG. 126 is a conceptual view illustrating how the probe chip 12501 described in FIG. 125 is observed using the scanning electron microscope.

Many probes are fixed on the surface of the probe fixing region 125102 of the chip 12501 this example is performed using a simplified method in which DNA pieces 125201-125204 are hybridized on each of the fixed probes 12511-12514; and these DNA pieces are labeled with gold particles 12521-12524. Each of the gold particles 12521, 12522, 12523 and 12524 is to have a ratio of (1:1:1:0), (1:1:0:1), (1:0:1:1), (1:1:1:1) for gallium, aluminum, yttrium and chromium, respectively. A maximum ratio of each metal blended into gold is 20% because binding between gold and alkanethiol introduced at a 5′ end of the probe is to be used in order to fix an mRNA specific probe on the surfaces of nanoparticles. Gold and thiol are vulnerable to oxidative conditions or exposure to UV rays, but under ordinary hybridization conditions gold and thiol can obtain very stable binding force. Therefore, in Example 1 the alkanethiol previously introduced at the 5′ end of the probe and the gold are blended at a ratio of 10 to 1 to obtain a string of gold nanoparticles with mRNA specific probes fixed on the surfaces thereof.

An electron gun 125300-1, a convergent lens 125300-2 and a scanner coil 125300-3 of a scanning electron microscope 125300 for detecting the gold particles are provided on the surface of the probe fixing region 125102 of the chip 12501. The electron of an electron ray 125300-4 shot from the electron gun 125300-1 clashes against the gold particles 12521, 12522, 12523 and 12524, and then the gold particles emit an electron ray 125300-5. This secondary electron is captured by a detector 125300-6. Based on the secondary electrons captured by the detector 125300-6, so called SEM images can be obtained to identify the location and the size of the gold particles.

On the other hand, the twenty-fifth embodiment is provided with an energy dispersive character X-ray detector 125300-8 for detecting an X-ray 125300-7 with a wavelength specific to elements constituting the gold nanoparticles emitted from the gold particles 12521, 12522, 12523 and 12524 when the electron of the electron ray 125300-4 clashes against the gold particles 12521, 12522, 12523 and 12524. Thus, analyzed images of elements can be obtained from wavelength signals corresponding to the structural elements detected by the energy dispersive character X-ray detector 125300-8.

The analyzed images of elements obtained by the energy-dispersive-character X-ray detector 125300-8 is to have the data of locations and structural elements of the gold particles. Therefore, when the SEM image and the analyzed image of elements are matched, mRNA particles hybridized by the gold particle labeling probe can be identified.

FIG. 127 is a conceptual view illustrating a method of identifying the mRNA particles hybridized by the gold particle labeling probe by comparing the SEM image with the analyzed image of elements.

As an example, oligo PNA (28 bases) having a sequence corresponding to an mRNA sequence of EpCAM, oligo PNA (26 bases) having a sequence corresponding to an mRNA sequence of CD44, an expression which is also said to increase in a cancer cell, and oligo PNA (29 bases) having a sequence corresponding to an mRNA sequence of CEA, each of them is fixed on the surface of the probe fixing region as a probe. A method of adding a gold particle (with a diameter of 10 nm), as a label, each including gallium, aluminum, yttrium and chromium with a ratio of (1:1:1:0), (1:1:0:1), (1:0:1:1), (1:1:1:1) respectively to the amino end hybridizing to these probes is described below.

In FIG. 127, the reference numeral 30 indicates the SEM image. The SEM image has all the particles images. The reference numeral 12531, 12532, 12533, 12534 each indicates a gallium image, an aluminum image, an yttrium image and a chromium image respectively. Comparing a SEM image 12530 with the gallium image 12531, aluminum image 12532, yttrium image 12533 and chromium image 12534 shows that the SEM image 12530 is the same with the gallium image 12531, but the aluminum image 12532, yttrium image 12533 and chromium image 12534 each fails to display a location particle by dotted lines shown against the SEM image 12530. In other words, because gallium is included in all of the particles used as labels, the gallium image 12531, like the SEM image 12530, shows all the particles. The aluminum image 12532 does not show a location particle shown by dotted lines. It means that an mRNA hybridized to the probe in this location indicates a CEA molecule labeled by a gold nanoparticle including no aluminum. This indicates a gold particle shown as the reference numeral 12537 in the SEM image 12530. Similarly, the yttrium image 12533 does not display two particles in the location shown by dotted lines. In other words, an mRNA hybridized to the probe in this location indicates a CD 44 molecule labeled by a gold particle including no yttrium. This is a gold particle shown as the reference numeral 12536 in the SEM image 12530. Further, the chromium image 12534 does not display three particles in the location shown by dotted lines. In other words, an mRNA hybridized to the probe in this location indicates an EpCAM molecule labeled by a gold particle including no chromium. This indicates a gold particle shown as the reference numeral 12535 in the SEM image 12530.

In FIG. 127, all the particles were regarded to have the same size in order to simplify the description; however, when the particles of different sizes are used together with the particles of the same size, more substances can be identified. Of course it is needless to say that this identification can be performed with an image processing of a calculator.

Using the twenty-fifth embodiment makes it possible to distinguish and quantitatively measure a plurality of mRNAs on the DNA chip with an mRNA having a poli-A tail simply captured. Because the energy dispersive X-ray detector attached to SEM can identify an element ratio of a few percent, it can identify the same element by about eight gradations. When four kinds of elements are used, it is possible to identify 4096 kinds of particles. When five kinds of elements are used, 32768 kinds of particles can be identified by shooting only five images.

As described above, using the particles with the element ratio altered according to the twenty-fifth embodiment enables the mRNA profiling of a single molecule level without using a probe chip made with a conventional section separation method but with using a particle counting method. The probe chip made with a conventional section separation method has such a complicated structure that it is troublesome to manufacture the probe chip.

Example 2

An example 2 describes the multi-detection method of a biological substance with an antigen-antibody reaction. In this example, the same substrate described by referring to FIG. 25 is used. In the example 2, the probe fixing region 125102 is used as a reaction portion; an IgG fraction with antihuman antiserum affinity purified is fixed in a reaction portion 125102. The serum to be measured contains a large amount of human albumin or human IgG; therefore it is necessary to remove an antibody to human albumin and an antibody to human IgG from the reaction portion 125102 in advance so that they may not react. Therefore, the IgG fraction with an affinity purified antihuman antiserum IgG fraction absorbed by human albumin and human IgG is prepared; the IgG fraction is fixed in the reaction portion 125102 and a surplus absorption place is masked with phosphatidylcholine compound. Next, the reaction portion 125102 is washed with 0.15M NaCl, 50 mM sodium phosphate buffer (PBS: pH7.4) including 10 mg/ml of bovine serum albumin to remove unreacted human IgG.

When 100 μl of human serum sample is added to the reaction portion 125102, and agitated for ten minutes just like the process in Example 1, the protein existing inside the serum causes an antigen antibody reaction, and the protein is trapped by the antibody on the reaction portion 125102.

Aside from this, a nanoparticle labeling antibody is prepared. For example, an SH group is introduced to an F(ab′)2 fragment obtained with papain degradation of affinity purified polyclonal anti-AFP antibody and anti-CEA antibody. The SH group to be inserted has 3 to 4 molecules per one F(ab′)2 molecule. Gold (20 nmφ)-based palladium and chromium with a ratio of (20:80) and gold particles with a ratio of (30:70) are blended with F(ab′)2 derived from the anti-AFP antibody and anti-CEA antibody including the SH group prepared as described above to obtain gold particles with F(ab′)2 bound on the surface thereof.

AFP alone with a concentration of 1 zmol/μl, CEA alone with a concentration of 5 zmol/μl and a control with nothing therein are prepared to make a sample. PBS (pH 7.4) including 0.1% Tween 20 and 0.5% BAS is used as a solvent.

Each solution is reacted with the protein chip, and then the gold nanoparticle labeling F(ab′)2 is reacted with the protein chip. The reaction time for the first sample reaction is five minutes, and the reaction time for the gold nanoparticle labeling F(ab′)2 is five minutes. After the reaction ends, the chip is washed with the buffer solution including 0.1% Tween 20 and 0.5% BAS; the gold nanoparticles are detected using the scanning electronic microscope and the energy dispersive character X-ray detector, and then AFP and CEA molecules are counted from the abundance ratio of palladium and chromium.

When AFP alone is reacted with the protein trapped by the antibody on the above mentioned reaction portion 125102, 120 particles/μm2 of gold nanoparticles which can recognize the AFP bound with protein and two particles/μm2 of the other gold nanoparticles are detected. Similarly, when CEA alone is reacted, 1580 particles/μm2 of gold nanoparticles which can recognize the CEA bound with protein and six particles/μm2 of the other gold nanoparticles are detected. Only two to four particles/μm2 of gold nanoparticles can be detected from the control solution.

In the twenty-fifth embodiment, the metal or semiconductor constituting an alloy particle which is to be a label is selected from either one of transition metals with any atomic number up to 79 of the periodic table excluding atomic number 43, either one of metals with atomic numbers 13, 31, 32, 49, 50, 51, 81, 82, 83, and either one of semiconductors with atomic numbers 14, 33, 34, 52.

As described above, the twenty-fifth embodiment can be carried out in several examples; in any example, a hybridized DNA sample and the like are detected practically by every molecule; therefore, the sensitivity obtained using this method far exceeds the sensitivity obtained using a conventional method. An infinitesimal DNA (RNA) can be detected by an infinitesimal volume; therefore, it is now possible to detect a target DNA (RNA) without carrying out any pretreated amplifications, which was impossible using a conventional method. Because a labeling particle size or form for detection can be changed, it is now possible to perform multi analysis of different samples from about six to ten kinds on the same element. In addition to using this technique to the conventional differential hybridization, this technique makes it possible to trap a sample polynucleotide in an element using the same probe and perform detection using a different label probe. The multi-analysis technique according to the twenty-fifth embodiment has the advantages of detecting alternative splicing or performing typing of a plurality of SNPs using one element.

Twenty-Sixth Embodiment

As with the twenty-fifth embodiment, a twenty-sixth embodiment of the present invention discloses a labeling material capable of identifying, in a minimized probe zone, several tens to several thousands sample molecules in the same zone and a multiplex examination method for examining biological materials with the labeling material. In the twenty-sixth embodiment, different from the twenty-fifth embodiment in which a probe is fixed to a probe zone, indexing particles each with a probe fixed thereto are prepared. In other points, the twenty-sixth embodiment is the same as the twenty-fifth embodiment.

In a first aspect of the twenty-sixth embodiment, nanoparticles having different elemental compositions respectively are used as labeling materials. Descriptions are provided below for a case in which nanoparticles of gold with minute quantities of palladium and chromium mixed therein are used as labeling materials. Sixty-four types of gold nanoparticles can be obtained by changing a content of palladium and that of chromium with 8 steps respectively. If three elements are added in the nanoparticles of gold, 512 types of gold nanoparticles can be obtained. If the particle diameter is changed by 5 stages with a 10-nm step in the range from 10 nm to 50 nm, about 2500 types of nanoparticles of gold having different compositions and sizes can be obtained.

The particles are conductive, the position and size of each particle can easily be detected by irradiating the particles with electrons under a scanning electron microscope and measuring an energy distribution of secondary electron beam to obtain a SEM image identifying positions and sizes of the particles. Further a position and size of each particle can be detected by irradiating electrons with a scanning electron microscope to the particles to obtain an elemental analysis image for the characteristic X-ray generated by each particle with an energy-dispersive-characteristic X-ray detector. With the operations above, a position of each nanoparticle on the substrate can be detected, and at the same time the elements contained in the particle and size thereof can be detected. With a structure having a number of different probe DNAs to which particles having different compositions and sizes conjugate respectively, even several thousands target DNA fragments can be detected on the same plane.

The main ingredient of the nanoparticle is gold, so that the probe cab be sided to a surface of the particle by using a DNA probe having an alkyl sulfide group.

The twenty-sixth embodiment is basically dependent on the alloy manufacturing technology, and various types of elements may be mixed in the particle. If necessary, four or more types of elements may be mixed in the particle. For instance, when five types of elements, nanoparticles based on thirty thousands or more compositions equivalent to a number of the existing DNA chips can be obtained. Alternatively, by preparing 250 types of compositions with three types of elements and then preparing other several elements to be mixed in each of the 250 types of compositions, several thousands of DNA probes can be discriminated and detected.

As elements available for preparing various compositions, three to five types of elements may be selected from the group including gallium, aluminum, yttrium, erbium, polonium, cesium, cobalt, titanium, nickel, and iron. To fix a probe, in addition to a reaction between gold and an SH group, in a case of an alloy having an oxidized surface, the probe DNA can be fixed by introducing a functional group using the silane coupling reaction.

As described above, a concept of the twenty-sixth embodiment of the present invention is completely different from the ordinary concept for a DNA chip in which different probes are required to be fixed in an extremely large number of zone elements. An expression of mRNA can be analyzed within a short period of time by simply trapping mRNAs on a chip with poly T fixed thereon, hybridizing synthetic DNA probes with nanoparticles having different compositions respectively labeled thereon to the mRNAs, and analyzing the reaction products with a scanning electron microscope.

Using the chip with DNA probes changed to antibodies for biological materials (such as proteins) fixed on the substrate, several thousand epitopes can be analyzed all at once.

In a second aspect of the twenty-sixth embodiment as a development of the configuration in the first embodiment, particles prepared with differential elemental compositions respectively are prepared and used for fixing specific probes. That is, a particle having a specific elemental composition can be used for fixing a specific probe. On the other hand, target DNA fragments to be hybridized to probes fixed on the particles are labeled with particles of gold for counting. The probes are hybridized to the target DNA fragments by mixing the particles with the probed fixed thereon and the target DNA fragments in a solution. This processing is performed in a specified zone in a vessel or in a specified zone, and then the particles are washed and recovered. To wash and recover the particles, centrifugation may be employed, or the supernatant may be replaced. When the particles contain any magnetic material, the particles may be recovered with a magnet with the supernatant replaced. After the processing, the particles are dried and fixed on a prespecified zone on the substrate. As a result, the target DNA fragments can be assessed by indexing the particles and counting the gold particles used for labeling.

In this second aspect, hybridization of probes fixed on particles and target DNA fragments can be performed in the state where the particles are suspended in a solution, so that such problems associated with hybridization occurring on an interface between a solid phase and a liquid phase as heterogeneous reactions, low reaction speed due to dispersion of molecules, and low reaction rate are substantially alleviated. As treated as a suspension, specific vessels and pipets and any special technique are not required, which is advantageous. The technique used to the labels for the target object materials may be applied to this particle indexing. In other words, by directing electros to the particles under a scanning electron microscope to obtain an SEM image identifying positions and sizes of the particles, and also by sensing the characteristic X ray generated when the particles are irradiated by electrons with an energy dispersive X ray detector to obtain an elemental analysis image, and particles fixed on a zone on the substrate are indexed by comparing the two images above with each other. The particles are fixed on the zone on the substrate. Descriptions of this example above assume use of the energy-dispersive X-ray detector, but a method with high sensitivity such as the wavelength dispersive X-ray spectroscopy (WDX) may be employed. Rather the wavelength dispersive X-ray spectroscopy may be more adapted to the twenty-sixth embodiment because the method is excellent in X-ray wavelength resolution.

When an object for measurement is a protein or a sugar chain, the immunoassay technique is employed. In other words, indexing particles each with an antibody molecule reactive to a particular epitope and antibodies fixed to nanoparticles of gold for labeling are used. In this case, both of the antibodies fixed to the indexing particles and particles for labeling contain an antigen molecule sandwiched with an antibody specific to an object for measurement and form hybrids of indexing particle, antigen, and gold nanoparticle for labeling. Alternatively the antigen is sandwiched with a second antibody universally reacting to the indexing particle with a specific antibody fixed thereon and an antibody not labeled. In any method, a number of antigens are indexed in use for quantitative detection.

To fix the hybrids of indexing particle, mRNA, and gold nanoparticles for labeling or the indexing particle-antigen-gold nanoparticles for labeling hybrid onto the substrate, a suspension of each hybrid may be dripped and dried thereon, or more reasonably a magnetic substance is used for the indexing particle, and the indexing particle is attracted onto the substrate with a magnet, and then the solution is scattered off with a blower or the like for drying.

As described above, the concept of this embodiment is completely different from the concept for ordinary DNA probe chip that different probes must be fixed in a number of zone elements. The concept of this embodiment provides a analyzing technique capable of analyzing types and quantities of several thousands to several tens of thousands of mRNAs or proteins all at once by making the indexing particles, samples, and labeling particles reacting to each other and observing the reacting situation with a scanning electron temperature.

The DNA chip 12501 according to the twenty-fifth embodiment shown in FIG. 125 may be employed as the DNA chip in the twenty-sixth embodiment.

An aspect in which probes are fixed on the DNA chip according to the twenty-sixth embodiment and indexing particles conjugated to the samples captured by the probes are observed with a scanning electron microscope is the same as that of the twenty-fifth embodiment shown in FIG. 126 and FIG. 127, and therefore description thereof is omitted here.

An SEM with low resolution or an X-ray detector with the resolution of about 0.1 μm may be used as a simple version for detection when indexing particles conjugated to the captured samples are observed under a scanning electron microscope. The device with low resolution as described above is so compact that the device can be installed on a desk, and in addition, the price is lower than an SEM with the ordinary X-ray detector. Alternatively, en electron probe X-ray microanalyser (EPMA) based on an electron beam microprobe capable of performing elemental analysis within a range of 1 μm2 may be used, and the method is described below. With the resolution of about 0.1 μm, nanoparticles of gold can not be counted, nor can be obtained an elemental analysis image thereof. In this case, an elemental analysis value for each element within the range irradiated by X ray is obtained. In this example, too many types of elements can not be used for labeling each DNA probe, and only two to three elements may be used for labeling one particle, and allowable elemental compositions are about three types. When a particle is labeled with one element, variation in labeling is allowable according to a number of used elements, and in this case, several tens of DNAs or biological materials can be analyzed simultaneously.

Example 1

FIG. 128 is a diagram showing a concept for measurement of a biological sample in the twenty-sixth embodiment. This measurement is characterized by using indexing particles. No probe is fixed on the silicon substrate 128101. The silicon substrate 128101 is a vessel for measurement only having a prespecified area, and is used for fixing indexing particles in measurement. The size is 20×20 mm. There is only one indexing particle fixing area 128102, and the diameter is 3 mm. SU8 is applied on the silicon substrate 128101, and a bank 128103 is formed by curing SU8 with UV ray. Needless to say, the bank 128103 may be formed by directly engraving the base. There is not restriction over a structure of the bank 128103 so long as a liquid is contained therein, but because sometimes an aqueous solution containing 70% alcohol may be contained therein, and in this case the height should preferably be 150 μm or more.

Reference numerals 12841 to 12844 are indexing particles composed with elemental compositions different from one another. The indexing particles correspond to the nanoparticles of gold 12821-12824 for labeling with different elemental compositions respectively in the first aspect, but are different from the latter in the following points. In the first aspect, the gold nanoparticles 12821-12824 for labeling have different elemental compositions respectively, and specific biological materials (such as, for instance, target DNA fragments) are detected by directing electrons to the gold nanoparticles to check X-rays having different wavelengths specific to elemental compositions of the gold nanoparticles for identifying each discrete nanoparticles of gold. In contrast, in the second aspect, the indexing particles 12841 to 12844 are directly used each for fixing a probe thereon, and in addition, particles for labeling are used for counting specific biological materials captured by the probe. That is, in the second aspect, positions of indexing particles are identified by making use of the fact the indexing particles 12841 to 12844 irradiated with electron beams generate X-rays having different wavelengths specific to elemental compositions of the particles 12841 to 12844 respectively and then specific biological materials captured by the indexing particles are detected. Particles including, in addition to gold, a plurality of elements are used for indexing, and gold nanoparticles are used for counting.

A particle as a base for the indexing particle is made of polystyrene not to prevent detection of elements for labeling in the indexing particles during the process of elemental analysis. Alternatively, polystyrene magnetic particles with a paramagnetic material such as iron or cobalt embedded therein may be used. In this case an element for labeling is deposited and fixed on a surface of the particle. There are variable methods available for preparing particles for labeling in addition to deposition of an element. For instance, a prespecified number of elements may be kneaded in a polystyrene sphere as a nanoparticle. In this case, an element signal from each particle can be obtained by raising energy of the emitted electron beam so that the electron beam reaches inside the polystyrene sphere.

When magnetic particles are used, there is provided the advantage that operations for reactions and those for detecting particles can advantageously be performed with a magnet. In a case of the ordinary polystyrene, operations can smoothly be performed by recovering particles by centrifugation or with a filter.

The solid black circle attached to each of the indexing particles 12841 to 12844 is a labeling particle for counting. As described below, this is a labeling particle for a specific biological material captured by a probe fixed on each of the indexing particles 12841 to 12844. The indexing particles 12841 to 12844 are fixed on the indexing particle fixing area 128102 (with a diameter of 3 mm) on the silicon substrate 128101. After the specific biological materials are captured by the probes fixed to the indexing particles 12841 to 12844 by mixing the indexing particles 12841 to 12844 and a sample containing the target biological material labeled with a labeling particle in a solution, and then the mixture solution is dripped by a prespecified volume onto the probe fixing area 128102 and dried to fix the indexing particles to the indexing particle fixing area 128102.

When a base for the indexing particle is a polystyrene particle, after 1 μl of the mixture solution is dripped onto the probe fixing area 128102 and dried in the depressurized state to fix the indexing particles. For this purpose, it is necessary to add a mechanism for holding a droplet in the indexing particle fixing area 128102, and in Example 3, SU8 is applied on the substrate 128101 and then the bank 128103 is prepared by curing with UV ray. Needless to say, the bank 128103 may directly be formed on the substrate 128101 by etching. There is no specific restriction over a structure of the bank 128103 so long as a liquid can be preserved therein, but as described below, sometimes an aqueous solution containing 70% alcohol must be preserved therein, and in this case the height is required to be at least 150 μm.

In the state where the indexing particles have been fixed on the indexing particle fixing area 128102, like in Example 1, the substrate 128101 is set in a scanning electron microscope 128300 having an energy dispersive X-ray detector or a wavelength dispersive X-ray spectrometer. The scanning electron microscope 128300 has an electron gun 128300-1, a focusing lens 128300-2, and a scanning coil 128300-3, and electrons emitted from the electron gun 128300-1 collide against the indexing particles 12841-12844, which emit the second electrons 128300-5. The secondary electrons are captured by the detector 128300-6. The so-called SEM image is made based on the secondary electrons detected by the detector 128300-6, so that positions and sizes of the indexing particles 12841 to 12844 are identified. Further, the labeling particles coupled to surfaces of the indexing particles 12841 to 12844 are detected. There is also provided an energy dispersive X-ray detector or a wavelength dispersive X-ray spectrometer 128300-8 for detecting X-ray 128300-7 having wavelength specific to elements constituting each indexing particle. That is, an elemental analysis image is obtained from the wavelength signals corresponding to the constituent elements detected by the energy dispersive X-ray detector or a wavelength dispersive X-ray spectrometer 128300-8. With this configuration, the indexing particles can indicate types of probes fixed on the surfaces thereof with the size and constituent element.

FIG. 129 is a diagram illustrating the operations for identifying positions and sizes of the indexing particles 12841 to 12844 from an SEM image obtained with the detector 128300-6 as well as from an elemental analysis image obtained by the energy dispersive X-ray detector 128300-8 and assessment of the specific biological materials with the labeling particles hybridized to the indexing particles 12841 to 12844 added thereto. In the following descriptions, the elemental compositions (gallium: aluminum: yttrium: chromium) of the indexing particles 41 12841 to 12844 are (1:1:1:0) in the indexing particle 12841, ((1:1:0:1) in the indexing particle 12842, ((1:0:1:1) in the indexing particles 12843, and (0:1:1:1) in the indexing particle 12844, and also it is assumed in the following descriptions that diameters of the particles are in the range from 0.5 to 5 μm.

In FIG. 129, reference numeral 12850 indicates an SEM image. All of the indexing particles 12841 to 12844 and labeling particles for the specific biological materials captured on the indexing particles 12841 to 12844 are shown in the SEM image. Reference numerals 12851, 12852, 12853, and 12854 are elemental analysis images for a chromium image, an yttrium image, an aluminum image, and a gallium image respectively. Comparing the SEM image 12850 to the chromium image 12851, yttrium image 12852, aluminum image 12853, and gallium image 12854, it is understood that an particle image at a position corresponding the indexing particle 12841 indicated by a broken line is not shown in the chromium image 12851. Likewise, particles image at positions corresponding to the indexing particles 12842, 12843, and 12844 shown in the SEM image 12830 are not shown in the yttrium image 12852, aluminum image 12853, and gallium image 12854. That is, the indexing particles 12841, 12842, 12843, and 12844 do not include chromium, yttrium, aluminum, and gallium each as a constituent element for each particle respectively, so that the images are not shown in the elemental analysis image. When the labeling particles are gold nanoparticles, the particle image is principally not shown in the elemental analysis image. When the labeling particles is irradiated with electron beams and emit X-rays having the specific wavelength close to that emitted from the constituent elements in the indexing particles, the particle images are shown in the elemental analysis image. Therefore, noise is included more as compared to the SEM image 12850, but the noise does not substantially spoil execution of the elemental analysis.

Therefore the indexing particles 12841 to 12844 are discriminated and identified by comparing the SEM image 12850 to the elemental analysis images 12851 to 12854. Further, because the labeling particles are shown in the SEM image 12850, by counting the particles and integrating the counts with a result of identification of the indexing particles 12841 to 12844 for assessment, how many labeling particles are included in each of the indexing particles, in other words, which specific biological material is present in the sample can be accessed. For simplification, the descriptions above assume a case in which four particles each having the same size are used for checking whether a particular element is present in a particle or not, but by preparing indexing particles having different diameters at a level where the sizes can be identified in an SEM image and also changing the elemental compositions of the indexing particles to various values at a level where the indexing particles can be recognized in the elemental analysis images, a number of types of indexing particles can be increased according to a product of a particle diameter x a number of elemental compositions x a quantity of each constituent element. For instance, when indexing particles with different diameters in four stages in the range from 0.5 to 5 μm and also with different elemental compositions in 10 stages, 40,000 types of indexing particles can be obtained.

Descriptions are provided below of elements that may be used as indexing particles. Elements that can be analyzed with the energy dispersive characteristic X-ray detector 128300-8 ranges from B, a fifth element up to U, a 92nd element in the periodic table. Any element in this range can be detected if the element is contained by 1% or more. Resolution of a device or spectrum ascription can be classified to about 10 grades in the range from 1% to about 20% in the determination characteristic analysis. When a magnetic particle is used as a base particle, elements involving in magnetism cannot be employed for indexing. Therefore, Fe, Co, and Ni cannot be used for indexing. C, N, and O are also contained in polystyrene, so that the elements cannot be used. The elements Fe, Co, Ni, C, N, and O exist a lot in the nature, and the elements may be introduced as a result of contamination from the outside, so that the elements should not be used. For the same reason, alkali metals (group I) and alkali earth metals (group II), and other metals in groups, 12815, 12816, and 12817 up to As should be excluded, and elements belonging to group 12818 are gases, so that the elements should be excluded. Al, Si, Mo, Sn exist a lot in the ordinary environment. V belong to family 12805 is excluded because the element existing in living organisms relatively a lot. Also Tc, Pm, Ac, Pa, and U having no or few stable isotopes should be excluded. Hg itself exists as a liquid. Elements other those listed above may be used for indexing. That is, the elements available for indexing are Sc, Ti, Ga, Ge, Y, Zr, Nb, Ru, Rh, Pd, Ag, Cd, In, Sb, La, Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, Lu, Hf, Ta, W, Re, Os, Ir, Pt, Au, Tl, Bi, and Th.

FIG. 130(A) is a diagram schematically showing the indexing particles 12841 to 12844 and probes 12841a, 12842a, 12843a, and 12844a fixed on surfaces of the indexing particles 12841 to 12844, FIG. 130(B) is a view schematically showing specific biological materials 12841b, 12842b, 12843b, and 12844b hybridized to the probes 12841a, 12842a, 12843a, and 12844a each with a labeling particle added thereto, and FIG. 130(C) is a diagram schematically showing the situation in which the probes and specific biological materials hybridize with each other. The following descriptions assume a case in which a DNA probe is used as a probe.

As shown in FIG. 130(A), specific probes are fixed to surfaces of the indexing particles 12841 to 12844 respectively. Any known method may be used for fixing the probes to the indexing particles. For instance, oxygen plasma is directed to the indexing particles to generate an active group on the surface thereof, then 3-aminoethyl aminopropyl trimethoxysilane is reacted to the indexing particles to introduce an amino group into the surface, the amino group is converted to a carboxylic group with succinic acid anhydride, this carboxylic group is changed to succinimide ester, and a probe DNA having an amino group at the 5′ terminal may be fixed thereto. When PNA is used as a probe DNA, the amino terminal of the probe DNA is used to fix the probe on the surface as above. Needless to say, the specific biological materials 12841b, 12842b, 12843b and 12844b hybridized to the probes 12841a, 12842a, 12843a, and 12844a shown in FIG. 130(B) have sequences complementary to the probes 12841a, 12842a, 12843a, and 12844a. The specific biological materials with labeling particles such as nanoparticles of gold (20 nm) fixed thereon are prepared by preparing a sequence having an SH group at the 5′ terminal and mixing the sequence with the nanoparticles of gold. The indexing particles 12841 to 12844 are mixed with a sample solution containing the specific biological materials to hybridize the specific biological materials to the probes 12841b, 12842b, 12843b and 12844b. Then the hybrid is dripped at a certain amount onto the indexing particle fixing area on the substrate 128101, dried and scanned under the scanning electron microscope 128300 as described above to obtain an SEM image and elemental analysis images as described above. The assessment is performed with the method described with reference to FIG. 129.

Example 2

Descriptions are provided for a case in which the technique described in Example 1 is applied for quantitatively detecting specific biological materials directly from a mixture of mRNA or by cDNA converted.

FIG. 131(A) is a view schematically showing the indexing particles 12841 to 12844 and probes 12841a, 12842a, 12843a, and 12844a fixed onto surfaces of the indexing particles 12841 to 12844; FIG. 131(B) is a view schematically showing a specific biological material with poly A hybridizing to each of the probes 12841a, 12842a, 12843a, and 12844a; and FIG. 131(C) is a view schematically showing the poly T hybridizing to the poly A.

As shown in FIG. 131(A), also in Example 4, configuration of each of the indexing particles 12841 to 12844 is the same as that described in Example 3. Namely specific probes 12841a, 12842a, 12843a, and 12844a are fixed to the indexing particles 12841 to 12844 respectively. As shown in FIG. 131(B), poly A is added to the specific biological materials 12841b, 12842b, 12843b, and 12844b. It is needless to say that the probes 12841a, 12842a, 12843a, and 12844a are complementary to the specific biological materials 12841b, 12842b, 12843b, and 12844b respectively, but when mRNA is directly detected, 1) a sequence complementary to a 30- to 50-base sequence ranging from the exon closest the poly-A terminal of mRNA to the second exon thereof is used as a probe. 2) When measuring as a cDNA, if a single-stranded cDNA (prepared by removing mRNA sequence, after cDNA is synthesized, with RNase, and complementary to the mRNA) is used as a sample, the 30- to 50-base sequence ranging from the exon closest the poly-A terminal of mRNA to the second exon thereof in the same side as the mRNA is used as a probe. In this case, a probe based on a sequence complementary to cDNA is used in the probes in place of probes 12841a, 12842a, 12843a, and 12844a shown in FIG. 131(A); a single-stranded cDNA is used in place of the specific biological materials 12841b, 12842b, 12843b, and 12844b shown in FIG. 131(B); and a poly A is used in place of the poly T conjugated to the labeling particle shown in FIG. 131(C) each as a probe. 3) When a double-stranded dDNA is used as a sample, a portion of the sequence close to the 3′ terminal (30 to 50 bases) from the poly-A terminal of human mRNA sequence to the site where the first MboI sequence appears is used as a probe. In this case, a combination of a probe having the same sequence as that of the mRNA and poly T conjugated to the labeling particle shown in FIG. 131(C) is used in places of the probes 12841a, 12842a, 12843a shown in FIG. 131(A), or a combination of a probe having the sequence complementary to that of the mRNA and poly A conjugated to the labeling particle shown in FIG. 131(C) is used in places of the probes 12841a, 12842a, 12843a shown in FIG. 131(A). When a double-stranded dDNA is used, any desired synthetic DNA can be introduced to the MboI-cut-off-terminal of the dDNA by a ligation reaction using the DNA ligase. In the case, a sequence complementary to the synthetic DNA in place of the poly T is conjugated to a labeling particle shown in FIG. 131(C).

Descriptions are provided below for the case 1) as a representative case. For fixing probes to the indexing particles shown in FIG. 131(A), any known method may be used. For instance, oxygen plasma is irradiated to the indexing particles to generate an active group on a surface thereof, then an amino group is introduced to the surface by reacting 3-aminoethyl aminopropyl trimethoxysilane thereto, then the amino group is converted to a carboxylic group with a succinic acid anhydride, the carboxylic group is converted to succinimide ester, and a probe DNA having an amino group may be added to the 5′ terminal of the ester. When PNA is used as a probe DNA, the amino terminal of the probe DNA is processed according to the same procedure.

As shown in FIG. 131(C), poly T-gold nanoparticles with poly T (T30) fixed thereto (with the size of 20 nm) is prepared. For fixing poly T to the gold nanoparticles, a sequence having an SH group at the 5′ terminal is synthesized, and the sequence is mixed with the gold nanoparticles.

The mixture solution containing the sample mRNA shown in FIG. 131(B) (containing the RNase inhibitor), a suspension of indexing particles shown in FIG. 131(A), and a suspension of the poly T-gold nanoparticles shown in FIG. 131(C) are mixed and a mixture solution is heated to 70° C. 0.1 to 1-M NaCl and 50-mM citric acid (pH 7) containing a surface active agent as a dispersant are used as the reaction liquid. The reaction liquid is mildly agitated for one hour at 45° C. to always keep the particles in the suspended state. In this step, the mRNAs 12841b, 12842b, 12843b, and 12844b are captured by the indexing particles 12841 to 12844 having the complementary probes 12841a, 12842a, 12843a, and 12844a, and the poly T-gold nanoparticles are conjugated to the poly A portions of the captured mRNAs.

FIG. 132 is a view schematically showing a result of operations for mixing particles, a sample, and labeling particles to obtain hybrids among the DNA probes 12841a, 12842a, 12843a, and 12844a, mRNAs 12841b, 12842b, 12843b, and 12844b, and poly T-gold nanoparticles. In each hybrid, the indexing particle correspond to a probe on the surface, and further the probe corresponds to each mRNA. In this case, poly T in some poly T-gold nanoparticles may be conjugated to poly A in mRNA in the reverse direction, or off by one base, but these phenomena do not give substantial damages to the effect provided in the twenty-sixth embodiment. In FIG. 132, the probes 12841a, 12842a, 12843a, and 12844a fixed to the indexing particles 12841 to 12844 respectively at the 3′ terminal thereof and gold nanoparticles with poly T fixed at the 5′ terminal are used. For the reason described above, the complex structure as shown in FIG. 132 is provided, but also indexing particles 12841 to 12844 with the probes 12841a, 12842a, 12843a, and 12844a fixed thereto at the 5′ terminal may be used.

The substrate having the hybrids obtained in Example 2 can be assessed by irradiating an electron beam to the substrate with the scanning electron microscope 128300 for scanning to obtain an SEM image and an elemental analysis image, and according to the method described with reference to FIG. 129.

FIG. 133 is a view showing the situation during processing expected to provide an assessment result with higher precision as compared to the result provided by the homogeneous reaction described with reference to FIG. 132 in which the indexing particles, sample mRNAs, and poly T-gold nanoparticles are simultaneously reacted. At first, the DNA probes 12841a, 12842a, 12843a, and 12844a fixed on the indexing particles 12841 to 12844 are reacted to the mRNAs 12841b, 12842b, 12843b, and 12844b to prepare hybrids between the indexing particles and the sample mRNAs and unnecessary components are washed away. Then the hybrids may be reacted to the poly T-gold nanoparticles shown in FIG. 132.

In Examples 1 and 2, a plurality of biological materials contained in the sample can simultaneously be discriminated and detected by the indexing particles with specific probes fixed thereto. In this step, the reaction between the samples and indexing particles can be performed in batch in the suspended state, so that, different from the DNA microarrays or protein arrays in which a reaction is performed on a surface of the substrate, the reaction can be carried out homogeneously and the reaction speed is faster because the particles are dispersed in the solvent, which advantageously enables simultaneous measurement for multiple items.

For instance, a colon cancer tissue piece cut off from the affected area is frozen with liquid nitrogen, and the frozen piece is directly added to phenol chloroform and homogenized, and then the total RNA is extracted in the examples described above, but in this example, 0.1% (W/V) solution of magnetic particles (2.8 μm) containing gallium, yttrium, cesium, osmium, and platinum with various probes fixed thereto at 8 different contents mixed in 50 μl of total RNA solution is added as indexing particles for discriminating sequences having about 40-base length complementary to various mRNAs. Under the conditions of salt concentration of 1 M and citric acid concentration of 50 mM, the reactants are left for one minutes at 70° C. and mildly agitated at 45° C. for hybridization. Then a magnet is approached from outside of the vessel to attract magnetic particles with the supernatant removed, and then the reaction products are washed with 1M NaCl and 50 mM citric acid buffer solution (pH 7). The gold nanoparticles are suspended in the buffer solution and the mixture solution is agitated for one hour at the room temperature.

The indexing particle-mRNA-gold nanoparticle-labeled poly T complex produced through the hybridization reaction is collected on a wall of the vessel using a magnet and washed with 1-M Na Cl and 50-mM citric acid buffer solution (pH 7), and then is washed with a 70% ethanol aqueous solution, and is suspended in 100 μl of 70% ethanol. 1 μl of the mixture solution is dripped onto the vessel 128102 (See FIG. 128) in Example 1, and is dried for 3 hours in the depressurized state. A substantially long period is consumed for drying in the depressurized state so that high vacuum in the scanning electron microscope will not be affected.

The particle hybrids prepared as described above are observed with a scanning electron microscope. In this step, the number of gold colloidal particles captured on surfaces of the magnetic particles can be counted. Then the operating mode is switched to the detection mode with the energy dispersive characteristic X-ray detector. When the electron beam 128300-4 collides the indexing particles, X-rays having various wavelengths specific to elements on the surfaces of the indexing particles are generated. The X-rays with specific wavelengths are detected with the energy dispersive characteristic X-ray detector or wavelength dispersive characteristic X-ray detector 128300-8 to perform elemental analysis. With this operation, the magnetic particles coupled to the gold nanoparticles can be indexed, and quantities of mRNA molecules with the corresponding gold nanoparticle-labeled probes hybridized thereto can be identified. In this state, one gold nanoparticle corresponds to one mRNA molecule.

When the indexing particles with different concentrations of gallium, cesium, osmium, and platinum each as an element for indexing at 8 grades are used, 25000 types of human mRNAs can be measured in batch.

As described above, by using particles with various contents of various elements according to the twenty-sixth embodiment, it is possible to profile each mRNA at a single molecule level without using the prior art-based probe chips having a complicated structure and very difficult to be manufactured and also by using the particle counting technique.

Example 3

In Examples 1 and 2, particles for detection and quantification having the poly T having the same sequence as that of the indexing particles each with a discrete probe DNA fixed thereto are used. But in Example 3, for further raising the specificity, it is possible to develop a system in which the indexing particles 12841 to 12844 having discrete sequence probes 12841a, 12842a, 12843a, and 12844a respectively and labeling particles having the probes 12841d to 12841d corresponding to the indexing particles 12841 to 12844 respectively are used. Descriptions are provided below for this system.

FIG. 134(A) is a view schematically showing the discrete probes 12841a, 12842a, 12843a, 12844a and 12845a similar to examples 1, 2; FIG. 134(B) is a view schematically showing the state in which the probes 12841c, 12842c, 12843c, and 12844c are further added to the specific biological materials 12841b, 12842b, 12843b, and 12844b each having poly A hybridizing to the probes 12841a, 12842a, 12843a, and 12844a respectively as samples having mRNA sequences to be measured; and FIG. 134(C) is a view schematically showing a case in which the synthetic oligonucleotides (with the 20- to 50-base length) 12841d, 12842d, 12843d, and 12844d complementary to the probes 12841c, 12842c, 12843c, 12844c, and 12845c having the sequence described above (the specific material 12845c is not included in the samples shown in FIG. 134(B) are labeled with gold nanoparticles (20 nm). FIG. 134(D) is a view showing the state of the indexing particles, samples, and oligonucleotides labeled with gold nanoparticles after hybridization.

The indexing particles 12841 to 12845 with the probes 12841a, 12842a, 12843a, 12844a, and 12845a fixed thereon are reacted to the samples with mRNA mixed in shown in FIG. 134(B) to selectively capture the probes with the probes 12841b, 12842b, 12843b, and 12844b of the sample mRNAs onto the indexing particles, and then gold nanoparticles (20 nm) having synthetic oligonucleotides 12841d, 12842d, 12843d, and 12844d (with the 20 to 50 base length) having sequences complementary to the sequences corresponding to the indexing particles, namely to other portions 12841c, 12842c, 12843c, and 12844c of the same mRNAs are reacted thereto. Magnetic particles are used as the indexing particles. At first, indexing particles for the mRNA existing a lot such as β-globin or β-actin included in the mRNA are added, and only the reacted ones are attracted with a magnet to remove it. In this step, only unnecessary mRNAs are removed, and therefore the time required for hybridization may be short, for instance, 15 minutes. Then indexing particles for mRNA to be measured are added and reacted for 30 minutes, and then particles not reacted yet are removed by washing. Further gold nanoparticles having probes for the mRNAs are added and reacted for 30 minutes. What is important in this step is that the synthetic oligonucleotides 12841d, 12842d, 12843d, 12844d, and 12844d labeled with gold nanoparticles are mixture materials. Therefore, gold nanoparticles 12846 are detected only in the hybrids 12841e, 12842e, 12843e, and 12844e among the obtained particle hybrids, and the gold nanoparticles are actually not detected in the 12845e not including a target material therein.

Merits provided in Example 3 are as described below. Assume, for instance, that mRNA has a similar sequence. Also assumes a case in which the mRNA 12841b shown in FIG. 134(B) hybridizes not only to the probe 12841a fixed on the indexing particles, but also the probe 12842a. This types of phenomenon often occurs in DNA hybridization. In other words, in addition to the mRNA having the target sequence 12842b, also mRNA having the sequence 12841b is sometimes captured as an artifact on a surface of the indexing particle 12842. In this step, by reacting a group of probes containing the sequence 12841d and a group of probes containing the sequence 12842d shown in FIG. 134(C) discretely, it is possible to separate and count even the mRNA which can not be separated and identified with the probe sequence on the indexing particles by remarking the difference in the probe sequences as shown in FIG. 134(C). In a group of indexing particles each having a sequence corresponding to an indexing bead with gold nanoparticle not added thereto, the gold nanoparticles are not coupled to the surface of the indexing particle 12842a, so that the gold nanoparticle is not detected.

Example 4

In Example 4, detection of multiple biological materials through the antigen-antibody reaction is described with reference to FIG. 135.

At first the F(ab′)2 fragment is prepared by decomposing various types of monoclonal antibodies with papain. Magnetic particles (3 μm) coated with polystyrene containing Hf, Pt, and Ce each at the concentrations of 0, 1, 2, 3, 4, 6, 8, and 10 weight percents respectively are prepared as indexing particles. Different F(ab′)2 fragments 12891a, 12892a, 12893a, and 12894a are fixed to the indexing particles 12891, 12892, 12893, and 12894 to obtain the F(ab′)2 fragment-labeled indexing particles. Any known method may be employed for fixing the F(ab′)2 fragment. For instance, a minute quantity of a monomer with a functional group introduced therein is mixed in polystyrene and the functional monomer exposed on the surface may be used for fixing the F(ab′)2 fragment, or the surface is oxidized by oxygen plasma so that 3-aminoethyl aminopropyl trimethoxysilane is reacted with the amino group introduced into the surface thereof, then the amino group is converted to a carboxylic group with succinic acid anhydride, then the carboxylic group is changed to a form of succinimido ester. Then a probe DNA having an amino group at the 5′ terminal can be fixed thereto. As the F(ab′)2 fragment, for instance, antibodies to AFP91b, CEA92b, EpCAM93b and the like may be used. The F(ab′)2 fragment mixture is coated with sphingolipids. Serums (from healthy people and those suffering from liver cancer) doubly diluted with 2×PBS (1×PBS: 0.15M NaCl, 50 mM sodium phosphate buffer solution (pH 7.4)) containing 0.2% Tween 20 is added to the F(ab′)2-labeled indexing particle mixture. After agitated for 10 minutes at 37° C., the indexing particles are attracted with a magnet to the vessel wall, and the supernatant is discarded. The reaction product is washed with PBS containing 0.1% Tween 20. Monoclonal antibodies labeled with gold nanoparticles 12891c, 12892c, 12893c, and 12894c are added to the monoclonal antibodies for antigens to be measured (those having different epitopes from the F(ab′)2 fragments fixed on the indexing particles). Also the monoclonal antibodies are labeled with the F(ab′)2 fragment respectively, and about three SH groups are introduced for molecule with iminothiolane, and the SH group is labeled with the gold nanoparticles (20 nmφ). Reference numeral 12891c indicates a gold nanoparticles-labeled antibody to AFP, reference numeral 12892c indicates a gold nanoparticles-labeled antibody to CEA, reference numeral 12893c indicates a gold nanoparticles-labeled antibody to EpCAM, and reference numeral 12894c indicates a gold nanoparticles-labeled antibody to other antigens. The reacting materials are left for 10 minutes at 37° C. to obtain indexing particle-antigen-gold nanoparticle particle hybrids 12891d, 12892d, 12893d, and 12894d with the supernatant discarded, and the hybrids is washed with PBS containing 0.1% Tween 20, and is then washed with 50% ethanol dissolved in deionized water. In this step, proteins are denatured, but the indexing particle-antigen-gold nanoparticle particle hybrids do not collapse. 1 μl of the solution is added on the vessel 102 shown in FIG. 128 and dried in the depressurized state. Then recognition of the forms and elemental analysis are performed with a scanning electron microscope.

As a result, 64 gold nanoparticles are found on a surface of the indexing bead for AFP in a serum from healthy people, and 3200 gold nanoparticles in a serum from people suffering from cancer, which indicates that more gold nanoparticles are found in serums from people suffering from cancer. There is no substantial fluctuation in CEA or EpCAM, and in any of the samples, only about 30 to about 100 gold nanoparticles are obtained on surfaces of indexing beads to the antigens.

As described, the twenty-sixth embodiment of the present invention can be carried out in various forms, and in any case, hybridized sample DNA molecules or the like are detected one by one, so that the sensitivity substantially higher than that provided by the conventional methods is provided. An extremely minute quantity of DNA (RNA) can be detected with an extremely small volume of samples, and therefore a target DNA (RNA) can be detected without performing pre-amplification with PCR as required in the conventional techniques. Further labeling particle used for detection can be changed in its size and form, so that 6 to about 10 different types of samples can be analyzed in batch with the same element. This technique can be applied not only to the differential hybridization, but also to a method in which sample nucleotides are captured with the same probe and detected with different labeling probes. With the multiplex analysis method according to the twenty-sixth embodiment of the present invention, detection of alternative splicing or typing of a plurality of SNPs can advantageously be performed with one element.

Twenty-Seventh Embodiment

A twenty-seventh embodiment discloses a gel plate having the shape designed to reliably collect a separated substance of high purity from a separation gel spot for two-dimensional electrophoresis gel after the separation by electrophoresis, an electrophoretic separated substance collecting device, and a method of collecting an electrophoretic separated substance for collecting the separation gel spot while observing the same.

Considering the technique for collecting an electrophoretic separated substance to date, one will find that there is a problem in cutting out gel after separation. When the technique is automated, a separated band is recognized to cut out a position corresponding to the band; however, it is often difficult to cut it out while observing because a cut-out jig obstructs the view. Though it is typical to capture images and conduct a cut-out based on the image data, a delicate cut-out is difficult to cut out tender gel. When an electrophoretic separated substance is collected using an electrode, the electrode is moved to a spot position referring to captured images, as the electrode forms an obstacle.

In the twenty seventh embodiment, an electrophoretic separated substance included in a gel spot is collected while confirming the position and shape of the gel spot. For this purpose, gel is collected after being melted with the photothermal conversion using light. It is desirable that gel turns to be a thin layer with the thickness of 0.5 mm or less, preferably 0.2 mm or less, and is configured to contact a substrate in order to prevent a melted range from broadening owing to thermal diffusion. Convergence light is employed because the irradiated light is required to be sufficiently small as compared to a spot. In addition, as light needs to convert into heat, laser at 1480 nm is employed. Laser is absorbed into water in gel to generate heat. As it is necessary for gel to be melted by heat, gel used herein includes agarose, linear polyacrylamide, dimethylcellulose and the like including agarose, copolymers of agarose and linear polyacrylamide, dimethylcellulose and the like. When protein is to be separated, in particular, the aforementioned gel including low melting point agarose having a melting point of 60° C. or less is used.

Example 1

FIG. 136 is a view schematically showing the situation in which a separated band is formed by electrophoresis in Example 1. FIGS. 137(A), 137(B) and 137(C) are views schematically showing melting and collection of the separated band with heat described in FIG. 136. Herein descriptions are provided for an example of separating a PCR product with the one-dimensional electrophoresis.

A sample used herein is amplified products form cDNA of human mRNA prepared by PCR amplification using synthetic oligo DNAs (concentration: 0.2 pmol/μl) having the sequence identification No. 1 and No. 2 as primers respectively, which is according to the conventional technology. In the PCR, a cycle of denaturation at 94° C. for 5 seconds, and annealing at 55° C. for 10 seconds and at 72° C. for 10 seconds is repeated 35 times. The quantity of a reaction solution is 2 μl. The base length of the PCR product predicted from the database is 233 bp.

CTGAGCGAGT GAGAACCTAC TG: (sequence identification No. 1)

AGCCACATCA GCTATGTCCA: (sequence identification No. 2)

In FIG. 136, reference numeral 13601 indicates a glass substrate. On the glass substrate 13601 is applied 2% agarose gel 13602, 10 cm square and 0.1 mm thick. The agarose gel has a thickness of 0.2 mm and a size of 90×90 mm. On the agarose gel is provided a slit 13603 allowing addition of a sample. The size of the slit 13603 is 5 mm in width and 0.5 mm in the electrophoretic direction. In the figure, though a plane view is omitted, a plurality of the slits 13603 is provided at suitable regular intervals, for instance, at an interval of 10 mm, so that a plurality of samples can be subjected to electrophoresis.

Gel is configured to connect a negative electrode 13605-1 and a positive electrode 13605-2 via sponges 13604-1 and 13604-2 containing a buffer also serving as an electrolysis solution of Tris-acetic acid (pH 8.2). 0.5 μl of a sample solution is filled in the slit 13603 with capillary phenomenon, and is put in a wet box, to which is impressed electric field by immediately connecting the electrodes 13605-1 and 13605-2 to a power source. Of course, electrophoresis may be conducted, like the conventional submarine electrophoresis, by immersing gel in an electrolysis solution. The electrophoresis is carried out with the electric field intensity of 15 V/cm, and, for instance, for 30 minutes.

At this point of time, a prespecified amount of ethidium bromide is put in the gel, in addition to the electrolysis solution. Ethidium bromide is put in a sample; however, the electrolysis solution is not. Ideally, a PCR product dissolved in water is preferable, but a PCR solution diluted with water twofold or more may be used. This intends the stacking effect when a PCR product in a sample solution penetrates the gel. Ethidium bromide produces fluorescence when intercalated in a duplex DNA and excited with YAG laser at 545 nm, so that existence of ethidium bromide can be easily confirmed. Reference numerals 13606-1 to 13606-4 in the figure indicate separated bands separated with electrophoresis as described above. Herein the band 13606-3 is the target band to be melted and collected.

As shown in FIG. 137(A), laser light 13607 at a wavelength of 1480 nm is irradiated. Laser beams thereof are narrowed down to 50 μmφ. If the diameter of a spot for an electrophoretic separated band is smaller than this, laser beams are needed to be further narrowed down, and in this case, an objective lens for a microscope of about 10 magnifications may be used. Reference numeral 13613 indicates a lens when such an objective lens is inserted. It is to be noted that a fluorescent observation of gel in a wide range is not possible in this case, because the objective lens is inserted. Only a portion of an electrophoretic separated band targeted to be cut out can be confirmed; nevertheless, laser irradiation can be executed while moving a stage and confirming a target spot, not causing any problem. Generally, it is often the case that the objective lens 13613 is not used.

When laser beams 13607 are irradiated, temperature of the gel in the band 13606-3 portion of the gel 13603 rises within an extremely short period of time, and the gel is melted. Reference numeral 13609 is a pipet, which interlocks a syringe pump 13614 to allow sucking of the melted gel. As shown in FIG. 137(B), this operation opens a hole 13608, in which the separated band 13606-3 has once existed, and the separated band 13606-3 is sucked in the pipet as shown with reference numeral 13606-3′.

Then, as shown in FIG. 137(C), the pipet 13609 is moved, and the syringe pump 13614 is operated to discharge the separated band 13606-3′ from the pipet 13609 to a plate 13610, so that the resultant separated band 13606-3′ can be collected as a dot of separated band as indicated at reference numeral 13611.

FIGS. 138(A) and 138(B) are waveform diagrams each showing a dot 13611 of the separated band obtained as described above and the result of analysis of a solution obtained by PCR amplification before separation. Herein the figures are the waveform diagrams demonstrating the result analyzed with an i-chip (micro electrophoretic chip) and a cosmo i-chip electrophoresis device produced by Hitachi, Ltd.

As shown in FIG. 138(A), the result of analyzing the dot 13611 of the separated band provides a substantially single electrophoretic separated band at a position of 230 bp. When the result of analyzing the dot 13611 of the separated band is examined in comparison with the database, it can be understood that a predicted base length of the PCR product does not represent any band other than the peak 13620-3′ at 233 bp. Peaks 13620-1, 13620-2, 13620-3 and 13620-4 corresponding to a plurality of bands are detected from the PCR product before separation.

Example 2

In Example 2, descriptions are provided for an example of separating and collecting a protein separation spot separated by the two-dimensional electrophoresis with the device according to the twenty seventh embodiment.

Electrophoresis in one dimension is the isoelectric focusing electrophoresis. In the isoelectric focusing electrophoresis, 0.5% agarose gel containing carry ampholyte (pH 4-7) in a glass tube 1 mm in diameter and 8 cm long is used for migration at 400 V for 8 hours. After finishing the migration, the gel is pushed out from the glass tube, and is placed at a position 10 mm from the negative pole side of the gel of the second dimension 90×90×0.2 mm in size. The gel of the second dimension is 2% agarose. Tris-acetic acid buffer (pH 8.5) is used as a buffer solution in the second dimension. Staining is conducted with Coomassie brilliant blue R250 in compliance with appropriate information to find that a protein separated band is stained blue.

FIG. 139 is a schematic view showing configuration of a device for recovering a specific band separated by two-dimensional electrophoresis.

The present device has a general observation optical system 136200 on the upper surface of separation gel 136100 and a laser heating optical system 136300 on the under surface of separation gel 136100, in order to heat with convergence light while observing a protein spot separated on the two-dimensional electrophoretic separation gel 136100.

Firstly, the general observation optical system 136200 is configured as described below. Light irradiated from a light source 136170 is irradiated to the electrophoretic separation gel 136100. The irradiated light passes through an objective lens 136205 and a filter 136206 to reach a CCD camera 136207. Image data obtained in the CCD camera 136207 is sent to an image processing analysis device 136161 and is used for detecting and aligning a spot and monitoring the state of laser heating.

In the laser heating optical system 136300, light irradiated from a laser light source 136141 is selected based on a wavelength, according to, for instance, a laser irradiation signal given by a user upon viewing a monitor screen, and then, the irradiated light is induced to an objective lens 136305 by a dichroic mirror 136310 to converge on the gel 136100. When a converging point is needed to shift, the dichroic mirror 136310 is moved accordingly to shift the convergence position of laser within a plane surface of the gel 136100. Gel present at the site where laser convergence light is irradiated is melted, which is observable as a light emitting point with the optical system 136200. Laser irradiation by the objective lens 136305 is sent to the image processing analysis device 136161 via the dichroic mirror 136310, mirror 136144, lens 136145 and filter 136146. The image processing analysis device 136161 sends a signal for stopping laser irradiation to the laser light source 136141 upon information on laser irradiation.

Image data obtained in the camera 136207 is analyzed with the image processing analysis device 136161. The movable dichroic mirror 136310 and a motor for moving stage 162 for freely moving in the X-Y direction in order to control the position of a movable XY stage 136304 with the gel substrate mounted thereon having a temperature regulating plate 136101 can be controlled based on various results of analysis. This enables recognition of the shape of a protein separated spot or tracking of laser irradiation after the recognition. Alternatively, it is possible to continually recognize a spot to subject the same to laser heating in sequence, or shifting a position of the pipet 13609 to collect melted agarose by moving the syringe 13614.

After finishing the laser irradiation, the pipet 13609 immediately shifts to the position where a spot has once existed to suck the melted agarose. A heater is attached to the pipet 13609, so that the temperature thereof can be maintained in a range from 30° C. to 65° C. if necessary. As the melted agarose is re-solidified over time, access to the pipet 13609 should be made without delay. The pipet 13609 accesses the proximity of the laser irradiation optical axis during laser irradiation, and immediately after finishing the laser irradiation, shifts to a portion where agarose is melted to suck the melted agarose. Though not shown in the figure, the pipet 13609 is attached to an arm capable of moving in the X-Y direction as well as in the vertical direction, and quickly shifts to a spot position following the directions from the image processing analysis device 136161, as indicated with the arrows 136210.

Agarose sucked in the pipet is analyzed similarly as described in Example 1.

Example 2

FIG. 140 is a view showing a collecting method in Example 2 which is different from the method of collecting thermally melted gel of the electrophoretic spot portion melted by being heated with converged light, as described in Example 1 and a structure of a pipet used in the method. The present method is described as a method in which a pipet used herein substitutes the pipet 13614 for the device of collecting a specific band separated with the two-dimensional electrophoresis, and protein is collected from a protein separation spot two-dimensionally developed by the electrophoresis.

A chip 136401 is attached to a pipet 136400. The chip 136401 is used as disposable. Firstly, a cylinder 136400′ of the pipet is operated to fill the pipet with an electrolysis solution 136440. A first electrode 136402 is attached to the inside of the pipet 136400. The pipet 136400 sucks gel melted with convergence light in the same way as Example 1. At this point of time, temperature of the gel drops, and the gel is gelated again in the pipet chip 136401. Then the tip of the chip 136401 is immersed in a prespecified amount of an electrolysis solution in a vessel 136406. A second electrode 136403 is attached to the vessel 136406. Electric field is impressed between the first electrode 136402 as negative pole and the second electrode 136403 as positive pole at 15 V/cm. Thus separated protein contained in the gel 136405 solidified in the chip 136401 is eluted in the electrolysis solution by electrophoresis. This operation enables to collect a target protein in the vessel 136406.

Twenty-Eighth Embodiment

As a twenty-eighth embodiment, a new technique is described which, expanding on the scope of a conventional method of simply isolating biochemical substances, isolates molecules active to a cell and found only in very small quantity in a functionally traceable manner, in order to clarify functionality of a cell. For this purpose, a solution including a small number of cells or cell masses are placed on a basal plate as a liquid droplet, and a focused light beam is irradiated on the liquid droplet on the basal plate.

FIG. 141 (A) is a plan view of a cell-holding basal plate 141100 suitable for the 28th embodiment of the present invention, and FIG. 141 (B) is a cross-sectional view of the plan view viewed at the A-A line on the plan view to the direction of the arrow. A reference numeral 14101 indicates a silicon basal plate with, for example, a size of 20 mm×20 mm and a thickness of 1 mm. On the surface of the basal plate 1 is a hydrophobic area 14102, and in the hydrophobic area 14102 are provided an array of hydrophilic areas 14103. A size of a hydrophilic area 14103 is small enough in comparison to a size of a diameter of the liquid droplet to be placed on the hydrophilic area 14103. A reference numeral 14104 refers to a marker for positioning, and is formed on a side of the silicon basal plate 14101.

For the creation of the hydrophilic area and the hydrophobic areas, an upper surface of the silicon basal plate may, for example, first be oxidized, generating a hydrophilic SiO2 thin film on the entire surface. Thereafter, the SiO2 thin film is dissolved and removed from areas intended to be hydrophobic with hydrofluoric acid. Alternatively, if on the surface of the material for the basal plate 14101 is formed the SiO2 thin film in advance and the surface is therefore hydrophilic, the hydrophobic area may be formed by placing hydrophobic material such as fluorine resin or silicon resin thereon. In this case, the hydrophilic areas in the hydrophobic area are depressed by a thickness of the hydrophobic material. FIG. 141 is an example in which the hydrophobic area 14102 is formed with the latter method.

FIG. 142 (A) is a conceptual diagram illustrating an example of a system configuration for forming a liquid droplet containing a cell on the hydrophilic area 14103 on the cell-holding basal plate 141100 suitable for the 28th embodiment of the present invention, and FIG. 142 (B) is a cross-sectional view showing a liquid droplet containing a cell formed on a hydrophilic area 14103 of the cell-holding basal plate 141100.

In FIG. 142 (A), a liquid droplet containing a cell 14112 is formed on the hydrophilic area 14103 on the cell-holding basal plate 141100 while a liquid droplet at a tip of a pipette 14111 for forming a liquid droplet containing a cell 14112 is being monitored optically. A reference numeral 14119 indicates a stage driven in the X-Y direction, and a reference numeral 14127 is a driving device for the stage 14119. On an upper surface of the stage 14119 is placed the cell-holding basal plate 141100. Over the cell-holding basal plate 141100 is provided the pipette 14111 having sucked up and contained suspension 14113 containing the cell 14112 for containment in the liquid droplet. To a base of the pipette 14111 is connected a syringe pump 14131 via a tube 14130, and to the syringe pump 14131 is connected a driving device 14132. When the syringe pump 14131 is driven by the driving device 14132, the suspension 14113 contained in the pipette 14111 is squeezed out together with the cell 14112. In the FIG. 142 (A), the base of the pipette 14111 and the connection part of the tube 14130 are illustrated as not contacting each other, but this is simply for the purpose of showing the pipette 14111 enlarged.

At the tip of the pipette 14111 is placed a tip of another pipette 14120 for supplying culture fluid to the tip of the pipette 14111. To a base of the pipette 14120 is connected a syringe pump 14135 via a tube 14134, and to the syringe pump 14135 is connected a driving device 14136. When the syringe pump 14135 is driven by the driving device 14136, the culture fluid contained in the pipette 14120 is squeezed out.

There is also provided a vertical driving device 14137 for driving the pipette up and down for transferring the liquid droplet formed at the tip of the pipette 14111 to the hydrophilic area 14103 on the cell-holding basal plate 141100. In this example, the vertical driving device is connected to the pipette 14111. If a user issues an instruction for lowering the pipette 14111 to the vertical driving device 14137, the pipette 14111 moves downward, and the liquid droplet formed at the tip of the pipette 14111 is transferred to the hydrophilic area 14103 on the cell-holding basal plate 141100. If the user issues an instruction for restoring a position of the pipette 14111 to the vertical driving device 14137, the pipette 14111 returns to the original position as shown in FIG. 142 (B). The restoring of the pipette 14111 to the position shown in FIG. 142 (B) may be controlled with a personal computer 14126 sequentially from the time of the lowering operation. A dot-dash line 14139 indicates that the vertical driving device 14137 is connected to the pipette 14111.

Further, a light source 14116 and a light-condensing lens 14117 are provided, forming an optical system for monitoring a size of the liquid droplet to be formed inside the pipette 14111 near the tip or at the tip thereof, and a collimate lens 14118 and a monitor 14125 are provided below the cell-holding basal plate 141100 facing the light source 14116 and the light-condensing lens 14117. For this reason, the cell-holding basal plate 141100 and the stage 14119 need to be transparent optically. The reference numeral 14126 indicates a so-called personal computer, and supplies an appropriate control signal to the driving devices 14127, 14132, 14136 and 14137, generated from a program stored in advance in response to an input signal from the monitor 14125, or based on an input-operation signal 14128 of the user watching the image on the screen of the monitor 14125. It is not shown in the FIG. 142 (A), but it is convenient if an identical image detected and shown by the monitor 14125 is also shown on the monitor of the personal computer 14126. In this configuration, a small CCD camera may be used as the monitor 14125. The input-operation signal 14128 is given with an input device of the personal computer 14126.

If the cell-holding basal plate 141100 and the stage 14119 are not transparent optically, the light may be irradiated from above, and reflected light may be monitored. This means that the collimate lens 14118 and the monitor 14125 are provided on the same side as the light source 14116 above the basal plate, and the reflected image is observed. For example, the light may be irradiated diagonally, and the image is observed from the right angle.

A size of the pipette 14111 is described hereinafter. It is necessary that the pipette 14111 is such that a liquid droplet can be formed at the tip thereof with an appropriate size for containing a required number of cells. The pipette 14111 is used after sucking the suspension 14113 containing the cells into inside the pipette 14111 with the functionality of the pipette 14111, and upon forming a liquid droplet 14121, the cells passing through the tip of the pipette 14111 must be detected without error with the monitor 14125. Therefore the diameter of the pipette 14111 at the tip thereof must be large enough to allow a cell, or a cell mass containing a prespecified number of cells to pass, but not too large to allow too many cells exceeding the counting capability to pass at once. This means that the pipette must not be culture pipettes generally used at present with a large diameter, but a transparent pipette with a diameter of 20 to 100 μm for general animal cells and one with a diameter of about 5 μm for bacteria and other microorganisms.

An operation for forming the liquid droplet 14121 containing the cell 14112 on the hydrophilic area 14103 on the cell-holding basal plate 141100 is described hereinafter. Upon start-up of the system, the user positions the cell-holding basal plate 141100 for a prespecified start-up position with the help of the marker 14104 described in FIG. 141 (A). Next, the stage 14119 is moved with the driving device 14127 based on the input-operation signal 14128 for moving the point on the cell-holding basal plate 141100 for forming the liquid droplet 14121 containing the cells 14112 to a position corresponding to the tips of the pipettes 14111 and 14120. When the cell-holding basal plate 141100 is moved to the prespecified position, an operation is performed for squeezing out the cell suspension liquid 14113 in the pipette 14111 together with the cells 14112. At the time of the operation, the outside of the tip of the pipette 14111 and the inside near the tip thereof are monitored with the optical system consisting of the light source 14116 and the monitor 14125. Output from the monitor 14125 is fed to the personal computer 14126, and, based on a picture image calculation result of the personal computer 14126, the driving device 14132 may be operated for controlling liquid sent by the syringe pump 14131.

While monitoring the tip of the pipette 14111 with the monitor 14125, the driving device 14132 is operated, the syringe pump 14131 is driven, the suspension 14113 containing the cells 14112 is squeezed out of the tip of the pipette 14111, and the liquid droplet 14121 is formed at the tip of the pipette. When the personal computer 14126 recognizes through the monitor 14125 that a prespecified number of cells are inserted into the liquid droplet 14121, the personal computer 14126 issues a halt instruction to the driving device 14132 and the syringe pump 14131 is stopped.

In order to make a description simpler, the number of cells 14112 inserted into the liquid droplet 14121 is assumed to be one hereinafter, although the number of cells may be set at the discretion of the user. For instance, it may be set that 10 cells are inserted to the liquid droplet 14121. The cell 14112 may be recognized directly in the liquid droplet 14121 at the tip of the pipette 14111, but more effectively, the cell 14112 moving inside the pipette 14111 may be monitored with the monitor 14125, the position and the moving speed of the cell inside the pipette may be calculated with the personal computer 14126, the timing that the cell is squeezed out to the liquid droplet 14121 from the tip of the pipette 14111 may be forecast, and the syringe pump 14131 may be controlled accordingly. The latter recognition method is advantageous if, for instance, a plurality of cells are moving inside the pipette with a short interval and only one cell is to be inserted into the liquid droplet.

If the cell concentration in the cell suspension 14113 is low, it is possible to start forming the liquid droplet 14121 just prior to the cell is squeezed out of the tip of the pipette 14111 and stop forming the liquid droplet after a prespecified time, for forming the liquid droplet 14121 of a desired size. When it is not desired to form the liquid droplet, the liquid squeezed from the tip of the pipette 14111 can be, for example, blown away with a blower. Alternatively, the liquid may be discharged to a drain formed outside the basal plate 14101.

If, on the other hand, the cell concentration in the cell suspension 14113 is high, the volume of liquid squeezed out of the pipette 14111 varies. Namely, the frequency with which the cell 14112 is squeezed out from the pipette rises, and if the time for squeezing out the liquid is fixed at a prespecified length, there is a possibility that a next cell is inserted into the liquid droplet 14121. The pipette 14120 is used in this case. The pipette 14120 and the syringe pump 14135 connected thereto are filled with culture fluid or cell diluting fluid only. When the personal computer 14126 recognizes through the monitor 14125 that a cell 14112 is squeezed out into the liquid droplet 14121, the personal computer 14126 issues a halt instruction to the driving device 14132 and the syringe pump 14131 is stopped, and the personal computer 14126 further calculates a cubic volume of the liquid droplet 14121 at that time from a movement distance of the syringe pump 14131 for forming the liquid droplet 14121. The personal computer 14126 further calculates a difference between the cubic volume of the liquid droplet 14121 and a desired cubic volume. Based on a result of the calculation, the culture fluid or the cell diluting fluid is added from the pipette 14120 to the liquid droplet 14121 already formed by that time with a signal sent from the personal computer 14126 to the driving device 14136, driving the syringe pump 14135 and adding the fluid with the pipette 14120 until the cubic volume of the liquid droplet 14120 reaches the prespecified volume.

It is desired that the tip of the pipette 14120 is thin enough for the cell not to pass, for instance 0.2 μmφ in diameter, so that the cell in the liquid droplet does not flow upstream to the pipette 14120. Alternatively, the pipette 14120 may be formed to have a filtering structure of 0.2 μm in diameter at the tip.

The liquid droplet 14121 containing a cell formed in the manner described above is brought in contact with the hydrophilic area 14103 on the basal plate 14101 placed on the stage 14119 by the vertical driving device 14137 of the pipette 14111, and the liquid droplet 14121 is transferred to the hydrophilic area 14103 on the basal plate 14101. The liquid droplet 14121 is shed by the hydrophobic area 14102, and is fixed to the energy-stable position at the hydrophilic area 14103 in a self-forming manner. The operator finishes the operation when it is confirmed that the liquid droplet 14121 containing the cell 14112 is transferred to the hydrophilic area 14103 on the basal plate 14101, that is, the hydrophilic area 14103 on the cell-holding basal plate 141100.

FIG. 142 (B) is a cross-sectional view of the liquid droplet containing a cell placed in the hydrophilic area 14103 on the cell-holding basal plate 141100, formed with the system for forming a liquid droplet containing a cell on the cell-holding basal plate 141100 as described with reference to FIG. 142 (A). On the hydrophilic area 14103 of the basal plate 14101 is placed a cell 14112, and a liquid droplet 14115 is formed, enclosing the cell.

FIG. 143 is a oblique perspective view illustrating an outline of an example device for destroying a cell in a liquid droplet, targeting the liquid droplet 14115 formed on the basal plate as described above with reference to FIGS. 141 and 142. The device described in FIG. 143 is an independent device, but it is convenient if the device is formed combined with the system for forming the liquid droplet as described with reference to FIG. 142 above and placed next to each other, and the personal computer 14126 controls the movement of the cell-holding basal plate 141100 by controlling the stage 14119, and irradiation of a laser beam.

In FIG. 143, the liquid droplet on the cell-holding basal plate 141100 can be irradiated with light from both above and below. The light from the light source 14141 placed above is first adjusted to a specific wavelength with a filter 14142, concentrated with a condenser lens 14143, and irradiated to the liquid droplet 14115. The irradiated light is led through an objective lens 14147, a dichroic mirror 14148, a mirror 14149 and a filter 14151 to a camera 14152 as transmitted light, and the transmitted light image of inside the liquid droplet 14115 is formed on a light receiving surface of the camera 14152. For this reason, it is desirable that the cell-holding basal plate 141100 and the stage 14119 are made of optically transparent material, as with the system for forming the liquid droplet. Specifically, glass such as borosilicate glass or silica glass, or resin such as polystyrene or plastic, or a solid basal plate such as a silicon basal plate, is suitable. If a silicon basal plate is used for the basal plate 1 of the cell-holding basal plate 141100, the wavelength of the light from the light source 14141 described above should be 900 nm or longer.

Light irradiated from a light source 14147 placed below is first wavelength-selected with the filter 14146, then led to the objective lens 14147 through the dichroic mirror 14148, and is used as excitation light for fluorescence for observing inside the liquid droplet 14115. The fluorescent light generated inside the liquid droplet is observed with the objective lens 14147 again, and the fluorescent light after the excitation light is removed with the filter 14151 can be observed with the camera 14152.

By adjusting a combination of the filters 14142, 14146 and 14151, it is possible to observe just the transmitted light with the camera 14152, just the fluorescent light, or both the transmitted light image and the fluorescent light image at the same time with the camera 14152.

The picture image data obtained with the camera are analyzed with the personal computer 14126, and the stage 14119 can be controlled accordingly so that laser beam 14163 may be focused on the liquid droplet 14115. If the laser beam 14163 is of type ultraviolet laser, it is dangerous to observe the light directly, and the CCD camera 14152 is used for observation. Again, although it is not illustrated in FIG. 143, it is convenient to display the picture image data being detected with the CCD camera 14152 on the monitor of the personal computer 14126.

A reference numeral 14161 indicates a laser beam source and a reference numeral 14162 refers to a filter for wavelength selection: in an example 1, the laser can irradiate a third harmonic component of a YAG laser at 355 nm in wavelength. Intensity of the laser beam 14163 is over around 200 μJ, and the beam is concentrated for radiation to the cell. In FIG. 143, the laser beam 14163 is irradiated from the laser beam source 14161 directly to the liquid droplet 14115; it is also possible to place mirrors in the path of the laser beam 14163 as appropriate for leading the laser beam, if structural constraints make it impossible to irradiate the liquid droplet 14115 directly. The irradiation from the laser beam source 14161 may be controlled with the personal computer 14126. The user can also control the irradiation from the laser beam source 14161 by inputting an operation signal 14128 to the personal computer.

When the laser beam 14163 is focused on the cell 14112 in the liquid droplet 14115 and a laser pulse of 200 μJ is irradiated to the cell under observation with a microscope, it is observed that membrane of the cell is destroyed instantaneously and cell contents are splashed. Since the laser in the example is an ultraviolet laser, all the optical components in the laser irradiation system are compatible with ultraviolet. If the size of the liquid droplet is large, or if there are many cells in the liquid droplet, the intensity of the laser beam 14163 may be strengthened. It is easy to attain an output power of around 5 mJ.

The selection of the wavelength of the light and the way to irradiate the light are important. If a wavelength is used for which the water has light absorptivity, the water, or the solvent itself, is evaporated. A wavelength should therefore be selected which is absorbed by the cell but absorptivity of which by water is ignorable. Specifically, one method is to use a wavelength in an ultraviolet band, which biochemical substances, proteins and nucleic acids absorb for conversion to heat. Alternatively, certain visible light can destroy the cell, although the mechanism is not known. It is known that the cell can be killed and destroyed instantaneously if the light is irradiated to the cell as converged light.

The purpose of the twenty-eighth embodiment of the present invention is to destroy a very small number of cells, such as a single cell, effectively and analyze or collect the contents efficiently thereafter, and for this purpose the cell is contained in a liquid droplet, so that dilution and splash of cell contents at the time of cell destruction are prevented by containing them in the liquid droplet. Generally, the cell and the water used as solution have slightly different light-absorptivity characteristics, and therefore, light with a wavelength, which is little adsorbed by water but is absorbed well by cell organs, is irradiated on the liquid droplet, thereby heating and destroying the cell only and retaining the contents of the destroyed cell in the liquid droplet. If the light absorption and temperature increase are slow, the temperature of the water, a component of the solution, rises as well. It is therefore important to irradiate a strong light for an instance, thereby realizing a faster temperature increase for the cell with light absorptivity than the temperature increase for the solution, and solubilizing the cell.

FIG. 144 is a conceptual diagram illustrating a concrete example of collecting biological substances directly from suspension containing fragments of the destroyed cell in the liquid droplet 14115 according to the method described in the embodiment above. A prespecified quantity (0.1 μl) of fluorescent intercalator CYBR Green II for RNA is added to the suspension containing fragments of the destroyed cell in the liquid droplet 14115. This is directly infused to the liquid droplet 14115 with a capillary tube. To the liquid droplet 14115 are contacted a platinum electrode 14171 and a capillary 14172 with an inner diameter of 50 μm filled with electrophoretic separation medium containing linear dimethylpolyacrylamide as a main ingredient. The other end of the capillary 14172 is dipped into buffer fluid in a container 14173. One end of a platinum electrode 14174 is also dipped into the buffer fluid. An electric field of 50 v/cm is applied to the capillary 14172 for 10 seconds between the platinum electrode 14171 as a negative electrode and the platinum electrode 14174 as a positive electrode. Thereafter, 50 μl of electrophoretic buffer fluid (Tris-HCl) is added to the liquid droplet 14115, and an electric field of 200 v/cm this time is applied, continuing the process of electrophoresis. Aragon laser from an argon laser source 14175 of 488 nm, located at 10 cm from the liquid droplet 14115, is irradiated to the liquid droplet 14115, and resulted fluorescence is monitored with a detector 14176.

It is omitted in FIG. 144, but it is desired that the electrode 14171 and the capillary 14172 are held in an arm manipulator with the tip thereof movable to a desired position, like the vertical driving device 14137 described with reference to FIG. 142, which is controlled with the personal computer 14126.

FIG. 145 is a electropherogram illustrating an example of an electrophoretic pattern observed in the electrophoresis. The horizontal axis represents the electrophoretic time, while the vertical axis represents fluorescence intensity. Two sharp peaks 14181 and 14182 represents two types of rRNAs, a broad band 14183 originates from mRNA, and a reference numeral 14184 corresponds to a polymer genome. As is observable from FIG. 145, the biological substances as described above are discharged from the other end of the capillary 14172 to the container 14173 after a period corresponding to the electrophoresis time. This means that biological substances can be collected from a very small number of cells with a method according to the twenty-eighth embodiment of the present invention. Furthermore, as these biological substances are obtained by destroying the cell in the liquid droplet, it is obvious that conditions of the biological substances in the cell at the time of cell destruction are stably fixed.

Twenty-Ninth Embodiment

A twenty-ninth embodiment discloses a reaction tracking device of extremely small amount which enables rapid reaction tracking using a different principle from a conventional stopped-flow principle. This embodiment utilizes a phenomenon in which a solvent mainly composed of water becomes a liquid droplet and rolls on a water-repellent substrate. The liquid droplet can move to any position by a slight external force. Making use of this phenomenon, a plurality of extremely small amount of liquids including dissolved substances for reaction are arranged on the substrate as liquid droplets in order to start a rapid reaction by making each of the liquid droplets colliding against one another. The liquid droplet weighs basically between a submicroliter and several microliters, making it possible to start the reaction instantly.

Example 1

Example 1 uses the twenty-ninth embodiment in order to track a DNA hybridization process.

FIG. 146 (A) is a flat view of a reaction substrate 146100 suitable for implementing the twenty-ninth embodiment; FIG. 146 (B) is a cross-sectional view of the flat view taken along the line A-A and viewed in the direction indicated by the arrow. The reference numeral 14601 indicates a silicon substrate, for example, with a thickness of 1 mm and a size of 20 mm×20 mm. The surface of the substrate 14601 is a hydrophobic region 14602, in which three hydrophilic regions 146031, 146032 and 146033 are arrayed. The dimension of the hydrophilic region 14603 is small enough compared with a diameter of the liquid droplet to be held in this hydrophilic region, for example, a dimension of 0.01 mm2. Three hydrophilic regions 146031, 146032 and 146033 are connected by narrow hydrophilic grooves 146041 and 146042, for example with a width of 2 μm. The reference numeral 14605 is a marker for positioning, and formed all over the silicon substrate 14601.

In FIG. 146 (B) the entire central portion of the substrate 14601 has become a hydrophilic region, because the cross-sectional surface thereof is positioned in three hydrophilic regions 146031, 146032 and 146033 and the hydrophilic grooves 146041 and 146042 for connecting these hydrophilic regions. A method of producing the hydrophilic region and the hydrophobic region is, for example, oxidizing a top surface of the hydrophobic silicon substrate 14601 to make the entire region a hydrophilic thin film of SiO2 once. After that, the SiO2 thin film in the region to become hydrophobic is dissolved and removed using fluorine to produce a hydrophobic region. Alternatively, when the surface of the substrate 14601 is hydrophilic with the SiO2 thin film formed thereon in advance, the hydrophobic region is formed by arraying a hydrophobic substance such as a fluoride resin and a silicon resin thereon. In this case, the hydrophilic region existing in the hydrophobic region has become low in accordance with a thickness of the hydrophobic substance. FIG. 146 shows an example of using the latter method to form the hydrophobic region 14602.

In Example 1, the liquid droplets including substances for reaction to the hydrophilic regions 146031 and 146033 are formed in advance; and each of the liquid droplets is guided through the hydrophilic grooves 146041 and 146042 to move each droplet to the hydrophilic region 146032 and to collide in the hydrophilic region 146032.

FIG. 147 (A) is a conceptual diagram describing an example of a system construction for constructing the liquid droplet including the substance for reaction to the hydrophilic regions 146031 and 146033 of the reaction substrate 146100 suitable for implementing the twenty-ninth embodiment; FIG. 147 (B) is a plan view showing a portion of the reaction substrate 146100 on which the liquid droplet including the substance for reaction to the hydrophilic regions 146031 and 146033 is formed in the hydrophilic region 14603 of the reaction substrate 146100.

In FIG. 147 (A), while optically monitoring the liquid droplet at the end of a pipette 14611 for forming the liquid droplet including the substance for reaction, the liquid droplet including the substance for reaction to the hydrophilic regions 146031 and 146033 of the reaction substrate 146100 is formed. The reference numeral 14619 indicates a stage driven in the direction of XY; and the reference numeral 14627 is a drive unit of the stage 14619. The reaction substrate 146100 is placed on the top surface of the stage 14619. The pipette 14611 with a suspension 14613, which is to be included in the liquid droplet and includes the substance for reaction, siphoned up and maintained beforehand is placed on top of the reaction substrate 146100. A syringe pump 14631 is provided at the bottom of the pipette 14611 through a tube 14630; and a drive unit 14632 is installed on the syringe pump 14631. When the syringe pump 14631 is driven with the drive unit 14632, the suspension 14613 inside the pipette 14611 is pushed out together with the substance for reaction. In the figure, the joint of the base of the pipette 14611 and the tube 14630 looks apart, because the pipette 14611 is enlarged for display; therefore the joint is not separated.

A pipette vertical drive unit 14637 is provided for transferring the liquid droplet formed at the end of the pipette 14611 to the hydrophilic regions 146031 and 146033 of the reaction substrate 146100. In this example, the vertical drive unit 14637 is linked to the pipette 14611. When a signal to lower the pipette 14611 is given to the vertical drive unit 14637 by a user, the pipette 14611 moves down, transferring the liquid droplet formed at the end of the pipette 14611 to the hydrophilic regions 146031 and 146033 of the reaction substrate 146100. When a signal to restore the pipette 14611 is given to the vertical drive unit 14637 by a user, the pipette 14611 returns to the position shown in the figure. Restoring the pipette 14611 to the position shown in the figure may be performed time sequentially using a personal computer 14626 starting from the downward operation. A dashed line 14639 indicates the link between the vertical drive unit 14637 and the pipette 14611.

A light source 14616 and a collective lens 14617 constituting an optical system are provided to monitor the dimension of the liquid droplet formed inside the neighborhood of and at the end of the pipette 14611; and in the opposite position, a collimate lens 14618 and a monitor 14625 are provided in the lower part of the reaction substrate 146100. Therefore, the reaction substrate 146100 and the stage 14619 need to be optically transparent. The reference numeral 14626 indicates a personal computer for giving a control signal obtained from a prescribed program stored beforehand in accordance with an input signal from the monitor 14625 and a personal computer for giving a necessary signal to the drive units 14627, 14632 and 14637 in accordance with an operation input signal 14628 given by the user while watching the display of the monitor 14625. Although not shown here, it is convenient to display the same screen as the screen detected by the monitor 14625 on the monitor of the personal computer 14626. By doing this, the monitor 14625 can become a small size CCD camera. The operation signal 14628 is given through the input device of the personal computer 14626.

When the reaction substrate 146100 and the stage 14619 are not optically transparent, the reflection of the light illuminated from the top surface is used as a monitor.

The size of the pipette 14611 is described hereinafter. The pipette 14611 needs to construct, at the end thereof, a liquid droplet with a suitable size including the substance for reaction. On the other hand, the suspension 14613 including the substance for reaction is siphoned up with the pipette 14611 before using the suspension 14613; therefore, the pipette 14611 needs to be big enough to be able to hold the suspension 14613 with a volume necessary to construct a liquid droplet 14621.

A method of forming the liquid droplet 14621 including the substance for reaction to the hydrophilic region 14603 of the reaction substrate 146100 is described herein after. First, when the system starts, the user chooses a position so that the reaction substrate 146100 is in the prescribed start position, focusing attention on the marker 14605 described in FIG. 146 (A). Next, in accordance with the operation input signal 14628 for transferring the position of the liquid droplet 14621 including the substance for reaction to the position corresponding to the end of the pipette 14611, the stage 14619 is operated using the drive unit 14627. When the reaction substrate 146100 comes to the prescribed position, an operation for discharging the suspension 14613 including the substance for reaction inside the pipette 14611 is performed. At this time, the outside of the end of the pipette 14611 and the inside of the neighborhood of the end of the pipette 14611 are monitored with the optical system consisting of the light source 14616 and the monitor 14625. The liquid pumping with the syringe pump 14631 can be controlled by inputting the output of the monitor 14625 into the personal computer 14626 and by operating the drive unit 14632 based on the image computing result of the personal computer 14626.

While the tip of the pipette 14611 is monitored with the monitor 14625, the liquid droplet 14621 is formed at the tip of the pipette by operating the drive unit 14632, activating the syringe pump 14631, discharging the suspension 14613 including the substance for reaction from the tip of the pipette 14611. At this time the personal computer 14626 recognizes that the liquid droplet has reached the prescribed size through the monitor 14625 and gives the stop command to the drive unit 14632 to stop the syringe pump 14631.

The liquid droplet 14621 of the suspension including the substance for reaction, which is produced according to the above-mentioned method, is contacted with the hydrophilic region 146033 on the substrate 14601 placed on the stage 14619 using the vertical drive unit 14637 on the pipette 14611, and transferred to the hydrophilic region 146033 of the reaction substrate 146100. The liquid droplet 14621 is repelled by the hydrophobic region 14602 and is fixed, in a self-generated manner, in the position of hydrophilic region 146033 which is energetically stable. When it is confirmed that the liquid droplet 14621 including the substance for reaction is transferred to the hydrophilic region 146033 of the reaction substrate 146100, the user transfers the stage 14619, going on to the next operation of placing the liquid droplet 14621 on the hydrophilic region 146031 of the reaction substrate 146100. This operation can be performed by exchanging the pipette 14611, suctioning the suspension including other substances for reaction therein and repeating the above-mentioned operations.

FIG. 147 (B) is a plan view showing the result in which the liquid droplet including the substance which is to be reacted to the hydrophilic region 146031 and 146033 of the reaction substrate 146100 is placed by using the system for forming the liquid droplet including the substance reacted to the reaction substrate 146100, as described referring to the FIG. 147 (A). Droplets 146151 and 146152 including the substance to be reacted to the hydrophilic region 146031 and 146033 of the reaction substrate 146100 are arranged.

FIG. 148 (A), as shown in FIG. 147 (B), is a perspective view showing an outline of the example of the device for reacting the two droplets 146151 and 146152 formed on the reaction substrate 146100 by making each of the two droplets collide against each other; and FIG. 148 (B) is a view showing a frame format of an aspect in which the two droplets 146151 and 146152 have turned into one droplet after colliding against each other. The device described in FIG. 148 is in the independent form; however, it is advantageous to be in the form which is unified with and adjacent to the system constituting the liquid droplet described in FIG. 147, so that the device can control the transfer of the reaction substrate 146100 with the stage 14619, the gas injection for moving the two droplets 146151 and 146152 and the like using the personal computer 14626.

In FIG. 148 (A), each of the top and the bottom of the reaction substrate 146100 is provided with the optical system for monitoring the liquid droplet and the reaction thereof. Gas injection nozzles 146221 and 146222 are provided on an extension of hydrophilic grooves 146041 and 146042 for connecting the two liquid droplets 146151 and 146152 with these. Each of the gas injection nozzles 146221 and 146222 is connected to tubes 146241 and 146242 which are connected to a gas pressure tank, so that the gas injection with the gas injection nozzles 146221 and 146222 can be controlled by opening or closing valves 146231 and 146232. When gas is injected from the gas injection nozzles 146221 and 146222, the liquid droplets 146151 and 146152 are guided by the hydrophilic grooves 146041 and 146042 and move to the hydrophilic region 146032, colliding on the hydrophilic region 146032.

FIG. 148 (B) shows a state in which the two liquid droplets 146151 and 146152 move on the hydrophilic grooves 146041 and 146042, collide on the hydrophilic region 146032 and is unified.

In FIG. 148 (A), the light irradiated from a light source 14641 on top is modulated to the prescribed wavelength with a filter 14642, condensed with a condenser lens 14643 and irradiated on the hydrophilic region 146032. The irradiated light is led to a camera 14652, as transmitted light, through an objective lens 14647, a dichroic mirror 14648, a mirror 14649 and a filter 14651; and a transmitted light image on the hydrophilic region 146032 is focused onto the acceptance surface of the camera 14652. In other words, it can be confirmed that the hydrophilic region 146032 is in the prescribed position. Therefore, as is the case with forming liquid droplets, it is preferable that the reaction substrate 146100 and the stage 14619 are made of optically transparent materials. More specifically, it is suitable to use glass like borosilicate glass and quartz glass, resin and plastic like polyethylene, or a solid substrate like a silicon substrate. When a silicon substrate is used for the substrate 14601 of the reaction substrate 146100, a light source 14641 on top may emit light with a wavelength of 900 nm or more.

When it is confirmed that the hydrophilic region 146032 is in the prescribed position; namely, the two liquid droplets 146151 and 146152 and the gas injection nozzles 146221 and 146222 are aligned on the line, the user gives the operation signal 14628 to the personal computer 14626, pulse-opens the valves 146231 and 146232 to inject gas from the gas injection nozzles 146221 and 146222. When gas is injected from the gas injection nozzles 146221 and 146222, the liquid droplets 146151 and 146152 are guided through the grooves 146041 and 146042 to move to the hydrophilic region 146032 and collide on the hydrophilic region 146032.

In this example, the liquid droplets 146151 and 146152 are supposed to be of the same size; however, depending on the reaction of the measurement thereof, each size may be different. In this case, gas injected from the gas injection nozzles 146221 and 146222 must be controlled, so that the two liquid droplets 146151 and 146152 collide on the hydrophilic region 146032. For this reason, it is natural for the personal computer to have a suitable program so that when the sizes of the two liquid droplets 146151 and 146152 are inputted into the personal computer 14626, the personal computer 14626 gives a suitable signal. This issue is not limited to the size; there can be a possibility that this issue needs to be considered depending on the substance which is included in the liquid droplet and which needs to be reacted.

The case of the reaction on the hydrophilic region 146032 in which the two liquid droplets 146151 and 146152 collide on the hydrophilic region 146032, turning into the liquid droplet 146153 can be measured not only by the above-mentioned optical system but also by the optical system described below.

After the wavelength of the light irradiated from a light source 14645 at the lower side is selected with the filter 14646, the light irradiated from a light source 14645 is led to the objective lens 14647 with the dichroic mirror 14648 and is used for excitation light for observing the reaction inside the liquid droplet 146153. Fluorescence emitted from inside the liquid droplet 146153 is observed with the objective lens 14647 again; and fluorescence emitted after excitation light is cut with the dichroic mirror 14648 and a filter 14651 can be observed with a camera 14652.

At this time, by adjusting a combination of the dichroic mirror 14648, the filters 14642, 14646 and 14651, transmitted light alone can be observed with the camera 14652; or fluorescence alone is observed; or transmitted light image and fluorescence image can be observed with the camera 14652 at the same time.

Image data obtained with a camera are analyzed with the personal computer 14626. The CCD camera 14652 carries out observation. Although not shown here, it is convenient to display the image signal detected by the CCD camera 14652 on the monitor of the personal computer 14626.

Specific examples are described below regarding tracking of the DNA hybridization process. Liquid A and liquid B each is a 28-base-long synthetic single-stranded DNA complementary to each other with a concentration of 0.2 pmol/μl. A solvent thereof is 10 mM of Tris-HCl (pH 8.0) including 500 mM of NaCl. Ethidiumhomodimer intercalated specifically to the double-stranded DNA is added in either of the liquid A and the liquid B. 1 μl of the liquid A is put on the hydrophilic region 146031 on the reaction substrate 146100 to form the liquid droplet 146151. 1 μl of the liquid B is put on the hydrophilic region 146033 to form the liquid droplet 146152. Two of the liquid droplets are made to roll and collide against each other on the hydrophilic region. The two collided liquid droplets turn into one liquid droplet 146153; the liquid droplet 146153 is anchored to the hydrophilic region 146032 and stays in that position stably; therefore, the hybridization process with the liquid A and the liquid B proceeds.

The aspect in which the two liquid droplets 146151 and 146152 collide on the hydrophilic region 146032 can be monitored and detected with the optical system on the upper side; hybridization by the liquid A and the liquid B coalesced into one liquid droplet 146153 can be monitored with the optical system on the lower side; and fluorescence intensity in the neighborhood of 560 nm can be dispersed and measured.

FIG. 149 is a waveform diagram showing change over time of the fluorescence intensity obtained by monitoring the fluorescence intensity of the liquid droplet 146153. After a threshold 14661 of several dozen milliseconds after the collision of the liquid droplets, the fluorescence intensity rapidly increases. The fluorescence intensity increases because each of the single-stranded DNAs hybridizes with one another to become a double-stranded DNA to which ethidiumhomodimer is intercalated. The reaction takes place in at least three steps of 14662, 14663 and 14664; it is considered that hybridization takes place with the portion of a single-stranded DNA as a core in which it is easier for each single-stranded DNA to hybridize with one another; and sequentially hybridization proceeds within a molecule.

Example 1 uses a reaction system similar to a stopped flow system in which flow is stopped for measurement by blending reaction liquid with collision; therefore, the data similar to those from the existing stopped flow system can be easily obtained. Because very small amount of liquid is used, the use of a precious sample can be reduced. In respect to reaction, spectroscopic change on the collision face of the liquid droplets may be tracked using microspectroscopy; similarly, spectroscopic change on the collision face of the liquid droplets may be tracked by driving a small droplet into a big droplet. It is effective to disperse light of the entire liquid droplet by irradiating ultrasonic waves for just a moment, agitating and blending to start the reaction, although this technique has a problem of promoting the reaction by giving energy from outside.

Other Examples

FIG. 150 is a plan view showing an example of the reaction substrate 146100 suitable for spectroscopic measurement using a microspectroscopic device. As can be seen easily in contrast with FIG. 146 (A), in this example, there are many combinations of the hydrophilic regions 146031, 146032 and 146033 and the hydrophilic grooves 146041 and 146042 on the substrate 14601. Therefore, a variety of liquid droplets including reactants of the A group are arrayed on the hydrophilic regions 146031; a variety of liquid droplets including reaction medium of the B group reacting to a variety of liquid droplets including reactants of the A group are arrayed on the hydrophilic region 146033; by making the liquid droplets of the liquid droplet array of the B group sequentially collide against the liquid droplets of the A group array, a variety of reactions start by time interval to perform measurement. For that purpose, the number of the pairs of the gas injection nozzles 146221 and 146222 should be the same as that of the pairs of the hydrophilic regions 146031, 146032 and 146033 and the hydrophilic grooves 146041 and 146042; and it is necessary to operate controls in which each valve is sequentially opened or closed with the personal computer 14626, or by moving the stage 14619 bit by bit with the personal computer 14626, the valve is opened or closed every time the stage 14619 reaches the prescribed position.

In Example 1, two liquid droplets are collided with the pair of the hydrophilic regions 146031, 146032 and 146033 and the hydrophilic grooves 146041 and 146042; however, for example, when a pair having the same construction with the pair of the hydrophilic regions 146031, 146032 and 146033 and the hydrophilic grooves 146041 and 146042 is formed with the hydrophilic region 146032 overlapped, and the gas injection nozzles 146221 and 146222 are provided corresponding to it, it is possible to observe the reaction caused by the collision of the four liquid droplets.

It is also possible to observe an influence on a cell by dissolving a plurality of reactive precursors for causing reaction in each of the different liquid droplets, making it collide or react, or by dissolving a liquid droplet with a cell inserted therein and a liquid droplet including an active substance of a different cell into a different liquid droplet, making it collide or react.

A Thirtieth Embodiment

A thirtieth embodiment of the present invention disclosed herein provides a spectroscopic system and a spectroscopic method capable of advantageously testing even a very small amount of sample without any cuvette device to solve the problem associated with the needs for measuring a minute amount of sample. This embodiment uses the known phenomenon that a solvent containing water as a main ingredient is apt to form a droplet having the form of substantially perfect circle on a water-repelling substrate. In this embodiment, a droplet is formed on a substrate having the water-repelling property. On the substrate, a hydrophilic line on which the droplet can be moved along is formed. The droplets are transferred on this line successively. A detection system is provided so that the direction of the system intersects the direction of the hydrophilic line, and the absorbance and fluorescence intensity of the droplet is measured when the droplet moves across the detector direction of the system. White light or excitation light is projected to the droplet on the hydrophilic line, and the absorbance is measured by the spectroscopy measurement with the light transmitted through the droplet, or the fluorescence level is measured. The light path length necessary for measurement of the absorbance and fluorescence can be obtained by measuring the size of the droplet.

Example 1

Detailed descriptions are provided below by referring to measurement of a concentration of a protein as an example. Herein, a quantification of a protein is performed using 280-nm wavelength known as a typical protein absorption band. As the protein, chicken egg white lysozyme is used and the molecular extinction coefficient E1%280 is 26.6. The concentration of the protein is previously adjusted in the range between 0.05 mg/ml and 10 mg/ml and the sample solution is used as a diluted solution.

FIG. 151 (A) is a plan view illustrating a measuring substrate 151100 advantageously applicable to the Example 1, and is also a conceptual view illustrating the measurement system with the measuring substrate configured therein as a fundamental component. FIG. 151 (B) is a cross-sectional view of the measuring substrate 151100 taken at the line A-A and viewed in the direction indicated by the arrow. Reference numeral 15101 denotes a silicon substrate with, for instance, 1 mm thickness and the size of 40 nm×40 nm. The surface of the silicon substrate 15101 is regarded as a hydrophobic region 15102. On the region, a hydrophilic line 15104 is formed. The length of the hydrophilic line 15104 may be, for instance, 20 mm with 0.01 mm wide. At the terminal point of the hydrophilic line 15104, a droplet stopper 15103 is formed. Numeral reference 15105 denotes an alignment marker formed on one surface of the silicon substrate 15101. As described below, a droplet is formed on the left end of the hydrophilic line 15104 and is moved on the hydrophilic line 15104 to the droplet stopper 15103 at the predefined velocity. The size in the figure is shown in the deformed state for simplifying for convenience of illustration.

A measurement system 15150 is provided approximately at an intermediate position of the both ends of the hydrophilic lines 15104 so that the measurement system intersects the hydrophilic line. The measurement system 15150 includes a wide range light source 15110 capable of emitting lights in the ultraviolet to visible regions, an optical fiber 15111 for guiding the white light outputted from the wide range light source 15110 and irradiating the white light to a droplet moving on a hydrophilic line 15104 in parallel to a surface of the measuring substrate 151100, an optical fiber 15112 provided at a position opposite to the optical fiber 15111 across the hydrophilic line 15104 and capable of receiving the white light transmitted though the droplet, and a detector 15113 receiving the white light transmitted through the droplet and guided though the optical fiber 15112. It is needless to say that the headers of both the optical fibers 15111 and 15112 are placed opposite to each other across the hydrophilic line 15104 so that the headers do not contact with any droplet moving on the hydrophilic line 15104. The detector 15113 includes a spectroscope 15114 and a CCD line sensor 15115.

A laser beam 15120 is projected in parallel to the surface of the measuring substrate 151100 and passes across the hydrophilic line 15104 to the left side of the measurement system 15150. Numeral reference 15121 denotes a laser source. Numeral reference 15122 and 15123 denote reflection mirrors for reflecting the laser beam 15120, and numeral reference 15124 denotes a detector for detecting the laser beam 15120. This laser beam 15120 is used for measuring a diameter of the droplet moving on the hydrophilic line 15104. Because of this feature, the laser beam 15120 may be projected to the right side of the measurement system 15150.

In FIG. 151 (B), the cross section is taken at the position of the hydrophilic line 15104, and therefore the entire central portion on the substrate 15101 are indicated as a hydrophilic region. The droplet stopper 15103 is provided at the right edge section of the hydrophilic line 15104.

For forming the hydrophilic line 15104 (hydrophilic region) and the hydrophobic region, the top surface of a hydrophilic silicon substrate 15101 is once oxidized to create a hydrophilic SiO2 thin film across the whole region once. Then the SiO2 thin film of the region is removed by melting the SiO2 thin film with a fluorinated acid to form a hydrophobic region. Alternatively, when the hydrophilic material is previously used on the surface of the substrate 15101 with the SiO2 thin film formed thereon, a hydrophobic material such as fluorinated resin and silicon resin can be placed on the hydrophilic surface to form a hydrophobic region. In this case, the height of the hydrophilic region provided in the hydrophobic region becomes shorter than the height of the hydrophobic region by the height of the hydrophilic region thereof. FIGS. 151 (A) and (B) show an example where the hydrophobic region 15103 and the hydrophilic line 15104 are formed by the latter method described above.

In Example 1, a droplet of a fluid to be measured can be formed at the left end of the hydrophilic line 15104 once. Then the droplet is moved to the right on the hydrophilic line 15104 with predefined speed. In the moving process, the size of the droplet can be measured to analyze the droplet.

FIG. 152 is a schematic diagram illustrating a sample of a system configuration preferable to the thirty embodiment of the present invention capable of forming a droplet at the left end of the hydrophilic line 15104 on the measuring substrate 151100.

First, descriptions are provided below for operations of forming a droplet 15136 at the left end of the hydrophilic line 15104 on the measuring substrate 151100. When the system is started up, a user checks the position of the alignment marker 15105 described with reference to FIG. 151(A), and gives an operation signal 15128 to a personal computer 15126 to control a driving unit 15127 to position the stage 15119 so that the measuring unit 151100 can be placed in the predetermined start-up position. The stage 15119 can be moved in X and Y directions in response to the signal inputted thereto. Next, for adjusting the position that the droplet 15136 is located (the position at the end of the hydrophilic line 15104) to the position that the header portion of the Pipet 15133, the user gives an operation signal 15128 to the personal computer 15126 to control the driving unit 15127, thereby the stage 15119 is positioned. In this case, if necessary, the user can adjust the position more accurately by sending a feedback signal for positioning to the personal computer 15126 while monitoring the header portion of a Pipet 15133. Then a fluid to be measured is aspirated into the Pipet 15133.

When the measuring substrate 151100 is moved to the predefined position, in other words, when the position of the header portion of the Pipet 15133 corresponds to the left end of the hydrophilic line 15104, this event can be detected or the user may give a direction to the personal computer 15126 to send a signal to the driving unit 15132 so as to eject a fluid 15134 to be measured. And then a syringe pump 15131 is driven so as to eject the fluid to be measured from the inside of the Pipet 15133 to form a droplet 15136 at the header portion of the Pipet 15133. The size of the droplet 15136 formed at the header portion of the Pipet 15133 can be determined according to the conditions such as the density and gravity of the fluid to be measured and the size of the header portion of the Pipet 15133. And after the droplet grows to have a certain size, the droplet can be dropped off to the left end of the hydrophilic line 15104. It is not always necessary to control to stop the syringe pump 15131 and it is allowable if a program to stop the syringe pump 15131 is stored in the personal computer.

When the user would prefer the method including the control of the syringe pump, it is allowable to monitor the droplet 15136 formed at the header portion of the Pipet 15133 with an optical device. And either in response to the signal outputted from the device, the driving unit 15132 is controlled so that the status that the droplet grows to have predefined size could be detected, or in response to the operator's instruction, the operation of the syringe pump 15131 can be stopped, and the Pipet 15133 can be held down (it is not shown but it is necessary to have a driving unit here like the driving unit 15137 to control the Rod 15141 as described hereinafter) so that the droplet 15136 formed at the header portion of the Pipet 15133 could be contacted with the left end of the hydrophilic line 15104 on the measuring substrate 100 to be placed on the hydrophilic line 15104. The reason why it is illustrated as the elementary part of the Pipet 15133 is separated from a tube 15130 herein is to enlarge the scale of the Pipet 15133 for illustrative purpose only.

Next, the descriptions are provided below for the measurement of the droplet 15135 of the fluid to be measured placed on the left end of the hydrophilic line on the measuring substrate 151100. In this case, 1 μl of solution including protein (50 mM of phosphoric acid buffer solution with pH 7.4 including 150 mM of NaCl) is used as the fluid to be measured. Next, a Rod 15141 with 0.1-mm diameter having a header made of hydrophilic glass and side surface made of hydrophobic Polyimide is contacted with the top surface of the droplet 15135. Therein, it is regarded that the Rod 15141 could work with the driving unit 15137 capable of moving the Rod 15141 in the vertical and horizontal directions on the hydrophilic line 15104. When the Rod 15141 is placed on the left end of the hydrophilic line 15104, if the user gives a signal to the personal computer 15126 to lower the position of the Rod 15141, the Rod 15141 is moved downward by the driving unit 15137. When the header portion of the Rod 15141 touches the droplet 15135, the downward movement of the driving unit 15137 is stopped. Then the Rod 15141 is moved to the right over the hydrophilic line 15104 with the predefined speed. Accordingly, the droplet 15135 on the hydrophilic line 15104 on the measuring substrate 151100 can be moved on the hydrophilic line 15104 horizontally to the right side with the predefined speed to drop into the droplet stopper 15103.

In the moving process on the hydrophilic line 15104 horizontally to the right side with the predefined speed, the droplet 15135 can be passed through the laser beam 15120 to be measured the diameter of the droplet 15135 thereof. For instance, if the Rod 15141 is moved at the speed of 2 mm/sec, the droplet 15135 can stick to the header of the Rod 15141, and move at the same speed. Namely, the droplet 15135 can also be moved at 2 mm/sec, the same moving speed of the Rod 15141. When the droplet 15135 passes through the laser beam 15120, the laser light is refracted on the boundary surface on the droplet 15135, changing the amount of light that reaches the detection unit 15124. After the droplet 15135 passes through the laser beam 15120, the amount of light can be restored to the previous level. If it would take 1.22 sec for the droplet to pass through the laser beam, the diameter of the droplet 15135 could be obtained by the calculation of 0.61 (=1.22/2) mm at the crossing position of the laser beam. This method assumes that the height of the laser beam 15120 from the measuring substrate 151100 is previously adjusted to the half of the diameter of the droplet 15135 before the measurement. Because of this feature, it might be necessary to adjust the height of the laser beam 15120 from the measuring substrate 151100 if the diameter of the droplet 15135 changes largely.

Next, the droplet 15135 passes through the position where the optical fibers 15111 and 15112 of the detection device placed opposite each other. In this case, since the height of the optical fibers 15111 and 15112 from the measuring substrate 151100 is adjusted to the same height of the laser beam 15120 from the measuring substrate 151100, the light pass length of fluid to be measured becomes 0.61 mm. The maximum absorbance when the droplet passes through the position between the optical fibers 15111 and 15112 of the detection device can be measured and then converted into the value when the light pass length is 1 cm.

The FIG. 153 is a characteristic drawing in which the measured absorbance values according to the Example 1 are plotted thereon. The characteristics having a linear portion 15121 and non-linear portion 15122 can be obtained as shown in this FIG. 153. The non-linear portion 15122 can be described as a typical phenomenon caused by too high lysozyme concentration level. When the values of the measurement result can be compared to the values in the public domain of the well-known protein concentration, they can be well matched each other.

In the measurements according to Example 1, the droplet 15135 dropped into the droplet stopper 15103 would be just passed through the laser beam 15120 and then while light projected from the optical fiber 15111 of the detection unit without receiving any operations that could induce any chemical changes of the droplet therein. Because of this feature, it is allowable to aspirate the droplet 15135 dropped into the droplet stopper 15103 and use it in the other measurement.

Further, in the measurement according to Example 1, what might be contaminated by the measurements is just the hydrophilic line 15104 on the measuring substrate 151100. Because of this feature, even if the droplet of a new sample is dropped on the left end of the hydrophilic line 15104 and then the measurements are to be repeated, the droplet of the new sample would not be contaminated by the sample previously measured. Accordingly, it is allowable to place all the series of sample droplets sequentially on the hydrophilic line 15104 on the measuring substrate 151100 to measure them sequentially to improve the throughput thereof.

According to the thirty embodiment of the present invention, the requirements of the measurements described above would be the possibility of measuring the spectral instantly and the property of the laser light to be projected to the samples that should have fairly constant intensity in terms of the wavelength component over time. Because of the limited requirements above, the measurement can be done even in an open space. Obviously, it is also allowable to use a light having a single wavelength after the spectroscopy to project to the droplet and use a conventional spectroscopy optical system to measure the absorbance. But in this case, it may not be allowable to use in an open space and, instead, the measurement may have to be done inside a dark box.

Further, since a cuvette is not substantially used in the above-mentioned measurements, the light used therein passes thorough the droplet and air only. Because of this feature, the spectroscopy measurements even using a waveform that could be absorbed by a cuvette can be advantageously performed. For instance, when the amount of protein is measured by using the absorbance method with 210 nm wavelength light, it is not practical to use a typical glass cuvette or plastic cuvette. It might be practical if a cuvette made of expensive fused silica could be used. But, with the thirty embodiment of the present invention, it would be possible to exclude such an expensive fused silica cuvette.

Example 2

Example 2 in the 30th embodiment of the present invention describes an example to conduct a fluorescence measurement. This example includes the preprocessing to mix the reagent with a liquid to be measured and make a reaction before the measurement.

FIG. 154 (A) is a plan view of the measuring substrate 151200 preferred for the Example 2, and a schematic diagram of the measuring system comprising the components based on the measuring system. FIG. 154 (B) is a cross-sectional diagram of the measuring substrate 151100, viewed in the direction of indicated by the arrow, at the position of A-A in the plan view of measuring substrate 151200. The sizes of the drawings are deformed for the purpose of explanation.

The measuring substrate 151200 is similar to the measuring substrate 151100 in the Example 1. Reference numeral 15101 indicates a silicon substrate, for instance, having the thickness of 1 mm and the size of 40 mm×40 mm. The surface of silicon substrate 15101 is made to a hydrophobic region, and hydrophilic regions 15152 to 15154 and hydrophilic lines 15156 to 15159 are set up therein to retain droplets. The liquid receiver 15103 has been formed on the end edge (at the far right) of the hydrophilic line 15159. The size of the hydrophilic regions 15152 to 15155 are decided depending on the size of the retained droplet in this region, for instance, however, it is approximately 400 μm×400 μm. The width of hydrophilic lines 15156 to 15159 is approximately 0.1 mm. The reference numeral 15105 indicates the marker for positioning, and which is formed on one side of silicon substrate 15101. The reference numeral 15108 indicates a temperature control plate, and which is formed on the back side of silicon substrate 15101. The sizes of the drawings are deformed for the purpose of explanation.

A measuring system 15151 is installed with the shape that intersects with hydrophilic line 15159. The measurement system 15151 is comprised optical fiber 15111, optical fiber 15112 and detector 15113. Optical fiber 15111 guides laser source 15110′ for fluorescent excitation and laser beam of the laser source 15110′, and the laser beam is exposed to the droplet in parallel to the surface of measuring substrate 151100, neighboring the droplet moving on the hydrophilic line 15159. Optical fiber 15112 is installed across the hydrophilic line 15159, and opposing position with optical fiber 15112 to receive fluorescent exposed by the droplet. Detector 15113′ has an input of fluorescent exposed by the droplet guided by optical fiber 15112. Optical fiber 15112 is set up to have a 120 degree of angle with optical fiber 15111, so that the reflected light on the surface of the droplet of the laser beam, which is exposed on the droplet, will not be entered into the optical fiber 15112. Optical fiber 15112 here is also set up at opposing position with optical fiber 15111, having a certain distance that the tips do not contact with the droplet which moves on the hydrophilic line 15159.

In the same way as the description referring to FIG. 152 in the Example 1 in the 30th embodiment of the present invention, each droplet is formed in the hydrophilic regions 15152 to 15154. A droplet containing a single stranded cDNA mixture, which is reverse-transcribed from mRNA, is formed in the hydrophilic region 15154. A droplet comprising 60 base probe solution, which hybridizes to specific cDNA, in the hydrophilic region 15153. A droplet comprising cyber green I solution, which intercalates specifically to the double stranded, is formed in the hydrophilic region 15152. Each droplet is 0.5 μl. Examine 5 pmol/μl of complementary probe and non-complementary probe per cDNA 0.2 pmol/μl here as a model system. The solvent is 10 mM of Tris-HCl (pH 8.0) containing 50 mM of NaCl.

Firstly, the droplets formed both in hydrophilic region 15153 and 15154 are transported in the same method as Example 1 in the 30th embodiment of the present invention, and mixed here. Rod 15141 used for transporting droplets can mix the droplets by rotating for the axial direction. Of course, a piezoelectric element should be formed in advance on the back face of the silicon substrate 15101, which is located at the position that hydrophilic region 15155 is formed, and the droplets may be stirred by contact-free after reaction of the ultrasonic wave caused by the piezoelectric element with the droplet placed in the hydrophilic region 15155. After stirring the droplets for 30 seconds, the droplet formed in the hydrophilic region 15152 is added in the droplets stirred in the hydrophilic region 15155, and then the mixed droplets are stirred again. After 30 seconds, the droplets comprising three different liquid droplets stirred in the hydrophilic region 15155, are transported with the prespecified speed, for instance, 2 mm/second, on the hydrophilic line 15159. The droplet transporting on the hydrophilic line 15159 produces fluorescence in receipt of the laser beam of the laser source 15121′, when the droplet transporting on the hydrophilic line 15129 passes through the betweenness of the tips of the optical fiber 15112, which is set up opposing to optical fiber 15111. The fluorescence intensity at this point is measured by detector 15113′ through optical fiber 15112.

When the complementary cDNA with probe exists in the liquid for the sample, the strength of fluorescence is obtained in accordance with the amount of cDNA. If there is no complementary cDNA at all, the fluorescence strength is less or equal to 1/20.

Since it is better to manage the size of the droplet in a rigorous manner in the Example 2 than the Example 1 in the 30th embodiment of the present invention, it is better to measure with a CCD camera using the optical system (not shown in the drawing), to input the data in the personal computer 15126, to make a prespecified process and to control driving device 15132 of the syringe pump 15131 when the droplet is formed described for FIG. 152.

This optical system may be, to be short, the system which can monitor the fore-end part of the pipet 15133. Moreover, the optical system should control the temperature control plate 15108 that is set up on the back surface of the measuring substrate 151200, and operate the system in the state that the temperature of the measuring substrate 151200 ranges 42° C. to 46° C. and in the wet condition that the ambient atmosphere of 45° C. Since the fluctuation of the size of the droplet will change the inclusive concentration of cDNA, it is better to control by monitoring the movement of the droplet or size of the droplet after stirring with an optical system CCD camera that the diameter of the droplet will not fluctuate 10% and above by feedback control on the temperature control plate 15108 in the case there is a fluctuation in size of the droplet diameter.

In the Example 2 in the 30th embodiment of the present invention, because the droplet formed in the hydrophilic region 15154 and the droplet formed in the hydrophilic region 15153 are transported to the hydrophilic region 15155 in the same method as the Example 1 in the 30th embodiment of the present invention, and preprocessing before the reaction is carried out by mixing the droplets at this point, and then the processes are integrated by a reaction of the droplet formed in the hydrophilic region 15152 with the mixed droplets, it is possible to avoid the above-mentioned human error. In addition, this process is made on one measuring substrate 151200, it is better to make the measuring substrate 151200 as a chip, which measures immediately after the reaction and is disposable type used only for one time, in order to prevent from any contamination.

It can be used for the purpose of detecting reaction products by combining with various reactions, and can resolve the problem by making it as system-on-chip, that the sample reaction and detection is integrated. The reactive precursor should be divided by several droplets, and each droplet on the hydrophilic line is reacted by collision and coalition in the predefined order. The reaction time is that, for instance, a hydrophilic region with approximately 2 to 4 times of line width diameter may be set up on the hydrophilic line so that the droplet can stay therein, or it is possible to solve by making a slightly bent part so that the droplet can stay therein for a predefined time.

Other Examples

Example 30 can be performed in various systems not limited to a configuration of the aforementioned examples.

For instance, a migration of droplet by the rod 15141 described with reference to FIG. 152 can be replaced to by gas injection. As an example, a gas injection nozzle is provided on an extension of the hydrophilic line 15104 and the gas injection nozzle has a tube connected to a gas pressure tank and a valve, and then a migration of the droplet 15135 may be controlled with gas injection using the gas injection nozzle by opening and closing the valve. Assuming that a size and weight of the droplet is considered to gas injection, the droplet 15135 migrates on the hydrophilic line 15104 with prespecified speed guided by the hydrophilic line 15104, and drops into a liquid tank 15103. A migration from the hydrophilic area 15155 to the liquid tank 15103 in Example 2 can be also performed in the same manner. When using gas injection for migration of the droplet, since physical facilities migrating on the upper side of the measuring substrate 151200 is reduced, a configuration of device becomes simpler.

A surface elastic wave can be used for migrating a droplet. FIG. 155 is a conceptual diagram illustrating an example of configuration of a system for preparing a droplet at a left edge of the hydrophilic line 15104, migrating the droplet with surface elastic wave, and measuring the migration. A surface elastic wave generator comprising of the piezoelectric element 151205 and the comb electrodes 151206 is provided under the hydrophobic line 15104 on which the droplet of the substrate 15101 migrates. As the comb electrodes, lithium compounds such as lithium 4-borale, lithium tantalate or lithium niobate can be used. Surfaces of the piezoelectric element 151205 and the comb electrodes 151206 are coated with hydrophobic coating, and the hydrophilic line 15104 is provided to a direction of transporting droplet as described in the aforementioned Example 1. By applying a voltage between the comb electrodes 151206 facing each other, a surface electric wave having uniform phases can be generated along the hydrophilic line 15104. The droplet 151202 migrates on the surface electric wave. Then, the comb device is provided at the upper section of the hydrophilic line 15104 generating a droplet. A piezoelectric substrate section may be provided at all over the hydrophilic line 15104 of the substrate 15101 or may be provided only close to areas in which the droplet 151202 is dropped as illustrated in FIG. 155. By applying a voltage between the comb electrodes, a surface elastic wave is generated and a droplet flies and migrates to a direction of the arrow 151204.

Conventionally, a sample used for measuring absorbance is generally abandoned. If a volume of liquids for the measurement is large, samples will become wastes.

For example, a high through-put can be achieved by the system described in FIG. 151; a plurality of the systems for the hydrophilic line 15104 and the liquid tank 15103 are provided in parallel, a droplet made from a sample liquid to be measured is provided at a left edge of each hydrophilic line 15104, and each droplet is sequentially rolled to a detecting section for measurement by gas injection. In this case, it is practical that only one system of gas injection is provided and the stage 15119 is moved.

A force for migrating a droplet is, in another system, that one miniature magnet is put into a droplet and the droplet is migrated by moving the miniature magnet from a back side of a substrate to a magnetic field. In this case, the miniature magnet should have hydrophilic property for clinging the droplet thereto. A size of the miniature magnet makes less than half of a diameter of the droplet so that measuring absorbance in later can not be interrupted.

The present invention can be realized with the following configurations in accordance with each embodiment as described previously besides the configurations described in the claims.

First Embodiment

1. A centrifugal separator comprising:

a motor for rotating a rotating plate;

a rotating plate rotating about a shaft rotated by the motor; and

a chip for centrifugal separation attached to a face of the rotating plate;

the chip for centrifugal separation including:

flow paths fed with a plurality of solutions each having different specific gravity;

a separation chamber with the flow path converged thereon; and

a plurality of flow paths branching out from the separation chamber;

wherein reservoirs are provided at each end of the flow paths for feeding solutions to the separation chamber and the plurality of flow paths branching out from the separation chamber, a solution having prespecified specific gravity is reserved in the reservoir communicating to the flow path for feeding solutions to the separation chamber, and a sample to be separated is supplied in one of the reservoirs.

2. The centrifugal separator according to paragraph 1, wherein the centrifugal separator has configuration in which the reservoir communicating to the flow path fed with a plurality of solutions each having different specific gravity is positioned at an equal distance from the rotational shaft, and the reservoir communicating to the plurality of flow path branching out from the separation chamber is positioned at an equal distance from the rotational shaft.

3. A method of separation performed by a centrifugal separator comprising:

a motor for rotating a rotating plate;

a rotating plate rotating about a shaft rotated by the motor; and

a chip for centrifugal separation attached to a face of the rotating plate;

the chip for centrifugal separation including:

flow paths fed with a plurality of solutions each having different specific gravity;

a separation chamber with the flow path converged thereon; and

a plurality of flow paths branching out from the separation chamber;

wherein reservoirs are provided at each end of the flow paths for feeding solutions to the separation chamber and the plurality of flow paths branching out from the separation chamber, a solution having prespecified specific gravity is reserved in the reservoir communicating to the flow path for feeding solutions to the separation chamber, a sample to be separated is supplied in one of the reservoirs, and a solution transferred from the reservoir to the separation chamber by centrifugal separation forms layers corresponding to the specific gravity to separate the sample to be separated according to the specific gravity.

4. A chip for centrifugal separation applicable to a centrifugal separator comprising:

a motor for rotating a rotating plate;

a rotating plate rotating on an axis rotated by the motor; and

a chip for centrifugal separation attached to a face of the rotating plate;

the chip for centrifugal separation including:

flow paths fed with a plurality of solutions each having different specific gravity;

a separation chamber with the flow path converged thereon; and

a plurality of flow paths branching out from the separation chamber;

wherein reservoirs are provided at each end of the flow paths feeding solutions to the separation chamber and the plurality of flow paths branching out from the separation chamber.

5. A chip for centrifugal separation, the centrifugal separator configured to have a position of the reservoir communicating to the flow paths feeding solutions to the separation chamber at an equal distance from the rotational shaft, and to have a position of the reservoir communicating to each end portion of the plurality of flow paths branching out from the separation chamber at an equal distance from the rotational shaft.

6. The chip for centrifugal separation according to paragraph 3, wherein the reservoir is provided on a face opposite to a substrate with the flow path for the chip for centrifugal separation and the separation chamber provided thereon, and an end of the reservoir and an end of the flow path are communicated by a hole penetrating the substrate.

7. The chip for centrifugal separation according to paragraph 3, wherein the reservoir communicating to one end of the flow path fed with a plurality of solutions each having a different specific gravity has a partly cut out separation wall for separating a plurality of reservoirs in a position opposite to the communicating hole.

Second Embodiment

1. A cell separation chip comprising:

a flow path introducing a fluid containing a target cell with a specific substance for labeling identification intaked into a cell separation area via a transporter, and a sample hole connected to the flow path for feeding a fluid containing a target cell;

a buffer flow path provided in parallel with the flow path with a fluid containing a target cell in the cell separation area introduced therein, and a buffer hole connected to the flow path for feeding a buffer;

a flow path located on the downstream side from the position in which the flow path introducing a fluid containing a target cell in the cell separation area and the buffer flow path converge, for observing a cell in the fluid in which the liquid containing a target cell and a buffer-combined fluid flow as a laminar flow;

the cell separation area comprising: two openings for gel electrodes formed on the downstream side of the flow path for observing a cell, facing to each other on both sides of the flow path, and placed in a position slightly deviated from the flow direction; a target cell collecting flow path located in an imaginary line extended from the flow path; and a cell discharge flow path branching out from the flow path;

a hole for feeding the gel electrodes with a gel electrode material;

a hole connected to the cell discharging flow path for accommodating a liquid containing a discharged cell;

a cell dialysis section provided on the downstream side of the target cell collecting flow path; and

a collecting flow path passing therethrough a fluid containing a target cell having passed through the cell dialysis section and a hole connected to the collecting flow path for accommodating a fluid containing the collected cell;

the cell separation chip including:

a buffer retention bath for feeding a buffer provided in a common communication with the sample hole for feeding a fluid containing a target cell and a buffer hole for feeding a buffer;

a buffer retention bath provided in communication with the hole for accommodating a fluid containing a fluid containing a discharged cell, for accommodating a discharged cell and a buffer; and

a buffer retention bath provided in communication with the hole for accommodating a fluid containing a collected cell, for accommodating a target cell and a buffer;

the cell dialysis section including:

a dialysis area for dialyzing the collected cell via a prespecified porous membrane to discharge a specific material for labeling identification;

a buffer retention bath for feeding a buffer not containing a specific material for labeling identification in the dialysis area; and

a buffer retention bath for collecting a buffer after dialysis.

2. The cell separation chip according to paragraph 1, comprising:

a substrate having a prespecified thickness and size;

each of the flow paths and the gel electrodes formed on the bottom face of the substrate;

a hole communicating with each of the flow paths and the gel electrodes formed the bottom face of the substrate and penetrating the substrate;

a translucent thin film attached onto the bottom face of the substrate,

a retention bath communicating with the flow path provided on the top face of the substrate;

the cell dialysis section including a flow path provided between a flow path in the downstream region of the cell separation area and the hole, and communicating from the bottom face to the top face of the substrate; and

a porous membrane provided on the top face of the substrate in the cell dialysis section, a space for circulating a buffer not containing a specific material for labeling identification for dialyzing the collected cell, and a retention bath for feeding the space with buffer.

3. A cell separator comprising:

a flow path with introduced in a cell separation area a fluid containing a target cell with a specific material for labeling identification intaked therein via a transporter, and a sample hole connected to the flow path for feeding a fluid containing a target cell;

a buffer flow path provided in parallel with the flow path with a fluid containing a target cell introduced into the cell separation area, and a buffer hole connected to the flow path for feeding a buffer;

a flow path located on the downstream side from a position in which the flow path with a fluid containing a target cell introduced into the cell separation area and the buffer flow path converge, for observing a cell in the fluid in which the fluid containing a target cell and a buffer are combined to flow as a laminar flow;

the cell separation area comprising: two openings for gel electrodes formed on the downstream side of the flow path for observing a cell, facing to each other on both sides of the flow path, and provided in a position deviated from the flow; a target cell collecting flow path located in an imaginary line extended from the flow path; and a cell discharging flow path branching out from the flow path;

a hole for feeding the gel electrodes with a gel electrode material;

a hole connected to the cell discharging flow path for accommodating a fluid containing a discharged cell;

a cell dialysis section provided on the downstream side of the target cell collecting flow path;

a collecting flow path passing therethrough a fluid containing a target cell having passed through the cell dialysis section and a hole connected to the collecting flow path for accommodating a fluid containing a collected cell;

a buffer retention bath provided in a common communication with the sample hole for feeding a fluid containing a target cell and a buffer hole for feeding buffer;

a buffer retention bath provided in communication with the hole for accommodating a fluid containing the discharged cell, for accommodating a discharged cell and a buffer; and

a buffer retention bath provided in communication with the hole for accommodating a fluid containing the collected cell, for accommodating a target cell and a buffer;

the cell dialysis section including: a dialysis area for dialyzing the collected cell via a prespecified porous membrane to discharge a specific material for labeling identification via a transporter; a buffer retention bath for feeding the dialysis area with a buffer not containing a specific material for labeling identification; and a buffer retention bath for collecting the buffer after dialysis, in addition to a cell separation chip; and

an optical system for detecting a cell flowing down in the flow path for observing a cell on the cell separation chip, the optical system determining whether a cell flowing down in the flow path is a target cell or not, and determining according to the result of determination whether voltage is applied to the gel electrodes or not.

4. The cell separator according to paragraph 3, wherein voltage is applied to the gel electrodes when it is determined that a cell flowing down in the flow path is not a target cell.

5. The cell separator according to paragraph 3, wherein a plurality of the cell separation chips are arrayed on the same plane; and a certain number of the cell separation chips are commonly provided with plumbing for feeding a buffer not containing a specific material for labeling identification and with plumbing for collecting a buffer after dialysis to feed a buffer to transit the buffers via each retention; and each buffer is relayed by respective detention baths to feed the dialysis area of the cell dialysis section with a buffer not containing a specific material for labeling identification.

Third Embodiment

1. A method of cytotechnology comprising the steps of:

binding for identification, polynucleotide specifically binding to a surface antigen expressed in a cancer-derived cell and having a structure binding to a labeled substance with covalent bonding, to the surface antigen expressed in the cancer-derived cell in a group of sample cells to separate the cells; and

subjecting the separated cells to action of nuclease for decomposing the polynucleotide binding to the surface antigen expressed in the cancer-derived cell to obtain the cancer-derived cell, thereby determining the presence of cancer.

2. A method of cytotechnology comprising the steps of:

binding for identification, polynucleotide specifically having EpCAM bound to a surface antigen in a cancer-derived cell and having a structure binding to a labeled substance with covalent bonding, to a EpCAM bound surface antigen in the cancer-derived cell in a group of sample cells to separate the cells; and

subjecting the separated cell to action of nuclease for decomposing the polynucleotide having EpCAM bound to the surface antigen with the cancer-derived cell to obtain the cancer-derived cell, thereby determining the presence of cancer.

3. A method of identifying a cell comprising the steps of:

preparing an identification element having a configuration in which a labeled substance is bonded to an identification substance with covalent bonding, the labeled substance being polynucleotide specifically binding to a specific antigen present on a surface of a specific cell;

mixing a group of sample cells and the identification element to bind the polynucleotide to the antigen in the specific cell in the group of sample cells; and

employing the identification substance to identify the specific cell having the specific antigen;

wherein nuclease discomposing the polynucleotide is used as a reagent.

4. A method of cytotechnique or cell identification according to any of paragraphs 1 to 3, wherein the identification substance of the identification element is a fluorescent substance, and fluorescent detection is used for identifying a cell with the labeled substance in the identification element bonded thereto.

5. A method of cytotechnique or cell identification according to any of paragraphs 1 to 3, wherein the identification substance of the identification element is a particle or a magnetic particle, and particle imaging, scattered light detection or magnetic detection is used for identifying a cell with the labeled substance in the identification element bonded thereto.

Fourth Embodiment

1. A sample freezing device comprising: a pressure-resistant vessel having a cylinder with a solution containing a sample accommodated therein; a piston capable of engaging with the cylinder; a pressurizing unit capable of pushing the piston into the cylinder; and a control unit for controlling the pressurizing unit to control the rate of pushing the piston into the cylinder, the control unit applying pressure to a solution while keeping a temperature of the solution in the cylinder within a range from the phase transition point between the ice-I area and the liquid water area up to plus 4° C., and releasing pressure when the temperature reaching the state of almost the lowest temperature in the relationship between the ice-I area and the liquid water area.

2. The sample freezing method according to paragraph 1, wherein the cylinder is tapered on an end face of the pressure-resistance vessel, and an operation of engaging the piston with the cylinder is conducted in the state where a solution containing a sample to be accommodated in the cylinder overflows from the top of the cylinder.

3. A sample freezing device comprising the steps of:

cooling a sample at high pressure keeping the state of a solution thereof; and

flash-freezing the sample by rapid pressure reduction.

4. The sample freezing method according to paragraph 3, wherein a solution containing a sample is pressurized in the range from 0.1 to 0.2 GPa while keeping a temperature thereof in the range from the phase transition point between the ice-I area and the liquid water area up to plus 4° C. in the state where a gas phase the solution is not present, and is then subjected to a rapid pressure reduction.

Fifth Embodiment

1. A cell aliquoting device comprising:

a pipet capable of retaining a solution containing a plurality of cells and having a diameter of a tip opening thereof suited for passing through a prespecified size of a cell or a cell agglomerate;

a means for observing a cell on the tip of the pipet;

a means for pushing out a solution containing cells on the tip of the pipet to form a liquid droplet; and

a means for determining that a prespecified cell is contained in the liquid droplet to become a prespecified size of the liquid drop;

wherein each of the liquid droplets formed on the tip of the pipet is dropped and arrayed in a prespecified position on a substrate.

2. A cell culture system comprising: a means for forming a liquid droplet containing a prespecified number of cells; a means for controlling the size of the liquid droplet; a substrate for setting each of the liquid droplets in array; and a solvent layer formed on the substrate, having specific gravity smaller than a solvent of the liquid droplet, and being substantially unfused with the liquid droplet.

3. A cell culture system comprising: a means for forming a liquid droplet containing a prespecified number of cells; a means for controlling the size of the liquid droplet; a substrate for setting the liquid droplet in array; and a solvent layer formed on the substrate, having specific gravity smaller than a solvent of the liquid droplet, and being substantially unfused with the liquid droplet; a means for replacing a solvent of a liquid droplet on the substrate; a means for controlling a temperature of the liquid droplet during cultivating the cell; a means for observing a cell in a liquid droplet set in array on the substrate; and a means for collecting the cell after cultivating for a prespecified period of time.

4. A cell culture chip comprising: a substrate with a face thereof having a prespecified size provided as a hydrophobic area, the hydrophobic area being formed thereon a plurality of discrete hydrophilic areas with a prespecified clearance; and a wall formed on the substrate surrounding the plurality of hydrophilic areas, the cells contained in prespecified droplets being arrayed in the hydrophilic areas, and being covered with a solvent layer having specific gravity smaller than the solvent of the liquid droplet and being substantially unfused with the solvent of the liquid droplet.

5. A cell culture chip according to paragraph 4, wherein the solvent layer is previously provided, and then each cell included in a prespecified liquid droplet is arrayed in the plurality of hydrophilic areas on the substrate.

6. The cell aliquoting device according to paragraph 1, wherein the means of forming a liquid droplet containing a prespecified number of cells is arranged in such a way that a tip of a pipet for feeding a suspension containing the cells and a tip of a pipet for feeding a culture solution are faced to each other, and the size of a liquid droplet is controlled by controlling a quantity of each liquid.

7. The cell culture system according to paragraph 2 or paragraph 3, wherein the means of forming a liquid droplet containing a prespecified number of cells is arranged in such a way that a tip of a pipet for feeding a suspension containing the cells and a tip of pipet for feeding a culture solution are faced to each other, and the size of a liquid droplet is controlled by controlling a quantity of each liquid.

8. The cell aliquoting device according to paragraph 6, wherein the flow path associated with the two pipets is formed in a single pipet.

9. The cell culture system according to paragraph 7, wherein the flow path associated with the two pipets is formed in a single pipet.

Sixth Embodiment

1. A droplet operation device comprising:

an insulating substrate with one surface thereof being water-repellent;

a plurality of hydrophilic droplet retention areas formed on the water-repellent surface of the substrate;

a hydrophilic droplet transfer line formed by extending the hydrophilic droplet retention areas on the substrate;

a droplet forming device for forming a droplet in the hydrophilic drop retention areas on the substrate;

a charging device for selectively charging a droplet retained in the hydrophilic drop retention area on the substrate; and

a joy stick for making a charge having the same polarity as that of the charged droplet act to cause repulsion force against a charge of the charged droplet;

wherein the specific droplet retention area in the hydrophilic droplet retention area on the substrate is configured to allow a droplet to be subjected to charging and discharging.

2. The droplet operation device according to paragraph 1, wherein the charging device for selectively charging a droplet retained in the hydrophilic droplet retention area on the substrate comprises: a first electrostatic electrode not directly contacting to the droplet on an insulating substrate with a droplet contacted thereto; and a second electrode configured to directly contact an in-capillary liquid with a capillary for retaining a liquid capable of contacting the solution; wherein the portion of a droplet is charged by polarizing a droplet and a liquid in the capillary.

3. The droplet operation device according to paragraph 1, wherein the configuration of the specific droplet retention area in the hydrophilic drop retention area on the substrate capable of discharging a charge of a droplet is by earthing an electrode provided in the drop earth retention area.

4. The droplet operation device according to paragraph 2 or paragraph 3, wherein further provided is a switchboard placed in the lower portion of the substrate for earthing the electrode provided in the hydrophilic droplet retention area, when the substrate is set up on the switchboard.

5. The droplet operation device according to paragraph 1, wherein the charging device for selectively charging a droplet retained in the hydrophilic droplet retention area on the substrate is a device for selectively launching charged particles into the droplet.

6. A droplet operation method comprising the steps of: charging a plurality of droplets formed on a hydrophilic pattern on an insulating substrate with water repellency; and making a movable stick charged and having the same polarity as that of the droplet come close to the charged droplet to move the droplet along the pattern by means of repulsing force between the two.

7. The droplet operation method according to paragraph 6, wherein the moved drop is discharged in a prespecified position, and is incorporated with other drops moved to the prespecified position.

8. A substrate for a droplet operation comprising:

an insulating substrate with one surface thereof being water-repellent;

a plurality of hydrophilic droplet retention areas formed on the water-repellent surface on the substrate;

a hydrophilic droplet transfer line for hydrophilic liquid formed by extending the hydrophilic droplet retention area on the substrate;

an electrostatic electrode provided in the hydrophilic droplet retention area on the substrate via an insulating layer; and

an electrode formed on another surface on the substrate, associated with the electrode provided in the hydrophilic droplet retention area, and electrically connected to the latter electrode.

9. A switchboard used by placing a substrate for a droplet operation, the substrate comprising:

an insulating substrate with one surface thereof being water-repellent;

a plurality of hydrophilic droplet retention areas formed on the water-repellent surface on the substrate;

a hydrophilic droplet transfer line formed by extending the hydrophilic drop retention areas on the substrate;

an electrostatic electrode provided in the hydrophilic droplet retention area on the substrate via an insulating layer; and

an electrode formed on another surface on the substrate, associated with the electrode provided in the hydrophilic droplet retention area, and electrically connected to the electrode;

wherein the electrode provided in the hydrophilic droplet retention area on the substrate is earthed.

Seventh Embodiment

1. A controller for the size of a droplet comprising: a means for generating a droplet; a substrate with a pattern of a hydrophilic area retaining the generated droplet on a water-repellent surface thereof provided thereon; a temperature regulator contacting the substrate; a means for measuring the size of a droplet formed on the substrate; and a control unit for controlling a temperature of the temperature regulator based on the size of the measured droplet.

2. The controller for the size of a droplet according to paragraph 1, wherein the temperature regulator is discretely provided for each of a plurality of drops, and is capable of discretely regulating the temperature of each drop.

3. A controller for the size of a droplet comprising: a means for generating a droplet; a substrate with a pattern of a hydrophilic area retaining the generated droplet on a water-repellent surface thereof provided thereon; a means for transferring a droplet from one hydrophilic area to another hydrophilic area on the hydrophilic pattern; a temperature regulator contacting the substrate; a means for measuring the size of a droplet formed on the substrate; and a control unit for controlling a temperature of the temperature regulator based on the size of the measured droplet.

4. The controller for the size of a droplet according to paragraph 3, wherein the hydrophilic pattern includes at least a hydrophilic line segment, and comprises a hydrophilic line segment on the substrate.

5. The controller for the size of a droplet according to paragraph 3, wherein the temperature regulator is capable of discretely regulating a temperature with respect to each hydrophilic area on the substrate on which the droplet can stay.

6. The controller for the size of a drop according to paragraph 3, wherein the means of transferring a droplet is a means for generating a droplet to which another droplet is contacted.

7. A method of controlling the size of a droplet comprising the steps of:

placing a droplet formed in a hydrophilic area on a substrate, in an environment humidified at a prespecified humidity; and controlling a temperature of the substrate with the droplet retained thereon to control the size of the droplet.

Eighth Embodiment

1. A cell culture microarray having an electrode in a groove or a tunnel for connecting a plurality of minute compartments capable of retaining a cell one by one.

2. A neuron culture microchamber having on a substrate a plurality of compartment walls for keeping a cell in a specific spatial configuration, a plurality of electrode patterns for measuring an electrical change in a cell being provided between each cell, and an optically-transparent semipermeable membrane and a culture solution bath being provided on the compartment walls.

3. A cell culture microarray on a substrate, made of agarose, having a plurality of compartments for keeping a cell in a specific spatial configuration, and provided with an electrode in a tunnel for connecting each compartment.

4. A cell culture microarray provided on a substrate, made of agarose or its derivative, having a plurality of compartments for keeping a cell in a specific spatial configuration, and having a configuration in which a cell is retained substantially one by one in each compartment; in order to obtain interaction between the cells, agarose is locally overheated with convergence light in a given direction to form a tunnel; and one or more electrodes are always provided in each tunnel.

5. A cell culture microarray according to paragraph 3 or paragraph 4, wherein a culture solution bath capable of replacing a solution therein is provided on the top face of agarose.

6. A method of electrically measuring a cell comprising the steps of: providing on a substrate a plurality of compartments made of agarose or its derivative for keeping a cell in a specific spatial configuration; retaining substantially a single cell in each compartment; locally overheating the agarose with convergence light for the purpose of discretionally prescribing the direction in which each cell extends axon or the like for securing intercellular interaction, to form a tunnel to connect each compartment with respect to one another; and measuring an electrical change caused by the intercellular interaction employing an electrode provided in each tunnel.

7. A method of electrically measuring a cell comprising the steps of: providing on a substrate a plurality of compartments made of agarose for keeping a cell in a specific spatial configuration; retaining substantially a single cell in each compartment; locally overheating the agarose with convergence light for the purpose of discretionally prescribing the direction in which each cell extends axon or the like for securing intercellular interaction, to form a tunnel to connect each compartment with respect to one another; giving electric stimulation to intercellular space using an electrode provided in each tunnel; and measuring an electrical change caused by a response from a cell.

8. The method of electrically measuring a cell employing a cell culture microarray according to paragraph 6 or paragraph 7 comprising the steps of: adding to a cell a biological material such as peptide and amino acid or a chemical material suspected of being an endocrine disrupting chemical or having toxicity; and measuring an electrical change caused by a response from the cell.

9. A method of electrically measuring a cell comprising the steps of: employing a neuron culture microchamber having a plurality of compartment walls and tunnels for connecting the compartment walls on a substrate for keeping a cell in a specific spatial configuration, a plurality of electrode patterns for measuring an electrical change in a cell being provided in each of the tunnels, and an optically transparent semipermeable membrane and a culture solution bath being provided on the compartment walls; giving electric stimulation to intercellular space using an electrode provided in each tunnel; and measuring an electrical change caused by a response from the cell.

Ninth Embodiment

1. A cell reconstruction device comprising: a plurality of microchambers each having an electrode for incubating a prespecified number of cells; and a tunnel or a groove communicating between the plurality of microchambers with the cell not capable of passing therethrough but with a culture solution capable of passing therethrough, a cell provided in the microchambers on both sides of the tunnel or groove being a heterogeneous cell.

2. A cell reconstruction device comprising: a plurality of microchambers each having an electrode for incubating a prespecified number of cells; a tunnel or a groove communicating between the plurality of microchambers with the cell not capable of passing therethrough but with a culture solution capable of passing therethrough; and a culture solution bath in which a culture solution for a cell provided in the microchambers on both sides of the tunnel or groove is discretely replaceable.

3. A cell reconstruction device having on a substrate a plurality of compartments for keeping a cell in a specific spatial configuration; a tunnel or a groove communicating between the plurality of compartments with the cell not capable of passing therethrough but with a culture solution capable of passing therethrough; a plurality of electrode patterns for measuring an electrical change in a cell; and an optically transparent semipermeable membrane and a culture solution bath being placed on the compartments; wherein a culture solution bath is designed so that a culture solution for the cell provided in the compartments on both sides of the tunnel or groove can be discretely replaced.

4. A cell reconstruction device having on a substrate a plurality of compartments for keeping a different cell in a specific spatial configuration; a tunnel or a groove communicating between the plurality of microchambers with the cell not capable of passing therethrough but with a culture solution capable of passing therethrough; a plurality of electrode patterns for measuring an electrical change in a cell; and an optically transparent semipermeable membrane and a culture solution bath being placed on the compartments; wherein a culture solution bath is designed so that a culture solution for the cell provided in the compartments on both sides of the tunnel or groove can be discretely replaced.

5. A bioassay chip comprising:

a plurality of microcompartments each retaining a prespecified number of heterogeneous cells;

a groove or a tunnel for connecting between the plurality of microcompartments and those adjacent thereto; and

a means for feeding a different culture solution to each cell in a microcompartment connected with the groove or tunnel.

6. A cell bioassay chip comprising:

    • a plurality of microcompartments each retaining a single cell of heterogeneous cells one by one;

a group of microcompartments for retaining homogenous cells in the plurality of microcompartments and for retaining homogenous cells connected with a groove or a tunnel to each other between the adjoining microcompartments;

a groove or a tunnel for connecting groups for connecting between the microcompartments groups for retaining homogenous cells; and

a means for feeding different culture solutions to each of microcompartment groups.

7. A bioassay: employing a cell reconstruction device comprising, a plurality of microchambers each having an electrode for incubating a prespecified number of cells, a tunnel or a groove communicating between the plurality of microchambers with the cell not capable of passing therethrough but with a culture solution capable of passing therethrough, and a culture solution bath capable of discretely replacing a culture solution for a cell provided in the microchambers on both sides of the tunnel or groove; adding a testing sample to the culture solution for a cell in a microchamber on one of the tunnel or groove side; and observing a change in electrical potential or shape of a cell in a microchamber on the other of the tunnel or groove.

8. A bioassay: employing a cell reconstruction device provided with a plurality of compartments having a substrate, agarose gel provided on the substrate, and an electrode for keeping two or more types of heterogeneous cells formed on the agarose gel in a specific spatial configuration; locally overheating the agarose gel with convergence light for the purpose of discretionally prescribing the direction in which a substantially single cell retained in each of the compartment extends a portion thereof for securing intercellular interaction, to form a tunnel or a groove; giving stimulation to a specific cell using the electrode; and measuring a response of a different cell.

Tenth Embodiment

1. A cell culture method comprising the steps of: incubating a cell on a cellulose membrane; and, after the incubation, decomposing the cellulose membrane using cellulase to collect a cultured cell.

2. A cell culture method comprising the steps of: incubating a cell on the cellulose membrane of a cell culture support having a bottom face inside thereof, forming a plurality of beams with the upper portion thereof opened on the bottom face, and configured to have a cellulose medium attached to the upper edge of the beams; and, after the incubation, injecting cellulose into a flow path formed in a portion of the beams to decompose the cellulose membrane.

3. A cell culture method comprising the steps of: in order to incubate a cell on a cellulose membrane on a cell culture support having a bottom face inside thereof, forming a plurality of beams with the upper portion thereof opened on the bottom face, and configured to have a cellulose membrane attached to the upper edge of the beams; circulating a culture solution in a flow path formed in a portion of the beams; injecting, after the incubation, cellulase in the flow path formed in a portion of the beams; decomposing the cellulose membrane by making cellulase act on the cellulose membrane; and collecting a cell or a sheet of cells.

4. A cell culture method comprising the steps of: in order to incubate a cell on a cellulose membrane on a cell culture support having a bottom face inside thereof, forming a plurality of beams with the upper portion thereof opened on the bottom face, and configured to have a cellulose membrane attached to the upper edge of the beams; circulating a culture solution in a flow path formed in a portion of the beams; injecting, after the incubation, cellulase in the flow path formed in a portion of the beams; decomposing the cellulose membrane by making cellulase act on the cellulose membrane; collecting a cell or a sheet of cells; and further, putting a previously-collected sheet of cells on top of

another sheet of cells newly formed with the procedure to incubate the cells; decomposing the cellulose membrane

by making cellulase act on the cellulose membrane; and collecting the two-ply sheet of cells.

5. The cell culture method according to paragraph 4 further comprising the step of: putting the two-ply sheet of cells on top of another newly formed sheet of cells.

6. A cell culture support having a bottom face inside thereof, forming a plurality of beams with the upper portion thereof opened on the bottom face, and configured to have a cellulose membrane attached to the upper edge of the beams.

7. The cell culture support according to paragraph 6, having a cover used by putting on top of the culture support, wherein the cover is provided with a tube for supplying or sucking a solution supplied to between the plurality of beams or sucked from between the same.

8. The cell culture support according to paragraph 6, having a cover used by putting on top of the culture support, wherein the cover provided with a tube for supplying or sucking a solution supplied to between the plurality of beams or sucked from between the same; and a plate adjoining the tube for blocking a flow of the solution is provided.

Eleventh Embodiment

1. A microchamber for cell culture comprising:

a semipermeable membrane;

a gel membrane formed on the semipermeable membrane and made of agarose or a derivative thereof; and

a plurality of compartments formed on the gel membrane for keeping a cell in a specific spatial configuration.

2. A microchamber for cell culture comprising:

a semipermeable membrane;

a gel membrane formed on the semipermeable membrane and made of agarose or a derivative thereof; and

a plurality of compartments formed on the gel membrane for keeping a cell in a specific spatial configuration, spaces between the plurality of compartments being capable of forming a groove by locally heating an agarose gel membrane with convergence light in the discretional direction.

3. The microchamber for cell culture according to paragraph 1 or paragraph 2, wherein the semipermeable membrane is a cellulose membrane.

4. A method of building the structure of a cell comprising the steps of:

placing a microchamber for cell culture configured to form an agarose gel membrane on a semipermeable membrane;

forming a prespecified number of cell compartments on the agarose gel membrane by means of convergence light heating;

inserting a cell into the cell compartment to incubate the same;

irradiating, during the cell culture, laser convergence light at a wavelength absorbable by water to the agarose gel membrane present between the cell compartments in a prespecified order in the direction desirable for binding the cells to one another to link any cell compartments to one another with a groove; and

making cellulase act on the semipermeable membrane, after a cell assembly with the cells conjugated therein is formed, to remove the semipermeable membrane.

5. A microchamber for cell culture comprising:

a semipermeable membrane;

a thin plate attached to the semipermeable membrane and having an opening in the center thereof;

a gel membrane formed on the opening on the thin plate and made of agarose or a derivative thereof supported by the semipermeable membrane; and

a plurality of compartments formed on the gel membrane for keeping a cell in a specific spatial configuration.

6. A microchamber kit for cell culture comprising:

a pool having an upper portion thereof opened and capable of retaining a solution;

a fine structure substrate having a plurality of beams formed in the pool at prespecified intervals; and

a microchamber for cell culture comprising: a semipermeable membrane; a thin plate attached to the semipermeable membrane and having an opening corresponding to the pool in the center thereof; a gel membrane formed on the opening on the thin plate and made of agarose or a derivative thereof supported by the semipermeable membrane; and a plurality of compartments formed on the gel membrane for keeping a cell in a specific spatial configuration.

7. The microchamber kit for cell culture according to paragraph 6, wherein the microchamber for cell culture is provided with an opening communicating with the pool at both ends of the opening.

8. A cell culture device comprising:

a pool having an upper portion thereof opened and capable of retaining a solution;

a fine structure substrate having a plurality of beams formed in the pool at prespecified intervals; and

a microchamber for cell culture comprising: a semipermeable membrane; a thin plate attached to the semipermeable membrane and having an opening corresponding to the pool in the center thereof; a gel membrane formed on the opening on the thin plate and made of agarose or a derivative thereof supported by the semipermeable membrane; and a plurality of compartments formed on the gel membrane for keeping a cell in a specific spatial configuration, the microchamber for cell culture being provided with an opening communicating to the pool at both ends of the opening to supply or discharge a culture solution to the pool via a tube communicating with the pool through the opening.

9. The cell culture device according to paragraph 8, wherein, when the cell culture reaches a prespecified stage, cellulase at a prespecified concentration is supplied to the pool via a tube communicating with the pool through the opening to dissolve and remove the semipermeable membrane.

10. The cell culture device according to paragraph 4, wherein the formation of a groove on the agarose gel membrane is conducted by, in the step of cell culture, irradiating laser convergence light to a portion of a microneedle contacting the agarose gel membrane to locally heat a portion of the microneedle.

Twelfth Embodiment

1. A cardiac muscle cell bioassay chip comprising:

a means for arranging a network constituting four or more pulsating myocardial cells in the state where each cell is observable;

a means for controlling and measuring electrical stimulation or response of each cell one by one; and

a means for preventing conditions during incubation from changing by means of spatial configuration of each cell.

2. A cardiac muscle cell bioassay chip comprising:

a means for arranging a network constituting not fewer than 4 nor more than 32 pulsating myocardial cells in the state where each cell is observable;

a means for controlling and measuring electrical stimulation or response of each cell one by one; and

a means for preventing conditions during incubation from changing by means of spatial configuration of each cell.

3. A cardiac muscle cell bioassay chip comprising:

a plurality of microcompartments each capable of retaining a single pulsating myocardial cell one by one;

a groove or a tunnel for connecting between the plurality of microcompartments and those adjacent thereto;

not fewer than 4 adjoining microcompartments each with a single cell having been inserted therein in advance; and

a means for supplying each of the microcompartments with a culture solution for pulsating myocardial cells.

4. A cardiac muscle cell bioassay chip comprising:

a substrate;

a plurality of microcompartments provided with four or more pulsating myocardial cells arranged to adjoin one another on the substrate;

a groove or a tunnel for connecting each of the microcompartments; and

a means for supplying each of the microcompartments with a culture solution for pulsating myocardial cells.

5. A cardiac muscle cell bioassay chip comprising:

a plurality of microcompartments each capable of retaining a single pulsating myocardial cell one by one;

a groove or a tunnel for connecting between the plurality of microcompartments and those adjacent thereto;

not fewer than 4 nor more than 32 adjoining microcompartments each with a single cell having been inserted therein in advance; and

a means for supplying each of the microcompartments with a culture solution for pulsating myocardial cells.

6. A cardiac muscle cell bioassay chip comprising:

a substrate;

a plurality of microcompartments provided with not fewer than 4 nor more than 32 pulsating myocardial cells arranged to adjoin one another on the substrate;

a groove or a tunnel for connecting each of the plurality of microcompartments; and

a means for supplying each of the microcompartments with a culture solution for pulsating myocardial cells.

7. A cardiac muscle cell bioassay chip according to any of paragraphs 1 to 6, wherein the material forming the plurality of microcompartments is agarose.

8. An aggregated cell microarray having on a substrate a groove or a tunnel for connecting between a plurality of microcompartment walls in order to adjoin four or more pulsating myocardial cells one another and to keep the cells in a specific spatial configuration, and a plurality of electrical patterns for measuring an electrical change of a cell in each groove or tunnel, and an optically transparent semipermeable membrane and a culture solution bath being provided on the microcompartment walls.

9. A bioassay accommodating a single pulsating myocardial cell in each of a plurality of microcompartments formed on a substrate and connected with a groove or a tunnel to one another, adding a testing sample to each of eight or more microcompartments adjacent to the plurality of microcompartments, and observing a change in electrical potential or shape of the cell each accommodated in the microcompartments.

10. The bioassay according to paragraph 9, wherein the testing sample is a biological material such as peptide and amino acid or a chemical material suspected of being a endocrine disrupting chemical or having toxicity.

11. A bioassay: employing an aggregated cell microarray having on a substrate a groove or a tunnel for connecting between a plurality of microcompartment walls in order to adjoin four or more pulsating myocardial cells one another and to keep the cells in a specific spatial configuration, and a plurality of electrical patterns for measuring an electrical change of a cell in each groove or tunnel, and an optically transparent semipermeable membrane and a culture solution bath being provided on the microcompartment walls; giving electric stimulation to intercellular space using an electrode provided in each groove or tunnel; and measuring a change in electrical potential or shape caused by a response from a cell.

Thirteenth Embodiment

1. A biological sample chip for collecting a specific biological material in a cell, the biological sample chip having a biological sample chip tip section with a needle configuration having a sharp-pointed tip, and fixed thereto a material having an affinity to the specific biological material in a probe area inserted into a cell in the biological sample chip tip section.

2. The biological sample chip according to paragraph 1, wherein TiO2 is fixed onto a portion where a cell is inserted into the endmost portion of the biological sample chip tip section.

3. The biological sample chip according to paragraph 1, wherein, in addition to the material having an affinity to the specific biological material, (Arg)n (n:1˜8) is fixed to a probe area inserted into a cell in the biological sample chip tip section.

4. The biological sample chip according to paragraphs 1 to 3, wherein the biological sample chip tip section has a holder in a root portion thereof, and the holder is connected to an operation substrate.

5. A method of measuring a specific material in a cell comprising the steps of:

sticking into a cell a probe area in the biological sample chip tip section with a material having an affinity to the specific biological material fixed thereon;

capturing in the probe area a material having an affinity to the material fixed to the probe area on the biological sample chip;

making a nanoparticle labeled probe react to the biological material in the cell captured in the probe area for hybridization; and

counting the number of nanoparticles of the probe hybridized with the biological material in the cell captured in the probe area.

6. A method of measuring a specific material in a cell comprising the steps of:

sticking into a cell a probe area in a biological sample chip tip section with a material having an affinity to the specific biological material and (Arg)n (n:1˜8) fixed thereon;

capturing in the probe area a material having an affinity to the material fixed to the probe area on the biological sample chip;

making a nanoparticle labeled probe react to the biological material in the cell captured in the probe area for hybridization; and

counting the number of nanoparticles of the probe hybridized with the biological material in the cell captured in the probe area.

7. The method of measuring a specific material in a cell according to paragraph 5 or paragraph 6, wherein the specific biological material is mRNA.

8. The method of measuring a specific material in a cell according to paragraph 5 or paragraph 6, wherein the specific biological material is protein.

9. The method of measuring a specific material in a cell according to any of paragraphs 5 to 8, wherein a position for sticking the biological sample chip tip section is the nucleus of a cell.

10. The method of measuring a specific material in a cell according to any of paragraphs 5 to 8, wherein a position for sticking the biological sample chip tip section is cytoplasm of a cell.

Fourteenth Embodiment

1. A method of collecting a biological material comprising the steps of:

sticking into a living cell a needle with a material having an affinity to a specific biological material fixed on a tip section thereof;

pulling out the needle from the living cell after a prespecified period of time; and

collecting the specific biological material from the tip section.

2. A method of collecting a biological material comprising the steps of:

sticking into a living cell a needle with a material having an affinity to a specific biological material and (Arg)n (n:1˜8) fixed onto a tip section thereof;

capturing the material having an affinity in the tip section of the needle; and

collecting the specific biological material contained in the cell as the cell remains alive.

3. A method of collecting a biological material comprising the steps of:

sticking into a living cell a needle with a material having an affinity to a specific biological material and TiO2 fixed onto a tip section thereof;

    • capturing the material having an affinity in the tip section of the needle; and

collecting the specific biological material contained in the cell as the cell remains alive.

4. The method of collecting a biological material according to paragraph 1 or paragraph 2, wherein the specific biological material is mRNA.

5. A method of collecting a biological material comprising the steps of:

sticking into a living cell a needle with a probe having a derivative with a poly T sequence having an affinity to a poly A portion of mRNA fixed onto a tip section thereof;

pulling out the needle from the cell after a prespecified period of time;

collecting the mRNA captured in the tip section of the needle; and

amplifying the collected mRNA with the PCR to obtain cDNA of a specific gene.

6. The method of collecting a biological material according to paragraph 1 or paragraph 2, wherein the specific biological material is protein.

7. A method of collecting a biological material comprising the steps of:

sticking into a living cell a needle with a material having an affinity to a specific biological material fixed onto a tip section thereof;

pulling out the needle from the living cell after a prespecified period of time;

collecting the specific biological material from the tip section;

further sticking, after a prespecified period of time, into the cell a needle with a material having an affinity to a specific biological material fixed onto a tip section thereof;

pulling out the needle from the cell after a prespecified period of time; and

collecting the specific biological material from the tip section.

Fifteenth Embodiment

1. An mRNA aliquotting device for collecting mature mRNA comprising:

a chip tip section having a hollow capillary structure with a tip section thereof contacted to the nuclear membrane of a cell;

a means for applying negative pressure to the inside of the chip;

a means for visually observing a contact state between the nuclear membrane of a cell and the chip tip section having a hollow capillary structure; and

a means for regulating a position of the chip tip section having a hollow capillary structure under the control of visual observation of the contact state between the nuclear membrane of a cell and the chip tip section having a hollow capillary structure.

2. An mRNA aliquotting device for collecting mature mRNA according to paragraph 1 further comprising:

a means for measuring electric conductivity between a buffer retained in the chip tip section having a hollow capillary structure and a portion of the cell.

3. A method of aliquotting mRNA comprising the steps of:

sticking a hollow capillary into a cell with mRNA thereof to be collected;

making a tip of the hollow capillary firmly adhere to the nuclear membrane in the cell; and

collecting mRNA passing through the nuclear membrane of the cell into the hollow capillary.

4. The method of aliquotting for collecting mature mRNA of a cell according to paragraph 3 comprising the step of:

filling the hallow capillary with a buffer before sticking a hollow capillary into a cell with mRNA thereof to be collected.

5. A hollow capillary employed in the method of aliquotting mRNA comprising the steps of: sticking a hollow capillary into a cell with mRNA thereof to be collected; making a tip of the hollow capillary firmly adhere to the nuclear membrane in the cell; and collecting mRNA passing through the nuclear membrane of the cell into the hollow capillary, the tip section of the hollow capillary having an (Arg)n (n:1˜8) fixed onto an outer wall thereof.

6. A hollow capillary with TiO2, in place of the (Arg)n (n:1˜8), fixed onto the tip section thereof according to paragraph 5.

7. A hollow capillary with TiO2, in addition to the (Arg)n (n:1˜8), fixed onto the tip section thereof according to paragraph 5.

8. A hollow capillary according to paragraphs 5 to 7, wherein the hollow capillary has a chip tip section configured to have inside thereof at least two systems of hollows separated with the same axle or partition; a buffer is flown from one or more of at least two systems of the hollows separated with the partition; and mRNA is continuously collected from the other hollow(s).

9. A method of aliquotting mRNA according to paragraph 3 or paragraph 4, wherein the collected mRNA is amplified with the PCR to obtain cDNA of a specific gene.

10. A method of aliquotting mRNA to collect mRNA passing through the nuclear membrane of the cell into hollow capillary by:

sticking a hollow capillary into a cell with mRNA thereof to be collected;

making a tip of the hollow capillary firmly adhere to the nuclear membrane in the cell; and

making mRNA transfer by applying positive voltage to an electrode provided in the hollow capillary and applying negative voltage to an electrode provided in the cell nucleus outside the hollow capillary.

Sixteenth Embodiment

1. A biochemical material separator comprising:

a member with a lipid bilayer containing a transporter fixed in a micropore thereof;

a mechanism provided on one side of the micropore for adding a sample; and

a mechanism provided on the other side of the micropore for collecting a biochemical material passing the micropore.

2. A biochemical material separator providing with a plurality types of separation members comprising a lipid bilayer having a transporter present in a cell membrane, nuclear membrane and the like, configured to hierarchically arrange the separation members each for partitioning an anterior vessel thereof, and having a means for collecting the separated biochemical material from between each of the separation members.

3. A biochemical material separator configured to fix a lipid bilayer having a transporter present in a cell membrane, nuclear membrane and the like and passing through a different biological material, onto an inlet of each collecting port of a vessel comprising one sample adding port and a plurality of collecting ports.

4. A biochemical material separator configured to fix a plurality types of lipid bilayers discretely having a plurality types of transporters present in a cell membrane, nuclear membrane and the like and passing through a specific biochemical material, onto an inlet of each collecting port of a vessel comprising one sample adding port and a plurality of collecting ports; and having a means for collecting a specific biochemical material passing through each transporter.

5. A biochemical material separator having the element configuration of fixing a lipid bilayer discretely having a plurality types of transporters present in a cell membrane, nuclear membrane and the like and passing through a specific biochemical material, onto an inlet of each collecting port of a vessel comprising one sample adding port and a plurality of collecting ports; and having a mechanism for collecting a transporter present in an element making a specific biochemical material pass through.

6. The separator according to paragraphs 1 to 5, having a mechanism of making a biochemical material transfer with the electrophoresis or electroosmosis and pass through a transporter.

7. A method of separating a biochemical material to separate a plurality of biochemical materials comprising the steps of:

adding a biological sample solution to a front portion of a micropore in a biochemical material separation comprising: a member with a plurality of transporters and lipid bilayers discretely fixed onto a micropore thereof; a mechanism for adding a sample to one of a front portion or a rear portion of each micropore; and a mechanism for collecting a biochemical material passing through each micropore on the other portion; and

making a biochemical material transfer to separate the same into a material passing through a micropore and that not passing through a micropore.

8. A method of separating a transporter comprising the steps of:

adding a specific biological sample solution to a front portion of a micropore in a biochemical material separation comprising: a member with a plurality of transporters and lipid bilayers discretely fixed onto a micropore thereof; a mechanism for adding a sample to one of a front portion or a rear portion of each micropore; and a mechanism for collecting a biochemical material passing through each pore on the other portion;

detecting an element in which a specific biochemical material passes through a micropore; and

collecting a transporter present in the element in which a specific biochemical material passes through a micropore.

9. The separation method according to paragraph 7 or paragraph 8, wherein a means for making a biochemical material transfer is the electrophoresis or electroosmosis.

10. An mRNA alquiotting chip, the chip being a biological material chip for collecting mature mRNA, having a chip tip section with a hollow capillary structure, and configured to fix a nuclear membrane onto the biological material chip tip section with the inside of the nuclear membrane turned to the outside of the chip.

11. An mRNA separation method comprising the steps of: immersing the biological material chip tip section for collecting the mature mRNA according to paragraph 10, in a sample solution; and collecting the mRNA passing through a nuclear membrane fixed onto the chip tip section, in the biological material chip.

Seventeenth Embodiment

1. A cell chip comprising: a cell fixing substrate having one face thereof as a face for fixing a cell; a micropore provided in a cell fixing portion of the substrate and having a diameter smaller than the cell; and a buffer chamber configured on the reverse of the face for fixing a cell at a position of the micropore on the cell fixing substrate, liquid such as a buffer capable of continuously being fed to the buffer chamber.

2. The cell chip according to paragraph 1, wherein, when a cell is fixed by adding a droplet in a position of the micropore on the face for fixing a cell on the cell fixing substrate, an electrode for measuring electrical conductivity or current passing between the droplet and the buffer chamber is provided.

3. The cell chip according to paragraph 2, wherein the electrode is formed each on both sides of the cell fixing substrate.

4. The cell chip according to paragraph 1 or 2, having a plurality of the micropores, and having clearances between the micropores smaller than those between the cells fixed on the cell fixing substrate.

5. A method of altering a cell comprising the steps of:

placing in a buffer solution a cell fixed onto a cell fixing substrate of a cell chip, the cell chip comprising: a cell fixing substrate having one face thereof as a face for fixing a cell; a micropore provided in a cell fixing portion of the substrate and having a diameter smaller than the cell; and a buffer chamber configured on the reverse of the face for fixing a cell at a position of the micropore on the cell fixing substrate, liquid such as a buffer capable of continuously being fed to the buffer chamber; and

feeding streptolysin O into the buffer chamber to make a lipid bilayer of a cell in a position of the micropore into a semipermeable membrane.

6. The method of altering a cell according to paragraph 5, further comprising the step of: after the feed of streptolysin O, adding any DNA or RNA or a derivative thereof to the buffer chamber.

7. A method of collecting a chemical material comprising the steps of:

placing in a buffer solution a cell fixed onto a cell fixing substrate of a cell chip, the cell chip comprising: the cell fixing substrate having one face thereof as a face for fixing a cell; a micropore provided in a cell fixing portion of the substrate and having a diameter smaller than the cell; and a buffer chamber configured on the reverse of the face for fixing a cell in a position of the micropore on the cell fixing substrate, liquid such as a buffer capable of continuously being fed to the buffer chamber;

altering a cell by feeding streptolysin O to the buffer chamber to make a lipid bilayer of a cell in a position of the micropore into a semipermeable membrane;

adding any chemical material to a buffer surrounding the altered cell; and

collecting a chemical material passing through a lipid bilayer of the cell from the semipermeable membrane-turned lipid bilayer into the buffer chamber.

8. A cell chip comprising: a cell fixing substrate having one face thereof as a face for fixing a cell; a micropore provided in a cell fixing portion of the substrate and having a diameter smaller than the cell; and a buffer chamber configured on the reverse of the face for fixing a cell at a position of the micropore on the cell fixing substrate, electrodes being provided in the buffer chamber and on the side of the face for fixing the cell, and liquid such as a buffer capable of continuously being fed to the buffer chamber, a cell fixed onto the cell fixing substrate of the cell chip being placed in a buffer solution, streptolysin O being fed to the buffer chamber to alter the cell by making a lipid bilayer of the cell at a position of the micropore into a semipermeable membrane, a cell chip with a given peptide expressed therein being prepared by adding mRNA encoding any membrane protein or a vector encoding the mRNA sequence into the cell, any chemical material being added to a buffer surrounding the altered cell, and a chemical material having an affinity to the membrane protein being detected by means of the electrodes.

9. A cell chip comprising: a cell fixing substrate having one face thereof as a face for fixing a cell; a micropore provided in a cell fixing portion of the substrate and having a diameter smaller than the cell; and a buffer chamber configured on the reverse of the face for fixing a cell at a position of the micropore on the cell fixing substrate, electrodes being provided in the buffer chamber and on the side of the face for fixing the cell, and liquid such as a buffer capable of continuously being fed to the buffer chamber, a cell fixed onto the cell fixing substrate of the cell chip being placed in a buffer solution, streptolysin O being fed to the buffer chamber to alter the cell by making a lipid bilayer of the cell at a position of the micropore into a semipermeable membrane, voltage being applied between the electrodes, and a chemical material passing through the fixed cell continuously being collected from the buffer chamber.

Eighteenth Embodiment

1. A biomolecule detecting tubule, being a tubule having one end thereof for an opening in diameter smaller than a prespecified wavelength of light and the other end thereof for another opening in diameter sufficiently larger than the prespecified wavelength of light, and forming a light guide configured to deposit metal on at least an inner wall and an outer wall in the proximity of the tip section opening of the tubule.

2. A biomolecule detector comprising:

a biomolecule detecting tubule, being a tubule having a tip section thereof for an opening in diameter smaller than a prespecified wavelength of light and the other end thereof for another opening in diameter sufficiently larger than the prespecified wavelength of light, and forming a light guide configured to deposit metal on at least an inner wall and an outer wall in the proximity of the tip section opening of the tubule;

two electrodes for applying prespecified voltage;

a laser light source for irradiating light at the prespecified wavelength from the sufficiently large opening of the biomolecule detecting tubule forming the light guide; and

a photon counter provided in the tip section of the tubule for counting light, an evanescence wave area being formed in the proximity of the tip section opening of the tubule by irradiating the laser light, the tip section of the biomolecule detecting tubule being placed in a solution containing a biomolecule, and, when the biomolecule traverses the evanescence wave area and passes the tip section opening of the tubule due to an electric field by the two electrodes, scattered wave generated by the biomolecule being detected with the counter.

3. A biomolecule detector comprising:

a biomolecule detecting chip with a curved and projecting opening in diameter smaller than a prespecified wavelength of light formed in the center portion thereof to form a light guide configured to deposit metal on both faces in the proximity of the opening in the center portion thereof;

two electrodes for applying prespecified voltage;

a laser light source for irradiating light at the prespecified wavelength from one edge face of a chip forming the light guide;

a substrate having a vessel provided on the side of a face with the chip opening being curved and projecting thereon;

a photon counter provided outside a bottom face of the vessel on the substrate, an evanescence wave area being formed in the proximity of the central section opening of the chip by irradiating the laser light; a buffer being put into the vessel; a droplet containing a biomolecule being placed on the opposite side to the side of the vessel of the biomolecule detecting chip; and, when the biomolecule traverses the evanescence wave area and passes the tip section opening of the chip due to electric field generated by the two electrodes, scattered wave caused by the biomolecule being detected with the counter.

4. The biomolecule detector according to paragraph 2, further comprising: a second tubule with a tip section of the biomolecule detector included therein and with a membrane passing a prespecified material provided in the tip opening section thereof.

5. The biomolecule detector according to paragraph 4, wherein the membrane provided in the tip opening section of the second opening and passing a prespecified material includes a transporter passing a prespecified material.

6. The biomolecule detector according to paragraph 3, further comprising: a second chip with an opening section having a membrane passing a prespecified material on a top face of the biomolecule detector.

7. The biomolecule detector according to paragraph 4, wherein the membrane provided in the opening section of the second chip and passing a prespecified material includes a transporter passing a prespecified material.

8. The biomolecule detector according to paragraph 2 or 3, wherein the metal is gold.

9. The biomolecule detector according to paragraph 4, wherein the membrane passing a specific biomolecule is a membrane in which an mRNA sequence of a specific membrane protein is incorporated into an immature ovum of a platanna, and thereby the specific membrane protein is forced to be expressed.

10. The biomolecule detector according to paragraph 6, wherein the membrane passing a specific biomolecule through is a membrane in which an mRNA sequence of a specific membrane protein is incorporated into an immature ovum of a platanna, and thereby the specific membrane protein is forced to be expressed.

11. A method of detecting a biomolecule comprising the steps of:

forming an evanescence wave area in the opening section in diameter smaller than a prespecified wavelength of light;

passing a biomolecule to be detected through the evanescence wave area; and

detecting a scattered wave caused by passage of the biomolecule.

12. The method of detecting a biomolecule according to paragraph 11, wherein the biomolecule to be detected is supplied through a membrane allowing passage of a prespecified material.

13. The method of detecting a biomolecule according to paragraph 12, wherein the membrane allowing passage of a prespecified material is a membrane in which an mRNA sequence of a specific membrane protein is incorporated into an immature ovum of a platanna, and thereby the specific membrane protein is forced to be expressed.

Nineteenth Embodiment

1. A biological sample analysis chip with a different probe fixed on each area of a plurality of areas discretely provided on a substrate thereof, each of the plurality of discrete areas having an area not more than that of a circle 700 nmφ and not less than that of a circle 3 nmφ.

2. A biological sample analysis chip with a different probe fixed on each area of a plurality of areas discretely provided on a substrate thereof, providing structures each having a specific shape on the four corners in each of the plurality of discrete areas, and each of the structures having a specific shape provided on the four corners being different from one another in each of the plurality of discrete areas respectively.

3. The biological sample analysis chip according to paragraph 1 or 2, wherein the areas having as a unit a prespecified number of the plurality of discrete areas are each provided via a groove formed between the areas.

4. The biological sample analysis chip according to paragraph 1 or 2, wherein the areas having as a unit a prespecified number of the plurality of discrete areas are provided at a prespecified distance or farther.

5. An analysis method by means of a biological sample analysis chip comprising the steps of:

dropping a sample solution on a biological sample analysis chip with a different probe fixed on each of a plurality of areas discretely provided on a substrate thereof, each of the plurality of discrete areas having an area not more than that of a circle 700 nmφ and not less than that of a circle 3 nmφ;

placing a thin plate or a rod rotating at a prespecified speed on the top face of the biological sample analysis chip; and

moving the plate or rod from side to side on the substrate to accelerate hybridization between the probe and a sample in the sample solution.

6. An analysis method by means of a biological sample analysis chip comprising the steps of:

dropping a sample solution on a biological sample analysis chip with a different probe fixed on each area of a plurality of areas discretely provided on a substrate thereof, a structure having a specific shape being provided on each of the four corners in the plurality of discrete areas, and each of the structures having a specific shape provided on the four corners being different from one another with respect to each of the plurality of discrete areas;

placing a thin plate or a rod rotating at a prespecified speed on the top face of the biological sample analysis chip; and

moving the plate or rod from side to side on the substrate to accelerate hybridization between the probe and a sample in the sample solution.

7. A method of analyzing a biological sample comprising the steps of:

tracing with a probe for an atomic force microscope a biological sample analysis chip with a different probe fixed on each area of a plurality of areas discretely provided on a substrate thereof, each of the plurality of discrete areas having an area not more than that of a circle 700 nmφ and not less than that of a circle 3 nmφ; and

detecting a sample hybridized with the probe.

8. A method of analyzing a biological sample comprising the steps of:

tracing with a probe for an atomic force microscope a biological sample analysis chip with a different probe fixed on each area of a plurality of areas discretely provided on a substrate thereof, a structure having a specific shape being provided on each of the four corners in the plurality of discrete areas, and each of the structures having a specific shape provided on the four corners being different from one another with respect to each of the plurality of discrete areas; and

detecting a sample hybridized with the probe.

9. The method of analyzing a biological sample according to paragraph 7 or 8, wherein the sample hybridized with the probe reacts to a labeling probe labeling particles each having a different particle diameter to an oligo probe hybridized with a sequence portion complementary to and different from a DNA fragment having been hybridized.

Twentieth Embodiment

1. An analysis method by means of a biological sample analysis chip comprising the steps of:

labeling by means of conductive microparticles a DNA fragment hybridized with a probe of a biological sample analysis chip with a different probe fixed on each area of a plurality of areas discretely provided on a substrate thereof, a structure having a specific shape being provided on each of the four corners in the plurality of discrete areas, each of the structures having a specific shape provided on the four corners being different from one another with respect to each of the plurality of discrete areas, and areas having as a unit a prespecified number of the plurality of discrete areas being provided via a groove formed between the areas; and

detecting the conductive microparticle with a scanning electron microscope.

2. The analysis method by means of a biological sample analysis chip according to paragraph 1 further comprising the steps of:

dropping a sample solution on the biological sample analysis chip;

placing a thin plate or a rod rotating at a prespecified speed on the top face of the biological sample analysis chip; and

moving the plate or rod from side to side on the substrate to accelerate hybridization between the probe and a sample in the sample solution.

3. An analysis method by means of a biological sample analysis chip comprising the steps of:

labeling by means of conductive microparticles a DNA fragment hybridized with a probe of a biological sample analysis chip with a different probe fixed on each area of a plurality of areas discretely provided on a substrate thereof, each of the plurality of discrete areas having an area not more than that of a circle 700 nmφ and not less than that of a circle 3 nmφ; and

detecting the conductive microparticles with a scanning electron microscope.

4. An analysis method by means of a biological sample analysis chip comprising the steps of:

labeling by means of conductive microparticles a DNA fragment hybridized with a probe of a biological sample analysis chip with a different probe fixed on each area of a plurality of areas discretely provided on a substrate thereof, a structure having a specific shape being provided on each of the four corners in the plurality of discrete areas, and each of the structures having a specific shape provided on the four corners being different from one another with respect to each of the plurality of discrete areas; and

detecting the conductive microparticles with a scanning electron microscope.

Twenty-First Embodiment

1. A DNA probe chip comprising:

a substrate;

an electrode formed on the substrate and having a plurality of discrete probe fixing areas formed thereon; and

prespecified DNA probes each fixed on respective probe fixing areas with covalent bonding,

wherein the DNA probe being configured to cause hybridization with a complementary strand DNA from the terminus side fixed onto the probe fixing area.

2. A DNA probe chip comprising:

a substrate;

an electrode formed on the substrate and having a plurality of discrete probe fixing areas formed thereon; and

prespecified DNA probes each fixed on respective probe fixing areas with covalent bonding,

wherein a dissociative group having a negative charge on the terminus different from that fixed on the probe fixing area being added to each of the DNA probes.

3. The DNA probe chip according to paragraph 1, wherein the electrode with a plurality of discrete probes formed thereon is an ITO electrode, and a water repellent surface coating is applied to the area other than the probe fixing areas.

4. The DNA probe chip according to paragraph 1, wherein an electrode surface in the plurality of discrete probe fixing areas is prepared by introducing a residue dissociating positive.

5. The DNA probe chip according to paragraph 1, wherein the DNA probe is a PNA whose main chain is composed with the peptide bond, or a CAS having S-carboxymethyl-L-cysteine as a basic skeleton.

6. The DNA probe chip according to paragraph 1, wherein the DNA probe is designed to have a sequence complementary to that having a prespecified base length starting from an mRNA sequence having a sequence to be hybridized with the DNA probe, and the DNA probe is selected from an area in which the quantity of GC fixed onto the plurality of discrete probe fixing areas on the terminus side is higher than that on the free end side.

7. The DNA probe chip according to paragraph 1, wherein the DNA probe has a sequence complementary to that having a prespecified base length starting from an mRNA sequence having a sequence to be hybridized with the DNA probe, and the DNA probe has a configuration in which, between the terminus side fixed onto the plurality of discrete probe fixing areas and the free end side is inserted a sequence mismatched with a sequence to be hybridized with the DNA probe between the position about 10 bases and that about 30 bases from the free end, or a blank sequence not forming a stable complementary strand with any of ACGT.

8. A method of controlling DNA hybridization comprising the steps of:

adding a sample solution containing a target polynucleotide to between a DNA probe chip comprising: a substrate; an electrode with a plurality of discrete probe fixing areas formed on the substrate formed thereon; and prespecified DNA probes each fixed on respective probe fixing areas with covalent bonding, a dissociative group having a negative charge on the terminus different from that fixed on the probe fixing area being added to the DNA probe: and a member provided opposing to a surface of the DNA probe chip;

applying prespecified electric field to between the electrode and the sample solution site to condense the polynucleotide in the proximity of the surface of the DNA probe chip; and

inverting the electric field for applying to between the electrode and the sample solution site to start hybridization in the state where the probe is stretched.

9. The method of controlling DNA hybridization according to paragraph 7, wherein a DNA probe chip is employed in which the electrode formed thereon a plurality of discrete probe is an ITO electrode, and a water repellent surface coating is applied to the area other than the probe fixing areas.

10. The method of controlling DNA hybridization according to paragraph 7, wherein a DNA probe chip is employed in which an electrode surface in the plurality of discrete probe fixing areas is prepared by introducing a residue dissociating positive.

11. The method of controlling DNA hybridization according to paragraph 7, wherein a DNA probe chip is employed in which the DNA probe is a PNA whose main chain is composed with the peptide bond, or a CAS having S-carboxymethyl-L-cysteine as a basic skeleton.

12. A DNA probe chip comprising:

a substrate;

an electrode with a plurality of discrete probe fixing areas formed on the substrate formed thereon; and

prespecified DNA probes each fixed on respective probe fixing areas with covalent bonding,

wherein the DNA probe being configured to form more stable hybridization on the terminus side fixed onto the probe fixing area than on the free end side.

13. The DNA probe chip according to paragraph 1, wherein the DNA probe with one end thereof fixed on a substrate has a sequence complementary to that having a prespecified base length starting from an mRNA sequence having a sequence to be hybridized with the DNA probe, and the DNA probe is selected from an area in which the quantity of GC fixed onto the plurality of discrete probe fixing areas on the terminus side is higher than that on the free end side.

Twenty-Second Embodiment

1. A DNA probe chip comprising: a substrate; an electrode with a plurality of discrete probe fixing areas formed on the substrate formed thereon; and prespecified DNA probes each fixed on respective probe fixing areas with covalent bonding, the DNA probe constituting at least three areas in the order viewed from the side of the probe fixing area with the DNA probe fixed thereon: a first area being a base sequence substantially complementary to a target polynucleotide; a second area being a base sequence including a base not forming the hydrogen bond complementary to any base among ACGT in the target polynucleotide; and a third area being a base sequence substantially complementary to the target polynucleotide and having a base length thereof equal to or shorter than that of the first area.

2. The DNA probe chip according to paragraph 1, wherein the second area includes at least one third or more base sequence noncomplementary to a target polynucleotide.

3. The DNA probe chip according to paragraph 1, wherein the second area includes a base sequence capable of forming the hydrogen bonding with a target polynucleotide, though unstable in terms of energy as compared to AG or CT base pair.

4. The DNA probe chip according to any of paragraphs 1 to 3, wherein stability of hybridization with a target polynucleotide in the first area, second area and third area declines in the order of the first area, third area and second area.

5. The DNA probe chip according to paragraph 1, wherein a dissociative group having a negative charge on the terminus different from that fixed on the probe fixing area is added to the DNA probe.

6. A method of controlling DNA hybridization comprising the steps of:

adding a sample solution containing a target polynucleotide to between: a DNA probe chip comprising: a substrate; an electrode with a plurality of discrete probe fixing areas formed on the substrate formed thereon; and prespecified DNA probes each fixed on respective probe fixing areas with covalent bonding, the DNA probe constituting at least three areas in the order viewed from the side of the probe fixing area with the DNA probe fixed thereon, a first area being a base sequence substantially complementary to a target polynucleotide; a second area being a base sequence including a base not forming the hydrogen bond complementary to any base among ACGT in the target polynucleotide; and a third area being a base sequence substantially complementary to the target polynucleotide and having a base length thereof equal to or shorter than that of the first area: and a member provided opposing to a surface of the DNA probe chip;

applying prespecified voltage to between the electrode and the sample solution site to condense the polynucleotide in the proximity of a surface of the DNA probe chip; and

inverting electric field for applying to between the electrode and the sample solution site to start hybridization in the state where the probe is stretched.

Twenty-Third Embodiment

1. A DNA probe chip comprising: a substrate; an electrode with a plurality of discrete probe fixing areas formed on the substrate formed thereon; and prespecified DNA probes each fixed with covalent bonding on respective faces of a plurality of pillars in array formed on the electrode face.

2. A DNA hybridization chip having: a structure having probe fixing areas each with a plurality of different DNA probes fixed on the substrate; a structure in which pillars in array are present on each of the probe fixing areas, and space between the pillars forms a valley; a structure of an electrode forming each of the probe fixing areas; and a structure with one end of the DNA probe fixed on a surface of the pillar with covalent bonding.

3. The DNA probe chip according to paragraph 1 or 2, wherein the DNA probe constitutes at least 3 areas in the order viewed from the pillar surface side with the DNA probe fixed thereon, a first area being a base sequence substantially complementary to a target polynucleotide; a second area being a base sequence including a base not forming the hydrogen bond complementary to any base among ACGT in the target polynucleotide; and a third area being a base sequence substantially complementary to the target polynucleotide with a base length thereof and having equal to or shorter than that of the first area.

4. The DNA probe chip according to paragraph 3, wherein the second area includes at least one third or more base sequence noncomplementary to a target polynucleotide.

5. The DNA probe chip according to paragraph 4, wherein the second area includes a base sequence capable of forming the hydrogen bonding with a target polynucleotide, though unstable in terms of energy as compared to AG or CT base pair.

6. The DNA probe chip according to any of paragraphs 3 to 5, wherein stability of hybridization with a target polynucleotide in the first area, second area and third area declines in the order of the first area, third area and second area.

7. A method of controlling DNA hybridization comprising the steps of:

adding a sample solution containing a target polynucleotide to between: a DNA probe chip comprising: a substrate; an electrode with a plurality of discrete probe fixing areas formed on the substrate formed thereon; and prespecified DNA probes each fixed with covalent bonding on respective faces of a plurality of pillars in array formed on the electrode face: and member provided opposing to a surface of the DNA probe chip;

applying prespecified voltage to between the electrode and the sample solution site to condense the polynucleotide into a valley of the pillar on a surface of on the DNA probe chip; and

inverting electric field applied to between the electrode and the sample solution site to start hybridization of the target polynucleotide with a probe on the surface of the pillar.

Twenty-Fourth Embodiment

1. A DNA probe chip having a prespecified DNA probe fixed onto a surface of each of the pillars with covalent bonding; a multitude of the pillars being shaped like a cone, truncated cone, or pyramid or truncated prism, and formed on a separate probe fixing area on a substrate; and having an electrode in a valley of the bottom face of each pillar.

2. A DNA probe chip having a prespecified DNA probe fixed onto a surface of each of wells with covalent bonding, a multitude of the wells being shaped like a cone, truncated cone, or pyramid or truncated prism, and formed on a separate probe fixing area on a substrate; and having an electrode on the bottom face of each well.

3. A method of DNA hybridization comprising the steps of:

adding a sample solution containing a target polynucleotide to between: a DNA probe chip having a substrate forming a plurality of pillars shaped like a cone, truncated cone, or pyramid or truncated prism on a plurality of separate probe fixing areas formed on the substrate, having an electrode in a valley formed with each pillar, and also having a prespecified DNA probe fixed onto a surface of each of the pillars with covalent bonding; and a member provided opposing to a surface of the DNA probe chip;

applying prespecified electric field to between the electrode and the sample solution site to condense the polynucleotide into a valley of the pillar on a surface of the DNA probe chip; and

inverting the electric field applied to between the electrode and the sample solution site to conduct hybridization of the target polynucleotide with a probe on a surface of the pillar.

4. A method of DNA hybridization comprising the steps of:

adding a sample solution containing a target polynucleotide to between: a DNA probe chip having a substrate, forming a plurality of wells shaped like a cone, truncated cone, or pyramid or truncated prism on a plurality of separate probe fixing areas formed on the substrate configured to provide an electrode on the bottom face of each well, and also having a prespecified DNA probe fixed onto a surface of each of the wells with covalent bonding; and a member provided opposing to a surface of the DNA probe chip;

applying prespecified electric field to between the electrode and the sample solution site to condense the polynucleotide into a well on the DNA probe chip; and

inverting the electric field applied to between the electrode and the sample solution site to conduct hybridization of the target polynucleotide with a probe on a surface of the pillar.

Twenty-Fifth Embodiment

1. A biological sample labeling substance being particles for labeling DNA or protein, and made of an alloy of at least two types of transition metal or semiconductor.

2. The biological sample labeling substance according to paragraph 1, wherein each of the particles has a size in a range from 10 nmφ to 50 nmφ.

3. The biological sample labeling substance according to paragraph 1, wherein each of the particles has a size in a range from 10 nmφ to 50 nmφ; and the ratio of elemental composition of the alloy constituting the particles varies, thereby enabling the particles to be classified into a number of different labeling substances in combination with the size thereof.

4. A biological sample labeling substance, being particles for labeling DNA, made of an alloy of at least two types of metal or semiconductor alloy, being a set of particles each having a varied ratio of elemental composition of the alloy, and used by one-to-one correspondence with respect to each sequence of a DNA probe.

5. A biological sample labeling substance, being particles for labeling DNA, made of an alloy of at least two types of metal or semiconductor alloy, being a set of particles each having a varied ratio of elemental composition of the alloy, being used by one-to-one correspondence with respect to an antigen reactive to a prespecified epitope.

6. A method of labeling a biological substance comprising the step of: labeling a biological substance capable of bonding to a biological sample fixed onto a substrate with particles made of an alloy of at least two types of transition metal or semiconductor.

7. A method of testing a biological substance comprising the steps of:

fixing a biological sample on a substrate;

labeling a biological substance capable of bonding to the biological sample with particles made of an alloy of at least two types of transition metal or semiconductor;

subjecting the biological substance labeled with the alloy particles to a reaction with the biological sample; and

conducting elemental analysis with respect to each of the alloy particles labeling the biological substance bonding to the biological sample on the substrate.

8. A method of testing a biological substance comprising the steps of:

fixing a biological sample on a substrate;

labeling a biological substance capable of bonding to the biological sample with particles made of an alloy of at least two types of transition metal or semiconductor;

subjecting the biological substance labeled with the alloy particles to a reaction with the biological sample;

scanning the alloy particles labeling the biological substance bonding to the biological sample on the substrate by means of electron beams of a scanning electron microscope for measuring an energy distribution of secondary electron beams derived from a specific element to identify the position and size of the particles; and

detecting characteristic X-ray radiated by the particles subjected to the electron beam scanning with a energy dispersive characteristic X-ray detector to obtain the result of elemental analysis.

9. The biological sample labeling substance according to any of paragraphs 1 to 5, wherein the metal or semiconductor is any of transition metal with the atomic number up to 79 other than 43 in the periodic table, metal with the atomic number 13, 31, 32, 49, 50, 51, 81, 82 and 83, and semiconductor with the atomic number 14, 33, 34 and 52.

10. The method of labeling a biological substance according to paragraph 6 to paragraph 7, wherein the metal or semiconductor is any of transition metal with the atomic number up to 79 other than 43 in the periodic table, metal with the atomic number 13, 31, 32, 49, 50, 51, 81, 82 and 83, and semiconductor with the atomic number 14, 33, 34 and 52.

11. The method of testing a biological substance according to paragraph 8, wherein the metal or semiconductor is any of transition metal with the atomic number up to 79 other than 43 in the periodic table, metal with the atomic number 13, 31, 32, 49, 50, 51, 81, 82 and 83, and semiconductor with the atomic number 14, 33, 34 and 52.

Twenty-Sixth Embodiment

1. A method of testing a biological substance comprising the steps of:

obtaining a secondary electron by scanning with electron beams a plurality of particles with a plurality of elements contained therein to obtain an electron beam scanning line image of the particles from the obtained secondary electron;

obtaining an elemental analysis image from the secondary electron obtained by scanning with electron beams a plurality of particles with a plurality of elements contained therein, based on X-ray at a specific wavelength depending on composition element of the particles;

comparing the electron beam scanning image and the elemental analysis image to identify each of the plurality of particles and a position thereof.

2. A biological sample labeling substance using particles with a plurality of elements contained therein as particles for labeling DNA or protein, the plurality of elements being at least two types of transition metal or semiconductor.

3. The biological sample labeling substance according to paragraph 2, wherein each of the particles has a size in a range from 10 nmφ to 50 nmφ.

4. The biological sample labeling substance according to paragraph 2, wherein each of the particle has a size in a range from 10 nmφ to 50 nmφ, the ratio of element composition of the alloy constituting the particles varies, thereby enabling particles to be classified into a number of different labeling substances in combination with the size thereof.

5. A biological sample labeling substance having particles for labeling DNA, the particles containing at least two types of transition metal or semiconductor, having a varied ratio of the element composition, and used by one-to-one correspondence with respect to each sequence of a DNA probe.

6. A biological sample labeling substance having particles for labeling DNA, the particles containing at least two types of transition metal or semiconductor, having a varied ratio of the element composition, and used by one-to-one with respect to each sequence of a specific epitope.

7. A method of labeling a biological substance, a biological substance capable of bonding a biological sample fixed on a substrate being labeled with particles containing at least two types of transition metal or semiconductor.

8. A method of testing a biological substance comprising the steps of:

fixing a biological sample on a substrate;

labeling a biological substance capable of bonding the biological sample with particles containing at least two types of transition metal or semiconductor;

subjecting the biological substance labeled with the alloy particles to a reaction with the biological sample; and

conducting elemental analysis of the particles labeling the biological substance bonded to the biological sample on the substrate with respect to each particle.

9. A method of testing a biological substance comprising the steps of:

fixing a biological sample on a substrate;

labeling a biological substance capable of bonding the biological sample with particles containing at least two types of transition metal or semiconductor;

subjecting the biological substance labeled with the alloy particles to a reaction with the biological sample;

scanning the particles labeling the biological substance bonded to the biological sample on the substrate with electron beams of a scanning electron microscope for measuring an energy distribution of a secondary electron beam derived from a specific element to identify the position and size of the particles; and

detecting characteristic X-ray generated by the particles scanned with the electron beams utilizing an energy dispersive characteristic X-ray spectrometer to obtain the result of elemental analysis.

10. The biological sample labeled substance according to any of paragraphs 2 to 6, wherein the metal or semiconductor is any of transition metal with the atomic number up to 79 other than 43 in the periodic table, metal with the atomic number 13, 31, 32, 49, 50, 51, 81, 82 and 83, and semiconductor with the atomic number 14, 33, 34 and 52.

11. The method of labeling a biological substance according to paragraph 7 or paragraph 8, wherein the metal or semiconductor is any of transition metal with the atomic number up to 79 other than 43 in the periodic table, metal with the atomic number 13, 31, 32, 49, 50, 51, 81, 82 and 83, and semiconductor with the atomic number 14, 33, 34 and 52.

12. The method of testing a biological substance according to paragraph 9, wherein the metal or semiconductor is any of transition metal with the atomic number up to 79 other than 43 in the periodic table, metal with the atomic number 13, 31, 32, 49, 50, 51, 81, 82 and 83, and semiconductor with the atomic number 14, 33, 34 and 52.

13. Particles for testing a biological substance, the particles having a prespecified size, including a mixture of at least two types of transition metal or semiconductor, and having a surface thereof with a probe having a base sequence complementarily bonded to a biological sample to be detected fixed thereon.

14. The particles for testing a biological substance according to paragraph 13, wherein different probes are fixed onto each of a plurality of the particles having different ratio of elemental composition respectively.

15. The particles for testing a biological substance according to paragraph 13 or paragraph 14, wherein the size of the particles is in a range from 0.5 μm to 5 μmm.

16. The particles for testing a biological substance according to paragraph 14, wherein each of a plurality of the particles is in one-to-one correspondence with respect to an antibody reactive to a specific epitope in a biological sample.

17. A method of testing a biological substance comprising the steps of:

labeling, with respect to each of a plurality of particles having different ratio of elemental composition composed of a prespecified size of a particle including a mixture of at least two types of transition metal or semiconductor, a first group of particles fixed in one-to-one correspondence to various types of ligands having affinity to different biological substance depending on each of the particles, and the biological substance with a second group of particles to complementarily bond each ligand;

scanning each particle of the first group of particles with electron beams to obtain an electron beam scanning line image of the particles from the obtained secondary electron;

obtaining an elemental analysis image from the secondary electron obtained by scanning the first group of particles with electron beams, based on X-ray at a specific wavelength depending on composition element of the particles;

comparing the electron beam scanning image and the elemental analysis image to identify each of the first group of particles and a position thereof; and

counting the number of the second group of particles to evaluate the quantity of the biological substance being in the state of ligand to each of the first group of a plurality of particles.

18. Particles for testing a biological substance according to paragraph 13, wherein a plurality types of elements used for a prespecified size of the particles including a mixture of at least two types of transition metal or semiconductor are any of Sc, Ti, Ga, Ge, Y, Zr, Nb, Ru, Rh, Pd, Ag, Cd, In, Sb, La, Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, Lu, Hf, Ta, W, Re, Os, Ir, Pt, Au, Tl, Bi and Th.

19. A method of testing a biological substance comprising the steps of:

labeling, with respect to each of a plurality of particles having different ratio of elemental composition composed of a prespecified size of particles including a mixture of at least two types of transition metal or semiconductor, a first group of particles fixed in one-to-one correspondence to various types of ligands having affinity to different biological substance depending on each of the particles, and the biological substance with a second group of particles to complementarily bond each ligand to thereby remove the biological substance together with the first group of particles;

labeling, with respect to each of a plurality of particles having different ratio of elemental composition of a prespecified size of particles including a mixture of at least two types of transition metal or semiconductor, a second group of particles fixed in one-to-one correspondence to various types of ligands having affinity to biological substances different from the various types of ligands having affinity to biological substances for the first group of particles, and the biological substance with a third group of particles to complementarily bond each ligand;

scanning each particle of the first group of particles with electron beams to obtain an electron beam scanning image of the particles from the obtained secondary electron;

obtaining an elemental analysis image from the secondary electron obtained by scanning the second group of particles with electron beams, based on X-ray at a specific wavelength depending on composition element of the particles;

comparing the electron beam scanning image and the elemental analysis image to identify each of the second group of a plurality of particles and a position thereof; and

counting the number of the third group of particles to evaluate the quantity of the biological substance being in the state of ligand to each of the second group of a plurality of particles.

Twenty-Seventh Embodiment

1. A method of collecting an electrophoretic separated substance comprising the steps of:

irradiating convergence light to a specific electrophoretic separation band portion of the electrophoretic separation band developed on heat-melting gel; and

melting the electrophoretic separation band portion to collect the same.

2. A device for collecting an electrophoretic separated substance comprising: a means for holding an electrophoretic separation gel substrate having a electrophoretic separation band developed on heat-melting gel; a means for detecting a specific electrophoretic separation band portion of the electrophoretic separation band; a means for irradiating convergence light to the detected electrophoretic separation band portion to heat the same; and a means for sucking gel melted by the heating.

3. The device for collecting an electrophoretic separated substance according to paragraph 2, wherein the means for holding an electrophoretic separation gel substrate holds a means for regulating temperature.

4. The device for collecting an electrophoretic separated substance according to paragraph 2, wherein the means for sucking gel melted by the heating is provided with a means for accessing a pipet and a specific electrophoretic separation band portion with the pipet melted thereon.

5. The device for collecting an electrophoretic separated substance according to paragraph 2, wherein the heat-melting gel contains agarose in a quantity at least sufficient to maintain a gel structure thereof.

6. The device for collecting an electrophoretic separated substance according to paragraph 2, wherein the melting point of agarose for the heat-melting gel is 60° C. or below.

7. A heat-melting gel substrate applied to a method of collecting an electrophoretic separated substance comprising the steps of: irradiating convergence light to a specific electrophoretic separation band portion of the electrophoretic separation band developed on heat-melting gel; and melting the electrophoretic separation band portion to collect the same, the heat-melting gel being fixed onto a glass substrate with a thickness of the heat-melting gel not less than 0.02 mm nor more than 0.2 mm.

8. A device for collecting an electrophoretic separated substance configured to have the means for sucking gel melted by heating capable of impressing electric field with a pipet with a first electrode attached to the inside thereof between the first electrode and another electrode provided in a vessel outside.

9. A method of collecting an electrophoretic separated substance comprising the steps of:

filling the pipet with an electrolysis solution in advance;

sucking gel melted by convergence light;

lowering the temperature of the gel sucked in the pipet to turn the same into gel again;

contacting a pipet chip tip section with a vessel filled with an electrolysis solution;

impressing electric field between a first electrode contacting the electrolysis solution in the pipet and a second electrode in the vessel, taking the second electrode as positive pole, to subject an electrophoretic separated substance contained in the gel solidifying in the pipet chip to electrophoresis to elute the same in the electrolysis solution in the vessel.

Twenty-Eighth Embodiment

1. A cell crushing device comprising: a substrate for holding a droplet including a prespecified cell on a surface thereof; and an optical system for irradiating convergence light including a band absorbed by the cell to the droplet.

2. The cell crushing device according to paragraph 1, wherein the substrate for holding a droplet including a prespecified cell in a hydrophilic area thereof is configured to have a hydrophilic area surrounded by a water-repellent area and having a range smaller than the size of the droplet.

3. A cell crushing device comprising: a pipet capable of holding a solution with a plurality of cells included therein, and having a tip opening in a diameter suited for a prespecified size of a cell or a cell mass to pass therethrough; a means for observing a cell on the pipet tip; a means for pressing out the solution including a plurality of cells on the pipet tip section from the inside of the pipet to form a droplet; a means for determining the formation of a droplet including a prespecified cell and having a prespecified size; a unit for dropping the droplet formed on the pipet chip section to a prespecified position on the substrate; and an optical system irradiating convergence light including a band absorbed by the cell to the droplet.

4. A method of crushing a cell comprising the steps of:

holding a droplet including a cell in a hydrophilic area on a substrate, the hydrophilic area surrounded by a water repellent area and having an area smaller than the size of the cell; and

irradiating convergence light including a band optically absorbed by a cell in the droplet.

Twenty-Ninth Embodiment

1. A high speed trace quantity reactor comprising: a means for transferring droplets each containing different reaction precursors respectively to collide to one another; and a detecting means for tracking reaction of the collided droplets.

2. A high speed trace quantity reactor comprising: a means for transferring droplets each containing different reaction precursors respectively to collide to one another; a means for stirring the collided droplets; and a detecting means for tracking reaction of the collided droplets.

3. A method of trace quantity reaction comprising the steps of:

dissolving a plurality of reaction precursors targeted to be reacted, in respective different droplets;

putting each of the droplets in different positions on a substrate; and

making each of the droplets collide to one another on the substrate to cause reactions.

4. A method of trace quantity reaction comprising the steps of:

putting each of a droplet with a cell inserted therein and a droplet including a heterologous cell active substance in different positions on a substrate; and

making each of the droplets collide to one another on the substrate to observe effects on the cell.

Thirtieth Embodiment

1. An absorption spectroscopy system comprising: a means for forming a droplet containing solute on a substrate; a means for transferring the droplet as crossing a beam of light; a source of the beam of light; and a light detector for detecting a signal obtained when the droplet crosses the beam of light.

2. An absorption spectroscopy system comprising: a means for forming a droplet containing solute on a substrate; a means for focusing a beam of light on the droplet; and a light detector for detecting intensity of light passing through the droplet.

3. A fluorescence spectroscopy system comprising: a means for forming a droplet containing solute on a substrate; a means for transferring the droplet as crossing a beam of light; a source of the beam of light; and a light detector for detecting a signal obtained when the droplet crosses the beam of light.

4. An absorption spectroscopy system comprising: a substrate with hydrophilic patterns for holding a droplet on a water repellent face provided thereon; a means for transferring the droplet formed on the substrate as the droplet crosses a beam of light on the hydrophilic patterns; a source of the beam of light; a light detector for detecting a signal obtained when the droplet crosses the beam of light; a measuring means for measuring the size of the droplet transferring as crossing the beam of light on the hydrophilic patterns; and a computing device for computing the light path length based on the measured size of the droplet.

5. An spectroscopy system comprising: an absorption spectroscopy system comprising; a substrate with hydrophilic patterns for holding a droplet on a water repellent face provided thereon, a means for transferring the droplet formed on the substrate utilizing a surface acoustic wave as the droplet crosses a beam of light on the hydrophilic patterns, a source of the beam of light, and a light detector for detecting a signal obtained when the droplet crosses the beam of light; and a computing device for estimating the size of the droplet by a temporal change of a position of the droplet to compute the light path length.

6. The spectroscopy system according to paragraph 5, wherein a means for generating the surface acoustic wave is a piezoelectric substrate provided in a droplet transfer path, and a comb-shaped electrode made of lithium tetraborate or lithium tantarate or lithium niobate.

7. The absorption spectroscopy system according to paragraph 4, wherein the substrate is equipped with a temperature control plate contacting thereto.

8. A spectroscopic method comprising the steps of:

providing a droplet on a line of a substrate with hydrophilic line patterns for holding a droplet on a water repellent face provided thereon;

transferring the droplet along the hydrophilic line patterns; detecting a signal including information on the droplet obtained when the droplet is transferred as crossing a beam of light irradiated from a light source; measuring the size of the droplet from the signal; computing the light path length of the light passing through the droplet based on the seize of the measured droplet; and

measuring light absorption or fluorescence of the droplet.

9. The spectroscopy system for measuring light absorption or fluorescence of a droplet according to paragraph 5, wherein the hydrophilic line patterns have a pattern with a plurality of hydrophilic lines converge thereon, and each droplet held on a plurality of the hydrophilic lines are mixed at a convergent point of the pattern.

10. The spectroscopic method for measuring light absorption or fluorescence of a droplet according to paragraph 6, wherein the hydrophilic line patterns have a pattern with a plurality of hydrophilic lines converge thereon, have another convergent point downstream of the convergent point described above, and have patterns allowing a plurality of times of time-series mixing at a convergent point of each of the droplets held in the plurality of hydrophilic lines.

Claims

1. A sample freezing device comprising:

a pressure-resistant vessel having a cylinder configured to accommodate a solution containing a sample without a gas phase;

a piston configured to engage with the cylinder;

a pressurizing unit configured to push the piston into the cylinder; and

a control unit configured to control the pressurizing unit to control the rate of pushing the piston into the cylinder,

wherein the control unit is configured to apply pressure to the solution while cooling the solution and keeping the temperature of the solution in the cylinder within a temperature range up to plus 4° C. from the phase transition point between ice and liquid water, and release the pressure when the solution reaches a state in which the temperature of the phase transition point between ice and liquid water is almost the lowest temperature.

2. The sample freezing device according to claim 1, wherein the cylinder is tapered on an end face of the pressure-resistance vessel and an operation of engaging the piston with the cylinder is conducted in the state where the solution containing the sample to be accommodated in the cylinder almost overflows from the top of the cylinder.

3. A sample freezing method comprising the steps of:

cooling a sample at high pressure to a temperature below 0° C. while keeping the sample in a solution state without a gas phase therein; and

flash-freezing the sample by a rapid pressure reduction within a period of time between several micro seconds and several dozen micro seconds.

4. The method according to claim 3, comprising the step of cooling the sample at high pressure to a temperature around minus 10° C. while keeping the sample in a solution state without a gas phase.

5. A sample freezing method comprising the steps of:

pressurizing a solution containing a sample at a pressure range from 0.1 to 0.2 GPa while cooling the solution and keeping the temperature of the sample in a temperature range up to plus 4° C. from the phase transition point between ice and liquid water without a gas phase in the solution, and

subjecting the sample to a rapid pressure reduction.

6. A rapid sample freezing device comprising:

a pressure-resistant vessel having a cylinder configured to accommodate a solution containing a sample without a gas phase;

a piston configured to engage with the cylinder;

a pressurizing unit configured to push the piston into the cylinder; and

a control unit configured to control the pressurizing unit to control the rate of pushing the piston into the cylinder,

wherein the control unit is configured to apply pressure to the solution while cooling the solution to a temperature below 0° C. and keeping the solution in the cylinder in a state where the solution does not freeze until the temperature of the phase transition point between ice and liquid water reaches almost the lowest temperature.

7. The rapid sample freezing device according to claim 6, wherein the control unit is configured to control the pressurizing unit to apply pressure to the solution in the cylinder in a pressure range from 0.1 to 0.2 GPa while keeping a state that does not allow the solution to freeze, and cool the solution to a temperature below 0° C., and then release the pressure.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class: