US20150376714A1
2015-12-31
14/765,294
2014-01-31
A method for predicting a benefit from inclusion of taxane in a chemotherapy regimen in a patient suffering from or at risk of developing recurrent neoplastic disease, in particular breast cancer. Said method comprises the steps of: a) determining in a tumor sample from said patient the expression levels of the marker genes S100P and PCSK6, and b) mathematically combining the expression level values of the genes PCSK6 and S100P to yield a combined score and comparing said combined score to a reference-value, including a cutoff, wherein a high combined score is indicative of a benefit from including a taxane in a chemotherapy regimen of said patient and a low combined score is indicative of not having a benefit from including a taxane in a chemotherapy regimen of said patient or c) mathematically combining the expression level value of PCSK6 and S100P with the expression values of other genes to yield a combined score and comparing said combined score to a reference-value, including a cutoff, wherein a high combined score is indicative of a benefit from including a taxane in a chemotherapy regimen of said patient and a low combined score is indicative of not having a benefit from including a taxane in a chemotherapy regimen of said patient.
Get notified when new applications in this technology area are published.
C12Q1/6886 » CPC main
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
C12Q2600/158 » CPC further
Oligonucleotides characterized by their use Expression markers
C12Q2600/106 » CPC further
Oligonucleotides characterized by their use Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
C12Q1/68 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids
The present invention relates to methods, kits and systems for predicting the benefit from inclusion of taxane in a chemotherapy regimen based on the measurements of gene expression levels in tumor samples of breast cancer patients.
Breast cancer is the most common tumor type and the leading cause of can-cer-related death in women (Jemal et al., CA Cancer J Clin., 2011). Considerable progress has been made in terms of breast cancer diagnosis and treatment in the last years.
After surgical removal of the primary tumor, breast cancer patients are frequently treated with radiotherapy, hormone therapy and cytotoxic chemotherapy to reduce the risk of recurrence. Today, anthracycline and taxane-based treatment strategies are commonly used in clinical routine, since these regimens have been shown to be superior compared to other standard chemotherapies.
Several large clinical trials demonstrated that the addition of taxanes to anthracycline-based treatment strategies results in an improved clinical outcome (Martin et al., NEJM, 2005, Gianni, K O, 2009). Although, taxanes are among the most active agents, the absolute benefit of taxane-based treatment is modest (3-5%) and has to be balanced according to serious side-effects.
To reduce the number of patients suffering from side effects without a clear benefit of the therapy regimen, there is a great need for novel predictive tests to identify a group of patients that can be safely treated with conventional chemotherapy and a subgroup that has a significant benefit of taxane-based treatment.
Considerable efforts have been made to identify biomarkers that allow a prediction of a specific treatment while minimizing the risk of unnecessary side effects. Ki67âa well-known cell proliferation markerâhas been described to predict the benefit from adjuvant taxane-based treatment in the PACS01 trial (Penault-Llorca, JCO, 2008). However, neither the association between Ki67 index and treatment effect nor any other clinicopathological parameter or biomarker predictive for the efficiency of taxanes has been validated so far.
The most challenging treatment decision in this context concerns ER+/HER2â breast cancer patients, for which classical clinical factors like grading, tumor size or lymph node involvement do not provide a clear answer to the question whether to use chemotherapy or not and what type of treatment therapy is appropriate for the individual patient.
Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
The term âtumorâ as used herein, refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues.
The term âcancerâ is not limited to any stage, grade, histomorphological feature, aggressivity, or malignancy of an affected tissue or cell aggregation.
The term âpredictionâ, as used herein, relates to an individual assessment of the malignancy of a tumor, or to the expected survival rate (OAS, overall survival or DFS, disease free survival) of a patient, if the tumor is treated with a given therapy.
A âbenefitâ from a given therapy is an improvement in health or wellbeing that can be observed in patients under said therapy, but isn't observed in patients not receiving this therapy. Non-limiting examples commonly used in oncology to gauge a benefit from therapy are survival, disease free survival, metastasis free survival, disappearance of metastasis, tumor regression, and tumor remission.
A âriskâ is understood to be a probability of a subject or a patient to develop or arrive at a certain disease outcome. The term âriskâ in the context of the present invention is not meant to carry any positive or negative connotation with regard to a patient's wellbeing but merely refers to a probability or likelihood of an occurrence or development of a given condition.
The term ânode positiveâ, âdiagnosed as node positiveâ, ânode involvementâ or âlymph node involvementâ means a patient having previously been diagnosed with lymph node metastasis. It shall encompass both draining lymph node, near lymph node, and distant lymph node metastasis. This previous diagnosis itself shall not form part of the inventive method. Rather it is a precondition for selecting patients whose samples may be used for one embodiment of the present invention. This previous diagnosis may have been arrived at by any suitable method known in the art, including, but not limited to lymph node removal and pathological analysis, biopsy analysis, in-vitro analysis of biomarkers indicative for metastasis, imaging methods (e.g. computed tomography, X-ray, magnetic resonance imaging, ultrasound), and intraoperative findings.
In the context of the present invention a âbiological sampleâ is a sample which is derived from or has been in contact with a biological organism. Examples for biological samples are: cells, tissue, body fluids, lavage fluid, smear samples, biopsy specimens, blood, urine, saliva, sputum, plasma, serum, cell culture supernatant, and others. A âtumor sampleâ is a biological sample containing tumor cells, no matter if intact or degraded.
A âgeneâ is a set of segments of nucleic acid that contains the information necessary to produce a functional RNA product. A âgene productâ is a biological molecule produced through transcription or expression of a gene, e.g. an mRNA or the translated protein.
An âmRNAâ is the transcribed product of a gene or a part of a gene and shall have the ordinary meaning understood by a person skilled in the art. A âmolecule derived from an mRNAâ is a molecule which is chemically or enzymatically obtained from an mRNA template, such as cDNA.
The term âexpression levelâ refers to a determined level of gene expression. This may be a determined level of gene expression as an absolute value or compared to a reference gene (e.g. a housekeeping gene) or to a computed average expression value (e.g. in DNA chip analysis) or to another informative gene without the use of a reference sample. The expression level of a gene may be measured directly, e.g. by obtaining a signal wherein the signal strength is correlated to the amount of mRNA transcripts of that gene or it may be obtained indirectly at a DNA or protein level, e.g. by immunohistochemistry, CISH, ELISA or RIA methods. The expression level may also be obtained by way of a competitive reaction to a reference sample. An expression value which is determined by measuring some physical parameter in an assay, e.g. fluorescence emission, may be assigned a numerical value which may be used for further processing of information.
A âreference pattern of expression levelsâ, within the meaning of the invention shall be understood as being any pattern of expression levels that can be used for the comparison to another pattern of expression levels. In a preferred embodiment of the invention, a reference pattern of expression levels is, e.g., an average pattern of expression levels observed in a group of healthy individuals, diseased individuals, or diseased individuals having received a particular type of therapy, serving as a reference group.
As all measurement results also gene expressions values or combined scores, consisting of a mathematical combination of one or more gene expression values, require to be compared to a âreference-valueâ to get a meaning in a clinical context. As such an expression value or a combined score exceeding such a âreference-valueâ, by way of example may mean an improved or worsened likelihood of survival for a patient. Such âreference-valueâ can be a numerical cutoff value, it can be derived from a reference measurement of one or more other genes in the same sample, or one or more other genes and/or the same gene in one other sample or in a plurality of other samples. This is how âreference-valueâ within the meaning of this invention should be understood.
The term âmathematically combining expression levelsâ, within the meaning of the invention shall be understood as deriving a numeric value from a determined expression level of a gene and applying an algorithm to obtain a combined numerical value or combined score.
An âalgorithmâ is a process that performs some sequence of operations to process an information.
The term âcytotoxic treatmentâ or âcytotoxic chemotherapyâ refers to various treatment modalities affecting cell proliferation and/or survival. The treatment may include administration of alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, and other antitumour agents, including monoclonal antibodies and kinase inhibitors. In particular, the cytotoxic treatment may relate to a treatment comprising microtubulestabilizing drugs such as taxanes or epothilones.
The term âneoadjuvant chemotherapyâ relates to a preoperative therapy regimen consisting of a panel of hormonal, chemotherapeutic and/or antibody agents, which is aimed to shrink the primary tumor, thereby rendering local therapy (surgery or radiotherapy) less destructive or more effective, enabling breast conserving surgery and evaluation of responsiveness of tumor sensitivity towards specific agents in vivo.
A âmicrotubule stabilizing agent-basedâ treatment or therapy is a treatment or therapy comprising taxol or therapeutically effective derivatives thereof, epothilones or therapeutically effective derivatives thereof or other microtubule stabilizing cytotoxic drugs.
A âtaxane-basedâ treatment or therapy is a treatment or therapy comprising taxol or therapeutically effective derivatives thereof. The principal mechanism of the taxane class of drugs is the disruption of microtubule function.
The term âhybridization-based methodâ, as used herein, refers to methods imparting a process of combining complementary, single-stranded nucleic acids or nucleotide analogues into a single double stranded molecule. Nucleotides or nucleotide analogues will bind to their complement under normal conditions, so two perfectly complementary strands will bind to each other readily. In bioanalytics, very often labeled, single stranded probes are in order to find complementary target sequences. If such sequences exist in the sample, the probes will hybridize to said sequences which can then be detected due to the label. Other hybridization based methods comprise microarray and/or biochip methods. Therein, probes are immobilized on a solid phase, which is then exposed to a sample. If complementary nucleic acids exist in the sample, these will hybridize to the probes and can thus be detected. These approaches are also known as âarray based methodsâ. Yet another hybridization based method is PCR, which is described above. When it comes to the determination of expression levels, hybridization based methods may for example be used to determine the amount of mRNA for a given gene.
An oligonucleotide capable of specifically binding sequences a gene or fragments thereof relates to an oligonucleotide which specifically hybridizes to a gene or gene product, such as the gene's mRNA or cDNA or to a fragment thereof. To specifically detect the gene or gene product, it is not necessary to detect the entire gene sequence. A fragment of about 20-150 bases will contain enough sequence specific information to allow specific hybridization.
The term âa PCR based methodâ as used herein refers to methods comprising a polymerase chain reaction (PCR). This is a method of exponentially amplifying nucleic acids, e.g. DNA by enzymatic replication in vitro. As PCR is an in vitro technique, it can be performed without restrictions on the form of DNA, and it can be extensively modified to perform a wide array of genetic manipulations. When it comes to the determination of expression levels, a PCR based method may for example be used to detect the presence of a given mRNA by (1) reverse transcription of the complete mRNA pool (the so called transcriptome) into cDNA with help of a reverse transcriptase enzyme, and (2) detecting the presence of a given cDNA with help of respective primers. This approach is commonly known as reverse transcriptase PCR (rtPCR).Moreover, PCR-based methods comprise e.g. real time PCR, and, particularly suited for the analysis of expression levels, kinetic or quantitative PCR (qPCR). The term âQuantitative PCRâ (qPCR)â refers to any type of a PCR method which allows the quantification of the template in a sample. Quantitative real-time PCR comprise different techniques of performance or product detection as for example the TaqMan technique or the LightCycler technique. The TaqMan technique, for examples, uses a dual-labelled fluorogenic probe. The TaqMan real-time PCR measures accumulation of a product via the fluorophore during the exponential stages of the PCR, rather than at the end point as in conventional PCR. The exponential increase of the product is used to determine the threshold cycle, CT, i.e. the number of PCR cycles at which a significant exponential increase in fluorescence is detected, and which is directly correlated with the number of copies of DNA template present in the reaction. The set up of the reaction is very similar to a conventional PCR, but is carried out in a real-time thermal cycler that allows measurement of fluorescent molecules in the PCR tubes. Different from regular PCR, in TaqMan real-time PCR a probe is added to the reaction, i.e., a single-stranded oligonucleotide complementary to a segment of 20-60 nucleotides within the DNA template and located between the two primers. A fluorescent reporter or fluorophore (e.g., 6-carboxyfluorescein, acronym: FAM, or tetrachlorofluorescein, acronym: TET) and quencher (e.g., tetramethylrhodamine, acronym: TAMRA, of dihydrocyclopyrroloindole tripeptide âminor groove binderâ, acronym: MGB) are covalently attached to the 5âČ and 3âČ ends of the probe, respectively[2]. The close proximity between fluorophore and quencher attached to the probe inhibits fluorescence from the fluorophore. During PCR, as DNA synthesis commences, the 5âČ to 3âČ exonuclease activity of the Taq polymerase degrades that proportion of the probe that has annealed to the template (Hence its name: Taq polymerase+TacMan). Degradation of the probe releases the fluorophore from it and breaks the close proximity to the quencher, thus relieving the quenching effect and allowing fluorescence of the fluorophore. Hence, fluorescence detected in the real-time PCR thermal cycler is directly proportional to the fluorophore released and the amount of DNA template present in the PCR.
By âarrayâ or âmatrixâ an arrangement of addressable locations or âaddressesâ on a device is meant. The locations can be arranged in two dimensional arrays, three dimensional arrays, or other matrix formats. The number of locations can range from several to at millions. Most importantly, each location represents a totally independent reaction site. Arrays include but are not limited to nucleic acid arrays, protein arrays and antibody arrays. A ânucleic acid arrayâ refers to an array containing nucleic acid probes, such as oligonucleotides, nucleotide analogues, polynucleotides, polymers of nucleotide analogues, morpholinos or larger portions of genes. The nucleic acid and/or analogue on the array is preferably single stranded. Arrays wherein the probes are oligonucleotides are referred to as âoligo-nucleotide arraysâ or âoligo-nucleotide chips.â A âmicroarray,â herein also refers to a âbiochipâ or âbiological chipâ, an array of regions having a density of discrete regions of at least about 100/cm2, and preferably at least about 1000/cm2.
The term âtherapy modalityâ, âtherapy modeâ, âregimenâ or âchemo regimenâ as well as âtherapy regimenâ refers to a timely sequential or simultaneous administration of anti-tumor, and/or anti vascular, and/or immune stimulating, and/or blood cell proliferative agents, and/or radiation therapy, and/or hyperthermic, and/or hypothermia for cancer therapy. The administration of these can be performed in an adjuvant and/or neoadjuvant mode. The composition of such âprotocolâ may vary in the dose of the single agent, timeframe of application and frequency of administration within a defined therapy window. Currently various combinations of various drugs and/or physical methods, and various schedules are under investigation.
The term âmeasurement at a protein levelâ, as used herein, refers to methods which allow for the quantitative and/or qualitative determination of one or more proteins in a sample. These methods include, among others, protein purification, including ultracentrifugation, precipitation and chromatography, as well as protein analysis and determination, including immunohistochemistry, immunofluorescence, ELISA (enzyme linked immunoassay), RIA (radioimmunoassay) or the use of protein microarrays, two-hybrid screening, blotting methods including western blot, one- and two dimensional gelelectrophoresis, isoelectric focusing as well as methods being based on mass spectrometry like MALDI-TOF and the like.
The term âmarker geneâ as used herein, refers to a differentially expressed gene whose expression pattern may be utilized as part of a predictive, prognostic or diagnostic process in malignant neoplasia or cancer evaluation, or which, alternatively, may be used in methods for identifying compounds useful for the treatment or prevention of malignant neoplasia and head and neck, colon or breast cancer in particular. A marker gene may also have the characteristics of a target gene.
The term âimmunohistochemistryâ or IHC refers to the process of localizing proteins in cells of a tissue section exploiting the principle of antibodies binding specifically to antigens in biological tissues. Immunohistochemical staining is widely used in the diagnosis and treatment of cancer. Specific molecular markers are characteristic of particular cancer types. IHC is also widely used in basic research to understand the distribution and localization of biomarkers in different parts of a tissue.
A âscoreâ within the meaning of the invention shall be understood as a numeric value, which is related to the outcome of a patient's disease and/or the response of a tumor to a specific chemotherapy treatment. The numeric value is derived by combining the expression levels of marker genes using prespecified coefficients in a mathematic algorithm. The expression levels can be employed as CT or delta-CT values obtained by kinetic RT-PCR, as absolute or relative fluorescence intensity values obtained through microarrays or by any other method useful to quantify absolute or relative RNA levels. Combining these expression levels can be accomplished for example by multiplying each expression level with a defined and specified coefficient and summing up such products to yield a score. The score may be also derived from expression levels together with other information, e. g. clinical data like tumor size, lymph node status or tumor grading as such variables can also be coded as numbers in an equation. The score may be used on a continuous scale to predict the response of a tumor to a specific chemotherapy and/or the outcome of a patient's disease. Cut-off values may be applied to distinguish clinical relevant subgroups. Cut-off values for such scores can be determined in the same way as cut-off values for conventional diagnostic markers and are well known to those skilled in the art. A useful way of determining such cut-off value is to construct a receiver-operator curve (ROC curve) on the basis of all conceivable cut-off values, determine the single point on the ROC curve with the closest proximity to the upper left corner (0/1) in the ROC plot. Obviously, most of the time cut-off values will be determined by less formalized procedures by choosing the combination of sensitivity and specificity determined by such cutoff value providing the most beneficial medical information to the problem investigated.
The âresponse of a tumor to chemotherapyâ, within the meaning of the invention, relates to any response of the tumor to cytotoxic chemotherapy, preferably to a change in tumor mass and/or volume after initiation of neoadjuvant chemotherapy and/or prolongation of time to distant metastasis or time to death following neoadjuvant or adjuvant chemotherapy. Tumor response may be assessed in a neoadjuvant situation where the size of a tumor after systemic intervention can be compared to the initial size and dimensions as measured by CT, PET, mammogram, ultrasound or palpation, usually recorded as âclinical responseâ of a patient. Response may also be assessed by caliper measurement or pathological examination of the tumor after biopsy or surgical resection. Response may be recorded in a quantitative fashion like percentage change in tumor volume or in a qualitative fashion like âno changeâ (NC), âpartial remissionâ (PR), âcomplete remissionâ (CR) or other qualitative criteria. Assessment of tumor response may be done early after the onset of neoadjuvant therapy e.g. after a few hours, days, weeks or preferably after a few months. A typical endpoint for response assessment is upon termination of neoadjuvant chemotherapy or upon surgical removal of residual tumor cells and/or the tumor bed. This is typically three month after initiation of neoadjuvanttherapy. Response may also be assessed by comparing time to distant metastasis or death of a patient following neoadjuvant or adjuvant chemotherapy with time to distant metastasis or death of a patient not treated with chemotherapy.
The term âtherapyâ refers to a timely sequential or simultaneous administration of anti-tumor, and/or anti vascular, and/or anti stroma, and/or immune stimulating or suppressive, and/or blood cell proliferative agents, and/or radiation therapy, and/or hyperthermia, and/or hypothermia for cancer therapy. The administration of these can be performed in an adjuvant and/or neoadjuvant mode. The composition of such âprotocolâ may vary in the dose of each of the single agents, timeframe of application and frequency of administration within a defined therapy window. Currently various combinations of various drugs and/or physical methods, and various schedules are under investigation. A âtaxane/anthracycline-containing chemotherapyâ is a therapy modality comprising the administration of taxane and/or anthracycline and therapeutically effective derivates thereof.
WO 2008/006517 A2 discloses methods and kits for the prediction of a likely outcome of chemotherapy in a cancer patient. More specifically, the invention relates to the prediction of tumour response to chemotherapy based on measurements of expression levels of a small set of marker genes. The set of marker genes is useful for the identification of breast cancer subtypes responsive to taxane based chemotherapy, such as e.g. a taxane-anthracyclinecyclophosphamide-based (e.g. Taxotere (docetaxel)-Adriamycin (doxorubicin)-cyclophosphamide, i.e. (TAC)-based) chemotherapy.
WO 2011/121028 A1 relates to a method or predicting an outcome of cancer in a patient suffering from cancer, said method comprising: (a) determining in a biological sample from said patient the expression level of at least one marker gene selected from AKR1C3, MAP4, SPP1, CXCL9, PTGER3, and VEGFC; (b) comparing said expression level to a reference pattern of expression, wherein an increased expression of said at least one marker gene is indicative of said patient having a benefit from microtubule stabilizing agent-based cytotoxic chemotherapy.
US 2011/306513 A1 relates to the elucidation of a gene that can act as a novel marker for liver cancer diagnosis and to diagnostic and prognostic measurements of liver cancer using the same. More specifically, it relates to a diagnosis kit that enables diagnostic and prognostic measurement of a liver cancer using a preparation that measures expression levels of at least one gene selected from a group of liver cancer diagnosis markers consisting of S100P, NK4, CCL20, CSPG2, PLAU, MMP12, ESM-1, ABHD7, HCAPG, CXCL-3, Col5A2, MAGEA, GSN, CDC2, CST1, MELK, ATAD2, FAP and MSN and/or a method for diagnostic and prognostic measurement of liver cancer using the same. These have been discovered using normal liver tissues and liver cancer tissues collected from the same liver cancer patient of the present invention and represent the markers whose accuracy and reliability have been greatly improved as markers of liver cancer. The markers of the present invention can be used for the accurate diagnosis and prognosis of liver cancer.
WO 03/001985 A2 discloses non-invasive methods for detecting, monitoring, staging, and diagnosing malignant melanoma in a skin sample of a subject. The methods include analyzing expression in skin sample of one or more melanoma skin markers. The melanoma skin markers include IL-1 RI, endothelin-2, ephrin-A5, IGF Binding Protein 7, HLA-AO202 heavy chain, Activin A (beta A subunit), TNF RII, SPC4, and CNTF R alpha. The skin sample can include nucleic acids, and can be a human skin sample from a lesion suspected of being melanoma.
Yuexin Liu, et al., concludes that a gene signature discovered on a large data set provides robustness in accurately predicting chemotherapy response in serous ovarian carcinoma. The combination of the molecular and morphologic signatures yields a new understanding of potential mechanisms involved in drug resistance (Integrated Analysis of Gene Expression and Tumor Nuclear Image Profiles Associated with Chemotherapy Response in Serous Ovarian Carcinoma, DOI: 10.1371/journal.pone.0036383).
It is an objective of the invention to provide a method for identification of patients, particularly breast cancer patients, who have a benefit from receiving taxanes as a part of their chemotherapy.
It is another object of the present invention to avoid unnecessary side-effects of adjuvant and/or neo-adjuvant taxane-based chemotherapy.
It is another object of the present invention to offer a more robust and specific diagnostic assay system for clinical routine fixed tissue samples to select individualized treatment modalities.
This disclosure focuses on a predictive test that will help the oncologist to identify patients who will have a benefit from inclusion of taxane in a chemotherapy regimen and thus will help to make decisions on therapeutic regimens. The biomarker and algorithms were identified in an in-vitro sensitivity study.
The present invention relates to a method for predicting a benefit from inclusion of taxane in a chemotherapy regimen in a patient suffering from or at risk of developing recurrent neoplastic disease, in particular breast cancer. Said method comprises the steps of:
S100P with the expression values of other genes to yield a combined score and comparing said combined score to a reference-value, including a cutoff, wherein a high combined score is indicative of a benefit from including a taxane in a chemotherapy regimen of said patient and a low combined score is indicative of not having a benefit from including a taxane in a chemotherapy regimen of said patient.
According to an aspect of the invention a high expression level of S100P and PCSK6 generally indicates an increased likelihood of benefit from inclusion of taxane in a chemotherapy regimen.
According to an aspect of the invention there is provided a method as described above, wherein said expression level is determined as an mRNA level. According to an aspect of the invention there is provided a method as described above, wherein said gene expression level is preferably determined by at least one of the following methods:
A preferred form is kinetic or quantitative RT-PCR using e.g. commercially available systems such as Taqman, Lightcycler or others.
According to an aspect of the invention there is provided a method as described above, wherein said determination of expression levels is in a formalin-fixed paraffin-embedded tumor sample or in a fresh-frozen tumor sample.
According to an aspect of the invention there is provided a method as described above, wherein the expression level of said at least one marker gene is determined as a pattern of expression relative to at least one reference gene or to a computed average expression value.
According to an aspect of the invention there is provided a method as described above, wherein said step of mathematically combining comprises a step of applying an algorithm to values representative of an expression level of a given gene.
According to an aspect of the invention there is provided a method as described above, wherein said algorithm is a mathematical combination of said values representative of an expression level of a given gene.
According to an aspect of the invention there is provided a method as described above, wherein a value for a representative of an expression level of a given gene is multiplied with a coefficient.
According to an aspect of the invention one, two or more thresholds are determined for said gene expression level or combined score and discriminated into (1) âpredicted benefitâ and âpredicted non-benefitâ, (2) âpredicted benefitâ and âpredicted adverse effectâ, (3) âpredicted benefitâ, âpredicted indifferent effectâ and âpredicted adverse effectâ, or more risk groups with different probabilities of benefit by applying the threshold on the combined score.
According to an aspect of the invention there is provided a method as described above, wherein information regarding clinical parameters of the patient is processed in the step of mathematically combining expression level values for the genes to yield a combined score.
The invention further relates to a kit for performing a method as described above, said kit comprising a set of oligonucleotides capable of specifically binding sequences or to sequences of fragments of the genes: S100P and PCSK6.
The invention further relates to a computer program product capable of processing values representative of an expression level of a combination of genes, mathematically combining said values to yield a combined score, wherein said combined score is predicting said benefit from inclusion of taxane in cytotoxic chemotherapy. The combined score can be transformed to a given scale in an additional step. Said transformation may be linear or non-linear, continuous or discontinuous, bounded or unbounded, monotonic or non-monotonic.
Said computer program product may be stored on a data carrier or implemented on a diagnostic system capable of outputting values representative of an expression level of a given gene, such as a real time PCR system.
If the computer program product is stored on a data carrier or running on a computer, operating personal can input the expression values obtained for the expression level of the respective genes. The computer program product can then apply an algorithm to produce a combined score indicative of a benefit from taxane-based cytotoxic chemotherapy for a given patient.
The methods of the present invention have the advantage of providing a reliable prediction of benefit from the inclusion of taxanes in a cytotoxic chemotherapy regimen based on the use of only a small number of genes.
According to an aspect of the invention said cancer is breast cancer. The marker genes described in this invention are not breast cancer specific genes, but generally cancer-relevant genes or genes relevant to the therapeutic mechanism of microtubule stabilizing drugs. It can therefore be expected that the methods of the invention are also predictive in other cancers, in which taxane-based therapy is commonly administered, such as lung cancer, headand-neck cancer, ovarian cancer and prostate cancer.
FIG. 1: Correlation between S100P gene expression levels and taxane response scores (derived from the in-vitro chemosensitivity data) in all 29 breast cancer samples. An increased taxane response score is associated with a higher likelihood of a higher benefit from a taxane in comparison to 5-Fluorouracil and/or Epirubicin in breast cancer patients.
FIG. 2: Correlation between PCSK6 gene expression levels and taxane response scores (derived from the in-vitro chemosensitivity data) in all 29 breast cancer samples. An increased taxane response score is associated with a higher likelihood of a higher benefit from a taxane in comparison to 5-Fluorouracil and/or Epirubicin in breast cancer patients.
FIG. 3: Correlation between Metagene (mean expression of S100P and PCSK6) RNA levels and taxane response scores (derived from the in-vitro chemosensitivity data) in all 29 breast cancer samples. An increased taxane response score is associated with a higher likelihood of a higher benefit from a taxane in comparison to 5-Fluorouracil and/or Epirubicin in breast cancer patients.
FIG. 4: Correlation between S100P/PCSK6 score (non-linear combination of S100P and PCSK6 expression levels) and taxane response scores (derived from the in-vitro chemosensitivity data) in all 29 breast cancer samples An increased taxane response score is associated with a higher likelihood of a higher benefit from a taxane in comparison to 5-Fluorouracil and/or Epirubicin in breast cancer patients.
FIG. 5: Platform transferâS100P: The results from the Affymetrix data (log 2 expression data) in fresh-frozen tumor samples were transferred to a diagnostic platform (qRT-PCR, dCt level) and formalin-fixed paraffin-embedded tissue using 56 paired technical samples.
FIG. 6: Platform transferâPCSK6: The results from the Affymetrix data (log 2 expression data) in fresh-frozen tumor samples were transferred to a diagnostic platform (qRT-PCR, dCt level) and formalin-fixed paraffin-embedded tissue using 56 paired technical samples.
Additional details, features, characteristics and advantages of the object of the invention are disclosed in the subclaims, and the following description of the respective figures and examples. However, these drawings should by no means be understood as to limit the scope of the invention.
The methods of the invention are particularly suited for predicting a benefit from inclusion of taxane in a chemotherapy regimen, preferably in breast cancer patients. Two predictive marker genes (S100P and PCSK6) were identified, whereas a high expression level indicates a benefit from inclusion of taxane in a chemotherapy regimen (FIGS. 1/2).
S100P has been described to be associated with paclitaxel resistance/sensitivity in ovarian cancer cell lines. S100P was overexpressed in stable cell lines derived from ovarian cancer cells and silenced using S100Ptargeted siRNA. Both experiments showed that the expression level of S100P contributes to paclitaxel sensitivity (Wang et al., Cancer Lett.; 2008, pp. 277-289; Gao et al., Chin Med J., 2008, pp. 1563-1568; He et al., Oncol Rep., 2008, pp. 325-332).
Villeneuve and colleagues carried out a microarray screening to compare the gene expression profiles between wild-type and paclitaxel-resistant breast cancer cell lines. Several deregulated genes were identified and S100P was among those genes that showed a decreased expression level in paclitaxelresistant cell lines. (Villeneuve et al., Breast Cancer Res Treat., 2006, pp. 17-39).
The stated prior art does not necessarily suggest that S100P is a predictive marker for breast cancer patients, since gene expression profiles and resistance mechanisms can be considerably different between cell lines (âin-vitroâ) and the primary tumor of cancer patients (âin-vivoâ).
Here, we show for the first time that S100P as well as PCSK6 predict taxane efficacy in breast cancer patients (âin-vivoâ). The combination of PCSK6 and S100P gene expression levels improves the predictive performance in comparison to the single markers (PCSK6 or S100P) alone (FIG. 1-4).
Therefore, the invention comprises the expression analysis of both genes of interest, whereas the expression levels are mathematically combined to yield a score, which is predictive for said benefit of a taxane-based cytotoxic chemotherapy (FIGS. 3/4).
The genes and the algorithms were identified in breast cancer patients. RNA was extracted and used for gene expression profiling (Affymetrix HG-U133A microarrays). Microarray cel files were MAS5 normalized with a global scaling procedure and a target intensity of 500. In-vitro chemosensitivity assays were carried out using different cytotoxic agents (e. g. Paclitaxel, 5-Fluorouracil, Epirubicin) to determine the response of a tumor towards a specific agent. The primary tumors were treated with increased concentration of the respective cytotoxic agent. The vitality of the tumor cells was determined using an ATP assay and an area under the dose-response curve (AUC) was determined for every tumor sample and all agents, respectively. An increased AUC indicated a higher sensitivity towards a specific chemotherapeutic agent.
Sensitivity results from the in-vitro chemosensitivity assays were used as the primary endpoint for the assessment of treatment response. The AUC response rates were normalized and the differences between the normalized taxane AUC and the mean AUC of 5-Fluorouracil and Epirubicin were calculated, resulting in a taxane-response score. An increased taxane response score is associated with a higher likelihood of a higher benefit from a taxane in comparison to 5-Fluorouracil and/or Epirubicin in breast cancer patients. Gene expression levels from the Affymetrix data were correlated to the taxane response score. The expression levels from two genes (S100P/PCSK6) were found to be significantly correlated to the taxane-response score (FIG. 1-4).
Table 1, below, shows Affymetrix probeset ID and TaqMan design ID mapping of the marker genes of the present invention.
| Gene | Design ID | Probeset ID | |
| S100P | SVD0018 | 204351_at | |
| PCSK6 | SVD0016 | 207414_s_at | |
Table 2, below, shows full names, Entrez GeneID and chromosomal location of the marker genes of the present invention.
| Official | |||
| Symbol | Official Full Name | Entrez | Location |
| S100P | S100 calcium binding protein P | 6286 | 4p16 |
| PCSK6 | proprotein convertase subtilisin/ | 5046 | 15q26.3 |
| kexin type 6 | |||
The results from the Affymetrix data in fresh-frozen tumor samples were transferred to a diagnostic platform (qRT-PCR) and formalin-fixed paraffinembedded tissue using 56 paired technical samples. The platform transfer was done using Affymetrix microarray data (fresh-frozen tumor samples) and qRTPCR expression data (FFPE samples) from the same technical samples (FIG. 5/6).
| TABLEâ3 |
| qRT-PCRâprimerâandâprobeâsequences |
| Gene | |||
| SeqâId | symbol | Primer-ID | Probe |
| 1 | S100P | SVD0018 | CTGCAATCACGTCTGCCTGTCACAAGT |
| 2 | PCSK6 | SVD0016 | CTGCTCCCCTGTTTGACGACAGTGC |
| Gene | |||
| SeqâId | symbol | Primer-ID | ForwardâPrimer |
| 1 | S100P | SVD0018 | TTCAGTGAGTTCATCGTGTTCGT |
| 2 | PCSK6 | SVD0016 | TTTCGACCTCGTCTTTCTCCAT |
| Gene | |||
| SeqâId | symbol | Primer-ID | ReverseâPrimer |
| 1 | S100P | SVD0018 | CATCATTTGAGTCCTGCCTTCTC |
| 2 | PCSK6 | SVD0016 | TCTCTCCAGCTCACAGGTGACA |
Herein disclosed are unique combinations of two marker genes which can be combined into an algorithm for the here presented new predictive test. Technically, the method of the invention can be practiced using two technologies: 1.) Isolation of total RNA from fresh or fixed tumor tissue and 2.) Quantitative RT-PCR of the isolated nucleic acids. Alternatively, it is contemplated to measure expression levels using alternative technologies, including but not limited to microarray, in particular Affymetrix U-133A arrays, sequencing or by measurement at a protein level.
The methods of the invention are based on quantitative determination of RNA species isolated from the tumor in order to obtain expression values and subsequent bioinformatics analysis of said determined expression values. RNA species can be isolated from any type of tumor sample, e.g. biopsy samples, smear samples, resected tumor material, fresh frozen tumor tissue or from paraffin embedded and formalin fixed tumor tissue. First, RNA levels of genes coding for the genes S100P and PSCK6 are determined. Based on these expression values a predictive score is calculated by a mathematical combination, e.g. a linear or non-linear combination (FIGS. 3/4). A high score indicates an increased likelihood of a benefit from inclusion of taxane in a chemotherapy regimen, whereas a low score value indicates a decreased likelihood.
1. A method for predicting a benefit from inclusion of taxane in a chemotherapy regimen, including adjuvant and/or neoadjuvant chemotherapy, in a patient suffering from or at risk of developing recurrent neoplastic disease, in particular breast cancer, said method comprising the steps of:
a) determining in a tumor sample from said patient the expression levels of the marker genes S100P and PCSK6,
and
b) mathematically combining the expression level values of the genes PCSK6 and S100P to yield a combined score and comparing said combined score to a reference-value, including a cutoff, wherein a high combined score is indicative of a benefit from including a taxane in a chemotherapy regimen of said patient and a low combined score is indicative of not having a benefit from including a taxane in a chemotherapy regimen of said patient
or
c) mathematically combining the expression level values of PCSK6 and S100P with the expression values of other genes to yield a combined score and comparing said combined score to a reference-value, including a cutoff, wherein a high combined score is indicative of a benefit from including a taxane in a chemotherapy regimen of said patient and a low combined score is indicative of not having a benefit from including a taxane in a chemotherapy regimen of said patient.
2. The method of claim 1, wherein said expression level is determined as a non-protein such as a gene expression level.
3. The method of claim 1, wherein said expression level is determined by at least one of the following methods:
a PCR based method,
a microarray based method,
a hybridization based method,
a sequencing and/or
next generation sequencing approach.
4. The method of claim 1, wherein said determination of expression levels is in a formalin-fixed paraffin-embedded tumor sample or in a fresh-frozen tumor sample.
5. The method of claim 1, wherein the expression levels are determined as a pattern of expression relative to at least one reference gene or to a computed average expression value.
6. The method of claim 1, wherein said step of mathematically combining the expression level values comprises a step of applying an algorithm to values representative of an expression level of S100P and PCSK6.
7. The method of claim 6, wherein said algorithm is a linear combination of said values representative of an expression level of S100P and PCSK6.
8. The method of claim 6, wherein a value for a representative of an expression level of a given gene is multiplied with a coefficient.
9. The method of any one of the foregoing claims claim 1, wherein one, two or more thresholds are determined for said combined score and discriminated groups by applying the threshold on the combined score.
10. The method of claim 1, wherein one, two or more thresholds are determined for said combined score and discriminated into (1) âpredicted benefitâ and âpredicted non-benefitâ, (2) âpredicted benefitâ and âpredicted adverse effectâ, (3) âpredicted benefitâ, âpredicted indifferent effectâ and âpredicted adverse effectâ, or more risk groups with different probabilities of benefit by applying the threshold on the combined score.
11. The method of claim 1,
wherein a high combined score is indicative of a benefit from taxane-based treatment.
12. The method of claim 1,
wherein information regarding clinical parameters of the patient is processed in the step of mathematically combining expression level values for the genes to yield a combined score.
13. A kit for performing the method of claim 1, said kit comprising a set of oligonucleotides capable of specifically binding sequences or to sequences of fragments of the genes.